CA2520936A1 - An antibody fragment capable of modulating multidrug resistance and compositions and kits and methods using same - Google Patents
An antibody fragment capable of modulating multidrug resistance and compositions and kits and methods using same Download PDFInfo
- Publication number
- CA2520936A1 CA2520936A1 CA002520936A CA2520936A CA2520936A1 CA 2520936 A1 CA2520936 A1 CA 2520936A1 CA 002520936 A CA002520936 A CA 002520936A CA 2520936 A CA2520936 A CA 2520936A CA 2520936 A1 CA2520936 A1 CA 2520936A1
- Authority
- CA
- Canada
- Prior art keywords
- antibody fragment
- cells
- glycoprotein
- scfv
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Abstract
An antibody fragment and methods of utilizing same are provided. The antibody fragment includes an antigen binding region capable of binding an extracellular portion of a P-glycoprotein thereby at least partially inhibiting drug efflux activity in multidrug resistant cells.
Description
AN ANTIBODY FRAGMENT CAPABLE OF MODULATING MULTIDRUG
RESISTANCE AND COMPOSITIONS AND KITS AND METHODS USING
SAME
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to an antibody fragment capable of binding to P-glycoprotein associated with multidrug resistant (MDR) cells. The present invention also relates to compositions and methods utilizing such an antibody fragment for inhibiting drug efflux activity in MDR cancer cells.
l0 Cancer chemotherapy often fails due to the development of acquired or intrinsic resistance in cancerous cells to a wide variety of anticancer drugs, such as colchicine, vinblastine, vincristine and doxorubicin. This phenomenon, which is known as multidrug resistance (MDR), is a major barrier to cancer chemotherapy.
A key mechanism of MDR is the overexpression of an energy-dependant efflux pump, known as the multidrug transporter. This efflux pump is a 170 kDa P-glycoprotein (Pgp), encoded by the MDRl gene. Pgp-mediated MDR plays an important role in the resistance of various tumor cells to chemotherapy; studies have shown a clear correlation between ntdrl expression and the lack of response to chemotherapy (6,7).
Inhibitors of the MDR phenotype in cancer cells may either modify or disrupt the expression of the drug efflux function of the transporter proteins involved in MDR.
Known MDR inhibitors include verpamil (a calcium-channel blocker and being used to treat leukemia), cyclosporins, steroids, and calmodulin inhibitors (which enhance the intracellular accumulation and cytotoxic action of Pgp-transported drugs).
However, most known MDR-modulating drugs presently available for clinical application have major side effects which substantially limit their therapeutic value.
Recently, Pgp-specific monoclonal antibodies (Mab) have been developed as intended agents for use in MDR inhibition. U.S. Pat. No. 4,837,306 describes antibodies directed against the C-terminal portion of the intracellular domain of Pgp.
These antibodies are not known to have an inhibitory effect on the drug efflux activity in MDR
cells.
U.S. Pat. No. 5,766,946 describes a monoclonal antibody termed MM.17 that recognizes an epitope located on the forth extracellular loop of human Pgp.
The MM.17 antibody was generated by immunizing mice with an MDR variant of a human T-lymphoblastoid. This antibody is not known to have an inhibitory effect on the drug efflux activity in MDR cells.
U.S. Pat. No. 6,479,639 describes a monoclonal antibody termed UIC2 directed against an extracellular domain of Pgp. The UIC2 antibody was generated_by immunizing mice with transfected fibroblast cells expressing Pgp. The UIC2 Mab was found capable of inhibiting the drug efflux activity of MDR cells irz vitro.
Monoclonal antibodies termed HYB-241 and HYB-612, recognize an external epitope of Pgp. These Mabs have been reported to increase the accumulation of the chemotherapeutic drugs vincristine and actinomycin D in tumor cells thereby increasing cytotoxicity [Meyers, M. B. et al., Cancer Res., 49:3209 (1987); O'Brien, J.
P. et al., Proc.
Amer. Assoc. Cancer Res., 30:Abs 2114 (1989)].
The monoclonal antibody Mab657 has been reported to react with MDR cells [Cinciarelli, C., et al., Int. J. Cancer, 47:533 (1991)]. This antibody was reported to increase the susceptibility of MDR cells to cytotoxicity mediated by human peripheral blood lymphocytes, it is not known to have an inhibitory effect on the drug efflux activity of Pgp.
The monoclonal antibodies MRK-16 and MRK-17, were generated by immunizing mice with MDR human leukemia cells. Both antibodies recognize Pgp and are capable of modulated the drug efflux activity in MDR cells MDR ira vitro and in vivo [Hamada H., et al.,. Cancer Res. PNAS 83:7785 (1986); Pearson, J.W., et al., J. Natl.
Cancer Inst.
88:1386 (1991); Tsuruo, T., et. al., Jpn. J. Cancer Res. 80:627 (1989)]. A
recombinant chimeric antibody that combines the variable region of MRK-16 with the Fc portion of human antibodies was reported to be more effective than parent MRK-16 Mab in increasing cytotoxicity to MDR cells ire vitro [Hamada H. et al., cancer Res.
50:3167 2s (1990)].
A substantial limitation of the above described antibodies stems from the large size of these molecules. It is well known that delivery efficiency of an agent is typically inversely proportional to its size. Thus, the large antibody molecules described above would not efficiently penetrate and distribute within the tumor tissue requiring high administration dosages to obtain therapeutic effect.
Another major shortcoming of presently available Pgp-specific antibodies is the fact that Pgp is constitutively expressed in normal human tissues, including kidney, liver, colon, testis, lymphocytes, and the blood-brain barrier (27). A large antibody molecule would typically circulate for extended time periods and would be slowly cleared from circulation resulting in possible toxic effects on normal tissues that physiologically express Pgp.
In addition, most of the Pgp-specific antibodies described above were selected for high affinity to Pgp. However, the practical use of Pgp-specific antibodies in therapy may be substantially restricted when the binding affinity of the antibody to Pgp is high. This is due to toxic effects that might be exerted on normal tissues that physiologically express Pgp. t There is thus a widely recognized need for, and it would be highly advantageous l0 to have, a Pgp-specific antibody devoid of the above limitations.
SUMMARY OF THE INVENTION
According to one aspect of the present invention there is provided an antibody fragment comprising an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to another aspect of the present invention there is provided a pharmaceutical composition, comprising, as an active ingredient, an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells and a pharmaceutically acceptable carrier.
According to yet another aspect of the present invention there is provided a method of treating cancer in an individual, comprising: (a) providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells, and (b) administrating to the individual a therapeutically effective amount of an anti cancer agent thereby treating cancer in the individual.
According to still another aspect of the present invention there is provided a kit for diagnosing cells overexpressing P-glycoprotein, comprising an antibody fragment containing an antigen binding region capable of binding said P-glycoprotein, and reagents for detecting said antibody fragment.
According to an additional aspect of the present invention there is provided a method of detecting cells overexpressing P-glycoprotein comprising: (a) exposing the cells to an antibody fragment including an antigen binding region capable of binding an extracellular portion of the P-glycoprotein; and (b) detecting said antibody fragment bound to said extracellular portion of said P-glycoprotein, thereby identifying the cells overexpressing extracellular P-glycoprotein.
According to yet an additional aspect of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to still an additional aspect of the present invention there is provided a l0 nucleic acid construct comprising an isolated polynucleotide which includes a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to a further aspect of the present invention there is provided a cell comprising a nucleic acid construct which includes an isolated polynucleotide comprising a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to further features in preferred embodiments of the invention described below, the antibody fragment of the present invention is an Fv fragment, preferably a single chain Fv.
According to still further features in the described preferred embodiments the antibody fragment of the present invention is a Fab.
According to still further features in the described preferred embodiments the antibody fragment of the present invention is a F(ab')2_ According to still further features in the described preferred embodiments the antibody fragment of the present invention is a F(ab')2.
According to still further features in the described preferred embodiments the antibody fragment of the present invention includes an antigen binding region capable of binding an extracellular portion of a 170 kDa polypeptide expressed by the mdrl gene, preferably the antigen binding region is directed against an epitope located in a first loop of the extracellular portion of the P-glycoprotein, more preferably the epitope comprises the amino acid sequence set forth in SEQ ID NO:l .
According to still further features in the described preferred embodiments the antibody fragment of the present invention is capable of at least partially inhibiting drug 5 efflux activity in multidrug resistant cancer cells, preferably human cancer cells.
According to still further features in the described preferred embodiments the pharmaceutical composition of the present invention further includes a chemotherapeutic drug, preferably a chemotherapeutic drug which is toxic to cancer cells.
According to still further features in the described preferred embodiments the to method of treating cancer in an individual includes providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells being administered along with a pharmaceutically acceptable carrier.
According to still further features in the described preferred embodiments the method of treating cancer in an individual includes administrating to the individual a therapeutically effective amount of an anti cancer agent prior to, concomitant with or following providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells.
According to still further features in the described preferred embodiments the method of treating cancer in an individual includes administrating to the individual a therapeutically effective amount of an anti cancer agent which is complexed with the antibody fragment of the present invention.
According to still further features in the described preferred embodiments the method of treating cancer in an individual includes expressing the antibody fragment of this invention within cells of the individual.
According to still further features in the described preferred embodiments the kit of the present invention further includes packaging material identifying the antibody fragment for use in diagnosing cells overexpressing extracellular P-glycoprotein.
According to still further features in the described preferred embodiments the kit of the present invention includes the antibody fragment of the present invention labeled 3o with a detectable moiety, preferably the detectable moiety is selected from the group consisting of a chromogenic moiety, a fluorogenic moiety, a light-emitting moiety and a radioactive moiety.
RESISTANCE AND COMPOSITIONS AND KITS AND METHODS USING
SAME
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to an antibody fragment capable of binding to P-glycoprotein associated with multidrug resistant (MDR) cells. The present invention also relates to compositions and methods utilizing such an antibody fragment for inhibiting drug efflux activity in MDR cancer cells.
l0 Cancer chemotherapy often fails due to the development of acquired or intrinsic resistance in cancerous cells to a wide variety of anticancer drugs, such as colchicine, vinblastine, vincristine and doxorubicin. This phenomenon, which is known as multidrug resistance (MDR), is a major barrier to cancer chemotherapy.
A key mechanism of MDR is the overexpression of an energy-dependant efflux pump, known as the multidrug transporter. This efflux pump is a 170 kDa P-glycoprotein (Pgp), encoded by the MDRl gene. Pgp-mediated MDR plays an important role in the resistance of various tumor cells to chemotherapy; studies have shown a clear correlation between ntdrl expression and the lack of response to chemotherapy (6,7).
Inhibitors of the MDR phenotype in cancer cells may either modify or disrupt the expression of the drug efflux function of the transporter proteins involved in MDR.
Known MDR inhibitors include verpamil (a calcium-channel blocker and being used to treat leukemia), cyclosporins, steroids, and calmodulin inhibitors (which enhance the intracellular accumulation and cytotoxic action of Pgp-transported drugs).
However, most known MDR-modulating drugs presently available for clinical application have major side effects which substantially limit their therapeutic value.
Recently, Pgp-specific monoclonal antibodies (Mab) have been developed as intended agents for use in MDR inhibition. U.S. Pat. No. 4,837,306 describes antibodies directed against the C-terminal portion of the intracellular domain of Pgp.
These antibodies are not known to have an inhibitory effect on the drug efflux activity in MDR
cells.
U.S. Pat. No. 5,766,946 describes a monoclonal antibody termed MM.17 that recognizes an epitope located on the forth extracellular loop of human Pgp.
The MM.17 antibody was generated by immunizing mice with an MDR variant of a human T-lymphoblastoid. This antibody is not known to have an inhibitory effect on the drug efflux activity in MDR cells.
U.S. Pat. No. 6,479,639 describes a monoclonal antibody termed UIC2 directed against an extracellular domain of Pgp. The UIC2 antibody was generated_by immunizing mice with transfected fibroblast cells expressing Pgp. The UIC2 Mab was found capable of inhibiting the drug efflux activity of MDR cells irz vitro.
Monoclonal antibodies termed HYB-241 and HYB-612, recognize an external epitope of Pgp. These Mabs have been reported to increase the accumulation of the chemotherapeutic drugs vincristine and actinomycin D in tumor cells thereby increasing cytotoxicity [Meyers, M. B. et al., Cancer Res., 49:3209 (1987); O'Brien, J.
P. et al., Proc.
Amer. Assoc. Cancer Res., 30:Abs 2114 (1989)].
The monoclonal antibody Mab657 has been reported to react with MDR cells [Cinciarelli, C., et al., Int. J. Cancer, 47:533 (1991)]. This antibody was reported to increase the susceptibility of MDR cells to cytotoxicity mediated by human peripheral blood lymphocytes, it is not known to have an inhibitory effect on the drug efflux activity of Pgp.
The monoclonal antibodies MRK-16 and MRK-17, were generated by immunizing mice with MDR human leukemia cells. Both antibodies recognize Pgp and are capable of modulated the drug efflux activity in MDR cells MDR ira vitro and in vivo [Hamada H., et al.,. Cancer Res. PNAS 83:7785 (1986); Pearson, J.W., et al., J. Natl.
Cancer Inst.
88:1386 (1991); Tsuruo, T., et. al., Jpn. J. Cancer Res. 80:627 (1989)]. A
recombinant chimeric antibody that combines the variable region of MRK-16 with the Fc portion of human antibodies was reported to be more effective than parent MRK-16 Mab in increasing cytotoxicity to MDR cells ire vitro [Hamada H. et al., cancer Res.
50:3167 2s (1990)].
A substantial limitation of the above described antibodies stems from the large size of these molecules. It is well known that delivery efficiency of an agent is typically inversely proportional to its size. Thus, the large antibody molecules described above would not efficiently penetrate and distribute within the tumor tissue requiring high administration dosages to obtain therapeutic effect.
Another major shortcoming of presently available Pgp-specific antibodies is the fact that Pgp is constitutively expressed in normal human tissues, including kidney, liver, colon, testis, lymphocytes, and the blood-brain barrier (27). A large antibody molecule would typically circulate for extended time periods and would be slowly cleared from circulation resulting in possible toxic effects on normal tissues that physiologically express Pgp.
In addition, most of the Pgp-specific antibodies described above were selected for high affinity to Pgp. However, the practical use of Pgp-specific antibodies in therapy may be substantially restricted when the binding affinity of the antibody to Pgp is high. This is due to toxic effects that might be exerted on normal tissues that physiologically express Pgp. t There is thus a widely recognized need for, and it would be highly advantageous l0 to have, a Pgp-specific antibody devoid of the above limitations.
SUMMARY OF THE INVENTION
According to one aspect of the present invention there is provided an antibody fragment comprising an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to another aspect of the present invention there is provided a pharmaceutical composition, comprising, as an active ingredient, an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells and a pharmaceutically acceptable carrier.
According to yet another aspect of the present invention there is provided a method of treating cancer in an individual, comprising: (a) providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells, and (b) administrating to the individual a therapeutically effective amount of an anti cancer agent thereby treating cancer in the individual.
According to still another aspect of the present invention there is provided a kit for diagnosing cells overexpressing P-glycoprotein, comprising an antibody fragment containing an antigen binding region capable of binding said P-glycoprotein, and reagents for detecting said antibody fragment.
According to an additional aspect of the present invention there is provided a method of detecting cells overexpressing P-glycoprotein comprising: (a) exposing the cells to an antibody fragment including an antigen binding region capable of binding an extracellular portion of the P-glycoprotein; and (b) detecting said antibody fragment bound to said extracellular portion of said P-glycoprotein, thereby identifying the cells overexpressing extracellular P-glycoprotein.
According to yet an additional aspect of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to still an additional aspect of the present invention there is provided a l0 nucleic acid construct comprising an isolated polynucleotide which includes a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to a further aspect of the present invention there is provided a cell comprising a nucleic acid construct which includes an isolated polynucleotide comprising a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
According to further features in preferred embodiments of the invention described below, the antibody fragment of the present invention is an Fv fragment, preferably a single chain Fv.
According to still further features in the described preferred embodiments the antibody fragment of the present invention is a Fab.
According to still further features in the described preferred embodiments the antibody fragment of the present invention is a F(ab')2_ According to still further features in the described preferred embodiments the antibody fragment of the present invention is a F(ab')2.
According to still further features in the described preferred embodiments the antibody fragment of the present invention includes an antigen binding region capable of binding an extracellular portion of a 170 kDa polypeptide expressed by the mdrl gene, preferably the antigen binding region is directed against an epitope located in a first loop of the extracellular portion of the P-glycoprotein, more preferably the epitope comprises the amino acid sequence set forth in SEQ ID NO:l .
According to still further features in the described preferred embodiments the antibody fragment of the present invention is capable of at least partially inhibiting drug 5 efflux activity in multidrug resistant cancer cells, preferably human cancer cells.
According to still further features in the described preferred embodiments the pharmaceutical composition of the present invention further includes a chemotherapeutic drug, preferably a chemotherapeutic drug which is toxic to cancer cells.
According to still further features in the described preferred embodiments the to method of treating cancer in an individual includes providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells being administered along with a pharmaceutically acceptable carrier.
According to still further features in the described preferred embodiments the method of treating cancer in an individual includes administrating to the individual a therapeutically effective amount of an anti cancer agent prior to, concomitant with or following providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells.
According to still further features in the described preferred embodiments the method of treating cancer in an individual includes administrating to the individual a therapeutically effective amount of an anti cancer agent which is complexed with the antibody fragment of the present invention.
According to still further features in the described preferred embodiments the method of treating cancer in an individual includes expressing the antibody fragment of this invention within cells of the individual.
According to still further features in the described preferred embodiments the kit of the present invention further includes packaging material identifying the antibody fragment for use in diagnosing cells overexpressing extracellular P-glycoprotein.
According to still further features in the described preferred embodiments the kit of the present invention includes the antibody fragment of the present invention labeled 3o with a detectable moiety, preferably the detectable moiety is selected from the group consisting of a chromogenic moiety, a fluorogenic moiety, a light-emitting moiety and a radioactive moiety.
According to still further features in the described preferred embodiments the method of detecting cells of an individual overexpressing P-glycoprotein further comprising obtaining a biological sample from the individual prior to exposing the cells to the antibody fragment of the present invention.
According to still further features in the described preferred embodiments the method of detecting cells overexpressing P-glycoprotein includes exposing the cells to the antibody fragment of the present invention which is labeled with a detectable moiety, preferably the detectable moiety is selected from the group consisting of a chromogenic moiety, a fluorogenic moiety, a light-emitting moiety and a radioactive moiety.
l0 According to still further features in the described preferred embodiments the isolated polynucleotide of the present invention is as set forth in SEQ ID
N0:2.
According to still further features in the described preferred embodiments the nucleic acid construct of the present invention further includes a promoter for regulating expression of said polynucleotide.
The present invention successfully addresses the shortcomings of the presently known configurations by providing an antibody fragment, a pharmaceutical composition, a polynucleotide, a nucleic acid construct, a kit and methods of utilizing same. The antibody fragment includes an antigen binding region capable of binding an extracellular portion of a P-glycoprotein thereby at least partially inhibiting drug efflux activity in multidrug resistant cells.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.
In the drawings:
FIGS. 1 a-d demonstrate specificity and binding properties of purified A2 single chain Fv (scFv). Figure 1 a is a photograph of SDS-PAGE analysis presenting a single to band of A2 scFv in the center and right lanes, while the left lane shows bands of molecular size standards. Figure lb is a bar graph of an ELISA of A2 scFv binding to biotinylated target Pgp-derived peptide (comprising an amino acid sequence of SEQ ID
NO:l; Pgp), or to biotinylated non-target peptide (PRP), or to streptavidin (streptA). The graph shows that A2 scFv reacted with the target Pgp-derived peptide in a dose-dependant fashion. A2 scFv did not react with the non-target peptide or with streptavidin. Figure lc is a plot of an ELISA presenting a dose-response curve of binding of A2 scFv to a biotinylated target Pgp-derived peptide. The concentration of A2 scFv required for 50%
binding was interpolated as ca. 150 nM. Figure ld is a competition radioimmunoassay plot. The plot is based on using a constant amount of [~ZSI]-labeled A2 scFv and an 2o increasing amount of non-labeled A2 scFv (as a competitor). The required concentration for 50% binding inhibition of A2 scFv was interpolated as ca. 130 nM.
FIGs. 2a-h demonstrate the capacity and selectivity of A2 scFv binding to tumor cells exhibiting mufti-drug resistant (MDR) and over-expressing P-glycoprotein (Pgp).
Figure 2a is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with drug-sensitive human ovarian carcinoma cells 2780. The plot shows that A2 scFv treatment had no effect on fluorescent intensity, indicating no antibody-cell binding.
Figure 2b is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with MDR and Pgp-overexpressing ovarian carcinoma cells 2780ADR. The plot shows that A2 scFv treatment resulted in a 10-fold increase in fluorescent intensity, indicating strong antibody-cell binding. Figure 2c is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with drug-sensitive human carcinoma cells KB3-1. The plot shows that A2 scFv treatment had no effect on fluorescent intensity, indicating no antibody-cell binding. Figure 2d is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with MDR and Pgp- , overexpressing human carcinoma cells KBV-1 (derived from the drug-sensitive human carcinoma cells KB3-1). The plot shows that A2 scFv treatment resulted in a substantial increase in fluorescent intensity, indicating a strong antibody-cell binding.
Figure 2e is a microphotograph illustrating immuno-histochemical staining of MDR and Pgp overexpressing ovarian carcinoma cells 278OADR (derived from the drug-sensitive ovarian carcinoma cell line 2780), treated with A2 scFv. The microphotograph shows stained cells indicating a positive antibody-cell reaction. Figure 2f is a microphotograph illustrating immuno-histochemical staining of drug-sensitive cells 2780 treated with A2 1o scFv. Cells were remained unstained indicating no antibody-cell reaction.
Figure 2g is a microphotograph illustrating immuno-histochemical staining of MDR and Pgp-overexpressing human carcinoma cells KB3-1 (derived from drug sensitive human carcinoma cell line KBV-1) treated with A2 scFv. The microphotograph shows stained cells indicating a positive antibody-cell reaction. Figure 2h is a microphotograph illustrating immuno-histochemical staining of drug sensitive human carcinoma cells KBV-1 (the parent line of the MDR and Pgp-overexpressing human carcinoma cell line KB3-1) treated with A2 scFv. Cells were remained unstained indicating no antibody-cell reaction.
FIGS. 3a-a demonstrate the effect of A2 scFv on drug efflux activity in MDR
cells.
Figure 3a is a bar graph presenting data obtained by a fluorometer assay comparing the calcein accumulation rate in (i) drug-sensitive human ovarian carcinoma cells (represented by black bars), and in (ii) MDR and Pgp-overexpressing ovarian carcinoma cells 2780A°R (represented by gray bars). The graph shows 5 and 10-fold decrease in fluorescence intensity, indicating a decrease in calcein uptake, after 5 or 15 min incubation, respectively. Figure 3b is a plot presenting a flow cytometer assay comparing calcein accumulation in (i) drug-sensitive human ovarian carcinoma cells 2780, and in (ii) MDR and Pgp-overexpressing human ovarian carcinoma cells 2780ADR. The plot shows that the 2780ADR cells exhibited substantially lower mean fluorescence intensity, indicating a substantially lower level of calcein uptake by the MDR cells, as compared with the calcein uptake by the drug-sensitive 2780 cells. Figure 3c is a bar graph demonstrating the effect of A2 scFv on the accumulation of calcein in MDR and Pgp-overexpressing 2780ADR cells, in a fluorometer assay. The graph shows a positive dose-response effect of A2 scFv, administered prior to the addition of calcein, on the uptake of calcein by 2780ADR cells. Figure 3d is a plot demonstrating the effect of A2 scFv on calcein uptake by MDR and Pgp-overexpressing 2780ADR cells. The A2 scFv was administered to cells prior to the addition of calcein. The plot shows a substantially higher (4-5 fold) mean of fluorescence intensity, indicating a substantial increase in calcein uptake by MDR cells treated with A2 scFv, as compared with cells not treated with A2 scFv. Figure 3e is a bar graph illustrating specificity of scFv. The graph presenting data obtained by a fluorometer assay and shows that administration of A2 scFv to 2780ADR cells, followed by to addition of calcein, substantially increased the cells' fluorescence intensity, indicating increased calcein uptake in cells. In comparison, the l0 administration of a non-target scFv Gl (isolated against a melanoma tumor antigen) to the 2780ADR cells, did not increase calcein uptake in cells.
FIGS. 4a-e. demonstrate the effect of A2 scFv on drug efflux activity in various MDR cell lines and their parental drug-sensitive cell lines. Figure 4a is a bar graph presenting data obtained by a fluorometer assay comparing calcein uptake in a rodent (CHO) MDR cell line EMTR~. The graph shows that cells treated with A2 scFv, followed by addition of calcein, exhibited substantially higher levels of fluorescence, which is indicative of higher calcein uptake in cells, as compared with the untreated (negative) control. The effect of A2 scFv was similar to the effect of verapamil, a reference MDR
modulator used as a positive control. Figure 4b is a bar graph presenting data obtained by 2o a fluorometer assay comparing calcein uptake in a MDR human epidermoid cell line KB-V 1. The graph shows that cells treated with A2 scFv, followed by addition of calcein, exhibited substantially higher levels of fluorescence, which is indicative of higher calcein uptake in cells, as compared with the untreated (negative) control. The effect of A2 scFv was similar to the effect of verapamil, a reference MDR modulator used as a positive control. Figure 4c is a bar graph presenting data obtained by a fluorometer assay comparing calcein uptake in a drug-sensitive 2780 cell line (the parental line of 2780ADR).
The graph showed similar fluorescence intensity observed in cells treated by A2 scFv, untreated (negative) control, or verapamil (positive) control, thus indicating no effect exerted by A2 scFv on calcein uptake in the drug-sensitive cells. Figure 4d is a bar graph 3o presenting data obtained by a fluorometer assay comparing calcein uptake in a drug-sensitive human epidermoid cell line KB3-1 (the parental line of KBV-1). The graph shows similar fluorescence intensity observed in cells treated by A2 scFv, untreated (negative) control, or verapamil (positive) control, thus indicating no effect exerted by A2 scFv on calcein uptake in the drug-sensitive cells. Figure 4e is a bar graph presenting data obtained by a fluorometer assay comparing calcein uptake in a drug-sensitive rodent (CHO) cell line A8 (the parental line of EMTR~). The graph shows similar fluorescence intensity observed in cells treated by A2 scFv, untreated (negative) control, or verapamil 5 (positive) control, thus indicating no effect exerted by A2 scFv on calcein uptake in the drug-sensitive cells.
FIG. 5 is a plot presenting calcein uptake in 2780A°R cells treated with various concentrations of A2 scFv. The plot shows a dose-response curve of fluorescence intensity, indicative of calcein uptake. The estimated saturation (ICioo) and ICSo 1o concentrations are 0.1 and 0.065 mg A2 scFv per ml, respectively (or 4 and 2.6 ~M, respectively).
FIG. 6 is a bar graph presenting the effect of A2 scFv on the viability of cells treated with various concentrations of doxorubicin. The viability of cells was determined by [3H]-leucine incorporation into cellular proteins. The graph shows that treating cells with A2 scFv, prior to the addition of doxorubicin, resulted in substantial loss of viability of cells, as compared with cells not treated with A2 scFv.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is of an antibody fragment which includes an antigen binding-site capable of binding extracellular P-glycoprotein (Pgp), and as such, can be used for inhibiting drug efflux activity in multidrug resistant (MDR) cells, or in detecting MDR cells.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.
As used herein the term "P-glycoprotein" refers to a 170. kDa trans-membrane 3o protein encoded by the human mdf-1 gene, which functions as an energy-depended biological pump in multidrug resistant cells.
As used herein the phrase "multidrug resistance" refers to the resistance of some cells, such as cancer cells overexpressing Pgp, to cytotoxic drugs.
As used herein the phrase "antibody fragment" refers to any active portion of a native antibody molecule. Examples of antibody fragments include, but are not limited to an Fv, a single chain Fv, a Fab, a F(ab')2 or a Fab'. An antibody fragment may be produced enzymatically or chemically from an intact antibody, or may be synthetically produced. Alternatively, an antibody fragment may be expressed from a polynucleotide sequence encoding the antibody fragment sequence.
As used herein the term "Fv" refers to a polypeptide comprising one variable light chain (VL) domain and one variable heavy chain (VH) domain of an antibody molecule held together by noncovalent interactions. An Fv includes the antigen binding region of 1o the antibody molecule.
As used herein the phrase "single chain Fv" (scFv) refers an Fv in which the VL
and VH domains are connected preferably by a polypeptide linker. The scFv is the smallest antibody fragment that bears the complete antigen binding site.
As used herein the term "Fab" refers to the polypeptide comprising an antibody fragment which is essentially equivalent to that obtained by digestion of the antibody with the enzyme papain.
As used herein the term "F(ab')2, refers to the polypeptide comprising an antibody fragment which is essentially equivalent to that obtained by digestion of the antibody with the enzyme pepsin at pH 4:0 - 4.5.
2o As used herein the term "Fab' " refers to the polypeptide comprising an antibody fragment which is essentially equivalent to that obtained by reduction of the disulfide bridge or bridges joining the two heavy chain pieces of a F(ab')2.
Several Pgp-specific monoclonal antibodies (Mab) which are capable of binding Pgp and thereby circumventing drug-efflux activity in MDR cells have been described in the prior art [U.S. Pat. Nos. 4,837,306, 5,766,946 and 6,479,639; Meyers, M.
B. et al., Cancer Res., 49:3209 (1987); O'Brien, J. P. et al., Proc. Amer. Assoc. Cancer Res., 30:Abs 2114 (1989); Cinciarelli, C., et al., Int. J. Cancer, 47:533 (1991) Hamada H., et al., Cancer Res. PNAS 83:7785 (1986); Pearson, J.W., et al., J. Natl. Cancer Inst. 88:1386 (1991); Tsuruo, T., et al., Jpn. J. Cancer Res. 80:627 (1989); Hamada H. et al., cancer 3o Res. 50:3167 (1990)]. Yet, thus far, practical therapeutic use of such anti-Pgp Mabs has been hampered mainly by the large size of these molecules which limits the mobility and tissue penetration thereof [Yokota et al., Cancer Res. 52: 3402-3408 (1992)].
In addition to tissue penetration and mobility limitations, these large Mab molecules would be slow to clear out from body circulation, and thus as a consequence could potentially damage non target tissue ( 12). Furthermore, these Mabs which typically display high affinity to Pgp may also be toxic to normal cells that physiologically express Pgp (27).
One way of circumventing of these limitations, is to use an antibody fragment.
Advantageously, the antibody fragment would have a small molecular size, yet a high specificity and moderate affinity to Pgp and thus would be highly efficient in inhibiting drug efflux activity in MDR cells yet devoid of the abovementioned limitations.
The possible use of an antibody fragment to overcome deficiencies of a monoclonal antibody molecule (Mab), was illustrated by Schodin and Kranz [J.
Biolog.
to Chem. 265:25722-25727 (1993)]. It was found that while monoclonal antibodies effectively inhibited activation of T cells in vitro, they also caused substantial undesirable side effects when used irz vivo. These side effects were effectively circumvented by replacing the Mab with a small size scFv.
Pat. No. 6,479,639 discloses a Pgp-specific Mab and the prospect of using portions thereof in therapy. It further describes enzymatic, chemical and genetic engineering techniques known in the art, which could be utilized for generating antibody fragments. Yet, the patent disclosure does not provide any examples of an actual Mab-derived fragment or specific methodology for generating same.
The fact that an antibody fragment capable of specifically binding Pgp and also 2o capable of modulating cellular MDR activity is not described in this or any other prior art document indicates that generation of functional antibody fragments from existing Mab sequences is not trivial.
This indication is supported by a recent study conducted by Niv and co-workers ( 19). This study generated and characterized a Pgp-specific Mab, termed "9F
11 ", and an scFv derived from this Mab. Both molecules, the complete 9F11 Mab as well as its scFv derivative, specifically targeted extracellular Pgp in MDR cells. However, while the 9F11 whole Mab was also capable of inhibiting drug-efflux activity in MDR cells, its scFv derivative was not (unpublished data).
Hence, the mere suggestion of U.S. Pat. No. 6,479,639 that Mab sequences can be utilized for generating a respective antibody fragment without actual demonstration that such an antibody fragment would be active in inhibiting drug-efflux activity in MDR cells does not provide an ordinary skilled artisan with motivation to generate such antibody fragment sequences since reasonable degree of success cannot be ensured.
The present invention provides a novel Pgp-specific antibody fragment which is capable of effectively inhibiting the drug-efflux activity in multidrug resistant cells.
Thus, according to one aspect of the present invention there is provided an antibody fragment which includes an antigen-binding region capable of binding an extracellular portion of P-glycoprotein (Pgp), and which is also capable of at least partially inhibiting the drug efflux activity in multidrug resistant cells.
Preferably, the antibody fragment is directed to the 170 kDa Pgp expressed by the human nadYl gene. Although several regions of this protein can potentially be targeted, the antibody fragment of the present invention is preferably directed to an epitope located to in the first extracellular loop of the 170 kDa polypeptide Pgp which is expressed by the human ~cdy-1 gene. Most preferably, the antibody fragment is directed to the amino acid sequence of SEQ ID NO:1.
The antibody fragment of the present invention can be generated using phage display techniques such as described in the following references: U.S. Pat.
Nos.
5,698,426; 5,658,727; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753;
5,821,047;
5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; and PCT application No. PCT/GB91/01134; PCT publications WO 90102809; WO 91/10737;
WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and Hoogenboom et al. Immunotechnology 4:1-20 (1998); Brinkman et al., J. Immunol.
2o Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995);
Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene (1997); and Burton et al., Advances in Immunology 57:191-280 (1994).
Accordingly, a target antigen may be utilized to immunize a host animal using immunization protocols well known in the art. Preferably, the target antigen is derived from P-glycoprotein (Pgp), more preferably the target antigen is derived from the 170 kDa Pgp expressed by the human nzdf-1 gene. Most preferably, the target antigen is derived from the first loop of the 170 kDa Pgp, and includes the amino acid sequence of SEQ ID
NO: l .
Following immunization, the mRNA of B-cells can be extracted from spleen, peripheral blood lymphocytes, bone-marrow or tonsil of the immunized animal.
The mRNA can then be utilized to construct an antibody fragment phage-display library, using methodology such as that described by Hoogenboom et al. [Immunotechnology 4:1-(1998)); Kand et al. [Proc. Natl. Acad. Sci. 88:4363 (1991)]; Barbas et al.
[Proc. Natl.
Acad. Sci. 88:7978 (1991)], Garrard et al.. [Biotechnology 9:1373-1377 (1991)];
Hoogenboom et al. [Nucleic Acids Res. 19:4133-4137 (1991)]; and Sharon et al.
[Combinational Chemistry & High Throughput Screening 3:185-196 (2000)].
Recombinant phages possessing desirable antibody binding properties can be selected by sequential enrichment of specific-target binding phages from a large excess of non-binding clones. This selection can be achieved by a number of optional techniques including panning on immobilized antigen; panning using specific elution;
using biotinylated antigen; affinity purification on columns; or direct panning on cells. Suitable selection techniques are described by, for example, Pluckthum [The Pharmacology of Monoclonal Antibodies, Vol 113: Rosenburg and Moors eds. Springer-Verlag, New York, pp. 269-315 (1994)] and Hoogenboom et al. ~Immunotechnology 4: 1-20 (1998)].
Following selection, the phages bearing nonspecific antibody fragments may be removed by washing and the bound phages, bearing target-specific antibody fragments, are eluted and amplified by infection of E. coli. Once the recombinant phages, displaying the target-specific antibody fragment, have been isolated, the polynucleotide sequence encoding the antibody can be recovered from the phage display package and cloned into a recombinant expression vector using standard methods known in the art, such as described by Ausubel et al. eds. [Current Protocols in Molecular Cloning (1989), Greene Publishing and Wiley Interscience, New York, NY].
2o An antibody fragment generated as described above can be characterized for Pgp specificity and affinity by any conventional immunoassay technique known in the art, including, but not limited to, the ELISA, radioimmunoassays, or immuofluorescence assays. The effect of an antibody fragment on inhibiting the drug-efflux activity in MDR
cells, may be assessed by monitoring intracellular accumulation or efflux of the drug of interest, in the present or absence of an antibody fragment. For example, Cole et al.
[Cancer Res. 54:5902-5910 (1994)] describe cellular accumulation and efflux assays which can be used for evaluating the efflux of drugs and/or toxins such as, but not limited to, doxorubicin, vincristine, colchicines, VP-16, vinblastine, verapamil, mitoxantrone, taxol, Cyclosporin A, quinidine, progesterone, tamoxifen, epirubicin, daunorubicin, and MX2. Additional suitable characterization assays include flow-cytometer or fluorometer assays which capitalize on the fluorescent properties of a drug, such as doxorubicin or daunorobicin [U.S. Pat. No. 5,556,856; Krishan Math. Cell Biol. 33:491-S00 (1990)], or alternatively, based on fluorescent dyes such as rhodamine or calcein [U.S.
Pat. No.
5,403,574; Hollo et al., Biochim. Biophys Acta 1191:384-388 (1994)]. The effect of an antibody fragment on increasing cytotoxicity to MDR cells may be assessed by monitoring cellular uptake of vital dyes following a period of exposure to a cytotoxin, such as the methods described in U.S. Pat. No. 5,543,423; or by assessment of 5 incorporation of [3H]Leucine, such as the method described in Example 3 of the example section that follows.
Example 1 of the Examples section which follows describes the isolation of an anti-Pgp single-chain antibody fragment (scFv).
Briefly, the amino acid sequence SEQ ID NO:l was batch-cloned into a fg8 l0 filamentous phage in fusion to a gene encoding a coat protein. The recombinant display phage was then used to immunize mice in order to generate an immune response to the target antigen (SEQ ID NO:l) using standard methods known in the art.
Following immunization, the spleen was removed from the immunized mice and the mRNA was extracted from splenic B cells. The isolated mRNA was then used to generate and 15 amplify cDNA using standard RT-PCR techniques. Following RT-PCR the amplified sequences were used to generate a phage display library which was screened using the target antigen. Polynucleotide sequences encoding the scFv were isolated from positive phage clones using standard molecular techniques. The isolated polynucleotide sequence (SEQ ID N0:2) was cloned into a prokaryotic expression vector and expressed in E. coli.
The expressed scFv was then purified from the periplasmic fraction of these cells, using standard purification methods (further description of scFv expression and purification is provided herein bellow).
As illustrated in Examples 2 and 3 of the Examples section which follows, the novel single-chain Fv generated according to the teachings of the present invention (termed "A2") is a relatively small molecule (about 30 kDa) which exhibits high specificity of binding to extracellular Pgp and multidrug resistant cells and a moderate binding affinity (about 150 nM) to Pgp. Furthermore this scFv is capable of effectively inhibiting drug efflux activity in MDR cells and as a result is capable of effectively increasing drug cytotoxicity in MDR cells.
As is mentioned hereinabove, a preferred approach for synthesizing the anti-Pgp scFv of the present invention is to isolate and express scFv encoding sequences.
As used herein the term "express" refers to the conversion of a polynucleotide sequence into a polypeptide.
Accordingly, the isolated polynucleotide sequence encoding the scFv polypeptide can be ligated to appropriate regulatory elements to generate a nucleic acid construct.
Preferably, the nucleic acid construct is an expression construct (i.e., an expression vector) which includes a promoter selected suitable for directing transcription of the isolated nucleic acid sequence encoding the polypeptide of this invention in a particular host cell.
Any suitable promoter sequence can be used by the nucleic acid construct of the present invention. Preferably, the promoter utilized by the nucleic acid construct is active in the specific cell being transformed. The nucleic acid construct of the present invention l0 can further include an enhancer, which can be adjacent or distant to the promoter sequence and can function in up regulating the transcription therefrom.
The nucleic acid construct of the present invention preferably further includes an appropriate selectable marker and/or an origin of replication. Preferably, the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for propagation in cells. The construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
A variety of prokaryotic or eukaryotic cells can be used as host-expression systems to express the polypeptide coding sequence. These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the polypeptide coding sequence; yeast transformed with recombinant yeast expression vectors containing the polypeptide coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV;
tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the polypeptide coding sequence. Mammalian expression systems can also be used to express the polypeptide of the present invention.
Bacterial systems are preferably used to produce recombinant polypeptides since they enable a high production volume at low cost.
In bacterial systems, a number of expression vectors can be advantageously selected depending upon the use intended for the polypeptide expressed. For example, when large quantities of polypeptide are desired, vectors that direct the expression of high levels of the protein product, possibly as a fusion with a hydrophobic signal sequence, which directs the expressed product into the periplasm of the bacteria or the culture medium where the protein product is readily purified may be desired.
Certain fusion protein engineered with a specific cleavage site to aid in recovery of the polypeptide may also be desirable. Such vectors adaptable to such manipulation include, but are not limited to, the pET series of E. coli expression vectors [Studier et al., Methods in Enzymol. 185:60-89 (1990)].
In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. Application No: 5,932,447. Alternatively, vectors can to be used which promote integration of foreign DNA sequences into the yeast chromosome.
In cases where plant expression vectors are used, the expression of the polypeptide coding sequence can be driven by a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al.
Nature 310:511-514 (1984)], or the coat protein promoter to TMV [Takamatsu et al.
EMBO J. 6:307-311 (1987)] can be used. Alternatively, plant promoters can be used such as, for example, the small subunit of RUBISCO [Coruzzi et al., EMBO J.
3:1671-1680 (1984); and Brogli et al., Science 224:838-843 (1984)] or heat shock promoters, e.g., soybean hsp17.5-E or hspl7.3-B [Gurley et al., Mol. Cell. Biol. 6:559-565 (1986)].
These constructs can be introduced into plant cells using Ti plasmid, Ri plasmid, plant viral vectors, direct DNA transformation, microinjection, electroporation and other techniques well known to the skilled artisan. See, for example, Weissbach &
Weissbach [Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-(1988)]. Other expression systems such as insects and mammalian host cell systems, which are well known in the art, can also be used by the present invention.
It will be appreciated that other then containing the necessary elements for the transcription and translation of the inserted coding sequence (encoding the polypeptide), the expression construct of the present invention can also include sequences engineered to optimize stability, production, purification, yield or activity of the expressed 3o polypeptide.
Transformed cells are cultured under effective conditions, which allow for the expression of high amounts of recombinant polypeptide. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH
and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce the recombinant polypeptide of the present invention.
Such a medium typically includes an aqueous solution having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
l0 Depending on the vector and host system used for production, resultant polypeptides of the present invention may either remain within the recombinant cell, secreted into the fermentation medium, secreted into a space between two cellular membranes, such as the periplasmic space in E. coli; or retained on the outer surface of a cell or viral membrane.
Following a predetermined time in culture, recovery of the recombinant polypeptide is effected.
The phrase "recovering the recombinant polypeptide" used herein refers to collecting the whole fermentation medium containing the polypeptide and need not imply additional steps of separation or purification.
Thus, polypeptides of the present invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
To facilitate recovery, the expressed coding sequence can be engineered to encode the polypeptide of~the present invention and fused cleavable moiety.
Such a ,..
fusion protein can be designed so that the polypeptide can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the cleavable moiety.
Where a cleavage site is engineered between the polypeptide and the cleavable moiety, the polypeptide can be released from the chromatographic column by treatment with an appropriate enzyme or agent that specifically cleaves the fusion protein at this site [e.g., see Booth et al., Immunol. Lett. 19:65-70 (1988); and Gardella et al., J.
Biol. Chem.
265:15854-15859 (1990)].
The polypeptide of the present invention is preferably retrieved in "substantially pure" form.
As used herein, the phrase "substantially pure" refers to a purity that allows for the effective use of the protein in the applications described herein.
In addition to being synthesizable in host cells, the polypeptide of the present invention can also be synthesized using ira vitro expression systems. These methods are well known in the art and the components of the system are commercially available.
1 o Further alternatively, the polypeptide of the present invention can also be synthesized using, for example, standard solid phase techniques. Such techniques include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis, and even by recombinant DNA
technology, such as described by Merrifield, J. [Am. Chem. Soc., 85:2149 (1963)]. Solid phase 1s polypeptide synthesis procedures are well known in the art and further described by John Morrow Stewart and Janis Dillaha Young [Solid Phase Peptide Syntheses, 2nd Ed., Pierce Chemical Company, (1984)].
The synthetic polypeptide can be purified by preparative high performance liquid chromatography procedure, such as described by Creighton T. [Proteins, structures and 20 molecular principles, W. H. Freeman and Co. N.Y. (1983)] and the composition of which can be confirmed via amino acid sequencing.
Since the antibody fragment of the present invention is Pgp-specific it can be used to detect multidrug resistant (MDR) cells. A key mechanism of MDR is the overexpression of Pgp and a clear correlation was established between overexpression of 25 Pgp and the lack of response to chemotherapy of cancer patients (6,7).
Thus, if chemotherapy is applied non-effectively, considerable damage may result from non target toxicity coupled with missed opportunity to provide another, more effective treatment.
Hence, an accurate, specific and reliable diagnosis of MDR cells in cancer patients would be a most useful clinical tool to determine options and selecting the most appropriate 3o treatment to administer.
Thus, according to another aspect of the present invention there is provided a method for detecting multidrug resistant cells. The method includes exposing cells to the antibody fragment of this invention, followed by detecting the antibody fragment bound to cells overexpressing Pgp, thereby detecting multidrug resistant cells.
Preferably, the antibody fragment is labeled with a detectable moiety (described below) and which can be detected using standard immunoassays known , in the art, such as ELISA, immunofluorescence, radioimmunoassay and immunohistochemical staining.
5 Initially, a biological sample, containing cells suspected of being MDR
cells, such as tumor cells, is obtained from the individual for ex vivo analysis. In order to prevent sampled cells from being degraded, the cells can be stored at temperature below -20 °C
until analyzed. Upon analysis, the cells are exposed to the antibody fragment and the antibody-cell binding is determined using any of the conventional in vitro immunoassay l0 techniques known in the art. For example, a tumor section can be exposed to the antibody fragment of this invention on a microscope slide and analyzed using standard immunohistochemical techniques.
Cells of an individual suspected of having multidrug resistant cells, such as a cancer patient, can also be exposed to the antibody fragment in vivo. In such cases, the 15 antibody fragment is labeled with a detectable moiety, such as radioactive moiety, e.g., 3H, 3sS, ~4C, 32P or ~zSI using standard techniques and the labeled antibody fragment is administered to an individual suspected of having cells overexpressing Pgp, preferably parenterally. Following a predetermined time period, changes in radioactivity levels in host cells are assessed using scintillation counting, auto-radiography or imaging 2o techniques.
The methodology described hereinabove is preferably practiced using a detection kit. The kit includes the antibody fragment of the present invention, which is preferably labeled with a detectable moiety such as a chromogenic moiety (e.g., biotin), a fluorogenic moiety (e.g., fluorescein), a light-emitting moiety (e.g., luminol) or a radioactive moiety (e.g., ~25I). The kit also includes reagents suitable for detecting the detectable moiety packaged in a container and identified in print on or in the package for use in diagnosing multidrug resistant cells. Procedures for labeling antibodies with such detectable moieties are described in, for example, "Using Antibodies: A
Laboratory Manual" [Ed Harlow, David Lane eds., Cold Spring Harbor Laboratory Press (1999)] and 3o the detection of such labeled antibodies can be accomplished using standard immunoassay procedures well known in the art.
As illustrated in the Examples section which follows, the anti-Pgp antibody fragment of this invention is highly suitable for use as an inhibitor of the drug efflux activity in multidrug resistant (MDR) cells, particularly for the following attributes: (i) it has a relatively small molecular size thereby conferring improved mobility and delivery to target cells, as well as short circulation in body fluids which minimizes undesired interactions with non-target cells; (ii) it has moderate affinity to Pgp , which further minimizes interactions with non-target cells; and (iii) it is capable of being expressed ex vivo and isa vivo.
Accordingly, the antibody fragment of this invention can be effectively used to substantially improve chemotherapy of individuals having multidrug resistant cancer cells.
Thus, according to another aspect of the present invention there is provided a method of treating cancer in an individual which includes providing the antibody fragment of this invention to an individual having cancer, and administrating the individual a therapeutically effective amount of an anti cancer agent, preferably an agent which is cytotoxic to cancer cells. The anti cancer drug may be administered prior to, concomitantly with, or following providing the antibody fragment. Preferably, the antibody fragment is provided to the patient sufficiently in advance of administering the anti cancer agent so as to allow the antibody fragment to penetrate to the individual's tumors containing MDR cells, to bind MDR cells, and to impair the drug-efflux capacity of such cells. The time interval required can be determined by routine pharmacokinetic methods and should be expected to vary with age, weight, and body size of the individual, as well as the location and condition of tumors containing the target MDR
cells.
The phrase "anti cancer .agent" and the phrase "chemotherapeutic drug" are used interchangeably herein and refer to a drug which can be used to treat cancer.
As used herein the term "treat" refers to substantially inhibiting, slowing or reversing the progression of a disease, such as cancer.
The antibody fragment may be provided by directly administrating the antibody fragment to the individual, or alternatively, by expressing the antibody fragment within cells of the individual.
When directly administrated, the antibody fragment is preferably introduced parenterally. It can be administered intravenously, intraperitoneally, retroperitoneally, intracistemically, intramuscularily, subcutaneously, topically, intraorbitally, intranasally or by inhilation. One or several doses may be administered as appropriate to achieve a sufficient level of antibody fragment bound to target MDR cells so as to produce an effective inhibition of drug efflux activity in the MDR cells to be eradicated by chemotherapy. The overall dosage and administration protocol for treatment with the antibody fragment and an anti cancer agent, may be designed and optimized by the clinical physician through the application of routine clinical skill.
The antibody fragment of this invention can also be provided by being expressed in cells of the individual. Preferably, the antibody fragment being expressed is a single-chain Fv (scFv). Further preferably, the antibody fragment is being expressed selectively in target cells such as, but not limited to MDR cancer cells, or in cells surrounding MDR
cancer cells (e.g., non MDR tumor cells), or in hematopoietic cells reaching MDR cancer to cells.. Expression of the antibody fragment in human cells can be effected by introducing the polynucleotide sequence of this invention into the target cells in a manner enabling transient or stable transformation and expression.
Introduction of the polynucleotide sequence of this invention into target cells may be accomplished either ex vivo or i~z vivo. In the ex vivo approach, cells are removed from an individual and transformed with the polynucleotide sequence of this invention while being cultured. The transformed cells are further expanded in culture and then returned to the individual. The ex-vivo approach is highly suitable for use along with autologous bone-marrow transplants. In such procedures, bone marrow cells are removed from the body of a cancer patient, hematopoietic stem cells are enriched, the patient treated with 2o extensive chemotherapy, and finally, the cultured stem cells are replanted into the patient in order to enable hematopoietic cell regeneration.
In such procedures, chemotherapy often fails to eradicate all cancer cells due to survival of multidrug resistance (MDR) cells. The recurrence of cancer following such extensive chemotherapy, when the body is drastically immuno-compromised, is most devastating. Use of the method of the present invention along with autologous bone marrow transplant can inhibit MDR activity and substantially decrease the likelihood of cancer recurrence.
The antibody fragment coding sequences can be introduced into the hematopoietic stem cells removed from the body and subsequently expressed and secreted from these 3o cells ifz vivo thereby targeting MDR cancer cells and substantially improving the efficacy of chemotherapy.
In the irz vivo approach, the polynucleotide is introduced directly to target cells within the individual. The polynucleotide of this invention can be introduced into cells by any one of a variety of known methods within the art. Such methods can be found generally described in Sambrook et al., [Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992)]; Ausubel et al., [Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989)]; Chang et al., .
[Somatic Gene Therapy, CRC Press, Ann Arbor, MI (1995)]; Vega et al., [Gene Targeting, CRC Press, Ann Arbor MI (1995)]; Vectors [A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston MA (1988)] and Gilboa et al.
[Biotechniques 4 (6): 504-512 (1986)] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In 1o addition, see United States patent 4,866,042 for vectors involving the central nervous system and also United States patents 5,464,764 and 5,487,992 for positive-negative selection methods for inducing homologous recombination.
A preferred approach for introducing a polynucleotide encoding the antibody fragment of the present invention into cells of an individual, is by using a viral vector.
Viral vectors offer several advantages including higher efficiency of transformation, and targeting to, and propagation in, specific cell types. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through specific cell receptors, such as cancer cell receptors.
Retroviral vectors represent one class of vectors suitable for use with the present invention. Defective retroviruses are routinely used in transfer of genes into mammalian cells (for review see Miller, A.D., Blood 76: 271 (1990)]. A recombinant retrovirus including a polynucleotide encoding the antibody fragment of the present invention can be constructed using well known molecular techniques. Portions of the retroviral genome can be removed to render the retrovirus replication defective and the replication defective retrovirus can then packaged into virions, which can be used to infect target cells through the use of a helper virus and while employing standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in, for example, Ausubul et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)]. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells endothelial cells, lymphocytes, myoblasts, hepatocytes and bone marrow cells.
Another suitable expression vector may be an adenovirus vector. The adenovirus is an extensively studied and routinely used gene transfer vector. Key advantages of an adenovirus vector include relatively high transduction efficiency of dividing and quiescent cells, natural tropism to a wide range of epithelial tissues and easy production of high titers [Russel, W.C. [J. Gen. Virol. 81: 57-63 (2000)]. The adenovirus DNA is transported to the nucleus, but does not integrate thereinto. Thus the risk of mutagenesis with adeno viral vectors is minimized, while short term expression is particularly suitable for treating cancer cells, such as multidrug resistant cancer cells. Adenoviral vectors used in experimental cancer treatments are described by Seth et al. [Adenoviral vectors for cancer gene therapy. In: P. Seth (ed.) Adenoviruses: Basic biology to Gene Therapy, Landes, Austin, TX , (1999) pp. 103-120].
to A suitable viral expression vector may also be a chimeric adenovirus/retrovirus vector which combines retroviral and adenoviral components. Preliminary results using such vectors to transduce tumor cells suggest that this new type of viral expression vector is more efficient than traditional expression vectors [Pan et al., Cancer Letters 184: 179-188 (2002)].
A specific example of a suitable viral vector for introducing and expressing the polynucleotide sequence of this invention in an individual is the adenovirus-derived vector Ad-TK. This vector expresses a herpes virus thymidine kinase (TK) gene for either positive or negative selection and includes an expression cassette for desired recombinant sequences. This vector can be used to infect cells that have an adenovirus 2o receptor which includes most cancers of epithelial origin [Sandmair et al.
[ Hum. Gene.
Ther. 11: 2197-2205 (2000)].
Features that limit expression to particular cell types can also be included.
Such features include, for example, promoter and regulatory elements that are specific for the desired cell type. The viral vector may also include a nucleotide sequence encoding a signal for secretion of the antibody fragment to the outside of the cell.
Secretion signals generally contain a short sequence (7-20 residues) of hydrophobic amino acids.
Secretion signals suitable for use in this invention are widely available and are well known in the art, see, for example by von Heijne [J. Mol. Biol. 184:99-105 (1985)] and by Lej et al., [J.
Bacteriol. 169: 4379 (1987)].
The recombinant vector can be administered in several ways. If viral vectors are used the procedure can take advantage of their target specificity and consequently, such vectors do not have to be administered locally at the tumor site. However, local administration can provide a quicker and more effective treatment.
Administration of viral vectors can also be performed by, for example, intravenous or subcutaneous injection into the subject. Following injection, the viral vectors will circulate until they recognize host cells with appropriate target specificity for infection.
The antibody fragment of the present invention, or the polynucleotide encoding 5 same, can be provided to an individual per se or as an active ingredient of a pharmaceutical composition which also includes a suitable carrier.
The pharmaceutical composition of the present invention can further include a chemotherapeutic drug, preferably a chemotherapeutic drug which is toxic to cancer cells such as, but not limited to, doxorubicin, vincristine, colchicines, VP-16, vinblastine, 10 verapamil, mitoxantrone, taxol, Cyclosporin A, quinidine, progesterone, tamoxifen, epirubicin, daunorubicin, and MX2.
The pharmaceutical composition may be administered in either one or more of ways depending on whether local or systemic treatment is of choice, and on the area to be treated. Administration may be done topically (including ophtalmically, vaginally, 15 rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip or intraperitoneal, subcutaneous, intramuscular or intravenous injection.
Preferably, the pharmaceutical composition is administered parenterally.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in .water-soluble form. Additionally, suspensions of the 20 antibody fragment may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as seasame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which icrease the viscosity of the suspension, such as sodium carboxylmethyl cellulose, sorbitol or dextran. Optionally, the suspension may 25 also contain suitable stabilizers or agentswhich increase the solubility of the antibody fragment to allow for the preparation of highly concentrated solutions.
Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which 26 .
notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for 1 o brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.
EXAMPLES
Reference is now made to the following examples, which together with the above 2o descriptions, illustrate the invention in a non limiting fashion. .
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature.
See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989);
"Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994);
Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York;
Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold 3o Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S.
Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A
Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994);
Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752;
3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533;
3,996,345;
4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis"
Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984);
"Animal Cell Culture" Freshney, R. L, ed. (1986); "Immobilized Cells and Enzymes" IRL
1o Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA ( 1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL
Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader.
All the information contained therein is incorporated herein by reference.
2o ISOLATION OF AZ SINGLE CHAIN Fv Gefiey~atiofa of peptide display cosistf°ucts for ifszmuniZatiosz:
The peptide sequence GEMTDIFANAGNL (SEQ ID NO:l) which corresponds to amino acids 73-85 of the first putative extracellular loop of human P-glycoprotein (Pgp, GenBank Accession number NM 000927.2) was synthesized as described by Niv et al (19). Recombinant phages that display this amino acid sequence were generated using the IIinDIII and Pstl cloning sites of the filamentous bacteriophage f88, as described by Frenkel and Solomon ( 17). The recombinant filamentous bacteriophage f88 were used to immunize mice in three intraperitoneally injection, of 10' 1 phage units in PBS per injection, at 14 days intervals. Serum samples collected from the immunized mice were 3o examined by ELISA for immunoreactivity with this peptide. The mice exhibiting a specific immune response to the target peptide were selected to construct a single-chain Fv (scFv) phage-display library.
Coustructiorz arzd screening of scFv library:
A scFv phage display library was generated using RNA extracted from spleen cells of the phage immunized mice described above, according to the procedure described by Clackson et al. [(Nature 352:624-628 (1991)x. Briefly, polynucleotide segments corresponding to the immunoglobulin heavy (VH) and light (VL) chain variable domains, were amplified from the mRNA spleen B-cells of immunized mice by RT-PCR, using specific sets of degenerate primers. The VH and VL PCR pools were assembled into a single-chain Fv repertoire by a PCR overlap extension reaction and subsequently cloned as an Sfil Notl fragment into the pCANTAB6 phagemid vector. The complexity of the to library was 1x10 independent clones. For panning, the library was first depleted from streptavidin binders by incubation with streptavidin-coated magnetic beads. A
biotinylated peptide comprising the amino acid sequence of SEQ ID NO:1 (l~.M) was then incubated with 10" cfu of the depleted library (1 hr, at room temperature) followed by addition of streptavidin-coated magnetic beads. Bound phages were eluted by using 1 ml of triethylamine (100 mM, pH 12) for 5 min at room temperature, followed by neutralization with 0.1 ml of 1 M Tris-HCI, pH 7.4. Eluted phages were expanded in exponentially growing E. coli TG1 cells that were later superinfected with helper phage as described by Hoogenboom et al (16).
As illustrated in Table 1 below, a progressive and marked enrichment, of phages that bind the peptide of SEQ ID NO:1, was observed after 3 rounds of panning.
Twenty phage clones out of 84 analyzed following the 3rd round of panning exhibited binding activity toward the peptide (data not shown). Fingerprint analysis by means of multicutter restriction enzyme digestion of 10 peptide- specific clones revealed that they had a similar digestion pattern, suggesting that all were similar or identical (data not shown). DNA
sequencing of VH and VL domains from these clones revealed that all were identical, suggesting that they were all derived from a single productive antibody during the VH/VL
combinatorial event. Sequence analysis and comparison to the Kabbat database revealed that the A2 VH domain belongs to subgroup II of mouse heavy chain and the VL
domain to the mouse Kappa II subgroup of light chains. The nucleic acid sequence of the scFv 3o constructed from these VH and VL domains is provided in SEQ ID N0:2.
Table 1 Selection of scFv phage library for binding the peptide of SEQ ID NO:1 C cle In ut* Out ut* Ratio O/ Enrichment 1 IX1O'~ 1x105 1x105 I
2 1x10" 1x10 1x10'4 300 3 I x 10" 2 x 10$ 2 x 10'3 2,000 * Phage input and output was determined by titration, determining phage cfu of infected E. coli T(il cells before and after each round of selection.
Expressiozz azzd purificatiozz of soluble recozzzbizzazzt scFv:
The A2 scFv sequence (SEQ ID N0:2) was rescued from the phage clone by PCR
and was subcloned into the phagemid vector pCANTAB6, using the Sfil Notl cloning sites. A Myc (SEQ ID N0:3) and hexahistidine tags were fused to the C-terminus of the scFv gene. The scFv antibody was expressed in BL21 (~,DE3) cells and purified from the periplasmic fraction by metal-ion affinity chromatography, using the hexahistidine tag fused to the C-terminus. An SDS-PAGE analysis of the purified A2 scFv is presented in Figure 1 a.
SPECIFICITYAND BINDING PROPERTIES OFA2 scFv The molecular profile of the A2 scFv antibody was analyzed by size-exclusion chromatography and revealed a single protein peak in a monomeric form with an expected molecular mass of approximately 30 kDa (data not shown). The yield of the A2 scFv was about 2% (2 mg of a highly pure protein in 1 liter culture).
The binding specificity of the purified A2 scFv antibody was determined via ELISA. 'A biotinylated target peptide having the amino acid sequence of SEQ ID
NO:l, or a non-target MRP1 control peptide (provided at 10 ~g in 100 ~,l) were each immobilized onto a flexible microtiter plate using BSA-biotin-streptavidin. A
purified A2 scFv was then added, at different concentrations, to the peptide-coated plate and was detected with an anti Myc tag-HRP conjugate antibody.
The ELISA results, presented in Figure lb, show that A2 scFv antibody reacted positively and in a dose-dependent manner with the target Pgp-derived peptide (SEQ ID
3o NO:l). By comparison, A2 scFv did not react with the non-target MRPl control peptide.
The binding properties of A2 scFv were further characterized using a saturation ELISA. In this experiment, a biotinylated Pgp-derived peptide (SEQ ID N0:1) was bound to plates precoated with BSA-biotin and exposed to increasing amounts of scFv. The ELISA results which are illustrated in Figure 1 c, show that A2 scFv binding to the target peptide was dose-dependent and saturable. By interpolating the amount of A2 scFv necessary for 50% of maximal binding the affinity constant was estimated at 150 nM, indicating moderate affinity.
5 In a competition binding radio-immunoassay the purified A2 scFv (100 gg) was first labeled with [~25I] using the Bolton-Hunter reagent. The [l2sl]-labeled A2 scFv antibody was added as a tracer (3-5 x 105 cpm/well) to a flexible microtiter plate, which had been pre-coated with BSA-biotin and the target peptide (SEQ ID NO:l), as described above. A non-labeled (i.e., cold) A2 scFv was then added, as a competitor, to the pre-l0 coated plates at increasing concentrations. Plates were incubated for 1 hr at room temperature, then washed and analyzed by gamma counter. The radio-immunoassay results, illustrated in Figure 1d, show that the [l2sl]-labeled A2 scFv antibody binding to the target Pgp-derived peptide (having the amino acid sequence SEQ ID NO:l) was dose-dependent. By interpolating the amount of the competitor (cold) A2 scFv necessary for 15 50% of maximal binding, the affinity constant was estimated at 130 nM, indicating a moderate affinity.
In another series of experiments, the reactivity and specificity of A2 scFv to Pgp, expressed on the surface of MDR cells, was evaluated. These experiments utilized human carcinoma cell lines that display a stable Pgp-dependent MDR phenotype, as well as their 2o respective parental drug-sensitive cells. The MDR cell lines and the drug-sensitive cell lines used in these experiments are described in Table 2 below.
Table 2 Tissue of Ori in MDR Cell Line Dru -Sensitive Cell Line Human ovarian carcinoma 2780A~ * 2780 Human epidermoid KBV-1 ** ~KB3-1 **
carcinoma ~
25 * 2780""" was established from the drug sensitive 2780 cell line (21 ).
** KBV-1 was established from the drug sensitive KB3-1 cell line (24).
Drug sensitive cells and MDR cells (5x105) were washed with PBS, and resuspended in RPMI-1640 medium (GIBCO). Cells growing on six well tissue culture 30 plates were washed twice followed by incubation with soluble purified A2 scFv (50 ~.g/ml) for 90 minutes on ice. Detection was with anti-Myc (30 ~.g/ml) and FITC- labeled anti-mouse IgG ( 1:1000, Jackson). Detection of fluorescent cells was performed on a FACScalibur (Becton Dickinson).
Figures 2a-d demonstrate a comparative immuno-fluorescence flow-cytometer analyses, illustrating a strong reactivity of A2 scFv with the MDR cell lines (Figure 2b) and KBV-1, while no reactivity was observed with the drug-sensitive cell lines 2780 (Figure 2a) and KB3-1 (Figure 2c).
The specificity and reactivity of the A2 scFv antibody to MDR and Pgp-overexpressing cells was further demonstrated by comparative immuno-histochemistry analysis. Drug sensitive cells and MDR cells were grown to 50% confluence on glass slides, pre-coated with 4% gelatin in PBS, fixed with 2% formaldehyde in PBS, blocked with 1% BSA in PBS at room temperature, then followed by 90 min incubation with A2 scFv (0.2 mg/ml) in PBS containing 1% BSA (room temperature). The slides were then covered with HRP-labeled anti-Myc- antibody (1:500, in PBS containing 1% BSA) for 1 hr, washes with water, then covered with peroxidase substrate, (AEC) for 2-3 min. Slides were then washed with water and counter staining was performed with hematoxylin. As illustrated in Figures 2e-h, the A2 scFv antibody displayed an intense in situ staining of MDR 2780ADR and KBV-1 cells (Figures 2e and 2g, respectively), while on the other hand, A2 scFv did not stain the respective drug-sensitive parental 2780 and KB3-1 cells (Figures 2f and 2 h, respectively).
Hence, the results described hereinabove clearly demonstrate that the A2 scFv antibody selectively binds human cell surface-expressed Pgp and does not bind human 2o drug-sensitive cells which lack, or marginally express Pgp.
BIOLOGICAL FUNCTION OF AZ scFv The effect of A2 scFv on the drug-efflux activity of Pgp was evaluated in a series of chromophore efflux assays. The assays utilized the fluorescent Pgp hydrophobic-substrate calcein-AM (Molecular Probes, Eugene, Oregon), as inverse relationship exist between the level of Pgp activity and the accumulation of calcein in MDR cells [Hollo et al (20)]. The A2 scFv was applied to human and rodent (CHO) cell lines that display a stable Pgp-dependent MDR phenotype, and their respective parental drug-sensitive cells, as described in the Table 3 below.
Table 3 Tissue of Ori in MDR Cell Line Dru -Sensitive Cell Line Human ovarian carcinoma 2780'' * 2780 Human a idermoid KBV-1 ** KB3-1 **
carcinoma rodent (CHO) EMTR' *** A8 ***
* ~7R0~ R was establishedfrom the drug sensitive cell line (21).
** KBV-1 was established from the drug sensitive KB3-1 cell line (24).
*** EMTR' was established from the drug sensitive A8 cell line (23).
Drug sensitive cells and MDR cells (5x105) were washed with PBS, and resuspended in HPMI buffer (10 mM Hepes at pH 7.4 containing 120 mM NaCI, 5mM
KCI, 0.4mM CaCl2, 10 mM NaHC03, 5mM NaZHPOa, and 10 mM glucose). The cell i o suspensions were pre-incubated for various times with various concentrations of the A2 scFv, then supplemented with 1 ~.M calcein-AM (a fluorescent Pgp hydrophobic substrate;
Molecular Probes, Eugene, Oregon) and allowed for 5-15 min incubation at 37°C.
Following incubation, the treated and untreated cells were exposed to calcein and analyzed for fluorescence intensity (493-515 nm) by a standard fluorometer or by a flow cytometer (FACScalibur, Becton Dickinson).
Figure 3a illustrate that the MDR cell line 278OADR, accumulated 5 and 10-fold less calcein (after 5 or 15 min incubation, respectively), as compared with the parental drug-sensitive 2780 cell line. Similarly, the results of a flow cytometer assay, illustrated in Figure 3b, show that the MDR cell line 2780ADR exhibited substantially lower mean 2o fluorescence intensity than the respective parental drug-sensitive 2780 cell line. These results clearly demonstrate the functional capacity of MDR and Pgp-overexpressed cells to extrude chromophoric substrates like calcein-AM.
In a similar experiment, A2 scFv was added to 2780ADR cells, for 10 - 30 minutes prior to the addition of calcein-AM. The A2 scFv treatment resulted in a substantial increase in fluorescence intensity of cells, indicating a substantial decrease in drug-efflux activity. Accordingly, Figure 3c shows that the accumulation of calcein in cells treated with A2 scFv, was 4-5 fold higher than the accumulation of calcein in cells not treated with A2 scFv. The results illustrated in Figure 3c further show that the inhibitory effect of A2 scFv on the drug-efflux activity of 2780ADR cells, was dose-dependent and 3o exhibited maximal inhibitory activity at 100 ~,g/ml (i.e. 4~.M). The drug-efflux inhibitory effect of A2 scFv was similar to the drug-efflux inhibitory effect observed with 15~M
verapamil, a known modulator of Pgp drug efflux (8). A similar effect was observed via a flow cytometer analysis, as illustrated in Figure 3d. These results indicate that the A2 scFv antibody can effectively inhibit the drug-efflux activity of human MDR
and Pgp overexpressing cells.
In another assay, the drug efflux modulating-activity of A2 scFv was compared with G1 scFv [isolated against a melanoma associated tumor antigen (22)]. The assay results, illustrated in Figure 3e, show that while the A2 scFv substantially inhibited drug efflux activity Of 278OADR, the Gl scFv antibody treatment had no effect.
The effect of A2 scFv on the drug efflux activity of other MDR and Pgp-overexpressing cell lines, and their parental drug-sensitive cell lines, was evaluated in a series of assays. Figures 4a-b illustrate the effect of A2 scFv on the drug efflux activity of 1o MDR and Pgp-overexpressing EMTR' and KBV-1 cells. The results show substantial increases in calcein accumulation, indicating drug-efflux inhibition in cells treated with A2 scFv To ascertain that the inhibitory activity of the A2 scFv molecule is not due to non-specific cell toxicity, additional experiments were performed whereby A2 scFv was pre-incubated, prior to addition of calcein, with the drug sensitive cell lines 2780, I~B3-1 and A8. The results, illustrated in Figure 4c-e, show that A2 scFv treatment did not affect the level of calcein accumulation in any of these cells, indicating no effect on the drug-efflux activity of drug-sensitive cells treated with A2 scFv.
The drug-efflux inhibition efficiency of A2 scFv was further evaluated in another 2o assay in which the A2 scFv was provided, at increasing concentrations, to cells, followed by the addition of calcein-AM. The results, illustrated in Figure 5a, show that A2 scFv increased the accumulation of calcein in cells in a dose-dependant and saturable fashion. The minimal detectable inhibitory activity was observed with an A2 scFv concentration of 0.025 mg/ml (1 ~.M). The saturation inhibitory activity was observed with an A2 scFv concentration exceeding 0.1 mg/ml (4 ~.M). The concentration of A2 scFv molecule that inhibits 50% drug-efflux activity (ICSO) was estimated at 65 ~.g/ml (2.6 ~.M).
The effect of the AZ scFv molecule on the survival Of 27$OADR, exposed to doxorubicin (a chemotherapeutic drug), was evaluated based on the level of [3H]Leucine 3o in cells, an indicator of cell viability. Cells were pre-incubated with A2 scFv at a concentration of 0.2 mg/ml, then exposed to 5 - 10 ~.M of doxirubicin and then analyzed for [3H]Leucine content. As illustrated in Figure 5b, the A2 scFv treatment effectively reduced the viability of cells exposed to doxirubicin, as compared with cells not treated with A2 scFv. These results show that A2 scFv can inhibit the Pgp-mediated drug efflux activity in mufti-drug resistant cells, thereby circumventing drug resistance.
Thus, in conclusion, the results presented herein clearly demonstrate that the scFv antibody of the present invention selectively reacts with Pgp-overexpressing cells and is therefore an effective inhibitor of drug-efflux activity in mufti-drug resistant cells.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for to brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.
REFERENCES CITED
(Additional references are cited in the text) 1. Gottesman, M.M., and Pastan, I. Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu. Rev. Biochem. 6:385-427, 1993.
2. Tan B, Piwnica-Worms D, Ratner L. Multidrug resistance transporters and modulation. Cur°r OpirZ Oncol. 12:450-8, 2000.
3. Sarkadi, B., and Muller, M. Search for specific inhibitors of multidrug resistance in cancer. Semin. Cancer Biol. 8: 171-82, 1997.
4. Riordan, J.R., and Ling, V. Purification of P-glycoprotein from plasma membrane vesicles of Chinese hamster ovary mutants with reduced colchicines permeability.
J. Biol. Chem. 254:12701-12705, 1979.
5. Borst P, Elferink RO. Mammalian abc transporters in health and disease.
Aranu Rev Biochem.71:537-92, 2002.
6. Roninson, L, Abelson, H.T., Housman, D.E., Howell, N., and Varshavsky, A.
Amplification of specific DNA sequences correlates with multi-drug resistance in Chinese hamster cells. Nature 309:626-628, 1985.
7. Goldstein, L.J., Galski, H., Fojo, A., Willingham, M.C., Lai, S.-L., Gazadar, A., Pirker, R., Green, A., Crist, W., Brodeur, G.M., Lieber, M., Cossman, J., Gottesman, M.M., and Pastan, I. Expression of a multidrug resistance gene in human cancers. J. Natl. Cancer Inst. 81:116-124, 1989.
8. Tsuruo T, Iida H, Tsukagoshi S, Sakurai Y. Overcoming of vincristine resistance in P388 leukemia in vivo and in vitro through enhanced cytotoxicity of vincristine and vinblastine by verapamil. Cancer Res. 41:1967-72, 1981.
9. Hamada H, and Tsuruo T. Functional role for the 170- to 180-kDa glycoprotein specific to drug-resistant tumor cells as revealed by monoclonal antibodies.
Proc Natl Acad Sci U S A 83:7785-9, 1986.
10. Mechetner EB, and Roninson IB. Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proc Natl Acad Sci U S A
89:5824-8, 1992.
According to still further features in the described preferred embodiments the method of detecting cells overexpressing P-glycoprotein includes exposing the cells to the antibody fragment of the present invention which is labeled with a detectable moiety, preferably the detectable moiety is selected from the group consisting of a chromogenic moiety, a fluorogenic moiety, a light-emitting moiety and a radioactive moiety.
l0 According to still further features in the described preferred embodiments the isolated polynucleotide of the present invention is as set forth in SEQ ID
N0:2.
According to still further features in the described preferred embodiments the nucleic acid construct of the present invention further includes a promoter for regulating expression of said polynucleotide.
The present invention successfully addresses the shortcomings of the presently known configurations by providing an antibody fragment, a pharmaceutical composition, a polynucleotide, a nucleic acid construct, a kit and methods of utilizing same. The antibody fragment includes an antigen binding region capable of binding an extracellular portion of a P-glycoprotein thereby at least partially inhibiting drug efflux activity in multidrug resistant cells.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.
In the drawings:
FIGS. 1 a-d demonstrate specificity and binding properties of purified A2 single chain Fv (scFv). Figure 1 a is a photograph of SDS-PAGE analysis presenting a single to band of A2 scFv in the center and right lanes, while the left lane shows bands of molecular size standards. Figure lb is a bar graph of an ELISA of A2 scFv binding to biotinylated target Pgp-derived peptide (comprising an amino acid sequence of SEQ ID
NO:l; Pgp), or to biotinylated non-target peptide (PRP), or to streptavidin (streptA). The graph shows that A2 scFv reacted with the target Pgp-derived peptide in a dose-dependant fashion. A2 scFv did not react with the non-target peptide or with streptavidin. Figure lc is a plot of an ELISA presenting a dose-response curve of binding of A2 scFv to a biotinylated target Pgp-derived peptide. The concentration of A2 scFv required for 50%
binding was interpolated as ca. 150 nM. Figure ld is a competition radioimmunoassay plot. The plot is based on using a constant amount of [~ZSI]-labeled A2 scFv and an 2o increasing amount of non-labeled A2 scFv (as a competitor). The required concentration for 50% binding inhibition of A2 scFv was interpolated as ca. 130 nM.
FIGs. 2a-h demonstrate the capacity and selectivity of A2 scFv binding to tumor cells exhibiting mufti-drug resistant (MDR) and over-expressing P-glycoprotein (Pgp).
Figure 2a is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with drug-sensitive human ovarian carcinoma cells 2780. The plot shows that A2 scFv treatment had no effect on fluorescent intensity, indicating no antibody-cell binding.
Figure 2b is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with MDR and Pgp-overexpressing ovarian carcinoma cells 2780ADR. The plot shows that A2 scFv treatment resulted in a 10-fold increase in fluorescent intensity, indicating strong antibody-cell binding. Figure 2c is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with drug-sensitive human carcinoma cells KB3-1. The plot shows that A2 scFv treatment had no effect on fluorescent intensity, indicating no antibody-cell binding. Figure 2d is a plot presenting an immunofluorescence flow-cytometer analysis of A2 scFv reacting with MDR and Pgp- , overexpressing human carcinoma cells KBV-1 (derived from the drug-sensitive human carcinoma cells KB3-1). The plot shows that A2 scFv treatment resulted in a substantial increase in fluorescent intensity, indicating a strong antibody-cell binding.
Figure 2e is a microphotograph illustrating immuno-histochemical staining of MDR and Pgp overexpressing ovarian carcinoma cells 278OADR (derived from the drug-sensitive ovarian carcinoma cell line 2780), treated with A2 scFv. The microphotograph shows stained cells indicating a positive antibody-cell reaction. Figure 2f is a microphotograph illustrating immuno-histochemical staining of drug-sensitive cells 2780 treated with A2 1o scFv. Cells were remained unstained indicating no antibody-cell reaction.
Figure 2g is a microphotograph illustrating immuno-histochemical staining of MDR and Pgp-overexpressing human carcinoma cells KB3-1 (derived from drug sensitive human carcinoma cell line KBV-1) treated with A2 scFv. The microphotograph shows stained cells indicating a positive antibody-cell reaction. Figure 2h is a microphotograph illustrating immuno-histochemical staining of drug sensitive human carcinoma cells KBV-1 (the parent line of the MDR and Pgp-overexpressing human carcinoma cell line KB3-1) treated with A2 scFv. Cells were remained unstained indicating no antibody-cell reaction.
FIGS. 3a-a demonstrate the effect of A2 scFv on drug efflux activity in MDR
cells.
Figure 3a is a bar graph presenting data obtained by a fluorometer assay comparing the calcein accumulation rate in (i) drug-sensitive human ovarian carcinoma cells (represented by black bars), and in (ii) MDR and Pgp-overexpressing ovarian carcinoma cells 2780A°R (represented by gray bars). The graph shows 5 and 10-fold decrease in fluorescence intensity, indicating a decrease in calcein uptake, after 5 or 15 min incubation, respectively. Figure 3b is a plot presenting a flow cytometer assay comparing calcein accumulation in (i) drug-sensitive human ovarian carcinoma cells 2780, and in (ii) MDR and Pgp-overexpressing human ovarian carcinoma cells 2780ADR. The plot shows that the 2780ADR cells exhibited substantially lower mean fluorescence intensity, indicating a substantially lower level of calcein uptake by the MDR cells, as compared with the calcein uptake by the drug-sensitive 2780 cells. Figure 3c is a bar graph demonstrating the effect of A2 scFv on the accumulation of calcein in MDR and Pgp-overexpressing 2780ADR cells, in a fluorometer assay. The graph shows a positive dose-response effect of A2 scFv, administered prior to the addition of calcein, on the uptake of calcein by 2780ADR cells. Figure 3d is a plot demonstrating the effect of A2 scFv on calcein uptake by MDR and Pgp-overexpressing 2780ADR cells. The A2 scFv was administered to cells prior to the addition of calcein. The plot shows a substantially higher (4-5 fold) mean of fluorescence intensity, indicating a substantial increase in calcein uptake by MDR cells treated with A2 scFv, as compared with cells not treated with A2 scFv. Figure 3e is a bar graph illustrating specificity of scFv. The graph presenting data obtained by a fluorometer assay and shows that administration of A2 scFv to 2780ADR cells, followed by to addition of calcein, substantially increased the cells' fluorescence intensity, indicating increased calcein uptake in cells. In comparison, the l0 administration of a non-target scFv Gl (isolated against a melanoma tumor antigen) to the 2780ADR cells, did not increase calcein uptake in cells.
FIGS. 4a-e. demonstrate the effect of A2 scFv on drug efflux activity in various MDR cell lines and their parental drug-sensitive cell lines. Figure 4a is a bar graph presenting data obtained by a fluorometer assay comparing calcein uptake in a rodent (CHO) MDR cell line EMTR~. The graph shows that cells treated with A2 scFv, followed by addition of calcein, exhibited substantially higher levels of fluorescence, which is indicative of higher calcein uptake in cells, as compared with the untreated (negative) control. The effect of A2 scFv was similar to the effect of verapamil, a reference MDR
modulator used as a positive control. Figure 4b is a bar graph presenting data obtained by 2o a fluorometer assay comparing calcein uptake in a MDR human epidermoid cell line KB-V 1. The graph shows that cells treated with A2 scFv, followed by addition of calcein, exhibited substantially higher levels of fluorescence, which is indicative of higher calcein uptake in cells, as compared with the untreated (negative) control. The effect of A2 scFv was similar to the effect of verapamil, a reference MDR modulator used as a positive control. Figure 4c is a bar graph presenting data obtained by a fluorometer assay comparing calcein uptake in a drug-sensitive 2780 cell line (the parental line of 2780ADR).
The graph showed similar fluorescence intensity observed in cells treated by A2 scFv, untreated (negative) control, or verapamil (positive) control, thus indicating no effect exerted by A2 scFv on calcein uptake in the drug-sensitive cells. Figure 4d is a bar graph 3o presenting data obtained by a fluorometer assay comparing calcein uptake in a drug-sensitive human epidermoid cell line KB3-1 (the parental line of KBV-1). The graph shows similar fluorescence intensity observed in cells treated by A2 scFv, untreated (negative) control, or verapamil (positive) control, thus indicating no effect exerted by A2 scFv on calcein uptake in the drug-sensitive cells. Figure 4e is a bar graph presenting data obtained by a fluorometer assay comparing calcein uptake in a drug-sensitive rodent (CHO) cell line A8 (the parental line of EMTR~). The graph shows similar fluorescence intensity observed in cells treated by A2 scFv, untreated (negative) control, or verapamil 5 (positive) control, thus indicating no effect exerted by A2 scFv on calcein uptake in the drug-sensitive cells.
FIG. 5 is a plot presenting calcein uptake in 2780A°R cells treated with various concentrations of A2 scFv. The plot shows a dose-response curve of fluorescence intensity, indicative of calcein uptake. The estimated saturation (ICioo) and ICSo 1o concentrations are 0.1 and 0.065 mg A2 scFv per ml, respectively (or 4 and 2.6 ~M, respectively).
FIG. 6 is a bar graph presenting the effect of A2 scFv on the viability of cells treated with various concentrations of doxorubicin. The viability of cells was determined by [3H]-leucine incorporation into cellular proteins. The graph shows that treating cells with A2 scFv, prior to the addition of doxorubicin, resulted in substantial loss of viability of cells, as compared with cells not treated with A2 scFv.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is of an antibody fragment which includes an antigen binding-site capable of binding extracellular P-glycoprotein (Pgp), and as such, can be used for inhibiting drug efflux activity in multidrug resistant (MDR) cells, or in detecting MDR cells.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.
As used herein the term "P-glycoprotein" refers to a 170. kDa trans-membrane 3o protein encoded by the human mdf-1 gene, which functions as an energy-depended biological pump in multidrug resistant cells.
As used herein the phrase "multidrug resistance" refers to the resistance of some cells, such as cancer cells overexpressing Pgp, to cytotoxic drugs.
As used herein the phrase "antibody fragment" refers to any active portion of a native antibody molecule. Examples of antibody fragments include, but are not limited to an Fv, a single chain Fv, a Fab, a F(ab')2 or a Fab'. An antibody fragment may be produced enzymatically or chemically from an intact antibody, or may be synthetically produced. Alternatively, an antibody fragment may be expressed from a polynucleotide sequence encoding the antibody fragment sequence.
As used herein the term "Fv" refers to a polypeptide comprising one variable light chain (VL) domain and one variable heavy chain (VH) domain of an antibody molecule held together by noncovalent interactions. An Fv includes the antigen binding region of 1o the antibody molecule.
As used herein the phrase "single chain Fv" (scFv) refers an Fv in which the VL
and VH domains are connected preferably by a polypeptide linker. The scFv is the smallest antibody fragment that bears the complete antigen binding site.
As used herein the term "Fab" refers to the polypeptide comprising an antibody fragment which is essentially equivalent to that obtained by digestion of the antibody with the enzyme papain.
As used herein the term "F(ab')2, refers to the polypeptide comprising an antibody fragment which is essentially equivalent to that obtained by digestion of the antibody with the enzyme pepsin at pH 4:0 - 4.5.
2o As used herein the term "Fab' " refers to the polypeptide comprising an antibody fragment which is essentially equivalent to that obtained by reduction of the disulfide bridge or bridges joining the two heavy chain pieces of a F(ab')2.
Several Pgp-specific monoclonal antibodies (Mab) which are capable of binding Pgp and thereby circumventing drug-efflux activity in MDR cells have been described in the prior art [U.S. Pat. Nos. 4,837,306, 5,766,946 and 6,479,639; Meyers, M.
B. et al., Cancer Res., 49:3209 (1987); O'Brien, J. P. et al., Proc. Amer. Assoc. Cancer Res., 30:Abs 2114 (1989); Cinciarelli, C., et al., Int. J. Cancer, 47:533 (1991) Hamada H., et al., Cancer Res. PNAS 83:7785 (1986); Pearson, J.W., et al., J. Natl. Cancer Inst. 88:1386 (1991); Tsuruo, T., et al., Jpn. J. Cancer Res. 80:627 (1989); Hamada H. et al., cancer 3o Res. 50:3167 (1990)]. Yet, thus far, practical therapeutic use of such anti-Pgp Mabs has been hampered mainly by the large size of these molecules which limits the mobility and tissue penetration thereof [Yokota et al., Cancer Res. 52: 3402-3408 (1992)].
In addition to tissue penetration and mobility limitations, these large Mab molecules would be slow to clear out from body circulation, and thus as a consequence could potentially damage non target tissue ( 12). Furthermore, these Mabs which typically display high affinity to Pgp may also be toxic to normal cells that physiologically express Pgp (27).
One way of circumventing of these limitations, is to use an antibody fragment.
Advantageously, the antibody fragment would have a small molecular size, yet a high specificity and moderate affinity to Pgp and thus would be highly efficient in inhibiting drug efflux activity in MDR cells yet devoid of the abovementioned limitations.
The possible use of an antibody fragment to overcome deficiencies of a monoclonal antibody molecule (Mab), was illustrated by Schodin and Kranz [J.
Biolog.
to Chem. 265:25722-25727 (1993)]. It was found that while monoclonal antibodies effectively inhibited activation of T cells in vitro, they also caused substantial undesirable side effects when used irz vivo. These side effects were effectively circumvented by replacing the Mab with a small size scFv.
Pat. No. 6,479,639 discloses a Pgp-specific Mab and the prospect of using portions thereof in therapy. It further describes enzymatic, chemical and genetic engineering techniques known in the art, which could be utilized for generating antibody fragments. Yet, the patent disclosure does not provide any examples of an actual Mab-derived fragment or specific methodology for generating same.
The fact that an antibody fragment capable of specifically binding Pgp and also 2o capable of modulating cellular MDR activity is not described in this or any other prior art document indicates that generation of functional antibody fragments from existing Mab sequences is not trivial.
This indication is supported by a recent study conducted by Niv and co-workers ( 19). This study generated and characterized a Pgp-specific Mab, termed "9F
11 ", and an scFv derived from this Mab. Both molecules, the complete 9F11 Mab as well as its scFv derivative, specifically targeted extracellular Pgp in MDR cells. However, while the 9F11 whole Mab was also capable of inhibiting drug-efflux activity in MDR cells, its scFv derivative was not (unpublished data).
Hence, the mere suggestion of U.S. Pat. No. 6,479,639 that Mab sequences can be utilized for generating a respective antibody fragment without actual demonstration that such an antibody fragment would be active in inhibiting drug-efflux activity in MDR cells does not provide an ordinary skilled artisan with motivation to generate such antibody fragment sequences since reasonable degree of success cannot be ensured.
The present invention provides a novel Pgp-specific antibody fragment which is capable of effectively inhibiting the drug-efflux activity in multidrug resistant cells.
Thus, according to one aspect of the present invention there is provided an antibody fragment which includes an antigen-binding region capable of binding an extracellular portion of P-glycoprotein (Pgp), and which is also capable of at least partially inhibiting the drug efflux activity in multidrug resistant cells.
Preferably, the antibody fragment is directed to the 170 kDa Pgp expressed by the human nadYl gene. Although several regions of this protein can potentially be targeted, the antibody fragment of the present invention is preferably directed to an epitope located to in the first extracellular loop of the 170 kDa polypeptide Pgp which is expressed by the human ~cdy-1 gene. Most preferably, the antibody fragment is directed to the amino acid sequence of SEQ ID NO:1.
The antibody fragment of the present invention can be generated using phage display techniques such as described in the following references: U.S. Pat.
Nos.
5,698,426; 5,658,727; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753;
5,821,047;
5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; and PCT application No. PCT/GB91/01134; PCT publications WO 90102809; WO 91/10737;
WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and Hoogenboom et al. Immunotechnology 4:1-20 (1998); Brinkman et al., J. Immunol.
2o Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995);
Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene (1997); and Burton et al., Advances in Immunology 57:191-280 (1994).
Accordingly, a target antigen may be utilized to immunize a host animal using immunization protocols well known in the art. Preferably, the target antigen is derived from P-glycoprotein (Pgp), more preferably the target antigen is derived from the 170 kDa Pgp expressed by the human nzdf-1 gene. Most preferably, the target antigen is derived from the first loop of the 170 kDa Pgp, and includes the amino acid sequence of SEQ ID
NO: l .
Following immunization, the mRNA of B-cells can be extracted from spleen, peripheral blood lymphocytes, bone-marrow or tonsil of the immunized animal.
The mRNA can then be utilized to construct an antibody fragment phage-display library, using methodology such as that described by Hoogenboom et al. [Immunotechnology 4:1-(1998)); Kand et al. [Proc. Natl. Acad. Sci. 88:4363 (1991)]; Barbas et al.
[Proc. Natl.
Acad. Sci. 88:7978 (1991)], Garrard et al.. [Biotechnology 9:1373-1377 (1991)];
Hoogenboom et al. [Nucleic Acids Res. 19:4133-4137 (1991)]; and Sharon et al.
[Combinational Chemistry & High Throughput Screening 3:185-196 (2000)].
Recombinant phages possessing desirable antibody binding properties can be selected by sequential enrichment of specific-target binding phages from a large excess of non-binding clones. This selection can be achieved by a number of optional techniques including panning on immobilized antigen; panning using specific elution;
using biotinylated antigen; affinity purification on columns; or direct panning on cells. Suitable selection techniques are described by, for example, Pluckthum [The Pharmacology of Monoclonal Antibodies, Vol 113: Rosenburg and Moors eds. Springer-Verlag, New York, pp. 269-315 (1994)] and Hoogenboom et al. ~Immunotechnology 4: 1-20 (1998)].
Following selection, the phages bearing nonspecific antibody fragments may be removed by washing and the bound phages, bearing target-specific antibody fragments, are eluted and amplified by infection of E. coli. Once the recombinant phages, displaying the target-specific antibody fragment, have been isolated, the polynucleotide sequence encoding the antibody can be recovered from the phage display package and cloned into a recombinant expression vector using standard methods known in the art, such as described by Ausubel et al. eds. [Current Protocols in Molecular Cloning (1989), Greene Publishing and Wiley Interscience, New York, NY].
2o An antibody fragment generated as described above can be characterized for Pgp specificity and affinity by any conventional immunoassay technique known in the art, including, but not limited to, the ELISA, radioimmunoassays, or immuofluorescence assays. The effect of an antibody fragment on inhibiting the drug-efflux activity in MDR
cells, may be assessed by monitoring intracellular accumulation or efflux of the drug of interest, in the present or absence of an antibody fragment. For example, Cole et al.
[Cancer Res. 54:5902-5910 (1994)] describe cellular accumulation and efflux assays which can be used for evaluating the efflux of drugs and/or toxins such as, but not limited to, doxorubicin, vincristine, colchicines, VP-16, vinblastine, verapamil, mitoxantrone, taxol, Cyclosporin A, quinidine, progesterone, tamoxifen, epirubicin, daunorubicin, and MX2. Additional suitable characterization assays include flow-cytometer or fluorometer assays which capitalize on the fluorescent properties of a drug, such as doxorubicin or daunorobicin [U.S. Pat. No. 5,556,856; Krishan Math. Cell Biol. 33:491-S00 (1990)], or alternatively, based on fluorescent dyes such as rhodamine or calcein [U.S.
Pat. No.
5,403,574; Hollo et al., Biochim. Biophys Acta 1191:384-388 (1994)]. The effect of an antibody fragment on increasing cytotoxicity to MDR cells may be assessed by monitoring cellular uptake of vital dyes following a period of exposure to a cytotoxin, such as the methods described in U.S. Pat. No. 5,543,423; or by assessment of 5 incorporation of [3H]Leucine, such as the method described in Example 3 of the example section that follows.
Example 1 of the Examples section which follows describes the isolation of an anti-Pgp single-chain antibody fragment (scFv).
Briefly, the amino acid sequence SEQ ID NO:l was batch-cloned into a fg8 l0 filamentous phage in fusion to a gene encoding a coat protein. The recombinant display phage was then used to immunize mice in order to generate an immune response to the target antigen (SEQ ID NO:l) using standard methods known in the art.
Following immunization, the spleen was removed from the immunized mice and the mRNA was extracted from splenic B cells. The isolated mRNA was then used to generate and 15 amplify cDNA using standard RT-PCR techniques. Following RT-PCR the amplified sequences were used to generate a phage display library which was screened using the target antigen. Polynucleotide sequences encoding the scFv were isolated from positive phage clones using standard molecular techniques. The isolated polynucleotide sequence (SEQ ID N0:2) was cloned into a prokaryotic expression vector and expressed in E. coli.
The expressed scFv was then purified from the periplasmic fraction of these cells, using standard purification methods (further description of scFv expression and purification is provided herein bellow).
As illustrated in Examples 2 and 3 of the Examples section which follows, the novel single-chain Fv generated according to the teachings of the present invention (termed "A2") is a relatively small molecule (about 30 kDa) which exhibits high specificity of binding to extracellular Pgp and multidrug resistant cells and a moderate binding affinity (about 150 nM) to Pgp. Furthermore this scFv is capable of effectively inhibiting drug efflux activity in MDR cells and as a result is capable of effectively increasing drug cytotoxicity in MDR cells.
As is mentioned hereinabove, a preferred approach for synthesizing the anti-Pgp scFv of the present invention is to isolate and express scFv encoding sequences.
As used herein the term "express" refers to the conversion of a polynucleotide sequence into a polypeptide.
Accordingly, the isolated polynucleotide sequence encoding the scFv polypeptide can be ligated to appropriate regulatory elements to generate a nucleic acid construct.
Preferably, the nucleic acid construct is an expression construct (i.e., an expression vector) which includes a promoter selected suitable for directing transcription of the isolated nucleic acid sequence encoding the polypeptide of this invention in a particular host cell.
Any suitable promoter sequence can be used by the nucleic acid construct of the present invention. Preferably, the promoter utilized by the nucleic acid construct is active in the specific cell being transformed. The nucleic acid construct of the present invention l0 can further include an enhancer, which can be adjacent or distant to the promoter sequence and can function in up regulating the transcription therefrom.
The nucleic acid construct of the present invention preferably further includes an appropriate selectable marker and/or an origin of replication. Preferably, the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for propagation in cells. The construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
A variety of prokaryotic or eukaryotic cells can be used as host-expression systems to express the polypeptide coding sequence. These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the polypeptide coding sequence; yeast transformed with recombinant yeast expression vectors containing the polypeptide coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV;
tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the polypeptide coding sequence. Mammalian expression systems can also be used to express the polypeptide of the present invention.
Bacterial systems are preferably used to produce recombinant polypeptides since they enable a high production volume at low cost.
In bacterial systems, a number of expression vectors can be advantageously selected depending upon the use intended for the polypeptide expressed. For example, when large quantities of polypeptide are desired, vectors that direct the expression of high levels of the protein product, possibly as a fusion with a hydrophobic signal sequence, which directs the expressed product into the periplasm of the bacteria or the culture medium where the protein product is readily purified may be desired.
Certain fusion protein engineered with a specific cleavage site to aid in recovery of the polypeptide may also be desirable. Such vectors adaptable to such manipulation include, but are not limited to, the pET series of E. coli expression vectors [Studier et al., Methods in Enzymol. 185:60-89 (1990)].
In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. Application No: 5,932,447. Alternatively, vectors can to be used which promote integration of foreign DNA sequences into the yeast chromosome.
In cases where plant expression vectors are used, the expression of the polypeptide coding sequence can be driven by a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al.
Nature 310:511-514 (1984)], or the coat protein promoter to TMV [Takamatsu et al.
EMBO J. 6:307-311 (1987)] can be used. Alternatively, plant promoters can be used such as, for example, the small subunit of RUBISCO [Coruzzi et al., EMBO J.
3:1671-1680 (1984); and Brogli et al., Science 224:838-843 (1984)] or heat shock promoters, e.g., soybean hsp17.5-E or hspl7.3-B [Gurley et al., Mol. Cell. Biol. 6:559-565 (1986)].
These constructs can be introduced into plant cells using Ti plasmid, Ri plasmid, plant viral vectors, direct DNA transformation, microinjection, electroporation and other techniques well known to the skilled artisan. See, for example, Weissbach &
Weissbach [Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-(1988)]. Other expression systems such as insects and mammalian host cell systems, which are well known in the art, can also be used by the present invention.
It will be appreciated that other then containing the necessary elements for the transcription and translation of the inserted coding sequence (encoding the polypeptide), the expression construct of the present invention can also include sequences engineered to optimize stability, production, purification, yield or activity of the expressed 3o polypeptide.
Transformed cells are cultured under effective conditions, which allow for the expression of high amounts of recombinant polypeptide. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH
and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce the recombinant polypeptide of the present invention.
Such a medium typically includes an aqueous solution having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
l0 Depending on the vector and host system used for production, resultant polypeptides of the present invention may either remain within the recombinant cell, secreted into the fermentation medium, secreted into a space between two cellular membranes, such as the periplasmic space in E. coli; or retained on the outer surface of a cell or viral membrane.
Following a predetermined time in culture, recovery of the recombinant polypeptide is effected.
The phrase "recovering the recombinant polypeptide" used herein refers to collecting the whole fermentation medium containing the polypeptide and need not imply additional steps of separation or purification.
Thus, polypeptides of the present invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
To facilitate recovery, the expressed coding sequence can be engineered to encode the polypeptide of~the present invention and fused cleavable moiety.
Such a ,..
fusion protein can be designed so that the polypeptide can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the cleavable moiety.
Where a cleavage site is engineered between the polypeptide and the cleavable moiety, the polypeptide can be released from the chromatographic column by treatment with an appropriate enzyme or agent that specifically cleaves the fusion protein at this site [e.g., see Booth et al., Immunol. Lett. 19:65-70 (1988); and Gardella et al., J.
Biol. Chem.
265:15854-15859 (1990)].
The polypeptide of the present invention is preferably retrieved in "substantially pure" form.
As used herein, the phrase "substantially pure" refers to a purity that allows for the effective use of the protein in the applications described herein.
In addition to being synthesizable in host cells, the polypeptide of the present invention can also be synthesized using ira vitro expression systems. These methods are well known in the art and the components of the system are commercially available.
1 o Further alternatively, the polypeptide of the present invention can also be synthesized using, for example, standard solid phase techniques. Such techniques include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis, and even by recombinant DNA
technology, such as described by Merrifield, J. [Am. Chem. Soc., 85:2149 (1963)]. Solid phase 1s polypeptide synthesis procedures are well known in the art and further described by John Morrow Stewart and Janis Dillaha Young [Solid Phase Peptide Syntheses, 2nd Ed., Pierce Chemical Company, (1984)].
The synthetic polypeptide can be purified by preparative high performance liquid chromatography procedure, such as described by Creighton T. [Proteins, structures and 20 molecular principles, W. H. Freeman and Co. N.Y. (1983)] and the composition of which can be confirmed via amino acid sequencing.
Since the antibody fragment of the present invention is Pgp-specific it can be used to detect multidrug resistant (MDR) cells. A key mechanism of MDR is the overexpression of Pgp and a clear correlation was established between overexpression of 25 Pgp and the lack of response to chemotherapy of cancer patients (6,7).
Thus, if chemotherapy is applied non-effectively, considerable damage may result from non target toxicity coupled with missed opportunity to provide another, more effective treatment.
Hence, an accurate, specific and reliable diagnosis of MDR cells in cancer patients would be a most useful clinical tool to determine options and selecting the most appropriate 3o treatment to administer.
Thus, according to another aspect of the present invention there is provided a method for detecting multidrug resistant cells. The method includes exposing cells to the antibody fragment of this invention, followed by detecting the antibody fragment bound to cells overexpressing Pgp, thereby detecting multidrug resistant cells.
Preferably, the antibody fragment is labeled with a detectable moiety (described below) and which can be detected using standard immunoassays known , in the art, such as ELISA, immunofluorescence, radioimmunoassay and immunohistochemical staining.
5 Initially, a biological sample, containing cells suspected of being MDR
cells, such as tumor cells, is obtained from the individual for ex vivo analysis. In order to prevent sampled cells from being degraded, the cells can be stored at temperature below -20 °C
until analyzed. Upon analysis, the cells are exposed to the antibody fragment and the antibody-cell binding is determined using any of the conventional in vitro immunoassay l0 techniques known in the art. For example, a tumor section can be exposed to the antibody fragment of this invention on a microscope slide and analyzed using standard immunohistochemical techniques.
Cells of an individual suspected of having multidrug resistant cells, such as a cancer patient, can also be exposed to the antibody fragment in vivo. In such cases, the 15 antibody fragment is labeled with a detectable moiety, such as radioactive moiety, e.g., 3H, 3sS, ~4C, 32P or ~zSI using standard techniques and the labeled antibody fragment is administered to an individual suspected of having cells overexpressing Pgp, preferably parenterally. Following a predetermined time period, changes in radioactivity levels in host cells are assessed using scintillation counting, auto-radiography or imaging 2o techniques.
The methodology described hereinabove is preferably practiced using a detection kit. The kit includes the antibody fragment of the present invention, which is preferably labeled with a detectable moiety such as a chromogenic moiety (e.g., biotin), a fluorogenic moiety (e.g., fluorescein), a light-emitting moiety (e.g., luminol) or a radioactive moiety (e.g., ~25I). The kit also includes reagents suitable for detecting the detectable moiety packaged in a container and identified in print on or in the package for use in diagnosing multidrug resistant cells. Procedures for labeling antibodies with such detectable moieties are described in, for example, "Using Antibodies: A
Laboratory Manual" [Ed Harlow, David Lane eds., Cold Spring Harbor Laboratory Press (1999)] and 3o the detection of such labeled antibodies can be accomplished using standard immunoassay procedures well known in the art.
As illustrated in the Examples section which follows, the anti-Pgp antibody fragment of this invention is highly suitable for use as an inhibitor of the drug efflux activity in multidrug resistant (MDR) cells, particularly for the following attributes: (i) it has a relatively small molecular size thereby conferring improved mobility and delivery to target cells, as well as short circulation in body fluids which minimizes undesired interactions with non-target cells; (ii) it has moderate affinity to Pgp , which further minimizes interactions with non-target cells; and (iii) it is capable of being expressed ex vivo and isa vivo.
Accordingly, the antibody fragment of this invention can be effectively used to substantially improve chemotherapy of individuals having multidrug resistant cancer cells.
Thus, according to another aspect of the present invention there is provided a method of treating cancer in an individual which includes providing the antibody fragment of this invention to an individual having cancer, and administrating the individual a therapeutically effective amount of an anti cancer agent, preferably an agent which is cytotoxic to cancer cells. The anti cancer drug may be administered prior to, concomitantly with, or following providing the antibody fragment. Preferably, the antibody fragment is provided to the patient sufficiently in advance of administering the anti cancer agent so as to allow the antibody fragment to penetrate to the individual's tumors containing MDR cells, to bind MDR cells, and to impair the drug-efflux capacity of such cells. The time interval required can be determined by routine pharmacokinetic methods and should be expected to vary with age, weight, and body size of the individual, as well as the location and condition of tumors containing the target MDR
cells.
The phrase "anti cancer .agent" and the phrase "chemotherapeutic drug" are used interchangeably herein and refer to a drug which can be used to treat cancer.
As used herein the term "treat" refers to substantially inhibiting, slowing or reversing the progression of a disease, such as cancer.
The antibody fragment may be provided by directly administrating the antibody fragment to the individual, or alternatively, by expressing the antibody fragment within cells of the individual.
When directly administrated, the antibody fragment is preferably introduced parenterally. It can be administered intravenously, intraperitoneally, retroperitoneally, intracistemically, intramuscularily, subcutaneously, topically, intraorbitally, intranasally or by inhilation. One or several doses may be administered as appropriate to achieve a sufficient level of antibody fragment bound to target MDR cells so as to produce an effective inhibition of drug efflux activity in the MDR cells to be eradicated by chemotherapy. The overall dosage and administration protocol for treatment with the antibody fragment and an anti cancer agent, may be designed and optimized by the clinical physician through the application of routine clinical skill.
The antibody fragment of this invention can also be provided by being expressed in cells of the individual. Preferably, the antibody fragment being expressed is a single-chain Fv (scFv). Further preferably, the antibody fragment is being expressed selectively in target cells such as, but not limited to MDR cancer cells, or in cells surrounding MDR
cancer cells (e.g., non MDR tumor cells), or in hematopoietic cells reaching MDR cancer to cells.. Expression of the antibody fragment in human cells can be effected by introducing the polynucleotide sequence of this invention into the target cells in a manner enabling transient or stable transformation and expression.
Introduction of the polynucleotide sequence of this invention into target cells may be accomplished either ex vivo or i~z vivo. In the ex vivo approach, cells are removed from an individual and transformed with the polynucleotide sequence of this invention while being cultured. The transformed cells are further expanded in culture and then returned to the individual. The ex-vivo approach is highly suitable for use along with autologous bone-marrow transplants. In such procedures, bone marrow cells are removed from the body of a cancer patient, hematopoietic stem cells are enriched, the patient treated with 2o extensive chemotherapy, and finally, the cultured stem cells are replanted into the patient in order to enable hematopoietic cell regeneration.
In such procedures, chemotherapy often fails to eradicate all cancer cells due to survival of multidrug resistance (MDR) cells. The recurrence of cancer following such extensive chemotherapy, when the body is drastically immuno-compromised, is most devastating. Use of the method of the present invention along with autologous bone marrow transplant can inhibit MDR activity and substantially decrease the likelihood of cancer recurrence.
The antibody fragment coding sequences can be introduced into the hematopoietic stem cells removed from the body and subsequently expressed and secreted from these 3o cells ifz vivo thereby targeting MDR cancer cells and substantially improving the efficacy of chemotherapy.
In the irz vivo approach, the polynucleotide is introduced directly to target cells within the individual. The polynucleotide of this invention can be introduced into cells by any one of a variety of known methods within the art. Such methods can be found generally described in Sambrook et al., [Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992)]; Ausubel et al., [Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989)]; Chang et al., .
[Somatic Gene Therapy, CRC Press, Ann Arbor, MI (1995)]; Vega et al., [Gene Targeting, CRC Press, Ann Arbor MI (1995)]; Vectors [A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston MA (1988)] and Gilboa et al.
[Biotechniques 4 (6): 504-512 (1986)] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In 1o addition, see United States patent 4,866,042 for vectors involving the central nervous system and also United States patents 5,464,764 and 5,487,992 for positive-negative selection methods for inducing homologous recombination.
A preferred approach for introducing a polynucleotide encoding the antibody fragment of the present invention into cells of an individual, is by using a viral vector.
Viral vectors offer several advantages including higher efficiency of transformation, and targeting to, and propagation in, specific cell types. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through specific cell receptors, such as cancer cell receptors.
Retroviral vectors represent one class of vectors suitable for use with the present invention. Defective retroviruses are routinely used in transfer of genes into mammalian cells (for review see Miller, A.D., Blood 76: 271 (1990)]. A recombinant retrovirus including a polynucleotide encoding the antibody fragment of the present invention can be constructed using well known molecular techniques. Portions of the retroviral genome can be removed to render the retrovirus replication defective and the replication defective retrovirus can then packaged into virions, which can be used to infect target cells through the use of a helper virus and while employing standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in, for example, Ausubul et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)]. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells endothelial cells, lymphocytes, myoblasts, hepatocytes and bone marrow cells.
Another suitable expression vector may be an adenovirus vector. The adenovirus is an extensively studied and routinely used gene transfer vector. Key advantages of an adenovirus vector include relatively high transduction efficiency of dividing and quiescent cells, natural tropism to a wide range of epithelial tissues and easy production of high titers [Russel, W.C. [J. Gen. Virol. 81: 57-63 (2000)]. The adenovirus DNA is transported to the nucleus, but does not integrate thereinto. Thus the risk of mutagenesis with adeno viral vectors is minimized, while short term expression is particularly suitable for treating cancer cells, such as multidrug resistant cancer cells. Adenoviral vectors used in experimental cancer treatments are described by Seth et al. [Adenoviral vectors for cancer gene therapy. In: P. Seth (ed.) Adenoviruses: Basic biology to Gene Therapy, Landes, Austin, TX , (1999) pp. 103-120].
to A suitable viral expression vector may also be a chimeric adenovirus/retrovirus vector which combines retroviral and adenoviral components. Preliminary results using such vectors to transduce tumor cells suggest that this new type of viral expression vector is more efficient than traditional expression vectors [Pan et al., Cancer Letters 184: 179-188 (2002)].
A specific example of a suitable viral vector for introducing and expressing the polynucleotide sequence of this invention in an individual is the adenovirus-derived vector Ad-TK. This vector expresses a herpes virus thymidine kinase (TK) gene for either positive or negative selection and includes an expression cassette for desired recombinant sequences. This vector can be used to infect cells that have an adenovirus 2o receptor which includes most cancers of epithelial origin [Sandmair et al.
[ Hum. Gene.
Ther. 11: 2197-2205 (2000)].
Features that limit expression to particular cell types can also be included.
Such features include, for example, promoter and regulatory elements that are specific for the desired cell type. The viral vector may also include a nucleotide sequence encoding a signal for secretion of the antibody fragment to the outside of the cell.
Secretion signals generally contain a short sequence (7-20 residues) of hydrophobic amino acids.
Secretion signals suitable for use in this invention are widely available and are well known in the art, see, for example by von Heijne [J. Mol. Biol. 184:99-105 (1985)] and by Lej et al., [J.
Bacteriol. 169: 4379 (1987)].
The recombinant vector can be administered in several ways. If viral vectors are used the procedure can take advantage of their target specificity and consequently, such vectors do not have to be administered locally at the tumor site. However, local administration can provide a quicker and more effective treatment.
Administration of viral vectors can also be performed by, for example, intravenous or subcutaneous injection into the subject. Following injection, the viral vectors will circulate until they recognize host cells with appropriate target specificity for infection.
The antibody fragment of the present invention, or the polynucleotide encoding 5 same, can be provided to an individual per se or as an active ingredient of a pharmaceutical composition which also includes a suitable carrier.
The pharmaceutical composition of the present invention can further include a chemotherapeutic drug, preferably a chemotherapeutic drug which is toxic to cancer cells such as, but not limited to, doxorubicin, vincristine, colchicines, VP-16, vinblastine, 10 verapamil, mitoxantrone, taxol, Cyclosporin A, quinidine, progesterone, tamoxifen, epirubicin, daunorubicin, and MX2.
The pharmaceutical composition may be administered in either one or more of ways depending on whether local or systemic treatment is of choice, and on the area to be treated. Administration may be done topically (including ophtalmically, vaginally, 15 rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip or intraperitoneal, subcutaneous, intramuscular or intravenous injection.
Preferably, the pharmaceutical composition is administered parenterally.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in .water-soluble form. Additionally, suspensions of the 20 antibody fragment may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as seasame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which icrease the viscosity of the suspension, such as sodium carboxylmethyl cellulose, sorbitol or dextran. Optionally, the suspension may 25 also contain suitable stabilizers or agentswhich increase the solubility of the antibody fragment to allow for the preparation of highly concentrated solutions.
Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which 26 .
notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for 1 o brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.
EXAMPLES
Reference is now made to the following examples, which together with the above 2o descriptions, illustrate the invention in a non limiting fashion. .
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature.
See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989);
"Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994);
Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York;
Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold 3o Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S.
Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A
Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994);
Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752;
3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533;
3,996,345;
4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis"
Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984);
"Animal Cell Culture" Freshney, R. L, ed. (1986); "Immobilized Cells and Enzymes" IRL
1o Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA ( 1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL
Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader.
All the information contained therein is incorporated herein by reference.
2o ISOLATION OF AZ SINGLE CHAIN Fv Gefiey~atiofa of peptide display cosistf°ucts for ifszmuniZatiosz:
The peptide sequence GEMTDIFANAGNL (SEQ ID NO:l) which corresponds to amino acids 73-85 of the first putative extracellular loop of human P-glycoprotein (Pgp, GenBank Accession number NM 000927.2) was synthesized as described by Niv et al (19). Recombinant phages that display this amino acid sequence were generated using the IIinDIII and Pstl cloning sites of the filamentous bacteriophage f88, as described by Frenkel and Solomon ( 17). The recombinant filamentous bacteriophage f88 were used to immunize mice in three intraperitoneally injection, of 10' 1 phage units in PBS per injection, at 14 days intervals. Serum samples collected from the immunized mice were 3o examined by ELISA for immunoreactivity with this peptide. The mice exhibiting a specific immune response to the target peptide were selected to construct a single-chain Fv (scFv) phage-display library.
Coustructiorz arzd screening of scFv library:
A scFv phage display library was generated using RNA extracted from spleen cells of the phage immunized mice described above, according to the procedure described by Clackson et al. [(Nature 352:624-628 (1991)x. Briefly, polynucleotide segments corresponding to the immunoglobulin heavy (VH) and light (VL) chain variable domains, were amplified from the mRNA spleen B-cells of immunized mice by RT-PCR, using specific sets of degenerate primers. The VH and VL PCR pools were assembled into a single-chain Fv repertoire by a PCR overlap extension reaction and subsequently cloned as an Sfil Notl fragment into the pCANTAB6 phagemid vector. The complexity of the to library was 1x10 independent clones. For panning, the library was first depleted from streptavidin binders by incubation with streptavidin-coated magnetic beads. A
biotinylated peptide comprising the amino acid sequence of SEQ ID NO:1 (l~.M) was then incubated with 10" cfu of the depleted library (1 hr, at room temperature) followed by addition of streptavidin-coated magnetic beads. Bound phages were eluted by using 1 ml of triethylamine (100 mM, pH 12) for 5 min at room temperature, followed by neutralization with 0.1 ml of 1 M Tris-HCI, pH 7.4. Eluted phages were expanded in exponentially growing E. coli TG1 cells that were later superinfected with helper phage as described by Hoogenboom et al (16).
As illustrated in Table 1 below, a progressive and marked enrichment, of phages that bind the peptide of SEQ ID NO:1, was observed after 3 rounds of panning.
Twenty phage clones out of 84 analyzed following the 3rd round of panning exhibited binding activity toward the peptide (data not shown). Fingerprint analysis by means of multicutter restriction enzyme digestion of 10 peptide- specific clones revealed that they had a similar digestion pattern, suggesting that all were similar or identical (data not shown). DNA
sequencing of VH and VL domains from these clones revealed that all were identical, suggesting that they were all derived from a single productive antibody during the VH/VL
combinatorial event. Sequence analysis and comparison to the Kabbat database revealed that the A2 VH domain belongs to subgroup II of mouse heavy chain and the VL
domain to the mouse Kappa II subgroup of light chains. The nucleic acid sequence of the scFv 3o constructed from these VH and VL domains is provided in SEQ ID N0:2.
Table 1 Selection of scFv phage library for binding the peptide of SEQ ID NO:1 C cle In ut* Out ut* Ratio O/ Enrichment 1 IX1O'~ 1x105 1x105 I
2 1x10" 1x10 1x10'4 300 3 I x 10" 2 x 10$ 2 x 10'3 2,000 * Phage input and output was determined by titration, determining phage cfu of infected E. coli T(il cells before and after each round of selection.
Expressiozz azzd purificatiozz of soluble recozzzbizzazzt scFv:
The A2 scFv sequence (SEQ ID N0:2) was rescued from the phage clone by PCR
and was subcloned into the phagemid vector pCANTAB6, using the Sfil Notl cloning sites. A Myc (SEQ ID N0:3) and hexahistidine tags were fused to the C-terminus of the scFv gene. The scFv antibody was expressed in BL21 (~,DE3) cells and purified from the periplasmic fraction by metal-ion affinity chromatography, using the hexahistidine tag fused to the C-terminus. An SDS-PAGE analysis of the purified A2 scFv is presented in Figure 1 a.
SPECIFICITYAND BINDING PROPERTIES OFA2 scFv The molecular profile of the A2 scFv antibody was analyzed by size-exclusion chromatography and revealed a single protein peak in a monomeric form with an expected molecular mass of approximately 30 kDa (data not shown). The yield of the A2 scFv was about 2% (2 mg of a highly pure protein in 1 liter culture).
The binding specificity of the purified A2 scFv antibody was determined via ELISA. 'A biotinylated target peptide having the amino acid sequence of SEQ ID
NO:l, or a non-target MRP1 control peptide (provided at 10 ~g in 100 ~,l) were each immobilized onto a flexible microtiter plate using BSA-biotin-streptavidin. A
purified A2 scFv was then added, at different concentrations, to the peptide-coated plate and was detected with an anti Myc tag-HRP conjugate antibody.
The ELISA results, presented in Figure lb, show that A2 scFv antibody reacted positively and in a dose-dependent manner with the target Pgp-derived peptide (SEQ ID
3o NO:l). By comparison, A2 scFv did not react with the non-target MRPl control peptide.
The binding properties of A2 scFv were further characterized using a saturation ELISA. In this experiment, a biotinylated Pgp-derived peptide (SEQ ID N0:1) was bound to plates precoated with BSA-biotin and exposed to increasing amounts of scFv. The ELISA results which are illustrated in Figure 1 c, show that A2 scFv binding to the target peptide was dose-dependent and saturable. By interpolating the amount of A2 scFv necessary for 50% of maximal binding the affinity constant was estimated at 150 nM, indicating moderate affinity.
5 In a competition binding radio-immunoassay the purified A2 scFv (100 gg) was first labeled with [~25I] using the Bolton-Hunter reagent. The [l2sl]-labeled A2 scFv antibody was added as a tracer (3-5 x 105 cpm/well) to a flexible microtiter plate, which had been pre-coated with BSA-biotin and the target peptide (SEQ ID NO:l), as described above. A non-labeled (i.e., cold) A2 scFv was then added, as a competitor, to the pre-l0 coated plates at increasing concentrations. Plates were incubated for 1 hr at room temperature, then washed and analyzed by gamma counter. The radio-immunoassay results, illustrated in Figure 1d, show that the [l2sl]-labeled A2 scFv antibody binding to the target Pgp-derived peptide (having the amino acid sequence SEQ ID NO:l) was dose-dependent. By interpolating the amount of the competitor (cold) A2 scFv necessary for 15 50% of maximal binding, the affinity constant was estimated at 130 nM, indicating a moderate affinity.
In another series of experiments, the reactivity and specificity of A2 scFv to Pgp, expressed on the surface of MDR cells, was evaluated. These experiments utilized human carcinoma cell lines that display a stable Pgp-dependent MDR phenotype, as well as their 2o respective parental drug-sensitive cells. The MDR cell lines and the drug-sensitive cell lines used in these experiments are described in Table 2 below.
Table 2 Tissue of Ori in MDR Cell Line Dru -Sensitive Cell Line Human ovarian carcinoma 2780A~ * 2780 Human epidermoid KBV-1 ** ~KB3-1 **
carcinoma ~
25 * 2780""" was established from the drug sensitive 2780 cell line (21 ).
** KBV-1 was established from the drug sensitive KB3-1 cell line (24).
Drug sensitive cells and MDR cells (5x105) were washed with PBS, and resuspended in RPMI-1640 medium (GIBCO). Cells growing on six well tissue culture 30 plates were washed twice followed by incubation with soluble purified A2 scFv (50 ~.g/ml) for 90 minutes on ice. Detection was with anti-Myc (30 ~.g/ml) and FITC- labeled anti-mouse IgG ( 1:1000, Jackson). Detection of fluorescent cells was performed on a FACScalibur (Becton Dickinson).
Figures 2a-d demonstrate a comparative immuno-fluorescence flow-cytometer analyses, illustrating a strong reactivity of A2 scFv with the MDR cell lines (Figure 2b) and KBV-1, while no reactivity was observed with the drug-sensitive cell lines 2780 (Figure 2a) and KB3-1 (Figure 2c).
The specificity and reactivity of the A2 scFv antibody to MDR and Pgp-overexpressing cells was further demonstrated by comparative immuno-histochemistry analysis. Drug sensitive cells and MDR cells were grown to 50% confluence on glass slides, pre-coated with 4% gelatin in PBS, fixed with 2% formaldehyde in PBS, blocked with 1% BSA in PBS at room temperature, then followed by 90 min incubation with A2 scFv (0.2 mg/ml) in PBS containing 1% BSA (room temperature). The slides were then covered with HRP-labeled anti-Myc- antibody (1:500, in PBS containing 1% BSA) for 1 hr, washes with water, then covered with peroxidase substrate, (AEC) for 2-3 min. Slides were then washed with water and counter staining was performed with hematoxylin. As illustrated in Figures 2e-h, the A2 scFv antibody displayed an intense in situ staining of MDR 2780ADR and KBV-1 cells (Figures 2e and 2g, respectively), while on the other hand, A2 scFv did not stain the respective drug-sensitive parental 2780 and KB3-1 cells (Figures 2f and 2 h, respectively).
Hence, the results described hereinabove clearly demonstrate that the A2 scFv antibody selectively binds human cell surface-expressed Pgp and does not bind human 2o drug-sensitive cells which lack, or marginally express Pgp.
BIOLOGICAL FUNCTION OF AZ scFv The effect of A2 scFv on the drug-efflux activity of Pgp was evaluated in a series of chromophore efflux assays. The assays utilized the fluorescent Pgp hydrophobic-substrate calcein-AM (Molecular Probes, Eugene, Oregon), as inverse relationship exist between the level of Pgp activity and the accumulation of calcein in MDR cells [Hollo et al (20)]. The A2 scFv was applied to human and rodent (CHO) cell lines that display a stable Pgp-dependent MDR phenotype, and their respective parental drug-sensitive cells, as described in the Table 3 below.
Table 3 Tissue of Ori in MDR Cell Line Dru -Sensitive Cell Line Human ovarian carcinoma 2780'' * 2780 Human a idermoid KBV-1 ** KB3-1 **
carcinoma rodent (CHO) EMTR' *** A8 ***
* ~7R0~ R was establishedfrom the drug sensitive cell line (21).
** KBV-1 was established from the drug sensitive KB3-1 cell line (24).
*** EMTR' was established from the drug sensitive A8 cell line (23).
Drug sensitive cells and MDR cells (5x105) were washed with PBS, and resuspended in HPMI buffer (10 mM Hepes at pH 7.4 containing 120 mM NaCI, 5mM
KCI, 0.4mM CaCl2, 10 mM NaHC03, 5mM NaZHPOa, and 10 mM glucose). The cell i o suspensions were pre-incubated for various times with various concentrations of the A2 scFv, then supplemented with 1 ~.M calcein-AM (a fluorescent Pgp hydrophobic substrate;
Molecular Probes, Eugene, Oregon) and allowed for 5-15 min incubation at 37°C.
Following incubation, the treated and untreated cells were exposed to calcein and analyzed for fluorescence intensity (493-515 nm) by a standard fluorometer or by a flow cytometer (FACScalibur, Becton Dickinson).
Figure 3a illustrate that the MDR cell line 278OADR, accumulated 5 and 10-fold less calcein (after 5 or 15 min incubation, respectively), as compared with the parental drug-sensitive 2780 cell line. Similarly, the results of a flow cytometer assay, illustrated in Figure 3b, show that the MDR cell line 2780ADR exhibited substantially lower mean 2o fluorescence intensity than the respective parental drug-sensitive 2780 cell line. These results clearly demonstrate the functional capacity of MDR and Pgp-overexpressed cells to extrude chromophoric substrates like calcein-AM.
In a similar experiment, A2 scFv was added to 2780ADR cells, for 10 - 30 minutes prior to the addition of calcein-AM. The A2 scFv treatment resulted in a substantial increase in fluorescence intensity of cells, indicating a substantial decrease in drug-efflux activity. Accordingly, Figure 3c shows that the accumulation of calcein in cells treated with A2 scFv, was 4-5 fold higher than the accumulation of calcein in cells not treated with A2 scFv. The results illustrated in Figure 3c further show that the inhibitory effect of A2 scFv on the drug-efflux activity of 2780ADR cells, was dose-dependent and 3o exhibited maximal inhibitory activity at 100 ~,g/ml (i.e. 4~.M). The drug-efflux inhibitory effect of A2 scFv was similar to the drug-efflux inhibitory effect observed with 15~M
verapamil, a known modulator of Pgp drug efflux (8). A similar effect was observed via a flow cytometer analysis, as illustrated in Figure 3d. These results indicate that the A2 scFv antibody can effectively inhibit the drug-efflux activity of human MDR
and Pgp overexpressing cells.
In another assay, the drug efflux modulating-activity of A2 scFv was compared with G1 scFv [isolated against a melanoma associated tumor antigen (22)]. The assay results, illustrated in Figure 3e, show that while the A2 scFv substantially inhibited drug efflux activity Of 278OADR, the Gl scFv antibody treatment had no effect.
The effect of A2 scFv on the drug efflux activity of other MDR and Pgp-overexpressing cell lines, and their parental drug-sensitive cell lines, was evaluated in a series of assays. Figures 4a-b illustrate the effect of A2 scFv on the drug efflux activity of 1o MDR and Pgp-overexpressing EMTR' and KBV-1 cells. The results show substantial increases in calcein accumulation, indicating drug-efflux inhibition in cells treated with A2 scFv To ascertain that the inhibitory activity of the A2 scFv molecule is not due to non-specific cell toxicity, additional experiments were performed whereby A2 scFv was pre-incubated, prior to addition of calcein, with the drug sensitive cell lines 2780, I~B3-1 and A8. The results, illustrated in Figure 4c-e, show that A2 scFv treatment did not affect the level of calcein accumulation in any of these cells, indicating no effect on the drug-efflux activity of drug-sensitive cells treated with A2 scFv.
The drug-efflux inhibition efficiency of A2 scFv was further evaluated in another 2o assay in which the A2 scFv was provided, at increasing concentrations, to cells, followed by the addition of calcein-AM. The results, illustrated in Figure 5a, show that A2 scFv increased the accumulation of calcein in cells in a dose-dependant and saturable fashion. The minimal detectable inhibitory activity was observed with an A2 scFv concentration of 0.025 mg/ml (1 ~.M). The saturation inhibitory activity was observed with an A2 scFv concentration exceeding 0.1 mg/ml (4 ~.M). The concentration of A2 scFv molecule that inhibits 50% drug-efflux activity (ICSO) was estimated at 65 ~.g/ml (2.6 ~.M).
The effect of the AZ scFv molecule on the survival Of 27$OADR, exposed to doxorubicin (a chemotherapeutic drug), was evaluated based on the level of [3H]Leucine 3o in cells, an indicator of cell viability. Cells were pre-incubated with A2 scFv at a concentration of 0.2 mg/ml, then exposed to 5 - 10 ~.M of doxirubicin and then analyzed for [3H]Leucine content. As illustrated in Figure 5b, the A2 scFv treatment effectively reduced the viability of cells exposed to doxirubicin, as compared with cells not treated with A2 scFv. These results show that A2 scFv can inhibit the Pgp-mediated drug efflux activity in mufti-drug resistant cells, thereby circumventing drug resistance.
Thus, in conclusion, the results presented herein clearly demonstrate that the scFv antibody of the present invention selectively reacts with Pgp-overexpressing cells and is therefore an effective inhibitor of drug-efflux activity in mufti-drug resistant cells.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for to brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.
REFERENCES CITED
(Additional references are cited in the text) 1. Gottesman, M.M., and Pastan, I. Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu. Rev. Biochem. 6:385-427, 1993.
2. Tan B, Piwnica-Worms D, Ratner L. Multidrug resistance transporters and modulation. Cur°r OpirZ Oncol. 12:450-8, 2000.
3. Sarkadi, B., and Muller, M. Search for specific inhibitors of multidrug resistance in cancer. Semin. Cancer Biol. 8: 171-82, 1997.
4. Riordan, J.R., and Ling, V. Purification of P-glycoprotein from plasma membrane vesicles of Chinese hamster ovary mutants with reduced colchicines permeability.
J. Biol. Chem. 254:12701-12705, 1979.
5. Borst P, Elferink RO. Mammalian abc transporters in health and disease.
Aranu Rev Biochem.71:537-92, 2002.
6. Roninson, L, Abelson, H.T., Housman, D.E., Howell, N., and Varshavsky, A.
Amplification of specific DNA sequences correlates with multi-drug resistance in Chinese hamster cells. Nature 309:626-628, 1985.
7. Goldstein, L.J., Galski, H., Fojo, A., Willingham, M.C., Lai, S.-L., Gazadar, A., Pirker, R., Green, A., Crist, W., Brodeur, G.M., Lieber, M., Cossman, J., Gottesman, M.M., and Pastan, I. Expression of a multidrug resistance gene in human cancers. J. Natl. Cancer Inst. 81:116-124, 1989.
8. Tsuruo T, Iida H, Tsukagoshi S, Sakurai Y. Overcoming of vincristine resistance in P388 leukemia in vivo and in vitro through enhanced cytotoxicity of vincristine and vinblastine by verapamil. Cancer Res. 41:1967-72, 1981.
9. Hamada H, and Tsuruo T. Functional role for the 170- to 180-kDa glycoprotein specific to drug-resistant tumor cells as revealed by monoclonal antibodies.
Proc Natl Acad Sci U S A 83:7785-9, 1986.
10. Mechetner EB, and Roninson IB. Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proc Natl Acad Sci U S A
89:5824-8, 1992.
11. Naito M, Tsuruo T. Monoclonal antibodies to P-glycoprotein: preparation and applications to basic and clinical research. Methods Enzymol.;292:258-65, 1998.
12. Jain RK Delivery of molecular medicine to solid tumors. Science 271:1079-1080, 1996.
13. Huston JS, Levinson D, Mudgett-Hunter M, Tai MS, Novotny J, Margolies MN, Ridge RJ, Bruccoleri RE, Haber E, Crea R, Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in~ Escherichia coli. Proc Natl Acad Sci U S A 85:5879-83, 14. Bird RE, Hardman KD, Jacobson JW, Johnson S, Kaufman BM, Lee SM, Lee T, Pope SH, Riordan GS, Whitlow M. Single-chain antigen-binding proteins.
Science 242:423-6, 1988.
Science 242:423-6, 1988.
15. Raag R, Whitlow M. Single-chain Fvs. FASEB J 9:73-80, 1995 16. Hoogenboom HR, de Bruine AP, Hufton SE, Hoet RM, Arends JW, Roovers RC.
Antibody phage display technology and its applications. Imrnuraotechnology 4:1-20, 1998.
Antibody phage display technology and its applications. Imrnuraotechnology 4:1-20, 1998.
17. Frenkel D, Solomon B. Filamentous phage as vector-mediated antibody delivery to the brain. Proc Natl Acad Sci USA. 99:5675-9, 2002.
18. Lev,A., Denkberg, G., Cohen, CJ., Tzukerman, M., Skorecki, KL., Chames, P., Hoogenboom, H.,and Reiter, Y. Isolation and characterization of human recombinant antibodies endowed with the antigen-specific, major histocompatibility complex-restricted specificity of T cells directed toward the widely expressed tumor T-cell epitopes of the telomerase catalytic subunit.
Cancer Res. 62: 3184-3194, 2002.
Cancer Res. 62: 3184-3194, 2002.
19. Niv, R., Pirak, E., Segal,D., Assaraf, Y., and Reiter, Y. Targeting multidrug resistant tumor cells with a recombinant single-chain FV fragment directed to P-glycoprotein. : Int. J. Cancer 94: 864-872, 2001.
20. Hollo Z, Homolya L, Davis CW, Sarkadi B. Calcein accumulation as a fluorometric functional assay of the multidrug transporter. Biochim Biophys Acta.1191:384-8, 1994.
21. Eva A, Robbins KC, Andersen PR, Srinivasan A, Tronick SR, Reddy EP, EllmoreNW, Galen AT, Lautenberger JA, Papas TS, Westin EH, Wong-Staal F, Gallo RC, Aaronson SA. Cellular genes analogous to retroviral one genes are transcribed in human tumour cells. Nature 295:116-9, 1982.
22. Denkberg, G., Cohen, CJ., Lev, A., Chames, P., Hoogenboom, H., and Reiter, Y.
Direct visualization of distinct T cell epitopes derived from a melanoma tumor-associated antigen by using human recombinant antibodies with MHC- restricted T cell receptor-like specificity. Proc. Natl. Acad. Sci. USA. 99: 9421-9426, 2002.
Direct visualization of distinct T cell epitopes derived from a melanoma tumor-associated antigen by using human recombinant antibodies with MHC- restricted T cell receptor-like specificity. Proc. Natl. Acad. Sci. USA. 99: 9421-9426, 2002.
23. Gupta RS, Siminovitch L. Mutants of CHO cells resistant to the protein synthesis inhibitors, cryptopleurine and tylocrebrine: genetic and biochemical evidence for common site of action of emetine, cryptopleurine, tylocrebine, and tubulosine.
Biochemistry 16:3209-14, 1977.
Biochemistry 16:3209-14, 1977.
24. Akiyama S, Fojo A, Hanover JA, Pastan I, and Gottesman MM Isolation and genetic characterization of human KB cell lines resistant to multiple drugs.
Somat Cell Mol Genet 11:117-26, 1985 25. Fojo A, Hamilton TC, Young RC, and Ozols RF. Multidrug resistance in ovarian cancer. Cancer 60:2075-80, 1987.
Somat Cell Mol Genet 11:117-26, 1985 25. Fojo A, Hamilton TC, Young RC, and Ozols RF. Multidrug resistance in ovarian cancer. Cancer 60:2075-80, 1987.
26. Sharma, R.C., Assaraf, Y.G., and Schimke, R.T. A phenotype conferring selective resistance to lipophilic antifolates in Chinese hamster ovary cells. Cancer Res.
51:2949-2959, 1991.
51:2949-2959, 1991.
27. Schinkel, AH., The physiological function of drug-transporting P-glycoproteins.
Senain Can. Biol. 8: 161-170, 1997.
Senain Can. Biol. 8: 161-170, 1997.
28. Chowdhury, P.S., & Pastan, I. Improving antibody affinity by mimicking somatic hypermutation in vitro. Nat Biotechnol. 17:568-72, 1999.
29. Forlani G, Bossi E, Ghirardelli R, Giovannardi S, Binda F, Bonadiman L, Ielmini L, Peres A. Mutation K448E in the external loop 5 of rat GABA transporter rGATl induces pH sensitivity and alters substrate interactions. JPhysiol.
536:479-94, 2001 30. Kanner BI, Kavanaugh MP, Bendahan A. Molecular characterization of substrate-binding sites in the glutamate transporter family. Bioc7Zem Soc Ti-ans. 29:707-10, 2001.
536:479-94, 2001 30. Kanner BI, Kavanaugh MP, Bendahan A. Molecular characterization of substrate-binding sites in the glutamate transporter family. Bioc7Zem Soc Ti-ans. 29:707-10, 2001.
31. Loo TW, Clarke DM. Identification of residues in the drug-binding site of human P-glycoprotein using a thiol-reactive substrate. JBiol Claern. 272:31945-8, 1997.
32. Loo TW, Bartlett MC, Clarke DM. Drug binding in human P-glycoprotein causes conformational changes in both nucleotide-binding domains. JBiol Chem. In press 2002.
33. Cattaneo A, and Biocca S. The selection of intracellular antibodies Trends Biotechnol 17:115-21, 1999.
34. Heike Y, Kasono K, Kunisaki C, Hama S, Saijo N, Tsuruo T, Kuntz DA, Rose DR, Curiel DT. Overcoming mufti-drug resistance using an intracellular anti-rndrl sFv. Int J Cancer 92:115-22, 2001.
SEQUENCE LISTING
<110> Reiter, Yoram Haus-Cohen, Maya <120> AN ANTIBODY FRAGMENT CAPABLE OF MODULATING MULTIDRUG RESISTANCE AND
COMPOSITIONS
AND KITS AND METHODS USING SAME
<130> 27329 <160> 3 <170> PatentIn version 3.1 <210> 1 <211> 13 <212> PRT
<213> Artificial sequence <220>
<223> Multidrug resistance protein 1 iMDRl) derived peptide <400> 1 Gly Glu Met Thr Asp Ile Phe Ala Asn Ala Gly Asn Leu <210> 2 <211> 723 <212> DNA
<213> Artificial sequence <220>
<223> Fv codingsequence single chain <900>
caggtccaactgcagcagtctggacctgacctggtgaagcctggggcttcagtgaagata60 tcctgcaaggcttctggttactcattcactggctactacatgcactgggtgaagcagagc120 catggaaagagccttgagtggattggacgtgctaatcctaacaatggtggtactagctac180 aaccagaagttcaagggcaaggccatattaactgtagacaagtcatccagcacagcctac290 atggagctccgcagcctgacatctgaggactctgcagtctattactgtgcaagatgggac300 ggggcttactggggccaagggactctggtcactgtctcttcgggaggtggtggatccggc360 ggtggcggttctggtggaggtggatctgatgttgtgatgacccaaactccactctccctg920 cctgtcagtcttggagatcaagcctccatctcttgcagatctagtcagagcattgtacat980 agtaatggaaacacctatttagaatggtacctgcagaaaccaggccagtctccaaagctc590 ctgatctacaaagtttccaaccgattttctggggtcccagacaggttcagtggcagtgga600 tcagggacagatttcacactcaagatcagcagagtggaggctgaggatctgggagtttat660 tactgctttcaaggttcacatgttccattcacgttcggctcggggaccaagctggaactg720 aaa 723 <210> 3 <211> 33 <212> DNA
<213> Artificial sequence <220>
<223> Myc-tag coding sequence <900> 3 gaacaaaaac tcatctcaga agaggatctg aat 33
SEQUENCE LISTING
<110> Reiter, Yoram Haus-Cohen, Maya <120> AN ANTIBODY FRAGMENT CAPABLE OF MODULATING MULTIDRUG RESISTANCE AND
COMPOSITIONS
AND KITS AND METHODS USING SAME
<130> 27329 <160> 3 <170> PatentIn version 3.1 <210> 1 <211> 13 <212> PRT
<213> Artificial sequence <220>
<223> Multidrug resistance protein 1 iMDRl) derived peptide <400> 1 Gly Glu Met Thr Asp Ile Phe Ala Asn Ala Gly Asn Leu <210> 2 <211> 723 <212> DNA
<213> Artificial sequence <220>
<223> Fv codingsequence single chain <900>
caggtccaactgcagcagtctggacctgacctggtgaagcctggggcttcagtgaagata60 tcctgcaaggcttctggttactcattcactggctactacatgcactgggtgaagcagagc120 catggaaagagccttgagtggattggacgtgctaatcctaacaatggtggtactagctac180 aaccagaagttcaagggcaaggccatattaactgtagacaagtcatccagcacagcctac290 atggagctccgcagcctgacatctgaggactctgcagtctattactgtgcaagatgggac300 ggggcttactggggccaagggactctggtcactgtctcttcgggaggtggtggatccggc360 ggtggcggttctggtggaggtggatctgatgttgtgatgacccaaactccactctccctg920 cctgtcagtcttggagatcaagcctccatctcttgcagatctagtcagagcattgtacat980 agtaatggaaacacctatttagaatggtacctgcagaaaccaggccagtctccaaagctc590 ctgatctacaaagtttccaaccgattttctggggtcccagacaggttcagtggcagtgga600 tcagggacagatttcacactcaagatcagcagagtggaggctgaggatctgggagtttat660 tactgctttcaaggttcacatgttccattcacgttcggctcggggaccaagctggaactg720 aaa 723 <210> 3 <211> 33 <212> DNA
<213> Artificial sequence <220>
<223> Myc-tag coding sequence <900> 3 gaacaaaaac tcatctcaga agaggatctg aat 33
Claims (53)
1. An antibody fragment comprising an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
2. The antibody fragment of claim 1, wherein the antibody fragment is an Fv fragment.
3. The antibody fragment of claim 2, wherein the antibody fragment is a single chain Fv.
4. The antibody fragment of claim 1, wherein the antibody fragment is a Fab.
5. The antibody fragment of claim 1, wherein the antibody fragment is a F(ab')2.
6. The antibody fragment of claim 1, wherein the antibody fragment is a F(ab')2.
7. The antibody fragment of claim 1, wherein said P-glycoprotein is a 170 kDa polypeptide expressed by the mdrl gene.
8. The antibody fragment of claim 7, wherein said antigen binding region is directed against an epitope located in a first loop of said extracellular portion of said P-glycoprotein.
9. The antibody fragment of claim 8, wherein said epitope comprises the amino acid sequence set forth in SEQ ID NO:1.
10. The antibody fragment of claim 1, wherein said multidrug resistant cells are cancer cells.
11. The antibody fragment of claim 1, wherein said cancer cells are human cancer cells.
12. A pharmaceutical composition, comprising, as an active ingredient, a antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells and a pharmaceutically acceptable carrier.
13. The pharmaceutical composition of claim 12, wherein said multidrug resistant cells are cancer cells.
14. The pharmaceutical composition of claim 12, further comprising a chemotherapeutic drug.
15. The pharmaceutical composition of claim 14, wherein said chemotherapeutic drug is toxic to cancer cells.
16. The pharmaceutical composition of claim 12, wherein said P-glycoprotein is a 170 kDa polypeptide expressed by the mdrl gene.
17. The pharmaceutical composition of claim 16, wherein said antigen binding region is directed against an epitope located in a first loop of said extracellular portion of said P-glycoprotein.
18. The pharmaceutical composition of claim 17, wherein said epitope comprises the amino acid sequence set forth in SEQ ID NO:1.
19. A method of treating cancer in an individual, comprising:
(a) providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells;
and (b) administrating to the individual a therapeutically effective amount of an anti cancer agent thereby treating cancer in the individual.
(a) providing to the individual an antibody fragment capable of at least partially inhibiting drug efflux activity in multidrug resistant cancer cells;
and (b) administrating to the individual a therapeutically effective amount of an anti cancer agent thereby treating cancer in the individual.
20. The method of claim 19, wherein said antibody fragment is administered along with a pharmaceutically acceptable carrier.
21. The method of claim 19, wherein step (b) is effected prior to, concomitant with or following step (a).
22. The method of claim 21, wherein said anti cancer agent is complexed with said antibody fragment.
23. The method of claim 19, wherein step (a) is effected by expressing said antibody fragment within cells of the individual.
24. The method of claim 19, wherein said antibody fragment includes an antigen binding region capable of binding an extracellular portion of P-glycoprotein.
25. The method of claim 24, wherein said antigen binding region is directed against an epitope located in a first loop of said extracellular portion of said P-glycoprotein.
26. The method of claim 25, wherein said epitope comprises the amino acid sequence set forth in SEQ ID NO:1.
27. A kit for diagnosing cells overexpressing P-glycoprotein, comprising an antibody fragment containing an antigen binding region capable of binding said P-glycoprotein, and reagents for detecting said antibody fragment.
28. The kit of claim 27, further comprising packaging material identifying said antibody fragment for use in diagnosing cells overexpressing extracellular P-glycoprotein.
29. The kit of claim 27, wherein said antibody fragment is labeled with a detectable moiety.
30. The kit of claim 29, wherein said detectable moiety is selected from the group consisting of a chromogenic moiety, a fluorogenic moiety, a light-emitting moiety and a radioactive moiety.
31. The kit of claim 27, wherein said P-glycoprotein is a 170 kDa polypeptide expressed by the mdrl gene.
32. The kit of claim 31, wherein said antigen binding region is directed against an epitope located in the first loop of an extracellular portion of said P-glycoprotein.
33. The kit of claim 32, wherein said epitope comprises a peptide having the amino acid sequence set forth in SEQ ID NO:1.
34. A method of detecting cells overexpressing P-glycoprotein comprising:
(a) exposing the cells to an antibody fragment including an antigen binding region capable of binding an extracellular portion of the P-glycoprotein;
and (b) detecting said antibody fragment bound to said extracellular portion of said P-glycoprotein, thereby identifying the cells overexpressing extracellular P-glycoprotein.
(a) exposing the cells to an antibody fragment including an antigen binding region capable of binding an extracellular portion of the P-glycoprotein;
and (b) detecting said antibody fragment bound to said extracellular portion of said P-glycoprotein, thereby identifying the cells overexpressing extracellular P-glycoprotein.
35. The method of claim 34, wherein the cells are of an individual and whereas the method further comprises obtaining a biological sample from the individual prior to step (a).
36. The method of claim 34, wherein said antibody fragment is labeled with a detectable moiety.
37. The method of claim 36, wherein said detectable moiety is selected from the group consisting of a chromogenic moiety, a fluorogenic moiety, a light-emitting moiety and a radioactive moiety.
38. The method of claim 34, wherein said P-glycoprotein is a 170 kDa polypeptide expressed by the mdrl gene.
39. The method of claim 38, wherein said antigen binding region is directed against an epitope located in a first loop of said extracellular portion of said P-glycoprotein.
40. The method of claim 39, wherein said epitope comprises the amino acid sequence set forth in SEQ ID NO:1.
41. An isolated polynucleotide comprising a nucleic acid sequence encoding an antibody fragment including an antigen binding region capable of binding an extracellular portion of a P-glycoprotein, wherein the antibody fragment is capable of at least partially inhibiting drug efflux activity in multidrug resistant cells.
42. The polynucleotide of claim 41, wherein said P-glycoprotein is the 170 kDa polypeptide expressed by the mdrl gene.
43. The polynucleotide of claim 42, wherein said antigen binding region is directed against an epitope located in the first loop of an extracellular portion of said P-glycoprotein.
44. The polynucleotide of claim 43, wherein said epitope comprises the amino acid sequence set forth in SEQ ID NO:1.
45. The polynucleotide of claim 41, wherein said antibody fragment is an Fv.
46. The polynucleotide of claim 45, wherein said antibody fragment is a single chain Fv.
47. The polynucleotide of claim 41, wherein said antibody fragment is a Fab.
48. The polynucleotide of claim 41, wherein said antibody fragment is a F(ab')2.
49. The polynucleotide of claim 41, wherein said antibody fragment is a F(ab').
50. The polynucleotide of claim 46, wherein the polynucleotide is as set forth in SEQ ID NO:2.
51. A nucleic acid construct comprising the polynucleotide of claim 41.
52. The nucleic acid construct of claim 51, further comprising a promoter for regulating expression of said polynucleotide.
53. A cell comprising the nucleic acid construct of claim 51.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/405,123 | 2003-04-02 | ||
US10/405,123 US7294701B2 (en) | 2003-04-02 | 2003-04-02 | Antibody fragment capable of modulating multidrug resistance and compositions and kits and methods using same |
PCT/IL2004/000017 WO2004087041A2 (en) | 2003-04-02 | 2004-01-08 | An antibody fragment capable of modulating multidrug resistance and compositions and kits and methods using same |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2520936A1 true CA2520936A1 (en) | 2004-10-14 |
CA2520936C CA2520936C (en) | 2013-06-11 |
Family
ID=33097024
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA2520936A Expired - Fee Related CA2520936C (en) | 2003-04-02 | 2004-01-08 | An antibody fragment capable of modulating multidrug resistance and compositions and kits and methods using same |
Country Status (8)
Country | Link |
---|---|
US (1) | US7294701B2 (en) |
EP (1) | EP1608307B1 (en) |
JP (1) | JP4576375B2 (en) |
AT (1) | ATE511519T1 (en) |
CA (1) | CA2520936C (en) |
ES (1) | ES2364462T3 (en) |
HK (1) | HK1085664A1 (en) |
WO (1) | WO2004087041A2 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007059143A2 (en) * | 2005-11-15 | 2007-05-24 | Bristol-Myers Squibb Company | Methods of identifying and treating individuals exhibiting mdr-1 overexpression with protein tyrosine kinase inhibitors and combinations thereof |
WO2008143702A2 (en) * | 2006-12-01 | 2008-11-27 | Duke University | Anti-mrp3 antibodies and methods of use |
WO2017013172A1 (en) * | 2015-07-23 | 2017-01-26 | Stichting Katholieke Universiteit | Novel inhibitors of p-glycoprotein |
Family Cites Families (42)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NL154600B (en) * | 1971-02-10 | 1977-09-15 | Organon Nv | METHOD FOR THE DETERMINATION AND DETERMINATION OF SPECIFIC BINDING PROTEINS AND THEIR CORRESPONDING BINDABLE SUBSTANCES. |
NL154598B (en) * | 1970-11-10 | 1977-09-15 | Organon Nv | PROCEDURE FOR DETERMINING AND DETERMINING LOW MOLECULAR COMPOUNDS AND PROTEINS THAT CAN SPECIFICALLY BIND THESE COMPOUNDS AND TEST PACKAGING. |
NL154599B (en) * | 1970-12-28 | 1977-09-15 | Organon Nv | PROCEDURE FOR DETERMINING AND DETERMINING SPECIFIC BINDING PROTEINS AND THEIR CORRESPONDING BINDABLE SUBSTANCES, AND TEST PACKAGING. |
US3901654A (en) * | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
US3853987A (en) * | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
US3867517A (en) * | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
US3879517A (en) * | 1972-12-26 | 1975-04-22 | Microdot Inc | Method for making a dual seal insulator for multiple conductor connectors |
US3935074A (en) * | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
US3996345A (en) * | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
US4034074A (en) * | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
US3984533A (en) * | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
US4098876A (en) * | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
US4879219A (en) * | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
US5011771A (en) * | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
US4666828A (en) * | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
US4837306A (en) * | 1985-02-25 | 1989-06-06 | The Ontario Cancer Institute | Method for selecting hybridomas producing antibodies specific to the P-glycoprotein cell suface antigen and a cDNA clone encoding the C-terminal portion of the antigen |
US4683202A (en) * | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4801531A (en) * | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
US4866042A (en) * | 1987-11-18 | 1989-09-12 | Neuwelt Edward A | Method for the delivery of genetic material across the blood brain barrier |
US5223409A (en) * | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
US5272057A (en) * | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
US5464764A (en) * | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
US5192659A (en) * | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
US5780225A (en) * | 1990-01-12 | 1998-07-14 | Stratagene | Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
US5427908A (en) * | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
GB9015198D0 (en) * | 1990-07-10 | 1990-08-29 | Brien Caroline J O | Binding substance |
US5698426A (en) * | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
ATE164395T1 (en) * | 1990-12-03 | 1998-04-15 | Genentech Inc | METHOD FOR ENRICHMENT OF PROTEIN VARIANTS WITH MODIFIED BINDING PROPERTIES |
US5773280A (en) * | 1992-03-20 | 1998-06-30 | The Board Of Trustees Of The University Of Illinois | Monoclonal antibody to a human MDR1 multidrug resistance gene product, and uses |
US5434075A (en) * | 1992-03-20 | 1995-07-18 | Board Of Trustees Of The University Of Illinois | Monoclonal antibody to a human MDR1 multidrug resistance gene product, and uses |
IE921169A1 (en) * | 1991-04-10 | 1992-10-21 | Scripps Research Inst | Heterodimeric receptor libraries using phagemids |
US5407653A (en) * | 1991-06-26 | 1995-04-18 | Brigham And Women's Hospital | Evaluation of the multidrug resistance phenotype |
US5733743A (en) * | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
IT1257893B (en) * | 1992-06-17 | 1996-02-16 | Ist Superiore Sanita | MONOCLONAL ANTIBODIES THAT RECOGNIZE AN EPITOPE OF HUMAN P-GLYCOPROTEIN. |
US5281521A (en) * | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
CZ199593A3 (en) * | 1992-10-02 | 1994-04-13 | Asta Medica Ag | Phthalazinone derivatives exhibiting anti-arrhythmic and analgesic activity and eliminating resistance to a plurality of medicaments (mdr) |
AU5420494A (en) * | 1992-11-02 | 1994-05-24 | Yves Claude Nicolau | Method of reducing multidrug resistance in cells and tissues |
US5541110A (en) * | 1994-05-17 | 1996-07-30 | Bristol-Myers Squibb | Cloning and expression of a gene encoding bryodin 1 from Bryonia dioica |
US5516637A (en) * | 1994-06-10 | 1996-05-14 | Dade International Inc. | Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage |
US5543423A (en) * | 1994-11-16 | 1996-08-06 | Vertex Pharmaceuticals, Incorporated | Amino acid derivatives with improved multi-drug resistance activity |
JP2978435B2 (en) * | 1996-01-24 | 1999-11-15 | チッソ株式会社 | Method for producing acryloxypropyl silane |
AU3482297A (en) * | 1996-06-05 | 1998-01-05 | Eugene Mechetner | Reagents and methods for inhibiting cytokine release by blood cells |
-
2003
- 2003-04-02 US US10/405,123 patent/US7294701B2/en active Active
-
2004
- 2004-01-08 AT AT04700749T patent/ATE511519T1/en not_active IP Right Cessation
- 2004-01-08 JP JP2006507575A patent/JP4576375B2/en not_active Expired - Fee Related
- 2004-01-08 CA CA2520936A patent/CA2520936C/en not_active Expired - Fee Related
- 2004-01-08 ES ES04700749T patent/ES2364462T3/en not_active Expired - Lifetime
- 2004-01-08 WO PCT/IL2004/000017 patent/WO2004087041A2/en active Application Filing
- 2004-01-08 EP EP04700749A patent/EP1608307B1/en not_active Expired - Lifetime
-
2006
- 2006-05-16 HK HK06105663.9A patent/HK1085664A1/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
WO2004087041A2 (en) | 2004-10-14 |
EP1608307A4 (en) | 2007-10-31 |
HK1085664A1 (en) | 2006-09-01 |
US7294701B2 (en) | 2007-11-13 |
EP1608307B1 (en) | 2011-06-01 |
JP4576375B2 (en) | 2010-11-04 |
WO2004087041A3 (en) | 2005-11-17 |
CA2520936C (en) | 2013-06-11 |
ATE511519T1 (en) | 2011-06-15 |
JP2006524505A (en) | 2006-11-02 |
US20040197334A1 (en) | 2004-10-07 |
EP1608307A2 (en) | 2005-12-28 |
ES2364462T3 (en) | 2011-09-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Ahmad et al. | scFv antibody: principles and clinical application | |
CN112154157B (en) | anti-ROR 1 antibodies and uses thereof | |
US11220551B2 (en) | CD133-binding agents and uses thereof | |
Heitner et al. | Selection of cell binding and internalizing epidermal growth factor receptor antibodies from a phage display library | |
JP2021087429A (en) | Anti-cd3 antibodies, activatable anti-cd3 antibodies, multispecific anti-cd3 antibodies, multispecific activatable anti-cd3 antibodies, and methods of using the same | |
Reiter et al. | An antibody single-domain phage display library of a native heavy chain variable region: isolation of functional single-domain VH molecules with a unique interface | |
JP2018150305A (en) | Antibodies against t cell immunoglobulin domain and mucin domain 1 (tim-1) antigen and uses thereof | |
AU2017237543B2 (en) | Antibody that binds to envelope glycoprotein of severe fever with thrombocytopenia syndrome virus, and use for same | |
JP7027530B2 (en) | Antibodies to human DLK1 and their uses | |
CN104936984A (en) | Antibody binding specifically to human and mouse L1cam protein, and use therefor | |
US20190031770A1 (en) | Intercalated single-chain variable fragments | |
KR20180138201A (en) | ILT7 binding molecules and methods for their use | |
Haus‐Cohen et al. | Disruption of P‐glycoprotein anticancer drug efflux activity by a small recombinant single‐chain Fv antibody fragment targeted to an extracellular epitope | |
US11168145B2 (en) | Plectin-1 binding antibodies and uses thereof | |
Sommavilla et al. | Design and construction of a naive mouse antibody phage display library | |
KR20100064985A (en) | Recombinant monoclonal antibody specifically binding to l1cam expressed in humans and mice and the use thereof | |
CA2520936C (en) | An antibody fragment capable of modulating multidrug resistance and compositions and kits and methods using same | |
Binyamin et al. | Targeting an extracellular epitope of the human multidrug resistance protein 1 (MRP1) in malignant cells with a novel recombinant single chain Fv antibody | |
Yuan et al. | Isolation of anti-MISIIR scFv molecules from a phage display library by cell sorter biopanning | |
CN114853890B (en) | PRLR antigen binding protein and preparation method and application thereof | |
IL171028A (en) | Single chain fv antibody capable of modulating multidrug resistance and compositions and kits and methods using same | |
US20240141061A1 (en) | Novel antibody against cd55 and use thereof | |
Cohen et al. | Interaction of the octapeptide angiotensin II with a high-affinity single-chain Fv and with peptides derived from the antibody paratope | |
Schmidt et al. | Selection of an anti-CD20, single-chain antibody by phage ELISA on fixed cells | |
CN116964094A (en) | Novel antibodies against CD55 and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKLA | Lapsed |
Effective date: 20170109 |