CA2462928A1 - Method for analysis of genomic methylation models - Google Patents

Abstract

The invention relates to a method for analysis of methylation models in genomic DNA. In contrast to conventional methods for the analysis of methylation models, said method comprises a two-part method, whereby the genomic DNA is firstly subjected to a methylation specific treatment followed by an isothermal replication step.

Description

' CA 02462928 2004-04-06 Method for analysis of genomic methylation models Field of the invention The invention relates to a method for the analysis of me-thylation patterns within genomic DNA. The invention dis-closes a method for the analysis of methylated cytosi-nes. This is of particular interest as aberrant cytosine methylation patterns within genomic DNA have been associ-ated with a variety of disease.
Drier Trt The most common covalent modification of genomic DNA is the methylation of cytosine to 5 methylcytosine. Cytosine methylation plays an important role in gene expression and regulation and has been shown to be critical in the maintenance of normal cellular functions. It is associ-ated with genomic imprinting, embryonic development and a wide variety of diseases, including cancer.
For example, aberrant DNA methylation within CpG islands is common in human malignancies leading to abrogation or overexpression of a broad spectrum of genes (Jones, P.A.
Cancer Res 65:2463-2467, 1996). Abnormal methylation has also been shown to occur in CpG rich regulatory elements in intronic and coding parts of genes for certain tumours (Chan, M.F., et al., Curr Top Microbiol Immunol 249:75-86,2000). Using restriction landmark genomic scanning, Costello and coworkers were able to show that methylation patterns are tumour-type specific (Costello, J. F., et al., Nat Genet 24:132-138, 2000). Highly characteristic DNA methylation patterns could also be shown for breast cancer cell lines (Huang, T. H.-M., et al., Hum Mol Genet 8:459-470, 1999). Genome wide assessment of methylation status represents a molecular fingerprint of cancer tis-sues.
The identification of 5-methylcytosine as a component of genetic information is therefore of considerable inter-est. However, 5-methylcytosine positions cannot be iden tified by sequencing since 5-methylcytosine has the same base pairing development as cytosine. Moreover, the epi genetic information carried by 5-methylcytosine is com pletely lost during PCR amplification.
Currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the reaction of bisulfate with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behaviour. However, 5-methylcytosine remains unmodified under these conditions.
Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behav-ior, can now be detected as the only remaining cytosine using "normal" molecular biological techniques, for exam-ple, by amplification and hybridization or sequencing.
Particularly favoured is the amplification of treated se-quence followed by analysis of the CG and TG dinucleo-tides within the amplificate.
To date, barring few exceptions (e. g., Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR
test for the diagnosis of Angelman and Prader-Willi syn-drome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr;5(2):94-8) the bisulfate technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfate treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov;l7(3):275-6) or individual cytosine posi-tions are detected by a primer extension reaction (Gon-zalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15;25(12):2529-31, WO Patent 9500669) or by enzymatic digestion (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15;25(12):2532-4). In addition, de-tection by hybridization has also been described (Olek et al., WO 99 28498).
Compared to sequencing, bisulfite analysis is a rela tively more precise method of quantifying the degree of methylation at a particular target. However, the tech nique is limited by the difficulty of carrying out the simultaneous analysis of multiple CpG targets within a target nucleic acid, for example by multiplex PCR.
Methods for the amplification of specific DNA targets are based upon template directed primer extension by poly-merases. The most widely utilised of these methods is the polymerase chain reaction 'PCR' (Mullis, K. et al., Cold Spring Harbor Symp. Quant. Biol. 51:263-273 (1986); Er-lich H. et al., EP 50,424; EP 84,796, EP 258,017, EP
237,362; Mullis, K., EP 201,184; Mullis K. et al., U.S.
Pat. No. 4,683,202; Erlich, H., U.S. Pat. No. 4,582,788;
Saiki, R. et al., U.S. Pat. No. 4,683,194 and Higuchi, R."PCR Technology," Ehrlich, H. (ed.), Stockton Press, NY, 1989, pp 61-68).
In the polymerase chain reaction successive cycles of de-naturation are followed by annealing and polymerisation.
In the first step the DNA double helix is denatured by transient heating. This is followed by the annealing of two species of primers, one to each strand of DNA. Subse-quently the annealed primers are extended using a poly-merase. This is followed by the denaturation of the re-sultant double stranded nucleic acids, allowing each strand to serve as a template for another cycle of tem-plate directed primer extension.
Although widely utilised and highly sensitive, one major drawback of the PCR is the difficulty of quantifiably si-multaneously amplifying multiple fragments using multiple primers (multiplex PCR). A number of factors contribute to the problem, principally:
1. The priming efficiency of each species of primer is likely to be different, in part this is due to sta-bility and structural differences between primers.
2. The denaturation rate of each primer target within the template nucleic acid may differ, therefore the rate of primer annealing will also differ between each site.
3. Due to the exponential nature of the PCR, any slight difference in yield between species of primers is amplified with each cycle.
An alternative to PCR is isothermal DNA replication, in particular rolling circle replication, based upon a natu rally occurring bacterial method of DNA replication.
In such a system, a circularised nucleic acid known as an amplification target circle (ATC) is isothermally repli-cated using rolling circle replication primers and a po-lymerase. There are no denaturation and annealing stages, hence DNA replication is both continuos and isothermal.

The resultant DNA comprises a catenated linear DNA of identical sequence to the ATC.
Several variants of the method have been described. U.S.

5 Pat. No. 5,871,921 (Landegren et al.) describes one method in which rolling circle amplification may be used for detection of genomic variants. In the assay, a de-tectable nucleic acid probe is hybridized to a single stranded nucleic acid target. The hybridization of the probe to the nucleic acid only occurs if the target se-quence is present. The hybridized probe ends are then co-valently connected to form a continuous loop of probe nu-cleic acid. This is followed by the removal of uncircu-larised probe molecules e.g. by exonuclease digest. The target molecule may then be detected by determination of the presence of the interlocking catenated probe.
An alternative method of using the rolling circle ampli-fication process is disclosed in U.S. Pat. No. 5,648,245, Fire et al. The reference describes a four-step process for generating a concatamer library. In the procedure, the first step is to generate an amplification target circle by annealing ends of a padlock probe to a target nucleic acid sequence followed by ligation of the ends of the padlock probe to form a continuous loop. Once the am-plification target circle is formed, the second step is to create a single stranded tandem-sequence DNA by roll-ing circle amplification of the amplification target cir-cle. The third step requires converting the single stranded tandem-sequence DNA to double stranded tandem-sequence DNA. Finally, the double stranded tandem-sequence DNA is cloned or used for in vitro selection.
U.S. Pat. No. 5,866,377 uses rolling circle amplification as a method to detect variants in a nucleic acid se-quence. In this method, a padlock probe hybridizes to a single stranded nucleic acid such that the ends are adja-cent to each other. A ligation step is then carried out such that, in the presence of a specific variant base at the locus near the end base of one of the probe ends a ligase is able to join the ends of the probe molecule to-gether to form a circularized molecule. Detection of the presence of the catenated probe on the target nucleic acid indicates the presence of the specific variant.
U.S. Pat. No. 5,854,033 (Lizardi) describes a similar assay where the catenated probe is used to produce tan-dem-sequence DNA by rolling circle amplification. The tandem sequence is detected to determine the amount of target sequence present.
An overview of the further known methods of detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, M. L., Zorbas, H., Nu-cleic Acids Res. 1998, 26, 2255.
Further publications dealing with the use of the bisul-fite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 Jun;l6(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Hor-sthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the ge-nomic sequencing method. Hum Mol Genet. 1997 Mar;6(3):387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes:
improved protocol for bisulphite genomic sequencing. Nu-cleic Acids Res. 1994 Feb 25;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic se-quencing indicates a correlation between DNA hypomethyla-tion in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19;157(1-2):261-4; WO 97 46705, WO 95 15373 and WO 45560.
An overview of the Prior Art in oligomer array manufac-turfing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.
Fluorophore labelled probe oligonucleotides are often used for the scanning of immobilized DNA arrays. The sim-ple attachment of Cy3 and Cy5 dyes to the 5'-OH of the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybrid-ized probes may be carried out, for example via a confo-cal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
In addition to the simple detection of fluorescent la-bels, two other detection methods are often used in nu-cleic acid analysis. interaction between two molecules wherein the excited state of one molecule (the donor) transfers energy to the other molecule (the acceptor).
The donor molecule is a fluorophore while the acceptor molecule may or may not be. The energy transfer occurs without the emission of photons, and is based on dipole-dipole interactions between the two molecules. Molecules that are commonly used in FRET include fluorescein, N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carb-oxy-X-rhodamine (ROX), 4-(4'-dimethylaminophenylazo) ben-zoic acid (DABCYL), and 5-(2'-aminoethyl)aminonaphtha-lene-1-sulfonic acid (EDANS).
A further detection method for the analysis of bio-molecules using fluorescent molecules is the use of fluo-rescence polarisation. Fluorescence polarisation relies on the property of plane polarised light to be emitted by a stationary fluorescent molecule. If plane polarised light is used to irradiate a fluorescent molecule, the molecule will emit plane polarised light between excita-tion and emission only when stationary. Larger molecules, i.e. those of larger molecular weight and/or volume tum-ble more slowly about their axes than smaller molecules.
The application of FP techniques to nucleic acid analysis is disclosed in patent application EP 0382433 B1.
Matrix Assisted Laser Desorption Ionization Mass Spec-trometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. La-ser desorption ionization of proteins with molecular mas-ses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15;60(20):2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short la-ser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accel-erated at different rates. Smaller ions reach the detec-tor sooner than bigger ones.
MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nu-cleic acids is somewhat more difficult (Gut I G, Beck S.
DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends.
1995, 1; 147-57). The sensitivity to nucleic acids is ap-proximately 100 times worse than to peptides and de-creases disproportionally with increasing fragment size.
For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is con-siderably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very effi-cient matrixes have been found which produce a very fine crystallization. There are now several responsive ma-y trixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a man-ner that it becomes more similar to a peptide. Phos-phorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a charge-neutral DNA using simple alky-lation chemistry (Gut IG, Beck S. A procedure for selec-tive DNA alkylation and detection by mass spectrometry.
Nucleic Acids Res. 1995 Apr 25;23(8):1367-73). The cou-pling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impuri ties which make the detection of unmodified substrates considerably more difficult.
Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard meth-odology is found in references such as Fritsch and Mani-atis eds., Molecular Cloning: A Laboratory Manual, 1989.
Description The invention discloses a method for the analysis of me-thylation of CpG dinucleotides within genomic DNA. It presents advantages over the prior art in that it allows a quantitative analysis of the degree of methylation at a specific CpG site, or multiple sites, within a DNA sam-ple. This is particularly significant wherein the methy-lation status analysis requires amplification of multiple ' ' CA 02462928 2004-04-06 DNA fragments within a sample, which may not be quanti-fiably amplified using multiplex PCR.
In general the method comprises the following steps.
5 Firstly genomic DNA is obtained from cellular or other sources. The DNA of interest (the target DNA) is then isolated from the genomic DNA. In the next step the iso-lated DNA may then undergo a methylation specific treat-ment resulting in the formation of single stranded DNA, 10 such as bisulfite treatment, or methylation sensitive re-striction enzyme digest (which may be combined with the previous step), followed by amplification of one of the two strands. This is followed by a circularisation step to form an amplification target circle which is then transcribed in a replication reaction using rolling cir-cle replication primers and a polymerase. The replicated nucleic acid takes the form of a linear nucleic acid com-prising catenated tandem copies of the amplification target circle sequence.
In the first step of the method genomic DNA is obtained from cellular, tissue or other sources using standard methods, as found in references such as Fritsch and Ma-niatis eds., Molecular Cloning: A Laboratory Manual, 1989. The extracted DNA may then be fragmented using means standard in the art, such as, but not limited to, restriction endonuclease digest.
The second step of the method is a methylation specific treatment of the genomic DNA fragment that results in the formation of single stranded nucleic acids. In one em-bodiment of the method the treatment may be carried out using methylation sensitive endonucleases. It will be ob-vious to one skilled in the art that a methylation sen-sitive endonuclease digest may be carried out in a manner capable of discriminating between methylated and unmethy-lated CpG dinucleotides, as illustrated by Costello, J.
F., et al., Nat Genet 24:132-138, 2000. The digest may be carried out such that CpG islands within the sequence are left intact, for example using a restriction enzyme spe-cific for the sequence TTAA. Alternatively, the digest may be carried out using restriction enzymes that digest within CpG islands, thus allowing methylation status analysis. In a further preferred embodiment this step may be combined with the previous step, wherein the DNA of interest is isolated by a methylation sensitive restric-tion enzyme digest.
Methylation sensitive digest is then followed by the am-plification of the strand of interest, for example using asymmetric PCR. The resultant single stranded fragments are then ligated into a circular conformation by means of a ligation oligonucleotide in the third step of the method.
In an alternative embodiment of the method, the second step may take the form of a chemical treatment. The ge-nomic DNA fragments may be treated such that cytosine bases within the DNA which are not methylated at the 5-position are converted to a base which has dissimilar base pairing properties. Nonetheless, cytosines which are methylated at the 5-position remain unchanged by the treatment. In a preferred embodiment the treatment is carried out using a bisulfite reagent (e. g. hydrogen sul-fite, disulfite). An addition takes place at the non-methylated cytosine bases. Furthermore, a denaturating reagent or solvent as well as a radical scavanger are re-quired to be present. A subsequent alkaline hydrolysis results in the conversion of non-methylated cytosine nu-cleobases to uracil. The chemically converted single stranded DNA may then be used for the detection of methy-lated cytosines.

As each CG dinucleotide may be converted into a TG dinu-cleotide or remain unconverted, dependant on its methyla-tion status, bisulfate treated CpG rich DNA has several unique characteristics. Firstly, the sense and antisense strands of the DNA are converted such that they are no longer complementary. In addition, bisulfate treatment of CpG rich DNA results in the creation of two species of strands, one relatively thiamidine rich and the other relatively cytosine rich. Furthermore, as each CG dinu-cleotide within the sense strand is hybridised to a CG
dinucleotide on the antisense strand of DNA, each CG po-sition may be analysed on both strands of the DNA.
In an alternative embodiment of the method, the treatment step of the method may comprise of a methylation sensi-tive restriction enzyme digest followed by a bisulphate treatment step.
In the third step of the method, the treated single stranded DNA is ligated into a circular conformation, by means of an oligonucleotide. Firstly the DNA is contacted with a specifically designed oligonucleotide, known as a ligation oligonucleotide, leading to the formation of a circular hybrid species of DNA which is subsequently ligated to form a covalently closed circular DNA.
The ligation oligonucleotide (illustrated in Figure 1) is linear single stranded DNA molecule with a 3' hydroxyl group and a 5' phosphate group, allowing the ends to be ligated using a DNA ligase. For the purposes of this in-vention the ligation oligonucleotide should comprise a 3' hydroxyl group a left target probe sequence, a spacer se-quence, a right target probe sequence and a 5' hydroxyl group. The spacer sequence should include a primer com-plement region for binding of rolling circle replication primers. The sequence of the spacer region should be such that it is not significantly complementary to any other sequence within the target DNA.
Hybridisation of the target probe regions to the single stranded target DNA molecule is carried out, whereby the left target probe region base pairs with the 5' end of the DNA fragment, and the right target probe region base pairs with the 3' end of the DNA fragment resulting in the formation of a circular hybrid nucleic acid.
In the fourth step of the method, the circularised nu-cleic acid is then contacted with a ligase under condi-tions conducive to ligation, such that the hybridised sections of the ligation oligonucleotide and the target nucleic acid are ligated to form a continuous circular nucleic acid (hereinafter referred to as an amplification target circle, or ATC), this is illustrated in Figure 2.
Circularised DNA fragments may then be isolated from lin-ear ligation products by any means standard in the art, for example, but not limited to, gel electrophoresis and exonuclease digest.
In the fifth step of the method the ATC is replicated using a rolling circle technique.
Firstly, a rolling circle replication primer is contacted with the ATC, under conditions conducive to the annealing of the primer to the ATC. The primer should consist of a sequence complementary to the primer complement region.
The sequence of the primer should be such that it is not significantly complementary to any other sequence within the circularised DNA. It is preferred that the primers used in the rolling circle replication contain an addi-tional sequence at the 5' end that is non complementary to any sequence within the circularised DNA. This se-quence facilitates the displacement of the replicated DNA
strand from the ATC.
Subsequent to the annealing of the primer to the ATC (il-lustrated in Figure 3) the ATC sequence is replicated into a continuous linear nucleic acid comprising tandem repeats of the ATC sequence (hereinafter referred to as tandem sequence DNA) . This is achieved by the addition of a DNA polymerase and nucleotides. DNA polymerase suit-able for use in the disclosed method are required to be capable of rolling circle replication of primed single stranded circular DNA. Such polymerases are hereinafter referred to as rolling circle polymerases. It is pre-ferred that the rolling circle polymerases do not have a 5' to 3' exonuclease activity, and that the polymerases are capable of displacement of the synthesised strand.
Examples of suitable polymerases include the Klenow fragment of DNA polymerase I, phage M2 DNA polymerase, T4 DNA polymerase and bacteriophage .0/.29 DNA poly-merase.
The nucleotides which are incorporated into the tandem sequence DNA may be labelled, allowing detection of the labels in the following step. Suitable labels are de-scribed below.
In further preferred embodiment of the invention strand displacement factors are added during the replication step of the method. Such factors include DNA helicases, such as calf thymus helicase or proteins such as single stranded DNA binding proteins and adenovirus DNA- binding protein.
In the final step of the method the tandem sequence DNA
is detected.

In one embodiment of the method, the nucleotides incorpo-rated during the ATC replication may be labelled with a detectable label allowing detection of nucleotides in-s corporated within tandem sequence DNA. A wide variety of molecules are suitable for use with this technique, for example, but not limited to, mass, fluorophore and radio-active labels.
10 In a further embodiment of the invention, detection may be carried out using labelled probe oligonucleotides. The probe oligonucleotides detect the presence of specific sequences within the tandem sequence DNA by hybridisation to the tandem sequence DNA. Such oligonucleotides are 15 hereinafter referred to as detection oligonucleotides.
The detectable labels may include, for example, but not limited to, mass, fluorescent (including FRET and fluo-rescence polarisation) and radioactive labels.
In a further embodiment of the method the rolling circle replication primers or oligonucleotide probes may be im-mobilised upon a solid phase surface with all subsequent steps of the method being carried out upon the solid phase surface. The solid phase surface is preferably com-posed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold. However, nitrocel-lulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are pos-sible as well.
Furthermore multiple primers may be immobilised upon the the solid phase surface in the form of an array allowing high throughput analysis of multiple DNA samples.
Therefore, a further subject matter of the present inven-tion is a method for manufacturing an array fixed to a carrier material for analysis of the methylation status of a genomic DNA, in which method at least one oligomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from US Patent 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of rolling circle replication primer oligonucleotides, oligonucleotides and/or PNA
oligomers as well as instructions for carrying out and evaluating the described method. However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
In a further embodiment of the method CpG methylation analysis may also be carried out using a specifically de-signed probe molecule.
Firstly, genomic DNA is obtained from cellular, tissue or other sources using standard methods, as found in refer-ences such as Fritsch and Maniatis eds., Molecular Clon-ing: A Laboratory Manual, 1989. The extracted DNA may then be fragmented using means standard in the art such as, but not limited to, restriction endonuclease digest.
In the first step of the method the DNA is treated such that cytosine bases within the DNA which are not methy-fated at the 5-position are converted to a base which has dissimilar base pairing properties. Nonetheless, cytosi-nes which are methylated at the 5-position remain un-changed by the treatment. In a preferred embodiment the treatment is carried out using a bisulfite reagent (e. g.
hydrogen sulfite, disulfite). An addition takes place at the non-methylated cytosine bases. Furthermore, a denatu-rating reagent or solvent as well as a radical scavanger are required to be present. A subsequent alkaline hy-drolysis results in the conversion of non-methylated cy-tosine nucleobases to uracil. The chemically converted single stranded DNA may then used for the detection of methylated cytosines.
In the second step of the method the target DNA is ana-lysed using a nucleic acid probe hereinafter referred to as an open circle probe (OCP). The OCP is hybridised to the target DNA, then ligated to form a covalent loop fol-lowed by rolling circle replication.
The probe is similar to the ligation oligonucleotide de-scribed earlier (illustrated in Figure 1), it is a linear single stranded DNA molecule with a 3' hydroxyl group and a 5' phosphate group, allowing the ends to be ligated using a DNA ligase . The use of OCPs have been described, for example in U.S. Patent 6,210,884. For the purposes of this invention the probe should comprise a 3' hydroxyl group a left target probe sequence, a spacer sequence, a right target probe sequence and a 5' hydroxyl group. The spacer sequence should include a primer complement region for binding of rolling circle replication primers. Fur-thermore, the spacer region may comprise detection tag portions and promoter portions. In a preferred embodiment the OCP does not contain any self complementary regions .
It is further preferred within OCPs containing a promoter portion that the OCP does not contain any sequences re-sembling a transcription terminator. The OCP may be immo-bilised on a solid surface with all further steps of the method carried out upon the surface, thus allowing for high throughput analysis of DNA samples.

Target probe sequences.
There are two target probe sequences, one at each end of the OCP. The target probe region at the 3' end of the probe is hereinafter referred to as the left target probe, whereas the target probe region at the 5' end of the probe is hereinafter referred to as the right target probe. Each target probe is complementary to a target se-quence within the treated genomic DNA. The target probe sequences are complementary to adjacent target regions of the treated genomic DNA. In a preferred embodiment each target probe may contain one or more CG dinucleo-tides.
Upon hybridisation of the target probes to the treated genomic DNA the 3' hydroxyl group of the left target probe is adjacent to 5' phosphate group of the right tar get probe, allowing the two ends to be joined together by a ligation reaction resulting in the circularisation of the linear OCP.
The hybridisation of the open circle probe to the target DNA may be such that a gap, of one or more bases, is pre-sent between the 5' and 3' ends of the open circle probe.
In such a case, the gap may be filled prior to, or during the ligation step. The gap may be filled by one or more oligonucleotides, or nucleotides, or a combination of both. These nucleotides and/or oligonucleotides may carry detectable labels, the use of which will be de scribed later.
The ligated OCP, hereinafter referred to as an amplifica-tion target circle (ATC) is then replicated using a roll-ing circle technique, as has been described previously, using rolling circle replication primers and polymerases.

Figures Figure 1 Figure 1 illustrates the basic structure of a ligation oligonucleotide or open circle probe, wherein A is the left target probe region, B is the right target probe re-gion and C is the spacer region which includes a primer complement sequence.
Figure 2 Figure 2 illustrates the hybridisation of a a ligation oligonucleotide to the target nucleic acid resulting in the formation of a circularised nucleic acid.
Figure 3 Figure 3 illustrates the annealing of a rolling circle replication primer to the amplification target circle.
'A' represents the left target probe region of the liga-tion oligonucleotide which is ligated to the 5' end of target DNA (E), 'B' represents the right target probe region of the ligation oligonucleotide which is ligated to the 5' end of target DNA (F). C is the rolling cir cle replication primer which is annealed to D, the spacer region of the ligation oligonucleotide.
Example:
Assay to detect the methylation status of the gene MDR 1 In the following example, rolling circle amplification was used to ascertain the methylation state of the CG di-nucleotides within the sequence CAGGAACAGCGCCGGGGCGTGGGC
(SEQ ID NO 1) within the gene 'multidrug resistance' Gen-bank Accession Number NM 000927 (MDR1). In the first ex-ample (Example 1) an assay was established to detect the ' CA 02462928 2004-04-06 presence of methylated versions of the gene in question, in the second example (Example 2) an assay was estab-lished to detect the presence of unmethylated versions of the gene. In the third example (Example 3) the two assays 5 were combined in order to determine the degree of methy-lation within a sample.
DNA was extracted from tissue samples using a Qiagen ex-traction kit according to manufacturer's instructions.
10 The DNA from each sample was treated using a bisulfite solution (hydrogen sulfite, disulfite) according to the agarose bead method (Olek et al 1996). The treatment is such that all non methylated cytosines within the sample are converted to thiamidine, conversely 5-methylated cy 15 tosines within the sample remain unmodified.
Example 1 Detection of methylation within the multidrug resistance 20 gene The following example describes the detection of the se quence CAGGAACAGCGCCGGGGCGTGGGC (SEQ ID NO 1)within the multidrug resistence (MDR1) gene in its CG-methylated state.
Hybridization and circularization of legation oligonu-cleotide (open circle probe) Following isolation and bisulphite treatment of the ge-nomic sequence according to the means described above, the sequence CAGGAACAGCGCCGGGGCGTGGGC (SEQ ID NO 1) was converted to TAGGAATAGCGTCGGGGCGTGGGT (SEQ ID NO 2).
The following reaction mixture was then combined in a PCR
tube:

' ' CA 02462928 2004-04-06 u1 of bisulfite treated target DNA within 50 mM Tris-HCl (pH 8.3) is added to 10 u1 of a ligation reaction mixture containing:
1.5 U of Ampligase thermostable DNA ligase (Epicentre 5 Technologies) 10 mM MgCl2 50 mM KC1 0.020 Triton-X-100 1 mM nicotinamide adenine dinucleotide (NAD) is added.
10 After addition of lul of a 2 pM solution of the ligation oligonucleotide (open circle probe) 5~-phosphoryl-ACGCTATTCCTATTAGAGACTAGTGTTCTACTAATGTGAATCGATGAGTTAATATTT
TACCCACGCCCCG-3~-OH (SEQ ID NO 3) the ligation mixture was incubated in an Eppendorff thermocycler at 95°C for 3min followed by 30 min at 65°C and finally at 4°C for up to 5 hours until further use.
Hybridization of primer and rolling circle amplification To the ligation mixture 5 u1 of a 0.6 uM solution of RCA
primer 5~- CATTAGTAGAACACTAGT -3~ (SEQ ID NO 4) was added. After incubating at 70°C for 5 min and cooling to room temparature 5 u1 of RCA reaction mixture containing 800 nM dNTP~s, 50 mM Tris-HCl, pH 8.3, 25 mM ammonium sulfate and 5 U Bst DNA Polymerase large fragment (New England Biolabs) was added and the RCA mixture was incu-bated at 65°C for 1 h and stored at 4°C for further use.
Detection of RCA product The RCA product is spotted onto polylysine glass slides (Fisher Scientific) . After drying and washing with water the slide is hybridised with the fluorescently labelled oligonucleotide probe Cy5- ACCCACGCCCCGACGCTATTCCTA (SEQ
ID NO 5). After washing off residual probe the slide is scanned in a fluorescence scanner (from the manufacturer Axxon). The presence of CG methylation in the target se-quence is reflected by the observation of an intense Cy5 fluorescence at the corresponding position.
Example 2 Detection of the sequence CAGGAACAGCGCCGGGGCGTGGGC (SEQ
ID NO 1) within the multidrug resistence (MDR-1) gene in its CG-nonmethylated state.
Hybridization and circularization of ligation oligonu-cleotide (open circle probe) Following isolation and bisulphite treatment of the ge-nomic sequence according to the means described above, the sequence CAGGAACAGCGCCGGGGCGTGGGC (SEQ ID NO 1)was converted to TAGGAATAGTGTTGGGGTGTGGGT (SEQ ID NO 6).
The following reaction mixture was then combined in a PCR
tube:
10 u1 of bisulfite treated target DNA within 50 mM Tris-HC1 (pH 8.3) is added to 10 u1 of a ligation reaction mixture containing:
1.5 U of Ampligase thermostable DNA ligase (Epicentre Technologies) 10 mM MgCl2 50 mM KC1 0.02°s Triton-X-100 1 mM nicotinamide adenine dinucleotide (NAD) is added.
After addition of 1 u1 of a 2 uM solution of the ligation oligonucleotide (open circle probe) 5'-phosphoryl-ACACTATTCCTATTAGAGACTAGTGTTCTACTAATGTGAATCGATGAGTTAATATTT
TACCCACACCCCA-3'-OH (SEQ ID NO 7)the ligation mixture is incubated in an Eppendorff thermocycler at 95°C for 3 min followed by 30 min at 65°C and finally at 4°C for up to 5 hours until further use.

Hybridization of primer and rolling circle amplification To the ligation mixture 5 u1 of a 0.6 uM solution of RCA
primer 5~-ACTAGTGTTCTACTAATG-3~ (SEQ ID NO 8)was added.
After incubating at 70°C for 5 min and cooling to room temparature 5 u1 of RCA reaction mixture containing 800 nM dNTP~s, 50 mM Tris-HC1, pH 8.3, 25 mM ammonium sulfate and 5 U Bst DNA Polymerase large fragment (New England Biolabs) was added and the RCA mixture was incubated at 65°C for 1 h and stored at 4°C far further use.
Detection of RCA product The RCA product is spotted onto polylysine glass slides (Fisher Scientific) . After drying and washing with water the slide is hybridised with the fluorescently labelled oligonucleotide probe Cy3- ACCCACACCCCAACACTATTCCTA (SEQ
ID NO 9). After washing off residual probe the slide is scanned in a fluorescence scanner (from the manufacturer Axxon). The presence of CG methylation in the target se-quence is reflected by the observation of an intense Cy3 fluorescence at the corresponding position.
Example 3 This example describes the detection of the relative level of CG methylation within the sequence CAGGAACAGCGCCGGGGCGTGGGC (SEQ ID NO 1) of the multidrug resistence (MDR-1) gene.
Hybridization and circularization of ligation oligonu-cleotide (open circle probe) ' ' CA 02462928 2004-04-06 Following isolation and bisulphate treatment of the ge-nomic DNA according to the means described above the fol-lowing reaction was carried out in a PCR tube:
u1 of bisulfate treated target DNA within 50 mM Tris 5 HC1 (pH 8.3) is added to 10 u1 of a ligation reaction mixture containing:
1.5 U of Ampligase thermostable DNA ligase (Epicentre Technologies) 10 mM MgCl2 10 50 mM KC1 0.02% Triton-X-100 1 mM nicotinamide adenine dinucleotide (NAD) is added.
After addition of lul of a 2 uM solution of the ligation oligonucleotide (open circle probe5'-phosphoryl-ACACTATTCCTATTAGAGACTAGTGTTCTACTAATGTGAATCGATGAGTTAATATTT
TACCCACACCCCA -3~-OH (SEQ ID NO 7)and 5~-phosphoryl-ACGCTATTCCTATTAGAGACTAGTGTTCTACTAATGTGAATCGATGAGTTAATATTT
TACCCACGCCCCG-3~-OH (SEQ ID NO 3) the ligation mixture is incubated in an Eppendorff thermocycler at 95°C for 3 min followed by 30 min at 65°C and finally at 4°C for up to 5 hours until further use.
Hybridization of primer and rolling circle amplification To the ligation mixture 5 u1 of a 0.6 uM solution of RCA
primer 5~-ACTAGTGTTCTACTAATG-3~ (SEQ ID NO 8)was added.
After incubating at 70°C for 5 min and cooling to room temparature 5 u1 of RCA reaction mixture containing 800 nM dNTP~s, 50 mM Tris-HC1, pH 8.3, 25 mM ammonium sulfate and 5 U Bst DNA Polymerase large fragment (New England Biolabs) was added and the RCA mixture was incubated at 65°C for 1 h and stored at 4°C for further use.

Detection of RCA product The RCA product is spotted onto polylysine glass slides (Fisher Scientific) . After drying and washing with water 5 the slide is hybridised with an equimolar mixture of the fluorescently labelled oligonucleotide probes Cy5-ACCCACGCCCCGACGCTATTCCTA (SEQ ID NO 5) and Cy3-ACCCACACCCCAACACTATTCCTA (SEQ ID NO 9). After washing off residual probe the slide is scanned in a fluorescence 10 scanner (e.g. from Axxon). The level of CG methylation in the target sequence is reflected by the ratio of the Cy5/Cy3 fluorescence intensities at the corresponding po-sition.

I
Sequence Listings <110> Epigenomics AG
<120> Method for Analysis of Genomic Methylation Models <160> 9 <210> 1 <211> 24 <212> DNA
<213> Homo Sapiens <400> 1 caggaacagc gccggggcgt gggc 24 <210> 2 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> chemically treated genomic DNA (Homo Sapiens) <400> 2 taggaatagc gtcggggcgt gggt 24 <210> 3 <211> 70 <212> DNA
<213> Artificial Sequence <220>
<223> chemically treated genomic DNA (Homo Sapiens) <400> 3 acgctattcc tattagagac tagtgttcta ctaatgtgaa tcgatgagtt aatattttac 60 ccacgccccg 70 <210> 4 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> chemically treated genomic DNA (Homo Sapiens) <900> 4 cattagtaga acactagt 10 <z1o> s <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> chemically treated genomic DNA (Homo Sapiens) Z
<400> 5 acccacgccc cgacgctatt ccta 24 <210> 6 <211> 24 <212> DNA

<213> ArtificialSequence <220>

<223> chemicallytreated genomicDNA (HomoSapiens) <400> 6 taggaatagt 24 gttggggtgt gggt <210> 7 <211> 70 <212> DNA

<213> ArtificialSequence <220>

<223> chemicallytreated genomicDNA (HomoSapiens) <400> 7 acactattcc ctaatgtgaa 60 tattagagac tcgatgagtt tagtgttcta aatattttac ccacacccca 70 <210> 8 <211> 18 <212> DNA

<213> ArtificialSequence <220>

<223> chemicallytreated genomicDNA (HomoSapiens) <400> 8 actagtgttc 18 tactaatg <210> 9 <211> 24 <212> DNA

<213> ArtificialSequence <220>

<223> chemicallytreated genomicDNA (Homosapiens) <400> 9 acccacaccc caacactatt ccta 24

Claims (10)

Claims

1. A method for the analysis of cytosine methylation within a genomic sample comprising the following steps:
a) isolating a target DNA from a genomic DNA sam-ple b) treating the DNA in a manner capable of distin-guishing methylated from unmethylated cytosine bases c) contacting the target DNA sequence with a liga-tion oligonucleotide under conditions conducive to the formation of circularised target DNA-ligation oligonucleotide nucleic acid hybrids d) contacting the circularised target DNA-ligation oligonucleotide nucleic acid with a ligase under conditions conducive to the formation of a continu-ous circular ligated nucleic acid (hereinafter re-ferred to as an ATC) e) contacting the ATC with a primer oligonucleo-tide under conditions conducive to hybridisation f) adding polymerase to the template DNA under conditions that promote the replication of the tem-plate DNA, wherein replication of the template DNA
results in the formation of a linear nucleic acid comprising tandem repeats of the template DNA se-quence g) detection of the tandem sequence DNA

2. A method according to Claim 1, characterised in that the ligation oligonucleotide comprises a single stranded linear nucleic acid comprising from 5' to 3', a 5' phosphate group, a right target probe, a spacer region, a left target probe and a 3' hydroxyl group.

3. A method according to Claims 1 and 2, characterised in that the sequence of the target probe regions of the ligation oligonucleotide comprise at least one CG
dinucleotide.

4. A method according to Claims 1 through 3, wherein the ligation oligonucleotide hybridises to the single stranded treated DNA only if the specific CpG dinu-cleotides under analysis were in a specific methyla-tion status within the genomic DNA.

5. A method according to Claims 1 through 4, wherein Step A comprises restriction endonuclease digest by at least one restriction enzyme.

6. A method according to Claims 1 through 4, character-ized in that step b) comprises a methylation sensi-tive restriction enzyme digest followed by the ampli-fication of 1 strand of the target DNA.

7. A method according to Claims 1 and 4, characterised in that step b) comprises a treatment such that me-thylated cytosine bases within the sample are con-verted into a base which has dissimilar base pairing properties.

8. A method according to Claims 1 and 4, characterised in that step b) comprises a methylation sensitive re-striction enzyme digest followed by a treatment such that methylated cytosine bases within the sample are converted into a base which has dissimilar base pair-ing properties.

9. A method according to Claims 7 and 8, wherein the treatment is carried out by means of a bisulfate so-lution. ~

10. A method for ascertaining genetic and/or epigenetic parameters within a genomic DNA sequence by analyzing cytosine methylations characterized in that the following steps are carried out:
a) treating the DNA in a manner capable of distin-guishing methylated from unmethylated cytosine bases such that the resultant target DNA is single stranded;
b) the pretreated single stranded DNA is contacted with at least I open circle probe under conditions conducive to hybridisation;
c) open circle probes hybridised to the target DNA
are ligated to form amplification target cir-cles(ATC);
d) a primer oligonucleotide is contacted with the amplification target circle under conditions that promote primer oligonucleotide ATC hybridisation;
e) polymerase is added to the primer oligonucleo-tide ATC mixture under conditions that promote the replication of the ATC, wherein replication of the ATC results in the formation of tandem sequence DNA
f) detection of the tandem sequence DNA.

11. A method according to Claim 10, characterized in that step a) comprises a methylation sensitive restriction enzyme digest followed by the amplification of 1 strand of the target DNA.

12. A method according to Claim 10, characterised in that step a) comprises a treatment such that methylated cytosine bases within the sample are converted into a base which has dissimilar base pairing properties.

13. A method according to Claim 10, characterised in that step a) comprises a methylation sensitive restriction enzyme digest followed by a treatment such that me-thylated cytosine bases within the sample are con-verted into a base which has dissimilar base pairing properties.

14. A method according to Claims 12 and 13, wherein the treatment is carried out by means of a bisulfate so-lution.

15. A method according to claims 10 through 14, charac-terised in that the open circle probe comprises one or more CG dinucleotides.

16. A method according to claims 10 through l5,wherein upon hybridisation of the open circle probe to the pre treated genomic DNA a gap of one or more bases exists between the 5' and 3' ends of the open circle probe, said gap filled in by means of one or more species of oligonucleotides or nucleotides or a com-bination thereof.

17. A method according to claim 16, characterised in that the gap filling oligonucleotides and /or nucleotides carry a detectable label.

18. A method according to claims 1 through 9, wherein the ligation oligonucleotide is immobilised upon a solid phase.

19. A method according to claim 18, wherein multiple ligation oligonucleotides are immobilised upon a solid phase.

20. A method according to claims 10 through 17, wherein the open circle probe is immobilised upon a solid phase.

21. A method according to claim 20, wherein multiple open circle probes are immobilised upon a solid phase.

22. A method according to claims 18 through 21, wherein one or more nucleic acids are immobilised upon a solid phase in the form of an array.

23. A method according to claim 22, characterized in that the immobilised nucleic acids are arranged on a plane solid phase in the form of a rectangular or hexagonal lattice.

24. A method according to claims 18 through 23, charac-terized in that the solid phase is composed of sili-con, glass, polystyrene, aluminium, steel, iron, cop-per, nickel, silver, or gold.

25. A method as recited in one of claims 1 and 10, wherein at least one species of labelled nucleotides is incorporated into the tandem sequence DNA.

26. A method as recited in one of claims 1 and 10, wherein the detection step comprises the hybridisa-tion of a labelled detection oligonucleotide or pep-tide nucleic acid (PNA)-oligomer.

27. The method as recited in claim 26, characterized in that the labels are detachable molecule fragments having a typical mass which are detected in a mass spectrometer.

28. The method as recited in Claim 27, characterized in that the labels are detected in a mass spectrometer.

29. The method as recited in one of Claims 26 and 27, characterized in that the produced fragments have a single positive or negative net charge.

30. The method as recited in one of claims 27 through 29, characterized in that the detection is carried out and visualized by means of matrix assisted laser de-sorption/ionization mass spectrometry (MALDI) or us-ing electron spray mass spectrometry (ESI).

31. A method according to claim 26, characterized in that the detectable labels are radionuclides.

32. A method according to claim 26, characterized in that the labels are fluorophore molecules.

33. A method according to claim 32, characterized in that more than one species of fluorophore labels are used.

34. A method according to claim 33, wherein two types of labels are used, one type being a donor fluorophore and the other type being an acceptor fluorophore, and wherein the fluorescence resonance energy transfer (FRET) between the two types of molecules is moni-tored.

35. A method according to one of claims 32 and 33, char-acterized in that the fluorescence polarisation of the labels) is/are measured.

36. A kit comprising a bisulfite (= disulfite, hydrogen sulfite) reagent, rolling circle replication primers, polymerases, as well as ligation oligonucleotides ac-cording to claim 1 or open circle probes according to

claim 10.