CA2474032C

CA2474032C - Infectious clone of human parvovirus b19 and methods

Info

Publication number: CA2474032C
Application number: CA2474032A
Authority: CA
Inventors: Kevin Brown; Ning Zhi; Peter Tijssen; Zoltan Zadori
Original assignee: Institut National de La Recherche Scientifique INRS; US Department of Health and Human Services
Current assignee: Institut National de La Recherche Scientifique INRS; US Department of Health and Human Services
Priority date: 2004-07-09
Filing date: 2004-07-09
Publication date: 2014-09-09
Anticipated expiration: 2024-07-09
Also published as: CA2474032A1

Abstract

The invention relates to infectious clones of parvovirus B19, methods of cloning infectious B19 clones, and methods of cloning viral genomes that have secondary DNA
structures that are unstable in bacterial cells. A B19 infectious clone and methods of producing B19 infectious clones are useful for producing infectious virus. Infectious virus is useful for identifying and developing therapeutically effective compositions for treatment and/or prevention of human parvovirus B19 infections.

Description

INFFCTTOUS CLONE OF R~~',~,~,~'_~ItVOVTRUS 1319 AN'D PyIE'll;:~dDS
STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY
SPOIYSOR1~D RESEARCI'd AND DEVELOPMENT
Part of the wak performed during the davelaprnent of this invention utilized United States government funds under the I3ivision of Intramural Research, NHLBLNgi, BACKGROUND OF THE IN'V'ENTIOIf human parvovirus B 19 is the only member of the Parvovuidae family known to cause diseases in humans. Parvovirus B19 infection causes fifth disease i~a children, polyarthropathy syndromes in adults, transient aplastic crisis in patients with underlying chronic hemolytic anemia, and chronic anemia due to persistent infection in immunocompromised patients.
Hydrops fetalis and fetal death have been reported after maternal infection with parvovirus B 19 during pregnancy (Brown et al., 1994, Crit. Rev.4ncpl./Hernatol. 15:1-13).
Parvovirus B 19 exhibits a selective tropism for erythmid progenitor cells.
The virus can be cultwrad in erythroid progenitor cells from bone marrow, fetal liver cells, and cell lines such as L1T7/Epo or ICU812Ep5. ( ~xavva et al., 1986, Science 233:883-886; Brown et al., 1991, J.
Ge~n. Vir.72:'141-745; IGomatsu at aL, 1993, Blood 82;156-A64; Shiroomura et al., 1992, Blood 79:18-24; Miyagawa et al., 1999, J. Virol. Methods 83:45-54). Although the virus can be cultured in these cells veay Little virus is produced. The selective tropism ofthe virus is mediated in part by neutral glycolipid globoside (blooo goup P antigen), which is present on cells of the erythroid lineage (Brown et al., 1993, ,Science, 262:114-117). The presence of globoside on the surface of a cell is a determinant of viral tropism_ Parvovirus B 19 has a cytotoxic effect on erythroid progenitor cells in bone barrow and Causes intemtption of erythrocyte production.
Human bane marrow cells that lack globoside on the call surface are resistant to parvoviru.s Bl 9 infection (Brown et al., 1994, N. Engl. J. Med, 33:1192-I 196).
The ends of the parvovirus B19 genomo have long inverted repeats {ITR), which are imperfect palindromes that form double-stranded hairpins. The role of the ITRs is the parvavirus B 19 viral life cycle is unknown due' to the inability to produce an infectious clone containing complete ITR sequences. In other parvoviruses, ITRs play an important role in the viral life cycle: they serve as prirr~crs for the synthesis of the complementary strand of viral DNA
I

and are essential for the replication, transcription, and packaging of virus D1~A (Berns, K (1990) in Virology, eds. Fields et al. Raven Press Ltd, NY, pp1743-1763). Previous attempts to produce an infectious clone ofparvovines 819 were unsuccesBful due to deletions in the I?R sequences and the instability of the ITRs in bacterial cells (Deisa et al., 1990, Virology 175;2x7-254; Shade ei al., 1986, J. V'~rol, x$:921-936). Methods of consistently producing infectious B19 parvoviru.s in cell rmltwe are not known.
Thus, there renaaius a need to develop an infectious clone of parvavirus 819 ~

infections clone and methods of producing 819 inf~tious clones can be useful for producing infectious virus. Infectious virus is usefltl far identifying and developing therapeutically effective compositions for treatment andlor prevention of human parvovirus 819 infections, such as for example, antibodies, attenuated vaccines, and chimeric viral capsid proteins comprising antigenic epitopes.
SU14EKARY OF TSE ~TI4N
One aspect ofthe invemion is directed to methods of cloning a parvavirus B19 viral genome. Clones of viral gnomes produced by the methods of the invention are useful for consistently producing infectious virus. Infectious virus is useftil for identifying and devalaping therapeutically effective compositions for trcat~uem and/or prevention of human patvovirus B19 infcxtions, such as far example, antibodies, attenuated vaccines, and chimeric viral capsid proteins comprising antigenic epitopes.
The methods of cloning a parvovirus B 19 viral gename generally employ introducing a vector comprising all or a portion of a parvovims B 19 genome into a prokaryotic cell that is deficient in at least one recombinase enzyme; incubating the cells at about 25°C to 35°C; and recovering the vector from the prokaryotic cells. An inverted terminal repeat ( ITIt) may be at the 5' end or 3' end or both of the viral genome. xn an embodiment, the ITR
comprises a nucleic acid sequence of SEQ ID NO: I or SEQ ID N0:2. In addition to at least one ITR, the viral gename may comprise a nucleic acid sequence encoding at least one or al! of VP2, nonstructural protein (NS), or 11-kDa protein. The bacterial cell may be recAl, endA, recB, andlor recr deficient. In an eanbodimeat, the bacterial cell comprises a genotype of e14-(McrA-) ~(mcrG'B-hsdSNIR-mrr)171 gruJRl supE44 thi-1 ~rA96 reL41 tae rec,J~ recJsbcC u»mC::Tn3 (Kanr) uvrC

[F' praAB lacIqZ.MlS T nl0 (Tetr)]. Vectors that art useful in the methods of the invention include pBR322, p PrtrF.xHTb, pl'Tcl9 and pl3luescript SiC.
In some embodimeittsy the full length B 19 genome is cloned by cloning at least two portions of the vial genome into separate vectors and recombining the two portions irno a single vector. Preferably, two portions of the viral genome comprise an ITR at the end of the portion.
. The parriorrs of the viral genome cats be obtained by digesting the genome with a restriction enzyme that cuts the genorne at a loctvtion betweeta the ITRs. Preferably the restriction enzyme cuts the genome at a location at least about 800 nucleotides from the ITR The portions may be y cut and rdigated to reduce the vector size and eliminate undesired restriction sites. For example, the B19 genome may be digested with BamI-ii. The two fragments (right end genome fragment arid left arid gcnome fragment) generated by BamHI digestion arc ligated into separate vectors and the iitll-length genome is generated by recombining the right end genome fragment and IeR
end genome fragment into a single vector. In an embodiment, the full length genome comprises a nucleic acid sequence of SEQ » NO; 5.
The methods of producing or identifying as infectious clone or infectious virus of parvovirus B 19 generally employ introducing a vector comprising all or a portion of a viral genome of p~trvovlrus B 19 into a population of cells, wherein the vector is present in at (east about 15°~ of the cells; and incubating the cells under conditions to allow for viral replication.
Preferably, the cells are eukaryotic ctlls, more preferably permissive ce119 such as for example erytluoid progenitor cells, fetal liver cells, UT71EP0 cells, UT'71EP0-S 1 cells, or T~'CT812'Ep6 cells. In some embodiments, the cells are cultured in vitro. Optionally, viral replication can be detected in the cells.
The vector may be introduced into the cells using standard transfection techniques known in the arE. In an embodiment, the cells are transfectad by electroporation or electrical nuclear ' 25 transport. Tha viral genome preferably comprises an ITIt sequence having a nucleic acid sequence of SEQ ID NO:1 or SEQ 1D N0:2 and it nucleic acid sequence encoding one or more of 11-kba protein, NS protein, V.PI, VP2, or putative protein X. Preferably the I~'Rs are located at the 5' end or 3' end of the ger~ome. In an embodimem, the infectious alone comprises a polynucleotide rnieleic acid sequence of SEQ m N0:5. Reproduction of the infectious clones produced by the methods ofthe invention can be defeated by contacting permissi~re cells with supernatant from the populatian of cells and analyzing the contacted cells for spliced capsid transcripts or capsid proteins.
Another aspect of the invention is directed to isolated infectious parvovirus B19 clones.
The clone9 may be produced by the methods of the invention. Infectious B 19 clones are useful in dia~no~ic assays, identifying~and developing therapeutically effective compositions for treatment andlar prevention of human parvovirus B 19 infections, such as for example, antibodies, attenuated vaccines, and chimeric viral capsid proteins comptisirt~ antigenic epitopes.
Preferably the clones comprise all or a portion of a parvovirus BI9 genome and a replicablc vector. The geaome may comprise ITRs located at the 5' end and 3' and of the genome and a I O nucleic acid sequence encodic~ one or more of VPI, VP2, NS, 11-lcDa protein, 7.5-kDa protein, or putative protein X. Preferably the viral genome comprises a polynucleatide having at least ' 90°la nucleic acid sequence identity to SEQ ID NO:S or SEQ ID N0:24.
In an embodiment, the viral genome comprises a nucleotide set~tence of SEQ m N0:5.
'rhe invention also encorrtpasses using the infectious parvovirus B19 clone of the 1 S invention and! or host cells comprising tho clone as immunogenic compositions to prepare vaccine components and/or to develop antibodies that can be used in diagnostic assays or to inhibit or aatagonixe 819 infection of cells. Host cell eultiues comprising the parvovirus B 19 clone can be heat inactivated and used as an immunogen. Passaging of an infectiou9 clone in vitro can provide an attenuated strain of parvovirus B19 useRtl in vaccine compositions.
BRIEF DESCRrPTrl7N OF T'8E DRAWINGS
Figure 1 shows a map of recombinant plasmid pB 19-N8, which contains an insert comprising 4$44 nucleotides of the B19 genome. The arrows indicate genes.
Shaded arrows indicate gee~es in the 819 gcnome_ The shaded circles at the 5' and 3' ends ofthe B19 genome indicate the 1TR sequences.
Figure 2A shows the stnxctura of the B 19 terminal inverted repeats in hairpin form. The "flip" (SEQ ID NQ:1) and "flop" (SEQ 1D N4:2) orientations at the 5' end (+
strand) are shown.
Figure 2B shows a comparison of nucleic acid sequences encoding the flip and flop forms of IT'Rs in BI9 isolate J35 (SEQ ID NOS: 1 and 2), the B19 isolate reported by Iaeias et al., 1990, Virology, I75:247 Z54 (SEQ II31V'pS;3 and 4), and the flop form in B 19->riv (SEQ B7 N0:37). Aligned positions are boxed in black. The numbering indicates the posetions of wucleotides in the genomes of the respective B19 isolates.
Figure 3 shows the exp~'emental strategy used to construct an infectious clone of parvovirus BI9.
Figure 4 shows a map of recombinant plasmid pBl9-4244, which contains an insert : comprising 5592 nucleotides of full-length B19 genome (S~EQ ID NO:S). The arrows indicate . genes. Shaded arrows indicate genes in the B19 genome. The shaded circles at the 5' and 3' ends of the B 19 genome indicate the TTR sequences.
Figure 5 shows a map of recombinant plasmid pBl9-4244d. The arrows indicate genes.
18 The shaded circles at the 5' aad 3' ends of the B I9 geaotne indicate the IT'R saquenres. Shaded arrows indicate genes in the B19 genome. plasmid pBl9-4244d was modiffed from pB 19-4.244 by ~I Ec136II digestion to remove the undesired XGar site.
Figure 6 shows a map of recombinant plagmid pBl9-M20. The arrows indicate genes_ Shaded arrows indicate genes in the B 19 genome. The shaded circles at the S' and 3' ends of the I5 819 genome indicate the ITrt sequences. Nucleic acid residue 2285 was substituted (C2285T) generating a.4alQI site in the B 19 genome.
Figure 7 shows a schematic representation of the replication of B 19 viral genome. The repiicativt DNA form provides evidence of viral DNA replication and can be distinguished by BemrHI restriction enzyme digestion.
20 Figure 8 shows RT-PCTt analysis of UT?Bpo-S1 ceJlg for 819 transcripts. The cells vvea~e transfected with recombinant plasrnids or'octed with B19 virus. Total RhtA was extracted from the cells 72 h post-transfection or ?2 h post-infection. RT-PCR
was performed with a primer pair of B19-1 (SEQ ID N0:6) and B19-9 (SEQ E7 NO:'~. The PCR
products were .: separatal by agarose electrophoresis and analyzed by Southern blotting with an alkaline-25 phosphataso-labeled probe. (-~) and {~) indicate the presence or absence respectively of reverse transcriptase in the PCIZ reaction. The numbers with arrows indicate amplicon size in base pairs ~p)~
Figures 9A-C show deterxion of B 19 capsid proteins in UT?lEpo-Sl cells infected with B 19 viru s (Fig. 9A), UT'7lEpo-S 1 cells transfected with pB 19-M20 (Fig.
9B), and UT7Bpo-S 1 30 cells transfected with pBl9-N8 (Fig. 9C). The B19 capsid proteins were detected 72 h post-S

J
E iransfection or 72 h post-infection using monoclonal antibody 521-5D (gift from Dr. Larry Anderson, Centers for Disease Control and Prevention, Atlanta, GA).
Magnification is 750X.
y Figure 10 shows Southern blot analysis of DNA purified from cells transfected with Sah digested fragment of pB 19-M20 or pB 19-4244. DNA from B 19 virus was used as a positive j ; S comml. The purified DNA was digested with Brnn~iI or FcaRI and the fragments separated by agarose electrophoresis. The fragments were probed with a 32P-random~primcd probed of the complete B19 coding region. Distinct doublets of 1.5 and 1.4 kb were detected in transfected cell sampler digested with Baml~t, but not in the plasmid controls. The 1.4 kb band is a definitive marker for viral genome replication.
Figure 11 shows Southern blot analysis ofDNA purified from cells transfected with undigested pB 19-M20 or pB 19.4244. The purii3ed DNA was digested with BcxmHI
or F.coltl and the fl"agments separated by agarose electrophoresis. The fragments were detected with a 3iP-random-primed probe of the complete B 19 coding region. Distinct doublets of 1.5 and 1.4 kb were detected in transfected cell samples digested with BamHI. The 1.4 kb band is a definitive marker for viral genome replication. A band with a molecular size of 5.6 kb, which corresponds to the size of the B19 ganome, was also detected in ZeoRl digested DNA. The 5.6 kb band indicated that progeny viral DNA was produced by the transfected cells as neither the B 19 genome nor the vector contained an ~caRI restriction enzyme site.
. Figures 12A and 12B show RT-PCR analysis o~UT7lEpo-S1 cells infected with clarified supeu~natant from B 19- infected or p 19-4244, pB 19-M20, or pB 19-N8 transfected cehs for B 19 trarucripts. Total RNA was extracted from the cells 0 h {Fig. 12A) and 72 h (Fig. 12B) post-infaxion. RT-PCR was performed with a primer pair of 819-1 (SEQ m N0:6) arid B
19-9 (SEQ
rD ND:7). The 1PCR products were,separated by agarose electrophoresis and analyzed by Southern blotting with an ailcaline-phosphatase-labeled probe. {+) and (-) indicate the presence or absence respectively of reverse transcriptase in the PCit reaction. The numbers with arrows indicate amplicoa size in base pairs (bp).
Figures 13A-C show detection ofBl9 capsid proteiiss in cells infected with clarified ' supernatant from B19- infected (Fig. 13A), or pBl9-lVhO (Fig. 13B) or pBl9-N8 (Fig. 13C) transfected cells. B 19 capsid proteins were detected 72 h post-infection using monoclonal antibody 521-5D. Magnification is 750X.
b Figure 14 shows a comparison of a portion of nucleic acid sequence from B19 clone J35 and 1319 close M20. M20 virus has a .~del restriction site that is not present in J3S virus.
Figure 15 shows 1LT-PCR. analysis of B 19 transcripts in UT7/Epo-S 1 cells infected with J35 virus or infectious clone p819-MZO, cDNA derived from the infected cells was amplified using a primer pair of B 19-2255 {SEQ ID N0:8) and 819-2543 (SEQ ID NO:9). Tho pCR
products were digesaed with DdeI and analyzed by gel electrophoresis. (+) and (-) indicate the presence or absence lively of raverse transcriptase in the PCR reaction. The numbers with arrows indicate amplicoa size in base pairs (bp).
.Figure 16A F shows RT-PCR analysis of819 transcripts in tTT7,lBpo-SI cells transfected with pB I 9-M20 (Fig I6A), pB 19-M2WidS (Fig 16A), pB I9-M2UIVP I (-) (Fig 16B), pB t 9-14I20/11(-) (Fig 16C)> pBl9-M2017.5{ ) (Fig 1bD), pB I9-M20IX(-) (Fig 168), or pBl9-N8 (Fig 16)F). At 72 h post transfectivn, cells were infected with clarified supernatant from the transfectad cells. Total RNA was extracted from the cells ?2 h post-tranfection or 72 h post-in&ction. RT-PCR was performed with a primer pair of B I9-I (SEQ ID N'O:6) arid B 19-9 (SEQ
i I 5 ID N0:'7). The PCR products were separated by gel electrophoresis. {+) and ( ) indicate the presence or absence respectively of rGVecse transsxiptase in the PCR reaction.
Figures 17A D show detection ofBl9 capsid proteins and 11-kDa protein in cells iransfected with pBl9-M20 (Figs. 1fA and 178 respectively) or pBl9-MZ0/l1( ) (Figs. 17C and 17D respectively). B19 capsid proteins were dttdcted 72 b post~infection using monoclonal ZO antibody 521-SD (Figures 17A; 17C). I I-kDa protein was detected 72 h post-transfection using a rabbit polyclonal anti-11-lsDa protein antibody (Figures 17B, 17D).
DETAILED D1ESCRIPTION QF TAE 1N'VENTIUN
25 L Definitions The terns "antibody" is used in the broadest sense and speci~tcally includes, for example, single anti-parvovirus B I9 monoclotlat antibodies, anti-parv;ovirus B 19 antibody compositions with polyepitopic speafrdty, single chain anti-parvovirus B I9 antibodies, and fi~agments of anti-parvovirus B19 antibodies. The team "monoclonal antibody"
as used herein 30 refers td an antibody obtaiaed from a population of substantially homogeneous antibodies, i.e..
the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts.
"Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab'~, and Fv fragments; diabodits; linear antibodies (Zapsta et al., 1995, Protein Eng., 8:1057-1062); singlo-chain antibody molecules; and multiapecific antibodies formed from antibody fragments.
The term "binds specifically" refers to an antibody that binds parvovirus B 19 and does not substantially bind other parvoviruses. In some embodiments, the antibody specifically binds a drat B19 isolate and does not bind a second B19 isolate. For example, sa antibody may i0 specifically bind B 19-Au and net bind B 19-HV.
"Carriers" as used herein include pharmaeeuticatly acceptable carriers, excipients, or stabilizers, which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations, amplayed. O$atl the physiologically acceptable carrier is a»
aqueous pH
bui~ered solution. F,xamples of physiologically acceptable carriers include buffers such as I5 phosphate, citrate, and her organic acids; a~ioxidaui~s including ascorbic acid; low molecular .. w~eiglit (less than about 1 o residues) polypeptide; protedrts, such as serum alburnin, gelatin, or imrrouxtoglobulins; hydrophilic poIymera such as polyvinylpyrrolidone; amino acids such as glyciney gtutanune, ssparagins, arginine or lysine; monosa~c:charides, disacxharides, and other carbohydrates including glucose, mannose, or daxtrias; chelating agems such as F.,DTA; sugar 20 alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; andlor nonionic surta~ants such as T~, polyethylene glycol (P)EG), and PLURaNICS'~_ The term "parvovirus B 19", ")319", "B 19 virus", "B 19 clone°, or "B
19 iso late" means an isolate, clone or variant B 19 viral genome of parvovirus B 19 of the family Parc~oviridae including genotypes 1, 2, and 3. A naturally occurring isolate of parvovirus B
19 of the invention 25 has at least 90% rnicleic acid identity to human parvovirua B 19-Au (GenBank accession number M13 i78; SECT l~ N0:24), which lacks intact ITita at bath 5' and 3' ends of the genome (Shade et al., 1986, J. Yrrol, 58:921-936}. B19 has a non-envolopcd, icQSahedral capsid packaging a single-stranded DNA genome of approximately 5600 nucleotides. Transcription of the B 19 genome is controlled by the single promoter gG located at map unit b, which regulates the 30 synthesis of viral proteins including, but not limited to, nonstrucxural protein (NS), capsid proteins VPl and VP2, 11-kDa protein, ?.5-kDa protein, and putative protein X.
B 19 viral DNA

can be isolated from infected humans or cells or can be prepared as described herein. An embodiment of sm isolate of parvo~rims H 19 has a rnucleotide sequence of SBQ
ID NQ:S (Table 1). In some embodiments, the B 19 genome cloned into the vector may have from 1 to about 5 nucleotldcs deleted from the 5' end andlor ~' end of ttce full length viral genome. For example, a the B19 genome (SEQ ID i~T0:5) cloned into p819-4244 (Pig.4) has 2 nucleic acids deleted from the 5' end and 3' end compared to the nucleic acid sequericc of the fixll length genome (SEQ ~p N0:38).
T_~ble 1 1 aaatcaga tgccgccggt cgccgccggt aggcgggact tccggtacaa gatggcggac 59 aattacgtca tttcctgtga cgtcatttcc tgtgacgtca cttccggtgg gcgggacttc 119 cggaattagg gttggctctg qgccagcttg cttgqggttg ccttgacact aagacaagcg 179 gcgcgaagat tgatcttagt ggcacgtcaa ccccaagcgc tggcccaQag ccaacactaa 239 ttccggaagt ccagcccacc ggaagtgacg tcacaggaaa tgacgtcaca ggaaatgacg IS 299 taattgtccg ccatcttgta ccggaagtca cgcctaccgg cggcgaoagg aggcatctga 359 tttggtgtct tcttttaaat tttagagggc ttttttcccg ccttatgCaa atgggcagcc 419 attttaaqtg ttttactata attttattgg tcagttttgt aacggttaaa atgggcgqag 479 cgtaggcggg gactacaqtn tatatagca~c agcactgccg cagctctttc tttctgggct 539 gctttttcct ggactttctt gctgtttttt gtgagctaac taacaggtat ttatactact 599 tgttaatata ctaacatgga gctatttaga ggggtgcttc aagtttcttC taatqttotg 659 gactgtgcta acgataaatg gtggtgatat ttactagatt tagacacttc tgactgggaa 719 ccaataactc atactaacag actaatggca atatacttaa gcagtgtgga ttctnagctt T79 gaccttaccg ggqggccact agcagggtgC ttgtactttt ttcaagcaga atgtaacaaa ;= B39 tttgaagaag gctatcatst tcatgtggtt attgggqggc cagggttaaa ccccagnaac 899 ctaaaagtgt gtgtagaggg gttatttaht aatgtacttt atcactttgt aactgaaaat 959 gtgaagctaa aatttttgcc aggaatgact acaeaaggca aatactttag agatggagag 1019 cagtttataq aaaactattt aatgaaaaaa atacctttaa atgttgtatg gtgtgttact 1079 aatattgatg gatatataga tacctgtatt tctgetactt ttagaagggg agcttgccat 1139 gccaagaaac cccgcattaC Cacagccata aatgataeta gtagcg$tgG tggggagtct ~; 3U 17.99 agcggcacag gggeagaggt tgtgccattt aatgggaagg gaactaaggc taqcataaag 1259 tttcaaacta tggtaaactg gttgtgtgaa aacagagtgt ttacagagga taagtggaaa 1319 ctagttgact ttaaccagta oactttac~a agcagtagtc acagtggaag ttaaaaatt 1379 caaagtgcaa taaaactagc aatttateaa gcaactaatt tagtgcctac tagcacattt ' 1439 ttattgcata cagactttga gcaggttatg tgtattaaag acaataaaat tgctaaattg 35 1499 ttaatttgtc aaaactatga CcCcctattg gtggggcagC atgtqttaaa gtggattgat 1559 aaaaaatgtg gcaagaanaa tacactgtgg ttttatqggc cgccaagtac aggaaaaaca r 1619 aacttgqcaatggacattgctaaaagtgttccagtatatggcatggttaactggaataat 16T9 gaaaactttccatttaatgatgtagcaggaaaaagcttggtggtctgggatgaaggtatt 1?39 attaagtctacaattgtagaagctgcaaaagccattttaggcgggcaacccaccagggta 1799 gatcaaaaaatgcgtqgaagtgtagctgtgcctggagtacctqtggttataaccagcast ' : 5 1859 ggtgacattacttttgttgtaagcggg~aasctacaacaactgtaeatgctaaagectta 1919 aaaqagcgaatggtaaagttaaactttactgtaagatgcagccctgacatggggttacta 1979 acagagqotgatgtacaacagtggcttacatggtgtaatgcacasagatgggaccactat i 2039 gaaaactgggcaataaactacacttttgatttccctggaattaatgcagatgccctccaa 2099 ccagacctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgna A
' ~~ 2159 agctctgaagaactcagtgaaagcagcttttttaaactcatcaccccaggcqcctggaac 2219 actgaaaccccgcgctctagtacgcccxtc~cccqggaccagttcaggagaatcatttgtc 2279 as ccca tttcctcaa tt~ta gg g a ct gcatcqtqqgaagaagcottctacacacCt g g g g g 2339 ttggcagacaagtttogtgaactgttagttggggttgattatgtgtgggacggtgtaagg 2399 ggtttacctgtgtgttgtgtgcaacatattaacaatagtgggqgaggcttgggactttgt 15 2459 ccacattgcattaatgtaggggcttggtataatggatggaaatttcgagaatttacccca 2519 gatttggtgcgatgtagctgcoatqtgggagcttctaatctcttttctgtgctaacctgc 2579 aaaaaatgtgcttaCGtQtCtggattgcaaaqctttgtngattatgagtaaagaaagtgg 2639 caaatggtgggaaagtgatgat9aatttgctaaagctgtgtatcagcaatttgtggaatt i ' 2699 ttatgaaaaggttactggsacagacttagagcttattcaxatattaaaagatcattatea 20 2759 tatttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgcat I, ' 2$19 taaaaataaccttaaaaattctaoagacttatataqtcatcattttcaaagtcatggaca 28?9 gttatctgaccacccccatgcottatcatccagtagcagtcatgcagaacctagaggaga 2939 agatgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacc 2999 aggtactaactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgt 25 3059 tgacagtgctgcaaggattcatqaotttaggtatagCCaactggctaagttqggaataaa 3119 tcaatatactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaac 3179 tgggtttcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgt 8239 ggcccattttcaaggaagtttgccggaagttcccgcttacaacqcctcagaaaaataccc 3299 aagcatgactttagttaattctgcaqaagcaagoactggtgcaggaggggggggcagtaa 30 3359 tcctgtcaaaagcatgtggagtgagggggecacttttagtgccaactctgtgacttgtae 3419 attttctagacagtttttaattccatatgacccagagcaccattataaggtgttttctcc 3479 cgcagcaagtagctgccacaatgccagtqgaaaggaggcaaaggtttgcaccattagtcc 3539 eataatgggatactcaaccccatggagatatttagattttaatgctttaaacttattttt 3599 ttcacctttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgcttt 35 3659 aactgtaaccatatcagaaattgctgttaaggatgttacagacaaaaCtggagggggggt 3719 gcaggttactgacagcactacagggcgcctatgcatgttagtagaccatgaa~acaaqta 379 cccatatgtgttagygcaaggtcaagatactttagccccagnacttcctatt~qggtata 3839 etttcccccteaatatgcttacttaacagCaqgagatgttaacacacaaggaatttCtgg Zd 3899 agacagcaaa aaattagcaa gtgaagaatc agcattttat gttttggaac aeagttcttt 3959 tcagctttta ggtacaggag gtacagcaac tatgtcttat aagtttcctc cagtgccccc 9019 agaaaattta gagggctgca gtcaacactt ttatgagatg tacaatccct tatacggatc 4079 ccgcttaggg gttcctgnca cattaggagg tgacccaaaa tttagatctt taacaaatga S 439 agaccatgCa attcagcCCC aaaacttCat gccagggcca ctagCaaact cagtgtctaC
9199 aaaggaqgga gacagctcta atacsggagc tgqqasagcc ttaacaggcc ttaqcacagg 4259 tacctctcaa aacaatagaa tatccttacg cccggggaca gtgtctcagc cctaccacca 4319 ctgc~gacaca gataaatatg tcacaggaat aaatgatatt tctaatggtc agaccactta 4379 tggtaacgct gaagacaaag agtatcagca aggagtgggt aqatttccaa atgaaaaaga 4939 acagctaaaa cagttacagg gtttaaacat gca'.cacctac tttcccaata aaggaaccca 4999 gcaatataca gatcaaattg agcgacccct aatggtgggt tctgtatgga acagaagagc 4559 ccttcactat gaaagccagc tgtggagtaa aattacaaat ttagatgaca gttttaaaac 4619 tcagtttgca gccttaggag gatggggttt gcatcagcca cctcctcaaa tatttttaaa 9679 aatattacca caaagtgggc caattggagg tattaaatca atgggaatta ctaccttngt 4739 tcagtatgcc ytgggaatta tgacaqtaac catgaCattt aaattqqggc cccgtaaagc 4799 tacgggacgg tggaatcctc aacctggagt atatcccccg cacgcagcag gtcatttacc 9859 atatgtacta tatgacccta cagotacaga tgcaaaacaa caccacagac atggatatga 9919 aaagcctgaa gaattgtgga caqccaaaag ccgtgtgcac ccattgtaaa cactccccac ' 4979 cqtgccctca gccaggatgc gtaactaaac gcccaccagt aecacccaga ctgtacctgc 5039 cccctcctat acctataaga cagcctaaca caaaagatat agacaatgta ga~stttaagt 5099 atttaacCag atatgaacaa catgttBtCa gaatgttaag attgtgtaat atgtatcaaa 5159 atttagaaaa ataaacqttt gttgtggtta senaatt~stg ttgttgcgct ttaaaaattt 5219 aaaagaagac acceaatcag atgcCgcagg tcgccgccgg taggcgggac ttccggtaaa 5279 aqatggcgga caattacgtc atttcctgtg acgtoatttc ctgtgacgtc acttccggtg . 2$ 5339 ggcqgaaatt ccggaattaq ggttggctct gggccagcgc ttgggqttga cgtgccacta 5399 agatcaagcg gcgcgccgct tgtcttagtg tcaaqgcaac cccaagcaag ctggcccaga Sd59 gccaacccta attccggaag tcccgcccac cggaaqtgac gtcacaggaa atqacgtcac 5519 aggaaatgac gtaattgtcc gccatcttgt accggaagtc ccqcctaccg qcggcgaccg 5579 gcggcatCtg attt N Variants" of the parvovirus B 19 viral genotne refer to a sequence of a viral genome that differs from a reference sequence and includes "naturally occurring" variants as well as variants that are prepared by alteration of one more nucleotides. Iri some embodiments, when the viral genome has the sequence of a naturally occurring isolate, the reference sequence may be human parvovirus B19-Au (fireneBxntc accession number M13178; SEQ 177 N0:24), which lacks intact ITlts at both 5' and 3' ends of the genome and the variant has at least 90%
sequence identity to the reference sequszsce. In ether cases, a variant may be prepared by altering or modifying the nucleic acid sequcnca of the viral genome including by addition, substitution, and deletion of nucleotides. In that cases the reference sequence can bg that of parvovirus B
19 comprising a polynucleotide sequence oFSEQ ID N~:S. Ia some embodiments, a parvovirus gnome has at least 90% sequence identity, more preferably at least 91%, more preferably at Ieast 42%, more preferably at least 93%, morn preferably at least 94%, more preferably at least 950, more j preferably at lease 9b%, more preferably at least 97%, more preferably at least 98%, more prefernbly at least 99% or greater sequence identity to that of a parvovirus B
19 genome comprising a nucleic acid sequence of pxrvovirus B 19 Au (GeneBanac accession number M13178; SEQ Da N0:24) or a parvovirus B19 comprising a polynucleotide sequence of SEQ ID
NO:S.
An "infectious clone " of parvovirus B19 as used herein refers to a full-length ganomc or portion of a gen~ome of a parvovin~.s B 19 isolate cloned into a replicable vector that provides for amplification of the viral genome in a call. In soma r-nabodiments, a portion of the parvovirus i 5 1319 genome comprises err canaists of nucleic acid sequence encoding at least one ITR, VP2, NS, and 11-kDa in a single replicable vecxor. In other embodiment, the viral genome is a full-length geaome. The replicable vector provides far introduction and amplification ofthe viral genome in a wide variety of prokaryotic and eukaryotic cells The terra " ecythroid progenitor cell" as used herein refers to a red blood cell precursor cell that differrntiatas to produce red blood cells.
"Electrical nuclear trap ort" is a method of imrodu ' ap cing nucleic acids into cells sucb as atkaryotic cells using an alactrical current. In same embodiments, in electrical nuclear transport, a recombinant plasmid is transported into the nucleus of cells. Greater amounts of DNA are transported into the nucleus of dividing cells with eleetzicai nuclear transport than may be 2S expected by cell division alone, thereby substgntially increasing the likelihood of integration of complete expression cassettes. Electrical nuolear transport methods and buyer systems arc describai in U.S. 20040014224.
The term " full length genome" refers to a complete coding sequence of a viral gcnome that comprises at least 75% or greater of the nucleotide sequence that forms the hairpin of the ITR at the 5' end and 3' end of the genome. In an embodiment, the coding sequence comprises nucleic acid sequence encoding VPI, VP2, NS, 11-kDa protein, 7.5-kDa protein, and putative n .r , protein X. rn another embodiment, TIR.s at each end of tho full length clone may have 1 to about deletions at each end aad retain the ability to provide for replication and expression of viral proteaas. In preferred embodiments, the 1TR has at least about 94 %, more preferably 95%, more prefergble 96°!0, more preferably 97%, more preferably 98%, more preferably about 99%, and 5 more preferably 100% of the sequence of that of viral genottte isolated from nature, such as that of SEQ ID N0:5 or SEQ Ip:24.
The terms fusion protein" and a "fission polypeptide" refer to a poIypeptide having two portion covalemly linked trogether, where each of the portions is a polypeptide having a different p~pecty. The property may. be a biological property, such as activity tn vitro or in vivo, The property rosy also be a simple chemical or physical property, such as binding to a target moleatle, catalysis of a reactioa, etc. The two portions may be lilted directly by a single peptide bond or through a peptide linker containing one or more amino acid residues. Generally, the two portions and the linker will be in reading frame with each other.
The term "infection" as used herein refers to the introduction B 19 viral DNA
irno a cell whtrein introduction of the viral DNA into the cell is mediated by B19 capsid.
Cells era typically infected by contacting tho cell with B19 virus. infection of a teal by B19 virus may be determined by analyzing the cell for increase in viral DNA including by detecting the presence or increase of spliced capsid transcripts andlor unspliced NS transcripts andlor capsid proteins.
The term "immunogenic e~'ective amount" of a parvovirus 1319 or component of a parvovitus re8ers to an amount of a parvovirus 819 or component thereof that inducts an immune response in as animal, The immune response may be detea~mined by measuring a T or B
cell response. Typically, the induction of an immune response is determined by the detection of t antibodies specific far parvovirus B19 or component thereof.
An "isolated" antibody i9 an antibody that has beet identified and separated andlor recovered from a component of its natural environmexrt. Contaminant camponeats of its natural environment arc materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other prateiaaceous or nonproteinaceous solutes. isolated antibody includes the antibody ~r sr~ within recombinant cells since at least one component of the antibody's natural environment will riot be present.
Ordinarily, however, 34 isolated antibody will be prepared by at feast one purification step.

An "isolated" nucleic acid molecule is a nucleic acid molecule that is identified and separated franc at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source. Preferably, the isolated nucleic is free of association with all componecits with which it is naturally associated. An isolated nucleic acid molecule is other than in the form or setting in which it is fotund in nature. Isolatod nucleic acid molecules encoding, for example, 819 genome or B19 viral proteins therefore are distinguished from nucleic acid molecules encodiirg B 19 viral proteins cx a 819 genome as it may exist in nature. In an embodiment, the B 19 genome comprises a nucleic acid sequenca encoding one or more of 1:1-lcDa protein, VPI, VP2, NS, 7.5-kria protein, and protein X. In another ombodimern, tht polynucleotides lave a~nucleotide sequencae that encodes a 1319 genome that h,as greater than 99% nuclaic acid sequence identity to SLQ ID NO:S (Table 1). Preferably, the polynucleotide encodes an infectious clone of parvovirus B 19.
"TTIt" or "ITR sequence" refers to an invertad tenminsl repeat of nucleotides in a nucleic acid such as a viral genome. The TfRs include act imperfect palindrome that allows for the formation of a double stranded hairpin with some areas of mismatch that form bubbles. The ITRs serve as a primer for viral replication and contain a recognition site for NS
protein that may be . required for viral replication and assembling. In some embodiments, the location and number of the bubbles or areas of mismatch are conserved a3 well as the NS binding site.
The NS binding site provides far cleavage and replication of tha viral genome. In an embodiment, the parvovirus B 19 genome comprises orie or more ITR sequences. Preferably, the B 19 geaome comprises an ITR sequence at the 5' end and the 3' end. Aa XTIZ may be about 350 nucleotides to about 400 nucleotides in length. An imperfect palindrome may be formed by about 350 to about 370 of the distal nucleotides, more preferably about 360 to about 365 of the distal nucleotides. Preferably the imperfect palindrome forms a double-stranded hairpin. In as eFnbodiment, the ITIts are about 383 nucleotides in length, ofwhich about 365 of the distal nucleotides are imperfect palindromes that form double-stranded hairpins. In another embodiment, the TTlis arc about 381 nucleotides in length, of which about 361 of the distal nucleotides arc imperfect palindromes that form double-stranded hairpins. In some embodiments, a B19 genome comprises st least 75% of the nucleotide sequence that forms the hairpin in the I;TR at the 5' end and 3' end of the genome.
In other embodiments, the ITRs may have 1 to about 5 nucleotides deleted from each end. In a further embodiment, the ITRs comprise a nucleic acid sequence of SEQ >D N4:1 a»dlor SEQ ID
N0:2. The ITRs triay be in the "flip" or "flop" orientation.
The term "permissive cells" means cells in which parvovirus B 19 isolates can be cultured. The permissive cells arc eukaryotic cells. Examples of permissive cells include, but are not limited to primary erythroid progenitor cells from bone marrow, blood, or fetal liver cells, megakaryoblast cells, UT7lEpo cells, UT7/Bpo-S1 cells, ICU812Epb cells, fK-1 cells, and 1VI8-02 cells.
"Percent (%) nucleic acid sequence identity" with respect to the nucleic acid sequences identified herein is defined as the perusntage of nucleotides in a candidate sequence that are j . . . 14 identical with the nucleotides in a reference B I9 nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
In some embodiments, the reference 819 nucleic add sequence is that of SEQ 1<p NO:S or that of SEQ 1D N0:24. Alignment for purposes of deterndning percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN 2 or Malign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared, For purposes herein, the °~ nucleic acid sequence identity of a given nucleic acid sequence A to, with, or against a given nucleic acid sequence B (which can alternatively be phrased as a given mrcleic acid sequence A that has or comprises a cextain %
nucleic acid saquencae identity to, with, or against a given aucleie acid sequence B) is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of A and )B, and where Z is the total number of nucleotides in B. a will he apprieciated that where the length of nucleic acid sequence A
is not equal to the length of nucleic acid sequence B, the % nucleic acid sequence identity of A
to B will not equal the % nucleic acid sequence idernity of H to A.
"Recombinam" refers to a polynucleotide that has been isolated and/or altered by the hand of man or a B19 clone encoded by such a polynucleotide. A DrA sequence encoding all or a portion of a B 19 viral genome may be isolated and combined w ith other control sequences in a vector. The other control sequences may be those that are found in the naturally occurring gene or others. The srecto~ provides for introduction into host calls and amplification of the polynucleotide. The vectors described herein for B 19 clones are introduced into cells and a culitubd under suitable conditions as known to those of skill in the art.
Preferably, the host cell S is a bacterial cell ar a, permissive cell.
The term "transformation" as used herein refers to introducing DNA into a bacterial cell so that the DNA is replicable, either as an cxtrachroaaosomal element or by chromosomal integrant. Depending an the host cell used, transformation is done using standard techniques appropriate to such cells. The calcium troatmant employing calcium chloride is generally used for bacterial cells that contain substsafxal cell-wall barriers. Another method for transformation is electroporation.
The term "transfeciion" as used herein refers to introducing DNA into a eukaryotic cell so J
that the DNA is replicablc, Bather as an extrachrom~osoma! clement or by chromosomal integrant.
1 : Depending on the host cell used, transfectio~ is done using standard techniques appropriate to such cells. Methods for tcansfecxing eukaryotic cells include polycthyleneglycollDMSO, liposomes, electroporation, cad electrical nuclear transport.
The term "transfection efficiency" as used herein means the percentage of total cells contacted with a nucleic acid, such as a plascnid, that take up one or more copies of the plasmid.
Tranfoction efficiency can also be expressed as the total number of cells that take up one or more copies of the plasmid per pg of plasmid. If the plasmid contains a reporter gene, transfection efRciency of cells can also be expressed in units of expression of the reporter gene per cell.
The farm " replicable vector," as used herein, is intended to rifer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked into a cell and ' providing for ampli8catian of the nucleic acid. One type of vector is a "plasmid", r~rhich refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
Another typo of vector is a phage vector. Another type of vector is a viral vector, wherein additional DNA segments may be ligated irno the viral genome. Curtain vectors are capable of autonomous replication in a host cell into vrhich they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
Glther vectors (e.g., non-episomsl mammalian vectors) can be integr~ed into the genome of a host ceEl upon introducxion into the host cell, and thereby are replicated along with the host genome. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. In some embodiments, the vector is a vector that can replicate to high copy number in a eQEE.
». Modes for Carrying Out the Ynvcntion Previous attempts to produce infectious clones of parvovirus B 19 have been unsuccessful due to deletions in the 1TR sequences {Shade et al., 1986, J. Yirol., 58:921-936) and the instability of the TTRs in bacterial cells. In addition, parvovirus B 19 can be cultured in permissive cells but the amount of virus produced in these cehs is very small.
There have been 1Q no methods or clones of the viral genome that can provide for consistent production of infectious virus. rltilixing the methods oftha invention, the genome of parvovirus B19 isolate was cloned arid sequenced. A vector was prepared Comprising a 819 viral genome and the vector was used to clone the viral genome. The parvovirus B 19 clone can be introduced into other cells types ( whether permissive or sot) to produce infectious virus.
t S xhs infectious clone and methods described herein can be utilized in a variety of assays and to daveiop therapeutic products. The infectious clone is useful for producing infectious virus.
An in vitro system for producing infectious virus parkicles can be used in screening methods to identify agents such as antibodies or antisense molecules that can inhibit viral infectivity or reproduction. The infectious virus and/ or infectious virus in a host call can be utilized to form 24 immunogenic compositions to prepare therapeutic antibodies or vaccine components. Antibodies and primers can be developed to specifically identify different parvovirus B
19 isolates. The ability to produce infectious virus is vitro is also useful to develop attenuated strains of the virus that may be utilized, in vaccines.
25 A. Meth4ds of the linvention One aspect of the invention involves a method of cloning a viral genome that has one or more inverted repeats or secondary structure of nucleic acid that is unstable in cells. A method of the invention comprises introducing the viral genome into a bacterial cell that is deficient in recombinase enzymes such as recAl, end Al, recB,, reel or combinations thereo~
The bacterial 30 cells are incubated at a low temperature, for example about 25°C to 35°C, preferably about 25°C
to 32° C, and more preferably about 2$°C to 31° C, and most preferably about 30°C. The cells i7 are incubated for a lima su~aicnt to allow ampllfieetion of the viral genome.
Preferably, the incubation time is about 8 to 24 hours, more preferably about 8 to 12 hours.
The viral genome is recovered from the bacterial cells.
In some embodiments, the methods of the invention include a method for cloning an infectious parvovirus B19 clone;. In an embodimeryt, the method comprises introducing a replicable vector comprising a parvovirus B 19 viral genome or portion thereof into prokaryotic cells that are deficient in major recombina#ion genes, such as for example recAl, er~i'Al,recB
andlor reel or combinations thereof. The ceps are incubated at a low temperature for a time sufficient to allow amplification of the vector. The infectious clone is recovered From the prokaryotic oe~lls. Dace: the infectious clone is prepared it can be introduced into other cell types, whether permissive or not, and provide infectious virus.
Preparing a clone of the viral g~noma The infectious clone is comprised of all or a portion of a viral genome of parvovirus B 19 and a replicable vector that can provide for amplification of the viral genomo in a cell, such as a bacterial cell. In some embodiments, the vector has a bacterial origin of replication Tn same embodiments, the vector is a plasmid. In some: embodiments, the vector can be selected based on the host cell as well as other characteristics such as compatibility with host cell, copy number, and restriction sites. Vectors that can be used in the invention include, without limitation, p~22, pPro~x~TTb, pUCl9, and pBluescript KS.
. The method of cloning a patvovirus genome can be applied to any parvovirus genome.
The parvovirus genome includes those obtained from knov~m isolates, th~osa isolated from samples from infected tissues, or parvovirus genomes from any source including those that have v been modified. AIi or a portion of the viral genorne can be cloned. In some embodiments, the parvovirus 819 genonLe is a full-length gaiome, In other embodimec~, a portion ofthe parvovirus genome comprises or consists of nucleic acid sequence encoding at least one ITR, VP2, NS and the 1 lkDa protein in a single replicable vector. The portion of the viral genome is that portion that is sufficient to provide for production of infectious virus.
In other embodiments, the parvovirus genome comprises or consists of a nucleic acid seceding an ITR
at the 5' end and an ITR at the 3' end, 'VP2, NS and the 11 kDa protein in a Single replicabla vector. In an embodiment, the 1E319 gex~ome comprises a polynucleotide encoding an infectious 819 clone having at ltast 90% nucleic acid sequence identity with SEQ ID N0:5 andlor SEQ
m N0,24. In another embodiment, the B 19 genome comprises a nucleic acid sequence of SEQ
ID N0:5.
'The parvoviras 819 genoma preferably comprises one ar more 1TR sequences. The TZ'Rs include an imperfect palindrome that allows for the formation of a double stranded hairpin with some areas of mismatch that form bubbles. The IT'R.s serve as a primer for viral replication and contain a recognition site for NS protein that may be required for viral replication sad assembling. In some embodiments, the nucleotide sequence that forms the hairpins is retained and conserved. rn some embodiments, the location and number of the bubbles or areas of ' mismatch are conserved as well as the NS binding site. The NS binding site provides for a . 10 cleavage and replication of the viral genome.
In an embodimem, the parvovirus B 19 gename comprises one or more ITR
sequences.
Preferably, the B 19 genome comprises an TTR sequence at the 5' end sad the 3' and. An f1'1~
may be about 350 rnucleotidts to about X100 nucleotides in length. An imperfect palindrome may be formed by about 354 to about 374 of the distal nucleotides, more preferably about 360 to 1 S about 365 of the distal nucleotides. Preferably the imperfect palindrome forma a daublc-stranded hairpin. In an embodiment, the TTRs ere about 383 nucleotides in length, of which about 365 of the distal nucleotides are imperfect palindromes that form doable-stranded hairpins. In another embodiment, the IfTts are about 381 nucleotides is length, of wizich about 361 of the distal nucleotides are icupertbet palindromes that form double-stranded hairpins. In some 20 embodiments, a 83.9 genome comprises at least ?~% of the nucleotide seduence that forms the hairpin in the ITR at the S' end and 3' end of the genome. In other embodiments, the ITRs may have 1 to about 5 nucleotides deleted from each ettd. In preferred embodiments, the ITR has at least about 94 %, more preferably 95%, more preferably 94%, more preferably 97%, more preferably 98%, more preferably about 99%, and more preferably 100% of the sequence of that 2S of viral genoma isolated from nature, such as that of SEQ ID N~:S or SEQ
1D:24, Jn a fhrther embodiment, the ITRs comprise $ rnicieic acid sequence of SEQ Iri lvTQ:1 andior SEQ ID N~:2.
The ITRs may be in the "flip" or "flop" orientation.
The parvovirus genome may have variation due to variation in naturally occurring isolates. For exempla, isolates of parvovirus B 19 $om infected tissues can have about 90°l0 30 sequence identity or greater to tbxt ofpsrcraYirus >iil9 Au (GeneHanlc accession number M131'~8;
SEQ 1D NQ:24) In some embodiments, a parvovirus genome has at least 90%
sequence identity, more preferably more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95°!a, more preferably at least 9Gq/°, more preferably at Ieast 97°l°, more preferably at least 98%, more preferably at least 99%
or geate~r sequence identity to that of a parvovirua B 19 genome comprising a nucleic acid sequonce ofparvovines B19 Au GteneBank accession number M131'78; SEQ ID
N0:24).
In some cages, alterations or modifications may be made to the nucloic acid sequence of the v'trdl geoome of a viral isolate using standard nsethads to form variant viral ganomes. The alterations may be made to add or delete characteristics to the nucleic acid sequence. For example, it may be desirable to add or delete a restriction site or add a sequence that can serve to identify the viral ganome. Iie a speck embodiment, a vector, idontified as p819-M20 comprises a #~11-length clone of ~rvoviruts B 19 having a sequence of SEQ 1D
NOvS but with a change at nucleotide 2285 from a cytosine to a~thymine, resulting in conversion of Bsrl site to a Dde site. In another embodiment , a vector, idernified as pB 19-4244d comprises a full-length clone of parvovicu91i319 having a sequence of SEQ ID 14:5 but with a change to eliminate an Xbal restriction site.
Alternatively it m,ay be desirable to add a nucleic acid sequence that encodes a heterologous polyptptide to the infectious clone. Such a heterologous polypeptide may include tag polypeptides such as poly-h[stidine (poly His) err poly-histidinc-glycine (poly-His-gly) tags;
the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell.
Biol., 8x2159-2165 (1488)x; the o-myc tag and the 8F9, 3C7. 5E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 ( 1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [1'aborsky et al., Protein Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al., Bio~'echnology, b;1204-1210 (198$)]; the IGT3 epitope peptide [Martin et aL, Science, 255:192-194 (1992)]; an "-tubulin epitope peptide [Skinner et al., J.13io1. Chcm., 26fi:15i63-15166 (I991)]; and the T7 gene 10 protein peptide tag ~Lutz-Frcyermuth et al., Proc. Natl. A.cad. Sci. ~JSA, 8?:6393-b397 (1990)]
The hetemlogous polypeptides are combined with viral proteins to form fusion proteins.
Epitopes from heterolpgous proteins may be combined with parvovirus B19 proteicts to form fusion proteins useful for immunogenic compositions.
Preferably, the variant viral ~enoma has at least 90% sequence identity, more preferably at least 9190, more preferably at lest 92%, more preferably at least 93'/°, morn preferably at least 94%, more preferably at least 950, more preferably at least 96°10, more preferably at least 97°l0, mort preferably at least 98°Yo, more preferably at least 99% ar greater sequence identity to that of a parvavirus B 19 gename comprising a nucleic acid sequence of SEQ. fD, ~T4:5.
In some embodiments, the parvovirus genorne, preferably has 99.2% sequence ide~ity, more preferably 99.3°10 , more preferably 99.4%, more preferably 99.5%, more preferably 99.6%, more preferably 99.7%, more preferably 99.8%, and more preferably 99.9% or greater sequence idemity io that of a parvovirus B 19 gerame comprising a poly~cleotide sequence of SEQ.1D. Na:S.
In sonic embodiments, the B 19 genome is cloned by cloning at least two portions of the viral genome into separate vectors and recornbiniag the two portions into a single vector.
14 Preferably, the two portions of the viral genome comprise an ITR at the end of the portion. The portions of the viral genome can be obtained by digesting the genome writh a restriction enzyme that cuts the genome at s location between the ITRs. Preferably the restriction enzyme cuts the genome at a location at least about 800 rnrcleotides from the IT'R_ The portions may be cut and religated to reduce the vector size and eliminate tandesired restriction sites. Por example, the B19 genome may be digasted with Bam~I. The two fragments (right end genome fragment and left end genome fragment) generated by Buml-II digestion are ligated into separate BamHI-,ytul digested pPraEX H"fb vectors (Invitrogen_Life Technologies). Soe, for example, Fig. 3. To reduce the vector size and eliminate undesired restriction sites, clones that contain the right end of the genome (pB 19-42dG) may be digested with L~'coRV and retigated. The full-length genome is generated by digesting the. plasmid cotrtaining the left end genome fragment (pB 19-44) with BanrHT and Ec113GI1 and cloning the fragment containing the left end genome fragment into the BavnHI / Elrel site of the pB 19-42d6 plastnid (Figs. 3 and 4).
rn some embodiments, it may be desirable to achieve a high e~cieney of ligation. rn that case, it is preferred that at least about 0.25 pg of the viral genome is combined with about 1 l,ig of the vector, more preferably about 0.25 to about 0.5 pg of viral genome per 1 pg amount of vector. The viral genome cap be obtained from serum or infected cells. The isolated virus may Ix high titer virus and/or concentrated to achieve tha amount of viral genome necessary for ligation. In soma embodiments, the parvovirus B 19 isolated from a sample and used to prepare . the clone is present in the sa>z~ple at about 10$ to about 10" genome copies/ ml of original sample, more preferably about IOBto about 1012 genome copies/ m1 of original sample. Virus can be concentrated from serum or infected cells using standard methods known in the art, such as for example, velocity andlor equilibrium density centrifugation using sucrose solutions in low-salt buffer. Preferably, viral genome is concentrated at about lOg to about 1014genome copies1100 ~1 of physiological solution, more preferably about 10$ to about 14~i genome copies/
100 pt of physiological solution.
S
l~drcCi~g and amplsfying a parvovirHS B19 clone in prokc ceps According to the method of cloning a vir$1 geno~ne, a vector comprising ah or a portion of the viral genome is introduoad into a prokaryotic ee)~ Methods of introduang vectors into cells are knavv~x to those of skill in the art and include transformation methods such as calcium I O salt precipitation, liposomes, polyethylene glycolIDMSO, electropormion and electro nuclear .. transport. In some embodiments, the vector is introduced into bacterial cells by electroporation, The bacterial cells are preferably deficient in racombinase enzymes such as recAl, endAl, recB, rec3, or combinations thereof. In some embodiments, the transformed bacterial cells are pr~ably L~' coli cells. In an embodiment, the E cori celts~ are MarA-, lVIcrC~-, McrF-15 , Mrs, fisdR-, and errdA deficient. In another embodiment, the E. cola cells comprise a geaotype of e14-{McrA-) d(mcrCB-hsdSMR-m~r)171 emtAl supE44 thi-.l gyrA96 relAl lac recB recJ abcC umuC:: TtZS (Kent) uvrC [F' pmA~B krclqZ.hfl S TnlO (Tetr)]; p"
mcrA Q(mrr-hs~.tMS-mcrlgC) recAl ena(A l lon gyrA96 thi-1 .~tipF~ relAl k t1 (iac proAH);
or F' mcrA
A(mcrBC-hs~RMS mrr) recAl errdAl lon.gyrA96 thi supFA4 retAl ~; ~(lac proAB).
In 20 another embodiment, the E coli cells are calls, such as for example SLTRE2~
cells (Stratagene, ra Jolla, CA); Stbl2 cells or Stble 4 cells (Invitrogcn, Carlsbad , CA).
In an embodiment, the incubation temperature for the transformed prokaryotic cells is about 25°C to about 35°C, preferably, about ZS°C to about 3Z°C, more preferably about 30°C to about 32°C, more preferably about 30°C. The prokaryotic cells preferably are plated 25 immediately following introduction ofthe viral genoma and incubated for a sufficient time to allow for amplification of the viral genonze, preferably, from about 12 to about 24 hours, more preferably tom about 16 to about 18 hours. The clone can be recovered from the cells using standard methods. infectious clones are those that can produce viral 17NA, proteins or particles when irrrroducod into other cell types.

KC1, 0.41 mM MgSO,, 103 mM NaCI, 23.8 mM NaHCOs, 5.64 mM Na~U~, t 1.1 rfrM
d{+) glucose, 3.25 NM glutathioae, 20 mM Hepes, and pH 7.3. Following transformation, the permissive cells may be incubated for about 70 min at 37°C before being plated in prewarmed (37°C) culaue medium with serum and incubated at 37°C.
S Commercially available devices and buffar systems for electrical nuclear transport, such as for example the AMAXA CELL LIhIE NUCLEC1FECTOR't'M system (Arnaxa Biosystems Inc., Natt~anc~alleey Germany; www-amax$ ecru), have been customized to transduae speciffc types of eukaryotio calls such as, for example, UT7lEpo cells UT7/Epo-S 1 cells. In an embodimcrt, UT7IEpo cells or UT7/Epo-S 1 cells are transfected using NUCLEOFECTOR'r'M
reageat R aad program T-20 on the NUCLEOFECTORr~ device accordictg to the manufacturer's insrruarons (Am~ca Biosystesms Inc., Nattermannaliee, Germany).
The aukaryotic cells includt, but are not limited to, erythroid progenitor cells, fetal liver cells, UT7/FP0 cells, UT7lEPO-S 1 cells, ar KU812Lp6 cells. In an embodiment, permissive cells include, but arc not limitai to, primary erythroid progenitor cells from bone marrow and blood; megakaryoblast cells, fetal liver cells; UT7/Epo cells, UT'llBpo-S 1 cells, KU812Epb cells, JK-1 and M~-02. Other Gulsaryatia cell types avay also be utilized including 293 cells, GIG cells, Cos ceps, Fiela cells, BIiK cells and SF9 cells.
The cells may be incubated in culture medium foflovving introduction oftha vector . comprising a parvovirus B 19 viral genorne or plated in culture medium immediately following transfection. The sells may be incubated for about 10 min to about 30 min at about 25°C to about 37°C, more pr~eferabiy about 30°C to about 37°C, more preferably 37°C before plating tht cells. Once plated, the cells ere incubated under conditions sufficient to provide for production of infectious virus. In sonic embodiments, the cells are incubated at 37°C for about 2 to about 4 hours, more preferably at least about 6 hours, more preferably at least about 12 hours, more preferably at least about 18 hours, more preferably at least about 24 hours. ~
an embodiment, the cells are incubated for about 72 hours past transfection. Infectious virus particles can be i isolated or recovered from call lysates.
To determine if B 19 virus producad by the methods of the invention is infectious, supernatants prepared from cell lysates of the cells can be used to infect non-transfected cells. In sn embodiment, the non-transfectmd cells are UT7/Epo-S 1 culls. Production of infectious B 19 virus by the methods of the invention may be detected by analyzing the infected cells for spliced transcripts of B19 gees. Preferably the spliced transcripts are spliced capsid transcripts encoding, Eor example, VP1 or VP2. In an embodanerit, infectious B19 is identified by contacting cells with supernatant from the transformed cells aid analyzing the contacted cells for B19 spliced transcripts. Detection of spliced capsid transcripts indicates the parvovitus B 19 is infectious. Production ofinfectious B19 virus may be detected by analyzing the infested cells forBl9 viral proteins. Preferably the B19 viral proteins are capsid proteins, such as for example VPl and VP2. In an embodiment, infectious parvovirus B19 virus is identified by contacting cells with supernatant from the transfected coils and analyzing the comacted cells for B 19 viral proteins. Detection of $19 eapsid proteins indicator the parvovirus ~ 19 is infectious. In another embodiment, tn vJlro neutralization assays can be performed to test whether neutralizing monoclonal antibodies against parvovirus B19 capsids are able to block the infection caused by a the cell tysater of transfccted cells. Bloc)ang of infectivity by neutralizing antibodies indicates the virur is infectious.
B. Infectious Parvovirtrs B19 Clones The invention also provides infectious B19 clones and polynucleotides encoding the infesrtious clones. 'The infectious clones may be produced by the methods of the invention. The infectious clone is comprised of all or a portion of a viral genome of parvovirus B 19 and a replicable vector that can provide fvr amplification of the viral genome in a bacterial cell. in . 20 same embodiments, the vector has a bacterial origin of replication. In some embodiments, the vector is a phtsmid. In some ernbodimerns, the vector can be selected based on the host cell as well as other characteristics such as compatibility with host cell" copy number, and restriction sites. Vectors that can be used in the invention include, without limitation, pBR322, pPraExfITb, p'UC19, and pBluescript KS. Preferably, the vector provides for high copy number of the infectious clone in bacterial cells, eg about 50.100 copies per cell. Several embodiments of the = infectious clones are described in the Frxamples and the Figures.
The method of cloning a parvovirus genome can be applied to any parvovirus genome.
Thus, an infectious clone can comprise a parvovirur genotne obtained from known isolates, those isolated from samples from infected tissues, or parvovirus genomes from any source including those genomes that have been modified. Alt or a portion of the viral genome can be cloned. Tn some embodiments, the parvovirus B 19 genome is a Rtll length ~enome. In other a embodiments, a portion of the parvovirus genome comprises or consists of nucleic acid sequence encodic~g at least one ITIt, YP2, NS and the llkDa protein is a singly replicable vector. The portion of the viral genome is that portion that is sufficient to provide for production of infectious virus. In other embodiments, the parvovirus genome comprises or consists of a ~~ 5 nucleic acid encoding an ITl't. at the 5' end and as iTR at the 3' end, VP2, NS and the l lk~Da protein in a single repiicable vector. In an embodiment, the B 19 genome comprises a polynucleotide encoding an infectious B19 clone having at least 90% nucleic acid sequence identity with SEQ ID N~:S. Tn another eaebodiment, the B 19 geaome comprises a nucleic acid v aequencx of SEQ Tin NU:S.
0 The parvovirus $19 genoxne preferably comprises one or more TTR sequences.
"ITR" or "ITR sequence" refers to an inverted terminal repeat of nucleotides in a nucleic acid such as a W iral genome. The ITRs include an imperfect palindrome that allows for the formation of a double stranded hairpin with some areas of mismatch that form bubbles. The ITRs serve as a primer for viral replication and contain a recognition site for NS protein that may be required for 15 viral ceplication and assembling, in some embodiments, the location and number of the bubbles ar areax of mismatch ate conserved as well as the NS binding site, The NS
binding site provides for cleavage and replication of the viral genome. Ia an embodiment, the parvovirus B 19 genome comprises one or more ITR sequences. Preferably, the B 19 genome comprises an ITR sequence at the 5' end and the 3' end. An ITR may be about 350 nucleotides to about 4D0 nucleotides in 20 length. An imperfect palindrome may be farmed by about 350 to about 370 of the distal nucleotides, more preferably about 360 to about 365 of the distal nucleotides.
Preferably the impdfect palindrome forms a double-stranded hairpin. In an embodiment, the ITRs are about 383 nucleotides in length, of which about 365 of the distal nucleotides are imperfect palindromes that form double-stranded hairpins. In another embodiment, the ITRs arc about 381 nucleotides 25 in length, of which about 351 of the distal nucleotisies tire imperfect palindromes that form double-stranded hairpins. In soma embodiments, a B 19 genome comprises at least 75a/o of the nuclcatide sequence that forutx the hairpin is the ITR at the 5' end and 3' end of the genome. In other embodiments, the ITRs may have I to about 5 nucleotides deleted from each end. rn prefaxed embodiments, the ITR has at least about 94 °/o, more preferably 95%, more preferable 30 96%, more preferably 9?%, mare preferably 98%, more preferably about 99%, and mare preferably 100°rb ofthe sequence ofthat ofviral genome isolated from nature, such as that of 2fi SEQ rD NO:S a SEQ ID:24. In a f~ut>~r embodiment, the ITRs comprise a nucleic acid i sequence of SEQ ID NO: l andlor SEQ 1D N0:2. The ITlis may be in the "flip" or "flop"
orientation.
The parvovirua genome may have variation due to variation in naturally occurring S isolates. For example, isolatos of psrvovirus H19 from ]nfectcd tissues can have about 90%
sequence identity or greater to that of parvovirus B19-Au (GeneBank Accession No. M13178;
SEQ ID N0:24). In some embodiments, a parvovirus genome has at least 90%
sequence identity, more preferably more preferably at least 91%, mare preferably at leant 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 959°, more preferably at least 96%, more preferably at least 97%, more preferably at Ieast 98%, more preferably at least 99%
or g~reard' to that of a parvovirus B 19 genome comprising a nucleic acid sequence of parvovirus B 19 Au (GeneBank Accession No. M13178; 9EQ 1D ~I0:24).
Jn some cases, alterations or modifications. may be made to the nucleic acid sequence of the viral genome using standard methods. The alterations may be made to add or delete characteristics to the nucleic acid sequence. For example, it may be desirable to add or delete a restriction site ar add a sequence that can servo to identify the viral genome. In a specific embodiment, a vector, identified as pB 19-M20 comprises a full length clone of parvovirus B 19 havixtg a sequence of SEt~ ID NO: ~ but with a change at nucleotide 2285 from a cytosine to a thymine, resulting in conversion of Bsrl site to a Dde site. rn another embodiment , a vector, 2a identified as pB 19-4244d comprises a full length clone of parvovirus B 19 having a sequence of SEQ Ip NO:S but with a change to eliminate an 3CbaI restriction site.
Alternatively it may be desirable to add a nucleic acid sequence that encodes a heterologous polypeptide r~o the infectious clone. Such a he'terologous polypeptide may include tag poiypeptides such as poly-histidine (poly His) or poly-histidine-glycine (poly-His-gly) tags;
i 25 the flu HA tag polypeptide and its antibody 12CA5 [Field et al., :Viol.
Cell. Biol,, 8:2159-2165 . (1988)]; the r~.myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3b10-3616 (1985)]; and the Herpes Simplex virus glycoproteia D (gD) tag and its antibody ~Paborsky et al., protein Engineering, 3(6):547-553 ( 1990)). Other tag palypeptades include the Flag-peptide [Fiopp ct al., BioTechnology, 6:1204-30 1210 (1988jJ; the 1CT3 epitape peptide [Martin et aL, Science, 255:192-194 (1992)]; an "-tubutin epitope peptide [Skinner et aL, J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag [Lutz Freyexmuth et al., Proc. Natl. Aaad. Sci. USA, 8'Iv6393.b397 (1990)].
Heterologous polypeptides are combined with viral proteins to form fusion proteins. Epetopes from other proteins rosy be combined with parvovirus 819 proteins to form fusion proteins useful as immunogeztic compositions.
Preferably, the viral genoma has at least 90% sequence identity, more preferably at least 91%, more preferably at least 92%, more preferably at least 939ro, more preferably at least 94%, more preferably at least 9>%, more preferably at least 95%, more preferably at Icast 97%, more : preferably at least 98%, more preferably at least 99'/0 or greater to that of a parvovirus B 19 genome comprising a nucleic acid seguance of SE(~. ID. NO:S. In some embodiments, the parvovirus genome, preferably has 99.2% sequence identity, more preferably 99.3°~ , more preferably 99_4%, more preferably 99.5%, more preferably 99.690, more preferably 99.7%, more preferably 99.8%, and more prefbrably 99.9% or greater sequence identity to that of a parvovirus B 19 genome comprising a nucleic acid sequence of SEQ. m. NO: S.
In soma embodiments, the B 19 genome is cloned by cloning at least two portions of the viral genome into separate vectors sad recombining the two portions into a single vector.
Preferably, tvro portions of the viral genome comprise an ITR at the end of the portion. The portions of the viral genome can be obtained by digesting the genome with a restriction enzyme . that cuts the genome at a location between the ITIts. Preferably the restriction enzyme cuts the gcaoma at a location at least about 800 nucleotides from the TTR 'fhe portions may be cut ~cnd relegated to reduce the vector sine and~eliminate undesired restriction sites.
Far example, the B 19 genomo may be digested with BavrtHI. ?he two fragments (right end genome fragment and left end genome fragment) generated by Baml~I digestion are legated into soparate ~atrrblI-S'tuI
digested pProEX HTb vectors (lnvitmgen-Life Technologies). See, for example, Fig. 3. To reduce the vector size and eliminate undesired restriction sites, clones that contain the right end of the genome (p~319-42db) cnay be digested with ~coRV and relegated. The full-length genome is generated by digesting the plasmid containing the le$ end genome fragment (pBl9-44) with ~amHI and Ec1136II and cloning the fragment containing the left end genome fragment into the BavrrHI I EheI site of the p$19-42d6 plasmid (Figs. 3 and 4).
In some embodiments, it may be desirable to achieve a high efficiency of legation. In that cast, it is preferred that at least about 0.25 ug ofthe viral genome is combined with about 1 pg of the vector, more preferably about 0.25 to about O.S pg or greater of viral genorne per 1 p.g rnlrodxcing the ir~j'actlous clo»e into other cell types Another aspect ofthe invention, provides a method of producing an infectious clone or infectious viral particles of parvovirus B19 in a eukaryotic cell. This method carp also be utilized to identify and/ or confirm that the parvovirus B19 clone produced is infectious. After the clone S is amplified in a bacterial call and recovered, th~c infectious clone may be introduced into other cell types (whether permissive or not} to identify whether the clone can produce infectious virus or for the production of infectious virus. The method provides for production of infectious vines in vitro. Utilizing an infectious clone allows introduction of the viral genome into a cell without the need for entry mediated by viral proteins such as the capsid proton. The method comprises i 10 introducing a vector comprising an infectious clone of parvovirus B 19 or all or a portion of a viral genome into a eukaryotic cell and incubating the cell for a sufficient time to produce infectious virus and optionally, detecting production of infectious virus. The method of idemifying an infectious clone comprises introduang a vector comprising all or a portion of a W iral gename into a eukaryatic cell; incubating the cell for a su~cient time to produce infectious 15 virus; and detecting production of infectious virus.
~ some embodiments, a high e~ciency of introduction ofthe vactor into eukaryotic cells is desirod. Preferably, the method of introduction employed achieves a transfection efFiciency of at least abosct 15% to 100% efficiency, more preferably about 30 to SO%
efficiency. The method is also selected to minimize cytotoxicity to the ..~xlls. Preferably, about 20% or greater of the cells 20 are viable and more preferably about 50% of the cells or greater. In some embodiments, the vector may be cut with one or mvrb restriction enzymes to enhance viral replication.
In an embodiment, eukaryotic cells are transfected with an electric current.
Methods of transfecting eulcaryotic cells utilizing an electric current are known in the art, such as far example, electroporation (Sambrook, et al., 1989, Molecular Cloning, A
l:.aboratory Manual, 25 Vols. 1-3, Cold Spring Harbor Press, Cold Spring Harbor, NY or Davis et al., 198b, Basic Methods irr Molecular Biology) and electrical nuclear transport {U. S.
20040014220}.
In an embodiment, the eukaryotic cells are transfected by electrical nuclear transport.
The cells are exposed to an electrical. pulse comprising a field strength of about 2kVlcm to about l OkVlcm, a duration of about 10 psec to about 200 psec, and a current of at about 1 A to about 30 2.5 A followed by a current flow of about 1 A to about 2.5 A for about 1 cosec ca about 50 cosec.
A buffer suitable for use in electrical nuclear transport comprises 0.42 mM
Ca(NU3~, 5.36 ~VI

_ amount of vector. The viral genotne can be obtained from serum or infected cells. The isolated virus may be high titer virus andlor concentrated to achieve the amount of viral genome necessary for ligation. In some embodiments, the parvoviws H 19 isolated from a sample and used to prepare the clone is present in the sample at about 10$ to about 10F' genome copies) ml of original sample, mots preferably about 10°to about 10~a genome cogiesl mI of original sample.
Virus can be concentrated from serum or infected cells using standard methods knovwn in the art, such as far example, vtlocity andlor equilibrium density centrifugation using sucrose solutions in low-salt buffer. Preferably, viral genome is concentrated at about 10& to about 101' aanome copuesl100 pl of physiological solution, more preferably about 10$ to about l Olz genoma copies/
100 ul of physiological solution.
The infectious olone is preferably stable and can be passaged through bacterial cell culture without toss of functional TTRs. The stability can be determined 6y introducing the infectious clone into bacterial cells and subcloning and roligating several times. In preferred ernhodiments, the clone can be passaged in bacterial calls at temperatures ranging from about 30°~ to about 37°C at least about 10 times without substantial loss of ITR nucleic acid seguence.
C. Recombina~at Methads,'Vectors, and Host Cells The infectious H 19 clot:es of the invention are produced by synthetic and recambi»ant methods. Accordingly, the i~vaation relates to polynuclaatides encoding the infectious B 19 clones of the invetitioaz (such as for example a B 19 gerwme) and host cells containing the infectious clarte~ as well as methods of making such vectors. and host cetis by recombinant methods.
'The B 19 clones of the invention may be synthesized or prepared by techniques well known in the art. Some nucleotide sequences for parvovirus B19 genomea are kaovm and readily available, for example, on the Ic~ternet at ~en8ank (accessible at www acbi-nlm-nihgov/entrtz).
The nucleotide sequences encoding the B 19 clones of the invention may be synthesized or amplified using methods knows to those of ordinary skill in the art including utilizing ril~lA
polymerases in a cal! &ea envimnment.
The B I9 clones ofthe invention eau be produced from vita! isolated obtained from biological samples. The polynucleotides may be produced by standard recombinant methods known in the art, such a3 polymerase chain reaction (Sambrook, et al., 1989, Molecular Cloning, A Laboratory Manual, Vols. 1-3, Cold Spring harbor press, Cold Spring Harbor, NY. Methods of altering or modifying nucleic acid sequences are also known to those of skill in the arc.
As described herein in the methods of the invention, the 819 genome may be assembled from polymaasz chain reaction cas9ettes sequartially cloned into a vector containing a selectable marker for propagation in a host. Such markers include dihydrofolate reductase or . neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes far culturing inE. cola and other bacteria.
The polynucleotide may be inserted into a replieable vector for cloning (amplification of the DNA) as described in the methods herein. Various vectors are publicly available. The vector may, for acample, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid seguence may be inserted into tha vector by a variety of procedures. in geaeral, DNA is inserted into an appropriate restriction endonuclease sites) using techniques known in the art. Vector conxponents generally include, but are sot limited to, one or more of a signal sequence, an origin of replication, one or more market genes, an enhancar element, a promoter, and a transoripiian termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques that are known to the skilled artisan.
lJxamples of suitable replicable vectors include, without limitation, pCR-Blunt II TOPO
vector (Invitrogen, San Diego, CA), pl?rolrX Htb vector {Invitragen, San Diego, CAS and pBR332 (Deiss et al., 1990, Virology, 175:247-254j, and pBluescipt SK. The polynuclootide can be operably linked to an appropriate promoter such as, for example, the parvovirus 1319 p6 promoter. Additionat suitable promoters are known in the art such as SV40 or ClvfV. The replicable vectors may further contain sites for transcription initiation, transcription termination, and a ribosome bindiag site for translation.
In an embodimant, the full length B 19 genome is cloned by digesting the genome with a restriction enzyme that cuts the genome into two fragments, cloning the two fragments, and relegating the two fragments to form the full-length genomc. The B 19 genome may be digested, for examples with BasrrI~. The two fragments (right end genome fragment and left end gename 3Q fragment) generated by BcmHI digestion ate ligatod into separate I3arnHI-Str~I digested pProEX
IT'fb vectors (Invitrogen-Life Technologies). See, for example, Fig. 3. To reduce the vector size and eliminate undesired restriction sites, clones that contain the right end of the genome (pB 19-42d5) may be digested with EcoiZV and religated. The full-length gename is generated by digesting the plasmid containing the left end genome frsgmettt (pB I9-4~) rwith BamHI and ~cll3dII and cloning the fragment containing the left end genome fragment into the BarnHI !
FJreI site of the p819-42d6 plasmid (Figs. 3 and 4).
Intmduction of a recombinant vector comprising a B19 genome into a host cell, such as for example a bacterial cell or eu~ryotic cell, can be affected by calcium phosphate transfeetioa, DEr~-dextran mediated transfection, cationic lipid-mediated transfection, electroparation, electrical nuclear transport, chemical transduction, electrotransductian, infection, or other methods. Such methods arse described in standard laboratory marnials such as Sambrook, et sl., I989, Molecular Claning, A Laboratory Manual, Vols_ 1-3, Cold Spring Harbor )Press, Cold Spring Harbor, N5~ or Davis et al., 1986, ~'asic Merhoats in Molecular . Biol~. Coaunercial transfection reagents, such as Lipofectamine {Invitrogen, Carlsbad, CA) and FuCxENE 6'~'M {Ruche Diagnostics, Indianapolis, ~, are also available.
Preferably 13 transfcctioa efficiency of the host cells is about 150!0 or greater, mare preferably about 24% or greater, more preferably about 30% or Beater, more preferably about 40°Jo or greater, more preferably about 50% or greatex, more prefbrsbly about 70 "!o or greater In an embodiment, eukaryotie cells are transfected with an electric current.
Methods of transfecting eukaryotie cells utilizing an electric current arc known in the art, such as for example, electroporation (Sambroak, et al., 1989, Molecular Cloning, A
I,aboratary Manual, Vols. 1-3, Cold Spring I~arbor Press, Cold Spring Harbor, NY or Davis et al., I986, .Basic MetJroats in Molecular Biology) and electrical nuclear transport (IJ. S.
20040014220).
In an embodira~cnt, a cukaryotic ce1! is transfected by electrical nuclear transport. The permissive cells are exposed to an dectrical pulse comprising a field strength of about 2kV/cm to about l OkVlcm, a duration of about 10 psec to about 200 psec, and a current of at about 1 A to about ?.5 A followed by a cunrart flow of about 1 A to about 2.5 A for about 1 msec to about 50 cosec. A buffer suitable for use in electrical nuclear transport comprises 0.42 rnM Ca(NOa~, 5.36 mM KCI, 0.41 niM MgS4~, 103 mM NaCf, 23.8 mM NaHC03, 5.8~ mM IvTa~'Q4, 11. I mM d(+) glucose 3.25 pM glutathione, 20 mM ~epes, and pH 7.3. Following 3o transformation, the permissive calls stray be incubated for about 10 min at 37°C before being plated in prewarmed (37°C) culture medium with serum and incubated at 37°C.

Commercially available devises and buffer systems for alxtrical nuclear transport, such as for example the AMA~~A CELL LLNE NUCLEO~CTORTM system (Amaxa Biosystems xnc., Nattermarmallee, Grerniany; www-amaxa-com), have been customized to traasduce specific typos of eukaryotic cells such as, far example, UT?IEpo cells UT7IBpo-S 1 cells. In an embodiment, UT7lEpo cells ar tJ?7/Epo-S 1 c~ls are transfected using NUCLEOFECTORT~
reagent R $ad pmgrarn T-2Q an the NUCLEOFECTOR'~'"t device according to the manufacturer's instructions (Ansaxa Biosystems Inc., Nattennannallee, Crermany).
b, Usca 14 The infectious clone and methods described herein can be utilised in a.
variety of assays and to develop therapeutic products. As discussed previously, methods for consistently obtaining infectious virus in call cxtlture were not previousty known. An in vitro system for producing infectious virus particles can be used in screening metlx~ds to identify agents such as antibodies or antisense molecules that can inhibit viral irtfectivity or reproduction.
The infectious virus and/
t 5 or infectious virus in a host cell can be utilized~to form immunogenlc compositions to prepare therapeutic antibodies or vaccine components. Antibodies and primers can be developed to specifically identify different parvovErus B19 isolates_ The ability to produce infectious virus consistently in vitro is also useful to produce attenuated virus that may be used in a vaccine.
The infectious B 19 clones of the imrention are useful in diagnostic assays.
The presence 20 or absence of an antibody in a biological sample that binds to a B 19 clone of the invention can be determined using standard methods. Alt~natiwely, the presence or absence ofBl9 parvovirus in a biological sample can be determined can be determined using pCl2 primers specific far nucleic acids encoding an infectious clone ofthe invention to amplify any parvovirus B19 DNA that rnay be present in tlx sample. Several primers have been described in the ILxamples_ The 25 primers and antibodies can be developed to specifically identify difl:erent viral isolates based an diilaren~ce in nucleic acid or protein sequences.
'fhe infectious B 19 clones of the imrention are also useful to produce antibodies to parvovirus B 19. The antibodies are useful in diagnostic assays for detecting the presence of parvovirus 819 in a biological sample. Methods for developing antibodies are described below.
- 30 One aspect of the invention provides a triethod for screening for parvovirus B 19 infection, comprising contacting a biological sample with an anti-parvovirus B19 antibody and assaying the biological sample for anti-parvowirus B 19 antibody binding. The antibodies, preferably recognize a particular isolate.
The invention also provider methods for sting for antibodies that may inhibit or adtagonizo B 19 infection of permissive cells- The amagonist effect of anti-parvovirus H 19 antibodies may determined by analyzing cells for B19 capsid proteins or B19 spliced capsid transcripts as described above. Antagonist antibodies can be prepared and screened ss described below.
The infectious parvovirus B19 alone and! or host cells comprising the clone can be used as itnmunogenic compositions to prepare vaccine components aodlor to develop antibodies that . 10 cau be used in diagnostic or other assays. For example, host cell cultures comprising the parvovirus 819 clone can be heat inactivated and used as as immunogen.
Passaging of an infectious clone in vitro can provide an attenuated strain of parvovirus B19 useful in vaccine compositions.
E. Production of Antibodies 1. Polyclonsl antibodies Polyclonal antibodies to infectious B 19 clones of the invention of the invention are preferably raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvaat. The r~evant antigen may be, for example, one or more B 19 clones of the invention or one or more B 19 proteins, such as NS, VP 1, 'VP2, 11-kDa protein, 7. S-kDa pmtein, and/or prateia X, derived from an infectious clone ofthe infection, It may be useful to conjugate the relevant amigen to a protein that is imrnunogenie in the species to be irnmunixed, e.g., keyhole limpet hemocyanin, action albumin, bovine thyroglobulin, or soybean trypsin inhibitor using ~ bifunctionat ar derivatizing agent, for example, maleimidobenzoyl sulfosuc;ciaimide ester (conjugation through cysteine residues), N-hydroxysurcinimide (through lysine residues), glutaraldehyde, suceinic anhydride, SOCl2, or R'N~C-NR, wharc R and R1 are different alkyl groups.
Animals are immunized against the antigen, immunogenic conjugates, or derivatives by combining, e.g ,100 pg or 5 ug of the protein ar conjugate (for rabbits or mice, respectively) I 30 with 3 volumes of Freund's compl~e adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with 1/2 to 1110 the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites.
Saver to 14 days later the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus. Preferably, the animal is bQOSted with the ovnjugate of tho same antigen, but conjugated to a different prcrteian andlor thmugh a different cross-linking reagent. Conjugates also can be made is recombinant Cell Culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response.
In an alternative embodiment, the animals are immunized with a recombinant adenovirus vector expressing one or more viral protons derived from an infectious done of the invention, such as for example VPl andJar ~'P2, followed by booster immunizations with the viral proteins.
The polyclonat antibodies generated by the immunizations may undergo a screen for B 19 antagonist activity. Preferably, antibodies to an infectious H19 clone of the invention inhibit the negative effect of H 19 on erythocyte production. In an embodiment, antibodies that speeificaliy bind a B 19 close encoded by a polynucleotide comprising a nucleic acid sexluence of SEQ m P10:5 inhibits infection of permissive cetls.
The poIyclonal antibodies are also screened by enrytne-linked immunoabsorbent assay (fiLISA) to characterize binding. The antigen panel includes 1'~S, VPI, VP2, 11-kDa protein, 7.5-kT~ protean, and protein X. Animals with sera samples that test positive for binding to one or more axperimeraal antigens in the panel are candidates for use in monoclonal antibody production T>x cxiteria for selection for monoclonal antibody production is based on a number 0 of factors including, but not limited to, binding patterns against a panel of B19 viral proteins.
2. Monoclonal antibodies Monoclonal antibodies to an infectious B 19 clone of the invention may be made using the hybridoma method first described by Kohler e: al., Nature, 256:~t9S (1975), or may be made by recombinant DNA methods (U.S, Patent No. 4,516,567).
~5 In the hybridoma method, a mouse ar other appropriate host animal, such as a hamster or macaqua monkey, is immunized as described above to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to a B 19 clone of the invention or viral proteins derived from a B 19 clone of the invention used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fttsed with rnyeioma cells using 3a a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell ((boding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)).

The hybridorna cells are than seeded and ,gown in a suitable culture medium that preferably contains one or morn substances that inhibit the growth. or survi~ral of the unfused, par~antal royeloma cells. For example, if the parental myoloma. cells lack the erixyme hypoxanthiae guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridonaas typically will include hypoxanthirae, aminoptcrin, and thynudina (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
Preferred myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-produang cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines ara routine myeloma lines, such as those derived $om MOPC-21 and MPC-11 mouse tumors available from the Sulk Institute Cell Distribution Center. San Diego, California USA, and SP-2 or X63-A~8-653 cells available $om the American Type Culture Collection, Rockville, Maryland USA.
Human myeloma and rnouso-human hcteromyeloma cell lines also hava been described for the production of human monoclonal antibodies (Kozbor, J. frnmurroZ, 133:3001 (19&4); Brodeur et al., hdar~o~clatxrl Arttibo~ Production Teclmiyues acrd Applications, Pp. 51-b3 (Mattel Dekker, Inc., Now 'York, 1987)).
Culture medium is which: hybridoma calls are Bowing is assayed for produ~ion of monoclonal antibodies directed against the antigen and HIV F..nv. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitatioa or enzyme-linked immunoabsorbent assay (1~.rrSA).
After hybridoma cells are identified that produce antibodies of the desired speciFcity, amity, andlor activity, the clones may be subclonetl by limiting dilution procedures and gown by standard methods (Coding, Monoclonal Ani'ibodter: Principles arrd Practice, pp. S9-103 (Aca~d~emie Press, 1986)). Suitable culture media fdr this purpose include, for axample, D-MEM
or RPMI~1640 medium. In addition, the hybridoraa cells may be grown in vlvo as ascltts tumors in an animal.
Tha monoclonal antibodies secreted by the suticlones are suitably separated from the culture medium, a$cites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protean A Sepharose, hydroxylapatite chromatography, gel electrophoresis, : 34 dialysis, or affinity chromatography.

The monoclonal antibodies are characterized for specificity of binding using assays as described previously, Antibodies can also be scroened for antagonist activity as described previously.
3. Human or I~umanized antibodies Humanized forms of non-human {e.g., murine) antibodies are chimeric amibodies that contain minimal sequence derived from non-human immunoglobulin, For the most part, hunuutized amibodies are human itnmuaogiobulias (recipient antibody) in which residues from a CDl2. of the recipient are replaced by residues from a CDR of a non-human species {donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specif5city, at~3nity, arid capacity. Useful non-hunnan antibodies are rttonoclonal antibodies that bind specii';cally to parvovirus 1319' Useful nocthuman antibodies also ,include antibodies that inhibit B19 infection of permissive cdls_ In some instances, framework region {FR) residues of the human immunoglobulin are replaced by corresponding non human residues. Furthermore, humanized antibodies nsay comprise residues tl~t axs not found in the recipient antibody or the donor antibody. These modiBcatiotts may be made to improve antibody al~Inity or ftunctional activity.
In general, the humastiaed antibody will comprise substantially all of $t least one, and typically two, variable domains, in which all ar substatt~ially all of the hypervariable regions correspond to those of a non-human immunoglobulin and au or substantially all of the FRs are those of a human iramunoglobulin sequence. 'fhe humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobul'm. For further details, see Jones et al., Nature 321:522-525 ( 1986); Riechmann et al., Natr~re 332:323-329 (1988); and Presto, Curr. Qp. Struct. Biol. 2:593-596 (1992}. See also the following review articles and references cited therein: 'Vaswani and Hamilton, A»n. Allergy, Asthma & Immureol. I :105-115 (1998); Harris, Bic~hem. Soc. Tranaactlo»s 23:1035-1038 (1993); Hurlc and Crross, Curr. Op. Biotech 5;428-433 (1994).
Human antibodies that specifically bind and/or antagonize parvovirus B19 can also be . made using the transgenic mice available for this purpose or through use of phoge display , techniques.
An in vitro systera for producing infectious virus particles can be used is screening methods to identify agents such as antibodies or antiscnsa molecules that can inhibit viral infectiv'rty or reproduction. A screening method comprises introducing the viral genome of an infectious clone of parvovirus B 19 into a cell and contacting the cells with a potential inhibitory agent, and determining whether the inhibitory agent inhibits infectivity or replication of the viral genome in the cells. Methods for detecting infectivity and replication of the viral genome have been described herein. Fatential inhibitory agettis include antibodies and anti sense molecules.
.. 5 The ability to produce infectious parvovirus in vitro may allow for the development of a vaccine or vaccine components. A vaccine can be comprised of heat inactivated virus or attenuated vacs. Inactivated virus can be prepared from production of infectious clones using methods known to those of skill in the art. Attenuated virus can be obtained by serially passagina the virus under conditions that make the virus nou patholoSical to humans. The attenuated virus is preferably passaged through a cell and under certain conditions that provide for an altered virus that is less pathological to humans. Vaccine cotnpoaerns can also include one or more of the parvovin,~s proteins or parvovirus protefns combined with epitopas from other infectious agams.
Afl publications, pateeats, and patent applications cited herein are hereby incorporated in their entirety by reference. The following examples are provided far ihustrative purposes only, .. and are in no way intended to limit the scope of the present invention.
if.?~AMFl~ 1 Qoning and Seqnenciag of Parvovirua B19 l(solnte J3S
Iutroductioa . The nucleotide sequentx ofBl9 was originally established by sequencing a viral isolate designated pvbaua obtained from the serum of a Child with homozygous sickle cell disease {Shade et aL 1986, J. ~irnL, 58: 921-936). Subsequently, many B19 isolates have been sequenced by multiple methods (Brdtnaa et ai. 1996, J. Gen. 'Virol., 77: 2767-2774 Following alignmem of the sequences, there is a 6% divergence amongst the various isolates (Heegaard 8z Brown, 2002, Clin. Microbiol. Rev., 15: 485-505), The single nonstructural protein (NS 1 ) gene is highly conserved, and the two capsid proteins, VP 1 and Vi'2, occasionally have a greater variability of 2-3°!° {~emauer et al. 1996, 3. Gen. Virol., 77:
1781-1785; Mori et al. 1987, J. Gen.
Virol, 68: 2797-280b).
There is no animal model for B I9, and virus can only be grown en cuhure with difficulty (Hee$aard d; Brown, 2002}. Parvovirus B 19 exhibits a selective tropism for erythroid progenitor aclls, and can only be cultured in primary erythroid progenitor cells from bone marrow, blood, or fetal liver cells, megakaryoblast cells, lfl"7lEpo cells, LJT7IEpo-S1 cells, TCU812Ep6 cells, fK-1 cells, and MB-02 cells. (Ozawa et al., 1986~rown et al., 1991; Yaegashi et al., 1989;Komatsu etal., 1993;Shimomura eaal.; 1992 Miyagawa etal., 1999), These series ofexamples establish a method of producing an infectious clone for parvovirus B 19.
Metdods Parvovirus B 19 (J35) was obtained from the serum of a child with sickle cell anemia undergoing aplastic crisis and rent to NIH for diagnostic purposes. The serum was found by dot blot assay (Nguyen et at , 2002) to contain approximately 10'~ genome copias of B 19/mL.
UT7JBpo-Sl ceUs (Shimomura et al., 1992) (maintained in iscove's modified Dulbecco's medium (M7I4n contai~ng 10% foal calf scrum. 2 Ulml recombinant human erythropoiatin (Amgen, Thousand Oaks, CA), and antibiotics at 37°C in 5% CO~) were infected with the 335 serum cornaining high titer B19 virus (Nguyen et al., 2402). DNA was extxacted by the l~Neasy°°
method (Qiagen Inc, Valencia, CA) and eluted info 100 ui of water.
To obtain the coding region of 819 genome, the primer B19-187PR
(CGCTTGTCTTAGTGGCACGTCAAC)(SEQ ID N0:16) was designed from the hairpin region ofthe virus using sequences available in CxenBank (19-HV; AF162273x SEQ m NO:1?'). Higb fidelity long PCR amplification was performed using the single primer H 19-187FR with the HF-2 polymerise Idt (BD Biosciences, Palo Alto, CA) with 25 cycles ofamplification (94°C, 1 Ss;
55°C, 30 s; 72°G 4 rein; fallowad by 72°C extGS~sion for 7 min}. The amplicon was cloned by blunt ligxtian iuta a pC,R Blunt Ii TOPO~ (linvitrogen, San Diego, CA) and transformod into One Shots ToplO competent ~ coli cells (Invitrogen, San Diego, CA).
Colonies were screened by hybridization with a ~P-random-primed B 19 probe obtained from p'~T103 as previously described for dot blot hybridization (Nguyen et al., 2002), and positive clones were confirmed by sequencing the plasmids using BigDye's ternunator cycle sequencing (ABi~Perkin Etmer, Foster City, CA). The fall-length sequences of both strands were obtained by primer walking.
To obtain the complete hairpin sequence, primers (Table 1) were designed from the clo~xtl sequence and from B19 sequences available in GenBa~sk. PCR
amplification was performed using FrxTaq polymerise with 34 cycles of amplification. Thc'PC~i products were i ligated into PCR2.1 TQPC?'a by TA cloning (lnvitrogen-Life Technologies), Top 10 cells transformed, and the products sequenced as above.
j Al! DNA sequences, and the amino acid Sequence of open reading frames, were analyzed using Lasergene°'saRv~nue (DNAStar, Inc., Madison, Wn. DNA pairwise homology was S deterjnined by Lipman-1'earson, method with a I~tuple of 2, gap penalty of 4, and deletion penalty of 12. Multiple sequence alignments were d~errtuned using the MegAlign program, using the Clustal method with a gap penalty of 10 and gap length penalty of 10, Table 2. List of primer pairs used for PCIt SEQ >D Primer Nucleotide Sequence (5'-3')Product (bp) No.

18 B19-1F CCACGATCiCACyCTACAACTT

19 B 19-1868G?GAGCGCGCCGC'I"fGTCTTAGTGr186 23 g19-4899FAACACCACAGGCATGGATAC X18 IO
Discussion The complete B 19 coding region, including half of each ITR, was ataplifeed using PCR
Although several plasmids containing the B19 geriome were obtained, only one clone, obtained using the primer B19-187FIt,, did not contain deletions. This plasmid, designated as pB 19-N8 15 (Fig. 1), was sequenced, and oontaiaed a 4844-nucleotide sequtnce including the entire coding region, and 177 rnicleotides ofthe fTR. The nucleotide sequence ofthis B19 isolate (J35) had v g9.1% identity to that of B19-Au isolate {GenBank M13178)(SEQ 1D No:24). The putative NS, VP1 and VPZ capsid proteins had 99.4°!0, 99,4% and 99.6°!o Iwmology respectively, at the artiino . acid level compared to the B 19-Au isolate.
20 The J35 isolate ofBl9 has a genome of5592 nucleotides, possessing ITRs of381 nucleotides is length. The distal 361 nualeotidea ofthese repeats ware imperfect palindromes that form double-stranded hairpins. This normally exist in two sequence orientations, "flip" or its reverse-complement "flop", believed to result from hairpin transfer during replication (Deiss et al., 1990).
The complete seguence analysis of the viral genome (J35) indicates that bath the 5' and 3' ITRs have two sequence conFgorations (SEQ m N0:1 and SEQ 1D N0:2) analogous to the . S flip and flop formats previously reported by Deiss et al. (1990) (Figs. 2A
and ~; SEQ ID NO:3 and SEQ In N0:4). Although several base changes within the iTRs were identified compared to the previous published sequence ofB 19 {Dales et al., 1990), the size and the positions of the bubbles formed by unpaired nucleotides iu these palindromic sequences era conserved among : diffea~ent B 19 isolates, suggesting an important role of these structures in the fife cycle of B 19 virus, In comparison to the previously reported B19 sequence, the hairpin of B
19-J35 isolate was shorter by two nucleotides at both 5' and 3' ends, but this deletion does not appear to affect viral replication and infection. Unlitte other parvoviruses, the hairpins of B 19 do not appear to form a Y- or T-shape structure at the turnaround.

Comsstruct~n of B19 Clopes Iatroductieu There has only been one previous report of the intact TTRs of the human pathogenic parvavirus B 19 (Deiss et al., I990). in .Dales et al., the genome was cloned in two halves, and the sequence of the ITRs obtained .However, laeias et al. were riot unable to successfully ligate the two halves of the gename together nor could shay cod that the TTF.s were correct by functional studies. Other attanpts to produce an iafecdaus clone wem also unsuccessful due to deletions in the 1TR sequences (Shade et at , 198C) and the instability ofthe ITRs in bacterial cells. Our attempts to construct a full-length clone by ligating the ITR
sequences to pB 19-N8 were repeatedly unsuccesst~l.
In the present examples, we succe9sfully clone the full-length B 19 genome using low incubation temperatures sad Sure°~'Z competent ~ con cells (Strategene, La Jolla, C.~i) that are deficient in major recombination genes. B 19 packages equal numbers of both positive and negative DNA strands (Summers et al., 1983) and has a unique Batnlal restriction enzyme site in the genome (Cotmore a~ Tattersa11,~1984). These properties were used to clone the full-length $19 genome in two halves (Fig. 3). We also tested whether the full-length 819 genome, especially the YTR sequences, would be stable in the plstsmid backbone during the multiple steps of molecular eloniag experiments.
Methods B19 DNA was purified from 50 ut of viremic serum {135) using the high Pux~~
Viral Nucleic Acid Kit (Roche, xndianapalis, ILV) to obtain approximately 1.5 pg of double stranded B19 DNA. Double stranded viral DNA (4.5 pg) was digested with BarmHI and both resultit~
&agmeats were legated into BarnHI-StuI digested pProEX HTb vector (invitrogen-Life Technologies). The liga.ted products were electroporated into dectmconnpetcnt Sure~2 E cvlr cells (Stratagene) using s BTx electroporator, than the bacteria were immedistely~plated and incubated overnight at 30°C. The resultant colaniss were screrned for inserts. To reduce the vector size and eliminate undesired restriction sates, clones that contained the right end of the . gcrnome were digested with L~'coRV and relegated (pB 19-42d5). The inse~'t of the plasmid, together with the insert ofthe left end captaining plasmid (pHl9.~) was completely sequenced.
To create full-length clones, pB 19-44 was digested r~rith BcurrHl and Ecll 36Ir and the fragments containing the left end of the geaome were cloned into the BamHI I Ehei site of the pH i 9-42db plasmid resulting in plrt29-X244 (Fig. 4).
To test the stability of the plasmid containing full-length B 19 geziome, pB
19-4244 was digested with BaynHI and relegated, and then transformed into Sure~2 cells, After incubation at 30°C av~night, 18 colonies were picked up from the plates and the bacteria were propagated at 30°C. The plasmids were purified and mapped by restriction digestion withHinc~Tl, BssHII, and Sc~II_ The fragments were then analyzed by agarose-electrophoresis.
Il~cussion Of the 192 clones that were analyzed, 5 contained the untnirrcated 5' end of the genome, . and 2 clones contained the untruncated 3' end of the genomc, t~li the untruncated clones had the game "flip" format for their I'fRs (Figs. 2A and 2B).
After legation of the plasmids together, two identical clones consisting of the full-length B19 genome wcne selected and designated as 819-3b and pBl9-4244; GenBank AY38633b;
SEQ 113 NO: 25 (Fig. 4). These fGII-length cloys were sequenced rind the sequences of inserts showed 100% identity to the corresponding region in the pBl9.N$. The full viral genorne was 5592 nucleotides long, with terminal repeat sequences of 381 nucleotides that formed an imperfect palindrome. In comparison to the previously published sequences (naisa et al., 1990), and the one unpublished sequence in GenBank (Big-hiV; AF1b2273)(SEQ 1D
NO;1'Tj, there were two toss nucleotides at the start and end of the genomey resulting in a palindramic sequence of 361. As chewed in Fig. 2B, the nucleotide sequences pf the flip and flop are slightly different from that reported by i7eiss et al. (1990) but the numbers and positions of the unpaired nucleotides in these palindromic sequences are conserved among the two diffec~ent B 19 isolates.
'We testod whcihcr the full-length B 19 genome, especially the TTR sequences, were able to be stabilized in the plasmid backbone during the multiple steps of molecular cloning experiments. The plasmid pB 19-4244 wan digested with Batn~I and rcligated, and then transformed into Sure~2 cells. After incubation at 30°C overnight, 18 colonise were picked up fl-om the plate for pur'dxcation and ruapping by restriction digestion. A11 of the plasmids tested (18/18) had the correct restriction sites, and there waro no deletions in the hairpin sequences.
'The plaamids were serially passed and then sequenced to confirm the absence of deletions in the hairpin sequences. We found no evidenco of deletions under the conditions used in the present study.

Introduction of Mutations into A B19 htfectious Clone Introductfatt As an experimental control, a second infectious close was produced. This clone was generated to have the same nucleotide sequence as plasmid p819-424.1, axcopt far a single nucleotide substitution to conf rm that the infectious clone could generate infectious vines. The production of an infectious clone and the ability to manipulate the plasanid will allow five genome to be studied more systematically.
Method A second infectious clone was produced by site directed mutager~esis. The cytosine at position 2285 (B19-J35 isolate) was replaced with a thymine to generate a rocagnitian site for restriction enzyme pdeI to produce a naturally existing variant of BI9 (8 a 9..Wi isoiate, CenBank M24682; SEQ D~ N0:26). The full-length plasrn~id pBl9-4244 was cut with Nh~I and the S' overhang filled in using T4 polym~a~se....Tba.tl~. p~smid.w~ sedig~st~
:~ah.~a:, the 1319 fragment (from nucleotide 1247 to 3423 in the genome of H 19-J35 isolate) ligated into an Xlaal-Ecll3fIi-digested pBluescript~ KS+: phagemid vector (Stratagene), and site-specific mutagenesis (C2285T) was performed using the QuikChange~ Site-directed Mutagenesis Kit (Strtrtagane) and primers CMCf (CATTTC~TCGGAACiCTCAtt?TTCCTCCGAAG; SEQ ID
N0:27) and CMCr (CTTCGGAGGAAACTGAGCTTCCGACAAATCr; SEQ ID N0:28). To eliminate an undesired XbaT restcictioa site in the vector sequeatoe of the plasmid pB 19-az44, the plssmid was digested with Ec1136I1-for ettxyraes; the XhoI overhang was blurned with T4 polymsrase, and the pIasmid was religated (plasmid pBl9-42444, dig. 5). The plasmid with the 819 fragment containing C2285T mutation was digested with MxGI Xbal and tha 819 fragment was ligated into the MscI-XGaI digasted pB 19-42444 plasmid resulting the p819-M2p clone ' (Fig.6).
Dis<euas:ion Although t#ee cloned sequence was 99% identical to the 1319-Au sequence, it was observed that there was a single nucleotide ditTa-ence between the J35 sequence (and 1319-Au) and the published sequence of another isolate B19-'Wi (CxenBank M24682) that would convert a .i3srI site in J35 to a DdeY sate. This site was within the RT-PCR product ampliixed with the primer pair ofBl9-2255 and H19-2543 and could potentially be used to distinguish transcripts, and hence, viruses with the ditlrerent .sequence. We therefore constructed a second plasmid, pBl9-MZO (Fig. 6), that contained the identical f'hll-Length clone, but in which tha cytosina at the nuclcodde of 2285 was replaced by thymine (C2285T).

Infection of Cilia with B19 and Detection of Iteplieative Forms pf 18151 ir: IylfECted'Cell9 lntrndaction During the replication of parvovirus B 19, the viral single-stranded DNA is converted to a double-str~tuded replicative form which hat either tut "extended" or a "turnaround" form at the t~nainal regions. These irnermediate structures provide evidence for viral DNA
replication and i can be distinguished by BcmrT~ restriction enzynne digestion (Cotmore &
'fatter3all, 1980 (Fig.
7). .
To test whathar the B 19. genome inserted in p1g 19-4244 could be excised from the flankiag vector seguences and produce progeny viral DNA, we compered So~uhern blot analysis of the bNA purified from the cells trar~sfwith either plasmids cut with Salt enzyme {which releases the full-length BI9 genomt from the plasmid, Fig. 4) or intact plasmids. Additionally, RT PCR wss used to detect transcripts for viral capsids in RNA reco~rored from transfected cells.
The presence or absence of B I9 capsid proteins was detected via immunofluorescent microscopy. By these experimental methods, the presence, transcription, acrd e~cpression of the aapsid gene could be confirmed.
Method The conditions and reagents for transfecting plasmid DNA into UT7lEpo-Si cells were first optimised using the plasmid pEGFP F (BD Biosclences, Palo Aho, CA) that encodes farnesylated enhanced green fluorescent protein (EGFP). Cells were examined at daily intervals for expression of EGFf by UV microscopy and by 1~ACS analysis. Conditions that gave the maximum number of cells expressing FrGFP with minimum cytotoxicity were chosen. For subsequent experiments UT7/Epo-S1 cells were transfected us'~ng the AIVIA.,~A°' Cell ~,ine I~lucleofector~ kit R according to mauuf~tur~'s instruction (AMAXA Biosystems Inc., ' 20 Nattartatannallee, Germany). The cells were harvested at various times posttransfection and used for DNA, RNA, and immunofluorescence studies. For infection studies, cells were harvested at 72 #t posttransfection, washed free of inoc~xlums using fresh culture medium, and eel! lysate prepared by tht~ cycles of freezeltbawing. After centrifugation at 10,0008 for 10 min, the clarified supernatant was treated with RNase {final concentration of 1 U/l,i.l, Roche Applied Science, Indianapolis, IN) and collated for further infections.
Total RNA was extracted from the 1JT7/Epo-S1 cells (2xlOs) using RNA STAT60TM
(Tel-Test Inc., Friendswood, T~. Residual DNA was removed by DNAse I treatment (final concentration, 90 U/rnl) for 15 min at room teraperature. RNA was converted to cDT~A with random hexamers and SuperScripfr'M II (Invitrogen), and RT PCR for flue spliced capsid trsns~pts was performed with primers H 19-1 (5'GTTTTTTCfTC3ACrCTAACTA3 ; SEQ
ID
NG:d) and 819-9 {5'CCACGAT(~CAAC3CTACAACTT3'; SEQ Ip N0:7) as described in (Nguyen ei a~, 2002).
To exclude the possibility that the transcripts detected were derived from laboratory contamination of B19 viral RNA, the cDNA derived from the pM20-transfected cells were PCIt amplified by using a primer pair ufBl9 2255 (CGAACCAGTTCAGGAGAATCA; SEQ )D
ND:B) and 819-2543 (TGGCACCTACATCCiCACCAA; SBQ II? N0:9), which anaealed proximal to the region containing the sits of mutagenesis (C2285T). After purification using QIAquick°° P'C.R Purification Kit (Qiagea Inc., Valencia, CA ), the PCR products were digested with DdeI m 37°C for 2 h.
Immuraof luorescertce. Infected or tranQfected oelis wero harvested alxd cytooernrifuged {i 500 rpm for 8 wins in a Shandon cytaspin 2 cytocentrifge). The cells were fixed in acetone:methanol (l:l) at -20°C for 5 min, washed'twice in phosphate buffered saline (PBS) containing 0.1% fetal bovine seruun, and incubated with a mu~rine anti-819 capsid protein monoclonal antibody (521-5D, gift of Larry Anderson, CDG) in PBS with 10%
fetal calf senun for 1 hr st 3T°C. After washing the slides twice in PBS, the elides wtrc inca~bsted with . 15 fluorescein isothiocyanate (FITC)-labeled goat anti mouse IgG a~ibody (Jackson Immunoch Laboratories, Inc., West Grove, PA) in PBS with i0% fetal calf serum and counterstainad with Evens Blue for 30 mires at 3?°C, washed in PBS, and examined by UV
microscopy.
Southern blot analysis of 819 DNA. 1)NA was extracted from H 19 infected UT7IEpo-S 1 cells (SxIO~ as previously described (Shimomura et al" 1992). Briefly, 5x101 cells were incubated with 100 mlvt NaGI, 10 mD~ITris-HCl (pH 7.5), 0.5% sodium dodecylsufatc (SDS~ 5 mM EbTA, and Z00 ug/ml proteinase IC Overnight at 37°C followed by phenol-chloroform extraction. For some experiments high and low-molecular weight DNA were separated by the Hirt method {Iiirt, 196?). Purified DNA (400 ng) was digested with 20 U of Ba»tH I {single cut in H 19) ar F~coRI {no ant in B19} at 3?°C for 4 h. The &agmertts were then separated by agarose-elecxrophoresis, transferred to a nylon membrane (Nylon+, Amersham), and hybridized with a 32P-random-primed probe of the complete B 19 coding region as previously described (Shimomura ei al., 1992).
3A Discussion The plasnud pLGFP F ryas used to optimize the conditions for transfecting UT7/Epo-S1 4s cells. Although standard electroporation and liposomes were also tried, the best results were obtained usin$ the AMAXA~ Cell Line Nucleofector aystern'rM. The highest transfection etxciency (~70°/.) with minimum cytotoxicity (--20~%) was achieved with reagent R and T-2D
program using 3 ~g pEGrFP DNA and 2x10b UT7/Epo~1 cells, following the manufackurer's instructions (AMAXA Biosystcms Inc., Cologne, (3~ermany).
UT7lEpo-81 cells were transfected with plaamids pB 19-4244, pB 19-M20, and pB

under the same conditions, and harvested at 72 h post-transfectioa The RT-PCR
and immunofluores<xnce assay ware perfornnod to detect the viral spliced transcripts and capsid proteins. After RT-PCR, two amplicons of 253 by and 133 bp, representing the alternative spliced transcripts of 819 capsid gene, rxrere detected in the cells transfected with either pla,smid (Fig. 8). By immunofluoreacencef assay, Bi9 capsid protein was also detected in the transfected cells, weth approximately 15% of the cells having a positive signal when transfected with pH 19-4244 and (Fig. 9B) sud 5°~ with p819-pN8 (Fig. 9C). There was a significant difference in the number of positive cells between the two different plasmid constructs althou~
the same amount ofplasmid DNA was introduced into the cells under identical conditions.
Infection with B19 wild-type virus (1~ 5 isolate) gaveapproximately 20'/o positive cells (Fig.
9A).
At 72 h postr<ansfection, the DNA was extraaxed from the cells and incubated with the restriction endonuelease F.coRI (rro cuts in the parvovirus 819 genome) or Baa~nHl (a single cut in the parvovirus genome). As in:B 19 infection of tTT7Bpo-S 1 cells, distinct doublets of 1.5 kb and 1.4 kb were detected in all the transfeCted cell samples digested with B~tHI, but not in the plasmid controls (Figs. 14 and 11 )_ Althoe~gh a portion of the signal for the 4.1 and 1.5 kb bands in Fig. 14 is contributed by the transfected DNA, the 1.4 kb band is a definitive marker for viral genome replication. In addition, a: band with a molecular size of 5.6 kb, which carrespands to the size ofthe viral B 19 genome, wag detected in EcaRI-digested DNA from the cells transfected with undigested (Salt plasmid pBl9-M20 (Fig. 11). This indicated that viral progeny DNA was produced because neither the B 19 genome nor vector contain an EcaRl restriction enzyme site, Although equal amounts of DNA'of either SaII-digested plasmid or whole plasmid were introduced into the cells, the baac~ density of the replication intermediates in the sample of Sal!-digested fragment appeared to be stronger. This suggested that the replication process was facilitated when the viral geaome;was reltased from the vector backbone.

EXAMPIL.IE s Confirmation pf B19 Infectious Virus ><ntrafaction To determine if infectious virus ware generated from the UT?~Epo-S 1 cells transfected with plasmid pBl9-4244 or pBl9-M20, the sup~eraatant from the cell lysates was tested for the detection of spliced transcripts of viral capsid ones by RT-PCR We also performed irr ultra neutralization assays to con~rrn that the infecrivity of the cell lysates was mediated by newly syrnhesized B19 virons. >~inally to cordirm that the viral transcripts in the inoculated cells were being generated from the infectious clone and not from Laboratory contamination of wild type J3 5 virus, we also used the second infectious clone (pBl9-M20) that carried a DdeI site that was present in other B19 isolates but not in 335 virus.
lViethod 1~or infection studies, 2x104 ofUT?lEpo-81 cells is 10 lal ~M were mixed with an equal volume of sample or positive control (J35 serum diluted to contain 10$
B19 genome copies) and incubated at 4°C for 2 h to allow far maximum virus-cell int~aetion. The cells were then diluted to 2x10s cellslml in the culture medium, and incubated at 37°C, in 5% CO~. Cells were harvested at 3 days post infection and tested for evidence of infection by detection of viral transcripts and protein expression- To determine if infectious virus were generated from the UT?/Epo-S 1 ills transfected with plasmid pB 19-4244 or p1B 19~.M20, the suparnatant from the cell lysates was tested for the detection of spliced transcripts of viral capsid genes by RT-PCR.
Plasmid pBl9-NB, which dons not contain intact IT'1!ts and should not produce infectious virus, was used as a negative control. B19 infected UT?/Epo-Sl cells were used as a positive comrol.
In vitro neutralization assays were performed to test whether peutralizing monoclonal antibodies against parvovirus B19 capsid$ were able to black the infection caused by the cell lysates of transfocted cells. The clarified cell Lysates prepared from the transfected cells were mixed with monoclonal antibody A and E (Yoshimoto er a~, 1991) at a dilution of 1:10, and incubated at mom temperature for 2 h. The anti B 19 monoclonal antibody A
without neutralizing activities was used a6 control ?he infection Studies Were performed as described above.

piscussioa As observed previously, following transfection, spliced transcripts were dettcted in all the samples including cells transfected with pBl.9-N8 (Fig. 8). T~nmndiately after inoculation of the clarified supernatant into the iJT7lEpo-g I cells, ao RT-PCR product was detected in any of S the sarnplo (Fig. 12A), indicating that there was no carty..over of the RNA
from the transfected cells. At 72 h post-inoculation spliced transcripts were.detected in the samples derived from the cells transfected with pB 19-4244 and pB 19-M20, but not with pB 19-N8 (Fig.
12.B), confirming that the full-length viral genome containing complete ITRs is essential for geateration of infectious viral particles. In addition, no viral..transcripts were detected is cells in which the plssmids were directly incubated with the cells (no elactroporation) (Fig.
128), suggesting that the detection of transcripts in the colts inoculated with transfected-cell lysate was due to the production of infectious » 19 virus from the plasmid.
The infecttd cultural were also examined for the production of parvovirus BI9 capsid proteins. At '72 h post-izroculation capsid proteins could be detected is the nuclei and cytoplasm of tails with the supernatants derived ifom either B 19 infection or pB 19-M20 transfection {Figs.
13A and 13B), but not in the cells inoculated with either pBl9-N8 cell lysate (Fig. 13C), or directly with plasmid.
We also performed irr vitro nsutralizatioa assays to confirm that the infectivity of the cell lysates was mediated by newly synthesized B19 virons. Incubation of the aril lysates with neutralizing monoclonal amibody E (Yoshimoto er al.,1991) reduced the infeccivity to undetoctable levels in the IFA testing. In contrast, incubation with a similar concentration of monoclonal antibody known to be non neutralizing {monoclonal antibody A) had no effect on infection. This result Further supports our infection experiment, indicating that infectious viral particles were produood from the cells transfectod with the plasmids containing full-length B 19 genome.
Finally to confirm that tlse viral transcripts in the inoculated cells were being generated from the infectious alone and not from laboratory cnmamination ofwild type J35 virus, we constructed the second infectious clone (p819-1Vi20) that carried a JadeI situ that was present in other B 19 isolates but not in J35 virus. The sequencing analysis of the plasmids constructed in sito-specific mutagcnesis showed that full-length B19 genome including complete fl"Ii was stable during serial passages in Surc2 bacteria cells, demonstrating the capacity for manipulating ' and stably passaging the infectious clone. After transfection, the viral transcripts were tested by restriction enzyme digestion for the presence ofthe arti8cially.ganarated DdeI
site (Figs. 14 and 15). No .DdeI site was present in transcripts generated by wild-type H 19-J35 isolate infection. A
pdel was present only in transaipts from cella infected with tyBate from p819-M20-transfected cells (Fig. 15).
1~XAMPLE 6 hdexrti~fication of Viral Y'rnt~ng Involved in B19 Irnfectlan a introduction Iti common with other parvoviruses, B 19 has a small (22 nm), nonenveloped, icosahedral capsid packaging a single-sd~nded DNA. The 819 genome has approximately 5,600 nucleotides.
The ends of t6c genome are long inverttd terminal repeats (ITR) of 383 nucleotides in fength, of which the distal 365 nucleotides form an imperfect palindrome (Dales et aL, 1990).
' Transcription of the 819 viral ganome is controlled by a single premolar p6 that regulates synthesis of nine viral transa~ip2s to produce one aousu~uctural protein (NS), twa capsid proteins (VPl and VPZ), and two small .proteins (I 1-kDa and ?.5-kDa) of unknown function (St. Amend at al., 1993, urology, 195:448-455). Additionally, there is a putative open reading frame encoding a functionally unknown small protein X (9-kDA).
Ia order to experimentally define the cola of these genes, we utilized the infectious B 19 . 20 clone described in Exempla 1 to generate knockout mutants in which the translational start colon for each of the described viral genes was substituted with a stop colon.
lVletbods To knockout exptussion of YP1, 7.5- kDa gmtein, or protein X, the translational initiation site (ATG) at 5' of the gene was replaced with a stop colon (TACx}. 1'lasmid pB 19-M20/Vl' 1 (-) corttaincd a knockout mutation fvr Vl?'1. Plasenid pBl9-M201f.5(-) contained a knockout mutation for 7.5 klaa protein. Plasn~id pB 19-M20fX(-) contained a knockout mutation for protein X.
To prepare these knackaut plasmids, the full-length plasntid pB 19-4244 w$s cut with MrsI and the 5' overhang filled.in using T4 polymerise. The linearized plssmid was redigested v with Xbal, the 819 fragment (from nucleotide 1249 to 3425 in the genome of H
19-335 isolate) ligated into an XIxrI Ecll3bll-digested pBluescriptll KS+ cloning vector (Stratagene), and sitc-specifie mutagenesis was performed using the Quickchangc Sitc-directed Mutagenesis Kit (Stratagene). The primers shown in Table 3 were used in the situ-spec mutagenesis.
Table 3. KnocLcout 1~CR primers Gene Primer Nucleotide Sequence SIrQ Mutation m NO

VPI Forward5'GCAAAC~CTTTGTAGATITAG SEQ ID A2624T
aad v AGTAAAGAAAGTGrGCAAATGG N0:29 T2625A

' TGGG3' 'R~er3t'>'C;CAt',CA'iTTCrCCAC'I"'i'FCT'f'SEQ ~'r ~ ..
' TACTCTAAATCTACAAAGCTTT N0:30 GC3' 7.5-kba ForwardS'GATTTCCCTGGAATTATAGC SEQ Il) A2084T
and protein AGATGCCCTCCACCCAGACG3' N0:31 T2083A

Reverse5'GGTCTGGGTGGAGGGCATCT SIaQ
ID

C3CTATAATTCCAGCGAAATC3' NQ:32 Protein Forward5'AGTeATCATTTTCAAAGTCTA SEQ rD A2874T
~ and GGACAGTTATCTGACCACC3' N0:33 T287SA

Iteverx5'GGTGGTCAGATAACTGTCCT SEQ In . AGACTTTGAAAATGATGACT3' Nt):34 To eliminate an undesired.YbaI restriction site in the vector sequance of the plasmid pBl9-4244, the plasmid was digested with Ec1136II-XhoI et~.zymes, the .xhol overhang was blunted with T4 polymerase, and the plasmid was religated (plasmid pB 19-4244d).
ld To knockout expression of 11-kDa protein, the third translational initiation site (ATG) at 5' of tlx I I -kDa protein gene was replaced wide a stop ~ (TAG). Plasmid pB
19-M2U111 (-) contained a knockout mutation for 11-lcDa protein.
Tbs foil-length plasmid pB 19-4244 described is Facample 1 was cut with Xabl and .BhvClY and tllc H19 fragment (from rn;clootide 1247 to 3423 in the genome afBl9-J35 isolate) was ligated into an XbaI BbvCl-digested p8luescriptII KS+ cloning vector (Stratagene), and site-specific mutagc~nesis (A4917T, T491$A) was performed using the Quickchange Site-directed Mutagorresis ICit (Stratagene) and primers of Pi 1 (..)F3 (5'CACCACAGACATGGAT'rAGAAA.ACrCCTGAAGAAT'fGTGGAC3'; SEQ Ip f~IG;35), and P11(-)R3 (5'GTCCACA.ATTCTTCAGC~C'TTTTC'fAATCCAT('xTCTGTGGTG3'; Si~Q ID
NG:36). Plasmid with the B19 fragment containing both the A491TT and T4918A
mutations was digested with Xbal-~tbvCl and the &a~ment was ligated inta XbaT BbvCI aI
digested pB 19-4294d plasmid.
To disrupt the ~cprassion of NS protein, the full-length plasmid pB 19-4244 was cut with A, flB (at nucleotide 756 in B 19 ~enome) and the 5' overhang fthed in using T4 polymerase. The linetnrized plasmid was religated with T4 ligase, which generated a stop colon and disrupted the open reading frame of NS. The plaa~id was earned pB 19-M20lNS(-).
To obtain the ITR deletion mutant, the primer B19-187FR (Table 1) was designed from the hairpin region of the virus using sequences available in GenBank (19-H'V;
Genbank accession number AF 162273). I~gh fidelity long PCR amplification was performed using the single primer B19-187p'R with a HF-2 polymeraae kit (BD Biosciences, Palo Alto, CA) with 25 cycles of amplification (94°C for 15 sec; 55°C for 3A sec;
72°C for 4 min; Followed by extension at 72°C for ? min). The amplicon was cloned by blunt ligation into a pCR-Blunt if TQPO
(Invitrogen-Life Technologies, San Diego, GA) and transformed into ToplO cells (Invitrogen-Irife Technologies).
v 20 Colonies were screetred by hybridization with a 3~P-random-primed B 1B
proba obtained from pYT103 as previously described for dotblat hybridization,(Nguyen et al., 2002) and positive clones confirmed by Sequencing the plasrnids using HigDye ternninator cycle sequencing (ABI-Perkin Elmer, Foster City, CA). The full-length sequences of both strands v~rere obtained by primer walking. One clone (pBl9-i~18) contained a 4844-nucleotide sequence including the ea~tire coding region, and 177 ~aleotides of the fI"R at both 5' and 3' ends (GenBank AY38633a}.
UT'7/Epo-S1 ells were txansfected with the 819 variant plasmids using the AMAXA
Cell Line Nucleofector~ kit Raccording to the manufacture's instructions (AMAXA
Bioaystems Inc., Cologne, Germany). The cells were harvested at various times post-transfection and used far DNA, RNA, and immunofluorescence studies. For infection studies, cells were harvested ?2 h post-transfection, washed Gee of inoculuins using 8resh culture SI

medium, and cell lysates prepared by three cycles of freezelthawing. After centrifugation at 10,000 g for 10 min. the clarified supernatant was treated with R~Tase (final concentration of 1 Ulgl, Ruche) and collected for further infections.
B 19 variant transcripts were detected using RT PCR Total RNA was extracted from the UT7IEpo-S! cells (2x10 using RNA STAT60 (Tel-Test lnc., Friendswood, 'f~.
Residual DNA was removed by DNAse I treatment ($nal concentration, 90 Ulml) for 1 S min at room tennperature. RNA wax converted to cDNA with randoui hexamers and Superscript II and RT-PCR for the spliced eapsid transcripts was performed 'with primers B ! 9-1 and B 19-9 as described in Eus~pte 4.
To exclude the possibility the detected transcripts detected were derived from laboratory contamination of B 19 viral RPTA, cDNA derived from pM20-transfeaed cells were PCR
amplified by using a primer pair of $19-2255 and B19-2543 (Table 1), wlrich targeted on the region containing the site of mutagenesis (C2285T). After purified by using ()lAquick PCR
purification Rit (Qiagen rnc., Valencia, CA), the PCR products wcre digested with DdeI at 3~"C
for 2 h.
B 19 variants were analysed for capsid protein expression using the indirect fluorescent antibody assay described in lExample 4. Tnfected or transfi~ted cells were harrrested and cytocentcifuged (1500 rpm for 8 minx in a Shandon cytospin 2 cytoceattifge).
The cells were fixed in acetone:methanol (1:1) at -20°C for 5 nun and washed twice in phosphate buffered saline (PBS) carnainiag 0.1% fetal bovine serum, and incubated with a mouse monoclonal at~ti'bady speci~CC to B 19 capsid groteins (521-5D, obtained from Dr. Larry Anderson, CDC) or a rabbit polyclonal antibody to 11-kDa protein in PBS with 10% foal calf serum for 1 hr at 3'7°C.
For double IFA staining, a lissamine rhodamine-labeled goat and-mouse IgG'r and fluorescein isothiocyanate~.labeled goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Z5 Ync.,1>Vest Grove, fA) were ustd as secondary antibodies. The B19 variants were then examined for capsid proteins using confocal microscopy (1_.SM 510, Leica).
riiscussioa No infectious B19 virus was detectad in cells transfected with NS, VP1, or 11-kDa protein knockout plasrnids. AS shows in figs. 16A E, immediately following transfection, spliced transcripts were detected in cells transfocted. with pB 19-M20 (Fig.
16A), pBl9-.~ M20lVPl(-} (p'ig. lf>B), pal?-M20l11( ) (Fig. I6C), pH l9-M20/7.5(-) (Fig 1615), pBl9-M2U/X
. (-) (Fig. 16E), or pBl9-N8 {TTR deletion; Fig. lbk~. 1~~To spliced transcripts were detected in cells transfected with pBl9-M20/NS(-) immediately follorning transfmction {Fig.
16A).
Immediately following infection of UT7lEpo-S 1 cells with clarified supernatant from the transfected cells, no RT-FCR product was detecxed in any of the calls, indicexing that there was no carry-over.of the RNA from the transfected cells (Figs. 1fA F~. Seventy-two h post-inoculation, spliced transcripts were datected in cells infected with supernatant derived from cells transfected with p819-MZO (Fig. 16A}, p819-M24/7.5( ) (Fig. 16E}, or p819-Nt20JX {-}
(Fig, 16E), but not pB 19-M20lNS{-) (Fig. 16A~), pB 19-M24lVP I(-) (Fig. 16B}, pB 19-M20I11(-) (Fig. 16C), or pB 19-N8 Wig. 16F). The data irr Fig. 16 indicated that knocking out expression of 11-kDa pratain, 'V'Pl, N9, ar TTR reduced the production ofittfectious viral particles to an undetectable level-Knocking out 11-kDa prateia changed the expression and distribution pattern of B l9 viral capsid protein {Figs. 17A D). In cells transfected with wild-type infectious clone, viral 1S capsid protein first appeared in the host cell nucleus and was transported into the cytoplasm at a late stage of infection. Capsid protein was either evenly distributed or formed fine clusters in the cytoplasm and nucleus. In cells transfected with l I-kDa protein knockout plasmids, production ofvirdl capsid protein was aigniftcantly decreased. Viral capsid protein formed rough clusters in the nucleus and could not be transported to cytoplasm (Figs. 17 C and 17D), suggesting 1 i-kDa protein may be involved in regulation of vir$1 promoter activity or vital capsid transportation.
Taken tagetha, the data i:l Fibs. 16A-F and 1~igs, 17A D indicated that 11-kDa protein may play an Important role in replication ofBl9 attd cot~ftrmed that I 1-kDa protein, in addition to ITR sequences and VP2, NS, and vP 1 proteins, is essential for production of infectious particles of B 19 parvovirus.
. 25 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: THE GOVERNMENT OF THE UNITED STATES OF AMERICA
AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF
HEALTH AND HUMAN SERVICES
(B) STREET: 6011 EXECUTIVE BOULEVARD, SUITE 325 (C) CITY: ROCKVILLE, MARYLAND
(E) COUNTRY: U.S.A.
(F) POSTAL CODE (ZIP): 20852 (G) TELEPHONE:
(H) TELEFAX:
(ii) TITLE OF INVENTION: INFECTIOUS CLONE OF HUMAN PARVOVIRUS B19 AND METHODS
(iii) NUMBER OF SEQUENCES: 38 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: RObic (B) STREET: 1000 Square-Victoria (C) CITY: Montreal (D) STATE: QC
(E) COUNTRY: Canada (F) ZIP: H2Z 2B7 (G) TELEPHONE: 514-987-6242 (H) TELEFAX: 514-845-7874 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Disk 3.5~~ / 1.44 MB
(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: TXT ASCII
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,474,032 (B) FILING DATE: 2004-07-09 (2) INFORMATION FOR SEQ ID N0: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 363 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:1:

aaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggacaa60 ttacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttccg120 gaattagggttggctctgggccagcttgcttggggttgccttgacactaagacaagcggc180 gcgccgcttgatcttagtggcacgtcaaccccaagcgctggcccagagccaaccctaatt240 ccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacgta300 attgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctgatt360 tgg 363 (2) INFORMATION FOR SEQ ID N0: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 363 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
aaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggacaa 60 ttacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttccg 120 gaattagggttggctctgggccagcgcttggggttgacgtgccactaagatcaagcggcg 180 cgccgcttgtcttagtgtcaaggcaaccccaagcaagctggcccagagccaaccctaatt 240 ccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacgta 300 attgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctgatt 360 tgg 363 (2) INFORMATION FOR SEQ ID N0: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 365 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(V1) ORIGINAL SOURCE:
(A)ORGANiSM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
ccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggac 60 aattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttc 120 cggaattagggttggctctgggccagcgcttggggttgccttgacactaagacaagcggc 180 gcgccgcttgatcttagtggcacgtcaaccccaagcaagctggcccagagccaaccctaa 240 ttccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacg 300 taattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctga 360 tttgg (2) INFORMATION FOR SEQ ID N0: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 365 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(v1) ORIGINAL SOURCE:

(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID
N0:4:

ccaaatcaga tgccgccggt cgccgccggt tccggtacaa gatggcggac60 aggcgggact aattacgtca tttcctgtga cgtcatttcc cttccggtgg gcgggacttc120 tgtgacgtca cggaattagg gttggctctg ggccagcttg acgtgccact aagatcaagc180 cttggggttg ggcgcgccgc ttgtcttagt gtcaaggcaa tggcccagag ccaaccctaa240 ccccaagcgc ttccggaagt cccgcccacc ggaagtgacg tgacgtcaca ggaaatgacg300 tcacaggaaa taattgtccg ccatcttgta ccggaagtcc cggcgaccgg cggcatctga360 cgcctaccgg tttgg (2) INFORMATION FOR SEQ ID N0: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5592 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:5:

aaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggacaa 60 ttacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttccg 120 gaattagggttggctctgggccagcttgcttggggttgccttgacactaagacaagcggc 180 gcgccgcttgatcttagtggcacgtcaaccccaagcgctggcccagagccaaccctaatt 240 ccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacgta 300 attgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctgatt 360 tggtgtcttcttttaaattttagcgggcttttttcccgccttatgcaaatgggcagccat 420 tttaagtgttttactataattttattggtcagttttgtaacggttaaaatgggcggagcg 480 taggcggggactacagtatatatagcacagcactgccgcagctctttctttctgggctgc 540 tttttcctggactttcttgctgttttttgtgagctaactaacaggtatttatactacttg 600 ttaatatactaacatggagctatttagaggggtgcttcaagtttcttctaatgttctgga 660 ctgtgctaacgataactggtggtgctctttactagatttagacacttctgactgggaacc 720 actaactcatactaacagactaatggcaatatacttaagcagtgtggcttctaagcttga 780 ccttaccggggggccactagcagggtgcttgtacttttttcaagcagaatgtaacaaatt 840 tgaagaaggctatcatattcatgtggttattggggggccagggttaaaccccagaaacct900 cacagtgtgtgtagaggggttatttaataatgtactttatcactttgtaactgaaaatgt960 gaagctaaaatttttgccaggaatgactacaaaaggcaaatactttagagatggagagca1020 gtttatagaaaactatttaatgaaaaaaatacctttaaatgttgtatggtgtgttactaa1080 tattgatggatatatagatacctgtatttctgctacttttagaaggggagcttgccatgc1140 caagaaaccccgcattaccacagccataaatgatactagtagcgatgctggggagtctag1200 cggcacaggggcagaggttgtgccatttaatgggaagggaactaaggctagcataaagtt1260 tcaaactatggtaaactggttgtgtgaaaacagagtgtttacagaggataagtggaaact1320 agttgactttaaccagtacactttactaagcagtagtcacagtggaagttttcaaattca1380 aagtgcactaaaactagcaatttataaagcaactaatttagtgcctactagcacattttt1440 attgcatacagactttgagcaggttatgtgtattaaagacaataaaattgttaaattgtt1500 actttgtcaaaactatgaccccctattggtggggcagcatgtgttaaagtggattgataa1560 aaaatgtggcaagaaaaatacactgtggttttatgggccgccaagtacaggaaaaacaaa1620 cttggcaatggccattgctaaaagtgttccagtatatggcatggttaactggaataatga1680 aaactttccatttaatgatgtagcaggaaaaagcttggtggtctgggatgaaggtattat1740 taagtctacaattgtagaagctgcaaaagccattttaggcgggcaacccaccagggtaga1800 tcaaaaaatgcgtggaagtgtagctgtgcctggagtacctgtggttataaccagcaatgg1860 tgacattacttttgttgtaagcgggaacactacaacaactgtacatgctaaagccttaaa1920 agagcgcatggtaaagttaaactttactgtaagatgcagccctgacatggggttactaac1980 agaggctgatgtacaacagtggcttacatggtgtaatgcacaaagctgggaccactatga2040 aaactgggcaataaactacacttttgatttccctggaattaatgcagatgccctccaccc2100 agacctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgaaag2160 ctctgaagaactcagtgaaagcagcttttttaacctcatcaccccaggcgcctggaacac2220 tgaaaccccgcgctctagtacgcccatccccgggaccagttcaggagaatcatttgtcgg2280 aagcccagtttcctccgaagttgtagctgcatcgtgggaagaagccttctacacaccttt2340 ggcagaccagtttcgtgaactgttagttggggttgattatgtgtgggacggtgtaagggg2400 tttacctgtgtgttgtgtgcaacatattaacaatagtgggggaggcttgggactttgtcc2460 ccattgcattaatgtaggggcttggtataatggatggaaatttcgagaatttaccccaga2520 tttggtgcgatgtagctgccatgtgggagcttctaatcccttttctgtgctaacctgcaa2580 aaaatgtgcttacctgtctggattgcaaagctttgtagattatgagtaaagaaagtggca2640 aatggtgggaaagtgatgatgaatttgctaaagctgtgtatcagcaatttgtggaatttt2700 atgaaaaggttactggaacagacttagagcttattcaaatattaaaagatcattataata2760 tttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgcatta2820 aaaataaccttaaaaattctccagacttatatagtcatcattttcaaagtcatggacagt2880 tatctgaccacccccatgccttatcatccagtagcagtcatgcagaacctagaggagaag2940 atgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacccg3000 gtactaactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgttg3060 acagtgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaatc3120 catatactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaactg3180 ggtttcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgtgg3240 cccattttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaatacccaa3300 gcatgacttcagttaattctgcagaagccagcactggtgcaggaggggggggcagtaatc3360 ctgtcaaaagcatgtggagtgagggggccacttttagtgccaactctgtgacttgtacat3420 tttctagacagtttttaattccatatgacccagagcaccattataaggtgttttctcccg3480 cagcaagtagctgccacaatgccagtggaaaggaggcaaaggtttgcaccattagtccca3540 taatgggatactcaaccccatggagatatttagattttaatgctttaaacttattttttt3600 cacctttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgctttaa3660 ctgtaaccatatcagaaattgctgttaaggatgttacagacaaaactggagggggggtgc3720 aggttactgacagcactacagggcgcctatgcatgttagtagaccatgaatacaagtacc3780 catatgtgttagggcaaggtcaagatactttagccccagaacttcctatttgggtatact3840 ttccccctcaatatgcttacttaacagtaggagatgttaacacacaaggaatttctggag3900 acagcaaaaaattagcaagtgaagaatcagcattttatgttttggaacacagttcttttc3960 agcttttaggtacaggaggtacagcaactatgtcttataagtttcctccagtgcccccag4020 aaaatttagagggctgcagtcaacacttttatgagatgtacaatcccttatacggatccc4080 gcttaggggttcctgacacattaggaggtgacccaaaatttagatctttaacacatgaag4140 accatgcaattcagccccaaaacttcatgccagggccactagtaaactcagtgtctacaa4200 aggagggagacagctctaatactggagctgggaaagccttaacaggccttagcacaggta4260 cctctcaaaacactagaatatccttacgcccggggccagtgtctcagccgtaccaccact4320 gggacacagataaatatgtcacaggaataaatgctatttctcatggtcagaccacttatg4380 gtaacgctgaagacaaagagtatcagcaaggagtgggtagatttccaaatgaaaaagaac4440 agctaaaacagttacagggtttaaacatgcacacctactttcccaataaaggaacccagc4500 aatatacagatcaaattgagcgccccctaatggtgggttctgtatggaacagaagagccc4560 ttcactatgaaagccagctgtggagtaaaattccaaatttagatgacagttttaaaactc4620 agtttgcagccttaggaggatggggtttgcatcagccacctcctcaaatatttttaaaaa4680 tattaccacaaagtgggccaattggaggtattaaatcaatgggaattactaccttagttc4740 agtatgccgtgggaattatgacagtaaccatgacatttaaattggggccccgtaaagcta4800 cgggacggtggaatcctcaacctggagtatatcccccgcacgcagcaggtcatttaccat4860 atgtactatatgaccctacagctacagatgcaaaacaacaccacagacatggatatgaaa4920 agcctgaagaattgtggacagccaaaagccgtgtgcacccattgtaaacactccccaccg4980 tgccctcagccaggatgcgtaactaaacgcccaccagtaccacccagactgtacctgccc5040 cctcctatacctataagacagcctaacacaaaagatatagacaatgtagaatttaagtat5100 ttaaccagatatgaacaacatgttattagaatgttaagattgtgtaatatgtatcaaaat5160 ttagaaaaataaacgtttgttgtggttaaaaaattatgttgttgcgctttaaaaatttaa5220 aagaagacaccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaag5280 atggcggacaattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtggg5340 cggaacttccggaattagggttggctctgggccagcgcttggggttgacgtgccactaag5400 atcaagcggcgcgccgcttgtcttagtgtcaaggcaaccccaagcaagctggcccagagc5460 caaccctaattccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacag5520 gaaatgacgtaattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggc5580 ggcatctgattt (2) INFORMATION FOR SEQ ID N0: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: ARTIFICIAL
(X1) SEQUENCE DESCRIPTION: SEQ ID N0:6:
gttttttgtg agctaacta 19 (2) INFORMATION FOR SEQ ID N0: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: ARTIFICIAL
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
ccacgatgca agctacaact t 21 (2) INFORMATION FOR SEQ ID N0: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(Vi) ORIGINAL SOURCE:
(A)ORGANISM: ARTIFICIAL
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
ggaaccagtt caggagaatc a 21 (2) INFORMATION FOR SEQ ID N0: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(Vi) ORIGINAL SOURCE:
(A)ORGANISM: ARTIFICIAL
(X1) SEQUENCE DESCRIPTION: SEQ ID N0:9:
tggcagctac atcgcaccaa 20 (2) INFORMATION FOR SEQ ID N0: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 94 amino acids (B) TYPE: protein (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: PRT
(Vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 11-kDa protein (X1) SEQUENCE DESCRIPTION: SEQ ID N0:10:
Met Gln Asn Asn Thr Thr Asp Met Asp Met Lys Ser Leu Lys Asn Cys Gly Gln Pro Lys Ala Val Cys Thr His Cys Lys His Ser Pro Pro Cys Pro Gln Pro Gly Cys Val Thr Lys Arg Pro Pro Val Pro Pro Arg Leu Tyr Leu Pro Pro Pro Ile Pro Ile Arg Gln Pro Asn Thr Lys Asp Ile Asp Asn Val Glu Phe Lys Tyr Leu Thr Arg Tyr Glu Gln His Val Ile Arg Met Leu Arg Leu Cys Asn Met Tyr Gln Asn Leu Glu Lys (2) INFORMATION FOR SEQ ID N0: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 671 amino acids (B) TYPE: protein (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: PRT
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 non-structural protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
Met Glu Leu Phe Arg Gly Val Leu Gln Val Ser Ser Asn Val Leu Asp Cys Ala Asn Asp Asn Trp Trp Cys Ser Leu Leu Asp Leu Asp Thr Ser Asp Trp Glu Pro Leu Thr His Thr Asn Arg Leu Met Ala Ile Tyr Leu Ser Ser Val Ala Ser Lys Leu Asp Leu Thr Gly Gly Pro Leu Ala Gly Cys Leu Tyr Phe Phe Gln Ala Glu Cys Asn Lys Phe Glu Glu Gly Tyr His Ile His val Val Ile Gly Gly Pro Gly Leu Asn Pro Arg Asn Leu Thr Val Cys Val Glu Gly Leu Phe Asn Asn Val Leu Tyr His Phe Val Thr Glu Asn Val Lys Leu Lys Phe Leu Pro Gly Met Thr Thr Lys Gly Lys Tyr Phe Arg Asp Gly Glu Gln Phe Ile Glu Asn Tyr Leu Met Lys Lys Ile Pro Leu Asn Val Val Trp Cys Val Thr Asn Ile Asp Gly Tyr Ile Asp Thr Cys Ile Ser Ala Thr Phe Arg Arg Gly Ala Cys His Ala Lys Lys Pro Arg Ile Thr Thr Ala Ile Asn Asp Thr Ser Ser Asp Ala Gly Glu Ser Ser Gly Thr Gly Ala Glu Val Val Pro Phe Asn Gly Lys Gly Thr Lys Ala Ser Ile Lys Phe Gln Thr Met Val Asn Trp Leu Cys Glu Asn Arg Val Phe Thr Glu Asp Lys Trp Lys Leu Val Asp Phe Asn Gln Tyr Thr Leu Leu Ser Ser Ser His Ser Gly Ser Phe Gln Ile Gln Ser Ala Leu Lys Leu Ala Ile Tyr Lys Ala Thr Asn Leu Val Pro Thr Ser Thr Phe Leu Leu His Thr Asp Phe Glu Gln Val Met Cys Ile Lys Asp Asn Lys Ile Val Lys Leu Leu Leu Cys Gln Asn Tyr Asp Pro Leu Leu Val Gly Gln His Val Leu Lys Trp Ile Asp Lys Lys Cys Gly Lys Lys Asn Thr Leu Trp Phe Tyr Gly Pro Pro Ser Thr Gly Lys Thr Asn Leu Ala Met Ala Ile Ala Lys Ser Val Pro Val Tyr Gly Met Val Asn Trp Asn Asn Glu Asn Phe Pro Phe Asn Asp Val Ala Gly Lys Ser Leu Val Val Trp Asp Glu Gly Ile Ile Lys Ser Thr Ile Val Glu Ala Ala Lys Ala Ile Leu Gly Gly Gln Pro Thr Arg Val Asp Gln Lys Met Arg Gly Ser Val Ala Val Pro Gly Val Pro Val Val Ile Thr Ser Asn Gly Asp Ile Thr Phe Val Val Ser Gly Asn Thr Thr Thr Thr Val His Ala Lys Ala Leu Lys Glu Arg Met Val Lys Leu Asn Phe Thr Val Arg Cys Ser Pro Asp Met Gly Leu Leu Thr Glu Ala Asp Val Gln Gln Trp Leu Thr Trp Cys Asn Ala Gln Ser Trp Asp His Tyr Glu Asn Trp Ala Ile Asn Tyr Thr Phe Asp Phe Pro Gly Ile Asn Ala Asp Ala Leu His Pro Asp Leu Gln Thr Thr Pro Ile Val Thr Asp Thr Ser Ile Ser Ser Ser Gly Gly Glu Ser Ser Glu Glu Leu Ser Glu Ser Ser Phe Phe Asn Leu Ile Thr Pro Gly Ala Trp Asn Thr Glu Thr Pro Arg Ser 5er Thr Pro Ile Pro Gly Thr Ser Ser Gly Glu Ser Phe Val Gly Ser Pro Val Ser Ser Glu Val Val Ala Ala Ser Trp Glu Glu Ala Phe Tyr Thr Pro Leu Ala Asp Gln Phe Arg Glu Leu Leu Val Gly Val Asp Tyr Val Trp Asp Gly Val Arg Gly Leu Pro Val Cys Cys Val Gln His Ile Asn Asn Ser Gly Gly Gly Leu Gly Leu Cys Pro His CyS Ile Asn Val Gly Ala Trp Tyr Asn Gly Trp Lys Phe Arg Glu Phe Thr Pro Asp Leu Val Arg Cys Ser Cys His Val Gly Ala Ser Asn Pro Phe Ser Val Leu Thr Cys Lys Lys Cys Ala Tyr Leu Ser Gly Leu Gln Ser Phe Val Asp Tyr Glu (2) INFORMATION FOR SEQ ID N0: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 781 amino acids (B) TYPE: protein (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: PRT
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 VP1 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
Met Ser Lys Glu Ser Gly Lys Trp Trp Glu Ser Asp Asp Glu Phe Ala Lys Ala Val Tyr Gln Gln Phe Val Glu Phe Tyr Glu Lys Val Thr Gly Thr Asp Leu Glu Leu Ile Gln Ile Leu Lys Asp His Tyr Asn Ile Ser Leu Asp Asn Pro Leu Glu Asn Pro Ser Ser Leu Phe Asp Leu Val Ala Arg Ile Lys Asn Asn Leu Lys Asn Ser Pro Asp Leu Tyr Ser His His Phe Gln Ser His Gly Gln Leu Ser Asp His Pro His Ala Leu Ser Ser Ser Ser Ser His Ala Glu Pro Arg Gly Glu Asp Ala Val Leu Ser Ser G1u Asp Leu His Lys Pro Gly Gln Val Ser Val Gln Leu Pro Gly Thr Asn Tyr Val Gly Pro Gly Asn Glu Leu Gln Ala Gly Pro Pro Gln Ser Ala Val Asp Ser Ala Ala Arg Ile His Asp Phe Arg Tyr Ser Gln Leu Ala Lys Leu Gly Ile Asn Pro Tyr Thr His Trp Thr Val Ala Asp Glu Glu Leu Leu Lys Asn Ile Lys Asn Glu Thr Gly Phe Gln Ala Gln Val Val Lys Asp Tyr Phe Thr Leu Lys Gly Ala Ala Ala Pro Val Ala His Phe Gln Gly Ser Leu Pro Glu Val Pro Ala Tyr Asn Ala Ser Glu Lys Tyr Pro Ser Met Thr Ser Val Asn Ser Ala Glu Ala Ser Thr Gly Ala Gly Gly Gly Gly Ser Asn Pro Val Lys Ser Met Trp Ser Glu Gly Ala Thr Phe Ser Ala Asn Ser Val Thr Cys Thr Phe Ser Arg Gln Phe Leu Ile Pro Tyr Asp Pro Glu His His Tyr Lys Val Phe Ser Pro Ala Ala Ser Ser Cys His Asn Ala Ser Gly Lys Glu Ala Lys Val Cys Thr Ile Ser Pro Ile Met Gly Tyr Ser Thr Pro Trp Arg Tyr Leu Asp Phe Asn Ala Leu Asn Leu Phe Phe Ser Pro Leu Glu Phe Gln His Leu Ile Glu Asn Tyr Gly Ser Ile Ala Pro Asp Ala Leu Thr Val Thr Ile Ser Glu Ile Ala Val Lys Asp Val Thr Asp Lys Thr Gly Gly Gly Val Gln Val Thr Asp Ser Thr Thr Gly Arg Leu Cys Met Leu Val Asp His Glu Tyr Lys Tyr Pro Tyr Val Leu Gly Gln Gly Gln Asp Thr Leu Ala Pro Glu Leu Pro Ile Trp Val Tyr Phe Pro Pro Gln Tyr Ala Tyr Leu Thr Val Gly Asp Val Asn Thr Gln Gly Ile Ser Gly Asp Ser Lys Lys Leu Ala Ser Glu Glu Ser Ala Phe Tyr Val Leu Glu His Ser Ser Phe Gln Leu Leu Gly Thr Gly Gly Thr Ala Thr Met Ser Tyr Lys Phe Pro Pro Val Pro Pro Glu Asn Leu Glu Gly Cys Ser Gln His Phe Tyr Glu Met Tyr Asn Pro Leu Tyr Gly Ser Arg Leu Gly Val Pro Asp Thr Leu Gly Gly Asp Pro Lys Phe Arg Ser Leu Thr His Glu Asp His Ala Ile Gln Pro Gln Asn Phe Met Pro Gly Pro Leu Val Asn Ser Val Ser Thr Lys Glu Gly Asp Ser Ser Asn Thr Gly Ala Gly Lys Ala Leu Thr Gly Leu Ser Thr Gly Thr Ser Gln Asn Thr Arg Ile Ser Leu Arg Pro Gly Pro Val Ser Gln Pro Tyr His His Trp Asp Thr Asp Lys Tyr Val Thr Gly Ile Asn Ala Ile Ser His Gly Gln Thr Thr Tyr Gly Asn Ala Glu Asp Lys Glu Tyr Gln Gln Gly Val Gly Arg Phe Pro Asn Glu Lys Glu Gln Leu Lys Gln Leu Gln Gly Leu Asn Met His Thr Tyr Phe Pro Asn Lys Gly Thr Gln Gln Tyr Thr Asp Gln Ile Glu Arg Pro Leu Met Val Gly Ser Val Trp Asn Arg Arg Ala Leu His Tyr Glu Ser Gln Leu Trp Ser Lys Ile Pro Asn Leu Asp Asp Ser Phe Lys Thr Gln Phe Ala Ala Leu Gly Gly Trp Gly Leu His Gln Pro Pro Pro Gln Ile Phe Leu Lys Ile Leu Pro Gln Ser Gly Pro Ile Gly Gly Ile Lys Ser Met Gly Ile Thr Thr Leu Val Gln Tyr Ala Val Gly Ile Met Thr Val Thr Met Thr Phe Lys Leu Gly Pro Arg Lys Ala Thr Gly Arg Trp Asn Pro Gln Pro Gly Val Tyr Pro Pro His Ala Ala Gly His Leu Pro Tyr Val Leu Tyr Asp Pro Thr Ala Thr Asp Ala Lys Gln His His Arg His Gly Tyr Glu Lys Pro Glu Glu Leu Trp Thr Ala Lys Ser Arg Val His Pro Leu (2) INFORMATION FOR SEQ ID N0: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 554 amino acids (B) TYPE: protein (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: PRT
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 VP2 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
Met Thr Ser Val Asn Ser Ala Glu Ala Ser Thr Gly Ala Gly Gly Gly Gly Ser Asn Pro Val Lys Ser Met Trp Ser Glu Gly Ala Thr Phe Ser Ala Asn Ser Val Thr Cys Thr Phe Ser Arg Gln Phe Leu Ile Pro Tyr Asp Pro Glu His His Tyr Lys Val Phe Ser Pro Ala Ala Ser Ser Cys His Asn Ala Ser Gly Lys Glu Ala Lys Val Cys Thr Ile Ser Pro Ile Met Gly Tyr Ser Thr Pro Trp Arg Tyr Leu Asp Phe Asn Ala Leu Asn Leu Phe Phe Ser Pro Leu Glu Phe Gln His Leu Ile Glu Asn Tyr Gly Ser Ile Ala Pro Asp Ala Leu Thr Val Thr Ile Ser Glu Ile Ala Val Lys Asp Val Thr Asp Lys Thr Gly Gly Gly Val Gln Val Thr Asp Ser Thr Thr Gly Arg Leu Cys Met Leu Val Asp His Glu Tyr Lys Tyr Pro Tyr Val Leu Gly Gln Gly Gln Asp Thr Leu Ala Pro Glu Leu Pro Ile Trp Val Tyr Phe Pro Pro Gln Tyr Ala Tyr Leu Thr Val Gly Asp Val Asn Thr Gln Gly Ile Ser Gly Asp Ser Lys Lys Leu Ala Ser Glu Glu Ser Ala Phe Tyr Val Leu Glu His Ser Ser Phe Gln Leu Leu Gly Thr Gly Gly Thr Ala Thr Met Ser Tyr Lys Phe Pro Pro Val Pro Pro Glu Asn Leu Glu Gly Cys Ser Gln His Phe Tyr Glu Met Tyr Asn Pro Leu Tyr Gly Ser Arg Leu Gly Val Pro Asp Thr Leu Gly Gly Asp Pro Lys Phe Arg Ser Leu Thr His Glu Asp His Ala Ile Gln Pro Gln Asn Phe Met Pro Gly Pro Leu Val Asn Ser Val Ser Thr Lys Glu Gly Asp Ser Ser Asn Thr Gly Ala Gly Lys Ala Leu Thr Gly Leu Ser Thr Gly Thr Ser Gln Asn Thr Arg Ile Ser Leu Arg Pro Gly Pro Val Ser Gln Pro Tyr His His Trp Asp Thr Asp Lys Tyr Val Thr Gly Ile Asn Ala Ile Ser His Gly Gln Thr Thr Tyr Gly Asn Ala Glu Asp Lys Glu Tyr Gln Gln Gly Val Gly Arg Phe Pro Asn Glu Lys Glu Gln Leu Lys Gln Leu Gln Gly Leu Asn Met His Thr Tyr Phe Pro Asn Lys Gly Thr Gln Gln Tyr Thr Asp Gln Ile Glu Arg Pro Leu Met Val Gly Ser Val Trp Asn Arg Arg Ala Leu His Tyr Glu Ser Gln Leu Trp Ser Lys Ile Pro Asn Leu Asp Asp Ser Phe Lys Thr Gln Phe Ala Ala Leu Gly Gly Trp Gly Leu His Gln Pro Pro Pro Gln Ile Phe Leu Lys Ile Leu Pro Gln Ser Gly Pro Ile Gly Gly Ile Lys Ser Met Gly Ile Thr Thr Leu Val Gln Tyr Ala Val Gly Ile Met Thr Val Thr Met Thr Phe Lys Leu Gly Pro Arg Lys Ala Thr Gly Arg Trp Asn Pro Gln Pro Gly Val Tyr Pro Pro His Ala Ala Gly His Leu Pro Tyr Val Leu Tyr Asp Pro Thr Ala Thr Asp Ala Lys Gln His His Arg His Gly Tyr Glu Lys Pro Glu Glu Leu Trp Thr Ala Lys Ser Arg Val His Pro Leu (2) INFORMATION FOR SEQ ID N0: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 74 amino acids (B) TYPE: protein (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: PRT
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 7.5-kDa protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
Met Gln Met Pro Ser Thr Gln Thr Ser Lys Pro Pro Gln Leu Ser Gln Thr Pro Val Ser Ala Ala Val Val Val Lys Ala Leu Lys Asn Ser Val Lys Ala Ala Phe Leu Thr Ser Ser Pro Gln Ala Pro Gly Thr Leu Lys Pro Arg Ala Leu Val Arg Pro Ser Pro Gly Pro Val Gln Glu Asn His Leu Ser Glu Ala Gln Phe Pro Pro Lys Leu (2) INFORMATION FOR SEQ ID N0: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 81 amino acids (B) TYPE: protein (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: PRT
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvoviru5 B19 Protein X
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
Met Asp Ser Tyr Leu Thr Thr Pro Met Pro Tyr His Pro Val Ala Val Met Gln Asn Leu Glu Glu Lys Met Gln Tyr Tyr Leu Val Lys Thr Tyr Thr Ser Leu Gly Lys Leu Ala Tyr Asn Tyr Pro Val Leu Thr Met Leu Gly Leu Ala Met Ser Tyr Lys Leu Gly Pro Arg Lys Val Leu Leu Thr Val Leu Gln Gly Phe Met Thr Leu Gly Ile Ala Asn Trp Leu Ser Trp (2) INFORMATION FOR SEQ ID N0: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base, pairs (B) TYPE: nUCleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(V1) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
cgcttgtctt agtggcacgt caac 24 (2) INFORMATION FOR SEQ ID N0: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5594 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (X1) SEQUENCE DESCRIPTION: SEQ ID N0:17:
ccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggac60 aattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttc120 cggaattagggttggctctgggccagcttgcttggggttgccttgacactaagacaagcg180 gcgcgccgcttgtcttagtggcacgtcaaccccaagcgctggcccagagccaaccctaat240 tccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacgt300 aattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctgat360 ttggtgtcttcttttaaattttagcgggcttttttcccgccttatgcaaatgggcagcca420 ttttaagtgtttcactataattttattggtcagttttgtaacggttaaaatgggcggagc480 gtaggcggggactacagtatatatagcacggcactgccgcagctctttctttctgggctg540 ctttttcctggactttcttgctgttttttgtgagctaactaacaggtatttatactactt600 gttaacatactaacatggagctatttagaggggtgcttcaagtttcttctaatgttctgg660 actgtgctaacgataactggtggtgctctttactggatttagacacttctgactgggaac720 cactaactcatactaacagactaatggcaatatacttaagcagtgtggcttctaagcttg780 actttaccggggggccactagcggggtgcttgtacttttttcaagtagaatgtaacaaat840 ttgaagaaggctatcatattcatgtggttattggggggccagggttaaaccccagaaacc900 tcacagtgtgtgtagaggggttatttaataatgtactttatcaccttgtaactgaaaatg960 taaagctaaaatttttgccaggaatgactacaaaaggcaaatactttagagatggagagc1020 agtttatagaaaactatttaatgaaaaaaatacctttaaatgttgtatggtgtgttacta1080 atattgatggatatatagatacctgtatttctgctacttttagaaggggagcttgccatg1140 ccaagaaaccccgcattaccacagccataaatgacactagtagtgatgctggggagtcta1200 gcggcacaggggcagaggttgtgccaattaatgggaagggaactaaggctagcataaagt1260 ttcaaactatggtaaactggttgtgtgaaaacagagtgtttacagaggataagtggaaac1320 tagttgactttaaccagtacactttactaagcagtagtcacagtggaagttttcaaattc1380 aaagtgcactaaaactagcaatttataaagcaactaatttagtgcctacaagcacatttc1440 tattgcatacagactttgagcaggttatgtgtattaaagacaataaaattgttaaattgt1500 tactttgtcaaaactatgaccccctattagtggggcagcatgtgttaaagtggattgata1560 aaaaatgtggcaagaaaaatacactgtggttttatgggccgccaagtacaggaaaaacaa1620 acttggcaatggccattgctaaaagtgttccagtatatggcatggttaactggaataatg1680 aaaactttccatttaatgatgtagcagggaaaagcttggtggtctgggatgaaggtatta1740 ttaagtctacaattgtagaagctgcaaaagccattttaggcgggcaacccaccagggtag1800 atcaaaaaatgcgtggaagtgtagctgtgcctggagtacctgtggttataaccagcaatg1860 gtgacattacttttgttgtaagcgggaacactacaacaactgtacatgctaaagccttaa1920 aagagcgaatggtaaagttaaactttactgtaagatgcagccctgacatggggttactaa1980 cagaggctgatgtacaacagtggcttacatggtgtaatgcacaaagctgggaccactatg2040 aaaactgggcaataaactacacttttgatttccctggaattaatgcagatgccctccacc2100 cagacctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgaaa2160 gctctgaagaactcagtgaaagcagcttttttaacctcatcaccccaggcgcctggaaca2220 ctgaaaccccgcgctctagtacgcccatccccgggaccagttcaggagaatcatttgtcg2280 gaagctcagtttcctccgaagttgtagctgcatcgtgggaagaagccttctacacacctt2340 tggcagaccagtttcgtgaactgttagttggggttgattatgtgtgggacggtgtaaggg2400 gtttacctgtgtgttgtgtgcaacatattaacaatagtgggggaggcttgggactttgtc2460 cccattgcattaatgtaggggcttggtataatggatggaaatttcgagaatttaccccag2520 atttggtgcggtgtagctgccatgtgggagcttctaatcccttttctgtgctaacctgca2580 aaaaatgtgcttacctgtctggattgcaaagctttgtagattatgagtaaagaaagtggc2640 aaatggtgggaaagtgatgataaatttgctaaagctgtgtatcagcaatttgtggaattt2700 tatgaaaaggttactggaacagacttagagcttattcaaatattaaaagatcactataat2760 atttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgtatt2820 aaaaataaccttaaaaactctccagacttatatagtcatcattttcaaagtcatggacag2880 ttatctgaccacccccatgccttatcatccagtagcagtcatgcagaacctagaggagaa2940 aatgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactaccc3000 ggtactaactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgtt3060 gacagtgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaat3120 ccatatactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaact3180 gggtttcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgtg3240 gcccattttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaataccca3300 agcatgacttcagttaattctgcagaagccagcactggtgcaggagggggtggcagtaat3360 cctgtcaaaagcatgtggagtgagggggccacttttagtgccaactctgtaacttgtaca3420 ttttccagacagtttttaattccttatgacccagagcaccattataaggtgttttctccc3480 gcagcaagcagctgccacaatgccagtggaaaggaggcaaaggtttgcacaattagtccc3540 ataatgggatactcaaccccatggagatatttagattttaatgctttaaatttatttttt3600 tcacctttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgcttta3660 actgtaaccatatcagaaattgctgttaaggatgttacagacaaaactggagggggggta3720 caggttactgacagcactacagggcgcctatccatgttagtagaccatgaatacaagtac3780 ccatatgtgttaggacaaggtcaggatactttagccccagaacttcctatttgggtatac3840 tttccccctcaatatgcttacttaacagtaggagatgttaacacacaaggaatctctgga3900 gacagcaaaaaattagcaagtgaagaatcagcattttatgttttggaacacagttctttt3960 cagcttttaggtacaggaggtacagcaactatgtcttataagtttcctccagtgccccca4020 gaaaatttagagggctgcagtcaacacttttatgaaatgtacaatcccttatacggatcc4080 cgcttaggggttcctgacacattaggaggtgacccaaaatttagatctttaacacatgaa4140 gaccatgcaattcagccccaaaacttcatgccagggccactagtaaactcagtgtctaca4200 aaggagggagacagctctaatactggagctggaaaagccttaacaggccttagcacaggc4260 acctctcaaaacactagaatatccttacgccctgggccagtgtcacagccataccaccac4320 tgggacacagataaatatgttccaggaataaatgccatttctcatggtcagaccacttat4380 ggtaacgctgaagacaaagagtatcagcaaggagtgggtagatttccaaatgaaaaagaa4440 cagctaaaacagttacagggtttaaacatgcacacctatttccccaataaaggaacccag4500 caatatacagatcaaattgagcgccccctaatggtgggttctgtatggaacagaagagcc4560 cttcactatgaaagccagctgtggagtaaaattccaaatttagatgacagttttaaaact4620 cagtttgcagccttaggaggatggggtttgcatcagccacctcctcaaatatttttaaaa4680 atattaccacaaagtgggccaattggaggtattaaatcaatgggaattactaccttagtt4740 cagtatgccgtgggaattatgacagtaactatgacatttaaattggggccccgtaaagct4800 acgggacggtggaatcctcaacctggagtatatcccccgcacgcagcaggtcatttacca4860 tatgtactatatgaccccacagctacagatgcaaaacaacaccacaggcatggatacgaa4920 aagcctgaagaattgtggacagccaaaagccgtgtgcacccattgtaaacactccccacc4980 gtgccctcagccaggatgcgtaactaaacgcccaccagtaccacccagactgtacctgcc5040 ccctcctgtacctataagacagcctaacacaaaagatatagacaatgtagaatttaagta5100 cttaaccagatatgaacaacatgttattagaatgttaagattgtgtaatatgtatcaaaa5160 tttagaaaaataaacatttgttgtggttaaaaaattatgttgttgcgctttaaaaattta5220 aaagaagacaccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaa5280 gatggcggacaattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgg5340 gcgggacttccggaattagggttggctctgggccagcgcttggggttgacgtgccactaa5400 gacaagcggcgcgccgcttgtcttagtgtcaaggcaaccccaagcaagctggcccagagc5460 caaccctaattccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacag5520 gaaatgacgtaattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggc5580 ggcatctgatttgg 5594 (2) INFORMATION FOR SEQ ID N0: 18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
ccacgatgca gctacaactt 20 (2) INFORMATION FOR SEQ ID N0: 19:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
gtgagcgcgc cgcttgtctt agtg 24 (2) INFORMATION FOR SEQ ID N0: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
gtgagcgcgc cgcttgatct tagt 24 (2) INFORMATION FOR SEQ ID N0: 21:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
aacttccact gtgactactg 20 (2) INFORMATION FOR SEQ ID N0: 22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
gtgagcgcgc cgcttgatct tagt 24 (2) INFORMATION FOR SEQ ID N0: 23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
aacaccacag gcatggatac 20 (2) INFORMATION FOR SEQ ID N0: 24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5112 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:
gaattccgcc aaatcagatg ccgccggtcg ccgccggtag gcgggacttc cggtacaaga 60 tggcggacaattacgtcatttcctgtgacgtcatttcctgtgacgtcacaggaaatgacg120 taattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctga180 tttggtgtcttcttttaaattttagcgggcttttttcccgccttatgcaaatgggcagcc240 attttaagtgttttactataattttattggttagttttgtaacggttaaaatgggcggag300 cgtaggcggggactacagtatatatagcacggtactgccgcagctctttctttctgggct360 gctttttcctggactttcttgctgttttttgtgagctaactaacaggtatttatactact420 tgttaacatcctaacatggagctatttagaggggtgcttcaagtttcttctaatgttcta480 gactgtgctaacgataactggtggtgctctttactggatttagacacttctgactgggaa540 ccactaactcatactaacagactaatggcaatatacttaagcagtgtggcttctaagctt600 gactttaccggggggccactagcagggtgcttgtacttttttcaagtagaatgtaacaaa660 tttgaagaaggctatcatattcatgtggttactggggggccagggttaaaccccagaaac720 cttacagtgtgtgtagaggggttatttaataatgtactttatcaccttgtaactgaaaat780 gtgaagctaaaatttttgccaggaatgactacaaaaggcaaatactttagagatggagag840 cagtttatagaaaactatttaatgaaaaaaatacctttaaatgttgtatggtgtgttact900 aatattgatggatatatagatacctgtatttctgctacttttagaaggggagcttgccat960 gccaagaaaccccgcattaccacagccataaatgatactagtagtgatgctggggagtct1020 agcggcacaggggcagaggttgtgccatttaatgggaagggaactaaggctagcataaag1080 tttcaaactatggtaaactggttgtgtgaaaacagagtgtttacagaggataagtggaaa1140 ctagttgactttaaccagtacactttactaagcagtagtcacagtggaagttttcaaatt1200 caaagtgcactaaaactagcaatttataaagcaactaatttagtgcctactagcacattt1260 ttattgcatacagactttgagcaggttatgtgtattaaagacaataaaattgttaaattg1320 ttactttgtcaaaactatgaccccctattggtggggcagcatgtgttaaagtggattgat1380 aaaaaatgtggtaagaaaaatacactgtggttttatgggccgccaagtacaggaaaaaca1440 aacttggcaatggccattgctaaaagtgttccagtatatggcatggttaactggaataat1500 gaaaactttccatttaatgatgtagcaggaaaaagcttggtggtctgggatgaaggtatt1560 attaagtctacaattgtagaagctgcaaaagccattttaggcgggcaacccaccagggta1620 gatcaaaaaatgcgtggaagtgtagctgtgcctggagtacctgtggttataaccagcaat1680 ggtgacattacttttgttgtaagcgggaacactacaacaactgtacatgctaaagcctta1740 aaagagcgcatggtaaagttaaactttactgtaagatgcagccctgacatggggttacta1800 acagaggctgatgtacaacagtggcttacatggtgtaatgcacaaagctgggaccactat1860 gaaaactgggcaataaactacacttttgatttccctggaattaatgcagatgccctccac1920 ccagacctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgaa1980 agctctgaagaactcagtgaaagcagcttttttaacctcatcaccccaggcgcctggaac2040 actgaaaccccgcgctctagtacgcccatccccgggaccagttcaggagaatcatttgtc2100 ggaagcccagtttcctccgaagttgtagctgcatcgtgggaagaagccttctacacacct2160 ttggcagaccagtttcgtgaactgttagttggggttgattatgtgtgggacggtgtaagg2220 ggtttacctgtgtgttgtgtgcaacatattaacaatagtgggggagggttgggactttgt2280 ccccattgcattaatgtaggggcttggtataatggatggaaatttcgagaatttacccca2340 gatttggtgcgatgtagctgccatgtgggagcttctaatcccttttctgtgctaacctgc2400 aaaaaatgtgcttacctgtctggattgcaaagctttgtagattatgagtaaaaaaagtgg2460 caaatggtgggaaagtgatgataaatttgctaaagctgtgtatcagcaatttgtggaatt2520 ttatgaaaaggttactggaacagacttagagcttattcaaatattaaaagatcattataa2580 tatttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgtat2640 taaaaataaccttaaaaactctccagacttatatagtcatcattttcaaagtcatggaca2700 gttatctgaccacccccatgccttatcatccagtagcagtcatgcagaacctagaggaga2760 aaatgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacc2820 cggtactaactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgt2880 tgacagtgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaa2940 tccatatactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaac3000 tgggtttcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgt3060 ggcccattttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaataccc3120 aagcatgacttcagttaattctgcagaagccagcactggtgcaggaggggggggcagtaa3180 ttctgtcaaaagcatgtggagtgagggggccacttttagtgctaactctgtaacttgtac3240 attttccagacagtttttaattccatatgacccagagcaccattataaggtgttttctcc3300 cgcagcgagtagctgccacaatgccagtggaaaggaggcaaaggtttgcaccatcagtcc3360 cataatgggatactcaaccccatggagatatttagattttaatgctttaaatttattttt3420 ttcacctttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgcttt3480 aactgtaaccatatcagaaattgctgttaaggatgttacagacaaaactggagggggggt3540 acaggttactgacagcactacagggcgcctatgcatgttagtagaccatgaatacaagta3600 cccatatgtgttagggcaaggtcaggatactttagccccagaacttcctatttgggtata3660 ctttccccctcaatatgcttacttaacagtaggagatgttaacacacaaggaatttctgg3720 agacagcaaaaaattagcaagtgaagaatcagcattttatgttttggaacacagttcttt3780 tcagcttttaggtacaggaggtacagcatctatgtcttataagtttcctccagtgccccc3840 agaaaatttagagggctgcagtcaacacttttatgaaatgtacaatcccttatacggatc3900 ccgcttaggggttcctgacacattaggaggtgacccaaaatttagatctttaacacatga3960 agaccatgcaattcagccccaaaacttcatgccagggccactagtaaactcagtgtctac4020 aaaggagggagacagctctaatactggagctggaaaagccttaacaggccttagcacagg4080 tacctctcaaaacactagaatatccttacgccctgggccagtgtctcagccataccacca4140 ctgggacacagataaatatgtcacaggaataaatgccatttctcatggtcagaccactta4200 tggtaacgctgaagacaaagagtatcagcaaggagtgggtagatttccaaatgaaaaaga4260 acagctaaaacagttacagggtttaaacatgcacacctactttcccaataaaggaaccca4320 gcaatatacagatcaaattgagcgccccctaatggtgggttctgtatggaacagaagagc4380 ccttcactatgaaagccagctgtggagtaaaattccaaatttagatgacagttttaaaac4440 tcagtttgcagccttaggaggatggggtttgcatcagccacctcctcaaatatttttaaa4500 aatattaccacaaagtgggccaattggaggtattaaatcaatgggaattactaccttagt4560 tcagtatgccgtgggaattatgacagtaactatgacatttaaattggggccccgtaaagc4620 tacgggacggtggaatcctcaacctggagtatatcccccgcacgcagcaggtcatttacc4680 atatgtactatatgaccccacagctacagatgcaaaacaacaccacagacatggatatga4740 aaagcctgaagaattgtggacagccaaaagccgtgtgcacccattgtaaacactccccac4800 cgtgccctcagccaggatgcgtaactaaacgcccaccagtaccacccagactgtacctgc4860 cccctcctgtacctataagacagcctaacacaaaagatatagacaatgtagaatttaagt4920 acttaaccagatatgaacaacatgttattagaatgttaagattgtgtaatatgtatcaaa4980 atttagaaaaataaacatttgttgtggttaaaaaattatgttgttgcgctttaaaaattt5040 aaaagaagacaccaaatcagatgccgccggtcggccggtaggcgggacttccggtacaag5100 atggcggaattc 5112 (2) INFORMATION FOR SEQ ID N0: 25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5596 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:
ccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggac60 aattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttc120 cggaattagggttggctctgggccagcttgcttggggttgccttgacactaagacaagcg180 gcgcgccgcttgatcttagtggcacgtcaaccccaagcgctggcccagagccaaccctaa240 ttccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacg300 taattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctga360 tttggtgtcttcttttaaattttagcgggcttttttcccgccttatgcaaatgggcagcc420 attttaagtgttttactataattttattggtcagttttgtaacggttaaaatgggcggag480 cgtaggcggggactacagtatatatagcacagcactgccgcagctctttctttctgggct540 gctttttcctggactttcttgctgttttttgtgagctaactaacaggtatttatactact600 tgttaatatactaacatggagctatttagaggggtgcttcaagtttcttctaatgttctg660 gactgtgctaacgataactggtggtgctctttactagatttagacacttctgactgggaa720 ccactaactcatactaacagactaatggcaatatacttaagcagtgtggcttctaagctt780 gaccttaccggggggccactagcagggtgcttgtacttttttcaagcagaatgtaacaaa840 tttgaagaaggctatcatattcatgtggttattggggggccagggttaaaccccagaaac900 ctcacagtgtgtgtagaggggttatttaataatgtactttatcactttgtaactgaaaat960 gtgaagctaaaatttttgccaggaatgactacaaaaggcaaatactttagagatggagag1020 cagtttatagaaaactatttaatgaaaaaaatacctttaaatgttgtatggtgtgttact1080 aatattgatggatatatagatacctgtatttctgctacttttagaaggggagcttgccat1140 gccaagaaaccccgcattaccacagccataaatgatactagtagcgatgctggggagtct1200 agcggcacaggggcagaggttgtgccatttaatgggaagggaactaaggctagcataaag1260 tttcaaactatggtaaactggttgtgtgaaaacagagtgtttacagaggataagtggaaa1320 ctagttgactttaaccagtacactttactaagcagtagtcacagtggaagttttcaaatt1380 caaagtgcactaaaactagcaatttataaagcaactaatttagtgcctactagcacattt1440 ttattgcatacagactttgagcaggttatgtgtattaaagacaataaaattgttaaattg1500 ttactttgtcaaaactatgaccccctattggtggggcagcatgtgttaaagtggattgat1560 aaaaaatgtggcaagaaaaatacactgtggttttatgggccgccaagtacaggaaaaaca1620 aacttggcaatggccattgctaaaagtgttccagtatatggcatggttaactggaataat1680 gaaaactttccatttaatgatgtagcaggaaaaagcttggtggtctgggatgaaggtatt1740 attaagtctacaattgtagaagctgcaaaagccattttaggcgggcaacccaccagggta1800 gatcaaaaaatgcgtggaagtgtagctgtgcctggagtacctgtggttataaccagcaat1860 ggtgacattacttttgttgtaagcgggaacactacaacaactgtacatgctaaagcctta1920 aaagagcgcatggtaaagttaaactttactgtaagatgcagccctgacatggggttacta1980 acagaggctgatgtacaacagtggcttacatggtgtaatgcacaaagctgggaccactat2040 gaaaactgggcaataaactacacttttgatttccctggaattaatgcagatgccctccac2100 ccagacctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgaa2160 agctctgaagaactcagtgaaagcagcttttttaacctcatcaccccaggcgcctggaac2220 actgaaaccccgcgctctagtacgcccatccccgggaccagttcaggagaatcatttgtc2280 ggaagcccagtttcctccgaagttgtagctgcatcgtgggaagaagccttctacacacct2340 ttggcagaccagtttcgtgaactgttagttggggttgattatgtgtgggacggtgtaagg2400 ggtttacctgtgtgttgtgtgcaacatattaacaatagtgggggaggcttgggactttgt2460 ccccattgcattaatgtaggggcttggtataatggatggaaatttcgagaatttacccca2520 gatttggtgcgatgtagctgccatgtgggagcttctaatcccttttctgtgctaacctgc2580 aaaaaatgtgcttacctgtctggattgcaaagctttgtagattatgagtaaagaaagtgg2640 caaatggtgggaaagtgatgatgaatttgctaaagctgtgtatcagcaatttgtggaatt2700 Fage 25 ttatgaaaaggttactggaacagacttagagcttattcaaatattaaaagatcattataa2760 tatttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgcat2820 taaaaataaccttaaaaattctccagacttatatagtcatcattttcaaagtcatggaca2880 gttatctgaccacccccatgccttatcatccagtagcagtcatgcagaacctagaggaga2940 agatgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacc3000 cggtactaactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgt3060 tgacagtgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaa3120 tccatatactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaac3180 tgggtttcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgt3240 ggcccattttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaataccc3340 aagcatgacttcagttaattctgcagaagccagcactggtgcaggaggggggggcagtaa3360 tcctgtcaaaagcatgtggagtgagggggccacttttagtgccaactctgtgacttgtac3420 attttctagacagtttttaattccatatgacccagagcaccattataaggtgttttctcc3480 cgcagcaagtagctgccacaatgccagtggaaaggaggcaaaggtttgcaccattagtcc3540 cataatgggatactcaaccccatggagatatttagattttaatgctttaaacttattttt3600 ttcacctttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgcttt3660 aactgtaaccatatcagaaattgctgttaaggatgttacagacaaaactggagggggggt3720 gcaggttactgacagcactacagggcgcctatgcatgttagtagaccatgaatacaagta3780 cccatatgtgttagggcaaggtcaagatactttagccccagaacttcctatttgggtata3840 ctttccccctcaatatgcttacttaacagtaggagatgttaacacacaaggaatttctgg3900 agacagcaaaaaattagcaagtgaagaatcagcattttatgttttggaacacagttcttt3960 tcagcttttaggtacaggaggtacagcaactatgtcttataagtttcctccagtgccccc4020 agaaaatttagagggctgcagtcaacacttttatgagatgtacaatcccttatacggatc4080 ccgcttaggggttcctgacacattaggaggtgacccaaaatttagatctttaacacatga4140 agaccatgcaattcagccccaaaacttcatgccagggccactagtaaactcagtgtctac4200 aaaggagggagacagctctaatactggagctgggaaagccttaacaggccttagcacagg4260 tacctctcaaaacactagaatatccttacgcccggggccagtgtctcagccgtaccacca4320 ctgggacacagataaatatgtcacaggaataaatgctatttctcatggtcagaccactta4380 tggtaacgctgaagacaaagagtatcagcaaggagtgggtagatttccaaatgaaaaaga4440 acagctaaaacagttacagggtttaaacatgcacacctactttcccaataaaggaaccca4500 gcaatatacagatcaaattgagcgccccctaatggtgggttctgtatggaacagaagagc4560 ccttcactatgaaagccagctgtggagtaaaattccaaatttagatgacagttttaaaac4620 tcagtttgcagccttaggaggatggggtttgcatcagccacctcctcaaatatttttaaa4680 aatattaccacaaagtgggccaattggaggtattaaatcaatgggaattactaccttagt4740 tcagtatgccgtgggaattatgacagtaaccatgacatttaaattggggccccgtaaagc4800 tacgggacggtggaatcctcaacctggagtatatcccccgcacgcagcag gtcatttacc4860 atatgtactatatgaccctacagctacagatgcaaaacaacaccacagac atggatatga4920 aaagcctgaagaattgtggacagccaaaagccgtgtgcacccattgtaaa cactccccac4980 cgtgccctcagccaggatgcgtaactaaacgcccaccagtaccacccaga ctgtacctgc5040 cccctcctatacctataagacagcctaacacaaaagatatagacaatgta gaatttaagt5100 atttaaccagatatgaacaacatgttattagaatgttaagattgtgtaat atgtatcaaa5160 atttagaaaaataaacgtttgttgtggttaaaaaattatgttgttgcgct ttaaaaattt5220 aaaagaagacaccaaatcagatgccgccggtcgccgccggtaggcgggac ttccggtaca5280 agatggcggacaattacgtcatttcctgtgacgtcatttcctgtgacgtc acttccggtg5340 ggcggaacttccggaattagggttggctctgggccagcgcttggggttga cgtgccacta5400 agatcaagcggcgcgccgcttgtcttagtgtcaaggcaaccccaagcaag ctggcccaga5460 gccaaccctaattccggaagtcccgcccaccggaagtgacgtcacaggaa atgacgtcac5520 aggaaatgacgtaattgtccgccatcttgtaccggaagtcccgcctaccg gcggcgaccg5580 gcggcatctgatttgg 5596 (2) INFORMATION
FOR SEQ
ID N0:
26:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5255 base pairs (s) TYPE: nucleic acid (C) STRANDEDNE55: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:
cgccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcgg60 acaattacgtcatttcctgtgacgtcacaggaaatgacgtcacaggaaatgacgtaattg120 tccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctgatttggt180 gtcttcttttaaattttagcgggcttttttcccgccttatgcaaatgggcagccatttta240 agtgttttactataattttattggtcagttttgtaacggttaaaatgggcggagcgtagg300 cggggactacagtatatatagcagggcactgccgcagctctttctttctgggctgctttt360 tcctggactttcttgctgttttttgtgagctaactaacaggtatttatactacttgttaa420 catactaacatggagctatttagaggggtgcttcaagtttcttctaatgttctggactgt480 gctaacgataactggtggtgctctttactggatttagacacttctgactgggaaccacta540 actcatactaacagactaatggcaatatacttaagcagtgtggcttctaagcttgacttt600 accggggggccactagcagggtgcttgtacttttttcaagtagaatgtaacaaatttgaa660 gaaggctatcatattcatgtggttattggggggccagggttaaaccccagaaacctcaca720 gtgtgtgtagaggggttatttaataatgtactttatcaccttgtaactgaaaatgtgaag780 ctaaaatttttgccaggaatgactacaaaaggcaaatactttagagatggagagcagttt840 atagaaaactatttaatgaaaaaaatacctttaaatgttgtatggtgtgttactaatatt900 gatggatatatagatacctgtatttctgctacttttagaaggggagcttgccatgccaag960 aaaccccgcattaccacagccataaatgatgctagtagtgatccgggggagtctagcggc1020 acaggggcagaggttgtgccatttaatgggaagggaactaaggctagcataaagtttcaa1080 actatggtaaactggttgtgtgaaaacagagtgtttacagaggataagtggaaactagtt1140 gactttaaccagtacactttactaagcagtagtcacagtggaagttttcaaattcagagt1200 gcactaaaactagcaatttataaagcaactaatttagtgcctactagcacatttttattg1260 catacagactttgagcagattatgtgtattaaagacaataaaattgttaaattgttactt1320 tgtcaaaactatgaccccctattggtggggcagcatgtgttaaagtggattgataaaaaa1380 tgtggcaagaaaaatacactgtggttttatgggccgccaagtacaggaaaaacaaacttg1440 gcaatggccattgctaaaagtgttccagtatatggcatggttaactggaataatgaaaac1500 tttccatttaatgatgtagcagggaaaagcttggtggtctgggatgaaggtattattaag1560 tctacaattgtggaagctgcaaaagccattttaggcgggcaacccaccagggtagatcaa1620 aaaatgcgtggaagtgtagctgtgcctggagtacctgtggttataaccagcaatggtgac1680 attacttttgttgtaagcgggaacactacaacaactgtacatgctaaagccttaaaagag1740 cgaatggtaaagttaaactttactgtaagatgcagccctgacatggggttactaacagag1800 gctgatgtacaacagtggcttacatggtgtaatgcacaaagctgggaccactatgaaaac1860 tgggcaataaactacacttttgatttccctggaattaatgcagatgccctccacccagac1920 ctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgaaagctct1980 gaagaactcagtgaaagcagcttttttaacctcatcaccccaggcgcctggaacactgaa2040 accccgcgctctagtacgcccatccccgggaccagttcaggagaatcatttgtcggaagc2100 tcagtttcctccgaagttgtagctgcatcgtgggaagaagccttctacacacctttggca2160 gaccagtttcgtgaactgttagttggggttgattatgtgtgggacggtgtaaggggttta2220 cctgtgtgttgtgtgcaacatattaacaatagtgggggaggcttgggactttgtccccat2280 tgcattaatgtaggggcttggtataatggatggaaatttcgagaatttaccccagatttg2340 gtgcggtgtagctgccatgtgggagcttctaatcccttttctgtgctaacctgcaaaaaa2400 tgtgcttacctgtctggattgcaaagctttgtagattatgagtaaagaaagtggcaaatg2460 gtgggaaagtgatgataaatttgctaaagctgtgtatcagcaatttgtggaattttatga2520 gaaggttactggaacagacttagagcttattcaaatattaaaagatcattataatatttc2580 tttagatcatcccctagaaaacccatcctctctgtttaacttagttgctcgtattaaaaa2640 taaccttaaaaactctccagacttatatagtcatcattttcaaagtcatggacagttatc2700 tgaccacccccatgccttatcatccagtagcagtcatgcagaacctagaggagaaaatgc2760 agtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacccggtac2820 taactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgttgacag2880 tgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaatccata2940 tactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaactgggtt3000 tcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgtggccca3060 ttttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaatacccaagcat3120 gacttcagttaattctgcagaagccagcactggtgcaggagggggtggcagtaatcctgt3180 caaaagcatgtggagtgagggggccacttttagtgccaactctgtaacttgtacattttc3240 cagacagtttttaattccatatgacccagagcaccattataaggtgttttctcccgcagc3300 aagtagctgccacaatgccagtggaaaggaggcaaaggtttgcaccattagtcccataat3360 gggatactcaaccccatggagatatttagattttaatgctttaaatttatttttttcacc3420 tttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgctttaactgt3480 aaccatatcagaaattgctgttaaggatgttacagacaaaactggagggggggtacaggt340 tactgacagcactacagggcgcctatgcatgttagtagaccatgaatacaagtacccata3600 tgtgttagggcaaggtcaggatactttagccccagaacttcctatttgggtatactttcc3660 ccctcaatatgcttacttaacagtgggagatgtcaacacacaaggaatctctggagacag3720 caaaaaattagcaagtgaagaatcagcattttatgttttggaacacagttcctttcagct3780 tttaggtacaggaggtacagcaactatgtcttataagtttcctccagtgcccccagaaaa3840 tttagagggctgcagtcaacacttttatgaaatgtacaatcccttatacggatcccgctt3900 aggggttcctgacacattaggaggtgacccaaaatttagatctttaacacatgaagacca3960 tgcaattcagccccaaaactttatgccagggccactagtaaactcagtgtctacaaagga4020 gggagacagctctaatactggagctggaaaagccttaacaggccttagcacaggtacctc4080 tcaaaacactagaatatccttacgccctgggccagtgtctcagccataccaccactggga4140 cacagataaatatgttacaggaataaatgccatttctcatggtcaaaccacttatggtaa4200 cgctgaagacaaagagtatcagcaaggagtgggtagatttccaaatgaaaaagaacagct4260 aaaacagttacagggtttaaacatgcacacctatttccccaataaaggaacccagcaata4320 tacagatcaaattgagcgccccctaatggtgggttctgtatggaacagaagagcccttca4380 ctatgaaagccagctgtggagtaaaattccaaatttagatgacagttttaaaactcagtt4440 tgcagccttaggaggatggggtttgcatcagccacctcctcaaatatttttaaaaatatt4500 accacaaagtgggccaattggaggtattaaatcaatgggaattactaccttagttcagta4560 cgccgtgggaattatgacagtaactatgacatttaaattggggccccgtaaagctacggg4620 acggtggaatcctcaacctggagtatatcccccgcacgcagcaggtcatttaccatatgt4680 actatatgaccccacagctacagatgcaaaacaacaccacagacatggatatgaaaagcc4740 tgaagaattgtggacagccaaaagccgtgtgcacccattgtaaacactccccaccgtgcc4800 ctcagccaagatgcgtaactaaacgcccaccagtaccacccagactgtacctgccccctc4860 ctgtacctataagacagcctaacacaaaagacatagacaatgtagaatttaagtacttaa4920 ccagatatgaacaacatgttattagaatgttaagattgtgtaatatgtat caaaatttag4980 aaaaataaacatttgttgtggttaaaaaattatgttgttgcgctttaaaa atttaaaaga5040 agacaccaaatcagatgccgccggtcggccggtaggcgggacttccggta caagatggcg5100 gacaattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccgg tgagcggaac5160 ttccggaagtgacgtcacaggaaatgacgtcacaggaaatgacgtaattg tccgccatct5220 tgtaccggaagtcccgcctaccggccgaccggcgg 5255 (2) INFORMATION
FOR SEQ
ID N0:
27:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
catttgtcgg aagctcagtt tcctccgaag 30 (2) INFORMATION FOR SEQ ID N0: 28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
cttcggagga aactgagctt ccgacaaatg 30 (2) INFORMATION FOR SEQ ID N0: 29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (i1) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:
gcaaagcttt gtagatttag agtaaagaaa gtggcaaatg gtggg 45 (2) INFORMATION FOR SEQ ID N0: 30:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (X1) SEQUENCE DESCRIPTION: SEQ ID N0:30:
cccaccattt gccactttct ttactctaaa tctacaaagc tttgc 45 (2) TNFORMATION FOR SEQ ID N0: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nUCleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:
gatttccctg gaattatagc agatgccctc cacccagacc 40 (2) INFORMATION FOR SEQ ID N0: 32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:
ggtctgggtg gagggcatct gctataattc cagggaaatc 40 (2) INFORMATION FOR SEQ ID N0: 33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE;
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:33:
agtcatcatt ttcaaagtct aggacagtta tctgaccacc 40 (2) INFORMATION FOR SEQ ID N0: 34:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNE55: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (xi) SEQUENCE DESCRIPTION: SEQ ID N0:34:
ggtggtcaga taactgtcct agactttgaa aatgatgact 40 (2) INFORMATION FOR SEQ ID N0: 35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (Xi) SEQUENCE DESCRIPTION: SEQ ID N0:35:
caccacagac atggattaga aaagcctgaa gaattgtgga c 41 (2) INFORMATION FOR SEQ ID N0: 36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Artificial (Xi) SEQUENCE DESCRIPTION: SEQ ID N0:36:
gtccacaatt cttcaggctt ttctaatcca tgtctgtggt g 41 (2) INFORMATION FOR SEQ ID N0: 37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 362 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:37:
ccaaatcaga tgccgccggt cgccgccggt aggcgggact tccggtacaa gatggcggac 60 aattacgtca tttcctgtga cgtcatttcc tgtgacgtca cttccggtgg gcgggacttc 120 cggaattagggttggctctgggccagcttgcttggggttgccttgacactaagacaagcg180 gcgcgccgcttgtcttagtggcacgtcaaccccaagcgctggcccagagccaaccctaat240 tccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacgt300 aattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctgat360 tt 362 (2) INFORMATION
FOR
SEQ
ID N0:
38:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5596 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A)ORGANISM: Parvovirus B19 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:38:
ccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtacaagatggcggac60 aattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtgggcgggacttc120 cggaattagggttggctctgggccagcttgcttggggttgccttgacactaagacaagcg180 gcgcgccgcttgatcttagtggcacgtcaaccccaagcgctggcccagagccaaccctaa240 ttccggaagtcccgcccaccggaagtgacgtcacaggaaatgacgtcacaggaaatgacg300 taattgtccgccatcttgtaccggaagtcccgcctaccggcggcgaccggcggcatctga360 tttggtgtcttcttttaaattttagcgggcttttttcccgccttatgcaaatgggcagcc420 attttaagtgttttactataattttattggtcagttttgtaacggttaaaatgggcggag480 cgtaggcggggactacagtatatatagcacagcactgccgcagctctttctttctgggct540 gctttttcctggactttcttgctgttttttgtgagctaactaacaggtatttatactact600 tgttaatatactaacatggagctatttagaggggtgcttcaagtttcttctaatgttctg660 gactgtgctaacgataactggtggtgctctttactagatttagacacttctgactgggaa720 ccactaactcatactaacagactaatggcaatatacttaagcagtgtggcttctaagctt780 gaccttaccggggggccactagcagggtgcttgtacttttttcaagcagaatgtaacaaa840 tttgaagaaggctatcatattcatgtggttattggggggccagggttaaaccccagaaac900 ctcacagtgtgtgtagaggggttatttaataatgtactttatcactttgtaactgaaaat960 gtgaagctaaaatttttgccaggaatgactacaaaaggcaaatactttagagatggagag1020 cagtttatagaaaactatttaatgaaaaaaatacctttaaatgttgtatggtgtgttact1080 aatattgatggatatatagatacctgtatttctgctacttttagaaggggagcttgccat1140 gccaagaaaccccgcattaccacagccataaatgatactagtagcgatgctggggagtct1200 agcggcacaggggcagaggttgtgccatttaatgggaagggaactaaggctagcataaag1260 tttcaaactatggtaaactggttgtgtgaaaacagagtgtttacagaggataagtggaaa1320 ctagttgactttaaccagtacactttactaagcagtagtcacagtggaagttttcaaatt1380 caaagtgcactaaaactagcaatttataaagcaactaatttagtgcctactagcacattt1440 ttattgcatacagactttgagcaggttatgtgtattaaagacaataaaattgttaaattg1500 ttactttgtcaaaactatgaccccctattggtggggcagcatgtgttaaagtggattgat1560 aaaaaatgtggcaagaaaaatacactgtggttttatgggccgccaagtacaggaaaaaca1620 aacttggcaatggccattgctaaaagtgttccagtatatggcatggttaactggaataat1680 gaaaactttccatttaatgatgtagcaggaaaaagcttggtggtctgggatgaaggtatt1740 attaagtctacaattgtagaagctgcaaaagccattttaggcgggcaacccaccagggta1800 gatcaaaaaatgcgtggaagtgtagctgtgcctggagtacctgtggttataaccagcaat1860 ggtgacattacttttgttgtaagcgggaacactacaacaactgtacatgctaaagcctta1920 aaagagcgcatggtaaagttaaactttactgtaagatgcagccctgacatggggttacta1980 acagaggctgatgtacaacagtggcttacatggtgtaatgcacaaagctgggaccactat2040 gaaaactgggcaataaactacacttttgatttccctggaattaatgcagatgccctccac2100 ccagacctccaaaccaccccaattgtcacagacaccagtatcagcagcagtggtggtgaa2160 agctctgaagaactcagtgaaagcagcttttttaacctcatcaccccaggcgcctggaac2220 actgaaaccccgcgctctagtacgcccatccccgggaccagttcaggagaatcatttgtc2280 ggaagcccagtttcctccgaagttgtagctgcatcgtgggaagaagccttctacacacct2340 ttggcagaccagtttcgtgaactgttagttggggttgattatgtgtgggacggtgtaagg2400 ggtttacctgtgtgttgtgtgcaacatattaacaatagtgggggaggcttgggactttgt2460 ccccattgcattaatgtaggggcttggtataatggatggaaatttcgagaatttacccca2520 gatttggtgcgatgtagctgccatgtgggagcttctaatcccttttctgtgctaacctgc2580 aaaaaatgtgcttacctgtctggattgcaaagctttgtagattatgagtaaagaaagtgg2640 caaatggtgggaaagtgatgatgaatttgctaaagctgtgtatcagcaatttgtggaatt2700 ttatgaaaaggttactggaacagacttagagcttattcaaatattaaaagatcattataa2760 tatttctttagataatcccctagaaaacccatcctctctgtttgacttagttgctcgcat2820 taaaaataaccttaaaaattctccagacttatatagtcatcattttcaaagtcatggaca2880 gttatctgaccacccccatgccttatcatccagtagcagtcatgcagaacctagaggaga2940 agatgcagtattatctagtgaagacttacacaagcctgggcaagttagcgtacaactacc3000 cggtactaactatgttgggcctggcaatgagctacaagctgggcccccgcaaagtgctgt3060 tgacagtgctgcaaggattcatgactttaggtatagccaactggctaagttgggaataaa3120 tccatatactcattggactgtagcagatgaagagcttttaaaaaatataaaaaatgaaac3180 tgggtttcaagcacaagtagtaaaagactactttactttaaaaggtgcagctgcccctgt3240 ggcccattttcaaggaagtttgccggaagttcccgcttacaacgcctcagaaaaataccc3300 aagcatgacttcagttaattctgcagaagccagcactggtgcaggaggggggggcagtaa3360 tcctgtcaaaagcatgtggagtgagggggccacttttagtgccaactctgtgacttgtac3420 attttctagacagtttttaattccatatgacccagagcaccattataaggtgttttctcc3480 cgcagcaagtagctgccacaatgccagtggaaaggaggcaaaggtttgcaccattagtcc3540 cataatgggatactcaaccccatggagatatttagattttaatgctttaaacttattttt3600 ttcacctttagagtttcagcacttaattgaaaattatggaagtatagctcctgatgcttt3660 aactgtaaccatatcagaaattgctgttaaggatgttacagacaaaactggagggggggt3720 gcaggttactgacagcactacagggcgcctatgcatgttagtagaccatgaatacaagta3780 cccatatgtgttagggcaaggtcaagatactttagccccagaacttcctatttgggtata3840 ctttccccctcaatatgcttacttaacagtaggagatgttaacacacaaggaatttctgg3900 agacagcaaaaaattagcaagtgaagaatcagcattttatgttttggaacacagttcttt3960 tcagcttttaggtacaggaggtacagcaactatgtcttataagtttcctccagtgccccc4020 agaaaatttagagggctgcagtcaacacttttatgagatgtacaatcccttatacggatc4080 ccgcttaggggttcctgacacattaggaggtgacccaaaatttagatctttaacacatga4140 agaccatgcaattcagccccaaaacttcatgccagggccactagtaaactcagtgtctac4200 aaaggagggagacagctctaatactggagctgggaaagccttaacaggccttagcacagg4260 tacctctcaaaacactagaatatccttacgcccggggccagtgtctcagccgtaccacca4320 ctgggacacagataaatatgtcacaggaataaatgctatttctcatggtcagaccactta4380 tggtaacgctgaagacaaagagtatcagcaaggagtgggtagatttccaaatgaaaaaga4440 acagctaaaacagttacagggtttaaacatgcacacctactttcccaataaaggaaccca4500 gcaatatacagatcaaattgagcgccccctaatggtgggttctgtatggaacagaagagc4560 ccttcactatgaaagccagctgtggagtaaaattccaaatttagatgacagttttaaaac4620 tcagtttgcagccttaggaggatggggtttgcatcagccacctcctcaaatatttttaaa4680 aatattaccacaaagtgggccaattggaggtattaaatcaatgggaattactaccttagt4740 tcagtatgccgtgggaattatgacagtaaccatgacatttaaattggggccccgtaaagc4800 tacgggacggtggaatcctcaacctggagtatatcccccgcacgcagcaggtcatttacc4860 atatgtactatatgaccctacagctacagatgcaaaacaacaccacagacatggatatga4920 aaagcctgaagaattgtggacagccaaaagccgtgtgcacccattgtaaacactccccac4980 cgtgccctcagccaggatgcgtaactaaacgcccaccagtaccacccagactgtacctgc5040 cccctcctatacctataagacagcctaacacaaaagatatagacaatgtagaatttaagt5100 atttaaccagatatgaacaacatgttattagaatgttaagattgtgtaatatgtatcaaa5160 atttagaaaaataaacgtttgttgtggttaaaaaattatgttgttgcgctttaaaaattt5220 aaaagaagacaccaaatcagatgccgccggtcgccgccggtaggcgggacttccggtaca5280 agatggcggacaattacgtcatttcctgtgacgtcatttcctgtgacgtcacttccggtg5340 ggcggaacttccggaattagggttggctctgggccagcgcttggggttgacgtgccacta5400 agatcaagcggcgcgccgcttgtcttagtgtcaaggcaaccccaagcaagctggcccaga5460 ' CA 02474032 2005-05-25 gccaacccta attccggaag tcccgcccac cggaagtgac gtcacaggaa atgacgtcac 5520 aggaaatgac gtaattgtcc gccatcttgt accggaagtc ccgcctaccg gcggcgaccg 5580 gcggcatctg atttgg 5596

Claims

1. A method for cloning a parvovirus B19 viral genome comprising:
(a) introducing a vector comprising all or a portion of a parvovirus B19 genome into a prokaryotic cell that is deficient in at least one recombinase enzyme;

(b) incubating the cells at about 25°C to 35°C; and (c) recovering the vector from the prokaryotic cells.

2. The method of claim 1, wherein the viral genome comprises an inverted terminal repeat (ITR) at the 5' end of the genome or at the 3' end of the genome or both.

3. The method of claim 2, wherein the ITR comprises a nucleic acid sequence of SEQ ID
NO:1.

4. The method of claim 2, wherein the ITR comprises a nucleic acid sequence of SEQ ID
NO:2.

5. The method of claim 2, wherein the viral genome further comprises a nucleic acid sequence encoding at least one or all of VP2, nonstructural protein, or 11-kDa protein.

6. The method of claim 1, wherein the viral genome is a full length parvovirus B19 genome.

7. The method of claim 6, wherein the B19 genome comprises a nucleic acid sequence that has at least 90% nucleic acid sequence identity to SEQ ID NO:5 or SEQ ID
NO:24.

8. The method of claim 6, wherein the B19 genome comprises a nucleic acid sequence of SEQ ID NO:5.

9. The method of claim 1, wherein the vector is a plasmid comprising a bacterial origin of replication.

10. The method of claim 9, wherein the vector can replicate to high copy number in the cell.

11. The method of claim 9, wherein the vector is selected from the group consisting of pBR322, p ProExHTb, pUc19 and pBluescript SK.

12. The method of claim 1, further comprising forming a vector comprising all or a portion of a parvovirus B19 viral genome by cloning the viral nucleic acid of at least 10 8 genome copies of the parvovirus B19 genome into the vector.

13. The method of claim 1, wherein the vector is introduced into the cells by electroporation.

14. The method of claim 12, wherein at least about 0.25 to 0.5 µg of viral gemone is combined with 1 ug of the vector.

15. The method of claim 1 wherein the prokaryotic cell is a bacterial cell.

16. The method of claim 15, wherein the prokaryotic cells are deficient in a recombinase enzyme selected from the group consisting of recAl, endA, recB , recJ and mixtures thereof

17. The method of claim 16, wherein the bacterial cells are E. coli.

18. The method of claim 17, wherein the E. coli comprise a genotype of e14-(McrA-) .DELTA.(mcrCB-hsdSMR-mrr)171 endAl supE44 thi-1 gyrA96 relAl lac recB recJ
sbcC umuC::Tn5 (Kanr) uvrC [F' proAB lacIqZM15 Tn10 (Tetr)].

19. The cells are incubated for a time sufficient to allow amplification of the vector.

20. The method of claim 12, further comprising cloning the viral genome by cloning at least two portions of the viral genome into separate vectors, wherein each portion of the viral genome comprises an ITR at an end of the portion of the viral genome and recombining the two portions into a single vector.

21. The method of claim 20, wherein the at least two portions of the viral genome are obtained by digesting the viral genome with a restriction enzyme, wherein the restriction enzyme cuts the viral genome at a nucleotide that is located in between the ITRs.

22. A method for producing an infectious virus of parvovirus B19, comprising:
(a) introducing a vector comprising an infectious clone of parvovirus B19 into a population of cells, wherein the vector is present in at least about 15% of the cells; and (b) incubating the cells under conditions to allow for viral replication.

23. The method of claim 22, wherein the cells are eukaryotic cells.

24. The method of claim 22, wherein introducing the vector into the population of cells is conducted by electric current.

25. The method of claim 24, wherein the cells are exposed to an electrical pulse comprising a field strength of about 2kV/cm to about 10kV/cm, a duration of at least about µsec, and a current of at least about 1 A followed by a current flow of about 1 A to about 3 A for at least 10 msec.

26. The method of claim 23, wherein the eukaryotic cells are erythroid progenitor cells, fetal liver cells, UT7/EPO cells, UT7/EPO-S1 cells, or KU812Ep6 cells.

27. The method of claim 22, wherein the viral genome comprises an ITR sequence having a nucleic acid sequence of SEQ ID NO:1.

28. The method of claim 22, wherein the viral genome comprises an ITR sequence having a nucleic acid sequence of SEQ ID NO:2.

29. The method of claim 28, wherein the viral genome further comprises comprises a nucleic acid sequence encoding one or more of 11-kDa protein, nonstructural protein, VP1, or VP2.

30. The method of claim 22, wherein the viral genome comprises a nucleic acid sequence having at leapt 90% nucleic acid sequence identity to SEQ ID NO:5 or SEQ ID
NO:24.

31. The method of claim 22, wherein the infectious parvovirus B19 clone comprises a nucleic acid sequence of SEQ ID NO:5.

32. The method of claim 22, wherein the cells are incubated for about 72 hours at about 37°C.

33. The method of claim 22, further comprising detecting reproduction of the parvovirus B19 viral genome comprising detecting the presence of B19 spliced capsid transcripts or B19 capsid protein.

34. The method of claim 33, wherein the B19 capsid protein is detected by binding to a specific antibody for B19 capsid protein.

35. The method of claim 33, wherein the presence of a B19 spliced capsid transcript is detected using PCR.

36. The method of claim 22, further comprising detecting reproduction of the infectious parvovirus B19 comprising contacting permissive cells with supernatant from the population of cells and analysing the contacted permissive calls for B19 spliced capsid transcripts, wherein detection of spliced capsid transcripts indicates the parvovirus B19 is infectious.

37. An isolated infectious parvovirus B19 clone comprising all or a portion of a parvovirus B19 viral genome and a replicable vector.

38. The isolated infectious parvovirus B19 clone of claim 37, wherein the portion of the viral genome comprises an inverted terminal repeat located at a 5' and a 3' ends of the genome, wherein the inverted terminal repeat comprises a nucleic acid sequence of SEQ
ID NO.1 and/or SEQ ID NO:2.

39. The infectious parvovirus B19 clone of claim 38, wherein the portion of the viral genome further comprises one or more of 11-kDa protein, VP1, VP2, and nonstructural protein (NS).

40. The infectious parvovirus B19 clone of claim 37, wherein parvovirus viral genome is a full-length genome.

41. The infectious parvovirus B19 clone of claim 37, wherein the parvovirus B19 viral genome comprises a polynucleotide having at least 90% sequence identity to SEQ
ID NO:5 or SEQ ID NO:24.

42. The infectious parvovirus B19 clone of claim 41, wherein the parvovirus B19 viral genome comprises a polynucleotide comprising a nucleic acid sequence of SEQ ID
NO:5

43. The infectious parvovirus clone of claim 37, wherein the clone is stable upon passage in bacterial cells.

44. A cell comprising the infectious clone of parvovirus B19 of claim 37.

45. A method of identifying an infectious clone comprises:
introducing a vector comprising all or a portion of a viral genome into a eukaryotic cell;
incubating the cell for a sufficient time to produce infectious virus; and detecting production of infectious virus.