CA2528853A1

CA2528853A1 - Methods and nucleic acids for analyses of colorectal cell proliferative disorders

Info

Publication number: CA2528853A1
Application number: CA 2528853
Authority: CA
Inventors: Fabian Model; Andrew Sledziewski; Tamas Rujan; Jorn Lewin; Juergen Distler; Cathy Loften-Day
Original assignee: Epigenomics AG
Current assignee: Individual
Priority date: 2005-12-23
Filing date: 2005-12-23
Publication date: 2007-06-23

Abstract

The invention provides methods, nucleic acids and kits for detecting, or for detecting and distinguishing between or among colorectal cell proliferative disorders. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of and differentiation between said class of disorders, thereby enabling the improved diagnosis and treatment of patients.

Description

DE11'LA.N1JE'.7 CJ BREVETS 1' L4JlJl'~7FUX

LA PRESENTE PARTIE DE CETTE DEiNL~NDE OL~ CE BR.E-,,-ETS
COMPREND PLUS D'U'f TONIE.

CECI EST LE TOINIE DE

NOTE: Pour les tomes additioneis, veillez contacter le Bureau Canadien des Brevets, THIS SECTION OF THE APPLICATION / PATENT CON T AINS iriORE
THAN ONE VOLUME.

THIS IS VOLUNLE ~ OF

NOTE: For additional volumes oiease contaet the Canadian Patent Office.

.APPlication numberlnumero de demande: W-SZ ~~ SJ
Figures: G~ 111etIA4--AleDCS'C

Pages:

Unscannable items received with tthis application (Request original documents in File Prep. Section on the 10th Floor) Documents rerus avec cette demande ne pouvant etre balayes (Commander les documents originaux dans la section de preparation des dossiers au .
l(?ieme etage) METHODS AND NUCLEIC ACIDS FOR ANALYSES OF
COLORECTAL CELL PROLIFERATIVE DISORDERS

FIELD OF THE iNVENTION
The present invention relates to genomic DNA sequences that exlubit altered CpG
mathylation patterns in disease states relative to normal. Particular embodirnents provide methods, nucleic acids, nucleic acid arrays and kits useful far detecting, or for detecting and differentiating between or among colorectal cell proliferative disorders.

BACKGROUND
The etiology of pathogenic states is kaown to involve modified methylation patterns of individual genos or of the genome. 5-methylcytosine, in the context of CpG
dinucleotide sequences, is the most frequent covalently modified base in the DNA of eukaryotic cells, and plays a role in the regnlaRion of truscription, gmtic imprinting, and tumorigenesis. The identification and quantification of 5-methyleytosine sites in a specific specimen, or between or among a plurality of specimens, is thus of considerable interest, not only in research, but particularly for the molocular diagnoses of various diseases.

Carrelatiort of aberrant DNA rnethylation with cancer. Aberrrant DNA
methylation within CpG 'islands' is charactezized by hyper- or hypomethylation of CpG
dinucleotide sequences leading to abrogation or overexpression of a broad spacttum of genes, and is among the earliest and most common a lterations found in, and correlated with human malignancies.
t Additionally, abnormal methylation has been shown to occur in CpG-rich regulatory elements in intronic and coding parts of genes for certain tumors. In colon cancer, for example, aberrant DNA methylation constitutes one of the most prominent alterations and inactivates many tumor suppressor genes such as p14ARF, p16TMC4a, THBSI, M1NT2, and 1VIINT3i and DNA
mismatch repair genes such as hMLHI.
In contrast to the specific hypennethylation of tumor suppressor genes, an overall hypomethylation of DNA can be observed in tumor cells. This decrease in global methylation can be detected early, far before the development of frank tumor formation. A
correlation between hypomethylation and increased gene expression has been determined for many oncogenes.
In the United States the annual incidence of colorectal cancer is approximately 150,000, with 56,600 individuals dying form colorectal cancer each year. The lifetime risk of colorectal cancer in the general population is about 5 to 6 percent. Despite intensive efforts in recent years in screening and e arly d etection o f c olon cancer, until today most cases are diagnosed in an advanced stage with regional or distant metastasis. W'hile the therapeutic options include surgery and adjuvant or palliative chemotherapy, most patients die from progression of their..
cancer within a few months. Identifjring the molecular changes that underlie the development of colon cancer may help to develop new monitoring, screening, diagnostic and therapeutic options that could improve the overall poor prognosis of these patients.
The current guidelines for colorectal screening according to the American Cancer Society utilizes one of five different options for screening in average risk individuals 50 years of age or older. These options include 1) fecal occult blood test (FOBT) annuaily, 2) flexible sigmoidoscopy every five years, 3) annual FPBT plus flexible signioidoscopy every five years, 4) double contrast barium enema (DCBE) every five years or 5) colonoscopy every ten years.

Even though these testing procedures are well accepted by the medical community, the implementation of widespread screening for colorectal cancer has not been realized. Patient compliance is a major factor for limited use due to the discomfort or inconvenience associated with the procedures. FOBT testing, although a non-invasive procedure, requires dietary and other restrictions 3-S days prior to testing. Sensitivity levels for this test are also very low for coloroctal adenocarcinoma with wide variability depending on the trial.
Sensitivity measurements for detection of adenomas is even less since most adenomas do not bleed. In contrast, sensitivity for more invasive procedures such as sigmoidoscoapy and colonoscopy are quite high because of direct visualization of the hunen of the colon. No randomized trials have evaluated the efficacy of these techniques, however, using data from case-control studies and data from the National Polyp Study (U.S.) it has been shown that removal of adenomatous polyps results in a 76-90% reduction in CRC incidence. Sigmoidoscopy has the lianitation of only visualizing the left side of the colon leaving lesions in the right colon undetected. Both scoping procedures are expensive, require cathartic preparation and have increased risk of morbidity and mortality. Improved tests with increased sensitivity, specificity, ease of use and decreased costs are clearly needed before general widespread screening for colorectal cancer becomes routine.
Early colorectal cancer detection is generally based on the fecal occult blood test (FOBT) performed annually on asymptomatic individuals. Cuzent recommendations adapted by several healthcare organizations, including the American Cancer Society, call for fecal occult blood testing beginning at age 50, repeated annually until such time as the patient would no longer benefit from scroening. A positive FOBT leads to colonoscopic exanaination of the bowel; an expensive and invasive procedure, with a serious complication rate of one per 5,000 examinations. Only 12% of patients with home positive stool are diagmosed with cancer or large polyps at the time of colon~oscopy. A number of studies show that FOBT
screening does not improve cancer-related mortality or overall survivat. Compliance with occult blood testing has been poor; less than 20 percent of the population is offered or completes FOBT
as recommanded. If FOBT is properly done, the patient collects a fecal sample from three consecutive bowel movements. Samples are obtained while the patient adheres to dietary guidelines and avoids medications known to induee occult gastrointestinal bleeding. In reality, physicians frequently fail to instruct patients properly, patients frequently fail to adhere to pmtocol, and some patients find the task of collecting fecal samples difficult or unpleasant, hence compliance with annual occult blood testing is poor. If testing sensitivity and specificity can be improved over current methods, the frequency of testing could be reduced, eollection of consecutive samples would be eliminated, dietary and medication schedule modifications would be eliminated, and patient compliance would be enhanced. Compounding the problem of compliance, the sensitivity and specificity of FOBT to detect colon cancer is poor. Poor test specificity leads to unnecessary colonoscopy, adding considerable expense to colon cancer screening.

Specificity of the FOBT has been calculated at best to be 96 /., with a sensitivity of 43%
(adenomas) and 50% (colorectal carcinoma). Sensitivity can be improved using an immunoassay FOBT such as that produced under the tradcname 'InSure"m', with an improved sensitivity of 77 % (adenomas) and 88.9~0 (colorectal carcinoma.
Molecular disease markers offer several advantages over other types of maYkers, one advantage being that even samples of very small sizes and/or samples whose tissue architecture has not been maintained can be analyzed quite efficiently. Within the last decade a number of genes have been shown to be differentially expressed between normal and colon carcinomas.
However, no siagle or combination of marker has been shown to be su.fficient for the diagnaais of colon carcinomas. High-dimensional'mRNA based approaches have recently been shown to be able to provide a better means to distinguish between different tumor types and benign and naalignant lesions. However its application as a routine diagnostic tool in a clinical environment is impeded by the extrame instability of mRNA, the rapidly oocurting expression changes following certain triggers (e.g., sample collection), and, most importantly, the large amount of mRNA needed for analysis (Lipshutz, R. J. et al., Nature Genetics 21:20-24, 1999; Bowtell, D.
D. L. Nature genetics suppl. 21:25-32, 1999), which often cannot be obtained from a routine biopsy.

The use of biological markers to further improve sensitivity and specificity of FOBT has been suggested, examples of such tests include the PreGen-PlusTM stool analysis assay available from EXACT Sciences which has a sensitivity of 20% (adenoma) and 52%
(colorectal carcinoma) and a specificity of 95% in both cases. This test assays for the presence of 23 DNA
mutations associated with the development of colon neoplasms. The use of DNA
methylation as colon cancer markers is known. For example Sabbioni et al. (Molecular Diagnosis 7:201-207, 2003) detected hypermethylation of a panel of gc,nes consisiting TPEF, HICI, DAPK and MGMT in peripheml blood in 98% of colon carcinoma patients. However, this does provide a suitable basis for a commercially marketable test, as the specificity of such a test must also be sufficiently high.
The cunreqtmodel of colorectal pathogenesis favours a stepwise progression of adenomas, which includes the development of dysplasia and finally sigas of invasive cancer.
The molecular changes underlying this adenoma-careinoma sequence include genetic and epigenetic alterations of tumor suppressor genes (APC, p53, DCC), the activation of oncogenes (K-ras) and the inactivation of DNA mismatch repair genes. Recently, further molecular changes and genetic defects have been revealed. Thus, activation of the Wnt signalling pathway not o nly includes m utations o f the A PC gene, b ut m ay also r esult from P
-catenin m utations.
Furthermore, a lterations i n t he T GF-0 s ignalling p athway t ogether w ith its s ignal t ransd.ucers SMAD4 and SMAD2 have been linked to the development of colon cancer.
Despite recent progress in the understanding of the pathogenesis of adenomas and carcinomas o f t he c=olon a nd t heir genetic a nd molecular changes, t he genetic and e pigenetic ;
changes underlying the development of metastasis are less well understood. It is, however, generally well accepted that the process of invasion and proteolysis of the extracellular matrix; :
as well a s infiltration of the vascular basement m embrane involve adhesive proteins, such as, members of the family of integrin receptors, the cadherins, the immunoglobulin superfamily, the laminin binding pratein and the CD44 receptor. Apart from adhesion, the process of metastasis formation also includes the induction and regulation of angiogenesis (VEGF, bFGF), the induction of cell proliferation (EGF, HGF, IGF) and the aativation of proteolytic enzymes (AWs, TIMPs, uPAR), as well as the inhibition of apoptosis (Bcl-2, Bcl-X).
More recently other groups have compared the genetic and molecular changes in metastatic lesions to the changes found in primary colorectal cancers. Thus, Kleeff et al. reported the loss of DOC-2, a candidate tumor suppressor gene, both in primary and metastatic colorectal cancer.
Furthermore, Zauber et al. reported that in their series of 42 colorectal cancers Ki-ras mutations in the primary cancers were identical in all of the 42 paired primary and synchronous metastatic lesions. Similarly loss of heterozygosity at the APC locus was identical for 39 paired carcinomas and synchronous metastasis. The authors concluded that for Ki-ras and APC genes the genetic changes in metastasis are identical to the primary colorectal cancer. However, other groups have found genetic and molecular changes in metastatic colon cancers, that are not present in the primary cancers. Thus, the development of LOH of chromosome 3p in colorectal metastasis has been reported. In addition, using comparative genomic hybridization several alterations were found in liver metastasis that were unique to metastastic lesions (-9q, -11q, and -17q).

Apart from mutations aberrant methylation of CpG islands has been shown to lead to the transcriptional silencing of certain genes that have been previously linked to the pathogenesis of various cancers. CpG islands are short sequences which are rich in CpG
dinucleotides and can usually be found in the 5' region of approximately 50% of all human genes.
Methylation of the cytosines in these islands leads to the loss of gene expression and has been reported in the inactivation of the X cbromosome and genomic imprinting.

Recently several groups have also analysed the methylation of various genes in colorectal cancer and reported the transeriptional silencing by promoter methylation for p16INK4, p14ARF, pl5IlVK4b, MGMT, hMLH1, GSTPI, DAPK, CDHI, T3Tvl.P-3 and APC
among others. Thus apart from mutational inactivation of certain genes, the hyperttxethylation of,=
these genes also contributes significantly to the pathogenesis of this disease.
In recent years several genes that are methylated in colon cancer have been identified by MS-APPCR. This group of genes, among others, includes TPEF/HI'P1 which is frequently methylated i n c olon c ancers a nd w hich w as i ndependently i dentified b y t wo d ifferent g roups using the MS-APPCR method (see, e.g., Young J, Biden KG, Simms LA, Huggard P, Karamatic R, Eyre HJ, Sutherland GR, Herath N, Barker M, Anderson GJ, Fitzpatrick DR, Ramm GA, Jass JR, Leggett BA. HPP1: a transmembrane protein-encoding gene commonly methylated in colorectal polyps and cancers. Proc Natl Acad Sci USA 98:265-270, 2001).

Multifactorfal approach. Cancer diagnostics has traditionally relied upon the detection of single molecular markers (e.g., gene mutations, elevated PSA levels).
Unfortunately, cancer is a disease state in which single markers have typically failed to detect or differentiate many forms of the disease. Thus, assays that recognize only a single marker have been shown to be of limited predictive value. A fundamental aspect of this invention is that methylation-based cancer diagnostics and the screening, diagnosis, and therapeutic monitoring of such diseases will provide significant improvements over the stat"f-the-art that uses single marker analyses by the use of a selection of multiple markers. The multiplexed analytical approach is particularly well suited for cancer diagnostics since cancer is not a simple disease, this multi-factorial "panel" approach is consistent with the heterogeneous nature of cancer, both cytologically and clinically.
Key to the successful implementation of a panel approach to methylation based diagnostic tests is the design and development of optimized panels of markers that can characterize and distinguish disease states.
Development of medical tests. Two key evaluative measures of any medical screening or diagnostic test are its sensitivity and specificity, which measure how well the test performs to accurately detect all affected individuals without exception, and without falsely including individuals who do not have the target disease (predicitive value).
Historically, many diagnostic tests have been criticized due to poor sensitivity and specificity.
A true positive (TP) result is where the test is positive and the condition is present. A
false positive (FP) result is where the test is positive but the condition is not present. A true, negative (TN) result is where the test is negative and the condition is not present. A false !
negative (F'N) result is where the test is negative but the condition is not present. In this context:
Sensitivity = TP/(TP+FN); Specificity = TN/(FP+TN); and Predictive value =
TP/(TP+FP).
Sensitivity is a measure of a test's ability to correctly detect the target disease in an individual being tested. A test having poor sensitivity produces a high rate of false negatives, i.e., individuals who have the disease but are falsely identified as being free of that particular disease. The potential danger of a false negative is that the diseased individual will remain undiagnosed and untreated for some period of time, during which the disease may progress to a later stage wherein treatments, if any, may be less effective. An example of a test that has low sensitivity is a protein-based blood test for HN. This type of test exhibits poor sensitivity because it fails to detect the presence of the virus until the disease is well established and the virus has invaded the bloodstream in substantial numbers. In contrast, an example of a test that has h igh s ensitivity i s v iral-load d etection u sing t he p olymerase c hain r eaction (PCR). H igh sensitivity is a chieved b ecause this type o f t est can detect very s mall quantities o f the virus.
High sensitivity is particularly important when the consequences of missing a diagnosis are high.
Specificity, on the other hand, is a measure of a test's ability to identify accurately patients who are free of the disease state. A test having poor specificity produces a high rate of false positives, i.e., individuals who are falsely identified as having the diseasa A drawback of false positives is that they force patients to undergo unnecessary medicat procedures treatments with their attendant risks, emot-onal and financial stresses, and which could have adverse effects on the patient's health. A feature of diseases which makes it difficult to develop diagnostic tests with high specificity is that disease mechaaisms, particularly in cancer, often involve a plurality of gam and proteins. Additionally, certain proteins may be elevated for reasons unrelated to a disease state. n example of a test that has high specificity is a gene-based test that can detect a p53 mutation. Specificity is important when the cost or risk associated with fiuther diagnostic procednres or farther medieal intervention are very high.

Pronounced need in the art. If colon cancer screening specificity can be increased, the problem of false positive test results leading to unnecessary colonoscopic examination would be reduced leading to cost savings and impmved safety.

In view of the incidence of colon cancer andd disadvantages associated with cumant colorectal cell proliferative disorder screening methods there is a substantial need in the art for ixnproved methods for the early detection of colon cell proliferative disorders, in particular colon cancer, to be used in addition to or as a substitute for currently available tests.

SUMMARY OF THE YNVENTION
Various aspects of the present invention provide efficient and unique panels of genes, whereby methylation analysis of one or a combination of the members of the panel enables the detection of cell proliferative disorders of the prostate with a particularly high sensitivity, specificity and/or predictive value. The inventive colorectal cancer testing methods have particular utility for the screening of at-risk populations. The inventive methods have advantages over prior art methods (including the industry standard FOBT), because of improved sensitivity, specificity and likely patient compliance.
The present invention provides novel metlto(Is for detecting or distinguisWng between colorectal cell prolifera.tive disorders. Said methods are most preferably utilised for detecting or detecting and distinguishing between one or more of the following: colorectal carcinoma, colon adenoma, inflammatory colon tissue, grade 2 dysplasia colon adenomas less than 1 cm, grade 3 dysplasia colon adenomas larger than 1 cm, normal colon tissue, non-colon normal tissue, body fluids and non-colon cancer tissue.
In a farther embodiment of the invention the method according to the invention may be used for the detection of aerodigestive cell proliferative disorders.
In one embodiment the invention provides a method for detecting and/or for detecting and distinguishing between or among colorectal cell proliferative disorders in a subject. Said method comprises the following steps: i) contacting genomic DNA isolated from blood plasma, blood serum, whole blood, isolated blood cells, cells isolated from the blood obtained from the subject with at least one reagent, or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one target region of the genomic DNA,' wherein the nucleotide sequence of said target region comprises at least one CpG dinucleotide sequence; and ii) detecting, or detecting and distingnishing between or among colorectal cell , proliferative disorders afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%.
Preferably, the sensitivity is from about 75% to about 96%, or from about 80%
to about 90o/a, or from about 80% to about 85%. Perferably, the specificity is is from about 75% to about 96%, or from about 80% to about 90%, or from about 80% to about 85%.

The method is novel as no methods currently exist that enable the detection o f c olon cancer by analysis of bodily fluids, with a sensitivity and specificity high enough for use in a commercially available and regulatory body approved assay. Current methods used to detect and diagnose colorectal cell proliferative disorders include colonoscopy, sigmoidoscopy, and fecal occult blood colon cancer. In comparison to these methods, the disclosed invention is much less invasive than colonoscopy, and as, if not more sensitive than sigmoidoscopy and FOBT. The development of a body fluid assay represents a clear technical advantage over current methods known in the art in that it is anticipated that patient compliance for a single body fluid based test will be higher than the triplicate analysis of stool currently recommended for FOBT.

A particular embodiment the method comprises the use of one or more genes or genomic sequences selected from the group consisting of: SEQ ID NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFU28, HOMEOBOX
PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30 and DUX4 as markers for the differentiation, detection and distinguishing of colorectal cell proliferative disorders.
Said use of the gene may be enabled by means of any anal.ysis of the expression of the gene, by means of mRNA expression analysis or protein expression analysis.
However, in the most preferred embodiment of the invention, the detection, differentiation and distinguishing of colorectal cell proliferative disorders is enabled by means of analysis of the methylation status of one or more genes or genomic sequences selected from the group consisting of SEQ ID
NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTHI, RNF4, SOX
21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIA.AT, BTF3 Homolog 1, ADCY9, BCIrSõ
BCOR, TAFII28, HOMEOBOX PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, ..
AR, RNF30, DUX4, and their promoter or regulatory elements.
The invention provides a method for the analysis of biological samples for features associated with the development of colorectal ceil proliferative disorders, the method characterised in that at least one nucleic acid, or a fragment thereof, from the group consisting of SEQ ID NO:1 to SEQ ID NO:535 is/are contacted with a reagent or series of reagents capable of distinguishing between methylated and non methylated CpG dinucleotides within the genomic sequence, or sequences of interest.

The present invention provides a method for ascertaining genedc and/or epigenetic parameters of genomic DNA. The method has utility for the improved diagnosis, treatment and monitoring of colorectal cell proliferative disorders, more specifically by enabling the improved identification of and differentiation between subclasses of said disorder. The invention presents improvements over the state of the art in that it enables a highly specific classification of colorectal celt proliferative disordeis, thereby allowing for improved and informed trcatment of patients.

Preferably, the source of the test sample is selected from the group consisting of cells or cell lines, histological s2ides, biopsies, paraffin-embedded tissue, bodily fluids, ejaculate, stool, urine, blood, and combinations thereof. Preferably, the source is selected from the group consisting of stool, blood plasma, blood serum, whole blood, isolated blood cells, cells isolated from the blood obtained from the subject.
Specifically, the present invention provides a method for detecting colorectal cell proliferative disorders, comprising: obtain.ing a biological sample comprising genoanic nucleic acid(s); contacting the nucleic acid(s), or a fragment theraof, with one reagent or a plurality of reagents sufficient for distinguishing between methylated and non methylated CpG dinuclefltide sequences witliin a target sequence of the subject nucleic acid, wherein the target sequence comprises, or hybridizes under stringent conditions to, a sequence comprising at least 16 contigaous nucleotides of SEQ ID NOS:1 to 64, said contiguous nucleotides camprising at least one CpG dinucleotide sequence; and determining, based at least in part on said distinguishing, the methylation state of at least one target CpG dinucleotide sequence, or an average, or a value, reflecting an average methylation state of a plurality of target CpG
dinucleotide sequences.
Preferably, distingaishing between methylated and non methylated CpG
dinucleotide sequences within the target sequence comprises methylation state-dependent conversion or non-conversion of at least one such CpG dinucleotide sequence to the corresponding converted or non-converted dinucleotide sequence within a sequence selected from the group consisting of SEQ ID
NOS:304 ta SEQ ID NO:535 and SEQ LD NOS:65 to SEQ ID NO:88, and contiguous regions thereoÃcorresponding to the target sequence.
Additional embodiments provide a method for the detection of colorectal cell proliferative disorders, comprising: obtaining a biological sample having subject genomic DNA;
extracting the g enomic DNA; t reating the genomic DNA, o r a fragment t hereoi; w ith o ne o r more reagents to convert 5-position unmethylated cytosine bases to uracil or to another base tbat is detectably dissimilar to cytosine in terms of hybridization properties;
contacting the treated genomic DNA, or the treated fragment thereof, with an amplification enzyme and at least two primers comprising, in each case a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting SEQ ID NOS:304 to SEQ ID NO:535 and SEQ ID
NOS:65 to SEQ ID NO:88, and complements thereof, wherein the treated DNA or the fragment thereof is either amplified to produce an amplificate, or is not amplified;
and determining, based on a presence or absence of, or on a property of said amplificate, the methylation state of at least one CpG dinucleotide sequence selected from the group consisting of SEQ ID
NOS:1 to SEQ ID
NO:64, or an average, or a value reflecting an average methylation state of a plurality of CpG
dinucleotide sequences thereof. Preferably, at least one such hybridizing nucleic acid molecule or peptide nucleic acid molecule is bound to a solid phase. Preferably, determining comprises use of at least one method selected from the group consisting o~ hybridizing at least one nucleic acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NOS:304 to SEQ ID NO:535 and SEQ

ID NOS:65 to SEQ ID NO:88, and complements thereoF hybridizing at least one nucleic acid molecule, bound to a solid phase, comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent oonditions .
to a sequence selected from the group consisting of SEQ ID NOS:304 to SEQ ID
NO:535 and SEQ ID NOS:65 to SEQ ID NO:88, and complements thereof; hybridizing at least one nucleic acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NOS:304 to SEQ ID NO:535 and SEQ
ID NOS:65 to SEQ ID NO:88, and complements thereof, and extending at least one such hybridized nucleic acid molecule by at least one nucleotide base; and sequencing of the amplificate_ Further embodiments provide a method for the analysis of colorectal cell proliferative disorders, comprising: obtaining a biological sample having subject genomic DNA; extracting the genomic DNA; contacting the genomic DNA, or a fragment thereof, comprising one or more sequences selected from the group consisting of SEQ ID NOS: 1 to SEQ ID NO:64 or a sequence that hybridizes under sdringent conditions thereto, with one or more methylation-sensitive restriction enzymes, wherain the ge,nomic DNA is either digested thereby to produce digestion fragments, or is not digested thereby; and determining, based on a presence or absence of, or on property of at least one such fragment, the methylation state of at least one CpG dinucleotide sequence of one or more sequences selected fmm the group consisting o f SEQ ID
NOS:1 to SEQ Ii) N0:64, or an average, or a value reflecting an average methylation state of a plurality of CpG dinucleotide sequences thweo~ Preferably, the digested or undigested genomic DNA is amplified prior to said determining.
Additional embodiments provide novel genomic and chemieally modified nucleic aeid sequences, as well as oligonucleotides and/or PNA-oligomers for analysis of cytosine methylation patterns within sequences from the group cons'ssting of SEQ ID
NOS:1 to SEQ ID
NO:64.

BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1, 5, 9, 13, 16, 20, 24, 28 and 32 show ranked matrices of data obtained according to EXAMPI.ES 1 and 2, and according to CpG methylation differenaes between the two classes of tissues, using a suitable algorithm. The figures are shown in greyscale, wherein the most significant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Black indicates total methylation at a given CpG position, white represents no methylation at the particular position, with degrees of inethylation represented in grey, from light (low proportion of inethylation) to dark (high proportion of Ynethylation). Each row represents one specific CpG position within a gene and each column shows the methylation profile for the different CpGs for one sample. The p-values for the individual CpG positions are shown on the right side. The p-values are the probabilities that the observed distribution occurred by chance in the data set.

Figures 2, 6, 10, 17, 21, 25, 29 and 33 show the uncorrected multivariate LogReg test results for each comparison. Each individual genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.

Figures 3, 7, 11, 14, 18, 22, 26, 30 and 34 show nutlced matrices of data, obtained according to EXAMPLES I and 2, of the accuracy of the genewise linear support vector machine cross validations between the two classes of tissues, for the best performing markers.
The figures are shown in greyscale, wherein the most significant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Black indicates total methylation at a given CpG position, white represents no methylation at the partacular position, with degrees of inethylatson rqaresented in grey, from light (low proportion of inethylation) to dark (high proportion of inethylatiou.). Each row represents one specific CpG
position within a gene and each column shows the methylation profile for the diffecent CpGs for one sample.
Accuracy values for each individual genomic region of interesi are shown on the right side.
Figures 4, 8, 12, 15, 18, 23, 27, 31 and 35 show the accuzacy of the genewise linear support vector machine cross validation for all genomic regions of each classification. The accuracy of each genomic region is represented as black squares, the specificity as unfilled diamonds, and the sensitivity as unfilled squares. The accuracy as measured on the X-axis ftws the fiwtion of correctly classified samples.
Figure 36 shows the level of inethylation determined by different MSP
MethyLigh04 assays and HeavyMethyff MethyLight'74 assays. The Y-axis shows the degree ofinethylation.
Tumor samples are represented by white points, and normal colon tissue samples by black .
points. A significantly higher degree of inethylation was observed in tumor samples than in healthy tissue samples.

Fignre 37 shows the Receiver Operating Characteristic curve (ROC curve) of the SEQ
ID NO:35 -MSP-MethylLightm-Assay for adenocarcinomas according to EXAMPI,E 2.
The AUC for the MSP-MethylLightm-Assay is: 0.94.
Figure 38 shows the Receiver Operating Characteristic curve (ROC curve) of the SEQ
ID NO:35 -HM-MethylLightm-Assay for Adenocareinoma according to EXAMPLE 3. The AUC for the HM MethylLightm-Assay is: 0.91.

Figure 39 shows the level of tnethylation determined by a SEQ TD NO:35 -HeavyMethyff MethyLightTM' assay according to EXAWLE 3, testing an additional set of colon samples (25 adenocarcinoma, 33 normals, and 13 adenomas). The Y-axis shows the degree of inethylation within the region of the SEQ ID NO:35 gene investigated.

Adeuocminoma samq.sles ace represented by white squaras, and normal colon tism samples by black diamonds. A significantly higher degree of inethylation was observed in tumor samples than in healthy tissae samples. The level of sigriificance as measured using a t-test was 0.00424.
Figure 40 shows the Receiver Operating Characteristic curve (ROC curve) of the SEQ
ID NO:35 HM MethylLight"m-Assay for Adenocaccinoma and Adenoma according to EXAMPLE 3 (additional sets of samples). The area under an ROC curve (AUC) is a measure for the accuracy of a diagnostic test. The AUC for the HM-MethylLightTm-Assay is 0.81.
Figure 41 shows the Receiver Operating Chaiacteristic curve (ROC curve) of the SEQ
ID NO:35 AM MethylLight7m-Assay fnr Adenocarcinoma only according to LXAMPLE 2 (additional sets of samples). The area under an ROC curve (AUC) is a measure for the accuracy of a diagnostic test. The AUC for the HM-Methyl-Light-Assay is: 0_844.
Figure 42 shows the Receiver Operating Characteristic curve (ROC curve) of the SEQ
ID NO:35 -HM MethylLighta-Assay for Adenenomas according to EXAMPI.E
3(additional sets of samples). The area under an ROC curve (AUC) is a raeasure for the accuracy of a diagnostic test. The AUC for the HM MethylLighi' "s-Assay is: 0.748.
Figura 43 shows the level of inethylation in different tumor and healthy tissues detertnined by a SEQ ID NO 35 -HeavyMet'hyllm MethyLightTM assay according to example 4.
The Y-axis shows the degree of methylation within the region of the SEQ ID
NO:35 gene investigated. Besides the colon cancer samples only one of the two breast cancer tissues were inethylated.

Figure 44 shows the level of inethyiation in different brcast cancer tissues detiermined by a SEQ ID NO:35 -HeavyMethyP MethyLightT" assay according to F.XAMPLE 4. Only one was methylated.

Figure 45 s hows the 1 evel o f inethylation i n s enim s amples d etennined by a S EQ ID
NO:35 HeavyMethyP MethyLight " assay according to EXA1ViPLE 4. The Y-axis shows the degree of methylation within the region of the SEQ ID NO:35 gene investigated.

Fignre 46 shows the ROC curve of the SEQ ID NO:34 -MSP-Methyl-Light T""-Assay according to EXAMPLE 9. The AUC is: 0.84.

Figure 47 shows the ROC curve of the SEQ ID NO:29 -MSP-Methyl-Light TM-Assay aocording to EXAMPI.E 10. The AUC is: 0.80.

Figure 48 shows the regression plot of the percentage methylation within SEQ
ID NO:35 calculated in each sample using the MSP and HeavyMethyl T" variants of the MethyLight T""
assay.

Figare 49 shows the ROC curve of the SEQ ID NO:29 -MSP-MethylLight TM-Assay according to EXAMPLE 8 (first sample set). The AUC is: 0.93.
Figure 50 shows the ROC curve of the SEQ ID NO:29 -MSP-MethylLight Tm-Assay according to BXAMPLE 8 (second sample set). The AUC is: 1.
Figure 51 shows the ROC curve of the SEQ ID NO:39 -MSP-MethylLight Tm-Assay according to EXAMPLB 9. The AUC is: 0.94.

Figures 52 to 59 show the amplification of stool samples according to example 10. The X-axis shows the cycle number of the polymerase chain reaction, the Y-axis shows the delta Rn, whieh is the fluorescence intensity over background, the horizontal line (A) represents the threshold level of the calibration curve (B), if the curve reaches above (A) methylation has been detected.

Figures 60 to 71 show the PCR amplification of samples according to example 11.Each individual sample is annotated on the x-axis as 'n' denoting normal, or 't' denoting tumour. A
bronchial tissue sample was accidentally analysed in some assays, these are annotated with an arrow, and are iYrelevant in the context of the present invention. The Y-axis shows the level of methylation ('methylation rate ') in the sample. The methylation rate {methy2ated/(methylated + unmethylated) are shown for the fragments corresponding to the primer paus in Table 4..
Figures 72 to 86 show the PCR amplification of samples according to assays I
to 15 of example 14 respectively. The X-axis shows the cycle number of the polymerase chain reaction, the Y-axis shows the fluorescence intensity over background.
Figure 72 shows the amplification curve of assay 1.
Figure 73 shows the amplification curve of assay 2.
Figure 74 shows the amplification curve of assay 3.
Figure 75 shows the amplification curve of assay 4.
Figure 76 shows the amplification curve of assay 5.
Figure 77 shows the amplification curve of assay 6.
Figu.re 78 shows the amplification curve of assay 7.

Figare 79 shows the amplification cnrve of assay 8.
Figure 80 shows the amplification curve of assay 9.
Figure 81 shows the amplification curve of assay 10.
Figure 82 shows the amplification curve of assay 11.
Figure 83 shows the amplification curve of assay 12.
Figure 84 shows the amplification curve of assay 13.
Figure 85 shows the amplification curve of assay 14.
Figore 86 shows the amplification curve of assay 15.
Figures 87 to 95 show the class prediction performance of quadratic SVA+is trained on the data set according to example 14. Circled points are the support vectois defining the borderline (white) between the lighter and darker shaded areas, Figure 87 shows an SVM trained using Assays 12 and 9.
Figure 88 shows an SVM trained using Assays 12 and 11.
Fignre 89 shows an SVM traixud using Assays 12 and 15.
Figure 90 shows an SVM trained using Assays 7 and 6.
Figure 91 shows an SVM tsained using Assays 11 and 5.
Figure 92 shows an SVM trained using Assays 7 and 5.
Figure 93 shows an SVM trained using Assays 6 and 4.
Figure 94 shows an S'V"M trained using Assays 12 and 7.
Figure 95 shows an SVM trained using Assays 12 and 6.
Figure 96 shows a ranked matrices of data obtained according to Examples 1 and according to CpG methylation differences between the two classes of tissues, (aerodigestive cancer on the left and healthy aerodigestive tissues on the right) using an algorithim. The most sigaificant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Red indicates total methylation at a given CpG position, green represents no methylation at the particular position.. Each row represents one specific CpG
position within a geae and esah column shows the methylation profile for the different CpGs for one sample.

DETATLED DESCRIPTION OF THE;QWENTION
De ti Q-s:

The term "Observe3/Expected Ratio" ("O/E Ratio") refers to the frequency of CpG
dinucleotides within a particular DNA sequeace, and corresponds to the [niiinber of CpG sites 1 (number of C bases x number of G bases)] x band length for each fragment.

The term "CpG island" refers to a contigaous region of genonlic DNA that satisfies the rxiteria of (1) having a frequency of CpG dinucleotides corresponding to an "Observed/Expected Ratio" >0.6, and (2) having a "GC Content" >0.5. CpG islands are typically, but not always, between about 0.2 to about t kb, or to about 2kb in length.
The term "methylation state" or "methylation status" refers to the presence or absence of 5-methylcytosine ("5~Cyt") at one or a plurality of CpG dinucleotides within a DNA sequence.
Methylation states at one or more particular CpG methylation sites (each having two CpG CpG
dinucleotide sequences) within a DNA sequence include "mmethylated," "fully-methylated"' and "hemi-methylated."
The term "hemi snethylation" or "hemimethylation" refers to the methylation state of a palindromic CpG methylation site, where only a single cytosine in one of the two CpG
dinucleotide sequences of the palindromic CpG methylation site is methylated (e.g., 5'-CCMGG-3' (top strand): 3'-GGCC-5' (bottom strand)).
The term 'AUC' as used herein is an abbreviation for the area under a curve.
In particular it refers to the area under a Receiver Operating Characteristic (ROC) curve.'The ROC
curve is a plot of the true positive rate against the false positive rate for the different possible cutpoints of a diagnostic test. It shows the tradeoff between sensitivity and specificity depending on, the selected cutpoint (any increase in sensitivity will be accompanied by a d'ecrease in specificity). The area under an ROC curve (AUC) is a measure for the aeeuracy of a diagnostic test (the larger the area the better, optimum is 1, a random test would have a ROC curve lying on the diagonal with an area of 0.5; for reference: I.P. Egan. Signat Detection Theory and ROC
Analysis, Academic Press, New York,1975).

The term "hypermethylation" refers to the average methylation state corresponding to an increased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG
dinucleotides within a nonnal control DNA sample.
The term "hypomethylation" refers to the average methylation state corresponding to a decreased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA
sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG

dinucleotides within a normal control DNA saniple.
The term "nicroarray" refers broadly to both "DNA microarrays," and 'DNA
chip(s),' as recognized in the art, encompasses all art-recognized solid supports, and encompasses all methods for af.tixing nucleic acid molecules thereto or synthesis of nucleic acids thereon.

"Genetic parameters" are mutations and polymorphisms of genes and sequences fwrther required for their regulafiion. To be designated as mutations are, in particular, insertions, deletions, point mutations, inveisions and polymoiphisms and, particularly prefetxed, SNPs (single nucleotide polymorphisms).
"Epigenetic parameters" are, in part.icular, eytosine methylations. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlate with the DNA
methylation.
The term "bisulfite reagent" refers to a reagent comprising bisulfite, disulfite, hydrogen sulfite or combinations thereof, usefnl as disclosed heroin to distinguish between methylated and unmethytated CpG dinucleotide sequences.
i5 The term '2Vlethylation assay" refers to any assay for determining the methylation state of one or more CpG dinucleotide sequences within a sequence of DNA.
The term "MS.AP-PCR" (Methylation-Sensitive .Arbitrarily-Primed Polylnerase Chain Reaction) refers to the art-recognized technology tbat allows for a global scan of the genome using CG-rich pruners to focus on the regions most likely to contain CpG
dinucleotides, and described by Gonzalgo et al., Cancer Research 57:594599,1997.
The term "MethyLightTM" refers to the att-recognized IIuorescence-based real-time PCR
technique described by Eads et al., Cancer Res. 59:2302-2306,1999.

The term "HeavyMethyTm" assay, in the embodiment thereof implemented herein, refers to an assay, wherein methylation specific bdocking probes (also referred to herein as blockers) covering CpG positions between, or covered by the amplification primers enable methylation-specific selective amplification of a nucleic acid sample.

The term "HeavyMethylTM MethyLight'' w' assay, in the embodiment thereof implemented herein, refers to a HeavyMethylT"Y MethyLightTu assay, which is a variation of the MethyLightTM a ssay, wherein the MethyLightTu assay i s combined w ith m ethylation specific blocking probes covering CpG positions between the amplification primers.
The term "Ms-SNuPE" (Methylation-sensitive Single Nucleotide Primer Extension) refers to the art-recogaixed assay described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531,1997.

The term "MSP" (Methylation-specific PCR) refers to the art-recognized methylation assay described by Herman et al. Proc. NatL Acad. Sci. USA 93:9821-9826, 1996, and by US
Patent No. 5,786,146.
The term "COBRA ' (Combined Bisulfite Restriction Analysis) refers to the art-recognized methylation assay described by Xiong & Laird, Nucleic Acids Res.
25:2532-2534, 1997.
The term "MCA" (Methylated CpG Island Amplification) refers to the methylation assay described by Toyota et al., Cancer Res. 59:2307-12, 1999, and in WO
00/26401A1.
The term "hybridizgtion" is to be understood as a bond of an oligonucleotide to a complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex strncture.
"Stringent hybridization conditions," as defined herein, involve hybridizing at 68 C in .
5x SSC15x Denhardt's solution/1.0% SDS, and washing in 0.2x SSC/0.1% SDS at room temperature, or involve the art-recognized equivalent thereof (e.g., conditions in which a hybridization is canied out at 60 C in 2.5 x SSC buffer, followed by several washing steps at 37 C in a low buffer concentration, and reanains stable). Moderately stringent conditions, as defined herein, involve including washing in 3x SSC at 42 C, or the art-recognized equivalent thereof. The parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid.
Guidance regard'zng such conditions is available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) at Unit 2.10.

The terms "array SEQ ID NO," "composite array SEQ ID NO," or "composite array sequence" refer to a sequence, hypothetical or otherwise, consisting of a head-to-tail (5' to 3') linear composite of all individual contiguous sequences of a subject array (e.g., a head-to-tail composite of SEQ ID NOS:1-71, in that order).
The terms "array SEQ ID NO node," "composite array SEQ ID NO node," or "composite array sequence node" refer to a junction between any two individual contiguous sequences of the "array SEQ ID NO," the "composite array SEQ ID NO," or the "composite array sequence."
In reference to composite array sequences, the phrase "contiguous nucleotides"
refers to a contiguous sequence region of any individual contiguous sequence of the composite array, but does not include a region of the composite array sequence that includes a "node," as defined herein above.

v iew:
The present invention provides for molecular genetic markers that have novel utility for the analysis of methylation patterns associated with the development of colorectal cell proliferative disorders. Said markers may be used for detecting or distinguishing between colorectal cell proliferative disorders, thereby providing improved means for the classification and treatment of said disorders. In an alternative embodiment said molecular genetic markers may be used for the detection of aerodigestive cell proliferative disorders.
Bisulfite mod fication of DNA is an art-recognized tool used to assess CpG
methylation status. 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interesi. However, 5-methylcytosine positions caamot be identified by sequencing, because 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during, e.g., PCR amplification.
The most frequently used method for analyzing DNA for the presence of 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine whereby, upon subsequent alkaline hydrolysis, cytosine is converted to uracil which corresponds to thymine in its base pairing behavior. Significantly, however, 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using standard, art-recognized molecular biological techniques, for example, by amplification and hybridization, or by sequencing. All of these techniques are based on differential base pairing properties, which can now be fully exploited.
The prior art, in terms of sensitivity, is defined by a method comprising enclosing the DNA to be analyzed in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and replacing all precipitation and purification steps with fast dialysis (Olek A, et al., A modified and improved method for bisulfite based cytosine methylation analysis, Nucleic Acids Res. 24:5064-6, 1996). It is thus possble to analyze individual cells for methylation status, illushating the utility and sensitivity of the naethod. An ovelview of art-recognized methods for detecting 5-methylcytosine is provided by Rein, T., et al., Nucleic Acids Res., 26:2255, 1998.
The bisulfite technique, barring few exceptions (e.g., Zeschnigk M, et a l., Eur J Hum Gerud. 5:94-98, 1997), is cumently only used in research. Iu all instances, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment, and either completely sequenced (Olek & Walter, Nat Genet. 1997 17:275-6, 1997), subjected to one or more primer extension reactions (Gonzalgo & Jones, Nucleic Acids Res., 25:2529-31, 1997; WO
95/00669; U.S. Patent No. 6,251,594) to analyze individual cytosine positions, or treated by enzymatic digestion (Xiong & Laird, Nucleic Acids Res., 25:2532-4, 1997).
Detection by hybridization has also been described in the art (Olek et al., WO 99/28498).
AdditionaIIy, use of the bisulfite technique for methylation detection with respect to individual genes has been described (Grigg & Clark, Bioessays, 16:431-6, 1994; Zeschnigk M, et al., Hum Mol Genet.,.
6:387-95, 1997; Feil R, et al., Nucleic Acids Res., 22:695-, 1994; Martin V, et al., Gene, 157:261-4, 1995; WO 9746705 and WO 9515373).
The p resent i nvention p rovides for the use o f t he bisulfite t echnique , in c ombination with one or more methylation assays, for determination of the methylation status of CpG
dinuclotide sequences within sequences from the group consisting of SEQ ID
NOS:1 to SEQ ID
NO:64. According to the present invention, detennination of the methylation status of CpG
dinuclotide sequences within sequences from the group consisting of SEQ ID
NOS:1 to SEQ ID
NO:64 has diagnostic and progaostic utility.
Methylation Assay Procedures. Various methylation assay procedures are known in the art, and can be used in conjunction with the present inveation. These assays allow for detertnination of the methylation state of one or a plurality of CpG
dinucleotides (e.g., CpG
islands) within a DNA sequence. Such assays involve, among other techniques, DNA
sequencing of bisulfita-treated DNA, PCR (for sequence-specific amplification), Southern blot analysis, and use of inethylation-sensitive restriction enzymes.

For example, genomic sequencing has been simplified for analysis of DNA
methylation pattecns and 5-methylcytosine distribution by using bisulfite treatment (Frommer et al., Proc.
Natl. Acad. Sci. USA 89:1827-1831, 1992). Additionally, restriction enzyme digestion of PCR
products amplified from bisulfite-converted DNA is used, e.g., the method described by Sadri &
Hornsby(Nucl. Acids Res. 24:5058-5059, 1996), or COBRA (Combined Bisulfite Restriction Analysis) (Xiong & Laird, Nucleic Acids Res. 25:2532-2534,1997).
COBRA. COBRAm analysis is a quantitative methylation assay useful for detennining DNA methylation levels at specific gene loci in small amounts of genomie DNA
(Xiong &
Laird, Nucleic Acids Re<r. 25:2532-2534, 1997). Briefly, restriction enzyme digestion is used to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA. Methylation-dependent sequence differences are first introduaed into the genomic DNA
by standard bisulfite treatmerrt aeeording to the procedure described by Frommer et al. (Proc.
Natl. Acad Sci. USA 89:1827-1831, 1992). PCR amplification of the bisulfite converted DNA
is then performed using primers specific for the CpG islands of interest, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes. Methylation levels in the original DNA sample are represented by the relative amounts of digested and undigested PCR product in a linearly quantitative fashion across a wide spectrum of DNA methylation levels. In addition, this technique can be reliably applied to DNA
obtained from microdissected paraffin-embedded tissue samples.
Typical reagents (e.g., as might be found in a typical COBRAm-based kit) for COBRAm analysis may include, but are not limited to: PCR primers for specific gene (or bisulfite treated DNA sequence or CpG island); restriction enzyme and appropriate buffer; gene-hybridization oligo; control hybridization oligo; kinase labeling Idt for oligo probe; and labeled nucleotides. Additionally, bisulfite conversion reagents may iuclude: DNA
denaturation buffer;
sulfonation buffer. DNA recovery reagents or kits (e.g., precipitation, ultrafiltration, affmity column); desulfonation buffer; and DNA recovery components.
Preferably, assays such as "MethyLight'w' (a fluorescence-based real-time PCR
technique) (Eads et al., Cancer Res. 59:2302-2306, 1999), Ms-SNnPE7m (Methylation-sensitive Single Nucleotide Primer Extension) reactions (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997), methyla6on-speci5c PCR ("MSP '; Herman et al., Proc. Natt. Acad.
Sci. USA
93:9821-9826, 1996; US Patent No. 5,786,146), and methylated CpG island amplification {"MCA"; Toyota et al., Cancer Res. 59:2307-12, 1999) are used alone or in combination with other of these methods.
MethyLight TM. The MethyLight "" assay is a high-throughput quantitative methylation assay that utilizes fluorescence-based real-time PCR (Ta4MMap TM) technology that requirea no fiuther manipulations after the PCR step (Eads et al., Cancer Res. 59:23022-2306, 1999).
Briefly, the MethyLight''"' process begins with a mixed sample of genomic DNA
that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an "anbiased"
(with primers that do not overlap known CpG methylation sites) PCR reaction, or in a"biased"
(with PCR primers that overlap known CpG dinucleotides) reaction. Sequence discrimination can occur either at the level of the amplification process or at the level of the fluorescence detection process, or both.
The ArlethyLight'"'' assay may be used as a quantitative test for methylation patterns in the genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization. In this quantitative version, the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides. Alternatively, a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides ttiat do not "cover" known methylation sites (a fluorescencabased version of the '1VbSP" technique), or with oligonucleotides covering potential methylation sites.
The MathyLight TM process can by used with a"TaqMan " probe in the amptification process. For example, double-sttanded genomic DNA is treated with sodium bisulfite and subjected to one of two sets of PCR reactions using TaqMan probes; e.g., with either biased primers and TaqMan probe, or unbiased primers and TaqMan probe. The TaqMan*
probe is dual-labeled with fluorescent 'reporter" and "quenchee' molecules, and is designed to be Z5 specific for a relatively high GC content region so that it melts out at about 10 C higher temperature in the PCR cycle than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealinglextension step. As the Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventuaUy reach the annealed TaqMan probe. The Taq polymerase 5' to 3' endonuclease activity will then 10 displace the TaqMan probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system..
Typical reagents (e.g., as might be found in a typical MethyLight Ta-based kit) for MethyLight;"' analysis may include, but are not limited to: PCR primers for specific gene (or bisulfite treated DNA sequence or CpG island); TaqMan probes; optimized PCR
buffers and deoxynucleotides; and Taq polymerase.
Ms-SNuPE. The Ms-SNuPETm technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single-nucleotide primer extension (Gonzalgo & Jones, Nucleic Acids Res.
25:2529-2531, 1997).
Briefly, genoniic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG
site(s) of interesk Small amounts of DNA can be analyzed (e.g., microdissected pathology sections), and it avoids utilization of restriction enzymes for determining the methylation status at CpG sites.

Typical reagents (e.g., as might be found in a typical Ms-SNuPEm-based kit) for Ms-SNuPEm analysis may include, but are not limited to: PCR primers for specific gene (or bisulfite treated DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides;

gel extraction Iat; positive control primers; Ms-SNuPEm primers for specific gene; reaction buffer (for the Ms-SNuPE reaction); and labelled nucleotides. Additionalty, bisuifite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA
recovery regents or Idt (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
MSP. MSP (methylation specific PCR) allows for assessing the methylation status of virtually any group of CpG sites within a CpG island, independent of the use of methylation-sensitive restriction enzymes (Herman et al. Proc. Natl. Acad. Sci. USA
93:9821-9826,1996; US
Patent No. 5,786,146). Briefly, DNA is modified by sodium bisulfite converting all unmethylated, but not methylated cytosines to uracil, and subsequently amplified with primers specific for methylated versus umnethylated DNA. MSP requires only small quantities of DNA, is sensitive to 0.1% metlhylated alleles of a given CpG island locus, and can be performed on DNA extracted from paraffin-embedded samples. Typical reagents (e.g., as might be found in a typical MSP-based Icit) for MSP analysis may include, but are not limited to:
methylated and unnaethylated PCR primers for specific gene (or bisulfite treated DNA sequence or CpG island), optimized PCR buffers and deoxynucleotides, and specific probes.

MCA. The MCA technique is a method that can be used to screen for altered methylatioai patteans in genomic DNA, and to isolate specific sequences associated with these changes (Toyota et al., Cancer Res. 59:2307-12, 1999). Briefly, restriction enzymes with different sensitivities to cytos;ne methylation in their recognition sites are used to digest genomic DNAs from primary tumors, cell lines, and normal tissues prior to arbitrarily primed PCR amplification. Fragments that show differential methylation are cloned and sequenced after resolving the PCR products on lugh-resolution polyacrylamide gels. The cloned fragments are then used as probes for Southem analysis to confirm differential methylation of these regions. Typical reagents (e.g., as might be found in a typical MCA-based kit) for MCA
analysis may include, but are not limited to: PCR primers for arbitrary priming Genomic DNA;
PCR b uffers and nucleotides, restriction enzymes and appropriate b uffers; g ene hybridization oligos or probes; control hybridization oligos or probes.

Genpmic Seau(mce$ Acg:ording to SEO ID NO:1 to SEO ID NO:64. Md Non-naturallv Occuring Treated Variants Thereof Accordins t o S EO ID NOS:30m to $ EO ID NQS:535 and S EO ID
NM:65 TO SEO ID NO:88. were Determined to have NoveLUtilitv fo; the Detection.
Classification and/or Treatment of Colorec~ Cell Proliferative Disorders In one embodiment the invention provides a method for detecting and/or for detecting and distingtushing between or among colon cdl proliferative disorders in a subject. Said method comprises the following steps: i) contacting genomic DNA isolated from bodily fluids obtained from the subject with at least one reagent, or seaies of reagents that distingaishes between methylated and non-methylated CpG dinucleotides within at least one targa region of the genomic DNA, wherein said contiguous nucleotides comprise at least one CpG
d'mucleotide sequence; and ii) detecting, or detecting and distinguishing between or among colon cell proliferative disorders afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80'/o.
Preferably, the sensitivity is from about 75% to about 96%, or from about 80%
to about 90%, or from about 80% to about 85%. Perferably, the specificity is is from about 75% to about 96o/Q, or fiom about 80% to about 90%, or from about 80% to about 85%.
Genomic DNA may be isolated by any means standard in the art, including the use of cammercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample must be disrupted and lysed by enzymatic, chelnical or mechanical means. The DNA solution may then be cleared ofproteins and other contaminants, e.g., by digestion with proteinase K. The genomic DNA is then recovered from the solution.

T"his may be carried out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase support. The choice of method will be affected by several factors including time, expense and required quantity of DNA. Body Quids are the preferred source of the DNA; particularly preferred are blood plasma, blood serum, whole blood, isolated blood cells and cells isolated from the blood.
The genomic DNA sample is then treated in such a mamier that cytosine bases which are unmethylated at the 5'-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as 'treatment' herein.
The above desaribed treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uraciI or to another base which is dissimilar to cytosine in terms of base pairing behavior.
The treated DNA is then analysed in order to detenmine the methylation state of one or more target gene sequences (prior to the treatment) associated with the development of colorectal carcinoma. It is particularly preferred that the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of at least one gene or sequence selected from the group consisting the genes and sequences as listed in Table 1. It is fmther preferred that the sequences of said genes in Table 3 as described in the accompanying sequence listing are analysed. The method of analysis may be selected from those known in the art,.
including those listed herein. Particularly preferred are Methy.Light, MSP and the use of blocking oligonucleotides as will be descn'bed herein. It is further preferred that any oligonucleotides used in such analysis (including primers, blocking oligonucleotides and detection probes) should be reverse complementary, identical, or hybridize under stringent or higlily stringent conditions to an at least 16-base-pair long segment of the base sequences of one or more of SEQ ID NO: (IDBISEQFIRST) to SEQ ID NO: and (IDBISEQI.AST) and sequences complementary thereto.
Aberrant methylation, more preferably hypermethylation of one or more genes or genomic sequences taken from the group consisting of: SEQ ID NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CSTS, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMEOBOX
PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30 and DUX4 are associated with the presence of colorectal carcinoma.
Analysis of one or a plurality of the sequences enables for the first time detecting, or detecting and distinguishing between or among colon cell proliferative disorders afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%.
Sensitivity is calculated as: {detected colon neoplasia/all colon neoplasia);
and specificity is calculated as (non-detected negatives/total negatives).
S Preferably, the sensitivity is from about 75% to about 96%, or from about 80% to about 90%, or from about 80% to about 85%. Perferably, the specificity is is from about 75% to about 96%, or from about 80% to about 90%, or from about 80% to about 85%.
Colon neoplasia can be defined as aIl colon malignancies or colon malignancies and large (> 1 cm adenomas), or subsets thereo~ Negatives can be defined as any disease other than colon malignancy and adenomas, or healthy individuals.
In one embodiment the method discloses the use of one or more genes or genomic sequences selected from the group consisting SEQ ID NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTHI, RNF4, SOX 21, RNF4, AIX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMEOBOX PROTEIN
SIX6, GSK-3 BETA, ELK L, HLA F, TGFBR2, AR, RNF30 and DUX4 as markers for the differentiation, detection and distinguishing of colon cell proliferative disorders.
Said use of the gene may be enabled by means of any analysis of the expression of the gene, by means of mRNA expression analysis or protein expression analysis.
However, in the most preferred embodiment of the imrention, the detection, differentiation and distinguishing of colon cell proliferative disorders is enabled by means of analysis of the methylation status of one or more genes or genomic sesluences selected from the group consisting SEQ IL) NOS:1-3, 14, 16, 21, 2 2,2 3, 4 4-46, 4 8, 5 0, 5 9-64, C OX7B, C ST5, EYA3, F TH1, RNF4, S
OX 21, RNF4, ALX 4, ONC2, NGFR; DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMBOBOX PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30 and DUX4 and their promoter or regulatory elements. Methods for the methylation analysis of genes are descn'bed herein, Abezrant levels of mRNA expression of the genes, genoniic sequences or genes regulated by genomic sequences according to SEQ ID NOS: 1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CSTS, EYA3, FTHI, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMEOBOX PROTEIN
SIX6, GSK-3 BETA, ELK L, HLA-F, TGFBR2, AR, RNF30 and DUX4 accozrling to Table are associated with colorectal carcinoma.
Accordingly, increased or decreased levels of expression of said genes or sequences are associable with the development of colorectal carcinoma and other colorectal ceIl proliferative disorders.
To detect the presence of mRNA encoding a gene or genomic sequence in a detection system for colon cancer, a sample is obtained from a patient. The sample can be a tissue biopsy sample or a sample of blood, plasma, sernm or the like. The sample may be treated to extract the nucleic acids contained therein. The resulting nucleic acid from the sample is subjected to gel electrophoresis or other separation techniques. Detection involves contacting the nucleic acids and in particular the mRNA of the sample with a DNA sequence serving as a probe to form hybrid duplexes. The stringency of hybridisation is detennined by a number of factors during hybridisation and during the washing procedure, including temperature, ionic strength, length of time and concentration of formamide. These factors are outlined in, for example, Sambrook e t a 1. ( Molecular C loning: A Laboratory M anual, 2 d ed., 1989).
D etection o f t he resulting duplex is usually accomplished by the use of labelled probes.
Alternatively, the probe may be unlabeled, but may be detectable by specific binding with a ligand which is labelled, either directly or indirectly. Suitable labels and methods for labelling probes and ligands are known in the art, and include, for example, radioactive labels which may b e incorporated by known methods (e.g., nick translation or kinasing),biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes, particulariy triggered dioxetanes), enzymes, antibodies, and the like.
In o rder t o i ncrease the sensitivity o f t he d etection i n a sample o f m RNA t ranscribed from the gene or genomic sequence, the technique of reverse tr=scription/polymerisation chain reaction can be used to a mplify c DNA transcribed from the mRNA. The method of reverse t=anscription /PCR is well known in the art (for example, see Watson and Fleming, supra).
The reverse transcription /PCR method can be performed as follows. Total cellular RNA
is isolated by, for example, the standard guanidium isothiocyanate method and the total RNA is reverse transcribed. The reverse transcription method involves synthesis of DNA on a template of. RNA using a reverse transcriptase enzyme and a 3' end primer. Typically, the primer contains an oligo(dT) sequence. The cDNA thus produced is then amplified using the PCR
method and EYA4 specific primers. (Belyavsky et al, Nucl Acid Res 17:2919-2932, 1989; Krug and Berger, Methods in Enzymology, Academic Press,N.Y., Vol.152, pp. 316-325, 1987 which are incorporated by reference).
The present invention may also be described in certain embodiments as a kit for use in detecting a colon cancer disease state through testing of a biological sample.
A representative lait may comprise one or more nucleic acid segments that selectively hybridise to the mRNA and a container for each of the one or more nucleic acid segments. In certain embodiments the nucleic acid segments may be combined in a single tube. In further embodiments, the nucleic acid segments may also include a pair of primers for amplifying the target mRNA. Such Idts may also include any buffers, solutions, solvents, enzymes, nucleotides, or other components for hybridisation, amplification or detection reactions. Preferred Isit components include reagents for reverse transcription-PCR, in situ hybridisation, Northera analysis and/or RPA
The present invention finther provides for methods to detect the preseace of the polypeptide encoded by said genes or gene sequences in a sample obtained from a patient.
Aberrant levels of polypeptide expression of the polypeptides encoded by the genes, genomic sequences or genes regulated by genomic sequences according to SEQ ID
NOS:1-3, 14,16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CSTS, EYA3, FTH1, RNF4, SOX
21, RNF4, AL.X 4, ONC2, NGFR, DLX 5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMEOBOX PROTEIN SIX6, GSK-3 BETA, ELK L, HLA-F, TGFBR2, AR, RNF30 and DUX4 according to Table 3 are associated with colorectal carcinoma.
Accordingly over or under expression of said polypeptides are associable with the development of colorectal carcinoma and other colorectal cell proliferative disorders.
Any method known in the art for detecting proteins can be used. Such methods include, but are not limited to immunodiB'usion, immunoelectrophoresss, immunochanical methods, binder-ligand assays, immunohistochemical techniques, agglutination and complement assays..
(e.g., see B asic and Clinical I mmunology, Sites and Terr, e ds., Appleton &
L ange,. Norwalk, Conn. pp 217-262, 1991 whieh is incorporated by reference). Preferred are binder-ligand immunoassay methods including reacting antibodies with an epitope or epitopes and.
competitively displaaing a labelled protein or derivative thereof.
Certain embodiments of the present invention comprise the use of antibodies specific to the polypeptide encoded by the genes or genomic sequences of the group consisting of SEQ lD
NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTH1, RNF4, SOX
21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, T.AFII28, HOMEOBOX PROTEIN SIX6, GSK-3 BETA, ELIC L, HT.A F, TGFBR2, AR,12NF30 and DUX4.
Such antibodies may be useful for diagnostic and prognostic applications in detecting the disease state, by comparing a patient's levels of colon disease marker expression to expression of the same markers in normal individuals. In certain embodiments production of monoclonal or polyclonal antibodies can be induced by the use of the coded polypeptide as antigene. Such amibodies may in tum be used to detect expressed protsins as markers for human disease states.
The levels of such proteins present in the peripheral blood or tissue sample of a patient may be quantifxed by conventional methods. Antibody-protein binding may be detected and quantified by a variety of means known in the art, such as labelling with fluorescent or radioactive ligands.
The invention fiuther comprises ldts for performing the above-mentioned procedures, wherein such kits contain antibodies specific for the investigated polypeptides.
Numerous competitive and non-competitive protein binding immunoassays are well known in the art. Antibodies employed in such assays may be unlabeled, for example as used in agglutination tests, or labelled for use a wide variety of assay methods.
Labels that can be used include radionuclides, enzymes, fluorescers, chemiluminescers, enzyme substrates or co-factors, enzyme intnbitors, particles, dyes and the like for use in radioimmunoassay (RIA), enzyme immunoassays, e.g., enzyme-linked immunosorbent assay (ELISA), fluorescent immunoassays and the like. Polyclonal or monoclonal antibodies or epitopes thereof can be made for use in immunoassays by any of a number of methods known in the art.
One approach for preparing antibodies to a protein is the selection and preparation of an amino acid sequence of all or part of the protein, chemically synthesising the sequence and injecting it into an appropriate animal, usually a rabbit or a mouse (Milstein and Kohler Nature 256:495-497,1975; Gulfre and Milstein, Methods in Enzymology: Immunochemical Techniques 73:1-46, Langone and Banatis eds., Academic Press, 1981 which are incorporated by reference).
Methods for preparation of the polypeptides or epitopes thereof include, but are not limited to chemical synthesis, recombinant DNA techniques or isolation from biological samples.
In addition to the embodiments above wherein the methylation analysis of genes or genomic sequences selected from the group SEQ ID NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1,ADCY9, BCL-5, BCOR, TAF'IT28, HOMEOBOX PROTEIN
SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, Alt, RNF30 and DUX4 according to Table are analysed, the invention presents two further panels of genes with novel utility for the detection of colorectal cancer.
In a first further embodiment the present invention is based upon the analysis of methylation levels within one or more genes or genomic sequences taken from the group consisting of SEQ ID NOS:1-3, 14, 16, 21, 22,23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIA.AT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR,TAFII28, HOMEOBOX PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30, DUX4, SMAD7, GTMBP, EYA4 and TCF1-ALPõlIA
according to Table 3 and/or their regulatory sequences.
It is further preferred that the sequences of said genes or genomic sequences are as according to Table 3.

In a fiuther embodiment the present invention is based upon the analysis of inethylation levels within two or more genes or genomic sequences taken from the group consisting all genes and genomic sequences according to Table 3 andlor their regulatory sequences.
It is further preferred that the sequences of said genes or genomic sequences are as according to SEQ ID
NOS:1 to SEQ ID NO:64.
Particular embodiments of the present invention provide a novel application of the analysis of inethylation levels and/or pattems within said sequences that enables a precise detection, characterisation and/or treatment of colorectal cell proliferative disorders. Early detection of colorectal cell proliferative disorders is directly linked with disease prognosis, and the disclosed method thereby enables the physician and patient to make better and more informed treatment decisions. The sequences of the group consisting SEQ ID
NOS: 20, 41, 35, 3, 39, 33 & 27 have fiuther utility for the detection of arod.igestive cell proliferative disorders.
FURTHER IMPROVE~VIENTS

The present invention provides novel uses for genomic sequences selected from the group consisting of SEQ ID NOS:1 to SEQ ID NO:64. Additional embodiments provide modified variants of SEQ ID NOS:1 to SEQ ID NO:64, as well as oligonucleotides and/or PNA-oligomers for analysis of cytosine methylation pattems within SEQ ID NOS:1 to SEQ ID
NO:64.
An objective of the invention comprises analysis of the methylation state of one or more-CpG dinucleotides within at least one of the genomic sequences selected from the group consisting of SEQ ID NOS:1 to SEQ ID NO: 64 and sequences complementary thereto.
The disclosed invention provides treated nucleic acids, derived from genomic SEQ ID
NOS:I to SEQ ID NO:64, wherein the treatment is suitable to convert at least one unmethylated cytosine base of the genomic DNA sequence to uracil or another base that is detectably dissimilar to cytosine in terms of hybridization. The genomic sequences in question may comprise one, or more, consecutive or random methylated CpG positions. Said treaiment preferably comprises use of a reagent selected from the group consisting of bisulfite, hydrogen sulfite, disulfite, and combinations thereof. In a preferred embodiment of the invention, the objective comprises analysis of a non-naturally o ccurring modified nucleic acid comprising a sequence of at least 16 contiguous nucleotide bases in length of a sequence selected from the group consisting of SEQ ID NOS:304 to SEQ ID NO:535 and SEQ ID NOS:65 to SEQ
ID
NO:88, wherein said sequence comprises at least one CpG, TpA or CpA
dinucleotide and sequences oomplementary thereto. The sequences of SEQ ID NOS:304 to SEQ ID
NO:535 and SEQ II) NOS:65 to SEQ ID NO:88 provide non-naturally occurring modified versions of the nucleic acid according to SEQ ID NOS:1 to SEQ ID NO:64, wherein the modification of each genomic sequence results in the synthesis of a nucleic acid having a sequence that is unique and distinct from said genomic sequence as fbllows. For each sense strand genomic DNA, e.g., SEQ
ID NO:1, four converted versions are disclosed. A first version wherein "C" -+"T," but "CpG"
remains "CpG" (i.e., corresponds to case where, for the genomic sequence, all "C" residues of CpG dirnicleotide sequences are methylated and are thus not converted); a second version discloses the complement of the disclosed genomic DNA sequence (i.e. antisense strand), wherein "C" but 'CpG" remains "CpG ' (i.e., coiresponds to case where, for all "C"
residues of CpG dinucleotide sequences are methylated and are thus not converted). The 'upmethylated' oonverbed sequences of SEQ ID NOS:1 to SEQ ID NO:64 correspond to SEQ ID, NOS:65 to 76 and SEQ ]D NOS:304 to SEQ ID NO:419. A third chemically converted version of each genomic sequences is provided, wherein for all"C" residues, including those =
of "CpG" dinucleotide sequences (i.e., corresponds to case where, for the genornic sequences, all "C" residues of CpG dinucleotide sequences are unmethylated); a final chemically converted version of each sequence, discloses the complement of the disclosed genomic DNA sequence (i.e. antisense strand), wherein "C" -+"T" for all "C" residues, including those of "CpG"
dinucleotide sequences (i.e., corresponds to case where, for the complement (antisense strand) of each genomic sequence, all "C" residues of CpG dinucleotide sequences are umneihylated).
Tbe 'dowinnethylated' converted sequences of SEQ ID NOS:1 to SEQ ID NO:64 correspond to SEQ ID NOS: 77 to 88 and SEQ ID NOS:420 to SEQ ID NO:535.
Signifieantly, heretofore, the nucleic acid sequences and molecules according SEQ ID
NOS:1-7, 9-11, 14-23, 27, 31, 32, 40-42, 44-46, 48, 50-55 and 59-64 were not implicated in or connected with the detection, classification or treatment of colorectal cell proliferative disorders or aerodigestive ce11 proliferative disorders..

In an alternative preferred embodiment, such analysis comprises the use of an oligonucleotide or oligomer for detecting the cytosine methylation state within genomic or treated (chemically m odified) D NA, according t o S EQ ID NOS:1 t o S EQ ID N
0:53 S. S aid oligonucleotide or oligomer comprising a nucleic acid sequence having a length of at least nine (9) nucleotides which hybridizes, under moderately stringent or stringent conditions (as defined herein above), to a treated nucleic acid sequence according to SEQ ID NOS: 65 to SEQ ID NO:
88 and SEQ ID NOS:304 to SEQ ID NO:535 and/or sequences complementazy thereto, or to a genomic sequence according to SEQ ID NOS:1 to SEQ ID N0:64 andlor sequences complementary thereto.
Thus, the present invention includes nucleic acid molecules (e.g., oligonucleotides and peptide nucleic aeid (PNA) molecules (PNA-oligomers)) that hybridize under moderately stringent and/or stringent hybridization conditions to all or a portion of the sequences SEQ ID
NOS:1 to SEQ ID NO:535, or to the complements thereof. The hybridizing portion of the hybridizing nucleic acids is typically at least 9, 15, 20, 25, 30 or 35 nucleotides in length.
However, longer molecules have inventive utility, and are thus within the scope of the present invention.

Preferably, the hybridizing portion of the inventive hybridizing nucleic acids is at least 95%, o r a t least 98%, or 100% i dentical t o the sequence, o r t o a p ortion t hereof o f S EQ ID
NOS:1 to SEQ ID NO:535, or to the complements thereof.

Hybridizing nucleic acids of the type descnbed herein can be used, for e xample, as a primer (e.g., a PCR primer), or a diagnostic and/or prognostic probe or primer. Preferably, hybridization of the oligonucleotide probe to a nucleic acid sample is performed under stringent conditions and the probe is 100% identical to the target sequence. Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions.

For target sequences that are related and substantially identical to the con:esponding sequence of SEQ ID NOS:1 to SEQ ID NO:64 (such as allelic variants and SNPs), rather than identical, it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC or SSPE). Then, assuming that 1% mismatching results in a 1 C decrease in the Tm, the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if sequences having > 95%
identity with the probe are sought, the final wash temperature is decreased by 5 C). In practice, the change in Tm can be between 0.5 C and 1.5 C per 1% mismatch.
Examples of inventive oligonucleotides of length X (in nucleotides), as indicated by polynucleotide positions with reference to, e.g., SEQ ID NO:1, include those corresponding to sets (sense and antisense sets) of consecutively overlapping oligonucleotides of length X. where the oligonucleotides within each consecutively overlapping set (corresponding to a given X
value) are defined as the finite set of Z oligonucleotides from nucleotide positions:
n to (n f (X-1));
where n=i, 2, 3,...(Y-(X-1));
where Y equals the length (nucleotides or base pairs) of SEQ ID NO:1(2,280);

where X equals the common length (in nucleotides) of each oligonucleotide in the set (e.g., X=20 for a set of consecutively overlapping 20-mers); and where the number (Z) of consecutively overlapping oligomers of length X for a given SEQ ID NO of length Y is equal to Y-(X-1). For example Z= 2,280-19= 2,261 for either sense or antisense sets of SEQ ID NO:1, where X=20.

Preferably, the set is limited to those oligomers that comprise at least one CpQ TpG or.
CpA dinucleotide.
Examples of inventive 20-mer oligonucleotides include the following set of 2,261 oligomers (and the antisense set complementary thereto), indicated by polynucleotide positions with reference to SEQ ID NO:1:

1-20, 2-21, 3-22, 4-23, 5-24, ...... 2259-2278, 2260-2279 and 2261-2280.
Preferably, the set is limited to those oligomers that comprise at least one CpC; TpG or CpA dinucleotide. ' Likewise, examples of inventive 25-mer oligonucleotides include the following set of 2,256 oligomers (and the antisense set complementary thereto), indicated by polynucleotide positions with reference to SEQ ID NO: 1:

1-25, 2-26, 3-27, 4-28, 5-29, ......2254-2278, 2255-2279 and 2256-2280.

.......... ... .... .

Preferably, the set is limited to those oligomers that comprise at least one CpQ TpG or CpA dinucleotide.

The present invention encompasses, for each of SEQ ID NOS:l to SEQ ID NO:535 (sense and antisense), multiple consecutively overlapping sets of oligonucleotides or modified oligonucleotides of length X, where, e.g., X= 9, 10, 17, 20, 22, 23, 25, 27, 30 or 35 nucleotides.
The oligonucleotides or oligomers according to the present invention constitute effective tools useful to ascertain genetic and epigenetic parameters of the genomie sequence corresponding to SEQ II) NOS:1 to SEQ ID NO:64. Preferred sets of such oligonucleotides or modified oligonucleotides of length X are those consecutively overlapping sets of oligomers corresponding to SEQ ID NOS:1 to SEQ ID NO:535 (and to the complements thereof).
Preferably, said oligomers comprise at least one CpC; TpG or CpA dinucleotide.
Particularly preferred oligonucleotides or oligomers according to the present invention are those in which the cytosine of the CpG dinucleotide (or of the corresponding converted TpG
or CpA dinculeotide) sequences is within the middle third of the oligonucleotide; that is, where the oligonucleotide is, for example, 13 bases in length, the CpG, TpG or CpA
dinucleotide is positioned within the fifth to ninth nucleotide from the 5'-end.
The o ligonucleotides o f the i nvention c an also b e m odified b y c hemicallly linidng t he oligonucleotide to one or more moieties or conjugates to enhance the activity, stability or detection of the oligonucleotide. Such moieties or conjugates include chromophores, fluorophors, lipids such as cholesterol, eholic acid, thioether, aliphatic c"hains, phospholipids, polyamines, polyethylene glycol (PEG), palmityl moieties, and others as disclosed in, for example, United States Patent Nurnbers 5,514,758, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,597,696 and 5,958,773. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly p refen-ed pairing properties. Thus, the oligonucleotide may include other appended groups such as peptides, and may include hybridization-triggered cleavage agents (IK.zol et al., BioTechnfques 6:958-976, 1988) or intercalating agents (Zon, Pharm. Res. 5:539-549, 1988). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a chromophore, fluorophor, peptide, hybridization-triggered cross-linldiig agent, transport agent, hybridization-triggered cleavage agent, etc.

The oligonucleotide may also comrprix at kast one art recognized modified sugar and/or base moiety, or may comprise a modified backbone or non-natural intemucleoside linkage.

The oligonucleotides or o ligomers according to p articular e mbodiments of the present invention are typically used in 'sets,' which contain at least one oligomer for analysis of each of the CpG dinucleotides of genomic sequences SEQ ID NOS:1 to SEQ ID NO:64 and sequences complementary, thereto, or to the corresponding CpCy, TpG or CpA d'uaucleotide within a sequence of the treated nucleic acids accordmg to SEQ ID NOS:304 to SEQ ID
NO:535 and sequences complementary thereto. However, it is anticipated that for economic or other factors it may be preferable to analyze a limited selection of the CpG dinucleofides within said sequences, and the content of the set of oligonucleotides is altered accordingly.

Therefore, in particular embodiments, the present invention provides a set of at least two (2) (oligonucleotides and/or PNA-oligomers) useful for detecting the cytosine methylation stats in treated genomic DNA (SEQ II) NOS:304 to SEQ ID NO:535), or in genomic DNA
(SEQ ID
NOS:1 to SEQ ID NO:64 and sequences complementary thereto). These probes enable diagnosis, classification and/or therapy of genetic and epigenetic parameters of colorectal cell proliferative disorders. The sd of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in treated genomic DNA (SEQ ID NOS:304 to SEQ ID NO:535), or in.
genomic DNA (SEQ ID NOS:1 to SEQ ID NO:64 and sequences complementary thereto).
In prefen~ed embodiments, at least one, and more preferably all members of a set of oligonucleotides is bound to a solid phase.
ln further embodiments, the present invention provides a set of at least two (2) oligonucleotides that are used as 'primer' oligonucleotides for amplifying DNA
sequences of one of SEQ ID NOS:1 to SEQ ID NO:535 and sequences complementary thereto, or segments thereof It is anticipated that the oligonucleotides may constitute all or part of an "array" or 'I)NA chip" (i.e., an arrangement of different oligonucleotides and/or PNA-oligomers bound to a solid phase). Such an aray of different oligonucleotide- and/or PNA-oligomer sequences can be characterized, for example, in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid-phase surface may be composed of silicon, glass, polystyrene, aluminuniõ steel, iron, copper, nickel, silver, or gold.
Nitrocellulose as well as plastics such as nylon, which can exist in the fotm of pellets or also as resin matrices, may also be used. An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999, and from the literature cited therein). Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays. T he s imple attachment o f C y3 a nd C y5 d yes to the 5 '-OH o f the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybridized probes may be carried out, for example, via a confocal microscope. Cy3 and Cy5 dyes, besides m.any others, are commercially available.

It is also anticipated that the oligonucleotides, or particular sequences thereof, may constitute all or part of an "virtual array" wherein the oligonucleotides, or particular sequences thereof, are used, for example, as 'specifiers' as part ot or in combination with a diverse population of unique labeled probes to analyze a complex mixture of analytes.
Such a method, for example is descnbed in US 2003/0013091 (United States serial number 09/898,743, published 16 January 2003). In such methods, enough labels are generated so that each nucleic acid in the complex mixture (i.e., each analyte) can be uniquely bound by a unique label and thus detected (each label is directly counted, resulting in a digital read-out of each molecular species in the mixture).

It is particularly preferred that the oligomers according to the invention are utilised for at least one of detection of; detection and differentiation between or among subclasses of;
diagnosis of; prognosis of; treatment of; monitoring of; and treatment and monitoring of colorectal cell proliferative disorders. This is enabled by use of said sets for the detection or detection and differentiation of one or more of the following classes of tissues: colorectal carcinoma, colon adenoma, inflammatory colon tissue, grade 2 dysplasia colon adenomas less than 1 cm, grade 3 dysplasia colon adenomas larger than 1 cm, normal colon tissue, non-colon healthy tissue and non-colon cancer tissue.

Particularly preferrred are those sets of oligomer that comprise at least two oligonucleotides selected from one of the following sets of oligonucleotides:

SEQ ID NOS:89-285, 14424 - 14453;

SEQ ID NOS:89 -109,113 - 223, 227 - 293,14424 - 14453;

SEQ ID NOS:89-109, 113-161, 164223, 227-285, 287-293, 14424 - 14453;
SEQ ID NOS:89, 90,126-135,147-151, 224-226, 253-256, 261-267, 283-285;
SEQ ID NOS:89-161, 164-293, 14424 - 14453;
SEQ ID NOS:89-109,113-299,14424 - 14453;

SEQ ID NOS:89-109,113-293, 296-299, 14424 - 14453;
SEQ.ID NOS:1-12, 15-20, 22, 25-36, 38-49, 51-58;

SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 777, 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 -836, 836, 837, 837 - 872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 -915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 -944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003, 1010 - 1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 -1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 -1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 -1102, 1102, 1103, 1103 - 1114, 1114, 1115, 1115 - 1119, 1119, 1120, 1120 -1141, 1141, 1142, 1142;
SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 777, 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 -836, 836, 837, 837 - 872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 885, 890 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 - 944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981- 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003, 1010 - 1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 - 1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 -1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095,1095-1102,1102,1103,1103-1114,1114,1115,1115-1119,1119,1120,1120-1124, 1129 -1141,1141, 1142,1142;
SEQ ID NOS:738 - 740, 810 - 814, 814, 815, 815 - 829, 854 - 865, 1004 - 1006, 1006, 1007, 1007 - 1009, 1062, 1062, 1063, 1063 - 1069, 1078, 1078, 1079, 1079 -1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 -1091,1121-1124;
SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 - 836, 836, 837, 837 -872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 - 944, 944 -957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962,962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003 - 1006, 1006, 1007, 1007 - 1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 -1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 -1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094,1095, 1095 - 1102,1102,1103,1103 - 1114,1114,1115, 1115 -1119, 1119, 1120,1120 -1141, 1141, 1142, 1142 - 1145, 1145, 1146, 1146, 1147, 1147, 1148, 1148 -1151, 1151, 1152, 1152 - 1154,1154,1155,1155,1156,1156,1157,1157,1158,1158, 1159,1159;
SEQ Il7 NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 - 836, 836, 837, 837 -872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 885, 890 -892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 -944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 -998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003 - 1006, 1006, 1007, 1007 -1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 -1034, 1034, 1035, 1035 - 1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 - 1102, 1102, 1103, 1103 - 1114, 1114, 1115, 1115 -1119, 1=119, 1120, 1120 - 1141, 1141, 1142, 1142;
SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 777, 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 -836, 836, 837, 837 - 872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 -915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 -944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999,1000,1000,1001,1001,1002,1002,1003,1003 - 1006,1006,1007,1007 -1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 -1034, 1034, 1035, 1035 - 1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 -1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 - 1102, 1102, 1103, 1103 - 1114, 1114, 1115, 1115 -1119, 1119, 1120, 1120 -1141,1141, 1142, 1142 - 1145, 1145,1146, 1146, 1147,1147, 1148, 1148 -1151, 1151, 1152, 1152;

and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 - 725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 777, 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 - 836, 836, 837, 837 - 872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 -892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 -944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 -998, 998, 999, 999, 1000, 1000, 1001, 1001,1002, 1002, 1003, 1003 -1006,1006,1007,1007 -1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 -1034, 1034, 1035, 1035 - 1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 - 1102, 1102, 1103, 1103 -1114, 1114, 1115, 1115 -1119, 1119, 1120, 1120 - 1141, 1141, 1142, 1142, 1145, 1145, 1146, 1146, 1147, 1147, 1148, 1148 -1151, 1151, 1152,1152.

In one embodiment of the method, at least one of colorectal carcinoma tissue or colon adenomas is distinguished from at least one tissue selected from the group consisting of inflaanmatory colon tissue and normal colon tissue. This is achieved by analysis of the methylation statns of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ II} NOS:1-12, 15-20, 22, 25-36. 38-49, 51-58 and complements thereof. This is preferrably achieved by use of a set consisting of at least one oligonucleotide, and more preferably at least two selected from one of the groups consisting of, or by use of a set comprising of at least two oligonucleotides selected from one of the groups consisting of:

SEQ ID NOS:89-285 & 14424 - 14453; and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763,763 - 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 - 836, 836, 837, 837 -872, 872, 873,973 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 - 944, 944 -957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003 - 1006, 1006, 1007, 1007 - 1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 -1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 -1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094,1095, 1095 - 1102, 1102, 1103, 1103 - 1114,1114,1115, 1115 - 1119, 1119, 1120, 1120 -1124.

In one embodiment of the rnethod, colorectal carcinoma is distinguished from at least one tissue selected from the group consisting of non-colon healthy tissue, periphet~ai blood lymphocytes and non-colon cancer. In one embodiment this is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ II) NOS:1-23, 26-36, 38-43, 45-49, 51-58. This is preferrably achieved by use of a set consisting of at least one oligonacleotide, and more preferably at least two oligonucleotides selected from one of the groups eonsisting of SEQ ID NOS:89 - 109,113 - 223, 227 - 293, 14424-14453 ; and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 777, 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 -836, 836, 837, 837 - 872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 -915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 -944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 999 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003, 1010 - 1016, 1016, 1017,1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 -1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 -1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 -1102, 1102, 1103, 1103 - 1114, 1114, 1115, 1115 - 1119, 1119, 1120, 1120 -1141, 1141, 1142, 1142.

In one embodiment of the method, colorectal carcinoma is distinguished from at least one tissue selected from the group consisting of inflammatory colon tissue, normal colon tissue, non-colon healthy tissue, peripheral blood lymphocytes, colon adenomas and non-colon cancer tissue. This is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ ID NO: 1-3, 5-13, 15-23, 26-36, 38-43, 45-49, 51-58 and complements thereof. This is preferably achieved by use of a set consisting of at least one oligonucleotide, and more preferably at least two by use of a set of oligomers comprising at least two oligonucleotides selected from one of the groups consisting of:

SEQ ID NOS:89 -109,113 - 161, 164 - 223,227 - 285,287 - 293, 14424-14453; and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 777, 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 -836, 836, 837, 837 - 872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 885, 890 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 - 944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003, 1010 - 1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 - 1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 -1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 -1102, 1102, 1103, 1103 -1114,1114,1115, 1115 - 1119, 1119, 1120, 1120 - 1124, 1129 - 1141, 1141, 1142, 1142.

In one embodiment of the method, the colorectal carcinoma is distinguished from colon adenomas. This is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ lI? NO: 11, 25, 27, 38, 40, 45, 53 and ' complements thereot This is prefernrably achieved by use of a set consisting of at least one oligonucleotide, and more preferably at least two oligonucleotides selected from one of the groups consisting of:

SEQ ID NOS:89, 90, 126 - 135, 147 - 151, 224 - 226, 253 - 256, 261 - 267, 283 -285;
and SEQ ID NOS:738 - 740, 810 - 814, 814, 815, 815 - 829, 854 - 865, 1004 - 1006, 1006, 1007, 1007 - 1009, 1062, 1062, 1063, 1063 - 1069, 1078, 1078, 1079, 1079 -1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1091, 1121 - 1124.

In one embodiment of the method, at least one of colorectal carcinoma tissue, or colon adenomas is distinguished from at least one tissue selected from the group consisting of inflammatory colon tissue and normal colon tissue. This is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ ID NO: 1-64 and complements thereof. This is preferably achieved by use of a set consisting of at least one oligonucleotide, and more preferably at least two oligomers comprising at least two oligonucleotides selected from one of the groups consisting of:

SEQ ID NOS: 89 - 303,14424-14453; and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 784, 784, 785, 785, 786, 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 - 836, 836, 837, 837 -872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 - 944, 944 -957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 - 998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003 - 1006, 1006, 1007, 1007 - 1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 - 1034, 1034, 1035, 1035 -1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 1073, 1074, 1074, 1075, 1075 -1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 -1102, 1102, 1103, 1103 -1114,1114, 1115, 1115 - 1119, 1119, 1120, 1120 -1141, 1141, 1142, 1142 - 1145, 1145, 1146, 1146, 1147, 1147, 1148, 1148 -1151, 115.1, 1152, 1152 -1154, 1154, 1155, 1155, 1156, 1156,1157, 1157, 1158, 1158, 1159, 1159.
In one embodiment of the method, colorectal carcinoma tissue is distingu.ished from at least one of inflammatory colon tissue and normal colon tissue. This is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ 11) NOS: 1-3, 5-23, 25-36, 38-49, 51-58 and complements thereo~ This is preferably achieved by use of a set consisting of at least one oligonucleotide, and more preferably at least two oligomers comprising at least two oligonucleotides selected from one of the groups consisting of SEQ ID NOS: 89 -161,164 - 293, 14424-14453; and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 691, 692, 692 - 695, 695, 696, 696 - 699, 699, 700, 700 - 709, 709, 710, 710 -725, 725, 726, 726, 727, 727, 728, 728 - 760, 760, 761, 761, 762, 762, 763, 763 - 784, 784, 785, 785, 786; 786, 787, 787 - 802, 802, 803, 803 - 814, 814, 815, 815 - 832, 832, 833, 833 - 836, 836, 837, 837 -872, 872, 873, 873 - 876, 876, 877, 877, 878, 878, 879, 879 - 882, 882, 883, 883 - 885, 890 -892, 892, 893, 893 - 896, 896, 897, 897 - 909, 909, 910, 910, 911, 911, 912, 912 - 915, 915, 916, 916 - 921, 921 - 925, 925, 926, 926 - 939, 939, 940, 940, 941, 941, 942, 942 -944, 944 - 957, 957, 958, 958, 959, 959, 960, 960, 961, 961, 962, 962 - 971, 971, 972, 972, 973, 973, 974, 974, 975, 975, 976, 976 - 979, 979, 980, 980, 981, 981 - 988, 988, 989, 989 - 994, 994, 995, 995 -998, 998, 999, 999, 1000, 1000, 1001, 1001, 1002, 1002, 1003, 1003 - 1006, 1006, 1007, 1007 -1016, 1016, 1017, 1017, 1018, 1018, 1019, 1019 - 1028, 1028, 1029, 1029 -1034, 1034, 1035, 1035 - 1046, 1046, 1047, 1047 - 1058, 1058, 1059, 1059, 1060, 1060, 1061, 1061, 1062, 1062, 1063, 1063 - 1070, 1070, 1071, 1071, 1072, 1072, 1073, 10773, 1074, 1074, 1075, 1075 - 1078, 1078, 1079, 1079 - 1084, 1084, 1085, 1085, 1086, 1086, 1087, 1087 - 1092, 1092, 1093, 1093, 1094, 1094, 1095, 1095 - 1102, 1102, 1103, 1103 - 1114, 1114, 1115, 1115 -1119, 1119, 1120, 1120 - 1141, 1141, 1142, 1142.
In one embodiment of the method, at least one of oolorectal carcinoma tissue, or colon adenomas is distinguished from at least one tissue selected from the group consisting of inflammatory colon tissue, norrnai colon tissue, non-colon healthy tissue, peripheral blood lymphocytes, and non-colon cancer tissue. This is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridizing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ
ID NO: 1-36, 38-43, 45-58 and complements thereof. This is preferably achieved by use of a set consisting of at least one oligonucleotide, and more preferably at least two oligomers comprising at least two oligonucleotides selected from one of the groups consisting of:
SEQ IDNOS: 89 -109,113 - 299, 14424-14453; and SEQ ID NOS:681 - 683, 683, 684, 684, 685, 685, 686, 686, 687, 687, 688, 688 -691, 8t, '866 '866 - 566 '966 '1'66 'tr66 - 686 '686 '886 '886 - 186 '186 '086 '086 '61.6 '646 - 9L6 '91.6 '5L6 'SL6 'fiL6 'bL6 '~L6 '~L6 'ZL6 'ZL6 'IL6 'IL6 - Z96 'Z96 '196 '196 '096 '096 '656 '696 '856 '8S6 'LS6 'L56 - bb6 'tlt,6 - Zti6 'Zt,6 'I#,6 'Ib6 '0b6 '0tb6 '6~6 '6~6 - 9Z6 '9Z6 'SZ6 'SZ6 - IZ6 '12:6-916'916'516'S16-2:1642:16'116'116'016'016'606'606-1.68'1.68'968'968-~68 '~68 'Z68 'Z68 - ~88 '~88 'Z88 'Z88 - 6L8 '6L8 '8L8 '8L8 'LL8 'LL8 '9L8 '9L8 -~L8 'EL8 'ZL8 'ZL8 SZ
- LE8 'L~8 9~8 '9~8 - ~~8 '~~8 'Z~8 Z~8 - 9i8 'SI8 'V18 'b18 - ~08 '~08 'Z08 'Z08 - L8L 'L8L
'98L '98L 'S8L 'S8L 'tr8L 't,8L - ~9L '~9L 'Z9L 'Z9L 'I9L '19L '09L '09L - 8ZL
'8ZL 'LZL 'LZL '9ZL
'9ZL 'SZL 'SZL - OIL '0IL '60L '60L - 00L 'OOL '669 '669 - 969 '969 'S69 '569 -Z69 'Z69 '169 '169 - 889 '889 'L89 '1.89 '989 '989 '589 '589 '1789 '189 '189 '189 - 189:S0M
CQ bHS
puv '=~Sbbi-VZ'bbi '~0~ - 68 :SON QI aHS 0Z
:,Io 8uqstsuoo sdnox8 aipjo auo uco.g pa}oaias sap4oapnuoStjo ong 4swi It, Bulsuduzoo smtuo80o jo ps v jo osn Sq ulSuo uoloa-uou jo sanssp tuog paqsitiSu4sip axe UDIoo aqi tuoLV $a49UISuo sanssq 'paq}oui aqi jo lmunpoqttn Qao uI

'ZSII 'Z5Ii 'ISII 'ISII -8bII '8tIi 'Lbii 'Lbli '9bli '9bI1 'SVII 'Stti -ZtII 'Z'bti ItiII
'I'bIi -OZII 51 '0ZI I'6I I 1'61 I I- 911 I'SI i I'tiI 11 1,1I I-~01 I'~0I I'Z0I I'Z0I I- 5601 '5601 '*601 $601 '~601 '~60I 'Z60I 'Z601 - L80I 'L80I '9801 '9801 'S801 '980I 'b80i 1,801 -6L0I 66L0i '8L0I
'8L0I - SL01 'SLOi 'VLOI 'tiLOi '~L0i '~L0I 'ZLOI 'ZLOi 'ILOi 'iLOi '0L0I
'OLOI - ~90i '~90i 'Z901 'Z901 '1901 '1901 '0901 '0901 '650I '60i '8501 '8S0I - LVQ i '13,0I
'9vOI '91-0I - S~0I
'S~OI 't~0I 'V~01 - 6Z0I '6Z0I '8Z0I '8Z01 - 6101 '6101 '8101 '8I01 'LIOI
'LIOI '9101 49I01 01 - 1.00 I '1.00 I '900 I '900 I - 100 I '100 I '2:00 I '2:00 I '1001 '100 I
'0001 '000 I '66 6 '66 6 1866 '866 - 966 '566 1,66 '1766 - 686 '686 '886 '886 - 186 '186 '086 '086 461.6 '6L6 - 9L6 '91.6 '5L6 'SL6 'K6 'irL6 '~L6 '~L6 'ZL6 'ZL6 'IL6 'IL6 - Z96 'Z96 '196 '196 '096 '096 '6S6 '656 '8S6 4896 'LS6 'L56 - iV6 *6 - ZV6 'Zt,6 'Ib6 106 '0b6 '0i-6 '6~6 '6~6 - 9Z6 '9Z6 '06 'SZ6 - IZ6 'IZ6 -916 '916 '516 '516 - Z16 '2:16 '116 '116 '016 '016 '606 '606 - L68 11.68 '968 '968 - ~68 '168 '2:68 S
'Z68 - ~88 '~88 'Z88 'Z88 - 6L8 '6L8 '8L8 '8L8 'LL8 'LL8 '9L8 '9L8 - ~L8 'EL8 'Z48 'ZL8 - L~8 'LE8 '9~8 '9~8 - ~~8 '~~8 'Z~8 'Z~8 - 9I8 '518 'b18 't'I8 - ~08 '~08 'Z08 'Z08 - L8L 'L8L '98L
'98L 'S8L '58L 'VBL 'b8L 'LLL - ~9L '~9L 'Z9L 'Z9L '19L '19L '09L '09L - 8ZL
68ZL 'l:cL 'LZL '9ZL
'9ZL 'SZL 'SZL - OIL 'OIL '60L '60L - 00L '00L '669 '669 - 969 '969 '569 'S69 -Z69 'Z69 '169 ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

6t, 'ZSII 'ZSII
'I511 'iSIT - Birli'8tii 'Lbii'Lbit 19viT 19vIi 'SbiT 'Stili'Zbii 'Zbii 'Tt'II'Iblt -OZII
'OZt I'61I I'6I i I- SI i i'Si i i'irl I I'bi I I-~0I I'~01 i'ZOT I'Z01 I-S60I '5601 $601 '*601 '~601 '~60I. 'Z60I 'Z601 - L80I 'L80I '9801 '9801 'S80I '980I 'b80I 'V801 -6L0I '6L0i '8L0T
'8LOT - SLOI 'SLOI 'bLOI 'bLOI '~LOI '~L0I 'ZLOI 'ZLOT '11.01 'TL01 '0L0I
'OLOI - ~901 '~901 SZ
'Z901 'Z901 '1901 '190I '090I '0901 '6501 '690I '8501 '8SOI - LbOi 'LVOI 'MI
'9v0I - S~0T
'S~OT '6~OI 'fi~0I - 6Z0T '6Z0I 'SZOI 'BZOI - 6I01 '6I01 '810I '8101 'LIOI
'LiOT '9101 '9I01 - 1.00 I '1.001 '900 I '900 i - ~00 I '~00 i 'ZOO I 'ZOO 1 '100 I '100 i '000 T '0001 '666 '666 '866 '866 ' 566 '566 'V66 $66 - 686 '686 '886 '886 - 186 '186 '086 '086 '6L6 '61.6 -9L6 '9L6 'SL6 '5L6 'irL6 'bL6 '~L6 '~L6 'Z1.6 'ZL6 'TL6 'TL6 - Z96 'Z96 'I96 'I96 '096 '096 '656 '6S6'8S6 '8S6 OZ
'L56'LS6 - V*6 *6 - Zb6 'Zti6 'Ib6 'IV6 '0b6 'Oti6 '6~6 '6~6 - 9Z6 '9Z6 'SZ6 'SZ6 - IZ6 'IZ6 -916 '916'916 'SI6 - Z16 'Zt6 '1. 16'116'016'016'606 '606 - 1.68 '1.68 '968 '968 - ~68 '~68 'Z68 'Z68 - ~88 '~88 'Z88 'Z88 - 6L8 '6L8 '8L8 '8L8 'LL8 'LL8 '9L8 '9L8 - ~L8 '~L8 'ZL8 'ZL8 - L~8 'L~8 '9~8 '9~8 - ~~8 '~~8 'Z~8 'Z~8 - SI8 '08 'trl8 'tiI8 - ~08 '~08 'ZOS 'Z08 - L8L 'L8L '98L
'98L 'S8L 'S8L 'b8L 't8L 'LLL - ~9L '~9L 'Z9L 'Z9L 'I9L 'I9L '09L '09L - 8ZL
'8ZL 'LZL 'LZL '9ZL SI
'9ZL 'SZL 'SZL - OIL 'OIL '60L '60L - 00L '00L '669 '669 - 969 '969 'S69 'S69 -Z69 'Z69 '169 '169 - 889 '889 '1.89 '1.89 '989 '989 '589 'S89 '489 'b89 '~89 'E89 - 189:90K
CII baS
PU'O'=~Stti-VZVVl '66Z - 96Z '~6Z - ~i i '60I - 68:SOX C1I a3S
.j0 8uzasisuoo sdno,z8 aqt3o auo uio4 MmIes soPqwlonuo8tto oenl Iseal p Satsudtuoo sramo8t[o 3o }as Bjo asn iCq sanasn 4ttiTwq 0I
oz04 poqsm8utastp aie Wpsostp anrl=jqozd nao 'poqatu aqI 3o Iuaanpoqm auo uI

'65iI'6STI'8511 '89II'LSII'LSII'9SII'9911 '99Ii'SSiI'VSi1'b5ii-ZSIi 'ZSiT 'ISTI 'I511 - 8titl 'BirTi 'LvII 'LvII '9bII '9bil 'SvII 'SbII - Zbil 'aII 'ivIi 'Itili - OZII '0ZI I '6T1i '6III - Siii 'STTi 'bIII 'tIII -~0II '~0Ti 'ZOII 'ZOIT -S60I 'S60i 'V60i 'ti60i '~60I '~601 160I 'Z601 - L801 'L80I '9801 '9801 '580I 'S80I $901 'V80I -6L0I '6L0I S
'8L0I 'BLOI - SLOI 'SLOI 'tLOI 'bLOI '~L0T '~L0T 'ZLOT 'ZLOI 'ILOT '1L0T '0L01 b/..OT - ~901 '~90I 'Z90I 'Z901 '1901 '1901 '0901 '0901 '6S0T 1690I '8501 '8901 - LtOi 'Lti'0I '9trOX '9b0I
- S~0I 'S~OI 'b~01 '4~OI - 6Z0I '6Z0I '8ZOI '8Z0I - 6101 '6101 '8101 '8I01 'LTOI 'LT01 '9101 '9101 - L00I 'LOOI '9001 '9001 - ~00I '~00 i 'ZOOI 'Z00 i 4100I '1001 '0001 '0001 '666 '666 ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

In a fiaUier embodiment of the method aerodigestive cell pmliferative disorders of the group consisting lung, liver, pancreas, bile duct, stomach, and colon cancers are detected . Tlais is achieved by analysis of the methylation status of at least This is achieved by analysis of the methylation status of at least one target sequence comprising, or hybridazing under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting SEQ ID NO: 20, 41, 35, 3, 39, 33 and complements thereof.The present invention further provides a method for ascertaining genetic and/or epigenetic parameters of the genomic sequences according to SEQ ID NOS:1 to SEQ ID NO:64 within a subject by analyzing cytosine methylation and single nucleotide polymorphisms. Said rnethod comprising contacting a nucleic acid eomprising one or more of SEQ ID NOS:1 to SEQ ID NO:64 in a biological sample obtamed from said subject with at least one reagent or a series of reagents, wherein said reagent or series of reagents, distinguishes between methylated and non-nnethylated CpG dinucleotides within the target nucleic acid.
Preferably, said method comprises the follownng steps: In the first step, a sample of the tissue to be analysed is obtained. The source may be any suitable source, sueh as cell lines, ba,stological slides, biopsies, paraffin-embedded tissue, bodily fluids, stool, coloxuc effluent, urine, b lood p lasma, b lood s eram, w hole b lood, i solated b lood c ells, c ells i solated from t he blood and all possible combinations thereof. It is preferred that said sources. ofDNA are stool or bodily fluids selected from the group consisting colonic effluent , urine, blood plasma, blood serum, whole blood, isolated blood cells, cells isolated from the blood.
The genomic DNA is then isolated from the sample. Genomic DNA may be isolated by any means standard in the art, including the use of commercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample must be disrapted and lysed by enzymaiic, chemical or mechanical means. The DNA
solution may then be cleared of proteins and other contaminants e.g. by digestion with proteinase K. The genomic DNA is then reoovered from the solution. This may be carri.ed out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase setpport. The choice of method will be affected by several factors inncluding time, expense and required quantity of DNA.

Once the nucleic acids have been extracted, the genomic double stranded DNA is used in the analysis.

In the secoitd step of the method, the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5'-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as 'pretreatment' or 'treatment' herein.

The above-desennbed treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent allraline hydrolysis which results in a conversion of non~nethylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
In the third step of the method, fragments of the treated DNA are ampli$ed, using sets of primer oligonucleotides according to the present invention, and an amplification enzyme. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Typically, the amplification is carried out using a polymerase chain reaction (PCR). The set of primer oligonucleotides includes at least two oligornucleotides whose sequences are each reverse complementary, identical, or hybridize under stringent or highly, stringent conditions to an at least 16-base-pair long segment of the base sequences of one.of.
SEQ ID NOS:304 to SEQ ID NO:535 and sequences complementary thereto.
In an altemate e mbodiment o f t he method, the methylation s tatus o fpreselected CpG
positions within the nucleic acid sequences comprising one or more of SEQ ID
NOS:1 to SEQ
ID NO:64 may be detected by use of methylation-specific primer oligomicleotides. This technique (MSP) has been described in United States Patent No. 6,265,171 to Herman. The use of inethylation status specific primers for the amplification of bisulfite treated DNA allows the differentiation between mettrylated and unmethylated nucleic acids. MSP
primers pairs contain at least one primer which hybridizes to a bisulfite treated CpG dinucleotide.
Therefore, the sequence of said primers comprises at least one CpG dinucleotide. MSP primers specific for non-methylated DNA contain a"T' at the position of the C position in the CpG.
Preferably, therefore, the base sequence of said primers is required to comprise a saquence having a length of at least 9 nucleotides which hybridizes to a treated nucleic acid sequence according to one of SEQ ID NOS:304 to SEQ ID NO:535 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG dinucleotide.
In a further prefezred embodiment of the method, the MSP primers are selected from the group consisting SEQ ID NOS:2754, 2757, 2759, 2767, 2768, 2772, 2776, 2779, 2784, 2785, 2786, 2789, 2791, 2792, 2794, 2797, 2798, 2801, 2805, 2806, 2809, 2811, 2815, 2817, 2824, 2830, 2832, 2833, 2834, 2838, 2840, 2843, 2846, 2850, 2851, 2853, 2855, 2859, 2866, 2867, 2870, 2871, 2876, 2878, 2881, 2885, 2886, 2892, 2893, 2895, 2896, 2898, 2904, 2912, 2915, 2917, 2919, 2922, 2923, 2929, 2931, 2939, 2941, 2944, 2946, 2948, 2950, 2955, 2956, 2957, 2960, 2962, 2965, 2966, 2967, 2968, 2969, 2971, 2975, 2976, 2977, 2978, 2979, 2980, 2981, 2984, 2988, 2989, 2990, 2992, 2994, 2997, 2999, 3001, 3002, 3004, 3006, 3007, 3008, 3010, 3013, 3014, 3016, 3017, 3018, 3020, 3022, 3025, 2752, 2755, 2760, 2762, 2763, 2764, 2765, 2769, 2771, 2773, 2775, 2777, 2780, 2781, 2782, 2783, 2787, 2788, 2790, 2793, 2795, 2796, 2800, 2802, 2803, 2804, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2821, 2823, 2825, 2827, 2828, 2829, 2831, 2835, 2836, 2837, 2839, 2841, 2842, 2844, 2845, 2847, 2849, 2852, 2854, 2856, 2858, 2860, 2861, 2862, 2863, 2864, 2865, 2868, 2869, 2872, 2873, 2874, 2875, 2877, 2879, 2880, 2882, 2883, 2884, 2887, 2888, 2889, 2890, 2891, 2894, 2897, 2899, 2901, 2902, 2903, 2905, 2907, 2909, 2911, 2914, 2916, 2918, 2920, 2924, 2926, 2927, 2928, 2930, 2932, 2933, 2934, 2935, 2936, 2937, 2938, 2942, 2945, 2947, 2949, 2951, 2953, 2954, 2958, 2959, 2961, 2963, 2970, 2972, 2973, 2974, 2982, 2985, 2987, 2991, 2993, 2995, 2996, 2998, 3000, 3003, 3005, 3011, 3019, 3021, 3023, 3026, 3027, 3028, 3032, 3033, 3036, 3037, 3038, 3039, 3041, 3042, 3043, 3044, 3047, 3048, 3049, 3052, 3055, 3059, 3061, 3064, 3065, 3068, 3069, 3071, 3072, 3075, 3076, 3080, 3083, 3084, 3085, 3086, 3091, 3093, 3096, 3097, 3100, 3104, 3109, 3110, 3113, 3115, 3117, 3118, 3123, 3126, 3127, 3130, 3134, 3135, 3136, 3138, 3139, 3144, 3146, 3147, 3149, 3150, 3155, 3029, 3031, 3034, 3040, 3045, 3050, 3051, 3053, 3054, 3056, 3057, 3060, 3063, 3066, 3073, 3078, 3081, 3088, 3089, 3090, 3092, 3094, 3098, 3101, 3103, 3105, 3107, 3108, 3111, 3114, 3116, 3119, 3121, 3122, 3124, 3128, 3131, 3133, 3137, 3140, 3142, 3145, 3148, 3151, 3152, 3153, 3157, 3159, 3165, 3166, 3167, 3170, 3171, 3172, 3174, 3175, 3176, 3179, 3180, 3181, 3184, 3185, 3186, 3192, 3194, 3198, 3201, 3202, 3203, 3204, 3206, 3209, 3212, 3213, 3215, 3216, 3217, 3218, 3221, 3224, 3226, 3228, 3229, 3230, 3232, 3233, 3234, 3235, 3237, 3238, 3239, 3245, 3247, 3248, 3249, 3160, 3162, 3163, 3164, 3168, 3169, 3173, 3178, 3182, 3183, 3187, 3189, 3190, 3195, 3196, 3197, 3199, 3205, 3207, 3210, 3214, 3219, 3222, 3223, 3225, 3227, 3236, 3240, 3242, 3243, 3244, 3246, 3250, 3252, 3256, 3261, 3264, 3268, 3269, 3270, 3273, 3275, 3279, 3280, 3281, 3282, 3283, 3284, 3285, 3286, 3290, 3292; 3295, 3297, 3301, 3304, 3305, 3306, 3307, 3308, 3310, 3311, 3312, 3315, 3319, 3320, 3324, 3327, 3331, 3333, 3334, 3339, 3348, 3351, 3354, 3358, 3360, 3364, 3367, 3368, 3374, 3376, 3253, 3255, 3257, 3259, 3260, 3262, 3265, 3266, 3267, 3271, 3274, 3276, 3278, 3287, 3289, 3291, 3293, 3298, 3300, 3302, 3309, 3313, 3314, 3316, 3318, 3321, 3322, 3325, 3328, 3330, 3332, 3335, 3337, 3338, 3340, 3342, 3343, 3344, 3345, 3346, 3347; 3349, 3350, 3352, 3353, 3355, 3356, 3357, 3359, 3361, 3363, 3365, 3369, 3371, 3372, 3373, 3377, 3380, 3383, 3386, 3388, 3389, 3390, 3391, 3392, 3395, 3396, 3400, 3401, 3403, 3406, 3408, 3413, 3414, 3417, 3420, 3423, 3428, 3432, 3433, 3434, 3436, 3439, 3440, 3442, 3443, 3445, 3447, 3453, 3455, 3458, 3463, 3466, 3469, 3470, 3471, 3472, 3473, 3474, 3475, 3477, 3478, 3480, 3481, 3483, 3484, 3487, 3490, 3494, 3495, 3496, 3497, 3499, 3500, 3504, 3505, 3508, 3512, 3514, 3515, 3516, 3521, 3525, 3529, 3533, 3534, 3537, 3538, 3540, 3541, 3542, 3543, 3544, 3547, 3548, 3553, 3557, 3558, 3559, 3560, 3562, 3563, 3566, 3571, 3574, 3575, 3577, .
3580, 3583, 3584, 3585, 3586, 3592, 3594, 3595, 3597, 3598, 3599, 3601, 3603, 3604, 3607, .
3608, 3612, 3619, 3621, 3622, 3626, 3631, 3632, 3637, 3638, 3639, 3640, 3642, 3643, 3644, 3646, 3647, 3649, 3650, 3652, 3656, 3657, 3660, 3663, 3668, 3670, 3673, 3676, 3677, 3678, 3683, 3688, 3690, 3694, 3697, 3700, 3702, 3703, 3704, 3708, 3404, 3409, 3411, 3415, 3418, 3419, 3421, 3424, 3426, 3427, 3429, 3431, 3435, 3437, 3438, 3441, 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3459, 3461, 3462, 3464, 3467, 3476, 3479, 3482, 3485, 3488, 3489, 3491, 3492, 3493, 3501, 3503, 3506, 3509, 3510, 3511, 3513, 3517, 3518, 3519, 3520, 3522, 3524, 3526, 3527, 3528, 3530, 3531, 3535, 3536, 3545, 3549, 3551, 3552, 3554, 3555, 3556, 3561, 3564, 3565, 3568, 3569, 3570, 3573, 3576, 3578, 3581, 3587, 3588, 3589, 3590, 3591, 3593, 3596, 3600, 3602, 3605, 3606, 3609, 3611, 3613, 3614, 3615, 3616, 3617, 3618, 3623, 3624, 3625, 3627, 3629, 3630, 3633, 3634, 3635, 3636, 3641, 3645, 3651, 3653, 3654, 3655, 3658, 3661, 3662, 3665, 3666, 3667, 3669, 3671, 3674, 3679, 3681, 3684, 3686, 3689, 3691, 3692, 3693, 3695, 3696, 3698, 3701, 3705, 3706, 3707, 3709, 3710, 3714, 3715, 3717, 3718, 3722, 3723, 3729, 3730, 3732, 3735, 3739, 3740, 3741, 3743, 3744, 3745, 3746, 3749, 3753, 3754, 3755, 3756, 3711, 3713, 3719, 3721, 3724, 3725, 3726, 3727, 3728, 3731, 3733, 3736, 3737, 3738, 3742, 3747, 3748, 3750, 3752, 3757, 3758, 3759, 3760, 3761, 3764, 3767, 3771, 3773, 3775, 3776, 3777, 3781, 3785, 3786, 3787, 3790, 3791, 3793, 3796, 3797, 3798, 3799, 3805, 3809, 3814, 3817, 3818, 3822, 3823, 3828, 3833, 3836, 3844, 3847, 3850, 3851, 3853, 3856, 3857, 3862, 3873, 3876, 3877, 3880, 3885, 3887, 3889, 3890, 3892, 3893, 3895, 3896, 3899, 3902, 3903, 3905, 3906, 3907, 3908, 3916, 3923, 3926, 3927, 3930, 3935, 3936, 3938, 3939, 3940, 3944, 3945, 3949, 3950, 3951, 3954, 3955, 3957, 3960, 3965, 3970, 3971, 3978, 3979, 3982, 3983, 3984, 3985, 3762, 3765, 3768, 3770, 3772, 3774, 3778, 3779, 3780, 3782, 3784, 3788, 3792, 3794, 3800, 3801, 3802, 3803, 3804, 3806, 3807, 3808, 3810, 3812, 3813, 3815, 3819, 3820, 3821, 3824, 3826, 3827, 3829, 3831, 3832, 3834, 3837, 3838, 3839, 3840, 3842, 3845, 3848, 3852, 3854, 3858, 3860, 3861, 3863, 3864, 3865, 3866, 3867, 3868, 3869, 3870, 3871, 3872, 3874, 3875, 3878, 3881, 3883, 3884, 3886, 3888, 3891, 3894, 3897, 3898, 3900, 3901, 3904, 3909, 3411, 3914, 3915, 3917, 3919, 3920, 3921, 3922, 3924, 3928, 3931, 3933, 3934, 3937, 3941, 3942, 3943, 3947, 3948, 3952, 3958, 3959, 3961, 3962, 3963, 3964, 3966, 3968, 3972, 3974, 3975, 3976, 3980, 3981, 3986, 3987, 3990, 3993, 3994, 3997, 4000, 4003, 4004, 4006, 4012, 4015, 4017, 4020, 4024, 4027, 4029, 4031, 4032, 4033, 4037, 4038, 4040, 4042, 4047, 4048, 4050, 4051, 4052, 4054, 4055, 4058, 4063, 4066, 4069, 4070, 4072, 4073, 4076, 4078, 4079, 4082, 4083, 4084, 4085, 4086, 4090, 4093, 4094, 4095, 4096, 4099, 4100, 4104, 4106, 4113, 4116, 4119, 4120, 4124, 4127, 4130, 4134, 4135, 4136, 4138, 4142, 4145, 4146, 4149, 4150, 4152, 4153, 4159, 4160, 4161, 4163, 4168, 4169, 4171, 4173, 4176, 4180, 4181, 4185, 4189, 4191, 4192, 4194, 4197, 4198, 4199, 4201, 4206, 4207, 4208, 4213, 4219, 4220, 4223, 4224, 4225, 4228, 4231, 4232, 4233, 4237, 4238, 4242, 4243, 4246, 4247, 4251, 4254, 4255, 4256, 4258, 3988, 3991, 3995, 3998, 4001, 4005, 4007, 4009, 4010, 4011, 4013, 4016, 4018, 4019, 4021, 4022, 4023, 4025, 4028, 4034, 4035, 4039, 4043, 4045, 4046, 4049, 4056, 4059, 4061, 4064, 4065, 4067, 4068, 4071, 4074, 4075, 4077, 4080, 4087, 4088, 4089, 4092, 4098, 4101, 4102, 4105, 4108, 4109, 4110, 4111, 4112, 4114, 4115, 4117, 4121, 4122, 4123, 4125, 4128, 4129, 4131, 4132, 4133, 4137, 4139, 4141, 4144, 4148, 4151, 4154, 4156, 4157, 4162, 4165, 4166, 4167, 4170, 4172, 4174, 4177, 4179, 4182, 4184, 4186, 4188, 4190, 4195, 4196, 4202, 4204, 4205, 4209, 4211, 4214, 4216, 4217, 4218, 4221, 4226, 4229, 4234, 4236, 4239, 4241, 4244, 4245, 4248, 4249, 4252, 4257, 4259, 4260, 4261, 4262, 4266, 4267, 4268, 4271, 4272, 4275, 4276, 4279, 4281, 4282, 4284, 4285, 4287, 4289, 4290, 4292, 4295, 4297, 4299, 4301, 4306, 4310, 4316, 4317, 4318, 4321, 4323, 4325, 4328, 4334, 4335, 4337, 4341, 4342, 4343, 4344, 4348, 4350, 4351, 4352, 4354, 4357, 4358, 4359, 4364, 4365, 4366, 4370, 4371, 4372, 4373, 4376, 4378, 4381, 4383, 4384, 4386, 4388, 4396, 4397, 4399, 4400, 4403, 4405, 4407, 4409, 4412, 4415, 4416, 4417, 4424, 4426, 4429, 4433, 4435, 4437, 4442, 4443, 4447, 4450, 4451, 4452, 4455, 4457, 4460, 4461, 4462, 4465, 4466, 4469, 4470, 4474, 4478, 4481, 4484, 4488, 4491, 4494, 4495, 4497, 4498, 4504, 4506, 4509, 4510, 4511, 4514, 4516, 4518, 4520, 4521, 4523, 4525, 4528, 4530, 4533, 4534, 4535, 4538, 4540, 4542, 4545, 4547, 4548, 4553, 4554, 4555, 4556, 4557, 4562, 4564, 4567, 4568, 4569, 4579, 4580, 4582, 4584, 4587, 4589, 4593, 4596, 4597, 4598, 4600, 4601, 4602, 4605, 4606, 4607, 4609, 4610, 4613, 4614, 4616, 4618, 4621, 4624, 4626, 4627, 4628, 4631, 4632, 4636, 4639, 4641, 4644, 4645, 4648, 4263, 4265, 4269, 4270, 4273, 4274, 4277, 4280, 4283, 4286, 4288, 4291, 4293, 4296, 4298, 4300, 4302, 4303, 4304, 4305, 4307, 4308, 4309, 4311, 4313, 4315, 4319, 4322, 4324, 4326, 4327, 4330, 4331, 4332, 4333, 4336, 4338, 4340, 4345, 4347, 4349, 4353, 4355, 4360, 4361, 4362, 4367, 4368, 4369, 4374, 4375, 4377, 4379, 4382, 4385, 4387, 4389, 4390, 4391, 4392, 4393, 4394, 4395, 4398, 4401, 4406, 4408, 4410, 4411, 4413, 4418, 4420, 4422, 4423, 4425, 4427, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4441, 4444, 4446, 4448, 4453, 4454, 4456, 4458, 4463, 4464, 4467, 4471, 4472, 4473, 4475, 4476, 4477, 4479, 4480, 4482, 4485, 4486, 4487, 4489, 4490, 4492, 4496, 4499, 4501, 4502, 4503, 4505, 4507, 4508, 4512, 4515, 4517, 4519, 4522, 4524, 4529, 4531, 4536, 4537, 4539, 4541, 4543, 4546, 4549, 4551, 4558, 4559, 4560, 4561, 4563, 4565, 4570, 4571, 4572, 4573, 4574, 4575, 4576, 4578, 4581, 4583, 4585, 4586, 4588, 4590, 4592, 4595, 4599, 4603, 4611, 4612, 4615, 4617, 4619, 4620, 4622, 4630, 4633, 4634, 4635, 4638, 4640, 4642, 4643, 4646, 4647, 4649, 4652, 4655, 4659, 4661, 4663, 4664, 4665, 4668, 4671, 4674, 4675, 4676, 4678, 4680, 4683, 4686, 4690, 4696, 4700, 4703, 4704, 4706, 4709, 4711, 4714, 4715, 4717, 4718, 4719, 4720, 4721, 4726, 4727, 4730, 4732, 4738, 4742, 4745, 4749, 4750, 4753, 4755, 4759, 4763, 4768, 4769, 4772, 4773, 4776, 4778, 4779, 4782, 4784, 4789, 4790, 4794, 4797, 4801, 4805, 4807, 4813, 4814, 4819, 4821, 4822, 4827, 4829, 4833, 4834, 4835, 4837, 4838, 4841, 4842, 4843, 4844, 4847, 4849, 4850, 4852, 4853, 4859, 4860, 4861, 4865, 4867, 4868, 4869, 4870, 4873, 4876, 4877, 4878, 4879, 4883, 4885, 4889, 4891, 4892, 4894, 4895, 4897, 4898, 4903, 4906, 4911, 4912, 4918, 4919, 4920, 4924, 4927, 4929, 4932, 4934, 4941, 4942, 4945, 4948, 4949, 4950, 4650, 4653, 4656, 4658, 4660, 4662, 4666, 4667, 4669, 4670, 4672, 4677, 4681, 4684, 4685, 4687, 4688, 4689, 4691, 4693, 4694, 4695, 4697, 4699, 4701, 4702, 4705, 4707, 4708, 4716, 4722, 4724, 4728, 4731, 4733, 4735, 4736,4737, 4739, 4741, 4744, 4746, 4748, 4751, 4754, 4756, 4758, 4760, 4761, 4764, 4766, 4767, 4770, 4771, 4774, 4777, 4780, 4783, 4785, 4786, 4787, 4788, 4791, 4792, 4793, 4795, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4811, 4812, 4815, 4816, 4817, 4818, 4820, 4823, 4824, .4825, 4828, 4830, 4832, 4836, 4839, 4840, 4845, 4846, 4848, 4851, 4854, 4855, 4856, 4857, 4858, 4862, 4864, 4871, 4872, 4874, 4875, 4881, 4882, 4884, 4886, 4887, 4890, 4893, 4896, 4899, 4900, 4901, 4902, 4904, 4905, 4907, 4908, 4909, 4910, 4913, 4915, 4917, 4921, 4922, 4923, 4925, 4926, 4928, 4930, 4935, 4936, 4937, 4938, 4940, 4943, 4944, 4946, 4947, 4951, 4952, 4953, 4954, 4956, 4957, 4960, 4963, 4967, 4970, 4971, 4972, 4976, 4977, 4985, 4986, 4987, 4989, 4991, 4992, 4997, 4999, 5002, 5003, 5004, 5006, 5010, 5013, 5014, 5015, 5017, 5018, 5019, 5020, 5021, 5024, 5025, 5027, 5031, 5032, 5033, 5037, 5040, 5041, 5042, 5043, 4958, 4961, 4964, 4966, 4968, 4969, 4973, 4974, 4975, 4978, 4979, 4980, 4981, 4982, 4983, 4984, 4988, 4990, 4993, 4995, 4996, 4998, 5000, 5005, 5007, 5009, 5011, 5016, 5022, 5026, 5028, 5030, 5034, 5036, 5038, 5039, 5044, 5047, 5049, 5050, 5052, 5054, 5055, 5057, 5060, 5061, 5064, 5045, 5048, 5051, 5053, 5056, 5058, 5062, 5065, 5056, 5069, 5073, 5077, 5080, 5083, 5087, 5093, 5096, 5099, 5100, 5103, 5104, 5106, 5111, 5116, 5119, 5120, 5125, 5128, 5132, 5134, 5135, 5137, 5139, 5140, 5142, 5144, 5148, 5149, 5150, 5155, 5157, 5158, 5160, 5166, 5168, 5170, 5171, 5173, 5176, 5177, 5179, 5184, 5187, 5188, 5190, 5193, S195, 5198, 5201, 5204, 5208, 5211, 5215, 5216, 5217, 5220, 5221, 5222, 5224, 5226, 5229, 5230, 5231, 5232, 5234, 5237, 5242, 5244, 5245, 5246, 5247, 5249, 5250, 5252, 5254, 5255, 5256, 5261, 5262, 5264, 5265, 5273, 5274, 5276, 5278, 5279, 5281, 5284, 5285, 5286, 5287, 5288, 5289, 5292, 5296, 5300, 5303, 5304, 5307, 5308, 5309, 5313, 5315, 5317, 5318, 5322, 5323, 5326, 5329, 5330, 5333, 5336, 5337, 5341, 5343, 5348, 5349, 5352, 5354, 5355, 5358, 5359, 5361, 5362, 5363, 5364, 5365, 5367, 5369, 5370, 5372, 5375, 5377, 5379, 5382, 5385, 5387, 5393, 5394, 5395, 5398, 5400, 5404, 5407, 5408, 5409, 5412, 5413, 5414, 5416, 5418, 5421, 5424, 5426, 5428, 5431, 5432, 5433, 5434, 5435, 5437, 5440, 5441, 5443, 5448, 5450, 5451, 5454, 5455, 5458, 5460, 5461, 5464, 5468, 5470, 5471, 5474, 5475, 5477, 5482, 5484, 5485, 5487, 5490, 5491, 5492, 5494, 5496, 5498, 5499, 5500, 5501, 5502, 5503, 5504, 5506, 5509, 5510, 5512, 5516, 5517, 5518, 5524, 5525, 5526, 5528, 5531, 5533, 5534, 5535, 5536, 5537, 5540, 5542, 5544, 5545, 5546, 5549, 5550, 5552, 5553, 5559, 5561, 5566, 5569, 5572, 5573, 5575, 5577, 5578, 5579, 5580, 5581, 5582, 5588, 5593, 5595, 5596, 5598, 5600, 5601, 5603, 5604, 5605, 5608, 5614, 5615, 5616, 5619, 5622, 5624, 5625, 5628, 5629, 5633, 5634, 5637, 5638, 5639, 5643, 5644, 5645, 5647, 5648, 5649, 5650, 5654, 5662, 5664, 5067, 5070, 5072, 5074, 5075, 5076, 5078, 5081, 5084, 5086, 5088, 5090, 5091, 5094, 5097, 5101, 5105, 5107, 5109, 5110, 5112, 5114, 5115, 5117, 5121, 5123, 5124, 5126, 5129, 5131, 5136, 5143, 5145, 5147, 5151, 5153, 5156, 5159, 5161, 5162, 5163, 5164, 5165, 5167, 5169, 5172, 5174, 5175, 5180, 5181, 5182, 5183, 5185, 5186, 5189, 5191, 5194, 5196, 5199, 5200, 5202, 5203, 5205, 5207, 5209, 5210, 5212, 5214, 5218, 5219, 5223, 5225, 5227, 5233, 5235, 5238, 5239, 5240, 5241, 5248, 5251, 5253, 5257, 5259, 5260, 5263, 5266, 5268, 5269, 5270, 5271, 5272, 5280, 5282, 5290, 5291, 5293, 5295, 5297, 5299, 5301, 5306, 5310, 5311, 5312, 5314, 5316, 5319, 5321, 5324, 5327, 5331, 5332, 5334, 5338, 5339, 5340, 5342, 5344, 5346, 5347, 5351, 5353, 5356, 5360, 5366, 5368, 5371, 5373, 5376, 5378, 5380, 5383, 5388, .
5389, 5391, 5392, 5396, 5399, 5401, 5403, 5405, 5410, 5415, 5417, 5419, 5420, 5422, 5425, 5427, 5429, 5436, 5438, 5442, 5444, 5445, 5446, 5447, 5449, 5452, 5456, 5457, 5459, 5462, 5465, 5466, 5467, 5469, 5472, 5478, 5480, 5481, 5486, 5488, 5493, 5495, 5497, 5505, 5507, 5508, 5511, 5513, 5515, 5519, 5521, 5522, 5527, 5529, 5532, 5538, 5539, 5541, 5543, 5548, 5551, 5554, 5555, 5556, 5557, 5558, 5560, 5562, 5563, 5564, 5565, 5567, 5568, 5570, 5571, 5574, 5576, 5583, 5585, 5586, 5587, 5589, 5591, 5592, 5594, 5597, 5599, 5602, 5606, 5609, 5611, 5612, 5618, 5620, 5623, 5626, 5627, 5630, 5632, 5635, 5640, 5642, 5646, 5651, 5652, 5656, 5657, 5659, 5660, 5661, 5663, 5665, 5667, 5670, 5672, 5673, 5676, 5678, 5679, 5681, 5682, 5683, 5686, 5687, 5688, 5690, 5694, 5697, 5698, 5699, 5700, 5701, 5704, 5708, 5709, 5711, 5713, 5714, 5717, 5721, 5723, 5724, 5727, 5728, 5733, 5734, 5735, 5736, 5739, 5740, 5741, 5742, 5743, 5668, 5671, 5674, 5677, 5680, 5684, 5689, 5691, 5693, 5696, 5702, 5705, 5707, 5710, 5712, 5715, 5718, 5720, 5722, 5725, 5729, 5730, 5731, 5732, 5737, 5744, 5747, 5750, 5753, 5759, 5762, 5763, 5770, 5775, 5777, 5778, 5780, 5782, 5785, 5787, 5791, 5792, 5793, 5794, 5797, 5801, 5803, 5808, 5810, 5812, 5814, 5816, 5817, 5824, 5832, 5833, 5834, 5835, 5838, 5840, 5841, 5844, 5849, 5853, 5854, 5857, 5859, 5860, 5862, 5863, 5865, 5868, 5874, 5882,.5883, 5885, 5887, 5894, 5895, 5896, 5897, 5902, 5904, 5906, 5909, 5912, 5915, 5918, 5919, 5920, 5922, 5923, 5926, 5927, 5928, 5930, 5932, 5933, 5934, 5935, 5939, 5940, 5946, 5947, 5948, 5949, 5952, 5954, 5955, 5956, 5958, 5959, 5961, 5962, 5964, 5965, 5968, 5970, 5971, 5972, 5973, 5977, 5978, 5980, 5983, 5986, 5987, 5992, 5993, 5996, 5997, 6000, 6002, 6003., 6004, 6005, 6006, 6008, 6009, 6010, 6011, 6012, 6013, 6017, 6018, 6019, 6020, 6025, 6027, 6030, 6033, 6035, 6036, 6039, 6041, 6042, 6045, 6049, 6050, 6051, 6055, 6059, 6063, 6064, 6065, 6067, 6070, 6072, 6073, 6075, 6077, 6078, 6081, 5745, 5748, 5751, 5754, 5756, 5758, 5760, 5764, 5766, 5767, 5768, 5769, 5771, 5773, 5774, 5776, 5779, 5781, 5783, 5786, 5788, 5789, 5790, 5795, 5796, 5798, 5800, 5802, 5804, 5806, 5807, 5809, 5811, 5813, 5818, 5820, 5821, 5822, 5823, 5825, 5826, 5827, 5828, 5830, 5831, 5836, 5837, 5839, 5842, 5843, 5845, 5846, 5847, 5848, 5850, 5852, 5855, 5856, 5858, 5861, 5864, 5866, 5867, 5870, 5871, 5872, 5873, 5875, 5876, 5877, 5878, 5879, 5880, 5881, 5884, 5886, 5888, 5889, 5890, 5891, 5892, 5893, 5898, 5899, 5900, 5903, 5905, 5907, 5910, 5913, 5916, 5921, 5924, 5929, 5931, 5936, 5937, 5938, 5942, 5943, 5944, 5945, 5950, 5953, 5957, 5960, 5963, 5966, 5969, 5975, 5976, 5981, 5984, 5988, 5990, 5991, 5994, 5998, 5999, 6001, 6007, 6014, 6015, 6016, 6021, 6023, 6024, 6026, 6028, 6031, 6032, 6034, 6037, 6038, 6040, 6043, 6046, 6048, 6053, 6054, 6056, 6058, 6060, 6062, 6066, 6068, 6074, 6076, 6079, 6083, 6084, 6085, 6089, 6090, 6093, 6096, 6098, 6100, 6106, 6110, 6111, 6114, 6118, 6121, 6127, 6130, 6133, 6135, 6137, 6138, 6141, 6143, 6145, 6148, 6150, 6151, 6152, 6153, 6154, 6156, 6159, 6160, 6162, 6163, 6166, 6167, 6168, 6169, 6170, 6171, 6172, 6175, 6177, 6180, 6183, 6187, 6188, 6190, 6193, 6194, 6195, 6196, 6198, 6201, 6202, 6204, 6207, 6211, 6212, 6214, 6215, 6216, 6218, 6219, 6220, 6222, 6225, 6226, 6230, 6235, 6239, 6241, 6242, 6243, 6244, 6245, 6247, 6250, 6252, 6254, 6259, 6260, 6261, 6264, 6265, 6268, 6270, 6273, 6275, 6278, 6280, 6282, 6286, 6287, 6288, 6291, 6293, 6298, 6299, 6300, 6302, 6303, 6305, 6307, 6308, 6312, 6313, 6314, 6315, 6316, 6317, 6318, 6320, 6321, 6323, 6325, 6327, 6328, 6334, 6335, 6337, 6340, 6341, 6344, 6348, 6350, 6353, 6354, 6357, 6360, 6362, 6364, 6368, 6372, 6374, 6377, 6378, 6383, 6386, 6392, 6394, 6398, 6400, 6404, 6405, 6409, 6410, 6411, 6417, 6418, 6424, 6426, 6429, 6431, 6432, 6433, 6435, 6436, 6437, 6438, 6440, 6442, 6445, 6446, 6448, 6449, 6452, 6455, 6457, 6458, 6461, 6462, 6463, 6464, 6465, 6470, 6473, 6475, 6478, 6480, 6481, 6484, 6485, 6486, 6489, 6491, 6492, 6494, 6498, 6502, 6504, 6505, 6507, 6511, 6513, 6514, 6086, 6088, 6091, 6094, 6097, 6099, 6101, 6103, 6105, 6108, 6112, 6115, 6116, 6117, 6119, 6120, 6122, 6123, 6125, 6126, 6128, 6131, 6132, 6134, 6136, 6139, 6142, 6144, 6146, 6149, 6155, 6157, 6161, 6164, 6173, 6174, 6176, 6178, 6181, 6182, 6184, 6186, 6189, 6191, 6192, 6197, 6199, 6200, 6205, 6206, 6208, 6210, 6213, 6221, 6223, 6224, 6227, 6229, 6231, 6232, 6233, 6234, 6236, 6237, 6238, 6240, 6246, 6248, 6251, 6253, 6255, 6256, 6257, 6258, 6262, 6266, 6269, 6271, 6272, 6274, 6276, 6277, 6281, 6283, 6284, 6285, 6289, 6292, 6294, 6295, 6296, 6297, 6301, 6304, 6306, 6309, 6310, 6311, 6319, 6322, 6324, 6326, 6329, 6330, 6331, 6333, 6336, 6338, 6342, 6345, 6347, 6349, 6351, 6355, 6356, 6358, 6359, 6361, 6365, 6367, 6369, 6371, 6373, 6375, 6376, 6379, 6381, 6382, 6384, 6387, 6388, 6389, 6390, 6393, 6395, 6397, 6399, 6401, 6402, 6403, 6406, 6407, 6412, 6413, 6414, 6415, 6416, 6419, 6420, 6421, 6422, 6423, 6425, 6427, 6428, 6434, 6441, 6443, 6444, 6447, 6450, 6451, 6453, 6459, 6460, 6466, 6467, 6468, 6469, 6471, 6472, 6474, 6476, 6479, 6482, 6487, 6490, 6493, 6496, 6497, 6499, 6500, 6501, 6503, 6506, 6508, 6510, 6512, 6515, 6518, 6521, 6522, 6523, 6524, 6528, 6532, 6535, 6539, 6549, 6560, 6561, 6564, 6566, 6567, 6570, 6573, 6576, 6577, 6578, 6579, 6583, 6584, 6585, 6586, 6587, 6590, 6591, 6594, 6596, 6597, 6603, 6605, 6608, 6609, 6610, 6611, 6612, 6615, 6625, 6630, 6632, 6633, 6634, 6638, 6639, 6642, 6643, 6644, 6647, 6650, 6655, 6657, 6658, 6659, 6661, 6663, 6664, 6665, 6669, 6671, 6674, 6677, 6678, 6679, 6680, 6681, 6682, 6686, 6687, 6688, 6689, 6690, 6691, 6693, 6695, 6696, 6697, 6699, 6701, 6703, 6704, 6705, 6706, 6707, 6708, 6710, 6711, 6712, 6713, 6717, 6718, 6720, 6721, 6722, 6725, 6727, 6732, 6734, 6735, 6739, 6741, 6745, 6748, 6751, 6755, 6759, 6762, 6764, 6767, 6770, 6772, 6773, 6774, 6777, 6778, 6782, 6785, 6786, 6787, 6790, 6791, 6794, 6795, 6796, 6798, 6800, 6802, 6803, 6806, 6811, 6814, 6815, 6818, 6824, 6829, 6834, 6835, 6842, 6516, 6519, 6525, 6526, 6527, 6529, 6531, 6533, 6536, 6537, 6538, 6540, 6541, 6542, 6543, 6544, 6545, 6546, 6547, 6548, 6550, 6551, 6552, 6553, 6554, 6556, 6558, 6562, 6563, 6565, 6568, 6571, 6572, 6575, 6580, 6582, 6588, 6589, 6592, 6595, 6598, 6599, 6600, 6601, 6602, 6604, 6606, 6607, 6613, 6614, 6617, 6618, 6619, 6620, 6621, 6623, 6624, 6627, 6628, 6629, 6631, 6635, 6640, 6641, 6645, 6646, 6649, 6651, 6652, 6653, 6656, 6660, 6662, 6666, 6668, 6670, 6672, 6675, 6676, 6683, 6685, 6692, 6694, 6698, 6700, 6702, 6709, 6714, 6715, 6716, 6719, 6723, 6726, 6728, 6730, 6731, 6736, 6738, 6740, 6742, 6744, 6746, 6747, 6749, 6752, 6754, 6756, 6757, 6758, 6760, 6761, 6765, 6769, 6775, 6779, 6781, 6783, 6784, 6789, 6792, 6797, 6799, 6801, 6804, 6805, 6807, 6809, 6810, 6812, 6816, 6817, 6819, 6821, 6822, 6825, 6827, 6828, 6830, 6831, 6832, 6833, 6836, 6837, 6838, 6839, 6840, 6841, 6843, Detection: SEQ ID NOS:6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6844y 6848, 6850, 6852, 6854, 6857, 6859, 6861, 6862, 6865, 6868, 6870, 6871, 6872, 6874, 6875, 6876, 6880, 6883, 6886, 6887, 6888, 6890, 6891, 6894, 6896, 6897, 6898, 6899, 6900, 6901, 6902, 6904, 6905, 6906, 6910, 6912, 6917, 6920, 6845, 6847, 6849, 6851, 6853, 6855, 6858, 6860, 6863, 6866, 6869, 6873, 6877, 6879, 6881, 6882, 6884, 6889, 6892, 6893, 6895, 6907, 6908, 6909, 6911, 6913, 6915, 6916, 6918, 6921, 6924, 6927, 6928, 6933, 6935, 6937, 6939, 6940, 6943, 6946, 6947, 6948, 6949, 6951, 6953, 6954, 6955, 6959, 6961, 6964, .
6965, 6968, 6969, 6972, 6973, 6976, 6979, 6980, 6922, 6925, 6929, 6930, 6931, 6932, 6934, 6936, 6942, 6944, 6945, 6950, 6952, 6956, 6957, 6958, 6960, 6962, 6963, 6966, 6967, 6970, 6971, 6974, 6975, 6977, 6981, 6983, 6986, 6992, 6995, 6998, 7002, 7006, 7013, 7017, 7022, 7024, 7027, 7030, 7032, 7036, 7037, 7040, 7050, 7052, 7055, 7056, 7058, 7059, 7060, 7064, 7067, 7072, 7074, 7076, 7077, 7084, 7085, 7086, 7087, 7088, 7089, 7090, 7091, 7096, 7097, 7100, 7102, 7109, 7110, 7113, 7114, 7115, 7118, 7121, 7123, 7124, 7131, 7133, 7135, 7136, 7138, 7139, 7140, 7144, 7146, 7148, 7149, 7158, 7159, 7160, 7163, 7165, 7166, 7168, 7172, 7175, 7178, 7180, 7181, 7183, 7185, 7186, 7187, 7192, 7194, 7199, 7202, 7203, 7204, 7205, 7207, 7208, 7213, 7214, 7216, 7220, 7221, 7227, 7228, 7230, 7233, 7235, 7237, 7239, 7243, 7245, 7246, 7248, 7249, 7251, 7255, 7256, 7260, 7263, 7264, 7265, 7266, 7268, 7269, 7272, 7276, 7277, 7278, 7279, 7280, 7281, 7283, 7284, 7287, 7291, 7295, 7299, 7302, 7303, 7306, 7309, 7310, 7311, 7314, 7315, 7320, 7321, 7324, 7325, 7329, 7331, 7332, 7334, 7336, 7339, '~ILL 'ZILL 'I ILL '60LL 'LOLL 'VOLL 'ZOLL 'IOLL '669L 'K)9L '169L '0691 '689L
'L89L 'S89L
'~89L 'Z89L 'LL9L '9L9L 'tL9L 'ZL9L '999L '199L 'S99L 'I S9L 'Lti9L '~b9L
'9C9L S~9L '~~9L
'6Z9L 'LZ9L '~Z9L 'IZ9L 'OZ9L '819L '9i9L '0I9L '609L '909L 'CO9L '009L '86SL
'L65L 496SL
'06SL '68SL '885L 'L85L '98SL 'SBSL 'ZBSL 'I8SL '08SL '6L9L '8L5L 'LLSL '9LSL
'SLSL 'nSL
'~LSL ILSL 'OLSL 'L95L '999L '599L '095L '69SL '895L 'SSSL 'OSSL 'BbSL 'Lt~SL
'9bSL 'bbSL SZ
'i'6SL '6~SL '8~SL 'L~SL '9~SL 'S~SL 'KSL '~~SL '0~SL '9ZSL '~ZSL 'IZ5L 'LISL
'9I5L 'SISL
'~ISL 'I ISL 'OISL '605L 'LOSL '909L '90SL 'IOSL '66tiL '86bL 'L6bL 'S6tIL
'b6tiL 'Z6'bL '88bL

UtiL 't,8VL '~BVL 'Z8tL '6LbL '8LtiL 'SLtiL 'ZL'bL 'ML 119ft '094L 'LStL 'SS~L
'PStt '~SVL
'ZSbL 'I01L 'OStbL 'LttL '9trbL 'S"L '9~t'L 't~bL '~~tL 'Z~tiL 'IEt~L '0~7L
'8ZbL '9ZbL '~ZbL
'tiS5L 'ZSSL 4 6VSL 'StlSL '~#?SL 'ZtrSL 'ObSL 'Z~SL '6ZSL '8ZSL 'LZSL 'SZSL
'VZSL 'ZZSL 'OZSL 0Z
'6I9L '8I54 'ZISL '809L '~0SL '00SL '96t~L 'E6tL '06tL '68tiL '98bL '58bL
'I8bL '08tL 'LLbL
'9LbL $L1lL 'ILbL 'OLtiL 'L9pL '99tL '99tiL '~9bL 'Z9tL '69ft '9SbL '6ttL
'81bbL 'b"L 'Zt'bL
'0'aVL '6~tiL '801L 'S~VL 'LZtlL 'SZtL 'ZZbL 'IZtiL '6ItiL 'IItiL '60tiL
'80'PL 'LObL '1oL '~OtrL
'00bL '86~L '96~L '~6~Z '68EL '88~L '98EL 'fi8~L '~8~L 'Z8~L '6L~L '9L~L '~L~L
'IL~L 'OL~L
'69~L '89~L 'L9~L '99~L 'S9~L 'V9~L '~9~L '19~L '69~L 'LS~L '9S~L 'fi5~L 'IS~L
'01EL '8b~L SI
'L'b~L 'ML 'Ztr~L 'L~~L 'S~~L 'EEEL '0~~L '8Z~L '9Z~L 'ZZ~L '61~L '$i~L 'LI~L
'9I~L 'ZIEL
'80~L 'LO~L '1~0~L 'IO~L '86ZL 'L6ZL '96ZL 'i+6ZL '~6ZL 'Z6ZL '06ZL '68ZL
'SBZL 'ZBZL 'SLZL
'tLZL= '~LZL 'ILZL 'OLZL 'L9ZL 'Z9ZL '19ZL '6SZL 'BSZL 'LSZL 'i~SZL '~SZL
'OSZL 'LtrZL '$*ZL

'ZKL 'I tiZL 'OKL '9~ZL 'Z~ZL 'I EZL 46ZZL '9ZZL 'SZZL 'VLZL 'EZZL 'ZZZL '61ZL
68IZL 'LIZL
'SIZL 'ZIZL 'IIZL 'OIZL'90ZL'00ZL '86IL 'L6IL'96i4 '56IL '~61L 'I6IL '06IL
'68IL'88IL 01 'bBIL, 'ZBIL '6LIL 'LLIL '9LIL 'tLIL '~LIL 'ILIL 'OLIL 'L91L 'I91L 'LSIL '9SIL
'SSTL 'bSIL
'ZSIL 'OSIL 'LbIL '~bIL 'ZbIL 'Ii~iL'L~IL 'b~iL 'Z~IL 'OEIL '6ZiL 'BZIL'LZIL
'9ZIL 'SZIL
'ZZIL '611L '9I1L 'ZIIL 'i I IL '80IL 'LOIL '90IL SOIL '~OiL '101L '860L
'S60L $60L '~60L
'Z60L 'E80L 'ZSOL 'I80L 'OSOL '8L0L 'SLOL '~L0L 'ILOL '0L0L '890L '990L '990L
'E90L 'Z90L
'I904 'LSOL 'trSOL '~SOL 'ISOL '6'b0L '8'hOL 'LVOL 'WL 'SVOL 'bbOL 6~ti0L
'Zti4L 'I'b0L '6~OL S
'8~OL 'S~OL 'ti~OL '~~OL 'I~OL '6Z0L '8Z0L '9ZOL 'SZOL '~Z0L '0Z0L 8I0L '9I0L
tiIOL 'ZIOL

'I IOL '0101. '6001. '1.001. '5001. '~OOL '100L '6669 '9669 '~669 '1669 '0669 '6869 'L869 'tr869 '0ZtL 'LItL '9IVL 'SIt'L 'EItiL 'OItrL 'SOtiL 'Z0PL 'I017L 'L6~L ''66~L 'Z6~L
'16EL '06~L 'L8EL
'SBEL 'I8~L '8L~L 'SL~L W~L 'ZL~L 'Z9~L '09~L '89~L 'SS~L '~S~L '05~L *~L
'I17~L '0'b~L
~Z-ZT-SOOZ ~588ZSZ0 Fi'J

7714, 7716, 7718, 7720, 7726, 7728, 7729, 7733, 7734, 7735, 7736, 7738, 7740, 7741, 7744, 7746, 7747, 7748, 7749, 7750, 7751, 7752, 7753, 7754, 7755, 7756, 7758, 7556, 7561, 7563, 7568, 7583, 7584, 7591, 7593, 7594, 7595, 7599, 7601, 7604, 7607, 7608, 7611, 7613, 7614, 7616, 7617, 7619, 7622, 7624, 7626, 7628, 7631, 7637, 7638, 7639, 7640, 7641, 7642, 7644, 7645, 7646, 7649, 7650, 7652, 7654, 7656, 7657, 7658, 7659, 7660, 7662, 7663, 7665, 7667, 7669, 7670, 7671, 7673, 7675, 7678, 7679, 7680, 7681, 7684, 7686, 7688, 7692, 7695, 7697, 7698, 7700, 7703, 7705, 7708, 7710, 7715, 7717, 7719, 7721, 7722, 7723, 7724, 7725, 7727, 7730, 7731, 7732, 7737, 7739, 7742, 7743, 7745, 7757, 7759, 7760, 7761, 7764, 7770, 7774, 7775, 7778, 7782, 7786, 7788, 7795, 7797, 7799, 7805, 7807, 7809, 7810, 7811, 7815, 7817, 7819, 7820, 7822, 7823, 7824, 7828, 7832, 7834, 7837, 7839, 7843, 7845, 7851, 7852, 7857, 7860, 7863, 7865, 7868, 7874, 7881, 7885, 7889, 7892, 7894, 7896, 7900, 7902, 7904, 7907, 7909, 7910, 7913, 7917, 7922, 7925, 7926, 7928, 7933, 7934, 7937, 7941, 7945, 7946, 7948, 7950, 7951, 7952, 7953, 7954, 7955, 7956, 7957, 7963, 7964, 7968, 7971, 7972, 7973, 7976, 7979, 7980, 7981; 7982, 7983, 7985, 7986, 7987, 7988, 7991, 7762, 7765, 7767, 7768, 7771, 7773, 7776, 7779, 7781, 7783, 7784, 7785, 7789, 7791, 7792, 7793, 7794, 7796, 7798, 7800, 7802, 7803, 7808, 7812, 7813, 7814, 7816, 7818, 7821, 7825, 7827, 7829, 7830, 7833, 7835;
7836, 7838, 7840, 7841, 7842, 7844, 7846, 7847, 7848, 7849, 7853, 7854, 7855, 7856, 7858, 7861, 7864, 7866, 7869, 7870, 7871, 7872, 7873, 7875, 7877, 7878, 7879, 7880,' 7882, 7884, 7886, 7888, 7890, 7897, 7899, 7903, 7905, 7912, 7914, 7916, 7918, 7919, 7920, 7921, 7923, 7929, 7931, 7932, 7936, 7938, 7939, 7940, 7942, 7943, 7944, 7947, 7949, 7958, 7960, 7962, 7965, 7967, 7969, 7970, 7974, 7977, 7989, 7990, 7992; 7995, 7996, 8000, 8003, 8006, 8007;
8010, 8012, 8015, 8016, 8018, 8019, 8026, 8027, 8030, 8034, 8035, 8038, 8039, 8043, 8044, 8046, 8049, 8050, 8052, 8053, 8055, 8056, 8062, 8064, 8066, 8067, 8068, 8069, 8070, 8071, 8074, 8076, 8077, 8078, 8079, 8080, 8081, 7993, 7997, 7999, 8001, 8004, 8005, 8008, 8009, 8011, 8013, 8017, 8020, 8021, 8022, 8023, 8024, 8025, 8028, 8031, 8033, 8036, 8040, 8042, 8047, 8051, 8054, 8057, 8059, 8060, 8061, 8065, 8072, 8073, 8075, 8082, 8083, 8084, 8085, 8087, 8088, 8089, 8090, 8093, 8095, 8098, 8100, 8101, 8102, 8104, 8107, 8110, 8111, 8114, 8115, 8116, 8118, 8122, 8124, 8126, 8127, 8129, 8132, 8134, 8136, 8138, 8142, 8143, 8144, 8146, 8151, 8157, 8160, 8163, 8165, 8168, 8169, 8170, 8173, 8174, 8175, 8176, 8178, 8181, 8185, 8187, 8188, 8189, 8190, 8191, 8193, 8194, 8200, 8203, 8206, 8208, 8209, 8212, 8214, 8216, 8217, 8220, 8222, 8224, 8228, 8230, 8091, 8094, 8096, 8099, 8103, 8105, 8108, 8112, 8113, 8117, 8119, 8121, 8123, 8125, 8128, 8130, 8131, 8133, 8135, 8137, 8139, 8145, 8147, 8148, 8149, 8150, 8152, 8153, 8154, 8155, 8156, 8158, 8161, 8164, 8166, 8167, 8171, 8177, 8179, 8180, 8182, 8183, 8184, 8186, 8192, 8195, 8197, 8198, 8199, 8201, 8202, 8204, 8207, 8210, 8213, 8218, 8221, 8223, 8225, 8227, 8229, 8231, 8232, 8235, 8236, 8237, 8238, 8244, 8245, 8247, 8250, 8251, 8253, 8254, 8255, 8256, 8258, 8259, 8260, 8263, 8267, 8269, 8270, 8273, 8274, 8277, 8280, 8281, 8289, 8292, 8293, 8294, 8295, 8296, 8297, 8298, 8301, 8305, 8306, 8310, 8311, 8312, 8315, 8317, 8318, 8322, 8323, 8324, 8327, 8328, 8329, 8330, 8333, 8336, 8339, 8340, 8347, 8349, 8350, 8352, 8353, 8356, 8359, 8360, 8366, 8369, 8370, 8372, 8374, 8376, 8377, 8379, 8381, 8382, 8383, 8233, 8239, 8240, 8242, 8243, 8246, 8248, 8252, 8257, 8261, 8264, 8266, 8268, 8271, 8275, 8278, 8282, 8284, 8285, 8286, 8287, 8288, 8291, 8299, 8302, 8303, 8304, 8307, 8309, 8313, 8314, 8316, 8319, 8321, 8325, 8326, 8331, 8332, 8334, 8335, 8337, 8341, 8342, 8343, 8344, 8345, 8346, 8348, 8351, 8354, 8357, 8361, 8362, 8363, 8364, 8365, 8367, 8371, 8373, 8375, 8378, 8384, 8387, 8390, 8391, 8397, 8398, 8401, 8402, 8405, 8406, 8409, 8414, 8418, 8419, 8422, 8425, 8428, 8431, 8432, 8433, 8435, 8437,.
8440, 8444, 8449, 8452, 8454, 8455, 8457, 8462, 8464, 8466, 8468, 8469, 8472, 8475, 8476, =
8478, 8479, 8481, 8484, 8487, 8488, 8490, 8493, 8496, 8497, 8498, 8501, 8505, 8508, 8511, 8513, 8515, 8517, 8518, 8519, 8521, 8522, 8523, 8526, 8528, 8530, 8531, 8532, 8534, 8536, 8541, 8544, 8547, 8551, 8554, 8556, 8558, 8560, 8562, 8563, 8566, 8567, 8568, 8570, 8571, 8574, 8575, 8576, 8577, 8580, 8581, 8585, 8588, 8591, 8594, 8601, 8602, 8603, 8608, 8609, 8613, 8614, 8617, 8618, 8619, 8620, 8623, 8624, 8628, 8629, 8630, 8633, 8634, 8635, 8636, 8638, 8643, 8645, 8648, 8654, 8657, 8658, 8659, 8660, 8661, 8662, 8666, 8670, 8672, 8674, 8676, 8681, 8683, 8686, 8688, 8689, 8691, 8692, 8693, 8695, 8696, 8700, 8701, 8702, 8703, 8704, 8705, 8709, 8716, 8717, 8719, 8722, 8725, 8727, 8728, 8729, 8732, 8733, 8734, 8735, 8736, 8385, 8388, 8392; 8394, 8395, 8399, 8403, 8407, 8410, 8411, 8412, 8413, 8415, 8416, 8420, 8423, 8424, 8426, 8429, 8434, 8436, 8438, 8442, 8445, 8446, 8447, 8448, 8450, 8451, 8456, 8458, 8460, 8461, 8463, 8465, 8467, 8470, 8473, 8474, 8477, 8480, 8482, 8485, 8486, 8489, 8491, 8492, 8494, 8499, 8500, 8502, 8503, 8504, 8506, 8510, 8512, 8514, 8516, 8520, 8524, 8527, 8529, 8533, 8S35, 8537, 8539, 8542, 8545, 8546, 8548, 8550, 8552, 8555, 8557, 8564, 8565, 8569, 8572, 8578, 8582, 8583, 8586, 8587, 8589, 8592, 8595, 8596, 8597, 8598, 8599, 8600, 8604, 8606, 8607, 8610, 8612, 8615, 8616, 8621, 8625, 8627, 8631, 8632, 8637, 8639, 8640, 8641, 8642, 8644, 8646, 8647, 8649, 8650, 8651, 8652, 8653, 8655, 8663, 8665, 8667, 8668, 8669, 8671, 8673, 8675, 8677; 8678, 8679, 8680, 8682, 8684, 8685, 8687, 8690, 8694, 8697, 8698, 8699, 8706, 8707, 8708, 8710, 8711, 8712, 8713, 8714, 8715, 8718, 8720, 8723, 8726, 8730, 8737, 8738, 8741, 8744, 8747, 8750, 8751, 8753, 8754, 8755, 8756, 8759, 8760, 8762, 8763, 8766, 8767, 8768, 8769, 8770, 8772, 8775, 8776, 8777, 8779, 8782, 8783, 8784, 8785, 8786, 8787, 8788, 8789, 8790, 8793, 8794, 8796, 8798, 8799, 8801, 8803, 8804, 8806, 8807, 8809, 8812, 8813, 8815, 8820, 8823, 8826, 8829, 8830, 8832, 8835, 8836, 8837, 8842, 8845, 8846, 8847, 8851, 8853, 8856, 8857, 8859, 8861, 8866, 8739, 8878, 8879, 8880, 8884, 8891, 8893, 8895, 8898, 8900, 8901, 8909, 8912, 8739, 8742, 8745, 8748, 8749, 8752, 8757, 8758, 8761, 8764, 8771, 8773, 8778, 8780, 8791, 8797, 8800, 8802, 8805, 8808, 8810;
8814, 8816, 8818, 8819, 8821, 8824, 8827, 8828, 8831, 8833, 8838, 8840, 8841, 8755, 8843, 8844, 8848, 8850, 8852, 8854, 8855, 8863, 8864, 8865, 8867, 8868, 8869, 8870, 8871, 8872, 8873, 8874, 8876, 8877, 8881, 8882, 8883, 8885, 8887, 8888, 8889, 8890, 8892, 8894, 8896, 8897, 8899, 8902, 8785, 8903, 8904, 8905, 8906, 8907, 8908, 8911, 8913, 8917, 8920, 8923, 8924, 8929, 8931, 8934, 8935, 8936, 8914, 8916, 8918, 8921, 8925, 8927, 8928, 8930, 8932, 8933, 8937, 8980, 8984, 8988, 8989, 8998, 9001, 9002, 9005, 9007, 9008, 9012, 9013, 9016, 9019, 9020, 9022, 9023, 9025, 9028, 9029, 9032, 9033, 9034, 9035, 9037, 9038, 9044, 9046, 9047, 9048, 9049, 9054, 8981, 8983, 8985, 8987, 8990, 8992, 8993, 8994, 8995, 8997, 8999, 9003, 9004, 9006, 9009, 9010, 9011, 9014, 9017, 9018, 9021, 9024, 9026, 9030, 9036, 9039, 9041, 9042, 9043, 9045, 9050, 9051, 9052, 9053, 9055, 9058, 9060, 9063, 9066, 9067, 9068, 9069, 9070, 9071, 9074, 9075, 9077, 9078, 9079, 9080, 9082, 9084, 9088, 9089, 9090, 9099, 9103, 9104, 9105, 9107, 9111, 9056, 9061, 9064, 9072, 9081, 9083, 9085, 9086, 9087, 9091, 9092, 9093, 9094, 9095, 9096, 9097, 9098, 9100, 9102, 9106, 9108, 9109, 9110, 9112, 9113, 9116, 9118, 9125, 9126, 9128, 9129, 9130, 9136, 9141, 9143, 9148, 9150, 9153, 9157, 9158, 9159, 9163, 9164, 9165, 9167, 9168, 9171, 9173, 9177, 9180, 9181, 9182, 9183, 9185, 9187, 9188, 9189, 9191, 9192, 9193, 9194, 9197, 9198, 9200, 9206, 9207, 9208, 9209, 9211, 9216, 9218, 9219, 9220, 9221, 9222, 9223, 9226, 9228, 9229, 9230, 9231, 9232, 9233, 9234, 9237, 9238, 9240, 9243, 9246, 9248, 9253, 9256, 9257, 9260, 9263, 9264, 9266, 9269, 9271, 9279, 9280, 9281, 9282, 9283, 9284, 9290, 9114, 9119, 9121, 9122, 9123, 9124, 9127, 9131, 9133, 9134, 9135, 9137, 9138, 9139, 9140, 9142, 9144, 9146, 9147, 9149, 9151, 9152, 9154, 9155, 9156, 9160, 9162; 9166, 9169, 9172, 9174, 9175, 9176, 9178, 9184, 9186, 9190, 9195, 9199, 9201, 9202, 9203, 9204, 9205, 9212, 9214, 9215, 9217, 9224, 9227, 9235, 9239, 9241, 9244, 9247, 9249, 9251, 9252, 9254, 9258, 9261, 9265, 9267, 9270, 9273. 9274, 9275, 9276, 9277, 9278, 9285, 9286, 9287, 9288, 9289, 9291, 9292, 9295, 9297, 9300, 9302, 9303, 9304, 9307, 9308, 9310, 9311; 9313, 9319, 9321, 9323, 9324, 9328, 9333, 9334, 9337, 9338, 9339, 9342, 9344, 9348, 9351, 9352, 9354, 9355, 9357, 9360, 9367, 9371, 9374, 9377, 9379, 9383, 9384, '9385, 9388, 9389, 9390, 9393, 9394, 9398, 9401, 9402, 9406, 9408, 9409, 9410, 9413, 9415, 9416, 9417, 9418, 9419, 9421, 9422, 9425, 9429, 9433, 9434, 9435, 9436, 9437, 9439, 9440, 9446, 9452, 9453, 9454, 9455, 9457, 9458, 9459, 9462, 9466, 9467, 9468, 9470, 9474, 9479, .9482, 9487, 9488, 9489, 9492, 9495, 9497, 9499, 9500, 9504, 9505, 9508, 9513, 9514, 9519, 9522, 9523, 9524, 9526, 9528, 9532, 9533, 9534, 9535, 9537, 9538, 9541, 9542, 9543, 9545, 9546, 9548, 9293, 9296, 9298, 9301, 9305, 9309, 9312, 9314, 9316, 9317, 9318, 9320, 9322, 9325, 9326, 9327, 9329, 9331, 9332, 9335, 9336, 9340, 9345, 9347, 9349, 9353, 9356, 9358, 9361, 9363, 9364, 9365, 9368, 9370, 9372, 9375, 9376, 9378, 9380, 9382, 9386, 9391, 9395, 9397, 9399, 9400, 9403, 9405, 9407, 9411, 9412, 9414, 9420, 9423, 9424, 9426, 9428, 9430, 9431, 9432, 9438, 9441, 9443, 9444, 9445, 9447, 9448, 9449, 9450, 9451, 9456, 9460, 9461, 9464, 9465, 9469, 9471, 9473, 9475, 9477, 9478, 9480, 9483, 9485, 9490, 9493, 9494, 9496, 9498, 9501, 9502, 9503, 9506, 9509, 9511, 9512, 9515, 9516, 9517, 9518, 9520, 9521, 9525, 9527, 9529, 9530, 9536, 9539, 9544, 9547, 9549, 9550, 9551, 9555, 9556, 9557, 9559, 9560, 9563, 9564, 9565, 9566, 9569, 9570, 9573, 9577, 9578, 9579, 9580, 9585, 9586, 9587, 9588, 9591, 9593, 9596, 9552, 9554, 9558, 9561, 9567, 9571, 9574, 9576, 9581, 9583, 9584, 9589, 9592, 9594, 9595, 9598, 9602, 9604, 9605, 9608, 9612, 9613, 9614, 9617, 9618, 9621, 9622, 9625, 9626, 9627, 9632, 9633, 9638, 9640, 9643, 9644, 9645, 9646, 9651, 9654, 9656, 9657, 9658, 9661, 9662, 9665, 9666, 9667, 9668, 9672, 9673, 9675, 9676, 9677, 9680, 9683, 9686, 9688, 9691, 9694, 9698, 9699, 9702, 9705, 9707, 9710, 9711, 9715, 9719, 9720, 9722, 9723, 9726, 9729, 9732, 9733, 9735, 9737, 9738, 9741, 9744, 9745, 9746, 9747, 9748, 9749, 9750, 9754, 9755, 9756, 9758, 9759, 9768, 9771, 9772, 9776, 9777, 9781, 9782, 9784, 9787, 9789, 9790, 9792, 9796, 9797, 9800, 9805, 9806, 9812, 9815, 9818, 9821, 9823, 9825, 9827, 9831, 9832, 9835, 9837, 9839, 9841, 9842, 9844, 9845, 9851, 9853, 9854, 9855, 9857, 9860, 9862, 9863, 9865, 9871, 9873, 9875, 9878, 9879, 9599, 9601, 9603, 9606, 9607, 9609, 9611, 9615, 9619, 9623, 9624, 9628, 9630, 9631, 9634, 9635, 9637, 9639, 9641, 9647, 9649, 9650, 9652, 9653, 9659, 9660, 9663, 9664, 9670, 9671, 9679, 9682, 9684, 9687, 9690, 9692, 9693, 9695, 9697, 9700, 9701, 9703, 9706, 9708, 9712, 9713, 9714, 9716, 9717, 9718, 9721, 9724, 9727, 9730, 9734, 9739, 9742, 9751, 9753, 9757, 9760, 9761, 9762, 9763, 9764, 9765, 9766, 9767, .
9769, 9773, 9775, 9778, 9780, 9783, 9786, 9788, 9791, 9793, 9794, 9795, 9798, 9801, 9803, 9804, 9807, 9808, 9809, 9810, 9811, 9813, 9816, 9817, 9819, 9820, 9822, 9826, 9828, 9830, 9833, 9836, 9838, 9840, 9843, 9846, 9847, 9848, 9849, 9850, 9852, 9856, 9858, 9859, 9861, 9864, 9866, 9867, 9868, 9869, 9870, 9872, 9876, 9877, 9880, 9881, 9882, 9886, 9890, 9891, 9894, 9900, 9902, 9904, 9908, 9911, 9912, 9915, 9917, 9919, 9923, 9925, 9928, 9935, 9936, 9940, 9943, 9949, 9953, 9954, 9956, 9957, 9958, 9962, 9963, 9964, 9968, 9969, 9975, 9978, 9981, 9988, 9989, 9990, 9991, 9992, 9995, 9997, 10011, 10012, 10014, 10017, 10018, 10031, 10032, 10033, 10034, 10035, 10037, 10041, 10042, 10046, 10050, 10054, 10058, 10059, 9883, 9885, 9887, 9889, 9892, 9893, 9895, 9896, 9897, 9898, 9899, 9901, 9903, 9905, 9907, 9909, 9913, 9914, 9916, 9918, 9920, 9921, 9922, 9924, 9926, 9929, 9931, 9932, 9933, 9934, 9937, 9938, 9939, 9941, 9942, 9944, 9945, 9946, 9947, 9948, 9950, 9952, 9955, 9959, 9960, 9961, 9966, 9967, 9970, 9972, 9973, 9974, 9976, 9979, 9980, 9982, 9983, 9984, 9985, 9986, 9987, 9993, 9994, 9996; 9998, 9999, 10000, 10001, 10002, 10003, 10004, 10005, 10006, 10007, 10008, 10009, 10010, 10013,10015, 10016, 10019, 10020, 10021, 10022, 10023, 10025, 10026, 10027, 10028, 10030, 1003 6, 1003 8, 10040, 10043, 10044, 10045, 10047, 10048, 10049, 10051, 10053,10055, 10056, 10057, 10060, 10061, 10064, 10067, 10068, 10070, 10071, 10072, 10074, 10079, 10081, 10083, 10088, 10091, 10095, 10096, 10097, 10101, 10103, 10105, 10106, 10109, 10110, 10111, 10113, 10116,10118,10120,10122,10125, 10126,10127,10131, 10134, 10137, 10138, 10144, 10147, 10149,10151,10152, 10155, 10156, 10i59, 10160,10169, 10172, 10174, 10175, 10178, 10181, 10186,10188,10189,10190, 10191, 10192, 10196, 10199,10203, 10204, 10210,10211,10216, 10218, 10221, 10224, 10225, 10226, 10229, 10230, 10231, 10232, 10234, 10239, 10241,10244, 10252, 10253,10257, 10258, 10259, 10261, 10266,10272, 10276, 10062, 10065, 10069, 10075, 10077,10078,10080,10082, 10084, 10086, 10087,10089, 10090, 10092, 10093, 10094, 10098, 10099, 10100, 10102, 10104, 10107, 10112, 10114, 10117, 10119, 10121, 10123, 10124, 10129, 10130,10132,10133, 10135, 10139, 10140,10141, 10142, 10143, 10145, 10148, 10150, 10153, 10154, 10157, 10161, 10163, 10164, 10165,10166, 10167,10170, 10173, 10176, 10177, 10179, 10182, 10183, 10184, 10187, 10193, 10194, 10195, 10197, 10198,10200, 10201, 10202, 10205, 10206, 10207, 10209, 10212, 10213, 10214, 10215, 10219, 10220, 10222, 10223, 10227, 10228, 10233, 10235, 10236, 10237, 10240, 10242, 10243, 10245, 10247, 10248, 10249, 10251, 10254, 10255, 10256,10260,10262, 10263, 10264, 10265, 10267, 10268, 10269, 10270, 10271, 10273, 10274, 10275, 10277, 10278, 10279, 10282, 10285, 10287, 10291, 10292, 10297, 10299, 10301, 10304, 10306, 10308, 10310, 10314, 10317, 10318, 10320, 10322, 10327, 10329, 10330, 10333, 10335, 10336, 10337, 10340, 10342, 10348, 10350, 10351, 10354, 10358, 10359, 10360, 10362, 10366, 10369, 10372, 10373, 10374, 10376, 10378, 10383, 10385, 10391, 10398, 10403, 10407, 10410, 10413, 10415, 10419, 10422, 10425, 10427, 10428, 10429, 10430, 10432, 10433, 10434, 10437, 10438, 10439, 10442, 10443, 10445, 10446, 10447, 10448, 10452, 10453, 10454, 10455, 10456, 10460,10463,10466, 10467, 10469, 10470, 10473, 10475, 10477, 10480, 10484, 10488, 10490, 10494, 10495, 10497, 10501, 10502, 10503, 10507, 10508, 10510, 10517, 10518, 10520, 10522, 10524,10525, 10528, 10529, 10533, 10536, 10537, 10540, 10541, 10545, 10547, 10551, 10553, 10556, 10559, 10560, 10563, 10564, 10565, 10568, 10571, 10574, 10576,10579, 10581, 10583,10588,10589, 10590, 10592,10593, 10596, 10597,10601, 10602, 10603, 10605, 10607, 10609, 10610,10612, 10613, 10617, 10618, 10621,10614, 10627, 10630, 10632,10634, 10637, 10638, 10639,10640,10641, 10643, 10645, 10647, 10653, 10655, 10657, 10659, 10661, 10662, 10663, 10664, 10665, 10666, 10667, 10668, 10669, 10672, 10673, 10674, 10675, 10280, 10283, 10286, 10288, 10290, 10293, 10295, 10298, 10300, 10302, 10305, 10307, 10309,10311, 10312, 10313, 10315, 10319, 10321, 10323,10325,10326,10328, 10331, 10338, 10341, 10343, 10344, 10345, 10346, 10347, 10349, 10352, 10355, 10356, 10357, 10361, 10363, 10365, 10367, 10370, 10375, 10377, 10379, 10380, 10381, 10382, 10384, 10386, 10387, 10388, 10390, 10392, 10394, 10395, 10399,10401, 10402, 10404, 10406, 10408, 10411, 10412, 10414, 10416, 10417,10418,10420,10423, 10426,10431, 10435, 10440,10444, 10449, 10451, 10457, 10459,10461, 10462, 10464, 10465, 10468, 10471, 10476, 10478, 10481, 10483, 10485, 10487, 10489,10491,10492,10493,10498,10499,10500,10504, 10506,10509, 10511,10513,10514, 10515,10516,10519,10521, 10523,10526,10530,10531,10532,10534,10535,10538,10539, 10542,10543,10544,10546,10548,10550,10552,10554,10557,10558,10561,10566,10569, 10572,10573,10577, 10578,10580,10582, 10584,10586,10594,10598,10600,10604,10606, 10611,10614,10616,10619,10622,10625, 10626,10628,10631,10633,10635,10642,10644, 10646,10648,10649,10650, 10651,10652,10654, 10656, 10658,10660,10670,10671,10676, 10678, 10684,10679,10681, 10682,10683, 10685,10687,10688, 10689, 10690,10691,10693, 10696,10699,10703, 10704, 10709, 10711, 10712, 10713, 10720,10721, 10722,10724,10725, 10726,10728,10729, 10734,10740, 10742, 10743,10744,10745,10746, 10748,10749,10751, 10754,10758, 10759, 10760, 10764, 10768, 10769,10772, 10775, 10780, 10781, 10783,10786, 10791,10796,10801,10808, 10817,10818, 10819,10821, 10823, 10826, 10827,10829,10830, 10834,10843, 10844, 10847, 10848, 10849, 10853,10856, 10858,10866, 10869, 10872,10874, 10877,10878,10879,10882, 10884,10885, 10889,10892, 10893,10896,10900, 10901,10903, 10905,10907, 10909, 10910, 10911,10914, 10916,10919, 10926,10930, 10932, 10933,10934, 10938, 10941, 10942, 10943, 10944,10946, 10947,10953, 10955, 10956, 10958, 10959, 10962, 10967,10968, 10972, 10975, 10977,10978,10981,10984, 10985,10988, 10992,10995, 10997, 10999, 11000, 11001, 11006, 11009,11013, 11016,11020,11025, 11033, 11036, 11040,11041, 11042, 11043, 11045, 11046, 11048, 11052, 11055,11060, 11061,11062, 11064, 11065,11067, 11070, 11071, 11072, 11078, 11079, 11081,11085,11093, 10694, 10697, 10700, 10702, 10705, 10707,10710, 10714, 10716, 10717,10718,10719,10723, 10727,10730, 10732,10733, 10735, 10737,10738, 10739, 10741,10747,10750, 10752, 10755, 10757,10761, 10762, 10763, 10765, 10767, 10770, 10773, 10776, 10778,10779, 10782, 10784,10788, 10789, 10790,10792, 10793, 10794, 10798, 10799, 10800, 10802, 10804, 10805, 10806, 10807, 10809, 10811, 10812, 10813, 10814, 10815, 10816, 10820, 10822, 10824, 10831, 10833, 10835, 10837, 10838, 10839, 10840, 10841,10842,10845, 10846, 10850,10851,10854, 10857, 10859,10860, 10861,10862, 10863, 10864, 10865, 10868, 10870, 10871, 10873, 10875, 10880, 10881, 10883, 10886, 108 88, 10890, 10894, 10897, 10899, 10902, 10904, 10906, 10908, 10912, 10915, 10917, 10920, 10922, 10924, 10925, 10927, 10928, 10929,10931, 10935, 10937,10939,10945, 10948, 10950,10951, 10952, 10954,10957,10960,10963, 10965, 10966, 10969,10970,10971, 10973, 10976, 10979,10980, 10982, 10986,10987,10989,10991,10993,10996,10998,11002,11004, 11005, 11007, 11010, 11012,11014,11015,11017,11019,11021,11022,11023,11026,11027, 11028,11029,11030, 11031, 11032, 11034,11037, 11039,11044,11047, 11049, 11050,11051,11053, 11054,11056, 11058, 11059,11063, 11066, 11068,11069, 11073,11074,11075, 11076,11077,11080,11082, 11083, 11084,11086,11087, 11088,11089,11090,11091,11092,11094, 11376,11381,11382, 11383, 11384, 11387,11397, 11401,11405,11408, 11414,11418, 11421, 11422, 11424,11427, 11429,11430,11377,11379,11380,11385,11386,11388,11390,11391, 11392,11394,11395, 11396,11398,11399,11400, 11402,11403, 11404,11406,11409, 11410, 11411,11412, 11415, 11416, 11417,11419,11423,11425,11428, 11431, 11432,11433, 11434,11438,11442,11443, 11447,11449,11450, 11452,11456,11459, 11463,11464,11467, 11468, 11472,11477, 11480, 11481,11482, 11483,11484, 11488, 11489,11493,11498, 11502, 11504, 11505, 11506,11507, 11508,11509, 11512, 11513, 11514, 11517,11520, 11522,11523, 11524, 11526,11528,11532, 11534,11435, 11439, 11444,11445, 11446, 11448,11451, 11453, 11457, 11458, 11460, 11461, 11462, 11465,11466, 11469, 11473, 11474,11475,11476, 11478, 11479, 11485,11486,11487;
11490,11494,11497, 11499, 11500,11501,11503,11510, 11511,11515, 11518,11519, 11521, 11525, 11527,11529, 11535,11539,11540,11541,11548,11550, 11551, 11552, 11555, 11556, 11557,11560, 11561, 11562, 11568, 11569, 11571,11572, 11573, 11577, 11536, 11542, 11545, 11546, 11547, 11549, 11553, 11554, 11563, 11566,11570,11574, 11578, 11585, 11586, 11590, 11591,11592,11595, 11596, 11597,11600, 11579,11582, 11587,11593, 11594, 11598,11601, 11602, 11606, 11607, 11608,11609,11616,11618,11622, 11626, 11628, 11632, 11633, 11603, 11610, 11613,11614, 11615,11617,11619,11623,11627, 11629,11634, 11635, 11640, 11641, 11642, 11643, 11647, 11648, 11654, 11655, 11656, 11657, 11658,11636,11639, 11644,11645, 11646, 11649, 11652, 11653,14659, 11663, 11664,11665, 11666, 11670, 11671,11672, 11673, 11677, 11681, 11687, 11690, 11694, 11696, 11697,11701, 11705,11709, 11713, 11719, 11723, 11729, 11733, 11739, 11744, 11745, 11748, 11749, 11751, 11755,11759, 11763, 11770, 11772, 11774,11776,11778,11782,11785,11660,11667,11674,11675,11676, 11678,11682,11685, 11686, 11688,11689,11691,11692,11693,11695,11698,11699,11'100,11702, 11706,11710, 11716,11720,11724, 11725, 11727,11728,11730,11731,11732, 11734, 11735, 11736,11737, 11738,11740,11743, 11746,11747,11750,11752, 11756,11761, 11762, 11764,11765, 11767, 11768,11769, 11773, 11775, 11777, 11779, 11783, 11784, 11786, 11790, 11791, 11792, 11787, 11793, 11796, 11800, 11802, 11803, 11805, 11810, 11818, 11819, 11823, 11824, 11827, 11828, 11829,11833,11836,11837,11839,11840,11847,11850,11852,11857,11860,11864,11866, 11797,11801, 11804, 11806, 11809, 11811, 11814,11815, 11817, 11820, 11825, 11830, 11835, 11841, 11844, 11845, 11846, 11848, 11851, 11853, 11856, 11858, 11861, 11862, 11863, 11865, 11867,11871,11876, 11878,11882,11888,11891,11894,11868,11872,11875,11877,11879, 11883,11886, "11887, 11889,11890,11892,11893, 11895, 11898, 11902, 11903, 11904, 11908, 11909,11911,11912, 11913, 11914,11915, 11917, 11918, 11922,11926, 11927, 11930, 11932, 11933,11937,11941, 11942, 11946,11947,11948,11949, 11950, 11951, 11952, 11955, 11959, 11968,11972,11976, 11978, 11979,11980,11981,11986,11988,11989, 11991,11992,11995, 11997,11998, 12001,12002, 12004,12005,11899, 11905, 11910, 11916,11919, 11923,11924, 11925, 11928, 11929, 11931, 11934, 11938, 11943, 11953, 11954, 11956, 11960, 11963, 11964, 11967,11969,11973,11977,11982,11985,11987,11990,11993,11994, 11996,11999,12000, 12003, 12006, 12011, 12015, 12016, 12017, 12021, 12022, 12023, 12024, 12025, 12026, 12027, 12031,12034, 12042, 12043, 12045,12049,12050, 12051,12054, 12062, 12063, 12064, 12066, 12067, 12068, 12070, 12072, 12076, 12082, 12085, 12086, 12089, 12090, 12093, 12094, 12095, 12096,12097, 12098, 12101, 12103, 12107, 12108, 12111, 12112, 12114, 12118, 12119, 12120, 12128, 12007, 12010, 12012, 12020, 12028, 12032, 1203 3, 12035, 12038, 12039, 12044, 12046, 12052, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12065, 12069, 12071, 12073, 12077, 12080, 12081, 12084, 12087, 12088, 12091, 12099, 12100, 12102, 12104, 12109, 12110, 12113, 12115, 12121, 12122, 12123, 12124, 12125, 12127, 12129, 12130, 12135, 12136, 12141, 12144, 12147, 12148, 12149, 12153, 12159, 12160, 12131, 12134, 12137, 12138, 12139, 12140, 12142, 12143, 12145, 12146, 12150, 12154, 12157, 12158, 12161, 12162, 12163, 12164, 12168, 12171, 12176,12181, 12187,12190,12194,12196,12197,12199, 12201, 12202,12209, 12213, 12216, 12220,12221, 12223,12225, 12226,12231,12233, 12239, 12243, 12244, 12250, 12254, 12256, 12257, 12259, 12266, 12270, 12271, 12272, 12274, 12276, 12277, 12278, 12280, 12284, 12285, 12288, 12289, 12290, 12291, 12295, 12296, 12302, 12308, 12313, 12317, 12321, 12322, 12323, 12324, 12325, 12327, 12328, 12330, 12331, 12332, 12336, 12337, 12339, 12343, 12346, 12349, 12353, 12354, 12355, 12359, 12361, 12363, 123 67, 12369, 12370, 12372, 12376,12377, 12379, 12380, 12381, 12382, 123 83, 12385, 12389, 12393, 12398, 12400, 12402, 12403, 12406, 12408, 12409, 12410, 12412, 12415, 12417, 12419, 12422, 12424, 12429, 1243 0, 12432, 12433, 12435, 12436, 12437, 12441, 12445, 12448, 12449, 12454, 12458, 12459, 12460, 12165, 12169, 12170, 12172, 12175, 12177, 12180, 12182, 12185, 12186, 12188, 12191, 12195, 12198, 12200, 12203, 12206, 12207,12208, 12210, 12214,12217, 12222, 12224, 12227, 12228, 12229, 12230, 12232, 12234,12237,12238, 12240,12241,12242,12245,12248,12249, 12251,12255,12258, 12260, 12262, 12263, 12264, 12265, 12267, 12268, 12269, 12273, 12279, 12281, 12286, 12287, 12292, 12297, 12300, 12303, 12306, 12307, 12309, 12312, 12314, 12318, 12326, 12333, 12338, 12340, 12341, 12342, 12345, 12347, 12348, 12352, 12356, 12360, 12362, 12364, 12371, 12373, 12378, 12386,12390,12394, 12397, 12401, 12404, 12405,12411, 12413, 12418, 12420, 12423, 12425, 12428, 12438, 12439, 12440, 12442, 12443, 12446,12450, 12453, 12455, 12461, 12465, 12467, 12468, 12472,12474,12477,12480,12484,12486,12488, 12489, 12490, 12493, 12495, 12499, 12501, 12504, 12506, 12462, 12469, 12475, 12478, 12481, 12483, 12485, 12487, 12492, 12494, 12496, 12497, 12498, 12500,12502, 12505, 12507, 12511, 12517, 12520, 12522, 12523, 12524, 12528, 12530, 12534, 12535, 12536, 12537, 12541, 12542, 12547, 12550, 12551, 12552, 12554, 12555,12560,12564, 12565, 12569,12571,12574, 12579, 12581, 12586, 12590, 12592, 12593, 12594, 12596, 12600, 12601, 12602, 12604, 12610, 12613, 12614, 12615, 12616, 12620, 12626, 12630, 12508, 12512, 12515, 12518, 12521, 12525, 12529, 12531, 12538, 12543, 12546, 12548, 12549, 12553, 12556, 12559, 12561, 12566, 12570, 12572, 12573, 12575, 12578, 12582, 12585, 12587, 12595, 12597, 12599, 12603, 12605, 12608, 12609, 12611, 12617, 12618, 12621, 12624, 12625, 12627,12631, 12636,12637,12638,12639,12643,12647, 12648, 12652, 12654, 12660, 12664, 12666, 12670, 12672, 12675, 12677, 12680, 12686, 12691, 12692, 12695, 12699, 12700, 2S 12701, 12703, 12705, 12709, 12710, 12714, 12715, 12716, 12718, 12719, 12720, 12724, 12725, 12728, 12732,12738, 12739,12743, 12744,12745,12747, 12748, 12752, 12757, 12763, 12764, 12766,12767, 12768, 12771,12776,12777,12781,12785, 12787,12788,12791,12792,12796, 12797, 12800, 12804, 12808, 12813, 12815, 12816, 12817, 12822, 12825, 12828, 12831, 12833, 12834, 12837,12839, 12841, 12842,12632, 12635,12640,12641,12644,12649, 12653,12655, 12658, 12661, 12662, 12663, 12665, 12667, 12671, 12673, 12678, 12679, 12681, 12682, 12683, 12684, 12685, 12687, 12688, 12689, 12690, 12693, 12694, 12696, 12702, 12704, 12706, 12712, 12713, 12717, 12721, 12726, 12729, 12730, 12731, 12733, 12736, 12737, 12740, 12746, 12749, 12750, 12751, 12753, 12754, 12755, 12756, 12758, 12760, 12761, 12762, 12765, 12769, 12770, 12772, 12775, 12778, 12782, 12786, 12789, 12790, 12793, 12794, 12795, 12798, 12799, 12801, 12805, 12809, 12812, 12814, 12818, 12821, 12823, 12824, 12826, 12827, 12832, 12835, 12836, 12838, 12840, 12843, 12844, 12845, 12849, 12850, 12854, 12857, 12862, 12866, 12867, 12868, 12870, 12872, 12880, 12881, 12884,12885, 12889, 12890, 12892, 12896, 12898, 12899, 12903, 12907, 12910, 12913, 12919, 12920, 12921, 12923, 12928, 12932, 12938, 12942, 12945, 12948, 12950, 12951, 12953, 12959, 12846, 12851, 12855, 1285 8, 12861, 12863, 12869, 12871, 12873, 12876, 12877, 12878, 12879, 12882, 12883, 12886, 12887, 12888, 12891, 12893, 12894, 12895, 12900, 12901, 12902, 12904, 12908, 12909, 12911, 12912, 12914, 12917, 12918, 12924, 12927, 12929, 12933,12936;12937, 12939, 12943, 12949, 12954, 12957, 12958, 12960, 12961, 12965, 12969, 12975, 12977, 12962, 12966, 12967, 12968, 12970, 12971, 12972, 12973, 12974, 12976, 12978, 12981, 12982, 12986, 12989, 12991, 12992, 12993, 12995, 12999, 13001, 12983, 12987, 12996, 12997, 12998, 13000, 13002, 13005, 13009, 13013, 13017, 13019, 13025, 13029, 13030, 13032, 13033, 13034, 13037, 13040, 13042, 13043, 13044, 13048, 13049, 13051, 13052, 13053, 13057, 13062, 13064, 13065, 13066, 13067, 13072, 13073, 13076, 13078, 13082, 13083, 13085, 13087, 13088, 13089, 13092, 13096, 13100, 13101, 13102, 13105, 13108, 13109, 13110, 13114, 13117, 13118, 13124, 13129, 13131,13132, 13138, 13144, 13146, 13147, 13148,13152, 13156, 13159, 13164, 13167, 13168, 13170,13171, 13172, 13173, 13174, 13184, 13185, 13006, 13010,-13014, 13018, 13020, 13021, 13022,13023, 13024,13026,13031, 13035, 13036, 13038, 13039, 13041, 13045, 13050, 13054, 13058, 13061, 13063, 13068, 13069, 13070, 13071, 13074, 13075, 13077, 13079, 13084, 13086, 13090,13091, 13093, 13097, 13104, 13107, 13111, 13115, 13119, 13121, 13122, 13123, 13125, 13126, 13127, 13128, 13130, 13133, 13137, 13139, 13142, 13143, 13145, 13149, 13153, 13157, 13158, 13160, 13163, 13165, 13166, 13169, 13175, 13176, 13177, 13178, 13179, 13180, 13181, 13182, 13183, 13186, 13189, 13190, 13191, 13195, 13196, 13197, 13199, 13200, 13204, 13206, 13192, 13198, 13201, 13207, 13212, 13213, 13226, 13228, 13231, 13235, 13240, 13245, 13247, 13248, 13250, 13254,13256, 13258, 13264, 13265, 13268, 13269, 13273, 13274, 13277, 13279, 13280, 13281, 13286, 13208, 13211, 13214, 13217, 13220, 13222, 13224, 13225, 13227, 13229, 13232, 13233, 13234, 13237, 13239, 13241, 13242, 13244, 13246, 13249, 13251, 13255, 13257, 13259, 13262, 13263, 13266, 13267, 13270, 13275, 13276, 13282, 13285, 13641, 13645, 13646, 13649, 13650, 13652, 13653, 13654, 13655, 13658, 13659, 13642, 13647, 13648, 13656, 13660, 13661, 13664, 13669, 13670, 13671, 13672, 13673, 13675, 13676, 13677, 13681, 13683, 13685,13687,13689, 13691, 13693, 13696, 13665, 13668, 13674, 13678, 13682, 13684,13686,13688,13690,13692,13694, i3695,13697, 13701,13702,13703,13709, 13713,13714, 13715, 13719, 13721, 13722,13726,13728, 13732, 13735, 13740,13698, 13704, 13705, 13706, 13707, 13708, 13710,13716, 13717, 13718, 13720, 13723, 13724,13725, 13727, 13729, 13733, 13734, 13736, 13739,13741, 13744, 13745, 13749, 13751, 13752, 13753, 13754, 13758,13762,13765, 13766, 13768,13772, 13773,13774,13777, 13778, 13779, 13783, 13785, 13790, 13791,13797, 13802, 13803,13805, 13806,13807, 13809, 13812, 13814,13816, 13817, 13818, 13819,13820, 13823, 13824,13826, i3828,13746, 13755, 13759, 13763, 13764, 13767, 13769, 13775, 13776, 13780, 13784, 13786, 13788,13789,13792,13795, 13796,13798, 13800, 13804, 13808, 13813, 13815, 13821,13822, 13829, 13832, 13837, 13841, 13844,13845, 13846, 13849, 13854, 13855, 13856, 13857,13861,13865, 13869, 13871, 13875, 13879,13880,13833, 13836, 13838,13843, 13847, 13850,13853, 13858, 13862, 13866, 13870, 13872,13876, 13881, 13882, 13883,13889, 13894, 13902,13903, 13910, 13911, 13914, 13915, 13916,13928,13929, 13930, 13931, 13935, 13936, 13937,13944, 13947, 13948, 13950, 13960, 13961,13962, 13964, 13965,13966, 13968, 13970, 13971,13972,13976,13978, 13884, 13887, 13890,13893, 13895, 13898, 13900, 13904,13905, 13906, 13907,13908,13909,13912, 13913, 13917, 13920, 13921, 13922,13923,13924, 13925, 13926, 13932, 13938,13941,13942, 13943, 13945,13946, 13949, 13953, 13954,13956, 13957, 13958,13959, 13963,13967, 13969,13974, 13975, 13977,13980, 13981,13988, 13989, 13990, 13992, 13994,13995,13999, 13982, 13985, 13986, 13987, 13991, 13993, 13996, 14000,14001, 14002, 14003, 14004,14009, 14014,14017, 14020, 14024, 14026, 14029,14035,14036, 14040, 14043, 14045, 14051,14057, 14058, 14059, 14063, 14065, 14066, 14067,14068,14069,14070,14071,14073, 14074, 14078,14079, 14080, 14081, 14082, 14083, 14084,14085,14087, 14094, 14095, 14100, 14108,14109, 14113,14114,14118, 14120, 14121, 14122, 14130, 14133, 14138, 14141, 14142, 14143,14147, 14005, 14008, 14010, 14013, 14015, 14018, 14021, 14025, 14027, 14028,14030, 14033, 14034,14037, 14038,14039,14041, 14042, 14044, 14046,14049, 14050, 14052, 14055, 14056, 14060, 14064, 14072,14077,14086, 14088, 14089, 14090, 14091, 14092, 14093, 14096, 14097, 14098, 14099, 14101, 14102, 14103, 14104, 14105, 14106, 14107, 14110, 14115, 14123, 14126, 14127, 14132, 14134, 1413 5, 14136, 1413 7, 14139, 14140, 14144, 14145, 14148, 14151, 14155, 14157, 14161, 14166, 14171, 14175, 14183, 14187, 14190, 14192, 14194, 14195, 14196, 14200, 14201, 14152, 14156, 1415 8, 14162, 14165, 14167, 14170, 14172, 14176, 14179, 14180, 14182, 14184, 14185, 14186, 14188, 14189, 1419 1, 14193, 14197, 14198, 14199, 14202, 14203, 14204, 14210, 14211, 14216, 14217, 14223, 14226, 14228, 14229, 14230, 14233, 14235,14239, 14241, 14243, 14244, 14250, 14254, 14255, 14256, 14257, 14260, 14261, 14262, 14267, 14268, 14269, 14273, 14274, 14277,14281,14284, 14286, 14289, 14292, 14293, 14297, 14299, 14301, 14304, 14305, 14306, 14312, 14316, 14320, 14322, 14324, 14328, 14329, 14331, 14337, 14342, 14344, 14346, 14347, 14349, 14350, 14353, 14356, 14361, 14363, 14364, 14365, 14366, 14205, 14208, 14212, 14215, 14218, 14221, 14224, 14225, 14227, 14231,14236, 14240, 14242, 14245, 14246, 14247, 14251, 14263, 14266, 14270, 14278,.
14282, 14283, 14285, 14287, 14290, 14291, 14294, 14298, 14300, 14302, 14303, 14307, 14310, 14313, 14317, 14323, 14325, 14327, 14330, 14334, 14338, 14340, 14341, 14345, 14348, 14351,.
14352, 14354, 14355, 14357, 14358, 14359, 14360, 14367, 14368, 14372, 14373, 14375, 14386, 14369, 14374, 14376, 14379, 14380, 14381, 14382, 14383, 14384 and SEQ ID
NO:14385.

A fiuther preferred embodiment of the method comprises the use of blocker oligonucleotides. T he u se o f s uch b locker o ligonucleotides h as b een d escribed b y Yu e t a 1., BioTechniques 23:714-720, 1997. Blocldng probe oligonucleotides are hybridized to the bisulfite treated nucleic acid concurrently with the PCR primers. PCR
amplification of the nucleic acid is terminated at the 5' position of the blocking probe, such that amplification of a nucleic acid is suppressed where the complementary sequence to the blocking probe is present.
The probes may be designed to hybridize to the bisulfite treated nucleic acid in a methylation status specific manner. For example, for detection of methylated nucleic acids within a population of unmethylated nucleic acids, sappression of the amplification of nucleic acids which are unnaethylated at the position in question would be carried out by the use of blocking probes comprising a'CpA' or 'TpA' at the position in question, as opposed to a'CpG' if the suppression of amplification of methylated nucleic acids is desired.

For PCR methods using blocker oligonucleotides, efficient disruption of polymerase-mediated amplification requires that blocker oligonucleotides not be elongated by the polymerase. Preferably, this is achieved through the use of blockers that are 3'-deoxyoligonucleotides, or oligonucleotides derivitized at the 3' position with other than a"free"
hydroxyl group. For example, 3'-O-acetyl oligonucleotides are representative of a preferred class of blocker molecule.
Additionally, polymerase-mediated decomposition of the blocker oligonucleotides should be precluded. Preferably, such preclusion comprises either use of a polymerase lacking 5'-3' exonuclease activity, or use of modified blocker oligonucleotides having, for example, thioate bridges at the 5'-tenminii thereof that render the blocker molecule nuclease-resistant.
Particular applications may not require such 5' modifications of the blocker.
For example, if the blocker- and primer-binding sites overlap, lhereby precluding binding of the primer (e.g., with excess blocker), degradation of the blocker oligonucleotide will be substantially precluded. This is because the polymerase will not extend the primer toward, and through (in the 5'-3' direction) the blocker-a process that normally results in degradation of the hybridized blocker oligonucleotide.

A particularly preferred blocker/PCR embodiment, for purposes of the present invention and as implemented herein, comprises the use of peptide nucleic acid (PNA) oligomers as blocking o ligonucleotides. S uch PNA b locker o ligomers are i deally s uited, b ecause they are neither decomposed nor extended by the polymerase.

Preferably, therefore, the base sequence of said blocking oligonucleotides is required to comprise a sequence having a length of at least 9 nucleotides which hybridizes to a treated nucleic acid sequence according to one of SEQ ID NOS:304 to SEQ ID NO:535 and sequences complementary thereto, wherein the base sequence of said oligonucleotides comprises at least one CpG, TpG or CpA dinucleotide.

in a further preferred embodiment of the method, the blocking oligonucleotides are selected from the group consisting of SEQ ID NOS:2114, 2119, 2124, 2125, 2127, 2132, 2133, 2135, 2137, 2138, 2139, 2140, 2141, 2142, 2143, 2144, 2146, 2147, 2148, 2149, 2150, 2151, 2152, 2153, 2154, 2155, 2156, 2157, 2158, 2159, 2160, 2031, 2082, 2087, 2089, 2094, 2095, 2096, 2097, 2099, 2107, 1980, 2018, 2022, 2023, 2026, 1939, 1966, 1973, 1974, 1975, 1926, 1930, 1931, 1932, 1933, 1934, 1903, 1917, 1921, 1834, 1896, 1805, 1819, 1821, 1823, 1824, 1825, 1826, 1827, 1828, 1829, 1770, 1782, 1785, 1786, 1788, 1789, 1790, 1792, 1795, 1796, 1797, 1798, 1799, 1800, 1748, 1759, 1760, 1761, 1762, 1763, 1764, 1765, 1724, 1741, 1597, 1609, 1610, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1621, 1622, 1623, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1631, 1633, 1634, 1635, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1645, 1646, 1647, 1648, 1649, 1650, 1651, 1652, 1653, 1654, 1655, 1656, 1657, 1658, 1659, 1660, 1661, 1662, 1663, 1668, 1684, 1685, 1686, 1687, 1688, 1689, 1690, 1691, 1692, 1693, 1694, 1695, 1696, 1697, 1698, 1699, 1700, 1701, 1706, 1712, 1713, 1715, 1716, 1717, 1718, 1719, 1571, 1579, 1581, 1584, 1585, 1586, 1587, 1588, 1591, 1592, 1537, 1555, 1556, 1557, 1558, 1559, 1560, 1561, 1562, 1563, 1564, 1565, 1566, 1452, 1455, 1456, 1457, 1458, 1463, 1514, 1515, 1516, 1517, 1518, 1519, 1524, 1525, 1526, 1527, 1528, 1529, 1531, 1532, 1372, 1423, 1424, 1425, 1427, 1432, 1433, 1434, 1435, 1436, 1437, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1343, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1310, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1324, 1325, 1327, 1328, 1330, 1332, 1334, 1337, 1338, 1276, 1290, 1305, 1203, 1228, 1238, 1239, 1240, 1247, 1248, 1255, 1256, 1265, 1268, 1269, 1164, 1171, 1172, 1173, 1174, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189; 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 2725, 2748, 2749, 2750, 2710, 2717, 2718, 2719, 2720, 2721, 2684, 2699, 2703, 2704, 2705, 2706, 2658, 2662, 2679, 2603, 2613, 2617, 2585, 2594, 2595, 2596, 2597, 2598, 2599, 2489, 2497, 2498, 2499, 2500, 2501, 2504, 2505, 2507, 2508, 2310, 2511, 2512, 2513, 2514, 2515, 2519, 2520, 2521, 2522, 2525, 2526, 2527, 2528, 2529, 2530, 2531, 2532, 2534, 2535, 2536, 2537, 2539, 2540, 2541, 2542, 2543, 2544, 2545, 2546, 2547, 2550, 2551, 2552, 2553, 2554, 2558, 2563,, 2564, 2572, 2580, 2581, 2472, 2482, 2484, 2408, 2464, 2465, 2466, 2467, 2468, 2339, 2349, 2367, 2370, 2372, 2373, 2374, 2375, 2376, 2377, 2378, 2379, 2380, 2382, 2386, 2387, 2389, 2393, 2394, 2395, 2396, 2397, 2398, 2402, 2403, 2404, 2327, 2333, 2334, 2335, 2305, 2315, 2318, 2260, 2268, 2270, 2271, 2272, 2273, 2274, 2275, 2276, 2277, 2278, 2279, 2280, 2281, 2282, 2283, 2284, 2285, 2286, 2287, 2288, 2289, 2290, 2291, 2292, 2293, 2294, 2295, 2296, 2297, 2298, 2299, 2300, 2301, 2232, 2245, 2246, 2248, 2249, 2250, 2251, 2252, 2254, 2255, 2256, 2210, 2218, 2219, 2221, 2222, 2223, 2227, 2228, 2202, 2204, 2205, 2206, 2164, 2180, 2183, 2187, 2188, 2189, 2190, 2191, 2192, 2193, 2194, 2195, 2196, 2197 and 2198.
The fragments obtained by means of the amplification can carry a direetly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass specftmeter. W here s aid 1 abels are m ass 1 abels, i t i s p referred t hat the 1 abeled arnplificates have a single positive or negative net charge, allowing for better detectability in the mass spectrometer. The detection may be carried out and visualized by means o4 e.g., matrix assisted laser desorptionlionization mass spectrometry (MALDl) or using electron spray mass vwftmetrv (ESI).
1Vlatrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI TOF) is a very efficient development for the analysis of biomolecules (Karas &
Hilienkamp, Anal Chem.,.
60:2299-301, 1988). An analyte is embedded in a light-absorbing matrix. The matrix isi evaporated by a sb.ort laser pulse thus transporting the analyte molecule into the vapour phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. - Smaller ions reach the detector sooner than bigger ones. MALDI-TOF spectrometry is well suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut & Beck, Current Innovations and F'uture Trends, 1:147-57, 1995). The sensitivity with respect to nucleic acid analysis is approximately 100-times less than for peptides, and decreases disproportionally with increasing fragment size. Moreover, for nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient. 7n MALDI-TOF
spectrometry, the selection of the matrix plays an eminently important role. For desorption of peptides, several very efficient matrixes have been found which produce a very fine erystallisation. There are now several responsive matrixes for DNA, however, the difference in sensitivity between peptides aad nucleic acids has not been reduced. This difference in sensitivity can be reduced, however, by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. For example, phosphorothioate nucleic acids, in which the usual phosphates of the backbone are sabstituted with thiophosphates, can be converted into a charge-neutral DNA using simple alkylation chemistry (Gut & Beck, Nucleic Acids Res. 23: 1367-73, 1995). The coupling of a charge tag to this modified DNA results in an increase in MALDI-TOF
sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities, which makes the detection of unmodifsed substrates conaiderably more difficult.
In the fourth siep of the method, the amplificates obtained during the third step of the method are analysed in order to ascertain the methylation statas of the CpG
dinueleotides prior to the treatmeart.
In embodiments where the amplificates were obtained by means of MSP
amplification, the presence or absence of an ampliftcate is in itself indicative of the methylation state of the CpG positions covered by the primer, according to the base sequences of said primer.

Atnplificates obtained by ineans of both standard and methylation specific PCR
may be ftuther analyzed by means of hybridization-based methods such as, but not limited to, atray technology and probe based technologies as well as by means of teclrniques such as sequeneing and template directed extension.

In one embodiment of the method, the amplificates synthesised in step three are subsequently h ybridized to an a xray or a set o f o ligonucleotides and/or PNA probes. In t his context, the hybridization takes place in the following manuer: the set of probes used during the hybridization is preferably composed of at least 2 oligonucleotides or PNA-oligomers; in the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase; the non-hybridized fragments are subsequently removed; said oligonucleotides contain at least one b ase sequence h aving a 1 ength oÃat 1 east 9 nucleotides which i s reverse complementary or identical to a segment of the base sequences specified in the present Sequence Listing; andd the segment comprises at least one CpG, TpG or CpA dinucleotide.

In a preferred embodiment, said dinucleotide is present in the central third of the oligomer. For example, wherein the oligomer comprises one CpG dinucleotide, said dinucleotide is preferably the fifth to ninth nucleotide from the 5'-end of a 13-mer. One oligonucleotide exists for the analysis of each CpG dinucleotide within the sequence according to SEQ ID NOS:1 to SEQ ID NO:64, and the equivalent positions within SEQ ID
NOS:304 to SEQ ID NO:535. Said oligonucleotides may also be present in the form of peptide nucleic acids. The non-hybridized amplificates are then removed. The hybridmed amplificates are then detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
In yet a fnrther embodiment of the method, the genomic methylation status of the CpG
positions may be ascertained by means of oligonucleotide probes that are bybridised to the bisulfite treated DNA concurrently with the PCR amplification primers (wherein said primers may either be methylation specific or standard).
A particularly prefared embodiment of this method is the use of fluorescence-based Real Time Quantitative PCR (Iieid et al., Genome Res. 6:986-994, 1996; also see United States Patent No. 6,331,393) employing a dual-labeled fluorescent oligonucleotide probe (TaqMan''M
PCR, using an ABI Prism 7700 Sequence Detection System, Perldn Elmer Applied Biosystems, Poster City, California). The TaqManTM PCR reaction employs the use of a nonextendible interrogating o ligonucleotide, c alled a T.aqManTu p robe, w hich, i n p refeaed embodiments, i s-designed to hybridi2e to a GpC-rich sequence located between the forward and reverse amplification primers. The TaqManTm probe ftuther comprises a fluorescent "'reporter moiety"
and a"queneher moiety" covalently bound to linker nioieties (e.g., phosphoramidites) attached to the nucleotides of the TaqMan'rM oligonucleotide. For analysis of methylation within nucleie acids subsequent to bisulfite treatment, it is required that the probe be methylation specific, as descn'bed in United States Patent No. 6,331,393, (hereby incorporated by reference in its entirety) also known as the MethylLightTu assay. Variations on the TasllvianTu detection methodology that are also suitable for use with the described invention include the use of dual-probe technology (LightcyelerT)A) or fluotescent amplification primers (SunriseTm technology).
Both these techniques may be adapted in a manner suitable for use with bisulfite treated DNA, and moreover for methylation analysis within CpG dinucleotides.

A further s uitable m ethod for t he u se o f p robe o ligonucleotides for t he assessment o f methylation by analysis of bisulfite treated nucleic acids In a further preferred embodiment of the method, the,ffth step of the method comprises the use of template-directed oligonucleotide extension, such as MS-SNuPE as described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531,1997.

In yet a further embodiment of the method, the fifth step of the method comprises sequencing and subsequent sequence analysis of the amplificate generated in the third step of the method (Sanger F., et a1., Proc Natl Acad Sci USA 74:5463-5467, 1977).

B est Mode In the most preferred embodiment of the method the genomic nucleic acids are isolated and treated according to the first three steps of the method outlined above, namely:

a) obtaining, from a subject, a biological sample having subject genomic DNA;
b) extracting or otherwise isolating the genomic DNA;

c) treating the genomic DNA of b), or a fragment thereof, with one or more reagents to convert cytosine bases that are unmethylated in the 5-position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms of hybridization properties; and wherein d) amplifying subsequent to treatment in c) is carried out in a methylation specific manner, namely by use of methylation specific primers or blocking oligonucleotides, and further wherein e) detecting of the amplificates is carried out by means of a real-time detection probe, as described above.

Preferably, where the subsequent amplification of d) is carried out by means of meth}tlation specific primers, as descn'bed above, said methylation specific primers comprise a sequence having a length of at least 9 mbcleotides which hybridizes to a treated nucleic acid sequence according to one of SEQ ID NOS:304 to SEQ ID NO:535 and sequences complementary t hereto, wherein t he b ase s equence o f sa id o ligomers comprises a t 1 east o ne CpG dinucleotide.

In a ftnther preferred embodiment of the method, the MSP primers are selected from the group consisting of SEQ ID NOS:2754, 2757, 2759, 2767, 2768, 2772, 2776, 2779, 2784, 2785, 2786, 2789, 2791, 2792, 2794, 2797, 2798, 2801, 2805, 2806, 2809, 2811, 2815, 2817, 2824, 2830, 2832, 2833, 2834, 2838, 2840, 2843, 2846, 2850, 2851, 2853, 2855, 2859, 2866, 2867, 2870, 2871, 2876, 2878, 2881, 2885, 2886, 2892, 2893, 2895, 2896, 2898, 2904, 2912, 2915, 2917, 2919, 2922, 2923, 2929, 2931, 2939, 2941, 2944, 2946, 2948, 2950, 2955, 2956, 2957, 2960, 2962, 2965, 2966, 2967, 2968, 2969, 2971, 2975, 2976, 2977, 2978, 2979, 2980, 2981, 2984, 2988, 2989, 2990, 2992, 2994, 2997, 2999, 3001, 3002, 3004, 3006, 3007, 3008, 3010, 3013, 3014, 3016, 3017, 3018, 3020, 3022, 3025, 2752, 2755, 2760, 2762, 2763, 2764, 2765, 2769, 2771, 2773, 2775, 2777, 2780, 2781, 2782, 2783, 2787, 2788, 2790, 2793, 2795, 2796, 2800, 2802, 2803, 2804, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2821, 2823, 2825, 2827, 2828, 2829, 2831, 2835, 2836, 2837, 2839, 2841, 2842, 2844, 2845, 2847, 2849, 2852, 2854, 2856, 2858, 2860, 2861, 2862, 2863, 2864, 2865, 2868, 2869, 2872, 2873, 2874, 2875, 2877, 2879, 2880, 2882, 2883, 2884, 2887, 2888, 2889, 2890, 2891, 2894, 2897, 2899, 2901, 2902, 2903, 2905, 2907, 2909, 2911, 2914, 2916, 2918, 2920, 2924, 2926, 2927, 2928, 2930, 2932, 2933, 2934, 2935, 2936, 2937, 2938, 2942, 2945, 2947, 2949, 2951, 2953, 2954, 2958, 2959, 2961, 2963, 2970, 2972, 2973, 2974, 2982, 2985, 2987, 2991, 2993, 2995, 2996, 2998, 3000, 3003, 3005, 3011, 3019, 3021, 3023, 3026, 3027, 3028, 3032, 3033, 3036, 3037, 3038, 3039, 3041, 3042, 3043, 3044, 3047, 3048, 3049, 3052, 3055, 3059, 3061, 3064, 3065, 3068, 3069, 3071, 3072, 3075, 3076, 3080, 3083, 3084, 3085, 3086, 3091, 3093, 3096, 3097, 3100, 3104, 3109, 3110, 3113, 3115, 3117, 3118, 3123, 3126, 3127, 3130, 3134, 3135, 3136, 3138, 3139, 3144, 3146, 3147, 3149, 3150, 3155, 3029, 3031, 3034, 3040, 3045, 3050, 3051, 3053, 3054, 3056, 3057, 3060, 3063, 3066, 3073, 3078, 3081, 3088, 3089, 3090, 3092, 3094, 3098, 3101, 3103, 3105, 3107, 3108, 3111, 3114, 3116, 3119, 3121, 3122, 3124, 3128, 3131, 3133, 3137, 3140, 3142, 3145, 3148, 3151, 3152, 3153, 3157, 3159, 3165, 3166, 3167, 3170, 3171, 3172, 3174, 3175, 3176, 3179, 3180, 3181, 3184, 3185, 3186, 3192, 3194, 3198, 3201, 3202, 3203, 3204, 3206, 3209, 3212, 3213, 3215, 3216, 3217, 3218, 3221, 3224, 3226, 3228, 3229, 3230, 3232, 3233, 3234, 3235, 3237, 3238, 3239, 3245, 3247, 3248, 3249, 3160, 3162, 3163, 3164, 3168, 3169, 3173, 3178, 3182, 3183, 3187, 3189, 3190, 3195, 3196, 3197, 3199, 3205, 3207, 3210, 3214, 3219, 3222, 3223, 3225, 3227, 3236, 3240, 3242, 3243, 3244, 3246, 3250, 3252, 3256, 3261, 3264, 3268, 3269, 3270, 3273, 3275, 3279, 3280, 3281, 3282, 3283, 3284, 3285, 3286, 3290, 3292, 3295, 3297, 3301, 3304, 3305, 3306, 3307, 3308, 3310, 3311, 3312, 3315, 3319, 3320, 3324, 3327, 3331, 3333, 3334, 3339, 3348, 3351, 3354, 3358, 3360, 3364, 3367, 3368, 3374, 3376, 3253, 3255, 3257, 3259-, 3260, 3262, 3265, 3266, 3267, 3271, 3274, 3276, 3278, 3287, 3289, 3291, 3293, 3298, 3300, 3302, 3309, 3313, 3314, 3316, 3318, 3321, 3322, 3325, 3328, 3330, 3332, 3335, 3337, 3338, 3340, 3342, 3343, 3344, 3345, 3346, 3347, 3349, 3350, 3352, 3353, 3355, 3356, 3357, 3359, 3361, 3363, 3365, 3369, 3371, 3372, 3373, 3377, 3380, 3383, 3386, 3388, 3389, 3390, 3391, 3392, 3395, 3396, 3400, 3401, 3403, 3406, 3408, 3413, 3414, 3417, 3420, 3423, 3428, 3432, 3433, 3434, 3436, 3439, 3440, 3442, 3443, 3445, 3447, 3453, 3455, 3458, 3463, 3466, 3469, 3470, 3471, 3472, 3473, 3474, 3475, 3477, 3478, 3480, 3481, 3483, 3484, 3487, 3490, 3494, 3495, 3496, 3497, 3499, 3500, 3504, 3505, 3508, 3512, 3514, 3515, 3516, 3521, 3525, 3529, 3533, 3534, 3537, 3538, 3540, 3541, 3542, 3543, 3544, 3547, 3548, 3553, 3557, 3558, 3559, 3560, 3562, 3563, 3566, 3571, 3574, 3575, 3577, 3580, 3583, 3584, 3585, 3586, 3592, 3594, 3595, 3597, 3598, 3599, 3601, 3603, 3604, 3607, 3608, 3612, 3619, 3621, 3622, 3626, 3631, 3632, 3637, 3638, 3639, 3640, 3642, 3643,.
3644, 3646, 3647, 3649, 3650, 3652, 3656, 3657, 3660, 3663, 3668, 3670, 3673, 3676, 3677, 3678, 3683, 3688, 3690, 3694, 3697, 3700, 3702, 3703, 3704, 3708, 3404, 3409, 3411, 3415, 3418, 3419, 3421, 3424, 3426, 3427, 3429, 3431, 3435, 3437, 3438, 3441, 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3459, 3461, 3462, 3464, 3467, 3476, 3479, 3482, 3485, 3488, 3489, 3491, 3492, 3493, 3501, 3503, 3506, 3509, 3510, 3511, 3513, 3517, 3518, 3519, 3520, 3522, 3524, 3526, 3527, 3528, 3530, 3531, 3535, 3536, 3545, 3549, 3551, 3552, 3554, 3555, 3556, 3561, 3564, 3565, 3568, 3569, 3570, 3573, 3576, 3578, 3581, 3587, 3588, 3589, 3590, 3591, 3593, 3596, 3600, 3602, 3605, 3606, 3609, 3611, 3613, 3614, 3615, 3616, 3617, 3618, 3623, 3624, 3625, 3627, 3629, 3630, 3633, 3634, 3635, 3636, 3641, 3645, 3651, 3653, 3654, 3655, 3658, 3661, 3662, 3665, 3666, 3667, 3669, 3671, 3674, 3679, 3681, 3684, 3686, 3689, 3691, 3692, 3693, 3695, 3696, 3698, 3701, 3705, 3706, 3707, 3709, 3710, 3714, 3715, 3717, 3718, 3722, 3723, 3729, 3730, 3732, 3735, 3739, 3740, 3741, 3743, 3744, 3745, 3746, 3749, 3753, 3754, 3755, 3756, 3711, 3713, 3719, 3721, 3724, 3725, 3726, 3727, 3728, 3731, 3733, 3736, 3737, 3738, 3742, 3747, 3748, 3750, 3752, 3757, 3758, 3759, 3760, 3761, 3764, 3767, 3771, 3773, 3775, 3776, 3777, 3781, 3785, 3786, 3787, 3790, 3791, 3793, 3796, 3797, 3798, 3799, 3805, 3809, 3814, 3817, 3818, 3822, 3823, 3828, 3833, 3836, 3844, 3847, 3850, 3851, 3853, 3856, 3857, 3862, 3873, 3876, 3877, 3880, 3885, 3887, 3889, 3890, 3892, 3893, 3895, 3896, 3899, 3902, 3903, 3905, 3906, 3907, 3908, 3916, 3923, 3926, 3927, 3930, 3935, 3936, 3938, 3939, 3940, 3944, 3945, 3949, 3950, 3951, 3954, 3955, 3957, 3960, 3965, 3970, 3971, 3978, 3979, 3982, 3983, 3984, 3985, 3762, 3765, 3768, 3770, 3772, 3774, 3778, 3779, 3780, 3782, 3784, 3788, 3792, 3794, 3800, 3801, 3802, 3803, 3804, 3806, 3807, 3808, 3810, 3812, 3813, 3815, 3819, 3820, 3821, 3824, 3826, 3827, 3829, 3831, 3832, 3834, 383?, 3838, 3839, 3840, 3842, 3845, 3848, 3852, 3854, 3858, 3860, 3861, 3863, 3864, 3865, 3866, 3867, 3868, 3869, 3870, 3871, 3872, 3874, 3875, 3878, 3881, 3883, 3884, 3886, 3888, 3891, 3894, 3897, 3898, 3900, 3901, 3904, 3909, 3911, 3914, 3915, 3917, 3919, 3920, 3921, 3922, 3924, 3928, 3931, 3933, 3934, 3937, 3941, 3942, 3943, 3947, 3948, 3952, 3958, 3959, 3961, 3962, 3963, 3964, 3966, 3968, 3972, 3974, 3975, 3976, 3980, 3981, 3986, 3987, 3990, 3993, 3994, 3997, 4000, 4003, 4004, 4006, 4012, 4015, 4017, 4020, 4024, 4027, 4029, 4031, 4032, 4033;
4037, 4038, 4040, 4042, 4047, 4048, 4050, 4051, 4052, 4054, 4055, 4058, 4063, 4066, 4069, 4070, 4072, 4073, 4076, 4078, 4079, 4082, 4083, 4084, 4085, 4086, 4090, 4093, 4094, 4095, 4096, 4099, 4100, 4104, 4106, 4113, 4116, 4119, 4120, 4124, 4127, 4130, 4134, 4135, 4136, 4138, 4142, 4145, 4146, 4149, 4150, 4152, 4153, 4159, 4160, 4161, 4163, 4168, 4169, 4171, 4173, 4176, 4180, 4181, 4185, 4189, 4191, 4192, 4194, 4197, 4198, 4199, 4201, 4206, 4207, 4208, 4213, 4219, 4220, 4223, 4224, 4225, 4228, 4231, 4232, 4233, 4237, 4238, 4242, 4243, 4246, 4247, 4251, 4254, 4255, 4256, 4258, 3988, 3991, 3995, 3998, 4001, 4005, 4007, 4009, 4010, 4011, 4013, 4016, 4018, 4019, 4021, 4022, 4023, 4025, 4028, 4034, 4035, 4039, 4043, 4045, 4046, 4049, 4056, 4059, 4061, 4064, 4065, 4067, 4068, 4071, 4074, 4075, 4077, 4080, 4087, 4088, 4089, 4092, 4098, 4101, 4102, 4105, 4108, 4109, 4110, 4111, 4112, 4114, 4115, 4117, 4121, 4122, 4123, 4125, 4128, 4129, 4131, 4132, 4133, 4137, 4139, 4141, 4144, 4148, 4151, 4154, 4156, 4157, 4162, 4165, 4166, 4167, 4170, 4172, 4174, 4177, 4179, 4182, 4184, 4186, 4188, 4190, 4195, 4196, 4202, 4204, 4205, 4209, 4211, 4214, 4216, 4217, 4218, 4221, 4226, 4229, 4234, 4236, 4239, 4241, 4244, 4245, 4248, 4249, 4252, 4257, 4259, 4260, 4261, 4262, 4266, 4267, 4268, 4271, 4272, 4275, 4276, 4279, 4281, 4282, 4284, 4285, 4287, 4289, 4290, 4292, 4295, 4297, 4299, 4301, 4306, 4310, 4316, 4317, 4318, 4321, 4323, 4325, 4328, 4334, 4335, 4337, 4341, 4342, 4343, 4344, 4348, 4350, 4351, 4352, 4354, 4357, 4358, 4359, 4364, 4365, 4366, 4370, 4371, 4372, 4373, 4376, 4378, 4381, 4383, 4384, 4386, 4388, 4396, 4397, 4399, 4400, 4403, 4405, 4407, 4409, 4412, 4415, 4416, 4417, 4424, 4426, 4429, 4433, 4435, 4437, 4442, 4443, 4447, 4450, 4451, 4452, 4455, 4457, 4460, 4461, 4462, 4465, 4466, 4469, 4470, 4474, 4478, 4481, 4484, 4488, 4491, 4494, 4495, 4497, 4498, 4504, 4506, 4509, 4510, 4511, 4514, 4516, 4518, 4520, 4521, 4523, 4525, 4528, 4530, 4533, 4534, 4535, 4538, 4540, 4542, 4545, 4547, 4548, 4553, 4554, 4555, 4556, 4557, 4562, 4564, 4567, 4568, 4569, 4579, 4580, 4582, 4584, 4587, 4589, 4593, 4596, 4597, 4598, 4600, 4601, 4602, 4605, 4606, 4607, 4609, 4610, 4613, 4614, 4616, 4618, 4621, 4624, 4626, 4627, 4628, 4631, 4632, 4636, 4639, 4641, 4644, 4645, 4648, 4263, 4265, 4269, 4270, 4273, 4274, 4277, 4280, 4283, 4286, 4288, 4291, 4293, 4296, 4298, 4300, 4302, 4303, 4304, 4305, 4307, 4308, 4309, 4311, 4313, 4315, 4319, 4322, 4324, 4326, 4327, 4330, 4331, 4332, 4333, 4336, 4338, 4340, 4345, 4347, 4349, 4353, 4355, 4360, 4361, 4362, 4367, 4368, 4369, 4374, 4375, 4377, 4379, 4382, 4385, 4387, 4389, 4390, 4391, 4392, 4393, 4394, 4395, 4398, 4401, 4406, 4408, 4410, 4411, 4413, 4418, 4420,.
4422, 4423, 4425, 4427, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4441, 4444, 4446, 4448;
4453, 4454, 4456, 4458, 4463, 4464, 4467, 4471, 4472, 4473, 4475, 4476, 4477, 4479, 4480, 4482, 4485, 4486, 4487, 4489, 4490, 4492, 4496, 4499, 4501, 4502, 4503, 4505, 4507, 4508, 4512, 4515, 4517, 4519, 4522, 4524, 4529, 4531, 4536, 4537, 4539, 4541, 4543, 4546, 4549, 4551, 4558, 4559, 4560, 4561, 4563,4565, 4570, 4571, 4572, 4573, 4574, 4575, 4576, 4578, 4581, 4583, 4585, 4586, 4588, 4590, 4592, 4595, 4599, 4603, 4611, 4612, 4615, 4617, 4619, 4620, 4622, 4630, 4633, 4634, 4635, 4638, 4640, 4642, 4643, 4646, 4647, 4649, 4652, 4655, 4659, 4661, 4663, 4664, 4665, 4668, 4671, 4674, 4675, 4676, 4678, 4680, 4683, 4686, 4690, 4696, 4700, 4703, 4704, 4706, 4709, 4711, 4714, 4715, 4717, 4718, 4719, 4720, 4721, 4726, 4727, 4730, 4732, 4738, 4742, 4745, 4749, 4750, 4753, 4755, 4759, 4763, 4768, 4769, 4772, 4773, 4776, 4778, 4779, 4782, 4784, 4789, 4790, 4794, 4797, 4801, 4805, 4807, 4813, 4814, 4819, 4821, 4822, 4827, 4829, 4833, 4834, 4835, 4837, 4838, 4841, 4842, 4843, 4844, 4847, 4849, 4850, 4852, 4853, 4859, 4860, 4861, 4865, 4867, 4868, 4869, 4870, 4873, 4876, 4877, 3{j 4878, 4879, 4883, 4885, 4889, 4891, 4892, 4894, 4895, 4897, 4898, 4903, 4906, 4911, 4912, 4918, 4919, 4920, 4924, 4927, 4929, 4932, 4934, 4941, 4942, 4945, 4948, 4949, 4950, 4650, 4653, 4656, 4658, 4660, 4662, 4666, 4667, 4669, 4670, 4672, 4677, 4681, 4684, 4685, 4687, 4688, 4689, 4691, 4693, 4694, 4695, 4697, 4699, 4701, 4702, 4705, 4707, 4708, 4716, 4722, 4724, 4728, 4731, 4733, 4735, 4736, 4737, 4739, 4741, 4744, 4746, 4748, 4751, 4754, 4756, 4758, 4760, 4761, 4764, 4766, 4767, 4770, 4771, 4774, 4777, 4780, 4783, 4785, 4786, 4787, 4788, 4791, 4792, 4793, 4795, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4811, 4812, 4815, 4816, 4817, 4818, 4820, 4823, 4824, 4825, 4828, 4830, 4832, 4836, 4839, 4840, 4845, 4846, 4848, 4851, 4854, 4855, 4856, 4857, 4858, 4862, 4864, 4871, 4872, 4874, 4875, 4881, 4882, 4884, 4886, 4887, 4890, 4893, 4896, 4899, 4900, 4901, 4902, 4904, 4905, 4907, 4908, 4909, 4910, 4913, 4915, 4917, 4921, 4922, 4923, 4925, 4926, 4928, 4930, 4935, 4936, 4937, 4938, 4940, 4943, 4944, 4946, 4947, 4951, 4952, 4953, 4954, 4956, 4957, 4960, 4963, 4967, 4970, 4971, 4972, 4976, 4977, 4985, 4986, 4987, 4989, 4991, 4992, 4997, 4999, 5002, 5003, 5004, 5006, 5010, 5013, 5014, 5015, 5017, 5018, 5019, 5020, 5021, 5024, 5025, 5027, 5031, 5032, 5033, 5037, 5040, 5041, 5042, 5043, 4958, 4961, 4964, 4966, 4968, 4969, 4973, 4974, 4975, 4978, 4979, 4980, 4981, 4982, 4983, 4984, 4988, 4990, 4993, 4995, 4996, 4998, 5000, 5005, 5007, 5009, 5011, 5016, 5022, 5026, 5028, 5030, 5034, 5036, 5038, 5039, 5044, 5047, 5049, 5050, 5052, 5054, 5055, 5057, 5060, 5061, 5064, 5045, 5048, 5051, 5053, 5056, 5058, 5062, 5065, 5066, 5069, 5073, 5077, 5080, 5083, 5087, 5093, 5096, 5099, 5100, 5103, 5104, 5106, 5111, 5116, 5119, 5120, 5125, 5128, 5132, 5134, 5135, 5137, 5139, 5140, 5142, 5144, 5148, 5149, 5150, 5155, 5157, 5158, 5160, 5166, 5168, 5170, 5171, 5173, 5176, 5177, 5179, 5184, 5187, 5188, 5190, 5193, 5195, 5198, 5201, 5204, 5208, 5211, 5215, 5216, 5217, 5220, 5221, 5222, 5224, 5226, 5229, 5230, 5231, 5232, 5234, 5237, 5242, 5244, 5245, 5246, 5247, 5249, 5250, 5252, 5254, 5255, 5256, 5261, 5262, 5264, 5265, 5273, 5274, 5276, 5278, 5279, 5281, 5284, 5285, 5286, 5287, 5288, 5289, 5292, 5296, 5300, 5303, 5304, 5307, 5308, 5309, 5313, 5315, 5317, 5318, 5322, 5323, 5326, 5329, 5330, 5333, 5336, 5337, 5341, 5343, 5348, 5349, 5352, 5354, 5355, 5358, 5359, 5361, 5362, 5363, 5364, 5365, 5367, 5369, 5370, 5372, 5375, 5377, 5379, 5382, 5385, 5387, 5393, 5394, 5395, 5398, 5400, 5404, 5407, 5408, 5409, 5412, 5413, 5414, 5416, 5418, 5421, 5424, 5426, 5428, 5431, 5432, 5433, 5434, 5435, 5437, 5440, 5441, 5443, 5448, 5450, 5451, 5454, 5455, 5458, 5460, 5461, 5464, 5468, 5470, 5471, 5474, 5475, 5477, 5482, 5484, 5485, 5487, 5490, 5491, 5492, 5494, 5496, 5498, 5499, 5500, 5501, 5502, 5503, 5504, 5506, 5509, 5510, 5512, 5516, 5517, 5518, 5524, 5525, 5526, 5528, 5531, 5533, 5534, 5535, 5536, 5537, 5540, 5542, 5544, 5545, 5546, 5549, 5550, 5552, 5553, 5559, 5561, 5566, 5569, 5572, 5573, 5575, 5577, 5578, 5579, 5580, 5581, 5582, 5588, 5593, 5595, 5596, 5598, 5600, 5601, 5603, 5604, 5605, 5608, 5614, 5615, 5616, 5619, 5622, 5624, 5625, 5628, 5629, 5633, 5634, 5637, 5638, 5639, 5643, 5644, 5645, 5647, 5648, 5649, 5650, 5654, 5662, 5664, 5067, 5070, 5072, 5074, 5075, 5076, 5078, 5081, 5084, 5086, 5088, 5090, 5091, 5094, 5097, 5101, 5105, 5107, 5109, 5110, 5112, 5114, 5115, 5117, 5121, 5123, 5124, 5126, 5129, 5131, 5136, 5143, 5145, 5147, 5151, 5153, 5156, 5159, 5161, 5162, 5163, 5164, 5165, 5167, 5169, 5172, 5174, 5175, 5180, 5181, 5182, 5183, 5185, 5186, 5189, 5191, 5194, 5196, 5199, 5200, 5202, 5203, 5205, 5207, 5209, 5210, 5212, 5214, 5218, 5219, 5223, 5225, 5227, 5233, 5235, 5238, 5239, 5240, 5241, 5248, 5251, 5253, 5257, 5259, 5260, 5263, 5266, 5268, 5269, 5270, 5271, 5272, 5280, 5282, 5290, 5291, 5293, 5295, 5297, 5299, 5301, 5306, 5310, 5311, 5312, 5314, 5316, 5319, 5321, 5324, 5327, 5331, 5332, 5334, 5338, 5339, 5340, 5342, 5344, 5346, 5347, 5351, 5353, 5356, 5360, 5366, 5368, 5371, 5373, 5376, 5378, 5380, 5383, 5388, 5389, 5391, 5392, 5396, 5399, 5401, 5403, 5405, 5410, 5415, 5417, 5419, 5420, 5422, 5425, 5427, 5429, 5436, 5438, 5442, 5444, 5445, 5446, 5447, 5449, 5452, 5456, 5457, 5459, 5462, 5465, 5466, 5467, 5469, 5472, 5478, 5480, 5481, 5486, 5488, 5493, 5495, 5497, 5505, 5507, 5508, 5511, 5513, 5515, 5519, 5521, 5522, 5527, 5529, 5532, 5538, 5539, 5541, 5543, 5548, 5551, 5554, 5555, 5556, 5557, 5558, 5560, 5562, 5563, 5564, 5565, 5567, 5568, 5570, 5571, 5574, 5576, 5583, 5585, 5586, 5587, 5589, 5591, 5592, 5594, 5597, 5599, 5602, 5606, 5609, 5611, 5612, 5618, 5620, 5623, 5626, 5627, 5630, 5632, 5635, 5640, 5642, 5646, 5651, 5652, 5656, 5657, 5659, 5660, 5661, 5663, 5665, 5667, 5670, 5672, 5673, 5676, 5678, 5679, '.5 5681, 5682, 5683, 5686, 5687, 5688, 5690, 5694, 5697, 5698, 5699, 5700, 5701, 5704, 5708, 5709, 5711, 5713, 5714, 5717, 5721, 5723, 5724, 5727, 5728, 5733, 5734, 5735, 5736, 5739, 5740, 5741, 5742, 5743, 5668, 5671, 5674, 5677, 5680, 5684, 5689, 5691, 5693, 5696, 5702, 5705, 5707, 5710, 5712, 5715, 5718, 5720, 5722, 5725, 5729, 5730, 5731, 5732, 5737, 5744, 5747, 5750, 5753, 5759, 5762, 5763, 5770, 5775, 5777, 5778, 5780, 5782, 5785, 5787, 5791, 5792, 5793, 5794, 5797, 5801, 5803, 5808, 5810, 5812, 5814, 5816, 5817, 5824, 5832, 5833, 5834, 5835, 5838, 5840, 5841, 5844, 5849, 5853, 5854, 5857, 5859, 5860, 5862, 5863, 5865, 5868, 5874, 5882, 5883, 5885, 5887, 5894, 5895, 5896, 5897, 5902, 5904, 5906, 5909, 5912, 5915, 5918, 5919, 5920, 5922, 5923, 5926, 5927, 5928, 5930, 5932, 5933, 5934, 5935, 5939, 5940, 5946, 5947, 5948, 5949, 5952, 5954, 5955, 5956, 5958, 5959, 5961, 5962, 5964, 5965, 5968, 5970, 5971, 5972, 5973, 5977, 5978, 5980, 5983, 5986, 5987, 5992, 5993, 5996, 5997, 6000, 6002, 6003, 6004, 6005, 6006, 6008, 6009, 6010, 6011, 6012, 6013, 6017, 6018, 6019, 6020, 6025, 6027, 6030, 6033, 6035, 6036, 6039, 6041, 6042, 6045, 6049, 6050, 6051, 6055, 6059, 6063, 6064, 6065, 6067, 6070, 6072, 6073, 6075, 6077, 6078, 6081, 5745, 5748, 5751, 5754, 5756, 5758, 5760, 5764, 5766, 5767, 5768, 5769, 5771, 5773, 5774, 5776, 5779, 5781, 5783, 5786, 5788, 5789, 5790, 5795, 5796, 5798, 5800, 5802, 5804, 5806, 5807, 5809, 5811, 5813, 5818, 5820, 5821, 5822, 5823, 5825, 5826, 5827, 5828, 5830, 5831, 5836, 5837, 5839, 5842, 5843, 5845, 5846, 5847, 5848, 5850, 5852, 5855, 5856, 5858, 5861, 5864, 5866, 5867, 5870, 5871, 5872, 5873, 5875, 5876, 5877, 5878, 5879, 5880, 5881, 5884, 5886, 5888, 5889, 5890, 5891, 5892, 5893, 5898, 5899, 5900, 5903, 5905, 5907, 5910, 5913, 5916, 5921, 5924, 5929, 5931, 5936, 5937, 5938, 5942, 5943, 5944, 5945, 5950, 5953, 5957, 5960, 5963, 5966, 5969, 5975, 5976, 5981, 5984, 5988, 5990, 5991, 5994, 5998, 5999, 6001, 6007, 6014, 6015, 6016, 6021, 6023, 6024, 6026, 6028, 6031, 6032, 6034, 6037, 6038, 6040, 6043, 6046, 6048, 6053, 6054, 6056, 6058, 6060, 6062, 6066, 6068, 6074, 6076, 6079, 6083, 6084, 6085, 6089, 6090, 6093, 6096, 6098, 6100, 6106, 6110, 6111, 6114, 6118, 6121, 6127, 6130, 6133, 6135, 6137, 6138, 6141, 6143, 6145, 6148, 6150, 6151, 6152, 6153, 6154, 6156, 6159, 6160, 6162, 6163, 6166, 6167, 6168, 6169, 6170, 6171, 6172, 6175, 6177, 6180, 6183, 6187, 6188, 6190, 6193, 6194, 6195, 6196, 6198, 6201, 6202, 6204, 6207, 6211, 6212, 6214, 6215, 6216, 6218, 6219, 6220, 6222, 6225, 6226, 6230, 6235, 6239, 6241, 6242, 6243, 6244, 6245, 6247, 6250, 5 6252, 6254, 6259, 6260, 6261, 6264, 6265, 6268, 6270, 6273, 6275, 6278, 6280, 6282, 6286, 6287, 6288, 6291, 6293, 6298, 6299, 6300, 6302, 6303, 6305, 6307, 6308, 6312, 6313, 6314, 6315, 6316, 6317, 6318, 6320, 6321, 6323, 6325, 6327, 6328, 6334, 6335, 6337, 6340, 6341, 6344, 6348, 6350, 6353, 6354, 6357, 6360, 6362, 6364, 6368, 6372, 6374, 6377, 6378, 6383, 6386, 6392, 6394, 6398, 6400, 6404, 6405, 6409, 6410, 6411, 6417, 6418, 6424, 6426, 6429, 6431, 6432, 6433, 6435, 6436, 6437, 6438, 6440, 6442, 6445, 6446, 6448, 6449, 6452, 6455, 6457, 6458, 6461, 6462, 6463, 6464, 6465, 6470, 6473, 6475, 6478, 6480, 6481, 6484, 6485, 6486, 6489, 6491, 6492, 6494, 6498, 6502, 6504, 6505, 6507, 6511, 6513, 6514, 6086, 6088, 6091, 6094, 6097, 6099, 6101, 6103, 6105, 6108, 6112, 6115, 6116, 6117, 6119, 6120, 6122, 6123, 6125, 6126, 6128, 6131, 6132, 6134, 6136, 6139, 6142, 6144, 6146, 6149, 6155, 6157, 6161, 6164, 6173, 6174, 6176, 6178, 6181, 6182, 6184, 6186, 6189, 6191, 6192, 6197, 6199, 6200, 6205, 6206, 6208, 6210, 6213, 6221, 6223, 6224, 6227, 6229, 6231, 6232, 6233, 6234, 6236, 6237, 6238, 6240, 6246, 6248, 6251, 6253, 6255, 6256, 6257, 6258, 6262, 6266, 6269, 6271, 6272, 6274, 6276, 6277, 6281, 6283, 6284, 6285, 6289, 6292, 6294, 6295, 6296, 6297, 6301, 6304, 6306, 6309, 6310, 6311, 6319, 6322, 6324, 6326, 6329, 6330, 6331, 6333, 6336, 6338, 6342, 6345, 6347, 6349, 6351, 6355, 6356, 6358, 6359, 6361, 6365, 6367, 6369, 6371, 6373, 6375, 6376, 6379, 6381, 6382, 6384, 6387, 6388, 6389, 6390, 6393, 6395, 6397, 6399, 6401, 6402, 6403, 6406, 6407, 6412, 6413, 6414, 6415, 6416, 6419, 6420, 6421, 6422, 6423, 6425, 6427, 6428, 6434, 6441, 6443, 6444, 6447, 6450, 6451, 6453, 6459, 6460, 6466, 6467, 6468, 6469, 6471, 6472, 6474, 6476, 6479, 6482, 6487, 6490, 6493, 6496, 6497, 6499, 6500, 6501, 6503, 6506, 6508, 6510, 6512, 6515, 6518, 6521, 6522, 6523, 6524, 6528, 6532, 6535, -6539, 6549, 6560, 6561, 6564, 6566, 6567, 6570, 6573, 6576, 6577, 6578, 6579, 6583, 6584, 6585, 6586, 6587, 6590, 6591, 6594, 6596, 6S97, 6603, 6605, 6608, 6609, 6610, 6611, 6612, 6615, 6625, 6630, 6632, 6633, 6634, 6638, 6639, 6642, 6643, 6644, 6647, 6650, 6655, 6657, 6658, 6659, 6661, 6663, 6664, 6665, 6669, 6671, 6674, 6677, 6678, 6679, 6680, 6681, 6682, 6686, 6687, 6688, 6689, 6690, 6691, 6693, 6695, 6696, 6697, 6699, 6701, 6703, 6704, 6705, 6706, 6707, 6708, 6710, 6711, 6712, 6713, 6717, 6718, 6720, 6721, 6722, 6725, 6727, 6732, 6734, 6735, 6739, 6741, 6745, 6748, 6751, 6755, 6759, 6762, 6764, 6767, 6770, 6772, 6773, 6774, 6777, 6778, 6782, 6785, 6786, 6787, 6790, 6791, 6794, 6795, 6796, 6798, 6800, 6802, 6803, 6806, 6811, 6814, 6815, 6818, 6824, 6829, 6834, 6835, 6842, 6516, 6519, 6525, 6526, 6527, 6529, 6531, 6533, 6536, 6537, 6538, 6540, 6541, 6542, 6543, 6544, 6545, 6546, 6547, 6548, 6550, 6551, 6552, 6553, 6554, 6556, 6558, 6562, 6563, 6565, 6568, 6571, 6572, 6575, 6580, 6582, 6588, 6589, 6592, 6595, 6598, 6599, 6600, 6601, 6602, 6604, 6606, 6607, 6613, 6614, 6617, 6618, 6619, 6620, 6621, 6623, 6624, 6627, 6628, 6629, 6631, 6635, 6640, 6641, }
6645, 6646, 6649, 6651, 6652, 6653, 6656, 6660, 6662, 6666, 6668, 6670, 6672, 6675, 6676, 6683, 6685, 6692, 6694, 6698, 6700, 6702, 6709, 6714, 6715, 6716, 6719, 6723, 6726, 6728, 6730, 6731, 6736, 6738, 6740, 6742, 6744, 6746, 6747, 6749, 6752, 6754, 6756, 6757, 6758, 6760, 6761, 6765, 6769, 6775, 6779, 6781, 6783, 6784, 6789, 6792, 6797, 6799, 6801, 6804, 6805, 6807, 6809, 6810, 6812, 6816, 6817, 6819, 6821, 6822, 6825, 6827, 6828, 6830, 6831, 6832, 6833, 6836, 6837, 6838, 6839, 6840, 6841, 6843, Detection. 6517, 6520, 6 530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6844, 6848, 6850, 6852, 6854, 6857, 6859, 6861, 6862, 6865, 6868, 6870, 6871, 6872, 6874, 6875, 6876, 6880, 6883, 6886, 6887, 6888, 6890, 6891, 6894, 6896, 6897, 6898, 6899, 6900, 6901, 6902, 6904, 6905, 6906, 6910, 6912, 6917, 6920, 6845, 6847, 6849, 6851, 6853, 6855, 6858, 6860, 6863, 6866, 6869, 6873, 6877, 6879, 6881, 6882, 6884, 6889, 6892, 6893, 6895, 6907, 6908, 6909, 6911, 6913, 6915, 6916, 6918, 6921, 6924, 6927, 6928, 6933, 6935, 6937, 6939, 6940, 6943, 6946, 6947, 6948, 6949, 6951, 6953, 6954, 6955, 6959, 6961, 6964, 6965, 6968, 6969, 6972, 6973, 6976, 6979, 6980, 6922, 6925, 6929, 6930, 6931, 6932, 6934, 6936, 6942, 6944, 6945, 6950, 6952, 6956, 6957, 6958, 6960, 6962, 6963, 6966, 6967, 6970, 6971, 6974, 6975, 6977, 6981, 6983, 6986, 6992, 6995, 6998, 7002, 7006, 7013, 7017, 7022, 7024, 7027, .
7030, 7032, 7036, 7037, 7040, 7050, 7052, 7055, 7056, 7058, 70S9, 7060, 7064, 7067, 7072, 7074, 7076, 7077, 7084, 7085, 7086, 7087, 7088, 7089, 7090, 7091, 7096, 7097, 7100, 7102, 7109, 7110, 7113, 7114, 7115, 7118, 7121, 7123, 7124, 7131, 7133, 7135, 7136, 7138, 7139, 7140, 7144, 7146, 7148, 7149, 7158, 7159, 7160, 7163, 7165, 7166, 7168, 7172, 7175, 7178, 7180, 7181, 7183, 7185, 7186, 7187, 7192, 7194, 7199, 7202, 7203, 7204, 7205, 7207, 7208, 7213, 7214, 7216, 7220, 7221, 7227, 7228, 7230, 7233, 7235, 7237, 7239, 7243, 7245, 7246, 7248, 7249, 7251, 7255, 7256, 7260, 7263, 7264, 7265, 7266, 7268, 7269, 7272, 7276, 7277, 7278, 7279, 7280, 7281, 7283, 7284, 7287, 7291, 7295, 7299, 7302, 7303, 7306, 7309, 7310, 7311, 7314, 7315, 7320, 7321, 7324, 7325, 7329, 7331, 7332, 7334, 7336, 7339, 7340, 7341, 7344, 7350, 7353, 7355, 7358, 7360, 7362, 7372, 7374, 7375, 7378, 7381, 7385, 7387, 7390, 7391, 7392, 7394, 7397, 7401, 7402, 7405, 7410, 7413, 7415, 7416, 7417, 7420, 6984, 6987, 6989, 6990, 6991, 6993, 6996, 6999, 7001, 7003, 7005, 7007, 7009, 7010, 7011, 7012, 7014, 7016, 7018, 7020, 7023, 7025, 7026, 7028, 7029, 7031, 7033, 7034, 7035, 7038, 7039, 7041, 7042, 7043, 7044, 7045, 7046, 7047, 7048, 7049, 7051, 7053, 7054, 7057, 7061, 7062, 7063, 7065, 7066, 7068, 7070, 7071, 7073, 7075, 7078, 7080, 7081, 7082, 7083, 7092, 7093, 7094, 7095, 7098, 7101, 7103, 7105, 7106, 7107, 7108, 7111, 7112, 7116, 7119, 7122, 7125, 7126, 7127, 7128, 7129, 7130, 7132, 7134, 7137, 7141, 7142, 7143, 7147, 7150, 7152, 7154, 7155, 7156, 7157, 7161, 7167, 7170, 7171, 7173, 7174, 7176, 7177, 7179, 7182, 7184, 7188, 7189, 7190, 7191, 7193, 7195, 7196, 7197, 7198, 7200, 7206, 7210, 7211, 7212, 7215, 7217, 7218, 7219, 7222, 7223, 7224, 7225, 7226, 7229, 7231, 7232, 7236, 7240, 7241, 7242, 7244, 7247, -7250, 7253, 7254, 7257, 7258, 7259, 7261, 7262, 7267, 7270, 7271, 7273, 7274, 7275, 7282, ' 7285, 7289, 7290, 7292, 7293, 7294, 7296, 7297, 7298, 7301, 7304, 7307, 7308, 7312, 7316, 7317, 7318, 7319, 7322, 7326, 7328, 7330, 7333, 7335, 7337, 7342, 7345, 7347, 7348, 7349, 7351, 7354, 7356, 7357, 7359, 7361, 7363, 7364, 7365, 7366, 7367, 7368, 7369, 7370, 7371, 7373, 7376, 7379, 7382, 7383, 7384, 7386, 7388, 7389, 7393, 7395, 7398, 7400, 7403, 7404, 7407, 7408, 7409, 7411, 7419, 7421, 7422, 7425, 7427, 7435, 7438, 7439, 7440, 7442, 7444, 7448, 7449, 7456, 7459, 7462, 7463, 7465, 7466, 7467, 7470, 7471, 7474, 7476, 7477, 7480, 7481, 7485, 7486, 7489, 7490, 7493, 7496, 7500, 7503, 7508, 7512, 7518, 7519, 7520, 7522, 7524, 7525, 7527, 7528, 7529, 7532, 7540, 7542, 7543, 7545, 7549, 7552, 7554, 7423, 7426, 7428, 7430, 7431, 7432, 7433, 7434, 7436, 7445, 7446, 7447, 7450, 7451, 7452, 7453, 7454, 7455, 7457, 7460, 7464, 7468, 7472, 7475, 7478, 7479, 7482, 7483, 7484, 7487, 7488, 7492, 7494, 7495, 7497, 7498, 7499, 7501, 7505, 7506, 7507, 7509, 7510, 7511, 7513, 7515, 7516, 7517, 7521, 7523, 7526, 7530, 7533, 7534, 7535, 7536, 7537, 7538, 7539, 7541, 7544, 7546, 7547, 7548, 7550, 7555, 7558, 7559, 7560, 7565, 7566, 7567, 7570, 7571, 7573, 7574, 7575, 7576, 7577, 7578, 7579, 7580, 7581, 7582, 7585, 7586, 7587, 7588, 7589, 7590, 7596, 7597, 7598, 7600, 7603, 7606, 7609, 7610, 7615, 7618, 7620, 7621, 7623, 7627, 7629, 7633, 7635, 7636, 7643, 7647, 7651, 7655, 7661, 7666, 7672, 7674, 7676, 7677, 7682, 7683, 7685, 7687, 7689, 7690, 7691, 7694, 7699, 7701, 7702, 7704, 7707, 7709, 7711, 7712, 7713, 7714, 7716, 7718, 7720, 7726, 7728, 7729, 7733, 7734, 7735, 7736, 7738, 7740, 7741, 7744, 7746, 7747, 7748, 7749, 7750, 7751, 7752, 7753, 7754, 7755, 7756, 7758, 7556, 7561, 7563, 7568, 7583, 7584, 7591, 7593, 7594, 7595, 7599, 7601, 7604, 7607, 7608, 7611, 7613, 7614, 7616, 7617, 7619, 7622, 7624, 7626, 7628, 7631, 7637, 7638, 7639, 7640, 7641, 7642, 7644, 7645, 7646, 7649, 7650, 7652, 7654, 7656, 7657, 7658, 7659, 7660, 7662, 7663, 7665, 7667, 7669, 7670, 7671, 7673, 7675, 7678, 7679, 7680, 7681, 7684, 7686, 7688, 7692, 7695, 7697, 7698, 7700, 7703, 7705, 7708, 7710, 7715, 7717, 7719, 7721, 7722, 7723, 7724, 7725, 7727, 7730, 7731, 7732, 7737, 7739, 7742, 7743, 7745, 7757, 7759, 7760, 7761, 7764, 7770, 7774, 7775, 7778, 7782, 7786, 7788, 7795, 7797, 7799, 7805, 7807, 7809, 7810, 7811, 7815, 7817, 7819, 7820, 7822, 7823, 7824, 7828, 7832, 7834, 7837, 7839, 7843, 7845, 7851, 7852, 7857, 7860, 7863, 7865, 7868, 7874, 7881, 7885, 7889, 7892, 7894, 7896, 7900, 7902, 7904, 7907, 7909, 7910, 7913, 7917, 7922, 7925, 7926, 7928, 7933, 7934, 7937, 7941, 7945, 7946, 7948, 7950, 7951, 7952, 7953, 7954, 7955, 7956, 7957, 7963, 7964, 7968, 7971, 7972, 7973, 7976, 7979, 7980, 7981, 7982, 7983, 7985, 7986, 7987, 7988, 7991, 7762, 7765, 7767, 7768, 7771, 7773, 7776, 7779, 7781, 7783, 7784, 7785, 7789, 7791, 7792, 7793, 7794, 7796, 7798, 7800, 7802, 7803, 7808, 7812, 7813, 7814, 7816, 7818, 7821, 7825, 7827, 7829, 7830, 7833, 7835, 7836, 7838, 7840, 7841, 7842, 7844, 7846, 7847, 7848, 7849, 7853, 7854, 7855, 7856, 7858, 7861, 7864, 7866, 7869, 7870, 7871, 7872, 7873, 7875, 7877, 7878, 7879, 7880, 7882, 7884, 7886, 7888, 7890, 7897, 7899, 7903, 7905, 7912, 7914, 7916, 7918, 7919, 7920, 7921, 7923, 7929, 7931, 7932, 7936, 7938, 7939, 7940, 7942, 7943, 7944, 7947, 7949, 7958, 7960, 7962, 7965, 7967, 7969, 7970, 7974, 7977, 7989, 7990, 7992, 7995, 7996, 8000, 8003, 8006, 8007, 8010, 8012, 8015, 8016, 8018, 8019, 8026, 8027, 8030, 8034, 8035; 8038, 8039, 8043, 8044, 8046, 8049, 8050, 8052, 8053, 8055, 8056, 8062, 8064, 8066, 8067, 8068, 8069, 8070, 8071, 8074, 8076, 8077, 8078, 8079, 8080, 8081, 7993, 7997, 7999, 8001, 8004, 8005, 8008, 8009, 8011, 8013, 8017, 8020, 8021, 8022, 8023, 8024, 8025, 8028, 8031, 8033, 8036, 8040, 8042, 8047, 8051, 8054, 8057, 8059, 8060, 8061, 8065, 8072, 8073, 8075, 8082, 8083, 8084, 8085, 8087, 8088, 8089, 8090, 8093, 8095, 8098, 8100, 8101, 8102, 8104, 8107, 8110, 8111, 8114, 8115, 8116, 8118, 8122, 8124, 8126, 8127, 8129, 8132, 8134, 8136, 8138, 8142, 8143, 8144, 8146, 8151, 8157, 8160, 8163, 8165, 8168, 8169, 8170, 8173, 8174, 8175, 8176, 8178, 8181, 8185, 8187, 8188, 8189, 8190, 8191, 8193, 8194, 8200, 8203, 8206, 8208, 8209, 8212, 8214, 8216, 8217, 8220, 8222, 8224, 8228, 8230, 8091, 8094, 8096, 8099, 8103, 8105, 8108, 8112, 8113, 8117, 8119, 8121, 8123, 8125, 8128, 8130, 8131, 8133, 8135, 8137, 8139, 8145, 8147, 8148, 8149, 8150, 8152, 8153, 8154, 8155, 8156, 8158, 8161, 8164, 8166, 8167, 8171, 8177, 8179, 8180, 8182, 8183, 8184, 8186, 8192, 8195, 8197, 8198, 8199, 8201, 8202, 8204, 8207, 8210, 8213, 8218, 8221, 8223, 8225, 8227, 8229, 8231, 8232, 8235, 8236, 8237, 8238, 8244, 8245, 8247, 8250, 8251, 8253, 8254, 8255, 8256, 8258, 8259, 8260, 8263, 8267, 8269, 8270, 8273, 8274, 8277, 8280, 8281, 8289, 8292, 8293, 8294, 8295, 8296, 8297, 8298, 8301, 8305, 8306, 8310, 8311, 8312, 8315, 8317, 8318, 8322, 8323, 8324, 8327, 8328, 8329, 8330, 8333, 8336, 8339, 8340, 8347, 8349, 8350, 8352, 8353, 8356, 8359, 8360, 8366, 8369, 8370, 8372, 8374, 8376, 8377, 8379, 8381, 8382, 8383, 8233, 8239, 8240, 8242, 8243, 8246, 8248, 8252, 8257, 8261, 8264, 8266, 8268, 8271, 8275, 8278, 8282, 8284, 8285, 8286, 8287, 8288, 8291, 8299, 8302, 8303, 8304, 8307, 8309, 8313, 8314, 8316, 8319, 8321, 8325, 8326, 8331, 8332, 8334, 8335, 8337, 8341, 8342, 8343, 8344, 8345, 8346, 8348, 8351, 8354, 8357, 8361, 8362, 8363, 8364, 8365, 8367, 8371, 8373, 8375, 8378, 8384, 8387, 8390, 8391, 8397, 8398, 8401, 8402, 8405, 8406, 8409, 8414, 8418, 8419, 8422, 8425, 8428, 8431, 8432, 8433, 8435, 8437, 8440, 8444, 8449, 8452, 8454, 8455, 8457, 8462, 8464, 8466, 8468, 8469, 8472, 8475, 8476, 8478, 8479, 8481, 8484, 8487, 8488, 8490, 8493, 8496, 8497, 8498, 8501, 8505, 8508, 8511, 8513, 8515, 8517, 8518, 8519, 8521, 8522, 8523, 8526, 8528, 8530, 8531, 8532, 8534, 8536, 8541, 8544, 8547, 8551, 8554, 8556, 8558, 8560, 8562, 8563, 8566, 8567, 8568, 8570, 8571, 8574, 8575, 8576, 8577, 8580, 8581, 8585, 8588, 8591, 8594, 8601, 8602, 8603, 8608, 8609, 8613, 8614, 8617, 8618, 8619, 8620, 8623, 8624, 8628, 8629, 8630, 8633, 8634, 8635, 8636, 8638, 8643, 8645, 8648, 8654, 8657, 8658, 8659, 8660, 8661, 8662, 8666, 8670, 8672, 8674, 8676, 8681, 8683, 8686, 8688, 8689, 8691, 8692, 8693, 8695, 8696, 8700, 8701, 8702, 8703, 8704, 8705, 8709, 8716, 8717, 8719, 8722, 8725, 8727, 8728, 8729, 8732, 8733, 8734, 8735, 8736, 8385, 8388, 8392, 8394, 8395, 8399, 8403, 8407, 8410, 8411, 8412, 8413, 8415, 8416, 8420, 8423, 8424, 8426, 8429, 8434, 8436, 8438, 8442, 8445, 8446, 8447, 8448, 8450, 8451, 8456, 8458, 8460, 8461, 8463, 8465, 8467, 8470, 8473, 8474, 8477, 8480, 8482, 8485, 8486, 8489, 8491, 8492, 8494, 8499, 8500, 8502, 8503, 8504, 8506, 8510, 8512, 8514, 8516, 8520, 8524, 8527, 8529, 8533, 8535, 8537, 8539, 8542, 8545, 8546, 8548, 8550, 8552, 8555, 8557, 8564, 8565, 8569, 8572, 8578, 8582, 8583, 8586, 8587, 8589, 8592, 8595, 8596, 8597, 8598, 8599, 8600, 8604, 8606, 8607, 8610, 8612, 8615, 8616, 8621, 8625, 8627, 8631, 8632, 8637, 8639, 8640, 8641, 8642, 8644, 8646, 8647, 8649, 8650, 8651, 8652, 8653, 8655, 8663, 8665, 8667, 8668, 8669, 8671, 8673, 8675, 8677, 8678, 8679, 8680, 8682, 8684, 8685, 8687, 8690, 8694, 8697, 8698, 8699, 8706, 8707, 8708, 8710, 8711, 8712, 8713, 8714, 8715, 8718, 8720, 8723, 8726, 8730, 8737, 8738, 8741, 8744, 8747, 8750, 8751, 8753, 8754, 8755, 8756, 8759, 8760, 8762, 8763, 8766, 8767, 8768, 8769, 8770, 8772, 8775, 8776, 8777, 8779, 8782, 8783, 8784, 8785, 8786, 8787, 8788, 8789, 8790, 8793, 8794, 8796, 8798, 8799, 8801, 8803, 8804, 8806, 8807, 8809, 8812, 8813, 8815, 8820, 8823, 8826, 8829, 8830, 8832, 8835, 8836, 8837, 8842, 8845, 8846, 8847, 8851, 8853, 8856, 8857, 8859, 8861, 8866, 8739, 8878, 8879, 8880, 8884, 8891, 8893, 8895, 8898, 8900, 8901, 8909, 8912, 8739, 8742, 8745, 8748, 8749, 8752, 8757, 8758, 8761, 8764, 8771, 8773, 8778, 8780, 8791, 8797, 8800, 8802, 8805, 8808, 8810, 8814, 8816, 8818, 8819, 8821, 8824, 8827, 8828, 8831, 8833, 8838, 8840, 8841, 8755, 8843, 8844, 8848, 8850, 8852, 8854, 8855, 8863, 8864, 8865, 8867, 8868, 8869, 8870, 8871, 8872, 8873, 8874, 8876, 8877, 8881, 8882, 8883, 8885, 8887, 8888, 8889, 8890, 8892, 8894, 8896, 8897, 8899, 8902, 8785, 8903, 8904, 8905, 8906, 8907, 8908, 8911, 8913, 8917, 8920, 8923, 8924, 8929, 8931, 8934, 8935, 8936, 8914, 8916, 8918, 8921, 8925, 8927, 8928, 8930, 8932, 8933, 8937, 8980, 8984, 8988, 8989, 8998, 9001, 9002, 9005, 9007, 9008, 9012, 9013, 9016, 9019, 9020, 9022, 9023, 9025, 9028, 9029, 9032, 9033, 9034, 9035, 9037, 9038, 9044, 9046, 9047, 9048, 9049, 9054, 8981, 8983, 8985, 8987, 8990, 8992, 8993, 8994, 8995, 8997, 8999, 9003, 9004, 9006, 9009, 9010, 9011, 9014, 9017, 9018, 9021, 9024, 9026, 9030, 9036, 9039, 9041, 9042, 9043, 9045, 9050, 9051, 9052, 9053, 9055, 9058, 9060, 9063, 9066, 9067, 9068, 9069, 9070, 9071, 9074, 9075, 9077, 9078, 9079, 9080, 9082, 9084, 9088, 9089, 9090, 9099, 9103, 9104, 9105, 9107, 9111, 9056, 9061, 9064, 9072, 9081, 9083, 9085, 9086, 9087, 9091, 9092, 9093, 9094, 9095, 9096, 9097, 9098, 9100, 9102, 9106, 9108, 9109, 9110, 9112, 9113, 9116, 9118, 9125, 9126, 9128, 9129, 9130, 9136, 9141, 9143, 9148, 9150, 9153, 9157, 9158, 9159, 9163, 9164, 9165, 9167, 9168, 9171, 9173, 9177, 9180, 9181, 9182, 9183, 9185, 9187, 9188, 9189, 9191, 9192, 9193, 9194, 9197, 9198, 9200, 9206, 9207, 9208, 9209, 9211, 9216, 9218, 9219, 9220, 9221, 9222, 9223, 9226, 9228, 9229, 9230, 9231, 9232, 9233, 9234, 9237, 9238, 9240, 9243, 9246, 9248, 9253, 9256, 9257, 9260, 9263, 9264, 9266, 9269, 9271, 9279, 9280, 9281, 9282, 9283, 9284, 9290, 9114, 9119, 9121, 9122, 9123, 9124, 9127, 9131, 9133, 9134, 9135, 9137, 9138, 9139, 9140, 9142, 9144, 9146, 9147, 9149, 9151, 9152, 9154, 9155, 9156, 9160, 9162, 9166, 9169, 9172, 9174, 9175, 9176, 9178, 9184, 9186, 9190, 9195, 9199, 9201, 9202, 9203, 9204, 9205, 9212, 9214, 9215, 9217, 9224, 9227, 9235, 9239, 9241, 9244, 9247, 9249, 9251, 9252, 9254, 9258, 9261, 9265, 9267, 9270, 9273, 9274, 9275, 9276, 9277, 9278, 9285, 9286, 9287, 9288, 9289, 9291, 9292, 9295, 9297, 9300, 9302, 9303, 9304, 9307, 9308, 9310, 9311, 9313, 9319, 9321, 9323, 9324, 9328, 9333, 9334, 9337, 9338, 9339, 9342, 9344, 9348, 9351, 9352, 9354, 9355, 9357, 9360, 9367, 9371, 9374, 9377, 9379, 9383, 9384, 9385, 9388, 9389, 9390, 9393, 9394, 9398, 9401, 9402, 9406, 9408, 9409, 9410, 9413, 9415, 9416, 9417, 9418, 9419, 9421, 9422, 9425, 9429, 9433, 9434, 9435, 9436, 9437, 9439, 9440, 9446, 9452, 9453, 9454, 9455, 9457, 9458, 9459, 9462, 9466, 9467, 9468, 9470, 9474, 9479, 9482, 9487, 9488, 9489, 9492, 9495, 9497, 9499, 9500, 9504, 9505, 9508, 9513, 9514, 9519, 9522, 9523, 9524, 9526, 9528, 9532, 9533, 9534, 9535, 9537, 9538, 9541, 9542, 9543, 9545, 9546, 9548, 9293, 9296, 9298, 9301, 9305, 9309, 9312, 9314, 9316, 9317, 9318, 9320, 9322, 9325, 9326, 9327, 9329, 9331, 9332, 9335, 9336, 9340, 9345, 9347, 9349, 9353, 9356, 9358, 9361, 9363, 9364, 9365, 9368, 9370, 9372, 9375, 9376, 9378, 9380, 9382, 9386, 9391, 9395, 9397, 9399, 9400, 9403, 9405, 9407, 9411, 9412, 9414, 9420, 9423, 9424, 9426, 9428, 9430, 9431, 9432, 9438, 9441, 9443, 9444, 9445, 9447, 9448, 9449, 9450, 9451, 9456, 9460, 9461, 9464, 9465, 9469, 9471, 9473, 9475, 9477, 9478, 9480, 9483, 9485, 9490, 9493, 9494, 9496, 9498, 9501, 9502, 9503, 9506, 9509, 9511, 9512, 9515, 9516, 9517, 9518, 9520, 9521, 9525, 9527, 9529, 9530, 9536, 9539, 9544, 9547, 9549, 9550, 9551, 9555, 9556, 9557, 9559, 9560, 9563, 9564, 9565, 9566, 9569, 9570, 9573, 9577, 9578, 9579, 9580, 9585, 9586, 9587, 9588, 9591, 9593, 9596, 9552, 9554, 9558, 9561, 9567, 9571, 9574, 9576, 9581, 9583, 9584, 9589, 9592, 9594, 9595, 9598, 9602, 9604, 9605, 9608, 9612, 9613, 9614, 9617, 9618, 9621, 9622, 9625, 9626, 9627, 9632, 9633, 9638, 9640, 9643, 9644, 9645, 9646, 9651, 9654, 9656, 9657, 9658, 9661, 9662, 9665, 9666, 9667, 9668, 9672, 9673, 9675, 9676, 9677, 9680, 9683, 9686, 9688, 9691, 9694, 9698, 9699, 9702, 9705, 9707, 9710, 9711, 9715, 9719, 9720, 9722, 9723, 9726, 9729, 9732, 9733, 9735, 9737, 9738, 9741, 9744, 9745, 9746, 9747, 9748, 9749, 9750, 9754, 9755, 9756, 9758, 9759, 9768, 9771, 9772, 9776, 9777, 9781, 9782, 9784, 9787, 9789, 9790, 9792, 9796, 9797, 9800, 9805, 9806, 9812, 9815, 9818, 9821, 9823, 9825, 9827, 9831, 9832, 9835, 9837, 9839, 9841, 9842, 9844, 9845, 9851, 9853, 9854, 9855, 9857, 9860, 9862, 9863, 9865, 9871, 9873, 9875, 9878, 9879, 9599, 9601, 9603, 9606, 9607, 9609, 9611, 9615, 9619, 9623, 9624, 9628, 9630, 9631, 9634, 9635, 9637, 9639, 9641, 9647, 9649; 9650, 9652, 9653, 9659, 9660, 9663, 9664, 9670, 9671, 9679, 9682, 9684, 9687; 9690, 9692, 9693, 9695, 9697, 9700, 9701, 9703, 9706, 9708, 9712, 9713, 9714, 9716, 9717, 9718, 9721, 9724, 9727, 9730, 9734, 9739, 9742, 9751, 9753, 9757, 9760, 9761, 9762, 9763, 9764, 9765, 9766, 9767, 9769, 9773, 9775, 9778, 9780, 9783, 9786, 9788, 9791, 9793, 9794, 9795, 9798, 9801, 9803, 9804, 9807, 9808, 9809, 9810, 9811, 9813, 9816, 9817, 9819, 9820, 9822, 9826, 9828, 9830;
9833, 9836, 9838, 9840, 9843, 9846, 9847, 9848, 9849, 9850, 9852, 9856, 9858, 9859, 9861, 9864, 9866, 9867, 9868, 9869, 9870, 9872, 9876, 9877, 9880, 9881, 9882, 9886, 9890, 9891, 9894, 9900, 9902, 9904, 9908, 9911, 9912, 9915, 9917, 9919, 9923, 9925, 9928, 9935, 9936, 9940, 9943, 9949, 9953, 9954, 9956, 9957, 9958, 9962, 9963, 9964, 9968, 9969, 9975, 9978, 9981, 9988, 9989, 9990, 9991, 9992, 9995, 9997, 10011, 10012, 10014, 10017, 10018, 10031, 10032, 10033, 10034, 10035, 10037, 10041, 10042, 10046, 10050, 10054, 10058, 10059, 9883, 9885, 9887, 9889, 9892, 9893, 9895, 9896, 9897, 9898, 9899, 9901, 9903, 9905, 9907, 9909, 9913, 9914, 9916, 9918, 9920, 9921, 9922, 9924, 9926, 9929, 9931, 9932, 9933, 9934, 9937, 9938, 9939, 9941, 9942, 9944, 9945, 9946, 9947, 9948, 9950, 9952, 9955, 9959, 9960, 9961, 9966, 9967, 9970, 9972, 9973, 9974, 9976, 9979, 9980, 9982, 9983, 9984, 9985, 9986, 9987, 9993, 9994, 9996, 9998, 9999, 10000, 10001, 10002, 10003, 10004, 10005, 10006, 10007, 10008, 10009, 10010, 10013, 10015, 10016, 10019, 10020, 10021, 10022, 10023, 10025, 10026, 10027, 10028, 10030, 10036, 10038, 10040, 10043, 10044, 10045, 10047, 10048, 10049, 10051, 10053, 10055, 10056, 10057, 10060, 10061, 10064, 10067, 10068, 10070, 10071, 10072, 10074, 10079, 10081, 10083, 10088, 10091, 10095, 10096, 10097, 10101, 10103, 10105, 10106, 10109, 10110, 10111, 10113, 10116, 10118, 10120, 10122, 10125, 10126, 10127, 10131, 10134, 10137, 10138, 10144, 10147, 10149, 10151, 10152, 10155, 10156, ' 10159, 10160, 10169, 10172, 10174, 10175, 10178, 10181, 10186, 10188, 10189, 10190, 10191, 10192, 10196, 10199, 10203, 10204, 10210, 10211, 10216, 10218, 10221, 10224, 10225, 10226, 10229, 10230, 10231, 10232, 10234, 10239, 10241, 10244, 10252, 10253, 10257, 10258, 10259, 10261, 10266, 10272, 10276, 10062, 10065, 10069, 10075, 10077, 10078, 10080, 10082, 10084, 10086, 10087, 10089, 10090, 10092, 10093, 10094, 10098, 10099, 10100, 10102, 10104, 10107, 10112, 10114, 10117, 10119, 10121, 10123, 10124, 10129, 10130, 10132, 10133, 10135, 10139, 10140, 10141, 10142, 10143, 10145, 10148, 10150, 10153, 10154, 10157, 10161, 10163, 10164, 10165, 10166, 10167, 10170, 10173, 10176, 10177, 10179, 10182, 10183, 10184, 10187, 10193, 10194, 10195, 10197, 10198, 10200, 10201, 10202, 10205, 10206, 10207, 10209, 10212, 10213, 10214, 10215, 10219, 10220, 10222, 10223, 10227, 10228, 10233, 10235, 10236, 10237, 10240, 10242, 10243, 10245, 10247, 10248, 10249, 10251, 10254, 10255, 10256, 10260, 10262, 10263, 10264, 10265, 10267, 10268, 10269, 10270, 10271, 10273, 10274, 10275, 10277, 10278, 10279, 10282, 10285, 10287, 10291, 10292, 10297, 10299, 10301, 10304, 10306, 10308, 10310, 10314, 10317, 10318, 10320, 10322, 10327, 10329, 10330, 10333, 10335, 10336, 10337, 10340, 10342, 10348, 10350, 10351, 10354, 10358, 10359, 10360, 10362, 10366, 10369, 10372, 10373, 10374, 10376, 10378, 10383, 10385, 10391, 10398, 10403, 10407, 10410, 10413, 10415, 10419, 10422, 10425, 10427, 10428, 10429, 10430, 10432, 10433, 10434,.
10437, 10438, 10439, 10442, 10443, 10445, 10446, 10447, 10448, 10452, 10453, 10454, 10455, 10456, 10460, 10463, 10466, 10467, 10469, 10470, 10473, 10475, 10477, 10480, 10484, 10488, 10490, 10494, 10495, 10497, 10501, 10502, 10503, 10507, 10508, 10510, 10517, 10518, 10520, 10522, 10524, 10525, 10528, 10529, 10533, 10536, 10537, 10540, 10541, 10545, 10547, 10551, 10553, 10556, 10559, 10560, 10563, 10564, 10565, 10568, 10571, 10574, 10576, 10579, 10581, 10583, 10588, 10589, 10590, 10592, 10593, 10596, 10597, 10601, 10602, 10603, 10605, 10607, 10609, 10610, 10612, 10613, 10617, 10618, 10621, 10624, 10627, 10630, 10632, 10634, 10637, 10638, 10639, 10640, 10641, 10643, 10645, 10647, 10653, 10655, 10657, 10659, 10661, 10662, 10663, 10664, 10665, 10666, 10667, 10668, 10669, 10672, 10673, 10674, 10675, 10280, 10283, 10286, 10288, 10290, 10293, 10295, 10298, 10300, 10302, 10305, 10307, 10309, 10311, 10312, 10313, 10315, 10319, 10321, 10323, 10325, 10326, 10328, 10331, 10338, 10341, 10343, 10344, 10345, 10346, 10347, 10349, 10352, 10355, 10356, 10357, 10361, 10363, 10365, 10367, 10370, 10375, 10377, 10379, 10380, 10381, 10382, 10384, 10386, 10387, 10388, 10390, 10392, -10394, 10395, 10399, 10401, 10402, 10404, 10406, 10408, 10411, 10412, 10414, 10416, 10417, 10418, 10420, 10423, 10426, 10431, 10435, 10440, 10444, 10449, 10451, 10457, 10459, 10461, 10462, 10464, 10465, 10468, 10471, 10476, 10478, 10481, 10483, 10485, 10487, 10489, 10491, 10492, 10493, 10498, 10499, 10500, 10504, 10506, 10509, 10511, 10513, 10514, 10515, 10516, 10519, 10521, 10523, 10526, 10530, 10531, 10532, 10534, 10535, 10538, 10539, 10542, 10543, 10544, 10546, 10548, 10550, 10552, 10554, 10557, 10558, 10561, 10566, 10569, 10572, 10573, 10577, 10578, 10580, 10582, 10584, 10586, 10594, 10598, 10600, 10604, 10606, 10611, 10614, 10616, 10619, 10622, 10625, 10626, 10628, 10631, 10633, 10635, 10642, 10644, 10646, 10648, 10649, 10650, 10651, 10652, 10654, 10656, 10658, 10660, 10670, 10671, 10676, 10678, 10684, 10679, 10681, 10682, 10683, 10685, 10687, 10688, 10689, 10690, 10691, 10693, 10696, 10699, 10703, 10704, 10709, 10711, 10712, 10713, 10720, 10721, 10722, 10724, 10725, 10726, 10728, 10729, 10734, 10740, 10742, 10743, 10744, 10745, 10746, 10748, 10749, 10751, 10754, 10758, 10759, 10760, 10764, 10768, 10769, 10772, 10775, 10780, 10781, 10783, 10786, 10791, 10796, 10801, 10808; 10817, 10818, 10819, 10821, 10823, 10826, 10827, 10829, 10830, 10834, 10843, 10844, 10847, 10848, 10849, 10853, 10856, 10858, 10866, 10869, 10872;
10874, 10877, 10878, 10879, 10882, 10884, 10885, 10889, 10892, 10893, 10896, 10900;
10901, 10903, 10905, 10907, 10909, 10910, 10911, 10914, 10916, 10919, 10926;
10930, 10932, 10933, 10934, 10938, 10941, 10942, 10943, 10944, 10946, 10947, 10953, 10955, 10956, 10958, 10959, 10962, 10967, 10968, 10972, 10975, 10977, 10978, 10981, 10984, 10985, 10988, 10992, 10995, 10997, 10999, 11000, 11001, 11006, 11009, 11013, 11016, 11020, 11025, 11033, 11036, 11040, 11041, 11042, 11043, 11045, 11046, 11048, 11052, 11055, 11060, 11061, 11062, 11064, 11065, 11067, 11070, 11071, 11072, 11078, 11079, 11081, 11085, 11093, 10694, 10697, 10700, 10702, 10705, 10707, 10710, 10714, 10716, 10717, 10718, 10719, 10723, 10727, 10730, 10732, 10733, 10735, 10737, 10738, 10739, 10741, 10747, 10750, 10752, 10755, 10757, 10761, 10762, 10763, 10765, 10767, 10770, 10773, 10776, 10778, 10779, 10782, 10784, 10788, 10789, 10790, 10792, 10793, 10794, 10798, 10799, 10800, 10802, 10804, 10805, 10806, 10807, 10809, 10811, 10812, 10813, 10814, 10815, 10816, 10820, 10822, 10824, 10831, 10833, 10835, 10837, 10838, 10839, 10840, 10841, 10842, 10845, 10846, 10850, 10851, 10854, 10857, 10859, 10860, 10861, 10862, 10863, 10864, 10865, 10868, 10870, 10871, 10873, 10875, 10880, 10881, 10883, 10886, 10888, 10890, 10894, 10897, 10899, 10902, 10904, 10906, 10908, 10912, 10915, 10917, 10920, 10922, 10924, 10925, 10927, 10928, 10929, 10931, 10935, 10937, 10939, 10945, 10948, 10950, 10951, 10952, 10954, 10957, 10960, 10963, 10965, 10966, 10969, 10970, 10971, 10973, 10976, 10979, 10980, 10982, 10986, 10987, 10989, 10991, 10993, 10996, 10998, 11002, 11004, 11005, 11007, 11010, 11012, 11014, 11015, 11017, 11019, 11021, 11022, 11023, 11026, 11027, 11028, 11029, 11030, 11031, 11032, 11034, 11037, 11039, 11044, 11047, 11049, 11050, 11051, 11053, 11054, 11056, 11058, 11059, 11063, 11066, 11068, 11069, 11073, 11074, 11075, 11076, 11077, 11080, 11082, 11083, 11084, 11086, 11087, 11088, 11089, 11090, 11091, 11092, 11094, 11376, 11381, 11382, 11383, 11384, 11387, 11397, 11401, 11405, 11408, 11414, 11418, 11421, 11422, 11424, 11427, 11429, 11430, 11377, 11379, 11380, 11385, 11386, 11388, 11390, 11391, 11392, 11394, 11395, 11396, 11398, 11399, 11400, 11402, 11403, 11404, 11406, 11409, 11410, 11411, 11412, 11415, 11416, 11417, 11419, 11423, 11425, 11428, 11431, 11432, 11433, 11434, 11438, 11442, 11443, 11447, 11449, 11450, 11452, 11456, 11459, 11463, 11464, 11467, 11468, 11472, 11477, 11480, 11481, 11482, 11483, 11484, 11488, 11489, 11493, 11498, 11502, 11504, 11505, 11506, 11507, 11508, 11509, 11512, 11513, 11514, 11517, 11520, 11522, 11523, 11524, 11526, 11528, 11532, 11534, 11435, 11439, 11444, 11445, 11446, 11448, 11451, 11453, 11457, 11458, 11460, 11461, 11462, 11465, 11466, 11469, 11473, 11474, 11475, 11476, 11478, 11479, 11485, 11486, 11487, 11490, 11494, 11497, 11499, 11500, 11501, 11503, 11510, 11511, 11515, 11518, 11519, 11521, 11525, 11527, 11529, 11535, 11539, 11540, 11541, 11548, 11550, 11551, 11552, 11555, 11556, 11557, 11560, 11561, 11562, 11568, 11569, 11571, 11572, 11573, 11577, 11536, 11542, 11545, 11546, 11547, 11549, 11553, 11554, 11563, 11566, 11570, 11574, 11578, 11585, 11586, 11590, 11591, 11592, 11595, 11596, 11597, 11600, 11579, 11582, 11587, 11593, 11594, 11598, 11601, 11602, 11606, 11607, 11608, 11609, 11616, 11618, 11622, 11626, 11628, 11632, 11633, 11603, 11610, 11613, 11614, 11615, 11617, 11619, 11623, 11627, 11629, 11634, 11635, 11640, 11641, 11642, 11643, 11647, 11648, 11654, 11655, 11656, 11657, 11658, 11636, 11639, 11644, 11645, 11646, 11649, 11652, 11653, 11659, 11663, 11664, 11665, 11666, 11670, 11671, 11672, 11673, 11677, 11681, 11687, 11690, 11694, 11696, 11697, 11701, 11705, 11709, 11713, 11719, 11723, 11729, 11733, 11739, 11744, 11745, 11748, 11749, 11751, 11755, 11759, 11763, 11770, 11772, 11774, 11776, 11778, 11782, 11785, 11660, 11667, 11674, 11675, 11676, 11678, 11682, 11685, 11686, 11688, 11689, 11691, 11692, 11693, 11695, 11698, 11699, 11700, 11702, 11706, 11710, 11716, 11720, 11724, 11725, 11727, 11728, 11730, 11731, 11732, 11734, 11735, 11736, 11737, 11738, 11740, 11743, 11746, 11747, 11750, 11752, 11756, 11761, 11762, 11764, 11765, 11767, 11768, 11769, 11773, 11775, 11777, 11779, 11783, 11784, 11786, 11790, 11791, 11792, 11787, 11793, 11796, 11800, 11802, 11803, 11805, 11810, 11818, 11819, 11823, 11824, 11827, 11828, 11829, 11833, 11836, 11837, 11839, 11840, 11847, 11850, 11852, 11857, 11860, 11864, 11866, 11797, 11801, 11804, 11806, 11809, 11811, 11814, 11815, 11817, 11820, 11825, 11830, 11835, 11841, 11844, 11845, 11846, 11848, 11851, 11853, 11856, 11858, 11861, 11862, 11863, 11865, 11867, 11871, 11876, 11878, 11882, 11888, 11891, 11894, 11868, 11872, 11875, 11877, 11879, 11883, 11886, 11887, 11889, 11890, 11892, 11893, 11895, 11898, 11902, 11903, 11904, 11908, 11909, 11911, 11912, 11913, 11914, 11915, ' 11917, 11918, 11922, 11926, 11927, 11930, 11932, 11933, 11937, 11941, 11942, 11946, 11947, 11948, 11949, 11950, 11951, 11952, 11955, 11959, 11968, 11972, 11976, 11978, 11979, 11980, 11981, 11986, 11988, 11989, 11991, 11992, 11995, 11997, 11998, 12001, 12002, 12004, 12005, 11899, 11905, 11910, 11916, 11919, 11923, 11924, 11925, 11928, 11929, 11931, 11934, 11938, 11943, 11953, 11954, 11956, 11960, 11963, 11964, 11967, 11969, 11973, 11977, 11982, 11985, 11987, 11990, 11993, 11994, 11996, 11999, 12000, 12003, 12006, 12011, 12015, 12016, 12017, 12021, 12022, 12023, 12024, 12025, 12026, 12027, 12031, 12034, 12042, 12043, 12045, 12049, 12050, 12051, 12054, 12062, 12063, 12064, 12066, 12067, 12068, 12070, 12072, 12076, 12082, 12085, 12086, 12089, 12090, 12093, 12094, 12095, 12096, 12097, 12098, 12101, 12103, 12107, 12108, 12111, 12112, 12114, 12118, 12119, 12120, 12128, 12007, 12010, 12012, 12020, 12028, 12032, 12033, 12035, 12038, 12039, 12044, 12046, 12052, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12065, 12069, 12071, 12073, 12077, 12080, 12081, 12084, 12087, 12088, 12091, 12099, 12100, 12102, 12104, 12109, 12110, 12113, 12115, 12121, 12122, 12123, 12124, 12125, 12127, 12129, 12130, 12135, 12136, 12141, 12144, 12147, 12148, 12149, 12153, 12159, 12160, 12131, 12134, 12137, 12138, 12139, 12140, 12142, 12143, 12145, 12146, 12150, 12154, 12157, 12158, 12161, 12162, 12163, 12164, 12168, 12171, 12176, 12181, 12187, 12190, 12194, 12196, 12197, 12199, 12201, 12202, 12209, 12213, 12216, 12220, 12221, 12223, 12225, 12226, 12231, 12233, 12239, 12243, 12244, 12250, 12254, 12256, 12257, 12259, 12266, 12270, 12271, 12272, 12274, 12276, 12277, 12278, 12280, 12284, 12285, 12288, 12289, 12290, 12291, 12295, 12296, 12302, 12308, 12313, 12317, 12321, 12322, 12323, 12324, 12325, 12327, 12328, 12330, 12331, 12332, 12336, 12337, 12339, 12343, 12346, 12349, 12353, 12354, 12355, 12359, 12361, 12363, 12367, 12369, 12370, 12372, 12376, 12377, 12379, 12380, 12381, 12382, 12383, 12385, 12389, 12393, 12398, 12400, 12402, 12403, 12406, 12408, 12409, 12410, 12412, 12415, 12417, 12419, 12422, 12424, 12429, 12430, 12432, 12433, 12435, 12436, 12437, 12441, 12445, 12448, 12449, 12454, 12458, 12459, 12460, 12165, 12169, 12170, 12172, 12175, 12177, 12180, 12182, 12185, 12186,12188, 12191, 12195, 12198, 12200, 12203, 12206, 12207, 12208, 12210, 12214, 12217, 12222, 12224, 12227, 12228, 12229, 12230, 12232, 12234, 12237, 12238, 12240, 12241, 12242, 12245, 12248, 12249, 12251, 12255, 12258, 12260, 12262, 12263, 12264, 12265, 12267, 12268, 12269, 12273, 12279, 12281, 12286, 12287, 12292, 12297, 12300, 12303, 12306, 12307, 12309, 12312, 12314, 12318, 12326, 12333, 12338, 12340, 12341, 12342, 12345, 12347, 12348, 12352, 12356, 12360, 12362, 12364, 12371, 12373, 12378, 12386, 12390, 12394, 12397, 12401, 12404, 12405, 12411, 12413, 12418, 12420, 12423, 12425, 12428, 12438, 12439, 12440, 12442, 12443, 12446, 12450, 12453, 12455, 12461, 12465, 12467, 12468, 12472, 12474, 12477, 12480, 12484, 12486, 12488, 12489, 12490, 12493, 12495, 12499, 12501, 12504, 12506, 12462, 12469, 12475, 12478,' 12481, 12483, 12485, 12487, 12492, 12494, 12496, 12497, 12498, 12500, 12502, 12505, 12507, 12511, 12517, 12520, 12522, 12523, 12524, 12528, 12530, 12534, 12535, 12536, 12537, 12541, 12542, 12547, 12550, 12551, 12552, 12554, 12555, 12560, 12564, 12565, 12569, 12571, 12574, 12579, 12581, 12586, 12590, 12592, 12593, 12594, 12596, 12600, 12601, 12602, 12604, 12610, 12613, 12614, 12615, 12616, 12620, 12626, 12630, 12508, 12512, '~SO~i 'ZSOEI 'ISOEI '6V0~I '8b0~I *0~T '~b0~I Zti0~T '0V0~I 'L~0~i 'fa~I
'~~0~I
'ZEOEI '0~0~I '6Z0~I 'SZO~I '6I0~I 'LIO~t '~TO~i '600~t '900~I 'Z00~I '000~I
'866ZI
'L66ZI '966ZI 'L86ZI '~86ZT 'IOOEI '666ZI 'S66Zi '~66ZI 4Z66ZI T66ZI '686ZT
'986ZI
'Z86ZI '186ZI '8L6ZT '9L6ZI 'bL6ZI '~L6ZI 'ZL6Zi 'IL6ZI '0L6ZI '896ZI 'L96ZI
'996ZI
'Z96ZI 'LL6ZI 'SL6ZI '696Zi '596ZI 'i96ZI '096ZI 'SS6ZI 'LS6ZI 't+96Zi '06ZT
'~66Zi SZ
'6~6ZI 'LE6ZI '9~6ZI '~~6ZI '6Z6ZI 'LZ6ZI 'VZ6ZI '816ZI 'LI6ZI 'bI6ZI 'ZI6Zi 'II6Zl 606ZI '806ZI 'tr06ZI 'Z06ZT 'I06ZI '006ZI '568ZT 'b68ZT '~68Z1 '168Zi '888ZI
'L88ZT
'988ZI '~88ZI 'Z88ZI '6LSZi '8L8ZI 'LLSZI '9LSZI '~LSZI 'ILSZI '698ZI '~98ZI
'I98ZI
'SS8Zt 'SSSZI 'IS8ZI '9MI '6S6ZI '~S6ZI '156ZI 'OS6ZI 'Sb6ZT 'StaT 'Zb6ZI
'8~6ZI
'Z~6ZI '8Z6ZT '~Z6ZI 'TZ6ZI '0Z6ZI '6I6ZI '~T6ZI '016Z1 'L06ZI '~06Zi '668ZT
'868Zi OZ
'968Zi 'Z68ZI '068ZI '688ZI '08Zi '088Zi 'TSSZI '088ZI 'ZL8ZI '0L8ZI '898ZI
L98Zi '998ZT 'Z98Zt 'LSSZI '1~S8ZI '0S8ZI '08ZI 'SbBZi '1Mi '~"ZI 'MZI '8~SZI '9~8Z1 'S~8ZT Z~SZI 'LZ8ZI '9Z8ZI 'trZBZI '~Z8ZI 'IZSZT 'SI8ZI 'VI8ZT 'ZTSZI '608ZI
'S08ZI
'IOSZI '66LZT '86LZI '56LZI 'V61,Z1 '~6LZi '06LZT '68LZI '98LZI 'Z8LZT 'SLLZT
'SLLZI
'ZLLZi 'OLLZI '69LZI 'S9LZT 'Z9LZI 'I9LZt '09LZi '85LZI '9SLZI 'SSLZI 'trSLZl '~SLZI SI
'TSLZI 'OSLZI '6fLZI '9i?,LZi 'ObLZI 'L~LZI '9~LZi '~~LZI T~LZI 'OELZI '6ZLZI
'9ZLZI
IZLZI 'LILZI '~ILZI 'ZILZI '90LZI 'bOLZT 'ZOLZI '969ZI 't,69ZI '~69ZI '069ZI
'689ZI
'889ZI 'L89ZT '989ZI 9189Z1 '~89ZI 'Z89Zi 'I89ZI '6L9ZI '8L9ZI '~L9ZI 'IL9Zi 'L99ZI
'09ZI '~99ZI 'Z99ZI 'I99ZI 'SS9Zi 'SS9ZI '~S9ZI '09ZI 'tt9ZT IMi '01~9ZT
'S~9ZI
'Z~9Zi 'ZV8ZI 'It~BZl '6~8Z1 'L~SZI 'V~8ZI '~~SZI 'T~SZi '8Z8ZI 'SZSZI 'ZZBZI
'LiBZi 01 '9i8Z1 'Si8Zi '~IBZI 808ZI 'tOSZI '008ZI 'L6LZI '96LZI 'Z6LZI '16LZI '88LZI
'LBLZt 'SSLZI 'iBLZI 'L,LLZI '9LLZI 'ILLZI '89LZI 'L9LZi '99LZI 'V9LZI '~9LZi 'LSLZI
'ZSLZI
'BVLZI 'LbLZt 'StrLZT 'tVLZI '~tLZI '6~LZI '8~LZI 'Z~LZI 8ZLZI 'SZLZI 'bZLZT
'OZLZI
'61LZI 'SILZI '91LZI 'SILZI 'tiiLZI 'OiLZi '60LZI 'SOLZI ~OLZI 'I0LZ1 'OOLZI
'669ZI
'569ZI 'Z69ZT 'I69Zi '989ZI '089ZI 'LL9Zi 'SL9ZI 'Zl.9Zi '0L9ZI '999ZI 'MZi '099ZI S
'bS9ZI 'ZS9ZI '8tr9Zi 'Lt9ZI '~MI '6~9ZI '8~9Zi 'L~9ZI '9~9ZI 'T~9Zi 'LZ9ZI
'SZ9Zi 'bZ9ZI 'IZ9ZI '819ZI 'LI92i 4II9Zi '609Zi '809ZI 'S09ZI '~09Zi '66SZI 'L6SZt 'S68Zi 'LBSZI '58SZI 'ZSSZI '84SZI 'SLSZI '~LSZI 'ZLSZI 'OLSZI '99SZi '19SZi '6SSZI
'9SSZI
'~SSZI '6b5Zi 'Bt+SZl '9$,SZi '~6SZI '8~SZI 'T~SZI '6ZSZI 'SZSZI 'TZSZT 'BiSZi 'SISZI

~Z-ZT-SOOZ ~588ZSZ0 Fi'J

13057, 13062, 13064, 13065, 13066, 13067, 13072, 13073, 13076, 13078, 13082, 13083, 13085, 13087, 13088, 13089, 13092, 13096, 13100, 13101, 13102, 13105, 13108, 13109, 13110, 13114, 13117, 13118, 13124, 13129, 13131, 13132, 13138, 13144, 13146, 13147, 13148, 13152, 13156, 13159, 13164, 13167, 13168, 13170, 13171, 13172, 13173, 13174, 13184, 13185, 13006, 13010, 13014, 13018, 13020, 13021, 13022, 13023, 13024, 13026, 13031, 13035, 13036, 13038, 13039, 13041, 13045, 13050, 13054, 13058, 13061, 13063, 13068, 13069, 13070, 13071, 13074, 13075, 13077, 13079, 13084, 13086, 13090, 13091, 13093, 13097, 13104, 13107, 13111, 13115, 13119, 13121, 13122, 13123, 13125, 13126, 13127, 13128, 13130, 13133, 13137, 13139, 13142, 13143, 13145, 13149, 13153, 13157, 13158, 13160, 13163, 13165, 13166, 13169, 13175, 13176, 13177, 13178, 13179, 13180, 13181, 13182, 13183, 13186, 13189, 13190, 13191, 13195, 13196, 13197, 13199, 13200, 13204, 13206, 13192, 13198, 13201, 13207, 13212, 13213, 13226, 13228, 13231, 13235, 13240, 13245, 13247, 13248, 13250, 13254, 13256, 13258, 13264, 13265, 13268, 13269, 13273, 13274, 13277, 13279, 13280, 13281, 13286, 13208, 13211, 13214, 13217, 13220, 13222, 13224, 13225, 13227, 13229, 13232, 13233, 13234, 13237, 13239, 13241, 13242, 13244, 13246, 13249, 13251, 13255, 13257, 13259, 13262, 13263, 13266, 13267, 13270, 13275, 13276, 13282, 13285, 13641, 13645, 13646, 13649, 13650, 13652, 13653, 13654, 13655, 13658, 13659, 13642, 13647, 13648, 13656, 13660, 13661, 13664, 13669, 13670, 13671, 13672, 13673, 13675, 13676, 13677, 13681, 13683, 13685, 13687, 13689, 13691, 13693, 13696, 13665, 13668, 13674, 13678, 13682, 13684, 13686, 13688, 13690, 13692, 13694, 13695, 13697, 13701, 13702, 13703, 13709, 13713, 13714, 13715, 13719, 13721, 13722, 13726, 13728, 13732, 13735, 13740, 13698, 13704, 13705, 13706, 13707, 13708, 13710, 13716, 13717, 13718, 13720, 13723, 13724, 13725, 13727, 13729, 13733, 13734, 13736, 13739, 13741, 13744, 13745, 13749, 13751, 13752, 13753, 13754, 13758, 13762, 13765, 13766, 13768, 13772, 13773, 13774, 13777, 13778, 13779, 13783, 13785, 13790, 13791, 13797, 13802, 13803, 13805, 13806, 13807, 13809, 13812, 13814, 13816, 13817, 13818, 13819, 13820, 13823, 13824, 13826, 13828, 13746, 13755, 13759, 13763, 13764, 13767, 13769, 13775, 13776, 13780, 13784, 13786, 13788, 13789, 13792, 13795, 13796, 13798, 13800, 13804, 13808, 13813, 13815, 13821, 13822, 13829, 13832, 13837, 13841, 13844, 13845, 13846, 13849, 13854, 13855, 13856, 13857, 13861, 13865, 13869, 13871, 13875, 1387% 13880, 13833, 13836, 13838, 13843, 13847, 13850, 13853, 13858, 13862, 13866, 13870, 13872, 13876, 13881, 13882, 13883, 13889, 13894, 13902, 13903, 13910, 13911, 13914, 13915, 13916, 13928, 13929, 13930, 13931, 13935, 13936, 13937, 13944, 13947, 13948, 13950, 13960, 13961, 13962, 13964, 13965, 13966, 13968, 13970, 13971, 13972, 13976, 13978, 13884, 13887, 13890, 13893, 13895, 13898, 13900, 13904, 13905, 13906, 13907, 13908, 13909, 13912, 13913, 13917, 13920, 13921, 13922, 13923, 13924, 13925, 13926, 13932, 13938, 13941, 13942, 13943, 13945, 13946, 13949, 13953, 13954, 13956, 13957, 13958, 13959, 13963, 13967, 13969, 13974, 13975, 13977, 13980, 13981, 13988, 13989, 13990, 13992, 13994,13995, 13999, 13982, 13985, 13986, 13987, 13991, 13993, 13996, 14000, 14001, 14002, 14003, 14004, 14009, 14014, 14017, 14020, 14024, 14026, 14029, 14035, 14036, 14040, 14043, 14045, 14051, 14057, 14058, 14059, 14063, 14065, 14066, 14067, 14068, 14069, 14070, 14071, 14073, 14074, 14078, 14079, 14080, 14081, 14082, 14083, 14084, 14085, 14087, 14094, 14095, 14100, 14108, 14109, 14113, 14114, 14118, 14120, 14121, 14122, 14130, 14133, 14138, 14141, 14142, 14143, 14147, 14005, 14008, 14010, 14013, 14015, 14018, 14021, 14025, 14027, 14028, 14030, 14033, 14034, 14037, 14038, 14039, 14041, 14042, 14044, 14046, 14049, 14050, 14052, 14055, .
14056, 14060, 14064, 14072, 14077, 14086, 14088, 14089, 14090, 14091, 14092, 14093, 14096, 14097, 14098, 14099, 14101, 14102, 14103, 14104, 14105, 14106, 14107, 14110, 14115, 14123, 14126, 14127, 14132, 14134, 14135, 14136, 14137, 14139, 14140, 14144, 14145, 14148, 14151, 14155, 14157, 14161, 14166, 14171, 14175, 14183, 14187, 14190, 14192, 14194, 14195, 14196, 14200, 14201, 14152, 14156, 14158, 14162, 14165, 14167, 14170, 14172, 14176, 14179, 14180, 14182, 14184, 14185, 14186, 14188, 14189, 14191, 14193, 14197, 14198, 14199, 14202, 14203, 14204, 14210, 14211, 14216, 14217, 14223, 14226, 14228, 14229, 14230, 14233, 14235, 14239, 14241, 14243, 14244, 14250, 14254, 14255, 14256, 14257, 14260, 14261, 14262, 14267, 14268, 14269, 14273, 14274, 14277, 14281, 14284, 14286, 14289, 14292, 14293, 14297, 14299, 14301, 14304, 14305, 14306, 14312, 14316, 14320, 14322, 14324, 14328, 14329, 14331, 14337, 14342, 14344, 14346, 14347, 14349, 14350, 14353, 14356, 14361, 14363, 14364, 14365, 14366, 14205, 14208, 14212, 14215, 14218, 14221, 14224, 14225, 14227, 14231, 14236, 14240, 14242, 14245, 14246, 14247, 14251, 14263, 14266, 14270, 14278, 14282, 14283, 14285, 14287, 14290, 14291, 14294, 14298, 14300, 14302, 14303, 14307, 14310, 14313, 14317, 14323, 14325, 14327, 14330, 14334, 14338, 14340, 14341, 14345, 14348, 14351, 14352, 14354, 14355, 14357, 14358, 14359, 14360, 14367, 14368, 14372, 14373, 14375, 14386, 14369, 14374, 14376,14379, 14380, 14381,14382, 14383,14384, and SEQ IDNO:14385.

Step e) of the method, namely the detection of the specific amplificates indicative of the methylation status of one or more CpG positions according to SEQ II) NOS:1 to SEQ ID
NO:64 is carried out by means of real-time detection methods as descn'bed above, and wherein the sequence of said hybridization probes is selected from the group consisting of SEQ ID
NOS:2753, 2756, 2758, 2761, 2766, 2770, 2774, 2778, 2799, 2807, 2813, 2819, 2822, 2826, 2848, 2857, 2900, 2906, 2908, 2910, 2913, 2921, 2925, 2940, 2943, 2952, 2964, 2983, 2986, 3009, 3012, 3015, 3024, 3030, 3035, 3046, 3058, 3062, 3067, 3070, 3074, 3077, 3079, 3082, 3087, 3095, 3099, 3102, 3106, 3112, 3120, 3125, 3129, 3132, 3141, 3143, 3154, 3156, 3158, 3161, 3177, 3188, 3191, 3193, 3200, 3208, 3211, 3220, 3231, 3241, 3251, 3254, 3258, 3263, 3272, 3277, 3288, 3294, 3296, 3299, 3303, 3317, 3323, 3326, 3329, 3336, 3341, 3362, 3366, 3370, 3375, 3379, 3382, 3387, 3394, 3398, 3405, 3407, 3410, 3412, 3416, 3422, 3425, 3430, 3449, 3451, 3457, 3460, 3465, 3468, 3486, 3498, 3502, 3507, 3523, 3532, 3539, 3546, 3550, 3567, 3572, 3579, 3582, 3610, 3620, 3628, 3648, 3659, 3664, 3672, 3675, 3680, 3682, 3685, 3687, 3699, 3712, 3716, 3720, 3734, 3751, 3763, 3766, 3769, 3783, 3789, 3795, 3811, 3816, 3825, 3830, 3835, 3841, 3843, 3846, 3849, 3855, 3859, 3879, 3882, 3910, 3912, 3913, 3918, 3925, 3929, 3932, 3946, 3953, 3956, 3967, 3969, 3973, 3977, 3989, 3992, 3996, 3999, 4002, 4008, 4014, 4026, 4030, 4036, 4041, 4044, 4053, 4057, 4060, 4062, 4081, 4091, 4097, 4103, 4107, 4118, 4126, 4140, 4143, 4147, 4155, 4158, 4164, 4175, 4178, 4183, 4187, 4193, 4200, 4203, 4210, 4212, 4215, 4222, 4227, 4230, 4235, 4240, 4250, 4253, 4264, 4278, 4294, 4312, 4314, 4320, 4329, 4339, 4346, 4356, 4363, 4380, 4402, 4404, 4414, 4419, 4421, 4431, 4439, 4445, 4449, 4459, 4468, 4483, 4493, 4500, 4513, 4526, 4527, 4532, 4544, 4550, 4552, 4566, 4577, 4591, 4594, 4604, 4608, 4623, 4625, 4629, 4637, 4651, 4654, 4657, 4673, 4679, 4682, 4692, 4698, 4710, 4712, 4713, 4723, 4725, 4729, 4734, 4740, 4743, 4747, 4752, 4757, 4762, 4765, 4775, 4781, 4796, 4799, 4803, 4809, 4826, 4831, 4863, 4866, 4880, 4888, 4914, 4916, 4931, 4933, 4939, 4955, 4959, 4962, 4965, 4994, 5001, 5008, 5012, 5023, 5029, 5035, 5046, 5059, 5063, 5068, 5071, 5079, 5082, 5085, 5089, 5092, 5095, 5098, 5102, 5108, 5113, 5118, 5122, 5127, 5130, 5133, 5138, 5141, 5146, 5152, 5154, 5178, 5192, 5197, 5206, 5213, 5228, 5236, 5243, 5258, 5267, 5275, 5277, 5283, 5294, 5298, 5302, 5305, 5320, 5325, 5328, 5335, 5345, 5350, 5357, 5374, 5381, 5384, 5386, 5390, 5397, 5402, 5406, 5411, 5423, 5430, 5439, 5453, 5463, 5473, 5476, 5479, 5483, 5489, 5514, 5520, 5523, 5530, 5547, 5584, 5590, 5607, 5610, 5613, 5617, 5621, 5631, 5636, 5641, 5653, 5655, 5658, 5666, 5669, 5675, 5685,. 5692, 5695, 5703, 5706, 5716, 5719, 5726, 5738, 5746, 5749, 5752, 5755, 5757, 5761, 5765, 5772, 5784, 5799, 5805, 5815, 5819, 5829, 5851, 5869, 5901, 5908, 5911, 5914, 5917, 5925, 5941, 5951, 5967, 5974, 5979, 5982, 5985, S989, 5995, 6022, 6029, 6044, 6047, 6052, 6057, 6061, 6069, 6071, 6080, 6082, 6087, 6092, 6095, 6102, 6104, 6107, 6109, 6113, 6124, 6129, 6140;
6147, 6158, 6165, 6179, 6185, 6203, 6209, 6217, 6228, 6249, 6263, 6267, 6279, 6290, 6332, 6339, 6343, 6346, 6352, 6363, 6366, 6370, 6380, 6385, 6391, 6396, 6408, 6430, 6439, 6454, 6456, 6477, 6483, 6488, 6495, 6509, 6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6846, 6856, 6864, 6867, 6878, 6885, 6903, 6914, 6919, 6923, 6926, 6938, 6941, 6978, 6982, 6985, 6988, 6994, 6997, 7000, 7004, 7008, 7015, 7019, 7021, 7069, 7079, 7099, 7104, 7117, 7120, 7145, 7151, 7153, 7162, 7164, 7169, 7201, 7209, 7234, 7238, 7252, 7286, 7288, 7300, 7305, 7313, 7323, 7327, 7338, 7343, 7346, 7352, 7377, 7380, 7396, 7399, 7406, 7412, 7414, 7418, 7424, 7429, 7437, 7441, 7443, 7458, 7461, 7469, 7473, 7491, 7502, 7504, 7514, 7531, 7551, 7553, 7557, 7562, 7564, 7569, 7572, 7592, 7602, 7605, 7612, 7625, 7630, 7632, 7634, 7648, 7653, 7664, 7668, 7693, 7696, 7706, 7763, 7766, 7769, 7772, 7777, 7780, 7787, 7790, 7801, 7804, 7806, 7826, 7831, 7850, 7859, 7862, 7867, 7876, 7883, 7887, 7891, 7893, 7895, 7898, 7901, 7906, 7908, 7911, 7915, 7924, 7927, 7930, 7935, 7959, 7961, 7966, 7975, 7978, 7984, 7994, 7998, 8002, 8014, 8029, 8032, 8037, 8041, 8045, 8048, 8058, 8063, 8086, 8092, 8097, 8106, 8109, 8120, 8140, 8141, 8159, 8162, 8172, 8196, 8205, 8211, 8215, 8219, 8226, 8234, 8241, 8249, 8262, 8265, 8272, 8276, 8279, 8283, 8290, 8300, 8308, 8320, 8338, 8355, 8358, 8368, 8380,8386, 8389, 8393, 8396, 8400, 8404, 8408, 8417, 8421, 8427, 8430, 8439, 8441, 8443, 8453, 8459, 8471, 8483, 8495, 8507, 8509, 8525, 8538, 8540, 8543, 8549, 8553, 8559, 8561, 8573, 8579, 8584, 8590, 8593, 8605, 8611, 8622, 8626, 8656, 8664, 8721, 8724, 8731, 8740, 8743, 8746, 8765, 8774, 8781, 8792, 8795, 8811, 8817, 8822, 8825, 8834, 8839, 8849, 8858, 8860, 8862, 8875, 8886, 8910, 8915, 8919, 8922, 8926, 8940, 8947, 8956, 8959, 8973, 8982, 8986, 8991, 8996, 9000, 9015, 9027, 9031, 9040, 9057, 9059, 9062, 9065, 9073, 9076, 9101, 9115, 9117, 9120, 9132, 9145, 9161, 9170, 9179, 9196, 9210, 9213, 9225, 9236, 9242, 9245, 9250, 9255, 9259, 9262, 9268, 9272, 9294, 9299, 9306, 9315, 9330, 9341; 9343, 9346, 9350, 9359, 9362, 9366, 9369, 9373, 9381, 9387, 9392, 9396, 9404, 9427, 9442, 9463, 9472, 9476, 9481, 9484, 9486, 9491, 9507, 9510, 9531, 9540, 9553, 9562, 9568, 9572, 9575, 9582, 9590, 9597, 9600, 9610, 9616, 9620, 9629, 9636, 9642, 9648, 9655, 9669, 9674, 9678, 9681, 9685, 9689, 9696, 9704, 9709, 9725, 9728, 9731, 9736, 9740, 9743, 9752, 9770, 9774, 9779, 9785, 9799, 9802, 9814, 9824, 9829, 9834, 9874, 9884, 9888, 9906, 9910, 9927, 9930, 9951, 9965, 9971, 9977, 10024, 10029, 10039, 10052, 10063, 10066, 10073, 10076, 10085, 10108, 10115, 10128, 10136, 10146, 10158, 10162, 10168, 10171, 10180, 10185, 10208, 10217, 10238, 10246, 10250, 10281, 10284, 10289, 10294, 10296, 10303, 10316, 10324, 10332, 10334, 10339, 10353, 10364, 10368, 10371, 10389, 10393, 10396, 10397, 10400, 10405, 10409, 10421, 10424, 10436, 10441, 10450, 10458, 10472, 10474, 10479, _ 10482, 10486, 10496, 10505, 10512, 10527, 10549, 10555, 10562, 10567, 10570, 10575, 10585, 10587, 10591, 10595, 10599, 10608, 10615, 10620, 10623, 10629, 10636, 10677, 10680, 10686, 10692, 10695, 10698, 10701, 10706, 10708, 10715, 10731, 10736, 10753, 10756, 10766, 10771, 10774, 10777, 10785, 10787, 10795, 10797, 10803, 10810, 10825, 10828, 10832, 10836, 10852, 10855, 10867, 10876, 10887, 10891, 10895, 10898, 10913, 10918, 10921, 10923, 10936, 10940, 10949, 10961, 10964, 10974, 10983, 10990, 10994, 11003, 11008, 11011, 11018, 11024, 11035, 11038, 11057, 11095, 11378, 11389, 11393, 11407, 11413, 11420, 11426, 11436, 11440, 11454, 11470, 11491, 11495, 11530, 11437, 11441, 11455, 11471, 11492, 11496, 11516, 11531, 11533, 11537, 11543, 11558, 11564, 11575, 11538, 11544, 11559, 11565, 11567, 11576, 11580, 11583, 11588, 11581, 11584, 11589, 11599, 11634, 11604, 11611, 11620, 11624, 11630, 11605, 11612, 11621, 11625, 11631, 11637, 11650, 11638, 11651, 11661, 11668, 11679, 11683, 11703, 11707, 11711, 11714, 11717, 11721, 11726, 11741, 11753, 11757, 11766, 11771, 11780, 11662, 11669, 11680, 11684, 11704, 11708, 11712, 11715, 11718, 11722, 11742, 11754, 11758, 11760, 11781, 11788, 11794, 11789, 11795, 11798, 11807, 11812, 11816, 11821, 11831, 11842, 11854, 11799, 11808, 11813, 11822, 11826, 11832, 11834, 11838, 11843, 11849, 11855, 11859, 11869, 11873, 11880, 11884, 11896, 11870, 11874, 11881, 11885, 11897, 11900, 11906, 11920, 11935, 11939, 11944, 11957, 11961, 11965, 11970, 11974, 11983, 11901, 11907, 11921, 11936, 11940, 11945, 11958, 11962, 11966, 11971, 11975, 11984, 12008, 12013, 12018, 12029, 12036, 12040, 12047, 12074, 12078, 12083, 12105, 12116, 12009, 12014, 12019, 12030, 12037, 12041, 12048, 12053, 12075, 12079, 12036, 12092, 12106, 12117, 12126, 12132, 12151, 12155, 12133, 12152, 12156, 12166, 12173, 12178, 12183, 12189, 12192, 12204, 12211, 12218y 12235, 12246, 12252, 12282, 12293, 12298, 12301, 12304, 12310, 12315, 12319, 12334, 12350, 12357, 12365, 12374, 12387, 12391, 12395, 12416, 12426, 12444, 12451, 12456, 12167, 12174, 12179, 12184, 12193, 12205, 12212, 12215, 12219, 12236, 12247, 12253, 12261, 12275, 12283, 12294, 12299, 12305, 12311, 12316, 12320, 12329, 12335, 12344, 12351, 12358, 12366, 12368, 12375, 12384, 12388, 12392, 12396, 12399, 12407, 12414, 12421, 12427, 12431, 12434, 12447, 12452, 12457, 12463, 12470, 12473, 12482, 12464, 12466, 12471, 12476, 12479, 12491, 12503, 12509, 12513, 12516, 12514, 12532, 12539, 12544, 12557, 12562, 12567, 12576, 12583, 12588, 12591, 12606, 12612, 12622, 12628, 12510, 12514, 12519, 12526, 12527, 12533, 12540, 12545, 12558, 12563, 12568, 12577, 12580, 12584, 12589, 12598, 12607, 12619, 12623, 12629, 12633, 12642, 12645, 12650, 12656, 12668, 12674, 12676, 12697, 12707, 12722, 12734, 12741, 12759, 12773, 12779, 12783, 12802, 12806, 12810, 12819, 12829, 12634, 12646, 12651, 12657, 12659, 12669, 12698, 12708, 12711, 12723, 12707, 12727, 12735, 12742, 12774, 12780, 12784, 12803, 12807, 12811, 12820, 12830, 12847, 12852, 12859, 12864, 12874, 12905, 12915, 12925, 12930, 12934, 12940, 12944, 12946, 12955, 12848, 12853, 12856, 12860, 12865, 12875, 12897, 12906, 12916, 12922, 12926, 12931, 12935, 12941, 12930, 12947, 12952, 12956, 12963, 12979, 12964, 12980, 12984, 13003, 12985, 12988, 12990, 12994, 13004, 13007, 13011, 13015, 13027, 13046, 13055, 13059, 13080, 13094, 13098, 13112, 13120, 13134, 13140, 13150, 13154, 13161, 13187, 13008, 13012, 13016, 13028, 13047, 13056, 13060, 13081, 13095, 13099, 13103, 13106, 13113, 13116, 13135, 13136, 13141, 13151, 13155, 13162, 13188, 13193, 13202, 13194, 13203, 13205, 13209, 13215, 13218, 13236, 13252, 13260, 13271, 13283, 13210, 13216, 13219, 13221, 13223, 13230, 13238, 13243, 13253, 13261, 13272, 13278, 13284, 13643, 13644, 13651, 13657, 13662, 13663, 13666, 13679, 13667, 13680, 13699, 13711, 13730, 13737, 13742, 13700, 13712, 13731, 13738, 13743, 13747, 13756, 13760, 13781, 13793, 13801, 13810, 13830, 13748, 13750, 13757, 13761, 13770, 13771, 13782, 13787, 13794, 13799, 13811, 13825, 13827, 13831, 13834, 13839, 13851, 13859, 13863, 13867, 13873, 13877, 13835, 13840, 13842, 13848, 13852, 13860, 13864, 13868, 13874, 13878, 13885, 13886, 13891, 13896, 13901, 13918, 13927, 13933, 13939, 13951, 13886, 13888, 13892, 13897, 13899, 13901, 13919, 13934, 13940, 13952, 13955, 13973, 13979, 13983, 13997, 13984, 13998, 14006, 14011, 14019, 14022, 14031, 14047, 14053, 14061, 14075, 14111, 14116, 14124, 14149, 14007, 14012, 14016, 14023, 14032, 14048, 14054, 14062, 14076, 14112, 14117, 14119, 14125, 14128, 14129, 14131, 14146, 14150, 14153, 14159, 14163, 14168, 14173, 14177, 14154, 14160, 14164, 14169, 14174, 14178, 14181, 14206, 14213, 14219, 14237, 14248, 14252, 14258, 14264, 14271, 14275, 14279, 14295, 14308, 14311, 14314, 14318, 14332, 14335, 14339, 14343, 14207, 14209, 14214, 14220, 14222, 14232, 14234, 14238, 14249, 14253, 14259, 14265, 14272, 14276, 14280, 14288, 14296, 14309, 14315, 14319, 14321, 14326, 14333, 14336, 14362, 14370,14377,14371 arul SEQ ID
NO:14378.
For each genomic sequence listed, the foliowing oligonucleotides as detailed in the sequence listing may be used for a combined 1VISP-RealTime analysis:
Taqman Raal time single probe detection assays:
SEQ ID NO: 41 left Primer: 2751, 2754, 2757, 2759, 2767, 2768, 2772, 2776, 2779, 2784, 2785, 2786, 2789, 2791, 2792, 2794, 2797, 2798, 2801, 2805, 2806, 2809, 2811, 2815, 2817, 2824, 2830, 2832, 2833, 2834, 2838, 2840, 2843, 2846, 2850, 2851, 2853, 2855, 2859, 2866, 2867, 2870, 2871, 2876, 2878, 2881, 2885, 2886, 2892, 2893, 2895, 2896, 2898, 2904, 2912, 2915, 2917, 2919, 2922, 2923, 2929, 2931, 2939, 2941, 2944, 2946, 2948, 2950, 2955, 2956, 2957, 2960, 2962, 2965, 2966, 2967, 2968, 2969, 2971, 2975, 2976, 2977, 2978, 2979, 2980, 2981, 2984, 2988, 2989, 2990, 2992, 2994, 2997, 2999, 3001, 3002, 3004, 3006, 3007, 3008, 3010, 3013, 3014, 3016, 3017, 3018, 3020, 3022, 3025, right Primer. 2752, 2755, 2760, 2762, 2763, 2764, 2765, 2769, 2771, 2773, 2775, 2777, 2780, 2781, 2782, 2783, 2787, 2788, 2790, 2793, 2795, 2796, 2800, 2802, 2803, 2804, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2821, 2823, 2825, 2827, 2828, 2829, 2831, 2835, 2836, 2837, 2839, 2841, 2842, 2844, 2845, 2847, 2849, 2852, 2854, 2856, 2858, 2860, 2861, 2862, 2863, 2864, 2865, 2868, 2869, 2872, 2873, 2874, 2875, 2877, 2879, 2880, 2882, 2883, 2884, 2887, 2888, 2884, 2890, 2891, 2894, 2897, 2899, 2901, 2902, 2903, 2905, 2907, 2909, 2911, 2914, 2916, 2918, 2920, 2924, 2926, 2927, 2928, 2930, 2932, 2933, 2934, 2935, 2936, 2937, 2938, 2942, 2945, 2947, 2949, 2951, 2953, 2954, 2958, 2959, 2961, 2963, 2970, 2972, 2973, 2974, 2982, 2985, 2987, 2991, 2993, 2995, 2996, 2998, 3000, 3003, 3005, 3011, 3019, 3021, 3023, 3026, 3027, Detection: 2753, 2756, 2 758, 2761, 2766, 2770, 2774, 2778, 2799, 2807, 2813, 2819, 2822, 2826, 2848, 2857, 2900, 2906, 2908, 2910, 2913, 2921, 2925, 2940, 2943, 2952, 2964, 2983, 2986, 3009, 3012, 3015, 3024, SEQ ID NO: 5 left Primer: 3028, 3032, 3033, 3036, 3037, 3038, 3039, 3041, 3042, 3043, 3044, 3047, 3048, 3049, 3052, 3055, 3059, 3061, 3064, 3065, 3068, 3069, 3071, 3072, 3075, 3076, 3080, 3083, 3084, 3085, 3086, 3091, 3093, 3096, 3097, 3100, 3104, 3109, 3110, 3113, 3115, 3117, 3118, 3123, 3126, 3127, 3130, 3134, 3135, 3136, 3138, 3139, 3144, 3146, 3147, 3149, 3150, 3155, right Primer: 3029, 3031, 3034, 3040, 3045, 3050, 3051, 3053, 3054, 3056, 3057, 3060, 3063, 3066, 3073, 3078, 3081, 3088, 3089, 3090, 3092, 3094, 3098, 3101, 3103, 3105, 3107, 3108, 3111, 3114, 3116, 3119, 3121, 3122, 3124, 3128, 3131, 3133, 3137, 3140, 3142, 3145, 3148, 3151, 3152, 3153, 3157, petection: 3030, 3035, 3 046, 3058, 3062, 3067, 3070, 3074, 3077, 3079, 3082, 3087, 3095, 3099, 3102, 3106, 3112, 3120, 3125, 3129, 3132, 3141, 3143, 3154, 3156, 3158, SEQ ID NO: 6 left Primer: 3159, 3165, 3166, 3167, 3170, 3171, 3172, 3174, 3175, 3176, 3179, 3180, 3181, 3184, 3185, 3186, 3192, 3194, 3198, 3201, 3202, 3203, 3204, 3206, 3209, 3212, 3213, 3215, 3216, 3217, 3218, 3221, 3224, 3226, 3228, 3229, 3230, 3232, 3233, 3234, 3235, 3237, 3238, 3239, 3245, 3247, 3248, 3249, right Primer: 3160, 3162, 3163, 3164, 3168, 3169, 3173, 3178, 3182, 3183, 3187, 3189, 3190, 3195, 3196, 3197, 3199, 3205, 3207, 3210, 3214, 3219, 3222, 3223, 3225, 3227, 3236, 3240, 3242, 3243, 3244, 3246, 3250, Detection: 3161, 3177, 3188, 3191, 3193, 3200, 3208, 3211, 3220, 3231, 3241, 3251, SEQ ID NO: 8 left Primer: 3252, 3256, 3261, 3264, 3268, 3269, 3270, 3273, 3275, 3279, 3280, 3281, 3282, 3283, 3284, 3285, 3286, 3290, 3292, 3295, 3297, 3301, 3304, 3305, 3306, 3307, 3308,.
3310, 3311, 3312, 3315, 3319, 3320, 3324, 3327, 3331, 3333, 3334, 3339, 3348, 3351, 3354,.
3358, 3360, 3364, 3367, 3368, 3374,3376, right Primer. 3253, 3255, 3257, 3259, 3260, 3262, 3265, 3266, 3267, 3271, 3274, 3276, 3278, 3287, 3289, 3291, 3293, 3298, 3300, 3302, 3309, 3313, 3314, 3316, 3318, 3321, 3322, 3325, 3328, 3330, 3332, 3335, 3337, 3338, 3340, 3342, 3343, 3344, 3345, 3346, 3347, 3349, 3350, 3352, 3353, 3355, 3356, 3357, 3359, 3361, 3363, 3365, 3369, 3371, 3372, 3373, Detection: 3254, 3258, 3 263, 3272, 3277, 3288, 3294, 3296, 3299, 3303, 3317, 3323, 3326, 3329,3336, 3341, 3362, 3366, 3370, 3375, SEQ ID NO: 16 left Priiner: 3377, 3380, 3383, 3386, 3388,3389, 3390, 3391, 3392, 3395, 3396, 3400, 3401, rigttt Primer: 3378, 3381, 3384, 3385, 3393, 3397,3399, 3402, Det.eotion: 3379, 3382, 3387, 3394, 3398, SEQ ID NO: 42 left Primer. 3403, 3406, 3408, 3413, 3414, 3417, 3420, 3423, 3428, 3432, 3433, 3434, 3436, 3439, 3440, 3442, 3443, 3445, 3447, 3453, 3455, 3458, 3463, 3466, 3469, 3470, 3471, 3472, 3473, 3474, 3475, 3477, 3478, 3480, 3481, 3483, 3484, 3487, 3490, 3494, 3495, 3496, 3497, 3499, 3500, 3504, 3505, 3508, 3512, 3514, 3515, 3516, 3521, 3525, 3529, 3533, 3534, 3537, 3538, 3540, 3541, 3542, 3543, 3544, 3547, 3548, 3553, 3557, 3558, 3559, 3560, 3562, 3563, 3566, 3571, 3574, 3575, 3577, 3580, 3583, 3584, 3585, 3586, 3592, 3594, 3595, 3597, 3598, 3599, 3601, 3603x 3604, 3607; 3608, 3612, 3619, 3621, 3622, 3626, 3631, 3632, 3637, 3638, 3639, 3640, 3642, 3643, 3644, 3646, 3647, 3649, 3650, 3652, 3656, 3657, 3660, 3663, 3668, 3670, 3673, 3676, 3677, 3678, 3683, 3688, 3690, 3694, 3697, 3700, 3702, 3703, 3704, 3708, right Primer: 3404, 3409, 3411, 3415, 3418, 3419, 3421, 3424, 3426, 3427, 3429, 3431, 3435, 3437, 3438, 3441, 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3459, 3461, 3462, 3464, 3467, 3476, 3479, 3482, 3485, 3488, 3489, 3491, 3492, 3493, 3501, 3503, 3506, 3509, 3510, 3511, 3513, 3517, 3518, 3519, 3520, 3522, 3524, 3526, 3527, 3528, 3530, 3531, 3535, 3536, 3545, 3549, 3551, 3552, 3554, 3555, 3556, 3561, 3564, 3565, 3568, 3569, 3570, 3573, 3576, 3578, 3581, 3587, 3588, 3589, 3590, 3591, 3593, 3596, 3600, 3602, 3605, 3606, 3609, 3611, 3613, 3614, 3615, 3616, 3617, 3618, 3623, 3624, 3625, 3627, 3629, 3630, 3633, 3634, 3635, 3636, 3641, 3645, 3651, 3653, 3654, 3655, 3658, 3661, 3662, 3665, 3666, 3667, 3669, 3671, 3674, 3679, 3681, 3684, 3686, 3689, 3691, 3692, 3693, 3695, 3696, 3698, 3701, 3705, 3706, 3707, 3709, Detection: 3405, 3407, 3 410, 3412, 3416, 3422, 3425, 3430, 3449, 3451, 3457, 3460, 3465, 3468, 3486, 3498, 3502, 3507, 3523, 3532, 3539, 3546, 3550, 3567, 3572, 3579, 3582, 3610, 3620, 3628, 3648, 3659, 3664, 3672, 3675, 3680, 3682, 3685, 3687, 3699, SEQ ID NO: 14 left Primer. 3710, 3714, 3715, 3717, 3718, 3722, 3723, 3729, 3730, 3732, 3735, 3739, 3740, 3741, 3743, 3744, 3745, 3746, 3749, 3753, 3754, 3755, 3756, right Primer. 3711, 3713, 3719, 3721, 3724, 3725, 3726, 3727, 3728, 3731, 3733, 3736, 3737, 3738, 3742, 3747, 3748, 3750, 3752, 3757, 3758, 3759, 3760, Deteation: 3712, 3716, 3720, 3734, 3751, SEQ ID NO: 43 left Prime.r: 3761, 3764, 3767, 3771, 3773, 3775, 3776, 3777, 3781, 3785, 3786, 3787, 3790, 3791, 3793, 3796, 3797, 3798, 3799, 3805, 3809, 3814, 3817, 3818, 3822, 3823, 3828, 3833, 3836, 3844, 3847, 3850, 3851, 3853, 3856, 3857, 3862, 3873, 3876, 3877, 3880, 3885, 3887, 3889, 3890, 3892, 3893, 3895, 3896, 3899, 3902, 3903, 3905, 3906, 3907, 3908, 3916, 3923, 3926, 3927, 3930, 3935, 3936, 3938, 3939, 3940, 3944, 3945, 3949, 3950, 3951, 3954, 3955, 3957, 3960, 3965, 3970, 3971, 3978, 3979, 3982, 3983, 3984, 3985, right Primer: 3762, 3765, 3768, 3770, 3772, 3774, 3778, 3779, 3780, 3782, 3784, 3788, 3792, 3794, 3800, 3801, 3802, 3803, 3804, 3806, 3807, 3808, 3810, 3812, 3813, 3815, 3819, 3820, 3821, 3824, 3826, 3827, 3829, 3831, 3832, 3834, 3837, 3838,, 3839, 3840, 3842, 3845, 3848, 3852, 3854, 3858, 3860, 3861, 3863, 3864, 3865, 3866, 3867, 3868, 3869, 3870, 3871, 3872, 3874, 3875, 3878, 3881, 3883, 3884, 3886, 3888, 3891, 3894, 3897, 3898, 3900, 3901, 3904, 3909, 3911, 3914, 3915, 3917, 3919, 3920, 3921, 3922, 3924, 3928, 3931, 3933, 3934, 3937, 3941, 3942, 3943, 3947, 3948, 3952, 3958, 3959, 3961, 3962, 3963, 3964, 3966, 3968, 3972, 3974, 3975, 3976, 3980, 3981, 3986, Detection: 3763, 3766, 3 769, 3783, 3789, 3795, 3811, 3816, 3825, 3830, 3835, 3841, 3843, 3846, 3849, 3855, 3859, 3879, 3882, 3910, 3912, 3913, 3918, 3925, 3929, 3932, 3946, 3953, 3956, 3967, 3969, 3973, 3977, SEQ ID NO: 15 left Primer. 3987, 3990, 3993, 3994, 3997, 4000, 4003, 4004, 4006, 4012, 4015, 4017, 4020, 4024, 4027, 4029, 4031, 4032, 4033, 4037, 4038, 4040, 4042, 4047, 4048, 4050, 4051, 4052, 4054, 4055, 4058, 4063, 4066, 4069, 4070, 4072, 4073, 4076, 4078, 4079, 4082, 4083, 4084, 4085, 4086, 4090, 4093, 4094, 4095, 4096, 4099, 4100, 4104, 4106, 4113, 4116, 4119, 4120, 4124, 4127, 4130, 4134, 4135, 4136, 4138, 4142, 4145, 4146, 4149, 4150, 4152, 4153, 4159, 4160, 4161, 4163, 4168, 4169, 4171, 4173, 4176, 4180, 4181, 4185, 4189, 4191, 4192, 4194, 4197, 4198, 4199, 4201, 4206, 4207, 4208, 4213, 4219, 4220, 4223, 4224, 4225, 4228, 4231, 4232, 4233, 4237, 4238, 4242, 4243, 4246, 4247, 4251, 4254, 4255, 4256, 4258, right Primer: 3988, 3991, 3995, 3998, 4001, 4005, 4007, 4009, 4010, 4011, 4013, 4016, 4018, 4019, 4021, 4022, 4023, 4025, 4028, 4034, 4035, 4039, 4043, 4045, 4046, 4049, 4056, 4059, 4061, 4064, 4065, 4067, 4068, 4071, 4074, 4075, 4077, 4080, 4087, 4088, 4089, 4092, 4098, 4101, 4102, 4105, 4108, 4109, 4110, 4111, 4112, 4114, 4115, 4117, 4121, 4122, 4123, 4125, 4128, 4129, 4131, 4132, 4133, 4137, 4139, 4141, 4144, 4148, 4151, 4154, 4156, 4157, 4162, 4165, 4166, 4167, 4170, 4172, 4174, 4177, 4179, 4182, 4184, 4186, 4188, 4190, 4195, 4196, 4202, 4204, 4205, 4209, 4211, 4214, 4216, 4217, 4218, 4221, 4226, 4229, 4234, 4236, 4239, 4241, 4244, 4245, 4248, 4249, 4252, 4257, 4259, 4260, 4261, Datection: 3989, 3992, 3 996, 3999, 4002, 4008, 4014, 4026, 4030, 4036, 4041, 4044, 4053, 4057, 4060, 4062, 4081, 4091, 4097, 4103, 4107, 4118, 4126, 4140, 4143, 4147, 4155, 4158, 4164, 4175, 4178, 4183, 4187, 4193, 4200, 4203, 4210, 4212, 4215, 4222, 4227, 4230, 4235, 4240, 4250, 4253, SEQ ID NO:4 left Primer: 4262, 4266, 4267, 4268, 4271, 4272, 4275, 4276, 4279, 4281, 4282, 4284, 4285, 4287, 4289, 4290, 4292, 4295, 4297, 4299, 4301, 4306, 4310, 4316, 4317, 4318, 4321,.
4323, 4325, 4328, 4334, 4335, 4337, 4341, 4342, 4343, 4344, 4348, 4350, 4351, 4352, 4354, 4357, 4358, 4359, 4364, 4365, 4366, 4370, 4371, 4372, 4373, 4376, 4378, 4381, 4383, 4384, 4386, 4388, 4396, 4397, 4399, 4400, 4403, 4405, 4407, 4409, 4412, 4415, 4416, 4417, 4424, 4426, 4429, 4433, 4435, 4437, 4442, 4443, 4447, 4450, 4451, 4452, 4455, 4457, 4460, 4461, 4462, 4465, 4466, 4469, 4470, 4474, 4478, 4481, 4484, 4488, 4491, 4494, 4495, 4497, 4498, 4504, 4506, 4509, 4510, 4511, 4514, 4516, 4518, 4520, 4521, 4523, 4525, 4528, 4530, 4533, 4534, 4535, 4538, 4540, 4542, 4545, 4547, 4548, 4553, 4554, 4555, 4556, 4557, 4562, 4564, 4567, 4568, 4569, 4579, 4580, 4582, 4584, 4587, 4589, 4593, 4596, 4597, 4598, 4600, 4601, 4602, 4605, 4606, 4607, 4609, 4610, 4613, 4614, 4616, 4618, 4621, 4624, 4626, 4627, 4628, 4631, 4632, 4636, 4639, 4641, 4644, 4645, 4648, right Primer: 4263, 4265, 4269, 4270, 4273, 4274, 4277, 4280, 4283, 4286, 4288, 4291, 4293, 4296, 4298, 4300, 4302, 4303, 4304, 4305, 4307, 4308, 4309, 4311, 4313, 4315, 4319, 4322, 4324, 4326, 4327, 4330, 4331, 4332, 4333, 4336, 4338, 4340, 4345, 4347, 4349, 4353, 4355, 4360, 4361, 4362, 4367, 4368, 4369, 4374, 4375, 4377, 4379, 4382, 4385, 4387, 4389, 4390, 4391, 4392, 4393, 4394, 4395, 4398, 4401, 4406, 4408, 4410, 4411, 4413, 4418, 4420, 4422, 4423, 4425, 4427, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4441, 4444, 4446, 4448, 4453, 4454, 4456, 4458, 4463, 4464, 4467, 4471, 4472, 4473, 4475, 4476, 4477, 4479, 4480, 4482, 4485, 4486, 4487, 4489, 4490, 4492, 4496, 4499, 4501, 4502, 4503, 4505, 4507, 4508, 4512, 4515, 4517, 4519, 4522, 4524, 4529, 4531, 4536, 4537, 4539, 4541, 4543, 4546, 4549, 4551, 4558, 4559, 4560, 4561, 4563, 4565, 4570, 4571, 4572, 4573, 4574, 4575, 4576, 4578, 4581, 4583, 4585, 4586, 4588, 4590, 4592, 4595, 4599, 4603, 4611, 4612, 4615, 4617, 4619, 4620, 4622, 4630, 4633, 4634, 4635, 4638, 4640, 4642, 4643, 4646, 4647, Detection: 4264, 4278,4294, 4312, 4314, 4320, 4329, 4339, 4346, 4356, 4363, 4380, 4402, 4404, 4414, 4419, 4421, 4431, 4439, 4445, 4449, 4459, 4468, 4483, 4493, 4500, 4513, 4526, 4527, 4532, 4544, 4550, 4552, 4566, 4577; 4591, 4594, 4604, 4608, 4623, 4625, 4629, 4637, SEQ ID NO: 7 left Primer: 4649, 4652, 4655, 4659, 4661, 4663, 4664, 4665, 4668, 4671, 4674, 4675, 4676, 4678, 4680, 4683, 4686, 4690, 4696, 4700, 4703, 4704, 4706, 4709, 4711, 4714, 4715, 4717, 4718, 4719, 4720, 4721, 4726, 4727, 4730, 4732, 4738, 4742, 4745, 4749, 4750, 4753, 4755, 4759, 4763, 4768, 4769, 4772, 4773, 4776, 4778, 4779, 4782, 4784, 4789, 4790, 4794, 4797, 4801, 4805, 4807, 4813, 4814, 4819, 4821, 4822, 4827, 4829, 4833, 4834, 4835, 4837, 4838, 4841, 4842, 4843, 4844, 4847, 4849, 4850, 4852, 4853, 4859, 4860, 4861, 4865, 4867, 4868, 4869, 4870, 4873, 4876, 4877, 4878, 4879, 4883, 4885, 4889, 4891, 4892, 4894, 4895, 4897, 4898, 4903, 4906, 4911, 4912, 4918, 4919, 4920, 4924, 4927, 4929, 4932, 4934, 4941, 4942, 4945, 4948, 4949, 4950, right Primer: 4650, 4653, 4656, 4658, 4660, 4662, 4666, 4667, 4669, 4670, 4672, 4677, 4681, 4684, 4685, 4687, 4688, 4689, 4691, 4693, 4694, 4695, 4697, 4699, 4701, 4702, 4705, 4707, 4708, 4716, 4722, 4724, 4728, 4731, 4733, 4735, 4736, 4737, 4739, 4741, 4744, 4746, 4748, 4751, 4754, 4756, 4758, 4760, 4761, 4764, 4766, 4767, 4770, 4771, 4774, 4777, 4780, 4783, 4785, 4786, 4787, 4788, 4791, 4792, 4793, 4795, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4811, 4812, 4815, 4816, 4817, 4818, 4820, 4823, 4824, 4825, 4828, 4830, 4832, 4836, 4839, 4840, 4845, 4846, 4848, 4851, 4854, 4855, 4856, 4857, 4858, 4862, 4864, 4871, 4872, 4874, 4875, 4881, 4882, 4884, 4886, 4887, 4890, 4893, 4896, 4899, 4900, 4901, 4902, 4904, 4905, 4907, 4908, 4909, 4910, 4913, 4915, 4917, 4921, 4922, 4923, 4925, 4926, 4928, 4930, 4935, 4936, 4937, 4938, 4940, 4943, 4944, 4946, 4947, 4951, 4952, Detection: 4651, 4654, 4 657, 4673, 4679, 4682, 4692, 4698, 4710, 4712, 4713, 4723, 4725, 4729, 4734, 4740, 4743, 4747, 4752, 4757, 4762, 4765, 4775, 4781, 4796, 4799, 4803, 4809, 4826, 4831, 4863, 4866, 4880, 4888, 4914, 4916, 4931, 4933, 4939, SEQ ID NO: 44 left Primer. 4953, right Primer: 4954,4956, Detection: 4955, SEQ ID NO:1 left Primer. 4957, 4960, 4963, 4967, 4970, 4971, 4972, 4976, 4977, 4985, 4986, 4987, 4989, 4991, 4992, 4997, 4999, 5002, 5003, 5004, 5006, 5010, 5013, 5014, 5015, 5017, 5018, 5019, 5020, 5021, 5024, 5025, 5027, 5031, 5032, 5033, 5037, 5040, 5041, 5042, 5043, right Primer: 4958, 4961, 4964, 4966, 4968, 4969, 4973, 4974, 4975, 4978, 4979, 4980, 4981, 4982, 4983, 4984, 4988, 4990, 4993, 4995, 4996, 4998, 5000, 5005, 5007, 5009, 5011, 5016, 5022, 5026, 5028, 5030, 5034, 5036, 5038, 5039, Detection: 4959, 4962, 4965, 4994, 5001, 5008, 5012, 5023, 5029, 5035, SEQ ID NO:Z

left Primer. 5044, 5047, 5049, 5050, 5052, 5054, 5055, 5057, 5060, 5061, 5064, right Primer. 5045, 5048, 5051, 5053, 5056, 5058, 5062, 5065, Detection: 5046, 5059, 5063, SEQ ID NO: 45 left Pr6er: 5066, 5069, 5073, 5077, 5080, 5083, 5087, 5093, 5096, 5099, 5100, 5103, 5104, 5106, 5111, 5116, 5119, 5120, 5125, 5128, 5132, 5134, 5135, 5137, 5139, 5140, 5142, 5144, 5148, 5149, 5150, 5155, 5157, 5158, 5160, 5166, 5168, 5170, 5171, 5173, 5176, 5177, 5179, 5184, 5187, 5188, 5190, 5193, 5195, 5198, 5201, 5204, 5208, 5211, 5215, 5216, 5217, 5220, 5221, 5222, 5224, 5226, 5229, 5230, 5231, 5232, 5234, 5237, 5242, 5244, 5245, 5246, 5247, 5249, 5250, 5252, 5254, 5255, 5256, 5261, 5262, 5264, 5265, 5273, 5274, 5276, 5278, 5279, 5281, 5284, 5285, 5286, 5287, 5288, 5289, 5292, 5296, 5300, 5303, 5304, 5307, 5308, 5309, 5313, 5315, 5317, 5318, 5322, 5323, 5326, 5329, 5330, 5333, 5336, 5337, 5341, 5343, 5348, 5349, 5352, 5354, 5355, 5358, 5359, 5361, 5362, 5363, 5364, 5365, 5367, 5369, 5370, 5372, 5375, 5377, 5379, 5382, 5385, 5387, 5393, 5394, 5395, 5398, 5400, 5404, 5407, 5408, 5409, 5412, 5413, 5414, 5416, 5418, 5421, 5424, 5426, 5428, 5431, 5432, 5433, 5434, 5435, 5437, 5440, 5441, 5443, 5448, 5450, 5451, 5454, 5455, 5458, 5460, 5461, 5464, 5468, 5470, 5471, 5474, 5475, 5477, 5482, 5484, 5485, 5487, 5490, 5491, 5492, 5494, 5496, 5498, 5499, 5500, 5501, 5502, 5503, 5504, 5506, 5509, 5510, 5512, 5516, 5517, 5518, 5524, 5525, 5526, 5528, 5531, 5533, 5534, 5535, 5536, 5537, 5540, 5542, 5544, 5545, 5546, 5549, 5550, 5552, .
5553, 5559, 5561, 5566, 5569, 5572, 5573, 5575, 5577, 5578, 5579, 5580, 5581, 5~582, 5588, 5593, 5595, 5596, 5598, 5600, 5601, 5603, 5604, 5605, 5608, 5614, 5615, 5616, 5619, 5622, 5624, 5625, 5628, 5629, 5633, 5634, 5637, 5638, 5639, 5643, 5644, 5645, 5647, 5648, 5649, 5650, 5654, 5662, 5664, right Primer: 5067, 5070, 5072, 5074, 5075, 5076, 5078, 5081, 5084, 5086, 5088, 5090, 5091, 5094, 5097, 5101, 5105, 5107, 5109, 5110, 5112, 5114, 5115, 5117, 5121, 5123, 5124, 5126, 5129, 5131, 5136, 5143, 5145, 5147, 5151, 5153, 5156, 5159, 5161, 5162, 5163, 5164, 5165, 5167, 5169, 5172, 5174, 5175, 5180, 5181, 5182, 5183, 5185, 5186, 5189, 5191, 5194, 5196, 5199, 5200, 5202, 5203, 5205, 5207, 5209, 5210, 5212, 5214, 5218, 5219, 5223, 5225, 5227, 5233, 5235, 5238, 5239, 5240, 5241, 5248, 5251, 5253, 5257, 5259, 5260, 5263, 5266, 5268, 5269, 5270, 5271, 5272, 5280, 5282, 5290, 5291, 5293, 5295, 5297, 5299, 5301, 5306, 5310, 5311, 5312, 5314, 5316, 5319, 5321, 5324, 5327, 5331, 5332, 5334, 5338, 5339, 5340, 5342, 5344, 5346, 5347, 5351, 5353, 5356, 5360, 5366, 5368, 5371, 5373, 5376, 5378, 5380, 5383, 5388, 5389, 5391, 5392, 5396, 5399, 5401, 5403, 5405, 5410, 5415, 5417, 5419, 5420, 5422, 5425, 5427, 5429, 5436, 5438, 5442, 5444, 5445, 5446, 5447, 5449, 5452, 5456, 5457, 5459, 5462, 5465, 5466, 5467, 5469, 5472, 5478, 5480, 5481, 5486, 5488, 5493, 5495, 5497, 5505, 5507, 5508, 5511, 5513, 5515, 5519, 5521, 5522, 5527, 5529, 5532, 5538, 5539, 5541, 5543, 5548, 5551, 5554, 5555, 5556, 5557, 5558, 5560, 5562, 5563, 5564, 5565, 5567, 5568,.
5570, 5571, 5574, 5576, 5583, 558S, 5586, 5587, 5589, 5591, 5592, 5594, 5597, 5599, 5602, 5606, 5609, 5611, 5612, 5618, 5620, 5623, 5626, 5627, 5630, 5632, 5635, 5640, 5642, 5646, 5651, 5652, 5656, 5657, 5659, 5660, 5661, 5663, 5665, Detection: 5068, 5071, 5 079, 5082, 5085, 5089, 5092, 5095, 5098, 5102, 5108, 5113, 5118, 5122, 5127, 5130, 5133, 5138, S141, 5146, 5152, 5154, 5178, 5192, 5197, 5206, 5213, 5228, 5236, 5243, 5258, 5267, 5275, 5277, 5283, 5294, 5298, 5302, 5305, 5320, 5325, 5328, 5335, 5345, 5350, 5357, 5374, 5381, 5384, 5386, 5390, 5397, 5402, 5406, 5411, 5423, 5430, 5439, 5453, 5463, 5473, 5476, 5479, 5483, 5489, 5514, 5520, 5523, 5530, 5547, 5584, 5590, 5607, 5610, 5613, 5617, 5621, 5631, 5636, 5641, 5653, 5655, 5658, 5666, SEQIDNO:9 left Fruner: 5667, 5670, 5672, 5673, 5676, 5678, 5679, 5681, 5682, 5683, 5686, 5687;
5688, 5690, 5694, 5697, 5698, 5699, 5700, 5701, 5704, 5708, 5709, 5711, 5713, 5714, 5717, 5721, 5723, 5724, 5727, 5728, 5733, 5734, 5735, 5736, 5739, 5740, 5741, 5742, 5743, right Primer. 5668, 5671, 5674, 5677, 5680, 5684, 5689, 5691, 5693, 5696, 5702, 5705, 5707, 5710, 5712, 5715, 5718, 5720, 5722, 5725, 5729, 5730, 5731, 5732, 5737, Detection: 5669, 5675, 5685, 5692, 5695, 5703, 5706, 5716, 5719, 5726, 5738, SEQ ID NO: 46 left Primer: 5744, 5747, 5750, 5753, 5759, 5762, 5763, 5770, 5775, 5777, 5778, 5780, 5782, 5785, 5787, 5791, 5792, 5793, 5794, 5797, 5801, 5803, 5808, 5810, 5812, 5814, 5816, 5817, 5824, 5832, 5833, 5834, 5835, 5838, 5840, 5841, 5844, 5849, 5853, 5854, 5857, 5859, 5860, 5862, 5863, 5865, 5868, 5874, 5882, 5883, 5885, 5887, 5894, 5895, 5896, 5897, 5902, 5904, 5906, 5909, 5912, 5915, 5918, 5919, 5920, 5922, 5923, 5926, 5927, 5928, 5930, 5932, 5933, 5934, 5935, 5939, 5940, 5946, 5947, 5948, 5949, 5952, 5954, 5955, 5956, 5958, 5959, 5961, 5962, 5964, 5965, 5968, 5970, 5971, 5972, 5973, 5977, 5978, 5980, 5983, 5986, 5987, 5992, 5993, 5996, 5997, 6000, 6002, 6003, 6004, 6005, 6006, 6008, 6009, 6010, 6011, 6012, 6013, 6017, 6018, 6019, 6020, 6025, 6027, 6030, 6033, 6035, 6036, 6039, 6041, 6042, 6045, 6049, 6050, 6051, 6055, 6059, 6063, 6064, 6065, 6067, 6070, 6072, 6073, 6075, 6077, 6078, 6081, right Primer: 5745, 5748, 5751, 5754, 5756, 5758, 5760, 5764, 5766, 5767, 5768, 5769, 5771, 5773, 5774, 5776, 5779, 5781, 5783, 5786, 5788, 5789, 5790, 5795, 5796, 5798, 5800, 5802, 5804, 5806, 5807, 5809, 5811, 5813, 5818, 5820, 5821, 5822, 5823, 5825, 5826, 5827, 5828, 5830, 5831, 5836, 5837, 5839, 5842, 5843, 5845, 5846, 5847, 5848, 5850, 5852, 5855, 5856, 5858, 5861, 5864, 5866, 5867, 5870, 5871, 5872, 5873, 5875, 5876, 5877, 5878,5879, 5880, 5881, 5884, 5886, 5888, 5889, 5890, 5891, 5892, 5893, 5898, 5899, 5900, 5903, 5905, 5907, 5910, 5913, 5916, 5921, 5924, 5929, 5931, 5936, 5937, 5938, 5942, 5943, 5944, 5945, 5950, 5953, 5957, 5960, 5963, 5966, 5969, 5975, 5976, 5981, 5984, 5988, 5990, 5991, 5994, 5998, 5999, 6001, 6007, 6014, 6015, 6016, 6021, 6023, 6024, 6026, 6028, 6031, 6032, 6034, 6037, 6038, 6040, 6043, 6046, 6048, 6053, 6054, 6056, 6058, 6060, 6062, 6066, 6068, 6074, 6076, 6079, 6083, 6084, Detection: 5746, 5749,5 752, 5755, 5757, 5761, 5765, 5772, 5784, 5799, 5805, 5815, 5819, 5829, 5851, 5869, 5901, 5908, 5911, 5914, 5917, 5925, 5941, 5951, 5967, 5974, 5979, 5982, 5985, 5989, 5995, 6022, 6029, 6044, 6047, 6052, 6057, 6061, 6069, 6071, 6080, 6082, SEQ ID NO: 10 left Psimer. 6085, 6089, 6090, 6093, 6096, 6098, 6100, 6106, 6110, 6111, 6114, 6118, 6121, 6127, 6130, 6133, 6135, 6137, 6138, 6141, 6143, 6145, 6148, 6150, 6151, 6152, 6153, 6154, 6156, 6159, 6160, 6162, 6163, 6166, 6167, 6168, 6169, 6170, 6171, 6172, 6175, 6177, 6180, 6183, 6187, 6188, 6190, 6193, 6194, 6195, 6196, 6198, 6201, 6202, 6204, 6207, 6211, 6212, 6214, 6215, 6216, 6218, 6219, 6220, 6222, 6225, 6226, 6230, 6235, 6239, 6241, 6242, 6243, 6244, 6245, 6247, 6250, 6252, 6254, 6259, 6260, 6261, 6264, 6265, 6268, 6270, 6273, 6275, 6278, 6280, 6282, 6286, 6287, 6288, 6291, 6293, 6298, 6299, 6300, 6302, 6303, 6305, 6307, 6308, 6312, 6313, 6314, 6315, 6316, 6317, 6318, 6320, 6321, 6323, 6325, 6327, 6328, 6334, 6335, 6337, 6340, 6341, 6344, 6348, 6350, 6353, 6354, 6357, 6360, 6362, 6364, 6368, 6372, 6374, 6377, 6378, 6383, 6386, 6392, 6394, 6398, 6400, 6404, 6405, 6409, 6410, 6411, 6417, 6418, 6424, 6426, 6429, 6431, 6432, 6433, 6435, 6436, 6437, 6438, 6440, 6442, 6445, 6446, 6448, 6449, 6452, 6455, 6457, 6458, 6461, 6462, 6463, 6464, 6465, 6470, 6473, 6475, 6478, 6480, 6481, 6484, 6485, 6486, 6489, 6491, 6492, 6494, 6498, 6502, 6504, 6505, 6507, 6511, 6513, 6514, right Primer: 6086, 6088, 6091, 6094, 6097, 6099, 6101, 6103, 6105, 6108, 6112, 6115, 6116, 6117, 6119, 6120, 6122, 6123, 6125, 6126, 6128, 6131, 6132, 6134, 6136, 6139, 6142, 6144, 6146, 6149, 6155, 6157, 6161, 6164, 6173, 6174, 6176, 6178, 6181, 6182, 6184, 6186, 6189, 6191, 6192, 6197, 6199, 6200, 6205, 6206, 6208, 6210, 6213, 6221, 6223, 6224, 6227, 6229, 6231, 6232, 6233, 6234, 6236, 6237, 6238, 6240, 6246, 6248, 6251, 6253, 6255, 6256, 6257, 6258, 6262, 6266, 6269, 6271, 6272, 6274, 6276, 6277, 6281, 6283, 6284, 6285, 6289, 6292, 6294, 6295, 6296, 6297, 6301, 6304, 6306, 6309, 6310, 6311, 6319, 6322, 6324, 6326;
6329, 6330, 6331, 6333, 6336, 6338, 6342, 6345, 6347, 6349, 6351, 6355, 6356, 6358, 6359, 6361, 6365, 6367, 6369, 6371, 6373, 6375, 6376, 6379, 6381, 6382, 6384, 6387, 6388, 6389, 6390, 6393, 6395, 6397, 6399, 6401, 6402, 6403, 6406, 6407, 6412, 6413, 6414, 6415, 6416, 6419, 6420, 6421, 6422, 6423, 6425, 6427, 6428, 6434, 6441, 6443, 6444, 6447, 6450, 6451, 6453, 6459, 6460, 6466, 6467, 6468, 6469, 6471, 6472, 6474, 6476, 6479, 6482, 6487, 6490, 6493, 6496, 6497, 6499, 6500, 6501, 6503, 6506, 6508, 6510, 6512, Deteotioa: 6087, 6092, 6 095, 6102, 6104, 6107, 6109, 6113, 6124, 6129, 6140, 6147, 6158, 6165, 6179, 6185, 6203, 6209, 6217, 6228, 6249, 6263, 6267, 6279, 6290, 6332, 6339, 6343, 6346, 6352, 6363, 6366, 6370, 6380, 6385, 6391, 6396, 6408, 6430, 6439, 6454, 6456, 6477, 6483, 6488, 6495, 6509, SEQ ID NO: 11 left Primer. 6515, 6518, 6521, 6522, 6523, 6524, 6528, 6532, 6535, 6539, 6549, 6560, 6561, 6564, 6566, 6567, 6570, 6573, 6576, 6577, 6578, 6579, 6583, 6584, 6585, 6586, 6587, 6590, 6591, 6594, 6596, 6597, 6603, 6605, 6608, 6609, 6610, 6611, 6612, 6615, 6625, 6630, 6632, 6633, 6634, 6638, 6639, 6642, 6643, 6644, 6647, 6650, 6655, 6657, 6658, 6659, 6661, 6663, 6664, 6665, 6669, 6671, 6674, 6677, 6678, 6679, 6680, 6681, 6682, 6686, 6687, 6688, 6689, 6690, 6691, 6693, 6695, 6696, 6697, 6699, 6701, 6703, 6704, 6705, 6706, 6707, 6708, 6710, 6711, 6712, 6713, 6717, 6718, 6720, 6721, 6722, 6725, 6727, 6732, 6734, 6735, 6739, 6741, 6745, 6748, 6751, 6755, 6759, 6762, 6764, 6767, 6770, 6772, 6773, 6774, 6777, 6778, 6782, 6785, 6786, 6787, 6790, 6791, 6794, 6795, 6796, 6798, 6800, 6802, 6803, 6806, 6811, 6814, 6815, 6818, 6824, 6829, 6834, 6835, 6842, right Primer: 6516, 6519, 6525, 6526, 6527, 6529, 6531, 6533, 6536, 6537, 6538, 6540, 6541, 6542, 6543, 6544, 6545, 6546, 6547, 6548, 6550, 6551, 6552, 6553, 6554, 6556, 6558, 6562, 6563, 6565, 6568, 6571, 6572, 6575, 6580, 6582, 6588, 6589, 6592, 6595, 6598, 6599, 6600, 6601, 6602, 6604, 6606, 6607, 6613, 6614, 6617, 6618, 6619, 6620, 6621, 6623, 6624, 6627, 6628, 6629, 6631, 6635, 6640, 6641, 6645, 6646, 6649, 6651, 6652, 6653, 6656, 6660, 6662, 6666, 6668, 6670, 6672, 6675, 6676, 6683, 6685, 6692, 6694, 6698, 6700, 6702, 6709, 6714, 6715, 6716, 6719, 6723, 6726, 6728, 6730, 6731, 6736, 6738, 6740, 6742, 6744, 6746, 6747, 6749, 6752, 6754, 6756, 6757, 6758, 6760, 6761, 6765, 6769, 6775, 6779, 6781, 6783, 6784, 6789, 6792, 6797, 6799, 6801, 6804, 6805, 6807,,6809, 6810, 6812, 6816, 6817, 6819, 6821, 6822, 6825, 6827, 6828, 6830, 6831, 6832, 6833, 6836, 6837, 6838, 6839, 6840, 6841, 6843, Dctection: 6517, 6520, 6 530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, SEQ ID NO: 12 left Primea: 6844, 6848, 6850, 6852, 6854, 6857, 6859, 6861, 6862, 6865, 6868, 6870, 6871, 6872, 6874, 6875, 6876, 6880, 6883, 6886, 6887, 6888, 6890, 6891, 6894, 6896, 6897, 6898, 6899, 6900, 6901, 6902, 6904, 6905, 6906, 6910, 6912, 6917, 6920, right Primer: 6845, 6847, 6849, 6851, 6853, 6855, 6858, 6860, 6863, 6866, 6869, 6873, 6877, 6879, 6881, 6882, 6884, 6889, 6892, 6893, 6895, 6907, 6908, 6909, 6911, 6913, 6915, IZI
'Z1IL 'IIIL '80IL 'LOIL '90IL '501L '~OIL 'I0I1. '860L '560L 'b60L '~60L 'Z60L
'~80L 'Z80L
'ISOL '080L 'BLOL 'SLOL '~L0L 'ILOL 'OLOL '890L '990L 'S90L '~901. 'Z90L 'I90L
'LSOL 'VSOL
'~S0L 'I S0L '6irOL 'BbOL 'LtOL 'ML 'SbOL 'bbOL '~bOL 'ZtrOL 'Ii-OL '6~0L
'8~0L 'S~OL 't-~OL
'~~OL 'I~OL '6Z0L 'BZOL '9ZOL 'SZOL '~ZOL 'OZOL '8I0L '910L 'bIOL 'ZIOL 'IIOL
'0I0L '600L
'L00L 'SOOL '~OOL '100L '6669 '9669 '~669 '1669 '0669 '6869 'L869 'b869 ugum.d ASu SZ
'OZtrL 'LIt-L '9I$,L 'SIbL '~IVL '0Ii-L 'SOtiL 'ZOtiL 'IOtiL 'L6~L 'b6~L 'Z6~L
'i6~L
'06~L 'L8~L 'S8~L 'I8~L '8L~L 'SL~L 'bL~L 'ZL~L 'Z9~L '09~L '8S~L 'SS~L '~S~L
'09~L 'tib~L
'It~L 'Ob~L '6~~L '9~~L 'b~~L 'Z~~L 'I~~L '6Z~L 'SZ~L 'bZ~L 'IZ~L 'OZ~L 'SI~L
'bI~L 'II~L
'OI~L '60~L '90~L '~0~L 'ZO~L '66ZL 'S6ZL 'I6ZL 'L8ZL 'ti8ZL '~8ZL 'I8ZL '08ZL
'6LZL '8LZL
',GLZ,L '9LZL 'ZLZL '69ZL '89ZL '99ZL 'S9ZL 'tr9ZL '~9ZL '09ZL '95ZL 'SSZL
'ISZL '6tiZL '8frZL OZ
'9VZL 'SbZL '~trZL '6~ZL 'L~ZL 'S~ZL '~~ZL '0~ZL 'BZZL 'LZZL 'IZZL 'OZZL '91ZL
'tiIZL '~IZL
'80ZL''L40ZL 'SOZL 'bOZL '~OZL 'ZOZL '661L '1-6IL 'Z6IL 'L8IL '98tL '581L
'EBIL '181L '081L
'8L1L 'SLIL 'ZLIL '89IL '99IL 'S91L '~9IL '091L '6SIL 'BSIL '6fiiL 'BVIL '9bIL
'trblL 'ObIL
'6~IL '8~IL '9~IL '5~1L '~~IL 'I~IL 'hZIL '~ZIL 'IZIL '811L 'SIIL 'VIIL '~IIL
'OIIL '60IL
'ZOIL '001L '460L '960L 'I60L '060L '880L '880L 'LSOL '980L 'S80L '480L 'LLOL
'9LOL 'bLOL SI
'ZLOL 'L90L 'tr90L '090L '6S0L '850L '9S0L 'SSOL 'ZSOL 'OSOL 'OvOL 'L~OL '9~0L
'Z~OL '0~OL
'LZOL 11ZOL 'ZZOL 'L10L '~I0L 1900L 'ZOOL '8669 'S669 'Z669 '9869 '~869 ~ZmPd NaI
vox cii aas 'Z869 48L69 4Ib69 '8~69 '9Z69 '~Z69 -U?PQlaQ 01 'I869 'LL69 'SL69 'bL69 'iL69 '0L69 'L969 '9969 '~969 'Z969 '0969 '8569 '1569 '9569 'ZS69 '0569 'SV69 '"69 'Zb69 '9~69 'b~69 'Z~69 'I~69 '0~69 '6Z69 'SZ69 'ZZ69 :-Mm.ud lqfP

'0869 '6L69 '91.69 '~1.69 'ZL69 '6969 '8969 '9969 '17969 '1969 46569 '9969 '17569 '~569 '1S69 '61,69 *69 'Ltr69 '91r69 '~1169 '0tr69 '6~69 'L~69 'S~69 '~~69 '8Z69 'LZ69 'tiZ69 'IZ69 =Mud $ai S

~I :ON (IIbas '6169 'tii69 '~069 '5889 '8L89 'L989 't989 '9589 '9V89 =uo9mpQ

'8169 '9I69 ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

7116, 7119, 7122, 7125, 7126, 7127, 7128, 7129, 7130, 7132, 7134, 7137, 7141, 7142, 7143, 7147, 7150, 7152, 7154, 7155, 7156, 7157, 7161, 7167, 7170, 7171, 7173, 7174, 7176, 7177, 7179, 7182, 7184, 7188, 7189, 7190, 7191, 7193, 7195, 7196, 7197, 7198, 7200, 7206, 7210, 7211, 7212, 7215, 7217, 7218, 7219, 7222, 7223, 7224, 7225, 7226, 7229, 7231, 7232, 7236, 7240, 7241, 7242, 7244, 7247, 7250, 7253, 7254, 7257, 7258, 7259, 7261, 7262, 7267, 7270, 7271, 7273, 7274, 7275, 7282, 7285, 7289, 7290, 7292, 7293, 7294, 7296, 7297, 7298, 7301, 7304, 7307, 7308, 7312, 7316, 7317, 7318, 7319, 7322, 7326, 7328, 7330, 7333, 7335, 7337, 7342, 7345, 7347, 7348, 7349, 7351, 7354, 7356, 7357, 7359, 7361, 7363, 7364, 7365, 7366, 7367, 7368, 7369, 7370, 7371, 7373, 7376, 7379, 7382, 7383, 7384, 7386, 7388, 7389, 7393, 7395,7398,7400,7403,7404,7407,7408,7409,7411,7419,7421, Detection: 6985, 6988, 6994, 6997, 7000, 7004, 7008, 7015, 7019, 7021, 7069, 7079, 7099, 7104, 7117, 7120, 7145, 7151, 7153, 7162, 7164, 7169, 7201, 7209, 7234, 7238, 7252, 7286, 7288, 7300, 7305, 7313, 7323, 7327, 7338, 7343, 7346, 7352, 7377, 7380, 7396, 7399, 7406, 7412, 7414, 7418, SEQ II) NO: 47 left Prnner: 7422, 7425, 7427, 7435, 7438, 7439, 7440, 7442, 7444, 7448, 7449, 7456, 1 7459, 7462, 7463, 7465, 7466, 7467, 7470, 7471, 7474, 7476, 7477, 7480, 7481, 7485, 7486, 7489, 7490, 7493, 7496, 7500, 7503, 7508, 7512, 7518, 7519, 7520, 7522, 7524, 7525, 7527, 7528, 7529, 7532, 7540, 7542, 7543, 7545, 7549, 7552, 7554, right Primer: 7423, 7426, 7428, 7430, 7431, 7432, 7433, 7434, 7436, 7445, 7446, 7447, 7450, 7451, 7452, 7453, 7454, 7455, 7457, 7460, 7464, 7468, 7472, 7475, 7478, 7479, 7482, 7483, 7484, 7487, 7488, 7492, 7494, 7495, 7497, 7498, 7499, 7501, 7505, 7506, 7507, 7509, 7510, 7511, 7513, 7515, 7516, 7517, 7521, 7523, 7526, 7530, 7533, 7534, 7535, 7536, 7537, 7538, 7539, 7541, 7544, 7546, 7547, 7548, 7550, Detection: 7424, 7429,7437, 7441, 7443, 7458, 7461, 7469, 7473, 7491, 7502, 7504, 7514, 7531, 7551, 7553, SEQ ID NO: 18 ~ZI
'ZLBL 'ILBL '0L8L '698L '998L 't98L 'I98L '8S8L '998L '558L 't'S8L '~S8L '08L
'8v8L 'LbBL
'9"L 'bb8L 'ZV8L 'Ifi8L '0"L '8~8L '9~8L '9~84 '~~8L '0~8L '6Z8L 'LZBL 'SZSL
'IZ8L '8I8L
'9I8L 11I8L '~I8L 'ZI8L '808L '~08L 'Z08L '008L '86LL '96LL 'mLL ULL ULL 'I6LL
'68LL
'SBLL 'f~8LL '~8LL 'I8LL '6LLL '9LLL '~LLL 'ILLL '89LL 'L9LL '99LL 'Z9LL
301M.d Tou 'I66L '886L SZ
'L86L '986L 'S86L '~86L 'Z86L '186L '086L '6L6L '9L6L '~L6L 'ZL6L 'IL6L '896L
'b96L '~96L
'LS6L '996L '5S6L '1pS6L '~S6L 'ZS6L 'I96L '0S6L '81,6L '9b6L 'Sti6L 'Ib6L
'L~6L 'tr~6L '~~6L
'8Z6L '9Z6L 'SZ6L 'ZZ6L 'LI6L '~I6L '0I6L '606L 'LO6L 'b06G 'ZO6L '006L '968L
'b68L 'Z68L
'688L 'S88L 'I88L 'VL8L '898L 'S98L '~98L '098L 'LS8L 'Z58L 'I58L '0181 '~b8L
'6~8L 'L~8L
'b~8L 'Z~8L '8Z8L 'tiZ8L '~Z8L 'ZZ8L 'OZ8L '6I8L 'LI8L '9I8L 'II8L '0I8L '608L
'L08L 'S08L OZ
'66LL ULL ULL '88LL '98LL 'Z8LL 'BLLL 'SLLL 'YLLL 'OLLL 'b9LL 'I9LL ~~T~d PI
oz :ou cu ass '90LL '969L '~69L '899L 'S99L ' ~59L 'ML 'i'~9L
'Z~9L '0~9L 'SZ9L 'ZI9L 'S09L 'Z09L 'Z65L 'ZLSL '69SL 'V9S L'Z9SL 'LSSL
MoW1a1a(i SI
'09LL '6SLL
'LSLL 'St~LL '~bLL 'Zf~LL '6~LL 'L~LL 'Z~LL ' I ~LL 'OELL 'LZLL 'SLLL 'VZLL
'~ZLL 'ZZLL 'IZLL
'6ILL 'LILL 'SILL 'OILL '80LL '50LL '~OLL 'OOLL '869L '169L '569L 'Z69L '8891.
'9891. 'mL
'I89L '089L '6L9L '8L9L 'SL9L '~L9L ' I L9L 'OL9L '699L '09L '999L 'E99L 'Z99L
'099L 46S9L
'8S9L 'L59L '9S9L *S9L 'Z59L '099L '09L '9V9L 'S'b9L 'iV9L 'Zb9L 'It9L '0V9L
'6~9L '8~9L 01 'L~9L 'I ~9L '8Z9L '9Z9L 'tiZ9L 'ZZ9L '6I9L 'LI9L '919L 'irI9t '~I9L 'I I9L
'809L 'L09L 't-09L
'I09L '66SL 'S6SL 'b65L '~6SL 'I69L 'i-85L '~8SL '895L '~9SL '19SL '9SSL =M!d Wu '89LL '9SLL 'SSLL *SLL '~SLL 'ZSLL ' I SLL 'OSLL '6ti.LL 'WL
'L'PLL '9'bLL '6VLL 'IftL '011 ULL '9~LL 'S~LL 'ti~LL '~~LL '6ZL4 '8ZLL '9ZLL
'OZLL 'BILL
'9ILL 'tiILL '~ILL 'ZILL 'IILL '60LL 'LOLL '1i0LL 'ZOLL 'IOLL '669L 'fi69L
'169L '069L '689L S
'L89L 'S89L '~891.'Z89L 'LL9L '9L9L 'tL9L 'ZL9L '999L 'I99L 'SS9L 'I59L 'Ltr9L
'~tr9L '9~9L
'5~9L '~~9L '6Z9L 'LZ9L '~Z9L 'IZ9L '0Z9L '8I9L 'SI9L '0I9L '609L '909L '~09L
'009L '86SL
'L6SL '969L '069L '68SL '885L 'L85L '98SL 'S8SL 'ZBSL 'IBSL '08SL '6LSL 'BLSL
'LLSL '9LSL
'SLSL 'tLSL '~LSL 'ILSL 'OLSL 'L95L '995L 'S9SL '09SL '659L 'BSSL 'SSSL uOtWd )PI

~Z-ZT-SOOZ ~588ZSZ0 Fi'J

7873, 7875, 7877, 7878, 7879, 7880, 7882, 7884, 7886, 7888, 7890, 7897, 7899, 7903, 7905, 7912, 7914, 7916, 7918, 7919, 7920, 7921, 7923, 7929, 7931, 7932, 7936, 7938, 7939, 7940, 7942, 7943, 7944, 7947, 7949, 7958, 7960, 7962, 7965, 7967, 7969, 7970, 7974, 7977, 7989, 7990, S Detection: 7763, 7766,7769, 7772, 7777, 7780, 7787, 7790, 7801, 7804, 7806, 7826, 7831, 7850, 7859, 7862, 7867, 7876, 7883, 7887, 7891, 7893, 7895, 7898, 7901, 7906, 7908, 7911, 7915, 7924, 7927, 7930, 7935, 7959, 7961, 7966, 7975, 7978, 7984, SEQ ID NO: 48 left Primer: 7992, 7995, 7996, 8000, 8003, 8006, 8007, 8010, 8012, 8015, 8016, 8018, 8019, 8026, 8027, 8030, 8034, 8035, 8038, 8039, 8043, 8044, 8046, 8049, 8050, 8052, 8053, 8055, 8056, 8062, 8064, 8066, 8067, 8068, 8069, 8070, 8071, 8074, 8076, 8077, 8078, 8079, 8080, 8081, -right Primer: 7993, 7997, 7999, 8001, 8004, 8005, 8008, 8009, 8011, 8013, 8017, 8020, 8021, 8022, 8023, 8024, 8025, 8028, 8031, 8033, 8036, 8040, 8042, 8047, 8051, 8054, 8057, 8059, 8060, 8061, 8065, 8072, 8073, 8075, 8082, 8083, 8084, 8085, 8087, 8088, Detection: 7994, 7998, 8002, 8014, 8029, 8032, 8037, 8041, 8045, 8048, 8058, 8063, 8086, SEQ ID NO: 50 left Primer 8090, 8093, 8095, 8098, 8100, 8101, 8102, 8104, 8107, 8110, 8111, 8114, 8115, 8116, 8118, 8122, 8124, 8126, 8127, 8129, 8132, 8134, 8136, 8138, 8142, 8143, 8144, 8146, 8151, 8157,. 8160, 8163, 8165, 8168, 8169, 8170, 8173, 8174, 8175, 8176, 8178, 8181, 8185, 8187, 8188, 8189, 8190, 8191, 8193, 8194, 8200, 8203, 8206, 8208, 8209, 8212, 8214, 8216, 8217, 8220, 8222, 8224, 8228, 8230, right Primer: 8091, 8094, 8096, 8099, 8103, 8105, 8108, 8112, 8113, 8117, 8119, 8121, 8123, 8125, 8128, 8130, 8131, 8133, 8135, 8137, 8139, 8145, 8147, 8148, 8149, 8150, 8152, 8153, 8154, 8155, 8156, 8158, 8161, 8164, 8166, 8167, 8171, 8177, 8179, 8180, 8182, 8183, 8184, 8186, 8192, 8195, 8197, 8198, 8199, 8201, 8202, 8204, 8207, 8210, 8213, 8218, 8221, 8223, 8225, 8227, 8229, 8231, Detectiog: 8092, 8097, 8106, 8109, 8120, 8140, 8141, 8159, 8162, 8172, 8196, 8205, 8211, 8215, 8219, 8226, SEQ ID NO:19 left Primer. 8232, 8235, 8236, 8237, 8238, 8244, 8245, 8247, 8250, 8251, 8253, 8254, 8255, 8256, 8258, 8259, 8260, 8263, 8267, 8269, 8270, 8273, 8274, 8277, 8280, 8281, 8289, 8292, 8293, 8294, 8295, 8296, 8297, 8298, 8301, 8305, 8306, 8310, 8311, 8312, 8315, 8317, 8318, 8322, 8323, 8324, 8327, 8328, 8329, 8330, 8333, 8336, 8339, 8340, 8347, 8349, 8350, 8352, 8353, 8356, 8359, 8360, 8366, 8369, 8370, 8372, 8374, 8376, 8377, 8379, 8381, 8382, 8383, right Primer. 8233, 8239, 8240, 8242, 8243, 8246, 8248, 8252, 8257, 8261, 8264, 8266, 8268, 8271, 8275, 8278, 8282, 8284, 8285, 8286, 8287, 8288, 8291, 8299, 8302, 8303, 8304, 8307, 8309, 8313, 8314, 8316, 8319, 8321, 8325, 8326, 8331, 8332, 8334, 8335, 8337, 8341, 8342, 8343, 8344, 8345, 8346, 8348, 8351, 8354, 8357, 8361, 8362, 8363, 8364;
8365, 8367, 8371, 8373, 8375, 8378, Detection: 8234, 8241, 8 249, 8262, 8265, 8272, 8276, 8279, 8283, 8290, 8300, 8308, 8320, 8338, 8355, 8358, 8368, 8380, SEQ ID NO:17 left .Primer. 8384, 8387, 8390, 8391, 8397, 8398, 8401, 8402, 8405, 8406, 8409, 8414, 8418, 8419, 8422, 8425, 8428, 8431, 8432, 8433, 8435, 8437, 8440, 8444, 8449, 8452, 8454, 8455, 8457, 8462, 8464, 8466, 8468, 8469, 8472, 8475, 8476, 8478, 8479, 8481, 8484, 8487, 8488, 8490, 8493, 8496, 8497, 8498, 8501, 8505, 8508, 8511, 8513, 8515, 8517, 8518, 8519, 8521, 8522, 8523, 8526, 8528, 8530, 8531, 8532, 8534, 8536, 8541, 8544, 8547, 8551, 8554, 8556, 8558, 8560, 8562, 8563, 8566, 8567, 8568, 8570, 8571, 8574, 8575, 8576, 8577, 8580, 8581, 8585, 8588, 8591, 8594, 8601, 8602, 8603, 8608, 8609, 8613, 8614, 8617, 8618, 8619, 8620, 8623, 8624, 8628, 8629, 8630, 8633, 8634, 8635, 8636, 8638, 8643, 8645, 8648, 8654, 8657, 8658, 8659, 8660, 8661, 8662, 8666, 8670, 8672, 8674, 8676, 8681, 8683, 8686, 8688, 8689, 8691, 8692, 8693, 8695, 8696, 8700, 8701, 8702, 8703, 8704, 8705, 8709, 8716, 8717, 8719, 8722, 8725, 8727, 8728, 8729, 8732, 8733, 8734, 8735, 8736, right Primer. 8385, 8388, 8392, 8394, 8395, 8399, 8403, 8407, 8410, 8411, 8412, 8413, 8415, 8416, 8420, 8423, 8424, 8426, 8429, 8434, 8436, 8438, 8442, 8445, 8446, 8447, 8448, 8450, 8451, 8456, 8458, 8460, 8461, 8463, 8465, 8467, 8470, 8473, 8474, 8477, 8480, 8482, 8485, 8486, 8489, 8491, 8492, 8494, 8499, 8500, 8502, 8503, 8504, 8506, 8510, 8512, 8514, 8516, 8520, 8524, 8527, 8529, 8533, 8535, 8537, 8539, 8542, 8545, 8546, 8548, 8550, 8552, 8555, 8557, 8564, 8565, 8569, 8572, 8578, 8582, 8583, 8586, 8587, 8589, 8592, 8595, 8596, 8597, 8598, 8599, 8600, 8604, 8606, 8607, 8610, 8612, 8615, 8616, 8621, 8625, 8627, 8631, 8632, 8637, 8639, 8640, 8641, 8642, 8644, 8646, 8647, 8649, 8650, 8651, 8652, 8653, 8655, 8663, 8665, 8667, 8668, 8669, 8671, 8673, 8675, 8677, 8678, 8679, 8680, 8682, 8684, 8685, 8687, 8690, 8694, 8697, 8698, 8699, 8706, 8707, 8708, 8710, 8711, 8712, 8713, 8714, 8715, 8718, 8720, 8723, 8726, 8730, 8737, Detection: 8386, 8389, 8393, 8396, 8400, 8404, 8408, 8417, 8421, 8427, 8430, 8439, 8441, 8443, 8453, 8459, 8471, 8483, 8495, 8507, 8509, 8525, 8538, 8540, 8543, 8549; 8553, 8559, 8561, 8573, 8579, 8584, 8590, 8593, 8605, 8611, 8622, 8626, 8656, 8664, 8721, 8724, 8731, SEQ ID NO: 23 left Primer: 8738, 8741, 8744, 8747, 8750, 8751, 8753, 8754, 8755, 8756, 8759, 8760, 8762, 8763, 8766, 8767, 8768, 8769, 8770, 8772, 8775, 8776, 8777, 8779, 8782, 8783, 8784, 8785, 8786, 8787, 8788, 8789, 8790, 8793, 8794, 8796, 8798, 8799, 8801, 8803, 8804, 8806, 8807, 8809, 8812, 8813, 8815, 8820, 8823, 8826, 8829, 8830, 8832, 8835, 8836, 8837; 8842, 8845, 8846, 8847, 8851, 8853, 8856, 8857, 8859, 8861, 8866, 8739, 8878, 8879, 8880, 8884, 8891, 8893, 8895, 8898, 8900, 8901, 8909, 8912, right Primer: 8739, 8742, 8745, 8748, 8749, 8752, 8757, 8758, 8761, 8764, 8771, 8773, 8778, 8780, 8791, 8797, 8800, 8802, 8805, 8808, 8810, 8814, 8816, 8818, 8819, 8821, 8824, 8827, 8828, 8831, 8833, 8838, 8840, 8841, 8755, 8843, 8844, 8848, 8850, 8852, 8854, 8855, 8863, 8864, 8865, 8867, 8868, 8869, 8870, 8871, 8872, 8873, 8874, 8876, 8877, 8881, 8882, 8883, 8885, 8887, 8888, 8889, 8890, 8892, 8894, 8896, 8897, 8899, 8902, 8785, 8903, 8904, 8905, 8906, 8907, 8908, 8911, Detection: 8740, 8743, 8 746, 8765, 8774, 8781, 8792, 8795, 8811, 8817, 8822, 8825, 8834, 8839, 8849, 8858, 8860, 8862, 8875, 8886, 8910, SEQ ID NO: 21 left Primer: 8913, 8917, 8920, 8923, 8924, 8929, 8931, 8934, 8935, 8936, right Primer: 8914, 8916, 8918, 8921, 8925, 8927, 8928, 8930, 8932, 8933, 8937, betection: 8915, 8919, 8922, 8926, SEQ ID NO: 32 left Primer: 8938, 8944, 8945, 8948, 8952, 8953, 8954, 8957, 8958, 8961, 8962, 8965, 8967, 8969, 8970, 8971, 8972, 8977, right Primer 8939, 8941, 8942, 8943, 8946, 8949, 8950, 8951, 8955, 8960, 8963, 8964, 8966, 8968, 8974, 8975, 8976, 8978, 8979, Detection: 8940, 8947, 8956, 8959, 8973, SEQ ID NO: 33 left Prnner: 8980, 8984, 8988, 8989, 8998, 9001, 9002, 9005, 9007, 9008, 9012, 9013, 9016, 9019, 9020, 9022, 9023, 9025, 9028, 9029, 9032, 9033, 9034, 9035y 9037, 9038, 9044, 9046, 9047, 9048, 9049, 9054, right Primer 8981, 8983, 8985, 8987, 8990, 8992, 8993, 8994, 8995, 8997, 8999, 9003, 9004, 9006, 9009, 9010, 9011, 9014, 9017, 9018, 9021, 9024, 9026, 9030, 9036, 9039, 9041, 9042, 9043, 9045, 9050, 9051, 9052, 9053, Detection: 8982, 8986, 8991, 8996, 9000, 9015, 9027, 9031, 9040, SEQID NO:34 left Primer. 9055, 9058, 9060, 9063, 9066, 9067, 9068, 9069, 9070, 9071, 9074, 9075, 9077, 9078, 9079, 9080, 9082, 9084, 9088, 9089, 9090, 9099, 9103, 9104, 9105, 9107, 9111, right Primer: 9056, 9061, 9064, 9072, 9081, 9083, 9085, 9086, 9087, 9091, 9092, 9093, 9094, 9095, 9096, 9097, 9098, 9100, 9102, 9106, 9108, 9109, 9110, 9112, Detection: 9057, 9059, 9062, 9065, 9073, 9076, 9101, SEQID NO:24 left Primer: 9113, 9116, 9118, 9125, 9126, 9128, 9129, 9130, 9136, 9141, 9143, 9148, 9150, 9153, 9157, 9158, 9159, 9163, 9164, 9165, 9167, 9168, 9171, 9173, 9177, 9180, 9181, 9182, 9183, 9185, 9187, 9188, 9189, 9191, 9192, 9193, 9194, 9197, 9198, 9200, 9206, 9207, 9208, 9209, 9211, 9216, 9218, 9219, 9220, 9221, 9222, 9223, 9226, 9228, 9229, 9230, 9231, 9232, 9233, 9234, 9237, 9238, 9240, 9243, 9246, 9248, 9253, 9256, 9257, 9260, 9263, 9264, 9266, 9269, 9271, 9279, 9280, 9281, 9282, 9283, 9284, 9290, right Pri.mer: 9114, 9119, 9121, 9122, 9123, 9124, 9127, 9131, 9133, 9134, 9135, 9137, 9138, 9139, 9140, 9142, 9144, 9146, 9147, 9149, 9151, 9152, 9154, 9155, 9156, 9160, 9162, 9166, 9169, 9172, 9174, 9175, 9176, 9178, 9184, 9186, 9190, 9195, 9199, 9201, 9202, 9203, 9204, 9205, 9212, 9214, 9215, 9217, 9224, 9227; 9235, 9239, 9241, 9244, 9247, 9249, 9251, 9252, 9254, 9258, 9261, 9265, 9267, 9270, 9273, 9274, 9275, 9276, 9277, 9278, 9285, 9286, 9287, 9288; 9289, 9291, Detection: 9115, 9117, 9 120, 9132, 9145, 9161, 9170, 9179, 9196, 9210, 9213, 9225, 9236, 9242, 9245, 9250, 9255, 9259, 9262, 9268, 9272, SEQ ID NO: 35 left Primer: 9292, 9295, 9297, 9300, 9302, 9303, 9304, 9307, 9308, 9310, 9311, 9313, 9319, 9321, 9323, 9324, 9328, 9333, 9334, 9337, 9338, 9339, 9342, 9344, 9348, 9351, 9352, 9354, 9355, 9357, 9360, 9367, 9371, 9374, 9377, 9379, 9383, 9384, 9385, 9388, 9389, 9390, 9393, 9394, 9398, 9401, 9402, 9406, 9408, 9409, 9410, 9413, 9415, 9416, 9417, 9418, 9419, 9421, 9422, 9425, 9429, 9433, 9434, 9435, 9436, 9437, 9439, 9440, 9446, 9452, 9453, 9454, 9455, 9457, 9458, 9459, 9462, 9466, 9467, 9468, 9470, 9474, 9479, 9482, 9487, 9488, 9489, 9492, 9495, 9497, 9499, 9500, 9504, 9505, 9508, 9513, 9514, 9519, 9522, 9523, 9524, 9526, 9528, 9532, 9533, 9534, 9535, 9537, 9538, 9541, 9542, 9543, 9545, 9546, 9548, right Primer: 9293, 9296, 9298, 9301, 9305, 9309, 9312, 9314, 9316, 9317, 9318, 9320, 9322, 9325, 9326, 9327, 9329, 9331, 9332, 9335, 9336, 9340, 9345, 9347, 9349, 9353, 9356, 9358, 9361, 9363, 9364, 9365. 9368, 9370, 9372, 9375, 9376, 9378, 9380, 9382, 9386, 9391, 9395, 9397, 9399, 9400, 9403, 9405, 9407, 9411, 9412, 9414, 9420, 9423, 9424, 9426, 9428, 9430, 9431, 9432, 9438, 9441, 9443, 9444, 9445, 9447, 9448, 9449, 9450, 9451, 9456, 9460, 9461, 9464, 9465, 9469, 9471, 9473, 9475, 9477, 9478, 9480, 9483, 9485, 9490, 9493, 9494, 9496, 9498, 9501, 9502, 9503, 9506, 9509, 9511, 9512, 9515, 9516, 9517, 9518, 9520, 9521, 9525, 9527, 9529, 9530, 9536, 9539, 9544, 9547, 9549, 9550, Detection: 9294, 9299, 9 306, 9315, 9330, 9341, 9343, 9346, 9350, 9359, 9362, 9366, 9369, 9373, 9381, 9387, 9392, 9396, 9404, 9427; 9442, 9463, 9472, 9476, 9481, 9484, 9486, 9491, 9507, 9510, 9531, 9540, SEQ ID NO: 25 left Primer: 9551, 9555, 9556, 9557, 9559, 9560, 9563, 9564, 9565, 9566, 9569, 9570, 9573, 9577, 9578, 9579, 9580, 9585, 9586, 9587, 9588, 9591, 9593, 9596, right Primer. 9552, 9554, 9558, 9561, 9567, 9571, 9574, 9576, 9581, 9583, 9584, 9589, 9592, 9594, 9595, Detection: 9553, 9562, 9568, 9572, 9575, 9582, 9590, 9597, SEQ ID NO: 36 left Primer: 9598, 9602, 9604, 9605, 9608, 9612, 9613, 9614, 9617, 9618, 9621, 9622, 9625, 9626, 9627, 9632, 9633, 9638, 9640, 9643, 9644, 9645, 9646, 9651, 9654, 9656, 9657, 9658, 9661, 9662, 9665, 9666, 9667, 9668, 9672, 9673, 9675, 9676, 9677, 9680, 9683, 9686, 9688, 9691, 9694, 9698, 9699, 9702, 9705, 9707, 9710, 9711, 9715, 9719, 9720, 9722, 9723, 9726, 9729, 9732, 9733, 9735, 9737, 9738, 9741, 9744, 9745, 9746, 9747, 9748, 9749, 9750, 9754, 9755, 9756, 9758, 9759, 9768, 9771, 9772, 9776, 9777, 9781, 9782, 9784, 9787, 9789, 9790, 9792, 9796, 9797, 9800, 9805, 9806, 9812, 9815, 9818, 9821, 9823, 9825, 9827, 9831, 9832, 9835, 9837, 9839, 9841, 9842, 9844, 9845, 9851, 9853, 9854, 9855, 9857, 9860, 9862, 9863, 9865, 9871, 9873, 9875, 9878, 9879, right Primer: 9599, 9601, 9603, 9606, 9607, 9609, 9611, 9615, 9619, 9623, 9624, 9628, 9630, 9631, 9634, 9635, 9637, 9639, 9641, 9647, 9649, 9650, 9652, 9653, 9659, 9660, 9663, 9664, 9670, 9671, 9679, 9682, 9684, 9687, 9690, 9692, 9693, 9695, 9697, 9700, 9701, 9703, 9706, 9708, 9712, 9713, 9714, 9716, 9717, 9718, 9721, 9724, 9727, 9730, 9734, 9739, 9742, 9751, 9753, 9757, 9760, 9761, 9762, 9763, 9764, 9765, 9766, 9767, 9769, 9773, 9775, 9778, 9780, 9783, 9786, 9788, 9791, 9793, 9794, 9795, 9798, 9801, 9803, 9804, 9807, 9808, 9809, 9810, 9811, 9813, 9816, 9817, 9819, 9820, 9822, 9826, 9828, 9830, 9833, 9836, 9838, 9840, 9843, 9846, 9847, 9848, 9849, 9850, 9852, 9856, 9858, 9859, 9861, 9864, 9866, 9867, 9868, 9869, 9870, 9872, 9876, 9877, 9880, 9881, Detection: 9600, 9610, 9 616, 9620, 9629, 9636, 9642, 9648, 9655, 9669, 9674, 9678, 9681, 9685, 9689, 9696, 9704, 9709, 9725, 9728, 9731, 9736, 9740, 9743, 9752, 9770, 9774, 9779, 9785, 9799, 9802, 9814, 9824, 9829, 9834, 9874, SEQ ID NO: 28 left Primer. 9882, 9886, 9890, 9891, 9894, 9900, 9902, 9904, 9908, 9911, 9912, 9915, 9917, 9919, 9923, 9925, 9928, 9935, 9936, 9940, 9943, 9949, 9953, 9954, 9956, 9957, 9958, 9962, 9963, 9964, 9968, 9969, 9975, 9978, 9981, 9988, 9989, 9990, 9991, 9992, 9995, 9997, 10011, 10012, 10014, 10017, 10018, 10031,10032,10033,10034, 10035,10037, 10041, 10042, 10046, 10050, 10054, 10058, 10059, right Primer: 9883, 9885, 9887, 9889, 9892, 9893, 9895, 9896, 9897, 9898, 9899, 9901, 9903, 9905, 9907, 9909, 9913, 9914, 9916, 9918, 9920, 9921, 9922, 9924, 9926, 9929, 9931, 9932, 9933, 9934, 9937, 9938, 9939, 9941, 9942, 9944, 9945, 9946, 9947, 9948, 9950, 9952, 9955, 9959, 9960, 9961, 9966, 9967, 9970, 9972, 9973, 9974, 9976, 9979, 9980, 9982, 9983, 9984, 9985, 9986, 9987, 9993, 9994, 9996, 9998, 9999, 10000, 10001, 10002, 10003, 10004, 10005, 10006, 10007, 10008, 10009, 10010, 10013, 10015, 10016, 10019, 10020, 10021, 10022, 10023, 10025, 10026, 10027, 10028, 10030, 10036, 1003 8, 10040, 10043, 10044, 10045, 10047, 10048, 10049, 10051, 10053, 10055, 10056, 10057, 10060, Detection: 9884, 9888, 9906, 9910, 9927, 9930, 9951, 9965, 9971, 9977, 10024, 10029, 10039, 10052, SEQ ID NO: 37 left Primee 10061, 10064, 10067, 10068, 10070, 10071, 10072, 10074, 10079, 10081, 10083,10088,10091,10095, 10096,10097,10101,10103,10105,10106, 10109, 10110, 10111, 10113,10116,10118,10120,10122,10125,10126,10127, 10131, 10134,10137,10138,10144, 10147,10149,10151,10152,10155,10156, 10159,10160,10169,10172, 10174,10175, 10178, 10181, 10186,10188, 10189, 10190, 10191, 10192,10196,10199, 10203, 10204,10210,10211, 10216,10218,10221, 10224,10225, 10226,10229, 10230, 10231, 10232, 10234, 10239, 10241, 10244,10252,10253, 10257,10258, 10259,10261,10266, 10272, 10276, right Primer. 10062, 10065, 10069, 10075, 10077, 10078, 10080, 10082, 10084, 10086, 10087, 10089, 10090, 10092, 10093, 10094, 10098, 10099, 10100, 10102, 10104, 10107, 10112, 10114,10117,10119, 10121, 10123, 10124, 10129, 10130,10132,10133, 10135,10139, 10140, 10 141, 10142, 10143, 10145,10148, 10150, 10153, 10154, 10157, 10161, 10163, 10164, 10165, 10166, 10167, 10170, 10173, 10176, 10177, 10179, 10182, 10183, 10184, 10187, 10193, 10194, 10195, 10197, 10198, 10200, 10201, 10202, 10205, 10206, 10207, 10209, 10212, 10213, 10214, 10215, 10219, 10220, 10222, 10223, 10227, 10228, 10233, 10235, 10236, 10237, 10240, 10242, 10243, 10245, 10247, 10248, 10249, 10251, 10254, 10255, 10256, 10260, 10262, 10263, 10264, 10265, 10267, 10268, 10269, 10270, 10271, 10273, 10274, 10275, 10277, 10278, Detection: 10063, 10066, 10073, 10076, 10085, 10108, 10115, 10128, 10136, 10146, 10 158, 10162, 10168, 10171, 10180, 10185, 10208, 10217, 10238, 10246, 10250, SEQ ED NO: 26 left Primer: 10279, 10282, 10285, 10287, 10291, 10292, 10297, 10299, 10301, 10304, 10306, 10308, 10310, 10314, 10317, 10318, 10320, 10322, 10327, 10329, 10330, 10333, 10335, 10336, 10337, 10340, 10342, 10348, 10350, 10351, 10354, 10358, 10359, 10360, 10362, 10366, 10369, 10372, 10373, 10374, 10376, 10378, 10383, 10385, 10391, 10398, 10403, 10407, 10410, 10413, 10415, 10419, 10422, 10425, 10427,10428,10429,10430, 10432, 10433, 10434, 10437, 1043 8, 10439, 10442, 10443, 10445, 10446, 10447, 10448, 10452, 10453, 10454, 10455, 10456, 10460, 10463, 10466, 10467, 10469, 10470, 10473, 10475, 10477, 10480, 10484, 10488, 10490, 10494, 10495, 10497, 10501, 10502, 10503, 10507, 10508, 10510, 10517, 10518,10520, 10522, 10524, 10525, 10528, 10529, 10533, 10536, 10537, 10540, 10541, 10545, 10547, 10551, 10553, 10556,10559,10560, 10563,10564,10565,10568,10571,10574, 10576,10579,10581, 10583, 10588, 10589, 10590, 10592, 10593, 10596, 10597, 10601, 10602, 10603, 10605, 10607, 10609, 10610, 10612, 10613, 10617, 10618, 10621, 10624,10627, 10630, 10632, 10634, 10637, 10638, 10639, 10640, 10641, 10643, 10645, 10647, 10653, 10655, 10657, 10659, 10661, 10662, 10663, 10664,10665,10666,10667,10668, 10669,10672,10673,10674,10675, right Primer 10280, 10283, 10286, 10288, 10290, 10293, 10295, 10298, 10300, 10302, 10305, 10307, 10309, 10311, 10312, 10313, 10315, 10319, 10321, 10323, 10325,10326,10328, 10331, 10338, 10341, 10343, 10344, 10345, 10346, 10347, 10349, 10352, 10355, 10356, 10357, 10361, 10363, 10365, 10367, 10370, 10375, 10377, 10379, 10380, 10381, 10382, 10384, 10386, 10387, 10388, 10390, 10392, 10394, 10395, 10399, 10401, 10402, 10404, 10406, 10408, 10411, 10412, 10414, 10416, 10417, 10418, 10420, 10423, 10426, 10431, 10435, 10440, 10444, 10449, 10451, 10457, 10459, 10461, 10462, 10464, 10465,10468, 10471, 10476, 10478, 10481, 10483, 10485, 10487, 10489, 10491, 10492, 10493, 10498, 10499, 10500, 10504, 10506, 10509, 10511, 10513, 10514, 10515, 10516, 10519, 10521, 10523,10526,10530, 10531, 10532, 10534, 10535, 10538,10539, 10542, 10543,10544, 10546,10548,10550,10552, 10554, 10557, 10558,10561, 10566, 10569, 10572, 10573, 10577,10578,10580,10582,10584, 10586, 10594,10598, 10600, 10604,10606, 10611, 10614,10616, 10619, 10622,10625,10626, 10628, 10631,10633, 10635, 10642, 10644, 10646,10648,10649, 10650, 10651, 10652, 10654, 10656, 10658, 10660, 10670, 10671, 10676, Detection: 10281, 10284, 10289, 10294, 10296, 10303, 10316, 10324, 10332, 10334, 10339, 10353, 10364, 10368, 10371, 10389, 10393, 10396, 10397, 10400, 10405, 10409,10421, 10424, 10436, 10441, 10450, 10458, 10472, 10474, 10479, 10482, 10486, 10496,10505, 10512, 10527, 10549, 10555, 10562, 10567, 10570, 10575, 10585,10587, 10591, 10595,10599, 10608, 10615,10620,10623,10629, 10636,10677, SEQ ID xo: 38 left Primer: 10678,10684, ~~1 'fi0601 'Z0601'66801 '1.6801 'M01 '06801 '88801 '98801 '~8801 '18801 '08801'SL801 '~L801 '11.801 '01.801 '89801 '59801 'V9801 '~9801 'Z9801 '19801 '09801 '6S80i 'L5801 'tS801 '15801 '09801 'M0I 'Sfi80i 'ZV801 '1"01 'Oti801 '65801 '8~801 'L~80T 'S~80T'~~801 'I~801 't~Z80i 'ZZ801 '0Z801 '91801 'ST801 'V1801 '~1801'ZT801 '11801 '60801 'L080T '90801 'S0801 'b0801 'Z0801 '00801'66LOT '86L01 '176L0T '~6L0T'Z6L01'06L0T '68L0I '88L0I 'b8L0i 'ZBLOI '6LLOI SZ
'8LL0T '91,L01 'ELLOI '0LL0T 'L9L0T 'S9LOI '~9L0T 'Z9L0i '19L01 'LSLOI 'SSLOI
'ZSLOI 'OSLOT
'LbL01 'Ti,LOi '6~L0I '8~L0I 'L~L0T 'S~L0I '~~L0I 'Z~LOT '0~L01 'LZLOI '~ZL01 '6TL0I '81L0T
'LILOT '91L0I 't+IL01 '0TL0I 'LOLOT 'SOLOI 'ZOL01 '00L0I 'L6901 116901 =U!M UP
'~6011'580I1 '18011 '61.OTT '8L0TT 'ZL01I'ILOIT '0L0TT 'L901I '99011 't,9011 'Z90T[
'19011 10901I 'SSOTT 'ZSOT1 '8ti0TT '9ti0TI 'S"Ti '~bOiT 'ZbOTI 'IvOiT '060II
'9~0iT '~~OTT OZ
'SZOT I 'OZO T I '91011 '~I01T '600 i 1 '9001 T '100I 1 '000I 1 '66601 'L6601 'S6601 'Z6601 '88601 'S8601 't,8601 '18601 '81.601 'LL601 'SL601 'ZL601 '89601 'L9601 'Z9601 '6S601 '8S601 695601 "S5601 '~5601 '0601 '9M1 'tfi60T '~b601 'Zb601 'IV601 '8E601 'ti~601 '~~601 'Z~601 '0~60I
'9Z601 '61601 '91601 'tr160i '11601 '01601 '60601 '1.0601 '50601 '~0601 '1.0601 '00601 '96801 '~6801 'Z6801 '68801 'S8801 118801 'Z8801'6L801 '81.801 'LL80I 'Y1.801 'ZL801 '69801 '9980i ST
'8S801 '95801 '~S801 '61801 '8b801 'LV80T '1,b801 'Eti801 'V5801 '0~801 '6Z801 'LZ801 '9Z801 '~Z80T '1Z801 461801 '81801 '1.1801 '80801 '10801 '961.01 '161.01 '981.01 '~8L01 '181.01 '08L01 'SLLOT 'ZLLOI '69L0T '89L01 'i-9L0T '09L0T '6SLOi'8SLOt 'KL01 'ISLOI '6fiL0i '81,L0t '9bL0I
'MOT '1tL0T '5tL01 'ZbLOi '0f'L0T 'KL01 '6ZL0T '8ZL0T '9ZL0I 'SZLOT 'bZLOi 'ZZLOI 'TZLOT
'OZLOT '~ILOT 'ZIL01 'ITL01 '60L0I 'VOL0I '~OLOI '66901 '96901 '~6901 :num.d )PT 01 LZ:OAid.Ia88 16901 'UoAMaQ
416901 ==d Tou '06901 =Umd }T'T S
6~ ~ON QI a'dS
'98901 '0890T monawQ

'68901 '88901 '48901 '58901 '~8901 'Z8901 '18901 '61.901 =Mud 311B?1 ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

10906, 10908, 10912, 10915, 10917, 10920, 10922, 10924, 10925, 10927, 10928, 10929, 1093.1, 10935, 10937, 10939, 10945, 10948, 10950, 10951, 10952, 10954, 10957, 10960, 10963, 10965, 10966,10969, 10970,10971,10973,10976,10979,10980,10982,10986,10987,10989,10991, 10993, 10996, 10998, 11002, 11004, 11005, 11007, 11010, 11012, 11014, 11015, 11017, 11019, 11021, 11022, 11023, 11026, 11027, 11028, 11029, 11030, 11031, 11032, 11034, 11037, 11039, 11044, 11047, 11049, 11050, 11051, 11053, 11054, 11056, 11058, 11059, 11063, 11066, 11068, 11069, 11073, 11074, 11075, 11076, 11077, 11080, 11082, 11083, 11084, 11086, 11087, 11088, 11089,11090, 11091, 11092,11094, Detection: 10695, 10698, 10701, 10706, 10708, 10715, 10731, 10736, 10753, 10756, 10766, 10771, 10774, 10777, 10785, 10787, 10795, 10797, 10803, 10810, 10825, 10828, 10832, 10836, 10852, 10855, 10867, 10876, 10887, 10891, 10895, 10898, 10913, 109,18, 10921, 10923, 10936, 10940, 10949, 10961, 10964, 10974, 10983, 10990, 10994, 11003, 11008, 11011, 11018, 11024, 11035, 11038, 11057, 11095, SEQ ID NO: 40 left Primer: 11376, 11381, 11382, 11383, 11384, 11387, 11397, 11401, 11405, 11408, 11414,11418, 11421, 11422, 11424,11427,11429, 11430, right Primer: 11377, 11379, 11380, 11385, 11386, 11388, 11390, 11391, 11392, 11394, 11395,11396, 11398,11399,11400,11402, 11403, 11404, 11406,11409, 11410, 11411, 11412, 11415, 11416, 11417, 11419,11423,11425,11428, 11431, 11432,11433, Detection: 11378, 11389, 11393, 11407,11413, 11420, 11426, Light cycler dnal probe assays:
SEQ ID NO: 41 left Primer 11434, 11438, 11442, 11443, 11447, 11449, 11450, 11452, 11456, 11459, 11463, 11464, 11467, 11468, 11472, 11477,11480, 11481, 11482, 11483, 11484, 11488, 11489, 11493,11498, 11502, 11504, 11505,11506, 11507, 11508,11509, 11512, 11513, 11514, 11517, 11520, 11522, 11523, 11524, 11526, 11528, 11532, 11534, right Primer: 11435, 11439, 11444, 11445, 11446, 11448, 11451, 11453, 11457, 11458, 11460,11461,11462,11465,11466,11469,11473,11474,11475,11476,11478,11479,11485, 11486,11487,11490,11494,11497,11499,11500,11501, 11503,11510, 11511, 11515, 11518, 11519,11521, 11525, 11527,11529, Detection:11436,11440,11454, 11470, 11491,11495,11530, Anchor: 11437,11441,11455,11471,11492,11496,11516,11531,11533, SEQ ID NO: 5 left Primer. 11535, 11539, 11540, 11541, 11548, 11550, 11551, 11552, 11555, 115S6, 11557,11560, 11561,11562,11568,11569,11571, 11572, 11573,11577, right Prinner: 11536, 11542, 11545, 11546, 11547, 11549, 11553, 11554, 11563, 11566, 11570, 11574, Detection:11537,11543,11558,11564,11575, Anchor: 11538,11544,11559, 11565, 11567, 11576, SEQ ID NO: 6 left Primer. 11578,11585, 11586,11590, 11591, 11592,11595, 11596, 11597, 11600, right Primer. 11579,11582,11587,11593, 11594,11598, 11601, Detection: 11580,11583, 11588, Anchor: 11581, 11584,11589, 11599, SE.Q ID NO: 8 lefft Primer. 11602, 11606, 11607, 11608, 11609, 11616, 11618, 11622, 11626, 11628,, 11632, 11633, right Primer 11603, 11610, 11613, 11614, 11615, 11617, 11619, 11623, 11627, 11629, 11634, Detection:11604,11611,11620,11624,11630, Anchor: 11605,11612,11621,11625,11631, SEQ ID NO: 16 left Primer: 11635, 11640, 11641, 11642, 11643, 11647, 11648, 11654, 11655, 11656, 11657,11658, right Primer:11636,11639,11644,11645,11646, 11649,11652,11653, Detectian: 11637,11650, Anchor: 11638,11651, SEQIDNO:42 left Primer. 11659, 11663, 11664, 11665, 11666, 11670, 11671, 11672, 11673, 11677, 11681,11687, 11690,11694,11696, 11697, 11701,11705,11709, 11713,11719,11723,11729, 11733,11739,11744,11745,11748,11749,11751,11755,11759, 11763, 11770,11772,11774, 11776,11778,11782,11785, right Primer 11660, 11667, 11674, 11675, 11676, 11678, 11682, 11685, 11686, 11688, 11689,11691, 11692,11693, 11695, 11698, 11699, 11700,11702, 11706, 11710, 11716,11720, 11724,11725,11727,11728,11730, 11731, 11732,11734,11735, 11736, 11737,11738,11740, -11743,11746, 11747, 11750,11752, 11756, 11761,11762, 11764,11765, 11767, 11768, 11769, 11773,11775, 11777,11779,11783, 11784, Detection: 11661, 11668, 11679, 11683, 11703, 11707, 11711, 11714, 11717, 11721, 11726,11741, 11753,11757,11766,11771, 11780, Anchor: 11662, 11669, 11680, 11684, 11704, 11708, 11712, 11715, 11718, 11722, 11742,11754,11758,11760, 11781, SEQIDNO:14 left Primer: 11786,11790,11791,11792, right Primer: 11787, 11793, Detecfion: 11788,11794, Anchor: 11789,11795, SEQ ID NO: 43 left Primer. 11796, 11800, 11802, 11803, 11805, 11810, 11818, 11819, 11823, 11824, 11827, 11828, 11829,11833,11836,11837, 11839, 11840, 11847, 11850, 11852, 11857, 11860, 11864,11866, right Primer: 11797, 11801, 11804, 11806, 11809, 11811, 11814, 11815, 11817, 11820, 11825, 11830, 11835, 11841, 11844, 11845, 11846, 11848, 11851, 11853, 11856, 11858, 11861, 11862,11863,11865, Detection: 11798, 11807, 11812,11816,11821, 11831,11842, 11854, Anchor 11799, 11808, 11813, 11822, 11826, 11832, 11834, 11838, 11843, 11849, 11855, 11859, SEQ ID NO: 15 left Prixner: 11867,11871,11876,11878,11882,11888,11891,11894, right Primer: 11868, 11872, 11875, 11877, 11879, 11883, 11886, 11887, 11889, 11890, 11892,11893,11895, Detection: 11869,11873, 11880,11884, 11896, Anchor: 11870, 11874, 11881, 11885, 11897, SEQ ID NO:4 left Primer. 11898, 11902, 11903, 11904, 11908, 11909, 11911, 11912, 11913, 11914, 11915, 11917, 11918,11922, 11926,11927, 11930,11932, 11933, 11937, 11941,11942, 11946, 11947,11948,11949,11950,11951,11952,11955,11959,11968, 11972, 11976,11978, 11979, 11980, 11981, 11986, 11988, 11989,11991, 11992, 11995, 11997, 11998, 12001, 12002, 12004, 12005, right Primer: 11899, 11905, 11910, 11916, 11919, 11923, 11924, 11925, 11928, 11929, 11931,11934,11938,11943,11953, 11954, 11956, 11960, 11963, 11964, 11967, 11969, 11973, 11977,11982, 11985,11987, 11990, 11993,11994, 11996,11999,12000, 12003, Detection: 11900, 11906, 11920, 11935, 11939, 11944, 11957, 11961, 11965, 11970, 11974,11983, Anchor. 11901, 11907, 11921, 11936, 11940, 11945, 11958, 11962, 11966, 11971, 11975, 11984, SEQ ID NO: 7 left Primer: 12006, 12011, 12015, 12016, 12017, 12021, 12022, 12023, 12024, 12025, 12026,12027,12031,12034, i2042,12043, 12045,12049,12050, 12051, 12054,12062, 12063, 12064,12066,12067, 12068, 12070,12072, 12076,12082,12085, 12086, 12089, 12090, 12093, 12094,12095,12096, 12097,12098,12101, 12103,12107,12108,12111,12112,12114, 12118, 12119, 12120,12128, right Primw. 12007, 12010, 12012, 12020, 12028, 12032, 12033, 12035, 12038, 12039, 12044, 12046, 12052, 12055,12056,12057, 12058,12059,12060,12061, 12065, 12069, 12071, 12073,12077,12080,12081,12084,12087,12088,12091,12099,12100,12102,12104,12109, 12110,12113, 12115,12121, 12122,12123, 12124, 12125,12127, 12129, Detection: 12008, 12013, 12018, 12029, 12036, 12040, 12047, 12074, 12078, 12083, 12105,12116, Anchor. 12009, 12014, 12019, 12030, 12037, 12041, 12048, 12053, 12075, 12079, 12036,12092,12106,12117,12126, SEQ ID NO:1 left Primer: 12130, 12135, 12136, 12141, 12144, 12147, 12148, 12149, 12153, 12159, 12160, right Primer: 12131, 12134, 12137, 12138, 12139, 12140, 12142, 12143, 12145, 12146, 12150,12154,12157,12158,12161,12162,12163, Detection: 12132,12151,12155, Anchor: 12133, 12152, 12156, SEQ II1 NO: 45 left Primer. 12164, 12168, 12171, 12176, 12181, 12187, 12190, 12194, 12196, 12197, 12199,12201,12202, 12209,12213,12216, 12220,12221,12223,12225, 12226,12231, 12233, 12239,12243,12244, 12250, 12254, 12256, 12257,12259, 12266, 12270, 12271, 12272, 12274, 12276,12277,12278, 12280,12284, 12285, 12288,12289,12290, 12291, 12295,12296, 12302, 12308, 12313, 12317, 12321, 12322, 12323, 12324, 12325, 12327, 12328, 12330, 12331, 12332, 12336,12337, 12339,12343,12346,12349,12353,12354,12355,12359,12361,12363, 12367, 12369, 12370, 12372, 12376, 12377, 12379, 12380, 12381, 12382, 12383, 12385, 12389, 12393, 12398, 12400, 12402, 12403, 12406, 12408, 12409, 12410, 12412, 12415, 12417, 12419, 12422, 12424,12429, 12430,12432,12433,12435, 12436,12437, 12441,12445,12448, 12449, 12454, 12458,12459, 12460, right Primer. 12165, 12169, 12170, 12172, 12175, 12177, 12180, 12182, 12185, 12186, 12188, 12191, 12195, 12198, 12200, 12203, 12206, 12207, 12208, 12210, 12214, 12217, 12222, 12224,12227, 12228, 12229, 12230, 12232, 12234, 12237,12238, 12240, 12241, 12242, 12245, 12248,12249,12251,12255,12258,12260,12262,12263, 12264,12265,12267, 12268, 12269, 12273, 12279, 12281, 12286, 12287, 12292, 12297, 12300, 12303, 12306, 12307, 12309, 12312, 12314,12318,12326,12333, 12338,12340,12341,12342,12345,12347,12348,12352,12356, 12360,12362,12364,12371,12373,12378, 12386,12390,12394,12397,12401,12404,12405, 12411, 12413, 12418, 12420, 12423, 12425, 12428, 12438,12439,12440, 12442, 12443, 12446, 12450,12453,12455, Detection: 12166, 12173, 12178, 12183, 12189, 12192, 12204, 12211, 12218, 12235, 12246, 12252, 12282, 12293,12298,12301, 12304,12310,12315,12319, 12334, 12350;
12357, 12365, 123.74, 12387, 12391,12395, 12416, 12426, 12444, 12451,12456, .Anchor. 12167, 12174, 12179, 12184, 12193, 12205, 12212, 12215, 12219, 12236, 12247,12253,12261,12275,12283,12294, 12299,12305, 12311,12316,12320,12329, 12335, 12344,12351, 12358, 12366,12368, 12375,12384, 12388,12392,12396, 12399,12407, 12414, 12421, 12427, 12431, 12434, 12447, 12452, 12457, SEQIDNO:9 left Primer: 12461, 12465, 12467, 12468, 12472, 12474, 12477, 12480, 12484, 12486, 12488,12489,12490,12493,12495,12499,12501,12504,12506, right Primer. 12462, 12469, 12475, 12478, 12481, 12483, 12485, 12487, 12492, 12494, 12496, 12497, 12498,12500, 12502,12505, Detection: 12463,12470,12473,12482, Anchor. 12464, 12466,12471,12476,12479,12491,12503, SEQ ID NO: 46 left Primer: 12507, 12511, 12517, 12520, 12522, 12523, 12524, 12528, 12530, 12534, 12535, 12536, 12537, 12541, 12542, 12547, 12550, 12551, 12552, 12554, 12555,12560,12564, 12565,12569, 12571,12574,12579,12581,12586,12590, 12586,12590,12594,12596, 12600, 12601,12602,12604,12610,12613,12614,12615,12616,12620,12626,12630, right Ffimer: 12508, 12512, 12515, 12518, 12521, 12525, 12529, 12531, 12538, 12543, 12546, 12548, 12549, 12553, 12556, 12559, 12561, 12566, 12570, 12572, 12573, 12575, 12578, 12582, 12585, 12587, 12595, 12597, 12599, 12603, 12605, 12608, 12609, 12611, 12617, 12618, 12621,12624,12625,12627, Detection: 12509, 12513, 12516, 12514, 12532, 12539, 12544, 12557, 12562, 12567, 12576,12583, 12588,12591,12606,12612,12622,12628, Anchor: 12510, 12514, 12519, 12526, 12527, 12533, 12540, 12545, 12558, 12563, 12568,12577, 12580,12584,12589,12598,12607,12619,12623, 12629, SEQ ID NO: 10 left Primer: 12631, 12636, 12637, 12638, 12639, 12643, 12647, 12648, 12652, 12654, 12660,12664,12666,12670,12672, 12675,12677, 12680,12686,12691, 12692, 12695, 12699, 12700, 12701, 12703, 12705, 12709, 12710, 12714, 12715, 12716, 12718, 12719, 12720, 12724, 12725, 12728, 12732, 12738, 12739, 12743, 12744, 12745, 12747, 12748, 12752, 12757, 12763, 12764, 12766, 12767, 12768, 12771, 12776, 12777, 12781, 12785, 12787, 12788, 12791, 12792, 12796, 12797, 12800, 12804, 12808, 12813, 12815, 12816, 12817, 12822, 12825, 12828, 12831, 12833,12834,12837, 12839, 12841, 12842, right Primer: 12632, 12635, 12640, 12641, 12644, 12649, 12653, 12655, 12658, 12661, 12662, 12663, 12665, 12667, 12671, 12673, 12678, 12679, 12681, 12682, 12683, 12684, 12685, 12687, 12688, 12689, 12690, 12693,12694,12696,12702,12704,12706, 12712, 12713, 12717, 12721, 12726, 12729, 12730, 12731, 12733, 12736, 12737, 12740, 12746, 12749, 12750, 12751, 12753,12754, 12755, 12756, 12758,12760, 12761, 12762, 12765, 12769, 12770, 12772, 12=775, 12778,12782,12786, 12789,12790,12793,12794,12795, 12798, 12799, 12801,12805,12809, 12812,12814,12818,12821,12823,12824,12826,12827,12832,12835,12836,12838,12840, 12843,12844, Detection: 12633, 12642, 12645, 12650, 12656, 12668, 12674, 12676, 12697, 12707, 12722,12734,12741,12759,12773,12779,12783,12802, 12806,12810,12819,12829, Anchor: 12634, 12646, 12651, 12657, 12659, 12669, 12698, 12708, 12711, 12723, 12707, 12727, 12735, 12742, 12774, 12780, 12784,12803, 12807, 12811, 12820, 12830, SEQ ID NO:11 left Prima: 12845, 12849, 12850, 12854, 12857, 12862, 12866, 12867, 12868, 12870, 12872, 12880,12881,12884, 12885,12889; 12890, 12892, 12896, 12898, 12899, 12903, 12907, 12910, 12913, 12919, 12920, 12921, 12923, 12928, 12932, 1293 8, 12942, 12945, 12948, 12950, 12951,12953, 12959, right Prinner: 12846, 12851, 12855, 12858, 12861, 12863, 12869, 12871, 12873, 12876, 12877, 12878, 12879, 12882, 12883, 12886, 12887, 12888, 12891, 12893, 12894, 12895, 12900, 12901, 12902, 12904, 12908, 12909, 12911, 12912, 12914, 12917, 12918,12924,12927,12929,.
12933, 12936, 12937, 12939, 12943, 12949, 12954, 12957, 12958,12960, Detection: 12847, 12852, 12859, 12864, 12874, 12905, 12915, 12925, 12930, 12934, 129940,12944, 12946,12955, Anchor. 12848, 12853, 12856, 12860, 12865, 12875, 12897, 12906, 12916, 12922, 12926,12931,12935,12941,12930,12947, 12952,12956, SEQ ID NO: 12 left Primer. 12961, 12965, 12969, 12975, 12977, right Primer: 12962, 12966, 12967, 12968, 12970, 12971, 12972, 12973, 12974, 12976, 12978,12981, Detectioa: 12963,12979, Anchor. 12964, 12980, SEQ ID NO: 13 left Primer: 12982, 12986, 12989, 12991, 12992, 12993, 12995, 12999, 13001, right Primer.12983,12987,12996,12997,12998,13000,13002, Detection: 12984, 13003, Anchor: 12985, 12988, 12990, 12994, 13004, SBQ IDNO:3 lefft Primer: 13005, 13009, 13013, 13017, 13019, 13025, 13029, 13030, 13032, 13033, 13034, 13037,13040, 13042,13043, 13044,13048,13049,13051, 13052, 13053, 13057,13062, 13064, 13065, 13066, 13067, 13072, 13073, 13076, 13078, 13082, 13083, 13085, 13087, 13088, 13089,13092,13096, 13100, 13101, 13102, 13105, 13108, 13109, 13110, 13114, 13117, 13118, 13124, 13129, 13131, 13132, 13138, 13144, 13146, 13147, 13148, 13152, 13156, 13159, 13164, 13167, 13168, 13170,13171,13172,13173,13174, 13184, 13185, right Primer: 13006, 13010, 13014, 13018, 13020, 13021, 13022, 13023, 13024, 13026, 13031, 13035, 13036, 13038, 13039, 13041, 13045, 13050, 13054, 1305 8, 13061, 13063, 13068, 13069, 13070, 13071, 13074, 13075, 13077, 13079, 13084, 13086, 13090, 13091,13093,13097;
13104,13107,13111,13115,13119,13121,13122,13123, 13125,13126,13127,13128, 13130, 13133,13137,13139,13142, 13143,13145, 13149,13153,13157, 13158, 13160,13163, 13165, 13166, 13169, 13175, 13176, 13177, 13178, 13179, 13180, 13181,13182,13183, 13186, 13189, 13190, Detection: 13007, 13011, 13015, 13027, 13046, 13055, 13059, 13080, 13094, 13098, 13112, 13120, 13134, 13140, 13150, 13154, 13161, 13187, Anchor. 13008, 13012, 13016, 13028, 13047, 13056, 13060, 13081, 13095, 13099, 13103,13106,13113, 13116, 13135,13136, 13141,13151, 13155,13162, 13188, SEQ ID NO: 47 leftPrimer: 13191,13195,13196,13197, 13199,13200,13204,13206, right Primec 13192, 13198,13201, Detection: 13193,13202, Anchor:13194,13203,13205, SEQID NO: 18 left Primer: 13207, 13212, 13213, 13226, 13228, 13231, 13235, 13240, 13245, 13247, 13248, 13250, 13254, 13256, 13258, 13264, 13265, 13268, 13269, 13273, 13274, 13277, 13279, 13280,13281, 13286, right Primer. 13208, 13211, 13214, 13217, 13220, 13222, 13224, 13225, 13227, 13229, 13232,13233,13234,13237,13239,13241,13242,13?A4,13246,13249,13251,13255,13257, 13259, 13262,13263, 13266,13267,13270,13275,13276,13282,13285, Detection: 13209,13215, 13218, 13236,13252, 13260,13271,13283, Anchor: 13210, 13216, 13219, 13221, 13223, 13230, 13238, 13243, 13253, 13261, 13272,13278, 13284, SEQ ID NO: 32 left Primer: 13641, 13645, 13646, 13649, 13650, 13652, 13653, 13654, 13655, 13658, 13659, right Primer: 13642, 13647',13648,13656, Detection: 13643, .Anchor:13644,13651,13657, SEQ ID NO: 33 left Primer: 13660, right Primer: 13661, Detection: 13662, Anchor.13663, SEQ ID NO: 34 left Primer: 13664, 13669, 13670, 13671, 13672, 13673, 13675, 13676, 13677, 13681, 13683, 13685, 13687, 13689, 13691, 13693, 13696, night Primer: 13665, 13668, 13674, 13678, 13682, 13684, 13686, 13688, 13690, 13692, 13694,13695, Detecc tion:13666, 13679, Anchor: 13667,13680, SEQ ID NO: 24 left Primer. 13697, 13701, 13702, 13703, 13709, 13713, 13714, 13715, 13719, 13721, 13722,13726,13728,13732,13735,13740, right Primer: 13698, 13704, 13705, 13706, 13707, 13708, 13710, 13716, 13717, 13718, 13720,13723, 13724,13725,13727,13729,13733, 13734,13736,13739,13741, 13744, Deteation:13699, 13711, 13730, 13737, 13742, Anchor: 13700,13712,13731,13738,13743, SEQ ID NO: 35 left Primer: 13745, 13749, 13751, 13752, 13753, 13754, 13758, 13762, 13765, 13766, 13768,13772, 13773,13774,13777,13778,13779, 13783,13785,13790,13791,13797,13802, 13803, 13805, 13806, 13807, 13809, 13812, 13814, 13816, 13817, 13818, 13819, 13820, 13823, 13824, 13826,13828, right Primer: 13746, 13755, 13759, 13763, 13764, 13767, 13769, 13775, 13776, 13780, 13784,13786,13788, 13789, 13792, 13795, 13796,13798, 13800, 13804,13808, 13813, 13815, 13821,13822, 13829, Detection: 13747, 13756, 13760,13781,13793,13801,13810,13830, Anchor. 13748, 13750, 13757, 13761, 13770, 13771, 13782, 13787, 13794, 13799, 13811,13825, 13827,13831, SEQID NO:36 left Primer 13832, 13837, 13841, 13844, 13845, 13846, 13849, 13854, 13855, 13856, 13857, 13861, 13865, 13869, 13871,13875, 13879, 13880, right Primer: 13833, 13836, 13838, 13843, 13847, 13850, 13853, 13858, 13862, 13866, 13870,13872, 13876,13881,13882, Detection: 13834, 13839, 13851, 13859, 13863, 13867, 13873, 13877, Anchor: 13835,13840, 13842,13848,13852,13860,13864,13868, 13874, 13878, SEQ ID NO: 28 left Primer: 13883, 13889, 13894, 13902, 13903, 13910, 13911, 13914, 13915, 13916, 13928,13929,13930,13931, 13935, 13936,13937, 13944,13947, 13948,13950,13960, 13961, 13962,13964, 13965,13966, 13968,13970,13971,13972,13976, 13978, right Primer: 13884, 13887, 13890, 13893, 13895, 13898, 13900, 13904, 13905, 13906, 13907,13908, 13909,13912, 13913, 13917, 13920, 13921, 13922, 13923, 13924, 13925, 13926, 13932,13938,13941,13942,13943, 13945, 13946,13949, 13953, 13954, 13956,13957, 13958, 13959, 13963,13967, 13969, 13974, 13975,13977,13980, Detection: 13885, 13886, 13891, 13896, 13901, 13918, 13927, 13933, 13939, 13951, Anchor: 13886, 13888, 13892, 13897, 13899, 13901, 13919, 13934, 13940, 13952, 13955,13973, 13979, SEQ ID NO: 37 left1'rimer: 13981,13988,13989, 13990, 13992,13994,13995, 13999, right Primer: 13982, 13985, 13986, 13987, 13991, 13993, 13996, 14000, 14001, 14002, 14003, Detection: 13983, 13997, Anchor: 13984, 13998, SEQ ID NO: 26 left Primer. 14004, 14009, 14014, 14017, 14020, 14024, 14026, 14029, 14035, 14036, 14040,14043,14045,14051,14057,14058,14059, 14063,14065,14066,14067,14068, 14069, 14070, 14071, 14073,14074,14078,14079,14080,14081, 14082, 14083, 14084, 14085, 14087, 14094,14095, 14100,14108,14109, 14113,14114,14118, 14120, 14121, 14122, 14130,14133, 14138, 14141, 14142, 14143, 14147, right Primer: 14005, 14008, 14010, 14013, 14015, 14018, 14021, 14025, 14027, 14028, 14030, 14033,14034, 14037,14038,14039,14041,14042,14044,14046, 14049,14050,14052, 14055,14056, 14060,14064,14072,14077, 14086,14088,14089, 14090, 14091,14092, 14093, 14096,14097, 14098, 14099, 14101,14102,14103,14104,14105, 14106, 14107,14110,14115, 14123,14126,14127,14132,14134,14135,14136,14137,14139,14140,14144,14145,14148, Ikteation: 14006, 14011, 14019, 14022, 14031, 14047, 14053, 14061, 14075, 14111, 14116, 14124, 14149, Anchor. 14007, 14012, 14016, 14023, 14032, 14048, 14054, 14062, 14076, 14112, 14117, 14119, 14125, 14128, 14129, 14131,14146,14150, SEQ ID NO: 27 left Primer: 14151, 14155, 14157, 14161, 14166, 14171, 14175, 14183, 14187, 14190, 14192,14194,14195, 14196, 14200,14201, right Primer: 14152, 14156, 14158, 14162, 14165, 14167, 14170, 14172, 14176, 14179, 14180, 14182,14184, 14185, 14186, 14188, 14189, 14191, 14193, 14197, 14198,14199, 14202, 14203, Detection:14153, 14159,14163,14168,14173,14177, Anohor: 14154, 14160, 14164,14169, 14174, 14178, 14181, SEQ ID NO: 31 left Primer. 14204, 14210, 14211, 14216, 14217, 14223, 14226, 14228, 14229, 14230, 14233, 14235, 14239,14241,14243, 14244, 14250,14254,14255, 14256, 14257,14260, 14261, 14262, 14267,14268,14269,14273, 14274, 14277,14281,14284, 14286, 14289, 14292, 14293, 14297, 14299,14301,14304,14305,14306,14312,14316,14320, 14322,14324, 14328, 14329, 14331, 14337, 14342, 14344, 14346, 14347,14349,14350,14353, 14356, 14361, 14363, 14364, 14365, 14366, right Primer. 14205, 14208, 14212, 14215, 14218, 14221, 14224, 14225, 14227, 14231, 14236, 14240, 14242, 14245, 14246, 14247, 14251, 14263, 14266, 14270,14278,14282, 14283, 14285, 14287,14290, 14291, 14294, 14298, 14300,14302, 14303, 1430'], 14310,14313, 14317, 14323,14325,14327,14330,14334,14338,14340,14341,14345,14348,14351, 14352, 14354, 14355,14357,14358,14359,14360,14367, Detection: 14206, 14213, 14219, 14237, 14248, 14252, 14258, 14264, 14271, 14275, 14279,14295,14308,14311,14314,14318,14332,14335,14339, 14343, Anchor. 14207, 14209, 14214, 14220, 14222, 14232, 14234, 14238, 14249, 14253, 14259, 14265,14272, 14276,14280, 14288,14296, 14309, 14315, 14319, 14321, 14326, 14333, 14336,14362, SEQIDNO:40 leR Primer. 14368,14372,14373,14375,14386, right Frimer.14369, 14374, 14376, 14379, 14380, 14381, 14382, 14383, 14384, 14385, Detection: 14370,14377, Anchor: 14371, 14378, In an alternative most preferred embodiment of the method, the subsequent ampli$cation of d) is carried out in the presence of blocktng oligonueleotides, as described above. Said blocking oligonucleotldes comprising a sequence having a length of at least 9 nucleotides which hybridizes to a treated nucleic acid sequence according to one of SEQ ID
NOS:304 to SEQ ID
NO:535 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG, TpG or CpA dinucleotide. Step e) of the method, namely the detection of the speaific amplfficates indicative of the methylation status of one or more CpG
positions according to SEQ ID NOS:l to SEQ ID NO:64 is carried out by means of real-time detection methods as desen'bed above.

In a further preferred embodimeat of the method the sequence(s) of the blocking oligonucleotides are selected from the group consisting of SEQ ID NOS:2114, 2119, 2124, 2125, 2127, 2132, 2133, 2135, 2137, 2138, 2139, 2140, 2141, 2142, 2143, 2144, 2146, 2147, 2148, 2149, 2150, 2151, 2152, 2153, 2154, 2155, 2156, 2157, 2158, 2159, 2160, 2031, 2082, 2087, 2089, 2094, 2095, 2096, 2097, 2099, 2107, 1980, 2018, 2022, 2023, 2026, 1939, 1966, 1973, 1974, 1975, 1926, 1930, 1931, 1932, 1933, 1934, 1903, 1917, 1921, 1834, 1896, 1805, 1819, 1821, 1823, 1824, 1825, 1826, 1827, 1828, 1829, 1770, 1782, 1785, 1786, 1788, 1789, 1790, 1792, 1795, 1796, 1797, 1798, 1799, 1800, 1748, 1759, 1760, 1761, 1762, 1763, 1764, 1765, 1724, 1741, 1597, 1609, 1610, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1621, 1622, 1623, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1631, 1633, 1634, 1635, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1645, 1646, 1647, 1648, 1649, 1650, 1651, 1652, 1653, 1654, 1655, 1656, 1657, 1658, 1659, 1660, 1661, 1662, 1663, 1668, 1684, 1685, 1686, 1687, 1688, 1689, 1690, 1691, 1692, 1693, 1694, 1695, 1696, 1697, 1698, 1699, 1700, 1701, 1706, 1712, 1713, 1715, 1716, 1717, 1718, 1719, 1571, 1579, 1581, 1584, 1585, 1586, 1587, 1588, 1591, 1592, 1537, 1555, 1556, 1557, 1558, 1559, 1560, 1561, 1562, 1563, 1564, 1565, 1566, 1452, 1455, 1456, 1457, 1458, 1463, 1514, 1515, 1516, 1517, 1518, 1519, 1524, 1525, 1526, 1527, 1528, 1529, 1531, 1532, 1372, 1423, 1424, 1425, 1427, 1432, 1433, 1434, 1435, 1436, 1437, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1343, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1310, 131 S, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1324, 1325, 1327, 1328, 1330, 1332, 1334, 1337, 1338, 1276, 1290, 1305, 1203, 1228, 1238, 1239, 1240, 1247, 1248, 1255, 1256, 1265, 1268, 1269, 1164, 1171, 1172, 1173, 1174, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 2725, 2748, 2749, 2750, 2710, 2717, 2718, 2719, 2720, 2721, 2684, 2699, 2703, 2704, 2705, 2706, 2658, 2662, 2679, 2603, 2613, 2617, 2585, 2594, 2595, 2596, 2597, 2598, 2599, 2489, 2497, 2498, 2499, 2500, 2501, 2504, 2505, 2507, 2508, 2510, 2511, 2512, 2513, 2514, 2515, 2519, 2520, 2521, 2522, 2525, 2526, 2527, 2528, 2529, 2530, 2531, 2532, 2534, 2535, 2536, 2537, 2539, 2540, 2541, 2542, 2543, 2544, 2545, 2546, 2547, 2550, 2551, 2552, 2553, 2554, 2558, 2563, 2564, 2572, 2580, 2581, 2472, 2482, 2484, 2408, 2464, 2465, 2466, 2467, 2468, 2339, 2349, 2367, 2370, 2372, 2373, 2374, 2375, 2376, 2377, 2378, 2379, 2380, 2382, 2386, 2387, 2389, 2393, 2394, 2395, 2396, 2397, 2398, 2402, 2403, 2404, 2327, 2333, 2334, 2335, 2305, 2315, 2318, 2260, 2268, 2270, 2271, 2272, 2273, 2274, 2275, 2276, 2277, 2278, 2279, 2280, 2281, 2282, 2283, 2284, 2285, 2286, 2287, 2288, 2289, 2290, 2291, 2292, 2293, 2294, 2295, 2296, 2297, 2298, 2299, 2300, 2301, 2232, 2245, 2246, 2248, 2249, 2250, 2251, 2252, 2254, 2255, 2256, 2210, 2218, 2219, 2221, 2222, 2223, 2227, 2228, 2202, 2204, 2205, 2206, 2164, 2180, 2183, 2187, 2188, 2189, 2190, 2191, 2192, 2193, 2194, 2195, 2196, 2197 and 2198.

Step e) of the method, namely the detection of the specific amplifioates indicative of the methylation status of one or more CpG positions according to SEQ ID NOS:I to SEQ ID NO:64 is carried out by means of rea2 time detection methods as described above, and wheroin the sequtncm of said hybridization probes is selected from the group consisting of SEQ ID
NOS:1162, 1163, 1201, 1202, 1208, 1211, 1217, 1274, 1288, 1275, 1289, 1299, 1308, 1309, 1341, 1342, 1347, 1351, 1354, 1372, 1423, 1424, 1425, 1427, 1432, 1433, 1434, 1435, 1436, 1437, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1370, 1371, 1400, 1450, 1461, 1451, 1462, 1467, 1470, 1473, 1475, 1535, 1536, 1542, 1544, 1569, 1570, 1583, 1590, 1595, 1666, 1704, 1596, 1601, 1603, 1667, 1705, 1722, 1723, 1727, 1735, 1746, 1747, 1768, 176%1773, 1803, 1804, 1807, 1810, 1832, 1833, 1836, 1867, 1871, 1901, 1902, 1908, 1911, 1924, 1925, 1937, 1938, 1943, 1946, 1949, 1956, 1957, 1978, 1979, 1986, 1992, 1998, 2001, 2003, 2010, 2020, 2025, 2029, 2030, 2113, 2163, 2201, 2209, 2231, 2259, 2304, 2326, 2338, 2348, 2351, 2369, 2407,2471, 2488, 2557, 2584, 2602, 2616, 2657; 2661, 2664, 2671, 2683, 2709 and SEQ
ID NO: 2724.

For each genomic sequence listed, the following oligonucteotides as detailed in the sequenca listing may be used for a combined Blockingoligonucleotide-RealTime analysis:
Lightcycler dual probe detection assays:
SEQ ID NO: 41 left Primer.1161,1165,1166, 1167, right Primer.1160,1168,1169,1170, 1175, Blocker: 1164, 1171, 1172, 1173, 1174, 1176, 1177,1178,1179,1180,1181, 1182, 1183,1184,1185,1186,1187,1188,1189,1190,1191,1192,1193,1194,1195,1196,1197, 1198, Detection: 1162, Anchor: 1163, SEQ ID NO: 6 left Primer: 1200,1204,1205,1206,1207,1209,1210,1212,1213,1214,1215,1216, osT
'~8~i 'Z8~I '18~I '08~I '6L~i '8L~I 'LL~T '9L~I 'SL~I 'VL~I '~L~I '69~I
uaum{Uoi I=ox aQ aas 'Vs~I 'IS~I 'Lb~I 'ZV~I :juqouV
'ib~i moAmoQ 0~
'L9~i '99~I 'S9~I '"~i '~9~I 'Z9~I 'I9~I '09ET '69~T '8S~i '~b~i -=Xaoig 'LS~I '9S~t '6~~i :Zmmd 3'R$u 'SS~I '~S~I 'ZS~i 'OS~I '6b~I 'Sb~I '9b~i 'Sb~I 'trV~i 'Ob~I =UM.d 8OI
t~~orlaia~s sz '60~T :xotIOUV
'80~I :Qorm;oQ
'8~~T 'L~~T 'b~~T 'Z~~I '0~~T '8Z~I
'LZ~I 'SZ~T 'bZ~T 'ZZ~T 'iZ~T 'OZ~T '6I~i '8T~T 'LT~i '9i~I 'SI~T 'OT~I
:",3pOIff '9~~I 'S~~T '~~~T 'I~~I '6Z~i '9Z~T '~Z~I 'bT~T '~T~T 'ZT~i '90~T :zm.udl'48P
OZ
'IT~T 'LO~i ~nuipd}TaI
corl aQ bas '66ZI '68ZI 'SLZI -joWUd .30O38Q SI
'88Zi 't+LZI :UDI
'SO~i '06ZI '9LZI sa)POIg '40~i '98ZI 'S8Zi 'b8Zi 'ZLZi mumd tqBN
'~0~I 'ZO~I IO~I 'OOEI '86ZI UZI '96ZI 'S6ZI 'V6ZI
UZI UZI 'I6Zi 'L8ZI '~8ZT UZI 'iSZI '08ZT '6LZI UZI 'LLZi '~LZI Mul9d }TSI
tii =oid QT aa5 OI
'LIZI 'IIZI '80ZI 'ZOZI :xpqOUV
'iOZi ~O40%0Q
'69ZT '89Zi 'S9ZT '9SZi 'SSZI 'BtrZI 'Lb'ZI 'OtiZI '6~ZT '8~ZI 'BZZI '~OZI
U03[00IS
'ILZI S
'OLZI 'L9ZI '99ZI 'V9ZI 'f9ZI 'Z9ZI '19ZI '09Zi '65ZI '8SZI 'LSZI 'tlSZI '~SZT
'ZSZT 'TSZI
'OSZI '6*ZI '9tfLT 'StiZI 'MI '~VZI 'ZtrZI 'TVZT 'L~ZI '9~ZT 'S~ZI 'tr~Zi '~~ZI 'Z~ZI 'i~Zi 'OEZI '6ZZT 'LZZI '9ZZI 'SZZI 'tiZZ[ '~ZZI 'ZZZI 'iZZI 'OZZI '61ZI '6611 :-=mudRIP
'RIT.t ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

1384, 1385, 1386,1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394,1395, 1396, 1397, 1398, 1399,1401,1402,1403,1404,1405,1406,1407,1408,1409,1410,1411,1412,1413,1414, 1415, 1416,1417, 1418, 1419, 1420,1421, rsght Primer:1368,1422,1426,1428,1429,1430,1431,1438,1439, Blocker: 1372,1423,1424, 1425,1427,1432, 1433,1434, 1435, 1436,1437,1440, 1441,1442,1443,1444,1445, 1446,1447, Detection: 1370, An+ctyor.1371, 1400, SEQ ID NO: 9 left Primer: 1449,1453,1454,1460,1464, 1465, 1466,1468,1469,1471,1472,1474, 1476, 1477, 1478, 1479, 1480, 1481, 1482, 1483,1484, 1485,1486, 1487, 1488, 1489, 1490, 1491, 1492, 1493, 1494, 1495, 1496, 1497, 1498, 1499, 1500, 1501, 1502, 1503, 1504, 1505, 1506,1507,1508,1509,1510, right Primer: 1448, 1459,1511,1512,1513,1520, 1521, 1522, 1523, 1530, Blocker: 1452,1455,1456,1457, 1458,1463,1514, 1515, 1516, 1517, 1518, 1519, 1524,1525,1526,1527,1528,1529,1531,1532, Detection:1450,1461, Anchor.1451, 1462, 1467,1470,1473,1475, SEQ ID NO: 46 left Primea: 1534,1538, 1539, 1540, 1541,1543,1545,1546,1547, 1548, 1549, 1550, 1551,1552,1553,1554, right Primer: 1533, Blocker:1537,1555, 1556, 1557,1558,1559, 1560, 1561,1562,1563, 1564,1565, 1566, Detection: 1535, Anchor. 1536,1542,1544, SEQ ID NO:10 left Primer. 1568, 1572, 1573, right Primer:1567,1574,1575,1576,1577,1578,1580,1582,1589, Bloeker:1571, 1579, 1581,1584,1585, 1586,1587,1588,1591, 1592, Detection: 1569, Amhor. 1570,1583,1590, SEQ ID NO: 12 left Primer.1594,1598,1599,1600,1602,1604,1605,1606, 1607, 1665, 1669, 1670, 1671,1672,1673,1674,1675,1676,1677,1678,1679,1680,1681,1682, 1703,1707, 1708, right Primer. 1593, 1608, 1632,1664,1683, 1702,1709,1710, 1711,1714, Blocker.1597,1609,1610,1611,1612,1613,1614,1615,1616,1617,1618,1619, 1620, 1621,1622,1623, 1624,1625,1626,1627,1628,1629,1630,1631,1633,1634,1635, 1636,1637,1638,1639,1640,1641,1642,1643,1644,1645,1646,1647,1648,1649,1650, 1651,1652,1653, 1654,1655,1656,1657, 1658, 1659, 1660, 1661, 1662,1663, 1668, 1684, 1685,1686,1687,1688,1689,1690,1691,1692,1693,1694,1695,1696,1697,1698,1699, 1700, 1701, 1706, 1712, 1713, 1715, 1716, 1717, 1718, 1719, Deteation:1595,1666,1704, Anchor. 1596, 1601, 1603, 1667, 1705, SEQ ID NO: 13 left Prinner:1721,1725,1726,1728,1729,1730,1731,1732,1733,1734,1736,1737, right Primer. 1720, 1738, 1739, 1740, 1742, 1743, Biocker:1724, 1741, Detection:1722, .Anchor. 1723,1727,173 5, SEQ ID NO:3 left Primer: 1745, 1749, 1750, 1751, 1752, 1753, 1754, 1755, 1758, 25. right Primer.1744, 1756,1757, Blocker: 1748, 1759,1760,1761, 1762,1763, 1764,1765, Detection: 1746, Anchor: 1747, SEQ ID NO: 18 left 1'rimer. 1767, 1771, 1772, 1774, 1775, 1776, 1777, 1778, right Primer. 1766, 1779, 1780, 1781, 1783, 1784, 1787, 1791, 1793, 1794, Blocker: 1770, 1782, 1785, 1786, 1788, 1789, 1790, 1792, 1795, 1796, 1797, 1798, 1799,1800, Debection: 1768, Anchor:1769,1773, SEQIDNO:17 left Primesc:1802,1806,1808,1809,1811,1812,1813,1814, rigbt Primer. 1801, 1815, 1816, 1817, 1818, 1820, 1822, Blocker.1805,1819,1821,1823,1824,1825,1826,1827,1828,1829, Detection: 1803, Anchor. 1804,1807,1810, SEQ ID NO: 21 left Prinaer=.1831,1835,1837,1838,1839,1840,1841,1842,1843,1844,1845,1846, 1847,1848, 1849, 1850,1851, 1852,1853,1854,1855,1856,1857,1858, 1859,1860, 1861, 1862,1863,1864, 1865, 1866,1868,1869,1870,1872,1873,1874, 1875,1876, 1877, 1878, 1879,1880,1881, 1882,1883,1884,1887,1889,1890, 1891, 1895, right Primer: 1830,1885,1886,1888,1892,1893,1994,1897,1998, Blocker. 1$34,1896, Detection: 1832, Anchor. 1833,1836,1867,1871, SEQ ID NO: 35 left Primer: 1900, 1904, 1905, 1906, right Primer: 1899, 1907, 1909, 1910, 1912, 1913, 1914, 1915, 1916, 1918,1919,1920;
Blocker: 1903, 1917,1921, Detection: 1901, Anchor: 1902, 1908, 1911, SEQ ID NO: 25 left Primer: 1923, right Primer: 1922,1927,1928,1929, Bloaker: 1926, 1930,1931,1932, 1933, 1934, Detection: 1924, Anchor. 1925, SEQ ID NO: 26 left Primer. 1936,1940,1941,1942,1944,1945, 1947, 1948,1950,1951, 1952, right Primer:1935,1953,1954,1955,1958,1959,1960,1961, 1962, 1963, 1964, 1965, 1967,1968,1969,1970,1971, 1972, Blocker: 1939, 1966, 1973, 1974, 1975, Detection: 1937, Anchor: 1938,1943,1946,1949,1956,1957, SEQ ID NO: 38 left Primer:1977,1981,1982,1983,1984,1985,1987,1988, 1989, 1990, 1991, 1993, 1994, 1995, 1996, 1997, 1999, 2000, 2002, 2004, 2005, 2006, 2007, 2008, 2009, 2011, 2012, right Primer. 1976, 2013, 2014, 2015, 2016, 2017, 2019, 2021, 2024, Blocker. 1980, 2018, 2022, 2023, 2026, Detection: 1978, Anchor: 1979,1986,1992,1998,2001, 2003, 2010, 2020, 2025, SEQ m NO: 27 left 1'rimer. 2028, 2032, 2033, 2034, 203.5, 2036, 2037, 2038, 2039, 2040, 2041, 2042, 2043, 2044, 2045, 2046, 2047, 2048, 2049, 2050, 2051, 2052, 2053, 2054, 2055, 2056, 2057, 2058, 2059, 2060, 2061, 2062, 2063, 2064, 2065, 2066, 2067, 2068, 2069, 2070, 2071, 2072, 2073, 2074, 2075, 2076, 2077, right Primer: 2027, 2078, 2079, 2080, 2081, 2083, 2084, 2085, 2086, 2088, 2090, 2091, 2092, 2093, 2098, 2100, 2101, 2102, 2103, 2104, 2105, 2106, 2108, 2109, 2110, Blocker: 2031, 2082, 2087, 2089, 2094, 2095, 2096, 2097, 2099, 2107, Detection: 2029, Anchor. 2030, Taqman Real-time single probe detection assays:
SEQ ID NO: 41 left Primer: 2112, 2115, 2116, 2117, right I'rimer. 2111, 2118, 2120, 2121, 2122, 2123, 2126, 2128, 2129, 2130, 2131, 2134, 2136, 2145, Blocker: 2114, 2119, 2124, 2125, 2127, 2132, 2133, 2135, 2137, 2138, 2139, 2140, 2141, 2142, 2143, 2144, 2146, 2147, 2148, 2149, 2150, 2151, 2152, 2153, 2154, 2155, 2156, 2157,2158,2159,2160, Detection: 2113, SEQID NO: 6 left Primer. 2162, 2165, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2173, right Primer. 2161, 2174, 2175, 2176, 2177, 2178, 2179, 2181, 2182, 2184, 2185, 2186, Blockor. 2164, 2180, 2183, 2187, 2188, 2189, 2190; 2191, 2192, 2193, 2194, 2195, 2196, 2197, 2198, Detection: 2163, SEQIDNO:8 left Primer. 2199, 2203, right Primer. 2200, Blocker: 2202, 2204, 2205, 2206, Detection: 2201, SEQ ID NO: 14 left Primer: 2208, 2211, 2212, 2213, 2214, right Primer: 2207, 2215, 2216, 2217, 2220, 2224, 2225, 2226, Blocker: 2210, 2218, 2219, 2221, 2222, 2223, 2227, 2228, Detection: 2209, SEQIDNO:9 left Primer: 2230, 2233, 2234, 2235, 2236, 2237, 2238, 2239, 2240, 2241, 2242, 2243, 2244, right Primer. 2229, 2247, 2253, Blocker: 2232, 2245, 2246, 2248, 2249, 2250, 2251, 2252, 2254, 2255, 2256, Detection: 2231, SEQ ID NO: 46 left Primer. 2257, 2264, 2265, 2266, 2267, 2269, right Primer. 2258, 2261, 2262, 2263, Bloakar. 2260, 2268, 2270, 2271, 2272, 2273, 2274, 2275, 2276, 2277, 2278, 2279, 2280, 2281, 2282, 2283, 2284, 2285, 2286, 2287, 2288, 2289, 2290, 2291, 2292, 2293, 2294, 2295, 2296, 2297, 2298, 2299, 2300, 2301, Detection: 2259, SEQ ID NO: 13 left Primer: 2303, 2306, 2307, 2308, 2309, 2310, 2311, 2312, 2313, right Primer. 2302, 2314, 2316, 2317, 2319, 2320, 2321, 2322, 2323, Blocker: 2305, 2315, 2318, Detection: 2304, SEQ ID NO:18 left Primer. 2325, 2328, 2329, 2330, right Primer. 2324, 2331, 2332, Blocker: 2327, 2333, 2334, 2335, Detection: 2326, SEQ ID NO: 20 left Primer. 2337, 2340, 2341, 2342, 2343, 2344, 2345, 2346, 2366, 2368, 2371, 2381, 2383, 2384, 2385, 2388, 2390, 2391, 2392, 2399, 2400, 2401, right Primer: 2336, 2347, 2350, 2352, 2353, 2354, 2355, 2356, 2357, 2358, 2359, 2360, 2361, 2362, 2363, 2364, 2365, Blocker. 2339, 2349, 2367, 2370, 2372, 2373, 2374, 2375, 23'16, 2377, 2378, 2379, 2380, 2382, 2386, 2387, 2389, 2393, 2394, 2395, 2396, 2397, 2398, 2402, 2403, 2404, Detection: 2338, 2348, 2351, 2369, SEQ ID NO: 48 left Primer: 2406, 2409, 2410, 2411, 2412, 2413, 2414, 2415, 2416, 2417, 2418, 2419, 2420, 2421, 2422, 2423, 2424, 2425, 2426, 2427, 2428, 2429, 2430, 2431, 2432, 2433, 2434, 2435, 2436, 2437, 2438, 2439, 2440, 2441, 2442, 2443, 2444, 2445, 2446, 2447, 2448, 2449, 2450, 2451, 2452, 2453, 2454, 2455, 2456, 2457, 2458, 2459, 2460, 2461, 2462, 2463, right Primer. 2405, Blocker: 2408, 2464, 2465, 2466, 2467, 2468, Detection: 2407, SEQ ID NO: 22 left Primer: 2469, 2483, 2485, right Primer: 2470, 2473, 2474, 2475, 2476, 2477, 2478, 2479, 2480, 2481, Blocker. 2472, 2482, 2484, Detection: 2471, SEQ ID NO: 19 left Primer: 2486, 2494, 2495, 2496, 2502, 2503, 2506, 2509, 2516, 2517, 2518, 2523, 2524, 2533, 2538, 2548, 2549, 2556, right Primer: 2487, 2490, 2491, 2492, 2493, 2555, 2559, 2560, 2561, 2562, 2565, 2566, 2567, 2568, 2569, 2570, 2571, 2573, 2574, 2575, 2576, 2577, 2578, 2579, Blocker: 2489, 2497, 2498, 2499, 2500, 2501, 2504, 2505, 2507, 2508, 2510, 2511, 2512, 2513, 2514, 2515, 2519, 2520, 2521, 2522, 2525, 2526, 2527, 2528, 2529, 2530, 2531, 2532, 2534, 2535, 2536, 2537, 2539, 2540, 2541, 2542,2543,2544,2545,2546,2547,2550, 2551, 2552, 2553, 2554, 2558, 2563, 2564, 2572, 2580, 2581, Detection: 2488,2557, SEQ ID NO: 17 left Primer. 2583, 2586, 2587, 2588, 2589, 2590, 2591, right Primer: 2582, 2592, 2593, Blocker. 2585, 2594, 2595, 2596, 2597, 2598, 2599, Detection: 2584, SEQ ID NO: 21 left Primer: 2600, 2612, 2615, 2618, 2619, 2620, 2621, 2622, 2623, 2624, 2625, 2626, 2627, 2628, 2629, 2630, 2631, 2632, 2633, 2634, 2635, 2636, 2637, 2638, 2639, 2640, 2641, 2642, 2643, 2644, 2645, 2646, 2647, right Primer. 2601, 2604, 2605, 2606, 2607, 2608, 2609, 2610, 2611, 2614, 2648, 2649, 2650, 2651, 2652, 2653, 2654, Blocker: 2603, 2613, 2617, Detection: 2602, 2616, SEQ ID NO: 36 left Primer: 2655, 2659, 2676, 2677, 2678, 2680, right Primer: 2656, 2660, 2663, 2665, 2666, 2667, 2668, 2669, 2670, 2672, 2673, 2674, aIaTMu a1;3 a0up =spe2q SS'k3IN [pTAA $uI3CQj,ioA pAQ II04MUCQ03 s$IK733AI
JU29Iaaap JO aSCI a[p 01 pal?wi 3ou Inq gntpnput 'ire aq{ tt! paRM auo o} plupum an ;sqi susauz Aq aq Asua uo4ml4xg 'pWP-Axa st yNQ atcuoaaS aq; 'dap puwas aiD uI mWasd uc pappaquza anssil jo 'sptng Apoq 0~
'wpqs mgoIopm 'mi liao apnto<n soomos tpns 'fIq=3wd =saoznos sqnllao io anssp taog Palu;ost sT aidurns YMQ amuoua@ aip %iuaunpoquza Ieuo9Tppe qans jo dws ;s.4 aip aI
luatwajaid io3 paaa vq; laoqtyA (;oaraqT siuaas3iduzoo pus '",ON
QI a'dS M Z:SON Qr ZaS) uopuaeun aW W Suq== VlqQ aituousS Jo MUqs uoq atD 3o sisrCp,ae a% ioJ poWui e apu-oid uourenuq aqi ;o smunpoqu~a p;uopq~ SZ
'bZLZ :uommQ
'OSLZ '6ttrLZ '8bLZ 'SZLZ =3POIH
'LbLZ '9bLZ 'ttLZ 'ZZLZ :jomud msp 'SbLZ '~tbLZ 'ZVLZ 'It,LZ 'ObLZ '6~LZ '8~LZ 'L~LZ 0Z
49~LZ 'S~LZ 'v~LZ '~~LZ 'Z~LZ 'i~LZ '0~LZ '6ZLZ 'SZLZ 'LZLZ '9ZLZ '~ZLZ
:.mmmgd 401 Lz:oAIcIIa'as '60LZ MO9OWQ
'IZLZ 'OZLZ '6iLZ '8ILZ 'LILZ 'OILZ =VOi8 SI
'9ILZ 'LOLZ :m'ugd ul8u 'SiLZ 'bT LZ '~ILZ 'ZILZ 't ILZ '80LZ =mud 8aI
woxala$s '~89Z :uonomaQ 0I
'90LZ 'SOLZ 'VOLZ '~OLZ '669Z 'ti89Z :=MIH
'ZOLZ
'TOLZ '00LZ '869Z 'L69Z '969Z 'S69Z 'V69Z '~69Z 'Z69Z 'I69Z '069Z 'I89Z :Xuud lq8u '689Z '889Z 'L89Z '989Z 'S89Z 'Z89Z :JDmPd IRI
9Z:ox QIbas S
'IL9Z 'v99Z 'i99Z 'LS9Z :IIoqaalaQ
'6L9Z 'Z99Z '859Z :zqwiS
'SL9Z
~Z-ZT-SOOZ ~588ZSZ0 Fi'J

acids have been extracted, the genomic double-stranded DNA is used in the analysis.

In a preferred embodiment, the DNA may be cleaved prior to the treatment, and this may be by any means standard in the state of the art, in particular with methylation-sensitive restriction endonucleases.

In the third step, the DNA is then digested with one or more methylation sensitive restriction enzymes. The digestion is carried out such that hydrolysis of the DNA at the restriction site is informative of the methylation status of a specific CpG
dinucleotide.
In the fourth step, which is optional but a preferred embodiment, the restriction fragments are amplified. This is preferably carried out using a polyrnerase chain reaction, and said amplificates may carry suitable detectable labels as discussed above, namely fluorophore labels, radionuclides and mass labels.

In the f{fdh step the amplificates are detected. The detection may be by any means standard in the art, for example, but not limited to, gel electrophoresis analysis, hybridization analysis, incorporation of detectable tags within the PCR products, DNA array analysis, MALDI
or ESI analysis.

Subsequent to the determination of the meWylation state of the genomic nucleic acids the presence, absence or subclass of colorectal cell proliferative disorder is deduced based upon the methylation state of at least one CpG dinucleotide sequence of SEQ ID NOS:1 to SEQ II) NO:64 , or an average, or a value reflecting an average methylation state of a phuality of CpG
dinucleotide sequences of SEQ lD NOS:1 to SEQ ID NO:64. In an alternative embodiment the presence or absence of an aerodigestive cell proliferative disorder selected from the group consisting is deduced based upon the methylation state of at least one CpG
dinucleotide sequence of SEQ II7 NOS:20, 41, 35, 3, 39, 33 , or an average, or a value reflecting an average methylation state of a plurality of CpG dinucleotide sequences of SEQ Il) NOS:20, 41, 35, 3, 39, 33.

Diaznostig Assavs for colorectal ceR Proliferative disorders The present invention enables diagnosis of events which are disadvantageous to patients or individuals in which important genetic andlor epigenetic parameters within one or more of SEQ ID NOS:l to SEQ ID NO:64 may be used as markers. Said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
More specifically the present invention enables the screening of at-risk populations for the early detection of colorectal carcinomas. Furthermore, specific embodiments of the present inva-tion enable the debection of aerodigestive cancers and thus are additionatly suitable for this purpose.Further embodiments of the method may also be used as atternatives to cytological screening for the differentation of colorectal carcinomas from other colon cell proliferative disorders, e.g. colon polyps.
Specifi.cally, the present invention provides for diagnostic cancer assays based on measurement of differential methylation of one or more CpG dinncleotide sequences of SEQ ID
NOS:1 to SBQ ID NO:64, or of subregions thereof that comprise such a CpG
dinucleotide sequence. 'i'ypically, such assays involve obtaining a tissue sample from a test tissue, performing an assay to measure the methylation status of at least one of one or more CpG ;
dinucleotide sequences of SEQ ID NOS:1 to SEQ ID NO:64 derived from the tissue sample, relative to a control sample, or a known standard and making a diagnosis or prognosis based thereon.

In particular preferred embodiments, inventive oligomers are used to assess the CpG
dinucleotide methylation status, such as those based on SEQ ID NOS:1 to SEQ ID
NO:535, or arrays thereof, as well as in ltits based tlsmon and useful for the diagnosis and/or prognosis of colorectat cell proliferative disorders.

Kiu Moreover, an additional aspect of the present invention is a kit comprising, for example:
a bisulflte-containing reagent; a set of primer oligonucleotides containing at least two ofigonucleotides whose sequences in each case correspond, are complementary, or hybridize under stringent or highly stringent conditions to a 16-base long segment of the sequences SEQ
ID NOs:I to SEQ ID NO:535; oligonucleotides and/or FNA-oligomers; as well as instructaons for carrying out and evaluating the described method. In a fiuther preferred embodiment, said kit may further comprise standard reagents for perfonning a CpG position-specific methylation analysis, wherein said analysis comprises one or more of the following techniques: MS-SNuPE, MSP, MethyLight TM, HeavyMethylTM , COBRA, and nucleic acid sequencing.
However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
While the present invention has been described with specificity in accordance with eerhain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the iavention within the principles and scope of the broadest interpretations and equivalent configurations thereof.

EXAMPLES
Samples were received either as frozen tissue or extracted genomic DNA. DNA
samples were extracted using lysis buffer from Qiagen and the Roche magnetic separation kit for genomic DNA isolation. DNA samples were also extracted using Qiagen Genomic Tip-100 cohunns, as well as the MagnaPure device and Roche reagents. All samples were quantitated using speckrophotometric or fluorometric techniques and on agarose gels for a subset of samples.
Bisulfite treatmentand mPCR

Total genomic DNA of all samples was bisulfite treat.ed converting unmethylated cytosines to uracil. Methylated cytosines remained conserved. Bisulfite treatment was performed with minor modifications aceording to the protocol described in Olek et al.
(1996). In order to avoid processing all samples with the same biological background together resulting in a potential process-bias in the data later on, the samples were randomly grouped into processing batches. For bisulfite treatment we created batches of 50 samples randomized for sex, diagnosis, and tissue. Per DNA sample two independent bisulfite reactions were performed.
After bisulfitation 10 ng of each DNA sample was used in subsequent mPCR reactions containing 6-8 primer pairs.

Each reaction contained the following:
0.4 mM each dNTPS
1 Unit Taq Polymerase 2.5 l PCR buffer 3.5 mM MgC12 80 nM Primerset (12-16 primers) 11.25 ng DNA (bisulfite treated) Further detaik of the primers are shown in TABLE 1.
Forty cycles were carried out as follows: Denaturation at 95 C for 15 min, followed by annealing at 55 C for 45 sec., primer elongation at 65 C for 2 min. A final elongation at 65 C
was caYried out for 10 1.1.2 vbridization All PCR products frarn each individual sample were the,n hybridised to glass slides cariying a pair of immobilised oligDnucleotides for each CpG position under anatysis. Each of these detecfiion oligonu.cleotides was designed to hybridise to the bisulphite conveated sequence around one CpG site which was either originally unmethylatsd (TG) or snethylated (CG). See Table 2 for further details of all hybridisation oligonucleotides used (both informative and non-informative.) Hybridisation conditions were selected to allow the detection of the single nucleotide differences between the TG and CO variants.
5 l volume of each multiplex PCR product was diluted in 10 x Ssarc buffer (10 x Ssarc:230 ml 20 x SSC, 180 ml sodium lauroyl sarcosinate solution 20%, dilute to 1000 ml with dH2O). The reaction mixture was then hybridised to the detection oligonucleotides as follows.
Denaturation at 95 C, cooling down to 10 C, hybridisation at 42 C overnight followed by washing with 10 x Ssarc and dH2O at 42 C.
Further details of the hybridisation oligonucleotides are shown in TABLE 2.
Fluorescent signals from each hybridised oligonucleotide were detected using genepix scanner and software. Ratios for the two signals (from the CG oligonucleotide and the TG
oligonucleotide used to analyse each CpG position) were ealculated based on comparison of intensity of the fluorescent signals.

The s amples w ere p rocessed i n b atches o f 8 0 s amples randomized for se x, diagnosis, tissue, and bisalphite batch For each bisulfite treated DNA sample 2 hybridizations were perFormed. This means that for each sample a total nzunber of 4 chips were processed.
Data analysis methods Analysis of the chip data:

From raw hybridization intensities to methylation ratios;

The log methylation ratio (log(CG/TG)) at each CpG position is determined aceording to a standardized preprocessing pipeline that includes the following steps:

For each spot the median background pixel intensity is subtracted from the median foreground pixel intensity (this gives a good estimate of background corrected hybridization intensities):

For both CG and TG detection oligonucleotides of each CpG position the background corrected median of the 4 redundant spot intensities is taken;

For each chip and each CpG position the log(CG/TG) ratio is calculated;
For each sample the median of log(CG/TG) intensities over the redundant chip repetitions is taken.

This ratio has the property that the hybridization noise has approximately constant variance over the fall range of possible methylation rates (Huber et al., 2002).

]'~iindpe l Cannponent Analvsis The principle component analysis (PCA) projects measurement vectors.(e.g. chip data, methylation profiles on several CpGs ete.) onto a new coordinate system. The new coordanate axes are referred to as principal components. The f~r' st principal component spans the directaon of the largest variance of the data. Subseqaent components are ordered by decreasing variance and are orthogonal to each other. Difffereat CpG positions contribute with different weights to the extension of the data cloud along different components. PCA is an unsupervised technique, Le., it does not take into account the labels of the data points (for fiuther details see e.g. Ripley (1996)).

PCA is typically used to prnject high dimensional data (in our case methylation-azray data) onto lower dimensional subspaces in order to visualize or extract features with high variance from the data. In the present report we use 2 dimensional projections for statistical quality control of the data. We investigate the effect of different process parameters on the chip data and exclude that changing process parameters cause Iarge alterations in the measurement vahies.

A robust version of PCA is used to detect single outlier chips and exclude them from further analysis (Model et a1., 2002).

Hypothesis testinug The main task is to identify markers that show significant differences in the average degree of inethylation between two classes. A signifcant difference is detected when the nullhypothesis that the average methylation of the two classes is identical can be rejected with p<0.05. Because we apply this test to a whole set of potential markers we have to correct the p-values for multiple testing. This wag done by applying the False Discovery Rate (FDR) method (Dudoit et aL, 2002).
For testing the null hypothesis that the methylation levels in the twa classes are identical we u sed the I ikelihood ratio t est for 1 ogistic r egression models (Venables and R ipley, 2 002).
The logistic regression model for. a single marker is a linear combination of methylation measurements from all CpG positions in the respective genomic region o f interest (ROI). A
significant p-value for a marker means that this ROI has some systematic correlation to the question of interest as given b~ the two classes. However, at least formally it makes no statement about the actual predictive power of the marker.

Class prediction b~p~ Iearning In order to give a reliable estimate of how we1l the CpG ensemble of a selected marker can differentiate between different tissue classes we can determine its prediction accuracy by classification. For that purpose we calculate a methylation profile based prediction function using a certain set of tissue samples with their class label. This step is called training and it exploits the prior knowledge represented by the data labels. The prediction accuracy of that fnnction is then tested by cross-validation or on a set of independent samples. As a method of choice, we use the support vector mschine (SVM) algorithm (Duda (2001), C'bristiannini (2000)) to learn the prediction function. If not stated otherwise, for this report the risk associated with false positive or false negative classifications are set bo be equal relative to the respactive class sizes. It follows that the learning algorithm obtains a class prediction function with the objective to optimize acmacy on an independent test sample set.
Therefore sensitivity and specificity of the resulting classifier can be expected to be approximately equal.

Bstimatim & oerformance of the tissue class p edi'c~~mgs Valida~ol}
With limited sample size the cross-validation method provides an effective and reliable estimate for the prediction aecuracy of a disoriminator functi.on and therefore in addition to the significance of the markers we provide cross-validation accuracy, saisitivity and specificity estimates. For each classification task, the samples were partitioned into 5 groups of approximately equal size. Then the learning algorithm was trained on 4 of these 5 sample groups. The preclictor obtained by this method was then tested on the remaining group of independent test samples. The. number of correct positive and negative classifications was counted over 5 runs for the leaming algorithm for all posssble choices of the independent test group without using any latowledge obtained from the previous runs. Tbis procedure was repeated on up to 10 random permutations of the sample set. Note that the above-described _ cross-validation procedure evaluates accuraoy, sensitivity and specificity using practically all possible combinations of trainin.g and independent test sets. It therefore gives a better estimate of the prediction performance than simply splitting the samples into one training sample set and one independent test set.

Results Pigures 1, 5, 9, 13, 16, 20, 24, 28 and 32 show ranked matrices of data obtained according to Examples 1 and 2 according to CpG methylation differences between the two classes of tissues, using an algorithim. The figures are shown in greyscale, wherein the most significant CpG positions are at the bottom of the matrix with significanee decressing towards the top. Black indicates total methylation at a given CpG position, white represents no methylation at the particnlar position, with degc+ees of methylation represented in grey, from light (low proportion of inethylafion) to dark (high proportion of inethylation). Each row represents one specific CpG position within a gene and each column shows the methylation profile for the different CpGs for one sample. On the right side p values for the individual CpG

positions are shown. The p values are the probabilities that the observed distribution occurred by chance in the data set.

Figure 96 shows a ranked matrices of data obtained according to Exatnples I
and 2 according to CpG methylation differences between the two classea of tissues, (aerodigestive cancer on the left and healthy aemdigestive tissues on the right) using an aigorilthim. The most significant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Red indicates total methylation at a given CpG position, green represents no methylation at the particular position.. Each row represents one specific CpG
position within a gene and each column shows the methylation profile for the different CpGs for one sample.
Figures 2, 6, 10, 17, 21, 25, 29 and 33 show the uncorrected multivariate LogReg test results for each comparison. Each individual genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.

Figures 3, 7, 11, 14, 18, 22, 26, 30 and 34 show ranked matrices of data obtained according to Examples 1 and 2 of the accuracy of the genewise linear support vector machine cross validations between the two classes of tissues, for the best perforauing markers. The figures are shown in gmyscale, wherein the most sigrtifcant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Black indicates total methylation at a given CpG position, white represents no methylation at the particular position, with degrees of methylation represented in grey, from light (low proportion of methylation) ta dark (high proportion of inethylation). Each row represents one speeific CpG position withm a gene and each column shows the methylation profile for the different CpGs for one sample. On the right side accuracy values for each individual genomic region of interest are shown.

Figim 4, 8, 12, 15, 18, 23, 27, 31 and 35 shows the accuracy of the genewise linear support vector machine cross validation for all genomic regions of each classification. The accuracy of each genomic region is represented as black squares, the specificity as unMled diamonds, the sensitivity as unfilled squares. The accuracy as measured on the X-axis shows ttLe fraction of corrwtly classified samples.

CologNormal vs. Colorectai Camcer In the first comparison 102 colorectal careinoma samples were compared to 73 samples from nornial colon, including colon polyps and colon inflammatory disorders.
Figure 1 shows the multivariate test results of the top 12 performing markers using the conservative Bonferroni corrected Loglteg test.
Figure 2 shows the uncorrected multivariate LogReg test results for each comparison.
Each individual genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.
Figure 3 shows the accuracy of the top 12 performing markers.
Figure 4 shows the accuracy of the genewise linear support vector maclxine cross validation for atl genomic regions o~ each classification.
The following genomic markers were evaluated as being significalrt:
SEQ ID NUS:i-12,15-20, 22, 25-36, 38-49, 51-58, and oomplements thereof.
QthgZTissues vs. Colorectal Caneer In this classification 73 colorectal carcinoma samples were compared to an 'other tissue' class consisting of 140 samples from non-colorectal careinomas, peripheral blood lymphocytes and otber normal tissues of non-colorectal origin. These markers therefore enable the detection of colorectal carcinoma cells in', for exaznple, body fluids such as serum.

Figure 5 shows the multivariate test results of the top 12 performing markers using the conservative Bonferroni corrected LogReg test.

Fig= 6 shows the uncortected multivariate L ogReg test results for each comparison.
Each individual genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.

Figure 7 shows the accuracy of the top 12 performing markers.

Figure 8 shows the accuracy of the genewise linear support vector machine cross validation for all genomic regions of each classification.
The following genomic markers were evaluated as being signi#icant:
SEQ ID NOS:1-23, 26-36, 38-43, 45-49, 51-58 and complements thereof.
Colon Nonnal and Other Tissue vs. Colon Cancer In this classification 73 colorectal carcinoma samples were compared to 242 colon norn-al and 'other tissue' samples. The colon normal class consisted of healthy colon, colon polyps and inflammatory disorder colon tissue samples, the 'other tissues' consisted of samples from non-colorectal carcinomas, peripheral blood lymphocytes and other normal tissues of non-colorectal origin.
Figure 9 shows the multivariate test results of the top 12 performing markers using the conservative Bonferroni corrected LogReg test.
Figure 10 shows the uncorrected multivariate LogReg test results for each comparison.
Each individual genomic region of interest is represented as a poin#, the dotted line represents the cut off point for the 25% false discovery rate.

Figure 11 shows the accuracy of the top 12 performing markers.

Figure 12 shows the accuracy of the genewise linear support vector machine cross validation for all genomic regions of each classification.
The following genomic markers were evaluated as being sigtuficant:
SEQ ID NOS:1-3, 5-13,15-23, 26-36, 38-43, 45-49, 51-58, and complements thereof.
Polyps vs. Colorectal Cancer Tn this classification 73 colorectal carcinoma samples were compared to 51 colon polyp samples.

Figure 13 shows the multivariate test results of the top performing markers using the conservative Bonferroni corrected LogReg test.
Figure 14 shows the accuracy of the top 12 performing maticers.
Figure 15 shows the accuracy of the genewise lz.n.ear support vector machine cross validation for all genomic regions of each classification.

The following genomic markers were evaluated as being siguificant:
SEQ ID NOS:11, 25, 27, 38, 40, 45, 53, and complements thereof.
Colon gormal vs. Colorectal cell praliferat~,ve disorder In this oalssification 124 colorectal cell proliferative disorder samples (consisting of colon polyps and colorectal carcinoma) were compared to 51 'normal colon' samples consisting of both heaithy colon saxnples and colon tissue of inflammatory disorders.
Figure 16 shows the multivariate test results of the top 12 performing markers using the conservative Bonferroni correeted LogReg test.
Fignre 17 shows the uneorrected multivariate LogReg test results for each comparison.
Each individnal genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.
Figure 18 shows the accuracy of the top 12 performing markers.
Figure 19 shows the aecuraey of the genewise linear support vector machine cross validation for all genomic regions of each classification.
The following genomic markers were evaluated as being significant:
SEQ ID NOS:1-58, and complements thereof.

Colon Normal vs. Colorectal Cancer In this classification 73 colorectal carcinoma samples were compared to 51 'normal colon' samples consisting of both healthy colon samples and colon tissue of inflammatory disorders.
Figure 20 shows the multivariate test results of the top 12 performing markers using the conservative Bonferroni corrected LogReg test.

Figure 21 shows the uncorrected multivariate LogReg test results for each comparison.
Each individaal genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.

Figure 22 shows the accuracy of the top 12 performing markers.

Figare 23 shows the accuracy of the genewise linear support vector machine cross validation for aii genonzic regions of each classification.
The following genomic markers were evaluated as being significant:
SEQ ID NOS:1-3, 5-23, 25-36,38-49, 51-58, and complements thereof.
Colon Normal and Other Tissues vs. CQlorectal cell õvrgUferative Disordef In this classification 124 colorectal cell proliferative disorder sainples (consisting of colon polyps and colorectal carcinoma) were compared to a class consisting of 'colon normal' and 'other tissue' samples. The colon nonnal samples consisted of both healthy colon samples and colon tissue of inflammatory disorders, the 'other tissue' samples consisted of samples from non-colorectal carcinomas, peripheral blood lymphocytes and other normal tissues of non-colorectal origin.
Figure 24 shows the multivariate test results of the top 12 performing makers using the conservative Bonferroni corrected LogRegtest.
Figure 25 shows the uncorracted multivariate LogReg test results for each comparison.
Each individual genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% false discovery rate.
Figure 26 shows the accuracy of the top 12 performing markers.

Figure 27 shows the aceuracy of the genewise linear support vector machine cross validation for all genomic regions of each classification.

The following genomic markers were evaluated as being significant:
SEQ ID NOS:1-36, 38-43, 45-58, and complements thereo~

Other Tissue vs. Colon Tissue The following comparison was carried out in order to identify markers capable of discerning elevated levels of free floating colon DNA, especially in bodily fluids as a marker of tumor progression. In this classification the 'colon tissue' class consisted of samples from colorectal carcinoma, colon polyps, colon tissue of inflannnatory disorders and healthy colon tissae. The 'other tissue' class consisted of samples from non-eoloreetal carcinomas, peripheral blood lymphocytes and other normal tissues of non-colorectal orlgin.

Figure 28 shows the multivariate test results of the top 12 perfornning markers using the conservative Bonferroni corrected LogReg test.

Figure 29 shows the uncorrected multivariate LogReg test results for each comparison.
Each individual genomic region of interest is represented as a point, the dotted line represents the cut off point for the 25% felse discovery rate.
Figure 30 shows the accuracy of the top 12 performing markers.
Figure 31 shows the accuracy of the genewise linear support vector machine cross vaiidation for all genomic regions of each classification.
The following genomic markers were evaluated as being significant:
SEQ ID NOS:1-58, and complements thereof.

N=ai Tissue vs. Cell Proliferative Disorder Tissue In this classification the gene panel was assessed for its ability to accurately discriminate cell proliferative disorder samples from both colorectal carcinoma, colon polyps and non-colon origin cancers from 'normal tissues', namely healthy colon samples, colon tissue of inflammatory disorders, peripheral b lood 1 ymphocytes, o ther n ormal t issues o f n on-colorectal origin~

Figure 32 shows the multivariate test resalts of the top 12 performing markers using the conservative Bonferroni corrected LogReg test.
Figure 33 shows the uneorrected multivariate LogReg test results for each comparison.
Each individual genomic region of interest is represented as a point, the dotted line repre,sents the cut off point for the 25% false discovery rate.
Figure 34 shows the accuracy of the top 12 performing marlcers.
Figure 35 shows the accuracy of the genewise linear support vector machine cross 15 validation for all genomic regions of each classification.

The following genomic markers were evaluated as being significant:
SEQ II) NOS: 1-36, 38-43, 45-49, 51-58, and complements tlaereof.
Aerodigestive canc y. hW~,iy aerodiQestive tisgues In this classification ft te,rm 'awodig;tive' describes a sanzple set of tissues consisting lung, liver, pancreas, bile duct, stomach, and colon. Figure 96 shows a ranked matrices of data obtained according to Examples I and 2 according to CpG methylation differences between the two classes of tissues, (Cancerous tissues on the left of the matrix were compared to normal tissues on the right of the matrix.) using an algorithim. The most significant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Red indicates total methylation at a given CpG position, green represents no mthylation at the particular position.
Each row represents one specific CpG position witbin a gene and each column shows the methylation profile for the different CpGs for one sample.The following genomic markers were considered significant SEQ ID NOS: 20, 41, 35, 3, 39 & 33.

The following examples descnbe the analysis of the methylation status of the genomic sequences SEQ ID N0:35, SEQ ID NO:34, SEQ ID N0:39, SEQ ID N0:29 in healthy and sick colorectal cell proliferative *disorder samples. The initial link between said genes and colorectal cell proliferative disordecs was initially carried by means of hybridisation analysis as descn'bed in EXAMPLE 1. The sequences were then selected from the larger set of genes analysed in said example, and the correlation between methylation status and colorectal cell proliferative disorder states was validated by analysis of samples using other methylation analysis techniques, namely the MSP- MethyLight TM and HeavyMethyl T"A MethyLight T"A assays.
Please note that the term 'MethyLight TM' is used to describe real time PCR analysis of bisulfite treated DNA
using probes of both the TaAmanT"! (single probe) and Lightcycler TM(dual probe) technologies.

Analysis of inethylation within colon cancer using an MSP- MethyLight assay (SEQ ID
NO 35) DNA was extracted from 33 colon adenocarcinoma samples and 43 colon normal adjacent tissues using a Qiagen entraction kit. The DNA fram each sample was treated using a bisulfite solution (hydrogen sulfite, disulfite) according to the agarose-bead method (Olek at al 1996). The hnatment is such that all non methylated cytosines within the sample are converted to thymidine. Conversely, 5-methylated cytosines within the sample reenain unmodified.

The methylation status was determined with a MSP-MethyLight assay designed for the CpG island of interest and a control fragment from the beta actin gene (Eads et al., 2001). The CpG island assay covers CpG sites in both the primers and the Taqman style probe, while the control gene does not. The control gene is used as a measure of total DNA
concentration, and the CpG island assay (methylation assay) determines the methyiation levels at that site.
Methods: The SEQ ID NO 35 gene CpG island assay was performed using the following primers and probes:

Forward Primer: CGGAGGGTACGGAGATTACG (SEQ ID NO:14387);
Reverse Prinaer. CGACGACGCGCGAAA (SEQ ID NO: 14388); and Probe: CGAAACCCTAAATATCCCGAATAACGCCG (SEQ ID NO: 14389).The corresponding control assay was performed using the following primers and probes:
Primer: TGGTGATGGAGGAGGTTTAGTAAGT (SEQ ID NO: 14390);
Primer: AACCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO:14391); and Probe:
ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 14392) The reactions were run in triplicate on each DNA sample with the following assay conditions:Reaction solution: (900 nM primers; 300 nM probe; 3.5 mM Magnesium Chloride; 1 unit of taq polymerase; 200 M dNTPs; 7 1 of DNA, in a final reaction volume of 20'.
l);Cycling conditions: (95 C for 10 minutes; then 50 cycles of: 95 C for 15 seconds; 60 C for I
minute ).

The d ata w as a nalysed u sing a P MR c alculation p reviously d escribed i n t he l iterature (Eads et al 2001).Results. The mean PMR for normal samples was 0.15, with a standard deviation of 0.18. The mean PMR for tmnour samples was 17.98, with a standard deviation of 18.18. The overall difference in methylation levels between tumour and normal samples is significant in a t-test (p=0.00000312). The results are shown in Figure 36. A
Receiver Operatnng Characteristic curve (ROC curve) of the assay was also deter,mined A
ROC is a plot of the true positive rate against the false positive rate for the different possible cutpoints of a diagnostic test. It shows the tradeoff between sensitivity and specificity depending on the selected cutpoint (any increase in sensitivity will be accompaaied by a decrease in specificity).
The area under an ROC curve (AUC) is a measure for the accuracy of a diagnostic test (the larger the area the better, optimum is 1, a random test would have a ROC curve lying on the diagonal with an area of 0.5; for reference: J.P. Egan. Signal Detection Theory and ROC
Analysis, Academic Press, New York, 1975). The AUC for the MSP-MethylLightr"A-Assay is:
0.94 (Figirre 37).

Methylation of SEQ ID NO 35 within colon cancer was analysed using a HeavyMethyl MetbyLightTM assay. The same DNA samples were also used to analyse methylation of the CpG
island with a HeavyMethyl MethyLight"" (or HM MethyLightT") assay, also referred to as the HeavyMethyl"" assay. Tlxe methylation status was determined with a HM
MethyLiglat'"' assay designed for the CpG island of interest and the same control gene assay described above. The CpG island assay covers CpG sites in both the bloekers and the TaqmanTM style probe, while the control gene does not.
Methods. The CpG island assay (methylation assay) was perfornned using the following primers and probes:

Forward Primer. GGTGATTC'rTTTATTGTTATGGTTTG (SEQ ID NO:14393) Reverse Prinaer: CCCCTCAACCTAAAAACTACAAC (SEQ ID NO:14394) Foravard Blocker. GTI'ATGGTTTGTGATTTTGTGTGGG (SEQ ID NO: 14395) Reverse Blocker. AAACTACAACCACTCAAATCAACCCA (SEQ ID NO: 14396) Probe: AAAATTACGACGACGCCACCCGAAA (SEQ ID NO: 14397) The reactions were each run in triplicate on each DNA sample with the following assay conditions:
Reaction sohdiot:: (400 nM primers; 400 nM probe; IOpM both blockers; 3.5 mM
magnesium chloride; lx ABI Taqman buffer, 1. unit of ABI TaqGold polymerase;
201iM
cIIVTPs; and 70 of DNA, in a final reaction volume of 20 0);

Cycling conditions: (95 C for 10 minutes); (95 C for 15 seconds, 64 C for 1 minute (2 cycles)); (95 C for 15 seconds, 62 C for 1 minute (2 cycles); (95 C for 15 seconds, 60 C for I
minute (2 cycles)); and (95 C for 15 seconds, 58 C for 1 minute, 60 C for 40 seconds (41 cycles)).

Results. The mean PMR for normal samples was 1.12 with a stavdard deviation of 1.45.
The mean PMR for tumour samples was 38.23 with a standard deviation of 33.22.
The overall difl'erence in methylation levels between tumour and normal samples is significant in a t-test (p~.000000326). The results are shown in Figure 36.

A ROC curve of the assay was also deternuned_ The AUC for the MSP-Methyl-Light-Assay is 0.91 (Figure 38) The assay was tested on an additional set of colon samples (25 adenocarcinoma, normals, and 13 adenomas). The results showed a significant difference again (Figure 39). The ROC are shown in Figure 40-42.
IO The MSP and HeavyMethyl variants of the MethyLight assay were determined to be equivalent for the analysis of methylation in SEQ ID NO:35. Figure 48 shows the regression plot of the percentage methylation detected in each sample using the two methods.

The SEQ ID NO:35 -HeavyMethyl-MethyLight-assay was also tested against a panel of other tissues (Fignre 43). Besides the colon cancer samples only one of the two breast cancer tissues were methylated. However, on a panel of 21 additional breast tumours (different stages), only one was methylated (Figure 44). So the marker is specific for colon tumour samples. All primers, probes, blockers and reaction conditions were identical to those used in the analysis of the colon cancer sainples (Example 3).

Twelve of the colon tissues analysed by real-time PCR also had paired serum taken before surgery. We extracted DNA from 1 mi of that serum using a Qiagen [J1traSensO DNA
extraction k it, b isuifite treated the DNA s ample, and ran the SEQ ID N 0:35 - HeavyMethyl-MethyLight""-assay on those samples. The control gene did not amplify for three of the cancer sernm samples and three of the normal serum samples, so we can conclude that the sample preparation did not work in these cases. In the other cases, there was evidence of higher methylation in the cancer samples than the normal samples (Figure 45).

Analysis of inethylation within colon cancer using a SEQ ID NO:34 -MSk-Met1Fyl.ightTM Assay. The colon cancer samples described in Example 2 were also analysed S using a SEQ ID NO:34 -MSP- MethyLig61T"" Assay with a Taqman style probe.
The sample preparation was c,arried out as described above (Example 1). The assay was performed using the following primers and probes:
Forward Primer. TGGGATTAAGATTTTCGGTTAGTTTC (SEQ ID NO:14398) Reverse Primer. CACTACAACGCTACGCGACTAAA (SEQ ID NO:14399) Probe: TCGACGTTACCCAAACGAATCACATAAAAAAC (SEQ ID NO:14400) The corresponding control assay was performed as described above (EXAMPLE 2) The reactions were run in triplicate on each DNA sample with the following assay conditions:
Reactfon soluiion: (900 nM primers; 300 nM probe; 3.5 tnM magnesium chloride;

units of taq polymezsse; 20Q M dNTPs, 5 M blocker; and 7. l of DNA, in a final reaction volume of 20 l);
Cyclfng cwnditions: 95 C for 10 minutes; (95 C far 15 seconds, 60 C for 1 minute) 50 cycles The d ata w as analysed u sing a PMR c alculation p reviously d escn'bed i n tb.e literature (Eads et al 2001).
Results. The results are shown in Figure 36. The mean PMR for normal samples was 3.93, with a standard deviation of 3.57. The mean PMR for tumour samples was 23.06, with a standard deviation of 20.23 The overall difference in methylation levels between tumour and normal samples is significant in a t-test (p=0.000003063). The ROC curve of the assay is shown in Figure 46. The AUC is 0.84.

This was further confirmed using a SEQ II} NO:34 -HeavyMethyl MethyLightTM
assay, using dual Lightcyclee" probes.

Methods. The CpG island assay (methylation assay) was perfnrmed using the following primers and ptobes:

Forward Primer. TGGATAGGAGTTGGGATTAAGATTTT (SEQ ID NO:14401) Reverse Primer. CTTATTACAATTTAAAEIAAAAAAT"TCACTACAA (SEQ ID
NO:14402);

Blocker: AAATTCACTACAACACTACACAACTAAATTCAACATTAC (SEQ ID
NO:14403);

Probe: TT"I"TCGTATTTTTT"TTCGGGTTATTACGTTTT-Fluor (SEQ ID NO: 14404);
Probe: LC640-ATGTGATTCGTT"TGGGTAACGTCGA Phos (SEQ ID NO:14405.
The reactions were each run in triplicate on each DNA sample with the following assay oonditions:

Reaction conditions: 500 nM prirners; 10 M blocker; 250 nM probes; 4 mM
Magnesium Chloride Cycling profile: 95 C denaturation for 10 minutes; 50 cycles: 95 C 10 seconds, seconds, 72 C 20 seconds Analysis of methylation within colon cancer using a SEQ ID NO:29 -MSP-MethyLight'"" Assay. The colon c ancer samples d escnbed in Example 2 w ere also analysed using a SEQ ID NO:29 -MSP- MethyLightTM' Assay with a Taqman style probe. The sample preparation was carried out as described above (Example 2). The assay was performed using the foilowing primezs and probes:
Forward Primer. TTTTT3 TTTCGGACGTCGTTG (SEQ ID NO: 14406) Reverse Primer: CCTCTACATACGCCGCGAAT (SEQ ID NO: 14407) Probe: AATTACCGAAAACATCGACCGA (SEQ ID NO:14408) The reactions were run in triplicate on each DNA sample with the following assay conditions:
Reaction solution: (900 nM primers; 300 nM probe; 3.5 mM magnesium chloride; 1 units of taq polymerase; 20Q pM (NTPs, 5 M blocker; and '1 l of DNA, in a final reaction volume of 20 l);

Cycling conditions: 95 C for 10 minutes; (95 C for 15 seconds, 60 C for 1 minute) 50 cycles The corresponding control assay was performed as desamW above (EXAMPLE 2).
The d ata w as analysed u sing a P MR c aiculation previously described in the 1 iterature (Eads et a12001).
Results. The resalts are shown in Figure 36. T'ae mean PMR for noimal samples was 3.04, with a standard deviation of 4.21. The mean PMR for tumour samples was 21.38, with a standard deviation of 24.08 The overaU difference in methylation levels between tumour and normal samples is significant in a t-test (p=0.0000101973). The ROC curve of the assay is shown in Figure 47. The AUC is 0.80.
This was fiuther confirmed using a SEQ ID N0:29 -HeavyMethyl MethyLightTM
assay (using dual labeled Lightcycl$rTM probes.
Methods. The CpG island assay (methylation assay) was performed using the following primers and probes:
Forward Primer: GTAGGGTTATTGTTTGGGTTAATAAAT (SEQ ID NO: 14409) Reverse Primer. T CTCCTCTACATAC (SEQ ID
NO:14410) Blocker AACTCCTCTACATACACCACAAATAA.A,TT (SEQ II) NO:14411) Probe: CGAAAACATCGACCGAACAACG-Fluor (SEQ II) NO:14412}
Probe: LC640-GTCCGAAAAAAAAAAAACGAACTCC-Phos (SEQ II) NO: 14413) The reactions wera each run in tripiicate on each DNA sample with the following assay conditions:
Rgaction conditions: Forward primer: 600 nM; Reverse primer. 30 nM; Blocker.

M; Probes: 500 nM; Taq polymerase: 0.1 Ul l; dNTPs: 0.2mM each; Magnesium Chloride: 4 mMiBSA: 0.25 mg/ml; Roche buffer with no MgClz: lx Cyci,ne conditions: 95 C danaturation for 10 minutes; 50 cycles: 95 C for 10 seconds, 57 C for 25 seconds, 72 C for 10 seconds Analysis of inethylation within oolon cancer using a SEQ ID NO:29 -MSR
MethyLightT"' Assay. An additional assay for SEQ ID NO:29 was tested on colon samples. The assay was t ested o n t wo s ats o f t issues, e ach w ith 12 c olon a denocarcinomas a nd 12 n onnal adj acent tissue sanuples.

The sample preparation was canied out as described above (Example 2). The assay was perfozzned using the following primers and probes:
Forward Primer: GGACGT'1"TTTTATCGAAGGCG (SEQ ID NO:14414) Reverse Primer: GCCACCCAACCGCGA (SEQ ID NO: 14415) Probe: ACCCGAAATCACGCGCGAAAAA (SEQ ID NO:14416) The reactions were run in triplicate on each DNA sample with the following assay conditions:

Reaction solution: (900 nM primers; 300 nM prnbe; 3.5 mM magttesium chloride;
I
units of taq polymerase; 200, M dNTPs, 5 M blocker; and 7 0 of DNA, in a final reaction volame of 20 l);
Cycling conditions: 95 C for 10 minutes; (95 C for 15 seconds, 60 C for 1 minute) 50 cycles. The corresponding control assay was performed as described above (Example 2) The data w as analysed u sing a P MR c alculation p reviously described in the 1 iterature (Eads et al 2001). In both cases, SEQ ID NO:29 was significantly more rnethylated in the cancer samples. The ROC curves of the assays are shown in Figures 49 and 50.
The AUC are 0.93 and 1.

Analysis of methylation within colon cancer using a SEQ ID NO:39 -MSP-MethyLightTM Assay The colon cancer samples descn'bed in Example 2 were also analysed using a SEQ
ID
NO:39 -MSP- MethyLights" Assay. The sample preparation was carried out as described above (EXAMPLE 2). The assay was performed using the following primers and probes:

Forward Primer: GACGGATTTTTTP!"TAACGTTT'I1TC (SEQ ID NO:14417) Reverse Primer: AAATAAAATACCACCTCCGCGA (SEQ ID NO: 14418) Probe: GCTCCTCGCGAAATACTCACCCCG (SEQ ID NO:14419) The reactions were ran in triplicate on each DNA sample with the following assay conditions:

Reaction solution: (900 nM primers; 300 nM probe; 3.5 mM magnesium chloride; 1 units of taq polymerase; 200, pM dNTPs, 5 M blocker, and 7 t of DNA, in a final reaction volume of 20 l);

Cycling conditions: 95 C for 10 minutes; (95 C for 15 seconds, 60 C for 1 minute) 50 cycles.

The conresponding control assay was performed as described above (EXAMPLE 2).
.The data was analysed using a PMR calculation p reviously d esen'bad in the l iterature (F=ads et al 2001).

Results. The results are shown in Figura 36. The mean PMR for normal samples was 2.25, with a standard deviation of 2.42. The mean PMR for tamour samples was 25.67, with a standard deviation of 17.57 The overall difference in methylation levels between tumour and normal samples is significant in a t-test (p-0.00000000118). The ROC curve of the assay is shown in Figure 52. The AUC is 0.94 This was further confirmed using a SEQ ID NO:39 -HeavyMethyl MethyLightTM
assay, usang dual Lightcycler probes using Lightcycler style dual probe teclmology.

Methods. The CpG island assay (methylation assay) was performed using the following primers and probes:

Forward Primer: GTTAGTTAGITAATTTTTTAAATAGATTAGTAG (SEQ ID
NO: 14420) Reverse Primef: CAAAAAAACAAATAAAATACCACCTCC (SEQ ID NO:14421) Blocker. CCTCCACAAAACTCACTCC'PCACA.AAATAC (SEQ ID NO:14422) Probe: red640 TTTCGTTTTGTATGGTAGA.TACG('xGGTGA- phosphate (SEQ ID
NO:14423) Probe: ATTAATGGTTTTATAAGACGGATI"1'TTTTTTAACGT- fluorescine (SEQ ID
NO:14424) The reactions were each run in triplicate on each DNA sample with the following assay conditions:

Reaction conditions: Forward primer=. 600 nM; Reverse primer. 300 nM; Blocker.

M; Probes: 500 nM; Taq polymerase: 0.1 Ul l; dNTPs: 0.2 mM each; Magnesium Chloride: 4 mM; BSA: 0.25 mg/rnl; Roche buffer with no MgC12:1x CLc-hLng conditions: 95 C denahiration for 10 minutes; 50 cycles: 95 C for 10 seconds, 57 C for 25 seconds, 72 C fer 10 seconas, Fxper'm;õe t 10: Stool analysis of meftlation markers The following experiments were run in order to establish the feasibility of inethylation markers (for the detection of colon cell proliferative disorders) from DNA
derived from stool samples. Accordingly, a series of samples were prepared each comprising either stool only (control) or stool with the addition of a controlled amount of cells from the colon cancer cell line SW 620 (25,000 cell equivalent -0.15 ug) the prepared samples were then frozen. Three different stool ss4nples wear, used. As a positive control a further sample was prepared comprisingperipheral blood lymphocytes (PBLs) and a controlled amount of cells from the colon cancer cell line.
The samples were as follows:
Class 1: Stool sample No. I
Class 2: Stool sample No. 1+ 0.15 ug Class 3: Stool sample No. 2 Class 4: Stool sample No. 2 + 0.15 ug Class 5: Stool sample No. 3 C]ass 6: Stool sample No. 3+ 0.15 ug Class T: PBS + 25,000 cell equivalents (0.15 ug) Class 8: H20 Multiple samples were prepared in each class. 300 ng of stool DNA was present in each sample.
Each sample was then analysed for methylation using an MSP TaqMan assay for the gene EPHB65 as follows:

Primer Forward: T'I7'T1TITTCGGACGTCGTTG (SEQ ID NO: 14455) Primer Reverse: CCTCTACATACGCCGCGAAT (SEQ ID NO:14456) Probe: AATTACCGAA.AACATCGACCGA (SEQ ID NO:14457) Cyocling conditions were: The reaction coiiditions for TaqMan:

Initial denaturation 95oC 10min-Denatiuation 95oC 15sec Armealing/ Extension 6OoC 60sec 50 cycles Amplification curves of the PCR reaction were according to figures 52 to 58.
Class 1: Figure 52 Class 2: Figure 53 Class 3: Figure 54 Class 4: Figvre 55 Class 5: Figure 56 Class 6: Not applicable (see below) Class 7: Figure 57 Class 8: Figure 58 The X-axis shows the cycle number of the polymerase chain reaction, the Y-axis shows the delta Rn, which is the fluorescence intensity over background, the horizontal line (A) represents the threshold level of the calibration curve (B), if the curve reaches above (A) methylation has been detected.
As can be seen, methylated colon oancer DNA could be detected in classes 2 &
5. Class 6 was not analysed as methylated DNA was detected in the stool sample (class 5).
In order to detennune the absolute sensitivity of inethylated DNA detection in stool samples stool sample No. 2 was spiked with varying amounts of SW 620 DNA. Five classes of samples were analysed using the MSP assays above:
= Class B:25,000 cell equivalents in 250 mg stool = Class C:2,500 cell equivalents in 250 mg stool = Class D:250 cell equivalents in 250 mg stool = Class E:25 cell equivalents in 250 mg stool = Class F:0 cell equivalents in 250 mg stool The amplification curves can be seen in figure 59. The X-axis shows the cycle number of the polymerase chain reaction, the Y-axis shows the delta Rn, which is the fluorescence intensity over backgi+ound, the horizontal line (A) reparestnts the threshold level of the calibmtion curves (B-F), if the curves reach above (A) methylation has been detected.Curves B, C, D; E; & F are the amplification curves of classes B, C, D, E& F respectively. Thus it can be seen that methylated DNA can be detected in stool samples at levels of 25 cells per 250 mg stool.

Example 11:

Real time analysis of inethylatian sensitlve re.striction.

DNA was prepared from from ten colon tumor samples and ten normal adjacent tissue samples. DNA isolation was performed using standard methods known to the expert and quantified by W measurement.

A digestion reaction was performed with the following reagents:
1 g genomic DNA;
25 U enzyme (10U/ l);
Y+/Tango Buffer By incubation 37 C.

The following steps were pe,rformed for all samples in parallel. I g of DNA
was dissolved in 190 1 Y+/Tango Buffer (Fermentas) in 0,2nil PCR tubes. 95 l of the reaction solution (half of the overall volume) was pipetted into a ele8n PCR tube as a control. To the remaining reagent in the first tube 1,251t1 HpaII and 1,25p1 HirsSI
restriction endunuclease (both from Fermentas)were added.
To the second tube 2,5 1 of a nzixture of glycerol and water (v:v =1:1) was added.
After incubating all 40 tubes at 37 C in an EppendorffThermocy+eler far five hours. Then another aliquot of restriction enzyme, resp. water-glycerol mix, was added to each tube and the incubation was extended for ten hours. After this period of time the restriction enzymes wem inactivated by heating at 65 C for 10 minutes.
Subsequently, dilutions of each tube were assembled in 96we11 plates by transfetring 20 1 from each tube into the plates and adding 80 1 water.

FinaUy, both the restriction product and the control of each sample were analyzed by Quantitative Real Time PCR. In tWs example 121i1 of a SybrGreen containing PCR
mastermix containing one of the primers according to table 4 was pipetted into a 96we11 Taqman plate followed by 81t1 of the eorresponding dilutions of zestricted sample and blank (each in duplicate).
Real Time PCR was performed on a ABI 7700 instrument applying the following temperatare profile:15 minutes at 95 C; 50 cycles of:15 seconds at 95 C, 45 seconds at 65 C, 75 seconds at 72 C;15 seconds at 95 C followed by 50 C for one hour.
Using the described primers and conditions amplification is observed only for methylated copies of the analysed sequences (according to table 4) when methylation sensitive restriction has been performed prior to PCR, since unnnethylated copies are digested during this step. The amount of inethylated DNA after restriction is normatized against the total amount of DNA present before the restrtction as obtained by Real Time quimtitation of the blank of the same sample. The equation ,} ect=Ctb,,* -CtõM',,W, represents a messare for the relative amount of unmethylated DNA present in a DNA sample. A
value of zero means that the DNA is completely methylated. A value of 0.5 corresporxis to approximately 50% methylation in case of an optimised PCR reactions whereas larger values correspond to low methylation levels. The relative amount of methylated sequence present in a sample would be given by.

(2) M - F- o where E is the PCR efficiency. The PCR efficiency is easily obtained by methods known to the expert.

Table 4 esul Gene Forward primer Reverse Prinaer Figure ID GACGGGGGTTCTGGACTTAC CCAGTCCCTGGATGTTGCT
NO: 8 (SEQ ID NO: 14458) (SEQ ID NO:14459) ID GCTAAGCCGGAGTCACCAAG CGCTGAGACCGAGAAGAAG
NO: 5 (SEQ IIID NO:14460) (SEQ ID NO:14461) S8i AlMuaptooB sgnn ojdures anssti Isiqozro.tq V '.motum suqouap j, lo 1etzrxou 2un povap u, se sFxB-x aqi uo pamoaus st aidures Iunp?Aipq ~'3 tL - 09 ~j3 ut unnoqs aa~
s;Insa~

(isvtit:ou cII bas) (ostrot:Ox (a bas) sv :o .LOO to,>~tot~o~so,to~~~oo o~.La.LOO,LS~r.~as~roo.to ai IL bas (6Litt:Ox (abaS) (8Liti-Old Cl baS) Z :O
JJ.I.JWJMDMVJVJD,LVJ .LJ31JJDDd3fAL3Wd.I7DD CU
oL bsis (LLbbuOx CII bas) (9LbbI :ox Ca bas) ~9 :0 D,L.Loa.LZ.~~omoo,tayDZD .LD.I.300,V.LVrJDJaYMD,LD a[
69 bas (SLbbI:Ox Cli bas) (bLtrbi:Ox CII bas) b9 :O
DZrJW'J~DW.L,L~DVDWJD3 ,LDSJODOd,L~~OMDa ,LJ CII
89 bas (~L"vox (a bas) (ztttr=ox cII bas) 9tr :o JWW:?VJDVD.LiJ.L3JVrJDM rJJ,LJ,LDJWIADd',L,I.I2V3D CC[
L9 baS
(ILbf-i:ON (II b3S) (OLtbI:Qx (II bas) t9 :p W,LrJO'd003dOJJJJ,Lfl'd ~WD'~J'da DOiJDZDVVJZ,LD QT
99 bas (69trtr I:ox ca bas) (89bvi:Ox QI bas) i I:O
J,DV000<JDd,LDJ.JJJ'~JW WJ,LJDdfl~'JVJJWflJ,L.-A tII
S9 bas (99b bl:oN (n bas) zi :o (L9ttT:ox CII bas) DWOdrJO'JJVJW,LJd'J'JD CQ
tr9 1.ad'OJE?rJ~VJD,LOOD'JW bas (s9w:Ox ca bas) (miI:ox cabas) z9 :o .LrJ1LJJ.iaõL007.L~~3V~J,.Ld .L1.,I.flVrJHHDDD,Ld'JDJ.LJD (11 ~9 bas aI ~o (~9tr6i:ox (n bas) (z9bbl:ox CCI bas) m ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

analysed in some assays, these are aanotated with an armw, and are irrelevant in the context of the present invention. The Y-axis shows the level of inethylation ('meEhylation rate ') in the sample. The methylation rate {methylatedl(methylated + unmethylated) are shown for the fragments corresponding to the primer pairs in Table 4. Formula (2) above was used for the calculation assuming a PCR efficiency of B= 2.
The data demonstrate that for several fragments the majority of the tumor samples show significantly higher methylation rates thaa the corresponding nonnal adjacent tissues.
Example 12 mRNA expression analysis 1. RNA =Mlg 'Total RNA from normal colon (rr-1) and colon cancer (adenocatcinoma; n=1) was obtained finm Ambion (Huntingdon, United Kingdom). Each RNA sample was derived from a single donor. Total cellular RNA was prepared using the ToTALLY RNA Kit (Ambion, Huntingdon, United Kingdom) and Dnase-treatment was performed to minimize contamination.
RNA integrity was assessed 'before and a8er 14 hours incubation at 37 C on an Agilent Bioanalyzer (Agilent Technologies, Inc, Palo Alto, CA).

2. Mi.croarray Experiments Target preparation and labeling, microarray hybridization, washing, and scanning was performed according to the manufacturer's protocol (Affymetrix, Inc., Santa Clara, CA). Briefly, 10 g of total RNA were reversa transcribed using a T7-linked oligo-dT primer, followed by second strand synthesis. Biotin labeled cRNA targets were prepared from double stranded cDNA using T7 RNA polymerase and biotinylated ribonucleotides (UTP, CTP).
Fragmentation was performed at 94 C for 35 minutes. 15 pg of the fragmented biotinylated cRNA were mixed with MES buffer (2-(N Morpholino)etb.anesulfonic acid) containing 0.5 mg/ml acetylated bovine seram albumin and hybridised to Affymetrix GeneChip HG LT133A arrays (Santa Clara, CA) for 16 hours at 45 C. Microarrays were stained using streptavidin phycoerythrin conjugates (Molecular Probes, Inc., Eugene, OR). For signal amplification biotinylated anti-streptavidin antibodies (Vector Laboratories, Burlingame, CA) were used.
Anmys were scanned on an Affymetrix GeneChip Scanner. The expression values for each probe set (representing a gene) were calculated from the raw data using Bioconductor R
packages 0http:/1www.biocondgctor.org, see below).

DataAnaly'g The raw expression data obtained from the Affymetrix scanner (the so called cel-files) were bsckground corrected and nornnalized using the defanlt settings of the RMA noimalization procedure (Frizaxry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KT, Scherf U, Speed TP: Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 2003 Apr;4(2):249-64) as implemented in the Bioconductor R packages, release 1.4 (Gautier L, Cope L, Bolstad BM, Irizarry RA: affy-analysis of A8'ynaetrix GeneCbip data at the probe level. Bioinfonnatics. 2004 Feb 12;20(3):307-150).
The raw data processing results in signal intensity values for each of the 22.293 probe sets available on the Affymetrix GeneChip HG U133A chip.
To identify diffemtiaUy expressed probe sets, the fold change of the normalized signal intensifies between colon normal tissue and colon tumour t.issue was calculated. Genes with a fold change bigger than 2 (or smaller than 0.5) were identified as differentially expressed.
Differentially expressed genes are shown in Table 5, as can be seen hypermetbylation does not correlate with underexpression in all cases.

Tabk 5 e og-fold old- up/down in EQ chanp Affymetxix beID O:
08944 at 3 -10 2,0 own 09945 s at 2 1,2 2,3 14211 at 54 -1,3 2,5 wn 03140 at 1 -1 8 3,4 wn O:
497 at 15 -1,4 2,6 wn Example 13 TPF.F(TMf3M) methylation analysis in sertun samples.
In the following example 3 different sample sets of serom from colorectal cancer patients and healthy colon individuals were analysed using MSP assay '4' and HM assay '6' of the geae ThCEFF2. Healthy colon was defined as being verified by colonoscopy as having no colon matignancy or polyps present. The assays were run on the LightCycler platform (Roche Diagnostics) , using two different versions of the instxument for comparative purposes, namely versions '1.2' and '2Ø They are referred to below as 'LC 1.2' and 'LC 2.0' respectively.

samule sets Sample set one:
30 colorectal cancers, 30 colonoscopy verified as no colon malignancy or polyps Sample set two:
15 colorectal cancers,15 colonoscopy verified as no colon malignaucy or polyps Sample set three:
30 colorectal cancers, 30 colonoscopy verified as no colon malignancy or polyps In each case approximately 1.8 mis of setvm equivalent was analysed per PCR
Reaction conditiQns Assay '4' was performed as below.
Forward primer: agggcgttttgttggcg (SEQ ID NO:14482) Reverse Primer: ctacaacctaaacgacgegct (SEQ II? NO:14483) Taqman Probe: atcggcgttttagcgtgcggg (FAM/BHQ11abelled) (SEQ ID NO:14484) Ligbtcxcler program:
' tio = 95 10 mins 3 cycles 950 15 sees (20 /sec) 66 45secs (20 /sec) detection 3 cycles 95 15 secs (20 /sec) 64 45secs (20 /sec) detection 50 cycles 95 15 sees (20 /sec) 62 45secs (20 /sec) detection Rlts Assay'4 Sample set one:
AUC=0.95 [0.86, 0.99) (95% confidence intervals) LC 2.0 Sample set two:
AUC-0.65 [0.44,0.80] Z.C 2.0 AUC=0.57 [0.37, 0.75] LC 1.2 Sample set thtee:
AUC=0.83 10.71, 0.92] LC 2.0 AUC=0.83 [0.71, 0.921 LC 1.2 Assay '6' Forward primer: aaaaaaaaaaaactcctctacatac (SEQ ID NO: 14485) Reverse Primer: ggttattgtttgggttaataaatg (SEQ 1D NO:14486) Blocker oligonucleotide: acatacaccacaaataaattaccaaaaacatcaaccaa-pho (SEQ ID
NO: 14487) Probes: ttttttttttcggacgtcgtt-fluo (SEQ ID N0:14488)and red640-tcggtcgatgttttcggtaa pho (SEQ
ID NO:14489) ILightCycler 1.2 rograms activati,on: 95 C I10min 55 cycles: 95 C 10 sec (20 C/s) 56 C 30 sec (20 C/s) detect:ion 72 C 10 sec (20 C/s) Sample set two:
AUC-0.70 [0S 1,0.85] LC 2.0 Sample set three:
AUC= 0.69 [0.55, 0.801 LC 2.0 AUC= 0.71 [0.S3, 0.83] LC 1.2 (Some samples were lost, approximately 20 cancer senun samples, 20 healthy colon senun samples were analysed) Exampt 14 MSP analylis of the g;enes acoordins to Table 6(below In the following analysis the methylation status of a selection of the genes according to Table 3 were analysed by means of inethylation specific amplification using the primers according to Table 6 (below).
The study was run on approximately 140 samples from colon, breast and liver carcinoma, normal tissue (peripheral blood lymphocytes, healthy colon and healthy tissue adjacent to colon carcinoma), colon polyps and other colon diseases. The positive class oonsisted of Colon Cancer and Colon polyps. The negative class was PBL (peripheral blood lymphocytes), Colon Nor.mal, Colon-NAT and Coloz-Inflammatory. For AUC values in braokets (see table 7, below) Breast-Cancer and Liver-Canc,er were also included in the negative class.
Genonue DNA was analyzed using the MSP technique after bisulfite conversion.
Total genomic DNA of all samples was bisulfite tceated converting unmethylated cytosines to uracil.
Methylated cytosines remained conserved. Bisulfite treatment was performed with minor modifications according to the protocol descnbed in Olek et al. (1996).
The sequence of interest was then amplified by means of methylation specific primers, the ampli.ficate is then detected by means of inethylatian specific Taqman probes.

Table 6: Oliaonncleotides for MSP Taqan.

.~

F ~ o ~..
aa~
=,..
~, ~..
p4~~
SR ~

s ma G, V
CAo~~

52 =- =p 'Zi g Ix ~.
pH

Reaction Conditions for Taqman PCR program:
Denaturation at 95 C for 10 minutes.

50 cycles: Denaturation at 95 C for 15 seconds.

Annealing at 62 C for 1 minute. Except Assayl 5, which has an annealing temp of 60 C.

Amplification curves for each assay are shown in figures 72 to 86 (according to Table 6).

The technical performance of a series of a[ternative assavs was validated by testing each of the followingusingVerm DNA as the tenmlate:

Gene SEQ ID NO: 34 (MSP assay) Primers: cgtacgaacgca.acaaccg (SEQ ID NO: 14535) & gttcggcgttgtttaggc (SEQ ID
NO: 14536) Probes: gcatcttccaacaccgtcc,cg (SEQ ID NO: 14537) - fluo & LC640-ctccgcatccttccccgaa-p (SEQ ID NO: 14538) (Lightcycler probes) Lightcycler program:
35 10 mins 55 cycles 95 15 secs(20 /sec) 62 45secs (200/sec)detection 72 15 secs(20 /sec) Gene SEQ ID NO: 28 (MSP assay) Primers: ccgaacaaacgtaatacgcg (SEQ ID NO: 14539) & acggcgtgaaggagcg (SEQ ID
NO:
14540) Probes: tacgcgcggtagtcgtgcgc (SEQ ID NO: 14541) (Taqman probe FAMBHQ1 labelled) Lightcycler program:
95010 mins 55 cycles95 15 secs(20 /sec) 60 45secs (200/sec) detect:ion Gene SEQ ID NO: 10 (MSP assay) Primers : cgacaaaatcctcatcgcg (SEQ ID NO: 14542) & gtcgtttagcgttgggaagc (SEQ
ID NO:
14543) Probes : tacgtacgagtttcgtacgcgtattatttcgtcg (SEQ ID NO: 14544) (Taqman probe FAMlBHQI
labelled) Lightcycler program:
95 10 mins 55 cycles 95 15 secs (20 /sec) 62 45secs (20 /sec) detection Gene SEQ ID NO: 9 (MSP assay) Primers: acitasaaatcgccgaatog (SEQ ID NO: 14545) &
agttttatagttaattagggtagttgtcgtcg (SEQ ID
NO: 14546) Probes: tcxtatcatcgctcacgaacg (SEQ ID NO: 14547) - fluo & LC640-cgacaacgactatccttactattataa-p (SEQ ID NO: 14548) (Lightcxcler probes) LC program:
95 10 mine 55 cycles 95 15 secg (200/eec) 60 30 secs (20 /sec) detection 72 15 secs (20 /sec) Gene SEQ ID NO: 17 (IicavyMethylm assay) primer:
Ggtgttgtttat#itagagagtt (SEQ ID NO : 14549) Cctaacccctatcctoc (SEQ ID NO : 14550) , Iocker:
ccttoaccaccttcccaacactacaacac-phho (SEQ ID NO: 14551) probes:
Itcggcgtcggtcgttsgg-fluo (SE~ ID NO: 14552) jred640-cgcgggagtagttagatgcgtc pho (SEQ ID NO: 14553) ightCycler program:
activati : 95 C 10min 5 ies: 95 C 10 sec (20 Cls) 56 C 30 sec (20 C/s) 72 C 10 sec (20 C/s) ' ony-c 95 C 10sec 0 40 C 10sec 20 70 C Osec 0,1 1~ 40 C 5 sec Gene SEQ II) NO: 7(HeavyMethylT" assay) ,Primer :
Tgagagagagagggttgaaa (SEQ ID NO: 14554) Tct4~aataacaaaatacctccatt (SEQ ID NO: 14555) ;probes:
CGaccCGccaacCGac-fluo ( SEQ ID NO : 14556) LCred640-CGcCGaaaCGCGctc-p (SEQ ID NO:
14557) blocker:
Iccattaccaacacaacccaccaaccaa p(SEQ ID NO : 14558) LightCycler program:
lactivation: 95 C 10min 155 cycles: 95 C 10 sec (20 C/s) 56 C 130 sec (20 C/s) detection 72 C 10 see (20 C/s) eltin c e: 95 C lOsec 20 40 C l0sec 20 70 C Osec 0,1 o lin : 40 C 5 sec Gene SEQ ID NO: 8(HeavyMethyP assays) primer:
~Aaaaaaaaaaaactcetctacatac (SEQ ID NO: 14559) Ggttattgtttgggttaataaatg (SEQ ID NO : 14560) blockerr:
Iacatacaccacaaataaattaccaaaaacatcaaccaa pho (SEQ ID
N0 : 14561) probes:
ttttKttttcggacgtcgtt-fluo (SEQ ID NO: 14562) ,red640-tcggtcgatgttttcggtaa-pho (SEQ ID NO: 14563) LigLtCycler program:
activa 'on: 95 C 110min 155 cycles: 95 C 110 sec (20 C/s) 56 C 30 sec 1(20 C/s) detection 72 C~10 sec (20 C/s) ~_..._ eltine curve: 95 C l Osec 20 40 C IOsec ~20 70 C 1Osec 0,1 cool 40 C 5 sec primer:
Aaaaaaaaaaaactcctctacatac (SEQ ID NO: 14564) EGgktattgtttgggttaataaatg (sEQ ID NO: 14565) ,blocker:
{ctctacataCAcCCACAaataaattacCAaaaacatC-p (SEQ ID
INO: : 14566) probes:
CGCGaataaattacCGaaaacatc-fluo (SEQ ID Na: 14567) LCred640-accgaacaacgacgtcc-p (SEQ ID NO: 14568) LightCxcier program:
activation: 95 C lOmin 55 c 1: 95 C 10 soc (20 C/s) 56 C 130 sec (20 C/s) detection 72 C 10 sec (20 C/s) ~ pLeltjing curve: 95 C tiOsec 20 40 C 10sec 0 70 C 0sec 10,1 40 C 5 sec rimer:
gaggtgttagaggagta.gtag (SEQ ID NO : 14569) ccccctacaacctaaa (SEQ ID NO: 14570) Iblocker:
Acctaaacaacacactcccacacactaaaacaccaat (SEQ ID NO:
14571) probes:
Cgagtcggcgcggga-flua (SEQ ID NO: 14572) ..., .~... ..... , . _. ._., .__._,. .._.
I.ared640-agggcgttttgttggcgatc-p (SEQ YD NO: 14573) ~ ( ( Li~htCycler program:
-activation= 95 C 10min 55 e;g 95 C 10 sec (20 C/s) 58 C 30 sec 1(20 C!s) detection 72 C 10 seo (20 Cls) cn~urve 95 C Iasec 20 40 C 10seo 20 70 C Osec 0,1 co i g= 40 C 5 sec Gene SEQ ID NO: 9(HeavyMethyff assays) jPrnnGr ctatcaatatacctaactaattaataac (SEQ ID NO : 14574) igtaaagtttttaatttttattagtattagtat (SEQ ID NO : 14575) Blocker ' ctaattaataacacttaaaacacaattatamaccaccatao-pho (S8~ ID
O : 14576) be:
~gdtatgtcgattatagttacgttagttt-pho (SEQ
ID NO: 14577) gtgaacggtttcgbCgggag fluo ( SEQ ID NO : 14578) ightCycler program:
activation: 95 C 10min c es: 95 C 10 sec 20 C!s) 56 C 30 sec (20 C/s) tion 72 C 10 sec (20 C/s) 1' e: 95 C lOsec 0 40 C lOsec 20 70 C sec [oi coo ' 40 C 5 sac .Pnmer.
jgttttattgtatgatgaattgga (SEQ ID NO: 14579) caccaaaaaaatattaaccac (SEQ ID NO: 14580) lBlocker:
Ttaaccacaacacaaataaaaccaaacaaattatccata-pho (SEQ ID NO: 14581) Probe:
Gttttttcgcgttcgtcgtttatttt-fluo (SEQ ID
O : 14582) Red640-ttgggtcgacgagattaaggagg-pho (SEQ ID
O: 14583) Ligl-tCycler program:
fiv ' n: 95 C l0mirt c es: 95 C 10 sec (20 C/s) 56 C 30 sec (20 C/s) detection 72 C 10 sec (20 C/s) curve: 95 C 10sec 20 400C 10sec 3220 70 C sec ,1 .SQEhLnX J4O C5sec Gene SEQ ID NO: 5(HeavyMethyff assay) rl~x:
Gagaggtttattaaggtaggg ( SEQ ID NO : 14584) taaaaaattattaac (SEQ ID NO: 14585) blocker:
tt8ttaaCStCC33caC8LttaLccaaacttce8a (SEQ ID NO:
14586) probes:
8Wag8$Sdtgtagagaagttcga-fluo (SEQ ID NO: 14587) -tcggataaacgcgtcgg-pho (SEQ ID NO: 14588) LightCycler program:
'vati n: 95 C lOmin c &10: 95 C 110 wc (20 C/s) F- 56 C 130 sec (20 Cls) detection 72 C 110 sec (20 C/s) f_95 C jlOsec 120 40 C 10soc 20 70 C losee 0,1 coolin~ 44 C 5 seo Gene 6480 (HeavyMethyff assay) Primer:
gagttgagagaatttttaaatttt ( SEQ ID NO : 14589) Tcttctaaaacaaaaaacacc (SEQ ID NOt 14590) Blocker:
Caccactacaatccaaacaacccaaa-pho (SEQ ID
NO: 14591) Probes:
Ggacgtcgagcgttgggtat-fluo (SEQ ID NO:
14592) Red640-aggacgcgtagttggacggt-pho (SEQ ID
NO: 14593) ' tCycler program:
95 C 10min 55 es: 95 C 10 sec 20 C/s) 56 C 30 sec 20 C/s) detection 72 C 10 soc (20 C/s) 1' c e: 95 C 10sec 20 40 C lOsec 20 70 C Osec 0,1 40 C 5 sec Gme SEQ ID NO: 28 (HeavyMethyff assay) Primer :
Gaaggaagggaaagtttt (SEQ ID NO: 14594) Taaaaaaaacactacxctac (SEQ ID NO: 14595) locker:
ctaccacaataaaaacccaaaacactcettcacacca-p ( S EQ ID NO :
14596) Probe acccgaaacgctocttcacg-fluo (SEQ ID NO: 14597) red640-cgtaaacaaacgaaacgacgactacg Pho (SEQ ID NO :
14598) LC program Roche :
de,gg-4t 95 C
95 10min 55 +cyples:
enat at 95 C 10 sec (20 CJs) annealing 56 C 30 sec (20 C/s) etection extension 72 C 10 sec (20 Cls) e' 95 C lOsec 120 35 C 20sec 20 95 C 1(sec 0,1 Gene SEQ ID NO: 1(HeavyMethylm assaq) otigos:
er:
Cacaaactatctataaaaaattaatctc ( SEQ ID NO : 14599) ttgltgttggtgtttgttatt (SEQ ID NO : 14600) locker:
ctcaaacacaaaaaaattaacatctcatetcttaaaccactttcaat-ph.o (SEQ
!ID NO: 14601) Pmbes:
CgTCTCITA.AACCgCTTTCgA-fluo (SEQ ID N0:
j14602) 640-CCTCA.AAATAAACACgAA,CATACCC pho (SEQ ID NO: 14603) ~
tLigLtCycler program:
vation: 95 C i0min ~ 1 1 95 C 110 sec 1(20 C/s) 56 C 130 sec (20 C/s) detection 72 C 10 sec (20 CIs) curve: 95 C lOsec 120 40 C lOsec 0 70 C Osec 0,1 coalin~: 40 C 5 sec Gene SEQ ID NO: 34 (HeavyMethyl7m assay) Prixner:
Atacaaaa onaataecttet (SEQ ID NO: 14604) Atttggttttattttggttatg (SEQ ID NO : 14605) ~Blocker:
accttctcacaaatcaactaaaacacacacaacacc-pho (SEQ ID
NO: 14606) Probes:
Red640-t88atttaS8Sc8tcScg-pho ( SEQ ID NQ:
14607) ogttcgttmaagcggcga---IIuo (SEQ ID N4: 14608) 6tCycler program:
95 C 10min 95 C 10 sec (20 CIs) 56 C 130 sec (20 C./s) etection 72 C 10 sec (20 CJs) e: 95 C lOsee 0 40 C 10sec 0 70 C Osec 10,1 00 40 C 5 sec R-OSU+s Sensitivity and specificity wera computed with SVM and 10 fold cross validation Table 7 Gene/Genomic location AUC Sensitivity Specificity Transcription 0.57 0.15 0.99 factor BTF3 Homolog (0.56) RING FINGER PROTEIN 0.54 0.91 0.09 4 (0.55) TUMOR NECROSIS 0.82 0.74 0.90 FACTOR RECEPTOR (0.82) SUPERFAMILY MEMBER

Region of 0.83 0.69 0.94 chromosome 14q31.1 (0.84) Chonclroitin sulfate 0.92 0.83 0.96 proteoglycan 2 (0.88) (versican) (CPSG2) 0.83 0.71 0.94 EYA 4 (0.84) MOTHERS AGAINST 0.54 0.25 0.91 DECAPENTAPLEGIC (0.52) HOMOLOG 7 (SMAD 7) ENDOPLASMIN 0.6 0.11 0.99 PRECURSOR (94 KDA (0.6) GLUCOSE-REGULATED
PROTEIN) (GRP94) (GP96 HOMOLOG) (TUMOR REJECTION
ANTIGEN 1) Region of 0.59 0.1 0.99 chromosome 6 25.1 (0.57) B-CELI, LYMPHOMA 6 0.62 0.11 0.98 PROTFIN (BCL-6) (0.62) (ZINC FINGER
PROTEIN 51) (LAZ-3 PROTEIN) (BCL-5) HOMEOBOX PROTEIN 0.78 0.74 0.95 ARISTALESS-LIIKE 4 (0.75) TRANSMEMBRANE 0.88 0.84 0.94 PROTEIN WITH EGF- (0.88) LIKE AND TWO
FOLLISTATIN-LIKE

Hypothetical 0.73 0.79 0.38 protein-leucine (0.72) rich re eat Candidate tumor 0.79 0.64 0.76 suppressor 8p22 (0.84) VESICULAR 0.77 0.78 0.44 INHIBITORY AMINO (0.77) ACID TRANSPORTER
(GABA AND GLYCINE
TRANSPORTER) (VESICULAR GABA
TRANSPORTER) (HVIAAT) Sensitivity and specificity of multiple gene (panel) assays.
Panel: Assay 9 , Assay 12 Sensitivity: 0.88421052631579 Specificity: 0.972972972972973 Panelo Assay 11 , Assay 12 Sensitivity: 0.88421052631579 Specificity: 0.97027027027027 Panel: Assay 12 , Assay 15 Sensitivity: 0.9 Specificity: 0.95 Panel: Assay 6 , Assay 7 Sensitivity: 0.87 8pecificity: 0.973333333333333 Panel: Assay 5 , Assay 11 Sensitivity: 0.894736842105263 Specificity: 0.941333333333333 Panel: Assay 5, Assay 7 Sensitivity: 0.894736842105263 Specificity: 0.938666666666667 Panel: Assay 4 , Assay 6 Sensitivity: 0.857894736842105 Specificity: 0.971428571428571 Panel: Assay 7 , Assay 12 Sensitivity: 0.9052638EQ ID NO: 94737 Specificity: 0.921621621621622 Panel : Assay 6, Assay 12 Sensitivity: 0.842105263SEQ ID NO: 95 SpeCificity: 0.978378378378378 Panel: Assay 5 , Assay 9 Sensitivity: 0.842105263S$Q ID NO: 95 Specificity; 0.973333333333333 Panel: Assay 3, Assay 15 Sensitivity: 0.857142857142857 Specificity: 0.953424657534247 Panel: Assay 1 , Assay 12 Sensitivity: 0.842105263SBQ ID NO: 95 Specificity: 0.967567567567568 Panel: Assay 5 , Assay 15 Sensitivity: 0.857142857142857 Specificity: 0.945205479452055 Panel: SEQ ID NO: 17.2 , Assay 5 Sensitivity: 0.81764705882353 Specificity: 0.966233766233766 Panel: Assay 3 , Assay 12 Sensitivity: 0.8 Specificity: 0.983783783783784 Panel: Assay 6 , Assay 11 Sensitivity: 0.83SEQ ID NO: 947368421 Specificity: 0.952 Panel: Assay 5 , Assay 12 Sensitivity: 0.8105263SEQ ID NO: 9474 Specificity: 0.972972972972973 Panel: Assay 3, Assay 11 Sensitivity: 0.83SBQ ID NO: 947368421 Specificity: 0.949333333333333 Panel: Assay 3 , Assay 5 Sensitivity: 0.823529411764706 Specificity: 0.955844155844156 Panel: Assay 3 , SBQ ID NO: 17.2 Sensitivity: 0.8 Specificity: 0.974025974025974 Glass predictian bysupervised learning In order to give a reliable estimate of how well the CpG ensemble of a selected marker set can differentiate between difl'erent tissue classes we determined its prediction accuracy by classification. For that purpose we calculated a methylation profile based prediction function.

This step is called training and it exploits the prior knowledge represented by the data labels.
The prediction accuracy of that funetion is then tested by cross-validation or on a set of independent samples. As a method of choice, we used the support vector machine (SVM) algorithm (Duda (2001), Christiannini (2000)) to learn the predictdon funetion. Ifnot stated otherwise, for this report the risk associated with false positive or false negative classifications are set to be equal relative to the respective class sizes. It follows that the learning algorithm obtains a class prediction function with the objective to optin-Aze accuracy on an independent test sample set. Therefore sensitivity and specificity of the resulting classifier can be expected to be approximately equal.Figures 87 to 95 show the performance of quadratic SVMs trained on the fall data set using the following assays.
Figure 87 :Assays 12 and 9 Figure 88 : Assays 12 and 11 Figure 89 : Assays 12 and 15 Figure 90: Assays 7 and 6 Figure 91 : Assays 1 I and 5 Figure 92: Assays 7 and 5 Figure 93 : Assays 6 and 4 Figure 94: Assays 12 and 7 Figure 95 : Assays 12 and 6 Ezamnle 15 HeavyMethyl anal is.
In the following, methylation of the genes/genonaic sequences according to Gene SEQ ID
Nos: 7, 8 & 17 was analysed in 15 colorectal cancer samples (refen-ed to as 'colon' in Table 7), and eight peripheral blood lymphocyte samples referred to as 'PBL' in Table 7).
Total genomic DNA of all samples was bisulfite treated converting unmethylated cytosines to uracil. Methylated cytosines remained conserved. Bisulfite treatment was performed with minor modifications according to the protocol described in Olek et al.
(1996).
The sequence of interest was then amplified by means of primers specific for bisulfite treated DNA and a blocking oligonucleotide (in order to suppress amplification of non-methyla#ed DNA). The 3'OH terminus of the blocking oligonucleotide was "capped" by a phosphate group to prevent polymerase from extending the primer durintg PCR
reaction. The amplificate i s t hen d etected b y m eans o f in ethylation s pecific LightCyclerTm p robes, w herein one probe was labelled with 5'red640 and had a capped 3'OH terminus and the other was labelled with 3'Fluorescein.

Genomic SEQ ID N0:8 Primers: aaaaaaaaaaaactcctctacatac (SEQ ID NO:14609)&
ggttattgtttgggttaataaatg (SEQ ID NO: 14610) Blocking oligonucleotide: acatacaccacaaataaattaccaaaaacatcaaccaa (SEQ ID NO: 14611+14612) Probes : ttttttttttcggacgtcgtt (SEQ ID NO: 14613) (Fluorescein) & tcggtcgatgttttcggtaa (red640) (SEQID NO: 14614) Genomic SEQ ID NO:7 Primers : ggtttgggatggttgt(SEQ IDNO: 14615) &
tctaaataacaaaatacctccatt (SEQ ID NO: 14616) Blocking ol igonucleot ides: ccattaccaacacaacccaccaaccaa (SEQ IDNO:
14617) Probes : ggtcgcggtgagagagagag (Fluorescein) &(SEQ ID NO: 14618) tgaaattagagcgcgtttcgg (red640) (SEQ IDNO: 14619) Genomic SEQ ID NO:17 Primers : ggtgttgtttattttagagagtt (SEQ ID NO: 14620) & cctaacccctatccttc (SEQ ID NO: 14621) Blocking oligonucleotides: ccttcaccaccttcccaacactacaacac (SEQ II) NO: 14622) Probes: tggggtttcggcgaagtaa (Fluorescein) (SEQ ID NO:14623) &
tttttcggcgtcggtcgt (red640) (SEQIDNO:14624) The reactions were performed in a total volume of 20 1 using a LightCycler device (Roche Diagnostics). The real time PCR reaction mix contained 10 l of template DNA, 2 l of FastStart LightCycler reaction mix for hybridization probes (Roche Diagnostics, Penzberg), T 7: R sults of Hea eth 1 ass al.cuiated onceatratio DNA
ndiluted isaue roaai iate roaeing inta (/topl) eaomiC SEQ ID iC S8Q ID or-iC 3 ID NO: 4 Gemomic SEQ ID NO: 4 O: 3 0: 12 (undiluted) (diluted) oloa 36,73 38,22 39,58 5,855 olae 33,1 51 386,9 olon 39,8 42,84 57,5 olon 39,74 38,75 32,54 33,8 482,6 oloa 51 132,55 oloa 38,8 29,95S
oloa 32,08 33,9 33,43 35,43 816 oloa 37,03 36,9 284,35 ol= 38,07 46,54 0 oloa 35,22 37,81 36, 37,03 298,35 olon 33,66 36,19 33,23 34,0 1355 oloa 36,78 37,46 40,71 879 olon 37,23 57 5 oloa 1669 loa 34,88 34,71 34,21 34,4 880,5 PSL 716,5 aL 796 PSL 584,5 HL 38,55 1813 3L 49,04 761 sL 625 F8L 39,7 9835 36,34 37,2 34,95 34,51. 583,5 100 36,06 37,86 34,64 34,09 428,3 F oche 1o0 34,48 hi 100 ter Bold type figures indicate those classified as positive because the amplification curves were flat.
Ezamale 15 5 Serum analyais of the genes acxording to SEQ ID Nos: 7. 30. 28 &8.

The assays as descrn.'bed above in example 13 (MSP) & 14 (HeavyMethyl) were then applied to a set of senun samples consisting 32 colorectal carcinoma serum samples, and compared to a set consisting of 54 normal senun samples, 11 serum samples from benign colon lesions and 6 10 serum samples from intIanunatory colon disease. 130 ul of senmi was used per assay and the results were quantitatively reported as positive or negative.
Table 6 Marker or Sensitivity Specificity combination of LOZ
8tis:oxcii s zs=oxaQ Oas) 16b tt,LLDa Z,LDVVa ZVODVZDVVD.L
vs :ox aQ as D.I.v.Lvvvoo,La,i,d.d'JOaL,L301 (sbs :ox ca bas) (tc :Ox aQ bas) Lt6 DD1..L.L,L00'JJY.L.L,LL,IJJõLJ,L,L
srs :ox aa as VVDKVVODa DdWDJ.LDO
Evvs :ox cli bas) (Lz =ox aQ bas) ~bZ VD.?VVJD'tVJJV'd.LVJ.IJWL
~tis :ox ca as VVVVJDaLdDMdJ.DZLLO
(zs,s :ox cu bas) (9s :ox (H bas) 61 ~ LLJ,L,LD,L,LrJ,I.,Lfl.I.LJJilo,L
tvs :ox ca as 3.LLj.L3D3.L.L.L,Lm,LV,I3.L.7W
(o'6S :ox cir bas) (ti :ox ca bas) 98t, Ob',LJflDE)VJJJ,L,L,L,LVJVJ
6ES :OXCO[ aS
,LLLsJ,L,LL LOOIJLLO<Jd,LLVVVD
(s~5 :ox QI bas) ('b :Ox CQ a8s) Ot't .Lb'.LD130,L.LD.LDdDda D.LDD,LV
Lcs :ox ca as Oo3dvvO.tJ3Dv30vvvv (9ss :ox ar aas) (9t :ox cu bas) zttr dJW.L'JJ,L,L.LdZJVvV.LLJVJJ,LL
apn*daff6' madi imacxag Bz 6=8L V=6s '9 o~ 's ON ai ZSss L'96 OS OE 12 8 '8 ONI QI bHS
E' 86 9' ST (dSW) L:ON QI bSs 9'LL 5'L~ (dSW) BZ 0N QI b3S
T'L6 6'TZ (dSW) OE :ON QI iDSS
~' Ã,6 9' 0fa (dSW) 8 :ON QI OaS
( jAxI:jaKA&aag) 6'26 5Z 8:Oid QI aSS
ezax.~auu ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

vOVVJVVDvvD,LVdvZVVvD0o (zLS :ox QI bas) (6~ :oAi (,II aas) 98Z M'~J,LDVVJJ.I.M'JV.LLVZ=J.L,LL
Ics:oxcII as v130DvDD,L,LoovOvv.Lvvv,Lv (OLS :ox col aas) (8~ =ox cli bas) s~t Zvvv.LJDJ'~JrJ,LUJZVJ.;?v,LLJ
69s :ox ca s 031013v,LOvvddv.l,3.L33vvvvv0 (895:Ox (H bas) (9z :ox ca bas) L09 vViJ,L'i',LLJVJ,LJrJJZJVIYvv,LJv 9s :ox aQ s J3=vvvdovdv,raw3v3o (99s :ox ~a bas) (c~ :ox cu bas) 96Z JMVO.L.LJVWfldviJ.L,UW,LJ
s9s =ox cci as T_7 ~DY,j,'?,uvoo,j,v (b9s :ox cii bas) (sz :ox cii bas) L6b .LJJOV.W.,L,LDJVJ.L.Lv1JV.L,I.L,L
~9S =0x cil aS
O~OOZ~v.LL.LV.LJ.O,LVO
(z9s :ox ca bas) (9~ :ox a[ bas) szs JrJ3õLVJ,L.i.LJUVrJ'~J'4'vrJVdWZ
i9s:oxaa as v.LD,I.LxJWJVVDDJJ.L,i.LVJv (095 :ON cil bas) (sz :Ox cii bas) 8LZ 3'JvZvZdv3OV'JOOVJ[333 6SS :Ox QI S
331VJ300vw.La ,Lowvw.L
(sss :ox cil bas) (is =ox ai bas) OOE rJVWJJJVDVVdJM.tõL,Lv ss :ox ai s MdvOVVVD,LVVVVV000 (9ss ,ox (,a aas) (s~ :ox aa[ aas) 9zz .LVD~'J,LVVV.L,LVJZJDVJVVJO
sss :ox ar as xJV.LV1JVV'JD,L'b'J,L.i,vDM,LVZv (vss :ox aoi bas) (vz :ox aa aas) iLtr O,LVdv,LmvWOvavdv,LvvOaL
~ss :ox ca as ,LVHvvOovOVdoZ,LIõLZO,LVKv (ZSS :ox Cii aZs) (6~ :ox ai bas) tritr ZVJWsLVOrJD,W.OVOOV,LVOD
iSs :Oxd[ S
30D,Ldv'JaZOw,Ll3v'J.Lotlv (oss :ox ca bas) (~~ :Ox cII bas) 969 J.LLf}JVvv,L.LOrJVtJvDDVvvJ
6trs :Ox ca bas) JJJ.LJV3.J,L.ifJIDV.L,i.LZ.LV,L,i Ldv py ua7 a~at(:rtdu~d :taww :aua,g ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

6oZ
ss :ox col as ,IIdJ,LJJ1 I.d,LDJd,LJD.LS JZ
(965:ox CII ZYas) (s I=ox CQ TJas) 59~ D,LLVVVZ)D.LDD.LDD'tWDW
S6S:OxC[I 63S-) ,LWVdDd,LDV,L~DV~DVDdDD
(V65 :ON GI aaS) (bT :ON QI aaS) 005 VtJdJZ LJrJdJJVJVJ.LdJWJ
~6S:OxCII S
JVZJJVJdJD,LJJJ LJJJ
(Z6S :ox C[I aas) (Zb :ox (n aas) 8tbl 331YOWd.LOO,L,L,I,D,LMO'd,I, 16S :Ox QI as ,I.I.JDV.LD,IõLJ,IõI,VV'~JDJJW.LV
(06S :ox Caaas) (8 :Ox (II aaS) 56~ D,LDD.L~~~~DVVW.LSV,La .L,L
68S :ox GI s VJJJ.LJII,sJ.UJD,LV1.LJd.L,LW
(885:ox cII aas) (s :ox (ii bas) 6~~ YWJID3,D.L.L,LV.L,LZODa ,L,LW'J
Ss : o x col s dW.LVaDd,LLDW.LDDOdOOD
{985:ox aa bas) (9 :ox aQ aas) Z917 VVVV,I.,LVYdiJd1J,I,.LJZJDdJVVJ
s8S -ox cil as .L3,LoOV3ddD,I3d,Id.W.L,I,.T, L.LV'd (1,85 :ox QI aas) (9 :Ox QI aas) 19~ V.LJDWrJ.iõLJDdd.dS.,LJrJ,L.L.LV
~85 :Ox cil as ~~~~VIVWDDDZVDZWVZV
(ZSS :ox cli Z}as) (S =ox (II aas) Lft JrJV,L,LrJK,I.L.L,LV1.VrJ,LJiJJd,LWD,L
ZSS :oxal as ,I..i.d'~JZVOM.LL.L.LJDdJb.L uJ
(08S :ox CQ aas) (s :ox CQ a'as) L81b vWW~~~~~DIDD,I 7 6LS :Ox CII as ,Lo.Ij,oYJow,LD,L,LLVaV'J,L7.I,L
(8LS :ON cil bas) (it".Ox CQ bas) szt .L.UJOrJV,Ld.LWJJJJIaf,L.i Ls :ON (H as WDD,LVD.Z,D.IJ LVDV,Lb'DDW,L
(9LS :ox aa bas) (ot:ox aQ bas) ipz1l 1õL,LJmv.LtZJDYJJJd.LV.LW
scs -ox ai as 3.L0,1a~0DIM,LD.L0,L0.I.L0 (tiLS :Ox CQ aas) (6z :ox cii bas) S6Z VJD.LWV,LWZ.LJM.L.L.LJ.LL
~LS :Ox CU aS
~7 apo~.t~dury' :.taurx~ :auaJ

~Z-ZT-SOOZ ~588ZSZ0 Fi'J

OIZ
trtrb O'dOZ.UDsODWa~OV,LDW..LD
Iz9 ox Cti s ZVJ JVZVJJdrJKZDJZVVJwvZJ
(oz9 :ox aQ bas) (oi :ox(II bus) 9~17 Dwwa.Loowv'w,I1,3a .TrIOo 619 :Ox CQ S
,LJYVWJVJDV,t..LJ.L,LJdJDZ3.
(8I9 :Ox CQ bas) (9V :ox cir bas) zstl dZ,I.L'V=D'JOtld,L,Ld'JN.I.LVDV'J.L,L
LI9 ox CQ aS
VIDWDoOVoDoooV=
(9I9 :ox ai bas) (si+ -Ox CII bSS) I9ti 1LrJJ.LvZJdtJZw,LW.Lv,L.LiJDrJ1 L
si9:oxaa as V,LwaW.Lav,LoooZ=d'D,LL
(tI9 =ox ca aas) (z =ox cil bas) Z6V .L,L.LJD,LJrJd'.L.T.LIZdJJE?,L,L
~i9:OxQI S
va,Ld.LDVDDWVDDb'VV.LdWD
(zi9 :ox aai bas) (z :ox cII aas) 66=b JMV,LJV.LLflJJd,LL i.LVVJJ.L
I19 :Ox cll aS
,LaZvoo,Ld,Lwt~owcov'JW
(0I9 :Ox CQ bas) (i :ox CQ bas) z1t 9v.LLJJwWZrJW,L1.JfTDE)JV
609 :Ox (H S
J-LxJZrJdIVO,I,lWJW'JJ.WD,LZ
(809 :ox ca bas) (I :ox cii bas) Zsb ooWVV.LVVV,LDa,LY.LdvvDv,I.bDo :ox al as ,LdHC)VVVD:L,L,=d.LV,L1 dda Kod'Z
(909 :Ox cil bas) (I :ox cii bas) osz .L,LrJZrJ'~J,I~LJ=IõLV.LVJ'=J,LVrJV
09 :ox cu s ODDWKV.LdO,btiZvvvmow.L
(1~09 :ox (H ZY3S) (wox CII bas) i It, ,LxJV,I.JJd,I.I,rJVtJVD'JDJZJ,L,L
~09 :ox ai as VV'JdJJ~~~WJDa 'diDX
(zo9 ox (Q bas) (wox (H bas) ~V~ JK,L,LLDJJ,LOODDWJV.LLU
I09 :ox ca as iaiWV=ojdao=oo (oo9 :ox anaas) (L :ox (a bas) 8Z~ JVJVIILS.xJ,LLdIV'=J,I.LO<JM
66s :ox COI s ,L,UrJDdOOKoDJ UVVrJ,LJ
(86S :Ox CII Z?aS) (SI :Ox CQ aas) sL~ .LVVVOVWZWVd,L,LOVDDDaL
: y uaT
a;pat,~,r~datd :~uqt.td :auaJ

~Z-ZT-SOOZ ~588ZSZ0 Fi'J

iiZ
=ON CII S 61 =Ox tIi EIS
9Zb LJ.I.LoodZ,LvJ,Ld,ZrJM,L,I.,LvSõI L
stv9 :ox cII Oas) V6'VYt+'O'6'O,LVKHK.L70J.,LVaVVV
(vt9 :ox (a[ aas) (zz :ox (B aas) ~c~ UYHJJJDWJvvrJ.u,LDV.LJb',L
~V9 :Ox (II as s.VVzoXVW.r,oMaJDswa (z'e9 :oN (n bas) (as :ox maas) 69~ dJVVJb',I.rJZ,L,LJ.LflVJJdjJdJJ
tfi9 :ox QI as OOW,LVdd'Hd=OwvOma (oti9 :ox (u aas) (wox ca aas) rJ00<JJVVJVS,J1,I,VflJW,UJH.L
6~9 ~ON QI aS
JJJMVVJXZJ L.LYflJW1.JVZ
(s~9 :ox ca aas) (st,:ox (II bas) 96~ WdZOa OV.L.La =o,L,LWW3 ~9 :Ox CII S
rJMJVVVrJMVIVV,LJ,LJjrT,LJ
(9f9 :ox (n bas) (si :ox (n bas) 86f, W,L70.L,Lvw3'6'Ojl3O,L3w,La ,L
S~9 :Ox CQ S
00~'.L,LOa~~.L,LOO~,LO~,LLO
(1~~9 :Ox CllaaS) (~ :Ox CQ aEts) 0510 ZdVVJZJWV'~JD,LL1JVVJd',L,L
~~9 :Ox ca aS
o9VDVosDDdJL9d~v.LLoioLU
(Z~9 :ox cllaas) (uox QI bas) vsz JaVVaDWDZVVWOaLO,L,LO
t~9 :oxQI as owa aroodowaoo.i.Lvvv (0~9 :ox cii Ws) (~i :ox (II Z3as) 6cz dJ0<JvV.LO<JVO<J,Ld,i,Vd,l,L,IJ.,L
6Z9 :ox Ca Oas) ,L,LLLLV,L,LSfJJ I.b'oWJJ1.,L2,L
(8Z9 :Ox CQ aas) (~uOx cllZ}aS) 9LV D3'd0vOyvo'Jo1.I.Yvd3vv Z9 :ox Qa Oas) 00vK3VJ.O,L7,LdJõi.l'.LKaI3,LdO.I, (9Z9 :Ox QI aas) (t i:Ox CII bas) 6b~ jJVJJVVD;J.L3õLLKDJW,L3õLV,L
SZ9 :ox (Q as ,LLJJZJIrJ,Ldr .t.LL,LvZJ LVrJ,L
(1-Z9 :ox cii bas) (t t :Ox (II aaS) ZSti Z~d,I.Oa,LOt~'~ZO,L~.L~OOO,Ld ~Z9 :oxQI aS
T_TnT LT_TyyDVJ~-ZV',~J'H~tJJ,L
~ (zz9 :ox cclaas) (oi :ON ai bas) :y uaZ
spollldwV =~~+d -aupJ

~Z-ZT-SOOZ ~588ZSZ0 Fi'J

ZiZ
OWW,Ld3o,I,D0OHDZ).LW.L3 (0L9 Ox (H aas) (OS :Ox cil Z?as) 9Z1r WVrJWdrJ,I.Ld,LJJ,L,i,W1J'~JYiJ
699 Ox CII a8 d.L,L'd.T.I.L,LvO.L,L,LaLO5aO,LL7 (899 :Ox (H aas) (oZ :ox CII aas) s" ,Y.VDMVaGJV,LWZd',LOOD.LrJD
99 :ox CII as 0D01131=3VdJZV,LWd3VZ
(999 ox (31 bas) (LV :Ort cu bas) t+86 ,L,LT.K.LJJJJJV,L,I.JD,LWJd.L'b' s99 :ox cQ s DO,L.L'b'VVW,L333LLdaWWV
(m:ox ai aas) (ZI :ox (Haas) zob Jd,LVtJVxJDWVDJ.LJYJd,LJD1.,L
Q99 Ox aa as D'~Jd'IV,Ld''~JV.LrJDDZ,LflE3WtJD
(Z99 :ox cil bas) (6 :Ox (II aas) 981 VVVV,La V,IO=,I,DV'b'WDdOO.L
i99 Ox ai as J.IUJJV,I L,I,Vb'~'J;J1.,L,L,I,J,L,III.
(099 -Ox CII bas) (~1,:Ox cil aas) OaL3w,L73J,O,T..733,LwZ3,L'4' 6S9 :ox al as JJVDJJ'dD'~JbJVZJV,I.1.VW'OV
(859 :ox cil aas) (iz :ox m aas) 86~ VvW,LoO~DVKdX)W,La.T.o,LLs S9 :Ox QI aS
DOOO1.,LW.LNIDDD1LaVZWW
(9s9 :ox aQ aas) (iz :ox (E bas) oL~ ,LL,LJV1JWtJJbJrJ.LLLL,LtJW.L
SS9 :ON ca aS
,LDwJlJd,Lb'rJ1,floDZ,L.LtJ.L.Ld (1-s9 :old cli bas) (~Z =ox (H aas) 68b rdd..LZLddõLaZb'J3"J30310 ~s9 :ox QI as IJV.L.I,VJ,LO<JW14.UdJJJJd (zs9 :ox (H bas) (Lt :ox (H bas) zsb 313131bOVOWDOWZDD.LW
TS9 :OAi QI aS
'~JV,L,~LJD,LLD.LD,LVJ'V()VJD,LL
(os9 :ox cii bas) (Lt :ox (H aas) Z6V ,LIV'tTZV,L7ZOJOO,LOJ,LDddw 6ti9 :Ox al aS
VJ LJZWtl0000VJDZWxJ
(8b9 :Ox cg bas) (6i :ox cii bas) sstb d'j3DSõLOb.L.La,LwwDDw'b'od v9 =Oxaa as .LO0O~~'o ad'O~'~'tl~.LO'd :q uaT
~lldurd :iaue~r~ :auag ~Z-ZT-SOOZ ~588ZSZ0 Fi'J

Gc,u: Prineer: Amplif:cate Length:
(SEQ ID NO: 671) (SEQ ID NO: 50) (SEQ ID NO: 672) TAATTTTTGAGGTTGGGAAA
(SEQ ID NO: 673) TABLE

Gene Olt o:

(SEQ ID NO: 41) (SEQ ID NO: 681) (SEQ ID NO: 41 SE ID NO: 682 (SEQ ID NO: 41) (UQ II) NO: 683) (SEQ ID NO: 41) (SEQ II) NO: 684) ATTAG'i TCGGGTCGCGT
(SEQ ID NO: 41) (SEQ ID NO: 685) $ IDNO:41 (SEQ IDNO:

SE ID NO: 41) (SEQ ID NO: 687) (SEQ ID NO: 41) (SDQ ID NO: 688) SE ID NO: 41) ID NO: 689) GGTGTGTTGTTAGTTTTATA
SE ID NO: 41) (SEQ ID NO: 690) (SEQ ID NO: 41 (SEQ ID NO: 691) SE ID NO: 41) S ID NO: 692) (SEQ ID NO: 41) (SEQ ID NO: 693) SE ID NO: 41) (SEQ ID NO: 694) TTCGGAGGGCGTATTT
(SAQ ID NO: 41) SE ID NO: 695) (SEQ II) NO: 41) (SEQ ID NO: 696) SE ID NO: 5) (SDQ ID NO: 697) SE ID NO: 5) SE IDNO: 698 (SEQ ID NO: (SEQ ID NO: 699) No: Gene Oti o:

SE ED NO: 5) (SEQ ID NO: 700 5E ID NO: 5) SE ID NO: 701) (SEQ ID NO: 5) (SEQ ID NO: 702) (SEQ ID NO:
(Mg ID NO: 703) SE ID NO: SE ID NO: 704 SE ID NO: (SEQ ID NO: 705) 26 GGATGTTGTT'TGTTAGG
SE ID NO: 5) (SEQ ID NO: 706) (SEQ ID NO: 5) (SEQ IL) NO; 707) SE 1D NO: S ID NO: 708 SE ID NO: SE ID NO: 709 SE ID NO: 5) (SgQ ID NO: 710) 31 TTTCGAT'ITTAATGCGAA
SE ID NO: 5) (SEQ ID NO: 711) 32 TTTGATTTfAATGTGAAGT
SE II') NO: 5) SE ID NO: 712) SE ID NO: SB ID NO: 713 (SEQ ID NO: 5) (SEQ ID NO: 714 35 T'TTGAGTCGTACGCGT
(SEQ ID NO: SE ID NO: 715 (SEQ ID NO: (SAQ ID NO: 716 SE ID NO: SE IDN0:71 (SEQ ID NO: 51 SB ID NO: 674) SE ID NO: (SEQ ID NO: 718 SE ID NO: SE ID NO: 719 SE ID NO: CSEQ ID NO: 720 42 TTT I'GATTGGGTTTGAG
SE ID NO: SE ID NO: 72b SE ID NO: 51 (SEQ ID NO: 675) 44 TGAGTATTi'GTAGGAAGA
(SEQ ID NO: SE ID NO: 722 No: Gexe Ol =

(SAQ ID NO: 6) SE ID NO: 723) ID NO: SE ID NO: 724 SE ID NO: 6) (SEQ ID NO:

SE ID NO: SB ID NO: 72 (SEQ ID NO: 8) (SEQ ID NO: 727) (SEQ ID NO: 8) (SEQ ID NO: 728) SE ID NO: 8 (SEQ ID NO: 729) SB ID NO: 8) (SEQ ID NO: 730) (SEQ ID NO: 8) (SEQ II) NO: 731) (SEQ ID NO:8 S ID NO: 732 SE ID NO: 16) SE ID NO: 733) 56 TTGGT'1'GGTATATTTTGA
SE ID NO: 1(SEQ ID NO: 734) (SEQ ID NO: 16) (SEQ ID NO: 73 58 TGGAGGT'1"I"'TGGTTTGA
SE ID NO:1 SE ID NO: 73 (SEQ ID NO: 16) SE ID NO: 737) (SEQ ID NO: 52) SE ID NO: 676) SE ID NO: 42) (SEQ II) NO: 738) SE IDNO: 53) (SEQ ID NO: 677) F S ID NO: 42) (SEQ ID NO: 739) 64 AGGTGGTT'GTTTGTAA
SE ID NO: 42 (SEQ ID NO: 740) SE ID NO: 14) (SEQ ID NO: 1125) SE ID NO: 14) SE ID NO: 1 i26 SE ID NO: 14) SE ID NO: 1127) SE ID NO: 14) (SEQ ID NO: 1128 SE ID NO: 43) SE ID NO: 741 ' No: Gene Oli o:
70 GGTT'XGGGTTGATTTGA
ID NO: 43) SE ID NO: 742) (SEQ ID NO: 43) SE ID NO: 743) (SEQ ID NO: 43) SE ID NO: 744 (SEQ ID NO: 43) (SEQ ID NO: 745) ID NO: 43) SE ID NO: 746) SE ID NO: 15(SEQ ID NO: 747) S ID NO: 54) (SEQ ID NO: 678) SE ID NO: 15) (SEQ ID NO: 748) 78 AGTTGTT'TGAGAGGGT
(SEQ ID NO: 15) (SEQ ID NO: 749 (SEQ ID NO: 15) SE II? NO: 750) SB ID NO: 15) SE ID NO: 751) SE ID NO: 15) (SEQ ID NO: 752) 82 AGGTTTTGGGAT'ITGA
(SEQ ID NO: 15) SE ID NO: 753 (SEQ ID NO:1S (SEQ 1D NO: 754) 84 AGGATGTGGTaATAGT
ID NO: 15) (SEQ ID NO: 755) S ID NO: 15) (SEQ ID NO: 756) 86 TAAGTTGTATGTTTGGfA
SE ID NO: 15(SEQ ID NO: 757) (SEQ ID NO: 4 S ID NO: 758) (SEQ ID NO: 4) (SEQ ID NO: 759) (SEQ ID NO: 4) S ID NO: 760 SE ID NO: 4) (SEQ ID NO: 761 (SEQ ID NO: 4) (SEQ ID NO: 762) (SEQ ID NO: 4) SE ID NO: 763) 93 TTT"PGGCGCGI'TTATA
( EQ ID NO: 4) S ID NO: 764) SE ID NO: 4 (SEQ ID NO: 765) No: Gene Ol' :

S ID NO: 4 S ID NO: 766 (SEQ ID NO: 4) (SEQ ID NO: 767) SE ID NO: 4) (SEQ ID NO: 768) 98 TAGTAT"P'FTTGTGTGTTAA
SE ID NO: 4) SE ID NO: 769) (SEQ ID NO: (SEQ ID NO: 770) (SEQ ID NO: (SEQ ID NO: 771 S ID NO: (SEQ ID NO: 772 (SEQ ID NO: (SEQ ID NO: 773) S ID NO: S ID NO: 774 S ID NO: (SEQ ID NO: 775) (SEQ ID NO: (SEQ ID NO: 77 106 GTT'I"TTGTGTGAAGATT
S ID NO: (SEQ ID NO: 777) ID NO: 44) SE ID NO: 778 S ID NO: 44) S ID NO: 779 (SEQ ID NO: 44) (SEQ ID NO: 780 SE ID NO: 44) S ID NO: 781) 111 TATTTTfGCGTACGGG
ID NO: 44) S ID NO: 782) SE ID NO: 44) (SEQ ID NO: 783) S ID NO= 1) S ID NO: 784 S ID NO: 1) (SEQ ID NO: 785 115 TTCGGGATrAATATCGAGAT
ID NO:1 S ID NO: 7 (SEQ ID NO: 1(SEQ ID NO: 7 (SEQ ID NO: 1(SEQ ID NO: 788) (SEQ ID NO: 1SE ID NO: 789 (SEQ ID NO:1 S IDNO: 790 No: Gene O o:

SE ID NO:1 (SEQ ID NO: 791) (SEQ ID NO: 1) SE ID NO: 792) SE ID NO: 1ID NO: 793) SE ID NO: 1) (SEQ ID NO: 794) (SEQ ID NO: 1(SEQ II) NO: 795) (SEQ ID NO:1 S ID NO: 7 (SEQ ID NO: 1) (SE_Q ID NO: 797) S ID NO: 1(SEQ ID NO: 798) 128 ATGGAATTTATGTGTTT"T
(SEQ ID NO: 1) SE IDNO: 799 ID NO: 1(SAQ ID NO: 800 (SEQ ID NO: 1) SE ID NO: 801) (SEQ ID NO: 2) (SEQ ID NO: 802) S ID NO: 2) S ID NO: 803) (SEQ ID NO: 2) S ID NO: 804) SE ID NO: 2) S ID NO: 805) (SEQ TD NO: 2) $ID NO: 806) SE ID NO: 2) SE ID NO: 80 (SEQ ID NO: 2) (SEQ ID NO: 808) S ID NO: 2 (SEQ ID NO: 809) (SEQ ID NO: 45) S ID NO: 810 SE ID NO: 45) S ID NO: 811) 141 GGCCTTT"TATTTACGAGA
(SEQ ID NO: 45) (SEQ ID NO: 812) SE ID NO: 45) ID NO: 813 143 ATCGTGGACGGTA.ACGA
(SEQ ID NO: 45) (SEQ ID NO: 814) CSEQ ID NO: 45 (SEQ ID NO: 815) No: Gene Olt o:

SE ID NO: 45 S Il) NO: 816) (SEQ ID NO: 45) SE IDNO: 81 SE ID NO: 45) (SEQ ID NO: 818) 148 GGTGAGATTTGTATGI?' SE ID NO: 45) (SEQ ID NO: 819) (SEQ ID NO: 45 (SEQ ID NO: 820 SE ID NO: 45) SE ID NO: 821) (SEQ ID NO: 45) ID NO: 822 SE ID NO: 45) ID NO: 823) (SEQ ID NO: 45) S ID NO: 824) S ID NO: 45) (SEQ ID NO: 82 (SEQ ID NO: 45) ll.) NO: 826) (SEQ ID NO: 45) ID NO: 827) (SEQ ID NO: 45) II) NO: 828 SE ID NO: 45) ID NO: 829 (SEQ ID NO: 9) (SEQ ID NO: 830 (SEQ ID NO: 9) SE ID NO: 831 161 AG(',GCGATTAGGACGT
SE ID NO: 9) (SEQ II? NO: 832) 162 AC',GGTGATTAGGATGT
(SEQ ID NO: 9 (SEQ ID NO: 833) SE ID NO: ID NO: 834) (SEQ ID NO: (SEQ ID NO: 835) SE ID NO: S ID NO: 836 SE ID NO: (SEQ ID NO: 837) SE ID NO: (SEQ ID NO: 838 SE ID NO: (SEQ ID NO: 839) S ID- NO: SE ID NO: 840 No: Gene Ol' o:

S ID NO: 46) (SEQ ID NO: 841) S ID NO: 10) SE ID NO: 842) (SEQ ID NO: 10) SE JOD NO: 843) (SEQ ID NO: 10) (SEQ I[) NO: 844 S ID NO: 10) (SEQ ID NO: 845) SE ID NO: 10) S ID NO:

(SEQ ID NO: 10 (SEQ ID NO: 847) SE ID NO: 10 (SEQ ID NO: 848) SE ID NO: 10 (SEQ ID NO: 849 (SEQ ID NO: 10) (SEQ ID NO: 850) SE ID NO: 10) (SEQ ID NO: 851 (SEQ ID NO: 10 (SEQ ID NO: 852) (SEQ ID NO: 10 (SEQ ID NO: 853) (SEQ ID NO: 11) (SEQ ID NO: 854) (SEQ ID NO: 11) (SEQ ID NO: 855) (SEQ ID NO: 11) (SEQ ID NO: 856) (SEQ ID NO: 11) S ID NO: 857) (SEQ ID NO: 11) SE ID NO: 858) (SEQ ID NO: 11) (SEQ ID NO: 859 189 GACGTGAATT'I"TCGGAA
(SEQ ID NO: 11) S ID NO: 860) (SEQ ID NO: 11) (SEQ ID NO: 861) 191 AATGCGTGGTCGTTT"T
(SEQ ID NO: 11) SE ID NO: 862) (SEQ ID NO: 11) (SEQ ID NO: 863 (MQ ID NO: 11) (SEQ ID NO: 864) (SEQ SE ID NO: 11) (SE ID NO: 865) =
No: Gene Oli o:

SE ID NO: 12 SE ID NO: 960 (SEQ ID NO: 12(SEQ ID NO: 867) SE ID NO:12 (SEQ ID NO: 868) SE ID NO: 12) (SEQ ID NO: 869) (SEQ ID NO: 12(SEQ ID NO: 870 (SIBQ ID NO: 12SE ID NO: 871) SE ID NO: 13SE ID NO: 1129) 202 AG'TI"I"TGAAGTGGAGT
(SEQ ID NO: 13) (SEQ ID NO: 1130) CSIBQ ID NO:13 (SEQ ID NO: 1131) (SEQ ID NO: 13(SEQ ID NO: 1132) SE ID NO: 3) (SEQ ID NO: 872) SE ID NO: 3) (SEQ ID NO: 873) (SEQ ID NO: 3) (SAQ ID NO: 874) 208 TATGTTATTGGf'I"fGTATT
(SEQ ID NO: 3 SE ID NO: 875) (SAQ ID NO: 3) SE ID NO: 876) (SEQ ID NO: 3) S ID NO: 87 (SEQ ID NO: 3) (SEQ ID NO: 878) SE ID NO: 3) (SEQ ID NO: 879) SE ID NO: 3) (SEQ ID NO: 880 S ID NO: 3) (SEQ ID NO: 881 (SEQ ID NO: 3) (SEQ ID NO: 882) SE ID NO: 3) (SEQ ID NO: 883) (SEQ ID NO: 3) (SEQ ID NO: 884) SE ID NO: 3) (SEQ ID NO: 885) SE ID NO: 47) (SEQ ID NO: 886 No: Gexe Ol' o:

S ID NO: 47) (SEQ ID NO: 887) (SEQ ID NO: 47) (SEQ ID NO: 888) (SEQ ID NO: 47) (SEQ ID NO: 889) (SEQ ID NO: 1 (SEQ ID NO: 890) (SEQ ID NO: 18) (SEQ ID NO: 891) (SEQ ID NO: 20) (SEQ ID NO: 892) (SEQ ID NO: 20) (SEQ ID NO: 893) (SEQ ID NO: 20) (SEQ ID NO: 894) S ID NO: 20) (SEQ ID NO: 895) (SEQ ID NO: 20) (SEQ II) NO: 896) (SEQ ID NO: 20) (SEQ ID NO: 897) (SEQ ID NO: 20) (SEQ ID NO: 898) (SEQ ID NO: 20) SE ID NO: 899 (SEQ ID NO: 20) (SEQ ID NO: 900) (SEQ ID NO: 20) (SEQ ID NO: 901) (SEQ ID NO: 20) (5_EQ ID NO: 902) (SEQ ID NO: 20) (SEQ ID NO: 903) (SEQ ID NO: 20) (SEQ ID NO: 904) (SEQ ID NO: 20) (SEQ ID NO: 905) (SEQ ID NO: 20 (SEQ ID NO: 906) (SEQ ID NO: 48) SE ID NO: 907) SE ID NO: 48) (SEQ ID NO: 908 SE ID NO: 50 (SEQ ID NO: 1143) SE ID NO: 50) (SEQ ID NO: 1144) (SEQ ID NO: 22) (SEQ ID NO: 909) No: Gene O!' .

SE ID NO: 22) SE II? NO: 910 246 ATTTCGG'fiGTAGTATCGT
(SEQ ID NO: 22) (WQ ID NO: 911 (SEQ ID NO: 22) SE ID NO: 912) SE ID NO: 19) (SEQ ID NO: 913) SE ID NO: 19 S ID NO: 914 SE ID NO: 19 (SEQ ID NO: 915) SE ID NO: 19) (SEQ ID NO: 91 (SEQ ID NO: 19) (SEQ ID NO: 917) SE ID NO:19 ID NO: 918) (SEQ ID NO: 19) (SEQ ID NO: 919) SE ID NO: 19SE ID NO: 920) (SEQ ID NO: 55) SE ID NO: 679) 257 TATGT'TGTTTGGATGAAT
(SEQ ID NO:19 SE ID NO: 921 ($EQ ID NO: 19SE ID NO: 922) (SEQ ID NO: 19) (SRQ ID NO: 923) SE ID NO: 55) SE II) NO: 680) SE ID NO: 19) ID NO: 924) SE ID NO:19 SE ID NO: 925) (SEQ ID NO: 19 (SEQ ID NO: 926) SE ID NO: 19) (SgQ ID NO: 927) (SEQ ID NO: 19SE ID NO: 928) 266 TGAAAACGTTTT"TCGT
SE ID NO: 17) SE ID NO: 929) 267 AATGTT'!"ITTGTAAAGAAA
SE ID NO: 1SE ID NO: 930 (SEQ ID NO: 17) SE
Q ID NO: 931 F AAAGGATTTTGGTGTTA
SE ID NO: 1 SE ID NO: 932) No: Gene OI' o:

(SEQ ID NO: 17) (SEQ ID NO: 933) SE ID NO: 934) (SEQ ID NO: 17 (SgQ ID NO: 17) (SEQ ID NO: 935) (SEQ ID NO: 17) (SEQ ID NO: 936) (SEQ ID NO: 17) (SEQ ID NO: 937) (SEQ ID NO: 17) (SEQ ID NO: 938) (SEQ ID NO: 17) (SEQ ID NO: 939) S ID NO: 17) SE ID NO: 940) (SEQ ID NO:1 (SEQ ID NO: 941) SE ID NO: 1 (SEQ ID NO: 942) (SEQ ID NO: 17) SE ID NO: 943) (SFQ ID NO: 17) (SEQ ID NO: 944) (SEQ ID NO: 17) (SEQ ID NO: 945) (SEQ ID NO: 17 (SEQ ID NO: 946) SE ID NO: 17) (SEQ ID NO: 947) (SEQ ID NO: 17) (SEQ ID NO: 948) 286 GAGGCGCGTTAT"I"T'?'T
$E ID NO: 23) (SEQ ID NO:1133 (SEQ ID NO: 23) (SEQ ID NO: 1134) (SEQ ID NO: 23) (SEQ ID NO: 1135) (SEQ ID NO: 23) (SEQ ID NO: 113 SE ID NO: 23) (SEQ ID NO: 1137 SE ID NO: 23) (SEQ ID NO: 1138 (SEQ ID NO: 21 (SEQ ID NO:1139 293 TT'TTTTGTGTATATGTTTAGG
SE IDNO: 21 (SEQ ID NO: 1140 SE ID NO: 21) (SEQ ID NO: 1141) No: Gene 4 0:

SE ID ND: 21) SE ID NO: 1142 (SEQ ID NO: 32) (SEQ ID NO: 949) (SEQ ID NO: 32) (SEQ ID NO: 950 S ID NO: 32) SE ID NO: 951) (~WQ ID NO: 32) (SIRQ ID NO: 952) (SEQ ID NO: 32) (SEQ ID NO: 953) (SEQ ID NO: 32 S ID NO: 954 S ID NO: 32 (SEQ ID NO: 955) (SEQ ID NO: 32 (SEQ ID NO: 95 (SEQ ID NO: 32) (SEQ ID NO: 957) 305 TATTTTGGTGGG'I'TGTAT
(SEQ ID NO: 32) SB ID NO: 958) SE ID NO: 32) (SEQ ID NO: 959) 307 AAGGTTATTGt'irTTTAAGA
SE ID NO: 32 SE ID NO: 960 SE ID NO: 32 SE ID NO: 961) 309 GGGGGA.TGATGT'TTT TGT
(SEQ ID NO: 32) SE ID NO: 962) (SEQ ID NO: 33) S ID NO: 963) (SEQ ID NO: 33) (SEQ ID NO: 964) (SEQ ID NO: 33) (SEQ II) NO: 965) (SEQ ID NO: 33) E ID NO: 966) (SEQ ID NO: 33) (SEQ ID NO: 967) 315 AGGTATTTTGTGATATTI't (SEQ ID NO: 33 (SEQ ID NO: 968) 316 GTTI'TTCGATTTACGTT
(SEQ ID NO: 33) SE ID NO: 969 (SEQ ID NO: 33) SE ID NO: 97Q

(SEQ II? NO: 33 (SgQ ID NO: 971) (SEQ ID NO: 33 SE Il? NO: 972 No: Gene Oli o:

(SEQ ID NO: 33) (SgQ ID NO: 973 (SEQ ID NO: 33) (SEQ ID NO: 974) (SEQ ID NO: 33) SE ID NO: 975) (SEQ ID NO: 33) (SEQ ID NO: 976) (MQ ID NO: 33) (SEQ ID NO: 977) (SEQ ID NO: 33) (SEQ ID NO: 978 (SEQ ID NO: 33) (SEQ ID NO: 979) (SEQ ID NO: 33) (SEQ ID NO: 980 (SEQ ID NO: 33) (SEQ ID NO: 981) (SEQ ID NO: 33) (SEQ ID NO: 982) SE ID NO: 33) (SEQ ID NO: 983) (SEQ ID NO: 33) (SEQ ID NO: 984) (SEQ ID NO: 33) (SEQ ID NO: 985) (SEQ ID NO: 34) (SEQ ID NO: 986) (SEQ ID NO: 34) (SEQ ID NO: 987) (SEQ ID NO: 34) S ID NO: 988 (SEQ ID NO: 34) (SEQ ID NO: 989 (SEQ ID NO: 34) (SEQ ID NO: 990 (SEQ ID NO: 34) (SEQ ID NO: 991) (SEQ ID NO: 34) (SEQ ID NO: 992) 340 A.A.AAATTTGTGAGTTTAG
SE ID NO: 34) (SEQ II) NO: 993) SE ID NO: 24) (SEQ ID NO: 1145) (SEQ ID NO: 24) (SEQ ID NO: 11 (SEQ ID NO: 24) S II) NO: 1147) (SEQ ID NO: 24) (SEQ ID NO:1148 No: Gene OI o:

SE ID NO: 24) (SEQ ID NO: 1149) (SEQ ID NO: 24) (SEQ ID NO: 1150) (SEQ ID NO: 24 (SEQ ID NO: 1151 (SEQ ID NO: 24) (SEQ ID NO: 1152 (SEQ ID NO: 35) (SEQ ID NO: 994) (SEQ IA NO: 35) (SEQ ID NO: 995) (SEQ II) NO: 35) (SEQ ID NO: 996) (SEQ ID NO: 35) (SEQ ID NO: 997) SE ID NO: 35) (SEQ ID NO: 998) (SEQ ID NO: 35) (SEQ ID NO: 999) (SEQ ID NO: 35) (SEQ ID NO: 1000) (SEQ ID NO: 35) (SEQ ID NO: 1001) (SEQ ID NO: 35) (SEQ ID NO: 1002) (SEQ ID NO: 35) (SEQ ID NO: 1003) (SEQ ID NO: 25) (SEQ ID NO: 1004) (SEQ ID NO: 25) (SEQ ID NO: 1005) (SEQ ID NO: 25) (SEQ ID NO: 10 SE ID NO: 25) (SEQ ID NO: 1007) (SEQ ID NO: 25) (SEQ ID NO: 1008) (SEQ ID NO: 25) (SEQ ID NO: 1009) (SEQ ID NO: 36) (SEQ ID NO: 1010) (SEQ ID NO: 36) (SEQ ID NO: 1011) SE ID NO: 36 SE ID NO: 1012 (SE Q ID NO: 36 SE IDNO: 1013 SE ID NO: 36) (SEQ ID NO: 1014) No: Gene O ' o:

SE ID NO: 36) (SEQ ID NO: 1015 (SEQ ID NO: 36) (SEQ ID NO: 1016) (SEQ ID NO: (SEQ ID NO: 101 (SEQ ID NO: 36) (SEQ ID NO: 1018) (SEQ IDNU:3 (SEQ IDNO:1019 375 TTTTCGAGTI"TTATCGA
(SEQ ID NO: 36) (SEQ ID NO: 1020 SE ID NO: 36) SE ID NO: 1021) 377 ATAGTCGTGGfiTTCGT
(SEQ ID NO: 36) (SEQ ID NO:1022 E ID NO: 36) ID NO: 1023) (SEQ ID NO: 36) (SEQ ID NO: 1024 380 GATGGGTGT'1 TTTGAG
(SEQ ID NO: 36) S8 ID NO: 1025 381 TAATGAGCGCGTTGTA, SE IIID NO: 36) (SEQ ID NO: 102 (SEQ ID NO: 36) (SgQ ID NO: 1027) (SEQ ID NO: 28) S ID NO: 1028) 384 TTGGTTTGGGAAA.GGTAA
(SEQ ID NO: 28) SE ID NO: 1029) SE ID NO: 28) (SEQ ID NO: 1030 ID NO: 28 SE ID NO: 1031) (SEQ ID NO: 28 (SEQ ID NO: 1032) (SEQ Il) NO: 28) (SEQ ID NO: 1033) (SEQ ID NO: 28) (SEQ ID NO: 1034) 390 GTTTAGTTAGTGC',GTTTT
(SEQ ID NO: 28) (SBQ ID NO: 1035) SE ID NO: 28) (SBQ ID NO: 1036) S ID NO: 2 SE ID NO: 103 S ID NO: 28) (SBQ ID NO: 1038 S Il7 NO: 28) S ID NO:1039 No: Gene Oli o:

(SgQ ID NO: 37) (SEQ ID NO: 1153) (SEQ ID NO: 3 (SEQ ID NO: 1154) SE ID NO: 37) (SEQ ID NO:1155 S ID NO: 3 Sfi ID NO: 1156) SE ID NO: 37) (SEQ ID NO: 1157) (SEQ ID NO: 37) (SEQ ID NO: 1158) (SEQ ID NO: 37) S IDNO: 1159 S ID NO: 26) (SEQ ID NO: 1040) (SEQ ID NO: 26) (SEQ ID NO: 1041) (SEQ ID NO: 26) (SEQ ID NO: 1042) 405 ATT"I"TAAGTGTATTGATGT
(SEQ ID NO: 26) (SEQ ID NO: 1043) (SEQ ID NO: 26) (SEQ ID NO: 1044 (SEQ ID NO: 26) (SEQ ID NO: 1045) (SEQ ID NO: 26) SE ID NO: 1 SE ID NO: 26) (SEQ ID NO: 1047) 3E ID NO: 26) (SEQ ID NO: 1048) (SEQ ID NO: 2 S ID NO: 1049 (SEQ ID NO: 26) (SEQ ID NO: 1050) (SEQ ID NO: 26) (SEQ ID NO: 1051 (SEQ ID NO: 26) SE ID NO: 1052) SE ID NO: 26) (SEQ ID NO: 1053) (SEQ ID NO: 26 (SEQ ID NO: 1054) (SEQ ID NO: 26) SE ID NO: 1055) 418 GTCGTTCGGA.ATTCGT
(SEQ ID NO: 2 S ID NO: 1056 (SEQ ID NO: 2 (SEQ ID NO: 105 No: Gene Oli o:

SE ID NO: 26) (SEQ ID NO: 1058 (SEQ ID NO: 26 (SEQ ID NO: 1059) (SEQ ID NO: 26) (SEQ ID NO: i060 (SEQ ID NO: 26) (SEQ ID NO: 1061) (SEQ ID NO: 38) (SEQ ID NO: 1062 (SEQ ID NO: 38) (SEQ ID NO: 1063 (SEQ ID NO: 38) (SEQ ID NO: 1064 427 AAGATGTGTT'TTTTGGA
(SEQ ID NO: 38) (SEQ ID NO: 1065) 428 T'ITTGTCGCGGGAATT
(SEQ ID NO: 38) (SEQ ID NO: 1066) (SEQ ID NO: 38) (SEQ ID NO: 1067) (SEQ ID NO: 38) (SEQ ID NO: 1068) (SEQ IIID NO: 38) (SEQ ID NO: 1069) (SEQ ID NO: 39) (SEQ ID NO: 1070) (SEQ ID NO: 39 (SEQ ID NO: 1071) SE ID NO: 39 (SEQ ID NO: 1072) (SEQ ID NO: 39) (SEQ ID NO: 1073) (SEQ ID NO: 39) (SEQ ID NO: 1074) (SEQ ID NO: 39) (SIRQ ID NO: 1075) SE ID NO: 39) (SEQ ID NO: 1076) (SEQ ID NO: 39) (SEQ ID NO: 1077) SE II) NO: 27) (SEQ ID NO: 1078) (SEQ ID NO: 27) (SEQ ID NO: 1079 SE ID NO: 27) (SEQ ID NO: 1080) 443 GGGTAAA.GTGTGGATA
(SEQ ID NO: 2 SE ID NO: 1081) (SEQ m NO: 27) (SEQ ID NO: 1082) No: Gene Oligo:

(PQ ID NO: 27) (SEQ ID NO: 1083 (SEQ ID NO: 27) (SEQ ID NO: 1084 SE JD NO: 27) (SEQ ID NO:108 (SEQ ID NO: 27) (SEQ ID NO: 1086 449 TTT"TGAGGGATGGAAG
SE ID NO: 27) (SEQ ID NO: 108 (SEQ ID NO: 2 (SEQ ID NO: 1088 (SEQ ID NO: 27) (SEQ ID NO: 1089 SE IDNO: 27) (SEQ ID NO: 1090) SE ID NO: 27) (SEQ ID NO: 1091) (SEQ ID NO: 29) (SRQ ID NO: 1092) (SEQ ID NO: 29) (SgQ ID NO: 1093) (SEQ ID NO: 29) (SEQ ID NO: 1094) SE ID NO: 29 (SEQ ID NO: 1095 SE ID NO: 29 (SEQ ID NO: 1096 459 GGTTGATGT'ITTTGGTA
(SEQ ID NO: 29) (VEQ ID NO: 109 (SEQ ID NO: 31) (SEQ II) NO: 1098 (SEQ ID NO: 31) SE ID NO: 1099) (SEQ ID NO: 31 S ID NO: 1100 S ID NO:31 S IDNO:1101 S ID NO: 31 (SEQ ID NO: 1102 S ID NO: 31 (SBQ ID NO: 1103) (SEQ ID NO: 31) (SEQ ID NO: 1104) SE ID NO: 31 (SEQ ID NO: 110 (SEQ ID NO: 31 (SEQ ID NO: 1 I

(SEQ IDNO: 31 (SEQ ID NO: 1 I

No: Crem O!' o:

S ID NO: 31 (SEQ ID NO:1108 S ID NO: 31 SE ID NO:1109 472 AGTI'iTCGGATTCGAA
(SEQ ID NO: 31 ID NO:1110 473 AGAGTTTCfGGATTTGA
(SEQ ID NO: 31 (SEQ ID NO:1111 SE ID NO: 31 SE ID NO: 1112) (SEQ ID NO:31 (SEQ ID NO:1113 (SEQ ID NO: 31 SE ID NO:1114 (SEQ ID NO: 31) SE ID NO: 1115 (SEQ ID NO: 31 SEQ ID NO: 111 (SEQ ID NO: 31) SE ID NO: 1117) SE ID NO: 31) SB ID NO: 1118 (SEQ ID NO: 31 (SEQ ID NO:1119 SE ID NO: 31 (SEQ ID NO: 1120 (SEQ ID NO: 40) (SEQ II) NO: 1121 S ID NO: 40 S ID NO:1122 SE ID NO: 40 S ID NO: 1123 S II) NO: 40 (SEQ ID NO: 1124 Table 3: Qenes or aeuornic locus associated with g~mtc seauences aocacdine to SBO ID NO
1=S~Q ID NO 64.

Genomic. isulfite SEQ ID bank Itef. ID esariptioo.
EQ ID os: o:/contig O=
1 04, 305, 420 & 55481,12.1.12 ypothetical protein leucine rich repeat 21 43 ega gene ID

06. 307, 422 & C02760125.1.1 azacytidine induced (Ensembl gene ID

08, 309, 424 ~t 711.4. .88 n known gene, close lo ATF/GTP-25 1 site motif A-loo protein _Wigg 232 310, 311, 426 & M_002938 ING FINGER PROTEIN 4; RNF4 12, 313, 428 & 021926 OMEOBOX PROTEIN ARISTALESS-29 IKE 4;. ALX 4 314, 315, 430 & 4M_004852 NE CUT DOMAIN FAMILY MEMBER
31 ; ONC2 16, 317, 432 & M 002507 UMOR NECROSIS FACTOR

16 PRECURSOR (LOW- AFFINITY
ERVE GROWTH FACTOR
ECEPTOR) (NGF RECEPTOR) (GP80-GFR) (P75 ICD) (LOW AFFINiTY
UROTROPHIN RECEPTOR
SNTR). NGFR
118, 319, 434 & 1M 016192 TRANSMEMBRANE PROTEIN WITH

IKE DOMAINS 2;
TRANSMEMBRANE PROTEIN TENB2;
T'OMOREGULIN; PUTATIVE
TRANSMEMBRANE PROTEIN WITH
GF-LIKE AND TWO FOLLISTATIN-IKE DOMAINS 2.
20, 321, 436 & 4M_005221 OMEOBOX PROTEIN DLX-5 122, 323, 438 & 4M_080552 ESICULAR INHIBITORY AMINO
139 CID TRANSPORTER (GABA AND
LYCINE TRANSPORTER) VESICULAR GABA TRANSPORTER) HVIAAT) 11 124, 325, 440 & M_001208 ranscription factor BTF3 Homolog 1 12 26, 327, 442 & M_005904 OTHERS AGAINST

SMAD 7) (MOTHERS AGAINST DPP
OMOLOG 7) (SMAD7) (HSMAD7).
13 328, 329, 444 & _002146 OMEOBOX PROTEIN HOX-B3 (HOX-5 G (HOX-2.7) 14 330, 331, 446 & M 025078 Homo sapiens hypothetical protein 332, 333, 448 & 001116 [ADENYLATE CYCLASE, TYPE IX (EC
449 1.6.1.1) (ATP PYROPHOSPHATE-YASE) (ADENYLYL CYCLASE).

16 334, 335, 450 & 4M_001706 3-CELL LYMPHOMA 6 PROTEIN
151 BCL-6) (ZINC FINGER PROTEIN 51) LAZ-3 PROTEIN) (BCL-5).
17 436,337,452 &

18 338, 339, 454 & _017745 CL-6 INTERACTING COREPRESSOR

19 340,341,456& 005643 SCRIPTION INFTIATION

AFII 28) (TAFII28) (TFIID SUBUNIT

d 42, 343, 458 & _007374 OMEOBOX PROTEIN SIX6 (SINE
59 HOMEOBOX HOMOLOG 6) OPTIC HOMEOBOX 2) OMEODOMAIN PROTEIN OPTX2).
1 44, 345, 460 & 3 500.2.1.16 itusted between Ensemble gene IDs 461 8 N L%TGM23086d9 and S Igoooizvgfig 22 46, 347, 462 & C 385.4. .97 PIR-2 PROTEIN (FRAGMENT) 3 48, 349, 464 & C 7 223.5.1.15 itusted witkin Ensemble EST ID
52 ESTGd0001971415 4 150, 351,466 & 005229 TS-DOMAIN PROTEIN ELK-1 5 52, 353, 468 & 000179 NA MISMATCH REPAIR PROTEIN
169 H6 (MUTS-ALPHA 160 KDA
UBUNIT) (G/T MISMATCH BINDING
ROT (GTBP) GTMBP (P160) 6 54, 355, 470 & 005427 OR PROTEIN P73 (P53-LIKE
71 CRIPTION FACTOR) (P53-TED PROTE .
7 156, 357, 472 & _002093 LYCOGEN SYNTHASE KINASE-3 ?3 ETA (EC 2.7.1.37 GSR-3 BETA).
158, 359, 474 & 006765 33 PROTEIlV' 9 60, 361, 476 & _016192 MEMBRANE PROTEIN WTTH

IKE DOMAINS 2;
MEMBRANE PROTEIN TENB2;
OMOREGULIN; PUTATIVE
sMEMBR-ANE PROTEIN WITH

DOMAINS 2.
10 62, 363, 478 & 004429 HR1N B1 PRECURSOR (EPH-ASE LIGAND 2) (LERR-2) (ELK
IGAND (ELK-L).
1 364,365,480 & _018950 -F gene for human leukocyte antigen 2 66, 367, 482 & 000038 ENOMATOUS POLYPOSIS COLI
493 ROTEIN (APC PROT
3 368, 369, 484 & 000610 ANTIGEN PRECUR.SOR
185 HAGOCYTIC GLYCOPROTEIN 1) GP-1) (HUTCH-I) CELLUL.AR. MATRIX
CEFTOR- (ECMR-III) GP90 YMPHOCYTE HOMING/ADHESION
E1'TOR) (HERMES ANTIGEN) ALURONATfi RECEPTOR) ARAN SULFATE
ROTEOGLYC (EPICAN) CDW44 4 70, 371, 486 8t 004385 VERSICAN CORE PROTEIN
487 RECURSOR (I.ARGE FIBROBLAST
ROTEOGLYCAN) (CHONI7ROITIN
ULFATE PROTEOGLYCAN CORE
ROTEIN 2) (PG-iVi) (GLIAL
ALURONATE-BIlNDING PROTEIN) 35 [74,375,490& 2, 373, 488 & A 4 EnsEMBL ID ENSG00000112319 1 E l 1(EC 2.7.1.-) SERINF./TFIl~EONINE- PROTEIN
ASE LKBI
I
7 76, 377, 492 & 003242 raasfomiing growth factor, beta receptor 8 178, 379, 494 & 001753 AVEOLIN-1; CAV 1 9 80, 381, 496 & 001257 HERIN-13 PRECURSOR
97 UNCATED-CADHERIN) (T-ADHFRiN) (T-CAD) (HEART-40 82, 383, 498 & 000044 ROGEN RECEPTOR

CBPTOR AR
1 84, 385, 500 dt 032546 G FINGER PROTEIN 30, RNF 30,, 2 386, 387, 502 & 033178 UBLE HOMEOBOX, 4; DOUBLE
503 OMEOBOX PROTEIN 4. DUX4 3 388, 389, 504 & _003573 TENT TRANSFORM[NG GROWTH
505 ACTOR BETA BINDING PROTEIN 4.;

90,391, 506 & GI-20 PROTEIN

5 392, 393, 508 & 014459 ROTOCADHERIN 17;
509 ROTOCADHERIN 68.; PCDH 17 46 94, 395, 510 & 005285 ROBABLE G PROTEIN-COUPLED
511 EPTOR GPR7.; GPR7 17 396, 397, 512 & _016269 YMPHOID ENHANCER BIND1NG
513 ACTOR l (LEF-1) (T CELL-SPECIFIC
SCRIPTION FACTOR 1 ALPHA) 48 98, 399, 514 & AC139426.2-1,18 ituated between F.ngRhMID

15 908 S TGQ 3302Q72 and EnsEMBL ID

9 , 401, 516 & 005904 OTHERS AGATNST

517 ECAPENTAPLEGiC HOMOLOG 7 SMAD 7) (MOTHERS AGAINST DPP
OMOLOG 7) (SMAD7) SMAD .
0 402,403,518 & 12590.2.1.165 omo sapiens mRNA for KIAA1529 19 32 rotein EnsEMBL ID ENSG00000029402 51 104, 405, 520 & _001866 OX7B

lAAA

, 407, 522 & 001900 ST5 3 108, 409, 524 & 001990 YES ABSENT HOMOLOG 3. EYA3 4 10, 411, 526 & 002032 TIN HEAVY CHAIN (FIy.RRITIN
27 SUBUNI . FTH1.
55 12, 413, 528 & _002938 G FINGER PROTEIN 4.; RNF4 6 14, 415, 530 & PI EnsEMBL ID ENSG00000144339 7 116, 417, 532 & _000852 LUTATHIONE S-TRANSFERASE P
533 C 2.5.1.18) (GST CLASS-PI) (GSTP1-8 18, 419, 534 & _007084 RANSCRIPTION FACTOR SOX-21 9 5, 66, 77 & 78 003299 0 7, 6$ 79 & 80 025218 I 9, 70, 81 & 82 INM 001374 2 1, 72, 83 & 84 003714 3 3 74,85 & 86 002196 5, 76, 87 & 88 000484 DEiNEA,-NDES OU BREVETS VOLUINIINEUX
LA PRESENTE PARTIE DE CETTE DE1YLaNDE OLT CE BREVETS
COMPREND PLUS D'UN TOtYIE.

CECI EST LE TOINIE DE

NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.

JLTNLBO APPLICATIONS / PATENTS

THIS SECTION OF THE APPLICATION I PATENT CON iAINS MORE
THAN ONE VOLUiY1E.

THIS IS VOLUiNLE J- OF

NOTE: For addiuonal volumes oiease contact the Canadian Patent Office.

Claims

1. A method for detecting and/or for detecting and distinguishing between or among colon cell proliferative disorders in a subject comprising:
i) contacting genomic DNA isolated from blood plasma, blood serum, whole blood, isolated blood cells, cells isolated from the blood obtained from the subject with at least one reagent, or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one target region of the genomic DNA, wherein said contiguous nucleotides comprise at least one CpG dinucleotide sequence; and ii) detecting, or detecting and distinguishing between or among colon cell proliferative disorders afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%.

2. A method according to claim 1 wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a gene or sequence selected from the group consisting of SEQ ID NOS: 1-3, 14, 16, 17, 21, 22, 23, 44-46, 48, 50, 59-64,36, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFI128, HOMEOBOX
PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30, DUX4, SMAD7, GTMBP, EYA4, TCF1-ALPHA, TPEF, P73, APC, CD44, CSPG2, CAV 1, H-cadherin, ELK1, N33, gstp1 and LTBP4 respectively.

3. A method for detecting, or for detecting and distinguishing between or among colon cell proliferative disorders in a subject comprising determining the expression levels of one or more genes or sequences selected from the group consisting SEQ ID NOS: 1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAF1128, HOMEOBOX PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30 and DUX4 in a biological sample isolated from said subject.

4. The method according to claim 3 wherein said expression level is determined by detecting the presence, absence or level of mRNA transcribed from said gene or sequence.

5. The method according to claim 3 wherein said expression level is determined by detecting the presence, absence or level of a polypeptide encoded by said gene or sequence.

6. The method according to claim 5 wherein said polypeptide is detected by one or more means selected from the group consisting immunoassay, ELISA immunoassay, radioimmunoassay and antibody.

7. The method according to claim 3 wherein said expression is determined by detecting the presence or absence of CpG methylation within said gene or sequence, wherein hypermethylation indicates the presence of a colon cell proliferative disorder.

8. A method for detecting, or for detecting and distinguishing between or among colon cell proliferative disorders in a subject, comprising contacting genomic DNA
isolated from a biological sample obtained from the subject, from the subject with at least one reagent, or series of reagents that distinguishes between methylated and non-methylated CpG
dinucleotides within at least one target region of the genomic DNA, wherein the target region comprises, or hybridizes under stringent conditions to a sequence of at least 16 contiguous nucleotides of at least one gene or sequence selected from the group consisting of SEQ ID NOS:1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMEOBOX PROTEIN SIX6, GSK-3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30, DUX4, SMAD7, GTMBP, EYA4 and TCF1-ALPHA respectively, wherein said contiguous nucleotides comprise at least one CpG dinucleotide sequence, and whereby detecting, or detecting and distinguishing between or among colon cell proliferative disorders is, at least in part, afforded.

9. A method for detecting, or for detecting and distinguishing between or among colon cell proliferative disorders in a subject, comprising contacting genomic DNA
isolated from a biological sample obtained from the subject with at least one reagent, or series of reagents that distinguishes between methylated and non methylated CpG
dinucleotides within at least one target region of the genomic DNA, wherein the target region comprises, or hybridizes under stringent conditions to a sequence of at least contiguous nucleotides of at least two genes or sequences selected from the group consisting of SEQ ID NOS: 1-3, 14, 16, 21, 22, 23, 44-46, 48, 50, 59-64, 36, COX7B, CST5, EYA3, FTH1, RNF4, SOX 21, RNF4, ALX 4, ONC2, NGFR, DLX-5, HVIAAT, BTF3 Homolog 1, ADCY9, BCL-5, BCOR, TAFII28, HOMEOBOX
PROTEIN SIX6, GSK 3 BETA, ELK-L, HLA-F, TGFBR2, AR, RNF30, DUX4, SMAD7, GTMBP, EYA4, TCF1-ALPHA, TPEF, P73, APC, CD44, CSPG2, CAV 1, H-cadherin and LTBP4 respectively, wherein said contiguous nucleotides comprise at least one CpG dinucleotide sequence, and whereby detecting, or detecting and distinguishing between or among colon cell proliferative disorders is, at least in part, afforded.

10. The method of claims 8 and 9, wherein colorectal carcinoma is distinguished from at least one condition selected from the group consisting of colon adenoma, normal colon tissue, non-colon tissues and non-colon cell proliferative disorders.

11. The method of claims 8 and 9, wherein colon adenoma is distinguished from at least one condition selected from the group consisting of colon carcinoma , normal colon tissue, non-colon tissues and non-colon cell proliferative disorders.

12. The method of claims 8 or 9, wherein at least one of colorectal carcinoma tissue or colon adenomas is distinguished from at least one tissue selected from the group consisting of colon polyps less than 1cm in diameter, inflammatory colon tissue, and normal colon tissue, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS:1-12, 15-20, 22, 25-36, 38-49, 51-58, and complements thereof.

13. The method of claims 8 or 9, wherein colorectal carcinoma is distinguished from at least one tissue selected from the group consisting of non-colon healthy tissue, peripheral blood lymphocytes and non-colon cancer tissue, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS:1-23, 26-36, 38-43, 45-49, 51-58 and complements thereof.

14. The method of claims 8 or 9, wherein colorectal carcinoma is distinguished from at least one tissue selected from the group consisting of inflammatory colon tissue, normal colon tissue, non-colon healthy tissue, peripheral blood lymphocytes, colon adenomas and non-colon cancer tissue, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS:1-3, 5-13, 15-23, 26-36, 38-43, 45-49, 51-58, and complements thereof.

15. The method of claims 8 or 9, wherein colorectal carcinoma is distinguished from colon adenomas, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS:11, 25, 27, 38, 40, 45, 53, and complements thereof.

16. The method of claims 8 or 9, wherein at least one of colorectal carcinoma tissue, or large adenomas is distinguished from at least one tissue selected from the group consisting of inflammatory colon tissue, and normal colon tissue.

17. Tho method of claims 8 or 9, wherein colorectal carcinoma tissue is distinguished from at least one of inflammatory colon tissue and normal colon tissue, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS:1-3, 5-23, 25-36, 38-49, 51-58, and complements thereof.

18. The method of claim 1, wherein at least one of colorectal carcinoma tissue, or colon adenomas is distinguished from at least one tissue selected from the group consisting of inflammatory colon tissue, normal colon tissue, non-colon healthy tissue, peripheral blood lymphocytes, and non-colon cancer tissue, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS:1 36, 38-43, 45-58, and complements thereof.

19. The method of claims 8 and 9, wherein tissues originitaing from the colon are distinguished from tissues of non-colon origin.

20. A method for detecting, or for detecting and distinguishing between or among cell proliferative disorders and healthy tissues in a subject, comprising contacting genomic DNA isolated from a biological sample obtained from the subject with at least one reagent, or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one target region of the genomic DNA, wherein the target region comprises, or hybridizes under stringent conditions to a sequence of at least 16 contiguous nucleotides of at least two sequences selected from the group consisting of SEQ ID NO: &[IDGENSEQ_class9] respectively, wherein said contiguous nucleotides comprise at least one CpG dinucleotide sequence, and wherein the target region comprises, or hybridizes under stringent conditions to at least 16 contiguous nucleotides of a sequence selected from the group consisting of.

21. A method according to any of claims 8 to 20, comprising:

a. extracting or otherwise isolating genomic DNA from a biological sample obtained from the subject b. treating the genomic DNA of a), or a fragment thereof, with one or more reagents to convert cytosine bases that are unmethylated in the 5-position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms of hybridization properties;
c. contacting the treated genomic DNA, or the treated fragment thereof, with an amplification enzyme and at least two primers comprising, in each case a contiguous sequence of at least 9 nucleotides that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID N0:88, and complements thereof, wherein the treated genomic DNA or the fragment thereof is either amplified to produce at least one amplificate, or is not amplified; and d. determining, based on a presence or absence of, or on a property of said amplificate, the methylation state of at least one CpG dinucleotide of a sequence selected from the group consisting SEQ ID NO: 1 to SEQ ID NO 64, or an average, or a value reflecting an average methylation state of a plurality of CpG
dinucleotides of a sequence selected from the groups consisting of SEQ ID NO:

to SEQ ID NO 64, whereby at least one of detecting, or detecting and distinguishing between colon cell proliferative disorders is, at least in part, afforded.

22. The method of claim 21, wherein treating the genomic DNA, or the fragment thereof in b), comprises use of a reagent selected from the group consisting of bisulfite, hydrogen sulfite, disulfite, and combinations thereof.

23. The method of claim 21, wherein contacting or amplifying in c) comprises use of at least one method selected from the group consisting of: use of a heat-resistant DNA
polymerase as the amplification enzyme; use of a polymerase lacking 5'-3' exonuclease activity; use of a polymerase chain reaction (PCR); generation of a amplificate nucleic acid molecule carrying a detectable labels; and combinations thereof.

24. The method of claim 23, wherein the detectable amplificate label is selected from the label group consisting of: fluorescent labels; radionuclides or radiolabels;
amplificate mass labels detectable in a mass spectrometer, detachable amplificate fragment mass labels detectable in a mass spectrometer, amplificate, and detachable amplificate fragment mass labels having a single-positive or single-negative net charge detectable in a mass spectrometer; and combinations thereof.

25. The method of claim 21, wherein the biological sample obtained from the subject is selected from the group consisting of cell lines, histological slides, biopsies, paraffin-embedded tissue, bodily fluids, stool, colonic effluent , urine, blood plasma, blood serum, whole blood, isolated blood cells, cells isolated from the blood and combinations thereof.

26. The method of claim 21, further comprising in step d) the use of at least one nucleic acid molecule or peptide nucleic acid molecule comprising in each case a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof, wherein said nucleic acid molecule or peptide nucleic acid molecule suppresses amplification of the nucleic acid to which it is hybridized.

27. The method of claim 26, wherein the sequence of said nucleic acid molecules is selected from the group consisting of SEQ ID NOS: 1162, 1163, 1201, 1202, 1208, 1211, 1217, 1274, 1288, 1275, 1289, 1299, 1308, 1309, 1341, 1342, 1347, 1351, 1354, 1372, 1423, 1424, 1425, 1427, 1432, 1433, 1434, 1435, 1436, 1437, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1370, 1371, 1400, 1450, 1461, 1451, 1462, 1467, 1470, 1473, 1475, 1535, 1536, 1542, 1544, 1569, 1570, 1583, 1590, 1595, 1666, 1704, 1596, 1601, 1603, 1667, 1705, 1722, 1723, 1727, 1735, 1746, 1747, 1768, 1769, 1773, 1803, 1804, 1807, 1810, 1832, 1833, 1836, 1867, 1871, 1901, 1902, 1908, 1911, 1924, 1925, 1937, 1938, 1943, 1946, 1949, 1956, 1957, 1978, 1979, 1986, 1992, 1998, 2001, 2003, 2010, 2020, 2025, 2029, 2030, 2113, 2163, 2201, 2209, 2231, 2259, 2304, 2326, 2338, 2348, 2351, 2369, 2407, 2471, 2488, 2557, 2584, 2602, 2616, 2657, 2661, 2664, 2671, 2683, 2709, 2753, 2756, 2758, 2761, 2766, 2770, 2774, 2778, 2799, 2807, 2813, 2819, 2822, 2826, 2848, 2857, 2900, 2906, 2908, 2910, 2913, 2921, 2925, 2940, 2943, 2952, 2964, 2983, 2986, 3009, 3012, 3015, 3024, 3030, 3035, 3046, 3058, 3062, 3067, 3070, 3074, 3077, 3079, 3082, 3087, 3095, 3099, 3102, 3106, 3112, 3120, 3125, 3129, 3132, 3141, 3143, 3154, 3156, 3158, 3161, 3177, 3188, 3191, 3193, 3200, 3208, 3211, 3220, 3231, 3241, 3251, 3254, 3258, 3263, 3272, 3277, 3288, 3294, 3296, 3299, 3303, 3317, 3323, 3326, 3329, 3336, 3341, 3362, 3366, 3370, 3375, 3379, 3382, 3387, 3394, 3398, 3405, 3407, 3410, 3412, 3416, 3422, 3425, 3430, 3449, 3451, 3457, 3460, 3465, 3468, 3486, 3498, 3502, 3507, 3523, 3532, 3539, 3546, 3550, 3567, 3572, 3579, 3582, 3610, 3620, 3628, 3648, 3659, 3664, 3672, 3675, 3680, 3682, 3685, 3687, 3699, 3712, 3716, 3720, 3734, 3751, 3763, 3766, 3769, 3783, 3789, 3795, 3811, 3816, 3825, 3830, 3835, 3841, 3843, 3846, 3849, 3855, 3859, 3879, 3882, 3910, 3912, 3913, 3918, 3925, 3929, 3932, 3946, 3953, 3956, 3967, 3969, 3973, 3977, 3989, 3992, 3996, 3999, 4002, 4008, 4014, 4026, 4030, 4036, 4041, 4044, 4053, 4057, 4060, 4062, 4081, 4091, 4097, 4103, 4107, 4118, 4126, 4140, 4143, 4147, 4155, 4158, 4164, 4175, 4178, 4183, 4187, 4193, 4200, 4203, 4210, 4212, 4215, 4222, 4227, 4230, 4235, 4240, 4250, 4253, 4264, 4278, 4294, 4312, 4314, 4320, 4329, 4339, 4346, 4356, 4363, 4380, 4402, 4404, 4414, 4419, 4421, 4431, 4439, 4445, 4449, 4459, 4468, 4483, 4493, 4500, 4513, 4526, 4527, 4532, 4544, 4550, 4552, 4566, 4577, 4591, 4594, 4604, 4608, 4623, 4b25, 4629, 4637, 4651, 4654, 4657, 4673, 4679, 4682, 4692, 4698, 4710, 4712, 4713, 4723, 4725, 4729, 4734, 4740, 4743, 4747, 4752, 4757, 4762, 4765, 4775, 4781, 4796, 4799, 4803, 4809, 4826, 4831, 4863, 4866, 4880, 4888, 4914, 4916, 4931, 4933, 4939, 4955, 4959, 4962, 4965, 4994, 5001, 5008, 5012, 5023, 5029, 5035, 5046, 5059, 5063, 5068, 5071, 5079, 5082, 5085, 5089, 5092, 5095, 5098, 5102, 5108, 5113, 5118, 5122, 5127, 5130, 5133, 5138, 5141, 5146, 5152, 5154, 5178, 5192, 5197, 5206, 5213, 5228, 5236, 5243, 5258, 5267, 5275, 5277, 5283, 5294, 5298, 5302, 5305, 5320, 5325, 5328, 5335, 5345, 5350, 5357, 5374, 5381, 5384, 5386, 5390, 5397, 5402, 5406, 5411, 5423, 5430, 5439, 5453, 5463, 5473, 5476, 5479, 5483, 5489, 5514, 5520, 5523, 5530, 5547, 5584, 5590, 5607, 5610, 5613, 5617, 5621, 5631, 5636, 5641, 5653, 5655, 5658, 5666, 5669, 5675, 5685, 5692, 5695, 5703, 5706, 5716, 5719, 5726, 5738, 5746, 5749, 5752, 5755, 5757, 5761, 5765, 5772, 5784, 5799, 5805, 5815, 5819, 5829, 5851, 5869, 5901, 5908, 5911, 5914, 5917, 5925, 5941, 5951, 5967, 5974, 5979, 5982, 5985, 5989, 5995, 6022, 6029, 6044, 6047, 6052, 6057, 6061, 6069, 6071, 6080, 6082, 6087, 6092, 6095, 6102, 6104, 6107, 6109, 6113, 6124, 6129, 6140, 6147, 6158, 6165, 6179, 6185, 6203, 6209, 6217, 6228, 6249, 6263, 6267, 6279, 6290, 6332, 6339, 6343, 6346, 6352, 6363, 6366, 6370, 6380, 6385, 6391, 6396, 6408, 6430, 6439, 6454, 6456, 6477, 6483, 6488, 6495, 6509, 6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6846, 6856, 6864, 6867, 6878, 6885, 6903, 6914, 6919, 6923, 6926, 6938, 6941, 6978, 6982, 6985, 6988, 6994, 6997, 7000, 7004, 7008, 7015, 7019, 7021, 7069, 7079, 7099, 7104, 7117, 7120, 7145, 7151, 7153, 7162, 7164, 7169, 7201, 7209, 7234, 7238, 7252, 7286, 7288, 7300, 7305, 7313, 7323, 7327, 7338, 7343, 7346, 7352, 7377, 7380, 7396, 7399, 7406, 7412, 7414, 7418, 7424, 7429, 7437, 7441, 7443, 7458, 7461, 7469, 7473, 7491, 7502, 7504, 7514, 7531, 7551, 7553, 7557, 7562, 7564, 7569, 7572, 7592, 7602, 7605, 7612, 7625, 7630, 7632, 7634, 7648, 7653, 7664, 7668, 7693, 7696, 7706, 7763, 7766, 7769, 7772, 7777, 7780, 7787, 7790, 7801, 7804, 7806, 7826, 7831, 7850, 7859, 7862, 7867, 7876, 7883, 7887, 7891, 7893, 7895, 7898, 7901, 7906, 7908, 7911, 7915, 7924, 7927, 7930, 7935, 7959, 7961, 7966, 7975, 7978, 7984, 7994, 7998, 8002, 8014, 8029, 8032, 8037, 8041, 8045, 8048, 8058, 8063, 8086, 8092, 8097, 8106, 8109, 8120, 8140, 8141, 8159, 8162, 8172, 8196, 8205, 8211, 8215, 8219, 8226, 8234, 8241, 8249, 8262, 8265, 8272, 8276, 8279, 8283, 8290, 8300, 8308, 8320, 8338, 8355, 8358, 8368, 8380,8386, 8389, 8393, 8396, 8400, 8404, 8408, 8417, 8421, 8427, 8430, 8439, 8441, 8443, 8453, 8459, 8471, 8483, 8495, 8507, 8509, 8525, 8538, 8540, 8543, 8549, 8553, 8559, 8561, 8573, 8579, 8584, 8590, 8593, 8605, 8611, 8622, 8626, 8656, 8664, 8721, 8724, 8731, 8740, 8743, 8746, 8765, 8774, 8781, 8792, 8795, 8811, 8817, 8822, 8825, 8834, 8839, 8849, 8858, 8860, 8862, 8875, 8886, 8910, 8915, 8919, 8922, 8926, 8940, 8947, 8956, 8959, 8973, 8982, 8986, 8991, 8996, 9000, 9015, 9027, 9031, 9040, 9057, 9059, 9062, 9065, 9073, 9076, 9101, 9115, 9117, 9120, 9132, 9145, 9161, 9170, 9179, 9196, 9210, 9213, 9225, 9236, 9242, 9245, 9250, 9255, 9259, 9262, 9268, 9272, 9294, 9299, 9306, 9315, 9330, 9341, 9343, 9346, 9350, 9359, 9362, 9366, 9369, 9373, 9381, 9387, 9392, 9396, 9404, 9427, 9442, 9463, 9472, 9476, 9481, 9484, 9486, 9491, 9507, 9510, 9531, 9540, 9553, 9562, 9568, 9572, 9575, 9582, 9590, 9597, 9600, 9610, 9616, 9620, 9629, 9636, 9642, 9648, 9655, 9669, 9674, 9678, 9681, 9685, 9689, 9696, 9704, 9709, 9725, 9728, 9731, 9736, 9740, 9743, 9752, 9770, 9774, 9779, 9785, 9799, 9802, 9814, 9824, 9829, 9834, 9874, 9884, 9888, 9906, 9910, 9927, 9930, 9951, 9965, 9971, 9977, 10024, 10029, 10039, 10052, 10063, 10066, 10073, 10076, 10085, 10108, 10115, 10128, 10136, 10146, 10158, 10162, 10168, 10171, 10180, 10185, 10208, 10217, 10238, 10246, 10250, 10281, 10284, 10289, 10294, 10296, 10303, 10316, 10324, 10332, 10334, 10339, 10353, 10364, 10368, 10371, 10389, 10393, 10396, 10397, 10400, 10405, 10409, 10421, 10424, 10436, 10441, 10450, 10458, 10472, 10474, 10479, 10482, 10486, 10496, 10505, 10512, 10527, 10549, 10555, 10562, 10567, 10570, 10575, 10585, 10587, 10591, 10595, 10599, 10608, 10615, 10620, 10623, 10629, 10636, 10677, 10680, 10686, 10692, 10695, 10698, 10701, 10706, 10708, 10715, 10731, 10736, 10753, 10756, 10766, 10771, 10774, 10777, 10785, 10787, 10795, 10797, 10803, 10810, 10825, 10828, 10832, 10836, 10852, 10855, 10867, 10876, 10887, 10891, 10895, 10898, 10913, 10918, 10921, 10923, 10936, 10940, 10949, 10961, 10964, 10974, 10983, 10990, 10994, 11003, 11008, 11011, 11018, 11024, 11035, 11038, 11057, 11095, 11378, 11389, 11393, 11407, 11413, 11420, 11426, 11436, 11440, 11454, 11470, 11491, 11495, 11530, 11437, 11441, 11455, 11471, 11492, 11496, 11516, 11531, 11533, 11537, 11543, 11558, 11564, 11575, 11538, 11544, 11559, 11565, 11567, 11576, 11580, 11583, 11588, 11581, 11584, 11589, 11599, 11634, 11604, 11611, 11620, 11624, 11630, 11605, 11612, 11621, 11625, 11631, 11637, 11650, 11638, 11651, 11661, 11668, 11679, 11683, 11703, 11707; 11711, 11714, 11717, 11721, 11726, 11741, 11753, 11757, 11766, 11771, 11780, 11662; 11669, 11680, 11684, 11704, 11708, 11712, 11715, 11718, 11722, 11742, 11754, 11758, 11760, 11781, 11788, 11794, 11789, 11795, 11798, 11807, 11812, 11816, 11821, 11831, 11842, 11854, 11799, 11808, 11813, 11822, 11826, 11832, 11834, 11838, 11843, 11849, 11855, 11859, 11869, 11873, 11880, 11884, 11896, 11870, 11874, 11881, 11885, 11897, 11900, 11906, 11920, 11935, 11939, 11944, 11957, 11961, 11965, 11970, 11974, 11983, 11901, 11907, 11921, 11936, 11940, 11945, 11958, 11962, 11966, 11971, 11975, 11984, 12008, 12013, 12018, 12029, 12036, 12040, 12047, 12074, 12078, 12083, 12105, 12116, 12009, 12014, 12019, 12030, 12037, 12041, 12048, 12053, 12075, 12079, 12036, 12092, 12106, 12117, 12126, 12132, 12151, 12155, 12133, 12152, 12156, 12166, 12173, 12178, 12183, 12189, 12192, 12204, 12211, 12218, 12235, 12246, 12252, 12282, 12293, 12298, 12301, 12304, 12310, 12315, 12319, 12334, 12350, 12357, 12365, 12374, 12387, 12391, 12395, 12416, 12426, 12444, 12451, 12456, 12167, 12174, 12179, 12184, 12193, 12205, 12212, 12215, 12219, 12236, 12247, 12253, 12261, 12275, 12283, 12294, 12299, 12305, 12311, 12316, 12320, 12329, 12335, 12344, 12351, 12358, 12366,12368, 12375, 12384, 12388,12392, 12396, 12399, 12407, 12414, 12421, 12427, 12431,12434,12447,12452,12457,12463,12470,12473,12482,12464,12466,12471, 12476,12479,12491,12503,12509,12513,12516,12514,12532,12539,12544,12557, 12562,12567,12576,12583,12588,12591,12606,12612,12622,12628,12510,12514, 12519,12526,12527,12533,12540,12545,12558,12563,12568,12577,12580,12584, 12589,12598,12607,12619,12623,12629,12633,12642,12645,12650,12656,12668, 12674,12676,12697,12707,12722,12734,12741,12759,12773,12779,12783,12802, 12806,12810,12819,12829,12634,12646,12651,12657,12659,12669, 12698,12708, 12711,12723, 12707,12727,12735,12742,12774,12780,12784,12803,12807,12811, 12820,12830,12847,12852,12859,12864,12874,12905,12915,12925,12930,12934, 12940,12944,12946,12955,12848,12853,12856,12860,12865,12875,12897,12906, 12916,12922, 12926,12931,12935,12941, 12930,12947,12952,12956,12963,12979, 12964,12980,12984, 13003,12985, 12988, 12990,12994,13004, 13007,13011,13015, 13027,13046, 13055,13059,13080,13094,13098,13112,13120, 13134,13140,13150, 13154,13161, 13187,13008,13012,13016,13028,13047,13056,13060, 13081,13095, 13099,13103,13106,13113,13116, 13135, 13136, 13141,13151,13155,13162,13188, 13193,13202,13194,13203,13205,13209,13215,13218,13236,13252,13260,13271, 13283,13210, 13216, 13219,13221,13223,13230,13238,13243, 13253,13261, 13272, 13278,13284, 13643,13644,13651,13657,13662,13663,13666,13679,13667, 13680, 13699,13711,13730,13737,13742,13700,13712,13731,13738,13743,13747,13756, 13760,13781, 13793,13801,13810, 13830,13748, 13750,13757, 13761,13770, 13771, 13782, 13787, 13794, 13799, 13811, 13825,13827, 13831, 13834, 13839, 13851,13859, 13863, 13867, 13873, 13877, 13835,13840,13842, 13848,13852, 13860,13864, 13868, 13874,13878, 13885,13886, 13891,13896,13901, 13918, 13927, 13933,13939, 13951, 13886,13888, 13892, 13897, 13899,13901,13919,13934,13940, 13952, 13955, 13973, 13979,13983, 13997,13984, 13998, 14006, 14011,14019, 14022, 14031,14047,14053, 14061,14075, 14111,14116, 14124,14149,14007,14012,14016,14023, 14032, 14048, 14054,14062, 14076, 14112,14117, 14119, 14125, 14128,14129, 14131,14146, 14150, 14153, 14159, 14163, 14168, 14173,14177,14154, 14160, 14164, 14169,14174, 14178, 14181,14206,14213,14219,14237,14248,14252,14258,14264,14271,14275,14279, 14295,14308, 14311, 14314, 14318, 14332, 14335,14339,14343, 14207, 14209, 14214, 14220,14222, 14232,14234, 14238,14249,14253,14259,14265, 14272,14276, 14280, 14288,14296, 14309,14315, 14319, 14321,14326,14333,14336,14362,14370, 14377, 14371, and SEQ ID NO:14378.

28. The method of claim 26, wherein said nucleic acid molecule or peptide nucleic acid molecule is in each case modified at the 5'-end thereof to preclude degradation by an enzyme having 5'-3' exonuclease activity.

29. The method of claim 26, wherein said nucleic acid molecule or peptide nucleic acid molecule is in each case lacking a 3' hydroxyl group.

30. The method of claim 26, wherein the amplification enzyme is a polymerase lacking 5'-3' exonuclease activity.

31. The method of claim 21, wherein determining in d) comprises hybridization of at least one nucleic acid molecule or peptide nucleic acid molecule in each case comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ

ID NO:88, and complements thereof.

32. The method of claim 31, wherein said nucleic acid is taken from the group consisting of SEQ ID NOS: SEQ ID NOS: 1162, 1163,1201,1202, 1208, 1211, 1217, 1274,1288, 1275,1289, 1299, 1308,1309,1341, 1342, 1347, 1351,1354,1372, 1423, 1424, 1425, 1427, 1432, 1433, 1434, 1435,1436,1437, 1440,1441, 1442, 1443,1444, 1445, 1446, 1447,1370,1371, 1400,1450, 1461, 1451, 1462, 1467, 1470,1473, 1475, 1535, 1536, 1542,1544,1569, 1570,1583,1590, 1595, 1666, 1704, 1596,1601,1603, 1667, 1705, 1722, 1723, 1727, 1735, 1746, 1747, 1768, 1769, 1773, 1803, 1804, 1807, 1810, 1832, 1833, 1836, 1867, 1871, 1901, 1902, 1908, 1911, 1924, 1925, 1937, 1938, 1943, 1946, 1949, 1956, 1957,1978, 1979, 1986, 1992, 1998, 2001, 2003, 2010, 2020, 2025, 2029, 2030, 2113, 2163, 2201, 2209, 2231, 2259, 2304, 2326, 2338, 2348, 2351, 2369, 2407, 2471, 2488, 2557, 2584, 2602, 2616, 2657, 2661, 2664, 2671, 2683, 2709, 2753, 2756, 2758, 2761, 2766, 2770, 2774, 2778, 2799, 2807, 2813, 2819, 2822, 2826, 2848, 2857, 2900, 2906, 2908, 2910, 2913, 2921, 2925, 2940, 2943, 2952, 2964, 2983, 2986, 3009, 3012, 3015, 3024, 3030, 3035, 3046, 3058, 3062, 3067, 3070, 3074, 3077, 3079, 3082, 3087, 3095, 3099, 3102, 3106, 3112, 3120, 3125, 3129, 3132, 3141, 3143, 3154, 3156, 3158, 3161, 3177, 3188, 3191, 3193, 3200, 3208, 3211, 3220, 3231, 3241, 3251, 3254, 3258, 3263, 3272, 3277, 3288, 3294, 3296, 3299, 3303, 3317, 3323, 3326, 3329, 3336, 3341, 3362, 3366, 3370, 3375, 3379, 3382, 3387, 3394, 3398, 3405, 3407, 3410, 3412, 3416, 3422, 3425, 3430, 3449, 3451, 3457, 3460, 3465, 3468, 3486, 3498, 3502, 3507, 3523, 3532, 3539, 3546, 3550, 3567, 3572, 3579, 3582, 3610, 3620, 3628, 3648, 3659, 3664, 3672, 3675, 3680, 3682, 3685, 3687, 3699, 3712, 3716, 3720, 3734, 3751, 3763, 3766, 3769, 3783, 3789, 3795, 3811, 3816, 3825, 3830, 3835, 3841, 3843, 3846, 3849, 3855, 3859, 3879, 3882, 3910, 3912, 3913, 3918, 3925, 3929, 3932, 3946, 3953, 3956, 3967, 3969, 3973, 3977, 3989, 3992, 3996, 3999, 4002, 4008, 4014, 4026, 4030, 4036, 4041, 4044, 4053, 4057, 4060, 4062, 4081, 4091, 4097, 4103, 4107, 4118, 4126, 4140, 4143, 4147, 4155, 4158, 4164, 4175, 4178, 4183, 4187, 4193, 4200, 4203, 4210, 4212, 4215, 4222, 4227, 4230, 4235, 4240, 4250, 4253, 4264, 4278, 4294, 4312, 4314, 4320, 4329, 4339, 4346, 4356, 4363, 4380, 4402, 4404, 4414, 4419, 4421, 4431, 4439, 4445, 4449, 4459, 4468, 4483, 4493, 4500, 4513, 4526, 4527, 4532, 4544, 4550, 4552, 4566, 4577, 4591, 4594, 4604, 4608, 4623, 4625, 4629, 4637, 4651, 4654, 4657, 4673, 4679, 4682, 4692, 4698, 4710, 4712, 4713, 4723, 4725, 4729, 4734, 4740, 4743, 4747, 4752, 4757, 4762, 4765, 4775, 4781, 4796, 4799, 4803, 4809, 4826, 4831, 4863, 4866, 4880, 4888, 4914, 4916, 4931, 4933, 4939, 4955, 4959, 4962, 4965, 4994, 5001, 5008, 5012, 5023, 5029, 5035, 5046, 5059, 5063, 5068, 5071, 5079, 5082, 5085, 5089, 5092, 5095, 5098, 5102, 5108, 5113, 5118, 5122, 5127, 5130, 5133, 5138, 5141, 5146, 5152, 5154, 5178, 5192, 5197, 5206, 5213, 5228, 5236, 5243, 5258, 5267, 5275, 5277, 5283, 5294, 5298, 5302, 5305, 5320, 5325, 5328, 5335, 5345, 5350, 5357, 5374, 5381, 5384, 5386, 5390, 5397, 5402, 5406, 5411, 5423, 5430, 5439, 5453, 5463, 5473, 5476, 5479, 5483, 5489, 5514~ 5520, 5523, 5530, 5547, 5584, 5590, 5607, 5610, 5613, 5617, 5621, 5631, 5636, 5641, 5653, 5655, 5658, 5666, 5669, 5675, 5685, 5692, 5695, 5703, 5706, 5716, 5719, 5726, 5738, 5746, 5749, 5752, 5755, 5757, 5761, 5765, 5772, 5784, 5799, 5805, 5815, 5819, 5829, 5851, 5869, 5901, 5908, 5911, 5914, 5917, 5925, 5941, 5951, 5967, 5974, 5979, 5982, 5985, 5989, 5995, 6022, 6029, 6044, 6047, 6052, 6057, 6061, 6069, 6071, 6080, 6082, 6087, 6092, 6095, 6102, 6104, 6107, 6109, 6113, 6124, 6129, 6140, 6147, 6158, 6165, 6179, 6185, 6203, 6209, 6217, 6228, 6249, 6263, 6267, 6279, 6290, 6332, 6339, 6343, 6346, 6352, 6363, 6366, 6370, 6380, 6385, 6391, 6396, 6408, 6430, 6439, 6454, 6456, 6477, 6483, 6488, 6495, 6509, 6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6846, 6856, 6864, 6867, 6878, 6885, 6903, 6914, 6919, 6923, 6926, 6938, 6941, 6978, 6982, 6985, 6988, 6994, 6997, 7000, 7004, 7008, 7015, 7019, 7021, 7069, 7079, 7099, 7104, 7117, 7120, 7145, 7151, 7153, 7162, 7164, 7169, 7201, 7209, 7234, 7238, 7252, 7286, 7288, 7300, 7305, 7313, 7323, 7327, 7338, 7343, 7346, 7352, 7377, 7380, 7396, 7399, 7406, 7412, 7414, 7418, 7424, 7429, 7437, 7441, 7443, 7458, 7461, 7469, 7473, 7491, 7502, 7504, 7514, 7531, 7551, 7553, 7557, 7562, 7564, 7569, 7572, 7592, 7602, 7605, 7612, 7625, 7630, 7632, 7634, 7648, 7653, 7664, 7668, 7693, 7696, 7706, 7763, 7766, 7769, 7772, 7777, 7780, 7787, 7790, 7801, 7804, 7806, 7826, 7831, 7850, 7859, 7862, 7867, 7876, 7883, 7887, 7891, 7893, 7895, 7898, 7901, 7906, 7908, 7911, 7915, 7924, 7927, 7930, 7935, 7959, 7961, 7966, 7975, 7978, 7984, 7994, 7998, 8002, 8014, 8029, 8032, 8037, 8041, 8045, 8048, 8058, 8063, 8086, 8092, 8097, 8106, 8109, 8120, 8140, 8141, 8159, 8162, 8172, 8196, 8205, 8211, 8215, 8219, 8226, 8234, 8241, 8249, 8262, 8265, 8272, 8276, 8279, 8283, 8290, 8300, 8308, 8320, 8338, 8355, 8358, 8368, 8380,8386, 8389, 8393, 8396, 8400, 8404, 8408, 8417, 8421, 8427, 8430, 8439, 8441, 8443, 8453, 8459, 8471, 8483, 8495, 8507, 8509, 8525, 8538, 8540, 8543, 8549, 8553, 8559, 8561, 8573, 8579, 8584, 8590, 8593, 8605, 8611, 8622, 8626, 8656, 8664, 8721, 8724, 8731, 8740, 8743, 8746, 8765, 8774, 8781, 8792, 8795, 8811, 8817, 8822, 8825, 8834, 8839, 8849, 8858, 8860, 8862, 8875, 8886, 8910, 8915, 8919, 8922, 8926, 8940, 8947, 8956, 8959, 8973, 8982, 8986, 8991, 8996, 9000, 9015, 9027, 9031, 9040, 9057, 9059, 9062, 9065, 9073, 9076, 9101, 9115, 9117, 9120, 9132, 9145, 9161, 9170, 9179, 9196, 9210, 9213, 9225, 9236, 9242, 9245, 9250, 9255, 9259, 9262, 9268, 9272, 9294, 9299, 9306, 9315, 9330, 9341, 9343, 9346, 9350, 9359, 9362, 9366, 9369, 9373, 9381, 9387, 9392, 9396, 9404, 9427, 9442, 9463, 9472, 9476, 9481, 9484, 9486, 9491, 9507, 9510, 9531, 9540, 9553, 9562, 9568, 9572, 9575, 9582, 9590, 9597, 9600, 9610, 9616, 9620, 9629, 9636, 9642, 9648, 9655, 9669, 9674, 9678, 9681, 9685, 9689, 9696, 9704, 9709, 9725, 9728, 9731, 9736, 9740, 9743, 9752, 9770, 9774, 9779, 9785, 9799, 9802, 9814, 9824, 9829, 9834, 9874, 9884, 9888, 9906, 9910, 9927, 9930, 9951, 9965, 9971, 9977, 10024, 10029,10039, 10052, 10063, 10066, 10073, 10076, 10085, 10108, 10115, 10128, 10136, 10146, 10158, 10162, 10168, 10171, 10180, 10185, 10208, 10217, 10238, 10246, 10250, 10281, 10284, 10289, 10294, 10296, 10303, 10316, 10324, 10332, 10334, 10339, 10353, 10364, 10368, 10371, 10389, 10393, 10396, 10397, 10400, 10405, 10409, 10421, 10424, 10436, 10441, 10450, 10458, 10472, 10474, 10479, 10482, 10486, 10496, 10505, 10512, 10527, 10549, 10555, 10562, 10567, 10570, 10575, 10585, 10587, 10591, 10595, 10599, 10608, 10615, 10620, 10623, 10629, 10636, 10677, 10680, 10686, 10692, 10695, 10698, 10701, 10706, 10708, 10715, 10731, 10736, 10753, 10756, 10766, 10771, 10774, 10777, 10785, 10787, 10795, 10797, 10803, 10810, 10825, 10828, 10832, 10836, 10852, 10855, 10867, 10876, 10887, 10891, 10895, 10898, 10913, 10918, 10921, 10923, 10936, 10940, 10949, 10961, 10964, 10974, 10983, 10990, 10994, 11003, 11008, 11011, 11018, 11024, 11035, 11038, 11057, 11095, 11378, 11389, 11393, 11407, 11413, 11420, 11426, 11436, 11440, 11454, 11470, 1149t, 11495, 11530, 11437, 11441, 11455, 11471, 11492, 11496, 11516, 11531, 11533, 11537, 11543, 11558, 11564, 11575, 11538, 11544, 11559, 11565, 11567, 11576, 11580, 11583, 11588, 11581, 11584, 11589, 11599, 11634, 11604, 11611, 11620, 11624, 11630, 11605, 11612, 11621, 11625, 11631, 11637, 11650, 11638, 11651, 11661, 11668, 11679, 11683, 11703, 11707, 11711, 11714, 11717, 11721, 11726, 11741, 11753, 11757, 11766, 11771, 11780, 11662, 11669, 11680, 11684, 11704, 11708, 11712, 11715, 11718, 11722, 11742, 11754, 11758, 11760, 11781, 11788, 11794, 11789, 11795, 11798, 11807, 11812, 11816, 11821, 11831, 11842, 11854, 11799, 11808, 11813, 11822, 11826, 11832, 11834, 11838, 11843, 11849, 11855, 11859, 11869, 11873, 11880, 11884, 11896, 11870, 11874, 11881, 11885, 11897, 11900, 11906, 11920, 11935, 11939, 11944, 11957, 11961, 11965, 11970, 11974, 11983, 11901, 11907, 11921, 11936, 11940, 11945, 11958, 11962, 11966, 11971, 11975, 11984, 12008, 12013, 12018, 12029, 12036, 12040, 12047, 12074, 12078, 12083, 12105, 12116, 12009, 12014, 12019, 12030, 12037, 12041, 12048, 12053, 12075, 12079, 12036, 12092, 12106, 12117, 12126, 12132, 12151, 12155, 12133, 12152, 12156, 12166, 12173, 12178, 12183, 12189, 12192, 12204, 12211, 12218, 12235, 12246, 12252, 12282, 12293, 12298, 12301, 12304, 12310, 12315, 12319, 12334, 12350, 12357, 12365, 12374, 12387, 12391, 12395, 12416, 12426, 12444, 12451, 12456, 12167, 12174, 12179, 12184, 12193, 12205, 12212, 12215, 12219, 12236, 12247, 12253, 12261, 12275, 12283, 12294, 12299, 12305, 12311, 12316, 12320, 12329, 12335, 12344, 12351, 12358, 12366, 12368, 12375, 12384, 12388, 12392, 12396, 12399, 12407, 12414, 12421, 12427, 12431, 12434, 12447, 12452, 12457, 12463, 12470, 12473, 12482, 12464, 12466, 12471, 12476, 12479, 12491, 12503, 12509, 12513, 12516, 12514, 12532, 12539, 12544, 12557, 12562, 12567, 12576, 12583, 12588, 12591, 12606, 12612, 12622, 12628, 12510, 12514, 12519, 12526, 12527, 12533, 12540, 12545, 12558, 12563, 12568, 12577, 12580, 12584, 12589, 12598, 12607, 12619, 12623, 12629, 12633, 12642, 12645, 12650, 12656, 12668, 12674, 12676, 12697, 12707, 12722, 12734, 12741, 12759, 12773, 12779, 12783, 12802, 12806, 12810, 12819, 12829, 12634, 12646, 12651, 12657, 12659, 12669, 12698, 12708, 12711, 12723, 12707, 12727, 12735, 12742, 12774, 12780, 12784, 12803, 12807, 12811, 12820, 12830, 12847, 12852, 12859, 12864, 12874, 12905, 12915, 12925, 12930, 12934, 12940, 12944, 12946, 12955, 12848, 12853, 12856, 12860, 12865, 12875, 12897, 12906, 12916, 12922, 12926, 12931, 12935, 12941, 12930, 12947, 12952, 12956, 12963, 12979, 12964, 22980, 12984, 13003, 12985, 12988, 12990, 12994, 13004, 13007, 13011, 13015, 13027, 13046, 13055, 13059, 13080, 13094, 13098, 13112, 13120, 13134, 13140, 13150, 13154, 13161, 13187, 13008, 13012, 13016, 13028, 13047, 13056, 13060, 13081, 13095, 13099, 13103, 13106, 13113, 13116, 13135, 13136, 13141, 13151, 13155, 13162, 13188, 13193, 13202, 13194, 13203, 13205, 13209, 13215, 13218, 13236, 13252, 13260, 13271, 13283, 13210, 13216, 13219, 13221, 13223, 13230, 13238, 13243, 13253, 13261, 13272, 13278, 13284, 13643, 13644, 13651, 13657, 13662, 13663, 13666, 13679, 13667, 13680, 13699, 13711, 13730, 13737, 13742, 13700, 13712, 13731, 13738, 13743, 13747, 13756, 13760, 13781, 13793, 13801, 13810, 13830, 13748, 13750, 13757, 13761, 13770, 13771, 13782, 13787, 13794, 13799, 13811, 13825, 13827, 13831, 13834, 13839, 13851, 13859, 13863, 13867, 13873, 13877, 13835, 13840, 13842, 13848, 13852, 13860, 13864, 13868, 13874, 13878, 13885, 13886, 13891, 13896, 13901, 13918, 13927, 13933, 13939, 13951, 13886, 13888, 13892, 13897, 13899, 13901, 13919, 13934, 13940, 13952, 13955, 13973, 13979, 13983, 13997, 13984, 13998, 14006, 14011, 14019, 14022, 14031, 14047, 14053, 14061, 14075, 14111, 14116, 14124, 14149, 14007, 14012, 14016, 14023, 14032, 14048, 14054, 14062, 14076, 14112, 14117, 14119, 14125, 14128, 14129, 14131, 14146, 14150, 14153, 14159, 14163, 14168, 14173, 14177, 14154, 14160, 14164, 14169, 14174, 14178, 14181, 14206, 14213, 14219, 14237, 14248, 14252, 14258, 14264, 14271, 14275, 14279, 14295, 14308, 14311, 14314, 14318, 14332, 14335, 14339, 14343, 14207, 14209, 14214, 14220, 14222, 14232, 14234, 14238, 14249, 14253, 14259, 14265, 14272, 14276, 14280, 14288, 14296, 14309, 14315, 14319, 14321, 14326, 14333, 14336, 14362, 14370, 14377, 14371, and SEQ ID NO: 14378.

33. The method of claim 31, wherein at least one such hybridizing nucleic acid molecule or peptide nucleic acid molecule is bound to a solid phase.

34. The method of claim 31, wherein a plurality of such hybridizing nucleic acid molecules or peptide nucleic acid molecules are bound to a solid phase in the form of a nucleic acid or peptide nucleic acid array selected from the array group consisting of linear or substantially so, hexagonal or substantially so, rectangular or substantially so, and combinations thereof.

35. The method of claim 31, further comprising extending at least one such hybridized nucleic acid molecule by at least one nucleotide base.

36. The method of claim 21, wherein determining in e), comprises sequencing of the amplificate.

37. The method of claim 21, wherein contacting or amplifying in c), comprises use of methylation-specific primers.

38. The method of claim 37 wherein the sequence of said methylation-specific primers is selected from the group consisting of SEQ ID NOS:2754, 2757, 2759, 2767, 2768, 2772, 2776, 2779, 2784, 2785, 2786, 2789, 2791, 2792, 2794, 2797, 2798, 2801, 2805, 2806, 2809, 2811, 2815, 2817, 2824, 2830, 2832, 2833, 2834, 2838, 2840, 2843, 2846, 2850, 2851, 2853, 2855, 2859, 2866, 2867, 2870, 2871, 2876, 2878, 2881, 2885, 2886, 2892, 2893, 2895, 2896, 2898, 2904, 2912, 2915, 2917, 2919, 2922, 2923, 2929, 2931, 2939, 2941, 2944, 2946, 2948, 2950, 2955, 2956, 2957, 2960, 2962, 2965, 2966, 2967, 2968, 2969, 2971, 2975, 2976, 2977, 2978, 2979, 2980, 2981, 2984, 2988, 2989, 2990, 2992, 2994, 2997, 2999, 3001, 3002, 3004, 3006, 3007, 3008, 3010, 3013, 3014, 3016, 3017, 3018, 3020, 3022, 3025, 2752, 2755, 2760, 2762, 2763, 2764, 2765, 2769, 2771, 2773, 2775, 2777, 2780, 2781, 2782, 2783, 2787, 2788, 2790, 2793, 2795, 2796, 2800, 2802, 2803, 2804, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2821, 2823, 2825, 2827, 2828, 2829, 2831, 2835, 2836, 2837, 2839, 2841, 2842, 2844, 2845, 2847, 2849, 2852, 2854, 2856, 2858, 2860, 2861, 2862, 2863, 2864, 2865, 2868, 2869, 2872, 2873, 2874, 2875, 2877, 2879, 2880, 2882, 2883, 2884, 2887, 2888, 2889, 2890, 2891, 2894, 2897, 2899, 2901, 2902, 2903, 2905, 2907, 2909, 2911, 2914, 2916, 2918, 2920, 2924, 2926, 2927, 2928, 2930, 2932, 2933, 2934, 2935, 2936, 2937, 2938, 2942, 2945, 2947, 2949, 2951, 2953, 2954, 2958, 2959, 2961, 2963, 2970, 2972, 2973, 2974, 2982, 2985, 2987, 2991, 2993, 2995, 2996, 2998, 3000, 3003, 3005, 3011, 3019, 3021, 3023, 3026, 3027, 3028, 3032, 3033, 3036, 3037, 3038, 3039, 3041, 3042, 3043, 3044, 3047, 3048, 3049, 3052, 3055, 3059, 3061, 3064, 3065, 3068, 3069, 3071, 3072, 3075, 3076, 3080, 3083, 3084, 3085, 3086, 3091, 3093, 3096, 3097, 3100, 3104, 3109, 3110, 3113, 3115, 3117, 3118, 3123, 3126, 3127, 3130, 3134, 3135, 3136, 3138, 3139, 3144, 3146, 3147, 3149, 3150, 3155, 3029, 3031, 3034, 3040, 3045, 3050, 3051, 3053, 3054, 3056, 3057, 3060, 3063, 3066, 3073, 3078, 3081, 3088, 3089, 3090, 3092, 3094, 3098, 3101, 3103, 3105, 3107, 3108, 3111, 3114, 3116, 3119, 3121, 3122, 3124, 3128, 3131, 3133, 3137, 3140, 3142, 3145, 3148, 3151, 3152, 3153, 3157, 3159, 3165, 3166, 3167, 3170, 3171, 3172, 3174, 3175, 3176, 3179, 3180, 3181, 3184, 3185, 3186, 3192, 3194, 3198, 3201, 3202, 3203, 3204, 3206, 3209, 3212, 3213, 3215, 3216, 3217, 3218, 3221, 3224, 3226, 3228, 3229, 3230, 3232, 3233, 3234, 3235, 3237, 3238, 3239, 3245, 3247, 3248, 3249, 3160, 3162, 3163, 3164, 3168, 3169, 3173, 3178, 3182, 3183, 3187, 3189, 3190, 3195, 3196, 3197, 3199, 3205, 3207, 3210, 3214, 3219, 3222, 3223, 3225, 3227, 3236, 3240, 3242, 3243, 3244, 3246, 3250, 3252, 3256, 3261, 3264, 3268, 3269, 3270, 3273, 3275, 3279, 3280, 3281, 3282, 3283, 3284, 3285, 3286, 3290, 3292, 3295, 3297, 3301, 3304, 3305, 3306, 3307, 3308, 3310, 3311, 3312, 3315, 3319, 3320, 3324, 3327, 3331, 3333, 3334, 3339, 3348, 3351, 3354, 3358, 3360, 3364, 3367, 3368, 3374, 3376, 3253, 3255, 3257, 3259, 3260, 3262, 3265, 3266, 3267, 3271, 3274, 3276, 3278, 3287, 3289, 3291, 3293, 3298, 3300, 3302, 3309, 3313, 3314, 3316, 3318, 3321, 3322, 3325, 3328, 3330, 3332, 3335, 3337, 3338, 3340, 3342, 3343, 3344, 3345, 3346, 3347, 3349, 3350, 3352, 3353, 3355, 3356, 3357, 3359, 3361, 3363, 3365, 3369, 3371, 3372, 3373, 3377, 3380, 3383, 3386, 3388, 3389, 3390, 3391, 3392, 3395, 3396, 3400, 3401, 3403, 3406, 3408, 3413, 3414, 3417, 3420, 3423, 3428, 3432, 3433, 3434, 3436, 3439, 3440, 3442, 3443, 3445, 3447, 3453, 3455, 3458, 3463, 3466, 3469, 3470, 3471, 3472, 3473, 3474, 3475, 3477, 3478, 3480, 3481, 3483, 3484, 3487, 3490, 3494, 3495, 3496, 3497, 3499, 3500, 3504, 3505, 3508, 3512, 3514, 3515, 3516, 3521, 3525, 3529, 3533, 3534, 3537, 3538, 3540, 3541, 3542, 3543, 3544, 3547, 3548, 3553, 3557, 3558, 3559, 3560, 3562, 3563, 3566, 3571, 3574, 357S, 3577, 3580, 3583, 3584, 3585, 3586, 3592, 3594, 3595, 3597, 3598, 3599, 3601, 3603, 3604, 3607, 3608, 3612, 3619, 3621, 3622, 3626, 3631, 3632, 3637, 3638, 3639, 3640, 3642, 3643, 3644, 3646, 3647, 3649, 3650, 3652, 3656, 3657, 3660, 3663, 3668, 3670, 3673, 3676, 3677, 3678, 3683, 3688, 3690, 3694, 3697, 3700, 3702, 3703, 3704, 3708, 3404, 3409, 3411, 3415, 3418, 3419, 3421, 3424, 3426, 3427, 3429, 3431, 3435, 3437, 3438, 3441, 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3459, 3461, 3462, 3464, 3467, 3476, 3479, 3482, 3485, 3488, 3489, 3491, 3492, 3493, 3501, 3503, 3506, 3509, 3510, 3511, 3513, 3517, 3518, 3519, 3520, 3522, 3524, 3526, 3527, 3528, 3530, 3531, 3535, 3536, 3545, 3549, 3551, 3552, 3554, 3555, 3556, 3561, 3564, 3565, 3568, 3569, 3570, 3573, 3576, 3578, 3581, 3587, 3588, 3589, 3590, 3591, 3593, 3596, 3600, 3602, 3605, 3606, 3609, 3611, 3613, 3614, 3615, 3616, 3617, 3618, 3623, 3624, 3625, 3627, 3629, 3630, 3633, 3634, 3635, 3636, 3641, 3645, 3651, 3653, 3654, 3655, 3658, 3661, 3662, 3665, 3666, 3667, 3669, 3671, 3674, 3679, 3681, 3684, 3686, 3689, 3691, 3692, 3693, 3695, 3696, 3698, 3701, 3705, 3706, 3707, 3709, 3710, 3714, 3715, 3717, 3718, 3722, 3723, 3729, 3730, 3732, 3735, 3739, 3740, 3741, 3743, 3744, 3745, 3746, 3749, 3753, 3754, 3755, 3756, 3711, 3713, 3719, 3721, 3724, 3725, 3726, 3727, 3728, 3731, 3733, 3736, 3737, 3738, 3742, 3747, 3748, 3750, 3752, 3757, 3758, 3759, 3760, 3761, 3764, 3767, 3771, 3773, 3775, 3776, 3777, 3781, 3785, 3786, 3787, 3790, 3791, 3793, 3796, 3797, 3798, 3799, 3805, 3809, 3814, 3817, 3818, 3822, 3823, 3828, 3833, 3836, 3844, 3847, 3850, 3851, 3853, 3856, 3857, 3862, 3873, 3876, 3877, 3880, 3885, 3887, 3889, 3890, 3892, 3893, 3895, 3896, 3899, 3902, 3903, 3905, 3906, 3907, 3908, 3916, 3923, 3926, 3927, 3930, 3935, 3936, 3938, 3939, 3940, 3944, 3945, 3949, 3950, 3951, 3954, 3955, 3957, 3960, 3965, 3970, 3971, 3978, 3979, 3982, 3983, 3984, 3985, 3762, 3765, 3768, 3770, 3772, 3774, 3778, 3779, 3780, 3782, 3784, 3788, 3792, 3794, 3800, 3801, 3802, 3803, 3804, 3806, 3807, 3808, 3810, 3812, 3813, 3815, 3819, 3820, 3821, 3824, 3826, 3827, 3829, 3831, 3832, 3834, 3837, 3838, 3839, 3840, 3842, 3845, 3848, 3852, 3854, 3858, 3860, 3861, 3863, 3864, 3865, 3866, 3867, 3868, 3869, 3870, 3871, 3872, 3874, 3875, 3878, 3881, 3883, 3884, 3886, 3888, 3891, 3894, 3897, 3898, 3900, 3901, 3904, 3909, 3911, 3914, 3915, 3917, 3919, 3920, 3921, 3922, 3924, 3928, 3931, 3933, 3934, 3937, 3941, 3942, 3943, 3947, 3948, 3952, 3958, 3959, 3961, 3962, 3963, 3964, 3966, 3968, 3972, 3974, 3975, 3976, 3980, 3981, 3986, 3987, 3990, 3993, 3994, 3997, 4000, 4003, 4004, 4006, 4012, 4015, 4017, 4020, 4024, 4027, 4029, 4031, 4032, 4033, 4037, 4038, 4040, 4042, 4047, 4048, 4050, 4051, 4052, 4054, 4055, 4058, 4063, 4066, 4069, 4070, 4072, 4073, 4076, 4078, 4079, 4082, 4083, 4084, 4085, 4086, 4090, 4093, 4094, 4095, 4096, 4099, 4100, 4104, 4106, 4113, 4116, 4119, 4120, 4124, 4127, 4130, 4134, 4135, 4136, 4138, 4142, 4145, 4146, 4149, 4150, 4152, 4153, 4159, 4160, 4161, 4163, 4168, 4169, 4171, 4173, 4176, 4180, 4181, 4185, 4189, 4191, 4192, 4194, 4197, 4198, 4199, 4201, 4206, 4207, 4208, 4213, 4219, 4220, 4223, 4224, 4225, 4228, 4231, 4232, 4233, 4237, 4238, 4242, 4243, 4246, 4247, 4251, 4254, 4255, 4256, 4258, 3988, 3991, 3995, 3998, 4001, 4005, 4007, 4009, 4010, 4011, 4013, 4016, 4018, 4019, 4021, 4022, 4023, 4025, 4028, 4034, 4035, 4039, 4043, 4045, 4046, 4049, 4056, 4059, 4061, 4064, 4065, 4067, 4068, 4071, 4074, 4075, 4077, 4080, 4087, 4088, 4089, 4092, 4098, 4101, 4102, 4105, 4108, 4109, 4110, 4111, 4112, 4114, 4115, 4117, 4121, 4122, 4123, 4125, 4128, 4129, 4131, 4132, 4133, 4137, 4139, 4141, 4144, 4148, 4151, 4154, 4156, 4157, 4162, 4165, 4166, 4167, 4170, 4172, 4174, 4177, 4179, 4182, 4184, 4186, 4188, 4190, 4195, 4196, 4202, 4204, 4205, 4209, 4211, 4214, 4216, 4217, 4218, 4221, 4226, 4229, 4234, 4236, 4239, 4241, 4244, 4245, 4248, 4249, 4252, 4257, 4259, 4260, 4261, 4262, 4266, 4267, 4268, 4271, 4272, 4275, 4276, 4279, 4281, 4282, 4284, 4285, 4287, 4289, 4290, 4292, 4295, 4297, 4299, 4301, 4306, 4310, 4316, 4317, 4318, 4321, 4323, 4325, 4328, 4334, 4335, 4337, 4341, 4342, 4343, 4344, 4348, 4350, 4351, 4352, 4354, 4357, 4358, 4359, 4364, 4365, 4366, 4370, 4371, 4372, 4373, 4376, 4378, 4381, 4383, 4384, 4386, 4388, 4396, 4397, 4399, 4400, 4403, 4405, 4407, 4409, 4412, 4415, 4416, 4417, 4424, 4426, 4429, 4433, 4435, 4437, 4442, 4443, 4447, 4450,4451, 4452, 4455, 4457, 4460, 4461, 4462, 4465, 4466, 4469, 4470, 4474, 4478, 4481, 4484, 4488, 4491, 4494, 4495, 4497, 4498, 4504, 4506, 4509, 4510, 4511, 4514, 4516, 4518, 4520, 4521, 4523, 4525, 4528, 4530, 4533, 4534, 4535, 4538, 4540, 4542, 4545, 4547, 4548, 4553, 4554, 4555, 4556, 4557, 4562, 4564, 4567, 4568, 4569, 4579, 4580, 4582, 4584, 4587, 4589, 4593, 4596, 4597, 4598, 4600, 4601, 4602, 4605, 4606, 4607, 4609, 4610, 4613, 4614, 4616, 4618, 4621, 4624, 4626, 4627, 4628, 4631, 4632, 4636, 4639, 4641, 4644, 4645, 4648, 4263, 4265, 4269, 4270, 4273, 4274, 4277, 4280, 4283, 4286, 4288, 4291, 4293, 4296, 4298, 4300, 4302, 4303, 4304, 4305, 4307, 4308, 4309, 4311, 4313, 4315, 4319, 4322, 4324, 4326, 4327, 4330, 4331, 4332, 4333, 4336, 4338, 4340, 4345, 4347, 4349, 4353, 4355, 4360, 4361, 4362, 4367, 4368, 4369, 4374, 4375, 4377, 4379, 4382, 4385, 4387, 4389, 4390, 4391, 4392, 4393, 4394, 4395, 4398, 4401, 4406, 4408, 4410, 4411, 4413, 4418, 4420, 4422, 4423, 4425, 4427, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4441, 4444, 4446, 4448, 4453, 4454, 4456, 4458, 4463, 4464, 4467, 4471, 4472, 4473, 4475, 4476, 4477, 4479, 4480, 4482, 4485, 4486, 4487, 4489, 4490, 4492, 4496, 4499, 4501, 4502, 4503, 4505, 4507, 4508, 4512, 4515, 4517, 4519, 4522, 4524, 4529, 4531, 4536, 4537, 4539, 4541, 4543, 4546, 4549, 4551, 4558, 4559, 4560, 4561, 4563, 4565, 4570, 4571, 4572, 4573, 4574, 4575, 4576, 4578, 4581, 4583, 4585, 4586, 4588, 4590, 4592, 4595, 4599, 4603, 4611, 4612, 4615, 4617, 4619, 4620, 4622, 4630, 4633, 4634, 4635, 4638, 4640, 4642, 4643, 4646, 4647, 4649, 4652, 4655, 4659, 4661, 4663, 4664, 4665, 4668, 4671, 4674, 4675, 4676, 4678, 4680, 4683, 4686, 4690, 4696, 4700, 4703, 4704, 4706, 4709, 4711, 4714, 4715, 4717, 4718, 4719, 4720, 4721, 4726, 4727, 4730, 4732, 4738, 4742, 4745, 4749, 4750, 4753, 4755, 4759, 4763, 4768, 4769, 4772, 4773, 4776, 4778, 4779, 4782, 4784, 4789, 4790, 4794, 4797, 4801, 4805, 4807, 4813, 4814, 4819, 4821, 4822, 4827, 4829, 4833, 4834, 4835, 4837, 4838, 4841, 4842, 4843, 4844, 4847, 4849, 4850, 4852, 4853, 4859, 4860, 4861, 4865, 4867, 4868, 4869, 4870, 4873, 4876, 4877, 4878, 4879, 4883, 4885, 4889, 4891, 4892, 4894, 4895, 4897, 4898, 4903, 4906, 4911, 4912, 4918, 4919, 4920, 4924, 4927, 4929, 4932, 4934, 4941, 4942, 4945, 4948, 4949, 4950, 4650, 4653, 4656, 4658, 4660, 4662, 4666, 4667, 4669, 4670, 4672, 4677, 4681, 4684, 4685, 4687, 4688, 4689, 4691, 4693, 4694, 4695, 4697, 4699, 4701, 4702, 4705, 4707, 4708, 4716, 4722, 4724, 4728, 4731, 4733, 4735, 4736, 4737, 4739, 4741, 4744, 4746, 4748, 4751, 4754, 4756, 4758, 4760, 4761, 4764, 4766, 4767, 4770, 4771, 4774, 4777, 4780, 4783, 4785, 4786, 4787, 4788, 4791, 4792, 4793, 4795, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4811, 4812, 4815, 4816, 4817, 4818, 4820, 4823, 4824, 4825, 4828, 4830, 4832, 4836, 4839, 4840, 4845, 4846, 4848, 4851, 4854, 4855, 4856, 4857, 4858, 4862, 4864, 4871, 4872, 4874, 4875, 4881, 4882, 4884, 4886, 4887, 4890, 4893, 4896, 4899, 4900, 4901, 4902, 4904, 4905, 4907, 4908, 4909, 4910, 4913, 4915, 4917, 4921, 4922, 4923, 4925, 4926, 4928, 4930, 4935, 4936, 4937, 4938, 4940, 4943, 4944, 4946, 4947, 4951, 4952, 4953, 4954, 4956, 4957, 4960, 4963, 4967, 4970, 4971, 4972, 4976, 4977, 4985, 4986, 4987, 4989, 4991, 4992, 4997, 4999, 5002, 5003, 5004, 5006, 5010, 5013, 5014, 5015, 5017, 5018, 5019, 5020, 5021, 5024, 5025, 5027, 5031, 5032, 5033, 5037, 5040, 5041, 5042, 5043, 4958, 4961, 4964, 4966, 4968, 4969, 4973, 4974, 4975, 4978, 4979, 4980, 4981, 4982, 4983, 4984, 4988, 4990, 4993, 4995, 4996, 4998, 5000, 5005, 5007, 5009, 5011, 5016, 5022, 5026, 5028, 5030, 5034, 5036, 5038, 5039, 5044, 5047, 5049, 5050, 5052, 5054, 5055, 5057, 5060, 5061, 5064, 5045, 5048, 5051, 5053, 5056, 5058, 5062, 5065, 5066, 5069, 5073, 5077, 5080, 5083, 5087, 5093, 5096, 5099, 5100, 5103, 5104, 5106, 5111, 5116, 5119, 5120, 5125, 5128, 5132, 5134, 5135, 5137, 5139, 5140, 5142, 5144, 5148, 5149, 5150, 5155, 5157, 5158, 5160, 5166, 5168, 5170, 5171, 5173, 5176, 5177, 5179, 5184, 5187, 5188, 5190, 5193, 5195, 5198, 5201, 5204, 5208, 5211, 5215, 5216, 5217, 5220, 5221, 5222, 5224, 5226, 5229, 5230, 5231, 5232, 5234, 5237, 5242, 5244, 5245, 5246, 5247, 5249, 5250, 5252, 5254, 5255, 5256, 5261, 5262, 5264, 5265, 5273, 5274, 5276, 5278, 5279, 5281, 5284, 5285, 5286, 5287, 5288, 5289, 5292, 5296, 5300, 5303, 5304, 5307, 5308, 5309, 5313, 5315, 5317, 5318, 5322, 5323, 5326, 5329, 5330, 5333, 5336, 5337, 5341, 5343, 5348, 5349, 5352, 5354, 5355, 5358, 5359, 5361, 5362, 5363, 5364, 5365, 5367, 5369, 5370, 5372, 5375, 5377, 5379, 5382, 5385, 5387, 5393, 5394, 5395, 5398, 5400, 5404, 5407, 5408, 5409, 5412, 5413, 5414, 5416, 5418, 5421, 5424, 5426, 5428, 5431, 5432, 5433, 5434, 5435, 5437, 5440, 5441, 5443, 5448, 5450, 5451, 5454, 5455, 5458, 5460, 5461, 5464, 5468, $470, 5471, 5474, 5475, 5477, 5482, 5484, 5485, 5487, 5490, 5491, 5492, 5494, 5496, 5498, 5499, 5500, 5501, 5502, 5503, 5504, 5506, 5509, 5510, 5512, 5516, 5517, 5518, 5524, 5525, 5526, 5528, 5531, 5533, 5534, 5535, 5536, 5537, 5540, 5542, 5544, 5545, 5546, 5549, 5550, 5552, 5553, 5559, 5561, 5566, 5569, 5572, 5573, 5575, 5577, 5578, 5579, 5580, 5581, 5582, 5588, 5593, 5595, 5596, 5598, 5600, 5601, 5603, 5604, 5605, 5608, 5614, 5615, 5616, 5619, 5622, 5624, 5625, 5628, 5629, 5633, 5634, 5637, 5638, 5639, 5643, 5644, 5645, 5647, 5648, 5649, 5650, 5654, 5662, 5664, 5067, 5070, 5072, 5074, 5075, 5076, 5078, 5081, 5084, 5086, 5088, 5090, 5091, 5094, 5097, 5101, 5105, 5107, 5109, 5110, 5112, 5114, 5115, 5117, 5121, 5123, 5124, 5126, 5129, 5131, 5136, 5143, 5145, 5147, 5151, 5153, 5156, 5159, 5161, 5162, 5163, 5164, 5165, 5167, 5169, 5172, 5174, 5175, 5180, 5181, 5182, 5183, 5185, 5186, 5189, 5191, 5194, 5196, 5199, 5200, 5202, 5203, 5205, 5207, 5209, 5210,5212, 5214, 5218, 5219, 5223, 5225, 5227, 5233, 5135, 5238, 5239, 5240, 5241, 5248, 5251, 5253, 5257, 5259, 5260, 5263, 5266, 5268, 5269, 5270, 5271, 5272, 5280, 5282, 5290, 5291, 5293, 5295, 5297, 5299, 5301, 5306, 5310, 5311, 5312, 5314, 5316, 5319, 5321, 5324, 5327, 5331, 5332, 5334, 5338, 5339, 5340, 5342, 5344, 5346, 5347, 5351, 5353, 5356, 5360, 5366, 5368, 5371, 5373, 5376, 5378, 5380, 5383, 5388, 5389, 5391, 5392, 5396, 5399, 5401, 5403, 5405, 5410, 5415, 5417, 5419, 5420, 5422, 5425, 5427, 5429, 5436, 5438, 5442, 5444, 5445, 5446, 5447, 5449, 5452, 5456, 5457, 5459, 5462, 5465, 5466, 5467, 5469, 5472, 5478, 5480, 5481, 5486, 5488, 5493, 5495, 5497, 5505, 5507, 5508, 5511, 5513, 5515, 5519, 5521, 5522, 5527, 5529, 5532, 5538, 5539, 5541, 5543, 5548, 5551, 5554, 5555, 5556, 5557, 5558, 5560, 5562, 5563, 5564, 5565, 5567, 5568, 5570, 5571, 5574, 5576, 5583, 5585, 5586, 5587, 5589, 5591, 5592, 5594, 5597, 5599, 5602, 5606, 5609, 5611, 5612, 5618, 5620, 5623, 5626, 5627, 5630, 5632, 5635, 5640, 5642, 5646, 5651, 5652, 5656, 5657, 5659, 5660, 5661, 5663, 5665, 5667, 5670, 5672, 5673, 5676, 5678, 5679, 5681, 5682, 5683, 5686, 5687, 5688, 5690, 5694, 5697, 5698, 5699, 5700, 5701, 5704, 5708, 5709, 5711, 5713, 5714, 5717, 5721, 5723, 5724, 5727, 5728, 5733, 5734, 5735, 5736, 5739, 5740, 5741, 5742, 5743, 5668, 5671, 5674, 5677, 5680, 5684, 5689, 5691, 5693, 5696, 5702, 5705, 5707, 5710, 5712, 5715, 5718, 5720, 5722, 5725, 5729, 5730, 5731, 5732, 5737, 5744, 5747, 5750, 5753, 5759, 5762, 5763, 5770, 5775, 5777, 5778, 5780, 5782, 5785, 5787, 5791, 5792, 5793, 5794, 5797, 5801, 5803, 5808, 5810, 5812, 5814, 5816, 5817, 5824, 5832, 5833, 5834, 5835, 5838, 5840, 5841, 5844, 5849, 5853, 5854, 5857, 5859, 5860, 5862, 5863, 5865, 5868, 5874, 5882, 5883, 5885, 5887, 5894, 5895, 5896, 5897, 5902, 5904, 5906, 5909, 5912, 5915, 5918, 5919, 5920, 5922, 5923, 5926, 5927, 5928, 5930, 5932, 5933, 5934, 5935, 5939, 5940, 5946, 5947, 5948, 5949, 5952, 5954, 5955, 5956, 5958, 5959, 5961, 5962, 5964, 5965, 5968, 5970, 5971, 5972, 5973, 5977, 5978, 5980, 5983, 5986, 5987, 5992, 5993, 5996, 5997, 6000, 6002, 6003, 6004, 6005, 6006, 6008, 6009, 6010, 6011, 6012, 6013, 6017, 6018, 6019, 6020, 6025, 6027, 6030, 6033, 6035, 6036, 6039, 6041, 6042, 6045, 6049, 6050, 6051, 6055, 6059, 6063, 6064, 6065, 6067, 6070, 6072, 6073, 6075, 6077, 6078, 6081, 5745, 5748, 5751, 5754, 5756, 5758, 5760, 5764, 5766, 5767, 5768, 5769, 5771, 5773, 5774, 5776, 5779, 5781, 5783, 5786, 5788, 5789, 5790, 5795, 5796, 5798, 5800, 5802, 5804, 5806, 5807, 5809, 5811, 5813, 5818, 5820, 5821, 5822, 5823, 5825, 5826, 5827, 5828, 5830, 5831, 5836, 5837, 5839, 5842, 5843, 5845, 5846, 5847, 5848, 5850, 5852, 5855, 5856, 5858, 5861, 5864, 5866, 5867, 5870, 5871, 5872, 5873, 5875, 5876, 5877, 5878, 5879, 5880, 5881, 5884, 5886, 5888, 5889, 5890, 5891, 5892, 5893, 5898, 5899, 5900, 5903, 5905, 5907, 5910, 5913, 5916, 5921, 5924, 5929, 5931, 5936, 5937, 5938, 5942, 5943, 5944, 5945, 5950, 5953, 5957, 5360, 5963, 5966, 5969, 5975, 5976, 5981, 5984, 5988, 5990, 5991, 5994, 5998, 5999, 6001, 6007, 6014, 6015, 6016, 6021, 6023, 6024, 6026, 6028, 6031, 6032, 6034, 6037, 6038, 6040, 6043, 6046, 6048, 6053, 6054, 6056, 6058, 6060, 6062, 6066, 6068, 6074, 6076, 6079, 6083, 6084, 6085, 6089, 6090, 6093, 6096, 6098, 6100, 6106, 6110, 6111, 6114, 6118, 6121, 6127, 6130, 6133, 6135, 6137, 6138, 6141, 6143, 6145, 6148, 6150, 6151, 6152, 6153, 6154, 6156, 6159, 6160, 6162, 6163, 6166, 6167, 6168, 6169, 6170, 6171, 6172, 6175, 6177, 6180, 6183, 6187, 6188, 6190, 6193, 6194, 6195, 6196, 6198, 6201, 6202, 6204, 6207, 6211, 6212, 6214, 6215, 6216, 6218, 6219, 6220, 6222, 6225, 6226, 6230, 6235, 6239, 6241, 6242, 6243, 6244, 6245, 6247, 6250, 6252, 6254, 6259, 6260, 6261, 6264, 6265, 6268, 6270, 6273, 6275, 6278, 6280, 6282, 6286, 6287, 6288, 6291, 6293, 6298, 6299, 6300, 6302, 6303, 6305, 6307, 6308, 6312, 6313, 6314, 6315, 6316, 6317, 6318, 6320, 6321, 6323, 6325, 6327, 6328; 6334, 6335, 6337, 6340, 6341, 6344, 6348, 6350, 6353, 6354, 6357, 6360, 6362, 6364, 6368, 6372, 6374, 6377, 6378, 6383, 6386, 6392, 6394, 6398, 6400, 6404, 6405, 6409, 6410, 6411, 6417, 6418, 6424, 6426, 6429, 6431, 6432, 6433, 6435, 6436, 6437, 6438, 6440, 6442, 6445, 6446, 6448, 6449, 6452, 6455, 6457, 6458, 6461, 6462, 6463, 6464, 6465, 6470, 6473, 6475, 6478, 6480, 6481, 6484, 6485, 6486, 6489, 6491, 6492, 6494, 6498, 6502, 6504, 6505, 6507, 6511, 6513, 6514, 6086, 6088, 6091, 6094, 6097, 6099, 6101, 6103, 6105, 6108, 6112, 6115, 6116, 6117, 6119, 6120, 6122, 6123, 6125, 6126,6128,6131,6132,6134,6136,6139,6142,6144,6146,6149,6155,6157,6161, 6164, 6173, 6174, 6176, 6178, 6181, 6182, 6184, 6186, 6189, 6191, 6192, 6197, 6199, 6200, 6205, 6206, 6208, 6210, 6213, 6221, 6223, 6224, 6227, 6229, 6231, 6232, 6233, 6234, 6236, 6237, 6238, 6240, 6246, 6248, 6251, 6253, 6255, 6256, 6257, 6258, 6262, 6266, 6269, 6271, 6272, 6274, 6276, 6277, 6281, 6283, 6284, 6285, 6289, 6292, 6294, 6295, 6296, 6297, 6301, 6304, 6306, 6309, 6310, 6311, 6319, 6322, 6324, 6326, 6329, 6330, 6331, 6333, 6336, 6338, 6342, 6345, 6347, 6349, 6351, 6355, 6356, 6358, 6359, 6361, 6365, 6367, 6369, 6371, 6373, 6375, 6376, 6379, 6381, 6382, 6384, 6387, 6388, 6389, 6390, 6393, 6395, 6397, 6399, 6401, 6402, 6403, 6406, 6407, 6412, 6413, 6414, 6415, 6416, 6419, 6420, 6421, 6422, 6423, 6425, 6427, 6428, 6434, 6441, 6443, 6444, 6447, 6450, 6451, 6453, 6459, 6460, 6466, 6467, 6468, 6469, 6471, 6472, 6474, 6476, 6479, 6482, 6487, 6490, 6493, 6496, 6497, 6499, 6500, 6501, 6503, 6506, 6508, 6510, 6512, 6515, 6518, 6521, 6522, 6523, 6524, 6528, 6532, 6535, 6539, 6549, 6560, 6561, 6564, 6566, 6567, 6570, 6573, 6576, 6577, 6578, 6579, 6583, 6584, 6585, 6586, 6587, 6590, 6591, 6594, 6596, 6597, 6603, 6605, 6608, 6609, 6610, 6611, 6612, 6615, 6625, 6630, 6632, 6633, 6634, 6638, 6639, 6642, 6643, 6644, 6647, 6650, 6655, 6657, 6658, 6659, 6661, 6663, 6664, 6665, 6669, 6671, 6674, 6677, 6678, 6679, 6680, 6681, 6682, 6686, 6687, 6688, 6689, 6690, 6691, 6693, 6695, 6696, 6697, 6699, 6701, 6703, 6704, 6705, 6706, 6707, 6708, 6710, 6711, 6712, 6713, 6717, 6718, 6720, 6721, 6722, 6725, 6727, 6732, 6734, 6735, 6739, 6741, 6745, 6748, 6751, 6755, 6759, 6762, 6764, 6767, 6770, 6772, 6773, 6774, 6777, 6778, 6782, 6785, 6786, 6787, 6790, 6791, 6794, 6795, 6796, 6798, 6800, 6802, 6803, 6806, 6811, 6814, 6815, 6818, 6824, 6829, 6834y 6835, 6842, 6516, 6519, 6525, 6526, 6527, 6529, 6531, 6533, 6536, 6537, 6538, 6540, 6541, 6542, 6543, 6544, 6545, 6546, 6547, 6548, 6550, 6551, 6552, 6553, 6554, 6556, 6558, 6562, 6563, 6565, 6568, 6571, 6572, 6575, 6580, 6582, 6588, 6589, 6592, 6595, 6598, 6599, 6600, 6601, 6602, 6604, 6606, 6607, 6613, 6614, 6617, 6618, 6619, 6620, 6621, 6623, 6624, 6627, 6628, 6629, 6631, 6635, 6640, 6641, 6645, 6646, 6649, 6651, 6652, 6653, 6656, 6660, 6662, 6666, 6668, 6670, 6672, 6675, 6676, 6683, 6685, 6692, 6694, 6698, 6700, 6702, 6709, 6714, 6715, 6716, 6719, 6723, 6726, 6728, 6730, 6731, 6736, 6738, 6740, 6742, 6744, 6746, 6747, 6749, 6752, 6754, 6756, 6757, 6758, 6760, 6761, 6765, 6769, 6775, 6779, 6781, 6783, 6784, 6789, 6792, 6797, 6799, 6801, 6804, 6805, 6807, 6809, 6810, 6812, 6816, 6817, 6819, 6821, 6822, 6825, 6827, 6828, 6830, 6831, 6832, 6833, 6836, 6837, 6838, 6839, 6840, 6841, 6843, 6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6844, 6848, 6850, 6852, 6854, 6857, 6859, 6861, 6862, 6865, 6868, 6870, 6871, 6872, 6874, 6875, 6876, 6880, 6883, 6886, 6887, 6888, 6890, 6891, 6894, 6896, 6897, 6898, 6899, 6900, 6901, 6902, 6904, 6905, 6906, 6910, 6912, 6917, 6920, 6845, 6847, 6849, 6851, 6853, 6855, 6858, 6860, 6863, 6866, 6869, 6873, 6877, 6879, 6881, 6882, 6884, 6889, 6892, 6893, 6895, 6907, 6908, 6909, 6911, 6913, 6915, 6916, 6918, 6921, 6924, 6927, 6928, 6933, 6935, 6937, 6939, 6940, 6943, 6946, 6947, 6948, 6949, 6951, 6953, 6954, 6955, 6959, 6961, 6964, 6965, 6968, 6969, 6972, 6973, 6976, 6979, 6980, 6922, 6925, 6929, 6930, 6931, 6932, 6934, 6936, 6942, 6944, 6945, 6950, 6952, 6956, 6957, 6958, 6960, 6962, 6963, 6966, 6967, 6970, 6971, 6974, 6975, 6977, 6981, 6983, 6986, 6992, 6995, 6998, 7002, 7006, 7013, 7017, 7022, 7024, 7027, 7030, 7032, 7036, 7037, 7040, 7050, 7052, 7055, 7056, 7058, 7059, 7060, 7064, 7067, 7072, 7074, 7076, 7077, 7084, 7085, 7086, 7087, 7088, 7089, 7090, 7091, 7096, 7097, 7100, 7102, 7109, 7110, 7113, 7114, 7115, 7118, 7121, 7123, 7124, 7131, 7133, 7135, 7136, 7138, 7139, 7144, 7144, 7146, 7148, 7149, 7158, 7159, 7160, 7163, 7165, 7166, 7168, 7172, 7175, 7178, 7180, 7181, 7183, 7185, 7186, 7187, 7192, 7194, 7199, 7202, 7203, 7204, 7205, 7207, 7208, 7213, 7214, 7216, 7220, 7221, 7227, 7228, 7230, 7233, 7235, 7237, 7239, 7243, 7245, 7246, 7248, 7249, 7251, 7255, 7256, 7260, 7263, 7264, 7265, 7266, 7268, 7269, 7272, 7276, 7277, 7278, 7279, 7280, 7281, 7283, 7284, 7287, 7291, 7295, 7299, 7302, 7303, 7306, 7309, 7310, 7311, 7314, 7315, 7320, 7321, 7324, 7325, 7329, 7331, 7332, 7334, 7336, 7339, 7340, 7341, 7344, 7350, 7353, 7355, 7358, 7360, 7362, 7372, 7374, 7375, 7378, 7381, 7385, 7387, 7390, 7391, 7392, 7394, 7397, 7401, 7402, 7405, 7410, 7413, 7415, 7416, 7417, 7420, 6984, 6987, 6989, 6990, 6991, 6993, 6996, 6999, 7001, 7003, 7005, 7007, 7009, 7010, 7011, 7012, 7014, 7016, 7018, 7020, 7023, 7025, 7026, 7028, 7029, 7031, 7033, 7034, 7035, 7038, 7039, 7041, 7042, 7043, 7044, 7045, 7046, 7047, 7048, 7049, 7051, 7053, 7054, 7057, 7061, 7062, 7063, 7065, 7066, 7068, 7070, 7071, 7073, 7075, 7078, 7080;
7081, 7082, 7083, 7092, 7093, 7094, 7095, 7098, 7101, 7103, 7105, 7106, 7107, 7108, 7111, 7112, 7116, 7119, 7122, 7125, 7126, 7127, 7128,7129,7130,7132,7134,7137,7141, 7142, 7143, 7147, 7150, 7152, 7154, 7155, 7156, 7157, 7161, 7167, 7170, 7171, 7173, 7174, 7176, 7177, 7179, 7182, 7184, 7188, 7189, 7190, 7191, 7193, 7195, 7196, 7197, 7198, 7200,7206, 7210, 7211, 7212, 7215, 7217, 7218, 7219, 7222, 7223, 7224, 7225, 7226, 7229, 7231, 7232, 7236, 7240, 7241, 7242, 7244, 7247, 7250, 7253, 7254, 7257, 7258, 7259, 7261, 7262, 7267, 7270, 7271, 7273, 7274, 7275, 7282, 7285, 7289, 7290, 7292, 7293, 7294, 7296, 7297, 7298, 7301, 7304, 7307, 7308, 7312, 7316, 7317, 7318, 7319, 7322, 7326, 7328, 7330, 7333, 7335, 7337, 7342, 7345, 7347, 7348, 7349, 7351, 7354, 7356, 7357, 7359, 7361, 7363, 7364, 7365, 7366, 7367, 7368, 7369, 7370, 7371, 7373, 7376, 7379, 7382, 7383, 7384, 7386, 7388, 7389, 7393, 7395, 7398, 7400, 7403, 7404, 7407, 7408, 7409, 7411, 7419, 7421, 7422, 7425, 7427, 7435, 7438, 7439, 7440, 7442, 7444, 7448, 7449, 7456, 7459, 7462, 7463, 7465, 7466, 7467, 7470, 7471, 7474, 7476, 7477, 7480, 7481, 7485, 7486, 7489, 7490, 7493, 7496, 7500, 7503, 7508, 7512, 7518, 7519, 7520, 7522, 7524, 7525, 7527, 7528, 7529, 7532, 7540, 7542, 7543, 7545, 7549, 7552, 7554, 7423, 7426, 7428, 7430, 7431, 7432, 7433, 7434, 7436, 7445, 7446, 7447, 7450, 7451, 7452, 7453, 7454, 7455, 7457, 7460, 7464, 7468, 7472, 7475, 7478, 7479, 7482, 7483, 7484, 7487, 7488, 7492, 7494, 7495, 7497, 7498, 7499, 7501, 7505, 7506, 7507, 7509, 7510, 7511, 7513, 7515, 7516, 7517, 7521, 7523, 7526, 7530, 7533, 7534, 7535, 7536, 7537, 7538, 7539, 7541, 7544, 7546, 7547, 7548, 7550, 7555, 7558, 7559, 7560, 7565, 7566, 7567, 7570, 7571, 7573, 7574, 7575, 7576, 7577, 7578, 7579, 7580, 7581, 7582, 7585, 7586, 7587, 7588, 7589, 7590, 7596, 7597, 7598, 7600, 7603, 7606, 7609, 7610, 7615, 7618, 7620, 7621, 7623, 7627, 7629, 7633, 7635, 7636, 7643, 7647, 7651, 7655, 7661, 7666, 7672, 7674, 7676, 7677, 7682, 7683, 7685, 7687, 7689, 7690, 7691, 7694, 7699, 7701, 7702, 7704, 7707, 7709, 7711, 7712, 7713, 7714, 7716, 77I8, 7720, 7726, 7728, 7729, 7733, 7734, 7735, 7736, 7738, 7740, 7741, 7744, 7746, 7747, 7748, 7749, 7750, 7751, 7752, 7753, 7754, 7755, 7756, 7758, 7556, 7561, 7563, 7568, 7583, 7584, 7591, 7593, 7594, 7595, 7599, 7601, 7604, 7607, 7608, 7611, 7613, 7614, 7616, 7617, 7619, 7622, 7624, 7626, 7628, 7631, 7637, 7638, 7639, 7640, 7641, 7642, 7644, 7645, 7646, 7649, 7650, 7652, 7654, 7656, 7657, 7658, 7659, 7660, 7662, 7663, 7665, 7667, 7669, 7670, 7671, 7673, 7675, 7678, 7679, 7680, 7681, 7684, 7686, 7688, 7692, 7695, 7697, 7698, 7700, 7703, 7705, 7708, 7710, 7715, 7717, 7719, 7721, 7722, 7723, 7724, 7725, 7727, 7730, 7731, 7732, 7737, 7739, 7742, 7743, 7745, 7757, 7759, 7760, 7761, 7764, 7770, 7774, 7775, 7778, 7782, 7786, 7788, 7795, 779?, 7799, 7805, 7807, 7809, 7810, 7811, 7815, 7817, 7819, 7820, 7822, 7823, 7824, 7828, 7832, 7834, 7837, 7839, 7843, 7845, 7851, 7852, 7857, 7860, 7863, 7865, 7868, 7874, 7881, 7885, 7889, 7892, 7894, 7896, 7900, 7902, 7904, 7907, 7909, 7910, 7913, 7917, 7922, 7925, 7926, 7928, 7933, 7934, 7937, 7941, 7945, 7946, 7948, 7950, 7951, 7952, 7953, 7954, 7955, 7956, 7957, 7963, 7964, 7968, 7971, 7972, 7973, 7976, 7979, 7980, 7981, 7982, 7983, 7985, 7986, 7987, 7988, 7991, 7762, 7765, 7767, 7768, 7771, 7773, 7776, 7779, 7781, 7783, 7784, 7785, 7789, 7791, 7792, 7793, 7794, 7796, 7798, 7800, 7802, 7803, 7808, 7812, 7813, 7814, 7816, 7818, 7821, 7825, 7827, 7829, 7830, 7833, 7835, 7836, 7838, 7840, 7841, 7842, 7844, 7846, 7847, 7848, 7849, 7853, 7854, 7855, 7856, 7858, 7861, 7864, 7866, 7869, 7870, 7871, 7872, 7873, 7875, 7877, 7878, 7879, 7880, 7882, 7884, 7886, 7888, 7890, 7897, 7899, 7903, 7905, 7912, 7914, 7916, 7918, 7919, 7920, 7921, 7923, 7929, 7931, 7932, 7936, 7938, 7939, 7940, 7942, 7943, 7944, 7947, 7949, 7958, 7960, 7962, 7965, 7967, 7969, 7970, 7974, 7977, 7989, 7990, 7992, 7995, 7996, 8000, 8003, 8006, 8007, 8010, 8012, 8015, 8016, 8018, 8019, 8026, 8027, 8030, 8034, 8035, 8038, 8039, 8043, 8044, 8046, 8049, 8050, 8052, 8053, 8055, 8056, 8062, 8064, 8066, 8067, 8068, 8069, 8070, 8071, 8074, 8076, 8077, 8078, 8079, 8080, 8081, 7993, 7997, 7999, 8001, 8004, 8005, 8008, 8009, 8011, 8013, 8017, 8020, 8021, 8022, 8023, 8024, 8025, 8028, 8031, 8033, 8036, 8040, 8042, 8047, 8051, 8054, 8057, 8059, 8060, 8061, 8065, 8072, 8073, 8075, 8082, 8083, 8084, 8085, 8087, 8088, 8089, 8090, 8093, 8095, 8098, 8100, 8101, 8102, 8104, 8107, 8110, 8111, 8114, 8115, 8116, 8118, 8122, 8124, 8126, 8127, 8129, 8132, 8134, 8136, 8138, 8142, 8143, 8144, 8146, 8151, 8157, 8160, 8163, 8165, 8168, 8169, 8170, 8173, 8174, 8175, 8176, 8178, 8181, 8185, 8187, 8188, 8189, 8190, 8191, 8193, 8194, 8200, 8203, 8206, 8208, 8209, 8212, 8214, 8216, 8217, 8220, 8222, 8224, 8228, 8230, 8091, 8094, 8096, 8099, 8103, 8105, 8108, 8112,8113,8117,8119,8121,8123,8125,8128,8130,8131,8133,8135,8137,8139, 8145, 8147, 8148, 8149, 8150, 8152, 8153, 8154, 8155, 8156, 8158, 8161, 8164, 8166, 8167, 8171, 8177, 8179, 8180, 8182, 8183, 8184, 8186, 8192, 8195, 8197, 8198, 8199, 8201, 8202, 8204, 8207, 8210, 8213, 8218, 8221, 8223, 8225, 8227, 8229, 8231, 8232, 8235, 8236, 8237, 8238, 8244, 8245, 8247, 8250, 8251, 8253, 8254, 8255, 8256, 8258, 8259, 8260, 8263, 8267, 8269, 8270, 8273, 8274, 8277, 8280, 8281, 8289, 8292, 8293, 8294, 8295, 8296, 8297, 8298, 8301, 8305, 8306, 8310, 8311, 8312, 8315, 8317, 8318, 8322, 8323, 8324, 8327, 8328, 8329, 8330, 8333, 8336, 8339, 8340, 8347, 8349, 8350, 8352, 8353, 8356, 8359, 8360, 8366, 8369, 8370, 8372, 8374, 8376, 8377, 8379, 8381, 8382, 8383, 8233, 8239, 8239, 8242, 8243, 8246, 8248, 8252, 8257, 8261, 8264, 8266, 8268, 8271, 8275, 8278, 8282, 8284, 8285, 8286, 8287, 8288, 8291, 8299, 8302, 8303, 8304, 8307, 8309, 8313, 8314, 8316, 8319, 8321, 8325, 8326, 8331, 8332, 8334, 8335, 8337, 8341, 8342, 8343, 8344, 8345, 8346, 8348, 8351, 8354, 8357, 8361, 8362, 663, 8364, 8365, 8367, 8371, 8373, 8375, 8378, 8384, 8387, 8390, 8391, 8397, 8398, 8401, 8402, 8405, 8406, 8409, 8414, 8418, 8419, 8422, 8425, 8428, 8431, 8432, 8433, 8435, 8437, 8440, 8444, 8449, 8452, 8454, 8455, 8457, 8462, 8464, 8466, 8468, 8469, 8472, 8475, 8476, 8478, 8479, 8481, 8484, 8487, 8488, 8490, 8493, 8496, 8497, 8498, 8501, 8505, 8508, 8511, 8513, 8515, 8517, 8518, 8519, 8521, 8522, 8523, 8526, 8528, 8530, 8531, 8532, 8534, 8536, 8541, 8544, 8547, 8551, 8554, 8556, 8558, 8560, 8562, 8563, 8566, 8567, 8568, 8570, 8571, 8574, 8575, 8576, 8577, 8580, 8581, 8585, 8588, 8591, 8594, 8601, 8602, 8603, 8608, 8609, 8613, 8614, 8617, 8618, 8619, 8620, 8623, 8624, 8628, 8629, 8630, 8633, 8634, 8635, 8636, 8638, 8643, 8645, 8648, 8654, 8657, 8658, 8659, 8660, 8661, 8662, 8666, 8670, 8672, 8674, 8676, 8681, 8683, 8686, 8688, 8689, 8691, 8692, 8693, 8695, 8696, 8700, 8701, 8702, 8703, 8704, 8705, 8709, 8716, 8717, 8719, 8722, 8725, 8727, 8728, 8729, 8732, 8733, 8734, 8735, 8736, 8385, 8388, 8392, 8394, 8395, 8399, 8403, 8407, 8410, 8411, 8412, 8413, 8415, 8416, 8420, 8423, 8424, 8426, 8429, 8434, 8436, 8438, 8442, 8445, 8446, 8447, 8448, 8450, 8451, 8456, 8458, 8460, 8461, 8463, 8465, 8467, 8470, 8473, 8474, 8477, 8480, 8482, 8485, 8486, 8489, 8491, 8492, 8494, 8499, 8500, 8502, 8503, 8504, 8506, 8510, 8512, 8514, 8516, 8520, 8524, 8527, 8529, 8533, 8535, 8537, 8539, 8542, 8545, 8546, 8548, 8550, 8552, 8555, 8557, 8564, 8565, 8569, 8572, 8578, 8582, 8583, 8586, 8587, 8589, 8592, 8595, 8596, 8597, 8598, 8599, 8600, 8604, 8606, 8607, 8610, 8612, 8615, 8616, 8621, 8625, 8627, 8631, 8632, 8637, 8639, 8640, 8641, 8642, 8644, 8646, 8647, 8649, 8650, 8651, 8652, 8653, 8655, 8663, 8665, 8667, 8668, 8669, 8671, 8673, 8675, 8677, 8678, 8679, 8680, 8682, 8684, 8685, 8687, 8690, 8694, 8697, 8698, 8699, 8706, 8707, 8708, 8710, 8711, 8712, 8713, 8714, 8715, 8718, 8720, 8723, 8726, 8730, 8737, 8738, 8741, 8744, 8747, 8750, 8751, 8753, 8754, 8755, 8756, 8759, 8760, 8762, 8763, 8766, 8767, 8768, 8769, 8770, 8772, 8775, 8776, 8777, 8779, 8782, 8783, 8784, 8785, 8786, 8787, 8788, 8789, 8790, 8793, 8794, 8796, 8798, 8799, 8801, 8803, 8804, 8806, 8807, 8809, 8812, 8813, 8815, 8820, 8823, 8826, 8829, 8830, 8832, 8835, 8836, 8837, 8842, 8845, 8846, 8847, 8851, 8853, 8856, 8857, 8859, 8861, 8866, 8739, 8878, 8879, 8880, 8884, 8891, 8893, 8895, 8898, 8900, 8901, 8909, 8912, 8739, 8742, 8745, 8748, 8749, 8752, 8757, 8758, 8761, 8764, 8771, 8773, 8778, 8780, 8791, 8797, 8800, 8802, 8805, 8808, 8810, 8814, 8816, 8818, 8819, 8821, 8824, 8827, 8828, 8831, 8833, 8838, 8840, 8841, 8755, 8843, 8844, 8848, 8850, 8852, 8854, 8855, 8863, 8864, 8865, 8867, 8868, 8869, 8870, 8871, 8872, 8873, 8874, 8876, 8877, 8881, 8882, 8883, 8885, 8887, 8888, 8889, 8890, 8892, 8894, 8896, 8897, 8899, 8902, 8785, 8903, 8904, 8905, 8906, 8907, 8908, 8911, 8913, 8917, 8920, 8923, 8924, 8929, 8931, 8934, 8935, 8936, 8914, 8916, 8918, 8921, 8925, 8927, 8928, 8930, 8932, 8933, 8937, 8980, 8984, 8988, 8989, 8998, 9001, 9002, 9005, 9007, 9008, 9012, 9013, 9016, 9019, 9020, 9022, 9023, 9025, 9028, 9029, 9032, 9033, 9034, 9035, 9037, 9038, 9044, 9046, 9047, 9048, 9049, 9054, 8981, 8983, 8985, 8987, 8990, 8992, 8993, 8994, 8995, 8997, 8999, 9003, 9004, 9006, 9009, 9010, 9011, 9014, 9017, 9018, 9021, 9024, 9026, 9030, 9036, 9039, 9041, 9042, 9043, 9045, 9050, 9051, 9052, 9053, 9055, 9058, 9060, 9063, 9066, 9067, 9068, 9069, 9070, 9071, 9074, 9075, 9077, 9078, 9079, 9080, 9082, 9084, 9088, 9089, 9090, 9099, 9143, 9104, 9105, 9107, 9111, 9056, 9061, 9064, 9072, 9081, 9083, 9085, 9086, 9087, 9091, 9092, 9093, 9094, 9095, 9096, 9097, 9098, 9100, 9102, 9106, 9108, 9109, 9110, 9112, 9113, 9116, 9118, 9125, 9126, 9128, 9129, 9130, 9136, 9141, 9143, 9148, 9150, 9153, 9157, 9158, 9159, 9163, 9164, 9165, 9167, 9168, 9171, 9173, 9177, 9180, 9181, 9182, 9183, 9185, 9187, 9188, 9189, 9191, 9192, 9193, 9194, 9197, 9198, 9200, 9206, 9207, 9208, 9209, 9211, 9216, 9218, 9219, 9220, 9221, 9222, 9223, 9226, 9228, 9229, 9230, 9231, 9232, 9233, 9234, 9237, 9238, 9240, 9243, 9246, 9248, 9253, 9256, 9257, 9260, 9263, 9264, 9266, 9269,9271, 9279, 9280, 9281, 9282, 9283, 9284, 9290, 9114, 9119, 9121, 9122, 9123, 9124,9127, 9131, 9133, 9134,9135, 9137, 9138, 9139,9140, 9142, 9144, 9146, 9147, 9149, 9151, 9152, 9154, 9155, 9156, 9160, 9162, 9166, 9169, 9172, 9174, 9175, 9176, 9178, 9184, 9186, 9190, 9195, 9199, 9201, 9202, 9203, 9204, 9205, 9212, 9214, 9215, 9217, 9224, 9227, 9235, 9239, 9241, 9244, 9247, 9249, 9251, 9252, 9254, 9258, 9261, 9265, 9267, 9270, 9273, 9274, 9275, 9276, 9277, 9278, 9285, 9286, 9287, 9288, 9289, 9291, 9292, 9295, 9297, 9300, 9302, 9303, 9304, 9307, 9308, 9310, 9311, 9313, 9319, 9321, 9323, 9324, 9328, 9333, 9334, 9337, 9338, 9339, 9342, 9344, 9348, 9351, 9352, 9354, 9355, 9357, 9360, 9367, 9371, 9374, 9377, 9379, 9383, 9384, 9385, 9388, 9389, 9390, 9393, 9394, 9398, 9401, 9402, 9406, 9408, 9404, 9410, 9413, 9415, 9416, 9417, 9418, 9419, 9421, 9422, 9425, 9429, 9433, 9434, 9435, 9436, 9437, 9439, 9440, 9446.
9452, 9453, 9454, 9455, 9457, 9458, 9459, 9462, 9466, 9467, 9468, 9470, 9474, 9479, 9482, 9487, 9488, 9489, 9492, 9495, 9497, 9499, 9500, 9504, 9505, 9508, 9513, 9514, 9519; 9522, 9523, 9524, 9526, 9528, 9532, 9533, 9534, 9535, 9537, 9538, 9541, 9542, 9543, 9545, 9546, 9548, 9293, 9296, 9298, 9301, 9305, 9309, 9312, 9314, 9316, 9317, 9318, 9320, 9322, 9325, 9326, 9327, 9329, 9331, 9332, 9335, 9336, 9340, 9345, 9347, 9349, 9353, 9356, 9358, 9361, 9363, 9364, 9365, 9368, 9370, 9372, 9375, 9376, 9378, 9380, 9382, 9386, 9391, 9395, 9397, 9399, 9400, 9403, 9405, 9407, 9411, 9412, 9414, 9420, 9423, 9424, 9426, 9428, 9430, 9431, 9432, 9438, 9441, 9443, 9444, 9445, 9447, 9448, 9449, 9450, 9451, 9456, 9460, 9461, 9464, 9465, 9469, 9471, 9473, 9475, 9477, 9478, 9480, 9483, 9485, 9490, 9493, 9494, 9496, 9498, 9501, 9502, 9503, 9506, 9509, 9511, 9512, 9515, 9516, 9517, 9518, 9520, 9521, 9525, 9527, 9529, 9530, 9536, 9539, 9544, 9547, 9549, 9550, 9551, 9555, 9556, 9557, 9559, 9560, 9563, 9564, 9565, 9566, 9569, 9570, 9573, 9577, 9578, 9579, 9580, 9585, 9586, 9587, 9588, 9591, 9593, 9596, 9552, 9554, 9558, 9561, 9567, 9571, 9574, 9576, 9581, 9583, 9584, 9589, 9592, 9594, 9595, 9598, 9602, 9604, 9605, 9608, 9612, 9613, 9614, 9617, 9618, 9621, 9622, 9625, 9626, 9627, 9632, 9633, 9638, 9640, 9643, 9644, 9645, 9646, 9651, 9654, 9656, 9657, 9658, 9661, 9662, 9665, 9666, 9667, 9668, 9672, 9673, 9675, 9676, 9677, 9680, 9683, 9686, 9688, 9691, 9694, 9698, 9699, 9702, 9705, 9707, 9710, 9711, 9715, 9719, 9720, 9722, 9723, 9726, 9729, 9732, 9733, 9735, 9737, 9738, 9741, 9744, 9745, 9746, 9747, 9748, 9749, 9750, 9754, 9755, 9756, 9758, 9759, 9768, 9771, 9772, 9776, 9777, 9781, 9782, 9784, 9787, 9789, 9790, 9792, 9796, 9797, 9800, 9805, 9806, 9812, 9815, 9818, 9821, 9823, 9825, 9827, 9831, 9832, 9835, 9837, 9839, 9841, 9842, 9844, 9845, 9851, 9853, 9854, 9855, 9857, 9860, 9862, 9863, 9865, 9871, 9873, 9875, 9878, 9879, 9599, 9601, 9603, 9606, 9607, 9609, 9611, 9615, 9619, 9623, 9624, 9628, 9630, 9631, 9634, 9635, 9637, 9639, 9641, 9647, 9649, 9650, 9652, 9653, 9659, 9660, 9663, 9664, 9670, 9671, 9679, 9682, 9684, 9687, 9690, 9692, 9693, 9695, 9697, 9700, 9701, 9703, 9706, 9708, 9712, 9713, 9714, 9716, 9717, 9718, 9721, 9724, 9727, 9730, 9734, 9739, 9742, 9751, 9753, 9757, 9760, 9761, 9762, 9763, 9764, 9765, 9766, 9767, 9769, 9773, 9775, 9778, 9780, 9783, 9786, 9788, 9791, 9793, 9794, 9795, 9798, 9801, 9803, 9804, 9807, 9808, 9809, 9810, 9811, 9813, 9816, 9817, 9819, 9820, 9822, 9826, 9828, 9830, 9833, 9836, 9838, 9840, 9843, 9846, 9847, 9848, 9849, 9850, 9852, 9856, 9858, 9859, 9861, 9864, 9866, 9867, 9868, 9869, 9870, 9872, 9876, 9877, 9880, 9881, 9882, 9886, 9890, 9891, 9894, 9900, 9902, 9904, 9908, 9911, 9912, 9915, 9917, 9919, 9923, 9925, 9928, 9935, 9936, 9940, 9943, 9949, 9953, 9954, 9956, 9957, 9958, 9962, 9963, 9964, 9968, 9969, 9975, 9978, 9981, 9988, 9989, 9990, 9991, 9992, 9995, 9997,10011,10012, 10014,10017,10018,10031,10032,10033,10034, 10035,10037,10041,10042,10046, 10050,10054,10058,10059, 9883, 9885, 9887, 9889, 9892, 9893, 9895, 9896, 9897, 9898, 9899, 9901, 9903, 9905, 9907, 9909, 9913, 9914, 9916, 9918, 9920, 9921, 9922, 9924, 9926, 9929, 9931, 9932, 9933, 9934, 9937, 9938, 9939, 9941, 9942, 9944, 9945, 9946, 9947, 9948, 9950, 9952, 9955, 9959, 9960, 9961, 9966, 9967, 9970, 9972, 9973, 9974, 9976, 9979, 9980, 9982, 9983, 9984, 9985, 9986, 9987, 9993, 9994, 9996, 9998, 9999,10000,10001,10002,10003,10004,10005,10006, 10007,10008,10009,10010, 10013, 10015,10016,10019,10020,10021,10022,10023y 10025, 10026, 10027, 10028, 10030, 10036, 10038,10040, 10043, 10044, 10045,10047, 10048, 20049,10051,10053, 10055,10056,10057,10060,10061,10064,10067,10068,10070,10071, i0072,10074, 10079, 10081, 10083, 10088,10091,10095,10096, 10097, 10101, 10103, 10105, 10106, 10109,10110,10111, 10113,10116,10118,10120,10122,10125,10126,10127,10131, 10134, 10137,10138,10144,10147, 10149,10151,10152, 10155,10156, 10159, 10160, 10169, 10172,10174,10175,10178,10181,10186,10188,10189, 10190, 10191,10192, 10196, 10199,10203,10204,10210, i0211,10216, 10218,10221,10224,10225,10226, 10229, 10230,10231, 10232,10234,10239,10241,10244, 10252, 10253, 10257,10258, 10259, 10261,10266,10272,10276, 10062,10065,10069,10075,10077,10078,10080, 10082,10084,10086,10087,10089,10090,10092,10093,10094,10098,10099,10100, 10102,10104,10107,10112,10114,10117,10119,10121,10123,10124,10129,10130, 10132, 10133,10135, 10139,10140, 10141,10142,10143, 10145, 10148,10150,10153, 10154,10157,10161,10163,10164,10165,10166,10167,10170,10173,10176,10177, 10179, 10182, 10183, 10184,10187,10193, 10194, 10195, 10197,10198, 10200, 10201, 10202,10205,10206,10207,10209,10212,10213,10214,10215,10219,10220,10222, 10223,10227,10228,10233,10235,10236,10237,10240,10242,10243,10245,10247, 10248,10249,10251,10254,10255,10256,10260,10262,10263,10264,10265,10267, 10268,10269,10270,10271,10273,10274,10275,10277,10278,10279,10282,10285, 10287,10291,10292,10297,10299,10301,10304,10306,10308,10310,10314,10317, 10318,10320,10322,10327,10329,10330,10333,10335,10336,10337,10340,10342, 10348,10350,10351,10354,10358,10359,10360,10362,10366,10369,10372,10373, 10374,10376,10378,10383,10385,10391,10398,10403,10407,10410,10413,10415, 10419,10422,10425,10427,10428,10429,10430,10432,10433,10434,10437,10438, 10439,10442,10443,10445,10446,10447,10448,10452,10453,10454,10455,10456, 10460,10463,10466,10467,10469,10470,10473,10475,10477,10480,10484,10488, 10490, 10494,10495,10497, 10501,10502,10503, 10507,10508, 10510,10517, 10518, 10520, 10522,10524,10525,10528,10529,10533, 10536,10537, 10540,10541, 10545, 10547,10551,10553,10556,10559,10560,10563,10564,10565,10568,10571,10574, 10576, 10579,10581,10583, 10588,10589,10590, 10592,10593,10596,10597, 10601, 10602, 10603,10605,10607, 10609,10610,10612,10613,10617, 10618,10621, 10624, 10627,10630,10632,10634,10637,10638,10639,10640,10641,10643,10645,10647, 10653,10655,10657,10659,10661,10662,10663,10664,10665, 10666,10667,10668, 10669,10672,10673,10674, 10675,10280,10283,10286,10288,10290,10293, 10295, 10298,10300,10302,10305,10307,10309,10311,10312,10313,10315,10319,10321, 10323,10325,10326,10328,10331,10338,10341,10343, 10344,10345,10346,10347, 10349,10352,10355,10356,10357,10361,10363,10365,10367,10370,10375,10377, 10379,10380,10381,10382,10384,10386,10387, 10388,10390,10392,10394,10395, 10399,10401,10402,10404,10406,10408,10411,10412,10414,10416,10417,10418, 10420,10423, 10426,10431,10435,10440,10444,10449, 10451, 10457,10459, 10461, 10462,10464,10465, 10468, 10471,10476,10478, 10481,10483, 10485,10487,10489, 10491,10492,10493, 10498, 10499,10500, 10504, 10506,10509,10511,10513, 10514, 10515,10516, 10519, 10521, 10523,10526,10530, 10531, 10532,10534, 10535, 10538, 10539,10542, 10543,10544, 10546,10548,10550,10552, 10554, 10557,10558, 10561, 10566,10569, 10572,10573, 10577,10578,10580,10582,10584,10586,10594,10598, 10600,10604, 10606, 10611, 10614,10616,10619, 10622,10625,10626,10628,10631, 10633,10635, 10642, 106a4,10646,10648, 10649,10650, 10651,10652,10654,10656, 10658, 10660, 10670, 10671,10676,10678, 10684, 10679,10681,10682,10683,10685, 10687, 10688, 10689, 10690, 10691, 10693, 10696, 10699, 10703, 10704, 10709, 10711, 10712,10713,10720,10721,10722,10724,10725,10726,10728,10729,10734,10740, 10742,10743,10744,10745,10746,10748,10749,10751,10754,10758,10759,10760, 10764,10768, 10769, 10772,10775,10780,10781,10783,10786,10791,10796,10801, 10808,10817, 10818,10819,10821,10823,10826,10827,10829,10830,10834,10843, 10844,10847,10848, 10849,10853,10856,10858,10866,10869,10872,1087'4,10877, 10878,10879,10882,10884,10885,10889,10892,10893,10896,10900,10901,10903, 10905,10907,10909,10910,10911,10914,10916,10919,10926,10930,10932,10933, 10934,10938,10941,10942,10943,10944,10946,10947,10953,10955,10956,10958, 10959, 10962, 10967, 10968, 10972, 10975, 10977, 10978, 10981, 10984, 10985, 10988, 10992,10995,10997,10999,11000,11001,11006,11009,11013,11016,11020,11025, 11033, 11036, 11040, 11041, 11042, 11043, 11045, 11046, 11048, 11052, 11055, 11060, 11061, 11062, 11064, 11065, 11067, 11070, 11071, 11072, 11078, 11079, 11081, 11085, 11093, 10694, 10697, 10700,10702, 10705, 10707, 10710, 10714, 10716, 10717, 10718, 10719, 10723, 10727, 10730,10732, 10733, 10735, 10737, 10738, 10739, 10741, 10747, 10750, 10752, 10755, 10757, 10761, 10762, 10763, 10765, 10767, 10770, 10773, 10776, 10778, 10779, 10782, 10784,10788, 10789, 10790, 10792, 10793, 10794, 10798, 10799, 10800, 10802, 10804, 10805, 10806, 10807, 10809, 10811, 10812, 10813, 10814, 108 15, 10816, 10820,10822,10824,10831,10833,10835,10837,10838,10839,10840,10841, 10842, 10845, 10846, 10850, 10851, 10854, 10857, 10859, 10860, 10861, 10862, 10863, 10864, 10865, 10868, 10870, 10871, 10873, 10875, 10880, 10881,10883,10886,10888, 10890, 10894, 10897, 10899, 10902, 10904, 10906, 10908, 10912, 10915, 10917, 10920, 10922,10924,10925,10927,10928, 10929,10931, 10935,10937, 10939,10945, 10948, 10950,10951, 10952,10954,10957,10960,10963,10965,10966,10969,10970,10971, 10973,10976, 10979,10980,10982,10986,10987,10989,10991, 10993, 10996,10998, 11002, 11004, 11005,11007,11010,11012,11014, 11015,11017, 11019, 11021, 11022, 11023, 11026, 11027, 11028, 11029, 11030, 11031,11032,11034,11037, 11039,11044, 11047,11049,11050,11051,11053,11054,11056,11058,11059, 11063,11066, 11068, 11069, 11073, 11074, 11075,11076,11077,11080, 11082,11083,11084,11086,11087, 11088,11089, 11090,11091,11092,11094,11376, 11381,11382, 11383, 11384, 11387, 11397,11401,11405,11408, 11414,11418,11421,11422,11424,11427,11429, 11430, 11377,11379, 1138Q 11385, 11386,11388,11390,11391,11392,11394, 11395,11396, 11398, 11399,11400,11402,11403,11404,11406,11409,11410,11411,11412,11415, 11416,11417,11419,11423,11425,11428,11431,11432,11433,11434,11438,11442, 11443, 11447,11449,11450,11452,11456,11459, 11463,11464,11467,11468, 11472, 11417,11480,11481, 11482,11483,11484,11488,11489,11493,11498,11502,11504, 11505,11506,11507,11508,11509,11512,11513,11514,11517,11520,11522,11523, 115244,11526,11528,11532,11534,11435,11439,11444,11445,11446,11448,11451, 11453, 11457, 11458,11460,11461,11462,11465,11466,11469,11473,11474,11475, 11476,11478,11479,11485,11486,11487,11490,11494,11497,11499,11500,11501, 11503,11510,11511,11515,11518,11519,11521,11525,11527,11529,11535,11539, 11540,11541,11548,11550,11551,11552,11555,11556,11557,11560,11561,11562, 11568,11569,11571,11572,11573,11577,11536,11542,11545,11546,11547, 11549, 11553,11554,11563,11566,11570, 11574,11578,11585, 11586,11590,11591,11592, 11595,11596,11597,11600,11579,11582,11587,11593,11594,11598, 11601,11602, 11606,11607,11608,11609,11616,11618,11622,11626,11628,11632,11633,11603, 11610,11613,11614,11615,11617,11619,11623,11627, 11629,11634,11635,11640, 11641, 11642,11643,11647,11648,11654,11655,11656, 11657,11658,11636, 11639, 11644,11645,11646,11649,11652,11653,11659,11663, 1 I664,11665,11666,11670, 11671,11672-,11673,11677,11681, 11687,11690,11694,11696,11697,11701,11705, 11709, 11713,11719,11723,11729,11733,11739,11744,11745,11748, 11749,11751, 11755,11759,11763,11770,11772,11774,11776,11778,11782,11785,11660,11667, 11674,11675,11676,11678,11682,11685,11686,11688,11689,11691,11692,11693, 11695,11698,11699,11700,11702,11706,11710,11716, 11720,11724,11725,11727, 11728, 11730,11731,11732,11734,11735,11736,11737, 11738, 11740,11743,11746, 11747, 11750,11752,11756,11761, 11762, 11764,11765,11767, 11768,11769,11773, 11775,11777,11779,11783,11784,11786,11790,11791,11792,11787,11793,11796, 11800,11802,11803,11805,11810,11818,11819,11823,11824,11827,11828,11829, 11833,11836,11837,11839,11840,11847,11850,11852,11857,11860, 1i864,11866, 11797,11801,11804,11806,11809, 11811,11814,11815, 11817,11820, 11825,11830, 11835,11841,11844, 11845,11846,11848,11851,11853, 11856,11858,11861, 118622, 11863,11865, 11867,11871,11876,11878,11882, 11888, 11891, 11894, 11868,11872, 11875,11877, 11879, 11883,11886,11887,11889,11890, 11892,11893, 11895, 11898, 11902,11903,11904, 11908,11909, 11911,11912,11913,11914,11915, 11917,11918, 11 922,11926,11927, 11930,11932, 11933,11937,11941, 11942, 11946,11947, 11948, 11949,11950, 11951,11952,11955, 11959,11968,11972, 11976, 11978,11979, 11980, 11981,11986,11988,11989,11991,11992,11995,11997,11998,12001,12002,12004, 12005,11899,11905,11910,11916,11919,11923,11924,11925, 11928,11929, 11931, 11934,11938,11943, 11953,11954, 11956, 11960,11963, 11964,11967, 11969, 11973, 11977,11982,11985,11987,11990,11993,11994,11996,11999,12000,12003,12006, 12011,12015,12016,12017,12021,12022,12023,12024,12025,12026,12027,12031, 12034,12042,12043,12045, 12049,12050,12051,12054,12062,12063,12064,12066, 12067,12068,12070,12072,12076,12082,12085,12086,12089,12090,12093,12094, 12095,12096,12097,12098,12101,12103,12107,12108,12111,12112,12114,12118, 12119,12120,12128,12007,12010,12012,12020,12028,12032,12033,12035,12038, 12039, 12044, 12046, 12052,12055,12056,12057,12058,12059, 12060,12061,12065, 12069,12071,12073,12077,12080,12081,12084,12087,12088,12091,12099,12100, 12102,12104,12109,12110,12113,12115,12121,12122,12123,12124,12125,12127, 12129,12130,12135,12136,12141,12144,12147,12148,12149,12153,12159,12160, 12131, 12134,12137, 12138, 12139,12140, 12142, 12143, 12145, 12146, 12150, 12154, 12157,12158,12161,12162,12163,12164,12168,12171,12176,12181,12187,12190, 12194,12196,12197,12199,12201,12202,12209,12213,12216,12220,12221,12223, 12225,12226,12231, 12233,12239,12243,12244,12250, 12254, 12256,12257,12259, 12266,12270,12271,12272,12274,12276,12277,12278,12280,12284,12285,12288, 12289,12290,12291,12295, 12296,12302, 12308,12313,12317, 12321,12322, 12323, 12324,12325,12327,12328,12330,12331,12332,12336,12337, 12339,12343,12346, 12349,12353,12354,12355, 12359,12361,12363,12367,12369, 12370,12372,12376, 12377,12379,12380,12381, 12382,12383,12385, 12389,12393, 12398, 12400, 12402, 12403, 12406, 12408, 12409, 12410, 12412, 12415, 12417, 12419, 12422, 12424, 12429, 12430,12432,12433,12435,12436,12437, 12441,12445, 12448,12449, 12454, 12458, .

12459, 12460,12165, 12169,12170,12172, 12175,12177, 12180, 12182,12185, 12186, 12188, 12191, 12195, 12198, 12200, 12203, 12206, 12207, 12208, 12210,12214, 12217, 12222,12224,12227, 12228, 12229,12230,12232,12234, 12237,12238,12240, 12241, 12242, 12245, 12248, 12249, 12251, 1225 5, 12258, 12260, 12262, 12263, 12264, 12265, 12267,12268,12269,12273,12279,12281,12286,12287,12292,12297,12300,12303, 12306,12307,12309,12312,12314, 12318,12326,12333, 12338,12340, 12341, 12342, 12345, 12347,12348, 12352, 12356, 12360,12362, 12364,12371, 12373, 12378, 12386, 12390, 12394,12397,12401,12404,12405, 12411, 12413,12418, 12420,12423,12425, 12428,12438,12439, 12440,12442,12443,12446,12450,12453,12455, 12461, 12465, 12467, 12468, 12472, 12474, 12477, 12480, 12484, 12486, 12488, 12489, 12490, 12493, 12495,12499, 12501, 12504, 12506,12462,12469,12475,12478,12481,12483,12485, 12487,12492,12494,12496,12497,12498,12500 12502,12505,12507,12511,12517, 12520, 12522,12523,12524,12528,12530,12534,12535,12536,12537,12541,12542, 12547,12550,12551,12552,12554,12555,12560,12564,12565,12569,12571,12574, 12579,12581,12586,12590,12592,12593, 12594,12596,12600, 12601,12602, 12604, 12610,12613,12614,12615,12616,12620,12626,12630,12508,12512,12515,12518, 12521,12525,12529, 12531,12538,12543,12546,12548,12549, 12553, 12556, 12559, 12561,12566,12570,12572,12573,12575,12578,12582,12585,12587,12595,12597, 12599,12603,12605,12608,12609,12611,12617,12618,12621,12624,12625,12627, 12631,12636,12637,12638,12639, 12643, 12647,12648, 12652,12654,12660,12664, 12666,12670,12672,12675,12677,12680,12686,12691,12692,12695,12699,12700, 12701,12703,12705,12709,12710,12714,12715, 12716,12718,12719,12720,12724, 12725,12728,12732,12738,12739,12743,12744, 12745;12747,12748,12752,12757, 12763,12764,12766,12767,12768,12771,12776,12777,12781,12785,12787,12788, 12791, 12792, 12796, 12797, 12800, 12804, 12808, 12813, 12815, 12816, 12817, 12822, 12825,12828,12831,12833,12834,12837,12839,12841,12842,12632,12635,12640, 12641,12644,12649,12653,12655,12658,12661,12662,12663,12665,12667,12671, 12673,12678, 12679,12681, 12682, 12683, 12684, 12685,12687,12688,12689,12690, 12693, 12694, 12696, 12702, 12704, 12706, 12712, 12713,12717, 12721, 12726, 12729, 12730,12731, 12733,12736,12737,12740,12746,12749, 12750,12751, 12753, 12754, 12755,12756,12758,12760,12761,12762,12765,12769,12770, 12772, 12775,12778, 12782,12786,12789,12790, 12793,12794, 12795,12798,12799,12801, 12805,12809, 12812,12814,12818,12821,12823,12824, 12826,12827, 12832, 12835, 12836, 12838, 12840, 12843,12844, 12845, 12849, 12850,12854, 12857, 12862,12866,12867,12868, 12870,12872,12880, 12881,12884, 12885,12889,12890, 12892, 12896, 12898, 12899, 12903,12907, 12910, 12913, 12919, 12920,12921, 12923,12928, 12932, 12938,12942, 12945,12948,12950, 12951, 12953, 12959, 12846, 12851, 12855, 12858, 12861, 12863, 12869, 12871, 12873, 12876, 12877,12878,12879, 12882,12883,12886,12887,12888, 12891, 12893, 12894, 12895, 12900, 12901,12902,12904,12908,12909,12911, 12912, 12914, 12917, 12918, 12924,12927, 12929,12933, 12936,12937,12939,12943,12949, 12954, 12957,12958,12960,12961,12965,12969,12975,12977, 12962, 12966,12967, 12968, 12970, 12971, 12972, 12973, 12974, 12976, 12978, 12981, 12982, 12986, 12989, 12991,12992, 12993, 12995, 12999,13001,12983,12987,12996,12997, 12998,13000, 13002, 13005, 13009, 13013, 13017, 13019, 13025, 13029, 13030, 13032, 13033, 13034, 13037,13040, 13042,13043, 13044,13048,13049,13051,13052,13053,13057,13062, 13064, 13065,13066,13067, 13072,13073,13076,13078, 13082, 13083, 13085, 13087, 13088, 13089, 13092, 13096, 13100, 13101, 13102, 13105, 13108, 13109, 13110, 13114, 13117,13118,13124, 13129, 13131, 13132, 13138,13144,13146,13147, 13148, 13152, 13156, 13159, 13164, 13167, 13168, 13170, 13171, 13172, 13173, 13174, 13184, 13185, 13006, 13010, 13014, 13018, 13020, 13021, 13022, 13023, 13024, 13026, 13031, 13035, 13036, 13038, 13039, 13041, 13 045, 13050, 13054, 13058, 13061, 13063, 13068, 13069, 13070, 13071, 13074, 13075, 13077, 13079, 13084, 13086, 13090, 13091, 13093, 13097, 13104, 13107, 13111, 13115, 13119, 13121, 13122, 13123, 13125, 13126, 13127, 13128, 13130,13133,13137,13139,13142,13143,13145,13149,13153,13157,13158,13160, 13163, 13165, 13166, 13169, 13175, 13176, 13177, 13178, 13179, 13180, 13181, 13182, 13183, 13186, 13189, 13190, 13191, 13195, 13196, 13197, 13199, 13200, 13204, 13206, 13192,13198,13201,13207,13212,13213,13226,13228,13231,13235,13240,13245, 13247, 13248, 13250, 13254, 13256, 13258, 13264, 13265, 13268, 13269, 13273, 13274, 13277,13279, 13280, 13281,13286,13208,13211,13214,13217, 13220, 13222,13224, 13225,13227,13229, 13232,13233,13234,13237,13239,13241,13242,13244,13246, 13249,13251, 13255, 13257, 13259, 13262, 13263, 13266, 13267, 13270, 13275, 13276, 13282,13285,13641,13645,13646,13649,13650,13652,13653,13654,13655,13658, 13659, 13642, 13647, 13648, 13656, 13660, 13661, 13664, 13669, 13670, 13671, 13672, 13673, 13675, 13676, 13677, 13681, 13683, 13685, 13687, 13689, 13691, 13693, 13696, 13665, 13668, 13674, 13678, 13682, 13684, 13686,13688,13690,13692,13694,13695, 13697, 13701, 13702, 13703, 13709, 13713, 13714, 13715, 13719, 13721, 13722,13726, 11728, 13732, 13735, 13740, 13698, 13704,13705,13706,13707,13708, 13710, 13716, 13717, 13718, 13720, 13723, 13724, 13725, 13727, 13729, 13733, 13734, 13736, 13739, 13741, 13744, 13745, 13749, 13751, 13752, 13753, 13754, 13758, 13762, 13765, 13766, 13768, 13772, 13773, 13774, 13777, 13778, 13779, 13783, 13785, 13790, 13791,13797, 13802, 13803, 13805, 13806,13807, 13809, 13812, 13814, 13816, 13817, 13818, 13819, 13820, 13823, 13824, 13826, 13828, 13746, 13755, 13759, 13763, 13764, 13767, 13769, 13775,13776,13780,13784,13786,13788,13789,13792,13795,13796,13798,13800, 13804,13808, 13813,13815,13821,13822,13829,13832,13837,13841,13844,13845, 13846,13849,13854,13855,13856,13857,13861,13865,13869, 13871,13875, 13879, 13880,13833,13836,13838,13843,13847,13850,13853,13858, 13862,13866, 13870, 13872,13876,13881,13882,13883,13889,13894,13902,13903,13910,13911,13914, 13915,13916,13928, 13929, 13930, 13931, 13935, 13936, 13937, 13944, 13947, 13948, 13950, 13960, 13961, 13962, 13964, 13965, 13966, 13968, 13970, 13971, 13972, 13976, 13978, 13884, 13887,13890,13893,13895,13898,13900,13904,13905,13906,13907, 13908, 13909, 13912, 13913, 13917, 13920, 13921, 13922, 13923, 13924, 13925, 13926, 13932,13938,13941,13942,13943,13945,13946,13949,13953,13954,13956,13957, 13958, 13959,13963,13967,13969,13974,13975,13977,13980, 13981, 13988,13989, 13990,13992,13994,13995,13999,13982,13985,13986,13987,13991,13993,13996, 14000, 14001,14002, 14003,14004,14009,14014,14017,14020,14024,14026,14029, 14035,14036,14040,14043,14045,14051,14057,14058,14059,14063,14065,14066, 14067,14068,14069,14070,14071,14073,14074,14078,14079,14080,14081,14082, 14083, 14084, 14085, 14087, 14094, 14095, 14100, 14108, 14109, 14113, 14114, 14118, 14120, 14121, 14122, 14130, 14133, 14138, 14141, 14142, 14143, 14147, 14005, 14008, 14010, 14013, 14015, 14018, 14021, 14025, 14027, 14028, 14030, 14033, 14034, 14037, 14038,14039,14041,14042,14044,14046,140,49,14050, 14052, 14055, 14056,14060, 14064, 14072,14077,14086,14088,14089, 14090, 14091,14092,14093,14096,14097, 14098,14099,14101,14102,14103,14104, 14105, 14106, 14107, 14110, 14115, 14123, 14126,14127,14132,14134,14135,14136,14137,14139,14140,14144,14145,14148, 14151, 14155,14157,14161,14166,14171,14175,14183,14187, 14190, 14192,14194, 14195,14196, 14200, 14201,14152,14156,14158,14162,14165,14167, 14170, 14172, 14176, 14179, 14180, 14182,14184, 14185, 14186, 14188, 14189, 14191, 14193, 14197, 14198,14199, 14202, 14203,14204,14210,14211,14216, 14217,14223, 14226,14228, 14229, 14230,14233,14235,14239,14241,14243, 14244,14250, 14254,14255,14256, 14257, 14260, 14261, 14262, 14267, 14268, 14269, 14273,14274,14277, 14281,14284, 14286, 14289, 14292,14293,14297,14299,14301,14304, 14305,14306, 14312,14316, 14320,14322,14324,14328,14329,14331,14337,14342,14344,14346,14347,14349, 14350,14353, 14356,14361,14363, 14364,14365,14366,14205, 14208,14212,14215, 14218,14221, 14224,14225,14227,14231,14236,14240,14242,14245, 14246,14247, 14251, 14263, 14266,14270,14278, 14282,14283, 14285, 14287, 14290, 14291, 14294, 14298, 14300, 14302, 14303, 14307, 14310, 14313, 14317, 14323, 14325, 14327, 14330, 14334,14338, 14340, 14341, 14345, 14348, 14351, 14352, 14354, 14355, 14357, 14358, 14359, 14360, 14367, 14368, 14372, 14373, 14375, 14386, 14369, 14374, 14376, 14379, 14380, 14381,14382,14383,14384 and SEQ ID NO:14385.

39. The method of claim 21 comprising in d) using primer oligonucleotides comprising one or more CpG; TpG or CpA dinucleotides; and further comprising in e) the use of at least one method selected from the group consisting of: hybridizing in at least one nucleic acid molecule or peptide nucleid acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID
NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof; hybridizing at least one nucleic acid molecule that is bound to a solid phase and comprises a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ
ID
NO:65 to SEQ ID NO:88, and complements thereof, hybridizing at least one nucleic acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof, and extending at least one such hybridized nucleic acid molecule by at least one nucleotide base; and sequencing in e) of the amplificate.

40. The method of claim 21 comprising in d) use of at least one nucleic acid molecule or peptide nucleic acid molecule comprising in each case a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID
NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof, wherein said nucleic acid molecule or peptide nucleic acid molecule suppresses amplification of the nucleic acid to which it is hybridized; and further comprising in e) the use of at least one method selected from the group consisting of:
hybridizing in at least one nucleic acid molecule or peptide nucleid acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ

ID NO:88, and complements thereof; hybridizing at least one nucleic acid molecule that is bound to a solid phase and comprises a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ
ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof;
hybridizing at least one nucleic acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ

ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof, and extending at least one such hybridized nucleic acid molecule by at least one nucleotide base; and sequencing in e) of the amplificate.

41. The method of claim 21, comprising in c) amplification by primer oligonucleotides comprising one or more CpG; TpG or CpA dinucleotides and further comprising in d) hybridizing at least one detectably labeled nucleic acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ

ID NO:88.

42. The method of claim 21, comprising in c) the use of at least one nucleic acid molecule or peptide nucleic acid molecule comprising in each case a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID
NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and complements thereof, wherein said nucleic acid molecule or peptide nucleic acid molecule suppresses amplification of the nucleic acid to which it is hybridized, and further comprising in d) hybridizing at least one detectably labeled nucleic acid molecule comprising a contiguous sequence at least 9 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ

ID NO:88.

43. The method according to claims 39 and 41 wherein the primer oligonucleotides of c) are selected from the group consisting SEQ ID NOS:2754, 2757, 2759, 2767, 2768, 2772, 2776, 2779, 2784, 2785, 2786, 2789, 2791, 2792, 2794, 2797, 2798, 2801, 2805, 2806, 2809, 2811, 2815, 2817, 2824, 2830, 2832, 2833, 2834, 2838, 2840, 2843, 2846, 2850, 2851, 2853, 2855, 2859, 2866, 2867, 2870, 2871, 2876, 2878, 2881, 2885, 2886, 2892, 2893, 2895, 2896, 2898, 2904, 2912, 2915, 2917, 2919, 2922, 2923, 2929, 2931, 2939, 2941, 2944, 2946, 2948, 2950, 2955, 2956, 2957, 2960, 2962, 2965, 2966, 2967, 2968, 2969, 2971, 2975, 2976, 2977, 2978, 2979, 2980, 2981, 2984, 2988, 2989, 2990, 2992, 2994, 2997, 2999, 3001, 3002, 3004, 3006, 3007, 3008, 3010, 3013, 3014, 3016, 3017, 3018, 3020, 3022, 3025, 2752, 2755, 2760, 2762, 2763, 2764, 2765, 2769, 2771, 2773, 2775, 2777, 2780, 2781, 2782, 2783b6687, 2788, 2790, 2793, 2795, 2796, 2800, 2802, 2803, 2804, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2821, 2823, 2825, 2827, 2828, 2829,2831, 2835, 2836, 2837, 2839, 2841, 2842, 2844, 2845, 2847, 2849, 2852, 2854, 2856, 2858, 2860, 2861, 2862, 2863, 2864, 2865, 2868, 2869, 2872, 2873, 2874, 2875, 2877, 2879, 2880, 2882, 2883, 2884, 2887, 2888, 2889, 2890, 2891, 2894, 2897, 2899, 2901, 2902, 2903, 2905, 2907, 2909, 2911, 2914, 2916, 2918, 2920, 2924, 2926, 2927, 2928, 2930, 2932, 2933, 2934, 2935, 2936, 2937, 2938, 2942, 2945, 2947, 2949, 2951, 2953, 2954, 2958, 2959, 2961, 2963, 2970, 2972, 2973, 2974, 2982, 2985, 2987, 2991, 2993, 2995, 2996, 2998, 3000, 3003, 3005, 3011, 3019, 3021, 3023, 3026, 3027, 3028, 3032, 3033, 3036, 3037, 3038, 3039, 3041, 3042, 3043, 3044, 3047, 3048, 3049, 3052, 3055, 3059, 3061, 3064, 3065, 3068, 3069, 3071, 3072, 3075, 3076, 3080, 3083, 3084, 3085, 3086, 3091, 3093, 3096, 3097, 3100, 3104, 3109, 3110, 3113, 3115, 3117, 3118, 3123, 3126, 3127, 3130, 3134, 3135, 3136, 3138, 3139, 3144, 3146, 3147, 3149, 3150, 3155, 3029, 3031, 3034, 3040, 3045, 3050, 3051, 3053, 3054, 3056, 3057, 3060, 3063, 3066, 3073, 3078, 3081, 3088, 3089, 3090, 3092, 3094, 3098, 3101, 3103, 3105, 3107, 3108, 3111, 3114, 3116, 3119, 3121, 3122, 3124, 3128, 3131, 3133, 3137, 3140, 3142, 3145, 3148, 3151, 3152, 3153, 3157, 3159, 3165, 3166, 3167, 3170, 3171, 3172, 3174, 3175, 3176, 3179, 3180, 3181, 3184, 3185, 3186, 3192, 3194, 3198, 3201, 3202, 3203, 3204, 3206, 3209, 3212, 3213, 3215, 3216, 3217, 3218, 3221, 3224, 3226, 3228, 3229, 3230, 3232, 3233, 3234, 3235, 3237, 3238, 3239, 3245, 3247, 3248, 3249, 3160, 3162, 3163, 3164, 3168, 3169, 3173, 3178, 3182, 3183, 3187, 3189, 3190, 3195, 3196, 3197, 3199, 3205, 3207, 3210, 3214, 3219, 3222, 3223, 3225, 3227, 3236, 3240, 3242, 3243, 3244, 3246, 3250, 3252, 3256, 3261, 3264, 3268, 3269, 3270, 3273, 3275, 3279, 3280, 3281, 3282, 3283, 3284, 3285, 3286, 3290, 3292, 3295, 3297, 3301, 3304, 3305, 3306, 3307, 3308, 3310, 3311, 3312, 3315, 3319, 3320, 3324, 3327, 3331, 3333, 3334, 3339, 3348, 3351, 3354, 3358, 3360, 3364, 3367, 3368, 3374, 337,6, 3253, 3255, 3257, 3259, 3260, 3262, 3265, 3266, 3267, 3271, 3274, 3276, 3278, 3287, 3289, 3291, 3293, 3298, 3300, 3302, 3309, 3313, 3314, 3316, 3318, 3321, 3322, 3325, 3328, 3330, 3332, 3335, 3337, 3338, 3340, 3342, 3343, 3344, 3345, 3346, 3347, 3349, 3350, 3352, 3353, 3355, 3356, 3357, 3359, 3361, 3363, 3365, 3369, 3371, 3372, 3373, 3377, 3380,3383, 3386, 3388, 3389, 3390, 3391, 3392, 3395, 3396, 3400, 3401?3403, 3406, 3408, 3413, 3414, 3417, 3420, 3423, 3428, 3432, 3433, 3434, 3436, 3439, 3440, 3442, 3443, 3445, 3447, 3453, 3455, 3458, 3463, 3466, 3469, 3470, 3471, 3472, 3473, 3474, 3475, 3477, 3478, 3480, 3481, 3483, 3484, 3487, 3490, 3494, 3495, 3496, 3497, 3499, 3500, 3504, 3505, 3508, 3512, 3514, 3515, 3516, 3521, 3525, 3529, 3533, 3534, 3537, 3538, 3540, 3541, 3542, 3543, 3544, 3547, 3548,3553, 3557, 3558, 3559, 3560, 3562, 3563, 3566, 3571, 3574, 3575, 3577, 3580, 3583, 3584, 3585, 3586, 3592, 3594, 3595, 3597, 3598, 3599, 3601, 3603, 3604, 3607, 3608, 3612, 3619, 3621, 3622, 3626, 3631, 3632, 3637, 3638, 3639, 3640, 3642, 3643, 3644, 3646, 3647, 3649, 3650, 3652, 3656, 3657, 3660, 3663, 3668, 3670, 3673, 3676, 3677, 3678, 3683, 3688, 3690, 3694, 3697, 3700, 3702, 3703, 3704, 3708, 3404, 3409, 3411, 3415, 3418, 3419, 3421, 3424, 3426, 3427, 3429, 3431, 3435, 3437, 3438, 3441, 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3459, 3461, 3462, 3464, 3467, 3476, 3479, 3482, 3485, 3488, 3489, 3491, 3492, 3493, 3501, 3503, 3506, 3509, 3510, 3511, 3513, 3517, 3518, 3519, 3520, 3522, 3524, 3526, 3527, 3528, 3530, 3531, 3535, 3536, 3545, 3549, 3551, 3552, 3554, 3555, 3556, 3561, 3564, 3565, 3568, 3569, 3570, 3573, 3576, 3578, 3581, 3587, 3588, 3589, 3590, 3591, 3593, 3596, 3600, 3602, 3605, 3606, 3609, 3611, 3613, 3614, 3615, 3616, 3617, 3618, 3623, 3624, 3625, 3627, 3629, 3630, 3633, 3634, 3635, 3636, 3641, 3645, 3651, 3653, 3654, 3655, 3658, 3661, 3662, 3665, 3666, 3667, 3669, 3671, 3674, 3679, 3681, 3684, 3686, 3689, 3691, 3692, 3693, 3695, 3696, 3698, 3701, 3705, 3706, 3707, 3709, 3710, 3714, 3715, 3717, 3718, 3722, 3723, 3729, 3730, 3732, 3735, 3739, 3740, 3741, 3743, 3744, 3745, 3746, 3749, 3753, 3754, 3755, 3756, 3711, 3713, 3719, 3721, 3724, 3725, 3726, 3727, 3728, 3731, 3733, 3736, 3737, 3738, 3742, 3747, 3748, 3750, 3752, 3757, 3758, 3759, 3760, 3761, 3764, 3767, 3771, 3773, 3775, 3776, 3777, 3781, 3785, 3786, 3787, 3790, 3791, 3793, 3796, 3797, 3798, 3799, 3805, 3809, 3814, 3817, 3818, 3822, 3823, 3828, 3833, 3836, 3844, 3847, 3850, 3851, 3853, 3856, 3857, 3862, 3873, 3876, 3877, 3880, 3885, 3887, 3889, 3890, 3892, 3893, 3895, 3896, 3899, 3902, 3903, 3905, 3906, 3907, 3908, 3916, 3923, 3926, 3927, 3930, 3935, 3936, 3938, 3939, 3940, 3944, 3945, 3949, 3950, 3951, 3954, 3955, 3957, 3960, 3965, 3970, 3971, 3978, 3979, 3982, 3983, 3984, 3985, 3762, 3765, 3768, 3770, 3772, 3774, 3778, 3779, 3780, 3782, 3784, 3788, 3792, 3794, 3800, 3801, 3802, 3803, 3804, 3806, 3807, 3808, 3810, 3812, 3813, 3815, 3819, 3820, 3821, 3824, 3826, 3827, 3829, 3831, 3832, 3834, 3837, 3838, 3839, 3840, 3842, 3845, 3848, 3852, 3854, 3858, 3860, 3861, 3863, 3864, 3865, 3866, 3867, 3868, 3869, 3870, 3871, 3872, 3874, 3875, 3878, 3881, 3883, 3884, 3886, 3888, 3891, 3894, 3897, 3898, 3900, 3901, 3904, 3909, 3911, 3914, 3915, 3917, 3919, 3920, 3921, 3922, 3924, 3928, 3931, 3933, 3934, 3937, 3941, 3942, 3943, 3947, 3948, 3952, 3958, 3959, 3961, 3962, 3963, 3964, 3966, 3968, 3972, 3974, 3975, 3976, 3980, 3981, 3986, 3987, 3990, 3993, 3994, 3997, 4000, 4003, 4004, 4006, 4012, 4015, 4017, 4020, 4024, 4027, 4029, 4031, 4032, 4033, 4037, 4038, 4040, 4042, 4047, 4048, 4050, 4051, 4052, 4054, 4055, 4058, 4063, 4066, 4069, 4070, 4072, 4073, 4076, 4078, 4079, 4082, 4083, 4084, 4085, 4086, 4090, 4093, 4094, 4095, 4096, 4099, 4100, 4104, 4106, 4113, 4116, 4119, 4120, 4124, 4127, 4130, 4134, 4135, 4136, 4138, 4142, 4145, 4146, 4149, 4150, 4152, 4153, 4159, 4160, 4161, 4163, 4168, 4169, 4171, 4173, 4176, 4180, 4181, 4185, 4189, 4191, 4192, 4194, 4197, 4198, 4199, 4201, 4206, 4207, 4208, 4213, 4219, 4220, 4223, 4224, 4225, 4228, 4231, 4232, 4233, 4237, 4238, 4242, 4243, 4246, 4247, 4251, 4254, 4255, 4256, 4258, 3988, 3991, 3995, 3998, 4001, 4005, 4007, 4009, 4010, 4011, 4013, 4016, 4018, 4019, 4021, 4022, 4023, 4025, 4028, 4034, 4035, 4039, 4043, 4045, 4046, 4049, 4056, 4059, 4061, 4064, 4065, 4067, 4068, 4071, 4074, 4075, 4077, 4080, 4087, 4088, 4089, 4092, 4098, 4101, 4102, 4105, 4108, 4109, 4110, 4111, 4112, 4114, 4115, 4117, 4121, 4122, 4123, 4125, 4128, 4129, 4131, 4132, 4133, 4137, 4139, 4141, 4144, 4148, 4151, 4154, 4156, 4157, 4162, 4165, 4166, 4167, 4170, 4172, 4174, 4177, 4179, 4182, 4184, 4186, 4188, 4190, 4195, 4196, 4202, 4204, 4205, 4209, 4211, 4214, 4216, 4217, 4218, 4221, 4226, 4229, 4234, 4236, 4239, 4241, 4244, 4245, 4248, 4249, 4252, 4257, 4259, 4260, 4261, 4262, 4266, 4267, 4268, 4271, 4272, 4275, 4276, 4279, 4281, 4282, 4284, 4285, 4287, 4289, 4290, 4292, 4295, 4297, 4299, 4301, 4306, 4310, 4316, 4317, 4318, 4321, 4323, 4325, 4328, 4334, 4335, 4337, 4341, 4342, 4343, 4344, 4348, 4350, 4351, 4352, 4354, 4357, 4358, 4359, 4364, 4365, 4366, 4370, 4371, 4372, 4373, 4376, 4378, 4381, 4383, 4384, 4386, 4388, 4396, 4397, 4399, 4400, 4403, 4405, 4407, 4409, 4412, 4415, 4416, 4417, 4424, 4426, 4429, 4433, 4435, 4437, 4442, 4443, 4447, 4450, 4451, 4452, 4455, 4457, 4460, 4461, 4462, 4465, 4466, 4469, 4470, 4474, 4478, 4481, 4484, 4488, 4491, 4494, 4495, 4497, 4498, 4504, 4506, 4509, 4510, 4511, 4514, 4516, 4518, 4520, 4521, 4523, 4525, 4528, 4530, 4533, 4534, 4535, 4538, 4540, 4542, 4545, 4547, 4548, 4553, 4554, 4555, 4556, 4557, 4562, 4564, 4567, 4568, 4569, 4579, 4580, 4582, 4584, 4587, 4589, 4593, 4596, 4597, 4598, 4600, 4601, 4602, 4605, 4606, 4607, 4609, 4610, 4613, 4614, 4616, 4618, 4621, 4624, 4626, 4627, 4628, 4631, 4632, 4636, 4639, 4641, 4644, 4645, 4648, 4263, 4265, 4269, 4270, 4273, 4274, 4277, 4280, 4283, 4286, 4288, 4291, 4293, 4296, 4298, 4300, 4302, 4303, 4304, 4305, 4307, 4308, 4309, 4311, 4313, 4315, 4319, 4322, 4324, 4326, 4327, 4330, 4331, 4332, 4333, 4336, 4338, 4340, 4345, 4347, 4349, 4353, 4355, 4360, 4361, 4362, 4367, 4368, 4369, 4374, 4375, 4377, 4379, 4382, 4385, 4387, 4389, 4390, 4391, 4392, 4393, 4394, 4395, 4398, 4401, 4406, 4408, 4410, 4411, 4413, 4418, 4420, 4422, 4423, 4425, 4427, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4441, 4444, 4446, 4448, 4453, 4454, 4456, 4458, 4463, 4464, 4467, 4471, 4472, 4473, 4475, 4476, 4477, 4479, 4480, 4482, 4485, 4486, 4487, 4489, 4490, 4492, 4496, 4499, 4501, 4502, 4503, 4505, 4507, 4508, 4512, 4515, 4517, 4519, 4522, 4524, 4529, 4531, 4536, 4537, 4539, 4541, 4543, 4546, 4549, 4551, 4558, 4559, 4560, 4561, 4563, 4565, 4570, 4571, 4572, 4573, 4574, 4575, 4576, 4578, 4581, 4583, 4585, 4586, 4588, 4590, 4592, 4595, 4599, 4603, 4611, 4612, 4615, 4617, 4619, 4620, 4622, 4630, 4633, 4634, 4635, 4638, 4640, 4642, 4643, 4646, 4647, 4649, 4652, 4655, 4659, 4661, 4663, 4664, 4665, 4668, 4671, 4674, 4675, 4676, 4678, 4680, 4683, 4686, 4690, 4696, 4700, 4703, 4704, 4706, 4709, 4711, 4714, 4715, 4717, 4718, 4719, 4720, 4721, 4726, 4727, 4730, 4732, 4738, 4742, 4745, 4749, 4750, 4753, 4755, 4759, 4763, 4768, 4769, 4772, 4773, 4776, 4778, 4779, 4782, 4784, 4789, 4790, 4794, 4797, 4801, 4805, 4807, 4813, 4814, 4819, 4821, 4822, 4827, 4829, 4833, 4834, 4835, 4837, 4838, 4841, 4842, 4843, 4844, 4847, 4849, 4850, 4852, 4853, 4859, 4860, 4861, 4865, 4867, 4868, 4869, 4870, 4873, 4876, 4877, 4878, 4879, 4883, 4885, 4889, 4891, 4892, 4894, 4895, 4897, 4898, 4903, 4906, 4911, 4912, 4918, 4919, 4920, 4924, 4927, 4929, 4932, 4934, 4941, 4942, 4945, 4948, 4949, 4950, 4650, 4653, 4656, 4658, 4660, 4662, 4666, 4667, 4669, 4670, 4672, 4677, 4681, 4684, 4685, 4687, 4688, 4689, 4691, 4693, 4694, 4695, 4697, 4699, 4701, 4702, 4705, 4707, 4708, 4716, 4722, 4724, 4728, 4731, 4733, 4735, 4736, 4737, 4739, 4741, 4744, 4746, 4748, 4751, 4754, 4756, 4758, 4760, 4761, 4764, 4766, 4767, 4770, 4771, 4774, 4777, 4780, 4783, 4785, 4786, 4787, 4788, 4791, 4792, 4793, 4795, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4811, 4812, 4815, 4816, 4817, 4818, 4820, 4823, 4824, 4825, 4828, 4830, 4832, 4836, 4839, 4840, 4845, 4846, 4848, 4851, 4854, 4855, 4856, 4857, 4858, 4862, 4864, 4871, 4872, 4874, 4875, 4881, 4882, 4884, 4886, 4887, 4890, 4893, 4896, 4899, 4900, 4901, 4902, 4904, 4905, 4907, 4908, 4909, 4910, 4913, 4915, 4917, 4921, 4922, 4923, 4925, 4926, 4928, 4930, 4935, 4936, 4937, 4938, 4940, 4943, 4944, 4946, 4947, 4951, 4952, 4953, 4954, 4956, 4957, 4960, 4963, 4967, 4970, 4971, 4972, 4976, 4977, 4985, 4986, 4987, 4989, 4991, 4992, 4997, 4999, 5002, 5003, 5004, 5006, 5010, 5013, 5014, 5015, 5017, 5018, 5019, 5020, 5021, 5024, 5025, 5027, 5031, 5032, 5033, 5037, 5040, 5041, 5042, 5043, 4958, 4961, 4964, 4966, 4968, 4969, 4973, 4974, 4975, 4978, 4979, 4980, 4981, 4982, 4983, 4984, 4988, 4990, 4993, 4995, 4996, 4998, 5000, 5005, 5007, 5009, 5011, 5016, 5022, 5026, 5028, 5030, 5034, 5036, 5038, 5039, 5044, 5047, 5049, 5050, 5052, 5054, 5055, 5657, 5060, 5061, 5064, 5045, 5048, 5051, 5053, 5056, 5058, 5062, 5065, 5066, 5069, 5073, 5077, 5080, 5083, 5087, 5093, 5096, 5099, 5100, 5103, 5104, 5106, 5111, 5116, 5119, 5120, 5125, 5128, 5132, 5134, 5135, 5137, 5139, 5140, 5142, 5144, 5148, 5149, 5150, 5155, 5157, 5158, 5160, 5166, 5168, 5170, 5171, 5173, 5176, 5177, 5179, 5184, 5187, 5188, 5190, 5193, 5195, 5198, 5201, 5204, 5208, 5211, 5215, 5216, 5217, 5220, 5221, 5222, 5224, 5226, 5229, 5230, 5231, 5232, 5234, 5237, 5242, 5244, 5245, 5246, 5247, 5249, 5250, 5252, 5254, 5255, 5256, 5261, 5262, 5264, 5265, 5273, 5274, 5276, 5278, 5279, 5281, 5284, 5285, 5286, 5287, 5288, 5289, 5292, 5296, 5300, 5303, 5304, 5307, 5308, 5309, 5313, 5315, 5317, 5318, 5322, 5323, 5326, 5329, 5330, 5333, 5336, 5337, 5341, 5343, 5348, 5349, 5352, 5354, 5355, 5358, 5359, 5361, 5362, 5363, 5364, 5365, 5367, 5369, 5370, 5372, 5375, 5377, 5379, 5382, 5385, 5387, 5393, 5394, 5395, 5398, 5400, 5404, 5407, 5408, 5409, 5412, 5413, 5414, 5416, 5418, 5421, 5424, 5426, 5428, 5431, 5432, 5433, 5434, 5435, 5437, 5440, 5441, 5443, 5448, 5450, 5451, 5454, 5455, 5458, 5460, 5461, 5464, 5468, 5470, 5471, 5474, 5475, 5477, 5482, 5484, 5485, 5487, 5490, 5491, 5492, 5494, 5496, 5498, 5499, 5500, 5S01, 5502, 5503, 5504, 5506, 5509, 5510, 5512, 5516, 5517, 5518, 5524, 5525, 5526, 5528, 5531, 5533, 5534, 5535, 5536, 5537, 5540, 5542, 5544, 5545, 5546, 5549, 5550, 5552, 5553, 5559, 5561, 5566, 5569, 5572, 5573, 5575, 5577, 5578, 5579, 5580, 5581, 5582, 5588, 5593, 5595, 5596, 5598, 5600, 5601, 5603, 5604, 5605, 5608, 5614, 5615, 5616, 5619, 5622, 5624, 5625, 5628, 5629, 5633, 5634, 5637, 5638, 5639, 5643, 5644, 5645, 5647, 5648, 5649, 5650, 5654, 5662, 5664, 5067, 5070, 5072, 5074, 5075, 5076, 5078, 5081, 5084, 5086, 5088, 5090, 5091, 5094, 5097, 5101, 5105, 5107, 5109, 5110, 5112, 5114, 5115, 5117, 5121, 5123, 5124, 5126, 5129, 5131, 5136, 5143, 5145, 5147, 5151, 5153, 5156, 5159, 5161, 5162, 5163, 5164, 5165, S167, 5169, 5172, 5174, 5175, 5180, 5181, 5182, 5183, 5185, 5186, 5189, 5191, 5194, 5196, 5199, 5200, 5202, 5203, 5205, 5207, 5209, 5210, 5212, 5214, 5218, 5219, 5223, 5225, 5227, 5233, 5235, 5238, 5239, 5240, 5241, 5248, 5251, 5253, 5257, 5259, 5260, 5263, 5266, 5268, 5269, 5270, 5271, 5272, 5280; 5282, 5290, 5291, 5293, 5295, 5297, 5299, 5301, 5306, 5310, 5311, 5312, 5314, 5316, 5319, 5321, 5324, 5327, 5331, 5332, 5334, 5338, 5339, 5340, 5342, 5344, 5346, 5347, 5351, 5353, 5356, 5360, 5366, 5368, 5371, 5373, 5376, 5378, 5380, 5383, 5388, 5389, 5391, 5392, 5396, 5399, 5401, 5403, 5405, 5410, 5415, 5417, 5419, 5420, 5422, 5425, 5427, 5429, 5436, 5438, 5442, 5444, 5445, 5446, 5447, 5449, 5452, 5456, 5457, 5459, 5462, 5465, 5466, 5467, 5469, 5472, 5478, 5480, 5481, 5486, 5488, 5493, 5495, 5497, 5505, 5507, 5508, 5511, 5513, 5515, 5519, 5521, 5522, 5527, 5529, 5532, 5538, 5539, 5541, 5543, 5548, 5551, 5554, 5555, 5556, 5557, 5558, 5560, 5562, 5563, 5564, 5565, 5567, 5568, 5570, 5571, 5574, 5576, 5583, 5585, 5586, 5587, 5589, 5591, 5592, 5594, 5597, 5599, 5602, 5606, 5609, 5611, 5612, 5618, 5620, 5623, 5626, 5627, 5630, 5632, 5635, 5640, 5642, 5646, 5651, 5652, 5656, 5657, 5659, 5660, 5661, 5663, 5665, 5667, 5670, 5672, 5673, 5676, 5678, 5679, 5681, 5682, 5683, 5686, 5687, 5688, 5690, 5694, 5697, 5698, 5699, 5700, 5701, 5704, 5708, 5709, 5711, 5713, 5714, 5717, 5721, 5723, 57?4, 5727, 5728, 5733, 5734, 5735, 5736, 5739, 5740, 5741, 5742, 5743, 5668, 5671, 5674, 5677, 5680, 5684, 5689, 5691, 5693, 5696, 5702, 5705, 5707, 5710, 5712, 5715, 5718, 5720, 5722, 5725, 5729, 5730, 5731, 5732, 5737, 5744, 5747, 5750, 5753, 5759, 5762, 5763, 5770, 5775, 5777, 5778, 5780, 5782, 5785, 5787, 5791, 5792, 5793, 5794, 5797, 5801, 5803, 5808, 5810, 5812, 5814, 5816, 5817, 5824, 5832, 5833, 5834, 5835, 5838, 5840, 5841, 5844, 5849; 5853, 5854, 5857, 5859, 5860, 5862, 5863, 5865, 5868, 5874, 5882, 5883, 5885, 5887, 5894, 5895, 5896, 5897, 5902, 5904, 5906, 5909, 5912, 5915, 5918, 5919, 5920, 5922, 5923, 5926, 5927, 5928, 5930, 5932, 5933, 5934, 5935, 5939, 5940, 5946, 5947, 5948, 5949, 5952, 5954, 5955, 5956, 5958, 5959, 5961, 5962, 5964, 5965, 5968, 5970, 5971, 5972, 5973, 5977, 5978, 5980, 5983, 5986, 5987, 5992, 5993, 5996, 5997, 6000, 6002, 6003, 6004, 6005, 6006, 6008, 6009, 6010, 6011, 6012, 6013, 6017, 6018, 6019, 6020, 6025, 6027, 6030, 6033, 6035, 6036, 6039, 6041, 6042, 6045, 6049, 6050, 6051, 6055, 6059, 6063, 6064, 6065, 6067, 6070, 6072, 6073, 6075, 6077, 6078, 6081, 5745, 5748, 5751, 5754, 5756, 5758, 5760, 5764, 5766, 5767, 5768, 5769, 5771, 5773, 5774, 5776, 5779, 5781, 5783, 5786, 5788, 5789, 5790, 5795, 5796, 5798, 5800, 5802, 5804, 5806, 5807, 5809, 5811, 5813, 5818, 5820, 5821, 5822, 5823, 5825, 5826, 5827, 5828, 5830, 5831, 5836, 5837, 5839, 5842, 5843, 5845, 5846, 5847, 5848, 5850, 5852, 5855, 5856, 5858, 5861, 5864, 5866, 5867, 5870, 5871, 5872, 5873, 5875, 5876, 5877, 5878;
5879, 5880, 5881, 5884, 5886, 5888, 5889, 5890, 5891, 5892, 5893, 5898, 5899, 5900, 5903, 5905, 5907, 5910, 5913, 5916, 5921, 5924, 5929, 5931, 5936, 5937, 5938, 5942, 5943, 5944, 5945, 5950, 5953, 5957, 5960, 5963, 5966, 5969, 5975, 5976, 5981, 5984, 5988, 5990, 5991, 5994,.5998, 5999, 6001, 6007, 6014, 6015, 6016, 6021, 6023, 6024, 6026, 6028, 6031, 6032, 6034, 6037, 6038, 6040, 6043, 6046, 6048, 6053, 6054, 6056, 6058, 6060, 6062, 6066, 6068, 6074, 6076, 6079, 6083, 6084, 6085, 6089, 6090, 6093, 6096, 6098, 6100, 6106, 6110, 6111, 6114, 6118, 6121, 6127, 6130, 6133, 6135, 6137, 6138, 6141, 6143, 6145, 6148, 6150, 6151, 6152, 6153, 6154, 6156, 6159, 6160, 6162, 6163, 6166, 6167, 6168, 6169, 6170, 6171, 6172, 6175, 6177, 6180, 6183, 6187, 6188, 6190, 6193, 6194, 6195, 6196, 6198, 6201, 6202, 6204, 6207, 6211, 6212, 6214, 6215, 6216, 6218, 6219, 6220, 6222, 6225, 6226, 6230, 6235, 6239, 6241, 6242, 6243, 6244, 6245, 6247, 6250, 6252, 6254, 6259, 6260, 6261, 6264, 6265, 6268, 6270, 6273, 6275, 6278, 6280, 6282, 6286, 6287, 6288, 6291, 6293, 6298, 6299, 6300, 6302, 6303, 6305, 6307, 6308, 6312, 6313, 6314, 6315, 6316, 6317, 6318, 6320, 6321, 6323, 6325, 6327, 6328, 6334, 6335, 6337, 6340, 6341, 6344, 6348, 6350, 6353, 6354, 6357, 6360, 6362, 6364, 6368, 6372, 6374, 6377, 6378, 6383, 6386, 6392, 6394, 6398, 6400, 6404, 6405, 6409, 6410, 6411, 6417, 6418, 6424, 6426, 6429, 6431, 6432, 6433, 6435, 6436, 6437, 6438, 6440, 6442, 6445, 6446, 6448, 6449, 6452, 6455, 6457, 6458, 6461, 6462, 6463, 6464, 6465, 6470, 6473, 6475, 6478, 6480, 6481, 6484, 6485, 6486, 6489, 6491, 6492, 6494, 6498, 6502, 6504, 6505, 6507, 6511, 6513, 6514, 6086, 6088, 6091, 6094, 6097, 6099, 6101, 6103, 6105, 6108, 6112, 6115, 6116, 6117, 6119, 6120, 6122, 6123, 6125, 6126, 6128, 6131, 6132, 6134, 6136, 6139, 6142, 6144, 6146, 6149, 6155, 6157, 6161, 6164, 6173, 6174, 6176, 6178, 6181, 6182, 6184, 6186, 6189, 6191, 6192, 6197, 6199, 6200, 6205, 6206, 6208, 6210, 6213, 6221, 6223, 6224, 6227, 6229, 6231, 6232, 6233, 6234, 6236, 6237, 6238, 6240, 6246, 6248, 6251, 6253, 6255, 6256, 6257, 6258, 6262, 6266, 6269, 6271, 6272, 6274, 6276, 6277, 6281, 6283, 6284, 6285, 6289, 6292, 6294, 6295, 6296, 6297, 6301, 6304, 6306, 6309, 6310, 6311, 6319, 6322, 6324, 6326, 6329, 6330, 6331, 6333, 6336, 6338, 6342, 6345, 6347, 6349, 6351, 6355, 6356, 6358, 6359, 6361, 6365, 6367, 6369, 6371, 6373, 6375, 6376, 6379, 6381, 6382, 6384, 6387, 6388, 6389, 6390, 6393, 6395, 6397, 6399, 6401, 6402, 6403, 6406, 6407, 6412, 6413, 6414, 6415, 6416, 6419, 6420, 6421, 6422, 6423, 6425, 6427, 6428, 6434, 6441, 6443, 6444, 6447, 6450, 6451, 6453, 6459, 6460, 6466, 6467, 6468, 6469, 6471, 6472, 6474, 6476, 6479, 6482, 6487, 6490, 6493, 6496, 6497, 6499, 6500, 6501, 6503, 6506, 6508, 6510, 6512, 6515, 6518, 6521, 6522, 6523, 6524, 6528, 6532, 6535, 6539, 6541, 6560, 6561, 6564, 6566, 6567, 6570, 6573, 6576, 6577, 6578, 6579, 6583, 6584, 6585, 6586, 6587, 6590, 6591, 6594, 6596, 6597, 6603, 6605, 6608, 6609, 6610, 6611, 6612, 6615, 6625, 6630, 6632, 6633, 6634, 6638, 6639, 6642, 6643, 6644, 6647, 6650, 6655, 6657, 6658, 6659, 6661, 6663, 6664, 6665, 6669, 6671, 6674, 6677, 6678, 6679, 6680, 6681, 6682, 6686, 6687, 6688, 6689, 6690, 6691, 6693, 6695, 6696, 6697, 6699, 6701, 6703, 6704, 6705, 6706, 6707, 6708, 6710, 6711, 6712, 6713, 6717, 6718, 6720, 6721, 6722, 6725, 6727, 6732, 6734, 6735, 6739, 6741, 6745, 6748, 6751, 6755, 6759, 6762, 6764, 6767, 6770, 6772, 6773, 6774, 6777, 6778, 6782, 6785, 6786, 6787, 6790, 6791, 6794, 6795, 6796, 6798, 6800, 6802, 6803, 6806, 6811, 6814, 6815, 6818, 6824, 6829, 6834, 6835, 6842, 6516, 6519, 6525, 6526, 6527, 6529, 6531, 6533, 6536, 6537, 6538, 6540, 6541, 6542, 6543, 6544, 6545, 6546, 6547, 6548, 6550, 6551, 6552, 6553, 6554, 6556, 6558, 6562, 6563, 6565, 6568, 6571, 6572, 6575, 6580, 6582, 6588, 6589, 6592, 6595, 6598, 6599, 6600, 6601, 6602, 6604, 6606, 6607, 6613, 6614, 6617, 6618, 6619, 6620, 6621, 6623, 6624, 6627, 6628, 6629, 6631, 6635, 6640, 6641, 6645, 6646, 6649, 6651, 6652, 6653, 6656, 6660, 6662, 6666, 6668, 6670, 6672, 6675, 6676, 6683, 6685, 6692, 6694, 6698, 6700, 6702, 6709, 6714, 6715, 6716, 6719, 6723, 6726, 6728, 6730, 6731, 6736, 6738, 6740, 6742, 6744, 6746, 6747, 6749, 6752, 6754, 6756, 6757, 6758, 6760, 6761, 6765, 6769, 6775, 6779, 6781, 6783, 6784, 6789, 6792, 6797, 6799, 6801, 6804, 6805, 6807, 6809, 6810, 6812, 6816, 6817, 6819, 6821, 6822, 6825, 6827, 6828, 6830, 6831, 6832, 6833, 6836, 6837, 6838, 6839, 6840, 6841, 6843, 6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 6648, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6844, 6848, 6850, 6852, 6854, 6857, 6859, 6861, 6862, 6865, 6868, 6870, 6871, 6872, 6874, 6875, 6876, 6880, 6883, 6886, 6887, 6888, 6890, 6891, 6894, 6896, 6897, 6898, 6899, 6900, 6901, 6902, 6904, 6905, 6906, 6910, 6912, 6917, 6920, 6845, 6847, 6849, 6851, 6853, 6855, 6858, 6860, 6863, 6866, 6869, 6873, 6877, 6879, 6881, 6882, 6884, 6889, 6892, 6893, 6895, 6907, 6908, 6909, 6911, 6913, 6915, 6916, 6918, 6921, 6924, 6927, 6928, 6933, 6935, 6937, 6939, 6940, 6943, 6946, 6947, 6948, 6949, 6951, 6953, 6954, 6955, 6959, 6961, 6964, 6965, 6968, 6969, 6972, 6973, 6976, 6979, 6980, 6922, 6925, 6929, 6930, 6931, 6932, 6934, 6936, 6942, 6944, 6945, 6950, 6952, 6956, 6957, 6958, 6960, 6962, 6963, 6966, 6967, 6970, 6971, 6974, 6975, 6977, 6981, 6983, 6986, 6992, 6995, 6998, 7002, 7006, 7013, 7017, 7022, 7024, 7027, 7030, 7032, 7036, 7037, 7040, 7050, 7052, 7055, 7056, 7058, 7059, 7060, 7064, 7067, 7072, 7074, 7076, 7077, 7084, 7085, 7086, 7087, 7088, 7089, 7090, 7091, 7096, 7097, 7100, 7102, 7109, 7110, 7113, 7114, 7115, 7118, 7121, 7123, 7124, 7131, 7133, 7135, 7136, 7138, 7139, 7140, 7144, 7146, 7148, 7149, 7158, 7159, 7160, 7163, 7165, 7166, 7168, 7172, 7175, 7178, 7180, 7181, 7183, 7185, 7186, 7187, 7192, 7194, 7199, 7202, 7203, 7204, 7205, 7207, 7208, 7213, 7214, 7216, 7220, 7221, 7227, 7228, 7230, 7233, 7235, 7237, 7239, 7243, 7245, 7246, 7248, 7249, 7251, 7255, 7256, 7260, 7263, 7264, 7265, 7266, 7268, 7269, 7272, 7276, 7277, 7278, 7279, 7280, 7281, 7283, 7284, 7287, 7291, 7295, 7299, 7302, 7303, 7306, 7309, 7310, 7311, 7314, 7315, 7320, 7321, 7324, 7325, 7329, 7331, 7332, 7334, 7336, 7339, 7340, 7341, 7344, 7350, 7353, 7355, 7358, 7360, 7362, 7372, 7374, 7375, 7378, 7381, 7385, 7387, 7390, 7391, 7392, 7394, 7397, 7401, 7402, 7405, 7410, 7413, 7415, 7416, 7417, 7420, 6984, 6987, 6989, 6990, 6991, 6993, 6996, 6999, 7001, 7003, 7005, 7007, 7009, 7010, 7011, 7012, 7014, 7016, 7018, 7020, 7023, 7025, 7026, 7028, 7029, 7031, 7033, 7034, 7035, 7038, 7039, 7041, 7042, 7043, 7044, 7045, 7046, 7047, 7048, 7049, 7051, 7053, 7054, 7057, 7061, 7062, 7063, 7065, 7066, 7068, 7070, 7071, 7073, 7075, 7078, 7080, 7081, 7082, 7083, 7092, 7093, 7094, 7095, 7098, 7101, 7103, 7105, 7106, 7107, 7108, 7111, 7112, 7116, 7119, 7122, 7125, 7126, 7127, 7128, 7129, 7130, 7132, 7134, 7137, 7141, 7142, 7143, 7147, 7150, 7152, 7154, 7155, 7156, 7157, 7161, 7167, 7170, 7171, 7173, 7174, 7176, 7177, 7179, 7182, 7184, 7188, 7189, 7190, 7191, 7193, 7195, 7196, 7197, 7198, 7200, 7206, 7210, 7211, 7212, 7215, 7217, 7218, 7219, 7222, 7223, 7224, 7225, 7226, 7229, 7231, 7232, 7236, 7240, 7241, 7242, 7244, 7247, 7250, 7253, 7254, 7257, 7258, 7259, 7261, 7262, 7267, 7270, 7271, 7273, 7274, 7275, 7282, 7285, 7289, 7290, 7292, 7293, 7294, 7296, 7297, 7298, 7301, 7304, 7307, 7308, 7312, 7316, 7317, 7318, 7319, 7322, 7326, 7328, 7330, 7333, 7335, 7337, 7342, 7345, 7347, 7348, 7349, 7351, 7354, 7356, 7357, 7359, 7361, 7363, 7364, 7365, 7366, 7367, 7368, 7369, 7370, 7371, 7373, 7376, 7379, 7382, 7383, 7384, 7386, 7388, 7389, 7393, 7395, 7398, 7400, 7403, 7404, 7407, 7408, 7409, 7411, 7419, 7421, 7422, 7425, 7427, 7435, 7438, 7439, 7440, 7442, 7444, 7448, 7449, 7456, 7459, 7462, 7463, 7465, 7466, 7467, 7470, 7471, 7474, 7476, 7477, 7480, 7481, 7485, 7486, 7489, 7490, 7493, 7496, 7500, 7503, 7508, 7512, 7518, 7519, 7520, 7522, 7524, 7525, 7527, 7528, 7529, 7532, 7540, 7542, 7543, 7545, 7549, 7552, 7554, 7423, 7426, 7428, 7430, 7431, 7432, 7433, 7434, 7436, 7445, 7446, 7447, 7450, 7451, 7452, 7453, 7454, 7455, 7457, 7460, 7464, 7468, 7472, 7475, 7478, 7479, 7482, 7483, 7484, 7487, 7488, 7492, 7494, 7495, 7497, 7498, 7499, 7501, 7505, 7506, 7507, 7509, 7510, 7511, 7513, 7515, 7516, 7517, 7521, 7523, 7526, 7530, 7533, 7534, 7535, 7536, 7537, 7538, 7539, 7541, 7544, 7546, 7547, 7548, 7550, 7555, 7558, 7559, 7560, 7565, 7566, 7567, 7570, 7571, 7573, 7574, 7575, 7576, 7577, 7578, 7579, 7580, 7581, 7582, 7585, 7586, 7587, 7588, 7589, 7590, 7596, 7597, 7598, 7600, 7603, 7606, 7609, 7610, 7615, 7618, 7620, 7621, 7623, 7627, 7629, 7633, 7635, 7636, 7643, 7647, 7651, 7655, 7661, 7666, 7672, 7674, 7676, 7677, 7682, 7683, 7685, 7687, 7689, 7690, 7691, 7694, 7699, 7701, 7702, 7704, 7707, 7709, 7711, 7712, 7713, 7714, 7716, 7718, 7720, 7726, 7728, 7729, 7733, 7734, 7735, 7736, 7738, 7740, 7741, 7744, 7746, 7747, 7748, 7749, 7750, 7751, 7752, 7753, 7754, 7755, 7756, 7758, 7556, 7561, 7563, 7568, 7583, 7584, 7591, 7593, 7594, 7595, 7599, 7601, 7604, 7607, 7608, 7611, 7613, 7614, 7616, 7617, 7619, 7622, 7624, 7626, 7628, 7631, 7637, 7638, 7639, 7640, 7641, 7642, 7644, 7645, 7646, 7649, 7650, 7652, 7654, 7656, 7657, 7658, 7659, 7660, 7662, 7663, 7665, 7667, 7669, 7670, 7671, 7673, 7675, 7678, 7679, 7680, 7681, 7684, 7686, 7688, 7692, 7695, 7697, 7698, 7700, 7703, 7705, 7708, 7710, 7715, 7717, 7719, 7721, 7722, 7723, 7724, 7725, 7727, 7730, 7731, 7732, 7737, 7739, 7742, 7743, 7745, 7757, 7759, 7760, 7761, 7764, 7770, 7774, 7775, 7778, 7782, 7786, 7788, 7795, 7797, 7799, 7805, 7807, 7809, 7810, 7811, 7815, 7817, 7819, 7820, 7822, 7823, 7824, 7828, 7832, 7834, 7837, 7839, 7843, 7845, 7851, 7852, 7857, 7860, 7863, 7865, 7868, 7874, 7881, 7885, 7889, 7892, 7894, 7896, 7900, 7902, 7904, 7907, 7909, 7910, 7913, 7917, 7922, 7925, 7926, 7928, 7933, 7934, 7937, 7941, 7945, 7946, 7948, 7950, 7951, 7952, 7953, 7954, 7955, 7956, 7957, 7963, 7964, 7968, 7971, 7972, 7973, 7976, 7979, 7980, 7981, 7982, 7983, 7985, 7986, 7987, 7988, 7991, 7762, 7765, 7767, 7768, 7771, 7773, 7776, 7779, 7781, 7783, 7784, 7785, 7789, 7791, 7792, 7793, 7794, 7796, 7798, 7800, 7802, 7803, 7808, 7812, 7813, 7814, 7816, 7818, 7821, 7825, 7827, 7829, 7830, 7833, 7835, 7836, 7838, 7840, 7841, 7842, 7844, 7846, 7847, 7848, 7849, 7853, 7854, 7855, 7856, 7858, 7861, 7864, 7866, 7869, 7870, 7871, 7872, 7873, 7875, 7877, 7878, 7879, 7880, 7882, 7884, 7886, 7888, 7890, 7897, 7899, 7903, 7905, 7912, 7914, 7916, 7918, 7919, 7920, 7921, 7923, 7929, 7931, 7932, 7936, 7938, 7939, 7940, 7942, 7943, 7944, 7947, 7949, 7958, 7960, 7962, 7965, 7967, 7969, 7970, 7974, 7977, 7989, 7990, 7992, 7995, 7996, 8000, 8003, 8006, 8007, 8010, 8012, 8015, 8016, 8018, 8019, 8026, 8027, 8030, 8034, 8035, 8038, 8039, 8043, 8044, 8046, 8049, 8050, 8052, 8053, 8055, 8056, 8062, 8064, 8066, 8067, 8068, 8069, 8070, 8071, 8074, 8076, 8077, 8078, 8079, 8080, 8081, 7993, 7997, 7999, 8001, 8004, 8005, 8008, 8009, 8011, 8013, 8017, 8020, 8021, 8022, 8023, 8024, 8025, 8028, 8031, 8033, 8036, 8040, 8042, 8047, 8051, 8054, 8057, 8059, 8060, 8061, 8065, 8072, 8073, 8075, 8082, 8083, 8084, 8085y 8087, 8088, 8089, 8090, 8093, 8095, 8098, 8100, 8101, 8102, 8104, 8107, 8110, 8111, 8114, 8115, 8116, 8118, 8122, 8124, 8126, 8127, 8129, 8132, 8134, 8136, 8138, 8142, 8143, 8144, 8146, 8151, 8157, 8160, 8163, 8165, 8168, 8169, 8170, 8173, 8174, 8175, 8176, 8178, 8181, 8185, 8187, 8188, 8189, 8190, 8191, 8193, 8194, 8200, 8203, 8206, 8208, 8209, 8212, 8214, 8216, 8217, 8220, 8222, 8224, 8228, 8230, 8091, 8094, 8096, 8099, 8103, 8105, 8108, 8112, 8113, 8117, 8119, 8121, 8123, 8125, 8128, 8130, 8131, 8133, 8135, 8137, 8139, 8145, 8147, 8148, 8149, 8150, 8152, 8153, 8154, 8155, 8156, 8158, 8161, 8164, 8166, 8167, 8171, 8177, 8179, 8180, 8182, 8183, 8184, 8186, 8192, 8195, 8197, 8198, 8199, 8201, 8202, 8204, 8207, 8210, 8213, 8218, 8221, 8223, 8225, 8227, 8229, 8231, 8232, 8235, 8236, 8237, 8238, 8244, 8245, 8247, 8250, 8251, 8253, 8254, 8255, 8256, 8258, 8259, 8260, 8263, 8267, 8269, 8270, 8273, 8274, 8277, 8280, 8281, 8289, 8292, 8293, 8294, 8295, 8296, 8297, 8298, 8301, 8305, 8306, 8310, 8311, 8312, 8315, 8317, 8318, 8322, 8323, 8324, 8327, 8328, 8329, 8330, 8333, 8336, 8339, 8340, 8347, 8349, 8350, 8352, 8353, 8356, 8359, 8360, 8366, 8369, 8370, 8372, 8374, 8376, 8377, 8379, 8381, 8382, 8383, 8233, 8239, 8240, 8242, 8243, 8246, 8248, 8252, 8257, 8261, 8264, 8266, 8844, 8848, 8850, 8852, 8854, 8855, 8863, 8864, 8865, 8867, 8868, 8869, 8870, 8871, 8872, 8873, 8874, 8876, 8877, 8881, 8882, 8883, 8885, 8887, 8888, 8889, 8890, 8892, 8894, 8896, 8897, 8899, 8902, 8785, 8903, 8904, 8905, 8906, 8907, 8908, 8911, 8913, 8917, 8920, 8923, 8924, 8929, 8931, 8934, 8935, 8936, 8914, 8916, 8918, 8921, 8925, 8927, 8928, 8930, 8932, 8933, 8937, 8980, 8984, 8988, 8989, 8998, 9001, 9002, 9005, 9007, 9008, 9012, 9013, 9016, 9019, 9020, 9022, 9023, 9025, 9028, 9029, 9032, 9033, 9034, 9035, 9037, 9038, 9044, 9046, 9047, 9048, 9049, 9054, 8981, 8983, 8985, 8987, 8990, 8992, 8993, 8994, 8995, 8997, 8999, 9003, 9004, 9006, 9009, 9010, 9011, 9014, 9017, 9018, 9021, 9024, 9026, 9030, 9036, 9039, 9041, 9042, 9043, 9045, 9050, 9051, 9052, 9053, 9055, 9058, 9060, 9063, 9066, 9067, 9068, 9069, 9070, 9071, 9074, 9075, 9077, 9078, 9079, 9080, 9082, 9084, 9088, 9089, 9090, 9099, 9103, 9104, 9105, 9107, 9111, 9056, 9061, 9064, 9072, 9081, 9083, 9085, 9086, 9087, 9091, 9092, 9093, 9094, 9095, 9096, 9097, 9098, 9100, 9102, 9106, 9108, 9109, 9110, 9112, 9113, 9116, 9118, 9125, 9126, 9128, 9129, 9130, 9136, 9141, 9143, 9148, 9150, 9153, 9157, 9158, 9159, 9163, 9164, 9165, 9167, 9168, 9171, 9173, 9177, 9180, 9181, 9182, 9183, 9185, 9187, 9188, 9189, 9191, 9192, 9193, 9194, 9197, 9198, 9200, 9206, 9207, 9208, 9209, 9211, 9216, 9218, 9219, 9220, 9221, 9222, 9223, 9226, 9228, 9229, 9230, 9231, 9232, 9233, 9234, 9237, 9238, 9240, 9243, 9246, 9248, 9253, 9256, 9257, 9260, 9263, 9264, 9266, 9269, 9271, 9279, 9280, 9281, 9282, 9283, 9284, 9290, 9114, 9119, 9121, 9122, 9123, 9124, 9127, 9131, 9133, 9134, 9135, 9137, 9138, 9139, 9140, 9142, 9144, 9146, 9147, 9149, 9151, 9152, 9154, 9155, 9156, 9160, 9162, 9166, 9169, 9172, 9174, 9175, 9176, 9178, 9184, 9186, 9190, 9195, 9199, 9201, 9202, 9203, 9204, 9205, 9212, 9214, 9215, 9217, 9224, 9227, 9235, 9239, 3241, 9244, 9247, 9249, 9251, 9252, 9254, 9258, 9261, 9265, 9267, 9270, 9273, 9274, 9275, 9276, 9277, 9278, 9285, 9286, 9287, 9288, 9289, 9291, 9292, 9295, 9297, 9300, 9302, 9303, 9304, 9307, 9308, 9310, 9311, 9313, 9319, 9321, 9323, 9324, 9328, 9333, 9334, 9337, 9338, 9339, 9342, 9344, 9348, 9351, 9352, 9354, 9355, 9357, 9360, 9367, 9371, 9374, 9377, 9379, 9383, 9384, 9385, 9388, 9389, 9390, 9393, 9394, 9398, 9401, 9402, 9406, 9408, 9409, 9410, 9413, 9415, 9416, 9417, 9418, 9419, 9421, 9422, 9425, 9429, 9433, 9434, 9435, 9436, 9437, 9439, 9440, 9446, 9452, 9453, 9454, 9455, 9457, 9458, 9459, 9462, 9466, 9467, 9468, 9470, 9474, 9479, 9482, 9487, 9488, 9489, 9492, 9495, 9497, 9499, 9500, 9504, 9505, 9508, 9513, 9514, 9519, 9522, 9523, 9524, 9526, 9528, 9532, 9533, 9534, 9535, 9537, 9538, 9541, 9542, 9543, 9545, 9546, 9548, 9293, 9296, 9298, 9301, 9305, 9309, 9312, 9314, 9316, 9317, 9318, 9320, 9322, 9325, 9326, 9327, 9329, 9331, 9332, 9335, 9336, 9340, 9345, 9347, 9349, 9353, 9356, 9358, 9361, 9363, 9364, 9365, 9368, 9370, 9372, 9375, 9376, 9378, 9380, 9382, 9386, 9391, 9395, 9397, 9399, 9400, 9403, 9405, 9407, 9411, 9412,9414, 9420, 9423, 9424, 9426, 9428, 9430, 9431, 9432, 9438, 9441, 9443, 9444, 9445, 9447, 9448, 9449, 9450, 9451, 9456, 9460, 9461, 9464, 9465, 9469, 9471, 9473, 9475, 9477, 9478, 9480, 9483, 9485, 9490, 9493, 9494, 9496, 9498, 9501, 9502, 9503, 9506, 9509, 9511, 9512, 9515, 9516, 9517, 9518, 9520, 9521, 9525, 9527, 9529, 9530, 9536, 9539, 9544, 9547, 9549, 9550, 9551, 9555, 9556, 9557, 9559, 9560, 9563, 9564, 9565, 9566, 9569, 9570, 9573, 9577, 9578, 9579, 9580, 9585, 9586, 9587, 9588, 9591, 9593, 9596, 9552, 9554, 9558, 9561, 9567, 9571, 9574, 9576, 9581, 9583, 9584, 9589, 9592, 9594, 9595, 9598, 9602, 9604, 9605, 9608, 9612, 9613, 9614, 9617, 9618, 9621, 9622, 9625, 9626, 9627, 9632, 9633, 9638, 9640, 9643, 9644, 9645, 9646, 9651, 9654, 9656, 9657, 9658, 9661, 9662, 9665, 9666, 9667; 9668, 9672, 9673, 9675, 9676, 9677, 9680, 9683, 9686, 9688, 9691, 9694, 9698, 9699, 9702, 9705, 9707, 9710, 9711, 9715, 9719, 9720, 9722, 9723, 9726, 9729, 9732, 9733, 9735, 9737, 9738, 9741, 9744, 9745, 9746, 9747, 9748, 9749, 9750, 9754, 9755, 9756, 9758, 9759, 9768, 9771, 9772, 9776, 9777, 9781, 9782, 9784, 9787, 9789, 9790, 9792, 9796, 9797, 9800,,9805, 9806, 9812, 981S, 9818, 9821, 9823, 9825, 9827, 9831, 9832, 9835, 9837, 9839, 9841, 9842, 9844, 9845, 9851, 9853, 9854, 9855, 9857, 9860, 9862, 9863, 9865, 9871, 9873, 9875, 9878, 9879, 9599, 9601, 9603, 9606, 9607, 9609, 9611, 9615, 9619, 9623, 9624, 9628, 9630, 9631, 9634, 9635, 9637, 9639, 9641, 9647, 9649, 9650, 9652, 9653, 9659, 9660, 9663, 9664, 9670, 9671, 9679, 9682, 9684, 9687, 9690, 9692, 9693, 9695, 9697, 9700, 9701, 9703, 9706, 9708, 9712, 9713, 9714, 9716, 9717, 9718, 9721, 9724, 9727, 9730, 9734, 9739, 9742, 9751, 9753, 9757, 9760, 9761, 9762, 9763, 9764, 9765, 9766, 9767, 9769, 9773, 9775, 9778, 9780, 9783, 9786, 9788, 9791, 9793, 9794, 9795, 9798, 9801, 9803, 9804, 9807, 9808, 9809, 9810, 9811, 9813, 9816, 9817, 9819, 9820, 9822, 9826, 9828, 9830, 9833, 9836, 9838, 9840, 9843, 9846, 9847, 9848, 9849, 9850, 9852, 9856, 9858, 9859, 9861, 9864, 9866, 9867, 9868, 9869, 9870, 9872, 9876, 9877, 9880, 9881, 9882, 9886, 9890, 9891, 9894, 9900, 9902, 9904, 9908, 9911, 9912, 9915, 9917, 9919, 9923, 9925, 9928, 9935, 9936, 9940, 9943, 9949, 9953, 9954, 9956, 9957, 9958, 9962, 9963, 9964, 9968, 9969, 9975, 9978, 9981, 9988, 9989, 9990, 9991, 9992, 9995, 9997, 10011, 10012, 10014, 10017, 10018,10031,10032,10033, 10034, 10035,10037,10041,10042,10046, 10050,10054,10058, 10059, 9883, 9885, 9887, 9889, 9892, 9893, 9895, 9896, 9897, 9898, 9899, 9901, 9903, 9905, 9907, 9909, 9913, 9914, 9916, 9918, 9920, 9921, 9922, 9924, 9926, 9929, 9931, 9932, 9933, 9934, 9937, 9938, 9939, 9941, 9942, 9944, 9945, 9946, 9947, 9948, 9950, 9952, 9955, 9959, 9960, 9961, 9966, 9967, 9970, 9972, 9973, 9974, 9976, 9979, 9980, 9982, 9983, 9984, 9985, 9986, 9987, 9993, 9994, 9996, 9998, 9999,10000,10001,10002,10003,10004,10005,10006,10007,10008,10009,10010, 10013, 10015,10016,10019,10020,10021,10022,10023,10025,10026,10027,10028, 10030,10036,10038,10040,10043,10044,10045,10047,10048,10049,10051,10053, 10055,10056,10057,10060,10061,10064,10067,10068,10070,10071,10072,10074, 10079,10081,10083,10088,10091,10095,10096,10097,10101,10103,10-105,10106, 10109,10110,10111,10113,10116,10118,10120,10122,10125,10126,10127,10131, 10134,10137,10138,10144,10147,10149,10151,10152,10155,10156,10159,10160, 10169,10172,10174,10175,10178,10181,10186,10188,10189,10190,10191,10192, 10196,10199,10203,10204,10210,10211,10216,10218,10221,10224,10225,10226, 10229,10230,10231,10232,10234,10239,10241,10244,10252,10253,10257,10258, 10259,10261,10266,10272,10276,10062,10065,10069,10075, 10077,10078,10080, 10082,10084,10086,10087,10089,10090,10092,10093,10094,10098,10099,10100, 10102,10104, 10107,10112,10114,10117,10119,10121,10123, 10124, 10129,10130, 10132,10133,10135,10139,10140,10141,10142,10143,10145,10148,10150,10153, 10154,10157,10161,10163,10164,10165,10166,10167,10170, 10173,10176,10177, 10179,10182,10183,10184,10187,10193,10194,10195,10197, 10198,10200,10201, 10202,10205,10206,10207,10209,10212,10213,10214,10215,10219,10220,10222, 10223,10227,10228,10233,10235,10236,10237,10240, 10242,10243,10245,10247, 10248, 10249, 10251, 10254, 10255, 10256, 10260, 10262, 10263, 10264, 10265, 10267, 10268, 10269,10270,10271, 10273, 10274,10275,10277, 10278,10279,10282, 10285, 10287, 10291, 10292, 10297, 10299, 10301, 10304, 10306, 10308, 10310, 10314, 10317, 103 18, 10320, 10322, 10327, 10329, 10330,10333,10335, 10336, 10337, 10340, 10342, 10348,10350,10351,10354,10358,10359,10360,10362,10366,10369,10372,10373, 10374, 10376, 10378, 103 83, 103 85, 10391, 10398, 20403,10407,10410,10413,10415, 10419, 10422, 10425, 10427, 10428, 10429, 10430, 10432, 10433, 10434, 10437, 10438, 10439, 10442, 10443, 10445, 10446, 10447, 10448, 10452, 10453, 10454, 10455, 10456, 10460, 10463, 10466, 10467, 10469, 10470, 10473, 10475, 10477, 10480, 10484, 10488, 10490,10494,10495,10497, 10501,10502,10503,10507,10508,10510,10517,10518, 10520, 10522,10524,10525,10528, 10529, 10533,10536, 10537, 10540, 10541, 10545, 10547,10551,10553,10556,10559,10560,10563,10564,10565,10568,10571,10574, 10576,10579,10581,10583, 10588,10589,10590,10592, 10593,10596,10597,10601, 10602, 10603, 10605, 10607, 10609,10610, 10612, 10613, 10617, 10618, 10621, 10624, 10627, 10630,10632,10634,10637,10638,10639, 10640, 10641, 10643, 10645, 10647, 10653, 10655, 10657,10659,10661, 10662, 10663, 10664,10665, 10666, 10667, 10668, 10669,10672, 10673, 10674,10675, 10280,10283, 10286, 10288, 10290,10293, 10295, 10298,10300,10302,10305, 10307,10309,10311, 10312,10313,10315,10319,10321, 10323,10325,10326,10328,10331,10338,10341,10343,10344,10345,10346,10347, 10349, 10352, 10355, 103 56, 10357, 10361, 10363, 10365, 10367, 10370,10375, 10377, 10379,10380,10381,10382,10384,10386,10387,10388,10390,10392,10394,10395, 10399,10401,10402,10404,10406,10408, 10411,10412,10414,10416,10417,10418, 10420,10423,10426,10431,10435,10440,10444,10449,10451,10457,10459,10461, 10462, 10464, 10465, 10468, 10471, 10476, 10478, 10481, 10483, 10485, 10487,10489, 10491, 10492, 10493, 10498, 10499, 10500, 10504, 10506, 10509, 10511, 10513, 10514, 10515,10516,10519,10521,10523,10526,10530,10531, 10532,10534,10535,10538, 10539,10542,10543,10544,10546,10548,10550,10552,10554,10557,10558,10561, 10566,10569,10572,10573,10577,10578, 10580,10582, 10584,10586,10594,10598, 10600, 10604,10606,10611, 10614,10616, 10619,10622, 10625, 10626,10628,10631, 10633,10635,10642,10644,10646,10648,10649,10650,10651,10652,10654,10656, 10658,10660,10670,10671,10676,10678,10684,10679,10681,10682,10683,10685, 10687,10688,10689,10690,10691,10693, 10696,10699, 10703, 10704,10709,10711, 10712,10713,10720,10721,10722,10724,10725,10726, 10728,10729,10734,10740, 10742,10743,10744,10745,10746,10748,10749,10751, 10754, 10758,10759,10760, 10764,10768,10769,10772,10775,10780, 10781,10783, 10786,10791,10796, 10801, 10808,10817,10818,10819,10821,10823,10826,10827, 10829,10830,10834, 10843, 10844, 10847, 10848, 10849, 10853, 10856, 10858, 10866, 10869, 10872, 10874, 10877, 10878, 10879,10882,10884, 10885,10889, 10892, 10893, 10896,10900,10901,10903, 10905, 10907, 10909, 10910,10911,10914, 10916, 10919, 10926, 10930, 10932, 10933, 10934, 10938, 10941, 10942, 10943,10944,10946,10947, 10953, 10955, 10956, 10958, 10959,10962,10967,10968, 10972,10975,10977,10978, 10981,10984,10985,10988, 10992, 10995, 10997, 10999, 11000, 11001, 11006, 11009, 11013, 11016, 11020, 11025, 11033, 11036,11040,11041,11042,11043, 11045,11046, 11048, 11052,11055, 11060, 11061, 11062,11064,11065,11067,11070, 11071,11072,11078,11079,11081, 11085, 11093,10694, 10697, 10700, 10702, 10705,10707, 10710, 10714, 10716, 10717, 10718, 10719,10723,10727,10730,10732,10733, 10735,10737, 10738, 10739, 10741, 10747, 10750,10752, 10755, 10757, 10761, 10762,10763,10765, 10767, 10770,10773, 10776, 10778,10779,10782,10784,10788,10789,10790,10792,10793,10794,10798,10799, 10800,10802,10804,10805,10806,10807,10809,10811,10812,10813,10814, 10815, 10816,10820,10822,10824,10831,10833,10835,10837,10838,10839,10840,10841, 10842,10845,10846,10850,10851,10854,10857,10859,10860,1086I,10862,10863, 10864, 10865, 10868, 10870,10871,10873,10875,10880, 10881, 10883, 10886, 10888, 10890,10894,10897,10899,10902,10904,10906,10908,10912,10915,10917,10920, 10922,10924,10925,10927,10928,10929,10931,10935,10937,10939,10945,10948, 10950,10951,10952,10954,10957,10960,10963,10965,10966,10969,10970,10971, 10973,10976,10979,10980,10982,10986, 10987,10989,10991,10993,10996, 10998, 11002,11004,11005,11007,11010,11012,11014,11015,11017,11019,11021,11022, 11023,11026,11027,11028,11029,11030,11031,11032,11034,11037,11039,11044, 11047,11049,11050,11051,11053,11054,11056, 11058,11059,11063,11066,11068, 11069,11073,11074, 11075,11076,11077,11080,11082,11083,11084,11086,11087, 11088,11089,11090,11091,11092,11094,11376,11381,11382,11383,11384,11387, 11397,11401,11405,11408,11414,11418,11421,11422,11424,11427,11429,11430, 11377,11379,11380,11385,11386,11388,11390,11391,11392, 11394,11395,11396, 11398, 11399,11400, .11402,11403,11404,11406,11409,11410,11411, 11412, 11415, 11416, 11417,11419,11423, 11425,11428,11431,11432,11433,11434,11438, 11442, 11443,11447,11449,11450, 11452,11456,11459,11463,11464,11467,11468,11472, 11477, 11480,11481,11482, 11483,11484,11488,11489,11493,11498, 11502,11504, 11505,11506,11507,11508,11509,11512,11513,11514, 11I517,11520,11522,11523, 11524,11526,11528, 11532, 11534,11435, 11439, 11444,11445,11446,11448,11451, 11453,11457,11458, 11460,11461,11462,11465,11466,11469,11473,11474,11475, 11476,11478,11479,11485,11486, 11487, 11490, 11494,11497,11499, 11500,11501, 11503, 11510,11511,11515, 11518, 11519, 11521, 11525,11527,11529,11535, 11539, 11540,11541,11548, 11550,11551, 11552,115SS, 11556,11557,11560,11561, 11562, 11568,11569,11571,11572,11573,11577,11536, 11542,11545, 11546,11547,11549, 11553,11554,11563,11566, 11570,11574,11578, 11585, 11586,11590, 11591, 11592, 11595,11596,11597,11600,11579, 11582,11587, 11593,11594,11598,11601,11602, 11606,11607,11608,11609,11616,11618,11622,11626,11628,11632,11633,11603, 11610,11613,11614,11615,11617,11619,11623, 11627,11629,11634,11635,11640, 11641,11642,11643,11647,11648,11654, 11655,11656,11657, 11658,11636,11639, 11644,11645,11646, 11649, 11652,11653,11659, 11663,11664,11665,11666,11670, 11671,11672, 11673,11677,11681,11687,11690,11694, 11696,11697,11701,11705, 11709,11713, 11719, 11723, 11729, 11733,11739,11744, 11745, 11748, 11749,11751, 11755,11759,11763,11770,11772,11774,11776,11778,11782,11785,11660,11667, 11674,11675,11676,11678,11682,11685,11686,11688,11689,11691,11692,11693, 11695, 11698, 11699, 11700, 11702, 11706, 11710, 11716, 11720, 11724, 11725, 11727, 11728,11730,11731,11732,11734,11735,11736,11737,11738,11740,11743,11746, 11747,11750,11752,11756,11761,11762,11764,11765,11767,11768,11769,11773, 11775,11777,11779,11783,11784,11786,11790,11791,11792,11787,11793,11796, 11800,11802,11803,11805, 11810,11818,11819,11823,11824,11827,11828,11829, 11833,11836,11837,11839,11840,11847,11850,11852,11857,11860,11864,11866, 11797,11801,11804,11806, 11809,11811,11814,11815,11817,11820,11825,11830, 11835,11841,11844,11845,11846,11848, 11851, 11853, 11856, 11858, 11861, 11862, 11863,11865, 11867,11871,11876, 11878, 11882,11888,11891,11894, 11868, 11872, 11875,11877,11879,11883,11886,11887,11889,11890,11892,11893,11895,11898, 11902,11903,11904,11908,11909,11911,11912,11913,11914,11915,11917,11918, 11922,11926,11927,11930,11932,11933,11937,11941,11942,11946,11947,11948, 11949,11950,11951,11952,11955,11959, 11968,11972,11976,11978,11979,11980, 11981,11986, 11988, 11989, 11991, 11992,11995,11997,11998,12001, 12002,12004, 12005,11899,11905, 11910,11916,11919,11923,11924, 11925,11928,11929, 11931, 11934,11938,11943, 11953,11954,11956, 11960,11963,11964,11967,11969,11973, 11977,11982,11985,11987,11990,11993,11994,11996,11999,12000,12003, 12006, 12011, 12015, 12016, 12017, 12021, 12022, 12023, 12024, 12025, 12026,12027,12031, 12034, 12042, 12043, 12045, 12049, 12050, 12051, 12054, 12062, 12063, 12064, 12066, 12067, 12068, 12070, 12072, 12076, 12082, 12085, 12086, 12089, 12090, 12093, 12094, 12095, 12096, 12097, 12098, 12101, 12103, 12107, 12108, 12111, 12112, 12114, 12118, 12119,12120,12128,12007,12010,12012,12020,12028,12032, 12033, 12035, 12038, 12039, 12044,12046,12052, 12055, 12056,12057,12058, 12059,12060, 12061, 12065, 12069, 12071,12073,12077,12080,12081,12084,12087, 12088,12091, 12099,12100, 12102, 12104, 12109, 12110, 12113, 12115, 12121, 12122, 12123, 12124, 12125, 12127, 12129, 12130, 12135, 12136, 12141, 12144, 12147, 12148, 12149, 12153, 12159, 12160, 1213 1, 12134, 12137, 12138, 12139, 12140, 12142, 12143, 12145, 12146, 12150, 12154, 12157, 12158, 12161, 12162, 12163, 12164, 12168, 12171, 12176, 12181, 12187,12190, 12194, 12196,12197,12199, 12201, 12202, 12209, 12213,12216, 12220, 12221,12223, 12225,12226,12231,12233,12239,12243,12244,12250,12254,12256,12257,12259, 12266, 12270, 12271,12272,12274,12276, 12277, 12278, 12280, 12284, 12285,12288, 12289,12290,12291,12295,12296,12302, 12308,12313,12317,12321,12322,12323, 12324,12325,12327,12328,12330,12331,12332,12336,12337,12339,12343,12346, 12349,12353,12354,12355,12359,12361,12363,12367,12369,12370, 12372,12376, 12377, 12379,12380,12381, 12382, 12383,12385, 12389, 12393,12398, 12400, 12402, 12403, 12406, 12408, 12409, 12410, 12412, 12415, 12417, 12419, 12422, 12424, 12429, 12430,12432,12433,12435,12436,12437,12441,12445,12448,12449,12454,12458, 12459, 12460, 12165, 12169, 12170, 12172, 12175, 12177, 12180, 12182, 12185, 12186, 12188, 12191, 12195, 12198, 12200, 12203,12206,12207,12208, 12210, 12214, 12217, 12222, 12224, 12227, 12228, 12229, 12230, 12232, 12234, 12237, 12238, 12240,12241, 12242, 12245, 12248, 12249, 12251, 1225 5, 12258, 12260, 12262, 12263, 12264, 12265, 12267, 12268, 12269, 12273, 12279, 12281, 12286, 12287, 12292, 12297, 12300, 12303, 12306, 12307,12309, 12312, 12314, 12318, 12326,12333,12338, 12340,12341,12342, 12345, 12347, 12348, 12352, 12356, 12360, 12362, 12364, 12371, 12373, 12378, 12386, 12390, 12394, 12397, 12401, 12404, 12405, 12411, 12413, 12418, 12420, 12423, 12425, 12428, 12438, 12439, 12440, 12442, 12443, 12446, 12450, 12453, 12455, 12461, 12465, 12467, 12468, 12472, 12474, 12477, 12480, 12484, 12486, 12488, 12489,12490, 12493, 12495, 12499,12501, 12504, 12506, 12462, 12469, 12475, 12478, 12481, 12483, 12485, 12487, 12492, 12494, 12496, 12497, 12498,12500,12502, 12505, 12507, 12511, 12517, 12520, 12522, 12523, 12524, 12528, 12530, 12534, 12535, 12536, 12537, 12541, 12542, 12547, 12550, 12551, 12552, 12554, 12555, 12560, 12564, 12565, 12569, 12571, 12574, 12579, 12581, 12586, 12590, 12592, 12593, 12594, 12596, 12600,12601, 12602, 12604, 12610, 12613, 12614, 12615, 12616, 12620, 12626, 12630, 12508, 12512, 12515, 12518, 12521, 12525, 12529, 12531, 12538, 12543, 12546, 12548, 12549, 12553, 12556, 12559, 12561, 12566, 12570, 12572, 12573, 12575, 12578, 12582, 12585, 12587, 12595, 12597, 12599, 12603, 12605, 12608, 12609, 12611, 12617, 12618, 12621, 12624, 12625, 12627, 12631, 12636, 12637, 12638, 12639, 12643, 12647, 12648, 12652, 12654, 12660, 12664, 12666, 12670,12672,12675, 12677, 12680, 12686,12691, 12692, 12695, 12699, 12700, 12701, 12703, 12705, 12709, 12710, 12714, 12715, 12716, 12718, 12719, 12720, 12724, 12725, 12728, 12732, 12738, 12739, 12743, 12744, 12745, 12747, 12748, 12752, 12757, 12763, 12764, 12766, 12767, 12768, 12771, 12776, 12777, 12781, 12785, 12787, 12788, 12791, 12792, 12796, 12797, 12800, 12804, 12808, 12813, 12815, 12816, 12817, 12822, 12825, 12828, 12831, 12833, 12834, 12837, 12839, 12841, 12842, 12632, 12635, 12640, 12641, 12644, 12649, 12653, 12655, 12658, 12661, 12662, 12663, 12665, 12667, 12671, 12673, 12678, 12679, 12681, 12682, 12683, 12684, 12685, 12687, 12688, 12689, 12690, 12693, 12694, 12696, 12702, 12704, 12706, 12712, 12713, 12717, 12721, 12726, 12729, 12730, 12731, 12733, 12736,12737,12740,12746,12749, 12750,12751, 12753, 12754, 12755,12756,12758,12760,12761,12762,12765,12769,12770,12772,12775,12778, 12782,12786,12789,12790,12793,12794,12795,12798,12799,12801,12805,12809, 12812,12814,12818,12821,12823,12824,12826,12827,12832,12835,12836,12838, 12840,12843,12844,12845,12849,12850,12854,12857,12862,12866, 12867,12868, 12870, 12872,12880,12881,12884,12885,12889,12890,12892,12896,12898,12899, 12903, 12907, 12910, 12913, 12919, 12920, 12921, 12923, 12928, 1293 2, 1293 8, 12942, 12945, 12948, 12950, 12951, 12953, 12959, 12846, 12851, 12855, 12858, 12861, 12863, 12869,12871,12873,12876,12877,12878,12879,12882,12883,12886,12887,12888, 12891, 12893, 12894, 12895, 12900, 12901, 12902, 12904, 12908, 12909, 12911, 12912, 12914,12917,12918,12924,12927,12929,12933,12936,12937,12939,12943,12949, 12954,12957,12958,12960,12961,12965,12969,12975,12917,12962,12966,12967, 12968, 12970, 12971, 12972,12973,12974, 12976,12978,12981,12982, 12986, 12989, 12941,12992,12993,12995,12999,13001, 12983, 12987, 12996, 12997, 12998, 13000, 13002, 13005, 13009, 13013, 13017, 13019, 13025, 13029, 13030, 13032, 13033, 13034, 13037, 13040, 13042, 13043,13044, 13048, 13049, 13051,13052, 13053, 13057, 13062, 13064, 13065, 13066, 13067, 13072, 13073, 13076,13078,13082,13083,13085,13087, 13088, 13089, 13092, 13096, 13100, 13101, 13102, 13105, 13108, 13109, 13110, 13114, 13117, 13118, 13124, 13129, 13131, 13132, 13138, 13 144, 13146, 13 147, 13148, 13152, 13156,13159,13164,13167,13168,13170,13171,13172,13173,13174,13184,13185, 13006, 13010, 13014, 13018, 13020, 13021, 13022,13023,13024,13026,13031,13035, 13036, 13038, 13039, 13041, 13045, 13050, 13054,13058, 13061, 13063, 13068, 13069, 13070, 13071,13074,13075,13077,13079,13084,13086, 13090,13091, 13093,13097, 13104,13107,13111,13115,13119,13121, 13122,13123, 13125,13126, 13127,13128, 13130, 13133,13137, 13139,13142, 13143, 13145,13149, 13153, 13157, 13158,13160, 13163, 13165,13166,13169,13175,13176,13177,13178, 13179,13180, 13.181,13182, 13183,13186,13189,13190,13191,13195,13196,13197,13199,13200,13204, 13206, 13192, 13198, 13201, 13207, 13212, 13213, 13226, 13228, 13231, 13235, 13240, 13245, 13247,13248, 13250, 13254,13256,13258, 13264,13265,13268,13269,13273,13274, 13277, 13279, 13280, 13281, 13286, 13208, 13211, 13214, 13217, 13220, 13222, 13224, 13225, 13227,13229, 13232, 13233, 13234, 13237, 13239, 13241,13242, 13244,13246, 13249,13251,13255,13257,13259,13262,13263,13266,13267,13270,13275,13276, 13282, 13285, 13641, 13645, 13646,13649, 13650,13652, 13653, 13654, 13655, 13658, 13659, 13642,13647,13648,13656,13660,13661,13664,13669, 13670, 13671,13672, 13673, 13675, 13676, 13677, 13681, 13683, 13685, 13687, 13689, 13691, 13693, 13696, 13665, 13668, 13674, 13678, 13682, 13684, 13686, 13688, 13690, 13692, 13694, 13695, 13697, 13701, 13702, 13703, 13709, 13713, 13714, 13715, 13719,13721,13722,13726, 13728, 13732, 13735, 13740, 13698, 13704, 13705, 13706, 13707, 13708, 13710, 13716, 13717, 13718, 13720, 13723, 13724, 13725, 13727, 13729, 13733, 13734, 13736, 13739, 13741, 13744,13745,13749,13751, 13752,13753, 13754, 13758, 13762,13765,13766, 13768, 13772, 13773, 13774, 13777, 13778, 13779, 13783, 13785, 13790, 13791, 13797, 13802, 13 803, 13805, 13806, 13807, 13809, 13812, 13814, 13 816, 13817, 13818, 13819, 13820, 13823, 13824, 13826, 13828, 13746, 13755, 13759, 13763, 13764, 13767, 13769, 13775,13776,13780,13784,13786,13788,13789, 13792, 13795, 13796, 13798, 13800, 13804,13808,13813,13815,13821, 13822,13829,13832,13837,13841,13844,13845, 13846, 13849, 13 854, 13855, 13856, 13857, 13861, 13865, 13869, 13871, 13875, 13879, 13880, 13833, 13836, 13838, 13843, 13847, 13850, 13853, 13858, 13862, 13866, 13870, 13872, 13 876, 13881, 13882, 13883, 13889, 13894, 13902, 13903, 13910, 13911,13914, 13915,13916,13928,13929,13930,13931,13935,13936,13937,13944,13947,13948, 13950,13960,13961,13962,13964,13965,13966,13968,13970,13971, 13972113976, 13978,13884,13887,13890,13893,13895,13898,13900,13904,13905,13906,13907, 13908,13909, 13912,13913,13917, 13920, 13921, 13922, 13923, 13924,13925, 13926, 13932,13938,13941,13942, 13943,13945,13946, 13949,13953,13954,13956,13957, 13958,13959, 13963,13967,13969,13974,13975, 13977, 13980, 13981, 13988,13989, 13990,13992,13994, 13995,13999, 13982,13985, 13986, 13987, 13991,13993,13996, 14000, 14001, 14002, 14003, 14004, 14009, 14014, 14017, 14020, 14024, 14026, 14029, 14035,14036, 14040, 14043, 14045, 14051, 14057, 1405 8, 14059, 14063, 14065, 14066, 14067, 14068, 14069, 14070, 14071, 14073, 14074, 14078, 14079, 14080, 14081, 14082, 14083,14084, 14085, 14087, 14094, 14095, 14100, 14108, 14109, 14113, 14114, 14118, 14120, 14121, 14122, 14130, 14133, 14138, 14141, 14142, 14143, 14147, 14005, 14008, 14010, 14013, 14015, 14018, 14021, 14025, 14027, 14028, 14030, 14033, 14034, 14037, 14038,14039, 14041, 14042, 14044, 14046,14049, 14050, 14052, 14055, 14056, 14060, 14064, 14072, 14077, 14086, 14088, 14089, 14090, 14091, 14092, 14093, 14096, 14097, 14098,14099, 14101, 14102, 14103, 14104, 14105, 14106, 14107, 14110, 14115, 14123, 14126,14127, 14132,14134,14135, 14136, 14137, 14139, 14140, 14144,14145, 14148, 14151,14155,14157, 14161,14166,14171,14175, 14183, 14187,14190,14i92,14194, 14195,14196,14200, 14201,14152, 14156,14158, 14162, 14165,14167, 14170, 14172, 14176, 14179, 14180, 14182, 14184, 14185, 14186, 14188, 14189, 14191, 14193, 14197, 14198, 14199, 14202, 14203, 14204, 14210, 14211, 14216, 14217, 14223, 14226, 14228, 14229, 14230, 14233, 14235, 14239, 14241, 14243, 14244, 14250, 14254, 14255, 14256, 14257, 14260, 14261, 14262, 14267, 14268, 14269, 14273, 14274, 14277, 14281, 14284, 14286, 14289, 14292, 14293, 14297, 14299, 14301, 143 04, 14305, 14306, 14312, 14316, 14320, 14322, 14324, 14328, 14329, 143 31, 14337, 14342, 14344, 14346, 14347, 14349, 14350, 14353, 14356, 14361, 14363, 14364, 14365, 14366, 14205, 14208, 14212, 14215, 14218, 14221, 14224, 14225, 14227, 14231, 1423 6, 14240, 14242, 14245, 14246, 14247, 14251, 14263, 14266, 14270, 14278, 14282, 14283, 14285, 14287, 14290, 14291, 14294, 14298, 14300, 14302, 14303, 14307, 14310,14313, 14317, 14323, 14325, 14327, 14330, 14334,14338,14340,14341,14345,14348,14351, 143 52, 14354, 14355, 14357, 14358, 14359,14360,14367,14368,14372,14373,14375, 14386,14369, 14374,14376, 14379, 14380, 14381, 14382, 14383, 14384 and SEQ ID NO: 14385, and wherein the nucleic acid molecule of d) is selected from 2753, 2756, 2758, 2761, 2766, 2770, 2774, 2778, 2799, 2807, 2813, 2819, 2822, 2826, 2848, 2857, 2900, 2906, 2908, 2910, 2913, 2921, 2925, 2940, 2943, 2952, 2964, 2983, 2986, 3009, 3012, 3015, 3024, 3030, 3035, 3046, 3058, 3062, 3067, 3070, 3074, 3077, 3079, 3082, 3087, 3095, 3099, 3102, 3106, 3112, 3120, 3125, 3129, 3132, 3141, 3143, 3154, 3156, 3158, 3161, 3177, 3188, 3191, 3193, 3200, 3208, 3211, 3220, 3231, 3241, 3251, 3254, 3258, 3263, 3272, 3277, 3288, 3294, 3296, 3299, 3303, 3317, 3323, 3326, 3329, 3336, 3341, 3362, 3366, 3370, 3375, 3379, 3382, 3387, 3394, 3398, 3405, 3407, 3410, 3412, 3416, 3422, 3425, 3430, 3449, 3451, 3457, 3460, 3465, 3468, 3486, 3498, 3502, 3507, 3523, 3532, 3539, 3546, 3550, 3567, 3572, 3579, 3582, 3610, 3620, 3628, 3648, 3659, 3664, 3672, 3675, 3680, 3682, 3685, 3687, 3699, 3712, 3716, 3720, 3734, 3751, 3763, 3766, 3769, 3783, 3789, 3795, 3811, 3816, 3825, 3830, 3835, 3841, 3843, 3846, 3849, 3855, 3859, 3879, 3882, 3910,3912, 3913, 3918, 3925, 3929, 3932, 3946, 3953, 3956, 3967, 3969, 3973, 3977, 3989, 3992, 3996, 3999, 4002, 4008, 4014, 4026, 4030, 4036, 4041, 4044, 4053, 4057, 4060, 4062, 4081, 4091, 4097, 4103, 4107, 4118, 4126, 4140, 4143, 4147, 4155, 4158, 4164, 4175, 4178, 4183, 4187, 4193, 4200, 4203, 4210, 4212, 4215, 4222, 4227, 4230, 4235, 4240, 4250, 4253, 4264, 4278, 4294, 4312, 4314, 4320, 4329, 4339, 4346, 4356, 4363, 4380, 4402, 4404, 4414, 4419, 4421, 4431, 4439, 4445, 4449, 4459, 4468, 4483, 4493, 4500, 4513, 4526, 4527, 4532, 4544, 4550, 4552, 4566, 4577, 4591, 4594, 4604, 4608, 4623, 4625, 4629, 4637, 4651, 4654, 4657, 4673, 4679, 4682, 4692, 4698, 4710, 4712, 4713, 4723, 4725, 4729, 4734, 4740, 4743, 4747, 4752, 4757, 4762, 4765, 4775, 4781, 4796, 4799, 4803, 4809, 4826, 4831, 4863, 4866, 4880, 4888, 4914, 4916, 4931, 4933, 4939, 4955, 4959, 4962, 496S, 4994, 5001, 5008, 5012, 5023, 5029, 5035, 5046, 5059, 5063, 5068, 5071, 5079, 5082, 5085, 5089, 5092, 5095, 5098, 5102, 5108, 5113, 5118, 5122, 5127, 5130, 5133, 5138, 5141, 5146, 5152, 5154, 5178, 5192, 5197, 5206, 5213, 5228, 5236, 5243, 5258, 5267, 5275, 5277, 5283, 5294, 5298, 5302, 5305, 5320, 5325, 5328, 5335, 5345, 5350, 5357, 5374, 5381, 5384, 5386, 5390, 5397, 5402, 5406, 5411, 5423, 5430, 5439, 5453, 5463, 5473, 5476, 5479, 5483, 5489, 5514, 5520, 5523, 5530, 5547, 5584, 5590, 5607, 5610, 5613, 5617, 5621, 5631, 5636, 5641, 5653, 5655, 5658, 5666, 5669, 5675, 5685, 5692, 5695, 5703, 5706, 5716, 5719, 5726, 5738, 5746, 5749, 5752, 5755, 5757, 5761, 5765, 5772, 5784, 5799, 5805, 5815, 5819, 5829, 5851, 5869, 5901, 5908, 5911, 5914, 5917, 5925, 5941, 5951, 5967, 5974, 5979, 5982, 5985, 5989, 5995, 6022, 6029, 6044, 6047, 6052, 6057, 6061, 6069, 6071, 6080, 6082, 6087, 6092, 6095, 6102, 6104, 6107, 6109, 6113, 6124, 6129, 6140, 6147, 6158, 6165, 6179, 6185, 6203, 6209, 6217, 6228, 6249, 6263, 6267, 6279, 6290, 6332, 6339, 6343, 6346, 6352, 6363, 6366, 6370, 6380, 6385, 6391, 6396, 6408, 6430, 6439, 6454, 6456, 6477, 6483, 6488, 6495, 6509, 6517, 6520, 6530, 6534, 6555, 6557, 6559, 6569, 6574, 6581, 6593, 6616, 6622, 6626, 6636, 6637, 66488, 6654, 6667, 6673, 6684, 6724, 6729, 6733, 6737, 6743, 6750, 6753, 6763, 6766, 6768, 6771, 6776, 6780, 6788, 6793, 6808, 6813, 6820, 6823, 6826, 6846, 6856, 6864, 6867, 6878, 6885, 6903, 6914, 6919, 6923, 6926, 6938, 6941, 6978, 6982, 6985, 6988, 6994, 6997, 7000, 7004, 7008, 7015, 7019, 7021, 7069, 7079, 7099, 7104, 7117, 7120, 7145, 7151, 7153, 7162, 7164, 7169, 7201, 7209 , 7234,7238, 7252, 7286, 7288, 7300, 7305, 7313, 7323, 7327, 7338, 7343, 7346, 7352, 7377, 7380, 7396, 7399, 7406, 7412, 7414, 7418, 7424, 7429, 7437, 7441, 7443, 7458, 7461, 7469, 7473, 7491, 7502, 7504, 7514, 7531, 7551, 7553, 7557,7562, 7564, 7569, 7572, 7592, 7602, 7605, 7612, 7625, 7630, 7632, 7634, 7648, 7653, 7664, 7668, 7693, 7696, 7706, 7763, 7766, 7769, 7772, 7777, 7780, 7787, 7790, 7801, 7804, 7806, 7826, 7931, 7850, 7859, 7862, 7867, 7876, 7883, 7887, 7891, 7893, 7895, 7898, 7901, 7906, 7908, 7911, 7915, 7924, 7927, 7930, 7935, 7959, 7961, 7966, 7975, 7978, 7984, 7994, 7998, 8002, 8014, 8029, 8032, 8037, 8041, 8045, 8048, 8058, 8063, 8086, 8092, 8097, 8106, 8109, 8120, 8140, 8141, 8159, 8162, 8172, 8196, 8205, 8211, 8215, 8219, 8226, 8234, 8241, 8249, 8262, 8265, 8272, 8276, 8279, 8283, 8290, 8300, 8308, 8320, 8338, 8355, 8358, 8368, 8380,8386, 8389, 8393, 8396, 8400, 8404, 8408, 8417, 8421, 8427, 8430, 8439, 8441, 8443, 8453, 8459, 8471, 8483, 8495, 8507, 8509, 8525, 8538, 8540, 8543, 8549, 8553, 8559, 8561, 8573, 8579, 8584, 8590, 8593, 8605, 8611, 8622, 8626, 8656, 8664, 8721, 8724, 8731, 8740, 8743, 8746, 8765, 8774, 8781, 8792, 8795, 8811, 8817, 8822, 8825, 8834, 8839, 8849, 8858, 8860, 8862, 8875, 8886, 8910, 8915, 8919, 8922, 8926, 8940, 8947, 8956, 8959, 8973, 8982, 8986, 8991, 8996, 9000, 9015, 9027, 9031, 9040, 9057, 9059, 9062, 9065, 9073, 9076, 9101, 9115, 9117, 9120, 9132, 9145, 9161, 9170, 9179, 9196, 9210, 9213, 9225, 9236, 9242, 9245, 9250, 9255, 9259, 9262, 9268, 9272, 9294, 9299, 9306, 9315, 9330, 9341, 9343, 9346, 9350, 9359, 9362, 9366, 9369, 9373, 9381, 9387, 9392, 9396, 9404, 9427, 9442, 9463, 9472, 9476, 9481, 9484, 9486, 9491, 9507, 9510, 9531, 9540, 9553, 9562, 9568, 9572, 9575, 9582, 9590, 9597, 9600, 9610, 9616, 9620, 9629, 9636, 9642, 9648, 9655, 9669, 9674, 9678, 9681, 9685, 9689, 9696, 9704, 9709, 9725, 9728, 9731, 9736, 9740, 9743, 9752, 9770, 9774, 9779, 9785, 9799, 9802, 9814, 9824, 9829, 9834, 9874, 9884, 9888, 9906, 9910, 9927, 9930, 9951, 9965, 9971, 9977, 10024, 10029, 10039, 10052, 10063, 10066, 10073, 10076, 10085,10108, 10115,10128, 10136,10146, 10158,10162,10168,10171, 10180,10185, 10208, 10217, 10238,10246,10250,10281,10284,10289,10294,10296,10303, 10316,10324, 10332, 10334, 10339, 10353, 10364, 10368, 10371, 10389, 10393, 10396, 10397, 10400, 10405, 10409,10421,10424,10436,10441,10450,10458,10472,10474,10479,10482,10486, 10496, 10505, 10512, 10527, 10549, 10555, 10562, 10567, 10570, 10575, 10585, 10587, 10591, 10595, 10599,10608,10615, 10620, 10623, 10629, 10636, 10677,10680, 10686, 10692, 10695, 10698, 10701, 10706, 10708, 10715, 10731, 10736, 10753, 10756, 10766, 10771, 10774, 10777, 10785,10787, 10795, 10797, 10803, 10810, 10825, 10828, 10832, 10836,10852,10855,10867,10876,10887,10891,10895,10898,10913,10918,10921, 10923, 10936, 10940, 10949, 10961, 10964, 10974, 10983, 10990, 10994, 11003, 11008, 11011,11018,11024,11035,11038,11057,11095,11378,11389,11393,11407,11413, 11420, 11426,11436,11440,11454,11470,11491,11495,11530,11437,11441,11455, 11471, 11492,11496,11516,11531, 11533,11537,11543, 11558,11564,11575, 11538, 11544, 11559,11S65,11567,11576, 11580,11583,11588, 11581,11584,11589,11599, 11634,11604, 11611, 11620, 11624, 11630,11605,11612, 11621, 11625, 11631, 11637, 11650,11638,11651,11661, 11668,11679,11683,11703, 11707, 11711,11714,11717, 11721,11726, 11741,11753,11757, 11766,11771,11780,11662,11669,11680,11684, 11704, 11708, 11712,11715, 11718, 11722, 11742,11754, 11758,11760,11781,11788, 11794, 11789, 11795, 11798, 11807, 11812, 11816, 11821, 11831, 11842, 11 8S4, 11799, I 1808, 11813, 11822, 11826, 11832, 11834, 11838, 11843, 11849, 11855, 11859, 11869, 11873,11880,11884,11896,11870,11874,11881,11885,11897,11900,11906,11920, 11935, 11939, 11944, 11957, 11961, 11965, 11970, 11974, 11983, 11901, 11907, 1192 1, 11936, 11940, 11945, 11958, 11962, 11966, 11971, 11975, 11984, 12008, 12013,12018, 12029,12036,12040,12047,12074,12078,12083,12105,12116,12009,12014,12019, 12030,12037, 12041, 12048,12053,12075,12079,12036, 12092, 12106, 12117,12126, 12132,12151,12155,12133,12152,12156,12166,12173,12178,12183, 12189,12192, 12204,12211,12218,12235, 12246,12252,12282,12293,12298, 12301,12304,12310, 12315,12319,12334, 12350, 12357,12365,12374,12387, 12391, 12395,12416,12426, 12444,12451, 12456,12167,12174,12179,12184,12193, 12205,12212,12215, 12219, 12236,12247,12253,12261,12275,12283,12294, 12299,12305,12311,12316,12320, 12329,12335,12344,12351,12358,12366,12368, 12375,12384,12388,12392,12396, 12399,12407,12414,12421,12427,12431,12434,12447, 12452,12457,12463,12470, 12473,12482,12464, 12466,12471, 12476,12479,12491, 12503, 12509,12513,12516, 12514,12532,12539,12544,12557,12562,12567,12576,12583, 12588,12591,12606, 12612, 12622,12628, 12510, 12514, 12519,12526, 12527, 12533, 12540,12545,12558, 12563,12568,12577,12580,12584, 12589,12598,12607, 12619, 12623,12629,12633, 12642,12645,12650,12656, 12668, 12674,12676,12697, 12707, 12722,12734,12741, 12759,12773,12779,12783,12802, 12806,12810,12819, 12829,12634,12646,12651, 12657, 12659, 12669, 12698, 12708, 12711,12723,12707, 12727, 12735,12742,12774, 12780, 12784, 12803,12807, 12811, 12820,12830,12847,12852, 12859,12864,12874, 12905, 12915,12925,12930, 12934, 12940,12944,12946, 12955, 12848,12853,12856, 12860,12865, 12875, 12897, 12906, 12916,12922,12926, 12931, 12935, 12941,12930, 12947,12952,12956, 12963, 12979,12964,12980,12984, 13003, 12985, 12988,12990, 12994, 13004,13007, 13011, 13015, 13027,13046, 13055,13059, 13080, 13094,13098, 13112, 13120,13134,13140, 13150, 13154,13161, 13187, 13008, 13012, 13016,13028, 13047,13056,13060,13081, 13095,13099,13103,13106,13113,13116, 13135,13136, 13141,13151,13155,13162,13188, 13193,13202,13194,13203,13205,13209,13215, 13218,13236, 13252, 13260, 13271, 13283,13210,13216, 13219,13221, 13223,13230, 13238, 13243, 13253, 13261, 13272, 13278, 13284, 13643, 13644, 13651, 13657, 13662, 13663, 13666, 13679, 13667, 13680, 13699, 13711, 13730, 13737, 13742, 13700, 13712, 13731, 13738, 13743, 13747, 13756, 13760, 13781, 13793, 13801, 13810, 13830, 13748, 13750, 13757, 13761, 13770, 13771, 13782, 13787, 13794, 13799, 13811, 13825, 13827, 13831, 13834, 13839, 13851, 13859, 13863, 13867, 13873, 13877, 13835, 13840, 13842, 13848, 13852,13860,13864,13868, 13874, 13878,13885, 13886, 13891, 13896,13901, 13918,13927, 13933,13939, 13951, 13886,13888, 13892, 13897, 13899, 13901,13919, 13934, 13940,13952,13955, 13973,13979,13983,13997, 13984, 13998, 14006, 14011, 14019, 14022, 14031, 14047, 14053, 14061, 14075, 14111, 14116, 14124, 14149, 14007, 14012,14016,14023,14032,14048,14054,14062,14076,14112,14117,14119,14125, 14128, 14129, 14131, 14146, 14150, 14153, 14159, 14163,14168,14173,14177,14154, 14160,14164,14169,14174,14178,14181,14206,14213,14219,14237,14248,14252, 14258,14264,14271,14275,14279,14295,14308,14311,14314,14318,14332,14335, 14339,14343,14207,14209,14214,14220,14222,14232,14234,14238,14249,14253, 14259,14265,14272,14276,14280,14288,14296,14309,14315,14319,14321,14326, 14333, 14336, 14362, 14370, 14377, 14371 and SEQ ID NO:14378.

1. The method according to claim 40 and 45 wherein the at least one nucleic acid molecule or peptide nucleic acid molecule of c) is selected from the group consisting SE ID
NOS: 2114, 2119, 2124, 2125, 2127, 2132, 2133, 2135, 2137, 2138, 2139, 2140, 2141, 2142, 2143, 2144, 2146, 2147, 2148, 2149, 2150, 2151, 2152, 2153, 2154, 2155, 2156, 2157, 2158, 2159, 2160, 2031, 2082, 2087, 2089, 2094, 2095, 2096, 2097, 2099, 2107, 1980, 2018, 2022, 2023, 2026,1939,1966,1973,1974,1975,1926,1930,1931,1932, 1933,1934,1903,1917,1921,1834,1896,1805,1819,1821,1823,1824,1825,1826, 1827, 1828, 1829, 1770, 1782, 1785, 1786, 1788, 1789, 1790, 1792, 1795, 1796, 1797, 1798, 1799, 1800, 1748, 1759, 1760, 1761, 1762, 1763, 1764, 1765, 1724, 1741, 1597, 1609, 1610,1611, 1612, 1613, 1614,1615, 1616, 1617, 1618, 1619, 1620, 1621, 1622, 1623,1624,1625.1626,1627, 1628,1629,1630,1631,1633,1634,1635,1636,1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1645, 1646, 1647, 1648,1649, 1650, 1651, 1652,1653, 1654, 1655, 1656, 1657, 1658, 1659,1660, 1661, 1662, 1663, 1668, 1684, 1685, 1686,1687,1688, 1689,1690,1691,1692,1693,1694,1695,1696, 1697, 1698, 1699,1700,1701,1706,1712,1713,1715,1716,1717,1718,1719,1571,1579,1581, 1584, 1585, 1586, 1587, 1588, 1591, 1592, 1537, 1555, 1556, 1557, 1558, 1559, 1560, 1561,1562,1563, 1564,1565,1566,1452,1455,1456, 1457,1458, 1463, 1514,1515, 1516, 1517, 1518, 1519, 1524, 1525, 1526, 1527, 1528, 1529, 1531, 1532, 1372, 1423, 1424, 1425, 1427, 1432, 1433, 1434,1435, 1436, 1437, 1440, 1441, 1442, 1443, 1444, 1445,1446,1447, 1343, 1358,1359,1360,1361,1362,1363,1364, 1365, 1366, 1367, 1310, 1315,1316,1317,1318,1319,1320,1321,1322,1324,1325,1327,1328,1330, 1332, 1334, 1337, 1338, 1276, 1290, 1305, 1203, 1228, 1238, 1239, 1240, 1247, 1248, 1255, 1256,1265,1268,1269, 1164, 1171, 1172, 1173, 1174, 1176, 1177, 1178, 1179,

44. A method for detecting, or for detecting and distinguishing between or among colon cell proliferative disorders in a subject, comprising:

a. obtaining, from a subject, a biological sample having subject genomic DNA;
b. extracting, or otherwise isolating the genomic DNA;
c. contacting the genomic DNA of b), or a fragment thereof, comprising at least 16 contiguous nucleotides of a sequence selected from the group consisting of SEQ

ID NO: 1 to SEQ ID NO 64and sequences that hybridize under stringent conditions thereto, with one or more methylation-sensitive restriction enzymes, wherein the genomic DNA is, with respect to each cleavage recognition motif thereof, either cleaved thereby to produce cleavage fragments, or not cleaved thereby; and d. determining, based on a presence or absence of, or on property of at least one such cleavage fragment, the methylation state of at least one CpG dinucleotide of a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO
64, or an average, or a value reflecting an average methylation state of a plurality of CpG dinucleotides of a sequence selected from the group consisting of SEQ
ID
NO: 1 to SEQ ID NO 64, whereby at least one of detecting, or of detecting and differentiating between or among colon cell proliferative disorders is, at least in part, afforded.

45. A treated nucleic acid derived from genomic SEQ ID NO: 1 to SEQ ID NO 64, wherein the treatment is suitable to convert at least one unmethylated cytosine base of the genomic DNA sequence to uracil or another base that is detectably dissimilar to cytosine in terms of hybridization.

46. A nucleic acid, comprising at least 16 contiguous nucleotides of a treated genomic DNA
sequence selected from the group consisting of SEQ ID NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88, and sequences complementary thereto, wherein the treatment is suitable to convert at least one unmethylated cytosine base of the genomic DNA sequence to uracil or another base that is detectably dissimilar to cytosine in terms of hybridization.

47. The nucleic acid of claims 45 and 46 wherein the contiguous base sequence comprises at least one CpG, TpG or CpA dinucleotide sequence.

48. The nucleic acid of claims 45 and 46 wherein the treatment comprises use of a reagent selected from the group consisting of bisulfite, hydrogen sulfite, disulfite, and combinations thereof.

49. An oligomer, comprising a sequence of at least 9 contiguous nucleotides that is complementary to, or hybridizes under moderately stringent or stringent conditions to a treated genomic DNA sequence selected from the group consisting of SEQ ID
NO:304 to SEQ ID NO:535 and SEQ ID NO:65 to SEQ ID NO:88

50. The oligomer of Claim 49, comprising at least one CpG, CpA or TpG
dinucleotide sequence.

51. The use of a method according to claims 1 to 44, a nucleic acid according to claims 45 to 48 or an oligonucleotide according to claims 49 to 50 for the detection and/or distinguishing between colon cell proliferative disorders.

52. A kit useful for detecting, or for detecting and differentiating between or among colon cell proliferative disorders of a subject, comprising:

-a methylation-sensitive restriction enzyme; and -at least one nucleic acid molecule or peptide nucleic acid molecule, comprising a contiguous sequence of at least 16 nucleotides that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NOS: 1-64, and complements thereof.

53. The kit of claim 52, wherein the contiguous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NOS:8 and 29, and complements thereof.

54. A kit useful for detecting, or for detecting and differentiating between or among colon cell proliferative disorders of a subject, comprising:

-a bisulfite reagent; and -at least one nucleic acid molecule or peptide nucleic acid molecule, comprising a contiguous sequence of at least 16 nucleotides that is complementary to, or hybridizes under moderately stringent or stringent conditions to a sequence selected from the group consisting of SEQ ID NOS:65-88, SEQ ID NOS:304-535, and complements thereof.\

55. The kit of claim 54, wherein the contiguous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID
NOS:318, 319, 434, 435, SEQ ID NOS:360, 361,476, 477, and complements thereof.

56. The kit of any one of claims 54 or 55, further comprising standard reagents for performing a methylation assay selected from the group consisting of MS-SNuPE, MSP, MethyLight, HeavyMethyl, COBRA, nucleic acid sequencing, and combinations thereof.

57. The kit of any one of claims 52-56, wherein the length of the contiguous nucleotide sequence is selected from the group consisting of at least 17, at least 18, at least 20, at least 22, at least 23, at least 25, at least 27, at least 30, and at least 35 nucleotides.

58. The kit of any one of claims 52-57, wherein the length of the contiguous nucleotide sequence is at least 18 nucleotides.