CA2460437A1 - Crh and pomc effects on animal growth - Google Patents

Abstract

The present invention provides for selection of bovine animals that will display phenotypes associated with increased rates of growth. These phenotypes include hot carcass weight, average daily lain, shipping weight, end of test rib eye area, and adjusted weaning weight which is a measure of post-natal growth, based on the knowledge of their CRH, POMC and MC4R genotypes. The predictive value comes from the discovery that certain single nucleotide polymorphisms (SNPs) in these genes are linked to higher growth rate phenotypes. Specifically, the phenotypes that correlated with specific SNP's are end-of-test rib-eye area, adjusted weaning weight, average daily gain, shipping weight and hot carcass weight. The invention also provides novel kits that can be used in making the determination of these genotypes. The invention further provides for methods of screening bovines to predict which animals will have higher growth rate, allowing producers to selectively breed and manage animals based on desired characteristics, thereby maximizing productivity and profitability in commercial meat production operations.

Description

CRH AND PUMC EFFECTS 4N A14TIMAL ~RUWTH:
The present invention relates generally to methods of selective breeding and management of livestock animals based on particular allelic polymorp~usms, and particularly to predicting the growth characteristics of livestock animals based on these allelic polymorphisms.
~a~,C»~:»o~l~x~ o~ ~'x~~rrTrc~N:
Increased growth rates are typically associated with higher economic returns to beef producers. Consequently, methods to improve growth rate in cattle are of significant benefit to producers. Prior art methods of increasing growth k~as included such approaches as the use of hormone implants {l3agley et al., 19$9}, sub-therapeutic levels of antibiotics (~chumann et al., 1990) and by selective breeding based on expected progeny differences {EPD} (Kress ~et al., 1977). However, hormone implants and the use of antibiotiics arc becoming unpopular and may be banned in North America in the near fixture. Therefore, alternative methods of improving growth rates ofcattle that don't require artificial forms ofstimuiation will become increasingly important and desirable in the industry.
2o Corticotropin releasing hormoxxe (CRH} indirectly causes the re~lea5e of glucøcørticoids (Duz~n and Bertadge, 1990}, naturally occurring hormones that arC. suggested to be growth inhibitors (Sharpe et al., 1.986). Although commonly referred to as a "stress-related hormone", CItH is released from the hypothalamus, an area of the brain known to be involved in appetite control.
T'he release ofCI~H regulates appetite via two distinct mechanisms; (1) indirectly triggering the xelease o~pro-opiomalanucortin {POMC), and (2) by increavsing the production of leptin {Fig. 1 ) Tlzc up-regulation of P~MC levels leads to increased synthesis of alpha melanocyte 3~ stimtdating hormone (aMSH) which, when bound to the melanocartin-4 receptor, reduces appetite {Marsh et al., 1999). The increase of leptin, which is induced by glucocorticoids,

2 reduces appetite by four other interactions (Fig. 1). Primarily l:eptin acts to decrease the levels ofneuropeptide ~', an appetite stimulant. Leptin also eats to increase POMC
levels, an agoz~ist for the melanocortin 4-receptor (lVtC4Tt); decrease the levels of antagonist agouti related protein (AGRP); and increase the production of CRH (lElouseknecht et al., 199$;
Marsh et al., 1999; Pritclzard et al., 2002).
The CIZEi gene conapxises two exons, laowevez~ only exan 2 is translated and codes for ti~.e pre-pro-protein (l~.oclze et al., 19$$; Shibihara et al., 19$$). The C~RH gene has been mapped to chromosome 14 ()$arezzdse et al., 199T), anal th.e results of quantitative trait linkage (t7TL) 14 zzzappin,g suggested an association between a Locus fax post-natal growth identified on chromosome 14 and the CRH gene (Buchanan et al., 2000). In. addition, vc~e previously reported a non-conserved amino acid substitution at position T7 (CRH7~ in the pro-peptide reg'zon of CRH and showed an association with post-natal grourth in beef cattle (Buchanan et al., 2002b).
The PON.1C pro-lzoznxaazie peptide is an integral component ofth a appetite regulation pathway (Fig. 1) azzd.f~as also been identified by QTL analysis in our unpublished studies as a positional candidate gene for average daily gain and carcass wright. We idcrztified a single nucleotide polymorphism (SNP) in the P(7MC gene that is translationally silent and used the zo SNP to map the POltIC gene to chromosome 11 in beef cattle (Thus et al., 2003), oonfimling its position to previously identi#ied c~TL Foci. We also idezztified SNPs in two other genes integral to this pathway, leptin and Mt.'41t (Buchanan et al., 2002a; Thue et al., 2001).
We have recently identified a novel SNk' iz~ the Cue' gene, at pasition ~ of the signal zs sequence, equivalent to position 22 of the sequence defined in SJE~ ~ N(7:
1. 'together with the existing gene tests for 1'OM~'. N1C'41t and .i;.~'P' (l3uc)x<zzaazx et al., 2002a;
Buehanarz ct al., 2002b;Thue et al., 2UU1; Thue et al., 20173) we. genotyped a group of 256 steers. Our results show that knowledge of;~enotxpes of cattle, with respect to these particular genes, can be used to better predict growth and yield during beef production.

3 SUMMARY OF THE INVENTION:
It is well known to those skilled in the art that single nucleotide polymorphisms (SI~Ps~
can provide a useful way in which to distinguish different alleles of a gene.
Furthermore, when the presence of a SNP can bc; associated with a spc;cific phenotype, the SNP
operates as a powerful marker and can be used to predict phe~.notypfo outcomes based on at7 an1711a1'S genotypic makeup. The present invention relate, to methods of managing livestock animals, such as cattle and pigs, and taking advani;agc of genetic factors that affect an anilna,l's appetite. »y identifying animals with a particular genotype, with respect to herein described SNP alleles, it is possible; to identify animals that will display phenotypes associated with increased growth rate, as compared to animals lacking the de;sircd genotype.
In particular, the present invention relates to methods for establishing the genetically 15 deteroxAizled predispvSitions of individual livestock animals, su~;h as cattle and pigs, within a group of such animals, to meet particular desired characteristics with respect to growth, based on the association of specific CRH, POMC or MC4F~', alleles with an increased appetite and hence growth phenotype.
2o The present invention pz~avides a method for analyzizlg the genotype Qf animals with respect to the Cl2Xf, ~C~MC and MC4R genes, anal using the genotype infornlatian to select animals with desired traits related to animal grorwth. Such knorwledge further permits producers to charge a premium for the more desirable faster-growing phenotype, and permits breeders to selecti~rely breed animals for genot~rpes that will result in the 25 most desirable phenotypes.
It is therefore an abject of the present invention to provide a method far selecting for animals homozygous for the "G" allele at the CRH gene locus, in the knowledge tklat animals that are "GG" hornozygotes will display the desired phenotypes of increased hot 3o carcass weight, increased end of test rib eye area, and increased adjusted weaning weigklt.

4 It is a further object of the present invention to provide a, method for selecting for animals homozygous for the "T" allele at the POMC gene locus, in the knowledge that animals that arc "TT" hamozygotes will display the desired phenotype , of increased average daily gain, shipping weight and hat carcass weight.
It is still another ob3ect of the present invention to provide a method for selecting for animals having at least one "C" allele at the MC4R gene locus, in the knowledge that animals that arc "CG" or "CC" at the MC4~ gene lacus~ will display the desired phenotype ofincrcasc hot carcass wezgl~t.
~o It is a further object of the present invention td select for ari.imals homoLygous for the "G" allele at Clt~' said the '"T" allele at POMC loci, in the knowledge that those animals that are "GC-TT" hom~ozygotes will display concurrent increases in rib-eye area, shipping weight, hot carcass weight and average daily gain.
It is a fiuthcr object of the present invention that where the desired phenotype is only incroased hot carcass weight, that a more efficient method of testing animals is provided, wherein an animal as first tested to determine it's MC4R genotype in the knowledge that an animal with at least on "C" allele at MC4R will display the desired phenotype of 2o increased carcass weight, regardless of the animal's CRH genotype, such that only those az~izz~.al.s thst are "GG" at MC4R will need to be tested with resheet to their Cltirf genotype in order to determine whether they will display the desired phenotype of increased hot carcass weights.
It is a further object of the present invention to gxovide a diagnostic kit to be used in the detemtination of an animal's C1ZH, POMC and MC4R genotype.
These and other objects, features, and advantages of the invention become further apparent in the following detailed description of the invention when taken in conjunction 3o with the accompaz~yix~g drawings which illustrate, by way of example, the principics of this invention.

5 Thus, the inventian provides a genetic testing rnethad for the deterr»inatian of an axximal's C'.?2,~', .F~'O,MCC axxd .MC"4R genotype ba.,ged on analysis s~f tire presence or absezzce of S~eci~c SN)''s, and tote use of the knowledge of an animal's genotype such.
that S animals of like genotype can be ideaztifZed azzd selected according to ~ze desired pb~enotypes of increased shippixag wei.gtxt, .hat oarcass weight, average daily gaixz aa~.d xib~
eye area.
C

L1ESCRIPTIUN (?F THE FIGUh'ES:
While the invention is claimed in the concluding porCions hereof, preferred embodiments are provided in the accompanying detailed description which. may be best understood iz~
canjunctian with the accompanying diagrama where like parts in each of tlae several diagrams are labeled with lilce numbers, and whers:
Fig. T : Appetite pathway. Arr-aws show the effect of leptins and CRH on neuropeptides t o that control appetite. Ovals represent neurons in the hypothalamus. CRH -carticotrophin.-releasing hormone, AGRP -~ agouti related protein, POIvIC - pro-opiarnelanocortin, NPY -neuropcptidc Y, aMSH - alpha melanoeyte stimulating hormone and MG4R -melanocortin 4 zeceptar.
I S Fig. 2: Sequerlee of the CRH SNP with respect to the nucleotide and protein coding sequences. The SNP of the invention occurs at position 22 of the nucleotide sequence as dcfuicd by SEQ ID NO: l, which corresponds to codon 4 of the protein coding sequence.
20 ~'ig. 3: xhe effect of C,W' genotype an CR~I secretion.
>dETAILE~ DESCRiI'TIQN QF' TH>T iN~IV'fTfJl'~:
xlC~rlAtiOns:
Tn the description that follows, a number of terms used in reGarnbinant 1~NA, technolo~r are ex;ensively utilized. In order to provide a clear and consistent understanding of the 3o specification and claims, including the scope to ~e given such terms, the following dchnitians arc provided:

$y "amplifying a segment" as used herein, is meant the prAductian of sufficient multiple copies of the segment to pexmit relatively facile manipulation ~of the segment.
Manipulation refers to both physical and chemical manipulation, that f s, the ability to rnave bulk quantities of the segment around and to conduct chemical reactions rovith the segment that result in detectable products.
A "segment" of a polynuclcatidc refers to an oligonuclcotidc that is a partial se~qucncc of entire nucleotide sequence of the polynucleotide.
fo A "modified segment" refers to a se~rcnt in which one or more natural nucleotides have been replaced with one ar more modified nucleotides. A. "modified., labeled segment"
refers to a modified segment that also contains a nucleotide, wJfucb is dafFerex~t fro~oo. the modified z~ucleatide or nucleotides therein, and which is detectabiy iabeled.
,fin "amplification primer" is an oligonucleotide that is capable of annealing adjacent to a target sequence arid serving as an initiation paint far DNA synthesis when placed under conditions in which synthesis of a primer extension product wluch is complementary to a nucleic acid strand is initiated.
By "analysis" is meant either detection of variations in the nucleotide sequence among tyro or morn related polynucleotides or, in the alternative, determining the full nu.cleotidc sequence of a polynuclcotidc. By "analyzing" the hybridized fragments for an incorporated detectable label identifying the suspected polymorphism is meant that, at some stage of the sequence ofevcnts that Leads to hybridized fragments, a label is incorporated. The label maybe incorporated at virtually any stage of the sequanca of events including tlae amplification, cleavage or hybridization pnocedares. The label may further be introduced into the sequence of events after cleavage and before or after hybridization. The label so incorporated is then observed visually or by instrumental means. The presence of the label iderttifZes the polymorphisnZ due to the fact that tlae fragments obtained during cleavage are specific to the modified nucleotides) used in the amplification and at least one of the modified nucleotide is selected so as to replace a nucleotide involved in the polymorphism.
~'he term ''animal" is ufiod herein to include all vertebrate animals, including humans. It also ~ncludeS axi individual animal in all stages of develaprnent, including embryonic and fetal stages. As u;;od herein, the term "production animals" is used interchangeably with "livestock animals" and refers generally to animats raised primarily for food.
For a 0 example, such animals include, but are not limited to, cattle ('bovine), sheep (ovine), pigs (porcine or swine), poultry (avian), and the like As used herein, the term "cow" or "cattle" is used generally to refer to an animal of bovine origi..n of any age.
Interchangeable terms include "bovizxe", "calf", "steer", "bull", "heifer" and the like. As used herein, the terxxx "'pig" or iS used generally to refer to an animal of porcine origin of any age. Interchangeable terms include 'piglet", "sow" and the like.
~'he term "antisense" is intended to refer to polynucleotide molecules complementary to a pc~rtian of an RNA marker of a gene, as defined herein. "Complementary"
polynucleatides are those that are capable ofbase pairing according to the standard 2o Watson-Crielc complementarity rules, whexe purines base paiu~ with pyritmidines to form combinations of guanine paired with cytosine (C~:~) and adenine paired with eitkaer thyn2inc (A:T) in the case of DNA, yr adenine paired with uracil (A:TTj in the case of RNA. Inclusion of less comnuon bases tine iraosixie, S-naethylcytosiuoe, G-z~ntethyladez~e, hypoxanthine and others in hybridizing sequences does not interFere with pairing.
2s $y the form "complementarily" or "complementary" is meant, for the purposes of the specifZCatioz~ or claims, a sufFcient number in the oligonucleoti.de of complementary base pairs in its sequence to interact specifically (hybridize) with the target nucleic acid sequence of the gene polymorphism to be amplified. or detected. As known to those skilled in the art, a very high degree of complementarii:y is needed for speci~eity and sensitivity involving hybridi~..ation, although it need not be 1 D~J%. Thus, far example, an oligonucleotide that is identical in nucleotide sequence to an oligonucleotide disclosed herein, except for one brio change or substitution, may function equivalently to the disclosed oligonuclcotidcs. A "complementary DNA," or "cDNA" gene includes recombinant genes synthesized by reverse transcription of me.~sezxger J~1~TA
("zn,l~NA"}.
By the term "wmposition" is meant, for the purposes of the specifcation or claims, a combination of elements which may include one or more of the following; the reaction t o buffer far the respective method of enzymatic amplification, plus oae ox rx~ore oligonucleatides specific for CRH, !'dMC' or MC'9,tf gene polymoxphiszxas, whereixx said oligonucleotide is labeled with a detectable moiety.
A "cyclic polymexase-mediated reaction" refers to a bioehcnaical reaction in ~uvhich a t 5 tez~rzplate z;nolecule or a population of template molecules is periodically and repeatedly copied to create a complementary template molecule or complementary template . molecules, thereby increasing the number of the template molecules over time. The products of such a reaction are eomxx~on~.ly refezxed to as amplification product..s.
20 "I7cnaturation" of a template molecule refers to the unfolding or other alteratirn~ of the structure of a template so as to znalce the template accessible far duplication or hybridization. In the case of DbTA, "denaturatian" refers to the separation of the two complementary strands of the double helix, thereby creating twm complementary, single stranded template molecules. "l7enaturatiøn" can be accomplish~l in any of a variety of 2s ways wch known to those skilled in the ark, iz~GludiRlg heat or by treatment of the ):?NA
with a bast or other chemical denaturant.
A "detectable amount ofpraduet" refers to an amount of amplified nucleic acid that can be detected using standard laboratozy tools. A "detectable marker" refers to a nucleotide ,.~. m ........ _ .. ~. .~.,,, . .~.m..~- _._.... . a;..~".~.~,g ~~,_.r..
...~~._. _..._....~....~,""..a...,~x.~,m..,.___ .._ .. ._w..~ ~.........

analog that allows detection using visual or other means. For example, fluorescently labeled nucleotides can be incorporated into a nucleic acid dux*ang one or more steps of a cyclic polymcrase-mediated reaction, thereby allowing the detection of the product of the reaction using, ~.g. fluorescence microscopy or other fluorescf:nce-detection instrumentation.
By the term "detectable moiety" is meant, far the purposes of the specification or claims, a Iabet molec~de (isotopic or non-isotopic) which is incorporated indirectly or directly into an otigonucleotide, wherein the label mdlecuIe facilitates the detection.
of the i 0 alignnncleotide in which it is incorporated when the oligonueleotide is hybridized to amplified gone polymorphism sequences. Thus, "detectable moietyr' is used synonymously with "label molecule". Synthesis of oligonucleotides can be accomplished by any one of several methods known to those skilled in tk~e art. lrabel molecules, lalown to those skilled in. the az~t as beiaag useful for detection, inolude chemiluminescent ar fluorescent molecules. Various fluorescent molecules are known in the art that are suitable for use to Iabel a nucleic acid substrate for the method of the present invention.
The protocol for such incorporation may vary depending upon the fluorescent molecule ustxl. Such protocols are lzoown in the art for the respective fluorescent indlecule.
zo By "dctcctably labeled." is meant that a fragment or an oligonucleotide contains a nucleotide that is radioactive, that is substituted with a fluorophore or some other molecular species Friat elicits a physical yr cl~eznical response can be observed by the naked eye or by means of instrumentation such as, without limitation, sci~xtallation counters, colorimeters, LTV spectrophotozr~eters aa~d the like. As used herein, a "label" or 2s "tag" refers to a molecule that, when appended by, for example, without limitation, covalent bonding or hybridization, to another molecule, for example, also without limitation, a ~polynuclcotide or polynucleotide fragment, provides ar enhances a means of detecting the other molecule. A fluorescence or fluorescent label or tag emits detectable light at a particular wavelength when excited at a different wavelength. t1 radiolabel or 30 radioactive tag emits radioactive particles detectable with an instrument such as, rxrithout limitation, a scintillation counter. Other signal generation detection methods include:
chemalurrxinescence, electracherniluminesccnce, ramanspectroscopy, colorimetric, hybridization protection assay, and Mass spectrometry.
S "DNA amplification" as used herein refers to any process that increases the number of copies of a specific DNA sequence by enzymatically amplifyin,~ the nucleic acid setluence. A variety of processes are known. l7ne of the mast commonly used is the polymerasc chain reaction {PCR) process of Mullis as described in U.S. Pat.
Nos.
A~,683,195 arid 4,683,202. PCR involves the use of a therxnostable DNA
polymerase, io known sequences as prizx~,ers, and heating cycles, which separate the replicating deoxyribonucleic acid (1:7NA), strand..s and exponentially amplify a gene of interest. Any type of ~'CR, such as quantiiatir~e PCR, RT-PCR, hot start PCR, LA-PCR, multiplex PCR, taucla.dawn PCR, etc., may be used. Pn;fcrably, real-time FCR is used. Zn general, th.e PCR amplification process involves an enzymatic chaizz reacction for preparing 15 exponential duantitics of a specific nucleic acid sequence. It requires a small amount of a secluenec to initiate the chain reaction and aligonucleotide prianers that will hybridize to the sequence. In PCR the primers are annealed to denatured nucleic acid followed by extension with an. inducing agent {enzyme) and nucleotides. This results in nevviy ~ ~ r synthesized extension products. Since these newly synthesized products become ZO templates for the primers, repeated cycles of denaturing, primer annealing, az~d extension results in exponential accumulation of the specific sequence being axnpli~ed.
Tl~o extension product of the chain reaction will be a discrete nucleic acid duplex with a termini corresponding to the ends of the speeif'nc primers employed, 25 "DNA" refers to the polymeric form of dcoxyribonucleotides (adenine, guanine, thymine, or cytosine) in it's either single stranded form, or a double-stranded helix.
This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary foz~n5. Thus, this term includes double-stranded DNA
found in linear and circular DNA molecules including, but not limited ta, restriction Fragments, 34 viruses,, plasrnids, cosmids, and artificial and naturally occurring chromosomes. In discussing the structure ofparticular double-stranded DNA rnr~Iecules, sequences may be described herein accoxding to the normal convention ofgiving only the sequence in the 5' to 3' direction along the non-transcribed strand of Z7NA (i.e., the stxaud having a sequence homologous to the mRNA).
13y the tenns "enzymatieally amplify" or "amplify" is meant, j~or the purposes of the specification or claims, DNA amplification by any process by which nucleic acid sequences are anz~lified in number. There are several means i:or enzymatically amplifying nucleic acid sequences known in the art. Currently the most commonly used ~o method is the polymcrase chain ruction (PCR). Other azx~plifzcation methods include LCR (Iigase chain reaction) which utilizes DNA ligase, and a pxobe consisting oftwo halves of a DNA segment that is complementary to the sequence c~f the DNA to be amplified, enzyme ~J3 repiicase and a ribonucleic acid (RNA) sequence template attached to a probe complementary to the DNA to be copied rvhieh is used to make a DNA
15 template .for exponential production of complementary RNA; strand displacement amplification (SDA); Q13 replicase amplification (Q13RA); self~sustain~d replication (3SR); and NASBA (nucleic acid sequence-based amplification), which caz~ be performed ran RNA or DNA, a th.e nucleic acid sequence to be amplified. The particular"
methodology used to amplify hNA sequences is not intended to be limiting, and all such 24 it is intended that the scope of the invention rWill include all mc;thods of DNA
amplification lcz~own in the art.
The "extension of the primers" refers to the addition of nucleotides to a primer molecule so as to synthesize a nucleic acid complementary Co a template; molecule.
"Extension of 2s the primers" does not necessarily imply that the primer molecule is extended to synthesize a complete complementary template molecule. Rather, even ifr~nly a fraction of the template molecule has been copied, the primer i.s still considered extended.
A "fragment" of a molecule such as a protein pr nucleic acid i~ meant to refer to any so portion of the amino acid yr nucleotide genetic sequence.

By "heterozygous" or "heterozygous polyioorphism" is meant that the two alleles of a diploid cell or organism at a given focus are different, that is, that they have a different nucleotide exchanged for the same nucleotide at the same place in their sequences.
s By "homozygous" is meant that the two alleles of a diploid cell or organism at a given loons are identical, that is, that they have the same nucleotide for nucleotide exchange at the same place in their sequences.
t o By "hybridization" or "hybridizing," as used herein, is meant the forrnation oiF A-~' az~d C~G base pairs between the nucleotide sequence of a fragment of a segment of a polynucleotide and a con:zplexnentary nucleotide sequence of an oligonucledtide. By complementary is meant that at the loom of each A, C, (s or T (or U in the casa of an RNA molecule) in the fragment sequE;nce, the oligonucleotide sequenced has a T, G, C or t5 A, re~,pectively. The hybridized fragmcntloligonucleotide is celled a "duplex." In the case of a DNA~RNA hybrid, the molecular is called a '°k~eteroduplex: ' .. . . . , . .. . .., . . . . . . , s A "hybridization complex", means a connplex of nucleic acid naolecaies including at lea~~;t the target nucleic acid and sensor probe. ,lt may also include an anchpr probe.
By "immobilized on a solid suppork" is meant that a fragment, primer or oligonucleotide is attached to a substance at a particular location in such a manner that the system containing the immobilized fiagment, primer or oligonucleatide may be subjected to washing or other physical or chemical xnanipul.ativz~ without being dislodged from that location. A number of solid supports and means of immobilizing nucleotide,containing molec«les to them arc known in the art; any afthese suppoz is and means may be used in the methods t~f this invention.

As used herein, the term "nucleic acid molecule" is intended to include DNA
molecules (e.g:, c171~tA or genoznic 17NA), ItNA zxxolecule;~ (e.g_, mRNA), analogs of the DNA or RNA generated using nucleotide analogs, and derivatives, fragments and hornolu~
thereof. 'The nucleic acid molecule can be single-strazzded or double-stranded, but preferably is double-stranded DNA. An "isolated" nucleic acid zx~.olecule is one that is separated from other nucleic acid molecules that are presexzt iz~ the z~atweal source of the nucleic acid. A "nucleoside" refers to a base linked to a sugar.. The base may be adenine (A), guanine (G) (or its substitute, inosine (1)), cytosine (C), or thyxxaixae ('x) (or i.ts substitute, uracil (U)). The sugar may be ribose (the sugar of a z~atuzal nucleotide in 1 o RNA) or 2-deoxyribose (the sugar of a natural nucleotide in DNA). A
"nucleotide"
refers to a nucleoside linked to a single phosphate group.
As used herein, the term "oligozzucleotide" refers to a series of linked nt~cleatide residues, which aligonuclevtide ha.~ a sufficient number of nucleotide bests to be used in a PCR.
I S rea~ctian. A short oliganucleotide sequence may be based on, or desigied from, a genomic or eDNA sequence and is used to amplify, con:~rm, or reveal the presence of an identical, similar or complementary DNA or RrJA in a particular cell oz tissue.
Oligonucleotides may be chemically synthesized and may be used. as primers nr probes: ' ' Dligonueleotide means any nucleotide of more than 3 bases in length used to facilitate 20 detection or idez~ti~catiran of a target nucleic acid, including probes and primirs.
"Polymerase chain. reaction" car "PCR" refers to a thermoeyelic, polymerase-mediated, DhIA amplification reaction. A PCR typically includes template molecules, oligonucleotide primers complen5entary to each strand of the template molecules, a zs thermostable Dh(A polyznerase, and deoxyribonucleotides, and. invoIwes three distinct processes that are multiply repeated to effect the amplification of the original nucleic acid. The three processes (denaturation, hybridi~.ation, anri prinner extension) are often performed at distinct temperatures, and in distiu~ot temporal Steps. In many embvditnents, however, the hybridization and primer extension processes can be performed 30 concurrently. The nucleotide sample to be analyzed may be PCR amplification products provitded using the rapid cycling techniques described in U.~. Pat. No.
5,455,175. Other methods of amplifZCation izrclude, without lirt~itation, NASBR, SDA, 3SR, T5A
and rolling circle replication, It is understood that, in any method for producing a polynucleotide containing given modified nucleotides, one or several polyrncrascs or amplification methods may be used. The selection of optimal polymerization conditions depends on the application.
A ''polymerase" is an enzyme that catalyzes the sequential addition of rnonorneric units to a polymeric chain, or links two or more monomeric units to initiate a polymeric chain.
i o In preferred embodiments of this invartion, the "polymerase" will work by adding rnonomcric units whose idcrztity is determined by and which is camplemeutary to a template molecule of a specific sequence. For Example, DIVA, polymerases such as DNA
Po11 and Taq golyrxierase add deoxyribonucleotides to the 3' ~end of a polynucleotide chain in a template-dependent manner, thereby synthesizing a nucleic acid that is t 5 complementary to the template molecule. 1>olymerases may be used either to extend a primer once or repetitively ar to amplify a polyrzueleotide by repetitYVe priming of two complementary strands using two prirnErs.
A "polynucleotide" refers to a linear chain of nucleotides connected by a phosphodiest~r 20 linkage between the 3'-hydroxyl group of one nucleoside and the 5'-hydroxyl group of a second nucleoside, wluch in turn is linked through its 3' hydroxyl group to the 5'-hydroxyl group of a third nucleoside and so on to form a polymer comprised of nucleosides liked by a phosphodiester backbone. A "modified polynucleotide"
refers to a polynucleotide ixz which one or more natural xzucleotides have been partially or Z,~ substantially completely replaced with modified nucleotides.
A '~rime~r" is a short oligonucleotide, the'sequence of which is complementary to a se,~m~nt of the template which is being replicated, and which the polymerase usas as the starting poizzt for the replication process. By "complementary''' is meant that the nucleotide sequence of a primer is such that the primex carp foxxn a stable hydrogen bond eoznplex with the template; d. e_, the primer can hybridize to the template by virtue of the formation of base~pairs over a length of at least ten consecutive base pairs.
The primers herein arc selected to be "substantially' complementary to different strands of a particular target DNA sequence. This means that the primers rn~xst be suff cierrtly complementary to hybridize with their respective strands. Thf~efore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complernentary nucleotide ffagncnt may be attachEd to the S' end of the primer, vv~ith the to remainder ofthe primer sequence being complementary to the strand.
Alternatively, non-complementary bases or longer sequences can be intezspersed into the primer, provided that the primer sequence has suff'tciez~t compleznex~tarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.
A "restriction er~cyrne" refers to as ondonuclcas~ (an enzyme that cleaves phosphodiester bonds within a polynuclcotide chain) that cleaves DNA in response to a recognition site orr the DNA. The recognition site (action site) consists of a specific sequence of nucleotides typically about 4-$ nucleotides long.

A "single nucleotide polymorphism" or "SIfP" refers to polyxuclcotide that differs from another polynucleotide by a sizzgle z~ualeotide exchange. Por example, without limitation, exchar~ing one A for one C, G or T ire the entire sequence ofpolynucleotide constitutes a SNP. Of course, it is possible to have more than one Shlf in a particular polynucleotidc.
2s For example, at one locus in a polynucleotide, a C may be ex~:hanged for a T, at another locus a G may be exchanged for an A anal so on. VYh.en referring to SNPs, the polynucleotide is most often DNA and the SNP is one that usually results in a change in the genotype that is associated with a corresponding change in phenotype of the organism in which the SNf occurs.
x7 As used herein, a "template" refers to a target palynuclcotidc strand, for example, without limitation, an uzaxxzadi.fzed naturally-accruming I7NA strand, which a palyn~erase uses as a means of recagz~izi.ng which nucleotide it should next incorporate into a growing strand to polymerize the complement of tlae naturally-uccun-ing strand.. Such DNA
strand may be single-stranded or it zxzay be part of a double-stranded DNA template. In applications of the present invention requiring repeated cycles ofpalyrn~rization, e.,~, the polymerise chain reaction (PC1Z), the template strand itself may become rn.odihed by incorporation bf modified nucleotides, yet still ser. ve as a template for a pblyrneraso to synthesize l0 additiozaal potyrzucl.aotides.
A. "thennacyclic reaction" is a mufti-stop reaction wherein at least two steps arc accomplished by changing the temperature of the reaction.
o s A "therrnostable polymerise" refers to a DNA or .1~NA polyzne~rase enzyme that can withstand extremely high temperatures, such as those approaching 100°C.
Thermastable polymerises are typically isolated from organisms that live in extreme temperatures, such - . ~ . . , , . . . n as 7lzermus aquaticus. examples of thermostable polymera.sos include Taq, Tth, Pfu, Vent, deep vent, 'UlTma, and variations and derivatives thereof:
A "variant" is a difference in the nucleotide sequence among rc;latod polynucleotides.
The difference may be the deletion of one or more nucleotides tom the scduence of one polynucleotide cozxzpared to the sequence of a related polynuclootidc, the addition of one or mare nucleoiades or the subsritution of one nuclvotidc for another. The terms "mutation," "polyznoxphiszzz" and "variant" are used interchangeably herein to describe such variants. As used hereizt, tlxe term "variant" in the singular is to be construed to include multiple variances; t.e., two or more nucleotide additions, deletions andlor substitutions in the wane polynucleotide. A "point zxzutation" .refers to a single substitution of one nucleotide for another.

The present invention makes use of a number of oligonucleotide sequences as described herein as primers for use in DNA amplification reaction or as hybridization probes. It is well known to those skilled in the art that such oligorruclcotidcs may be modified in tezms of length and even specificity, and they will still be well sW ted to the practice of the invention. As such, the invention is not limited to the preciae oligonucleotides described but is intended to include all those oligonucleotides chat will allow the method of the invention to be earned out as disclosed herein.
~o tx~troduc~ion~:
A variety of charaetcristics of livestock animals are considered. important in determining the overall value of the finished product. Some factors are involved in the palatability of the meat produced, which is i~nC~.po~rtat7t to consumers, and which i5 reflected in the grading system used to classify meat. 5ti11 other factors affect the cost of producing an animal of given size and therefore affect the cost o~Fmeat that tfze consumer will >.. .,. .. .. . i ultimately pay, ~ and which will result in improved profitability for producers ~of livestock , as well as the operators of feccllots. As a result, methods of production that can improve zo the duality, or reduce the cost of production are desirable far al.l co~acez~,ed. in the production and consumption of meat from livestock.
The present invention discloses the discovery of iNPs that are associated with a variety of parameters related to the growth rate of animals. Knowledge of the CRH, PUJIIC and MC4R genotype of animals permits the development of genetic testixzg rxxethods such that animals with the most desirable characteristics witlx regard to carcass weight, average daily wci~lht gain and rib eye area can be identified and selected. This in turn leads to the development of methods of livestock management, wherein a lugher degree of predictability about the eventual development of livestock anintials becomes possible, ante the genotype of animals with regard to the CRH, POHC and MC4R genes is detez~xziz~ed_ According to one aspect of the present invention, there i5 provided a method far dist'sn~mishing bovines .~l??vina ~ ~~~~°IIP-iJ'llytrlnl~5111~'ru ~F~f' mpthnrW -nmnrice~,~~,e;._ _ ...... __.._ ..... ....
steps of first isolating a genozzzic JI~I°:lA sample from a bovine, and then amplifying a region of the bovine C1ZH gene using an oligonucleotide pair to form zxucleic acid ampliiacation products of C.t2.H gene polymorphism sequexzces. .A.rrzplil-ZCatian can be by any of a number of methods known to thane skilled in the art including 1'C1R., and the i0 invention is izxterzded to encompass any sz~itabEe methods of DIVA
amplifcation.
7.'he aznplificatic~n products are then analyzed in order to detect the presence or absence of at polymorphism in the CRFI gene that alters the fourth amino acid and which is associated with a number of desired phenotypes. The polymorphism comprises a C
to G
is transition at a position corresponding to position 22 of SEQ LL> IVO: 1, which is the eDNA sequence of exon 2 of the .l3os tr~z~rus corticotrophin-releasing hormone precursor (CRIB gene (Gez~azxlc .Accession No. AF340152), The presence of a "G" residue at tE~is position results in animals that display the desirable phenotypes of increased carcass weight, increased end-of test rib~eye area and increased post-natal growth..
By practicing 2o the method of the present invention and analyzing the amplification products it is possible to determine the genotype of individual animals with respect to the polymorphism.
Conveniently, analysis may be made by restriction fragzrzent length polymorphism 2s (RFLP) analysis of a 129 by PCIt produced by amplification of bovine genomic DNA
with the aligonucleotide pair of S~C,~ YD h10: -0~ and SEQ Ix7 NcJ: 5_ The use of a forward primer containing a purposeful mismatch, in combination with a target D1VA
containing the "G" allele, creates a Dd~I site such that the presence of the "G" allele is positively indicated by digestion of the amplification products with Dc~el. In the absence of the "G"
30 allele, the amplification product still contains a single .DdeI site, normally present in the CIZll gene, sncla that digestion yields two fragment of 8$ and ~G1 bp. In the presence of the SNP, the s'G" alley, an additional .Duel site is created at nucleotide 87 ofthe amplification product, resulting in the further digestion of the 88 by fragnnent to yield fragments of ~9 and T 9 bp.
In order to simplify detection of the amplification products axed the restriction fcagtz~.er~ts, it will be obvious to those skilled in the art that the ampiif~ed DNA will further comprise labeled moieties to permit detection of relatively szxAall azaaouz~la of product. .A, variety of rnoietaes are well luaown. to those skilled in the art and include such labeling tags as fluorescent, bioluminescent, chemiluminescent, and radioactive or colorigenic moieties.
,A, variety of methods of detecting the presence acrd restriction <iigestion properties of CRH gene amplification products are also suitable for use with the present invention.
These can include methods such as gel electrophoresis, mass spectroscopy or the like.
The present invention is also adapted to the use of single strancf.ed DIfA
detection is techniques such as fluorescence resonance energy transfer (FRET). For FRET
analysis, hybridization anchor and detection probes may be used to hybridize to the amplification products. The probes sequences are selected such that in the presence of the SNP (i.e. a G residue at position 22 as described above), the resulting hybridization corn~plex is more stable than if there is a C residue at the same position. By adjusting the hybridization 2o conditions, it is therefore possible to distinguish between animals with the SNP and those without. A variety of parameters well known to those skilled in the art can be used to affect the ability ofa hybxidization complex to fozaxx. These include changes in temperature, ionic concentration, or the inclusion of che~nacal constituents like formamide that decrease complex stability. It is further possible to distix~uish ax~ixu,als 2s heteroaygous for the SN'P versus those that are homozygous for the same.
The method of FRET analysis is well latown to the art, and the conditions under which the presence or absence of the SNP would be detected by FRET are readily determinable.
It is also well known to those in the art that a number of DNA atnplifieation techniques 3o are suitable for use with the present invention. Conveniently such amplification techniques zx~ay comprise methods such as polymerise chain reaction (PCR), Strand ,.~~._-_~ .~. _~~",~".. _ .r~... ~~,.... ,r ..w. ,,.~,w~~"~~,~ "a~,,m, ~
~__.... __._...._.m_~~..,..,.~.,~,."n",.,~~ ~_.__ displacement amplification (SI3A}, nucleic acid sequence based amplification (NAS$A.), rolling circle amplifica#ion, T7 palym~c~a..s~ mediated amplification, T3 poiymerase mediated amplification and SP6 palymerase mediated amplification. The precise method of DNA amplification is not intended to be li»~iting, an~i ether methods not listed here will be apparent to those skilled in the art arid (heir use i.s within the scope of the inventian.
In another aspect, the present invention provides a zaaothod for distinguishing bovines having a POMG' gene polymorphism. The method comprises :isolating genomie DNA
1o from a bovine, amplifying a region of the k~ovins POMC' gene using an oligonucleotide pair to form nucleic acid amplification sequences comprising arnplified,i~O.ll~G' gene polymorphism sequences, and than analyzing the amplification products in order to detect the presence or absence of a SNP in the POMC gene at position 254 of SEQ ID
NO: 2.
The polymorphism is a C to T transition, such that the presence ofa °'T" residue at this 1s position is associated with the desirable phenotypes of increased shipping weight and increased average daily gain, as coznpaxed to azaixn,al.s with a. "C" residue at position 254 of SEQ ID htO: 2.
Conveniently, the 3°O~IrfC SNP can be detected by restriction digest of a 390 by 20 ampliFcation product produced using the oligonuclcotide pair SEQ ID NO: 6 and SEQ
ID NO: 7. The presence of a "T" residue creates a BtsI restriction site at nucleotide 157 in a nucleic acid amplification product produced by amplification of the FOMC
gene using the aligonucleotide pair SEQ ID NO: 6 and SEQ ID NO: 7. The presence of the SNP is readily detested by digestion of the amplification product with Btsl, and the 2s digestion products analyzed by methods such as gel electrophoresis and the like.
As was described about, in order to simplify deteetian of the ampli~catidn products and the restriction fragments, it will be obvious to those skilled in the art that the amplified D'NA will further comprise labeled moieties to permit detection of relatively mall 30 amounts Of product.
za ........ ..,........_ .....,.. urw.":.~yrer» <,nsfi~~Y~~."''" ~~""~~~~-w v nave.-o-wr;,~,~mq'.~yy".~. ~waaW an-.---..-Y_.._.........,......~.~,~.e,~.~,~"., ,.~y,.es,rt~~e"-_.....
-0.%~.. ., rwww..

1n practicing the present invention it is also possible to use other known methods of analysis, such as FRET analysis, as a method of detection. Conveniently, hybridization probes comprising an anchor and detection probe, the design of which art is well la~.own to those skilled in the art of FRET analysis, are labeled with a detectable moiety, and then under suitable conditioxas are hybridized a PQ1VIC amplification product containing the site of iz~,texest in order to form a hybridization cnmple~c. Slsecificatly, the hybridization probe will be designed such that a change at position 2~4 of ~'EQ II7 NO: 2 will produce a hybridization complex of altered stability. A variety of parameters well known to those skilled ixt the art can be used to affect the ability of a hybridization complex to form.
1o These include changes in temperature, ionic concentration, or the inclusion of chemical constituents tike fonnamide that decrease complex stability.
The presence or absence of the PC7MC SNP is then determined by the stability of the hybridization complex as was described for the CX~'lT gene. The parameters affecting is hybridization and FRET analysis are well kxxowo. to those skilled in the art. In addition;
the foregoiz~.g are examples of amplification products and hybridization probes that are suitable far use with FRET analysis. It will be readily apparent to those skilled i;n the art that modification may be made to the oligonuclc,otides that are used to synthesize the amplification products or probes while still permitting the practice of the present zo invention. As before, a variety of amplification methods are suitable faz~
use in the practice of the present invention and all such methods are intended to be within the scope of the invention.
In another aspect, the present invention pmvidet a method for distinguishing animals 2s having a MC4~i2 gene polynnorphism. The method comprises isolating genomic 'DNA
from a bovine, anaplifyi~og a region of the bovine kIC4R gene using an aligonucleatide pair to form nucleic acid amglification sequences comprising amplified Jta~G4R
gene polymorphism sequences, and then detecting a SNF present in the MC4R gene.
'fhe SNP
comprises a G to C transition at position lOli9 of SECT ID NO: 3, and is associated with 3o the phenotype of maximum increased hot carcass weight, as compared to bovines with a "G" residue at this position.

~.....~. ..,. . .... m . "m.~ __. .. _._.. . ,ri ~~_, .~.
....~~.~"~"r:..,,~,...a~~ ~. _._..W ,_...,~.~..h..,",w. .. .._... _ _~.~~..~..~...~

Conveniently, a porkion of the MG4R gene is amplified using the oligonucleatide pair SEQ ID NO: 13 and SEQ rD NU: 9, which yields a 226 by amplification product.
The presence of a "T" residue results in an RFLP due to tlxe creation of a Tiu'I
restriction site.
s Thus, the presence or absence of the SNp in the t~tC4R gene can be detected by restricting the arnpli~catian product with Tair. h2 tl~e absence of the SNP
the 226 by is undigested, while in the presence of the SNP, the X26 by is digested to yield two fragments of i23 and 103 bp. The results of the digestiozz reaction are analyzed using well-known DNA sizing techniques such as gel elec~broph,axesis az~d the like.
To aid i~a io the detention of the digestion pxoducts in cases where small amounts of DNA
amplification products axe irzvolved, tlae amplification products may be labeled v~ith a detectable moiety to aid in the sensitivity of the detection methods used.
Such labeling tags and znethads are known to those skilled in the art and it will be readily apparent whether such rnodifeatians would be needed or desired.
Detection of the SNP present in the ~f9.C4.tt gene caz~. also be conveniently performed by FILET analysis. Here the amplification product produced by the oligonueleotide pair SEQ 1D Na: $ and SEQ ID NO: 9 is included in a hybridization reaction with oligonucleotide probes that serve as hybridisation anchor and probe sequences.
Conveniently, the anchor and probe arc labeled such that FRTT analysis can be used to detect the prasance or absence of the SNP in the lidG4R gene. The parameters affecting hybridir_ation and FRET analysis are well known to thQSe skilled in the art.
Isx addition, the foregoing arc cxa~mples of amplification products and hybridization probes that are suitable far use with FRET analysis. it will lx readily apparent to those skilled in the art that modification may be made to the oligonucleotides that are used to synthesize the amplification products or probes while still pernxittizag the practice of the present invention. As before, a variety of amplification methods are suitable for use in the practice of the present invention and all such methods are intended to be within the scope of the izwention.

The present invention alw describes newly dxscovezed siztgle nucleotide polymorphism sequences, previously not kxaown in the art. In particular, the invention describes nucleic acids comprising a portion of the bovine Cltf! gene, further comprising a polymorphism at position 22 as defined by the positions in SEQ ID NO: 1, and in which there is a "C"
s ~ residue at position 22. The invention also describes a nucleic acid comprising a portion of the bovine POMP' gene, in which a T residue is present at position 254 as defined by the positions in SEQ ID NO: 2.
Conveniently, purified and isolated nucleic acids comprising the SNPs of the invention io may be recovered from animals by subjecting a sample of gonomic DNA to an amplification procedure. Alternatively, it will be readily apparent to those skilled in the art that DNA segxnezzts containing the SNP could be artificially produced by oligonucleatide synthesis technology, or by screening cDNA ~ar genomic 17NA
libraries produced from ;animals known to possess the polymorphisms.
is Bovines, like all mammals, are diploid organisms possess;uig pairs of homologous chromosomes. Thus, at a typical genetic locus, an animal has throe possible genotypes that can result from the combining of two difFerez~t a~lletes (e.g_ A and T3).
The animal E
may be homozygous for one or another aileie, or heterozygous, possessing oz~e of each of 2p the two possible alleles (e.g. AA, BB or AB).
The present invention provides a method of selecting individual livestock animals based on the knowledge of an animal's CRH genotype. With respect to the SNP
described in the present invention, the two possible alleles are a "C" or "G" residue at position 22 as 2s defined by SEQ B7 NO: I. The method of the invention comprises the steps of determining the GRH alleles of an animal, such that it can be determined whether an animal is "CC", "CG" or "GG" with respect to the CRH one Locus. The presence of a "G" allele is assaaiated the desired phenotypes. With the knowledge of the animal's genotype oz~e can. then identify and sort animals into l;roups of like phenotype, or 30 otherwise use the larowledge of the genotype in order to predict: which animals will have z5 the desired phenotypes of increased hot carcass weight, increased end-of test n'b-oye area and increased adjusted weaning weight, a measure of post-natal growth.
Here sorting can be taken to mean placing animals in physical groupings such as pens, so that animals of like gcrnotype are kept separate fmm animals of a different genotype:
This would be a useful practice in the case of breeding programs where it would be desirable to pmduce animals of particular genotypes. For example, it may be desirable to establish herds that are homozygous "GG" at the CRH gene, such that breeding am4ng these animals would only produce more "GG" animals. Here keeping animals of this i0 genotype separate would be needed to ensure that "GG" animals did not have the opportunity to breed with animals possessing one or more "C" alleles, which could result in the reproduction of animals with a reduced tendency to display the desired phenotypes associated wzth the C.~C "G" allele. further~xxore, by ex~suxing that at least one animal in a breeding pair is "GG" at the CRH locus, conveniently allows for the frequency of the i s "G" allele to be increased in the next, and subsequent generations.
Sorting may also be of a "virtual" nature, such that an animal's genotype is recorded either in a notebook or computer database. Hare, animals could then be selected based on their lrnown ge~~otype without the need for physical separation. This would allow one to 24 select for animals of desired phenotype where physical separatian~ is xzot required.
The invention further provides a method of seleetirig individual livestock animals based on the knowledge of an animal's P(7MC genotype. With respect to the ~"Q.tI~G' SNp described in the present invention, the two possible alleles are a "C" or "T"
residue at 25 position 254 as defined by SEQ ID NO: 2. The method of the invention comprises the steps of determining the FOMC alleles of an animal, such That it can be detenxnined whether an animal is "CC", "CT" or "TT" with respect to the PQ.MC gene locus:
With the knowledge of the animal's genotype one can then sort aniaroals into groups of like phenotype, or athetwise use the laaowledge of the genotype in order to predict which 30 animals will have the desired phenotypes of increased shipping weight, increased average daily gain and increased hot carcass weight. ?he extent of the phenotypic response is directly related to the number of "T" alleles, such that an animal homozygous for the "T"
allele, a "TT°' ariinial, will display the greatest phenotypic change for the desired pl~ertotypes when compared to animals with the "CC" genotype. Animals that are "C'f"
display an intermediate phenotypic response.
A.s descz~ibad for the CRX~' gene, krzawledge of the POMC genotype allows for the selection and sorting of animals that will display desired phenotypes. As before, sorting may be physical or virtual, and znay be used in conjunction with animal breeding or other herd znanageznerzt prograrxzs.
IO
T.he invention further comprises a method of selecting individual livestock animals based on the knorxrledge of an animal's MC4R genotype. With respect to the MC4R SNP
described in the present invention, the t~vo possible alleles aarc a "C" or "G" residue at position l Ob9 as defined by 5~Q ID NO: 3. The method of t:he invention comprises the is steps of determining the MC4R alleles of an animal, such that it can 'be deterxrLined whether an axtizzzal is "CC", "CC" or "GG" with respect to the A~IG'~R gene locus. The presence of a "C" allele is associated the desired phenotypes of increased hat carcass weight. With the knowledge of the animal's genotype one can then sort aniit~als into groups of lute phenotype, or otherwise use the knowledge of the genotype in order to 2o predict which animals will have the desired phenotypes of increased hot carcass weight.
Knowledge of an animal's MC4lt genotype provides a further advantage. Animals with one or two "C" alleles will display an increase in hot carcass weight, regardless of the animal's Cl~i' genotype. Thus, where the sale phenotype of iztterest is increased hot zs carcass weight, sel~taxzg animals with either the "GG°" C,tt~~' genotype or the °'CC" or "CCx" MC4R genotypes will accomplish the same goal, being the greatest increase in hot carcass weight. Any animals that have at least one "C" allele at the MC4R gene locus will display the increased hot carcass weight phenotype, and thus testing of animals for the prescance of the CRH SNPs wih not be necessary to detect and select the desired 3o animals.

For the subgroup of a~aiznais that lack a "C" allele at MG'4R, further testing for the presence of G'Rff ~1"~Tp' could detect additional animals that will display the desired phenotype. In any population where the '°~" and "Gr'" alleles 1=or the lvfC~R gene are both present, testing for MC4R genotype provides the greatest chance of detecting animals that s will display the maximum increased hot carcass weight possible. xhis occurs because two out of tnrcc poss~le combinations will have a "G" allal~e. In cozztrast, only ozze in three of the possible combinations, "GG", in the CRff SNl' will e~,k~ibit the same maximum increase in hot carcass weight. The overall advantage will be that fewer animals will need to be tested for both CR!-1 and MC4R gezaotypes if the MC4R
getzotype ~ o of the animal is determined first. Thus, based. on the allele frequencies shown in Table V, it is more likely that an animal will have at least one "C" allele at MC~4R
than that it will be homozygous for the "~'" allele at CRH.
A,s described for the CRH and POII~C ge.ncs, l~nowled~e of an animal's MC4R
genotype i3 allows for the selection and sorting of animals that will display desired phenotypes. As before, sorting tray be physical or virtual; and may be used in conjunction with anirxaal breeding or other herd management programs.
It is a further aspect of the invention that animals can be selected as to their combined 20 Ct~' and POMC genotypes. There is an advantage to selecting animals with a "GG"
gexxotype at the CRH gene locus, and a "TT" genotype at the POMC gene locus, in that animals that are double homozygotes ("GG - 1T" animals) will display the ,greatest phenotypic change in the desirable phenotypes of increased I~ot carcass weight, increased shipping weight, increased average daily gain and increased end~of test rib-eye area, ~5 greater than that which would be obtained for animals homozygous for only one of the CRFf and POMC loci. Thus, through the method of the invention, animals with the most desirable combination of growth-related phenotypes can be selected. As before, the selection may be physical or virtual, and the advantage of selecting animals based on their combined CRH and P(7MC genotypes will be readily apparent to those skilled in the 30 areas of animal breedixxg, herd management and the like.

In order to hilly realize the utility of the invention, there are also provided diagnostic kits that can be used to determine the CRtI, FOtVI~' ar MC4l~ genotypes of animals.
in ,general, each of the kits comprises oligonuclcotidc primers suitable to amplify the portions of each gene comprising the SNPs of the present invention. The kits comprise forward and reverse primers suitable for amplification of a DNA sample taken fforn an animal. The sample may be from any tissue or fluid in which genornic DNA is present.
Conveni ently the sample may be Oaken from blood skin or a hair bixlb.
Ta for the presence of CRFir SNP alleles, the kit comprises a forward primer comprising In at it's 3' end secluencc identical to at least 10 contiguous nucleotides within SEQ ID: 1, a reverse primer oornprising at it's 3' end a nucleotide sequence folly complementary to at least I O contiguous nucleotides with SEQ ID NtS: 1. The primers are preferably Pram 10 to 30 nucleotides in length, although variation in the length of the primer is not intended to be limiting. An example of suitable primers would be those defined by SEQ
ID NO: 4 and SEQ ID N(~: 5.
In one embodiment of a diag~astic lrit, the primers will be usc;d to amplify DNA from a genomic DNA sample to produce amplification products, which can then be analyzed by restriction digest for the presence or absence of the SNf' at position 22 as defined by SEQ
2Q ID NGI: 1. In an alternative embodiment, the kit would further comprise hybridization probes adapted to distinguish between the two CRHslleles using FRET analysis.
Tn this embodiment, the use of FRET analysis is one such method well known in the art that is suitable .for detecting SNPs. Where a method of analysis such as FRET is used, the bybridization probes would be labeled with a detectable moiety to aid in the detection of the SNP. The types of detectable moieties suitable for use in FRET analysis are well leaawn to thane Skilled in the art of molecular biology.
In another embodixxaent, where it is desired to test for the presence of POMC
SNP alleles, the kit comprises a forward primer comprising at it's 3' end sequence identical to at least so 10 conti,guons nucleotides within SEQ ID: 2, a reverse primer <;omprising at it's 3' end a n~ccleatide sequence fully complementary to at least 10 contiguous nucleotides with SEQ

...__.._ r x~., ,...~ ., .. ....... . _ . ... ..~ r.."~,.~,~" ~., r ..
........ . __._._ ~_.,Ar. ~....,~.,~..~, n o.. _.~ __._..

ID NO: 2. The primers are preferably fxoztz t0 to 3U nucleotides in length, although variation in the length of the primer is not izatended to be limiting. An example of suitable primers vvotild be those deE.ned by SEt~ i17 NO~: 6 and ShQ 1D Nt~:
7.
Xn one embodiment of a diagnostic kit, the primers will be used to amplify .DNA from a genomic DNA sample to produce amplification products, which can then be analyzed by restrictaoz~ digest far the presence ar absence of the SIWP at position 254 as defined by SEQ TD NO: 2. In an alternative embodiment, the kit would further comprise lxybri.dization anchor and detection probes adapted to distinguish between the two FOMC
ko alleles using FRET analysis. Where a method of analysis such as F).tE'x" is used, the hybridization probes would be labeled with a detectable znoieky to aid in the detectaoxi of the SNP. The types of detectable moieties suitable far use in FRET analysis are well known to those skilled in the art of zzzalecular biology.
In yet another embodiment, where it is desired to test for trxc presence of alleles, the kit comprises a forward primer comprising at it's ~' end sequence identical to at least 10 contiguous nucleotides within SEQ 1D: 3, a ireverse priuzer comprising at it's 3' end a nucleotide sequence fully camplezx~erttary to at least 1Q contiguous nucleotides with SEQ ID NO: 3. The primers are preferably from '10 to 30 nucleotides iri length, although variation in tb.e length of the primer is not intended to be limiting. An example of suitable primers would be those defined by 5E(~ ID NO: 8 and SEQ ID NO: 9.
In one embodiment of a diagnostic kit, the primers will be used to amplify DNA
from a genomic DNA sample to produce amplification products, which can then be analyzed by restriction digest far the presence or absence of the SKIP at position 1069 as defined by S1JQ 1:17 NO: 3. In ate alternative embodiment, die kii: would further comprise hybridization probes adapted to distinguish between the two MC4R alleles by FRET
analysis. tn this exnbadiment, the use of FRET analysis is one such method well known in the art that is suitable for detecting SNPs. Where a method of analysis such as FRET
3o is used, the hybridisation probes would be labeled with a detectable moiety to aid in the detection of the SNP. The types of detectable moieties suitable for use in FILET analysis are well known to those skilled in the art of molecular biology.
It will also be obvious to one skilled in the art that diagnostic kits will include additional s reagents including, but not limited to lysing buffers for lysing cells contained in a sample, dNTP's, reaction buffer, an amplifying enzyme and combinations thereof. Kits may also include accessory diagnostic agents such as the restriction cnzyxne used to detect the SNP, or detection reagents to reveal the presence of detectable moieties. For example, it is well known in the art, and especially where only limited duantiti~s of DNA
are to available, to use sensitive detection techniques such as Southern blot hybridization, chromatography or. mass spectroscopy in order to detect specie amplification products, or specific restriction digest products derived from az~apli~catioz~ products as derived herein. Thus, the precise means of detecting the various ShlPs from the azz~plification or ~'estrictiran digest products could be performed by a variety of techniques well known to 15 those skilled in the art of molecular biology, and the present invention is intended to encompass those methods of detection.
The diagnostic kits as referred to herein array be individually pacltaged for each individual gene locus to be tested, or the required reagents required to test foz polymorphisms in alI
20 tbxee genes could be present in a single kit: Such variation is ~CW nmon in diagnostic kits and it xtot intended to be limiting Qf tfte invention.
Examnlcs:
In terms of demonstrating the practice of the inventions the following examples are provi ded.

Materials and Methods:
Cattle:
s A group of 2s6 tan-colored Charolais-cross steers were divided into two groups of 12S
anirnaIs cash, and either limit-fed a grain diet or full-fed a forage-based diet during the backgrounding phase (90 day period). During the finishing phase each of these two groups were divided into half and allowed a full or limited high ,grain diet; this was based on voluntu~r intake. The full diets were 100% ad dibitum and the limited diets were ~?5% ad io lihitum. Live animal weight, ultrasound measurements of rib-eye area (121;A) and average daily gain (ADG) data were collected. Steers were sent far slaughtez~ as tlxey approached a target shipping weight of 635 kg (mean = 636.6 kg, SD = 21.4$). They were weighed every two weeks then ozx two consecutive days and transported for slaughter within a week where b.ot carcass weight (FiCV~ data was collected. Adjusted weaning weights were available in a 15 second group of animals {n ~ 255) that included the Canadian Beef REfcrcncc Herd (n ~ I32;
Schsrxut2 et al., 2001) and 123 animals from three ranches.
SIVP identificatiozx izt C,t2l~'~,ene:
20 Ba~ozx 2 of the C'RH gene was amplified and sequenced as described in 8uchanan et al. (2002b;
Gezx:Bank accession.number AF340I52). Briefly, the following single-stranded DNA primers were used Go amplify a 254 by fragment:
Forward:
25 5' - ATGCGACTGCCGCTGCTCG - 3' Reverse:
S' - AGAGAGGGGAGCAGCCCG - 3' 3o The 20 ul reaction contaizxed: x 00 ng of DNA, I Ox PC1~ bufFer, 5x (~-solution (C~iagex~.), 0.2 mM dNTPs, 0.5 emits Taq polymerase, 4 pmol forward primer, and 4 pmol reverse primer. The amplification programm consisted of one e~relc of 95°C for 2 minutes, followed by 35 cycles of denaturation at 95°C for 45 sec, atrncaling at 55°C for 30 sec and extension at 72°C far 45 sec, fallawed by a final cycle of extension at ?2°C tbr 3 minutes. Sequez~cizzg of PCR products was gerFormed, an an AB~1373 sequenccr (Applied Biosystems). Sequence was aligned and compared for varixtian using Sequencher 4.1.2 (Gene Godes Corporada~x).
PCR-RFLP Anal,:
to The C'.t~H4 SNP is defined bar a C to G transition at position 22 of SLt,~ ID
NO: 1. Wherever the tez~n "CRH~" or "CRH4 SN.P" is used it is meant to refer to the nucleotide present at position 22 of SEQ ID NO: 1. CRIT4 genotypes were derived from the amplificataox~ and t s subsequent digestion of the product with Ddel (New Ex~glar~.d ~3iaL.abs).
The following primers were used to amplify a 12~ by pmduct:
1~orward:
i 5' - GCGCCCGCTAA~1ATGGGACTGA - 3' zo Reverse:
5' - CTGTGAT~GCCT~iCCCrCzGCAC - 3' The 25 ul amplification reaction. cantaioed 50 ng of genarnic krovine DNA, 0.2 uM of each 2s primer, 0.2 mM dNTPs, 45 mM Tris-l~Cl pH 8.8, llm.M (Nl~i)2SU4, 4.5 mM
MgCl2, G.7 m11~
~i mercaptoethanol, 4.5 mM EDTA, 0,25 mM spermidane, l0~ra D1VIS0 axzd U.65 ~,T Taq ~1~1,A, polytnerase (Invitrogen). The cycling protocol was 2 rxxin at 94°C, 35 cycles of 94°C far t rain, s2°C for 45 sec, 72°C for 50 sec, with a final exter~sioz~
at 72°C for 4 min. A 2-hour digestion with DdeI was carried out in a 37°C water bath. The digesters PCR-products were 30 separated on a 4% agarose gel. )=li,~esti an of the 12~ by FCR l~rnduet with DcIeI produced fragments of 88 and 41 bp, due to the presence of a DcleZ reca,8nition site at nt 87 of tlae f'CR

pmciuct. This site was present in the DNA of all ariirnals tested. The CRH4 SNP introduces a second Dde>' recognition site due the presence of a G residue at nucleotide S7, resulting in further digestxatx oftbe $$ by fragment further into fragments of ~9 and T 9 by upon digestion with ~7det.
PGMC. LEP and MC4R Ge~aotypirg:
Genotypi.ng methods for SN)?s presexit in x'D,~I~IC. MC4.R and.~lG'.l' have pzeviously beezx t0 desczibed (~uckxazui~ et al., 2002x; 2002b; Thm et al., 2003).
Statistical Analysis:
is A regression analysis was carried out in the group of 255 c~a.ttle to determine if the number of copies of a GRH allele si~ai~ZCantly affected adjusted weaning weil;ht. Tn the steers (fed two different backgroundiz~g .rations and finishing diet:;) statistical analyses were performed using the general linear model (GLM) procedure of SAS (SAS,199f1}. 1Vo significant e~'ects were observed based on backgrounding (forage vs. grain} or f"rnishing (limited vs.
cad libiturn} diets zc or the interaction between the two and hence these were deleted from the model. No sigt~ificat~t effects were observed with leptin or between the four or three gene interactions and hence these were deleted from the model.
In steers, tire model used to determine the effects of genotype on ADS, EOT-REA, shipping z5 weight and HCW was:
Y~o = ~. + GCRH~ + GPGMCn, + GMC~P," + GC:~H x t',POMC:,~" + GC~H x GMG.tR,o, +
GPOMC x GMCAR"N,+ e,~"~,~
30 Where: Y~",no is an observation. of the dependent variable (cnd~of=test REA, Shipping weight, hot carcass weight (HCW) and average daily gain (ADG)}; p, is the overall population mean 3~-...... ..~,n ~~.>_, ; ,~.,N,~,,~~,:".,~,5« ,mx~.w....~_ . . ....

far the variable; GCRHx is the effect of the l~tl~ genotype of C.~t,~;C~ (k =1 ( .l",xC), 2 (CC), 3 (GG)); GPOMCm is the effect of the mth genotype of PUMC (m =1 (CC}, 2 (CT), 3 (TT}};
GMC4R is the effect of the nth genotype of MC4R (n =1(CiG), 2 (GC), 3 (CC));
GCRH x GPOMCxm, GCRH x GMC4Rx", and GPOMC x GMC4R~ are effects ofthe gene interaction arid e~,T", is the randrnn error associated with the observation. Treatments comparisons used least sduares means by PI7IFF o~ptiorfs (SAS, 1998). Signifteauce was declared at P ~ 0.05.
salts:
The CHR4, POMC, MtC4R and LEP genes were genotyped in 2;56 steers and then analyzed using GLM for association with average daily gain (A1,7G), ezxd-of test rib-eye area (EOT-REA), shippin,~ weight and hot carcass weight {HCW). 'fhe CR~'4 SNP
was positively correlated with EOT-R8A and HCW (Table I). The POMC SNP was positively correlated with shipping weight arid HCW and there was evidence of a trend assaeiated with ADG (Table I). MC4R showed a'trend with HCW (Table I) Interactions between two sets of genes were observed in the case of two traits. The CRI~
and PUMC genes appeared to interact with respeck to EOT-REA, (Iy = 0.0407);
while the CRH and tI~~CR4 gexles appeared to interact with recptxt to HC'JJ {P= 0.02) {Table >), Tn the case of the interaction between the CRX and MCR4 genc;s, HCW increased ioy 26 lCg where animals were homozygous at CRH for the "C" allele, and had either one or two MC~4R "C" alleles (i.e. "CC" or "CG" at the MCR4 SNP site) as compared to animals ~5 with an A~IC~tR "GG" genotype (P = 0.008 and P = 0.008). However, these same animals (CC-CC or CC-CG at lLiCR~ were not sigrnificantly different from animals that had one or two "G" alleles at CRH.
The data lead to the conolusxon drat, zf a~n anxrnal lxas either the "GG"
genotype at the CRFI gene locus, or, at least one "C" allele at the 11~C4R gene locus, then they will display the desired phenotype of increase hot carcass weight. Thus, CRH and MC4R
operate as parallel switches with respect to the increased hot carca..fis weight phenotype such that if one switch is on, the position of the athex is irrelevant.
Carcass yield least squaxe means for CXX and l~t~~C genotypes are reported in 'fables 'fl and III respectively. The presence of a "Cx" allele at CRH4 is associated with an izzcrease in weiht. In the case of PC3MG, the "T" a11o1e is associated with increased weights.
Furthermore, the effect of a "T" allele appeals to be additive with each copy of the allele rcsulti:ng in an increase of 9 kg. The "C" allele at tt?C4R is associated with an ixzcrease in HGW (LS Means CG = 378, CG = 377 and GG = 3b8 SEM =1.79), and acts in a 1 U dominant fashion.
The expected gains in cm2ofrib-eye 2trea or Iive and carcass weight irr kilogt'arns are shown in Tabie ItT. Allele frequencies observed in the 25b staers for CRH4, POMC and MC4R are shown in Table V. The allele frequencies were such, that adequate t 5 representation of all genotypes would have been present in, the test population, Three SNPs have now been identified in the Clt~z' gene, two in the pro peptide region and another in tile signal sequence. The CIG SNP at codon ~. of CR~I (position 22 of SEQ ID
N'O: t) appears to be the mutation associated with effects on adjusted weaning weight, a 20 measm-e of post natal growth and carcass weight. A Pro within the CRH
signal sequence at cods~n 4 ltas been previously reported in both sheep (Itocl2e ct al., 1988) and humans (Shibabara et al., 1983). Similarly, in the Genbank database a Pro at this same site has been reported in another ovine sequence, two porcine, and two more human CRII
sequences (Accession Numbers JOUS03, AF440229, Y 151 ~9, NM000756 and ECU11 t)31 2s respectively).
The introduction of an Arg at position 4 in the signal sequence could lead to a reduction in the levels of circulating CRH (Fig. 3), resulting in a decrease in the growth inhibition effect zzormally associated with this hormone.
3C~
__~.., ~-~.~ -~"., - ...".,">r .T,.~.v~..~"~..~",..~ ~,:~,,. .,.......___ . ..

The data izzdicate that the CRH4 SNP is predictive of increased. E~JT-I~.EA
and HCW.
The data from animals that were "GG - TT" homozygotes at CRH and POMC
respectively, suggests that the presence ofthe C.?~~'4 allele does not result in an increase in shipping weight above that observed for .;t'?O,t'1~C "TT" k~oznozygotes alone_ The r3ata from animals with various CRll and MC4.R genotypes showed that the greatest increase in hot carcass weight could be achieved either by having CItH animals hoxiaazygous for the "G" allele SNP, or animals with at least one "C" allele at the MC4R locus.
We had previously sequenced PUMC as a candidate gene for AD ,1''x and carcass weight. 'Vlre mapped it directly under C~TX. peals (x'hue et al., 2003) and the cxu~-ent results confirm its association with ADG (!' = 0.07) and carcass weight. 'V~lhatever the møl~ular mechanism through which ,POMC polymorphisms act, the as.~ociations with increased ADG, shipping and hot carcass weight can be capitalized upon by selecting cattle that are homozygous for the "T"
allele at POll~IC'. The effect seen on shipping weight is likely to be an under estimate, based ~ 5 on how these animals were shipped (target weight) as compared to the usual practice. The usual practice in feedlots is to either use a set number of days an feed or visually appraise the weight of an animal, and then actually wex~, a truckload. of cai-kle.
Since CRH affects POMC levels both directly in the hypothalamus, and indirectly by ~o affecting the release of glucocorticoids, it was important to determine if the associations between these genes and the various traits we have examined were dependent or indcpcndEnt effec,~ts of the SNPs that have been studied. As there was no interaction effect observed with respect to HCW, the data arc consistent with the premise that these genes act independently of each other. As a result, testing for the presence of either the CT~H or POMG' SNPs will be 2s useful as a predictor of HCW. In addition, given that the allele frequencies of each of the alleles associated with the most desirable traits (increase weights) are fairly common (U.37 far the CRFT4 "G" allele, and 0.23 for the PUMC "T" allele), it will be possible to use the genetic test of the present invention to select for animals that arc; homozygous for both the CRH4 G
and!?OMC "T" alleles. Selecting for such "GG -- TT" animals v~ill allow for the concurrent 30 improvement R);A, shipping weight, HCW and ADG. Finally, the association observed bertween adj ustec~ weaning weight and the CRH4 SNP means the cow-calf producer will benefit from genetic selection methods based on this SNP.

Tabke x. Gerterak X,incar yodel Probability values for ~eneQs) with Trait Associations.
Gene or Gene EOT-iuteracti,on ADG R.EA Shipping HCW

cRi'-r4 a.37 0.03~~' 0.35 0.0015**

!'0lvIG' 0.07 O.A.S 0.0078** O.ooB**

lYl~4R 0.$$ 0.78 0.60 0.085 Cltfl4 x PC7ItIG'0.$9 0.047* 0.63 0.17 Cd~l'4 x MG~4~~0.28 U.~b 0.21 0.02*

* =1'~U.OS; * * = P~0.01 Table IL Effects of CRH4 on beef cattle performance (~,~ rneans) Trait CC GC Cr ,C'x SE.M*

- ..~,.. - a EOT-REA 88.6b 92.7a~ 94.6a U.84 Shipping 63 i .5 638.5 64.1.5 2.55 Wt HCW 367.Sa 373.7bc 3$1.$a 1.64 *SEM = pooled standard erroz~ o~Fznean; lVifeans with different letters in the same row are significantlydi~1'erent (~ ~ 0.(?5) Table XXX. ~f~ccts of PCy~IfC on beef cattle performance (LS means) POMC
s Trait CC CT TT S_ FM*

ADG 1.62 1.69 1.72 0.028 EaT-REA 92.5 933 90.2 1.11 S~uppxng 628.0 b 637.4 a 646.0 a 3.37 Wt 1-ICW 368.8 b 376.2 a 378.0 a 2.16 *SElVi = pooled standard error of mean; Means with different letters in the same z~ow acre significantly different (P ~ 0.05) 'X"ablc iV. Increase in ILEA end pounds expected from selec:iing animals GG
at CRH4 or TT at POMC or path GG and TT.
Trait CRH4 POMC CR.H4 ~ P'OMC
~(T~' ZtEA 6 cmz ~ 6 em2 Ship weight 'l8 kg 18 kg Hot carcass weight 14.3 kg 9.2 kg 23.5 kg Table V. Allele frequencies ifor Cue(, EUIViC axed lvXC4Fc Cli'Cf4 POMC MC4R
Cx=0.37 T=0.23 C=0.66 C = 0.63 C = 0.77 ti = 0.34 i Table 'VX, Sutoatnary of the >fhcnotypcs ,Associated with the CRFi, POMP and MC4R Sh)las.
Gene S' P kk~e~otv~e(sl CRII C. - G transition HCW, EQTREA, AWW

FOMC C - T transition ADCa, HCW, SW

MC4R G - C traxzsation ki'CW

The followi~ag abbreviations axe used in tlae tables: ~'J~:W - hot carcass weight; EQTRE~
- end of test rib eye area; AWW - adjusted weaning weight; ADG - aveYage daily gain;
SW - slxippzng weight.
The foregdin~ is considered as illustrative only of the principles of the invention.
io Further, since numerous changes and modifications will readily occxzr to those skirled in the art, it is nat desired to limit the invention to the exact constructioxa and operation shown and described, and accordingly, all such suitable changes or modifications ixz stTUCttue or operation which may be resort~3 to are intended 6o fall within the scope of .
the claimed invention.
i SEQUENCE LISTING:
Number czf SEQ ID NOS: 9 SEQ ID NO: 1 LENGTH: 5$4 base pairs 'X"Y~'E: Dl'rTA
ORGANISM: Bos taws k'EATUitE: SNP's present a~ nucleotide;s 22 ("CRH4"~, 14S ("GRH45") and 240 ~ a ~s~GFtH77").
OTHER INFORMATION: GcnBank Accession AF340152 SEQUENCE:
I cgcccgctaaaatgcgactgccgctgctcgtgtccgtgygCgtcCtgCtggtggctCtgc 61 tgGCCtCCCCgccatgcagggCactcetaageegggggcccatecegggtgeccggeagg:

z2~. Catcacageacccccagcccctgagtttcttccagccgccgccgcagccccaggaacccc lsl aggctctgcccaccctactccgtgttggggaggaatacttcctccgcetgggtaacctag atgagacccgggctgctccactctctcccgccgcctcgcctctcgocagcagaagcagca 301 gtcgcctttctccggacaaggtggccgccaactttttacgagcgCtgctgcagccccggc 361 gcccattcgacagcccagcgggtcecgcggaacgcggcacggagaacgccatcggcagcc 421 gceaggaggegeeggccgecaggaagaggegatcccaggaacctceeatetccetggatc 481 tcaacttccacctcctccgagaagtcttggaaatgaCaaaggccgatcagttagcacagc 541 aagctcatarcaayaggaaaCCgttgga~attgctgggaaa'tga SEQ ZD NO: 2 LENGTH: l (102 base pairs TYPE: DNA

ORGAN1SM:
.Bos taurus 3o rEATURE: SNP at pasitiozz OTHER INFORMATION: CxenBaz~c ,Accession JQQ(f21 SEQUENCE:
1 gaggagggagtggaaggctcaggcggcgcgcttgaggggcgggtgaacgccgcggcctgg 61 agtgggcggggcctgacgCgCtCtgCCgGCGtCC~Cc'lggCgCgCatccgggCCtgcaagC

121 ccgaCCtCtCcgccgagacgcCggtgttCCCcggcaacggcgatgageagccgctgactg 181 agaacccCCggaagtacgtcatgggccatttccgctgggaccgcttcggccgtcggaatg 241 gtagcagcagcagcggagttgggggcg~ggcccagaagcgcgaggaggaagiggcggtgg 301 gcgaaggCCCCgggccCCgcggcgatgaegccgagacgggtccgcgcgaggacaagcgtt 361 cttactccatggaacacttccgctggggGaagCCggtgggCaagaagcggCgCCCggtga 421 aggtgtaCCCCaaCggCgCCgaggaCgagtcggcccaggcctttcccctcgaattcaaga g81 gggagctgaecggggagaggctcgagcaggcgcgeggecccgaggcccaggetgagagtg 541 cggccgcGGgggCtgagctggagtatggcctggtggaggaggcggaggctgaggcggccg ~5 601 agaagaaggactcggggccctataagatggaacacttCCgGtcjgggCaeJGCcgCGCaagg 661 acaagcgctacggcgggttCaC.gaCCtCCgagaagr~.gC4s~daCgCCCCtCgtCe~CgCtgt ' 721 tcaaaaacgccatcatcaagaacgcccacaagaagggccagtgagggcgcagc~ggcagg 781 ggectctatCcgcggaaagttgaccetgaaggcetetcttetgeaetactaaagectcgc 84z agCCtgggtgaggattcgcccaggcagtgatggcgccaggtatcccgactcttaaagctg 901 tctgtagttaagaaatadaaCCtttCaagttCCa,CgaatszttgaCtgggCgc~atLaaaaa 96X CgCatttccatcaagtaaagggcagtacatattggaggggcg SEQ
ID
NO:

2S LENGTH: base pairs TYPE:.DNA

ORGANISM:
l3os taurus FEATURE: at position i OTHER
INFORMATION:
Genbank Accession No.
AF2652~?i.

3~
SEQUENCE:
1 CagCCtaaga CttCCaag~.g atgCtgcaCCa gagccacact tgaaagagac tgaaaacttc 6x ctttccagct ccggagcatg ggacatttat tcacagcagg catgccactc tccgccgcct 35 122 aactttcgtt tggggcaagt caagactgga gaaaggtgct gaggctgcaa gatccaggag 1s1 gttcagtcag tacagagggg acctgaatec aaaatgaact ctacccagcc ccttgggatg 241 cacacctctc tccactcctg gaaccgcagc gcccacggaa tgcccaccaa tgtcagtgag 301 tccctggcaa aaggctactc ggacgggggg tgctatgagc agctctttgt ctctcccgag 361 gtgtttgtga ctctgggggt catcagcttg ttggagaata ttctggtgat cgtggccata $ 42X gecaagaaca agaatetgca ctcaCCCatg tactttttca tctgaagcet ggctgtggct 481 gacatgttgg tgagcgtttc caacgggtcg gaaaccattg tcatcaccct gctgaacagC
54I acggaoacgg acgcgcagag cttcacggtg gatattgaca atgtaattga ctcggtgatc 64X tgtagctcct tgettgcctc catctgcagc Ctgctgtcga tcgcggtgga caggtacttc 661 actatcttct atgcgctcca gtaccataac atcatgacgg tgaagcgggt ggcgatcaCC
lU 721 atcagcgcca tctgggcagc ctgcacggtg tcgggcgtct tgttcatcat ttactcagac 781 agcagtgctg ttatcatctg cctCatcacc gtgttcttca ccatgctggc tctCatggCg 841 tctctctatg tccacatgtt cctcatggcc agactccaca ttaagaggat cgcggtcctg 901 ccaggtagcg gcaccatccg ccagggcgcc aacatgaagg gggcgattac cctgaccata 961 ctgatcgggg tctttgttgt ctgctgggcc cccttcttcc tgcacctgat attctacate 15 10x1 tcttgtcCec agaacccata ctgtgtgtgt ttcatgtctc actttaaact gtacctcatc 1081 ctcatcatgt gcaattccat cattgaccct ctgatttatg ccctgcggag ccaagaaatg 1141 aggaaaacct tcaaagagaG catttgttgc tctcctetag gtggcctCtg tgatttgtCt 1201 agcagatatt aaatggggac aaacgcgatg ctaaacacaa gcttaagaga ctttctcatC
1261 ctcatatgta caacctgaac agtctgtatc agccacagct ttttcttctg tgtagggcat 20 1321 ggagtgaaaa tttctattgt atcagttgaa gtttgtgatt tttttctgat gtgaaacagt 1381 gcccagtatt ggtgtatttt taatgtaatg ctactttCtg gCtgtaaaat gtgaatccac 1441 atcacaggtt ataggcacta tgcatttata aaaaaagaag aaaaaaagtc cttatgagga 1501 gtttaacagt gtttccttct tgttatttac aaggatgtga cactttgctt gcttttgtaa 1,561 catggaaatc aeagcttcat taagtatatc ctcataagtg gtttttttat gttatacttt 25 1621 acaacactga agtgtaaaaa tttgattcta gcatttaggg gagaaatatt gagaacatat 7.681 tgcttaatca taaaaaacaa gctgaaattt Caggtaattt aataagactt tctCattCat' 1741 tcttcctgtg cagaagttga aatgaagctt gtattgggag aaaaacagtt acttaaaaaa isol aaaaaaaaa SEA ID ~NO: 4 LEN CrTH: 22 TYPE: DNA
ORGANISM: Bos taurus ss FEATURE:
OTHER INFORMATION: Forward primer f'or DNA amplii:ication of sequences within SEQ ID 1~T0: 1.

SEQUENCE:
R gCgccogcta aaatgcr~act ga 22 SEQ ID NO: 5 LENGTH: 20 TYPE: DNA
ORGANISIVr: Bos taurus IU FEATURE:
OTHER INFORMATION: Reverse primer for DNA amplification; seclnence is the reverse cozxaplement of the corresponding sequence in SEQ ID NO: 1.
SEQUENCE:
IS
I etgtgatgcc tgccgggcaG ~0 SEQ IB NO: ~ . i 20 LENGTH; ~1 T'.YPE: DNA
ORGANISM: Bvs tauru5 , FEATURE:
OTHER INFORMATION; Forward primer far DNA ampli~catian of sequences within 25 SEQ ID NO: 2.
i SEQUENCE:
1. egtgcatccg ggcctgcaag c 21 SEQ ID NO: 7 LENGTH: 23 T~.'PF.: I~;~VA
ORGANISM: .~~.s taurLas FEATURE:
OTHER LNFORMATION: Reverse primer far L7NA arnplificaticn; Sequence is the s rcvcrsc complement of the corre~spondxng sequence xzt SEQ Z~ NO: ~.
I SEQUENCE:
1 gtcagctccc tettgaattc gag 23 SEQ ID NO: 8 LENGTH: 20 TYPE: L?NA
ORGANISM: Bos taurus t5 FEATURE:
QT~IER INFORMATION: Forward primer for DNA amplification of sequences witf~
SEQ ID NO: 3.
SEQUENCE:
zo 1 taccCtgaCCataGtgatc~
SEQ ID NO: a LENGTEi: z2 s 25 TYPE: 1DNA
i ORGANISM: ,~os taur~ss FEATURE:
OTHER INFORMATZC1N: Reverse pramer for DNA amplification; sequence is tk~e reverse complement of corresponding sequence in SEt~ ID NC~: 3.

Claims (22)

CLAIMS:

We claim:

1. A method for distinguishing bovines having a CRH gene polymorphism, comprising:
isolating a gnomic DNA sample form a bovine;
amplifying a region of the bovine CRH gene using an oligonucleotide pair to form nucleic acid amplification products comprising amplified CRH gene polymorphism sequences;
detecting a polymorphism present in the CRH gene at position 22 of SEQ ID
NO: 1;
analyzing the polymorphism, and wherein the presence of a "G" residue is associated with the phenotypes of increased hot carcass weight, increased end-of-test rib-eye area and increased adjusted weaning weight, as compared to bovines with a "C" residue at position 22 of SEQ ID NO: 1.

2. The method of Claim 1 wherein the oligonucleotide pair comprises SEQ ID NO:
4 and SEQ ID NO: 5.

3. The method of Claim 2 wherein the polymorphism detected is a restriction fragment length polymorphism (RFLP).

4. The method of Claim 3 wherein the RFLP is the presence or absence of a DdeI
restriction site at nucleotide 137 in a nucleic acid amplification product produced by amplification of the CRH gene using the oligonucleotide pair SEQ ID NO: 4 and SEQ ID NO: 5.

5. The method of Claim 1 further comprising the inclusion of a detectable moiety such that the amplification product comprises a labeled amplification product.

6. The method of Claim 5 wherein the detectable moiety is selected from the group consisting of fluorescent, bioluminescent, chemiluminescent, radioactive and colorigenic moieties.

7. The method of Claim 1 further comprising:
contacting the nucleic acid amplification products with a hybridization probe;
wherein the hybridization probes comprise at least one oligonucleotide labeled with a detectable moiety;
under suitable conditions permitting hybridization of the at least one oligonucleotide to the amplification product to form a hybridization complex;
and wherein the presence of the detectable moiety in the hybridization complex indicates the presence of a CRH polymorphism.

8. The method of Claim 1 wherein the nucleic acid amplification product is produced by an amplification method selected from the group of polymerase chain reaction (PCR), strand displacement amplification (SDA), nucleic acid sequence based amplification (NASBA), rolling circle amplification, T7 polymerase mediated amplification, T3 polymerase mediated amplification and SP6 polymerase mediated amplification.

9. A method for distinguishing bovines haying a POMC gene polymorphism;
comprising:

isolating genornic DNA from a bovine;

amplifying a region of the bovine POMC gene using an oligonucleotide pair to form nucleic acid amplification sequences comprising amplified POMC
gene polymorphism sequences;

detecting a polymorphism present in the POMC gene at position 254 of SEQ
ID NO: 2;
analyzing the polymorphism, and wherein the presence of a "T" residue is associated with the phenotypes of increased shipping weight and increased average daily gain as compared to bovines with a "C" residue at position 254 of SEQ ID NO: 2.

10. The method of Claim 9 wherein the oligonucleotide pair comprises SEQ ID
NO:
6 and SEQ ID NO: 7.

11. ~The method of Claim 14 wherein the polymorphism detected is a restriction fragment length polymorphism (RFLP).

12. ~The method of Claim 11 wherein the RFLP is the presence or absence of a BtsI
restriction site at nucleotide 157 in a nucleic acid amplification product produced by amplification of the POMC gene using the oligonucleotide pair SEQ ID NO: 6 and SEQ ID NO: 7.

13. ~The method of Claim 9 further comprising the inclusion of a detectable moiety such that the amplification product comprises a labeled amplification product.

14. ~The method of Claim 14 wherein the detectable moiety is selected from the group consisting of fluorescent, bioluminescent, chemiluminescent, radioactive and colorigenic moieties.

15. ~The method of Claim 9 further comprising:

contacting the nucleic acid amplification product with a hybridization probe;

wherein the hybridization probes comprise at least one oligonucleoticle labeled with a detectable moiety;

under suitable conditions permitting hybridization of the at least one oligonucleotide to the amplification product to form a hybridization complex;
and wherein the presence of the detectable moiety in the hybridization complex indicates the presence of a POMC polymorphism.

16. The method of Claim 9 wherein the nucleic acid amplification product is produced by an amplification method selected from the group of polymerase chain reaction (PCR), strand displacement amplification (SDA), nucleic acid sequence based amplification (NASBA), rolling circle amplification, T7 polymerase mediated amplification, T3 polymerase mediated amplification and SP6 polymerase mediated amplification.

17. A method for distinguishing bovines having a MC4R gene polymorphism, comprising:

isolating genomic DNA from a bovine amplifying a region of the bovine MC4R gene using an oligonucleotide pair to form nucleic acid amplification sequences comprising amplified MC4R gene polymorphism sequences;

detecting a polymorphism present in the MC4R gene at position 1069 of SEQ
ID NO: 3;

analyzing the polymorphism, and~

wherein the presence of a "G" residue is associated with the phenotype of increased hot carcass weight, as compared to bovines with a "C" residue at position 1069 of SEQ ID NO: 3.

18. The method of Claim 17 wherein the oligonucleotide pair comprises SEQ ID
NO:
8 and SEQ ID NO: 9.

19. The method of Claim 17 wherein the polymorphism detected is a restriction, fragment length polymorphism (RFLP).

20. The method of Claim 19 wherein the RFLP is the presence or absence of a Tail.
restriction site at nucleotide 123 in a nucleic acid amplification product produced by amplification of the MC4R gene using the oligonucleotide pair SEQ ID NO: 8 and SEQ ID NO: 9.

21. The method of Claim 17 further comprising the inclusion of a detectable moiety such that the amplification product comprises a labeled amplification product.

22. The method of Claim 21 wherein the detectable moiety is selected from the group consisting of fluorescent, bioluminescent, chemiluminescent, radioactive and colorigenic moieties.

23. The method of Claim 17 further comprising:

contacting the nucleic: acid amplification product with a hybridization probe;

wherein the hybridization probe comprises at least one oligonucleotide labeled with a detectable moiety;

under suitable conditions permitting hybridization of the at least one:
oligonucleotide to the amplification product to form a hybridization complex;
and wherein the presence of the detectable moiety in the hybridization complex indicates the presence: of a MC4R polymorphism.

24. The method of Claim 17 wherein the nucleic acid amplification product is produced by an amplification method selected from the group of polymerase chain reaction (PCR) strand displacement amplification (SDA), nucleic acid, sequence based amplification (NASBA), rolling circle amplification, T7 polymerase mediated amplification, T3 polymerase mediated amplification and~
SP6 polymerase mediated amplification.

25. An isolated and purified nucleic acid comprising a portion of the bovine CRH
gene, further comprising a polymorphism at position 22 as defined by the positions in SEQ ID NO: 1, and in which there is a "C"' residue at position 22.

26. An isolated and purified nucleic acid comprising a portion of the bovine POMC
gene, further comprising a polymorphism at position 254 as defined by the positions in SEQ ID NO: 2, and in which there is a "T" residue at position 254.

27. A method of selecting individual livestock animals based on the knowledge of am animal's CRH genotype, comprising the steps of:~
determining the CRH alleles of an animal;

wherein the alleles of an animal will be one of "CC", "CG", or" G"G at position 22 of SEQ ID NO: 1; and sorting animals into groups of like genotype; and wherein a "CG" or "GG" genotype is associated with the desired phenotypes of increased hot carcass weight, increased end-of-test rib-eye area and increased adjusted weaning weight.

28. A method of selecting individual livestock animals based on the knowledge of an animal's POMC genotype, comprising the steps of:

determining the POMC alleles of an animal;

wherein the alleles of an animal will be one of "CC", "CT", or "TT" at position 254 of SEQ ID NO: 2; and wherein a "CT" or "TT" genotype is associated with the desired phenotypes of increased shipping weight, increased average daily gain and increased hot~
carcass weight.

29. A method of selecting individual livestock animals based on the knowledge of an animal's MC4R genotype, comprising the steps of;

determining the MC4R alleles of an animal;

wherein the alleles of an animal will be one of "CC", "CG", or "GG" at position 1069 of SEQ ID NO: 3; and wherein a "CG" or "GG" genotype is associated with increased hot carcass weight.

30. ~The method of Claim 29, wherein the only phenotype of interest is maximum increased hot carcass weight, and wherein an animal is first tested to determine the animal's MC4R genotype;

and wherein, if the animal is homozygous for the "G" allele at the MC4R gene locus the animal is then tested to determine its CRH genotype, such that an animal that is homozygous for the "G" allele at the CRH gene locus will display the desired phenotype of maximum increased hot carcass weight.

31. ~The method of selecting individual livestock animals based an the knowledge of an animal's CRH and POMC genotype, comprising the steps of:~
determining the CRH and POMC alleles of an animal;

wherein the genotype of an animal will be one of "CC", "CG" or "GG" at position 22 of SEQ ID NO: 1, and "CC", "CT", or "TT" at position 254 of SEQ ID NO: 2; and wherein a "GG" genotype at the CRH gene and a "TT" genotype at the POMC
gene (a "GG-TT" phenotype) is associated with the desired phenotypes of increased adjusted weaning weight, increased hot carcass weight, increased shipping weight, increased average daily gain and increased end-of-test rib-eye area, greater than that which would be obtained for animals homozygous for only one of the CRH and POMC loci.

32. ~A diagnostic kit for determining the CRH genotype of a bovine animal, the kit comprising:

oligonucleotide primers for amplifying a portion of the CRH gene;

the primers comprising a forward primer comprising at it's 3' end sequence~
identical to at least 10 contiguous nucleotides within SEQ ID: 1;~

a reverse primer comprising at it's 3' end a nucleotide sequence fully complementary to at least 10 contiguous nucleotides with SEQ ID NO: 1;

and wherein the forward and reverse primers are from 10 to 30 nucleotides in length and in a PCR amplification reaction will produce a nucleic acid product amplification product containing a residue corresponding to position 2 of SEQ
ID NO: 1.

33. ~The kit of Claim 32 wherein the primers comprise the oligonucleotides SEQ
ID
NO: 4 and SEQ ID NO: 5.

34. ~The kit of Claim 32 wherein the primers are labeled with a detectable moiety.

35. ~The kit of Claim 32 further comprising at least one oligonucleotide, labeled with a detectable moiety and suitable for use as a hybridization probe.

36. ~A diagnostic kit for determining the POMC genotype of a bovine animal, the kit comprising:

oligonucleotide primers for amplifying the POMC gene;

the primers comprising a forward primer comprising at it's 3' end sequence identical to at least 10 contiguous nucleotides within SEQ ID: 2;

a reverse primer comprising at it's 3' end a nucleotide sequence fully complementary to at least 10 contiguous nucleotides with SEQ ID NO: 2;

at least one additional reagent selected from the group consisting of a lysing buffer for lysing cells contained in a sample, dNTP's, reaction buffer, an amplifying enzyme and a combination thereof.

and wherein the forward and reverse primers arc from 10 to 30 nucleotides in length and in a PCR amplification reaction will produce a nucleic acid product amplification product containing a residue corresponding to position 254 of SEQ ID NO: 2.

37. The kit of Claim 36 wherein the primers comprise the oligonucleotides SEQ
ID
NO: 6 and SEQ ID NO: 7.

38. The kit of Claim 36 wherein the primers are labeled with a detectable moiety.

39. The kit of Claim 36 further comprising an oligonucleotide, labeled with a detectable moiety and suitable as a hybridization probe.

40. A kit for determining the MC4R genotype of an animal, the kit comprising:

oligonucleotide primers for amplifying the MC4R gene;

the primers comprising a forward primer comprising at it's 3' end sequence identical to at least 10 contiguous nucleotides within SEQ ID: 3;

a reverse primer comprising at it's 3' end a nucleotide sequence fully complementary to at least 10 contiguous nucleotides with SEQ ID NO: 3;

at least one additional reagent selected from the group consisting of a lysing buffer for lysing cells contained in a sample, dNTP's, reaction buffer, an amplifying enzyme and a combination thereof.

and wherein the forward and reverse primers are from 10 to 30 nucleotides in length and in a PCR amplification reaction will produce a nucleic acid product amplification product containing a residue corresponding to position 1069 of SEQ ID NO: 3.

41. The kit of Claim 40 wherein the primers comprise the oligonucleotides SEQ
ID
NO: 8 and SEQ ID NO: 9.

42. The kit of Claim 40 wherein the primers are labeled with a detectable moiety.

43. The kit of Claim 40 further comprising at least one oligonucleotide, labeled with a detectable moiety and suitable or use as a hybridization probe.

REFERENCES CITED:

1. Bagley C.P., Morrison D.G., Feazel J.I., Saxton A.M., Growth and sexual characteristics of suckling beef calves as influenced by age at castration and growth implants, J. Anim. Sci. 67 (1989) 1258-1264.

2. Barendse W., Vaiman D., Kemp S.J., Sugimoto Y., Armitage S.M., Williams J.L., Sun H.S., Eggen A., Agaba M., Alcyasin S.A., Band M., Bishop M.D., Buitkamp J., Byrne K, Collins F., Cooper L., Coppettiers W., Denys B., Drinkwater R.D., Easterday K., Elduque C., Ennis S., Erhardt G., Ferretti L., Flavin N., Gao Q., Georges M., Gurung R., Harlizius B., Hawkins G., Hetzel J., Hirano T., Hulme D., Jorgensen C., Kessler M., Kirkpatrick B.W., Konfortov B., Kostia S., Kuln C., Lenstra J.A., Leveziel H., Lewin H.A., Leyhe B., Lil L., Martin Burriel I., McGraw R.A., Miller J.R., Moody D.E., Moore S.S., Nakane S., Nijman I.J., Olsaker I., Pomp D., Rando A., Ron M., Shalom A., Teale A.J., Thieven U., Urquhart B.G.D., Vage D-I., Van de Weghe A., Varvio S., Velmala R., Vilkki J., Weikard, R., Woodside C., Womack J.E., Zanotti M., Zaragoza P., A medium-density genetic linkage map of the bovine genome, Mammal.
Genome 8 (1997) 21-28.

3. Buchanan F.C., Thue T.D., Winkelman-Sim D.C., Plante Y., Schmutz S.M., Two QTLs for growth map to bovine chromosome 14, 27th International Conference on Animal Genetics, July 22-26 2000, Minneapolis, MN.

4. Buchanan F.C., Fitzsimmon C.J., Van Kessel A.G., Thue T.D., Winkelman-Sim D.C., Schmutz S.M., Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels, Genet. Sel. Evol. 34 (2002) 105-116.

5. Buchanan F.C., Thue T.D., Elsaesser E.D., Winkelman-Sim D.C.,A
corticotrophin-releasing hormone polymorphism associated with post-natal growth in Beef cattle, Proceedings of the 7th World Congress on Genetics Applied to Livestock Production.
2002 Paper. CD-ROM communication n~ 11-32.

6. Dunn A.J., Berridge, C.W., Physiological and behavioral responses to corticotropin-releasing factor administration: is CRF a mediator of anxiety or stress responses?
Brain Research Reviews 15 (1990) 71-100.

7. Grobet L., Poncelet D., Royo L.J., Brouwers B., Pirotiin D., Michaux C., Menissier F., Zanotti M., Dunner S., Georges, M., Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle, Mammal. Genome 9 (1998) 210-213.

8. Houseknecht K.L., Baile C.Z., Matteri R.L., Spurlock M.C., The biology of leptin: A
review, J. Anim. Sci. 76 (1998) 1405-1420.

9. Kress D.D., Burfening P.J., Miller P.D., Vaniman D., Beef sire expected progeny differences calculated by three methods, J. Anim. Sci. 44 (1977) 195-202.

10. Liu H-X., Chew S.L., Cartegni L., Zhang M.Q., Krainer A.R., Exonic splicing enhancer motif recognized by human SC35 under splicing conditions, Molecular and cellular biology 20 (2000)1063 -1071.

11. Liu H-X., Cartegni L., Zhang M.Q., Krainer A.R., A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes, Nat.Genet.

(2001) 55 - 58.

12. Marsh D.J., Hollopeter G., Huszar D., Laufer R., Yagaloff K.A., Fisher S.L. Burn P.
Palmiter R.D., Response of mclanocortin-4 receptor-deficient mice to anorectic and orexigenic peptides, Nat. Genet. 21 (1999) 119-122.

13. Pritchard L.E., Turnbull A.V., White A., Pro-opiomclanocortin processing in the hypothalamus: impact on melanocortin signalling and obesity, J. Endocrinol.

(2002) 411-421.

14. Roche P.J., Crawford R.J., Fernley R.T., Tregear G.W., Coghlan, J.P., Nucleotide sequence of the gene coding far ovine corticotropin-releasing factor and regulation of its mRNA levels by glucocorticoids, Gene 71 (1988) 421-431.

15. SAS (1998) SAS/STAT User's Guide (Release 8.02). SAS Inst. Inc.,Cary, NC.

16. Schmutz S.M., Buchanan F.C., Winkelman-Sim D.C., Pawlyshyn V., Plante Y., McKinnon J.J., Fournier, B.P., Development of the Canadian Beef Reference Herd for gene mapping studies, Theriogenology 55 (2001) 963-972.

17. Schumann F.J., Janzen E.D., McKinnon, J.J., Prophylactic tilmicosin medication of feedlot calves at arrival, Can. Vet. J. 31 (1990) 285-288.

18. Sharpe P.M., Haynes N.B., Buttery P.J., Glucocorticoid status in growth, in: Buttery P.J., Haynes N.B., Lindsay D.B. (Eds.), Control and Manipulation of Animal Growth, Butterworths, London, 1986 , p 207-222.

19. Shibahara S., Morimoto Y., Furutani Y., Notake M., Takahashi H., Shimizu S., Horikawa S., Numa, S., Isolation and sequence analysis of the human corticotropin-releasing factor precursor gene, EMBO J. 2 (1983) 775-779.

20. Szabo G., Dallmann G., Muller G., Patthy L., Soller M., Varga, L., A
deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice, Mammal. Genome. 9 (1998) 671-672.

21. Thue T.D., Schumtz S.M., Buchanan, F.C., A SNP in the cattle MC4R gene is used to map MC4R to BTA 24, Anim. Genet. 32 (2001) 390 - 391.

22. Thue T.D., Buchanan, F.C., Linkage mapping of POMC to bovine chromosome 11, Anim. Genet. 34 (2003) 149.