CA2603298A1 - Tuberculosis vaccine and method for making same - Google Patents

Abstract

The present invention relates to an improved tuberculosis (TB) vaccine and a method for making this vaccine. The present invention further includes a method for determining the potency of TB strains. Mycobacterium bovis Bacille Calmette-Guerin (BCG) strains are genetically and phenotypically heterogeneous. Expression of the antigenic proteins MPB70 and MPB83 is known to vary considerably across BCG strains; however, the reason for this phenotypic difference has remained unknown. Because the history of BCG strain dissemination has been recorded, it has been possible to precisely determine the chronology of specific genetic changes in BCG strains (Behr and Small, 1999). A number of these mutations affect putative regulatory genes (Behr et al., 1999; Brosch et al ., 2000; Spreadbury et al ., 2005), so it was hypothesized that a mutation in a regulatory gene was likely responsible for the variable production of MPB70 and MPB83. The production of MPB70 and MPB83 across a panel of BCG strains was therefore determined, in order to assign the chronology of this phenotypic change and thereby guide studies towards identifying the responsible mutation. Interestingly, the data implicate a start codon mutation in the M. tuberculosis sigma factor K (RvO445c or sigK) and point to a highly specific link between sigK and expression of MPB70 and MPB83.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

TUBERCULOSIS VACCINE AND METHOD FOR MAKING SAME

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No.
60/667,243 filed on April 1 S' , 2005, which is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention relates to an improved tuberculosis (TB) vaccine and includes a method for making this vaccine. Vaccination against mycobacterial infection occurs through peptides and proteins expressed in response to sigma K
stimulation. The invention further includes a method for determining the potency of tuberculosis (TB) strains which is based on the detection of an anti-sigma K
cell response.

BACKGROUND OF THE INVENTION

Mycobacterium bovis Bacille Calmette-Guerin (BCG) strains have been given to billions of people as vaccines against tuberculosis (TB) as their derivation at the Pasteur Institute between 1908 and 1921. While BCG immunization reliably provides protection in animal models, their protection in human clinical trials has been inconsistent, leading to a number of hypotheses to explain these variable findings (Fine, 1995; Agger and Andersen, 2002). One theory that has been the subject of recent investigation pertains to the heterogeneity of BCG
preparations distinct from each other and different from the vaccines first provided in the early 20th century (Mostowy et al ., 2003). Moreover, analysis of the elements implicated in BCG evolution indicates that genes encoding regulatory elements and antigenic proteins are over-represented in the genomic deletions incurred by BCG strains (Behr, 2002).

The importance of antigenic proteins in TB pathogenesis and vaccine development has been well established through their use in generating immunity to TB and the demonstration that disruption of the ESAT-6 region contributed to the derivation of BCG (Andersen, 1994; Harboe et al., 1996; Mahairas et al., 1996;
Pym et al., 2002; Lewis et al., 2003; Brodin et al., 2004; Doherty et al., 2004).
Therefore, the observation that BCG strains have suffered loss of antigenic proteins during in vitro passage is consistent with a potential impairment in their capacity to serve as immunizing agents. Of the described antigenic proteins of the Mycobacterium tuberculosis complex, the M. bovis antigens MPB70 and MPB83 (also known as MPT70 and MPT83 when studied in M. tuberculosis) figure prominently as candidates for vaccine development (Fifis et al., 1994; Mustafa et al., 1998;
Chambers et al., 2002; 2004). Although the genes encoding these proteins have not been deleted in BCG evolution, production of these proteins by BCG vaccines during in vitro growth varies considerably. In certain BCG strains, such as BCG
Tokyo, MPB70 represents the most abundant protein in the culture filtrate (Nagai et al., 1981). In other BCG strains, such as BCG Pasteur, production of MPB70 is markedly reduced, leading to the division of BCG strains into high-producers or low-producers (Miura et al., 1983; Harboe and Nagai, 1984). The same pattern of antigen production across BCG strains has also been observed for MPB83, although the differences have generally not been as dichotomous (Wiker et al., 1996).

To explore the reasons underlying these differences in production, sequence-based analysis has been performed, but no mutations in the encoding genes or their upstream promoter regions have been detected (Hewinson et al., 1996; Vosloo et a/., 1997). Complementation of BCG Pasteur with mpb70 from BCG
Tokyo did not restore levels of MPB70 to those observed with BCG Tokyo, suggesting differences in expression inherent to the parent BCG strain (Matsumoto et al., 1995). By targeted expression analysis, using reverse transcription polymerase chain reaction (RT-PCR) and Northern blots, an obvious difference in mpb70 transcription was observed between BCG Tokyo (high-producer) and BCG Pasteur (low-producer) (Matsuo et al., 1995). However, the reason for this difference has remained unknown.

Identification of the cause or causes behind the observed differences in antigen production across tuberculosis vaccines would be useful for a variety of reasons, including the determination of the relative potency of the vaccines and the development of new, more effective vaccines. The present invention seeks to meet these and related needs.

SUMMARY OF THE INVENTION

Mycobacterium bovis Bacille Calmette-Guerin (BCG) strains are genetically and phenotypically heterogeneous. Expression of the antigenic proteins MPB70 and MPB83 is known to vary considerably across BCG strains; however, the reason for this phenotypic difference has remained unknown. By immunoblot, BCG
strains were separated into high- and low-producing strains. By quantitative reverse transcription polymerase chain reaction (RT-PCR), it was determined that transcription of the antigen-encoding genes, mpb70 and mpb83, follows the same strain pattern with mRNA levels reduced over 50-fold in low-producing strains.
Transcriptome comparison of the same BCG strains by DNA microarray revealed two gene regions consistently downregulated in low-producing strains compared with high-producing strains, one including mpb70 (Rv2875) and mpb83 (Rv2873) and a second that includes the predicted sigma factor, sigK. DNA sequence analysis revealed a point mutation in the start codon of sigK in all low-producing BCG
strains.
Complementation of a low-producing strain, BCG Pasteur, with wild-type sigK
fully restored MPB70 and MPB83 production. Microarray-based analysis and confirmatory RT-PCR of the complemented strains revealed an upregulation in gene transcription limited to the sigK and the mpb83/mpb70 gene regions. These data demonstrate that a mutation of sigK is responsible for decreased expression of MPB70 and MPB83 in low-producing BCG strains and provide clues into the role of Mycobacterium tuberculosis Sig K.

In one embodiment, the present invention relates to an improved tuberculosis (TB) vaccine and includes a method for making this vaccine. This vaccine is based on the complementation of a defective sigma K protein with a wild-type sigma K protein. In a specific embodiment, the nucleotide sequence for wild-type sigma K protein is introduced via a nucleotide vector.

Host organisms to make the tuberculosis vaccine include but are not limited to the following: M. tuberculosis, M. bovis, M. caprae, M. microti, M.
africanum, M. canettii, M. pinnipedii.

Alternatively, the tuberculosis vaccine is BCG and wild-type sigma K is introduced into a host cell to stimulate the production of the immunogens mpb70 and mpb83 (or mpt70 an mpt83). Possible BCG strains are chosen from the following non-limited group: BCG Russia, BCG Moreau, BCG Japan, BCG Sweden, BCG
Birkhaug, BCG Prague, BCG Glaxo, BCG Denmark, BCG Tice, BCG Connaught, BCG Frappier, BCG Phipps and BCG Pasteur.

The vaccines produced in accordance with the present invention are useful for the immunization of mammals against tuberculosis. Mammals include but are not limited to man, sheep, goats, pigs, deer, elk, bison, cows, steers, bulls and oxen.

In another embodiment, the invention relates to a method for determining the potency of tuberculosis (TB) strains. In one embodiment, this method is based on the detection of an anti-sigma K cell response reflected in the overall production of mpb70, mpb83 or both of these antigenic proteins. (Instead of mpb70 and mpb83, the antigenic proteins may be analogous proteins, such as mpt70 and mpt83.) In another embodiment, the method is based on microarray hybridization and analysis.
This method relies on the use of the newly identified nucleotide sequence described in the present specification for a mutant form of sigma K wherein the G at position 3 is replaced by A. The nucleotide sequence of this mutant form of sigma K, as well as its peptidic sequence, are part of the present invention, as are nucleotide and amino acid fragments comprising the point mutation described here.

Further scope and applicability will become apparent from the detailed description given hereinafter. It should be understood, however, that this detailed description, while indicating preferred embodiments of the invention, is given by way of example only, since various changes and modifications will become apparent to those skilled in the art.

BRIEF DESCRIPTION OF THE FIGURES

In the appended drawings:

Figure 1: SDS-PAGE and immunoblotting of culture filtrate proteins (A
and C) and cell extracts (B and D) from BCG strains, using monoclonal antibodies 1-5 5c for MPB70 (A and B) and MBS43 for MPB83 (C and D). The strains used were as follows: Ja, BCG Japan; Pa, BCG Pasteur; Ru, BCG Russia; Sw, BCG Sweden; Bi, BCG Birkhaug; Ph, BCG Phipps; GI, BCG Glaxo; Mo, BCG Moreau; Pr, BCG
Prague; Fr, BCG Frappier; Co, BCG Connaught; Ti, BCG Tice; De, BCG Denmark.

Figure 2: Expression of mpb70 (white) and mpb83 (grey) in M. bovis BCG strains. Ratio of expression is to that of BCG Pasteur. All values were normalized to the levels of sigA mRNA.

Figure 3: A and B. Expression of sigK (A) and mpb70 (white) and mpb83 (grey) (B) upon complementation of BCG Pasteur with sigK from M. tuberculosis H37Rv, BCG Russia, BCG Birkhaug and BCG Pasteur. Values are expressed as a ratio of mRNA copies in complemented strains compared with BCG
Pasteur::pMV306. All values were normalized to the levels of sigA mRNA and error bars represent the standard error of the mean. C and D. SDS-PAGE and immunoblotting of culture filtrate proteins (C) and cell extracts (D) from complemented BCG Pasteur, using monoclonal antibodies 1-5c for MPB70 (C) and MBS43 for MPB83 (D). The strains used were as follows: 1, BCG Pasteur::pH37Rv;
2, BCG Pasteur::pRUSS; 3, BCG Pasteur::pBIRK; 4, BCG Pasteur::pPAST; 5, BCG
Pasteur::pMV306.
Figure 4: A. Expression analysis of the genes Rv0441c to Rv0450c. B.
Expression analysis for the genes Rv2870c to Rv2881c. Levels presented represent the ratio of mRNA copies in sigK-complemented strain to the control strain BCG
Pasteur::pMV306 (empty vector). All values were normalized to the levels of sigA
mRNA and the ratio presented represents the mean of results from different clones, specifically BCG Pasteur::pH37Rv, BCG Pasteur::pRUSS and BCG Pasteur::pBIRK.
Figure 5: Protective efficacy against M. tuberculosis low-dose aerosol challenge in a guinea pig model.

Figure 6: Protective efficacy against M. tuberculosis i.v. challenge in C57BL/6 mouse model; and Figure 7: Immunogenicity, as measured by MPB70-induced gamma-interferon production by spienocytes in mice.

DEFINITIONS AND TERMS

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.

Use of the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a target polynucleotide" includes a plurality of target polynucleotides.

As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "include" and "includes") or "containing" (and any form of containing, such as "contain" and "contains"), are inclusive or open-ended and do not exclude additional, unrecited elements or process steps.

The term "about" is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value.

Terms such as "connected," "attached," and "linked" may be used interchangeably herein and encompass direct as well as indirect connection, attachment, linkage or conjugation unless the context clearly dictates otherwise.

Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the invention, as are ranges based thereon.

Unless defined otherwise or the context clearly dictates otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods and materials are now described.

All publications mentioned herein are hereby incorporated by reference for the purpose of disclosing and describing the particular materials and methodologies for which the reference was cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

The terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and may comprise ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. These terms refer only to the primary structure of the molecule. Thus, the terms include triple-, double- and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RNA"). They also include modified (for example, by alkylation and/or by capping) and unmodified forms of the polynucleotide.

More particularly, the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" include polydeoxyribonucleotides (containing deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing a phosphate or other polyanionic backbone, and other synthetic sequence-specific nucleic acid polymers provided that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. There is no intended distinction in length between the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule,"
and these terms are used interchangeably herein. Thus, these terms include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3' P5' phosphoramidates, 2'-O-alkyl-substituted RNA, double- and single-stranded DNA, as well as double-and single-stranded RNA, and hybrids thereof, including, for example, hybrids between DNA and RNA, and also include known types of modifications, for example, labels, alkylation, "caps," substitution of one or more of the nucleotides with an analog, internucleotide modifications such as, for example, those with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (including enzymes (e.g.
nucleases), toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelates (of, e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or oligonucleotide.

Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the and C6-NH2, respectively, of adenosine and between the C2-oxy, N3 and C4-NH2, of cytidine and the C2-NH2, N'--H and C6-oxy, respectively, of guanosine.
Thus, for example, guanosine (2-amino-6-oxy-9-.beta.-D-ribofuranosyl-purine) may be modified to form isoguanosine (2-oxy-6-amino-9-.beta.-D-ribofuranosyl-purine).
Such modification results in a nucleoside base which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (1-.beta.-D-ribofuranosyl-2-oxy-4-amino-pyrimidine) to form isocytosine (1-.beta.-D-ribofuranosyl-2-amino-4-oxy-pyrimidine) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine.
Isocytosine is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine may be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2'-deoxy-5-methyl-isocytidine may be prepared by the method of Tor et al. (1993) J. Am. Chem. Soc. 115:4461-4467 and references cited therein; and isoguanine nucleotides may be prepared using the method described by Switzer et al. (1993), supra, and Mantsch et al. (1993) Biochem. 14:5593-5601, or by the method described in U.S. Pat. No. 5,780,610 to Collins et al. Other normatural base pairs may be synthesized by the method described in Piccirilli et al.
(1990) Nature 343:33-37 for the synthesis of 2,6-diaminopyrimidine and its complement (1-methylpyrazolo-[4,3]pyrimidine-5,7-(4H,6H)-dione). Other such modified nucleotidic units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 and Switzer et al., supra.

Hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM. Hybridization temperatures can be as low as 5 C., but are typically greater than 22 C., more typically greater than about 30 C., and preferably in excess of about 37 C. Longer fragments may require higher hybridization temperatures for specific hybridization. Other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, and the combination of parameters used is more important than the absolute measure of any one alone. Suitable hybridization conditions for a given assay format can be determined by one of skill in the art; nonlimiting parameters which may be adjusted include concentrations of assay components, salts used and their concentration, ionic strength, temperature, buffer type and concentration, solution pH, presence and concentration of blocking reagents to decrease background binding such as repeat sequences or blocking protein solutions, detergent type(s) and concentrations, molecules such as polymers which increase the relative concentration of the polynucleotides, metal ion(s) and their concentration(s), chelator(s) and their concentrations, and other conditions known in the art.

The target polynucleotide can be single-stranded, double-stranded, or higher order, and can be linear or circular. Exemplary single-stranded target polynucleotides include MRNA, rRNA, tRNA, hnRNA, ssRNA or ssDNA viral genomes, although these polynucleotides may contain internally complementary sequences and significant secondary structure. Exemplary double-stranded target polynucleotides include genomic DNA, mitochondrial DNA, chloroplast DNA, dsRNA
or dsDNA viral genomes, plasmids, phage, and viroids. The target polynucleotide can be prepared synthetically or purified from a biological source. The target polynucleotide may be purified to remove or diminish one or more undesired components of the sample or to concentrate the target polynucleotide.
Conversely, where the target polynucleotide is too concentrated for the particular assay, the 5 target polynucleotide may be diluted.

Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted genomes employed. In general, the oligonucleotide probes or primers are at least 12 nucleotides in length, preferably between 15 and 24 molecules, and 10 they may be adapted to be especially suited to a chosen nucleic acid amplification system. As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hybridization thereof with its targeted sequence (see below and in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).

Probes of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a-nucleotides and the like.
Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann.
Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic Acids Res., 14:5019.
Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.

The types of detection methods in which probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less preferred, labeled proteins could also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.
Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labeled according to numerous well known methods (Sambrook et al., 1989, supra). Non-limiting examples of labels include 3H, 14C, 32P, and 35S. Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.

As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP
(e.g. uniformly labeled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.

As used herein, "oligonucleotides" or "oligos" define a molecule having two or more nucleotides (ribo or deoxyribonucleotides). The size of the oligo will be dictated by the particular situation and ultimately on the particular use thereof and adapted accordingly by the person of ordinary skill. An oligonucleotide can be synthesized chemically or derived by cloning according to well known methods.
While they are usually in a single-stranded form, they can be in a double-stranded form and even contain a"regulatory region".
As used herein, a "primer" defines an oligonucleotide which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA synthesis under suitable conditions.
Primers can be, for example, designed to be specific for certain alleles so as to be used in an allele-specific amplification system.

Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, Am.
Biotechnol. Lab. 8:14-25. Numerous amplification techniques have been described and can be readily adapted to suit particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Q(3 replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al., 1988, BioTechnology 6:1197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 1989, supra). Preferably, amplification will be carried out using PCR.

Polymerase chain reaction (PCR) is carried out in accordance with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 (the disclosures of all three U.S. Patent are incorporated herein by reference). In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected.
An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analyzed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA
following gel electrophores, or using a detectable label in accordance with known techniques, and the like. For a review on PCR techniques (see PCR Protocols, A
Guide to Methods and Amplifications, Michael et al. Eds, Acad. Press, 1990).
As used herein, the term "gene" is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide. A "structural gene"
defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise to a specific polypeptide or protein. It will be readily recognized by the person of ordinary skill, that the nucleic acid sequence of the present invention can be incorporated into anyone of numerous established kit formats which are well known in the art.

A "heterologous" (e.g. a heterologous gene) region of a DNA molecule is a subsegment of DNA within a larger segment that is not found in association therewith in nature. The term "heterologous" can be similarly used to define two polypeptidic segments not joined together in nature. Non-limiting examples of heterologous genes include reporter genes such as luciferase, chloramphenicol acetyl transferase, P-galactosidase, and the like which can be juxtaposed or joined to heterologous control regions or to heterologous polypeptides.

The term "vector" is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art.

The term "expression" defines the process by which a gene is transcribed into mRNA (transcription), the mRNA is then being translated (translation) into one polypeptide (or protein) or more.
The terminology "expression vector" defines a vector or vehicle as described above but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserted sequence) is usually placed under the control of control element sequences such as promoter sequences.
The placing of a cloned gene under such control sequences is often referred to as being operably linked to control elements or sequences.

Operably linked sequences may also include two segments that are transcribed onto the same RNA transcript. Thus, two sequences, such as a promoter and a "reporter sequence" are operably linked if transcription commencing in the promoter will produce an RNA transcript of the reporter sequence. In order to be "operably linked" it is not necessary that two sequences be immediately adjacent to one another.

Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites.

Prokaryotic expressions are useful for the preparation of large quantities of the protein encoded by the DNA sequence of interest. This protein can be purified according to standard protocols that take advantage of the intrinsic properties thereof, such as size and charge (e.g. SDS gel electrophoresis, gel filtration, centrifugation, ion exchange chromatography...). In addition, the protein of interest can be purified via affinity chromatography using polyclonal or monoclonal antibodies. The purified protein can be used for therapeutic applications.

The DNA construct can be a vector comprising a promoter that is operably linked to an oligonucleotide sequence of the present invention, which is in turn, operably linked to a heterologous gene, such as the gene for the luciferase reporter molecule. "Promoter" refers to a DNA regulatory region capable of binding directly or indirectly to RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of the present invention, the promoter is bound at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
Within the promoter will be found a transcription initiation site (conveniently defined by mapping with S1 nuclease), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CCAT" boxes. Prokaryotic promoters contain -10 and -35 consensus sequences, which serve to initiate transcription and the transcript products contain Shine-Dalgarno sequences, which serve as ribosome binding sequences during translation initiation.
As used herein, the designation "functional derivative" denotes, in the context of a functional derivative of a sequence whether a nucleic acid or amino acid sequence, a molecule that retains a biological activity (either function or structural) that is substantially similar to that of the original sequence. This functional derivative or equivalent may be a natural derivative or may be prepared synthetically.
Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity of the protein is conserved. The same applies to derivatives of nucleic acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained.
When relating to a protein sequence, the substituting amino acid generally has chemico-physical properties which are similar to that of the substituted amino acid.
The similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like. The term "functional derivatives" is intended to include 5 "fragments", "segments", "variants", "analogs" or "chemical derivatives" of the subject matter of the present invention.

Thus, the term "variant" refers herein to a protein or nucleic acid molecule which is substantially similar in structure and biological activity to the protein or 10 nucleic acid of the present invention.

The functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA technology. All these methods are well known in the art.
The term "allele" defines an alternative form of a gene which occupies a given locus on a chromosome.

As commonly known, a "mutation" is a detectable change in the genetic material which can be transmitted to a daughter cell. As well known, a mutation can be, for example, a detectable change in one or more deoxyribonucleotide. For example, nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position. Spontaneous mutations and experimentally induced mutations exist. A mutant polypeptide can be encoded from this mutant nucleic acid molecule.
As used herein, the term "purified" refers to a molecule having been separated from a cellular component. Thus, for example, a "purified protein"
has been purified to a level not found in nature. A "substantially pure" molecule is a molecule that is lacking in most other cellular components.
As used herein, the terms "molecule", "compound", "agent" or "ligand" are used interchangeably and broadly to refer to natural, synthetic or semi-synthetic molecules or compounds. The term "molecule" therefore denotes for example chemicals, macromolecules, cell or tissue extracts (from plants or animals) and the like. Non limiting examples of molecules include nucleic acid molecules, peptides, antibodies, carbohydrates and pharmaceutical agents. The agents can be selected and screened by a variety of means including random screening, rational selection and by rational design using for example protein or ligand modeling methods such as computer modeling. The terms "rationally selected" or "rationally designed"
are meant to define compounds which have been chosen based on the configuration of interacting domains of the present invention. As will be understood by the person of ordinary skill, macromolecules having non-naturally occurring modifications are also within the scope of the term "molecule". For example, peptidomimetics, well known in the pharmaceutical industry and generally referred to as peptide analogs can be generated by modeling as mentioned above. Similarly, in a preferred embodiment, the polypeptides of the present invention are modified to enhance their stability. It should be understood that in most cases this modification should not alter the biological activity of the interaction domain.

For certainty, the sequences and polypeptides useful to practice the invention include without being limited thereto mutants, homologs, subtypes, alleles and the like. It shall be understood that generally, the sequences of the present invention should encode a functional (albeit defective) interaction domain. It will be clear to the person of ordinary skill that whether an interaction domain of the present invention, variant, derivative, or fragment thereof retains its function in binding to its partner can be readily determined by using the teachings and assays of the present invention and the general teachings of the art.

A host cell or indicator cell has been "transfected" by exogenous or heterologous DNA (e.g. a DNA construct) when such DNA has been introduced inside the cell. The transfecting DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transfecting DNA may be maintained on a episomal element such as a plasmid. With respect to eukaryotic cells, a stably transfected cell is one in which the transfecting DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication.
This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transfecting DNA. Transfection methods are well known in the art (Sambrook et al., 1989, supra;
Ausubel et al., 1994 supra).

In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology:
Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody- A
Laboratory Manual, CSH Laboratories). The present invention also provides polyclonal, monoclonal antibodies, or humanized versions thereof, chimeric antibodies and the like which inhibit or neutralize their respective interaction domains and/or are specific thereto.
From the specification and appended claims, the term therapeutic agent should be taken in a broad sense so as to also include a combination of at least two such therapeutic agents. Further, the DNA segments or proteins according to the present invention can be introduced into individuals in a number of ways. For example, erythropoietic cells can be isolated from the afflicted individual, transformed with a DNA construct according to the invention and reintroduced to the afflicted individual in a number of ways, including intravenous injection.
Alternatively, the DNA construct can be administered directly to the afflicted individual, for example, by injection in the bone marrow. The DNA construct can also be delivered through a vehicle such as a liposome, which can be designed to be targeted to a specific cell type, and engineered to be administered through different routes.

For administration to humans, the prescribing medical professional will ultimately determine the appropriate form and dosage for a given patient, and this can be expected to vary according to the chosen therapeutic regimen (e.g. DNA
construct, protein, cells), the response and condition of the patient as well as the severity of the disease.

Composition within the scope of the present invention should contain the active agent (e.g. fusion protein, nucleic acid, and molecule) in an amount effective to achieve the desired therapeutic effect while avoiding adverse side effects.
Typically, the nucleic acids in accordance with the present invention can be administered to mammals (e.g. humans) in doses ranging from 0.005 to 1 mg per kg of body weight per day of the mammal which is treated. Pharmaceutically acceptable preparations and salts of the active agent are within the scope of the present invention and are well known in the art (Remington's Pharmaceutical Science, 16th Ed., Mack Ed.).
For the administration of polypeptides, antagonists, agonists and the like, the amount administered should be chosen so as to avoid adverse side effects. The dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 50 mg/kg/day will be administered to the mammal.

The present invention may be included within a kit for determining the characteristics (such as the potency) of a tuberculosis vaccine, comprising a nucleic acid, a protein or a ligand in accordance with the present invention. For example, a compartmentalized kit in accordance with the present invention includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the test sample (DNA protein or cells), a container which contains the primers used in the assay, containers which contain enzymes, containers which contain wash reagents, and containers which contain the reagents used to detect the extension products.

EXPERIMENTAL PROCEDURES
Bacterial cultures Unless otherwise stated, BCG strains were grown at 37 C in Middlebrook 7H9 medium (Difco Laboratories, Detroit, MI) containing 0.05% Tween 80 (Sigma-Aldrich, St. Louis, MO) and 10% albumin-dextrose-catalase (Becton Dickinson and Co., Sparks, MD) supplement on a rotating platform (Wheaton). Transformed BCG
strains were resuspended in 7H9 containing 15% glycerol and frozen in 1 ml aliquots at -80 C until needed. Frozen bacteria were thawed and diluted in fresh 7H9 medium containing 10% albumin-dextrose-catalase and grown with rotation at 37 C.

PCR amplification and sequencing across Rv0445c (sigK) The sequence of Rv0445c (sigK) was determined by amplifying the gene and flanking regions from isolates of M. canettii, M. tuberculosis H37Rv, M.
tuberculosis H37Ra, Mycobacterium africanum (n = 2), M. microti (n = 2), M.
caprae (n = 2), M. bovis (n = 2) and 13 members of the BCG family - BCG Russia (ATCC
35740), BCG Moreau, BCG Japan, BCG Sweden, BCG Birkhaug (ATCC 35731), BCG Prague, BCG Glaxo (ATCC 35741), BCG Denmark 1331 (ATCC 35733), BCG
Tice (ATCC 35743), BCG Frappier (ATCC 35735), BCG Connaught, BCG Phipps (ATCC 35744) and BCG Pasteur 1173. The sequence was amplified using Primers were left primer: 5'- agctcgagcagctcaaaatc-3'; and right primer: 5'-acgcgtcaccccaactact-3' and amplicons were sequenced by di-deoxy terminal sequencing at the McGill University and Genome Quebec Innovation Center. To look for differences between the amplified sequence and the prototype genome sequences, results were compared by BLAST analysis to M. tuberculosis H37Rv using Tuberculist (http://genolist.pasteur.fr/TubercuList/), M. tuberculosis 210 and CDC1551 using the sequences provided at NCBI
(http://www.ncbi.nlm.nih.gov/sutils/genom-table.cgi), M. bovis AF2122/97 using Bovilist (http://qenolist.pasteur.fr/BoviList/), and the assembly sequence of BCG
Pasteur (http://www.sanger.ac.uk/cgi-bin/blast/submitblast/m bovis).

RNA extraction BCG strains grown to an OD600 of 0.3-0.5 were pelleted by centrifugation, resuspended in 1 ml of wash buffer (0.5% Tween 80, 0.8% sodium chloride) and transferred to 1.5 mi screw-cap cryovials. RNA was extracted by a modified phenol-chloroform extraction protocol as previously described (Belley et al., 2004). Genomic DNA contamination was removed by RNAeasy on-column digestion, following the manufacturer's protocol (Qiagen, Mississauga, Canada). The quality of RNA was confirmed by denaturing gel electrophoresis (formaldehyde).

Real-time quantitative RT-PCR

Targeted gene expression levels were determined using RTPCR with molecular beacons or sybr green, according to established protocols (Manganelli et al., 1999;

Mostowy et al., 2004). To provide a normalization standard for mRNA
expression, expression of sigA was also determined, and the level of expression of a gene of interest divided by that of sigA to normalize for differences in total mRNA
extracted (Manganelli et al., 1999). Sequences of the primers used for molecular beacon and 5 sybr green analysis and the sequences of the molecular beacons used are as listed in Table 4.

Microarray analysis 10 Microarray hybridization and analysis were performed as previously described (Mostowy et al., 2004). In brief, mRNA from BCG strains and complemented strains was extracted during log-phase in vitro growth and labelled with Cy3 or Cy5 dUTP by reverse-transcriptase (Amersham Biosciences). Labelled cDNA was hybridized to microarrays composed of oligonucleotide probes from the 15 TB Array-Ready Oligo SetTM (Operon) that had been printed onto SigmascreenTM
microarray slides (Sigma). Initial comparisons were BCG Russia versus BCG
Pasteur, and BCG Birkhaug versus Denmark. After complenting BCG Pasteur with wild-type sigK, comparisons of Pasteur::sigK versus Pasteur::pMV306 (empty vector) were also performed. In each case, duplicate hybridizations were performed for each 20 dye combination (Cy3/Cy5 and Cy5/Cy3), resulting in four hybridizations per comparison. Hybridized arrays were scanned with Scanarray 5000XL (PerkinElmer, Freemont, CA) and hybridization results were quantified with Scanalyze software (http://rana.Stanford.EDU/software/).

Array analysis was performed as previously described (Mostowy et al., 2004) in order to determine a z-score, indicative of how many standard deviations a data point lies from the population mean, for each gene. z-scores for each gene were averaged across replicates within each experiment to minimize the probability of observing such variation by chance alone and genes with average z-scores of 2 or greater are presented.

Complementation of sigK

To complement BCG strain Pasteur, the sigK region (including the complete gene and 288 bp upstream) was amplified via PCR from M. tuberculosis H37Rv, and BCG strains Russia and Birkhaug. As a control, the sigK from BCG
Pasteur was also complemented to determine the effect of having a second copy of the mutated gene. To complement, PCR was performed using the following primers Rv0445cL and sigKR (left primer: 5'-agctcgagcagctcaaaatc-3'; right primer: 5'-acgcgtcaccccaactact-3') and amplified products were cloned into the T-vector, pDRIVE (Qiagen). The sigK region was then removed by digestion with Hindlll and Kpnl and ligated to the integrative mycobacterial vector pMV306 (de Stover et al., 1991) cut with the same restriction endonucleases. Integrity of the cloned genes was confirmed by DNA sequencing, then the resulting plasmids (pH37Rv, pRUSS, pBIRK
and pPAST) were electroporated into M. bovis BCG Pasteur cells, using previously described methods (Belley et al., 2004). The empty pMV306 vector was also included as a control. Transformants were grown at 37 C on Middlebrook 7H10 agar supplemented with 10% ADC [albumin (bovine fraction V), dextrose and catalase;
BD/BBL media] and kanamycin (25 mg ml-1). Complementation was PCR-confirmed by amplifying the sigK gene with primers specific for the regions of pMV306 flanking the sigK insert and these amplicons were sequence-confirmed for all transformants.
Protein preparation and immunoblot analysis BCG strains BCG strains were cultivated as surface pellicles on liquid synthetic Sauton medium for 3 weeks at 37 C. The bacteria were washed and disrupted by a bead beater to yield a cellular extract and the culture medium was filtered to remove residual bacteria and concentrated by ammonium sulphate precipitation at 80%
saturation.
The antigens were separated under reducing conditions by horizontal SDSPAGE in precast 8-18% gradient Excel gel using a Multiphor II unit 2117 (Amersham Pharmacia). After separation, the proteins were transferred to a nitrocellulose membrane (pore size, 0.2 mm) by diffusion blotting (Olsen and Wiker, 1998) and the gel was stained with CBB. The membranes were blocked with PBS containing 2%
bovine serum albumin (BSA) and 1% gelatin and incubated with antibodies overnight.
Bound antibodies were recognized by horseradish peroxidase (HRP)-labelled anti-rabbit or anti-mouse Ig. As substrate, 3,3-diaminobenzidine was added to visualize the bound antibodies.

BCG pasteur complemented strains Cultures were grown at 37 C in 7H9 with 10% ADC, supplemented with kanamycin (25 mg ml-1) for 7 days. The cultures were then centrifuged and the supernatant was filtered with a 0.22 mm membrane filter and concentrated with an Amicon Ultra-15 Centrifugal Filter Unit, 10 000 MWCO. Cell pellets were frozen and whole-cell lysates were prepared by resuspending the cell pellet in 100 ml of PBS
and boiling for 20 min. The culture filtrate proteins (CFP) were precipitated by the following protocol: 1 volume of sample was mixed with 3 volumes of methanol, 1 volume of chloroform, 4 volumes of water. Samples were centrifuged at max speed (-13 200 rpm) for 1 min. The upper phase was removed and replaced with 4 volumes of methanol and mixed briefly. Protein was pelleted at max speed for 15 min (Wessel and Flugge, 1984). Protein was resuspended in 100 ml of PBS and the final concentration was determined using Coomassie Plus Protein Determination Kit (Pierce) following standard protocol.

A total of 10 mg of CFP for each sample or 2 ml of cell lysate was loaded in each lane. Samples were added to SDSloading buffer and heated to 80 C for 5 min. SDS-PAGE was performed under reducing conditions using the Mini-PROTEAN
3 electrophoresis system (Bio-Rad) with 12% polyacrylamide gels. Proteins were transferred to a polyvinylidene difluoride membrane. Membranes were blocked in PBS containing 2% BSA and 0.05% Tween 20, then probed with primary antibodies for 1 h at room temperature. Bound antibodies were recognized by HRP-labelled anti-mouse Ig. All antibodies were diluted in PBST with 1% BSA. Mouse monoclonal antibodies 1-5C (anti-MPB70) and MBS43 (anti-MPB83) (Wiker et al., 1998) were used at a dilution of 1/500 and the HRP-conjugated anti-mouse antibody was used at a dilution of 1/10 000. Protein bands were detected using ECL PIusTMWestern Blotting Detection Reagents (Amersham).
DETAILED DESCRIPTION

lmmunoblotting M. bovis BCG culture filtrate proteins and whole-cell extracts To determine the production of MPB70 and MPB83 across BCG strains, culture filtrate proteins and whole-cell extracts blinded to strain identity were analysed. Upon decoding the samples, MPB70 was detected in substantial amounts in the culture filtrates of BCG Russia, Birkhaug, Sweden, Japan and Moreau and not in the remaining strains (Figure 1A). In the whole-cell extracts, MPB70 was not detectable in any strain (Figure 1 B). MPB83 was detected in both the culture filtrate proteins and the wholecell extracts of BCG Russia, Birkhaug, Sweden, Japan and Moreau (Figure 1 C). In the remaining strains of BCG, MPB83 could be detected in low amounts in the wholecell extracts (Figure 1D). These results are in agreement with previous results from a subset of these strains (Miura et al., 1983;
Harboe and Nagai, 1984; Wiker et al., 1996) and indicate a clear delineation between strains obtained from the Pasteur Institute until 1927 (high-producers) versus strains obtained, either directly or indirectly, in 1931 or later (low-producers).

Transcription of mpb70 and mpb83 in BCG strains To determine whether transcriptional differences might correlate with variations in protein production, quantitative RT-PCR was employed with molecular beacons to estimate relative mRNA levels for mpb70 and mpb83. As immunoblotting results pointed to distinctions between strains obtained before or after the interval 1927-1931, the first and last strain obtained from each group were selected (BCG
Russia and BCG Birkhaug for the earlier/high-producing group and BCG Danish and BCG Pasteur for the later/low-producing group). Consistent with previous reports indicating different mRNA expression (Matsuo et al., 1995), measured levels of mpb70 and mpb83 mRNA were profoundly lower in BCG Danish and BCG Pasteur as compared with BCG Birkhaug and BCG Russia with a calculated difference greater than 50-fold (Figure 2).

Microarray analysis of BCG strains To look for other differences in gene expression that might coincide with transcription of mpb70 and mpb83, the same four BCG strains were studied by whole genome microarray, directly comparing BCG Russia with BCG Pasteur and BCG
Birkhaug with BCG Danish (Table 1). Consistent with the RT-PCR data, levels of mpb70 and mpb83 were significantly lower in BCG Pasteur and BCG Danish, as compared with BCG Russia and BCG Birkhaug. Also in this region, Rv2876 and Rv2878c showed decreased expression in late/low-producing strains compared with early/high-producing strains. A second region that showed consistent downregulation in the low-producing strains was Rv0445c-Rv0449c. Of these genes, the only putative transcriptional regulator is Rv0445c (sigK), which is predicted to encode an alternate sigma factor, prompting further analysis.
Sequence analysis of sigK

Comparison of sigK across sequenced genomes indicated two polymorphisms in BCG Pasteur compared with M. tuberculosis H37Rv. First, located at nucleotide -31 upstream from the sigK start codon, the adenine residue is replaced by a thymidine residue in BCG Pasteur. Sequencing this region across members of the M. tuberculosis complex and 13 BCG strains revealed that this mutation represents an M. tuberculosis polymorphism; Mycobacterium canettii, Mycobacterium microti, Mycobacterium caprae, M. bovis and all BCG strains have the thymidine residue at the -31 upstream position while sequenced M. tuberculosis strains (H37Rv, 210 and CDC1551) have the adenine residue. Second, in M. tuberculosis H37Rv, the start codon of sigK is the predominant start codon sequence AUG, while in BCG Pasteur there is a G-> A mutation at the third nucleotide, resulting in an altered AUA start codon. The AUG was observed in all members of the M.
tuberculosis complex except for the eight low-producing BCG strains obtained after 1927 in which the altered AUA start codon was observed (Table 2). While the codon AUA has been identified as a functional start codon in Escherichia coli, Bacillus subtilis and Salmonella spp., levels of translation are substantially reduced with this codon compared with the conventional start codon AUG (Romero and Garcia, 1991;
Sussman et al., 1996). Because the start codon mutation correlated precisely with the BCG strains having decreased sigK and mpb83/mpb70 expression, the functional consequence of the sigK mutation was examined.

Effect of sigK complementation on transcription in BCG Pasteur First, the effect of sigK complementation on its own expression by quantitative RT-PCR was determined. Complementation with the empty vector or with the mutant sigK resulted in no change of sigK expression, as seen with BCG
Pasteur::pMV306 (empty vector) and BCG Pasteur::pPAST. This latter result indicated that a second copy of the mutant gene did not alter levels of transcription.

In contrast, complementation with wild-type sigK, demonstrated with BCG
Pasteur::pH37Rv, BCG Pasteur::pRUSS and BCG Pasteur::pBIRK, showed a marked increase in transcription of sigK (Figure 3A). Similar results were obtained with a second clone of each of the same strains (data not shown). As the mutation in 5 sigK is predicted to impair translation, not transcription, and complementation of wild-type, but not mutant-type, sigK served to markedly increase sigK expression, these results signify that expression of this gene appears to be autoregulated, as has been described for other M. tuberculosis sigma factors (Helmann, 2002; Manganelli et al., 2004a).
Next, the effect of sigK complementation on mpb70 and mpb83 levels was determined, using the same clones and mRNA preparations. In BCG
Pasteur::pPAST and BCG Pasteur::pMV306, levels of mRNA were comparable to those previously demonstrated in low-producing strains of BCG. The same strains in which increased sigK expression was observed, BCG Pasteur::pH37Rv, BCG
Pasteur::pRUSS and BCG Pasteur::pBIRK, manifested highly increased transcription levels for mpb70 and mpb83, comparable to the levels observed with high-producing strains of BCG (Figure 3B). The same results were obtained with a second clone of the same strains (data not shown).
Effect of sigK complementation on MPB70 and MPB83 production To determine the effect of expression of wild-type sigK in BCG Pasteur on protein synthesis, culture filtrate proteins and whole-cell lysates from the sigK-complemented strains of BCG Pasteur were analysed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. MPB70 was detected in the culture filtrate proteins in BCG Pasteur::pH37Rv, BCG
Pasteur::pRUSS and BCG Pasteur::pBIRK, but could not be detected in Pasteur::pPAST or BCG Pasteur::pMV306 (Figure 3C). Similarly, MPB83 was detected in the whole-cell lysates of the same clones where MPB70 was abundantly detected in the culture filtrates (Figure 3D). Upon complementation of wild-type sigK, BCG Pasteur was able to produce MPB70 and MPB83 in a pattern consistent with high-producing strains.

Further expression analysis of genes neighbouring mpb70/mpb83 and sigK

Based on observed differences in expression of the genes neighbouring sigK and mpb70/mpb83 by microarraybased analysis of four BCG strains, quantitative RT-PCR was used to determine the effect of wild-type sigK
complementation on transcription in these regions. As shown in Figure 4A, expression of Rv0443c-Rv0449c was increased over twofold with sigK
complementation. Transcription of Rv2874, Rv2876 and Rv2877c was increased over 10-fold in the sigK-complemented strains compared with the control strain.
Rv2878c (mpt53) was also increased, although to a lesser extent, with fourfold increase seen in the sigKcomplemented strains. Contrary to expectations from previous study indicating that Rv2871-Rv2874 are cotranscribed (Juarez et al., 2001), no increase in expression of either Rv2871 or Rv2872 was detected, suggesting that these two genes are under separate transcriptional control.
Based on the differences in transcription, this sigK-regulated gene region includes Rv2873 through Rv2878, but not Rv2872 or Rv2879 (Figure 4B).

Microarray-based analysis of sigK complementation To further examine the role that sigK plays in global gene expression, global transcription was analysed in BCG Pasteur::pH37Rv, BCG Pasteur::pRUSS
and BCG Pasteur::pBIRK compared with BCG Pasteur::pMV306 by DNA microarray.
Results revealed increased expression of the majority of genes presented in Figure 4, with significant changes in expression as measured by both induction ratios and z-scores. Because of the stringency of the analysis performed, genes whose expression was induced in three of four arrays, but whose expression could not be optimally quantified on the fourth, were not included in the table (e.g.
mpb83). Only four genes were repressed with introduction of wild-type sigK; genes whose expression was increased were restricted to the sigK and the mpb70/83 regions (Table 3).

Comparative genomic studies have demonstrated the substantial genome decay experienced by BCG strains during a half-century of in vitro passage (Mostowy et al., 2003). While DNA microarray-based comparisons have efficiently uncovered genomic deletions as the most evident form of evolution, these tools overlook other forms of genomic variability, such as duplications and single nucleotide polymorphisms (SNPs). With targeted study of specific genes has come the recognition of numerous loss of function SNPs during BCG evolution, including a SNP that impairs synthesis of methoxymycolic acids (Behr et al., 2000), a SNP
predicted to decrease the DNA binding ability of a cAMP receptor protein (CRP) homologue (Spreadbury et al., 2005) and the start codon mutation described in this report. Remarkably, along with the loss of the RD2 region (Mahairas et al., 1996), these three SNPs all coincide with the interval 1927-1931, suggesting either a period of considerable in vitro evolution or the replacement of one BCG stock with another at the Pasteur Institute in the late 1920s.
The data presented here indicate that the sigK SNP occurred between 1927 and 1931 at the Pasteur Institute and resulted, either directly or indirectly, in a major drop in production of the antigenic proteins MPB70 and MPB83. These two proteins exhibit striking amino acid sequence homology (Hewinson et al., 1996) and both are exported, but localize differently. The single form of MPB70 is secreted into culture media while MPB83 is present in two forms, a 26 kDa lipoprotein which remains associated with the mycobacterial cell wall and a 23 kDa form which is found in the culture media (Harboe et al., 1998). The structure of MPB70 has recently been solved and superimposition of MPB83 on the MPB70 structure confirmed the overall homology of the antigens (Carr et al., 2003). From immunologic studies, it is known that both proteins induce cellular and humoral responses in experimental infection of model hosts and natural infection of humans (Miura et al., 1983; Haslov et al., 1987;
Fifis et al., 1994; Roche et al., 1994; Harboe et al., 1995; Wiker et al., 1996;
Vordermeier et al., 2000; Lyashchenko et al., 2001). Based on these observations, both MBP70 and MPB83 have been developed as candidates for novel TB vaccine development (Chambers et al., 2000; Morris et al., 2000; Al Attiyah et al., 2003;
Tollefsen et al., 2003; Xue et al., 2004). As extracellular antigens have consistently been implicated in the induction of a protective immune response against M.
tuberculosis, it is remarkable that all BCG strains are unable to produce the antigenic proteins ESAT-6 and CFP-10 (lost with the RD1 deletion of 1908-1921), while strains obtained after 1927-1931 are also deficient (through the deletion of RD2) in the proteins MPB64 (Harboe et al., 1986; Li et al., 1993) and CFP-21 (Mahairas et al., 1996; Weldingh et al., 1998; Weldingh and Andersen, 1999) and functionally deficient in production of MPB70 and MPB83 via the sigK mutation described here.

SigK is one of 10 extracytoplasmic function (ECF) sigma factors annotated in the M. tuberculosis H37Rv genome. As the name suggests, these regulatory elements mediate responses to changing external conditions (Manganelli et al., 2001; 2004b; Ando et al., 2003; Hu et al., 2004), with a common feature being their control over relatively small regulons (Bashyam and Hasnain, 2004). For instance, by microarray analysis, the regulon of sigC has been estimated to contain 13, 14 and 18 genes, in exponential, early and late stationary phase growth, respectively (Sun et al., 2004), consistent with present observations of two regions, comprising 13 genes, being consistently upregulated in wild-type sigK-complemented strains. Mutants of sigC, sigD, sigE and sigH all exhibit reduced virulence in animal models (Kaushal et al., 2002; Calamita et al., 2004; Raman et al., 2004; Sun et al., 2004), but to date, there have been no published papers looking specifically at M.
tuberculosis sigK. In transposon site hybridization studies, neither sigK nor any of the other genes in the regulon identified here was observed to be essential for in vivo growth in a murine model (Sassetti and Rubin, 2003). However, these experiments averaged the results for M. tuberculosis H37Rv and BCG Pasteur, and BCG
Pasteur is now shown to be functionally deficient in this regulon, therefore the impact of mutations in these genes may have been minimized. An epidemiologic study of M.
tuberculosis isolates in San Francisco used genomic hybridization studies to determine deletions in strains that had successfully caused TB, thereby generating a list of genes that are apparently nonessential for disease (Tsolaki et al., 2004). Of 224 genes disrupted in at least one clinical isolate, none of the genes implicated in the sigK nor the mpb83/70 regions is featured, suggesting that loss of these genes may be detrimental to disease causation.
The relevance of sigK-regulated genes is supported by transcriptome analysis of M. tuberculosis during intracellular conditions, where mpb70 and mpb83 figure among the most highly induced genes, across time points and in both activated and non-activated macrophages (Schnappinger et al., 2003). Additionally, in a microarray-based study of M. tuberculosis expression during murine infection, sigK
and mpt53 were among those genes noted as significantly dysregulated in vivo (Talaat et al., 2004). Together, these results point to a potential role of the sigK
regulon in the pathogenesis of TB that merits further attention.

The data presented here explain the difference in expression between high-producing and low-producing BCG strains. However, MPB70 and MPB83 are also differentially produced by M. tuberculosis and M. bovis. Although these organisms have identical, wild-type AUG sigK start codons, in vitro expression is low (although inducible) in M. tuberculosis and constitutively high in M. bovis (Wiker et a/., 1996). The constitutive in vitro production of MBP70 and MPB83 observed in M.
bovis may therefore stem from unregulated activity of SigK. Activity of an ECF
sigma can be mediated by a second protein, the anti-sigma factor, that functions post-translationally as a negative regulator to prevent constitutive expression of the target regulon (Helmann, 2002; Manganelli et al., 2004a). The sigma/anti-sigma pair are usually adjacent and co-transcribed genes; for instance, in M. tuberculosis, RshA
(Rv3221A) is the anti-sigma factor for SigH (Rv3223c) while UsfX (Rv3287c) is the anti-sigma factor for SigF (Rv3286c) (Beaucher et al., 2002; Song et al., 2003).
Consistent with this pattern, Rv0444c may encode the anti-sigma factor for sigK
(Rv0445c), and by extension, mutations in Rv0444c might result in unregulated expression of sigK. Ongoing investigations are pursuing this possibility, based on the presence of two non-synomyous SNPs in Rv0444c restricted to M. tuberculosis complex species presenting constitutively high MPB70 production (data not shown).

As BCG vaccines are given to an estimated 2 million infants per week, there are important practical implications of these findings. The sigK
mutation described here impairs the production of two immunodominant antigens, MPB70 and MPB83, as well as transcription of mpb53. The importance of this deficit for TB
immunization is unknown because strains of BCG that produce these antigens have never been utilized in a randomized clinical trial, although results from some observational studies have suggested a greater potency to some of the highproducer strains (Kroger et al., 1994; Vitkova et a/., 1995). Based on the number of documented differences between BCG strains obtained before 1927 and those obtained after 1931, there is compelling rationale to perform a human trial comparing BCG strains from these two groups. Furthermore, these results are also applicable towards efforts to develop improved vaccines against TB.

Recent advances have demonstrated that recombinant strains of BCG
expressing M. tuberculosis antigens provide an important avenue towards more effective vaccines (Horwitz et al., 2000; Pym et al., 2003). These constructs may benefit from the inherent MPB70 and MPB83 expression of the high-producing 5 strains obtained before 1931, or alternatively, by correcting the sigK
mutation in later strains to achieve the same result.

Example 1: IMMUNIZATION EXPERIMENTS WITH GUINEA PIGS

Recombinant BCG Pasteur expressing sigK from BCG Russia were used 10 in the experiments.

Hartley guinea pigs were vaccinated with 103 CFU of recombinant BCG.
Guinea pigs were rested for 10 weeks and then infected with a low dose aerosol of M. tuberculosis H37Rv. Viable count was performed at day 30 post challenge on 15 guinea pigs per group (Figure 5).

The results are shown in Table 5. Preliminary real-time PCR analysis of blood samples taken from guinea pigs post-vaccination, pre-challenge: IFN-y -negative for all guinea pigs.
Example 2: IMMUNIZATION EXPERIMENTS WITH MICE

The protocol used for mice was similar to that used for the guinea pigs described in Example 1. Vaccination was with 106 bacteria injected sub-cutaneously. The mice were challenged with 104 of Mycobacterium tuberculosis weeks later. Results appeared 4 and 8 weeks after challenge (Figure 6).

For immunogenicity, the vaccine was once again 106 bacteria injected sub-cutaneously. Spleens were harvested 28 days later, splenocytes were isolated and plated in tissue culture plates, then stimulated with either nothing (control), PHA, MPB 70 (2 doses) with gamma interferon being read in the supernatant by ELISA
(Figure 7).

Although the present invention has been described hereinabove by way of preferred embodiments thereof, it can be modified without departing from the spirit, scope and the nature of the subject invention, as defined in the appended claims.

~
~
~
C_ T C ~ C C
~ fn C_ C C_ ~
O :222 2O 2 'n. o 2 2 0_ a Q~
4) p fl. C. n a). '~ V N a) c L
a - ~ ~o c o c 2 c c o ~ (o 0 S
~ U L~ L L L d ~ 7 a aE 0 0E E E 2 2 tn U d fn U U
G> E C C4 ' C ~
C ~ 2 L LL (6 C '0 (6 w +z o O
Z Q) N Z O
ra/) N C C C N () ' y~ C
O o O co ~ Q U U U~ wU ~
O
U
T
U
V N t- - N M O lf) NC7 N
E VJ MC) C) 4 6 N N U~ U=) rt CV N
C N
d >
d t t4 6> 00 _ o0 C'7 M m N N M
L m U) 6 LL
V

W ~
0 co Co00 CV rt 6) ~ Lo C) co Q) ~
=, y M M M d' 6 N CV (D (D 4 M CV
N
~ y f0 a ~ - >

cn v s ch co rn co u, r~ ~n o cfl cD 4 C? 1 C? c.i 7 7 7 U.
co cv o E Y .~ 2 C.
U y O_~ 4 Q Q m z c,, '0' co ~
t--H' o 0 0 0 o N~~~~ ~ (D
~ z cc cc or o_ Table 2 Sequence analysis of sigK across M. tuberculosis complex members.

Strains 31 bp prior to start 3bp of start codon codon M. canettii T G
M.tuberculosis H37Rv A G
M.tuberculosis H37Ra A G
M. africanum T G
M. microti T G
M.caprae T G
M.bovis T G
BCG Russia T G
BCG Moreau T G
BCG Japan T G
BCG Sweden T G
BCG Birkhaug T G
BCG Prague T A
BCG Glaxo T A
BCG Denmark T A
BCG Tice T A
BCG Connaught T A
BCG Frappier T A
BCG Phipps T A
BCG Pasteur T A

~
~
co U
~
C 0 c: C
a~ cn c c c m O ~
p 2 N N~ OO ~ p 2 a Q o o m m a a a c o a) LO a n - ~ ~C GJ V q> a .r Y +' C d (4 _cv E 0~0 C C C C ~ o .~ . 0' V U o c 9 p, E
O aE i a ' -~ a a~i O Q E o 0 o c~c E L
Q c~ ~a a m ~ r cn c a v a) cca U' o f4 C o -p z Z 6 ~ m c ai ~ o vi a~ Q n r= c fl. ~ ~ o ~ ~ (C'0 0Q U U O 0 0 ~
0, U
o a (a a.
>
U > 0 d: N O CD N M M LA N N M O
w y N Lf) 4 iI) lC) C'") N CV O) r-~ 6 M N
m N
O
C V) +' O Q
+. : a aD
c v v =' (D O) O V M CO N CO CO . h ~-..r N
E a m V N 6 6 CO M M N ~.'.. cj N U' O

Q U U-E

U
Q > 0 (D M LO00 U')N N CV O -,T
Y N U) 4 f~ (D M CV CV ~. I-~ CO N
N
~
N m p) Y 3 C
cu v a o C7 c O O~.O .-- N ~C? (O ty m V N CD r M N N
co CNO M
c a. o O ti O U
u~ m O
L
Q.
x O y O c o> Q Q 4 N~ 'M m ~ 4) Q OL

~
O
c !On v . . ~.~O' r~ OJ' Oi v co eV- tt lp CO
U. 14" ~r v <r tr 00 cv m r, r, r, CD
14- v'r v rr ao w oao mCO W co o 0 0 0 0> ~>~~~>>

H

Table 4 Sequences of primers and molecular beacons for quantitative RT-PCR

Gene Left Primer (5' to 3') Right Primer (5' to 3') Beacon SigA tgcagtcggtgctggaca cgcgcaggacctgtgagc cctcgcgtcgaagttgcgccatccgagcgagg SigK agtttgactccgccaaaggt gcaccatagcgcacttcc gcagcctgtcgaccgagtccgttggctgc mpb70 ctcgaacaatccggagttgaca acaccgtgtactgaccgctgtt gcagccagctcaatccgcaagtaaacctgggctgc mpb83 atcaactcaagactgacgccaaac caccttgcagggtctgatgg gcagccagcatcctgacctaccacgtgaggctgc Dxr gggacttgaggtcatcgaaa tatggaaatcacaggcagca Rv2871 gtatcgatgacgagctgtacc ttggacgatagatcgacacc Rv2872 gactatcggggtttgcttga tcaacatcggacgctaactg DipZ tcggttggtatcaggcctac ggtccaagtggcgtagttgt Rv2876 agtgggagttcgacgtcagt acgtgatcaggaaccagtcc Rv2877c ggttccatgtatggctacgg agccagatagatcgctacgc mpb53 gttcggtctggccaatacac cgtccagaaccacaacacc Rv2879c gcgacgggtgtctattgagt taccgtgcaggaaactcctt Rv2880c aacacggtctgcatttcctc cccatacccatgaacaccac CdsA tggtcgttgtctgcatgatt gagccattttccgggtagac Rv0441 c tgggtgccaaaaaggtagac ccacaacagggtgacttcg PPE10 caattcggcactgatgtttg caggctaggtactgggttgc Rv0443 cgggtgcaggatatacaggt tagtaccccgacagcaggtc Rv0444c ggccgagcaagttctgac gcagccacatctgatacacg Rv0446c tggcaactgtgggtattcaa cagcaggtaggtcatcagca ufaA1 ccgacctttcgacctagttg tgaacattgcgcacgaatac Rv0448c cttctacgtttcgccgtttc tcatcgcgatctgtcttgtc Rv0449c cccacacccactatctggac acatcgacatttccgactcc MmpL4 ctaaattcgcgaacgactcc cttccagtgacgggacaaat MmpS4 cct aaaaca caaaccat ccacgatatttcccatcacc ~

~~ ~ ~'Cl- J -0 ~

N -00 1- Lf7 O
> Lf? CV 7r O
J O O O O
(a ~
cn LL
U) u CV O O
or- o Lf) N O
c+ ) Cq N C1l (D O
U J
E
2 C,o~ oo c0~
=~ ~ U uc) r- cq - C,i ry J
co (D -) = aa cy o 0 cn ~ ~ Lf) o rv 0) LO o~
~
D
cn LL
2 U 7- c+) un r-n. o rv cQ a7 ~j ~ uC) r) rti rti L ~
~ J
~
fa O
(D V' 0~0 O(D
J u o o aD
~

O r S7 ~ I. (N~ NN
O O O O
E J
~

~ LL
(, C+'? 00 00 (O
LO o c+7 N CO
?5 Lf7 O
Q J
H
~
~
~ D
U) U
L _ L
~ O ~
<D (D
Q aD~ U~
U U U
=~

REFERENCES

Agger, E.M., and Andersen, P. (2002) A novel TB vaccine; towards a strategy based on our understanding of BCG failure. Vaccine 21: 7-14.

Al Attiyah, R., Shaban, F.A., Wiker, H.G., Oftung, F., and Mustafa, A.S.
(2003) Synthetic peptides identify promiscuous human Th1 cell epitopes of the secreted mycobacterial antigen MPB70. Infect Immun 71: 1953-1960.

Andersen, P. (1994) Effective vaccination of mice against Mycobacterium tuberculosis infection with a soluble mixture of secreted mycobacterial proteins. Infect Immun 62: 2536-2544.

Ando, M., Yoshimatsu, T., Ko, C., Converse, P.J., and Bishai, W.R. (2003) Deletion of Mycobacterium tuberculosis sigma factor E results in delayed time to death with bacterial persistence in the lungs of aerosol-infected mice. Infect Immun 71:

7172.

Bashyam, M.D., and Hasnain, S.E. (2004) The extracytoplasmic function sigma factors: role in bacterial pathogenesis. Infect Genet Evol 4: 301-308.

Beaucher, J., Rodrigue, S., Jacques, P.E., Smith, I., Brzezinski, R., and Gaudreau, L.
(2002) Novel Mycobacterium tuberculosis anti-sigma factor antagonists control sigmaF activity by distinct mechanisms. Mol Microbiol 45: 1527-1540.

Behr, M.A. (2002) BCG - different strains, different vaccines? Lancet Infect Dis 2:
86-92.

Behr, M.A., and Small, P.M. (1999) A historical and molecular phylogeny of BCG
strains. Vaccine 17: 915-922.

Behr, M.A., Wilson, M.A., Gill, W.P., Salamon, H., Schoolnik, G.K., Rane, S., and Small, P.M. (1999) Comparative genomics of BCG vaccines by whole-genome DNA
microarray. Science 284: 1520-1523.

Behr, M.A., Schroeder, B.G., Brinkman, J.N., Slayden, R.A., and Barry, C.E., III
(2000) A point mutation in the mma3 gene is responsible for impaired methoxymycolic acid production in Mycobacterium bovis BCG strains obtained after 1927. J Bacteriol 182: 3394-3399.

Belley, A., Alexander, D., Di Pietrantonio, T., Girard, M., Jones, J., Schurr, E., et al.
(2004) Impact of methoxymycolic acid production by Mycobacterium bovis BCG
vaccines. Infect lmmun 72: 2803-2809.

Brodin, P., Rosenkrands, I., Andersen, P., Cole, S.T., and Brosch, R. (2004) proteins: protective antigens and virulence factors? Trends Microbiol 12: 500-508.
Brosch, R., Gordon, S.V., Buchrieser, C., Pym, A.S., Garnier, T., and Cole, S.T.
(2000) Comparative genomics uncovers large tandem chromosomal duplications in Mycobacterium bovis BCG Pasteur. Yeast 17: 111-123.

Calamita, H., Ko, C., Tyagi, S., Yoshimatsu, T., Morrison, N.E., and Bishai, W.R.
(2004) The Mycobacterium tuberculosis SigD sigma factor controls the expression of ribosome-associated gene products in stationary phase and is required for full virulence. Cell Microbiol. doi: 10.1111/j.1462-5822.2004.00454.x.

Carr, M.D., Bloemink, M.J., Dentten, E., Whelan, A.O., Gordon, S.V., Kelly, G., et al.
(2003) Solution structure of the Mycobacterium tuberculosis complex protein MPB70:
from tuberculosis pathogenesis to inherited human corneal disease. J Biol Chem 278: 43736-43743.

Chambers, M.A., Vordermeier, H., Whelan, A., Commander, N., Tascon, R., Lowrie, D., and Hewinson, R.G. (2000) Vaccination of mice and cattle with plasmid DNA
encoding the Mycobacterium bovis antigen MPB83. Clin Infect Dis 30 (Suppl. 3):
S283-S287.

Chambers, M.A., Williams, A., Hatch, G., Gavier-Widen, D., Hall, G., Huygen, K., et al. (2002) Vaccination of guinea pigs with DNA encoding the mycobacterial antigen MPB83 influences pulmonary pathology but not hematogenous spread following aerogenic infection with Mycobacteriumbovis. Infect Immun 70: 2159-2165.

Chambers, M.A., Gavier-Widen, D., and Hewinson, R.G. (2004) Antibody bound to the surface antigen MPB83 of Mycobacterium bovis enhances survival against high dose and low dose challenge. FEMS Immunol Med Microbiol 41: 93-100.

Doherty, T.M., Olsen, A.W., Weischenfeldt, J., Huygen, K., D'Souza, S., Kondratieva, T.K., et al. (2004) Comparative analysis of different vaccine constructs expressing defined antigens from Mycobacterium tuberculosis. J Infect Dis 190: 2146-2153.
Fifis, T., Corner, L.A., Rothel, J.S., and Wood, P.R. (1994) Cellular and humoral immune responses of cattle to purified Mycobacterium bovis antigens. Scand J
Immunol 39: 267-274.

Fine, P.E. (1995) Variation in protection by BCG: implications of and for heterologous immunity. Lancet 346: 1339-1345.

Harboe, M., and Nagai, S. (1984) MPB70, a unique antigen of Mycobacterium bovis BCG. Am Rev Respir Dis 129: 444-452.

Harboe, M., Nagai, S., Patarroyo, M.E., Torres, M.L., Ramirez, C., and Cruz, N.
(1986) Properties of proteins MPB64, MPB70, and MPB80 of Mycobacterium bovis BCG. Infect Immun 52: 293-302.

Harboe, M., Nagai, S., Wiker, H.G., Sletten, K., and Haga, S. (1995) Homology between the MPB70 and MPB83 proteins of Mycobacterium bovis BCG. Scand J
Immunol 42: 46-51.

Harboe, M., Oettinger, T., Wiker, H.G., Rosenkrands, I., and Andersen, P.
(1996) Evidence for occurrence of the ESAT-6 protein in Mycobacterium tuberculosis and virulent Mycobacterium bovis and for its absence in Mycobacterium bovis BCG.
Infect Immun 64: 16-22.

Harboe, M., Wiker, H.G., Ulvund, G., Lund-Pedersen, B., Andersen, A.B., Hewinson, R.G., and Nagai, S. (1998) MPB70 and MPB83 as indicators of protein localization in mycobacterial cells. Infect Immun 66: 289-296.

Haslov, K., Andersen, A.B., and Bentzon, M.W. (1987) Biological activity in sensitized guinea pigs of MPB 70, a protein specific for some strains of Mycobacterium bovis BCG. Scand J lmmunol 26: 445-454.

Helmann, J.D. (2002) The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol 46: 47-110.

Hewinson, R.G., Michell, S.L., Russell, W.P., McAdam, R.A., and Jacobs, W.R., Jr (1996) Molecular characterization of MPT83: a seroreactive antigen of Mycobacterium tuberculosis with homology to MPT70. Scand J Immunol 43: 490-499.

Horwitz, M.A., Harth, G., Dillon, B.J., and Maslesa-Gali , S. (2000) Recombinant bacillus calmette-guerin (BCG) vaccines expressing the Mycobacterium tuberculosis 30-kDa major secretory protein induce greater protective immunity against tuberculosis than conventional BCG vaccines in a highly susceptible animal model.
Proc Natl Acad Sci USA 97: 13853-13858.

Hu, Y., Kendall, S., Stoker, N.G., and Coates, A.R. (2004) The Mycobacterium tuberculosis sigJ gene controls sensitivity of the bacterium to hydrogen peroxide.
FEMS Microbiol Lett 237: 415-423.

Juarez, M.D., Torres, A., and Espitia, C. (2001) Characterization of the Mycobacterium tuberculosis region containing the mpt83 and mpt70 genes. FEMS
Microbiol Lett 203: 95-102.

Kaushal, D., Schroeder, B.G., Tyagi, S., Yoshimatsu, T., Scott, C., Ko, C., et al.
(2002) Reduced immunopathology and mortality despite tissue persistence in a Mycobacterium tuberculosis mutant lacking alternative sigma factor, SigH. Proc Natl Acad Sci USA 99: 8330-8335.

Kroger, L., Brander, E., Korppi, M., Wasz-Hockert, 0., Backman, A., Kroger, H., et al.
(1994) Osteitis after newborn vaccination with three different Bacillus Calmette-Guerin vaccines: twenty-nine years of experience. Pediatr Infect Dis J 13: 113-116.
Lewis, K.N., Liao, R., Guinn, K.M., Hickey, M.J., Smith, S., Behr, M.A., and Sherman, D.R. (2003) Deletion of RD1 from Mycobacterium tuberculosis mimics bacille Calmette-Guerin attenuation. J lnfect Dis 187: 117-123.

Li, H., Ulstrup, J.C., Jonassen, T.O., Melby, K., Nagai, S., and Harboe, M.
(1993) Evidence for absence of the MPB64 gene in some substrains of Mycobacterium bovis BCG. Infect Immun 61: 1730-1734.

Lyashchenko, K.P., Wiker, H.G., Harboe, M., McNair, J., Komissarenko, S.V., and Pollock, J.M. (2001) Novel monoclonal antibodies against major antigens of Mycobacterium bovis. Scand J Immunol 53: 498-502.

Mahairas, G.G., Sabo, P.J., Hickey, M.J., Singh, D.C., and Stover, C.K. (1996) Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J Bacteriol 178: 1274-1282.

Manganelli, R., Dubnau, E., Tyagi, S., Kramer, F.R., and Smith, I. (1999) Differential expression of 10 sigma factor genes in Mycobacterium tuberculosis. Mol Microbiol 31: 715-724.

Manganelli, R., Voskuil, M.I., Schoolnik, G.K., and Smith, I. (2001) The Mycobacterium tuberculosis ECF sigma factor sigmaE: role in global gene expression and survival in macrophages. Mol Microbiol41: 423-437.

Manganelli, R., Provvedi, R., Rodrigue, S., Beaucher, J., Gaudreau, L., Smith, I., and Proveddi, R. (2004a) Sigma factors and global gene regulation in Mycobacterium tuberculosis. J Bacteriol 186: 895-902.

Manganelli, R., Fattorini, L., Tan, D., Iona, E., Orefici, G., Altavilla, G., et al. (2004b) The extra cytoplasmic function sigma factor sigma(E) is essential for Mycobacterium tuberculosis virulence in mice. Infect Immun 72: 3038-3041.

Matsumoto, S., Matsuo, T., Ohara, N., Hotokezaka, H., Naito, M., Minami, J., and Yamada, T. (1995) Cloning and sequencing of a unique antigen MPT70 from Mycobacterium tuberculosis H37Rv and expression in BCG using E. coli-mycobacteria shuttle vector. Scand J Immunol 41: 281-287.

Matsuo, T., Matsumoto, S., Ohara, N., Kitaura, H., Mizuno, A., and Yamada, T.
(1995) Differential transcription of the MPB70 genes in two major groups of Mycobacterium bovis BCG substrains. Microbiology 141 (Pt 7): 1601-1607.

Miura, K., Nagai, S., Kinomoto, M., Haga, S., and Tokunaga, T. (1983) Comparative studies with various substrains of Mycobacterium bovis BCG on the production of an antigenic protein, MPB70. Infect Immun 39: 540-545.

Morris, S., Kelley, C., Howard, A., Li, Z., and Collins, F. (2000) The immunogenicity of single and combination DNA vaccines against tuberculosis. Vaccine 18: 2155-2163.

Mostowy, S., Tsolaki, A.G., Small, P.M., and Behr, M.A. (2003) The in vitro evolution of BCG vaccines. Vaccine 21: 4270-4274.

Mostowy, S., Cleto, C., Sherman, D.R., and Behr, M.A. (2004) The Mycobacterium tuberculosis complex transcriptome of attenuation. Tuberculosis (Edinb) 84:

204.

Mustafa, A.S., Amoudy, H.A., Wiker, H.G., Abal, A.T., Ravn, P., Oftung, F., and Andersen, P. (1998) Comparison of antigen-specific T-cell responses of tuberculosis patients using complex or single antigens of Mycobacterium tuberculosis. Scand J
Immunol 48: 535-543.

Nagai, S., Matsumoto, J., and Nagasuga, T. (1981) Specific skin-reactive protein from culture filtrate of Mycobacteriumbovis BCG. Infect Immun 31: 1152-1160.

Olsen, I., and Wiker, H.G. (1998) Diffusion blotting for rapid production of multiple identical imprints from sodium dodecyl sulfate polyacrylamide gel electrophoresis on a solid support. J Immunol Methods 220: 77-84.

Pym, A.S., Brodin, P., Brosch, R., Huerre, M., and Cole, S.T. (2002) Loss of contributed to the attenuation of the live tuberculosis vaccines Mycobacterium bovis BCG and Mycobacterium microti. Mol Microbiol 46: 709-717.

Pym, A.S., Brodin, P., Majlessi, L., Brosch, R., Demangel, C., Williams, A., et al.
(2003) Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis. Nat Med 9: 533-539.

Raman, S., Hazra, R., Dascher, C.C., and Husson, R.N. (2004) Transcription regulation by the Mycobacterium tuberculosis alternative sigma factor SigD and its role in virulence. J Bacteriol 186: 6605-6616.

Roche, P.W., Triccas, J.A., Avery, D.T., Fifis, T., Billman-Jacobe, H., and Britton, W.J. (1994) Differential T cell responses to mycobacteria-secreted proteins distinguish vaccination with bacille Calmette-Guerin from infection with Mycobacterium tuberculosis. J Infect Dis 170: 1326-1330.

Romero, A., and Garcia, P. (1991) Initiation of translation at AUC, AUA and AUU
codons in Escherichia coli. FEMSMicrobiol Lett 68: 325-330.

Sassetti, C.M., and Rubin, E.J. (2003) Genetic requirements for mycobacterial survival during infection. Proc Natl Acad Sci USA 100: 12989-12994.

Schnappinger, D., Ehrt, S., Voskuil, M.I., Liu, Y., Mangan, J.A., Monahan, I.M., et al.
(2003) Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J Exp Med 198: 693-704.
Song, T., Dove, S.L., Lee, K.H., and Husson, R.N. (2003) RshA, an anti-sigma factor that regulates the activity of the mycobacterial stress response sigma factor SigH.
Mol Microbiol 50: 949-959.

Spreadbury, C., Pallen, M., Overton, T., Behr, M., Mostowy, S., Spiro, S., et al.
(2005) Point mutations in the DNA- and cNMP-binding domains of the homologue of the cAMP receptor protein (CRP) in Mycobacterium bovis BCG: implications for the inactivation of a global regulator and strain attenuation. Microbiology (in press).

Stover, C.K., de Ia Cruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., et al. (1991) New use of BCG for recombinant vaccines. Nature 351: 456-460.

Sun, R., Converse, P.J., Ko, C., Tyagi, S., Morrison, N.E., and Bishai, W.R.
(2004) Mycobacterium tuberculosis ECF sigma factor sigC is required for lethality in mice and for the conditional expression of a defined gene set. Mol Microbiol 52: 25-38.
Sussman, J.K., Simons, E.L., and Simons, R.W. (1996) Escherichia coli translation initiation factor 3 discriminates the initiation codon in vivo. Mol Microbiol 21: 347-360.
Talaat, A.M., Lyons, R., Howard, S.T., and Johnston, S.A. (2004) The temporal expression profile of Mycobacterium tuberculosis infection in mice. Proc Natl Acad Sci USA 101: 4602-4607.

Tollefsen, S., Pollock, J.M., Lea, T., Harboe, M., and Wiker, H.G. (2003) T-and B-cell epitopes in the secreted Mycobacterium bovis antigen MPB70 in mice. Scand J
Immunol 57: 151-161.

Tsolaki, A.G., Hirsh, A.E., DeRiemer, K., Enciso, J.A., Wong, M.Z., Hannan, M., et al.
(2004) Functional and evolutionary genomics of Mycobacterium tuberculosis:
insights from genomic deletions in 100 strains. Proc Natl Acad Sci USA 101: 4865-4870.
Vitkova, E., Galliova, J., Krepela, K., and Kubin, M. (1995) Adverse reactions to BCG. Cent Eur J Public Health 3: 138-141.

Vordermeier, H.M., Cockle, P.J., Whelan, A.O., Rhodes, S., Chambers, M.A., Clifford, D., et al. (2000) Effective DNA vaccination of cattle with the mycobacterial antigens MPB83 and MPB70 does not compromise the specificity of the comparative intradermal tuberculin skin test. Vaccine 19: 1246-1255.

Vosloo, W., Tippoo, P., Hughes, J.E., Harriman, N., Emms, M., Beatty, D.W., et al.
(1997) Characterisation of a lipoprotein in Mycobacterium bovis (BCG) with sequence similarity to the secreted protein MPB70. Gene 188: 123-128.

Weldingh, K., and Andersen, P. (1999) Immunological evaluation of novel Mycobacterium tuberculosis culture filtrate proteins. FEMS Immunol Med 23: 159-164.

Weldingh, K., Rosenkrands, I., Jacobsen, S., Rasmussen, P.B., Elhay, M.J., and Andersen, P. (1998) Two-dimensional electrophoresis for analysis of Mycobacterium tuberculosis culture filtrate and purification and characterization of six novel proteins.
Infect Immun 66: 3492-3500.

Wessel, D., and Flugge, U.I. (1984) A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal Biochem 138:

143.

Wiker, H.G., Nagai, S., Hewinson, R.G., Russell, W.P., and Harboe, M. (1996) Heterogenous expression of the related MPB70 and MPB83 proteins distinguish various substrains of Mycobacterium bovis BCG and Mycobacterium tuberculosis H37Rv. Scand J Immunol 43: 374-380.

Wiker, H.G., Lyashchenko, K.P., Aksoy, A.M., Lightbody, K.A., Pollock, J.M., Komissarenko, S.V., et al. (1998) Immunochemical characterization of the and MPB83 proteins of Mycobacterium bovis. Infect Immun 66: 1445-1452.

Xue, T., Stavropoulos, E., Yang, M., Ragno, S., Vordermeier, M., Chambers, M., et al. (2004) RNA encoding the MPT83 antigen induces protective immune responses against Mycobacterium tuberculosis infection. Infect Immun 72: 6324-6329.

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims (35)

1. A method of improving a tuberculosis vaccine comprising:

Introducing a nucleotide sequence corresponding to SEQ ID No: 1 into a host organism that is used to make the tuberculosis vaccine.

2. A method as defined in claim 1, wherein said nucleotide sequence is introduced via a nucleotide vector.

3. A method as defined in claim 1, wherein said host organism is chosen from a group comprising M. tuberculosis, M. bovis, M. caprae, M. microti, M. africanum, M. canettii, M. pinnipedii.

4. A method as defined in claim 1, wherein said tuberculosis vaccine is chosen from from a group comprising M. tuberculosis, M. bovis, M.
caprae, M. microti, M. africanum, M. canettii, M. pinnipedii.

5. A method as defined in claim 1, wherein said tuberculosis vaccine is BCG.

6. A method as defined in claim 5, wherein said BCG is chosen from a group comprising BCG Russia, BCG Moreau, BCG Japan, BCG Sweden, BCG
Birkhaug, BCG Prague, BCG Glaxo, BCG Denmark, BCG Tice, BCG
Connaught, BCG Frappier, BCG Phipps and BCG Pasteur.

7. A vaccine produced by the methods of any one of claims 1-6.

8. Use of a vaccine as defined in claim 7 for the immunization of a mammal against tuberculosis.

9. A use as defined in claim 8, wherein said mammal is chosen from the group comprising man, sheep, goats, pigs, deer, elk, bison, cows, steers, bulls and oxen.

10. A method of producing antigenic proteins mpb70 and mpb83 (or mpt70 and mpt83) comprising the steps of:

Introducing a nucleotide sequence corresponding to SEQ ID No: 1 into a host organism that is used to make a tuberculosis vaccine;

Culturing the host organism; and Isolating the mpb70 and mpb83 (or mpt70 and mpt83) proteins resulting from culturing said organism.

11. A method of making a tuberculosis vaccine comprising use of the antigenic proteins of claim 9.

12. A tuberculosis vaccine produced by the method of claim 11.

13. Use of a vaccine as defined in claim 7 for the immunization of a mammal against tuberculosis.

14. A nucleic acid molecule comprising the nucleotide sequence of SEQ ID
NO: 1 operably linked to nucleotide sequences coding for mpb70 and mpb83.

15. An expression vector comprising the nucleic acid molecule of claim 14 operably linked to an expression control sequence.

16. A cultured cell comprising the nucleic acid molecule of claim 14 operably linked to an expression control sequence.

17. A cultured cell transfected with the vector of claim 15, or a progeny of said cell, wherein the cell expresses the polypeptide corresponding to SEQ ID NO: 2, mpb70 and mpb83.

18. A method of producing proteins, the method comprising culturing the cell of claim 16 under conditions permitting expression of the polypeptide corresponding to SEQ ID NO: 2 as well as mpb70 and mpb83.

19. A method of producing proteins, the method comprising culturing the cell of claim 17 under conditions permitting expression under the control of the expression control sequence, and purifying the proteins from the cell or the medium of the cell.

20. An isolated DNA the nucleotide sequence of which consists of SEQ ID
No: 3.

21. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID No: 3, or a degenerative variant of SEQ ID NO: 3.

22. An isolated nucleic acid molecule comprising a sequence that encodes a polypeptide with the amino acid sequence of SEQ ID NO:4.

23. An isolated nucleic acid molecule comprising a sequence that hybridizes under highly stringent conditions to a hybridization probe the nucleotide sequence of which consists of SEQ ID NO: 3, or the complement of SEQ
ID NO:3.

24. An isolated nucleic acid molecule comprising a sequence that encodes a polypeptide having the sequence of SEQ ID NO:4, or SEQ ID NO: 4 with conservative amino acid substitutions.

25. An isolated nucleic acid molecule comprising a sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, or a fragment of SEQ ID NO: 4 which includes at least the first 8 residues of the amino acid sequence of SEQ ID NO: 4.

26. A single-stranded nucleic acid molecule that hybridizes under highly stringent conditions to a nucleic acid having the sequence of SEQ ID NO:
3.

27. An isolated nucleic acid molecule comprising at least 10 consecutive nucleotides of SEQ ID NO: 3.

28. An isolated nucleic acid molecule comprising at least 10 consecutive nucleotides of SEQ ID NO: 1, including nucleotide 3 wherein the G is replaced by A.

29. An isolated nucleic acid molecule comprising the complement of the nucleic acid molecule of claim 27 or 28.

30. A single-stranded DNA probe that hybridizes to a variant form of the gene for sigma K and not to wild type sigma K, wherein the variant form has an A at position 3 of SEQ ID NO: 1.

31. The probe of claim 30, wherein the probe is detectably labeled.

32. An array of nucleic acid molecules attached to a solid support, the array comprising an oligonucleotide that will hybridize to a nucleic acid molecule consisting of SEQ ID NO: 1, wherein the G at position 3 is replaced by A, under conditions in which the oligonucleotide will not substantially hybridize to a nucleic acid molecule consisting of SEQ ID
NO: 1.

33. A method of determining the potency of a strain of tuberculosis or tuberculosis vaccine comprising:

Obtaining a sample of nucleic acid from said strain or vaccine; and Determining the identity of the nucleotide at position 3 of the open reading frame of sigma K.

34. The method of claim 33, wherein the determining step comprises amplifying at least a portion of a nucleic acid molecule encoding sigma K.

35. The method of claim 33, wherein the determining step comprises sequencing at least a portion of the nucleic acid molecule encoding sigma K.