CA2571917A1 - Corynebacterium glutamicum genes encoding metabolic pathway proteins - Google Patents

Abstract

Isolated nucleic acid molecules, designated MP nucleic acid molecules, which encode novel MP
proteins form Corynebacterium glutamicum are described. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing MP nucleic acid molecules, and host cells into which the expression vectors have been introduced. The invention still further provides isolated MP proteins, mutated MP proteins, fusion proteins, antigenic peptides and methods for the improvement of production of a desired compound from C. glutamicum based on genetic engineering of MP genes in this organism.

Description

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME t DE 2 NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

hJOTE: For additional volumes please contact the Canadian Patent O~ce.

CORYIVEBACTERIFIMGLUTAMfCUMGENES ENCODING METABOLIC
PATHWAY PROTEINS
This application is a divisional application derived from Patent Application Serial No. 2,402,186 which is a National Phase application derived from PCT
Application IB2000/02035 filed December 22, 2000 and entitled "Corynebacterium Glutamicum Genes Encoding Metabolic Pathway Proteins"
Background of the Invention Certain products and by-products of naturally-occurring metabolic processes in cells have utility in a wide array of industries, including the food, feed, cosmetics, and pharmaceutical industries. These molecules, collectively termed 'fme chemicals', include organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, and enzymes. Their production is most conveniently performed through large-scale culture of bacteria developed to produce and secrete large quantities of a particular desired molecule. One particularly useful organism for this purpose is Corynebacterium glutamicum, a gram positive, nonpathogenic bacterium. Through strain selection, a number of mutant strains have been developed which produce an array of desirable compounds. However, selection of strains improved for the production of a particular molecule is a time-consuming and difficult process.
Summary of the Invention The invention provides novel bacterial nucleic acid molecules which have a variety of uses. These uses include the identification of microorganisms which can be used to produce fine chemicals (e.g., amino acids, such as, for example, lysine and methionine), the modulation of fme chemical production in C. glutamicum or related bacteria, the typing or identification of C. glutamicum or related bacteria, as reference points for mapping the C. glutamicum genome, and as markers for transformation.
These novel nucleic acid molecules encode proteins, referred to herein as metabolic pathway (MP) proteins.
C. glutamicum is a gram positive, aerobic bacterium which is commonly used in industry for the large-scale production of a variety of fine chemicals, and also for the degradation of hydrocarbons (such as in petroleum spills) and for the oxidation of terpenoids. The MP nucleic acid molecules of the invention, therefore, can be used to identify microorganisms which can be used to produce fine chemicals, e.g., by fermentation processes. Modulation of the expression of the MP nucleic acids of the invention, or modification of the sequence of the MP nucleic acid molecules of the invention, can be used to modulate the production of one or more fine chemicals from a I5 microorganism (e.g., to improve the yield or production of one or more fine chemicals from a Corynebacterium or Brevibacterium species). In a preferred embodiment, the MP genes of the invention are combined with one or more genes involved in the same or different metabolic pathway to modulate the production of one or more fine chemicals from a microorganism.
The MP nucleic acids of the invention may also be used to identify an organism as being Corynebacterium glutamicum or a close relative thereof, or to identify the presence of C. glutamicum or a relative thereof in a mixed population of microorganisms. The invention provides the nucleic acid sequences of a number of C.
glutamicum genes; by probing the extracted genomic DNA of a culture of a unique or mixed population of microorganisms under stringent conditions with a probe spanning a region of a C. glutamicum gene which is unique to this organism, one can ascertain whether this organism is present. Although Corynebacterium glutamicum itself is nonpathogenic, it is related to species pathogenic in humans, such as Corynebacterium diphtheniae (the causative agent of diphtheria); the detection of such organisms is of significant clinical relevance.
The MP nucleic acid molecules of the invention may also serve as reference points for mapping of the C: glutamicum genome, or of genomes of related organisms.

Similarly, these molecules, or variants or portions thereof, may serve as markers for genetically engineered Corynebacterium or Brevibacterium species.
The MP proteins encoded by the novel nucleic acid molecules of the invention are capable of, for example, performing an enzymatic step involved in the metabolism of certain fine chemicals, including amino acids, e.g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose. Given the availability of cloning vectors for use in Corynebacterium glutamicum, such as those disclosed in Sinskey et al., U.S. Patent No. 4,649,119, and techniques for genetic manipulation of C.
glutamicum and the related Brevibacterium species (e.g., lactofermentum) (Yoshihama et al, J. Bacteriol. 162: 591-597 (1985); Katsumata et al., J. Bacteriol. 159:

(1984); and Santamaria et al., .I. Gen. Microbiol. 130: 2237-2246 (1984)), the nucleic acid molecules of the invention may be utilized in the genetic engineering of this organism to make it a better or more efficient producer of one or more fine chemicals.
This improved production or efficiency of production of a fine chemical may be due to a direct effect of manipulation of a gene of the invention, or it may be due to an indirect effect of such manipulation. Specifically, alterations in C.
glutamicum metabolic pathways for amino acids, e.g., lysine and methionine, vitamins, cofactors, nucleotides, and trehalose may have a direct impact on the overall production of one or more of these desired compounds from this organism. For example, optimizing the activity of a lysine or a methionine biosynthetic pathway protein or decreasing the activity of a lysine or methionine degradative pathway protein may result in an increase in the yield or efficiency of production of lysine or methionine from such an engineered organism. Alterations in the proteins involved in these metabolic pathways may also have an indirect impact on the production or efficiency of production of a desired fine chemical. For example, a reaction which is in competition for an intermediate necessary for the production of a desired molecule may be eliminated, or a pathway necessary for the production of a particular intermediate for a desired compound may be optimized.
Further, modulations in the biosynthesis or degradation of, for example, an amino acid, e.g., lysine or methionine, a vitamin, or a nucleotide may increase the overall ability of the microorganism to rapidly grow and divide, thus increasing the number and/or production capacities of the microorganism in culture and thereby increasing the possible yield of the desired fine chemical.

The nucleic acid and protein molecules of the invention, alone or in combination with one or more nucleic acid and protein molecules of the same or different metabolic pathway, may be utilized to directly improve the production or efficiency of production of one or more desired fine chemicals from Corynebacterium glutamicum (e.g., methionine or lysine). Using recombinant genetic techniques well known in the art, one or more of the biosynthetic or degradative enzymes of the invention for amino acids, e.g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose may be manipulated such that its function is modulated. For example, a biosynthetic enzyme may be improved in efficiency, or its allosteric control region destroyed such that feedback inhibition of production of the compound is prevented.
Similarly, a degradative enzyme may be deleted or modified by substitution, deletion, or addition such that its degradative activity is lessened for the desired compound without impairing the viability of the cell. In each case, the overall yield or rate of production of the desired fine chemical may be increased.
It is also possible that such alterations in the protein and nucleotide molecules of the invention may improve the production of other fine chemicals besides the amino acids, e.g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose through indirect mechanisms. Metabolism of any one compound is necessarily intertwined with other biosynthetic and degradative pathways within the cell, and necessary cofactors, intermediates, or substrates in one pathway are likely supplied or limited by another such pathway., Therefore, by modulating the activity of one or more of the proteins of the invention, the production or efficiency of activity of another fine chemical biosynthetic or degradative pathway may be impacted.
For example, amino acids serve as the structural units of all proteins, yet may be present intracellularly in levels which are limiting for protein synthesis; therefore, by increasing the efficiency of production or the yields of one or more amino acids within the cell, proteins, such as biosynthetic or degradative proteins, may be more readily synthesized.
Likewise, an alteration in a metabolic pathway enzyme such that a particular side reaction becomes more or less favored may result in the over- or under-production of one or more compounds which are utilized as intermediates or substrates for the production of a desired fine chemical.
This invention provides novel nucleic acid molecules which encode proteins, referred to herein as metabolic pathway ("MP's proteins, which are capable of, for example, performing an enzymatic step involved in the metabolism of molecules important for the normal functioning of cells, such as amino acids, e.g., lysine and methionine, vitamins, cofactors, nucleotides and nucleosides, or trehalose.
Nucleic acid molecules encoding an MP protein are referred to herein as MP nucleic acid molecules.
S In a preferred embodiment, an MP protein, alone or in combination with one or more proteins of the same or different metabolic pathway, performs an enzymatic step related to the metabolism of one or more of the following: amino acids, e.g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose.
Examples of such proteins include those encoded by the genes set forth in Table 1.
Accordingly, one aspect of the invention pertains to isolated nucleic acid molecules (e.g., cDNAs, DNAs, or RNAs) comprising a nucleotide sequence encoding an MP protein or biologically active portions thereof, as well as nucleic acid fragments suitable as primers or hybridization probes for the detection or amplification of MP-encoding nucleic acid (e.g., DNA or mRNA). In particularly preferred embodiments, the isolated nucleic acid molecule comprises one of the nucleotide sequences set forth as the odd-numbered SEQ ID NO in the Sequence Listing (e.g., SEQ ID NO:1, SEQ ID
N0:3, or SEQ ID NO:S), or the coding region or a complement thereof of one of these nucleotide sequences. In other particularly preferred embodiments, the isolated nucleic acid molecule of the invention comprises a nucleotide sequence which hybridizes to or is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%; 93%, 94%,. and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7%
or more homologous to a nucleotide sequence set forth as an odd-numbered SEQ ID
NO in the Sequence Listing (e.g., SEQ ID NO:1, SEQ ID N0:3, or SEQ ID NO:S), or a portion thereof. In other preferred embodiments, the isolated nucleic acid molecule encodes one of the amino acid sequences set forth as an even-numbered SEQ ID NO in the Sequence Listing (e.g., SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6). The preferred MP
proteins of the present invention also preferably possess at least one of the MP activities described herein.

According to one aspect, the present invention provides an isolated nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:1 or a full complement thereof.
According to a further aspect of the present invention there is provided an isolated nucleic acid molecule which encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence set forth in SEQ ID N0:2, wherein the allelic variant has an O-acetylhomoserine sulfhydrylase activity, or a full complement thereof.
According to another aspect of the present invention there is provided an isolated nucleic acid molecule comprising a nucleotide sequence which is at least SO% identical to the entire nucleotide sequence set forth in SEQ ID NO:1, wherein said nucleic acid molecule encodes a polypeptide having an O-acetylhomoserine sulfhydrylase activity, or a full complement thereof.
According to a still further aspect of the present invention there is provided 1 S an isolated nucleic acid molecule comprising a fragment of at least 20 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO:1, wherein said fragment encodes a polypeptide having an O-acetylhomoserine sulfhydrylase activity, or a full complement thereof.
According to another aspect of the present invention there is provided an isolated polypeptide comprising the amino acid sequence set forth in SEQ ID N0:2.
According to a further aspect of the present invention there is provided an isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID N0:2 or a full complement thereof.
According to yet another aspect of the present invention there is provided an isolated polypeptide comprising a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID N0:2, wherein said polypeptide has an O-acetylhomoserine sulfhydrylase activity.
5a According to still a furthere aspect of the present invention there is provided an isolated polypeptide which is encoded by a nucleic acid molecule comprising a nucleotide sequence which is at least 50% identical to the entire nucleotide sequence set forth in SEQ ID NO:1, wherein said polypeptide has an O-acetylhomoserine sulfhydrylase activity.
According to a further aspect of the present invention there is provided an isolated polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:1.
According to another aspect of the present invention there is provided an isolated polypeptide comprising an amino acid sequence which is at least 60%
identical to the entire amino acid sequence set forth in SEQ ID N0:2, wherein said polypeptide has an O-acetylhomoserine sulfhydrylase activity.
According to a still further aspect of the present invention there is provided an isolated polypeptide comprising a fragment of the amino acid sequence set forth in SEQ ID N0:2, wherein said fragment has an O-acetylhomoserine sulfhydrylase activity.
According to another aspect of the present invention there is provided n isolated nucleic acid molecule which encodes a polypeptide comprising an amino acid sequence which is at least 60% identical to the entire amino acid sequence set forth in SEQ ID N0:2, wherein said polypeptide has an O-acetylhomoserine sulfllydrylase activity, or a full complement thereof.
According to a further aspect of the present invention there is provided an isolated nucleic acid molecule comprising a fragment of at least 20 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: l, wherein said nucleic acid molecule is a primer, a probe or an antisense molecule.
According to yet another aspect of the present invention there is provided a host cell comprising a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:1, wherein the nucleic acid molecule is disrupted.
According to a still further aspect of the present invention there is provided a host cell comprising a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:I, wherein the nucleic acid molecule Sb comprises one or more nucleic acid modifications as compared to the sequence set forth in SEQ ID NO:1.
According to a further aspect of the present invention there is provided a host cell comprising a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:1, wherein the regulatory region of the nucleic acid molecule is modified relative to the wild-type regulatory region of the molecule.
In another embodiment, the isolated nucleic acid molecule encodes a protein or portion thereof wherein the protein or portion thereof includes an amino acid sequence Sc which is sufficiently homologous to an amino acid sequence of the invention (e.g., a sequence having an even-numbered SEQ ID NO in the Sequence Listing, such as SEQ
ID N0:2, SEQ ID N0:4, or SEQ ID N0:6), e.g., sufficiently homologous to an amino acid sequence of the invention such that the protein or portion thereof maintains an MP
activity. Preferably, the protein or portion thereof encoded by the nucleic acid molecule maintains the ability to perform an enzymatic reaction in a amino acid, e.g., lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway. In one embodiment, the protein encoded by the nucleic acid molecule is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%,.preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, $2%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%,, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to an amino acid sequence of the invention (e.g., an entire amino acid sequence selected from those having an even-numbered SEQ ID NO in the Sequence Listing, such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6). In another preferred embodiment, the protein is a full length C. glutamicum protein which is substantially homologous to an entire amino acid sequence of the invention (encoded by an open reading frame shown in the corresponding odd-numbered SEQ ID NO in the Sequence Listing (e.g., SEQ ID NO:1, SEQ ID N0:3, or SEQ ID NO:S).
In another preferred embodiment, the isolated nucleic acid molecule is derived from C. glutamicum and encodes a protein (e.g., an MP fusion protein) which includes a biologically active domain which is at least about 50% or more homologous to one of the amino acid sequences of the invention (e.g., a sequence of one of the even-numbered SEQ ID NOs in the Sequence Listing, such as SEQ ID N0:2, SEQ ID N0:4, or SEQ
ID
N0:6) and is able to catalyze a reaction in a metabolic pathway for an amino acid, e.g., lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose, or one or more of the activities set forth in Table 1, and which also includes heterologous nucleic acid sequences encoding a heterologous polypeptide or regulatory regions.
In another embodiment, the isolated nucleic acid molecule is at least 15 nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising a nucleotide sequence of the invention (e.g., a sequence of an odd-numbered SEQ ID NO in the Sequence Listing, such as SEQ ID NO:1, SEQ ID N0:3, or SEQ ID NO:S). Preferably, the isolated nucleic acid molecule corresponds to a naturally-occurnng nucleic acid molecule. More preferably, the isolated nucleic acid encodes a naturally-occurring C, glutamicum MP protein, or a biologically active portion thereof.
Another aspect of the invention pertains to vectors, e.g., recombinant expression vectors, containing the nucleic acid molecules of the invention, alone or in combination with one or more nucleic acid molecules involved in the same or different pathway, and host cells into which such vectors have been introduced. In one embodiment, such a host cell is used to produce an MP protein by culturing the host cell in a suitable medium. The MP protein can be then isolated from the medium or the host cell.
Yet another aspect of the invention pertains to a genetically altered microorganism in which one or more MP genes, alone or in combination with one or more genes involved in the same or different metabolic pathway, have been introduced or altered. In one embodiment, the genome of the microorganism has been altered by introduction of a nucleic acid molecule of the invention encoding one or more wild-type or mutated MP sequences as transgenes alone or in combination with one or more nucleic acid molecules involved in the same or different metabolic pathway. In another embodiment, one or more endogenous MP genes within the genome of the microorganism have been altered, e.g., functionally disrupted, by homologous recombination with one or more altered MP genes. In another embodiment, one or more endogenous or introduced MP genes, alone or in combination with one or more genes of the same or different metabolic pathway in a microorganism have been altered by one or more point mutations, deletions, or inversions, but still encode functional MP
proteins.
In still another embodiment, one or more of the regulatory regions (e.g., a promoter, repressor, or inducer) of one or more MP genes in a microorganism, alone or in combination with one or more MP genes or in combination with one or more genes of the same or different metabolic pathway, has been altered (e.g., by deletion, truncation, inversion, or point mutation) such that the expression of one or more MP genes is modulated. In a preferred embodiment, the microorganism belongs to the genus Corynebacterium or Brevibacterium, with Corynebacterium glutarnicum being particularly preferred. In a preferred embodiment, the microorganism is also utilized for the production of a desired compound, such as an amino acid, with lysine and w0 01/66573 PCT/IB00/02035 methionine being particularly preferred. In a particularly preferred embodiment, the MP
gene is the metZ gene (SEQ ID NO:1), metC gene (SEQ ID N0:3), or the RXA00657 gene (SEQ ID NO:S), alone or in combination with one or more MP genes of the invention or in combination with one or more genes involved in methionine and/or lysine metabolism.
In another aspect, the invention provides a method of identifying the presence or activity of Cornyebacterium diphtheriae in a subject. This method includes detection of one or more of the nucleic acid or amino acid sequences of the invention (e.g., the sequences set forth in Table l and in the Sequence Listing as SEQ ID NOs 1 through 122) in a subject, thereby detecting the presence or activity of Corynebacterium diphtheriae in the subject.
Still another aspect of the invention pertains to an isolated MP protein or portion, e.g., biologically active portion, thereof. In a preferred embodiment, the isolated MP
protein or portion thereof, alone or in combination with one or more MP
proteins of the invention or in combination with one or more proteins of the same or different metabolic pathway, can catalyze an enzymatic reaction involved in one or more pathways for the metabolism of an amino acid, e.g., lysine or methioriine, a vitamin, a cofactor, a nutraceutical, a nucleotide, a nucleoside, or trehalose. In another preferred embodiment, the isolated MP protein or portion thereof, is sufficiently homologous to an amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: in the Sequence Listing, such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6) such that the protein or portion thereof maintains the ability to catalyze an enzymatic reaction involved in one or more pathways for the metabolism of an amino acid, a vitamin, a cofactor, a nutraceutical, a nucleotide, a nucleoside, or trehalose.
The invention also provides an isolated preparation of an MP protein. In preferred embodiments, the MP protein comprises an amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence Listing such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6). In another preferred embodiment, the invention pertains to an isolated full length protein which is substantially homologous to an entire amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO of the Sequence Listing such as SEQ ID
N0:2, SEQ ID N0:4, or SEQ ID N0:6) (encoded by an open reading frame set forth in a corresponding odd-numbered SEQ ID NO: of the Sequence Listing such as SEQ ID

NO: l, SEQ ID N0:3, or SEQ ID N0:5). In yet another embodiment, the protein is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to an entire amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence Listing such as SEQ ID N0:2, SEQ ID
N0:4, or SEQ ID N0:6). In other embodiments, the isolated MP protein comprises an amino acid sequence which is at least about 50% or more homologous to one of the amino acid sequences of the invention (e.g., a sequence of an even-numbered SEQ ID
NO: of the Sequence Listing such as SEQ ID N0:2, SEQ ID N0:4, or SEQ ID N0:6) and is able to catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway either alone or in combination one or more MP proteins of the invention or any protein of the same or different metabolic pathway, or has one or more of the activities set forth in Table 1.
Alternatively, the isolated MP protein can comprise an amino acid sequence which is encoded by a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, or is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to a nucleotide sequence of one of the even-numbered SEQ ID NOs set forth in the Sequence Listing. It is also preferred that the preferred forms of MP proteins also have one or more of the MP bioactivities described herein.
The MP polypeptide, or a biologically active portion thereof, can be operatively linked to a non-MP polypeptide to form a fusion protein. In preferred embodiments, this fusion protein has an activity which differs from that of the MP protein alone. In other preferred embodiments, this fusion protein, when introduced into a C.
glutamicum pathway for the metabolism of an amino acid, vitamin, cofactor, nutraceutical, results in increased yields and/or efficiency of production of a desired fine chemical from C.
glutamicum. In particularly preferred embodiments, integration of this fusion protein into an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway of a host cell modulates production of a desired compound from the cell.
In another aspect, the invention provides methods for screening molecules which modulate the activity of an MP protein, either by interacting with the protein itself or a substrate or binding partner of the MP protein, or by modulating the transcription or translation of an MP nucleic acid molecule of the invention.
Another aspect of the invention pertains to a method for producing a fine chemical. This method involves the culturing of a cell containing one or more vectors directing the expression of one or more MP nucleic acid molecules of the either alone or in combination one or more MP nucleic acid molecules of the invention or any nucleic acid molecule of the same or different metabolic pathway, such that a fine chemical is produced. In a preferred embodiment, this method further includes the step of obtaining a cell containing such a vector, in which a cell is transfected with a vector directing the expression of an MP nucleic acid. In another preferred embodiment, this method further includes the step of recovering the fine chemical from the culture. In a particularly preferred embodiment, the cell is from the genus Corynebacterium or Brevibacterium, or is selected from those strains set forth in Table 3. In another preferred embodiment, the MP genes is the metZ gene (SEQ ID NO:1), metC gene (SEQ ID N0:3), or the gene designated as RXA00657 (SEQ ID NO:S) (see Table 1 ), alone or in combination with one or more MP nucleic acid molecules of the invention or with one or more genes involved in methionine and/or lysine metabolism. In yet another preferred embodiment, the fine chemical is an amino acid, e.g., L-lysine and L-methionine.
Another aspect of the invention pertains to methods for modulating production of a molecule from a microorganism. Such methods include contacting the cell with an agent which modulates MP protein activity or MP nucleic acid expression such that a cell associated activity is altered relative to this same activity in the absence of the agent. In a preferred embodiment, the cell is modulated for one or more C.
glutarnicum amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways, such that the yields or rate of production of a desired fine chemical by this microorganism is improved. The agent which modulates MP protein activity can be an agent which stimulates MP protein activity or MP nucleic acid expression.
Examples of agents which stimulate MP protein activity or MP nucleic acid expression include small molecules, active MP proteins, and nucleic acids encoding MP
proteins that have been introduced into the cell. Examples of agents which inhibit MP
activity or expression include small molecules and antisense MP nucleic acid molecules-Another aspect of the invention pertains to methods for modulating yields of a desired compound from a cell, involving the introduction of a wild-type or mutant MP
gene into a cell, either alone or in combination one or more MP nucleic acid molecules of the invention or any nucleic acid molecule of the same or different metabolic pathway, either maintained on a separate plasmid or integrated into the genome of the host cell. If integrated into the genome, such integration can be random, or it can take place by homologous recombination such that the native gene is replaced by the introduced copy, causing the production of the desired compound from the cell to be modulated. In a preferred embodiment, said yields are increased. In another preferred embodiment, said chemical is a fine chemical. In a particularly preferred embodiment, said fine chemical is an amino acid. In especially preferred embodiments, said amino 1 S acid are L-lysine and L-methionine. In another preferred embodiment, said gene is the metZ gene (SEQ ID NO:1), metC gene (SEQ ID N0:3), or the RXA00657 gene (SEQ
ID NO:S), alone or in combination with one or more MP nucleic acid molecules of the invention or with one or more genes involved in methionine and/or lysine metabolism.
Detailed Description of the Invention The present invention provides MP nucleic acid and protein molecules which are involved in the metabolism of certain fine chemicals in Corynebacterium glutamicum, including amino acids, e.g., lysine and methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose. The molecules of the invention may be utilized in the modulation of production of fine chemicals from microorganisms, such as C.
glutamicum, either directly (e.g., where modulation of the activity of a lysine or methionine biosynthesis protein has a direct impact on the production or efFciency of production of lysine or methionine from that organism), or may have an indirect impact which nonetheless results in an increase of yield or e~ciency of production of the desired compound (e.g., where modulation of the activity of a nucleotide biosynthesis protein has an impact on the production of an organic acid or a fatty acid from the bacterium, perhaps due to improved growth or an increased supply of necessary co-factors, energy compounds, or precursor molecules). The MP molecules may be utilized alone or in combination with other MP molecules of the invention, or in combination with other molecules involved in the same or a different metabolic pathway (e.g., lysine or methione metabolism). In a preferred embodiment, the MP molecules are the metZ
(SEQ ID NO:1), metC (SEQ ID N0:3), or RXA00657 (SEQ ID NO:S) nucleic acid molecules and the proteins encoded by these nucleic acid molecules (SEQ ID
N0:2, SEQ ID N0.:4 and SEQ ID N0.:6, respectively). Aspects of the invention are further explicated below.
I. Fine Chemicals The term 'fine chemical' is art-recognized and includes molecules produced by an organism which have applications in various industries, such. as, but not limited to, the pharmaceutical, agriculture, and cosmetics industries. Such compounds include organic acids, such as tartaric acid, itaconic acid, and diaminopimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides, and nucleotides (as described e.g. in Kuninaka, A. (1996) Nucleotides and ' related compounds, p. 561-612, in Biotechnology vol. 6, Rehm et al., eds. VCH:
Weinheim, and references contained therein), lipids, both saturated and unsaturated fatty acids (e.g., arachidonic acid), diols (e.g., propane diol, and butane diol), carbohydrates (e.g., hyaluronic acid and trehalose), aromatic compounds (e.g., aromatic amines, vanillin, and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, vol. A27, "Vitamins", p. 443-613 (1996) VCH: Weinheim and references therein; and Ong, A.S., Niki, E. & Packer, L. (1995) 'Nutrition, Lipids, Health, and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia, and the Society for Free Radical Research -Asia, held Sept. 1-3, 1994 at Penang, Malaysia, AOCS Press, (1995)), enzymes, polyketides (Cane et al. (1998) Science 282: 63-68), and all other chemicals described in Gutcho (1983) Chemicals by Fermentation, Noyes Data Corporation, ISBN:
0818805086 and references therein. The metabolism and uses of certain of these fine chemicals are further explicated below.
A. Amino Acid Metabolism and Uses Amino acids comprise the basic structural units of all proteins, and as such are essential for normal cellular functioning in all organisms. The term "amino acid" is art-recognized. The proteinogenic amino acids, of which there are 20 species, serve as structural units for proteins, in which they are linked by peptide bonds, while the nonproteinogenic amino acids (hundreds of which are known) are not normally found in proteins (see Ulinann's Encyclopedia of Industrial Chemistry, vol. A2, p. 57-97 VCH:
Weinheim (1985)). Amino acids may be in the D- or L- optical configuration, though L-amino acids are generally the only type found in naturally-occurring proteins.
Biosynthetic and degradative pathways of each of the 20 proteinogenic amino acids have been well characterized in both prokaryotic and eukaryotic cells (see, for example, Stryer, L. Biochemistry, 3'd edition, pages 578-590 (1988)). The 'essential' amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine), so named because they are generally a nutritional requirement due to the complexity of their biosyntheses, are readily converted by simple biosynthetic pathways to the remaining 11 'nonessential' amino acids (alanine, arginine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, and tyrosine).
Higher animals do retain the ability to synthesize some of these amino acids, but the essential amino acids must be supplied from the diet in order for normal protein synthesis to occur.
Aside from their function in protein biosynthesis, these amino acids are interesting chemicals in their own right, and many have been found to have various applications in the food, feed, chemical, cosmetics, agriculture, and pharmaceutical industries. Lysine is an important amino acid in the nutrition not only of humans, but also of monogastric animals such as poultry and swine. Glutamate is most commonly used as a flavor additive (mono-sodium glutamate, MSG) and is widely used throughout the food industry, as are aspartate, phenylalanine, glycine, and cysteine.
Glycine, L-methionine and tryptophan are all utilized in the pharmaceutical industry.
Glutamine, valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine are of use in both the pharmaceutical and cosmetics industries. Threonine, tryptophan, and D! L-methionine are common feed additives. (Leuchtenberger, W. (1996) Amino aids -technical production and use, p. 466-502 in Rehm et al. (eds.) Biotechnology vol. 6, chapter 14a, VCH: Weinheim). Additionally, these amino acids have been found to be useful as precursors for the synthesis of synthetic amino acids and proteins, such as N-acetylcysteine, S-carboxymethyl-L-cysteine, (S)-5-hydroxytryptophan, and others described in Ulmann's Encyclopedia of Industrial Chemistry, vol. A2, p. 57-97, VCH:
Weinheim, 1985.

The biosynthesis of these natural amino acids in organisms capable of producing them, such as bacteria, has been well characterized (for review of bacterial amino acid biosynthesis and regulation thereof, see Umbarger, H.E.(1978) Ann. Rev.
Biochem. 47:
533-606). Glutamate is synthesized by the reductive amination of a-ketoglutarate, an intermediate in the citric acid cycle. Glutamine, proline, and arginine are each subsequently produced from glutamate. The biosynthesis of serine is a three-step process beginning with 3-phosphoglycerate (an intermediate in glycolysis), and resulting in this amino acid after oxidation, transamination, and hydrolysis steps. Both cysteine and glycine are produced from serine; the former by the condensation of homocysteine with serine, and the latter by the transferal of the side-chain ~-carbon atom to tetr~hydrofolate, in a reaction catalyzed by serine transhydroxymethylase.
Phenylalanine and tyrosine are synthesized from the glycolytic and pentose phosphate pathway precursors erythrose 4-phosphate and phosphoenolpyruvate in a 9-step biosynthetic pathway that differ only at the final two steps after synthesis of prephenate.
Tryptophan is also produced from these two initial molecules, but its synthesis'is an 11-step pathway. Tyrosine may also be synthesized from phenylalanine, in a reaction catalyzed by phenylalanine hydroxylase. Alanine, valine, and leucine are all biosynthetic products of pyruvate, the final product of glycolysis. Aspartate is formed from oxaloacetate, an intermediate of the citric acid cycle. Asparagine, methionine, threonine, and lysine are each produced by the conversion of aspartate.
Isoleucine is formed from threonine.
The biosynthetic pathways leading to methionine have been studied in diverse organisms. The first step, acylation of homoserine, is common to all of the organisms, even though the source of the transferred acyl groups is different.
Escherichia coli and the related species use succinyl-CoA (Michaeli, S. and Ron, E. Z. (1981) Mol.
Gen.
Genet. 182, 349-354), while Saccharomyces cerevisiae (Langin, T., et al.
(1986) Gene 49, 283-293), Brevibacterium flavum (Miyajima, R. and Shiio, I. (1973) J.
Biochem. 73, 1061-1068; Ozaki, H. and Shiio, I. (1982) J. Biochem. 91,1163-1171), C.
glutamicum (Park, S.-D., et al. (1998) Mol. Cells 8, 286-294), and Zeptospira meyeri (Belfaiza, J. et al. (1998) 180, 250-255; Bourhy, P., et al. (1997) J. Bacteriol. 179, 4396-4398) use acetyl-CoA as the acyl donor. Formation of homocysteine from acylhomoserine can occur in two different ways. E. coli uses the transsulfuration pathway which is catalyzed by cystathionine ~y-synthase (the product of metB) and cystathionine ~i-lyase (the product of metC). S. cerevisiae (Cherest, H. and Surdin-Kerjan, Y. (1992) Genetics 130, 51-58), B. flavum (Ozaki, H. and Shiio, I. (1982) J. Biochem. 91, 1163-1171), Pseudomonas aeruginosa (Foglino, M., et al. (1995) Microbiology 141, 431-439), and L. meyeri (Belfaiza, J., et al. (1998) J. Bacteriol. 180, 250-255) utilize the direct sulfhydrylation pathway which is catalyzed by acylhomoserine sulfhydrylase.
Unlike closely related B. flavum which uses only the direct sulfhydrylation pathway, enzyme activities of the transsulfuration pathway have been detected in the extracts of the C.
glutamicum cells and the pathway has been proposed to be the route for methionine biosynthesis in the organism (Hwang, B-J., et al. (1999) Mol. Cells 9, 300-308; Kase, H.
and Nakayama, K. (1974) Agr. Biol. Chem. 38, 2021-2030; Park, S.-D., et al.
1998) Mol. Cells 8, 286-294).
Although some genes involved in methionine biosynthesis in C. glutamicum have been isolated, information on the biosynthesis of methionine in C.
glutamicum is still very limited. No genes other than metA and metB have been isolated from the organism. To understand the biosynthetic pathways leading to methioriine in C.
glutamicum, we have isolated and characterized the metC gene (SEQ ID N0:3) and the metZ (also called meth gene (SEQ ID NO:1) of C. glutamicum (see Table 1).
Amino acids in excess of the protein synthesis needs of the cell cannot be stored, and are instead degraded to provide intermediates for the major metabolic pathways of the cell (for review see Stryer, L. Biochemistry 3'd ed. Ch. 21 "Amino Acid Degradation and the Urea Cycle" p. 495-516 (1988)). Although the cell is able to convert unwanted amino acids into useful metabolic intermediates, amino acid production is costly in terms of energy, precursor molecules, and the enzymes necessary to synthesize them.
Thus it is not surprising that amino acid biosynthesis is regulated by feedback inhibition, in which the presence of a particular amino acid serves to slow or entirely stop its own production (for overview of feedback mechanisms in amino acid biosynthetic pathways, see Stryer, L. Biochemistry, 3'd ed. Ch. 24: "Biosynthesis of Amino Acids and Heme" p.
575-600 (1988)). Thus, the output of any particular amino acid is limited by the amount of that amino acid present in the cell.
B. Vitamin, Cofactor, and ~Vutraceutical Metabolism and Uses Vitamins, cofactors, and nutraceuticals comprise another group of molecules which the higher animals have lost the ability to synthesize and so must ingest, although they are readily synthesized by other organisms, such as bacteria. These molecules are either bioactive substances themselves, or are precursors of biologically active substances which may serve as electron carriers or intermediates in a variety of metabolic pathways. Aside from their nutritive value, these compounds also have significant industrial value as coloring agents, antioxidants, and catalysts or other processing aids. (For an overview of the structure, activity, and industrial applications of these compounds, see, for example, Ullinan's Encyclopedia of Industrial Chemistry, "Vitamins" vol. A27, p. 443-613, VCH: Weinheim, 1996.) The term "vitamin" is art-recognized, and includes nutrients which are required by an organism for normal functioning, but which that organism cannot synthesize by itself. The group of vitamins may encompass cofactors and nutraceutical compounds. The language "cofactor"
includes nonproteinaceous compounds required for a normal enzymatic activity to occur. Such compounds may be organic or inorganic; the cofactor molecules of the invention are preferably organic. The term "nutraceutical" includes dietary supplements having health benefits in plants and animals, particularly humans. Examples of such molecules are vitamins, antioxidants, and also certain lipids (e.g., polyunsaturated fatty acids).
The biosynthesis of these molecules in organisms capable of producing them, such as bacteria, has been largely characterized (Ullinan's Encyclopedia of Industrial Chemistry, "Vitamins" vol. A27, p. 443-613, VCH: Weinheim, 1996; Michal, G.
(1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley & Sons; Ong, A.S., Niki, E. & Packer, L. (1995) "Nutrition, Lipids, Health, and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia, and the Society for Free Radical Research - Asia, held Sept.
1-3, 1994 at Penang, Malaysia, AOCS Press: Champaign, IL X, 374 S).
Thiamin (vitamin B 1) is produced by the chemical coupling of pyrimidine and thiazole moieties. Riboflavin (vitamin B2) is synthesized from guanosine-5'-triphosphate (GTP) and ribose-5'-phosphate. Riboflavin, in turn, is utilized for the synthesis of flavin mononucleotide (FMI~ and flavin adenine dinucleotide (FAD). The family of compounds collectively termed 'vitamin B6' (e.g., pyridoxine, pyridoxamine, pyridoxa-5'-phosphate, and the commercially used pyridoxin hydrochloride) are all derivatives of the common structural unit, 5-hydroxy-6-methylpyridine. Pantothenate (pantothenic acid, (R)-(+~N-(2,4-dihydroxy-3,3-dimethyl-1-oxobutyl)-~-alanine) can be produced either by chemical synthesis or by fermentation. The final steps in pantothenate biosynthesis consist of the ATP-driven condensation of (3-alanine and pantoic acid. The enzymes responsible for the biosynthesis steps for the conversion to pantoic acid, to ~-alanine and for the condensation to panthotenic acid are known. The metabolically active form of pantothenate is Coenzyme A, for which the biosynthesis proceeds in 5 enzymatic steps. Pantothenate, pyridoxal-5'-phosphate, cysteine and ATP are the precursors of Coenzyme A. These enzymes not only catalyze the formation of panthothante, but also the production of (R)-pantoic acid, (R)-pantolacton, (R)-panthenol (provitamin BS), pantetheine (and its derivatives) and coenzyme A.
Biotin biosynthesis from the precursor molecule pimeloyl-CoA in microorganisms has been studied in detail and several of the genes involved have been identified. Many of the corresponding proteins have been found to also be involved in Fe-cluster synthesis and are members of the nifs class of proteins. Lipoic acid is derived from octanoic acid, and serves as a coenzyme in energy metabolism, where it becomes part.of the pyruvate dehydrogenase complex and the a-ketoglutarate dehydrogenase complex. The folates are a group of substances which are all derivatives of folic acid, which is turn is derived from L-glutamic acid, p-amino-benzoic acid and 6-methylpterin. The biosynthesis of folic acid and its derivatives, starting from the metabolism intermediates guanosine-5'-triphosphate (GTP), L-glutamic acid and p-amino-benzoic acid has been studied in detail in certain microorganisms.
Corrinoids (such as the cobalamines and particularly vitamin B12) and porphyrines belong to a group of chemicals characterized by a tetrapyrole ring system.
The biosynthesis of vitamin B12 is sufficiently complex that it has not yet been completely characterized, but many of the enzymes and substrates involved are now known. Nicotinic acid (nicotinate), and nicotinamide are pyridine derivatives which are also termed 'niacin'. Niacin is the precursor of the important coenzymes NAD
(nicotinamide adenine dinucleotide} and NADP (nicotinamide adenine dinucleotide phosphate) and their reduced forms.
The large-scale production of these compounds has largely relied on cell-free chemical syntheses, though some of these chemicals have also been produced by large-scale culture of microorganisms, such as riboflavin, Vitamin B6, pantothenate, and biotin. Only Vitamin B1z is produced solely by fermentation, due to the complexity of its synthesis. In vitro methodologies require significant inputs of materials and time, often at great cost.
C. Purme, Pyrimidine, Nucleoside and Nucleotide Metabolism and Uses Purine and pyrimidine metabolism genes and their corresponding proteins are important targets for the therapy of tumor diseases and viral infections. The language "purine" or "pyrimidine" includes the nitrogenous bases which are constituents of nucleic acids, co-enzymes, and nucleotides. The term "nucleotide" includes the basic structural units of nucleic acid molecules, which are comprised of a nitrogenous base, a pentose sugar (in the case of RNA, the sugar is ribose; in the case of DNA, the sugar is D-deoxyribose), and phosphoric acid. The language "nucleoside" includes molecules which serve as precursors to nucleotides, but which are lacking the phosphoric acid moiety that nucleotides possess. By inhibiting the biosynthesis of these molecules, or their mobilization to form nucleic acid molecules, it is possible to inhibit RNA and DNA
synthesis; by inhibiting this activity in a fashion targeted to cancerous cells, the ability of tumor cells to divide and replicate may be inhibited. Additionally, there are nucleotides which do not form nucleic acid molecules, but rather serve as energy stores (i.e., AMP) or as coenzymes (i.e., FAD and NAD).
Several publications have described the use of these chemicals for these medical indications, by influencing purine and/or pyrimidine metabolism (e.g.
Christopherson, R.I. and Lyons, S.D. (1990) "Potent inhibitors of de novo pyrimidine and purine biosynthesis as chemotherapeutic agents." Med. Res. Reviews 10: 505-548).
Studies of enzymes involved in purine and pyrimidine metabolism have been focused on the development of new drugs which can be used, for example, as immunosuppressants or anti-proliferants (Smith, J.L., (1995) "Enzymes in nucleotide synthesis."
Curr. Opin.
Struct. Biol. 5: 752-757; (1995) Biochem Soc. Transact. 23: 877-902). However, purine and pyrimidine bases, nucleosides and nucleotides have other utilities: as intermediates in the biosynthesis of several fine chemicals (e.g., thiamine, S-adenosyl-methionine, folates, or riboflavin), as energy Garners for the cell (e.g., ATP or GTP), and for chemicals themselves, commonly used as flavor enhancers (e.g., lMP or GMP) or for several medicinal applications (see, for example, Kuninaka, A. (1996) Nucleotides and Related Compounds in Biotechnology vol. 6, Rehm et al., eds. VCH: Weinheim, p.

612). Also, enzymes involved in purine, pyrimidine, nucleoside, or nucleotide metabolism are increasingly serving as targets against which chemicals for crop protection, including fungicides, herbicides and insecticides, are developed.
The metabolism of these compounds in bacteria has been characterized (for reviews see, for example, Zalkin, H. and Dixon, J.E. (1992) "de novo purine nucleotide biosynthesis", in: Progress in Nucleic Acid Research and Molecular Biology, vol. 42, Academic Press:, p. 259-287; and Michal, G. (1999) "Nucleotides and Nucleosides", Chapter 8 in: Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, Wiley: New York). Purine metabolism has been the subject of intensive research, and is essential to the normal functioning of the cell. Impaired purine metabolism in higher animals can cause severe disease, such as gout. Purine nucleotides are synthesized from ribose-5-phosphate, in a series of steps through the intermediate compound inosine-5'-phosphate (IMP), resulting in the production of guanosine-5'-monophosphate (GMP) or adenosine-5'-monophosphate (AMP), from which the triphosphate forms utilized as nucleotides are readily formed. These compounds are also utilized'as energy stores, so their degradation provides energy for many different biochemical processes in the cell.
Pyrimidine biosynthesis proceeds by the formation of uridine-5'-monophosphate (UMP) from ribose-5-phosphate. UMP, in turn, is converted to cytidine-5'-triphosphate (CTP).
The deoxy- forms of all of these nucleotides are produced in a one step reduction reaction from the diphosphate ribose form of the nucleotide to the diphosphate deoxyribose form of the nucleotide. Upon phosphorylation, these molecules are able to participate in DNA synthesis.
D. Trehalose Metabolism and Uses Trehalose consists of two glucose molecules, bound in a, a-1,1 linkage. It is commonly used in the food industry as a sweetener, an additive for dried or frozen foods, and in beverages. However, it also has applications in the pharmaceutical, cosmetics and biotechnology industries (see, for example, Nishimoto et al., (1998) U.S.
Patent No. 5,759,610; Singer, M.A. and Lindquist, S. (1998) Trends Biotech.
16: 460-467; Paiva, C.L.A. and Panek, A.D. (1996) Biotech. Ann. Rev. 2: 293-314; and Shiosaka, M. (1997) J. Japan 172: 97-102). Trehalose is produced by enzymes from many microorganisms and is naturally released into the surrounding medium, from which it can be collected using methods known in the art.

WO 01/66573 PCTlIB00/02035 II. Elements and Methods of the Invention The present invention is based, at least in part, on the discovery of novel molecules, referred to herein as MP nucleic acid and protein molecules (see Table 1 ), which play a role in or function in one or more cellular metabolic pathways.
In one embodiment, the MP molecules catalyze an enzymatic reaction involving one or more amino acid, e.g., lysine or methionine, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways. In a preferred embodiment, the activity of one or more MP molecules of the present invention, alone or in combination with molecules involved in the same or different metabolic pathway (e.g., methionine or lysine metabolism), in one or more C. glutamicum metabolic pathways for amino acids, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides or trehalose has an impact on the production of a desired fine chemical by this organism. In a particularly preferred embodiment, the MP molecules of the invention are modulated in activity, such that the C. glutamicum metabolic pathways in which the MP proteins of the invention are involved are modulated in efficiency or output, which either directly or indirectly modulates the production or efficiency of production of a desired fine chemical by C. glutamicum. In a preferred embodiment, the fine chemical is an amino acid, e.g., lysine or methionine. In another preferred embodiment, the MP
molecules are metZ, metY, and/or 12XA00657 (see Table 1).
The language, "MP protein" or "MP polypeptide" includes proteins which play a role in, e.g., catalyze an enzymatic reaction, in one or more amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside or trehalose metabolic pathways.
Examples'of MP proteins include those encoded by the MP genes set forth in Table 1 and by the odd-numbered SEQ ID NOs. The terms "MP gene" or "MP nucleic acid sequence" include nucleic acid sequences encoding an MP protein, which consist of a coding region and also corresponding untranslated 5' and 3' sequence regions.
Examples of MP genes include those set forth in Table 1. The terms "production" or "productivity" are art-recognized and include the concentration of the fermentation product (for example, the desired fine chemical) formed within a given time and a given fermentation volume (e.g., kg product per hour per liter). The term "efficiency of production" includes the time required for a particular level of production to be achieved (for example, how long it takes for the cell to attain a particular rate of output of a fme chemical). The term "yield" or "productlcarbon yield" is art-recognized and includes the efficiency of the conversion of the carbon source into the product (i.e., fine chemical). This is generally written as, for example, kg product per kg carbon source.
By increasing the yield or production of the compound, the quantity of recovered molecules, or of useful recovered molecules of that compound in a given amount of S culture over a given amount of time is increased. The terms "biosynthesis"
or a "biosynthetic pathway" are art-recognized and include the synthesis of a compound, preferably an organic compound, by a cell from intermediate compounds in what may be a multistep and highly regulated process. The terms "degradation" or a "degradation pathway" are art-recognized and include the breakdown of a compound, preferably an organic compound, by a cell to degradation products (generally speaking, smaller or less complex molecules) in what may be a multistep and highly regulated process.
The language "metabolism" is art-recognized and includes the totality of the biochemical reactions that take place in an organism. The metabolism of a particular compound, then, (e.g., the metabolism of an amino acid such as glycine) comprises the overall biosynthetic, modification, and degradation pathways in the cell related to this compound.
The MP molecules of the present invention may be combined with one or more MP molecules of the invention or one or more molecules of the same or different metabolic pathway to increase the yield of a desired fine chemical. In a preferred embodiment, the frne chemical is an amino acid, e.g., lysine or methionine.
Alternatively, or in addition, a byproduct which is not desired may be reduced by combination or disruption of MP molecules or other metabolic molecules (e.g., molecules involved in lysine or methionine metabolism). MP molecules combined with other molecules of the same or a different metabolic pathway may be altered in their nucleotide sequence and in the corresponding amino acid sequence to alter their activity under physiological conditions, which leads to an increase in productivity and/or yield of a desired fine chemical. In a fiirther embodiment, an MP molecule in its original or in its above-described altered form may be combined with other molecules of the same or a different metabolic pathway which are altered in their nucleotide sequence in such a way that their activity is altered under physiological conditions which leads to an increase in productivity and/or yield of a desired fine chemical, e.g., an amino acid such as methionine or lysine.

In another embodiment, the MP molecules of the invention, alone or in combination with one or more molecules of the same or different metabolic pathway, are capable of modulating the production of a desired molecule, such as a fine chemical, in a microorganism such as G glutamicum. Using recombinant genetic techniques, one or more of the biosynthetic or degradative enzymes of the invention for amino acids, e.g., lysine or methionine, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose may be manipulated such that its function is modulated. For example, a biosynthetic enzyme may be improved in efficiency, or its allosteric control region destroyed such that feedback inhibition of production of the compound is prevented.
Similarly, a degradative enzyme may be deleted or modified by substitution, deletion, or addition such that its degradative activity is lessened for the desired compound without impairing the viability of the cell. In each case, the overall yield or rate of production of one of these desired fine chemicals may be increased.
It is also possible that such alterations in the protein and nucleotide molecules of the invention may improve the production of other fine chemicals besides the amino acids, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, and trehalose.
Metabolism of any one compound is necessarily intertwined with other biosynthetic and degradative pathways within the cell, and necessary cofactors, intermediates, or substrates in one pathway are likely supplied or limited by another such pathway.
Therefore, by modulating the activity of one or more of the proteins of the invention, the production or efficiency of activity of another fine chemical biosynthetic or degradative pathway may be impacted. For example, amino acids serve as the structural units of all proteins, yet may be present intracellularly in levels which are limiting for protein synthesis; therefore, by increasing the efficiency of production or the yields of one or more amino acids within the cell, proteins, such as biosynthetic or degradative proteins, may be more readily synthesized. Likewise, an alteration in a metabolic pathway enzyme such that a particular side reaction becomes more or less favored may result in the over- or under-production of one or more compounds which are utilized as intermediates or substrates for the production of a desired fine chemical.
The isolated nucleic acid sequences of the invention are contained within the genome of a Corynebacterium gdutamicum strain available through the American Type Culture Collection, given designation ATCC 13032. The nucleotide sequence of the isolated C. glutamicum MP DNAs and the predicted amino acid sequences of the C.

glutamicum MP proteins are shown in the Sequence Listing as odd-numbered SEQ
ID
NOs and even-numbered SEQ ID NOs, respectively. Computational analyses were performed which classified and/or identified these nucleotide sequences as sequences which encode metabolic pathway proteins, e.g., proteins involved in the methionine or lysine metabolic pathways.
The present invention also pertains to proteins which have an amino acid sequence which is substantially homologous to an amino acid sequence of the invention (e.g., the sequence of an even-numbered SEQ ID NO of the Sequence Listing). As used herein, a protein which has an amino acid sequence which is substantially homologous to a selected amino acid sequence is least about SO% homologous to the selected amino acid sequence, e.g., the entire selected amino acid sequence. A protein which has an amino acid sequence which is substantially homologous to a selected amino acid sequence can also be least about 50%, 51%, S2%, S3%, S4%, SS%, S6%, S7%, 58%, S9%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 6S%, 66%, 67%, 68%, 1S 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 8S%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to the selected amino acid sequence.
An MP protein of the invention, or a biologically active portion or fragment thereof, alone or in combination with one or more proteins of the same or different metabolic pathway, can catalyze an enzymatic reaction in one or more amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways, or have one or more of the activities set forth in Table 1 (e.g., metabolism of methionine or lysine biosynthesis).

Various aspects of the invention are described in further detail in the following subsections: .
A. Isolated Nucleic Acid Molecules One aspect of the invention pertains to isolated nucleic acid molecules that encode MP polypeptides or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes or primers for the identification or amplification of MP-encoding nucleic acid (e.g., MP DNA). As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. This term also encompasses untranslated sequence located at both the 3' and 5' ends of the coding region of the gene: at least about 100 nucleotides of sequence upstream from the 5' end of the coding region and at least about nucleotides of sequence downstream from the 3'end of the coding region of the gene.
The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA. An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. Preferably, an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated MP nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived (e.g, a C. glutamicum cell). Moreover, an "isolated" nucleic acid molecule, such as a DNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized.
A nucleic acid molecule of the present invention, e.g., a nucleic acid molecule having a nucleotide sequence of an odd-numbered SEQ ID NO of the Sequence Listing, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, a C. glutamicum MP DNA can be isolated from a G glutamicum library using all or portion of one of the odd-numbered SEQ ID NO sequences of the Sequence Listing as a hybridization probe and standard hybridization techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed , Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
Moreover, a nucleic acid molecule encompassing all or a portion of one of the nucleic acid sequences of the invention (e.g., an odd-numbered SEQ ID NO:) can be isolated by the polymerase chain reaction using oligonucleotide primers designed based upon this sequence (e.g., a nucleic acid molecule encompassing all or a portion of one of the nucleic acid sequences of the invention (e.g., an odd-numbered SEQ ID NO of the Sequence Listing) can be isolated by the polymerase chain reaction using oligonucleotide primers designed based upon this same sequence). For example, mRNA
can be isolated from normal endothelial cells (e.g., by the guanidinium-thiocyanate extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and DNA
can be prepared using reverse transcriptase (e.g., Moloney MLV reverse transcriptase, available from GibcoBRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for polymerase chain reaction amplification can be designed based upon one of the nucleotide sequences shown in the Sequence Listing. A nucleic acid of the invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to an MP nucleotide sequence can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises one of the nucleotide sequences shown in the Sequence Listing. The nucleic acid sequences of the invention, as set forth in the Sequence Listing, correspond to the Corynebacterium glutamicum MP DNAs of the invention. This DNA comprises sequences encoding MP proteins (i.e., the "coding region", indicated in each odd-numbered SEQ ID NO: sequence in the Sequence Listing), as well as 5' untranslated sequences and 3' untranslated sequences, also indicated in each odd-numbered SEQ ID
NO: in the Sequence Listing. Alternatively, the nucleic acid molecule can comprise only the coding region of any of the nucleic acid sequences of the Sequence Listing.
For the purposes of this application, it will be understood that some of the MP
nucleic acid and amino acid sequences set forth in the Sequence Listing have an identifying RXA, RXN, RXS, or RXC number having the designation "RXA", "RXN", "RXS", or "RXC" followed by 5 digits (i. e., RXA,, RXN, RXS, or RXC). Each of the nucleic acid sequences comprises up to three parts: a 5' upstream region, a coding region, and a downstream region. Each of these three regions is identified by the same RXA, RXN, RXS, or RXC designation to eliminate confusion. The recitation "one of the odd-numbered sequences of the Sequence Listing", then, refers to any of the nucleic acid sequences in the Sequence Listing, which may also be distinguished by their differing RXA, RXN, RXS, or RXC designations. The coding region of each of these sequences is translated into a corresponding amino acid sequence, which is also set forth in the Sequence Listing, as an even-numbered SEQ ID NO: immediately following the corresponding nucleic acid sequence . For example, the coding region for RXA00115 is set forth in SEQ ID N0:69, while the amino acid sequence which it encodes is set forth as SEQ ID N0:70. The sequences of the nucleic acid molecules of the invention are identified by the same RXA, RXN, RXS, or RXC designations as the amino acid molecules which they encode, such that they can be readily correlated. For example, the amino acid sequences designated RXA00115, RXN00403, and RXS03158 are translations of the coding regions of the nucleotide sequences of nucleic acid molecules RXA00115, RXN00403, and RXS03158, respectively. The correspondence between the RXA, RXN, RXS, and RXC nucleotide and amino acid sequences of the invention and their assigned SEQ ID NOs is set forth in Table 1.
Several of the genes of the invention are "F-designated genes". An F-designated gene includes those genes set forth in Table 1 which have an 'F' in front of the RXA, RXN, RXS, or RXC designation. For example, SEQ ID N0:77, designated, as indicated on Table 1, as "F RXA,00254", is an F-designated gene.
Also listed on Table 1 are the metZ (or meth and metC genes (designated as SEQ ID NO:1 and SEQ ID N0:3, respectively. The corresponding amino acid sequence encoded by the metZ and metC genes are designated as SEQ ID N0:2 and SEQ ID
NO:S, respectively.
In one embodiment, the nucleic acid molecules of the present invention are not intended to include those compiled in Table 2.
In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of one of the nucleotide sequences of the invention (e.g., a sequence of an odd-numbered SEQ
ID
NO: of the Sequence Listing), or a portion thereof. A nucleic acid molecule which is complementary to one of the nucleotide sequences of the invention is one which is su~ciently complementary to one of the nucleotide sequences shown in the Sequence Listing (e.g., the sequence of an odd-numbered SEQ ID NO:) such that it can hybridize to one of the nucleotide sequences of the invention, thereby forming a stable duplex.
In still another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to a nucleotide sequence of the invention (e.g., a sequence of an odd-numbered SEQ ID NO: of the Sequence Listing), or a portion thereof. Ranges and identity values intermediate to the above-recited ranges, (e.g., 70-90% identical or 80-95% identical) are also intended to be encompassed by the present invention. For example, ranges of identity values using a combination of any of the above values recited as upper and/or lower limits are intended to be included. . In an additional preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, to one of the nucleotide sequences of the invention, or a portion thereof.
Moreover, the nucleic acid molecule of the invention can comprise only a portion of the coding region of the sequence of one of the odd-numbered SEQ ID
NOs of the Sequence Listing, for example a fragment which can be used as a probe or primer or a fragment encoding a biologically active portion of an MP protein. The nucleotide sequences determined from the cloning of the MP genes from C. glutamicum allows for the generation of probes and primers designed for use in identifying and/or cloning MP
homologues in other cell types and organisms, as well as MP homologues from other Coryn'ebacteria or related species. The pxobe/primer typically comprises substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 40, 50 or 75 consecutive nucleotides of a sense strand of one of the nucleotide sequences of the invention (e.g., a sequence of one of the odd-numbered SEQ ID NOs of the Sequence Listing), an anti-sense sequence of one of these sequences, or naturally occurring mutants thereof. Primers based on a nucleotide sequence of the invention can be used in PCR reactions to clone MP homologues.
Probes based on the MP nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In preferred embodiments, the probe fizrther comprises a label group attached thereto, e.g.
the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a diagnostic test kit for identifying cells which misexpress an MP protein, such as by measuring a level of an MP-encoding nucleic acid in a sample of cells from a subject e.g., detecting MP ml'ZNA
levels or determining whether a genomic MP gene has been mutated or deleted.
In one embodiment, the nucleic acid molecule of the invention encodes a protein or portion thereof which includes an amino acid sequence which is sufficiently homologous to an amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO of the Sequence Listing) such that the protein or portion thereof maintains the ability to catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway. As used herein, the language "sufficiently homologous" refers to proteins or portions thereof which have amino acid sequences which include a minimum number of identical or .
equivalent (e.g., an amino acid residue which has a similar side chain as an amino acid residue in a sequence of one of the even-numbered SEQ ID NOs of the Sequence Listing) amino acid residues to an amino acid sequence of the invention such that the protein or portion thereof is able to catalyze an enzymatic reaction in a C.
glutamicum amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside or trehalose metabolic pathway. Protein members of such metabolic pathways, as described herein, function to catalyze the biosynthesis or degradation of one or more of amino acids, vitamins, cofactors, nutraceuticals, nucleotides, nucleosides, or trehalose.
Examples of such activities are also described herein. Thus, "the function of an MP
protein"
contributes to the overall functioning of one or more such metabolic pathway and . contributes, either directly or indirectly, to the yield, production, and/or efficiency of production of one or more fine chemicals. Examples of MP protein activities are set forth in Table 1.
In another embodiment, the protein is at least about 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 71%, 72%, 73%, ?4%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, $5%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to an entire amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence Listing).

Portions of proteins encoded by the MP nucleic acid molecules of the invention are preferably biologically active portions of one of the MP proteins. As used herein, the term "biologically active portion of an MP protein" is intended to include a portion, e.g., a domainlmotif, of an MP protein that catalyzes an enzymatic reaction in one or more C. glutamicum amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathways, or has an activity as set forth in Table 1.
To determine whether an MP protein or a~biologically active portion thereof can catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway, an assay of enzymatic activity may be performed.
Such assay methods are well known to those of ordinary skill in the art, as detailed in Example 8 of the Exemplification.
Additional nucleic acid fragments encoding biologically active portions of an MP protein can be prepared by isolating a portion of one of the amino acid sequences of the invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence Listing), expressing the encoded portion of the MP protein or peptide (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of the MP protein or peptide.
The invention further encompasses nucleic acid molecules that differ from one of the nucleotide sequences of the invention (e.g., a sequence of an odd-numbered SEQ ID
NO: of the Sequence Listing) (and portions thereof) due to degeneracy of the genetic code and thus encode the same MP protein as that encoded:by the nucleotide sequences of the invention. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in the Sequence Listing (e.g., an even-numbered SEQ ID NO:). In a still further embodiment, the nucleic acid molecule of the invention encodes a full length C.
glutamicum protein which is substantially homologous to an amino acid sequence of the invention (encoded by an open reading frame shown in an odd-numbered SEQ ID
NO:
of the Sequence Listing).
It will be understood by one of ordinary skill in the art that in one embodiment the sequences of the invention are not meant to include the sequences of the prior art, such as those Genbank sequences set forth in Table 2, which was available prior to the present invention. In one embodiment, the invention includes nucleotide and amino acid sequences having a percent identity to a nucleotide or amino acid sequence of the WO 01!66573 PCT/IB00/02035 invention which is greater than that of a sequence of the prior art (e.g., a Genbank sequence (or the protein encoded by such a sequence) set forth in Table 2).
For example, the invention includes a nucleotide sequence which is greater than and/or at least 45% identical to the nucleotide sequence designated RXA00657 SEQ ID N0:5 One of ordinary skill in the art would be able to calculate the lower threshold of percent identity for any given sequence of the invention by examining the GAP-calculated percent identity scores set forth in Table 4 for each of the three top hits for the given sequence, and by subtracting the highest GAP-calculated percent identity from percent. One of ordinary skill in the art will also appreciate that nucleic acid and amino acid sequences having percent identities greater than the lower threshold so calculated (e.g., at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more identical) are also encompassed by the invention.
In addition to the C. glutamicum MP nucleotide sequences set forth in the Sequence Listing as odd-numbered SEQ ID NOs, it will be appreciated by one of ordinary skill in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of MP proteins may exist within a population (e.g., the C.
glutamicum population). Such genetic polymorphism in the MP gene may exist among individuals within a population due to natural variation. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding an MP protein, preferably a C. glutamicum MP protein.
Such natural variations can typically result in 1-5% variance in the nucleotide sequence of the MP gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in MP that are the result of natural variation and that do not alter the functional activity of MP proteins are intended to be within the scope of the invention.
Nucleic acid molecules corresponding to natural variants and non-C. glutamicum homologues of the C. glutamicum MP DNA of the invention can be isolated based on their homology to the C. glutamicum MP nucleic acid disclosed herein using the C.
glutamicum DNA, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 15 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising a nucleotide sequence of an odd-numbered SEQ m NO: of the Sequence Listing. In other embodiments, the nucleic acid is at least 30, 50,100, 250 or more nucleotides in length. As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferably, the conditions are such that sequences at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologous to each other typically remain hybridized to each other. Such stringent conditions are known to one of ordinary skill in the art and can be found in current Protocols in Molecular Biology, John Wiley 8t Sons, N.Y. (1989), 6.3.1-6.3.6.
A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at SO-65°C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to a nucleotide sequence of the invention corresponds to a naturally-occurnng nucleic acid molecule. As used herein, a "naturally-occurnng" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein). In one embodiment, the nucleic acid encodes a natural C
glutamicum MP protein.
In addition to naturally-occurring variants of the MP sequence that may exist in the population, one of ordinary skill in the art will further appreciate that changes can be introduced by mutation into a nucleotide sequence of the invention, thereby leading to changes in the amino acid sequence of the encoded MP protein, without altering the functional ability of the MP protein. For example, nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in a nucleotide sequence of the invention. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of one of the MP proteins (e.g., an even-numbered SEQ ID NO: of the Sequence Listing) without altering the activity of said MP
protein, whereas an "essential" amino acid residue is required for MP protein activity.
Other amino acid residues, however, (e.g., those that are not conserved or only semi-conserved in the domain having MP activity) may not be essential for activity and thus are likely to be amenable to alteration without altering MP activity.
Accordingly, another aspect of the invention pertains to nucleic acid molecules encoding MP proteins that contain changes in amino acid residues that are not essential for MP activity. Such MP proteins differ in amino acid sequence from a sequence of an even-numbered SEQ ID NO: of the Sequence Listing yet retain at least one of the MP
activities described herein. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 50% homologous to an amino acid sequence of the invention and is capable of catalyzing an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside; or trehalose metabolic pathway, or has one or more activities set forth in Table 1. Preferably, the protein encoded by the nucleic acid molecule is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%%, more preferably at least about 7I%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% homologous to one of the amino acid sequences of the invention.
To determine the percent homology of two amino acid sequences (e.g., one of the amino acid sequences of the invention and a mutant form thereof) or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of one protein or nucleic acid for optimal alignment with the other protein or nucleic acid). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in one sequence (e.g., one of the amino acid sequences of the invention) is occupied by the same amino acid residue or nucleotide as the corresponding position in the other sequence (e.g., a mutant form of the amino acid sequence), then the molecules are homologous at that position (i. e., as used herein amino acid or nucleic acid "homology"
is equivalent to amino acid or nucleic acid "identity"). The percent homology between the two sequences is a function of the number of identical positions shared by the sequences (i. e., % homology = # of identical positions/total # of positions x 100).
An isolated nucleic acid molecule encoding an MP protein homologous to a protein sequence of the invention (e.g., a sequence of an even-numbered SEQ ID
NO: of WO 01!66573 PCTlIB00/02035 the Sequence Listing) can be created by introducing one or more nucleotide substitutions, additions or deletions into a nucleotide sequence of the invention such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into one of the nucleotide sequences of the invention by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in an MP protein is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of an MP coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for an MP activity described herein to identify mutants that retain MP activity. Following mutagenesis of the nucleotide sequence of one of the odd-numbered SEQ ID NOs of the Sequence Listing, the encoded protein can be expressed recombinantly and the activity of the protein can be determined using, for example, assays described herein (see Example 8 of the Exemplification).
In addition to the nucleic acid molecules encoding MP proteins described above, another aspect of the invention pertains to isolated nucleic acid molecules which are antisense thereto. An "antisense" nucleic acid comprises a nucleotide sequence which is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded DNA molecule or complementary to an mRNA
sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. The antisense nucleic acid can be complementary to an entire MP coding strand, or to only a portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence encoding an MP protein. The term "coding region" refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the entire coding.
region of SEQ ID NO.:1 (met. comprises nucleotides 363 to 1673). In another embodiment, the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding MP. The term "noncoding region"
refers to 5' and 3' sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5' and 3' untranslated regions).
Given the coding strand sequences encoding MP disclosed herein (e.g., the sequences set forth as odd-numbered SEQ ID NOs in the Sequence Listing), antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of MP mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of MP mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of MP mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, l-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio N6-isopentenyladenine, uracil-S-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, S-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, S-methyluracil, uracil-S-oxyacetic acid methylester, uracil-S-oxyacetic acid (v), S-methyl-2-thiouracil, 3-(3-amino-3-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense S nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA
transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
The antisense nucleic acid molecules of the invention are typically administered to a cell or generated in situ such that they hybridize with or bind to cellular mRNA
and/or genomic DNA encoding an MP protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to.form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through 1 S specific interactions in the major groove of the double helix. The antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong prokaryotic, viral, or eukaryotic promoter are preferred.
In yet another embodiment, the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms 2S specific double-stranded hybrids with complementary RNA in which, contrary to the usual (3-units, the strands run parallel to each other (Gaultier et al. (198 Nucleic Acids.
Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-methylribonucleotide (moue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (moue et al. (1987) FEBS Lett. 215:327-330).
In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoffand Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave MP mRNA transcripts to thereby inhibit translation of MP
mRNA.
A ribozyme having specificity for an MP-encoding nucleic acid can be designed based upon the nucleotide sequence of an MP DNA disclosed herein (i.e., SEQ ID NO:1 (metZ). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an MP-encoding mRNA. See, e.g., Cech et al. U.S.
Patent No. 4,987,071 and Cech et al. U.S. Patent No. 5,116,742. Alternatively, MP
mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J.W. (1993) Science 261:1411-1418.
Alternatively, MP gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of an MP nucleotide sequence (e.g., an MP promoter and/or enhancers) to form triple helical structures that prevent transcription of an MP gene in target cells. See generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et al. (1992) Ann. N Y. Acad. Sci. 660:27-36; and Maker, L.J. (1992) Bioassays 14(12):807-15.
Another aspect of the invention pertains to combinations of genes involved in methionine and/or lysine metabolism and the use of to combinations of genes involved in methionine and/or lysine metabolism in the methods of the invention.
Preferred combinations are the combination of metZ with metC, metB (encoding Cystathionine-Synthase), metA (encoding homoserine-O-acetyltransferase), metE (encoding Methionine Synthase), metes (encoding Methionine Synthase), hom (encoding homoserine dehydrogenase), asd (encoding aspartatesemialdehyd dehydrogenase), IysC
/ask (encoding aspartokinase) and rxa00657 (herein designated as SEQ ID
NO.:S), dapA, (gene encoding DIHYDRODIPICOLINATE SYNTHASE), dapB (gene encoding DIHYDRODIPICOLINATE REDUCTASE), dapC (gene encoding 2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase), dapDlargD (gene encoding acetylornithine transaminase), dapE (gene encoding succinyldiaminopimelate desuccinylase), dapF (gene encoding diaminopimelate epimerase), lysA (gene encoding diaminopimelate decarboxylase), ddh (gene encoding diaminopimelate dehydrogenase), lysE (gene encoding for the lysine exporter), IysC, lysR, lysG (gene encoding for the exporter regulator), hsk (gene encoding homoserine kinase) as well as genes involved in anaplerotic reaction such as ppc (gene encoding phosphoenolpyruvate carboxylase), ppcK (gene encoding phosphoenolpyruvate carboxykinase), pycA (gene encoding pyruvate carboxylase), accD, accA, accB, accC (genes encoding for subunits of acetyl-CoA-carboxylase), as well as genes of the pentose-phosphate pathway, gpdh genes encoding glucose-6-phophate-dehydrogenase, opcA, pgdh (gene encoding 6-phosphogluconate-dehydrogenase), to (gene encoding transaldolase), tk (gene encoding gene encoding transketolase), pgl (gene encoding 6-PHOSPHOGLUCONO-LACTONASE), ripe (gene encoding RIBULOSE-PHOSPHATE 3-EPIMERASE) rpe (gene encoding RIBOSE 5-PHOSPHATE EPIMERASE) or combinations of the above-mentioned genes of the pentose-phosphate-pathways, or other MP genes of the invention.
The genes may be altered in their nucleotide sequence and in the corresponding amino acid sequence resulting in derivatives in such a way that their activity is altered under physiological conditions which leads to an increase in productivity and/or yield of a desired fine chemical, e.g., an amino acid such as methionine or lysine. One class of such alterations or derivatives is well known for the nucleotide sequence of the ask gene encoding aspartokinase. These alterations lead to removal of feed back inhibition by the amino acids lysine and threonine and subsequently to lysine overproduction. In a preferred embodiment the metZ gene or altered forms of the metZ gene are used in a Corynebacterium strain in combination with ask, hom, metA and metes or derivatives of these genes. In another preferred embodiment metZ or altered forms of the metZ
gene are used in a Corynebacterium strain in combination with asl~ hom, metA and metE or derivatives of these genes. In a more preferred embodiment, the gene combinations metZ
or altered forms of the metZ gene are combined with ash hom, metA and metes or derivatives of these genes, or metZ is combined with asl~ hom, metA and metE
or derivatives of these genes in a Corynebacterium strain and sulfur sources such as sulfates, thiosulfates, sulfites and also more reduced sulfur sources such as H2S and sulfides and derivatives are used in the growth medium. Also, sulfur sources such as methyl mercaptan, methanesulfonic acid, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids such as cysteine and other sulfur containing compounds can be used. Another aspect of the invention pertains to the use of the above mentioned gene combinations in a Corynebacterium strain which is, before or after introduction of the genes, mutagenized by radiation or by mutagenic chemicals well-known to one of ordinary skill in the art and selected for resistance against high concentrations of the fine chemical of interest, e.g. lysine or methionine or analogues of the desired fine chemical such as the methionine analogues ethionine, methyl methionine, or others. In another embodiment, the gene combinations mentioned above can be expressed in a Corynebacterium strain having particular gene disruptions. Preferred are gene disruptions that encode proteins that favor carbon flux to undesired metabolites. Where methionine is the desired fme chemical the formation of lysine may be unfavorable. In such a case the combination of the above mentioned genes should proceed in a Corynebacterium strain bearing a gene disruption of the IysA gene (encoding diaminopimelate decarboxylase) or the ddh gene (encoding the meso-diaminopimelate dehydrogenase catalysing the conversion of tetrahydropicolinate to meso-diaominopimelate). In a preferred embodiment, a favorable combination of the above-mentioned genes are all altered in such a way that their gene products are not feed back inhibited by end products or metabolites of the biosynthetic pathway leading to the desired fine chemical. In the case that the desired fine chemical is methionine, the gene combinations may be expressed in a strain previously treated with mutagenic agents or radiation and selected for the above-mentioned resistance. Additionally, the strain should be grown in a growth medium containing one or more of the above mentioned sulfur sources.
In another embodiment of the invention, a gene was identified from the genome of Corynebacterium glutamicum as a gene coding for a hypothetical transcriptional regulatory protein. This gene is described as RXA00657. The nucleotide sequence of RXA00657 corresponds to SEQ ID NO:S. The amino acid sequence of RXA00657 corresponds to SEQ ID N0:6. It was found that when the RXA00657 gene, as well as upstream and downstream regulatory regions described in the examples, was cloned into a vector capable of replicating in Corynebacterium glutamicum and transformed and expressed in a lysine producing strain such as ATCC 13286, that this strain produced more lysine compared to the strain transformed with the same plasmid lacking the aforementioned nucleotide fragment RXA00657. In addition to the observation that the lysine titer was increased in the mentioned strain, the selectivity determined by the molar amount of lysine produced compared to the molar amount of sucrose consumed was increased (see Example 14). Overexpression of RXA00657 in combination with the overexpression of other genes either directly involved in the lysine specific pathway such as IysC, dapA, dapB, dapC, dapD, dapF, ddh, lysE, lysG, and lysR results in an increase in the production of lysine compared to 1ZXA00657 alone.
B. Recombinant Expression Vectors and Host Cells Another. aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding an MP protein (or a portion thereof) or combinations of genes wherein at least one gene encodes for an MP protein. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g:, non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA
techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector.
However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequences) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, repressor binding sites, activator binding sites, enhancers and other expression control elements (e.g., terminators, polyadenylation signals, or other elements of mRNA secondary structure). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells. Preferred regulatory sequences are, for example, promoters such as cos-, tac-, trp-, tet-, trp-tet-, lpp-, lac-, lpp-lac-, lacI9-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, amy, SP02, ~,-PR- or ~, PL, which are used preferably in bacteria.
Additional regulatory sequences are, for example, promoters from yeasts and fungi, such as ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, promoters from plants such as CaMV/3SS, SSU, OCS, lib4, usp, STLS I, B33, nos or ubiquitin- or phaseolin-promoters. It is also possible to use artificial promoters. It will be appreciated by one of ordinary skill in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., MP proteins, mutant forms of MP
proteins, fusion proteins, etc.).
The recombinant expression vectors of the invention can be designed for expression of MP proteins in prokaryotic or eukaryotic cells. For example, MP
genes can be expressed in bacterial cells such as C. glutamicum, insect cells (using baculovirus expression vectors), yeast and other fungal cells (see Romanos, M.A. et al.
(1992) "Foreign gene expression in yeast: a review", Yeast 8: 423-488; van den Hondel, C.A.M.J.J. et al. (1991) "Heterologous gene expression in filamentous fungi"
in: More Gene Manipulations in Fungi, J.W. Bennet & L.L. Lasure, eds., p. 396-428:
Academic Press: San Diego; and van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J.F. et al., eds., p. 1-28, Cambridge University Press:
Cambridge), algae and multicellular plant cells (see Schmidt, R. and Willmitzer, L. (1988) High efficiency Agrobacterium fume, f 'aciens mediated transformation of Arabidopsis thaliana leaf and cotyledon explants" Plant Cell Rep.: 583-586), or mammalian cells.

WO 01/665?3 PCT/IB00/02035 Suitable host cells are discussed further in Goeddel, Gene Expression Technology:
Methods in Enrymology 185, Academic Press, San Diego, CA (1990).
Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
S Expression of proteins in prokaryotes is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein but also to the C-terminus or fused within suitable regions in the proteins. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors;
a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein:. Such enzymes; and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase.
Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly;
MA) and pRITS (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. In one embodiment, the coding sequence of the MP protein is cloned into a pGEX expression vector to create a vector encoding a fusion protein comprising, from the N-terminus to the C-terminus, GST-thrombin cleavage site-X protein. The fusion protein can be purified by affinity chromatography using glutathione-agarose resin.
Recombinant MP protein unfused to GST can be recovered by cleavage of the fusion protein with thrombin.
Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., (1988) Gene 69:301-315) pLG338, pACYC184, pBR322, pUCl8, pUCl9, pKC30, pRep4, pHSI, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, ~,gtl l, pBdCl, and pET l 1d (Studier et al., Gene Expression Technology:
Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89;
and Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York IBSN 0 444 904018).
Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector relies on transcription from a T7 gnl0-lac fusion promoter mediated by a coexpressed viral RNA polymerase ('f7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS 174(DE3) from a resident ~, prophage harboring a gnl gene under the transcriptional control of the lacUV 5 promoter. For transformation of other varieties of bacteria, appropriate vectors may be selected. For example, the plasmids pIJ101, pIJ364, pIJ702 and pIJ361 are known to be useful in transforming Streptomyces, while plasmids pUB110, pC194, or pBD214 are suited for transformation of Bacillus species. Several plasmids of use in the transfer of genetic information into Corynebacterium include pHM1519, pBLI, pSA77, or pAJ667 (Pouwels et al., eds.
(1985) Cloning Vectors. Elsevier: New York IBSN 0 444 904018).
' One strategy to maximize recombinant protein expression is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymolog~ 185, Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in the bacterium chosen for expression, such as C.
glutamicum (Wads et al. (I992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the MP protein expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari, et al., (1987) Embo J. 6:229-234), , 2 ~., pAG-l, Yep6, Yepl3, pEMBLYe23, pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods for the construction of vectors appropriate for use in other fungi, such as the filamentous fungi, include those detailed in: van den Hondel, C.A.M.J.J. &
Punt, P.J.
(1991) "Gene transfer systems and vector development for filamentous fungi, in:
Applied Molecular Genetics of Fungi, J.F. Peberdy, et al., eds., p. 1-28, Cambridge University Press: Cambridge, and Pouwels et al., eds. (1985) Cloning Vectors.
Elsevier:
New York (IBSN 0 444 904018).
Alternatively, the MP proteins of the invention can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al.
(1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39).
In another embodiment, the MP proteins of the invention may be expressed in unicellular plant cells (such as algae) or in plant cells from higher plants (e.g., the spermatophytes, such as crop plants). Examples of plant expression vectors include those detailed in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20: 1195-1197; and Bevan, M.W. (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acid. Res. 12: 8711-8721, and include pLGV23, pGHlac+, pBINl9, pAK2004, andpDH51 (Pouwels et al:, eds. (1985) Cloning Vectors.
Elsevier:
New York IBSN 0 444 904018).
. In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC
(Kaufman et al. (1987) EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements.
For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific;
Pinkert et al.
(1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) PNAS 86:5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the a-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).
The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to MP mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which 1 S direct constitutive, tissue specific or cell type specific expression of antisense RNA.
The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986.
Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell"
and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
A host cell can be any prokaryotic or eukaryotic cell. For example, an MP
protein can be expressed in bacterial cells such as C glutamicum, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
Other suitable host cells are known to those of ordinary skill in the art.
Microorganisms related to Corynebacterium glutamicum which may be conveniently used as host cells for the nucleic acid and protein molecules of the invention are set forth in Table 3.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection", "conjugation" and "transduction" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., linear DNA or RNA (e.g., a linearized vector or a gene construct alone without a vector) or nucleic acid in the form of a vector (e.g., a plasmid, phage, phasmid, phagemid, transposon or other DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, chemical-mediated transfer, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al.
(Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest.
Preferred selectable markers include those which confer resistance to drugs, such as 6418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding an MP protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
To create a homologous recombinant microorganism, a vector is prepared which contains at least a portion of an MP gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the MP gene.
Preferably, this MP gene is a Corynebacteriurn glutamicum MP gene, but it can be a homologue from a related bacterium or even from a mammalian, yeast, or insect source. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous MP gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector).
Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous MP gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous MP protein). In the homologous recombination vector, the altered portion of the MP gene is flanked at its 5' and 3' ends by additional nucleic acid of the MP gene to allow for homologous recombination to occur between the exogenous MP gene carned by the vector and an endogenous MP gene in a microorganism. The additional flanking MP nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA
~ (both at the 5'~ and 3' ends) are included in the vector (see e.g., Thomas, K.R., and Capecchi, M.R. (198'n Cell 51: 503 for a description of homologous recombination vectors). The vector is introduced into a microorganism (e.g., by electroporation) and cells in which the introduced MP gene has homologously recombined with the endogenous MP gene are selected, using art-known techniques.
In another embodiment, recombinant microorganisms can be produced which contain selected systems which allow for regulated expression of the introduced gene.
For example, inclusion of an MP gene on a vector placing it under control of the lac operon permits expression of the MP gene only in the presence of IPTG. Such regulatory systems are well known in the art.
In another embodiment, an endogenous MP gene in a host cell is disrupted (e.g., by homologous recombination or other genetic means known in the art) such that expression of its protein product does not occur. In another embodiment, an endogenous or introduced MP gene in a host cell has been altered by one or more point mutations, deletions, or inversions, but still encodes a functional MP protein. In still another embodiment, one or more of the regulatory regions (e.g., a promoter, repressor, or inducer) of an MP gene in a microorganism has been altered (e.g., by deletion, truncation, inversion, or point mutation) such that the expression of the MP
gene is modulated. One of ordinary skill in the art will appreciate that host cells containing more than one of the described MP gene and protein modifications may be readily produced using the methods of the invention, and are meant to be included in the present invention.
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i. e., express) an MP protein. Accordingly, the invention further provides methods for producing MP proteins using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding an MP protein has been introduced, or into which genome has been introduced a gene encoding a wild-type or altered MP protein) in a suitable medium until MP protein is produced. In another embodiment, the method further comprises isolating MP proteins from the medium or the host cell.
C. Isolated MP Proteins Another aspect of the invention pertains to isolated MP proteins, and biologically active portions thereof. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material when produced by recombinant DNA
techniques, or chemical precursors or other chemicals when chemically synthesized.
The language "substantially free of cellular material" includes preparations of MP
protein in which the protein is separated from cellular components of the cells in which it is naturally or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of MP protein having less than about 30% (by dry weight) of non-MP protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-MP
protein, still more preferably less than about 10% of non-MP protein, and most preferably less than about 5% non-MP protein. When the MP protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i. e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation. The language "substantially free of chemical precursors or other chemicals"
includes preparations of MP protein in which the protein is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. In one embodiment, the language "substantially free of chemical precursors or other chemicals"
includes preparations of MP protein having less than about 30% (by dry weight) of chemical precursors or non-MP chemicals, more preferably less than about 20% chemical precursors or non-MP chemicals, still more preferably less than about 10%
chemical precursors or non-MP chemicals, and most preferably less than about 5%
chemical precursors or non-MP chemicals. In preferred embodiments, isolated proteins or biologically active portions thereof lack contaminating proteins from the same organism from which the MP protein is derived. Typically, such proteins are produced by recombinant expression of, for example, a C. glutamicum MP protein in a microorganism such as C. glutamicum.
An isolated MP protein or a portion thereof of the invention can catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway, or has one or more of the activities set forth in Table 1. In preferred embodiments, the protein or portion thereof comprises an amino acid sequence which is sufficiently homologous to an amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID NO: of the Sequence Listing) such that the protein or portion thereof maintains the ability to catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway. The portion of the protein is preferably a biologically active portion as described herein. In another preferred embodiment, an MP
protein of the invention has an amino acid sequence set forth as an even-numbered SEQ ID
NO: of the Sequence Listing. In yet another preferred embodiment, the MP protein has an amino acid sequence which is encoded by a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, to a nucleotide sequence of the invention (e.g., a sequence of an odd-numbered SEQ ID NO: of the Sequence Listing). In still another preferred embodiment, the MP protein has an amino acid sequence which is encoded by a nucleotide sequence that is at least about SO%, S1%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to one of the nucleic acid sequences of the invention, or a portion thereof. Ranges and identity values intermediate to the above-recited values, (e.g., 70-90% identical or 80-95% identical) are also intended to be encompassed by the present invention. For example, ranges of identity values using a 3.0 combination of any of the above values recited as upper and/or lower limits are intended to be included. The preferred MP proteins of the present invention also preferably possess at least one of the MP activities described herein. For example, a preferred MP
protein of the present invention includes an amino acid sequence encoded by a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, to a nucleotide. sequence of the invention, and which can catalyze an enzymatic reaction in an amino acid, vitamin, cofactor, nutraceutical, nucleotide, nucleoside, or trehalose metabolic pathway, or which has one or more of the activities set forth in Table 1.
In other embodiments, the MP protein is substantially homologous to an amino acid sequence of the invention (e.g., a sequence of an even-numbered SEQ ID
NO: of the Sequence Listing) and retains the functional activity of the protein of one of the amino acid sequences of the invention yet differs in amino acid sequence due to natural variation or mutagenesis, as described in detail in subsection I above.
Accordingly, in another embodiment, the MP protein is a protein which comprises an amino acid sequence which is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even'more preferably at least about 95%, 96%, 97%, 98%, 99%, 99.7% or more homologous to an entire amino acid sequence of the invention and which has at least one of the MP activities described herein. Ranges and identity values intermediate to the above-recited values, (e.g., 70-90% identical or 80-95%
identical) are also intended to be encompassed by the present invention. For example, ranges of identity values using a combination of any of the above values recited as upper and/or lower limits are intended to be included. In another embodiment, the invention pertains to a full length C. glutamicum protein which is substantially homologous to an entire amino acid sequence of the invention.
Biologically active portions of an MP protein include peptides comprising amino acid sequences derived from the amino acid sequence of an MP protein, e.g., an amino acid sequence of an even-numbered SEQ ID NO: of the Sequence Listing or the amino acid sequence of a protein homologous to an MP protein, which include fewer amino acids than a full length MP protein or the full length protein which is homologous to an MP protein, and exhibit at least one activity of an MP protein. Typically, biologically active portions (peptides, e.g., peptides which are, for example, 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino acids in length) comprise a domain or motif with at least one activity of an MP protein. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the activities described herein.
Preferably, the biologically active portions of an MP protein include one or more selected domains/motifs or portions thereof having biological activity.
MP proteins are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as described above) and the MP protein is expressed in the host cell. The MP
protein can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques. Alternative to recombinant expression, an MP
protein, polypeptide, or peptide can be synthesized chemically using standard peptide synthesis techniques. Moreover, native MP protein can be isolated from cells (e.g., endothelial cells), for example using an anti=MP antibody, which can be produced by standard techniques utilizing an MP protein or fragment thereof of this invention.
The invention also provides MP chimeric or fusion proteins. As used herein, an MP "chimeric protein" or "fusion protein" comprises an MP polypeptide operatively linked to a non-MP polypeptide. An "MP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to MP, whereas a "non-MP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the MP protein, e.g., a protein which is different from the MP protein and which is derived from the same or a different organism. Within the fusion protein, the term "operatively linked" is intended to indicate that the MP
polypeptide and the non-MP polypeptide are fused in-frame to each other. The non-MP
polypeptide can be fused to the N-terminus or C-terminus of the MP
polypeptide. For example, in one embodiment the fusion protein is a GST-MP fusion protein in which the MP sequences are fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant MP proteins. In another embodiment, the fusion protein is an MP protein containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), expression and/or secretion of an MP protein can be increased through use of a heterologous signal sequence.
Preferably, an MP chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together 'in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA
synthesizers.
Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds.
Ausubel et al. John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). An MP-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the MP protein.
Homologues of the MP protein can be generated by mutagenesis, e.g., discrete point mutation or truncation of the MP protein. As used herein, the term "homologue"
refers to a variant form of the MP protein which acts as an agonist or antagonist of the activity of the MP protein. An agonist of the MP protein can retain substantially the same, or a subset, of the biological activities of the MP protein. An antagonist of the MP protein can inhibit one or more of the activities of the naturally occurnng form of the MP protein, by, for example, competitively binding to a downstream or upstream member of the MP cascade which includes the MP protein. Thus, the C.
glutamicum MP protein and homologues thereof of the present invention may modulate the activity of one or more metabolic pathways in which MP proteins play a role in this microorganism.
In an alternative embodiment, homologues of the MP protein can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the MP
protein for MP protein agonist or antagonist activity. In one embodiment, a variegated library of MP variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of MP
variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential MP
sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of MP sequences therein.
There are a variety of methods which can be used to produce libraries of potential MP

homologues from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential MP sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, S.A. (1983) Tetrahedron 39:3;
Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477.
In addition, libraries of fragments of the MP protein coding can be used to generate a.variegated population of MP fragments for screening and subsequent selection of homologues of an MP protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of an MP coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S 1 nuclease, and Iigating the resulting fragment Library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the MP protein.
Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA
libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of MP
homologues. The most widely used techniques, which are amenable to high through-put analysis, for screening Large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a new technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify MP homologues (Arkin and Yourvan (1992) PNAS
89:7811-7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).

In another embodiment, cell based assays can be exploited to analyze a variegated MP library, using methods well known in the art.
D. Uses and Methods of the Invention The nucleic acid molecules, proteins, protein homologues, fusion proteins, primers, vectors, and host cells described herein can be used in one or more of the following methods: identification of C. glutarnicum and related organisms;
mapping of genomes of organisms related to C. glutamicum; identification and localization of C.
glutamicum sequences of interest; evolutionary studies; determination of MP
protein regions required for function; modulation of an MP protein activity;
modulation of the activity of an MP pathway; and modulation of cellular production of a desired compound, such as a fine chemical.
The MP nucleic acid molecules of the invention have a variety of uses. First, they may be used to identify an organism as being Corynebacterium glutarnicum or a close relative thereof. Also, they may be used to identify the presence of C.
glutamicum or a relative thereof in a mixed population of microorganisms. The invention provides the nucleic acid sequences of a number of C. glutamicum genes; by probing the extracted genomic DNA of a culture of a unique or mixed population of microorganisms under stringent conditions with a probe spanning a region of a C. glutamicum gene which is unique to this organism, one can ascertain whether this organism is present.
Although Corynebacterium glutamicum itself is not pathogenic to humans, it is related to species which are human pathogens, such as Corynebacterium diphtheriae.
Corynebacterium diphtheriae is the causative agent of diphtheria, a rapidly developing, acute, febrile infection which involves both local and systemic pathology. In this disease, a local lesion develops in the upper respiratory tract and involves necrotic injury to epithelial cells; the bacilli secrete toxin which is disseminated through this lesion to distal susceptible tissues of the body. Degenerative changes brought about by the inhibition of protein synthesis in these tissues, which include heart, muscle, peripheral nerves, adrenals, kidneys, liver and spleen, result in the systemic pathology of the disease. Diphtheria continues to have high incidence in many parts of the world, including Africa, Asia, Eastern Europe and the independent states of the former Soviet Union. An ongoing epidemic of diphtheria in the latter two regions has resulted in at least 5,000 deaths since 1990.

In one embodiment, the invention provides a method of identifying the presence or activity of Cornyebacterium diphtheriae in a subject. This method includes detection of one or more of the nucleic acid or amino acid sequences of the invention (e.g., the sequences set forth as odd-numbered or even-numbered SEQ ID NOs, respectively, in the Sequence Listing) in a subject, thereby detecting the presence or activity of Corynebacterium diphtheriae in the subject. C. glutamicum and C. diphtheriae are related bacteria, and many of the nucleic acid and protein molecules in C.
glutamicum are homologous to C. diphtheriae nucleic acid and protein molecules, and can therefore be used to detect C. diphtheriae in a subject.
The nucleic acid and protein molecules of the invention may also serve as markers for specific regions of the genome. This has utility not only in the mapping of the genome, but also for functional studies of C. glutamicum proteins. For example, to identify the region of the genome to which a particular C. glutamicum DNA-binding protein binds, the C. glutamicum genome could be digested, and the fragments incubated with the DNA-binding protein. Those which bind the protein may be additionally probed with the nucleic acid molecules of the invention, preferably with readily detectable labels; binding of such a nucleic acid molecule to the genome fragment enables the localization of the fragment to the genome map of C. glutamicum, and, when performed multiple times with different enzymes, facilitates a rapid determination of the nucleic acid sequence to which the protein binds. Further, the nucleic acid molecules of the invention may be sufficiently homologous to the sequences of related species such that these nucleic acid molecules may serve as markers for the construction of a genomic map in related bacteria, such as Brevibacterium lactofermentum.
The MP nucleic acid molecules of the invention are also useful for evolutionary and.protein structural studies. The metabolic processes in which the molecules of the invention participate are utilized by a wide variety of prokaryotic and eukaryotic cells;
by comparing the sequences of the nucleic acid molecules of the present invention to those encoding similar enzymes from other organisms, the evolutionary relatedness of the organisms can be assessed. Similarly, such a comparison permits an assessment of which regions of the sequence are conserved and which are not, which may aid in determining those regions of the protein which are essential for the functioning of the enzyme. This type of determination is of value for protein engineering studies and may WO 01/66573 PCTlIB00/02035 give an indication of what the protein can tolerate in terms of mutagenesis without losing function.
'n Manipulation of the MP nucleic acid molecules of the invention may result in the production of MP proteins having functional differences from the wild-type MP
proteins. These proteins may be improved in efficiency or activity, may be present in greater numbers in the cell than is usual, or may be decreased in efficiency or activity.
The invention also provides methods for screening molecules which modulate the activity of an MP protein, either by interacting with the protein itself or a substrate or binding partner of the MP protein, or by modulating the transcription or translation of an MP nucleic acid molecule of the invention. In such methods, a microorganism expressing one or more MP proteins of the invention is contacted with one or more test compounds, and the effect of each test compound on the activity or level of expression of the MP protein is assessed.
When the desired fine chemical to be isolated from large-scale fermentative culture of C. glutamicum is an amino acid, a vitamin, a cofactor, a nutraceutical, a nucleotide, a nucleoside, or trehalose, modulation of the activity or efficiency of activity of one or more of the proteins of the invention by recombinant genetic mechanisms may directly impact the production of one of these fine chemicals. For example, in the case of an enzyme in a biosynthetic pathway for a desired amino acid, improvement in efficiency or activity of the enzyme (including the presence of multiple copies of the gene) should lead to an increased production or efficiency of production of that desired amino acid. In the case of an enzyme in a biosynthetic pathway for an amino acid whose synthesis is in competition with the synthesis of a desired amino acid, any decrease in the efficiency or activity of this enzyme (including deletion of the gene) should result in an increase in production or efficiency of production of the desired amino acid, due to decreased competition for intermediate compounds and/or energy. In the case of an enzyme in a degradation pathway for a desired amino acid, any decrease in efficiency or activity of the enzyme should result in a greater yield or efficiency of production of the desired product due to a decrease in its degradation. Lastly, mutagenesis of an enzyme involved in the biosynthesis of a desired amino acid such that this enzyme is no longer is capable of feedback inhibition should result in increased yields or e~ciency of production of the desired amino acid. The same should apply to the biosynthetic and degradadve enzymes of the invention involved in the metabolism of vitamins, cofactors, nutraceuticals, nucleotides, nucleosides and trehalose.
Similarly, when the desired fine chemical is not one of the aforementioned compounds, the modulation of activity of one of the proteins of the invention may still impact the yield and/or efficiency of production of the compound from large-scale culture of C. glutamicum. The metabolic pathways of any organism are closely interconnected; the intermediate used by one pathway is often supplied by a different pathway. Enzyme expression and function may be regulated based on the cellular levels of a compound from a different metabolic process, and the cellular levels of molecules necessary for basic growth, such as amino acids and nucleotides, may critically affect the viability of the microorganism in large-scale culture. Thus, modulation of an amino acid biosynthesis enzyme, for example, such that it is no longer responsive to feedback inhibition or such that it is improved in efficiency or turnover may result in increased cellular levels of one or more amino acids. In turn, this increased pool of amino acids provides not only an increased supply of molecules necessary for protein synthesis, but .-also of molecules which are utilized as intermediates and precursors in a number of other biosynthetic pathways. If a particular amino acid had been limiting in the cell, its increased production might increase the ability of the cell to perform numerous other metabolic reactions, as well as enabling the cell to more efficiently produce proteins of all kinds, possibly increasing the overall growth rate or survival ability of the cell in large scale culture. Increased viability improves the number of cells capable of producing the desired fine chemical in fermentative culture, thereby increasing the yield of this compound. Similar processes are possible by the modulation of activity of a degradative enzyme of the invention such that the enzyme no longer catalyzes, or catalyzes less efficiently, the degradation of a cellular compound which is important for the biosynthesis of a desired compound, or which will enable the cell to grow and reproduce more efficiently in large-scale culture. It should be emphasized that optimizing the degradative activity or decreasing the biosynthetic activity of certain molecules of the invention may also have a beneficial effect on the production of certain fine chemicals from C. glutamicum. For example, by decreasing the efficiency of activity of a biosynthetic enzyme in a pathway which competes with the biosynthetic pathway of a desired compound for one or more intermediates, more of those intermediates should be available for conversion to the desired product. A
similar situation may call for the improvement of degradative ability or efficiency of one or moze proteins of the invention.
This aforementioned list of mutagenesis strategies for MP proteins to result in increased yields of a desired compound is not meant to be limiting; variations on these mutagenesis strategies will be readily apparent to one of ordinary skill in the art. By these mechanisms, the nucleic acid and protein molecules of the invention may be utilized to generate C glutamicum or related strains of bacteria expressing mutated MP
nucleic acid and protein molecules such that the yield, production, andlor efficiency of production of a desired compound is improved. This desired compound may be any natural product of C. glutamicum, which includes the final products of biosynthesis pathways and intermediates of naturally-occurring metabolic pathways, as well as molecules which do not naturally occur in the metabolism of C. glutamicum, but which are produced by a C. glutamicum strain of the invention. Preferred compounds to be produced by Corynebacterium glutamicum strains are the amino acids L-lysine and L
methionine.
In one embodiment, the metC gene encoding cystathionine (3-lyase, the third enzyme in the methionine biosynthetic pathway, was isolated from Corynebacterium glutamicum. The translational product of the gene showed no significant homology with that of metC gene from other organisms. Introduction of the plasmid containing the metC gene into C. glutamicum resulted in a 5-fold increase in the activity of cystathionine ~i-lyase. The protein product, now designated MetC
(corresponding to SEQ ID N0:4), which encodes a protein product of 35,574 Daltons and consists of 325 amino acids, is identical to the previously reported aecD gene (Rossol, I. and Puhler, A.
(1992) J. Bacteriology 174, 2968-2977) except the existence of two different amino acids. Like aecD gene, when present in multiple copies, metC gene conferred resistance to S ((3-aminoethyl)-cysteine which is a toxic lysine analog. However, genetic and biochemical evidences suggest that the natural activity of metC gene product is to mediate methionine biosynthesis in C. glutamicum. Mutant strains of metC were constructed and the strains showed methionine prototrophy. The mutant strains completely lost their ability to show resistance to S (7-aminoethyl)-cysteine.
These results show that, in addition to the transsulfuration, which is another biosynthetic pathway, the direct sulfhydrylation pathway is functional in C. glutamicum as a parallel biosynthetic route for methionine.

in yet another embodiment, it is also shown that the additional sulfliydrylation pathway is catalyzed by O-acetylhomoserine sulfhydrylase. The presence of the pathway is demonstrated by the isolation of the corresponding metZ (or meth gene and enzyme (corresponding to SEQ ID NO:1 and SEQ ID N0:2, respectively). Among the eukaryotes, fungi and yeast species have been reported to have both the transsulfuration and direct sulfhydrylation pathway. Thus far, no prokaryotic organism which possesses both pathways has been found. Unlike E. coli which only possesses single biosynthetic route for lysine, C glutamicum possesses two parallel biosynthetic pathways for the amino acid. The biosynthetic pathway for methionine in C. glutamicum is analogous to that of lysine in that aspect.
The gene metZ is located in the upstream region of metA, which is the gene encoding the enzyme catalysing the first step of methionine biosynthesis (Park, S.-D., et al. ( 1998) Mol. Cells 8, 286-294). Regions upstream and downstream of metA
were sequenced to identify other met genes. It appears that metZ and metA form an operon.
Expression of the genes encoding MetA and MetZ leads to overproduction of the corresponding polypeptides.
Surprisingly, metZ clones can complement methionine auxotrophic Escherichia coli metB mutant strains. This shows that the protein product of metZ
catalyzes a step that can bypass the step catalyzed by the protein product of metB.
MetZ was also disrupted and the mutant strain showed methionine prototrophy.
Corynebacterium glutamicum metB and metZdouble mutants were also constructed.
The double mutant is auxotrophic for methionine. Thus, metZ encodes a protein catalysing the reaction from O-Acetyl-Homoserine to Homocysteine, which is one step in the sulfhydrylation pathway of methionine biosynthesis. Corynebacterium glutamicum contains both the transsulfuration and the sulfhydrylation pathway of methionine biosynthesis.
Introduction of metZ into C. glutamicum resulted in the expression of a 47,000 Dalton protein. Combined introduction of metZ and metA in C. glutamicum resulted in the appearance of metA and metZ proteins as shown by gel electrophoresis. If the Corynebacterium strain is a lysine overproducer, introduction of a plasmid containing metZ and metA resulted in a lower lysine titer but accumulation of homocysteine and methionine is detected.

In another embodiment metZ and metA were introduced into Corynebacterium glutamicum strains together with the hom gene, encoding the homoserine dehydrogenase, catalysing the conversion from aspartate semialdehyde to homoserine. Different hom genes from different organisms were chosen for this experiment. The Corynebacterium glutamicum hom gene can be used as well as hom genes from other procaryotes like Escherichia coli or Bacillus subtilis or the hom gene of eukaryotes such as Saccharomyces cerevisiae, Shizosaccharomyces pombe, Ashbya gossypii or algae, higher plants or animals. It may be that the hom gene is insensitive against feed back inhibition mediated by any metabolites that occur in the biosynthetic routes of the amino acids of the aspartate family, like aspatrate, lysine, threonine or methionine. Such metabolites are for example aspartate, lysine, methionine, threonine, aspartyl-phosphate, aspartate semialdehyd, homoserine, cystathionine, homocysteine or any other metabolite that occurs in this biosynthetic routes. In addition to the metabolites, the homoserine dehydrogenase may be insensitive against inhibition by analogues of all those metabolites or even against other compounds involved in this metabolism as there are other amino acids like cysteine or cofactors like vitamin B 12 and all of its derivatives and S-adenosylmethionine and its metabolites and derivatives and analogues. The insensitivity of the homoserine dehydrogenase against all these, a part of these or only one of these compounds may either be its natural attitude or it may be the result from one or more mutations that resulted from classical mutation and selection using chemicals or irradiation or other mutagens. The mutations could also be introduced into the hom gene using gene technology, for example the introduction of site specific point mutations or by any method aforementioned for the MP or MP encoding DNA-sequences.
When a hom gene was combined with the metZ and metA genes and introduced into a Corynebacterium glutamicum strain that is a lysine overproducer, lysine accumulation was reduced and homocysteine and methionine accumulation was enhanced.
A further enhancement of homocysteine and methionine concentrations can be achieved, if a lysine overproducing Corynebacterium glutamicum strain is used and a disruption of the ddh gene or the IysA gene was introduced prior to the transformation with DNA
containing a hom gene and metZ and metA in combination. The overproduction of homocysteine and methionine was possible using different sulfur sources.
Sulfates, thiosulfates, sulfites and also more reduced sulfur sources like H2S and sulfides and derivatives could be used. Also, organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like cysteine and other sulfur containing compounds can be used to achieve homocysteine and methionine overproduction.
In another embodiment, the metC gene was introduced into a Corynebacterium glufanucum strain using aforementioned methods. The metC gene can be transformed into the strain in combination with other genes like metB, metA and metA. The hom gene can also be added. When the hom gene, the met C, metA and metB genes were combined on a vector and introduced into a Co~ynebacterium glutamicum strain, homocysteine and methionine overproduction was achieved. 'The overproduction of homocysteine and methionine was possible using different sulfur sources. Sulfates, thiosulfates, sulfites and also more reduced sulfi~r sources like H2S and sulfides and derivatives could be used.
Also, organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like~cysteine and other sulfur containing compounds can be used to achieve homocysteine and methionine overproduction.
' This invention is further illustrated by the following examples which should not be construed as limiting.

WO 01/66573 PCTlB00/02035 Exemplification Example 1: Preparation of total genomic DNA of Corynebacteriu»: glutamicum A culture of Corynebacterium glutamicum (ATCC 13032) was grown overnight at 30°C with vigorous shaking in BHI medium (Difco). The cells were harvested by centrifugation, the supernatant was discarded and the cells were resuspended in 5 ml buffer-I (S% of the original volume of the culture - all indicated volumes have been calculated for 100 ml of culture volume). Composition of buffer-I: 140.34 g/1 sucrose, 2.46 g/1 MgSO, x 7H20, 10 m1/1 KHZPO, solution (100 g/1, adjusted to pH 6.?
with KOH), 50 mill M12 concentrate (10 g/1 (NH4)ZSO,,1 g/1 NaCI, 2 g/1 MgS04 x 7H20, 0_2 g/1 CaCl2, 0.5 gll yeast extract (Difco), 10 m1/1 trace-elements-mix (200 mg/1 FeSO, x HxO,10 mg/1 ZnSO, x 7 H20, 3 mg/1 MnCl2 x 4 HZO, 30 mg/1 H,BO, 20 mg/1 CoClz x 6 HZO, 1 mg/1 NiCIZ x 6 H20, 3 mg/1 Na~MoO, x 2 HZO, 500 mg/1 complexing agent (EDTA or critic acid), 100 m1/1 vitamins-mix (0.2 mg/1 biotin, 0.2 mg/1 folic acid, 20 mg/1 p-amino benzoic acid, 20 mg/1 riboflavin, 40 mg/1 ca-panthothenate, 140 mg/I
nicotinic acid, 40 mgll pyridoxole hydrochloride, 200 mg/1 myo-inositol).
Lysozyme was added to the suspension to a final concentration of 2.5 mg/ml. After an approximately 4 h incubation at 37°C, the cell wall was degraded and the resulting protoplasts are harvested by centrifugation. The pellet was washed once with S
ml buffer-I and once with 5 ml TE-buffer ( 10 mM Tris-HCI,1 mM EDTA, pH 8). The pellet was resuspended in 4 ml TE-buffer and 0.5 ml SDS solution (10%) and 0.5 ml NaCI solution (5 M) are added. After adding of proteinase K to a final concentration of 200 ~,g/ml, the suspension is incubated for ca.l8 h at 37°C. The DNA
was purified by extraction with phenol, phenol-chloroform-isoamylalcohol and chloroform-isoamylalcohol using standard procedures. Then, the DNA was precipitated by adding 1/50 volume of 3 M sodium acetate and 2 volumes of ethanol, followed by a 30 min incubation at -20°C and a 30 min centrifugation at 12,000 rpm in a high speed centrifuge using a SS34 rotor (Sorvall). The DNA was dissolved in 1 ml TE-buffer containing 20 p,g/ml lZNaseA and dialysed at 4°C against 1000 ml TE-buffer fox at least 3 hours.

During this time, the buffer was exchanged 3 times. To aliquots of 0.4 ml of the dialysed DNA solution, 0.4 ml of 2 M LiCI and 0.8 ml of ethanol are added.
After a 30 min incubation at -20°C, the DNA was collected by centrifugation (13,000 rpm, Biofuge Fresco, Heraeus, Hanau, Germany). The DNA pellet was dissolved in TE-buffer.
DNA
prepared by this procedure could be used for all purposes, including southern blotting or construction of genomic libraries.
Example Z: Construction of genomic libraries in Escfierichia coli of Corynebacterium glutamicum ATCC13032.
Using DNA prepared as described in Example 1, cosmid and plasmid libraries were constructed according to known and well established methods (see e.g., Sambrook, J. et al.
(1989) "Molecular Cloning : A Laboratory Manual", Cold Spring Harbor Laboratory Press, or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John Wiley &
Sons.) ' ' Any plasmid or cosmid could be used. Of particular use were the plasmids pBR322 (Sutcliffe, J.G. (1979) Proc. Natl. Acacl Sci. SSA, 75:3737-3741); pACYC177 (Change &
Cohen (1978) J. Bacteriol 134:1141-1156), plasmids of the pBS series (pBSSK+, pBSSK- a others; Stratagene, LaJolla, USA), or cosmids as SuperCosl (Stratagene, LaJolla, USA) or Lorist6 (Gibson, T.J., Rosenthal A. and Waterson, R.H. (1987) Gene 53:283-286.
Gene libr~
specifically for use in C. glutamicum may be constructed using plasmid pSLl09 (Lee, H.-S.
A. J. Sinskey (1994) J. Microbiol. Biotechnol. 4: 256-263).
For the isolation of metC clones, E. coli JE6839 cells were transformed with the library DNA and plated onto the M9 minimal medium containing ampicillin and appropriate supplements. The plates were incubated at 37°C for 5 days.
Colonies were isolated and screened for the plasmid content. The complete nucleotide sequence of the isolated metC gene was determined by methods well-known to one of ordinary skill in the art.
Example 3: DNA Sequencing and Computational Functional Analysis Genomic libraries as described in Example 2 were used for DNA sequencing according to standard methods, in particular by the chain termination method using ABI377 sequencing machines (see e.g., Fleischman, R.D. et al. (1995) "Whole-genome Random Sequencing and Assembly of Haemophilus Influenzae Rd., Science, 269:496-512). Sequencing primers with the following nucleotide sequences were used: 5'-GGAAACAGTATGACCATG-3' (SEQ ID N0:123) or 5'-GTAAAACGACGGCCAGT-3'(SEQ ID N0.:124).
Example 4: In vivo Mntagenesis In vivo mutagenesis of Corynebacterium glutamicum can be performed by passage o plasmid (or other vector) DNA through E. coli or other microorganisms (e.g.
Bacillus spp. o yeasts such as Saccharomyces cerevisiae) which are impaired in their capabilities to maintai the integrity of their genetic information. Typical mutator strains have mutations in the gent for the DNA repair system (e.g., mutHLS, mutD, mutT, etc.; for reference, see Rupp, W.D.
(1996) DNA repair mechanisms, in: Escherichia coli and Salmonella, p. 2277-2294, ASM:
Washington.) Such strains are well known to those of ordinary skill in the art. The use of s~
strains is illustrated, for example, in Greener, A. and Callahan, M. (1994) Strategies 7: 32-3' Example S: DNA Transfer Between Escherichia coli and Corynebacterium glutamicum Several Corynebacterium and Brevibacterium species contain endogenous plasmids (as e.g., pHMI S 19 or pBLl) which replicate autonomously (for review see, e.g., Martin, J.F. et al. (1987) Biotechnology, 5:137-146). Shuttle vectors for Escherichia coli and Corynebacterium glutamicum can be readily constructed by using standard vectors for E. coli (Sambrook, J. et al. (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John Wiley & Sons) to which a origin or replication for and a suitable marker from Corynebacterium glutamicum is added. Such origins of replication are preferably taken from endogenous plasmids isolated from Corynebacterium and Brevibacterium species. Of particular use as transformation markers for these species are genes for kanamycin resistance (such as those derived from the Tn5 or Tn903 transposons) or chloramphenicol (Winnacker, E.L. (1987) "From Genes to Clones Introduction to Gene Technology, VCH, Weinheim). There are numerous examples in the literature of the construction of a wide variety of shuttle vectors which replicate in both E.
coli and C glutamicum, and which can be used for several purposes, including gene over-expression (for reference, see e.g., Yoshihama, M. et al. (1985) J. Bacteriol.
162:591-597, WO 01/66573 PCT/IB00l02035 Martin J.F. et al. (1987) Biotechnology, 5:137-146 and Eikmanns, B.J. et al.
(1991) Gene, 102:93-98).
Using standard methods, it is possible to clone a gene of interest into one of the shuttle vectors described above and to introduce such a hybrid vectors into strains of Corynebacterium glutamicum. Transformation of C, glutamicum can be achieved by protoplast transformation (Kastsumata, R. et al. (1984) J. Bacteriol. 159306-311), electroporation (Liebl, E. et al. (1989) FEMS Microbiol. Letters, 53:399-303) and in cases where special vectors are used, also by conjugation (as described e.g: in Schafer, A et al.
(1990) J. Bacteriol. 1?2:1663-1666). It is also possible to transfer the shuttle vectors for C. glutamicum to E. coli by preparing plasmid DNA from C. glutamicum (using standard methods well-known in the art) and transforming it into E. coli. This transformation step can be performed using standard methods, but it is advantageous to use an Mcr-deficient E. coli strain, such as NM522 (Gough & Murray (1983) J. Mol. Biol. 166:1-19).
Genes may be overexpressed in G glutamicum strains using plasmids which comprise pCGI (U.S. Patent No. 4,617,267) or fragments thereof, and optionally the gene for kanamycin resistance from TN903 (Grindley, N.D. and Joyce, C.M.
(1980) Proc. Natl. Acad. Sci. USA 7.7(12): 7176-7180). In addition, genes may be overexpressed in C. glutamicum strains using plasmid pSL109 (Lee, H.-S. and A.
J.
Sinskey (1994)J. Microbiol. Biotechnol. 4: 256-263).
Aside from the use of replicative plasmids, gene overexpression can also be achieved by integration into the genome. Genomic integration in C. glutamicum or other Corynebacterium or Brevibacterium species may be accomplished by well-known methods, such as homologous recombination with genomic region(s), restriction endonuclease mediated integration (REMI) (see, e.g., DE Patent 19823834), or through the use of transposons. It is also possible to modulate the activity of a gene of interest by modifying the regulatory regions (e.g:, a promoter, a repressor, and/or an enhancer) by sequence modification, insertion, or deletion using site-directed methods (such as homologous recombination) or methods based on random events (such as transposon mutagenesis or REMI). Nucleic acid sequences which function as transcriptional terminators may also be inserted 3' to the coding region of one or more genes of the invention; such terminators are well-known in the art and are described, for example, in Winnacker, E.L. (198?) From Genes to Clones-Introduction to Gene Technology.
VCH:
Weinheim.

Example 6: Assessment of the Expression of the Mutant Protein Observations of the activity of a mutated protein in a transformed host cell rely on the fact that the mutant protein is expressed in a similar fashion and in a similar quantity to that of the wild-type protein. A useful method to ascertain the level of transcription of the mutant gene (an indicator of the amount of mRNA available for translation to the gene product) is to perform a Northern blot (for reference see, for example, Ausubel et al.
(1988) Current Protocols in Molecular Biology, Wiley: New York), in which a primer designed to bind to the gene of interest is labeled with a detectable tag (usually radioactive or chemiluminescent), such that when the total RNA of a culture of the organism is extracted, run on gel, transferred to a stable matrix and incubated with this probe, the binding and quantity of binding of the probe indicates the presence and also the quantity of mRNA for this gene. This information is evidence of the degree of transcription of the mutant gene. Total cellular RNA can be prepared from Corynebacterium glutamicum by several methods, all well-known in the art, such as that described in Bormann, E.R. et al.
(1992) Mol. Microbiol. 6: 317-326.
To assess the presence or relative quantity of protein translated from this mRNA, standard techniques, such as SDS-acrylamide gel electrophoresis, were employed. The overproduction of metC and metZ in combination with metA in Corynebacterium glutamicum was demonstrated by this method. Western blot may also be employed (see, for example, Ausubel et al. (1988) Current Protocols in Molecular Biology, Wiley: New York). In this process, total cellular proteins are extracted, separated by gel electrophoresis, transferred to a matrix such as nitrocellulose, and incubated with a probe, such as an antibody, which specifically binds to the desired protein. This probe is generally tagged with a chemiluminescent or colorimetric label which may be readily detected. The presence and quantity of label observed indicates the presence and quantity of the desired mutant protein present in the cell.
Example 7: Growth of Escherichia coli and Genetically Modified Corynebacterium glutamicum - Media and Culture Conditions E. coli strains are routinely grown in MB and LB broth, respectively (Follettie, M.
T., et al. (1993) J. Bacteriol. 175, 4096-4103). Minimal media for E. coli is M9 and modified MCGC (Yoshihama, M., et al. (1985) J. Bacteriol.162, 591-507).
Glucose was added to a final concentration of 1 %. Antibiotics were added in the following amounts (micrograms per milliliter): ampicillin, 50; kanamycin, 25; nalidixic acid, 25. Amino acids, vitamins, and other supplements were added in the following amounts:
methionine, 9.3 mM; arginine, 9.3 mM; histidine, 9.3 mM; thiamine, 0.05 mM. E. coli cells were routinely grown at 37°C, respectively.
Genetically modified Corynebacteria are cultured in synthetic or natural growth media. A number of different growth media for Corynebacteria are both well-known and readily available (Lieb et al. (1989) Appl. Microbiol. Biotechnol., 32:205-210; von der Osten et al. (1998) Biotechnology Letters, 11:11-16; Patent DE 4,120,867;
Liebl (1992) "The Genus Corynebacterium, in: The Procaryotes, Volume II, Balows, A. et al., eds.
Springer-Verlag). These media consist of one or more carbon sources, nitrogen sources, inorganic salts, vitamins and trace elements. Preferred carbon sources are sugars, such as mono-, di-, or polysaccharides. For example, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffmose, starch or cellulose serve as very good carbon sources. It is also possible to supply sugar to the media via complex compounds such as molasses or other by-products from sugar refinement. It can also be advantageous to supply mixtures of different carbon sources. Other possible carbon sources are alcohols and organic acids, such as methanol, ethanol, acetic acid or lactic acid. Nitrogen sources are usually organic or inorganic nitrogen compounds, or materials which contain these compounds. Exemplary nitrogen sources include ammonia gas or ammonia salts, such as NIi4Cl or (NH4),504, NH~OH, nitrates, urea, amino acids or complex nitrogen sources like corn steep liquor, soy bean flour, soy bean protein, yeast extract, meat extract and others.
The overproduction of sulfur containing amino acids like homvcysteine and methionine was made possible using different sulfur sources. Sulfates, thiosulfates, sulfites and also more reduced sulfur sources like H2S and sulfides and derivatives can be used. Also, organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, thiourea, sulfur containing amino acids like cysteine and other sulfur containing compounds can be used to achieve homocysteine and methionine overproduction Inorganic salt compounds which may be included in the media include the chloride-, phosphorous- or sulfate- salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. Chelating compounds can be added to the medium to keep the metal ions in solution. Particularly useful chelating compounds include dihydroxyphenols, like catechol or protocatechuate, or organic acids, such as citric acid. It is typical for the media to also contain other growth factors, such as vitamins or growth promoters, examples of which include biotin, riboflavin, thiamin, folic acid, nicotinic acid, pantothenate and pyridoxin. Growth factors and salts frequently originate from complex media components such as yeast extract, molasses, corn steep liquor and others. The exact composition of the media compounds depends strongly on the immediate experiment and is individually decided for each specific case.
Information about media optimization is available in the textbook "Applied Microbiol.
Physiology, A
Practical Approach (eds. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). It is also possible to select growth media from commercial suppliers, like standard 1 (Merck) or BHI (grain heart infusion, DIFCO) or others.
All medium components are sterilized, either by heat (20 minutes at 1.5 bar and 121 °C) or by sterile filtration. The components can either be sterilized together or, if necessary, separately. All media components can be present at the beginning of growth, 1 S or they can optionally be added continuously or batchwise.
Culture conditions are defined separately for each experiment. The temperature should be in a range between 15°C and 45°C. The temperature can be kept constant or can be altered during the experiment. The pH of the medium should be in the range of 5 to 8.5, preferably around 7.0, and can be maintained by the addition of buffers to the media.
An exemplary buffer for this purpose is a potassium phosphate buffer.
Synthetic buffers such as MOPS, HEPES, ACES and others can alternatively or simultaneously be used. It is also possible to maintain a constant culture pH through the addition of NaOH or NII40H during growth. If complex medium components such as yeast extract are utilized, the necessity for additional buffers may be reduced, due to the fact that many complex compounds have high buffer capacities. If a fermentor is utilized for culturing the micro-organisms, the pH can also be controlled using gaseous ammonia.
The incubation time is usually in a range from several hours to several days.
This time is selected in order to permit the maximal amount of product to accumulate in the broth. The disclosed growth experiments can be carried out in a variety of vessels, such as microtiter plates, glass tubes, glass flasks or glass or metal fermentors of different sizes.
For screening a large number of clones, the microorganisms should be cultured in microtiter plates, glass tubes or shake flasks, either with or without baffles. Preferably 100 ml shake flasks are used, filled with 10% (by volume) of the required growth medium. The flasks should be shaken on a rotary shaker (amplitude 25 mm) using a speed-range of 100 - 300 rpm. Evaporation losses can be diminished by the maintenance of a humid atmosphere; alternatively, a mathematical correction for evaporation losses should be performed.
If genetically modified clones are tested, an unmodified control clone or a control clone containing the basic plasmid without any insert should also be tested.
The medium is inoculated to an OD6~ of O.5 -1.5 using cells grown on agar plates, such as CM plates (10 g/1 glucose, 2,5 g/1 NaCI, 2 g/1 urea, 10 g/1 polypeptone, 5 g/1 yeast extract, 5 g/1 meat extract, 22 g/1 NaCI, 2 g/1 urea, 10 g/1 polypeptone, 5 g/1 yeast extract, 5 g/1 meat extract, 22 g/1 agar, pH 6.8 with 2M NaOH) that had been incubated at 30°C.
Inoculation of the media is accomplished by either introduction of a saline suspension of C.
glutamicum cells from CM plates or addition of a liquid preculture of this bacterium.
Example 8 -Ih vitro Analysis of the Function of Mutant Proteins The determination of activities and kinetic parameters of enzymes is well established in the art. Experiments to determine the activity of any given altered enzyme must be tailored to the specific activity of the wild-type enzyme, which is well within the ability of one of ordinary skill in the art. Overviews about enzymes in general, as well as specific details concerning structure, kinetics, principles, methods, applications and examples for the determination of many enzyme activities may be found, for example, in the following references: Dixon, M., and Webb, E.C., (1979) Enzymes. Longmans: London; Fersht, (1985) Enzyme Structure and Mechanism.
Freeman: New York; Walsh, (1979) Enzymatic Reaction Mechanisms. Freeman: San Francisco; Price, N.C., Stevens, L. (1982) Fundamentals of Enzymology. Oxford Univ.
Press: Oxford; Boyer, P.D., ed. (1983) The Enzymes, 3'd ed. Academic Press:
New York; Bisswanger, H., (1994) Enzymkinetik, 2"d ed. VCH: Weinheim (ISBN
3527300325); Bergmeyer, H.U., Bergmeyer, J., Graf3l, M., eds. (1983-1986) Methods of Enzymatic Analysis, 3'~ ed., vol. I-XII, Verlag Chemie: Weinheim; and Ullmann's Encyclopedia of Industrial Chemistry (1987) vol. A9, "Enzymes". VCH: Weinheim, p.
352-363.
Cell extracts from Corynebacterium glutamicum were prepared as described previously (Park, S.-D., et al. (1998) Mol. Cells 8, 286-294). Cystathionine (3-lyase was assayed as follows. The assay mixture contained 100 mM Tris-HCl (pH8.5), 0.1 mM

NADH, 1 mM L-cystathionine, 5 units of L-lactate dehydrogenase, and appropriate amounts of crude extract. Optical changes were monitored at 340 nm. Assay for S (~-aminoethyl)-cysteine (AEC) resistance was carried out as described in Rossol, I. and Puhler, A. (1992) ,I. Bacteriol. 174, 2968-77. The results of cystathionin (3-lyase assays from extracts of different Corynebacterium glutamicum strains as well as results of AEC resistance assays of the same strain are summarized in Table 5, below.

Table 5. Expression of cystathionine ø-lyase a Activity Growth Strains Properties' on ' Resistance b (nmol min' MM to AEC
mg ) C. glutamicum AS019E12- 146 + +

C. glutamicum AS019E12/pMTlEmpty 145 + +
vector C. glutamicmn AS019E121pSL173metC clone797 + ++

C. glutamicum I-ILfl57tnetC 19 + -mutant C. glutamicum HL459 metC mutants23 + -E. coli JE6839 metC mutant21 - ND a S ' The enryme was induced by growth to the stationary phase on the minimal medium containing 1%
glucose. Cells were harvested, disrupted, and assayed for the activity as described in the Materials and Methods.
6 MCGC minimal media was used. Growth was monitored on plates.
' Cells were grown on plates containing 40 mM S-(ø-aminoethyl)-cysteine (AEC) for 5 days.
d The mutants were generated in this study.
'Not determined The ability of the metC clones to express cystathionine ø-lyase was tested by enzymatic assay. Crude extracts prepared from the C. glutamicum AS019E12 cells harboring plasmid pSL173 were assayed. Cells harboring the plasmid showed approximately a 5-fold increase in the activity of cystathionine ø-lyase compared to those harboring the empty vector pMTI (Table 5), apparently due to the gene-dose effect. SDS-PAGE analysis of crude extracts revealed a putative cystathionine ø-lyase band with approximate Mr of 41,000. Intensity of each putative cystathionine ø-lyase band agreed with the complementation and enzymatic assay data (Table 5). As described above, a region of metC appeared to be nearly identical to the previously reported aecD.
Since the aecD gene was isolated on the basis of its ability to confer resistance to S (ø-aminoethyl)-cysteine (AEC), a toxic lysine analogue, we tested the protein product of metC for the presence of the activity. As shown in Table 5, cells overexpressing cystathionine ø-lyase showed increased resistance to AEC. The strain carrying a mutation in metC gene (see below) completely lost its ability to show a resistant phenotype to AEC.
Assay for O-acetylhmoserine sulphydrylase was performed as follows (Belfaiza, J., et al. (1998) J. Bacteriol. 180, 250-255; Ravanel, S., M. Droux, and R. Douce (1995) Arch Biochem. Biophys. 316, 572-584; Foglino, M. (1995) Microbiology 141, 431-439).
Assay mixhue of 0.1 ml contained 20 mM MOPS-NaOH (pH7.5),10 mM O

acetylhomoserine, 2 mM Na2S in 50 mM NaOH, and an appropriate amount of enzyme.
Immediately after the addition of Na2S which was added last, the reaction mixture was overlayed with 50 u1 of mineral oil. After 30 minute incubation at 30°C, the reaction was stopped by boiling the mixture for 3 minutes. Homocysteine produced in the reaction was quantified as previously described (Yamagata, S. (1987) Method Enzymol.
143, 478-483.). Reaction mixture of 0.1 ml was taken and mixed with 0.1 ml of H20, 0.6 ml of saturated NaCI, 0.1 ml of 1.5 M NaZC03 containing 67 mM KCN, and 0.1 ml of 2% nitroprusside. After 1 minute incubation at room temperature, optical density was measured at 520 nm. Corynebacterium cells harboring additional copies of the metZ
gene, e.g., a plasmid containing the metZ gene, exhibited significantly higher metZ
enzyme activities than the same type of Corynebacterium cells without additional copies of the metZ gene.
The activity of proteins which bind to DNA can be measured by several well-established methods, such as DNA band-shift assays (also called gel retardation assays).
The effect of such proteins on the expression of other molecules can be measured using reporter gene assays (such as that described in Kolmar, H. et al. (1995) EMBO
J. 14:
3895-3904 and references cited therein). Reporter gene test systems are well known and established for applications in both pro- and eukaryotic cells, using enzymes such as beta-galactosidase, green fluorescent protein, and several others.
The determination of activity of membrane-transport proteins can be performed according to techniques such as those described in Gennis, R.B. (1989) "Pores, Channels and Transporters", in Biomembranes, Molecular Structure and Function, Springer: Heidelberg, p. 85-137; 199-234; and 270-322.
Example 9: Analysis of Impact of Mutant Protein on the Production of the Desired Product The effect of the genetic modification in C. glutamicum on production of a desired compound (such as an amino acid) can be assessed by growing the modified microorganism under suitable conditions (such as those described above) and analyzing the medium and/or the cellular component for increased production of the desired product (i.e., an amino acid). Such analysis techniques are well known to one of ordinary skill in the art, and include spectroscopy, thin layer chromatography, staining methods of various kinds, enzymatic and microbiological methods, and analytical chromatography such as high performance liquid chromatography (see, for example, Ullman, Encyclopedia of Industrial Chemistry, vol. A2, p. 89-90 and p. 443-613, VCH:
Weinheirn (1985); Fallon, A. et al., (1987) "Applications of HPLC in Biochemistry" in:
Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17; Rehm et al.
(1993) Biotechnology, vol. 3, Chapter III: "Product recovery and purification", page 469-714, VCH: Weinheim; Better, P.A. et al. (1988) Bioseparations: downstream processing for biotechnology, John Wiley and Sons; Kennedy, J.F. and Cabral, J.M.S.
(1992) Recovery processes for biological materials, John Wiley and Sons;
Shaeiwitz, J.A. and Henry, J.D. (1988) Biochemical separations, in: Ulmann's Encyclopedia of Industrial Chemistry, vol. B3, Chapter 11, page 1-27, VCH: Weinheim; and Dechow, F.J. (1989) Separation and purification techniques in biotechnology, Noyes Publications.) In addition to the measurement of the final product of fermentation, it is also possible to analyze other components of the metabolic pathways utilized for the production of the desired compound, such as intermediates and side-products,'to determine the overall efficiency of production of the compound. Analysis methods include measurements of nutrient levels in the medium (e.g., sugars, hydrocarbons, nitrogen sources, phosphate, and other ions), measurements of biomass composition and growth, analysis of the production of common metabolites of biosynthetic pathways, and measurement of gasses produced during fermentation. Standard methods for these measurements are outlined in Applied Microbial Physiology, A Practical Approach, P.M. Rhodes and P.F. Stanbury, eds., IRL Press, p. 103-129; 131-163; and 165-(ISBN: 0199635773) and references cited therein.
Example 10: Purification of the Desired Product from C. glutamicum Culture Recovery of the desired product from the C. glutamicum cells or supernatant of the above-described culture can be performed by various methods well known in the art.
If the desired product is not secreted from the cells, the cells can be harvested from the culture by low-speed centrifugation, the cells can be lysed by standard techniques, such as mechanical force or sonication. The cellular debris is removed by centrifugation, and the supernatant fraction containing the soluble proteins is retained for further purification of the desired compound. If the product is secreted from the C.
glutamicum cells, then the cells are removed from the culture by low-speed centrifugation, and the supernate fraction is retained for further purification.
The supernatant fraction from either purification method is subjected to chromatography with a-suitable resin, in which the desired molecule is either retained on a chromatography resin while many of the impurities in the sample are not, or where the impurities are retained by the resin while the sample is not. Such chromatography steps may be repeated as necessary, using the same or different chromatography resins. One of ordinary skill in the art would be well-versed in the selection of appropriate chromatography resins and in their most efficacious application for a particular molecule to be purified. The purified product may be concentrated by filtration or ultrafiltration, and stored at a temperature at which the stability of the product is maximized.
There are a wide array of purification methods known to the art and the preceding method of purification is not meant to be limiting. Such purification techniques are described, for example, in Bailey, J.E. & Ollis, D.F.
Biochemical Engineering Fundamentals, McGraw-Hill: New York (1986).
The identity and purity of the isolated compounds may be assessed by techniques standard in the art. These include high-performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin layer chromatography, NIRS, enzymatic assay, or microbiologically. Such analysis methods are reviewed in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11: 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry, (1996) vol. A27, VCH: Weinheim, p. 89-90, p. 521-540, p. 540-547, p. 559-566, 575-581 and p. 581-587; Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A.
et al.
(1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17.
Example 11: Analysis of the Gene Sequences of the Invention The comparison of sequences and determination of percent homology between two sequences are art-known techniques, and can be accomplished using a mathematical algorithm, such as the algorithm of Karlin and Altschul (1990) Proc. Natl.
Acad. Sci.
USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad.
Sci. USA
90:5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST

programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
BLAST
nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to MP nucleic acid molecules of the invention. BLAST protein searches can be performed with the S XBLAST program, score = S0, wordlength = 3 to obtain amino acid sequences homologous to MP protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, one of ordinary skill in the art will know how to optimize the parameters of the program (e.g., XBLAST and NBLAST) for the specific sequence being analyzed.
Another example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Meyers and Miller ((1988) Comput. Appl. Biosci.
4: 11-17). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is 1 S part of the GCG sequence alignment software package. When utilizing the ALIGN
program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Additional algorithms for sequence analysis are known in the art, and include ADVANCE and ADAM.
described in Torelli and Robotti (1994) Comput. Appl. Biosci. 10:3-S; and FASTA, described in Pearson and Lipman (1988) P.N.A.S. 85:2444-8.
The percent homology between two amino acid sequences can also be accomplished using the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 12, 10, 8, 6, or 4 and a length weight of 2, 3, or 4. The percent homology between two nucleic acid sequences can be accomplished using the GAP program in the GCG software package, using standard parameters, such as a gap weight of 50 and a length weight of 3.
A comparative analysis of the gene sequences of the invention with those present in Genbank has been performed using techniques known in the art (see, e.g., Bexevanis and Ouellette, eds. (1998) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins. John Wiley and Sons: New York). The gene sequences of the invention were compared to genes present in Genbank in a three-step process. In a first step, a BLASTN analysis (e.g., a local alignment analysis) was performed for each of the sequences of the invention against the nucleotide sequences present in Genbank, and the top 500 hits were retained for further analysis. A subsequent FASTA search (e.g., a combined local and global alignment analysis, in which limited regions of the sequences are aligned) was performed on these 500 hits. Each gene sequence of the invention was S subsequently globally aligned to each of the top three FASTA hits, using the GAP
program in the GCG software package (using standard parameters). In order to obtain correct results, the length of the sequences extracted from Genbank were adjusted to the length of the query sequences by methods well-known in the art. The results of this analysis are set forth in Table 4. The resulting data is identical to that which would have been obtained had a GAP (global) analysis alone been performed on each of the genes of the invention in comparison with each of the references in Genbank, but required significantly reduced computational time as compared to such a database-wide GAP
(global) analysis. Sequences of the invention for which no alignments above the cutoff values were obtained are indicated on Table 4 by the absence of alignment information.
It will further be understood by one of ordinary skill in the art that the GAP
alignment homology percentages set forth in Table 4 under the heading "% homology (GAP)"
are listed in the European numerical format, wherein a ',' represents a decimal point. For example, a value of "40,345" in this column represents "40.345%".
Example 12: Construction and Operation of DNA Microarrays The sequences of the invention may additionally be used in the construction and .
application of DNA microarrays (the design, methodology, and uses of DNA
arrays are well known in the art, and are described, for example, in Schena, M. et al.
(1995) Science 270: 467-470; Wodicka, L. et al. (1997) Nature Biotechnology 15: 1359-1367;
DeSaizieu, A. et al. (1998) Nature Biotechnology 16: 45-48; and DeRisi, J.L.
et al.
(1997) Science 278: 680-686).
DNA microarrays are solid or flexible supports consisting of nitrocellulose, nylon, glass, silicone, or other materials. Nucleic acid molecules may be attached to the surface in an ordered manner. After appropriate labeling, other nucleic acids or nucleic acid mixtures can be hybridized to the immobilized nucleic acid molecules, and the label may be used to monitor and measure the individual signal intensities of the hybridized molecules at defined regions. This methodology allows the simultaneous quantification of the relative or absolute amount of all or selected nucleic acids in the applied nucleic acid sample or mixture. DNA microarrays, therefore, permit an analysis of the expression of multiple (as many as 6800 or more) nucleic acids in parallel (see, e.g., Schena, M. (1996) BioEssays 18(5): 427-431).
The sequences of the invention may be used to design oligonucleotide primers which are able to amplify defined regions of one or more C. glutamicum genes by a nucleic acid amplification reaction such as the polymerise chain reaction. The choice and design of the 5' or 3' oligonucleotide primers or of appropriate linkers allows the covalent attachment of the resulting PCR products to the surface of a support medium described above (and also described, for example, Schena, M. et al. (1995) Science 270:
467-470).
Nucleic acid microarrays may also be constructed by in situ oligonucleotide synthesis as described by Wodicka, L. et al. (1997) Nature Biotechnology 15:

1367. By photolithographic methods, precisely defined regions of the matrix are exposed to light. Protective groups which are photolabile are thereby activated and 1 S undergo nucleotide addition, whereas regions that are masked from light do not undergo any modification. Subsequent cycles of protection and light activation permit the synthesis of different oligonucleotides at defined positions. Small, defined regions of the genes of the invention may be synthesized on microarrays by solid phase oligonucleotide synthesis.
The nucleic acid molecules of the invention present in a sample or mixture of nucleotides may be hybridized to the microarrays. These nucleic acid molecules can be labeled according to standard methods. In brief, nucleic acid molecules (e.g., mRNA
molecules or DNA molecules) are labeled by the incorporation of isotopically or fluorescently labeled nucleotides, e.g., during reverse transcription or DNA
synthesis.
Hybridization of labeled nucleic acids to microarrays is described (e.g., in Schena, M. et al. (1995) supra; Wodicka, L. et al. (1997), supra; and DeSaizieu A. et al.
(1998), supra). The detection and quantification of the hybridized molecule are tailored to the specific incorporated label. Radioactive labels can be detected, for example, as described in Schena, M. et al. (1995) supra) and fluorescent labels may be detected, for example, by the method of Shalon et al. (1996) Genome Research 6: 639-645).
The application of the sequences of the invention to DNA microarray technology, as described above, permits comparative analyses of different strains of C.
glutamicum or other Corynebacteria. For example, studies of inter-strain variations based on individual transcript profiles and the identification of genes that are important for specific and/or desired strain properties such as pathogenicity, productivity and stress tolerance are facilitated by nucleic acid array methodologies. Also, comparisons of the profile of expression of genes of the invention during the course of a fermentation i reaction are possible using nucleic acid array technology.
Example Z3: Analysis of the Dynamics of Cellular Protein Populations (Proteomics) The genes, compositions, and methods of the invention may be applied to study the interactions and dynamics of populations of proteins, termed 'proteomics'.
Protein populations of interest include, but are not limited to, the total protein population of C.
glutamicum (e.g., in comparison with the protein populations of other organisms), those proteins which are active under specific environmental or metabolic conditions (e.g., during fermentation, at high or low temperature, or at high or low pH), or those proteins which are active during specific phases of growth and development.
Protein populations can be analyzed by various well-known techniques, such as gel electrophoresis. Cellular proteins may be obtained, for example, by lysis or extraction, and may be separated from one another using a variety of electrophoretic techniques. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separates proteins largely on the basis of their molecular weight. Isoelectric focusing polyacrylamide gel electrophoresis (IEF-PAGE) separates proteins by their isoelectric point (which reflects not only the amine acid sequence but also posttranslational modifications of the protein). Another, more preferred method of protein analysis is the consecutive combination of both IEF-PAGE and SDS-PAGE, known as 2-D-gel electrophoresis (described, for example, in Hermann et al. (1998) Electrophoresis 19:
3217-3221; Fountoulakis et al. (1998) Electrophoresis 19: 1193-1202; Langen et al.
(1997) Elech~ophoresis 18: 1184-1192; Antehnann et al. (1997) Electrophoreses 18:
1451-1463). Other separation techniques may also be utilized for protein separation, such as capillary gel electrophoresis; such techniques are well known in the art.
Proteins separated by these methodologies can be visualized by standard techniques, such as by staining or labeling. Suitable stains are known in the art, and include Coomassie Brilliant Blue, silver stain, or fluorescent dyes such as Sypro Ruby (Molecular Probes). The inclusion of radioactively labeled amino acids or other protein precursors (e.g., 35S-methionine, 35S-cysteine, 14C-labelled amino acids,15N-amino acids, 15N03 or ~SNH4+ or 13C-labelled amino acids) in the medium of C.
glutamicum permits the labeling of proteins from these cells prior to their separation.
Similarly, fluorescent labels may be employed. These labeled proteins can be extracted, isolated and separated according to the previously described techniques.
Proteins visualized by these techniques can be fiu~ther analyzed by measuring the amount of dye or label used. The amount of a given protein can be determined quantitatively using, for example, optical methods and can be compared to the amount of other proteins in the same gel or in other gels. Comparisons of proteins on gels can be made, for example, by optical comparison, by spectroscopy, by image scanning and analysis of gels, or through the use of photographic films and screens. Such techniques are well-known in the art.
To determine the identity of any given protein, direct sequencing or other standard techniques may be employed. For example, N- and/or C-terminal amino acid sequencing (such as Edman degradation) may be used, as may mass spectrometry (in particular MALDI or ESI techniques (see, e.g., Langen et al. (1997) Electrophoresis 18:
1184-1192)). The protein sequences provided herein can be used for the identification of C. glutamicum proteins by these techniques.
The information obtained by these methods can be used to compare patterns of protein presence, activity, or modification between different samples from various biological conditions (e.g., different organisms, time points of fermentation, media conditions, or different biotopes, among others). Data obtained from such experiments alone, or in combination with other techniques, can be used for various applications, such as to compare the behavior of various organisms in a given (e.g., metabolic) situation, to increase the productivity of strains which produce fine chemicals or to increase the efficiency of the production of fine chemicals.
Example 14: Cloning of Genes by Application of the Polymerase Chain Reaction (PCR) Genes can be amplified using specific oligonucleotides comprising either nucleotide sequences homologous to sequences of Corynebacterium glutamicum or other strains as well as recognition sites of restriction enzymes well known in the art (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A

Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Theses oligonucleotides can be used to amplify specific DNA-fragments containing parts of the chromosome of mentioned strains using DNA-polymerises such as T. aquaticus DNA-polymerise, P. furiosus DNA-polymerise, or P. woesei DNA-polymerise and dNTPs nucleotides in an appropriate buffer solution as described by the manufacturer.
Gene fragments such as coding sequences from RXA00657 including appropriate upstream and downstream regions not contained in the coding region of the mentioned gene can be amplified using the aforementioned technologies.
Furthermore, these fragments can be purified from unincorporated oligonucleotides and nucleotides.
DNA restriction enzymes can be used to produce protruding ends that can be used to ligate DNA fragments to vectors digested with complementary enzymes or compatible enzymes producing ends that can be used to ligate the DNA into the vectors mentioned in Sinskey et al., U.S. Patent No. 4,649,119, and techniques for genetic manipulation of C. glutamicum and the related Brevibacterium species (e.g., lactofermentum) (Yoshihama et al, J. Bacteriol. 162: 591-597 (1985); Katsumata et al., J.
Bacteriol. 159:
306-311 (1984); and Santamaria et al., J. Gen. Microbiol. 130: 2237-2246 (1984).
Oligonucleotides used as primers for the amplification of upstream DNA
sequence, the coding region sequence and the downstream region of RXA00657 were as follows:
TCGGGTATCCGCGCTACACTTAGA (SEQ ID N0:121);
GGAAACCGGGGCATCGAAACTTA (SEQ ID N0:122).
Corynebacterium glutamicum chromosoriial DNA with an amount of 200ng was used as a template in a 100p1 reaction volume containing 2,5U Pfu Turbo-PolymeraseTM
(StratageneTM), and 200p.M dNTP-nucleotides The PCR was performed on a PCR-CyclerTM (Perkin Ehner 2400TM) using the following temperature/time protocol:
1 cycle: 94 °C: 2 min.;
20 cycle: 94°C : 1 min.;
52°C: 1 min, 72°C: 1.5 min., I cycle: 72 °C: 5 min.
Primers were removed from the resulting amplified DNA fragment and the resulting fragment was cloned into the blunt EcoRV site of pBS KS
(StratageneTM). The fragment was excised by digestion with the restriction enzymes BamHI/~~hoI and ligated into a BamHI SaII digested vector pB (SEQ ID N0.:125). The resulting vector is called pB RXA00657.
Resulting recombinant vectors can be analyzed using standard techniques described in e.g., Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A
Laboratory Manual. 2nd, ed , Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and can be transferred into C.
glutamicum using aforementioned techniques.
A Corynebacterium strain (ATCC 13286) was treated for a transformation as described. Transformation of C. glutamicum can be achieved by protoplast transformation (Kastsumata, R. et al. (1984) J. Bacteriol. 159306-311), electroporation (Liebl, E. et al.
(1989) FEMSMicrobiol. Letters, 53:399-303) and in cases where special vectors are used, also by conjugation (as described, e.g., in Schafer, A. et al. (1990) J.
Bacteriol. 172:1663-1666). It is also possible to transfer the shuttle vectors for C. glutamicum to E. coli by preparing plasmid DNA from G glutamicum (using standard methods well-known in the art) and transforming it into E. coli. This transformation step can be performed using standard methods, but it is advantageous to use an Mcr-deficient E. coli strain, such as NM522 (Gough & Murray (1983) J. Mol. Biol. 166:1-19).
Transformation of a bacterial strain such as Corynebacterium glutamicum strain (ATCC 13286) was performed with a plasmid pB containing the aforementioned DNA
regions of RXA00657 (SEQ ID N0.:6) and in another case with the vector p8 (SEQ
ID
NO.: ) carrying no additional insertion of nucleic acids.
The resulting strains were plated on and isolated from CM-Medium ( 10 g/1 TM
Glucose 2,5 g/1 NaCI, 2,0 g/1 Urea, 10 g/1 Bacto Peptone (DifcoBecton Dicinson/Sparks USATM), 5 g/1 yeast extract (DifcoBecton Dicinson/Sparks USATM), 5g/1 meat extract (DifcoBecton DicinsonlSparks USAT"~, 22g/1 Agar (DifcoBecton Dickinson/Sparks USAT"~ and I5ltg/ml kanamycin sulfate (Serva, Germany) with a adjusted with NaOH to pH of 6.8.
Strains isolated from the aforementioned agar medium were inoculated in 10 ml in a 100m1 shake flask containing no baffles in liquid medium containing 100 g/1 sucrose 50g/1 (NH4)ZS04, 2,5 g/1 NaCI, 2,0 g/1 Urea,10 g/1 Bacto Peptone (Difco/Becton Dickinson/Sparks USA), 5 g/1 yeast extract (DifcoBecton Dickinson/Sparks USA), 5g/1 meat extract (DifcoBecton Dickinson/Sparks USA), and 25g/1 CaC03 (Riedel de Haen, Germany) . Medium was a adjusted with NaOH to pH
of 6.8. .
Strains were incubated at 30°C for 48h. Supernatants of incubations were prepared by centrifugation 20'at 12,000 rpm in an Eppendorf''M
microcentrifuge. Liquid supernatants were diluted and subjected to amino acid analysis (Standard methods for these measurements are outlined in Applied Microbial Physiology, A Practical _ Approach, P.M. Rhodes and P.F. Stanbury, eds., IRL Press, p. 103-129; 131-163;
and 165-192 (ISBN: 0199635773) and references cited therein).
The results are shown in Table 6, below.
Results: Table 6:
Strain ATCC Plasmid pB pB RXA00657 13286 contained lysin produced 13.5 14.93 Selectivity 0.235 0.25 (mol lysine/

mol consumed Saccharose) Eq uivalents Those of ordinary skill in the art will recognize, or will be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

WO 01!66573 PCT/IB00/02035 m u ~

J

i ~Z TZ ~ Z
- v M
'-U
~ U
v _ j ~ '-Z

~tL Zp cvU V
W

(O J ~ N L1J~ N N
!D ~ llJ C
J IL
Z
~

ZU ~ Q~ ~ ~ ~~ r tn~.-'r~

UU Z ~ gN~ g Z
:J w_ wg ~
wwQ~

~ Q Z , tiJlL
~
Z

Nt >Z . mOp vU ~ - ~~U V
~~
n>Oa _ OZ~ D~N". ~~ V~~m ~ pp !1lLtlZ
~ui W

ww >J' a ~
y~ ZZ U w?. U O
y N
ZZ p ~~ z- ~o- wwN c ?r z= gg~
z~HO o~HC Q

u!N Ol,u Q~ Uz toww z uJotu Xxa-1-~~ I-J QlIJZW Z DD m ~ 1-Z
r ZD Z
v, go Qo >-um o 00 m0 ~-~-oao g oum-m'~zzaQ> _~ ,,,~m' 3~ ~~ aQgaov~
_ c9z ~ , UU
UUZ
uy U u,i>.~[1J[jJ yr u!
_ w aQa V ~a g~ muW--mE-=a~~ H~~
~-~waaz'gZ ~Z JJO o ,0 ,um OoC~~aa Z a m w a.-~
'~

~WZUtu JuJ aa~ Z ao ~_~ ~~~a~?.
'zzzoE- af- Q O
~'~ z_, _,~

-. z w~ _ ., a f- y--a O >- , ~>-a o ~n o~ 'n"~xo x oo ~~~
O o x ogx=a~n~ ~
~

UO.c ~
mwZZ~nan. a ~w oaa'- c~ ~ZZ ~
w~ ~ ~ ~ muo p ~~a a muU_ _U_ m ~ -Q-.~~ Z Yh-h-~JQQ ~
zzJ _~J OauJN m '-aQ~
Ua 00 rOO I11uI0 c a0-~J~~O ZUO c 1-I-!-m ~ '-Q~~~

Z 10L20 ~ QQ"'~.iUUU~ cu'ni00Zu)ZQ
mm0 gQ ~~~ ~ ~ U~==o or.~j UtU11tU11QQ~J
t~LU~I~ pc~i U
=

t y aQaa~~U ~l-U IL a'QN~~QQ N ~~~2, O.U _ QOJJJQ

f~ fn !D O~ cD O~ ~
M c0 M O O ~
O~ a0 O
M h 00 01 ef M -t t E" f0 W "' O D 0 s O M M ' Y (O M N M
V ~ O~ O
u1 ' Z M Z M M V'M - h M
~(7 N V' ~ (fl V' ~ 4 N ! M

a M ~ aD M a00 r O M
V O~ O O n V

N ~OV~'O V~'~(OD V Ot0 ~
O NN~~c~D

Z N Z ~ N ~I7M M tn st M M 00 at 10 c0 V' N
~

M h M N DO ~ N 00 f~ I~ 1~ ~ tn ~ ~0 In N ID f0 t0 00 M tD h M O
M O O M
~ M
M

tD aD (O N M N 1~.
N O O V' O

C O C 000 O p 000 N N
'O 'O

O O
U U

c O~ c N
H. f~ p M N M 47 N M M
O~ N M M ~ r- e!
O In ~ st ~t1 ~
~ O t 0 O ( tC
I~
~
O
O
O
~
N

I ~ M 0 V O 7 ~ O
V ~O t0 V st N W M c0 N In ~ ~ O f~ M
O~ N O p~ cp ~ CO O M N
M OD M CD
t~ aD
N
O

N O O N N O O N ~
N O ~ O O O Oa O ~

~ 000 O 000000 ~ 0000 OOOa000 a ~z O 0O O ~ a V O f0O ~t f0 M N Q f0 N N OD O
O 0D tt N V
N f0 ~
f0 ~~-e-ew- NN C C- NNN MMMM M V' V' V' V V lnM~

>. ~ >. a ~

p a '~ p ~
a r n e-MOl~ 07 C UQ MInI~O.rMIn 1~O MInI~01 ~ N M
~ f O

O ~ a- ~ d N N M M ~ V' Qe- - N M st tt 'Q' - N M ~
~ M 7 N

O U
GPI

.I N J Zln Z

m z ~z z z z ~

J UJ ~
- C
U

t N
-Z J m J V' J J
~
J

z az V >- r U ~ =r =
=
~

~ U W ~ F llJ
0 f- --~ IL J ~ ~ ~LO
J M
N
~

W W W

't z z Z Z ~~~~~~ w ~z w V ~' N ~- w c!
~ N
01OOMOf~

Z ~ZZ O ~
l 1v ' '~
' ?

W W- ~-w ~ p v V
V
~
>' m O WO p umwwwwWm~O O O
' m =
m tnln(n.
..~.
..r ~

d .
a W E.a.. . O O
~. -~ n. ~
1- ~
u1 l11 !L
u1 uJ
~
O

J Z Z

Z ~ZZ ~ ~ LL= = ~
IL =~
IL
Z
i z zz z z ~ ~z z z o~~g g z ~~r~r g ~~~~,a~,~,Q opo o ww a ~Q z~Q' ~ ~ ~ ~
z ~~ z ~~~~~L w w~ z ~aaQa'' o o a o ~ o ~ ~
~ ~

> mUU d ~
H - pc~(~C7c~ = z z =
te Z > ~ ~
=d' r ~
- j ~Qaa J Q' O~'OOO~ILIIJILIII~
J

U
I_O = ~~r.
O ~~~~ZZZZZ
O ~
O >
a~~ma~

c ~~~OOO~O_O ~ M_~MHM_r~
O L

c J~pZ4~pZ c LU t~ii~(~iiHh=-h=- '~r:~.=~rOJ
f~'-' - t.~-' HOU Q N N
~ a ~
~ ~
~
a c U ~ N~~~NN~Nt ~ N U
- l /!
UI ~
U

ti c~i~QQ~aNQ~a ti OU==ZUUUUUW ~~ ~Nwa n U~

d o L: (n M
M
~

Iw 01 Z ~ M
N
N
N
M
~~
~
~

Z v ' N (O
N
v s .~

I- ~ O ~ ONE N M M
I ) ~~M
O

Z ~" O 01 N O
Z D <O O O
M tn V
O re-at N
V' O
ll~hi~
NM

_ N

N

h t0 a0 aD
c0 O
N
~

O ~ O O
O
O
O
O
~
O
O
p C O p O
U ~ U~ >0 ~

~
~
' ' ~
~
' ~' C9 (7 U
U

U
C
J

N

a o o -a a U C U

p ~j C d h e- (p O M aO O
M tn O et aD
O
Id N
O
(O
O
h ~
O
O

V 07 h y M
tl~

c ~ tOU UUU ~ ~ _ N O M
~ z z OMONlhOON
~~
~z v~
~

a~~~ '~~a~ G a E ~a~~a~~~ ~ ~
~ E ~

a a ap C1 UZ '~' ' , is ~~ lj 0 Z N
~
~
M

f ( O CA N U~ O>
p Ot 'd'nt 0 c ~.rnntD~a~O~O~f aO ~ O

az .Q aZ

d ~ (O (MO V~ O M
~ ~ t~O e~
l~ (h0 M
O
M
In h M
1n h N

Ua h ap ~ O
h h h a CD
a0 a0 M

Z~
z'~

w z a o z z z z z z Z

z c~n ~
~
N
~
~
o g U
U
U
U
U
U
~
O
-' O
O
O
O
O
O
It~
x O
O
O
O
O
O
~

z x x x x x x ~
u.

W
to timi w tii O
o a a w a a a a z Q U
Q
Q
Q
Q
Q
Q
p a W

_ _ U
c'i ri c~i O
C~
(7 O
~

of ri H
of ~
a ~
~
~
~
~
~
~

W '.J~~"'~J~
~~~
'J' l ~J
J'~

W _ 11J.-WW _ _ v , ~'-OrOrO~O~Or' liJ

~N[n(n W ~N~'N 00 (n ~N~N~N~'Na >

diwzz z a,UL awayaw~yi w aw JOz z_~uiuw u~v o~,owo~,ow~ z o~,ow Z~

z~c~nci c~n'~~.~wg~~~~~~~~c~nz O~UU LU Z
Q
Ur~~~?'~
~
~'~

~-w00 Oxm xu t t ~xwxw=w=m>z~0 t~ii~~~~ tu'n~~p=~~

~

=J J ZO
J

~J(nfn J
(n~'J~'J~'JrJ~"JrJZZ~tn o zro o o z oxr=rxr~r=rxrwa~o v o~ww w'~H~xwl-x-why-x-~i~OOaW ~ o ~ I

awoo o~w~~u~w~w~w~w~z ~ a o '~

~ v~~aa a~~~~~~~~~~~~aa u.
a u~

p U
~

~ r Z o M
i r~ st a co W
n C
te .
r N N M Obl N ~ (OD
~
4~'7 ~

Z M ~ N r~ z t~
N
In e~-d s ~ ~ = , N N N
'N
~
N

N

o o ~ o o o ~ ~ ~
~ o o o ~
~
~
~
~

( C C

m a p ~ o a p N ~ ~ ~ O
O ~ (~
N ~
c~ ~
t~
M
GO
CU
b 'd' In b b N M
M b ~ N
O N
N
~
N
N
M
N
O
(O
N

000 ooooaoo m 'FNo s O +r :o O

oz C7 ~ z ~ O ~ ~
O N
~

O ~ ~ p W ~
~ r r ~W

a N a (O
fn VD

~

U ~ ~ p O
D t~ M ~ W
' b N ~
- I~ e-O
r-c0 O
t~
O
O
O

~ 07 ~ ~
w O) ~
V) ~
r r ~-~ in z v~
z ~n v N o ~;v ~. ~ p a ad O v a c a~
W

~.W ..
> U ~ ~ C 'r ~

H ~

,Q. N
~ ~"' Ar .p o "~ . af"p4 V ~~
v~, .y" W ~ aU.~ .N b a: d U
~" i~
~

N' c0 H cd p a~ ~' O
C N

~', ~ ~ ~ .fly/
~

O. .~, ~ U Op ~ ~ N ~ ~O
ai 'C Cy~
s. ~ ' ~"r ~

, ~ 'O O s,..,~
p C C y 4" cG
b ~
OD

d0 y .r,C.' of .U O
L: .Y
G

bbDa~ Np F~.'~Q cC~O

O C
'U ~ ~ G V O
U ~ v >
AO

o N a ~ n~w a ".~ o a~ w ~ a ~7 .C
~ ~1 ~ b M .Y
''"' 0o o a " a~ ...
d ~ o, O ~ O .~ ~ s-~"' ~ d ~ O_ A
~

a " G.'.
- U y~ U w .
d ,~, a ~ O N U
N ~
p~

~ p M tct h .
o - ;n p U Bc 0 ~o '',:y ~~ V o_ ~' ~oQW ~.a~ ~~~. a~ ~~~

~z N t: Y ~ O ~ cC ~
wA fi W U '" ~ ~-'y h O ~ C
C~1 N
CG U W' ~

f ~ ~ b C ~ v ' p, D N ~ ~ W
M p . ~. O
- a) ~

~; x o ~ v .~ a o '~
~

U
w .~ a~ p w ~
. ~ ~ O "
a U 4i ~., ~ "' ~

~ ~ O ... O c .
r~ U ,' x~~ O ~.
aa~~~ ~~~ 3w a-.
V
xb~

w b p >a .t" U N N
.

~

o ~ ~ w ~ ' a ' ~ . ~

'~ ~ ~ '~
a > y ~ o~ ~ ~~ a~ ~ ~'o id y,.,'~ N N N
,..,..

~I '.af'' y ~'~" ~ a ~ ~
~ ~ ~

y N . , U c~
~ H

b ~~ ~ ~
~

o .~ o ~.. ~
~1~.t"r r ~U '~"~ ~ ~O ~p ~

.. U U ..
as o. o ~x . . a~ , >, y ~ t, ~ bD ~ ON N is a U~
~ ~ 'CT

a, H A~ ~~ ~x x zb c~~d o ~

W

A

z ~ ~ ~ ~

b d ~ ~ ~ ~ a ~ V ~ i w p ~a a. o~o ~onoo C7 " ~ ~ v ~~ w w ~ ~~ ~
p ' . b o ~s ~ eu ..
N o z N r~ O .-.~t~o0 et_~t_v~N h hO o_0 ~ O M h ~ ~ ~ ON

VJ M Oi .~ ~' V M I~t~ N ~ VV h h t'~1 M h '1 a0OM V' V1t'~l~ v1 v1'1 O h I~ O ~' 00 ~ NN N NN N O O OO cn h 00 ~' cnM

h v1 v1 h v1 h h h O O O O OO O OO O O O OO O
h h ~ ~r pq as pqorsvao0 oaas w w w t7dd ~r ~ ~ d d dd d ad d d d ~~ d v ddd d d d .,:
°' .
M
r' U
N
C ~U G. a U O ~ U
0~1 Op v O ~~ ~ O U
N .~ Op 0.
~°~..° ~~ aoo .°.'. cn co a a ~ .. d O
O .., U o >, ~
U x ., '~ o ..~ w .~ 'a ::
w, .mo ~' ° o ~ ~ o 'b ~ o cu v r~. v E-~ ~ o A v ~ '~ v ~p~r ~ °Y'W
°~
N ' ~ ~, ~ n V ~.' ~ '~ t~ ~ 'a ~ ~
~ 00 ~ ',Z b4'C~ Ov ice., ~ ~ ~ p~
d ~' Ix...U~ ~U~M
P~. 3 3 a: ~ U ~1 .°~ o' o b °~-~' ::
c o ~ o' b~ tea. ~ , ° i ~ ~ ~ o 0 ~" ~ Yz~. :~ ~ ~ ~h~ w O N tti ~ O N' O d ~ O ~ .~ '~ N ~ ~ ~ U
i.W 1~ ~ ~ N ~ ~ ~ H ~ p' ,~ ~' ~ ~ '~ U
O c'~0 X ~ ~ b ~ .~ t~0 T ~ ~ ~ 4N ~ ~ ~ .o ~ ~ ~ awG ~ b .C .~
N ~ "fl ~ .~ N O ~V ~ ~ ~ p V V O.;D ~D O. ~ :D -G ~ N
% % ~' 'n y, 4. O '~ o' p ~ N ~ a..
f~, 'o ~3 b 0 ° °' ° ~ .~ ,~ 0 0 o A .~ ° °
~ ~ o _~ o 0 b o c~ o.~°'o~o~ 'o~o~~'~' ~.5.~ o ~~ o ~ ~ .~ o o c a°~
c~ Mo.A ~.o. .~~z o ~ ~ ~ wd~. o..~x Ac~w ~..~ ~a ~:.; cz" x a a ~Qac~A_ i~ acid ~ oaxw d a °' o ?, ° oo eau oo .c v~ ~ o ~ v~ o C7 ~ n. -o ~ .~ ~ ~ ~ ~ ~ :~ :a ~ :d :.c c ~ a.

z vo 0o n o, ~o ~o m .-. ao er c~~ et f; ~ fn ~ .r7 c~1 01 O~ O_ ~_O ~ V1 l~ v1 O M 00 ~D 0~0 0~0 .~-Wj 0N0 Ov O O ~ N Cn O ~D ~ ~D
C~ O O O O O O O O O O O O O O

an _~
~' o a C ~ a~'J. ~ N U ~
p ~ O~

C (U0 _ ~
.~ ~
ct1 ~

7. ~ ~ a, y o ~
~ ~ v ' N C
O~p ~~ ' . ~

N~ ~ OpN '~O, w V ~ ~ U ' J~ p .C"' ~ O ~ M
. O M

2i a o w O ~ , o .. O U p ~n ~ ~ t~
;d T fn ~ dp O .i. ~
3 cOu ~ ~
p. -~

, v , o OJl ~ it N
O ~ O td N

O r.
0' NC ~N N~~ ~ .-i 'V~ V
.N~ 1 p ~ V ~N _ _ 00 , ~ r' U U
. O ~
C N O~ n N
~

I1 ~ ~ , , ~
G' V U N U ~O
C ~ ~~ M
C) 'i n ~N'~0 ~~ 0~ U Va)~,~0 7c c ~ ~ ~ o ~ ~ ~ w v v M
~

~ o N O
, ~

V O p G V N ~ ,,O'",, ~ U M C ..O ~"
~ m .

Gr ~ C ~. .b 'O N
00 ~ M O ~ ..
~. v p) b0 p j.," cCO c0 _ y 3 V b ~ N
~" O~ N ~ U ~".' ,"

r.' ~ _ N 'i7 ~ ~

~1 Y ~~ H
~ ~ ~ ~' ~ 17 0 U ~ d ~
~O ~

~ d a~"~7 ~ y ~ U
C1 a a.. ~ ~
U 1. M . ~ ~
C C 'D '~ .~
p a ~tO~ICL~~ bD~.D p~0 OUp,~bD
~ ~ O ~ ~
~

y C (~ O O ~ N
L' Y1 b 7. y O
~ . ~ V ~ ~
~ ~' y ~ ~
, c 'j d ~

!o ~ ~
.
..

O V ~ _. _~ .,.~,~
U , .4. N U ~ a-U
W N C/1 ~ G3.
a~

~. o c~ y a~
y a3~ ~ ~ (~
~ ~~~ W Ho ~~ a~

~ O a O

p ~ w y ~ ~
G '.: "~ v O x m U O 'n C p U
O. ~ a ' ' O O
~ ~ v ~ ~ ~
' a U
~

w ,u ~ ~ N , a~ . ~
~ m ,,, ~

y .. N ~ O :~ U N
tY a. .-d. ~ O (E O
r k.,'~ ~ s~ ~ O
w ~ 3 - E
o on ' w , . .
0 .

.~
>

~, 3 ;~

.o .~ ' p ~ ~n ai ~

U U Y o tarN
~ ~; ...Uw .5 .S
~"' a~ a~ .~ ~ ~ w c.~
..: ~
m ,.~' ~ C

C N U O , ~ ~., c .b 00 O, ~n G. 0 N ."
~ f V ~ '~ T ~ . ~ M
,SC .
~, cNC 09 y 3 O b Ur-G N
U R
O

N cd . . a i< '~ C
ai ~ i by a~
'~ r ~ .~
'~ 'D ~
O
O

V . ~ 7 ~7 ;~ ~ a~
~ ~ ~
t ~
~

Ci fn y~-y O O ~ ,~ ~ "~,~~O~" OD
fn a. ~ T1 -. O O U
a.. y.., (3, ~ Q. Q. O .~
CL O C
v V '~ ( w ~ U ~ ~
p ~ C O b' O N .C~ .C
~ a~ v p U C ~
~ O 'm .'.' ."

o . O ~ O t"' ~ ~ i.''b O
C. ' N ~ ~
~

' ~'~v~~ N~ ~a ~ ~~,~ ~ ~ x H
N~~~

y . . 'O
O ~

b ,. ~ d .~ ~ -C
.C~C ~ ~ ~ ~
.CU ~ r ~
~ X

C7 M . E a H P, a U ~ Z a. E-~a V :.r ~s a~
b o v o b E'' o A
o +r S
~ ''~ ~

m o ~ ~ a p ~' ~'Q' b o ~ o ~

C7 ~ ~ ~ ~ ~ , ~ ~ ~ C o c. a~ b o. ~u .
~

z n 0 ~ ~ M M M ~ ~Od' 4lO

~ N N ~ ~ O O ~ N N m ~

p c c a ~ 0 n ~ N n :

a~ w w w 0 0 , ' c~~ '~ a a a a ~ a a ~ Q , Q A
a a s7 a a N

; ~ ~ N o:

' >; > ~ ,.., w o~ wQ Q o F ~ N N U ~ ~.L, i-:i-:p w w O ~ d' v ai of' ~~" ~ p ~ N ' ~ ~ ~
~ O O ~ N
,~, ' ~

' L1 d U ~ ~ '.~.t~C~ ~ ai O U U C G a O O 1 +r v~
' ' M
N

M N O D ' ~ .~ ~ ( Q" ~ O
~i , O ~ M M O , ~
U M ~

V O ~ O O 0 ~ O~ T'-.a ~' ~ 'a~
l~ O U U 00 01 ' U O c O f3.0~

O ~ m C ~ U d .b .~ z z p 'b ~ b p pOp~ ~
~ . .
' ~ ~7 .a w ci. ~ v U ~,:A f~ y o . . a. -' N ~ ~
~ ~ ' ~ a ~ ~ ~ ' ~
~

u ~ ~ ~ ~ '~ c G
~ ~ ~ ~ ~
.

5 ~ ~ y a~ oon ~ ~ ~ o o o i i i i O . O ~ ' ~ ~ ~ ~ _ C d ~ ~

O ~ H ,~ ~ O O
O ~ ' 0 ' b '~

U N ~ ~ ~ . O
M ~ ~ fr O L -!
.--nU
Y

U x ~ O ~ 0 0 LL O t. r R X 0 0 n y ~3 a:. 'h-. Q

-. .~ . . +, .
O a a ~ U ~ ~ t~. p c'~~ A.
'' a 7 ~ ~ .~ p O

,-~ . - ~ C O ~ C Y ~n ,.-~
~ ' N N ~ " a H y o . N ~ . :
00 N j 00 ~

O N N p ' t d ~ w O U
00 by O C OD U ' M M ' b p p ~
i ~ p O O -~ 4 G f. C ~.' G F'" ~ G !'3 cW C
~ ~

t O 0 O . ~ b ~' ~ ~ ~ a U ~ ~ '~ "
C ~ ~ ' N

U v U c ~ a 'b p O~ N U z 0 ' 1: Vp ~L' z f3 ~
~ ~

Dp O O . . s ~ UM M M M
o b b . ., z m ~ A o o ~ Ca p ~ ~ G . p ~ a~ o ~ ~ ~ o, O O a. Q, (~ a> > 21 ~
~ ~ o o w w w o. av '." O
"' ~ N O ~ ~ p v ~ ~ U O O
~ ~ '~ N 0 w O O M N
' ~ C
~ p C; P" P' C t". '~ . C O . ~ ~
~ W ~ ~ ~ b c 7 ~ U
. . t , . v CL CL c C7 C~ ...,. . M r a.. ~ O E ..., ,..,0 i i ~ ~ M . ".
. O O O ~, - ~ O O O O
U 'r ''% d ~
.p E

~ a. ~'N~..
y ~~ ~N ~~~ ~ ~ Y r ~~ M M ,._, ~~ N ~ ~ ' ' Ya P, , ' U U d a a ~a ~
~ ~ N O~ PC PG
w N N
~

'~ N N y ai ~ C C O o0 0o z W
w O ,~ Y ~ O
a~ ~ ~, O
~

U ~ ~ ~ ~ ~ ~
p p T O
~ ~

O t ~ t , . r N N to ~ ~ u1 V O
d N 0 ~ .n N aj ,.fl~ ~ l~ 00 ~ N ~ ~ ~ N
F' ' O
" ~
' .O ~ M I P. ~ O . 'n m , ~~ O
X M N t~. ~ ~ ~ ~ O~ p M M
b p O ip ca m ? N ~ ~ ~ '~
~ ~ oo op O

4.r ~ fN..sN.. a.. '~ ,..,C r" ~ ,~ ~ 01 Op a~ sU..pip pip ._ . i..H v~ '.'.'G~ Ov o G, N ~ ca ~ ~ . ~ s ~ ~ ~ a, a ~, ' ca o o o. a. o, ' o ~ ~
,.., ,-.

x ~~o x~' x~' ~ ~ x:~xb.- x~~ x~ x..x~ ~..w..
~~ ~

U ~ V C

.~..f~/1 ~H
p l~
~

~ p p p O ~.~.
.l=

ui p a~ O

O ~ b4 0 ' op O p ~. b a~ c~
~ ..

b O U ~ ~ 'rd z ~ ~ ~

o ~ '' p b w o ~ o ~ ~ ~

.~ ~ b b b .

o ~ .~ .~ ~ x a .~~ ~ ~ p ~ ~ ~

~, . ~ ~ p G.b ~ ~ ~ ~ a b 'v C.

w o o n. ~ o o ~ ~ o o I?
~

C7 c5 x ~ H ~ ~ PO A' Ca w .~ ~ a. a ;x ~

.

v z c~

p z a o _ O 00 ~'' ~ ~ M d' O ~ ~ O~OO

~ V V l M M G~ ~ O M M M ~h r 1 i ~ ' M M M

' ~!' .., .-r.~.--r .-. M ~t tt ~t ~ et V v1 "
v a Q Q a o~ o~ _ °' ~ o 0 H N N N ~ O~O o~0 ~ b N b N U U
~n~HEEN~tNO~cOC~
.O O 000 ~~'-'~'-' O L1_C
'Vb.~ O 0,.~~~~ ~ ~~,'sU..Q ~ O C
. . p~ O~ O~
U ~ O
N ~ ~ ~ ~ ~ ~ ~D ~ ~ ~ O
_ 'U ~i-~ i.~ M
O m C O N O N O V y ~~44:44: A~aU.~,.U, ~~~~~ ~~aU.~O
b j, ..D ~ O i3. D. 4 ~~ ~ ~' ~ H' 'v q ~ .-, O M O M fn O O 'O ~ ~ ~ N d ~, Q~ ~ ~ ,O O d 'G .~ c ~ ~ 6 ~ ~ ;r ~ ;r o ~ ~ ~~a O .~ .~ ~ b0 OUD by ~ ~ b ~ b ~
pp O A ~ ~ ~ ~ U M N N N pp G~ V fY0 V tYC ~ G 7 M
g.-, cn.-..~ ~ ~ d°' o ~ ~ ~'°w~w~ o ~ .~~°n b G *' a~ a~ an ~ ~ ~ ~ ~~ ~t o ~ o ~ i N ~~ ov o yd Q °'~ .~ ~., .o ~., c ~ ~e :x :x a. ~ ?? ~ a~ a U v o ~r =
V O ~ ~,'~ y"~ 'D N O O O -V O~ ~ O p O t0 01 w OV U
Q a a Z ~ d' ~ ~ ~ w N w ' w ... a, a. o, .t'~.' ~'' c~
4~Z~Q °N oN od N ~ ~ c. v O.-. bo'v N M O .-, C . tC cG cC :..: ~a:. i~ O .r C ~ a O
~ M A M Z c. o "~ o. "_' .-Q.' r''~ Y Y d o Q o Q o v o °'.
QA
[7 ~ ~ ~ b .=~ b .~ ~ M '~' ~ ~ ~ ~ O ~ ~ G A ~ A M
~~ ,...., O pp O pp .f, a.r ~ .,r ~ ~O h _~ C~ Z" 00 s"' 00 U M " ~ .. y N N N N O ~ O t0 ~ ~ ~_. d ~ ~ ~ ~ ~ ~ i~ of is ~ i,~,. ~ O O O ~ n N v~ y j °' ~ ~ N co M ~ M ~ ~ i N y ~ ~ C7 ~ U .:. C) ~N, ~ ~ U
T N ~ ~ ate.. N . '~ . '~ ~ ~ ~ ~ x ,L
., . icf i-~ ~ ~ ~ N ~ iV ~ ic7 ~ iV at N
Y C. 4a . La . Y r N H ~ H ~ a~ :: ~ ~ 0 ~ o ~ z o a~ ~ a~ ~ a~ ~ a~ ~ ~ w w .n .n ..a .n °' ~ ~ ~ ,o~,, .~ ~ 'oo c 'co 0 on o ~ o o ~ o ~ ~a ~ y ,,oo, ~
a~ ~a o 0 0 0 ~ ~ ~ ~, o r, a M a M o w ~ ~, ~ a~ c ~ ~' ~ '~ o fli W o A4 ca ~ ~ a4 ti. x' tz. ... O W o W o v1 0 ~ u. W w v1 w .., P. d w x o a~
x °' = ~ C ~ ~o a~ .~ ø. ~ a .
b i o ~ ~ a w ~ o a. a. ~ a 'd o °Y' v ~ .n ~, °' °' ~ o -d ., b ~ ~ o :b C~1 ,~ ~ r., 'U .Y ..1G 'j," U ~-' O
O ~ _.-. ~ ~ N cV O O rp U U U R. ~' N ~ t~C U 7, '~~-. O
~t~. ~ m ~ p ~ O. t3. '~ '~ p ~ u.
O 'b N ~ i" Li ~ t~C ~"' ~r W
F~" o .~ ~~ ~ ~ .c ° ~ ~
p'~ ~~,o~c~o:~ i crab °
G7 ,.t'~- ~ ~"' ~ O v .Nn. O ~ ~~ y U E' c~ A A ~ a, ~ a a ~ ~ a ~, a w ~
a z H H
O
z xo ~~ N v0 O~ O .-. ~O h ~O t~ ~-~ l~ oo O~ O ~-~ N N ~t M
t~ l~ ~-~ ~~ ~ N N N O t~ t~ t~ oo ao 0o M M d ~ .-n .--n rr 00 00 00 l~ .-m--n .-r ..r N .-~ N N
V O O O O O O O O O O O O O O O O O O O
G7~w w w w w w w w w w w wwwwww w w w a~
~ a '~

vm U ~ Y p ~ G O ~ r ~ h a vv . .w ~ y Y V ~ Y
O ~

~ '.'C1~w P-s Y ' ~
p P

y ! 3. ~ N a y E., ~
M M 1 ~ .-. .
-~ ~ z ~o ~ ~
~ -' N ~ ~ A

y v ~ a ~ ~ .~x ~ a~
. ~.

o ~ ~ T ~o ~

.
~

o ~ A ~ ~ ~ ~ ~ _ a~ .
( ~ ,err, ~ ~ e~
. O

c 4~,,~ b0 b0 y ~ .. J3 ~ ~ L. .,, w N
O ~ ~ ., p~ y ~ U
',~ ~

c. U 'ra'~ N i~ id .icecue.~ ~ v O V
~ O O O , . N ~ Cf O .

O O A" U U U U U O ~ U
~ ~ a : w~ w w~ ~ Q

v 1 U w , _ ~, O C
U ~ O ~
..-.~

O ~ N ~ ca c~
~ ~ ~

A.
~O

O N i v m v t O

C C ~ in n ~ ~ ~ ~ y ~
. N _ p O p R O ~ O a p, ~ M -p O
C
~

R by ~ ~ a' ~ o O O ~ G, v N ~ '~
.~ r..p, ~ ~
~n ' v as v ...~ -7 y ~ ~ ~ ~ p ~o a> ~
. ~ - N ~ ~
> ~ . . ~
~

a o o o ~ ~ ~ ~ ~ .~~. ~ x.
p po . ~a0U U O O O O O ~~'C p Cz N 00 yN

~~ ~ ~ ~~ .~. N>
~

a.:U~ N.~"C~~..),,.~"''V p O O O O N~ ~~p..NN'i -~ U U

~ ~ .O b V U U h [~ ~ ~ p4 U
H O r. f~ l~ " Y ~
l' I~ ~r ~i ~i ~ w .~..n~ ~ \ U U y. ~
~ ~ ~ ~ ~ ~ ~ w ~ ~O y .

~ ~ O y ~
O ~

z z~ z~ .
\ \ \ \ \
~~ ~ ~ o o o o o : : % o ~ ~

p o~ A Q a Q ~ a , , .
~ a .a ~.a.a -.a ~ , ~ ~ ~ ~~ x ~..

fl ~Pry~ y~ x ~N NN NN ~N NN N U '~MOC

y ~,. , ' 0 0 0 0 0 ,. ~o ~o ~o ~o ~ ..: ' .:
do ~ o w ~ ~~~' y >.w~o b .~oTw d'W e"~ar~~iWa"~>'~a~w ~,j . C~ i U O Q ~ ~
-L U a. .' . O ~, ~, ~ ~ ~, .~CV
U y~ ~ O\ 01 .~,>~ . b N

cH ~ ~ b b .~ N t, s. r..'..'+~.IN y Y .n N ~ ~ ~ U >, O~

'..a ~ ~b ' ~~ ~~"~~ ~~ ~~ 1~ ~bv U .~, v ~ "o "' oD~
o ~r ~ ~. a. ~. ~
, i1 a, cC t ~ N U c ~' !
U

N ,.,( ~ N a c ~ O .. b4 U

N t t_t7 O C ~-~
.. H
N

W ' U O '~ H. U
~ U
O
~
~

U c L' y N ~ ~ N
V

b ~ ~ ~ .b . b ~

t b a~ f,' C C

'c7~ U cU0 ~ U' ~ r fWn .~

U ~ O ~ U + ~ , 'b N ~ a. O TJ
~ ~ :D

~ ~ _ ~ " t0 ~ . t~ a!
c~

O
O U ~ ~ O ~., ~ ?.>a>>
~ .~

U U y x . V N V .ti~ 4.
N . . N

" b , O
" ~ a~ . 'a.~ o, ' ,~ O
O

.n T3 v o a O ~ ~ ~ ~ O
N O
O

~ >> ~ .rJ'N 7, ~ U y .

U" 1 A V ~ a ~1 ~ A c7 E-~ M a ~ A a a p4 a ~ 1 .

U

a~ >

z ~

~ . 0 7 U >

C ~-. W .=.

z x~

ao M

Vi ~p O~ O ...~~' O l~ O M ~ 00 M N

'~t~i'O O ~ 1D ~O t~ l~ h O O M
V1 ~ ~ ~ ~ v t0 N

v ~D ~D O~ O~ v1 I~ l~ l t l O 1 t~ O~
00 t~ N N N N M ~
I~
N

o0 00 0o N N
N

C7~ w w w w w www w w w w w a ,- a a $~ ~ ~ ~°o ~~ o°°, wCj wC7 °~' d _.-.vc o" o" ~[~
0 0~o .d ~ c~ ~ ~ Y N ~, ~ ~ c 60 ~: ~ O ' w 0 ~ O O~ O a..
v.c00 .y ;.a ~ .~G N C w O tip .t~ .OA.~.. .N .rte ~ O N
y O I' N ''' O 'S' y ~ N O~ O ~ a.. f. ar yy O C.' Y i~. l~ O ~p0.. UI"-. U ~j ~ ~ .~" ~..' ~° U O cUG O c~ a-~. U
o ''~ °° o Ty ,-, °' g y°o ~,~ ° a ~ ~ a ion a goo ~ ~ C+7 a a ~ °' ~a ~. o°n o ~ o .o ~ ~ ": ~ .. a ~ a ~
.. ow d~. pp'O ,n ~ ..p ~ O U ~ ~ ~ N ~ ~ v ~ ~ O v O Cv q c .C N ~ N ~t ~ ~ ~ U N ~ Ov O "r ~ t~ p, P. p G V v "00..p N
o o ~ o .~ o .b ~ o ~ ~ m ~" O ~ ~ ~ N ~ ~ ~ ~ a) ~ cU0 cUC ~ G N ~ ',,~2 a~~'~yN~O~ at~ aR.~i ~~'~ O~ OU Nbp~''O-..'C
O. W '~ C ~, ~" .~ ~ p ~ A ~ ~ ~ ai O o 4'~.. ~ .~~. w ~ ~ N ~3 ~ pp itt ~ ~ '~ ~ ~ bU C _~ pp O O ~c~ O
p p ~ a~ m ~ .~ .~ C w ~ ~ N '~ ~ ~ ~ 0 ,~ CO .~ v G ~N'' ~y U 'm ~Y ~ b ~ ~ ~ ~ R '~ ~ l~ r,0, a cG ~O 'V (~ U Qi 4; Gl ~ ~
'O eR' O c~ ~ cW ~ ~ "" p ci .a ~ N
'° xC7 ~ ~~
O V ~ ~" U O ~ N ~ ~ y ~ N c00 N
v m G o ~ ~~ ~ ....
v _a~ ~ .~ ~ .~o W _ ~ >, ~ o ~ o U ,ap r_~ ~
NO°~Op~~~ ~~~iCb.OP.~~ ~h~'.'~U~hV'~U(~O
~ ar "rye a' p ~" O _~ ~ U ~ ~ ~ ~ ~ N ~ V ' .O M
w e°~ o ~ W '° V M " '~ °' ~ ~ H ~ a~ ~ i~ . ~ m . ~ o a ;°
a a ~ ~ ~ ~ °' ~ N ~ ~ Q ~ ~ ~ ~ x o. i ;r °o ~ ' °o ~ ~
~ ° v o y Q o ~ io ~ v ~ .N ;° ~ ~ ~' °~,' ~ ° a ~. ~ x c°a N x c°a N ~ o ~ U a .
y ~ O ~ ~ p~ p G 'd ~ O T ~00D ~ V p O ~ '~ cpC ~ CV ~ w N ~ ~ ~ p ~ U
P; w a. ~ ~ on ~ .a ~ ~ ~°~' U i O ~ .~° w U w w v) W ~n v~
pCi ~n O w o0 P;
U
N
C b O O
N
b0 O ~ ~ O
V't M V O
w~G~,w ~~~X~ ~N y o ~ .~ ~ o on W o ~ +°: Y . i . ~ ~ °. ~°c m a. o. °~' > ~ '~ ,~ ~ °" w -o '~ n. °' o v~
A w ~ F~~ a~.~
U" ~ a. ~
as a G5 ~ ~ v~

x~

d' V1 M 'd' OWD
r N N ~ O ~ h ~ ~ ~ O
pp ...v ~ I~ Ov M_ ~_O ~_D ~_D V1 Y1 d V 00 l\ ~ a ra C5 Q ~..~ .-N7 a w ~ .~ ~ ~ o~'n ~ U
U ~ °' ce .-. w. o bn U ~ . v '° [~ w °~,' ° °' w' o, o o °
a~ ~ p ~ ~ ° ~~ ~ o o ~' 'y °~ ~ ~ o a~ a a~ o ,.d O ~ ° v G V C D .~ ~ ~ .~ 'y p v C .C ~ ~ O ~ N .. .~ ~O :: 0 4; O d N ~ ~ ..D O 4~. ~: ~ _O .~ W 'c~ C ø' CS ø' CS t3. b ~~: a~ '~ ~ ~ ~N Op +~' ~"C., ~ N ~ ~ W ~ ~7 ~ W
as °°~v.~ ~.° ° off a °°.~a~~' b ~ ~ o ~ ~ ~ ai A
,.c M a~ v ~ ~ ~ ~ ~. ~ ~ :; a4 .~ en . . °° Q on a o4 ~
~n.a a ~Q ~ ~ a .~~. o °.r' on Ti o ~ .~ vW o~, ~ o ~ o ~ o 'n 'b o, ~ ... > _°' A ° a ~ o o :-: '~ a. y a. y n.
a. &,~ ° c ~ ~ ~ N,J
'a _~ ~~ O v V OA W F,.. O O ~'' ~ 01 ~' M V ~~~... U ~ U y ~ ~'E"ow ~ ~ A. U~~vV.~~cN ~ ° a ° ~ °
°°>::~M bD~~Q' ..N~ ~ a0.. ~O.
V1 ~ N ~ fn U O v ~ O~ V ~_ V ~ ~ i0 ~ ° ~ ~ ~ (] ° ~ O CL O d T
.fl ~ N ~ v H Wit' ~ y ~ v f"' ~ ~ . ~ .~ Gy pp ; y .O ~ .O ~ .O
N H~ ~ ~~a~y~., ~ ~~ r~.,~ ~'G a0..'~M V ~' a"~'-. V 1.~. f~-n v N 'rte'. N ~ ~ O O N r.a '~F' ~=, ~ ~ ~ ~ ,.~~. I_',~., .T.~.' ~ G ~ C
o ° ~ ° oo ~ .,: .~ U ~' ° ° oo ° ~ M ~ ~ ~
° o ~, ° o ~ C o ° ~ .~ o ~,,., ~- ~ ' U N - a ~ a v ~ °' ~ ~ ~ v V 'code -°: .a ,~ ~ U ~ ° ~." a c~
Ov ~ ~ a ov V ~ p M ~ . ~. ~ ~ ~ b0 N ~ ~ r-~ cC O ~ .~i .."! ~N V . (~O ~ . l~'O
t~ .b .~ tC _f3. " i:. U ~ '~~' y~y r-. N > .,,d, L: V ~ Q' ~ ~ ~ _N i0 Q' ..N~
a N ~c ~ ~ ~ ~ ~ 'd '~ ~; m~ ~ a ~ 'd ~ ~ W °' y ~ °' ~ ~
°' ~~
o ~..; ;~ Vy ~ ~, Gj ° o ~ ~ ~ ~ ~ ~ ~ ~ '~ ~ v~ rte. .. vi x~- ~.
it 7.: U ~ ~ 3 U .~. ~", ~r.. ~r~~ ~ F: ~ W N N .. .O. ~ C ~ V_1 ~ C .-~'.
~_, ~". y V1 O CS .b ~, N ,~ ~ (~ ~' :y c0 Vi M ~ ~, ~O
y ° a3 ~ ° t~ AO O O y ~ ~ av p y U N M '° ° N O
o0 O I~ O
rx x ~~x?~~U u.xx E"oUA~~.- ~Ub a~~-. :~~~:r,.-.
b 'V O
O ~ ~ O
FO. O
a~ ~ .'ra' 4a; ~ O
~ O of G" . 0. ~ a V ~ o ,~ ~ O. ~ ~d ~°~ ~~.. '.~ ~ ~. ~ ~ ~ O ~O (NO r°..
O .C ~ ~L V N ~ .~G .~
CL n C ',.°"~ ~ N ~' ,~.., ,f"" N y.r t. .O V O O
n °° ~..a~, ~ 3 °~~' w ~ °~' ~ ~ "on .a f~ a v' ~ °° '_" '~' ~ ° '' .~ ,~ n. on y U °' ~ ~~ ~ ~, ~ ~ Wo a~ ~n u: a. x U' N m a a Q a; ~ ~ ~ ,.~ ~.° ~o °' '' ~ a z ~ ~° o a C1 A ~ a ,~ U
U O
UU H t1. p, O
~z o _ a%pOOM ~ VN'N ~NNth h h ~ N ~ M ~_ ..N., ' a ' on o o w o .

b 'L~ U iC G ~ tNn n G ~

.~,Y N~ ~~ W V~~ cOG3U

~ ~ ~ O ~ ",~ N ~i Ov V ~H ~~., p ~ ~ ~' U ca .,: ~ ~ a o' a .-n on ~ ~ v a '~ N N
~..' s-, V ~ pv 7, ~ O :O ~ N y y N
~ .~ G ~ L1 pp m ~ C
. ~ .~ ~ cNV
~

:O~ ~~C; ~ .N ON~,bv N~
G

cV U C p ~ ~ ~ O ~ W
~ ~ CS ~ O

~ .~ ~ .~ y y tp W . X y' ~ .-a o w oo, ~ " U . p oo ~ a ~o ~
~

(n ~ ~ a . p Op .~ ' w H Ci a O 00 4., x 'd:

pa'~Can~ o ~ ~~ ~ ~~ a~~ Q
ny p. ~~~
o OON ~ ~v ~ G~ ~ p~ ptd-C ~
~

i ~ p 'd ~ . 00 .~y ~ c0 C .p ~ C M ~
~ Op N f3.

~ O ~ ~ ~U

V 'b Q H U ~p ~
- ~ R. ~ O ~ ~; O ~
~ ~

W ~ N G ~ Q. _~ .. y.., N 'C a O M .~
l~ ~

bD bQ N O O a n F. N
~ V :v ~ O ~" d 6 rn .~' .c a w N

a ~ ~ o n ' ~ ~: a P7 ' W. ~ ~ ~ x ~ ~ o . id o V p U ~
O ~" '~ V . r. .~
~ '~ p C o . N
~~ o 0.,~
~ N ~
~ ..:
O~

~ U r..
" ~
~
p ' O- ~O n NN~ G4 " ( ~ ~ ~
~ C v .
~~~

G~ e vwo .~ y~d~,~ -U
C ~v n.-, o y C7 GZ. it7 O ~ C. ~ N C N
' ~ p O a: ~
~ O~ ~
~
' .'r.9v..OQ' cy, U~r""C p p d~,~
L O z . .~

E. U U ~ o ~ ~ C~ x o ~
p ~ ~ U ~ o ~ ~ o ~ ' ~ ~

, . . .
a .-n , n " - v ~ '~ ~
~ ~.

~, ~ . b ' o ~ ci ~ ' . ~ ~ ~
~ O ~

iCN.pax..N ~~,,~ ~~N ~'.- '~."v~NO
iO ~~~ 0 .~
~

p ~ a~ ~ (~ ~? n ~ V1 .p ~ ~ ~ p., ~
~ : ~ p ~'' v ~ ~ N ,'~., ~ ~ cv0 ~ v ~
~p U V' :fl ~ p ~ ~ ~ cpG
.x O C ~ ~

FI . of 3 , .~ .a ' _ N
~ ~ v y N p t. ~
V N ~ ~ ~
~p . ' a~ t0 H

y .~ L F: py G4~C~H .b~ e N ~~ v ,. i N C~
~' ~ ~ ~ ~
~ ~ ~

..Y," C G
G7 ~ OD b0 ~ t ~ O k ~ O~
C" O ~m N N O ~ O
p ~ ~ ~ ~ p Ol ttf w ~ '~ ~ ~ Cn O ~ fn P~l ~ o. i'. ~ ao W U a~ U U
U ~C -- -~ C~ s ~s U

a~
N
H
' _' W
N ~ a p ~ ~ N
U H ~ o ~

p N

o ' ~ ~

v ai a o Q,a .. o 0 ~

tn ~ (~'c~ ~' U N G
.t1 tOd N ~ b , .~ '"' ~ V' .~

.n-op o ~ ~ N. a.
~ ~ U

. f p. ' H W
-~'.~H ' A' ' -c V ..p ~
an N ~ ~ p ~ ~ .~ ~ >, -~
~

A ~, w, ~ p '~p ..O v p y FT T a) p k 'O
~ N N
c~
m y ~ ' d , O fn M
O

~ .~:'.~~ p, W N v r:
~

d .C ~ d N O ~L' Q
C7 CG ~ ~ i ~ E N t ~ C

E-' x n ~ - Cs. w a v cx. w v A

as ~, ~' M
' o H ' Q ~ a ' ~ ~ r~

G7 ;a ~ v ~ ~ ~' W w b ~

G

~ z ~

Vj-~ M V1 ~Ol~00 O M ~ m M
N O h h h ~ ~ N

m a .--m1 M t1M O~ ~ I~ ~ l M
~

V M c~1 et C1'V100 O O _ w o a. ~ ~ w ~ ~ ~ ~o v ," ~ ~ .U .V ~ .E' _ ~ O_~ t0 ~ n N U M Qv C yr N C 001 t~,, ~ ~O .~ ~ n 'n V p N ~_'n ~~O O~O 0 O_~ ~ ~f~p ~ M ~N
c"a .s5 ~' ~ '~ ~ ~ o ~ a ~ ~ ~ ~ ~. ° c°~ o"_h ~ ~ v 'a v, ~ ~a°', ~ ~~ Q~.a ~~.o ~,a°c Act ~ ~ .~a°~ o '~ '~ y Ga o ~ ~ .-. N a ~~, ~ ~ ~ so -~ o ~ o ~ U ~,., '~ .~ ~ o ~ U '~ :~ ~ L ~., ~. a. o ov .o a.
ca N W 4.. ~ .n .~y ,.~ c..r~.. o, ~ c b °' ~~ °o°, ° a.o ~..o a.b ~ ~r ~ o ° o c. .~ ~ U ov U o ~o a. ~ o as ~, .: ~ :b v U ~ w O L.DC .Cv.Cv øC pdUr~n~d~
~w.~ °'~ ~ ~~?~~CS ~' u~o a ~ a a°, ~ ~ o ~ ~ ~ .u o a ~~ ~ ~ ~ .o~' 'n ° ~ ~ a ° .D 'D N V O -O ~ % ~ V N 'd. ~ v) ~ ltt N
N .C V '.~ ~ M ~ O .Ti ~ .O Q ~ pn n ~ ~ ~ y ~ ?v p 4. C
!, V ~. ~ ~: ~ V ar ~ i. ~ ~v~
N ~ ~ d 0~0 V '~O '~'~ ~ .fl N
~-.w a,U o S~ ~, .~,~; ~"U o ~.°x,~~ "ono ° ~,y !°3 a~ ~~ ~ ~ p ~ ,°~n ~ 23 ,~ ~ o ~ ~ O E a, =: ~ or ~b~~.'~a -..~~~~'o~ %iv.~~isooubao.da. ~Te~n i E o. ~ ai c .. '~'~ b.::o.i.v i.- ~~ ~ ~ N i c Q on r~ a ~ o', ~ m O ~ 'b ~ Z -~ ~ r1 r; .C t-i V ~,, "", ~ ,° ~% o ~ ~, y Li ~ ~~ O~ ~ N t3 U _ b ~ ~ NE' c°o'~ ~ ° a o c~a ~c,~~ ~ ~~o''~~ ~ wo'b W ~ b o, a~ ° ~ ~ .n . U ~' A ~ ~' .~ o ~ Wo ~ 0 3 '~ ~ ~ .n N ~ ~ ~ °, y 'U ~ U O ~r ~ ~., O ~V \D O U O ~ V ~ O ~ N n N n W ~~ a O) ~ ~ oo O ~ ~ ~cd O ~ ~ ~ ~ ~.~ ~ ~ ~ O ~ O
x vU ~nN~ °~x ~'x~~c3 ~n.~x~x ~UWU a~.~~cn ao.~v~ en°
.o o ~ ~ a A
'~ ~ ~ ~ N ~ R
:, ~ ~ .~.° .a g O .~0. LL O et! of .fl O M ~ 'O m a N ~ Q' ~ .'fir U ~ ~ 'd ~~-~ ~' d A ~ ~ p ~ r ~ ~ 'b ~ t~ . J
p ~ ~ ,~ t> aWy C O ..~ '~D b0 a~ o o ,d . p ~ ca a>
pq W . V O m m ~ ~ ° p a ab ~, ~~ a as H ....~1.
a W ~ ~ g.
Ch ~e -.. ~ o~n ~°on x d p O
M n N (V
O
G~ O O
y ~ ~ ~r vwc ~o ~ b' d' Ch ~ ~C 5C ~G ~C DC X i~ ?C

WO O1/b6573 PCT/IB00/02035 on ~ °,° ~ ~ o o w ~ ..,:
c~ o a -d ~ ~: ' i o : a. ~°
'b~~ ~ , oo ,~~' > :: Oc ~s ~ ~ o o ~ ~~ ~ .c ~= o°~; ~
a. e°p ~ v '~ ~ a '~ .n '~ an a ~ c a >, a~ ~ a ~ ~ a a o ~: .~ ~ o .. G b ~ b ~,.~ v ~ ~ o a~ .a eooo. N.N ~ E'°'a_ o ~ ~ o "~° ~
U
a"0.. ~ ~ ~ O ~ ~' a ~ O O. C .~ >p', ~ 'J O '~ ~ 'H N
O O _~ p ~ ~ ~ U ~ ~ b 4-. .~ ~ ~ 'a~:0. ~ ~ ~ ~ (n c'~a N ~~ Q ~ ~ O V ' ~ p ~ v ~ N .s:. O a ' .a F, a ~,.~N ~E~ H a ~ o:=,~a a ~ 8 ~~ '°d.ra ~ as O~ v a~ ,", N
~ °""~ o on ~ ~.., '-' ~ e°'p'~. ~, a ~ ~ > a°_~, o E :~
cs °' O' ~'' U ~'-' '~_ ~ ~ U o~ ~T~ ~ en~° ~va.a aH
p, ~ i-v y '~ N p '.' H y," C U ." a .,.U., ~ .Y'~ O b ~ p O O ~ O w O P. ~O ~ .~ oo a~ r,.., ~~ ~ ~ O m ~ F., 'Ci N ~ 'C1 ~ ~ ~~, ~ '~ O
O" b0 O "C1 . ~ ~ ~ '~ O O
'O~D~ l_~ ar.a a~'' ~bCN"U.,U ~avO~~C~7 v W
a~.O~ObA.~~.,00 , a ~V r..l~OV~ U A~~"~~~U~M~O
Q ~' O~ V (~ ~f"'.' ~ 7~ G "'~pOp ~ O".~V' O ~ ~ N ~ ,.Vr ~; 00Q ~
.c '~ b ~ ~ '~ a-~ ~'~ U ~ °- '~ ~' ~y ~ V '-'on "~ U v >' U -~ ~ ~ o a ~ ~ ~ ~ 'C "° ~ Q ~ ,~ " ~ ~ r M ~ 4., ~~o ~~~p "_. ~;~.:;~,~r.a ~,w,~ ~ ~y ~ 0D~ iti ~ V ~ bp~".
O Z y-i N V ~ ~ ~ ~ H ' ~ ~, .D N N ~ O ~N ~.~. ~ ~ v iV 'm m~.d ~,W'.~~~ ~ ~~ ~ a ;° ~ ~C4W ~ ~~ ~-~ ~C4 a~aopA'C~ v a i o v _a~ ~ ~ " a ,-, a~ C7 a 'n ø' a N °' '' ~ ~ >~ ~ ~ .~ a o ~ ~1 ~ ~ " a. O a~ ~ o H OO~r~v~~ 'rUO~ d~ ~~aaOW.id'~ ~~N~~~O VNi.3a V7 .C U cd ~ M wr ~ ~, '~ ~ +. .a C~ HU p ~ U V .,.~ ~ U 'C 'y G4 E~ o'~o W ~ H a, H o ct7 ~ ~-~~ ~ i ~' W o 'C ~ ~ U W Gt. o ~ ~ U ~ ...07 ~
., + p+, w Ca Q ~v ° a O N ~ N ~ ~ H
N
N ' ~ a ~ U by ~ N .j"r t~C~~fnO OcaO TO

ctf fir' of i~ _O .~7 '~ ~ .~ c~ y .~ O, k1 N N y f. ~ O
FZI O U c0 0. ld ~ 'r N
y ~ k_~ aC M a' ~ ~ CL
U" G. U A v~ ~ ,~ ,~ C7 ~n Pte, Q
d z C7 ° on a ~ ~ ~° A ~ $

~z x~

f# 00 N t~ M et 01 CT V7 M ~ v7 n Ov O~ p ~ 0N0 O Y1 O h a~0 N ~n O v1 v~ b X

o ' ' -G . ~ . i p '~ c, ..U. ~ ~ N a7 O ~ O V N ~ % ,~ ~ v w O
p ~ ~ V V1 ~,~,, ~O ~ CS ~ ..
p N ~ ~' V z ~-~ b ~ U '~~f ~ ~ ~ ~ ,1,~ V ~ ~d ~ ~1 y .D ~ ~ ~ cct O G ~~: V 4r '~ N O O O G ~ ~ p b ~
i o ~ av ° ~ o ~ o a "~ ~ v ~ '~ ~ ~ ~ ~ °' :: ~ v ...
a~ "~o~ 0~~..:~a~pQ'~,~ra~cM
F.' ~ ~ C ~ V .-V. ~ ~ W ~ 'r N ~ N ~ O et cV0 i ~ o .o o ~ " ~ N ~ ~ w ~ ~ c A. ~ a. U " ~; ~ ov °., o~~~c°~~en.5e°'n.5~o -c'E.v$ -~.°. ~ ~.~ ~; A ~ ~ ~ ~ ~ 'da 'da ~ o~
.n o a ~n ~' .~: o hi ° on u~ V a .d a~
o v~ b o ~ v V _o '~ o ~~ ~ ~ Z o0 ~ o- ~ sa. ?, a. a> CS ~ o :a ~ ~ ° "- o ~ o t~~- N a .q '.~ U ~ c o a ~ w ~ ~ 4.'°, N C O N a o5 '~ ° ~ a ~ ~ N N a m a . ~ b°D O b°8 O
M v~ o r a~ ~ .y~' ~ ~ ~ ~ ~ 0 0 0 0 'o ca p, °~ p, ~ o. ar .: ~ °~' o o goo NA ~'.c°w' Vdo ~'~ oo~.~a ~s°~-~"'N.c°-.v'~'V
O '~ ~ ~ ;? H o0 °' ~ L.~ O ~ °v p p >' ~' O >, >, p V ~ ~
o U
m ~~ ~ o ~~ oo ~~ oU 'H ~.. ~ o-°~a o.'~~n ~ ~
e, o: O .C r.. a. w ~ ~.. ,~, .,. a, ~ V a N V a N C v °~ d, ~
w .°f, ~ ° h p .~ ~ ~ .~T".' F ~j '~ ~ ~; VM ~ O ~ ~
01 T,~ N O ~ ,~~. ~ ~, V O _°. d O~ Q ~ Ov O G G ,.~, Y~1 O ,.~., 1 Pi w Y" ~ ~ ~ ~p M A" N -~ ~ ~ ~~ ~~ O M ~~O h ~ ~ ~ l~ .L'. ~ ~ V V
O .. f, ~, ~ .-1 ~".a O ~ V
d Y'TC,~~F",.~~.-~~,a>~ 3~~ ~~'P'~t".at....~P.Nr~0.N,~~~ H
~-o ~ ~~o ~~ ~~ o d ~Na~ ~~'' ~'n~ ~~~ v~ ~a a °'~
b ~ . a~ o fs, . ~$ a~ ,r ~ ~ o ~, o ~ G ~; .~ ~: V V
-o .sy2 ~e _ ~o ~ N ~ .~ a~ o . ~ o i.. as v, v, o .~ .o a m ~ o~ wo ~ o Q, G . ~ U_ Q ~ ~ O t~ . V cC v w O. n.. V H '~ N
~ ~1 .a aVa bp~p (~ C> O.i C. ~ ~ z ~~.r v ~ by ..~., ,"~ C> ~ i~ m dN' C%~
'V0 DO VI 'VG ~ W O ~ b0 c-a~
a>
7, v c-~d ~ ~ N
b 'C H
V 0.
H
a ~ .~ a ~ ~, a b O $ ° ~ x ° ~ ~ ~' ~ o ao ~, ° a:o N ~~a~n?
° :a ~ g ~ '~ ~° ~i ~o . ~ .i., W ~ '° C7 w ;~ Q C7 '° Q
CJ

as W
Z x ~ 2 U Q °' du ~ z ~c Ch ~ a ~ ~ ° ~ ~'' p ~° ° ~ o :° en on b '....° ~ a.
x b d O
.., _ EQ o~ M ~ Ov N Ov n ~ ~ 01 t~ v~
N ~n ~O
O M d. ~O ~_~ M_ O ~ O~ N O~
H n 000 DD 00 0N0 ONO O~C O~O
x x x x x ~ x WO Oi/66573 PCT/IB00/02035 c ,.., o, ' ' > , >, _ 5 S .5 ~ S '~"a ., O\

" o . ~ C . . . c V C

~ O O :
~OQ'~ ~ y U U U U U U ~
~ O O O O

,p O ~ ~ O

O O ~ O O O
O

O ~ U v ~ ~ ~ V a O
~ ~ ~ ~ p p p p p p ';
~ ~

.4: vN1 w ' ' ' ' ' ' O V ~G O U ( V V U U a y '.~ OU
~ N
>

, U ~ ~ ~ ~
~

_ ~
N

~, ~ ~. ~ dp bIl b4 b0 OD b0 O
~ ~ H-~i ~ 4-i 4: 4-P 4.i ~

U ~~ ~ ~ ~ ~ ~ ~ ~ ~ U
~ ~ O O O O O O
O

N r. ~ O ' ~ ~ ~C~ ~ ~
N ~ ~ ' ~ ~
G

, ~ y.~ t, , y, y, O cvY U N N U N a) N D
~ O W m ~ N W W O
~ U U ~ O

W ~ ~U ~ t NN c VN ~'~ ~v~ ~
O ~' CN N C~ ( y N
y N N

" O U O .O . .fl .C .a .a c (C N N ~ N N ~ 0 . U ~ V! f/1 V1 N N O
1.' 6 c ~.o ~'o ~'o ~,o ~o ~o a ~-o a . v ' " , ~ OU OU OU OU OU OU o 3U ~.~,~ U

~ ~" ~n U U U U U U U
an- ~ ~ ~ ~ ~ ~

'L~ ~ r' O O O O O O O
~ ~ U ~ ~ w ~ ~ ~ O
~ t ~
~ ~
"
N

N ' .. ~I ~r' ~.a ~r' ~.i ~ ~+
~ ~ . U U U U U U ~
~ U
U

( F. .
~b ~i.~H ~ ~ ~ w ., ~ ~ ~ ~ i a~ on ~ a~ a~ a~ a~ a~ a~ a~
~ .~rs U a, ~ ~ ~ ~ ~ ~ c ~ .~ v~ r-. ....
~p v~ H

O U " (7 O TJ O O 'l O O
~ ~ N 'b n 'O 'L 7 'cJ
U ~ n n f n n ' n ~ v ' O~~ OcOV~O~~ ~ p Ot~V~~m L ~ ~~ O~~ O~~
, iCy0~"t~

s '...1r'y ~ ~ (y, ..N.,~,'y,(y Q, . . ,.U.. ~ ...~.,...N.,~ : ...~...,.N., . ~, ~ ~ ~ ~
O ~

n1 ' U Vl ~ " H H " "
U a V7 (A a v Vl T' a v " 'I

- ~. v " . . " , . .
.~ ~ o . ~ ?, . , >. as 00 v .~ ov ~ ~, . ~
ov ~ ~, ~

a) ~ ~ ~ is at ic! is iO is ~ N cd ~ ~ id ~ ~
~ O O O O O O

-o ~ ~ i a c~ o~ ~~ ~~ ~~

a~ ~~-.N N ~ ~ ca cd ~ ~ U
O m h h h h h h ~
'~ ~_ ~ ~ ~ ~ ~ ~

n ~ V V ~ ~ N
~ ~

it F." ~ ~ V ~ N V V V N
O N O d N ~; ~ N ~
N Q, ~ ~ N ~ N
' J ~
~ ~

tw ~ v A ~ ~ . c'"0 . . ~ ~
.L h O c~0 O ~ cue O 'Cy ~ ~ V O ~t O NV ~
4-~ d' ch N~
.C "

C/~ ~ .-. Pr Pr ~ (y, C1r C1r 13a .O O ~ ~.' ~" ,~"~ '~ '~" ~". c m O. ~ .-. .-~ " .-. C
.-.

U N
b x a~

z ~

U
z ~

O ~ N 'V' h ~"~ c w ~,' w w w w i "' .tea x A ~ ~
~F~~ ~ ~ ~ ~ ~
~ H
' "
~

sn Eo o ~ ~ ' c ~
~

W a, Ilk y ~ Y ~ Y V Y
(~ ~
~ O
~

p y U ~ ~, ~,, O O O O O O O
J ~.~. ~ ~ ~
v U d on w d a, a, r a, w r ~s U ~

ca w~ ~o ~ z x o _ N 0~0 h h h h h ~ ~D b _ O~ O~ O O O O O O O
~D

~ G ~S ~G

C d ~C ~C ~C ~C ~C ~S ~C ~

b ~ ~N ~
C ~ p dD h0 00 d0 00 00 .'~'a .~"a .'~'a' .~ N V ~ '-' G1 y GO ~ p ~ p ~ p ~ ~ O ~ M ld O ~ O ~~:
U O U O U O U ~ U O U O ~ ~ U N ~ ~ j3,, :o ~ .o ~ :.o ~ :.o ~ :.a w '~ '~ o N w .~ ~ 4°.~ ~ " ~ w v O O O O v O v O o ~ ~o ~' N O '~ ' ~ ~ ~ ~ ø.
U ~~., V ~~ V ~~, V ~~., V ~~, V p ~ O ~ n .,N~ U ~ f1. V ~_~ A
a.~. ~ .,.~ ~ ~~ .U 'in ~ ~ ?, d "" ~ ~ U H
ou 4: ao a ; en 4.; ~0 4: on 4.: oW : '~ c~~o "~'. '.'~-.s ~ ~
E . ~ ~ .b ~: c ~ ~ ~.F. o i ~ ~ N i ~ i ~ i ~ i ~ E c ° ° ° ~N'~'~~
.r ° .r a ~ .-. a .~ a .r a ~ v ~ w 3 '~:, U N U ~ ~'' ~ U N U H U N U ,a ~ C,' v ,f1 ~ O ~." aU-n .~~"' N
y .G N ~ N. .O N .G N .O y -U N C. U N U
N VJ N N N Vl N N N VJ E~ N ~ V O y ~ N ~" ,y.,~. C ~ 'N :-r 'L" fr' r-r C"r C, Cr .~'.~ C L." C G C ~ '.~ Sir ~ ~ (~ O ~ U (O
~o ~.o ~,o ~o ~,o o ~~ ~ ~,~ ~.~ o, N ~ >
U U U U U ~ U
U ~ U ~ U ~ U ~ U ° U '~,° 'v a ~ ~ ~ ~ ~ ~ o .., ~ bn ~w° ~~° 84° ~w° ~w Ew° ~ o ","n.°
~.D~ a.,Uovo..°~' ~a v ~ v. ~"'.or v ~'"r U O U
w ; o o .~. U ~ ..o '~ a a. ~ a a~ ~ u, ~ a~ ~ a~ a~ a~ ~ a~ a~ '.:. ~ ~o a~ ~ o ,~ ~? ~ N a~7 a~
i~ N 1J NJ a> V7 w N 1.n V) fr N U O~ C ~ ~. U Lw o.b o.a o.a...°.a..ow.~ow.~~'~o~ o~~° ~~, ~3 o a~
o X06, o ~~ o ~~ o ~a o ~o~. o ~~u~ vv~°.? ~'~ ° a ~ x~ n,~
r.. N C~ ~ OW"' [n p~ ~"' ~ ~ ~" ~ ~ r.. N ~ " . N M o O4 ~ -O ~'p ~,f~ 0 00 ~
CO
p, ~in v ~ 'm ~-~ f1" ~N .-n P, ~N d, ~N P, ~N O~ m ~, ~ ~ ~ N Q ~ A 'Ly ~s v. ~.. ~ ~ V-.
as O icf ~ O is ~ O iti ~ O is ~ O at ~ O ~ ~~ ' O iC N
~~ a ~ a~ ~~ ; ~~ i c~o~ ~ ~~ a' ;° °' ~ ~~r'"a ~ N "U
a> M '~ a~ C ~ a a 'c~3~ ~dt~ c~ ~c~ ~t~ ~~~ ~'~ °' ~~ ~' ~ o i.~, ~ U N ~ U N ~ v N ~ ~ N ~ U N ~ v N 4j .O O x N ~ ~ O N ~ O "D x 4., P4 a. E .-. A, ~ .-. a, ~ .-~ w ~ -. a, ~ .~ w ~ .. 'v~ ~ N a. U o a. w .p >
w~ ~ v~ ~

a a, .5 N
O O O ~ ~ '~ O U
wwwa~',au""w~ ø' ,°

CI ~ ~ a ~ ~ ~ ~' ~ a.
w ~ ~ ~ ~ ~ ~ x b ~ ~ ~ ~ ~ ~ ~ o 0 a v d ~ ~ ~ CL cV
y o 0 o O O O ~~ ,~ d _~
y O O O O O O
CJ a ~i. c~ w a~ w~ d C7 .a °~.' ri, .c 7, k a, y.
G7 ~ s~ o ,~ a.

z xa C~ ~V! M 'd' V1 \O l~ 00 M ~ 01 . .~ O
v! ~O ~O v0 v0 ~O v0 r, ..-y' t1 00 C7 M M M (~t M M V1 V1 ~O ~ V1 v O O O O O O M M ~n ~O ~D
a a Q. c. o~ o, o, o~ o, a, o. o, x ~ ~t ~ x ~ x c ~ N ~ a ~ ~_e°uno ~ ~ ~ C5 O '~ c0 .~' ~~' .p N N ~
~U~
~. ~~ N ~ " N V U 01 l0 \b0 c0 O O ~, ~ N
°, ao~~a~~,~ ~ .cue ~ o ~ ~ ~~~.~.~ ~a a;~~;~b boo W a.'Cy' d..~2~ ~' G l~r.~, CW r ~' l1v!?pMb 0ppv U ~a~° °~'-'~O apW~athO.pON
;..~., '~ v o~ o ~ 'd o ~, ~ .~t . N ~ o d' " o, ~ ° ~°
>, ~ .c ~ o ~ .>; 8 ~ . M ~ c°e N p U ~ ~ ~ ~ ° 3 ~ .-. p v O ~ H O
~ i;-;f.°t ~'~ l'~" ~ ~o ° ~ ~ U °:,x". oo c~~
'°v°o a) U Ov tH, v U w C N U ~Cj w ccf N ° TJ ~ tn ti.. O
'r 'd b o~0 ° ~ ~ ~ O. ~ ec CL ~ ~ O w ovo ~ ~ y ..: ° v ~
° N
-0 cp'lt ~ ~ R w 'w U W U ~ .G > ~" f.' ~ ~ _O ~ ~ ° ~ O yr ,t~~ C b V ~ ~ m ~ ~ ~ ~ ~ v ~ ~° ~ '" " G4 N ~ _~ ~ p" o°o U o~ ~ ° ~° cr:° °. ~ >~ Of7 P". " g ~ ~
° ... o p a ~ E" N o v ~ °' ~ ~ ° ~ a .~ :o ~ o. 0'10 ,a: ~ :3 ~ 00 ~ ~ o L N ~ '~, H -~,, y ~ U '~ .aY.~ ° V ~ v ~ p ° G ',:, ~1 U .O ~ ~ O ~ ° ..Z; ,~., i~ N ~n O 'v .~ t0 G ~ a G 'O ~'~ >-~-. V U N ~ ~ . ty, ~, .O H C1 i I '~' '4 ~ ~~ ° ?: ~1 z ~> ° et ~ G ~L ~ h ~, ~ y ° ~
~" ~ 0' a Z ~~ ~~o_, ~ i~~~.5,°~ ~a~Q.c~~" °U a,o v b is v ',,., ° ~ ' O o_, ~ ~,., '-' a p.; ~ °..-~'' ° .
.~ N v . ~~ is w ° ~ ' fil N 4i ~ ~", :'.O ~ ~ a ~ ° ~ ~ ' 're '~"' ~", v cC O. t°r~ T! ~ Y
" ~ °~. ~ G°7 U ~.Ur e.~ Wea ,>, °~ ~~,.j °op.~ °N a, ~ ° ~ ~.o ° ~vi ° ~ o.~ a~a ~i ::. .:. o o ~ ~ '~ :a .r' '.' U ~ " ° ~ p~ p .1~ ~ := ~ '~~' ' ~ ~w, +xU~ ~ O ~
.~U~ ~~ ''per' O~.I fy. Nv~-. Or.~,b.v..,~,v~PU,Uvx O~pr bpV Pr ~~P, b0~ vP~ t~ OQ
'~ ~ hi .O
N N c~a ~~ WO ,~
O ~0 ~~ ,.~.. ,~" aU..
O ..f~'. N of ~ G.
e~ cpd b 'c~ c'nv ~ia O ~aW' o o Ca ° o a~ .5 0 ° .n a >.
o v~ ~ wu ao ~ o °' ~ ~, .~ ~ .x ~ Q. a, ~ .'~ .d c~~o G. o a a '° ~ ',~
ii ~ ~ c~°a x ~~, r -bT ~'~:d.~ ~ ~ ~ a v c w ~, ~ ~a ~ a>! ~ : : ..-. .~ ~ _6 C ~~ ~~ ~ ~H ~ tUV .s V ~~ U >, ~ V
~ C ~..' r' o ~ a~
as .~ ao o p ~ o o a~ Z o :5 0 0 ~ U a o ~ ~1 :~ °~.' ~ > ° ~ .o ~c~ ~w x ~~ x xx ~a~ ~x ~ M a w N
A
o b O
Q ~ '~ ~ °
'~ ,~ s a b O
0°~O _~1' v1 ~ d' ~ ~ t'~ ~ M
O ~ O O O O O ~ ..N., w m x .n °
a.
m x ..
m '~ o. w y ~, °
.~.~ G o '~ c~ p~ C N ~.m., p~" N ~ m m ~ d ~ _~ w ai ~ ~ ~ o"o m w ~ ,.. 00 d ~ r.~ v ~ ° ~ N .b °~
d0 00 d' Ov O ~ (~ U tn 4. Cv , y TJ , N ~ ?v a°~ a.v°~ N ~ b ~ ~ ~ N
m CS t~ m m G '~ M ~D
~D AO ~ ~ ~ i ~~,~-~~.7 c n'~~~ °' ~'~.-. .'Y~'~~ >,~ aup u'j ~U .~3 0 m ~ ~ ~ ~', ~ : C O .o ~~.° a.o m y°o .5 ~ ~~G °~o~o codQ
a r ~ ,o m ~ ~~ ~ ~ ~ ~ 00 o~_~~ a a~~~ .~ o a m '~~ wmGnc~a a:b ~o N °'~ °° .~ o a' .n ~ .~u - °° °' '~, nmo ~ ~ a. ~ o aa~n o a. o ~ ~ ~ a is m m m m m v .n ~ v H v m m rc~ N ~ t~ " .. ~$ ,o ~ ~ ~ o ~ G ~ k 01 ~' LU~, U ~ iv ~ ° m H ~ ° c~'V ~ w tU0 o t1 "O m m o, ."~~' y ~ m o c m . 6 C .~ ,# 0. m w m ~ ~ C dD m N f. ,~ C 'in ~ ~ E ~ ADD ~ .d ~ m ~'3 'H ~ .~ ~ 'H G ~ w ° .~ ° o ~ ~° im. G 3 .-~,. W ~ ~ G,~ C ~ ~ .Wa ~
° p m m ° m a .-. M d, m ° m ,. a ;, 'C .r ~ o ~ °~ o Q" °'m ~a ~~_a.m aoa, ~ a ~ '° m ~ r:~ a y _°° ,n C
~ ammo ~ a ~ ~ ~ _ o v~ r: ~; ~ c ,., N - U ' ~ ~" - .U V , .w a c ~ ° . ,ay ~ G ,,you, N Y ~~ ,mo m m as is _~ ~ ' pq °' ~m ~o m aW a~ o a ~~ o r Q ~ ,~m~ ~ ~ ~m-, ~ m .a v m ~ ~ . c ° ~
do ~? m ~-, ~ ~ a ~ m a cue, ~ °w ~ ~.~ ~ ~~ a. ~'~ ~°~ ~ ~~ cd'~
y -° o H ~."~ ~ a .~°'. a '> .d ~ a ~ .~ o :...~ '> ai '~ o ".~
omo.:.J ~
y ° U O ~,0,, OOp N ~ Q .,~..y ~ ~'.-~' ~ t0 i.., bA U ~ Lm. ~ CD V ~
° m ~ ~~ O.
Qi ~ ~ ~' .~ O ~ O,' W P, 0.7 '.ms's m ~ a'~3. O ~ v-, O Q7 b0 0 ~ v, U '~ ..-~ ° ,.m...
m ,n O
m d, O
.a m ~ ~ O
M pp m ~ ~ °' a m on ~ b ° '~ .a o o a ° ~ ~ ~ o~oo x~
~, m m y O m ~ N ~.,' ~ a' ~ ai °_' U ~, .~ ~ i c ~ m e1 ~o ~ ~ ,~ .~ .o ° ~ ~ ~o Q m ~ o ~ ~ ~ '> p.
o .. ~ ~ ~a ~ N ~ ~ -~ '° ~ ~ 'v g m c~. O ~ a. m ca ~ , ~ m ~ 5 '~ m ~ ~' :~ .~ ~- ebb ~ m ~i ~ ° ,~ T ° ° G 4~ 'vi ~1 P.
p V' C7 A ~ Q 'v A '-~o E~-~ C7 ~ U ~~ a. ~."
c °
.. >
a b x m ,.47., N
0. p, a A b c~ ~ ~. ~ .~ .~ ~° w ~ ~

~z m a ,o " .. N °v ,..
o ~°n v°~ ~ n oNO oNO oNO vM, p v rwo 00 ,~ °wo ov ov °, ~o v v .. ... .-.
U" ~f,' ?~ ~ ?~ t~ N N N N N N N
1~~

TABLE 3. Corynebacterium and Brevibacterium Strains Which May be Used in the Practice of the Invention Genus species ATCC FEIiM-NIitRI.CEC_T~1G_IMB; NCTCIDSMZ-ASS

Brevibacteriumammoniagenes21054 Brevibacteriumammoniagenes19350 Brevibacteriumammoniagenes19351 Brevibacteriumammoniagenes19352 Brevibacteriumammoniagenes19353 Brevibacteriumammoniagenes.19354 Brevibacteriumammoniagenes19355 Brevibacteriumammoniagenes19356 Brevibacteriumammoniagenes21055 Brevibacteriumammoniagenes21077 Brevibacteriumammoniagenes21553 Brevibacteriumammoniagenes21580 Brevibacteriumammoniagenes39101 .

Brevibacteriumbutanicum 21196 Brevibacteriumdivaricatum21792 P928 Brevibacteriumflavum 21474 Brevibacteriumflawm 21129 Brevibacteriumflawm 21518 Brevibacteriumflawm B11474 Brevibacteriumflavum B11472 Brevibacteriumflavum 21127 Brevibacteriumflavum 21128 Brevibacteriumflavum 21427 Brevibacteriumflavum 21475 Brevibacteriumflawm 21517 Brevibacteriumflawm 21528 Brevibacteriumflawm 21529 Brevibacteriumflavum B11477 Brevibacteriumflawm B11478 Brevibacteriumflawm 21127 Brevibacteriumflavum B11474 Brevibacteriumhealii 15527 Brevibacteriumketoglutamicum21004 Brevibacteriumketoglutamicum21089 Brevibacteriumketosoreductum21914 Brevibacteriumlactofermentum 7p Brevibacteriumlactofermentum 74 Brevibacteriumlactofermentum 77 Brevibacteriutnlactofermentum21798 Brevibacteriumlactofermentum21799 Brevibacteritunlactofermentum21800 ' Brevibacteriumlactofermentum21801 Brevibacteriumlactofermentum B11470 ~Brevibacteriumlactofermentum~ ~ 811471 ~ ~

Genus species ~TCC FERM NR.RLCELTC13YIB'.. ' DSMZr ~ . ' N CBS: NCTC

Brevibacteriumlactofermentum2108 6 Brevibacteriumlactofermentum21420 Brevibacteriumlactofermentum21086 Brevibacteriumlactofermentum31269 Brevibacteriumlinens 9174 Brevibacteriumlinens 19391 Brevibacteriumlinens 8377 Brevibacteriumpaiaffmolyticum ~ 11160 Brevibacteriumspec. 717.73 Brevibacteriumspec. 717.73 Brevibacteriumspec. t4604 Brevibacteriumspec. 21860 Brevibacteriumspec. 21864 Brevibacteriumspec. 21865 Brevibacteriumspec. 21866 Brevibacteriumspec. 19240 Corynebacteriumacetoacidophilum21476 Corynebacteriumacetoacidophilum13870 Corynebacteriumacetoglutamicum 811473 Corynebacteriumacetoglutamicum B11475 Corynebacteriumacetogiutamicum15806 Corynebacteriumacetoglutamicum21491 Corynebacteriumacetoglutamicum31270 Corynebacteriurnacetophilum B3671 Corynebacteriurnammoniagenes6872 2399 Corynebacteriumammoniagenes15511 Corynebacteriumfujiokense21496 Coryn~acteriumglutamicum14067 . , Corynebacteriumglutamicum3913?

Corynebacteriumglutamicum21254 Corynebacteriumglutamicum21255 Corynebacteriumlutamicum 31830 g Corynebacteriumlutamicum 13032 g Corynebacteriumlutamicum 14305 g Corynebacteriumlutamicum 15455 g Corynebacteriumlutamicum 13058 g Corynebacteriumlutamicum 13059 _ g Corynebacteriumlutamicum 13060 g Corynebacteriumlutamicum 21492 g Corynebacteriumlutamicum 21513 g Corynebacteriumlutamicum 21526 g Corynebacteriumlutamicum 21543 g Corynebacteriumlutamicum 13287 g Corynebadenumlutamicum 21851 g Coryaebacteriumlutamicum 21253 g Corynebacteriumlutamicum 21514 g ~Corynebacteriumlutamicutn21516 ' , g Corynebacteriumlutamicum 21299 g Genns': ~ -. A,TCC F)4ltMKRRI,CE NCIMBCBS NCTCDSMZ
' . :

Cotynebacteriumglutamicum21300 Corynebacteriumglutamicum39684 Corynebacteriumglutamicum21488 Corynebacteriumglutamicum21649 Corynebacteriumglutamicum21650 Corynebacteriumglutamicum19223 Corynebacteriumglutamicum13869 Corynebacteriumglutamicum21157 Corynebacteriumglutamicum21158 Corynebacteriumglutamicum21159 Corynebacteriumglutamicum21355 Corynebacteriumglutamicum31808 Corynebacteriumglutamicum21674 .

Corynebacteriumglutamicum21562 Corynebacteriumglutamicum21563 Corynebacteriumglutamicum21564 Corynebacteriumglutamicum21565 Cotynebacteriumglutamicum21566 , Corynebacteriumglutamicum21567 Coryuebacteriumglutamicum21568 Carynebacteriumglutamicum21569 Corynebacteriumglutamicum21570 Corynebacteriurnglutamicum21571 Corynebacteriumglutamicum21572 Corynebacteriumglutatnicum21573 Corynebacteriumglutamicum21579 Corynebacteriurnglutamicum19049 Corynebacteriumglutamicum19050 , Corynebacteriumglutamicum19051 Corynebacteriumglutamicum19052 Corynebacteriumglutamicum19053 Corynebacteriumglutamicum19054 Corynebacteriumglutamicum19055 Corynebacteriumglutamicum19056 .
Corynebaderiumglutamicum19057 Corynebacteriumlutamicum 19058 g lutamicum 19059 Corynebacterium g Corynebacteriumlutamicum 19060 g Corynebacteriumlutamicum 19185 g Corynebacteriumlutamicum 13286 g lutamicam 21 .
Corynebacterium S
g 15 Corynebacteriumlutatnicum21527 g lutattiicura21544 Coryuebacterium g Corynebacteriumlutamicum 21492 g lutamicum 88183 Corynebacterium.
g Corynebaeteriumlutamicum B
g lutamicum - g Corynebactetium 1 g g2 ~Corynebacteriumlutamicum 812417 ~g 1 Oenns ~_ species ATCC PERM NRifLEG"TNCnYIBCBS NCTC~DSMZther . . . ,. C O . ~ _ ~
. : . " ~ , -; . ~ ~ _ - ~ w o ' ur Corynebacteriumglutamicum~ ~ B12418 Corynebacteriumglutamicum B11476 Corynebacteriumglutamicum21608 Corynebacteriumlilium P973 Coryne acteriumnitrilophilus21419 11594 Corynebacteriumspec. P4445 Corynebacteriumspec. P4446 Corynebacterittmspec. 31088 Corynebacteriumspec. 31089 Corynebacteriumspec. 31090 Carynebacteriumspec. 31090 Corynebacteriumspec. 31090 Corynebacterittmspec. 15954 20145 Corynebacteritunspec. 21857' .

Corynebacteriumspec. 21862 Corynebacteriumspec. 21863 CorynebacteriumGlutamicum* ' AS019 CorynebacteriumGlutamicum** "' . AS019 ' E12 CorynebacteriumGlutamicum*# HL457 CorynebacteriumGlutamicum**** I-IL,459 Corynebacteriumherculis ATCC: American Type Culture Collection, Rockville, MD, USA
FERM: Fermentation Research Institute, Chiba, Japan NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL, USA
CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK
CBS: Centraalbureau voor Schimmelcultures, Baarn, NL
NCTC: National Collection of Type Cultures, London, UK
DSMZ: Deutsche Sammlung von Ml7QOOrganismen and Zellkulturen, Braunschweig, Germany For refotence soe Sugawara, H. et al. ( 1993) World directory of collections of cultures of microorganisms: Bacteria, fungi and yeasts (4'~ edn), World federation for culture collections world data center on microorganisms, Saimata, Japen. ' * Spontaneous rifampin-resistant mutant of C gJutamicum ATCC13059°Yoshihama et a!., 1985 ** Restriction-deficient variant of AS019 Follettie et aG, i993 * * * meJC-disrupted mutant of AS019E12 This study **** matC-0isruptedmutantofAS0t9E12 This study n co r>

mm m = m m =

v- w 4 U o~ a~ ~ o~ m o>
m > o> ' ~
? cvi ~ ~ 4 U

> ? 0 po~ ~ ~ ~za d n~
~' d d , ~

G r N O ~ U N ~ ~ ~ 9 N N
G N O r N N (' o N N
N

O

O
E ,~ co o~o~ n - u~ ~ ~ N m W ~ W a~ r rn m .-r t N 0 W O I~ (D N r N N
~ N 7 ~ ~O c0 I~
~ _ M

a O N N 07 n 10 10 O t0 O O
Q V' ~ O M N ~ V V ~
o V' c~ M c0 l0 t9 of OWE .t O
v' ao vu <t M

E E '-'~ ~ ~ ' m ~

t _ . E E Y m _ U

~ m ~ ? o, o, m d E
m C ~ > O1Of O O .O 'O
> N E E m m ' E

Q m ? _ a~ _ ~ m v, m .~ ~ ~o .~ g $ "' E a~ E .
m o ~ ~ m E c ~ a'> m v E ~ m ao .
~

m m ~ o ~ ~ ~3 N ~
~ ~ ' ~

d m d 3 a -c . H m ~ ~ n m 3 a' o m m ~ o a, a c o 0 o 0 0 0 3 ~ U ~ Y U O o m ~ Y E E
8 ~ U U E E
~ O V
~

O K~ J U p ~ ~..- U ~S Z 2 J a ~
L LWZ
D

N ~ L Z( (J

~a ~
~ m U U

m m W m ~ U U
U U

v ~ ~ ci ~ z z a a cn ~ n m ~ ~ ~= '"

ca Q 4 ~ cVw O' w w ' m p _ f~ ~ N 01 Q d O
D n O. ~
"' N O n ~ N m m N w w c p N- p a I ar tn tn U m u1 U
~ c 'm E E Z Z _ ~ a.
S 7 ~ m o.
M~ U' c y M M p r W
w N m (~ O (~ ~
d ~ ' ~ C
~ ~

m ~ i U y v. ~ ao lNtltNL
E . ~ , Fw-c ~

v 0 0 aw~ ~ ~ Uw UUZJ ooov~ - v v I

~ a ~ ~ I
I

N ~ m d m m ti O L N ai ai ai ~ m w m w Z ~ U ~ U U
m rn ao d o.
~? .t O a~ m L ~

$ m m 'aW om mo.o m Y v~mt~
c ~ N V U~ W Q = ~
~m f ~ G =
p, d c0 O ~ m m ~ . m 7 7 ~ ~ E N C
7 ~ n = aG
~ ~
o L

N J, .r m Q V V
m m a O ~~ ~ ~ ~ m m r p C
J ~
E N O
T
m Oj 3 > O C C
j~V o 3 .n ~~vom ~E~~ E E
o n~ ~ ~o c v < U ~ c ~ .
U

m ~ o c o ~ = m ~ : r' r' o T = a $ ~ ch ~

= U c ~ c a, ~ m ~ m m a rL ~ Q m ~ ~ c m ~
~
~

~ m N ~ O N 10 ~ C d 'C E E
0. N m L m m U C o o a1 O 'm W O I ~ t E ~ E
H ~ 4' a m ~ o . m uJ U y U a a NH% m rn~o' pn ov~
m ~~Ct~IH ~Ol~a v Q
dmy d - (M =
E
.
~

~ a a E v ~ ~ Y Y ~ t ~ Q
~ W ~ ~ ~ U ~I o' m ~
Q rn ' Q
~
a =

o ~ m E o m m _ I r E ~ a cr3 ~ a m tb ~ E U' U' E m o- ~ o ~ ' m ~
E p ~

, E v ~ c m a E Q p ,~ H
o m ~ o E ~ " O O
E ,~ rn. ~ U c c c ~ a E ~ ' c ~ 0: ~
' Z

_ n m .r E c m- c r Q a ~ D Q c~ ~ m ~ ~ F~ a t1 n ' m ~ w _~ U
D ~ c 'a cu a't C O L V V '~ m (C N
~ ,CQ E E N Q m l0 i5 E y O
N m W
m m 7~0 7 ~m~pr_~a N~O O O
S N pM r-OM O O O
Z' O ~ ~ ~ ~
~ O O O
M

J m N N ~' M d O
z te N ~ N m ~ ~
' J ~ ~ ~
g a w m tn I1 O o ~ w w ~ c~ 2 z ~ a o D c m E Z z ?
c o w a a, a, N N n ~o n n o n n o _ _ N ~ ~ N M ~ h m N M~ r ' N ~ ~ ~o O ~ W b m O O O
po N O M O
(p O

a ~ ~ o U ~ N w Ii U U
u. u .- ~ ~
~ U U
m a Q i p w a a 7 a a a a G
a Q a ~
Q

~ ~ ~ n o m o 0 ~ ' (h M r n N V' N V O O
V 00 ~ aD V' V' r n a~
w O n ~
a0 4' '' 7 ~ th _ O O n to ~1' 107 ~ W T ~
N t0 ~ m N (O
N N ~- ~ n '-V l~

~ ~ n n n N N m O a0 ~ ~ N ~ h h o tp a0 t0 n ~
J n tD

O ~ ~ N t0 ~ M 00 OD
N M
o _ n O ,no U j < ~ U U
Q U ~
cn U
Q

M ~ 1J
N

I -.~ ~ F- C~
a~ Ww a i- C z mmm a am =

.o n w m as I II I . I I ~ I I I I I
m I I I I I
I I I

mmmm m ~ mmmm m mmmm m mm m m c~ c~ w c~ c~ c~ c~ c~ c~ t~ c~
c~ C~ c~ C~ c~
c~ c~ C~
c~

.r rn o as W n o,~~~ yr mn n m 0o a~ m m r' ~ ° h m m ~ ao co ° o °°r' a~ o~ ~' o~ o~ o~ o> o~ ~ rn M w a~ o> V o~ o~ U o o~ o~ o~
U U °' ~ ~ ~ ~ U o ~ ~ 'a ~ j n1 5 ~ 11~ ~ Q ~ ~ ~ U
O O o. -,-,'-»O Z ~-~ Q~~O-~-,O tt_~ ~ Q Q O
n a ri ~ tm. ' c~ c~ t~ m oo ~:. th ao n ~ o tb ' ' rn r O W ~- r r r M . N N N '- e- O r '- N r N (O N N r V CO (O CD ~ t0 10 O ~ Q 01 OD h CD f0 Cp f~ 1~
M N N t~ r N ~D N t0 a7 N r N M O) CO m N CO r tn r_ ~ r ~ (h M O 4~ f~ N (D ~ 1n M CO r (D t0 t0 M O f0 M t0 1~ O ~ fD O ~O N V' (D f~ 1~ 00 M M M V ~ M M f0 O7 fp 10 V' fO M M CO t0 10 10 In st M M M
O O O ~ ~O Nm '- ~O O Q O H
7 ~ 7 ~ ~ 7 O C ~ 3 7 O p ~O' ~~~~~ ~ ~~~ (Cpe~ ~dC pE
$ a ~ a a c ~ .G O E ~ ~ a ~C G. ~ U O O!
H ~ ~' ~ ~ 'm c .8 d $ 3 w ~ ~ ?~ a~ ~°' ~~ E c°
'° ° v E~ °'EEEEE~ $E ' '°
a 7 ~ 7 7 W E C c 7 C = C G C c ~ 7J d N E
O '~ .d-. T ~.d.. m C N ,~0, O c ~ GI r N Y O >, N ~- . m 'a 'C. W
'° ~ .n ~°o E °w ~ E t m o m W m ~ m m o E ~ c c m 0 0 ~ a Q a a o ~ a -o n a a .o a a ~ Q a o m a 10 C yL' a m ~ ~ '~f O ~ ~ ~ ~ 7. >. ?. >. H .,05. ~ ~E ~ O O E
U ~O ~cn~W - o ~a .W~~~~a v~~ a~x x o t0 .y.. a0 !O J
jp NE t~ h ~tNO tNOr~ 0.N OoN Cf4 r ~ r _ d r ,O v v N d E~°~ o~~.M-y~0.~~ cn.N-~p ~E y n>_ p Z c c c c o '° c r p ~ O ~ ' m ~ d m d ~ m m a~ d v a $ v E a~ p O
.-pa ~~ ~E ~ ~~ ~. ~V' ~~ ~m rn ~ m vi -~ ~ ~ ~ °~
a Q, L y ~' ~ m. a~ y :_ ~ U % o m ~ ~ m Q ~ i° ~ ~ t Z Z ~
°°
N O~ 'O
c°_-°°c;d°' > o°'oom Uj E EETE ~__~ u~~' ao U C9 ~m c ;p C C C Q
m O ~ 'W ° m d C ~ V1 C C 0i C ~ 9 C ~ ~ 'yp ~ E Z Z ~
uJ w N a~ m m a~ -~ ~ m m d c d y y o ~ c m t U U _ L m a w rn t am oW .n or o~ o ay a o ~ Z 2 L
d W N L~ O d tC y ~ y ~ ~ ~ ~ m '~ $ ~ m U ~ D' ~ ~ O ~ ~ N x W W m m a~ ~ ~ m ' °' ~, 3~ m - .~ o v ~ v d d a~ a~ °' '-' ~ ~a - $ E ~
E
'°~~°a$ O~EaEEo X~ E~3. EE~EQ~Em'" .~cm~~ to t~! Mc .~$ 8 c._vo~ 5 '~ ~ ~ m ~ ~ v c t ~ 3 $ ' E U U V U O Q m ~ $ o_ ~ ~ m a r m E $ m d o H ~ E ~ ~ 3, a a ~ ~ $ ~ ~ ~ 0'. ~''~ o w° m C m ° ~ t0 O L
p 07 O T N f~ h 1~ ~ ~ O ~ 'N V M ('j ~N 7 NU yM ~~(~'~1 O E ~ M W 0! MM gMm'OL H d;0_ ~0 7 1p~_ Efn W E o~~~ Zx~_2.2 y o T Z N ~ x2 NT~~c,? m EU' c'o d,c'S_~p O O
~~11J0-j f=pf%1~E~Nf~6 ~' 'd ~~ NNNHW(O~.L..mO'' ~07~ h n' t W . N ~ V O N O O ~ ~. O ~ O O O O O N ~ C O~ V O O ~
m -E a ~ °~ ~ c ~ ~ $ ~ o tn aW"n m o X ~ -7 7 7 7 ° O !0 T .-.
o u, m m Wo Z x ar .C. d ~ U E ' ' fn N yI O ~ C ~' yV.. ' ' d C L N ~ O h 7 Z Z 01 p 7 7~~C oM~~20m.On.O.00an~ON~Vj~Y~.C~C C ~d ~ U m C E U O .,r Ln . 0I C ~ 'O .~0. d .7C L ~ L~ .~ ~ d N t L O ~ N E O h O
N C Z
IO d m '" N f0 N m 10 T T 10 d d O ° C a~. E O m V U N
~ °' ~ ~ ~° p p m $ a'~ m c m '° o m o ~ c 'm, d ~ $ d o E a. o °°' ~ '° E w ~u ~ v 'n y ~ E Z
.oo'~'°~-°H~E~c~om.Em~E :c,~~WOOEm~mA W W o~o~E
W$'oa~°$o~~~°~=Z
m o m a .$ a a ~ H y, ~ c °~ ~ $ $ o~ n o~ o ° ~ r ,Q~. '° ~ ~o v o 0 0 0 0 $ $ ~ u. n o ro ~° L ° ~ o °' o °' o ~
O ~ N T O d ~ a .x0 ~U, ~ ~O, ~ ~ N O ~ . ~ % L 'd T T O T T N N C v ~ p ~ t ,E ~ O ~ O ~ WL
U.v w E °.m c c~tn~~H$DM~ ~D.v~~~~~~n.$ v mini am.da oix °x 30~
O N ~ O ~ ~ crO m r- ~ N n ~- O
N ~ O ~ n ~ ~ I~ O e- O !N0 r O O r O ~ O~ N h o0 ~ O
m C7 ~ ° ~ rn ° U o ~ ago 00 ~° $ m ~ ao~ ~ u°. ~
U U U
Q . Q N ~ N N ~ Q N J K N t~ Q N J 7 Q < O Q
ao o ~c o ~ m r ~- a o r~ ~ cM~.
O O M~~~N N MM ~ ~~MmCOD ~M
? O M
c~nn ~'ncv~aa°°o c°~n ~chNV v~~~$cmo~ ~'~r' °' r M M n m r _ _ ~ N_ X Z N_ N_ U h mmmm.N b mQ' mmu~'IOmMN OM ~ m O
N nVCJ NnNNO O ~~' NrrNO r _h O O
~ Q I-I-U" ~ IU- IU- ~ FU- m O °~ ° U U U
g -~ ~v,~~~~ m ~,~~, ~~~g~d (UQ ' O ca~5 ~ 'da'. .
H~

aaZ ~_ Q ~
~ ~~ ~~ ~~ ~~ m~ m~ m~ ~~ ~~ ml x~ _~ =I
m mm mmmmm m mm mmmmmmm mm m m m m O t9 O (9 c9 c9 c9 (~ t9 c7 (~ C7 t9 c9 c9 c9 O C9 c9 c9 c9 c9 O t7 v 'ur~ o ~ r°p cMv ~n ao n .r v v r O O O

o m m m m m m m m m m m m w ao m r' ~ °' m m N m oy' ~
U CJ °> a> m m ~ ~ H j. °' ~ or ~ r > °'rn E= cv a ~
~
4 Q ~ Ii! Ii! 0 0 0 o m a U Q a o > > Q Q ,b U ° a? a, 0 o z z z z ~~ o ~ a~ ~a a ~~ ago r r M m N N N Qr N lD aD ap (p O r f~ M ~ op y. m f'7 O O r N N N N N N ch r r N N 41 O U N
(h N 4W n CO f~ f~ 1~ m In ~ 1~. 00 1() O 1~ f~ (D t0 M
r_ O N t0 m N N N N 1~'> N f9 m O tt d' m ~ Iff ~?
h N ~ ~ h N N N N r ~ N m O Q ~ Oo ~ 1f!. op [ _ t _ p~
N (~') V' h f~ a0 0D a0 OD OD O m c0 f0 N O V V (O N. et ~ t0 m m m c~1 M M M M (~1 ~d V' M m C~ fn r t9 fn M ('~7 V' (n M c0 7 ~ E E
_U _O N _U _U
E E ~ N ~ E N E
N YO
07 Q O ~ °~ ' ~ N ~ ° J 01 EE ~o-~E ~E'_U'UO_O ro W v) W N N N W V N C N N C ~ ~ H H f0 N
C C C C C C L L E C = L t ~ ''-' v a~ a~ v_ v m m ~ d ~ d a ~ E m m Ln N~VW1 N W %'0~N.O11L17 ~,~~7 ~~~ ~N NlC
d n m a~ 8 $ o o '~ m N f = c E E ~ E E E ~ o N c2~ E m ~' N ~ !9 ~ ~ a c'T m U U ~ 2 z i Z = S ~ j ~ p' U 2 U U a a !L Lu ~ m m U
ro m m m x ~, m~'o No.mcnr~ $~ zZ
> ~ _ _ _ - cn - _ O O ~ O
X X ~ C7 (~ o ~ ~ ~ ~ ~ ~ ~ C7 U' ui 41 Z Z U - U tn m ~ oo ~ Q~ Z Z
Qccl~mu! v ~ UU
N N Z U U m ~ U1 ttl t11 y m E m O Z Z
m a~p~lzu ~~m~ ~oo''or °'a uiw and c c v ~ (~ C7 C7 N a~ J > n a J ~ I °~ a' Z E E
a a o 0 o a a a o,N-r'ig~f~f~/7~y'°~-as ~~~° 8z~f~ ._ 2 Z Z ~ m y O ~ci U ~ ~ Z Z v ~ .Q y ~ O $ U' C~ C9 ~ o 'a ~ a Z ~ r: ~ ~ m H
H a ~ a N °i of ~ o Z Z Z o v a ~ p p E E m c E c E ~ o a a E U U U a i m 't J ~"~ m m m Ol U 01 U ~O aOD 0~~0 Z x W W 111 ~ O E C dj ~ (~(j ~ v v N N E U
D ai D ~ ~ ,° ~ J 7 7 0 9 E - y ~ ~ o o cg a °> > °> > c ~ ~ v UaJ IaL W ~ ~ o ° a ~ ~ ~ ~ ~ ~ ~ m c $ '- d '°N'°~m o~o~~o ~ ~ ~ ~'c °~~Evcmo m~°'Eo'cc °'~ .n m ~ C $ t-S QU Q~N N N N O9 O~ O ~~~ TII ~ n~ p.C C X~C NY
E ~ ~ b y o~ ~ ~ ~ a ~ ~ N N N ~ O t I~t1 ~ y -' c ~ ~ ~ E ~ c c V S 3_ E
~_ C U C ~ ~ E m E O Q L N N N ~ E U 2~ jj ~ ~ ~ ~ ,C N .C d ~ U ~ d E '° ~E W '° Q m° E ~°n E ~ ° (7 U U
~'_ N m C7 'E m c "-' o -Q a E c c $
N N 07 m~ ~a~O~~~~~L7~L7UV ~m7 ~l0 ENE.°~n~.ovc~ca°or vdvdv°":~a~~zE:°.a~d~n~~~
oo cv mm o,~o oL° co m >,- cgn 'c ~° 'c Z ~ c ~ ~ ~ E .c '~ ~i $' m ~ a M ° c O -oc » $ ~
°' E ,~ ~ ~° ~ L = or .6 _ ~ ,,&, o ~,~ ~ ~ m ~ a '= m n ar a d n ~ d ~ ~ z ~ $ ay d o E ~ E N m m ~ v o ~°
a c ~ c Wn W u! ~ to ~. ; °' y°d ~ ~ ~ °~ ~ ~ ~ Z
'° ° a '° d c' ~ uU1 ? ~ .o .n ~ ~ m M W ~ ~. C ~ N N 't7 .n N L [yJ a ~ N 'E L ~ 'g 0.' ~ ~ g ~ ~ ~ y f c °cNU° o '°a$oEoaoE'~9~oJcvo~~~EU' E~EE Ea' E ~ E ~ E ~ ~ E ~ o ~ o ~ ~ o '~ a ~ o .~ o m ,i °., ~ ~ ~ Vx c t~°c ~ Z Z v U ~ U m lit ~ i a_ i d = o m Z ~ x o x o a ~ n o cn U c x U N U a a a a to to ~ D yr U
v~°nnn °u°m°° ommo a°o°m m° ~p NW ~ ~N t_D°~ !'M~~
m m N J J J U U U ~ IL U U_ U U c°0 J J aD am0 O O O
a a a a Q a a a a xa a a as xa a » dw ula O O O O M N ~ OD m C'J <''> V O O O p Iv m G7 N m N ~O 47 m m m i° d N
n N ~ a~r- ~ O O O 1~ f~ a0 O ~ aD N N ~ N N ~ ~ O (Op O O O r r ~ r ~ N ~ ~ r m ~ r M M N M ~ M
O O) p O O a ~l ~l ~l ~ M M_ O O IW° ~ ~ O O O ~- V a0 M ~ off ~f1 fp h h N ~ ' D u7 ~ u7 Z ~ O °~ (O J -~ ~ b O 4.
N N N ~ Q O O O O O O d' O U a a ~ ~ m M ~°
0 o a m ~ t~ U U U N U N ~ U ~ ~ ~ °° °°
x x z ~ a Q ~ Q UQ ~a_ a » o$ o FN- ~U' CN7- N . C~ C~ C~~-. ~ C~ ~cy i~~~' C9 C~ C~ ~ ~ ~ h f-: V_ mt~112~2 2ZSmm and m ~zZZ~a a?
ml ao o~ ml ml ml m ml ml m~ ml ml ml m~ m~ m~ m m~ m~ ml ml l ml m~
o ~ c~ c~ c~ o c~ ~ c~ o o c~ c~ ~ c~ c~ 0 0 0 0 ~ ~ c~ o No m m O r O N O
r OD v- r U1 r O m_ C7 Of N t0 OD
N N N N N N N

o~ ~n ~ as w rn a> u, I ~~ ha»oa»oa~Mh °'~nha~ o°' °-' ~ °' ° °' W °' ~o~
I h , o~ o> 07 0~ rn c~ o~ o~ c77 Orn °> om o> ' a> ' °~ ~
o~ ~ ~ o~
' g' "o>°' o.~ c ~ c ~ ~ ~ c.oic c~ I= ~=o,' ~ . o~
I a ~ Z ~ ~ -°,~ ~ ~ ~ ° Q ? O ~ ~ ~ ~ ~ Q Q ' ~ ~ ~ ~ ~ 0 o r ~ et O ef ~ ~ h h (V o eb V tn O O) r d7 h 01 N N c~ N N r N r N N r O N N r r O N N O e- <t e~M- r I
CD O r W h In r tD 07 OD h O ~ (U ~ O ~ O N t0 t0 f0 V M
h ~ O r h O ~ r O Iv ~ is O °> et h M 47 r ~ N tD O~ t0 O O M a0 tD r O o> c~ N O W °> ch V W st °! c~ ch ~n I t0 CO 07 OD oD t0 O ~ N 0D O O ~ O) O 00 !D V' tv h N CO ~ t0 D) h Q7 r h M G7 01 O O c'rl fD u~ M C~ Q7 G7 O> r 07 tD ch M c'~ 47 V V ~o~ M ch Cl '? ch E E E ,~ ,~ N E E E E E
E E E .o o ~o $ v ~ v ' N ~ $ 'n Q Q
E E E ~m ~ :? u, E -° ~ E
v~ m ov w of o. a n. a rn as W of a o U o. o o ~ .n 'rn a E ° E E E ~ m ~ °-' ~' E E E E m G N m ~ ~ E ~ °' E
.~ o C U C C C E E E E E ~ C C C E m ~ N E m m ~ E ~ 7 E U
~$' m m m .~ -'c c c -°c ~.' m m ~ E $ c o E E '~ ? 'c _o m '~ 2 ~ 't5 ~ m m a~ H v ~ '~ v m m °-' ° m ~o 'E d F~i v v ~ c m m m ~ W ~ ~ ~ 3 m ~ a°~ '$~ ~ ~'m Q ° .m ~ :c s ~ m E .a ~' E
c c c c a a a a a m c a -$ a a a m a o m a o O ~ O ~ O ~ ~ ~ ~ ~ ~ O C ~~ ~ ~ T E C E $ p p Z' ~ ~ ~ ~ N
U ~UVU~~~~~mU aUUU. gD ti Z ~D O U ~t~ U ~m m N ~ C ~,.~ ti!
O m ~ O a0 Q
C7 ~ O~OVN'. O' t amhd' N ~~ ~t<'O
a m s ~ E o. N _... ~ a x o~ x 07 01 O ~ [l~ $ H ~ ~ ~ C N ~ N
- ° O ~ 111 ~ U
m g U G ~ 'J (' O .-. m G m G
c ai ~ '~,: ~ '- . du _ ~ L °c Q p °o' '° ~ ~ ~ O
a°°o 'E° $' ~
.L m n °' "' ~" w ~' m c °' a ~ W c ~ o w ? °n °~
3 °~ v~. : _.._ _ E o~EcSi 5i 5i ~ v, cNC oQ~ ~ o visa; °,'$y-Sdg~E E c Q ~Q~m o m N ~ 'o~E ''8::E
a H a m ~ $ ~ $ ~ U R ~ Em ~ m ~ z ~ Z m Q $ °' ~ m °' ~
u, m~'~o.m~~ ~ ~ s o.mEam ZE v W$m dv~
.c ~ ~ ~ m a H a .° m ~ N ~ ~ L ~ ~ ~ .:-: a °~ O °' p H
m o, c ~' ~ ~ a E a m '' ai "m Q o ~ ~ ~ a z ° m ~ '~~- °' .. ~ Ti 0! F ~ ~ ~ $ ~ ~ ~ d ~ V d G Z ~ m m Cf ~ ~ ~ ~ O ~ 9 G $ ~ .OD E
:E o '~ ~ N ~ N ~ ° ~ o f" ~ m m N a~-n c ° W = ~ ~ ~ m c° ~ ' ~~ ~° ~ ~ d o ~ oa m~ri~co~ d~ ~Q ° N Eoo o a~ E m U cm.~c~~ ap-2M
E r E 'E m = -'mo = ~ = c ~ °° ~ E E ° s ~ ~ a ~ ~ IUL ~
'~ c ~ °' N Z E °~ ~ _ N7m NENEHE O~ 7 Ea.~Cr ° jrEZ o E V1N E _tnN
Q' ~ Z V G ~ O O~ _~ O $ ~ ~ m ~ U a? ~ m N ~ J O Q 1p O TJ ~' V '~R O $ U C M
$
m cE~S o .coQE ~ °oc~~ a~~=$ 'Em? ERo 1-a ~5 0 '~ E -°o m ~ m ~ Z ~ a: .°~_ ='° m O v ~ Q ~ U m N in ~ :°. m L~ o ~ m _o vi N oW ~ a..ma o. a ~ or a ~ w o~ a. a U ~ V ~ d W °~ rn E ~ m m u. 3 ~ ~ $
$~~m~d~m~E m msZa'~ Ugh y°c °c°°' ~ro o~'3d _ W E ~ E E - m O m ~ ao n_ - m m ° E $ r- N o my ~.m ~ ~ ~-'c-°c ~ c N d d.?~ d c a~ ~ a Z_.'~c~-'c E E° m d ° ~ ~ ~, o v~
'G v Z v m ° , m m m _~, ~ m ~ U m M m O E = ~c °c; "- 'c ~' W O m ~ N, N m !0 U O d: O O ~ W O ~N C m ~ C1 m d N G am ~N m~ W m W W ~ m a ~ ~ a W N Oi O U ~ N ,.°, 1- ~ L ~ .C a ~
E ~ E
O
E m a ~ a .a a a a m mg '8 m o o ,_, a c a m a ~. Q1~1'Q TNmc~~t~'-m'EUVI~Q~~'°~oEi.,~
U v ~ U m Q ~ ~ ~ ~ ~ m U VJ m C7 V ~ ~ E ~ o~ a o m ~ ~ D ~ p ... U co ~ a7 U
m ~ ~n N M
h N a0 N op N h tv r (~O h r N h ~ ~° N ~ n n N O m ~ ~ ~ op h O h ~ ~ O op ~ N r Or ~ ~ N O ~ W ~
i r o t~ n t°.. ~ r~ p ~ ~ ~ .~- ~ ~ d' ~ o .fir U i > > 5 U tL N ~ N ~ N ~ X ~ ~ )- Q J Q ~ ~ ~ d Q Q N ~ ~ N Q
ovovo r O V !~ O r O O r N O l0 N O ~ O N r r r l'9 r r O r ~!' r et r V N ti' O ~ O h ~ 07 r ~ ~ ~ M
O N t0 ~ O CO f0 0O f0 CD N r CO ~ tD W N c0 CD fp N h ~ ~ h ~ t0 N PO r (~ M c9 f~ f~7 f0 (~ Ln f0 W N t0 f~ t~. t~7 CO l~7 Gp M r f4 !~ 2 N
M rnaroa t~UhUh Wn Uh N ~ h O h ~ O h N M N N N V IL f0 h ~ N r _O h ~M O a O
j c~ ~ ~ ~ ~' m r m ~ u~! ~ N = o m ~ c°~~ o i° cw ,~ N '- 'hd' j, r~
r~ U U U C9 U
C~ Z C~ fr O I- UJ F- U 1- ~ (~ c~ J Ur 101. f0 ~ U ~ ..~~ o 'r °m U ~Umulg~~~gopU °-mUQ ~N t~! ~, _,45,d d 4 r r /- r r r r r f- r v- r /- N N r r r r a o~QQ aaa ~ QQ ~ am m cYmma~mmm~0~ am~m mm ~ t~u ~Z ? m m~ ~ mm ml m~ m~ m~ m m~ ml m~ ml m) ml ml m~ m m, ml ml ml m~ ml m~ ml m ml ml ml ml mi m U n (~ (9 C9 U' C9 (~ C~ U' C7 C9 (~ (9 U' (7 U U' (9 C9 C9 U U (~ U C9 C9 (7 C~
N
N ~ ~ ~ ~ N 'V
N M M ~ M M
108 g ~ ~ , o~ ~n rn m m m of ~ o '~n m ~ m ~ w °' o °' ~ °~ ~ t= m ~ c° U °~ °~ y m ~ ~ ~ V m ~ ~ U ~ m rn m Q °' v~ QU c °'cQ do- c c c ~a' ~a' ~~ o, ~ o~oa', ? ~ in v~ _ ;o ;~ ~o ~ ~a ch r~ <b N ~ N v r n ao r M r o c5 0 0~ Q ~ m d~ d~ ? cb o~ m r r r r N N N r r '- r O N r N r N N r O N r m O r- N m N r 1p m I~ ui N~ (h m 47 CO N 07 m N mN N O r- O m Ncp fh W~ ~~ N00 ~N vr-~~~~ aNO, 'r0'_ ~~ MNNtnO_ am0_O ~ aOD
°~ (O r N N V m O~ (p ~ _ - m O ~ O m m m 07 W Q1 O O m N r O) m M m sf m M m m f0 IO ~ M m eh m m m m m O st IfJ M 10 m 7 .~ m W ~ .~ ~ .~ n! j l6 j !I1 _U N Q y ~p a0 C1 ~p N N U N U N
E ~ _o '> N N ~ ~ $ _ o ~ ° E t_ c E
O N ~ ° O L O) ~~ v m $'~ N 2~a n °w 'N° ~.a am v is v~ a ~
d H ~ d 3 ~ v. ~ R .~°. 3 °' E E ~ E
m '=G ~ ~ ON y.~.- V 'O C ~ 7 7 7 C G E U 3 7 3 '' ~ C W = 7 >
U ~ C 'O. ~ V N E 'V U 'F~J N f0 ° O N 2 C1 V G ~ ~ ° b N ~ O ~ .W-, f 1~ ~ ~ O O W t6 f0 41 ~ 3. L ~ Qf l0 l0 ~ 'n p ~ f0 C ~ n Ef N C ~ ' 7 ° .O ° O N c O ~ D O O C ~ a O
Z' ~,m o0o m° E mo2B..~U.E ~ ,-c mn~ S.~U.U~ ~y ~ v~
U ~i~ v» UU tUZ a~~~= Z v! ~Y.°~c ~~~U UO~. U ~O
U
N ° Q ~ c p m ~ (V ~ d a ~ E t ~ ~ ~ ~ V ~ ~ m c °' ~° m ~
8 ~ ~ gi ~ ~ ~ N d ~ ~ ~ $ o~ ~ ~ ~ E
J M. ° E ~ N ~ v ~ ~ ~ ~ N ~ ~ E E
cEE .~~c E Z°d m ~ ~ d~ ~v~ ~ .°'n ma°', a a'Zo ~.. m.n o t '~'>~ m ~° A ~Z nY- a d m c ~ , E~o of ~ '" .. '. a _o n ~ .n Z N ~ ~ . ~ ad ~ E ~' ~ °' ~: m Q °_ ~
" ~'W ~ .
o °' E a ~. ~ H ~ N N~ ui ~ 8 ~ v ~ O ~i E N ~ o w ~ E E
m ~ c a ~r ~ Or a j o ~ d s c° 2~ ° ~ ~ °c o Q
ar ~ y ~ ~ ~ ~ ~ a°o o ~ ~ o or a~ ~' amn a o 'o >
o. r '~ ~ GyL ~ v~ o v ~ a a oW° O
on 4'' m'N°~ " ~~ mE a~a~ain. O~d g~E d O a~ocn n o c c n o d o Q fn W 5 n d y c o a >
o~~Ep 'g~~° rn m~j E.~p r°.LCai~ 2°':°- E~~c ~a~° c Eoc C O U O = "°' = C ~ ~ U (,I N m N G! m 0 IUD W ~ N V C O~ ~ E ~~ U
f0 U
~° ~ > ~ ~ o ~° o i. _ ~ > d ch~ o ' o _ E ~ ~ a~ c > o m d o >
E Q
m ~ c~ v Y s r r ~ ~ .. ~ ~ c'S ~ c c .t E~ c 't3 ~ ~ m E E E ~ ~ Z
~-mmv BEN pe. '-'n m$a~rtn_rtnN~,°,°LW T m,~' mr and t MoD
~i~.~o ~~'r' eEno aU_ H~EmwmwEQj~c~a~_~EE ~o ~
U N ~, V ' d ~ ~ ~ 'N C! 1p E ~ E ~ Z W U ~ U f71 N N ~ ~ N U N
°'o '->EY Hm Qc'~c»cg~°,Op°mOpE~mo~~.~~~~E ~c E ~OY_'>
3? m~ ~J~? We ~a rnL-'~~E~EoC°'c°aN>°nm~mL°? n-°' ~
E ~ ' ~ :g ° cv m % vi m V a m ' ' ?~ .c z s Z ~ m o '° a o $
? ~ d E ~ w E
H m ~ ~ ~ ~ c~ °' 1 m = E E E ,~ U' N G N E ~~ o ~ a ,~ E E E z .~ ;~ ~
E p° o N ~ ~ tV c so o a ~ c z c z of ° E w m 7 7 ~ N f0 N 7 a> 'a m ~ m o m -c ~c ~c m a> - m N o c ._ .c . g3 m c ~ ,c Q t W ~° ~ ~ c rmo, o a~' m ~ ~ c u~r ~ c ~ ~~ ~. ~m Z ~m Z c°'n ~ $
~ N a o~ ~ ~ ~ m ~ m ° ~ ar v ~ c m ~ 0 8 d ~ ~ Z ~ m ~ _ --° u'1 ~ .d 8 8 8' ~ d ~ d rN- °' ~ a ~ .
gQ ~ ~ E ~~ ~ H ~~ n $ O Q m U o~in t~i~ HUU oWS rn0.~~~2~S~tN~J~t~Y~ a.~~~~U'c~Ua ~U S~~O m O.p M N~a~N
007 N O ~ ~ ~ O n In O m ~ r ~ ~ m O ~j N O) N N O N
o cmn° ~~ o~ amok c°~r~W~oo o° r o~ ~oMO o0 0 0~
m m .~ m ~ r o C'J m ao D ~ U U ~ ~ ti o D .- u. ti ti ~
Q N Q ~ ~ Q > >- Q X N < Q Q Q Q ~ Q N Q r Q Q Q < Q Q
_ _ m n m m ~ ~ ~ r 1~ Om ~ CY ~ ~ ~ h N 10 ' O ~ ~ O
W ~ ~ r ~ (r~) ~ r VO' ~f.? ~ ~ ~ f0 (h N '°V' ~ N N V N N Im n [(/ m O N h m a th LL tr0 O M O t0~7 ~ 4~7 N ~ ~ O O ~ ~ ~ N ~ m O ~ ~ O N
m ~~ j~ w~ ~a Q~~~Q Q
CD c'7 U CJ Q ~ d ,cS', ~ ~ N N M ~ IL
m mm >w Zm d~ mmm~i z W a~ ~m~m mm ~ mw r rr rr rr rr trrrr r r rr rrrr rr r rr r mn r M ~ m h o ~N
M fh M M M M M ~ °
O g ~ ~ ~ ~ ~ ~ O

t ~ ~ U I=F= j m ~ f= m U U > I=~ 1=F=
U e ~ ~ ~ ~ H
m y L ~ U U o o, > U c u)tL o U ~ U U
o > > w o > c U
1u > > rn o -~o~~o?-~ o o z ~z ~a= o z o o zo o ~ q q N N ~ O r N O ~ N N ~ O O N ~ d7 O
O O N O r ~ ~ r r - c~ N O

r r r r r ~ r O 01 N 1fi4) aDN a0 O N O 07N M M
O) h ~D t~ O) l0 f0 M M M M tp cp N M N N 4) 41a0 f~t~
h O ~I7 ~ M O
~ h N

N 4 O) fhM 1~N O O 0) 474) V O)t0 (~f?
r (p (O 4) h - N
N O -~ O N O t0t0 n f~ ('~N at (D st4) 4 aD tvi (O f0 ~ M ~O M
h M OD ~
~ 'Q
M
M

7 ~t t0 M M M ~ M ~ M M M
M !D M M C
t~ V

_M N !/! N
_N

O O Q O O

O O O _O O
O O

N ~ U C V ' W l0 V ~

O O) CT
> m t ~ ~ ~ y 'g b 'g o C
C

~

u1 M ~
fG

C ~ 'C d m N ~ _ ~ N d E E y m d d C C ~ ~ ~ ~ ~
O ~ ~

" '~' W .~ .~. W N ' b U ~ N N N p ~ ~Q f0W
J U V ~
W
~

IC GS b N N E9~ l0 ~ N N Ol n n td N V!
N N l0~ H x C N

O O O O O O O n ~ Q Q O O Q O O O O
O o ~ O G! Q O
b O

T O O O ~ O ~ ~ O ~ O O
O 7 ~ O
O

>~ >. ~, O O O O
O a U7 _ = UJ
m f~
_ Q ~; z c '~c co a m (NO NN ~ ~(NpZ ~ ~ ~ _7 ~t O ~ 100 ~ ~ N N ~ Z I_- ~ ~. #_ m m C
v- Z fn fn C1 QJ ~ O N r r c '~ c c U ~ o m ~ ~ E co °? ". ~ ~ ~ ai ci ro ~ d a a ~ ~ a a. ro W IV a c~; cv ao c a Q
~H,~~ cmU'U' 0 OrnUa r r m~
'~ N :~ :i H W U ~ ~ ~ ~ O U ~ ~ ~ E ~ N N 0. -H ~: .1N '~ n ~ 0' m d °' m m N .o ~ d a N N d m a o c n ~ o. c~ m o al ~ d E a E m E ~ E E '$ n 2 Z I I E w '" ° d m m ca m c .~ c .4' a In 'n to n o c o o T $ E - - Y Y o ~ a E N E '2 E 'n o n o o. ~ ~
d ~ m d C y % U ~ ~ NI NI ~ ~ ~ ~ ~ O M a a O y V a M M ~ f00 OI O) O »p N Z Z ~ M p1 I (p V ~ Y ~ ~ O r N
mN M m a v c ° a~ U U ar '° ~ a o~ ~ ~ ~, ~ a~
nM nnQQ H ou W ~ ~ p.aU ?~ o ~~ 'off ~ ~ °.7 °~ U~U ~
C7M U U VU~NW W ~ ~_ ~ v m m °'~ - ~~ ~S~ S~ Ev E~~~y m~ d > m » c r -o tn V! o o > c c°; e' ~ o t- o t- .- ~ c _ c _ ~~ ~o~, y8~ ~ 'cue t~~ ~ ~m ~ a0 NN C~ O; ~~ ~ of of U d ~~ ~~
M U M M m m o a~ ~ '? n ~"~ a cc E :S v o c ° U ° ~ o E tn E v7 a ~ N c~ N to 2 m S Z ~ v N oo ~ n .- E r Z ~ r '~ ~ E ~ v m X tn X tn ~ o cn o t~ S m r ~ r ~
O dp C O O O NO t p O O O O O C 0 '~ N d U V ~ L.. O U, O (~ O ~ (' ~ (~ N. ~
O (~ O (' 7t0?777~~00 ~ ~ ~~ OCOCe'E.OOQ7N~O~O~O~ONOr~~
d ~ _ar ~ ui t ei .c t~m t ? ~ .~ ~_ ~ ~ ~ ~ ~ ~ a Z L Z 'u c Z c Z
c°~. ego t Z~ r 2 E H a~ E E E E 7 ~ 4! V N ~ ~ $ v~ E w m~ ~ m ~ ~ ~~ rUnU' vU,U' $ mU' dU' m~
mU~ ~U' c m °. ~ '. ~'c c ° ~ d a m a. d $ ~ c ° 'm N yj ~ a' .~' Q .~? ~ ? acr Z ~ E Z E Z d U m z v z ~'o.E o~~E' m T'S.a aa'a Ta ° ~'o.U Tc ~Z c nU'a.U TmU mU'nQ nU aU
a'~$aaaaol '~d'~a'~'~ oN ~W h~o~.~o~~jHWHWpp.tZtl~.lZL~c~LZIJ»W
° 2~ q o _ ~ b E o ~ ° n o ~R ~ o (~ a a n n m ~i o S o ~- n o ~
o S- o m o ~ o ~
oa~8.28.o~',>°.8to~o~o Lo ~~o~~c~~~~owow~QtUu°wo~owotau =o~~~~Q n= °_ ~2 ti~2 ~~SD_tn malW =M=t°2t~tnUtoOtO=22cO=(O
00 o I. ~,,,~. 1O n r' o h~007~m~~N n~~~~~~MI~PMpO~
r 10 O N O W O) IfJ b !~ M M M 07 OI T O M M Of O
N ~ N ~ ~ OU ~ Q O O M O N O O r N N M O O M O O O N N
as any°a~~ a a Q as aQa N aaQ a a as a a ud 'd' COP~~o~~~ ~~~aMO~(NDOOtNOtNO~ rN00«cn0 c0 ~ 1~ ~ (O ~ ~ (O O) Or i~ h 1~ N t0 t0 M a0 c0 ID M M f0 N ~ t0 t0 N 47 c0 O tD eo e~ oD .- f0 t0 c0 N N ao et ~t .- r- r N r u) r N t~ M M r N N M N N do r r M M
m o Y Y r n N n m cn D rna~ m r cc r p r m m ~ ~ m n m ~
m M V O O p _ O O M ' ~ O M N N
~ Q n a O
O

~o ~~U' U U o c~o oU O NN~- ~ DU U o u_uo.
U Q ~
~

~ a ~ ~ ~ ~ fO (V (n a Q CV fV
~ ~ fn a ,a,~~ N

_ _ ~ ~ ~
~ _ ~ ~ ~

~a ~mm~m i z a ma Via= m mma z m a z ~x .

mi mi m/ m/mi I I I I I I 0 I I I I
mi m/ m/ I I I I I
m/ m I

C~ c9 (~ C7. . m m m m m a m m m m U t7 c9 C7 m m m c9 m C7(~ m t9 c9m C7 C7c9 C7 m c9 U c9 C7 c7 (~ t9 c7 C7 U

r 0 r N ~

4 C) a N a r 7 ~ 4) 4) 0 p 1(7 41 O 4) [~ ~ O

O O O

rn rn oy' m °°~' m°~~'o~ W ~~~~° ~ m ~ ~m ~ ~m~o~, o~ o> > w a °' ~ Q > j Q d Q tUU UUJ y ~ ~° t .b c ,d > > Q ~ Q ~ m ~ ~ -~ ~ tn ~ D D Li u. ? ti ~ '~ Ii ~ 1i Q Q .p Q h -a '3 r- ~ r~ c~'~ c'~ N r. o r~ co d .~ cE
N N N ~ N a~ a0 O r r O r O O O r r M r r N r N N
_ _ O
O O ~ W h CO 07 W ~O W CO <D M t0 M O M W
O t(7 ~ N y0 W N O7 N O O O W
M ~ r N N f~ ~ ~ ~ ~ I~ ~ N M o0 h ~ ~ O
O O Ifi O) 1~. a0 V 1~ M O m O 00 (D m W O ~ D) t0 W O c0 a~
V' ~f M m M M n M M M M f0 M M (~ Q7 O O D) M O7 r l0 (D
M _U _U U_ d ~ _U ~ul ~N
ate. r m j ~ p ~ E N E .' O
m ~m._ ~dd~°_vL° > >
o ~ n ~ °c~ n a a n ' n ~ o~ o~ ~ o~ o~ a R A °-'_m~ E °-'-''-''°'o°~ E E ~E E EE'E--N 41 C ~ d W = N 7 7 7 7 ~ 7 G C C ~ C 7 7 = Z 5 7 E E o .c E E .g ~ 'c 'c ~ 'c ~j 'c a> m ~ ~ o ~! f~ ~ ~ 'c -N m 'a d m o O p~ ~ m 0i w7 ~ 47 ~ 'a U V O O m m 0 0 9 ~o ~ a o a .n a a $ a a o a ~ ~ a ~ ~ a ~ .n 0 o E ~ o E o° c°~ v °v d S E E ~ Z' ~ Z' 2' v a o ~, ~ E >, >. >, t,2 0 0 0 o c o 0 0 0 >. >.
O O 2 201- ~ m~~~~cn2S 2 U U wU U UU~~
NO t t Q
U W U W N r N N Z Z ~ ~ j, N ,Q
~D W
~U' ~U' NW = > > Nm Nm d ~m O O W m (V T ~ (~ (~ W ~ ~p N 'O In N
H
~a ,:a ~a d (O m Y m ~ m E r C
U C C O
D 2 0 Z _ 7 N N m ~ 'C O C o aol C9 C9 Q w E E _, d c. _d -. J Z_ J Z O (L' C ~ ~ ~V N N N ~ . O ' :v :A~
V1 ~ o U N U a o » » o Q Q ' m ' vTv: ' m W m m °~ Z Q U ° hi ui Y oa ~ ~ v ~ .. ~ -o n ni ui E
V W U W Z W V E E t E E ", m m m -oo W ~ E >, m C~J m O ~ O C C ~ N_ N_ C ~ ~ C L 'O ~ = O
~ W m W ~ = v rn ~ W tL 111 rn b ~ rn v W T ~ n C ~ C ~ ~ ~ O ~ ~ b Y! ~ N 'O ~ O N ~ H
O O U Q ~ N N y~ ~ >, H y y V ~ V ~ ~~ O W V a D. L (V N m ~ ~ N OE L H ~ ~ Q N
tn Q m Q a ~ ~ E E 3 N N ~ t9 'O ~ 'o ~o ~ E m Q
o m a m o U ~ ~ ~. a v o ~ a ~ m '° .: a> o m m ~ ~ a o E o m o a o .3n o ~ ~ n o '~ c°.> > > N Q n m .4~ d ~ ~ ~ >. X ~ a : ~ ~ m n > j o $ 2 O c ~ o o ~° ~ m ~o Z w c n c n ~ ~ ~ _ a m r ~ a o ~ w E ~ E ~ N Z N m ~ o m M ~ m O m ~ d ~ d ~ m cvi ~ ~ U m cv ~ ~ m o ~ .5 O j; ~ ~ v ~ c a Z 2 o N v ~n y so m ~ ~ ~° m ~ r m ~ ~ ,v~ S n W JTmz~~~~na1 N !ON~f%1~M~EOE~~~W V NTWW~OC.~ON~N
vin~'am°'0.~~$ml-~c °' $»$o'$~on~o~_na-vu ~n~~; ~'ifQ»
$~a°~Q$~°rn'°~-n~~ZL°o~~~ ~ ~d~~°_v~otc c-ip4o~W ~o~~p'~n~~s~mao'~o~
G C 1 0 N C N N m U a T m O d L F L I ~ v, ~ N n ~ ~ N ~ v ~ C j a ~ W ~ A ~ ~ W- m ° ar ~ c~ v .2~ c U m ~ >. c U E m Eo.~Eo.a'Z~~?E~m n, 3»>$~cwc~»~E »~m~cE»m m E o m ~ o rWx, ~ Z. ~ ~ _ ~ c ~~ ~ ~u ~~ ~ v m l? ~ ~U' E R > ~ c ~E
~° > ~° urn $ ~ ~ ~ E
o ~° o m o ~ '° H a c N 'E E a ~ a ~O 8 .'°oO o y o ~ W
,$ v ~ - E '° a ~ ~ ~ a ,EL° a a $
~'tre'NOc~ora-.°c E ~U.~U.U~n°oEaEaoyo~'~ c°W .00.2', ~UUm ~0~.0o~~~ina~~rn ~ a~ ~~~~i~~=Z=ZU m ~U ~U W ~UaOU~~ o~
aND aN0 h ~ M y0 y~ N Y7 ~ ~O ~ ~ (O W tD Y M r t0 O O m ~ r ~° 07 tp 10 r O r r N N ~ N ~ r In N N
N N ~ O r r O r O M M N 0~ N ~O 07 N 47 U U ~ ~ .°~ d ° o ~'. ~ °° o °°
o o ~ aNO o ~i W v o J a°°o Q Q < NQQ Y ~ ~~l~J~a~a a x x au =l WXQ~
t0 N W W N N N ~ ~ CO ~ M h M N N N
M (~ N N M 1~ (O M ~ W l~ Q) M (D t0 O D) O W Q Q) c~ M 01 t0 W N c0 (~ N t0 N ~ N W ~ W W fD et ~ V
r Y Y N V' M V' M M ~ V V r N N N N M N
~n O
N N N O> M N N (n N
D O aD m ~ a. Q W W O '" N N U O ~ ~ O N
Q Q ~ ~ U Q t7 °o U U S ~ °o m m ~ U ~ J ~ ~ J ° ~
NU' ~ ~ p ~ ~ ~ ~ ~ ~ cn ~ iV iii U U ~ U ~ uJ U
'' a ~a~~~~~ ~ a a as a a~aa Z S uNJ mZ~ mmmmm Zm mam mdmm m~ m m m~ m~ oo ml m~ ml ml ml ml ml ml m m~ ml ml ml ml ml ml ml m~
O C9 C9 C9 C9 C9 C9 (9 C9 C9 C7 C9 C9 C9 C~ C7 C9 (9 (7 C7 t7 C9 C7 (9 N n (Op ~ N r M
Y' W r r r w- r r- m n o rn ~ ~ m v m rn m ~ ~ n ~ ~ m ~i ~ ao ~ o, .
rn ~ ~ ~ n ~ ~ ~ ~ ~ : rn ~ uy ~ o~ rn c c w t c °' Q c W V ~ d c c w V n m c V cvi -a V ~ a> > ~ °~ ~
cn > > D ~ ~ ~ ~ ~ D O m m ? -' D O ~ m ~ O ~ W O ~ ~ m Z ~ a -y ~ m -a ao ' ~ n ~ o~ n ui d? ~ ~ ~ .'t n m ~ v c3 ~ ~' n ~o m ~ N oo Z n v ~0 7 N
N N O N r u7 O r O O U N N O O U N O U O N N P N ~- a0 r N O Iii r h r 1f7 O) CD V' tn 1n (h O O O m m OD t0 P7 N C) t0 (D t0 1n O tD
V N ~ ~ °~ fD tO f0 t0 h fs n ('~ l0 N M O ~ ~ ~ O N
t0 O M CO ~ 0D ~ 07 (h (h O O O N ~ M O r f~7 r M N N c0 N Q (O ~ ~ c0 aD o7 ~ Of Q) n h n e0 V M ~ ~ N _- _ __ fD t0 !D p (D m l0 ~ ~ Q1 O) O) O O) 0) M f~7 P7 p 10 ~O M V ~ (D (O ~D ~ fns N 4) N rn E E E E E E E
Q 'O ,O ~O ~p V U U U U U U
° - E ~E E E E E E w_ a; ar a'> > ~n o ' ' m $ m ~ m m m m m m m '~ 'o~ in in w vmm '~°a~ L°u> »> » > mm m~m_c a a a .a n a O7 07 Oi v) o) OD p~ m °~ O of d 'c m 'C C C C ~ G1 > > > > ~ d > > ~ ~ ~'c '= c ~ ~ ~ m ~ ~ E E ,N ~a v 'c ~c 'c ~c Q3 ~ ~c -c ~ m m ~ ~ ~ ~ ~' m E E E c c .a w a ~ o ~ a n o a a o a m m o m d m a a o ~ = a m m ~ o E
o. o o c o o ~ o o c c c c c ~ v. d ~ ° a a c E $
a r c i. a o E >, i. c ~ ~ o c o ~ ~ c o ~~, m E ° ° >, i. ~ ~
tn ~~ »~U m~~~U UU~U UU ~U ~1LD o o~~ ~p_ in N
E E °' m p Q
a tNOtND ø~ %'°~~N
r ~- E E E r ' o M ~ ~ m .~ .~ ' g ~ v X $ ~ v c ~ c c ~ ~ ~ r' °' ~ ° 5 c :3 m - a~ d E a E E a a ~ ~ ~ ~ ~ ~° m ~ H a om or ~ ~ ~ ~ '~ m o v w ~ H H .', o.~ ~ .. "'m m ~ ~m Z . H m $
'~ ~ c .~ E E c o ~ 0 0 0 0 o m ~ a o E a~
d m ai ~ ~ ai ~ ai o _~ ° ~ Wn o c o a m ° ~ m E.° ~ m m '° ~ .ac- S _m E N ~ N oW' n.
p, d .4? ~' ,a! a? E.~ '~ .E~amm N ~' z m a H n a N 'E w ~ w A r r oo E m o CJ ~ ~ a $i of o o ~ ~ L ~° !a°.~ O 'a'- mn °cmm c E E a O O U fD C7 O ~ ~ ~ .,0.. ° m N ~ °. co ~> N ~ n ~ ~ L t r ~ '~ ° U °° E M
m o to ~ > N '-° m O n ~ ~ 'ri n N n '° ar m v o m m d ~ v a ~ ", m E ~ ~ n ~ ai ~ o _a Z a ~ p Z v z ~ E E E h E E E n c~5 .'°- ° !° Q a ~
~ m o ~ m m uo ~ m ai ~'c ~'~'~ ~' ~'~' 'n E ai Ed~.~tzcn yxga~~ a E c E !~ m o 0 o cn o 0 o cn 3 $ a Z ,~ O o n m m_ 'E O '~
U 'w 'w ai _ w Tn y w w > > > c~ ° ~ a~ w O 'w m c $~ W U~ T TTw~ TT .,Øw V~CO ~ w°O~G.
O v .,0., 10 m ~ ~ d ' d L L L ~ L L t CN ~ ~ i0 E ~ V ~ N N Q ~ m ~ .'w' '= a .ma a a a a a Q a a ~ ~~ ~ n ~ c v o. ~ E d ~ ~ ~ t~ o ~ ~ a a om. 'c A
o ~ -b ° ~ ~ o o E E C u' '~ o ~ m W E H b w Eo ~ $ ~o °' ~ D m ~ a E w ?~ E $
U .-w C .C ° °_~ C .~C C1 7 7 '_" ~ C C ~ m ~ ~ .k 'C ~ ~ $- ;~j G.
~ G ~ ~011OOO0 W 7 7 C m (O m ?~
~~4C)~~1U°. U~lg~~~~~ $$ ~~m~~fn.°IOm~ °~~1~~ O
° ~ a °~' m a a E d .G d N N N ~ d m m N m N O 'C N ~ d O m m m C ° EO
~i.ag~ i.~ ~i,~Z ZZ 2 2Z ~o ~~°~ ~op ~m E i.>,~m in ~ g ~ m ~ ~ m ~ ~ cn O O O m O D D t~ U rn Q u~ G E v~ A tL O ~ ~ t~ d v~
v W m m ~t c~ ~ X00 ~ 1~7 ~ 1~f ~_ ~ f_~O ~ ~ ~ O n ~ N ' Mp ~ ~f ~ ~ ~ cmV ~ ~ N t0 O O ~ m ~ N 10 ~ N ~ t0 N h O V N fn J ~M N~a0001 OM7 NNO N ~n NOap ~ OW70i000 Q N ~ ~ N N X 7 N ~ UJ W W ttl W W Q ~ ~ D ~ a X N N Q
N O O M a~ s~
m V tN0 ~OaMDa~°0 N 00 ~~~~ ~~ ~O ~fM~O r Nm~ ~ (p0 V' ~ N N ~ M ~ ~ ~ N N N N N N N N N ~ M ~ N ~ ~ M M e~-p7 m n_ 07 M V7 m ~ p Z O n O~ p ~ ~ M et V~ ~ M V' M ~ Z ~ ~ $ ~ J o0'7 ~ M N d M ,~jm~j ~~rh °~a> h °~~ V ~ m Z>-m M Q
D U o U U a ~ U O N ~ N N ~
U F- ~ N J F- J F- a' N ~ d' r . N ~ ~ a ~ ~ ~ U U O O
~n ~~ °~~~~ ~~gw u~wgw ww qc.o °om °~ ~g'°
rrr ~~ ~~~~ ~~ ~~ ~ ~ ~ _.°.
m ~mm amaQOm mmaa aaaa as a~ mmtNU w Zm~aa m i i i i i i i i i i i i i i i ~ i i ~ i i ~ i i i i i i m mm mmmm mmm mmmg -mg mm mmm m mmmmm m c9 c7 C7 O (7 c9 c9 c9 (9 c9 ~ c9 C7 c9 to c7 u~ C7 C9 C7 c7 O t9 C9 c9 O c7 C~ t7 M u~ N o hV ~ p ~ ~ r O
r p O O
~L
IIZ

m m m ~°hl~°°°'°~'~~ °'°'m mrn ~~
c ~O- ~m ~m~~ m ~ rn mQ n~~~ ~ mv~ m 3 °a ~° a m W » >Q of m of ~ v~Z -~~ ~ ~~v~QO»p~ Q Q o m N N N ~ N O fh N N (~ N ~ ~ m N a N N M O ~ ~ ~ N fb lb t0 O f0 aJ V' CO h a~ V' ~ O 47 c>' O M O (p 07 O V ~ h c1D O O ~ aD
N OD h O h O O IA h W IW (D M (O M
O m M f0 07 a0 O ('~ O aD CO t~ 47 O N O r ~t ~ t0 W (D N ~ I ; t0 (O a00 O 10 00 h 1~- aD aD h a0 M N 47 ill O D1 O Oi Is h h h O in O t!7 D O
M M M W 10 M O~ O O) 07 01 1() t0 Of l0 M V' V M M 1t) 10 at M V' ~Y M
U U ~ ~ ~~ U O O ~O ~.. v m m E ~ ~ ~ .fl 8 B .m ~ ~ N t ° v N N al o~ of m V 'S m m m m ~ rn of m m a a a ao o~ v~ 00 ow a vi ° - a a a o 0 0 m mw~?~E EEE E~ ~E a a ww3 c c c C N ~ ." 7 7 J ~ ~ ~~ U N V ' C O E 7 7 7 m N _tG
E
m D °' a d d ~ ~ ~ 'G 'E v ~ ~m v m %m ~ ~m ~m ~m m m m m v a f w m m ~ a a a a L ~ a W ° c 'c ~ $F 'G ~ 'G ~u' = t r °c °c a o a m m m m m c o m o o ~ m °c °c o o ap ° o o °' O NOImO~a~~ ~ ~ ~'~ ~~ T EC9Y~COO~E N N
2 U Z U ~ ~ ~ U U U U U u1 ~ U ~ N 7 3 ~ 7 ~ ~ ~ Z O D p N N N
Z ~ L° ~ m ~ W m Z U ~ C C m N ° ° fV IV (V
IL C r- N ~0 N ~ ~ i~ o c0 t0 CO ' a' O
> > ~ to m !~ m c m IL ' U r p IOU d °' G ~ F ~ ~ r' ~ °° 9 w n n n ~j ~ ~ ~ m .~? .a~ c~ ~ ~°~ I° '~' c c 'E °° a ao ao tO ~ m A m m m m d m a E c m m m ~ ~ z o z o Z
E 'o c o c ~ E ~ ~ ~ N ~ E E E m o O o O o O
of ~ E a m~. v ~° cv _.~ o ~ m a~0 x U ~ ~ ~ ~' ~ . D U D U D U
d c d E ~o ~E ~c E ° m ~ v m °' d m 5i m v ~ ~ Z 1 ~ Z ~ Z
m m m o o~ m ° m x E Q G m ,~ E E E E ui to to ~'nmrn m W~'-° '~'~ °c'~ 'vid~mE H mddm m0 and W c Q a m o~ d U a ~ d ~ $ co E n ~ m ~ m w °, m ~ m ~ m !!J
m EOEm °c ~'cc ~~ . ~d m ooO ..°w ma~d~ o o~
U'a~~~ME ~$»°'_mB ~ pE~ ~mmQ~v ~' EpEE°. N~ No. cud mdiLmILe ~mCN~rmrmm U4 O.~Zmm a ' ~U~~ m~ m m V a ~- i,Up ~ ~ yj N h °. O C v. a C ~ ~ (O d C ~Q O!'a m _U M N ~ ~
Q.' ~ ~ H a 1°p ~ ~ N .°
oW' v o v M m -~ 'o E r -~ ,o E 'E .c M 'o . ~ '~ m $~ ~p ~ c ~ n m ~ chi Z ~
~ ~' E ~ 'a E ~ a.
m ~EoE2vvN$~mN$mN 2.~ pwEl°Esty°inI22~QQ~. OT'00>.D
O Z O h fEn N C N ~ ~ C ~ 9 T vi 'VI C ~ p U m m w ~ ~ p ~ ~ 01 N , m L C t C
m ~ N
O ~ U ~ O O O O m N O O m IC O H _O' m O m m N ~ Y =~ p 7 7 p _O O U T ~ (~
° ~ m ~ ~p m M tp m y~ . U U Ol r. y_ O w O (l7 f~ p.'°cvy~~~~,-GO;D~~c~.~~~m~HQWN~xv~~~ 'Lo'~~~QO~Qp~Qc°
'~°w~m~'°~$~'~°~8mn~'°°°Bo.o°_ -'°-,Qo.a.~~.~E-~o~'a~MO~~Mm' m y' E E E E .E ~ ~ ~ ~ ~ ~, ~ E E m E ~ c o ° E N E E ~° ~ Q ~_ Q h _m IL v ~ v ~ c '°c ? -° 0 o E ~~ ~ E .~ o .k ~ E E E ~ o ~ ~ ~
~ Q
C G ' .. G ~ C O 3 7 3 m '° in m 'FS ~ ~ m ~ > > ~' -° ° ~ m m ~m m m E c ~ c c_ ~
°i ~m ~d ~d :-o ~ m. ~ o m E tit! s~° E w yr O 'E m f W m m ~ ~ °~ ° r,, ~' .c ~r YS ' tS 9; . o ,~
° Pi ZS t5 2S ,_.
° ~ _ ~ °c o n o .° v ~ U ~ ,D m~ G p ~ U o ~ C 1°
p m ~ N d d ~ ~ i O p ~ a0. ~ O 2' E a m fi m ° 3 ° > a a > a '~ ~ ~
o mN w >.>.>.~ ~ZZ ~vZ >, m i,°'m~E ~Q vtr~ $ eU'~ 00~-~'O mD0 =ZUmU~~~mmOOmWOw°L.~mm~nE~NTaW ov'i~~~~'°O~~ O~a~~a aD M p N
~o N
of ~ °' to p a~ho ~ ~ ~ °~ ~ ~ °~ m m ao ~ i~~~ m O ~ ~ O 1C1 10. ~ ~ ~ sf ~ c0 O W f0~. p ~ p r O ~ ~ ~ ~ p p p U °' °' °° V V
Q N~NNt°37D tLU°~a u°~~ ~n ~
~°op~rn°~o;o;rJ U
V' D N pp p r M(p ~(~ 1° N N N~ 01 aND 0 M ~ M1~ M1(~ h h M M ON7 11~ 1f~7 N .p.. ~ ~ ~ M ~ ~ fhO a~N- N e- r N e1°- N ~ ~ ~ ~ ~ n t~~. M h r0 00 W
N ~ M M M fD ,- , M ~ (~ Q O
OdOa O ~-N M hm M PN7 O ILOWm4'!~~ O~ O W ~l~L ~ ~ NNN~ p O O
Q ~ ~~~~~ ooh oS ~~ m ~~on~UU~g U Q U
U -U ~ ~ ~ rn W W. aD uJ W ~ In ~ ~ ~ W ~ ay ~ ~ M co ~n~aQaQ <aa a~ as ~ ~aaaaQaa~ ~ v v z~zmmmm aam am mm m maaaammmC9 z m~ m~ m m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
v c~c~vvvvv vvv vv vv v vvvvvvvvv v v v O WO ~ ~ M h O ~ O M O
O h oD N
N ~ ~ m O O O O

~

m p~~ ~ m ~ m ~ m o ~ o~ W

a a Q ~ I= ~ (j ~ ~ ~ ~ ~ m o ~
a 1= ~ ~ ~ m f"
rn ~
~
~

tiW ~ ~ O O ~ O m Q ~ ? - , i ~ Clm~ o ~ Q ' ~ tii ~ Q ? Q
Q O

N N N N ~ ~ Q
O O ~
a N r (~ O N ob ~ (WY N N
~ ~ N N N ~ ~ N
N ~ N

t~h (O c'~ f0 01 V' O 07 O ~U 10 ~
thc~Ih t0 (p f~ Q) t0 O ~ N h a0 O O ? c~ C7 O ~
N O O O M 0D ~ O O
V' 0) O
c~ 07 O
t~
~

c0 n r~m .- ao cn u~ o u~ un 0 ao ao v v ~ co ~n ao o ~ s~ co ~ 0 n v r~

conm c~~in~ c~c~~nWn c~~ c~~c~rngimW oo ~~~~m ~
o c E E E E E E
E
E

O d E 'p U U U U _U C'->1 m ~n~ 0 E ~E ~E E _U ~
C G N N ~E U E > > O
m f0 E V
V (0 !0 E
G C E
L
~

D ~ U pp N Y ~ ~0 O
U ~ p~ b W ~ 7 > YO 7 y A O
~ > N 'O

$ 7 N ~ Imo m m U m ' .
m 'm ?o ~ c E
c N . - EEE E ''c ~
- m EEE
W

.~ a.t . _'~'E'c -'cc~-' EEm mm w - .r Z 'c o m =n a) ..m. ~ UI
U ~~ M m N 0-! m 7 N
'O
'O
E
'C

~ t~",~~Tm~OGI~ UN N -~U~UU UUU Udm aao o o ~ d'~~ v Oo ~ m ' ~d E

c ~ m o a v a c o.
m m ~ ~$ Ea c ,a r c na ~ d ~ ~ a c O
m ~ c c c z' c ~ Z' Z' Z' ~' Z' Y
Z' U U
~

N tGN T c0 N
U U IL~~(n t ~ ~ ~~~~U ~~~ U~~W m T ~
U~U
~

~ .1 n iAfn N N

a1 C Cm C C
C

a l f U
fnfnN C~ O p N ~
C7 p H O
~ U H ~
U
~
y Z

t0 Z ~l N N
m Q ~ _ ~ r c ? tm U U z , ~~
m O U Z ~ ~ . c oo ~ .
~ c c p O ~ ~ j Eo ~ . ~ ~ w m a~
~ ~ 'i?
a E

[~ 'J . " o ' m ' C d m . . E ~ ~ ~ ~ rn ~
z z o~ ~ Q ~ a L =m c z a _ m ~ ~
.g 8 i t cn v~
' ~ m m _ ..
U C'~ H ~ ~ a ~ V 8 i C . Vl N C . V H j ~I M - ~ V
~

T~ z C ~ ~ > .. . ~ ~
~ d ~ . ~ ' V! _7 m ~ d a V
G . ~ ~O. ~' ~O.

f Z Z m~~ Q~ ~~c E ~ oa~o ~~o a ~ ~ Eo ~~o~

_ c ~

> > M rn ~ ~ m ~ _~ O m ~ o, .o W ~ ~ ~ 'c ~ H 0 '~ r w a n f~ Z0. m ~ d ~
' o ' ' d v , . Q N , S n !n(nva c c - V ,~ c o D.W E
,~ z O'.Q=Q'Q VQ~ ~ E
d c c VUU~a ~a~

m ~ ~ O O C 7~ 'a'n ~ 'Q y m m O C O O N
1 U C ~
U
C

N m m m ~ u C ~ ~ o ay. .d ~ ~ o ~ ~ ~ ' ~, 0 ~ U o ~ m ~
~

Y Y ocomo . c o c ,5~a c '~
on.o'a~~,~''.~c ~m~ a - om U a~a c~'oa c xvE o v?~~in~ -v 'oEc ~r,c a E c a ~oEv m =~ o x c ~ a ~ ~ ~ c v ~
~ 'rom ~ o ~
rn o m a~ N
a ~ o ~ ~ E o~
'~ a= c ~
~

et m o~ t m _ m ~ m M
a t Z U U Q
~
~

C C Y ~ ~ ~ Q 7 O ~ U U a ~ O
~ . U W ~ Q O W j~ V O

C
~
=
U

U ~ C a00 C ~ m ~ Cn y T '~N O
G~ d j ;O E U O
m ~ ~ N m ~ ~O
U
p > 0 > tp~=. m~a tG~a~ _UU
1 ~p .
~0Qj0 cu WE~p~L?a~
' $ m -m Uoo .'cLUiEm mmE m~o~~~ ~c~
~ ~ EEH -a~Z ~ mE~a a ' o ~c !R~ ~~~
c t ' '-'. ~.E _ vWcc.~EE
c '~~. ~ cSc, E
10a a U w c a a tp P c E ~ a ~
c v~ ~ ~o a E ~ o a ~ ~
o '~ a N
m ~ E Vi m Q ~o ~ .o " m f0 cn m a C ~ ~m ~
t~ "
E o 'c m - 'c m ~ ~
U ~C ~
U U m ~ ~ m O ~ ~
O ~G
(d N

~ O ~ N C T
o ~e~ [JJ ~'oa~d ~.k~omc.u!'vEco ~ 7a W.mUO.~moom ~o od~mm oo [y) v ='o~u~imnad O
O

E _ _ ~
c v ~ c ' a c 'G
E v o Q
a ~
c ' Z o-~li a m a :- a ~' n m ct ~S o a E
' .Z
~ a v z. z ~
~ ~
~Z
' m ms ~T
E
'~
=

U ~~~lll~~~~ ~ $ - i 2 a 9~ , ~ o ~ ~ . 2 s c ~ ~ o . ~
~ U Z3m ~
~a~aU~~~ Q D~ ~
l~~~
v Cf m .n t' UDa v in Ct a oOt o i~

o~o~,r ~ c~ o ao m w o, r t~
n r~o o ~ ~ N M
N n o o ~p N ai o O N ~ O O O ~ ~ O ~ N ('~7 N ~ G~0 ~
m ~ O O O N .~ N ~N..
p O (O O p~ ~ O n h e- O ~ N r N N ~ ~ ~ ~
O ~ O
~
O

t O
~a~Q N N ' a t 0 O O
a ~ a N w a ' N~ N O
a a wr~ xu~r~w Via ~N~

N N n v c, c'o d.
T N m '- '- .
N N

Q
0 o or o o n o o n o v n ~ O
~ ~ O w ~ rn ~O N O o O aD a0 O N !~ O 10 n 00 ~ N O K7 ' O O
IA

tDapN l0 IA (D ~- d' Ih N N r ~ h O
sT N f0 N M l0 d N
~ l0 f~

N ~ ~ O
O

M 117 O ~ ~ m m m N
m O N
y~
N

00 t~t~iJsr~ oo o '~n~riQ ~~Q D' oo o nMOo C ~ U U o V n O ~n ~ o d. O
D ~ N ~ D ~ ~ ~ O
n ~ O ~ U
>

V iv~ m lU UJ U W Q ~ ~
OD lL .t N t m !l _ z as ~ ~ ~ a aaa aaa aaaaQ , mm~ a ~ Qa z z m a u~ m aam mam aammm mm mm u.i m~m~m~ m m~ m~ m~ m~ m~ m~ ~ ~ ~
m~ m~ m~ ~ ~ ~ ~
m~ m~ ~ ~ ~
m~ ' m~ ~

c~c~c~ c~ c~ . c~ m m m m c~ c~ c~ m m m m c~ c~ c~ c~ c~ c~ m m c~
t~ c~ Cs c~ m Cs c~ c~ m c~ c~ c~
c~ C~
Cv cn ~

O N t0 ~ a00 W ~ ~ n co 0 0~ ~ ~'~ ~ ~ cnc n 0 o ~ n 0 o0 op co m w o g o 0 0 0 0 0 o am n ~ n v o~ a~ rn o~ o~ o~ °' 0o r' o~ oo ~ .°-' .°-' o~ n n n o~ n o~ n °' _ o~ n o, n n o> n n cn °.' n 0 0> m o~ a~ rn m a~ m o> o o~ o~ rn a~ a~ m a> o~ o~ o~ V m o>
W > j Q ~ ~ ~ ~ m d m m m d m m U ~ ~ y v d m d d d d m It1 m °' ~
o. U
~ o ~ -~ g ~ ~ ~ ~ u. v~ m In u. v1 u. u~ o ~ m u. cn u. vj cn u, v~ v~ ar c?
al > vy iri o ~cb ooo>d>oo~ oo>o>d~oo~oo~co~ ~'oo~oo>o~od~rn~ Nor oo rnw ao O ~ r N N O U r N N N r N r N O U r N r N N r N N O N N N N N
tn (p V n N n t0 n ~O cb N (G N N N O n ~ ~O n n N N cD u7 O VW p p aD O n O (D N MwY N u7 1n ~ i~ n V' ~ O V' t~ N (O O> O) In O N M CO f~ fn O
N i~ O m N O) I~ tp W Q ~ n n t'! f~ N ~ 07 O) aD [~ [~ fD W C9 ~!7 O) 07 O) In (p O n a0 t~7 (h r O1 GO OD OD t0 CO 00 m OD CD 01 OD 0) c0 W GD OD aD O) A Is 07 °! ~ n n t0 f~ M M t0 c0 (O M °~ O) O Ol O 01 Of W M °> O Of 07 O O
°~ O W O O 01 O O M fh N_N N E E E EEE E EEEE EE E E E E
_'~ $ ' » » » » »
U ~ ~ ~ U U U .~ U U U _U U U U
Q ° ~N W N W ~ N m ~W ~N ~ N N N W N N m U .~ - . ~ 07 07 01 01 O O m 01 O) 0) 01 O) O O! 01 O~ C
a ' ~ '~ ' o ~ E E E E E E E E E E E E E E E E E '°
" » m ~ m a, c c ~ ~ v r c ~ ~ c v z 'c c ~ c c ~ ~~'m ~ o a'r ~ ~ v ~ ~ ~ y ~ v ~ ~ a v ~ v ~ '~ '~ ~ a ~ v ~ v ? !!' o a a i°ca a o ~ ~ .~ c .~ ~ d ~ '~ ~ ~ .~ .~ ~ c c ~ .~ ~ m ~ m ~ o '~
~ a °' v ~ n v n n ~, Z, .,mQ Z, ~ Z, Z, ~, ~ Z. Z 2~ 2~ Z ~ ~ 2~ E 2' ~ ~
2~ x 2~ ° a d ~ ~ F~ ~ t0 t~ U U 3 U ~ U U U ~ U ~ U ~ U ~ U U ~ U ~ U U 7 U U' Q
m ~ _ m m ci a m Q Q' E
U tND m 2Y' ~ O
O '~ r T C n W E
° 1~ L m C m O
V~ C C C C G C G G y m W U
(~ m o, m . , E E E E E m ° ,coo a,; E E - m m m m ,o c E ~' ~ E
o a: c c c c ~ 'c ,~ a o » ~ m m m ~m m m c a C/~ w ~i~ 'n'~ ~ E E E. 'Eo ~ '°
°-'E'c~m Ea'~ L L L L tE :° U d JO
n o a E o ~ E n n n n o_,oc z ~ a U ~
E c m o c. !~ c o o c c o c c Q c o O ,v_ Q
[H $ o ° w m E Q m ? E m Q io w = a, ~ U
OI -O O ~ O).O L m m m ~ N m - d E ~ N N U N m ~m'~mm°=m=~a on> >on onE on .a En m _ .'°c a E ~ ov. E E W a'~ ~ ~ R d m m m A a m m o .E m c c E ~ F- ~ E ~ c s ~ ~ L s ~' t s ° L ~ °' of ~ 'o m !-°
~' U c°; Q >, v of m n W ,a n n m a n m n m ~ ai ° v o L_ m cZ °'y °act'°c°cai °c°ca°c~w a ~° c H n ~ ~ o ~ ~ ~ $ ~ ~ ~ E v 2' E Z' m m ~ E ~ ° ~ ~ ° L ~ ~
s a ~ ~E y m '°c~~ N~r '°e'~ °'~ _°.g.°. o nc ~. a ~u=
°mv :: m°v ~ a m . v v E E E ~ o w co m in E ao H ,~ E !~ c., M, ~ ~ c m c ~ cco ~ c ~ c m ~ m c ~ m c ~ O ~ E ~ °
° a oo~otD°c~QQm m°a.°m~m°m mnmaEmaov ~N. a ='v !.°
Qt'yu"-oyo°o ~oao,k?~.,R~~oo ,~a,~ao,~o.o~H~E E m.~o'° ~o p,na'~'ra v $_ a ~grgto'S ~v ~a ~ ~v ~.~'~ ~E"cn~d~ .m °.~ m Q.3.orOOw~~~~ soo'somoAOr mom'vomocE'~E'o 'v Em ~' > > Q Q ~ c E Q v Q E ~ E ~ ~ E v E a Q E c~ ~ ~ ~ E o~ c ~ of m a > >
a ~ 'c Z Z z ~ ~ 'o ? Z c Z ~ c, _ 'v ? c ? c Z ~ c a'> ~m _ 5 'Wo c ~ m ~ o' ov~00~EE$ u~~ vc~~_s ~o-~c ~~o~~~ic°r~=caic~~~WVv o a a ~ ~ a a o m m ~ ~ E m m A m m m m m' R m m ~ C C m N C ~ N O
,o a m a E a w a w E a H E a m m m m ~, E d °'c°~ dm$nn~ >oQo.SQ'>o~
>QSQ°~l'>Q°~Z.LOQm~ss° Q3on d~~cLn~~inin~a . m~DC~mom~ o, m'Dm'o~m'D~U ~c'n'oY OINfnO~C~CJ v o °o so m o n O O N N M O aD ~O a0 O 47 O 4D CO O ~ O N a0 O n0 CD (O GD 47 pp ~
Ot~07D~000007 007tOOMm WCn~l~~007 ~fn'1001(h~7~pmlM(~Oh ~~ h MU "O
(O O O O d' e- st ~ _O V r < r .- at r O O r lp O ~ N O
n ro 4 ~ rn a o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ~ o ~ .- U
D N Q Q N Q ~ IL X tL UJ lil X tll X 111 111 X 111 X l1! 111 X IL tL >- t1J
l1! Q 111 ~ Q
V' ~ ~ O V' O) c0 1p 1° CO ~° N t0 1n IA W ~I7 f0 In (O N In fp It) 1n N ~ O ~ r N 0~7 O N a0 n_ OD t9 N N N N N N N N r N N N N N N N N o0 aD n M ~1 ~ n n n n n n n n n n n h n 1~ n t0 (D t0 N W ~ O
N ~ V' Y ~ O O C~ n n ~ n n n f~ n f'~ n n n n n n n n f~ fh N c~ C~ c7 1n r O
O
M N ~ m N N ~ m n p r o° o ~ a- ~ n ~ d ~ a. ~ ~ a r~° a n ~ n. n ~ p n ,~°
N oo ~ '~ o o U U' Q U O O o ~ cn m ro ~ cn ~ m m ~ co ~ ch ~a ~ M co = a M n W n o ~ ~[UI), V 111 mIOLIOLUlm1011m11~W pJplollmWIOLmU°J41U °IOU IL
~LlJ U
1-- I- 1-= 1- r I- r f- I- 1- r 1-~ 1-~ ~ 1-- 4- r 1- 1- 1-~ 1- E
~mamC~'J mamma mdddmdmdd mamdamOQØm dd d GQ.d 00.
ml ml ml ml ml.ml ml ~ . . ml ml ml m~ a 1 ml ml ml ~ ao ml ml ml m m~ ml m~
m~ ao m~ ml ml ml m~ ml o c~ c~ c~ c~ c~ c~ w c~ c~ c~ c~ c~ c~ c~ c~ w c~ c~ c~ c~ c~ c~ c~ c~ c~ c~
c~ c~ c~ c~ c~ c~
r ~ ~ ~ ~ thD ~ M
n N ~ O ~ n a0 O
O ~ 07 ~(W7 O W W ~ m m O O O O O O O O ~ O p o m ~ m m ~ m m h M m a~ m r o~ m m ~' -' m w ~

tn o> t=~ ' f= o~ o~ ~ o~ ~ a> oy' ~' ~ tn ' t ~ o~ m tn o, ~ c c o> a~ ~ >
c c c U c n n c c c n > > > U n. ~ U m ~ m ~ tn~ o~ a a a o o~ o ~ - o > > a ~ a = ~~z ~ m cn ~~
>

> > o ~ ; o ~ ? c~ a a5 a .> ~ ~ '~ ~ b m o ~ a %
h Q

a ~ ~ ~ ~ o ~ ~ ~ a h c N N $ N r N 1nr N ~ c ~ r r 1h ~
N r O r O N N
N

0 ~ ~r r t0 r~ ~~'01W NNCO N lOD r ~1~~
h W m0 ~
n r ~ ~ t0 N V: t0 h. c9. tp ~ (..
( r O W O M O~ .p OSf ~ r N
t ~
D
tV r r r c0 ~

- O W (DO 01 V' ~O O CD f~ O In t0 N M
a0 M ~ M M ~ m st, W m h h of 'Q M !D V' M tp O (D 1!~
M ~O ~U O h (h sf M t0 ~ M M r M

N
m U

N '4! U t/l U m J ~ N
m 0 0 'E ' o _o '~o 'E
c c ~ c ~

m ~ d ~ ~ ~

r c a a ~ a n c a o o ~ ~ ~ ~

~ o ~ ~ m ~ . c~~
' a m v ~ ?~

E ~ w m N w E E '~'~ ~ d a ' - N ,~ E a~ ' N
E ~ E ~
.c 'C

N ~ ~ _ _ l m ~ ~ ~ m m C -3 ~ D a m = 'C C = ~ ~ .~' 7 = U t m ~ m a m m h m T a G C d j, m m 7 ~7U ~ _ G! U L .p, C ~m a m'. V O (O
'd U 'd ~1 o mE~~ t tm m ~ E'- mmR$ ~~o ~ ~'' ~'-~

. ' n a U ~ nc,m ~ E ~ U U V Z'U Z Z' E E
S Z' E E c~ E ' c E io ~ W ~ F

~ Cn ~ U U Z T t~ ~ ~ m ~ o U rv tmn U I In ~ u) Z ~ E 2 Q
Q ~d m ~'~

o c~ a> _ 01 C~ M M x m ~ n 'O.
'o tNO ~ tj V ~- ~- D ~ ~ % v v v ~°
h o ~~ ~ ~ ~ ° U , of a nj a>ioo~,? t~n~~m ~~i,~ma~'c~Z~ mz~ m U ~ acr d ~ N C~ U ~ ~ d m ~ E ~ ~ = n g d ' o. m v U v m. '- v~ o> ~ ~ c~ ~ ~ c °. o~ ~ o ,°, N ~ E E m ~ ~, c m m ,= W
H m o N ~ Z Z ° c ui ui ~ m d O E ~ ~ m a N ~ a o m a c°' ~ E x U m E o~ E E o ° a c Z c .c ~ Z' ~ E d o a m m m~ tm" mZ Z ~g °c °c.E cEo ~~tti °c~~ui ~E
tntn+r mUU(~j~ ~~.° c$Y~~.° moo~a EE a~
c c n. o.~ ~ E> j E~ v m s m o~~ m~-Q m~m'E-Q a~ rm, n o 0 o ui ~ ~ W t~at1 2 l m o o m ~ ~ o ma ~ '° E y .c 2 ~ Ivl :p U U E m N O N U nj ~ U U W t .~. - ~ Y ,p U > Y 'E 'o Q L
~'a > >-o Eo~ : >tnUo,>,~.,' ~'-pmc »mc UN_a t' a' Q thn C M ~ O 'p. ~ _ _ M ~ ~ m ~ m ~ t O N m 7 d N ~ ~ d '~ U m ~ o d N ~. ~ ~ m N ~ N E H ~ ~ ~ T' ~ E N ~ ,~,~ E N O, o m E o c E ° c -°° ~E N ~ ° C7 ~ U ~ o V ~~ ~ o c o ~ ~ p E ~ ~o ~ E '~ o a a ,~ ~ m mrn 3 ~ ui ~ ~ C ° ~' ~ ~ ~ ~ m ~ m m o» U m 'o E ' m E o ~ m c m o m °' m ~ o, ~ a, m m ~ o $ v m f.° m ~ m m m ? E E m ~ ~ E u-n c c_ IC_O ~ '~ d Ul m G m p N O N O U rn ~ ~ ~ C C 7 C N O m m j O m m. ~ .~ ~ ~ O
'° ~° E m E ~ E .f~ N ~ N ~ ~I E ~~ ~ E E E m H m w t E O ~ E 2 g ? E _c~ ,m,~
.t- H 7 > 7 y vi .- CI m r ~~ m C . C - O > > > m :p C m NE -~~o~~van ad. amna,m ~~ 'm'm,~~~ED~,dm ~~~ ~~~v v~z '-°
o~~wvt~'a~~'E~~E.mn vmWa~n ~~ mmmEomvmio~dov m~o~ E_:o~
°L'mf'~aWco,cU°c°m°mmm Q'~ oo~mm~o'~a~c~c oc ~E m~ m o ° E6 °v7~~W ~' °: i.i.>,a.~ m a~ $'o ~ ~ i.~~ o _ m ~ cri ~ U ~ U d U 2 ~ Z ~ x w in d ~ ~ ~ m m m z m U m U ~ ~ m U ~ x m a V ~ N p O O00 ~ m r_ OMf N . M GhD M N
M N O N h O ~ h N M m N N N N_ ~t7 N t0 V' 1U N
h h r N O M u1 10 r ~ t0 r O h O N h ~ h N M 10 O
m N O N N O tp O O i_~ M ~ N N O h t0 O O r ~ N ~ ~ N t0 O h O O M O r O o~ O O O <n M r ~ O O O r O~ M O ~y, t0 J r J f~ J m U ~ C~ J m J O~ m U ~ lL O J lL O h IL o7 m Arab a Na a a ax aNNn1 ~aa a >.. as >- x M M W v ~ o h N m h m M h M ai M w h h r w m N M v ao v v M
h N ~ ~ N N N h m ~C!M V1 ~n M ~ N N ~ N c m m N m h m O! O

h V' a ~ ~ N ~ ~ O ~ N ~ ~ O
m 0 N V O ~ M N
m r N

N f0 M N M u7 ' p ~ r r m V' 7 r X Z Z
N ~

~ N N m ~ ~ ~
P

a0 tn ~ u07 ~ U N M ~ ~ L N lL N ~
m N ~ M L t~~7 p O ~ ~

O M g h~ U m~Z Oo ~ o Q ' a OM

> o o t > V ~ >~
~ U U U w ~

U ~ V ~ g Q U a Q i Q E- Q
U' ~ rJ- ~ ~ U u ~

tn ~ U V N b~ rn ~ ~ m Q U . v tn Q
N Q ~ Q ~ z m g a aaa~ ~ ~~ ~ ~ as aaaa a~~ ~ a a~ a aN~
v mmmm z ?x x v mm mmmm maa m m m m N
mZa m~ m~ m~m~ m~ m~ m~ m~ m~ m~ ~ ~ ~ ~ m m~ m~ m~ m~ m~ m m~ ~
m~ m~ ~ ~
m v c~vvv v vv . . vv vvvv m v m m m m v v vvv v vv v m m vvv v O

O n ~ ~ N ~ W
~

h r Q! N 01 m W ~ N N

O O ~ O O O O O O

~ rn m rn m m ~ ~ W m ~ ~ ~ ~ m ~ ~ r~ rn ~n h r' c o 0 0 0 o W ~' ~ a o n ~ o. a c ~ (V17 W IVi! c c a ~ 5 > > > m ~ m o ~ Z Z Z Z Z O Q ~ Q z Q -~ Q Q ~ ~ ~ D d D -~ ? ti m tn z O W c 7 (~ c~ O I'~ N W M 01 O7 (O t0 c~ V ? o Is O O C c'~ V' 07 ~ t~
r r r r r N r- N N N N N N N N N r N t~7 N N c~ N O N
O
t'~7 ~D O f0 c~ N tD V 4'! (n N a0 c~ CW O
N ~ W O N OMf_ Oh1 f0'J_ ~ ~ N ~D h t(7 C7 V (~D cal 10 ;O OM7 r N O tp O h O
y'7 O P7 O M 07 W ~ N r ef ~ CO (p N
M f0 (p O h O fs. In O V ~O O OG O) O O (O O fv O O ~ O 07 c0 (p ~f c'~ fn r V Q) V' (O 01 07 M O) C7 ~O u7 f~ c0 (p f'1 (O t~l tO ~ e- O) O) M
f~
E E E ,~ E E N N N H N N N E E
~O ~ ~ ~ O ~ ~ ~ ~ ~ ~o ~O O 'b ' ~O
a~o m A ~ m m m ~~ 0 0 0 0 ~ ' 3, m 3 E ~ ~ ~ m d 7 7 ~ ~ N 7 rJ ~ H U U U m m m m m d m a o~ of of a a o~ o~ o~ a a a $ a E a o~ o~ o, E E E ~ °-' E E E o .o Io .~' ~ ~~ ~ ~ ~ ~n w E E E
7 G C C = = O ~ C 7 C C td W fO N 7 3 7 ' S 7 7 C '~C ~ ~ a1 r d m a d d .c .c m d m m $ H ~,' v 'c '~ 'c 'c 'c m °= °' ° m a o o m ~ ~ a a ~ ~ .o m o 0 0 o a ~ a a ~ a a m m m ~ o ~8.E E ~~ ~8vt~ ~ E ~ m m v ~ 88S8SS 8~ ~ z~m 2 2 2 V U U g ~ U U Z U (n tO (p ~ ~ ~ ~ g ~ ~ ~ U U U

c v N N 'u cj z ~
'~° a~ rn ai d z ai '~° ~ co gin.
.c '~ " ''' v q.
tV uj lL , °' m (9 m D ai a p, 'o o a Q ~ N
V 4J IN N a y~ O z O U ~ ~' h N h N E. r m 11 lL ~c ~ c~ S v N z ~ i6 m ~ ~ H m fn. H p a' E > > :! a~ e: E ~ w v~,t~u 111 as a m~ m ~ m o. c ~~ m ~~cE m ..
° m m m N E
t0 .. ~ H .' d m Q Q N N
O ~ ~ O1._ O o O N C E N ~ d ~ m N N ~ m .G a n E e~ U v ~ '~ N 'i"" ~ 'f"n m ~ o ~ >. ~ = o ~, ? m m E
vn ~ d d v o .~ ~ 0 4 ~O o ~ o ~ co 0 0 .~ ey ~ Q ~ 'v °3U'. (' aooi o~U ~ E ~ Ov .o H,~ ~ o °:w U U ~ ~ m~~o v c d Z Z ti ~ u. E o X E .~ E m m d m d m E p m ~, o ,~' L o Y °' °-' ~' Q a o W m c m c a~ a a _o ~ m ,Z, n v o 8 O O N ~ H ~ ° = m c ~ °~ c ~o c. o a E m 8 $ H o ~ o ~' 8 r d w ~ ~ v ~ m m m d ~p H' ~ m c H W C7 o p o H U' > > H t_n v (~ c ' ° E ,o ~? ~
v U T U 7 r L N y~ O 47 ~ V H ~ M ~ ~t ~ ~ 7 ' H ~ ~ O 'O O E (/j M ~i p ~ ~ m a m p, '~ 'a ° v m m y m :Q m co d m ~ r ~ M m !9 ~
'a ~ o ~
,_" m z E E E '° 9 E r°- E '- d E E t m ~ ~ E x x ~o v v, ~: x a m R ~ u. ~
'? ~n E E m m ~ o~ c p~ o m w m E m W ~ ,n ~ 'm °'- k E
EO ~ ~ ~ ~ ~ ~ ~ U ~p ~p ~p O O O ~ O > ~ C ~
°' ~ '~ E ~ '~ ~m v '° v ~ ~ '~' ' m ~ L c ~ 'E° ~.~ t m c~
a C C O7 0) O! d a b1 01 ~ C OI U C C C C V D ~. d N a N ~ ~ 0l ~' ~ O a N E
H ° H >_> >~~ ~~ ~ o~~~ H ~iox'a_oZ v ~~.2 ~~ ~.~~ ~.,tp"~ a o ~~2 c ~ a m n ~ H ~~ .'c ' ~m o "' 'd. fl1 Cm ~ y N ~ L r L s V ~ ~ ~ ~ C is ~~° O ~m ~ t 8 c o~_o °~ 'n o n v ~ tS 'G d ~H t5 ,0 8 'G. $ .n ~ ~ 8 ~ b o' a. p~r ~ m c'3 is d m m ~° m m p. ~ m c m m m m W m m o0 0o i~ v ~ it o E ~ ~ ~ ~
m n H E o E o ~ ~ ~ $ S. ~ a ~ ~ E E O ~ E d ~ U ~ U
T O O C O O O T ~ O ,C O O Q" O to m r T T T 7. >. t >, p O ' p g p C
gx ~x ~aU U~~U nHU 8xao 8Tn vi~virv~ ~~~~~~ a~c~ o,m c,o~x c°~
M ~ O o' ~ O O M V l n' l~ m a'~O M
~ V' ~ .p~ O Q1 a0 ~7 Of 10 00 m O aD t0 (D 01- O N ~t0p N N W N
amp ~~~N mOm001~1N0007~t~n~~OVO~~N~NNO
N O O O O O r O O O 10 1n O 1!7 II7 p~ V' ED O N
N Q~ Q ~ Q ~ ~ ~ Q ~ ~ ~ N N ~ ~ ~ X N ~ D UOl ° h h M O O O ~ b h h h tm0 h h th c~ f0 47 t0 a0 C7 10 < h 07 O
W n tn ~ ~Y V' O O ap t0 (p ~ OD OD ~ V ~d 4 O O Of V O f0 f0 O1 ~O ~ ~ h 1~ h N O cn t~'7 N ch tp O O t0 N N N O N N N h m O a0 ~O.
th h h h at ~ h tD N t0 C~ f~i t~ f~ M cn ~t ~ V' N C~ V' v- n N M
m (Mp ~ N h 10 (n ~ CD 00 ~ 00 ~ ~ fn ~ (~7 Q Q
O e- ~ O O N ~ ~ O ' p0 ~ ~ c2 ~ ~ N ~ (U Q ) N Q) Qt°LU°. °~~°
°No~~~~UUCr~'~(~~'xU~.jNNV
T o0 o N
m ~n a,a ,a,~~Q a r ~ ~ f0 N tUll, ~~~ ,~5,~~ ~~ m 1O11QT
~ ~ ~- .- e- '- _ _ _ aa~
~m~ m~ m~ ~~ ~~ ~~ m~ ~m~ m m~ m~ m m~ ao m~ m m m m m~ m m m~ m m~ m~ m~ m c~ c~ ~ ~ c~ c~ c~ ~ c~ c~ ~ c~ ~ c~ ~ c~ c~ ~ ~ c~ ~ c~ ~ ~ ~ c~ ~ c~
t0 O~ N OV
O ~1' c0 W h h N ~ e-p 0 O O O
_ ~ O O ~ m O O O O O O O O O O
t~

w o> W m m o~ w m a~ m m m m m m m mro .°-°°-'mo mmm °_'m_,pm m m m o °' °~ ~ F= t_ m m m ~ m ~j, ~ (S CS m >- m N F~- °~ f:.
°' °,' > j ~ U U o ~ c o ~ ai ~ W ~1 o Q p, U U Q U ~ o -~ m O O Z -> > Z ~ ~ Q D O Z ~ ~ O O Q O -s 2 m ~ N r= O O N ~ /~. N r V' N N N (d~7 O N N ~ N O a~~- N
w m w m o o co n co u~ m v oo w v o < o t0 47 ~O (O O O O ~ t~7 _fh ~'7 07 O r h f0 N th m r ~ ~ O
M O O N O O w(p O t p_ .- M ~ ~- ~ M ~- ~pD N them c.n~ I : t n mMM~ V'~M~~f~n('O)V~ MMCO~'d'~ M ~~M
N H
_O p m m ._ ~ C N N
m m m m m ~a C 01 O O) m A E
E H.4~0 ~ OHyCCmNp f0 m - .. j N H N > M H ~ E O H E H H ~ ~ .~ % d m ~ Y M ~ H
c c c c c o v c o c c c E E c ~ c d G) 61 ~~ N N H ~m ~p N ~a m m N o! ~ m n n d ~p n ~d H 'E d O. n H M m 6 !~ ~ N a1 n E N
W m l0 ~ W n U m m U m N d d W t L d n tC ' W
1~ H H E H O N H m H H O~ O ~ b n Q O O W n H
O O O 7 O O ~ a E O 'p O O' ~ a o O O O ~ ~ O ~' O
O O O~ C O O H ~ 'm O ~ O O ~ ~ ~ O E E L L O O O
2 Z 2 1- 2 Z ~ ~ .~ I ~ Z 2 ~ Q U T O' O ~ ~ S U' I
U' U' E ",mUrn m vv U~ z°~C v~tnVU~ ~ Q
l,' Z Z N N O Q ~ p. ~ ~
tn t0 j j °' ~ ~ ~ ~ 2~ % m m m ~ C~ ~ ai E
~c'ww ~Oa~ ~mo~~a~ m m ~~~~NO
tA tn ~ ~ m M a'c~ > > E E = Q O Z C~ a ~ o~ d ~ ~ O.
V U U ~ ~ Vml N (~ Z H
N "N~~v.~'m~ ~~~ tno U U Dm~Z ~Z_ E
dZ z QO D Nm n GjHUC N m .~~~.,~Z ~"~U C ~O IL~EmtL
o U (7 E ~ ~ n' E m ~ ~ E ~8 E ~ c a Q '~' U W V Z m ~ Z J~ .~ E c v Z Z $ ~f~ ~~ 'p ~ io ip n ~ .~ g m m m ~ 7 t1! m oy1 ~ ~ m m U U U a U ai m m r '~ d r m ~ m aHO °' o ~ tiJ ~ O ~ N ~ :2 m ~ N
~tZU w Ztan ta'n~"°, do mmdaco O O ~m~~ ~~ N ~ W~~mn m > U ~ Z ~a Z ~ o d a ~ E d ~ m ~ tai. tai. c °' ~ ~ ~ ti ~ O ~ .~3 ~
U
~(" ~ O E ~ ~ ~ O d ~ ~ L a w 7 M U U O N p~ N ~ U U U ~ H ~ H
~° tn ~ m U Z' U ~ E Q a o E Q = o Q Q ' ~ H a Q Q ~ o 0 0.
n = ~ c E ~ L ~ ~ n d ~ $ m ~ U m m = o ; m fD 0~ (~ ~ N c v~ ~ ~ ~ o ~ oz ~~ o~ ~o Eo ~ E U~~ o ~ o L m m ~n'm ~V v of nm_~m_~O m a ~tpcn o.M o o '°U 1i pE ~; En ~ o o -~'=QQX
Y U = t '- C/~ _ ~ ~ I, H H N. G C H H c r) a m 0 o m "'_ m ~ y .~ N E ~ N Y t- is E E .o ~ U v cc'a v c E ~ ~ ~. > E o off =~ =~ w ~ s ~ i ~ o r N U ? ~ U~ ~ ° E p ~ aNO a'~ m ~b ~ '°
H ° o Y~ U '~ Q a E~ ~~ ~ ~ ~~C ~a~~fito ~ ~ ~ol~ °~ a~~ ac c cl~~° ~.'c t tIl W E L. .C ~ C ~ O z ~ O' V !6 f0 ~ c Q .p C . ~ ~p ~ !O O x y ~ V
O H ~ p ~ ~ H ~ H ~ ~ 7 E O H C~J E H UI ~E r r 'Y~ U~ m m ~l ~ m CQ0 y 7 = N
~ t ~ O
c~c c. a~c~c~ owvuicZoc o ~~ cEabE'r d g n m o. m a m a H. m ~c m a~ ~c m Q c .n m 'p Q. o ,~. , n o. m_ m H d c.~~
o Q ~
'a 'a 9 a v ~ n n H m m $ c U ~-vo. 1 ~ H H ~ t v !~ o ~ c ~ H ~ ~ Z o m m ' m. ' W m m a a; ~ W ay w Z o ,~ ao ao n ~ n ~ ' m o ~ E ~ L ~° o a m n $ ~w ._. ~ D
E E D E ~ ~ E E a m H H m E Cl $ o~ ~'I c 9 m v I E W i a a o °ro o 0 0~ '°E E ~ a ei'~oc~o~c~°co ~°-o -m:E E~ao~c x°x° ~x° 3r.'-i?iZQ 8~~'8=~~xx n Q Hd~ ~U~z o,a'~~ omF ~
8d~ ~x°m~2 u~ ~ ~ m m h ~ N o o cn c~ <o h m o (D ~D f0 (O tD h ch O m m ~Y h 07 10 N b N m m p~ T ~ O m f~ ~ O O N m m m V f0 OD
.N V ~t tp O M in O N m 1~ 1n tn a0 h a- u7. In r S ~ aD r e- WO t(7 10 O N O_ g g O ~' r g ~O o U U ~ U U o m o o ~ o (7 U U r ~ U U
4 Q ~ Q Q ~ N ~ ~ N ~ Q Q 4 ~ Q ~ Q Q Q Q N
o m ~ ~° m o o c h co r> u~ n v o o N
o h r. n '~~ v ao h h h n N N o 0o co W t'7 H7 m t~ fh f~ m a0 O f~ f~ tn m m N V K7 N ~ h M ON1 t0 N N M r h a0 M C7 ~O M tn m m .o- m M h N N N
V' fn M N r .- h ('n e- r Cn t0 c9 m m C9 V' r .- aD m ~ h. 0D
mmOYVO~ C~ O NO ~~ ~ ~~~~h_ H ~ ~ ~ O ~ d n ~ O O ~ ~p O ~ O O '- 47 U.
p m ~ O O N h U~444Qom1-U-~ZIU-OODQ ,~~~~Q ~ Ea..
N N f-. f9 l~ ~ ~ J N ~ !'S W !L lL () <- N V' Q C9 N Z
M 'O' V' (t-~ U' r _ r fn _ (D (~ O' a~ ~ a= ~ a ~? ~ oai~a~ d a ZC9 ~ s d m~ m~ m~ m~ m~ m~ m~ m~ m m m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
c~ c~ c~ t~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ t~ c~ c~ c~ c~ c~ c~ c~ c~ c~
W m a~0 r Or N ~ ~ O h N
N N N N N cN9 M
m W ON W N W ON W
11~

o °' ~ ° ~ m ~ °n' ~ m ~ ~ o ~ m m ~ a ~ ~ ~ ~ ~ rn ~ rn m o~ ~ o, o, ~ rn o a c ,$ ~ .c a v~ rn = ~ Q o Q > j c c c c rn or °' w o' c Z 2 ~ ~ ti ? 3 ti '~ Ii~ Q Q ~ ~ ~ Z ~ -~ a ~ 7 ~ -'a Q Q d Q ~
~'' chd cb ~d'n'' d~ob d'dN~ ~$r~n~~ ~b nNdu- c~''~
Ip N 01 N N N N N N ~ N N N r N r N N r N r r ~- N r ~ N 01 r n st n (O t0 tD O) m n S O ~O (O O O n n O N n N V = O N
M n Q) O M M n O O (O N n!1 ~ 10 N M ~ 10 10 m V' ~ t0 Q) N M m N 47 O M CO 07 'P m ~ N p V' (D (n~ r (h t0 (rp O O o i~ O M O) O! ~ O ~ ~0O1 O
'mQ' ~~ ~~ M ~~MM ~~ ~~MCn~Ib~~M~MM~ ~ ~MlOnl7 ~~M
°' E > > ~ mo H m o E .E E .o o .o m _0 0 _ _'o _'o m B m m ° a~ ~ ° ~ m ~ d ~ ~ m o m o ~ ~ U O ~ U ~ m U GI ~ N ~ N m ~ U W U m m ~ E .°' E E .o m .~ .o ~ m ~ ~ H ~ ~ .a~ m .~, a N N H N t_ N E ? $ m .~ o, ~ ° E E ~o o 'o ° E E E E _E E E
H ~ N E w E
U U U U ~ ~ O ~ O ~ ~ L G m f_0 m L C G G ~ C ~ ~~ G ~ ~ C
> >3 ~o H m~E~ aH .~°oEm~v,'r3vEmmm~m' ~ ~RE~'°mE W
E E E E ro o a c ° o c o c ° a a ~ d m.° a a a a n a .° Q ~ o a $ a 7 77 7m o $~'~O 00 ~'~'H~H.U~U.~SSS8 H HH~oEH~H
D N ~ O d nj E cV M ~ N
H H 2. ~ ~. 2, ~ f0 O N (O ~ t0 O m m ~ ~ G (p E C Z 7 n U O a O N ~ aD O N N ~ r v ~m :7 d w n °E ~' ~°c ~ o. ~c d n acr d U' m E d E E
.o Z °- _° ~' °' ~ . H ~. o~ ~ c o rn o~ ~ ~ mH' e>
U U~ .N . ~- _UZ tn~:E ~ N e0Y ~ tOp ~ m ~U n'o~~ Q ~ E'~~?..'c'.EEa~'E~ ~ E
m v ~ ui ~ ~ o c c ~ 0 0 N e1 O m m W U' O C ~ ~ O C = d d U C ~ C
E c ii o~ E c n ~ y' °v rn ~ Q. n acT ~ O o~
N m ~ H m O ~ of m O Y N .'V'-.. 4i wU.. O W Q "m" a m c ~p v E °m n. ~ °m o.~o,°' n. 3.a ~'m' m ~ °
:Y N E r v ~ o N 'o E ~ cmo o E D ~ m E d o ~ ~ E can v o ~ N ? ~ m i a ri $ ~ ~ a o_ ~ $ N % a ~ ~ ~ Q o G ~i~~ a.2 ~ m ~ ~a ~ 'o.m ~mt~~ c c ~_~ ~N m ~~~c-U~ w ~°~
v ~ °x v ~ '_ ~ ~ N. M aW ~ a~ °' a m v m M o o .° M ~ ~"
f~ ~ M m~ ,v_ a~ m v M
E O U ° '1p N ° E N U ~ N O N N m N ~ O N 0 'V7 tE9 ~ W N O
~ H O fp WOtL v~N UO, OTUN TUU TVHOt.G(~Up$pH- - - (DG' U'C C1 r E .N a d! h E ~ G ° O C ~ 'E C 0 ' ~ Y Y N O ~' N ~ d EO ~ U d p E ~
o O
E o p W ~ ~ ~ oim ? H H ~ m o ~ H m ~ ? ~ Z Y o ~ m ~ m N ~ m ~° ~
m p N E ~ MV E 'ip U 07 ~. ~ ~ ~, (' 07 T H U O ._ U ~ ~ j U
M7fn~~ ~.C ~C ~E~C EN~C EN37°UV~7777 7H7Tm~C
m 7 (- fMV VJ ~ d 'C = GU1 d m U CU1 L 'C ~ ~ m U G 'C L 'G 'G ~p 'C 'C V V L
V 'C
M C U T' H 'W ~ C. ~ H T C1 H ~'G ~ ~. w ~ ~, ~' N ~ N~ C7 01 U m >, 0~5o..c~~o~NmUUmEEN EnH~E~~~umwE~mmm ~=%~~~a- ~''mE°m ~~y~~~$$~~~~~sasa a~asy~. $~s a c~~ ~~ m~~ mZS m~C7~2 UZ2 mCJ~A~~I,Ljtl~~~~~~~ ~H~~~U
a»n ~ m °~ ~ ~ ,~ cM~i ~ n n ,'tn °' o n m n _ m n O~ OO ~ N~MO n0 Y~MNO~aNDOONMfp~ h aOp.p ~t0 ~om0c~p O m O O ~ n t0 O m O O O O ~ M N m~ m N O n M m n n O
> o ° o m O m U of C! rn o~ W J rn o eMO ~ ti ~ o~ M °' a ~a ~a a ax~a xa x~N~~~aaN~N~ a aN~ao u~ m n m N c m o ~o s< rn o u~ o M OM (Np~ ~M ~ ~mm mW ONE n of e~-apCNpn mM
n M N n O n M N ~ m m N O M ~ fD m Q N M st N n n M 07 O h O m M O r M O M O m m ~ O O) ~O (O O ~ ~O ~ 10 pv ~
r ~O N M m sT m N ~ r N ~O N M '? 47 r .- M M M M M n O 4U7 iMf1 1A A W ~ ~ ~ N ~ ~ O n tn a°~oo a°°o~ ~ My~.Qo yU.n ~UmoaNOaNO°ooMm~m ~
$mVli moo a o Q o CJ ~ J h O J C~ J M U o 0 o Z U U C9 o U ~ U
,Q, O U U U' ~ U' U ~ ~ o~ o> IL U ~ ~ F- tn sf ~ i~i ~ ~ o ~ U u~ Q U m U ~ ~ ~ ~ ~ ~ t/~ ~ ~ ~ ~ Q ~ ~ tn U ~ tn w ~ ~d ~U' mmma m~U' m~~mmm~mmmmm ~ mmmm m~m m m~ m~ m~ ~ m~ m~ m~ m~ m~ . m m~ pp m~ m~ m~ m~ m~ m~ m~ ~ m~ m~ m~ m~ m~ m~
m~ m~ m~ m~ m~
C9 C9 U' C9 C7 (9 C7 U' (7 (9 U' U' U' C9 C9 C9 U' V U' U' U' U' C9 O C9 U' C9 C9 U U' C9 U' Q ~ ~ ~ r n n T' ~ ~ t0 N
M M ~ ~ ~ ~ ~ ~ 'W0' O O O O O O O O O O O

r ~ ~ ~ M o r m a0 t0 ~ ~ pp a0 M ~ OD t0 m O~ Of Of O M r r O 07 07 O W O~ M ~ V r m rno~ o~o>a~ o~mo>o~ o> o~o~m m o o~a~o ~Va~m~jo>a~a~rn Uoo Q~d ~~ °'U 't°' °' °'w' °' v rnvyV
U cto°,' ' t n ~'ozz ~~ ~~a', q~a~a' a' ~a'a m ~' aa'?O q Los doQ~v,~
N~NN WO ~°~NN~~NM c°v c~l~d'd' ,?~ ooo~ ~~''mr~r-r v r r r r ~ N N N O O r OD N O N ~ N
hV Wa~D(00 NN W VM''~~OOOV ~ VO'V fOD ~ O NOO('7 !'~ 1~(~OO~P07 VO'Ot~I00 tO N~p ~ V O ~ ~O (h cp m O»(7 O M W .- cD up7 O N CD 1~ h O O t~ O ~ N~ 1~ 07 c'~ f~ 1~
M~fr~COn ~~ ~~~f~OM('~~M~ M tOOfO~~ CO~ M ~f~~I~r7M ~ f~07M(Op~f~h'7MtMDfO~M
N fn _N al IA

O' O= O7 ~ ~ ~ m O O' Vlf/1 -O y' m ~~p ~ ~Il ~ ~ ~C 'mm ~ m v ~ m m L° m '° o, ~ m ~ m d v o, m '~
m d ~'n~ ~ a ~°a .~ ~ ~ °-°-n' _ ~ ~ °c °c W n ~ ~ _ ,o ~ ~ a n v, ~ .SR ~ ° E E E E ~' ~~ ~o E m m m ~ m t N w m N m E O ° .~
.,~ E E E
y m v v ~ c ~c c ' '.' ~' = E E E E ° ~ m m o m d c ° ~ 'o ~ c c c Nm T'~ UU~70VUU~ t t~n0 n C ~W mNm N UVEOmpU~IU
o w o o ~ a a a a c ~y d a ~~ o p v ~ ,v°°_ m o o E o o a ~m ~ o o p a a v E W m m ~ ° ° U ~ p~ U U ~ O ~ O l0 ~ t m~ O O ~ ~ O T
° ~ m O ~ T ~
O - W m ~ ~ ~~ ~~ 3 m x x ~ x x ~ ~ fn ~ x fn x F U U iO ~ ~ ~ ~ uJ uJ U~ ~ L~ O O ~ tn a c a a> Q ~
Zm °' U In c m m c vm, m ~ cv '' a W ~ ~ °' ci cv m ~a co 5 ~ x ~ ~ a n o 0 'c .B? ~ ~ v m cr~~ o .~ U' E c c v ° ~ s3 N c > > °' o. o p°n m Z '? cr n a ~ c c .~ ~ c m 0.. ~ X v c c z m m E E m. O ~ ~ W _n ~_ m m °' °' S. E E E ~ Z N m m v c°~ E ~ E
E ~~ O Nm~ OOp°~IW O cOUV ~ CC x x Ot C 0) .
C : Vl' N _: O O N H Z Z ~ ~ 'O C O' C' Z Z ~ p' -N N ° E ~ ~C ~O O m V O U ~ r O' c O m m m m m m N '.
m n °- ao ao E m V Z E m ~ W ~ m w ~ v E yn E
m m u~ ° ° ~1 ci cV o '° Q W c ° n ur m. o g m o Q m m t d N O7 O) d -°p CD ~ m .~ V' O m ~ N N d C N '~ d Z c.n nm~°EE~m U' c ~~ c °.n°'$°'~E
n_'°' E E d ~: °: ~ ,°k ,°k m t ~ ~ c 'o E ~ m o o ai o 'n m ao o y c ?3 d N N m E E d O O ~ N N ~ h ~ ° U ~ U U M ~ O ~ Q ~ E N E
7 H ~ ~ 9 N m O. ~ ~t U U 47 U U _ U N ~ x U
~o N °° °> c ~ ~ '° ~ m ~ ,Q ~ .~ O ~ ~m m ~ E E ~
m pap ~ a°'o d o c ~ ~ vh' cn 11 ~i IL ~ h h N ~. E E n ° ~ n c o o 'cZ ~- ~ m m = S a o ~°n ion = ~ p ~3_ ~ = E ~ ~ ~ 'Np ~ ~ X iWn = o~ ~ ° o O w ~ t~
ONN 4E7~ OINE~EE~E VT VV-C.GE N~fr(~mm NC~MNOMEE
- - O 0 4p N C U U V T .O ~~ O a O O O . (~ ~m 'V O = m V et O O ~ Q O U 8 ~, m Q H u1 N t O U V V > .m.. w r Q N ~ L ~ N ~ ~ m m O W 09 ~
o mrn rn w ~ ~ ~ ~ ~ N ~ d rn ~ O " ~ m ~ ~ m ~ E ~ ~ E E E m ~ U ~ N X m L° L°
m n m ar m ? ~ m " Y Y ~ c° c° N ~ c W ~,m W ~ ° H c c t r t ? E $ ~ ~ 9 ~' m m ~ ~ r =_' m ~ on > > > z v v ~ m m ~ 9 m Y m d ~ ~ a ~ v ~ ' c c 3 ° m ''.m-e ~ m > > >
~ a ~c ~c 'c ~c ~ 'c E E u~ ~ E m E c m ~. c U U m d. ~c E ~ v y n 'c ~c ~c ~ ~ ~o ~o ~ a ~ ~ a a '3 ~ 'c a a ~. E o a ~ ~°n W ~ ~ ~ ~ c m o .h c H
'°~c ~ ,~ o o ',m" .m ~ a ~
E N ~ d .U~. o U U U ~~ U U O . ° ~ m E ~ O m ~ p G C 7 E O O m~T O = U
~ ~ W O:~Q! ~U. ~U. ~U.
wOUU in~'~~'~'~'uIUW ~'O~ooao~Qm o~Q °Q mxx~x o,x ~~'ui~nU=x222 r. o o~ in r co 0 o cn o m d 1~ ~ M u~ (D to ~p V V N m mooo ~~n ~ononcocyvao ~ oao ~ Nn°°ni ,~ vcoaococ~ ao n a0 a0 a0 01 t~ 07 tfi M u7 O O a0 N 0D (C ~ O) N O ~O N O ~p N r M t~7 M ~t O V' t0 N f~ O O ~ M O t~ f~ f'~ O O O d. O O r O G~ c7 O N O r ~ m J ~ O~f ~ J ~ et _V~ M N yi u. o U o U U ° U U ago o ° 0 ,n °° ~ o°
X N N Q 7 N N Q N > > IV ~ Q Q Q Q '~ Q Q Q Q Q N 7 Q a ~ ~ N ~ N
M M O d CO O ~ t0 ~ M M O ~ ~ O W N c~
P ~ ~ ~ ~O V' M O GO N 07 f~ tp ~ ~ O f~ t~ N V ~ N M 01 O N t0 tD f~ O O N °~ N a0 a0 Q m V' K7 h o0 07 1~ h ~ ~D ~O 'Q c0 ~ M
O V7 V' 01 ~O th ~ ~ 1~ 'C M V' a0 ~ f~ I~ 07 ~ O 00 N 'Q O W 0) O) tD (O aD W (~ 10 h- N
07 1~ 07 00 N f- M do t~ N M N c'1 M M u7 r ~ a0 f0 r it7 r r r r r M r '- ~ C'1 M M t~f C~
O o NN n0 ~xWOM7~N O) Nmf~Olr00)~~~OaO
'p a U U a°°o U cw OU.. v ~ o ~' m o ti v v a ~ n n r Z °
O c~ r~
~i V ~ ~ U V ~ ~ ~ Q ~ = o Q Q ° ° v o o V ~ C'l m ~ O U
o° V
~ g w w N ~ ~ ~ ~ ~ ~ ~ ~ g ~ ~ S~ u. ~- Z U U ~ U U U U w U U_' E- o -~
~OUU . O U, 4~a ~ ~ .na~.N~m ~ ~ILtnU a~7~
~n>~~ as aaa~~a~ ~ N~~ ~ a ~~o~ ~ ~~a ~~a~Q
u~0?z mm mmma m ? x Za2 a m aa~d a mZaOm m m~ m~ m~ m~ m~ m~ m~ m~ m~ m m~ m~ m~ m~ , m~ . m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
m~ m~ m~ m~ m~ m~ m~ m~ m~
C~ t9 c9 C~ c9 c9 (9 C9 C~ C7 C7 O C~ C7 c9 (~ c9 c9 c9 O C9 O O C~ t9 t9 C~
U' c9 (~ (~ C~ c9 C7 n n Wn ~ m m ~
00 N ~ Ip tp h aO O
O tn tO O 47 ' ~ N ~ ~ h v- w- ,- r e m m m m m ~a m m m m m v~ o~ n n n a~ o~ n cn co m ai °~ m a~ a~ °~ m °~ rn o> ~ o a~ o~ o~ a~ ,o ~n a> o c~ °' m o °' o_> o o~
m ~~ ~' ~ o~~F-F=!=~ c°o' ~> m~ °'~~ ~W
o . 5 .n Q > > Q U U U o ~ c m ° ~ c 5 Q > > Q tiJ U U
z ~ -~ m ~ -~ d ~ O O Z ° ~ z 5 0 ~' ~ ~ g O O O
-' ,.'~ '' i:u- c~~rn~n~ooQooo ~7uS~ ?-' nv N ~1 ~- ~ r N O N N N ~ r r N N M N ~ r ~ O N
r ~D o0 t0 N 01 tp '~t V' ~T N tp n n O_ ~t n N 01 (h M O C~ O O O U7 (p (U V7 (O O to (O (O W n ~ ~ M N 1~ W Q) O N OD O (D N n W n O ~O N t~ O~ m co aD h U7 O~ ~ O r O O O ~ c~7 n ~ N e< o0 M M ~ ~ ~ V t00 ~ ej V' M f°~~ ~ ~~ f00 ~ c0'1 ~ ~ M O f0~7 ~ ~ ~
~ V' N m j m j .m .tn U .01 U
d m O ~ ~ - O N W m ~ m ~~0 N

m ~ m C U Op p)~C ~ m ~ ~ N
O j h C C m ~ O U O m N
E ~ ~ U E E '~ b m m m E ~n ~y E u, m ~n m ~ m m ~ o, ~ E E .~ m c c c _3 c ~ j ~ c c "~ E E m m m ~ ? m ~ ~ E
W N N U N ~U N~ ~~~ v~ N a~ d ~O- ~ T ~ ~ V ~ Q ~ m ,.m. ~ T a3 N
0 0 o ao ~pEE~>'Sa o,~,n;~o ~-o >;c oo~ a E E c~ E O a N m m ca E E
Z Z ~ ~ Z FL- ~ ~ ~ Fo- h lo- Z Z U'g t~ D O ~ ~ ~ U ~ ~ U in O t-~-ao 01 N Q1 C N z ~ N N m i a O ~ O N O CV N W ~ (V ~ 9 m d ~ f0 ~g ~° '° ~ p m ~ y m <° ;~ m °' E N E
N' ~ z ~V C~ a Q a~ m N d ~ V ~ O a r D r N O m 'p ~ m ~ ~ yj n U ~ ~ ~ m m Hi E U E U m W C
E ~ N In N m Z E- m m ~ C Y .m-.. ~ Y m O m C d o N ~ ~ d ~ E o D m O a~- °' ~ ~~ H a E w a n n n m ~ Z ~, N m 3. 3 ~ °~ o Q
U N o U N.~ H ~ H Q m m_ O m O $ a N ~ O cg N m O 8 Q r U O r: E E D. E h m (I1 Z ~ ~ H O 7 m ~ = W U m m~"v C n O
N C ~ N O ° Q O U ~ ~ ~ H ~ m ~ C C m lL m ~ 10 O V m ~ N L m m O ~ l0 (G ~ ~ ~ R L ~ ~ ~ ~ ~ ~ L ~ ~ ~ d L Op N ~ O N
c rr~. mf E n n o nv o °.o~
p S'°mm om mmmo.-~ ,~ e? aaE ~~m m~rcm n °~ ~ n v ~ .~ a'~ ~ . a a n H j ~ '~ a ~ ai v w. v ~ ~ w Q c ~ N "~ O
m c C N v aim~EZ~A~ °n~suaTm~°.~~Q_m:°.~~~~
o Q a o ~ o t m o m ~ ~ m o W Q. m ~ m m 'c n o. o r° w ° Z m ~
m of umd ~m0 Enco c~ci=Zm~$yi3~ro°Tp.nE~oU' oOE~m'Oa.~g'o~ ~u EdE Em~TU~~c'~va'ma'2j2~dr~vn.ac°.mtTB~ocTBoEo°' ~o m ~ ~.= m m M c o. M o n ° ~ E v m a o o c _L = E v m m m m a m m t m r ~
~ v~~g'~~~vOvpvN~E~c~rEnpU' d.E~'~-wE~~»~E~~~Aw~c $r~
W ~ W ° 'm 'C ~ ~ 'fp ~ M N 41 Z A ' O m C ~ t Z O O m .O . E 7 N ~
~ m N a N ~ N V O a! ~ ~ n n n m M U m ~p U U C a N N _U C ~ ~ C ~ n ~
X°o~ x°o~czW
~md~ood°'~~°o;~~cOUNUEm~'~oa~mmoaNm,c~~ nE
. ~~ E E p ~ 2 d tJ U V m M ~ (~ O ~ ~ Q O ~N v O ~ ~ a U d~ Q Cu T v ~ p ~ U
N i0 aQo~ N °oao Em_-m E m~E c'c~ oX~(7 ~ °~ mZ.~S_~'~ v E y'~~ v E y H m~Y
E c C9 E ' m ~ ~ _ ~ ~ ~o N tn v, Q ~ E $ a ~~'m ~ N .'C' m 'o ~ M a 3 ~ ~ M
o. H o m n ~ r' a N d~ V E N d O 4 7 m 7 r ~ ~ O '- O ~ fn E ~ 47 N m ~ e' C ~ V 'p ~ d ~ ~ a O ~ n E' ~ ~ ~ m t r d L. r D m N r ~.- T . Q O' ~ C
a m am c"3~c~> ~. ~ a ~~~ '-NJU)? ~~ or:~ u.°aZr'Za m ~~ a~ W~.E '"~~
~~ o ONN N O ~ ?'sy >~'~Q W ~Q~ c° o o ~s_ E ~Y ~ o'o ~Y~ am R~~fnQ
E N E C E N U ~ Z ~ U ~ E Q 19 01f W ~ 'm E m O m ~ ~1--O r O ~ U U ~' ,fg ' f i/i O ~ Z Z
S 4 = U 2 Q ~ = WU'' ~ ~ ~ in f~ Fo- h i, i~~ C~'J L tn =U' ~ ~ ~ ~ K U W. o, ~ ~ U ~ n in n'~ U 1W- ~
'd n ~f ~1 07 V' N (O Ice. O O O
W O CO N O h ~ 01 N O O a0 t'1 V' t~ n O O) (~ W m O P~ N h m OD r n ~ ~p ~ O ~p 10 N ~
V V' 00 n W O O O O ~ N ~ N ~ n. N p ~ ~p N ~. tD N
M N f0 t0 N N N ~O M M !h a0 O c_'I c~ tp N W N ap ap N 1~ ~O
J J -J ~N ILJW~,Of'D1~O N J~ ILLOL ~MlL WhIL IOL
a Q a N ~a a x a > > > x U' ~ a a a a ~ K a N .J Q Q U
n n ~ ~ O M O M m ~ ~ te c t V D O O N O U7 r O O) 00 D 0 ' V N O ~ 10 - u7 n n O) ' ( N C~ N 1n 00 O
M N N C~ 00 W f~ c0 .-O O O N a0 .-n0 O O r V' V' c0 N O O C7 OD 01 n N N Q) O O O t0 N 07 O O th c7 V c'7.
.- N r t0 tD (O M .- .- c'7 d' N
C~ t0 ~D V7 V ~ .- M
d o N o. V m O Q 07 M M O N ~ 01 a U1 m m N N

~

o' . ~~~ ~o z~~
E.-'NZ~~~~~~, N U ~ i j p ti q ~ t~
cc u >

Z T ~ ~ .~ ti _ t t t S j c u- ~ ~ ~ i . ~ Z ~ N ~ ' g Q
q ~ ~ 4 E" h ~ 1- F- ~ ~. a~ N
~ ~aam oa tn v~

a a m ___ a ? y m y y w a ui y y m ~ y y m a W m m W y >
>
>

i ~ i t n i i ~ i l m i i i mm mmm t m m m m mm I t ~
m i i mmm i .-mmmm mmmmmmmm-.

(~ t9t~ c9 C9 C~ c9 c7 c9 c9 C~ C~ C~ c9 (~
C~ C~ C7 t~ C9 c9 ~7 c9 c9 c9 (~ c9 c9 a~ v M
~

n ~ ~ ~ ~ ~ ~ ~ m n O N O~ O N aD O7 N
~ ~ m 0 0 ~
n ~

1O f ( f n _ O O O O O O O O O O

121 .

m ~r m a~ o> .. o~ ~ ~ ~ ~ ~ ~ ~ w m m ..
U o~QQ~~QQ c~ c °'~ cUU°'t~t1°~Q°' O ZZ~~-°a~~~ ~Q~~ QQ~00 ~DU°~.Q
c~ th ~ a5 ~ cb N ~ N N t~7 Q
N N N O N ~ N N N N ~ N ~ ~ r ~ ~ N N Ob O
1~ f~ t0 M N tn V' V O u1 N O t~ O O O N N O~
tC u7 a t~ G~ V' W Of c0 m7 ~ O c0 Wn O m (D O N N
(n tp tD ~° a0 tC CV o0 t0 N ~ a0 c0 O O O ~P V ~ (D W r- O O
V' c~~ ~ t0~7 ~ ~ M VN' V N ~ f0 M ~ ~ ~ ~ ~ O M M M C~ M
N E
N ~
O a O w w' E
O ~~U W N ~' O O
R ~ y N N 7l C C °~ t4 t '- ° '~ 'c n m E ~ a N h N tIl ~ N M N E E ° (p ~ ~ d N ~ ~ C M N
C C ~ C C C C > > C U T
E v m o a~ m d a~ d 'c ~c ~ m W a E E ~d m ' d ~N N 3 'N ~O ~4~J N ~N ~ p b N H E a c. v ~ ~ N M d 0 o E o '~ 0 0 0 ~ a Q o ~ o ~ o o c ~ ~ E o 0 E E N E a E E E c~ S d E ~ ~ ° o i x° ~ x d= z i ~~~n x° x z ~o' o v ~dN xx a z _o c ~ m m m E Z Z ° ~ ~ ~ v ~ E a_r c Z z m °' °~ ~ m ~ ~ °~ Z Z o ~; c y o~ ~
U n a o c m m a m .
UUmE Ecc c ojc~M (~O o w.
W1ZL9 0 °~ v E ~..~ ~cOn UU °'oaW '~~
i: ~ d ~ ~ ~ 2 w O ~ ~ Z ~ .,,,~ ;. .~ o m m n CO U E N N D D ~ ° ~ N 5 7 ~ c x g' C
o c~ c~ m N E C r ~ O d d ~ m m E w O
a ~ N N C c O m h ~ U ~ ~ ~ C U ~ U V
d d C
n r~ ~ ~- ~- n 'n o~ w o '° z ~ ~ c~ ~ ~' Z' o E
~ V O' V N w 9 g N (V m o i~1 ~ ~ C
1' f' M V7 Y ° W ~ O C
"' E E o o ar E O m ~ x x '" °''W°- m o~
.j. ~ ~ O E E D. _O M ~ '$ M C ~Q ~ o a ~ N
,g x x E ~ a~ m A °- y ~ '~° '» Z
U ~ m ~ di ~ '- O ~ m a~ $ tn ~ H ~ c~ ~ % of of Q n D tn u>
(7 o c m a m ~p p> > N 1 N ~ m U ~j U ~ v o o w o_ ~ c~j Z ~ ~ N ,o m ~- ~ t~, o ° ~ o ~ d ~ '° ~ ~ m m ~J Ti c~ 'c. o ~ o 0 o c y c y c.> m v O ~ E Z m H Z ay a~ D in v - o m .O Q. ~~ 7 ~p 7 x V E ~ , ~ C C ' tI!
m ~ d ~ o ,~,~ p ~ p n d n m n ~E o 1-~ ~ ~ ~? ~ O ~ o i-°~ ~ ~ ~ ~ ~ o x '~' '° Z o ~ ~ .D E a ar U d C m C N o 0 0 -~ ,~ o N ~ E ~ ~ '~ m ~ n o W E ~ o o » ° ~ z o a o m a m a o o z ~_E uw N a ° o ~ o ~
m c ' v ~ = c d d E d ~ -o° m d B M ~ a E ~ ~ ° ~ ~ n °' ~ w o m g E ~
m H o ~ c ~ Jc ~ tn °.~ c ~ ~ ~ ° ~ 0 7 ~ N ~ cw~ O ~ m d ~ d ~ m ~ ~ m ~°-~ ~ ~ '~ 2 ~ d tn cl~ o o m to a E E W m °' d x a '° N_ 2 m g m °-' tn .-is ~. a_~ m °' o o 'Y '~ °~ w v ~ M ;c ~ ~
m tn 'E 2 '~ °- Z o> . o.
O ~~ (L ~ oo ~ W ~ c..~°o ~ ,.~ m ~ ~ U ~ E N ~ j ~ ~ ~ ~ t L IL ~~~ W
~ ~ N 'q. "
VJa o0 o~U' ~~ o d? o m°m~om~ a~ a ~~~~mc0° ~ o »O
r°n0 c~~ no~UU' V
=a=a E~x° mQ= N T~ a~ ~~~ o~~w~z m °~aao'a ~ a~d~v c~tm~ c~
m NN~NO~1~ ~~ MfMD~~M O
W W O M N ~ t~ 1~ 07 c0 ~ N O O f0 f0 n 00 N ~ 47 N
N O~ p~ O M ~° N N ap :p t0 ~ ~ O> O O O n O h O O ~' p N N N h O O O O ~
o OL~, ~ tD t0 O a0 O V O O O p ~ ~ N N~
a '~ aQ ~ ~ NN~ ~ ~L ~ as a ~ ~Xa C7m (O CO 4J a0 N t0 GO a0 O
00 V' ~ W (O O) f~ N O (O 47 O 1° 10 ~ (D O aD (h 1° 1°
I-. ~ N o') 1~ o 1~ ~ d' ~h O O ~C N ~0 ~- V t0 M t!
N ~- e- d' .- .- .- ~ V M d' ~d' V M V e- v- .- ~ h r- cn 47 ~O
O N O N O ~ o f~ °~ °~ CNY n °f D D ~ O a tMU N N °~ N ~ ~ d O O ~ (~ °~ If1 b a0 N N ~ ~Q O QO O Q O N N O
_ 2IQUoU~~ E.-~U~ =~°~Q(J'~Fa---QNm fn ° ~ ~ n. o N U' C7~'V~'~VvhM-~ 'H I-~-~ C7U~' r W ~ ~ w a as w w ~~m W w t~ii 00~ ~ m m~ Q1~ m m~ a7, m .. m~ m~ m~ m~ m m~ op m, m m, m~ m m~ m~ m~
C~ U' C9 (~ C9 C7 U (~ C9 C9 (9 U' (9 C9 C7 U' C~ C~ C9 C9 C9 C9 t9 C9 N O v co ~- oo r- o~ w v°
o~ o ~ t- n s ,n n rN.n.~n coaNO

WO 01!66573 PCT/IB00/02035 m rn rn ~ ~ -~ m m m m o~ m m °' a~ a~ r' m M m w m r m m r ~ Y H f= t= °' ~' ~ °' °> °' ~ o~ o~ ~ o~ o~ ~
o~ m ~ W rn ~ o~ rn rn o Q U U U > >' a ~ o ~ w n Q m d Q m m ~ ~ m o~ o y c ~_z~o 0 0 -~a -~za = Q ~' ~v~ ~m v~~ v~ =z u.
cu dW d~ .~ d~ ~ ~ o~ d~ ab Q ab ~ .- ,1~ ~ ~ d~ dwE ~ ~b a d ~ N r N ~ r- N ~ ~ ~ N ~- ~ r ~ N N cD M r-t0 ~ O V V' f0 O O O O 4'! 07 M N ~ r If7 O O b r O 10 g Q1 r b 07 N ~O (O (D r a- m (O N N r M N m O N O V O c0 r O m ~t ~ O QO b ~ b a! N N N b 47 r (h O pp 01 07 0 h C7 'Q b N 0 QO (tDp ~~MMCr~Mfb~~~~~M 007nr~fb~fM~~fm~ f0~1t~0~'00'~~~1~
a .~ E ~ E n ~ E
_m m .~ . ~O
C C C m ~ E -E m ~ N 0 W O! 10 W
vi oW ~ ~° ~° ~ ~ ~ .~ ~ .o o ~ a a ~ ~ ~ o m ° v a~ a~ a n. n a m o of w a .p °' E E ~.° 'C a~ of N D
~o o ~ .,mo m ~ E E E E .~ v ~ ~ ~ ~ d c ~ E c m~ H ~ a m ~ 3 U
s r t ~ m ~ ~ ~ ~ ~ ~° W m m °m° ~°o m W m m m c .~ o A ~ ~ ~ ~ ~ ~c ~dzy°ao 0 0' aaa aoo c caCOa'Qc~c~sm La '°Ecc .c .c E c c c $ $ °v -$ c m Z' E E ~, o !° o m° °
,c $ a v c) ~ m ~ ~ T T T T ~ O E ~ E O L i0 ~ m G m 'C 0f ~ ~ T
It~ I'B x U U U ~ ~ ~ ~ U O C~ ~ ~ m U m U U ~ U ~ U ~ > ~ U 2 ~ U ~ do Z Z Z ~ m m E Z Z Z U ~ m N m O r ~ D: ~ ~ N m Z G~
m ~ O W W W ~ N ~ ~ E 'G = G O~ tN0 7~N, ~~ J ~ 00. C '~ ~ ~ mN ~ bl..m. ~_ ujb E a °' w a tau d ~ ~ z 3 3 E- ~ o e? n c '$ c _~ nE~v> v) W E E o>U ~ ~ m ~ ~ ~p >, ao ZS W E
d m v n ~ ~ ~ N ~ tL Z ~ °' c. a~ d .. . m 'o ' ~ Q . ~ W m -°- ~a v : '- '- ui m ° Z rvn ~ r a a o m ~~ m Z 'c eo' d m o ~ ~ ~ ~ ~ d ~ ~ a ~ ~ i° $ $ ~ a ~ v a E ~ m ow r r r ° o d u1 a 'a m ° ~ w o ~ m m ~cccm%~o:'mco zz ~~mn~~° '~'~°v c ~ ~ O ri3 ~ a Q p, c'S ~ _o E ~ D O ~ m E ~ o ~ °= t o~>>opEuiNm$=c JE'a~a'=$~N~ a°cE
O ~ C °~ d 4:
O M 07 Hi O N N M U W ~ x ~ 3 t~ ~ O 1~ ~ C C $
~cEEE>,o,t~>~a°~accc,~v~mgo~fmdd°a~°~>
N ~ H ~ N ~ ~ N v- ~ !L O V a m m_ O O m_ p E' O E N ~ N T~O v O n O d n M m m M ;p E 'C ~ ~ ~ op ~ = b D m O O O x M
~ E v E -~ ~ v 2 v v = ~ o- i. y ~ °: ~"c ~o m ~'c m ~ m '~ o> Y a ~n.
~ ~ x o~odo o~,~EE _mm c ~ cn ma»fa n af~m E' o~vco a,mm m ~ ~ V ~V f0 n O O C L al 7 _N t0 W O C .
~ U E U 'O V 'O ~ O ~ ~ V d N m ~ O ~p E C O ~ C ~ = Z N. C ~ '° O Ol ~ G C C C C C ~, d N ~ C N V V N E ~ U d U V d ~ ~J O W $ ~ N C O
N ~ N m 7 O 7 p ~ W O W r .~ ~ E N (0 O m O ~ O °~ M
._ °~dcann nmorj,O.o~~~a m~mc c opnm amui Enu. ~v.°
Y Y ~ o _ y . v _ .~ m °~ w y ~ t1! v v E m m m m ~ E = ~ m m ~ o J
~ ~ r c (~ c°~ ~.c-~n~.3t .~~ .!Qt > > > >:~ mM m.~ y.c c~nr~~. aY,-~°n n~v: v ,°~ $ m am~°U U m E
t r t caa W. ~ W am IUiI .°' .m m m ~ ~ ~ m E ~ ° ~ ~ m ? m 3 ~
O e' o o ~ E ~ d co U ,a ~ d ~d°oaU' oU'~oU~'a-a.n ao'o~.'~~°~
~y~vUv_oU~rc~ivNrvc°~apo,~~ ~m.n UUdm~C~d~$~$' $dmW~ d~' >>.GC~IC~~m,~CLCS 77 ~~$
m l0 t0 ~ ~ d' N ~ T T T T (0 E M m O 7 ~ ~o ~ ~ ~ ~q ~ C7 (0 'E O 4'~ ~ ~ >.
UJIt~xUdUdUd~~~ ~UOo~ U o~U U mUd m~ mUXx viXU o~I2UU dr $~
r C07 b tp m <O V' 4D V' V' ~'~ N b N m O Y ~ O '~ ~' W 07 b b h r r r N m N N O N r O c0 O ~ ap ~ r_ r b h m b W
01 O h [~ r r O (~ m O ~ O r- b b O b b M O r M C1 O h a0 O N p~ O O ~ h aD sf O 07 O ~ O O m M ~ M O v- .- b r M
IL M o~ a~ m r a~ r r a U ~i o a~ d m m m m ~ o~
~ Q ~ N N N N N J N ~ Q Q >- ~ X ~ Q X ~ ~ ~ ~ ~ X X ~ N
O m W m M m a0 o b cv v ~t v M u> m M h r o o M r h ~ rn o m m m m m v w ~ ~ ~ ~ 01 O O O N m N O
O ~ r r Of to O) O7 OC b aW I7 N m_ N N fD cD O> m W
r O M r r r 01 O m Of m ~ ~ O N h b Y M O ~- ~t Of (O ~ A
~- r- ~ ~ ~ r- M < M M M ~- f0 ~- N ~ ~ N m '- ~- ~- M e- N m N
Ot ~- ~- _~- d. W
l~ b n Z ON7 ~ fmD N N ~ d o r 111 b it M b m O
0-' M ~ b d O
°oN~ ~ ~ UUC7 U~~ '- Z o ~$°o °o ~~ Z~ °pnDD j U
U M U U V 1- ~ W I- Q ti Q C~. n. a. .. V U C7 C~ I-(9 (9 ~ ~ ~ ~ t ~ ~ Q ,U, ~ U ~ a ~ X ~ U ~ Q U U
aaa a~t- ~ a ~ N
mi mt mt xt xt =t mt mt mt mt zt_ rt mt mt mt ~t at at ~t mt y zt y y ~t mt mt ml mmmm m m mmm mmm m m m mm m mm mm mmmm m m C~ t7 c9 C~ c9 t~ C~ U C~ (~ c9 U c9 c9 C~ C~ c9 C~ c9 t~ c9 C~ c9 c9 c9 c9 c9 c9 O N ~O 01 O
rV O ~ ~ ~ t°0 ~ O N
r .- m O~ ~ 41 OD a- r- m O m N ~ O CD ~ O N
a00 ~ W m ~ ~ O ~ N N
O O O O O O O O O O

WO 01/66573 PCTlIB00/02035 m ' m ~ ~n~ w ~ o~ m o~
o~

t a a~' v> =wa ~da a v a t Q
~ ~
~a' ~

oZ?o~

1~ 1~M 00 eF V' ~ N
~ ~d ~ r M V r N ~ r O
Q7 V' ~ N
- O
~ tD N
' N

r e N
N
N N
V

O ~ onO ~NO O) O M Il7 N ~ r m n ~ ) 1 N f ~
~ ~
~ u ~
M
~

O V r X11r 7 O N ~ ~
h !~ M N _O) a0 WW I~ N t0 M m ~ In N m MN 1~ M M M M M
N t0 ~ ~f V O
N ~ 1~
V M M M A
01 ~ t~
V N
O O M
m M
M M
V!

M

> j _N
_4!!

U V ~ a..
~ d ~
~
E ~E

g ~ o o ~ o c _7 U U m W O! _U E _U
_' ~ 07 ~ ' m ~
~ ~

d d ~ ? m d ? m c m a~
v ~ c S

~ ~ cc ~ c $ ~ ~ ~ L
m c 3 > ~
> E
v 8 ~ ~C
'C ' 'C
~

. mm ~ N v1 C N
m a v a .n Nan0 T T d t E W W ~ ~ ' L7 ~ U
L7 ~
'~ ~
W ro at m m ~ ~ wm on a p a g Q p o n m a r m U U ~ ~ EE m E ' m o m E ~
cg $
v o ~ ~
E

>. O ip OO .~ O ~ O
T O T ~ D i ' ~ a y~
O

U a Zs tn t tn n U m ~ x ~
~ ~
w D
x ; in _ $ m o ~ m ~ ~ Q
~

.- c Z

0 'rno ~.

r~ m c ~~ ~ ~ c "' p Q
~? x p a m a a E E ~~ E c~ o a E c E a v Oa ~ U z Z
~

7 ~ oy $ z . ~ ~, o ~ ~ ~m.
' ~ Z z ' m . QI E~ ~, U
E ~
~ d E a c 4 ~
~

,~ Q w 8~ WmO E mrJ .
c.i w ? ma~ d p ~ ._ i ~ d o r R w w s o ' cv ' ago c '' ~ ~ mY N Q o $ o o ~ ai m tn -' =

. E .N ~ E a o W~
v ~ a w c '~
' ~
~

o . r= ~ oc ,~
~' o ~a ~n oo~'N mrn i~ mv o t w~~ o~~ZO ~ ~~ r hp $'r d= Wnn Q

C m O t J Z ~ y E ~
~ ~ 9 m U
m C~~f ~ E
~

~ C WC
7 ~ E G1 UO N N h O O Q O Q
W W O) ~ >' E
~ E W
~ O
Z ~

N d U ('m $ E V O ~ Z O Z
10 ~a ~ .. N a C O t0~1D
N. , o ~ N ~ U
Y1 ~ o N~ C
c ~ g m ~a o $
$
-C ~ W R ~ ~ 'E ~ vi ~ M a 7 C ~ Q ~ Q ~ ~ W
' ~' N ~=
N W
d N
~

E = 07 ~ i N '~-~ u. ~ U 9 O
2 U~ j a > m O ~
d a d o Q ~
~I

E ~ OED'~~NfE9~j ~~O$UN4~= $~~WIL q~ VNIL dU M~'U

Zm ~ .

'c n O ~ ~ ' ~ yn m r. Z~ U g' ~ a E O
O ~ ,~ d E a O 0 c O'~ a ~ L O ~
o M p ~
~
mN
vQ
O

N N . Ta .r y(n! E 0 _:
U C m .~W (C G $$
U m 2 W .. N
E I1 ~!7 ~ O .-~1 U
N
r d O

y W O ~' (~ CN ~.pm C =O
Ow= ~.GD ~
af0 p ~ ~ O r~ 7 ~ ~ N 7 N Z
- fpp ~ d' >' ~ E ~ V
~, E Oi 9v Oi ~ ' ~

UUa~~ui Na t .-s=hoo .-cnmQ hai N cExv~x n~~oo E >

,-v mn W u~ ~ ~ in H

a00 nCJ O'~ ~ M O
O ~ ~ ~ ~
W O' ~
N
~
~

i0 NO~Ia~Oh~l~ ~Q p Om1O M M
W OOTOnf ~~h0 ~ V

~ K X ~Q ~ ~ m a X Q X
~ Q Q ~
N N
N ~ Q

o~ m o M m o v N o n r~ m n ~ v u ' ~~ ~ ~~~

ago oom vn ~ r ~n ~~ ~
vN

M M N N V'r M r M - r (p 47 m r M ~
N M
Y w Ot N ~ ~ ~ ~

O V (' ~ M t0 ~ O ~ O
~ ~ M o ~ ~ ~ M o ?-~ cJ
~ o o ao O O ~M Q O C~ ~ O w r w g ~ ~
m q ~ r ~ O
U U

a7 ~ ..UW ~UUU~ -a op g V a V
C~(9 ~ UoF
~
~

g ~ ~ qCn.g~:; cn~ M v~ ~ ~,n, cocoa , ~,~

a a aa~aaa~ ~~a~~ aaa~ ~ ~ a ~ Q
m m mm wamaw mmmx c~ = m w m mmmw m~ m~ m~ m~m~ m~ m~ m~ m~ m m~ m~
m~ m~ m~ m~
m~ ~
m~ ~
m~
m~
m~

c9 t9 c~ C~c9 C~ m C7 c~ i7 c9 c9 C~ (~ (~ m C~ C7 c9 O
(~ t~
C~ t9 t9 no. g N o 7 r- r- e-r N ~
O

tv N ~l7 t0 r N M M O u-f~
m O NO N N

~o>~ ~tc crn rn°'~ ~°'°'~
Z ~ 7 0 0 ~ ~ ~ ~ > > ~ > > ~ ? 3 w N ~ N M t~ N ~ r r .= N N r- N N N ~
I~Op d' O V' p~p~ V(~' 4N7 M W~p ~
~

~ ~r N N~~ ~ ~ ~~ u N M
- - '7_ ~

f M N c0 Oi O~ O a0 ap O O~ O~ 4i V' V M tD m m a) ~ W O7 - O) m 1n m M 'd' M M m f0 m j 5 7 7 7 7 7 7 Q U U U U U U U U
N W N N N A N

N m N 10 N O O _7 7 7 7 7 7 7 ~J O
(D
d m W m m m ~ o~ rn w of rn rn o~
m ~ m m > > 7 L L ~ ~ E > ~ '~ O
C r ~ 7 ~ ~ y E
~

d ~ d d ~ - ~ 0 ~ ~

d A N W .~ N A t0 N N N
ttl H r . N W

a a a a a a a a ' ' a E _ N ~ U ~ ~ ~ L'~ ~' Z' ~ ~ V
W a U
N U

Q ~ ~ U U U U U U U U
~~

Q Q Q

a~
d a U N -o U ~ U E' N
E C m c~ i E' ' E' 'o c v cc : ~ m m m :
a :' c '_ dQ 01 G) H NnN N
~~

(/~ E 07 _ ~ d A 'O Nm W C S L'n T ~ d N
~ ~
~

E:= ~ U ' t v=-'~ t U P
~ ~:'~
t ' ~o d d m . ~ ~ C ~ _ o a ~ m 10 ~ N
~ ~

O O) a N cg'm ~ ', P: .-~

E N ~ ~ C y., ?:
IL ~ N 10 .- U ~ N -~
~
W - O

Q' ~

Q U ~ ~ 0 O H ~ a W C n ~ O
cm- ' H ~ ~ m N G R ~
cm ~ U
~

~ ~~ ~ c rE
~ Y ~ sE ~ ~
' m a n ' ~

~ ~ Q c .~_ ~ Ii r Yy U v m v O m ~ ~- . ~ Lp v J('Q gm W ~ C7mE ~ ~ ~ ~ c H~ ~ ~~CNN
~~C~

mam ~ ~ - N Ro~._~a~Nm dE m ~ ~o~._mE
m ~N ~
~ ~U U Paz z ~~.~~-go~~g~~.~ 'g ~~~go gg~'g~ 4 m 8~ p ~o _ ~

' ' E ~y' m~'~O o Z~7' >~ h -~ro a ~o d ~ Z
~ - HC
Hz ~ m z G

8 ~ U ~ U
m N ~ pOGU p0 p 1 U ~ e _ ~ -_ g ~ E !O ~ ~ O) C m lp O N ' Cl m ~ ~
~ N. m ~ Z U c ~ m Z Z U
Z

~7 N N 'O m = m Z ~ v O 2- . ~ '-' O! ~ C
'p m . ~
~~

~ S ~ H
8 E ~ ~
~ ~

~ m W ~
~
~

.3 (0 t0 W ~ N N ~ N W ~ ~
fE IU c ~ ~ p1 ~ ~ ~ U H ~
m c c ~ U
c c a w c c o 2' o U

a a . of c c oo of c ~ ~ ~~~~m~mm m c o.
~Nm ~~~N"~' ~~~

~'r rr s rEE E ~~
-Q W m N ? w V C 'C ~ H G n 7 O H G
Q N 'C . H r C 7 ~ O. H
N C . r C 7 C

a m a m a m o a y o a -~ ~ E E E ~ E a, ~ m aa a E a o c ~ E ~ c E ' c yv y ov S ,~.c c >,? ~ ~ ~ o ~ cp ~ i ~ o o W > ' , b ~ L : . E c~ ~ E ~ ~ or -' E ~
Z g $ ~ E' m ~ U E' ~
U ~ ~ m ~ U o m m a ~ m U o w ~ m U v U U o ~o Q Q ~e U c m m ~n ~ U ~
Q ~

n ~ v ~ v ~

m'N '~r'co ~m'e 'a ~ h~i W ~~ .i W "-' ' ao 00 ~ U ao co o ~0 0 o co iv ~
~ U ~

. a w a 7 o ~ Q QX Q X Q
Q p~ X
~

Q Q Q J Q

M M
~ o ' ' ~

ao t m ~ ~ ~ ~ m ~ ~ ,~
n u r ~

c~ o o co 0 u~ n ~ m m ~ a. v v a~
N ~o n M

v ~ V p p p m ~ U

~

a nf'1m ~ m ~ N ~ O) N ~ ~ O m ~ c~ ~ ~
m '~c~

~ o ~ g Q ~ a r' a ~ m ~ Q
m ~ (~
m Q 1- Ii ~ ~ u.
p ~ 4 Q U
Q ~

~~a a ~ a a ~ a a a ~ a a a a a m m m m m m m m m m a a I m I I I I I
I I I
I 1 t I

I I I I I
m mm m mmm m .m . m m m m m m m m m c9 r' (~ (~ c9 C~ t7 (7 c7 t~ C~ C~ c~ c9 (9 t~ (~

y n ~ o v ono a m as m M co n "~

0 0 o _ No WO 01!66573 PCT/IB00/02035 m m ~? ~ m ~~ y °' z a r~ ~ N ~= . N ~ N ~
u~5 ~
O O O O
M
O O N (O fD N ~ ~ ~ W (nD O ~ W W
O
O ~ t0() ~ ~ ~ ~ 0~7 ~ W pip ~ ~j ~ N
Of !D
E E E E _m E E E E E E E E
U ~1 V U V ~ U U U U
E ~E E E E E E ~E E E ~E E
m . m m m ~ m ca m m m m m m d 7 ~ 7 7 y ~ J ~ 7 3 7 j j o~ o~ ~ o> of a w rn o~ o~ o~ m o~ o, c c E ~~ E .~' -'~L ~ .~ E E 2 ~
d m m m ~ ~ N N N N m y N
~1 U V U ~ U V U ~J U U U U
m m m m o m m m m m m m m a a a a a a a a a a a a m m ° a~ ar ,a m m m m m a~ m y o C C ~ C C p C C C C C C C C
N Z' ~' U Z' ~' Z' ~' ~,' F~a-U U~~ U~U ~~ Utn oy' or of w L~ °' c~ w m ~ U m c of ° r? :° ~ :° m ~? :°.
a a .~ ~ Ni° c ~ ~ ~ ~° c r w.° ~ m ~ or ,~ m m ~ o~ o. ~ m c'°'o c U' o v ~' m E ~ my °~' ~o' ~ ~ v m a! W, ~. E' °~ m m o a o, y H _ O N ~ m vW__ m'D~N_.
~mLE° m~mwi°E' d~HrEn m ~m~,L°~ m ~~.mn'~U d Cj,v d~Cj,v mrN~Tv ~!.':: '...mC~~ OlElm'.'~ N
m ~ ai c °. °. a; ~ ~ vi c; E a ao W ~ ri m c ~ d m ~ .~ m ~ o, air E m ar.~ ~ p~ V ~ ~ 'E fJ V p~ C ~ E ~ ~ ?~ OJ L E ~ ~ ~ T 'm-' L E ~ ~ U
~' 7 ~ m Gl E1 Y ~' 7 ~ H N ~ m ~ ~ m ~ d E ~ ~. ~ ~ H N E N J, j ~ H y ~m 'C
~~'~~E~ °~2~$~E'~ a~Z~~mE -o fq.~,$~E.° a,9JtmEo a o,gE~8m ~o~gEyBm Ea,gE,~88 ~ o,gE.~'S8~ ~o,g'E.~g~
~. at ° ~ ~ ~ ~ .~~ m ° ~ ~ p 8 ~, '° ° ~ d c p ~, m o ~ ~ c ~ ~, m o o vi ~ rn gZDoco~ og.ZOoc~ ~agZ~.o~~ o~ gZOo~r .ct°;ZC7o~.c I
,~ o~'° NZ ~:~ rn mzW~.~ oy 'm m~ ~nc caE -Q,m~ vy ~~
m m of o m Z ~ m c o m 2 m 'c m m ~'~ ~.cE'a m~ o E~°~N ~ ~m m ~~°-~ ~ oiE °~ E~d ~o~E E E
~ m~E'z E c (1 m _ 'V ~ N m . v ~ U ~ m _ m Zj m U d ~ ~ ~ U C~J U N ~ ~ V m .-. .
m W ~E oo °~ E' m ~ '~ ~E rn a'. ~ ~ m y E o~ m m ~ .m ~ E ~ °' .m .m m ~ E ~, N ~E c m ~''' O)C Cv~U ~ 01C G'~~ .a OoC CvT01 ~ m m ~~,7 ~ 7 N N ~ j,~ O
_ V U U 01 C. C tn O! -01 C C
c .d m m ~ m E ~ b d " c '° E ? ~ m m ~ ~ ~ ' m W ~ > > > ~ ~ m ~ ~
m m_S L':3 E _d c L.p E o m.~c 2~'F3 m ui E ~ ~ c ~ p_~ a'_~'~ ~ c ~ c'c a; m m ~ M ~ ~ U m ~ N ~ m ~ ~ M m d ~ m m x ~ ail U' m U m m ~ ~ ~N m d D1 G1 C ~ G C m ° ~ C ~ C C W n N C Q C C U N m m C O~ C C ~ m ~ m~ C
O G C m aE°ca;°'~°r°' a'oEgQ'wor ~o~EgE'°'g~o°' ~Eb''L'.°°ooooEgi~L'~oo3 U o m m m U ~ U o m m m U ~ U o m m m U o U ~ o m m m U v U U o m m m U o ~
O ~ O ~ ~ O O M ~ O
a0 1~ cp c0 1~ N m ~ I~ W h ~' n) t(~
O Y N O O ~ W O O r O t0 O O (p ~j O O ~p O p p p !L m llJ !L m a0 !L !L O tL IL t1 li l1 Q X Q Q X N Q Q X Q Q Q Q Q N
007 1N 6 ~ h o 007 ~ ~ ~j In (D (O O
c~ O f~ a0 O M ~ t0 O O O
O Wit' 01 O
'~ C7 O N V' W N ~ D) V ~ m V T n ao V n c° ~ m N C~
0o cp ao C7 o m~ u~ C~ m yo o °o o ~ V o a Q v ii st E- ti ti (9 a t°i ~ t°L t°i. U
Q U QN Q U ~ Q ~ U Q Q Q Q Q.. N tI) oQOm~ mmm m m mm m rnm .. m pp m m a1m m m (9 U' C7 C9 C9 U' (9 C9 U C7 C7 C9 (9 C~ C9 N m o N ~° ~
T
r N N
N

V ~ 't m ~ ~ M
O m O O O O h O h h O ~ ~ M m O~ On O~
W ED ~ ~ ~ m ~ ~ ~ Q1 O) O p7 QI ~ ~ W QI ~ m 01 ~ ~ ~ ~ 0~1 o~ o~ c c a n c b. ~ ~. m ~ Q o> m i > > m ~ a> >, m a m n c a m .° ~ m ~ Q ~ Q ~ ~ ~ D O ~ ~ ~ -oa O
> > ~ -, u. -, U v~ m Q w m v~ m ~ u_ -' ,-~.~n°'~b~ mu-~~-~ ~~u. Q ~n~~ r-~ cnd~c~5r-. ~cb r' r r (b N u7 m N m t0 N N O O N O N N O r O r r ~t N aD O at ~O O M h _V~ O ~ ~ 1° N o0 h O V' N h M N h h M r N CO M O~ h V cD OD u7 cD R7 O O O h ~ M h h t0 h N V 01 V' O ? N N O
u7 Ifj 1~ 01 07 tt O~ N (O I~ M (D N aD ~ ~ O nfJ O) N 1~ t0 P Y) 00 y r b- . -v ~ O !~ r m i~ l0 D) CO O M O) O h M O O 07 47 fh O (O a0 t(1 h ~ D> h fh O O t0 '- t~
O O ~ M M M ~ ~t M 01 O M ~ O r r M M M t0 M M tO M O M M ~ ~ ~ m h !D
E E _ E E E E E E E E
tp N ~ O O 7 7 7 ~ N t!1 N W _N
.Sa r ~ V .~ V .~ ~ t N 'N N 'N
E E -° -° E o E E E E E E o d ° a o 0 m m ~ ~ m N m m m W m m m c o~ o~ n n om U '° ~ .~ ~ .2 ~ ? 'E ~ '° Lm° m m ~ m ~ ~ ~
m ~ n E E ~~EU -°' EE_E EEE :°_ W~°-n~mm°-Q'~°-n',~ ~.3m~~a > > '~ m c ~ c '~ m 8 '~ '~ 'd v F E .~'c W'c c -' c ~'c a c > > > > > >
m a ~c 'c ~c ~c ~c 8 v ~ ~ v ~ °' m °-' v ~ ._ v ~ U U 7 m m a, m m a a~ m E ~n m m a m m m a m '° ~° m o °' '° '~ ~ ~ c m ~ ~ air m o, W m ~
coo o m A ~ ~ W ~m m m m m Z' Z' v° °v c ~° o ~ ° c c r c c c c m N a a ,n a o 0 0 °. ° '° o a o 0 0 m Fa s ~ ~' 2' U ~' ~o~a. 2d~ a ° ~ ~ ~ ~ ~U, U U E ~ ~ U ~ U U U
U U ~~~~_~ =UUIifU ~~U lil D~~~~~~~Qm2~~~~~'~
m m ti _m o~ or a m m F- v lV fV U ~ d- ~ ~ N C N
1p t0 ~ N m °~ E ~ ~ O t' m !N'0 C C ~ V' ~ d d ~ N ~ ~ O N N
~ ~°_ o~ d d E a m '~ E a~ 'n La ~ m m m c c c - m m E E $ r m m a of or n a m o 0 o E
N' ~ N N C U g ~g '~''' ~ ~ ' .. ~ m ~ ~ N b ~°, ~ Qp~07 oma~N~ oou-°'v~ .h°oE °°'~ ~~n c o o rI~,E aiEc L~p ~m ~~j.U NC ClllO00n (~y~ C ~ ~ N d O X h~~,. O h U m 1A ~ ~ O) m m ~ m C C C m mmC~%~m ~NmE~ Nwa = °) m X001 jG~L
ClLrn.C dNOmQN d~~OO RCN C) d ~ a~UN ywO
v, ~ E U ° ~ E E m a_ ~ Z ~ N ~' ° ~ m r a n c U E n Q o. o _o W o m m °~ ~ -E ~ E E .c ~ E E
_O U O ~ ~ ~ x ~ = m ° D7 O ~ m O Z O
O O C ~C > > j, O U ~ U ~ ~ ~ d O Q N ~ ~ ~ M N N m y N U p U > M ~ y m O! C ~'~ ~ ~ ~ y a m a C ~ E ~ c ~ L ~ m ~ N N N N ~ N ~ U ~ ~ m m ~ a Z ~~.5 m MM m ar m r°nQ m m n of oM mmmmMm~Q~ ~c,~ M.
~ ~ W U_ ~ t~ ~U _O~ N b ~. ~ m O U_ d ~ ~ t0 L m N N W N' N N~ E O E ~ ~ E E

E N ' ~ E O w O ~ ~ ~ m 'CS ~ E A W E '~ a O ~ U U U U ~ ~ ~E m0 ~ O
d ~ ~ N r ~'~"''.°~?.~ mmaUE~° E>»~ 3°~dE
omWL°L°~m'~~mEm~m~
~~~°n E '~~V °-°-n' ocmYE ~QEE:° ~»m~d~dx~5'$dy ~ n O ~U N ~N E ~ O C E = ~ ~ ~ ~ ~ ~ E ~ 'C C 'C C C G 'C °' m C C G ~
'C t mm~~~m 'U~y,t°~rm L~-$m$~ W c~ tn°' .~mmmE~Q~møøii mmm.
dGpmO~ ~N(~O~OECR CN~Cddm~NO~ ~~ (OD~~Al~62NAW~N~NA
C V ~ °) ~ H ,~~. ~~. ~ m ~ ~ ~ L Z' U E a a ~ m '° C ~ ~ ~ ~
~~ ~ ~ ~ O E U
U o m m 'mU~~~Um=~ =m~ti3U c°~mOU~IL o~.~E~~~~~~~~_~~~~~~
g (gyp t~D (00 ~ p O D fh (p N
N r N O~ V' y~ ~ t0 1~ M r cp O~ h v0 4~ p~ M h h M M h O N O O p~ O
op O .- 01 N N r O O O ~ ep ' 07 O u7 W N r O O g N p a~ O O
_ m M o o m m o 0 0 ~O M l0 W aO O pp r O O ap h ~O t0 ~ m (,O1 N O ~ O N O O h ~ OJ O O ~ ~ O d U ~ Oi O h aD O
N N ~C ~ Q .~ a o w ~ 'd o w ~d i- ~ N G 7 ~ Q N ~ Q Q Q N ~ J N ~
f0 a0 ~? N 4'1 h ImfJ N h D ~ O M ?
O h O M M O aW0 ~ ~ h ~ h 01 N V ~l 4~ ~ N 47 M ~u7 M M r M M
W M O f0 O b M 10 f0 cD CO O OO OD V N M N N M 10 h ~ 07 O 07 V' O
yt a0 h. O h O~ r O~ ~ M V of cO 1p O M 1. O N N O h N a0 N O M tD a0 O M
r M M M N r M r ~- M N r r N c0 M N ~! ~ ~ ~ N ~ r r ~ ~- M M N V' U U

w ~ T U ~ v .°-' v a ~° ~ ~ ~ co ~ ~ c~ ~ ~ ,'~ ,~ nU.
v aov ~ ~ -i ~ o m o ~ i.°~ ~ ,° ~ ~ ~ h w ~ m o o m ~ 0 0 o y ~
o m yN. ~
a o U U C9 > o C9 0 ~ O o ~ ao 0 7- '- U U o o U U o 0 0 U' U o° CJ U o u. ~ ~-- I- C9 U U ~ U ~ c'S U ti ~ o u. Q o t- J p p J t- o a U ~ !- o v7 0 a a ~~coa~~ gmwwq mwQ w c~~~»~~~ga~~»,~~,~
Qa~~~a ~aaa~ Qa~ ~ ~aaaQaaa~~aaaaQd m m mm aam amamm mam mmmmmmmm ammmmmm m~ m~ m~ m ao m~ m~ m~ m~ m~ m~ ao~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~ m~
m m~ m~ m~ m~ m~ m c~ c~ c~ c~ c~ c~ c~ c~ t~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ C~ c~ Co c~
c7 c~ c~ c~ o C~ t~
N tD O m OM1 1° W . N ~ Q
oD G~ M YJ N ~ M
f0 N ~ O
N
O O O O O O O p 0 N N

r. co r n m n n r~
m w °' r n m m m oo ~ m rn ~ n r W n. r o~ m n n o~ m m V= a n I= ci a ~ ~ 1= cu ~ m aW= cvi m m I= c~i m m n ~ ~ O ~ p ~ O ~ ~ a U '° ~ a~ .n a U m ~ ~ ~ U ~n ~ d m .c a c~ ~ ~ d~ z ow%> r~ °~ ~ ~ ~ m m ~ o> ~ u. ~ m e_' um. ti O m m ~ pi ti N ~ ~ N 117 '- N N N O ~ U O M O ~ U N (b fb ~ ~ U ~ Ib O ~ U N N Cb (b O V' V N t0 N N N 4J c0 O m m m 1~ f~ I~ ~7 P'7 r m m ~ ao co ~ ~ co 0 0 0 o r~ r~ M v v f0 W ~ ~_ CO N In f0 O m m m d1 W 01 aO aD _ O h n 4~ 00 tD m f0 m c~ 1n N N N Ice. 1~ ~ V of t co m r~ u~ v co m m r~ m <o ~o m m u»n u»n ~ cc cu <o cc co E m H m N
-m d v 3'~ c a a .- a v~ - v ~m ~a~ cd ~'~ ~~~a~
m ~ __~ 'm m -m g ~ ~~m ~~ v~ m ~U ~N ~N U O N ~ -N N .~ E E ~ W a ~ G ~ W C G ~ ~ ~ m ~ W C
O O ~ D E p O O ~ a Q G O C O C ~ ~ O C C C O ~ O ~ O ~ C
0 o i.~~ ~.o o ~o ~ ~' o f o~ccoE ccr~ o~oEcc I I ~ ~ ~ Z Z 2 U ~ ~ U m U m O 7 U m 7 ~ ~ m U m U m 7 ~
c c c y m coy r°~ m ~ ~m 'm m ~ ~ N ~ fV ~ ~~ ~ O O O
OI C _ _ 1p Q O M !n C C
fn fn ~ z ta0 W I~11 C .mp c m .Hp c c Q' m U m ~ O nC m W W c ° c C9 C9 a m m d d m N
m n ~ ~ E ~ E O O ~ N m W N N °'N fm0 O O d ~ ~ d a . a d ~ n o n n r '-° a a m =' %Z~ Z nm O L 8 Z Z o ~ ~ o Z Z ~ n c ° ~ c o 0 E a a~ ,o C7 O y ~ ~ m U V w ~ s d ~' d E
m v Z Z o, Q of Z Z ~° o. m n °~. ~ m - - °, m o 0 0 U U a!aZ mj ~ r -o° m ~ t ~ ~ t t o~tzmZU Q~~ QClOW Em m ~ %m n n a d o ~ 2~ o ~ ~ m .°c ~ ' t ~' ~ .°c r ~ tin > ~ E > ~ ~ c o y ~ p ~~ ~ N ~ ~ ~ ~ :5 yri Sri '° o ~ ~ n m m ~ °° c° ~ o ~ N m c rn ~ ~ m c c ~
m '~ o ~ r~ 2 m ~ $ S m ~ ~ ~ j a~ m ~ ~ ~ d ~ ~ ~ c m ~ E E ~ ° m ~ m ~ u'S T O ~ ~ ~ ~ ~ ~ m a o ~ m m tn W
E c ~ ~ o c ~ m I Z ° ~ !~ ,~ -o o~ 7 7 ~ > > ~ o~ o~ 7 7 m ~'~d~~Z Z m yr :amE m dmE ~~E m E E m ", ~ Q m m. m ~ m m .6 E ~ m m E m m E m m m m t nr ai,a,~,'~ mZ ~ o o a ~ o '° nnm nam - - nn ~ ~ ~vpi c ~ c ~ ~ ~_° ~ ~ c ~ c ~ ~ ~ N m c E ~ ~-c ~~ c c _~ a a w Vi 0 a'0 O. 'Oval. ~M V'~m~O.V dD ~ ~ aU ~ ~N V, r'e-~ ~ ~ ~N
p ~ m E ~ E O D f~ Qa~ p m N m dd ~ O C am m ~ ~ m d m d d ~ W O W m m EO~CEOC'Vt?~~OEOE00~ 4Q~ dlDO COQ O'O'Z' ~ZCO'O.
n v 2 ~ Z ~ ~ ~ Q ~ ~ Z ~ 2 ~ vi W ~ th ~ Sao H ~ V7 U ai ~ U y> ~ o~ m ~ cd t~O m N (MD V~' ~V V P'1 (9 M
ao M m n n u~ N m °~ m OO~h~~O a~0 aMD~O ~NV~O VNVO ~ONM
0 0 0 0 0 0 0 0 m r o r' r i. o r r o r n rn U U ao ti 7 ~ U U o an 1i m o N ~ m N c~,~ m o o Q Q N Q Q N Q 4 lL Q Q Q lL ~? Q M Q u1 I1J
N N
n 10f7 C1 1~ aOD ~ m N f'7 m m m m m m m m m m m m O N N N (O M M C~ m O c0 a0 u0 00 W a0 t0 c0 aD aO n0 PD
om7 ~ N M m m N c7 c7 1° N t° t0 u7 u7 u7 u1 N ~O o7 fD
r- ~ ~ '- .- ~ N ~(7 ~7 1° N N ~ tn ~ W O ~ N
~t ? n OM7~mN~mn~ ~m ~ OM7 O O
O O N ~ N r ~ M ~ ~ ~ N M ~ N N ~ ~' ~' N c'~7 U U U~a UU U g °r° °o ~ ~n°o N~o ~ ~ ~n iii a ~ Q N ~ iah' M w r~ ti ~ w m M a ~ M m o o ~ m m i z mmw m= z a a ~ m a aam aam a a as m mm~ mm m m mm ~ Cm7 ~ Cm7 Cm7 ~ Cm7 ~ w ~ tm7 uW 9 c9 C9 m c~ t~ ~ (~ (~ c~ c9 N M O '' 100 M O
r ~ ~ r.
n w M m °v v ~ ~ v 0 0 ~ o ~ ~ o m ~ ~ ~ ~ ~ ~ m h m a~ ~ o~ o o a~ m o~ o~ o~ rn O~ h r O~ ~ Q7 01 fn a~ Of i r r '- r M r r n m F= cv v o >- ~ o~ o~ H- ~i a rn ~ ~ H ~ >- F- rn F- F=
m n U ~ ~ c Q m c ~ U 'n .~ or m Q U Q Q U n U
tn m O ~ m m ~ ti m w O ' ° ° u. ~ O ~ ~ O m ~ O
o~ ~ m ~ ~' -' o~ o ~ ~ of ~ m a O h tn (D N f0 N Is f~
N ~ O U I~ N f~ I~ O U 1~ N .- O O (~ N N
O O O O
c_o a_o ao 0 0 o w ao n r m o ao m v O O ~ O N N ~0 c~ m co o n m u'W n C~ M M O O ~ O ~ ~ r N O O~ ~ N N Y V
(D f0 t0 O O o0 O 1~ tD (O t0 c0 h M O 1~ O lD t0 ~O 1° r r M r M 07 W C7 C7 M M r M V' C~ M
E E E E E
~ > > > >
U _U U U U
~E E ~E ~E E d d m m m m m O N
7 7 ~O 3 J m 7 (p ~
07 m N O) 07 C OD ~ O O
2 ~ 2 c c .m ~ .~ m m N t ~ m '" E E
G m c c c c m U m U m ~ U e' U ~ G D. ~ N U7 a0 V d Ly m m m ~ m ~ m m m m m ", ,~ n n n. m m n .C ~ D .C ,p ~ L ,D ~ N CJ h 0m7 N O ~ h ~E ~ ~E ~ ~ ~ ~ o m m o 0 o W o o =~
U m 7 U m U U r U U m m x x 2 Q U x E O D
U N
m m m a ~ ~ ~'o ~ O d m E 'o O ~.
'a ~ ~ o c°> >
c N o 0 o v ,n v ~ ~ ,o m o ai a fn a m ~c ~j m ai m -7 ° Q c n ~ c' °' ~' Z v Z
mmc cc ~~aZamEEx~O
m o~ l a~ rn o m y ~ Q m ~ ~ h Z m Z
o a I = a m ~, ~ n m o o V o V
c ~ I iui m w '° v ~ a m ° °~ U o n ~ Z a0o z c c ' ~° c c $ ~ E ~ .W .o ~ E ~ ~~ 7 ~ ~ _ d a _m(9 C9 aN(7M ~ °' v6 C~N c°a°t~n mt~n '° a ~m' °-~m v 8~~o x° O o. Goo mc! c~
° n E m H ~ O E U ~ ~ m ~ U ~ ° Q ° a c ° c c °'~'~i °' U °: ~~ mM m coy '°
m x c Nz °' ~ ~' m Ez ~',~, i g~ m m n ~ E'~ E
c ~~ a On on. mC~~m Z°m N ~°~ ae°n~ »
o ' o c io ~ m io ~ z a a ~1 ~ o J Q a E E c m N N ~ ~ O .
O ? N U ~N V = ~ C UJ ~' ° LI Q E V N I- p ~ '~ ~ U N
Zo $Uc~
~ E .m C 2 m m o~ ~ O ~ ~ m ~ ~ ~ m !r ~ n H ~ H ~ ~ of d m 07 O ~ 07 O) ~ ,Q M NI G NI ~ C OD a ~I ° y~ 07 m. ~ °) O,.
G O O
m E > > G ~ v ~ ~ ~ ~ c c ~ I amo 'm °° W E E t°yl ~ ' ~
u. vn ~. Ii a ~~E E'm~'~o~ 'a ~c Ic NON y~~~ vEn~~aa'~
v,°'n ~ m m~ E ~m~ m~ c ~ A~I~ ~~,o ~ ~,nl~ 8 °~ aE ° QE
°c Q r ~ ~c ~c N ~' m ~ ;n in .E ~ ° ~ ° m ~ v Zp c °' o o ~ m ~ o ~ p ~ d ~W a cnl Eo g m Q W Q o ~ NI a c °' U', v °°' O ~t vn'nf~U U mU xU mU m U m2xx h ~~Q ~U °'xx ~~~ov~ O~
N N N ~ O M O ~ O ~ O
NM n o0 0 0 ~ ~ 00 0 01 a' O O ~ V' O~ O M ~O O _ h h O O M h O O W DD O ~ O ~ O O
w ~a ~ x X~ a w oa~a a a ~d a xQ a ~ m ~ n W ' fOO N 01 (0O tOO O7 O> (OD M N O I~ O O
u7 t0 tt1 V' O N ~ ~ y0 ~ 47 t0 O V' O N Oh n u) 47 In V' N N r In C~ '- t0 t(7 V' O
0) n W ~ M ~ o M O
rm~~UHhMNtOD Wh0_V =mto0 O 'NQ~ O ~ ~O O h 00~ N O m Yp O
J Q U J J ~ ~ U Q q Q (J ~ U U
w "~ ~ ~ w4? ~ w a ~ N Q g o' ~~Y c~
4 Q Q Q Q = Q Q Q Q t- m ~ ~ ~ ~ 1- t-a n.m m m >m m a mxc9 w a m c9 >x x 1 I 1 1 1 1 I I 1 f 1 I I I I I 1 I I
O (~ w C9 C7 C9 C7 C7 w . C~ O C7 C~ C9 C7 C9 C7 U C9 N ~ m ~ ~ M
ro n O m r N N

t0 O O W O tD ~ M W O
W
a~ o~ m m o~ w ' o 0 0~ o~ o~ m r~ ~ ~ ~ ~ m a> a~ ~ m m °' ~ m rn°' °' I-W t W U U U W ~ b. c ~ .c t a ~. uU1 a ~ ~ U U
> > ~o m m ,4 ~ m v~ a_ a $ O -~ D O O O D ~ m ~ ti ti -, -~ ° ~ O ~ o m m -~ O O
ch Y cn c%~ r~ U ~ o o yn Z o~ cv ~ a N U ~ c0 c$
O O ~ ~ ~ O r N ~- r r- e- N O N N op a0 ~- r r c0 a0 O O N N V' r tt h (O f_~ t~ M O O N 0 0 m h h N f0 t° N N ~ O W a0~ M N V' OD ~ N N M _ OD
W ~ M r c0 W 1~ I~ Q 1~ f0 a0 tY ~O tp N N c0 O CD GO
N M O m 0 0 f0 n h 0 61 07 st f° f0 l0 (D l0 O 0 ID m 0 0 M ~ ~ M M M M M M M f0 M M t0 M M tn 0 0 O M M C~ M M
41 N 01 W N ,f~ N ' _!n ,a n .n a a a .n a ~ rn a Ø 3 w r ~ S y o 0 2 E E H ~, E
E E E E w vi vi E E m c v E E
> > > > c c c > > ? m c > > m ~ m a c ? E E
y '~ m a~ d m 'm ~ ~ m m ~m ~ m ~ ~ ~ ~ °' m 'm R w m m w h H W m ~ ~ '-° ~ m ~ ~° E E ~ 3 ~ a .H w °m t s o a a a o 0 o a a E c o ~° a c o r '° c o 0 0 ~° 0 0 O UUUE E E SSm ~E°°~cg.~ES~ayY ~ E E S
~ ~~ Z I Z ~~~ U m ~~U m tmn in > j 7 U I S ~ D D
° Y m ' c z z z E~3 '=-m m ° m ~ Z Z Z ~ N cp <° ~° ~ F x O ~ F
O
E C Q ~ p ~ 7 7 O N (~07 r r ~' ~ ~ O N N
c O (~ CJ r c~ o to w m m o,~°.~°'o dtwnt~n~ dW dm -~mUO daM'oaMS
TtdU~ E EO E E m c U O E°-' °' t c v or ~ ~ ~ oW om ~ n m m ~ °~ U U
L d9 m~~ ~ .~'~"~ ~ ~t m m N ~ X ~° ~.c Z Z n~ d'~ co m 01 7 m Y N m N w w ~ N m C - m m = m 'O d N U m O ~ N ~ m T p T O C~ W ~' O 3 O O E 't 07 C Z Z O ° C. O C.
mo ~~~ mcm~ m 1 me cc o o~ cc~~°
~ ~ m °' ,°c ~° o mrn o U U Y o o~ Z w W o ~ ~ °
'° Z Z a~
~ .E % m ~ m v m Ti a a vy 'a m D m m E m ° o W w w m ~' m °c v t m si E a E x Z ~ E a m Q Q L O ~ ~ H a a ~ 5 °
a o 0 0~ oa °' ~ ~ E ~ H 1_ N. ~ E ~ of E E ,i ° o ~ d v rwn twn E M ~ M
v .~ o ° a ~ ~'c ~ c m d m d m " ~C ~ ~ ~ > Sy v ° 2 a o ~ n ~ ~
~ ° E ~ E r' m C m ~ m C ° C U C c°3 m ~ E oo ~ ~ w m to u~ o n h v o m .Q p~ o d a ~ N w ~ ~ ~ ~ g o ~ a E ~ ~ ,~ 0 0 W amnx N~°yn n~ ~ wx~ a xx n EWE.~O V E ° N N x oy 4t~n ~N m ~ ~ p_ N N fd E ~ E ~ E m ~f0 N ~ C ~N N C ~ ~ ~ w ~ U ~ 0 O ~N
U m a~U c m o 0 0 0 ~ o ~ ° v o o ~ m S o m ' g U O
c o ~ N m > > ~o° ° o ° ~ ° a Y X ~ m c c ~
°' Z Z o t: O ~? O
2w~~~'.m3d ~~aE~_EM_E~'?~~N g ~~o O'°~mm~o. ~ m mmama a = $ c o 0 0 ~ > > ~. ~ .~ ~ r ~ ? ~y ~ m ~ ~ m ~ u> a o- °, g o N o ~
~ ~ z c Z
E S % o ~ W a E E E m ~ H ~ H m E E o ~ ~ E E ~ ~ ~ N ~ Q ~ N N S ~ S E v U' y U' > c ~ c ~ c m o o cO ~ m > > m O o .~ ~... 'c m m c n ai ~ m -c ~c ~c v w u, w v w 'c 'c m ,~ 'c 'c ~ m m °, .i. r m c d 'a m 'a ~c' E z E Z
cDm ca'~ mmma~n~Q~mm~m_ mm._ m_mc T~~- mmUwU
~n ~ ~ o ~ W ~ ~m W Coo amo p h p m p m' m o d ~ m A o '"rs '~' 'o ~ ~
'° '_Y ~% ~ ~ °~r ~ _ ~ t lZt1 .°° 'o ~ Q -~ o 0 0 ° m o ~ o ~ o ag t ~ E o o E c~ m m.
~ ~ ° m ° m a ~ O o U
0 0 ,~ ~ "~ ~ U U ° E a E d E n. o ,~Y ~ E ~ o E Q Q Q. Z. m E E E ~ o °' d '~ f7 d' Ub m ~ U ~ ~~~xzxZ=Z~~7~fJm ~gm (nlnpfnCAU 01 x 7x 7~
O ~ ~ V N O c~J
O O ~ O ~ ~ r O ~ N ~ is A a°~D M O O !p ~~ N Q01 0 O u7 O r' O 117 ~ 1~ 1~ c0 1° M M M N O O
m ~~oU U U o'~i- NNr ~oooao o Mo 0 o> or of a~ o~ rn o o g m U
D Q N g a a a ~ N Q X N N X X x w s _ ~ a a n'°1 a a f'~' M t0 N N
N O ~ p0 O ~ p ~ (O W n n GNO 007 ~ ~ ~ ~ O ~ 00I N
cD O O O ~- Of O O h 0 N N 0 ~ O G° aD o0 O
r ~ ~ V ~ ~ 47 st V' ~t N V ~P N 0 r r r M tr O ~' ~ d' t~'7 ~ ~t ~ ~ N w w > LL m ~ ~ M ~ tOD
0_,Aa,~~r ~ mNOo ~NU'U U U GN O UUO ~X~oMm~ U U UU U
uW mQ q Q tn~~ ~ r-f-~ UU~ooU g Q t-a Q
m ~~~r~ ~ r~ ~~ m ~aD, c!)cn!L__cCy.) M in gv aaa~ ~ ~ Qa~ a aaa JJaaa~
m mmmx x x mmw m mmm aaaaam z = m= z ml ml ml ml ml ml ml ml ml ml ml ml ml ml ml ml ml m ml ml ml ml ml ml ml U c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ O c~ c~ c~ c~ c~ t~ c~ C~ c~ c~
n O p M O M
~I' r e- (p r' O ' ~ h A W
M M
O O ON W m m ~f1 ~ ~ W On Or m m °~ M c0 ~ h ao c °~c'~ ~ c ac c ~ ~ a c c mc°'v~-~' n.~n' ~'~°'m~~°'~°°U
m z m o a m > > m or ~ a c a . ~ , or ~ -~> Z ar CD -a w~llr ~-~~ j m W '~~~ m~~~ ND
N r N ~ ~ ~ ~ M N 1~ ~ ~ h ~ a ~ d Q Q !O In N N N M N ~ O eh~- N f~f N ~ N (~
O tv N O O O ~ ~ O O p ~ M 0) 1p O O N 01 ~ h a0 Cp ~ N ~- O ~p ~°
M
N O ' ~D C Of ~ N ~t V O c0 h N V (O Ip N
aD O ~O O O O h W rtr ~ N IO M c0 ~ V h h N V: M h M On Oo ~ Or cV N t =
ao 'ao ao 0 0 0 of n ui o of of of of of of h ci ai ' of of or ' ' h 01 M 01 r ~ r M M M M M M 4~ ~ ~ tn M O V ~ M 47 M M M ~ ~ <t 1 M
E E E E E E
U ~ N N U a1 U N N
'~E- .~ E E E ~ .~ ~E ~ E _d ° o A m m ° ~ m ~ ~ v A ~ O O R N
m ~ E .2 ~ ro g ~ ~ ~ ~ ~ ~ ~ m 2 m N N m m d H ~ m ~ ~~ ~~ ~ ~V ~ ~ U 01 E C '=C ~O N d ~ ~ N m C
R ~ ~ ~ ~ H N C y C ~ W b ~ ~ l0 O d C N O A O M t9 h N M ,N IC
c °c c ° ° ~ c E o 0 0 o.c o a c ~ ° o ~ a o 0 0 0 O C G O O ~ r m ~ ° 7, ~ r T ~ O m ° T ~ ~ O O O ° O
O >.
c~ ~t~ c»>x x .~d' c~ a t- ~'~incg~inc~ z~ ~~~cxxx~'xx~
ai m ar ~ c m m $ m o o ~ m m C N N a ~ N N
°~ d ~ a N ~ C ~ _O t0 r0 U ~ (' aD ~ aD
N d Z N~ N ° U ~ O U ~ ~ U U
O C 0. ' N ° > V aQ0 N n ~ ~° C C C ~° C C
o ~ ~ ~ ~ ~ z m o c c ~ D z ~ v' ~ a' ~ Q c cr a acr Z. °' a ~ ° o $ ~ ~ E E o v ~ E N N N E m ar w ar yr . ~ >. m ~ ~ L ~ ~ d '3 d v z y m m ar ~, d v yr : c L '. -. ~ at w yr Ti o_ ~ g ~g yr o a L n - -v °~ m..%ro W m.. m 'r E ~~ V w' ~~n' m zs, a E ',Yc vi E X ~u E ai E E E E E E
E ar E ~ E ~ '~ w °c' ~ mw acr oovo ~o mom ~ wcc°~»u°r _,=n m~ p8v '°~d a c~ d a c' v °' ~ ~ cv°. ~ o ~ m a a m Q ~ °~ a Q ~ ~ ~ ~ m <o v ca ~n E o m c . E ~ ~ Q ~ >~ E O !~ m E ~ m o m Mar % E E c v v o'a p ~ a d ar io N ° ° ~ or ° a m = '~' ~ °°
°' ° ~ E 3 ~ oo $ E E E ° E E
,hr~o too.M~'~~cZ Z,m pZ~m4a~~o_ m°~ ~Nyo~°~°8rn x E ° v~u'ZU o °r~~_ ~°tiJ d ~2aN 2 EJ ro O i:
I~~oioioi=oioi~
~ ~ c '° > J ~ V .~ ~ O cr N o O ar E w E a ° m U o Q ~ ~ u> .m S E E E ~N E E w La ~ ~.~m ~~°rc'aocL~u~ ~~~~7 ~~~°o'°~o~°
.~inulUUarvo00~o'~m F~1 a a~° ac.a~~mL°°~$~Q~~ ~Nan.'-'r~a~~
oa~na.a2QQEaEen d a ' ~ m m E E u~ a m ~° W acr E E m o ~ ~ ~ ~ d c E r ~ E -~ _w O it ~ ~ ~~ a U U "~ U U m E 7 ~~ A E ~ ~ N! C' ~ .~ r ~ ~ ° ~ N ~ ~ a 7 7 ~ ~ 7 U ~ N C O p V E E
~ N O- m E N N E
U trJ :G ~ % M m, U M M N Nyy ~ C M ~ ~ O O ~.w~. ~ T ° ~ ~ U~,~, U O!
~a O O 01 a) E d d d 'Q G7 d E N~~. E~~~OUfpO.C7.C~:'mOrO~~~~ WN~~ar~~~Ca07~.A~~N~~N16N1NN
or v Z''° o,p.~~I~H a ~ Z'4EH'.~z ~~ °o v ~ Z'°° ~
Z'E ~ arUao U v LsE E E v E E v U ~~~ ar ar(n mcn ~ ° ov~o~tr~~~ o ~ o m Qrri~ ~~=2IZ~=2~
yr U to W x or LL T o U O o E v! tn ~ U ~ in o Z D o N h ~~'M'>O N 00 O m N~NNV
N ~~"r pOfOMfO O O ~ O ~~ONmmN t~°r m aN-N~NmnCrl~f~V
01 ~ N ~° a0 O O ao O ~ N ~r Y N Or O O O O O O O
oNO aocr nao~a o a°o 3 ~ Moc.-~o~- v c X N ~ X °° = a 1- a ~ 4 a I~ Q ~ ~ N Q ~ X Q N ~ X Q Q Q N
Q Q N
M w co .- '° ao io v v v ao v w ~
M It) h 47 In h O f~ 01 N N
~ 00 ~ M M n O M 4N7 a0 c0 o N ONr N 07 N Or N Or N ~ sir st N ~ ~
h aD h N f0 O (O ~ h f0 a0 Or N h N 10 M ~O h h N M N N N u7 ~ t~ ~- O h M M sf ~t M .- ~ r- .- M V ~- M ~ M M M ~ M
N h W
O o0 M t~0 O M O O a0 ~ ~ O 10 ~N °r aD t0 CO O a0 Ifi w aMr d °° 'rd' C! ~ m o ~ ~ h M n_ °o ~ v '° ~ u, ~ a U ~ U U -° ~ r ~ m ~' 4 rii ~' '~ U C7 ~'U" U U' C7 Q 1V- °p r U U U H U U ~
,Q, g M ~~~U~(n ,U, Z ~~ Wg~a~QQ~
~ H E- ~ F- F- ~ N .
aa~aaa~ a~ as=~~~a~~a m mm mna.a w a m ui c9 mm mmmm mx mm>aaamaam m m~ m~ m~ m~ m~ m~., m~ m~ m~ m m m~ m~ m~ m~ m~ m~ m~ m m m~ m m~ m~ m~ m m~
m~ m~ m~
C~ (7 C7 c9 c9 (~ C9 C~ C~ (~ C7 (~ c9 C~ C7 (~ (~ C9 t~ c9 c9' c9 C7 C9 (~ C9 C9 C9 (~ (~ C~
o ~ m m w ~ ~~oMMr r~crm cv ~ru°r$~n o $ o ~ o m o o ,~°a m r~°v ~L

o> ~ a_> rn m o o> o~ o m cn °' ao ~ m rn o~ m o~ m m ~ o CS ~ W ~ ~ ~ ' m m °~ ~ a~ ~ O> rn or rn °~ o~ o~ o~
~ W Q ~ a a d d > > U ~ h d c > >° ~ o ~ n a -~o~-~ da u. ~ ~ u.~ ~-~ o ~ dv~ °a a a z a a a N ~ m ~ r v yn d> 06 ~ id ~-' n n c~ o~ n d~ o O O n N N N N r '- a- (~ N N r ~ N N N
m tn W a0 m O m ~ V m M V (O W a0 c0 ~ N m ~ t0 m M
N C~7 n M f0 II) In t0 (~ N O ~f1 m m m O O ~_f t~ m o 0 o m oo m n N v n o 0o ro .- o~ n n ao n o 0 n - n n ~ ~ ci o of n °i n n of ai of ao ui of n n m f0 m M m m ~t ~ ~ ~ m M m m s< f~7 M ~ m ~ m m m m m N
m _m ~ m w ~°
N ~ ~ m p ~ m 0 ~ ~ W C C
m ~ V_ (O Gl m V N N E N N
d ~ G) N ~$' l0 7 m Ci 7 7 O ~ O O
> > > ? ~ > > c c t > > g > > E d m ~ c c ~
N N d N T IU V V n a m ~ ~m T m d O'C 'C a a a ~b N
RmmmE~»~aoWmEm~c~oo~ a ~ ma'°n' a a a a ° ~ E E o o 'o a .a o n o a ~ 0 0 0 °' °' ~~$c°y'°? '~ o o cao °°v ~ ac~. ~~ ~ 0 0 0 ~'o2.~O2_ ~ (O ~ ~ Z I d ~ ~ l0 ~ 7 ~ H u. u. Z T 2 to > m '>
y d c ~ m m a~
c~i .-. a n a ~ c d a~
c ~ a ~ '° i~ c E c E m D a n a of ~ o Q r a E 'a> $ ~a: 8 0 ~ U' N E E
'$ v r~ ~ ~ o o Z °~ 8 8 Q N r o Q ~ a H E m y d ~ O p ~ ~ ~ m d m E ° ~ ° d ~ O = ~ Z
E a" °~ ~ '~ ~ E E $ ~ U O U O 10 . N m 3 7 D' Q N d N T d p N .D ~ .~-~ ~ . N >~ E E
Q w _ V7 J H ~.
° ~E E. EQE~O V~ ° (~ aYC YC mU E UV~ a n ~ m m ~ ~ d m o ~~ ~~ m E n ~ ~ v '~ °' c ~ ° Z ~ Z ~ U m ~ °, .coy o '~ E a E ~ ~ ~ m is >.
°? a? ~ ! ~ ~ ~ d °' m °: E ~ a a ~ d ~ ~a m ~ m a_> ~ r ~ m ~~ _yi ,.. ti c m . ~ vi c c am n U c°U °c'p ~z ~ c oZm Z ~~ r ctii L°
dm Q °Q ~ m m m m a a W ii .n a ~$ ~N~°~ -~~acaSE 8o d; ~uio 'T'a~ ~'~N xo d .°°m m .1 v ~ m sf ~_° ~ m c c . ' c . ~ H o~ 2 0~ n c c ~- ~ c m = ~ E E
n m r U -E ~ ~ v ~ -° ~ g ~ o ~ N ~ o o ~L~ m ~ m ~ n o r a m m G7 ,.~ J m v d °. 1- °. o U a U E "~ m o ~,~~ v ~ ~- N
vxvv_ Y m a~ co - ~~ °Nr.u ~ .~ N~ V n m_ i 2 2 E ~ ~ w m ~, cn co !~ _ _ _ ° E x ,~ a c a o p_ ° °' ~a U o ~S >
E m E E N d > > m tL o lL a ~ ~E m y> tn m o- m ~ m ~ ~ E N.
0 0 0 0 ~ m E ~ E ~ E ~U' o ~U' a o o ~ o ~ o ~~ E Q W ~ o d ~ p m m '~~°v__c_mEdEEaEa~ 'm~° v ~~~ m~'c:: o~ ~~ E
d ~ d d ~~ ~'o m 'n L Z s Z- m ~ ~ d ~ °' ~ :~ ~ a ~ a p~ m = ~ N_~ ~ Z
-~ E E E E ° ~. ~ ~ ~ ~_ our C~ H U' Y E E o E ~ E E c ~ c ~ OI m m '° UI m m 3 ~ o ° E U ~ c° Z Z ._ .~ ~ ~ .- c v m Q ~ '~ ~ a o. ~ w ~ o 'a 'a 'C L ~_ 'C
maW aymy,r= U U m~ °oaiorn.c U m ~w~mmWEma o~p~-HUZlo °a~ E mc~°'oaa'~o n~o'to ~~~?' Hw~vm d °vucgv~m,NQ~OoWOtal1'a~° °v~.S ~ ~~v~L~ N~~viU~°c oWtO~.c~>~>ai ~~~~indF'>~>~x~nx~na ~~' ~n ~m~o~u.Q~~ac~3xW xcnxo~m-8m°°~
'vt O 07 n ~ ~ tD N ~ c0 O V V N ~ O
m O N m (00 N O N O O ~ Ol ~ O ?1 '? ~l n ~ V O f0 h O N f- O °) m ~ N m m m 01 a0 c) O m m O t0 t0 r N t0 t°
n cc o 0 o n o 0 0 ~ o m cn so O J ~ O J IL _ ~ LL (L O p1 n J J O N IlI (L LL a v a W o ~aN~aaa ~ a a ~ NJ a aN~ as a a a a ~
r t0 V~ O n n O) OD O O n ~t at W O N N v- aD o7 D) O W n R7 O O W tc~ H7 1I7 c0 a0 N a0 r W O O tn m 07 m O O 01 N N ~f o0 V N N
1n N (D IA N m O N ~ °) 47 O1 r O) O st 07 ~C tD f0 (~ m m m N a0 m et .- r t0 01 m N O 47 ~ r ~ ~ .r .- 1A .)~ d.
U
(00 (OD ~ n O N aMp 'C
m n ~ ~.,~ ~ h ~ o O ~ n O ~ M O ~ ~ OnD ~ !OD
r O J N N (~O W m m ~ ~ m V o V N n 1b ~ 00 O m ~' d O O n - x t0 O Y V
v Z U o U m ~ ~ u. ti U U' N ~ co ~ o m ~o C! U C! g F- t~ U °° W to ~°y Q Q
a c°n N N Q ~ ~ ~n ~ N g ui ui a a m m aaaaa>~ ~ ~ ~ ~ as ~ aaa ~> >
i i i i i ~i i wi i xi ai mi mi mi mi ai mi mi ~i ~i ~i xt ~i ~i ~i mmmmmmm m m. .m m . mm- m mmm mm m m m m m m c~ c~ c~ c~ c~ c~ c~ c7 o O c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ o c~
o n r W ~ o ~ ~ o n n f0 O m N m O ~ ~ tND (D
N N N N N N

~rn mo ~m m om, o~ ~ o~ o> o~ m M r r r' m m ~ ~ °' °> ~ ~ >- ~ o~ e' a; o~ ~ ay ~ rn a ~ ~ °~
n n > c tmn v~ ~ z ~ > > ~ o o '°
~Nao ~o r~r~d o ~ coo~o~uS ao a a oz z O O N N O O N N N N N N N ~ N N N IA 1r7 O O O a0 tD N t(7 ~ N M c'~ M W m r r aD r 01 c_~ ~ M_ f'7 t0 ~U h N N m aD c0 O u7 m ~ O N
O ~ ~ f0 O f~ tn 1n N O O r r aD (~ a0 O~
O> C~ O~ °i Oi 6~ aD a~ ~G V~ c0 a0 c0 N to N N is 47 M
f~ C~f tn O Of m M M l~ 01 O O (h P7 In C~ l'~ Cp Ih f~7 U U U V U U U_ U_ U_ O 'y E E E ~E E E E E E m ?' ~ E
r010W y0 mN f0mm y~ N
7 J 7 ~ J 7 77 ~ 7 m m G7 01 OD C1 O a) m m m ~ p p .O a n.~. O C C Y J
'C 'C 'G C C ~ N N 3 C OI N RI U m E n m n g gr m m m 'm c ? ~ d a~ m ~ y ~ E E
U U ~ '~ c"'i ~ n ~ Ø ~ v ~, > ~n ~4 0 _A ~ 'a n m .~°a n ~ a a a ~ 5 ~ a a a E N ~ r 2° W H N a cm c c ~ E o c c c v o 0 0 0 0 0 o t 2' 2~ t~ ,a m E ~ Z' 2' E E E o o a E E
0 0 0 0 0 ~ 0 0 0 0 0 0 0 0 0 U ~ U U U U ~ ~ Z U U U Z Z Z O D ~ S 2 m d d crn~ ~c ~~ VIU11ULNLNOo is n ~ ~ m o 1- ~ 2 ~ U. ~ ~ N N_ t0 Y C _ ~
U U ~ y N ~ m. H E E; ~ ~ ~ ~ $ ~ a ~ ~~
cc ~~d v ~mvm~-mo-ccNntnain'°
oz oz m ~d Q Q N o ~ ~ ~ ~j J °~ U' °_~ . .d,U C~ °' n~ ~ 7 c > > ~ Q .~ ~ ~ V ~o y a ~ Z o >, co ~ z ~ z n- a n ~ o :.° ~ ~ ~ ~ ~ ~° ~ ~.N.. Q 7 Q 7 ~ Z Z Nm ~ ~ ~' a ~
~ w c a_, d, E ~ m C7 m Cl m C7 U' ~a c _ .C m c ~ ° o v to m w °' z z o '~ u~ m °' o ~ .4 c '' ~ ~ o tn o tn r% U U o >, a '~C ai p v v m~ ~ r ~=N v ~~ °~ aw IZL v~o~W
tV N C ~ N !V ~ N E a 1w~0 m E M ~ E E ~' E w U C7 p v ~ .c ~ ~ m a o m m ~°n '~ c m ° 3 ° 3 > I1J LL t S
o~ o> ~ o~ ~ T' ~ S c a a o E R $ w ° N a ~ ~n W ~ h a m W m O J ° C O c r _ :p O v ~. ~ vi N n O O' E E ~ O ~' z = -o .p r ~ E >' W . _ ~ a ° .mn o c ~
V_ U_ ~~Cm F- mNmUO E UC UC .girl r~ n~J~()ENm c c E ~E C C ~ ~ U c c '° m ° 'k E ° y ~ m ai o m~ m~ .~
t o m a' °! ~ m y m'c~. o ~ m m v a ~ o w ~ % '° ~'~ ~ ~ ~ n ~ E
a~''m o~ aa~'°$~~ aanp-a'~°~ o m~voW°-ac c -o°~'g~-°'~
L c m m ~ ~ ~ o a t c~°>?~ c°°'vY o.,~ o ai ~ c nm ~'a;.
EEE E EE mm~>, .c nn ~' v mQn~aQ~ vmu Nt-c$.m 0 0 0 ~ o o .a. m °- m - m m m v c~ "' ~ m w v mo~m~mmam Ema~n-~,ajmm ,°'m m orc~$e' Ecc~a c EomE.o'2ocmc~W °°
o ~ m~ ~ ~bv o ?~ n~ ao~c m nv n.c,a m.i~Z o~
o. m °o >z -°' !am mmc?jnanvd ~'~a;mvi ~mm m ~~2~ZCan~ .mu~~~~m%ca~°n~o~N~~~ouo~t~_~
7 7 F 7 ~ _7 ~ ~ = O ~ m m ~ ° j N ~ ~ N e- r O ° E ° '~
~ '~ m >. y~~' m m dm~N~Nda°~mXEHc w~~EEoU' Ec uEoEo m oE'i.~
m o o L n o m Q ,c o ~ ~ ~ ~ _ ~ z ~ m n. ~ ~ a m a.
tn v) U ~i U B tn !~ ~ E io U o~ U O A Z Z m U Z ~n O .- .-,°n o '° '° u~ m ~ ~ w ~~-. ~ ° ~ o ~ a~'o a~'o ~ ~
O ~ ~ ~° M M O O M ~ O ~' O O O ~' O O
aa° ~ aa~~ a ~wwiN a a a Na a a N N ~ ~ M
N N N N N N VO 117 O ~ a0 a0 n Is W O O r M
01 07 O~ 01 m W N ~ V' , ~ ~ ~ nfJ N ~ M M V' ~v- ~ N
<t f0 Wl7 ~ N N (~D ~ O
OD -J .J W 0M0 U N ~ a ~ ~ 't O ~ ~ O ~- O O 'f ~,~a,U U ~~~~ a ~oo~n v a a ~a a U .- in IlJ Itl Z
H N ~ N h -.~ H ~ H H ~ N M ~ ~ ~ UM~
aaa a as>v~ ~ aaa~~ ~ ~ ~- Q~
a~ a~ m~ mi ai ai of ui~ c9~ mi a~ a~ a~ ai d~ xt xi m~ xi =~ m~
mmm m mmmm m m.mmmm.. m m m mm m m c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~
a ~ M o °o t~ ~ ~ ~ cmo i: n r N N ~V N ~ N N
O~ ~ L

m d' O O 47 c0 W W
W WW W O> Of W W W
W o~ ~ w ~ F= 1= ~ ~ o rn ~ W Q ~ ~ W
o IUtI~ m > >c c ~Q~V U ~3c» ~ m tUtJtUu D~ ~ -o~-> > > ~Q ~O O ~-a m-~ ~~~~ v7 DD
v ! n'' '' i:mQ~ ~ ~r~-'~~d'mr~ o ~r~
.- O ~- ('h c~ ~- N f~1 N N ~- t~ O N N M .-N c0 t0 ~ W t0 O cD O ~O n N c0 a0 a_D f0 <O g O (D ~1 W ~ W O
1A (') c0 f~ W V O t0 (D (~1 W N N W N O N O OD O (p M
c0 W 1n _ W t~ W (O OO N 1~ OD ? c0 CO V 'C W ~ 1~ (D OD Q O GO W
W 07 a0 a0 h n ~ W a0 CO O O N O ~ O n O o0 a0 W at W C7 M f~ (~ f~ M (h M ~ V' ~O Q fn '- M (n W ~ M ('~ (n E N N a1 ,N ~ ~ N
~~ ~O ~O ~ O _~
N ~N
O) a~ N d 47 y N N ~ 47 rn a m o~ a a a a E a a o~ a a o~
and E ~?~~ ~ N .o.w E~°'E o yCJ "' ~ 7 7 7 C C 7 yo 7 C G 7 7 C ~~ 7 7 ~~ _7 ~ ~E C
~7 ~ ~ ~ N N N a ~ y ~ ~ N N ~~ ~~ m U N ~N U O 7 _(p m D L .t a (0 N (0 h tp N Ol W N N A ~ N ~ W f0 ~ 7 7 O N
c °c °c ~ 0 0 0 0 0 °o ~ o o ~ 0 0 0 ~ o a~ c E E t o Gtplm ~ UUUE E U_t~UE E UUE~L~'U~Zp'd1 t~ NE
U UU U ~~~Z I ~~~2 Z ~~Z~~~~~ ~7 .J=
m o m ~ o m N :: 4: v a Y m _~
> > ~ ao c a c '° Q c cNO ~ ~ .r~,- ~ m cn ~ cNn c.i o N N 2 ac m -~ r c ~ ~ m ao r ~_a v ~ ' n c a ~ ~_ t11 IL m M ~ Z -~ m $ m O O
°~ o o ~ °' o c c c c c Q Q c c ~ ~ U. ~ d ° ~ Y
H u~ = s ~a w Q d m A m d ~ ~ m o a> m ~ o d a m N N -~ Y N C C m U d . ,. U ~ Q
1 ~ d d N N A l0 N ~ .8 m n (~ H .. ~ h O Z [vj p O !L
rZ~~ m m m Q~'Q~ aW Vui EO,. O ~omU
.>v N ~ ~ E E aW r E N c c E E E ~ N ~ a Z~~a °c °ca .3n °c$ofC~~f~~ °c°c me o,o ? ~aE~
C G C 01 m p O N m ~ O' C N N N ~ N O c N
H o~ A '~, in of m o~ rn ~ ~ o~ m m m ~n a ai rn a a~ o o ~ o n .
x.v~~ t~n~v~c°: °'co re ~a.waQnQ ma> °~ ~~~ E
°oN~E
c d m c a~ a_~ '~ ~ E ~ Z Z m ~ ~ ~ g m o V1 ~ N ~ d ~ ~ 7 ~~3o~o°w'~°o'co~,a'~EE~E Eo ~~ OZIo U U U Q ~ U O~ f0. m-'O r d N
G~NGW~O~d.~Y>n>r0' >2'm0~0~ »a0»COCfD UO~
a c f- c. c ~ m ~ r ~ ~ ~ ~ E c 2 ~ Z cWn ~ ~ m ~ n '~a !° f7 c Era ~ ~ ~zvid?3a mice '°Zozo zz~t'z_~_ ~ ~~ cZ.i v a vm_ ~ y o T m ~ ~ Z ~ ~. ,o ~n ~E N ~ _a> K d ,~ ,e L z to Z to N m m ~ H E m m $ c ml ~~ .fir E o o H
W E d ~p ~ O ~ E ~ ~ ~ V ~ Qm a ~ p = O W y~l 0D NI 00 ~~ _O O E ~ V' OI m ~ ~
~ Q' b Q b O N
a ~ r~° U~ m A m ~ .c° a~ °' v m ~ °~ O ~' ~ v Q
~° °' E -"E, ~ ~ E ~~ p W c E
o~ g ~.c d v,aa~a a.n Q,Z'n2'ax 0 c~N ~N. aaZ we ap ml 4 NI _~ mr % o [~ ~ o, o N Y .~°-' ~ Q E E E E n ~ .a ~ E ~ W o U o U E E w ? E E ~ o ~ ~ o '' O U ~ 7 7 C 7 a1 d m v Y ~ d d o c ~° _ ~ 3 c ~ > > c tn ~ E ~n h E
C a d O U U U A m W m ~1 C E X O x O ~7 U 10 a ~ ~ ~' nj ~ Z Vj ~ ~ O W O C
albNOMO~'O~aaa"G~"caddo~°o'-° .non aso UlW tL GF~m ~ a mm)) m > m rp N '7 >. >, ~U. O 7 O ~ ,U~ .G n 01 N m ~ ~U, O O O U ~O, ~ ~
a ~ b a m ~ o M !-~-r~.~UQU~ c-°..~~~~5===2U~2 own crM ~~=U~~m ~~d ~~~=UNtn r N '- O o n n u~ co o ~ ~ ~ o W ~M W N ~~ f00 ~W~VO' OV NNN V~_~ONO m tn0 O ~ W o ~' ~ M O O M 10 ~ ~ ~ ~ N O O P'7 4_') ~ W ~ O O
4. oo j fi c oo U U m ~°~ W W m vt J
Q ~ Q ~ N ~ N Q Q N ~ N Q Q N N ~ ~ N ~ N ~ Q ~ Q
c~ rn m co m m o 0 o w m N O ~ ~ ~Np W N N a0 W ~ W W O O W ~ h ~ ~ ~ n O 1~ f0 O Il7 O M ~ n CO tp O t0 Ip N N W
V' t~ M ~t C~ ~t M r- M M N .- r N N W - N C~ N C~ c7 M v Nr~N ~ ~Y~M ~ ~n~pOJ~~°_~~~ aMp V'm m > m ~' o ?' o o ~ ~ (A N N ~ ~ N ~ 1M0 ~ U' °~
o E' o UoU~ o UUQ UU~~U~
ti ~ ~ ~ 1- o F- U U 1-- Y t~ g g I- 1- tn U~ I- J ~ ~ ~ ~ Vi Q V M Q ~~LQ Q ~ V .~',N N ~~Z(~~~mN N
m Zw m mmma a mOmuml w mmammmmtmu w ?a 1 I I I I I I I I I I I I I t 1 I I I I I 1 I I
m mm m mmmm m mmmm.m mmmmmmmm m mm c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ c~ C~ c~ c~ C~ o n c~ C~ c~ c~ ' c~ c~ c~
n O N n r m ~ ~ m N r N ~ M t!J M
0r0 ~ N

H
n.
H
O
O
T.
C
N
N O
N
r- N
N
a °' H
o ~
E ~U
o ;_ c r o E
~ ~ o D
~ d ~N d aaao c v Eo°~rn'~
~ co m a c ° n.
~' m c E
°v N
H N
_. (n z Vl f~ (p p C
7 O ~ E-T U r. cO
N
m Z
a m c9 DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTS PARTIE DE CETTE DEMANDS OU CE BREVETS
COMPREND PLUS D'UN TOME.

NOTE: Pour lea tomes additionels, veiUez contacter 1e Bureau Canadieat des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION l PATENT CONTAINS MORE
THAN ONE VOLUME.

NOTE: For additional volumes please contact the Canadian Patent Offrce.

Claims (47)

1. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, or a full complement thereof.

2. An isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO: 6, or a fall complement thereof.

3. An isolated nucleic acid molecule which encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID
NO:6, wherein the allelic variant has a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity, or a full complement thereof.

4. An isolated nucleic acid molecule comprising a nucleotide sequence which is at least 50% identical to the entire nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, wherein the nucleic acid molecule encodes a polypeptide having a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity, or a full complement thereof.

5. An isolated nucleic acid molecule comprising a fragment of at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, wherein the fragment encodes a polypeptide having a cystathionine-y-lyase activity or an amino acid biosynthesis regulator activity, or a full complement thereof.

6. An isolated nucleic acid molecule which encodes a polypeptide comprising an amino acid sequence which is at least 50% identical to the entire amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6, wherein the polypeptide has a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity, or a full complement thereof.

7. An isolated nucleic acid molecule comprising a fra#nent of at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, wherein said nucleic acid molecule is useful as a primer, probe or antisense molecule.

8. An isolated nucleic acid molecule comprising the nucleic acid molecule of any one of claims 1-7 and a nucleotide sequence encoding a heterologous polypeptide.

9. A vector comprising the nucleic acid molecule of any one of claims 1-5.

10. The vector of claim 9, further comprising a metabolic pathway nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of metz, metC, metB, metA, metE, metH, hom, asd, lysC, lysC/ask, dapA, dapB, dapC, dapD/argD, dapE, dapF, lysA, ddh, lysE, lysG, lysR, hsk, ppc, pycA, accD, accA, accB, accC, gpdh genes encoding glucose-6-phophate-dehydrogenase, opcA, pgdh, ta, tk, pgl, rlpe, rpe, a gene encoding an amino acid biosynthesis regulator, SEQ ID NOs:75, 79, 81, 85, 87, 89, 93, 97, 103, 109, 115, 117 and 119 and each of the odd numbered sequences SEQ ID NOs:1-9, 13-39 and 43-71.

11. The vector of claim 9 or 10, which is an expression vector.

12. A host cell transfected with the expression vector of claim 11.

13. The host cell of claim 12, wherein said cell is a microorganism.

14. The host cell of claim 12, wherein said cell belongs to the genus Corynebacterium or Brevibacterium.

15. The host cell of claim 12, wherein the expression of said nucleic acid molecule results in the increase in production of a fine chemical from said cell.

16. The host cell of claim 15, wherein said fine chemical is an amino acid.

17. The host cell of claim 16, wherein said amino acid is methionine or lysine.

18. A method of producing a polypeptide comprising culturing the host cell of claim 12 in an appropriate culture medium to, thereby, produce a cystathionine-.gamma.-lyase polypeptide or an amino acid biosynthesis regulator polypeptide.

19. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6.

20. An isolated polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5.

21. An isolated polypeptide comprising an amino acid sequence which is at least 500/a identical to the entire amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6, wherein said polypeptide has a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity.

22. An isolated polypeptide comprising a fragment of the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6, wherein said fragment has a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity.

23. An isolated polypeptide comprising a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:6, wherein said polypeptide has a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity.

24. An isolated polypeptide which is encoded by a nucleic acid molecule comprising a nucleotide sequence which is at least 50% identical to the entire nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:5, wherein said polypeptide has a cystathionine-.gamma.-lyase activity or an amino acid biosynthesis regulator activity.

25. The isolated polypeptide of any one of claims 19-24, further comprising a heterologous amino acid sequence.

26. A method for producing a fine chemical, comprising culturing the cell of claim 12 in an appropriate culture medium, such that the fine chemical is produced.

27. The method of claim 26, wherein said cell is cultured in the presence of a sulfur source.

28. The method of claim 26, wherein said method further comprises the step of recovering the fine chemical from said culture.

29. The method of claim 26, wherein said fine chemical is an amino acid.

30. The method of claim 29, wherein said amino acid is methionine or lysine.

31. The method of claim 26, wherein said cell belongs to the genus Corynebacterium or Brevibacterium.

32. The method of claim 26, wherein said cell is selected from the group consisting of Corynebacterium glutamicum, Corynebacterium herculis, Corynebacterium lilium, Corynebacterium acetoacidophilum. Corynebacterium acetoglutamicum, Corynebacterium acetophilum, Corynebacterium ammoniagenes, Corynebacterium fujiokense, Corynebacterium nitrilophilus, Brevibacterium ammoniagenes, Brevibacterium butanicum, Brevibacterium divaricatum, Brevibacterium flavum, Brevibacterium healii, Brevibacterium ketoglutamicum, Brevibacterium ketosoreductum, Brevibacterium lactofermentum, Brevi bacterium linens, and Brevibacterium paraffinolyticum.

33. A method for producing a fine chemical, comprising culturing a cell, wherein the nucleic acid molecule of any one of claims 1-8 is introduced into the genomic DNA of the cell, thereby producing a fine chemical.

34. The method of claim 33, further comprising introducing into the cell a metabolic pathway nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of metz, met C, metB, metA, metE, metes, hom, asd, lysC, lysC /ask, dapA, dapB, dapC, dapD/argD, dapE, dapF, lysA, ddh, lysE, lysG, lysR, hsk, ppc, pycA, accD, accA, accB, accC, gpdh genes encoding glucose-6-phophate-dehydrogenase, opcA, pgdh, ta, tk, pgl, ripe, rpe, a gene encoding an amino acid biosynthesis regulator, SEQ ID NOs:75, 79, 81, 85, 87, 89, 93, 97, 103, 109, 115, 117 and 119 and each of the odd numbered sequences SEQ ID NOs:1-9, 13-39 and 43-71.

35. The method of claim 34, wherein said metabolic pathway is the metabolic pathway of methionine or lysine metabolism.

36. A method of increasing the yield of a fine chemical from a cell comprising introducing into a cell the nucleic acid molecule of any one of claims 1-8, thereby increasing the yield of the fine chemical.

37. The method of claim 36, wherein the nucleic acid molecule is integrated into the chromosome of the cell.

38. The method of claim 36, wherein the nucleic acid molecule is maintained on a plasmid.

39. The method of claim 36, wherein said fine chemical is an amino acid.

40. The method of claim 39, wherein said amino acid is methionine or lysine.

41. The method of claim 36, further comprising introducing into the cell a metabolic pathway nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of metz, metC, metB, metA, metE, metes, hom, asd, lysC, lysC/ask, dapA, dapB, dapC, dapD/argD, dapE, dapF, lysA, ddh, lysE, lysG, lysR, hsk, ppc, pycA, accD, accA, accB, accC, gpdh genes encoding glucose-6-phophate-dehydrogenase, opcA, pgdh, ta, tk, pgl, rlpe, rpe, a gene encoding an amino acid biosynthesis regulator, SEQ ID NOs:75, 79, 81, 85, 87, 89, 93, 97, 103, 109, 115, 117 and 119 and each of the odd numbered sequences SEQ ID NOs:I-9, 13-39 and 43-71.

42. A method for detecting the presence or activity of Corynebacterium diphtheriae in vitro in a sample, comprising detecting the presence of at least one of the nucleic acid molecules of claims 1-8 or at least one of the polypeptide molecules of claims 19-24, thereby detecting the presence or activity of Corynebacterium diphtheriae in the sample.

43. The method of claim 42, wherein the sample is derived from a subject.

44. Use of at least one of the nucleic acid molecules of claims 1-8 or the polypeptide molecules of claims 19-24 in the diagnosis of the presence or activity of Corynebacterium diphtheriae in a subject.

45. A host cell comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or S, wherein the nucleic acid molecule is disrupted.

46. A host cell comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or 5, wherein the nucleic acid molecule comprises one or more nucleic acid modifications as compared to the nucleotide sequence of SEQ ID NO:3 or 5.

47. A host cell comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:3 or 5, wherein the regulatory region of the nucleic acid molecule is modified relative to the wild-type regulatory region of the molecule.