CA2621272A1

CA2621272A1 - Anchoring disruption molecules

Info

Publication number: CA2621272A1
Application number: CA002621272A
Authority: CA
Inventors: Cathrine R. Carlson; Birgitte Lygren; Kjetil Tasken; Enno Klussmann; Walter Rosenthal
Original assignee: Individual
Current assignee: Forschungsverbund Berlin FVB eV; Universitetet i Oslo
Priority date: 2005-09-05
Filing date: 2006-09-05
Publication date: 2007-03-15
Also published as: EP1928896A2; WO2007028969A3; WO2007028969A2; GB0518027D0

Abstract

The present invention relates to molecues which modify the binding between AKAP 18.delta. and phosphodiesterase 4D or AKAP 18.delta. and phospholamban and their use in altering PKA type II-mediated, activation of SERCA2 in a cell, for example to alleviate cardiovascular disease. Preferably such molecules include the motif RRASTIE. Molecules such as those which mimic binding of AKAP 18.delta. to PKA which allow enhanced phosporylation of PLB
are also provided.

Description

Compounds The present invention relates to molecules which are able to modulate the association between molecules in a complex comprising cAMP dependent protein kinase (PKA) type II, AKAP18S, phosphodiesterase 4D (PDE4D), phospholamban (PLB) and SERCA2 and their use to modulate signalling achieved through that complex, particularly to produce pharmaceutical preparations to treat or prevent diseases which would benefit from modulation of said signalling, such as cardiovascular diseases, e.g. heart failure. Preferably the molecules are inhibitors of the binding or association between AKAP18S and phospholamban or between PDE4D and AKAP 188.

More specifically, the present invention provides molecules, e.g. direct antagonistic inhibitors of the association or binding between PLB and AKAP 186 or between PDE4D and AKAP18S. In particular, said antagonistic inhibitors, which may be anchoring disruption peptides, bind to the PLB binding site of AKAP 188 to antagonize PLB binding to AKAP18S, preferably to abolish that binding and thus antagonize complex formation and signalling through that complex. Inhibitors which prevent binding at the nucleotide level are also provided. In the alternative mimics are provided which bind or associate with components of the complex and which may also facilitate localization or activation of certain components and may thus act as agonists of the associations and hence signalling through the complex.
Cyclic AMP-dependent protein kinase (PKA) is an enzyme present in all cells. Hormones and neurotransmitters binding to specific receptors stimulate the generation of the second messenger 3',5'-cyclic adenosine monophosphate (cAMP).
Cyclic AMP is one of the most common and versatile second messengers. The best characterized and major downstream effector mechanism whereby cAMP exerts its effects involves binding to and activating PKA. PKA is a serine/threonine protein kinase which phosphorylates a number of different proteins within the cell, and thereby regulates their activity. It is known that ?KA regulates a vast variety of cellular processes such as metabolism, proliferation, differentiation and regulation of gene transcription.

The great diversity of cellular processes mediated by cAMP and PKA
strongly suggests that there exists mechanisms that provide the required sensitivity and specificity of the effector pathway to ensure that rapid and precise signalling processes take place. Specificity can be achieved by tissue- and cell-type specific expression of PKA isoforms with different biochemical properties. However, targeting of PKA isoforms by A-kinase anchoring proteins (AKAPs) provides a higher level of specificity to the signalling process by localizing PKA to defined subcellular sites in close proximity to the substrate. Anchoring of PKA by AKAPs may also tune the sensitivity of the signal pathway by recruiting PKA into multiprotein complexes that include phosphodiesterases and protein phosphatases as well as other signal proteins in addition to PKA (Michel and Scott, 2002, Ann.
Rev.
Pharmacol. Toxicol., 42, p235-257).
PKA is made up of four different subunits, a regulatory (R) subunit dimer and two catalytic (C) subunits. Two main classes of PKA isozymes, PKA type I
and PKA type II (PKA I and PKA II, respectively) have been described. PKA I and PKA II can be distinguished by their R subunits, designated RI and RII.
Isoforms of RI and RII are referred to as RIa, RIP, RIIa and RII(3. Moreover, the C
subunits also exist as isoforms referred to as Ca, C(3 and Cy. The different subunits may form multiple forms of PKA (isozymes) with potentially more than 18 different forms.
Activation occurs upon binding of cAMP to the R subunits followed by the release of the active catalytic subunit. PKA type II is mainly particulate and associated with AKAPs whereas PKA type I is both soluble and particulate although PKA type I anchoring has remained more elusive. However, PKA type I is present in the lipid raft fraction of the cell membrane and colocalizes with the TCR-complex upon T-cell activation (Skalhegg et al., 1994, Science, 263, p84-87).
The cAMP signalling pathway has been iniplicated in numerous diseases.
Disease may correlate with hyperactivation (too much signalling) or hypoactivation (too little signalling) of the cAMP pathway. Hypoactivity in cAMP signalling is implicated in several diseases such as asthma and clironic obstructive pulmonary disease, cardiovascular diseases such as heart failure and atherosclerotic peripheral arterial disease, neurological disorders and erectile dysfunction (Corbin, et al., 2002, Urology, 60, p4-11; Feldman and McNamara, 2002, Clin.Cardiol., 25, p256-262;
Grouse et al., 2002, J.Clin.Pharmacol., 42, p1291-1298; Manji et al., 2003, Biol.Psyc., 53, p707-742; Spina, 2003, Curr. Opin. Pulm. Med., 9, p57-64), whereas hyperactivity of the cAMP signalling pathway correlates with control of exocytotic events in polarised epithelial cells with implications for diabetes insipidus, hypertension, gastric ulcers, thyroid disease, diabetes mellitus and asthma.
Also (3-adrenergic signalling in the heart, the control of metabolism in adipose tissue and, reproductive function requires localization of the cAMP signalling pathway.
All these effects of cAMP appear to be mediated via PKA type II / AKAP complexes.
In contrast, cAMP pathways that signal to anchored PKA type I /AKAP complexes are involved in,the regulation of steroidogenesis and immune responses.
Rhythmic heart muscle contractions are regulated by action potentials generated by pacemaker cells located in the sinus and other centres within the heart muscle. The action potentials induce opening of voltage-dependent L-type Ca2+
channels thereby eliciting an influx of Ca2+ into the cytosol of cardiac myocytes through those channels. L-type Ca2+ channels are located in the plasma membrane of the cells. The plasma membrane of myocytes is known as sarcolemma. The rise of cytosolic CaZ+ activates Ca2+-activated Caz+ release channels (ryanodine R2 receptors, RyR2) located in the membrane surrounding the sarcoplasmic reticulum (SR). Activation of RyR2 induces the release of Ca2+ from the SR into the cytosol.
The elevation of cytosolic Ca2+ triggers the contraction of cardiac myocytes through proteins of the cytoskeleton. Relaxation of the myocytes and thus of the heart muscle after each contraction is achieved by removal of the cytosolic Ca2+, mainly into the SR through the ATP-dependent Ca2+ pump SERCA2 (sarcoplasmic reticulum Ca2+-ATPase; Ca2+ reuptake).
SERCA2 is located in the membrane of the SR. During contraction SERCA2 is kept inactive by interaction with its inhibitor phospholamban (PLB or occasionally referred to herein as PLN), a small protein of 5 kDa in its monomeric form. PLB may also pentamerize giving rise to a protein complex of 25 kDa. The rise of cytosolic Ca2+ causes dissociation of PLB and thereby activation of SERCA2.
The phenomenon of linking myocyte contraction to electric stiinulation (action potential) is known as excitation-contraction coupling. All components of the system that regulates the cytosolic CaZ+ including RyR2, SERCA2 and PLB are located at the SR membrane at junctions with the sarcolenuna where the L-type Ca2+ channels are localized. The location is morphologically defined and termed the T-tubule.
The heart is subject to regulation by various hormones and neurotransmitters including adrenalin, noradrenalin and other (3-adrenoreceptor agonists via the cAMP
signalling pathway. P-adrenoreceptors are found in the sarcolemma with the T-tubules. Sympathetic stimulation of the heart through (3-adrenergic receptors increases both contraction force (inotropy) and heart rate (clironotropy). In order for the heart rate to increase, relaxation and Ca2+ decline must occur rapidly. (3-adrenergic receptor stimulation activates a G-protein which stimulates the production of cAMP, which in turn activates PKA. PKA then phosphorylates several proteins related to excitation-contraction coupling (L-type Ca2+ channels, RyR, troponin I and myosin binding protein C) thus regulating the Ca2+ -flux from L-type Ca2+ channels and the SR. Furthermore, PKA phosphorylates phospholamban that regulates the activity of SERCA2 and leads to increased re-uptake of Ca2+ into SR, a process which is affected in failing hearts (Frank and Kranias, 2000, Ann.
Med., 32, 572-578; Movsesian, 1998, Ann. N.Y. Acad. Sci., 853, p231-239; Schwinger and Frank, 2003, Sci. STKE, 2003, pe15-).
In failing hearts, RYR is hyperphosphorylated by PKA leading to an altered channel function, while SERCA2 has reduced Ca2+-reuptake activity because PLB
is hypo-phosphorylated. Upon heart failure, the heart can be damaged by adrenergic stimulation due to too much metabolic stress and beta-blockers that prevent adrenergic pacing give increased survival during post-infarction heart failure. Heart failure is a major cause of death and disability and there remains a need for suitable therapeutic molecules to prevent or treat heart failure.
According to the current neurohumoral model, pharmacological treatment of chronic heart failure (CHF) is aimed at preventing the maladaptive, biological changes that occur in chronic CHF. In line with this, the only pharmacological interventions proven conclusively to improve mortality and morbidity in clironic CHF, i.e. angiotensin converting enzyme (ACE) inhibitors/ angiotensin II type receptor antagonists, aldosterone antagonists and beta-adrenoceptor antagonists (beta-blockers), all address such neurohumoral changes.
The rationale for beta-blocker therapy in CHF is that chronic adrenergic stimulation is a harmful compensatory mechanism in the failing human heart (Bristow, 2000, Circulation, 101, p558-569). In end-stage failing heart, 50%
to 60%
of total beta-adrenergic signal transducing potential is lost, due to desensitisation changes in betal- and beta2-adrenoreceptors and downstream signalling mechanisms (Bristow, 1993, J. Am. Coll. Cardiol., 22, 61A-71A; Ungerer et al., 1994, Circ. Res., 74, p206-213). The remaining signalling capacity still appears harmful enough to explain the remarkable results with beta-blockade in CHF.
The inotropic effect of beta-adrenergic agonists in CHF is cAMP mediated (Brattelid et al., 2004, Naunyn-Schmiedeberg's Arch. Pharmacol., 370, p157-166;
Qvigstad et al., 2005, Cardiovasc. Res., 65, p869-878); Qvigstad et al., 2005, Proceedings of the 25th European Section Meeting, International Society for Heart Research, Tromso, Norway, June 21-25, 2005, Medimond International Proceedings, Bologna, Italy, p7-12). Peptides that specifically disrupt PKA
type II /
AKAP interactions may be used to displace PKA, and prevent phospholamban phosphorylation and thus work as cardioprotective agents in post-infarction heart failure.
Conversely, if PLB becomes superinhibitory or chronically inhibitory this may reduce contractility and induce dilated cardiomyopathy in mice and humans (reviewed in MacLennan and Kranias, 2003, Nat. Rev. Mol. Cell Biol., p566-577).
In support of this, ablation of PLB (Minamisawa et al, 1999, Cell, 99, p313-322;
Sato et al., 2001, J. Biol. Chem. 276, p9392-9399; Freeman et al., 2001, J.
Clin.
Invest., 107, p967-974) or introduction of a pseudophosphorylated PLB
(Hoshijima et al, 2002, Nat.Med., 8, p864-871) conlpletely or partially prevents progression to end-stage heart failure in various mouse models of dilated cardiomyopathy.
Similarly, short term adenoviral-mediated overexpression of SERCA2 or overexpression of upstream regulators such as (3-adrenoreceptor kinase inhibitor which prevents termination of (3-adrenergic signals also delays development of cardiac dysfunction in these models (Miamoto et al., 2000, Proc. Natl. Acad.
Sci.
USA, 97, p793-798; del Monte et al., 2001, Circulation, 104, 1424-1429; White et al., 2000, Proc. Natl. Acad. Sci. USA, 97, p5428-5433; Shah et al., 2001, Circulaiton, 103, p1311-1316). In humans, PLB mutations may cause dilated cardiomyopathy by chronic inhibition of SERCA2 or by prevention of PKA
phosphorylation (Schmitt et al., 2003, Science, 299, p1410-1413; Haghighi et al., 2003, J. Clin. Invest., 111, p869-876). Such loss of normal PLB function also increased cardiac susceptibility to ischemic injury (Cross et al., 2003, Am.
J.
Physiol. Heart. Circ. Physiol., 2003, 284, pH683-H690). Together this indicates that selective upregulation of PLB phosphorylation or reversal of the hypophosphorylated state of PLB (as opposed to more general (3-adrenergic stimulation leading to phosphorylation also of outer substrates such as RYR) may be beneficial in cardiac diseases. Mimics that target PKA to the PLB-SERCA2-AKAP 186 complex may be used to achieve such selective increase in PLB
phosphorylation and suppress heart failure progression in progressive dilated cardiomyopathies and cardiac muscle diseases.
Localized signalling is clearly important in the regulation of Ca2+ in the heart. The cAMP increase in response to P-adrenergic stimuli is known to be local and controlled temporally. Such pools of cAMP are shaped by phosphodiesterases localized in the vicinity of the SR. It is clear that the green fluorescent protein/yellow fluorescent protein (GFP/YFP) PKA probe for cAMP (Zaccolo and Pozzan, Science, 295, p1711) is targeted, indicating the presence of AKAPs.
The P-AR and the L-type Ca2+-channel have known AKAPs associated with them that are present in heart ((3-AR:AKAP79, and gravin:L-type Ca2+- channel:AKAP18a). ' AKAP-lbc (Diviani et al., 2001, J. Biol. Chem., 276, p44247-44257), AKAP18a (Hulme et al., 2003, Proc. Natl. Acad. Sci. USA, 100, p13093-13098) and (Henn et al., 2004, J. Biol. Chem., 279, p26654-26665) have been found to be expressed in heart. Furthermore, rnAKAP has been shown to be colocalized with RyR (Kapiloff et al., 2001, J. Cell Sci., 114, p3167-3176; Marks, 2001, J.
Mol. Cell Cardiol., 33, p615-624), although the majority of mAKAP is at the nuclear envelope of cardiomyocytes. A mutant resulting in a single amino acid substitution in D-AKAP2 (1646V) has lowered affinity for Rta and is associated with changes in ECG-recordings and cardiac dysfunction, implicating D-AKAP2 in targeting of PKA, possibly to an ion channel although the exact location of D-AKAP2 is not known (Kammerer et al., 2003, Proc. Natl. Acad. Sci. U.S.A, 100, p4066-4071).
AKAP 18, also referred to as AKAP7, comprises a fanlily of splice variants including a, P, y and S(Gray et al., 1997, J. Biol. Chem., 272, p6297-6302;
Fraser et al., 1998, EMBO J., 17, p2261-2272; Trotter et al., 1999, J. Cell Biol., 147, p1481-1492; Henn et al., 2004, J. Biol. Chem., 279, p26654-26665; gene bank entry AKAP188: AY350741). AKAP18a (Fraser et al., 1998, supra) is also known as AKAP15 (Gray et al., 1997, supra). AKAP18 variants function as AKAPs.
AKAP18a, 0, y and S interact witli RII subunits of PKA. The RII-binding domain (LVRLSKRLVENAVL) is identical in all variants. In human and rat AKAP 18a sequences it corresponds to amino acid residues 29-42. The RII-binding domain forms an amphipathic helix structure which is conserved within the AKAP
family. All AKAPs dock to the dimerization/docking domain of regulatory subunits through this motif.
A leucine zipper motif ELVRLSKRLVENAVLKAVQQYLEETQN) within human and rat AKAP 18a (amino acid residues 28-54 of hunian AKAP 18a) interacts with a leucine zipper motif of skeletal muscle voltage-dependent L-type Ca2+
channel Cavl.1 (amino acid residues 1774-1821 of the rabbit protein; Hulme et al., 2002, J. Biol. Chem., 277, p4079-4087) and a leucine zipper motif of cardiac voltage-dependent L-type Ca2+ channel Cavl.2 (amino acid residues 2062-2104 of the rat protein; Hulme et al., 2003, supra). The leucine zipper motifs of human and rat AKAP 18a are identical with those of all other AKAP 18 variants. They overlap with the RI- and RII-binding domains. Surprisingly, only interaction of rat and human AKAP18a with L-type Ca2+ channels has been observed.
The present inventors have now identified that AKAP 188 anchors PKA type II in heart sarcoplasmic reticulum and that this AKAP is in complex with PLB
which in turn is in complex with, and regulates the activity of SERCA2. PDE4D
which degrades cAMP, has also been found to be associated with AKAP 188 near the PKA II binding site. Signalling is achieved by activation of PKA which phosphorylates PLB whicli dissociates from SERCA2 to increase the activity of SERCA2 which increases calcium reabsorption into the sarcoplasmic reticulum which increases relaxation rates (lusitropic effect) which allows for increasing the heart rate (chronotropic effect) as well as the contraction force (inotropic effect) in response to sympathetic nervous stimuli and adrenalin.
Modulation of the complex formation affects the PKA signalling achieved through this complex. The inventors have found that removal or dissociation of AKAP 188 from the complex by the use of anchoring disruption peptides disrupts localization and thereby the regulatory function of PKA type II at this specific locus.
siRNA has been found to be similarly useful. Removal of PDE4D from the complex would lead to increased local cAMP levels and hence PKA activity and PLB
phosphorylation whicli in turn would increase the activity of SERCA2. These mechanisms of modulating the complex and the signalling achieved through the complex may thus be used in cardiology and in particular in the treatment of myocardial infarction and heart failure in a similar but more potent manner to currently used beta-blockers. The development of treatnients offering alternatives to beta-blockers is important because beta-blockers are contraindicated in several diseases, including asthma.
Anchoring disrupting peptides for PKA type I and type II have been described previously, Ht31 (Carr et al., J. Biol. Chem, 266:14188-92, 1991;
Rosenmund et. al., Nature, 368(6474):853-6, 1994), AKAP-IS (Alto et. al., Proc Natl Acad Sci USA. 100:4445-50, 2003), and PV38 (Burns-Hamuro et. al. Proc Natl Acad Sci USA. 100:4072-7, 2003).
The work carried out by the present inventors has identified the specific interaction between AKAP188 and PKA type II. Furthermore, the interactions between PLB and AKAP 188 and between AKAP 188 and PDE4D were not previously known and thus present new targets in treating heart diseases and conditions.
The present invention provides a variety of modes of modifying, e.g.
interrupting or enhancing PKA type II-mediated activation of SERCA2 by affecting the binding between PLB and AKAP18 S and/or between AKAP186 and PDE4D or affecting the phosphorylation of PLB in the complex by increasing the levels of PKA in said complex such as by using the AKAP188:PKA association. Suitable modes of interruption include the use of direct or indirect inhibitors of those interactions and modification of the wild-type forms to impair normal binding.

In a first aspect therefore, the present invention provides a method of altering PKA type II-mediated activation of SERCA2 (preferably SERCA2a) in a cell by administration of an anchoring disruption molecule or binding partner mimic, preferably as defined herein, which modifies, e.g. reduces, inliibits or enhances the binding between one or more of the following binding partners:
i) PLB and AKAP 185, and ii) AKAP18S and PDE4D.
The binding between AKAP188 and PKA type II may also be used in certain applications of the invention to modify PLB phosphorylation as described hereinafter.
As referred to herein a "binding partner" refers to a molecule which recognizes and binds or associates specifically (i.e. in preference to binding to other molecules) through a binding site to its binding partner. Such binding pairs when bound together form a complex.
The amino acid sequence of the human form of PLB appears in SEQ ID No.
1:

mekvqyltrs airrastiem pqqarqklqn lfinfclili cllliciivm 11 (SEQ ID No. 1) The amino acid sequence of PLB from rat appears in SEQ ID No. 2:
mekvqyltrs airrastiem pqqarqnlqn lfinfclili cllliciivm 11 (SEQ ID No. 2) The amino acid sequence of AKAP18S from rat appears in SEQ ID No. 3:
merpaageid ankcdhlsrg eegtgdlets pvgsladlpf aavdiqddcg lpdvpqgnvp qgnpkrsken rgdrndhvkk rkkakkdyqp nyflsipitn kkitagikvl qnsilrqdnr ltkamvgdgs fhitllvmql lnedevnigt dallelkpfv eeilegkhlt lpfhgigtfq gqvgfvklad gdhvsallei aetakrtfqe kgilagesrt fkphltfmkl skapmlwkkg vrkiepglye qfidhrfgee ilyqidlcsm lkkkqsngyy hcessivige kdrkepedae lvrlskrlve navlkavqqy leetqnkkqp gegnsvkaee gdrngdgsdn nrk (SEQ ID No. 3) The amino acid sequence of the huinan form of PKA type IIa appears in SEQ ID
No. 4:
mshiqippgl tellqgytve vlrqqppolv efaveyftrl rearapasvl paatprqslg hpppepgpdr vadakgdses eededlevpv psrfnrrvsv caetynpdee eedtdprvih pktdeqrcrl qeackdillf knldqeqlsq vldamferiv kadehvidqg ddgdnfyvie rgtydilvtk dnqtrsvgqy dnrgsfgela lmyntpraat ivatsegslw gldrvtfrri ivknnakkrk mfesfiesvp llkslevser mkivdvigek iykdgeriit qgekadsfyi iesgevsili rsrtksnkdg gnqeveiarc hkgqyfgela lvtnkpraas ayavgdvkcl vmdvqaferl lgpcmdimkr nishyeeqlv kmfgssvdlgnlgq (SEQ ID No. 4) The amino acid sequence of the human form of PKA type IIR appears in SEQ ID
No. 5:
msieipaglt ellqgftvev lrhqpadlle falqhftrlq qenerkgtar fghegrtwgd lgaaagggtp skgvnfaeep mqsdsedgee eeaapadag'a fnapvinrft rrasvcaeay npdeeeddae sriihpktdd qrnrlqeack dillfknldp eqmsqvldam feklvkdgeh vidqgddgdn fyvidrgtfd iyvkcdgvgr cvgnydnrgs fgelalmynt praatitats pgalwgldrv tfrriivknn akkrkmyesf ieslpflksl efserlkvvd vigtkvyndg eqiiaqgdsa dsffivesge vkitmkrkgk seveengave iarcsrgqyf gelalvtnkp raasahaigt vkclamdvqa ferllgpcme imkrniatye eqlvalfgtn mdivepta (SEQ ID No. 5) The amino acid sequence for human PDE4D appears in SEQ ID No. 6:
MMHVNNFPFR RHSWICFDVD NGTSAGRSPL DPMTSPGSGL ILQANFVHSQ RRESFLYRSD
SDYDLSPKSM SRNSSIASDI HGDDLIVTPF AQVLASLRTV RNNFAALTNL QDRAPSKRSP
MCNQPSINKA TITEEAYQKL ASETLEELDW CLDQLETLQT RHSVSEMASN KFKRMLNREL
THLSEMSRSG NQVSEFISNT FLDKQHEVEI PSPTQKEKEK KKRPMSQISG VKKLMHSSSL
TNSSIPRFGV KTEQEDVLAK ELEDVNKWGL HVFRIAELSG NRPLTVIMHT IFQERDLLKT
FKIPVDTLIT YLMTLEDHYH ADVAYHNNIH AADVVQSTHV LLSTPALEAV FTDLEILAAI
FASAIHDVDH PGVSNQFLIN TNSELALMYN DSSVLENHHL AVGFKLLQEE NCDIFQNLTK
KQRQSLRKMV IDIVLATDMS KHMNLLADLK TMVETKKVTS SGVLLLDNYS DRIQVLQNMV
HCADLSNPTK PLQLYRQWTD RIMEEFFRQG DRERERGMEI SPMCDKHNAS VEKSQVGFID
YIVHPLWETW ADLVHPDAQD ILDTLEDNRE WYQSTIPQSP SPAPDDPEEG RQGQTEKFQF
ELTLEEDGES DTEKDSGSQV EEDTSCSDSK TLCTQDSEST EIPLDEQVEE EAVGEEEESQ
PEACVIDDRS PDT
(SEQ ID No. 6) The encoding nucleic acid sequences of SEQ ID Nos. 1-6 appears in SEQ ID Nos.
7-12 as follows:

The nucleotide sequence of the human form of PLB:
1 agctaaacac ccgtaagact tcatacaaca caatactcta tactgtgatg atcacagctg 61 ccaaggctac ctaaaagaag acagttatct catatttggc tgccagcttt ttatctttct 121 ctcgaccact taaaacttca gacttcctgt cctgctggta tcatggagaa agtccaatac 181 ctcactcgct cagctataag aagagcctca accattgaaa tgcctcaaca agcacgtcaa 241 aagctacaga atctatttat caatttctgt ctcatcttaa tatgtctctt gctgatctgt 301 atcatcgtga tgcttctctg aagttctgct acaacctcta gatctgcagc ttgccacatc 361 agcttaaaat ctgtcatccc atgcagacag gaaaacaata ttgtataaca gaccacttcc 421 tgagtagaag agtttctttg tgaaaaggtc aagattaaga ctaaaactta ttgttaccat 481 atgtattcat ctgttggatc ttgtaaacat gaaaagggct ttattttcaa aaattaactt 541 caaaataagt gtataaaatg caactgttga tttcctcaac atggctcaca aatttctatc 601 ccaaatcttt tctgaagatg aagagtttag ttttaaaact gcactgccaa caagttcact 661 tcatatataa agcattattt ttactctttt gaggtgaata taatttatat tacaatgtaa 721 aagcttcttt aatactaagt atttttcagg tcttcaccaa gtatcaaagt aataacacaa 781 atgaagtgtc attattcaaa atagtccact gactcctcac atctgttatc ttattataaa 841 gaactatttg tagtaactat cagaatctac attctaaaac agaaattgta ttttttctat 901 gccacattaa catcttttaa agttgatgag aatcaagtat ggaaaagtaa ggccatactc 961 ttacataata aaattccttt taagtaattt tttcaaagaa tcacagaatt ctagtacatg 1021 taggtaaatc ataaatctgt tctaagacat atgatcaaca gatgagaact ggtggttaat 1081 atgtgacagt gagattagtc atatcactaa tactaacaac agaatctaat cttcatttaa 1141 ggcactgtag tgaattatct gagctagagt tacctagctt accatactat atctttggaa 1201 tcatgaaacc ttaagacttc agaatgattt tgcaggttgt cttccattcc agcetaacat 1261 ccaatgcagg caaggaaaat aaaagatttc cagtgacaga aaaatatatt atctcaagta 1321 ttttttaaaa atatatgaat tctctctcca aatattaact aattattaga ttatattttg 1381 aaatgaactt gttggcccat ctattacatc tacagctgac ccttgaacat gggggttagg 1441 ggagctgaca attcgtgggt ccgcaaaatc ttaactacct aatagcctac tattgaccat 1501 aaaccttact gataacataa acagtaaatt aacacatatt ttgcgtgtta tatgtattat 1561 acactatatt cctacaataa agtaagctag agaaaatgtt atttagaaaa tcataagaaa 1621 gagaaaatat atttactatt cattaaatgg aagtgggtca acaaaaaaaa aaaaaaaaaa 1681 aaaaaaaaaa a (SEQ ID No. 7) The nucleotide sequence of PLB from rat:
1 cgcagctgag ctcccagact tcacacaact aaacagtctg cattgtgacg atcacagaag 61 ccaaggcctc ctaaaaggag acagctcgcg tttggctgcc tgctgtcaac tttttatctt 121 tctcttgact acttaaaaaa gacttgtctt cctacttttg tcttcctggc atcatggaaa 181 aagtccaata ccttactcgc tcggctatta ggagagcctc gactattgaa atgccccagc 241 aagcgcgtca gaacctccag aacctcttta tcaatttctg tctcatcttg atatgtctgc 301 tgctgatatg catcattgtg atgcttctgt gacaagctgt cgccaccgca gacctgcacc 361 atgccaacgc agttacaacc tggccctcca ccacgagggg agggcagtgc cgccgccttt 421 tccctgctgg gacatcgtcg tgaagggtca cgatttaaga gtgagactga tggcagccag 481 tgtgatcatc gctgatcttg taactttaca cgactagtgt gccacaatgt agctgcccgt 541 ttcctcagtg tggctcataa atgtctttcc taaatacttc tgacattgta gtatgagatt 601 ttaattttga aacagcacta caaaaaaagt tacactttct atatccagca ctagaaagtt 661 caacttatag cattcagttt ggggaataaa tgaaatttaa a (SEQ ID No. 8) The nucleotide sequence of AKAP18S from rat:
1 gtgccgggga tgctgcgact cgcagggctc tgcgcctccg taggcctggc cgccgcggcc 61 cgcgcccccg ctgccccgcg ggccccgggc ccgcgcctct gccttcgcgc cgcgaccatg 121 gagcgccccg ccgcgggaga aatagatgcc aataagtgtg atcatttatc aagaggagag 181 gaagggacgg gggacctgga gaccagccct gtaggttctc tggcagacct gccgtttgct 241 gccgtagaca ttcaagatga ctgtggactc cctgatgtac ctcaaggaaa tgtacctcaa 301 ggaaacccaa agagaagcaa agaaaataga ggcgacagga atgatcacgt gaagaagagg 361 aagaaggcca agaaagatta tcaacccaac tatttcctgt ccattccaat caccaacaaa 421 aagattacag ctggaattaa agtcttgcaa aattcgatac tgagacagga taatcgattg 481 accaaagcca tggtcggcga cggctccttt cacatcacct tgctagtgat gcagctatta 541 aacgaagatg aagtaaacat aggtaccgac gcgcttttgg aactgaagcc gttcgttgag 601 gagatccttg aggggaagca tctgactttg cccttccacg ggattggcac tttccaaggt 661 caggttggct ttgtgaagct ggcagacgga gatcacgtca gtgccctcct ggagatagca 721 gagactgcaa aaaggacatt tcaggaaaaa ggcatcctgg ctggagaaag cagaactttt 781 aagcctcacc tgacctttat gaagctgtcc aaagcaccaa tgctctggaa gaagggagtg 841 agaaaaatag agcctggatt gtatgagcaa tttatcgacc acagatttgg agaagaaata 901 ctgtaccaaa tagatctctg ctccatgctg aagaaaaaac agagcaatgg ttattaccac 961 tgcgagtctt cgatcgtgat cggtgagaag gaccgaaagg agcctgagga tgctgaactg 1021 gtcaggctca gtaagaggct ggtggagaac gccgtgctca aggctgtcca gcagtaccta 1081 gaagagacac agaacaaaaa gcagccgggg gaggggaact ccgtcaaagc tgaggaggga 1141 gatcggaatg gcgatggcag tgataacaac cggaagtgag agctgaaccc ggtccgctgc 1201 ccctccgcta agtcgcagac tgactcgcaa tgtgctagtg aagtgtcttg ttcaagccct 1261 ggagatcacc tagtgattga cgcgattgat gagttcggtt ttgctgcgac acaacagaaa 1321 agaatggggt gctgggacca gcagaaggaa ttactttaca gaagaacaac acgcacaagg 1381 gggagccggc acttcgggcc gcctgcccga ctcaaagggc agagggagag gactggtcgc 1441 cgacagaata ctgttctgcc gtttacattg cttcgatcct ttgactactt tatctgaggc 1501 caaaacttgc acacagctat caagtgctaa gttcactttg tcactgttga aatgaccatg 1561 agtatagtga gtccacaatg tttcctgttt gtccccccca tgtgctttta ccacacagtg 1621 atctttattt acagtaaatt gagttttgtg taaattatat atatttttgg caaatgcaat 1681 cttttctatg aaatgtgggt aatgttgtaa aggtttttga gccttatttt gataaagtca 1741 attgccatat ttaatgtcct ccgttgatat ttgtacttta aatgtatcat ataattttcc 1801 cccttaggca agaaaccagt tggaacccaa gacttaatta acgaagcttt gcaccgagaa 1861 aggatggagc tgaagtccaa agtgaaacag atcaaagaac ttttgttaaa gcctgagacc 1921 caggccaaga ttagaaagga gctttttgaa ggaagagttt ttaataatgg tgacccaact 1981 gatttcaaca tgactttgcc atagctctcc gctgctgtta cgcttgctca catgtttatg 2041 aactctcagc ccgttaaata gctctttggt gagtaaccaa agtgttctta cggtctctac 2101 aaagcccaca aaccaacatt tggtaaggaa ctaacaactt cttgccaaag aaaacgtatt 2161 tttgccttat cgtggtcacc atcatcaccg tcatcatcgt catcaccacc ataaaattga 2221 gttttagaat gttccttttg gtatcttact cattttatat aaaaacttct taattagctg 2281 ttgtaagatg ttccatgggt ccttgcagat aatattatat atatatatat atatatacac 2341 acatatatgt acatatatat acatatatat acacatatac tcacacactt ttaaaaatcc 2401 tttatagaca aaaacagcaa aacaaaataa aaccaacaac agtattctaa gggtcacctg 2461 cctcctgttg atgtggtcct gttacttcaa aggaagcatt gtccgggcca gtccagtctc 2521 aaggtccttt tgctgagcgt ttgagtgctt attgaggatc agcacttgaa cagacattag 2581 taagcgtaat cgttgtagtc acgggttcag aatgttttat actatctata ttctctcttt 2641 cattgatgaa gtacagtttg cttttttttt taatttttta tttcttcgtg aacagtgttc 2701 agggttccta tttcctactc tctgaagatg agcccaagcc tgcgttcttc acggtttgag 2761 tagcttgcac tggttccttt gtaaacgagc attcttgagt gttatttggg tagtcacttt 2821 aaaattgctg ctactaatag atgatgggga aagaaagtga ttagagatta aatatataat 2881 catctcacag tccagtttgc tcgtggattt ttggctattt ctttccactg ggtaaatgat 2941 gcattaattc atgatgtatt cctttatacg tacctacgtt ttcatgcgtc ataataaaag 3001 tactctttcc tctaaaaaaa aaaaaaaaaa aaaaaaaaa (Seq ID No. 9) The nucleotide sequence of PKA type IIa from human:
1 ccaggtcggc cgtggtagcg tagggttgcg cggdccggaa acgcagagcc ggccaaagag 61 cggcgcgacg tgagccgggg ccgtgcgcga agagacctcg cgggcgcgga gcgaaaggcc 121 ggcgtgagtg agcgcggaga cagtggccgc cggcggccca acccgtctat cccttcggcc 181 gccgccggca tgagccacat ccagatcccg ccggggctca cggagctgct gcagggctac 241 acggtggagg tgctgcgaca gcagccgcct gacctcgtcg aattcgcagt ggagtacttc 301 acccgcctgc gcgaggcccg cgccccagcc tcagtcctgc ccgccgccac cccacgccag 361 agcctgggcc accccccgcc agaacccggc ccggaccgtg tcgccgacgc caaaggggac 421 agcgagtcgg aggaggacga ggacttggaa gttccagttc ctagcagatt taatagacga 481 gtatcagtct gtgctgagac ctataaccct gatgaggaag aggaagatac agatccaagg 541 gtgattcatc ctaaaactga tgaacagaga tgcagacttc aggaagcttg caaagatatt 601 ctccttttca aaaatcttga tcaggaacag ctttctcaag ttctcgatgc catgtttgaa 661 aggatagtca aagctgatga gcatgtcatt gaccaaggag atgatggaga caacttttat 721 gtcatagaac ggggaactta tgacatttta gtaacaaaag ataatcaaac ccgctctgtt 781 ggtcaatatg acaaccgtgg cagttttgga gaactagctc tgatgtacaa caccccgaga 841 gctgctacca ttgttgctac ctcagaaggc tccctttggg gactggaccg ggtgactttt 901 agaagaatca tagtgaaaaa taatgcaaag aagaggaaga tgtttgaatc atttattgag 961 tctgtgcccc tccttaaatc actagaggtg tcagaacgaa tgaagattgt ggatgtaata 1021 ggagagaaga tctataagga tggagaacgc ataatcactc agggtgaaaa ggctgatagc 1081 ttttacatca tagagtctgg cgaagtgagc atcttgatta gaagcaggac taaatcaaac 1141 aaggatggtg ggaaccagga ggtcgagatt gcccgctgcc ataaggggca gtactttgga 1201 gagcttgccc tggtcaccaa caaacccaga gctgcctcag cttatgcagt tggagatgtc 1261 aaatgcttag ttatggatgt acaagcattc gagaggcttc tggggccctg catggacatc 1321 atgaagagga acatctcaca ctatgaggaa cagctggtga agatgtttgg ctccagcgtg 1381 gatctgggca acctcgggca gtaggtgtgc cacaccccag agccttctta gtgtgacacc 1441 aaaaccttct ggtcagccac agaacacata cagaaaacag acatgacaga actgttcctg 1501 ccgttgccgc cactgctgcc attgctgtgg ttatgggcat ttagaaaact tgaaagtcag 1561 cactaaagga tgggcagagg ttcaacccac acctccactt tgcttctgaa ggcccattca 1621 ttagaccact tgtaaagatt actccaaccc agtttttata tctttggttc aaaacggcat 1681 gtctctccaa caatttaagt gcctgataca aagtccaaag tataaacatg ctcctttcct 1741 ctc (SEQ ID No. 10) The nucleotide sequence of PKA type 110 from human:
1 gacgcgcgcc gggagccgcg ggccgggcca gccgggccgc cggggcccag tgcgccgcgc 61 tcgcagccgg tagcgcgcca gcgccgtagg cgctcgctcg gcagccgcgg ggccctaggc 121 cgtgccgggg agggggcgag ggcggcgccc aggcgcctgc cgccccggag gcaggatgag 181 catcgagatc ccggcgggac tgacggagct gctgcagggc ttcacggtgg aggtgctgag 241 gcaccagccc gcggacctgc tggagttcgc gctgcagcac ttcacccgcc tgcagcagga 301 gaacgagcgc aaaggcaccg cgcgcttcgg ccatgagggc aggacctggg gggacctggg 361 cgccgctgcc gggggcggca cccccagcaa gggggtcaac ttcgccgagg agcccatgca 421 gtccgactcc gaggacgggg aggaggagga ggcggcgccc gcggacgcag gggcgttcaa 481 tgctccagta ataaaccgat tcacaaggcg tgcctcagta tgtgcagaag cttataatcc 541 tgatgaagaa gaagatgatg cagagtccag gattatacat ccaaaaactg atgatcaaag 601 aaataggttg caagaggctt gcaaagacat cctgctgttt aagaatctgg atccggagca 661 gatgtctcaa gtattagatg ccatgtttga aaaattggtc aaagatgggg agcatgtaat 721 tgatcaaggt gacgatggtg acaactttta tgtaattgat agaggcacat ttgatattta 781 tgtgaaatgt gatggtgttg gaagatgtgt tggtaactat gataatcgtg ggagtttcgg 841 cgaactggcc ttaatgtaca atacacccag agcagctaca atcactgcta cctctcctgg 901 tgctctgtgg ggtttggaca gggtaacctt caggagaata attgtgaaaa acaatgccaa 961 aaagagaaaa atgtatgaaa gctttattga gtcactgcca ttccttaaat ctttggagtt 1021 ttctgaacgc ctgaaagtag tagatgtgat aggcaccaaa gtatacaacg atggagaaca 1081 aatcattgct cagggagatt cggctgattc ttttttcatt gtagaatctg gagaagtgaa 1141 aattactatg aaaagaaagg gtaaatcaga agtggaagag aatggtgcag tagaaatcgc 1201 tcgatgctcg cggggacagt actttggaga gcttgccctg gtaactaaca aacctcgagc 1261 agcttctgcc cacgccattg ggactgtcaa atgtttagca atggatgtgc aagcatttga 1321 aaggcttctg ggaccttgca tggaaattat gaaaaggaac atcgctacct atgaagaaca 1381 gttagttgcc ctgtttggaa cgaacatgga tattgttgaa cccactgcat gaagcaaaag 1441 tatggagcaa gacctgtagt gacaaaatta cacagtagtg gttagtccac tgagaatgtg 1501 tttgtgtaga tgccaagcat tttctgtgat ttcaggtttt ttcctttttt tacatttaca 1561 acgtatcaat aaacagtagt gatttaatag tcaataggct ttaacatcac tttctaaaga 1621 gtagttcata aaaaaatcaa catactgata aaatgacttt gtactccaca aaattatgac 1681 tgaaaggttt attaaaatga ttgtaatata tagaaagtat ctgtgtttaa gaagataatt 1741 aaaggatgtt atcataggct atatgtgttt tacttattca gactgataat catattagtg 1801 actatcccca tgtaagaggg cacttggcaa ttaaacatgc tacacagcat ggcatcactt 1861 ttttttataa ctcattaaac acagtaaaat tttaatcatt tttgttttaa agttttctag 1921 cttgataagt tatgtgctgg ccttggccta ttggtgaaat ggtataaaat atcatatgca 1981 gttttaaaac tttttatatt tttgcaataa agtacatttt gactttgttg gcataatgtc 2041 agtaacatac atattccagt ggttttatgg acaggcaatt tagtcattat gataataagg 2101 aaaacagtgt tttagatgag agatcattaa tgcatttttc cctcatcaag catatatctg 2161 ctttttttta ttttgcaatt ctctgtattc tatgtcttta aaaatttgat cttgacattt 2221 aatgtcacaa agttttgttt ttttaaaaag tgatttaaac ttaagatccg acattttttg 2281 tattctttaa gattttacac ctaaaaaatc tctcctatcc caaaaataat gtgggatcct 2341 tatcagcatg cccacagttt atttctttgt tcttcactag gcctgcataa tacagtccta 2401 tgtagacatc tgttcccttg ggtttccgtt ctttcttagg atggttgcca acccacaatc 2461 tcattgatca gcagccaata tgggtttgtt tggttttttt aattcttaaa aacatcctct 2521 agaggaatag aaacaaattt ttatgagcat aaccctatat aaagacaaaa tgaatttctg 2581 accttaccat atataccatt aggccttgcc attgctttaa tgtagactca tagttgaaat 2641 tagtgcagaa agaactcaga tgtactagat tttcattgtt cattgatatg ctcagtatgc 2701 tgccacataa gatgaattta attatattca accaaagcaa tatactctta catgatttct 2761 aggccccatg acccagtgtc tagagacatt aattctaacc agttgtttgc ttttaaatga 2821 gtgatttcat tttgggaaac aggtttcaaa tgaatatata tacatgggta aaattactct 2881 gtgctagtgt agtcttacta gagaatgttt atggtcccac ttgtatatga aaatgtggtt 2941 agaatgttaa ttggataatg tatatataag aagttaaagt atgtaaagta taacttcagc 3001 cacattttta gaacactgtt taacattttt gcaaaacctt cttgtaggaa aagagagctc 3061 tctacatgaa gatgacttgt tttatatttc agattttatt ttaaaagcca tgtctgttaa 3121 acaagaaaaa acacaaaaga actccagatt cctggttcat cattctgtat tcttactcac 3181 tttttcaagt tatctatttt gttgcataaa ctaattgtta actattcatg gaacagcaaa 3241 cgcctgttta ataaagaact ttgaccaagg ctataaatgc cacgtacatt attttcagta 3301 ttgttggtta tatttaaatt ttccttacaa taaagcacac ttttataata aaatacatga 3361 attattgttt ttcatacttt tttgcttgtt tctttaaagt tttctgacgt gcataatgca 3421 taattcattg aaaagcatga tagcaatgtg gcatgtggaa gcgaaccccc agggcataac 3481 atagtaagaa agtatggttc tgtatggcaa taggttttta aaattattag ctattcatca 3541 tgtgtgggag aaataattgt ggtgtgttgc agatttattt ggccatttag aataaccaaa 3601 tcaatctggc taactaggaa tttatgtgta aaattatctg attaaaacag ctcaagtttg 3661 aaaaaaaaaa aaaaaaaa (SEQ ID No. 11) The nucleotide sequence of human PDE4D:
1 ggaattcatc tgtaaaaatc actacatgta acgtaggaga caagaaaaat attaatgaca 61 gaagatctgc gaacatgatg cacgtgaata attttccctt tagaaggcat tcctggatat 121 gttttgatgt ggacaatggc acatctgcgg gacggagtcc cttggatccc atgaccagcc 181 caggatccgg gctaattctc caagcaaatt ttgtccacag tcaacgacgg gagtccttcc 241 tgtatcgatc cgacagcgat tatgacctct ctccaaagtc tatgtcccgg aactcctcca 301 ttgccagtga tatacacgga gatgacttga ttgtgactcc atttgctcag gtcttggcca 361 gtctgcgaac tgtacgaaac aactttgctg cattaactaa tttgcaagat cgagcaccta 421 gcaaaagatc acccatgtgc aaccaaccat ccatcaacaa agccaccata acagaggagg 481 cctaccagaa actggccagc gagaccctgg aggagctgga ctggtgtctg gaccagctag 541 agaccctaca gaccaggcac tccgtcagtg agatggcctc caacaagttt aaaaggatgc 601 ttaatcggga gctcacccat ctctctgaaa tgagtcggtc tggaaatcaa gtgtcagagt 661 ttatatcaaa cacattctta gataagcaac atgaagtgga aattccttct ccaactcaga 721 aggaaaagga gaaaaagaaa agaccaatgt ctcagatcag tggagtcaag aaattgatgc 781 acagctctag tctgactaat tcaagtatcc caaggtttgg agttaaaact gaacaagaag 841 atgtccttgc caaggaacta gaagatgtga acaaatgggg tcttcatgtt ttcagaatag 901 cagagttgtc tggtaaccgg cccttgactg ttatcatgca caccattttt caggaacggg 961 atttattaaa aacatttaaa attccagtag atactttaat tacatatctt atgactctcg 1021 aagaccatta ccatgctgat gtggcctatc acaacaatat ccatgctgca gatgttgtcc 1081 agtctactca tgtgctatta tctacacctg ctttggaggc tgtgtttaca gatttggaga 1141 ttcttgcagc aatttttgcc agtgcaatac atgatgtaga tcatcctggt gtgtccaatc 1201 aatttctgat caatacaaac tctgaacttg ccttgatgta caatgattcc tcagtcttag 1261 agaaccatca tttggctgtg ggctttaaat tgcttcagga agaaaactgt gacattttcc 1321 agaatttgac caaaaaacaa agacaatctt taaggaaaat ggtcattgac atcgtacttg 1381 caacagatat gtcaaaacac atgaatctac tggctgattt gaagactatg gttgaaacta 1441 agaaagtgac aagctctgga gttcttcttc ttgataatta ttccgatagg attcaggttc 1501 ttcagaatat ggtgcactgt gcagatctga gcaacccaac aaagcctctc cagctgtacc 1561 gccagtggac ggaccggata atggaggagt tcttccgcca aggagaccga gagagggaac 1621 gtggcatgga gataagcccc atgtgtgaca agcacaatgc ttccgtggaa aaatcacagg 1681 tgggcttcat agactatatt gttcatcccc tctgggagac atgggcagac ctcgtccacc 1741 ctgacgccca ggatattttg gacactttgg aggacaatcg tgaatggtac cagagcacaa 1801 tccctcagag cccctctcct gcacctgatg acccagagga gggccggcag ggtcaaactg 1861 agaaattcca gtttgaacta actttagagg aagatggtga gtcagacacg gaaaaggaca 1921 gtggcagtca agtggaagaa gacactagct gcagtgactc caagactctt tgtactcaag 1981 actcagagtc tactgaaatt ccccttgatg aacaggttga agaggaggca gtaggggaag 2041 aagaggaaag ccagcctgaa gcctgtgtca tagatgatcg ttctcctgac acgtaacagt 2101 gcaaaaactt tcatgccttt ttttttttta agtagaaaaa ttgtttccaa agtgcatgtc 2161 acatgccaca accacggtca cacctcactg tcatctgcca ggacgtttgt tgaacaaaac 2221 tgaccttgac tactcagtcc agcgctcagg aatatcgtaa ccagtttttt cacctccatg 2281 tcatccgagc aaggtggaca tcttcacgaa cagcgttttt aacaagattt cagcttggta 2341 gagctgacaa agcagataaa atctactcca aattattttc aagagagtgt gactcatcag 2401 gcagcccaaa agtttattgg acttggggtt tctattcctt tttatttgtt tgcaatattt 2461 tcagaagaaa ggcattgcac agagtgaact taatggacga agcaacaaat atgtcaagaa 2521 caggacatag cacgaatctg ttaccagtag gaggaggatg agccacagaa attgcataat 2581 tttctaattt caagtcttcc tgatacatga ctgaatagtg tggttcagtg agctgcactg 2641 acctctacat tttgtatgat atgtaaaaca gattttttgt agagcttact tttattatta 2701 aatgtattga ggtattatat ttaaaaaaaa ctatgttcag aacttcatct gccactggtt 2761 atttttttct aaggagtaac ttgcaagttt tcagtacaaa tctgtgctac actggataaa 2821 aatctaattt atgaatttta cttgcacctt atagttcata gcaattaact gatttgtagt 2881 gattcattgt ttgttttata taccaatgac ttccatattt taaaagagaa aaacaacttt 2941 atgttgcagg aaaccctttt tgtaagtctt tattatttac tttgcatttt gtttcactct 3001 ttccagataa gcagagttgc tcttcaccag tgtttttctt catgtgcaaa gtgactattt 3061 gttctataat acttttatgt gtgttatatc aaatgtgtct taagcttcat gcaaactcag 3121 tcatcagttc gtgttgtctg aagcaagtgg gaaatatata aatacccagt agctaaaatg 3181 gtcagtcttt tttagatgtt ttcctactta gtatctccta ataacgtttt gctgtgtcac 3241 tagatgttca tttcacaagt gcatgtcttt ctaataatcc acacatttca tgctctaata 3301 atccacacat ttcatgctca tttttattgt ttttacagcc agttatagca agaaaaaggt 3361 ttttcccctt gtgctgcttt ataatttagc gtgtgtctga accttatcca tgtttgctag 3421 atgaggtctt gtcaaatata tcactaccat tgtcaccggt gaaaagaaac aggtagttaa 3481 gttagggtta acattcattt caaccacgag gttgtatatc atgactagct tttactcttg 3541 gtttacagag aaaagttaaa caaccaacta ggcagttttt aagaatatta acaatatatt 3601 aacaaacacc aatacaacta atcctatttg gttttaatga tttcaccatg ggattaagaa 3661 ctatatcagg aacatccctg agaaacggct ttaagtgtag caactactct tccttaatgg 3721 acagccacat aacgtgtagg aagtccttta tcacttatcc tcgatccata agcatatctt 3781 gcagagggga actacttctt taaacacatg gagggaaaga agatgatgcc actggcacca 3841 gagggttagt actgtgatgc atcctaaaat atttattata ttggtaaaaa ttctggttaa 3901 ataaaaaatt agagatcact cttggctgat ttcagcacca ggaactgtat tacagtttta 3961 gagattaatt cctagtgttt acctgattat agcagttggc atcatggggc atttaattct 4021 gactttatcc ccacgtcagc cttaataaag tcttctttac cttctctatg aagactttaa 4081 agcccaaata atcatttttc acattgatat tcaagaattg agatagatag aagccaaagt 4141 gggtatctga caagtggaaa atcaaacgtt taagaagaat tacaactctg aaaagcattt 4201 atatgtggaa cttctcaagg agcctcctgg ggactggaaa gtaagtcatc agccaggcaa 4261 atgactcatg ctgaagagag tccccatttc agtcccctga gatctagctg atgcttagat 4321 cctttgaaat aaaaattatg tctttataac tctgatcttt tacataaagc agaagaggaa 4381 tcaactagtt aattgcaagg tttctactct gtttcctctg taaagatcag atggtaatct 4441 ttcaaataag aaaaaaataa agacgtatgt ttgaccaagt agtttcacaa gaatatttgg 4501 gaacttgttt cttttaattt tatttgtccc tgagtgaagt ctagaaagaa aggtaaagag 4561 tctagagttt attcctcttt ccaaaacatt ctcattcctc tcctccctac acttagtatt 4621 tcccccacag agtgcctaga atcttaataa tgaataaaat aaaaagcagc aatatgtcat 4681 taacaaatcc agacctgaaa gggtaaaggg tttataactg cactaataaa gagaggctct 4741 ttttttttct tccagtttgt tggtttttaa tggtaccgtg ttgtaaagat acccactaat 4801 ggacaatcaa attgcagaaa aggctcaata tccaagagac agggactaat gcactgtaca 4861 atctgcttat ccttgccctt ctctcttgcc aaagtgtgct tcagaaatat atactgcttt 4921 aaaaaagaat aaaagaatat ccttttacaa gtggctttac atttcctaaa atgccataag 4981 aaaatgcaat atctgggtac tgtatgggga aaaaaatgtc caagtttgtg taaaaccagt 5041 gcatttcagc ttgcaagtta ctgaacacaa taatgctgtt ttaattttgt tttatatcag 5101 ttaaaattca caataatgta gatagaacaa attacagaca aggaaagaaa aaacttgaat 5161 gaaatggatt ttacagaaag ctttatgata atttttgaat gcattattta ttttttgtgc 5221 catgcatttt ttttctcacc aaatgacctt acctgtaata cagtcttgtt tgtctgttta 5281 caaccatgta tttattgcaa tgtacatact gtaatgttaa ttgtaaatta tctgttctta 5341 ttaaaacatc=atcccatgat ggggtggtgt tgatatattt ggaaactctt ggtgagagaa 5401 tgaatggtgt gtatacatac tctgtacatt tttcttttct cctgtaatat agtcttgtca 5461 ccttagagct tgtttatgga agattcaaga aaactataaa atacttaaag atatataaat 5521 ttaaaaaaac atagctgcag gtctttggtc ccagggctgt gccttaactt taaccaatat 5581 tttcttctgt tttgctgcat ttgaaaggta acagtggagc tagggctggg cattttacat 5641 ccaggctttt aattgattag aattctgcca ataggtggat tttacaaaac cacagacaac 5701 ctctgaaaga ttctgagacc cttttgagac agaagctctt aagtacttct tgccagggag 5761 cagcactgca tgtgtgatgg ttgtttgcca tctgttgatc aggaactact tcagctactt 5821 gcatttgatt atttcctttt tttttttttt taactcggaa acacaactgg gggaat (SEQ ID No. 12) Preferably the binding partners PLB, AKAP 185, PKA type II and PDE4D as described herein refer to a polypeptide comprising SEQ ID NO. 1 (or 2), 3, 4 (or 5) or 6, respectively, and their functionally equivalent variants, derivatives or fragments. Especially preferably the binding partners are those molecules which occur endogenously. Such variants, derivatives and fragments are described hereinafter with particular reference to anchoring disruption molecules of the invention. Variants, derivatives and fragments of the binding partners as mentioned herein are similarly defined.

In particular such variants include naturally occurring variants such as comparable proteins found in other species or more particularly variants and alleles found within humans. Conveniently, said variants may be described as having more than 75%, e.g. 80, 85 or 90, especially preferably more than 95% sequence similarity or identity to the sequence described in SEQ ID Nos. 1 to 6.

Thus in a preferred 'aspect, the present invention provides a method of altering the PKA type II-mediated activation of SERCA2 in a cell by administration of an anchoring disruption molecule or binding partner mimic as defined herein, which modifies, e.g. reduces, inhibits or enhances binding between one or more of the following binding partners:

i) a polypeptide comprising the sequence as set fortlz in SEQ ID No. 1(or 2) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 1 (or 2), or a functionally equivalent fragment thereof, and a polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 3, or a functionally equivalent fragment thereof; or ii) a polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 3, or a functionally equivalent fragment thereof, and a polypeptide comprising the sequence as set forth in SEQ ID No. 6 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID
No. 6, or a functionally equivalent fragment thereof.

In connection with amino acid sequences, "sequence similarity", preferably "identity", refers to sequences which have the stated value when assessed using e.g.
using the SWISS-PROT protein sequence databank using FASTA pep-cmp with a variable pamfactor, and gap creation penalty set at 12.0 and gap extension penalty set at 4.0, and a window of 2 amino acids). Sequence identity at a particular residue is intended to include identical- residues which have simply been derivatized.

"Hybridizing under conditions of high stringency" refers to hybridization under non-stringent binding conditions of 6 x SSC/50% formainide at room temperature and washing under conditions of high stringency, e.g. 2 x SSC, 65 C, where SSC = 0.15 M NaCl, 0.015M sodium citrate, pH 7.2. As referred to herein, sequences encoded by a sequence which hybridizes to a particular sequence refers to the polypeptide sequence encoded by the conlplementary sequence of a sequence which hybridizes to the particular sequence.

Alternatively, or additionally, such hydridizing sequences may be described as those which exhibit at least 70%, preferably at least 80 or 90%, e.g. at least 95%
sequence identity (as determined by, e.g. FASTA Search using GCG packages, with default values and a variable pamfactor, and gap creation penalty set at 12.0 and gap extension penalty set at 4.0 with a window of 6 nucleotides) to the sequence which encodes the recited polypeptide (encoding sequences are provided in SEQ ID
Nos.
7-12), or a sequence complementary to any of the aforesaid sequences, or a fragment of any of the aforesaid sequences encoding the relevant binding region.

"Functionally equivalent" variants, derivatives or fragments thereof refers to molecules, preferably peptides, related to, or derived from the above described amino acid sequences, where the amino acid sequence has been modified by single or nlultiple (e.g. at 1 to 10, e.g. 1 to 5., preferably 1 or 2 residues) amino acid substitution, addition and/or deletion or chemical modification, including deglycosylation or glycosylation, but which nonetheless retain functional activity, insofar as they act as anchoring disruption molecules or binding partner mimics and thus antagonize or agonize the interaction between the binding partners (or in the case of functionally equivalent binding partners retain the ability to bind to their respective binding partners).

Within the meaning of "addition" variants are included amino and/or carboxyl terminal fusion proteins or polypeptides, comprising an additional protein or polypeptide or other molecule fused to the anchoring disruption molecule (or binding partner or its mimic) sequence. "Substitution" variants preferably involve the replacement of one or more aniino acids with the same number of amino acids and making conservative substitutions.

Such functionally-equivalent variants mentioned above include in particular naturally occurring biological variations (e.g. allelic variants or geographical variations within a species, most particularly variants and alleles found within humans) and derivatives prepared using known techniques. In particular functionally equivalent variants of the anchoring disruption molecules (or binding partners or their mimic) described herein extend to anchoring disruption molecules (or binding partners or their mimics) which are functional in (or present in), or derived from proteins isolatable from, different genera or species than the specific anchoring disruption molecules and binding partner molecules mentioned herein.

Preferred "derivatives" or "variants" include those in which instead of the naturally occurring amino acid the amino acid which appears in the sequence is a structural analogue thereof. Amino acids used in the sequences may also be derivatized or modified, e.g. labelled, glycosylated or methylated, providing the function of the anchoring disruption molecule (or binding partner or its mimic) is not significantly adversely affected.

Derivatives particularly include peptidomimetics which may be prepared using techniques known in the art and which are described hereinafter in more detail. For example, non-standard amino acids such as a-aminobutyric acid, penicillamine, pyroglutamic acid or conformationally restricted analogues, e.g. such as Tic (to replace Phe), Aib (to replace Ala) or pipecolic acid (to replace Pro) may be used. Other alterations may be made when the anchoring disruption molecule is to be used in the methods of the invention described hereinafter (or the binding partners are to be used for screening for anchoring disruption molecules). In such cases, the stability of the anchoring disruption molecule (or binding partner or its mimic), e.g. peptide, may be enhanced, e.g. by the use of D-amino acids, or amide isosteres (such as N-methyl amide, retro-inverse amid, thioamide, thioester, phosphonate, ketomethylene, hydroxymethylene, fluorovinyl, (E)-vinyl, methyleneamino, methylenethio or alkane) which protect the peptides against proteolytic degradation. Di(oligo)peptidomimetics may also be prepared.

Precursors of the anchoring disruption molecules (or binding partners or their mimics) are also encompassed by the term functionally equivalent variants and include molecules which are larger than the anchoring disruption molecules (or binding partners or their mimics) and which may optionally be processed, e.g.
by proteolysis to yield the anchoring disruption molecule (or binding partner or its mimic). Additional moieties may also be added to the anchoring disruption molecules (or binding partners or their mimics) to provide a required function, e.g. a moiety may be attached to assist or facilitate entry of the anchoring disruption molecule into the cell.

Derivatives and variants as described above may be prepared during synthesis of the anchoring disruption molecule (or binding partner or its mimic if isolated binding partners are to be used), e.g. peptide, or by post-production modification, or when the peptide is in recombinant form, using the known techniques of site-directed mutagenesis including deletion, random mutagenesis and/or ligation of nucleic acids.

Functionally-equivalent "fragments" according to the invention may be made by truncation, e.g. by removal of a peptide from the N and/or C-terminal ends.
Such fragments may be derived from the anchoring disruption peptides (or binding partners or their mimics) described above, or may be derived from a functionally equivalent peptide as described above, but which retain the ability to act as an anchoring disruption molecule (or binding partner or its mimic) according to the method of the invention. Preferably such fragments are between 6 and 30 residues in length, e.g. 6 to 25 or 10 to 15 residues. Preferably these fragments satisfy the homology (relative to a comparable region) or hybridizing conditions mentioned herein. Preferably functional variants according to the invention have an aniino acid sequence which has more than 75%, e.g. 75 or 80%, preferably more than 85%, e.g.
more than 90 or 95% or 98% similarity or identity to the aforementioned anclioring disruption molecule or binding partner sequences (according to the test described hereinbefore).

Especially preferably said nucleotide sequences are the degenerate sequences which encode the recited polypeptides or their variants or fragments.
Especially preferably said binding partners consist of, or coniprise, specific fragments (functionally equivalent fragments) of said above described polypeptides which correspond to the relevant binding sites.

PLB binds to AKAP18S through residues 7-23 of PLB and residues 181-215 (or 201-220) and/or 237-257 of AKAP186 (rat). Further experiments reveal a binding site in the region 67-181, preferably 124-181, especially preferably 124 to 138. Binding of AKAP186 to PKA type II involves residues 301-314 of AKAP188 (rat) and residues 1-44 of PKA type II (rat or human). PDE4D binds to AKAP 186 close to the PKAII binding site on AKAP18S.

Thus, in a particularly preferred aspect said binding partner polypeptide consists of at least the following amino acid sequence or a sequence with 95%
similarity tllereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence:

(a) amino acids 7-23 of SEQ ID No. 1 (or 2) for binding to SEQ ID No. 3 or its variants; or (b) amino acids 61-181 and/or 181-215 and/or 201-220 and/or 237-257 of SEQ
ID No. 3 for binding to SEQ ID No. 1(or 2) or its variants.

Such variants are as described previously.

Thus, preferably said first binding partner polypeptide comprises or consists of amino acids 7-23 of SEQ ID No. 1(or 2) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence; and/or said second binding partner polypeptide comprises or consists of amino acids 61-181 (preferably 124-138) and/or 181-215 and/or 201-220 and/or 237-257 of SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence.

Where appropriate, inhibitors of the binding between even smaller fragments of the afore-described binding partners may be used.

Binding between these binding partners may be affected in a variety of ways. Conveniently inhibitors of said binding which directly interfere with the binding at the binding site may be employed. Alternatively and as described hereinafter, binding may be reduced by modifying the endogenous molecules taking part in binding.

By "anchoring disruption molecule" it is meant a molecule which interferes with the association of AKAP18S, PDE4D and/or PLB with each other and thereby is capable of preventing the normal PKA:AKAP18S:PLB and AKAPI8S:PDE4D
interaction taking place. As a result, when used in cells, PKA RII does not become localised to the complex and cannot function to signal in the PKA type II-mediated activation of SERCA2. The presence of an anchoring disruption molecule in a cell thus alters, preferably reduces, PKA type II-mediated activation of SERCA2.
Such molecules include nucleic acid molecules which encode peptides or polypeptides of interest.

Anchoring disruption molecules as referred to herein include both direct inhibitors such as antagonists (e.g. anchoring disruption peptides and antibodies) and the molecules used to achieve an alteration in the form or expression of one or more of the endogenous binding partners. Such molecules are all referred to herein as inhibitors or anchoring disruption molecules even though their mode of interaction may not necessarily achieve direct inhibition of the binding site (i.e, a steric inhibitor). Thus molecules which act to ultimately achieve inhibition of binding between binding partners (preferably endogenous binding partners) are referred to herein as inhibitors or anchoring disruption molecules. Such molecules include peptides and proteins as well as nucleic acid molecules, such as those which encode peptide/protein inhibitors which may be used to express the peptide/protein inhibitors within the cell or may be used to derive sense or antisense nucleotide sequences, siRNA or RNAi sequences to cause co-suppression or suppression to modify, e.g. reduce expression of the endogenous binding partner.

Thus in a further aspect the present invention provides an anchoring disruption molecule which reduces or inhibits the binding between one or more of the binding partners as defined hereinbefore and which preferably is capable of altering PKA type 11-mediated activation of SERCA2 in a cell.

Preferably direct inhibitors of binding are antagonists of binding between the specific binding pairs. Such inhibitors may themselves bind to one of the binding pair at the binding site (e.g. as described hereinbefore) or at a site on one or other of the binding partners which prevents the successful interaction of those binding partners, e.g. through steric interference or altering the properties of the binding site, e.g. its spatial or charge confonnation or nucleic acid molecules which encode such inhibitors. As referred to herein an "antagonist" is a molecule or complex of molecules which by virtue of structural similarity to one molecule of a binding pair competes with that molecule for binding to the other molecule of the binding pair.

Thus the anchoring disruption molecules may be molecules which specifically recognize the binding site, such as antibodies (or fragments thereof), or proteins or peptides which associate with that region or associate sufficiently close to affect accessibility by the other binding partner. Other small molecules which act as inhibitors of binding between the binding partners which thereby act to disrupt binding, may also be used. Altennatively, molecules, particularly peptides or larger molecules, which mimic the binding site (or contain a region which mimics the binding site) (e.g. peptides, proteins or anti-idiotypes) may be used to act instead as the pseudo-binding partner to reduce the extent of binding between the true endogenous binding partners. Preferred mimics are peptides that comprise the relevant binding site as described herein. Molecules which are complementary to the binding site, e.g. such that they bind to that site may also be used.
Molecules which affect the binding site indirectly, by binding at a distant part of the molecule, but which affect the conformation of the binding site and thus the ability to form relevant interactions with its binding partner, may also be used.

Preferably appropriate molecules may be peptides which correspond to a binding partner's binding site, e.g. comprise or consist of at least the minimum binding site (i.e. the minimum ainino acid sequence required for binding of the relevant binding partner), e.g. a fragment of 7, 9, 11, 13 or 15 residues of the binding site which may optionally include residues from the surrounding region.

Tlius, for example, an anchoring disruption molecule or binding partner mimic is a peptide which consists of or comprises one or more sequences selected from:

(i) amino acids 7-23 of SEQ ID No. 1(or 2);
(ii) amino acids 61-181 of SEQ ID No. 3;
(iii) amino acids 124-138 of SEQ ID No. 3:
(iii) amino acids 181-215 of SEQ ID No. 3;
(iv) amino acids 201-220 of SEQ ID No. 3;
(v) amino acids 237-257 of SEQ ID No. 3;
(vi) amino acids 124-220 of SEQ ID No. 3;

or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence, or a fragment thereof of 7 to 15 residues.

Appropriate molecules may for example be proteins or peptides or other molecules which can affect binding, or a nucleic acid molecule which encodes such a product may be used to generate the inhibitor and are all encompassed by anchoring disruption molecules. Conveniently small inhibitory molecules may be used. However, where desired, large molecules containing the binding site may be employed, e.g. larger molecules which mimic the entire binding partner (e.g.
the soluble portion thereof), but which have preferably been modified such that one or more properties required for involvement in the signalling pathway is missing or altered to lose or impair its ability to be involved in signalling. For example in the case of AKAP188 a large molecule absent only amino acids 301-314 may be used, which would allow functional binding with PLB, but not PKA type II.

Alternatively whilst the ability to bind one binding partner may be retained, otlier relevant binding sites required to allow the development of the signalling scaffold may be impaired or removed such that a functional complex is not formed, e.g. by mutation. For example, in the case of AKAP 185, the full length molecule could be used with a mutation at the binding site for either PLB or PKA type II.

Thus the present invention further extends to an anchoring disruption molecule which is a polypeptide (or the nucleic acid molecules encoding it) containing one or more mutations in one or more binding sites described herein (e.g.
the minimum binding site), in which said mutation results in a molecule which has impaired binding at that site to the relevant binding partner relative to the same molecule witliout the mutation. For example, one or more of the residues in the PLB binding site of the AKAP18S molecule, e.g. amino acids 124-138 of SEQ ID
No. 3 may be mutated, preferably to a proline residue, and the resultant molecule used as an inhibitor to interfere with the ability of the endogenous protein to bind to its binding partner PLB.

The present invention thus also extends to novel modified, e.g. mutated binding partners or functionally equivalent variants, derivatives or fragments thereof and the nucleic acid molecules which encode tliem.

Thus, viewed from a yet further aspect, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding a binding partner, or a functionally equivalent variant, derivative or fragment thereof, as defined above, wherein said sequence is modified as defined above to alter its ability to bind to its binding partner as defined above.

Particularly preferred anchoring disruption molecules of the invention are peptides which disrupt the association between AKAP 188 and PLB or between AKAP 188 and PDE4D. Peptides as referred to herein are referred to as "anchoring disruption peptides" in view of their effect on the anchoring of PKA to the complex.
Other preferred anchoring disruption molecules are nucleic acid molecules.
corresponding to or derived from the sequences of AKAP18S, PLB or PDE4D, e.g.
antisense oligonucleotides or siR.NA. Other preferred inliibitors includes ribozymes and antibodies.

In this regard, the inventors have identified a family of molecules which comprise newly defined amino acid sequences which share the property of binding to AKAP18S, PLB or PDE4D with high affinity and selectivity and tlierefore act in a cell to prevent or enhance PKA. II localising to its normal position within the SERCA2 complex or redirecting PKA II to another position. In this way the function of PKA II on SERCA2 is modulated by affecting localisation or recruitment.
Preferred anchoring disruption molecules or binding partner mimics of the invention comprise the region of phospholaniban that binds to AKAP 185, or a sequence which is closely related to the sequence of that region.
In a further preferred aspect therefore, the present invention provides an anchoring disruption molecule or phospholamban mimic, wherein said molecule or mimic is a polypeptide which comprises the following amino acid sequence:
RRASTIE

or a sequence which has been modified by substitution or deletion of up to 3 residues, i.e. one, two or three substitutions or deletions or insertions of up to 3 residues between the described residues, provided that said modified peptide retains its ability to bind to the relevant binding partner, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said polypeptide, Preferably only one or two substitutions or deletions are made. Preferably however the arginine and glutamic acid residues are not varied. Such molecules may be used in methods of the invention.
Especially preferably the sequence may be:
RSAIRRASTIEMP
or a sequence whicli has been modified by substitution or deletion of up to 5 residues, i.e. one, two, three, four one or five substitutions or deletions or insertion of up to 5 residues between the described residues, provided that said modified peptide retains its ability to bind to the relevant binding partner, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said polypeptide.
Preferably only one or two substitutions or deletions are made. Especially preferably the arginines at positions 1, 5 and 6 and the glutamic acid at position 11 are not varied.
Where the arginines in the above described sequences are varied, they are preferably substituted by lysine residues. When the glutamic acid residue in the above described sequences is varied, it is preferably substituted by an aspartic acid residue.
Particularly preferred substitutions of the above described sequences are conservative, i.e. arginine may be replaced with lysine, serine may be replaced with threonine, alanine may be replaced with valine, leucine or isoleucine, glutamic acid may be replaced with aspartic acid and methionine may be replaced with cysteine (and vice versa).
Thus in a preferred embodiment the above described polypeptide comprises the sequence (R/K)(R/K)X3(S/T)(T/S)X4(E/D) or (R/K)(S/T)X1X2(R/K)(R/K)X3(S/T)(T/S)X4(E/D)(M/C)P, wherein Xi and X2 independeritly may be any amino acid except E, preferably A, V, L or I, and X3 and X4 independently may be any amino acid except E or K, preferably A, V, L or I, which sequences may be truncated and/or to which sequences additions may be made, as described above, or a nucleic acid molecule encoding said polypeptide.
In a particularly preferred embodiment the polypeptide comprises the above described sequences or a sequence with at least 80, 90, 95 or 98% sequence identity thereto. Particularly preferred are those peptides described in the Examples which achieve substantially comparable binding to the unmodified sequence and substitutions which are particularly preferred are those which do not significantly modify the binding of the peptide to the binding partner, e.g. achieve up to 80% of the wild-type peptide binding.
Preferably deletions are made at the end of the above described sequence, e.g. one or two residues may be removed, e.g. the sequence IRRASTIEMPQQ.
Additions may be made, preferably at the N or C-terminal of the above described sequence, preferably to extend the binding sequence in line with the naturally occurring sequence. Thus for example the sequence may be:
LTRSAIRRASTIEMPQQARQ, or VQYLTRSAIRRASTIEMPQQARQNLQ
or a peptidomimetic or analogue thereof for example comprising conservative substitutions as described above.
The above described sequence is based on residues 4-29 of the rat phospholamban sequence.
In an alternative embodiment the anchoring disruption molecule or binding partner mimic of the invention further comprises an amino acid sequence which assists cellular penetration of said anchoring disruption molecule or binding partner mimic, or a nucleic acid molecule encoding said polypeptide. Said additional amino acid sequence may for example be a polyarginine sequence, e.g. having from 3 to 16 residues, e.g. 8-12, preferably R4, Rlo or Ri i or the HIV tat sequence or antennaepedia peptide (penetratin).
Anchoring disruption molecules mimicking the relevant binding sites between AKAP 188 and PDE4D may also be used in methods described hereinafter.
Preferred anchoring disruption peptides include the sequence of the binding sites of AKAP 188 or PDE4D in which additions, deletions or substitutions (e.g. of up to 5 residues) may be made to that sequence as described above or sequences with at least 90% sequence identity thereto.
Appropriate anchoring disruption molecules for use in methods of the invention may be identified or tested using appropriate screening tests. Thus in a further aspect, the present invention provides a method of screening for, or testing the ability or efficacy of, a molecule to reduce or inhibit binding between any one of the aforementioned binding partners, wherein said test molecule is contacted with said binding partners and the extent of binding is assessed. Optionally said binding partners are present in isolated form, for example the first of said binding pair may be immobilized on a solid support and the ability of the second of said pair to bind to said first binding partner may be assessed in the presence or absence of said test molecule, i.e. by competition. Alternatively, said binding partners may be present in endogenous form, e.g. in a cell and the ability of said test molecule to affect PKA
type II signalling by examination of an indicator of said signalling, e.g. PLB
phosphorylation or SERCA 2 activation may be examined.

Antagonistic anchoring disruption molecules of the invention tlius have the ability to interact with AKAP188, PLB or PDE4D (depending on which binding they are modelled on) in a reversible or irreversible manner. In other words the anchoring disruption molecule associates with AKAP18S, PLB or PDE4D, preferably AKAP 186. The structure of the antagonistic anchoring disruption molecules of the invention are such that they bind to or associate with e.g.
AKA.P18S at the site at which PLB would normally interact with that AKAP
molecule. This site on AKAP 188 has been defined as residues 61-181 and/or 181-215 (or 201-220) and/or 237-257 (rat). Thus the anchoring disruption molecule associates with, preferably binds to, a molecule comprising amino acid residues 61-181 and/or 181-215 (or 201-220) and/or 237-257 of AKAP18S.
In one alternative, the anchoring disruption molecule may thus be considered as being a direct inhibitor of PKA. RII anchoring, i.e. by acting as an antagonist, i.e.
it associates with or binds to PLB, AKAP 188 or PDE4D and blocks the interaction of PLB and AKAP 186 or AKAP 188 and PDE4D e.g. sterically by occupying the binding site on one of the binding partners. These molecules therefore act as artificial binding sites and compete with endogenous molecules containing those binding sites to bind to the relevant binding partner. Such anchoring disruption molecules may thus be seen as conlpetitors of binding between PLB and AKAP 188 or AKAP18S and PDE4D as, for example, both endogenous PLB and anchoring disruption molecules of the invention will bind to AKAP188. By affecting the binding between PLB and AKP 185, PKA RII is prevented from being associated with the SERCA2 complex with PLB and AKAP 188 and its normal localisation is disrupted.
As a consequence of the anclloring disruption molecule being designed to have a higher affinity for the binding partners, e.g. AKAP18S, than the corresponding endogenous molecules, it is possible to displace the endogenous molecules from their binding partners to which they are already bound when the anchoring disruption molecule is administered.
The ability of a molecule to act as an antagonistic anchoring disruption molecule is thus dependent on its ability to selectively associate with or bind to one of the above described binding partners with high affinity. As referred to herein "binding" refers to the interaction or association of a least two moieties in a reversible or irreversible reaction, wherein said binding is preferably specific and selective. Specific binding refers to binding which relies on specific features of the molecules involved to achieve binding, i.e. does not occur when a non-specific molecule is used (i.e. shows significant binding relative to background levels) and is selective insofar as binding occurs between those partners in preference to binding to any of the majority of other molecules which may be present, particularly other AKAPs.
The binding or association of the anchoring disruption molecule serves to reduce or inhibit binding between the aforementioned binding partners.
"Reduced"
binding in this sense refers to a decrease in binding e.g. as manifest by reduced affinity for one another and/or an increased concentration of one of this binding pair required to achieve binding. Reduction includes a slight decrease as well as absolute abrogation of specific binding. A total reduction of specific binding is considered to equate to a prevention of binding. "Inhibited" binding refers to adversely affecting (e.g. by competitive interference) the binding of the binding partners by use of an anchoring disruption molecule which serves to reduce the partners' binding.
A reduction in binding or inhibition of binding may be assessed by any appropriate technique which directly or indirectly measures binding between the binding partners. Thus relative affinity may be assessed, or indirect effects reliant on that binding may be assessed. Thus for example, the binding of the 2 binding partners in isolated form may be assessed in the presence of the anchoring disruption molecule. Alternatively tests may be conducted in which the signalling achieved by the PKA type II pathway, particularly in relation to SERCA2 activation, is examined or by assessing disrupted or redirected localization as evident from the presence of one or more binding partners in biochemical subcellular fractionation or by inununofluorescent staining and epifluorescence microscopy. Anchoring disruption molecules or binding partner mimics may be labelled to follow such processes.
As mentioned above, the anchoring disruption molecules of the invention have a high affinity for the binding partner to which the molecule from which they are derived would bind. The antagonistic anchoring disruption molecules in general have a higher affinity for those binding partners than the endogenous corresponding binding partner. Preferably the anchoring disruption molecule has both a higher affinity and specificity for the binding partner than the endogenous, corresponding binding partner.
The ability of a peptide or peptidomimetic to act as an anchoring disruption molecule, i.e. to bind to one of the binding partners mentioned herein and the strength of binding (the affinity of binding) can be measured in a number of different ways, which are standard in the art and would be considered routine by the person skilled in the art. Examples of such methods include overlay or far western tecllniques, using radiolabelled binding partners (see the Examples), measuring dissociation constants or coimmunoprecipitation techniques. These techniques may also be used to deterniine whether a potential anchoring disruption molecule has the requisite level of selectivity or specificity.
,. , Alternatively, binding may be detected or measured based on the functional effects of the binding as described above for measuring the extent of binding between binding partners, e.g. between PLB and AKAP188, e.g. by measuring the amount of PKA II signalling, particularly SERCA2 activation by PKA II
signalling (e.g. by measuring a downstream signal or effect such as in the heart:
increased heart rate, increased cardiac output, increased speed of Ca2+ release and reuptake (phosphorylation of b2-AR, L-type Ca2+ channel, RYR, phospholamban)). Such markers may be examined in individuals, organs or cells as appropriate.
'The antagonistic anchoring disruption molecule is capable of associating with or binding to one c-"~ the binding partners described herein and has been designed for and is intended for use in affecting the SERCA2 mediated PKA type II
signalling pathway. Preferably therefore the anchoring disruption molecule binding to the binding partner is specific in that the anchoring disruption molecule of the invention has a higher affinity for that binding partner than for other molecules in the cell, e.g. in the case of PLB that it has higher affinity for AKAP18S than it does for other AKAPs and may thus be considered specific for AKAP 185. Preferably the binding affinity for the binding partner is 10 times, e.g. 50 times higher for the binding partner than for any other molecule in the cell, even more preferably times, 200 times, 800 times, 1000 times or 2000 times higher. This may be measured as described above.

Conveniently said binding may be assessed according to the KD between the binding partners in the presence of the anclioring disruption molecule. Said binding may alternatively be assessed according to the KD between the anchoring disruption molecule and the binding site of the binding partner to which it binds.
Preferably the KD should be 0.01-500nM, preferably 0.1-lOnM when assessed in vitro. This can be assessed by any appropriate techniques which measures binding between two binding partners.
For example the dissociation constants (KD) may be measured directly by fluorescence polarization, or using other standard techniques which are known in the art.
Binding partner "mimics" as described herein refer to molecules of the invention which have at least one of the functions of a naturally occurring binding partner, e.g. bind to AKAP18S and/or also bind to one or more membrane bound components and/or modulate signalling through PKA II or nucleic acid molecules encoding such mimics. Said mimic may exhibit said function to a higher or lesser extent than the binding partner which it mimics, e.g. may have higher binding affinity. Binding partner mimics which bind to AKAP186 or PLB preferably do so with high affinity. Binding partner mimics enhance binding between binding partners as described herein, preferably by enhancing the binding between an endogenous binding partner molecule and the mimic. Such mimics according to the invention are molecules which mimic a binding site of an endogenous binding partner as described herein and bind to the corresponding endogenous binding partner and exhibit at least one of said binding partner's functions which it mimics.
To act as mimics which allow the formation of a functional PKA signalling complex, said mimics preferably include a targeting sequence to facilitate anclloring at a specific site. This site may be a site used by naturally occurring binding partners or a site not in use under normal circumstances. Such targeting sequences may target the bound molecules to the mitochondria, ER, sarcoplasmic reticulum, centrosomes or other appropriate location. Synthetic or known target sequences may be used, e,g. targeting domains from D-AKAP1 (for targeting to the mitochondria and ER) or AKAP450 (for targeting to the centrosome) may be used.

These mimics thus may bind and act as binding partners and allow the formation of relevant complexes to achieve SERCA2 mediated PKA type II
signalling. Molecules which are able to act as mimics may be determined using the same tests as described above to identify anchoring disruption molecules, but the mimics that serve to activate the SERCA2 mediated PKA type II signalling will show markers of enlianced rather than depressed SERCA2 mediated PKA type II
signalling. Furthermore, PKA type I could also be targetted to the SERCA2 complex using appropriate mimics with a higher affinity PKA type I binding domain.
Other mimics may not necessarily facilitate localization and complex formation and may instead bind to one of the binding partners and for example be used to identify or isolate the same, e.g. may bind and allow the identification or isolation of specific PKA isotypes. In such cases the mimic may be labelled.
Other binding partner mimics may mimic a functional role of a naturally occurring binding partner by modulating signalling of the SERCA2 mediated PKA type II pathway through means not necessarily involving a PKA II:AKAPI8S:PLB or AKAP 188: PDE4D interaction.
Molecules which affect the PKAII:AKAPI8S:PLB complex are also contemplated. As described hereinbefore, PLB phosphorylation by PKAII affects PKA signalling. Thus, hyperphosphorylation of PLB by PKA may be used in methods of the invention, e.g. to suppress heart failure progression.
Thus a preferred aspect of the invention provides a method of altering PKA
type II activation of SERCA2 for the purposes described herein wherein a molecule is used which alters the phosphorylation level of PLB. This may be achieved, e.g.
by disrupting binding of PD4ED and AKA.P18S to increase cAMP levels locally.
Molecules to disrupt binding of these binding partners are described above.
Alternatively, the level of PKA in the PKA:AKAP 1 88:PLB:SERCA2 complexes may be increased.
As mentioned above, PKA II binds to AKAP 185. The binding between these binding partners may be used to draw PKA into complexes containing PLB
where it can phosphorylate PLB. Thus, a mimic of the binding site of AKAPI86 may be used to capture PKA molecules. Attachment of the mimic to a targetting sequence allows the captured molecules to be directed to the correct location, i.e. to the con7plex containing PLB. Appropriate targetting molecules are as described herein and include molecules which target to the sarcoplasmic reticulum, e.g.
as described in Figure 21.
Thus in a further aspect, the present invention provides a method of altering PKA type II-mediated, preferably PKA type IIa- mediated, activation of SERCA2 in a cell by administration of a binding partner mimic which enhances binding between the following binding partners:
a first polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 3, or a functionally equivalent fraginent thereof, and a second polypeptide comprising the sequence as set forth in SEQ ID No. 4 (or 5) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 4 (or 5), or a functionally equivalent fragment thereof, wherein said binding partner mimic comprises a targetting sequence and a sequence which mimics the binding site of said first polypeptide to said second polypeptide and binds to said second polypeptide, preferably binding to amino acids 1-44 of SEQ ID No. 4 (or 5) or a sequence with 95% similarity tliereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence, or a nucleic acid molecule encoding said targetting and mimic sequences.
The binding site between PKA II and AKAP18S is located at residues 1-44 of PKA II (SEQ ID No. 4 (or 5)) and residues 301-314 of AKAP188. Thus, preferably the sequence which mimics the binding site of said first polypeptide consists of or comprises amino acids 301-314 of SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence of SEQ ID No. 3, or a fragment thereof of 7 to 15 residues.
The sequence which mimics the binding site of said first polypeptide may be derived from the binding site of AKAP18S as described in the Examples, e.g.
consist of or comprise PEDAELVRLSKRLVENAVE/LKAVQQY.
Examples of other molecules which may be used include ht31 (DLIEEAASRIVDAVIEQVKAAGAY), AKAP-IS (QIEYLAKQIVDNAIQQA) and super-AKAP-IS (QIEYVAKQIVDYAIHQA) or MEME3 (LEQYANQLADQIIKEATE).
Other molecules whicli may be used to bind to PKA type II include peptides as described in UK Patent Application No. 0421356.7, now PCT/GB2005/003677, published as WO2006/032909, incorporated herein by reference, which bind to PKA
type II. Thus alternatively, the sequence which mimics the binding site of said first polypeptide may comprise the following amino acid sequence:

Xl X2 EX3X4AKQIVX5X6X7I.X8X9Xlo wherein Xl is Q, D, M, A, G, H, K, L, P, R, S, T, V, W or Y (preferably K, Q, D or M);
X2 is I, L, V or Y (preferably I, L'or V);
X3 is Y, F, V, C, K, L, W or H (preferably K, Y, F or V);
X4 is V, K, C, L, H, F, Y, I or W (preferably V, K, C, L or H, especially preferably K or V);
X5 is D, E, G, H, S, T or R (or A, C, K, M, N or W) (preferably D, G, H, S, T or R);
X6 is Y, H, N, R, W, C, F, K or R (preferably K, Y, H or N, especially preferably K or Y);
X7 is A, C or V;
X8 is H, C, Q or K (or L or W) (preferably K or H);
X9 is Q, C, K, H, A, G, N, R, S, T, V, W or Y (preferably K, Q or C);
and Xlo is A, C, K (preferably K), provided that when X2 is I, either X3 is not Y, X4 is not L, X5 is not D, X6 is not N, X7 is not A, X8 is not Q, X9 is not Q or Xio is not A, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said peptide.
Preferably X4 is V; X6 is Y and X8 is H, especially preferably X4 is V; X6 is YandXBisHandX1isQ,DorM;X2isl,LorV;X3isY,ForV;X5isDorE;X7 isAorV;X9isQandXtoisA.
Epecially preferably, the sequence is QIEYVAKQIVDYAIHQA.
In a further feature therefore, the present invention further provides a method of identifying and/or isolating a PKA type II molecule comprising contacting a sample containing said PKA molecule with an AKAP 188 mimic as described herein, carrying a labelling means and capable of binding to PKA type II (e.g. PKA
lI(X) with high affinity and assessing the level of said AKAP18S mimic which is bound and/or isolating said PKA to which said AKAP18S mimic is bound, wherein said level of AKAP 18 S mimic is indicative of the level of said PKA molecule in said sample.
Alternative methods of reducing binding between the binding partners as defined hereinbefore includes modification of endogenous molecules taking part in said binding. Thus, the invention extends to modifying the endogenous binding partner as described hereinbefore in a cell. This may be achieved for example by manipulation of the wild-type gene, by manipulating expression of the gene (e.g. by affecting transcription or translation) or by manipulating the expressed product.
This could for example be achieved by using antisense oligonucleotides comprising nucleic acid sequences as described hereinbefore (i.e. of binding partners or of relevant protein/peptide inhibitors) or their complementary sequences, ribozymes, RNAi or siRNA and the invention extends to such molecules and their uses. For example, to manipulate the endogenous gene, this could be performed for example by somatic cell gene therapy with homologous recombination to for example remove or mutate the binding site. This could be performed on for example hematopoietic stem cells or on blood cells ex vivo or in vivo. Mutation of one or more of the residues to a proline residue in the AKAP 185 binding site for PLB
for example could be performed to generated proteins that have reduced binding to PLB.

Alternatively wild-type or mutated sequences may be used to cause co-suppression of the naturally occurring molecule. Such exogenous molecules may be administered to cells as described hereinafter. In a particularly preferred aspect, expression of one or more of the endogenous binding partners described herein is suppressed. Conveniently this may be achieved using the known tecluniques involving antisense molecules or siRNA. Preferably the oligonucleotides used for this purpose are derived from the sequences of the binding partners described herein, e.g. derived from SEQ ID Nos. 7-9 or 12 or a sequence with at least 80, 90 or 95%
sequence identity thereto or the complementary sequence thereof. Derived sequences are those which are all or a part or fragment of the full sense or antisense sequence which are e.g. 10-500, preferably 10-30 bases in lengtli. Preferred siRNA
molecules are described in the Examples. Thus in a preferred aspect, the methods of the invention are performed in which the anchoring disruption molecules are nucleic acid molecules or oligonucleotides (sense or antisense) derived from the nucleotide sequence of a binding partner as described hereinbefore or the complementary sequence thereof.

"Polypeptides" or "peptides" as referred to herein are molecules with preferably less than 100 amino acid residues but are preferably shorter, e.g.
less than 50 amino acid residues in length, preferably 10 to 35, 14 to 30, or 14 to 25 amino acid residues in length. Anchoring disruption molecules of the invention are preferably of this length.
Polypeptides and polynucleotides as described herein may be prepared by any conventional modes of synthesis, including chemical synthesis or recombinant DNA technology. Chemical synthesis of polypeptides may be performed by methods well known in the art involving cyclic sets of reactions of selective deprotection of the functional groups of a terminal amino acid and coupling of selectively protected amino acids, followed by complete deprotection of all functional groups. Synthesis may be performed in solution or on a solid support using suitable solid phases known in the art. Preferably the anchoring disruption molecules or binding partner mimics are substantially purified, e.g. pyrogen-free, e.g. more than 70%, especially preferably more than 90% pure (as assessed for example, in the case of peptides, by an appropriate technique such as peptide mapping, sequencing or chromatography). Purification may be performed for example by chromatography (e.g. HPLC, size-exclusion, ion-exchange, affinity, hydrophobic interaction, reverse-phase) or capillary electrophoresis.
As described above, peptidomimetics are also included within the scope of the invention. Peptidomimetics and analogues as referred to herein are molecules which mimic the peptide described above in terms of function (i.e. their ability to act as an anchoring disruption molecule or binding partner mimic as described herein using the tests described herein) and/or structure. Functionally said peptidomimetics and analogues may show some reduced efficacy in perfonning the anchoring disruption molecule or binding partner mimic function, but preferably are as efficient or are more efficient.
Peptides, particularly when used in biological, e.g. medical applications may not be without shortcoming as a result of e.g. poor oral and tissue absorption, rapid proteolysis cleavage, rapid excretion, potential antigenicity and poor shelf stability.
One way in which this may be addressed is by the adoption of peptidomimetics which retain the functional features of the peptide but present them in the context of a different, e.g. non-peptide structure. Such peptidomimetics may have improved distribution, metabolism and pharmacokinetics profiles, e.g. improved stability and membrane permeability. Such peptidomimetics have successfully been developed and used for other particularly medical applications.
Peptidomimetics, particularly non-peptidic molecules may be generated through various processes, including conformational-based drug design, screening, focused library design and classical medicinal chemistry. Strategies that have been used to identify peptidomimetics from the parent peptide structure which serve as scaffolds for enhancing non-peptide character may include 3-dimensional conformation analysis of the peptide followed by the establishment of organic synthetic strategies to prepare non-peptidic analogues witli similar or improved interaction with the pharmacophore groups on the ligand and the receptor. Thus for example various elements may be used to conformationally restrict certain relevant portions of the molecule, e.g. the distance between binding centers, a, (3 or y turns, (3-strands or a helices.
Thus not only may oligomers of unnatural amino acids or other organic building blocks be used, but also carbohydrates, heterocyclic or macrocyclic compounds or any organic molecule that comprises structural elements and confomlation that provides a molecular electrostatic surface that mimics the same properties of the 3-dimensional conformation of the peptide may be used (Martin-Martinez et al., 2002, Bioorg. Med. Chem. Letters, 12, p109-112; Andronati et al., 2004, Current Med. Chem., 11(9), p1183-1211; Eguchi et al., 2003, Combinatorial Chemistry and High Throughput Screening, 6(7), p611-621; Freidinger, 2003, J.
Med. Chem., 46(26), p5553-5566; Jones et al, 2003, Current Opin. Pharm., 3.(5), p530-543; Le et al., Drug Discovery Today, 8(15), p701-709; Schirmeister &
Kaeppler, 2003, Mini-reviews in Med. Chem., 3(4), 361-373; Eguchi & Kahn, Mini-reviews in Med. Chem., 2(5), p447-462).
Thus the peptidomimetics may bear little or no resemblance to a peptide backbone. Peptidomimetics may comprise an entirely synthetic non-peptide form (e.g. based on a carbohydrate backbone with appropriate substituents) or may retain one or more elements of the peptide on which it is based, e.g. by derivatizing one or more amino acids or replacing one or more amino acids with alternative non-peptide components. Peptide-like templates include pseudopeptides and cyclic peptides.
Structural elements considered redundant for the function of the peptide may be minimized to retain a scaffold function only or removed where appropriate.
When peptidomimetics retain one or more peptide elements, i.e. more than one amino acid, such amino acids may be replaced with a non-standard or structural analogue thereof. Amino acids retained in the sequences may also be derivatised or modified (e.g. labelled, glycosylated or methylated) as long as the ability of the polypeptide to associate with or bind to a binding partner and compete with binding to the complementary binding partner or act as an binding partner mimic is not compromised by the substitution, derivatisation or modification.
The peptidomimetics are referred to as being "derivable from" a certain polypeptide sequence. By this it is meant that the peptidomimetic is designed with reference to a defined polypeptide sequence, such that it retains the structural features of the peptide which are essential for its function. This may be the particular side chains of the polypeptide, or hydrogen bonding potential of the structure. Such features may be provided by non-peptide components or one or more of the amino acid residues or the bonds linking said amino acid residues of the polypeptide may be modified so as to improve certain functions of the polypeptide such as stability or protease resistance, while retaining the structural features of the polypeptide whicli are essential for its function. In other words the peptidomimetic or analogue has the same functional characteristics as a polypeptide having the defined sequence with respect to its ability to associate with or bind to a binding partner and to act as an anchoring disruption molecule or to act as an binding partner mimic and thereby alter the SERCA2 mediated PKA RII signalling pathway. The peptidomimetic or analogue's functional characteristics are inherent from the structure of the peptidomimetic and the structure is designed to retain these properties. For example, in peptidomimetics retaining at least a partial amino acid content, one or more of these amino acid residues may be replaced with structural analogues, as long as the key structural features which provide the ability to bind to the binding partner, e.g. PKA RII or AKAP18S are retained.
Examples of non-standard or structural analogue amino acids which may be used are D amino acids, amide isosteres (such as N-methyl amide, retro-inverse amid, thioamide, thioester, phosphonate, ketomethylene, hydroxymethylene, fluorovinyl, (E)-vinyl, metliyleneamino, methylenethio or alkane), L-N
methylamino acids, D-V methylamino acids, D-N-methylamino acids. Examples of non-conventional amino acids are listed in Table 1.

Non-conventional Code Non-conventional Code amino acid amino acid a-aminobutyric acid ' Abu ,b -N-methylalanine Nmala a-amino-a-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-Nmethylglutanmine Nmgln carboxylate L-N-methylglutamic acid Nmg1u cyclohexylalanine Chexa L-N-methylhistidine Nmhis cyclopentylalanine Cpen L-N methylisolleuci.ne Nmile D-alanine Dal L-N-methylleucine Nmleu D-arginine Darg L-N-methyllysine Nmlys D-aspartic acid Dasp L-N-methylmethionine Nmmet D-cystein:e Dcys L-N-methylnorleucine Nmnle D-glutamine Dgln L-N,methylnorvaline Nmnva D-glutamic acid Dglu L N methylornithine Nmorn D-histidine Dhis L-N-methylphenylalanine , Nmphe D-isoleucine Dile L-N-methylproline Nmpro D-leucine Dleu L-N-methylserine Nmser D-lysine Dlys L-N-methylthreonine Nm.thr D-methionine Dmet L-N-methyltryptophan Nmtrp D-ornithine Dorn L-N-methyltyrosine Nmtyr D-phenylalanine Dphe L-N-methylvaline Nmval D-proline Dpro L-N-methylethylglycine Nmetg D-seriae Dser L-N-methyl-t-butylglycine Nmtbug D-threonine Dthr L-norleucine Nle D-tryptophan Dtrp L-norvaline Nva D-tyrosine Dtyr a-methyl-aminoisobutyrate Maib D-valine Dval a-methyl-y-a.minobutyrate Mgabu B=a-methylalanine Dmala a-methylcyclohexylalanine Mchexa.
D-a-methylarginine Dmarg a-methylcylcopentylalanine Mcpen D-a-methylasparagine Dmasn a-methyi-a-napthylalanine Manap D-a-methylaspartate Dmasp a-methylpenicillaniine Mpen D-a-methylcysteme Dmcys N-(4-aminobutyl)glycine Nglu D-a-methylglutamine Dmgln N-(2-aniinoethyl)glycine Naeg D-a-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn D-a-methylisoleucine Dmile N-amino-a-methylbutyrate Ninaabu D-a-methylleucine Dmleu a-napthylalanine Anap D-a-methyllysine Dmlys N-benzylglycine Nphe D-a-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln D-a-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn D-a-methylphenyialanine Dmphe N-(2-carboxyethyl)glycine Nglu D-a-methyiproline Dmpro N-(carboxymethyl)glycine Nasp D-amethylserine Dmser N-cyclobutylglycine Ncbut D-a-methylthreonine Dmthr N-cycloheptylglycine Nchep D-a-methyltryptophan Dmtrp N-cyclohexylglycine Nchex D-a-methyltyrosine Dmty N-cyclodecylglycine Ncdec D-a-methylvaline Dmval N-cylcododecylglycine Ncdod JN -methylala.nine Dnmala N-cyclooctylglycine Ncoct D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg D-N-methylglutamate Dnmglu N-(1-hydroxyethyl)glycine Nthr D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser, D-N-methylisoleucine Dnmile N-(inudazolylethyl))glycine Nhis D-N-metbylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp D-N-methyllysine Dnmlys N-methyl-y-aminobutyrate Nmgabu N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen N-methylglycine Nala D-N-methylphenylalanine Dnmphe N-methylaminoisobutyrate Nmaib D-N-methylproline Dnrnpro N-(1-methylpropyl)glycine Nile D-N-methylserine Dnmser N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr D-N-methyltryptophan Dnmtrp N-(1-methylethyl)glycine Nval D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap .D-N-methylvaline Dnmval N-methylpenicillamine Nmpen y-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr L-t-butylglycine Thug N-(thiomethyl)glycine Ncys L-ethylglycine Etg penicillamine Pen Irhomophenylalanine Hphe L-a-methylalanine Mala L-a-methylarginine Marg L-a-methylasparagine Masn L-a-methylaspartate Masp L-a-methyl-t-butylglycine. Mtbug L-a-methyicysteine Mcys L-methylethylglycine Metg L-a-methylglutamine Mgln L-a-methylglutamate Mglu L-a-methylhistidine Mhis L-a-methylhomophenylalanine Mhphe L-a-methylisoleucine Mile. N-(2-methylthioethyl)glycine Nmet L-a-methylleucine Mieu L-a-methyllysine Mlys L-a-methylmethionine Mmet L-a-methylnorleucine Ivfnle L-a-methylnorvaline Mnva L--a-methylornithine Morn L-a-methylphenylalanine Mphe L-a-methylproline Mpro L-a-methylserine Mser L-a-methyltlu-eonine Mthr L-a-methyltryptophan Mtrp L-a-methyltyrosine Mtyr L-a-methylvaline Mval L-N-methylhomophenylalanine Nmhphe N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)glycine 1-carboxy-l-(2,2-diphenyl- Nmbc L-O-methyl serine Omser ethylamino)cyclopropane L-O-methyl homoserine Omhser Non-standard amino acids which may be used include conformationally restricted analogues, e.g. such as Tic (to replace F), Aib (to replace A) or pipecolic acid (to replace Pro).
Analogues also include molecules to which additional conlponents have been added. This includes precursors of the anchoring disruption molecules or binding partner mimics or their peptidomimetics which may optionally be processed to yield the. anchoring disruption molecule or binding partner mimic or peptidomimetic.
Additional moieties may also be added to provide a required function, e.g. a moiety may be attached to assist or facilitate entry of the molecule into the cell.
Peptidoinimetics and analogues such as those exemplified above may be prepared by chemical synthesis or where they retain amino acids, during synthesis of the polypeptide or by post production modification, using techniques which are well known in the art. Synthetic techniques for generating peptidomimetics from a known polypeptide are well known in the art.
As mentioned above, an anchoring disruption molecule or binding partner mimic will alter the SERCA2 mediated PKA type II signalling pathway, when administered to a cell. The SERCA2 mediated PKA type II signalling pathway may be up or down regulated, i.e. signalling may be increased or reduced.
The "PKA type II signalling pathway" as referred to herein refers to a series of signalling events in which PKA type II is activated (or not), resulting in increased (or reduced) kinase activity of this enzyine. This signalling pathway is intended to include molecular events from activation of PKA type II to end effects such as described previously, e.g. phosphorylation of phospholamban. Preferably the invention is concerned with PKA type IIa or PKA type IIp, especially preferably PKA type IIa. "SERCA2 mediated PKA type II signalling" refers to a series of signalling events in which PKA type II is activated (or not) resulting in phosphorylation of phospholaniban (or not) which in turn activates SERCA2, preferably SERCA2a, (or not). "PKA type II signalling that regulates SERCA2 activity" refers to the PKA type II signalling pathway which is responsible for regulation of SERCA2 activity.
In another aspect, a PKA type I signalling pathway may be engineered to signal to PLB and SERCA2.

As referred to herein the phrase "altering the activity of the PKA type II
signalling pathway" or the SERCA2 pathway is intended to mean the alteration of one or more signalling elements in the pathway (e.g. to affect its enzymatic or other functional properties) which affects downstream signalling events, specifically the activity of SERCA2. "Alteration" of the signalling elements refers to the ability to form interactions with other molecules, e.g. protein-protein interactions. The ultimate effect is to down-regulate or up-regulate downstream events which typify PKA type II signalling, specifically the activity of SERCA2. Alteration of said signalling pathway may be assessed by determining the extent of activation of a molecule involved in said pathway, e.g. phosphorylation of a relevant molecule as described previously, or examination of levels of molecules whose levels are dependent on the activity of said pathway. For use in particularly clinical conditions, down-regulation or up-regulation of the PKA type II signalling pathway, i.e. enhancing or reversing the effects of cAMP activation, e.g. to regulate the cardiovascular system, is required depending on whether the clinical condition is typified by elevated or suppressed PKA type- II signalling and/or would benefit from elevation or suppression of the same.
The present invention also extends to antibodies (monoclonal or polyclonal) and their antigen-binding fragments (e.g. F(ab)2, Fab and Fv fragments i.e.
fragments of the "variable" region of the antibody, which comprise the antigen binding site) directed to the anchoring disruption molecules or binding partner mimics as defined hereinbefore, i.e. which bind to epitopes present on the anchoring disruption molecules and/or binding partner mimics and thus bind selectively and specifically to such anchoring disruption molecules and/or binding partner mimics relative to binding to other molecules such as other AKAPs and which may be used to inhibit the binding of PLB to AKAP18S or AKAP18S to PDE4D.
The invention also relates to nucleic acid molecules comprising a sequence encoding a polypeptide or peptide described above or for targetting and silencing the expression of a polypeptide described above.
The nucleic acid molecules described above may be operatively linked to an expression control sequence, or a recombinant DNA cloning vehicle or vector containing such a recombinant DNA molecule. This allows intracellular expression of the anchoring disruption molecule or binding partner mimic as a gene product, the expression of which is directed by the gene(s) introduced into cells of interest. Gene expression is directed from a promoter active in the cells of interest and may be inserted in any form of linear or circular DNA vector for incorporation in the genome or for independent replication or transient transfection/expression.
Alternatively, the naked DNA, RNA or cheinically derived and stabilized nucleic acid molecule (e.g. PNA) may be injected directly into the cell, particularly where the anchoring disruption molecule is a nucleic acid molecule such as siRNA or an antisense oligonucleotide.
Appropriate expression vectors include appropriate control sequences such as for example translational (e.g. start and stop codons, ribosomal binding sites) and transcriptional control elements (e.g. promoter-operator regions, termination stop sequences) linked in matching reading frame with the nucleic acid molecules required for performance of the method of the invention as described hereinafter.
Appropriate vectors may include plasmids and viruses (including both bacteriophage and eukaryotic viruses). Suitable viral vectors include baculovirus and also adenovirus, adeno-associated virus, herpes and vaccinia/pox viruses. Many other viral vectors are described in the art. Preferred vectors include bacterial and mammalian expression vectors pGEX-KG, pEF-neo and pEF-HA. The nucleic acid molecule may conveniently be fused with DNA encoding an additional polypeptide, e.g. glutathione-S-transferase, to produce a fusion protein on expression.
Thus viewed from a further aspect, the present invention provides a vector, preferably an expression vector, comprising a nucleic acid molecule as defined above.
Other aspects of the invention include methods for preparing recombinant nucleic acid molecules according to the invention, comprising inserting nucleotide sequences encoding the anchoring disruption molecule or binding, partner mimic into vector nucleic acid.
In order to affect the signalling pathway, anchoring disruption molecules or binding partner mimics as described hereinbefore are conveniently added to a cell.
This may be achieved by relying on spontaneous uptake of the anchoring disruption molecule or binding partner mimic into the cells or appropriate carrier means may be provided. Exogenous peptides or proteins may thus be introduced by any suitable technique known in the art such as in a liposome, niosome or nanoparticle or attached to a carrier or targeting molecule (see hereinafter). Thus for example, as discussed above, the anchoring disruption molecule or binding partner mimic may be tagged with a suitable sequence that allows the anchoring disruption molecule or binding partner mimic to cross the cell menibrane. An example of such a tag is the HIV tat sequence, a stretch of e.g. 11 arginines or the attachment of stearic acid.
It will be appreciated that the level of exogenous molecules introduced into a cell will need to be controlled to avoid adverse effects. The anchoring disruption molecule or binding partner mimic may be transported into the cell in the fomi of the polypeptide or in the form of a precursor, e.g. with an attached moiety to allow passage across the cell membrane (e.g. via endocytosis, pinocytosis or macro pinocytosis) or for cell targeting or in a form which is only activated on conversion, e.g. by proteolysis or transcription and translation.
The anchoring disruption molecule or binding partner mimic may be administered to a cell by transfection of a cell with a nucleic acid molecule encoding the anchoring disruption molecule or binding partner mimic. As mentioned above, the present invention thus extends to nucleic acid molecules comprising a sequence which encodes the anchoring disruption molecule or binding partner mimic described herein and their use in methods described herein. Preferably said nucleic acid molecules are contained in a vector, e.g. an expression vector.
Nucleic acid molecules of the invention or for use in the invention, preferably contained in a vector, may be introduced into a cell by any appropriate means. Suitable transformation or transfection techniques are well described in the literature. A variety of techniques are known and may be used to introduce such vectors into prokaryotic or eukaryotic cells for expression. Preferred host cells for this purpose include insect cell lines, eukaryotic cell lines or E. coli, such as strain BL21/DE3. The invention also extends to transformed or transfected prokaryotic or eukaryotic host cells containing a nucleic acid molecule, particularly a vector as defined above.
A further aspect of the invention provides a method of preparing an anchoring disruption molecule or binding partner mimic of the invention as hereinbefore defined, which comprises culturing a host cell containing a nucleic acid molecule as defined above, under conditions whereby said anchoring disruption molecule or binding partner mimic is expressed and recovering said molecule thus produced. The expressed anchoring disruption molecule or binding partner mimic product forms a further aspect of the invention.
The invention also extends to an anchoring disruption molecule or binding partner mimic encoded by a nucleic acid molecule as hereinbefore described.
This may be produced by expression of a host cell as described above.
Cells containing anchoring disruption molecules or binding partner mimics of the invention, introduced directly or by expression of encoding nucleic acid material form further aspects of the invention.
Nucleic acid molecules which may be used according to the invention may be single or double stranded DNA, cDNA or RNA, preferably DNA and include degenerate sequences. Ideally however genomic DNA or cDNA is employed.
Anchoring disruption molecules or binding partner mimics as described herein may be used to alter SERCA2 mediated PKA RII signalling.
Thus in a further aspect, the present invention provides a method of altering the SERCA2 mediated PKA type II signalling pathway in a cell by administration of an anchoring disruption molecule or binding partner mimic (or a nucleic acid molecule encoding said anchoring disruption molecule or binding partner mimic) as defined herein. This method may be used in vitro, for example in cell or organ culture, particularly for affecting SERCA2 mediated PKA type II signalling pathways which have been activated (or not) or to reduce or increase the extent of endogenous signalling or to stimulate or suppress SERCA2 mediated PKA type II
signalling.

The method may also be used ex vivo, on animal parts or products, for example organs or collected blood, cells or tissues, particularly when it is contemplated that these will be reintroduced into the body from which they are derived. In particular, in samples in which abnormal levels of PKA type II
signalling that regulates SERCA2 activity are occurring, levels may be normalized, e.g. by inhibiting (or activating) the activity of the SERCA2 mediated PKA
type II
signalling pathway, as necessary. In such a method of treatment, the sample may be harvested from a patient and then returned to that patient.
In this context, a"sample" refers to any material obtained from a human or non-human animal, including tissues and body fluid. "Body fluids" in this case include in particular blood, spinal fluid and lymph and "tissues" include tissue obtained by surgery or other means. Such methods are particularly useful wlien the anchoring disruption molecule or binding partner mimic is to be introduced into the body by expression of an appropriate nucleic acid molecule or if the anchoring disruption molecule is itself a nucleic acid molecule.
In such methods the methods of treatment of the invention as described hereinafter comprise the initial step of obtaining a saniple from an individual or subject, contacting cells from said sample with an anchoring disruption molecule or binding partner mimic (or a nucleic acid molecule encoding an anchoring disruption molecule or binding partner mimic) of the invention and administering said cells of said sample to the individual or subject. The step of contacting refers to the use of any suitable technique which results in the presence of said anchoring disruption molecule or binding partner mimic in cells of the sample.
The method may also be used in. vivo for the treatment or prevention of diseases in which abnormal SERCA2 PKA type II signalling occurs or in which alteration of such signalling would produce a positive effect and this will be discussed in more detail below.
As described previously the methods of altering SERCA2 mediated PKA
type II signalling have utility in a variety of clinical indications in which abnormal PKA type II signalling that regulates SERCA2 activity is exhibited.
Alternatively the signalling may be at nonnal levels but alleviation of disease progression or symptoms may be achieved by reducing or elevating the levels of SERCA2 mediated PKA type II signalling.
Abnormal signalling may be elevated or reduced relative to a normal cell, sample or individual. Diseases or conditions in which reduced signalling occurs (i.e.
hypoactivation) include cardiovascular diseases such as heart failure.
Diseases or conditions in which elevated signalling occurs (i.e. hyperactivity) include hypertension. P-adrenergic signalling in the heart may be modified with molecules as described herein. Hypoactivity may be treated with the binding partner mimics described herein and hyperactivity may be treated with the anchoring disruption molecules described herein. P-adrenergic signalling may be reduced to avoid post-infarction heart failure by using anchoring disruption molecules of the invention as cardioprotective agents. Furthermore, PLB phosphorylation may be increased in states wliere PLB is hypo-phosphorylated by mimics to improve progressive cardiac contractile dysfunction in dilated cardiomyopathy.
Since PKA type II is a key regulator of (3-adrenergic signalling, diseases wliich exhibit impaired or elevated (3-adrenergic signalling or would benefit from such modification of the same are particular targets for this treatment.
Specifically, the anchoring disruption molecules or binding partner mimics which abolish or enhance the function of PKA type II may be used to produce pharmaceutical preparations to treat the above described diseases or disorders.
Thus, the anchoring disruption molecules or binding partner mimics may be used to treat or prevent diseases or disorders typified by aberrant PKA type II
signalling that regulates SERCA2 activity or disorders or diseases in which SERCA2 mediated PKA type II signalling has been implicated or disorders or diseases which would be alleviated (e.g. by a reduction in symptoms) by reducing or elevating SERCA2 mediated PKA type II signalling.
The invention further relates to an anchoring disruption molecule or binding partner mimic or their encoding nucleic acid molecule as defined herein or pharmaceutical compositions containing such molecules for use in medicine.
Specifically, the anchoring disruption molecules or binding partner mimics which affect SERCA 2 mediated PKA type II signalling may be used to produce pharmaceutical preparations.
The invention further relates to the use of an anchoring disruption molecule or binding partner mimic as defined herein in the manufacture of a medicament for treating or preventing diseases or disorders with abnormal PKA type II
signalling that regulates SERCA2 activity or which would benefit from a reduction or elevation in the levels of SERCA2 mediated PKA type II signalling, e.g.
cardiovascular diseases, including hypertension or post-infarction heart failure.
The invention also relates to a method of treating or preventing such diseases or disorders comprising the step of administering an effective amount of an anchoring disruption molecule or binding partner mimic as defined herein to a human or non-human animal, e.g. a mammal in need thereof.
Preferred mammals are humans.
The anchoring disruption molecules or binding partner mimics as described herein may therefore be formulated as pharmaceutical compositions in which the anclioring disruption molecule or binding partner mimic may be provided as a pharmaceutically acceptable salt. Pharmaceutically acceptable salts may be readily prepared using counterions and techniques well known in the art.
The invention thus further extends to pharmaceutical compositions comprising one or more anchoring disruption molecules or binding partner mimics (e.g. nucleic acid molecules, peptides or proteins, antisense oligonucleotides, siRNA, ribozymes or antibodies as defined above) and one or more pharmaceutically acceptable excipients and/or diluents. By "pharmaceutically acceptable" is meant that the ingredient must be compatible with other ingredients in the composition as well as physiologically acceptable to the recipient.
The active ingredient for administration may be appropriately modified for use in a pharmaceutical composition. For example when peptides are used these may be stabilized against proteolytic degradation by the use of derivatives such as peptidomimetics as described hereinbefore. The active ingredient may also be stabilized for example by the use of appropriate additives such as salts or non-electrolytes, acetate, SDS, EDTA, citrate or acetate buffers, mannitol, glycine, HSA
or polysorbate.
Conjugates may be formulated to provide improved lipophilicity, increase cellular transport, increase solubility or allow targeting. Conjugates may be made terminally or on side portion of the molecules, e.g. on side chains of amino acids.
These conjugates may be cleavable such that the conjugate behaves as a pro-drug.
Stability may also be conferred by use of appropriate metal complexes, e.g.
with Zn, Ca or Fe.
The active ingredient may be formulated in an appropriate vehicle for delivery or for targeting particular cells, organs or tissues. Thus the pharmaceutical compositions may take the form of microemulsions, liposomes, niosomes or nanoparticles with which the active ingredient may be absorbed, adsorbed, incorporated or bound. This can effectively convert the product to an insoluble form. These particulate forms have utility for transfer of nucleic acid molecules and/or protein/peptides and may overcome both stability (e.g. enzymatic degradation) and delivery problems.
These particles may carry appropriate surface molecules to improve circulation time (e.g. serum components, surfactants, polyoxamine908, PEG
etc.) or moieties for site-specific targeting, such as ligands to particular cell borne receptors.
Appropriate tecluiiques for drug delivery and for targeting are well known in the art and are described in W099/62315. Clearly such methods have particular applications in the methods of the invention described herein.
Such derivatized or conjugated active ingredients are intended to fall within the definition of anchoring disruption molecules or binding partner mimics which are described herein.

Pharannaceutical compositions for use according to the invention may be formulated in conventional manner using readily available ingredients. Thus, the active ingredient may be incorporated, optionally together with other active substances as a coinbined preparation, with one or more conventional carriers, diluents and/or excipients, to produce conventional galenic preparations such as tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions (as injection or infusion fluids), emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments, soft and hard gelatin capsules, suppositories, sterile injectable solutions, sterile packaged powders, and the like. Biodegradable polymers (such as polyesters, polyanhydrides, polylactic acid, or polyglycolic acid) may also be used for solid iniplants. The compositions may be stabilized by use of freeze-drying, undercooling or Permazyme.
Suitable excipients, carriers or diluents are lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, calcium carbonate, calciuni lactose, corn starch, aglinates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water syrup, water, water/ethanol, water/glycol, water/polyethylene, glycol, propylene glycol, metliyl cellulose, methylhydroxybenzoates, propyl hydroxybenzoates, talc, magnesium stearate, mineral oil or fatty substances such as hard fat or suitable mixtures thereof.
Agents for obtaining sustained release formulations, such as carboxypolymethylene, carboxymethyl cellulose, cellulose acetate phthalate, or polyvinylacetate may also be used. The compositions may additionally include lubricating agents, wetting agents, viscosity increasing agents, colouring agents, granulating agents, disintegrating agents, binding agents, osmotic active agents, emulsifying agents, suspending agents, preserving agents, sweetening agents, flavouring agents, adsorption enhancers, e.g. for nasal delivery (bile salts, lecithins, surfactants, fatty acids, chelators) and the like. The compositions of the invention may be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration of the patient by employing procedures well known in the art.
The active ingredient in such conipositions may comprise from about 0.01%
to about 99% by weiglit of the formulation, preferably from about 0.1 to about 50%, for exanlple 10%.
The invention also extends to pharmaceutical compositions as described above for use as a medicament.
In methods of the invention, anchoring disruption molecules or binding partner mimics should be used at appropriate concentrations such that a significant number of the relevant binding partners' interactions, are prevented or where mimics are used, such that SERCA2 mediated PKA II signalling is increased relative to untreated samples or individuals.
Preferably the pharmaceutical composition is formulated in a unit dosage form, e.g. with each dosage containing from about 0.1 to 500mg of the active ingredient. The precise dosage of the active compound to be adniinistered and the length of the course of treatment will of course, depend on a number of factors including for example, the age and weight of the patient, the specific condition requiring treatment and its severity, and the route of administration.
Generally however, an effective dose may lie in the range of from about 0.01mg/kg to 20mg/kg, depending on the animal to be treated, and the substance being administered, taken as a single dose.
For methods in which the anchoring disruption molecule or binding partner mimic or their encoding molecule is administered to a sample ex vivo to be returned to the body, suitable dosages of said anchoring disruption molecule are 25-100nM or lower, such as 10-50nM, 5-25nM, 1-5nM or 0.2-5nM.
The administration may be by any suitable method known in the medicinal arts, including for example oral, parenteral (e.g. intramuscular, subcutaneous, intraperitoneal or intravenous) percutaneous, buccal, rectal or topical administration or administration by inhalation. The preferred administration forms will be administered orally, rectally or by injection or infusion. As will be appreciated oral administration has its limitations if the active ingredient is digestible. To overcome such problems, ingredients may be stabilized as mentioned previously and see also the review by Bernkop-Scluiurch, 1998, J. Controlled Release, 52, p1-16.
It will be appreciated that since the active ingredient for performance of the invention takes a variety of forms, e.g. oligonucleotide, antibody, ribozyme, nucleic acid molecule (which may be in a vector) or polypeptide/peptide, the form of the composition and route of delivery will vary. Preferably however liquid solutions or suspensions would be employed, particularly e.g. for nasal delivery and administration will be systemic.
As mentioned above, these pharmaceutical compositions may be used for treating or preventing conditions in which PKA type II signalling which regulates SERCA2 is abnormal, in particular when the activity of this pathway is elevated or reduced. Furthennore, anchoring disruption may be beneficial also when the signalling is normal in cases when the heart is damaged and needs to be protected from adrenergic stimuli and pacing.
Thus, viewed from a further aspect the present invention provides a method of treating or preventing diseases or disorders exhibiting abnormal PKA type II
signalling that regulates SERCA2 activity or which would benefit from a reduction or elevation in the levels of SERCA2 mediated PKA type II signalling, preferably as described hereinbefore, in a human or non-human animal wherein a pharmaceutical composition as described hereinbefore is administered to said animal.
Alternatively stated, the present invention provides the use of a pharmaceutical composition as defined above for the preparation of a medicament for the treatment or prevention of diseases or disorders exhibiting abnormal PKA
type II signalling that regulates SERCA2 activity or which would benefit from a reduction or elevation in the levels of SERCA2 mediated PKA type II
signalling, preferably as described hereinbefore.
As referred to herein a "disorder" or "disease" refers to an underlying pathological disturbance in a symptomatic or asymptomatic organism relative to a normal organism, which may result, for example, from infection or an acquired or congenital genetic imperfection. A "condition" refers to a state of the mind or body of an organism which has not occurred through disease, e.g, the presence of a moiety in the body such as a toxin, drug or pollutant.

As referred to herein "cardiovascular disease" refers to a disease or disorder of the heart or vascular system which may be congenital or acquired and enconipasses diseases such as congenital heart failure, hypertension, myocardial infarction, congestive heart failure, dilated cardiomyopathy, atherosclerotic peripheral arterial disease and alveolar hypoxia leading to pulmonary hypertension and right ventricle failure. Preferred conditions for treatment according to the invention are as described previously.
Subjects whicli may be treated are preferably mammalian, preferably humans and companion or agricultural animals such as dogs, cats, monkeys, horses, sheep, goats, cows, rabbits, rats and mice.
As used herein, "treating" refers to the reduction, alleviation or elimination, preferably to normal levels, of one or more of the syrnptoms of said disease, disorder or condition which is being treated, e.g. normal blood pressure, cardiac function, etc., relative to the symptoms prior to treatment. Where not explicitly stated, treatment encompasses prevention. "Preventing" refers to absolute prevention, i.e.
maintenance of normal levels with reference to the extent or appearance of a particular symptom (e.g. hypertension) or reduction or alleviation of the extent or timing (e.g. delaying) of the onset of that symptom.
The method of treatment according to the invention may advantageously be combined with administration of one or more active ingredients which are effective in treating the disorder or disease to be treated.
Thus, pharmaceutical compositions of the invention may additionally contain one or more of such active ingredients.
In a further aspect, the present invention provides methods and/or compositions which combine one or more anchoring disruption molecules or binding partner mimics as described herein with compounds that improve the tolerability of the active ingredient, especially during long term treatment.
Typical compounds include antihistamine and proton pump inhibitors.
According to a yet further aspect of the invention we provide products containing one or more anchoring disruption molecules or binding partner mimics as herein defined and one or more additional active ingredients as a combined preparation for simultaneous, separate or sequential use in human or animal therapy.

The following Examples are given by way of illustration only in which the Figures referred to are as follows:

Figure 1 shows PKA-RII binding proteins in sarcoplasmatic reticulum (SR) from rat heart. RII binding was detected by a solid-phase binding assay using 32P-radiolabeled RIIa (R-overlay) as a probe in absence (upper panel) or presence (lower panel) of 500 nM the Ht31 anchoring inhibitor protein. Molecular weight standards are indicated (Benchmark, Invitrogen). Calsequestrin which is a major Caz+ binding protein of SR was used as an SR marker and indicator for the quality of the fractions (lower panel);
Figure 2 shows the identification of a RII-binding protein of approximately 50 kDa in the anti-AKAP 188 precipitation and in the total cell lysate isolated from rat heart analysed by R-overlay. Recombinant AKAP18S protein and rabbit IgG was used as a positive control negative control, respectively. PKA-reg refers to PKA R
subunit detected in overlay assay;

Figure 3 shows the identification of AKAP188 in rat heart SR (fractions 11-13) and the presence of the catalytic (PKA-C) subunit and the different regulatory subunits (RIa, RIIa and RII(3) in all fractions. Pep refers to the use of peptide antigen to block antibody. Calsequestrin was used as an SR marker and indicator for the quality of the fractions (data not shown);
Figure 4 shows the presence of the Ca2+-activated Ca2+ release channels ryanodine receptors 2 (RyR2) and Ins(1,4,5)P3 receptor (IP3R), the ATP-dependent Ca2+
pump (SERCA2a) and pentamer and monomer forms of phospholamban (PLB) in SR.
Calsequestrin was used as an SR marker and indicator for the quality of the fractions (data not shown);

Figure 5 shows colocalization (yellow merge) of the AKAP 18b (red) with a-actinin (green), RIIa (green), SERCA2a (green) and PLB (green) by immunofluorescence analysis of rat heart tissue using monoclonal and polyclonal antibodies (four upper most panels). Two lower most panels shows colocalization (yellow merge) of SERCA2a (red) with a-actinin (green) and PKA-RIIa (green) analysed by immunofluorescence analysis of rat heart tissue. The relative fluorescence intensity in each panel was measured and is shown at the right;

Fiure 6 shows colocalization (yellow merge) of a-actinin (red) and AKAP18S
(red) by immunofluorescence analysis of rat neonatal cardiac myocytes;

Figure 7 shows copurification of AKAP 185 and SERCA2a together with PKA-RIta and PKA-C in a cAMP pull down experiment using Rp-8-AHA-cAMP agarose beads (antagonist that does not dissociate PKA C). Negative control with free cAMP present upon binding is shown at right;
Figure 8 shows coimmunoprecipitation of PLB pentamer (upper band) and monomer (lower band) with AKAP 185 from SR (rat heart) using polyclonal antibodies against AKAP 185. SR lysate and rabbit IgG was used as positive and negative control, respectively;
Figure 9 shows results of immunoprecipitation experiments with the antibodies indicated on total cell lysate from rat heart, followed by SDS-PAGE and western blotting using an antibody against PLB. PLB coprecipitated with AKAP188 but not with preimmune serum or a-actinin. Lysate and immunoprecipitation of PLB using anti-PLB were used as positive controls;

Fi ug re 10 shows identification of a dynamic AKAP18S binding site in PLB. In an overlay experiment, GST-AKAP18S bound PLB (synthesized on membrane as 20 mers) (upper panel), but not when PLB contained a phosphorylated Serine (at residue 16 in full length PLB) (lower 2 panels). GST protein was used as a negative control in both experiments;
Fi ug: re 11 shows substitution with either a proline (P) (upper panel) or alanine (A) (lower panel) in the PLB sequence to identify amino acids important for AKAP

binding. The bar diagram at the right shows the relative affinity of the PLB
derivatives with a higher affinity than the wild-type PLB sequence;
Figure 12 shows epitope mapping of the monoclonal PLB antibody by peptide array technology and immunoblotting. The antibody epitope is within the same region as the AKAP 186 binding site;
Figure 13 shows analysis of the AKAP18S binding site in PLB. A GST-AKAP18S
overlay on a two dimensional array of 400 PLB derivatives (spotted as 20-mer peptides) in which each residue in the PLB sequence (given by their single-letter codes above the array) was replaced with residues having every possible side chain (given by their single-letter codes to the left of the array). The two first rows correspond to the native PLB sequence. White circles denote peptides in the array that correspond to the native PLB sequence. GST overlay was performed as a negative control (data not shown);
Figure 14 shows analysis of the minimal AKAP 186 binding site in PLB. A GST-AKAP18S overlay on a two dimensional array of 260 PLB derivatives (spotted as 13-mer peptides) in which each residue in the PLB sequence (given by their single-letter codes above the array) was replaced with residues having every possible side chain (given by their single-letter codes to the left of the array). The two first rows correspond to the native PLB sequence. White circles denote peptides in the array that correspond to the native PLB sequence. GST overlay was performed as a negative control (data not shown). The experiments identify amino acids in PLB
important for AKAP 186 binding;
Fi ug re 15 shows that AKAP188 binds in a dynamic fashion to both a 13-mer peptide and a 20-mer peptide of PLB and also when PLB contains the R9C mutation (an inherited mutation in human dilated cardiomyopathy, Schmitt et al., 2003, Science, 299, p1410-1413). The on/off binding is regulated by phosphorylation of a serine residue in the peptides (serine at position 16 in full length PLB);
Figure 16 shows that AKAP18S is not able to bind to PLB(R9C) after incubation with the PKA-C subunit, indicating that the binding site is blocked by PKA-C;
Figure 17 shows down regulation of Ser16 PLB phosphorylation after anchoring disruption using the PKA type II specific peptide, super-AKAP-is. Super-AKAP-is disrupts the PKA-AKAP 18 interaction;
Fig-ure 18 shows representative kinetics of Ca2+ re-uptake in the sarcoplasmic reticulum (SR). Neonatal cardiac myocytes were transfected with the FRET-based Ca2+ sensor cameleon targeted to the SR and the response to a 10 mM caffeine pulse (Is, arrow) was recorded in control cells (filled squares) or cells pre-treated with 50 gM peptide (R R A S T I E M P Q Q R R R R R R R R R R R) for 40 min and/ or Ne 10 mM and IBMX 100 mM for 20 min, as indicated;
Figure 19 shows the averages of time constant i(tau), calculated by fitting the recovery phase in the curve of Ca2+ re-uptake as shown in Figure 18 by using the exponential function f(t) =Eni=1 Ai e-t/ti + C. For each sample n > 20 independent cells were used. * p = 0.02, ** p = 0.001, *** p< 6.16226e-10, Student's t-test;

Fi ruge 20 shows delineation of the minimal binding region of PLB, RRASTIE, by peptide array and AKAP 188 overlay in vitro;
Fi ug re 21 shows a schematic illustration of a construct that potentially can be used to enhance PKA-phosphorylation of PLB. A high affinity PKA type II or type I
binding sequence is coupled to the SR targeting domain of PLB. Such a construct should target PKA to SR with high efficiency and PKA will successively phosphorylate PLB. Optinally, two glycine spacers (ten glycine residues) are included as spacers between the two functional domains and a myc tag (or another tag) could be added in between. In some cases the high affinity PKA type I
binding sequence MEME3 (LEQYANQLADQIIKEATE) might be exchanged with super-AKAP-is;
Figare 22 shows that disruption of PKA anchoring with the PKA anchoring disruptor peptide L314E or inhibition of PKA inhibits (3-adrenoreceptor-mediated phosphorylation of phospholamban (PLB) in neonatal cardiac myocytes.
Incubations were carried out in the absence or presence of the PKA anchoring disruptor peptide L314E (100 M, 30 min preincubation) or the PKA inhibitor H89 (30 M, 30 min preincubation). Cells were next treated with isoprotenerol ((3-AR agonist). At the indicated times cells were harvested and phospho-phospholamban phosphorylated by PKA at Serl6, and total phospholamban were detected by Western blotting.
Shown is one representative experiment (upper panel). Signal was densitometrically analysed (n=3 independent experiments, mean SD, lower panel);
Figure 23 shows knockdown of AKAP188 using selective RNA; measured by FACS
analysis. HEK293 cells co-expressing selective AKAP18b-RNA; and AKAP18S-YFP or AKAPI8S-YFP and vector without (w/o) RNA; were subjected to FACS
analysis. As further controls, the cells were transfected with the indicated (+) combinations of vectors (mean SD, n=3 independent experiments);
Figure 24 shows knockdown of AKAP186 using selective RNA;. Detection of AKAP 185-YFP in HEK293 cells expressing the indicated vectors or combinations thereof using AKAP185-specific antibody A1884 by Western blotting. Right panel, densitometric analysis of the signals obtained in the Western blot depicted in the left panel;

Figure 25 shows that disruption of the AKAP18S-phospholamban interaction alters Ca2+ reuptake into the SR of cardiac myocytes. Rat neonatal cardiac myocytes were left untreated or incubated with the AKAPI8S -phospholamban disruptor peptide S-PLB-1 (50 M, 30 min) stearic acid-VQYLTRSAIRRASTIEMPQQARQNLQ-NH2, amino acid residues 4-29 in rat phospholamban (protein data base entry XP-579462). During the last 10 nlin of the incubation the cells were loaded with Fluo-4-AM (1 M) by adding the fluophore into the medium. Line scans were performed using a laser scanning microscope (1 line scan/ 20 ms, total of 10,0001ine scans).
Where indicated isoproterenol (Iso) was added to the incubation chamber. Line scans were taken 10 and 35 seconds after isoprotenerol treatment;
Figure 26 shows that PLB is precipitated with AKAP 185 in HEK293 transfected cells. HEK293 cells were grown in petri dishes (40 mm diameter) and transfected with plasmids encoding AKAP 188-YFP, PLB-CFP or with both. The samples were applied to SDS-PAGE and Western blot analysis as indicated. Preimmune serum 1854 was used as negative control;
Fig e 27 shows the PLB binding site in AKAP 18&. Rat AKAP 18S sequence was synthesized on membrane as 20-mers and with 3 amino acids offset. Binding to PLB
was analysed in an overlay experiment using biotinylated-PLB (biotin-MEKVQYLTRSAIRRASTIEM). The PLB binding sequence in AKAP18S is shown in dark shading. The lighter shaded box shows the RII binding domain;
Figure 28 shows knockdown of AKAP 188 using RNAi303 and RNAi700.
RNAi directed against both AKAP18S and AKAP18y was generated. HEK293 cells were left untransfected, co-transfected with one of the two and AKAP18S-YFP, or with empty RNAi vector and AKAP18S -YFP, or with a vectors encoding GFP and RNA;303 or RNA;700. The cellular fluorescence was evaluated by FACS analysis.
The mean fluorescences determined in two independent experiments are shown;
Figure 29 shows copurification of AKAP 188 (left lane: cAMP agarose) from adult rat heart lysates in a pull down experiment using Rp-8-AHA-cAMP agarose beads (antagonist that does not dissociate PKA). As a positive control recombinant AKAP 185 (lane: rec. AKAP 185) is shown; as a negative control the pull down experiment was carried out in the presence of cAMP which prevents association of AKAP 188 with the cAMP agarose beads;

Fi re 30 shows AKAP188 overlay binding assay with an array of immobilized PLB peptides as indicated in the absence (left) or presence (right) of the PLB-derived disruptor peptide in solution. As can be seen, AKAPI8S-PLB disruptor peptide competed with binding of AKAP18S to PLB;
Figure 31 shows the effect of the PLB-derived disruptor peptide on isoproterenol-induced phospholamban Ser16 phosphorylation. Mouse neonatal cardiac myocytes were treated with or without Arg9_> >-PLB peptide (50 M) for 30 min before stimulation with isoproterenol (0.1 M) for 5 min as indicated. Scrambled peptide (Argi i-scramPLB) was used as negative control (data not shown). pSer16-PLB
(upper panel) immunoblots are shown. Calsequestrin blot is shown as control.
Phosphorylated Ser16-PLB was quantified by densiometry (bottom graph). Error bars represent the SEM from n=2-3 independent experiments;
Figure 32 shows siRNA-mediated knock down of AKAP 188 inhibits the adrenergic effect on Ca2+-reabsorption into sarcoplasmic reticulum. Efficacy of knockdown was tested by transfecting AKAP 188 and siRNA into a keratinocyte cell line, HaCaT, together with a FLAG-tagged control for transfection efficacy (upper panel).
Kinetics of Ca2+ release and re-uptake in the SR of cardiac myocytes transfected with the YC6.2 sensor alone (squares, middle and bottom panels) or in combination with AKAP 185 siRNA (middle panel, circles) or control siRNA (bottom panel, triangles) subsequent to treatment with 50 M BHQ. The arrow indicates the time point at which 10 M NE was added to cells stimulated with the beta-agonist (filled symbols, no NE, open symbols with NE). Note: time scale differs at break-point.
The averages of time constants ti were calculated as before (right). For each sample n=l 1-12 independent cells were analysed (p < 0.025, Student's t-test);
Figure 33 shows deletional mapping of the phospholainban binding domain in AKAP 18S by use of GST-AKAP 188 truncated proteins in peptide array overlay experiments of PLB (A) and coexpression and co-immunoprecipitation of PLB-GFP
and AKAP18S truncated proteins in HEK293 cells;

Figure 34 shows colocalization of the AKAP 188/PLB/SERCA2 complex in cardiomyocyte sarcoplasmic reticulum by immunogold staining and electron microscopy. Neonatal rat hearts were obtained and processed for immunogold electron microscopy as described in "Experimental Procedures". Immunogold staining was performed using secondary antibodies labeled with gold particle of two sizes to allow dual staining. Co-staining of PLB and SERCA2 labeled with 15 and nm gold grains respectively is shown (upper left), SERCA2 and AKAP 185 were labeled with 10 and 15 nm gold grains (upper riglit) and PLB and AKAP 185 were 5 labeled with 10 and 15 nm gold grains respectively (two bottom panels).
Scale bars, 1 rn. The magnified views show representative areas where the indicated proteins co-localize; and Figure 35 shows the a]ignment of rat AKAP 18a, rat AKAP 180, and rat AKA.P 18S
with human AKAP 18y amino acid sequences, showing that the AKAP 185 and AKAP18y splice variants both cover the regions 124-138 and 201-220 where PLB
binds.

EXAMPLES

Methods Autospot Peptide Array. Peptide arrays were synthesized on cellulose paper by using Multipep automated peptide synthesizer (INTAVIS Bioanalytical Instruments AG, Koeln, Germany) as described (Frank, R., 1992, Tetrahedron 48, 123-132).
Protein expression and purification. AKAP188-GST was expressed in E.cola B121 by IPTG induction. The AKAP 18d-GST containing pellet was incubated in lysis buffer (10 mM MOPS, pH 6.5, 100 mM NaCI, added protease inhibitors) and sonicated (UP400s Ultraschall processor) for 1 minute in three intervals at 0 C.
After centrifugation, the supernatant was incubated with glutathione-agarose beads (Sigma) and rotated overnight at 4 C. The AKAP 1 8d-GST protein bound to the beads was washed two times in lysis buffer thereafter two times in the washing buffer (5 mM MOPS, pH 6.5, 0.5 M NaCI) and finally two times in lysis buffer.
The AKAP18d-GST protein was eluted in 20 mM L-Glutathione (reduced, in 50 mM
Tris-HCl (pH 8.4) 150 mM NaCI) at 4 C ON before dialysis into PBS overnight.
Immunoblot analysis. Cell lysates, immunocomplexes, were analyzed on a 4-20%
PAGE and blotted onto PVDF membranes. The filters were blocked in 5% non-fat dry milk in TBST for 30 minutes at RT, incubated 1 hour at RT or overnight at with primary antibodies, washed four times 5 minutes in TBST with 0.1 % Tween-and incubated with a horseradish-peroxidase-conjugated secondary antibody.
Blots were developed by using Supersignal West Dura Extended Duration Substrate or Supersignal West Pico substrate (Pierce).

Antibodies. PLB or AKAP 1 8d were immunoprecipitated with monoclonal (Upstate) or polyclonal (Biogenes, Berlin, Germany; Henn et al., 2004, supra) antibodies at a 4 g ml-1 or 5-10 l/ml of lysate dilution, respectively. Monoclonal antibodies against human RIa, RIIa and RII(3 (Transduction laboratories) were used at a 0.5 g ml-I
dilution for Western blotting. Polyclonal antibodies against human Ca (Santa Cruz Biotechnology), Calsequestrin (Upstate), Serca2a and IP3R-II (Santa Cruz) were used at a 1 gg m1"1 dilution for Western blotting. Monoclonal antibodies against RyR
(Affinity BioReagents) and PLB (Upstate) were used at a 1 g m1"1 dilution for Western blotting. Polyclonal antibodies against phospho-PLB (Badrilla), GST
(Amersham Pharmacia Biotech) and Biotin (Abcain) were used at a 1:5000 dilution for Western blotting. HRP-conjugated anti-mouse or anti-rabbit IgGs were used as secondary antibodies at a 1:5000 dilution (Jackson Imnzunoresearch).

Monoclonal mouse antibodies directed against a-actinin (clone EA-53) were purchased from Sigma, against SERCA2a (clone 2A7-Al) from Alexis Biochemicals. An anti-phospho-phospholamban serine 16 antibody was from Upstate Technolgy.

Cell cultures and transient transfections. The human keratinocyte cell line HaCaT
was cultured in serum-free keratinocyte medium (Gibco BRL) supplemented with 2.5 ng/ml epidermal growth factor, 25 g/m1 bovine pituitary extract, 100 g/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere of 5% CO2. The cell line was regularly passaged at sub-confluence and plated 1 or 2 days before transfection. HaCaT cells at 50-80% confluency were transfected with 5 g of plasmid DNA (PLB-YFP, AKAP 18S-GFP), by using lipofectamin 2000 (Invitrogen), loaded with arginine coupled SuperAKAP-IS peptide (Lygren et al, unpublished data) for 12 hours, before being stimulated and lysed after 30 hours in lysis buffer (20 mM Hepes, pH 7.5, 150 mM NaCI, 1 mM EDTA, 1% Triton X-100) witll protease inhibitors (Complete Mini, EDTA-free tablets, Roclie).
Immunoprecipitation from SR lysate. SR lysate was incubated with antibodies and protein A agarose beads (Invitrogen) ON at 4 C. Immunocomplexes were washed three times in lysis buffer (20 mM Hepes, pH 7.5, 150 mM NaCI, 1 mM
EDTA and 1% Triton) before being resolved by SDS/PAGE and detected by immunoblotting.

cAMP pulldown. SR fraction was subjected to cAMP pulldown experiment using Rp-8-AHA-cAMP agarose beads (antagonist that does not dissociate PKA, Biolog) in homogenate buffer (20 mM Hepes pH 7.4, 20 mM NaC, 5mM EDTA, 5 mM
EGTA, 0.5 % Triton X-100, 1 mM DTT, protease inhibitor). PKA-complexes were washed four times in washing buffer (10 mM Hepes pH 7.4, 1.5 mM MgC12a 10 mM
KCI, 0.1 % NP-40, 1 mM DTT, protease inhibitor) before being eluted with 75 M
cAMP.

Overlays. Interaction of spotted peptides with AKAP 18S-GST, GST, PKA-C or biotin-PLB peptide was tested by overlaying the membranes with 1 g/ml of recombinant protein or 2 g/ml peptide in TBST. Bound recombinant proteins were detected witli anti-GST or anti-biotin. The procedure and detection of signals is identical with immunoblot analysis (see above).

Heart subcellular fractionation. (Modification of Kapiloff et al, 2001, supra). Two rat hearts (Pel-freeze) were disrupted using a mortar in 20 ml Buffer B(10 mM
Hepes, pH 7.4, 1 g/ml pepstatin,l g/ml leupeptin, 1 mM AEBSF, 1 mM
benzamidine, 5 mM EDTA) with 0.32 M sucrose. Whole heart homogenate was filtered through cheesecloth, before low-speed centrifugation at 3800 g for 20 minutes. The supernatant fraction (S 1) was re-centrifuged at 100,000 g for 1 hour.
The resulting pellet (P2 fraction), containing SR, Golgi apparatus and plasma membrane, was resuspended in 2 ml buffer B and 0.32 M sucrose. Purified SR was obtained from the P2 fraction by sucrose step gradient centrifugation (8 parts 24%, 6 parts 40%, 2 parts 50% sucrose in 5 mM Hepes buffer) at 100,000 g for 90 minutes.
Purified SR forms a layer at the interface between 24% and 40% sucrose.

Peptides.
PLB-Arg, RRASTIEMPQQ-Argl 1 Biotin-PLB, biotin-MEKVQYLTRSAIRRASTIEM
S-PLB-1, stearic acid-VQYLT RSAIR RASTI EMPQQ ARQNL Q-NH2 SuperAKAPIS-Arg, Argl I -QIEYVAKQIVDYAIHQA
(see U.K. patent application No. 0421356.7 filed on September 24, 2004, supra) L314E, stearic acid- PEDAELVRLSKRLVENAVEKAVQQY-NH2 AKAP 18d-PP, stearic acid PEDAELVRLSKRLPENAPLKAVQQY-NH2 (patent application filed with the German authorities (DE 10 2004 031 579.5:
Peptide zur Inliibition der Interaktion von Proteinkinase A und Proteinkinase A-Ankerprotein - peptides for inliibition of the interaction of protein kinase A
and A
kinase anchoring proteins). PCT application will be filed 2 a September 2005) RNA; directed against AKAP188. Oligonucleotides encoding RNAi for selective knockdown of AKAP 188 (derived from bp 18-3 8 of the AKAP 186 cDNA, RNAi AKAP18S, sequence see below) was cloned into the Block-it inducible H1 lentiviral RNAi system, Version B (Invitrogen, Karlsruhe, Germany). For this purpose an inducible RNAi entry vector was generated as follows: The oligonucleotide sequences listed below were annealed to form double stranded oligonucleotides (ds oligo) and cloned into the vector pENTRm/H 1/TO as in the manufacturer's instructions. LacZ2.1 oligonucleotides were provided by the manufacturer for use as a control. All other oligonucleotides were ordered from Biotez (Berlin, Germany).
RNAi AKAP 188 caccgggagaaatagatgccaataacgaattattggcatctatttctccc aaaagggagaaatagatgccaataattcgttattggcatctatttctccc RNAi LacZ2.1 caccaaatcgctgatttgtgtagtcggagacgactacacaaatcagcga aaaatcgctgatttgtgtagtcgtctccgactacacaaatcagcgattt The RNAi AKAP 18S-encoding entry vector is suitable for expression in mammalian cells. In order to test its efficiency in knockdown of AKAP 188 Fluorescence Activated Cell Sorting (FACS) analysis was performed. HEK293 cells were plated into 12 well plates and co-transfected at 30-50% confluency using Transfectin reagent (Bio-Rad Laboratories, Munich, Germany) with the vector and the vector YFP-AKAP 186 or vector pEYFP-C 1(encoding YFP only) according to the manufacturer's instructions. All transfections were performed in duplicate.
The cells were then trypsinised and collected in 1% BSA. After 48 h the cells were subjected to FACS analysis (FACSsCalibur; Becton and Dickinson).

A pLenti-based expression vector was created as follows: The HI/TO RNAi cassette from the pENTRTM/H 1/TO vector was transferred into the pLenti4/BLOCK-iTTM-DEST vector via LR recombination. A control vector pLenti4-GW/H1/TO-laminSWNA expressing an shRNA targeting the Lamin A/C gene was provided in the kit. The pLenti4/BLOCK-iTTM-DEST expression construct and the ViraPowerTM
Packaging Mix were co-transfected into the HEK293FT cell line to produce a lentiviral stock. All steps were performed as in the manufacturers instructions.

In addition to the AKAPI8S-selective RNAi, RNAi directed against both AKAP18S
and AKAP 1&y was generated:

RNAi303 (Pos. 303-321 of AKAP188 cDNA) 303: aaagattacagctggaatt RNAi700 (Pos. 701-720) 701: ccaatgctctggaagaagg Cardiac myocyte preparation. Ventricles were isolated from 1-3 day old Wistar rat hearts enzymatically digested at 37 C using 0.48 mg/ml collagenase type II
(Biochrom AG, Berlin, Germany) and 0.6 mg/ml pancreatin (Sigma, Deisenhofen, Germany) and suspended in a mix of 4:1 DMEM:M199 media supplemented with 10% horse serum (Invitrogen, Gibco) and 5% fetal calf serum (Invitrogen, Gibco), and were plated for 1 h on tissue culture plates to deplete fibroblasts. The non-adherent myocytes were plated on 1%(w/v) gelatin pre-coated plates or glass cover slips pre-coated with 0.5 mg/ml Laminin (Roche, Mannheim, Germany). After 24 hs, the medium was changed to low serum medium (DMEM:M199) containing 4%
horse serum.

Calcium imaging. Rat neonatal cardiac myocytes were prepared on laminin coated glass coverslips (see above). Cells were incubated with the above listed peptides S-PLB-1 derived from PLB (50 M, 30min, 37 C). The cells were then loaded with 1 M Fluo-4, AM (Molecular Probes, Groningen, The Netherlands) and further incubated at 37 C for 10 min. The glass cover slips were transferred to a chamber containing Tyrodes solution. Line scans were performed at LSM5 10 (1 line scan per 20 ms for 10000 line scans). Isoproterenol (Sigma) was added to the chamber as indicated, Immnnohistocheniistry. Rats (R. noti~egicus) were sacrificed; the left ventricles of the hearts were removed and cut into smaller fragments using a razor blade.
The tissue was shock frozen in liquid nitrogen. It was embedded in Tissue Embedding Medium (Jung, Tissue freezing medium, Leica Instruments GmbH, Nussloch, Germany) mounted in the cryostate and cut into sections (4 m; Cryostate CM

from Lyeka) using a D-knife. While cutting the tissue temperature was -20 C, room temperature in the cryostate was -16 to -18 C. Sections (3 or 4) were transferred from the knife to each glass slide (Menzel, Superfrost Plus), and fixed with 2.5%
paraformaldehyde in sodium cacodylate buffer (100 mM sodium cacodylate and 100 mM sucrose, pH 7.4) for 30 min. After three washes with phosphate-buffered saline (PBS), cells were permeabilized in PBS containing 0.1 % Triton X-100 for 5 min and rewashed three times. Blocking was carried out in blocking solution (0.3 m145 %
fish skin gelatine/100 ml PBS) in a humidifying chamber by incubation for 45 min at 37 C. After three washes with PBS (10 min each wash), antibody diluted in blocking solution (30 l) directed against a-actinin (1:100), PKA RIIa subunits,1:100), SERCA2a (1:100), phospholamban (1:50), mouse IgG2a (1:50), anti-AKAP 18 antibodies A18S3 and A18S4 (1:100 each) or combinations of the antibodies were added. The slides were incubated in a humidifying chamber by incubation for 45 min at 37 C. The slides were washed three times (10 min each wash) with cold PBS, and subsequently incubated in a humidifying chamber for min at 37 C with Cy3-conjugated anti-rabbit IgG or anti-mouse Cy5-conjugated secondary antibody (1:600 each).

Coverslips were mounted with a mixture of glycerol (70%) and PBS (30%). 1,4-Diazabicyclo[2.2.2]octane (DABCO) (Sigma; 100 mg/ml) was added to reduce photobleaching (Oksche et al:, 1992). Alternatively, Immu-Mount (Thermo Shandon, Thermo Electron Corporation, Dreieich, Germany, cat. no. 9990402) was used for mounting according to the manufacturer's instructions. Samples were visualized by confocal microscopy on a Zeiss laser scanning microscope LSM 510 (Zeiss, Jena, Gerrnany).

Immunoprecipitation from adult rat heart tissue and Western blotting.
Phospholamban was immunoprecipitated witli specific antibodies (see above) or co-immunoprecipitated with anti-AKAP 18 antibodies 1964 and A18S4 (see above) from adult rat heart tissue (see above; Henn et al.). As a control, precipitations were carried out with the corresponding rabbit preimmune sera and mouse IgG.
Precipitates were analyzed by Western blotting.

The lower side of the left ventricle of fresh rat heart was lysed in lysis buffer (2-5 ml; 20 mM HEPES, 150 mM NaCI, 1 mM EDTA, 0,5 % Tween 20, pH 7.5) containing 8 gl/ml protease inhibitor stock solution (2 mg/mi soybean trypsin inhibitor, 1.43 mg/ml Trasylol (aprotinin), 100 mM Benzamidine, 500 M
Phenylmethanesulfonyl fluoride (PMSF); Asahi et al., 1999, J. Biol. Chem., 274, p32855-32862).

Samples (1 ml each) were homogenized in a glass/teflon homogenizer (10 strokes, 1250 rpm) and centrifuged (24,000 x g, 20 min, 4 C). Supernatants were collected and at least 10 l were retained as controls for Western Blotting. Protein A-suspension (25 l/ml) and antibody (anti-phospholamban, mouse IgG2a, each 1 l/lml of lysate; A1864 or 1964 each 5-l0 l/lml of lysate; preimmune serum corresponding to A1864, 5-10 1/ml of lysate) were added. The samples were rotated overnight at 4 C, and subsequently washed 4 times with 200 l lysis buffer.
The washing included centrifugations of 30 s at 1,000 x g. Sample buffer (3 x) containing 1,4-Dithio-DL-threitol (DTT) was added and the samples were analysed by SDS-PAGE and Western blotting.

Western blotting was carried out as described (Tamma et al., 2003, J. Cell Sci., 116, p3285-3294; Henn et al, 2004, supra). Phospholamban was detected using mouse antibody (see above; 1:2,000 dilution). As a control, mouse IgG2a were used (1:2,000 dilution). Bound primary antibodies were visualized with corresponding secondary horseradish peroxidase-conjugated anti-mouse antibodies (see above;
1:2,000 dilutions for all) and the Lumi-Imager Fl (Roche Diagnostics, Mannheim, Germany).

Immunoprecipitation of AKAP186-YFP and PLB-CFP from HEK293 cells.
HEK293 cells were grown in petri dishes (40 mm diameter) and transfected with plasmids encoding AKAP 188-YFP, PLB-CFP or with both using TransFectin Lipid Reagent (Bio-Rad) according to the manufacturer's instructions. Cells were lysed for IP after 24h of transfection. The cells were washed 4 times with PBS prior to addition of lysis buffer (10 mM K2HPO, 150 mM NaCI, 5 mM EDTA, 5 mM
EGTA, 0,5% Triton X 100, pH7.5; lml/dish) containing protease inhibitors (see above). Cells were collected using a cell scraper and briefly shaken vigorously (vortex). The lysates were centrifuged (12,000 x g, 10 min, 4 C). The supernatant was collected. An aliquot (10 l) was withdrawn and served' as control for Western Blotting. Antibodies (phospholamban, mouse IgG2a, A18S4 and the corresponding preimmuneserum were used as described for immunoprecipitations from adult rat heart) and 25 l/ml protein A-suspension (see above) were added. The samples rotated overnight at 4 C, were washed 4 times with 200 l lysis buffer (with centrifugation steps of 30 s, 1000 x g). Sample buffer (3 x) and DDT were added and the samples were applied to SDS-PAGE and Western blot analysis.

SiRNA
SiRNA sequences used for the experiment in Fig. 32 are:
AKAP185: 5' GGG AGA AAU AGA UGC CAA UAA 3' 5' AUU GGC AUC UAU UUC UCC CGC 3' control: 5' GGG ACA AAU ACA UGG CAA UAA 3' 5' A UUG CCA UGU AUU UGU CCC GC 3' Immunogold electron microscopy Immunogold electron microscopy was carried out as described (Henn V, et al. J.
Biol. Chem. 279:26654-26665, 2004). Hearts were obtained from neonatal rats, fixed (0.25 % glutaraldehyde, 3 % formaldehyde), cryosubstituted in a Leica AFS

freeze-substitution unit and embedded in LR-White. The samples were sequentially equilibrated over 4 days in methanol at temperatures gradually increasing from C to -45 C. The samples were infiltrated witli LR-White for 72 h at -20 C, and polymerised for 1 h at -20 C and 2 h at 4 C. Sections (60 nm) were cut on a Reichert Ultracut S, placed on nickel grids and blocked with glycine.

The sections were incubated with mouse anti-PLB (ABR, Affinity Bioreagents, Dianova, Hamburg Germany) and goat anti-SERCA2 antibody (ABR, Affinity Bioreagents, Dianova). The sections were washed with PBS and incubated with anti-mouse antibody and anti-goat antibody coupled to 15 and 10 nin gold grains, respectively. Co-staining of PLB and AKAP188 was perfomied with primary mouse anti-PLB and affinity-purified rabbit anti-AKAP18 8(Henn V, et al., 2004, supra) antibodies. As secondary antibodies anti-mouse and anti-rabbit secondary antibodies coupled to 10 and 15 nm gold grains were used. For co-staining of SERCA2 and AKAP 18S mouse anti-SERCA2 (ABR, Affinity Bioreagents, Dianova, Hamburg Germany) and affinity-purified rabbit anti-AKAP 18 S antibodies were employed.
As secondary antibodies anti-mouse 10 nm gold grain-coupled and anti-rabbit 15 nm gold grain-coupled antibodies were utilized. All primary antibodies were 1:100 diluted. All secondary antibodies were from Dianova and applied in 1:20 dilutions.
The sections were stained with uranyl acetate and lead citrate. The sections were analysed with a 80 kV electron microscope (902A, LEO, Obercochem, Germany) equipped with a slow scan CCD camera (Megaview III, Soft Imaging System, Germany) and the analySIS software (Soft Inlaging System).

EXAMPLE 1 - Identification of RII-binding proteins in sarcoplasmatic reticulum.
Adult rat hearts were fractionated for comparison of the constituents of different membrane compartments (Kapiloff et al., 2001, supra). SR fractions were prepared from the P2 fraction (described in methods) by sucrose gradient centrifugation (sedimentation), followed by analysis on a 4-20% PAGE and blotting onto PVDF
membrane. Fractions 4-13 were analysed for RII binding proteins by R-overlay.

labelled RII binding was detected in absence (Figure 1, upper panel) or presence (lower panel) of 500 nM Ht31 anchoring inhibitor protein and signals were detected by autoradiography. Three bands of 50-kDa, 130-kDa and 200-kDa were positive in the SR fractions (no. 9-12) after 12 hours exposure. The 200-kDa protein corresponds probably to mAKAP and the 130 kDa to a degradation product thereof.
The 50-kDa protein corresponds to the new RII binding protein. Calsequestrin which is a major Ca2+ binding protein of SR was used as an SR marker and indicator for the quality of the fractions (lower panel).

EXAMPLE 2- Identification of a RII binding protein in the AKAP188 immunoprecipitate A 50-kDa RII binding protein was identified in the AKAP18S immunoprecipitate by R-overlay (Figure 2).

EXAMPLE 3 - Identification of AKAP188 in sarcoplasmic reticulum.
Adult rat hearts were fractionated as described in Example 1 and followed by analysis on a 4-20% PAGE and blotting onto PVDF membrane. A 50-kDa band was recognized by the AKAP18S antibodies in SR (Figure 3, uppermost panel), but not if the antibody was preincubated with the peptide used for inununisation (second panel). PKA type II (RIIa and RIIp), PKA type I(RIIcx ) and PKA catalytic subunit were also present in the SR fractions. Molecular weight standards are indicated at left (Benchmark, Invitrogen).

EXAMPLE 4 - Identification of PLB and different Ca2+ channels in SR
fractions Adult rat hearts were fractionated as described in Example 1 and followed by analysis on a 4-20% PAGE and blotting onto PVDF membrane. The presence of the Ca2+-activated Ca2+ release channels ryanodine receptors 2 (RyR2) (Figure 4, uppermost panel) and Ins(1,4,5)P3 receptor (IP3R) (second upper most panel), the ATP-dependent Caz+ pump (SERCA2a) (second lower most panel) and pentamer and monomer forms of phospholamban (PLB) (lower panel) was identified in SR
using different monoclonal and polyclonal antibodies against the proteins indicated.

EXA.MPLE 5- AKAP185 co-localizes with phospholamban and SERCA2a at T-tubules in cardiac myocytes.
Left ventricles of adult rat hearts were cut into sections (4 M) and mounted on slides. The cells were fixed and permeabilized. AKAP 185 was detected using the anti-AKAP 18 8-selective antibody A1884. The indicated proteins a-actinin, RIIa subunits of PKA, SERCA2a, pliospholamban (PLB) were detected with specific primary antibodies. The results are shown in Figure 5. Primary antibodies were visualized by using Cy3- (red) and Cy5- (green) conjugated secondary antibodies.
Fluorescence signals were detected by laser scanning microscopy. The overlay of Cy3 and Cy5 fluorescence signals is shown in the merge image. Yellow colour indicated co-localization of the two proteins stained in the image. Magnified views from each merge image were taken from the indicated regions. The right panel shows a quantitative analysis of fluorescence signals obtained by scanning the images perpendicularly to the striated staining pattern. The different lines (originally in red and green) depict Cy3- and Cy5 fluorescence signals, respectively.
EXAMPLE 6- Colocalization of AKAP186 with a-actinin in SR in rat neonatal cardiac myocytes Neonatal cardiac myocytes were fixed, permeabilized and stained for a-actinin and AKAP18S using specific antibodies and secondary Cy3- and Cy5-conjugated antibodies, respectively (see Figure 6).

EXAMPLE 7- Identification of an AKAP186-PKA complex in SR by cAMP
pull down A cAMP pull down experiment using Rp-8-AHA-cAMP agarose beads (an antagonist that does not dissociate PKA) to identify proteins coprecipitating with PKA from SR lysate was performed. The eluate was analysed on a 4-20% PAGE
and blotted onto PVDF membrane. The catalytic and regulatory subunits of the PKA
holoenzyme were detected by immunoblotting using specific polyclonal and monoclonal antibodies. Presence of the C subunit was a positive control for the experiment. The results are shown in Figure 7. An approximately 50-kDa protein was recognized by AKAP 186 polyclonal antibodies in the eluate. SERCA2a was identified in the eluate by using specific antibodies against SERCA2a.
EXAMPLE 8- Coimmunoprecipitation of PLB with AKAP185 from SR
fractions Immunocomplexes from SR using an AKAP 188 antibody was analysed on a 4-20%
PAGE and blotted onto PVDF membrane. PLB binding was detected by immunoblotting using a monoclonal antibody. Both PLB as monomer (approximately 5-kDa) and pentamer (25-kDa) coprecipitated with AKAP 185 (see Figure 8).

EXAMPLE 9- AKAP186 interacts with phospholamban.
Left ventricles of adult rat hearts were subjected to immunoprecipitation using antibody 1964 directed against all members of the AKAP 18 family (AKAP 18a, P, Y
and S, the corresponding preimmune serum, anti-phospholamban (PLB), anti- a -actinin and control IgG (IgG2a, see materials and methods) antibodies (Figure 9). As a control, lysates prior to immunoprecipitation were applied. PLB was detected by Western blotting.

EXAMPLE 10 -Identification of the AKAP188 binding site in PLB
The whole native PLB sequence was synthesized as 20-mer peptides (with 3 amino acid offset) on membrane (MultiPep, Intavis AG) and AKAPI8S binding was analysed by GST-AKAP 18S-overlay. The AKAP 188 binding sequence was identified in the N-terminus of PLB. The AKAP 185 core binding sequence is underlined and peptides are in bold (Figure 10).

In a second experiment, the PLB (7-26) peptide was synthesized witli or without a phosphorylated serine (pS) in position 16 and AKAP 186 binding was analysed by overlay. AKAP188 was not able to bind to PLB(7-26) containing a phosphorylated serine residue (mimicking PKA phosphorylated PLB), see lower 3 panels.

EXAMPLE 11- Characterization of the AKAP188 binding site by proline and alanine substitutions.
Native PLB sequence (10-29 aa) (20-mer) and peptides with a proline in each position from 10 to 29 in the sequence were syntliesized on a membrane (MultiPep, Intavis AG) and AKAP 188 binding was analysed by overlay (Figure 11, upper panel at left). Proline substitutions in the PLB sequence in position R13, R14 or disrupted the AKAP 18 binding, indicating that amino acids in these positions are important for binding. It is noteworthy that R13 and R14 are within the PKA
phosphorylation site (RRAS).

Native PLB sequence (7-26 aa) (20-mer) and peptides with a proline in each position from 7 to 26 in the sequence were synthesized on a meinbrane (MultiPep, Intavis AG) and AKAP 186 binding was analysed by overlay (Figure 11, upper panel at right). Proline substitutions in the PLB sequence in position A15, S16, T17, 118, E19, M20, P21, Q22, Q23, A24, R25 and Q26 disrupted the AKA.P18 binding, indicating that amino acids in these positions are important for binding.

Native PLB sequence (13-23) (11 -mer) and peptides with a proline substitution in each position from 13-23 were synthesized on a membrane (MultiPep, Intavis AG) and AKAP18S binding was analysed by overlay (lower panel at left, proline scan).
Proline substitutions in the PLB sequence in position R13, R14, A15, S16 or disrupted the AKAP 186 binding, indicating that amino acids in these positions are important for binding in the 11-mer peptide. Proline substitution in position T17, 118, E19, M20 or P21 restored and even increased the AKAP188 binding to PLB
(13-23). These amino acids (17-21) lie within the identified hinge region between the two helix domains in PLB (Zamoon et al., 2003, Biophysical J., 85, p2589-2598). Thus, by introducing the helix-breaking amino acid proline into this region, the AKAP186 binding is increased. The bar diagram at the right shows the relative affinity of the PLB derivatives with a higher affinity than the PLB wild-type sequence. These include the following substitutions, I18P, E19P and M20P.
Native PLB sequence (7-26 aa) (20-mer) and peptides with an alanine in each position from 7 to 26 in the sequence were synthesized on a membrane (MultiPep, Intavis AG) and AKAP188 binding was analysed by overlay (Figure 11, alanine scan, left panel). Alanine substitutions in the PLB sequence in position R9, R13, R14, P21, Q22, Q23 and R25 disrupted the AKAP18S binding, indicating that amino acids in these positions are important for binding. Alanine substitutions in the hinge region (17-20) showed a somewhat increased AKAP188 binding. Double alanine substitutions (panel at right) in the PLB sequence in positions T8 and R9, R9 and S10, 112 and R13, R13 and R14, R14 and A15, M20 and P21, P21 and Q22, Q22 and Q23, Q23 and A24, A24 and R25, R25 and Q26 disrupted or reduced the AKAP18S binding, indicating that amino acids in these positions are important for binding.

EXAMPLE 12 - Epitope mapping of the monoclonal PLB antibody The whole native rat PLB sequence (1-52 aa) was synthesized on a membrane as mer peptides (MultiPep, Intavis AG) and the recognition sequence/epitope for the monoclonal PLB antibody was identified by immunoblotting (Figure 12). The epitope was identified within the N-terminus of PLB and is overlapping with the AKAP188 binding region. This finding indicates that immunoprecipitation using the monoclonal PLB antibody will only be able to precipitate unbound PLB (which is consistent with our other data not shown).

The epitope for the monoclonal PLB antibody was mapped to the same region in the native human PLB sequence as well (data not shown).

EXAMPLE 13 -PLB derivated anchoring disruptors (20-mers) The PLB (7-26) sequence was further analysed for AKAP188 binding by a two-dimensional array (Figure 13). A two dimensional peptide array of 400 PLB
derivatives (spotted as 20-mer peptides) in which each residue in the PLB
sequence (given by their single-letter codes above the array) was replaced with residues having every possible side chain (given by their single-letter codes to the left of the array). The two first rows correspond to the native PLB sequence. The PLB
derivatives were analysed for AKAP 188 binding using a recombinant and purified GST- AKAP 185 protein. Binding was detected by immunoblotting. Substitutions of R13 and R14 generally decreased the AKAP186 binding. It is noteworthy that AKAP185 bound to the PLB (R9C).

EXAMPLE 14 -PLB derivated anchoring disruptors (13-mers) A shorter peptide of PLB (9-21) containing the AKAP 188 binding site was analysed for binding by a two dimensional peptide array of 260 PLB derivatives (spotted as 13-mer peptides) as described in Example 13. The two-dimensional peptide array of the smaller PLB peptide was much more discriminating than the array of the 20-mer described in Example 13 (see Figure 14). Substitutions of R9, R13 R14 and E19 almost abolished the AKAP18S binding, indicating the importance of the amino acids in these positions.

EXAMPLE 15- AKAP186-PLB dynamic binding The PLB (13-23), PLB (7-26) and PLB (7-26) (R9C) peptides were synthesized without and with a phosphorylated serine residue in position 16 (mimicking PKA
phosphorylated PLB) on a membrane (MultiPep, Intavis AG) and AKAP 188 binding was analysed by overlay and immunoblotting. AKAP 188 bound to the three PLB
peptides with an unphosphorylated serine but no AKAP18S binding was observed to PLB when serine was phosphorylated (Figure 15). Thus, the AKAP18S binding seems to be dynamic and regulated by the PKA phosphorylation status of serine.
EXAMPLE 16 -PKA-C subunit blocks the AKAP186 binding to PLB.
Three PLB peptide sequences containing the AKAP 185 binding domain (PLB (5-24), PLB (7-26), and PLB (9-28) with and without the R9C mutation) (two lower most panels) were synthesized in triplicates. PKA-C subunit was incubated with the membranes (left panels, Figure 16) two hours before the AKAP 188 binding was analysed by a second overlay using GST-AKAP 185. AKAP 186 was able to bind all three peptides in presence of the C subunit (upper most panel). However, no AKAP 188 binding was observed when the peptides containing the R9C mutation (two lower most panels) was pre-incubated with the C subunit (second lower most panel). PKA-C is reported to be trapped in PLB(R9C) by Schmitt et al., 2003, Science, supra) and our data shows that trapped C blocks the AKAP 185 binding to PLB. AKAP188 did not bind to PLB or PLB (R9C) wlien serine was phosphorylated indicating a dynamic binding (second and last panel).

EXAMPLE 17- Inhibition of the PKA phosphorylation of PLB by the anchoring disruption peptide, super-AKAP-is.
The PLB-AKAP I 8-PKA complex was reconstituted in HaCat cells by transfecting the cells with PLB-YFP and AKA.P188-EGFP. Approximately 16 hours after the transfection, the cells were treated with the high affinity anchoring disruption peptide, super-AKAP-is, for 24 hours, and thereafter stimulated with forskolin. The total cell lysate was analysed on a 4-20% PAGE and blotted onto PVDF membrane (Figure 17). The phosphorylation level of PLB was detected using a antibody against PLB (Ser16). Upon forskolin stimulation and no super-AKAP-is, the level of phosphorylated PLB was increased (left panel). Phosphorylated PLB was hardly detectable in cells treated with super-AKAP-is although the cells were stimulated with forskolin (right panel). Disruption of the AKAP 185-PKA interaction by super-AKAP-is abolished the phosphorylation of PLB by endogenous PKA. The presence of AKAP 188-EGFP was detected using anti-GFP.

EXAMPLE 18 - Defective Ca2+ re-uptake in the sarcoplasmic reticulum in neonatal cardiac myocytes after treatment with the RRASTIEMPQQ-Argll peptide Neonatal cardiac myocytes were transfected with the FRET-based Ca2+ sensor cameleon targeted to the SR and the response to a 10 mM caffeine pulse (1s, arrow) was recorded in control cells (filled squares) or cells pre-treated with 50 gM
of RRASTIEMPQQ-Arg11 for 40 min and/ or Ne 10 mM and IBMX 100 mM for 20 min, as indicated (Figure 18).

Neonatal cardiac myocytes treated with the anchoring disruption peptide, RRASTIEMPQQ-Argl l, had a reduced Ca2+ re-uptake in the sarcoplasmic reticulum both at basal level and after stimulation with Ne and treatment with IBMX. The peptide, RRASTIEMPQQ-Argl l disrupts the PLB-AKAP 188 interaction and thereby, is delocalize the AKAP-PKA complex from the PLB-SERCA2a complex.

EXAMPLE 19 - A higher time constant is observed in neonatal cardiac myocytes treated with the RRASTIEMPQQ-Argll peptide The averages of time constant i, calculated by fitting the recovery phase in the curve of Ca2+ re-uptake as shown in Figure 18 by using the exponential function f(t) Eni=1 Ai e-t/ti + C (Figure 19). For each sample n> 20 independent cells were used. * p = 0.02, ** p = 0.001, *** p< 6.16226e-10 , Student's t-test. The time constant was higher for cells treated with the peptide both at basal level and after stimulation (NE-IBMX).

EXAMPLE 20 - Extreme niinimal AKAP188 binding region in PLB
The PLB (7-26) peptide and truncations thereof was synthesized on membrane (MultiPep, Intavis AG) and AKAP18S binding was analysed by overlay and immunoblotting (Figure 20).

A minimal AKAP 186 core binding region was identified and includes the amino acid sequence; RRASTIE.

EXAMPLE 21- Enhanced PKA type II signaling pathway A high affinity PKA type II or PKA type I binding sequence, such as e.g. super-AKAP-is or MEME3 (LEQYANQLADQIIKEATE), can be coupled to the SR
targeting domain of PLB. Such a construct will target PKA type II or type I, respectively, to SR with high efficiency and PKA will hyper-phosphorylate PLB
upon cAMP stimulation (Figure 21).

PLB(R9C) is reported to block PKA-mediated phosphorylation of wild type PLB by trapping PKA into mutated PLB(R9C) (Schmitt et al., 2003, Science, supra). By using a construct similar to that described above, the problem with hypo-phosphorylation of PLB in PLB(R9C) should be overcome.

EXAMPLE 22- Disruption of PKA anchoring in cardiac myocytes prevents (3-adrenoreceptor-mediated PKA phosphorylation of phopholamban 0-adrenoreceptor activation in cardiac myocytes induces PKA phosphorylation of PLB and thereby the dissociation of PLB from SERCA2a. The dissociation increases contractility of cardiac myocytes (positive inotropic, positive chronotropic and positive lusitropic effects). The increase in PKA-mediated phosphorylation of PLB is detectable in neonatal cardiac myocytes after (i-adrenoreceptor stimulation with isoprotenerol using a phospho-specific anti-phospholamban antibody (phospho-PLB Ser16). The PKA inhibitor H89 prevented the phosphorylation. In order to test whether the anchoring of PKA to AKAPs is a prerequisite for PLB
phosphorylation, rat neonatal cardiac myocytes were incubated with the AKAP188-derived high affinity membrane-permeable (stearic acid-coupled) PKA anchoring disruptor peptide L314E. The peptide inhibited (3-adrenoreceptor agonist (isoprotenerol)-induced PLB phosphorylation indicating that PKA anchoring to AKAPs is a prerequisite for PLB phosphorylation (Figure 22).

EXAMPLE 23 - Knockdown of 18SYFP expression by RNAi confirmed by' FACS analysis In order to analyse the role of AKAP 188 in cardiac myocyte contraction, RNAi (derived from bp 18-3 8 of the AKAP 186 cDNA, RNAi AKAP 185, sequence, see the methods section) was established. AKAP 18S-selective RNAi was co-expressed with AKAPI8S-YFP or empty vector in HEK293 cells. FACS analysis of the cells revealed a knockdown of AKAP18d by about 70 % (Figure 23).

EXAMPLE 24- Knockdown of 186YFP expression by RNAi confirmed by western blotting and the sequence of the RNAi The knockdown of AKAP 188 was also confirmed by Western blot analysis of the cells (Figure 24). Therefore, the RNAi identified here represents a valuable tool for the functional analysis of AKAP18S. The RNAi AKAP18S sequence was derived from bp 18-38 of the AKAP18S cDNA as described in the methods section.

EXAMPLE 25- Disruption of the AKAP188-phospholamban interaction in neonatal cardiac myocytes slows Ca2+ reuptake into the SR
The functional role of the AKAP188-phospholamban interaction was tested by disruption of the interaction in neonatal cardiac myocytes. The cells were treated witli a membrane-permeable peptide mimicking the interaction site of PLB (S-PLB-1). Ca2+ imaging by applying line scan analysis and a laser scazuiing microscope revealed that the peptide extended the relaxation period (Figure 25). This was indicated by the extension of the time between two Ca2+ peaks in the presence of S-PLB-1. The 0-adrenoreceptor agonist isoprotenerol induced an increase in peak frequency (measurements 10 and 35 seconds after addition of isoprotenerol).
Compared to resting condition the peak frequency also increased in the presence of the peptide. However, compared to the cells not treated with the peptide the rise in frequency was lower. The data show that the interaction of AKAP 1 8d and PLB
is involved in the regulation regulation of Ca2+ reuptake into the SR, presumably by facilitating P-adrenoreceptor-mediated phosphorylation of PLB by PKA.
EXAMPLE 26 - Immunoprecipitation of AKAP188-YFP and PLB-CFP from HEK293 cells The AKAP186 specific antibody, A1884, imniunoprecipitated PLB from HEK293 cells expressing the fusion proteins AKAP 18S-YFP and PLB-CFP (Figure 26). The preimmune serum corresponding to antibody 1964 did not precipitate detectable amounts of PLB. Antibody A1884 precipitated a small amount of PLB. Taken together, the data indicate that AKAP 188 and PLB form a complex inside the cells.
EXAMPLE 27 - PLB binding site in AKA.P181i.
To identify the PLB binding site, rat AKAP188 sequence was synthesized on membrane as 20-mers. The PLB binding domain was identified in a PLB overlay experiment and was found to reside within the AKAP18S (181-257 aa) fragment (dark shading) (n=2). The PLB binding domain was upstream of the PKA-RII
binding domain (indicated in light shading).

EXAMPLE 28 - Knockdown of AKAP186 using RNAi303 and RNAi700.
In order to analyse the role of AKAP18S in cardiac myocyte contraction, RNAi that specifically targetted AKAP18S and RNAi that targetted both AKAP18S and AKAP187 was developed. RNA;303 and RNA;700 (RNA;303 (Pos. 303-321 of AKAP 186 cDNA) and RNA;700 (Pos. 701-720)) directed against both AKAP 188 and AKAP 18y knocked down expression of AKAP 185 in HEK293 transfected cells (Figure 28). The RNAi identified here represent valuable tools for the functional analysis of AKAP18S.

EXAMPLE 29 - Purification of PKA - AKAP186 complex from adult rat heart A cAMP pull down experiment using Rp-8-AHA-cAMP agarose beads (an antagonist that does not dissociate PKA) and adult rat heart lysate was carried out in the absence (cAMP agarose) or presence of cAMP (control + cAMP). The eluate was separated on a 12 % SDS-PAGE and blotted onto PVDF membrane. AKAP18S
was detected by inununoblotting using specific antibody A1884. As a positive control recombinant AKAP 185 (rec. AKAP 185) was detected. The result is shown in Figure 29.

EXAMPLE 30 - PLB-derived disruptor peptide in solution competes with binding of PLB to AKAP188.

We identified the AKAP 186 binding site in the cytoplasmic part of PLB. The cytoplasmic PLB (1-36) sequence was synthesized as 20-mer peptides with 2 amino acid offset on a membrane and analyzed for AKAP 185 binding by overlay with purified, recombinant GST-AKAP 188 protein, followed by anti-GST
immunoblotting (Fig. 30, left column). GST was used as a negative control for the overlay experiment (not shown). To evaluate the specificity of the assay, an AKAP 18Fi-PLB disruptor peptide was included in the overlay (right column), which abolished binding. The AKAP 185 core binding sequence was defined to amino acids 13-20 in PLB (Fig. 30, right). This motif is positioned at the end of domain IA
(amino acids 1-16) and in the whole loop domain (amino acids 17-21) which is within the hinge region between the two helical domains of PLB.

EXAMPLE 31 - PLB-derived disruptor peptide attenuates isoproterenol-induced phospholamban Ser16 phosphorylation.
The isoproterenol-induced phosphorylation of PLB-Ser16 was analyzed in presence and absence of the disruptor peptide (Fig. 31). Neonatal cardiac myocytes were incubated with or without the Arg9-PLB peptide (Arg9-RRASTIEMPQQ) for 30 min, and stimulated with 100 nm isoproterenol. The phosphorylation of PLB at Ser16 clearly increased by (3-adrenergic stimulation (Fig 31, middle lane). The presence of the PLB-peptide inhibited the increase in phosphorylation by almost 50% (Fig.
31, right lane). This indicates that AKAP 186 is necessary for recruitment of PKA
to its target, PLB. In contrast, a scrambled control peptide Arg9-scramPLB (Arg9-QAEMSITRPQR) used as negative control had little or no influence on the phosphorylation level of PLB-Ser16 after stimulation (not shown).
EXAMPLE 32 - siRNA-niediated knock down of AKAP185 abolishes the adrenergic stintulatory effect on Ca2+-reabsorption into sarcoplasmic reticulum To confirm the involvement of AKAP188 in the PKA/AKAP188/PLB/SERCA2 complex as a prerequisite for phosphorylation of PLB, we knocked down AKAP18S
using siRNA (see upper panel for efficacy of siRNA mediated knockdown as tested in HaCaT cells) and measured Ca2+ re-uptake. siRNA labeled with Cy3 flurochrom was injected into cardiomyocytes together with the FRET-based Ca2+ sensor YC6.2.
SR was emptied by placing the cells in a Ca2+-free solution and by blocking SERCA2 with BHQ (a reversible inhibitor). Then, BHQ was washed away before Ca2+ was added and CaZ+ re-uptake measured (Fig. 32). This demonstrates that AKAP188 siRNA oligos abolished the effect of norepinephrine on Ca2+ re-uptake in the SR whereas control siRNA had no effect. These data indicate that AICAP18S
recruitment of PKA to a supramolecular complex containing PLB and SERCA2 is important to discretely regulate PKA phosphorylation of PLB at Ser16 and thereby the PLB iiihibitory effect on SERCA2 and Ca2+ reuptake in heart sarcoplasmic reticulum.

EXAMPLE 33 - Deletional mapping of the phospholamban binding domain in AKAP188 by AKAP188 truncated proteins in peptide array overlay experiments of phospholamban.

The PLB binding site in AKAP188 was delineated by deletional mapping and interaction analysis by overlay of GST-AKAP18S truncated proteins on PLB
cytoplasmic part arrays (20-mer peptides, 2 amino acid offset) (Fig. 33A). GST-protein was used as a negative control (not shown). Binding of various constructs is indicated (right, yes/no). This outlines amino acids 124 to 138 and amino acids 201 to 220 as important for binding. To analyze these amino acids for PLB binding in situ, different AKAP 188 fragments were cloned into a mammalian expression vector and expressed in HEK293 cells together with PLB fused to GFP. GFP
immunoprecipitation demonstrated that AKAP 188 constructs covering amino acids 1-220 containing both binding regions and 1-138 containing the N-terminal binding region were co-immunoprecipitated with PLB-GFP. Notably, the AKAP18S 1-138 appeared to interact more weakly, suggesting that both domains might cooperate in binding in vivo.

EXAMPLE 34 - The AKAP188(PKA)/PLB/SERCA2 complex is present in sarcoplasniic reticulum as assessed by by immunogold staining and electron microscopy.
Immunogold staining using specific antibodies labeled with two different sizes of gold particles allowed for colocalization of the complex by electron microscopy (Fig. 34). As evident from the ultrastructure all three proteins localize on stacks of sarcoplasmic reticulum that are interspersed with the contractile machinery.
Furthermore, more than 20% of PLB and SERCA2 staining colocalized within 60 nm, more than 10% of the SERCA2 and AKAP186 colocalized and more than 12%
of the PLB and AKAP 186 colocalized within distances of less than 60 nm.
This analysis of the co-localization of AKAP 185, PLB and SERCA2 by immunogold EM (Fig. 34) supports the finding of colocalization by imniunofluorescence in heart tissue and provides a higher resolution.

EXAMPLE 35 - Homology comparisons of rat and hunian AKAP18 splice variants.
The binding region mapped using the different GST constructs is not unique for the delta isoform of AKAP18, but is also present in the AKAP18y isoform, see Fig for alignment of rat AKAP 186 with the human sequence for AKAP 18y. The sequence of PLB binding sites in human AKAP 188 are expected to be closely related to those observed in human AKAP 18y. Thus preferably the binding sites of the binding partaier of the invention (when referring to AKAP 188) are the regions of human AKAP18y corresponding to ainino acids 61-181 (preferably 124-138) and/or 181-215 and/or 201-220 and/or 237-257 of rat AKAP18S.

Claims

1. A method of altering the PKA type II-mediated, preferably PKA type IIa-mediated, activation of SERCA2 in a cell by administration of an anchoring disruption molecule or binding partner mimic, which modifies binding between one or more of the following binding partners:

i) a polypeptide comprising the sequence as set forth in SEQ ID No. 1(or 2) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 1(or 2), or a functionally equivalent fragment thereof, and a polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 3, or a functionally equivalent fragment thereof; or ii) a polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 3, or a functionally equivalent fragment thereof, and a polypeptide comprising the sequence as set forth in SEQ ID No. 6 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 6, or a functionally equivalent fragment thereof.

2. A method as claimed in claim 1 wherein said first binding partner polypeptide comprises or consists of amino acids 7-23 of SEQ ID No. 1(or 2) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence; and/or said second binding partner polypeptide comprises or consists of amino acids 61-181 (preferably 124-138) and/or 181-215 and/or 201-220 and/or 237-257 of SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence.

3. A method as claimed in claim 1 or 2 wherein said anchoring disruption molecule reduces or inhibits the binding between said binding partners.

4. A method as claimed in claim 3 wherein said anchoring disruption molecule is a direct inhibitor which is an antagonist which inhibits binding between the binding partners.

5. A method as claimed in claim 3 wherein said anchoring disruption molecule is an indirect inhibitor of binding between the binding partners, which preferably modifies expression of one or both of said binding partners.

6. A method as claimed in any one of claims 3 to 5 wherein said anchoring disruption molecule is a peptide, antibody or a nucleic acid molecule.

7. A method as claimed in claim 6 wherein said anchoring disruption molecule is a sense, antisense, siRNA or RNAi sequence derived from the nucleotide sequence encoding a polypeptide as defined in claim 1 or 2 or the complementary sequence thereof.

8. A method as claimed in claim 7 wherein said anchoring disruption molecule is derived from any one of the sequences of SEQ ID Nos. 7 to 12 or a sequence with at least 90% identity thereto or the complementary sequence thereof.

9. A method as claimed in claim 7 or 8 wherein said anchoring disruption molecule is an RNAi molecule selected from:

(i) caccgggagaaauagaugccaauaacgaauuauuggcaucuauuucuccc;
(ii) aaagauuacagcuggaauu; and (iii) ccaaugcucuggaagaagg, or an siRNA molecule:

(iv) 5' gggagaaauagaugccaauaa 3' 3'cgcccucuuuaucuacgguua 5'.

10. A method as claimed in claim 1 or 2 wherein said binding partner mimic enhances the binding between said binding partners.

11. A method as claimed in claim 10 wherein said binding partner mimic is a peptide or a nucleic acid molecule.

12. A method as claimed in any one of claims 1 to 11 wherein said anchoring disruption molecule or binding partner mimic is a nucleic acid molecule 10-500 bases in length.

13. A method as claimed in claim 6 or 11 wherein said anchoring disruption molecule or binding partner mimic is a peptide which comprises the minimum binding site of said first binding partner and preferably binds to the binding partner to which said first binding partner binds or a nucleic acid molecule encoding said polypeptide.

14. A method as claimed in claim 6 or 11 wherein said anchoring disruption molecule or binding partner mimic is a peptide which comprises the minimum binding site of a binding partner, which is modified to contain one or more mutations in said binding site which results in impaired binding to its binding partner or a nucleic acid molecule encoding said polypeptide.

15. A method as claimed in claim 13 or 14 wherein said peptide consists of or comprises one or more sequences selected from:

(i) amino acids 7-23 of SEQ ID No. 1(or 2);
(ii) amino acids 61-181 of SEQ ID No. 3;
(iii) amino acids 124-138 of SEQ ID No. 3:
(iii) amino acids 181-215 of SEQ ID No. 3;
(iv) amino acids 201-220 of SEQ ID No. 3;
(v) amino acids 237-257 of SEQ ID No. 3;
(vi) amino acids 124-220 of SEQ ID No. 3;

or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridizes under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence, or a fragment thereof of 7 to 15 residues.

16. A method as claimed in any one of claims 1 to 8 or 10 to 15 wherein said anchoring disruption molecule or binding partner mimic modifies the binding between binding partners as defined in claim 1, part (i) and is a polypeptide which comprises the following amino acid sequence:

RRASTIE
or a sequence which has been modified by substitution or deletion of up to 3 residues, provided that said modified peptide retains its ability to bind to the relevant binding partner, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said polypeptide.

17. A method as claimed in claim 16 wherein said polypeptide comprises the sequence:

RSAIRRASTIEMP
or a sequence which has been modified by substitution or deletion of up to 5 residues, provided that said modified peptide retains its ability to bind to the relevant binding partner, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said polypeptide.

18. A method as claimed in claim 16 or 17 wherein said polypeptide comprises the sequence (R/K)(R/K)X3(S/T)(T/S)X4(E/D) or (R/K)(S/T)X1X2(R/K)(R/K)X3(S/T)(T/S)X4(E/D)(M/C)P, wherein X1 and X2 independently may be any amino acid except E, preferably A, V, L or I, and X3 and X4 independently may be any amino acid except E or K, preferably A, V, L or I, which may optionally be truncated and/or extended, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said polypeptide.

19. A method as claimed in any one of claims 16 to 18 wherein said anchoring disruption molecule or binding partner mimic is a peptide consisting of the sequence as defined in any one of claims 16 to 18 or selected from the list consisting of:

(i) IRRASTIEMPQQ;
(ii) RRASTIEMPQQ;
(iii) LTRSAIRRASTIEMPQQARQ;
(iv) LTRSAIRRASTIEMPQQARQNLQ;
(v) VQYLTRSAIRRASTIEMPQQARQNLQ;
(vi) MEKVQYLTRSAIRRASTIEMPQQARQNLQ;
(vii) QYLTRSAIRRASTIEMPQQA;
(viii) RSAIRRASTIEMPQQARQNL;

(ix) RSAIRRASTIEMP;
(x) AIRRASTIEMPQQARQNLQN;
(xi) RRASTIEMPQQARQNLQNLF;
(xii) RRASTPEMPQQ;
(xiii) RRASTIPMPQQ; and (xiv) RRASTIEPPQQ, or a peptidomimetic or analogue thereof, or a nucleic acid molecule encoding said peptide.

20. A method of altering PKA type II-mediated, preferably PKA type IIa-mediated, activation of SERCA2 in a cell by administration of a binding partner mimic which enhances binding between the following binding partners:

a first polypeptide comprising the sequence as set forth in SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 3, or a functionally equivalent fragment thereof, and a second polypeptide comprising the sequence as set forth in SEQ ID No. 4 (or 5) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 4 (or 5), or a functionally equivalent fragment thereof, wherein said binding partner mimic comprises a targetting sequence and a sequence which mimics the binding site of said first polypeptide to said second polypeptide and binds to said second polypeptide, preferably binding to amino acids 1-44 of SEQ ID No. 4 (or 5) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence, or a nucleic acid molecule encoding said targetting and mimic sequences.

21. A method as claimed in claim 20 wherein said sequence which mimics the binding site of said first polypeptide consists of or comprises amino acids of SEQ ID No. 3 or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding said amino acid sequence of SEQ ID No. 3, or a fragment thereof of 7 to 15 residues.

22. A method as claimed in claim 20 or 21 wherein said sequence which mimics the binding site of said first polypeptide consists of or comprises one or more sequences selected from:

(i) PEDAELVRLSKRLVENAVE/LKAVQQY;
(ii) DLIEEAASRIVDAVIEQVKAAGAY;
(iii) QIEYLAKQIVDNAIQQA;

(iv) QIEYVAKQIVDYAIHQA; and (v) LEQYANQLADQIIKEATE.

23. A method as claimed in claim 20 or 21 wherein said sequence which mimics the binding site of said first polypeptide comprises the following amino acid sequence:

wherein Xi is Q, D, M, A, G, H, K, L, P, R, S, T, V, W or Y (preferably K, Q, D or M);

X2 is I, L, V or Y (preferably I, L or V);
X3 is Y, F, V, C, K, L, W or H (preferably K, Y, F or V);
X4 is V, K, C, L, H, F, Y, I or W (preferably V, K, C, L or H);
X5 is D, E, G, H, S, T, R, A, C, K, M, N or W (preferably D, G, H, S, T or R);

X6 is Y, H, N, R, W, C, F, K or R (preferably K, Y, H or N);
X7 is A, C or V;
X8 is H, C, Q, K, L or W (preferably K or H);
X9 is Q, C, K, H, A, G, N, R, S, T, V, W or Y (preferably K, Q or C);
and X10 is A, C, K (preferably K), provided that when X2 is I, either X3 is not Y, X4 is not L, X5 is not D, X6 is not N, X7 is not A, X8 is not Q, X9 is not Q or X10 is not A, or a peptidomimetic or analogue thereof.

24. A method as claimed in claim 23 wherein X1 is Q, D or M; X2 is I, L or V;
X3 is Y, F or V; X4 is V; X5 is D or E; X6 is Y; X7 is A or V; X8 is H; X4 is Q and X10 is A.

25. A method as claimed in any one of claims 20 to 24 wherein said targetting sequence targets the sarcoplasmic reticulum.

26. A method as claimed in any one of claims 1-6, 10, 11 or 13 to 25 wherein said anchoring disruption molecule or binding partner mimic is a peptide less than 100 amino acids in length, preferably 10 to 35 residues in length.

27. A method as claimed in any one of claims 1 to 8 or 10 to 26 wherein said anchoring disruption molecule or binding partner mimic further comprises an amino acid sequence which assists cellular penetration of said anchoring disruption molecule or binding partner mimic, preferably a polyarginine sequence, the HIV
tat sequence or antennaepedia peptide (penetratin) or a nucleotide sequence encoding said amino acid sequence.

28. An anchoring disruption molecule or binding partner mimic as defined in any one of claims 1 to 27.

29. A nucleic acid molecule comprising a nucleotide sequence encoding an anchoring disruption molecule or binding partner mimic as defined in claim 28.

30. A vector comprising a nucleic acid molecule as defined in claim 29.

31. A method of preparing a vector as defined in claim 30, comprising inserting a nucleic acid molecule as defined in claim 29 into a vector nucleic acid.

32. A method of preparing an anchoring disruption molecule or binding partner mimic of the invention as defined in any one of claims 1-6, 10, 11 or 13 to 27, which comprises culturing a host cell containing a nucleic acid molecule as defined in claim 29, under conditions whereby said anchoring disruption molecule or binding partner mimic is expressed and recovering said molecule thus produced.

33. An anchoring disruption molecule or binding partner mimic product expressed by a method of claim 32.

34. A cell containing an anchoring disruption molecule or binding partner mimic as defined in claim 28, introduced directly or by expression of encoding nucleic acid material.

35. A method of screening for, or testing the ability or efficacy of, a molecule to reduce or inhibit binding between any pair of binding partners defined in claims 1 or 2, wherein said test molecule is contacted with said binding partners and the extent of binding is assessed.

36. A method of identifying and/or isolating a PKA type II molecule comprising contacting a sample containing said PKA molecule with an anchoring disruption molecule or binding partner mimic as defined in claim 28 which binds with high affinity to a polypeptide comprising the sequence as set forth in SEQ ID No. 4 (or 5) or a sequence with 95% similarity thereto or a sequence encoded by a nucleotide sequence which hybridises under conditions of high stringency to the nucleotide sequence encoding the amino acid sequence of SEQ ID No. 4 (or 5), carrying a labelling means and assessing the level of said anchoring disruption molecule or binding partner mimic which is bound and/or isolating said PKA to which said anchoring disruption molecule or binding partner mimic is bound, wherein said level of anchoring disruption molecule or binding partner mimic is indicative of the level of said PKA molecule in said sample.

37. An antibody or an antigen-binding fragment thereof which binds specifically to an anchoring disruption molecule or binding partner mimic as defined in claim 28.

38. A method of altering the SERCA2 mediated PKA type II signalling pathway in a cell by administration of an anchoring disruption molecule or binding partner mimic as defined in claim 28.

39. A method as claimed in claim 38 wherein said method is performed in vivo, ex vivo or in vitro.

40. A pharmaceutical composition comprising one or more anchoring disruption molecules or binding partner mimics as defined in claim 28 and one or more pharmaceutically acceptable excipients and/or diluents.

41. An anchoring disruption molecule or binding partner mimic or their encoding nucleic acid molecule as defined in claim 28 or a pharmaceutical composition as claimed in claim 40 for use in medicine.

42. A method of treating or preventing diseases or disorders with abnormal PKA

type II signalling that regulates SERCA2 activity or which would benefit from a reduction or elevation in the levels of SERCA2 mediated PKA type II signalling comprising the step of administering an effective amount of an anchoring disruption molecule or binding partner mimic as defined in claim 28 to a human or non-human animal in need thereof.

43. A method of treating or preventing diseases or disorders with abnormal PKA

type II signalling that regulates SERCA2 activity or which would benefit from a reduction or elevation in the levels of SERCA2 mediated PKA type II signalling comprising the step of obtaining a sample from a subject in need of such treatment, contacting cells from said sample with an anchoring disruption peptide or binding partner mimic as defined in claim 28 and administering said cells of said sample to the subject.

44. Use of an anchoring disruption molecule or binding partner mimic as defined in claim 28 or a cell as defined in claim 43 in the manufacture of a medicament for treating or preventing diseases or disorders with abnormal PKA type II
signalling that regulates SERCA2 activity or which would benefit from a reduction or elevation in the levels of SERCA2 mediated PKA type II signalling.

45. A method or use as claimed in claim 43 or 44 wherein said disease is a cardiovascular disease.

46. A product containing one or more anchoring disruption molecules or binding partner mimics as defined in claim 28 and one or more additional active ingredients as a combined preparation for simultaneous, separate or sequential use in human or animal therapy.