CA2538147A1 - Farnesyl dibenzodiazepinone, processes for its production and its use as a pharmaceutical - Google Patents

Abstract

This invention relates to a novel farnesylated dibenzodiazepinone, named ECO-04601, its pharmaceutically acceptable salts and derivatives, and to methods for obtaining such compounds. One method of obtaining the ECO-04601 compound is by cultivation of a novel strain of Micromonospora sp., 046-ECO11; another method involves expression of biosynthetic pathway genes in transformed host cells.
The present invention further relates to Micromonospora sp. strain 046-ECO11, to the use of ECO-04601 and its pharmaceutically acceptable salts and derivatives as pharmaceuticals, in particular to their use as inhibitors of cancer cell growth, bacterial cell growth, mammalian lipoxygenase, and to pharmaceutical compositions comprising ECO-04601 or a pharmaceutically acceptable salt or derivative thereof.
Finally, the invention relates to novel polynucleotide sequences and their encoded proteins, which are involved in the biosynthesis of ECO-04601.

Description

TITLE OF INVENTION; FARNESYL DIBENZODIAZEPINONE, PROCESSES FOR
ITS PRODUCTION AND ITS USE AS A PHARMACEUTICAL
RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application 60/441,126, filed January 21, 2003; U.S. Provisional Application 60/492,997, filed August 7, 2003; and U.S. Provisional Application 60/518,286, filed November 10, 2003.
The entire teachings of the above provisional applications are incorporated herein by reference.
FIELD OF THE INVENTION
This invention relates to a novel farnesylated dibenzodiazepinone, named ECO-04601, its pharmaceutically acceptable salts and derivatives, and to methods for obtaining the compound. One method of obtaining the compound is by cultivation of a novel strain of Micromonospora sp., i.e., 046-EC011 or [S01]046;
another method involves expression of biosynthetic pathway genes in transformed host cells. The present invention further relates to Micromonospora sp.
strains 046-EC011 and [S01]046, to the use of ECO-04601 and its pharmaceutically acceptable salts and derivatives as pharmaceuticals, in particular to their use as inhibitors of cancer cell growth, bacterial cell growth, mammalian lipoxygenase, and for treating acute and chronic inflammation, and to pharmaceutical compositions comprising ECO-04601 or a pharmaceutically acceptable salt or derivative thereof.
Finally, the invention relates to novel polynucleotide sequences and their encoded proteins, which are involved in the biosynthesis of ECO-04601.
BACKGROUND OF THE INVENTION
The euactinomycetes are a subset of a large and complex group of Gram-positive bacteria known as actinomycetes. Over the past few decades these organisms, which are abundant in soil, have generated significant commercial and scientific interest as a result of the large number of therapeutically useful compounds, particularly antibiotics, produced as secondary metabolites. The intensive search for strains able to produce new antibiotics has led to the identification of hundreds of new species.
Many of the euactinomycetes, particularly Streptomyces and the closely related Saccharopolyspora genera, have been extensively studied. Both of these genera produce a notable diversity of biologically active metabolites. Because of the commercial significance of these compounds, much is known about the genetics and physiology of these organisms.
Another representative genus of euactinomycetes, Micromonospora, has also generated commercial interest. For example, U.S. Patent No. 5,541,181 (Ohkuma et al.) discloses a dibenzodiazepinone compound, specifically 5-farnesyl-4,7,9-trihydroxy-dibenzodiazepin-11-one (named "BU-4664L"), produced by a known euactinomycetes strain, Micromonospora sp. M990-6 (ATCC 55378). The Ohkurma et al. patent reports that BU-4664L and its chemically synthesized di- and tri-alkoxy and acyloxy derivatives possess anti-inflammatory and anti-tumor cell activities.
Although many biologically active compounds have been identified from bacteria, there remains the need to obtain novel naturally occurring compounds with enhanced properties. Current methods of obtaining such compounds include screening of natural isolates and chemical modification of existing compounds, both of which are costly and time consuming. Current screening methods are based on general biological properties of the compound, which require prior knowledge of the structure of the molecules. Methods for chemically modifying known active compounds exist, but still suffer from practical limitations as to the type of compounds obtainable.
Thus, there exists a considerable need to obtain pharmaceutically active compounds in a cost-effective manner and with high yield. The present invention solves these problems by providing a novel strain of Micromonospora capable of producing a potent new therapeutic compound, as well as reagents (e.g., polynucleotides, vectors comprising the polynucleotides and host cells comprising the vectors) and methods to generate novel compounds by de novo biosynthesis rather than by chemical synthesis.
SUMMARY OF THE INVENTION
In one aspect, the invention relates to a compound of the formula I
i n (Formula II) or a pharmaceutically acceptable salt thereof.
In another aspect, the invention relates to a pharmaceutical composition comprising a compound of the formula I
i HO
or a pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier.
In a further aspect, the invention relates to a class of compounds represented by Formula I:

i ~ ,~W~ 3~CHg w Rz0 ORa Formula I
wherein, W 1, W2 and W3 is each independently selected from or HZ I I . H I , -C-H-~_ ; _~-H-C-~_ _ - \ / - _ O OH OH
the chain from the tricycle may terminate at W3, W2 or W1 with W3, W2 or W 1 respectively being either -CH=O or -CH20H;

A is selected from -NH--, -NCH2R1, -NC(O)R1;
R1 is selected from C1-6 alkyl, C2-6 alkene, aryl or heteroaryl;
R2, R3, and R4 is each independently selected from H, R5, -C(O)RE
R5 is each independently selected from C1_6 alkyl, C2_7 alkalene, aryl or heteroaryl;
R6 is each independently selected from H, C1 _g alkyl, C2_7 alkalene, aryl or heteroaryl; or a pharmaceutically acceptable salt thereof.
in one embodiment, A is NH.
In another embodiment, A is -NCH2R'.
In another embodiment, A is -NC(O)R'.
In another embodiment, R2 is H.
In another embodiment, R3 is H.
In another embodiment, R4 is H.
In another embodiment, R2, R3 and R4 are each H.
In another embodiment, R2, R3 and R4 are each H, and W' is -CH =CH-.
In another embodiment, R2, R3 and R4 are each H, and W2 is -CH =CH-.
In another embodiment, R2, R3 and R4 are each H, and W3 is -CH =CH-.
In another embodiment, A is NH and R2, R3 and R4 are each H.
In another embodiment, A is NH, each of W', W2, and W3 is -CH =CH-.
The invention further encompasses a compound selected from the group consisting of:
O CH- CH, CH-N~~I~~CH, N
HO _ OH
O=C

~00~-PCT-9CA
o cH, cH, cH, N / / / CHj N /
HO
_ OH
H'CJ HO .

0 CH, CH, CH, 0 CH, CH, CH, N I / / CH ~ N / / CH
0 ~~/ 0 N / ~ i N (\
HO H OH HO H ~~~~~OH
HO ~ HO
0 CH, CH, CH, O CH, CH, CH, ~N / / CH, / N / CH, 0 \ ~ O 0 / ~ % /
HO H _ 'OH HO H OH
HO ~ HO
0 CH, CH, CH, O CH, CH, CH, N / CH, / N / CH, 0 O ~ ~ 0 0 HO H OH HO H OH
HO ~ HO
O CH, CH, CH, 0 CH, CH, CH, i ~ i N CH, N / CH, O O O \ ~ O
% / ~ % /
HO H _ OH HO H ' OH
HO ~ HO

~OU5-7PCT-9CA

0 CH, CH, CH, 0 CH, CH, CH, N / CH, / ~ ~N / CH, \ p \ ~ O
1~ ~N / ~ i /
HO H OH HO H ~ OH
HO ~ HO
Q OH, CH, CH, 0 CH, CH, CH, i i N CH, ~ N~ CH, \ / O 0 \ ~ 0 O
j /
HO H OH HO H OH
HO ~ HO
O ~ H, CH, CH, O CH, CH, CH, i ~~N CH, N / CH, O O \ ~ O
HO H / ~ OH HO H / ~ OH
HO ~ HO
O CH, CH, CH, O CH, CH, CH, \ ~ N / CH, \ ~ N / CH, N /
HO H ~~ OH HO ~ _ ~ OH
HG ~ HO
O CH, CH, CH, O CH, CH, CH, i i N ~ CH, ~N CH, \ ~ o \ ~ o i / \ i /
HO H OH HO H OH
HO ~ HO

O CH, CH, CH, O CH, CH, CH, / / /
C ~ 1 CH ~ / CH
\ 0 O ~ N
HO ~ OH O ~ _ OH
H H
HO ~ H'C HO
O CH, CH, CH, i N~ / / CH;
HC ~ ~~ v r-~N--~~ 0 Ho ; ~ p ~ H ~ ~CH3 HO
O CH, CH, CH, N~ / / CH
0~ N ~ ~ O
O IIII
H O~CH, HsC HO
O CH3 CH3 CH, 0 CH, CH3 CHI
i N/ / / C N / / / CH
v N
N ~ \ HO
H,C'0 ~ _ pH H _ OH
H
HO ~ H3C~0 _g_ O CH, CH, CH, N / / / CH, N ~ ~ H C, HO ~ O-CH, H
HO
0 CH, CH, CH, I
0 CH, CH, CH=
N / / / CH, N / / / CH
N
HO H ~ ~ O~CH, H C~ 0 H _ ~ O~CH, CH; ~ HO
O CH3 CH3 CH;
i N
HO ~ OH
H
HO
O CHI CHI CH, 0 CH3 CH3 CH, N / / CH ~ N / / CH
HO N ' ~ HO ~ ~ ~ H
~OH H _ ~O
HO~ ~ HO
0 CH3 CH3 CHa 0 CH3 CH3 CH3 N ~ / CH3 ~ ~ N / CH3 i N---~ \\ N
HO H/' ~OH HO H ' OH
HC/;~''/ ~ HO

_g_ i / i \ ~
N CH3 ~ ' /r 'N CH3 i /
HO H _ OH HO H ~ OH
HO , HO
0 CH, CH, O CH, CH, N / / /O ~ ~ N i / OH
N / ~ N /
HO H _ OH HO H ~ OH
HO , HO
O CH, O CH3 / /O ~ ~N / OH
/ ~ % /
HO H OH HO H _ OH
HO , HO
O O
N~O ~ ~ N~OH
N ~ \ ~ N /
HC /~OH HO ~ OH
H ~ H
HO , HO
O CH, CH, CH O CH, CH, CH, i w (( N/ /. /~CH3 O ~ N / / CH3 v off ~ off ~N / OH N OH
HO H ~OH HO H ' ~ OH
HO ~ HO

0 CH, CH; CH; 0 CH, CH, CH;
N / / CH; /N / CH, OH \ ~ OH OH
N / OH N / OH OH
HO ; _ OH HO ~ _ ~ OH
H H
HC/ ; HO
0 CH; CH; CH, O CH; CH, CH;
'\ N / CH; / N / CH3 OH OH \ ~ OH OH
OH OH OH OH
/ ~ % /
HO H _ OH HO H _ OH
HC' ; H~~ ; and O CH; CH, CH, i ~N CH, OH OH OH
/ OH OH OH
N
HO
H _ ~OH
HO
In one embodiment, the invention relates to compositions of the compounds of Formula I together with a pharmaceutically acceptable carrier.
The invention further encompasses a farnesyl dibenzodiazepinone obtained by a method comprising: a) cultivating Micromonospora sp. strain [S01]046, wherein the cultivation is performed under aerobic conditions in a nutrient medium comprising at least one source of carbon atoms and at least one source of nitrogen atoms; and b) isolating a farnesyl dibenzodiazepinone from the bacteria cultivated in step (a). In one embodiment the farnesyl dibenzodiazapinone is the compound of Formula II.
In one embodiment, the farnesyl dibenzodiazepinone generates NMR spectra essentially as shown in Figure 3, 4, 5, 6 and 7. In another embodiment, the farnesyl dibenzodiazepinone generates an'H NMR spectrum of Figure 3.
The invention further encompasses a process for making a farnesyl dibenzodiazapinone compound, comprising cultivation of Micromonospora sp.
strain 046-EC011, in a nutrient medium comprising at least one source of carbon atoms and at least one source of nitrogen atoms, and isolation and purification of the compound.

The invention further encompasses a process for making a farnesyl dibenzodiazepinone compound comprising cultivation of Micromonospora sp.
strain [S01]046 in a nutrient medium comprising at least one source of carbon atoms and at least one source of nitrogen atoms, and isolation and purification of the compound.
In one embodiment, the cultivation occurs under aerobic conditions.
In another embodiment, the carbon atom and nitrogen atom sources are chosen from the components shown in Table 16.
In another embodiment, the cultivation is carried out at a temperature ranging from 18°C to 40°C. In a further embodiment, the temperature range is 18°C to 29°C.
In another embodiment, the cultivation is carried out at a pH ranging from 6 to 9.
The invention further encompasses the Micromonospora sp. having IDAC
Accession No. 231203-01.
The invention further encompasses a method of inhibiting the growth of a cancer cell, the method comprising contacting the cancer cell with a compound of Formula I, such that growth of the cancer cell is inhibited.
In one embodiment, the compound is ECO-04601.
The invention further encompasses a method of inhibiting the growth of a cancer cell in a mammal, the method comprising administering a compound of Formula I to a mammal comprising a cancer cell, such that growth of the cancer cell is inhibited in the mammal.
In one embodiment, the compound is ECO-04601.
The invention further encompasses a method of treating a pre-cancerous or cancerous condition in a mammal, comprising the step of administering to the mammal a therapeutically effective amount of a compound of Formula I, such treat a pre-cancerous or cancerous condition is treated.
In one embodiment, the compound is ECO-04601.
The invention further encompasses a method of treating a bacterial infection in a mammal, comprising administering a therapeutically effective amount of a compound of Formula I to a mammal having a bacterial infection, such that the bacterial infection is treated.

In one embodiment, the compound is ECO-04601.
The invention further encompasses a method of reducing inflammation in a mammal, comprising administering to a mammal having inflammation a therapeutically effective amount of a compound of Formula I, such that the inflammation is reduced.
In one embodiment, the compound is ECO-04601.
The invention further encompasses an isolated polynucleotide comprising one or more of SEQ ID NOs. 1, 64 and 73, wherein the polynucleotide encodes a polypeptide that participates in a biosynthetic pathway for a farnesyl dibenzodiazepinone.
The invention further encompasses an isolated polynucleotide comprising SEQ ID NOs. 1, 64 and 73, wherein the polynucleotide encodes a polypeptide that participates in a biosynthetic pathway for a farnesyl dibenzodiazepinone.
The invention further encompasses an isolated polynucleotide that encodes a polypeptide selected from the group consisting of SEQ ID NOs. 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89.
In one embodiment, the isolated polynucleotide comprising SEQ ID No. 1 encodes a polypeptide selected from the group consisting of SEQ ID Nos. 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 and 63.
In another embodiment, the isolated polynucleotide comprising SEQ ID No.
64 encodes a polypeptide selected from the group consisting of SEQ ID NOS: 66, 68, 70 and 72.
In another embodiment, the isolated polynucleotide comprising SEQ ID No.
73, encodes a polypeptide selected from the group consisting of SEQ ID NOS:
75, 77, 79, 81, 83, 85, 87 and 89.
The invention further encompasses an isolated polypeptide of SEQ ID NO. 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 or 89.
In one embodiment, the polypeptide participates in a biosynthetic pathway for a farnesyl dibenzodiazepinone.
The invention further encompasses an expression vector comprising one or more of the polynucleotides described herein.
The invention further encompasses a recombinant prokaryotic organism comprising one or more such expression vectors.
In one embodiment, the organism is an actinomycete.
In another embodiment, the organism requires the expression vector to synthesize a farnesyl dibenzodiazepinone. That is, the organism is deficient in the ability to synthesize a farnesyl dibenzodiazepinone before transformation with a polynucleotide as described herein.
The invention further encompasses a method of making a farnesyl dibenzodiazepinone de novo in a prokaryote, comprising the steps of: (a) providing a prokaryote that is incapable of synthesizing a farnesyl dibenzodiazepinone;
(b) transforming the prokaryote with an expression vector as described herein; and (c) culturing the prokaryote; wherein the culturing results in the synthesis of a farnesyl dibenzodiazepinone in the prokaryote.
In one embodiment, the prokaryote is an actinomycete.
In another embodiment, the vector expresses a polypeptide of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 or 89.
Brief Description of the Figures FIGURE 1 shows the mass of ECO-04601 determined by electrospray mass spectrometry to be 462.6.
FIGURE 2 shows the absorption spectrum of purified ECO-04601 with a UVmax at 230 nm and a shoulder at 290nm.
FIGURE 3 shows proton NMR data for the compound dissolved in MeOH-d4 .
FIGURE 4 shows multidimensional pulse sequences gDQCOSY.
FIGURE 5 shows multidimensional pulse sequences gHSQC.
FIGURE 6 shows multidimensional pulse sequences gHMBC.
FIGURE 7 shows multidimensional pulse sequences NOESY.
FIGURE 8 shows the in vitro anti-inflammatory activity of ECO-04601. Graph shows percent inhibition of 5-lipoxygenase activity plotted against the Log pM concentration of ECO-04601 and NDGA. Graph shows the EC5o of ECO-04601 to be 0.93pM.

FIGURE 9 shows inhibition of tumor growth resulting from administration of 1 U
to 30 mg/kg of ECO-04601 to glioblastoma-bearing mice beginning one day after tumor cell inoculation.
FIGURE 10 shows inhibition of tumor growth resulting from administration of 20-mg/kg of ECO-04601 to glioblastoma-bearing mice beginning ten days after tumor cell inoculation.
FIGURE 11 shows micrographs of tumor sections from mice bearing glioblastoma tumors and treated with saline or ECO-04601. The cell density of tumor treated with ECO-04601 appears decreased and nuclei from ECO-04601-treated tumor cells are larger and pynotic suggesting a cytotoxic effect.
FIGURE 12 shows the biosynthetic locus of ECO-04601, isolated from Micromonospora sp. strain 046-EC011, including the positions of cosmids 046KM and 046KQ.
FIGURE 13 shows a schematic diagram of the biosynthetic pathway for the production of the farnesyl-diphosphate group of ECO-04601 with biosynthetic enzymes indicated by their ORF number and family designation.
FIGURE 14 shows a schematic diagram of the biosynthetic pathway for the production of (a) 3-hydroxy-anthranilate-adenylate, and (b) 2-amino-6-hydroxy-[1,4]benzoquinone components as specified by ORFs present in the locus encoding ECO-04601. Biosynthetic enzymes are indicated by their ORF number and family designation.
FIGURE 15 shows a schematic diagram of the biosynthetic pathway for the assembly_of the ECO-04601 precursors, farnesyl-diphosphate, 3-hydroxy-anthranilate-adenylate and 2-amino-6-hydroxy-[1,4]benzoquinone. Biosynthetic enzymes are indicated by their ORF
number and family designation.
FIGURE 16 shows a sequence listing table indicating the SEQ ID NO. and function for each of the open reading frames (ORFs) of the 046D biosynthetic locus and the corresponding gene product.
FIGURE 17 shows results of the fatty acid analysis of Micromonospora sp.
strain 046EC011 (Accession No. IDAC 070303-01 ). Analysis was conducted using gas chromatography on fatty acid methyl esters (FAME).
FIGURE 18 illustrates the 16S ribosomal RNA analysis of Micromonospora sp.
strain 046EC011 (Accession No. IDAC 070303-01). Alignment of 16S
ribosomal RNA sequences demonstrates the phylogenetic relatedness of Micromonospora sp. strain 046EC011 (indicated as MID352 ECOPIA#1 con) to Micromonospora chalcea.
FIGURE 19 shows the complete'H and'3C NMR assignments for ECO-04601 when measured in MeOH-d4.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a novel farnesyl dibenzodiazepinone, referred to herein as "ECO-04601," which was isolated from novel strains of actinomycetes, Micromonospora sp. strain 046-EC011 and strain [S01]046. These microorganisms were analysed using gas chromatography as Fatty acid methyl esters (FAME) (Figure 17) 6S ribosomal RNA determination (Figure 18) and were found to belong to the genus of Micromonospora. These organisms were deposited on March 7, 2003, and December 23, 2003, respectively, with the International Depository Authority of Canada (IDAC), Bureau of Microbiology, Health Canada, 1015 Arlington Street, Winnipeg, Manitoba, Canada R3E 3R2, under Accession Nos. I DAC 070303-01 and I DAC 231203-01, respectively.
The invention further relates to pharmaceutically acceptable salts and derivatives of ECO-04601, and to methods for obtaining such compounds. One method of obtaining the compound is by cultivating Micromonospora sp. strain EC011, or a mutant or a variant thereof, under suitable Micromonospora culture conditions, preferably using the fermentation protocol described hereinbelow.
The invention also relates to a method for producing novel polyketide compounds, namely farnesyl dibenzodiazepinones, by selectively altering the genetic information of an organism. The present invention further provides isolated and purified polynucleotides that encode farnesyl dibenzodiazepinone domains, i.e., polypeptides from farnesyl dibenzodiazepinone-producing microorganisms, fragments thereof, vectors containing those polynucleotides, and host cells transformed with those vectors. These polynucleotides, fragments thereof, and vectors comprising the polynucleotides can be used as reagents in the above described method. Portions of the polynucleotide sequences disclosed herein are also useful as primers for the amplification of DNA or as probes to identify related domains from other farnesyl dibenzodiazepinone producing microorganisms.
The present invention also relates to pharmaceutical compositions comprising ECO-04601 and its pharmaceutically acceptable salts and derivatives. ECO-04601 is useful as a pharmaceutical, in particular for use as an inhibitor of cancer cell growth, bacterial cell growth, and mammalian lipoxygenase. The invention also relates to novel polynucleotide sequences and their encoded proteins, which are involved in the biosynthesis of ECO-04601.
The following detailed description discloses how to make and use ECO-04601 and compositions containing this compound to inhibit microbial growth and/or specific disease pathways.
Accordingly, certain aspects of the present invention relate to pharmaceutical compositions comprising the farnesylated dibenzodiazepinone compounds of the present invention together with a pharmaceutically acceptable carrier, methods of using the compositions to inhibit bacterial growth, and methods of using the pharmaceutical compositions to treat diseases, including cancer, and chronic and acute inflammation.
I. Definitions For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below.
As used herein, the term "farnesyl dibenzodiazepinone" refers to a class of dibenzodiazepinone compounds containing a farnesyl moiety. The term includes, but is not limited to, the exemplified compound of the present invention, 10-farnesyl-4,6,3-trihydroxy-dibenzodiazepin-11-one, which is referred to herein as "ECO-04601." As used herein, the term "farnesyl dibenzodiazepinone" includes compounds of this class that can be used as intermediates in chemical syntheses.
As used herein, the term "alkyl" refers to linear or branched hydrocarbon groups.
Examples of alkyl groups include, without limitation, methyl, ethyl, n-propyl, isopropyl, n-butyl, pentyl, hexyl, heptyl, cyclopentyl, cyclohexyl, cyclohexymethyl, and the like. Alkyl may optionally be substituted with substituents selected from acyl, amino, acylamino, acyloxy, carboalkoxy, carboxy, carboxyamido, cyano, halo, hydroxyl, nitro, thio, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, alkoxy, aryloxy, sulfinyl, sulfonyl, oxo, guanidino and formyl.
The term "alkenyl" refers to linear, branched or cyclic hydrocarbon groups containing at least one carbon-carbon double bond. Examples of alkenyl groups include, without limitation, vinyl, 1-propen-2-yl, 1-buten-4-yl, 2-buten-4-yl, 1-penten-5-yl and the like. Alkenyl may optionally be substituted with substituents selected from acyl, amino, acylamino, acyloxy, carboalkoxy, carboxy, carboxyamido, cyano, halo, hydroxyl, nitro, thio, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, alkoxy, aryloxy, sulfinyl, sulfonyl, formyl, oxo and guanidino.
The double bond portions) of the unsaturated hydrocarbon chain may be either in the cis or traps configuration.
The terms "cycloalkyl" and "cycloalkyl ring" refer to a saturated or partially unsaturated carbocyclic ring in a single or fused carbocyclic ring system having from three to fifteen ring members. Examples of cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclohexyl, and cycloheptyl. Cycloalkyl may optionally be substituted with substituents selected from acyl, amino, acylamino, acyloxy, carboalkoxy, carboxy, carboxyamido, cyano, halo, hydroxyl, nitro, thio, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, alkoxy, aryloxy, sulfinyl, sulfonyl and formyl.
The terms "heterocyclyl" and "heterocyclic" refer to a saturated or partially unsaturated ring containing one to four hetero atoms or hetero groups selected from O, N, NH, NRx, P02, S, SO or S02 in a single or fused heterocyclic ring system having from three to fifteen ring members. Examples of a heterocyclyl or heterocyclic ring include, without limitation, morpholinyl, piperidinyl, and pyrrolidinyl.
~leterocyclyl, heterocyclic or heterocyclyl ring may optionally be substituted with substituents selected from acyl, amino, acylamino, acyloxy, oxo, thiocarbonyl, imino, carboalkoxy, carboxy, carboxyamido, cyano, halo, hydroxyl, nitro, thio, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, alkoxy, aryloxy, sulfinyl, sulfonyl and formyl.
The term "amino acid" refers to any natural amino acid, all natural amino acids are well known to a person skilled in the art.

The term "halo" refers to a halogen atom, e.g., bromine, chlorine, fluorine and iodine.
The terms "aryl" and "aryl ring" refer to aromatic groups in a single or fused ring system, having from five to fifteen ring members. Examples of aryl include, without limitation, phenyl, naphthyl, biphenyl, terphenyl. Aryl may optionally be substituted with one or more substituent group selected from acyl, amino, acylamino, acyloxy, azido, alkythio, carboalkoxy, carboxy, carboxyamido, cyano, halo, hydroxyl, nitro, thio, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, alkoxy, aryloxy, sulfinyl, sulfonyl and formyl.
The terms "heteroaryl" and "heteroaryl ring" refer to aromatic groups in a single or fused ring system, having from five to fifteen ring members and containing at least one hetero atom such as O, N, S, SO and S02. Examples of heteroaryl groups include, without limitation, pyridinyl, thiazolyl, thiadiazoyl, isoquinolinyl, pyrazolyl, oxazolyl, oxadiazoyl, triazolyl, and pyrrolyl groups. Heteroaryl groups may opitionally be substituted with one or more substituent group selected from acyl, amino, acylamino, acyloxy, carboalkoxy, carboxy, carboxyamido, cyano, halo, hydroxyl, nitro, thio, thiocarbonyl, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, alkoxy, aryloxy, sulfinyl, sulfonyl, and formyl.
The terms "aralkyl" and "heteroaralkyl" refer to an aryl group or a heteroaryl group, respectively bonded directly through an alkyl group, such as benzyl.
Aralkyl and heteroaralkyl may be optionally substituted as the aryl and heteroaryl groups.
Similarly, the terms "aralkenyl" and "heteroaralkenyl" refer to an aryl group or a heteroaryl group, respectively bonded directly through an alkene group, such as benzyl. Aralkenyl and heteroaralkenyl may be optionally substituted as the aryl and heteroaryl groups.
The compounds of the present invention can possess one or more asymmetric carbon atoms and can exist as optical isomers forming mixtures of racemic or non-racemic compounds. The compounds of the present invention are useful as single isomers or as a mixture of stereochemical isomeric forms.
~iastereoisomers, i.e., nonsuperimposable stereochemical isomers, can be separated by conventional means such as chromatography, distillation, crystallization or sublimation. The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes.

The invention encompasses isolated or purified compounds. An "isolated" or "purified" compound refers to a compound which represents at least 10%, 20%, 50%, 80% or 90% of the compound of the present invention present in a mixture, provided that the mixture comprising the compound of the invention has demonstrable (i.e. statistically significant) biological activity including antibacterial, cytostatic, cytotoxic, antiinflammatory or enzyme inhibitory action when tested in conventional biological assays known to a person skilled in the art.
The terms "farnesyl dibenzodiazepinone-producing microorganism" and "producer of farnesyl dibenzodiazepinone," as used herein, refer to a microorganism that carries genetic information necessary to produce a farnesyl dibenzodiazepinone compound, whether or not the organism naturally produces the compound. The terms apply equally to organisms in which the genetic information to produce the farnesyl dibenzodiazepinone compound is found in the organism as it exists in its natural environment, and to organisms in which the genetic information is introduced by recombinant techniques.
Specific organisms contemplated herein include, without limitation, organisms of the family Micromonosporaceae, of which preferred genera include Micromonospora, Actinoplanes and Dactylosporangium; the family Streptomycetaceae, of which preferred genera include Streptomyces and Kitasatospora; the family Pseudonocardiaceae, of which preferred genera are Amycolatopsis and Saccharopolyspora; and the family Actinosynnemataceae, of which preferred genera include Saccharothrix and Actinosynnema; however the terms are intended to encompass all organisms containing genetic information necessary to produce a farnesyl dibenzodiazepinone compound. A preferred producer of a farnesyl dibenzodiazepinone compound includes microbial strain EC011, a deposit of which was made on March 7, 2003, with the International Depository Authority of Canada (IDAC), Bureau of Microbiology, Health Canada, 1015 Arlington Street, Winnipeg, Manitoba, Canada R3E 3R2, under Accession No.
I DAC 070303-01.
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as, where applicable, intervening regions (introns) between individual coding segments (exons).

The terms "gene locus, "gene cluster," and "biosynthetic locus" refer to a group of genes or variants thereof involved in the biosynthesis of a farnesyl benzodiazepinone compound. The biosynthetic locus in strain 046-EC011 that directs the production of ECO-04601 is often referred to herein, in both the written description and Figures, as "046D." Genetic modification of gene locus, gene cluster or biosynthetic locus refers to any genetic recombinant techniques known in the art including mutagenesis, inactivation, or replacement of nucleic acids that can be applied to generate variants of ECO-04601.
A DNA or nucleotide "coding sequence" or "sequence encoding" a particular polypeptide or protein, is a DNA sequence which is transcribed and translated into a polypeptide or protein when placed under the control of an appropriate regulatory sequence.
"Oligonucleotide" refers to a nucleic acid, generally of at least 10, preferably 15 and more preferably at least 20 nucleotides in length, preferably no more than 100 nucleotides in length, that are hybridizable to a genomic DNA molecule, a cDNA
molecule, or an mRNA molecule encoding a gene, mRNA, cDNA or other nucleic acid of interest.
A promoter sequence is "operably linked to" a coding sequence recognized by RNA polymerise which initiates transcription at the promoter and transcribes the coding sequence into mRNA.
The term "replicon" as used herein means any genetic element, such as a plasmid, cosmid, chromosome or virus, that behaves as an autonomous unit of polynucleotide replication within a cell. A "expression vector" or "vector" is a replicon in which another polynucleotide fragment is attached, such as to bring about the replication and/or expression of the attached fragment. "Plasmids" are designated herein by a lower case "p" preceded or followed by capital letters and/or numbers.
The starting plasmids disclosed herein are commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accordance with published procedures. In addition, equivalent plasmids to those described herein are known in the art and will be apparent to the skilled artisan.
The terms "express" and "expression" means allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation 0005-7~CT-9CA

of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an "expression product" such as a protein. The expression product itself, e.g. the resulting protein, may also be said to be "expressed" by the cell. An expression product can be characterized as intracellular, extracellular or secreted.
"Digestion" of DNA refers to enzymatic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinary skilled artisan. For analytical purposes, typically 1 pg of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 pl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 pg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular enzymes are specified by the manufacturer.
Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the gel electrophoresis may be performed to isolate the desired fragment.
The term "isolated" as used herein means that the material is removed from its original environment (e.g. the natural environment where the material is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, which is separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that the vector or composition is not part of the natural environment.
The term "restriction fragment" as used herein refers to any linear DNA
generated by the action of one or more restriction enzymes.
The term "transformation" means the introduction of a foreign gene; foreign nucleic acid, DNA or RNA sequence to a host cell, so that the host cell will express the introduced gene or sequence to produce a desired substance, typically a protein or enzyme coded by the introduced gene or sequence. The introduced gene or sequence may also be called a "cloned" or "foreign" gene or sequence, may include regulatory or control sequences, such as start, stop, promoter, signal, secretion, or other sequences used by a cell's genetic machinery. The gene or sequence may include nonfunctional sequences or sequences with no known function. A host cell that receives and expresses introduced DNA or RNA has been "transformed" and is a "transformant" or a "clone" or "recombinant". The DNA or RNA introduced to a host cell can come from any source, including cells of the same genus or species as the host cell, or cells of a different genus or species.
The terms "recombinant polynucleotide" and "recombinant polypeptide" as used herein mean a polynucleotide or polypeptide which by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide or polypeptide with which it is associated in nature and/or is linked to a polynucleotide or polypeptide other than that to which it is linked in nature.
The term "host cell" as used herein, refer to both prokaryotic and eukaryotic cells which are used as recipients of the recombinant polynucleotides and vectors provided herein. In one embodiment, the host cell is a prokaryote.
The terms "open reading frame" and "ORF" as used herein refers to a region of a polynucleotide sequence which encodes a polypeptide; this region may represent a portion of a coding sequence or a total coding sequence.
As used herein and as known in the art, the term "identity" is the relationship between two or more polynucleotide sequences, as determined by comparing the sequences. Identity also means the degree of sequence relatedness between polynucleotide sequences, as determined by the match between strings of such sequences. Identity can be readily calculated (see, e.g., Computation Molecular Biology, Lesk, A.M., eds., Oxford University Press, New York (1998), and Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York (1993), both of which are incorporated by reference herein). While there exist a number of methods to measure identity between two polynucleotide sequences, the term is well known to skilled artisans (see, e.g., Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); and Sequence Analysis Primer, Gribskov., M. and Devereux, J., eds., M. Stockton Press, New York (1991 )). Methods commonly employed to determine identity between sequences include, for example, those disclosed in Carillo, H., and Lipman, D., SIAM J.
Applied Math. (1988) 48:1073. "Substantially identical," as used herein, means there is a very high degree of homology (preferably 100% sequence identity) between subject polynucleotide sequences. However, polynucleotides having greater than 90%, or 95% sequence identity may be used in the present invention, and thus sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence can be tolerated.
As used herein, the term "treatment" refers to the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disorder, e.g., a disease or condition, a symptom of disease, or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of disease, or the predisposition toward disease.
As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of a farnesyl dibenzodiazepinone and a pharmaceutically acceptable carrier. As used herein, "pharmacologically effective amount," "therapeutically effective amount" or simply "effective amount"
refers to that amount of a farnesyl dibenzodiazepinone effective to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 25% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 25% reduction in that parameter.
The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.

~00~-7PCT-9CA

The term "pharmaceutically acceptable salt" refers to both acid addition salts and base addition salts. The nature of the salt is not critical, provided that it is pharmaceutically acceptable. Exemplary acid addition salts include, without limitation, hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulphuric, phosphoric, formic, acetic, citric, tartaric, succinic, oxalic, malic, glutamic, propionic, glycolic, gluconic, malefic, embonic (pamoic), methanesulfonic, ethanesulfonic, 2-hydroxyethanesulfonic, pantothenic, benzenesulfonic, toluenesulfonic, sulfanilic, mesylic, cyclohexylaminosulfonic, stearic, algenic, /3-hydroxybutyric, malonic, galactaric, galacturonic acid and the like. Suitable pharmaceutically acceptable base addition salts include, without limitation, metallic salts made from aluminium, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N-methylglucamine, lysine, procaine and the like. Additional examples of pharmaceutically acceptable salts are listed in Journal of Pharmaceutical Sciences (1977) 66:2. All of these salts may be prepared by conventional means from a farnesyi dibenzodiazepinone by treating the compound with the appropriate acid or base.
II. Farnesylated Dibenzodiazepinone Compounds In one aspect, the invention relates to a novel farnesyl dibenzodiazepinone, referred to herein as "ECO-04601" and having the chemical structure represented by the following formula:

N
UH
N
OH
HO
ECO-04601 may be described as a new dibenzodiazepinone having a 10-farnesyl substituent located on the nitrogen atom in the 10 position of the dibenzodiazepine ring (i.e., the amide nitrogen in the diazepinone ring), and three phenolic hydroxy substituents in the 4,6 and 8 positions of the dibenzodiazepinone ring. ECO-04601 may be characterized by any one or more of its physicochemical and spectral properties given below, such as its mass, UV, and NMR
spectroscopic data. Mass was determined by electrospray mass spectrometry to be 462.6 (FIGURE 1 ); UV = 230 nm with a shoulder at 290nm (FIGURE 2). NMR data were collected using MeOH- d4, including proton (FIGURE 3), and multidimensional pulse sequences gDQCOSY (FIGURE 4), gHSOC (FIGURE 5), gHMBC (FIGURE 6), and NOESY (FIGURE 7).
In another aspect, the invention relates to a novel class of farnesyl dibenzodiazepinone compounds represented by Formula I:
~W~ 3~CH3 W
Formula I.
wherein, W1, W2 and W3 is each independently selected from ~_C? H-~- , _~-H-C-~_ ; _~-C-C-~_ ; ; Or \O OH OH
the chain from the tricycle may terminate at W3, W2 or W1 with W3, W2 or W 1 respectively being either -CH=O or -CH20H;
A is selected from -NH--, -NCH2R1, -NC(O)R1;
R1 is selected from C1-6 alkyl, C2-6 alkene, aryl or heteroaryl;
R2, R3, and R4 is each independently selected from H, R5, -C(O)RE
R5 is each independently selected from C1_6 alkyl, C2_7 alkalene, aryl or 3Q0~-7PCT-9CA
heteroaryl;

R~ is each independently selected from H, C~ _g alkyl, C2_7 alkalene, aryl or heteroaryl; or a pharmaceutically acceptable salt thereof.
In other embodiments, the invention provides compounds of Formula I, wherein A is selected from the group cansisting of NH, NCH2R1, and NC(O)R~ ;
wherein R2 is H; R3 is H; and R4 is H. In another embodiment, R2, R3 and R4 are each H; and all other groups are as previously defined. In a further embodiment, R2, R3 and R4 are each H; ar7d W1 is -CH =CH- and all other groups are as previously defined. In a further embodiment, R2, R3 and R4 are each H, and W2 is -CH =CH- and all other groups are as previously defined. In a further embodiment, R2, R3 and R4 are each H; and V'J3 is -CH =CH- ; and all other groups are as previously defined. In a further embodiment, A is NH; R2, R3 and R4 are each H;
and all other groups are as previously defined. In a further embodiment, A is NHn each of W ~ , W2, and W3 is -CH =CH-; and all other groups are as previously defined. The invention encompasses ail pharmaceutically acceptable salts of the foregoing compounds.
The following are exemplary compounds of the invention:

X005-7~CT-9~A

O N
Oli NY
OH
HO
Formula II
O CH, CH, CH, 0 CH, CH, CH, i N / / / CH, / N / / / CH ' I N
N ~ ~ HO ~H ~ OH
HO ~ OH
0-C ~ HO
H3C HO ~ /
Formula lii Formula IV
o cH, cH, cH, N / / / CH
N
HO J/ _ OH
H'C/ HO .
Formula V Formula VI
CH, CH, CH, 0 CH, CH, CH, N / / CH, /N / / CH, / o ~ / o HO H ~ ~OH HO H ~OH
HO ~ ~ HO
Formula VII Formula VIII
O CH, CH, CH, O CH, CH, CH, ~~N/ / / ~ CH, / N / CH, O \ / O O
HO ~ ~_~OH HO H ~ ~ OH
HO ~ HO
Formula VIX Formula X

O CH; CH; CH, O CH; CH; CH, I
~i v ~~~ N 0 O CH' ~ / N/ / O O CH
I N / N /
HO H ~ OH HO H _ ~ OH
HO ~ HO
Formula XI Formula XII
O CH, CH, CH; O CH; CH; CHI
i i i N ~ CH; N / CH;
O 0 O \ ~ O
/ ~ % /
HO H _ OH HO H OH
HO ~ HO
Formula XIII Formula XIV
o cH; cH; cH; o cH; cH, cH;
N CH; ~ i ~CH;
0 \ 0 ------(( \ N~ /
HO H ~OH HO H ~OH
HO/~~/ ~ HO~
Formula XV Formula XVI
0 CH; CH; H 0 i H; CH, CH;
N I I OH; N ~ CH;

/ ~ % /
HO H OH HO H _ OH
HO ~ HO
Formula XVII Formula XVIII
0 CH, CH; i H; O CH, CH; CH, i N CH; N / CH;
O O ~ ~ 0 N /
HO N /' OH HO H OH
HO ~ HO
Formula XIX Formula XX

O CH, CH, CH, O CH, CH, CH, N / CH, ~ ~ N / CH, N / ~ N /
HO H _ OH HO H _ OH
HO ~ HO
Formula XXI Formula XXII
0 CH, CH, CH, O CH, CH, CH, i i ~N CH, ~ N CH, 0 ~ 0 / ~ % /
HO H ' OH HO H _ OH
HO ~ HO
Formula XXIII Formula XXIV
0 CH, CH, CH, O CH, CH, CH, i i N CH, ~ N / / / CH, °\ ~ /
NO H OH ~~0 H _ OH
HO ~ H'C HO
Formula XXV Formula XXVI
0 CH, CH, CH, N / / / CH, N ~' ~~Of HO ~ \\ / \O \
H ~ CH
HO
Formula XXVII Formula XXVIII

H,y.
Formula XXIX Formula XXX

X005-71'CT-9CA
O CH, CH, CH, N / / / CH
I
O ~ ~ O
N IIII
O /
H O~CH, HO

Formula XXXI Formula XXXII
0 CH, CH, CH, O CH, CH, CH, N / / / CH, / / N / / / CH, N ~ \ HO N
H,C'O ~ OH H -_-~~OH
H
H3C~0 HU
Formula XXXIII Formula XXXIV
cH, cH, o cH, cH, cH, / /
CH, N / / / CH
N ~
Ho i ~ o-cH, r;
Ho ;
Formula XXXV Formula XXXVI
O CH, CH, CH, 0 CH, CH, CH, N / / / CH, N / / / CH
/~~ (, /
N \
l //~~
HO H ~~O~CH, ~ \N~~~\
O / H,C~O ~ ~O~CH, /~ /H
CH, 9 HO ?
Formula XXXVII Formula XXXVIII

O ~ H3 CH3 CH3 i O N
HO j OH
H
;, HO
Formula XXXIX Formula XL
O CH3 "H3 CH3 0 CH3 CH3 CH3 II I ~ i ~'~N /" " CH3 ~ / N / / "' CH3 / N ~ \ ~ N
HO H _ OH HO H _ OH
HO , HO
Formula XLI Formula XLII
O CH3 CHj CH3 O CH3 CH3 CHI
I
N / CH3 ~ ~ N / CH3 HO H ~ ~ OH HO H ~ ~ OH
HO . HO
Formula XLIII Formula XLIV
O CH3 CH~ CH3 O CHa CH3 CH3 I I
'/ ~N /CHI N CH3 I N ~ \ N
HO H _ OH 0 H ~ OH
HO , HO
Formula XLV Formula XLVI
O CH, i.H, O CH, CH, ~/~\ i I N ~ ~ N
HO H _ ~ OH HO H ~ OH
HO ~ HO
Formula XLVII Formula XLVIII

O CH, O CH, i ~ /O ~ ~ OH
\ ~ ~N \ ~ N
/_ \ % /_ \
HO H OH HO H OH
HO , H / 7 Formula XLIX Formula L

\ ,o ~ ~oH
\ ~ N~ \ ~ N
/ \ -~/ \
HO HN _ OH HO H _ OH
HO ~ , HO
Formula LI Formula LII
0 CH, CH, CH, 0 CH, CH, CH, N /~ / CH, / N / / CH, \ / H \ / ~ OH
~/ \ OH OH
He HN / \ OH HO H / \ OH
HO y HO
Formula LIII Formula LIV
CH, CH, CH, O CH, CH CH
i ~ /~ ~ i ~ ~/ ~~I
N~~~CH, N ~ " " CH, \ OH \ ~ OH OH
OH ~ OH OH
/ ~ N
HO H ~ _ \ OH HO H _ OH
H~ ~ HO
Formula LV Formula LVI
O CH, CH, CH, O CH, CH, CH, N / CH, ~ N / CH, \ ~ OH OH OH ~ OH
OH OH \ OH OH
I N--~ I N \
HG H ~~OH O H _ OH
HO ~/ ~ HO ~ c'LIZ
Formula LVII Formula LVIII

/ ~~ I~ \~ ~ \~ CHI
OH ~ OH OH
~/~\ OH OH OH
/ N
HO /
H 'OH
HO
Formula LIX
Certain embodiments expressly exclude one or more of the compounds of Formula I. In one embodiment, the compound of Formula II is excluded.
The compounds of this invention may be formulated into pharmaceutical compositions comprised of compounds of Formula I in combination with a pharmaceutical acceptable carrier, as discussed in Section V below.
III. Method of MakincLa Farnesyl Dibenzodiazepinone by Fermentation In one embodiment, ECO-04601 is obtained by cultivating a novel strain of Micromonospora, namely Micromonospora sp. strain 046-EC011. Strain 046-EC011 was deposited on March 7, 2003, with the International Depositary Authority of Canada (IDAC), Bureau of Microbiology, Health Canada, 1015 Arlington Street, Winnipeg, Manitoba, Canada R3E 3R2, under Accession No. 070303-01. The deposit of the strain was made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Purposes of Patent Procedure. The deposited strains will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. The deposited strains are provided merely as convenience to those skilled in the art and are not an admission that a deposit is required for enablement, such as that required under 35 U.S.C. ~112.
It is to be understood that the present invention is not limited to use of the particular strain 046-EC011. Rather, the present invention contemplates the use of other ECO-04601 producing organisms, such as mutants or variants of 046-ECO11 that can be derived from this organism by known means such as X-ray irradiation, ultraviolet irradiation, treatment with nitrogen mustard, phage exposure, antibiotic selection and the like; or through the use of recombinant genetic engineering techniques, as described in Section IV below.
The farnesyl dibenzodiazepinone compounds of the present invention may be biosynthesized by various microorganisms. Microorganisms that may synthesize the compounds of the present invention include but are not limited to bacteria of the order Actinomycetales, also referred to as actinomycetes. Non-limiting examples of members belonging to the genera of Actinomycetes include Nocardia, Geodermatophilus, Actinoplanes, Micromonospora, Nocardioides, Saccharothrix, Amycolatopsis, Kutzneria, Saccharomonospora, Saccharopolyspora, Kitasatospora, Streptomyces, Microbispora, Streptosporangium, and Actinomadura. The taxonomy of actinomycetes is complex and reference is made to Goodfellow, Suprageneric Classification ofActinomycetes (1989); 8ergey's Manual of Systematic bacteriology, Voi. 4 (Williams and Wilkins, Baltimore, pp. 2322-2339); and to Embley and Stackebrandt, ''The molecular phylogeny and systematics of the actinomycetes,"' Annu. Rev. Microbiol. (1994) 48:257-289, each of which is hereby incorporated by reference in its entirety, for genera that may synthesize the compounds of the invention.
Farnesyl dibenzodiazepinone-producing microorganisms are cultivated in culture medium containing known nutritional sources for actinomycetes. Such media having assimilable sources of carbon, nitrogen, plus optional inorganic salts and other known growth factors at a pH of about 6 to about 9. Suitable media include, without limitation, the growth media provided in Table 16. Microorganisms are cultivated at incubation temperatures of about 18 °C to about 40 °C for about 3 to about 40 days.
The culture media inoculated with the farnesyl dibenzodiazepinone-producing microorganisms may be aerated by incubating the inoculated culture media with agitation, for example, shaking on a rotary shaker, or a shaking water bath.
Aeration may also be achieved by the injection of air, oxygen or an appropriate gaseous mixture to the inoculated culture media during incubation. Following cultivation, the farnesyl dibenzodiazepinone compounds can be extracted and isolated from the cultivated culture media by techniques known to a skilled person in the art and/or disclosed herein, including for example centrifugation, chromatography, adsorption, filtration. For example, the cultivated culture media can be mixed with a suitable organic solvent such as n-butanol, n-butyl acetate or 4-methyl-2-pentanone, the organic layer can be separated for example, by centrifugation followed by the removal of the solvent, by evaporation to dryness or by evaporation to dryness ~00~-71'CT-9CA

under vacuum. The resulting residue can optionally be reconstituted with for example water, ethanol, ethyl acetate, methanol or a mixture thereof, and re-extracted with a suitable organic solvent such as hexane, carbon tetrachloride, methylene chloride or a mixture thereof. Following removal of the solvent, the compounds may be further purified by the use of standard techniques, such as chromatography.
The farnesyl dibenzodiapezinones biosynthesized by microorganisms may optionally be subjected to random and/or directed chemical modifications to form compounds that are derivatives or structural analogs. Such derivatives or structural analogs having similar functional activities are within the scope of the present invention. Farnesyl dibenzodiapezinone compounds may optionally be modified using methods known in the art and described herein.
IV. Method of Making a Farnesyl Dibenzodiazepinone by Recombinant Technology In another embodiment, the present invention relates to nucleic acid molecules that encode proteins useful in the production of farnesyl benzodiazepinones. Specifically, the present invention provides recombinant DNA
vectors and nucleic acid molecules that encode all or part of the biosynthetic locus in strain 046-EC011, which directs the production of ECO-04601, and is referred to herein as "046D." The invention further includes genetic modification of 046D
using conventional genetic recombinant techniques, such as mutagenesis, inactivation, or replacement of nucleic acids, to produce chemical variants of ECO-04601.
The invention thus provides a method for making a farnesyl benzodiazepinone compound using a transformed host cell comprising a recombinant DNA vector that encodes one or more of the polypeptides of the present invention, and culturing the host cell under conditions such that farnesyl benzodiazepinone is produced. The host cell is a prokaryote. In one embodiment, the host cell is an actinomycete. In another embodiment, the host cell is a Streptomyces host cell.
The invention provides recombinant nucleic acids that produce a variety of farnesyl dibenzodiazepinone compounds that cannot be readily synthesized by chemical methodology alone. The invention allows direct manipulation of 046D
biosynthetic focus via genetic engineering of the enzymes involved in the biosynthesis of a farnesyl benzodiazepinone according to the invention. The biosynthetic locus is described in Example 11.
Recombinant DNA Vectors Vectors of the invention typically comprise the DNA of a transmissible agent, into which foreign DNA is inserted. A common way to insert one segment of DNA
into another segment of DNA involves the use of specific enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. A "cassette" refers to a DNA coding sequence or segment of DNA
that codes for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. Generally, a nucleic acid molecule that encodes a protein useful in the production of a farnesyl benzodiazepinone is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a prokaryote e.g. actinomycte, by transformation (see below). A
segment or sequence of DNA having inserted or added DNA, such as an expression vector, can also be called a "DNA construct". A common type of vector is a "plasmid"
which generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can be readily introduced into a suitable host cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA. Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular protein or enzyme. In one embodiment of the invention, the coding DNA encodes for polypeptides of SEQ ID NOs. 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 or 89 that are required for the biosynthesis of a farnesyl benzodiazepinone.
Promoter DNA of a recombinant vector is a DNA sequence that initiates, regulates, or otherwise mediates or controls the expression of the coding DNA.
Promoter DNA and coding may be from the same or different organisms.
Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g.
antibiotic resistance, and one or more expression cassettes. Vector constructs may be produced using conventional molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al., 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D. N. Glover ed. 1985); F. M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
Examples of promoters that function in actinomycetes, e.g. Streptomyces, are taught in US Patent Nos. 5,830,695 and 5,466,590. Another example of a transcription promoter useful in Actinomycetes expression vectors is tipA, a promoter inducible by the antibiotic thiostrepton [c.f. Murakami, T., et al., (1989), J.
Bacteriol, 171, 1459].
Transformation of Actinomycetes A suitable transformation method for use with an actinomycete comprises forming the actinomycete culture into spheroplasts using lysozyme. A buffer solution containing recombinant DNA vectors and polyethylene glycol is then added, in order to introduce the vector into the host cells, by using either of the methods of Thompson or Keiser [c. f. Thompson, C. J., et al., (1982), J. Bacteriol., 151, or Keiser, T. et al. (2000), "Practical Streptomyces Genetics", The John lnnes Foundation, Norwich], for example. A thiostrepton-resistance gene is frequently used as a selective marker in the transformation plasrnid [c.f. Hopwood, D. A., et al., (1987), "Methods in Enzymology" 153, 116, Academic Press, New York], but the present invention is not limited thereto. Additional methods for the transformation of actinomycetes are taught in US 5,393,665.
Assay for farnesyl dibenzodiazepinone or biosynthetic intermediates Actinomycetes defective in farnesyl dibenzodiazepinone biosynthesis are transformed with one or more expression vectors encoding one or more proteins in the farnesyl benzodiazepinone biosynthetic pathway, thus restoring farnesyl benzodiazepinone biosynthesis by genetic complementation of the specific defect.

3~05-7PCT-9CA

The presence or absence of farnesyl dibenzodiazepinone or intermediates in the biosynthetic pathway (see Figures 13, 14 and 15) in a recombinant actinomycete can be determined using methodologies that are well known to persons of skill in the art. For example, ethyl acetate extracts of fermentation media used for the culture of a recombinant actinomycete are processed as described in Example 2 and fractions containing farnesyl dibenzodiazepinone or intermediates detected by TLC on commercial Kieselgel 60F25a plates. Farnesyl dibenzodiazepinone and intermediate compounds are visualized by inspection of dried plates under UV light or by spraying the plates with a spray containing vanillin (0.75%) and concentrated sulfuric acid (1.5%, v/v) in ethanol and subsequently heating the plate. The exact identity of the compounds separated by TLC is then determined using gas chromatography-mass spectroscopy. Methods of mass spectroscopy are taught in the published U.S.
Patent Application No. US2003/0052268.
Mutac~enesis The invention allows direct manipulation of 046D biosynthetic locus via genetic engineering of the enzymes involved in the biosynthesis of a farnesyl benzodiazepinone according to the invention.
A number of methods are known in the art that permit the random as well as targeted mutation of the DNA sequences of the invention (see for example, Ausubel et. al. Short Protocols in Molecular Biology (1995) 3rd Ed. John Wiley & Sons, Inc.).
In addition, there are a number of of commercially available kits for site-directed mutagenesis, including both conventional and PCR-based methods. Examples include the E~SITET"' PCR-Based Site-directed Mutagenesis Kit available from Stratagene (Catalog No. 200502) and the QUIKCHANGETM Site-directed mutagenesis Kit from Stratagene (Catalog No. 200518), and the CHAMELEON~
double-stranded Site-directed mutagenesis kit, also from Stratagene (Catalog No.
200509).
In addition the nucleotides of the invention may be generated by insertional mutation or truncation (N-terminal, internal or C-terminal) according to methodology known to a person skilled in the art.
Older methods of site-directed mutagenesis known in the art rely on sub-cloning of the sequence to be mutated into a vector, such as an M13 bacteriophage vector, that allows the isolation of single-stranded DNA template. In these methods, one anneals a mutagenic primer (i.e., a primer capable of annealing to the site to be mutated but bearing one or more mismatched nucleotides at the site to be mutated) to the single-stranded template and then polymerizes the complement of the template starting from the 3' end of the mutagenic primer. The resulting duplexes are then transformed into host bacteria and plaques are screened for the desired mutation.
More recently, site-directed mutagenesis has employed PCR methodologies, which have the advantage of not requiring a single-stranded template. In addition, methods have been developed that do not require sub-cloning. Several issues must be considered when PCR-based site-directed mutagenesis is performed. First, in these methods it is desirable to reduce the number of PCR cycles to prevent expansion of undesired mutations introduced by the polymerise. Second, a selection must be employed in order to reduce the number of non-mutated parental molecules persisting in the reaction. Third, an extended-length PCR method is preferred in order to allow the use of a single PCR primer set. And fourth, because of the non-template-dependent terminal extension activity of some thermostable polymerises it is often necessary to incorporate an end-polishing step into the procedure prior to blunt-end ligation of the PCR-generated mutant product.
The protocol described below accommodates these considerations through the following steps. First, the template concentration used is approximately fold higher than that used in conventional PCR reactions, allowing a reduction in the number of cycles from 25-30 down to 5-10 without dramatically reducing product yield. Second, the restriction endonuclease Dpn I (recognition target sequence: 5-Gm6ATC-3, where the A residue is methylated) is used to select against parental DNA, since most common strains of E. coli Dam methylate their DNA at the sequence 5-GATC-3. Third, Taq Extender is used in the PCR mix in order to increase the proportion of long (i.e., full plasmid length) PCR products.
Finally, Pfu DNA polymerise is used to polish the ends of the PCR product prior to intramolecular ligation using T4 DNA ligase.
A non-limiting example for the isolation of mutant polynucleotides is described in detail as follows:
Plasmid template DNA (approximately 0.5 pmole) is added to a PCR cocktail containing: 1x mutagenesis buffer (20 mM Tris HCI, pH 7.5; 8 mM MgCl2;
40~gi'ml BSA); 12-20 pmole of each primer (one of skill in the art may design a mutagenic primer as necessary, giving consideration to those factors such as base composition, primer length and intended buffer salt concentrations that affect the annealing characteristics of oligonucleotide primers; one primer must contain the desired mutation, and one (the same or the other) must contain a 5' phosphate to facilitate later ligation), 250 ~M each dNTP, 2.5 U Taq DNA polymerise, and 2.5 U
of Taq Extender (Available from Stratagene; See Nielson et al. (1994) Strategies 7:
27, and U.S. Patent No. 5,556,772). Primers can be prepared using the triester method of Matteucci et al., 1981, J. Am. Chem. Soc. 103:3185-3191, incorporated herein by reference. Alternatively automated synthesis may be preferred, for example, on a Biosearch 8700 DNA Synthesizer using cyanoethyl phosphoramidite chemistry.
The PCR cycling is performed as follows: 1 cycle of 4 min at 94oC, 2 min at 50oC and 2 min at 72oC; followed by 5-10 cycles of 1 min at 94oC, 2 min at 54oC
and 1 min at 72oC. The parental template DNA and the linear, PCR-generated DNA
incorporating the mutagenic primer are treated with Dpnl (10 U) and Pfu DNA
polymerise (2.5U). This results in the Dpnl digestion of the in vivo methylated parental template and hybrid DNA and the removal, by Pfu DNA polymerise, of the non-template-directed Taq DNA polymerise-extended bases) on the linear PCR
product. The reaction is incubated at 37oC for 30 min and then transferred to 72oC
for an additional 30 min. Mutagenesis buffer (115 ul of 1x) containing 0.5 mM
ATP
is added to the Dpnl-digested, Pfu DNA polymerise-polished PCR products. The solution is mixed and 10 ul are removed to a new microfuge tube and T4 DNA
ligase (2-4 U) is added. The ligation is incubated for greater than 60 min at 37oC.
Finally, the treated solution is transformed into competent E. coli according to standard methods.
Methods of random mutagenesis, which will result in a panel of mutants bearing one or more randomly situated mutations, exist in the art. Such a panel of mutants may then be screened for those exhibiting reduced uracil detection activity relative to the wild-type polymerise (e.g., by measuring the incorporation of 10nmoles of dNTPs into polymeric form in 30 minutes in the presence of 200~M
dUTP and at the optimal temperature for a given DNA polymerise). An example of a method for random mutagenesis is the so-called "error-prone PCR method". As the name implies, the method amplifies a given sequence under conditions in which the DNA polymerise does not support high fidelity incorporation. The conditions encouraging error-prone incorporation for different DNA polymerises vary, however one skilled in the art may determine such conditions for a given enzyme. A key variable for many DNA polymerises in the fidelity of amplification is, for example, the type and concentration of divalent metal ion in the buffer. The use of manganese ion and/or variation of the magnesium or manganese ion concentration may therefore be applied to influence the error rate of the polymerise.
Genes for desired mutant polypeptides generated by mutagenesis may be sequenced to identify the sites and number of mutations. For those mutants comprising more than one mutation, the effect of a given mutation may be evaluated by introduction of the identified mutation to the wild-type gene by site-directed mutagenesis in isolation from the other mutations borne by the particular mutant.
Screening assays of the single mutant thus produced will then allow the determination of the effect of that mutation alone.
V. Genes and proteins for the production of ECO-04601 As discussed in more detail below, the isolated, purified or enriched nucleic acids of one of SEQ I D NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 2 7, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89 may be used to prepare one of the polypeptides of SEQ ID
NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 4C, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80,' 82, 84, 86 and 88, respectively, or fragments comprising at least 50, 75, 100, 200, 300, 500 or more consecutive amino acids of one of the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88.
Accordingly, another aspect of the present invention is an isolated, purified or enriched nucleic acid which encodes one of the polypeptides of SEQ ID NOS: 2, 4, 5, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200, 300 or more consecutive amino acids of one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88. The coding sequences of these nucleic acids may be identical to one of the coding sequences of one of the nucleic acids of SEQ I D NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89 or a fragment thereof, or may be different coding sequences which encode one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200, 300 consecutive amino acids of one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, ~'34, 86 and 88 as a result of the redundancy or degeneracy of the genetic code. The genetic code is well known to those of skill in the art and can be obtained, for example, from Stryer, Biochemistry, 3rd edition, W. H. Freeman & Co., New York.
The isolated, purified or enriched nucleic acid which encodes one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36. 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 may include, but is not limited to: (1 ) only the coding sequences of one of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89; (2) the coding sequences of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89 and additional coding sequences, such as leader sequences or proprotein; and (3) the coding sequences of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89 and non-coding sequences, such as non-coding sequences 5' and/or 3' of the coding sequence. Thus, as used herein, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide that includes only coding sequence for the polypeptide as well as a polynucleotide that includes additional coding and/or non-coding sequence.
The invention relates to polynucleotides based on SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89 but having polynucleotide changes that are "silent", for example changes which do not alter the amino acid sequence encoded by the polynucleotides of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89. The invention also relates to polynucleotides which have nucleotide changes which result in amino acid substitutions, additions, deletions, fusions and truncations of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88. Such nucleotide changes may be introduced using techniques such as site directed mutagenesis, random chemical mutagenesis, exonuclease III
deletion, and other recombinant DNA techniques.
The isolated, purified or enriched nucleic acids of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89, the sequences complementary thereto, or a fragment comprising at least 100, 150, 200, 300, 400 or more consecutive bases of one of the sequence of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 51, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89, or the sequences complementary thereto may be used as probes to identify and isolate DNAs encoding the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 espectively. In such procedures, a genomic DNA library is constructed from a sample microorganism or a sample containing a microorganism capable of producing a farnesyl dibenzodiazepinone.
The genomic DNA library is then contacted with a probe comprising a coding sequence or a fragment of the coding sequence, encoding one of the polypeptides of SEO ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88, or a fragment thereof under conditions which permit the probe to specifically hybridize to sequences complementary thereto. In a preferred embodiment, the probe is an oligonucleotide of about 10 to about 30 nucleotides in length designed based on a nucleic acid of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89. Genomic DNA clones which hybridize to the probe are then detected and isolated. Procedures for preparing and identifying DNA clones of interest are disclosed in Ausubel et al., Current Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997; and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press, 1989. In another embodiment, the probe is a restriction fragment or a PCR
amplified nucleic acid derived from SEQ I D NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89.
The isolated, purified or enriched nucleic acids of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive bases of one of the sequences of SEQ I D NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89 or the sequences complementary thereto may be used as probes to identify and isolate related nucleic acids. In some embodiments, the related nucleic acids may be genomic DNAs (or cDNAs) from potential farnesyl dibenzodiazepinone producers. In such procedures, a nucleic acid sample containing nucleic acids from a potential farnesyl dibenzodiazepinone producer is contacted with the probe under conditions that permit the probe to specifically hybridize to related sequences. The nucleic acid sample may be a genomic DNA (or cDNA) library from the potential farnesyl dibenzodiazepinone-producer. Hybridization of the probe to nucleic acids is then detected using any of the methods described above.
Hybridization may be carried out under conditions of low stringency, moderate stringency or high stringency. As an example of nucleic acid hybridization, a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45 °C in a solution consisting of 0.9 M
NaCI, 50 mM

NaH2P04, pH 7.0, 5.0 mM Na2EDTA, 0.5% SDS, 10X Denhardt's, and 0.5 mg/ml polyriboadenylic acid. Approximately 2 x 10' cpm (specific activity 4-9 x 10$
cpm/ug) of 32P end-labeled oligonucleotide probe are then added to the solution. After hours of incubation, the membrane is washed for 30 minutes at room temperature in 1X SET (150 mM NaCI, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na2EDTA) containing 0.5% SDS, followed by a 30 minute wash in fresh 1X SET at Tm-10°C for the oligonucleotide probe where Tm is the melting temperature. The membrane is then exposed to autoradiographic film for detection of hybridization signals.
By varying the stringency of the hybridization conditions used to identify nucleic acids, such as genomic DNAs or cDNAs, which hybridize to the detectable probe, nucleic acids having different levels of homology to the probe can be identified and isolated. Stringency may be varied by conducting the hybridization at varying temperatures below the melting temperatures of the probes. The melting temperature of the probe may be calculated using the following formulas:
For oligonucleotide probes between 14 and 70 nucleotides in length the melting temperature (Tm) in degrees Celcius may be calculated using the formula:
Tm=81.5+16.6(log [Na+]) + 0.41 (fraction G+C)-(600/N) where N is the length of the oligonucleotide.
If the hybridization is carried out in a solution containing formamide, the melting temperature may be calculated using the equation Tm=81.5+16.6(log [Na +]) + 0.41 (fraction G + C)-(0.63% formamide)-(600/N) where N is the length of the probe.
Prehybridization may be carried out in 6X SSC, 5X Denhardt's reagent, 0.5%
SDS, 0.1 mg/ml denatured fragmented salmon sperm DNA or 6X SSC, 5X
Denhardt's reagent, 0.5% SDS, 0.1 mg/ml denatured fragmented salmon sperm DNA, 50% formamide. The composition of the SSC and Denhardt's solutions are listed in Sambrook et al., supra.
Hybridization is conducted by adding the detectable probe to the hybridization solutions listed above. Where the probe comprises double stranded DNA, it is denatured by incubating at elevated temperatures and quickly cooling before addition to the hybridization solution. It may also be desirable to similarly denature single stranded probes to eliminate or diminish formation of secondary structures or oligomerization~ The filter is contacted with the hybridization solution for a sufficient period of time to allow the probe to hybridize to cDNAs or genomic DNAs containing sequences complementary thereto or homologous thereto. For probes over 200 nucleotides in length, the hybridization may be carried out at 15-25 °C
below the Tm.
For shorter probes, such as oligonucleotide probes, the hybridization may be conducted at 5-10 °C below the Tm. Preferably, the hybridization is conducted in 6X
SSC, for shorter probes. Preferably, the hybridization is conducted in 50%
formamide containing solutions, for longer probes. All the foregoing hybridizations would be considered to be examples of hybridization performed under conditions of high stringency.
Following hybridization, the filter is washed for at least 15 minutes in 2X
SSC, 0.1 % SDS at room temperature or higher, depending on the desired stringency.
The filter is then washed with 0.1X SSC, 0.5% SDS at room temperature (again) for minutes to 1 hour. Nucleic acids which have hybridized to the probe are identified by conventional autoradiography and non-radioactive detection methods.
The above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence. For example, to obtain nucleic acids of decreasing homology to the detectable probe, less stringent conditions may be used. For example, the hybridization temperature may be decreased in increments of 5 °C from 68 °C to 42 °C in a hybridization buffer having a Na+ concentration of approximately 1 M. Following hybridization, the filter may be washed with 2X SSC, 0.5% SDS at the temperature of hybridization. These conditions are considered to be "moderate stringency" conditions above 50°C and "low stringency" conditions below 50°C. A specific example of "moderate stringency"
hybridization conditions is when the above hybridization is conducted at 55°C. A
specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 45°C.
Alternatively, the hybridization may be carried out in buffers, such as 6X
SSC, containing formamide at a temperature of 42 °C. In this case, the concentration of formamide in the hybridization buffer may be reduced in 5% increments from 50%
to 0% to identify clones having decreasing levels of homology to the probe.
Following hybridization, the filter may be washed with 6X SSC, 0.5% SDS at 50 °C.
These conditions are considered to be "moderate stringency" conditions above 25%
formamide and "low stringency" conditions below 25% formamide. A specific example of "moderate stringency" hybridization conditions is when the above hybridization is conducted at 30% formamide. A specific example of "low stringency"
hybridization conditions is when the above hybridization is conducted at 10%
formamide. Nucleic acids which have hybridized to the probe are identified by conventional autoradiography and non-radioactive detection methods.
The preceding methods may be used to isolate nucleic acids having at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70%
sequence identity to a nucleic acid sequence selected from the group consisting of the sequences of SEQ I D NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89. The isolated nucleic acid may have a coding sequence that is a naturally occurring allelic variant of one of the coding sequences described herein. Such allelic variant may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89, or the sequences complementary thereto.
Additionally, the above procedures may be used to isolate nucleic acids which encode polypeptides having at least 99%, at least 95%, at least 90%, at least 85%, at least 80°f0, or at least 70% identity to a polypeptide having the sequence of one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200, 300 consecutive amino acids thereof.
Another aspect of the present invention is an isolated or purified polypeptide comprising the sequence of one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof. As discussed herein, such polypeptides may be obtained by inserting a nucleic acid encoding the polypeptide into a vector such that the coding sequence is operably linked to a sequence capable of driving the expression of the encoded polypeptide in a suitable host cell. For example, the expression vector may comprise a promoter, a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for modulating expression levels, an origin of replication and a selectable marker.
Promoters suitable for expressing the polypeptide or fragment thereof in bacteria include the E.coli lac or trp promoters, the lacl promoter, the iacZ
promoter, the T3 promoter, the T7 promoter, the gpt promoter, the lambda PR promoter, the lambda P~ promoter, promoters from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), and the acid phosphatase promoter. Fungal promoters include the a factor promoter. Eukaryotic promoters include the CMV
immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter. Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used.
Mammalian expression vectors may also comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donors and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. In some embodiments, DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels. Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 by in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin by 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancers.
In addition, the expression vectors preferably contain one or more selectable marker genes to permit selection of host cells containing the vector. Examples of selectable markers that may be used include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E. coli, and the S.
cerevisiae TRP1 gene.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases. Alternatively, appropriate restriction enzyme sites can be engineered into a DNA sequence by PCR. A variety of cloning techniques are disclosed in Ausbel et al. Current Protocols in Molecular Biology, John Wiley Sons, Inc. 1997 and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbour Laboratory Press, 1989. Such procedures and others are deemed to be within the scope of those skilled in the art.
The vector may be, for example, in the form of a plasmid, a viral particle, or a phage. Other vectors include derivatives of chromosomal, nonchromosomal and synthetic DNA sequences, viruses, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A
variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989).
Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), pGEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, phiX174, pBluescriptT"' II KS, pNHBA, pNH16a, pNH18A, pNH46A
(Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7. Particular eukaryotic vectors include pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used as long as it is replicable and stable in the host cell.
The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells or eukaryotic cell s. As representative examples of appropriate hosts, there may be mentioned: bacteria cells, such as E. coli, Streptomyces lividans, Streptomyces griseofuscus, Streptomyces ambofaciens, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, Bacillus, and Staphylococcus, fungal cells, such as yeast, insect cells such as Drosophila S2 and Spodoptera Sf9, animal cells such as CHO, COS or Bowes melanoma, and adenoviruses. The selection of an appropriate host is within the abilities of those skilled in the art.
The vector may be introduced into the host cells using any of a variety of techniques, including electroporation transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Where appropriate, the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.
Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art.
The expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography.
Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purification steps.
Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts (described by Gluzman, Cell, 23:175(1981 )), and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines. The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Polypeptides of the invention may or may not also include an initial methionine amino acid residue.
Alternatively, the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, h2, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof can be synthetically produced by conventional peptide synthesizers. In other embodiments, fragments or portions of the polynucleotides may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
Cell-free translation systems can also be employed to produce one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof using mRNAs transcribed from a DNA
construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof. In some embodiments, the DNA construct may be linearized prior to conducting an in vitro transcription reaction. The transcribed mRNA is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
The present invention also relates to variants of the polypeptides of SEQ ID
NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments comprising at least 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof. The term "variant" includes derivatives or analogs of these polypeptides. In particular, the variants may differ in amino acid sequence from the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
The variants may be naturally occurring or created in vitro. In particular, such variants may be created using genetic engineering techniques such as site directed mutagenesis, random chemical mutagenesis, exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives may be created using chemical synthesis or modification procedures.
Other methods of making variants are also familiar to those skilled in the art.

These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids that encode polypeptides having characteristics which enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Preferably, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
The variants of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 15, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, b0, 62, 65, 679 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 may be variants in which one or more of the amino acid residues of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the following replacements: replacements of an aliphatic amino acid such as Ala, Val, Leu and Ile with another aliphatic amino acid;
replacement of a Ser with a Thr or vice versa; replacement of an acidic residue such as Asp or Glu with another acidic residue; replacement of a residue bearing an amide group, such as Asn or Gln, with another residue bearing an amide group;
exchange of a basic residue such as Lys or Arg with another basic residue; and replacement of an aromatic residue such as Phe or Tyr with another aromatic residue.
Other variants are those in which one or more of the amino acid residues of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 include a substituent group. Still other variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol). Additional variants are those in which additional amino acids are fused to the polypeptide, such as leader sequence, a secretory sequence, a proprotein sequence or a sequence that facilitates purification, enrichment, or stabilization of the polypeptide.
In some embodiments, the fragments, derivatives and analogs retain the same biological function or activity as the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88. In other embodiments, the fragment, derivative or analogue includes a fused heterologous sequence that facilitates purification, enrichment, detection, stabilization or secretion of the polypeptide that can be enzymatically cleaved, in whole or in part, away from the fragment, derivative or analogue.
Another aspect of the present invention are polypeptides or fragments thereof which have at least 70%, at least 80%, at least 85%, at least 90%, or more than 95% identity to one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 50, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or a fragment comprising at least 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof. It will be appreciated that amino acid "substantially identity" includes conservative substitutions such as those described above.
The polypeptides or fragments having homology to one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or a fragment comprising at least 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof may be obtained by isolating the nucleic acids encoding them using the techniques described above.
Alternatively, the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures. The sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing. The sequence of the prospective homologous polypeptide or fragment can be compared to one of the polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
The polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 59, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88 or fragments, derivatives or analogs thereof comprising at least 40, 50, 75, 100, 150, 200 or 300 consecutive amino acids thereof invention may be used in a variety of applications. For example, the polypeptides or fragments, derivatives or analogs thereof may be used to catalyze biochemical reactions as described elsewhere in the specification.
VI. Pharmaceutical compositions comprising farnesyl dibenzodiazepinones In another embodiment, the invention relates to a pharmaceutical composition comprising a farnesyl dibenzodiazepinone, as described in the preceding section, and a pharmaceutically acceptable carrier, as described below. The pharmaceutical composition comprising the farnesyl dibenzodiazepinone is useful for treating a variety of diseases and disorders, including cancer, inflammation and bacterial infections.
The compounds of the present invention, or pharmaceutically acceptable salts thereof, can be formulated for oral, intravenous, intramuscular, subcutaneous, topical or parenteral administration for the therapeutic or prophylactic treatment of diseases, particularly bacterial infections, acute and chronic inflammation and cancer. For oral or parental administration, compounds of the present invention can be mixed with conventional pharmaceutics! carriers and excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, wafers and the like.
The compositions comprising a compound of this present invention will contain from about 0.1 % to about 99.9%, about 1 % to about 98%, about 5% to about 95%, about 10% to about 80% or about 15% to about 60% by weight of the active compound.
The pharmaceutical preparations disclosed herein are prepared in accordance with standard procedures and are administered at dosages that are selected to reduce, prevent, or eliminate bacterial infection, cancer or inflammation.
(See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA; and Goodman and Gilman, Pharmaceutical Basis of Therapeutics, Pergamon Press, New York, NY, the contents of which are incorporated herein by reference, for a general description of the methods for administering various antimicrobial agents for human therapy). The compositions of the present invention can be delivered using controlled (e.g., capsules) or sustained release delivery systems (e.g., bioerodable matrices). Exemplary delayed release delivery systems for drug delivery that are suitable for administration of the compositions of the invention (preferably of Formula I) are described in U.S. Patent Nos 4,452,775 (issued to Kent), 5,239,660 (issued to Leonard), 3,854,480 (issued to Zaffaroni), The pharmaceutically acceptable compositions of the present invention comprise one or more compounds of the present invention in association with one or more non-toxic, pharmaceutically acceptable carriers and/or diluents and/or adjuvants and/or excipients, collectively referred to herein as "carrier"
materials, and if desired other active ingredients. The compositions may contain common carriers and excipients, such as corn starch or gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid.
The compositions may contain crosarmellose sodium, microcrystalline cellulose;, sodium starch glycolate and alginic acid.
Tablet binders that can be included are acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (Providone), hydroxypropyl methylcellulose, sucrose, starch and ethylcellulose.
Lubricants that can be used include magnesium stearate or other metallic stearates, stearic acid, silicon fluid, talc, waxes, oils and colloidal silica.
Flavouring agents such as peppermint, oil of wintergreen, cherry flavouring or the like can also be used. It may also be desirable to add a coloring agent to make the dosage form more aesthetic in appearance or to help identify the product comprising a compound of the present invention.
For oral use, solid formulations such as tablets and capsules are particularly useful. Sustained released or enterically coated preparations may also be devised.
For pediatric and geriatric applications, suspension, syrups and chewable tablets are especially suitable. For oral administration, the pharmaceutical compositions are in the form of, for example, a tablet, capsule, suspension or liquid. The pharmaceutical composition is preferably made in the form of a dosage unit containing a therapeutically-effective amount of the active ingredient. Examples of such dosage units are tablets and capsules. For therapeutic purposes, the tablets and capsules which can contain, in addition to the active ingredient, conventional carriers such as binding agents, for example, acacia gum, gelatin, polyvinylpyrrolidone, sorbitol, or tragacanth; fillers, for example, calcium phosphate, glycine, lactose, maize-starch, sorbitol, or sucrose; lubricants, for example, magnesium stearate, polyethylene glycol, silica or talc: disintegrants, for example, potato starch, flavoring or coloring agents, or acceptable wetting agents. Oral liquid preparations generally are in the form of aqueous or oily solutions, suspensions, emulsions, syrups or elixirs and may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous agents, preservatives, coloring agents and flavoring agents. Examples of additives for liquid preparations include acacia, almond oil, ethyl alcohol, fractionated coconut oil, gelatin, glucose syrup, glycerin, hydrogenated edible fats, lecithin, methyl cellulose, methyl or propyl para-hydroxybenzoate, propylene glycol, sorbitol, or sorbic acid.
For intravenous (iv) use, compounds of the present invention can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion. Intravenous fluids include, without limitation, physiological saline or Ringer's solution.
Formulations for parental administration can be in the form of aqueous or non-aqueous isotonic sterile injection solutions or suspensions. These solutions or suspensions can be prepared from sterile powders or granules having one or more of the carriers mentioned for use in the formulations for oral administration.
The compounds can be dissolved in polyethylene glycol, propylene glycol, ethanol, corn oil, benzyl alcohol, sodium chloride, and/or various buffers.
For intramuscular preparations, a sterile formulation of compounds of the present invention or suitable soluble salts forming the compound, can be dissolved and administered in a pharmaceutical diluent such as Water-for-Injection (WFI), physiological saline or 5% glucose. A suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g. an ester of a long chain fatty acid such as ethyl oleate.
For topical use the compounds of present invention can also be prepared in suitable forms to be applied to the skin, or mucus membranes of the nose and throat, and can take the form of creams, ointments, liquid sprays or inhalants, lozenges, or throat paints. Such topical formulations further can include chemical compounds such as dimethylsulfoxide (DMSO) to facilitate surface penetration of the active ingredient.
For application to the eyes or ears, the compounds of the present invention can be presented in liquid or semi-liquid form formulated in hydrophobic or hydrophilic bases as ointments, creams, lotions, paints or powders.
For rectal administration the compounds of the present invention can be administered in the form of suppositories admixed with conventional carriers such as cocoa butter, wax or other glyceride.
Alternatively, the compound of the present invention can be in powder form for reconstitution in the appropriate pharmaceutically acceptable carrier at the time of delivery. In another embodiment, the unit dosage form of the compound can be a solution of the compound or a salt thereof in a suitable diluent in sterile, hermetically sealed ampoules.
The amount of the compound of the present invention in a unit dosage comprises a therapeutically-effective amount of at least one active compound of the present invention which may vary depending on the recipient subject, route and frequency of administration. A recipient subject refers to a plant, a cell culture or an animal such as an ovine or a mammal including a human.
According to this aspect of the present invention, the novel compositions disclosed herein are placed in a pharmaceutically acceptable carrier and are delivered to a recipient subject (including a human subject) in accordance with known methods of drug delivery. In general, the methods of the invention for delivering the compositions of the invention in vivo utilize art-recognized protocols for delivering the agent with the only substantial procedural modification being the substitution of the compounds of the present invention for the drugs in the art-recognized protocols.
Likewise, the methods for using the claimed composition for treating cells in culture, for example, to eliminate or reduce the level of bacterial contamination of a cell culture, utilize art-recognized protocols for treating cell cultures with antibacterial agents) with the only substantial procedural modification being the substitution of the compounds of the present invention for the agents used in the art-recognized protocols.
The compounds of the present invention provide a method for treating bacterial infections, pre-cancerous or cancerous conditions, and acute or chronic inflammatory disease. As used herein, the term "unit dosage" refers to a quantity of a therapeutically effective amount of a compound of the present invention that elicits a desired therapeutic response. As used herein, the phrase "therapeutically effective amount" means an amount of a compound of the present invention that prevents the onset, alleviates the symptoms, or stops the progression of a bacterial infection, inflammatory condition, or pre-cancerous or cancerous condition.
The term "treating" is defined as administering, to a subject, a therapeutically effective amount of at least one compound of the present invention, both to prevent the occurrence of a bacterial infection, inflammation or pre-cancer or cancer condition, or to control or eliminate a bacterial infection, inflammation or pre-cancer or cancer condition. The term "desired therapeutic response" refers to treating a recipient subject with a compound of the present invention such that a bacterial or inflammatory condition or pre-cancer or cancer condition is reversed, arrested or prevented in a recipient subject.
The compounds of the present invention can be administered as a single daily dose or in multiple doses per day. The treatment regime may require administration over extended periods of time, e.g., for several days or for from two to four weeks. The amount per administered dose or the total amount administered will depend on such factors as the nature and severity of the disease condition, the age and general health of the recipient subject, the tolerance of the recipient subject to the compound and the type of the bacterial infection, inflammatory disorder, or type of cancer.
A compound according to this invention may also be administered in the diet or feed of a patient or animal. The diet for animals can be normal foodstuffs to which the compound can be added or it can be added to a premix.
The compounds of the present invention may be taken in combination, together or separately with any known clinically approved antibiotic, inflammation or anti-cancer agent to treat a recipient subject in need of such treatment.
VII. Method of Inhibiting Tumor Growth In another embodiment, the present invention relates to a method of inhibiting tumor growth. Compounds as described herein can possess antitumor activity.
The compounds are effective against mammalian tumor cells such as leukemia cells, melanoma cells, breast carcinoma cells, lung carcinoma cells, pancreatic carcinoma cells, ovarian carcinoma cells, renal carcinoma cells, colon carcinoma cells prostate carcinoma cells and glioma cells. The antitumor method of the invention results in inhibition of tumor cells. The term "inhibition", when used in conjunction with the antitumor method refers to suppression, killing, stasis, or destruction of tumor cells.
The antitumor method preferably results in prevention, reduction or elimination of invasive activity and related metastasis of tumor cells. The term "effective amount"
when used in conjunction with the antitumor cell method refers to the amount of the compound sufficient to result in the inhibition of mammalian tumor cells.
The inhibition of mammalian tumor growth according to this method can be monitored in several ways. First, tumor cells grown in vitro can be treated with the compound and monitored for growth or death relative to the same cells cultured in the absence of the compound. A cessation of growth or a slowing of the growth rate (i.e., the doubling rate), e.g., by 10% or more, is indicative of tumor cell inhibition.
Alternatively, tumor cell inhibition can be monitored by administering the compound to an animal model of the tumor of interest. Examples of experimental animal tumor models are known in the art and described in the examples herein. A cessation of tumor growth (i.e., no further increase in size) or a reduction in tumor size (i.e., tumor volume) or cell number (e.g., at least a 10% decrease in either) in animals treated with a compound as described herein relative to tumors in control animals not treated with the compound is indicative of tumor growth inhibition.
To monitor the efficacy of tumor treatment in a human, tumor size or tumor cell titer is measured before and after initiation of the treatment, and treatment is considered effective if either the tumor size or titer ceases further growth, or if the tumor is reduced in size or titer, e.g., by at least 10% or more (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100%, that is, the absence of the tumor).
Methods of determining the size or cell titer of a tumor in vivo vary with the type of tumor, and include, for example, various imaging techniques well known to those in the medical imaging or oncology fields (MRI, CAT, PET, etc.), as well as histological techniques and flow cytometry.
For the antitumor method of the invention, a typical effective dose of the compounds given orally or parenterally would be from about 5 to about 100 mg/kg of body weight of the subject with a daily dose ranging from about 15 to about mg/kg of body weight of the subject.
VIII. Method of Inhibiting Lipoxyaenase In another embodiment, the present invention also provides for a method of treating diseased states, in particular inflammation, caused by the 5-lipoxygenase system and/or by the synthesis of the Leukotrienes C4, D4, E4 and F4 as well as Leukotriene B4 in mammals, especially in human subjects. This method comprises administering to a subject an effective amount of ECO-04601. Compound ECO-04601 may be used alone or in combination with other anti-inflammatory compounds to treat or prevent disease states related to inflammation including pulmonary conditions, inflammation, cardiovascular conditions, central nervous system conditions or skin conditions. More specific diseases include gastritis;
erosive esophagitis; inflammatory bowel disease; ethanol-induced hemorrhagic erosions;
hepatic ischemia; ischemic neuronal injury; noxious agent induced damage or necrosis of hepatic, pancreatic, renal, neuronal or myocardial tissue; liver parenchymal damage caused by hepatoxic agents such as CC14 and D-galactosamine; ischemic renal failure; disease-induced hepatic damage; trauma-or stress-induced cell damage; asthma; multiple sclerosis; ischemic reperfusion;
edema; rheumatoid arthritis; viral encephalitis; bacterial pneumonia;
neurodegeneration; Alzheimer's disease and glycerol-induced renal failure.
For the method of the invention related to the 5-lipoxygenase system and/or the biosynthesis of Leukotrienes, a typical effective unit dose of ECO-04601 given orally or parenterally would be from about 5 to about 100 mg/kg of body weight of the subject with a daily dose ranging from about 15 to about 300 mg/kg of body weight of the subject.
The inhibition of lipoxygenase enzymes is monitored using methods well known in the art and as described in the examples herein. A decrease in enzyme activity by at least 10%, relative to the activity in the absence of a compound as described herein is indicative of effective inhibition of lipoxygenase activity.
Farnesyl dibenzodiazepinone compounds useful according to the invention can be used to reduce or prevent inflammation. Among the hallmarks of local acute inflammation are heat, redness, swelling, pain and loss of function. These changes are induced largely by changes in vascular flow and caliber, changes in vascular permeability and leukocyte exudation (Bobbins et al., "Pathologic Basis of Disease", 6'" Ed., W.B. Saunders Co., Philadelphia, PA). Anti-inflammatory therapy performed using compounds useful according to the invention can be monitored for success by tracking any of these changes. For example, a decrease in swelling (e.g., at least 10% decrease following treatment) or reported pain (e.g., a sustained decrease of 1 point or more on a 1-10 scale reported by the patient, with 10 being the worst pain experienced in association with this disorder prior to treatment, and 0 being no pain) can be used to indicate successful treatment.
Other measurable hallmarks of inflammation include leukocyte infiltration and inflammatory cytokine levels. These hallmarks can be monitored by biopsy of the affected tissue. A decrease of 10% or more in leukocyte infiltration in fixed, stained tissue relative to infiltration in similar tissue prior to treatment can be used to indicate successful treatment, as can a decrease of 10% or more in the level of any given inflammatory cytokine, relative to the level before treatment. Those skilled in the art can readily assay for inflammatory cytokine levels in tissue, blood, or other fluid samples. Alternatively, the level of systemic indicators of inflammation such as C
reactive protein levels and erythrocyte sedimentation rate can be monitored.
Each of these has established normal ranges in medicine, and treatment is considered successful if one or more of such indicators goes from outside the normal range to inside the normal range after the initiation of treatment.
IX. Method of Inhibitina Bacterial Growth In another embodiment, the present invention relates to a method for treating bacterial infection in a mammalian subject in need thereof, comprising the step of administering to the mammal a therapeutically effective amount of compound ECO-0~601, a compound as described herein, or a pharmaceutically acceptable derivative or prod rug thereof.

According to another embodiment, the invention provides a method of decreasing bacterial quantity in a biological sample. This method comprises the step of contacting the biological sample with a compound ECO-04601, a compound as described herein, or a pharmaceutically acceptable derivative or prodrug thereof.
This method is effective if the number of bacteria decreases by at least 10%, and preferably more, e.g., 25%, 50%, 75% or even 100% after contacting the biological sample with compound ECO-04601, a compound as described herein, or a pharmaceutically acceptable derivative or prod rug thereof.
These pharmaceutical compositions effective to treat or prevent a bacterial infection which comprise ECO-04601, a compound as described herein, or a pharmaceutically acceptable derivative or prodrug thereof in an amount sufficient to measurably decrease bacterial quantity, and a pharmaceutically acceptable carrier, are another embodiment of the present invention. The term "measurably decrease bacterial quantity", as used herein means a measurable change in the number of bacteria between a sample containing the inhibitor and a sample not containing the inhibitor.
Agents which increase the susceptibility of bacterial organisms to antibiotics are known. For example, U.S. Pat. No. 5,523,288, U.S. Pat. No. 5,783,561 and U.S.
Pat. No. 6,140,306 describe methods of using bactericidal/permeability-increasing protein (BPI) for increasing antibiotic susceptibility of gram-positive and gram-negative bacteria. Agents that increase the permeability of the outer membrane of bacterial organisms have been described by Vaara, M. in Microbiological Reviews (1992) pp. 395-411, and the sensitization of gram-negative bacteria has been described by Tsubery, H., et al, in J. Med. Chem . (2000) pp. 3085-3092.
For the method of the invention related to treatment of subjects with a bacterial infection, a typical effective unit dose of ECO-04601, a compound described herein or a pharmaceutically acceptable derivative or prod rug thereof given orally or parenterally would be from about 5 to about 100 mg/kg of body weight of the subject with a daily dose ranging from about 15 to about 300 mg/kg of body weight of the subject.
Another preferred embodiment of this invention relates to a method, as described above, of treating a bacterial infection in a mammal in need thereof, but further comprising the step of administering to the mammal an agent which increases the susceptibility of bacterial organisms to antibiotics.
According to another preferred embodiment, the invention provides a method, as described above, of decreasing bacterial quantity in a biological sample, but further comprising the step of contacting the biological sample with an agent which increases the susceptibility of bacterial organisms to antibiotics.
Methods of decreasing bacterial quantity are effective if the number of bacteria decreases at least 10%, and preferably more, e.g., 25%, 50%, 75% or even 100% after contacting the biological sample with compound ECO-04601, a compound as described herein, or a pharmaceutically acceptable derivative or prod rug thereof.
The pharmaceutical compositions and methods of this invention will be useful generally for controlling bacterial infections in vivo. Examples of bacterial organisms that may be controlled by the compositions and methods of this invention include, but are not limited to the following organisms: Streptococcus pneumoniae, Streptococcus pyrogenes, Enterococcus fecalis, Enterococcus faecium, Klebsiella pneumoniae, Enterobacter spp., Proteus spp., Pseudomonas aeruginosa, E. coli, Serratia marcesens, Staphylococcus aureus, Coagulase negative Staphylococcus, Haemophilus infuenzae, Bacillus anthracis, Mycoplasma pneumoniae, and Staphylococcus epidermidis. The compositions and methods will therefore be useful for controlling, treating or reducing the advancement, severity or effects of nosocomial or non-nosocomial infections. Examples of nosocomial uses include, but are not limited to, urinary tract infections, pneumonia, surgical wound infections, bacteremia and therapy for febrile neutropenic patients. Examples of non-nosocomial uses include but are not limited to urinary tract infections, pneumonia, prostatitis, skin and soft tissue infections and intra-abdominal infections.
In addition to the compounds of this invention, pharmaceutically acceptable derivatives or prod rugs of the compounds of this invention may also be employed in compositions to treat or prevent the above-identified disorders.
A "pharmaceutically acceptable derivative or prod rug" means any pharmaceutically acceptable salt, ester, salt of an ester or other derivative of a compound of this invention which, upon administration to a recipient, is capable of providing, either directly or indirectly, a compound of this invention or an inhibitorily active metabolite or residue thereof. Particularly favored derivatives or prod rugs are those that increase the bioavailability of the compounds of this invention when such compounds are administered to a mammal (e.g., by allowing an orally administered compound to be more readily absorbed into the blood) or which enhance delivery of the parent compound to a biological compartment (e.g., the brain or lymphatic system) relative to the parent species.
Pharmaceutically acceptable prodrugs of the compounds of this invention include, without limitation, esters, amino acid esters, phosphate esters, metal salts and sulfonate esters.
Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, IC5o and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the present specification and attached claims are approximations. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of significant figures and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set in the examples, Tables and Figures are reported as precisely as possible. Any numerical values may inherently contain certain errors resulting from variations in experiments, testing measurements, statistical analyses and such.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
FX~4MP1 F

EXAMPLE 1: PREPARATION OF PRODUCTION CULTURE
lJnless otherwise noted, all reagents were purchased from Sigma Chemical Co. (St. Louis, MO), (Aldrich). Micromonospora spp. (deposit accession number IDAC 070303-01 ) was maintained on agar plates of ISP2 agar (Difco Laboratories, Detroit, MI). An inoculum for the production phase was prepared by transferring the surface growth of the Micromonospora spp. from the agar plates to 125-mL
flasks containing 25 mL of sterile medium comprised of 24 g potato dextrin, 3 g beef extract, 5 g Bacto-casitone, 5 g glucose, 5 g yeast extract, and 4 g CaC03 made up to one liter with distilled water (pH 7.0). The culture was incubated at about 28°C for approximately 60 hours on a rotary shaker set at 250 rpm. Following incubation, 10 mL of culture was transferred to a 2L baffled flask containing 500 mL of sterile production medium containing 20 g/L potato dextrin, 20 g/L glycerol, 10 g/L
Fish meal, 5 g/L Bacto-peptone, 2 g/L CaC03, and 2 g/L (NH4)2S04, pH 7Ø
Fermentation broth was prepared by incubating the production culture at 28°C in a rotary shaker set at 250 rpm for one week.
EXAMPLE 2: ISOLATION
500 mL ethyl acetate was added to 500 mL of fermentation broth prepared as described in Example 1 above. The mixture was agitated for 30 minutes on an orbital shaker at 200 rpm to create an emulsion. The phases were separated by centrifugation and decantation. Between 4 and 5 g of anhydrous MgS04 was added to the organic phase, which was then filtered and the solvents removed in vacuo.
An ethyl acetate extract from 2 L fermentation was mixed with HP-20 resin (100 mL; Mitsubishi Casei Corp., Tokyo, Japan) in water (300 mL). Ethyl acetate was removed in vacuo, the resin was filtered on a Buchner funnel and the filtrate was discarded. The adsorbed HP-20 resin was then washed successively with 2 x 125 mL of 50% acetonitrile in water, 2X125 mL of 75% acetonitrile in water and 125 mL of acetonitrile.
Fractions containing the compound of Formula II were evaporated to dryness and 100 mg was digested in the 5 mL of the upper phase of a mixture prepared from chloroform, cyclohexane, methanol, and water in the ratios, by volume, of 5:2:10:5.
The sample was subjected to centrifugal partition chromatography using a High Speed Countercurrent (HSCC) system (Kromaton Technologies, Angers, France) fitted with a 200 mL cartridge and prepacked with the upper phase of this two-phase system. The HSCC was run with the lower phase mobile and the compound of Formula II was eluted at approximately one-half column volume. Fractions were collected and the compound of Formula II was detected by TLC of aliquots of the fractions on commercial Kieselgel 60F25a plates. Compound could be visualized by inspection of dried plates under UV light or by spraying the plates with a spray containing vanillin (0.75%) and concentrated sulfuric acid (1.5%, v/v) in ethanol and subsequently heating the plate. Fractions contained substantially pure compound of Formula II, although highly colored. A buff-colored sample could be obtained by chromatography on HPLC as follows.
6 mg of sample was dissolved in acetonitrile and injected onto a preparative HPLC column (XTerra ODS (10ym), 19x150mm, Waters Co., Milford, MA), with a 9 mL/min flow rate and UV peak detection at 300 nm. The column was eluted with acetonitrile/buffer (20 mM of NH4HC03) according to the following gradient shown in Table 1.
Table 1 Time min Water % Acetonit_rile 5 95 i Fractions containing the compound of Formula II eluted at approximately 11:0 min and were combined, concentrated and lyophilized to give a yield of 3.8 mg compound.
Alternative Protocol 1 The compound of Formula II was also isolated using the following alternative protocol. At the end of the incubation period, the fermentation broth from the baffled flasks of Example 1 was centrifuged and the supernatant decanted from the pellet containing the bacterial mycelia. 100 mL of 100% MeOH was added to the mycelial pellet and the sample was stirred for 10 minutes and centrifuged for 15 minutes.

The methanolic supernatant was decanted and saved. 100 mL of acetone was then added to the mycelial pellet and stirred for 10 minutes then centrifuged for minutes. The acetonic supernatant was decanted and combined with the methanolic supernatant. Finally, 100 mL of 20% MeOH/H20 was added to the mycelial pellet, stirred for 10 minutes and centrifuged for 15 minutes. The supernatant was combined with the acetonic and methanolic supernatants.
The combined supernatant was added to 400 ml of HP-20 resin in 1000 rnL of water and the organics were removed in vacuo. The resulting slurry was filtered on a Buchner funnel and the filtrate was discarded. Adsorbed HP-20 resin was washed successively with 2x500mL of 50% MeOH/H20, 2x500mL of 75% MeOH/H20 and 2x500mL of MeOH.
The individual washes were collected separately and analyzed by TLC as described above. Those fractions containing the compound of Formula II were evaporated to near dryness and lyophilized. The lyophilizate was dissolved in methanol and injected onto a preparative HPLC column (Xterra ODS (10~m), 19x150mm, Waters Co., Milford, MA) with a flow rate of 9 mL/min and peak detection at 300 nm.
The column was eluted with acetonitrile/buffer (5 mM of NH4HC03) according to gradient shown in Table 2.
Table 2 i Time min Buffer % Acetonitrile Fractions containing the compound of Formula II were combined, concentrated and lyophilized to yield about 33.7 mg of compound.
Alternative Protocol 2 liters of the whole broth from Example 1 are extracted twice with equal volumes of ethyl acetate and the two extracts are combined and concentrated to dryness. The dried extract is weighed, and for every gram of dry extract, 100 mL of MeOH-H20 (2:1 v/v) and 100 mL of hexane is added. The mixture is swirled gently but well to achieve dissolution. The two layers are separated and the aqueous layer is washed with 100 mL of hexane. The two hexane layers are combined and the combined hexane solution is washed with 100 mL methanol:water (2:1, v/v). The two methanol:water layers are combined and treated with 200 mL of EtOAc and mL of water. The layers are separated and the aqueous layer is extracted twice more with 200 mL portions of EtOAc. The EtOAc layers are combined and concentrated. The residue obtained will be suitable for final purification, either by HSCC or by HPLC as described above. This extraction process achieves a ten-fold purification when compared with the extraction protocol used above.
EXAMPLE 3: ELUCIDATION OF THE STRUCTURE OF COMPOUND OF
FORMULA II.
The structure of the compound of Formula II was derived from spectroscopic data, including mass, UV, and NMR spectroscopy. Mass was determined by electrospray mass spectrometry to be 462.6 (FIGURE 1 ), UVmax 230nm with a shoulder at 290 nm (FIGURE 2). NMR data were collected dissolved in MeOH-d4 including proton (FIGURE 3), and multidimensional pulse sequences gDQCOSY
(FIGURE 4), gHSQC (FIGURE 5), gHMBC (FIGURE 6), and NOESY (FIGURE 7).
A number of cross peaks in the 2D spectra of ECO-04601 are key in the structural determination. For example, the farnesyl chain is placed on the amide nitrogen by a strong cross peak between the proton signal of the terminal methylene of that chain at 4.52 ppm and the amide carbonyl carbon at 170 ppm in the gHMBC
experiment. This conclusion is confirmed by a cross peak in the NOESY spectrum between the same methylene signals at 4.52 ppm and the aromatic proton signal at 6.25 ppm from one of the two protons of the tetra substituted benzenoid ring.
Based on the mass, UV and NMR spectroscopy data, the structure of the compound was determined to be the structure of Formula II.
EXAMPLE 4: ANTIBACTERIAL ACTIVITY (MINIMAL INHIBITORY
CONCENTRATION DETERMINATION) Minimal Inhibitory Concentration (MIC) is defined as the lowest concentration of drug that inhibits more than 99% of the bacterial population. The MIC determination of ECO-04601 against bacteria strains (Bacillus subtilis - ATCC 23857;
Micrococcus luteus - ATCC 9341 ) was performed using broth microdilution assay (Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically;
Approved Standard-Fifth Edition. NCCLS document M7-A5 (ISBN 1-56238-394-9).
NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA.).
Test compound preparation: The test article ECO-04601 is prepared as 100X
stock solutions in DMSO, with concentrations ranging from 3.2 mg/ml to 0.0625 mg/ml (a two-fold dilution series over 10 points). The first dilution (3.2mg/ml) was prepared by resuspending 0.5 mg of each test article in 156.25,u1 of DMSO. The stock is then serially diluted by two-fold decrement to obtain the desired concentration range.
Inoculum preparation: From an overnight culture in Mueller Hinton (MH) broth, cell density for each indicator strain (Bacillus subtilis; Micrococcus luteus) was adjusted to 0.5 Mc Farland units in 0.85% saline, then further diluted 1/100 in appropriate assay medium (~ 1 X 106 cells/ml).
MIC determination: The 100X ECO-04601 solutions was diluted 50 times in MH
broth and dispensed in a 96 well plate, one test concentration per column of wells, columns in total. The 11t" column of wells contained MH broth with 1% DMSO, the 12'" column of wells contained 100,u1 of broth alone. 50 ~I of the final cell dilution of each indicator strain was added to each corresponding well of the microplate containing 50 ~I of diluted drug or media alone. Assay plates were incubated at 35°C
for 24 hrs.
The results of the MIC for the compound of ECO-04601, shown in Table 3, demonstrate a range of antibacterial effects:

Table 3 Indicator strain MIC (~g/mL) Bacillus subtilis ATCC 23857 12.5 Micrococcus luteus ATCC 9341 6.25 EXAMPLE 5. ANTICANCER ACTIVITY IN VITRO AGAINST HUMAN AND ANIMAL
TUMOR CELL LINES FROM VARIOUS TISSUES
Culture conditions: The cell lines listed in Table 4 were used to characterize the cytotoxicity of ECO-04601 against human and animal tumor cell lines. These cell lines were shown to be free of mycoplasma infection and were maintained on the appropriate media (Table 4) supplemented with 10% heat-inactivated fetal bovine serum and 1 % penicillin-streptomycin, under 5% C02 at 37°C. Cells were passaged twice to three times per week. Viability was examined by staining with 0.25%
trypan blue and only flasks where cell viability was >95% were used for this study.
Cell lines amplification and plating: Tumor cells were seeded (1-3 x 103 cells per 100 pL) in 96-wells flat bottom microtiter plates and incubated at 37°C and 5% COZ for 16 hrs before treatment in drug-free medium supplemented with 10% serum.
Evaluation of inhibitory activity on cell proliferation: Cells were incubated for 96 hrs with 6 loglo-fold concentrations of the test substance starting at 10pg/ml (20 pM;P.
The test substance stock solution (5 mg/mL) was initially diluted at 1/70 fold in medium supplemented with serum. Other concentrations were then obtained from 1/10fold successive dilutions in the same supplemented medium. Cell survival vvas evaluated 96 h later by replacing the culture media with 150 pL fresh medium containing 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer, pH
7.4.
Next, 50 pL of 2.5 mg/mL of 3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyltetrazolium bromide (MTT) in phosphate buffer solution, pH 7.4, was added. After 3-4h of incubation at 37°C, the medium and soluble MTT was removed, and 200 pL
of dimethylsulfoxide was added to dissolve the precipitate of reduced MTT
followed by addition of 25 pL glycine buffer (0.1 M glycine plus 0.1 M NaCI, pH 10.5). The absorbance was determined at 570 nm with a microplate reader. Results were expressed as the concentration of drug which inhibits 50% of the cell growth (IC~o).
The IC~o values shown in Table 4 demonstrated a pharmacologically relevant cytotoxic activity of ECO-04601 against a variety of tumor types such as leukemias, melanomas, pancreatic and breast carcinomas.
Table 4 ~II lines Type Origin Source Culture medium IC5o x10'6M

K562 Leukemia Human ATCC RPMI 1640 8.6 I ~

m elo eneous P388 Leukemia Mouse ATCC RPM11640 10.9 183 Leukemia Human ATCC RPM11640 2.7 B16 F10 Melanoma Mouse ATCC RPMI 1640 11.4 SK-MEL 28 Melanoma Human ATCC RPMI 1640 14.0 SK-MEL Melanoma Human ATCC RPM11640 14.3 28VEGF (expressing VEGF

SK-MEL-1 Melanoma ~ Human ATCC EMEM 1 % non- 14.1 ~ i i ~ essential amino i I acid 1 % Sodium i ur vate ~ i Panc 96 Pancreatic Human ATCC RPMI 1% Sodium 12.5 carcinoma ur vate Panc 10.05 Pancreatic Human ATCC RPMI 1% Sodium 14.2 carcinoma ur vate Insulin i MCF-7 Breast Human ATCC RPMI 1640 9.7 adenocarcinoma EXAMPLE 6. ANTICANCER ACTIVITY IN VITRO AGAINST VARIOUS HUMAN
TUMOR CELL LINES FROM THE U.S. NATIONAL CANCER INSTITUTE PANEL
A study measuring the in vitro antitumor activity of ECO-04601 was performed by the National Cancer Institute (National Institutes of Health, Bethesda, Maryland, USA) against panel of human cancer cell lines in order to determine the ECO-04601 concentrations needed to obtain a 50% inhibition of cell proliferation (Gl5o). The operation of this unique screen utilizes 50 different human tumor cell lines, representing leukemia, melanoma and cancers of the lung, colon, brain, ovary, breast, prostate, and kidney.

Culture conditions and plating:

The human tumor cell lines of the cancer-screening panel were grown in RPMI 1640 medium containing 5% fetal bovine serum and 2 mM L-glutamine. For a typical screening experiment, cells were inoculated into 96 well microtiter plates in 100 ~L at plating densities ranging from 5,000 to 40,000 cells/well depending on the doubling time of individual cell lines (Table 5). After cell inoculation, the microtiter plates were incubated at 37°C, 5% C02, 95% air and 100% relative humidity for 24 h prior to addition of experimental drugs. After 24 h, two plates of each cell line were fixed in situ with TCA, to represent a measurement of the cell population for each cell line at the time of drug addition (Tz).
Evaluation of inhibitory activity on cell proliferation:
ECO-04601 was provided as a lyophilized powder with an estimated purity of 90+%. The compound was stored at -20°C until day of use. ECO-04601 was solubilized in dimethyl sulfoxide at 400-fold the desired final maximum test concentration. At the time of drug addition, an aliquot of frozen concentrate was thawed and diluted to twice the desired final maximum test concentration with complete medium containing 50pg/mL gentamicin. Additional four, 10-fold or'/2 log serial dilutions were made to provide a total of five drug concentrations plus control.
Aliquots of 100 pl of these different drug dilutions were added to the appropriate microtiter wells already containing 100 ~I of medium, resulting in the required final drug concentrations (8.0 x 10-5 M to 8.0 x 10-9 M).
Following drug addition, the plates were incubated for an additional 48 h at 37°C, 5°/~ COz, 95% air, and 100% relative humidity. For adherent cells, the assay was terminated by the addition of cold TCA. Cells were fixed in situ by the gentle addition of 50 pl of cold 50% (w/v) TCA (final concentration, 10% TCA) and incubated for 60 minutes at 4°C. Supernatants were discarded, and the plates were washed five times with tap water and air-dried. Sulforhodamine B (SRB) solution (100 pl) at 0.4% (w/v) in 1 % acetic acid was added to each well, and plates were incubated for 10 minutes at room temperature. After staining, unbound dye was removed by washing five times with 1 % acetic acid and the plates were air-dried.
Bound stain was subsequently solubilized with 10 mM trizma base, and the absorbance was read on an automated plate reader at a wavelength of 515 nm.
For suspension cells, the methodology was the same except that the assay was terminated by fixing settled cells at the bottom of the wells by gently adding 50 pl of 80% TCA (final concentration, 16% TCA).
The growth inhibitory activity of ECO-04601 was measured by NCI utilizing the Gl5o value, rather than the classical IC5o value. The GlSO value emphasizes the correction for the cell count at time zero and, using the seven absorbance measurements [time zero, (Tz), control growth, (C), and test growth in the presence of drug at the five concentration levels (Ti)], Gl5o is calculated as [(Ti-Tz)/(C-Tz)] x 100 = -50, which is the drug concentration resulting in a 50% reduction in the net protein 'increase (as measured by SRB staining) in control cells during the drug incubation.
Result:
ECO-04601 shows a significant antitumor activity against several types of tumor as revealed by the NCI screening. Results of the screen are shown in Table 5, and more detailed results of activity against gliomas are shown in Example 7 (Table 6).
Table 5 Inoculation GlSo Cell Line Name Type Origin Density (x10-6M) (number of cells/well) CCRF-CEM Leukemia Human 40,000 1.08 K-562 Leukemia Human 5,000 1.43 RPMI-8226 Leukemia Human 20,000 3.15 A549/ATCC Non-Small Cell Human 7,500 9.10 Lung EKVX Non-Small Cell Human 20,000 0.23 Lung HOP-62 Non-Small Cell Human 10,000 8.29 Lung NCI-H226 Non-Small Cell Human 20,000 2.00 Lung NCI-H23 Non-Small Cell Human 20,000 2.02 Lung NCI-H460 Non-Small Cell Human 7,500 13.60 Lung NCI-H522 Non-Small Cell Human 20,000 3.44 Lung COLD 205 Colon Human 15,000 12.70 HCT-116 Colon Human 5,000 2.92 HCT-15 Colon Human 10,000 9.73 HT29 Colon Human 5,000 20.70 ~SW-620 Colon Human 10,000 2.72 SF-268 CNS Human 15,000 4.94 SF-295 CNS Human 10,000 12.70 SF-539 CNS Human 15,000 0.0075 SNB-19 CNS Human 15,000 2.90 SNB-75 CNS Human 20,000 7.71 U251 CNS Human 7,500 2.19 LOX IMVI Melanoma Human 7,500 4.53 M14 Melanoma Human 15,000 4.57 SK-MEL-2 Melanoma Human 20,000 25.0 SK-MEL-28 Melanoma Human 10,000 11.6 SK-MEL-5 Melanoma Human 10,000 7.80 UACC-257 Melanoma Human 20,000 2.31 UACC-62 Melanoma Human 10,000 1.55 IGR-OV1 Ovarian Human 10,000 3.11 OVCAR-3 Ovarian Human 10,000 13.50 OVCAR-4 Ovarian Human 15,000 9.67 OVCAR-5 Ovarian Human 20,000 2.81 OVCAR-8 Ovarian Human 10,000 ~ 2.65 i SK-OV-3 Ovarian Human 20,000 4_.00 786-0 Renal Human 10,000 6.99 A498 Renal Human 25,000 22.30 ACHN Renal Human 10,000 3.10 CAKI-1 Renal Human 10,000 15.20 RXF 393 Renal Human 15,000 7.71 SN12C Renal Human 15,000 3.85 UO-31 Renal Human 15,000 19.70 DU-145 Prostate Human 10,000 3.56 MCF7 Breast Human 10,000 10.10 NCI/ADR-RES Breast Human 15,000 18.30 MDA-MB- Breast Human 20,000 2.72 HS 578T Breast Human 20,000 2.76 MDA-MB-435 Breast Human 15,000 15.30 BT-549 Breast Human 20,000 U.11 T-47D Breast Human 20,000 U.77 The results indicate that ECO-04601 was effective against most of the human tumor cell lines that have been assayed in the NCI screening panel suggesting a broad anticancer activity against several types of human cancer.
EXAMPLE 7: IN VITRO ANTIPROLIFERATIVE STUDY AGAINST A PANEL OF
GLIOMA CELL LINES

The anticancer activity of ECO-04601 was evaluated using a panel of glioma cancer cell lines shown in Table 6, and the 50% inhibition of cell proliferation (IC5o) was determined.
Culture conditions:
The cell lines listed in Table 6 were shown to be free of mycoplasma infection and were maintained on DMEM medium supplemented with 10% heat-inactivated fetal bovine serum and 1 % penicillin-streptomycin, under 5% C02 at 37°C. Cells were passaged once a week. Prior to use the cells were detached from the culture flask by treating with trypsin for five to ten minutes. The cells were counted with a Neubauer glass slide and viability assessed by 0.25% trypan blue exclusion.
Only flasks with >95% cell viability, were used in the study.
Cell lines amplification and plating:
Cells, 5 x 103 cells per well in 100 pL drug-free medium supplemented with 10% serum, were plated in 96-well flat bottom microtiter plates and incubated at 37°C for 48 hrs before treatment.
Evaluation of inhibitory activity on cell proliferation:
Cells (in triplicate wells) were incubated 96 hrs with medium containing different concentrations of ECO-04601, starting at 5.0 pg/ml (10 pM). The compound was used in a solution of 1 % DMSO in D-MEM or RPMI media (or other equivalent media). The concentrations of ECO-04601 were as follows: 10 pM (5.0 pg/ml), 1 pM
(0.50 pg/ml), 0.5 pM (0.25 pg/ml), 0.1 pM (0.050 pg/ml), 0.5 pM (0.025 pg/ml), 0.01 pM (0.0050 pg/ml), 0.001 pM (0.00050 pg/ml). Negative controls were cells treated with vehicle alone (1 % DMSO in culture medium). Positive controls were cells treated with 4 to 6 increasing concentrations of cisplatin (CDDP) (data not shown).
The optical density was measured before incubation (time 0) and following 96 hrs of incubation with test compound in order to measure the growth rate of each cell line.
At the end of the cell treatment, cell culture media was replaced with 150 pl of fresh medium containing 10 mM of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer, pH 7.4. Then 50 pl of 2.5 mg/ml of 3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyltetrazolium bromide in PBS pH 7.4, were added to each well and the culture plates incubated for 4 hrs at 37°C. The resulting supernatant was removed and formazan crystals were dissolved with 200 pl of DMSO followed by 25 pl of glycine buffer (0.1 M glycine plus 0.1 M NaCI, pH 10.5). The optical density was read in each well using a single wavelength spectrophotometer plate reader at 570 nm.
Results were expressed as the concentration of drug, which inhibits 50% of the cell growth (IC5o). Each of the cell lines was tested in at least 3 independent experiments.
Results shown in Table 6 confirmed the activity of ECO-04601 against different brain cancer cell lines including gliosarcoma, which is the most malignant form of type IV glioblastoma multiform. Gliosarcomas are a mixture of glial and endothelial cells and are resistant to any chemotherapy.
Table 6 Cell linesType Origin Source ICso (x 10-6 M) 9L Gliosarcoma Rat ATCC 6.82 2.90 GHD Astrocytoma Human ATCC 6.29 2.98 U 373 Astrocytoma Human ATCC 3.83 1.37 GL26 Glioblastoma Human ATCC 8.93 1.10 C6 Glioblastoma Rat ATCC 4.28 2.82 Oligodendrogliom ATCC
DN a Human 3.26 0.93 OligodendrogliomI ATCC
GHA a Hurnan 1.78 0.84 '... ~

EXAMPLE 8: EFFECT ON THE ENZYMATIC ACTIVITY OF HUMAN
LIPOXYGENASE (5-LO) 5-Lipoxygenase catalyzes the oxidative metabolism of arachidonic acid to 5-hydroxyeicosatetraenoic acid (5-HETE), the initial reaction leading to formation of leukotrienes. Eicosanoids derived from arachidonic acid by the action of lipoxygenases or cycloxygenases have been found to be involved in acute and chronic inflammatory diseases (i.e. asthma, multiple sclerosis, rheumatoid arthritis, ischemia, edema) as well in neurodegeneration (Alzheimer disease), aging and various steps of carcinogenesis, including tumor promotion, progression and metastasis.
The aim of this study was to determine whether ECO-04601, is able to block the formation of leukotrienes by inhibiting the enzymatic activity of human 5-LO.
Methods employed are based on Carter et al (1991 ) J. Pharmacol. Exp. Ther.
256(3):929-937, and Safayhi (2000), Planta Medica 66:110-113 which are incorporated herein in their entirety by reference.
Experimental Design:
Human peripheral blood mononuclear cells (PMNs) were isolated through a Ficoll-Paque density gradient. PMNs were stimulated by addition A23187 (30 pM
final concentration). Stimulated PMNs were adjusted to a density of 5 x106 cells/mL
in HBBS medium and incubated with the vehicle control (DMSO), ECO-04601 (at final concentrations of 0.1, 0.5, 1, 2.5, 5 and 10 pM) and NDGA as positive control (at final concentrations of 3, 1, 0.3, 0.1 and 0.03 pM) for 15 minutes at 37°C.
Following incubation, samples were neutralized with NaOH and centrifuged.
Leukotriene B4 content was measured in the supernatant using an Enzyme Immunosorbant Assay (EIA) assay.
Results:
Results shown in Figure 8 demonstrated that ECO-04601 inhibited the activity of human 5-LO with an apparent ICSO = 0.93 pM (versus 0.1 NM for the positive control NDGA) and therefore displays anti-inflammatory properties.
EXAMPLE 9: IN VIVD EFFICACY IN A GLIOMA MODEL
The aim of this study was to test whether ECO-04601 administered by i.p.
route prevents or delays tumor growth in C6 glioblastoma cell-bearing mice, and to determine an effective dosage regimen.
Animalc~
A total of 60 six-week-old female mice (Mus musculus nude mice), ranging between 18 to 25 g in weight, were observed for 7 days before treatment.
Animal experiments were performed according to ethical guidelines of animal experimentation (Charte du comite d'ethique du CNRS, juillet 2003) and the English guidelines for the welfare of animals in experimental neoplasia (WORKMAN, P., TWENTYMAN, P., BALKWILL, F., et al. (1998). United Kingdom Coordinating Committee on Cancer Research (UKCCCR) Guidelines for the welfare of animals in experimental neoplasia (Second Edition, July 1997; British Journal of Cancer 77:1-10). Any dead or apparently sick mice were promptly removed and replaced with healthy mice. Sick mice were euthanized upon removal from the cage. Animals were maintained in rooms under controlled conditions of temperature (23~2°C), humidity (45~5%), photoperiodicity (12 hrs light / 12 hrs dark) and air exchange.
Animals were housed in polycarbonate cages (5/single cage) that were equipped to provide food and water. Animal bedding consisted of sterile wood shavings that were replaced every other day. Food was provided ad libitum, being placed in the metal lid on the top of the cage. Autoclaved tap water was provided ad libitum. Water bottles were equipped with rubber stoppers and sipper tubes. Water bottles were cleaned, sterilized and replaced once a week. Two different numbers engraved on two earrings identified the animals. Each cage was labelled with a specific code.
Tumor Cell Line:
The C6 cell line was cloned from a rat glial tumor induced by N-nitrosomethyurea (NMU) by Premont et al. (Premont J, Benda P, Jard S., [3H]
norepinephrine binding by rat glial cells in culture. Lack of correlation between binding and adenylate cyclase activation. Biochim Biophys Acta. 1975 Feb 13;381 (2):368-76.) after series of alternate culture and animal passages.
Cells were grown as adherent monolayers at 37°C in a humidified atmosphere (5% COz, 95% air). The culture medium was DMEM supplemented with 2 mM L-glutamine and 10% fetal bovine serum. For experimental use, tumor cells were detached from the culture flask by a 10 min treatment with trypsin-versen. The cells were counted in a hemocytometer and their viability assessed by 0.25%
trypan blue exclusion.
Preparation of the Test Article:
For the test article, the following procedure was followed for reconstitution (performed immediately preceding injection). The vehicle consisted of a mixture of benzyl alcohol (1.5%), ethanol (8.5%), propylene glycol (27%), PEG 400 (27%), _79_ dimethylacetamide (6%) and water (30%). The vehicle solution was first vortexed in order to obtain a homogeneous liquid. 0.6 mL of the vortexed vehicle solution was added to each vial containing the test article (ECO-04601 ). Vials were mixed thoroughly by vortexing for 1 minute and inverted and shaken vigorously. Vials were mixed again prior to injection into each animal.
Animal Inoculation with tumor cells:
Experiment started at day 0 (Do). On Do, mice received a superficial intramuscular injection of C6 tumor cells (5 x 105 cells) in 0.1 mL of DMEM
complete medium into the upper right posterior leg.
Treatment regimen and Results:
In a first series of experiments, treatment started 24 hrs following inoculation of C6 cells. On the day of the treatment, each mouse was slowly injected with pL of test or control articles by i.p. route. For all groups, treatment was performed until the tumor volume of the saline-treated mice (group 1 ) reached approximately 3 crra3 (around day 16). Mice of group 1 were treated daily with a saline isosmotic solution for 16 days. Mice of group 2 were treated daily with the vehicle solution for 16 days. Mice of group 3 were treated daily with 10 mg/kg of ECO-04601 for 16 days. Mice of group 3 were treated every two days with 30 mg/kg of ECO-04601 and received 8 treatments. Mice of group 5 were treated every three days with 30 mg/kg of ECO-04601 and received 6 treatments. Measurement of tumor volume started as soon as tumors became palpable (>100 mm3; around day 11 post-inoculation) and was evaluated every second day until the end of the treatment using callipers.
As shown in Table 7 and Figure 9, the mean value of the tumor volume of all ECO-04601 treated groups (6 mice/group) was significantly reduced as demonstrated by the one-way analysis of variance (Anova) test followed by the non-parametric Dunnett's multiple comparison test comparing treated groups to the saline group. An asterisk in the P value column of Table '7 indicates a statistically significant valuE:, while "ns'° signifies not significant.
Table 7 Treatment Treatment Tumor volume % P

regimen (mm3) Inhibitiovalue I

(mean SEM) n Saline Q1 x 16 3,004.1 - -I 249.64 Vehicle Q1 x 16 2,162.0 350.028.0% >0.05 solution ns ECO-04601 Q1 x 16 1,220.4 59.4% <0.01 (10 mg/kg) 283:46 ECO-04601 Q2 x 8 1,236.9 58.8% <0.01 (30 mg/kg) 233.99 I

ECO-04601 Q3 x 6 1,184.1 60.6% <0.01 I

(30 mg/kg) 221.45 In a second series of experiments, treatment started at day 10 following inoculation of C6 cells when tumors became palpable (around 100 to 200 mm3) Treatment was repeated daily for 5 consecutive days. On the day of the treatment, each mouse was slowly injected with 100 pL of ECO-04601 by i.p. route. Mice of group 1 were treated daily with saline isosmotic solution. Mice of group 2 were treated daily with the vehicle solution. Mice of group 3 were treated daily with 20 mg/kg of ECO-04601. Mice of group 4 were treated daily with 30 mg/kg of ECO-04601. Mice were treated until the tumor volume of the saline-treated control mice (group 1 ) reached around 4 cm3. Tumor volume was measured every second day until the end of the treatment using callipers. As shown in Table 8 and Figure 70, the mean value of the tumor volume of all ECO-04601 treated groups (6 mice/group) was significantly reduced as demonstrated by the one-way analysis of variance (Anova) test followed by the non-parametric Dunnett's multiple comparison test comparing treated groups to the saline group. An asterisk in the P value column of Table 8 indicates a statistically significant value, while "ns" signifies not statistically significant.
Histological analysis of tumor sections showed pronounced morphological changes between ECO-04601-treated tumors and control groups. In tumors treated with ECO-04601 (20 - 30 mg/kg), cell density was decreased and the nuclei of remaining tumor cells appeared larger and pycnotic while no such changes were observed for vehicle-treated mice (Figure 11 ).
Table 8 Treatment Treatment ~ Tumor volume% P ~I, i regimen (mm3) Inhibitiovalue I

(mean SEM) n Saline Q1 x 5 4,363.1 - -614.31 Vehicle solutionQ1 x 5 3,205.0 26.5% >0.05 i 632.37 ns ECO-04601 Q1 x 5 1,721.5 60.5% <0.01 !, (20 mg/kg) 374.79 ECO-04601 Q1 x 5 1,131.6 74.1% <0.01 (30 mglkg) 525.21 EXAMPLE 10: GENERATION OF VARIANTS OF ECO-04601 ACCORDING TO
THE INVENTION
Variants of the ECO-04601 molecule, for example those identified herein as Formulae III-LIX, can be generated by standard organic chemistry approaches.
General principles of organic chemistry required for making and manipulating the compounds described herein, including functional moieties, reactivity and common protocols are described, for example, in "Advanced Organic Chemistry," 3~d Edition by Jerry March (1985) which is incorporated herein by reference in its entirety. In addition, it will be appreciated by one of ordinary skill in the art that the synthetic methods described herein may use a variety of protecting groups, whether or not they are explicitly described. A "protecting group" as used herein means a moiety used to block one or more functional moieties such as reactive groups including oxygen, sulfur or nitrogen, so that a reaction can be carried out selectively at another reactive site in a polyfunctional compound. General principles for the use of protective groups, their applicability to specific functional groups and their uses are described for example in T. H. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons, lVew York (1999).
Scheme 1: Epoxide variants The epoxide compounds of the present invention (e.g., compounds according to exemplary Formulae VII-XIV) are made from the compound of Formula II (ECO-04601 ) by treatment with any of a number of epoxidizing reagents such as perbenzoic acid, monoperphthalic acid or more preferably by m-chloroperbenzoic acid in an inert solvent such as tetrahydrofuran (THF) dichloromethane or 1,2-dichloroethane. It will be appreciated by one of ordinary skill in the art that slightly greater than one molecule equivalent of epoxidizing agent will result in the maximal yield of mono-epoxides, and that the reagent, solvent, concentration and temperature of the reaction will dictate the ratio of specific mono-epoxides formed. It will also be appreciated that the mono-epoxides will be enantiorneric mixtures, and that the di-epoxides and the tri-epoxide can be prepared as diastereomers and that the conditions of the reaction will determine the ratios of the products. One skilled in the art will appreciate that under most conditions of reactions the product will be a mixture of all possible epoxides and that these may be separated by standard methods of chromatography. Exemplary approaches to the generation of mono-, di-and tri-epoxides are provided below.
A) Mono-epoxides of the Formulae VII, VIII, and IX by epoxidation of the compound of Formula II:
Formula VII Formula VIII
O CH, CH3 CH, 0 CH, CH, CH, i N / / CH, N / / CHI
O ~ 0 N
~N ~ \ HO
HO / ~ OH H ~OH
H
H HO
0 CH, CH, CH, i N / / CH, O
HO H ~ ~ OH Formula IX
HO

;005-PCT-OCR
-g~_ To a solution of the compound of Formula II dissolved in tetrahydrofuran ~TI~F) is added 1.1 equivalents of meta-chloroperbenzoic acid. The reaction is cooled in an 'ice bath and stirred at 0 °C for 1-2 hours. The reaction mixture is then evaporated to dryness, re-dissolved in methanol and subjected to liquid chromatography on a column of Sephadex LH-20 to isolate a mixture of predominantly the compounds of Formulae VII, VIII and IX, contaminated with some unchanged starting material and some di- and tri- epoxides. The compounds of Formulae VII, Vill and XIX are separated and purified by HPLC using the system described in Example 2 for the purification of the compound of Formulae II. In a typical experiment yields of 15% to 25% are obtained for each of the compounds of Formulae VII, VIII and IX.
B) Synthesis of Compounds of Formulae X, XI, and XII by di-epoxidation of Compound of Formula II~
~orrnu~a ~ Forrnu~a ~9 o cH, cH, !~H, ;,~cH, cH; ;1 ~~i w ' ~ ~cH, , ' ~, ~ ' ,, c i~~'j /%~
r,_~'~ HO ' ~~oH
"_cH
HG
c CH, CH3 CH, ~~i\/~N~ CH, /~ ~Y ~ ~.
HO H ~ ~~OH Formula X~~
HO
To a solution of the compound of Formula II dissolved in tetrahydrofuran ~THF) is added 2.3 equivalents of meta-chloroperbenzoic acid. The reaction is cooled in an ice bath and stirred at 0 °C for 1-2 hours. The reaction mixture is then evaporated to dryness, re-dissolved in methanol and subjected to liquid chromatography on a column of Sephadex LH-20 to isolate a mixture of predominantly the compounds of Formulae X, XI and XII, contaminated with traces of unchanged starting material and some mono- and tri- epoxides. The Compounds of Formulae X, XI and XII are separated and purified by HPLC using the system described in Example 2 for the purification of the compound of Formulae II. In a typical experiment, yields of 15% to 20% are obtained for each of the compounds of Formulae X, XI and XII.
C) Synthesis of Compound of Formula XIII by tri-epoxidation of Compound of Formula II:
O CH; CHj i H3 N~ CHj O O O
HO ~N~~ ~ OH Formula XI ll H
HO
To a solution of the compound of Formula II, dissolved in tetrahydrofuran (THF), is added 3.5 equivalents of meta-chloroperbenzoic acid. The reaction is cooled in an ice bath and stirred at 0 °C for 1-2 hours. The reaction mixture is then evaporated to dryness, re-dissolved in methanol and subjected to liquid chromatography on a column of Sephadex LH-20 to isolate the compound of Formula XIII as a mixture of diasteriomers in a yield of 80+%.
Scheme 2: Synthesis of Compound of Formula III by N-acetylation of Compound of Formula II.
UII CH CH, CH, ~N~ /I / CHo Formula III
N
Ho , o=c ~ off H,C HO
To a solution of Compound of Formula II dissolved in tetrahydrofuran (THF) is added 1.2 equivalents of acetic anhydride and a few drops of triethylamine.
The reaction mixture allowed to stand at room temperature for 1-2 hours and then evaporated to dryness under reduced pressure to obtain the Compound of Formula III in an essentially pure form in an almost quantitative yield.
Scheme 3: Syntheses of Compounds of Formulae IV and V by N-alkylation of Compound of Formula II.

CH, CH, CH, i' ~ IAN ~ ~~ ~~H Formula IV R = benzyl Formula V R = ethyl off Ho To a solution of Compound of Formula II dissolved in terachloroethylene is added 1.2 equivalents of the appropriate alkyl bromide (benzyl bromide for the compound of formula IV or ethyl bromide for the Compound of Formula V). The reaction mixture the reaction mixture is heated under reflux for 1-2 hours and then evaporated to dryness under reduced pressure to obtain the Compound of Formula IV or the Compound of Formula V respectively, in an essentially pure form in an almost quantitative yield.
Scheme 4: Syntheses of Compounds of Formulae XL, XLI and XLII by catalytic reduction of Compound of Formula II.
O CH3 CH3 CH3 ".,3 .."3 ' N / / CH3 ~ ~ N / / CH3 N ~ ~ Formula XL ~ ~ ~ Formula XLI
HO HO
OH H ' OH
HO HO
0 CH3 CH, CH3 i H° ; ~ ~ off Formula XLII
H ~
HO
A solution of the Compound of Formula II (462 mg) in ethanol (200 ml) with palladium on charcoal (25 mg of 5%) is shaken in an hydrogenation apparatus in an atmosphere of hydrogen. The uptake of hydrogen by the reaction is measured carefully and at the point where one millimole of hydrogen has been consumed, shaking is stopped, the vessel is rapidly evacuated and the atmosphere is replaced with nitrogen. The catalyst is removed by filtration and the filtrate is concentrated to obtain a crude mixture of the Compounds of Formulae XL, XLI and XLII
contaminated by unreacted starting material and minor amounts of over reduced products. The desired products may be separated and purified by HPLC or HSCC
chromatography using the systems as described in Example 2 above, to obtain approximately 100 mg of each of the Compounds of Formulae XL, XLI and XLII.

Scheme 5: Syntheses of Compounds of Formulae XLIII, XLIV and XLV by catalytic reduction of Compound of Formula II.

i \ ~
i '~N / CHa N / CHj Formula XLIV
Formula XLIII H
HO OH
H _ OH
HO
HO
0 CH, CH3 CHI
i Formula XLV
N
HO / OH
H
HO
A solution of the Compound of Formula II (462 mg) in ethanol (200 ml) with palladium on charcoal (25 mg of 5%) is shaken in an hydrogenation apparatus in an atmosphere of hydrogen. The uptake of hydrogen by the reaction is measured carefully and at the point where two millimoles of hydrogen has been consumed, shaking is stopped, the vessel is rapidly evacuated and the atmosphere is replaced with nitrogen. The catalyst is removed by filtration and the filtrate is concentrated to obtain a crude mixture of the Compounds of Formulae XLIII, XLIV and XLV
contaminated by trace amounts unreacted starting material and minor amounts of under and over reduced products. The desired products may be separated and purified by HPLC or HSCC chromatography using the systems as described in Example 2 above, to obtain approximately 100 mg of each of the Compounds of Formulae XLIII, XLIV and XLV.
Scheme 6: Syntheses of Compound of Formula XLVI by catalytic reduction of Compound of Formula ll.
O CH3 CH3 ~ H3 i ~ ~
N~ CH3 HO ; / ~ off Formula XLVI
H
HO
A solution of the Compound of Formula II (462 mg) in ethanol (200 ml) with palladium on charcoal (25 mg of 5%) is shaken in an hydrogenation apparatus in an _87_ atmosphere of hydrogen. The uptake of hydrogen by the reaction is measured carefully and at the point where three millimoles of hydrogen has been consumed, shaking is stopped, the vessel is rapidly evacuated and the atmosphere is replaced with nitrogen. The catalyst is removed by filtration and the filtrate is concentrated to obtain an essentially pure sample of the Compound of Formula XLVI.
Scheme 7: Syntheses of Compound of Formula VI by peracetylation of Compound of Formula II.
H3~
A solution of the Compound of Formula II (100 mg) in acetic anhydride (5 ml) is treated with pyridine (250 ul). The reaction mixture is allowed to stand overnight at room temperature and is then diluted with toluene (100 ml). The toluene solution is washed well with aqueous 5% sodium bicarbonate solutions, then with water and is finally concentrated under reduced pressure to give an essentially pure sample of the Compound of Formula VI in almost quantitative yield.
Scheme 8: Syntheses of Compound of Formula LI by opening the epoxide of Compound of Formula VII.
O i H~ CH, CHI
N / / CHI
OH OH
N i ~ Formula LI
Ho ~ off H ~
HO
A solution of the Compound of Formula VII (100 mg) in tetrahydrofuran (50 ml) is treated with 1 N aqueous hydrochloric acid (5 ml). The reaction mixture is stirred overnight at room temperature and is then diluted with toluene (100 ml) and water (200 ml). The toluene layer is separated and the aqueous layer is extracted with a further 100 ml of toluene. The combined toluene layers are washed once more with water (50 ml) and the separated and dried under vacuum to give the _88_ vicinal glycol Compound of Formula LI.
Scheme 9: Syntheses of Compounds of Formulae XLVII, XLIX and LI by ozonolysis of Compound of Formula II.
0 CFi, O CH, CH, i ~~0 / NN
/ N Ho N i~ Formula XLIX
Ho ; ~ ~ Formula XLVII H OH
H ~ ~OH HO
HO

i ~ ~O
N
Formula LI
N ~
HO / OH
H
HO
A solution of the Compound of Formula II (462 mg) in dry ethyl acetate (200 ml) in an ozonolysis apparatus is cooled to below -20°C. A stream of ozone-containing oxygen is passed into the solution from an ozone generator, which has been precalibrated such that the rate of ozone generation is known. To obtain predominantly the compound of Formula XLVII the passage of ozone is halted after 0.9 millimole have been generated. To obtain predominantly the compound of Formula XLIX the ozone passage is halted after 2 millimoles have been generated and to obtain the compound of Formula LI as the predominant product 3.3 millimoles of ozone are generated.
At the completion of the ozonolysis, the reaction mixture is transferred to an hydrogenation apparatus, 5% palladium on calcium carbonate catalyst (0.2 g) is added to the reaction mixture which is maintained at less than -20°C
and is hydrogenated. When hydrogen uptake is complete the hydrogen atmosphere is r eplaced with nitrogen and the reaction mixture is allowed to come to room temperature, filtered to remove catalyst and the filtrate is concentrated. The crude product may be purified by chromatography using either HPLC or HSCC with the systems as described in Example 2 to give, dependent on the amount of ozone used, Compounds of Formulae XLVII, XLIX and LI.
Scheme 10: Synthesis of Compound of Formulae XLVIII by reduction of the _89_ aldehyde of Compound of Formula XLVII.
O CH CH, i i N ~~,~~.OH
y y Ho N ~ \ off Formula XLVIII
H
HO
A solution of the Compound of Formula XLVIII (50 mg) in isopropanol (5 ml) is cooled in an ice-salt bath and sodium borohydride (10 mg) is added and the mixture is stirred for 20 minutes. It is then diluted with water (20 ml) and extracted twice with toluene (10 ml portions) at ambient temperature. The combined toluene extracts are filtered and the filtrate is concentrated to give the Compound of Formula XLVII.
Scheme 11: Syntheses of Compounds of Formulae XIV and XV by epoxidation of the Compound of Formula XLII.
0 CH, !'H, CH 0 ~ ,, ~H..
l~ . v ":~% ~ ,r ~N~~ / ~CH3 ~ ~~ .i ~ w, ~0 ~
\ Formula XIV Ho ;N ~ \ Formul;
HO / OH H ,~OH
H
HO HO
To a solution of Compound of Formula XLII dissolved in tetrahydrofuran (THF) is added 1.1 equivalents of meta-chloroperbenzoic acid. The reaction is cooled in an ice bath and stirred at 0 °C for 1-2 hours. The reaction mixture is then evaporated to dryness, re-dissolved in methanol and subjected to liquid chromatography on a column of Sephadex LH-20 to isolate a mixture of predominantly the Compounds of Formulae XIV, and XV, contaminated with some unchanged starting material and some diepoxide. The Compounds of Formulae XIV
and XV are separated and purified by HPLC or HSCC using one of the systems described in Example 2 for the purification of the Compound of Formulae II. In a typical experiment yields of 35% to 40% are obtained for each of the Compounds of Formulae XIV and XV.
Scheme 12: Synthesis of Compound of Formulae XIX by epoxidation of the Compound of Formula XL.

O CH, CH, CH, i ~N CHI

Ho ; ~ \ off Formula XIX
H
HO
To a solution of Compound of Formula XL dissolved in tetrahydrofuran (THF) is added 2.2 equivalents of meta-chloroperbenzoic acid. The reaction is cooled in an ice bath and stirred at 0 °C for 1-2 hours. The reaction mixture is then evaporated to dryness, re-dissolved in methanol and subjected to liquid chromatography on a column of Sephadex LH-20 to isolate essentially pure Compound of Formulae XIX in good yield.
Scheme 13: Syntheses of Compounds of Formulae XXVI, XXVII and XXVIII by esterification of the Compound of Formula II.
O CH, CH, CH, i~
N~' / / CH, o , N ~ \ Formula XXVI
H ~~OH
H,C HO
O CH, CH3 CH, i ~N ~ ~ ~ C;H, HO ; ~ \ o~ Formula XXVIII
" ~ cH, HO
To a solution of Compound of Formula II dissolved in toluene (9 parts) tetrahydrofuran (1 part), cooled in an ice-bath is added 1.1 equivalents of acetic anhydride and two drops of boron trifluoride etherate. The reaction is maintained cool in an ice bath and stirred at 0 °C for 1-2 hours. The reaction mixture is then poured into aqueous 5% sodium bicarbonate solution shaken and the toluene layer is removed. The aqueous layer is re-extracted with toluene and the combined toluene layers are concentrated to a mixture of predominantly the Compounds of Formulae XXVI, XXVII and XXVIII, contaminated with some unchanged starting material and some diacetates. The Compounds of Formulae XXVI, XXVII and XXVIII are separated and purified by HPLC or HSCC using one of the systems described in Example 2 for the purification of the Compound of Formulae II. In a typical experiment yields of 25% to 30% are obtained for each of the Compounds of Formulae XXVI, XXVII and XXVIII.
Scheme 14: Syntheses of Compounds of Formulae XXXIII, XXXIV and XXXV by methylation of the Compound of Formula II.
CH, CHI CH3 CH CHI CHI
I ~ ~~ ~
N~~~~ ~ CH
N~ / / CH, Formula XXXIV
N ~ \ Formula XXXIII N ~ \
HO
H,C'O H _ OH H OH
HO H C'0 O CH, CH, CH, ~N / /~ / CHa Formula XXXV
N
HO O-CH, H
HO
A solution of the Compound of Formula II (1 g) in tetrahydrofuran 50 (ml) is titrated with exactly one equivalent of sodium methoxide, allowed to stand for minutes at room temperature and then treated with 1.2 equivalents of dimethylsulphate. Heat the mixture under reflux for one hour, cool to room temperature and pour into a mixture of toluene (200 ml) and water (200 ml).
The layers are separated and the aqueous layer is extracted once more with an equal portion of toluene. The combined toluene layers are washed once with 1 N
aqueous acetic acid and then concentrated to s crude product, which is predominantly a mixture of the Compounds of Formulae XXXIII, XXXIV and XXXV with some unchanged starting material and traces of over-methylated derivatives. The desired products may be separated and purified by HPLC or HSCC chromatography using the systems as described in Example 2 above, to obtain approximately 200 mg of each of the Compounds of Formulae XXXII1, XXXIV and XXXV.
EXAMPLE 11: GENES AND PROTEINS FOR THE PRODUCTION OF
COMPOUNDS OF FORMULA
Micromonospora sp. strain 046-EC011 is a representative microorganism useful in the production of the compound of the invention. Strain 046-EC011 has been deposited with the International Depositary Authority of Canada (IDAC), Bureau of Microbiology, Health Canada, 1015 Arlington Street, Winnipeg, Manitoba, Canada R3E 3R2 on March 7, 2003 and was assigned IDAC accession no. 070303-01. The biosynthetic locus for the production of the compound of Formula ll wa s identified in the genome of Micromonospora sp. strain 046-EC011 using the genome scanning method described in USSN 10/232,370, CA 2,352,451 and Zazopoulos et. al., Nature 8iotechnol., 21, 187-190 (2003).
The biosynthetic locus spans approximately 52,400 base pairs of DNA and encodes 43 proteins. More than 10 kilobases of DNA sequence were analyzed on each side of the locus and these regions were deemed to contain primary genes or genes unrelated to the synthesis of the compound of Formula II. As illustrated in FIGURE 12, the locus is contained within three sequences of contiguous base pairs, namely Contig 1 having the 36,602 contiguous base pairs of SEQ ID NO: 1 and comprising ORFs 1 to 31 (SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 and 63), Contig 2 having the 5,960 contiguous base pairs of SEQ ID NO: 64 and comprising ORFs 32 to 35 (SEQ ID NOS: 66, 68, 70 and 72), and Contig 3 having the 9,762 base pairs of SEO ID NO: 73 and comprising ORFs 36 to 43 (SEQ ID NOS: 75, 77, 79, 81, 83, 85n 87 and 89). The order, relative position and orientation of the 43 open reading frames representing the proteins of the biosynthetic locus are illustrated schematically in FIGURE 12. The top line in FIGURE 12 provides a scale in base pairs. The gray bars depict the three DNA contigs (SEQ ID NOS: 1, 64 and 73) that cover the locus. The empty arrows represent the 43 open reading frames of this biosynthetic locus. The black arrows represent the two deposited cosmid clones covering the locus.
The biosynthetic locus will be further understood with reference to the sequence listing which provides contiguous nucleotide sequences and deduced amino acid sequences of the locus from Micromonospora sp. strain 046-EC011.
The contiguous nucleotide sequences are arranged such that, as found within the biosynthetic locus, Contig 1 (SEQ ID NO: 1 ) is adjacent to the 5' end of Contig 2 (SEQ ID NO: 64), which in turn is adjacent to Contig 3 (SEQ ID NO: 73). The ORFs illustrated in FIGURE 12 and provided in the sequence listing represent open reading frames deduced from the nucleotide sequences of Contigs 1, 2 and 3 (SEQ
ID NOS: 1, 64 and 73). Referring to the Sequence Listing, ORF 1 (SEQ ID NO: 3) is the polynucleotide drawn from residues 2139 to 424 of SEQ ID NO: 1, and SEQ ID
NO: 2 represents that polypeptide deduced from SEQ ID NO: 3. ORF 2 (SEQ ID
NO: 5) is the polynucleotide drawn from residues 2890 to 4959 of SEQ ID NO: 1, and SEQ ID NO: 4 represents the polypeptide deduced from SEQ ID NO: 5. ORF 3 (SEQ ID NO: 7) is the polynucleotide drawn from residues 7701 to 5014 of SEQ
ID
NO: 1, and SEQ ID NO: 6 represents the polypeptide deduced from SEQ ID NO: 7.
ORF 4 (SEQ ID NO: 9) is the polynucleotide drawn from residues 8104 to 9192 of SEQ ID NO: 1, and SEQ ID NO: 8 represents the polypeptide deduced from SEQ ID
N0: 9. ORF 5 (SEQ ID .NO: 11 ) is the polynucleotide drawn from residues 9192 to 10256 of SEQ ID NO: 1, and SEQ ID NO: 10 represents the polypeptide deduced from SEQ ID NO: 11. ORF 6 (SEQ ID NO: 13) is the poiynucleotide drawn from residues 10246 to 11286 of SEQ ID NO: 1, and SEQ ID NO: 12 represents the polypeptide deduced from SEQ ID NO: 13. ORF 7 (SEQ ID NO: 15) is the polynucleotide drawn from residues 11283 to 12392 of SEQ ID NO: 1, and SEQ ID
NO: 14 represents the polypeptide deduced from SEQ ID NO: 15. ORF 8 (SEQ ID
NO: 17) is the polynucleotide drawn from residues 12389 to 13471 of SEQ ID N0:
1, and SEQ ID NO: 16 represents the polypeptide deduced from SEQ ID NO: 17. ORF

9 (SEQ ID NO: 19) is the polynucleotide drawn from residues 13468 to 14523 of SEQ ID NO: 1, and SEO ID NO: 18 represents the polypeptide deduced from SEQ
ID NO: 19. ORF 10 (SEQ ID NO: 21 ) is the polynucleotide drawn from residues 14526 to 15701 of SEQ ID NO: 1, and SEQ ID NO: 20 represents the poiypeptide deduced from SEQ JD NO: 21. ORF 11 (SEQ ID NO: 23) is the polynucleotide drawn from residues 15770 to 16642 of SEQ ID NO: 1, and SEQ ID NO: 22 represents the polypeptide deduced from SEQ ID NO: 23. ORF 12 (SEQ ID NO: 25) is the polynucleotide drawn from residues 16756 to 17868 of SEQ ID NO: 1, and SEQ ID NO: 24 represents the polypeptide deduced from SEQ ID NO: 25. ORF 13 (SEQ ID NO: 27) is the polynucleotide drawn from residues 17865 to 18527 of SEQ
ID NO: 1, and SEQ ID NO: 26 represents the polypeptide deduced from SEQ ID NO:
27. ORF 14 (SEQ ID NO: 29) is the polynucleotide drawn from residues 18724 to 19119 of SEQ ID NO: 1, and SEQ ID NO: 28 represents the polypeptide deduced from SEQ ID NO: 29. ORF 15 (SEQ ID NO: 31 ) is the polynucleotide drawn from residues 19175 to 19639 of SEQ ID N0: 1, and SEQ ID NO: 30 represents the polypeptide deduced from SEQ ID NO: 31. ORF 16 (SEQ ID NO: 33) is the polynucieotide drawn from residues 19636 to 21621 of SEQ JD NO: 1, and SEQ ID
NO: 32 represents the polypeptide deduced from SEQ ID NO: 33. ORF 17 (SEQ ID
NO: 35) is the polynucleotide drawn from residues 21632 to 22021 of SEQ ID NO:
1, and SEQ ID NO: 34 represents the polypeptide deduced from SEQ ID NO: 35. ORF
18 (SEQ ID NO: 37) is the poiynucleotide drawn from residues 22658 to 22122 of SEQ ID NO: 1, and SEQ ID NO: 36 represents the polypeptide deduced from SEQ
ID NO: 37. ORF 19 (SEQ ID NO: 39) is the polynucleotide drawn from residues 24665 to 22680 of SEQ ID NO: 1, and SEQ ID NO: 38 represents the polypeptide deduced from SEQ ID NO: 39. ORF 20 (SEQ ID NO: 41 ) is the polynucleotide drawn from residues 24880 to 26163 of SEQ ID NO: 1, and SEQ ID NO: 40 represents the polypeptide deduced from SEQ ID NO: 41. ORF 21 (SEQ ID NO: 43) is the polynucleotide drawn from residues 26179 to 27003 of SEQ ID NO: 1, and SEQ ID NO: 42 represents the polypeptide deduced from SEQ ID NO: 43. ORF 22 (SEQ ID NO: 45) is the polynucleotide drawn from residues 27035 to 28138 of SEQ
ID NO: 1, and SEQ ID NO: 44 represents the polypeptide deduced from SEQ ID NO:
45. ORF 23 (SEQ ID NO: 47) is the polynucleotide drawn from residues 28164 to 28925 of SEQ iD NO: 1, and SEQ ID NO: 46 represents the polypeptide deduced from SEQ ID NO: 47. ORF 24 (SEQ ID NO: 49) is the polynucleotide drawn from residues 28922 to 30238 of SEQ ID NO: 1, and SEQ ID NO: 48 represents the polypeptide deduced from SEQ ID NO: 49. ORF 25 (SEQ ID NO: 51 ) is the polynucleotide drawn from residues 30249 to 31439 of SEQ ID NO: 1, and SEQ ID
NO: 50 represents the poiypeptide deduced from SEQ ID NO: 51. ORF 26 (SEQ ID
NO: 53) is the polynucleotide drawn from residues 31439 to 32224 of SEQ ID NO:
1, and SEQ ID NO: 52 represents the polypeptide deduced from SEQ ID NO: 53. ORF
27 (SEQ ID NO: 55) is the polynucleotide drawn from residues 32257 to 32931 of SEQ ID NO: 1, and SEQ ID NO: 54 represents the polypeptide deduced from SEQ
ID NO: 55. ORF 28 (SEQ ID NO: 57) is the polynucleotide drawn from residues 32943 to 33644 of SEQ ID NO: 1, and SEQ ID NO: 56 represents the poiypeptide deduced from SEQ ID NO: 57. ORF 29 (SEQ ID NO: 59) is the polynucleotide drawn from residues 34377 to 33637 of SEQ ID NO: 1, and SEQ ID NO: 58 represents the polypeptide deduced from SEQ ID NO: 59. ORF 30 (SEQ ID NO: 61) is the polynucleotide drawn from residues 34572 to 34907 of SEQ ID NO: 1, and SEQ ID NO: 60 represents the polypeptide deduced from SEQ ID NO: 61. ORF 31 (SEQ ID NO: 63) is the polynucleotide drawn from residues 34904 to 36583 of SEQ
ID NO: 1, and SEQ ID NO: 62 represents the polypeptide deduced from SEQ ID NO:
63. ORF 32 (SEQ ID NO: 66) is the polynucleotide drawn from residues 23 to of SEQ ID NO: 64, and SEQ ID NO: 65 represents the polypeptide deduced from SEQ ID NO: 66. ORF 33 (SEQ ID NO: 68) is the polynucleotide drawn from residues 1702 to 2973 of SEQ ID NO: 64, and SEQ ID NO: 67 represents the polypeptide deduced from SEQ ID NO: 68. ORF 34 (SEQ ID NO: 70) is the polynucleotide drawn from residues 3248 to 4270 of SEQ ID NO: 64, and SEQ ID
NO: 69 represents the polypeptide deduced from SEQ ID NO: 70. ORF 35 (SEQ ID
NO: 72) is the polynucleotide drawn from residues 4452 to 5933 of SEQ ID NO:
64, and SEQ ID NO: 71 represents the polypeptide deduced from SEQ ID NO: 72. ORF
36 (SEQ ID NO: 75) is the polynucleotide drawn from residues 30 to 398 of SEQ
ID
NO: 73, and SEQ ID NO: 74 represents the polypeptide deduced from SEQ ID NO:
75. ORF 37 (SEQ ID NO: 77) is the polynucleotide drawn from residues 395 to of SEQ ID NO: 73, and SEQ ID NO: 76 represents the. polypeptide deduced from SEQ ID NO: 77. ORF 38 (SEO ID NO: 79) is the polynucleotide drawn from residues 3388 to 1397 of SEQ ID NO: 73, and SEQ ID NO: 78 represents the polypeptide deduced from SEQ ID N0: 79. ORF 39 (SEQ ID NO: 81) is the polynucleotide drawn from residues 3565 to 5286 of SEQ ID NO: 73, and SEQ ID NO: 80 represents the polypeptide deduced from SEQ ID NO: 81. ORF 40 (SEQ ID NO: 83) is the polynucleotide drawn from residues 5283 to 7073 of SEQ ID NO: 73, and SEQ ID
NO: 82 represents the polypeptide deduced from SEQ ID NO: 83. ORF 41 (SEQ ID
NO: 85) is the polynucleotide drawn from residues 7108 to 8631 of SEQ ID NO:
73, and SEQ ID NO: 84 represents the polypeptide deduced from SEQ ID NO: 85. ORF
42 (SEQ ID NO: 87) is the polynucleotide drawn from residues 9371 to 8673 of SEQ
ID NO: 73, and SEQ ID NO: 86 represents the polypeptide deduced from SEQ ID
NO: 87. ORF 43 (SEQ ID NO: 89) is the polynucleotide drawn from residues 97Ei2 to 9364 of SEQ ID NO: 73, and SEQ ID NO: 88 represents the polypeptide deduced from SEQ ID NO: 89.
Some open reading frames provided in the Sequence Listing, namely ORF 2 (SEQ ID NO: 5), ORF 5 (SEQ ID NO: 11), ORF 12 (SEQ ID NO: 25), ORF 13 (SEQ
ID NO: 27), ORF 15 (SEQ ID NO: 31 ), ORF 17 (SEQ ID NO: 35), ORF 19 (SEQ ID
NO: 39), ORF 20 (SEQ ID NO: 41 ), ORF 22 (SEQ ID NO: 45), ORF 24 (SEQ ID N0:

49), ORF 26 (SEQ ID NO: 53) and ORF 27 (SEQ ID NO: 55) initiate with non-standard initiation codons (eg. GTG - Valine, or CTG - Leucine) rather than standard initiation codon ATG methionine. All ORFs are listed with the appropriate M, V or L amino acids at the amino-terminal position to indicate the specificity of the first codon of the ORF. It is expected, however, that in all cases the biosynthesized protein will contain a methionine residue, and more specifically a formylmethionine residue, at the amino terminal position, in keeping with the widely accepted principle that protein synthesis in bacteria initiate with methionine (formylmethionine) even when the encoding gene specifies a non-standard initiation codon (e.g. Stryer Biochemistry 3~d edition, 1998, W.H. Freeman and Co., New York, pp. 752-754).
ORF 32 (SEQ ID NO: 65) is incomplete and contains a truncation of 10 to 20 amino acids from its carboxy terminus. This is due to incomplete sequence information between Contigs 2 and 3 (SEQ ID NOS: 64 and 73, respectively).
Deposits of E. coli DH10B vectors, each harbouring a cosmid clone (designated in FIGURE 12 as 046KM and 046KQ respectively) of a partial biosynthetic locus for the compound of Formula II from Micromonospora sp.
strain 046-EC011 and together spanning the full biosynthetic locus for production of the compound of Formula II have been deposited with the International Depositary Authority of Canada, Bureau of Microbiology, Health Canada, 1015 Arlington Street, Winnipeg, Manitoba, Canada R3E 3R2 on February 25, 2003. The cosmid clone designated 046KM was assigned deposit accession numbers IDAC 250203-06, and the cosmid clone designated 046KQ was assigned deposit accession numbers IDAC
250203-07. Cosmid 046KM covers residue 1 to residue 32,250 of Contig 1 (SEQ ID
NO: 1 ). Cosmid 046KQ covers residue 21,700 of Contig 1 (SEQ ID NO: 1 ) to residue 9,762 of Contig 3 (SEQ ID NO: 73). The sequence of the polynucfeotides comprised in the deposited strains, as well as the amino acid sequence of any polypeptide encoded thereby are controlling in the event of any conflict with any description of sequences herein.
The deposit of the deposited strains has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure. The deposited strains will be irrevocably and without restriction or condition released to the public upon the issuance of a patent.
The deposited strains are provided merely as convenience to those skilled in the art and are not an admission that a deposit is required for enablement, such as that:
required under 35 U.S.C. ~112. A license may be required to make, use or sell the deposited strains, and compounds derived therefrom, and no such license is hereby granted.
In order to identify the function of the proteins coded by the genes forming the biosynthetic locus for the production of the compound of Formula II the gene products of ORFs 1 to 43, namely SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 74, 76, 78, 80, 82, 84, 86 and 88 were compared, using the BLASTP
version 2.2.10 algorithm with the default parameters, to sequences in the National Center for Biotechnology Information (NCBI) nonredundant protein database and the DECIPHER~ database of microbial genes, pathways and natural products (Ecopia BioSciences Inc. St.-Laurent, QC, Canada).
The accession numbers of the top GenBankTM hits of this BLAST analysis are presented in Table 14 along with the corresponding E values. The E value relates the expected number of chance alignments with an alignment score at least equal to the observed alignment score. An E value of 0.00 indicates a perfect homolog.
The E values are calculated as described in Altschul et al. J. Mol. Biol., 215, (1990). The E value assists in the determination of whether two sequences display sufficient similarity to justify an inference of homology.

_98_ a T
Q

L N

N~
O

f0p .(0O

C _ tn ~/JN f1O N

U N m o N ,mcnY

N i E ~'coy U y U vto t n N U

C ~ N O p ~ d ' w U
U

V O) O _ O N O Ip ' ' .N _ ~ OO
tlJf O

C C C C d ~~ U~ J O ~ ~ L VN N N~
N

N _ ~

U U U U p / O N~ pM U ~ J N ON ~ C

_ t M fn7 ~ O

p tG ~ ~ N U QU ~ Mp E= ~ m E N Y ~ O

O N Q7p7>, p~ N Q) 7N ~ f4'Jc6 c0 E E N~
E

O E E E ~ ~ O ~~ O 7 ~O

~ ~ OO Q 7 UO O U X N X _~w C N ~C
~ C

c ' ' ' ~ _ ~~ ~ ~ ~ n U)Y a a ~0 ~ g c 0 a a a ~ a~c ~ . ~' ~ >.. ~, , ~ ~ ~ X ~, w O OO NU ~ (0p N a7~ ~ OU
~ ~ ~ U

c0 c0c0p f~UN Q UO C~ ~ ~ U ViV7c0~ 'O

N p Q7O Op N UN 2'.,.~..N (4~ ~ ~ ~ C G y~ w p~0 N

p ~ ~ ~ _ U Y Y C 7 Q ?, >.~ ~ U~' U~ ~ Y ~ ~ ~ Ot . =

O O O ~ ~ ~~ ~O U ? " (dO N ~ ~ OO. d d~
~ ~7 d U U U ~ ~ ~ oU ~ ~ N ~ o = o ~ c op o o~
s ~ ~

a = ' ~= a QN ~~ c c c ~ n ~ o o ~n. a aa~
_ a~

r p L y Y Y p _ O j ~ -E
'O E

O O O U C (nU d _~(U ~V N ~ p E N E N 7 N, ~ OM
N N ~ N N ~> ~ -M

c0(Of0O (0O E E O, . C>
C C >

, C C C L C = O O L p.
X
X

c9 N c0~ 'U~O 'pON ~~ O O O N'O d Q-~ ~ G~
C C ~
p N p (0a. N N (Of4c4 O O d d N p O-O
N 'O
O

U U U m C Q~ ?~a ~N ' ' ' n ' Q O O co 0 0~r m m m ~ , . a a ~ ~ .
~ v ~ > a a ~ a~ ~~ Q:oE E E a E ~ a a ~~n N Ncb c:~
w c o ~~ cc ~ ~ o c ~ ~ c o 0o c c~
o ~ o v o ~o c yo 00 0 0 o c o 0 0 0 00 0 0o W o M O ~ M t0.~O NM tnO M h N WN CON07 O N O O (DOO ~ r ~M N r O N O O)N ~ O~ M 07O
M

M ~ d'M CD . u O ~ WO (D O

c0 M ~ h ~CC CJ O NV h O
V ~~ v ~..~. CDO v CvCO~ CoV V'v h ~

v .
r CO O ~ O O "O h ~N O N N h tn~ h ~ 07V O)O~00 h U)O ~ MM h MM N O h O COtnt()CO 'd'VV
M M

o ~ O ~ ~ ~ OM N ~~ MM M M N c\M M MM M MM
M

00 O ~,r ~ O(~ ~0 \VM ~ ~ n ~ ~ O N O)~ O Nh O

h N QO00 ~'d'O OO ~ O cDV N O ~(O h -N 00 .- r rN NN r ' r r N N rN N NM
M

R

o ~ ~ ~ ao ~ 00 00 0 o 0 0 0 ~ 0 0 00 0 00 ~ . 0 O o 0 0 o o N p~N ~ M M T h M ~h M O

f~ r O M~ M O(V OJN O h ~ O h N h OJ07 NCO
O ~ N

~ M O CO h 07M hCOCflV ~ 07N ~ O h O~

p " N ~ ~ ~ N~ ~

O . ~ ~ O (OV ~ ~ 0 t0d0V O GO00 h O ~ QO O h O h ~

v 0 N M MC\~ M M M (V~ M M MM M M~
c' ~

~ OM M~ a0 O if N~ N
N

a 0~is~ NN O ~~ ~M s ~ h t0~ M o ~ ~V
0 ~

N r t0~ m 0~m ~ ~ O h ~ r 07h ON N ~

w h O N h N hO ~ NO O7O~r (p(pp~p~~ M h rM O M~
O

,-O a0r _ _ ON r a0 h1~I~(OM 00(O~ ~ 1~MN N h(O
(O

Oj lJJW IJJW lJJlJJUJWt1JL1JLLW W tJJUJLLll1JUJW Wj j W

~ O ~.f O O O O O OO O OO OO O O O O O O O O O OW

O O O
p O O O O O OO O OO OO O O O O O O O O OO O OO

O
M M M MM r MN MN N ~ M N N M ~ CONr r ~O
r r (0 N N p O (9(Q f0c9O NN O p t9N N p f0N N pN
N

N N N ~p~pOc9 f0O~ OO m m O N cD~ N N cb mc0 O O N

O ~ M M MM M 0 ~ ~ M O O N ~ O 00~ m hM
M

lC7~O~ON ~ N V h (O~ ~ M ~ O ,.h COO M

O OM MM M ~ ~ ~ M
O O) O O M M M M ~ M M M M

O N r _ _ _ _ _ _M M r ~

L h ofo7dj~jV07 tnWc0 h07Lj~ O ofh ~j07NcD N m y N M M O O Nh hOJO ~f7~ O O V11 (~Mh CO

C CO COCO~ N rh N h~ MO h O~O h ofM h 00V~ ~ V
CO O O M ofC O ~
O

O
m M o o M ~ MM ~ Mo M_ h h N h h ~ h h NY Y _V
m ~ m ,n o o p o o O o h h y '~'~U U ~U U h~'~ yN m m '~m m him m C7o a~~Q

n a o Q Q dQ Q aa oo Q Q ~ Q Q a Q Q U c~iQ
a a _ z _ U m zU m zz __ m m z m m z m m ~ zm z z zz m CO M ('~ M M M M M

m w w > ~ > a p Q ~ ~ - ~ o ~ - z r N M V u~ CD h a0 O

OU05~7F'~~~9C~
_99_ a U J ~ m >,U ' c a . ~

o a ~ m a~

Q o c m v~ u~~ m o a~ C
O

~ Q O O
_~O C U O
U

r1J~ ~m ~ _ d E O E
~ -o ~

C ~_ O Q UQ C N E ~
tn N 0 Ov f0~_, ( 0 U ~ O O

UM ~ N M O ~ N 7 N O C N

U ~i--0Q D_ ~ Q C C_ L ~ O

~C~ ~O Np Q ~ ~ ~ ~ d (n c0 _ ~ _ ~

N p .L-..O ~N ME O O -OO O L (~ c/7 U

U O CU NO QN Q (0.U O U N 0 c0 N
' N

Q f/7N (0~ U7U L U U ~ ,-,,-, ~ N N C ~
d O ~ ~O ~~ pH ~~~ O ~ ~ '-'L ~ ~ ~ -U U ~ _ ~. >, (6Ntn 07j ~V~ ~ f0cO N N tn7 O O 7, ~ N N U
=

N , ~ ~

U ~ OC N U O O m ~UQ O ~ E ~ ~ N
a C Q 7 ~

O O O UE ~a UY 7 O ~ ~ ~ O a7N ~ '~7 L O O (0c0 U U m ~O U~ NN . E O O O m t0/7N C ~ O C C C
E ~

UC O C_ ~ N O U y E E ~~ ~

~ ON >'-a~ 47N E N a d U L 9 L U O
Q

cp(0 N Q L N N O ~p O O
O. O

7 ~ Y ~(O op in~ H ~ t ~ ~ ~ O c ~-L ~ C C w,0 i7 y _ _ U dL " flQ L ~ ~ O ~ O ~ ~ (OO
O m U

O OC (OC OC ~ O O d 'pO U U ~ ~ (O N O_L
> > (~tO N O Q L

, , N O ~ N N O N 7 C _ tnH
U C

L ~'~ ~ O O O O N ~ Q -O~ w C ~
j, OJN ~ C j ~ ~ _ D D ~ O U U v77 '~ f0 (O
O fn E E d O U O O p7 ~ a 0 N ~ 'p~UU Q. Q Q7 O

M w~ ?-T O N~ O N ~ OJQ C 7 "ON ~ ~ O O (~6 Q L

> Q QU NQ ~~ N ~ ~ p O ~ X ~ ~ f4 C C
~
O

. >. O O~ ~.~ N O C C C C ' 1' ~ ~

X X U U= ~o Y" m U O O V C U o ~ ~ 3 ~ c ,~
~ ~ ~
.N

0 o o 0 0 o 0 3 .> , c M ~ n -CJC7o V ~~ ~ c-o- c io~ E c ~ L ' co V a~ ' c L

O- ~O CO)~ ~ N = j N O Y 1' C O ~ a O

L L ~ ~t 3 ~tn~ ~ C~C~ Y E ~ ~ n a ~'Q

chc~ Z = v ~ U U C~= ~ ~ . Q
Q~

0 0 0 00 "" "'~0 0 0 ~ o o ~ ~ ~ '1 0 0 0 f~N M Mh OO~ 0000COI~I~ .-..-..-. M I~0 0 o O O ~ M
O) h r ~m NO 07~ M i~o~ 0 0 o ~ O CO07~ M ~ ~ O
~

COf~ OJ~M ON Nf~~ ~ M O O O ~ . . C7N ~ ~ O N
' ~

O_JIv iv~_~ ~CO cD~_o~IvI_~ COCOCO~ ~ V_Ivv CO (O (O ~
C_D

f~c0 M MN MO~ 00O~O 00N ~ ~ ~ M c0of 1~N N N O ~I7 N

V M d'o~M I~O Op N N ~ ~ M ~ N O N r N N N N
N

M M M MN NN Nr N N N C7M M V V _ r CO CO V V
CO

67O ~ OV N V 6)M ~ M M M ~ ~ O I~COCO of M ~ o~
M

N ~ N (VN rM Mr I~c0(O r I~f~00OJf~ ~ V N N
~

0 0 0 oa o0 0~ 0 0 0 ~ ~ ~ 0 0 0 o a o 0 0 0 0 M CO N N ~ ~~ f~I~(D o 0 o O f~O 07 O M r O

M M COr~ MO~ N~ N r M ofo~OJI~O~r M r M N N M r N

O I~ O)M rM M f~07O r ~-r OjO~O~ 07P
~

I_~CO CO~_~ Nv ~y 0 y _O N ofofN N N_~ ~ . tn ~ M M
v ~.. _~

I~CO M ~ M ~v O N N M M M M COo~ v N N O
N M ~ " " " N N

V OJ V N O O N _ N ~ ~ ~ M N O ~ N N N
O N N

M M M MN NN N N N N ~ ~ ~7V V V ~ r CO CO ~
r .. cD

I~O ~ CO N N OJ07V ~ M ~ O~ O~ V
O O~

N MN ~ ~ ~ M N N N N ~ r ~ cD~ w ~ r ~

N r r 7 M
M

M ON COO~ NV O)t~CO N N N N N r M M

f~N OV VM I~(OCO O O O ~ M M M M N CO(O

W W LIJ~ WW 11JW W IJJW W W 11JliJW W W W W W W LiJW
W W

O O O OO OO OO O O O O O O O O O O O O O O O O
O

O O O OO OO OO O O O cDcDCOO O O O O O O O O O
O

r r M~f1~~ ~07M ~ CO 1~I~I~r M r I~r r r r N

N c~ (i3 cB N (6 N ciFN NO (6N Oc9N N GO (~O O N (6N N ~ N N N (Q
N

caca sncu~ mc~ ~~ ca co cBca~ cao m co~ ca a~ ca m n M O CflM~ V'~t NO V N r ofM M O o0M I~M _ Cp f~ ~p~
O~

O N~ MV N N N N t~N O ~yCON N M I~ N ~
CO

M M M MN MM M N _ N COV ~ ~ _ V r r CD
r r r r _ _ _ __- __ _ _ _ _ _ ~ _ _ ~ _ N p L ~

COtn N O~ O1(7~O)o~O V O O djc0 I~O 6jI~ V C

COO N N~ MM Om O O)CO ~ r V c0~ c0~ M (O O r I~ O

OJVN NV ~M tnO~M Z ~ N O O V M p~N t~ ~ f~
f~ ~

~ O O ~ r ' N M ~ M O
M

O O NM CO O O N n V ~ O 7 O
~f Q CO 07D~I Z~ ofO ofO I ~I~I~ NI NI~IO I O NI d O
O

Q Q Q Q~ Q~ o_I a I a a a Q n_O a.o_Q a I a I
I I

a7m 07UZ Q ZN Z N Z Z Z Q Z N Z Z Q Z N Z
N

N

0 0 o v o~ oo r~

O O I~ N M tn CO N f~ (O N

M N M N r (p r Cp Z m u7 Y W W p Y ~ a ~ >

c > O > > U Q
n O N M ~Y~ cD I~ M ~ O

r r r r r r r r N

L
' N - O O~ O
Q ~

N N N ~ O) 01N
~

U ~ U ~ ._~ .-. ~j j ~ ~

W (0 (0 O

O. O_ y UM C O y Y O ~ ~ ~ O O

V ~ C O O N -m 3 O (~=~ ' O ,-, m ~ ', N

(07 ~ p d ~ ~ N L M LN ~ N
N

. Q _ O M

E Q ~ ~ ~ f0~ 7 7C ~ N
C ' . 3N Y

t ~ L ~ U~~O N G C m mO j ~ ~

N N . O O O
E r O ~.~ O ~ O V O~ :p m~ p :7 N

N ~ N ~ O j O ' c9N _ ~ O
O ~ p ~tnU N U ON U ~ ~ ~ N c O c0L N ~ U N (0 ~ ~ I~N 6 j' O
(0 T

a t U C ~O N U

O . O L ~ .~ ~ ~ ~ O N OO'O (0 p N
O ~ O . ~ f9 N U L ~ 7 N

o E N E L ~U N v w ~ ~ ; ~~ ~~ ~ ',~ ~
~
~

O ~ '-'o ~ O L , L ~ , E U
-~ ~ a ~ ~

N L ON' U ~ O O OC ~ .L1O CLO ~ ~ Q

E O N O d M O O C O.CN ~ 7N aU Q O .
O (0 ~ L
N
O

N ~ (CO~~ p Upfn~A~ t N =.~ ~ ~f0 N~ Q C
- p p L L .7dc6O . w N fl.(nQX O C 7U f6O fO~
O -a p . - c~O Z 7, = L X x~ ~ ~ w E t ..

~ - U o a _v ~ c~U
a~ O V'O~ O afO' ~ p M
N

c ~ ~ ~ .7. C C ~ L N LD O O O~ O~O ~' O >, C C ~ _ L OL C C C
L L '~NL V m~ ' ' 'pU N N
~ Q C _ ~ N ~ N N U T N~ I,-,O . C
, d 'N
' N ~ 'U ~ E ~ _ O
-~ p a~ O O ~ ~ ~ ~,jN ~dj N Np Lp O O O
p ' O

O O ~,-Od d M M M C CON O (9cD ~9c ON d O_ m a N Q c~s~ ~ li~ > ~ > c Em m ~,a -aco c~

d ~ ~ N N O , t , ~E E EN ~ ~ U U
U

~a~. '~~ E E ~ ~ N'O O v~ ~ny- ~-o C
p ' . a U ~ ~
O N

N O U C N fJN ~ '' t ~ U~ L L~ ~ __ O -V

U N N~ O O C C p O U O~ L UU U U ~'pO O E
O C Q C C O

. ~ ~ p d d N N Q . p_~ >. O. d Q 2 N O ~ O O ~ > O O XO O O U

N . . O O U LX >,>,>, c0U LL U (0UE L L U U U N NN D ~~ ~ ~ E
.~

U N (p rnO L L L

a o o 0 0 00 0 0 0 0 0 0 0 00 0 00 0 00 00 0 ~

M M N u7NO O ~.,~o~f~f~~ M MO MN 1~ fW~ ~ ~ o V' of ~ N 00ppCOM N ~ ~ 07~ COO O OI~ I~d'~ (Dc0 ~
O

O

~ M vv ~ ~r ~ ~~ V~ O

_ ~ ~ V

N O O~ ~ ~ h In~ 07O t() O f~O~ (bMO O7O
M O

M V O ~ ~~ lyC7'~V V tf7N OCO N ~I7O) O O NN O f~
M

~ N N M N Nr ~ r M M M M V MN N.- r NN NN ~ ~ Q) N

CO!~cD M O~ 00(O ~ r r (OOW ~ atN O WN..OO h N V V (O~ppt~f~Ivt~I~ OV r ~~ ~ Mr OO ~ ~ V
~ r.

e-c- r r-~ N N Nr r r r ~-0 0 0 0 0 00 \ a o 0 0 0 0 00 0 00 0 0~ ~o ~ o o 0 'v 67N M (O aOOo ~.._ (OQ)1~(OM (OO m M(O (ON 0 0 0 00O M CD O ('~O ~ ~ r V O ~ M OIO I~MIn ~ N~ MN ~
~ M

c0tnM f~ ofOO tfjy (7N o~c0tIjV tIj~ tnN ~ ~

~ ~ ~ ~~ ~ M ~ ~ ~ ~~ ~ ~~ ~ ~ N O
d' V N .- v N N N tv v ~ '-'.-N O 00 ~ LC7N f~1IWC7O~O ~ O f~OJ ~7MO O~m CO(O

M V O O ~I~ V d'~ ~ N O(D 1(Wf)6) O O r ' ~

V N N c~ N Nr ~ ~ C\M M M d~MN N N _ NN NN ~ Or N ~ V c0 tnM~ N ~ N c0W c0hO O c0 tn O7O O O ~ V ~ N r ~ ~ On ' M
O

r r r r r r r COcD~hV M

V M N CO ~ M~ N r COr opop ~f7MO opop ~~ N N O
O O~

cD~ ~ V~ ~ ~r ~ r V'~ ~ h.I~c01n ~ ~(O M ~N ~-.-O O ~
u~ O

W W LL W lLLLJW W W t1JL11LIJW LLJWW W LLJW W WW LLW W W LLJ
W W

O O O O O OO O O O O O O O OO O OO O OO OO O O O
O O

O O O O O OO O O O O O O O OO O OO O OO OO lC707O
O O

c0N N V N (VdW- N ~OI~O~r-NCO r QiIs .-NOi ~Is' ti~
N dW r p f9N c6 c6NN c9N c0N N (gypN ~N (m0 ON cB N N
N s0 m f4N cb (0(6N N N c9f4c6N f0Mf0 O ~p (O(B O(4 N O
c0 ~p N

COO O~ N _1~f~o~M ~ I~~ O O_ CO~~p ~pNN ~~ _ M
N (OI~ O O O
~

1 f~ O (D~ ~ ~ M M M ~ N ct(O N ~~p ~p V M of~-N c0 N
N

N M ~ MN N N t V V _ ~ N _ N~ ~ MN NN ~ N -r r r r rr r r r r - 'N ~ O -r ~ r ~ ~~ N rr r CV ~
' , N N M ~ N m d'O N O ~p l Np pj~
CO ~ 0 O ~

N O N O)~tf O 7 Q7N O ~ ~ ofof ~ 0 O

~ ~ ~~ _ O ~ MO ~ ~ _ OM ON ~ ~

tfJ~t ~ N ~ d0N N ~ l~
~ (~

I~ I~ ~1~~ N I~ M O N OQ) O M_ _ WO O O N O
M

NI~I NI ~INI I I ~I~I~I ~IOM ~ ~ M ~ ~ o ~I ~ t~

o_ a a~ n.a ~.o_a O a ~I O ~a a lzl ~. n I
~ ~ , z z z z zz z z z z z N z Nz N z z z N

~ M ~

C tn CD N M
O

N M N d' M N N N N r o ~ o ~ x ~ m ~ a a ~ z >

Q o N N N N

N N N N N M

N

N

U

L c9 C

roU ~ N

N E tl5, N
U

Q N
w ,U r..7 _' .

roi 7 . C

/~ U

N N ro~
T N U m 7 m N C =
.

7 ~ L N . .U

U U
c O _ T
ro ro~ ' OJD
"

U O
U O_ ~

ro7 m X O ~

O
_ ~ Q

- ~ ro7 ro~'N O

p]~ m E N N ~
ro . ~ O

N .,.C (0C_ ~

N W ~ U

~ N

~ E ~ J L Q d N
~ _ ro N ~n;~~, m ~
a a ~ s N

O a~o a~~ ~

~,U L - N .~
O

.cW N p ~ ~ Y

d N d E ~ L H L J L

I~ I~ 0 I~ 0 N N N CO
N

N ~

~ M M M_ V

~ 0 0 N N N N N
N

M CO~.' n CO

~ t ~
V

n r 0 0 ~ ~ 0 0 M N O)O y f c 7 D
N

M M N ~
M

N N N
~N..v '-'~.N_v N

O O

N N O I~
N

N CNON N N O
N

M M ~ ~ V ~
M N

O O O O O O O O
W W W W W W W W
O O O O O O O O) ~ N NI ~ N ~1 ~
ro rororororo ro m m rom m m m m m ca .-o~o ~ r-cc ~ O ~ O N
due.. N
~

CO c0N N N ~
c0 r O O m f~N N
~ r f~ m O M tn1~

u7 N o~I~1~N
f~ V

V O V t(7I~
CO

M <tM ~ t!7N
~ V

0~ ~ ~ OJCO00 CO I I I I N
I
I

I
a d d a ~ a a a z z z z z z z z I~ N N

O M M

N

a z rt The ORFs encoding proteins involved in the biosynthesis of compounds of Formula II are assigned a putative function and grouped together in families based on sequence similarity to known proteins. To correlate structure and function, the protein families are given a four-letter designation used throughout the description and figures as indicated in Table 15. The meaning of the four letter designations is as follows: AAKD designates an amino acid kinase; ABCA and ABCC designate ABC transporters; ADSA designates an amide synthetase; ALDB designates an aidolase function; CSMB designates a chorismate transaminase; DAHP designates a 3,4-dideoxy-4-amino-D-arabino-heptulosonic acid 7-phosphate synthase activity;
DHBS designates a 2,3-dihydro-2,3-dihydroxybenzoate synthase activity; DMDA
designates a diphosphomevalonate decarboxylase; EFFT designates an efflux protein; HMGA designates a 3-hydroxy-3-methylglutaryl-CoA reductase; HOXV
designates a monooxygenase activity; HOYH designates a hydroxylase/
decarboxylase activity; HYDK designates a hydrolase activity; IDSA designates an isopentenyl diphosphate synthase; IPPI designates an isopentenyl diphosphate isomerase; IPTN designates an isoprenyltransferase; KASH designates 3-hydrcsxy-methylglutaryl-CoA synthase; MVKA designates a mevalonate kinase; MVPK
designates a phosphomevalonate kinase; OXAH designates an acyICoA oxidase;
OXDS designates an oxidoreductase; RECH, RECI, RECD, REGG and RREB
designate regulators; SDRA designates a dehydrogenase/ketoreductase, SPKG
designates a sensory protein kinase; UNES, UNEZ, UNFA, UNFC, UNFD, UNFE, UNFJ and UNIQ designate proteins of unknown function.
Table 15 FAMILY FUNCTION

AAKD amino acid kinase; strong homology to primary aspartate kinases, converting L-aspartate to 4-phospho-L-aspartate ABCA ABC transporter ABCC ABC transporter ADSA adenylating amide synthetase ALDB aldolase; similarity to fructose-1,6-biphosphate aldolase that generates D-i glyceraldehyde-3Ph, precursor of D-erythrose-4Ph involved in the shikimate pathway ~SMB chorismate transaminase, similarity to anthranilate synthase DAHP DAHP synthase, class II; involved in formation of aminoDAHP
from PEP and j a erythrose-4-phosphate i DHBS 2,3-dihydro-2,3-dihydroxybenzoate synthase (isochorismatase) DMDA diphosphomevalonate decarboxylase (mevalonate pyrophosphate decarboxylase) EFFT ~ efflux protein HMGA HMG-CoA reductase; converts 3-hydroxy-3-methylglutaryl-CoA
to mevalonate plus CoA in isoprenoid biosynthesis HOXV FAD monooxygenase; shows homology to a variety of monooxygenases including salicylate hydroxylases, zeaxanthin epoxidases HOYH hydroxylase/decarboxylase; FAD-dependent monooxygenase i HYDK hydrolase ~

IDSA isoprenyl diphosphate synthase, catalyzes the addition of 2 molecules of l isopentenyl pyrophosphate to dimethylallyl pyrophosphate to generate GGPP

IPPI I isopentenyl diphosphate isomerase, catalyzes the isomerization i j of IPP to produce dimethylallyl diphosphate IPTN ~ isoprenyltransferase; catalyzes covalent N-terminal attachment of isoprenyl units i to amide groups of nitrogen-containing heterocycle rings i KASH HMG-CoA synthase; condenses acetyl-CoA with acetoacetyl-CoA
to form 3-hydroxy-3-methylglutaryl-CoA

MVKA mevalonate kinase; converts mevalonate to 5-phosphomevalonate in the mevalonate pathway of isoprenoid biosynthesis MVKP phosphomevalonate kinase; converts 5-phosphomevalonate to 5-diphosphomevalonate in the mevalonate pathway of isoprenoid biosynyhesis OXAH acyl CoA oxidase OXDS oxidoreductase RECH regulator RECI regulator; similarity to PadR transcriptional regulators involved in repression of phenolic acid metabolism ) RECD transcriptional regulator; relatively large regulators with an N-terminal ATP-binding domain containing Walker A and B motifs and a C-terminal LuxR type DNA-binding domain REGG regulator RREB response regulator; similar to response regulators that I are known to bind DNA
i and act as transcriptional activators SDRA I dehydrogenase/ketoreductase, NAD-dependent SPKG sensory protein kinase, two component system UNES unknown function UNEZ unknown function UNFA unknown function I UNFC unknown function i UNFD unknown function UNFE putative membrane protein UNFJ unknown function UNIQ unknown function Biosynthesis of the compound of Formula II involves the action of various enzymes that synthesize the three building blocks of the compound, namely the farnesyl-diphosphate component (FIGURE 13), the 3-hydroxy-anthranilate-adenylate component (FIGURE 14a) and the 2-amino-6-hydroxy-benzoquinone component (FIGURE 14b) that are subsequently condensed to form the final compound (FIGURE 15).
The farnesyl-diphosphate biosynthesis involves the concerted action of seven enzymes (FIGURE 13). ORF 10 (KASH) (SEQ ID NO: 20) encodes a hydroxymethylglutaryl-CoA synthase that catalyzes an aldol addition of acetyl-CoA
onto acetoacyl-CoA to yield 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). This product is subsequently reduced through the action of ORF 9 (HMGA) (SEQ ID NO:
18) to form mevalonic acid (MVA). ORF 5 (MVKA) (SEQ ID NO: 10) phosphorylates mevalonate to 5'-phosphomevalonate using ATP as the phosphate donor. The next step in the farnesyl-diphosphate biosynthesis is the phosphorylation reaction of the 5'-phosphomevalonate to 5'-pyrophosphomevalonate (DPMVA) that is catalyzed by ORF 7 (MVKP) (SEQ ID NO: 14). Subsequent decarboxylation of 5'-pyrophosphomevalonate catalyzed by ORF 6 (DMDA) (SEQ ID NO: 12) yields isopentenyl diphosphate (IPP) which is then converted to dimethylallyldiphosphate (DMADP) through the action of ORF 8 (IPPI) (SEQ ID NO: 16) that has isomerase enzymatic activity. The final step in the biosynthesis of farnesyl-diphosphate is the condensation of one molecule of dimethylallyldiphosphate with two molecules of isopentenyl diphosphate catalyzed by the isoprenyl diphosphate synthase ORF 4 (IDSA) (SEQ ID NO: 8). The described pathway involved in synthesis of farnesyl-diphosphate is entirely consistent with related mevalonate pathways described in other actinomycete species (Takagi et al., J. Bacteriol. 182, 4153-4157, (2000)).
Biosynthesis of the 3-hydroxy-anthranilate component involves the use of precursors derived from the shikimate pathway (FIGURE 14a). Chorismic acid is transaminated through the action of ORF 19 (CSMB) (SEQ ID NO: 38) to form aminodeoxyisochorismic acid. This enzyme resembles anthranilate syntheses and is likely to catalyze specifically the transfer of the amino group using glutamine as the amino donor. The next step involves isochorismatase activity and is mediated by ORF 27 (DHBS) (SEQ ID NO: 54). This reaction consists in the removal of the pyruvate side chain from aminodeoxyisochorismic acid to form 6-amino-5-hydroxy-cyclohexa-1,3-dienecarboxylic acid. This compound is subsequently oxidized through the action of ORF 26 (SDRA) (SEQ ID NO: 52) yielding 3-hydroxy-anthranilic acid. ORF 24 (ADSA) (SEQ ID NO: 48) catalyzes the activation of 3-hydroxy-anthranilic acid through adenylation generating the 3-hydroxy-anthranilate-adenylate component (FIGURE 14a).
Biosynthesis of the 2-amino-6-hydroxy-benzoquinone component of the compound of Formula II, requires components derived from the aminoshikimate pathway. FIGURE 14b depicts the series of enzymatic reactions involved in the biosynthesis of this constituent. ORF 21 (ALDB) (SEQ ID NO: 42) resembles aldolases involved in the generation of precursors of D-erythrose-4-phosphate which is part of the aminoshikimate pathway used for the generation of 2-amino-6-hydroxy-[1,4]-benzoquinone. ORF 33 (DAHP) (SEQ ID NO: 67) catalyzes the initial step in the aminoshikimate pathway that corresponds to the formation of 3,4-dideoxy-4~-amino-D-arabino-heptulosonic acid 7-phosphate (amino DAHP) from phosphoenolpyruvate (PEP) and erythrose 4-phosphate (E-4Ph). Subsequent reactions leading to 3-amino-5-hydroxy-benzoic acid are catalyzed by enzymes provided by primary metabolism biosynthetic pathways present in Micromonospora sp. strain 046-EC011. ORF 25 (HOXV) (SEQ ID NO: 50) hydroxylates 3-amino-5-hydroxy-benzoic acid at position 2, generating 3-amino-2,5-dihydroxy-benzoic acid.
This intermediate is further modified by ORF 32 (HOYH) (SEQ ID NO: 65) that catalyzes a decarboxylative oxidation reaction yielding 6-amino-benzene-1,2,4-trios.
A final oxidation reaction is performed by ORF 16 (OXDS) (SEQ ID NO: 32) yielding 2-amino-6-hydroxy-[1,4]-benzoquinone (FIGURE 14b).
Assembly of the three components resulting in the compound of Formula II is catalyzed by ORFs 24 and 11 (FIGURE 15). ORF 24 (ADSA) (SEQ ID NO: 48) catalyzes the condensation of the adenylated 3-hydroxy-anthranilate with the 2-amino-6-hydroxy-[1,4]-benzoquinone component. A spontaneous condensation between the free amino group of the 3-hydroxy-anthranilate and one of the carbonyl groups present on the 2-amino-6-hydroxy-[1,4]-benzoquinone component occurs yielding a dibenzodiazepinone intermediate. This compound is further modified through transfer of the farnesyl group of the farnesyl-diphosphate intermediate onto the nitrogen of the amide of the dibenzodiazepinone catalyzed by ORF 11 (IPTN) (SEQ ID NO: 22) and resulting in the formation of the compound of Formula II

(FIGURE 15).
Additional ORFs, namely ORF 2 (RECH) (SEQ ID NO: 4), ORF 3 (REGD) (SEQ ID NO: 6), ORF 12 (SPKG) (SEQ ID NO: 24), ORF 13 (RREB) (SEQ ID NO:
26), ORF 34 (REGG) (SEQ ID NO: 69) and ORF 36 (RECI) (SEQ ID NO: 74) are involved in the regulation of the biosynthetic locus encoding the compound of Formula II. Other ORFs, namely ORF 1 (ABCC) (SEQ ID NO: 2), ORF 31 (EFFT) (SEQ ID NO: 62), ORFs 39 and 40 (ABCA) (SEQ ID NOS: 80 and 82, respectively) and ORF 42 (SEQ ID NO: 86) are involved in transport. Other ORFs involved in the biosynthesis of the compound of Formula II include ORF 20 (AAKD) (SEQ ID NO:
40), ORF 23 (HYDK) (SEQ ID NO: 46), ORF 38 (OXAH) (SEQ ID NO: 78) as well as ORFs 14, 15, 17, 18, 22, 29, 30, 35, 37, 41 and 43 (SEQ ID NOS: 28, 30, 34, 34, 44, 58, 60, 71, 76, 84 and 88, respectively) of unknown function.

TABLE 16: PREFERRED MEDIA COMPOSITION FOR PRODUCTION OF ECO-Component QB MA KH RM JA FA
.

pH* 7.27.5 7 6.857.3 7.0 Glucose 12 10 10 10 I

Sucrose I I I 100 i I Lactose i Cane molassesi 15 Corn starch 30 Soluble starch10 25 Potato dextrin 20 40 Corn steep solid Corn steep 5 15 liquor Dried yeast 2 Yeast extract 5 Malt extract 35 - 10 ~ 15 ~harmamediaTMI
~

~ Glycerol NZ-Amine 5 10 Soybean powder 15 Soybean flour Meat extract Bacto-peptone MgS04.7H20 1 MgCl2. 6H20 I

CaC03 f I 4 1 2 2 I

~ NaCi 5 (NHa)2 SOa 2 KZ S04 0.25 MnClz.4H20 MgC12.6H20 10 FeC12.4H20 Z

Na2HP04 j ~ ~ 3 i Thiamine Gasamino ' 0.1 acid Proflo oil 4 I Trace element 2 I solution *3 ml/L

Unless otherwise indicated all the ingredients are in gm/L.
*~ Trace elements solution contains: ZnCl2 40 mg; Fe C13 6H20 (200 mg); CuCl2 2H20 (10 mg);
MnC12.4H20; Na2B40~.10H20 (10mg); (NH4)6 M0,0z4.4H20 (10 mg) per litre.
*5 The pH is to adjusted as marked prior to the addition of CaC03.

All patents, patent applications, and published references cited herein are hereby incorporated by reference in their entirety. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

SEQUENCE LISTING
APPLICANT: ECOPIA BIOSCIENCES INC.
Zazopoulos, Emmanuel Farnet, Chris M.
TITLE OF INVENTION: FARNESYL DIBENZODIAZEPINONE, PROCESSES FOR ITS
PRODUCTION AND ITS USE AS A PHARMACEUTICAL
NUMBER OF SEQUENCES: 89 CORRESPONDANCE ADDRESS: 7290 Frederick-Banting Saint-Laurent, Quebec, Canada, H4S 2A1 COMPUTER-READABLE FORM
SOFTWARE: PatentIn version 3.0 FILE REFERENCE: 3005-7PCT-9CA
PRTOR APPLICATION DATA
APPLICATION NUMBER: USSN 60/441,126 FILING DATE: 2003-O1-21 APPLICATION NUMBER: USSN 60/492,997 FILING DATE: 2003-08-07 APPLICATION NUMBER: USSN 60/518,286 FILING DATE: 2003-11-10 PATENT AGENT INFORMATION
NAME: Ywe J. Looper REFERENCE NUMBER: 10961 NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:1 ccggtgcaccgggttctccaggatcgccgtcgcgcccaccggccccgacaggtagacgac60 gttcagggacttgccgcgcccttcgtagttggcccgcaccacctgcgcgtcgccgatccg120 gcccctggtctccagcgtgcggttctcccacacctgccatccgacgaaggtcaggaacag180 cgcggtgaacagggacgtgacgagcagccagaggccagctgtcagcacggtcgccccctc240 gccccgtagcaggccgaggacgacctcctcgtagcgcgaggggcggccgacggggccggt300 gcccgctccgtcgacagccatcccgccgctccttcgccgactgccccggacatccacggt360 agccagcgagtccagtccggtgaggaaggggtggcgagaagtcgatatgactgagaggca420 tatttatgactcccagtcatatcgctcggaagtgaccgaacgacctgacgccgccggggc480 tgtgagcggcagcgtgggccaggccgcgaggtcctggagcatctgccggtcgtgggtggc540 gacgaccaccgccgcccgggtcgtcagcagggcggcggtgaggtcgtcgaccagcggcgc600 cgacaggtggttcgtcggttcgtcgaggatcagcaggtcgggacgttcggccaggcgcag660 cgccaggttcagccgccgttgctgtccgtgcgacatccggccgacgggggtacgccgggc720 ctcggcgtcgagcaggttcgtcgcgctcagcggcagggccgtgccggagccgacgcgccc780 gctggagcggagccggcccacgtgctgctcgtacaggtcgtgcgcgagcagcgccggcgg840 ccagtcgggcacctcctgaccgaggtacgcgacgcgcgcgccggacaggtgccggacctc900 cccggtcgacggcgtgaggtcgccggccagcacggagagcagcgtcgacttgcccgcgcc960 gttgggtccggtcaccagcaggcggtccccgccgtcgagcgtgagcgtgacccgggtacg1020 caggcgcccggccaccgtgacgtcgtggcatcgcaggatgggcagtccggcacgggtgtc1080 cagcggcggccagcgcagcggctgcggtggctccggcacggtgacgcggtgcgcgtcgag1140 cgcctcctgccggcggcgcagcgcctggaccagtccgggcgcgcgggactggcgctggtg1200 cttgccgtgccccttctccggccgccagccggtgctgagccggtcccgcgcctcccgtac1260 cccgtcggccagccgctggtgctcggcctgctgcgcctcgtggtcgcgtacccagtgcgc1320 gaagtcgcggcggcgcccgtcctgccaggcgacgtagtccccggcgtagcggcgcgggcg1380 cccgtccgcgctggggtcgaggtccaggaactccgtggcgacgtcccgcagcagggcgcg1440 gtcgtgggtcaccagcacgacgccgcccgggtggtcgcgtagccgggcggtgaggaaggc1500 caggctgtcggcgtcgaggtggttcgtcggctcgtccagcatcagcaggtcgaccctcgc1560 tcccagcaggcacgccagccgtacccggtagcgctggccgacggacaacgtggccagctg1620 ccggtcccggtccgggcacgcgtcgaggccggccagcgccacgtcgacgcgccgctgcgc1680 gtcccaggcgtccagccgggtcgccgcgtcgagcgcggccgcgtacgcgtcgtccgcgcc1740 cgcccggccctcggtgagcgcgatcgtcgcctcgtcgagcgcccgcagcgcgcgttcgga1800 ctcccggatcgcctcccggacgagcgtgcccactgtctcgccgtggcgcgactccaggtt1860 ctgccgggcgacgccgatcgtgcccagccgttccaccacgccctggtcgggcgcgatgag1920 gccggccagcacgtgcagcagggtggtcttgccgcggccgttctcgccgacgactgcgag1980 gcgggaagcggcggagacggtcacgctgacgtcggacagcacgacccggccgccgcgtac2040 gacgcggacgccgtcggcccgcacgtgcgcccggtgcccggcgggcagcgaaccgcccga2100 ggtggatggggaggaaggaatgttgtcgaggttgtgcacagtccgctcttcggctcgtcg2160 tggagccgggcagcgcgaggacaccgcccggcgggaacgccgggacggcggagcagagct2220 ggtacgtcagaagaagccggtcaccctgccgccgtcagcggagggaccagggcttcatga2280 cagcggcgtagaacctcatgcggtcaacactacccggggccgggccggagatcgccgcag2340 ttatcggcggcggcgggcgtcggcctcggcgtcgagcaggtcgttcaccgccagcgccga2400 gttgatcagagcgaggtggctgaacgcctgcggatccacggttgcggtactccatttgca2460 gtacacctgtcggtatccggtcagcgccgtatcctgcgctttctctgtcggcagagcggc2520 gcggtcgcccgccgcccgccgacgtggctgcggggccggtcgggctcggaccgctcggtg2580 cggcgtcgcggcccggccgtagcatgtttcacctgttcagagcggcttccgggcgctcgg2640 gccgtcggccgcggtggttaccggcgagggctatttcggtcatgcgagagggttctgcca2700 atcgtggcattgtttagttaagtccgatatcagcgggatgctgcctgatatatgacggct2760 gcgcccgggcctgccggatagctatgatgagcgacgacggtgatcgatggcaaatgttgt2820 tgctgtggggtagcgtcaccgccgagtccaggcttttcttgagctgtgtgcgcatattcc2880 ggggggattatgacaacgggacggccgggggagaaccgggcgacagacgcggcacgaaat2940 ccggggtgggccgccggggggccggcgtcccagccatggggcggggggaacgacgagcag3000 gtcctgcgcgagatcctcggggtcgacgtgcaccgcgagctgattgacttcgcgggtggt3060 gccggcggaaatccgcacctggtcgccgaactcgcgcgcgggctcgccgaagagggattg3120 attcgggagacaaacggtcgggcggaattggtgtcccggcgaattccccggcgcgtgctg3180 agttttgtcatgcgtcgattgaatgatgtcagcgccggctgccagcagttcttgaaggtt3240 gccgcggcattgggcagatccttcatgctggaggacgtttcgagaatgctgggccgatcg3300 tcggcggccctgctcccgccggtggacgaggcgatcgcatcgggcttcgtcgtcgccgcc3360 gagcatcaactcgcctttcagagcgacttcctgctgcgcggcatcatcgagtccattccc3420 gggcccgcccgcgacgccttacgacgtgaggcgatgagcctttccgggcgacggcgcccg3480 gcggccgaccagaatcgccggttggacgcggcgcctaccgcgccggtgagcgcgaccggg3540 gaggacgccaccggatcctgttcccgggcgcaccgcctgataatgaacgggaacgcgaag3600 gccggcattcgcgtcgccgaggcggttctcgccggcccggccgcgtcgctcgctgcccgg3660 cgtgacgcggaggcgtgtctggtgctggccgatctgctgctcggcggggagggcggcggc3720 ccgatgaccgaggcgatcctgcgcgaacgcgacgccgagtccggtgacgccgcactggcg3780 atggcgctgaccgcccggtccaccgggctgtggtcggcgggaaagctggcggagggcctg3840 aagctgggacgggcggcggtgcgggcgggcgcggaggccgaaccggtgtggcgtctgcac3900 gcccagctcgcgctcgccgggaaactcgcgaacctccgcgagttcgacgaggccgaggcg3960 ttgatcaacgaggcggaagcgggcctgcgcggactgcccgcgccgatctggacggccgcg4020 acggcggtgatgcggtcccggttgctgctccaggcggggcggatcggggaggcgcgtcgg4080 gaggcggcgctggccaccaccgccgtggagggggacgcggtgccgatgctgcggcctctc4140 gcctacgcggtgctcagcaccgcctccttctacatgggggacctgcccgccgcgatcgag4200 tacctcaggcgggggcagcgggacgcggaccgccacgtggtcctcgactcggtgcagtac4260 tcgtgggcggaagtgctgatcacggtcaagcaggaaggcccgcgggccgccgcccagctg4320 ctcgcgggcaagcaccaccgcctgcccacgcagcgccgcctctacgtcgaggtgccgagc4380 gccgccgccttcctggtcctgctcgcccgcgacgtggacgaccgtgacctcgaacgccgc4440 gtcctcgacacggtcaacgggctcgccgcggacaaccccaggatccaggtcgtcagcctc4500 accgccatgcacgcccacgcgctggcgaacagcgctccggccgccctggcgctcatcatc4560 gtgcagtcacgggacccgatctcggtggcgctggccaccgaggaactcgccaagctctac4620 gccgcgcaggcccaggcggggggacggccggcgacgccggcccgcgccgaggaggccgcc4680 accccgccggcgagctgctggtcgaccctgtccgacatggagcagcggatcgcctacctg4740 gtgagcg~gggtctgacgaaccggcagatcgccaagcaggtccacctgtccgcgcacacc4800 gtcaactaccacctgcggaagatctaccggaaactgggtttcaacacccgggccgagctg4860 gcgcacgccgcggccacgtactccggccgggcggcgatctactccatgagcggcgaccag4920 gactggggcgccggatccatgaccggcaaggccagctgaaccgcattcccggcgtccgcc4980 ggctgaaccgcgccccggcgtacgccggccggttcagccggcggacgccggctggcgtgt5040 ggtggccagcgccggccggaccgcctcgtgcgcgatgaagcagcgggtcagttccacccg5100 gctgttgatgtcgagcttggagaagacgcgccgcaggtgactgtcgacggtgtgcgggga5160 caggaacagcgaactcgccgcctcgcggttggtcatcccgtccacgatggcccgcacgac5220 ccgcagctccgcgctggtcaggctctcccaccccgaccggggccggtcggggaccagcgg5280 gcggacgttgtgagccggcaggccacgcagctcggcctccacgcgctccaggtcgcgtcg5340 cgcgccgcactcccggtagccgtccgtcgcggcctcgagcagacgggtggcctcggcccg5400 gtcccgggtgctgcgggccgcgtcctccaccgcgccggccgccgcgagcgtacggccggc5460 gagccggtgcagatccgcggcccgcagcagcgccgccggatcgtcgcgcaggagacccgc5520 ggcgtgttccgccgccgccgccagcgactggacgaacgggttgccgcgggcgacgcgccg5580 ggcgacctccacggcgcgctcggcctccgcgtcgagccccgcccggcgggcctggcgtac5640 gagcgtcgccgcagcggccggcgcctcggtgaacagcagcggatcgggtgcgacctgtcc5700 ggcgacgttgatcagcgtctgcaccatcatcgccggacggccgctggcagcgtggaaccg5760 ggccagcgcccagtccatccgcgccgagtcgtcggcggaggccagccgctcggccgcccg5820 caactggtcgctggccgtggcgaggtcaccgtggtgcacgccgaggtgggccaggaccag5880 gcgcgccggcacgcagtcgcccggccgggagtggtcggcggctcgcagcgccgcctccgc5940 ctcggcgcgtgcctcgtccagccgtccggccgctgccagcagctcggcccggtggccgcg6000 ccagagcgactccgagccggtgtgactgggctcctgcgccagcggtcgtacggtgtccag6060 caccgcctgcgcctcgtcgagctgatcggccgcgcccagcgcccggaccagccaggtcca6120 cagcggccgccggccgggcgcgcagcccggggactggtgccggggctccagctcggcgga6180 ggaggcaccgcccaggtgcttcgtggtgtccgcgagcgcccggtccagcttggcgcggtc6240 cagctcgcacacgtcgtggcgggcctgcgtccggcgcaggaagccggccgccaggcggtg6300 gctgccggcggcccgcatcccgtgtcccagttcgagcacgagctgcgcctcgacgtccgc6360 cgcgaggtcgcggcggagcatcacctccgcgaggcggccggcctcggcggcccgccccgc6420 cccggccagcaggcgcagcgcacgggccagtgctcgtggcgcctcggcggatccgttctc6480 caggtgggacacggcggctgccgccacgtcgtcgcacccgcaccggcccgagcgcggccc6540 cgccgtcgcggcgggcgtggccgcgtccggcgcggagcgcgtgacgcgtacgccggcggg6600 ggagtggggcgtcccgggccgcggatcgggccgcccgcgccggaccgggtcgcccgccgc6660 cggtgecggcgcggatccgggctcggcacgctccggttccgggtacgcggcgtggcgaag6720 cgcctctccgagcaccgggtgggcgaaggtcagctccgcgccgtcgcgtcgtatcagccc6780 gacccgcaccgcctcgtcgatcgcggcggacacgtcggcggccgagccgtccagcaggcc6840 cgtcacccggtcgacgggaaacgtgtggccgagccggccgccggccgcgagcaggcgccg6900 cagcgggggcggcagctcctccagcagcccgcgaacggcggcgaggacaccgtcgggcag6960 ctcgtcggacaccaccgacgccgccccgtccacgatgatcatctggccggccttgatgaa7020 cgcgctgaagacgatctccatcaccttcgggttgccgccgcagcgggccgcccagcgcag7080 gacggaggcgtccggccgggcgccgaggatgccggcgcacaggtcggccaccgcctcctc7140 gcccggctcgcgcagccgtacccgtaccgcgacgtgctcggccagccagtcgacggcgtg7200 ctgagcgatcgacccggcggcgaccggccggcgggccagcagccagagcaccggcgagga7260 cgccaggcgcggcacgagcccgcgcagggccagggcgctgacgtcgtcgatgcgctgggc7320 gtcgtccagggcgaccacgagcgggcgccggcgcgccgcgacctcgaccagatcgccgac7380 ccggtcgatcagccagaacgggttggcgcccggcagggcgagctgctcgaccgccgcttc7440 gccgggcatcgcgtggcgcaggaagttgacgagcaggtgtacgggcaccggctgatccgt7500 gacgcttgcccgcccggccaccactgtcagcccgcgggccgccgcctccaggccggtgac7560 cttcagcaggtgggtcttgccgatgccgaacggcccgtcgacgacgacgcagcccccgga7620 tccccgcatggtggcgtcgagcagttcccccaatgaggacaattcctgcccgcgccccgc7680 catgcgattcatgatgaccatcccgttttcctctgctgaatcgtccgacgtgcgccgcga7740 gccgatgtcccaccgcgttcgaccgtccgttctggacagttgaacgccggatcggggcgg7800 gctactcagttatacgggatctgcggccgttcgtcggcgacgtcgctggcagcgcgcact7860 actcgcgtgagtagtgggcagggtgtcaggccgcgattactgtcaggccatgccgggctc7920 ggcgtgccggcgcggacgaaatggcgacgccgatggggagatcggcgtcgtttccgcgcc7980 ggcgcaaaacgtccggaacggaatcgactaatcgccgctcgacgcgactggtccagcgaa8040 tccaggggagtccgagatgcgtgagtgtaatggtgaccgccgtcttgatcgggagacgcg8100 ggcatgaccgtcggatatctcgggacggtcaccgactcggcgcccgtcgacgccgcgctg8160 cgcgacttcttcgccgagcgccgcgccgaggcacgcgagctcggcgacgacttcgcggcc8220 ctggtcgccgagctggagagctacgtcctgcggggcggcaagcgcatccggcccgccttc8280 gcctggctgggctggatcggcgccggcggcgacccggaggacccggtggcgaccgcggtg8340 ctgaacgcctgcgccgggttcgagctgctgcacgcgtccggcctcatccacgacgacatc8400 atcgacgcgtcgcagacccgccgcggccatcccgccgcgcacgtcgcgtacgccgaacgg8460 catcgggcgcggcgcttctccggtgacccgggaacgttcggcaccggcaccgccatcctg8520 atcggagacctcgtcctgatctgggccgacgtcctggtccgcgcctccggcctgccggcc8580 gacgcgcacgtgcgggtctcgccggtgtggtcggcggtgcgctccgaggtcatgtacggc8640 cagctgctcgatctgatcagccaggtgagccggagcgaggacgtcgacgcggcgctgcgc8700 atcaaccagtacaagaccgcgtcgtacacggtggagcggccactgcagttcggcgcggcg8760 atcgccggcgcggacgacgacctcttcgcggcctaccgcgccttcggcgccgacgtgggt8820 attgccttccagctgcgcgacgacctgctcggcgtgttcggcgacccggtggtgacgggc8880 aagccgtccggcgacgacctgcgggagggcaagcggacggtcctgctcgccacggcgctc8940 aagcgcgccgacgaacgggacccggacgcggcggcctacctgcgggcgaaggtcggcacg9000 gacctcgcggacgaggagatcgcccgcatccgcgccatcttccgcgacgtcggcgcggtc9060 gaggagatcgagcggcagatctcgcagcgcaccgaccgggcgctggccgcgctggaggcg9120 agcagcgccaccgcccccgcgaagcatcagctcgccgacatggcgatcaaggccacccag9180 cgggcccagtgatgtccacggaaccggtgaccgtcgtcgcccgcggcgttctcgacggcc9240 ggggtgacgggccgggccgcctcggcaccggccgcgcccacggcaaggccatcctgctgg9300 gcgaacacgccgtcgtgtacggcgctccggcgctcgccgtcccggtgccgcaactgaccg9360 ccgtggccaaggcgcggcgggccggcggcgacggcggcgacgaggtctccttcgccatcg9420 ccgggctggagagcccggaggtgacgtcgcttccgaccgacggcctgcaacatctggtga9480 cggagttccggcagcgggccgccgtcaccgagccgatgcgcgtcgacgtgctcgtggact9540 gcgccatcccgcagggccgggggctcgggtcgagcgccgcctgcgcccgcgccgcggtgc9600 tggccctcgcggacgcgttcgaccgccgcctcgacgccgccacggtgttcgatctggtgc9660 agacctcggagaacgtggcgcacggccgggccagcggcatcgacgccctggccaccggtg9720 cgaccgcgccgctgatcttccgcaacggcgtgggccgggaactgccggtcgccatggcgg9780 gcgccgcgcg tgccgcgcga gggtcgggcc cggccggctt cgacgcggtg ctcgtcatcg 9840 ccgacagcgg cgtcagcggc agcacccggg acgcggtgga gctgctgcgg ggtgccttcg 9900 agcgctcccc gcgcacgcgc gacgagttcg tcagccgggt gaccagcctg accgaggcgg 9960 cggcgcacga cctgctccag ggccgggtcg ccgacttcgg cgcgcggctg accgagaacc 10020 accggctgtt gcgcgaggtc ggcatcagca ccgaacggat cgaccggatg gtcgacgccg 10080 cgctcgcggc gggcagcccg ggcgccaaga tcagcggcgg tggcctgggc ggctgcatga 10140 tcgcactggc ccgggaccgc caggaatccg cggcggtggt gcggagcgtc cagcaggccg 10200 gcgccgtccg cacctggacc gtcccgatgg ggaggttcac cggccatgac gactgaccac 10260 cgggcggagc cgtccgagcc ggcgctcgac cggcccgcga ccgccgtggc ccatccgaac 10320 atcgcgctga tcaagtactg gggcaagcgc gacgagcagc tgatgatccc gtacgccgac 10380 agcctgtcga tgacgctcga cgtcttcccg accaccacca ccgtccggat cgacagcggc 10440 gcggcggccg acgaggtcgt cctcgacggc tcgcccgccg acggcgaacg gcgacagcgc 10500 gtcgtcacct tcctggacct ggtacgcaag ctggccgggc gcacggaacg ggcctgcgtc 10560 gacacccgca actccgtgcc caccggcgcc ggcctggcgt cctcggcgag cggattcgcc 10620 gCCCtCgCCC tCgCCggCgC CgCCgCgtaC ggCCtCgaCC tggaCaCCaC CgCgCtgtCC 10680 cgcctggccc ggcggggatc cgtgtcggcc tcccggtcgg tcttcggcgg cttcgcgatg 10740 tgccacgcag gccccggcgc cgggaccgcc gcggacctcg gctcctacgc cgagccggtg 10800 cccgtcgcgc ccctcgacgt cgcgctggtg atcgcgatcg tcgacgccgg gccgaaggcg 10860 gtgtcgagcc gcgaggggat gcggcgaacc gtccggacct ccccgctcta tcagtcgtgg 10920 gtcgcctccg gccgcgccga cctggccgag atgcgggccg cgctgctcca gggagacctg 10980 gacgcggtcg gcgagatcgc cgaacgcaac gccctcggca tgcacgccac catgctggcc 11040 gcccggccgg cggtgcgcta cctggcgccg gtcactgtcg ccgtgctcga cagcgtgctg 11100 cgcctgcgcg ccgacggcgt ctccgcctac gccacgatgg acgcgggacc gaacgtcaag 1116c) gtgctctgcc gccgcgcgga cgccgaccgg gtcgccgaca ccctgcgcga cgccgcgccg 11220 agctgcgccg tggtcgtcgc cggaccgggg ccggcggccc ggccggaccc gggcagccgg 11280 ccgtgaccgg cccgggcgcc gtgcgccgcc acgcgccggg caagctgttc gtcgccggtg 11340 agtacgcggt gctggagccg ggccacccgg cgctgctggt ggcggtcgac aggggagtgg 1140() acgtcaccgt ctccggcgcc gacgcccacc tcgttgtcga ctccgacctc tgcccggagc 11460 aggcgtgcct gcggtggcag gacggccggc tcgtcggcgc gggcgacggg cagccggcgc 11520 ccgacgccct cggcgccgtg gtctcggcga tcgaggtggt cggcgaactc ctgaccggac 11580 gagggctgcg cccgctgccc atgcgggtgg cgatcaccag ccggctgcac cgcgacggca 11640 cgaagttcgg cctcgggtcg agcggggcgg tgacagtcgc cacggtgacc gcagtggccg 11700 cgtaccacgg ggtggagctg tcgctcgaat cgcggttccg gctggcgatg ctggcgacgg 11760 tgcgtgacgg cgccgacgcc tccggcggtg atctggccgc gagcgtctgg ggcggctgga 11820 tcgcctacca ggcgcccgac cgcgcggccg tgcgcgagat ggcgcggcgg cgcggcgtcg 11880 aggagacgat gcgcgcgccc tggccgggcc tgcgggtccg gcggctgcca ccaccgcgtg 11940 gcctcgcgct ggaggtgggc tggaccggcg agccggcgag cagcagctcg ttgaccgggc 12000 ggctggccgc ctcccggtgg cggggcagcc cggcgcggtg gagcttcacc agccgtagcc 12060 aggagtgtgt gcgtaccgcc atcgacgcgc tggagcgggg cgacgaccag gaactgctgc 12120 accaggtccg gcgggcccgg cacgtgcttg ccgagctgga cgacgaggtc cggctcggga 12180 tcttcacccc ccggctgacg gcgctgtgcg acgccgccga gaccgtcggc ggcgcggcca 12240 aaccgtccgg cgccggtggc ggggactgcg gcatcgcgtt gctggacgcc accgccgcga 12300 cgcggaccgc gcggctgcgc gagcagtggg ccgccgccgg ggtgctcccc atgccgatcc 12360 aggtccatca gacgaacggg agcgcgcgat gatcgccaac cgcaaggacg accacgtccg 12420 gctcgccgcc gagcagcagg gccggctcgg cggtcaccac gagttcgacg acgtgtcctt 12480 cgtgcaccac gccctggccg gcatcgaccg gtccgacgtc tcgctggcca cgtcgttcgg 12540 cggcatcgac tggccggtgc cgctgtgcat caacgcgatg accggcggca gcaccaagac 12600 cggcctgatc aaccgggacc tggcgatcgc ggcccgggag accggcgtac cgatcgccac 12660 cgggtcgatg agcgcctact tcgccgacga gtcggtggcc gagagtttca gcgtgatgcg 12720 ccgggagaac cccgacgggt tcatcatggc caacgtcaac gccaccgcct ccgtcgaacg 12780 ggcccggcgg gctgtcgacc tgatgcgggc cgacgcgctg cagatccacc tgaacaccat 12840 ccaggagacg gtgatgccgg agggggaccg gtcgttcgcc gcctgggggc cgcggatcga 12900 acagatcgtc gccggcgtcg gtgtgccggt gatcgtcaag gaggtcggct tcgggctcag 12960 ccgcgaaacg ctgctgcggc tgcgggacat gggcgtccgg gtggccgacg tcgccggccg 13020 cggcggcacg aacttcgcgc gcatcgagaa cgaccggcgg gacgccgccg actactcctt 13080 cctcgacggg tggggacagt cgacacccgc ctgcctgctg gacgcccagg gcgtggacct 13140 gcccgtgctg gcctccggcg gcatccgcaa cccgctcgac gtggtccgcg ggctggcgct 13200 cggcgccggc gcggccgggg tgtccggact gttcctgcgc acgctcctgg acggcggcgt 13260 gccggcgctg ctgtcgctgc tgtccacctg gctcgaccag atcgaagccc tgatgaccgc 13320 cctgggcgcg cggaccccgg ccgacctgac ccgctgcgac ctgctgatcc agggtcggct 13380 gagcgcgttc tgcgcggccc ggggcatcga cacccaccgc ctcgccaccc gttccggcgc 13440 cacccacgag atgatcggag gcattcgatg aacgacgcga tcgccggtgt gcccatgaaa 13500 tgggtaggtc ccgtgcggat ctcgggaaac gtggcgcaga tcgagacgga ggttccgctc 13560 gccacgtacg agtcgccgct ctggccgtcc gtcggccggg gcgcgaagat ctcccggatg 13620 gtcgaggcgg gcatcgtcgc cacgctcgtc gacgagcgca tgacccgctc ggtgttcgtg 13680 cgcgccaagg acgcgcagac cgcctacctg gcctcgcttg aggtcgacgc gcggttcgac 13740 gaactgcgtg acatcgtgcg cacctgcggc aggttcgtcg agctgatcgg gttccaccac 13800 gagatcaccg cgaacctgct gttcctgcgg ttcagtttca ccaccggcga cgcgtccggg 13860 cacaacatgg cgacgctggc cgccgacgcg ctgctgaagc acatcctgga caccattccg 13920 ggcatctcgt acggctcgat ctcgggcaac tactgcaccg acaagaaggc caccgcgata 13980 aacggcattc tcggccgggg caagaacgtg gtcaccgagc tggtcgtgcc gcgggagatc 14040 gtccacgaca gcctgcacac gacggcggcg gcgatcgccc agctgaacgt gcacaagaac 14100 atgatcggca cgttgctcgc cggcggtatc cgctcggcca acgcccacta cgcgaacatg 14160 ctgctcgggt tctacctggc cacgggtcag gacgccgcga acatcgtcga gggctcccag 14220 ggcgtgacgg tcgccgagga ccgcgacggc gacctctact tctcctgcac gctgcccaac 14280 ctgatcgtgg gcaccgtcgg caacggcaag gggctcggct tcgtcgagga gaacctggag 14340 cggctcggct gccgcgcctc gcgtgatccg ggcgagaacg cccggcggct cgcggtcatc 14400 gcggccgcga cggtgctctg cggcgagctg tccctgctcg ccgcgcagac caacccgggc 14460 gagctgatgc gggcgcacgt ccggctcgaa cgcccgaccg agaccacgaa gatcggagcc 14520 tgacgatggc cgagagaccc gccgtcggca tccacgacct gtccgccgcg acggcgcatc 14580 acgtgctgac acacgagacc ctggccgcga gcaacggcgc cgacgtggcc aagtaccacc 14640 gtggcatcgg gctgcgggcg atgagcgtgc ccgccccgga cgaggacatc gtgacgatgg 14700 ctgctgccgc cgccgcgccg gtggtcgccc gccacggcac cgaccggatc cggaccgtcg 14760 tgttcgccac ggagtcgtcg gtcgaccagg cgaaggcggc cgggatacac gtccactccc 14820 tgctcggcct cccctcggcc acccgggtgg tcgagctgaa gcaggcctgc tacggcggta 14880 cggcgggact gcagttcgcc atcggcctgg tgcaccgtga cccgtcgcag caggtcctgg 14940 tgatcgccag cgacgtgtcg aagtacgcgc tgggtgagcc cggcgaggcg acccagggcg 15000 ccgcggcggt cgccatgctc gtcggcgcgg acccggcgct ggtacgcgtc gaggacccgt 15060 cgggcatgtt caccgccgac gtcatggact tctggcggcc gaactaccgc accaccgccc 15120 tggtcgacgg gcacgagtcc atctccgcct acctgcaggc gctggagggc tcgtggaagg 15180 actacaccga gcgcggcggt cgcaccctgg acgagttcgg cgcgttctgc taccaccagc 15240 cgttcccgag gatggccgac aaggcgcacc ggcacctgct caactactgc gggcgcgacg 15300 tcgacgacgc gctggtggcc ggggccatcg ggcacaccac cgcgtacaac gccgagatcg 15360 gcaacagcta cacggcgtcg atgtatctcg ggctcgcggc actgctcgac accgccgacg 15420 acctgaccgg ccggaccgtc ggcttcctca gctacgggtc cggcagcgtc gccgagttct 15480 tcgccggcac tgtcgtgccc gggtaccgcg cgcacacgcg acccgaccag caccgcgcgg 15540 cgatcgaccg gcggcaggag atcgactacg cgacgtaccg ggagttgcac gagcacgcct 15600 tcccggtcga cggcggcgac tatccggcgc cggaggtgac caccgggccg taccggctgg 15660 ccgggctctc cggtcacaag cgcgtctacg agccgcgata ggaccggcca cgccggccgc 15720 cctgaccgaa cgaaccatgc ttggaggatc gatgtccgga actcccgagg tggccgagct 15780 ctactcgacc atcgaggaat cggcccggca actggacgtg ccgtgttcgc gcgaccgggt 15840 ctggcccatc ctgtccgcgt acggcgacgc gttcgcccat cccgaggcgg tggtcgcctt 15900 ccgggtggcg accgcgctgc gtcacgcggg cgagctggac tgccggttcc ggacgcatcc 15960 ggacgaccgg gacccgtacg cctcggcgct cgcccggggc ctcaccccgc gcacggacca 16020 ccccgtcggc gcgctgctct ccgaggtcca ccggcgctgc ccggtggaga gccacggcat 16080 cgacttcggg gtggtcggcg gcttcaagaa gatctacgcg gccttcgccc cggacgagct 16140 gcaggtggcc acgtcgctcg ccggcattcc ggcgatgccc cgcagcctcg ccgcgaacgc 16200 cgacttcttc acccggcacg gcctcgacga ccgggtcggc gtgctgggat tcgactaccc 16260 ggcccggacc gtgaacgtct acttcaacga cgtgccgcgt gagtgcttcg agccggagac 16320 catccggtcg acgctgcgcc ggaccgggat ggccgagccg agcgagcaga tgctccggct 16380 cggcaccggg gcgttcgggc tctacgtcac gctgggctgg gactccccgg agatcgagcg 16440 gatctgctac gccgcggcga ccacggacct gaccacgctt ccggtacccg tggaaccgga 16500 gatcgagaag ttcgtgaaaa gcgttccgta cggcggcggg gaccggaagt tcgtctacgg 16560 cgtggcgctg acccccaagg gggagtacta caaactcgag tcgcactaca aatggaagcc 16620 gggcgcggtg aacttcattt gaacagcggc cggttccgcc gcccgggcgg cggaaccggg 16680 atcaatgcct gttcgctcgg gttcaacact ggcgcgctcc gctaaagtgc gaacatgacg 16740 actggactgt ccagtgtgtg ggcccgggtg aagaactggg tcgtcgcgtt ggctgtggcg 16800 gcggtgctga tgatcagcgc gctggccggt gaccatcctg cccccgaggg cctcggtctg 16860 ctcggcttcg cgctggtggc ggcgagcggc ctggcgctgg ccgccagtcg tcgggccccg 16920 atcgccgtgc tggtcgccac cgggctgtgc gtggtgggct acaacgcgat cggcttcggg 16980 gtgcccgcca tcgcgtacct gttcgcggtc tacgcggcgg tccgggccgg gcaccggctc 17040 gtcacgctcg gggcgagcgc cgccctgctc gtcgtcctgc cgctggcgat catggtctcg 17100 cccgcggacg gcgccctcaa ggaggcgctc gcgcagtcgc ggggcgtgct ggaactggcc 17160 tggctgatcg ccgcggcggc ggccggtgag gcgctgcggc aggccgaacg gcgagcggac 17220 gaggcggaac ggacccgcga ggagaccgcc cggctgcgcg ccacccagga gcggctgcac 17280 atcgcacggg agctgcacga ctcgctcacc caccagatct cgatcatcaa ggtgcaggcg 17340 gaggtggcgg tccacctggc ccgcaagcgg ggcgagcagg tgccggagtc gctgctggcg 17400 atccaggagg ccggccgggc ggcgactcgc gagctgcgcg cgaccctgga gacgctgcgt 17460 gacctgacca agtccccgtc gcacgggctc gaccacctcc cggagctgct ggccggggcc 17520 gagaagatcg gcctggccac cacgctgacc atcgagggcg acCagcggga cgtgccggag 17580 gcggtgggcc gcaccgcgta ccggatcgtg caggagtcgc tcaccaacac cgcccggcac 17640 gcctccgccg cggccgccgc ggtccggatc gactaccgcc cggacgcgct gagcatccgg 17700 atcgacgacg acgggacggc ccggccgggc gccgccccgg tgcccggcgt cgggctgctg 17760 gggatgcacg agcgcgtcct cgcgctgggc ggccggctgc gggcggaacc ccgcaccggc 17820 ggaggcttca ccgtccaggc cgaactcccg gtggtgcgcg tcccatgatc aggatcatgc 17880 tgctcgacga ccagccgctg ctgcgcagcg ggttccgcgc gctcctcgac gccgaggacg 17940 acatcgaggt ggtggccgag ggcgggaacg gccgggaggg cctggcgctg gcccggcagc 18000 acctgcccga tctcgccctg atcgacatcc agatgccggt catggacggc gtcgagacga 18060 cccggcagat cgtcgcggat ccggcgctgg ccggggtacg cgtcgtcatc ctcaccaact 18120 acggcctcga cgagtacgtc ttccacgcgc tgcgcgccgg cgccaccggc ttcctggtca 18180 aggacatcga gccggacgac ctgctgcacg ccgtgcgggt cgccgcgcgc ggtgacgcgc 18240 tgctcgcgcc gtcgatcacc cggatgctga tcaacaggta cgtgtcggag ccgctctgcg 18300 cggacgtcac gcccggcatg gaggagctga ccaaccggga acgcgaggcg gtcgccctgg 18360 ccgcccgggg cctgtccaac gacgagatcg ccgatcgcat ggtgatcagc ccgctgaccg 18420 cgaagaccca cgtcaaccgc gccatgacca agctgcaggc ccgcgaccgc gcccagctgg 18480 tggtgttcgc ctacgagtcc ggcctggtgt cacccggcaa tcgctgaccg ggcagcccgc 18540 ccggtctgtc gcctcggcag tgctgcggct gcggtatgcg gctgctcccg gcgcagacgc 18600 cggagcccgt ggataccgtc accgcagtag atcgatcgat tgtctccttc ggcatgacga 18660 cccgtagcgg ggtcgttacc tacgctggcg cagatgcctg ttcccgcagc cgaaggggct 18720 tccatgttca tccgtcgttt gctcaccgcc gccgcagccg gcgtcctcgg tgggctcgca 18780 ctcgtcgcac cggcggccgc gcaggtgacg gccgccgacg gtgacggtgg ttccggccgc 18840 gccggatccg tgctggcgct cgcgctcgcg ttgctcggcc tcgtcctggg cgggtgggcg 18900 ttgcgctccg cggggcgcgg cggcggtcgt ggcaacgcga tcgccgcgct ggtgctcgcg 18960 ~l gtggccggcc tgatcgccgg cgtggtcgcc ctggccggct ccgacggtgg tgtcggcagc 19020 ggcaacggcc gtggtggcgc catcgtggcc gtcgtgctgg cgctgatcgg gatcgccgtc 19080 ggcggcctgg cattcacccg ctcccggcgc gccgcctgac cggcgctgcc gaccgaacac 19140 cccggtgacc caaccgaacc cgaaggggag tcccatgcgc aaagtgttcg ccggactggc 19200 agcgttcctg ctgctcgtgc tcgtggtgca gttcttcctg gccgccagcg gcgcgttcag 19260 caacgaggcc aacgaggagg cgttccgccc tcaccggatc ctgggcctgg ggagcatcct 19320 cgtcgccgtg gtgctgacgg tggccgccgc ggtgatgcgg atgcccggcc ggatcatcgg 19380 cctgtccggc ctggtcgccg ggctgggcat cctgcaggcc ctgatcgcgg tcatcgccaa 19440 ggcgttcggc gactcggccg gtgactcggc cgtcggccgg tacgtgttcg gcctgcacgc 19500 ggtcaacgga ctggtgatgg tggccgtcgc ccgcgtcatc ctgcgcagcg tccgggcggc 19560 gccggacacg accaccacgc ccggcgtgga cacgacggtc accggtccgg cggccgactc 19620 ggcgcgaacg gcgtcatgag cacgctccaa tggatcctcg tggaccacgt cgtggcgctg 19680 ctcggtgtcg cgacgtggtt cgcaacgggt gtcacggcag ctctcggccg ccaccggatc 19740 gcgttggcgc tcctcggcgc cgcggtgctg gtgacagtcg cccgcctggg caccgtggcg 19800 ctgctggccg accgcggctg gtggttcgtc caggagaagg ttctgctggg gctgccgatg 19860 ctcggcgccg cggggctcgt cgcggtgctc ctggccggcc cgcgcctgct cgcggcccgg 19920 cagtcaccgg cggcggacct gccggccggc gcgctggtcg cggtgctgac cgccggcttc 19980 gccgcgctgg ccggcctggt ggtgacgttc accgccgggt acccgctgac gtggagcacc 20040 gcgctgatcg ccgtcgccct cgtctgcgcc gccgcgctgc tcaccgcgcg ggtggtcgga 20100 cgacccgccg ccccggccgc ggaggccggc tccccggagc acacgccggc ggcggccggg 20160 cccacggcgc tgtcccgccg ccggttcctc ggcgtggccg ggggagtggt cgcggcgggc 20220 gccggcgcca ccggcgtcgg cctgctcttc cgcgacccgg aggcgatggt caccggaggc 20280 ggccccggac acgccggtgg cgcccgcccc aaggtctccg tggcggacct gcgcggcccc 20340 ggcgctccgg cggcgggcgg cacggcgcga cgccacgtgc tcaccgcccg gacgggcacc 20400 gtcacgattc cgtccggacg tccgatcgac gcctggagct acgagggccg cctgcccggg 20460 ccggccatca ccgcgaccga gggcgacctg atcgaggtga cgctccgcaa cgccgacatc 20520 gaggacggcg tcaccgtgca ctggcacggg tacgacgtgc cgtgcggcga ggacggcgcg 20580 ccgggcgcca cgcagcacgc ggtgcagccc ggcggcgagt tcgtctaccg gttccaggcg 20640 gaccaggtgg ggacgtactg gtaccacacc caccaggcgt cgcaccccgc cgtgcgcaaa 20700 gggctgtacg ggacgctcgt cgtgacgccg cgcgaggacc ggccggaagc ggagcgcggg 20760 ctggacctga cgctgccggt gcacacgttc gacgacgtca cgatcctcgg cgaccaggag 20820 ggacgcgccg tccacgacgt ccgccccggc cagccggtgc gactgcgtct gatcaacacc 20880 gactccaacc cgcactggtt cgccgtcgtc ggctcgccct tccgcgtggt ggccgtcgac 20940 ggccgcgacc tcaaccagcc gggcgaggta cgcgaggtcg ggctccgcct gcccgccgga 21000 ggccggtacg acctgaccct ggccatgccg gacgccaagg tcacgctgct gctcgacaac 21060 gactccgacc agggcgtcct gctgcgcccg ccgggcgtcg gcggtggtga ccgcccgctg 21120 ccggacaccg ccgactggcc cgagttcgac ctgctgggct acggcgagcc ggcgcccgtg 21180 ccgttcgacg ccgacgacgc cgaccgccac ttcaccatcg tcctcgaccg ggccctggcc 21240 atggtcgacg gcaagcccgc gtacgcccag accgtcgacg gtcgcgcaca tccctccgtc 21300 cccgaccagc tcgtccggga gggggacgtc gtgcgcttca cggtggtcaa ccggagcctc 21360 gaaacccacc cgtggcacct gcacggccat ccggtgctga tcctgtcccg cgacggccgg 21420 ccgtactccg gcagcccgct gtggatggac accttcgacg tgcggccggg agaggtgtgg 21480 gaggtggcgt tccgggcgga caatccgggt gtctggatga accactgcca caacctgccg 21540 caccaggagc agggcatgat gctgcggctc gtctacgacg gtgtcaccac gcccttcgcc 21600 agcacgagcc acgcacactg aggggactcg catgaccgca gacctgcacg gcctggccag 21660 cgtccgctac atcgtcgacg acgtgtcggc ggcgatcgag ttctacacca cccacctggg 21720 tttcacggtg tcgaccgcgt tcccgccggc cttcgccgac gtggtgcgcg ggccgctgcg 21780 gctcctgctg tccgggccga ccagctcggg cgcccgggtc accccggcgg acgcggccgg 21840 gtgcgggcgc aaccgcatcc acctgatcgt cgacgatctc gacgccgaac gggagcggct 21900 ggagcgcgcc ggggtgacgt tgcgcagcga cgtcgtggcc gggccgggcg gccgtcagtt 21960 cctgatcgcc gacccggcgg gcaacctggt cgaggtgttc gagccggcag cccgcggctg 22020 aaccgccgac ggacgccctc ccacctcgcg acgcccgaag cccgacacct ggccgcgtcg 22080 cggccacgat caccgtggcc gcgacgcggt gacggggtgc cttaccgggg cggggtgggc 22140 gcggcgagcc gcgcggccag gatggagatg atcacggcgc cggcgatcac gtgggtgccg 22200 gcgaggacga gctgcgtcga caccggggtg tcccgggcga aggcgggcgc ggcgagggac 22260 agcacggtga acgcgacggt gccggccacg aaggcacgca cgggccgccg ggcccgccgc 22320 gccacgacca ccgccaggac gattccgccg atcgaccaga gcacgacgct gcgggcgatg 22380 gcccccaccg ggatcgcctg cgcctgctcc tcccagacgc cggccgcctc catcggtacg 22440 ccgaagcccc gggcggcgag cgtgaacgcc tccgcggcca cggccccggc gagggtggcc 22500 agcacgccga ccagccacac cggagcggtg gccggcgacc aggtgggccg tgccgcgacg 22560 ggagttcggg gagtggcctc atccacggcg tcgcctccgg tcgggtgcct cgatgtgttc 22620 tcgggagaat gcggggacgc cacgacggca gtcaacatgg acagttgaac gccctggcgt 22680 cacgggcggt tcccgcgccg gcccgccgcc tcggccgcgg cggcggccgt gccgtcggcg 22740 agcagggaga ccagcaggtc gcccaggatc cgtgggccgt gctgggtgag gacggactcc 22800 aggtggaact ggacggaacg gaatcccggg ccgcgcagcg cgtgcacgtc cccgctgtcc 22860 gggctgcggc tgatctcgat cgggccccgc cggccaccgg ccaccacgtc gtgcgcggag 22920 cgggcggtgt aggtgttgta gaaccccacg agttccggcc ggccgaacag gtcgatccgc 22980 ttctgcacac cctggttggg caccgcgcgc cgggcgaggg ggaaccccag ttcggcggcg 23040 agcacctggt ggcccaggca gatggacagg aacggcaccg ttccggcgag caggtcgcgg 23100 gtgagcccgc gcagggtccg catacgcggg tcggtcaggt cgcccgggtc gccggggccg 23160 ggaccgacga cgacgaggtc gtgtccgtcc ggccgcagcc ggctgtcgaa ccgggcgatg 23220 ctcgaccgca gcccgagggc ccgcaactgg tggtcgagca tggccatgaa cgtgtcctcg 23280 ttgtcgacga cgagcacgcg gcgtccggtc agcgccgggt tcggggtgcg ccgctccgcg 23340 ccgtcgagcc agaacctcga cagtgtggtg ttgcgctcgc gcaacgcccg ccgtacccgg 23400 gggtcggtgg ccagggacga acgagcccgc gcggccgtgg tccgcccgcc gtccgggccg 23460 tccgggtcga cgccgaggcc gagcgccgcg cgcatggcgc ccgccttggc ccgcgtctcg 23520 gccacctccg actccggctt ggagtcccgc acgagggtgg cgccgacgcc caggcgcagc 23580 gtgcccgcgt cgtcgatctc ggcggtgcgg atcatgatgg ccgagtcgag cgtacggctg 23640 ccggccgagt cacggcccat caacgcgagc acgccgccgt agtagccgcg gccggtcgtc 23700 tcgtggcggg tgatgacccg gaacgcgttc tcgatcgggc tgccggtgac cgtcggcgcg 23760 agcagggtct cccgcagcac gtcgcgcacg tccaggtcgc tgcggccggt caggatgtac 23820 tcggagtgcg tcacccgcgc catttccttg aggaacgggc cgtgcacctg gccgccggag 23880 gcgcacatcc gcgccatcat tttcagttcc tcgtcgacga ccatgtagag ttcgttagcc 23940 tctttcgggt cgttcaggaa ttccagcaga ccggaaacgg ccgggccgtt cggggggtgc 24000 cggtaggtcc cgctgatggg attcatcgag acggttccgt cgatcatgct gacgtgtcgt 24060 tccggtgacg cgccgatgaa cgtgccggcg ccggagtgga acagaaacgt ccagtaggaa 24120 cccagttcgc cggtcagcaa ccggcggaag agcgccagtt ccgtggcgat cgagtagtcg 24180 gccagccgcg cggtgaaggt gcgccggatg acgaagttgg atccggcgcc cagcccgatc 24240 tcgtcaccca ccacccgctt gacgatcgcg gcgtagtcct cgtcgctgag gtcgaagtcg 24300 gcgtcggtca ccggcacacc gcgttcgggc aggcccgcca gcgcctgtcc gcggtcgagc 24360 ccgaactgct cgtggacgcg catcgcgagc agcggcgcgc cgtcgtcgtg gcagtcgaac 24420 ccccgttcgg tgacctgccg gtacggcacc gccacgagca ggtcgtgccg cgcgccggtc 24480 gccggctcgg tgggcagggg cagctcgccg agagtgtcca cgtcgcacac ctcgccggtc 24540 agaacctcca cgtacgcgca cccggccgcg ccgggccggt gcagcagggc gaaggcgcgc 24600 ccgtcgccgc cgagaccgga cagcagatcg gggaatccgg tcacgttcga ttccgtcccg 24660 tccatgtcgc tccctttgcc tgagagatcg cctgtcgata ctgcgtccgg caaaaggcgt 24720 cgcacatgac gtgaagtcgc cgacggcatc acgtgtttcc ggtaacgcgc cgacgttatg 24780 gcgtgaacga ctgaatcggc gggctactac tcgggcgagt agtgcccacg cagatcgacc 24840 gcgattactg tcgaccgcaa tgccgatacg acgagggcgg tgaagacgac tgtggacgtg 24900 ctggtccaga aatacggggg cacctcgctg cagaccctcg accgcgttcg gcacgccgcg 24960 ctgcggatcg ccgaggcgcg gcggcacggc tccgccgtga cagtggtcgt gtcggcgcgc 25020 ggcagccgga ccgacgacct gctgcggctg gcggccgacg tcggcgccgc gggtccgtcc 25080 cgggaactcg accagttgct cgcagtcggc gagtccgagt cggcggcgct gatggcgctg 25140 gcgttgaccg ggctgggagt gccggccgtc tcgctgaccg ggcaccaggc ggagatccac 25200 accaccgacc ggcacggcga cgcgctgatc tcgcggatcg gggcggcgcg ggtggaagcg 25260 gcgctgggcc gtggcgaggt cgccgtggtc accggattcc agggcatcga ccgggccggt 25320 gacgtcgcca cgctggggcg cggcggctcc gacacgacag cggtggcgct cgcggcccgg 25380 ctccgcgcgt cggcgtgcga gatctacacc gacgtggacg gcgtcttcag cgccgacccc 25440 cgcatccttc cggcggcgcg ttgcctgccg tgggtggagc ccggcgtcat ggcggagatg 25500 gcgttcgccg gcgcgcgggt cctgcacacc cgatgcatcg agctggccgc catggaaggg 25560 gtcgaagtgc gcgtgcgcaa cgcgtcgtcg caggcgcccg gaacgatagt cgtggaccgg 25620 cccgacgacc ggccgctgga gacccggcgg gccgtggtgg cggtcaccca cgacaccgat 25680 gtcgtccgcg tgctggtgca ctgccgcgac ggccgccggg acatggcacc cgacgtgttc 25740 gaggtgctgg ccgcccatgg ggcggtggcg gacctggtgg cccggtccgg gccctacgag 25800 agcgagttcc ggatggggtt caccatccgc cgcagccagg ccgaagcggt gcggaccgcg 25860 ctgcacgacc tcaccgcgtc cttcgacggc ggggtccact tcgacgagaa cgtcggcaag 25920 gtgtccgtgg tcggcatggg cctgctcagc cgccccgagc acacggcccg gctgatggcg 25980 gcgctggccg cggcggggat ctcgacgagc tggatctcca cctcccagat gcggctgtcg 26040 gtgatcgtgt cgcgggaccg caccgtcgac gccgtcgaag ccctgcaccg cgcgttccgc 26100 ctggaccggt ccgagccggc ggacgccacg tccctgacct cccgccgttc cgccaccgcc 26160 tgagagaggt aggaaaccgt ggccgtactc aacgcttcgt tcgctcgtgg cctgcgtctg 26220 cgccgactgt tccgacgcgg cgacggacgc ctgctcgtcg tcccgctcga ccactccgtc 26280 accgacgggc cgctgcgccg cggcgacctg aactcgctgc tcggtgagct cgccggcacc 26340 ggcgtggacg ccgtggtgct gcacaagggc agcctgcggc acgtcgacca cggctggttc 26400 ggcgacatgt cgctgatcgt gcatctgagc gtgagcaccc ggcacgcccc ggacccggac 26460 gcgaagtacc tggtcgcgca cgtggaggag gcgctgcggc tgggcgccga cgcggtcagc 26520 gtgcacgtca acctcggctc accgcaggag gcgcggcaga tcgccgacct ggcggcggtg 26580 gcgggggagt gcgaccgctg gaacgtcccg ctgctggcca tggtgtacgc ccgcgggccg 26640 cagatcaccg actcccgggc accggagctg gtggcgcacg ccgcgacgct cgccgcggac 26700 ctcggcgccg acatcgtcaa gaccgactac gtgggcacgc ccgagcagat ggccgaggtg 26760 gtgcgcggct gcccgatccc gctgatcgtg gccggcggcc cgcgctcggc cgacactccg 26820 acggtgctcg cctacgtctc ggacgcgctg cgcggcggcg tggccgggat ggccatgggc 26880 cgcaacgtgt tccaggccga gcagcccggc ctgatggccg ccgccgtggc acggctggtg 26940 cacgagccac ggcacgtgcc ggaccggtac gacgtcgacg accggctcgc ccttacgtcc 27000 tgagactccc tgaccgtcca ccgaggagaa acccgtgaag ctgtgctggc tggacatccg 27060 taacgtcaac ggcgccaagg aggcaatcgt cgaggaggcg gtccaccagc gggtggacgc 27120 cgtcgtggcg gccgatccgg ccgacctgga gacgcttccc ccgacggtga agaaggtgct 27180 gttcccgcag ggcgggccgc tgccggagaa gctggaaccg gccgacctgg tgatcgtcga 27240 gccggcccgg cacggcgagc ccgccgagct ggcggcccgg tacccggagg tggagttcgg 27300 ccggttcgtc gagatcgtcg acgcggacag cctggaggac gcctgccggt ccgcgcgcca 27360 cgaccggtgg agcctgctgt acttccgcga ccccaccaag atcccgctgg agatcgtgct 27420 ggcggccgcg gcgggcgcgg agggcagcat catcacccag gtcgccgacg tcgaggaggc 27480 ggagatcgtc ttcggcgtcc tggagcacgg ctcggacgga gtgatgctgg cgccccgcgc 27540 cgtgggggag gccaccgagc tgcggaccgc cgcggtgagc acggcggcgg acctgtcgct 27600 cgtggagctg gaggtcaccg gcatccggcg ggtgggcatg ggcgagcgcg cctgcgtcga 27660 cacgtgcacg aacttccgtc tggacgaggg catcctggtc ggctcgcact ccaccggcat 27720 gatcctgtgc tgcagcgaga cgcatccgct gccgtacatg ccgacccggc cgttccgggt 27780 caacgccggc gcgctgcact cgtacacgct ctccgccggc gggcggacca actacctcag 27840 cgagctggtc tccggcggcc gggtgctcgc cgtggactcg caggggaagt cccgcgtcgt 27900 cacagtggga cgggtcaaga tcgagacgcg tccgctgctg gcgatcgacg cggtctcccc 27960 ctccgggaca cgcgtcaacc tcatcgtcca ggacgactgg cacgtgcgcg tgctcgggcc 28020 gggcggcacc gtgctcaacg tgaccgagct gaccgccggc acgaaggtgc tcggttacct 28080 gccggtggag aagcggcacg tcggctaccc gatcgacgag ttctgcatcg agaagtgaca 2814() ggcggcggga aggggagcgg gcgatgaccg cgcagccggt gctggacttc cacgtacgcc 28200 tggcgccccg gcccggggcg cgggagcggc tgctcgccgc gctgcgcgag tgcgggctgg 28260 cgcgggcggt ggtgtgcgcg ggcggcacca tcgacctgga ccggctgtcc cgccagctcg 28320 tcaccggcgg ccacgtcgag accgacgccg acaacgacgc ggtggcggcg gcctgcgccg 28380 gcaccgacgg ccggctggtg ccgttcttct tcgccaaccc gcaccggccg gccgaggcgt 28440 accgggcccg cgccgccgag ttccgcggcc tggagatctc acccgccgtc cacggcgtcg 28500 ccctgaccga cccgcgggtc gccgacctcg tggccgtggc ggcggagttc gaccatccgg 28560 tgtacgtggt ctgcctggac cgacccggcg cgggcgtggc cgacctggtc ggcctgagcc 28620 gccggttccc gcaggtgagc ttcgtgctcg ggcacagcgg cgtcggcaac atcgacctct 28680 acgccctgac cctgatccag gacgagccga acatctcgct ggagacctcc ggcggctaca 28740 cctgcgtggc cgaggcggcg ctacgccgcc tcggcgacga ccgggtggtg ttcggctccg 28800 agtacccgct gcagcacccg gccgtggaac tggccaagtt ccaggcgttg cgactgccgc 28860 cggagcggtg gcggcggatc gcctgggaca acgcgcatcg actgctagga gaggagaagc 28920 ggtgagcgag ccaagttcga gcctgccccg gctcggccag tggcacggcc tcgaggacct 28980 gcggcgcctc caggagaagc aactggcgga gacgttcacc tgggcggccc ggtcgccgtt 29040 ctaccgggcg cggctggcct ccggcgcgcc gccggtgacg cccgccgacc tggccgacct 29100 gccgctgacc accaagcagg acctgcggga caactacccc ttcggcatgc tcgccgtgcc 29160 ccgcgaacgg ctggcgacct accacgagtc gagcgggacc gccgggaagc ((a(((cct( 29220 ctactacacc gcggaggact ggaccgacct ggcggagcgc ttcgcccgca agtggatcgg 29280 catgtccgcc gacgacgtct tcctggtccg cacgccgtac gcgctgctgc tgaccgggca 2934() tctcgcccac gccgcagccc ggctgcgtgg ggccacggtg gtacctggcg acaaccggtc 29400 gctggcgatg ccgtacgccc gggtggtccg ggtgatgcac gacctggacg tcacgctcac 2946C
ctggtcggtg ccgacggagt gcctgatctg ggccgccgcg gcgatcgcgg ccgggcaccg 29520 gcccgacatc gacttcccgg cgctgcgcgc gctgttcgtc ggcggcgagc cgatgaccga 29580 cgcccgccgg cggcggatca gccgcctgtg gggggtgccg gtcatcgagg agtacggctc 29640 gacggagacc ggcagcctgg ccggggagtg ccccgaggga cgcctgcacc tgtgggccga 29700 ccgggcgctg ttcgaggtgt acgacccgga caccggcgcc gtccgcgcgg acggcgacgg 29760 ccagctcgtg gtcacgccgc tgttccggga ggcgatgccg ctgctgcggt acaacctgga 29820 ggacaacgtg tcggtctcct acgacgactg cggatgcggc tggaagctgc ccaccgtgcg 29880 ggtgctcggc cggtcggcgt tcggctaccg ggtcggcggc accaccatca cccagcacca 29940 gctggaggaa ctggtcttct ccctgccgga ggcgcaccgg gtgatgttct ggcgggccaa 30000 ggcggagccg gcgctgttgc gggtcgagat cgaggtggcc gccgcgcacc gggtcgccgc 3006() cgaggcggag ctgaccgccg cgatccgggc cgccttcggc gtggacagcg aggtcaccgg 30120 cctggcgccg ggaaccctga tcccgctcga cgcgctgacc agcatgccgg acgtggtgaa 30180 gccacgcagc ctgttcggtc cggacgagga ctggagcaaa gcgctcctct actactgagg 30240 gaaccgacat gccgcagatg agggtcgccg tggccggcgc cggcatcgcc gggctcgcct 30300 tcgccgccgc cctgcgccgg accgggatcg actgccacgt gtacgaacag gccgaccagc 30360 tcatggaggt gggcgcgggc gtgcaggtcg cgccgaacgc cacccggctg ctgcaccggc 30420 tgggcctgcg tgaccgcctg cgtacggtgg ctgtcgcgcc gcaggcgatc gagatgcgcc 30480 gctgggacga cggcacgctg ctgcaacgca cccagctggg cagcgtgtgc ggacgccgct 30540 tcggcgcgcc gtactacgtg gtgcaccgcg cggacctgca cagcagcctg ctgtcgctgg 30600 tgccgccgga ccgggtgcac ctgggcgccc gcctcaccgc cgtgacgcag accgccgacg 3066() aggcgtacct gcacctgtcc aacggcacca cggtcgcggc ggatctcgtc gtgggcgccg 30720 acggcatcca ctcggtcgcg cgggagcaga tcgtggcgga ccggccgcgc ttctccggac 30780 agtccatcta ccgcgggctg gtgccggccg agcgggtgcc gttcctgctc accgaacccc 30840 gggtgcagtt gtggttcggg ccggaccagc actgcgtctg ctacccggtg tccgccggcc 30900 ggcaggtgag cttcggcgcg acggtgcccg ccaccgactg gcggcaggag tcgtggtcgg 30960 gccggggcga cgtgacgcaa ctcgcggccg cgtacgcggg ctggcacccg gacgtcaccc 31020 ggctgatcgc cgcggccgac cgggtcggca ggtgggcgct gcacgaccgg gacagcatcg 31080 accggctcag cgcgggacgg gtgaccctga tcggcgacgc cgcgcacccg atgctgccgt 31140 tccaggcgca gggcgcgaac caggccgtcg aggacgcggt ggtgctcgcg gtctgcctgg 31200 ccggcgtgga accggcgggc ctgggcgccg cgctgcgccg ctacgaacgg atccgcctgc 31260 cccggaccac ccggatccag cggcagtccc gggccaacgc cgagatgttc cacctggccg 31320 acggcgccga ccagcgccgc cgggacgtcg ccgcacaatc ctcgtccggc ctggaccgcc 31380 acgaatggct cttcgggtac gacgccgaga aagccaccac gaccagcggg agcgcctgat 31440 ggaactgacc ggaatcgagt cgaaggtcgc cctggtcacg ggcgcggggc agggcatcgg 31500 cgccgccgtg gccggtgtcc tggcgagggc gggcgcgcag gtggcggcgg tggaccgcaa 31560 cgccgaggcg ctgaccaccg tcgtgacgaa gctcgccgcc gagggcgact cggcgcgcgc 31620 ctactgcgtc gacgtgtgcg acagcgaggc ggtggacgcg ctggtgcgcc gggtcgagga 31680 cgagatgggg ccggtcgcca tcctggtcaa cgccgccggc gtgctgcaca ccggacgggt 31740 cgtcgagctg tcggaccggc agtggcgccg gaccttctcg gtgaacgccg acggcgtgtt 31800 ccacgtgtcc cgggcggtgg cgcggcggat ggtgggccgc cgtcgtggcg cgatcgtcac 31860 cgtggcgtcg aacgccgccg gggtgccgcg taccgagatg gccgcgtacg ccgcctccaa 31920 ggccgcgtcc gcgcagttca cccgctgcct ggggcttgag ctgtccggct acggcatccg 31980 gtgcaacgtg gtctcgcccg gctccaccga cacccccatg ctgcgggcca tgctcggcga 32040 gggcgccgac ccgagcgcgg tgatcgaggg cacgccgggc gcgtaccgcg tcggcatccc 32100 gctgcgcaag ctggcccagc cgcgcgacgt ggccgaggcg gtcgcctatc tggtgtccga 32160 ccaggcgggc cacgtgacca tgcacgacct gtacgtcgac ggcggcgcgg ccctgcacgt 32220 gtgacgccct cgcacggaaa ccggaggcga gaaccgatgg ccatgacccc gatcgcgccg 32280 taccgcatgc ccggcgacgg cgacctgccc ggcaccgcgc tgccctggcg tccgcacccg 32340 gaccgggccg ccgtgctggt gcacgacctg caacgctact tcctgcgccc gttcgaggcc 32400 ggggagtccc cgatggccga actgctcccc aacgtcgcga agctgctcgc cacggcgcgg 32460 gcggccggcg tgccggtgct gtacaccgcg cagcccggcg gcatgagccg gcaggaccgc 32520 gggttgctgc acgacctgtg gggccccggc atgagcagcg ccgaggacga ccggggcatc 32580 gtcgacgacg tcgccccgca gccgggcgac acggtgctga ccaagtggcg ctacagcgcg 32640 ttcttccgca gcgacctgga ggagcgactg cgcggtgcgg gacgggacca gctcgtggtc 32700 tgcggcgtgt acgcgcacat ggggtgcctg atcaccgcct gcgacgcgtt cagccgcgac 32760 atcgaggcgt tcctggtggc ggacgcgctg gccgacctat cgcgcgagga ccacctgatg 32820 gcgctgcgct acgccgcgga ccgctgcgcg gtgccgttgt ggacggcgga tgtgctggac 32880 gggctggcgg acgccgccgg gcgtccggat cagagcagca cccaacgatg aggagaacat 32940 cgatgtcgga tcggacccgg gtcgtggtcg tcggcggaac ctcggggatc gggcggcact 33000 tcgcccgatt ctgcgccgaa cgcggagacg acgtggtgat caccggccgt tcggcggccc 33060 ggaccaagac cgtggcggac gagatcggcg ggcggacccg tgggctcgct ctcgacctgg 33120 ccgagccgga gacgatcgcg gacgcgctcg ccgacgl=gcc gcacgtcgac cggctcgtgg 33180 tcgcggcgct ggaccgcgac tacaacaccg tccgcgcgta ccggccgggc gacgcggcgc 33240 ggctgctgac cgtcaagctg gtcggctaca cggcggtcct gcacgccctc gccccgcgga 33300 tgaccgacga gagcgcagtc gtgctgctcg gcggcctggc cagccaccgg ccgtatcccg 33360 gctccacctc cgtcacgacc gccaacggcg ggatcagcgc gctggtgcgg accctggctg 33420 tggaactctc gccggtccgg gtcaacgccc tgcacccgag catcgtctcc gacacgccgt 33480 tctggagcga caagcccgcc gcgcgggagg ccgccgcgac ccgcgcgctc agccgacggc 33540 cggtcaccat gcaggactgc gccgaggcga tcgacttcct gctgacgaac cgctcgataa 33600 acggggtcaa cctgaacatc gacggcgggg acgtgctcat ctgacgccgg aggcgatccg 33660 ccacggcccc caccacccgg tcgcgccctg cccgtgctcc cgctgctcgc gggggtaccg 33720 ggccaggtcg cgggcggaga agagcgccat gccggcgtgg aatccggtca ccggcaccgg 33780 gacccgcgcc cagtaggcga gccggccgtc gacgtggaac tccacctccg acgtcggcgc 33840 ccggtaggtg atggcgtatc cgtgcgcccg gcccggctcc gtcggcacgt ccaggaccac 33900 ccggtggatg tagtgctcgt gcggctgggt cacgccgggc agcaccaggc gctcgaccgt 33960 cgcgtacacg gtgtcgttcg tggcggcggc gttgaacacg acgccggtct ccaggtcgaa 34020 caggttcacc gtgccgaacg cgtccagcag gtcgtgcggg atctgccggt acgtccgcac 34080 gcccatctcc acctcgacgg tcagcgagcc ctccgccggc acggcgaagc gccgcaccga 34140 ccggtacatc tgcttggcgt tgttctgccg gggatcggtg tcgtggaagc gggtgaacgg 34200 gtcgacggtc agctccagcc gcccgtcgcc ggtgcggacc tgggcgttgc ggtcctggta 34260 cctgtgggtc tgcccgtccg cgccggcgat cgacatgatc gcccagcggg cggggtccag 34320 ctcgcggctg gtgaagtcgt cgtacgtcca cgcgctggtt ctcagtgccg acgtcatgca 34380 gtcaccatcg gacgccggcc gggcgcgggc atcacccgtt cacgcggttc ggccggaccc 34440 ggcacgccaa tgcgccggcc acgccccgga aatcccgtga ttaagccatg ccggagcgtg 34500 aacggtcgcc gagactgacg ccgcacccat ctccgcatcg tctgcgacgt tctcaccagg 34560 gggagagagc aatggacacg gcagctccgg caacggacgg cggtcgctac ctcgccgtcc 34620 atcacagcgc agagttcagg gaactacggc gacgatcgag cacgttcacg ctctgggcca 34680 gcgtcgcctt cttcggctgg tggttcctcg gcagcctgct cgccacctac gcgccggact 34740 tcttccggga gaaggtggcc ggcccggtca acgtgggtct gctcttcgtc ttcctgtcgt 34800 tcgccttcgt ggtgacgctc gccgccttct acctgcgtta cgcccgcacg catctcgatc 34860 cgctcagcga gaagatccgt gccgacctgg aaggagcgtc ccgatgagcg tcatcctcgc 34920 cgacccgcca cccccggtcg acaacacgtg ggcgacgccc gcgatcgccg tgccggtcac 34980 catcgtcctc gcgctcgcgg tgctctacct ggtccggtcg gcgcgcgcca gcaccaccac 35040 cgcggacggc ttcctgctgg ccgaccggcg gatcgggccg gtgcagaacg cgctggcggt 35100 ggcctccgcg ccgctgatgt actcgacgat gtacatcatc accggccaca tcgcgctcag 35160 cggctacgac gccatcctgc tgatgaccgc cttcaccatg ggcaccatgc tcgcgctgtt 35220 cctcttcgcc gggccggtgc gcaacgtggg cggctar_acg ctcggtgacc tgctcgcggt 35280 ccgtacccgg gagcggccgg cgcggatcgc gtcggcggtg ctcacgctgc tgacgtacgt 35340 catgctgacg gtgatcatga tggccgccat cgcgttcatc ttcaaccgct ggttcggcgt 35400 cgacgccctc gtcggcctgg tcctcccggt gttcgtcgtc ggtctgatca cggtggggta 35460 cgtgtacctc ggcgggatgc tcggggtcac ccgcatcctg gtgttcaagc tggtgctgtc 3552() ggtggtcgtc gtgggcgtgc tgaccgcctg ggtgctggcc cgcttcgacc tgaacctctt 35580 cagcctgctg gagcgggccg aggcgaacgc ggcgccggtg cccagcggca gcgacctgct 35640 gggcccgggc cggctgttcg gcgagggcgc gaccacgctc gtgcacctgt cgaagctgtt 35700 cgccatcgcc gtcggagtgg cggccattcc gttcctgttc atgcgcaact tcgcggtgac 3576() cagcgggcgg gacgcgcgcc ggtcgaccgg gtgggcgtcg atgatcatcg tcgggttcta 35820 cctgtgcctg tccgtcgtcg ggctcggtgc cgtcgcgatc ctcggccggg acaacatcgg 35880 cgtcatcaag gcccaccgcg acatcagctt ccccaagctc gccgacgagc tcggcggtcc 35940 ggtgatggtc ggctccctgg ccggcgtcgc ggtcctgacg atcgtcggcg tcttcgcgcc 3600() gctgctgcac agcgccgtga cgacggtgac caaggacctg aacgtgatcc gcggccggcg 3606() gctggatccg gccgccgagc tgcgggacat caagcgcaac accctgatca tcggcgtcgg 36120 ctccgtgctg ctggcggtcg tgatgctgcc ggtacggacc cacatcttca tcccgacctc 36180 gatcgacatt gccggcgcgg tggtcctgcc gatcgtc:gtc tacgcgttgt tctggcggcg 3624() tttcaacacc cgcggactgc agtggacggt ctacggcggc ctcgcgctca ccgcgttcct 36300 ggtgctgttc tccaacggtg tctcgggcga gccggacgcc atcttcccgg accgcaactt 36360 caagttcgtg gacgtcgagc ccgcgctgat cacggtgccg gtcggcttcc tgctcggcta 36420 cctcggctcg atcaccagcc gggagcgcga cgacgccgcg ttcgccgaga tgcaggtccg 36480 gtccctcacc ggagctgtcg tcacgggacc gccgcggccg gccgccgtgg acgacgagga 36540 ccgcgacggc cgccaggacc gggcgcccag cccggtgagc tgaacatccg caacggtgtg 36600 gg 36602 SEQ ID NO: 2 LENGTH: 571 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 2 Val His Asn Leu Asp Asn Ile Pro Ser Ser Pro Ser Thr Ser Gly Gly Ser Leu Pro Ala Gly His Arg Ala His Val Arg Ala Asp Gly Val Arg Val Val Arg GIy Gly Arg Val Val Leu Ser Asp Val Ser Val Thr Val Ser Ala Ala Ser Arg Leu Ala Val Val Gly Glu Asn Gly Arg Gly Lys Thr Thr Leu Leu His Val Leu Ala Gly Leu Ile Ala Pro Asp Gln Gly Val Val Glu Arg Leu Gly Thr Ile Gly Val Ala Arg Gln Asn Leu Glu Ser Arg His Gly Glu Thr Val Gly Thr Leu Val Arg Glu Ala Ile Arg Glu Ser Glu Arg Ala Leu Arg Ala Leu Asp Glu Ala Thr Ile Ala Leu Thr Glu Gly Arg Ala Gly Ala Asp Asp Ala Tyr Ala Ala Ala Leu Asp Ala Ala Thr Arg Leu Asp Ala Trp Asp Ala Gln Arg Arg Val Asp Val Ala Leu Ala Gly Leu Asp Ala Cys Pro Asp Arg Asp Arg Gln Leu Ala Thr Leu Ser Val Gly Gln Arg Tyr Arg Val Arg Leu Ala Cys Leu Leu Gly Ala Arg Val Asp Leu Leu Met Leu Asp Glu Pro Thr Asn His Leu Asp Ala Asp Ser Leu Ala Phe Leu Thr Ala Arg Leu Arg Asp His Pro Gly Gly VaI Val Leu VaI Thr His Asp Arg Ala Leu Leu Arg Asp Val Ala Thr Glu Phe Leu Asp Leu Asp Pro Ser Ala Asp Gly Arg Pro Arg Arg Tyr Ala Gly Asp Tyr Val Ala Trp Gln Asp Gly Arg Arg Arg Asp Phe Ala His Trp Val Arg Asp His Glu Ala Gln Gln Ala Glu His Gln Arg Leu Ala Asp Gly Val Arg Glu Ala Arg Asp Arg Leu Ser Thr Gly Trp Arg Prc Glu Lys Gly His Gly Lys His Gln Arg Gln Ser Arg Ala Pro Gly Leu Val Gln A1a Leu Arg Arg Arg Gln Glu Ala Leu Asp Ala His Arg Val Thr Val Pro Glu Pro Pro Gln Pro Leu Arg Trp Pro Pro Leu Asp Thr Arg Ala Gly Leu Pro Ile Leu Arg Cys His Asp Val Thr Val Ala Gly Arg Leu Arg Thr Arg Val Thr Leu Thr Leu Asp Gly Gly Asp Arg Leu Leu Val Thr Gly Pro Asn Gly Ala Gly Lys Ser Thr Leu Leu Ser Val Leu Ala Gly Asp Leu Thr Pro Ser Thr Gly Glu Val Arg His Leu Ser Gly Ala Arg Val Ala Tyr Leu Gly Gln Glu Val Pro Asp Trp Pro Pro Ala Leu Leu Ala His Asp Leu Tyr Glu Gln His Val Gly Arg Leu Arg Ser Ser Gly Arg Val Gly Ser Gly Thr Ala Leu Pro Leu Ser Ala Thr Asn Leu Leu Asp Ala Glu Ala Arg Arg Thr Pro Val Gly Arg Met Ser His Gly Gln Gln Arg Arg Leu Asn Leu Ala Leu Arg Leu Ala Glu Arg Pro Asp Leu Leu Ile Leu Asp Glu Pro Thr Asn His Leu Ser Ala Fro Leu Val Asp Asp Leu Thr Ala Ala Leu Leu Thr Thr Arg Ala Ala Val Val Val Ala Thr His Asp Arg Gln Met Leu Gln Asp Leu AIa Ala Trp Pro Thr Leu Pro Leu Thr Ala Pro Ala Ala Ser Gly Arg Ser Val Thr Ser Glu Arg Tyr Asp Trp Glu Ser N0:

LENGTH: 716 TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:3 gtgcacaacctcgacaacattccttcctccccatccacctcgggcggttcgctgcccgcc60 gggcaccgggcgcacgtgcgggccgacggcgtccgcgtcgtacgcggcggccgggtcgtg120 ctgtccgacgtcagcgtgaccgtctccgccgcttcccgcctcgcagtcgtcggcgagaac180 ggccgcggcaagaccaccctgctgcacgtgctggccggcctcatcgcgcccgaccagggc240 gtggtggaacggctgggcacgatcggcgtcgcccggcagaacctggagtcgcgccacggc300 gagacagtgggcacgctcgtccgggaggcgatccgggagtccgaacgcgcgctgcgggcg360 ctcgacgaggcgacgatcgcgctcaccgagggccgggcgggcgcggacgacgcgtacgcg420 gccgcgctcgacgcggcgacccggctggacgcctgggacgcgcagcggcgcgtcgacgtg480 gcgctggccggcctcgacgcgtgcccggaccgggaccggcagctggccacgttgtccgtc540 ggccagcgctaccgggtacggctggcgtgcctgctgggagcgagggtcgacctgctgatg600 ctggacgagccgacgaaccacctcgacgccgacagcctggccttcctcaccgcccggcta 660 cgcgaccacccgggcggcgtcgtgctggtgacccacgaccgcgccctgctgcgggacgtc 720 gccacggagttcctggacctcgaccccagcgcggacgggcgcccgcgccgctacgccggg 780 gactacgtcgcctggcaggacgggcgccgccgcgacttcgcgcactgggtacgcgaccac 840 gaggcgcagcaggccgagcaccagcggctggccgacggggtacgggaggcgcgggaccgg 900 ctcagcaccggctggcggccggagaaggggcacggcaagcaccagcgccagtcccgcgcg 960 cccggactggtccaggcgctgcgccgccggcaggaggcgctcgacgcgcaccgcgtcacc 1020 gtgccggagccaccgcagccgctgcgctggccgccgctggacacccgtgccggactgccc 1080 atcctgcgatgccacgacgtcacggtggccgggcgcctgcgtacccgggtcacgctcacg 1140 ctcgacggcggggaccgcctgctggtgaccggacccaacggcgcgggcaagtcgacgctg 1200 ctctccgtgctggccggcgacctcacgccgtcgaccggggaggtccggcacctgtccggc 1260 gcgcgcgtcgcgtacctcggtcaggaggtgcccgactggccgccggcgctgctcgcgcac 1320 gacctgtacgagcagcacgtgggccggctccgctccagcgggcgcgtcggctccggcacg 1380 gccctgccgctgagcgcgacgaacctgctcgacgccgaggcccggcgtacccccgtcggc 1440 cggatgtcgcacggacagcaacggcggctgaacctggcgctgcgcctggccgaacgtccc 1500 gacctgctgatcctcgacgaaccgacgaaccacctgtcggcgccgctggtcgacgacctc 1560 accgccgccctgctgacgacccgggcggcggtggtcgtcgccacccacgaccggcagatg 1620 ctccaggacctcgcggcctggcccacgctgccgctcacagccccggcggcgtcaggtcgt 1680 tcggtcacttccgagcgatatgactgggagtcataa 171c;

SEQ ID NO: 4 LENGTH: 689 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 4 Met Thr Thr Gly Arg Pro Gly Glu Asn Arg Ala Thr Asp Ala Ala Arg Asn Pro Gly Trp Ala Ala Gly Gly Pro Ala Ser Gln Pro Trp Gly Gly Gly Asn Asp Glu Gln Val Leu Arg Glu I1e Leu Gly Val Asp Val His Arg Glu Leu Ile Asp Phe Ala Gly Gly Ala Gly Gly Asn Pro His Leu Val Ala Glu Leu Ala Arg GIy Leu Ala Glu Glu Gly Leu Ile Arg GIu Thr Asn Gly Arg Ala Glu Leu Val Ser Arg Arg Ile Pro Arg Arg Val Leu Ser Phe Val Met Arg Arg Leu Asn Asp Val Ser Ala Gly Cys Gln Gln Phe Leu Lys Val Ala Ala Ala Leu Gly Arg Ser Phe Met Leu Glu Asp Val Ser Arg Met Leu Gly Arg Ser Ser Ala Ala Leu Leu Pro Pro Val Asp Glu Ala IIe Ala Ser Gly Phe Val Val Ala Ala Glu His Gln Leu Ala Phe Gln Ser Asp Phe Leu Leu Arg Gly Ile Ile Glu Ser Ile Pro Gly Pro Ala Arg Asp Ala Leu Arg Arg Glu Ala Met Ser Leu Ser GIy Arg Arg Arg Pro Ala Ala Asp Gln Asn Arg Arg Leu Asp Ala Ala Pro Thr Ala Pro Val Ser Ala Thr Gly Glu Asp Ala Thr Gly Ser Cys Ser Arg Ala His Arg Leu Ile Met Asn Gly Asn Ala Lys Ala Gly Ile Arg Val Ala Glu Ala Val Leu Ala Gly Pro Ala Ala Ser Leu Ala Ala Arg Arg Asp Ala Glu Ala Cys Leu Val Leu Ala Asp Leu Leu Leu Gly G1y Glu Gly Gly GIy Pro Met Thr Glu Ala Ile Leu Arg Glu Arg Asp Ala Glu Ser Gly Asp Ala Ala Leu Ala Met Ala Leu Thr Ala Arg Ser Thr Gly Leu Trp Ser Ala Gly Lys Leu Ala Glu Gly Leu Lys Leu Gly Arg AIa Ala Val Arg Ala Gly Ala Glu Ala Glu Pro Val Trp Arg Leu His AIa Gln Leu Ala Leu Ala Gly Lys Leu Ala Asn Leu Arg Glu Phe Asp Glu Ala Glu Ala Leu Ile Asn Glu Ala Glu Ala Gly Leu Arg Gly Leu Pro Ala Pro Ile Trp Thr Ala Ala Thr Ala Val Met Arg Ser Arg Leu Leu Leu Gln Ala Gly Arg Ile Gly Glu Ala Arg Arg Glu Ala Ala Leu Ala Thr Thr Ala Val Glu Gly Asp Ala Val Pro Met Leu Arg Pro Leu Ala Tyr Ala Val Leu Ser Thr Ala Ser Phe Tyr Met Gly Asp Leu Pro Ala Ala Ile Glu Tyr Leu Arg Arg Gly GIn Arg Asp AIa Asp Arg His Val Val Leu Asp Ser Val Gln Tyr Ser Trp Ala Glu Val Leu Ile Thr Val Lys Gln Glu Gly Pro Arg Ala Ala Ala Gln Leu Leu Ala Gly Lys His His Arg Leu Pro Thr Gln Arg Arg Leu Tyr Val Glu Val Pro Ser Ala Ala Ala Phe Leu Val Leu Leu Ala Arg Asp Val Asp Asp Arg Asp Leu Glu Arg Arg Val Leu Asp Thr Val Asn Gly Leu Ala Ala Asp Asn Pro Arg Ile Gln Val Val Ser Leu Thr Ala Met His Ala His Ala Leu Ala Asn Ser Ala Pro Ala Ala Leu Ala Leu Ile Ile Val Gln Ser Arg Asp Pro Ile Ser Val Ala Leu Ala Thr Glu Glu Leu Ala Lys Leu Tyr Ala Ala Gln Ala Gln Ala Gly Gly Arg Pro Ala Thr Pro Ala Arg Ala Glu Glu Ala Ala Thr Pro Pro Ala Ser Cys Trp Ser Thr Leu Ser Asp Met Glu Gln Arg Ile Ala Tyr Leu Val Ser Val Gly Leu Thr Asn Arg GIn Ile Ala Lys Gln Val His Leu Ser Ala His Thr Val Asn Tyr His Leu Arg Lys Ile Tyr Arg Lys Leu Gly Phe Asn Thr Arg Ala Glu Leu Ala His Ala Ala Ala Thr Tyr Ser Gly Arg Ala Ala Ile Tyr Ser Met Ser Giy Asp Gln Asp Trp Gly Ala Gly Ser Met Thr Gly Lys Ala Ser SEQ ID N0: 5 LENGTH: 2070 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE:5 atgacaacgggacggccgggggagaaccgggcgacagacgcggcacgaaatccggggtgg60 gccgccggggggccggcgtcccagccatggggcggggggaacgacgagcaggtcctgcgc120 gagatcctcggggtcgacgtgcaccgcgagctgattgacttcgcgggtggtgccggcgga180 aatccgcacctggtcgccgaactcgcgcgcgggctcgccgaagagggattgattcgggag240 acaaacggtcgggcggaattggtgtcccggcgaattccccggcgcgtgctgagttttgtc300 atgcgtcgattgaatgatgtcagcgccggctgccagcagttcttgaaggttgccgcggca360 ttgggcagatccttcatgctggaggacgtttcgagaatgctgggccgatcgtcggcggcc420 ctgctcccgccggtggacgaggcgatcgcatcgggcttcgtcgtcgccgccgagcatcaa480 ctcgcctttcagagcgacttcctgctgcgcggcatcatcgagtccattcccgggcccgcc540 cgcgacgccttacgacgtgaggcgatgagcctttccgggcgacggcgcccggcggccgac600 cagaatcgccggttggacgcggcgcctaccgcgccggtgagcgcgaccggggaggacgcc660 accggatcctgttcccgggcgcaccgcctgataatgaacgggaacgcgaaggccggcatt720 cgcgtcgccgaggcggttctcgccggcccggccgcgtcgctcgctgcccggcgtgacgcg780 gaggcgtgtctggtgctggccgatctgctgctcggcggggagggcggcggcccgatgacc840 gaggcgatcctgcgcgaacgcgacgccgagtccggtgacgccgcactggcgatggcgctg900 accgcccggtccaccgggctgtggtcggcgggaaagctggcggagggcctgaagctggga960 cgggcggeggtgcgggcgggcgcggaggccgaaccggtgtggcgtctgcacgcccagctc1020 gcgctcgccgggaaactcgcgaacctccgcgagttcgacgaggccgaggcgttgatcaac1080 gaggcggaagCgggCCtgCgcggactgcccgcgccgatctggacggccgcgacggcggtg1140 atgcggtcccggttgctgctccaggcggggcggatcggggaggcgcgtcgggaggcggcg1200 ctggccaccaccgccgtggagggggacgcggtgccgatgctgcggcctctcgcctacgcg1260 gtgctcagcaccgcctccttctacatgggggacctgcccgccgcgatcgagtacctcagg1320 cgggggcagcgggacgcggaccgccacgtggtcctcgactcggtgcagtactcgtgggcg1380 gaagtgctgatcacggtcaagcaggaaggcccgcgggccgccgcccagctgctcgcgggc1440 aagcaccaccgcctgcccacgcagcgccgcctctacgtcgaggtgccgagcgccgccgcc1500 ttcctggtcctgctcgcccgcgacgtggacgaccgtgacctcgaacgccgcgtcctcgac1560 acggtcaacgggctcgccgcggacaaccccaggatccaggtcgtcagcctcaccgccatg1620 cacgcccacgcgctggcgaacagcgctccggccgccctggcgctcatcatcgtgcagtca1680 cgggacccgatctcggtggcgctggccaccgaggaactcgccaagctctacgccgcgcag1740 gcccaggcgg ggggacggcc ggcgacgccg gcccgcgccg aggaggccgc caccccgccg 1800 gcgagctgctggtcgaccctgtccgacatggagcagcgga tcgcctacctggtgagcgtg1860 ggtctgacgaaccggcagatcgccaagcaggtccacctgt ccgcgcacaccgtcaactac1920 cacctgcggaagatctaccggaaactgggtttcaacaccc gggccgagctggcgcacgcc1980 gcggccacgtactccggccgggcggcgatctactccatga gcggcgaccaggactggggc2040 gccggatccatgaccggcaaggccagctga 2070 SEQ ID N0: 6 LENGTH: 895 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 6 Met Vai Ile Met Asn Arg Met Ala Gly Arg Gly Gln Glu Leu Ser Ser Leu Gly Glu Leu Leu Asp Ala Thr Met Arg Gly Ser Gly Gly Cys Val Val Val Asp Gly Pro Phe Gly Ile Gly Lys Thr His Leu Leu Lys Val Thr Gly Leu Glu Ala Ala Ala Arg Gly Leu Thr Val Val Ala Gly Arg Ala Ser Val Thr Asp Gln Pro Val Pro Val His Leu Leu Val Asn Phe Leu Arg His Ala Met Pro Gly Glu Ala Ala Val Glu Gln Leu Ala Leu Pro Gly AIa Asn Pro Phe Trp Leu Ile Asp Arg Val Gly Asp Leu Val Glu Val Ala Ala Arg Arg Arg Pro Leu Val Val Ala Leu Asp Asp Ala Gin Arg Ile Asp Asp Val Ser Ala Leu Ala Leu Arg Gly Leu Val Pro Arg Leu Ala Ser Ser Pro Val Leu Trp Leu Leu Ala Arg Arg Pro Val Ala Ala Gly Ser Ile Ala Gln His Ala Val Asp Trp Leu Ala Glu His Val Ala Va1 Arg Val Arg Leu Arg Glu Pro Gly Glu Glu Ala Val Ala Asp Leu Cys Ala Gly Ile Leu Gly Ala Arg Pro Asp Ala Ser Val Leu Arg Trp Ala Ala Arg Cys Gly Gly Asn Pro Lys Val Met Glu Ile Val Phe Ser Ala Phe Ile Lys Ala Gly Gln Met Ile Ile Val Asp Gly Ala Ala Ser Val Val Ser Asp Glu Leu Pro Asp Gly Val Leu Ala Ala Val Arg Gly Leu Leu Glu Glu Leu Pro Pro Pro Leu Arg Arg Leu Leu Ala Ala Gly Gly Arg Leu Gly His Thr Phe Pro Val Asp Arg Val Thr Gly Leu Leu Asp Gly Ser Ala Ala Asp Val Ser Ala Ala Ile Asp Glu Ala Val Arg Val Gly Leu Ile Arg Arg Asp Gly Ala Glu Leu Thr Phe Ala His Pro Val Leu Gly Glu Ala Leu Arg His Ala Ala Tyr Pro Glu Pro Glu Arg Ala Glu Pro Gly Ser Ala Pro Ala Pro Ala Ala Gly Asp Pro Val Arg Arg Gly Arg Pro Asp Pro Arg Pro Gly Thr Pro His Ser Pro Ala Gly Val Arg Val Thr Arg Ser Ala Pro Asp Ala Ala Thr Pro Ala Ala Thr Ala Gly Pro Arg Ser Gly Arg Cys Gly Cys Asp Asp Val Ala Ala Ala Ala Val Ser His Leu Glu Asn Gly Ser Ala Glu Ala Pro Arg Ala Leu Aia Arg Ala Leu Arg Leu Leu Ala Gly Ala Gly Arg Ala Ala Glu Ala Gly Arg Leu Ala Glu Val Met Leu Arg Arg Asp Leu Ala Ala Asp Val Glu Ala Gln Leu Val Leu Glu Leu Gly His Gly Met Arg Ala Ala Gly Ser His Arg Leu Ala Ala Gly Phe Leu Arg Arg Thr Gln Ala Arg His Asp Val Cys Glu Leu Asp Arg Ala Lys Leu Asp Arg Ala Leu Ala Asp Thr Thr Lys His Leu Gly Gly Ala Ser Ser Ala Glu Leu Glu Pro Arg His Gln Ser Pro Gly Cys Ala Pro Gly Arg Arg Pro Leu Trp Thr Trp Leu Val Arg Ala Leu Gly Ala Ala Asp Gln Leu Asp Glu Ala Glra Ala Val Leu Asp Thr Val Arg Pro Leu Ala Gln Glu Pro Ser His Thr Gly Ser Glu Ser Leu Trp Arg Gly His Arg Ala Glu Leu Leu Ala Ala Ala Gly Arg Leu Asp Glu Ala Arg Ala Glu Ala Glu Ala Ala Leu Arg AIa Ala Asp His Ser Arg Pro Gly Asp Cys Val Pro Ala Arg Leu Val Leu Ala His Leu Gly Val His His Gly Asp Leu Ala Thr Ala Ser Asp Gln Leu Arg Ala Ala Glu Arg Leu Ala Ser Ala Asp Asp Ser Ala Arg Met Asp Trp Ala Leu Ala Arg Phe His Ala Ala Ser Gly Arg Pro Ala Met Met Val Gln Thr Leu Ile Asn Val Ala Gly Gln Val Ala Pro Asp Pro Leu Leu Phe Thr Glu Ala Pro Ala Ala Ala Ala Thr Leu Val Arg Gln Ala Arg Arg Ala Gly Leu Asp Ala Glu Ala Glu Arg Ala Val Glu Val Ala Arg Arg Val Ala Arg Gly Asn Pro Phe Val Gln Ser Leu Ala Ala Ala Ala Glu His Ala Ala Gly Leu Leu Arg Asp Asp Pro Ala Ala Leu Leu Arg Ala Ala Asp Leu His Arg Leu Ala Gly Arg Thr Leu Ala Ala Ala Gly Ala Val Glu Asp Ala Ala Arg Ser Thr Arg Asp Arg Ala Glu Ala Thr Arg Leu Leu Glu Ala Ala Thr Asp Gly Tyr Arg Glu Cys Gly Ala Arg Arg Asp Leu Glu Arg Val Glu Ala Glu Leu Arg Gly Leu Pro Ala His Asn Val Arg Pro Leu Val Pro Asp Arg Pro Arg Ser Gly Trp Glu Ser Leu Thr Ser Ala Glu Leu Arg Val Val Arg Ala Ile Val Asp Gly Met Thr Asn Arg Glu Ala Ala Ser Ser~Leu Phe Leu Ser Pro His Thr Val Asp Ser His Leu Arg Arg Val Phe Ser Lys Leu Asp Ile Asn Ser Arg Val Glu Leu Thr Arg Cys Phe Ile Ala His Glu Ala Val Arg Pro Ala Leu Ala Thr Thr Arg Gln Pro Ala Ser Ala Gly SEQ ID NO: 7 LENGTH: 2688 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE:7 atggtcatcatgaatcgcatggcggggcgcgggcaggaattgtcctcattgggggaactg60 ctcgacgccaccatgcggggatccgggggctgcgtcgtcgtcgacgggccgttcggcatc120 ggcaagacccacctgctgaaggtcaccggcctggaggcggcggcccgcgggctgacagtg180 gtggccgggcgggcaagcgtcacggatcagccggtgcccgtacacctgctcgtcaacttc240 ctgcgccacgcgatgcccggcgaagcggcggtcgagcagctcgccctgccgggcgccaac300 ccgttctggctgatcgaccgggtcggcgatctggtcgaggtcgcggcgcgccggcgcccg360 ctcgtggtcgccctggacgacgcccagcgcatcgacgacgtcagcgccctggccctgcgc420 gggctcgtgccgcgcctggcgtcctcgccggtgctctggctgctggcccgccggccggtc480 gccgccgggtcgatcgctcagcacgccgtcgactggctggccgagcacgtcgcggtacgg540 gtacggctgcgcgagccgggcgaggaggcggtggccgacctgtgcgccggcatcctcggc600 gcccggccggacgcctccgtcctgcgctgggcggcccgctgcggcggcaacccgaaggtg660 atggagatcgtcttcagcgcgttcatcaaggccggccagatgatcatcgtggacggggcg720 gcgtcggtggtgtccgacgagctgcccgacggtgtcctcgccgccgttcgcgggctgctg780 gaggagctgccgcccccgctgcggcgcctgctcgcggccggcggccggctcggccacacg840 tttcccgtcgaccgggtgacgggcctgctggacggctcggccgccgacgtgtccgccgcg900 atcgacgaggcggtgcgggtcgggctgatacgacgcgacggcgcggagctgaccttcgcc960 cacccggtgctcggagaggcgcttcgccacgccgcgtacccggaaccggagcgtgccgag1020 cccggatccgcgccggcaccggcggcgggcgacccggtccggcgcgggcggcccgatccg1080 cggcccgggacgccccactcccccgccggcgtacgcgtcacgcgctccgcgccggacgcg1140 gccacgcccgccgcgacggcggggccgcgctcgggccggtgcgggtgcgacgacgtggcg1200 gcagccgccgtgtcccacctggagaacggatccgccgaggcgccacgagcactggcccgt1260 gcgctgcgcctgctggccggggcggggcgggccgccgaggccggccgcctcgcggaggtg1320 atgctccgccgcgacctcgcggcggacgtcgaggcgcagctcgtgctcgaactgggacac1380 gggatgcgggccgccggcagccaccgcctggcggccggcttcctgcgccggacgcaggcc1440 cgccacgacgtgtgcgagctggaccgcgccaagctggaccgggcgctcgcggacaccacg1500 aagcacctgggcggtgcctcctccgccgagctggagccccggcaccagtccccgggctgc1560 gcgcccggccggcggccgctgtggacctggctggtccgggcgctgggcgcggccgatcag 1620 ctcgacgaggcgcaggcggtgctggacaccgtacgaccgctggcgcaggagcccagtcac 1680 accggctcggagtcgctctggcgcggccaccgggccgagctgctggcagcggccggacgg 1740 ~ctggacgaggcacgcgccgaggcggaggcggcgctgcgagccgccgaccactcccggccg 1800 ggcgactgcgtgccggcgcgcctggtcctggcccacctcggcgtgcaccacggtgacctc 1860 gccacggccagcgaccagttgcgggcggccgagcggctggcctccgccgacgactcggcg 1920 cggatggactgggcgctggcccggttccacgctgccagcggccgtccggcgatgatggtg 1980 cagacgctgatcaacgtcgccggacaggtcgcacccgatccgctgctgttcaccgaggcg 2040 ccggccgctgcggcgacgctcgtacgccaggcccgccgggcggggctcgacgcggaggcc 2100 gagcgcgccgtggaggtcgcccggcgcgtcgcccgcggcaacccgttcgtccagtcgctg 2160 gcggcggcggcggaacacgccgcgggtctcctgcgcgacgatccggcggcgctgctgcgg 2220 gccgcggatctgcaccggctcgccggccgtacgctcgcggcggccggcgcggtggaggac 2280 gcggcccgcagcacccgggaccgggccgaggccacccgtctgctcgaggccgcgacggac 2340 ggctaccgggagtgcggcgcgcgacgcgacctggagcgcgtggaggccgagctgcgtggc 2400 ctgccggctcacaacgtccgcccgctggtccccgaccggccccggtcggggtgggagagc 2460 ctgaccagcgcggagctgcgggtcgtgcgggccatcgtggacgggatgaccaaccgcgag 2520 gcggcgagttcgctgttcctgtccccgcacaccgtcgacagtcacctgcggcgcgtcttc 2580 tccaagctcgacatcaacagccgggtggaactgacccgctgcttcatcgcgcacgaggcg 2640 gtccggccggcgctggccaccacacgccagccggcgtccgccggctga 2688 SEQ ID NO: 8 LENGTH: 362 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 8 Met Thr Val Gly Tyr Leu Gly Thr Val Thr Asp Ser Ala Pro Val Asp Ala Ala Leu Arg Asp Phe Phe Ala Glu Arg Arg Ala Glu Ala Arg Glu Lei. Gly Asp Asp Phe Ala AIa Leu Va1 Ala Glu Leu Glu Ser Tyr Val Leu Arg Gli~ Gly Lys Arg Ile Arg Pro Ala Phe Ala Trp Leu Gly Trp Ile Gly Ala Gly Gly Asp Pro Glu Asp Pro Val Ala Thr Ala Val Leu Asn AIa Cys Ala Gly Phe Glu Leu Leu His AIa Ser Gly Leu Ile His Asp Asp Ile Ile Asp Ala Ser Gln Thr Arg Arg Gly His Pro Ala Ala His Val Ala Tyr Ala Glu Arg His Arg Ala Arg Arg Phe Ser Gly Asp Pro Gly Thr Phe Gly Thr Gly Thr Ala Ile Leu Ile Gly Asp Leu Val Leu IIe Trp Ala Asp Val Leu Val Arg Ala Ser Gly Leu Pro Ala Asp AIa His Val Arg Val Ser Pro Val Trp Ser Ala Val Arg Ser Glu Val Met Tyr Gly Gln Leu Leu Asp Leu Ile Ser GIn Val Ser Arg Ser Glu Asp Val Asp Ala Ala Leu Arg Ile Asn Gln Tyr Lys Thr Ala Ser Tyr Thr Val Glu Arg Pro Leu Gln Phe Gly Ala Ala Ile Ala Gly Ala Asp Asp Asp Leu Phe Ala Ala Tyr Arg Ala Phe Gly Ala Asp Val Gly Ile Ala Phe Gln Leu Arg Asp Asp Leu Leu Gly Val Phe Gly Asp Pro Val Val Thr Gly Lys Pro Ser Gly Asp Asp Leu Arg Glu Gly Lys Arg Thr Val Leu Leu Ala Thr Ala Leu Lys Arg Ala Asp Glu Arg Asp Pro Asp Ala Ala Ala Tyr Leu Arg Ala Lys Val Gly Thr Asp Leu Ala Asp Glu Glu Ile Ala Arg Ile Arg Ala Ile Phe Arg Asp Val Gly Ala Val Glu Glu Ile Glu Arg Gln Ile Ser Gln Arg Thr Asp Arg Ala Leu Ala Ala Leu Glu Ala Ser Ser Ala Thr Ala Pro Ala Lys His Gln Leu Ala Asp Met Ala Ile Lys Ala Thr Gln Arg Ala Gln SEQ ID N0: 9 LENGTH: 1089 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 9 3s atgaccgtcggatatctcgggacggtcaccgactcggcgcccgtcgacgccgcgctgcgc60 gacttcttcgccgagcgccgcgccgaggcacgcgagctcggcgacgacttcgcggccctg120 gtcgccgagctggagagctacgtcctgcggggcggcaagcgcatccggcccgccttcgcc180 tggctgggctggatcggcgccggcggcgacccggaggacccggtggcgaccgcggtgctg240 aacgcctgcgccgggttcgagctgctgcacgcgtccggcctcatccacgacgacatcatc300 gacgcgtcgcagacccgccgcggccatcccgccgcgcacgtcgcgtacgccgaacggcat360 cgggcgcggcgcttctccggtgacccgggaacgttcggcaccggcaccgccatcctgatc420 ggagacctcgtcctgatctgggccgacgtcctggtccgcgcctccggcctgccggccgac480 gcgcacgtgcgggtctcgccggtgtggtcggcggtgcgctccgaggtcatgtacggccag540 ctgctcgatctgatcagccaggtgagccggagcgaggacgtcgacgcggcgctgcgcatc600 aaccagtacaagaccgcgtcgtacacggtggagcggccactgcagttcggcgcggcgatc660 gccggcgcggacgacgacctcttcgcggcctaccgcgccttcggcgccgacgtgggtatt720 gccttccagctgcgcgacgacctgctcggcgtgttcggcgacccggtggtgacgggcaag780 ccgtccggcgacgacctgcgggagggcaagcggacggtcctgctcgccacggcgctcaag840 cgcgccgacgaacgggacccggacgcggcggcctacctgcgggcgaaggtcggcacggac900 ctcgcggacgaggagatcgcccgcatccgcgccatcttccgcgacgtcggcgcggtcgag960 gagatcgagcggcagatctcgcagcgcaccgaccgggcgctggccgcgctggaggcgagc1020 agcgccaccgcccccgcgaagcatcagctcgccgacatggcgatcaaggccacccagcgg1080 gcccagtga 1089 SEQ ID NO: 10 LENGTH: 354 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 10 Met Ser Thr Glu Pro Val Thr Val Val Ala Arg Gly Val Leu Asp Gly Arg Gly Asp Gly Pro Gly Arg Leu Gly Thr Gly Arg Ala His Gly Lys Ala Ile Leu Leu Gly Glu His Ala Val Val Tyr Gly Ala Pro Ala Leu Ala Val Pro Val Pro Gln Leu Thr Ala Val Ala Lys Ala Arg Arg Ala Gly Gly Asp Gly Gly Asp Glu Val Ser Phe Ala Ile Ala Gly Leu Glu Ser Pro Glu Val Thr Ser Leu Pro Thr Asp Gly Leu Gln His Leu Val Thr Glu Phe Arg Gln Arg Ala Ala Val Thr Glu Pro Met Arg Val Asp Val Leu Val Asp Cys Ala Ile Pro Gln Gly Arg Gly Leu Gly Ser Ser Ala Ala Cys Ala Arg Ala Ala Val Leu Ala Leu Ala Asp Ala Phe Asp Arg Arg Leu Asp Ala Ala Thr Val Phe Asp Leu Val Gln Thr Ser Glu Asn Val Ala His Gly Arg Ala Ser Gly Ile Asp Ala Leu Ala Thr Gly Ala Thr Ala Pro Leu Ile Phe Arg Asn Gly Val Gly Arg Glu Leu Pro Val Ala Met Ala Gly Ala Ala Arg Ala Ala Arg Gly Ser Gly Pro Ala Gly Phe Asp Ala Val Leu Val Ile Ala Asp Ser Gly Val Ser Gly Ser Thr Arg Asp Ala Val Glu Leu Leu Arg Gly Ala Phe Glu Arg Ser Pro Arg Thr Arg Asp Glu Phe Val Ser Arg Val Thr Ser Leu Thr Glu Ala Ala Ala His Asp Leu Leu Gln Gly Arg Val Ala Asp Phe Gly Ala Arg Leu Thr Glu Asn His Arg Leu Leu Arg Glu Val Gly Ile Ser Thr Glu Arg Ile Asp Arg Met Val Asp Ala Ala Leu Ala Ala Gly Ser Pro Gly Ala Lys Ile Ser Gly Gly Gly Leu Gly Gly Cys Met Ile Ala Leu Ala Arg Asp Arg Gln Glu Ser Ala Ala val Val Arg Ser Val Gln Gln Ala Gly Ala Val Arg Thr Trp Thr Val Pro Met Gly Arg Phe Thr Gly His Asp Asp SEQ ID NO: 11 LENGTH: 1065 'TYPE : DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 11 atgtccacgg aaccggtgac cgtcgtcgcc cgcggcgttc tcgacggccg gggtgacggg 60 ccgggccgcctcggcaccggccgcgcccacggcaaggccatcctgctgggcgaacacgcc120 gtcgtgtacggcgctccggcgctcgccgtcccggtgccgcaactgaccgccgtggccaag180 gcgcggcgggccggcggcgacggcggcgacgaggtctccttcgccatcgccgggctggag240 agcccggaggtgacgtcgcttccgaccgacggcctgcaacatctggtgacggagttccgg300 cagcgggccgccgtcaccgagccgatgcgcgtcgacgtgctcgtggactgcgccatcccg360 cagggccgggggctcgggtcgagcgccgcctgcgcccgcgccgcggtgctggccctcgcg420 gacgcgttcgaccgccgcctcgacgccgccacggtgttcgatctggtgcagacctcggag480 aacgtggcgcacggccgggccagcggcatcgacgccctggccaccggtgcgaccgcgccg540 ctgatcttccgcaacggcgtgggccgggaactgccggtcgccatggcgggcgccgcgcgt600 gccgcgcgagggtcgggcccggccggcttcgacgcggtgctcgtcatogccgacagcggc660 gtcagcggcagcacccgggacgcggtggagctgctgcggggtgccttcgagcgctccccg720 cgcacgcgcgacgagttcgtcagccgggtgaccagcctgaccgaggcggcggcgcacgac780 ctgctccagggccgggtcgccgacttcggcgcgcggctgaccgagaaccaccggctgttg840 cgcgaggtcggcatcagcaccgaacggatcgaccggatggtcgacgccgcgctcgcggcg900 ggcagc~~cgggcgccaagatcagcggcggtggcctgggcggctgcatgatcgcactggcc960 cgggaccgccaggaatccgcggcggtggtgcggagcgtccagcaggccggcgccgtccgc1020 acctggaccgtcccgatggggaggttcaccggccatgacgactga 1065 SEQ ID N0: 12 LENGTH: 346 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 12 Met Thr Thr Asp His Arg Ala Glu Pro Ser Glu Pro Ala Leu Asp Arg Pro Ala Thr Ala Val Ala His Pro Asn Ile Ala Leu Ile Lys Tyr Trp Gly Lys Arg Asp Glu Gln Leu Met Ile Pro Tyr Ala Asp Ser Leu Ser Met Thr Leu Asp Val Phe Pro Thr Thr Thr Thr Val Arg Ile Asp Ser Gly Ala Ala Ala Asp Glu Val Val Leu Asp Gly Ser Pro Ala Asp Gly 65 70 75 g0 Glu Arg Arg Gln Arg Val Val Thr Phe Leu Asp Leu Val Arg Lys Leu Aia Gly Arg Thr Glu Arg Ala Cys Val Asp Thr Arg Asn Ser Val Pro Thr Gly Ala Gly Leu Ala Ser Ser Ala Ser Gly Phe Ala Ala Leu Ala Leu Ala Gly Ala Ala Ala Tyr Gly Leu Asp Leu Asp Thr Thr Ala Leu Ser Arg Leu Ala Arg Arg Gly Ser Val Ser Ala Ser Arg Ser Val Phe Gly Gly Phe Ala Met Cys His Ala Gly Pro Gly Ala Gly Thr Ala Ala Asp Leu Gly Ser Tyr Ala Glu Pro Val Pro Val Ala Pro Leu Asp Val Ala Leu Val Ile Ala Ile VaI Asp AIa Gly Pro Lys Ala Val Ser Ser Arg Glu Gly Met Arg Arg Thr Val Arg Thr Ser Pro Leu Tyr Gln Ser Trp Val. Ala Ser Gly Arg Ala Asp Leu Ala Glu Met Arg Ala Ala Leu Leu Gln Gly Asp Leu Asp Ala Val Gly Glu Ile Ala Glu Arg Asn Ala Leu Gly Met His Ala Thr Met Leu Ala Ala Arg Pro Ala Val Arg Tyr Leu Ala Pro Val Thr Val Ala Val Leu Asp Ser Val Leu Arg Leu Arg Ala Asp Gly Val Ser Ala Tyr Ala Thr Met Asp Ala Gly Pro Asn Val Lys Val Leu Cys Arg Arg Ala Asp Ala Asp Arg Val Ala Asp Thr Leu Arg Asp Ala Ala Pro Ser Cys Ala Val Val Val Ala Gly Pro Gly Pro Ala Ala Arg Pro Asp Pro Gly Ser Arg Pro SEQ ID N0: 13 LENGTH: 1041 TYPE: DNA
ORGANISM: Micromonospora sp. strain 045-ECO11 SEQUENCE: 13 atgacgactg accaccgggc ggagccgtcc gagccggcgc tcgaccggcc cgcgaccgcc 60 gtggcccatc cgaacatcgc gctgatcaag tactggggca agcgcgacga gcagctgatg 120 atcccgtacg ccgacagcct gtcgatgacg ctcgacgtct tcccgaccac caccaccgtc 180 cggatcgaca gcggcgcggc ggccgacgag gtcgtcctcg acggctcgcc cgccgacggc 240 gaacggcgacagcgcgtcgtcaccttcctggacctggtacgcaagctggccgggcgcacg300 gaacgggcctgcgtcgacacccgcaactccgtgcccaccggcgccggcctggcgtcctcg360 gcgagcggattcgccgccctcgccctcgccggcgccgccgcgtacggcctcgacctggac420 accaccgcgctgtcccgcctggcccggcggggatccgtgtcggcctcccggtcggtcttc480 ggcggcttcgcgatgtgccacgcaggccccggcgccgggaccgccgcggacctcggctcc540 tacgccgagccggtgcccgtcgcgcccctcgacgtcgcgctggtgatcgcgatcgtcgac600 gccgggccgaaggcggtgtcgagccgcgaggggatgcggcgaaccgtccggacctccccg660 ctctatcagtcgtgggtcgcctccggccgcgccgacctggccgagatgcgggccgcgctg720 ctccagggagacctggacgcggtcggcgagatcgccgaacgcaacgccctcggcatgcac780 gccaccatgctggccgcccggccggcggtgcgctacctggcgccggtcactgtcgccgtg840 ctcgacagcgtgctgcgcctgcgcgccgacggcgtctccgcctacgccacgatggacgcg900 ggaccgaacgtcaaggtgctctgccgccgcgcggacgccgaccgggtcgccgacaccctg960 cgcgacgccgcgccgagctgcgccgtggtcgtcgccggaccggggccggcggcccggccg1020 gacccgggcagccggccgtga 1041 N0:

LENGTH:

TYPE:
PRT

ORGANISM:Micromonospora sp. strain SEQUENCE: 14 Val Thr Gly Pro Gly Ala Val Arg Arg His Ala Pro Gly Lys Leu Phe Val Ala Gly Glu Tyr Ala VaI Leu Glu Pro Gly His Pro Ala Leu Leu Val Ala Val Asp Arg Gly Val Asp Val Thr Val Ser Gly Ala Asp Ala His Leu Val Val Asp Ser Asp Leu Cys Pro Glu Gln Ala Cys Leu Arg Trp Gln Asp Gly Arg Leu Val Gly Ala Gly Asp Gly Gln Pro Ala Pro Asp Ala Leu Gly Ala Val Val Ser Ala Ile Glu Val Val Gly Glu Leu Leu Thr Gly Arg Gly Leu Arg Pro Leu Pro Met Arg Val Ala Ile Thr Ser Arg Leu His Arg Asp Gly Thr Lys Phe Gly Leu Gly Ser Ser Gly Ala Val Thr Val Ala Thr Val Thr Ala Val Ala Ala Tyr His Gly Val Glu Leu Ser Leu Glu Ser Arg Phe Arg Leu Ala Met Leu Ala Thr Val Arg Asp Gly Ala Asp Ala Ser Gly Gly Asp Leu Ala Ala Ser Val Trp Gly Gly Trp Ile Ala Tyr Gln Ala Pro Asp Arg Ala Ala Val Arg Glu Met Ala Arg Arg Arg Gly Val Glu Glu Thr Met Arg Ala Pro Trp Pro Gly Leu Arg Val Arg Arg Leu Pro Pro Pro Arg Gly Leu Ala Leu Glu Val Gly Trp Thr Gly Glu Pro Ala Ser Ser Ser Ser Leu Thr Gly Arg Leu Ala Ala Ser Arg Trp Arg Gly Ser Pro Ala Arg Trp Ser Phe Thr Ser Arg Ser Gln Glu Cys Val Arg Thr Ala Ile Asp Ala Leu Glu Arg Gly Asp Asp Gln Glu Leu Leu His Gln Val Arg Arg Ala Arg His Val Leu Ala Glu Leu Asp Asp Glu Val Arg Leu Gly Ile Phe Thr Pro Arg Leu Thr Aia Leu Cys Asp Ala Ala Glu Thr Val Gly Gly Ala Ala Lys Pro Ser Gly Ala Gly Gly Gly Asp Cys Gly Ile Ala Leu Leu Asp Ala Thr Ala Ala Thr Arg Thr Ala Arg Leu Arg Glu Gln Trp Ala Ala Ala GIy Val Leu Pro Met Pro Ile Gln Val His Gln Thr Asn Gly Ser Ala Ar g SEQ ID NO: 15 LENGTH: 1110 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 15 gtgaccggcc cgggcgccgt gcgccgccac gcgccgggca agctgttcgt cgccggtgag 60 tacgcggtgc tggagccggg ccacccggcg ctgctggtgg cggtcgacag gggagtggac 120 gtcaccgtct ccggcgccga cgcccacctc gttgtcgact ccgacctctg cccggagcag 180 gcgtgcctgc ggtggcagga cggccggctc gtcggcgcgg gcgacgggca gccggcgccc 240 gacgccctcggcgccgtggtctcggcgatcgaggtggtcggcgaactcctgaccggacga300 gggctgcgcccgctgcccatgcgggtggcgatcaccagccggctgcaccgcgacggcacg360 aagttcggcctcgggtcgagcggggcggtgacagtcgccacggtgaccgcagtggccgcg420 taccacggggtggagctgtcgctcgaatcgcggttccggctggcgatgctggcgacggtg480 cgtgacggcgccgacgcctccggcggtgatctggccgcgagcgtctggggcggctggatc540 gcctaccaggcgcccgaccgcgcggccgtgcgcgagatggcgcggcggcgcggcgtcgag600 gagacgatgcgcgcgccctggccgggcctgcgggtccggcggctgccaccaccgcgtggc660 ctcgcgctggaggtgggctggaccggcgagccggcgagcagcagctcgttgaccgggcgg720 ctggccgcctcccggtggcggggcagcccggcgcggtggagcttcaccagccgtagccag780 gagtgtgtgcgtaccgccatcgacgcgctggagcggggcgacgaccaggaactgctgcac840 caggtccggcgggcccggcacgtgcttgccgagctggacgacgaggtccggctcgggatc900 ttcaccccccggctgacggcgctgtgcgacgccgccgagaccgtcggcggcgcggccaaa960 ccgtccggcgccggtggcggggactgcggcatcgcgttgctggacgccaccgccgcgacg1020 cggaccgcgcggctgcgcgagcagtgggccgccgccggggtgctccccatgccgatccag1080 gtccatcagacgaacgggagcgcgcgatga 1110 SEQ ID N0: 16 LENGTH: 360 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 16 MetIleAla Asn Lys AspAspHis ValArgLeu AlaAlaGlu Gln Arg GlnGlyArg LeuGlyGly HisHisGlu PheAspAsp ValSerPhe Val HisHisAla LeuAlaGly IleAspArg SerAspVal SerLeuAla Thr SerPheGly GlyIleAsp TrpProVai ProLeuCys IleAsnAla Met ThrGlyG1y SerThrLys ThrGlyLeu IIeAsnArg AspLeuAla Ile AlaAlaArg GluThrGly ValProIle AlaThrGly SerMetSer Ala Tyr Phe Ala Asp Glu Ser Val Ala Glu Ser Phe Ser Val Met Arg Arg Glu Asn Pro Asp Gly Phe Ile Met Ala Asn Val Asn Ala Thr Ala Ser Val Glu Arg Ala Arg Arg Ala Val Asp Leu Met Arg Ala Asp Ala Leu Gln Ile His Leu Asn Thr Ile Gln Glu Thr Val Met Pro Glu Gly Asp Arg Ser Phe Ala Ala Trp Gly Pro Arg Ile Glu Gln Ile Val Ala Gly Val Gly Vai Pro Val Ile Val Lys Glu Val Gly Phe Gly Leu Ser Arg Glu Thr Leu Leu Arg Leu Arg Asp Met Gly Val Arg Val Ala Asp Val Ala Gly Arg Gly Gly Thr Asn Phe Ala Arg Ile Glu Asn Asp Arg Arg Asp Ala Ala Asp Tyr Ser Phe Leu Asp Gly Trp Gly Gln Ser Thr Pro Aia Cys Leu Leu Asp Ala Gln Gly Val Asp Leu Pro Val Leu Ala Ser Gly Gly Ile Arg Asn Pro Leu Asp Val Val Arg Gly Leu Ala Leu Gly Ala Gly Ala Ala Gly Val Ser Gly Leu Phe Leu Arg Thr Leu Leu Asp Gly Gly° Val Pro Ala Leu Leu Ser Leu Leu Ser Thr Trp Leu Asp Gln Ile Glu Ala Leu Met Thr Ala Leu Gly Ala Arg Thr Pro Ala Asp Leu Thr Arg Cys Asp Leu Leu Ile Gln Gly Arg Leu Ser Ala Phe Cys Ala Ala Arg Gly Ile Asp Thr His Arg Leu Ala Thr Arg Ser Gly Ala Thr His Glu Met Ile Gly Gly Ile Arg SEQ ID NO: 17 LENGTH: 1083 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECOll SEQLENCE: 17 atgatcgcca accgcaagga cgaccacgtc cggctcgccg ccgagcagca gggccggctc 60 ggcggtcacc acgagttcga cgacgtgtcc ttcgtgcacc acgccctggc cggcatcgac 120 cggtccgacg tctcgctggc cacgtcgttc ggcggcatcg actggccggt gccgctgtgc 180 atcaacgcga tgaccggcgg cagcaccaag accggcctga tcaaccggga cctggcgatc 240 gcggcccgggagaccggcgtaccgatcgccaccgggtcgatgagcgcctacttcgccgac300 gagtcggtggccgagagtttcagcgtgatgcgccgggagaaccccgacgggttcatcatg360 gccaacgtcaacgccaccgcctccgtcgaacgggcccggcgggctgtcgacctgatgcgg420 gccgacgcgctgcagatccacctgaacaccatccaggagacggtgatgccggagggggac480 cggtcgttcgccgcctgggggccgcggatcgaacagatcgtcgccggcgtcggtgtgccg540 gtgatcgtcaaggaggtcggcttcgggctcagccgcgaaacgctgctgcggctgcgggac600 atgggcgtccgggtggccgacgtcgccggccgcggcggcacgaacttcgcgcgcatcgag660 aacgaccggcgggacgccgccgactactccttcctcgacgggtggggacagtcgacaccc720 gcctgcctgctggacgcccagggcgtggacctgcccgtgctggcctccggcggcatccgc780 aacccgctcgacgtggtccgcgggctggcgctcggcgccggcgcggccggggtgtccgga840 ctgttcctgcgcacgctcctggacggcggcgtgccggcgctgctgtcgctgctgtccacc900 tggctcgaccagatcgaagccctgatgaccgccctgggcgcgcggaccccggccgacctg960 acccgctgcgacctgctgatccagggtcggctgagcgcgttctgcgcggcccggggcatc1020 gacacccaccgcctcgccacccgttccggcgccacccacgagatgatcggaggcattcga1080 tga 108:3 SEQ ID N0: 18 LENGTH: 351 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 18 Met Asn Asp Ala Ile Ala Gly Val Pro Met Lys Trp Val Gly Pro Val Arg Ile Ser Gly Asn Val Ala Gln Ile Glu Thr Glu Val Pro Leu Ala Thr Tyr Glu Ser Pro Leu Trp Pro Ser Val Gly Arg Gly Ala Lys Ile Ser Arg Met Val Glu Ala Gly Ile Val Ala Thr Leu Val Asp Glu Arg Met Thr Arg Ser Val Phe Val Arg Ala Lys Asp Ala Gln Thr Ala Tyr Leu Ala Ser Leu Glu Val Asp Ala Arg Phe Asp Glu Leu Arg Asp Ile Val Arg Thr Cys Gly Arg Phe Val Glu Leu Ile Gly Phe His His Glu Ile Thr A:la Asn Leu Leu Phe Leu Arg Phe Ser Phe Thr Thr Gly Asp Ala Ser Gly His Asn Met Ala Thr Leu Ala Ala Asp Ala Leu Leu Lys His Ile Leu Asp Thr Ile Pro Gly Ile Ser Tyr Gly Ser Ile Ser Gly Asn Tyr Cys Thr Asp Lys Lys Ala Thr Ala Ile Asn Gly Ile Leu Gly Arg Gly Lys Asn Val Val Thr Glu Leu Val Val Pro Arg Glu Ile Val His Asp Ser Leu His Thr Thr Ala Ala Ala Ile Ala Gln Leu Asn Val His Lys Asn Met Ile Gly Thr Leu Leu Ala Gly Gly Ile Arg Ser Ala Asn AIa His Tyr Ala Asn Met Leu Leu Gly Phe Tyr Leu Ala Thr Gly Gln Asp Ala Ala Asn Ile Val Glu Gly Ser Gln Gly Val Thr Val Ala Glu Asp Arg Asp Gly Asp Leu Tyr Phe Ser Cys Thr Leu Pro Asn Leu Ile Val Gly Thr Val Gly Asn Gly Lys Gly Leu Gly Phe Val Glu Glu Asn Leu Glu Arg Leu Gly Cys Arg Ala Ser Arg Asp Pro Gly Glu Asn Ala Arg Arg Leu Ala Val Ile Ala Ala Ala Thr Val Leu Cys Gly Glu Leu Ser Leu Leu Ala Ala Gln Thr Asn Pro Gly Glu Leu Met Arg Ala His VaI Arg Leu Glu Arg Pro Thr Glu Thr Thr Lys IIe Gly Ala N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:19 atgaacgacgcgatcgccggtgtgcccatgaaatgggtaggtcccgtgcggatctcggga60 aacgtggcgcagatcgagacggaggttccgctcgccacgtacgagtcgccgctctggccg120 tccgtcggccggggcgcgaagatctcccggatggtcgaggcgggcatcgtcgccacgctc180 gtcgacgagcgcatgacccgctcggtgttcgtgcgcgccaaggacgcgcagaccgcctac240 ctggcctcgcttgaggtcgacgcgcggttcgacgaactgcgtgacatcgtgcgcacctgc300 ggcaggttcgtcgagctgatcgggttccaccacgagatcaccgcgaacctgctgttcctg360 cggttcagtttcaccaccggcgacgcgtccgggcacaacatggcgacgctggccgccgac420 gcgctgctgaagcacatcctggacaccattccgggcatctcgtacggctcgatctcgggc480 aactactgcaccgacaagaaggccaccgcgataaacggcattctcggccggggcaagaac540 gtggtcaccgagctggtcgtgccgcgggagatcgtccacgacagcctgcacacgacggcg600 gcggcgatcgcccagctgaacgtgcacaagaacatgatcggcacgttgctcgccggcggt660 atccgctcggccaacgcccactacgcgaacatgctgctcgggttctacctggccacgggt720 caggacgccgcgaacatcgtcgagggctcccagggcgtgacggtcgccgaggaccgcgac780 ggcgacctctacttctcctgcacgctgcccaacctgatcgtgggcaccgtcggcaacggc840 aaggggctcggcttcgtcgaggagaacctggagcggctcggctgccgcgcctcgcgtgat900 ccgggcgagaacgcccggcggctcgcggtcatcgcggccgcgacggtgctctgcggcgag960 ctgtccctgctcgccgcgcagaccaacccgggcgagctgatgcgggcgcacgtccggctc1020 gaacgcccgaccgagaccacgaagatcggagcctga 1056 SEQ ID N0: 20 LENGTH: 391 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 20 Met Ala Glu Arg Pro Ala Val Gly Ile His Asp Leu Ser Ala Ala Thr Ala His His Val Leu Thr His Glu Thr Leu Ala Ala Ser Asn Gly Ala Asp Vai Ala Lys Tyr His Arg Gly Ile Gly Leu Arg Ala Met Ser Val Pro Ala Pro Asp Glu Asp Ile Val Thr Met Ala Ala Ala Ala Ala Ala Pro Val Val Ala Arg His Gly Thr Asp Arg Ile Arg Thr Val Val Phe Ala Thr Glu Ser Ser Val Asp Gln Ala Lys Ala Ala Gly Ile His Val His Ser Leu Leu Gly Leu Pro Ser Ala Thr Arg Val Val Glu Leu Lys Gln Ala Cys Tyr GIy Gly Thr Ala Gly Leu Gln Phe Ala Ile Gly Leu VaI His Arg Asp Pro Ser Gln Gln Val Leu Val Ile Ala Ser Asp Val Ser Lys Tyr Ala Leu Gly Glu Pro Gly Glu Ala Thr Gln Gly Ala Ala Ala Val Ala Met Leu Val Gly Ala Asp Pro Ala Leu Val Arg Val Glu Asp Pro Ser Gly Met Phe Thr Ala Asp Val Met Asp Phe Trp Arg Pro Asn Tyr Arg Thr Thr Ala Leu Val Asp Gly His Glu Ser Ile Ser Ala Tyr Leu Gln Ala Leu Glu Gly Ser Trp Lys Asp Tyr Thr Glu Arg Gly Gly Arg Thr Leu Asp Glu Phe Gly Ala Phe Cys Tyr His Gln Pro Phe Pro Arg Met Ala Asp Lys Ala His Arg His Leu Leu Asn Tyr Cys Gly Arg Asp Val Asp Asp Ala Leu Val Ala Gly Ala Ile Gly His Thr Thr Ala Tyr Asn Ala Glu Ile Gly Asn Ser Tyr Thr Ala Ser Met Tyr Leu Gly Leu Ala Ala Leu Leu Asp Thr Ala Asp Asp Leu Thr Gly Arg Thr Val Gly Phe Leu Ser Tyr Gly Ser Gly Ser Val Ala Glu Phe Phe Ala Gly Thr Val Val Pro Gly Tyr Arg Ala His Thr Arg Pro Asp Gln His Arg Ala Ala Ile Asp Arg Arg Gln Glu Ile Asp Tyr Ala Thr Tyr Arg Glu Leu His Glu His Ala Phe Pro Val Asp Gly Gly Asp Tyr Pro Ala Pro Glu Val Thr Thr Gly Pro Tyr Arg Leu Ala Gly Leu Ser Gly His Lys Ara Val Tyr Glu Pro Arg SEQ ID NO: 2I
LENGTH: 1176 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 21 atggccgaga gacccgccgt cggcatccac gacctgtccg ccgcgacggc gcatcacgtg 60 ctgacacacg agaccctggc cgcgagcaac ggcgccgacg tggccaagta ccaccgtggc 120 atcgggctgc gggcgatgag cgtgcccgcc ccggacgagg acatcgtgac gatggctgct 180 gccgccgccg cgccggtggt cgcccgccac ggcaccgacc ggatccggac cgtcgtgttc 240 gccacggagt cgtcggtcga ccaggcgaag gcggccggga tacacgtcca ctccctgctc 300 ggcctcccctcggccacccgggtggtcgagctgaagcaggcctgctacggcggtacggcg360 ggactgcagttcgccatcggcctggtgcaccgtgacccgtcgcagcaggtcctggtgatc420 gccagcgacgtgtcgaagtacgcgctgggtgagcccggcgaggcgacccagggcgccgcg480 gcggtcgccatgctcgtcggcgcggacccggcgctggtacgcgtcgaggacccgtcgggc540 atgttcaccgccgacgtcatggacttctggcggccgaactaccgcaccaccgccctggtc600 gacgggcacgagtccatctccgcctacctgcaggcgctggagggctcgtggaaggactac660 accgagcgcggcggtcgcaccctggacgagttcggcgcgttctgctaccaccagccgttc720 ccgaggatggccgacaaggcgcaccggcacctgctcaactactgcgggcgcgacgtcgac780 gacgcgctggtggccggggccatcgggcacaccaccgcgtacaacgccgagatcggcaac840 agctacacggcgtcgatgtatctcgggctcgcggcactgctcgacaccgccgacgacctg900 accggccggaccgtcggcttcctcagctacgggtccggcagcgtcgccgagttcttcgcc960 ggcactgtcgtgcccgggtaccgcgcgcacacgcgacccgaccagcaccgcgcggcgatc1020 gaccggcggcaggagatcgactacgcgacgtaccgggagttgcacgagcacgccttcccg1080 gtcgacggcggcgactatccggcgccggaggtgaccaccgggccgtaccggctggccggg1140 ctctccggtcacaagcgcgtctacgagccgcgatag 1176 SEQ ID NO: 22 LENGTH: 290 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 22 Val Ala Giu Leu Tyr Ser Thr Ile Glu Glu Ser Ala Arg Gln Leu Asp Val Pro Cys Ser Arg Asp Arg Val Trp Pro Ile Leu Ser Ala Tyr Gly Asp Ala Phe Ala His Pro Glu Ala Val Val Ala Phe Arg Val Ala Thr Ala Leu Arg His Ala Gly Glu Leu Asp Cys Arg Phe Arg Thr His Pro Asp Asp Arg Asp Pro Tyr Ala Ser Ala Leu Ala Arg Gly Leu Thr Pro Arg Thr Asp His Pro Val Gly Ala Leu Leu Ser Glu Val His Arg Arg Cys Pro Val Glu Ser His Gly Ile Asp Phe Gly Val Val Gly Gly Phe Lys Lys Ile Tyr Ala Ala Phe Ala Pro Asp Glu Leu Gln Val Ala Thr Ser Leu Ala Gly Ile Pro Ala Met Pro Arg Ser Leu Ala Ala Asn Ala Asp Phe Phe Thr Arg His Gly Leu Asp Asp Arg Val Gly Val Leu Gly i45 150 155 160 Phe Asp Tyr Pro Ala Arg Thr Val Asn Val Tyr Phe Asn Asp Val Pro Arg Glu Cys Phe Glu Pro Glu Thr Ile Arg Ser Thr Leu Arg Arg Thr Gly Met Ala Glu Pro Ser Glu Gln Met Leu Arg Leu Gly Thr Gly Ala Phe Gly Leu Tyr Val Thr Leu Gly Trp Asp Ser Pro Glu Ile Glu Arg Ile Cys Tyr Ala Ala Ala Thr Thr Asp Leu Thr Thr Leu Pro Val Pro Vai Glu Pro Glu Ile Glu Lys Phe Val Lys Ser Val Pro Tyr Gly Gly Gly Asp Arg Lys Phe Val Tyr Gly Val Ala Leu Thr Pro Lys Gly Glu Tyr Tyr Lys Leu Glu Ser His Tyr Lys Trp Lys Pro Gly Ala Val Asn Phe Ile NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:23 gtggccgagctctactcgaccatcgaggaatcggcccggcaactggacgtgccgtgttcg60 cgcgaccgggtctggcccatcctgtccgcgtacggcgacgcgttcgcccatcccgaggcg12() gtggtcgccttccgggtggcgaccgcgctgcgtcacgcgggcgagctggactgccggttc180 cggacgcatccggacgaccgggacccgtacgcctcggcgctcgcccggggcctcaccccg240 cgcacggaccaccccgtcggcgcgctgctctccgaggtccaccggcgctgcccggtggag300 agccacggcatcgacttcggggtggtcggcggcttcaagaagatctacgcggccttcgcc360 ccggacgagctgcaggtggccacgtcgctcgccggcattccggcgatgccccgcagcctc42() gccgcgaacgccgacttcttcacccggcacggcctcgacgaccgggtcggcgtgctggga480 ttcgactacccggcccggaccgtgaacgtctacttcaacgacgtgccgcgtgagtgcttc540 gagccggagaccatccggtcgacgctgcgccggaccgggatggccgagccgagcgagcag600 atgctccggctcggcaccggggcgttcgggctctacgtcacgctgggctgggactccccg660 gagatcgagcggatctgctacgccgcggcgaccacggacctgaccacgcttccggtaccc720 gtggaaccggagatcgagaagttcgtgaaaagcgttccgtacggcggcggggaccggaag780 ttcgtctacggcgtggcgctgacccccaagggggagtactacaaactcgagtcgcactac840 aaatggaagccgggcgcggtgaacttcatttga 87:3 SEQ ID N0: 24 LENGTH: 370 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 24 Val Trp Ala Arg Val Lys Asn Trp Val Val Ala Leu Ala Val Ala Ala Val Leu Met Ile Ser Ala Leu Ala Gly Asp His Pro Ala Pro Glu Gly Leu Gly Leu Leu Gly Phe Ala Leu Val Ala Ala Ser Gly Leu Ala Leu Ala Ala Ser Arg Arg Ala Pro Ile Ala Val Leu Val Ala Thr Gly Leu Cys Val Val Gly Tyr Asn Ala Ile Gly Phe Gly Val Pro Ala Ile Ala Tyr Leu Phe Ala Val Tyr Ala Ala Val Arg Ala Gly His Arg Leu Val Thr Leu G1V Ala Ser Ala Ala Leu Leu Val Val Leu Pro Leu Ala Ile y 100 105 110 Met '~'al Ser Pro Ala Asp Gly Ala Leu Lys Glu Ala Leu Ala Gln Ser ~15 i20 125 Arg Gly Val Leu Glu Leu Ala Trp Leu Ile Ala Ala Ala Ala Ala Cllr Glu Ala Leu Arg Gln Ala Glu Arg Arg Ala Asp Glu Ala Glu Arg Thr Arg Glu Glu Thr Ala Arg Leu Arg Ala Thr Gln Glu Arg Leu His Ile Ala Arg Glu Leu His Asp Ser Leu Thr His Gln Ile Ser Ile Ile Lys Val Gln Ala GIu Val Ala Val His Leu Ala Arg Lys Arg Gly Glu Gln Val Pro Glu Ser Leu Leu Ala Ile Gln Glu Ala Gly Arg Ala Ala Thr Arg Glu Leu Arg Ala Thr Leu Glu Thr Leu Arg Asp Leu Thr Lys Ser Pro Ser His Gly Leu Asp His Leu Pro Glu Leu Leu Ala Gly Ala Glu Lys Ile Gly Leu Ala Thr Thr Leu Thr Ile Glu Gly Asp Gln Arg Asp Val Pro Glu Ala Val Gly Arg Thr Ala Tyr Arg Ile Val Gln Glu Ser Leu Thr Asn Thr Ala Arg His Ala Ser Ala Ala Ala Ala Ala Val Arg Ile Asp Tyr Arg Pro Asp Ala Leu Ser Ile Arg Ile Asp Asp Asp Gly Thr Ala Arg Pro Gly Ala Ala Pro Val Pro Gly Val Gly Leu Leu Gly Met His Glu Arg Val Leu Ala Leu Gly Gly Arg Leu Arg Ala Glu Pro Arg Thr Gly Gly Gly Phe Thr Val Gln Ala Glu Leu Pro Val Val Arg Val Pro SEQ ID N0: 25 LENGTH: 1113 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE:25 gtgtgggcccgggtgaagaactgggtcgtcgcgttggctgtggcggcggtgctgatgatc60 agcgcgctggccggtgaccatcctgcccccgagggcctcggtctgctcggcttcgcgctg120 gtggcggcgagcggcctggcgctggccgccagtcgtcgggccccgatcgccgtgctggtc180 gccaccgggctgtgcgtggtgggctacaacgcgatcggcttcggggtgcccgccatcgcg240 tacctgttcgcggtctacgcggcggtccgggccgggcaccggctcgtcacgctcggggcg300 agcgecgccctgctcgtcgtcctgccgctggcgatcatggtctcgcccgcggacggcgcc360 ctcaaggaggcgctcgcgcagtcgcggggcgtgctggaactggcctggctgatcgccgcg420 gcggcggccggtgaggcgctgcggcaggccgaacggcgagcggacgaggcggaacggacc480 cgcgaggagaccgcccggctgcgcgccacccaggagcggctgcacatcgcacgggagctg540 cacgactcgctcacccaccagatctcgatcatcaaggtgcaggcggaggtggcggtccac600 ctggcccgcaagcggggcgagcaggtgccggagtcgctgctggcgatccaggaggccggc660 cgggcggcgactcgcgagctgcgcgcgaccctggagacgctgcgtgacctgaccaagtcc720 ccgtcgcacgggctcgaccacctcccggagctgctggccggggccgagaagatcggcctg780 gccaccacgctgaccatcgagggcgaccagcgggacgtgccggaggcggtgggccgcacc840 gcgtaccggatcgtgcaggagtcgctcaccaacaccgcccggcacgcctccgccgcggcc900 gccgcggtccggatcgactaccgcccggacgcgctgagcatccggatcgacgacgacggg960 acggcccggccgggcgccgccccggtgcccggcgtcgggctgctggggatgcacgagcgc1020 gtcctcgcgctgggcggccggctgcgggcggaaccccgcaccggcggaggcttcaccgtc1080 caggccgaactcccggtggtgcgcgtcccatga 1113 SEQ ID NO: 26 LENGTH: 220 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 26 Met Ile Arg Ile Met Leu Leu Asp Asp Gln Pro Leu Leu Arg Ser Gly Phe Arg Ala Leu Leu Asp Ala Glu Asp Asp Ile Glu Val Val Ala Glu GIy Gly Asn Gly Arg Glu GIy Leu Ala Leu Ala Arg Gln His Leu Pro Asp Leu Ala Leu Ile Asp Ile Gln Met Pro Val Met Asp Gly Val Glu Thr Thr Arg Gln Ile Val Ala Asp Pro Ala Leu Ala Gly Val Arg Val Val Ile Leu Thr Asn Tyr Gly Leu Asp Glu Tyr Val Phe His Ala Leu Arg Ala Giy Ala Thr Gly Phe Leu Val Lys Asp Ile Glu Pro Asp Asp Leu Leu His Ala Val Arg Val Ala Ala Arg Gly Asp Ala Leu Leu Ala Pro Ser Ile Thr Arg Met Leu Ile Asn Arg Tyr Val Ser Glu Pro Leu Cys Ala Asp Val Thr Pro Gly Met Glu Glu Leu Thr Asn Arg Glu Arg GIu Ala Val Ala Leu Ala Ala Arg Gly Leu Ser Asn Asp Glu Ile Ala Asp Arg Met Va1 Ile Ser Pro Leu Thr Ala Lys Thr His Val Asn Arg Ala Met Thr Lys Leu Gln Ala Arg Asp Arg Ala Gln Leu Val Val Phe Ala Tyr Glu Ser Gly Leu Val Ser Pro Gly Asn Arg SEQ ID NO: 27 LENGTH: 663 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE:27 atgatcaggatcatgctgctcgacgaccagccgctgctgcgcagcgggttccgcgcgctc60 ctcgacgccgaggacgacatcgaggtggtggccgagggcgggaacggccgggagggcctg120 gcgctggcccggcagcacctgcccgatctcgccctgatcgacatccagatgccggtcatg180 gacggcgtcgagacgacccggcagatcgtcgcggatccggcgctggccggggtacgcgtc240 gtcatcctcaccaactacggcctcgacgagtacgtcttccacgcgctgcgcgccggcgcc300 accggcttcctggtcaaggacatcgagccggacgacctgctgcacgccgtgcgggtcgcc360 gcgcgcggtgacgcgctgctcgcgccgtcgatcacccggatgctgatcaacaggtacgtg420 tcggagccgctctgcgcggacgtcacgcccggcatggaggagctgaccaaccgggaacgc480 gaggcggtcgccctggccgcccggggcctgtccaacgacgagatcgccgatcgcatggtg540 atcagcccgctgaccgcgaagacccacgtcaaccgcgccatgaccaagctgcaggcccgc600 gaccgcgcccagctggtggtgttcgcctacgagtccggcctggtgtcacccggcaatcgc660 tga 663 SEQ ID N0: 28 LENGTH: 131 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 28 Met Phe Ile Arg Arg Leu Leu Thr Ala Ala Ala Ala Gly Val Leu Gly Gly Leu Ala Leu Val Ala Pro Ala Ala Ala Gln Val Thr Ala Ala Asp Gly Asp Gly Gly Ser Gly Arg Ala Gly Ser Val Leu Ala Leu Ala Leu Ala Leu Leu Gly Leu Val Leu Gly Gly Trp Ala Leu Arg Ser Ala Gly Arg Gly Gly Gly Arg Gly Asn Ala Ile Ala Ala Leu Val Leu Ala Val Ala Gly Leu Ile Ala Gly Val Val Ala Leu Ala Gly Ser Asp Gly Gly Val Gly Ser Gly Asn Gly Arg Gly Gly Ala Ile Val Ala Val Val Leu Ala Leu Ile Gly Ile Ala Val Gly Gly Leu Ala Phe Thr Arg Ser Arg SI

Arg Ala Ala SEQ ID N0: 29 LENGTH: 396 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 29 atgttcatcc gtcgtttgct caccgccgcc gcagccggcg tcctcggtgg gctcgcactc 60 gtcgcaccgg cggccgcgca ggtgacggcc gccgacggtg acggtggttc cggccgcgcc 120 ggatccgtgc tggcgctcgc gctcgcgttg ctcggcctcg tcctgggcgg gtgggcgttg 180 cgctccgcgg ggcgcggcgg cggtcgtggc aacgcgatcg ccgcgctggt gctcgcggtg 240 gccggcctga tcgccggcgt ggtcgccctg gccggctccg acggtggtgt cggcagcggc 300 aacggccgtg gtggcgccat cgtggccgtc gtgctggcgc tgatcgggat cgccgtcggc 360 ggcctggcat tcacccgctc ccggcgcgcc gcctga 395 SEQ ID NO: 30 LENGTH: 154 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 30 Met Arg Lys Val Phe Ala Gly Leu Ala Ala Phe Leu Leu Leu Val Leu Val Val Gln Phe Phe Leu Ala Ala Ser Gly Ala Phe Ser Asn Glu Ala Asn Glu Glu Ala Phe Arg Pro His Arg Ile Leu Gly Leu Gly Ser Ile Leu Val Ala Val Val Leu Thr Val Ala Ala Ala Val Met Arg Met Pro Gly Arg Ile Ile Gly Leu Ser Gly Leu Val Ala Gly Leu Gly Ile Leu Gln Ala Leu 31e Ala Val Ile Ala Lys Ala Phe Gly Asp Ser Ala Gly Asp .Ser Ala Val Gly Arg Tyr Va1 Phe Gly Leu His Ala Val Asn Gly Leu Val Met Val Ala Val Ala Arg Val Ile Leu Arg Ser Val Arg Ala Ala Pro Asp Thr Thr Thr Thr Pro Gly Val Asp Thr Thr Val Thr Gly Pro Ala Ala Asp Ser Ala Arg Thr Ala Ser SEQ ID N0: 31 LENGTH: 465 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE:31 atgcgcaaagtgttcgccggactggcagcgttcctgctgctcgtgctcgtggtgcagttc60 ttcctggccgccagcggcgcgttcagcaacgaggccaacgaggaggcgttccgccctcac120 cggatcctgggcctggggagcatcctcgtcgccgtggtgctgacggtggccgccgcggtg180 atgcggatgcccggccggatcatcggcctgtccggcctggtcgccgggctgggcatcctg240 caggccctgatcgcggtcatcgccaaggcgttcggcgactcggccggtgactcggccgtc300 ggccggtacgtgttcggcctgcacgcggtcaacggactggtgatggtggccgtcgcccgc360 gtcatcctgcgcagcgtccgggcggcgccggacacgaccaccacgcccggcgtggacacg420 acggtcaccggtccggcggccgactcggcgcgaacggcgtcatga 465 SEQ ID N0: 32 LENGTH: 661 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 32 Met Ser Thr Leu Gln Trp Ile Leu Val Asp His Val Val Ala Leu Leu Gly Val Ala Thr Trp Phe Ala Thr Gly Val Thr Ala Ala Leu Gly Arg His Arg Ile Ala Leu Ala Leu Leu GIy Ala Ala Val Leu Val Thr Val Ala Arg Leu Gly Thr Val Ala Leu Leu Ala Asp Arg Gly Trp Trp Phe Val Gln Glu Lys Val Leu Leu Gly Leu Pro Met Leu Gly Ala Ala Gly Leu Val Ala Val Leu Leu Ala Gly Pro Arg Leu Leu Ala Ala Arg Gln Ser Pro Ala Ala Asp Leu Pro Ala Gly Ala Leu Val Ala Val Leu Thr Ala Gly Phe Ala AIa Leu Ala Gly Leu Val Val Thr Phe Thr Ala Gly Tyr Pro Leu Thr Trp Ser Thr AIa Leu Ile Ala Val Ala Leu Val Cys Ala Ala Ala Leu Leu Thr Ala Arg Val Val Gly Arg Pro Ala Ala Pro Si Ala Ala Glu Ala Gly Ser Pro Glu His Thr Pro Ala Ala Ala Gly Pro Thr Ala Leu Ser Arg Arg Arg Phe Leu Gly Val Ala Gly Gly Val Val Ala Ala Gly Ala Gly Ala Thr Gly Val Gly Leu Leu Phe Arg Asp Pro Glu Ala Met Val Thr Gly Gly Gly Pro Gly His Ala Gly Gly Ala Arg Pro Lys Val Ser Val Ala Asp Leu Arg Gly Pro Gly Ala Pro Ala Ala Gly Gly Thr Ala Arg Arg His Val Leu Thr Ala Arg Thr Gly Thr Val Thr Ile Pro Ser Gly Arg Pro Ile Asp Ala Trp Ser Tyr Glu Gly Arg Leu Pro Gly Pro Ala Ile Thr Ala Thr Glu Gly Asp Leu Ile Glu Val Thr Leu Arg Asn Ala Asp Ile Glu Asp Gly Val Thr Val His Trp His Gly Tyr Asp Val Pro Cys Gly Glu Asp Gly Ala Pro Gly Ala Thr Gln His Ala Val Gln Pro Gly Gly Glu Phe Val Tyr Arg Phe Gln Ala Asp Gln Val Gly Thr Tyr Trp Tyr His Thr His Gln Ala Ser His Pro Ala Val Arg Lys Gly Leu Tyr Gly Thr Leu Val Val Thr Pro Arg Glu Asp Arg Pro Glu Ala Glu Arg Gly Leu Asp Leu Thr Leu Pro Val His Thr Phe Asp Asp Val Thr Ile Leu Gly Asp Gln Glu Gly Arg Ala Val His Asp Val Arg Pro Gly Gln Pro Val Arg Leu Arg Leu Ile Asn Thr Asp Ser Asn Pro His Trp Phe Ala Val Val Gly Ser Pro Phe Arg Val Val Ala Val Asp Gly Arg Asp Leu Asn Gln Pro Gly Glu Val Arg Glu Val Gly Leu Arg Leu Pro Ala Gly Gly Arg Tyr Asp Leu Thr Leu Ala Met Pro Asp Ala Lys Val Thr Leu Leu Leu Asp Asn Asp Ser Asp Gln Gly Vai Leu Leu Arg Pro Pro Gly Val Gly Gly Gly Asp Arg Pro Leu Pro Asp Thr Ala Asp Trp Pro Glu Phe Asp Leu Leu Gly Tyr Gly Glu Pro Ala Pro Val Pro Phe Asp Ala Asp Asp Ala Asp Arg His Phe Thr Ile Val Leu Asp Arg Ala Leu Ala Met Val Asp Gly Lys Pro Ala Tyr Ala Gln Thr Val Asp Gly Arg Ala His Pro Ser Val Pro Asp Gln Leu Val Arg Glu Gly Asp Val Val Arg Phe Thr Val Val Asn Arg Ser Leu Glu Thr His Pro Trp His Leu His Gly His Pro Val Leu Ile Leu Ser Arg Asp Gly Arg Pro Tyr Ser Gly Ser Pro Leu Trp Met Asp Thr Phe Asp Val Arg Pro Gly Glu Val Trp Glu Val Ala Phe Arg Ala Asp Asn Pro Gly Val Trp Met Asn His Cys His Asn Leu Pro His Gln Glu Gln Gly Met Met Leu Arg Leu Val Tyr Asp Gly Val Thr Thr Pro Phe Ala Ser Thr Ser His Ala His NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:33 atgagcacgctccaatggatcctcgtggaccacgtcgtggcgctgctcggtgtcgcgacg60 tggttcgcaacgggtgtcacggcagctctcggccgccaccggatcgcgttggcgctcctc120 ggcgccgcggtgctggtgacagtcgcccgcctgggcaccgtggcgctgctggccgaccgc180 ggctggtggttcgtccaggagaaggttctgctggggr_tgccgatgctcggcgccgcgggg240 ctcgtcgcggtgctcctggccggcccgcgcctgctcgcggcccggcagtcaccggcggcg300 gacctgccggccggcgcgctggtcgcggtgctgaccgccggcttcgccgcgctggccggc360 ctggtggtgacgttcaccgccgggtacccgctgacgtggagcaccgcgctgatcgccgtc420 gccctcgtctgcgccgccgcgctgctcaccgcgcgggtggtcggacgacccgccgccccg480 gccgcggaggccggctccccggagcacacgccggcggcggccgggcccacggcgctgtcc540 cgccgccggttcctcggcgtggccgggggagtggtcgcggcgggcgccggcgccaccggc600 S$

gtcggcctgctcttccgcgacccggaggcgatggtcaccggaggcggccccggacacgcc660 ggtggcgcccgccccaaggtctccgtggcggacctgcgcggccccggcgctccggcggcg720 ggcggcacggcgcgacgccacgtgctcaccgcccggacgggcaccgtcacgattccgtcc780 ggacgtccgatcgacgcctggagctacgagggccgcctgcccgggccggccatcaccgcg8417 accgagggcgacctgatcgaggtgacgctccgcaacgccgacatcgaggacggcgtcacc900 gtgcactggcacgggtacgacgtgccgtgcggcgaggacggcgcgccgggcgccacgcag960 oacgcggtgcagcccggcggcgagttcgtctaccggttccaggcggaccaggtggggacg1020 tactggtaccacacccaccaggcgtcgcaccccgccgtgcgcaaagggctgtacgggacg1080 ctcgtcgtgacgccgcgcgaggaccggccggaagcggagcgcgggctggacctgacgctg1140 ccggtgcacacgttcgacgacgtcacgatcctcggcgaccaggagggacgcgccgtccac1200 gacgtccgccccggccagccggtgcgactgcgtctgatcaacaccgactccaacccgcac1260 tggttcgccgtcgtcggctcgcccttccgcgtggtggccgtcgacggccgcgacctcaac1320 cagccgggcgaggtacgcgaggtcgggctccgcctgcccgccggaggccggtacgacctg1380 accctggccatgccggacgccaaggtcacgctgctgctcgacaacgactccgaocagggc1440 gtcctgctgcgcccgccgggcgtcggcggtggtgaccgcccgctgccggacaccgccgac1500 tggcccgagttcgacctgctgggctacggcgagccggcgcccgtgccgttcgacgccgac1560 gacgccgaccgccacttcaccatcgtcctcgaccgggccctggccatggtcgacggcaag1620 cccgcgtacgcccagaccgtcgacggtcgcgcacatccctccgtccccgaccagctcgtc1680 cgggagggggacgtcgtgcgcttcacggtggtcaaccggagcctcgaaacccacccgtgg1740 cacctgcacggccatccggtgctgatcctgtcccgcgacggccggccgtactccggcagc1800 ccgctgtggatggacaccttcgacgtgcggccgggagaggtgtgggaggtggcgttccgg1860 gcggacaatccgggtgtctggatgaaccactgccacaacctgccgcaccaggagcagggc1920 atgatgctgcggctcgtctacgacggtgtcaccacgr_ccttcgccagcacgagccacgca1980 cactga 1986 SEQ ID N0: 34 LENGTH: 129 TYPE : PRT
OP.GANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 34 Met Thr Ala Asp Leu His Gly Leu Ala Ser Val Arg Tyr Ile Val Asp Asp Val Ser Ala Ala Ile Glu Phe Tyr Thr Thr His Leu Gly Phe Thr Val Ser Thr Ala Phe Pro Pro Ala Phe Ala Asp Val Val Arg Gly Pro Leu Arg Leu Leu Leu Ser Gly Pro Thr Ser Ser Gly Ala Arg Val Thr Pro Ala Asp Ala Ala Gly Cys Gly Arg Asn Arg Ile His Leu Ile Val Asp Asp Leu Asp Ala Glu Arg Glu Arg Leu Glu Arg Ala Gly Val Thr Leu Arg Ser Asp Val Val Ala Gly Pro Gly Gly Arg Gln Phe Leu Ile Ala Asp Pro Ala Gly Asn Leu Val Glu Val Phe Glu Pro Ala Ala Arg Giy SEQ ID N0: 35 LENGTH: 390 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE: 35 atgaccgcagacctgcacggcctggccagcgtccgctacatcgtcgacgacgtgtcggcg60 gcgatcgagttctacaccacccacctgggtttcacggtgtcgaccgcgttcccgccggcc120 ttcgccgacgtggtgcgcgggccgctgcggctcctgctgtccgggccgaccagctcgggc180 gcccgggtcaccccggcggacgcggccgggtgcgggcgcaaccgcatccacctgatcgtc240 gacgatctcgacgccgaacgggagcggctggagcgcgccggggtgacgttgcgcagcgac300 gtcgtggccgggccgggcggccgtcagttcctgatcgccgacccggcgggcaacctggtc360 gaggtgttcgagccggcagcccgcggctga 390 SEQ ID NO: 36 LENGTH: 178 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 36 Met Leu Thr Ala Val Val Ala Ser Pro His Ser Pro Glu Asn Thr Ser Arg His Pro Thr Gly Gly Asp Ala Val Asp Glu Ala Thr Pro Arg Thr Pro Val Ala Ala Arg Pro Thr Trp Ser Pro Ala Thr Ala Pro Val Trp Leu Val Gly Val Leu Ala Thr Leu Ala Gly Ala Val Ala Ala Glu Ala Phe Thr Leu Ala Ala Arg Gly Phe Gly Val Pro Met Glu Ala Ala Gly Vai Trp GIu Glu Gln Ala Gln Ala Ile Pro Val Gly Ala Ile Ala Arg Ser Val Val Leu Trp Ser Ile Gly Gly Ile Val Leu Ala Val Val Val Ala Arg Arg Ala Arg Arg Pro Val Arg Ala Phe Val Ala Gly Thr Val Ala Phe Thr Val Leu Ser Leu Ala Ala Pro Ala Phe Ala Arg Asp Thr Pro Val Ser Thr Gln Leu Val Leu Ala Gly Thr His Val Ile Ala Gly Ala Val Ile Ile Ser Ile Leu Ala Ala Arg Leu Ala Ala Pro Thr Pro Pro Arg N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:37 atgttgactgccgtcgtggcgtccccgcattctcccgagaacacatcgaggcacccgacc60 ggaggcgacgccgtggatgaggccactccccgaactcccgtcgcggcacggcccacctgg120 tcgccggccaccgctccggtgtggctggtcggcgtgctggccaccctcgccggggccgtg180 gccgcggaggcgttcacgctcgccgcccggggcttcggcgtaccgatggaggcggccggc240 gtctgggaggagcaggcgcaggcgatcccggtgggggccatcgcccgcagcgtcgtgctc300 tggtcgatcggcggaatcgtcctggcggtggtcgtggcgcggcgggcccggcggcccgtg360 cgtgccttcgtggccggcaccgtcgcgttcaccgtgctgtccctcgccgcgcccgccttc420 goccgggacaccccggtgtcgacgcagctcgtcctcgccggcacccacgtgatcgccggc480 gccgtgatcatctccatcctggccgcgcggctcgccgcgcccaccccgccccggtaa 53'7 SEQ ID NO: 38 LENGTH: 66i TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 38 Met Asp Gly Thr Glu Ser Asn Val Thr Gly Phe Pro Asp Leu Leu Ser 5g Gly Leu Gly Gly Asp Gly Arg Ala Phe Ala Leu Leu His Arg Pro Gly Ala Ala Gly Cys Ala Tyr Val Glu Val Leu Thr Gly Glu Val Cys Asp Val Asp Thr Leu Gly Glu Leu Pro Leu Pro Thr Glu Pro Ala Thr Gly Ala Arg His Asp Leu Leu Val Ala Val Pro Tyr Arg Gln Val Thr Glu Arg Gly Phe Asp Cys His Asp Asp Gly Ala Pro Leu Leu Ala Met Arg Val His Glu Gln Phe Gly Leu Asp Arg Gly Gln Ala Leu Ala Gly Leu Pro Glu Arg Gly Val Pro Val Thr Asp Ala Asp Phe Asp Leu Ser Asp Glu Asp Tyr Ala Ala Ile Val Lys Arg Val Val Gly Asp Glu Ile Gly Leu Gly Ala Gly Ser Asn Phe Val Ile Arg Arg Thr Phe Thr Ala Arg Leu Ala Asp Tyr Ser Ile Ala Thr Glu Leu Ala Leu Phe Arg Arg Leu Leu Thr Gly Glu Leu Gly Ser Tyr Trp Thr Phe Leu Phe His Ser Gly Ala Gly Thr Phe Ile Gly Ala Ser Pro Glu Arg His Val Ser Met Ile Asp Gly Thr Val Ser Met Asn Pro Ile Ser Gly Thr Tyr Arg His Pro Pro Asn Gly Pro Ala Val Ser Gly Leu Leu Glu Phe Leu Asn Asp Pro Lys Glu Ala Asn Glu Leu Tyr Met Val Val Asp Glu Glu Leu Lys Met Met Aia Arg Met Cys Ala Ser Gly Gly GIn Val His GIy Pro Phe Leu Lys Glu Met Ala Arg Val Thr His Ser Glu Tyr Ile Leu Thr Gly Arg Ser Asp Leu Asp Val Arg Asp Val Leu Arg Glu Thr Leu Leu Ala Pro Thr Val Thr Gly Ser Pro Ile Glu Asn Ala Phe Arg Val Ile Thr Arg His Glu Thr Thr Gly Arg Gly Tyr Tyr Gly Gly Val Leu Ala Leu Met Gly Arg Asp Ser Ala Gly Ser Arg Thr Leu Asp Ser Ala Ile Met Ile $~

Arg Thr Ala Glu Ile Asp Asp Ala Gly Thr Leu Arg Leu Gly Val Gly Ala Thr Leu Val Arg Asp Ser Lys Pro Glu Ser Glu Val Ala Glu Thr Arg AIa Lys Ala Gly Ala Met Arg Ala Ala Leu Gly Leu GIy Val Asp Pro Asp Gly Pro Asp Gly Gly Arg Thr Thr Ala Ala Arg Ala Arg Ser Ser Leu Ala Thr Asp Pro Arg Val Arg Arg Ala Leu Arg Glu Arg Asn Thr Thr Leu Ser Arg Phe Trp Leu Asp Gly Ala Glu Arg Arg Thr Pro Asn Pro Ala Leu Thr Gly Arg Arg Val Leu Val Val Asp Asn Glu Asp Thr Phe Met Ala Met Leu Asp His Gln Leu Arg Ala Leu Gly Leu Arg Ser Ser Ile Ala Arg Phe Asp Ser Arg Leu Arg Pro Asp Gly His Asp Leu Val Val Val Gly Pro Gly Pro Gly Asp Pro Gly Asp Leu Thr Asp Pro Arg Met Arg Thr Leu Arg Gly Leu Thr Arg Asp Leu Leu Ala Gly Thr Val Pro Phe Leu Ser Ile Cys Leu Gly His Gln Val Leu Ala Ala Glu Leu Gly Phe Pro Leu Ala Arg Arg Ala Val Pro Asn Gln Gly Val Gln Lys Arg Ile Asp Leu Phe Gly Arg Pro Glu Leu Val Gly Phe Tyr Asn Thr Tyr Thr Ala Arg Ser Ala His Asp Val Val Ala Gly Gly Arg Arg Gly Pro Ile Glu Ile Ser Arg Ser Pro Asp Ser Gly Asp Val His Ala Leu Arg Gly Pro Gly Phe Arg Ser Val Gln Phe His Leu Glu Ser Val Leu Thr Gln His Gly Pro Arg Ile Leu Gly Asp Leu Leu Val Ser Leu Leu Ala Asp Gly Thr Ala Ala Ala Ala Ala Glu Ala Ala Gly Arg Arg Gly Asn Arg Pro NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain 046-ECOll SEQUENCE:39 atggacgggacggaatcgaacgtgaccggattccccgatctgctgtccggtctcggcggc60 gacgggcgcgccttcgccctgctgcaccggcccggcgcggccgggtgcgcgtacgtggag120 gttctgaccggcgaggtgtgcgacgtggacactctcggcgagctgcccctgcccaccgag180 ccggcgaccggcgcgcggcacgacctgctcgtggcggtgccgtaccggcaggtcaccgaa240 cgggggttcgactgccacgacgacggcgcgccgctgctcgcgatgcgcgtccacgagcag300 ttcgggctcgaccgcggacaggcgctggcgggcctgcccgaacgcggtgtgccggtgacc360 gacgccgacttcgacctcagcgacgaggactacgccgcgatcgtcaagcgggtggtgggt420 gacgagatcgggctgggcgccggatccaacttcgtcatccggcgcaccttcaccgcgcgg480 ctggccgactactcgatcgccacggaactggcgctcttccgccggttgctgaccggcgaa540 ctgggttcctactggacgtttctgttccactccggcgccggcacgttcatcggcgcgtca600 ccggaacgacacgtcagcatgatcgacggaaccgtctcgatgaatcccatcagcgggacc660 taccggcaccccccgaacggcccggccgtttccggtctgctggaattcctgaacgacccg720 aaagaggctaacgaactctacatggtcgtcgacgaggaactgaaaatgatggcgcggatg780 tgcgcctccggcggccaggtgcacggcccgttcctcaaggaaatggcgcgggtgacgcac840 tccgagtacatcctgaccggccgcagcgacctggacgtgcgcgacgtgctgcgggagacc900 ctgctcgcgccgacggtcaccggcagcccgatcgagaacgcgttccgggtcatcacccgc960 cacgagacgaccggccgcggctactacggcggcgtgctcgcgttgatgggccgtgactcg102() gccggcagccgtacgctcgactcggccatcatgatccgcaccgccgagatcgacgacgcg1080 ggcacgctgcgcctgggcgtcggcgccaccctcgtgcgggactccaagccggagtcggag114() gtggccgagacgcgggccaaggcgggcgccatgcgcgcggcgctcggcctcggcgtcgac1200 ccggacggcccggacggcgggcggaccacggccgcgcgggctcgttcgtccctggccacc1260 gacccccgggtacggcgggcgttgcgcgagcgcaacaccacactgtcgaggttctggctc132() gacggcgcggagcggcgcaccccgaacccggcgctgaccggacgccgcgtgctcgtcgtc1380 gacaacgaggacacgttcatggccatgctcgaccaccagttgcgggccctcgggctgcgg1440 tcgagcatcgcccggttcgacagccggctgcggccggacggacacgacctcgtcgtcgtc1500 ggtcccggceccggcgacccgggcgacctgaccgacccgcgtatgcggaccctgcgcggg1560 ctcacccgcgacctgctcgccggaacggtgccgttcctgtccatctgcctgggccaccag162() ~1 gtgctcgccgccgaactggggttccccctcgcccggcgcgcggtgcccaaccagggtgtg 1680 cagaagcggatcgacctgttcggccggccggaactcgtggggttctacaacacctacacc 1740 gcccgctccgcgcacgacgtggtggccggtggccggcggggcccgatcgagatcagccgc 1800 agcccggacagcggggacgtgcacgcgctgcgcggcccgggattccgttccgtccagttc 1860 cacctggagtccgtcctcacccagcacggcccacggatcctgggcgacctgctggtctcc 1920 ctgctcgccgacggcacggccgccgccgcggccgaggcggcgggccggcgcgggaaccgc 1980 ccgtga 1986 SEQ ID NO: 40 LENGTH: 427 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE: 40 ValLysThr ThrValAsp ValLeuVal GinLysTyr GlyGly ThrSer LeuGlnThr LeuAspArg ValArgHis AlaAlaLeu ArgIle AlaGlu AlaArgArg HisGlySer AlaValThr ValValVal SerAla ArgGly SerArgThr AspAspLeu LeuArgLeu AlaAlaAsp ValGly AlaAla GIyProSer ArgGluLeu AspGlnLeu LeuAlaVal GlyGlu SerGlu Ser Ala Ala Leu Met Ala Leu Ala Leu Thr Gly Leu Gly Val Pro Ala Val Ser Leu Thr Gly His Gln Ala Glu Ile His Thr Thr Asp Arg His Gly Asp Ala Leu Ile Ser Arg Ile Gly Ala Ala Arg Val Glu Ala Ala Leu Gly Arg Gly Glu Val Ala Val Val Thr Gly Phe Gln Gly Ile Asp Arg Ala Gly Asp Val Ala Thr Leu Gly Arg Gly Gly Ser Asp Thr Thr Ala Val Ala Leu Ala Ala Arg Leu Arg Ala Ser Ala Cys Glu Ile Tyr Thr Asp Val Asp Gly Val Phe Ser Ala Asp Pro Arg Ile Leu Pro Ala Ala Arg Cys Leu Pro Trp Val Glu Pro Gly Val Met Ala Glu Met Ala Phe Ala Gly Ala Arg Val Leu His Thr Arg Cys Ile Glu Leu Ala AIa Met Glu Gly Val Glu Val Arg Val Arg Asn Ala Ser Ser Gln Ala Pro Gly Thr Ile Val Val Asp Arg Pro Asp Asp Arg Pro Leu Glu Thr Arg Arg Ala Val Val Ala Val Thr His Asp Thr Asp Val Val Arg Val Leu Val His Cys Arg Asp Gly Arg Arg Asp Met Ala Pro Asp Val Phe Glu Val Leu Ala Ala His Gly Ala Val Ala Asp Leu Val Ala Arg Ser Gly Pro Tyr Glu Ser Glu Phe Arg Met Gly Phe Thr Ile Arg Arg Ser Gln Ala Glu Ala Val Arg Thr Ala Leu His Asp Leu Thr Ala Ser Phe Asp Gly Gly Val His Phe Asp Glu Asn Val Gly Lys Val Ser Val Val Gly Met Gly Leu Leu Ser Arg Pro Glu His Thr Ala Arg Leu Met Ala Ala Leu Ala Ala Ala Gly Ile Ser Thr Ser Trp Ile Ser Thr Ser Gln Met Arg Leu Ser val Ile Val Ser Arg Asp Arg Thr Val Asp Ala Val Glu Ala Leu His Arg Ala Phe Arg Leu Asp Arg Ser Glu Pro Ala Asp Ala Thr Ser Leu Thr Ser Arg Arg Ser Ala Thr Ala NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:41 gtgaagacgactgtggacgtgctggtccagaaatacgggggcacctcgctgcagaccctc60 gaccgcgttcggcacgccgcgctgcggatcgccgaggcgcggcggcacggctccgccgtg120 acagtggtcgtgtcggcgcgcggcagccggaccgacgacctgctgcggctggcggccgac180 gtcggcgccgcgggtccgtcccgggaactcgaccagttgctcgcagtcggcgagtccgag240 tcggcggcgctgatggcgctggcgttgaccgggctgggagtgccggccgtctcgctgacc300 gggcaccaggcggagatccacaccaccgaccggcacggcgacgcgctgatctcgcggatc360 ggggcggcgcgggtggaagcggcgctgggccgtggcgaggtcgccgtggtcaccggattc420 cagggcatcgaccgggccggtgacgtcgccacgctggggcgcggcggctccgacacgaca 480 gcggtggcgctcgcggcccggctccgcgcgtcggcgtgcgagatctacaccgacgtggac 540 ggcgtcttcagcgccgacccccgcatccttccggcggcgcgttgcctgccgtgggtggag 600 cccggcgtcatggcggagatggcgttcgccggcgcgcgggtcctgcacacccgatgcatc 660 gagctggccgccatggaaggggtcgaagtgcgcgtgcgcaacgcgtcgtcgcaggcgccc 720 ggaacgatagtcgtggaccggcccgacgaccggccgctggagacccggcgggccgtggtg 780 gcggtcacccacgacaccgatgtcgtccgcgtgctggtgcactgccgcgacggccgccgg 840 gacatggcacccgacgtgttcgaggtgctggccgcccatggggcggtggcggacctggtg 900 gcccggtccgggccctacgagagcgagttccggatggggttcaccatccgccgcagccag 960 gccgaagcggtgcggaccgcgctgcacgacctcaccgcgtccttcgacggcggggtccac 1020 ttcgacgagaacgtcggcaaggtgtccgtggtcggcatgggcctgctcagccgccccgag 1080 cacacggcccggctgatggcggcgctggccgcggcggggatctcgacgagctggatctcc 1140 acctcccagatgcggctgtcggtgatcgtgtcgcgggaccgcaccgtcgacgccgtcgaa 1200 gccctgcaccgcgcgttccgcctggaccggtccgagccggcggacgccacgtccctgacc 1267 tcccgccgttccgccaccgcctga 1284 SEQ ID NO: 42 LENGTH: 274 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 42 Val Ala Val Leu Asn Ala Ser Phe Ala Arg Gly Leu Arg Leu Arg Arg Leu Phe Arg Arg Gly Asp Gly Arg Leu Leu Val Val Pro Leu Asp His Ser Val Thr Asp Gly Pro Leu Arg Arg Gly Asp Leu Asn Ser Leu Leu Gly G1u Leu Ala Gly Thr Gly Val Asp Ala Val Val Leu His Lys Gly Ser Leu Arg His Val Asp His Gly Trp Phe Gly Asp Met Ser Leu Ile Val His Leu Ser Val Ser Thr Arg His Ala Pro Asp Pro Asp Ala Lys Tyr Leu Vai Ala His Val Glu Glu Ala Leu Arg Leu Gly Ala Asp Ala VaI Ser Val His Val Asn Leu Gly Ser Pro Gln Glu Ala Arg Gln Ile Ala Asp Leu Ala Ala Val Ala Gly Glu Cys Asp Arg Trp Asn Val Pro Leu Leu Ala Met Val Tyr Ala Arg Gly Pro Gln Ile Thr Asp Ser Arg Ala Pro Glu Leu Val Ala His Ala Ala Thr Leu Ala Ala Asp Leu Gly Ala Asp Ile Val Lys Thr Asp Tyr Val Gly Thr Pro Glu Gln Met Ala Glu Val Val Arg Gly Cys Pro Ile Pro Leu Ile Val Ala Gly Gly Pro Arg Ser Ala Asp Thr Pro Thr Val Leu AIa Tyr Val Ser Asp Ala Leu Arg Gly Gly Val Ala Gly Met Ala Met Gly Arg Asn Val Phe Gln Ala Glu Gln Pro Gly Leu Met Ala Ala Ala Val Ala Arg Leu Val His Glu Pro Arg His Val Pro Asp Arg Tyr Asp Val Asp Asp Arg Leu Ala Leu Thr Ser NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain 046-ECOll SEQUENCE:43 gtggccgtactcaacgcttcgttcgctcgtggcctgcgtctgcgccgactgttccgacgc60 ggcgacggacgcctgctcgtcgtcccgctcgaccactccgtcaccgacgggccgctgcgc120 cgcggcgacctgaactcgctgctcggtgagctcgccggcaccggcgtggacgccgtggtg180 ctgcacaagggcagcctgcggcacgtcgaccacggctggttcggcgacatgtcgctgatc240 gtgcatctgagcgtgagcacccggcacgccccggacccggacgcgaagtacctggtcgcg300 cacgtggaggaggcgctgcggctgggcgccgacgcggtcagcgtgcacgtcaacctcggc360 tcaccgcaggaggcgcggcagatcgccgacctggcggcggtggcgggggagtgcgaccgc420 tggaacgtcccgctgctggccatggtgtacgcccgcgggccgcagatcaccgactcccgg480 gcaccggagctggtggcgcacgccgcgacgCtCgCCgCggacctcggcgccgacatcgtc540 aagaccgactacgtgggcacgcccgagcagatggccgaggtggtgcgcggctgcccgatc600 ccgctgatcgtggccggcggcccgcgctcggccgacactccgacggtgctcgcctacgtc660 tcggacgcgctgcgcggcggcgtggccgggatggccatgggccgcaacgtgttccaggcc720 gagcagcccg gcctgatggc cgccgccgtg gcacggctgg tgcacgagcc acggcacgtg 780 ccggaccggt acgacgtcga cgaccggctc gcccttacgt cctga 82.5 SEQ ID N0: 44 LENGTH: 367 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 44 Val Lys Leu Cys Trp Leu Asp Ile Arg Asn Val Asn Gly Ala Lys Glu Aia Ile Val Glu Glu Ala Val His Gln Arg Val Asp Ala Val Val Ala Ala Asp Pro Ala Asp Leu Glu Thr Leu Pro Pro Thr Val Lys Lys Val Leu Phe Pro GIn Gly Gly Pro Leu Pro Glu Lys Leu Glu Pro Ala Asp Leu Val Ile Val Glu Pro Ala Arg His Gly Glu Pro Ala Glu Leu Ala Ala Arg Tyr Pro Glu Val Glu Phe Gly Arg Phe Val Glu Ile Val Asp Ala Asp Ser Leu Glu Asp Ala Cys Arg Ser Ala Arg His Asp Arg Trp Ser Leu Leu Tyr Phe Arg Asp Pro Thr Lys Ile Pro Leu Glu Ile Val Leu Ala Ala Ala Ala Gly Ala Glu Gly Ser Ile Ile Thr Gln Val Ala Asp Val Glu Glu Ala Glu Ile Val Phe Gly Val Leu Glu His Gly Ser Asp Gly Val Met Leu Ala Pro Arg Ala Val Gly Glu Ala Thr Glu Leu Arg Thr Ala Ala Val Ser Thr Ala Ala Asp Leu Ser Leu VaI Glu Leu Glu Val Thr Gly Ile Arg Arg Val Gly Met Gly Glu Arg Ala Cys Val Asp Thr Cys Thr Asn Phe Arg Leu Asp Glu Gly Ile Leu Val Gly Ser His Ser Thr Gly Met Ile Leu Cys Cys Ser Glu Thr His Pro Leu Pro Tyr Met Pro Thr Arg Pro Phe Arg Val Asn Ala Gly Ala Leu His Ser Tyr Thr Leu Ser Ala Gly Gly Arg Thr Asn Tyr Leu Ser Glu Leu Val Ser Gly Gly Arg Val Leu Ala Val Asp Ser Gln Gly Lys Ser Arg Val Val Thr Val Gly Arg Val Lys Ile Glu Thr Arg Pro Leu Leu Ala Ile Asp Ala Val Ser Pro Ser Gly Thr Arg Val Asn Leu Ile Val Gln Asp Asp Trp His Val Arg Val Leu Gly Pro Gly Gly Thr Val Leu Asn Val Thr Glu Leu Thr Ala Gly Thr Lys Val Leu Gly Tyr Leu Pro Val Glu Lys Arg His Val Gly Tyr Pro Ile Asp Glu Phe Cys Ile Glu Lys N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:45 gtgaagctgtgctggctggacatccgtaacgtcaacggcgccaaggaggcaatcgtcgag60 gaggcggtccaccagcgggtggacgccgtcgtggcggccgatccggccgacctggagacg120 cttcccccgacggtgaagaaggtgctgttcccgcagggcgggccgctgccggagaagctg180 gaaccggccgacctggtgatcgtcgagccggcccggcacggcgagcccgccgagctggcg240 gcccggtacccggaggtggagttcggccggttcgtcgagatcgtcgacgcggacagcctg300 gaggacgcctgccggtccgcgcgccacgaccggtggagcctgctgtacttccgcgacccc360 accaagatcccgctggagatcgtgctggcggccgcggcgggcgcggagggcagcatcatc420 acccaggtcgccgacgtcgaggaggcggagatcgtcttcggcgtcctggagcacggctcg480 gacggagtgatgctggcgccccgcgccgtgggggaggccaccgagctgcggaccgccgcg540 gtgagcacggcggcggacctgtcgctcgtggagctggaggtcaccggcatccggcgggtg600 ggcatgggcgagcgcgcctgcgtcgacacgtgcacgaacttccgtctggacgagggcatc660 ctggtcggctcgcactccaccggcatgatcctgtgcr_gcagcgagacgcatccgctgccg720 tacatgccgacccggccgttccgggtcaacgccggcgcgctgcactcgtacacgctctcc780 gccggcgggcggaccaactacctcagcgagctggtctccggcggccgggtgctcgccgtg840 gactcgcaggggaagtcccgcgtcgtcacagtgggacgggtcaagatcgagacgcgtccg900 ctgctggcgatcgacgcggtctccccctccgggacacgcgtcaacctcatcgtccaggac960 gactggcacgtgcgcgtgctcgggccgggcggcaccgtgctcaacgtgaccgagctgacc1020 gccggcacga aggtgctcgg ttacctgccg gtggagaagc ggcacgtcgg ctacccgatc 1080 gacgagttct gcatcgagaa gtga 1104 SEQ ID NO: 46 LENGTH: 253 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE. 46 Met Thr Ala Gln Pro Val Leu Asp Phe His Val Arg Leu Ala Pro Arg Pro Gly Ala Arg Glu Arg Leu Leu Ala Ala Leu Arg Glu Cys Gly Leu Ala Arg Ala Val Val Cys Ala Gly Gly Thr Ile Asp Leu Asp Arg Leu Ser Arg Gln Leu Val Thr Gly Gly His Val Glu Thr Asp Ala Asp Asn Asp Ala Val Ala Ala Ala Cys Ala Gly Thr Asp Gly Arg Leu Val Pro Phe Phe Phe Ala Asn Pro His Arg Pro Ala Glu Ala Tyr Arg Ala Arg Ala A1a Glu Phe Arg Gly Leu Glu Ile Ser Pro Ala Val His Gly Val Ala Leu Thr Asp Pro Arg Val Ala Asp Leu val Ala Val Ala Ala Glu Phe Asp His Pro Val Tyr Val Val Cys Leu Asp Arg Pro Gly Ala Gly Val Ala Asp Leu Val Gly Leu Ser Arg Arg Phe Pro Gln Val Ser Phe Val Leu Gly His Ser Gly Val Gly Asn Ile Asp Leu Tyr Ala Leu Thr Leu Ile Gln Asp Glu Pro Asn Ile Ser Leu Glu Thr Ser Gly Gly Tyr Thr Cys Val Ala Glu Ala Ala Leu Arg Arg Leu Gly Asp Asp Arg Val Val Phe Gly Ser Glu Tyr Pro Leu Gln His Pro Ala Val Glu Leu Ala Lys Phe Gln Ala Leu Arg Leu Pro Pro Glu Arg Trp Arg Arg Ile Ala Trp Asp Asn Ala His Arg Leu Leu Gly Glu Glu Lys Arg SEQ ID NO: 47 LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:47 atgaccgcgcagccggtgctggacttccacgtacgcctggcgccccggcccggggcgcgg60 gagcggctgctcgccgcgctgcgcgagtgcgggctggcgcgggcggtggtgtgcgcgggc120 ggcaccatcgacctggaccggctgtcccgccagctcgtcaccggcggccacgtcgagacc180 gacgccgacaacgacgcggtggcggcggcctgcgccggcaccgacggccggctggtgccg240 ttcttcttcgCCaaCCCgCaCCggCCggCCgaggcgtaccgggcccgcgccgccgagttc300 cgcggcctggagatctcacccgccgtccacggcgtcgccctgaccgacccgcgggtcgcc360 gacctcgtggccgtggcggcggagttcgaccatccggtgtacgtggtctgcctggaccga420 cccggcgcgggcgtggccgacctggtcggcctgagccgccggttcccgcaggtgagcttc480 gtgctcgggcacagcggcgtcggcaacatcgacctctacgccctgaccctgatccaggac540 gagccgaacatctcgctggagacctccggcggctacacctgcgtggccgaggcggcgcta600 cgccgcctcggcgacgaccgggtggtgttcggctccgagtacccgctgcagcacccggcc660 gtggaactggccaagttccaggcgttgcgactgccgccggagcggtggcggcggatcgcc720 tgggacaacgcgcatcgactgctaggagaggagaagcggtga 762 SEQ ID N0: 48 LENGTH: 438 TYPE: PRT
ORGANISM: Micromonospora sp. strain 045-ECO11 SEQUENCE: 48 v'al Ser ProSer Ser Pro ArgLeu Gly TrpHis Glu Ser Leu Gln Gly Leu. Glu LeuArg Leu Glu LysGln Leu GluThr Asp Arg Gln Ala Phe Thr Trp AlaArg Pro Tyr ArgAla Arg AlaSer Ala Ser Phe Leu Gly Ala Pro Pro Val Thr Pro Ala Asp Leu Ala Asp Leu Pro Leu Thr Thr Lys Gln Asp Leu Arg Asp Asn Tyr Pro Phe Gly Met Leu Ala Val Pro Arg GIu Arg Leu Ala Thr Tyr His Glu Ser Ser Gly Thr Ala Gly Lys Pro Thr Pro Ser Tyr Tyr Thr Ala Glu Asp Trp Thr Asp Leu Ala Glu Arg Phe Ala Arg Lys Trp Ile Gly Met Ser Ala Asp Asp Val Phe Leu Val Arg Thr Pro Tyr Ala Leu Leu Leu Thr Gly His Leu Ala His Ala Aia Ala Arg Leu Arg Gly Ala Thr Val Val Pro Gly Asp Asn Arg Ser Leu Ala Met Pro Tyr Ala Arg Val Val Arg Val Met His Asp Leu Asp Vai Thr Leu Thr Trp Ser Val Pro Thr Glu Cys Leu Ile Trp Ala Ala Ala Ala Ile Ala Ala Gly His Arg Pro Asp Ile Asp Phe Pro Ala Leu Arg Ala Leu Phe Val Gly Gly Glu Pro Met Thr Asp Ala Arg Arg Arg Arg Ile Ser Arg Leu Trp Gly Val Pro Val Ile Glu Glu Tyr Gly Ser Thr Glu Thr Gly Ser Leu Ala Gly Glu Cys Pro Glu Gly Arg Leu His Leu Trp Ala Asp Arg Ala Leu Phe Glu vaI Tyr Asp Pro Asp Thr Gly Ala Val Arg Ala Asp Gly Asp Gly Gln Leu Val Val Thr Pro Leu Phe Arg Glu Ala Met Pro Leu Leu Arg Tyr Asn Leu Glu Asp Asn Val Ser Val Ser Tyr Asp Asp Cys Gly Cys Gly Trp Lys Leu Pro Thr Vai Arg Val Leu Gly Arg Ser Ala Phe Gly Tyr Arg Val Gly Gly Thr Thr Ile Thr Gln His Gln Leu Glu Glu Leu Val Phe Ser Leu Pro Glu Ala His Arg Val Met Phe Trp Arg Ala Lys Ala Glu Pro Ala Leu Leu Arg Val Giu ile Glu Val Ala Ala Ala His Arg Val Ala Ala Glu Ala Glu Leu Thr Ala Ala I1e Arg Ala Ala Phe Gly Val Asp Ser Glu Val Thr Gly Leu Ala Pro Gly Thr Leu Ile Pro Leu Asp Ala Leu Thr Ser Met Pro Asp Val Vai Lys Pro Arg Ser Leu Phe Gly Pro Asp Glu Asp Trp Ser Lys Ala Leu Leu Tyr Tyr N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:49 gtgagcgagccaagttcgagcctgccccggctcggccagtggcacggcctcgaggacctg60 cggcgcctccaggagaagcaactggcggagacgttcacctgggcggcccggtcgccgttc12c) taccgggcgcggctggcctccggcgcgccgccggtgacgcccgccgacctggccgacctg180 ccgctgaccaccaagcaggacctgcgggacaactaccccttcggcatgctcgccgtgccc240 cgcgaacggctggcgacctaccacgagtcgagcgggaccgccgggaagcccaccccctcc300 tactacaccgcggaggactggaccgacctggcggagcgcttcgcccgcaagtggatcggc360 atgtccgccgacgacgtcttcctggtccgcacgccgtacgcgctgctgctgaccgggcat420 ctcgcccacgccgcagcccggctgcgtggggccacggtggtacctggcgacaaccggtcg480 ctggcgatgccgtacgcccgggtggtccgggtgatgcacgacctggacgtcacgctcacc540 tggtcggtgccgacggagtgcctgatctgggccgccgcggcgatcgcggccgggcaccgg600 cccgacatcgacttcccggcgctgcgcgcgctgttcgtcggcggcgagccgatgaccgac660 gcccgccggcggcggatcagccgcctgtggggggtgccggtcatcgaggagtacggctcg720 acggagaccggcagcctggccggggagtgccccgagggacgcctgcacctgtgggccgac780 cgggcgctgttcgaggtgtacgacccggacaccggcgccgtccgcgcggacggcgacggc840 cagctcgtggtcacgccgctgttccgggaggcgatgccgctgctgcggtacaacctggag90() gacaacgtgtcggtctcctacgacgactgcggatgcggctggaagctgcccaccgtgcgg960 gtgctcggccggtcggcgttcggctaccgggtcggcggcaccaccatcacccagcaccag1020 ctggaggaactggtcttctccctgccggaggcgcaccgggtgatgttctggcgggccaag1080 gcggagccggcgctgttgcgggtcgagatcgaggtggccgccgcgcaccgggtcgccgcc1140 gaggcggagctgaccgccgcgatccgggccgccttcggcgtggacagcgaggtcaccggc1200 ctggcgccgggaaccctgatcccgctcgacgcgctgaccagcatgccggacgtggtgaag1260 ccacgcagcctgttcggtccggacgaggactggagcaaagcgctcctctactactga 1317 SEQ ID NO: 50 LENGTH: 396 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 50 Met Pro Gln Met Arg Val Ala Val Ala Gly Ala Gly Ile Ala Gly Leu Ala Phe Ala Ala Ala Leu Arg Arg Thr Gly Ile Asp Cys His Val Tyr Glu Gln Ala Asp Gln Leu Met Glu Val Gly Ala Gly Val Gln Val Ala Pro Asn Ala Thr Arg Leu Leu His Arg Leu Gly Leu Arg Asp Arg Leu Arg Thr Val Ala Val Ala Pro Gln Ala Ile Glu Met Arg Arg Trp Asp Asp Gly Thr Leu Leu Gln Arg Thr Gln Leu Gly Ser Val Cys Gly Arg Arg Phe Gly Ala Pro Tyr Tyr Val Val His Arg Ala Asp Leu His Ser Ser Leu Leu Ser Leu Val Pro Pro Asp Arg Val His Leu Gly Ala Arg Leu Thr Ala Val Thr Gln Thr Ala Asp Glu Ala Tyr Leu His Leu Ser Asn Gly Thr Thr Val Ala Ala Asp Leu Val Val Gly Ala Asp Gly Ile His Ser Val Ala Arg Glu Gln Ile Val Ala Asp Arg Pro Arg Phe Ser Gly Gln Ser Ile Tyr Arg Gly Leu Val Pro Ala Glu Arg Val Pro Phe Leu Leu Thr Glu Pro Arg Val Gln Leu Trp Phe Gly Pro Asp Gln His Cys Val Cys Tyr Pro Val Ser Ala Gly Arg Gln Val Ser Phe Gly Ala Thr Val Pro Ala Thr Asp Trp Arg Gln Glu Ser Trp Ser Gly Arg Gly Asp Val Thr Gln Leu Ala Ala Ala Tyr Ala Gly Trp His Pro Asp Val Thr Arg Leu Ile Ala Ala Ala Asp Arg Val Gly Arg Trp Ala Leu His Asp A_rg Asp Ser Ile Asp Arg Leu Ser Ala Gly Arg Val Thr Leu Ile Gly Asp Ala Ala His Pro Met Leu Pro Phe Gln Ala Gln Gly Ala Asn Gln Ala Val Glu Asp Ala Val Val Leu Ala Val Cys Leu Ala Gly Val Glu Pro Ala Gly Leu Gly Ala Ala Leu Arg Arg Tyr Glu Arg Ile Arg Leu Pro Arg Thr Thr Arg Ile Gln Arg Gln Ser Arg Ala Asn Ala Glu Met Phe His Leu Ala Asp Gly Ala Asp Gln Arg Arg Arg Asp Val Ala Ala. Gln Ser Ser Ser Gly Leu Asp Arg His Glu Trp Leu Phe Gly Tyr Asp Ala Glu Lys Ala Thr Thr Thr Ser Gly Ser Ala SEQ ID N0: 51 LENGTH: 1191 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE:51 atgccgcagatgagggtcgccgtggccggcgccggcatcgccgggctcgccttcgccgcc60 gccctgcgccggaccgggatcgactgccacgtgtacgaacaggccgaccagctcatggag120 gtgggcgcgggcgtgcaggtcgcgccgaacgccacccggctgctgcaccggctgggcctg180 cgtgaccgcctgcgtacggtggctgtcgcgccgcaggcgatcgagatgcgccgctgggac240 gacggcacgctgctgcaacgcacccagctgggcagcgtgtgcggacgccgcttcggcgcg300 ccgtactacgtggtgcaccgcgcggacctgcacagcagcctgctgtcgctggtgccgccg360 gaccgggtgcacctgggcgcccgcctcaccgccgtgacgcagaccgccgacgaggcgtac42() ctgcacctgtccaacggcaccacggtcgcggcggatctcgtcgtgggcgccgacggcatc480 cactcggtcgcgcgggagcagatcgtggcggaccggccgcgcttctccggacagtccatc540 taccgcgggctggtgccggccgagcgggtgccgttcctgctcaccgaaccccgggtgcag600 ttgtggttcgggccggaccagcactgcgtctgctacccggtgtccgccggccggcaggtg660 agcttcggcgcgacggtgcccgccaccgactggcggcaggagtcgtggtcgggccggggc720 gacgtgacgcaactcgcggccgcgtacgcgggctggcacccggacgtcacccggctgatc78() gccgcggccgaccgggtcggcaggtgggcgctgcacgaccgggacagcatcgaccggctc840 agcgcgggacgggtgaccctgatcggcgacgccgcgcacccgatgctgccgttccaggcg900 cagggcgcgaaccaggccgtcgaggacgcggtggtgctcgcggtctgcctggccggcgtg960 gaaccggcgggcctgggcgccgcgctgcgccgctacgaacggatccgcctgccccggacc1020 acccggatccagcggcagtcccgggccaacgccgagatgttccacctggccgacggcgcc1080 gaccagcgccgccgggacgtcgccgcacaatcctcgt:ccggcctggaccgccacgaatgg114() ctcttcgggtacgacgccgagaaagccaccacgaccagcgggagcgcctga 119=

SEQ ID NO: 52 LENGTH: 261 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 52 Met Glu Leu Thr Gly Tle Glu Ser Lys Val Ala Leu Val Thr Gly Ala Gly Gln Gly Ile Gly Ala Ala Val Ala Gly Val Leu Ala Arg Ala Gly A1a Gln Val Ala Ala Val Asp Arg Asn Ala Glu Ala Leu Thr Thr Val Val Thr Lys Leu Ala Ala Glu Gly Asp Ser Ala Arg Ala Tyr Cys Val Asp Val Cys Asp Ser Glu Ala Val Asp Ala Leu Val Arg Arg Val Glu Asp Glu Met Gly Pro Val Ala Ile Leu Val Asn Ala Ala Gly Val Leu His Thr Gly Arg Val Val Glu Leu Ser Asp Arg Gln Trp Arg Arg Thr Phe Ser Val Asn Ala Asp Gly Val Phe His Val Ser Arg Ala Val Ala Arg Arg Met Val Gly Arg Arg Arg Gly Ala Ile Val Thr Val Ala Ser Asn Ala Ala Gly Val Pro Arg Thr Glu Met Ala Ala Tyr Ala Ala Ser Lys Ala Ala Ser Ala Gln Phe Thr Arg Cys Leu Gly Leu Glu Leu Ser Gly Tyr Gly Ile Arg Cys Asn Val Val Ser Pro Gly Ser Thr Asp Thr Pro Met Leu Arg Ala Met Leu Gly Glu Gly Ala Asp Pro Ser Ala Val Ile Glu Gly Thr Pro Gly Ala Tyr Arg Val Gly Ile Pro Leu Arg Lys Leu Ala Gln Pro Arg Asp Val Ala Glu Ala Val Ala Tyr Leu Val Ser Asp Gln Ala Gly His Val Thr Met His Asp Leu Tyr Val Asp Gly Gly Ala Ala Leu His Val SEQ ID N0: 53 LENGTH: 786 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE:53 atggaactgaccggaatcgagtcgaaggtcgccctggtcacgggcgcggggcagggcatc 6U

ggcgccgccgtggccggtgtcctggcgagggcgggcgcgcaggtggcggcggtggaccgc 120 aacgccgaggcgctgaccaccgtcgtgacgaagctcgccgccgagggcgactcggcgcgc 180 gcctactgcgtcgacgtgtgcgacagcgaggcggtggacgcgctggtgcgccgggtcgag 240 gacgagatggggccggtcgccatcctggtcaacgccgccggcgtgctgcacaccggacgg 30U

gtcgtcgagctgtcggaccggcagtggcgccggaccttctcggtgaacgccgacggcgtg 360 ttccacgtgtcccgggcggtggcgcggcggatggtgggccgccgtcgtggcgcgatcgtc 420 accgtggcgtcgaacgccgccggggtgccgcgtaccgagatggccgcgtacgccgcctcc 48U

aaggccgcgtccgcgcagttcacccgctgcctggggcttgagctgtccggctacggcatc 540 cggtgcaacgtggtctcgcccggctccaccgacacccccatgctgcgggccatgctcggc 60() gagggcgccgacccgagcgcggtgatcgagggcacgccgggcgcgtaccgcgtcggcatc 660 ccgctgcgcaagctggcccagccgcgcgacgtggccgaggcggtcgcctatctggtgtcc 720 gaccaggcgggccacgtgaccatgcacgacctgtacgtcgacggcggcgcggccctgcac 780 gtgtga 786 SEQ ID N0: 54 LENGTH: 224 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 54 Met Ala Met Thr Pro Ile Ala Pro Tyr Arg Met Pro Gly Asp Gly Asp Leu Pro Gly Thr Ala Leu Pro Trp Arg Pro His Pro Asp Arg Ala Ala Val Leu Val His Asp Leu Gln Arg Tyr Phe Leu Arg Pro Phe Glu Ala Gly Glu Ser Pro Met Ala Glu Leu Leu Pro Asn Val Ala Lys Leu Leu Ala Thr Ala Arg Ala Ala Gly Val Pro Val Leu Tyr Thr Ala Gln Pro Gly Gly Met Ser Arg Gln Asp Arg Gly Leu Leu His Asp Leu Trp Gly Pro Gly Met Ser Ser Ala Glu Asp Asp Arg Gly Ile Val Asp Asp Val Ala Pro Gln Pro Gly Asp Thr Val Leu Thr Lys Trp Arg Tyr Ser Ala 7$

Phe Phe Arg Ser Asp Leu Glu Glu Arg Leu Arg Gly Ala Gly Arg Asp Gln Leu Val Val Cys Gly Val Tyr Ala His Met Gly Cys Leu Ile Thr Ala Cys Asp Ala Phe Ser Arg Asp Ile Glu Ala Phe Leu Val Ala Asp Ala Leu Ala Asp Leu Ser Arg Glu Asp His Leu Met Ala Leu Arg Tyr Ala Ala Asp Arg Cys Ala Val Pro Leu Trp Thr Ala Asp Val Leu Asp Gly Leu Asp Ala Ser Ser Gln Arg Ala Ala Gly Thr Arg Pro Asp Gln N0:

LENGTH: 5 TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:55 atggccatgaccccgatcgcgccgtaccgcatgcccggcgacggcgacctgcccggcacc60 gcgctgccctggcgtccgcacccggaccgggccgccgtgctggtgcacgacctgcaacgc120 tacttcctgcgcccgttcgaggccggggagtccccgatggccgaactgctccccaacgtc180 gcgaagctgctcgccacggcgcgggcggccggcgtgccggtgctgtacaccgcgcagccc240 ggcggcatgagccggcaggaccgcgggttgctgcacgacctgtggggccccggcatgagc300 agcgccgaggacgaccggggcatcgtcgacgacgtcgccccgcagccgggcgacacggtg360 etgaccaagtggcgctacagcgcgttcttccgcagcgacctggaggagcgactgcgcggt420 gcgggacgggaccagctcgtggtctgcggcgtgtacgcgcacatggggtgcctgatcacc480 gcctgcgacgcgttcagccgcgacatcgaggcgttcctggtggcggacgcgctggccgac540 ctatcgcgcgaggaccacctgatggcgctgcgctacgccgcggaccgctgcgcggtgccg600 ttgtggacggcggatgtgctggacgggctggcggacgccgccgggcgtccggatcagagc660 agcacccaacgatga 675 SEQ ID NO: 56 LENGTH: 233 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 56 Met Ser Asp Arg Thr Arg Val Val Val Val Gly Gly Thr Ser Gly Ile Gly Arg His Phe Ala Arg Phe Cys Ala Glu Arg Gly Asp Asp Val Val Ile Thr Gly Arg Ser Ala Ala Arg Thr Lys Thr Val Ala Asp Glu Ile Gly Gly Arg Thr Arg Gly Leu Ala Leu Asp Leu Ala Glu Pro Glu Thr Ile Ala Asp Ala Leu Ala Asp Val Pro His Val Asp Arg Leu Val Val Ala Ala Leu Asp Arg Asp Tyr Asn Thr Val Arg Ala Tyr Arg Pro Gly Asp Ala Ala Arg Leu Leu Thr Val Lys Leu Val Gly Tyr Thr Ala Vai Leu His Ala Leu Ala Pro Arg Met Thr Asp Glu Ser Ala Val Val Leu Leu Gly GIy Leu Ala Ser His Arg Pro Tyr Pro Gly Ser Thr Ser Val Thr Thr Ala Asn Gly Gly Ile Ser Ala Leu Val Arg Thr Leu Ala Val Glu Leu Ser Pro Val Arg Val Asn Ala Leu His Pro Ser Ile Val Ser Asp Thr Pro Phe Trp Ser Asp Lys Pro Ala Ala Arg Glu Ala Ala Ala Thr Arg Ala Leu Ser Arg Arg Pro Val Thr Met Gln Asp Cys Ala GIu Ala Ile Asp Phe Leu Leu Thr Asn Arg Ser Ile Asn Gly Val Asn Leu Asn Ile Asp Gly Gly Asp Val Leu Ile NO:

LENGTH:

TYPE:
DNA

ORGANISM:MiCromonospora sp. strain SEQUENCE:57 atgtcggatcggacccgggtcgtggtcgtcggcggaacctcggggatcgggcggcacttc60 gcccgattctgcgccgaacgcggagacgacgtggtgatcaccggccgttcggcggcccgg120 accaagaccgtggcggacgagatcggcgggcggacccgtgggctcgctctcgacctggcc180 gagccggagacgatcgcggacgcgctcgccgacgtgccgcacgtcgaccggctcgtggtc240 gcggcgctggaccgcgactacaacaccgtccgcgcgtaccggccgggcgacgcggcgcgg300 ctgctgaccgtcaagctggtcggctacacggcggtcctgcacgccctcgccccgcggatg360 accgacgagagcgcagtcgtgctgctcggcggcctggccagccaccggccgtatcccggc420 tccacctccgtcacgaccgccaacggcgggatcagcgcgctggtgcggaccctggctgtg480 gaactctcgc cggtccgggt caacgccctg cacccgagca tcgtctccga cacgccgttc 540 tggagcgaca agcccgccgc gcgggaggcc gccgcgaccc gcgcgctcag ccgacggccg 600 gtcaccatgc aggactgcgc cgaggcgatc gacttcctgc tgacgaaccg ctcgataaac 660 ggggtcaacc tgaacatcga cggcggggac gtgctcatct ga 702 SEQ ID NO: 58 LENGTH: 246 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 58 Met Thr Ser Ala Leu Arg Thr Ser Ala Trp Thr Tyr Asp Asp Phe Thr Ser Arg Glu Leu Asp Pro Ala Arg Trp Ala Ile Met Ser Ile Ala Gly Ala Asp Gly GIn Thr His Arg Tyr Gln Asp Arg Asn Ala Gln VaI Arg Thr Gly Asp Gly Arg Leu Glu Leu Thr Val Asp Pro Phe Thr Arg Phe His Asp Thr Asp Pro Arg Gln Asn Asn Ala Lys Gln Met Tyr Arg Ser Val Arg Arg Phe Ala Val Pro Ala Glu Gly Ser Leu Thr Val Glu Val Glu Met Gly Val Arg Thr Tyr Arg Gln Ile Pro His Asp Leu Leu Asp Ala Phe Gly Thr Val Asn Leu Phe Asp Leu Glu Thr Gly Val Val Phe Asn Ala Ala Ala Thr Asn Asp Thr Val Tyr Ala Thr Val Glu Arg Leu Val Leu Pro Gly Val Thr Gln Pro His Glu His Tyr Ile His Arg Val Val Leu Asp Val Pro Thr Glu Pro GIy Arg Ala His Gly Tyr AIa Ile Thr Tyr Arg Ala Pro Thr Ser Glu Val Glu Phe His Val Asp Gly Arg Leu Ala Tyr Trp Ala Arg VaI Pro Val Pro Va1 Thr Gly Phe His Ala Gly Met Ala Leu Phe Ser AIa Arg Asp Leu Ala Arg Tyr Pro Arg Glu Gln Arg Glu His Gly Gln Gly Ala Thr Gly Trp Trp Gly Pro Trp Arg 7g Ile Ala Ser Gly Val Arg SEQ ID N0: 59 LENGTH: 74i TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE:59 atgacgtcggcactgagaaccagcgcgtggacgtacgacgacttcaccagccgcgagctg60 gaccccgcccgctgggcgatcatgtcgatcgccggcgcggacgggcagacccacaggtac120 caggaccgcaacgcccaggtccgcaccggcgacgggcggctggagctgaccgtcgacccg180 ttcacccgcttccacgacaccgatccccggcagaacaacgccaagcagatgtaccggtcg240 gtgcggcgcttcgccgtgccggcggagggctcgctgaccgtcgaggtggagatgggcgtg300 cggacgtaccggcagatcccgcacgacctgctggacgcgttcggcacggtgaacctgttc360 gacctggagaccggcgtcgtgttcaacgccgccgccacgaacgacaccgtgtacgcgacg420 gtcgagcgcctggtgctgcccggcgtgacccagccgcacgagcactacatccaccgggtg480 gtcctggacgtgccgacggagccgggccgggcgcacggatacgccatcacctaccgggcg540 ccgacgtcggaggtggagttccacgtcgacggccggctcgcctactgggcgcgggtcccg60() gtgccggtgaccggattccacgccggcatggcgctcttctccgcccgcgacctggcccgg66() tacccccgcgagcagcgggagcacgggcagggcgcgaccgggtggtgggggccgtggcgg720 atcgcctccggcgtcagatga 74:L

SEQ ID NO: 60 LENGTH: 111 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 60 Met Asp Thr Ala Ala Pro Ala Thr Asp Gly Gly Arg Tyr Leu Ala Val His His Ser Ala Glu Phe Arg Glu Leu Arg Arg Arg Ser Ser Thr Phe Thr Leu Trp Ala Ser Val Ala Phe Phe Gly Trp Trp Phe Leu Gly Ser Leu Leu Ala Thr Tyr Ala Pro Asp Phe Phe Arg Glu Lys Val Ala Gly Pro Val Asn Val Gly Leu Leu Phe Val Phe Leu Ser Phe Ala Phe Val Val Thr Leu Ala Ala Phe Tyr Leu Arg Tyr Ala Arg Thr His Leu Asp Pro Leu Ser Glu Lys Ile Arg Ala Asp Leu Glu Gly Ala Ser Arg N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:61 atggacacggcagctccggcaacggacggcggtcgctacctcgccgtccatcacagcgca6t) gagttcagggaactacggcgacgatcgagcacgttcacgctctgggccagcgtcgccttc120 ttcggctggtggttcctcggcagcctgctcgccacctacgcgccggacttcttccgggag180 aaggtggccggcccggtcaacgtgggtctgctcttcgtcttcctgtcgttcgccttcgtg24() gtgacgctcgccgccttctacctgcgttacgcccgcacgcatctcgatccgctcagcgag300 aagatccgtgccgacctggaaggagcgtcccgatga 336 N0:

LENGTH:

TYPE:
PRT

ORGANISM:Micromonospora sp. strain SEQUENCE: 62 Met Ser Val Ile Leu Ala Asp Pro Pro Pro Pro Val Asp Asn Thr Trp Ala Thr Pro Ala Ile Ala Val Pro Val Thr Ile Val Leu Ala Leu Ala Val Leu Tyr Leu Val Arg Ser Ala Arg Ala Ser Thr Thr Thr Ala Asp Gly Phe Leu Leu Ala Asp Arg Arg Ile Gly Pro Val Gln Asn Ala Leu Ala Val Ala Ser Ala Pro Leu Met Tyr Ser Thr Met Tyr Ile Ile Thr Gly His Ile Aia Leu Ser Gly Tyr Asp Ala Ile Leu Leu Met Thr Ala Phe Thr Met Gly Thr Met Leu Ala Leu Phe Leu Phe Ala Gly Pro Val Arg Asn Val Gly Gly Tyr Thr Leu Gly Asp Leu Leu Ala Val Arg Thr Arg Glu Arg Pro Ala Arg Ile Ala Ser Ala Val Leu Thr Leu Leu Thr Tyr Val Met Leu Thr Val Ile Met Met Ala Ala Ile Ala Phe Ile Phe Asn Arg Trp Phe Gly Val Asp Ala Leu Val Gly Leu Val Leu Pro Val Phe Val Val Gly Leu Ile Thr Val Gly Tyr Val Tyr Leu Gly Gly Met Leu Gly Val Thr Arg Ile Leu Val Phe Lys Leu Val Leu Ser Val Val Val Val Gly Val Leu Thr Ala Trp Val Leu Ala Arg Phe Asp Leu Asn Leu Phe Ser Leu Leu Glu Arg Ala Glu Ala Asn Ala Ala Pro Val Pro Ser Gly Ser Asp Leu Leu Gly Pro Gly Arg Leu Phe Gly Glu Gly Ala Thr Thr Leu Val His Leu Ser Lys Leu Phe Ala Ile Ala Val Gly Val Ala Ala Ile Pro Phe Leu Phe Met Arg Asn Phe Ala Val Thr Ser Gly Arg Asp Ala Arg Arg Ser Thr Gly Trp Ala Ser Met Ile Ile Val Gly Phe Tyr Leu Cys Leu Ser Val Val Gly Leu Gly Ala Val Ala Ile Leu G1y Arg Asp Asn Ile Gly Val Ile Lys Ala His Arg Asp Ile Ser Phe Pro Lys Leu Aia Asp Glu Leu Gly Gly Pro Val Met Val Gly Ser Leu Ala Gly Val Ala Val Leu Thr Ile Val Gly Val Phe Ala Pro Leu Leu His Ser Ala Val Thr Thr Val Thr Lys Asp Leu Asn Val Ile Arg Gly Arg Arg Leu Asp Pro Ala Ala Glu Leu Arg Asp Ile Lys Arg Asn Thr Leu Ile Ile Gly Val Gly Ser Val Leu Leu Ala Val Val Met Leu Pro Val Arg Thr His Ile Phe Ile Pro Thr Ser Ile Asp Ile Ala Gly Ala Val Val Leu Pro Ile Val Val Tyr Ala Leu Phe Trp Arg Arg Phe Asn Thr Arg Gly Leu Gln Trp Thr Val Tyr Gly Gly Leu Ala Leu Thr Ala Phe Leu Val Leu Phe Ser Asn Gly Val Ser Gly Glu Pro Asp Ala Ile Phe Pro Asp Arg Asn Phe Lys Phe Val Asp Val Glu Pro Ala Leu Ile Thr Val Pro Val Gly Phe Leu Leu Gly Tyr Leu Gly Ser Ile Thr Ser Arg Glu Arg Asp Asp Ala Ala Phe Ala Glu Met Gln Val Arg Ser Leu Thr Gly Ala Val Val Thr Gly Pro Pro Arg Pro Ala Ala Val Asp Asp Glu Asp Arg Asp Gly Arg Gln Asp Arg Ala Pro Ser Pro Val Ser NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:63 atgagcgtcatcctcgccgacccgccacccccggtcgacaacacgtgggcgacgcccgcg60 atcgccgtgccggtcaccatcgtcctcgcgctcgcggtgctctacctggtccggtcggcg120 cgcgccagcaccaccaccgcggacggcttcctgctggccgaccggcggatcgggccggtg180 cagaacgcgctggcggtggcctccgcgccgctgatgtactcgacgatgtacatcatcacc240 ggccacatcgcgctcagcggctacgacgccatcctgctgatgaccgccttcaccatgggc300 accatgctcgcgctgttcctcttcgccgggccggtgcgcaacgtgggcggctacacgctc360 ggtgacctgctcgcggtccgtacccgggagcggccggcgcggatcgcgtcggcggtgctc420 acgctgctgacgtacgtcatgctgacggtgatcatgatggccgccatcgcgttcatcttc480 aaccgctggttcggcgtcgacgccctcgtcggcctggtcctcccggtgttcgtcgtcggt540 ctgatcacggtggggtacgtgtacctcggcgggatgctcggggtcacccgcatcctggtg600 ttcaagctggtgctgtcggtggtcgtcgtgggcgtgctgaccgcctgggtgctggcccgc660 ttcgacctgaacctcttcagcctgctggagcgggccgaggcgaacgcggcgccggtgccc720 agcggcagcgacctgctgggcccgggccggctgttcggcgagggcgcgaccacgctcgtg780 cacctgtcgaagctgttcgccatcgccgtcggagtggcggccattccgttcctgttcatg840 cgcaacttcgcggtgaccagcgggcgggacgcgcgccggtcgaccgggtgggcgtcgatg900 atcatcgtcgggttctacctgtgcctgtccgtcgtcgggctcggtgccgtcgcgatcctc960 ggccgggacaacatcggcgtcatcaaggcccaccgcgacatcagcttccccaagctcgcc1020 gacgagctcggcggtccggtgatggtcggetccctggccggcgtcgcggtcctgacgatc1080 gtcggcgtcttcgcgccgctgctgcacagcgccgtgacgacggtgaccaaggacctgaac1140 gtgatccgcggccggcggctggatccggccgccgagctgcgggacatcaagcgcaacacc1200 ctgatcatcggcgtcggctccgtgctgctggcggtcgtgatgctgccggtacggacccac1260 atcttcatcccgacctcgatcgacattgccggcgcggtggtcctgccgatcgtcgtctac 1320 gcgttgttctggcggcgtttcaacacccgcggactgcagtggacggtctacggcggcctc 138() gcgctcaccgcgttcctggtgctgttctccaacggtgtctcgggcgagccggacgccatc 1440 ttcccggaccgcaacttcaagttcgtggacgtcgagcccgcgctgatcacggtgccggtc 1500 ggcttcctgctcggctacctcggctcgatcaccagccgggagcgcgacgacgccgcgttc 1560 gccgagatgcaggtccggtccctcaccggagctgtcgtcacgggaccgccgcggccggcc 1620 gccgtggacgacgaggaccgcgacggccgccaggaccgggcgcccagcccggtgagctga 168() NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora rain 046-ECO11 sp. st SEQUENCE:64 ccacacccctcgggaggcaactgtggatccggtaccggttctggtcgtgggcgcgggccc50 ggtcggcatggtcaccgcgctggcgctcgcccgtcacggcgtcgcctgcgtcctcgtcga120 ccagggcttcgagacgtcggtccatcccaagctggactacgtcaacgcccgcagcatgga180 gttcctccgccagttcggcctcgccgacgacgtccgtgccgccggcgtcgcgcccgagca240 ccgggccgacgtcatctggtcgaccggcctggccggtgagccgatcaccaggtgggggct300 gccctcggtgacgcaggagtggcgccgcatcgccgagcacaacgacggcacccagccggc360 cgagcccggccagcggatctcccagatcgacctggaaccggtcctgcgggcccgctgccg420 gcgggagccccttgtcgacctgcgcctcggcgtacggttcgactcgctgacccaggacga480 cgcgggggtcaccagcgtcctcgccgacgacaccggcggcgaggtccgggtgcggtcgga540 gtacgtggtcgggtgcgacggcgcgtcgagccaggtccgccgggccgtgggcatcggtga60() ggaggggttegacgtgcccggcctgccgggcgccttcatggtgcacttcaccagccggga66() cctggacagcctgcaccggcacggccggttctggcactacttcgcgttccggtacgtgat720 catcgcccaggacgaggtcgacacctggaccgcgcacgtcaacggcgtcgacccgaacga780 gttcgacgagccgccggccgacccggaggcgttcctgctcgacacgatccgcaccgagct840 gcggatcgacaaggtgctgctcacctcgcgctggcgtcccggcttcatgctcgccgacag900 gtaccgcgccggccgggtgctgctcgccggtgactcggcccaccggatgttccccaccgg960 cgcgtacggcatgaacaccggcatcggcgacgccgtcgacgtggcctggaagctggccgc1020 tgtcgtccggggcttcggcggccccgggctgctcgacagctacgacgccgaacgccgccc1080 ggtggggcggcgcaacatgcgcacctcgcaccggcacctgggcgtgcacctgcgggcggg1140 cgagctcctgcgcggcggcgccccgctgccgtccgtcgcggccttcctcgacgccgagcg1200 gggcgagaac gagtaccggg ggatcgagct cggctaccgc tactccggct cgccggtgct 1260 ctggccggag ggcccggggg agccctcgga cgacccgcgg gcgtacgccc cgacgacctg 1320 gcccggcgcc cgtccgccca gcctcctgct gagcgacggg cagcagatct tcgaccggtt 1380 cgacccggcc tcgttcaccc tcgtggactt caccggtgac ggcgccgccg gtccgctgct 1440 ggcggcggcg gccgcgcggg ggctcccggt cacccacacc gtggtgaccg acccccgggc 1500 tcgtgagctg tgggaacgcg acctcgtcct gctgcggccg gaccaccacg tcgcctggcg 1560 gggaaacacc gtgccgccgg accccgacgc cgtggtccag cgcgtgcggg gtggcggata 1620 ggcgcgacgt gccgtcaccg gcggcccggg tcacgcgcac acgcgaccgg ccggtccggc 1680 tgactctcga ctggaggaca gatgcagcaa tccggttcaa cggcggaacg cagcccactc 1740 gggccgtggg agggcatgcc ggcggtccag caaccggact ggcaggacca cccggcgtac 1800 gcggagacct gtcaggcgtt ggcgtcggcc ccgccgctgg tcccacccgg ggaggtacgg 1860 gggttccggc agctgttgtc ggagctggcg tcgaccgacg ggctcctgct gcagttgggc 1920 gactgcgccg agagcctcta cgagtgcacc ccccggcaca cctcggacaa gatcgaggtc 1980 atcgaccggc tgggggaccg gctcagcgag ctcaccgggc gcaacgtgct gcgggtgggc 2040 cggatggccg ggcagttcgc caagccccgg tcgcaggcga cggagtggca cgacgcgctg 2100 agcatcccct ccttccgcgg ccacatgatc aattccgagc tggccgcgcc cggtacgcgc 2160 aaggccgacc ctcgccgcat gtggtgggcg tacgaggcga gcgaccgggt gcagcgggtc 2220 ctgcgcgccc accgggaggg caaccggcgt gccgcgcgga ccgaggggcc gtggtcgagc 2280 cacgaggccc tggtcgtcga ctacgagtcc cgcctgatcc gccgggaccc ggacacgggc 2340 gagcactacc tggcgtcgac ccacctgccg tgggtggggg agcggacccg ccggtccgcc 2400 gaggcgcacg tggccatgct gtccacggtg gtgaacccgg tcggctgcaa gatcgggccg 2460 gacgccgacc cggacgacgt cctgcgggtg tgcgaggcgc tcgaccCgcg gcgcgatccg 2520 ggccgtctcg tcctgatccc gcggatgggc cgggaccgga tccgggagtc cctgccgccg 2580 atcgtccgcg cggtggtgaa cgcggggcac cccgtgctct ggctgagcga tcccatgcac 2640 ggcaacaccg tcaaggcctc ggtcggcctg aagacgc~gcc acctctccga cgtggtcacc 2700 gaggcgctgt ggttccgcga catcctcgac cagcagcggc agcacgccgc cgggctgcac 2760 atcgaggtcg ccgccaccga cgtgaccgag tgcgtcggcg gttcggtggc cggcgaggag 2820 gacctggcgc ggcactacac ctcgctgtgc gacccgcggc tcaacccggg tcaggccacc 2880 gagctgatcg aagcgtgggc caaggacacc gcgacggtcg gcccgggacc gcggcgctcc 2940 ggcccttcgg cgcggccgga ggtcgccgcc tgacgtcgcc ggtctttgcg ccggccgttt 3000 ccgaactgcg ggaaaattga cagaaggaga cctgccggag caaattcggc caggctagcc 3060 gcgccgtagttcgtcgtccactacttgcgtgggtagtgtcaactacccgtgccgggaccg3120 tcggtggtgttgctcagcaggaatcccatcgcaatgatgtgtgagaaggcgtaatccttc318c) gatcggtgacgcgcgtacctcatcctatccgcactgaatcctgtctcagctgaagcgagt3240 gtttccaatgtggggcagctcaaacacgctggaagtgaagggcaacgacgagagattccc3300 cctgcccgatgcagctacggaggatcggtctgtgcttggcgagacggttccggtttccgc336c) gctgctgcccggtgactccccgcggctggcgggcgagaacgtcgagcacatccggctgct3420 ggccgcgatgcacgacctcccgccgatcctggtgcaacgcggcacgatgcgggtgatcga3480 cggcatgcaccggctgcgggccgccaagctgcgcggcgacgagaccgtgcgggtgacgtt3540 cttcgacggggacgacgccgcggcgttcctgctctcggtcgacgccaacatcaaacacgg3600 gctgccgttgtcccgcgccgaccgggaggccgccgcc~acccgcatcctgcggttgtatcc3660 gcagtggtcggaccgcgccgtcgccgcggcggccgggctgtcaccgaccacggcgagcgg3720 catccggcgccgcctgctgcaaccggcggcgcgggagggcagccgggtgggacgggacgg3780 gcgggtgcgcccgctggacggctcggcgggccgacggcgggccagcgcggtcatcgcgct3840 ccggccggacgcgcccctgcgtgccatcgcgcaggaggccggggtgtcggtgggcacggc3900 gcgggacgtgcgcgcccggttgcaggcgggccgggaccccgtcctgacctcgcagcgacc3960 ggcggccgagcccgagccggccgccgacgacgggccggaggcgcgcagacgccggctcgg4020 ccagccctccgtgccgcctgtcgactggccggcggtacggggcaacctgatccgggaccc4080 cgcggtgaagtacgccgagctgggccgggccttcgtccgctgggccgacgggcacgtggt4140 ggatccggcggcctggcgcgagttcgtcgacgccgtgccgccgtactggcgcaaatcggt4200 ggccgagctggcccgttcgtgcgccagcgcctggctggcgttcgcccaggaactggagga4260 ccgggcgtgaaaatggcggccggcatatttacggtggttgccgacagcgcgtcgcattcc4320 actgtcgcggccactacccgatcgagtagtggaccggcttgaataacgcgcgttaatgtt4380 ccttcgatccgctgccctcatttttcggtgagcacatttttgcggcggtccaatggagag4440 gagaattcccggtgaacattctgaggcggccgcggaaacggcatctcgggggtgtcgcgg4500 ccgtcgccgcggcgatcgccctggtggcgtcgctgacaaacggtgtggcggctgccccgc4560 aggcgccgaccttcgacctcgacaacgggaacgccctgaccgacgtcatctacccggccc4620 tcaacaccgagccgcgggtcgagtacagcggccggcccgggtcctgggccgcggaccgcg4680 ccatgctcatcgaactgccgtggttcgacgccctggcggcgtaccaccccaccgcggtcg4740 gcatcttctccaccatcggccgccgtcccgccgaggagcacacgacgcgcaacaagaaca4800 tcgccgtcatctactcggcctacacctcgctcagcaagctctacccccagcacgaggcga4860 g5 cctggcagcggatgatggccaccgcgggcctggacc<:ggccgtcaccgcggaggaccgga 4920 ccaccgccagcggcatcggcatcctcgcctcgaagaacgcgatggcggcgcgccggaacg 4980 acggcacgaaccgcgacggcgacgcgggcggccgtcgctacaaccgtgagccgtacgccg 5040 accacaccggctaccggccggtcaacagcccgtacgagctgcgcttcccgtcgcgctggc 5100 agccgaacaccatctccaagcgcgaggtcgtcctgacgcaggagttcgcgacgccccagt 5160 tcggccgggtcaagccgatcaccttcgagcggcccgagcagttccggctcaccccgccgc 5220 cgaaccaccacctgttgaacccgaagggctaccggaagcaggccgacgaggtgctgcgcg 528() cctcggcgggcctggacgaccgcaagaagatgagcgcggagatcttcagcgacaacatca 5340 cgccgtacggcgccatcgcgcacacgctcctgcggggccggtacaacaccgaggactccg 5400 tccggttcatcgtgatgactgacgtcgccgggttcgacgtggcgatcgcgtcctggtact 5460 acatgcgcaagtacgactcggtgcagccgttcagcgcgatccgccacctgtacccgaaca 5520 agaagctgaccgcgtggggcggcccgggccggggcaccgtcaacgacatcaccggcaccc 5580 agtggcgcagctacctcagctcggtcgccatcgcggctccggattacccgtcggtcaacg 5640 cggcggtctgcgtcgcctacgcccaggtcgcgcgccggttcaccggcacggacaagctga 5700 ccgtcgtgatcccggtccgcaagggctcctcgatcgtggaaccgggcgtgaccccggccg 5760 ccgacatgatgctcacctggaacagctactcggagtgggccgccgagtgcgggcagagcc 5820 gggtctgggccggcgagaacttccccgcctcggtcgcggccgccgaccagtacgcgccgc 5880 agatcggcgaccgtgccttcgacttcgtccagagcaagctgaacgggcgctgacgcccgc 5940 gtaccggtccgtgctgccgg SEQ ID N0: 65 LENGTH: 532 TYPE: PRT
ORGANISM: Micromonospora 5p. strain 046-ECOll SEQUENCE: 65 Val Asp Pro Va1 Pro Val Leu Val Val Gly Ala Gly Pro Val Gly Met Val Thr Ala Leu Ala Leu Ala Arg His Gly Val Ala Cys Val Leu Val Asp Gln Gly Phe Glu Thr Ser Val His Pro Lys Leu Asp Tyr Val Asn Ala Arg Ser Met Glu Phe Leu Arg Gln Phe Gly Leu Ala Asp Asp Val Arg Ala Aia Gly Val Ala Pro Glu His Arg Ala Asp Val Iie Trp Ser g6 Thr Gly Leu Ala GIy Glu Pro Ile Thr Arg Trp Gly Leu Pro Ser Val Th-r G1n Glu Trp Arg Arg Ile Ala Glu His Asn Asp Gly Thr Gln Pro Ala Glu Pro Gly Gln Arg Ile Ser Gln Ile Asp Leu Glu Pro Val Leu Arg Ala Arg Cys Arg Arg Glu Pro Leu Val Asp Leu Arg Leu Gly Val Arg Phe Asp Ser Leu Thr Gln Asp Asp Ala Gly Val Thr Ser Val Leu Ala Asp Asp Thr Gly Gly Glu Val Arg Val Arg Ser Glu Tyr Val Val Gly Cys Asp Gly Ala Ser Ser Gln Val Arg Arg Ala Val Gly Ile Gly Glu Glu Gly Phe Asp Val Pro Gly Leu Pro Gly Ala Phe Met Val His Phe Thr Ser Arg Asp Leu Asp Ser Leu His Arg His Gly Arg Phe Trp His Tyr Phe Aia Phe Arg Tyr Val Ile Ile Ala Gln Asp Glu Val Asp Thr Trp Thr Aia His VaI Asn Gly Val Asp Pro Asn Glu Phe Asp Glu Pro Pro Ala Asp Pro Glu Ala Phe Leu Leu Asp Thr Ile Arg Thr Glu Leu Arg Ile Asp Lys Val Leu Leu Thr Ser Arg Trp Arg Pro Gly Phe Met Leu Ala Asp Arg Tyr Arg Ala Gly Arg Val Leu Leu Ala Gly Asp Ser Ala His Arg Met Phe Pro Thr Gly Ala Tyr Gly Met Asn Thr Gly Ile Gly Asp Ala Val Asp Val Ala Trp Lys Leu Ala Ala Val Val Arg Gly Phe Gly Gly Pro Gly Leu Leu Asp Ser Tyr Asp Ala Glu Arg Arg Pro Val Gly Arg Arg Asn Met Arg Thr Ser His Arg His Leu Gly Val His Leu Arg Ala GIy Glu Leu Leu Arg Gly Gly Ala Pro Leu Pro Ser Val AIa Ala Phe Leu Asp Ala Glu Arg Gly Glu Asn Glu Tyr Arg Gly Ile Glu Leu Gly Tyr Arg Tyr Ser Gly Ser Pro Val Leu Trp Pro Glu Gly Pro Gly Glu Pro Ser Asp Asp Pro Arg Ala Tyr Ala Pro Thr Thr Trp Pro Gly Ala Arg Pro Pro Ser Leu Leu Leu Ser Asp Gly Gln Gln Ile Phe Asp Arg Phe Asp Pro Ala Ser Phe Thr Leu Val Asp Phe Thr Gl~° Asp Gly Ala Ala Gly Pro Leu Leu Ala Ala Ala Ala Ala Arg Gly Leu Pro Val Thr His Thr Val Val Thr Asp Pro Arg Ala Arg Glu Leu Trp Glu Arg Asp Leu Val Leu Leu Arg Pro Asp His His Val Ala Trp Arg Gly Asn Thr Val Pro Pro Asp Pro Asp Ala Val Val Gln Arg Val Arg Gly Gly Gly N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:56 gtggatccggtaccggttctggtcgtgggcgcgggcccggtcggcatggtcaccgcgctg60 gCgCtCgCCCgtcacggcgtcgcctgcgtcctcgtcgaccagggcttcgagacgtcggtc12c) catcccaagctggactacgtcaacgcccgcagcatggagttcctccgccagttcggcctc18t) gccgacgacgtccgtgccgccggcgtcgcgcccgagcaccgggccgacgtcatctggtcg24c) accggcctggccggtgagccgatcaccaggtgggggctgccctcggtgacgcaggagtgg300 cgccgcatcgccgagcacaacgacggcacccagccggccgagcccggccagcggatctcc360 cagatcgacctggaaccggtcctgcgggcccgctgccggcgggagccccttgtcgacctg420 cgcctcggcgtacggttcgactcgctgacccaggacgacgcgggggtcaccagcgtcctc480 gccgacgacaccggcggcgaggtccgggtgcggtcggagtacgtggtcgggtgcgacggc540 gcgtcgagccaggtccgccgggccgtgggcatcggtgaggaggggttcgacgtgcccggc600 ctgccgggcgccttcatggtgcacttcaccagccgggacctggacagcctgcaccggcac660 ggccggttctggcactacttcgcgttccggtacgtgatcatcgcccaggacgaggtcgac720 acctggaccgcgcacgtcaacggcgtcgacccgaacgagttcgacgagccgccggccgac78U

ccggaggcgttcctgctcgacacgatccgcaccgagctgcggatcgacaaggtgctgctc840 acctcgcgctggcgtcccggcttcatgctcgccgacaggtaccgcgccggccgggtgctg900 ctcgccggtgactcggcccaccggatgttccccaccggcgcgtacggcatgaacaccggc 960 atcggcgacgccgtcgacgtggcctggaagctggccgctgtcgtccggggcttcggcggc 1020 cccgggctgctcgacagctacgacgccgaacgccgcccggtggggcggcgcaacatgcgc 1080 acctcgcaccggcacctgggcgtgcacctgcgggcgc)gcgagctcctgcgcggcggcgcc 1140 ccgctgccgtccgtcgcggccttcctcgacgccgagcggggcgagaacgagtaccggggg 1200 atcgagctcggctaccgctactccggctcgccggtgctctggccggagggcccgggggag 126() ccctcggacgacccgcgggcgtacgccccgacgacctggcccggcgcccgtccgcccagc 1320 ctcctgctgagcgacgggcagcagatcttcgaccggttcgacccggcctcgttcaccctc 1380 gtggacttcaccggtgacggcgccgccggtccgctgctggcggcggcggccgcgcggggg 1440 ctcccggtcacccacaccgtggtgaccgacccccgggctcgtgagctgtgggaacgcgac 1500 ctcgtcctgctgcggccggaccaccacgtcgcctggcggggaaacaccgtgccgccggac 1560 cccgacgccgtggtccagcgcgtgcggggtggcggatag 1599 SEQ ID NO: 67 LENGTH: 423 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 67 Met Gln Gln Ser Gly Ser Thr Ala Glu Arg Ser Pro Leu Gly Pro Trp Glu Gly Met Pro Ala Val Gln Gln Pro Asp Trp Gln Asp His Pro Ala Tyr Ala Glu Thr Cys Gln Ala Leu Ala Ser AIa Pro Pro Leu Val Pro Pro Gly Glu Val Arg Gly Phe Arg Gln Leu Leu Ser Glu Leu Ala Ser Thr Asp Giy Leu Leu Leu Gln Leu Gly Asp Cys Ala Glu Ser Leu Tyr Giu Cys Thr Pro Arg His Thr Ser Asp Lys Ile Glu Val Ile Asp Arg Leu Gly Asp Arg Leu Ser Glu Leu Thr Gly Arg Asn Val Leu Arg Val G1y Arg Met Ala Gly Gln Phe Ala Lys Pro Arg Ser Gln Ala Thr Glu Trp His Asp Ala Leu Ser Ile Pro Ser Phe Arg Gly His Met Ile Asn Ser Glu Leu Ala Ala Pro Gly Thr Arg Lys Ala Asp Pro Arg Arg Met g9 Trp Trp Ala Tyr Glu Ala Ser Asp Arg Val Gln Arg Val Leu Arg Ala His Arg Glu Gly Asn Arg Arg Ala Ala Arg Thr Glu Gly Pro Trp Ser Ser His Glu Ala Leu Val Val Asp Tyr Glu Ser Arg Leu Ile Arg Arg Asp Pro Asp Thr Gly Glu His Tyr Leu Ala Ser Thr His Leu Pro Trp Val Gly Glu Arg Thr Arg Arg Ser Ala Glu Ala His Val Ala Met Leu Ser Thr Val Val Asn Pro Val Gly Cys Lys Ile Gly Pro Asp Ala Asp Pro Asp Asp Val Leu Arg Val Cys Glu Ala Leu Asp Pro Arg Arg Asp Pro Gly Arg Leu Val Leu Ile Pro Arg Met Gly Arg Asp Arg Ile Arg Glu Ser Leu Pro Pro Ile Val Arg Ala Val Val Asn Ala Gly His Pro Val Leu Trp Leu Ser Asp Pro Met His Gly Asn Thr Val Lys Ala Ser Val Gly Leu Lys Thr Arg His Leu Ser Asp Val Val Thr Glu Ala Leu Trp Phe Arg Asp Ile Leu Asp Gln Gln Arg Gln His Ala Ala Gly Leu His Ile Glu Val Ala Ala Thr Asp Val Thr Glu Cys Val Gly Gly Ser Val Ala Gly Glu Glu Asp Leu Ala Arg His Tyr Thr Ser Leu Cys Asp Pro Arg Leu Asn Pro Gly Gln Ala Thr Glu Leu Ile Glu Ala Trp Ala Lys Asp Thr Ala Thr Val Gly Pro Gly Pro Arg Arg Ser Gly Pro Ser Ala Arg Pro Glu Val Ala Ala SEQ ID NO: 68 LENGTH: 1272 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 68 atgcagcaat ccggttcaac ggcggaacgc agcccactcg ggccgtggga gggcatgccg 60 9 C) gcggtccagcaaccggactggcaggaccacccggcgtacgcggagacctgtcaggcgttg 120 gcgtcggccccgccgctggtcccacccggggaggtacgggggttccggcagctgttgtcg 180 gagctggcgtcgaccgacgggctcctgctgcagttgggcgactgcgccgagagcctctac 240 gagtgcaccccccggcacacctcggacaagatcgagc~tcatcgaccggctgggggaccgg 300 ctcagcgagctcaccgggcgcaacgtgctgcgggtgggccggatggccgggcagttcgcc 360 aagccccggtcgcaggcgacggagtggcacgacgcgctgagcatcccctccttccgcggc 420 cacatgatcaattccgagctggccgcgcccggtacgcgcaaggccgaccctcgccgcatg 480 tggtgggcgtacgaggcgagcgaccgggtgcagcgggtcctgcgcgcccaccgggagggc 540 aaccggcgtgccgcgcggaccgaggggccgtggtcgagccacgaggccctggtcgtcgac 600 tacgagtcccgcctgatccgccgggacccggacacgggcgagcactacctggcgtcgacc 660 cacctgccgtgggtgggggagcggacccgccggtccgccgaggcgcacgtggccatgctg 720 tccacggtggtgaacccggtcggctgcaagatcgggccggacgccgacccggacgacgtc 780 ctgcgggtgtgcgaggcgctcgacccgcggcgcgatccgggccgtctcgtcctgatcccg 840 cggatgggccgggaccggatccgggagtccctgccgccgatcgtccgcgcggtggtgaac 900 gcggggcaccccgtgctctggctgagcgatcccatgcacggcaacaccgtcaaggcctcg 960 gtcggcctgaagacgcgccacctctccgacgtggtcaccgaggcgctgtggttccgcgac 1020 atcctcgaccagcagcggcagcacgccgccgggctgcacatcgaggtcgccgccaccgac lOBU

gtgaccgagtgcgtcggcggttcggtggccggcgaggaggacctggcgcggcactacacc 1140 tcgctgtgcgacccgcggctcaacccgggtcaggccaccgagctgatcgaagcgtgggcc 1200 aaggacaccgcgacggtcggcccgggaccgcggcgctccggcccttcggcgcggccggag 1260 gtcgccgcctga 127'?

SEQ ID NO: 69 LENGTH: 340 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE: 69 Met Trp Gly Ser Ser Asn Thr Leu Glu Val Lys GIy Asn Asp Glu Arg Phe Pro Leu Pro Asp Ala Ala Thr Glu Asp Arg Ser Val Leu Gly Glu Thr Val Pro Val Ser Ala Leu Leu Pro Gly Asp Ser Pro Arg Leu Ala Gly Glu Asn Val Glu His Ile Arg Leu Leu Ala Ala Met His Asp Leu Pro Pro Ile Leu Val Gln Arg Gly Thr Met Arg Val Ile Asp Gly Met His Arg Leu Arg Ala Ala Lys Leu Arg Gly Asp Glu Thr Val Arg Val Thr Phe Phe Asp Gly Asp Asp Ala Ala Ala Phe Leu Leu Ser Val Asp Ala Asn Ile Lys His Gly Leu Pro Leu Ser Arg Ala Asp Arg Glu Ala Ala Ala Thr Arg Ile Leu Arg Leu Tyr Pro Gln Trp Ser Asp Arg Ala Val Ala Ala Ala Ala Gly Leu Ser Pro Thr Thr Ala Ser Gly Ile Arg Arg Arg Leu Leu Gln Pro Ala Ala Arg Glu Gly Ser Arg Val Gly Arg Asp Gly Arg Val Arg Pro Leu Asp Gly Ser Ala Gly Arg Arg Arg Ala Ser Ala Val Ile Ala Leu Arg Pro Asp Ala Pro Leu Arg Ala Ile Ala Uln Glu Ala Gly Val Ser Val Gly Thr Ala Arg Asp Val Arg Ala Arg Leu Gln Ala Gly Arg Asp Pro Val Leu Thr Ser Gln Arg Pro Ala Ala Glu Pro Glu Pro Ala Ala Asp Asp Gly Pro Glu Ala Arg Arg Arg Arg Leu Gly Gln Pro Ser Val Pro Pro Val Asp Trp Pro Ala Val Arg Gly Asn Leu IIe Arg Asp Pro Ala Val Lys Tyr Ala Glu Leu Gly Arg Ala Phe Val Arg Trp Ala Asp Gly His Val Val Asp Pro Ala Ala Trp Arg Glu Phe Vai Asp Ala Val Pro Pro Tyr Trp Arg Lys Ser Val Ala Glu Leu Ala Arg Ser Cys Ala Ser Ala Trp Leu Ala Phe Ala Gln Glu Leu Glu Asp Arg Ala SEQ ID NO: 70 LENGTH: 1023 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 70 atgtggggcagctcaaacacgctggaagtgaagggcaacgacgagagattccccctgccc5c) gatgcagctacggaggatcggtctgtgcttggcgagacggttccggtttccgcgctgctg120 cccggtgactccccgcggctggcgggcgagaacgtcgagcacatccggctgctggccgcg180 atgcacgacctcccgccgatcctggtgcaacgcggcacgatgcgggtgatcgacggcatg240 caccggctgcgggccgccaagctgcgcggcgacgagaccgtgcgggtgacgttcttcgac300 ggggacgacgccgcggcgttcctgctctcggtcgacgccaacatcaaacacgggctgccg360 ttgtcccgcgccgaccgggaggccgccgccacccgcatcctgcggttgtatccgcagtgg420 tcggaccgcgccgtcgccgcggcggccgggctgtcaccgaccacggcgagcggcatccgg480 cgccgcctgctgcaaccggcggcgcgggagggcagccgggtgggacgggacgggcgggtg540 cgcccgctggacggctcggcgggccgacggcgggccagcgcggtcatcgcgctccggccg600 gacgcgcccctgcgtgccatcgcgcaggaggccggggtgtcggtgggcacggcgcgggac660 gtgcgcgcccggttgcaggcgggccgggaccccgtcctgacctcgcagcgaccggcggcc720 gagcccgagccggccgccgacgacgggccggaggcgcgcagacgccggctcggccagccc780 tccgtgecgcctgtcgactggccggcggtacggggcaacctgatccgggaccccgcggtg840 aagtacgccgagctgggccgggccttcgtccgctgggccgacgggcacgtggtggatccg900 gcggcctggcgcgagttcgtcgacgccgtgccgccgtactggcgcaaatcggtggccgag960 ctggcccgttcgtgcgccagcgcctggctggcgttcgcccaggaactggaggaccgggcg1020 tga 1023 SEQ ID NO: 71 LENGTH: 493 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE: 71 Val Asn Ile Leu Arg Arg Pro Arg Lys Arg His Leu Gly Gly Val Ala Ala Val Ala Ala Ala Ile Ala Leu Val Ala Ser Leu Thr Asn Gly Val Ala Ala Ala Pro G1n Ala Pro Thr Phe Asp Leu Asp Asn Gly Asn Ala Leu Thr Asp Val Ile Tyr Pro Ala Leu Asn Thr Glu Pro Arg Val Glu Tyr Ser Gly Arg Pro Gly Ser Trp Ala Ala Asp Arg Ala Met Leu Ile G1u Leu Pro Trp Phe Asp Ala Leu Ala Ala Tyr His Pro Thr Ala Val Gly Ile Phe Ser Thr Ile Gly Arg Arg Pro Ala Glu Glu His Thr Thr Arg Asn Lys Asn Ile Ala Val Ile Tyr Ser Ala Tyr Thr Ser Leu Ser Lys Leu Tyr Pro Gln His Glu Ala Thr Trp Gln Arg Met Met Ala Thr Ala Giy Leu Asp Pro Ala Val Thr Ala Glu Asp Arg Thr Thr Ala Ser Gly Ile Gly Ile Leu Ala Ser Lys Asn Ala Met Ala Ala Arg Arg Asn Asp Gly Thr Asn Arg Asp Gly Asp Ala Gly Gly Arg Arg Tyr Asn Arg Glu Pro Tyr Ala Asp His Thr Gly Tyr Arg Pro Val Asn Ser Pro Tyr Glu Leu Arg Phe Pro Ser Arg Trp Gln Pro Asn Thr Ile Ser Lys Arg Glu Val Val Leu Thr Gln Glu Phe Ala Thr Pro Gln Phe Gly Arg Val Lys Pro Ile Thr Phe Glu Arg Pro Glu Gln Phe Arg Leu Thr Pro Pro Pro Asn His His Leu Leu Asn Pro Lys Gly Tyr Arg Lys Gln Ala Asp Glu Val Leu Arg Ala Ser Ala Gly Leu Asp Asp Arg Lys Lys Met Ser Ala Giu Ile Phe Ser Asp Asn Ile Thr Pro Tyr Gly Ala Ile Ala His Thr Leu Leu Arg Gly Arg Tyr Asn Thr Glu Asp Ser Val Arg Phe Ile Val Met Thr Asp Val Ala Gly Phe Asp Val Ala Ile Ala Ser Trp Tyr Tyr Met Arg Lys Tyr Asp Ser Val Gln Pro Phe Ser Ala Ile Arg His Leu Tyr Pro Asn Lys Lys Leu Thr Ala Trp Gly Gly Pro Gly Arg Gly Thr Val Asn Asp Ile Thr Gly Thr Gln Trp Ar_g Ser Tyr Leu Ser Ser Val Ala Ile Ala Ala Pro Asp Tyr Pro Ser VaI Asn Ala Ala Val Cys Val Ala Tyr Ala Gln Val Ala Arg Arg Phe Thr Gly Thr Asp Lys Leu Thr Val Val Ile Pro Val Arg Lys Gly Ser Ser Ile Val Glu Pro Gly Val Thr Pro Ala Ala Asp Met Met Leu Thr Trp Asn Ser Tyr Ser Glu Trp Ala Ala Glu Cys Gly Gln Ser Arg Val Trp Ala Gly Glu Asn Phe Pro Ala Ser Val Ala Ala Ala Asp Gln Tyr Ala Pro Gln Ile Gly Asp Arg Ala Phe Asp Phe Val Gln Ser Lys Leu Asn Gly Arg SEQ ID NO: 72 LENGTH: 1482 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE:72 gtgaacattctgaggcggccgcggaaacggcatctcgggggtgtcgcggccgtcgccgcg60 gcgatcgccctggtggcgtcgctgacaaacggtgtggcggctgccccgcaggcgccgacc120 ttcgacctcgacaacgggaacgccctgaccgacgtc<~tctacccggccctcaacaccgag180 ccgegggtcgagtacagcggccggcccgggtcctgggccgcggaccgcgccatgctcatc240 gaactgccgtggttcgacgccctggcggcgtaccaccccaccgcggtcggcatcttctcc300 accatcggccgccgtcccgccgaggagcacacgacgr_gcaacaagaacatcgccgtcatc360 tactcggcctacacctcgctcagcaagctctacccccagcacgaggcgacctggcagcgg420 atgatggccaccgcgggcctggacccggccgtcaccgcggaggaccggaccaccgccagc480 ggcatcggcatcctcgcctcgaagaacgcgatggcggcgcgccggaacgacggcacgaac54c) cgcgacggcgacgcgggcggccgtcgctacaaccgtgagccgtacgccgaccacaccggc600 taccggccggtcaacagcccgtacgagctgcgcttcccgtcgcgctggcagccgaacacc660 atctccaagcgcgaggtcgtcctgacgcaggagttcgcgacgccccagttcggccgggtc720 aagccgatcaccttcgagcggcccgagcagttccggctcaccccgccgccgaaccaccac780 ctgttgaacccgaagggctaccggaagcaggccgacgaggtgctgcgcgcctcggcgggc840 ctggacgaccgcaagaagatgagcgcggagatcttcagcgacaacatcacgccgtacggc900 gccatcgcgcacacgctcctgcggggccggtacaacaccgaggactccgtccggttcatc960 gtgatgactgacgtcgccgggttcgacgtggcgatcgcgtcctggtactacatgcgcaag1020 tacgactcggtgcagccgttcagcgcgatccgccacctgtacccgaacaagaagctgacc1080 gcgtggggcggcccgggccggggcaccgtcaacgacatcaccggcacccagtggcgcagc1140 tacctcagctcggtcgccatcgcggctccggattacccgtcggtcaacgcggcggtctgc1200 gtcgcctacgcccaggtcgcgcgccggttcaccggcacggacaagctgaccgtcgtgatc1260 ccggtccgcaagggctcctcgatcgtggaaccgggcgtgaccccggccgccgacatgatg1320 ctcacctggaacagctactcggagtgggccgccgagtgcgggcagagccgggtctgggcc1380 ggcgagaacttccccgcctcggtcgcggccgccgaccagtacgcgccgcagatcggcgac1440 cgtgccttcgacttcgtccagagcaagctgaacgggcgctga 148:2 SEQ ID N0: 73 LENGTH: 9762 TYPE: DNA
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE:73 cagccacggcgttccgaccccccgcaagatggcttgtatagcaaggtatcttgcgatgca60 tggacggggcacgtgagcggatcactacgaacatccgcaagggcgtgctggagtactgcg120 tgctcgccctgctctcgcggcgcgacatgtacggcctggaactggccgactggctcgccg180 tccgcggtctgaccgcgagcgagggcagcctgtatccgctgctcgcccgcatgcggcagg240 ccggctccgtgcagacccggtgggtggcccccgagcaggggcacgcccggcggtactacg300 cgatcaccgaccaggggcgggcgcacctgcgggtgttcgcggcggtgtggcaggagatcc360 agccgcacgtggacgacctgatgggggaggaagcatgagcgacgacggcctcccggaggc42i) ggcgtggacctatctgcgcgcgctcgacgcggagttgtccgacgtcccgtccggcacggc480 ggaggagatcgtcgcggatgtccgcgcgcacatcgccgacgccctcgacagcggacggag540 cgcccacgagatcctcgccggcctcggcgccgcgcgggacgtggcccggcaggcgcgcga600 ggagctggggctgccggcccaggaccgcccggcccgggccggccggaccctgtccctggc660 cgcggtggcggtcggcgtgctgatcgccgtgtgcgtgagcttcctgctgccgtccgcagt720 gccggtggagccgatccaggccggccccggcgagcagggcgtcctccgccggctcggccc780 cggaatcgcgctgctcacgctgctgccggcgctcgtcgcggccgcgccgctcgtggcgcc840 cgcccgggcacgtgccggggtacggttcgccggcgcggcggtcctgacgatgttcgcctg900 cgcggccggcgagacgggcctgtactacttcccgctcgcgctgatggcctgggcggcggc960 gatcgtgccgtgggccctgcggcgcggagccggtggacggtggtggcgctatctgaccgg1020 tggattcgtggcgatgcccggcgtgctggtggcggtcgcgtcggccggtggctcggtcgg1080 cgtcggctgggtcggcgcggcgctgtggatcgccgggccgctcgcggccggcgcgctgtg1140 cgcctacgggatccgggccggctacgccgtgaccgcc;ctggccggcgcgctggccatagc1200 gctctcgatggccgagcgcggcttcctgttcgccgccttctggctgttcggcgggctgta126() cctggcgctcggcgccgctgcgtacaccgcctcgcgggccgtcgacggcgacgccgccgc132() gacgcccggcccgccggcccggccggaacccgcgccggcccccggaggctgacccggggg1380 ccgtggcgccggccggctaggcggggacggcctgcgggtcgccggcggcgtcgtgcgcgg1440 ccatcgtctcctgccggacgggctcctcgcgcaggatcgccgcgtgcagccacgcgtccg1500 ggatggcgaagccgtccacgagcgtgcgcatgtccgggcgcagctccttgagcagcccgt1560 tcaccacgctggtgatggtcttcgagcgggccggggtgagccggccgtgctcgagcagcc1620 agcccttgttcgcctcgatcacggtgagcgcgtacaggtcgcagacccgggacagcagtt1680 ccttgaccgccgggtcggcgatggcgtcgatcccggcgacgaacgcctccagcgtcaccc1740 ggtcgatgtgcgccgcggcgacggcgaggacgtggtcctggacgtcgttgaagatgtcga1800 aggggcggtccttcttggtggacgcgccaccgcgcaggcggcggaccgcgctgtcgagca1860 ggtgctcctcgcggtcctcgaagagcttgagctgccagccccggtcggtgacggcgacct1920 cgtcgtcgcgcccgggcacggcgctgaccagacgtgcgatcagcgcccgcgcggcggtgc1980 gttccagcaccatctcgcgtacctgctcggccacgaaggaggcgcgtccccagccgtcga2040 gcgagccgaactcgtcccggtagccggtcagcagccccttggcgaccagttgcagcagca2100 ccgtgttgtcgccctcgaaggtggtgaagacatcggtgtcggccttgaggctgggcaggc2160 ggttctcggacaggtagccggcgccgccacacgcctcccggcagatctggatggtgcggg2220 tggcgtgccaggtctgcgccgccttcagaccggcggcccgggactccagctcccgctgcc2280 ggtgctcgtcgaccggcccgtcgccgccctggatgtcgtcgagcgccgcgaccagctccg2340 cctgggcgaaggtcagcgcgtacgtggtggccagcgcgggcagcagcttgcgctggtgcg2400 ccaggtagtcgttgagcagcacctcgcggtcgccgtcggcgtcggcgaactgccggcgga2460 tgtcgccgtagcgcaccgcgatggccagcgccgacttggtggccgccgacgcggcgccgc2520 CCaCaCtcaCcCggCCCCggaccagggtgcccagcatggtgaagaagcgccgggagtcgt2580 tctcgatcgggctggagtacgtgccgtcctcggcgacctgcgcgtactggtccagcagca2640 tctcccgcggcacccgcacgtggtcgaagctgagccgcccgttgtccacgccgagcaggc2700 cggccttgggcccggcgtcgccgatggtcacgccgggcatcggcttgccgtgctcgtcgc2760 ggatcggcaccagccaggcgtgcaccccgtggcggcgcccgccggtgacgagctgggcga2820 acaccacagccatccgcccgtcccgggccgcgttgccgatgtagtccttgcgcgcggcct2880 cgtgcggggtgtgcaggtcgaaggtctgcgtctgcgggtcgtagacgcaggtggtgcgca2940 gttgctgcacgtccgagccgtggccggtctcggtcatcgcgaagcagccgaagagccggc3000 ccgcgacgatgtcccgcaggtaggcgtcgtggtgccgcttcgtgccgagggcggcgaccg3060 cgccgccgaacaggccccactgcacgccggccttcaccatcagtgacaggtccacctggg3120 ccagcatctcggtggcgacgatcgaggcgcccacgtcgccgcggccgccgtactcggcgg3180 ggaaaccgga ggcgatgccc agctcgacgg ggagttcgga cagcagccgg gtgatgcgct 3240 cgcgggcctg gtcaccggtc tcgccgtaca ccgggaggaa gcgttcgtcg aggtgttcgc 3300 ggtgcgcccg gcggacctcg gcccaccggc cgtcgagcgc ttcccgcagg cgtgtgacgt 3360 cgatgcggcc ggatgcgtga tcgagcattg tcactcctcg gggcagcgga catttgcgta 3420 tactctcggc ctgatcaaca ttaccggcgg tgatcgcacc ccgctggcgg agcgcgtggt 3480 gagcccggcc acccccggcg gttcggccac ccgtgaagct gaggttaggc tgtcctcact 3540 tcacagcact ggaggcatcc cctcgtgtcc ccgcttcccc ccggcagcgc cgtcaccgcc 3600 cggcacgtgc tccgccaggc gctgcgccgc cagcgccgcc cggtgctgat cggcgtgacc 3660 ctgctcgggc tgcaccaggt caccgaggcg ctcgtgccgg tggcgatcgg cgtcatcatc 3720 gaccgggccg tggtgaccgg cgacccgtgg gcgctcgcgt actccgtcgc cggcctcgcc 3780 gccctgttca ccgtgctggc gttcgcctac cgcaacggcg cccgccaggc gttcgcggcg 3840 gtggaacggg aggcgcacct gctgcgggtc gagctggccg agcgcgcgct cgacccgcgc 3900 gggcaccgct ccggcctgcg cgacggcgag ctgctctcgg tcgccgcctc cgacgccgaa 3960 ctctccgcgt acgtggtccg ggtggccggc ttcggcgtcg ccgcggtgag cgcgctgacc 4020 gtcgcggcgg tcgcgctgct ggtcatcgac gtcccgctcg gactcggcgt gctcatcggc 4080 gtaccggtgc tggtcctggc gctgcaacgg atggcgccgc tgctgtcccg gcgcagcgcc 4140 tcccagcagg aggccctcgc ggagaccacg gcgctcgccg tggacctcgt ctccggcctg 4200 cgcgtgctgc gcggcatcgg cgcccagcac cacgccgccg gccggtacgc cgaggccagc 4260 cgacgcgccc tcgccgtgac gctgcgcgcc gccaacacca agggcctgca cctcgggctc 4320 accaccgccg cgaacggcct cttcctcgcc gccgtcgccg gggtcgccgg ctggctcgcg 4380 ctgcgcggcc ggctcaccat cggcgagctg gtcaccgtgg tcgggctcgc gcagttcgtc 4440 gccgagccgg tgcagacgct gggctactgc gtgcagctgt tcgcgatggc ccgcgcctcc 4500 gccgcccggg tcgggcgcgt gctcggcgcc gagccgctga cccggccggg cagcgcgccc 4560 cggccggacc gcacggacgg gccgcggctc gtcctcgacc acgtcggcca cgccgcgctg 4620 gacggggtgt gcctgcgcgt cgacccggga gagatcgtcg gcgtcctggc gtacgacccg 4680 gccgacgcgg acgcgctggt ggcgctgctg tccgggr_ggg tgcccgcgga ccggcgccgg 4740 ggcacggtac gcgtcgacgg ggtacccgcc gacgacctgg acgtcgacgc gctgcgcggc 4800 gccgtcctgg tcgagccgca cgacgtgacg ctgttcgagg gaaccgtggc cgccaacctc 4860 gccgccggga gcaggaccga ggaggggcgc ctgcgcgccg cggtccgggc ggccgcggcg 4920 gacgacgtgg tggacgcgca ccccggcggc ctcggccacc ggctcgtcga gcggggcgcc 4980 aacctctccg gcgggcagcg ccagcggctc gggctggcgc gggcgctgca cgccgacccg 5040 ccggtgctgg tgctgcacga ccccaccacc gccgtggacg cggccaccga ggcccaactc 5100 gccgacggac tggccggcgc gcgccgcgaa gcgccccggg gcacgctgct ggtcaccagc 5160 agccccgccc tgctgcggat caccgaccgg gtggtggtga tcgccgacgg ccgggtgacc 5220 gccgagggga cgcacgagca cctgctggcc accgacgccc gctaccgcga ggagacactg 5280 cggtgaccgc tgacccgcgt accgccgaac ccacccgggt gttgctgccc accgcgaccg 5340 cccggcggac ctggacgacg ctcggcgcgg agttccgccg gcggcccggc ctcagcgccg 5400 ccgcgaccgc cgtgctcgtc gccgccgcca ccggcgggct ggtcgcgccc tgggtgctcg 5460 gccgcctcgt cgacgacgtc atcgccgacg ccccggtctc ccggatcgcc ggccgggtgg 5520 cggtgatcgc cggcgcggca gtgctcaccg gactgctcac cgccgccggg gccgcgctcg 5580 cgtcccgcct gggggagacg gtgctggccc ggctgcgcga gcgggtcctc gaccgggcgc 5640 tgcacctgcc ctcggcgacg ctggaacggg ccggcaccgg cgacctgctg gcccgggtcg 5700 gcgacgacgt ggcggtggtg acgaacgtga tcgcggtcag cggcccggcg ttcgtcggcg 5760 cgctgctgtc cgtggtgctg accgtgttcg ggctggtcgc gctcgactgg cggctcggcc 5820 tcgccgggct ggtcgccgcg cccgcctacg cgctggcgct gcgctggtac ctgcgccggt 5880 cggcgccgta ctacgcccgc gagcgcgtcg ccaccggcga gcggacgcag gcgatggccg 5940 gcgcgctgcg tggcgcggcc accgtgcgcg cgtaccggac cgaggacgcg cacgtcgcgg 6000 cgatcgccga gcgctccggc gtggcgcgcg acctgtcgct ggagatcttc aacctgcaca 6060 cccggttcgg gctgcggatc aacaggtcgg agttcctcgg cctggccgcg gtgctcgtcg 6120 ccgggttctt cctggtccgc gccgacctgg tcacagtggg cgcggcgacc accgccgcgc 6180 tctacttcca ccggctgttc aacccgatcg gcctgctgct gatggagtcc gactcggtgc 6240 tgcaggccgg cgcgagcctc gcccggctgg tcggcgtggc cacgctgccc gacaccgccc 6300 cgtccgggcc cgcgccgtcg gcggccgggc ggcgcggccc ggcggcgctg gacgtcacgg 6360 tccgccggca ccgctacgac gacgacggcc ctctggtcct ggccgacgtc gacctgcgcc 6420 tggccccggg cgagcgggtc gcgctcgtgg gcgccagcgg cgcgggcaag agcacgctcg 6480 ccggcatcgc cgccgggatc atcgcgccca ccgacgggtc ggtacgcctg ggcggcgtgc 6540 cgctgaccga gcggggcgag cacgccgtgc ggcgcgacgt cgcgctggtc agccaggagg 6600 tgcacgtctt cgctggaccg ctcgccgagg atctgcgcct ggctgccccg gacgccaccg 6660 acgccgaact gctcgacgcg ctggaccggg tcggcgccac cacctggctg cgcgcgctgc 6720 cggacgggct ggccacagcg gtcggcgagg gcggccaccg gctcaccgcc gcgcaggccc 6780 agcaggtcgc cctggcccgg ctggtgctgg ccgcgcccgc cgtcgccgtg ctggacgagg 6840 ccaccgccga ggccggcagc gccggagcgc gtgacctgga ccgggcggcg ctggccgcca 6900 ccgagggacg gaccacgctg atcgtggcgc accggci~cag ccaggcggtc gccgccgacc 6960 ggatcgtcct gctcgaccac gggcggatcg tggagcaggg cacgcactcg gaactgctcg 7020 ccgccgacgg ccggtacggg catctgtggc gctcctggag cgtcccggta tgatcgcgca 7080 ccgcccatcg gcccaggtga ggggaacatg accgacgcgc cggcccgctt cgtgctcttc 7140 ccggggcggc accacctgct gacccggttc caggccgact acctgcggcg gctggccggg 7200 gacgacgcca cagtggtctg ggcggtgacg tcggccaacc acgagaacac caggcgcaac 7260 ccggtgccct accaccggcg ggaggccgcg atcgaacgat tcagcgtgct gagcgggctg 7320 cgctcggtgg tggtgccgat cttcgacacc gcgtacaccg acgcgttcgc cgaggtgacg 7380 ctgaagtcca tcgcggtggc caccgggctc gaactcaccc ccgccgacac cgtgctggcc 7440 tgctccacgc cggaggtcgc gaagctgtac gagcagctcg gcttttcgat cgcgccggtc 7500 gaggcggacc cggacctgcc cgagccgccc gaacggccgt gggacgtgct gctgcgcctg 7560 gccgccgggg acgagacctg gcgcgcgctc acccacccgg ccaccatcga cgtgttcgag 7620 cgctaccgcc tggtcgagtc gatccggtcg gtggtgaacg acccgctcgt cggcgacgag 7680 ggcggtctca cagtgacccg cgactaccgg acctacgtcg aggcgttcgc cacggccgcg 7740 cagcgcaagt gggactcggt acgccggtac gtgcagcccg gccgcatcgt ggacatcggc 7800 tgcggcgcgg gcgccgtcct ggaactcgcc gaccgggagg ccgcgctgcg tgagagcgac 7860 ctgatcggcg tggaggtcgc ccgccacctc taccaggagt gcctgcacaa gaaggcgcag 7920 ggcgtgttcc gcaacgccaa cgtctacttc ttccaccgca acgtcctcgg cggcgcggtg 7980 ttcaaggacc gctcggtcga caccacgctc acgttcgcgc tgacccacga gatctggtcg 8040 tacgggcggc ggcgggagtc gctgctgcag ttcgcccgcc gcatccacga ccacacggtg 8100 cccggcggcg tctggatcaa cagcgacgtg tgcggtccgg acgacccccg gcggcaggtg 8160 ctcctgcgac tgtccaccga cgacggcgac aacccggccg cgccccgccc cgacctcgcc 8220 gagctgacct cggcggaggt ccggcgttac gtcggcgggc tgtcgacgcg ggcgcggctg 8280 gaccagttcg ccgtcgactt cgcgttcgac ttcgactacg agccgctccc cgacggcgcg 8340 gtacgcctga cgctgggcgc cgcgatggac tacctgaccc gcaaggacta cacggacaac 8400 tggctgtcgg agacgcagga gcagttctgc ggcctgagct tcgccgactg gacggacctg 8460 ctcaccgagg cggggttcga gatcggcccg gcgtcggcgc cggtgcgcaa cgagtgggtg 8520 atcgacaacc ggatcgcgcc agtcgcgtcc ctcaccgacc tcgacggccg gccgctggac 8580 tggccgacca cccacgtcct caccgtcgcc caccgccccc gcaaccagtg agaccgacgg 8640 cgcccgccgcgttcggcgggcgccgtcgtcgctcaccggctcagcgcgatccggatcgcc 8700 aggacgatcaggatgagcccggtcagccgttcgatcaccagcagcacggacggccgggtc 8760 agccagggctgcaacctgtcgatgagcatgatgtagcaggcccaccagagcaccgcgagg 8820 ccgatgaacgtggcggcgagcaccgccgtacgggccgccgccccctcgccgggcttgacg 8880 aactgcggcacgaacgagacgtagaagacgaccaccttgacgttcagcagctggctggtg 8940 acgcccatgacgaacgagcggcgggccacgtgcggctcgtcggcggccggggtgtccggc 900() accggcgcggggccggtgtccgtgtccggcccggcgccgcccgcgccgacagtgaccggc 9060 tgcgccgccgggaccgtccggcgcggccgggtcgcccagaggatcgtgccgcccaggtag 9120 agcaggtacagcgcgccggcgacgcgcagcaccgtgtagagcgtcggcgaggagaccagc 9180 agggcggacaggccggcggtcgcgaacgacgcgtgcaccagcgcggcgacgaacagcccg 924() gccagcaccacgaacccggcccgccggccgtacctgacggtctgccgggtgacgagcgcg 9300 aagtcgacgcccggcacgatgatgatgagcaggctggcggcgacgaaactgatgatctgg 9360 atgt.cagacacgacgccggctctcctgtcctccggcgagcgccggcactgcctcctcgat 9420 gacggagacgccgctgtcctggcgtggtccgtgccggcgccactgttcccgcagccggat 948() ccggccgtccggcagccgttcgggccgggactcgcactcgccgatgactatggtgccgtc 954() ggtgagcacctccaggtaggcgaagcgcacgacgccctgcgcgtcgcaggtgccggccag 9600 ccggccgtgccggaccgggccgccggtgatctccgcccagaccaggtcgccacgctggtg 9660 gtagtgcccccgcagcggctcggcgccgtcaccggcgtcgtggtccaccgagacgaagac 972() gcggccgtcgtagtcgaatgtcgtcatcgcgctcacgcccac 976:?

SEQ ID N0: 74 LENGTH: 112 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 74 Met Asp Gly Ala Arg Glu Arg Ile Thr Thr Asn Ile Arg Lys Gly Val Leu Glu Tyr Cys Val Leu Ala Leu Leu Ser Arg Arg Asp Met Tyr Gly Leu Glu Leu Ala Asp Trp Leu Ala Vai Arg Gly Leu Thr Ala Ser Glu G1y Ser Leu Tyr Pro Leu Leu Ala Arg Met Arg Gln Ala Gly Ser Val Gln Thr Arg Trp Val Ala Pro Glu Gln Gly His Ala Arg Arg Tyr Tyr Ala Ile His Leu Val Phe Thr Asp Arg Ala Ala Gln Gly Val Arg Ala Trp Gln u Ile Asp Asp Met Gly Gl Gln Pro Leu Glu Glu His Val Ala NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora rain 046-ECO11 sp. st SEQUENCE:75 atggacggggcacgtgagcggatcactacgaacatccgcaagggcgtgctggagtactgc60 gtgctcgccctgctctcgcggcgcgacatgtacggcctggaactggccgactggctcgcc120 gtccgcggtctgaccgcgagcgagggcagcctgtatccgctgctcgcccgcatgcggcag180 gccggctccgtgcagacccggtgggtggcccccgagcaggggcacgcccggcggtactac240 gcgatcaccgaccaggggcgggcgcacctgcgggtgttcgcggcggtgtggcaggagatc300 cagccgcacgtggacgacctgatgggggaggaagcatga 339 SEQ ID N0: 76 LENGTH: 325 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 76 Met Ser Asp Asp Gly Leu Pro Glu Ala Ala Trp Thr Tyr Leu Arg Ala Leu Asp Ala Glu Leu Ser Asp Val Pro Ser Gly Thr Ala Glu Glu Ile Val Ala Asp Val Arg Ala His Ile Ala Asp Ala Leu Asp Ser Gly Arg her Ala His Glu Ile Leu Ala Gly Leu Gly Ala Ala Arg Asp Val Ala Arg Gln Ala Arg Glu Glu Leu Gly Leu Pro Ala Gln Asp Arg Pro Ala 65 70 75 $0 Arg Ala Gly Arg Thr Leu Ser Leu Ala Ala Val Ala Val Gly Val Leu Ile Ala Val Cys Val Ser Phe Leu Leu Pro Ser Ala Val Pro Val Glu Pro Ile Gln Ala Gly Pro Gly Glu Gln Gly VaI Leu Arg Arg Leu Gly Pro Gly Ile Ala Leu Leu Thr Leu Leu Pro Ala Leu Val Ala Ala Ala Pro Leu Val Ala Pro Ala Arg Ala Arg Ala Gly Val Arg Phe Ala Gly 1~~

Ala Ala Val Leu Thr Met Phe Ala Cys Ala Ala Gly Glu Thr Gly Leu Tyr Tyr Phe Pro Leu Ala Leu Met Ala Trp Ala Ala Ala Ile Val Pro Trp Ala Leu Arg Arg Gly Ala Gly Gly Arg Trp Trp Arg Tyr Leu Thr Gly Gly Phe Val Ala Met Pro Gly Val Leu Val Ala Val Ala Ser Ala Gly Gly Ser Val Gly Val Gly Trp Val Gly Ala Ala Leu Trp Ile Ala Gly Pro Leu Ala Ala Gly Ala Leu Cys Ala Tyr Gly Ile Arg Ala Gly Tyr Ala Val Thr Ala Leu Ala Gly Ala Leu Ala Ile Ala Leu Ser Met Ala Glu Arg Gly Phe Leu Phe AIa Ala Phe Trp Leu Phe Gly Gly Leu Tyr Leu Ala Leu Gly Ala Ala Ala Tyr Thr Ala Ser Arg Ala Val Asp Gly Asp Ala Ala Ala Thr Pro Gly Pro Pro Ala Arg Pro Glu Pro Ala Pro Ala Pro Gly Gly N0:

LENGTH.

TYPE, DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:77 atgagcgacgacggcctcccggaggcggcgtggacctatctgcgcgcgctcgacgcggag 60 ttgtccgacgtcccgtccggcacggcggaggagatcgtcgcggatgtccgcgcgcacatc 120 gccgacgccctcgacagcggacggagcgcccacgagatcctcgccggcctcggcgccgcg 180 cgggacgtggcccggcaggcgcgcgaggagctggggctgccggcccaggaccgcccggcc 240 cgggccggccggaccctgtccctggccgcggtggcggtcggcgtgctgatcgccgtgtgc 300 gtgagcttcctgctgccgtccgcagtgccggtggagccgatccaggccggccccggcgag 360 cagggcgtcctccgccggctcggccccggaatcgcgctgctcacgctgctgccggcgctc 420 gtcgcggccgcgccgctcgtggcgcccgcccgggcacgtgccggggtacggttcgccggc 480 gcggcggtcctgacgatgttcgcctgcgcggccggcgagacgggcctgtactacttcccg 540 ctcgcgctgatggcctgggcggcggcgatcgtgccgtgggccctgcggcgcggagccggt 600 ggacggtggtggcgctatctgaccggtggattcgtggcgatgcccggcgtgctggtggcg 66U

1 ~;3 gtcgcgtcggccggtggctcggtcggcgtcggctgggtcggcgcggcgctgtggatcgcc 72() gggccgctcgcggccggcgcgctgtgcgcctacgggatccgggccggctacgccgtgacc 780 gcgctggccggcgcgctggccatagcgctctcgatggccgagcgcggcttcctgttcgcc 840 gccttctggctgttcggcgggctgtacctggcgctcggcgccgctgcgtacaccgcctcg 900 cgggccgtcgacggcgacgccgccgcgacgcccggcccgccggcccggccggaacccgcg 960 ccggcccccggaggctga 978 SEQ ID N0: 78 LENGTH: 663 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-EC011 SEQUENCE: 78 Met Leu Asp His Ala Ser Gly Arg Ile Asp Val Thr Arg Leu Arg Glu Ala Leu Asp Gly Arg Trp Ala Glu Val Arg Arg Ala His Arg Glu His Leu Asp Glu Arg Phe Leu Pro Val Tyr Gly Glu Thr Gly Asp Gln Ala Arg Glu Arg Ile Thr Arg Leu Leu Ser Glu Leu Pro Val Glu Leu Gly Ile Ala Ser Gly Phe Pro Ala Glu Tyr Gly Gly Arg Gly Asp Val Gly Ala Ser Ile Val Ala Thr Glu Met Leu Ala Gln Val Asp Leu Ser Leu Met Val Lys Ala Gly Val Gln Trp Gly Leu Phe Gly Gly Ala Val Ala Ala Leu Gly Thr Lys Arg His His Asp Ala Tyr Leu Arg Asp Ile Val Ala Gly Arg Leu Phe Gly Cys Phe Ala Met Thr Glu Thr Gly His Gly Ser Asp Va1 Gln Gln Leu Arg Thr Thr Cys Val Tyr Asp Pro Gln Thr Gln Thr Phe Asp Leu His Thr Pro His Glu Ala Ala Arg Lys Asp Tyr Ile Gly Asn AIa Ala Arg Asp Gly Arg Met Ala Val Val Phe Ala Gln i80 185 190 Leu VaI Thr Gly Gly Arg Arg His Gly Val His Ala Trp Leu Val Pro Ile Arg Asp Glu His Gly Lys Pro Met Pro Gly Val Thr Ile Gly Asp 1~~

Ala Gly Pro Lys Ala Gly Leu Leu Gly Val Asp Asn Gly Arg Leu Ser Phe Asp His Val Arg Val Pro Arg Glu Met Leu Leu Asp Gln Tyr Ala Gln Val Ala Glu Asp Gly Thr Tyr Ser Ser Pro Ile Glu Asn Asp Ser Arg Arg Phe Phe Thr Met Leu Gly Thr Leu Vai Arg Gly Arg Val Ser Val Gly Gly Ala Ala Ser Ala Ala Thr Lys Ser Ala Leu Ala Ile Ala Val Arg Tyr Gly Asp Ile Arg Arg Gln Phe Ala Asp Ala Asp Gly Asp Arg Glu Val Leu Leu Asn Asp Tyr Leu Ala His Gln Arg Lys Leu Leu Pro Ala Leu Ala Thr Thr Tyr Ala Leu Thr Phe Ala Gln Ala Glu Leu Val Ala Ala Leu Asp Asp Ile Gln Gly Gly Asp Gly Pro Val Asp Glu His Arg Gln Arg Glu Leu Glu Ser Arg Ala Ala Gly Leu Lys Ala Ala Gln Thr Trp His Ala Thr Arg Thr Ile Gln Ile Cys Arg Glu Ala Cys Gly GIy Ala GIy Tyr Leu Ser Glu Asn Arg Leu Pro Ser Leu Lys Ala Asp Thr Asp Val Phe Thr Thr Phe Glu Gly Asp Asn Thr Val Leu Leu Gln Leu Val Ala Lys Gly Leu Leu Thr Gly Tyr Arg Asp Glu Phe Gly Ser Leu Asp Gly Trp Gly Arg Ala Ser Phe Val Ala Glu Gln Val Arg Glu Met Val Leu Glu Arg Thr Ala Aia Arg Ala Leu Ile Ala Arg Leu Val Ser Ala Val Pro Gly Arg Asp Asp Glu Val Ala Val Thr Asp Arg Gly Trp Gln Leu Lys Leu Phe Glu Asp Arg Glu Glu His Leu Leu Asp Ser Ala Val Arg Arg Leu Arg Gly Gly Ala Ser Thr Lys Lys Asp Arg Pro Phe Asp Ile Phe Asn Asp Val GIn Asp His Val Leu Ala Val Ala Ala Ala His Ile Asp Arg Val Thr Leu Glu Ala Phe Val Ala Gly Ile Asp Ala Ile Ala Asp Pro Ala Val Lys Glu Leu Leu Ser Arg Val Cys Asp Leu Tyr Ala Leu Thr Val Ile G1u Ala Asn Lys Gly Trp Leu Leu Glu His Gly Arg Leu Thr Pro Ala Arg Ser Lys Thr Ile Thr Ser Val Val Asn Gly Leu Leu Lys Glu Leu Arg Pro Asp Met Arg Thr Leu Val Asp Gly Phe Ala Ile Pro Asp Ala Trp Leu His Ala Ala Ile Leu Arg Glu Glu Prc Val Arg Gln Glu Thr Met Ala Ala His Asp Ala Ala Gly Asp Pro Gln Ala Val Pro Ala N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:79 atgctcgatcacgcatccggccgcatcgacgtcacacgcctgcgggaagcgctcgacggc60 cggtgggccgaggtccgccgggcgcaccgcgaacacctcgacgaacgcttcctcccggtg120 tacggcgagaccggtgaccaggcccgcgagcgcatcacccggctgctgtccgaactcccc180 gtcgagctgggcatcgcctccggtttccccgccgagtacggcggccgcggcgacgtgggc240 gcctcgatcgtcgccaccgagatgctggcccaggtggacctgtcactgatggtgaaggcc300 ggcgtgeagtggggcctgttcggcggcgcggtcgccgccctcggcacgaagcggcaccac360 gacgcctaectgcgggacatcgtcgcgggccggctct:tcggctgcttcgcgatgaccgag420 accggccacggctcggacgtgcagcaactgcgcaccacctgcgtctacgacccgcagacg480 cagaccttcgacctgcacaccccgcacgaggccgcgcgcaaggactacatcggcaacgcg540 gcccgggacgggcggatggctgtggtgttcgcccagctcgtcaccggcgggcgccgccac600 ggggtgcacgcctggctggtgccgatccgcgacgagcacggcaagccgatgcccggcgtg660 accatcggcgacgccgggcccaaggccggcctgctcggcgtggacaacgggcggctcagc720 ttcgaccacgtgcgggtgccgcgggagatgctgctggaccagtacgcgcaggtcgccgag780 gacggcacgtactccagcccgatcgagaacgactcccggcgcttcttcaccatgctgggc840 accctggtccggggccgggtgagcgtgggcggcgccgcgtcggcggccaccaagtcggcg900 10~

ctggccatcgcggtgcgctacggcgacatccgccggcagttcgccgacgccgacggcgac960 cgcgaggtgctgctcaacgactacctggcgcaccagcgcaagctgctgcccgcgctggcc1020 accacgtacgcgctgaccttcgcccaggcggagctggtcgcggcgctcgacgacatccag1080 ggcggcgacgggccggtcgacgagcaccggcagcgggagctggagtcccgggccgccggt1140 ctgaaggcggcgcagacctggcacgccacccgcaccatccagatctgccgggaggcgtgt1200 ggcggcgccggctacctgtccgagaaccgcctgccc<~gcctcaaggccgacaccgatgtc1260 ttcaccaccttcgagggcgacaacacggtgctgctgcaactggtcgccaaggggctgctg1320 accggctaccgggacgagttcggctcgctcgacggctggggacgcgcctccttcgtggcc1380 gagcaggtacgcgagatggtgctggaacgcaccgccgcgcgggcgctgatcgcacgtctg1440 gtcagcgccgtgcccgggcgcgacgacgaggtcgccgtcaccgaccggggctggcagctc1500 aagctcttcgaggaccgcgaggagcacctgctcgacagcgcggtccgccgcctgcgcggt1560 ggcgcgtccaccaagaaggaccgccccttcgacatcttcaacgacgtccaggaccacgtc1620 ctcgccgtcgccgcggcgcacatcgaccgggtgacgctggaggcgttcgtcgccgggatc1680 gacgccatcgccgacccggcggtcaaggaactgctgtcccgggtctgcgacctgtacgcg1740 ctcaccgtgatcgaggcgaacaagggctggctgctcgagcacggccggctcaccccggcc1800 cgctcgaagaccatcaccagcgtggtgaacgggctgctcaaggagctgcgcccggacatg1860 cgcacgctcgtggacggcttcgccatcccggacgcgtggctgcacgcggcgatcctgcgc1920 gaggagcccgtccggcaggagacgatggccgcgcacgacgccgccggcgacccgcaggcc1980 gtccccgcctag 1992 SEQ ID NO: 80 LENGTH: 573 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 80 '~'al Ser Pro Leu Pro Pro Gly Ser Ala Val Thr Ala Arg His Val Leu Arg Gln Ala Leu Arg Arg Gln Arg Arg Pro Val Leu Ile Gly Val Thr Leu Leu Gly Leu His Gln Val Thr Glu Ala Leu Val Pro Val Ala Ile Gly Val Ile Ile Asp Arg Ala Val Val Thr Gly Asp Pro Trp Ala Leu Ala Tyr Ser Val Ala Gly Leu Ala Ala Leu Phe Thr Val Leu Ala Phe 1~~

Ala Tyr Arg Asn Gly Ala Arg Gln Ala Phe Ala Ala Val Glu Arg Glu Ala His Leu Leu Arg Val Glu Leu Ala Glu Arg Ala Leu Asp Pro Arg Gly His Arg Ser G1y Leu Arg Asp Gly Glu Leu Leu Ser Val Ala Ala Ser Asp Ala Glu Leu Ser Ala Tyr Val Val Arg Val Ala Gly Phe Gly Val Ala Ala Val Ser Ala Leu Thr Val Ala Ala Val Ala Leu Leu Val Ile Asp Val Pro Leu Gly Leu Gly Val Leu Ile Gly Val Pro Val Leu Val Leu Ala Leu Gln Arg Met Ala Pro Leu Leu Ser Arg Arg Ser Ala Ser Gln Gln Glu Ala Leu Ala Glu Thr Thr Ala Leu Ala Val Asp Leu Val Ser Gly Leu Arg Val Leu Arg Gly Ile Gly Ala Gln His His Ala Ala Gly Arg Tyr Ala Glu Ala Ser Arg Arg Ala Leu Ala Val Thr Leu Arg Ala Ala Asn Thr Lys Gly Leu His Leu Gly Leu Thr Thr Ala Ala Asn G1y Leu Phe Leu Ala Ala Val Ala Gly Val Ala Gly Trp Leu Ala Leu Arg Gly Arg Leu Thr Ile Gly Glu Leu Vai Thr Val Val Gly Leu Ala Gln Phe Val Ala Glu Pro Val Gln Thr Leu Gly Tyr Cys Val Gln Leu Phe Ala Met Ala Arg Ala Ser Ala Ala Arg Val Gly Arg Val Leu Gly Ala Glu Pro Leu Thr Arg Pro Gly Ser Ala Pro Arg Pro Asp Arg Thr Asp Gly Pro Arg Leu Val Leu Asp His Val Gly His Ala Ala Leu Asp Gly Val Cys Leu Arg Val Asp Pro Gly Glu Ile Val Gly Val Leu Ala Tyr Asp Pre Ala Asp A1a Asp Ala Leu VaI Ala Leu Leu Ser Gly Arg Val Pro Ala Asp Arg Arg Arg Gly Thr Val Arg Val Asp Gly Val Pro Ala Asp Asp Leu Asp Val Asp Ala Leu Arg Gly Ala Val Leu Val 1~g Glu Pro His Asp Val Thr Leu Phe Glu Gly Thr Val Ala Ala Asn Leu Ala Ala Gly Ser Arg Thr Glu Glu Gly Arg Leu Arg Ala Ala Val Arg Ala Ala Ala Ala Asp Asp Val Val Asp Ala His Pro Gly Gly Leu Gly His Arg Leu Val Glu Arg Gly Ala Asn Leu Ser Gly Gly Gln Arg Gln Arg Leu Gly Leu Ala Arg AIa Leu His Ala Asp Pro Pro Val Leu Val Leu His Asp Pro Thr Thr Ala Val Asp Ala Ala Thr Glu Ala Gln Leu Ala Asp Gly Leu Ala Gly Ala Arg Arg Glu Ala Pro Arg Gly Thr Leu Leu Val Thr Ser Ser Pro Ala Leu Leu Arg Ile Thr Asp Arg Val Val Val Ile Ala Asp Gly Arg Val Thr Ala Glu Gly Thr His Glu His Leu Leu Ala Thr Asp Ala Arg Tyr Arg Glu Glu Thr Leu Arg NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:81 gtgtccccgcttccccccggcagcgccgtcaccgcccggcacgtgctccgccaggcgctg60 CgCCgCCagCgccgcccggtgctgatcggcgtgaccctgctcgggctgcaccaggtcacc120 gaggcgctcgtgccggtggcgatcggcgtcatcatcgaccgggccgtggtgaccggcgac180 ccgtgggcgctcgcgtactccgtcgccggcCtCgCCgCCCtgttcaccgtgctggcgttc240 gcctaccgcaa.cggcgcccgccaggcgttcgcggcggtggaacgggaggcgcacctgctg300 cgggtcgagctggccgagcgcgcgctcgacccgcgcgggcaccgctccggcctgcgcgac360 ggcgagctgctctcggtcgccgcctccgacgccgaactctccgcgtacgtggtccgggtg420 gccggcttcggcgtcgccgcggtgagcgcgctgaccgtcgcggcggtcgcgctgctggtc480 atcgacgtcccgctcggactcggcgtgctcatcggcgtaccggtgctggtcctggcgctg540 caacggatggcgccgctgctgtcccggcgcagcgcctcccagcaggaggccctcgcggag600 accacggcgctcgccgtggacctcgtctccggcctgcgcgtgctgcgcggcatcggcgcc660 cagcaccacgccgccggccggtacgccgaggccagccgacgcgccctcgccgtgacgctg720 1~9 Lgcgccgccaacaccaagggcctgcacctcgggctcaccaccgccgcgaacggcctcttc 780 ctcgccgccgtcgccggggtcgccggctggctcgcgctgcgcggccggctcaccatcggc 840 gagctggtcaccgtggtcgggctcgcgcagttcgtcgccgagccggtgcagacgctgggc 900 tactgcgtgcagctgttcgcgatggcccgcgcctccgccgcccgggtcgggcgcgtgctc 960 ggcgccgagccgctgacccggccgggcagcgcgccccggccggaccgcacggacgggccg 1020 cggctcgtcctcgaccacgtcggccacgccgcgctggacggggtgtgcctgcgcgtcgac 1080 ccgggagagatcgtcggcgtcctggcgtacgacccggccgacgcggacgcgctggtggcg 1140 ctgctgtccgggcgggtgcccgcggaccggcgccggggcacggtacgcgtcgacggggta 1200 cccgccgacgacctggacgtcgacgcgctgcgcggcgccgtcctggtcgagccgcacgac 1260 gtgacgctgttcgagggaaccgtggccgccaacctcgccgccgggagcaggaccgaggag 1320 gggcgcctgcgcgccgcggtccgggcggccgcggcggacgacgtggtggacgcgcacccc 1380 ggcggcctcggccaccggctcgtcgagcggggcgccaacctctccggcgggcagcgccag 1440 cggctcgggctggcgcgggcgctgcacgccgacccgccggtgctggtgctgcacgacccc 1500 accaccgccgtggacgcggccaccgaggcccaactcgccgacggactggccggcgcgcgc 1560 cgcgaagcgccccggggcacgctgctggtcaccagcagccccgccctgctgcggatcacc 1620 gaccgggtggtggtgatcgccgacggccgggtgaccgccgaggggacgcacgagcacctg 1680 ctggccaccgacgcccgctaccgcgaggagacactgcggtga 1722 SEQ ID NO: 82 LENGTH: 596 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECOll SEQUENCE: 82 Val Thr Ala Asp Pro Arg Thr Ala GIu Pro Thr Arg Val Leu Leu Pro Thr Ala Thr Ala Arg Arg Thr Trp Thr Thr Leu Gly Ala Glu Phe Arg Arg Arg Pro Gly Leu Ser Ala Ala AIa Thr Ala Val Leu Val Ala Ala Ala 'Ihr Gly Giy Leu Val Ala Pro Trp Val Leu Gly Arg Leu Val Asp Asp Val Ile Ala Asp Ala Pro Val Ser Arg Ile Ala Gly Arg Val Ala Val IIe Ala Gly Ala Ala Val Leu Thr Gly Leu Leu Thr Ala Ala Gly Aia Ala Leu Ala Ser Arg Leu Gly Glu Thr Val Leu Ala Arg Leu Arg Glu Arg Val Leu Asp Arg Ala Leu His Leu Pro Ser Ala Thr Leu Glu Arg Ala Gly Thr Gly Asp Leu Leu Ala Arg Val Gly Asp Asp Val Ala Val Val Thr Asn Val Ile Ala Val Ser Gly Pro Ala Phe Val Gly Ala Leu Leu Ser Val Val Leu Thr Val Phe Gly Leu Val Ala Leu Asp Trp Arg Leu Gly Leu Ala Gly Leu Val Ala Ala Pro Ala Tyr Ala Leu Ala Leu Arg Trp Tyr Leu Arg Arg Ser Ala Pro Tyr Tyr Ala Arg Glu Arg Val Ala Thr Gly Glu Arg Thr Gln Ala Met Ala Gly Ala Leu Arg Gly Ala Ala Thr Val Arg Ala Tyr Arg Thr Glu Asp Ala His Val Ala Ala Ile Ala Glu Arg Ser Gly Val Ala Arg Asp Leu Ser Leu Glu Ile Phe Asn Leu His Thr Arg Phe Gly Leu Arg Ile Asn Arg Ser Glu Phe Leu Gly Leu Ala Ala Val Leu Val Ala Gly Phe Phe Leu Val Arg Ala Asp Leu Vai Thr Vai Gly Ala Ala Thr Thr Ala Ala Leu Tyr Phe His Arg Leu Phe Asn Pro Ile Gly Leu Leu Leu Met Glu Ser Asp Ser Val Leu Gln Ala Gly Ala Ser Leu Ala Arg Leu Val Gly Val Ala Thr Leu Pro Asp Thr Ala Pro Ser Gly Pro Ala Pro Ser Ala Ala Gly Arg Arg Gly Fro Ala Ala Leu Asp Val Thr Val Arg Arg His Arg Tyr Asp Asp Asp Gly Pro Leu Val Leu Ala Asp Val Asp Leu Arg Leu Ala Pro Gly Glu Arg Val Ala Leu Val Gly Ala Ser Gly Ala Gly Lys Ser Thr Leu Ala Gly Ile Ala Aia Gly Ile Ile Ala Pro Thr Asp Gly Ser Val Arg Leu Gly Gly Val Pro Leu Thr Glu Arg Gly Glu His Ala Val Arg Arg Asp Val Ala Leu Val Ser Gln Glu Val His Val Phe Ala Gly Pro Leu Ala Glu Asp Leu Arg Leu Ala Ala Pro Asp Ala Thr Asp Ala Glu Leu Leu Asp Ala Leu Asp Arg Val Gly Ala Thr Thr Trp Leu Arg Ala Leu Pro Asp Gly Leu Ala Thr Ala Val Gly Glu Gly Gly His Arg Leu Thr Ala Ala Gln Ala Gln Gln Val Ala Leu Ala Arg Leu Val Leu Ala Ala Pro Ala Val Aia Val Leu Asp Glu Ala Thr Ala Glu Ala Gly Ser Ala Gly Ala Arg Asp Leu Asp Arg Ala Ala Leu Ala Ala Thr Glu Gly Arg Thr Thr Leu Ile Val Ala His Arg Leu Ser Gln Ala Val Ala Ala Asp Arg Ile Val Leu Leu Asp His Gly Arg Ile Val Glu Gln Gly Thr His Ser Glu Leu Leu Ala Ala Asp Gly Arg Tyr Gly His Leu Trp Arg Ser Trp Ser Val Pro Val N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:83 gtgaccgctgacccgcgtaccgccgaacccacccgggtgttgctgcccaccgcgaccgcc60 cggcggacctggacgacgctcggcgcggagttccgccggcggcccggcctcagcgccgcc120 gcgaccgccgtgctcgtcgccgccgccaccggcgggctggtcgcgccctgggtgctcggc180 cgcctcgtcgacgacgtcatcgccgacgccccggtctcccggatcgccggccgggtggcg240 gtgatcgccggcgcggcagtgctcaccggactgctcaccgccgccggggccgcgctcgcg300 tcccgcctgggggagacggtgctggcccggctgcgcgagcgggtcctcgaccgggcgctg360 cacctgccctcggcgacgctggaacgggccggcaccggcgacctgctggcccgggtcggc420 gacgacgtggcggtggtgacgaacgtgatcgcggtcagcggcccggcgttcgtcggcgcg480 ctgctgtccgtggtgctgaccgtgttcgggctggtcgcgctcgactggcggctcggcctc540 gccgggctggtcgccgcgcccgcctacgcgctggcgctgcgctggtacctgcgccggtcg600 mz gcgccgtactacgcccgcgagcgcgtcgccaccggcgagcggacgcaggcgatggccggc660 gcgctgcgtggcgcggccaccgtgcgcgcgtaccggaccgaggacgcgcacgtcgcggcg720 atcgccgagcgctccggcgtggcgcgcgacctgtcgctggagatcttcaacctgcacacc780 cggttcgggctgcggatcaacaggtcggagttcctcggcctggccgcggtgctcgtcgcc840 gggttcttcctggtccgcgccgacctggtcacagtgggcgcggcgaccaccgccgcgctc900 tacttccaccggctgttcaacccgatcggcctgctgctgatggagtccgactcggtgctg960 caggccggcgcgagcctcgcccggctggtcggcgtggccacgctgcccgacaccgccccg1020 tccgggcccgcgccgtcggcggccgggcggcgcggcr_cggcggcgctggacgtcacggtc1080 cgccggcaccgctacgacgacgacggccctctggtcctggccgacgtcgacctgcgcctg1140 gccccgggcgagcgggtcgcgctcgtgggcgccagcggcgcgggcaagagcacgctcgcc1200 ggcatcgccgccgggatcatcgcgcccaccgacgggtcggtacgcctgggcggcgtgccg1260 ctgaccgagcggggcgagcacgccgtgcggcgcgacgtcgcgctggtcagccaggaggtg1320 cacgtcttcgctggaccgctcgccgaggatctgcgcctggctgccccggacgccaccgac1x80 gccgaactgctcgacgcgctggaccgggtcggcgccaccacctggctgcgcgcgctgccg1440 gacgggctggccacagcggtcggcgagggcggccaccggctcaccgccgcgcaggcccag1500 caggtcgccctggcccggctggtgctggccgcgcccgccgtcgccgtgctggacgaggcc1560 accgccgaggccggcagcgccggagcgcgtgacctggaccgggcggcgctggccgccacc1620 gagggacggaccacgctgatcgtggcgcaccggctcagccaggcggtcgccgccgaccgg1680 atcgtcctgctcgaccacgggcggatcgtggagcagggcacgcactcggaactgctcgcc1740 gccgacggccggtacgggcatctgtggcgctcctggagcgtcccggtatga 1791 SEQ ID N0: 84 LENGTH: 507 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 84 Met Thr Asp Ala Pro Ala Arg Phe Val Leu Phe Pro Gly Arg His His Leu Leu Thr Arg Phe Gln Ala Asp Tyr Leu Arg Arg Leu Ala Gly Asp Asp Ala Thr Val Val Trp Ala Val Thr Ser Ala Asn His Glu Asn Thr Arg Arg Asn Pro Val Pro Tyr His Arg Arg Glu Ala Ala Ile Glu Arg Phe Ser Val Leu Ser Gly Leu Arg Ser Val Val Val Pro Ile Phe Asp Thr Ala Tyr Thr Asp Ala Phe Ala Glu Val Thr Leu Lys Ser Ile Ala Val Ala Thr Gly Leu Glu Leu Thr Pro Ala Asp Thr Val Leu Ala Cys Ser Thr Pro Glu Val Ala Lys Leu Tyr GIu Gln Leu Gly Phe Ser Ile Ala Pro Val Glu Ala Asp Pro Asp Leu Pro Glu Pro Pro Glu Arg Pro 130 135 i40 Trp Asp Val Leu Leu Arg Leu Ala Ala Gly Asp Glu Thr Trp Arg Ala Leu Thr His Pro Ala Thr Ile Asp Val Phe Glu Arg Tyr Arg Leu Val Glu Ser Ile Arg Ser Val Val Asn Asp Pro Leu Val Gly Asp Glu Gly Gly Leu Thr Val Thr Arg Asp Tyr Arg Thr Tyr Val Glu Ala Phe Ala Thr Aia Ala Gln Arg Lys Trp Asp Ser Val Arg Arg Tyr Val Gln Pro Gly Arg Ile Val Asp Ile Gly Cys Gly Ala Gly Ala Val Leu GIu Leu Ala Asp Arg Glu Ala Ala Leu Arg Glu Ser Asp Leu Ile Gly Val Glu Val Ala Arg His Leu Tyr Gln Glu Cys Leu His Lys Lys Ala Gln Gly '~'al Phe Arg Asn Ala Asn Val Tyr Phe Phe His Arg Asn Val Leu Gly Gly Ala Vai Phe Lys Asp Arg Ser Val Asp Thr Thr Leu Thr Phe Ala Leu Thr His Glu Ile Trp Ser Tyr Gly Arg Arg Arg Glu Ser Leu Leu Gln Phe Ala Arg Arg Ile His Asp His Thr Val Pro Gly Gly Val Trp Ile Asn Ser Asp Val Cys Gly Pro Asp Asp Pro Arg Arg Gln Val Leu Leu Arg Leu Ser Thr Asp Asp Gly Asp Asn Pro Ala Ala Pro Arg Pro Asp Leu Ala Glu Leu Thr Ser Ala Glu Val Arg Arg Tyr Val Gly Gly Leu Ser Thr Arg Ala Arg Leu Asp Gln Phe Ala Val Asp Phe Ala Phe ll~

Asp Phe Asp Tyr Glu Pro Leu Pro Asp Gly Ala Val Arg Leu Thr Leu Gly Ala Ala Met Asp Tyr Leu Thr Arg Lys Asp Tyr Thr Asp Asn Trp Leu Ser Glu Thr Gln Glu Gln Phe Cys Gly Leu Ser Phe Ala Asp Trp Thr Asp Leu Leu Thr Glu Ala Gly Phe Glu Ile Gly Pro Ala Ser Ala Pro Val Arg Asn Glu Trp Val Ile Asp Asn Arg Ile Ala Pro Val Ala Ser Leu Thr Asp Leu Asp Gly Arg Pro Leu Asp Trp Pro Thr Thr His Val Leu Thr Val Ala His Arg Pro Arg Asn Gln N0:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:85 atgaccgacgcgccggcccgcttcgtgctcttcccggggcggcaccacctgctgacccgg60 ttccaggccgactacctgcggcggctggccggggacgacgccacagtggtctgggcggtg120 acgtcggccaaccacgagaacaccaggcgcaacccggtgccctaccaccggcgggaggcc180 gcgatcgaacgattcagcgtgctgagcgggctgcgct=cggtggtggtgccgatcttcgac240 accgcgtacaccgacgcgttcgccgaggtgacgctgaagtccatcgcggtggccaccggg30() ctcgaactcacccccgccgacaccgtgctggcctgctccacgccggaggtcgcgaagctg360 tacgagcagctcggcttttcgatcgcgccggtcgaggcggacccggacctgcccgagccg420 cccgaacggccgtgggacgtgctgctgcgcctggccgccggggacgagacctggcgcgcg480 ctcacccacccggccaccatcgacgtgttcgagcgctaccgcctggtcgagtcgatccgg540 tcggtggtgaacgacccgctcgtcggcgacgagggcggtctcacagtgacccgcgactac600 cggacctacgtcgaggcgttcgccacggccgcgcagcgcaagtgggactcggtacgccgg660 tacgtgcagcccggccgcatcgtggacatcggctgcggcgcgggcgccgtcctggaactc720 gccgaccgggaggccgcgctgcgtgagagcgacctgatcggcgtggaggtcgcccgccac780 ctctaccaggagtgcctgcacaagaaggcgcagggcgtgttccgcaacgccaacgtctac840 ttcttccaccgcaacgtcctcggcggcgcggtgttcaaggaccgctcggtcgacaccacg900 ctcacgttcgcgctgacccacgagatctggtcgtacgggcggcggcgggagtcgctgctg960 cagttcgcccgccgcatccacgaccacacggtgcccggcggcgtctggatcaacagcgac1020 gtgtgcggtccggacgacccccggcggcaggtgctcctgcgactgtccaccgacgacggc1080 gacaacccggccgcgccccgccccgacctcgccgagctgacctcggcggaggtccggcgt1140 tacgtcggcgggctgtcgacgcgggcgcggctggaccagttcgccgtcgacttcgcgttc1200 gacttcgactacgagccgctccccgacggcgcggtacgcctgacgctgggcgccgcgatg1260 gactacctgacccgcaaggactacacggacaactggctgtcggagacgcaggagcagttc132() tgcggcctgagcttcgccgactggacggacctgctcaccgaggcggggttcgagatcggc1380 ccggcgtcggcgccggtgcgcaacgagtgggtgatcgacaaccggatcgcgccagtcgcg1440 tccctcaccgacctcgacggccggccgctggactggccgaccacccacgtcctcaccgtc150() gcccaccgcccccgcaaccagtga 1524 SEQ ID N0: 86 LENGTH: 232 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 86 Val Ser Asp Ile Gln Ile Ile Ser Phe Val Ala Ala Ser Leu Leu Ile Ile Ile VaI Pro Gly Val Asp Phe Ala Leu Val Thr Arg Gln Thr Val Arg Tyr Gly Arg Arg Ala Gly Phe Val Val Leu Ala Gly Leu Phe Val Ala Ala Leu Val His Ala Ser Phe Ala Thr Ala Gly Leu Ser Ala Leu Leu Val Ser Ser Pro Thr Leu Tyr Thr Val Leu Arg Val Ala Gly Ala Leu Tyr Leu Leu Tyr Leu Gly Gly Thr Ile Leu Trp Ala Thr Arg Pro Arg Arg Thr Val Pro Ala Ala Gln Pro Val Thr Val Gly Ala Gly Gly Ala Gly Pro Asp Thr Asp Thr Gly Pro Ala Pro Val Pro Asp Thr Pro Ala Ala Asp Glu Pro His Val Aia Arg Arg Ser Phe Val Met Gly Val Thr Ser Gln Leu Leu Asn Val Lys Val Val Val Phe Tyr Val Ser Phe Val Pro Gln Phe Val Lys Pro Gly Glu Gly Ala Ala Ala Arg Thr Ala Val Leu Ala Ala Thr Phe Ile Gly Leu Ala Val Leu Trp Trp Ala Cys Tyr Ile Met Leu Ile Asp Arg Leu Gln Pro Trp Leu Thr Arg Pro Ser Val Leu Leu Val Ile Glu Arg Leu Thr Gly Leu Ile Leu Ile Val Leu Ala Ile .Arg Ile Ala Leu Ser Arg NO:

LENGTH.

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:87 gtgtctgacatccagatcatcagtttcgtcgccgccagcctgctcatcatcatcgtgccg 60 ggcgtcgacttcgcgctcgtcacccggcagaccgtcaggtacggccggcgggccgggttc 120 gtggtgctggccgggctgttcgtcgccgcgctggtgcacgcgtcgttcgcgaccgccggc 180 ctgtccgccctgctggtctcctcgccgacgctctacacggtgctgcgcgtcgccggcgcg 240 ctgtacctgctctacctgggcggcacgatcctctgggcgacccggccgcgccggacggtc 300 ccggcggcgcagccggtcactgtcggcgcgggcggcgccgggccggacacggacaccggc 360 cccgcgccggtgccggacaccccggccgccgacgagccgcacgtggcccgccgctcgttc 420 gtcatgggcgtcaccagccagctgctgaacgtcaaggtggtcgtcttctacgtctcgttc 480 gtgccgcagttcgtcaagcccggcgagggggcggcggcccgtacggcggtgctcgccgcc 540 acgttcatcggcctcgcggtgctctggtgggcctgctacatcatgctcatcgacaggttg 600 cagccctggctgacccggccgtccgtgctgctggtgatcgaacggctgaccgggctcatc 660 ctgatcgtcctggcgatccggatcgcgctgagccggtga 699 SEQ ID N0: 88 LENGTH: 132 TYPE: PRT
ORGANISM: Micromonospora sp. strain 046-ECO11 SEQUENCE: 88 Val Gly Val Ser Ala Met Thr Thr Phe Asp Tyr Asp Gly Arg Val Phe Val Ser Val Asp His Asp Ala Gly Asp Gly Ala Glu Pro Leu Arg Gly His Tyr His Gln Arg Gly Asp Leu VaI Trp Aia Glu Ile Thr Gly Gly Pro Val Arg His Gly Arg Leu Ala Gly Thr Cys Asp Ala Gln Gly Val Val Arg Phe Ala Tyr Leu Glu Val Leu Thr Asp Gly Thr Ile Val Ile Gly Glu Cys Glu Ser Arg Pro Glu Arg Leu Pro Asp Gly Arg Ile Arg Leu Arg Glu Gln Trp Arg Arg His Gly Pro Arg Gln Asp Ser Gly Val Ser Val Ile Glu Glu Ala Val Pro Ala Leu Ala Gly Gly Gln Glu Ser Arg Arg Arg Val NO:

LENGTH:

TYPE:
DNA

ORGANISM:Micromonospora sp. strain SEQUENCE:89 gtgggcgtgagcgcgatgacgacattcgactacgacggccgcgtcttcgtctcggtggac60 cacgacgccggtgacggcgccgagccgctgcgggggcactaccaccagcgtggcgacctg120 gtctgggcggagatcaccggcggcccggtccggcacggccggctggccggcacctgcgac180 gcgcagggcgtcgtgcgcttcgcctacctggaggtgctcaccgacggcaccatagtcatc240 ggcgagtgcgagtcccggcccgaacggctgccggacggccggatccggctgcgggaacag300 tggcgccggcacggaccacgccaggacagcggcgtctccgtcatcgaggaggcagtgccg360 gcgctcgccggaggacaggagagccggcgtcgtgtctga 399

Claims (79)

1. A compound of the formula or a pharmaceutically acceptable salt thereof.

2. A pharmaceutical composition comprising a compound of the formula or a pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier.

3. A compound of Formula I:
wherein, W1, W2 and W3 is each independently selected from The chain from the tricycle may terminate at W3, W2 or W1 with W3, W2 or W1 respectively being either -CH=O or -CH2OH;
A is selected from -NH--, -NCH2R1, -NC(O)R1;
R1 is selected from C1-6 alkyl, C2-6 alkene, aryl or heteroaryl;
R2, R3, and R4 is each independently selected from H, R5, -C(O)R6 R5 is each independently selected from C1-6 alkyl, C2-7 alkalene, aryl or heteroaryl;
R6 is each independently selected from H, C1-6 alkyl, C2-7 alkalene, aryl or heteroaryl; or a pharmaceutically acceptable salt thereof.

4. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein A is NH.

5. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein A is -NCH2R1.

6. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein A is -NC(O)R1.

7. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R2 is H.

8. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R3 is H.

9. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R4 is H.

10. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R2, R3 and R4 are each H.

11. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R2, R3 and R4 are each H, and W1 is -CH =CH-.

12. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R2, R3 and R4 are each H, and W2 is -CH =CH-.

13. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein R2, R3 and R4 are each H, and W3 is -CH =CH-.

14. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein A is NH and R2, R3 and R4 are each H.

15. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein A is NH, each of W', W2, and W3 is -CH =CH-.

16. A compound selected from the group consisting of:

17. A pharmaceutical composition comprising the compound of any one of claims 3 to 16 or a pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier.

18. A farnesyl dibenzodiazepinone obtained by a method comprising a) cultivating Micromonospora sp. strain [S01]046, wherein said cultivation is performed under aerobic conditions in a nutrient medium comprising at least one source of carbon atoms and at least one source of nitrogen atoms;
and b) isolating a farnesyl dibenzodiazepinone from the bacteria cultivated in step (a).

19. The farnesyl dibenzodiazepinone of claim 18 that generates NMR spectra essentially as shown in Figure 3.

20. A process for making the compound of claim 1, comprising cultivation of Micromonospora sp. strain 046-EC011, in a nutrient medium comprising at least one source of carbon atoms and at least one source of nitrogen atoms, and isolation and purification of said compound.

21. A process for making a compound of claim 1, comprising cultivation of Micromonospora sp. strain [S01]046 in a nutrient medium comprising at least one source of carbon atoms and at least one source of nitrogen atoms, and isolation and purification of said compound.

22. The process of claim 21, wherein said cultivation occurs under aerobic conditions.

23. The process of claim 21, wherein said carbon atom and said nitrogen atom sources are chosen from the components shown in Table 16.

24. The process of claim 21, wherein said cultivation is carried out at a temperature ranging from 18°C to 40°C.

25. The process of claim 21, wherein said cultivation is carried out at a pH
ranging from 6 to 9.

26. Micromonospora sp. having IDAC Accession No. 231203-01 or IDAC
Accession No. 070303-01.

27. A method of inhibiting the growth of a cancer cell, comprising contacting said cancer cell with a compound of claim 3, such that growth of said cancer cell is inhibited.

28. A method of inhibiting the growth of a cancer cell, comprising contacting said cancer cell with a compound of claim 1, such that growth of said cancer cell is inhibited.

29. A method of inhibiting the growth of a cancer cell in a mammal, comprising administering the compound of claim 3 to a mammal comprising a cancer cell, such that growth of said cancer cell is inhibited in said mammal.

30. A method of inhibiting the growth of a cancer cell in a mammal, comprising administering the compound of claim 1 to a mammal comprising a cancer cell, such that growth of said cancer cell is inhibited in said mammal.

31. A method of treating a pre-cancerous or cancerous condition in a mammal, comprising the step of administering to said mammal a therapeutically effective amount of the compound of claim 3, such that a pre-cancerous or cancerous condition is treated.

32. A method of treating a pre-cancerous or cancerous condition in a mammal, comprising the step of administering to said mammal a therapeutically effective amount of the compound of claim 1, such that a pre-cancerous or cancerous condition is treated.

33. A method of treating a bacterial infection in a mammal, comprising administering a therapeutically effective amount of the compound of claim 3 to said mammal having a bacterial infection, such that said bacterial infection is treated.

34. A method of treating a bacterial infection in a mammal, comprising administering a therapeutically effective amount of the compound of claim 1 to said mammal having a bacterial infection, such that said bacterial infection is treated.

35. A method of reducing inflammation in a mammal, comprising administering to a mammal having inflammation a therapeutically effective amount of the compound of claim 3, such that said inflammation is reduced.

36. A method of reducing inflammation in a mammal, comprising administering to a mammal having inflammation a therapeutically effective amount of the compound of claim 1, such that said inflammation is reduced.

37. An isolated polynucleotide comprising SEQ ID NOs. 1, 64 and 73, wherein said polynucleotide encodes a polypeptide that participates in a biosynthetic pathway for a farnesyl dibenzodiazepinone.

38. An isolated, purified or enriched nucleic acid for production of a farnesyl dibenzodiazepine, said nucleic acid selected from the group consisting of:

a) SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89;
b) a nucleic acid encoding a polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88;
c) a nucleic acid that is at least 75% identical to a nucleic acid of a) or b), and which encodes a polypeptide having the same biological function as a polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88 respectively;
d) a nucleic acid that is complementary to a nucleic acid of a), b) or c).

39. A nucleic acid sequence encoding a polypeptide selected from the group consisting of:

a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88;
b) polypeptides that are at least 85% identical to SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88, and having the same biological function as a polypeptide of SEQ ID
NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88.

40. A nucleic acid sequence of claim 38 or 29 encoding a polypeptide selected from the group consisting of:

a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80 and 82; and b) polypeptides that are at least 85% identical to SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80 and 82 and having the same biological function as a polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80 or 82.

41. A nucleic acid sequence of claim 38, 39 or 40 comprising a sequence selected from the group consisting of:

a) SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89; and b) a sequence that is at least 85% identical to SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 or 89, and encodes a polypeptide having the same biological function as a polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88.

42. A nucleic acid sequence of any one of claims 38 to 41 comprising a sequence selected from the group consisting of:

a) SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89; and b) a sequence that is at least 90% identical to SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89.

43. A nucleic acid sequence of any one of claims 38 to 42 comprising a sequence selected from the group consisting of:

a) SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 and 89; and b) a sequence that is at least 98% identical to a SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 66, 68, 70, 72, 75, 77, 79, 81, 83, 85, 87 or 89.

44. A nucleic acid sequence encoding at least two of the nucleic acid sequences of any one or claims 38 to 43.

45. A nucleic acid sequence encoding at least three of the nucleic acid sequences of any one of claims 38 to 43.

46. A nucleic acid sequence encoding at least five of the nucleic acids of any one of claims 38 to 43.

47. Use of a nucleic acid of any one of claims 38 to 46 for the production of a farnesyl dibenzodiazepine.

48. An expression vector comprising a nucleic acid of any one or claims 38 to 46.

49. An isolated host cell transformed with an expression vector of claim 48.

50. A bacterial host cell transformed with an expression vector of claim 48.

51. The host cell of claim 49 or 50 wherein said host cell is selected from species of the genera Pseudomonas and Streptomyces.

52. The host cell of claim 49 or 50 wherein the host cell is E. coli.

53. An isolated polypeptide sequence selected from the group consisting of:
a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88; and b) a polypeptide having at least 75% identity to a polypeptide of SEQ ID
NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84 or 86, and having the same biological function as the polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84 or 86 respectively.

54. An isolated polypeptide sequence selected from the group consisting of:
a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86, 88; and b) polypeptide having at least 85% identity to a polypeptide of SEQ ID NOS:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88, and having the same biological function as the polypeptide as SEQ ID NOS. 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 24, 26, 38, 40, 42, 44, 46, 48 or 50 respectively.

55. An isolated polypeptide sequence selected from the group consisting of:
a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86, 88; and b) a polypeptide having at least 85% identity to a polypeptide of SEQ ID
NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88, and having the same biological function as the polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88 respectively.

56. An isolated polypeptide sequence selected from the group consisting of:

a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88; and b) a polypeptide having at least 90% identity to a polypeptide of SEQ ID
NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88.

57. An isolated polypeptide sequence selected from the group consisting of:
a) SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 and 88;
b) a polypeptide having at least 95% identity to a polypeptide of SEQ ID
NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 41, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 70, 71, 74, 76, 78, 80, 82, 84, 86 or 88.

58. A method of making a polypeptide having a sequence selected from the polypeptides of any one of claims 53 to 57 comprising introducing into a host cell in vitro a nucleic acid encoding said polypeptide, said nucleic acid being operably linked to a promoter.

59. A method of making a polypeptide having a sequence selected from the polypeptides of any one of claims 53 to 57 comprising introducing into an isolated host cell a nucleic acid encoding said polypeptide, said nucleic acid being operably linked to a promoter.

60. A method of making a polypeptide having a sequence selected from the polypeptides of any one of claims 53 to 57 comprising introducing into a bacterial host cell a nucleic acid encoding said polypeptide, said nucleic acid being operably Pinked to a promoter.

61. Use of at least one polypeptide of any one of claim 53 to 57 for the production of a farnesyl dibenzodiazepine.

62. Use of at least two polypeptides of any one of claims 53 to 57 for the production of a farnesyl dibenzodiazepine.

63. Use of at least three polypeptides of any one of claims 53 to 57 for the production of a farnesyl dibenzodiazepine.

64. Use of at least five polypeptides of any one of claims 53 to 57 for the production of a farnesyl dibenzodiazepine.

65. Use according to any one of claims 53 to 57 wherein the farnesyl dibenzodiazepine is the compound ECO-04601.

66. Cosmid 046KM deposited under IDAC accession no. 250203-06.

67. Cosmid 046KQ deposited under IDAC accession no. 250203-07.

68. The cosmid of claim 66 or 67, wherein said cosmid is inserted into a prokaryotic host for expressing a product.

69. The cosmid of claim 68, wherein said host is E. coli, Streptomyces lividans, Streptomyces griseofuscus, Streptomyces ambofuchsus, Actinomycetes, Bacillus, Corynebacteria or Thermoactinomyces.

70. A DNA which hybridizes under stringent hybridization conditions to the DNA
of the cosmid of claim 66 or 67; and that encodes a biosynthetic pathway for the production of a farnesyl dibenzodiazepine.

71. A method for increasing the yields of a farnesyl dibenzodiazepine using the cosmids of claim 66 or 67, said method comprising the steps of transforming a prokaryotic host with the cosmid of claim 66 or 67; and culturing the transformed prokaryotic host under conditions which result in the expression of farnesyl dibenzodiazepine.

72. The polypeptide of any one of claims 53 or 57, wherein said polypeptide participates in a biosynthetic pathway for a farnesyl dibenzodiazepinone.

73. An expression vector comprising one or more of the polynucleotides of claims 38 to 46.

74. A recombinant prokaryotic organism comprising one or more expression vectors of claim 73.

75. The organism of claim 74, wherein said organism is an actinomycete.

76. The organism of claim 74 or 75, wherein said organism requires said expression vector to synthesize a farnesyl dibenzodiazepinone.

77. A method of synthesizing a farnesyl dibenzodiazepinone de novo in a prokaryote, comprising the steps of:
(a) providing a prokaryote that is incapable of synthesizing a farnesyl dibenzodiazepinone;
(b) transforming said prokaryote with an expression vector of claim 75; and (c) culturing said prokaryote;
wherein said culturing results in the synthesis of said farnesyl dibenzodiazepinone in said prokaryote.

78. The method of claim 77, wherein said prokaryote is an actinomycete.

79. The method of claim 77, wherein said vector expresses a polypeptide of any one of claims 53 to 57.