CA2469098A1 - Pathogen inducible plant promoter and use thereof - Google Patents

Abstract

An isolated polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence are provided In one embodiment of the invention. In another embodiment of the invention, methods are provided for transforming plant cells with the sequences, and also for regenerating the plants cells into plants. Transformed plants are also provided that preferably express plant defense genes.

Description

Pathogen inducible plant promoter and use thereof Field of the invention:
The invention relates to a plant promoter that is induced by pathogen attack.
More specifically, the invention relates to a wound and pathogen inducible promoter and uses thereof.
Background of the invention:
Over the years, there have been many approaches to dealing with pests and diseases in plants. In days gone by, crop rotation and burning were relied upon to reduce the pest load in crop species.
As cropping moved progressively to mono-cropping on very large acreages, disease loads increased and crops losses resulted. Spraying programmes were developed to assist producers in reducing crop losses as a result of pests and diseases. While these could often prevent crop failures, the cost of spraying programmes was substantial. Further, the use of sprays was found to be deleterious to the environment, as it polluted ground water and soil, and led to resistant diseases and pests.
With regard to disease, there is often a very rapid onset and spreading of the disease vector. A
crop can be destroyed in a matter of days. Hence, unless a prophylactic spraying programme is in place, a crop may be lost before spraying commences.
In more recent years, there has been the development of a number of transgenic plants with elevated tolerance to economically important pests and disease agents.
However, in most of them the transgene is driven by a powerful constitutive promoter, such as the cauliflower mosaic virus 35S (CaMV 35S) and its derivatives, and is expressed at high levels even in the absence of pathogen invasion. For example, we showed earlier that potato plants can be engineered for broad-spectrum disease resistance by expression of antimicrobial peptides from a constitutive CaMY 35S promoter [5]. Continuous synthesis and high accumulation of transgene products, especially toxins, could interfere with plant metabolic pathways and the overall expression of other valuable traits.

Studies of inducible promoters have led to the isolation and characterization of a number of plant promoters. Within those that have been studied are a group that are referred to as wound inducible promoters. These promoters control expression of a heterogeneous array of genes.
For example, there are genes that encode chitinases, glucanases, structural proteins such as S hydroxyl proline-rich glycoproteins, peroxidases, enzymes of the phenylpropanoid pathway, glycine rich proteins and protease inhibitors.
A number of wound inducible genes have been isolated from poplar (Populus trichocarpa x P.
deltoids. These genes are predicted to encode chitinases, protease inhibitors and storage proteins. Promoters controlling expression of these genes have been shown to be induced by wounding. For example, the win6 promoter was studied and was shown to be induced by wounding, was developmentally activated in young leaves and floral tissue.
The win3.l2 is another promoter that has been isolated from poplar. This promoter controls expression of a gene that belongs to a heterogeneous multigene family of proteinase inhibitors.
These genes encode for protein that represent up to 5% of the total protein in storage organs, serve multifunctional roles in plant development, and some of whose members have been shown to retard growth and development of insect larvae in artificial feeding experiments [6]. The win3. l2 gene, specifically is thought to encode a Kunitz-type proteinase inhibitor.
Hollick and Gordon [4] have shown that 1352 by region upstream of the translation initiation site of the win3.12 gene from hybrid poplar (P. trichocarpa x P. deltoides) is responsive to wound stimuli in transgenic tobacco. The sequence is shown in Fig. 6 and is designated SEQ ID
No 1.
Although proteases and chitinases have been shown to accumulate in response to wounding, fungal elicitors and insect feeding, there are many that are not induced by these stressors. For example in Arabidopsis 8200 genes were analysed from the sequences in databank. A total of 657 genes were identified as wound responsive. Only 30% of wound responsive genes were reported to be involved in plant defense. Of those 30%, no information exists on induction of these genes in response to pathogens. Further, a wound responsive gene Pin from potato does not respond to fungal challenge and shows a high background level of expression. Thus, the wound induced pin promoter of potato is not useful to engineer fungal induced activity. A

further indication of a lack of relationship between wound induction and pathogen induction is seen with regard to the Lox gene family. The Lox gene family of potato contains several members that are transcriptionally activated in response to wounding, pathogens or their elicitors. However, there are also members that are not induced by either wounding or pathogens. The POTLX-3 gene is specifically induced by pathogen infection and does not respond to wounding.
It is an object of the invention to overcome the deficiencies in the prior art.
Summary of the invention:
It is an object of the invention to provide a pathogen inducible promoter for use with plant defense genes. The use of promoters of plant defensive genes has distinct advantages because most of them are activated only when the plant is attacked by pests or pathogens and the transgene product when expressed constitutively and at a high level may be toxic to the plants and animals. The win3.12T promoter, induces low transgene expression in vegetative organs (except in roots) under normal conditions, and increases expression only in response to pathogen invasion. Another advantage is that this promoter has low activity in tubers, the edible part of potato. In addition, transgene expression in win3.12T plants can be predicted from the number of insertions and is useful for applications where low to moderate promoter activity is preferred.
The use of native plant promoters (i.e. from native species) can also help to avoid transgene silencing often associated with the presence of promoters of non-plant origin in the plant genome.
In one embodiment of the invention, an isolated polynucleotide sequence comprising SEQ. ID
No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence is provided.
In another aspect of the invention the sequence is characterized as having promoter activity.
In another aspect of the invention, the activity is inducible.

In another aspect of the invention, the activity is inducible in response to at least one of wounding, exposure to at least one suitably selected pathogen or exposure to at least one suitably selected pathogen elicitor.
In another aspect of the invention, the activity is in response to exposure to at least one suitably selected pathogen or exposure to at least one suitably selected pathogen elicitor.
In another aspect of the invention, the pathogen is Fusarium.
In another aspect of the invention, the sequence further comprises regulatory sequences operatively linked to SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.
In another aspect of the invention, the sequence further comprises a suitably selected plant pathogen defense gene.
In another aspect of the sequence of the invention, the selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.
In another embodiment of the invention a transgenic cell comprising a polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence is provided.
In another aspect of the invention the transgenic cell comprises a suitably selected plant pathogen defense gene.
In another aspect of the transgenic cell of the invention, the suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.

In another aspect of the invention the transgenic cell further comprising sequences operatively linked to SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.
In another aspect of the invention, the transgenic cell is a plant cell.
In yet another embodiment of the invention, a method for expressing a nucleic acid sequence of interest in a plant cell, comprising providing:
a plant cell;
a nucleic acid sequence of interest; and a polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence, is provided.
In another aspect of the method of the invention, the nucleic acid sequence of interest is a suitably selected pathogen defense gene.
In another aspect of the method of the invention, the suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.
In another aspect of the method of the invention, the polynucleotide sequence is SEQ ID No 2 or its complement.
In another aspect of the method of the invention, the plant cell is a potato plant cell.
In another aspect of the invention, the method further comprises regenerating the plant cell into a plant using PetM regeneration medium.
In another embodiment of the invention, a transformed plant produced by transforming a plant cell with a nucleic acid sequence of interest and a polynucleotide sequence comprising SEQ. ID

No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence, and regenerating said plant is provided.
In another aspect of the transgenic plant of the invention, the transformed plant is a potato plant.
In another aspect of the transgenic plant of the invention, the transformed plant is regenerated by culturing in PetM regeneration medium.
In another aspect of the transgenic plant of the invention, the nucleic acid sequence of interest is a pathogen defense gene.
In another aspect of the transgenic plant of the invention, the suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.
In another aspect of the invention, a cell line derived from a plant that is the product of the process of transforming a plant cell with a nucleic acid sequence of interest and a polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence, and regenerating said plant, is provided.
In another aspect of the invention, the cell line is derived from a potato plant.
In another aspect of the invention, the cell line is derived from a plant that has been regenerated by culturing in PetM regeneration medium.
In another aspect of the cell line of the invention, the nucleic acid sequence of interest is a pathogen defense gene.

In another aspect of the cell line of the invention, the suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.
Figures:
Figure 1. A-C. A schematic presentation of the pwin3.12T-GUS construct for potato transformation in accordance with an embodiment of the invention. Restriction sites relevant for cloning are in bold. The positions of PCR primers for DNA analyses are indicated by arrows. PolyA (NOS-t) is a poly-adenylation sequence of the nopaline synthase gene.
B: PCR analysis of DNA isolated from 12 transgenic potato lines. Fragments of 1812 by (B) were generated using GUS-specific primers and they indicated the presence of the full-length transgene. Fragments of 971 by (C) were generated using promoter- and GUS-specific primers and they indicated both the presence of the win3.12T promoter (823 bp) and the correct promoter-transgene fusion. Lane 1 and 17: 1 kb DNA ladder. Lane 2: PCR mix without template DNA. Lane 3: plasmid pwin3.12T-GUS. Lane 4: untransformed potato.
Lanes S tol6:
transgenic potato lines Trwl, Trw2, Trw3, Trw4, TrwS, Trw7, TrwB, Trw9, TrwlO, Trwll, Trwl2, and Trwl4, respectively.
Figure 2. Systemic activity of win3.I2T promoter in response to mechanical wounding in accordance with an embodiment of the invention. The fifth leaf from the apex (line Trwl l) was repeatedly wounded at 0, 1, and 2 h. Mean values of GUS activities t SE (n=3) in pmol MU
mg 1 protein miri 1 were measured at indicated time points in the upper leaf 3 (light grey bars) and leaf 4 (dark grey bars), in the wounded leaf 5 (black bars), and in the lower leaf 6 (white bars). Vertical lines are SE.
Figure 3. Southern blot analysis of transgenic plants in accordance with an embodiment of the invention. Potato DNA was digested with XbaI, eleetrophoresed, and probed with 32-P-labelled GUS gene. The number of bands reflects the number of transgene insertions.
Transgene copy number in bands with higher signal intensity was determined by a Molecular Dynamics densitometer. Molecular weight DNA markers are shown on the left.

Figure 4. A. Results demonstrating that the win3.12T promoter is systemically responsive to fungal infection in accordance with an embodiment of the invention. Mean values of GUS
activities ~ SE in pmol MU mg 1 protein miri 1 were measured in leaves from three plants of transgenic line Trw3. Leaf 1 is the most apical leaf with lamina length longer than 5 mm. Black bars represent systemic GUS activities in potato leaves after co-cultivation of the plant with F.
solani. Grey bars represent local GUS activities in the wounded leaves 24 h after mechanical wounding. White bars represent GUS activities in leaves in the absence of treatment. Vertical lines are SE, and the asterisks indicate GUS activities that are significantly different (P<0.05, by Student's t test) from the corresponding controls. B. Histochemical GUS
staining of leaves from win3.12T plants (line Trw9) grown in the absence of stress (left) and subjected to F. solani infection (right).
Figure 5. A. Systemic activity of poplar promoter in response to crude Fusarium extract. Stems of transgenic plants (line Trw3) were injected with either extract from fungal mycelium (black bars) or 50 mM sodium phosphate buffer (grey bars). White bars denote controls for single wounding of stem by needle. Mean values are GUS activities in the first five leaves located above the site of injection. B. Dynamics of activation of the poplar promoter in leaves incubated with Fusarium extract. One half of detached leaf (line Trw3) was incubated in fungal extract (black bars), and the other half was incubated in 50 mM sodium phosphate buffer (grey bars). In both figures, mean GUS activity t SE (n=3) is given in pmol MU mg 1 protein miri 1, the vertical lines are SE, and the asterisks indicate GUS activities that are significantly different (P<0.05, by Student's t test) from the corresponding controls.
Figure 6. Gene sequence of the win3.12 promoter (SEQ ID No 1 ). The truncated promoter SEQ
ID No 2), win3.12T is underlined and is in accordance with an embodiment of the invention.
Detailed Description of the Invention:
Materials and methods Plant material Solanum tuberosum L. cultivar Desiree plants were grown aseptically in culture tubes (Sigma) on MS medium [7] containing 2% sucrose, in a 16-h photoperiod (25 ~M m 2 s 1 ) at 240C. In vitro tubers were induced as described elsewhere [8] on MS medium containing 8% sucrose, 2.5 mg I; 1 kinetin and 0.5 mg I; 1 abscisic acid Vector construction Two binary vectors designed to express the reporter 13-D-glucuronidase (GUS) gene from different promoters were used for potato transformations: pBI121 [9] contained the 35S
promoter of cauliflower mosaic virus (CaMV), and pwin3.12T-GUS contained the 823 by fragment of the wound-inducible promoter win3.12 from hybrid poplar [4]. To make the pwin3.12T-GUS construct, the promoter part of the proteinase inhibitor-like gene win3.12 (GenBank accession # L11233) was amplified by PCR from plasmid pwin3.12 [4] in a 100 ~,l reaction mix containing 70 ng of pwin3.l2, 2 Units of Deep Vent DNA polymerase (NE
Biolabs) and standard concentrations of MgCl2 dNTPs, and primers (5' WIN, 5'-AACTGCAGAAGCTTCCAACATCAATGAT-3', 28-mer; 3' WIN, 5'-CGGGATCCTCTAGAATTTGTTGAATATGAG-3', 30-mer). The underlined parts of the primers correspond to the win3.12 promoter sequence in GenBank Database, HindIII (forward primer) and engineered XbaI (reverse primer) sites are shown in bold and were used in subsequent cloning. PCR was performed with the manual hot-start and by denaturing the template DNA at 94°C for 3 min, followed by 30 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C, with a 10 min extension at 72°C for the last cycle prior to halting the reaction at 4°C. After electrophoresis in a 1 % (w/v) agarose gel, an 846 by PCR
product corresponding to the desired length of the win3.12T promoter was excised, purified using a NucleoSpin Extraction KitTM (Clontech), digested with HindIII and XbaI, and the 823 by HindIIIlXbaI DNA
fragment ligated into the corresponding sites of pBI121 in place of deleted CaMV 35S promoter.
The correct insertion and full nucleotide sequence of the amplified win3.12T
promoter was confirmed by DNA sequence analysis (PE Applied Biosystems). The constructs were maintained in Agrobacterium tumefaciens MP90.
Medium for potato regeneration (Medium PetM) One-step regeneration medium PetM was used for shoot induction and plant regeneration from all types of potato explants. It contained MS salts [7], Gamborg's vitamins [10], 40 mg L-1 adenine ' S04~ 20 g L; 1 glucose, 20 g I; 1 mannitol, 900 mg L; 1 2-[N-morpholino]ethanesulfonic acid (MES), 0.04 mg L-1 GA3, 0.02 mg I; 1 NAA, 2 mg L; 1 ZR, and 4 g L-1 agarose at pH5.7. Growth regulators GA3 and ZR were filter sterilized and added to the cooled autoclaved medium.
Plant transformation, selection and regeneration Petioles from 4-5-week-old potato plants were used for transformation. After pre-cultivation on liquid PetM for 2 days at 24°C in low light intensity (5 p.M m 2 s 1 ), the explants were incubated with a fresh Agrobacterium culture (re-suspended at OD600=1.0 in liquid PetM
immediately before plant infection) for 1 h with slow shaking, then blotted with sterile filter paper to remove excess bacteria, and placed horizontally on antibiotic-free PetM medium solidified with 0.4% (w/v) agarose. After 3-4 days of cultivation at 24°C in low light, the infected explants were washed twice for 1 h with liquid PetM containing 1 g I;
1 carbenicillin, and placed onto selective PetM medium containing 50 to 100 mg L-1 kanamycin and 500 mg I;
1 carbenicillin. The explants were cultivated at 24 °C in a 16-h photoperiod (60 ~,M m 2 s 1 ) and transferred to fresh antibiotic-containing PetM every 2 weeks. Regenerated shoots (1-1.5 cm high) were rooted in the hormone-free medium (see "Plant material") supplemented with 25 mg I; 1 kanamycin PCR and Southern analysis of transgenic plants Genomic DNA was isolated from potato leaves using a GenEluteTM Plant Genomic DNA Kit (Sigma). Amplification reactions comprised 200 ng of plant DNA in 50 p,l of a PCR mix containing Taq PCR Master MixTM (Qiagen) and specific primers, and were carried out with the following parameters: 94°C for 3 min, then 30 cycles of 94°C
for 30 s, 57°C for 30 s, and 72°C for 1 min 30 s, followed by a final 10 min incubation at 72°C. Primers for plants containing pBIl21 and pwin3.12T-GUS constructs were designed to amplify 1812 by full-length GUS gene: forward primer S'GUS (5'-ATGTTACGTCCTGTAGAAACC-3', 21-mer) and reverse primer 3'GUS (5'- TCATTGTT"TGCCTCCCTGCTG - 3', 21-mer). Another set of primers for win3.12T-GUS plants was used to confirm the correct promoter-transgene fusions (971 by amplified DNA fragment): forward primer 5' WIN (see "Vector construction") and reverse primer 3'M/GUS with sequence complimentary to nucleotides +89 to +109 of the GUS gene upstream region (5'- CTTTCCCACCAACGCTGATCA - 3', 21-mer).
For Southern analysis, 4 p,g of potato DNA from each line was digested with XbaI, electrophoresed in a 1 % (w/v) agarose gel, transferred to a Biodyne B nylon membrane (Pall), and hybridized with 32P-labelled GUS gene in PerfectHyb PIusTM buffer (Sigma) according to the manufacturer's protocol. After final wash in O.Sx SSC, 0.1% SDS at 65 °C for 10 min, the membrane was exposed to a Phosphor ScreenTM (Molecular Dynamics).
Transgenic plant wounding and tissue sampling Leaf tissue samples for protein extraction were collected from the distal portion of fully developed potato leaves on one side of the midrib. After the first samples had been removed, the proximal portion and the periphery of the sampled leaf (~50% of the leaf) were wounded with forceps. In some experiments, the wounded part of the leaf was treated with an aqueous solution of cell wall degrading enzymes, containing 0.2% (w/v) Cellulase (Sigma) and 0.1%
(w/v) Driselase (Sigma). After 18 h (unless otherwise indicated), the distal portion of the same leaf was sampled as before on the opposite side of the midrib.
Plant treatments with Fusarium and fungal extract TM
Fusarium solani was cultivated on medium containing 10% V-8 juice, 5 mM MES, 15 g I. 1 of agar Difco (pH6.4), at RT and low light. Two 1 cm2 agar blocks of the fungal mycelia were placed 3 cm from the stem of a 6-8-week-old well-developed potato plant grown aseptically in a MagentaTM vessel (Sigma), and cultivated for several days. One to two days after the fungal mycelia reached the plant stem (disease symptoms were not visible yet), tissues from all parts of the plant were collected for protein extractions.

For fungal extract, 1 g of 2-week-old F. solani mycelia was ground in liquid N2, transferred to a centrifuge tube with 2 ml of 50 mM sodium phosphate buffer (pH 7.0), vortexed, and then centrifuged twice at 14,000 g for 10 min to pellet the cellular debris. The clear supernatant S contained crude fungal extract and was used for plant treatments. A 400 ~l of the fungal extract was slowly injected into stem of each plant with a 1-ml syringe equipped with a 2761/2 needle (Becton Dickinson). As a control, the transgenic plants were injected with 50 mM sodium phosphate buffer (pH 7.0). First five leaves above the site of injection were collected from each plant at indicated time points and used for protein extractions. In another set of experiments, one half of the leaf was incubated in Fusarium extract, and the other half of the same leaf was incubated in 50 mM sodium phosphate buffer (pH 7.0). The samples were collected for protein extractions after 0, 0.5, 1, and 2 h of treatment.
GUS assays Quantitative fluorometric assays of GUS activity in tissue samples, harvested both before and after treatments, were performed as described earlier [9] by incubation of the extracts (20 ~g protein) with 2 mM 4-methyl-umbelliferyl-(3-D-glucuronide (MUG) in a lysis buffer for 60 min at 37°C. GUS activity was calculated as pmol of 4-methyl-umbelliferone (4-MU) produced miri 1 mg 1 of soluble protein. Histochemical localization of GUS was done according to Jefferson et al. [9].
Detailed Description of the Invention:
Results Production of transgenic plants A plant transformation vector with transcriptional fusion between thewin3.12T
promoter and the GUS reporter gene was constructed (Fig. 1 a) and introduced into S. tuberosum L. cv Desiree by Agrobacterium-mediated transformation. As a control, potato plants were transformed with pBI121 [9]. By using our single-step regeneration protocol, nearly 100%
regeneration frequency with multiple shoots per explant was achieved on the selection medium. Twenty putative transgenic shoots were randomly selected in each experiment and rooted in the presence of selective agent. All plants retained the normal morphology of S.tuberosum L.
Stable transgene integration into plants was confirmed by PCR (Fig. 1 b, c) and Southern analyses (Fig.3).
Twelve lines with the win3.12T-GUS construct and four lines with the CaMV 35S-GUS
construct were randomly selected among the Agrobacterium-free transgenics, and fully developed 6-8-week-old plants grown in vitro were used to study promoter activity.
Local and systemic response to wounding Eighteen hours after mechanical wounding of leaves, all but one of the win3.12T transgenic lines showed increased GUS expression in the uninjured part of the wounded leaf, with the highest GUS activity (pmol MU miri 1 mg 1 protein ) of 290.2319.11 (tSE, n=3) in transgenic line Trw9 (Table 1). The fold induction in response to wound stimuli was from 4.3912.07 (fSE, n=3) in line TrwS to 21.666.12 (tSE, n=3) in Trw9, with average 11-fold increase in GUS
activity upon wounding. The GUS expression in unwounded leaves of win3.12T
plants was merely detectable, ranging from 2.671.1 (tSE, n=5) in line Trw2 to 23.813.86 (tSE, n=3) in Trw7. Thus, the 823 by downstream sequence of win3.12 promoter from poplar (win3.12T
promoter) was sufficient to confer wound-regulated transgene expression in potato.
In contrast, the leaves of all transgenic lines containing CaMV 35S promoter showed no increased GUS activity in response to the same wounding conditions, although constitutive GUS
expression in unwounded leaves was significant: average values (ASE, n=3) from 278.27127.5 in line Trsl to 1125.56188.69 pmol MU miri 1 mg 1 protein in Trs3.
Further analysis of the win3.12T promoter was concentrated on transgenic lines with highest GUS expression: Trw3, Trw9 and Trwll. To study systemic response to wounding, a single leaf in the middle part of the plant (leaf 5, counted downward from the apex) was repeatedly wounded and GUS activity was measured in each leaf from the same plant (including the unwounded part of the wounded leaf) at 0, S, 10, 15 and 20 h. (Fig. 2).
Although the response varied among transformants, 10 h after wounding, GUS activity was clearly detected in the leaf just above the wounded leaf 5. Fifteen and 20 h after wounding, the remote response was detected in other upper leaves (2 and 3) and in the leaf 6 just below the wounded leaf; however, the increase in GUS activity was lower than in leaves 4 and 5. Thus, the wound signal moved mainly upwards, probably in the vascular system and systemic GUS expression increased gradually over time, with the highest activity in the leaves that were closest to the wounded site and just above it. In some win3.12T plants, the elevated GUS expression was also observed in the upper juvenile leaves, which can be explained by the strong sink status of particular leaf and its direct vascular connection to the wounded leaf below.
The expression pattern of the win3.12T promoter varied according to developmental age in all lines. In both stressed and control win3.12T plants, transgene expression was always lowest in young plants (1-2-week-old) and increased several fold as plants matured (8-week-old).
Comparison with GUS activity in control CaMV 35S plants confirmed that this developmental expression pattern was specific for win3.12T promoter and was not a result of GUS protein stability and its accumulation in older plants over time.
Transgene copy number and promoter activity To investigate if the large variation in GUS activity among the transgenic lines is associated with the number of transgene insertions, tra,nsgene copy number was determined by Southern blot (Fig. 3). We observed a strong positive correlation between transgene copy number and win3.12T-driven GUS expression (Table 1 ): the increase in GUS activity in leaves upon wounding was proportional to the number of transgene insertions. The exception was line Trwl2 that exhibited no GUS activity. It contained one transgene insertion, and its transgene silence could be explained by a position effect.
Among plants with the CaMV 35S promoter, no correlation between number of transgene insertions and GUS accumulation was observed, although highest GUS expression was in transgenic line with the largest copy number (Trs2, 14 insertions).
Win3.12T promoter is systemically responsive to fungal infection In addition to mechanical wounding, in some experiments we treated the injured part of the leaf with cell wall degrading enzymes. In all experiments with the combined treatment, local GUS
activity in win3.12T plants was at least twice as high as in leaves that received mechanical damage only. Moreover, 20 h after the treatment, GUS expression was detected in all unwounded leaves of the win3.12T plant (line Trw3) at values comparable to GUS
expression in the wounded leaf 5 indicating a high systemic response.
Potato plants were co-cultivated with Fusarium solani, a potato pathogen, and fluorogenic GUS
activity was quantified in all leaves of each plant 1-2 d after fungal mycelia contacted the plant stem. In all lines, GUS accumulation in the leaf tissue after fungal infection was 2- to 3-fold higher than the local GUS activity in the corresponding leaves upon mechanical wounding: the results from representative lines are shown in Fig. 4. Increased GUS
expression was detected not only in the lower leaves, which are closest to the site of contact with the mycelia, but rather in all leaves indicating a systemic response to fungal infection.
To analyze organ-specific activity of win3.12T promoter, transgenic plants of the same developmental stage were infected with F.solani, and GUS expression was measured in all 1 S vegetative parts of the plants (Table 2). Promoter activity was also studied in the organs of non-stressed plants. All win3.12T lines analyzed had similar spatial patterns of promoter activity. In the absence of treatment, the win3.12T-driven GUS accumulation in aerial parts of the plants was generally low, from practically negligible in leaves to moderate (5-8 times higher) in axillary buds. In contrast, GUS activity in roots was high. This expression pattern was confirmed by histochemical localization of GUS, showing the most intensive blue staining in roots and in vegetative axillary buds with their surrounding stem regions, whereas staining in all other vegetative parts of non-stressed plants was not detectable. After fungal infection, GUS
expression increased in most vegetative organs throughout the plants (Table 2). The highest induction of GUS activity in response to F.solani invasion was in leaves (up to SO-fold), whereas the highest total GUS activity was in axillary bud areas. Promoter activity remained low in tubers. Similar to the experiments with wound treatments, there was no increased GUS activity detected in roots of infected win3.12T plants. No pathogen-induced GUS
accumulation was found in plants with the CaMV 35S promoter.
Activation of poplar promoter by fungal extract To differentiate wound response from infection and to show that the increased GUS
accumulation after co-cultivation with F. solani was a direct response to fungal infection and not due to extensive damage of vascular tissue by growing mycelium, we injected crude Fusarium extract into stems of transgenic plants and measured activity of win3.12T
promoter in all leaves above the site of injection (Fig. Sa). All transgenic plants showed a significant increase in GUS
activity in all leaves just 5 h after injection with fungal extract. Moreover, within a transgenic plant, mean GUS activities in leaves were similar 5, 10, or 20 h after treatment. The response to fungal extract was faster than the response to wounding, reaching a plateau within 5 h. Injection of sodium phosphate buffer into control transgenic plants caused no increase in GUS activity even 20 h after the treatment, and no GUS activity was detected in the fungal extract, indicating that the observed increase in win3.12T promoter activity was caused by chemical compounds present in the fungal extract.
To determine the minimum time required for activation of poplar promoter by fungal extract, whole leaves of similar size and development stage were cut along the main vein, and one half of the leaf was incubated in fungal extract, whereas the other half of the same Leaf was incubated in sodium phosphate buffer. The increase in GUS accumulation after incubation in fungal extract was non linear, preceded by a lag phase with no detectable GUS
activity, then followed by rapid accumulation of transgene product after 2 h of incubation (Fig. Sb).
Similar to previous experiments, no increase in GUS activity was found in leaf samples incubated in buffer (control for wounding). Incubation of leaves is concentrated fungal extract did not increase GUS
accumulation. This may be because of a lack of uptake of the extract or it may be because of low uptake, such that a threshold level was not attained Our finding that the response of the poplar promoter to Fusarium is much higher than to mechanical wounding alone indicates that the win3.12T promoter contains specific regulatory sequences, together with their own set of intracellular receptors/regulatory proteins, that are responsive to fungal infection. The higher GUS expression is response to Fusarium may reflect a cumulative effect of the win3.12T promoter responses to both fungal infection and wounding.
In contrast to inducible activity in most vegetative organs, the win3.12T
promoter is constitutively active in the roots with no response to either wounding or fungal infection.
concentrations.
Example 2:

To evaluate the efficacy of win3.12T promoter for pathogen-induced expression of defense genes, we constructed three plant transformation vectors with transcriptional fusion between this promoter and one of the following antimicrobial peptide genes: cecropin-mellitin (CEMA) chimeric gene (Hancock et al., 1992), dermaseptin B gene (Vouille et. al., 1997), and temporin A gene (Simmaco et al., 1996). These constructs were introduced into tobacco (Nicotiana tabacum L. cv Xanthi) and hybrid poplar (Populus nigra x Populus maximowiczii) via Agrobacterium-mediated transformation. As a control for promoter activity, tobacco and poplar were also transformed with a construct designed to express (3-glucuronidase (GUS) reporter gene from the win3.12T promoter. Stable transgene integration into plants regenerated on selective medium was confirmed with PCR and Southern analyses, indicating that one to nine copies of the transgene were maintained in the plant genome. All transgenic plants had normal genotype, with no indication of cytotoxicity due to expression of the antomicrobial peptide genes. Northern blot analyses of leaf RNA from win3.12T plants showed high level of transgene expression after pathogen infection, whereas in the absence of stimuli the promoter activity was negligible. The pathogen-induced activity of the win3.12T promoter was systemic, i.e.
throughout the plant. A number of stringent bioassays showed a spectrum of plant resistance to fungal infections, which correlated with the expression level of transgene mRNAs in response to pathogen invasion.
The transgenic plants were all resistant to Fusarium solani, Pythium aphanidermatum, and Rhizoctonia solani. These plants were also resistant against wild type of a pathogenic bacteria Agrobacterium tumefaciens.
References 1. M.A. Matzke, A.J.M. Matzke, How and why do plants inactivate homologous (trans)genes? Plant Physiol. 107 (1995) 679-685.
2. D.J.Bowles, Defense related proteins in higher plants, Annu. Rev. Biochem.
59 (1990) 873-907.
3. H.R. Clarke, J.M. Davis, S.M. Wilbert, H.D.Jr. Bradshaw, M.P. Gordon, Wound-induced and developmental activation of a poplar tree chitinase gene promoter in transgenic tobacco, Plant Mol. Biol. 25 (1994) 799-815.

4. J.B. Hollick, M.P. Gordon, A poplar tree proteinase inhibitor-like gene promoter is responsive to wounding in transgenic tobacco, Plant Mol. Biol. 22 (1993) 561-572.
5. M. Osusky, G. Zhou, L. Osuska, R.E. Hancock, W.W. Kay, S. Misra, Transgenic plants expressing cationic peptide chimeras exhibit broad-spectrum resistance to phytopathogens, Nat.
Biotechnol. 18 (2000) 1162-1166.
6. R.M. Broadway, S.S. Duffey, Plant proteinase inhibitors: mechanism of action and effect on the growth and digestive physiology of larval Heliothis zea and Spodoptera exiqua, J. Insect Physiol. 32 (1986) 827-833.
7. T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays with tobacco tissue cultures, Physiol. Plant. 15 (1962) 473-497.
8. J.E.Bourque, J.C.Miller, W.D.Park, Use of an in vitro tuberization system to study tuber protein gene expression, In Vitro Cell. Dev. Biol. Plant 23 (1987) 381-386.
9. R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fusions: D-glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J. 6 (1987) 3901-3907.
10. O.L. Gamborg, R.A. Miller, K. Ojima, Nutrient requirements of suspension cultures of soybean root cells, Exp. Cell Res. 50 (1968) 151-158.
11. M. De Block, Genotype-independent leaf disc transformation of potato (Solarium tuberosum) using Agrobacterium tumefaciens, Theor. Appl. Genet. 76 ( 1988) 767-774.
12. S. Sheerman, M. W. Bevan, A rapid transformation method for Solarium tuberosum using binary Agrobacterium tumefaciens vectors, Plant Cell Rep. 7 (1988) 13-16.
13. W.J. Stiekema, F. Heidekamp, J.D. Louwerse, H.A. Verhoeven, P. Dijkhuis, Introduction of foreign genes into potato cultivars Bintje and Desiree using an Agrobacterium tumefaciens binary vector, Plant Cell Rep. 7 (1988) 47-50.
14. H. Wenzler, G. Mignery, G. May, W. Park, A rapid and efficient transformation method for the production of large numbers of transgenic potato plants, Plant Sci. 63 (1989) 79-85.

15. J.M. Davis, M.P. Gordon, B.A. Smit, Assimilate movement dictates remote sites of wound-induced gene expression in poplar leaves, Proc. Natl. Acad. Sci. USA, 88 (1991) 2393-2396.

16. J.B. Hollick, M.P. Gordon, Transgenic analysis of a hybrid poplar wound-inducible promoter reveals developmental patterns of expression similax to that of storage protein genes, Plant Physiol. 109 (1995) 73-85.

17. R.W. Thornburg, G. An, T.E. Cleveland, R. Johnson, C.A. Ryan, Wound-inducible expression of a potato inhibitor II-chloramphenicol acetyltransferase gene fusion in transgenic tobacco plants, Proc. Natl. Acad. Sci. USA, 84 (1987) 744-748.

18. K. Keinonen-Mettala, A. Pappinen, K. von Weissenberg, Comparisons of the efficiency of some promoters in silver birch (Betula pendula), Plant Cell Rep. 17 (1998) 356-361.

19. E.E. Farmer, C.A. Ryan, Octadecanoid precursors of jasmonic acid activate the synthesis of wound-inducible proteinase inhibitors, Plant Cell, 4(2) (1992) 129-134.

20. S.J. Wang, Y.C. Lan, S.F. Chen, Y.M. Chen, K.W. Yeh, Wound-response regulation of the sweet potato sporamin gene promoter region, Plant Mol. Biol. 48 (2002) 223-231.

21. Y.H. Cheong, H.S. Chang, R. Gupta, X. Wang, T. Zhu, S. Luan, Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in arabidopsis, Plant Physiol. 129 (2002) 661-677.

22. B. Alberts, D. Bray, J. Lewis, M. Raff, K. Roberts, J.D.Watson, Molecular biology of the cell, Ed. 3, Garland Publishing, Inc., New York,1994.

23. K. Maleck, A. Levine, T. Eulgem, A. Morgan, J. Schmid, K.A. Lawton, J.L.
Dangl, R.A.
Dietrich, The transcriptome of Arabidopsis thaliana during systemic acquired resistance, Nat.
Genet. 26 (2000) 403-409.

24. M. Keil, J.J. Sanchez-Serrano, L. Willmitzer, Both wound-inducible and tuber-specific expression are mediated by the promoter of a single member of the potato proteinase inhibitor II
gene family, EMBO J. 8 (1989) 1323-1330.

25. Hancock R.E.W., Brown M.H., Piers K. Cationic peptides and method of preparation. US
Patent application serial No. 07/913, 492, filed August 21, 1992.

26. Vouille V., Amiche M., Nicolas P. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. (1997) FEBS Lett. 414, 27-32.

27. Simmaco M., Mignogna G., Canofeni S., Miele R., Mangoni M.L., Barra D.
Temporins, antimicrobial peptides from the European red frog Rana temporaria. (1996) Eur.
J. Biochem.
242. 788-792.

p~~~g ~i~3'.:~2T ~A~ aid ~aM'V 3~~ ~'B~ p~oma~crs.

A

~ aans~a w~.3.,~''~.~r~"~

1'~ic lc T1 'CIta~3 Tt~r3 Trw~ ~ - TT!8 '"I r~r9 Trwtrl0 Tar l 1 -Try 1 1 ~ 1 1 3 ~ 3 ! ~4 Gar 4 a2~13 ~1~3 '~O~t Lo8~8 "~~~z 2~i~ 6214 it~d.nt~' ,.,cue r~:z ~~~ ;~r:~ ~a~.~ ~:~ ~:~ s:~ ~o.~ x:~ ~~:~ .

I~cv~t Card' ,~~5'~rU~ ~r~its T I Tint Tt~2 "~"r~ Tts"T

City ~cta~br in vra~detl tin':2Z~ i 1 1'~6 ~~~t tit t~9 PW~i ~n a~

t; ~iyjl~,' _ _ ~s r s ~ia~by aa~S~ ~ ~t~~r ~ci~ .
~ti~~r:i~.l~~~~ ~'~vi.~:~
t ~i~r ~nr~s a~ ~; liar. ~5 ~ lt~d~t=aa~t~u~ea1 h ' to 'irr~' t'~U~ ~' ie~ ~rEe~d ~'~ ~D!~ ~ ,~, ~ re~aana~.to rwat~l Eli:

Table 2. Organ-specific plants in activity of win3.12T the promoter in ttansgenic absence of treatment and in response to fungal infection.

DNA ecmstruct wi3:IlT Ca~Y35~=GTIS
GUS

Tra~tsgenic Iine Trw3 Trw9 Trwl l Trs1 Leaves, N~ 114' I4~3 1313 3858 I;eaves;Fb 460142 52134 42621 347152 Petioles, N 21 t4 25+5 245 241 130 Petioles, P 5 t 1~r3~ 5'13~~7 48512$ 23433 ~t~m segme~; 'I~ 287 3~~7 2716 31Q~43 Stem se~me~; F 6337'1 68081 597t7D 2$840 Axillary~ duds, N $711 11219 G3f8 278136 Ancillary buds, F 76054 835*~3 72567 2~ 1 ~2 Vegetative apex, N 3518 53114 f$~10 272140 Wcgetative apex, F 49112 80118 66115 29Q~44 Rots, N 3$446 423152 4U9t47 5701?

Roots; F 3645$ 44061 37439 5$31$1 Tubers; N 1614 I3t3 L5~4 I44t2f Tubers; F 215 114 225 12$19 'tissue eras collected frcau a non-trued plant.

~F; tissue au~s collectedsubjected solani infection(see "Materials frr~m a plant to F.

> s ~Iea~n values-t Slr m ~nol-MU mg' ptotem mug' represent the average GUS accumu#ah~

in indicated orgat~s/tiss~s from three plants of each trans~enic line.

Claims (31)

1. An isolated polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.

2. The sequence of claim 1 wherein said sequence is characterized as having promoter activity.

3. The sequence of claim 1 or 2 wherein said activity is inducible.

4. The sequence of any one of claims 1 to 3 wherein said activity is inducible in response to at least one of wounding, exposure to at least one suitably selected pathogen or exposure to at least one suitably selected pathogen elicitor.

5. The sequence of any one of claims 1 to 4 wherein said activity is in response to exposure to at least one suitably selected pathogen or exposure to at least one suitably selected pathogen elicitor.

6. The sequence of any one of claims 1 to 5 wherein said pathogen is Fusarium.

7. The sequence of any one of claims 1 to 6 wherein said pathogen is Fusarium solani.

8. The sequence of claim 4 wherein said sequence further comprises regulatory sequences operatively linked to SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.

9. The sequence of claim 4 to 8 further comprising a suitably selected plant pathogen defense gene.

10. A transgenic cell comprising a polynucleotide sequence comprising SEQ. ID
No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.

11. The transgenic cell of claim 10 further comprising a suitably selected plant pathogen defense gene.

12. The transgenic cell of claim 10 or 11 further comprising sequences operatively linked to SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.

13. The transgenic cell of any one of claims 10 to 12 wherein said cell is a plant cell.

14. A method for expressing a nucleic acid sequence of interest in a plant cell, comprising providing:
a plant cell;
a nucleic acid sequence of interest; and a polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence.

15. The method of claim 14 wherein said nucleic acid sequence of interest is a suitably selected pathogen defense gene.

16. The method of claim 14 or 15 wherein said polynucleotide sequence is SEQ
ID No2 or its complement.

17. The method of any one of claims 14 to 16 wherein said plant cell is a potato plant cell.

18. The method of claim 17 further comprising regenerating said plant cell into a plant using PetM regeneration medium.

19. A transformed plant produced by transforming a plant cell with a nucleic acid sequence of interest and a polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence, and regenerating said plant.

20. The transformed plant of claim 19 wherein said plant is a potato plant.

21. The transformed plant of claim 19 or 20 wherein regenerating comprising culturing in PetM regeneration medium.

22. The transformed plant of any one of claims 19 to 21, wherein said nucleic acid sequence of interest is a pathogen defense gene.

23. A cell line derived from a plant that is the product of the process of transforming a plant cell with a nucleic acid sequence of interest and a polynucleotide sequence comprising SEQ. ID No 2, its complement, its homologues, complements of the homologues and variants having conserved deletions, replacements, and truncations, and homologues of said variants, that do no alter the function of said sequence, and regenerating said plant.

24. The cell line of claim 23 wherein said plant is a potato plant.

25. The cell line of claim 23 or 24 wherein said regenerating comprises culturing in PetM
regeneration medium.

26. The cell line of any one of claims 23 to 25 wherein said nucleic acid sequence of interest is a pathogen defense gene.

27. The sequence of claim 9, wherein said suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.

28. The transgenic cell line of claim 11, wherein said suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.

29. The method of claim 15 wherein said suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.

30. The transgenic plant of claim 22, wherein said suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.

31. The cell line of claim 26, wherein said suitably selected plant pathogen defense gene is selected from the group consisting of the antimicrobial peptide genes cecropin-mellitin, dermaseptin B gene and temporin A.