CA2502088A1 - Use of antibodies to the gamma 2 chain of lallminin 5 to inhibit tumor growth and metastasis - Google Patents

Abstract

The present invention provides a methods and compositions for inhibiting tumor growth and/or metastasis involving the administering to a subject with a laminin 5-secreting tumor of an amount effective to inhibit tumor growth and/or metastasis of an antibody that binds to one or more epitopes of the laminin 5 .gamma.2 chain.

Description

Use of antibodies to the gamma 2 chain of laminin 5 to inhibit tumor growth and metastasis CROSS REFERENCE
This application claims priority to U.S. Provisional Patent Application 60/422,009 filed October 29, 2002.
BACKGROUND OF THE INVENTION
Laminins are basement membrane glycoproteins with diverse biological functions including cell adhesion, proliferation, migration and differentiation. Thus far, I 1 genetically distinct chains forming at least 12 laminin isoforms have been characterized.
Every member of this growing protein family has a heterotrimeric chain composition of a, (3, and y chains that are formed through an intracellular self assembly mechanism.
Laminin-5 is a specific component of epithelial basement membranes with the chain composition cx3(33y2 (Kallunki, et al., J. Cell Biol. 119: 679-93, 1992). The y2 chain has a mass of ~ 130 kd and is thus smaller than the "classical" ~ 200 kd [31 and yl light chains of laminip 1.
Expression of laminin 5 chains is often up-regulated in epithelial cancers, such as squamous cell carcinomas and gastric carcinomas, but not in mesenchymally derived cancers (Larjava, et al., J.
Clin. Invest. 92: 1425-35, 1993) (Pyke, et al., Am. ,1. Pathol. 145: 782-91, l 994) (Pyke, et al., Cancer- Res. 55: 4132-9, 1995) (Tani, et al., Am. J. Pathol. 149: 781-93, 1996) (Orian-Rousseau, et al., J. Cell. Sci. 11 I : 19932004, 1998) (Sordat, et al., J. Pathol. 185:
44-52, 1998). However, down-regulation has been reported in epithelial prostate and breast carcinomas (Hao, J., Yang, Am. J. Pathol. 149: 1341-9, 1996) (Martin; et al., Mol. Med. 4: 602-613, 1998). In colon adenocarcinomas, both gene and protein expression of the y2 chain seem to be a characteristic of cancer cells with a budding phenotype (Lar java, et al., ,1. Clin. Invest. 92:
1425-35, 1993) (Pyke, et al., Am. J. Pathol. 145: 782-91, 1994) (Pyke, et al., Cancer Res. 55: 4132-9, 1995). Tumor cell budding in colorectal carcinoma has also been associated with the presence of intracellular laminin-5 (Sordat, et al., J. Pathol. 185: 44-52, 1998).

The y2 chain of laminin-5 has also been shown to be strongly expressed in malignant cells located at the invasion front of several human carcinomas, as.determined by i~ situ hybridization and immunohistochemical staining (Pyke, C., Romer, J., Kallunki, P., Lund, L.R., Ralfkiaer, E., Dano, K. & Tryggvason, K. (1994) Am. J. Pathol. 145: 782-791;
Pylce, C., Salo, S., Ralfl:iaer, E., Romer, J., Dano, K. & Tryggvason, K. (1995) Cancer Res. 55:
4132-4139).
However, no studies have shown that antibodies to the y2 chain of laminin 5 can be used to inhibit tumor cell growth.
SUMMARY OF THE INVENTION
The present invention provides antibodies, compositions and methods for inhibiting tumor growth and/or metastasis. In one aspect, the present invention provides antibodies that bind to one or more epitopes of domain III of the human laminin 5 y2 chain (SEQ ID NOS: 2 and 4).
In another aspect, the present invention provides a method for inhibiting tumor growth and/or metastasis comprising administering to a subject with a laminin 5-secreting tumor an amount effective to inhibit tumor growth and/or metastasis of an antibody that binds to one or more epitopes of the laminin 5 y2 chain. In one embodiment, the antibody binds to one or more epitopes of domain III of the laminin 5 y2 chain.
In a further aspect, the present invention provides a pharmaceutical composition comprising an antibody that binds to the laminin 5 y2 chain and one or more further anti-tumor agents. In various embodiments of this aspect, the antibody is selective for one or more epitopes in domain III of the laminin 5 y2 chain, and/or the further anti-tumor agent is a chemotherapeutic.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 shows efficiency of human laminin-5 and recombinant human laminin y2 chain fox attachment of HaCat keratinocytes and KLN205 squamous carcinoma cells in vits~o.
The attachment efficiency was compared with the efficiency with which the cells bound to laminin-1. Substrate concentrations (IO pg/ml) providing maximum attachment to laminin-1 and laminin-5 were used. The results are presented as means +/- SD calculated from at least four duplicate series; the values for laminin-1 were given the arbitrary value of 100%.

FIGURES 2A-B show the effects of polyclonal y2 chain antibodies on the migration of KLN205 squamous carcinoma cells in Boyden and Transwell chamber assays of migration.
FIGURE 3 shows tumor growth inhibition using Mab SDS and CPT-I 1 on day 31 in the HT29-e28 cell line.
FIGURES 4A-E show tumor growth curves for individual mice in the 1-IT29-e28 study.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect, the present invention provides a method for inhibiting tumor growth and/or metastasis comprising administering to a subject with a laminin 5-secreting tumor an amount effective to inhibit tumor growth and/or metastasis of an antibody that binds to one or more epitopes of the laminin 5 y2 chain. In a preferred embodiment, the subject is a mammal; in a more preferred embodiment, the subject is human.
As used herein, the term "inhibiting tumor growth" means to reduce the amount of tumor growth that would occur in the absence of treatment, and includes decrease in tumor size andlor decrease in the rate of tumor growth.
As used herein, the term "inhibiting tumor metastasis" means to reduce the amount of tumor metastasis that would occur in the absence of treatment, and includes decrease in the number and/or size of metastases.
As used herein, the term "laminin-5 secreting tumor" means a tumor that expresses detectable amounts of laminin 5. Such tumors include, but are not limited to, carcinomas. Such carcinomas include, but are not limited to squamous cell carcinomas (including but not limited to squamous cell carcinoma of skin, cervix, and vulva), gastric carcinomas, colon adenocarcinomas, colorectal carcinomas, and cervical carcinomas.
As used herein, the term "laminin 5 y2 chain" preferably refers to the human laminin 5 y2 chain, with protein sequences comprising the amino acid sequence of SEQ ID
N0:2 or SEQ ID
N0:4, and derivatives thereof.
As used herein, the term "epitope" refers to a specific site within the protein that is bound by the antibody, which includes both linear and non-linear epitopes.
In a preferred embodiment, the antibody binds to one or more epitopes of domain III of the laminin 5 y2 chain. As used herein, the term ''domain III of the laminin 5 y2 chain" refers to a 177 amino acid region of SEQ ID N0:2 between residues 391 and 567 (ICallunki et al., J. Cell Biol. 119:679-693 (1992)), which is presented herein as SEQ ID N0:8. In a further preferred embodiment, the antibody binds to one or more epitopes within domain III that are contained within the amino acid sequence of SEQ ID N0:6 and does not bind to epitopes within domain III that are within the amino acid sequence of SEQ ID NOS: 9 and 3~.
The antibody can be a polyclonal antibody or a monoclonal antibody, but preferably is a monoclonal antibody. For use in humans, humanized monoclonal antibodies are especially preferred.
In a further embodiment, the methods of the invention further comprises treating the subject with chemotherapy and/or radiation therapy, whereby the use of the antibody permits a reduction in the chemotherapy and/or radiation dosage necessary to inhibit tumor growth and/or metastasis. Any reduction in chemotherapeutic or radiation dosage benefits the patient by resulting in fewer and decreased side effects relative to standard chemotherapy and/or radiation therapy treatment.
In this embodiment, the antibody may be administered prior to, at the time of, or shortly after a given round of treatment with chemotherapeutic and/or radiation therapy. In a preferred embodiment, the antibody is administered prior to or simultaneously with a given round of chemotherapy and/or radiation therapy. In a most preferred embodiment, the antibody is administered prior to or simultaneously with each round of chemotherapy andlor radiation therapy.
The exact timing of antibody administration will be determined by an attending physician based on a number of factors, but the antibody is generally administered between 24 hours before a given round of chemotherapy and/or radiation therapy and simultaneously with a given round of chemotherapy and/or radiation therapy.
The methods of the invention are appropriate for use with chemotherapy using one or more cytotoxic agent (ie: chemotherapeutic), including, but not limited to, cyclophosphamide, taxol, 5-fluorouracil, adriamycin, cisplatinum, methotrexate, cytosine arabinoside, mitomycin C, prednisone, vindesine, carbaplatinum, and vincristine. The cytotoxic agent can also be an antiviral compound which is capable of destroying proliferating cells. For a general discussion of cytoto~cic agents used in chemotherapy, see Sathe, M. et al., Dancer Chemotherapeutic Agents: Handbook of Clinical Data (1978), hereby incorporated by reference.

The methods of the invention are also particularly suitable for those patients in need of repeated or high doses of chemotherapy andlor radiation therapy.
In practicing the invention, the amount or dosage range of antibody employed is one that effectively inhibits tumor growth and/or metastasis. The actual dosage range is based on a variety of factors, including the age, weight, sex, medical condition of the individual, the severity of the condition, and the route of administration. An inhibiting amount of antibody that can be employed ranges generally between 0.01 pg/kg body weight and 15 mg/kg body weight, preferably ranging between 0.05 pg/kg and 10 mg/kg body weight, more preferably between 1 pg /kg and 10 mg/kg body weight, and even more preferably between about 10 p.g /kg and 5 mg/kg body weight.
The antibody may be administered by any suitable route, but is preferably administered parenterally in dosage unit formulations containing conventional pharmaceutically acceptable carriers, adjuvants, and vehicles. The term "parenteral" as used herein includes, subcutaneous, intravenous, intraarterial, intramuscular, intrasternal, intratendinous, intraspinal, intracranial, intrathoracic, infusion techniques or intraperitoneally. In preferred embodiments, antibody is administered intravenously or subcutaneously.
The antibody may be made up in a solid form (including granules, powders or suppositories) or in a liquid form (e.g., solutions, suspensions, or emulsions). Antibody may be applied in a variety of solutions. Suitable solutions for use in accordance with the invention are sterile, dissolve sufficient amounts of the antibody, and are not harmful for the proposed application.
The antibody may be subjected to conventional pharmaceutical operations such as sterilization and/or may contain conventional adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers, buffers etc.
For administration, the antibody is ordinarily combined with one or more adjuvants appropriate for the indicated route of administration. The compounds may be admixed with lactose, sucrose, starch powder, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol, and tableted or encapsulated for conventional administration. Alternatively, the antibody may be dissolved in saline, water, polyethylene glycol, propylene glycol, carboxymethyl cellulose colloidal solutions, ethanol, corn oil, peanut oil, cottonseed oil, sesame oil, tragacanth gum, and/or various buffers.

Other adjuvants and modes of administration are well known in the pharmaceutical art. The carrier or diluent may include time delay material, such as glyceryl monostearate or glyceryl distearate alone or with a wax, or other materials well known in the art.
In another aspect, the present invention provides isolated antibodies that bind to one or more epitopes of domain 1II of the laminin 5 y2 chain, hybridoma cells that produce isolated monoclonal antibodies, and pharmaceutical compositions comprising such monoclonals. In a further preferred embodiment, the isolated antibody binds to one or more epitopes within the amino acid sequence of SEQ ID N0:6 and does not bind to epitopes within the amino acid sequence of SEQ ID NOS: 9 and 10. The isolated antibody can be a polyclonal antibody or a monoclonal antibody, but preferably is a monoclonal antibody. In a further embodiment, the isolated antibodies are humanized. In a further embodiment, the isolated antibody is prepared as a pharmaceutical composition, combined with one or more appropriate pharmaceutical carriers, as described above.
These isolated antibodies are useful in all of the methods of the invention, as well as in I S diagnostic use for detecting the presence of invasive cells in a tissue sample. In a preferred embodiment, diagnostic use of the isolated antibodies of the invention comprises contacting a tumor tissue with one or more isolated antibodies to form an immunocomplex, and detecting formation of the immunocomplex, wherein the formation of the immunocomplex correlates with the presence of invasive cells in the tissue. The contacting can be performed i~ vivo, using labeled isolated antibodies and standard imaging techniques, or can be performed i~r vzt~°o on tissue samples.
In a preferred embodiment, the tissue is a tumor tissue. In a further preferred embodiment, the tumor tissue is a laminin 5 secreting tumor tissue. More preferably, the tumor tissue is a carcinoma, including but are not limited to squamous cell carcinomas (including but not limited to squamous cell carcinoma of skin, cervix, and vulva), gastric carcinomas, colon adenocarcinomas, colorectal carcinomas, and cervical carcinomas.
In a further preferred embodiment of this aspect of the invention, the isolated monoclonal antibodies are of the IgG isotype. In a further preferred embodiment, the isolated monoclonal antibodies are selected from the group consisting of those designated herein as 4G I, SDS and 6C 12, and the hybridomas expressing these monoclonals, which are deposited with the American Type Tissue Collection as ATCC accession numbers ----, ----, and --- . A more detailed description of the production of these particular hybridomas and monoclonal antibodies, and their use, is provided below. .
The additional components of pharmaceutical compositions comprising one or more of these isolated antibodies are as described above.
Antibodies can be made by well-known methods, such as described in Hay°low and Lane, Antibodies; A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1988). In one example, pre-immune serum is collected prior to the first immunization. A
peptide portion of the amino acid sequence of a laminin 5 y2 chain polypeptide, together with an appropriate adjuvant, is injected into an animal in an amount and at intervals sufficient to elicit an immune response. Animals are bled at regular intervals, preferably weekly, to determine antibody titer. The animals may or may not receive booster injections following the initial immunization. At about 7 days after each booster immunization, or about weekly after a single immunization, the animals are bled, the serum collected, and aliquots are stored at about -20° C.
Polyclonal antibodies against the laminin 5 y2 chain polypeptides can then be purified directly by passing serum collected from the animal through a column to which non-antigen-related proteins prepared from the same expression system without the laminin 5 y2 chain polypeptides bound.
Monoclonal antibodies can be produced by obtaining spleen cells from the animal. (See Kohler and Milstein, Nature 256, 495-497 (1975)). In one example, monoclonal antibodies (mAb) of interest are prepared by immunizing inbred mice with a laminin 5 y2 chain polypeptide, or portion thereof. The mice are immunized by the IP or SC route in an amount and at intervals sufficient to elicit an immune response. The mice receive an initial immunization on day 0 and are rested for about 3 to about 30 weeks. Immunized mice are given one or more booster immunizations of by the intravenous (IV) route. Lymphocytes from antibody positive mice are obtained by removing spleens from immunized mice by standard procedures known in the art.
Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner under conditions that allow formation of stable hybridomas. The antibody producing cells and fusion partner cells are fused in polyethylene glycol at concentrations from about 30%
to about 50%. Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art. Supernatant fluids are collected from growth positive wells and are screened for antibody production by an immunoassay such as solid phase immunoradioassay.
Hybridoma cells from antibody positive wells are cloned by a technique such as the soft agar technique of MacPherson, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, Eds., Academic Press, 1973.
To generate such an antibody response, a laminin 5 y2 chain polypeptide or portion thereof is typically formulated with a pharmaceutically acceptable carrier for parenteral administration.
Such acceptable adjuvants include, but are not limited to, Freund's complete, Freund's incomplete, alum-precipitate, water in oil emulsion containing Corynebacterium parvum and tRNA. The formulation of such compositions, including the concentration of the polypeptide and the selection of the vehicle and other components, is within the knowledge of those of skill of the art.
The term antibody as used herein is intended to include antibody fragments thereof which are selectively reactive with the laminin 5 y2 chain polypeptides. Antibodies can be fragmented using conventional techniques, and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab')~ fragments can be generated by treating antibody with pepsin. The resulting F(ab')y fragment can be treated to reduce disulfide bridges to produce Fab' fragments.
In another aspect, the present invention provides pharmaceutical compositions comprising an antibody that binds to the laminin 5 y2 chain and one or more further anti-tumor agent. In a preferred embodiment of this aspect of the invention, the antibody binds to one or more epitopes in domain III of the laminin 5 y2 chain, as described above. In a further preferred embodiment, the isolated antibody binds to one or more epitopes within the amino acid sequence of SEQ ID N0:6 and does not bind to epitopes within the amino acid sequence of SEQ ID
NOS: 9 and 10. The antibody can be a polyclonal antibody or a monoclonal antibody, but preferably is a monoclonal antibody. In a further preferred embodiment of this aspect of the invention, the further anti-tumor agent is a chemotherapeutic agent, such as one or more of those described above. The components of the pharmaceutical composition may be pre-mixed together or may be combined at any time prior to administration to a patient in need thereof.
The examples below are meant by way of illustration, and are not meant to be limiting as to the scope of the instant disclosure.

The following example demonstrates the effect of laminin-5, including the y2 chain of laminin-5, on cell adhesion and cell migration.
Matey~ials arid Methods Cells and Cell Culture A mouse squamous cell carcinoma cell line, KLN205 (cat. no. ATCC CRL-1453), was obtained from American Type Culture Collection (Rockville, MD). The cells were maintained as monolayer cultures in Eagle's minimum essential medium-(MEM) containing non-essential amino acids and Earle's BSS supplemented with 10% fetal calf serum (FCS). The HaCat human keratinocyte cell line was a kind gift from Dr. Fuzenig (Heidelberg, Germany).
The HaCat cells were cultured in Dulbecco's MEM supplemented with 10% FCS. However, when the cells were cultured for the production of laminin-5, the medium was replaced by serum-free medium.
Ps°ePa~~ution of Proteiv~s Mouse EHS laminin (laminin-1) was obtained from GIBCO BRL. Fibronectin was purified from FCS using a gelatin-Sepharose 4B column (Sigma) as described in Vuento, M. &
Vaheri, A. (1979) Biochem. J. 183: 331-337.34 and Gillies, R. J., Didier, N. &
Denton, M.
(1986) Anal. Biochem. 159: 109-1 13. Human laminin-5 was immunoaffinity purified from the media of HaCat cells cultured for three days in the absence of serum. Briefly, the medium was first passed through a 5 ml gelatin-Sepharose column (Sigma, St. Louis, MO) to ensure the complete absence of fibronectin from the protein preparation, after which the medium was passed through a 10 ml anti-laminin y2-Sepharose affinity column in order to bind laminin-5 molecules. Both columns were equilibrated in phosphate-buffered saline. The anti-laminin y2-Sepharose affinity column was prepared by coupling a Protein A-purified anti-y2 IgG (8 mg/ml) to 10 ml of CNBr-activated Sepharose (Pharmacia, Uppsala, Sweden). The anti-y2 IgG was purified from a rabbit polyclonal antiserum prepared against a GST-fusion protein containing domain III of the y2 chain (Pyke, C., Salo, S., Ralfkiaer, E., Romer, J., Dano, K. & Tryggvason, K. (1995) Cancer Res. 55: 4132-4139). The laminin-S was eluted from the immunoaffinity column using 50 mM triethanolamine, pH 1 1.25, 0.1 % Triton X-100 and neutralized directly with 1 M Tris-HCI, pH 7Ø Collected fractions were analyzed by SDS-PAGE and Western blotting using the same polyclonal antibodies as used for the preparation of the affinity column.
Fractions containing laminin-5 were pooled and dialyzed against 50 mM Tris-HCI, 0,1 M NaCI, pH 7.4. Some batches of laminin-5 were denatured with 5 M urea and renatured to study the effects of the treatment on adhesion and migration properties.
Generation of Recombina~rt Baculovirus and Expre.s.sinJ~ t~f Recombi~arrt Luminirr 2 Chaiy~
The y2 chain of laminin-5 was expressed as recombinant protein using the baculovirus system and purified for studies on its functional propeuies. A full-length human laminin y2 chain cDNA containing 6 by of the 5' UTR and 822 by of the 3' UTR was constructed from four overlapping cDNA clones L52, HT2-7, L15 and L61 (Kallunki, P., Sainio, K., Eddy, R., Byers, M., Kallunki, T., Sariola, H., Beck, K., Hirvonen, H., Shows, T.B. &
Tryggvason, K. (1992) J.
Cell Biol. 1 19: 679-693). The resulting 4,402 by cDNA was analyzed by restriction enzyme mapping and partial sequencing, and cloned into the pVL1393 recombinant transfer plasmid prior to transfer into the AcNPV-y2 baculovirus vector kindly provided by Max Summers (Texas A&M University). This baculovirus vector containing the human laminin y2 chain cDNA under the transcriptional control of the polyhedrin promoter was produced and purified following standard procedures, except that it was first enriched according to tile method of Pen, et al. (Pen, J., Welling, G.W. & Welling-Wester, S. (1989), Nucl. Acid. Res. l7: 451) from the virus containing medium obtained by co-transfecting Sf9 cells with the wild-type virus (AcNPV) DNA
and the recombinant transfer vector pVL 1393-y2. For expression of the recombinant protein, High Five (H5) cells were infected with the recombinant virus at a multiplicity of infection (MO1) of 5-10 pfu per cell by using standard protocols.
The recombinant y2 chain was purified by first resuspending the cells in 10 volumes of 50 mM Tris-HC1, pH 7.4, 100 mM NaCI, 2.5 mM EDTA, 1 % Triton X-100, 1 mM PMSF
and 1 mM NEM followed by homogenization in a Dounce homogenizes. The protein was extracted for 60 minutes on ice and solubilized proteins were removed by centrifugation at 1500 x g for 10 minutes at 4° C. The pellet was extracted again with buffer containing 1-3 M urea. The recombinant y2 chain was extracted with a buffer containing 5 M urea, and renatured by dialysis against 50 mM Tris-HCI, pH 7.4, 100 mM NaCI.

Prepay~atio~r ofA~tibodies Polyclonal antiserum against domain III of the laminin y2 chain was prepared and characterized as described previously. Briefly, rabbits were immunized s.c.
four times using a y2-GST fusion protein as antigen. The antigen contained 177 amino acid residues (res. # 391-567) from domain III of the y2 (SEQ ID N0:8) (Kallunki, P., Sainio, K., Eddy, R., Byers, M., Kallunki, T., Sariola, H., Beck, K., Hirvonen, H., Shows, T.B. & Tryggvason, K. (1992) J. Cell Biol. 1 19: 679-693). Antibodies against the GST-epitopes were removed from the antisera by negative immunoadsorption with GST-Sepharose made by coupling E. toll expressed GST
protein to CNBr-activated Sepharore. The removal of anti-GST IgG was ensured by Western blotting analysis with GST-specific antibodies. The specificity of the antibody against the laminin y2 chain was also tested by Western blotting as well as by ELISA.
Polyclonal antibody against the C-terminus of the laminin y2 chain was produced in rabbits essentially as above for domain III using a y2-GST fusion protein as antigen. The antigen contained 161 amino acids (res. # 1017-1178) from domain 1/II of the y2 chain and antibodies against the GST-epitopes were removed from the antisera by negative immunoadsorption with GST-Sepharose. The specificity of the antibody was tested by Western blotting and EL1SA.
Polyclonal antiserum against laminin-1 was a kind gift of Dr. Foidart (University of Liege, Belgium). Normal rabbit serum was obtained prior to immunization from the rabbits used for immunization. IgG from the laminin-1 and laminin y2 chain antisera, as well as from normal rabbit serum, was purified using Protein A Sepharose (Pharmacia, Uppsala, Sweden).
Dell Adhesion Assay Microtiter plates (96 wells: Nunc, Copenhagen, Denmark) were coated with 100 pl/well of laminin-1 (10 p.g/ml), laminin-5 (10 p.g/ml), or recombinant larninin y2 chain (10 p,g/ml) in PBS or 50 M Tris-HCI, pH 7.4 by incubating the plates overnight at 4°
C. Control wells were uncoated or coated with the same amounts of BSA. In some experiment the proteins were first denatured by dialysis overnight against 5 M urea, 50 mM Tris-HCI, pH 7.5 and then renatured by dialysis against 50 mM Tris-HCI, pH 7.5. Potential remaining active sites on the plates were blocked with 150 p,l of 10 mg/ml BSA in PBS for 2 hours at room temperature.
The wells were washed with PBS, and 100 ml of Eagle's MEM containing 5 mg/ml BSA was added.
For the adhesion assays, KLN205 cells were detached from subconfluent cell culture dishes with trypsin-EDTA (0.25%-0.03%) and resuspended in Eagle's MEM/BSA (5 mg/ml) at a concentration of 2 x 10' cells/ml and allowed to recover for 20 minutes at 37° C. A total of 20,000 cells were then added to each well and allowed to attach for an additional 90 minutes at 37° C. T he extent of cell adhesion was determined by measuring color yields at 600 nm, following fixation with 3%
paraformaldehyde and staining with 0.1 % crystal violet. For inhibition assays with the anti-y2 antibody, the substrate coated wells were incubated with 20 p,g/ml of anti-y2 chain IgG in PBS
for 60 minutes prior to incubations with the cells.
l~l~YClZl03? l~S.S'Cly The effect of endogenous laminin-5 on migration of KLN205 cells was determined by using a modified Boyden chamber assay, as described by Hujanen and Terranova (Hujanen, E. &
Terranova, V.P. (1985) Cancer Res. 45: 3517-3521), and the effect of exogenous laminin-5 by using a modified Transwell assay, as described by Pelletier, et al.
(Pelletier, A.J., Kuniclci, T. and Quaranta, V. (1996), J. Biol. Chem. 271:364).
The Boyden chamber assay was carried out as follows. Polycarbonate filters (pore size 10 pm, diameter 12 mm; Costar, Cambridge, MA) were coated with 2.5 pg of EHS
type IV
collagen, and used to separate the upper and lower compartments of the 50 p.l chamber. A total of 1 x 105 cells in Eagle's MEM containing 0.1% BSA were placed in the upper compartment, and the lower compartment was filled with medium with or without chemoattractants (50 p,g/ml laminin-I or fibronectin). To study the effect of the laminin y2 chain antibodies on cell migration, anti-y2 (III) IgG or anti-y2 (C-term) IgG was added to the upper compartment together with the cells at a concentration of20 p.g/ml. Normal rabbit IgG was used as a negative control. After an 8-hour incubation at 37° C in a humidified atmosphere, the filters were removed, fixed and stained (Diff Quick, Baxter Diagnostics, Tubingen, Germany). The cells that had not migrated were removed from the upper surface of the filter with cotton swabs.
Migration of cells was quantified by counting the cells on the lower surface of each filter in 10 randomly selected high power fields (x400). All assays were performed in triplicate.

The "Transwell" plate assay (Transwell plates with pore size 12 ~,m, diameter I2 mm;
Costar, Cambridge, MA) was used to determine the effect of exogenous laminin-5 on cell migration. The lower side ofthe membrane was coated with 2.5 wg of EHS type IV
collagen for 3 hours at room temperature. Both sides were blocked with 1 % bovine serum albumin for 1 hour. A total of 1 x 10' cells were added per well in the upper compartment in Eagle's MEM
containing 10% FCS, and the lower compartment was tilled with 2.5 p,g/ml laminin-5 as a chemoattractant. Antibodies against the C-terminus and domain III of the y2 chains or nonimmune IgG were added to the upper compartment, together with the cells at a concentration 20 ~g/ml. Following a 16-hour incubation at 37° C the cells were fixed and stained. Cells on the top surface of the membrane were removed with cotton swabs, and cells that had migrated to the lower side of the membrane were counted (12 fields +/- S.D.).
IrnJnuuohistochcmical Stairrihg Five p,m thick paraffin sections were stained with polyclonal antibodies against laminin-1 or the y2 chain of laminin-5. In brief, the paraffin sections were first incubated with 0.4% pepsin in 0.1 M HCI at 37° C for 20 minutes to expose the antigens, blocked for nonspecific binding with 5% newborn rabbit serum, 0.1 % BSA, and then incubated for 1 hour at 37° C with the polyclonal IgG diluted in TBS to 5-10 p,g/ml. Subseduently, a biotinylated swine-anti-rabbit antibody was applied, followed by incubation with a 1:400 dilution of Horseradish-Peroxidase-Avidin-Biotin-Complex (DAKO, Copenhagen, Denmark). The color was developed in diaminobentsamidine (DAB), followed by counterstaining ofthe slides with hematoxylin.
Results C'lza~acterzzatiou of Pr~otezns and EpitheliuJn-Def°ioed C'~lls ?5 lmmunopurified trimeric laminin-5, isolated from the culture medium of HaCat cells contained two major bands when analyzed by SDS-PAGE. These bands corresponded, respectively, to the 16S IcDa y2 chain, and the 155 kDa and 140 kDa y2 and (33 chains migrating as a single band, as reported previously. Additionally, a weak band of about 105 kDa corresponding to the processed y2 chain could be observed.

Full-length human recombinant laminin y2 chain was produced in High-5 Spodoptera _fi°ugipef~da insect cells using the baculovirus system. Since the y2 chain was not secreted to the culture medium, possibly because it was not assembled intracellularly into a normal heterotrimer, it was isolated from the cell fraction as described in Matey°ials and Methods. The protein was extracted under denaturating conditions using S M urea, renatured by extensive dialysis against 50 mM Tris-HCI, 100 mM NaCI, pH 7.4, and purified. The purified recombinant y2 chain was full length (approximately I55 kDa) and highly pure as determined by SDS-PAGE
analysis.
The HaCat human keratinocytes and mouse KLN205 squamous carcinoma cells were shown to express laminin-5, based on Northern blot analyses and immunostaining, using a cDNA probe and/or polyclonal antibodies specific for the y2 chain, respectively. Furthermore, the KLN205 cells developed y2 chain positive primary tumors and metasases in mice in vivo (data not shown). Following intramuscular or subcutaneous inoculations, large primary tumors developed in 4 weeks with numerous lung metastases after 4-6 weeks. KLN205 cells injected into the tail vein produced multiple lung tumors (experimental metastases) in four weeks.
I S Consequently, both cell types were considered appropriate for the cell attachment and migration experiments carried out in this study.
Lasni~ri~-5 Molecule, but not Reco~nbivraht Lami~in y2 Chaiu, Prouzotes Cell Adhe.s~ion The laminin-5 and recombinant y2 chain prepared in this study, as well as commercial laminin-l, were used as substrata in attachment assays (FIGURE 1) with the two epithelium-derived HaCat and KLN205 cell lines that both express laminin-5. Both cell lines attached about 2.5 times more readily to laminin-1 than to plastic. Adhesion of the cells to laminin-5 appeared to be slightly higher than that to laminin-l, but the differences were not statistically significant.
The cells attached equally well to laminin-5 preparations denatured in 5 M
urea and then renatured by dialysis against 50 mM Tris-HC1, 100 mM NaCI, pH 7.4, as described for the recombinant y2 chain above, indicating that this treatment did not affect the binding properties of the trimeric molecule. The attachment to laminin-5 did not significantly decrease in the presence of two different polyclonal antibodies made against the short or long arms of the y2 chain or pre-IgG. Different amounts of the antibody against the short arm of the y2 chain were also tested (up to 50 p,g/ml), but no effects on cell adhesion were observed. When the cells were plated on the recombinant y2 chain alone, the attachment was not significantly higher than that to plastic, this attachment not being influenced by polyclonal antibodies against the y2 chain.
The data confirm previous results showing that trimeric laminin-5 promotes adhesion of epithelial cells, but the present results further strongly suggest that this adhesion is not mediated by the y2 chain.
Arrtihodies Against Lamihi~z ls2 Domain 111, But Not Donnuiv~ IlII, Iyzhibit Cell Mig~°atio~
The potential role of the y2 chain of laminin-5 in cell migration was examined for the KLN205 cells i~ vitro using Boyden and Transwell chamber assays as described in Materials aszd Methods.
Migration was first studied in the Boyden chamber assay using laminin-1 and fibronectin in the lower chamber as chemoattractants (See Figure 2A). The two compartments of the chemotactic Boyden chambers were separated by a type IV collagen coated porous filter (pore size 8 Vim). The cells (I x 10') in MEM containing 0.1 % BSA were placed in the upper compartment, and laminin-1 (+/-) or fibronectin (-/+) in MEM containing 0.1°/~ BSA were added as chemoattractants to the lower compartment. IgG against y2 chain domains II
I, I/II or preimmune IgG was added to the upper compartment with the cells at a concentration of 20 ~g/ml. After an 8-hour incubation at 37°C the filters were removed and migration of cells to the lower surface of the filter was quantitated. The data are expressed as percentage of migrated cells (+/- SD (bars)) per high power field, setting migration in the presence of pre-immune IgG
as 100%. Cells were counted in ten randomly selected high power fields to triplicate assays.
When polyclona( IgG against the short arm of the y2 chain was added to the upper compartment containing the cells, the migration of cells through the filter was decreased to about 35 to 45% of that observed with the preimmune serum. In contrast, the polyclonal IgG
against C-terminal domain I/II did not affect migration of the cells.
The effects of the two antibodies were similarly used in the Transwell assay using native laminin-5 as chemoattractant in the lower compartment (See Figure 2B). The lower side of the membrane was coated with EHS type IV collagen, and the lower compartment was filled with 2.5 p,g/ml laminin-5 as a chemoattractant. Pre-immune IgG, IgG against the y2 chain domains III or I/II were added to the upper chamber containing the cells. Following a 16-hour incubation the cells were fixed and cells at the lower side of the membrane,were counted ( 12 fields +/- SD).
IS

The results were essentially the same as in the Boyden chamber assay. Thus, addition of IgG
raised against domain III of the y2 chain inhibited the migration to about 50%
as compared with preimmune IgG, while the polyclonal IgG against domain I/II did not affect the cell migration.
These iN vit~~o results demonstrate that laminin-5 have a role in the locomotion of epithelium-derived cells, and that this function can be inhibited by antibodies directed against domain III of the y2 chain.
Thus, antibodies against the short arm of the laminin ~,2 chain inhibited the migration of KLN205 squamous carcinoma cells by about 55-65% as determined in the Boyden chamber migration assay. Interestingly, the antibodies used here were directed against 177 amino acid residues of domain III (SEQ ID N0:8) that when deleted by mutation cause lethal functional epidermolysis bullosa. Accordingly, the short arm of the laminin ~,2 chain is important for the interaction of this laminin isoform to other extracellular matrix proteins and this interaction is also involved in the cell migration process.

The following example describes, in detail, the preparation of monoclonal antibodies according to the invention as well as demonstrating their use in inhibiting tumor cell growth in laminin-5 secreting tumors.
Monoclonal antibodies against the ~y2 chain of laminin-5 were produced by immunizing Balb/c mice with 100 ug GST-laminin-'y2-III fusion protein as antigen. The GST-laminin-'y2-III
fusion protein contains human laminin- y2-chain amino acid residues 391-567 (SEQ ID N0:8).
Subsequent to immunization, spleen cells from the immunized mice were fused with mouse myeloma cell obtained from cell line P3X63Ag.8.653 (ATCC #CRL-1580). The hybridoma clones were then screened in immunohistology on frozen and paraffin sections (human cervix carcinoma, normal cervix and normal skin) for the production of the anti-laminin- y2 antibody.
The staining result was compared to negative control, mouse normal serum and IgG, and to the positive result obtained with well-characterized anti-laminin-5, y2 chain polyclonal antibody (described in Pylee, et al., 1995). The hybridoma clones were also screened in ELISA. The best hybridoma clones were picked and cloned again twice (single cell cloning) to ensure that the produced hybridoma cell line was monoclonal.
The following describes the details of the production of three specific hybridoma clones and corresponding monoclonal antibodies produced therefrom. Characterization studies were conducted with respect to the 4G1, SDS and 6C12 monoclonal antibodies. Western blot analysis and ELISAs were carried out to confirm the specificity of the antibodies to the y2 chain of laminin 5. Western blot analysis involved running recombinant laminin 5 y2 chain (as well as appropriate controls) in an SDS-PAGE gel, blotting the gel on a nylon membrane, and incubating the membrane with the antibodies For EL1SA, plates were coated with 100 p,l GST-y2-III fusion protein (antigen) (Salo et al., Matrix Biology 18:197-210 (1999) at a concentration of 2.5 ug/ml in O.1M
carbonate/bi-carbonate buffer (pH 9) overnight at 4° C (0.25ug/well). The ELISA
plate was then washed three times with a PBST solution (200 p.l) (1 OmM potassium phosphate, I50 mM
NaCI), pH 7.5, and 0.05% Tween-20. Non-specific binding was then blocked by addition of BSA-PBS ( 1 bovine serum in PBS buffer (1 OmM K;P04, 150 mM NaCI, pH 7.5)) (200 m/well) for a period of 90 minutes. To this, a dilution of negative controls (normal mouse serum) and a sample diluted in BSA-PBS (Mab 4G1, SDS or 6C12) were added and then the ELISA plate was incubated for 1 . hour at room temperature. After incubation, the ELISA plate was then washed with PBST three times. Next, HRP-conjugated anti-mouse IgG secondary antibody (Peroxidase (HRP) conjugated Rabbit Anti-Mouse IgG (H+L), Jackson Laboratories #315-035-045) was added and the plate was incubated at room temperature for 30 minutes. The ELISA plate was then washed again three times with PBST solution (200 ml). An ABTS-peroxide substrate was then added to the wells (ABTS diluted in 0.1 M Na-citrate, pHS; diluted immediately before assay use lml to lOml with Na citrate buffer + 2 ~ 1 30% hydrogen peroxide) and then the plate was al lowed to incubate in the dark for 30 minutes. The absorbance was then read with a micro plate reader at 405 nm at and 60 minutes.
These analyses demonstrated the specificity of the monoclonal antibodies for domain III
25 of the larninin S y2 chain. Epitope mapping of the epitopes recognized by Mab 4G1, SDS or 6C12 indicated that they each bound epitopes within the amino acid sequence of SEQ ID N0:6 (which is a portion of domain III of the y2 chain that lacks part of the amino and carboxy terminal portions of domain III), and did not bind to epitopes within the amino acid sequence of SEQ ID NOS: 9 and 10 (the 9 amino terminal and 41 carboxy terminal amino acids of domain 30 III, respectively).

Monoclonal antibodies against the y2 chain of laminin-5 were then tested for efficacy in inhibiting tumor cell growth in laminin-5 secreting tumors.
Study 1: Tufno~ Growth i~r Imtnunosupp~essed Mice The following study demonstrates the ability of IgG immunogloben against human laminin-5, y2-III-domain (Mab 5D5) to affect the number and size of metastases in immune deficient mice.
106 human squamous epithelial carcinoma cells were injected into the tail vein of immunosuppressed mice for tumor implantation. The cell lines used were human squamous epithelial carcinoma cells, cell line A431 and HSC-3. The cells were provided in suspensions in a medium containing DMEM-glutamax, I% penicillin-streptomycin, 1% Na-pyruvate, 5% FCS.
The cells were re-suspended in sterile Ca and Mg free PBS for inoculation. A
control cell count was performed for the cell suspension at arrival and the cell density and the injected volume was recorded. The origin ofthe cells is HSC-3: Japan Health Science Research Resources Bank, JCRB 0623 A431: ATCC catalog number CRL-1555. The immunosuppressed mice were selected as they are susceptible to grow cells of human origin as is well known in the held. The tumor cells in groups 3 and 6 were injected into mice with test item (test item was 50 ~g/mI) for tumor implantation. The tumor cells were allowed to grow for one week after which the animal received intravenous injections of the test item twice a week for four weeks.
Table 1. Study Layout Group Mouse Strain Animal Cell Treatment Number Line 1 Balb/c~nudet5 1-5 - -control, no treatment 2 Balb/c-nude5 6-10 HSC-3 +control, no treatment 3 Balb/c-nude'S 1 1-15 HSC-3 Test item treatment: 50 pg 5D5Umouse injection 4 SC1D 5 21-25 - -control, no treatment 5 SCID~ 5 26-30 A431 +control, no test item 6 SCIDZ 5 31-35 A431 Test item treatment: 50 ~Lg 5D5/mouse injection ~amic-nuae ~r~HLtsic.vtsom-nu, M~'cti A/5, Denmark) '' Fox Chase Scid (C.B-17/Icr scid/scid, M&B A/S, Denmark) immunodeficient mice.

After the treatment period, the animals were killed and tissue samples were collected.
Number and size of the tumors in different tissues were counted and compared.
Test Items acrd Dosing Solzctioyas The test item was IgG immunoglobin against human laminin-5, y2-III-domain (Mab SDS). The test item was produced with monoclonal hybridoma method i~ vitro as set forth above. The test item (Mab SDS) was suspended in sterile phosphate buffered saline (PBS) with a concentration of 1 mg/ml. The vehicle was sterilized using a 0.2 um filter.
The delivered test item was diluted with sterile PBS 50:50 to give a dosing concentration of 500 ~g/ml.
The test item was administered intravenously into the lateral tail vein of the immunosuppressed mice in a volume of 0.1 ml/animal. The dosing was twice a week on Mondays and Thursdays. The first dose of test item was administered one week after the induction of experimental metastasis.
After four weeks of treatment (eight doses of test item), the animals were killed by exsanguination with cardiac puncture in COZ anesthesia. Blood was collected and serum separated and frozen in -20° C. A gross necropsy was performed and the macroscopic signs were recorded with special attention to macroscopic tumor masses, which were calculated and measured if possible. The following organs/tissues were collected and weighed:
lungs, lymph nodes (cervical and mesenerial), liver, and spleen. The organs/tissues were rinsed in PBS and fixed in 4% phosphate buffered formalin.
Clinical Sigrrs Animal number 6 had a thickening of the tail from day 5 through the whole study. The tail of animal number 1 1 turned dark/black after tumor cell inoculation and eventually turned necrotic. Half of the tail was missing from day 7 onward. No other treatment related clinical signs were recorded. One animal (number 8, group 2) was found dead on the morning of the day following tumor cell inoculation. Gross necropsy did not reveal any macroscopic changes. All other animals survived in good condition during the whole study.
JO
Necropsy The injected tumor cells induced tumor growth almost only in the lungs. Other tissues with macroscopic metastases include spleen, liver, small intestine, and preputial gland. The SCID mice had changes in the liver which might be of microbial origin. In the lungs, the metastases were so numerous and so small that it was impractical to calculate or measure individual metastases.
The following Table 2 represents a summarization of the results of the nice treated from Table 1.
Table 2. Experimental Metastases in Lung Group Mouse N Cell Treatment Number of Mice Strain Line with Macroscopic Lung Metastases Observed 1 Balb/c-nude5 -control, no treatment 2~ BaIb/c-nude5 HSC-3 + control, no treatment4/4 (full of mastastases) 3 Balb/c-nude5 HSC-3 Test item treatmentI/5 4 SCID ~ 5 -control, no treatment 5 SCID 5 A431 +control, no test 3/5 item 6 SCID 5' A431 Test item treatment4/5 * one mouse was dead at the end of the second study As can be seen from Table 2 above, the treated Balb/c-nude mice had 1 of 5 mice with macroscopic lung metastases while 4 of 4 untreated control Balb/c-nude mice had macroscopic lung metastases.

Monoclonal antibody SDS was tested against HT29 carcinomas in a tumor growth inhibition assay. The assay compared immunotherapy with 75 and 25 ~g/mouse SDS, qod x 15, to conventional chemotherapy with 100 mg/kg CPT-1 1 (irinotecan/Campostar), qwk x 3.
Methods aid Mates°ials Female nude athymic mice (Harlan) were 13 weeks of age on day I of the study.
The animals were fed ad libiturN water (reverse osmosis, I ppm C1) and the NIH 31 Modified and Irradiated Lab Diet~ consisting of 18.0% protein, 5.0% fat, and 5.0% fiber.
Mice were housed in static microisolators on a 12-hour light cycle at 21-22 ° C (70-72 ° F) and 40%-60% humidity.
Tumoi° Inzpla~ttation An HT29 carcinoma fragment (1 mm3) was implanted subcutaneously in the flank region of each mouse. When the tumors reached a size ranging from 62.5-126 mg, the mice were sorted into five treatment groups to provide a group mean tumor weights of 84.2-85.5 mg.
Estimated tumor weight was calculated using the formula:
w' x 1 Tumor Weight (mg) = 2 Where v~ = width and l = length in mm of the HT29 carcinoma.
Dosing solutions of SD5 and control IgG were prepared fresh daily by dilution with phosphate-buffered saline. CPT-11 (Pharmacia; 20 mg/mL) was diluted with saline on each day of dosing.
On day 1, mice were sorted into five groups of animals (n = 10/group), and dosing was initiated according to the protocols listed in Table 3.
Table 3. Protocol Design for the HT29-e29 Study Group n Treatment Regimen I

Agent mg/kg Route Schedule I 10 No n/a treatment.

2 10 CPT-11 100 IP Qwkx3 10 Control 75 ug/ mouse I V Qod x I
1gG 5 4 10 5D5 75 ug/ mouse IV Qod x I

5 10 5D5 25 ug/ mouse IV Qod x I
5~

As a positive reference drug, CPT- 1 1 was administered once per week for three weeks (qwk x 3) in 100 mg/kg doses. CPT- I 1 was delivered ~i.p. in volumes of 0.2 ml/20 g body weight, which were body-weight adjusted. Doses of SDS or control mouse 1gG
Were delivered intravenously in volumes of 0.2 mL/mouse. The antibody doses were not body-weight adjusted.
Untreated Group I mice served as controls for the CPT-1 1 therapy. Group 3 mice received i ~
p.g/mouse doses of control 1gG once daily on alternate days (qod x I5). Mice in groups 4 and 5 received 75 and 25 uglmouse doses of SDS x I5, respectively.
Endzaoi~t Efficacy was evaluated in a tumor growth inhibition assay. Tumors were measured twice weekly until the study was terminated on day 31. Each animal was then euthanized and its HT29 carcincoma was excised and weighed. Treatment may produce complete tumor regression (CR) or partial tumor regression (PR) in an animal. In a CR response, there is no measurable tumor mass at the completion of the study. In a PR response, the tumor weight is lower than the weight on day, but greater than 0 mg. All tumors that did not regress were included in the calculation of tumor growth inhibition.
The increase in tumor weight for each animal was calculated as the difference between the actual tumor weight at the end of the study and the calculated tumor weight on day 1. These values were used to calculate the group mean tumor weight increases. Tumor growth inhibition was calculated from the group mean tumor weight increases of treated and control mice by the following equation:
d TGI = [~ - ( MeanNetTum v~Wei~ht Treated ) I x I 00 MeanNet Tu~~~ or Weight control Toxicity The mice were weighed twice weekly until the end of the study. They were examined frequently for clinical signs of any adverse, drug-related side effects.
Acceptable toxicity for cancer drugs in mice is defined by the NCI as a mean group weight loss of less than 20% during the test, and not more than one toxic death among ten treated animals.

Statistics ar?cl Graphical Ar~alyse.s The unpaired t-test and Mann-Whitney U-test (for analysis of means and medians, respectively) were used to determine the statistical significance of the difference in mean tumor weights for mice in a treatment group and mice in a control group. The two-tailed statistical analyses were conducted at P = 0.05.
Results E~cacy: Growth of HT29 Colon Carcinomas irr Control Mice Treatment protocols are listed in Table 3. Group I mice received no treatyent and served as controls for CPT-1 I and SD5 therapy. Group 3 mice received fifteen 75 ~tg/mouse doses of irrelevant mouse lgG on alternate days (qod x 15). Table 4 summarizes the results for all groups in the study. The mean values for actual day 31 tumor weights in untreated and 1gG-reated mice are 640.0 and 696.2 mg, respectively.
Table 4. Treatment Response Summary for the HT29-e28 Study Regimen Final TumorTumor# Mean # Max. #
l Weight % % Death Mean ~ SEM GrowthCP TumorCR BW
(n) Inhibitio Decrease Loss n Day TR

Agent mg/kgRouteSchedule TR NT

R

) 1 No n/a 640.0 ~ D% 0 None (7 -0.4%:0 0 i) 124.9 mg ( 10) treannent Day 2 10CPT-1 l00 IP Qwk 447.9 f 34.7%0 None (1 -s.8%:0 0 1 x 91.8 mg( 3 l0) Day4 3 IOControl75 IV Qod 696:? ~ 0% 0. None 0 -3.6%;0 0 Igg )tgl x 131.4 mg I~ ( 1 D) mouse Day 4 10SDS 75~gJIV Qod 543.5 ~ 17.8% None 0 ?.D%;0 0 x 149.3 mg IS (8) mouse Day 10SDS 25NgJIV Qod 700.7f I 0% 0 None 0 -I 0 0 x 16.1 mg( .2%;
IS 10) -mouse Dav4 RespoJ~se of HT29 ~.'e~ographs to Irztraperito>?eal CPT 1 1 Therapy Group 2 mice were treated once weekly for three weeks (qwk x 3) with i.p.
injections' of 100 mg/lcg CPT-11 (Table 3). No tumors regressed in response to CPT-11. The final mean tumor weight in Group 3 mice was 447.9 mg (Table 4). Group 2 mice experienced 34.7%
tumor growth inhibition, relative to the untreated mice. This result, which is illustrated in a bar graph in FIGURE
3, was not statistically significant (P = 0.23.1 l, unpaired two-tailed t-test). FIGURES 4A-E shows the growth of individual tumors in all treatment groups, as calculated from caliper measurements.
CPT-1 1 treatment caused a decrease in the slope of tumor growth.
Response of HT29 XeJ~ogf°afts to Ihtrave~rous ~D~
In7n~zr>7otherapy SD5 was administered intravenously to mice in Groups 4 and 5 on the qod x 15 schedule at 75 and 25 ug/mouse, respectively (Table 3). No tumor regressions were observed. The 75 and 25 I S ~g/mg mouse SDS treatments yielded final actual mean tumor weights of 543.5 and 700.7, respectively (Table 4). The high dose of SDS inhibited HT29 carcinoma growth by 17.8%, relative to tumor growth in untreated mice. Tumor growth inhibition in Group 4 mice, relative to untreated and 1gG-treated mice, was not statistically significant (P = 0.6241 and 0.453, respectively; t-test).
Group 5 mice experienced no inhibition of tumor growth. FIGURE 3 illustrates the lack of significant tumor growth inhibition, given the large error (SEMI bars. FIGURES
4 A-E shows that there was a modest decrease in the slopes of the tumor growth curves in animals treated with 75 ug/mouse SDS.
Side Ef fect.3~
All therapies were well tolerated. The highest group mean body-weight loss, an acceptable 5.8%, was recorded in mice treated with CPT-1 1. Body weight losses in antibody-treated mice Were 3.6% or lower.
Discussion The HT29 colon carcinoma xenograft model was appropriate for SDS evaluation because HT29 cells produce laminin. Growth of primary tumors can be impeded by anti-proliferative agents.
such as CPT-11, as well as by agents that prevent invasion of the substratum.
Combinational treatments using monoclonal antibodies against the y2 chain of laminin-5, such as 5D5, with anti-proliferative agents such as CPT-l l are also contemplated as part of the invention. Treatment efficacy was based on tumor growth inhibition, i.e., the difference between the mean increase in tumor size in control and treated groups of animals during the 31-day study.
Although there was no response to 5D5 at a dose of 25 ~g/mouse, tumor growth was inhibited by 17.$%
at 75 ~glmouse (Table 4 and FIGURE 3). Thus, a 75 ug/mouse dose of 5D5 produced some therapeutic effect against HT29 colon carcinomas. In general, there was a reduction in the slopes of the tumor growth curves in mice treated with CPT-I I and 5D5 (FIGURES 4A-E). Accordingly, these results indicate that anti-laminin immunotherapy has application in cancer treatment of laminin-5 secreting tumors.
in summary, established HT29 colon carcinomas responded to therapy with 75 ~ug/mouse doses of SDS. High dose SD5 immunotherapy achieved 50% of the tumor growth inhibition that was produced by CPT-1 1 chemotherapy. The tumor growth shown in FIGURES 4A-E
curves suggest that'SD5 immunotherapy can impair colon tumor growth at doses of 75 pg/mouse or higher.
Those skilled in the art will know, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein.
These and all other equivalents are intended to be encompassed by the following claims.

SEQUENCE LISTING
<110> Tryggvason, Karl Salo, Sirpa <120> Use of antibodies to the gamma 2 chain of laminin 5 to inhibit tumor growth and metastasis <130> 02-1147-PCT
<150> 60/422,009 <151> 2002-10-29 <160> 10 <170> PatentIn version 3.1 <210> 1 <211> 5200 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (118)..(3699) <223>
<220>
<221> sig peptide <222> (118)..(183) <223>
<400> 1 gaccacctga tcgaaggaaa aggaaggcac agcggagcgc agagtgagaa ccaccaaccg 60 aggcgccggg cagcgacccc tgcagcggag acagagactg agcggcccgg caccgcc 117 atg cct gcg ctc tgg ctg ggc tgc tgc ctc tgc ttc tcg ctc ctc ctg 165 Met Pro Ala Leu Trp Leu Gly Cys Cys Leu Cys Phe Ser Leu Leu Leu ccc gca gcc cgg gcc acc tcc agg agg gaa gtc tgt gat tgc aat ggg 213 Pro Ala Ala Arg Ala Thr Ser Arg Arg Glu Val Cys Asp Cys Asn Gly aag tcc agg cag tgt atc ttt gat cgg gaa ctt cac aga caa act ggt 261 Lys Ser Arg Gln Cys Ile Phe Asp Arg Glu Leu His Arg Gln Thr Gly aat gga ttc cgc tgc ctc aac tgc aat gac aac act gat ggc att cac 309 Asn Gly Phe Arg Cys Leu Asn Cys Asn Asp Asn Thr Asp Gly Ile His tgc gag aag tgc aag aat ggc ttt tac cgg cac aga gaa agg gac cgc 357 Cys Glu Lys Cys Lys Asn Gly Phe Tyr Arg His Arg Glu Arg Asp Arg tgt ttg ccc tgc aat tgt aac tcc aaa ggt tct ctt agt get cga tgt 405 Cys Leu Pro Cys Asn Cys Asn Ser Lys Gly Ser Leu Sex Ala Arg Cys gac aac tct gga cgg tgc agc tgt aaa cca ggt gtg aca gga gcc aga 453 Asp Asn Ser Gly Arg Cys Ser Cys Lys Pro Gly Val Thr Gly Ala Arg tgc gaccgatgt ctgcca ggcttccac atgctcacg gatgcgggg tgc 501 Cys AspArgCys LeuPro GlyPheHis MetLeuThr AspAlaGly Cys acc caagaccag agactg ctagactcc aagtgtgac tgtgaccca get 549 Thr GlnAspGln ArgLeu LeuAspSer LysCysAsp CysAspPro A1a ggc atcgcaggg ccctgt gacgcg'ggccgctgtgtc tgcaagcca get 597 Gly IleAlaGly ProCys AspAlaGly ArgCysVal CysLysPro Ala gtt actggagaa cgctgt gataggtgt cgatcaggt tactataat ctg 645 Val ThrGlyGlu ArgCys AspArgCys ArgSexGly TyrTyrAsn Leu gat ggggggaac cctgag ggctgtacc cagtgtttc tgctatggg cat 693 Asp GlyGlyAsn ProGlu GlyCysThr GlnCysPhe CysTyrGly His tca gccagctgc cgcagc tctgcagaa tacagtgtc cataagatc acc 741 Ser AlaSerCys ArgSer SexAlaGlu TyrSerVal HisLysIle Thr tct acctttcat caagat gttgatggc tggaagget gtccaacga aat 789 Ser ThrPheHis G1nAsp ValAspGly TrpLysAla ValGlnArg Asn ggg tctcctgca aagctc caatggtca cagcgccat caagatgtg ttt 837 Gly SerProAla LysLeu G1nTrpSer GlnArgHis GlnAspVal Phe agc tcagcccaa cgacta gatcctgtc tattttgtg gotcctgcc aaa 885 Ser SerAlaGln AxgLeu AspProVal TyrPheVal AlaProAla Lys ttt cttgggaat caacag gtgagctat gggcaaagc ctgtccttt gac 933 Phe LeuGlyAsn GlnGln ValSerTyr G1yGlnSer LeuSerPhe Asp tac cgtgtggac agagga ggcagacac ccatetgcc catgatgtg atc 981 Tyr ArgValAsp AxgGly G1yArgHis ProSerAla HisAspVal Ile c,tg gaaggtget ggtcta cggatcaca getcccttg atgccactt ggc 1029 Leu G1uGlyAla G1yLeu ArgIleThr AlaProLeu MetProLeu Gly aag acactgcct tgtggg ctcaccaag acttacaca ttcaggtta aat 1077 Lys ThrLeuPro CysGly LeuThrLys ThrTyrThr PheArgLeu Asn gag catccaagc aataat tggagcccc cagctgagt tactttgag tat 1125 Glu HisProSer AsnAsn TrpSerPro GlnLeuSer TyrPheGlu Tyr cga aggttactg cggaat ctcacagcc ctccgcatc cgagetaca tat 1173 Arg ArgLeuLeu ArgAsn LeuThrAla LeuArgIle AxgAlaThr Tyr gga gaatacagt actggg tacattgac aatgtgacc ctgatttca gcc 1221 Gly Glu Tyr Ser Thr Gly Tyr Ile Asp Asn Val Thr Leu Ile Ser Ala cgc cct gtc tct gga gcc cca gca ccc tgg gtt gaa cag tgt ata tgt 1269 Arg Pro Val Ser Gly Ala Pro Ala Pro Trp Val Glu Gln Cys Ile Cys cct gtt ggg tac aag ggg caa ttc tgc cag gat tgt get tct ggc tac 1317 Pro Val Gly Tyr Lys Gly Gln Phe Cys Gln Asp Cys Ala Ser Gly Tyr aagagagat tcagcgaga ctggggcct tttggcacc tgtattcct tgt 1365 LysArgAsp SerAlaArg LeuGlyPro PheGlyThr CysIlePro Cys aactgtcaa gggggaggg gcctgtgat ccagacaca ggagattgt tat 1413 AsnCysGln GlyGlyGly AlaCysAsp ProAspThr GlyAspCys Tyr tcaggggat gagaatcct gacattgag tgtgetgac tgcccaatt ggt 1461 SerGlyAsp GluAsnPro AspIleGlu CysAlaAsp CysProIle Gly ttctacaac gatccgcac gacccccgc agctgcaag ccatgtccc tgt 1509 PheTyrAsn AspProHis AspProArg SerCysLys ProCysPro Cys cataacggg ttcagctgc tcagtgatt ccggagacg gaggaggtg gtg 1557 HisAsnGly PheSerCys SerValIle ProGluThr GluGluVal Val tgc aat aac tgc cot ccc ggg gtc acc ggt gcc cgc tgt gag ctc tgt 1605 Cys Asn Asn Cys Pro Pro Gly Val Thr Gly Ala Arg Cys Glu Leu Cys get gat ggc tac ttt ggg gac ccc ttt ggt gaa cat ggc cca gtg agg 1653 Ala Asp Gly Tyr Phe Gly Asp Pro Phe Gly Glu His Gly Pro Val Arg cct tgt cag ccc tgt caa t~gc aac agc aat gtg gac ccc agt gcc tct 1701 Pro Cys Gln Pro Cys Gln Cys Asn Ser Asn Val Asp Pro Ser A1a Ser ggg aat tgt gac cgg ctg aca ggc agg tgt ttg aag tgt atc cac aac 1749 Gly Asn Cys Asp Arg Leu Thr Gly Arg Cys Leu Lys Cys Ile His Asn aca gcc ggc atc tac tgc gac cag tgc aaa gca ggc tac ttc ggg gac 1797 Thr Ala Gly Ile Tyr Cys Asp Gln Cys Lys Ala Gly Tyr Phe Gly Asp cca ttg get ccc aac cca gca gac aag tgt cga get tgc aac tgt aac 1845 Pro Leu A1a Pro Asn Pro Ala Asp Lys Cys Arg Ala Cys Asn Cys Asn ccc atg ggc tca gag cct gta gga tgt cga agt gat ggc acc tgt gtt 1893 Pro Met Gly Ser Glu Pro Val Gly Cys Arg Ser Asp Gly Thr Cys Val tgc aag cca gga ttt ggt ggc ccc aac tgt gag cat gga gca ttc agc 1941 Cys Lys Pro Gly Phe Gly Gly Pro Asn Cys Glu His Gly Ala Phe Ser tgtccaget tgctat aatcaagtg aagattcag atggatcag tttatg 1989 CysProAla CysTyr AsnGlnVal LysIleGln MetAspGln PheMet cagcagctt cagaga atggaggcc ctgatttca aaggetcag ggtggt 2037 GlnGlnLeu GlnArg MetGluAla LeuTleSer LysAlaGln GlyGly gatggagta gtacct gatacagag ctggaaggc aggatgcag cagget 2085 AspGlyVal ValPro AspThrGlu LeuGluGly ArgMetGln GlnAla gagcaggcc cttcag gacattctg agagatgcc cagatttca gaaggt 2133 GluGlnAla LeuGln AspIleLeu ArgAspAla GlnIleSer GluGly getagcaga tccctt ggtctccag ttggccaag gtgaggagc caagag 2181 AlaSerArg SerLeu GlyLeuGln LeuAlaLys ValArgSer GlnGlu aacagctac cagagc cgcctggat gacctcaag atgactgtg gaaaga 2229 AsnSerTyr GlnSer ArgLeuAsp AspLeuLys MetThrVal GluArg gttcggget ctggga agtcagtac cagaaccgagtt cgggatact cac 2277 ValArgAla LeuGly SerGlnTyr GlnAsnArgVal ArgAspThr His aggctcatc actcag atgcagctg agcctggcagaa agtgaaget tcc 2325 ArgLeuIle ThrGln MetGlnLeu SerLeuAlaGlu SerGluAla Ser ttgggaaac actaac attcctgcc tcagaccactac gtggggcca aat 2373 LeuGlyAsn ThrAsn IleProAla SerAspHisTyr ValGlyPro Asn ggctttaaa agtctg getcaggag gccacaagatta gcagaaagc cac 2421 GlyPheLys SerLeu AlaGlnGlu AlaThrArgLeu AlaGluSer His gttgagtca gccagt aacatggag caactgacaagg gaaactgag gac 2469 ValGluSex A1aSer AsnMetGlu GlnLeuThrArg GluThrGlu Asp tattcc aaacaagcc ctctcactg gtgcgcaag gccctgcat gaagga 2517 TyrSer LysGlnAla LeuSerLeu ValArgLys AlaLeuHis GluGly gtcgga agcggaagc ggtagcccg gacggtget gtggtgcaa gggctt 2565 ValGly SerGlySer GlySerPro AspGlyAla ValValGln GlyLeu gtggaa aaattggag aaaaccaag tccctggcc cagcagttg acaagg 2613 ValGlu LysLeuGlu LysThrLys SerLeuAla GlnGlnLeu ThrArg gaggcc actcaagcg gaaattgaa gcagatagg tottatcag cacagt 2661 GluAla ThrGlnAla GluIleGlu AlaAspArg SerTyrGln HisSer ctccgc ctcctggat tcagtgtct ccgcttcag ggagtcagt gatcag 2709 LeuArg LeuLeuAsp SerValSer ProLeuGln GlyValSer AspGln tcc gcggat tca 2757 ttt cag gtg gaa gaa gca aag agg atc aaa caa aaa Ser AlaAsp Ser Phe Gln Val Glu Glu Ala Lys Arg Ile Lys Gln Lys ctc tca agc ctg gta acc agg cat atg gat gag cgtaca caa 2805 ttc aag Leu Ser Ser Leu Val Thr Arg His Met Asp Glu ArgThr Gln Phe Lys aag aat ctg gga aac tgg aaa gaa gaa gca cag ttacag aat 2853 cag ctc Lys Asn Leu Gly Asn Trp Lys Glu Glu Ala G1n LeuGln Asn Gln Leu gga aaa agt ggg aga gag aaa tca gat cag ctg cgtgcc aat 2901 ctt tcc Gly Lys Ser Gly Arg Glu Lys Ser Asp Gln Leu ArgAla,Asn Leu Ser ctt get aaa agc aga gca caa gaa gca ctg agt aatgcc act 2949 atg ggc Leu Ala Lys Ser Arg Ala Gln Glu Ala Leu Ser AsnAla Thr Met Gly ttt tat gaa gtt gag agc atc ctt aaa aac ctc tttgac ctg 2997 aga gag Phe Tyr Glu Val Glu Ser Ile Leu Lys Asn Leu PheAsp Leu Arg Glu cag gtg gac aac aga aaa gca gaa get gaa gaa aagaga ctc 3045 gcc atg Gln Va1 Asp Asn Arg Lys Ala Glu Ala Glu Glu LysArg Leu Ala Met tcc tac atc agc cag aag gtt tca gat gcc agt acccag caa 3093 gac aag Ser Tyr Ile Ser Gln Lys Val Ser Asp Ala Ser ThrGln Gln Asp Lys gca gaa aga gcc ctg ggg agc get get get gat g gg ca 3141 gca ca a g aag Ala Glu Arg Ala Leu Gly Ser Ala Ala Ala Asp n la Ala Gl Arg Lys A

gg5 1000 10 05 aat ggg gcc ggg gag gcc ctg gaa atc tcc agt attgaa cag 3186 gag Asn Gly A1a Gly Glu Ala Leu Glu Tle Ser Ser IleGlu Gln Glu gag att ggg agt ctg aac ttg gaa gcc aat gtg gcagat gga 3231 aca Glu Ile Gly Ser Leu Asn Leu Glu Ala Asn Val AlaAsp Gly Thr gcc ttg gcc atg gaa aag gga ctg gcc tct ctg agtgag atg 3276 aag Ala Leu Ala Met Glu Lys Gly Leu Ala Ser Leu SerGlu Met Lys agg gaa gtg gaa gga gag ctg gaa agg aag gag gagttt gac 3321 ctg Arg Glu Val Glu Gly Glu Leu Glu Arg Lys Glu GluPhe Asp Leu acg aat atg gat gca gta cag atg gtg att aca gcccag aag 3366 gaa Thr Asn Met Asp Ala Va1 Gln Met Val Ile Thr AlaGln Lys Glu gtt caagac aca 3411 gat acc aga gcc aag aac get ggg gtt aca atc Val GlnAsp Thr Asp Thr Arg Ala Lys Asn Ala Gly Val Thr Ile ctc cagcct ctc 3456 aac aca tta gac ggc ctc ctg cat ctg atg gac Leu GlnPro Leu Asn Thr Leu Asp Gly Leu Leu His Leu Met Asp agt gta gat gaa gag ggg ctg gtc tta ctg gag cag aag ctt tcc 3501 Ser Val Asp Glu Glu Gly Leu Val Leu Leu Glu Gln Lys Leu Ser cga gcc aag acc cag atc aac agc caa ctg cgg ccc atg atg tca 3546 Arg Ala Lys Thr Gln Ile Asn Ser Gln Leu Arg Pro Met Met Ser gag ctg gaa gag agg gca cgt cag cag agg ggc cac ctc cat ttg 3591 Glu Leu Glu Glu Arg Ala Arg Gln Gln Arg Gly His Leu His Leu ctg gag aca agc ata gat ggg att ctg get gat gtg aag aac ttg 3636 Leu Glu Thr Ser Ile Asp Gly Tle Leu Ala Asp Val Lys Asn Leu gag aac att agg gac aac ctg ccc cca ggc tgc tac aat acc cag 3681 G.lu Asn Ile Arg Asp Asn Leu Pro Pro Gly Cys Tyr Asn Thr Gln get ctt gag caa cag tga agctgccata aatatttctc aactgaggtt 3729 Ala Leu Glu Gln Gln cttgggatacagatctcagggctcgggagccatgtcatgtgagtgggtgggatggggaca3789 tttgaacatgtttaatgggtatgctcaggtcaactgacctgaccccattcctgatcccat3849 ggccaggtggttgtcttattgcaccatactccttgcttcctgatgctgggcatgaggcag3909 ataggcactggtgtgagaatgatcaaggatctggaccccaaagatagactggatggaaag3969 acaaactgcacaggcagatgtttgcctcataatagtcgtaagtggagtcctggaatttgg4029 acaagtgctgttgggatatagtcaacttattctttgagtaatgtgactaaaggaaaaaac4089 tttgactttgcccaggcatgaaattcttcctaatgtcagaacagagtgcaacccagtcac4149 actgtggccagtaaaatactattgcctcatattgtcctctgcaagcttcttgctgatcag4209 agttcctcctacttacaacccagggtgtgaacatgttctccattttcaagctggaagaag4269 tgagcagtgt tggagtgaggacctgtaaggcaggcccattcagagctatggtgcttgctg4329 gtgcctgcca ccttcaagttctggacctgggcatgacatcctttcttttaatgatgccat4389 ggcaacttag agattgcatttttattaaagcatttcctaccagcaaagcaaatgttggga4449 aagtatttac tttttcggtttcaaagtgatagaaaagtgtggcttgggcattgaaagagg4509 taaaattctc tagatttattagtcctaattcaatcctacttttcgaacaccaaaaatgat4569 gcgcatcaat gtattttatcttattttctcaatctcctctctctttcctccacccataat4629 aagagaatgt tcctactcacacttcagctgggtcacatccatccctccattcatccttcc4689 atccatcttt ccatccattacctccatccatccttccaacatatatttattgagtaccta4749 ctgtgtgcca ggggctggtg ggacagtggt gacatagtct ctgccctcat agagttgatt 4809 gtctagtgag gaagacaagc atttttaaaa aataaattta aacttacaaa ctttgtttgt 4869 cacaagtggtgtttattgcaataaccgcttggtttgcaacctctttgctcaacagaacat4929 atgttgcaagaccctcccatgggcactgagtttggcaaggatgacagagctctgggttgt4989 gcacatttctttgcattccagcgtcactctgtgccttctacaactgattgcaacagactg5049 ttgagttatgataacaccagtgggaattgctggaggaaccagaggcacttccaccttggc5109 tgggaagactatggtgctgccttgcttctgtatttccttggattttcctgaaagtgtttt5169 taaataaagaacaattgttagatgccaaaaa 5200 <210> 2 <211> 1193 <212> PRT
<213> Homo Sapiens <400> 2 Met Pro Ala Leu Trp Leu G1y Cys Cys Leu Cys Phe Ser Leu Leu Leu Pro Ala Ala Arg Ala Thr Ser Arg Arg Glu Val Cys Asp Cys Asn Gly Lys Ser Arg Gln Cys Ile Phe Asp Arg Glu Leu His Arg Gln Thr Gly Asn Gly Phe Arg Cys Leu Asn Cys Asn Asp Asn Thr Asp G1y Ile His Cys Glu Lys Cys Lys Asn Gly Phe Tyr Arg His Arg Glu Arg Asp Arg Cys Leu Pro Cys Asn Cys Asn Ser Lys Gly Ser Leu Ser Ala Arg Cys Asp Asn Ser Gly Arg Cys Ser Cys Lys Pro Gly Val Thr Gly Ala Arg Cys Asp Arg Cys Leu Pro G1y Phe His Met Leu Thr Asp Ala Gly Cys Thr Gln Asp Gln Arg Leu Leu Asp Ser Lys Cys Asp Cys Asp Pro Ala Gly I1e Ala Gly Pro Cys Asp Ala Gly Arg Cys Val Cys Lys Pro Ala Val Thr Gly Glu Arg Cys Asp Arg Cys Arg Ser Gly Tyr Tyr Asn Leu Asp Gly Gly Asn Pro Glu Gly Cys Thr Gln Cys Phe Cys Tyr Gly His Ser Ala Ser Cys Arg Ser Ser Ala Glu Tyr Ser Val His Lys Ile Thr Ser Thr Phe His Gln Asp Val Asp Gly Trp Lys Ala Val Gln Arg Asn Gly Ser Pro Ala Lys Leu Gln Trp Ser Gln Arg His Gln Asp Val Phe Ser Ser Ala Gln Arg Leu Asp Pro Val Tyr Phe Val Ala Pro Ala Lys Phe Leu Gly Asn Gln Gln Val Ser Tyr Gly Gln Ser Leu Ser Phe Asp Tyr Arg Val Asp Arg Gly Gly Arg His Pro Ser Ala His Asp Val Ile Leu Glu Gly Ala Gly Leu Arg Ile Thr Ala Pro Leu Met Pro Leu Gly Lys Thr Leu Pro Cys Gly Leu Thr Lys Thr Tyr Thr Phe Arg Leu Asn Glu His Pro Ser Asn Asn Trp Ser Pro Gln Leu Ser Tyr Phe Glu Tyr Arg Arg Leu Leu Arg Asn Leu Thr Ala Leu Arg Ile Arg Ala Thr Tyr Gly Glu Tyr Ser Thr Gly Tyr Ile Asp Asn Val Thr Leu I1e Ser Ala Arg Pro Val Ser Gly Ala Pro Ala Pro Trp Val Glu Gln Cys Ile Cys Pro Val Gly Tyr Lys Gly Gln Phe Cys Gln Asp Cys Ala Ser Gly Tyr Lys Arg Asp Ser Ala Arg Leu Gly Pro Phe Gly Thr Cys Ile Pro Cys Asn Cys Gln Gly Gly Gly Ala Cys Asp Pro Asp Thr Gly Asp Cys Tyr Ser Gly Asp Glu Asn Pro Asp I1e Glu Cys Ala Asp Cys Pro Ile Gly Phe Tyr Asn Asp Pro His Asp Pro Arg Ser Cys Lys Pro Cys Pro Cys His Asn Gly Phe Ser Cys Ser Val Ile Pro Glu Thr Glu Glu Val Val Cys Asn Asn Cys Pro Pro Gly Val Thr Gly Ala Arg Cys Glu Leu Cys Ala Asp Gly Tyr Phe G1y Asp Pro Phe Gly Glu His Gly Pro Val Arg Pro Cys Gln Pro Cys Gln Cys Asn Ser Asn Val Asp Pro Ser Ala Ser Gly Asn Cys Asp Arg Leu Thr Gly Arg Cys Leu Lys Cys Ile His Asn Thr A1a Gly Ile Tyr Cys Asp Gln Cys Lys Ala Gly Tyr Phe Gly Asp Pro Leu Ala Pro Asn Pro Ala Asp Lys Cys Arg Ala Cys Asn Cys Asn Pro Met Gly Ser Glu Pro Val G1y Cys Arg Ser Asp Gly Thr Cys Val Cys Lys Pro Gly Phe Gly Gly Pro Asn Cys Glu His Gly Ala Phe Ser Cys Pro Ala Cys Tyr Asn Gln Va1 Lys Tle Gln Met Asp Gln Phe Met G1n Gln Leu Gln Arg Met Glu Ala Leu Ile Ser Lys Ala Gln Gly Gly Asp Gly Val Val Pro Asp Thr Glu Leu Glu Gly Arg Met Gln Gln Ala Glu Gln Ala Leu Gln Asp Ile Leu Arg Asp A1a Gln Ile Ser Glu Gly Ala Ser Arg Ser Leu Gly Leu Gln Leu Ala Lys Val Arg Ser Gln Glu Asn Ser Tyr Gln Ser Arg Leu Asp Asp Leu Lys Met Thr Val Glu Arg Val Arg Ala Leu Gly Ser Gln Tyr Gln Asn Arg Val Arg Asp Thr His Arg Leu Ile Thr Gln Met Gln Leu Ser Leu Ala Glu Ser Glu Ala Ser Leu Gly Asn Thr Asn Ile Pro Ala Ser Asp His Tyr Val Gly Pro Asn Gly Phe Lys Ser Leu Ala Gln Glu Ala Thr Arg Leu Ala G1u Ser His Va1 Glu Ser Ala Ser Asn Met Glu Gln Leu Thr Arg Glu Thr Glu Asp Tyr Ser Lys Gln Ala Leu Ser Leu Val Arg Lys Ala Leu His Glu Gly Val Gly Ser Gly Ser Gly Ser Pro Asp Gly A1a Val Val Gln Gly Leu Val Glu Lys Leu Glu Lys Thr Lys Ser Leu Ala Gln Gln Leu Thr Arg Glu Ala Thr Gln Ala Glu Ile Glu Ala Asp Arg Ser Tyr Gln His Ser Leu Arg Leu Leu Asp Ser Va1 Ser Pro Leu Gln Gly Val Ser Asp Gln Ser Phe Gln Val Glu Glu Ala Lys Arg Ile Lys Gln Lys Ala Asp Sex Leu Ser Ser Leu Val Thr Arg His Met Asp Glu Phe Lys Arg Thr Gln Lys Asn Leu Gly Asn Trp Lys Glu Glu Ala Gln Gln Leu Leu Gln Asn Gly Lys 5er Gly Arg Glu Lys Ser Asp Gln Leu Leu Ser Arg Ala Asn Leu Ala Lys Ser Arg Ala Gln Glu Ala Leu Ser Met Gly Asn Ala Thr Phe Tyr Glu Val Glu Ser Tle Leu Lys Asn Leu Arg Glu Phe Asp Leu Gln Val Asp Asn Arg Lys Ala Glu Ala Glu Glu Ala Met Lys Arg Leu Ser Tyr Ile Ser Gln Lys Val Ser Asp Ala Ser Asp Lys Thr Gln Gln Ala Glu Arg Ala Leu Gly Ser Ala Ala Ala Asp Ala Gln Arg Ala Lys Asn Gly Ala Gly Glu Ala Leu Glu Ile Ser Ser Glu Ile Glu Gln Glu Ile Gly Ser Leu Asn Leu Glu Ala Asn Val Thr Ala Asp Gly Ala Leu A1a Met Glu Lys Gly Leu Ala Ser Leu Lys Ser Glu Met Arg Glu Val Glu Gly Glu Leu Glu Arg Lys Glu Leu G1u Phe Asp Thr Asn Met Asp Ala Val Gln Met Val Ile Thr Glu Ala Gln Lys Val Asp Thr Arg Ala Lys Asn Ala Gly Val Thr Ile Gln Asp Thr Leu Asn Thr Leu Asp Gly Leu Leu His Leu Met Asp Gln Pro Leu Ser Val Asp Glu Glu Gly Leu Val Leu Leu Glu Gln Lys Leu Ser Arg Ala Lys Thr Gln Ile Asn Ser Gln Leu Arg Pro Met Met Sex Glu Leu Glu Glu Arg Ala Arg Gln Gln Arg Gly His Leu His Leu Leu Glu Thr Ser Ile Asp Gly Ile Leu Ala Asp Val Lys Asn Leu Glu Asn Ile Arg Asp Asn Leu Pro Pro Gly Cys Tyr Asn Thr Gln Ala Leu Glu Gln Gln <210> 3 <211> 4316 <212> DNA
<213> Homo Sapiens <220>
<221> sig_peptide <222> (118)..(183) <223>
<220>
<221> CDS
<222> (118)..(3453) <223>
<220>
<22l> repeat_unit <222> (4021) .(4310 <223>
<220>
<221> polyA site <222> (4296) .. (4316) <223>
<400> 3 gaccacc tga tcgaaggaaa agagtgagaa ccaccaaccg aggaaggcac agcggagcgc aggcgccggg cagcgacccc agcggcccgg caccgcc tgcagcggag acagagactg atgcctgcg ctctgg ctgggctgc tgcctctgc ttctcgctcctc ctg 165 MetProAla LeuTrp LeuGlyCys CysLeuCys PheSerLeuLeu Leu cccgcagcc cgggcc acctccagg agggaagtc tgtgattgcaat ggg 213 ProAlaAla ArgAla ThrSerArg ArgGluVal CysAspCysAsn Gly aagtccagg cagtgt atctttgat cgggaactt cacagacaaact ggt 261 LysSerArg GlnCys IlePheAsp ArgGluLeu HisArgGlnThr Gly aatggattc cgctgc ctcaactgc aatgacaac actgatggcatt cac 309 AsnG1yPhe ArgCys LeuAsnCys AsnAspAsn ThrAspGlyIle His tgcgagaag tgcaag aatggcttt taccggcac agagaaagggac cgc 357 CysGluLys CysLys AsnGlyPhe TyrArgHis ArgGluArgAsp Arg tgtttgccc tgcaat tgtaactcc aaaggttct cttagtgetcga tgt 405 CysLeuPro CysAsn CysAsnSer LysGlySer LeuSerAlaArg Cys gacaac tctggacgg tgcagctgt aaaccaggt gtgaca ggagccaga 453 AspAsn SerGlyArg CysSerCys LysProGly ValThr GlyAlaArg tgcgac cgatgtctg ccaggcttc cacatgctc acggat gcggggtgc 501 CysAsp ArgCysLeu ProGlyPhe HisMetLeu ThrAsp A1aGlyCys acccaa gaccagaga ctgctagac tccaagtgt gactgt gacccaget 549 ThrGln AspGlnArg LeuLeuAsp SerLysCys AspCys AspProAla 130 135 l40 ggcatc gcagggccc tgtgacgcg ggccgctgt gtctgc aagccaget 597 GlyIle AlaGlyPro CysAspAla GlyArgCys ValCys LysProAla gttact ggagaacgc tgtgatagg tgtcgatca ggttac tataatctg 645 ValThr GlyGluArg CysAspArg CysArgSer GlyTyr TyrAsnLeu gatggg gggaaccct gagggctgt acccagtgt ttctgc tatgggcat 693 AspGly GlyAsnPro GluGlyCys ThrGlnCys PheCys TyrGlyHis tcagcc agctgccgc agctctgca gaatacagt gtccat aagatcacc 741 SerAla SerCysArg SerSerAla GluTyrSer ValHis LysIleThr tctacc tttcatcaa gatgttgat ggctggaag getgtc caacgaaat 789 SerThr PheHisGln AspValAsp GlyTrpLys AlaVal GlnArgAsn gggtct cctgcaaag ctccaatgg tcacagcgc catcaa gatgtgttt 837 GlySer ProAlaLys LeuGlnTrp SerGlnArg HisGln AspValPhe agctca gcccaacga ctagatcct gtctatttt gtgget cctgccaaa 885 SerSer AlaGlnArg LeuAspPro ValTyrPhe ValAla ProAlaLys tttctt gggaatcaa caggtgagc tatgggcaa agcctg tcctttgac 933 PheLeu GlyAsnGln GlnValSer TyrGlyGln SerLeu SerPheAsp taccgt gtggacaga ggaggcaga cacccatct gcccat gatgtgatc 981 TyrArg ValAspArg GlyGlyArg HisProSer AlaHis AspValIle ctggaa ggtgetggt ctacggatc acagetccc ttgatg ccacttggc 1029 LeuGlu GlyAlaGly LeuArgIle ThrAlaPro LeuMet ProLeuGly aagaca ctgccttgt gggctcacc aagacttac acattc aggttaaat 1077 LysThr LeuProCys GlyLeuThr LysThrTyr ThrPhe ArgLeuAsn gagcat ccaagcaat aattggagc ccccagctg agttac tttgagtat 1125 GluHis ProSerAsn AsnTrpSer ProGlnLeu SerTyr PheGluTyr cgaagg ttactgcgg aatctcaca gccctccgc atccga getacatat 1173 ArgArg LeuLeuArg AsnLeuThr AlaLeuArg IleArg AlaThrTyr ggagaatac agtactggg tacattgac aatgtgacc ctgatttca gcc 1221 GlyGluTyr SerThrGly TyrTleAsp AsnValThr LeuIleSer Ala cgccctgtc tctggagcc ccagcaccc tgggttgaa cagtgtata tgt 1269 ArgProVal SerGlyAla ProAlaPro TrpValGlu GlnCysIle Cys cctgttggg tacaagggg caattctgc caggattgt gettctggc tac 1317 ProValGly TyrLysGly GlnPheCys GlnAspCys AlaSerGly Tyr aagagagat tcagcgaga ctggggcct tttggcacc tgtattcct tgt 1365 LysArgAsp SerAlaArg LeuG1yPro PheGlyThr CysIlePro Cys aactgtcaa gggggaggg gcctgtgat ccagacaca ggagattgt tat 1413 AsnCysGln GlyGlyGly AlaCysAsp ProAspThr GlyAspCys Tyr .

tcagggcjatgagaatcct gacattgag tgtgetgac tgcccaatt ggt 1461 SerGlyAsp GluAsnPro AspIleGlu CysAlaAsp CysProIle Gly ttctacaac gatccgcac gacccccgc agctgcaag ccatgtccc tgt 1509 PheTyrAsn AspProHis AspProArg SerCysLys ProCysPro Cys cataacggg ttcagctgc tcagtgatt ccggagacg gaggaggtg gtg 1557 HisAsnGly PheSerCys SerValIle ProGluThr GluGluVal Val tgcaataac tgccctccc ggggtcacc ggtgcccgc tgtgagctc tgt 1605 CysAsnAsn CysProPro GlyValThr GlyAlaArg CysGluLeu Cys getgatggc tactttggg gaccccttt ggtgaacat ggcccagtg agg 1653 AlaAspGly TyrPheGly AspProPhe G1yGluHis GlyProVal Arg ccttgtcag ccctgtcaa tgcaacagc aatgtggac cccagtgcc tct 1701 ProCysGln ProCysGln CysAsnSer AsnValAsp ProSerAla Ser gggaattgt gaccggctg acaggcagg tgtttgaag tgtatccac aac 1749 GlyAsnCys AspArgLeu ThrGlyArg CysLeuLys CysT1eHis Asn acagccggc atctactgc gaccagtgc aaagcaggc tacttcggg gac 1797 ThrAlaGly IleTyrCys AspGlnCys LysAlaGly TyrPheGly Asp ccattgget cccaaccca gcagacaag tgtcgaget tgcaactgt aac 1845 ProLeuAla ProAsnPro AlaAspLys CysArgAla CysAsnCys Asn cccatgggc tcagagcct gtaggatgt cgaagtgat ggcacctgt gtt 1893 ProMetGly SerGluPro ValGlyCys ArgSerAsp GlyThrCys Val tgcaagcca ggatttggt ggccccaac tgtgagcat ggagcattc agc 1941 Cys Lys Pro Gly Phe Gly Gly Pro Asn Cys Glu His Gly Ala Phe Ser tgtccagettgctat aatcaagtg aagattcag atggat cagtttatg 1989 CysProAlaCysTyr AsnGlnVal LysIleGln MetAsp GlnPheMet cagcagcttcagaga atggaggcc ctgatttca aagget cagggtggt 2037 GlnGlnLeuGlnArg MetGluAla LeuIleSer LysAla GlnGlyGly gatggagtagtacct gatacagag ctggaaggc aggatg cagcagget 2085 AspGlyValValPro AspThrGlu LeuGluGly ArgMet GlnGlnAla gagcaggcccttcag gacattctg agagatgcc cagatt tcagaaggt 2133 GluGlnAlaLeuGln AspIleLeu ArgAspAla GlnIle SerGluGly getagcagatccctt ggtctccag ttggccaag gtgagg agccaagag 2181 AlaSexArgSerLeu GlyLeuGln LeuAlaLys ValArg SerGlnGlu aacagctaccagagc cgcctggat gacctcaag atgact gtggaaaga 2229 AsnSerTyrGlnSer ArgLeuAsp AspLeuLys MetThr ValGluArg gttcgggetctggga agtcagtac cagaaccga gttcgggat actcac 2277 Va1ArgAlaLeuGly SerGlnTyr GlnAsnArg ValArgAsp ThrHis aggctcatcactcag atgcagctg agcctggca gaaagtgaa gettcc 2325 ArgLeuIleThrGln MetGlnLeu SerLeuAla GluSerGlu AlaSer ttgggaaacactaac attcctgcc tcagaccac tacgtgggg ccaaat 2373 LeuGlyAsnThrAsn IleProAla SerAspHis TyrValGly ProAsn ggctttaaa~agtctg getcaggag gccacaaga ttagcagaa agccac 2421 GlyPheLysSexLeu AlaGlnGlu AlaThrArg LeuAlaGlu SerHis gttgagtcagccagt aacatggag caactgaca agggaaact gaggac 2469 ValGluSerAlaSer AsnMetG1u GlnLeuThr ArgG1uThr GluAsp tattcc aaacadgcc ctctca ctggtgcgcaag gccctgcat gaagga 2517 TyrSer LysGlnAla LeuSer LeuValArgLys AlaLeuHis GluGly gtcgga agcggaagc ggtagc ccggacggtget gtggtgcaa gggctt 2565 ValGly SerGlySer GlySer ProAspGlyAla ValValGln G1yLeu gtggaa aaattggag aaaacc aagtccctggcc cagcagttg acaagg 2613 ValGlu LysLeuGlu LysThr LysSerLeuAla GlnGlnLeu ThrArg gaggcc actcaagcg gaaatt gaagcagatagg tcttatcag cacagt 2661 GluAla ThrGlnAla GluIle GluAlaAspArg SerTyrGln HisSer ctccgcctc ctg tca gtg tct ccg ctt cag agt gatcag 2709 gat gga gtc LeuArgLeu Leu Ser Val Ser Pro Leu Gln Ser AspGln Asp Gly Val tcctttcag gtg gaa gca aag agg atc aaa gcg gattca 2757 gaa caa aaa SerPheGln Val Glu Ala Lys Arg Ile Lys Ala AspSer Glu Gln Lys ctctcaagc ctg acc agg cat atg gat gag cgt acacaa 2805 gta ttc aag LeuSerSer Leu Thr Arg His Met Asp Glu Arg ThrGln Val Phe Lys aagaatctg gga tgg aaa gaa gaa gca cag tta cagaat 2853 aac cag ctc LysAsnLeu Gly Trp Lys Glu G1u Ala Gln Leu GlnAsn Asn Gln Leu ggaaaaagt ggg gag aaa tca gat cag ctg cgt gccaat 2901 aga ctt tcc GlyLysSer Gly Glu Lys Ser Asp Gln Leu Arg AlaAsn Arg Leu Ser cttgetaaa agc gca caa gaa gca ctg agt aat gccact 2949 aga atg ggc LeuAlaLys Ser Ala Gln Glu Ala Leu Ser Asn AlaThr Arg Met Gly ttttatgaa gtt agc atc ctt aaa aac ctc ttt gacctg 2997 gag aga gag PheTyrGlu Va1 Ser Ile Leu Lys Asn Leu Phe AspLeu Glu Arg Glu caggtggac aac aaa gca gaa get gaa gaa aag agactc 3045 aga gcc atg GlnValAsp Asn Lys Ala Glu Ala Glu Glu Lys ArgLeu Arg Ala Met tcctacatc agc aag gtt tca gat gcc agt acc cagcaa 3093 cag gac aag SerTyrIle Ser Lys Val Ser Asp Ala Ser Thr GlnGln Gln Asp Lys gcagaaaga gcc ggg agc get get get gat g ca 3141 ctg gca ca agg aag g AlaGluArg Ala Gly Ser Ala Ala Ala Asp n rg la Leu Ala Gl A A Lys aatggggcc ggg gcc ctg gaa atc tcc agt att gaacag 3186 gag gag AsnGlyAla Gly Ala Leu Glu Ile Ser Ser Ile GluGln Glu Glu gagattggg agt aac ttg gaa gcc aat gtg gca gatgga 3231 ctg aca GluIleGly Ser Asn Leu Glu Ala Asn Val Ala Gly Leu Thr Asp gccttggcc atg aag gga ctg gcc tct ctg agt gagatg 3276 gaa aag AlaLeuAla Met Lys G1y Leu Ala Ser Leu Ser GluMet Glu Lys agggaagtg gaa gag ctg gaa agg aag gag gag tttgac 3321 gga ctg ArgGluVa1 Glu Leu Glu Arg Lys Glu Glu PheAsp Gly Glu Leu acgaatatg gat gta cag atg gtg att aca gcc cagaag 3366 gca gaa ThrAsnMet Asp Val Gln Met Val Ile Thr Ala GlnLys Ala Glu gttgatacc aga aac get ggg gtt aca caa gacaca 3411 gcc aag atc ValAspThr Arg Lys Asn Ala Gly Val Thr Gln AspThr Ala Ile ctc aac aca tta gac ggc ctc ctg cat ctg atg ggt atg tga 3453 Leu Asn Thr Leu Asp Gly Leu Leu His Leu Met Gly Met acccacaacccacaaccttccagctccatgctccagggctttgctccagaacactcacta3513 tacctagccccagcaaaggggagtctcagctttccttaaggatatcagtaaatgtgcttt3573 gtttccaggcccagataactttcggcaggttcccttacatttactggaccctgttttacc3633 gttgctaagatgggtcactgaacacctattgcacttgggggtaaaggtctgtgggccaaa3693 gaacaggtgtatataagcaacttcacagaacacgagacagcttgggaatcctgctaaaga3753 gtctggcctggaccctgagaagccagtggacagttttaagcagaggaataacatcaccac3813 tgtatatttcagaaagatcactagggcagccgagtggaggaaagcttgaagagggggtta3873 gagagaaggcaggttgagactacttaagatattgttgaaataattgaagagagaaatgac3933 aggagcctgctctaaggcagtagaatggtggctgggaagatgtgaaggaagattttccca3993 gtctgtgaagtcaagaatcacttgccggccgggtgtggtggctcacgcctgtaattctag4053 cactttgggagactgaagcgggtggatcacccgaggtcaggagttgaagaccagcctggc4113 caacatggtgaaaccctgtctctactaaaagtacaaaaattagctggatg-atggtggtgg4173 gcgcctgtaattccagctactcaggagtctgaggcaggagaatcgcttgaacccaggagg4233 cgaggttacagtgagccaagattgcaccactgctcttccagcctgggaacagagagactg4293 cctaaaaaaa aaaaaaaaaa aaa 4316 <210> 4 <211> 1111 <212> PRT
<213> Homo sapiens <400> 4 Met Pro Ala Leu Trp Leu Gly Cys Cys Leu Cys Phe Ser Leu Leu Leu Pro Ala Ala Arg Ala Thr Ser Arg Arg Glu Val Cys Asp Cys Asn Gly Lys Ser Arg Gln Cys Ile Phe Asp Arg Glu Leu His Arg Gln Thr Gly Asn Gly Phe Arg Cys Leu Asn Cys Asn Asp Asn Thr Asp Gly Ile His Cys Glu Lys Cys Lys Asn G1y Phe Tyr Arg His Arg Glu Arg Asp Arg Cys Leu Pro Cys Asn Cys Asn Ser Lys Gly Ser Leu Ser Ala Arg Cys Asp Asn Ser Gly Arg Cys Ser Cys Lys Pro Gly Val Thr Gly Ala Arg Cys Asp Arg Cys Leu Pro Gly Phe His Met Leu Thr Asp Ala Gly Cys Thr Gln Asp Gln Arg Leu Leu Asp Ser Lys Cys Asp Cys Asp Pro Ala Gly Ile Ala Gly Pro Cys Asp Ala Gly Arg Cys Val Cys Lys Pro Ala Val Thr Gly Glu Arg Cys Asp Arg Cys Arg Ser Gly Tyr Tyr Asn Leu Asp Gly Gly Asn Pro Glu Gly Cys Thr Gln Cys Phe Cys Tyr Gly His Ser Ala Ser Cys Arg Ser Ser Ala Glu Tyr Ser Val His Lys Ile Thr Ser Thr Phe His Gln Asp Val Asp Gly Trp Lys Ala Val Gln Arg Asn Gly Ser Pro Ala Lys Leu G1n Trp Ser Gln Arg His Gln Asp Val Phe Ser Ser Ala Gln Arg Leu Asp Pro Val Tyr Phe Val Ala Pro Ala Lys Phe Leu Gly Asn Gln Gln Val Ser Tyr Gly Gln Ser Leu Ser Phe Asp Tyr Arg Val Asp Arg G1y Gly Arg His Pro Ser Ala His Asp Val Ile Leu Glu Gly Ala Gly Leu Arg Ile Thr Ala Pro Leu Met Pro Leu Gly Lys Thr Leu Pro Cys Gly Leu Thr Lys Thr Tyr Thr Phe Arg Leu Asn Glu His Pro Ser Asn Asn Trp Ser Pro Gln Leu Ser Tyr Phe Glu Tyr Arg Arg Leu Leu Arg Asn Leu Thr Ala Leu Arg Ile Arg Ala Thr Tyr Gly Glu Tyr Ser Thr Gly Tyr Ile Asp Asn Val Thr Leu Ile Ser Ala Arg Pro Val Ser Gly Ala Pro Ala Pro Trp Val Glu Gln Cys Ile Cys Pro Val Gly Tyr Lys Gly Gln Phe Cys Gln Asp Cys Ala Ser Gly Tyr Lys Arg Asp Ser Ala Arg Leu Gly Pro Phe Gly Thr Cys Ile Pro Cys Asn Cys Gln Gly Gly Gly Ala Cys Asp Pro Asp Thr Gly Asp Cys Tyr Ser Gly Asp Glu Asn Pro Asp Ile Glu Cys Ala Asp Cys Pro Ile Gly Phe Tyr Asn Asp Pro His Asp Pro Arg Ser Cys Lys Pro Cys Pro Cys His Asn Gly Phe Ser Cys Ser Val Ile Pro Glu Thr Glu Glu Val Val Cys Asn Asn Cys Pro Pro Gly Val Thr Gly Ala Arg Cys Glu Leu Cys A1a Asp Gly Tyr Phe Gly Asp Pro Phe Gly Glu His Gly Pro Val Arg Pro Cys Gln Pro Cys Gln Cys Asn Ser Asn Val Asp Pro Ser Ala Ser Gly Asn Cys Asp Arg Leu Thr Gly Arg Cys Leu Lys Cys Ile His Asn Thr Ala Gly Ile Tyr Cys Asp Gln Cys Lys Ala Gly Tyr Phe Gly Asp Pro Leu Ala Pro Asn Pro Ala Asp Lys Cys Arg Ala Cys Asn Cys Asn Pro Met Gly Ser Glu Pro Val Gly Cys Arg Ser Asp Gly Thr Cys Val Cys Lys Pro Gly Phe Gly Gly Pro Asn Cys Glu His Gly Ala Phe Ser Cys Pro Ala Cys Tyr Asn Gln Val Lys Tle Gln Met Asp Gln Phe Met Gln Gln Leu Gln Arg Met Glu Ala Leu Ile Ser Lys Ala Gln Gly Gly Asp Gly Val Val Pro Asp Thr Glu Leu Glu Gly Arg Met Gln Gln Ala Glu Gln Ala Leu Gln Asp Ile Leu Arg Asp Ala Gln Ile Ser Glu Gly Ala Ser Arg Ser Leu Gly Leu G1n Leu Ala Lys Val Arg Ser Gln Glu Asn Ser Tyr Gln Ser Arg Leu Asp Asp Leu Lys Met Thr Val Glu Arg Va1 Arg Ala Leu Gly Ser Gln Tyr Gln Asn Arg Val Arg Asp Thr His Arg Leu Ile Thr Gln Met Gln Leu Ser Leu Ala Glu Ser Glu Ala Ser Leu Gly Asn Thr Asn Tle Pro Ala Ser Asp His Tyr Val Gly Pro Asn Gly Phe Lys Ser Leu Ala Gln Glu Ala Thr Arg Leu Ala Glu Ser His Val Glu Ser Ala Ser Asn Met G1u Gln Leu Thr Arg Glu Thr Glu Asp Tyr Ser Lys Gln Ala Leu Ser Leu Val Arg Lys Ala Leu His Glu Gly Val Gly Ser G1y Ser Gly Ser Pro Asp Gly Ala Val Val Gln Gly Leu Val Glu Lys Leu Glu Lys Thr Lys Ser Leu Ala Gln Gln Leu Thr Arg Glu Ala Thr Gln Ala Glu Ile Glu Ala Asp Arg Ser Tyr Gln His Ser Leu Arg Leu Leu Asp Ser Val Ser Pro Leu Gln Gly Val Ser Asp Gln Ser Phe Gln Val Glu Glu Ala Lys Arg Ile Lys Gln Lys Ala Asp Ser Leu Ser Ser Leu Val Thr Arg His Met Asp Glu Phe Lys Arg Thr Gln Lys Asn Leu Gly Asn Trp Lys G1u G1u Ala Gln Gln Leu Leu Gln Asn Gly Lys Ser Gly Arg Glu Lys Ser Asp Gln Leu Leu Ser Arg Ala Asn Leu Ala Lys Ser Arg Ala Gln Glu Ala Leu Ser Met Gly Asn Ala Thr Phe Tyr Glu Val Glu Ser Ile Leu Lys Asn Leu Arg Glu Phe Asp Leu Gln Val Asp Asn Arg Lys Ala Glu Ala Glu Glu A1a Met Lys Arg Leu Ser Tyr Ile Ser Gln Lys Val Ser Asp Ala Ser Asp Lys Thr Gln Gln Ala Glu Arg Ala Leu Gly Ser Ala Ala A1a Asp Ala Gln Arg Ala Lys Asn Gly Ala Gly Glu Ala Leu Glu Ile Ser Ser Glu Ile Glu Gln Glu Ile Gly Ser Leu Asn Leu Glu Ala Asn Val Thr A1a Asp Gly Ala Leu Ala Met G1u Lys Gly Leu Ala Ser Leu Lys Ser Glu Met Arg Glu Val Glu Gly Glu Leu Glu Arg Lys Glu Leu Glu Phe Asp Thr Asn Met Asp Ala Val Gln Met Val Ile Thr Glu Ala Gln Lys Val Asp Thr Arg Ala Lys Asn Ala Gly Val Thr Ile Gln Asp Thr Leu Asn Thr Leu Asp Gly Leu Leu His Leu Met Gly Met <210> 5 <211> 530 <212> DNA
<213> Homo Sapiens <220>
<221> misc feature <223> Portion of Domain III of laminin gamma 2 <400>

aattctgccaggattgtgcttctggctacaagagagattcagcgagactggggccttttg60 gcacctgtattccttgtaactgtcaagggggaggggcctgtgatccagacacaggagatt120 gttattcaggggatgagaatcctgacattgagtgtgctgactgcccaattggtttctaca180 acgatccgcacgacccccgcagctgcaagccatgtccctgtcataacgggttcagctgct340 cagtgattccggagacggaggaggtggtgtgcaataactgccctcccggggtcaccggtg300 cccgctgtgagctctgtgctgatggctactttggggacccctttggtgaacatggcccag360 tgaggccttgtcagccctgtcaatgcaacagcaatgtggaccccagtgcctctgggaatt420 gtgaccggctgacaggcaggtgtttgaagtgtatccacaacacagccggcatctactgcg480 accagtgcaaagcaggctacttcggggacccattggctcccaacccagca 530 <210> 6 <211> 177 <212> PRT
<213> Homo Sapiens <220>
<221> misc feature <223> Portion of Domain III of laminin gamma 2.
<400> 6 G1n Phe Cys Gln Asp Cys Ala Ser Gly Tyr Lys Arg Asp Ser Ala Arg Leu Gly Pro Phe Gly Thr Cys Ile Pro Cys Asn Cys Gln Gly Gly Gly Ala Cys Asp Pro Asp Thr Gly Asp Cys Tyr Ser Gly Asp Glu Asn Pro Asp Ile Glu Cys Ala Asp Cys Pro Ile Gly Phe Tyr Asn Asp Pro His Asp Pro Arg Ser Cys Lys Pro Cys Pro Cys His Asn~Gly Phe Ser Cys Ser Val Met Pro Glu Thr Glu Glu Val Val Cys Asn Asn Cys Pro Pro Gly Val Thr Gly Ala Arg Cys Glu Leu Cys Ala Asp Gly Tyr Phe Gly Asp Pro Phe Gly Glu His Gly Pro Val Arg Pro Cys Gln Pro Cys Gln Cys Asn Asn Asn Val Asp Pro Ser Ala Ser Gly Asn Cys Asp Arg Leu Thr Gly Arg Cys Leu Lys Cys Ile His Asn Thr Ala Gly Ile Tyr Cys Asp Gln Cys Lys Ala Gly Tyr Phe Gly Asp Pro Leu Ala Pro Asn Pro Ala <210> 7 <211> 681 <212> DNA
<213> Homo sapiens <220>
<221> misc_feature <223> Complete domain IIT of laminin gamma 2 <400>

tgtatatgtcctgttgggtacaaggggcaattctgccaggattgtgcttctggctacaag f0 agagattcagcgagactggggccttttggcacctgtattccttgtaactgtcaaggggga 120 ggggcctgtgatccagacacaggagattgttattcaggggatgagaatcctgacattgag 180 tgtgctgactgcccaattggtttctacaacgatccgcacgacccccgcagctgcaagcca 240 tgtccctgtcataacgggttcagctgctcagtgattccggagacggaggaggtggtgtgc 300 aataactgccctcccggggtcaccggtgcccgctgtgagctctgtgctgatggctacttt 360 ggggacccctttggtgaacatggcccagtgaggccttgtcagccctgtcaatgcaacagc 420 aatgtggaccccagtgcctctgggaattgtgaccggctgacaggcaggtgtttgaagtgt 480 atccacaacacagccggcatctactgcgaccagtgcaaagcaggctacttcggggaccca 540 ttggctccca acccagcaga caagtgtcga gcttgcaact gtaaccccat gggctcagag 600 cctgtaggat gtcgaagtga tggcacctgt gtttgcaagc caggatttgg tggccccaac 660 tgtgagcatg gagcattcag c 681 <210> 8 <211> 227 <212> PEtT
<2l3> Homo sapiens <220>
<221> misc_feature <223> Complete domain III of laminin gamma 2.
<400> 8 Cys Ile Cys Pro Val Gly Tyr Lys Gly Gln Phe Cys Gln Asp Cys Ala Ser Gly Tyr Lys Arg Asp Ser Ala Arg Leu Gly Pro Phe Gly Thr Cys Ile Pro Cys Asn Cys Gln Gly Gly Gly Ala Cys Asp Pro Asp Thr Gly Asp Cys Tyr Ser G1y Asp Glu Asn Pro Asp Ile G1u Cys Ala Asp Cys Pro Ile Gly Phe Tyr Asn Asp Pro His Asp Pro Arg Ser Cys Lys Pro 65 . 70 75 80 Cys Pro Cys His Asn Gly Phe Ser Cys Ser Val Met Pro Glu Thr Glu Glu Val Val Cys Asn Asn Cys Pro Pro Gly Val Thr Gly Ala Arg Cys Glu Leu Cys Ala Asp Gly Tyr Phe Gly Asp Pro Phe Gly Glu His Gly Pro Val Arg Pro Cys Gln Pro Cys Gln Cys Asn Asn Asn Val Asp Pro Ser Ala Ser Gly Asn Cys Asp Arg Leu Thr Gly Arg Cys Leu Lys Cys Ile His Asn Thr Ala Gly Ile Tyr Cys Asp Gln Cys Lys Ala Gly Tyr Phe Gly Asp Pro Leu Ala Pro Asn Pro Ala Asp Lys Cys Arg Ala Cys Asn Cys Asn Pro Met Gly Ser G1u Pro Val Gly Cys Arg Ser Asp Gly Thr Cys Val Cys Lys Pro Gly Phe Gly Gly Pro Asn Cys Glu His Gly Ala Phe Ser <210> 9 <211> 9 <212> PRT
<213> Homo sapiens <220>
<221> misc_feature <223> N-terminal portion of domain TII of laminin gamma 2.
<400> 9 Cys Ile Cys Pro Val Gly Tyr Lys Gly <210> 10 <211> 41 <212> PRT
<213> Homo sapiens <220>
<221> misc_feature <223> C-terminal portion of domain III of laminin gamma 2.
<400> 10 Asp Lys Cys Arg Ala Cys Asn Cys Asn Pro Met Gly Ser Glu Pro Val Gly Cys Arg Ser Asp Gly Thr Cys Val Cys Lys Pro Gly Phe Gly Gly Pro Asn Cys Glu His Gly Ala Phe Ser

Claims (13)

We claim:

1. Use of an antibody that binds to one or more epitopes of a laminin 5 .gamma.2 chain for the preparation of a medicament for inhibiting tumor growth in a patient with a tumor.

2. The use of claim 1 wherein the antibody is a monoclonal antibody.

3. The use of claim 1 or 2 wherein the tumor is a carcinoma.

4. The use of any one of claims 1-3 wherein the medicament further comprises one or more further anti-tumor agent.

5. The use of claim 4 wherein the further anti-tumor agent is a chemotherapeutic agent.

6. An isolated antibody that binds to one or one or more epitopes of domain III of the laminin 5 .gamma.2 chain but does not bind to epitopes within the amino acid sequence of SEQ ID NOS: 9 and 10.

7. The isolated antibody of claim 5 wherein the antibody is a monoclonal antibody.

8. A pharmaceutical composition comprising the isolated antibody of claim 5 and a pharmaceutically acceptable carrier.

9. Isolated hybridoma cells that express the monoclonal antibody of claim 6.

10. Use of the isolated antibody of any one of claims 6-8 for the preparation of a medicament for one or more of inhibiting tumor growth, inhibiting tumor metastasis, and detecting invasive cells in a patient with a tumor.

11. A pharmaceutical composition comprising an antibody that binds to one or more epitopes in domain III of laminin 5 .gamma.2 chain and a further anti-tumor agent.

12. The pharmaceutical composition of claim 6 wherein the further anti-tumor agent is a chemotherapeutic agent.

13. A method for detecting the presence of invasive cells in a tissue comprising contacting the tissue sample with the antibody of any one of claims 6-8 to form an immunocomplex, and detecting formation of the immunocomplex, wherein the formation of the immunocomplex correlates with the presence of invasive cells in the tissue.