CA2458953A1 - Novel genetic products obtained from ashbya gossypii, which are associated with transcription mechanisms, rna processing and/or translation - Google Patents

Abstract

The invention relates to novel polynucleotides obtained from Ashbya gossypii , to oligonucleotides that hybridise with the latter, to expression cassettes and vectors containing said polynucleotides, to micro-organisms transformed therewith, to polypeptides that have been coded by said polynucleotides and to the use of the novel polypeptides and polynucleotides as targets for modulating the control of transcription and/or translation and/or the contro l of RNA processing and in particular the improvement of vitamin B2 production in micro-organisms of the genus Ashbya.

Description

NOVEL GENETIC PRODUCTS OBTAINED FROM ASHBYA GOSSYPII, WHICH
ARE ASSOCIATED WITH TRANSCRIPTION MECHANISMS, RNA
PROCESSING AND/OR TRANSLATION
The present invention relates to novel polynucleotides from Ashbya gossypii;
to oligonucleotides hybridizing therewith; to expression cassettes and vectors which comprise these polynucleotides; to microorganisms transformed therewith; to polypeptides encoded by these polynucleotides; and to the use of the novel poiypeptides and polynucleotides as targets for modulating the operations of 1 o transcription, RNA processing and/or translation and, in particular, improving vitamin B2 production in microorganisms of the genus Ashbya.
Vitamin B2 (riboflavin, lactoflavin) is an alkali- and light-sensitive vitamin which shows a yellowish green fluorescence in solution. Vitamin B2 deficiency may lead to ectodermal damage, in particular cataract, keratitis, corneal vascularization;
or to autonomic and urogenital disorders. Vitamin B2 is a precursor for the molecules FAD
and FMN which, besides NAD+ and NADP+, are important in biology for hydrogen transfer. They are formed from vitamin B2 by phosphorylation (FMN) and subsequent adenylation (FAD).
Vitamin B2 is synthesized in plants, yeasts and many microorganisms from GTP
and ribulose 5-phosphate. The reaction pathway starts with opening of the imidazoie ring of GTP and elimination of a phosphate residue. Deamination, reduction and elimination of the remaining phosphate result in 5-amino-6-ribitylamino-2,4-pyrimidinone.
Reaction of this compound with 3,4-dihydroxy-2-butanone 4-phosphate leads to the bicyclic molecule 6,7-dimethyl-8-ribityllumazine. This compound is converted into the tricyclic compound riboflavin by dismutation, in which a 4-carbon unit is transferred.
Vitamin B2 occurs in many vegetables and in meat, and to a lesser extent in cereal products. The daily vitamin B2 requirement of an adult is about 1.4 to 2 mg.
The main breakdown product of the coenzymes FMN and FAD in humans is in turn riboflavin, .-. 0000052814 which is excreted as such.

Vitamin B2 is thus an important dietary substance for humans and animals.
Efforts are therefore being made to make vitamin B2 available on the industrial scale. It has therefore been proposed to synthesize vitamin B2 by a microbiological route.
Microorganisms which can be used for this purpose are, for example, Bacillus subtilis, the ascomycetes Eremothecium ashbyii, Ashbya gossypii, and the yeasts Candida flareri and Saccharomyces cerevisiae. The nutrient media used for this purpose comprise molasses or vegetable oils as carbon source, inorganic salts, amino acids, animal or vegetable peptones and proteins, and vitamin additions. In sterile aerobic submerged processes, yields of more than 10 g of vitamin B2 are obtained per Titer of culture broth within a few days. The requirements are good aeration of the culture, careful agitation and setting of temperatures below about 30°C. Removal of the biomass, evaporation and drying of the concentrate result in a product enriched in vitamin B2.
Microbiological production of vitamin B2 is described, for example, in WO-A-92/01060, EP-A-0 405 370 and EP-A-0 531 708.
A survey of the importance, occurrence, production, biosynthesis and use of vitamin B2 is to be found, for example, in Ullmann's Encyclopaedia of Industrial Chemistry, volume A27, pages 521 et seq.
Transcription Gene expression in fungi is mainly controlled at the transcription level. The transcription apparatus consists of a number of proteins which can be divided into two groups: RNA
polymerase (the operative DNA-transcribing enzyme) and transcription factors (which control gene transcription by guiding the RNA polymerase to specific promoter DNA
sequences which recognize these factors). Fungi such as Ashbya gossypii contain a number of different transcription factors which are specific for different promoters, growth phases, environmental conditions, substrates, oxygen levels and the like, _. 00ooo52s14 allowing the organism to adapt to various environmental and metabolic conditions.
Promoters are specific DNA sequences which serve as docking sites for the RNA
polymerase complex and transcription factors. Many promoter elements have conserved sequence elements which can be identified by homology searches; an alternative possibility is to identify promoter regions for a particular gene using standard techniques such as primer extension. Many promoter regions of eukaryotes are known (Guarente, L (1987), Ann. Rev. Biochem., 21; 425-452).
Promoter transcription control is influenced by several repression or activation mechanisms. Specific regulatory proteins (transcription factors), which bind to promoters, have the ability to block the binding of the RNA holoenzyme (repressors) or assist the latter (activators) and thus control transcription. In addition, certain enzymes modify the histones bound to the DNA and thus make it possible for either access of the transcription factors to the promoter to be prevented or made possible for the first time (Loo, S.; Rine, J. (1995); Annu. Rev. Cell. Dev. Biol., 11, 519-548). The binding of the transcription factors is likewise controlled by their interactions with other molecules such as proteins or other metabolic compounds (Evans, R. (1989), Science, 240, 889-895).
The ability to control the transcription of genes thus responds to a plurality of environmental or metabolic signs makes it possible for the cells to control exactly when a gene can be expressed and how much of a gene product can be present in the cell at a point in time. This in turn prevents unnecessary expenditure of energy or unnecessary use of possibly rare intermediate compounds or cofactors.
RNAprocessing RNA is synthesized as heterogeneous fragment, with the coding sequence (axons) in eukaryotes frequently being interrupted by noncoding sequences (introns).
During RNA
processing after transcription, the introns are cut out (splicing) so that the coding sequence (of mRNA) can be read off on the ribosomes (Sharp, P. (1987), Science; 235, 766-771 ). Since the export of RNA from the cell is also controlled with the splicing, it is possible in this way to control the amount of mRNA available on the ribosomes.

Translation Translation is the process by which a polypeptide is synthesized from amino acids in accordance with the information contained in an RNA molecule. The main components of this process are ribosomes and specific initiation or elongation factors such as eEF1 and eEF2 (Moidave (1985); Ann. Rev. Biochem., 54, 1109-1149). Ribosomes are composed of RNA (rRNA) and specific proteins, They consist of a large and a small subunit, each of which can be characterized by its sedimentation behavior in an analytical ultracentrifuge. Synthesis of the ribosomes is controlled by coordinated production of the RNA and protein components depending on the physiological state of the cell.
Each codon of the mRNA molecule encodes a particular amino acid. The conversion of mRNA into amino acid is carried out by transfer RNA (tRNA) molecules. These molecules consist of an RNA single strand (between 60 and 100 bases) which is in the form of an L-shaped three-dimensional structure with projecting regions or "arms". One of these arms forms base pairs with a particular codon sequence on the mRNA
molecule. A second arm interacts specifically with a particular amino acid (which is encoded by the codon). Other tRNA arms comprise the variable arm, the 'T't'C
arm (which has thymidylate and pseudouridylate modifications) and the D arm (which has a dihydrouridine modification). The function of these latter structures is still unknown, but their conservation between tRNA molecules suggests a role in protein synthesis.
In order that the nucleic acid-based tRNA molecule pairs with the correct amino acid it is necessary for a family of enzymes, referred to as aminoacyl-tRNA
synthetases, to act. There are many different enzymes of this type, and each is specific for a particular tRNA and a particular amino acid. These enzymes bind the 3'-hydroxyl of the terminal tRNA adenosine ribose unit to the amino acid in a two-step reaction. Firstly, the enzyme is activated by reaction with ATP and the amino acid, resulting in an aminoacyl-tRNA
synthetase/aminoacyl adenylate complex. Secondly, the aminoacyl group is transferred from the enzyme to the target tRNA, on which it remains in a high-energy state. Binding v 0000052814 of the tRNA molecule to its recognition codon on the mRNA molecule then brings the high-energy amino acid bound to the tRNA into contact with the ribosome.
Inside the ribosome, the amino acid-Loaded tRNA (aminoacyl-tRNA) occupies a binding site (the A site) next to a second site (the P site) which carries a tRNA molecule whose amino 5 acid is bound to the growing polypeptide chain (peptidyl-tRNA). The activated amino acid on the aminoacyl-tRNA is sufficiently reactive for a peptide bond to form spontaneously between this amino acid and the next amino acid on the growing polypeptide chain. GTP hydrolysis supplies the energy to transfer the tRNA, which is now loaded with the polypeptide chain, from the A site to the P site of the ribosome, and the process is repeated until a stop codon is reached.
There is a number of different steps at which translation can be controlled.
These include binding of the ribosome to mRNA, the presence of mRNA secondary structure, the codon usage or the frequency of particular tRNAs.
The utilization of genes associated with the mechanisms of transcription, RNA
processing and/or translation for generating microorganisms, preferably of the genus Ashbya, in particular of Ashbya gossypii strains, with improved adaptability to external conditions such as environmental and metabolic conditions has not yet been described.
It is an object of the present invention to provide novel targets for influencing the transcription and/or translation mechanisms and/or the mechanisms of RNA
processing in microorganisms of the genus Ashbya, in particular in Ashbya gossypii. The object in particular is specific modulation of the transcription, RNA processing and/or translation in such microorganisms. A further object is to improve the vitamin B2 production by such microorganisms.
We have found that this object is achieved by providing encoding nucleic acid sequences which are upregulated or downregulated in Ashbya gossypii during vitamin B2 production (based on results found with the aid of the MPSS analytical method described in detail in the experimental part), in particular a) a, preferably upregulated, nucleic acid sequence which codes for a protein having the function of a 26 S proteasome subunit or of a TAT binding homolog 7.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 28".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Ofigo 28v".
A first aspect of the present invention relates to a poiynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 1. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 4 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 28" and "Oligo 28~' have significant homologies with the MIPS tag "Yta7" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 4. The amino acid sequences derived therefrom have significant sequence homology with a 26 S proteasome subunit or a TAT-binding homolog 7 (TBP-7) from S. cerevisiae.
b) a, preferably upreguiated, nucleic acid sequence which codes for a protein having the function of a translation initiation factor subunit.
In a preferred embodiment there has been isolation according to the invention of a DNA
clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 45".

In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 45v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 6. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 10 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 45" and "Oligo 45~' have significant homologies with the MIPS tag "p39" or 'Tif34" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 6 or SEQ ID NO: 70. An amino acid sequence derived therefrom has significant sequence homology with a subunit (P39) of the translation initiation factor EiF3 (1F32) from S. cerevisiae.
c) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of a ribosomal protein.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 85".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of.the invention and which bears the internal name "Oligo 85v".
34 A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 12. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 14 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 85" and "Oligo 85v" have significant homologies with the MiPS tag "Rpl35a" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 12 or SEQ ID NO: 14. The amino acid sequence derived from the coding strand or amino acid part-sequence has significant sequence homology with a ribosomal protein from S. cerevisiae.
d) a, preferably upregulated, nucleic acid sequence codes for a protein having the function of a nucleolar protein.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 133".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 133v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 17. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 19 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 133" and "Oligo 133v" have significant homologies with the MIPS
tag "Nopl3" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 17 or SEQ iD NO: i9. The amino acid sequence or amino acid part-sequence derived from the corresponding complementary strand of SEQ ID NO: 17 or from the sequence shown in SEQ ID NO: 19 has significant sequence homology with a nucleolar protein from S. cerevisiae.
e) a, preferably upregulated, nucleic acid sequence which codes for a protein having the function of a translation initiation protein.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 172".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 172v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 21. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID N0: 24 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 172" and "Oligo 172' have significant homologies with the MIPS
tag "SuaS" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 21 or SEQ ID NO: 24. The amino acid sequence or amino acid part-sequence derived from the coding strand has significant sequence homology with a translation initiation protein from S. cerevisiae.
f) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of a precursor of ribosomal protein S 31.

In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 63", 5 In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 63v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic 10 acid sequence as shown in SEQ ID NO: 26. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 29 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucieotides through the degeneracy of the genetic code.
The inserts of "Oligo 63" and "Oligo 63v" have significant homologies with the MIPS tag "Rps25a" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 26 or SEQ ID NO: 29. The amino acid sequence or amino acid part-sequence derived from the corresponding complementary strand of SEQ ID NO: 26 or from the coding strand shown in SEQ ID NO: 29 has significant sequence homology with a precursor of the ribosomal protein S 31 from S. cerevisiae.
g) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of a cell nuclear pore protein.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 132".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 132'.
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 31. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ iD NO: 36 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 132" and "Oligo 132v" have significant homologies with the MIPS
tag "Nic96" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 31 or SEQ ID NO: 36. An amino acid sequence derived therefrom (corresponding to nucleotides 108 to 764 in SEQ ID NO: 31) has significant sequence homology with a cell nuclear pore protein from S. cerevisiae.
h) a, preferably upregulated, nucleic acid sequence which codes for a protein having the function of a constituent of the ADH-histone acetyltransferase complex.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 174".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 174v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 38. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 40 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 174" and "Oligo 174v" have significant homologies with the MIPS
tag "Ahc1" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 38 or SEQ ID NO: 40. The amino acid sequence or amino acid part-sequence derived from the corresponding complementary strand to SEQ ID NO: 38 or from the coding strand shown in SEQ ID NO: 40 has significant sequence homology with a constituent of the ADH-histone acetyltransferase complex from S, cerevisiae.
i) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of an RNA helicase involved in RNA processing.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 51 ".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 51 v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 42. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 46 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 51" and "Ofigo 51~' have significant homologies with the MIPS tag "Rok1" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 42 or SEQ ID NO: 46. The amino acid sequence derived from the corresponding complementary strand to SEQ ID NO: 42 or from the coding strand of SEQ ID NO: 46 have significant sequence homology with a S. cerevisiae RNA
helicase involved in RNA processing.
k) a, preferably upregulated, nucleic acid sequence which codes for a protein having the function of the non-essential constituent of RNA poll.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 30".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 30v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 48. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 51 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 30" and "Oligo 30~' have significant homologies with the MIPS tag "Rpa34" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 51. The amino acid sequences derived in each case from the coding strand have significant sequence homology with the non-essential constituent of RNA poll from S. cerevisiae.
I) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of an RNA helicase.

In a preferred embodiment of this aspect of the invention there has been isolation of 3 DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 124".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 124v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 53. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 56 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 124" and "Oligo 124v" have significant homologies with a MIPS tag "Sub2" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ iD NO: 53 or SEQ ID NO: 56. The amino acid sequence or amino acid part-sequence derived from the coding strand has significant sequence homology with an RNA helicase from S. cerevisiae.
m) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of an mRNA decapping enzyme.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 139".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 139v".

A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEO ID NO: 58. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 60 or a 5 fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
10 The inserts of "Oligo 139" and "Oligo 139' have significant homologies with the MIPS
tag "DCP1" from S. cerevisiae. The inserts having nucleic acid sequence as shown in SEQ ID NO: 58 or SEQ ID NO: 60. The amino acid sequence or amino acid part-sequence derived from the coding strand has significant sequence homology with an mRNA decapping enzyme from S. cerevisiae.
n) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of a subunit of the translation initiation factor eIF3.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 144".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 144v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 63. A further aspect of the invention relates to a polynuc(eotide comprising a nucleic acid sequence as shown in SEQ ID NO: 65 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 144" and "Oligo 144v" have significant homologies with the MIPS
tag "PRT1" from S. cerevisiae. The inserts have a nucleic acid sequence as shown in SEQ ID NO: 63 or SEQ !D NO: 65. The amino acid sequence or amino acid part-sequence derives from the coding strand as significant sequence homology with a subunit of the translation initiation factor eiF3 from S. cerevisiae.
o) a, preferably upregulated, nucleic acid sequence which codes for a protein having the function of a U3 small nucleolar ribonucleoprotein-substituted protein which is involved in preribosomal RNA processing.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 168".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 168v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 67. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ iD NO: 70 or a w fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A, gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 168" and "Oligo 168v" have significant homologies with the MIPS
tag "Rrp9" from S. cerevisiae. The inserts have the nucleic acid sequence as shown in SEQ ID N0: 67 or SEQ ID N0: 70. The amino acid sequence or amino acid part-sequence derived from the coding strand has significant sequence homology with a S. cerevisiae U3 small nucleolar ribonucleoprotein-associated protein which is involved in preribosomal RNA processing.
p) a, preferably downregulated, nucleic acid sequence which codes for a protein having the function of the ribosomal protein L7a.e.B of the large 60 S subunit.
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Oligo 160".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEa ID NO: 72, which can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotide complementary thereto; and to the sequences derived frarri these polynucleotides through the degeneracy of the genetic code.
The insert of "Oligo 160" has significant homologies with the MIPS tag "RplBb"
from S. cerevisiae. The insert has a nucleic acid sequence as shown in SEQ ID NO:
72. The amino acid sequence derived from the corresponding complementary strand has significant sequence homology with a ribosomal protein (L7a.e.B; large 60S
subunit) from S. cerevisiae.
q) We have found that this object is achieved by providing an encoding nucleic acid sequence which is unregulated in Ashbya gossypii during vitamin B2 production (based on results found with the aid of the MPSS analytical method described in detail in the experimental part).
In a preferred embodiment of this aspect of the invention there has been isolation of a DNA clone which codes for a characteristic part-sequence of the nucleic acid sequence of the invention and which bears the internal name "Ofigo 18".
In a further preferred embodiment there has been isolation according to the invention of a DNA clone which codes for the complete sequence of the nucleic acid of the invention and which bears the internal name "Oligo 18v".
A first aspect of the present invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 75 or the polynucleotide complementary thereto as shown in SEQ ID NO: 74. A further aspect of the invention relates to a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 77 or a fragment thereof. The polynucleotides can be isolated preferably from a microorganism of the genus Ashbya, in particular A. gossypii. The invention additionally relates to the polynucleotides complementary thereto; and to the sequences derived from these polynucleotides through the degeneracy of the genetic code.
A further aspect of the invention relates to oligonucleotides which hybridize with one of the above polynucleotides, in particular under stringent conditions.
The invention additionally relates to polynucleotides which hybridize with one of the oligonucleotides of the invention and code for a gene product from microorganisms of the genus Ashbya or a functional equivalent of this gene product.
The invention further relates to polypeptides or proteins which are encoded by the polynucleotides described above; and to peptide fragments thereof which have an amino acid sequence which comprises at least 10 consecutive amino acid residues as shown in SEQ ID NO: 2, 3, 5, 7, 8, 9, 11, 13, 15, 16, 18, 20, 22, 23, 25, 27, 28, 30, 32, 33, 34, 35, 37, 39, 41, 43, 44, 45, 47, 49, 50, 52, 54, 55, 57, 59, 61, 62, 64, 66, 68, 69, 71, 73, 76, or SEQ ID NO: 78; and to functional equivalents of the polypeptides or proteins of the invention.
In this connection, functional equivalents differ from the products specifically disclosed in the invention by their amino acid sequence through addition, insertion, substitution, deletion or inversion at a minimum of one, such as, for example, 1 to 30 or 1 to 20 or 1 to 10, sequence positions without the originally observed protein function, which can be deduced by sequence comparison with other proteins, being lost. It is thus possible for equivalents to have essentially identical, higher or lower activities compared with the native protein.
Further aspects of the invention relate to expression cassettes for the recombinant production of proteins of the invention, comprising one of the nucleic acid sequences defined above, operatively linked to at least one regulatory nucleic acid sequence; and to recombinant vectors comprising at least one such expression cassette of the invention.
Also provided according to the invention are prokaryotic or eukaryotic hosts which are transformed with at least one vector of the above type. A preferred embodiment provides prokaryotic or eukaryotic hosts in which the functional expression of at least one gene which codes for a polypeptide of the invention as defined above is modulated (e.g. inhibited or overexpressed}; or in which the biological activity of a polypeptide as defined above is reduced or increased. Preferred hosts are selected from ascomycetes, in particular those of the genus Ashbya and preferably strains of A. gossypii.
Modulation of gene expression in the above sense includes both inhibition thereof, for example through blockade of a stage in expression (in particular transcription or translation) or a specific overexpression of a gene (for example through modification of regulatory sequences or increasing the copy number of the coding sequence}.
A further aspect of the invention relates to the use of an expression cassette of the invention, of a vector of the invention or of a host of the invention for the microbiological production of vitamin B2 andlor precursors and/or derivatives thereof.
A further aspect of the invention relates to the use of an expression cassette of the invention, of a vector of the invention or of a host of the invention for the recombinant production of a polypeptide of the invention as defined above.
Also provided according to the invention is a method for detecting or for validating an effector target for modulating the microbiological production of vitamin B2 andlor precursors and/or derivatives thereof. This entails treating a microorganism capable of the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof with an effector which interacts with (such as, for example, non-covalentiy binds to) a target selected from a pofypeptide of the invention as defined above or a nucleic 5 acid sequence coding therefor, validating the influence of the effector on the amount of the microbiologically produced vitamin B2 and/or of the precursor and/or of a derivative thereof; and isolating the target where appropriate. The validation in this case takes place preferably by direct comparison with the microbiological vitamin production in the absence of the effector under otherwise identical conditions.
A further aspect of the invention relates to a method for modulating (in relation to the amount and/or rate of) the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof, where a microorganism capable of the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof is treated with an effector which interacts with a target selected from a polypeptide of the invention as defined above or a nucleic acid sequence coding therefor.
Preferred examples of the abovementioned effectors which should be mentioned are:
a) antibodies or antigen-binding fragments thereof;
b) polypeptide ligands which are different from a) and which interact with a polypeptide of the invention;
c) low molecular weight effectors which modulate the biological activity of a polypeptide of the invention;
d) antisense nucleic acid sequences which interact with a nucleic acid sequence of the invention.
The invention likewise relates to the abovementioned effectors having specificity for at least one of the targets, according to the invention, defined above.
A further aspect of the invention relates to a method for the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof, where a host as defined above is cultivated under conditions favoring the production of vitamin B2 and/or precursors and/or derivatives thereof, and the desired products) is(are) isolated from the culture mixture. It is preferred in this connection that the host is treated with an effector as defined above before and/or during the cultivation. A preferred host is in this case selected from microorganisms of the genus Ashbya; in particular transformed as described above.
A final aspect of the invention relates to the use of a polynucleotide or polypeptide of the invention as target for modulating the production of vitamin B2 and/or precursors and/or derivatives thereof in a microorganism of the genus Ashbya.
Description of the figures:
Figure 1 shows an alignment between an amino acid sequence of the invention based on SEQ ID NO: 5 (middle sequence) and a part-sequence of the MIPS tag "Yta7"
from S. cerevisiae (lower sequence). The consensus sequence is depicted above these two.
Positions lacking homology are symbolized by black rectangles.
Figure 2 shows an alignment between an amino acid sequence of the invention based on SEQ ID NO: 11 (middle sequence) and a part-sequence of the MIPS tag 'Tif34"
from S. cerevisiae (lower sequence). The consensus sequence is depicted above these two.
Positions lacking homology are symbolized by black rectangles.
Figure 3 shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 469 to 825 in SEQ ID NO: 12 (upper sequence) and a part-sequence of the MIPS tag "Rpl25a" from S. cerevisiae (lower sequence) Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 4 shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand at position 114 to 1 in SE4 ID NO:

(upper sequence) and a part-sequence of the MIPS tag "Nopl3" from S.
cerevisiae (lower sequence). identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 5A shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 2 to 349 in SEQ ID NO: 21 ) (upper sequence) and a part-sequence of the MIPS tag "SuaS" from S. cerevisiae (lower sequence).
Figure 5B shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 336 to 947 in SEQ ID NO: 21 ) (upper sequence) and a part-sequence of the MIPS tag "SuaS" from S. cerevisiae (lower sequence).
Figure 6A shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand to position 609 to 562 in SEQ ID
NO: 26) (upper sequence) and a part-sequence of the MIPS tag "Rps25a" from S.
cerevisiae (lower sequence). Figure 6B shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand to position 556 to 401 in SEQ ID NO: 26) (upper sequence) and a part-sequence of the MIPS tag "SuaS"
from S, cerevisiae (lower sequence). Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 7 shows an alignment between an amino acid sequence of the invention based on SEQ ID NO: 36 (middle sequence) and a part-sequence of the MIPS tag "Nic96"
from S. cerevisiae (lower sequence). The consensus sequence is depicted above these two. Positions lacking homology are symbolized by black rectangles.
Figure 8 shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand at position 174 to 1 in SEQ ID NO:
38) (upper sequence) and a part-sequence of the MiPS tag "Ahc1" from S, cerevisiae (lower sequence). Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 9A shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand to position 1086 to 1012 in SEQ ID

N0:42) (upper sequence) and a part-sequence of the MiPS tag "Rok1" from S. cerevisiae (lower sequence). Figure 9B shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand to position 1022 to 915 in SEQ ID NO: 42) (upper sequence) and a part-sequence of the MIPS
tag "Rok1" from S. cerevisiae (lower sequence). Figure 9C shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand to position 925 to 689 in SEQ ID NO: 42) (upper sequence) and a part-sequence of the MIPS tag "Rok1" from S. cerevisiae (lower sequence). Identical sequence positions are in each case indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 1 OA shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 1 to 102 in SEQ ID NO: 48) (upper sequence) and a part-sequence of the MIPS tag "Rpa43" from S. cerevisiae (lower sequence).
Figure 10B shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 122 to 400 in SEQ ID NO: 48) (upper sequence) and a part-sequence of the MIPS tag "Rpa43" from S. cerevisiae (lower sequence). Identical sequence positions are indicated between the two sequences.
Similar sequence positions are labeled with "+". Figure 10C shows the coding part-sequence as shown in SEQ ID NO: 48 and the part-sequence complementary thereto.
Figure 11 A shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 2 to 148 in SEQ IS NO: 53) (upper sequence) and a part-sequence of the MIPS tag "Sub2" from S. cerevisiae (lower sequence).
Figure 11 B shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 150 to 185 in SEQ IS NO: 53) (upper sequence) and a part-sequence of the MIPS tag "Sub2" from S. cerevisiae (lower sequence).
Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 12 shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 2 to 82 in SEQ ID NO: 58 (upper sequence) and a part-sequence of the MIPS tag "DCP1" from S. cerevisiae (lower sequence).
Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 13 shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 21 to 695 in SEQ ID NO: 63) (upper sequence) and a part-sequence of the MIPS tag "PRT1" from S. cerevisiae (lower sequence).
Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 14A shows an al'~nment between an amino acid part-sequence of the invention (corresponding to the strand at position 1 to 111 in SEQ ID NO: 67) (upper sequence) and a part-sequence of the MIPS tag "Rrp9" from S. cerevisiae (lower sequence).
Figure 14B shows an alignment between an amino acid part-sequence of the invention (corresponding to the strand at position 144 to 887 in SEQ ID NO: 67) (upper sequence) and a part-sequence of the MIPS tag "Rrp9" from S. cerevisiae (lower sequence). Identical sequence positions are indicated between the two sequences.
Similar sequence positions are labeled with "+".
Figure 15 shows an alignment between an amino acid part-sequence of the invention (corresponding to the complementary strand at position 508 to 176 in SEQ ID
NO: 72) (upper sequence) and a part-sequence of the MIPS tag "Rpl8b" from S.
cerevisiae (lower sequence). Identical sequence positions are indicated between the two sequences. Similar sequence positions are labeled with "+".
Figure 16 shows the construction scheme for inserting an antibiotic resistance cassette (G418 resistance gene under the control of the Ashbya TEF promoter) behind the open reading frame (ORF) shown for "Oligo 18".
Detailed descriation of the invention:
The nucleic acid molecules of the invention encode polypeptides or proteins which are referred to here as proteins of the transcription, RNA processing and/or translation (for example with activity in relation to transcription, RNA processing, splicing or translation) or for short as "TT proteins". These TT proteins have, for example, a function in the adaptation to various growth phases and environmental and metabolic conditions such 5 as substrates, oxygen level and the like.
Owing to the availability of cloning vectors which can be used in Ashbya gossypii, as disclosed, for example, in W right and Philipsen (1991 ) Gene, 109, 99-105, and of techniques for genetic manipulation of A, gossypii and the related yeast species, the 10 nucleic acid molecules of the invention can be used for genetic manipulation of these organisms, in particular of A. gossypii, in order to make them better and more efficient producers of vitamin B2 and/or precursors and/or derivatives thereof. This improved production or efficiency may result from a direct effect of the manipulation of a gene of the invention or result from an indirect effect of such a manipulation.
The present invention is based on the provision of novel molecules which are referred to here as TT nucleic acids and TT proteins and are involved in the transcription, RNA
processing and/or translation, in particular in Ashbya gossypii (e.g. in the regulation of transcription, RNA processing and/or translation). The activity of the TT
molecules of the invention in A. gossypii influences vitamin B2 production by this organism. The activity of the TT molecules of the invention is preferably modulated so that the metabolic and/or energy pathways of A. gossypii in which the TT proteins of the invention are involved are modulated in relation to the yield, production and/or efficiency of vitamin B2 production, which modulates either directly or indirectly the yield, production and/or efficiency of vitamin B2 production in A, gossypii.
The nucleic acid sequences provided by the invention can be isolated, for example, from the genome of an Ashbya gossypii strain which is freely available from the American Type Culture Collection under the number ATCC 10895.

Improvement in vitamin B2 production:

There is a number of possible mechanisms by which the yield, production and/or efficiency of production of vitamin B2 by an A. gossypii strain can be influenced directly through changing the amount and/or activity of a TT protein of the invention.
Thus, a more efficient transcription, RNA processing or translation, which adapts expression of the desired gene products to the external conditions, can achieve optimization of the formation of the desired products of value.
Mutagenesis of one or more TT proteins of the invention may also lead to TT
proteins with altered (increased or reduced) activities which influence indirectly the production of the required product from A. gossypii. It is possible, for example, with the aid of the TT proteins for the progress of transcription, RNA processing and/or translation to be assisted (e.g by activators) or blocked (e.g. by repressors) at various points, and thus gene expression or protein synthesis to be influenced. The yield of target product can thus be increased or optimized in relation to external conditions.
Polvaeptides The invention relates to polypeptides which comprise the abovementioned amino acid sequences or characteristic part-sequences thereof and/or are encoded by the nucleic acid sequences described herein.
The invention likewise encompasses "functional equivalents" of the specifically disclosed novel polypeptides.
"Functional equivalents" or analogs of the specifically disclosed poiypeptides are for the purposes of the present invention polypeptides which differ therefrom but which still have the desired biological activity (such as, for example, substrate specificity).
"Functional equivalents" mean according to the invention in particular mutants which have in at least one of the abovementioned sequence positions an amino acid which differs from that specifically mentioned but nevertheless have one of the abovementioned biological activities. "Functional equivalents" thus comprise the mutants obtainable by one or more amino acid additions, substitutions, deletions andJ
or inversions, it being possible for said modifications to occur in any sequence position as long as they lead to a mutant having the profile of properties of the invention.
Functional equivalence exists in particular also when there is qualitative agreement between mutant and unmodified polypeptide in the reactivity pattern, i.e.
there are differences in the rate of conversion of identical substrates, for example.
"Functional equivalents" in the above sense are also precursors of the polypeptides described, and functional derivatives and salts of the polypeptides. The term "salts"
means both salts of carboxyl groups and acid addition salts of amino groups in the protein molecules of the invention. Salts of carboxyl groups can be prepared in a manner known per se and comprise inorganic salts such as, for example, sodium, calcium, ammonium, iron and zinc salts, and salts with organic bases such as, for example, amines such as triethanolamine, arginine, lysine, piperidine and the like. Acid addition salts such as, for example, salts with mineral acids such as hydrochloric acid or sulfuric acid and salts with organic acids such as acetic acid and oxalic acid are also an aspect of the invention.
"Functional derivatives" of poiypeptides of the invention can also be prepared at functional amino acid side groups or at their N- or C-terminal end by known techniques.
Such derivatives include, for example, aliphatic esters of carboxyl groups, amides of carboxyl groups obtainable by reaction with ammonia or with a primary or secondary amine; N-acyl derivatives of free amino groups prepared by reaction with acyl groups;
or O-acyl derivatives of free hydroxyl groups prepared by reaction with acyl groups.
"Functional equivalents" naturally also comprise polypeptides which are obtainable from other organisms, and naturally occurring variants. For example homologous sequence regions can be found by sequence comparison, and equivalent enzymes can be established on the basis of the specific requirements of the invention.

"Functional equivalents" likewise comprise fragments, preferably single domains or sequence motifs, of the polypeptides of the invention, which have, for example, the desired biological function.
"Functional equivalents" are additionally fusion proteins which have one of the abovementioned polypeptide sequences or functional equivalents derived therefrom and at least one other heterologous sequence functionally different therefrom in functional N- or C-terminal linkage (i.e. with negligible mutual impairment of the functions of the parts of the fusion proteins). Nonlimiting examples of such heterologous sequences are, for example, signal peptides, enzymes, immunoglobulins, surface antigens, receptors or receptor ligands.
"Functional equivalents" include according to the invention homologs of the specifically disclosed proteins. These have at least 60%, preferably at least 75%, in particular at least 85%, such as, for example, 90%, 95% or 99%, homology to one of the specifically disclosed sequences, calculated by the algorithm of Pearson and Lipman, Proc.
Natl.
Acad. Sci. (USA) 85(8), 1988, 2444-2448.
In the case where protein glycosylation is possible, equivalents of the invention include proteins of the type defined above in deglycosylated or glycosylated form, and modified forms obtainable by altering the glycosyfation pattern.
Homologs of the proteins or polypeptides of the invention can be generated by mutagenesis, for example by point mutation or truncation of the protein. The term "homolog" as used here relates to a variant form of the protein which acts as agonist or antagonist of the protein activity.
Homologs of the proteins of the invention can be identified by screening combinatorial libraries of mutants such as, for example, truncation mutants. It is possible, for example, to generate a variegated library of protein variants by combinatorial mutagenesis at the nucleic acid level, such as, for example, by enzymatic figation of a mixture of synthetic ofigonucleotides. There is a large number of methods which can be used to produce libraries of potential homologs from a degenerate oligonucleotide sequence.
Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA
synthesizer, and the synthetic gene can then be ligated into a suitable expression vector. The use of a degenerate set of genes makes it possible to provide all sequences which encode the desired set of potential protein sequences in one mixture.
Methods for synthesizing degenerate oligonucleotides are known to the skilled worker (for example Narang, S.A. (1983) Tetrahedron 39:3; Itakura et a1. (1984) Annu. Rev.
Biochem. 53:323; ltakura et al., (1984) Science 198:1056; lke et al. (1983) Nucleic Acids Res. 11:477).
In addition, libraries of fragments of the protein codon can be used to generate a variegated population of protein fragments for screening and for subsequent selection of homologs of a protein of the invention. In one embodiment, a library of coding sequence fragments can be generated by treating a double-stranded PCR fragment of a coding sequence with a nuclease under conditions under which nicking takes place only about once per molecule, denaturing the double-stranded DNA, renaturing the DNA to form double-stranded DNA, which may comprise sense/antisense pairs of different nicked products, removing single-stranded sections from newly formed duplices by treatment with S1 nuclease and ligating the resulting fragment library into an expression vector. It is possible by this method to derive an expression library which encodes N-terminal, C-terminal and internal fragments having different sizes of the protein of the invention.
Several techniques are known in the prior art for screening gene products from combinatorial libraries which have been produced by point mutations or truncation and for screening cDNA libraries for gene products with a selected property. These techniques can be adapted to rapid screening of gene libraries which have been generated by combinatorial mutagenesis of homologs of the invention. The most frequently used techniques for screening large gene libraries undergoing high-throughput analysis comprise the cloning of the gene library into replicable expression vectors, transformation of suitable cells with the resulting vector library and expression of the combinatorial genes under conditions under which detection of the required activity facilitates isolation of the vector which encodes the gene whose product has been detected. Recursive ensemble mutagenesis (REM), a technique which increases the frequency of functional mutants in the libraries, can be used in combination with the screening tests for identifying homologs (Arkin and Yourvan (1992) PNAS
89:7811-5 7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).
Recombinant preparation of the polypeptides of the invention is possible (see following sections) or they can be isolated in native form from microorganisms, especially those of the genus Ashbya, by use of conventional biochemical techniques (see Cooper, T.G., 10 Biochemische Arbeitsmethoden, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
Nucleic acid seauences:

15 The invention also relates to nucleic acid sequences (single- and double-stranded DNA
and RNA sequences such as, for example, cDNA and mRNA), coding for one of the above polypeptides and their functional equivalents which are obtainable, for example, by use of artificial nucleotide analogs.
20 The invention relates both to isolated nucleic acid molecules which code for polypeptides or proteins of the invention or biologically active sections thereof, and to nucleic acid fragments which can be used, for example, for use as hybridization probes or primers for identifying or amplifying coding nucleic acids of the invention.
25 The nucleic acid molecules of the invention may additionally comprise untranslated sequences from the 3' and/or 5' end of the coding region of the gene.
An "isolated" nucleic acid molecule is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid and may moreover be 30 essentially free of other cellular material or culture medium if it is produced by recombinant techniques, or free of chemical precursors or other chemicals if it is chemically synthesized.

A nucleic acid molecule of the invention can be isolated by using standard techniques of molecular biology and the sequence information provided according to the invention.
For example, cDNA can be isolated from a suitable cDNA library by using one of the specifically disclosed complete sequences or a section thereof as hybridization probe and standard hybridization techniques (as described, for example, in Sambrook, J., Fritsch, E.F, and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). It is moreover possible for a nucleic acid molecule comprising one of the disclosed sequences or a section thereof to be isolated by polymerase chain reaction using the oligonucleotide primers constructed on the basis of this sequence.
The nucleic acid amplified in this way can be cloned into a suitable vector and be characterized by DNA sequence analysis. The oligonucleotides of the invention which correspond to a TT nucleotide sequence can also be produced by standard synthetic methods, for example using an automatic DNA synthesizer.
The invention additionally comprises the nucleic acid molecules which are complementary to the specifically described nucleotide sequences, or a section thereof.
The nucleotide sequences of the invention make it possible to generate probes and primers which can be used for identifying and/or cloning homologous sequences in other cell types and organisms. Such probes and primers usually comprise a nucleotide sequence region which hybridizes under stringent conditions onto at least about 12, preferably at least about 25, such as, for example, 40, 50 or 75, consecutive nucleotides of a sense strand of a nucleic acid sequence of the invention or a corresponding antisense strand.
Further nucleic acid sequences of the invention are derived from SEQ 1D NO: 1, 4, 6, 10, 12, 14, 17, 19, 21, 24, 26, 29, 31, 36, 38, 40, 42, 46, 48, 5 i , 53, 56, 58, 60, 63, 65, 67, 70, 72, 74, 75, or SEQ ID NO: 77 and differ therefrom through addition, substitution, insertion or deletion of one or more nucleotides, but still code for polypeptides having the desired profile of properties.

The invention also encompasses nucleic acid sequences which comprise so-called silent mutations or are modified, by comparison with a specifically mentioned sequence, in accordance with the codon usage of a specific source or host organism, as well as naturally occurring variants such as, far example, splice variants or allelic variants, thereof. It likewise relates to sequences which are obtainable by conservative nucleotide substitutions (i.e. the relevant amino acid is replaced by an amino acid with the same charge, size, polarity and/or solubility).
The invention also relates to molecules derived from the specifically disclosed nucleic acids through sequence polymorphisms. These genetic polymorphisms may exist because of the natural variation between individuals within a population.
These natural variations normally result in a variance of from 1 to 5% in the nucleotide sequence of a gene.
The invention additionally encompasses nucleic acid sequences which hybridize with or are complementary to the abovementioned coding sequences. These polynucleotides can be found on screening of genomic or cDNA libraries and, where appropriate, be amplified therefrom by means of PCR using suitable primers, and then, for example, be isolated with suitable probes. Another possibility is to transform suitable microorganisms with polynucleotides or vectors of the invention, multiply the microorganisms and thus the polynucleotides, and then isolate them. An additional possibility is to synthesize polynucleotides of the invention by chemical routes.
The property of being able to "hybridize" onto polynucleotides means the ability of a polynucleotide or oligonucleotide to bind under stringent conditions to an almost complementary sequence, while there are no nonspecific bindings between noncomplementary partners under these conditions. For this purpose, the sequences should be 70-100%, preferably 90-100%, complementary. The property of complementary sequences being able to bind specifically to one another is made use of, for example, in the Northern or Southern blot technique or in PCR or RT-PCR in the case of primer binding. Oligonucleotides with a length of 30 base pairs or more are normally employed for this purpose. Stringent conditions mean, for example, in the Northern blot technique the use of a washing solution at 50 - 70°C, preferably 60 -65°C, for example 0.1 x SSC buffer with 0.1 % SDS (20x SSC: 3M NaCI, 0.3M Na citrate, pH 7.0) for eluting nonspecifically hybridized cDNA probes or oligonucleotides. In this case, as mentioned above, only nucleic acids with a high degree of complementarity remain bound to one another. The setting up of stringent conditions is known to the skilled worker and is described, for example, in Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
A further aspect of the invention relates to antisense nucleic acids. This comprises a nucleotide sequence which is complementary to a coding sense nucleic acid. The antisense nucleic acid may be complementary to the entire coding strand or only to a section thereof. In a further embodiment, the antisense nucleic acid molecule is antisense to a noncoding region of the coding strand of a nucleotide sequence.
The term "noncoding region" relates to the sequence sections which are referred to as 5'-and 3'-untranslated regions.
An antisense oligonucleotide may be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides long. An antisense nucleic acid of the invention can be constructed by chemical synthesis and enzymatic ligation reactions using methods known in the art.
An antisense nucleic acid can be synthesized chemically, using naturally occurring nucleotides or variously modified nucleotides which are configured so that they increase the biological stability of the molecules or increase the physical stability of the duplex formed between the antisense and sense nucleic acids. Examples which can be used are phosphorothioate derivatives and acridine-substituted nucleotides.
Examples of modified nucleosides which can be used for generating the antisense nucleic acid are, inter alia, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethyl-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueuosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methyl-inosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueuosine, 5-methoxycarboxy-methyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate, 3-(3-amino-3-carboxypropyl)uracil, (acp3)w and 2,6-diaminopurine. The antisense nucleic acid may also be produced biologically by using an expression vector into which a nucleic acid has been subcloned in the antisense direction.
The antisense nucleic acid molecules of the invention are normally administered to a cell or generated in situ so that they hybridize with the cellular mRNA and/or a coding DNA or bind thereto, so that expression of the protein is inhibited for example by inhibition of transcription and/or translation.
The antisense molecule can be modified so that it binds specifically to a receptor or to an antigen which is expressed on a selected cell surface, for example through linkage of the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be administered to cells by using the vectors described herein. The vector constructs preferred for achieving adequate intracellular concentrations of the antisense molecules are those in which the antisense nucleic acid molecule is under the control of a strong bacterial, viral or eukaryotic promoter.
In a further embodiment, the antisense nucleic acid molecule of the invention is an alpha-anomeric nucleic acid molecule. An alpha-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA, with the strands running parallel to one another, in contrast to normal alpha units (Gaultier et al., (1987) Nucleic Acids Res. 15:6625-6641 ). The antisense nucleic acid molecule may additionally comprise a 2'-O-methylribonucleotide (Inoue et al., (1987) Nucleic Acids Res.
15:6131-6148) or a chimeric RNA-DNA analog (Inoue et al. (1987) FEES Lett. 215:327-330).
The invention also relates to ribozymes. These are catalytic RNA molecules with ribonuclease activity which are able to cleave a single-stranded nucleic acid such as an mRNA to which they have a complementary region. It is thus possible to use ribozymes (for example hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591 )) for the catalytic cleavage of transcripts of the invention in order thereby to inhibit the translation of the corresponding nucleic acid. A
ribozyme with 5 specificity for a coding nucleic acid of the invention can be formed, for example, an the basis of a cDNA specifically disclosed herein. For example a derivative of a tetrahymena-L-i 9 IVS RNA can be constructed, with the nucleotide sequence of the active site being complementary to the nucleotide sequence to be cleaved in a coding mRNA of the invention. (Compare, for example, US-A-4 987 071 and US-A-5 116 742).
10 Alternatively, mRNA can be used for selecting a catalytic RNA with specific ribonuclease activity from a pool of RNA molecules (see, for example, Bartel, D., and Szostak, J.W. (1993) Science 261:1411-1418).
Gene expression of sequences of the invention can alternatively be inhibited by 15 targeting nucleotide sequences which are complementary to the regulatory region of a nucleotide sequence of the invention (for example to a promoter and/or enhancer of a coding sequence) so that there is formation of triple helix structures which prevent transcription of the corresponding gene in target cells (Helene, C. (1991) Anticancer Drug Res. 6(6) 569-584; Helene, C. et al., (1992) Ann. N. Y. Acad. Sci. 660:27-36; and 20 Maher., L.J. (1992) Bioassays 14(12):807-815).
Expression constructs and vectors:
The invention additionally relates to expression constructs comprising, under the 25 genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide of the invention; and to vectors comprising at least one of these expression constructs. Such constructs of the invention preferably comprise a promoter 5'-upstream from the particular coding sequence, and a terminator sequence 3'-downstream, and, where appropriate, other usual regulatory elements, in particular 30 each operatively linked to the coding sequence. "Operative linkage" means the sequential arrangement of promoter, coding sequence, terminator and, where appropriate, other regulatory elements in such a way that each of the regulatory elements is able to comply with its function as intended for expression of the coding sequence. Examples of sequences which can be operatively linked are targeting sequences and enhancers, polyadenylation signals and the like. Other regulatory elements comprise selectable markers, amplification signals, origins of replication and the like. Suitable regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA
(1990).
In addition to the artificial regulatory sequences it is possible for the natural regulatory sequence still to be present in front of the actual structural gene. This natural regulation can, where appropriate, be switched off by genetic modification, and expression of the genes can be increased or decreased. The gene construct can, however, also have a simpler structure, that is to say no additional regulatory signals are inserted in front of the structural gene, and the natural promoter with its regulation is not deleted. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place, and gene expression is enhanced or diminished. The nucleic acid sequences may be present in one or more copies in the gene construct.
Examples of promoters which can be used are: cos, tac, trp, tet, trp-let, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, ~.-PR or ~.-PL. promoter, which are advantageously used in Gram-negative bacteria; and the Gram-positive promoters amy and SP02, the yeast promoters ADC1, MFa, AC, P-60, CYC1, GAPDH or the plant promoters CaMV/35S, SSU, OCS, lib4, usp, STLS1, B33, not or the ubiquitin or phaseolin promoter. The use of inducible promoters is particularly preferred, such as, for example, light- and, in particular, temperature-inducible promoters such as the PAP, promoter. It is possible in principle for all natural promoters with their regulatory sequences to be used. In addition, it is also possible advantageously to use synthetic promoters.
Said regulatory sequences are intended to make specific expression of the nucleic acid sequences possible. This may mean, for example, depending on the host organism, that the gene is expressed or overexpressed only after induction or that it is immediately expressed and/or overexpressed.

The regulatory sequences or factors may moreover preferably influence positively, and thus increase or reduce, expression. Thus, enhancement of the regulatory elements can take place advantageously at the level of transcription by using strong transcription signals such as promoters and/or enhancers. However, it is also possible to enhance translation by, for example, improving the stability of the mRNA.
An expression cassette is produced by fusing a suitable promoter to a suitable nucleotide sequence of the invention and to a terminator signal or polyadenylation signal. Conventional techniques of recombination and cloning are used for this purpose, as described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
(1982) and in T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc.
and Wiley Interscience (1987).
For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector, which makes optimal expression of the genes in the host possible. Vectors are welt known to the skilled worker and can be found, for example, in "Cloning Vectors" (Pouwels P.
H. et al., eds, Elsevier, Amsterdam-New York-Oxford, 1985). Vectors also mean not only plasmids but also all other vectors known to the skilled worker, such as, for example, phages, viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS
elements, phasmids, cosmids, and linear or circular DNA. These vectors may undergo autonomous replication in the host organism or chromosomal replication.
Examples of suitable expression vectors which may be mentioned are:
Conventional fusion expression vectors such as pGEX (Pharmacia Biotech lnc;
Smith, D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRiT 5 (Pharmacia, Piscataway, NJ), with which respectively glutathione S-transferase (GST), maltose E-binding protein and protein A are fused to the recombinant target protein.
Non-fusion protein expression vectors such as pTrc (Amann et ai., (1988) Gene 69:301-315) and pET 1 i d (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89).
Yeast expression vector for expression in the yeast S. cerevisiae, such as pYepSecl (Baldari et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:i 13-123) and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods for constructing vectors suitable for the use in other fungi such as filamentous fungi comprise those which are described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991 ) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F.
Peberdy et al., eds, pp. 1-28, Cambridge University Press: Cambridge.
Baculovirus vectors which are available for expression of proteins in cultured insect cells (for example Sf9 cells) comprise the pAc series (Smith et al., (1983) Mol. Cell Biol.
3:2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170:31-39).
Plant expression vectors such as those described in detail in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20:1195-1197; and Bevan, M.W.
(1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res.
12:8711-8721.
Mammalian expression vectors such as pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC (Kaufman et ai. (1987) EMBO J. 6:187-195).
Further suitable expression systems for prokaryotic and eukaryotic cells are described in chapters 16 and 17 of Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular cloning:

A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Coid Spring Harbor, NY, 1989.
Recombinant microorganisms:
The vectors of the invention can be used to produce recombinant microorganisms which are transformed, for example, with at least one vector of the invention and can be employed for producing the pofypeptides of the invention. The recombinant constructs of the invention described above are advantageously introduced and expressed in a suitable host system. Cloning and transfection methods familiar to the skilled worker, such as, for example, coprecipitation, protoplast fusion, eiectroporation, retroviral transfection and the like, are preferably used to bring about expression of said nucleic acids in the particular expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., eds, Wlley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A
Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
It is also possible according to the invention to produce homologously recombined microorganisms. This entails production of a vector which contains at least one section of a gene of the invention or a coding sequence, in which, where appropriate, at least one amino acid deletion, addition or substitution has been introduced in order to modify, for example functionally disrupt, the sequence of the invention (knockout vector). The introduced sequence may, for example, also be a homolog from a related microorganism or be derived from a mammalian, yeast or insect source. The vector used for homologous recombination may alternatively be designed so that the endogenous gene is mutated or otherwise modified during the homologous recombination but still encodes the functional protein (for example the regulatory region located upstream may be modified in such a way that this modifies expression of the endogenous protein). The modified section of the TT gene is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is, for example, described in Thomas, K.R. and Capecchi, M.R.
(1987) Cell 51:503.
Suitable host organisms are in principle all organisms which enable expression of the nucleic acids of the invention, their allelic variants, their functional equivalents or 5 derivatives. Host organisms mean, for example, bacteria, fungi, yeasts, plant or animal cells. Preferred organisms are bacteria, such as those of the genera Escherichia, such as, for example, Escherichia coli, Streptomyces, Bacillus or Pseudomonas, eukaryotic microorganisms such as Saccharomyces cerevisiae, Aspergillus, higher eukaryotic cells from animals or plants, for example Sf9 or CHO cells. Preferred organisms are selected 10 from the genus Ashbya, in particular from A. gossypii strains.
Successfully transformed organisms can be selected through marker genes which are likewise present in the vector or in the expression cassette. Examples of such marker genes are genes for antibiotic resistance and for enzymes which catalyze a color-15 forming reaction which causes staining of the transformed cell. These can then be selected by automatic cell sorting. Microorganisms which have been successfully transformed with a vector and harbor an appropriate antibiotic resistance gene (for example 6418 or hygromycin) can be selected by appropriate antibiotic-containing media or nutrient media. Marker proteins present on the surface of the cell can be used 20 for selection by means of affinity chromatography.
The combination of the host organisms and the vectors appropriate for the organisms, such as plasmids, viruses or phages, such as, for example, plasmids with the RNA
polymerase/promoter system, phages ~, or w or other temperate phages or transposons 25 and/or other advantageous regulatory sequences forms an expression system.
The term "expression system" means, for example, the combination of mammalian cells, such as CHO cells, and vectors, such as pcDNA3neo vector, which are suitable for mammalian cells.
30 If desired, the gene product can also be expressed in transgenic organisms such as transgenic animals such as, in particular, mice, sheep or transgenic plants.

Recombinant production of the pol~peptides:
The invention further relates to methods for the recombinant production of a polypeptide of the invention or functional, biologically active fragments thereof, wherein a polypeptide-producing microorganism is cultured, expression of the polypeptides is induced where appropriate, and they are isolated from the culture. The polypeptides can also be produced on the industrial scale in this way if desired.
The recombinant microorganism can be cultured and fermented by known methods.
Bacteria can be grown, for example, in TB or LB medium and at a temperature of to 40°C and a pH of from 6 to 9. Details of suitable culturing conditions are described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning:
A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
(1982).
If the polypeptides are not secreted into the culture medium, the cells are then disrupted and the product is obtained from the lysate by known protein isolation methods. The cells may alternatively be disrupted by high-frequency ultrasound, by high pressure, such as, for example, in a French pressure cell, by osmolysis, by the action of detergents, fytic enzymes or organic solvents, by homogenizers or by a combination of a plurality of the methods mentioned.
The polypeptides can be purified by known chromatographic methods such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and by other usual methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, T.G., Biochemische Arbeitsmethoden, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
It is particularly advantageous for isolation of the recombinant protein to use vector systems or oligonucleotides which extend the cDNA by particular nucleotide sequences and thus code for modified polypeptides or fusion proteins which serve, for example, for simpler purification. Suitable modifications of this type are, for example, so-called tags which act as anchors, such as, for example, the modification known as hexa-histidine anchor, or epitopes which can be recognized as antigens by antibodies (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A
Laboratory Manual. Cold Spring Harbor (N.Y.) Press). These anchors can be used to attach the proteins to a solid support, such as, for example, a polymer matrix, which can, for example, be packed into a chromatography column, or can be used on a microtiter plate or another support.
These anchors can at the same time also be used for recognition of the proteins. It is also possible to use for recognition of the proteins conventional markers such as fluorescent dyes, enzyme markers which form a detectable reaction product after reaction with a substrate, or radioactive labels, alone or in combination with the anchors for derivatizing the proteins.
The invention additionally relates to a method for the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof.
If the conversion is carried out with a recombinant microorganism, the microorganisms are preferably initially cultured in the presence of oxygen and in a complex medium, such as, for example, at a culturing temperature of about 20°C or more, and at a pH of about 6 to 9 until an adequate cell density is reached. In order to be able to control the reaction better, it is preferred to use an inducible promoter. The culturing is continued in the presence of oxygen for 12 hours to 3 days after induction of vitamin B2 production.
The following nonlimiting examples describe specific embodiments of the invention.

General experimental details a) General cloning methods The cloning steps carried out for the purpose of the present invention, such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA
fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of E. coli cells, culturing of bacteria, replication of phages and sequence analysis of recombinant DNA, were carried out as described by Sambrook et al. (1989) loc. cit.
b) Polymerase chain reaction (PCR) PCR was carried out in accordance with a standard protocol with the following standard mixture:
8 NI of dNTP mix (200 NM), 10 Nl of Taq polymerase buffer (10 x) without MgCl2, 8 NI
of MgCl2 (25 mM), 1 NI of each primer (0.1 ,uM), 1 ,u1 of DNA to be amplified, 2.5 U of Taq polymerase (MBI Fermentas, Vilnius, Lithuania), demineralized water ad 100,u1.
c) Culturing of E. coli The recombinant E. coli DHSa strain was cultured in LB-amp medium (tryptone 10.0 g, NaCI 5.0 g, yeast extract 5.0 g, ampicillin 100 g/ml, H20 ad 1000 ml) at 37°C. For this purpose, in each case one colony was transferred, using an inoculating loop, from an agar plate into 5 ml of LB-amp. After culturing for about 18 hours shaking at a frequency of 220 rpm, 400 ml of medium in a 2 I flask were inoculated with 4 ml of culture.
Induction of P450 expression in E. coli took place after the fJD578 reached a value between 0.8 and 1.0 by heat-shock induction at 42°C for three to four hours.

d) Purification of the required product from the culture The required product can be isolated from the microorganism or from the culture supernatant by various methods known in the art. If the required product is not secreted by the cells, the cells can be harvested from the culture by slow centrifugation, and the cells can be lysed by standard techniques such as mechanical force or ultrasound treatment.
The cell detritus is removed by centrifugation, and the supernatant fraction which contains the soluble proteins is obtained for further purification of the required compound. If the product is secreted by the cells, the cells are removed from the culture by slow centrifugation, and the supernatant fraction is retained for further purification.
The supernatant fraction from the two purification methods is subjected to a chromatography with a suitable resin, with the required molecule either being retained on the chromatography resin, or passing through the latter, with greater selectivity than the impurities. These chromatography steps can be repeated if necessary, using the same or different chromatography resins. The skilled worker is proficient in the selection of suitable chromatography resins and their most effective use for a particular molecule to be purified. The purified product can be concentrated by filtration or ultrafiltration and be stored at a temperature at which the stability of the product is maximal.
Many purification methods are known in the art. These purification techniques are described, for example, in Bailey, J.E. & Ollis, D.F. Biochemical Engineering Fundamentals, McGraw-Hill: New York (1986).
The identity and purity of the isolated compounds can be determined by prior art techniques. These comprise high performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin layer chromatography, NIBS, enzyme assay or microbiological assays. These analytical methods are summarized in:
Patek et al. (1994) Appl. Environ. Microbiol. 60:133-~ 40; Maiatcnova et ai. (~ X06) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19:67-70.

Ullmann's Encyclopedia of Industrial Chemistry (1996j Vol. A27, VCH: Weinheim, pp.89-90, pp. 521-540, pp. 540-547, pp. 559-566, pp. 575-581 and pp. 581-587;
Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in 5 Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17.
e) General description of the MPSS method, clone identification and homology search The MPSS technology (Massive Parallel Signature Sequencing as described by 10 Brenner et al, Nat. Biotechnol. (2000) 18, 630-634; to which express reference is hereby made) was applied to the filamentous, vitamin B2-producing fungus Ashbya gossypii. It is possible with the aid of this technology to obtain with high accuracy quantitative information about the level of expression of a large number of genes in a eukaryotic organism. This entails the mRNA of the organism being isolated at a 15 particular time X, being transcribed with the aid of the enzyme reverse transcriptase into cDNA and then being cloned into special vectors which have a specific tag sequence.
The number of vectors with a different tag sequence is chosen to be high enough (about 1000 times higher) for statistically each DNA molecule to be cloned into a vector which is unique through its tag sequence.
The vector inserts are then cut out together with the tag. The DNA molecules obtained in this way are then incubated with microbeads which possess the molecular counterparts of the tags mentioned. After incubation it can be assumed that each microbead is loaded via the specific tags or counterparts with only one type of DNA
molecules. The beads are transferred into a special flow cell and fixed there so that it is possible to carry out a mass sequencing of all the beads with the aid of an adapted sequencing method based on fluorescent dyes and with the aid of a digital color camera. Although numerically high analysis is possible with this method, it is limited by a reading width of about 16 to 20 base pairs. The sequence length is, however, sufficient to make an unambiguous correlation between sequence and gene possible for most organisms (20 by have a sequence frequency of -1 x 10'2; compared with this, the human genome has a size of "only" --3 x 109 bp).

The data obtained in this way are analyzed by counting the number of identical sequences and comparing their frequencies with one another. Frequently occurring sequences reflect a high level of expression, and sequences which occur singly a low level of expression. If the mRNA was isolated at two different time points (X
and Y), it is possible to construct a chronological expression pattern of individual genes.
Example 1:
Isolation of mRNA from Ashbya gossypii Ashbya gossypii was cultured in a manner known per se (nutrient medium: 27.5 g/1 yeast extract; 0.5 g/1 magnesium sulfate; 50 m1/1 soybean oil; pH 7). Ashbya gossypii mycelium samples are taken at various times during the fermentation (24h, 48h and 72h), and the corresponding RNA or mRNA is isolated therefrom according to the protocol of Sambrook et al. (1989).
Example 2:
Application of the MPSS
Isolated mRNA from A, gossypii is then subjected to an MPSS analysis as explained above.
The sets of data found are subjected to a statistical analysis and categorized according to the significance of the differences in expression. This entailed examination both in relation to an increase and a reduction in the level of expression. A division is made by classifying the change in expression into a) monotonic change, b) change after 24 h, and c) change after 48 h.
The 20 by sequences representing a change in expression and found by MPSS
analysis are then used as probes and hybridized with a gene library from Ashbya gossypii, with an average insert size of about 1 kb. The hybridization temperature in this case was in the range from about 30 to 57°C.

Example 3:
Construction of a genomic gene library from Ashbya gossypii To construct a genomic DNA library, initially chromosomal DNA is isolated by the method of Wright and Philippsen (Gene (1991) 109: 99-105) and Mohr (1995, PhD
Thesis, Biozentrum Universitat Basel, Switzerland).
The DNA is partially digested with Sau3A. For this purpose, 6 Ng of genomic DNA are subjected to a Sau3A digestion with various amounts of enzyme (0.1 to 1 U).
The fragments are fractionated in a sucrose density gradient. The 1 kb region is isolated and subjected to a QiaEx extraction. The largest fragments are ligated to the BamHl-cut vector pRS416 (Sikorski and Hieter, Genetics (1988) 122; 19-27) (90 ng of BamHl-cut, dephosphorylated vector; 198 ng of insert DNA; 5 ml of water; 2 ,u1 of 10x ligatiori buffer; 1 U ligase). This ligation mixture is used to transform the E. coli laboratory strain XL-1 blue, and the resulting clones are employed for identifying the insert.
Example 4:
Preparation of an ordered gene library (CHIP technology) About 25,000 colonies of the Ashbya gossypii gene library (this corresponds to approximately a 3-fold coverage of the genome) were transferred in an ordered manner to a nylon membrane and then treated by the method of colony hybridization as described in Sambrook et al. (1989). Oligonucleotides were synthesized from the 20 by sequences found by MPSS analysis and were radiolabeled with 32P. In each case labeled oligonucleotides with a similar melting point are combined and hybridized together with the nylon membranes. After hybridization and washing steps, positive clones are identified by autoradiography and analyzed directly by PCR
sequencing.
In this way, a clone which harbors an insert with the internal name "Oligo 28"
and has significant homology with the MIPS tag "Yta7" or TBP7 from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 1.

In this way, a further clone which harbors an insert with the internal name "Oligo 45" and has significant homology with the MIPS tag "p39" or "Tif34" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 6.
In this way, a further clone which harbors an insert with the internal name "Oligo 85" and has significant homology with the MIPS tag "Rpl35a" from S. cerevisiae was identified.
The insert has a nucleic acid sequence as shown in SEQ ID NO: 12.
In this way, a further clone which harbors an insert with the internal name "Oligo 133"
and has significant homology with the MIPS tag "Nopl3" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 17.
In this way, a further clone which harbors an insert with the internal name "Oligo 172"
and has significant homology with the MIPS tag "SuaS" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ 1D NO: 21.
In this way, a further clone which harbors an insert with the internal name "Oligo 63" and has significant homology with the MIPS tag "Rps25a" from S. cerevisiae was identified.
The insert has a nucleic acid sequence as shown in SEQ !D NO: 26.
In this way, a further clone which harbors an insert with the internal name "Oligo 132"
and has significant homology with the MIPS tag "Nic96" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 31.
in this way, a further clone which harbors an insert with the internal name "Oligo 174"
and has significant homology with the MIPS tag "Ahc1" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 38.
In this way, a further clone which harbors an insert with the internal name "Oligo 51" and has significant homology with the MIPS tag "Rok1" from S. cerevisiae was identified.
The insert has a nucleic acid sequence as shown in SEQ ID NO: 42.

In this way, a further clone which harbors an insert with the internal name "Oligo 30" and has significant homology with the MIPS tag "Rpa34" from S. cerevisiae was identified.
The insert has a nucleic acid sequence as shown in SEQ ID NO: 48.
In this way, a further clone which harbors an insert with the internal name "Oligo 124"
and has significant homology with the MIPS tag "Sub2" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 53.
In this way, a further clone which harbors an insert with the internal name "Oligo 139"
and has significant homology with the MIPS tag "DCP1" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 58.
In this way, a further clone which harbors an insert with the internal name "Oligo 144"
and has significant homology with the MiPS tag "PRT1" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 63.
In this way, a further clone which harbors an insert with the internal name "Oligo 168"
and has significant homology with the MIPS tag "Rrp9" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 67.
In this way, a further clone which harbors an insert with the internal name "Oligo 160"
and has significant homology with the MIPS tag "RplBb" from S. cerevisiae was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 72.
In this way, a further clone which harbors an insert with the internal name "Oligo 18"
was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO:

(complementary strand with SEQ ID NO: 74). A potential ORF is located between positions 958 and 1272 shown in SEQ ID NO: 75.

Example 5:
Analysis of the sequence data by means of a BLASTX search An analysis of the resulting nucleic acid sequences, i.e. their functional assignment to 5 a functional amino acid sequence took place by means of a BLASTX search in sequence databases. Almost all of the amino acid sequence homologies found related to Saccharomyces cerevisiae (baker's yeast). Since this organism had already been completely sequenced, more detailed information about these genes could be referred to under:
10 http~//www mips 4sf de/proLyeast/search/code search.htm .
The followindhomologies with amino acid fragments from S. cerevisiae were found in this wav The corresponding alignments are shown in figures 1 to 15.
15 a) Amino acid sequences (corresponding to nucleotides 3 to 374 and 373 to 1479) derived from SEQ ID N0:1 have significant sequence homologies with a 26 S
proteasome subunit or the TAT-binding homolog 7 (TBP7) from S. cerevisiae. A
corresponding alignment is shown in figure 1. SEO ID NO: 2 and SEQ ID NO: 3 in each case show an amino acid part-sequence of the invention.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a 26 S proteasome subunit or a TAT-binding homolog 7 (TBP7).
b) An amino acid sequence derived from SEQ ID NO: 6 (cf. SEQ ID NO: 7;
corresponding to nucleotides 5 to 463 in SEO ID NO: 6) has significant sequence homology with a translation initiation factor (EIF3) subunit (P39) from S.
cerevisiae. A
corresponding alignment is shown in figure 2. SEQ ID NO: 8 and SEA ID NO: 9 in each case show a further amino acid part-sequence of the invention.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a translation initiation factor subunit.

c) The amino acid sequence derived from the coding strand to SEQ ID NO: 12 has significant sequence homology with a ribosomal protein from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 469 to 825 from SEQ ID NO: 12) with a part-sequence of the S. cerevisiae protein is depicted in figure 3.
5~ SEQ ID NO: 13 shows an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a ribosomal protein.
d) The amino acid sequence derived from the corresponding complementary strand to SEQ ID NO: 17 has significant sequence homology with a nucleolar protein from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 114 to 1 from SEQ ID NO: 17) with a part-sequence of the S.
cerevisiae protein is depicted in figure 4. SEQ ID NO: 18 shows an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a nucleolar protein.
e) The amino acid sequence derived from the coding strand to SEQ ID NO: 21 has significant sequence homology with a translation initiation protein from S.
cerevisiae.
An amino acid part-sequence derived therefrom (corresponding to nucleotides 2 to 349 from SEQ 1D NO: 21) with a part-sequence of the S. cerevisiae protein is depicted in figure 5A. A further amino acid part-sequence derived therefrom (corresponding to nucleotides 336 to 947 from SE4 ID NO: 21 ) with a part-sequence of the S.
cerevisiae protein is depicted in figure 5B. SEQ ID NO: 22 and SEQ ID NO: 23 in each case show an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a translation initiation protein.
f) The amino acid sequence derived from the corresponding complementary strand to SEQ ID NO: 26 has significant sequence homology with a precursor of ribosomal protein S 31 from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 609 to 562 from SEQ ID NO: 26) with a part-sequence of the S. cerevisiae protein is depicted in figure 6A. Another amino acid part-sequence derived therefrom (corresponding to nucleotides 556 to 401 from SEQ ID NO: 26) with a part-sequence of the S. cerevisiae protein is depicted in figure 6B. SEQ ID
NO: 27 and SEQ ID NO: 28 in each case show an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a precursor of ribosomal protein S 31.
g) An amino acid sequence derived from SEQ ID NO: 31 (cf. SEQ ID NO: 32, corresponding to nucleotides 108 to 764 in SEQ ID NO: 31) has significant sequence homology with a cell nuclear pore protein from S. cerevisiae. Figure 7 shows a corresponding alignment. The sequences SEQ ID NO: 33 to SEQ ID NO: 35 show further amino acid part-sequences of the invention.
The A, gossypii nucleic acid sequence found could thus be assigned the function of a cell nuclear pore protein.
h) The amino acid sequence derived from the corresponding complementary strand to SEQ ID NO: 38 has significant sequence homology with a constituent of the ADH-histone acetyltransferase complex from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 174 to 1 from SEQ ID NO: 38) with a part-sequence of the S. cerevisiae protein is depicted in figure 8. SEQ ID NO:
39 shows an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a constituent of the ADH-histone acetyltransferase complex.
i) The amino acid sequence derived from the corresponding complementary strand to SEQ ID NO: 42 has significant sequence homology with an S. cerevisiae RNA
helicase which is involved in RNA processing. An amino acid part-sequence derived therefrom (corresponding to nucleotides 1086 to 1012 from SEQ ID NO: 42) with a part-sequence of the S. cerevisiae enzyme is depicted in figure 9A. A second amino acid part-sequence derived therefrom (corresponding to nucleotides 1022 to 915 from SEQ
ID
NO: 42) with a part-sequence of the S. cerevisiae enzyme is depicted in figure 9B. A
further amino acid part-sequence derived therefrom (corresponding to nucleotides 925 to 689 from SEQ ID NO: 42) with a part-sequence of the S. cerevisiae enzyme is depicted in figure 9C. SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45 in each case show an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of an RNA helicase which is involved in RNA processing.
k) The amino acid sequence derived from the coding strand to SEQ ID NO: 48 has significant sequence homology with the nonessential constituent of RNA poll from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 1 to 102 from SEQ ID NO: 48) with a part-sequence of the S.
cerevisiae protein is depicted in figure 10A. A further amino acid part-sequence derived therefrom (corresponding to nucleotides 122 to 400 from SEQ ID NO: 48) with a part-sequence of the S. cerevisiae protein is depicted in figure 10B. SEQ ID NO: 49 and SE4 ID
NO: 50 in each case show an amino acid part-sequence of the invention.
The A. gossypii nucleic acid sequence found could thus be assigned a function of the nonessential constituent of RNA poll.
I) The amino acid sequence derived from the coding strand to SEQ ID NO: 53 has significant sequence homology with an RNA helicase from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 2 to 148 from SEQ ID NO: 53) with a part-sequence of the S. cerevisiae enzyme is depicted in figure 11 A. A further amino acid part-sequence derived therefrom (corresponding to nucleotides 150 to 185 from SEQ ID NO: 53) with a part-sequence of the S.
cerevisiae enzyme is depicted in figure 11 B. SEQ ID NO: 54 and SEQ ID NO: 55 in each case show an N-terminal extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of an RNA helicase.
m) The amino acid sequence derived from the coding strand to SEQ ID NO: 58 has significant sequence homology with an mRNA decapping enzyme from S.
cerevisiae.
An amino acid part-sequence derived therefrom (corresponding to nucleotides 2 to 82 from SEQ ID NO: 58) with a part-sequence of the S. cerevisiae enzyme is depicted in figure 12. SEQ ID NO: 5.9 shows an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of an mRNA decapping enzyme.
n) The amino acid sequence derived from the coding strand to SEQ ID NO: 63 has significant sequence hornology with an S. cerevisiae subunit to translation initiation factor eIF3. An amino acid part-sequence derived--therefrom (corre-sponding fo nucleotides 21 to 695 from SEQ ID NO: 63) with a part-sequence of the S.
cerevisiae protein is depicted in figure 13. SEQ ID NO: 64 shows an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a subunit of translation initiation factor eIF3.
o) The amino acid sequence derived from the coding strand to SEQ ID NO: 67 has significant sequence homology with an S. cerevisiae U3 small nucleolar ribonucleoprotein-associated protein which is involved in preribosomal RNA
processing.
An amino acid part-sequence derived therefrom (corresponding to nucleotides 1 to 111 from SEQ ID NO: 67) with a part-sequence of the S. cerevisiae protein is depicted in figure 14A. A further amino acid part-sequence derived therefrom (corresponding to nucleotides 144 to 887 from SEQ ID NO: 67) with a part-sequence of the S.
cerevisiae protein is depicted in figure 14B. SEQ ID NO: 68 and SEQ ID NO: 69 in each test show an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the function of a 5 U3 small nucleolar ribonucleoprotein-associated protein which is involved in preribosomal RNA processing.
p) The amino acid sequence derived from the corresponding complementary strand to SEQ ID N0:72 has significant sequence homology with a ribosomal protein 10 (L7a.e.B/large 60 S subunit) from S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to nucleotides 508 to 176 from SEQ ID NO: 72) with a part-sequence of the S. cerevisiae protein is depicted in figure 15. SEQ ID NO: 73 shows an N-terminally extended amino acid part-sequence.
15 The A. gossypii nucleic acid sequence found could thus be assigned the function of the ribosomal protein (L7a.e.B/large 60 S subunit).
Example 6:
Isolation of full-len4th DNA
a) Construction of an A. gossypii gene library High molecular weight cellular complete DNA from A. gossypii was prepared from a 2-day old 100 ml culture grown in a liquid MA2 medium (10 g of glucose, 10 g of peptone, 1 g of yeast extract, 0.3 g of myo-inositol ad 1000 ml). The mycelium was filtered off, washed twice with distilled H20, suspended in 10 ml of 1 M
sorbitol, 20 mM
EDTA, containing 20 mg of zymolyase 20T, and incubated at 27°C, shaking gently, for to 60 min. The protoplast suspension was adjusted to 50 mM Tris-HCI, pH 7.5, 150 mM NaCI, 100 mM EDTA and 0.5% strength sodium dodecyl sulfate (SDS) and 30 incubated at 65°C for 20 min. After two extractions with phenol/chloroform (1:1 vol/vol), the DNA was precipitated with isopropanol, suspended in TE buffer, treated with RNase, reprecipitated with isopropanol and resuspended in TE.

An A. gossypii cosmid gene library was produced by binding genomic DNA which had been selected according to size and partially digested with Sau3A to the dephosphorylated arms of the cosmid vector Super-Cos1 (Stratagene). The Super-Cos1 vector was opened between the two cos sites by digestion with Xbal and dephosphorylation with calf intestinal alkaline phosphatase (Boehringer), followed by opening of the cloning site with BamHl. The ligations were carried out in 20 ,u1, containing 2.5,ug of partially digested chromosomal DNA, 1 Ng of Super-Cost vector arms, 40 mM Tris-HCI, pH 7.5, 10 mM MgCl2, 1 mM dithiothreitol, 0.5 mM ATP and 2 Weiss units of T4-DNA lipase (Boehringer) at 15°C overnight. The ligation products were packaged in vitro using the extracts and the protocol of Stratagene (Gigapack II
Packaging Extract). The packaged material was used to infect E. coli NM554 (recAl3, araD139, a(ara,leu)7696, a(~ac)17A, galU, galK, hsrR, rps(st~'), mcrA, mcrB) and distributed on LB plates containing ampicillin (50,ug/m1). Transformants containing an A. gossypii insert with an average length of 30-45 kb were obtained.
b) Storage and screening of the cosmid gene library In total, 4 x 104 fresh single colonies were inoculated singly into wells of 96-well microtiter plates (Falcon, No. 3072) in 100 ,u1 of LB medium, supplemented with the freezing medium (36 mM K2HP04/13.2 mM KH2P04, 1.7 mM sodium citrate, 0.4 mM
MgS04, 6.8 mM (NH4)2S04, 4.4% (w/v) glycerol) and ampicillin 1,50 Ng/ml), allowed to grow at 37 °C overnight with shaking, and frozen at -70°C. The plates were rapidly thawed and then duplicated in fresh medium using a 96-well replicator which had been sterilized in an ethanol bath with subsequent evaporation of the ethanol on a hot plate.
Before the freezing and after the thawing (before any other measures) the plates were briefly shaken in a microtiter shaker (Infors) in order to ensure a homogeneous suspension of cells. A robotic system (Bio-Robotics) with which it is possible to transfer small amounts of liquid from 96 wells of a microtiter plate to nylon membrane (GeneScreen Plus, New England Nuclear) was used to place single clones on nylon membranes. After the culture had been transferred from the 96-well microtiter plates (1920 clones), the membranes were placed on the surface of LB agar with ampicillin (50,ug/ml) in 22 x 22 cm culture dishes (Nunc) and incubated at 37°C
overnight. Before cell confluence was reached, the membranes were processed as described by Herrmann, B. G., Barlow, D. P. and Lehrach, H. (1987) in Cell 48, pp. 813-825, including as additional treatment after the first denaturation step a 5-minute exposure of the filters to vapors on a pad impregnated with denaturation solution on a boiling water bath.
The random hexamer primer method (Feinberg, A. P, and Vogelstein, B. (1983), Anal.
Biochem. 132, pp. 6-13) was used to label double-stranded probes by uptake of [alpha-32P]dCTP with high specific activity. The membranes were prehybridized and hybridized at 42°C in 50% (vol/vol) formamide, 600 mM sodium phosphate, pH 7.2, 1 mM EDTA, 10% dextran sulfate, 1 % SDS, and 10x Denhardt's solution, containing salmon sperm DNA (50 Ng/ml) with 32P-labeled probes (0.5-1 x 1 Oscpm/ml) for 6 to 12 h.
Typically, . washing steps were carried out at 55 to 65°C in 13 to 30 mM NaCI, 1.5 to 3 mM sodium citrate, pH 6.3, 0.1 % SDS for about 1 h and the filters were autoradiographed at -70°C
with Kodak intensifying screens for 12 to 24 h. To date, individual membranes have been reused successfully more than 20 times. Between the autoradiographies, the filters were stripped by incubation at 95°C in 2 mM Tris-HCI, pH 8.0, 0.2 mM EDTA, 0.1 % SDS for 2 x 20 min.
c) Recovery of positive colonies from the stored gene library Frozen bacterial cultures in microtiter wells were scraped out using sterile disposable lancets, and the material was streaked onto LB agar Petri dishes containing ampicillin (50,ug/ml). Single colonies were then used to inoculate liquid cultures to produce DNA
by the alkaline lysis method (Birnboim, H. C. and Doly, J. (1979), Nucleic Acids Res. 7, pp. 1513-1523).
d) Full-length DNA
It was possible as described above to identify clones which harbor an insert with the appropriate complete sequence. These clones have the internal names given below:

"Oligo 28~'. The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 4.
"Oligo 45~'. The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 10.
"Oligo 85~'. The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 14. The protein encoded thereby preferably comprises at least one of the amino acid sequences shown in SEQ ID NO: 15 and 16.
"Oligo 133v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 19.
"Oligo 172v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 24.
"Oligo 63v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 29.
"Oligo 132v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 36.
"Oligo 174'. The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 40.
"Oligo 51 ~'. The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 46.
"Oligo 30~'. The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 51.

"Oligo 124v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 56.
"Oligo 139v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 60. The protein encoded thereby preferably comprises at least one of the amino acid sequences as shown in SEQ ID NO: 61 and 62.
"Oligo 144v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 65.
"Oligo 168v". The insert comprising the complete -sequence has a nucleic acid sequence as shown in SEQ ID NO: 70.
"Oligo 18v". The insert comprising the complete sequence has a nucleic acid sequence as shown in SEQ ID NO: 77.
Example 7:
Detection of a modulating effect of Oligo 18 on vitamin B2 production In order to test whether integration of DNA in the vicinity of the potential reading frame of oligo 18 has adverse effects on riboflavin synthesis, a DNA fragment was integrated by means of homologous recombination into the genome of the Ashbya gossypii strain used (Ashbya TEF promoter + 6418 resistance gene - cf. figure 1 ).
Transformation took place by electoporation in a manner known per se. Positive transformants were identified by PCR using the primer pair shown in figure 1. One transformant in which specific integration into this locus was detectable was investigated for vitamin B2 production both in shaken flask experiments and in laboratory fermentations.
It emerged that integration of this DNA fragment brought about an increase (of about 3%) in riboflavin production. The information in the TEF-6418 construct cannot have been the reason. It is therefore concluded that there is a position effect.

Shaken flask experiments for riboflavin determination:
10 ml of preculture medium (9.5 ml [9.5 g] of medium + 0.5 ml soybean oil) in a 100-ml 2-baffle Erlenmeyer flask are inoculated with 0.5 ml of a glycerol culture or with about 5 one inoculating loop of mycelium from a 5-day old, well grown SP agar plate, and shaken at 180 rpm (cabinet shaker, excursion 2.5 cm) and 28°C for 40 hours.
1.1 ml of this culture are used to inoculate 25.7 ml of main culture medium (21.2 ml [21.2 g] of medium, 1 ml of urea [10 g/45 ml] + 3.5 ml [3.2 g] of soybean oil, final 10 volume = 26.8 ml, of which 4.4 ml compensates for evaporation during shaking without humidification) or 21.8 ml of main culture medium (17.3 ml [17.3 g] of medium, 1 ml of urea [10 g/45 ml] + 3.5 ml [3.2 g] of soybean oil, final volume = 22.9 ml, of which 0.5 ml compensates for evaporation during shaking in an environment without artificial humidification) in a 250 ml Erlenmeyer flask and shaken at 220 rpm (industrial shaker, 15 excursion 5 cm) or 300 rpm (cabinet shaker, excursion 2.5 cm) and 28°C for 5 days.
0.5 ml of the main culture is vigorously shaken with 4.5 ml [5 g] of a 40%
strength nicotinamide solution (dilution factor 10) or 0.25 ml with 4.75 ml [5.27 g] of a 40%
strength nicotinamide solution (dilution factor 20) in a test tube and incubated in a water 20 bath at 70°C for about 2 x 20 minutes (cells lyzed, shaking in between). After cooling, 40 ~I are put in a macro dispersible cuvette, mixed with 3 ml of deionized water and measured as quickly as possible in a photometer, because vitamin B2 decomposes very rapidly. This entails measurement of the extinctions at 402, 446 and 550 nm and calculation as follows:
V=(W1 -W2xC+W3x(C-1)):(B1 -B2xC) with B1 - 17.36 [constant]
B2 - 31.15 [constant]
K - cuvette volume in ml (standard = 3.04 mll P _ sample volume in ml [standard = 0.04 mll F - dilution factor [standard = 10, i.e. 0.5 ml : 5 rnlJ

C - correction factor [(550-405)/(550-450) = 1.45]
W 1 - extinction at 402 nm W2 - extinction at 446 nm W3 - extinction at 550 nm -> V = (W 1 - 1.45W2 + 0.45W3) : -27.8075 Vitamin B2 concentration = V x K : P x F
=Vx3.04:0.04x10 = V x 760 With these values it is also necessary to take account of the evaporation of the medium during the shaking:
G1 - weight of the flask immediately after inoculation G2 - weight of the flask before sampling KV1 = volume of the medium with compensation for evaporation [22.4 m! + 4.4 ml = 26.8 ml]
KV2 = volume of the medium [22.4 ml]
BZ - the previously calculated, uncorrected vitamin B2 concentration Vitamin B2 concentration (corrected) _ ((KV1 - (G1 - G2)) : KV2) x B2 = ((26.8 - (G1 - G2)) : 22.4) x B2 The A. gossypii nucleic acid sequence found could on the basis of the above observations be assigned the function of a protein for modulating the vitamin productivity.

Table 1: Seguence survey SEQ OliooDescription of the sequence S eauence homolo gv ID
NO:

1 028 DNA part-sequence 26 S proteasome 2 028 Amino acid part-sequence derived subunit or TAT-binding from homolog 7 (TBP7) complementary strand to SEQ ID from NO: 1 3 028 Amino acid part-sequence derived S. cerevisiae from complementary strand to SEO !D
NO: 1 4 028 DNA full-length sequence 028 Amino acid sequence corresponding to the coding region of SEQ ID NO: 4 from position 245 to 4222 6 045 DNA part-sequence Translation initiation 7 045 Amino acid part-sequence derived factor subunit from from the S. cerevisiae complementary strand to SEQ ID
NO: 6 8 045 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 6 9 045 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 6 045 DNA full-length sequence 11 045 Amino acid sequence corresponding to the coding region of SEQ ID NO: 10 from position 640 to 1674 12 085 DNA part-sequence Ribosomal protein from 13 085 Amino acid part-sequence derived S. cerevisiae from the coding strand to SEQ ID NO: 12 14 085 DNA full-length sequence SEQ Oli Description of the sequence Seguence homolopy o ID NO:

15 085 Amino acid sequence corresponding to the coding region of SEQ ID NO: 14 from position 92 to 307 16 085 Amino acid sequence corresponding to the coding region of SEQ ID NO: 14 from position 403 to 858 17 133 DNA part-sequence Nucleolar protein from 18 133 Amino acid part-sequence derived S. cerevisiae from the complementary strand to SEQ ID
NO: 17 19 133 DNA full-length sequence 20 133 Amino acid sequence corresponding to the coding region of SEQ ID NO: 19 from position 1371 to 2495 21 172 DNA part-sequence Translation initiation 22 172 Amino acid part-sequence derived protein from from the coding strand to SEQ ID NO: 21 S. cerevisiae 23 172 Amino acid part-sequence derived from the coding strand to SEO ID NO: 21 24 172 DNA full-length sequence 25 172 Amino acid sequence corresponding to the coding region of SEQ ID NO: 24 from position 277 to 1476 26 063 DNA part-sequence Ribosomal protein 27 063 Amino acid part-sequence derived rom S. cerevisiae from the f complementary strand to SEQ ID
NO: 26 SEQ OliaoDescription of the sequence Sequence homology ID NO:

28 063 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 26 29 063 DNA full-length sequence 30 063 Amino acid sequence corresponding to the coding region of SEQ ID NO: 29 from position 533 to 856 31 132 DNA part-sequence Cell nuclear pore 32 132 Amino acid part-sequence derived protein from from the complementary strand to SEQ ID S. cerevisiae NO: 31 33 132 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 31 34 132 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 31 35 132 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 31 36 132 DNA full-length sequence 37 132 Amino acid sequence corresponding to the coding region of SEQ ID NO: 36 from position 629 to 3181 38 174 DNA part-sequence ADH-histone 39 174 Amino acid part-sequence derived acetyltransferase from the complementary strand SEQ ID NO: complex from 40 174 DNA full-length sequence S. cerevisiae 41 174 Amino acid sequence corresponding to the coding region of SEQ ID NO: 40 from position 964 to 2589 SEQ OliaoDescription of the sequence Seauence homology ID

NO:

42 051 DNA part-sequence S. cerevisiae RNA

43 051 Amino acid part-sequence derived helicase which is from the complementary strand to SEQ ID involved in RNA
NO: 42 44 051 Amino acid part-sequence derived Processing from the complementary strand to SEQ ID
NO: 42 45 051 Amino acid part-sequence derived from the complementary strand to SEQ ID
NO: 42 46 051 DNA full-length sequence 47 051 Amino acid sequence corresponding to the coding region of SEQ ID NO: 46 from position 502 to 2208 48 030 DNA part-sequence Nonessential 49 030 Amino acid part-sequence derived constituent of RNA
from the poll coding strand to SEQ ID NO: 48 from S. cerevisiae 50 030 Amino acid part-sequence derived from the coding strand to SEQ ID NO: 48 51 030 DNA full-length sequence 52 030 Amino acid sequence corresponding to the coding region of SEQ ID NO: 51 from position 198 to 1073 53 124 DNA part-sequence RNA helicase from 54 124 Amino acid part-sequence derived S. cerevisiae from the coding strand to SEQ ID NO: 53 55 124 Amino acid part-sequence derived from the coding strand to SEQ ID NO: 53 56 124 DNA full-length sequence SEQ Oli Description of the sequence Seauence hornoloav ID o NO:

57 124 Amino acid sequence corresponding to the coding region of SEQ ID NO: 56 from position 465 to 1775 58 139 DNA part-sequence mRNA decapping 59 139 Arnino acid part-sequence derivedenzyme from from the coding strand to SEQ ID NO: 58 S. cerevisiae 60 139 DNA full-length sequence 61 139 Amino acid sequence corresponding to the coding region of SEQ ID NO: 60 from position 402 to 638 62 139 Amino acid sequence corresponding to the coding region of SEQ ID NO: 60 from position 663 to 974 63 144 DNA part-sequence Subunit of the 64 144 Amino acid part-sequence derived translation initiation from the coding strand to SEQ ID NO: 63 factor eIF3 from 65 144 DNA full-length sequence S. cerevisiae 66 144 Amino acid sequence corresponding to the coding region of SEQ ID NO: 65 from position 468 to 2675 67 168 DNA part-sequence S. cerevisiae U3 small 68 168 Amino acid part-sequence derived nucleolar ribonucleo-from the coding strand to SEQ ID NO: 67 protein-associated 69 168 Amino acid part-sequence derived protein which is from the involved coding strand to SEQ ID NO: 67 n preribosomal RNA
i 70 168 DNA full-length sequence processing SEQ OI_ Description of the seguence Sequence homoloav ID ip0 NO:

71 168 Amino acid sequence corresponding to the coding region of SEQ ID NO: 70 from position 660 to 2432 72 160 DNA part-sequence Ribosomal protein 73 160 Amino acid part-sequence derived ~~7a.e.B; large from the 60 S

complementary strand to SEQ ID subunit) from NO: 72 S. cerevisiae 74 018 DNA part-sequence Modulator of vitamin 75 018 DNA full-length sequence production 76 018 Amino acid sequence corresponding to the coding region of SEQ ID NO: 75 from position 958 to 1272 77 018 DNA full-length sequence 78 018 Amino acid sequence corresponding to the coding region of SEQ ID NO: 77 from position 1531 to 1845 SEQUENCE LTSTING
<110> BASF Aktiengesellschaft <120> Novel polynucleotides for modulation of transcription/translation <130> M/42319iPCT
<160> 78 <170> PatentIn version 3.1 <210> 1 <211> 1481 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 28 <220>
<221> misc_feature <222> (151)..(151) <223> unknown amino acid <400>

gatctttgaaaacgaatgaragagtgttacttttagctattgcggaaggcttcaccgaag60 aagagttacataacacacctttgtcgttatttggctttgacctgaatattgkctctatta120 gagaaccatytacttgcccaaagacacaacntacttcaaaactctkgaagagttacctga180 aaatgaagcccactaagtttcgagagaagaggaaaagaaaaaagccactgccggtcctac240 ccgtgtgcgatactcccagcaacgatgatatyggttctgatggtgaactmttaaccgaag300 acgaaaagtygaggaggaagttaaaatcataccatcaccaagacatgaaattgaagaata360 ctttgaagataaaagctttccggtctgatggatctatttaaggggcgttataaaagattt420 aggaaaccgcccattgaggattccttgcttattcatctatttgaaccagaagcctatgcc480 tcaaatcctgaatggcaaccggcttatgtaagagaagatgacatgattttagaagtttca540 accggcaggaagtactacaatatggatttggatattatagaagaaaggttgtggaacggg600 tattactctgaaccgaaacagtatttgaaggatatcgagttaatttaccgcgatgctaat660 acaactggtgaccgagagcgtataataaaagcgtcagagatgtttgcaaacgcacagatg720 ggcattgaagaaatatctacgcctgagcttatccaggagtgcagggatacacgtcaaaga780 gaactattaaggcagcagttgtatttacgcgaccagcagaaaaagatacacgaggaagaa840 gctaagctcgagcaggagaaaaaggatccgacttttccaaatgacgataatcatccagaa900 gaggccgacttaagcgttggggctggacagcaattgcatagcccatcacaaatgtctcat960 gaggcttgtgaaagccacgcagaagatggactgggggtaccacatggctttgaaaataac1020 acatatgctattggagataacacaccagagacgatcgataacgggtctcctaaacccyta1080 gaggacttttgcggggaagacaagactgtccctgacgacaaatccgtgccagaacgattt1140 gttcaagagggagaagcttctgagatgggctttatcccgaaaacaccttccgccagaccc1200 gtctccatgcactcaaatccatcaagcaaagaatccgtagttgctcctatgcaaaagact1260 gggttagaagtgaacagtatcgaggacacgtcagtcgctgttcaatcagaactgacccgc1320 gatgaagacttacccatgactcctgaaccggcctttatcctggatgaaaccgttttagcg1380 aaaataatctcgatgttgaaaacaaaaacacagggatttacagtcgaacagctggaaaca1440 tgctatgctgccgtactggagctagtatgggaggcgagatc 1481 <210> 2 <211> 124 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 28 <220>
<221> misc feature <222> (37)..(37) <223> unknown amino acid <220>
<221> misc_feature <222> (43)..(43) <223> unknown amino acid <220>
<221> misc feature <222> (50)..(50) <223> unknown amino acid <220>
<221> misc_feature <222> (55)..(55) <223> unknown amino acid <220>
<221> misc_feature <222> (103)..(103) <223> unknown amino acid <400> 2 Ser Leu Lys Thr Asn Glu Arg Val Leu Leu Leu Ala Ile Ala Glu Gly Phe Thr Glu Glu Glu Leu His Asn Thr Pro Leu Ser Leu Phe Gly Phe Asp Leu Asn Ile Xaa Ser Ile Arg Glu Pro Xaa Thr Cys Pro Lys Thr Gln Xaa Thr Ser Lys Leu Xaa Lys Ser Tyr Leu Lys Met Lys Pro Thr Lys Phe Arg Glu Lys Arg Lys Arg Lys Lys Pro Leu Pro Val Leu Pro Val Cys Asp Thr Pro Ser Asn Asp Asp Ile Gly Ser Asp Gly Glu Leu Leu Thr Glu Asp Glu Lys Xaa Arg Arg Lys Leu Lys Ser Tyr His His Gln Asp Met Lys Leu Lys Asn Thr Leu Lys Ile Lys <210> 3 <211> 369 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 28 <400> 3 Lys Leu Ser Gly Leu Met Asp Leu Phe Lys Gly Arg Tyr Lys Arg Phe Arg Lys Pro Pro Ile Glu Asp Ser Leu Leu Ile His Leu Phe Glu Pro Glu Ala Tyr Ala Ser Asn Pro Glu Trp Gln Pro Ala Tyr Val Arg Glu Asp Asp Met Ile Leu Glu Val Ser Thr Gly Arg Lys Tyr Tyr Asn Met Asp Leu Asp Ile Ile Glu Glu Arg Leu Trp Asn Gly Tyr Tyr Ser Glu Pro Lys Gln Tyr Leu Lys Asp Ile Glu Leu Ile Tyr Arg Asp Ala Asn Thr Thr Gly Asp Arg Glu Arg Ile I1e Lys Ala Ser Glu Met Phe Ala Asn Ala Gln Met Gly Ile Glu Glu Ile Ser Thr Pro Glu Leu Ile Gln Glu Cys Arg Asp Thr Arg Gln Arg Glu Leu Leu Arg Gln Gln Leu Tyr Leu Arg Asp Gln Gln Lys Lys Ile His Glu Glu Glu Ala Lys Leu Glu Gln Glu Lys Lys Asp Pro Thr Phe Pro Asn Asp Asp Asn His Pro Glu Glu Ala Asp Leu Ser Val Gly Ala Gly Gln Gln Leu His Ser Pro Ser Gln Met Ser His Glu Ala Cys Glu Ser His Ala Glu Asp Gly Leu Gly Val Pro His Gly Phe Glu Asn Asn Thr Tyr Ala Ile Gly Asp Asn Thr Pro Glu Thr Ile Asp Asn Gly Ser Pro Lys Pro Leu Glu Asp Phe Cys Gly Glu Asp Lys Thr Val Pro Asp Asp Lys Ser Val Pro Glu Arg Phe Val Gln Glu Gly Glu Ala Ser Glu Met Gly Phe Ile Pro Lys Thr Pro Ser Ala Arg Pro Val Ser Met His Ser Asn Pro Ser Ser Lys Glu Ser 275 -. 280 285 Val Val Ala Pro Met Gln Lys Thr Gly Leu Glu Val Asn Ser Ile Glu Asp Thr Ser Val Ala Val Gln Ser Glu Leu Thr Arg Asp Glu Asp Leu Pro Met Thr Pro Glu Pro Ala Phe Ile Leu Asp Glu Thr Val Leu Ala Lys Ile Ile Ser Met Leu Lys Thr Lys Thr Gln Gly Phe Thr Val Glu - Gln Leu Glu Thr Cys Tyr Ala Ala Val Leu Glu Leu Val Trp Glu Ala Arg <210> 4 <211> 4670 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (245).-(4222) <223>
<220>
<221> misc feature <223> Oligo 28 <400> 4 tctcgttccgaagctgaggctggatacgaatatcaccatatacgaaggccccgccacccc 60 gagaaaggcatttttcccctttgaaatgggttatgtgacgatgttcatgagttgtgcaga 120 aaagcagggagggaaagacgagtcattagcatcgaagggcagcattgtgtagtcttagtg 180 tcgtatttttggatctgcaataggtttttgatttatctctcggtcttcgatttgatagag 240 aatc 289 atg gcg cgt cat aca agg aga tcg cat cag cac gtg aac gac gaa Met Ala Arg His Thr Arg Arg Ser His Gln His Val Asn Asp Glu gataca ggtagcgaa atatacgataaa aatgggatcaag cacacgacg 337 AspThr GlySerGlu IleTyrAspLys AsnGlyIleLys HisThrThr ccgagg tcgctgaag aagatcaattac gcggaaatcgaa aacagttac 385 ProArg SerLeuLys LysIleAsnTyr AlaGluIleGlu AsnSerTyr gattat atggaggac tacgatgaagga gacaaggaagag gagcctgca 433 AspTyr MetGluAsp TyrAspGluGly AspLysGluGlu GluProAla gaactg gagaacaac gggcggagcaag ggactggtaggc cgcgagcgc 481 Glu Leu Glu Asn Asn Gly Arg Ser Lys Gly Leu Val Gly Arg Glu Arg °

65 ?0 75 gggcgggag ccggaggag gacgag gaggag gtc cgg 529 gac ggg ggg cca GlyArgGlu ProGluGlu AspGlu GluGlu Val Arg Asp Gly Gly Pro 80 85 90 g5 cggcgcagc cggaaacgc acttatgtg gatgtggag gac gag 577 gag agc ArgArgSer ArgLysArg ThrTyrVal AspValGlu Asp Glu Glu Ser ttccacgag gaggaggcg gaggacgag gacgaggag ctg gac 625 gcg gac PheHisGlu GluGluAla GluAspGlu AspGluGlu Leu Asp Ala Asp gatgaggac gaggacgag gaggagcgg aactggcgg cgg cgc 673 cgg gag AspGluAsp GluAspGlu GluGluArg AsnTrpArg Arg Arg Arg Glu caccagttt gttgtagag gacgaggat gatgacgag gag gag 721 gac gac HisGlnPhe ValValGlu AspGluAsp AspAspGlu Glu Glu Asp Asp gactatgga gcacagaaa aaacgcggc aggcggcgg cgg cgt 769 acc ggc AspTyrGly AlaGlnLys LysArgGly ArgArgArg Arg Arg Thr Gly aggtcgcgg ctaacagag cggcgttcg ccgccacgc ctg cgg 817 aag aca ArgSerArg LeuThrGlu ArgArgSer ProProArg Leu Arg Lys Thr cgccggacg cgatcgtct gtgaacatg tatgacagt cat gac 865 gag ggg ArgArgThr ArgSerSer ValAsnMet TyrAspSer His Asp Glu Gly actggcgaa gcgttgacg ctggaggac gagattcgg ctg cag 913 gaa gag ThrGlyGlu AlaLeuThr LeuGluAsp GluIleArg Leu Gln Glu Glu gattcgccc atccgcgag aaacggtcg ctgcgggag aca aag 961 cgc ccg AspSerPro IleArgGlu LysArgSer LeuArgGlu Thr Lys Arg Pro gtaaattac acgctgccc ccacccctg actgataac atg aac 1009 caa gtt ValAsnTyr ThrLeuPro ProProLeu ThrAspAsn Met Asn Gln Val 240. 245 250 255 gatggcact getgcacca gcgtacggg agcttccat ccc aga 1057 tct ggc AspGlyThr AlaAlaPro AlaTyrGly SerPheHis Pro Arg Ser Gly 260 265 27p aagcgtggg ctacactcg ggacaaagt tttggacct 1105 atc agg cga ttg LysArgGly LeuHisSer GlyGlnSer PheGlyPro Ile Arg Arg Leu tttccaacg ggcggccct ttcggcgga gatgtg 1153 aac aca get ata ttc PheProThr GlyGlyPro PheGlyGly Asn Asp Val Thr Ala Ile Phe ggccacaac accaacttt tatgcaacg 1201 get caa gat ccg act gtg gcc GlyHisAsn ThrAsnPhe Tyr Thr Ala Ala Gln Asp Pro Thr Val Ala aataacaag tttatc tcggactct 1249 gat tca gat gac gaa att ttg ccg Asn Asn Lys Phe Ile Asp Ser Asp Ser Ser Asp Asp Glu Ile Leu Pro ctg gga agt acc cec aaa cca aaa agc tcc gaa get aag aaa aag aaa 1297 Leu Gly Ser Thr Pro Lys Pro Lys Ser Ser Glu Ala Lys Lys Lys Lys aag ccg gag att gca gat ctg gat ccg tta gga gta gat atg aat att 1345 Lys Pro Glu Ile Ala Asp Leu Asp Pro Leu Gly Val Asp Met Asn Ile aat ttt gat gac att ggc ggt ctg gat aac tac ata gac cag ctg aag 1393 Asn Phe Asp Asp Ile G1y Gly Leu Asp Asn Tyr Ile Asp Gln Leu Lys gag atg gtt gcg ttg ccg tta ctc tat ccg gag ctc tat caa aat ttc 1441 Glu Met Val Ala Leu Pro Leu Leu Tyr Pro Glu Leu Tyr Gln Asn Phe aac atc aca cct ccg cgt ggt gtg ctc ttc tat ggg cca cca ggt acg 1489 Asn Ile Thr Pro Pro Arg G1y Val Leu Phe Tyr Gly Pro Pro Gly Thr ggt aag acg ctt atg get aga gcg ttg gca gcg agc tgc tca act gaa 1537 Gly Lys Thr Leu Met Ala Arg Ala Leu Ala Ala Ser Cys Ser Thr Glu aag agg aag att acg ttc tat atg cgc aag ggg gcc gat atc ctg tcg 1585 Lys Arg Lys Ile Thr Phe Tyr Met Arg Lys Gly Ala Asp Ile Leu Ser aaa tgg gtt ggc gaa get gag aga cag ctt cga ctg ctg ttt gag gag 1633 Lys Trp Val Gly Glu Ala Glu Arg Gln Leu Arg Leu Leu Phe Glu Glu get aag aag cac cag cct tcg ata att ttc ttt gac gag att gat ggc 1681 Ala Lys Lys His Gln Pro Ser Ile Ile Phe Phe Asp Glu Ile Asp Gly ctg gcc ccg gtt agg agt tca aag caa gaa caa atc cat gcc agc atc 1729 Leu Ala Pro Val Arg Ser Ser Lys Gln Glu Gln Ile His Ala Ser Ile gta tct acc atg ttg gcg tta atg gat gga atg gac aat agg gga caa 1777 Val Ser Thr Met Leu Ala Leu Met Asp Gly Met Asp Asn Arg Gly Gln gtg att gta atc ggt get act aat aga ccg gat gca gta gac cct get 1825 Val Ile Val Ile Gly Ala Thr Asn Arg Pro Asp Ala Val Asp Pro Ala tta aga cga cca ggt aga ttt gac aga gag ttt tat ttc cct ctg cct 1873 Leu Arg Arg Pro Gly Arg Phe Asp Arg Glu Phe Tyr Phe Pro Leu Pro gac ata cga gcc aga gcg aag att ctg gaa att cac acc agg aaa tgg 1921 Asp I1e Arg Ala Arg Ala Lys Ile Leu Glu Ile His Thr Arg Lys Trp cat cct cca gta tca agt gcg ttt ata gaa aag ctt get tct ttg acg 1969 His Pro Pro Va1 Ser Ser Ala Phe Ile Glu Lys Leu Ala Ser Leu Thr aaa gga tac ggt gga gca gat ctt aga gcg cta tgt aca gag gcg gcc 2017 Lys Gly Tyr Gly Gly Ala Asp Leu Arg Ala Leu Cys Thr Glu Ala Ala tgg aat agc att cag cga aga ttc ccg caa ata tat caa agt gag gtc 2065 Trp Asn Ser Ile Gln Arg Arg Phe Pro Gln Ile Tyr Gln Ser Glu Val aag ttg gcaataaaccca agggaagtg caggttaaa getaaagacttt 2113 Lys Leu AlaIleAsnPro ArgGluVal GlnValLys AlaLysAspPhe atg att getatggaaaaa attacaccg tcttccgcg cggtcgagtggg 2161 Met Ile AlaMetGluLys IleThrPro SerSerAla ArgSerSerGly aac ttg gccgaaccctta cctcgtacc atagcggtt ctgctaaacgat 2209 Asn Leu AlaGluProLeu ProArgThr IleAlaVal LeuLeuAsnAsp cag ttc gaggaaataaaa caaaaattg aatagcatt ttgcctgaagcg 2257 Gln Phe GluGluIleLys GlnLysLeu AsnSerIle LeuProGluAla tca agt aagtctcatcgc ggttcttcg ctaattaaa gaatacctggag 2305 Ser Ser LysSerHisArg GlySerSer LeuIleLys GluTyrLeuGlu tac gaa gatgaagaagat gaagaagat ggagaagat aatatcgaaggc 2353 Tyr Glu AspGluGluAsp GluGluAsp GlyGluAsp AsnIleGluGly aca ggt atccactcgtcg aacggcttc agcagacat gaatttttcaag 2401 Thr Gly IleHisSerSer AsnGlyPhe SerArgHis GluPhePheLys atg ctt gatcaggetagg accgttaaa ccaaagttg ttaataacaggt 2449 Met Leu AspGlnAlaArg ThrValLys ProLysLeu LeuIleThrGly ccg get ggcaatggccaa caatatatt ggttccgcg cttttgcatcat 2497 Pro Ala GlyAsnGlyGln GlnTyrIle GlySerAla LeuLeuHisHis tta gag gattacaatatt cagaatctt gatttaggc acattactctcg 2545 Leu Glu AspTyrAsnIle GlnAsnLeu AspLeuGly ThrLeuLeuSer gaa agt ttaaggacaatg gagtccget attgtgcag acatttattgag 2593 Glu Ser LeuArgThrMet GluSerAla IleValGln ThrPheIleGlu gcg aaa aaacgacaacca tcagtaatc tacatccct aatgetgatatt 2641 Aia Lys LysArgGlnPro SerValIle TyrIlePro AsnAlaAspIle tgg tca agaacggtcccc gaaagtgcc ataatgacc ttggcaagctta 2689 Trp Ser ArgThrValPro GluSerAla IleMetThr LeuAlaSerLeu ttt aga tctttgaaaacg aatgagaga gtgttactt ttagetattgcg 2737 Phe Arg SerLeuLysThr AsnGluArg ValLeuLeu Leu IleAla Ala gaa ggc ttcaccgaa gaagagtta cataacaca cctttgtcg ttattt 2785 Glu Gly PheThrGlu GluGluLeu HisAsnThr ProLeuSer LeuPhe ggc ttt gacctgaat attgtctct attagagaa ccatctact gcccaa 2833 Gly Phe AspLeuAsn IleValSer IleArgGlu ProSerThr AlaGln aga cac aactacttc aaaactctc gaagagtta ctgaaaatg aagccc 2881 Arg His AsnTyrPhe LysThrLeu GluGluLeu LeuLysMet LysPro 865 870 g75 act aag tttcgagag aagaggaaa agaaaaaag ccactgccg gtacta 2929 Thr Lys PheArgGlu LysArgLys ArgLysLys ProLeuPro ValLeu ccc gtg tgcgatact cccagcaac gatgatatc ggttctgat ggtgaa 2977 Pro Val CysAspThr ProSerAsn AspAspIle GlySerAsp GlyGlu cta tta accgaagac gaaaagttg aggaggaag ttaaaatca taccat 3025 Leu Leu ThrGluAsp GluLysLeu ArgArgLys LeuLysSer TyrHis cac caa gacatgaaa ttgaagaat actttgaag ataaagctt tccggt 3073 His Gln AspMetLys LeuLysAsn ThrLeuLys IleLysLeu SerGly cta gtg getctattt aaggggcgt tataaaaga tttaggaaa ccgccc 3121 Leu Val AlaLeuPhe LysGlyArg TyrLysArg PheArgLys ProPro att gag gattccttg cttattcat ctatttgaa ccagaagcc tatgcc 3169 Ile Glu AspSerLeu LeuIleHis LeuPheGlu ProGluAla TyrAla tca aat cctgaatgg caaccgget tatgtaaga gaagatgac atgatt 3217 Ser Asn ProGluTrp GlnProAla TyrValArg GluAspAsp Ile Met tta gaa gtt tca acc ggc agg aag tac tac aat atg gat ttg gat att 3265 Leu Glu Val Ser Thr Gly Arg Lys Tyr Tyr Asn Met Asp Leu Asp Ile atagaagaa agg ttgtggaac ggg tattactct gaaccg aaacag 3310 IleGluGlu Arg LeuTrpAsn Gly TyrTyrSer GluPro LysGln tatttgaag gat atcgagtta att taccgcgat getaat acaact 3355 TyrLeuLys Asp IleGluLeu Ile TyrArgAsp AlaAsn ThrThr ggtgaccga gag cgtataata aaa gcgtcagag atgttt gcaaac 3400 GlyAspArg Glu ArgIleIle Lys AlaSerGlu MetPhe AlaAsn gcacagatg ggc attgaagaa ata tctacgcct gagctt atccag 3445 AlaGlnMet Gly IleGluGlu Ile SerThrPro GluLeu IleGln gagtgcagg gat acacgtcaa aga gaactatta aggcag cagttg 3490 Glu Cys Arg Asp Thr Arg Gln Arg Glu Leu Leu Arg Gln Gln Leu tatttacgc gac cagcagaaa aag atacacgag gaa get 3535 gaa aag 'I'~,~rLeuArg Asp GlnGlnLys Lys IleHisGlu Glu Ala Glu Lys ctcgagcag gag aaaaaggat ccg acttttcca aatgac gataat 3580 LeuGluGln Glu LysLysAsp Pro ThrPhePro AsnAsp AspAsn catccagaa gag gccgactta agc gttgggget ggacag caattg 3625 HisProGlu Glu AlaAspLeu Ser ValGlyAla GlyGln GlnLeu catagccca tca caaatgtct cat gaggettgt gaaagc cacgca 3670 HisSerPro Ser GlnMetSer His GluAlaCys GluSer HisAla gaagatgga ctg ggggtacca cat ggctttgaa aataac acatat 3715 GluAspGly Leu GlyValPro His GlyPheGlu AsnAsn ThrTyr getattgga gat aacacacca gag acgatcgat aacggg tctcct 3760 AlaIleGly Asp AsnThrPro Glu ThrIleAsp AsnGly SerPro aaaccccta gag gacttttgc ggg gaagacaag actgtc cctgac 3805 LysProLeu Glu AspPheCys Gly GluAspLys ThrVal ProAsp gacaaatcc gtg ccagaacga ttt gttcaagag ggagaa gettct 3850 AspLysSer Val ProGluArg Phe ValGlnGlu GlyGlu AlaSer gagatgggc ttt atcccgaaa aca ccttccgcc agaccc gtctcc 3895 GluMetGly Phe IleProLys Thr ProSerAla ArgPro ValSer atgcactca aat ccatcaagc aaa gaatccgta gttget cctatg 3940 MetHisSer Asn ProSerSer Lys GluSerVal ValAla ProMet caaaagact ggg ttagaagtg aac agtatcgag gacacg tcagtc 3985 GlnLysThr Gly LeuGluVal Asn SerIleGlu AspThr SerVal getgttcaa tca gaactgacc cgc gatgaagac ttaccc atgact 4030 AlaValGln Ser GluLeuThr Arg AspGluAsp LeuPro MetThr cctgaaccg gcc tttatcctg gat gaaaccgtt ttagcg aaaata 4075 ProGluPro Ala PheIleLeu Asp GluThrVal LeuAla LysIle atctcgatg ttg aaaacaaaa aca cagggattt acagtc gaacag 4120 IleSerMet Leu LysThrLys Thr GlnGlyPhe ThrVal GluGln ctggaaaca tgc tatgetgcc gta ctg cta gtatgg gaggcg 4165 gag LeuGluThr Cys TyrAla Val Leu Leu Trp GluAla Ala Glu Val agatcgtca tgg gataaaaca agt gtc ata gaa 4210 att aaa aag caa Arg Ser Ser Trp Asp Lys Thr Val Ile Glu Lys Ser Lys Gln Ile tat ata ggc atg tgag cccgtt 4262 agtaggacca agtgtatcta acatttattt Tyr Ile Gly Met acacgattaa agcctagagt cgatatatactagttcaattgttcttgcatgacgtcctcg4322 gctgcatcga gtaagccgta gtcatcggcaaactgtgcggtgagttggatacctactccc4382 ttcattccag caagaggaac agatatgcatggaagcccagcgagggacattggcaccgtg4442 aagacgtcgt tgatgtacga gttgactggactcttgttctccttgctagtgaaggcctcg4502 agactaggtg ggtggcgcca tgcaggtcagcgagagcagcacatccaccccagcaggatt4562 aggtttgttt ccggtgcaga tgttctcaaaggcaaatatcgagtcaaactggtttataag4622 ctcgactctc agtttctgcg ccctcatgtagttggtcttaaatgcgcc 4670 <210> 5 <211> 1326 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 28 <400> 5 Met Ala Arg His Thr Arg Arg Ser His Gln His Val Asn Asp Glu Asp Thr Gly Ser Glu Ile Tyr Asp Lys Asn Gly Ile Lys His Thr Thr Pro Arg Ser Leu Lys Lys Ile Asn Tyr Ala Glu Ile Glu Asn Ser Tyr Asp Tyr Met Glu Asp Tyr Asp Glu Gly Asp Lys Glu Glu Glu Pro Ala Glu Leu Glu Asn Asn Gly Arg Ser Lys Gly Leu Val Gly Arg Glu Arg Gly Arg Glu Pro Glu Glu Asp Glu Asp Glu Glu Gly Pro Val Arg Gly Arg .. 13 Arg Ser Arg Lys Arg Thr Tyr Val Asp Val Glu Glu Asp Glu Ser Phe His Glu Glu Glu Ala Glu Asp Glu Asp Glu Glu Ala Leu Asp Asp Asp Glu Asp Glu Asp Glu Glu Glu Arg Asn Trp Arg Arg Arg Arg Glu His Gln Phe Val Val Glu Asp Glu Asp Asp Asp Glu Asp Glu Glu Asp Asp Tyr Gly Ala Gln Lys Lys Arg Gly Arg Arg Arg Thr Arg Arg Gly Arg Ser Arg Leu Thr Glu Arg Arg Ser Pro Pro Arg Lys Leu Arg Thr Arg Arg Thr Arg Ser Ser Val Asn Met Tyr Asp Ser Glu His Asp Gly Thr Gly Glu Ala Leu Thr Leu Glu Asp Glu Ile Arg Glu Leu Gln Glu Asp Ser Pro Ile Arg Glu Lys Arg Ser Leu Arg Glu Arg Thr Lys Pro Val Asn Tyr Thr Leu Pro Pro Pro Leu Thr Asp Asn Gln Met Asn Val Asp Gly Thr Ala Ala Pro Ala Tyr Gly Ser Phe His Ser Pro Arg Gly Lys Arg Gly Leu His Ser Gly Gln Ser Phe Gly Pro Ile Arg Arg Leu Phe Pro Thr Gly Gly Pro Phe Gly Gly Asn Asp Val Thr Ala Ile Phe Gly His Asn Thr Asn Phe Tyr Ala Thr Ala Gln Asp Pro Thr Val Ala Asn Asn Lys Phe Ile Asp Ser Asp Ser Ser Asp Asp Glu Ile Leu Pro Leu Gly Ser Thr Pro Lys Pro Lys Ser Ser Glu Ala Lys Lys Lys Lys Lys Pro Glu Ile Ala Asp Leu Asp Pro Leu Gly Val Asp Met Asn Ile Asn Phe Asp Asp Ile Gly Gly Leu Asp Asn Tyr Ile Asp Gln Leu Lys Glu -Met Val Ala Leu Pro Leu Leu Tyr Pro Glu Leu Tyr Gln Asn Phe Asn Ile Thr Pro Pro Arg Gly Val Leu Phe Tyr Gly Pro Pro Gly Thr Gly Lys Thr Leu Met Ala Arg Ala Leu Ala Ala Ser Cys Ser Thr Glu Lys Arg Lys Ile Thr Phe Tyr Met Arg Lys Gly Ala Asp Ile Leu Ser Lys Trp Val Gly Glu Ala Glu Arg Gln Leu Arg Leu Leu Phe Glu Glu Ala Lys Lys His Gln Pro Ser Ile Ile Phe Phe Asp Glu Ile Asp Gly Leu Ala Pro Val Arg Ser Ser Lys Gln Glu Gln Ile His Ala Ser Ile Val Ser Thr Met Leu Ala Leu Met Asp Gly Met Asp Asn Arg Gly Gln Val Ile Val Ile Gly Ala Thr Asn Arg Pro Asp Ala Val Asp Pro Ala Leu Arg Arg Pro Gly Arg Phe Asp Arg Glu Phe Tyr Phe Pro Leu Pro Asp Ile Arg Ala Arg Ala Lys Ile Leu Glu Ile His Thr Arg Lys Trp His Pro Pro Val Ser Ser Ala Phe Ile Glu Lys Leu Ala Ser Leu Thr Lys Gly Tyr Gly Gly Ala Asp Leu Arg Ala Leu Cys Thr Glu Ala Ala Trp Asn Ser Ile Gln Arg Arg Phe Pro Gln Ile Tyr Gln Ser Glu Val Lys Leu Ala Ile Asn Pro Arg Glu Val Gln Val Lys Ala Lys Asp Phe Met Ile Ala Met Glu Lys Ile Thr Pro Ser Ser Ala Arg Ser Ser Gly Asn Leu Ala Glu Pro Leu Pro Arg Thr Ile Ala Val Leu Leu Asn Asp Gln Phe Glu Glu Ile Lys Gln Lys Leu Asn Ser Ile Leu Pro Glu Ala Ser Ser Lys Ser His Arg Gly Ser Ser Leu Ile Lys Glu Tyr Leu Glu Tyr Glu Asp Glu Glu Asp Glu Glu Asp Gly Glu Asp Asn Ile Glu Gly Thr Gly Ile His Ser Ser Asn Gly Phe Ser Arg His Glu Phe Phe Lys Met Leu Asp Gln Ala Arg Thr Val Lys Pro Lys Leu Leu Ile Thr Gly Pro Ala Gly Asn Gly Gln Gln Tyr Ile Gly Ser Ala Leu Leu His His Leu Glu Asp Tyr Asn Ile Gln Asn Leu Asp Leu Gly Thr Leu Leu Ser Glu Ser Leu Arg Thr Met Glu Ser Ala Ile Val Gln Thr Phe Ile Glu Ala Lys Lys Arg Gln Pro Ser Val Ile Tyr Ile Pro Asn Ala Asp Ile Trp Ser Arg Thr Val Pro Glu Ser Ala Ile Met Thr Leu Ala Ser Leu Phe Arg Ser Leu Lys Thr Asn Glu Arg VaI Leu Leu Leu Ala Ile Ala Glu Gly Phe Thr Glu Glu Glu Leu His Asn Thr Pro Leu Ser Leu Phe Gly Phe Asp Leu Asn Ile Val Ser Iie Arg Glu Pro Ser Thr Ala Gln Arg His Asn Tyr Phe Lys Thr Leu Glu Glu Leu Leu Lys Met Lys Pro Thr Lys Phe Arg Glu Lys Arg Lys Arg Lys Lys Pro Leu Pro Val Leu Pro Val Cys Asp Thr Pro Ser Asn Asp Asp Ile Gly Ser Asp Gly Glu Leu Leu Thr Glu Asp Glu Lys Leu Arg Arg Lys Leu Lys Ser Tyr His His Gln Asp Met Lys Leu Lys Asn Thr Leu Lys Ile Lys Leu Ser Gly Leu Val Ala Leu Phe Lys Gly Arg Tyr Lys Arg Phe Arg Lys Pro Pro Ile Glu Asp Ser Leu Leu Ile His Leu Phe Glu Pro Glu Ala Tyr Ala Ser Asn Pro Glu Trp Gln Pro Ala Tyr Val Arg Glu Asp Asp Met Ile Leu Glu Val Ser Thr Gly Arg Lys Tyr Tyr Asn Met Asp Leu Asp Ile Ile Glu Glu Arg Leu Trp Asn Gly Tyr Tyr Ser Glu Pro Lys Gln Tyr Leu Lys Asp Ile Glu Leu Ile Tyr Arg Asp Ala Asn Thr Thr Gly Asp Arg Glu Arg Ile Ile Lys Ala Ser Glu Met Phe Ala Asn Ala Gln Met Gly Ile Glu Glu Ile Ser Thr Pro Glu Leu Ile Gln Glu Cys Arg Asp Thr Arg Gln Arg Glu Leu Leu Arg Gln Gln Leu Tyr 1070 10?5 1080 Leu Arg Asp Gln Gln Lys Lys Ile His Glu Glu Glu Ala Lys Leu Glu Gln Glu Lys Lys Asp Pro Thr Phe Pro Asn Asp Asp Asn His Pro Glu Glu Ala Asp Leu Ser Val Gly Ala Gly Gln Gln Leu His Ser Pro Ser Gln Met Ser His Glu Ala Cys Glu Ser His Ala Glu Asp Gly Leu Gly Val Pro His Gly Phe Glu Asn Asn Thr Tyr Ala Ile Gly Asp Asn Thr Pro Glu Thr Ile Asp Asn Gly Ser Pro Lys Pro Leu Glu Asp Phe Cys Gly Glu Asp Lys Thr Val Pro Asp Asp Lys Ser Val Pro Glu Arg Phe Val Gln Glu Gly Glu Ala Ser Glu Met Gly Phe Ile Pro Lys Thr Pro Ser Ala Arg Pro Val Ser Met His Ser Asn Pro Ser Ser Lys Glu Ser Val Val Ala Pro Met Gln Lys Thr Gly Leu Glu Val Asn Ser Ile Glu Asp Thr Ser Val Ala Val Gln Ser Glu Leu Thr Arg Asp Glu Asp Leu Pro Met Thr Pro Glu Pro Ala Phe Ile Leu Asp Glu Thr Val Leu Ala Lys Ile Ile Ser Met Leu Lys Thr Lys Thr Gln Gly Phe Thr Val Glu Gln Leu Glu Thr Cys Tyr Ala Ala Val Leu Glu Leu Val Trp Glu Ala Arg Ser Ser Trp Asp Lys Thr Ser Val Ile Lys Gln Ile Glu Lys Tyr Ile Gly Met <210> 6 <211> 1049 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 45 <400>

gatcgacgtggaccagcacacggagtacgcggtgaccgggagtgcggacttcaktgtgaa60 ggtctggcgcgtacgcgacggcagcatcgcgcactcgtgggacacagcgcacgcccgtgc120 aggcagcgtggagttttcgcccaccggcgaccgtgtgccttgcaggtgcctggataacgt180 gatgaactacgccggcgccatcgtggtgttcagcgtgacgcgggatgcgaacaaccagat240 cactggcttcaacagcggcctttcctgcgagatcctgacgcaggagggctgtgcgcccgt300 gcttgtggcgtcgtggtcgtatgacggcaagtacatcgtggccgggcaccaagacggcaa360 gatcagcaaatacaacggcgtcacgggcgaatgcctggaaatcaaggacctgcacaagca420 gcgcgtctccgacatccaattctcgcttgaccgcacctacttctcacgacctccagagac480 agctacgccaacctagtcgatgtcgagacattcgaggtcctgaagacctacgaaactgac540 tgtccgctgaacagcggttgcatcaccccgctaaaggagttcgtcattctgggcggtggc600 cagacgcgcgcgatgtcacgaccaccagtgcccgcgagggtaagttcgaggccaagttct660 accacaagcttttccaggtggaaatcggccgtgtggacgaccatttcggtcccgtcaact720 acatcgccgtttccccgcagggcacctcgtacgcctccggcggtgaggacggtttcgtgc780 gcctccatcacttcgacaagaggctacttcgacttcaagttcgacgtcgaaaaaagcgcc840 gacgcccagaagaaggtcgacactgctgaccgctgagctacatacctctgtaaactaccc900 tcttgaacagctattttctactgccctgcatcgtaccaggcaaggcctacacacctatac960 actacctgctggccttctcggccttcagccgctccagccgctcgcgctccttgcgctcgt1020 ccgccgcctgctgcttacgccgcaggatc 1049 <210> 7 <211> 153 w 19 <212> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 45 <220>
<221> mist feature <222> (17)..(17) <223> unknown amino acid <400> 7 Asp Val Asp Gln His Thr Glu Tyr Ala Val Thr Gly Ser Ala Asp Phe Xaa Val Lys Val Trp Arg Val Arg Asp Gly Ser Ile Ala His Ser Trp 20 25 3p Asp Thr Ala His Ala Arg Ala Gly Ser Val Glu Phe Ser Pro Thr Gly Asp Arg Val Pro Cys Arg Cys Leu Asp Asn Val Met Asn Tyr Ala Gly Ala Ile Val Val Phe Ser Val Thr Arg Asp Ala Asn Asn Gln Ile Thr Gly Phe Asn Ser Gly Leu Ser Cys Glu Ile Leu Thr Gln Glu Gly Cys Ala Pro Val Leu Val Ala Ser Trp Ser Tyr Asp Gly Lys Tyr Ile Val Ala Gly His Gln Asp Gly Lys Ile Ser Lys Tyr Asn Gly Val Thr Gly Glu Cys Leu Glu Ile Lys Asp Leu His Lys Gln Arg Val Ser Asp Ile Gln Phe Ser Leu Asp Arg Thr Tyr Phe ,. 20 <210> 8 <211> 47 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 45 <400> 8 Leu Thr Thr Ser Arg Asp Ser Tyr Ala Asn Leu Val Asp Val Glu Thr Phe Glu Val Leu Lys Thr Tyr Glu Thr Asp Cys Pro Leu Asn Ser Gly Cys Ile Thr Pro Leu Lys Glu Phe Val Ile Leu Gly Gly Gly Gln <210> 9 <211> 70 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 45 <400> 9 Gly Arg Trp Pro Asp Ala Arg Asp Val Thr Thr Thr Ser Ala Arg Glu Gly Lys Phe Glu Ala Lys Phe Tyr His Lys Leu Phe Gln Val Glu Ile . 21 Gly Arg Val Asp Asp His Phe Gly Pro Val Asn Tyr Ile Ala Val Ser Pro Gln Gly Thr Ser Tyr Ala Ser Gly Gly Glu Asp Gly Phe Val Arg Leu His His Phe Asp Lys <210> 10 <211> 4389 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (640)..(1674) <223>
<400>

gattcgctggagcgcgtgtgcaaggaggccgcgccggggcaggaactgctgctcatcttc60 ggggacctgggacacccacgtgccgccggcgggccgcgacttgttgcgcagcagcctgcg120 cgaacacggcgtggccgcctccttcctggaactgcacgcggcccagcacgctttcgtgcg180 cgacgagttctccaagggccgcttcgacggggccgtcacctccagctgtctggggctgat240 gttcgagcagttcgaccgcctgctgaagcacaaccttggtccgcgcgaggcagacgccgg300 cgagctggagcacgtctgctaaaactacgtaactgccgcttcgatacataacacgccttg360 ggccctgctggccctgctggccctgctggccctgctggccctgctggccctgctggccct420 gctggccctgccggtacgccgcatctctgcacttctacctgcacctttgcaccgggtcat480 cgtggtctagcaagtggctcgccaatatgaaaaattttcgactagttcgcaggccttaga540 gcactatcacccaagtgaacggaccagccagagcgcatctaagtcacttggagggtatct600 gatcacatcacacgcttggccatataccatacttgaaag atc atg 654 atg aga ccg Met Arg Ile Met Pro ttg atg gga cac gag cgt tcg ctc acg cag gtg aaa tat aac cgc gag 702 Leu Met Gly His Glu Arg Ser Leu Thr Gln Val Lys Tyr Asn Arg Glu gga gac cta atc ttc acg tcg ggg aag gat aac gtt gcg tcg gtg tgg 750 Gly Asp Leu Ile Phe Thr Ser Gly Lys Asp Asn Val Ala Ser Val Trp ' 0050/52814 tat gcg atg aac ggc gag cgt ctg gga acg ctg gag ggt cac aat ggt 798 Tyr Ala Met Asn Gly Glu Arg Leu Gly Thr Leu Glu Gly His Asn Gly tcg att tgg tcg atc gac gtg gac cag cac acg gag tac gcg gtg acc 846 Ser Ile Trp Ser Ile Asp Val Asp Gln His Thr Glu Tyr Ala Val Thr ggg agt gcg gac ttc agt gtg aag gtc tgg cgc gta cgc gac ggc agc 894 Gly Ser Ala Asp Phe Ser Val Lys Val Trp Arg Val Arg Asp Gly Ser atc gcg cac tcg tgg gac acg cgc acg ccc gtg cgg cgc gtg gag ttt 942 Ile Ala His Ser Trp Asp Thr Arg Thr Pro Val Arg Arg Val Glu Phe tcg ccc acc ggc gac cgt gtg ctt gcg gtg ctg gat aac gtg atg aac 990 Ser Pro Thr Gly Asp Arg Val Leu Ala Val Leu Asp Asn Val Met Asn tac gcc ggc gcc atc gtg gtg ttc agc gtg acg cgg gat gcg aac aac 1038 Tyr Ala Gly Ala Ile Val Val Phe Ser Val Thr Arg Asp Ala Asn Asn cag atc act ggc ttc aac agc ggc ctt tcc tgc gag atc ctg acg cag 1086 Gln Ile Thr Gly Phe Asn Ser Gly Leu Ser Cys Glu Ile Leu Thr Gln gag ggc tgt gcg ccc gtg ctt gtg gcg tcg tgg tcg tat gac ggc aag 1134 Glu Gly Cys Ala Pro Val Leu Va1 Ala Ser Trp Ser Tyr Asp Gly Lys tac atc gtg gcc ggg cac caa gac ggc aag atc agc aaa tac aac ggc 1182 Tyr Ile Val Ala Gly His Gln Asp Gly Lys Ile Ser Lys Tyr Asn G1y gtcacg ggcgaatgc ctggaaatcaag gacctgcac aagcagcgcgtc 1230 ValThr GlyGluCys LeuGluIleLys AspLeuHis LysGlnArgVal tccgac atccaattc tcgcttgaccgc acctacttc ctcacgacctcc 1278 SerAsp IleGlnPhe SerLeuAspArg ThrTyrPhe LeuThrThrSer agagac agctacgcc aacctagtcgat gtcgagaca ttcgaggtcctg 1326 ArgAsp SerTyrAla AsnLeuValAsp ValGluThr PheGluValLeu aagacc tacgaaact gactgtccgctg aacagcggt tgcatcaccccg 1374 LysThr TyrGluThr AspCysProLeu AsnSerGly CysIleThrPro ctaaag gagttcgtc attctgggcggt ggccaggac gcgcgcgatgtc 1422 LeuLys GluPheVal IleLeuGlyGly GlyGlnAsp AlaArgAspVal acg acc acc agt gcc cgc gag ggt aag ttc gag gcc aag ttc tac cac 1470 Thr Thr Thr Ser Ala Arg G1u Gly Lys Phe Glu Ala Lys Phe Tyr His aag ctt ttc cag gtg gaa atc ggc cgt gtg gac gac cat ttc ggt ccc 1518 ' 0050/52814 Lys Leu Phe Gln Val Glu Ile Gly Arg Val Asp Asp His Phe Gly Pro gtc aac tac atc gcc gtt tcc ccg cag ggc acc tcg tac gcc tcc ggc 1566 Val Asn Tyr Ile Ala Val Ser Pro Gln Gly Thr Ser Tyr Ala Ser Gly ggt gag gac ggt ttc gtg cgc ctc cat cac ttc gac aag agc tac ttc 1614 Gly Glu Asp Gly Phe Val Arg Leu His His Phe Asp Lys Ser Tyr Phe gac ttc aag ttc gac gtc gaa aaa agc gcc gac gcc cag aag aag gtc 1662 Asp Phe Lys Phe Asp Val Glu Lys Ser Ala Asp Ala Gln Lys Lys Val gac act get gac cgctgagcta catacctctg taaactaccc tcttgaacag 1714 Asp Thr Ala Asp ctattttctacgcccgcatcgtaccaggcaagcctacacacctatacactacctgctggc1774 cttctcggccttcagccgctccagccgctcgcgctccttgcgctcgtccgccgcctgctg1834 cttacgccgcaggatctccgcgtcactctccatccgcttcagggggtccccagacttttt1894 ctgccccttggcgctctccttctgcttcttcaggttcttctgccgtgcgagctcgcgctg1954 gtttcctctagccatccttagctgaagagtgtcggaggggccgccacggtggcagcccgc2014 cttgcttatctttgtggccagccctccccacgtgaggtatcacgtggcctcctccgactc2074 ggcggtctgaccttcggaaaaatcggaaaattaagccggtccggaatctccgccggaccg2134 gtgttcttcccctctcgcggtactcgagaaaaatttactgcagctgtttaagttgcgtct2194 catgcgtgcggcgttgtgcgaaccgtcagtgaaaacgtggaaaaaaaatgcatcaacgca2254 ggcgcatactaaatacgaaatatatatagtgggaaagcgcaggcatcgcgagttgcacac2314 aacaggtcgtaatgtgtcttaagcaaaaacaagagcgggcgaaataactgagygraatcc2374 ccctatattcaacaacagtccgcagtatttcccagatctgaactatttatctccatggca2434 cagttattcaaacggtgtcggcaccccaataccaattaacagttccatgattgggaaccc2494 aaacctttccaacgtccccatgaccaagacgtacgatccctacgatgttccacagtcgag2554 ctttcctgcctattttaatccgcgcgcagcgctgaacatgccccaccgcgagaaggttaa2614 ccaatggatagaaaatgttccaatacatattgttcaccgaagagtaccctgactcacgac2674 tgctatagcattgacgagtacatgaactgggaggaggatgaatttgacatgtctttgttc2734 cagcgcggggagaagacccagattaatatggcaaccgtcgacgaactattacaattccag2794 ctgaaacggataacctccatggttttaagactatacgaggaaagcccggaggtcccattg2854 gacaactctgatgctacatcttactgaaatactgattccacatcatcatgattaatactt2914 aatagttttagtatttatatagtatattattaaatagccacggggtgcacatcaacgctg2974 acgccgtacaacggctttcgggccccgacaacattttagcgcatagtaaaactaagtccc3034 atacacagcg aataatcgcccccaagaaagcttcgatcaaaacataagttactctcgagc3094 ggcaagatag gctaacaggaagaggcagtactattggacggggttagcgctgaaaggtgc3154 aaatttgggg ccatgagtaaggaacccggaaagaaggttacgctgaaggaacgcatggta3214 agcgcctctg ctggctcgctggtcacgtcactgtttctcacgccactggacgtggtccgc3274 gtgcggcttc aacagcaagaaatgcttccaagttgtacatgtacaggacagctgtcgaaa3334 ccggcaggga aagtgttttggcaggatgagtgctttgcaaacgtcggctgccgagagcct3394 gctgcgaggc tgcagggaactctggaggggctcaggaagatagcccaactagagggtctg3454 ccgactctgt ggcgagggctggggattacgctcgtaatggcggtgccggctaacgtggtg3514 tacttttccg gctatgaagcactgcgtgataactcgcccttggcatcccggctacctgtg3574 gcaaacccac tagtgtgtggagcatttgcgcggatattggctgcaactactattgcgccg3634 ctggagctat tgcgcacacggctccagagtgtgccccgcgcaagagacacagagcgtaca3694 atatatctga taggcgacctgctgcgagagatgcggcatgaggtttcggttatgggttac3754 cgtgcgctat ttaaaggcttggagatcactttatggagggacgtgcccttcagcgcaatc3814 tattggggaa catacgagttctgtaaaacccagttctgggcccgccatgccgcaacccat3874 aatgcatcaa actgggaccatttcatcggcagttttgcctgcggtagcatgggcggtgct3934 gttgcagcac ttttgacacatccttttgatgtgggcaagacccgcatgcagattgcgatt3994 gccagtccac agcagctaactgtggggggaaaagctacgaaaactgatgactcaagaggc4054 atgttctcat ttttgaatgccattaggaaatcagaaggtattagagcgctatataccggc4114 ctattaccta gggtgatgaagattgcaccaagttgcgccataatgatctcgacttatgaa4174 ctgtcgaaga agttcttcactagttgaactttgtttcttcctgtatataccaagtaattc4234 acactgttga tacacgatacagcatttttcttaaaaccctgtgatatacgcttgctgtag4294 tacacgccca aacggtgaggtctataattttacatgtccgcgagatggtattggatcggc4354 agaattttag agctgccgctgtagcccatccgtcg 4389 <210> 11 <211> 345 <212> PRT
<213> Ashbya gossypii <400> 11 Met Arg Pro Ile Met Leu Met Gly His Glu Arg Ser Leu Thr Gln Val Lys Tyr Asn Arg Glu Gly Asp Leu Ile Phe Thr Ser Gly Lys Asp Asn " 20 25 30 Val Ala Ser Val Trp Tyr Ala Met Asn Gly Glu Arg Leu Gly Thr Leu G1u Gly His Asn Gly Ser Ile Trp Ser Ile Asp Val Asp Gln His Thr Glu Tyr Ala Val Thr Gly Ser Ala Asp Phe Ser Val Lys Val Trp Arg Val Arg Asp Gly Ser Ile Ala His Ser Trp Asp Thr Arg Thr Pro Val 85 90 95 , Arg Arg Val Glu Phe Ser Pro Thr Gly Asp Arg Val Leu Ala Val Leu Asp Asn Val Met Asn Tyr Ala Gly Ala Ile Val Val Phe Ser Val Thr Arg Asp Ala Asn Asn Gln Ile Thr Gly Phe Asn Ser Gly Leu Ser Cys Glu Ile Leu Thr Gln Glu Gly Cys Ala Pro Val Leu Val Ala Ser Trp Ser Tyr Asp Gly Lys Tyr Ile Val Ala Gly His Gln Asp Gly Lys Ile Ser Lys Tyr Asn Gly Val Thr Gly Glu Cys Leu Glu Ile Lys Asp Leu His Lys Gln Arg Val Ser Asp Ile Gln Phe Ser Leu Asp Arg Thr Tyr Phe Leu Thr Thr Ser Arg Asp Ser Tyr Ala Asn Leu Val Asp Val Glu Thr Phe Glu Val Leu Lys Thr Tyr Glu Thr Asp Cys Pro Leu Asn Ser Gly Cys Ile Thr Pro Leu Lys Glu Phe Val Ile Leu Gly Gly Gly Gln Asp Ala Arg Asp Val Thr Thr Thr Ser Ala Arg Glu Gly Lys Phe Glu Ala Lys Phe Tyr His Lys Leu Phe Gln Val Glu Ile Gly Arg Val Asp Asp His Phe Gly Pro Val Asn Tyr Ile Ala Val Ser Pro Gln Gly Thr Ser Tyr Ala Ser Gly Gly Glu Asp Gly Phe Val Arg Leu His His Phe .305 310 315 320 Asp Lys Ser Tyr Phe Asp Phe Lys Phe Asp Val Glu Lys Ser Ala Asp Ala Gln Lys Lys Val Asp Thr Ala Asp <210> 12 <211> 1042 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 45 <220>
<221> misc_feature <223> Oligo 85 <400>

gatctgccgaaatcgttaatttcacctgtaggtcacgtgattgtgaattgtgtttgactg60 ttgcatccgtacattcggaggtgtgtgggttgtatagctgaagattctgcgtcgtccgac120 agactcgctcgcgcacaccgagcggagcacagtcggtttccacagcaggccaacatcttc180 aacagaagaggcagttcatttggagtggctcttagtgcaaaatacagcaaaatcaatcat240 aatggtatgtgtcaggcggtgtatagcgtgggatgatggcatgcagccttttcgttgggt300 atcgaggtgaccgttagaggcttaaatccgtgggacagaagtgcgcgacagcagcgcata360 ccgggttagccagcgagcggtagccgaggggtagatgcggccccgcaggttgccagcaat420 gtcattccaagcttgataggtgcgcggagtactaacatctcatctcaggccggtgttaaa480 .. 27 gcttttgaattgagaaccaagtccaaggagcaactggagcaacagttgatctccttgaag540 caggagr_tggctgctttgaaggtccagaagctatccagaccatcctLgccaaagatcaac600 accgtcagaaagagcattgctcgtgtcttgaccgtcatcaaccagaaccagagacaggct660 gtcagagagttgtacaagggcaagaagtaccagccaaaggacttgagagcaaagaagacc720 agagctttgagaagagctttgacgaagttcgaggctgctcagatcactgagaagcagaga780 aagaagcagattgctttcccacaaagaaagtacgctattaaggcctaaacgtctacggta840 aaccgttgtatgttaatttagtttacttttaagaacccatctttagacccgcgggctcaa900 gcggcggcggcctgccagagggagtagcaggcgaggcgcttttttgatagtgtggaatct960 atacaggaaaggtgactacttattgtttaccttgtttctttgatgctttgaactcctcga1020 ttctctgtttcaactcatgatc 1042 <210> 13 <211> 119 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 85 <400> 13 Ala Gly Val Lys Ala Phe Glu Leu Arg Thr Lys Ser Lys Glu Gln Leu Glu Gln Gln Leu Ile Ser Leu Lys Gln Glu Leu Ala Ala Leu Lys Val Gln Lys Leu Ser Arg Pro Ser Leu Pro Lys Ile Asn Thr Val Arg Lys Ser Ile Ala Arg Val Leu Thr Val Ile Asn Gln Asn Gln Arg Gln Ala Val Arg Glu Leu Tyr Lys Gly Lys Lys Tyr Gln Pro Lys Asp Leu Arg Ala Lys Lys Thr Arg Ala Leu Arg Arg Ala Leu Thr Lys Phe Glu Ala Ml42319-PCT

° 0050/52814 . 28 Ala Gln Ile Thr Glu Lys Gln Arg Lys Lys Gln Ile Ala Phe Pro Gln Arg Lys Tyr Ala Ile Lys Ala <210> 14 <211> 1072 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (92)..(307) <223>
<220>
<221> misc_feature <223> Oligo 85 <220>
<221> CDS
<222> (403)..(858) <223>
<220>
<221> misc_feature <222> (279)..(501) <223> Intron <400> 14 cggtgttccg tcgcgccttt ggcgctcact ttgcgatctg ccgaaatcgt taatttcacc 60 tgtaggtcac gtgattgtga attgtgtttg a ctg ttg cat ccg tac att cgg I12 Leu Leu His Pro Tyr Ile Arg agg tgt gtg ggt tgt ata get gaa gat tct gcg tcg tcc gac aga ctc 160 Arg Cys Val Gly Cys Ile Ala Glu Asp Ser Ala Ser Ser Asp Arg Leu get cgc gca cac cga gcg gag cac agt cgg ttt cca cag cag gcc aac 208 Ala Arg Ala His Arg Ala Glu His Ser Arg Phe Pro Gln Gln Ala Asn atc ttc aac aga aga ggc agt tca ttt gga gtg get ctt agt gca aaa 256 Ile Phe Asn Arg Arg Gly Ser Ser Phe Gly Val A1a Leu Ser Ala Lys tac agc aaa atc aat cat aat ggt atg tgt cag gcg gtg tat agc gtg 304 Tyr Ser Lys Ile Asn His Asn Gly Met Cys Gln Ala Val Tyr Ser Val gga tgatggcatg cagcttttcg ttgggtatcg aggtgaccgt tagaggctta 357 Gly aatccgtggg acagaagtgc gcgacagcag cgcataccgg gttag cca gcg agc ggt 414 Pro Ala Ser Gly agc cga ggg gta gat gcg gcc ccg cag gtt gcc agc aat gtc att cca 462 Ser Arg Gly Val Asp Ala Ala Pro Gln Val Ala Ser Asn Val Ile Pro agc ttg ata ggt gcg cgg agt act aac atc tca tct cag gcc ggt gtt 510 Ser Leu Ile Gly Ala Arg Ser Thr Asn Ile Ser Ser Gln Ala Gly Val 95 loo los aaa get ttt gaa ttg aga acc aag tcc aag gag caa ctg gag caa cag 558 Lys Ala Phe Glu Leu Arg Thr Lys Ser Lys Glu Gln Leu Glu Gln Gln ttg atc tcc ttg aag cag gag ttg get get ttg aag gtc cag aag cta 606 Leu Ile Ser Leu Lys Gln Glu Leu Ala Ala Leu Lys Val Gln Lys Leu tcc aga cca tcc ttg cca aag atc aac acc gtc aga aag agc att get 654 Ser Arg Pro Ser Leu Pro Lys Ile Asn Thr Val Arg Lys Ser Ile~Ala cgt gtc ttg acc gtc atc aac cag aac cag aga cag get gtc aga gag 702 Arg Val Leu Thr Val Ile Asn Gln Asn Gln Arg Gln Ala Val Arg Glu ttg tac aag ggc aag aag tac cag cca aag gac ttg aga gca aag aag 750 Leu Tyr Lys Gly Lys Lys Tyr Gln Pro Lys Asp Leu Arg Ala Lys Lys acc aga get ttg aga aga get ttg acg aag ttc gag get get cag atc 798 Thr Arg Ala Leu Arg Arg Ala Leu Thr Lys Phe GIu A1a Ala Gln Ile act gag aag cag aga aag aag cag att get ttc cca caa aga aag tac 846 Thr Glu Lys Gln Arg Lys Lys Gln Ile Ala Phe Pro Gln Arg Lys Tyr 0050!52814 get att aag gcc taaacgtcta cgtaaaccgt tgtatgttaa tttagtttac 898 Ala Ile Lys Ala ttttaagaacccatctttagacccgcgggctcaagcggcggcggcctgccagagggagta958 gcagcgagcgcttttttgatagtgtggaatctatacaggaaaggtgactacttattgttt1018 accttgtttctttgatgctttgaactcctcgattctctgtttcaactcatgatc 1072 <210> 15 <211> 72 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 85 <220>
<221> misc_feature <222> (279)..(501) <223> Intron <400> 15 Leu Leu His Pro Tyr Ile Arg Arg Cys Val Gly Cys Ile Ala Glu Asp Ser Ala Ser Ser Asp Arg Leu Ala Arg Ala His Arg Ala Glu His Ser Arg Phe Pro Gln Gln Ala Asn Ile Phe Asn Arg Arg Gly Ser Ser Phe Gly Val Ala Leu Ser Ala Lys Tyr Ser Lys Ile Asn His Asn Gly Met Cys Gln Ala Val Tyr Ser Val Gly <210> 16 <211> 152 <212> PRT
Mi42319-PCT

<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 85 <220>
<221> misc_feature <222> (279)..(501) <223> Intron <400> 16 Pro Ala Ser Gly Ser Arg Gly Val Asp Ala Ala Pro Gln Val Ala Ser Asn Val Ile Pro Ser Leu Ile Gly Ala Arg Ser Thr Asn Ile Ser Ser Gln Ala Gly Val Lys Ala Phe Glu Leu Arg Thr Lys Ser Lys Glu Gln Leu Glu Gln Gln Leu Ile Ser Leu Lys Gln Glu Leu Ala Ala Leu Lys Val Gln Lys Leu Ser Arg Pro Ser Leu Pro Lys Ile Asn Thr Val Arg Lys Ser Ile Ala Arg Val Leu Thr Val I1e Asn Gln Asn Gln Arg Gln Ala Val Arg Glu Leu Tyr Lys Gly Lys Lys Tyr Gln Prow Lys Asp Leu Arg Ala Lys Lys Thr Arg Ala Leu Arg Arg Ala Leu Thr Lys Phe Glu Ala Ala Gln Ile Thr Glu Lys Gln Arg Lys Lys Gln Ile Ala Phe Pro Gln Arg Lys Tyr Ala Ile Lys Ala <210> 17 <211> 1011 <212> DNA
<213> Ashbya gossypii <220>
.<221> misc_feature <223> Oligo 133 <220>
<221> misc_feature <222> (439)..(439) <223> unknown nucleotide <400>

cttaccgcgtctcagcagacgtttctgcttctttgagaggggcactggttgagtcaagtc60 gatttcaatttcatcctcggcctttctcttcttggtggggtcgcttagcgctttagcttg120 catatcaacctttgctggccgtggccgattcttcgtctgacatagctccacgcagtagga180 atgtatgtagtgaccctatggattatggtcaagaagtgcgatgcgtgcggagaactatgc240 gttacaccatagctcatcgcatctcaaaaattttcgaatcaccgaaaattcaggtcacgt300 gatttataataggccctcacttgaaaatctcagtccaccagcagacaaacatatgtcggt360 tgctgaacggggcacgacaaaactggcggcatcccgtgtaacgctcgcaagattatttca420 gaaccaaattactctttcngkcgkatttttgtatctggtatataccatctacccattaaa480 taagccgagcccagtccgtgatttgcgcggcatcaacattgcatagtatggcggtactat540 catgtcacttgccttgtaaaccgatgattaattagctcgaattgctgaagcgggcgaccc600 ttgctaaacgtactaatcaacgtctctcttcattataggtaaaacgtcaggggatcggca660 cgcagatcttgaactaaaataaaataacgaaatgggatgaatgtataattagagcagtca720 gatagttccatgagaatatgagaataaccgagaacgaactagagttccctagatttcagg780 ccgtgggataagggcttcggtgtacggcgctttaagttcacctcaaaaatctcttcaacc840.

tagcaaagaatccggaccttctctttggttcagtggaagagcggctagggctagaattgc900 tgttcttgctagaaggcctgccgttgtgagcatcaaagctctgcttcgtgcttggagcgg960 tagccatactagcagcatccttagaatgacgtgactgcgttacagaagatc 1011 ' 0050/52814 <210> I8 <211> 38 <212> PFT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 133 <400> 18 Lys Ala Leu Ser Asp Pro Thr Lys Lys Arg Lys Ala Glu Asp Glu Ile Glu Ile Asp Leu Thr Gln Pro Val Pro Leu Ser Lys Lys Gln Lys Arg Leu Leu Arg Arg Gly Lys <210> 19 <211> 3091 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (1371)..(2495) <223>
<220>
<221> misc_feature <223> Oligo 133 <400> 19 ttctgaggct catgtgacac cggtaactaa cgttccagta tctgagcaga tattcttcgc 60 ' 0050/52814 cgaaggtgac tcagccagtt gtcgaatcaa gccctgccac tgaatcggag aaggtaatta 120 aggcacctgc tgttgctgct cacgagatat tcccacctca tgtggtcaag ctaacaccgg 180 tgtcgcctaagaagaagacgtccaccgggagcttgaagaagcagattattgcgcctagag240 aagaggagcagccacagcctgttcacgcagtgacaggtactgccattgagctcgaggagg300 ttccatcgacggtggaacttgtcgaggtacctccatctgaagtgcccacgactcattccc360 ctattgtcgtcggaataccactatcaaatgacaagattgtcgtcgcccctgtgcagatac420 aaggagatatcacgacacagacgtctgctccaagtactcagtacactgacacatatgctg480 ctcccgtccgccaggatgtgcctcttgctacgaccgctggcagatcttctgtaacgcagt540 cacgtcattctaaggatgctgctagtatggctaccgctccaagcacgaagcagagctttg600 atgctcacaacggcaggccttctagcaagaacagcaattctagccctagccgctcttcca660 ctgaaccaaagagaaggtccggattctttgctaggttgaagagatttttgaggtgaactt720 aaagcgccgtacaccgaagcccttatcccacggcctgaaatctagggaactctagttcgt780 tctcggttattctcatattctcatggaactatctgactgctctaattatacattcatccc840 atttcgttattttattttagttcaagatctgcgtgccgatcccctgacgttttacctata900 atgaagagagacgttgattagtacgtttagcaagggtcgcccgcttcagcaattcgagct960 aattaatcatcggtttacaaggcaagtgacatgatagtaccgccatactatgcaatgttg1020 atgccgcgcaaatcacggactgggctcggcttatttaatgggtagatggtatataacaga1080 tacaaaaatacgaccgaaagagtaatttggttctgaaataatcttgcgagcgttacacgg1140 gatgccgccagttttgtcgtgccccgttcagcaaccgacatatgtttgtctgctggtgga1200 ctgagattttcaagtgagggcctattataaatcacgtgacctgaattttcggtgattcga1260 aaatttttgagatgcgatgagctatggtgtaacgcatagttctccgcacgcatcgcactt1320 cttgaccataatccatagggtcactacatacattcctactgcgtggagctatg tca 1376 Met Ser '. 1 gac gaa atg caa aaa gcg 1424 gaa tcg get gcc acg gcc agc aaa gtt gat Asp Glu Met Gln Lys Ala Glu Ser Ala Ala Thr Ala Ser Lys Val Asp cta agc ccc acc gat gaa gaa atc 1472 gac aag aag att aga aag gcc gag Leu Ser Asp Glu Glu Ile Asp Pro Ile Thr Lys Lys Arg Lys Ala Glu gac ttg caa cca g ccc cag aaa ctg ctg 1520 act gt ctc tca cgt aag aag Asp Leu Gln Pro l Pro Gln Lys Leu Leu Thr Va Leu Ser Arg Lys Lys aga cgc aag atc c ctc ag ctc gag aag aac atc 1568 ggt ac gaa c agc ttc Arg Arg Glu Lys Asn Ile Gly Lys Phe Ile Thr Leu Glu Gln Leu Ser gat caa tcc atc g gag ag aac caa aag aca gca 1616 aag ga tac a gag gaa Asp Gln Lys Ser Ile Glu Glu Tyr Lys Asn Glu Gln Lys Glu Thr Ala gag aac gac gat gcc gaa cca get gcc gag gag gag cca aag cct gcg 1664 Glu Asn Asp Asp Ala Glu Pro Ala Ala Glu Glu Glu Pro Lys Pro Ala ccc cgc aaa gag aag aag ttc ggc gtc tgg atc ggt aac atg get ttc 1712 Pro Arg Lys Glu Lys Lys Phe Gly Val Trp Ile Gly Asn Met Ala Phe gac acc acg cag gag gag ctt cgc cgc ttt gtt gtt tcc aag acc get 1760 Asp Thr Thr Gln Glu Glu Leu Arg Arg Phe Val Val Ser Lys Thr Ala ggc atg gag gca ggc gag gtc aca gac get gac atc gtg cgt gtg aat 1808 Gly Met Glu Ala Gly G1u Val Thr Asp Ala Asp Ile Val Arg Val Asn atg ccg ctg gcc aag aac gac ggc aaa cag atc aaa aac aag ggc ttt 1856 Met Pro Leu Ala Lys Asn Asp Gly Lys Gln Ile Lys Asn Lys Gly Phe gcg tac gtg gac ttt gcg act agt gcg cag atg gat gca gta atc ggc 1904 Ala Tyr Val Asp Phe Ala Thr Ser Ala Gln Met Asp Ala Val Ile Gly ctc agc gaa gca cag ctc aac gga cgc aac ttg ctg atc aag aac gcc 1952 Leu Ser Glu Ala Gln Leu Asn Gly Arg Asn Leu Leu Ile Lys Asn Ala aag agc tac gac ggc cgc ccg gcg aag aac gac ctc atc tcg atg tcc 2000 Lys Ser Tyr Asp Gly Arg Pro Ala Lys Asn Asp Leu Ile Ser Met Ser aaa aac cct cct tct cgc att ttg ttt gtc ggc aac ctc tcc ttc gac 2048 Lys Asn Pro Pro Ser Arg Ile Leu Phe Val Gly Asn Leu Ser Phe Asp acc acc gat gag ctg ctg aaa aag cat ttc cag cac tgc ggc gag atc 2096 Thr Thr Asp Glu Leu Leu Lys Lys His Phe Gln His Cys Gly Glu Ile gtc aaa atc cgc atg gcc acc ttc cag gac tcc ggc aag tgc aag ggt 2144 Val Lys Ile Arg Met Ala Thr Phe Gln Asp Ser Gly Lys Cys Lys Gly ttc gcc ttc gtt gac ttc cgc gac gag gcc ggt gcc acc gcc gcc ctc 2192 Phe Ala Phe Val Asp Phe Arg Asp Glu Ala Gly Ala Thr Ala Ala Leu aca gac cgc tcc tgt cgc gcc ata gca ggt cgc ccg ctc cgg atg gag 2240 Thr Asp Arg Ser Cys Arg Ala Ile Ala Gly Arg Pro Leu Arg Met Glu tac ggc gag gac cgc agc aag cgc cac gtc cgc agc cgc ccg gcg ccc 2288 Tyr Gly Glu Asp Arg Ser Lys Arg His Val Arg Ser Arg Pro Ala Pro tcg ctc gtc gac gcc gag cct cat gcg cct gcc ccc get gac cca gca 2336 Ser Leu Val Asp Ala Glu Pro His Ala Pro Ala Pro Ala Asp Pro Ala _ ccc gcg ccc gcg ccc gcg cct gcc cct agg gcg ccc cgg ccc cgc aag 2384 Pro Ala Pro Ala Pro Ala Pro Ala Pro Arg Ala Pro Arg Pro Arg Lys ccc acg cgc aat gac cac cac agc cgc cct aag agc agc gtc gcc ctc 2432 Pro Thr Arg Asn Asp His His Ser Arg Pro Lys Ser Ser Val Ala Leu gcc tcc gcc cag cgc gcc tca gcc gcc atc gtt ccc tct cag ggt aag 2480 Ala Ser Ala Gln Arg Ala Ser Ala Ala Ile Val Pro Ser Gln Gly Lys aag gtc aag ttt gat tagcatgcat ctctacatac cgaatgtaca ttagttattg 2535 Lys Val Lys Phe Asp tgcccgctgcgttgctcggtctgctaccctacgcccgcataccgtccgttctttcgactc2595 tcgcctcggcgtatgtgatgcagcacactgcatgcagcatcgaccccggggaacatgaac2655 aaccacgtactgccaacatactagccggccaatgcaaggcaaaaaggaccaagatcgagg2715 tcagggatgtcacaagatgatatgcccttgtgtgaaagtatttttggtcaacctggttgc2775 tacgttgagtacctaaaaaaggaaggatccattaggctcgataggttctacggtacaatt2835 atattctcgacacggcattggatgcaagactctgaggaagcggaggtgtaactactagga2895 gagttaagcatggggtataacaatacgagctctccaataggctcagggcatgggagttcg2955 ggggtggaaaaggcatccaggcccagttcggtgcagtcgacgacgcagatgggagcacgt3015 cattccgagagcatgaatctgtccgtgagctggctctcgacggatgcgtggagcgcggcg3075 gagtttgcgacactgg 3091 <210> 20 <211> 375 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 133 <400> 20 Met Ser Asp Glu Glu Ser Ala Thr Ala Ser Lys Val Asp Met Gln Ala Lys Ala Leu Ser Asp Pro Thr Lys Lys Arg Lys Ala Glu Asp Glu Ile Glu Ile Asp Leu Thr Gln Pro Val Pro Leu Ser Lys Lys Gln Lys Arg Leu Leu Arg Arg Gly Lys Ile Thr Leu Glu Gln Leu Ser Glu Lys Phe Asn Ile Asp Gln Lys Ser Ile Glu Glu Tyr Lys Asn Glu Gln Lys Glu 65 70 75 g0 Thr Ala Glu Asn Asp Asp Ala Glu Pro Ala Ala Glu Glu Glu Pro Lys Pro Ala Pro Arg Lys Glu Lys Lys Phe Gly Val Trp Ile Gly Asn Met Ala Phe Asp Thr Thr Gln Glu Glu Leu Arg Arg Phe Val Val Ser Lys Thr Ala Gly Met Glu Ala Gly Glu Val Thr Asp Ala Asp Ile Val Arg Val Asn Met Pro Leu Ala Lys Asn Asp Gly Lys Gln Ile Lys Asn Lys Gly Phe Ala Tyr Val Asp Phe Ala Thr Ser Ala Gln Met Asp Ala Val Ile Gly Leu Ser Glu Ala Gln Leu Asn Gly Arg Asn Leu Leu Ile Lys Asn Ala Lys Ser Tyr Asp Gly Arg Pro Ala Lys Asn Asp Leu Ile Ser Met Ser Lys Asn Pro Pro-Ser Arg Ile Leu Phe Val Gly Asn Leu Ser Phe Asp Thr Thr Asp Glu Leu Leu Lys Lys His Phe Gln His Cys Gly Glu Ile Val Lys I1e Arg Met Ala Thr Phe Gln Asp Ser Gly Lys Cys Lys Gly Phe Ala Phe Val Asp Phe Arg Asp Glu Ala Gly Ala Thr Ala Ala Leu Thr Asp Arg Ser Cys Arg Ala Ile Ala Gly Arg Pro Leu Arg Met Glu Tyr Gly Glu Asp Arg Ser Lys Arg His Val Arg Ser Arg Pro Ala Pro Ser Leu Val Asp Ala Glu Pro His Ala Pro Ala Pro Ala Asp Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Arg Ala Pro Arg Pro Arg Lys Pro Thr Arg Asn Asp His His Ser Arg Pro Lys Ser Ser Val Ala Leu Ala Ser Ala Gln Arg Ala Ser Ala Ala Ile Val Pro Ser Gln Gly Lys Lys Val Lys Phe Asp <210> 21 <211> 1687 <212> DNA
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 172 <400>

gatcagccatgtgtcatctattgcacagctaaaccgtcgcatataccagcaggatagaga60 gggcgatgttctgcggaatattcctgtagtgtaccacagagctagttcgtcaacctgtgg120 cctggtccacctcactatccttctccctatcaacgaggagaccgctctatctgtactcac180 gacagcaggccagccaacctttgctgttcgcatccccgcagatccagtagcgagggcact240 gattgctcttagcgacacccccattgctgcgccgtcggctaacgtctcaactaggccttc300 tccgacggccgctgagcatgtataccatgacttaaagggaaagataccacctaattctag360 atggtggaagttgccgtgttggggttgagtctactgtcatcgatggcttggtaaatccgc420 caatgttgttacgtcctggaggatttacgtatgaagaaatcatcgaactaggcggggagc480 aatggtcccattgtaaagttgagaataggatgactgtagggagtggggaaaaggttagaa540 ctcccggtatgaagtacaaacattactctcctagggcctccactgtagcatttgccccaa600 ttaacgatga tcttccaacg agcgaaagga tgaagattgt gacctccgaa ataatgaaat 660 acatgacaag ccatggcacc gataagcgcc aaaaagtggg gctactgaca agcattatgt 720 tccccaataa cttactggaa tccattacgg acgaagttga tgttgtggtt tattcattgg 780 gctcctctgg gaaagaagtt caatcgaatt tgtttgccat gctgcgaagg ctggacgagg 840 aagatgaggt ggatttgata tttgttgaag gtattagcga taggaatgag ggactggcag 900 tgatgaatag attaagaaaa gccgctgggg ggaacgtagt gtcattttaa tgaaccgggt 960 agtcgcacat ttcatcgtca atagaaacag ccggtgggca atattgatcg atcgttttgt 1020 gtcgcttgtt ggataacttt atctgataaa tacaccctat atgcttgtgt atatgtttag 1080 tatataaatg actttatcat ctctggatga aaaaataaga gaaaacaaca tacgcactct 1140 gtgaattaaa ccatggaaaa gtaatatgcg tcttgatggg tattcttttt ggcgtaatac 1200 tttcgaactt catctgcaat gaaaacactg ctactgatta caatcaaata aatgagatcc 1260 cccaggctca ggcgctctgt cttgaagata ttctggaaaa atggaatgta aatagcgcac 1320 aactgaccta gtaatgagaa accaacagca tagttaaaca tcttattatt gaagatacca 1380 atttcgaaaa tggacttcgt aggcatgcct acacgctaga ggctgctgaa catatcaaaa 1440 aacacgaaac aggtaaacgt cattgtggtg tctctcgcag taacctgtcc atcctcagtc 1500 atttccttga tgaacacgta gatagtacca ccaatgataa aggctgcatt gataaggagt 1560 ctccgcataa cttggggagg tcaagatctt gtctgaacgt tttcttggag gcttcctcat 1620 tacttcgtgg tcaactggct ccacacctag ggattgcgcg ggtggaccgt ccatcaatat 1680 gttgatc <210> 22 <211> 116 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 172 <400> 22 Ile Ser His Val Ser Ser Ile Ala Gln Leu Asn Arg Arg I1e Tyr Gln Gln Asp Arg Glu Gly Asp Val Leu Arg Asn Ile Pro Val Val Tyr His Arg Ala Ser Ser Ser Thr Cys Gly Leu Val His Leu Thr Ile Leu Leu Pro Ile Asn Glu Glu Thr Ala Leu Ser Val Leu Thr Thr Ala Gly Gln Pro Thr Phe Ala Val Arg Ile Pro Ala Asp Pro Val Ala Arg Ala Leu Ile Ala Leu Ser Asp Thr Pro Ile Ala Ala Pro Ser Ala Asn Val Ser Thr Arg Pro Ser Pro Thr Ala Ala Glu His Val Tyr His Asp Leu Lys Gly Lys Ile Pro <210> 23 <211> 204 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 172 <400> 23 Arg Glu Arg Tyr His Leu Ile Leu Asp Gly Gly Ser Cys Arg Val Gly Val Glu Ser Thr Val Ile Asp Gly Leu Val Asn Pro Pro Met Leu Leu Arg Pro Gly Gly Phe Thr Tyr Glu Glu Ile Ile Glu Leu Gly Gly Glu Gln Trp Ser His Cys Lys Val Glu Asn Arg Met Thr Val Gly Ser Gly Glu Lys Val Arg Thr Pro Gly Met Lys Tyr Lys His Tyr Ser Pro Arg Ala Ser Thr Val Ala Phe Ala Pro Ile Asn Asp Asp Leu Pro Thr Ser Glu Arg Met Lys Ile Val Thr Ser Glu Ile Met Lys Tyr Met Thr Ser His Gly Thr Asp Lys Arg Gln Lys Val Gly Leu Leu Thr Ser Ile Met Phe Pro Asn Asn Leu Leu Glu Ser Ile Thr Asp Glu Val Asp Val Val Val Tyr Ser Leu Gly Ser-Ser Gly Lys Glu Val Gln Ser Asn Leu Phe Ala Met Leu Arg Arg Leu Asp Glu Glu Asp Glu Val Asp Leu Ile Phe Val Glu Gly Ile Ser Asp Arg Asn Glu Gly Leu Ala Val Met Asn Arg Leu Arg Lys Ala Ala Gly Gly Asn Val Val Ser Phe <210> 24 <211> 2641 <212> DNA
<213>~ Ashbya gossypii <220>
<221> CDS
<222> (277)..(1476) <223>
<220>
<221> mist feature <223> Oligo 172 <400> 24 caagaccaat ccggtcccat tctatcgga acgttgttgttcggagca ccataccgtt 60 c ga tgatggggcg gcaaaggcgt t cgatcacg tgacataact gagaaaaatc gaattacat tt gctgcgtctt cgaactgctc tggcatccg gttgtatgtctataatgaactgatgccg g cc cagaacacaa gtgtatttgg ttgacagt ttatgcagag gtccttctct tggcctcgaa tt tttcttcgga ggtcaggttt gtcatataacact aaggtactg 294 tcatagcgca at TyrAsnThr LysValLeu agggtagaccca agtgcg atacacttctcg gcaactgcg catattgat 342 ArgValAspPro SerAla IleHisPheSer AlaThrAla HisIleAsp gggtccctgccg cggatt tcggacccagag acggagaaa cacttactc 390 GlySerLeuPro ArgIle SerAspProGlu ThrGluLys HisLeuLeu gaggetgccaga cttatc cgggatgatggc gagacggtt gcgtttccg 438 GluAlaAlaArg LeuIle ArgAspAspGly GluThrVal AlaPhePro acagaaactgta tatgga ctgggggggtcg tctctgaat gatacttcg 486 ThrGluThrVal TyrGly LeuGlyGlySer SerLeuAsn AspThrSer gtgcgcaatatc tacaag gcaaagaacaga cccagtgac aatccactg 534 ValArgAsnIle TyrLys AlaLysAsnArg ProSerAsp AsnProLeu atcagccatgtg tcatct attgcacagcta aaccgtcgc atataccag 582 IleSerHisVal SerSer IleAlaGlnLeu AsnArgArg IleTyrGln caggatagagag ggcgat gttctgcggaat attcctgta gtgtaccac 630 GlnAspArgGlu GlyAsp ValLeuArgAsn IleProVal ValTyrHis -gagctagttcgt caactg tggcctggtcca ctcactatc cttctccct 678 GluLeuValArg GlnLeu TrpProGlyPro LeuThrIle LeuLeuPro atcaacgaggag accget ctatctgtactc acgacagca ggccagcca 726 IleAsnGluGlu ThrAla LeuSerValLeu ThrThrAla GlyGlnPro acctttgetgtt cgcatc cccgcagatcca gtagcgagg gcactgatt 774 ThrPheAlaVal ArgIle ProAlaAspPro ValAlaArg AlaLeuIle getcttagcgac accccc attgetgcgccg tcggetaac gtctcaact 822 AlaLeuSerAsp ThrPro IleAlaAlaPro SerAlaAsn ValSerThr aggccttctccg acggcc getgagcatgta taccatgac ttaaaggga 870 ArgProSerPro ThrAla AlaGluHisVal TyrHisAsp LeuLysGly aag ata cca cta att cta gat ggt gga agt tgc cgt gtt ggg gtt gag 918 Lys Ile Pro Leu Ile Leu Asp Gly Gly Ser Cys Arg Val Gly Val Glu tct act gtc atc gat ggc ttg gta aat ccg cca atg ttg tta cgt cct 966 Ser Thr Val Ile Asp Gly Leu Val Asn Pro Pro Met Leu Leu Arg Pro gga gga ttt acg tat gaa gaa atc atc gaa cta ggc ggg gag caa tgg 1014 Gly Gly Phe Thr Tyr Glu Glu Ile Ile Glu Leu Gly Gly Glu Gln Trp tcc cat tgt aaa gtt gag aat agg atg act gta ggg agt ggg gaa aag 1062 Ser His Cys Lys Val Glu Asn Arg Met Thr Val Gly Ser Gly Glu Lys gttagaactcccggt atgaagtac aaacattac tctcctagggcc tcc 1110 ValArgThrProGly MetLysTyr LysHisTyr SerProArgAla Ser actgtagcatttgcc ccaattaac gatgatctt ccaacgagcgaa agg 1158 ThrValAlaPheAla ProIleAsn AspAspLeu ProThrSerGlu Arg atgaagattgtgacc tccgaaata atgaaatac atgacaagccat ggc 1206 MetLysIleValThr SerGluIle MetLysTyr MetThrSerHis Gly accgataagcgccaa aaagtgggg ctactgaca agcattatgttc ccc 1254 ThrAspLysArgGln LysValGly LeuLeuThr SerIleMetPhe Pro aataacttactggaa tccattacg gacgaagtt gatgttgtggtt tat 1302 AsnAsnLeuLeuGlu SerIleThr AspGluVal AspValValVal Tyr tcattgggctcctct gggaaagaa gttcaatcg aatttgtttgcc atg 1350 SerLeuGlySerSer GlyLysGlu ValGlnSer AsnLeuPheAla Met ctgcgaaggctggac gaggaagat gaggtggat ttgatatttgtt gaa 1398 LeuArgArgLeuAsp GluGluAsp GluValAsp LeuIlePheVat.Glu ggt att agc gat agg aat gag gga ctg gca gtg atg aat aga tta aga 1446 Gly Ile Ser Asp Arg Asn Glu Gly Leu Ala Val Met Asn Arg Leu Arg aaa gcc get ggg ggg aac gta gtg tca ttt taatgaaccg ggtagtcgca 1496 Lys Ala Ala Gly Gly Asn Val Val Ser Phe catttcatcgtcaatagaaacagccggtgggcaatattgatcgatcgttttgtgtcgctt1556 gttggataactttatctgataaatacaccctatatgcttgtgtatatgtttagtatataa1616 atgactttatcatctctggatgaaaaaataagagaaaacaacatactgcactctgtgaat1676 taaaccatggaaaagtaatatgcgtcttgatgggtattctttttggcgtaatactttcga1736 acttcatctgcaatgaaaacactgctactgattacaatcaaataaatgagatcccccagg1796 ctcaggcgct ctgtcttgaagatattctggaaaaatggaatgtaaatagcgcacaactga1856 cctagtaatg agaaaccaacagcatagttaaacatcttattattgaagataccaatttcg1916 aaaatggact tcgtaggcatgcctacacgctagaggctgctgaacatatcaaaaaacacg1976 aaacaggtaa acgtcattgtggtgtctctcgcaggtaacctgtccatcctcagtcatttc2036 cttgatgaac acgtagatagtaccaccaatgataaaggctgcattgataaggagtctccg2096 -cataacttggggagtcaagatcttgtctgaacgttttcttggaggcttcctcattacttc2156 gtggtcaact ggctccacacctagggattgcgcgggtggaccgtccatcaatatgttgat2216 ccataatatc tgcatggcatttaacggattttgaagcttaaatgcagtagctatggcgac2276 aagtgacaag gctgcgacagaggtagacaattgaaacgttagaaaactctgaatattgtt2336 aaaaataccc ttgccttcttcaatagcggttaggatggtgctgaagtcatcatcagttaa2396 taccatatca aaagcttctttcgcaacatcagtacccatatggcccatggcgacaccgat2456 atcagccaat ttcaatgcaggtgcgtcgttaacaccatctcctgtcatagcgacaatgtc2516 gcccctcttc tgcaaagcacgcacaatattcagcttgtgttcacgtgtagcccgagcaaa2576 aatattcaca tgatcgatccgccggccagatggtccatcaatcctttggtcaagtctatc2636 accgg 2641 <210> 25 <211> 400 <212> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 172 <400> 25 Tyr Asn Thr Lys Val Leu Arg Val Asp Pro Ser Ala Ile His Phe Ser Ala Thr Ala His Ile Asp Gly Ser Leu Pro Arg Ile Ser Asp Pro Glu Thr Glu Lys His Leu Leu Glu Ala Ala Arg Leu Ile Arg Asp Asp Gly Glu Thr Val Ala Phe Pro Thr Glu Thr Val Tyr Gly Leu Gly Gly Ser .. 45 Ser Leu Asn Asp Thr Ser Val Arg Asn Ile Tyr Lys Ala Lys Asn Arg Pro Ser Asp Asn Pro Leu Ile Ser His Val Ser Ser Ile Ala Gln Leu Asn Arg Arg Ile Tyr Gln Gln Asp Arg Glu Gly Asp Val Leu Arg Asn Ile Pro Val Val Tyr His Glu Leu Val Arg Gln Leu Trp Pro Gly Pro Leu Thr Ile Leu Leu Pro Ile Asn Glu Glu Thr Ala Leu Ser Val Leu Thr Thr Ala Gly Gln Pro Thr Phe Ala Val Arg Ile Pro Ala Asp Pro Val Ala Arg Ala Leu Ile Ala Leu Ser Asp Thr Pro Ile Ala Ala Pro 165 . 170 175 Ser Ala Asn Val Ser Thr Arg Pro Ser Pro Thr Ala Ala Glu His Val Tyr His Asp Leu Lys Gly Lys Ile Pro Leu Ile Leu Asp Gly Gly Ser Cys Arg Val Gly Val Glu Ser Thr Val Ile Asp GIy Leu Val Asn Pro Pro Met Leu Leu Arg Pro Gly Gly Phe Thr Tyr Glu Glu Ile Ile Glu Leu Gly Gly Glu Gln Trp Ser His Cys Lys Val Glu Asn Arg Met Thr Val Gly Ser Gly Glu Lys Val Arg Thr Pro Gly Met Lys Tyr Lys His Tyr Ser Pro Arg Ala Ser Thr Val Ala Phe Ala Pro Ile Asn Asp Asp Leu Pro Thr Ser Glu Arg Met Lys Ile Val Thr Ser Glu Ile Met Lys Tyr Met Thr Ser His Gly Thr Asp Lys Arg Gln Lys Va1 Gly Leu Leu Thr Ser Ile Met Phe Pro Asn Asn Leu Leu Glu Ser Ile Thr Asp Glu Val Asp Val Val Val Tyr Ser Leu Gly Ser Ser Gly Lys Glu Val Gln Ser Asn Leu Phe Ala Met Leu Arg Arg Leu Asp Glu Glu Asp Glu Val Asp Leu Ile Phe Val Glu Gly Ile Ser Asp Arg Asn Glu Gly Leu Ala Val Met Asn Arg Leu Arg Lys Ala Ala Gly Gly Asn Val Val Ser Phe <210> 26 <211> 609 <212> DNA
<213> Ashbya gossypii <220>
<221> misc feature ' <223> Oligo 63 <220>
<221> misc feature <222> (470)..(470) <223> unknown nucleotide <220>
<221> misc feature <222> (518)..(518) <223> unknown nucleotide <220>

<221> misc_feature <222> (536)..(536) <223> unknown nucleotide <400>

gatcataaacgaagaattcctaattaacaatttgtcctgcatgtacttcctcagtgagaa 60 atagcagatataatcattagaaagcttccccgagcactttagcagcaccgcatgccagca 120 taaccccctggactcagggcagtatgccaggctggcacctcggcacctcatcgcaggcga 180 gacagtccaccactgcgagcaccgtagtatttatacttttccaggttgaaaaattttcga 240 ccgccccacgccgcagagggctggacgcgcattagggctcacagcggtcgactgccactg 300 ctgccccaacagcgccgcgcatgtaacgtgaaatgatatattataccttctgactacaat 360 gtgaaatatacaaaggtggctcataggcgcattgcatttattcagacgcagtagctctgg 420 tgtagatagcctgcttggagtgcttggagattggcttgatgatgccctcngtctccaagt 480 gtctcatagcaactctggccatggaaccgccgatcttnaatctgtcgaccaacacngaca 540 cagagacgtatctgtagggttgggaccctcctttaagattctgtcaagcttgtcctggtc 600 caagatgac 609 <210> 27 <211> 16 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 63 <400> 27 Val Ile Leu Asp Gln Asp Lys Leu Asp Arg Ile Leu Lys Glu Gly Pro <210> 28 <211> 52 <212> PRT

<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 63 <220>
<221> misc feature <222> (13)..(13) <223> unknown amino acid <400> 28 Tyr Arg Tyr Val Ser Val Ser Val Leu Val Asp Arg Xaa Lys Ile Gly Gly Ser Met Ala Arg Val Ala Met Arg His Leu Glu Thr Glu Gly Ile Ile Lys Pro Ile Ser Lys His Ser Lys Gln Ala Ile Tyr Thr Arg Ala Thr Ala Ser Glu <210>29 <211>1850 <212>DNA

<213>Ashbya gossypii <220>
<221> CDS
<222> (533)..(856) <223>
<220>

0050!52814 . 49 <221> misc_feature <223> Oligo 63 <400>

tagccgcgatctaccaagcgctgccggtacccttacagcccgcctccaacacgtccgtgt60 gccgtcttgtctccgcagccgctgctcttcccattagtttctccgctccgcttcgaaccc120 cagccctcaacgggcggcggcgctagccgctgcaccaccaaagcgaaaattgtaaatcgt180 cgcttacgaaagagggtaccccttctgtgactgcacatccgtacatccatggactccgcc240 aaatctgagttcggaccgacgcaatactggttccgcaacgggccctgctcaccactgaat300 cctcccacgctctattgattaaagcagaagagctaagtaagtcgctgaagtctggcaaag360 tagaaaccagctaggaacatttagagtatgtgagaggacatgtgggaccaacgccgttga420 ggcgcgtaggcgttcaggcgcgcaggaggctaccggcacgcctgcagccacgcctgccgc480 cagaagagcggccagctcgctgccggacagctactaacgagcacacagtaat atg 538 cca Met Pro ccaaaa caacaattatct aaggcccag aaggccgcc gccgccatg gcc 586 ProLys GlnGlnLeuSer LysAlaGln LysAlaAla AlaAlaMet Ala ggtggt aagaagtccaag aagaagtgg tccaagaag tcccacaag gac 634 GlyGly LysLysSerLys LysLysTrp SerLysLys SerHisLys Asp aaggcc cagcacgccgtc atcttggac caggacaag cttgacaga atc 682 LysAla GlnHisAlaVal IleLeuAsp GlnAspLys LeuAspArg Ile ctaaag gaggtcccaacc tacagatac gtctctgtg tccgtgttg gtc 730 LeuLys GluValProThr TyrArgTyr ValSerVal SerValLeu Val gacaga ttgaagatcggc ggttccatg gccagagtt getttgaga cac 778 AspArg LeuLysIleGly GlySerMet AlaArgVal AlaLeuArg His ttggag accgagggcatc atcaagcca atctccaag cactccaag cag 826 LeuGlu ThrGluGlyIle IleLysPro IleSerLys HisSerLys Gln get atc acc aga get act tct gaa 876 tac gcg taaatgcaat gcgcctatga Ala Ile Thr Arg Ala Thr Ser Glu Tyr Ala gccacctttgtatatttcac attgtagtcagaaggtataatatatcatttcacgttacat936 gcgcggcgctgttggggcag cagtggcagtcgaccgctgtgagccctaatgcgcgtccag996 ccctctgcggcgtggggcgg tcgaaaatttttcaacctggaaaagtataaatactacggt1056 gctcgcagtggtggactgtc tcgcctgcgatgaggtgccgaggtgccagccggcatactg1116 .. 50 ccctgagtccagggggttatgctggcatgcggtgctgctaaagtgctcggggaagctttc1176 taatgattatatcgctatttctcactgaggaagtacatgcaggacaaattgttaattagg1236 aattcttcgtttatgatcggagagcacctcccccagcgcagcactgcgcagcccaaccat1296 gagaccatggtgtccgacagaaggtgtgcttcgccgttctatgatgaatagcttccacag1356 ctctcgatccggcgatgattctcaggaatatgtgccaggatatatcatgcatcaccatct1416 gagattcgaacaggtaaagtcttctgctggattggccgtatgcgttcttctagatgatga1476 taaaactttttattcagttctgcttctgaacatctaggaagataactctattaccaaagc1536 tcaaaactctgacaggaggaacgcataacggtctgggctgctagtgccaaagagtaacgt1596 aaaatctaacgaaagtacttagtgggcagggccgcctgctcagagcctcttgcgggcctc1656 ttcctgagtgaccttctgctcccgtagtttccggagcaggaagtcttgcacggcgtccca1716 gcgttcgcgctggctcgcggggaaccacacgcttcagcttggaaagaatccgcaccacgg1776 ttgtctgcacgtaaaagggaaaagttcagctttgagccagtagatggcccagtagaagaa1836 cagcgcgaaccccc 1850 <210> 30 <211> 108 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 63 <400> 30 Met Pro Pro Lys Gln Gln Leu Ser Lys A1a Gln Lys Ala Ala Ala Ala Met Ala Gly Gly Lys Lys Ser Lys Lys Lys Trp Ser Lys Lys Ser His Lys Asp Lys Ala Gln His Ala Val Ile Leu Asp Gln Asp Lys Leu Asp Arg Ile Leu Lys Glu Val Pro Thr Tyr Arg Tyr Val Ser Val Ser Val Leu Val Asp Arg Leu Lys Ile Gly Gly Ser Met Ala Arg Val Ala Leu Arg His Leu Glu Thr Glu Gly Ile Ile Lys Pro Ile Ser Lys His Ser Lys Glri Ala Ile Tyr Thr Arg Ala Thr Ala Ser Glu <210> 31 <211> 933 <212> DNA
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 132 <400>

gatcctagaattgcggtggaatatcttctcctaatcgctttagcgcacgaagactcacaa 60 attgaacttgctcacgaagcattgagggagcctggtcctagatactaaagagttcaccat 120 acctcctcggaaaaatcaacagggatggcaccaggataccgggcattatcgaggagagac 180 agcctctgctttacttggccgacaaagaggactttttgcataagattacggagcaggcag 240 cgcgcagagcagatgaaaatggcagagtctacgacagtctgctactgtatcagctggcgg 300 aagagtacgatattgtcattagcattgttaataagctgctgagcgaaatgttgagcaaca 360 ctgacctggcgcaacccctgatgcggcaggacgacaatagcgagactaaccctgttctaa 420 tcgccaagaagctcattgatgtctatatcaagaacttggaaatttcaaagaaggtacaca 480 ggaaaaacaaggaaacatgcattctgctcctgaaactcgtggatataaggagaacatata 540 ttgcaagacagtggcaaaacaccctgcagcagatagaggagctggatctgcttccatctg 600 tcgaagactcttccccaaggaagaaggcgcaggaattccacaacctggacgactgtatca 660 taaagaatgtccccaacctgttgatcatcgccatgacctgcgtttctaacctcatcaagc 720 agttgagcaagggccccttctccaacggggccacgcaagctcaaggtcgaggctctgaag 780 aaggtcgccaacaactacatgatctacagaggcatgatccagtacaagatgcctcgggag 840 gtgtacaacaccctcataaacatcgaggtggacctctgaccgctcgtcagaccacgatgc 900 agtgtgtaccagaccagtattatagattagatc 933 <210> 32 <211> 30 <222> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 132 <400> 32 Asp Pro Arg Zle Ala Val Glu Tyr Leu Leu Leu Ile Ala Leu Ala His Glu Asp Ser Gln Ile Glu Leu Ala His Glu Ala Leu Arg Glu <210> 33 <211> 10 <212> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 132 <400> 33 Leu Val Leu Asp Thr Lys Glu Phe Thr Ile <210> 34 <211> 219 <212> PRT
<213> Ashbya gossypii <400> 34 Lys Ser Ser Pro Tyr Leu Leu Gly Lys Ile Asn Arg Asp Gly Thr Arg Ile Pro Gly Ile Ile Glu Glu Arg Gln Pro Leu Leu Tyr Leu Ala Asp Lys Glu Asp Phe Leu His Lys Ile Thr Glu Gln Ala Ala Arg Arg Ala Asp Glu Asn Gly Arg Val Tyr Asp Ser Leu Leu Leu Tyr Gln Leu Ala Glu Glu Tyr Asp Ile Val Ile Ser Ile Val Asn Lys Leu Leu Ser Glu Met Leu Ser Asn Thr Asp Leu Ala Gln Pro Leu Met Arg Gln Asp Asp Asn Ser Glu Thr Asn Pro Val Leu Ile Ala Lys Lys Leu Ile Asp Val Tyr Ile Lys Asn Leu Glu Ile Ser Lys Lys Val His Arg Lys Asn Lys Glu Thr Cys Ile Leu Leu Leu Lys Leu Val Asp Ile Arg Arg Thr Tyr Ile Ala Arg Gln Trp Gln Asn Thr Leu Gln Gln Ile Glu Glu Leu Asp Leu Leu Pro Ser Val Glu Asp Ser Ser Pro Arg Lys Lys Ala Gln Glu Phe His Asn Leu Asp Asp Cys Ile Ile Lys Asn Val Pro Asn Leu Leu Ile Ile Ala Met Thr Cys Val Ser Asn Leu Ile Lys Gln Leu Ser Lys Gly Pro Phe Ser Asn Gly Ala Thr Gln Ala Gln <210> 35 <211> 38 <212> PRT

<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 132 <400> 3S
Lys Val Glu Ala Leu Lys Lys Val Ala Asn Asn Tyr Met Ile Tyr Arg Gly Met Ile Gln Tyr Lys Met Pro Arg Glu Val Tyr Asn Thr Leu Ile Asn Ile Glu Val Asp Leu <210> 36 <2I1> 3969 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (629)..(3181) <223>
<220>
<221> misc_feature <223> Oligo 132 <400> 36 catgacagctgtgccacttatcccacggaagactagtggcagacgactaccacgatttag60 tagctttaaatccagctattcgacgagctcaggtccaagatttactgtgtgagagacgat120 caattcactgcggcctacaataatccggatacgagggctattccaaacggtttaactgtc180 gagctaaatgatgggactaccttggaagaggttgttgtcgagtaccctattggccataag240 actagacgtg cagaggcagaaccgaagctg cttgagaagttctacaggcatttgtcaggg 30U

cactttgagg gcgacattactaaggtcgag caagtaatgacaatgtccactgacccagag 360 tttgagtcct atagtatcgaccagtatgta gacactttctgtcgttgacggtatctagat 420 ccaacaaatg tactaagttacgtaacagtt ttatgatgatgttacataatcttcccagtc 480 gccggagctt cgcgtcaatgatatccgggt aatacttttctgtcaacaaaattttctcta 540 -gggatgaatg aagttttcatctatcagcaa gtacagtataagcagtttgttattataaga 600 agtacggcag ctgccttcttcgtctaac atg aat gca tcg 652 aac tcc atc aat Met Asn Asn Ser Ala Ser Ile Asn gat tta cgg agc gtc tta aag gtg tcg 700 agc ccg ggc cac gaa gcc ccc Asp Leu Arg Ser Val Leu Lys Val Ser Ser Pro Gly His Glu Ala Pro aagacctttaat gatttg attgaaacgtcc aagaat ctgccttctaca 748 LysThrPheAsn AspLeu IleGluThrSer LysAsn LeuProSerThr tcatccgagttg ggttcc gtactattgaat gtcaat gaactcaagaag 796 SerSerGluLeu GlySer ValLeuLeuAsn ValAsn GluLeuLysLys cgggetgcagag ttaaga getaaaaatgtc aagaac aaatctcctcac 844 ArgAlaAlaGlu LeuArg AlaLysAsnVal LysAsn LysSerProHis catacccgggca cactat ttgttggcagga agtgga ctggcgattcaa 892 HisThrArgAla HisTyr LeuLeuAlaGly SerGly LeuAlaIleGln gatgttgaatct tctttgaaa acccttgaa tcgagacag ctgttggag 940 AspValGluSer SerLeuLys ThrLeuGlu SerArgGln LeuLeuGlu cagaatgtccaa aataaggtt cccgatgga gatcttgac acctacctg 988 GlnAsnValGln AsnLysVal ProAspGly AspLeuAsp ThrTyrLeu cgcaataaaaaa gatgaaaac atcctctcc tctattgag cagtccttg 1036 ArgAsnLysLys AspGluAsn IleLeuSer SerIleGlu GlnSerLeu tctttggcggca aaggatttt gataatttt gtcaatgcg aacttcaat 1084 SerLeuAlaAla LysAspPhe AspAsnPhe ValAsnAla AsnPheAsn ctggactggaag aagcataag gaggaagtg aagaggagc tttttgggt 1132 LeuAspTrpLys LysHisLys GluGluVal LysArgSer PheLeuGly ctcgtatggaag tcggatcca aaccacaag agtccaact tctgtgtct 1180 LeuValTrpLys SerAspPro AsnHisLys SerProThr SerValSer gaa cca tca ttt atg acc tgg ccc aag aaa ggt agc gga ata ttg gat 1228 Glu Pro Ser Phe Met Thr Trp Pro Lys Lys Gly Ser Gly Ile Leu Asp ggt gaa tca aag ctg aat atc aac gaa aac tac gtt gtg aga gag aag 1276 Gly Glu Ser Lys Leu Asn Ile Asn Glu Asn Tyr Val Val Arg Glu Lys tttgaaaaatac gccagaata atcaatcgg ttcaacaat gccaga 1324 cag PheGluLysTyr AlaArgIle IleAsnArg PheAsnAsn AlaArg Gln ctgcataataat ttccctttg acgacagag tttattact ctattccaa 1372 LeuHisAsnAsn PheProLeu ThrThrGlu PheIleThr LeuPheGln aattccgcagac tacaaacag aggcagctg ctcgaagca tggaagatc 1420 AsnSerAlaAsp TyrLysGln ArgGlnLeu LeuGluAla TrpLysIle cttgataattac cgcttgtgt tcggattct atgaatatt gtggatatt 1468 LeuAspAsnTyr ArgLeuCys SerAspSer MetAsnIle ValAspIle tcaaaagggtat cttgaaaac caattcatg gactacgtc gacaatcta 1516 SerLysGlyTyr LeuGluAsn GlnPheMet AspTyrVal AspAsnLeu taccccaaaaat ggaaatgaa ggattgcct actaacatt aataagatc 1564 TyrProLysAsn GlyAsnGlu GlyLeuPro ThrAsnIle AsnLysIle 300 . 305 310 aaatccttcatt gattgtaaa ttaaaaaat ccaaataac acttggaag 1612 LysSerPheIle AspCysLys LeuLysAsn ProAsnAsn ThrTrpLys tttggcaacttg acgatcgtc aatggtgtt cctgtgtgg gccttgatc 1660 PheGlyAsnLeu ThrIleVal AsnGlyVal ProValTrp AlaLeuIle ttttatctatta agggccggt aagttccag gaagetttg gaggtcgcc 1708 PheTyrLeuLeu ArgAlaGly LysPheGln GluAlaLeu GluValAla ataaacaataag ctaagttta aaaaaggtg gagcagtct ttcctggta 1756 IleAsnAsnLys LeuSerLeu LysLysVal GluGlnSer PheLeuVal tacttcaaagca tatgtctcc tctaaagac aagcggctg ccacaggag 1804 TyrPheLysAla TyrValSer SerLysAsp LysArgLeu ProGlnGlu ttcattactaga ttgcacacg gagtacaat caacacatt aaaaactcc 1852 PheIleThrArg LeuHisThr GluTyrAsn GlnHisIle LysAsnSer ctcgatggcgac cccttcaga ctcgccgtt tacaagatc attggaaga 1900 LeuAspGlyAsp ProPheArg LeuAlaVal TyrLysIle IleGlyArg tgtgatctgacg agaaagaat atttccget ataacgctg agtgttgaa 1948 CysAspLeuThr ArgLysAsn IleSerAla IleThr SerValGlu Leu gactggctatgg gtccacttc atgttgata aaagac tccagc 1996 ggc atc Asp Trp Leu Trp Val His Phe Met Leu Ile Lys Asp Gly Ile Ser Ser gac gac cca gtt tat gag aga tat agc ctg gtc gac ttc caa aac atc 2044 Asp Asp Pro Val Tyr Glu Arg Tyr Ser Leu Val Asp Phe Gln Asn Ile atc acg tct tat ggc tct tcc agc ttc aat aac cac tac ttg caa gtc 2092 Ile Thr Ser Tyr Gly Ser Ser Ser Phe Asn Asn His Tyr Leu Gln Val ctactt ctcagcggt caatatgaacta getgtccaa tatgcctac act 2140 LeuLeu LeuSerGly GlnTyrGluLeu AlaValGln TyrA1aTyr Thr attaac gaaattgac getgttcatttg gegatcget etggcggat tat 2188 IleAsn GluIleAsp AlaValHisLeu AlaIleAla LeuAlaAsp Tyr aaatta ttgaaggtg gcagetaatgtg actgacgat gagtttgtc acg 2236 LysLeu LeuLysVal AlaAlaAsnVal ThrAspAsp GluPheVal Thr tcgccc actggcgag agaaagatcaac tttgcaaag attctgggg aac 2284 SerPro ThrGlyGlu ArgLysIleAsn PheA1aLys IleLeuGly Asn 540 545 . 550 tataca aagtccttc aagttctctgat cctagagtt gcggtggaa tat 2332 TyrThr LysSerPhe LysPheSerAsp ProArgVal AlaValGlu Tyr cttctc ctaatcgettta gegcacgaa gactcacaa attgaacttget 2380 LeuLeu LeuIleAlaLeu AlaHisGlu AspSerGln IleGluLeuAla cacgaa gcattgagggag ctggtccta gatactaaa gagttcaccata 2428 HisGlu AlaLeuArgGlu LeuValLeu AspThrLys GluPheThrIle ctcctc ggaaaaatcaac agggatggc accaggata ccgggcattatc 2476 LeuLeu GlyLysIleAsn ArgAspGly ThrArgIle ProGlyIleIle gaggag agacagcctctg ctttacttg gccgacaaa gaggactttttg 2524 GluGlu ArgGlnProLeu LeuTyrLeu AlaAspLys GluAspPheLeu cataag attacggagcag gcagcgcgc agagcagat gaaaatggcaga 2572 HisLys IleThrGluGln AlaAlaArg ArgAlaAsp GluAsnGlyArg gtctac gacagtctgcta ctgtatcag ctggcggaa gagtacgatatt 2620 ValTyr AspSerLeuLeu LeuTyrGln LeuAlaGlu GluTyrAspIle gtcatt agcattgttaat aagctgctg agcgaaatg ttgagcaacact 2668 ValIle SerIleValAsn LysLeuLeu SerGluMet LeuSerAsnThr gacctg gcgcaacccctg atgcggcag gacgacaat agcgagactaac 2716 AspLeu AlaGlnProLeu MetArgGln AspAspAsn SerGluThrAsn cct gtt cta atc gcc aag aag ctc att gat gtc tat atc aag aac ttg 2764 Pro Val Leu Ile Ala Lys Lys Leu Ile Asp Val Tyr Ile Lys Asn Leu gaa att tca aag aag gta cac agg aaa aac aag gaa aca tgc att ctg 2812 Glu Ile Ser Lys Lys Val His Arg Lys Asn Lys Glu Thr Cys Ile Leu ctc ctg aaa ctc gtg gat ata agg aga aca tat att gca aga cag tgg 2860 Leu Leu Lys Leu Val Asp Ile Arg Arg Thr Tyr Ile Ala Arg Gln Trp caaaacacc ctgcagcag atagaggag ctggatctgctt ccatctgtc 2908 GlnAsnThr LeuGlnGln IleGluGlu LeuAspLeuLeu ProSerVal gaagactct tccccaagg aagaaggcg caggaattccac aacctggac 2956 GluAspSer SerProArg LysLysAla GlnGluPheHis AsnLeuAsp gactgtatc ataaagaat gtccccaac ctgttgatcatc gccatgacc 3004 AspCysIle IleLysAsn ValProAsn LeuLeuIleIle AlaMetThr tgcgtttct aacctcatc aagcagttg agcaagggcccc ttctccaac 3052 CysValSer AsnLeuIle LysGlnLeu SerLysGlyPro PheSerAsn ggggccacg caagetcaa gtcgagget ctgaagaaggtc gccaacaac 3100 GlyAlaThr GlnAlaGln ValGluAla LeuLysLysVal AlaAsnAsn tac atg atc tac aga ggc atg atc cag tac aag atg cct cgg gag gtg 3148 Tyr Met Ile Tyr Arg Gly Met Ile Gln Tyr Lys Met Pro Arg Glu Val tac aac acc ctc ata aac atc gag gtg gac ctc tgaccgctcg tcagaccacg 3201 Tyr Asn Thr Leu Ile Asn Ile Glu Val Asp Leu atgcagtgtg taccagacca gtattataga ttagatccta cgaactttac ctgctattta 3261 tccccgtgca gatacttctg cctgtactga ctgtagtccg gctggtactc gtacgcgttc 3321 ggactactgg atctcttccg ttcgagtttc tgccgacgtc tggcgattcg agcctgccgc 3381 ctcgcttcaa agtccatgct agtgtcgttt tcggattccg aagacgagct cgacgaggca 3441 ctcgacgatg cgtgctcgca ctcacccccg tcctcgtcgt caaagttctg ctgcgggtgg 3501 aaaatgcagc atatctttgt cttcttctta ttcatatgct cgttatctac cacattctca 3561 tcccatctga ctttcgactt ctgctctttc ttggctaact ttggcacctg ttccgtttga 3621 tttgcccgga gctgaaggat ctgcgatgtc tccgaaacag ttacagtgtg tgacctgtta 3681 gcaagtgact cctggttgtt gcttgacatc ggaacagctc ttcccacttc cagaccaatc 3741 taatagtctt aacgttgttt gctcctgatt gtgtaccgct tacatacctt ccagctatta 3801 tacagaataa ccccttcgta actggtgata tcagcttgta tgggtggcaa attcaagggc 3861 cttttggcgt attatggttt acaacagcca taatctgaac agcggttaca gagaactgat 3921 cagatacact agccccttat tcgacgtgga tgggatagat tacagaga 3969 <210> 37 <211> 851 <212> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 132 <400> 37 Met Asn Asn Ser Ile Asn Ala Ser Asp Leu Arg Ser Val Ser Pro His Glu Ala Pro Leu Lys Gly Val Ser Lys Thr Phe Asn Asp Leu Ile Glu Thr Ser Lys Asn Leu Pro Ser Thr Ser Ser Glu Leu Gly Ser Val Leu Leu Asn Val Asn Glu Leu Lys Lys Arg Ala Ala Glu Leu Arg Ala Lys Asn Val Lys Asn Lys Ser Pro His His Thr Arg Ala His Tyr Leu Leu 65 70 75 g0 Ala Gly Ser Gly Leu Ala Ile Gln Asp Val Glu Ser Ser Leu Lys Thr Leu Glu Ser Arg Gln Leu Leu Glu Gln Asn Val Gln Asn Lys Val Pro Asp Gly Asp Leu Asp Thr Tyr Leu Arg Asn Lys Lys Asp Glu Asn Ile Leu Ser Ser Ile Glu Gln Ser Leu Ser Leu Ala Ala Lys Asp Phe Asp Asn Phe Val Asn Ala Asn Phe Asn Leu Asp Trp Lys Lys His Lys Glu Glu Val Lys Arg Ser Phe Leu Gly Leu Val Trp Lys Ser Asp Pro Asn His Lys Ser Pro Thr Ser Val Ser Glu Pro Ser Phe Met Thr Trp Pro Lys Lys Gly Ser Gly Ile Leu Asp Giy Glu Ser Lys Leu Asn Ile Asn Glu Asn Tyr Val Val Arg Glu Lys Phe Glu Lys Tyr Ala Arg Ile Ile Asn Arg Phe Asn Asn Ala Arg Gln Leu His Asn Asn Phe Pro Leu Thr Thr Glu Phe Ile Thr Leu Phe Gln Asn Ser Ala Asp Tyr Lys Gln Arg Gln Leu Leu Glu Ala Trp Lys Ile Leu Asp Asn Tyr Arg Leu Cys Ser Asp Ser Met Asn Ile Val Asp Ile Ser Lys Gly Tyr Leu Glu Asn Gln Phe Met Asp Tyr Val Asp Asn Leu Tyr Pro Lys Asn Gly Asn GIu Gly Leu Pro Thr Asn Ile Asn Lys Ile Lys Ser Phe Ile Asp Cys Lys Leu Lys Asn Pro Asn Asn Thr Trp Lys Phe Gly Asn Leu Thr Ile Val Asn Gly Val Pro Val Trp Ala Leu Ile Phe Tyr Leu Leu Arg Ala Gly Lys Phe Gln Glu Ala Leu Glu Val Ala Ile Asn Asn Lys Leu Ser Leu Lys Lys Val Glu Gln Ser Phe Leu Val Tyr Phe Lys Ala Tyr Val Ser Ser Lys Asp Lys Arg Leu Pro Gln Glu Phe Ile Thr Arg Leu His Thr Glu Tyr Asn Gln His Ile Lys Asn Ser Leu Asp Gly Asp Pro Phe Arg Leu Ala Val Tyr Lys Ile Ile Gly Arg Cys Asp Leu Thr Arg Lys Asn Ile Ser Ala Ile Thr Leu Ser Val Glu Asp Trp Leu Trp Val His Phe Met Leu Ile Lys Asp Gly Ile Ser Ser Asp Asp Pro Val Tyr Glu Arg Tyr Ser Leu Val Asp Phe Gln Asn Ile Ile Thr Ser Tyr Gly Ser Ser Ser Phe Asn Asn His Tyr Leu Gln Val Leu Leu Leu Ser Gly Gln Tyr Glu Leu Ala Val Gln Tyr Ala Tyr Thr Ile Asn Glu Ile Asp Ala Val His Leu Ala Ile Ala Leu Ala Asp Tyr Lys Leu Leu Lys Val Ala Ala Asn Val Thr Asp Asp Glu Phe Val Thr Ser Pro Thr Gly Glu Arg Lys Ile Asn Phe Ala Lys Ile Leu Gly Asn Tyr Thr Lys Ser Phe Lys Phe Ser Asp Pro Arg Val Ala Val Glu Tyr Leu Leu Leu Ile Ala Leu Ala His Glu Asp Ser Gln Ile Glu Leu Ala His Glu Ala Leu Arg Glu Leu Val Leu Asp Thr Lys Glu Phe Thr Ile Leu Leu Gly Lys Ile Asn Arg Asp 595 600 . 605 Gly Thr Arg Ile Pro Gly Ile Ile Glu Glu Arg Gln Pro Leu Leu Tyr Leu AIa Asp Lys Glu Asp Phe Leu His Lys Ile Thr Glu Gln Ala Ala Arg Arg Ala Asp Glu Asn Gly Arg Val Tyr Asp Ser Leu Leu Leu Tyr Gln Leu Ala Glu Glu Tyr Asp Ile Val Ile Ser Ile Val Asn Lys Leu _ Leu Ser Glu Met Leu Ser Asn Thr Asp Leu Ala Gln Pro Leu Met Arg Gln Asp Asp Asn Ser Glu Thr Asn Pro Val Leu Ile Ala Lys Lys Leu Ile Asp Val Tyr Ile Lys Asn Leu Glu Ile Ser Lys Lys Val His Arg Lys Asn Lys Glu Thr Cys Ile Leu Leu Leu Lys Leu Val Asp Ile Arg Arg Thr Tyr Ile Ala Arg Gln Trp Gln Asn Thr Leu Gln Gln Ile Glu Glu Leu Asp Leu Leu Pro Ser Val Glu Asp Ser Ser Pro Arg Lys Lys Ala Gln Glu Phe His Asn Leu Asp Asp Cys Ile Ile Lys Asn Val Pro Asn Leu Leu Ile Ile Ala Met Thr Cys Val Ser Asn Leu Ile Lys Gln Leu Ser Lys Gly Pro Phe Ser Asn Gly Ala Thr Gln Ala Gln Val Glu Ala Leu Lys Lys Val Ala Asn Asn Tyr Met Ile Tyr Arg Gly Met Ile Gln Tyr Lys Met Pro Arg Glu Val Tyr Asn Thr Leu Ile Asn Ile Glu Val Asp Leu <210> 38 <211> 997 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 174 <400>

gatcatgacctgcagatggagctgctccagaatctcgcgcttcgctatctcgtattttat 60 ccgctccgtctcctcgctctcacgccccagcggcccctcctccgcacgcagcccgctgta 120 ttcgtcgtcgcccagggaaagctcgtgcggcgacttcggtgtcgccacctggtaatatgc 180 cggccctgcgccgatgtgtgggcgccccgtgatatcctccgagtccatgagtaatacttg 240 cggagatgatattagctgaccgctgtcgctatgtgcaatgggctcctctgccccgtggaa 300 ttcttccgagcttcgatgctgaatcctgctatgttgtctcttgttccgaagcgtccccgt 360 taatgtcattgcacccggcgttctgtagtataaccgcgttcctgcgtcgtgctgcccagc 420 gcctcaaatttgatgttcccgactgttcctgcaagtaattaccgaagactgcgcccgctt 480 agtctccaggatagaatacgctcatataaacccggtcctgactatagagagtgtgcagag 540 agtgcgaagagcttcgcttgccctgctcctacgcttgaagagccccatagaaaaaagcgg 600 aaacgagaagcctcttcctttgatgcatttcagccgttcccgcagtcacgcgaccgcaac 660 tctcagatatttacagcttttcagtgcttcatttcattagtggcaacatggccgagcggt 720 taaggcgaaagattagaaatcttttgggctatgcccgcgcaggttcgagtcctgctgttg 780 tcgttattttttgccgaatccatgtatacatggtcacgtgcatgagaggtcacaccacgt 840 atgtaagtatagtaaagattccgttagagtaaggattacatattcttctgagcctcaagc 900 tccgcaaggaggtcgtcgagcagcgcaaccgtttcctgtggcgacgatatccacgctgtg 960 cagcctgcgagccgtgccttgaagtcattcgcagatc g97 <210> 39 <211> 58 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 174 <400> 39 Tyr Gln Val Ala Thr Pro Lys Ser Pro His Glu Leu Ser Leu Gly Asp Asp Glu Tyr Ser Gly Leu Arg Ala Glu Glu Gly Pro Leu Gly Arg Glu Ser Glu Glu Thr Glu Arg Ile Lys Tyr Glu Ile Ala Lys Arg Glu Ile Leu Glu Gln Leu His Leu Gln Val Met Ile <210> 40 <211> 3197 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (964)..(2589) <223>
<220>
<221> misc feature <223> Oligo 174 <400>

tgcgcctgcctgcggagaccccagatcatccgcaaggtgcgcgcagtggccattgtaccg60 ggggcagcgctttgaccgggagtgggccgcgaaattcggcgtgccgctgttgcgcgagac120 gctggaggaaatcgttcttacagtccagggtcggctcgagaacttcccacccgcgcagcg180 tgtgcaattcagctgtttcgacggcggcagcgacgtgtggtgcgacatcggcggcaagga240 cctcggtgtagccttcctgcagcggttctactcgccggagcgtccaatccgccctgagca300 gtccttgcatgtcggtgaccagttcgcccccgtcggatctgcgaatgacttcaaggcacg360 gctcgcaggctgcacagcgtggatatcgtcgccacaggaaacggttgcgctgctcgacga420 cctccttgcggagcttgaggctcagaagaatatgtaatccttactctaacggaatcttta480 ctatacttacatacgtggtgtgacctctcatgcacgtgaccatgtatacatggattcggc540 aaaaaataacgacaacagcaggactcgaacctgcgcgggcatagcccaaaagatttctaa600 tctttcgccttaaccgctcggccatgttgccactaatgaaatgaagcactgaaaagctgt660 y, aaatatctga gagttgcggt cgcgtgactg cgggaacggc tgaaatgcat caaaggaaga 720 ggcttctcgtttccgcttttttctatggggctcttcaagcgtaggagcagggcaagcgaa780 gctcttcgcactctctgcacactctctatagtcaggaccgggtttatatgagcgtattct840 atcctggagactaagcgggcgcagtcttcggtaattacttgcaggaacagtcgggaacat900 caaatttgaggcgctgggcagcacgacgcaggaacgcggttatactacagaacgccgggt960 gca atgacattaacg gggacgctt cggaacaag agacaacatagc agg 1008 MetThrLeuThr GlyThrLeu ArgAsnLys ArgGlnHisSer Arg att cagcatcgaagc tcggaagaa ttccacggg gcagaggagccc att 1056 Ile GlnHisArgSer SerGluGlu PheHisGly AlaGluGluPro Ile gca catagcgacagc ggtcagcta atatcatct ccgcaagtatta ctc 1104 Ala HisSerAspSer GlyGlnLeu IleSerSer ProGlnValLeu Leu atg gactcggaggat atcacgggg cgcccacac atcggcgcaggg ccg 1152 Met AspSerGluAsp IleThrGly ArgProHis IleGlyAlaGly Pro gca tattaccaggtg gcgacaccg aagtcgccg cacgagctttcc ctg 1200 Ala TyrTyrGlnVal AlaThrPro LysSerPro HisGluLeuSer Leu ggc gacgacgaatac agcgggctg cgtgcggag gaggggccgctg ggg 1248 Gly AspAspGluTyr SerGlyLeu ArgAlaGlu GluGlyProLeu Gly cgt gagagcgaggag acggagcgg ataaaatac gagatagcgaag cgc 1296 Arg GluSerGluGlu ThrGluArg IleLysTyr GluIleAlaLys Arg gag attctggagcag ctccatctg caggtcatg atcaagcatcga gaa 1344 Glu IleLeuGluGln LeuHisLeu GlnValMet IleLysHisArg Glu atg gacgacctggaa gccgagtca cgtggctta ggggcgaaattg gag 1392 Met AspAspLeuGlu AlaGluSer ArgGlyLeu GlyAlaLysLeu Glu gtg ctggagatgttg catgatgat ccggagctc ttggccaaggtg gac 1440 Val LeuGluMetLeu HisAspAsp ProGluLeu LeuAlaLysVal Asp gcg cac cag gag caa cag gca cag ctg cgt ttg gca cag tta gaa gca 1488 Ala His Gln Glu Gln Gln Ala Gln Leu Arg Leu Ala Gln Leu Glu Ala cgt cgc agg agg gaa caa cag atg gca gcg cta ccc cct get ccg ctt 1536 Arg Arg Arg Arg Glu Gln Gln Met Ala Ala Leu Pro Pro Ala Pro Leu tcg tcg agc agt ggt ggt gag tac tat tac cac acc cgc agt aag agc 1584 Ser Ser Ser Ser Gly Gly Glu Tyr Tyr Tyr His Thr Arg Ser Lys Ser atg aac tcc cat cag ggg agg tct tct acc ctc cgg ccg get gac ggg 1632 Met Asn Ser His Gln Gly Arg Ser Ser Thr Leu Arg Pro Ala Asp Gly aat gta atc ggc ctc cgt gtt ttg ggc tca aag acg gtt gca gac get 1680 Asn Val Ile Gly Leu Arg Val Leu Gly Ser Lys Thr Val Ala Asp Ala agt agt ccc gga acc acg tca cca cct ttc agc tcc ttt cag cag gca 1728 Ser Ser Pro Gly Thr Thr Ser Pro Pro Phe Ser Ser Phe Gln Gln Ala gac cct ttc gcg ccg caa cat ttc aac cag cat cac agg agg aac tac 1776 Asp Pro Phe Ala Pro Gln His Phe Asn Gln His His Arg Arg Asn Tyr agc agt aat tgt att tca agc aac agc ggc gta gtc ggg aaa acc gac 1824 Ser Ser Asn Cys Ile Ser Ser Asn Ser Gly Val Val Gly Lys Thr Asp agc ggg gat gcg att ttt agg cgc ctt gat ggg ctc ctg atc gtt atc 1872 Ser Gly Asp Ala Ile Phe Arg Arg Leu Asp Gly Leu Leu Ile Val Ile acg tgc tgc aag tgc ggt aag tcg gga ttt acg tct gca caa ggc atc 1920 Thr Cys Cys Lys Cys Gly Lys Ser Gly Phe Thr Ser Ala Gln Gly Ile gtcaaccactcc aggctgaaa catgccaat tcttattcc agtcagcca 1968 ValAsnHisSer ArgLeuLys HisAlaAsn SerTyrSer SerGlnPro ctagetgtactt cataaccag sgaattctt ccggaagag cagcaaaat 2016 LeuAlaValLeu HisAsnGln XaaIleLeu ProGluGlu GlnGlnAsn aaaattgtcatg gataaattt aaggaactg catcttgac cctcagacg 2064 LysIleValMet AspLysPhe LysGluLeu HisLeuAsp ProGlnThr gagtacctgccg aatcccaca gtggtctcc caaagccca tcctctagt 2112 GluTyrLeuPro AsnProThr ValValSer GlnSerPro SerSerSer get aat tca aat gca tgt ata aca get act gaa ggg cgc gat ata tca 2160 Ala Asn Ser Asn Ala Cys Ile Thr Ala Thr Glu Gly Arg Asp Ile Ser cca aca cat atc tca tcg tcc tta tcg cct acc tgc gtg cag cca gtt 2208 Pro Thr His Ile Ser Ser Ser Leu Ser Pro Thr Cys Val Gln Pro Val tcc caa ttt cac tca act aaa cat ctg gag aag ctc tat ggc aaa gag 2256 Ser Gln Phe His Ser Thr Lys His Leu Glu Lys Leu Tyr Gly Lys Glu gga ttc cag cag ata gtg gac tat gtc aag gag tct aaa gat gat ttg 2304 Gly Phe Gln Gln Ile Val Asp Tyr Val Lys Glu Ser Lys Asp Asp Leu ggc ccc ccc atg cgg gtc gat tcg gat atc gat aac gat acg aat tcg 2352 Gly Pro Pro Met Arg Val Asp Ser Asp Ile Asp Asn Asp Thr Asn Ser ctg cac ccg ggg gat caa tcg gat ttg ctt tca caa cat aat tcg gag 2400 Leu His Pro Gly Asp Gln Ser Asp Leu Leu Ser Gln His Asn Ser G1u cgt tca acc gac cta aag cgt cgc gca tcg cct aat atg gac aaa get 2448 Arg Ser Thr Asp Leu Lys Arg Arg Ala Ser Pro Asn Met Asp Lys Ala ctt cgt gaa cga atg cgg cct get gag aag cgg gtg agg ccc gac get 2496 Leu Arg Glu Arg Met Arg Pro Ala Glu Lys Arg Val Arg Pro Asp Ala . 500 505 510 atg gca ctc gtc gag ctc cct get gaa gag aag aga tca tcg cat tac 2544 Met Ala Leu Val Glu Leu Pro Ala Glu Glu Lys Arg Ser Ser His Tyr aac tta agg gcc agg tca aag cta aaa tca ctc tcg aaa cat gaa 2589 Asn Leu Arg Ala Arg Ser Lys Leu Lys Ser Leu Ser Lys His Glu taatatgtaa gtattgttga gacctcattt cccttcgcat ataagtacta tgtattaata 2649 tcatagattc tggacggatc atcacttgtt tgctcggact ctctcaggaa acgcttgggc 2709 gacataggga aatatgtaac gtaccctaac ttcgcgcata ctaaatcaca gccgaaaaca 2?69 ctggggctga acagcatata acacatgttc ctttcgcaac acaagaggag tatagttcga 2829 aggatttgtt ggccctcggc taagcgctac cattcggaac tggtgcgctg gttctacgcc 2889 acggattcgc ccttggaaaa gccgtacgaa ccgaactata agcctgtaaa gcctccggta 2949 aactttatac cgttctctaa aagcgattcc gaccgtttag agcggttcta tagccttgaa 3009 aggccctctg agaatcccat ttcggtcaat gaggattatc tgttcgaagt atacttggaa 3069 gcaagacgtc tgaagcccgc gtattgggat ggccctgttt acgaggtccg gagaggcacc 3129 tggcttaata gcgatggcat gcctctaagt gaagacctga gcgccgagcc actgagctat 3189 cggccaag 3197 <210> 41 <211> 542 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <222> (343)..(343) <223> The 'Xaa' at location 343 stands for Gly, or Arg.
<220>

<221> misc feature <223> Oligo 174 <400> 41 Met Thr Leu Thr Gly Thr Leu Arg Asn Lys Arg Gln His Ser Arg Ile Gln His Arg Ser Ser Glu Glu Phe His Gly Ala Glu Glu Pro Ile Ala His Ser Asp Ser Gly Gln Leu Ile Ser Ser Pro Gln Val Leu Leu Met Asp Ser Glu Asp Ile Thr Gly Arg Pro His Ile Gly Ala Gly Pro Ala Tyr Tyr Gln Val Ala Thr Pro Lys Ser Pro His Glu Leu Ser Leu Gly 65 70 75 g0 Asp Asp Glu Tyr Ser Gly Leu Arg Ala Glu Glu Gly Pro Leu Gly Arg 85 . 90 95 Glu Ser Glu Glu Thr Glu Arg Ile Lys Tyr Glu Ile Ala Lys Arg Glu Ile Leu Glu Gln Leu His Leu Gln Val Met Ile Lys His Arg Glu Met Asp Asp Leu Glu Ala Glu Ser Arg Gly Leu Gly Ala Lys Leu Glu Val Leu Glu Met Leu His Asp Asp Pro Glu Leu Leu Ala Lys Val Asp Ala His Gln Glu Gln Gln Ala Gln Leu Arg Leu Ala Gln Leu Glu Ala Arg Arg Arg Arg Glu Gln Gln Met Ala Ala Leu Pro Pro Ala Pro Leu Ser Ser Ser Ser Gly Gly Glu Tyr Tyr Tyr His Thr Arg Ser Lys Ser Met Asn Ser His Gln Gly Arg Ser Ser Thr Leu Arg Pro Ala Asp Gly Asn Val Ile Gly Leu Arg Val Leu Gly Ser Lys Thr Val Ala Asp Ala Ser Ser Pro Gly Thr Thr Ser Pro Pro Phe Ser Ser Phe Gln Gln Ala Asp Pro Phe Ala Pro Gln His Phe Asn Gln His His Arg Arg Asn Tyr Ser Ser Asn Cys Ile Ser Ser Asn Ser Gly Val Val Gly Lys Thr Asp Ser Gly Asp Ala Ile Phe Arg Arg Leu Asp Gly Leu Leu Ile Val Ile Thr Cys Cys Lys Cys Gly Lys Ser Gly Phe Thr Ser Ala Gln Gly Ile Val Asn His Ser Arg Leu Lys His Ala Asn Ser Tyr Ser Ser Gln Pro Leu 325 330 , 335 Ala Val Leu His Asn Gln Xaa Ile Leu Pro Glu Glu Glri Gln Asn Lys Ile Val Met Asp Lys Phe Lys Glu Leu His Leu Asp Pro Gln Thr Glu Tyr Leu Pro Asn Pro Thr Val Val Ser Gln Ser Pro Ser Ser Ser Ala Asn Ser Asn Ala Cys Ile Thr Ala Thr Glu Gly Arg Asp Ile Ser Pro Thr His Ile Ser Ser Ser Leu Ser Pro Thr Cys Val Gln Pro Val Ser Gln Phe His Ser Thr Lys His Leu Glu Lys Leu Tyr Gly Lys Glu Gly Phe Gln Gln Ile Val Asp Tyr Val Lys Glu Ser Lys Asp Asp Leu Gly Pro Pro Met Arg Val Asp Ser Asp Ile Asp Asn Asp Thr Asn Ser Leu His Pro Gly Asp Gln Ser Asp Leu Leu Ser Gln His Asn Ser Glu Arg r Ser Thr Asp Leu Lys Arg Arg Ala Ser Pro Asn Met Asp Lys Ala Leu Arg Glu Arg Met Arg Pro Ala Glu Lys Arg Val Arg Pro Asp Ala Met Ala Leu Val Glu Leu Pro Ala Glu Glu Lys Arg Ser Ser His Tyr Asn Leu Arg Ala Arg Ser Lys Leu Lys Ser Leu Ser Lys His Glu <210> 42 <211> 1086 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 51 <400>

gatctagtaccagctgagactctctagttgcgtagtaactgtcgagcatacagcaggtga60 ttaaaaatggcatctcgggtacaagcattcattaactgtgctagtcagaaggcctccttt120 tttgtttcgaagaccgtctactgcggcaaggttgccggtgaattgaccaagacggtgtac180 ttcaaagagggcttgcagcctccaaacatatctgacttcgagatggtatactggagacta240 ctaaagcagttcaagaatgcggctgcacacccacagcaaacattggcatctgtgaagagc300 ctagggaagaatgacctggtgaagtacggtgccgtcggtgtgcagatgctcggactgtac360 tcgctaggcgaggcgatcggtagaagacaccttgtcggctacacaaactactcctcgcac420 cactagatattccgcgcggcggacggagcgggccgggattgcgcccattgtgtggggaag480 ccaacctagaaaacgaattgatgaagcattgattcgcagatctcarggatctgatgatac540 atctataaataacaactctaaactagttatcaatcttatatattcgtactatttgtgttc600 atactatgatacagtacgcgcgcgacacttgggcgccggcgagttatgcatgctcttcct660 cgctggcgtcgccggcttgctgggccagtttgcgcttcttagatgcctctatcatttctt720 tttgctgtcgtttcttctgcttcagtatctttggaaccgtgctgatctgcttcctgtcca780 cgaatgccttgcccttcttaatcatctccttttccctcttggtcatcttcgcgatattct840 ccatccaagc ggcgacctcgcacccactctgcttcatgacgttgacaatcggtttcacag900 caawtgcgtc ctgctttgtaaagaaaggtcactgctgtacctttccgtccgcctctgcct960 gtacggccga tcctgtggacgtaagcctgtgctgagcgaggaacgtcataggttgataac1020 aagattgatg cccttgaaatctataccacgtgccagaacatcggtacagatgaggcacca1080 tagatc <210> 43 <211> 25 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 51 <400> 43 Asp Leu Trp Cys Leu Ile Cys Thr Asp Val Leu Ala Arg Gly Ile Asp Phe Lys Gly Ile Asn Leu Val Ile Asn <210> 44 <211> 36 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 51 <400> 44 Leu Leu Ser Thr Tyr Asp Val Pro Arg Ser Ala Gln Ala Tyr Val His Arg Ile Gly Arg Thr Gly Arg Gly Gly Arg Lys Gly Thr Ala Val Thr Phe Leu Tyr Lys <210> 45 <211> 100 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 51 <220>
<221> misc feature <222> !29)..(29) <223> unknown amino acid <400> 45 His Arg Leu Thr Ser Thr Gly Ser Ala Val Gln Ala Glu Ala Asp Gly Lys Val Gln Gln Pro Phe Phe Thr Lys Gln Asp Ala Xaa Ala Val. Lys Pro Ile Val Asn Val Met Lys Gln Ser Gly Cys Glu Val Ala Ala Trp Met Glu Asn Ile Ala Lys Met Thr Lys Arg Glu Lys Glu Met Ile Lys Lys Gly Lys Ala Phe Val Asp Arg Lys Gln Ile Ser Thr Val Pro Lys Ile Leu Lys Gln Lys Lys Arg Gln Gln Lys Glu Met Ile Glu Ala Ser Lys Lys Arg Lys loo <210> 46 <211> 3296 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (502)..(2208) <223>
<220>
<221> misc feature <223> Oligo 51 <400> 46 atcgtcgggaatctgcaacccgtacttatctagattgaatgcttgcttaaatttcgcctg60 gtgccttgctgggtccccctcgttgtagtgcagccccgccgggttcttaagatcttcatt120 ggggttcttcaggcctcggactttgataccattaacgatgtaagatgcatggcgcgtaga180 ctgtctagtgcctatcgatatcttagaacacaacatggtgctatagacggcaactacagc240 agattaaccacggctggtcgctcttgaaggtggcctaagccaagagatgagcatccgcta300 agctatcaaaattttcaaactaccccgggtaacaagttatccgggtaaccacgtacaaaa360 cgatatttgaaaattttgtattcacattgctttttggtcattagcctgcccggtgcgcga420 tgaggtccctacttgtcagtcagatcgtatccgagctagtgagactgggtcaggccaata480 aggacattgagactcgaagtt atg att ttc gtt ctg cgt ggc 531 gat agg aca Met Asp Ile Phe Val Leu Arg Gly Arg Thr gca tcg gtg aag aag gac ggg aag cag gtg gac ttc tcc aga gtg cag 579 Ala Ser Val Lys Lys Asp Gly Lys Gln Val Asp Phe Ser Arg Val Gln agc cag cga aca gcg cgg cct gga cag cgc ggg aag gac gag gac gaa 627 Ser Gln Arg Thr Ala Arg Pro Gly Gln Arg Gly Lys Asp Glu Asp Glu gag caa ttc tcg cgc gag ctg gat ttc ttt cgc acg agg cgg tct gtg 675 Glu Gln Phe Ser Arg Glu Leu Asp Phe Phe Arg Thr Arg Arg Ser Val cct get gcc gca gag agg cca gcg gaa gag acc ggg gat gtt cat agg 723 Pro Ala Ala Ala Glu Arg Pro Ala Glu Glu Thr Gly Asp Val His Arg gacgag accgagcag gacgagggc gcagaggacgtg gcaccaccg ccc 771 AspGlu ThrGluGln AspGluGly AlaGluAspVal AlaProPro Pro ?5 80 85 90 cggatc acgacagca gaagaagcg tcgcagctacgg cgctcgtac cgg 819 ArgIle ThrThrAla GluGluAla SerGlnLeuArg ArgSerTyr Arg ggcaag gtcacaggc gcggatgcg cctctccccatt gggtcgttt gag 867 GlyLys ValThrGly AlaAspAla ProLeuProIle GlySerPhe Glu gacctg gtgacacgc ttcaagctg gacaagaggctg ctatcgaac ctg 915 AspLeu VaiThrArg PheLysLeu AspLysArgLeu LeuSerAsn Leu attgag aacaacttt acggagccg acgcccatccag tgcgaggcc atc 963 IleGlu AsnAsnPhe ThrGluPro ThrProIleGln CysGluAla Ile cccatc agtctgcag aaccgggac atagtggcgtgt gcgccgacc ggt 1011 ProIle SerLeuGln AsnArgAsp IleValAlaCys AlaProThr Gly agtggt aagactctg gcctttttg atacctctttta cagcaggtg ata 1059 SerGly LysThrLeu AlaPheLeu IleProLeuLeu GlnGlnVal Ile tccgac aaggccgtt ggcaccggc gtgaagggcttg attatctcg ccc 1107 SerAsp LysAlaVal GlyThrGly ValLysGlyLeu IleIleSer Pro acaaaa gaacttgcc aaccagatc tttgacgagtgc tcgaagctt get 1155 ThrLys GluLeuAla AsnGlnIle PheAspGluCys SerLysLeu Ala cagcgg atcttcctc gagaaaaag cgcccgttgtca gtggcattg ctc 1203 GlnArg IlePheLeu GluLysLys ArgProLeuSer ValA1aLeu Leu tcc aag tct ctc gcg gcg aag ctg aaa aac cag atc gtg agc gac aag 1251 Ser Lys Ser Leu Ala Ala Lys Leu Lys Asn Gln Ile Val Ser Asp Lys aaa tat gat atc atc ata tcg act cct ctg cga ctc ata gat ata gtg 1299 Lys Tyr Asp Ile Ile I1e Ser Thr Pro Leu Arg Leu Ile Asp Ile Val aag agc gaa tcg ctt gac cta agc get gtc aag tac ctg atc ttt gat 1347 Lys Ser Glu Ser Leu Asp Leu Ser Ala Val Lys Tyr Leu Ile Phe Asp gaa gcc gac aag cta ttt gac aaa acc ttt gtg gaa cag acg gac gac 1395 Glu Ala Asp Lys Leu Phe Asp Lys Thr Phe Val Glu Gln Thr Asp Asp atc cta agc gca tgt agc cac cca aat att agc aag gtg ctg ttc tcg 1443 Ile Leu Ser Ala Cys Ser His Pro Asn Ile Ser Lys Val Leu Phe Ser Ml423 i 9-PCT

gcc acc ctg ccc tcc agt gtc gaa gag ctt gca cag tcg atc atg acc 1491 Ala Thr Leu Pro Ser Ser Val Glu Glu Leu Ala Gln Ser Ile Met Thr gac ccc gtc aga gta atc att ggc cac aag gag gcc get aat acg aac 1539 Asp Pro Val Arg Va1 Ile I1e Gly His Lys Glu Ala Ala Asn Thr Asn att gaa cag aaa tta gta ttc tgc gga aac gaa gaa ggt aag ttg gtt 1587 Ile Glu Gln Lys Leu Val Phe Cys Gly Asn Glu G1u Gly Lys Leu Val gcc atc agg cag cta ata cag gaa ggg atg ttc cgc cct ccc gta ata 1635 Ala Ile Arg Gln Leu Ile Gln Glu Gly Met Phe Arg Pro Pro Val Ile atc ttt ttg gaa tcc atc acc aga gcc aaa gca tta ttc cat gag cta 1683 Ile Phe Leu Glu Ser Ile Thr Arg Ala Lys Ala Leu Phe His Glu Leu ttg tac gat aaa cta aat gtt gat gtt atc cac get gag cgt acc caa 1731 Leu Tyr Asp Lys Leu Asr~ Val Asp Val Ile His Ala Glu Arg Thr Gln 395 400 405 , 410 gtt caa agg gag aag atc atc gaa cga ttc aag agc ggt gat cta tgg 1779 Val Gln Arg Glu Lys I1e Ile G1u Arg Phe Lys Ser Gly Asp Leu Trp tgcctcatctgt accgatgttctg gcacgtggt atagatttc aagggc 1827 CysLeuIleCys ThrAspValLeu AlaArgGly IleAspPhe LysGly atcaatcttgtt atcaactatgac gttcctcgc tcagcacag gettac 1875 IleAsnLeuVal IleAsnTyrAsp ValProArg SerAlaGln AlaTyr gtccacaggatc ggccgtacaggc agaggcgga cggaaaggt acagca 1923 ValHisArgIle GlyArgThrGly ArgGlyGly ArgLysGly ThrAla gtgactttcttt acaaagcaggac gcaattget gtgaaaccg attgtc 1971 ValThrPhePhe ThrLysGlnAsp AlaIleAla ValLysPro IleVal aac gtc atg aag cag agt ggg tgc gag gtc gcc get tgg atg gag aat 2019 Asn Val Met Lys Gln Ser Gly Cys Glu Val Ala A1a Trp Met Glu Asn atc gcg aag atg acc aag agg gaa aag gag atg att aag aag ggc aag 2067 Ile Ala Lys Met Thr Lys Arg Glu Lys Glu Met Ile Lys Lys Gly Lys gca ttc gtg gac agg aag cag atc agc acg gtt cca aag ata ctg aag 2115 Ala Phe Val Asp Arg Lys Gln Ile Ser Thr Val Pro Lys Ile Leu Lys cag aag aaa cga cag caa aaa gaa atg ata gag gca tct aag aag cgc 2163 Gln Lys Lys Arg Gln Gln Lys Glu Met Ile Glu Ala Ser Lys Lys Arg aaa ctg gcc cag caa gcc ggc gac gcc agc gag gaa gag cat gca 2208 Lys Leu Glu Glu Ala Gln His Ala Gln Ala Gly Asp Ala Ser Glu taactcgccg gcgcccaagtgtcgcgcgcgtactgtatcatagtatgaacacaaatagta2268 cgaatatata agattgataactagtttagagttgttatttatagatgtatcatcagatcc2328 ctgagatctg cgaatcaatgcttcatcaattcgttttctaggttggcttccccacacaat2388 gggcgcaatc ccggcccgctccgtccgccgcgcggaatatctagtggtgcgaggagtagt2448 ttgtgtagcc gacaaggtgtcttctaccgatcgcctcgcctagcgagtacagtccgagca2508 tctgcacacc gacggcaccgtacttcaccaggtcattcttccctaggctcttcacagatg2568 ccaatgtttg ctgtgggtgtgcagccgcattcttgaactgctttagtagtctccagtata2628 ccatctcgaa gtcagatatgtttggaggctgcaagccctctttgaagtacaccgtcttgg2688 tcaattcacc ggcaaccttgccgcagtagacggtcttcgaaacaaaaaaggaggccttct2748 gactagcaca gttaatgaatgcttgtacccgagatgccatttttaatcacctgctgtatg2808 ctcgacagtt actacgcaactagagagtctcagctggtactagatcgcttatatcgtcaa2868 aattttcaaa ggtggcagcattcaggatatccgggtaacaatataccaatggccaatcag2928 atgccggttt ttagcacggagagtggtcttataccggtgatggactttgatggccaggcg2988 gaaggcgata tacggccgaaaagtagtgattgagcgcgcggtagtgtaatcgtttacttg3048 cgtctgtcta ttcggcgaacgcggcgagcatagagctgtttatcgcgcgtacaaagtccg3108 aaacaattac gctaaaacagtgagaatagctgagtgtgggcgcgcgagcaaactagacac3168 ggccgttcag gcgtatcgatctccggacgccgtcgccgaggaccactatcttgtcttcct3228 gctgcaggcg attcagagcgtctgaaatcgtcatgttgtccaggcgggcctgagagttct3288 cgttcagc 3296 <210> 47 <211> 569 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 51 <400> 47 Met Asp Ile Phe Arg Val Leu Thr Arg Gly Ala Ser Val Lys Lys Asp Mi42319-PCT

- Gly Lys Gln Val Asp Phe Ser Arg Val Gln Ser GIn Arg Thr Ala Arg Pro Gly Gln Arg Gly Lys Asp Glu Asp Glu Glu Gln Phe Ser Arg Glu Leu Asp Phe Phe Arg Thr Arg Arg Ser Val Pro Ala Ala Ala Glu Arg Pro Ala Glu Glu Thr Gly Asp VaI His Arg Asp Glu Thr Glu Gln Asp Glu Gly AIa Glu Asp Val Ala Pro Pro Pro Arg Ile Thr Thr Ala Glu Glu Ala Ser Gln Leu Arg Arg Ser Tyr Arg Gly Lys Val Thr GIy Ala Asp Ala Pro Leu Pro Ile Gly Ser Phe Glu Asp Leu Val Thr Arg Phe Lys Leu Asp Lys Arg Leu Leu Ser Asn Leu Ile Glu Asn Asn Phe Thr Glu Pro Thr Pro Ile Gln Cys Glu Ala Ile Pro Ile Ser Leu Gln Asn Arg Asp Ile Val Ala Cys Ala Pro Thr Gly Ser Gly Lys Thr Leu Ala Phe Leu Ile Pro Leu Leu Gln Gln Val Ile Ser Asp Lys Ala Val Gly Thr Gly Val Lys Gly Leu Ile Ile Ser Pro Thr Lys Glu Leu Ala Asn Gln Ile Phe Asp Glu Cys Ser Lys Leu Ala Gln Arg Ile Phe Leu Glu Lys Lys Arg Pro Leu Ser Val Ala Leu Leu Ser Lys Ser Leu Ala Ala Lys Leu Lys Asn Gln Ile Val Ser Asp Lys Lys Tyr Asp Ile Ile Ile Ser Thr Pro Leu Arg Leu Ile Asp Ile Val Lys Ser G1u Ser Leu Asp Leu Ser Ala Val Lys Tyr Leu Ile Phe Asp Glu Ala Asp Lys Leu Phe Asp Lys Thr Phe Val Glu Gln Thr Asp Asp Ile Leu Ser Ala Cys Ser His Pro Asn Ile Ser Lys Val Leu Phe Ser Ala Thr Leu Pro Ser Ser Val Glu Glu Leu Ala Gln Ser Ile Met Thr Asp Pro Val Arg Val Ile Ile Gly His Lys Glu Ala Ala Asn Thr Asn Ile Glu Gln Lys Leu Val Phe Cys Gly Asn Glu Glu Gly Lys Leu Val Ala Ile Arg Gln Leu Ile Gln Glu Gly Met Phe Arg Pro Pro Val Ile Ile Phe Leu Glu Ser Ile Thr Arg Ala Lys Ala Leu Phe His Glu Leu Leu Tyr Asp Lys Leu Asn Val Asp Val Ile His Ala Glu Arg Thr Gln Val Gln Arg Glu Lys Ile Ile Glu Arg Phe Lys Ser Gly Asp Leu Trp Cys Leu Ile Cys Thr Asp Val Leu Ala Arg Gly Ile Asp Phe Lys Gly Ile Asn Leu Val Ile Asn Tyr Asp Val Pro Arg Ser Ala Gln Ala Tyr Val His Arg Ile Gly Arg Thr Gly Arg Gly Gly Arg Lys Gly Thr Ala Val Thr Phe Phe Thr Lys Gln Asp Ala Ile Ala Val Lys Pro Ile Val Asn Val Met Lys Gln Ser Gly Cys Glu Val Ala Ala Trp Met Glu Asn Ile Ala Lys Met Thr Lys Arg Glu Lys Glu Met Ile Lys Lys Gly Lys Ala Phe Val Asp Arg Lys Gln Ile Ser Thr Val Pro Lys Ile Leu Lys Gln Lys Lys Arg Gln Gln Lys Glu Met Ile Glu Ala Ser Lys Lys Arg Lys Leu Ala Gln Gln Ala Gly Asp Ala Ser Glu Glu Glu His Ala <210> 4B
<211> 528 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 30 <220>
<221> misc_feature <222> (1131..(1131 <223> unknown nucleotide <400>

gacgctttcaacgcatccattaagaaaaataacattccggatgattggacctttattcat60 aacgaagagagtaccaacgggagcagcgaaaacgattcttccacaggaatgcngcaaggc120 ccggtctctaggccactgggttgacggcaacggtaagcagctggacggaaaactcaaatt180 tactgttaaaaatgtctacactgcgggcagaatggtgtccctcgaggggtcactgctaag240 tgaaggctatcacaggtcgcaagcagaaaacctgcctgtcgtttccaacaccaagatcat300 ctttgatgacgaggtctctcaagagaacaaggaatctcataaggacttggaacttagcgt360 tctaaaagaagataatggcgacgagatcatgtatgaaaaagattccagcgattcaaacag420 cgacagcgacagcgactaagttgcctctcatatttagttgccttctacgtccgcatatta480 catatataaaacatgttttgaatactgaagcacaatgagtcgcatcgc 528 <210> 49 <2i1> 34 <212> PPT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 30 <400> 49 Asp Ala Phe Asn Ala Ser Ile Lys Lys Asn Asn Ile Pro Asp Asp Trp Thr Phe Ile His Asn Glu Glu Ser Thr Asn Gly Ser Ser Glu Asn Asp Ser Ser <210> 50 <211> 105 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 30 <400> 50 Arg Ser Leu Gly His Trp Val Asp Gly Asn Gly Lys Gln Leu Asp Gly Lys Leu Lys Phe Thr Val Lys Asn Val Tyr Thr Ala GIy Arg Met Val Ser Leu Glu Gly Ser Leu Leu Ser Glu Gly Tyr His Arg Ser Gln Ala G1u Asn Leu Pro Val Val Ser Asn Thr Lys Ile Ile Phe Lsp Asp Glu Val Ser Gln Glu Asn Lys Glu Ser His Lys Asp Leu Glu Leu Ser Val Leu Lys Glu Asp Asn Gly Asp Glu Ile Met Tyr Glu Lys Asp Ser Ser Asp Ser Asn Ser Asp Ser Asp Ser Asp <210> 51 <211> 1489 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (198)..(1073) <223>
<220>
<221> misc_feature <223> Oligo 30 <400> 51 caatttttgt atcacgtgac acataccatg gaagttttgt atccattttt tacgttacaa 60 tacgtacaga aaattttcac attagacgcc agtcctcatg cgatgagatg agcttcaaga 120 gcagtagctg tcgctgaacg gacatcaacg tggttatact gtcctgcttg ctaaggtagt 180 tacgcaaatt ggttaga atg ggt gtc aaa aaa agc ccg ctc aaa cgg tcc 230 Met Gly Val Lys Lys Ser Pro Leu Lys Arg Ser aag acc gcc gag ttc atc aac aag cat cgc aag cta tgc aag aac ccc 278 Lys Thr Ala Glu Phe Ile Asn Lys His Arg Lys Leu Cys Lys Asn Pro atc agc agt gaa gat aac aca tca cag tgc atc acg cgg ctt cca gtg 326 Ile Ser Ser Glu Asp Asn Thr Ser Gln Cys Ile Thr Arg Leu Pro Val tct atg tac gtc tcg cta get ccc ctt tac cag caa cat cct ctg gag 374 Ser Met Tyr Val Ser Leu Ala Pro Leu Tyr Gln Gln His Pro Leu Glu ggc ata aaa cgg caa cat ctg aat ccc atg gtc atg aaa tac aac gga 422 Gly Ile Lys Arg Gln His Leu Asn Pro Met Val Met Lys Tyr Asn Giy gat gtt gga ggt gta ata ctg gga tat gag aat gtg gcg att atg aat 470 Asp Val Gly Gly Val Ile Leu Gly Tyr Glu Asn Val Ala Ile Met Asn so as 90 gaaggcgetgcg aaagatgaa gaactgcta gtcaagttg acgccagat 518 GluGlyAlaAla LysAspGlu GluLeuLeu ValLysLeu ThrProAsp accccttttgcg tttacctgg tgcagcgta gatcttgtg gtatggtcg 566 ThrProPheAla PheThrTrp CysSerVal AspLeuVal ValTrpSer ccacatatcggc gatgtgctc gagggatgg atcttcata cagtcagcc 614 ProHisIleGly AspVal-LeuGluGlyTrp IlePheIle GlnSerAla tcacacattggt ctgctgatc cacgacget ttcaacgca tccattaag 662 SerHisIleGly LeuLeuIle HisAspAla PheAsnAla SerIleLys aaaaataacatt ccggatgat tggaccttt attcataac gaagagagt 710 LysAsnAsnIle ProAspAsp TrpThrPhe IleHisAsn GluGluSer accaacgggagc agcgaaaac gattcttcc acaggaatg cgcaaggcc 758 ThrAsnGlySer SerGluAsn AspSerSer ThrGlyMet ArgLysAla cggtctctaggc cactgggtt gacggcaac ggtaagcag ctggacgga 806 ArgSerLeuGly HisTrpVal AspGlyAsn GlyLysGln LeuAspGly aaactcaaattt actgttaaa aatgtctac actgcgggc agaatggtg 854 LysLeuLysPhe ThrValLys AsnValTyr ThrAlaGly ArgMetVal tccctcgagggg tcactgcta agtgaaggc tatcacagg tcgcaagca 902 SerLeuGluGly SerLeuLeu SerGluGly TyrHisArg SerGlnAla gaaaacctgcct gtcgtttcc aacaccaag atcatcttt gatgacgag 950 GluAsnLeuPro ValValSer AsnThrLys IleIlePhe AspAspGlu gtctctcaagag aacaaggaa tctcataag gacttggaa cttagcgtt 998 ValSerGlnGlu AsnLysGlu SerHisLys AspLeuGlu LeuSerVal ctaaaagaagat aatggcgac gagatcatg tatgaaaaa gattccagc 1046 LeuLysGluAsp AsnGlyAsp GluIleMet TyrGluLys AspSerSer gattcaaacagc gacagcgac agcgactaagttgcct 1093 ctcatattta AspSerAsnSer AspSerAsp SerAsp gttgccttct acgtccgcatattacatatataaaacatgttttgaatact gaagcacaat1153 gagtcgcatc gcagttagtgtatagatagaacatgaaagtccaattgaga caatttacat1213 ccatatttta gtgagttaaaagcgacattaaacttggaagcaatatatat accttatttc1273 cacgcaataa ctaaattccaaaatgtcgattattttaaggctaggctaca acgggtaccc1333 aatagcttat gatcgtgaatacaacgacgtaaatacctaataatatgctc tttttatgtc1393 caaattcact actcattacctggtataatcattatatacgaaaatacttt atatatgtca1453 tctgaagact gtctctctaccaatcattgcaccaag 1489 <210> 52 <211> 292 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 30 <400> 52 Met Gly Val Lys Lys Ser Pro Leu Lys Arg Ser Lys Thr Ala Glu Phe Ile Asn Lys His Arg Lys Leu Cys Lys Asn Pro Ile Ser Ser Glu Asp Asn Thr Ser Gln Cys Ile Thr Arg Leu Pro Val Ser Met Tyr Val Ser Leu Ala Pro Leu Tyr Gln Gln His Pro Leu Glu Gly Ile Lys Arg Gln His Leu Asn Pro Met Val Met Lys Tyr Asn Gly Asp Val Gly Gly Val Ile Leu Gly Tyr Glu Asn Val Ala Ile Met Asn Glu Gly Ala Ala Lys Asp Glu Glu Leu Leu Val Lys Leu Thr Pro Asp Thr Pro Phe Ala Phe _ Thr Trp Cys Ser Va1 Asp Leu Val Val Trp Ser Pro His Ile Gly Asp Val Leu Glu Gly Trp Ile Phe Ile Gln Ser Ala Ser His Ile Gly Leu Leu Ile His Asp Ala Phe Asn Ala Ser Ile Lys Lys Asn Asn Ile Pro Asp Asp Trp Thr Phe Ile His Asn Glu Glu Ser Thr Asn Gly Ser Ser Glu Asn Asp Ser Ser Thr Gly Met Arg Lys Ala Arg Ser Leu Gly His Trp Val Asp Gly Asn Gly Lys Gln Leu Asp Gly Lys Leu Lys Phe Thr Val Lys Asn Val Tyr Thr Ala Gly Arg Met Val Ser Leu Glu Gly Ser Leu Leu Ser Glu Gly Tyr His Arg Ser Gln Ala Glu Asn Leu Pro Val Val Ser Asn Thr Lys Ile Ile Phe Asp Asp Glu Val Ser Gln Glu Asn Lys Glu Ser His Lys Asp Leu Glu Leu Ser Val Leu Lys Glu Asp Asn Gly Asp Glu Ile Met Tyr Glu Lys Asp Ser Ser Asp Ser Asn Ser Asp Ser Asp Ser Asp <210> 53 <211> 1289 <212> DNA
<213> Ashbya gossypii <220>
<22I> misc_feature <223> Oligo 124 <400>

gatcaactacgatatgcctagtgaggcagaccaatacctccacagagtcggtagagcggg60 cagattcggtaccaaaggtctggctatttcccttgtgtcctcaaaagatgatgaggaggt120 tttagctaagatccaagaacgttttgaccgtgaagatcaccgaatttccagaagaaggtg180 tcgacccatctacctatttgaacacttgaacaacaccgcttctccccatttccgatacta240 tatacgaaaagggctaacgtaaataagagaagaactcaacaaagggaaattttaaccttt300 ttcttggttttttgtatctaatataatcatcaaggactgggacgtatggtttagcctagt360 ctagctgaatactattagcgtcgcttctccgtcggaaagtactgatctaataaaccttcc420 aaaatgttttactgacattgatggcctagctctagaatttcttgtactcgtgacttcttt480 acacccagtcgcttttgcttttacgtaaaaccaaaactgaatgttttacttctcatataa540 aactgcatctttaaatcttaaatcgggcctcatattacatatgtgattttttttcccgga600 aagtgcatcgaacttcaatgcaggagtggtaatacgccaagagcaatgacgggatcttca660 gcgttccttgcggatgcgcaagtaaaacataaacttagaatatcactacaaataaacagc720 aactaggttacaagcactattataaacggccacatgaagacatctctcggctgtaaccca780 gcgctcatgtttgctctggggtgtcgcgtgcgctgacgtcaggaggctgcggtaagatga840 tctgcatatcttgctgtgcactgggcttttcgttagacttggatgatagaaccttggaaa900 ctttctctagacctttggtggaattaggcatgctgtttaaatgatgtgcatgaatattac960 ttaacgggagttccttggggagttcttcaatgtggcttcgggccttcaaagcacgagggg102.0 cagcagctaacaatgacggagaactatcatgccaattggagtgatcagactcagcaatat1080 tagttacaggcgttgaatctgattcctcgtctaggacgcgcgatgccaggatcccaaggg1140 tggttagcatatgggaaccgtttttgcttccgctgtcgctgcaagttattccactattaa1200 cagagccactgttactttttgccttcacactaggcgttgtgggcatgtactgggcagtct1260 tattcagaatgcgcatgagcctgttgatc 1289 <210> 54 <211> 49 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature 0050!52814 <223> Oligo 124 <400> 54 Ile Asn Tyr Asp Met Pro Ser Glu Ala Asp Gln Tyr Leu His Arg Val Gly Arg Ala Gly Arg Phe Gly Thr Lys Gly Leu Ala Ile Ser Leu Val Ser Ser Lys Asp Asp Glu Glu Val Leu Ala Lys Ile Gln Glu Arg Phe Asp <210> 55 <211> 18 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 124 <400> 55 Val Lys Ile Thr Glu Phe Pro Glu Glu Gly Val Asp Pro Ser Thr Tyr Leu Asn <210> 56 <211> 3228 <212> DNA
<213> Ashbya gossypii <220>

<221> CDS
<222> (465)..(1775) <223>
<220>
<221> misc feature <223> Oligo 124 <400>

ccagacgaggatgatgccccggactcccgccgctgcagatgttgctgtcgctattctggg60 gcattcgcctccgctggaacgaacgccatccgcagaacgcgcatcaacagatccgcagac120 tatgcatgcccaattgaaggcgttggtggctaccattgatgaccatgagccacagcttta180 taacaatatggcagatcccgcatcaaaagttctactgaataacatcttcaaccgtcttcg240 agccatggtgagtgatgatgcgtcctagtctcgatcacgtgattcaaaagcgtatcctgt300 tacccggccctctaaaggtggcaaactgtcgaaaattgaaagcgtaatgaaaaatcagcg360 aaaagaacaggatttgtttggaacgccatattatctttcattctttgaaagcataaagcg420 ctattttagctgtcaggtcattctttagttaatcgattatcagg atg 476 tca cac gaa Met Ser His Glu ggc gag gaa gat tta ttg gaa tat tcc gat aac gaa cag gaa atc cag 524 Gly Glu Glu Asp Leu Leu Glu Tyr Ser Asp Asn Glu Gln Glu Ile Gln gtt gac aac acg aag gcc act gag gta gcc ggt aac gga gaa gag gca 572 Val Asp Asn Thr Lys Ala Thr Glu Va1 Ala Gly Asn Gly Glu Glu Ala get gac gga aag gat gga gac aag aag gga tcg tac gta ggt att cac 620 Ala Asp Gly Lys Asp Gly Asp Lys Lys Gly Ser Tyr Val Gly Ile His tcg aca ggt ttt aag gat ttt ctg ttg aag cca gag ctt tcc cgg gcc 668 Ser Thr Gly Phe Lys Asp Phe Leu Leu Lys Pro Glu Leu Ser Arg Ala att att gac tgt ggt ttg gaa cat cca tgt gag gtc caa caa cac acc 716 Ile Iie Asp Cys Gly Leu Glu His Pro Cys Glu Val Gln Gln His Thr atc cca caa tca att cac ggt acg gac gtt cta tgt cag gca aag tcc 764 Ile Pro Gln Ser I1e His Gly Thr Asp Val Leu Cys Gln Ala Lys Ser ggt ctc ggg aaa act get gtg ttt gtg ttg tca acg ctg cag caa ttg 812 Gly Leu Gly Lys Thr Ala Val Phe Val Leu Sex Thr Leu Gln Gln Leu _ gac cct gtt cca ggc gag gta tca gtg gtc gtt ctg tgc aat gcc aga 860 Asp Pro Val Pro Gly Glu Val Ser Val Val Val Leu Cys Asn Ala Arg gaa ttg get tat cag atc aga aac gag tac ttg aga ttc tcg aaa tat 908 Glu Leu Ala Tyr Gln Ile Arg Asn Glu Tyr Leu Arg Phe Ser Lys Tyr atg ccg gac gtg aaa aca get gtt ttc tat ggt ggc aca gac act agg 956 Met Pro Asp Val Lys Thr Ala Val Phe Tyr Gly Gly Thr Asp Thr Arg aag gac att gag ttg tta aaa aac aaa gat act gcg cca cat att gta 1004 Lys Asp Ile Glu Leu Leu Lys Asn Lys Asp Thr A1a Pro His IIe Val gtt gca acg ccg gga cgg ttg aag gcg ctg gta cgg gac aac aat att 1052 Val Ala Thr Pro Gly Arg Leu Lys Ala Leu Va1 Arg Asp Asn Asn Ile gac ttg tct cac gtt aag aac ttt gtt atc gat gag tgt gac aag gtg 1100 Asp Leu Ser His Val Lys Asn Phe Val Ile Asp Glu Cys Asp Lys Val ttg gag gag ctc gat atg aga aga gat gtg caa gac att ttc agg gca 1148 Leu Glu Glu Leu Asp Met Arg Arg Asp Val Gln Asp Ile Phe Arg Ala act cct aga gat aag cag gtg atg atg ttc tct get acg cta tct caa 1196 Thr Pro Arg Asp Lys Gln Val Met Met Phe Ser Ala Thr Leu Ser Gln gag atc aga ccg atc tgt aga cgt ttc ttg caa aac cct ctg gag att 1244 Glu Ile Arg Pro Ile Cys Arg Arg Phe Leu Gln Asn Pro Leu Glu Ile ttt gtt gat gac gaa get aag ttg acc ttg cac ggt ttg cag cag tac 1292 Phe Val Asp Asp Glu Ala Lys Leu Thr Leu His Gly Leu Gln Gln Tyr tat atc agg ctt gag gaa cgt gag aag aac cgt aag ctg get caa ttg 1340 Tyr Ile Arg Leu Glu Glu Arg Glu Lys Asn Arg Lys Leu Ala Gln Leu ttg gat gat ttg gaa ttt aac cag gtt att atc ttc gta aaa tcg aca 1388 Leu Asp Asp Leu Glu Phe Asn Gln Val Ile Ile Phe Val Lys Ser Thr ctt aga gca aac gaa ttg act aag ctg ttg aat get tcc aac ttc cct 1436 Leu Arg Ala Asn Glu Leu Thr Lys Leu Leu Asn Ala Ser Asn Phe Pro gca att act gtt cac ggt cac atg aga cag gaa gag cgt att gcc cgc 1484 Ala Ile Thr Val His Gly His Met Arg Gln Glu Glu Arg Ile Ala Arg tac aag gcc ttc aag gaa ttt gaa aag cgt atc tgt gtg tca aca gac 1532 Tyr Lys Ala Phe Lys Glu Phe Glu Lys Arg Ile Cys Va1 Ser Thr Asp gtt ttc ggt agg ggt att gat atc gag cgt atc aac cta gcg atc aac 1580 Val Phe Gly Arg Gly Ile Asp Ile Glu Arg Ile Asn Leu Ala Ile Asn tac gat atg cct agt gag gca gac caa tac ctc cac aga gtc ggt aga 1628 Tyr Asp Met Pro Ser Glu Ala Asp Gln Tyr Leu His Arg Val Gly Arg gcg ggc aga ttc ggt acc aaa ggt ctg get att tcc ctt gtg tcc tca 1676 Ala Gly Arg Phe Gly Thr Lys Gly Leu Ala Ile Ser Leu Val Ser Ser aaa gat gat gag gag gtt tta get aag atc caa gaa cgt ttt gac gtg 1724 Lys Asp Asp Glu Glu Val Leu Ala Lys Ile Gln Glu Arg Phe Asp Val aag atc acc gaa ttt cca gaa gaa ggt gtc gac cca tct acc tat ttg 1772 Lys Ile Thr Glu Phe Pro Glu Glu Gly Val Asp Pro Ser Thr Tyr Leu aac acttgaacaa caccgcttct ccccatttcc gatactatat acgaaaaggg 1825 Asn ctaacgtaaataagagaagaactcaacaaagggaaattttaacctttttcttggtttttt1885 gtatctaatataatcatcaaggactgggacgtatggtttagcctagtctagctgaatact1945 attagcgtcgcttctccgtcggaaagtactgatctaataaaccttccaaaatgttttact2005 gacattgatggcctagctctagaatttcttgtactcgtgacttctttacacccagtcgct2065 tttgcttttacgtaaaaccaaaactgaatgttttacttctcatataaaactgcatcttta2125 aatcttaaatcgggcctcatattacatatgtgattttttttcccggaaagtgcatcgaac2185 ttcaatgcaggagtggtaatacgccaagagcaatgacgggatcttcagcgttccttgcgg2245 atgcgcaagtaaaacataaacttagaatatcactacaaataaacagcaactaggttacaa2305 gcactattataaacggccacatgaagacatctctcggctgtaacccagcgctcatgtttg2365 ctctggggtgtcgcgtgcgctgacgtcaggaggctgcggtaagatgatctgcatatcttg2425 ctgtgcactgggcttttcgttagacttggatgatagaaccttggaaactttctctagacc2485 tttggtggaattaggcatgctgtttaaatgatgtgcatgaatattacttaacgggagttc2545 cttggggagttcttcaatgtggcttcgggccttcaaagcacgaggggcagcagctaacaa2605 tgacggagaactatcatgccaattggagtgatcagactcagcaatattagttacaggcgt2665 tgaatctgattcctcgtctaggacgcgcgatgccaggatcccaagggtggttagcatatg2725 ggaaccgtttttgcttccgctgtcgctgcaagttattccactattaacagagccactgtt2785 actttttgccttcacactaggcgttgtgggcatgtactgggcagtcttattcagaatgcg2845 catgagcctgttgatctgtttattcttctccataatggtatcacgatattttgagatttt2905 atgatctctagtgcgaatctgttccttcaactcttgcttatctatattgagcttgcattt2965 cacgtgttcgtacatatgcttggacaaattaagctcaacttcagaacgggaatccacatt3025 ctttaacgttgaattcagcaccaggtttttgaacttgagttgccggatctgctcttgtga3085 ctttgaaagc aggcttaccaacaattctaa ggtcttcgag agttcatcyt tggatgggac3145 aaacagttcg agtggtgtctgttgcctcga ctctgatggt tccgtcctat caaattcgtt3205 acatcgccgt gtcgacaagttgt 3228 <210> 57 <211> 437 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 124 <400> 57 Met Ser His GIu Gly Glu Glu Asp Leu Leu Glu Tyr Ser Asp Asn Glu Gln Glu Ile Gln Val Asp Asn Thr Lys Ala Thr Glu Val Ala Gly Asn Gly Glu Glu Ala AIa Asp Gly Lys Asp Gly Asp Lys Lys Gly Ser Tyr Val Gly Ile His Ser Thr Gly Phe Lys Asp Phe Leu Leu Lys Pro Glu Leu Ser Arg Ala Ile Ile Asp Cys Gly Leu GIu His Pro Cys Glu Val Gln Gln His Thr Ile Pro Gln Ser Ile His Gly Thr Asp Val Leu Cys Gln Ala Lys Ser Gly Leu Gly Lys Thr Ala Val Phe Val Leu Ser Thr Leu Gln Gln Leu Asp Pro Val Pro Gly G1u Val Ser Val Val VaI Leu 17.5 120 125 Cys Asn Ala Arg Glu Leu Ala Tyr Gln Ile Arg Asn Glu Tyr Leu Arg Phe Ser Lys Tyr Met Pro Asp Val Lys Thr AIa Val Phe Tyr Gly Gly Thr Asp Thr Arg Lys Asp Ile Glu Leu Leu Lys Asn Lys Asp Thr Ala Pro His Ile Val Val Ala Thr Pro Gly Arg Leu Lys Ala Leu VaI Arg Asp Asn Asn Ile Asp Leu Ser His Val Lys Asn Phe Val Ile Asp Glu Cys Asp Lys Val Leu Glu Glu Leu Asp Met Arg Arg Asp Val Gln Asp Ile Phe Arg Ala Thr Pro Arg Asp Lys Gln Val Met Met Phe Ser Ala Thr Leu Ser Gln Glu Ile Arg Pro Ile Cys Arg Arg Phe Leu Gln Asn Pro Leu Glu Ile Phe Val Asp Asp Glu Ala Lys Leu Thr Leu His Gly Leu Gln Gln Tyr Tyr Ile Arg Leu Glu Glu Arg Glu Lys Asn Arg Lys Leu Ala Gln Leu Leu Asp Asp Leu Glu Phe Asn Gln Val Ile Ile Phe Val Lys Ser Thr Leu Arg Ala Asn Glu Leu Thr Lys Leu Leu Asn Ala Ser Asn Phe Pro Ala Ile Thr Val His Gly His Met Arg Gln Glu Glu Arg Ile Ala Arg Tyr Lys Ala Phe Lys Glu Phe Glu Lys Arg Ile Cys Val Ser Thr Asp Val Phe Gly Arg Gly Ile Asp Ile Glu Arg Ile Asn Leu Ala Ile Asn Tyr Asp Met Pro Ser Glu Ala Asp Gln Tyr Leu His Arg VaI Gly Arg Ala Gly Arg Phe Gly Thr Lys Gly Leu Ala Ile Ser Leu Val Ser Ser Lys Asp Asp Glu Glu Val Leu Ala Lys Ile Gln Glu Arg Phe Asp Val Lys Ile Thr Glu Phe Pro Glu Glu Gly Val Asp Pro Ser Thr Tyr Leu Asn <210> 58 <211> 545 <212> DNA
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 139 <220>
<221> misc feature <222> (358)..(358) <223> unknown nucleotide <220>
<221> misc_feature <222> (418)..(418) <223> unknown nucleotide <220>
<221> misc feature <222> (461)..(461) <223> unknown nucleotide <220>
<221> misc feature <222> (506)..(506) <223> unknown nucleotide <220>
<221> misc_feature <222> (539)..(539) <223> unknown nucleotide <400>

gatccacacgccaaccgacaggcagaacatctacgatttactgaaatatctcctggagaa 60 cgagccgaargattcgttwgcctgagtcatgtactatattattacactttgagtwgttta 120 tgtataggttgggacaacatgcagacaggcacctacacacctggattggacagcgtagcc 180 gctgccgcggcctgttgcttcttagtaaccctctttttggggactgccgccccatctgcc 240 tttttggtgggcttccgctgccttttcggtttggatttgtcgtcgctgtccgcggtgccg 300 gcgcgcttgccgtttgcctcgctcggcgcggtgtgcgcactgcccatccccataccgncc 360 ggcccaacattctgcagcatggccccggcctgctgcttcacaggctgtgtagtaagangg 420 gtcgacatcgagatgcggtgattataccccggcggggccangttcgcgttgagtgcctgc 480 tgcttcttcttctctttggtcaagcngaactgctcgacgaattttagtctgctgaaccng 540 gtatt <210> 59 <211> 27 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 139 <220>
<221> misc_feature <222> (26)..(26) <223> unknown amino acid <400> 59 Ile His Thr Pro Thr Asp Arg Gln Asn Ile Tyr Asp Leu Leu Lys Tyr Leu Leu Glu Asn Glu Pro Lys Asp Ser Xaa Ala <210> 60 <211> 1396 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (402)..(638) <223>
<220>
<221> misc_feature <223> Oligo 139 <220>
<221> CDS
<222> (663)..(974) <223>
<400>

cttccccggaatgaaagccgggctcacgctgagttgcaggcgtggcagccgcgcggcaat60 atttgcacggttctctcagcactgcgccagtcaaccccttaactctcgagggtgccgccc120 ctcccgtaggcgcagtcggccaaggaggaagcggcggcacatggtgccggccgccaccgc180 ggagcaggatcaccggaatgacggatgtcacgtgcaggccgagggaccgactaagcgcgg240 tgttcgacagcgcgctcgtggcggcaggcacagccgtcggttaatgtgcacacacgtgat300 ggtcacgtgcgcaacggccgggcctttttgtgtggtcaaagccagagcacactcgggcag360 - atccacagca tacacaccat agagggacag tgccgatgac g acc gcg cgt gac aat 416 Thr Ala Arg Asp Asn agc gcg acg acg ctc gag ctg tat cgc aag acg ctg aat ttc aat gtg 464 Ser Ala Thr Thr Leu Glu Leu Tyr Arg Lys Thr Leu Asn Phe Asn Va1 atcggc agatatgac cccaaaata aagcagctg ctgttccac acgccg 512 IleGly ArgTyrAsp ProLysIle LysGlnLeu LeuPheHis ThrPro catgcg acggtgtac aagtgggag gccggcgag aacaagtgg aacaag 560 HisAla ThrValTyr LysTrpGlu AlaGlyGlu AsnLysTrp AsnLys ctggag taccagggc gtgctgget atatatcta cgcgatgtg cgcgag 608 LeuGlu TyrGlnGly ValLeuAla IleTyrLeu ArgAspVal ArgGlu caggcg gagctgccg gtgccgcac caggaggcgagtgcag 658 gcgcggaggg GlnAla GluLeuPro ValProHis GlnGlu gcgg 707 tgc ggc gag gtg ctc agc ggg cgc gac atc tac aac tac gcg ctg Cys Gly Glu Val Leu Ser Gly Arg Asp Ile Tyr Asn Tyr Ala Leu atcgtgctcaaccgg atcaacccc gagaacttc tcgattgca attgcg 755 IleValLeuAsnArg IleAsnPro GluAsnPhe SerIleAla IleAla ccgaacagcgttgtg aacaagcgg cgtctcttt tcgccggag gagaac 803 ProAsnSerValVal AsnLysArg ArgLeuPhe SerProGlu GluAsn gtgcagcagccgctg gagccaatg gacgttgag gtcaaagat gaactg 851 ValGlnGlnProLeu GluProMet AspValGlu ValLysAsp GluLeu gtgatcatcaaaaac ctgcggaag gaggtgtac ggcatctgg atccac 899 ValIleIleLysAsn LeuArgLys GluValTyr GlyIleTrp IleHis acgccaaccgacagg cagaacatc tacgattta ctgaaatat ctcctg 947 ThrProThrAspArg GlnAsnIle TyrAspLeu LeuLysTyr LeuLeu gag aac gag ccg aag gat tcg ttt gcc tgagtcatgt actatattat 994 Glu Asn Glu Pro Lys Asp Ser Phe Ala 175 lao tacactttgagttgtttatgtataggttgggacaacatgcagacaggcacctacacacct1054 ggattggacagcgtagccgctgccgcggcctgttgcttcttagtaaccctctttttgggg1114 actgccgccccatctgcctttttggtgggcttccgctgccttttcggtttggatttgtcg1174 tcgctgtccgcggtgccggcgcgcttgccgtttgcctcgctcggcgcggtgtgcgcactg1234 cccatccccataccgcccggcccaacattctgcagcatggccccggcctgctgcttcaca1294 ~ 96 ggctgtgtag taagaggggt cgacatcgag atgcggtggt tataccccgg cggggccagg 1354 ttcgcgttga gtgcctgctg ctcttcttct ctttggtcaa gc 1396 <210> 61 <211> 79 <2I2> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 139 <400> 61 Thr Ala Arg Asp Asn Ser Ala Thr Thr Leu Glu Leu Tyr Arg Lys Thr Leu Asn Phe Asn Val Ile Gly Arg Tyr Asp Pro Lys Ile Lys Gln Leu Leu Phe His Thr Pro His Ala Thr Val Tyr Lys Trp Glu Ala Gly Glu Asn Lys Trp Asn Lys Leu Glu Tyr Gln Gly Val Leu Ala Ile Tyr Leu Arg Asp Val Arg Glu Gln Ala Glu Leu Pro Val Pro His Gln Glu <210> 62 <211> 104 <212> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 139 <400> 62 Cys Gly Glu Val Leu Ser Gly Arg Asp Ile Tyr Asn Tyr Ala Leu Ile Val Leu Asn Arg Ile Asn Pro Glu Asn Phe Ser Ile Ala Ile Ala Pro 2p 25 30 Asn Ser Val Val Asn Lys Arg Arg Leu Phe Ser Pro Glu Glu Asn Val -Gln Gln Pro Leu Glu Pro Met Asp Val Glu Val Lys Asp Glu Leu Val Ile Ile Lys Asn Leu Arg Lys Glu Val Tyr Gly Ile Trp Ile His Thr Pro Thr Asp Arg Gln Asn Ile Tyr Asp Leu Leu Lys Tyr Leu Leu Glu Asn Glu Pro Lys Asp Ser Phe Ala <210> 63 <211> 944 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 144 <400> 63 gatctgagaatgttaacgataaccctgctattgcgaagaacgttgtgagcttctacgcgc 60 ctgagaagaaggtcgacaagaagggtgtcatcattgacaaagagctcagcatcttcaaga 120 agtggaaacttgtgcgtgccatcgacggcaagttctccaacgaaattacctggtcacctg 180 ctggacgttttgtatgcgtcgctgctattggtaagattggttcccgtaacgagaacattg 240 atttctacgatatggactatccaaacactgaaaagatcattaacactgctactgacgtta 300 acgctaccctgagagacgttgcccacatcaactacgccagtgccactgattacgaatggg 360 acccaagtggacggtaccttgccttctggtcttccgcgtggaagcacaaggccgaaaatg 420 gatacaaggtattcaacttggccggtgccatcgtgcgtgaggagctcatcaccgacttta 480 acaacttcttctggagaccaagaccagactctctactatccaactctgagaagaagaagg 540 gg - tcagaaagaacctcaaggaatggtccgcgcactttgaagagcaggatgctatggaggcgg600 acagtgctac aagagagttaatcctaaagagacgcaactggttggatgaatggtccaagt660 acagagaggc ttgcaagcaaaccctatccgaaagtggattgtccatttgcgattgtgtcg72D

aactgtcaac taaggatgaggactgtgagcttgtcgaggagattagagagactgtggttg780 aggagtccac cgaggaagtgccatttttcgaggagtaatcgggtttcggctgttgttgta840 taatagtggc aacactggtaattgattatgtatatatacaagtactacatccagcgtata900 atgttttctt ttccgcagcagcgtctcgtcgcactcatgcgatc 944 <210> 64 <211> 260 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature .
<223> Oligo 144 <400> 64 Asn Pro Ala Ile Ala Lys Asn Val Val Ser Phe Tyr Ala Pro Glu Lys Lys Val Asp Lys Lys Gly Val Ile Ile Asp Lys Glu Leu Ser Ile Phe Lys Lys Trp Lys Leu Val Arg Ala Ile Asp Gly Lys Phe Ser Asn Glu 35 40 . 45 Ile Thr Trp Ser Pro Ala Gly Arg Phe Val Cys Val Ala Ala Ile Gly Lys Ile Gly Ser Arg Asn Glu Asn Ile Asp Phe Tyr Asp Met Asp Tyr Pro Asn Thr Glu Lys Ile Ile Asn Thr Ala Thr Asp Val Asn Ala Thr Leu Arg Asp Val Ala His Ile Asn Tyr Ala Ser Ala Thr Asp Tyr Glu Trp Asp Pro Ser Gly Arg Tyr Leu Ala Phe Trp Ser Ser Ala Trp Lys His Lys A1a Glu Asn Gly Tyr Lys Val Phe Asn Leu Ala Gly Ala Ile Val Arg Glu Glu Leu Ile Thr Asp Phe Asn Asn Phe Phe Trp Arg Pro Arg Pro Asp Ser Leu Leu Ser Asn Ser Glu Lys Lys Lys Val Arg Lys Asn Leu Lys Glu Trp Ser Ala His Phe Glu Glu Gln Asp Ala Met Glu Ala Asp Ser Ala Thr Arg Glu Leu Ile Leu Lys Arg Arg Asn Trp Leu Asp Glu Trp Ser Lys Tyr Arg Glu Ala Cys Lys Gln Thr Leu Ser Glu Ser Gly Leu Ser Ile Cys Asp Cys Val Glu Leu Ser Thr Lys Asp Glu Asp Cys Glu Leu Val Glu Glu Ile Arg Glu Thr Val Val Glu Glu Ser Thr Glu Glu Val <210> 65 <211> 3397 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (468)..(2675) <223>
<220>

<221> misc_feature <223> Oligo 144 <400>

actccattgccctcttgcgctgccatcgtctcactttcgcctgcaaatatccactttggt60 cccgtcgcctgctccattcagcacagattggattatcgcctctaacacctccatgagtct120 tgctgaagcttgcttggtgctttgcgcgtactgtttttggacatctatgtaaacaagcga180 aaatacccacttctgtgtcgcgtggataaggtgcgcgcccacattgcgaatcccacggca240 cggccacttgctagtaaaccccaaagcgtaacgctagttctctagccgggcactgagacc300 gttaatgcagcagccaatggcctgcatttgggatgaggttggtcagatggaatcacgtga360 tatagatgcttggcgaggtcaaggtgaaaaattgttaagttaaaattttggacgcatcac420 cagttccagcgagagaagatcagtcaagcagcaggtatagagcgaag gca gcg 476 atg - Met Ala Ala gtattc gacgatata aggcttgag gacatccctgtg gatgatgtg gat 524 ValPhe AspAspIle ArgLeuGlu AspIleProVal AspAspVal Asp atgcag gaccttgag gagacgtat getgtagagcgg agcatcgaa ttt 572 MetGln AspLeuGlu GluThrTyr AlaValGluArg SerIleGlu Phe gacaga tacgtggtt gtcgacggg gcgccggtggcg ccggaggcg aag 620 AspArg TyrValVal ValAspGly AlaProValAla ProGluAla Lys gtgggc gcgctgcag aaggtgctg acgaagctattt tcgcaggcg ggg 668 ValGly AlaLeuGln LysVal~Leu ThrLysLeuPhe SerGlnAla Gly tcagtg gtggacatg gatgtgcct gtcgaagagggg cggacgaag gga 716 SerVal ValAspMet AspValPro ValGluGluGly ArgThrLys Gly cacctt ttcattgagttt gaggacgcc ggcgetgcg cggcgggcg atc 764 HisLeu PheIleGluPhe GluAspAla GlyAlaAla ArgArgAla Ile aagatg ttcaacgggaag aagttggac gtcaagcac cgcctgtgg gtg 812 LysMet PheAsnGlyLys LysLeuAsp ValLysHis ArgLeuTrp Val aacgga ctagacgacatg gagcgctac gggcggccg gacttttca acg 860 AsnGly LeuAspAspMet GluArgTyr GlyArgPro AspPheSer Thr gaatac cgggagcctgtg gtgccggag ttcgaggcg acggaatac cca 908 GluTyr ArgGluProVal ValProGlu PheGluAla ThrGluTyr Pro cggtcg tggttgcaggac gagacgggt cgggaccag tttgtgctg cag 956 ArgSer TrpLeuGlnAsp GluThrGly ArgAspGln PheValLeu Gln aag ggc gag atg acg get gta ttc tgg aac cgg aac aac ctg cag ceg 1004 Lys Gly Glu Met Thr Ala Val Phe Trp Asn Arg Asn Asn Leu Gln Pro gag aac gtt gtc gaa ccg cgc cgc aac tgg tcg aac tct atc ttg aac 1052 Glu Asn Val Val Glu Pro Arg Arg Asn Trp Ser Asn Ser Ile Leu Asn ttc tcg cct cac ggt acg tac cta ttc tcg ttc cac gac cag ggc att 1100 Phe Ser Pro His Gly Thr Tyr Leu Phe Ser Phe His Asp Gln Gly Ile gcg tcc tgg ggt ggg ccg cag ttc aag cgt ctc cgt cgg ttt gcg cac 1148 Ala Ser Trp Gly Gly Pro Gln Phe Lys Arg Leu Arg Arg Phe Ala His cct gat gtt aag gcg atc tcc atg tcc tcg acc gag aag tac ctg gtt 2196 Pro Asp Val Lys Ala Ile Ser Met Ser Ser Thr Glu Lys Tyr Leu Val acc ttt tcg tcg gaa cct eta gaa gtc teg gat gaa cct aac gag get 1244 Thr Phe Ser Ser Glu Pro Leu Glu Val Ser Asp Glu Pro Asn Glu Ala tgtcca ttcgggccc gagtcgcgg ggccaccagcta tgtatatgg gat 1292 CysPro PheGlyPro GluSerArg GlyHisGlnLeu CysIleTrp Asp gtggca acaggtgtc tgcgtgaag acctttgcgctg ccgcctcag cag 1340 ValAla ThrGlyVal CysValLys ThrPheAlaLeu ProProGln Gln cagctg caatggcct atggtcaag tggtcctttgac gacaagttc tgc 1388 GlnLeu GlnTrpPro MetValLys TrpSerPheAsp AspLysPhe Cys getegt cttggccct ggegcaatt getgtgtacgag acegagaag aac 1436 AlaArg LeuGlyPro GlyAlaIle AlaValTyrGlu ThrGluLys Asn ttc cag ctg ttg ggc ggt aag gtg atg aag atc gag gat gtt cag gac 1484 Phe Gln Leu Leu Gly Gly Lys Val Met Lys Ile Glu Asp Val Gln Asp ttc tcc ttt get cet aag ggc ate aag ttg gcg tca aae aga cce aac 1532 Phe Ser Phe Ala Pro Lys Gly Ile Lys Leu Ala Ser Asn Arg Pro Asn gac cca cca tct act gtc atg gta tac tgg act cca gag tcg aac aac 1580 Asp Pro Pro Ser Thr Val Met Val Tyr Trp Thr Pro Glu Ser Asn Asn cag tcg tgt aaa get gtc ctg att gag cta ccg aac cge cgt gtt ctg 1628 Gln Ser Cys Lys Ala Val Leu Ile Glu Leu Pro Asn Arg Arg Val Leu cgt acc atc aac ttg gtg cag gtt act gat gtc tcc ttc cat tgg cag 1676 Arg Thr Ile Asn Leu Val Gln Val Thr Asp Val Ser Phe His Trp Gln aac cag gca gag ttc ctc tgt gta cag gtg gac cgt cac acg aag tct 1724 a Asn Gln Ala Glu Phe Leu Cys Val Gln Val Asp Arg His Thr Lys Ser agg aag acc atc ttc acc aac atg gag att tgc tct ttg act gcc aga 1772 Arg Lys Thr Ile Phe Thr Asn Met Glu Ile Cys Ser Leu Thr Ala Arg gagttt ccatttgag aaggtggag attaaggac cgctgtatg cgcttt 1820 GluPhe ProPheGlu LysValGiu IleLysAsp ArgCysMet ArgPhe gcatgg gaacctaat agcgaccgt ttcgtgatc atttcgaga tctgag 1868 AlaTrp GluProAsn SerAspArg PheValIle IleSerArg SerGlu aatgtt aacgataac cctgetatt gcgaagaac gttgtgagc ttctac 1916 AsnVal AsnAspAsn ProAlaIle AlaLysAsn ValValSer PheTyr gcgcct gagaagaag gtcgacaag aagggtgtc atcattgac aaagag 1964 AlaPro GluLysLys ValAspLys LysGlyVal IleIleAsp LysGlu ctcagc atcttcaag aagtggaaa cttgtgcgt gccatcgac ggcaag 2012 LeuSer IlePheLys LysTrpL~ysLeuValArg AlaIleAsp GlyLys ttctcc aacgaaatt acctggtca cctgetgga cgttttgta tgcgtc 2060 PheSer AsnGluIle ThrTrpSer ProAlaGly ArgPheVal CysVal getget attggtaag attggttcc cgtaacgag aacattgat ttctac 2108 AlaAla IleGlyLys IleGlySer ArgAsnGlu AsnIleAsp PheTyr gatatg gactatcca aacactgaa aagatcatt aacactget actgac 2156 AspMet AspTyrPro AsnThrGlu LysIleIle AsnThrAla ThrAsp gttaac getaccctg agagacgtt gcccacatc aactacgcc agtgcc 2204 ValAsn AlaThrLeu ArgAspVal AlaHisIle AsnTyrAla SerAla actgat tacgaatgg gacccaagt ggacggtacctt gccttctgg tct 2252 ThrAsp TyrGluTrp AspProSer GlyArgTyrLeu AlaPheTrp Ser tccgcg tggaagcac aaggccgaa aatggatacaag gtattcaac ttg 2300 SerAla TrpLysHis LysAlaGIu AsnGlyTyrLys ValPheAsn Leu gccggt gccatcgtg cgtgaggag ctcatcaccgac tttaacaac ttc 2348 AlaGly AlaIleVal ArgGluGlu LeuIleThrAsp PheAsnAsn Phe ttctgg agaccaaga ccagactct ctactatccaac tctgagaag aag 2396 PheTrp ArgProArg ProAspSer LeuLeuSerAsn SerGluLys Lys aaggtc agaaagaac ctcaaggaa tggtccgcgcac tttgaagag cag 2444 LysVal ArgLysAsn LeuLysGlu TrpSerAlaHis PheGluGlu Gln gat get atg gag gcg gac agt get aca aga gag tta atc cta aag aga 2492 Asp Ala Met Glu Ala Asp Ser Ala Thr Arg Glu Leu Ile Leu Lys Arg cgc aac tgg ttg gat gaa tgg tcc aag tac aga gag get tgc aag caa 2540 Arg Asn Trp Leu Asp Glu Trp Ser Lys Tyr Arg Glu Ala Cys Lys Gln acc cta tcc gaa agt gga ttg tcc att tgc gat tgt gtc gaa ctg tca 2588 Thr Leu Ser Glu Ser Gly Leu Ser Ile Cys Asp Cys Val Glu Leu Ser act aag gat gag gac tgt gag ctt gtc gag gag att aga gag act gtg 2636 Thr Lys Asp Glu Asp Cys Glu Leu Val Glu Glu Ile Arg Glu Thr Val gtt gag cca ttt gag gag 2685 gag ttc taatcgggtt tcc acc gag gaa gtg Val Glu Pro Phe Glu Glu Glu Phe Ser Thr Glu Glu Val tcggctgttgttgtataatagtggcaacactggtaattgattatgtatatatacaagtac2745 tacatccagcgtataatgttttcttttccgcagcagcgtctcgtcgcactcatgcgatct2805 ggctgcggccgccaccacgcagaccgcggaccgccttcggtgagatcattaccatacaat2865 ctagagaagcaataaataggtttttcgtttattcagctttggtacgcagctgcagcccat2925 gccagcgtttgatgtcgtccgcaagcacgcggttgacgagcttgtgctgctgcaccatgc2985 tcttgcccttgaagtgtgtgctccggatatcgatcgtgaacatcgaaccacaacccccgc3045 tcacatcagtgactttcacataccccggcgcaagcgcgtcggttagcttttgcgtaatga3105 gcgcctcttccggcgtgctagtataatagcgcgcgaagagacgggagtaagagcccacaa3165 gccgacctctagctaacatggggtcgtttgagcggcaaataatgaaacgggagcagcaga3225 tgaagtttaaatctgcgtgatctgcagatatacgtgtgtgcgcgtgagcagtcagcctga3285 gaacttttcggaacatcgcttttgccggcaacgtgggggaagccctacttgccttacaag3345 tcaactcatggcacaccggctacccttctgatgtttgcattcccagccaaga 3397 <210> 66 <211> 736 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 144 <400> 66 0050/528'i 4 Met Ala Ala Val Phe Asp Asp Ile Arg Leu Glu Asp Ile Pro Val Asp " 1 5 10 15 Asp Val Asp Met Gln Asp Leu Glu Glu Thr Tyr Ala Val Glu Arg Ser Ile Glu Phe Asp Arg Tyr Val Val Val Asp Gly A1a Pro Val Ala Pro Glu Ala Lys Val Gly Ala Leu Gln Lys Val Leu Thr Lys Leu Phe Ser Gln Ala Gly Ser Val Val Asp Met Asp Val Pro Val Glu Glu Gly Arg Thr Lys Gly His Leu Phe Ile Glu Phe Glu Asp Ala Gly Ala Ala Arg Arg Ala Ile Lys Met Phe Asn Gly Lys Lys Leu Asp Val Lys His Arg Leu Trp Val Asn Gly Leu Asp Asp Met Glu Arg Tyr Gly Arg Pro Asp Phe Ser Thr Glu Tyr Arg Glu Pro Val Val Pro Glu Phe Glu Ala Thr Glu Tyr Pro Arg Ser Trp Leu Gln Asp Glu Thr Gly Arg Asp Gln Phe Val Leu Gln Lys Gly Glu Met Thr Ala Val Phe Trp Asn Arg Asn Asn Leu Gln Pro Glu Asn Val Val Glu Pro Arg Arg Asn Trp Ser Asn Ser Ile Leu Asn Phe Ser Pro His Gly Thr Tyr Leu Phe Ser Phe His Asp Gln Gly Ile Ala Ser Trp Gly Gly Pro Gln Phe Lys Arg Leu Arg Arg Phe Ala His Pro Asp Val Lys Ala Ile Ser Met Ser Ser Thr Glu Lys Tyr Leu Val Thr Phe Ser Ser Glu Pro Leu Glu Val Ser Asp Glu Pro Asn Glu Ala Cys Pro Phe Gly Pro Glu Ser Arg Gly His Gln Leu Cys Ile Trp Asp Val Ala Thr Gly Val Cys Val Lys Thr Phe Ala Leu Pro Pro Gln Gln Gln Leu Gln Trp Pro Met Val Lys Trp Ser Phe Asp Asp Lys Phe Cys Ala Arg Leu Gly Pro Gly Ala Ile Ala Val Tyr Glu Thr Glu Lys Asn Phe Gln Leu Leu Gly Gly Lys Val Met Lys Ile Glu Asp Val Gln Asp Phe Ser Phe Ala Pro Lys Gly Ile Lys Leu Ala Ser Asn Arg Pro Asn Asp Pro Pro Ser Thr Val Met Val Tyr Trp Thr Pro Glu Ser Asn Asn Gln Ser Cys Lys Ala Val Leu Ile Glu Leu Pro Asn Arg Arg Val Leu Arg Thr Ile Asn Leu Val Gln Val Thr Asp Val Ser Phe His Trp Gln Asn Gln Ala Glu Phe Leu Cys Val Gln Val Asp Arg His Thr Lys Ser Arg Lys Thr Ile Phe Thr Asn Met Glu Ile Cys Ser Leu Thr~Ala Arg Glu Phe Pro Phe Glu Lys Val Glu Ile Lys Asp Arg Cys Met Arg Phe Ala Trp Glu Pro Asn Ser Asp Arg Phe Val Ile Ile Ser Arg Ser Glu Asn Val Asn Asp Asn Pro Ala Ile Ala Lys Asn Val Val Ser Phe Tyr Ala Pro Glu Lys Lys Val Asp Lys Lys Gly Val Ile Ile Asp Lys Glu Leu Ser Ile Phe Lys Lys Trp Lys Leu Val Arg Ala Ile Asp Gly Lys Phe Ser Asn Glu Ile Thr Trp Ser Pro Ala Gly Arg Phe Val Cys Val Ala Ala IIe Gly Lys Ile Gly Ser Arg Asn Glu Asn Ile Asp Phe Tyr Asp Met Asp Tyr Pro Asn Thr Glu Lys Ile Ile Asn Thr Ala Thr Asp Val Asn Ala Thr Leu Arg Asp Val Ala His Ile Asn Tyr Ala Ser Ala Thr Asp Tyr Glu Trp Asp Pro Ser Gly Arg Tyr Leu Ala Phe Trp Ser Ser Ala Trp.Lys His Lys Ala Glu Asn Gly Tyr Lys Val Phe Asn Leu Ala Gly Ala Ile Val Arg Glu Glu Leu Ile Thr Asp Phe Asn Asn Phe Phe Trp Arg Pro Arg Pro Asp Ser Leu Leu Ser Asn Ser Glu Lys Lys Lys Val Arg Lys Asn Leu Lys GIu Trp Ser AIa His Phe Glu Glu GIn Asp Ala Met Glu Ala Asp Ser Ala Thr Arg Glu Leu Ile Leu Lys Arg Arg Asn Trp Leu Asp Glu Trp Ser Lys Tyr Arg Glu Ala Cys Lys Gln Thr Leu Ser Glu Ser Gly Leu Ser Ile Cys Asp Cys Val Glu Leu Ser Thr Lys Asp Glu Asp Cys Glu Leu Val Glu Glu Ile Arg 705 710 715 ?20 Glu Thr VaI VaI GIu GIu Ser Thr GIu Glu Val Pro Phe Phe Glu Glu <210> 67 <211> 1136 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 168 <400> 67 gatcggaggg gtgaagtgctcgggttggctttcaggagaaacacggaccaactgtatgcg60 gcctgtgccg attataaaatacgtacgttcgcaattaaccaattttcgcagcctggaggt120 tctatatggt caccaagatatcwgtcgcagatatttcggccctgaatatggagcgctgcg180 ttacggtcgg gtccagggataggacctgtatgctgtggaagattgcagacgaaacacgct240 tgaccttcag aggcggtgacgatcctgaaaagctgctcagaagatggcagaaggcgaaca300 gtgaacagga aaacaaggatgcagacgacaatactccagcggagccgcccgtcttttacg360 gcgagggaag catagactgcatcaccatgctcgacgattcacacttcatctcgggctcgg420 acaatggaaa catatcgctttggtccctatccaagaaaaagccgctcttcgttcagcgag480 ttgcccatgg agtgcagccacagccagataataccaagatcagcggcgagcgggacccag540 ctgtgcgtac gcagcaggcccaaggcaaccgtctcgcgcagccgtactggataactgccc600 tgcacgccgt cccctacagcaatgtattcttcagtgggtcctggaacggaaccatgaagg660 tctggaagct gcacgaaaacatgcgctctttcgagccactcggcgaactggatggctgca?20 agggcctggt gacgaagatccagacggtggaggccggtaagagcggcagggaaacacttc780 gcgtcctcgc cagtgtcagcaaggagcaccggcttggtcggtggatgggcaagcttcccg840 gcgccagaaa cggactgttttccgcagtcatcgaccaggctggcttctgagcaccagtcg900 cctgaagaac actcgacacactgcagcttgcacacacaccgttccaacagtctctctgca960 agcgagctgc tatcggcattatgtttgtatggatacatagacagacatagaagcaataaa1020 aaaaggcgca ccatggcgctacgaactaatcgcaaaagggaagcctgctgggctccacat1080 gtctagagaa cttcggattttgcattcgctcgcacctttcgcgctcaacatagatc 1136 <210> 68 <211> 34 <212> PRT
<213> Ashbya gossypii ° 108 <220>
<221> misc_feature <223> Oligo 168 <400> 68 Arg Gly Glu Val Leu Gly Leu Ala Phe Arg Arg Asn Thr Asp Gln Leu Tyr Ala Ala Cys Ala Asp Tyr Lys Ile Arg Thr Phe Ala Ile Asn Gln Phe Ser <210> 69 <211> 239 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 168 <400> 69 _ Sex VaI Ala Asp IIe Ser Ala Leu Asn Met Glu Arg Cys Val Thr Val Gly Ser Arg Asp Arg Thr Cys Met Leu Trp Lys Ile Ala Asp Glu Thr Arg Leu Thr Phe Arg Gly Gly Asp Asp Pro Glu Lys Leu Leu Arg Arg Trp Gln Lys Ala Asn Ser Glu Gln Glu Asn Lys Asp Ala Asp Asp Asn Thr Pro Ala Glu Pro Pro Val Phe Tyr Gly Glu Gly Ser Ile Asp Cys - Ile Thr Met Leu Asp Asp Ser His Phe Ile Ser Gly Ser Asp Asn Gly Asn Ile Ser Leu Trp Ser Leu Ser Lys Lys Lys Pro Leu Phe Val Gln Arg Val Ala His Gly Val Gln Pro Gln Pro Asp Asn Thr Lys Ile Ser Gly Glu Arg Asp Pro Ala Val Arg Thr Gln Gln Ala Gln Gly Asn Arg Leu Ala Gln Pro Tyr Trp Ile Thr Ala Leu His Ala Val Pro Tyr Ser Asn Val Phe Phe Ser Gly Ser Trp Asn Gly Thr Met Lys Val Trp Lys Leu His Glu Asn Met Arg Ser Phe Glu Pro Leu Gly Glu Leu Asp Gly Cys Lys Gly Leu Val Thr Lys Ile Gln Thr Val Glu Ala Gly Lys Ser Gly Arg Glu Thr Leu Arg Val Leu Ala Ser Val Ser Lys Glu His Arg Leu Gly Arg Trp Met Gly Lys Leu Pro Gly Ala Arg Asn Gly Leu <210> 70 <211> 2681 <212> DNA
<213> Ashbya gossypii <220>
<22I> CDS
<222> (660)..(2432) <223>

° 110 <220>
c221> misc_feature <223> Oligo 168 <400> 70 acagccagaagacattcatg tctggccact cggcctgaactatgacatgttaaattacat60 tctaatcaaaggcaagaatc tgtggcccgg cttccccttgccgctgccttcagaaatgga.120 aatcaggcttccacttctcg ataaaacgca ggtgctgaaaaacgacacatctcccgacga180 agaagtggtgatccctcccg cactagcagc agaagaggaattcctccgctctcaggtcct240 tgcaggactccttgcagata cactaaagta tgatggagagttttttgggaatgagaatga300 gatactggcgaacttgaatg gggttcgtga caaatcgttgctacgcctctttgcctccgc360 ttgttcagaccacaacaccg agaaggcgct atcactggtgaaggaattgaagcaagataa420 agcattgaatgccgctcaaa aaatagcaga acgcgctgaattattaagactggtaagcag480 catcaacgacatcagaaact ctcgtttcga gtcagaattgaacaacttatagcactgaac540 caacactgtaactagtcctg tcgcttagtt aatatagttttttttgaaggttcgcggaat600 cgtttctttttatatgaaaa ttttgaaggt cctttggaaggcgatgagaagaaacgccg 659 atg agg get tta tct cca ctg gtt aac tct ata gca 707 aag agt agg cat Met Arg Ala Leu Ser Pro Leu Val Asn Ser Ile Ala Lys Ser Arg His cgc acc gca cgg ggt tcg gat agc cgc aag act agg 755 atg gcg tct aga Arg Thr Ala Arg Gly Ser Asp Ser Arg Lys Thr Arg Met Ala Ser Arg cag aag acg gaa aag aat aat gtt gag gaa tcg ggt 803 act gtg gac att Gln Lys Thr Glu Lys Asn Asn Val Glu GIu Ser Gly Thr Val Asp Ile gtg tca aac gag gaa gga tca tcg gaa caa tta gag 851 tct tca gat gaa Val Ser Asn Glu Glu Gly Ser Ser Glu Gln Leu Glu Ser Ser Asp Glu gat gta gac get gag ttg gat tct gaa ttt aat gag 899 get gat gag gcg Asp Val Asp Ala Glu Leu Asp Ser Glu Phe Asn Glu Ala Asp Glu Ala aac ccc gac aag cgg agg cga ctc caa tac gaa aat 947 get gcc aaa cta Asn Pro Asp Lys Arg Arg Arg Leu Gln Tyr Glu Asn Ala Ala Lys Leu att aag gag get aat gaa att atg gat tct gca cat 995 gaa cat ggc gag Ile Lys Glu Ala Asn Glu Ile Met Asp Ser Ala His Glu His Gly Glu gca gac gcc caa ggt caa ggt ttt gca tac aac ttt 1043 gat get gat aat Ala Asp AIa GIn GIy GIn Gly Phe Ala Tyr Asn Phe Asp Ala Asp Asn ° 111 ., gac gcgcgcgacctg gatcgtgac attatctca gcaagattg caa 1091 aag Asp AlaArgAspLeu AspArgAsp IleIleSer AlaArgLeu LysGIn gac gttgetgagcaa aggggatct gtgtaccgc tggategcc gataag 1139 Asp ValA1aGluGln ArgGlySer ValTyrArg TrpIleAla AspLys ctg ctactatctgag gccaagaag tccttcacc agggtcggg gagaag 1187 Leu LeuLeuSerGlu AlaLysLys SerPheThr ArgValGly GluLys aac ctgactgcgctc agctgctat cagcaagca atgaataaa ttttca 1235 Asn LeuThrAlaLeu SerCysTyr GlnGlnAla MetAsnLys PheSer cat agggaaatccaa agcaaaagc aagggacta atgtttgcc tatact 1283 His ArgGluIleGln SerLysSer LysGlyLeu MetPheAla TyrThr gtc agtaaggacatg caactgacg aaatacgat atcaccgac ttcaat 1331 Val SerLysAspMet GlnLeuThr LysTyrAsp IleThrAsp PheAsn get agaccgacgaag gtaaagtac actaaggga gggcgcaaa tacatc 1379 AIa ArgProThrLys ValLysTyr ThrLysGly GlyArgLys TyrIle cca gagggtaaccag ggctttcag aacacgacg gagggacac tatgat 1427 Pro GluGlyAsnGln GlyPheGln AsnThrThr GluGlyHis TyrAsp gag attctgacggtt gcagettct ccagatggt aagtaegtt gtcacg 1475 Glu IleLeuThrVal AlaAlaSer ProAspGly LysTyrVal ValThr gga gggagagacaaa aagcttatc gtgtggagc actgagtcg ttggca 1523 ' Gly GlyAr5AspLys LysLeuIle ValTrpSer ThrGluSer LeuAla cca gttaaagttata ccaaccaaa gatcggagg ggtgaagtg ctcggg 1571 Pro ValLysValIle ProThrLys AspArgArg GlyGluVal LeuGly ttg getttcaggaga aacacggac caactgtat gcggcctgt gccgat 1619 Leu AlaPheArgArg AsnThrAsp GlnLeuTyr AlaA1aCys AlaAsp tat aaaatacgtacg ttcgcaatt aaccaattt tcgcagctg gaggtt 1667 Tyr LysIleArgThr PheAIaIIe AsnGlnPhe SerGlnLeu GluVal cta tatggtcaccaa gatatcgtc gcagatatt tcggccctg aatatg 1715 Leu TyrGlyHisGln AspIleVaI AlaAspIle SerAlaLeu AsnMet gag cgctgcgttacg gtcgggtcc agggatagg acctgtatg ctgtgg 1763 Glu ArgCysValThr ValGlySer ArgAspArg ThrCysMet LeuTrp aag attgcagacgaa acacgcttg accttcaga ggcggtgac gat 1811 cct Lys IleAlaAspGlu ThrArgLeu ThrPheArg GlyGlyAsp AspPro gaa aag ctg ctc aga aga tgg cag aag gcg aac agt gaa cag gaa aac 1859 Glu Lys Leu Leu Arg Arg Trp Gln Lys Ala Asn Ser Glu Gln Glu Asn aag gat gca gac gac aat act cca gcg gag ccg ccc gtc ttt tac ggc 1907 Lys Asp Ala Asp Asp Asn Thr Pro Ala Glu Pro Pro Val Phe Tyr Gly gag gga agc ata gac tgc atc acc atg ctc gac gat tca cac ttc atc 1955 Glu Gly Ser Ile Asp Cys Ile Thr Met Leu Asp Asp Ser His Phe Ile tcg ggc tcg gac aat gga aac ata tcg ctt tgg tcc cta tcc aag aaa 2003 Ser Gly Ser Asp Asn Gly Asn Ile Ser Leu Trp Ser Leu Ser Lys Lys aagccgctc ttcgttcag cgagttgcc catggagtg cagccacagcca 2051 LysProLeu PheValGln ArgValAla HisGlyVal GlnProGlnPro gataatacc aagatcagc ggcgagcgg gacccaget gtgcgtacgcag 2099 AspAsnThr LysIleSer~Gly GluArg AspProAla ValArgThrGln caggcccaa ggcaaccgt ctcgcgcag ccgtactgg ataactgccctg 2147 GlnAlaGln GlyAsnArg LeuAlaGln ProTyrTrp IleThrAlaLeu cacgccgtc ccctacagc aatgtattc ttcagtggg tcctggaacgga 2195 HisAlaVal ProTyrSer AsnValPhe PheSerGly SerTrpAsnGly acc atg aag gtc tgg aag ctg cac gaa aac atg cgc tct ttc gag cca 2243 Thr Met Lys Val Trp Lys Leu His Glu Asn Met Arg Ser Phe Glu Pro ctc ggc gaa ctg gat ggc tgc aag ggc ctg gtg acg aag atc cag acg 2291 Leu Gly Glu Leu Asp Gly Cys Lys Gly Leu Val Thr Lys Ile Gln Thr gtg gag gcc ggt aag agc ggc agg gaa aca ctt cgc gtc ctc gcc agt 2339 Val Glu Ala Gly Lys Ser Gly Arg Glu Thr Leu Arg Val Leu Ala Ser gtc agc aag gag cac cgg ctt ggt cgg tgg atg ggc aag ctt ccc ggc 2387 Val Ser Lys Glu His Arg Leu Gly Arg Trp Met Gly Lys Leu Pro Gly gcc aga aac gga ctg ttt tcc gca gtc atc gac cag get ggc ttc 2432 Ala Arg Asn Gly Leu Phe Ser Ala Val Ile Asp Gln Ala Gly Phe tgagcaccagtcgcctgaagaacactcgacacactgcagcttgcacacacaccgttccaa2492 cagtctctctgcaagcgagctgctatcggcattatgtttgtatggatacatagacagaca2552 tagaagcaataaaaaaaggcgcaccatggcgctacgaactaatcgcaaaagggaagcctg2612 ctgggctccacatgtctagagaacttcggattttgcattcgctcgcacctttcgcgctca2672 acatagatc 2681 <210> 71 <211> 591 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 168 <400> 71 Met Arg Lys Ala Leu Ser Pro Leu Val Ser Arg Asn Ser His Ile Ala Arg Thr Met Ala Arg Gly Ser Asp Ser Ala Ser Arg Lys Arg Thr Arg Gln Lys Thr Thr Glu Lys Asn Asn Val Val Asp Glu Glu Ile Ser Gly Val Ser Ser Asn Glu Glu Gly Ser Ser Ser Asp Glu Gln Glu Leu Glu Asp Val Ala Asp Ala Glu Leu Asp Ser Asp Glu Glu Phe Ala Asn Glu Asn Pro Ala Asp Lys Arg Arg Arg Leu Ala Lys Gln Tyr Leu Glu Asn Ile Lys Glu Glu Ala Asn GIu Ile Met His Gly Asp Ser GIu Ala His Ala Asp Asp Ala Gln Gly Gln Gly Phe Ala Asp Ala Tyr Asn Asn Phe Asp Ala Arg Asp Leu Asp Arg Asp Ile Ile Ser Ala Arg Leu Lys Gln Asp Val Ala Glu Gln Arg Gly Ser Val Tyr Arg Trp Ile Ala Asp Lys Leu Leu Leu Ser Glu Ala Lys Lys Ser Phe Thr Arg Val Gly Glu Lys '' 114 Asn Leu Thr Ala Leu Ser Cys Tyr Gln Gln Ala Met Asn Lys Phe Ser His Arg Glu Ile Gln Ser Lys Ser Lys Gly Leu Met Phe Ala Tyr Thr Val Ser Lys Asp Met Gln Leu Thr Lys Tyr Asp Ile Thr Asp Phe Asn Ala Arg Pro Thr Lys Val Lys Tyr Thr Lys Gly Gly Arg Lys Tyr Ile Pro Glu Gly Asn Gln Gly Phe Gln Asn Thr Thr Glu Gly His Tyr Asp Glu Ile Leu Thr Val Ala Ala Ser Pro Asp Gly Lys Tyr Val Val Thr Gly Gly Arg Asp Lys Lys Leu Ile Val Trp Ser Thr Glu Ser Leu Ala Pro Val Lys Val Ile Pro Thr Lys Asp Arg Arg Gly Glu Val Leu Gly Leu Ala Phe Arg Arg Asn Thr Asp Gln Leu Tyr Ala Ala Cys Ala Asp Tyr Lys Ile Arg Thr Phe Ala Ile Asn Gln Phe Ser Gln Leu Glu Val Leu Tyr Gly His Gln Asp Ile Val Ala Asp Ile Ser Ala Leu Asn Met Glu Arg Cys Val Thr Val Gly Ser Arg Asp Arg Thr Cys Met Leu Trp Lys Ile Ala Asp Glu Thr Arg Leu Thr Phe Arg Gly Gly Asp Asp Pro Glu Lys Leu Leu Arg Arg Trp Gln Lys Ala Asn Ser Glu Gln Glu Asn Lys Asp Ala Asp Asp Asn Thr Pro Ala Glu Pro Pro Val Phe Tyr Gly Glu Gly Ser Ile Asp Cys Ile Thr Met Leu Asp Asp Ser His Phe Ile Ser Gly Ser Asp Asn Gly Asn Ile Ser Leu Trp Ser Leu Ser Lys Lys Lys Pro Leu Phe VaI GIn Arg Vai Ala His Gly Val Gln Pro Gln Pro Asp Asn Thr Lys Ile Ser Gly Glu Arg Asp Pro Ala Val Arg Thr Gln Gln Ala Gln Gly Asn Arg Leu Ala Gln Pro Tyr Trp Ile Thr Ala Leu His Ala VaI Pro Tyr Ser Asn Val Phe Phe Ser Gly Ser Trp Asn Gly Thr Met Lys Val Trp Lys Leu His Glu Asn Met Arg Ser Phe Glu Pro Leu Gly Glu Leu Asp Gly Cys Lys Gly Leu Val Thr Lys Tle Gln Thr Val Glu Ala Gly Lys Ser Gly Arg Glu Thr Leu Arg Val Leu Ala Ser Val Ser Lys Glu His Arg Leu Gly Arg Trp Met Gly Lys Leu Pro Gly Ala Arg Asn Gly Leu Phe Ser Ala Val Ile Asp Gln Ala Gly Phe <210> 72 <211> 510 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 160 <400> 72 gatctgcgtg ggcctcgctg ggcgggcggc gggcttcaac aacatgtggg ccggggtaga 60 gagcaaagtcggttagaggatataaacgtaggtaggggcagcagcctcargcaggcctcc 120 gaggccttggatctcttggctagccttggcctgggccttggggcccatgacaccagccac 180 cccagtgctttctggattcgtcgtacttctcgatgaagttggcgttgacggcggagacga 240 gcttggcaagggcagcctcgtcctcggcgcggacctcggtgagggcggcgacggcggagg 300 tcttctggttgaccagggtgcctaggcgggccttgcccttgacgatggcgtatgggacgc 360 ccatcttcttgcacagcgcaggcaggaagatgacaagctcgatggggtcgacgtcgttgg 420 cgatgagcacgagcttggccttcttgttctcgacgagggagacgacgtggttcaagccga 480 acttgacggcgtatggcttaagcgaagcct 510 <210> 73 <211> 111 <212> PRT
<213> Ashbya gossypii <220>
<221> misc feature <223> Oligo 160 <400> 73 Ala Ser Leu Lys Pro Tyr Ala Val Lys Phe Gly Leu Asn His Val Val Ser Leu Val Glu Asn Lys Lys Ala Lys Leu Val Leu Ile Ala Asn Asp Val Asp Pro Ile Glu Leu Val Ile Phe Leu Pro Ala Leu Cys Lys Lys Met Gly Val Pro Tyr Ala Ile Val Lys Gly Lys Ala Arg Leu Gly Thr Leu Val Asn Gln Lys Thr Ser Ala Val Ala Ala Leu Thr Glu Val Arg Ala Glu Asp Glu Ala Ala Leu Ala Lys Leu Val Ser Ala Val Asn Ala Asn Phe Ile Glu Lys Tyr Asp Glu Ser Arg Lys His Trp Gly G1y ," 100 105 110 <210> 74 <211> 1437 <212> DNA
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 18 <400>

gatcagtgaattttcatcattatggccaaaactgcgtctggggctttaatcgaagtcatc60 ttcatcataatcatcaccataagcccgatattgcaagtccctgtcaacgccaccatagct120 gcgctcatacagcagatcctcagcgccgagatcaagccttgctcatctgagtgagatagt180 tgaattcagattcctcatcattgttgcgcctagtttcaattttccgggcctgctcgcgac240 tctgctcataattaggcacgcgcctacgagtctgacccccattgccaccaaagtcgcgcc300 tacgctgacccgagccgtactcgtcgcggccactgcgtctgcgttcttgccccgatccac360 caaagtcgcgcctacgctgaccccagccgtactcgtcgcggccactgcgtctgcgttctt420 gccccgatccaccaaagtcgtgctgacgttcttgcccctaactgggattgccaccatcat480 aaggctttggctctgcaccctctatttcctcttgcaaagccggctccaaagcaaggatag540 agcttgcacctgttaacaaacaaataatactggataattttatcttgctgatggttatta600 ggctattcaatgtagaaacctattccacaaataacatagagtgcttttatatgccacatt660 tcatatccttccgcaagcttgatggcaaaatgctgagtcataataaggatagagtaaagt720 ggcccatctgatacactcttaatgacttcgcatttttagtaactttgcccaggcatatca780 tatattctaccccttcataaaagttatgtaacgaataatttgaaggagcctattatttcc840 tggaagagtataaccgtctttttattccaagtatccaaaacatcactataggaacatata900 ctaaaaagtgggaacgttccgatattcacataactactgttgttttagatcaaaaaattg960 tctattttattggcgttggatggatcctttgtatcacgaaatacgcaaatgttggaattt1020 ttaactttggaatacctattgaagcaacatatgtcattttacaaggagcatcactttaca1080 ggcaccgagaaagaaagaaattgacaaaaaagaagggataagtgaaggcagttgcacagg1140 caccgaccaagacagtgatttacaatagttacaggtcaataataagaaagacaactatgt1200 ggcattatgcagtacgctctaagggcgcagttccgatgaCtgtttcacccagctacacca1260 gtagctcgca ctgccattta tttacagtgc ttgtgtcaca gacccaaaat ggataagtgt 1320 gagagcgact gtcgcttctg tatagctcaa cgccaatgtg tgtctgcact gggacaacac 1380 cggatttagt acattgacac caacyttcgc cgcctgctga cagatgcagc wccgatc 1437 <210>75 <211>1437 <212>DNA

<213>Ashbya gossypii <220>
<221> CDS
<222> (958)..(1272) <223>
<220>
<221> misc_feature <223> Oligo 18 <400>

gatcggwgctgcatctgtcagcaggcggcgaargttggtgtcaatgtactaaatccggtg60 ttgtcccagtgcagacacacattggcgttgagctatacagaagcgacagtcgctctcaca120 cttatccattttgggtctgtgacacaagcactgtaaataaatggcagtgcgagctactgg180 tgtagctgggtgaaacaatcatcggaactgcgcccttagagcgtactgcataatgccaca240 tagttgtctttcttattattgacctgtaactattgtaaatcactgtcttggtcggtgcct300 gtgcaactgccttcacttatcccttcttttttgtcaatttctttctttctcggtgcctgt360 aaagtgatgctccttgtaaaatgacatatgttgcttcaataggtattccaaagttaaaaa420 ttccaacatttgcgtatttcgtgatacaaaggatccatccaacgccaataaaatagacaa480 ttttttgatctaaaacaacagtagttatgtgaatatcggaacgttcccactttttagtat540 atgttcctatagtgatgttttggatacttggaataaaaagacggttatactcttccagga600 aataataggctccttcaaattattcgttacataacttttatgaaggggtagaatatatga660 tatgcctgggcaaagttactaaaaatgcgaagtcattaagagtgtatcagatgggccact720 ' 119 ttactctatc cttattatgactcagcattttgccatcaagcttgcggaaggatatgaaat780 gtggcatata aaagcactctatgttatttgtggaataggtttctacattgaatagcctaa840 taaccatcag caagataaaattatccagtattatttgtttgttaacaggtgcaagctcta900 tccttgcttt ggagccggctttgcaagaggaaatagagggtgcagagccaaagcctt 95?

atg atg gca atc ggc aag gtc agc act ttg 1005 gtg cca gtt aac acg agg Met Met Ala Ile Gly Lys Val Ser Thr Leu Val Pro Val Asn Thr Arg gtg gat cgg ggc aag aac gca gac gca gtg gcc gcg acg agt acg get 1053 Val Asp Arg Gly Lys Asn Ala Asp Ala Val Ala Ala Thr Ser Thr Ala ggg gtc agc gta ggc gcg act ttg gtg gat cgg ggc aag aac gca gac 1101 Gly Val Ser Val G1y Ala Thr Leu Val Asp Arg Gly Lys Asn Ala Asp gca gtg gcc gcg acg agt acg get cgg gtc agc gta ggc gcg act ttg 1149 Ala Val Ala Ala Thr Ser Thr Ala Arg Val Ser Val Gly Ala Thr Leu gtg gca atg ggg gtc aga ctc gta ggc gcg tgc cta att atg agc aga 1197 Val Ala Met Gly Val Arg Leu Val Gly Ala Cys Leu Ile Met Ser Arg gtc gcg agc agg ccc gga aaa ttg aaa cta ggc gca aca atg atg agg 1245 Val Ala Ser Arg Pro Gly Lys Leu Lys Leu Gly Ala Thr Met Met Arg aat ctg aat tca act atc tca ctc aga tgagcaaggc ttgatctcgg 1292 Asn Leu Asn Ser Thr Ile Ser Leu Arg cgctgaggatctgctgtatgagcgcagcta tggtggcgtt gacagggact tgcaatatcg1352 ggcttatggtgatgattatgatgaagatga cttcgattaa agccccagac gcagttttgg1412 ccataatgatgaaaattcactgatc 1437 <210> 76 <21I> 105 <212> PRT
<213> Ashbya gossypii <220>
<221> mist feature <223> Oligo 18 <400> 76 Met Met Val Ala Ile Pro Val Arg Gly Lys Asn Val Ser Thr Thr Leu Val Asp Arg Gly Lys Asn Ala Asp Ala Val Ala Ala Thr Ser Thr Ala Gly Val Ser Val Gly Ala Thr Leu Val Asp Arg Gly Lys Asn Ala Asp Ala Val Ala Ala Thr Ser Thr Ala Arg Val Ser Val Gly Ala Thr Leu Val Ala Met Gly Val Arg Leu Val Gly Ala Cys Leu Ile Met Ser Arg Val Ala Ser Arg Pro Gly Lys Leu Lys Leu Gly Ala Thr Met Met Arg Asn Leu Asn Ser Thr Ile Ser Leu Arg <210> 77 <211> 2602 <212> DNA
<213> Ashbya gossypii <220>
<221> CDS
<222> (1531)..(1845?
<223>
<220>
<221> misc_feature <223> Oligo 18 <400> 77 tcagcggtgt ggtgtatggg tctctcagcg gtgtggtgta tgggtctctc agcggtgtgg 60 tgtatgggtc tctcagcggt gtggtgtatg gtctctcagc ggtgtggtgt atgggtctct 120 cagcggtgtg gtgtatgggt ctctcagcgg tgtggtgtat gggtctctca gcggtgtggt 180 gtatgggtct ctcagcggtg tggtgtatgg gtctctcagc ggtgtggtgt atcagagggt 240 ' 121 tttaaacctaaatctgacgccttaaccactcggccaaactctcttatatgcttttatatg300 aaaggcgtgcaatacgtacgagcaggttggccacgtgaactggctgcccagggtcagagc360 tgtatccgcgagtatcccaaaacccgtacagtacgaaatacccacaccagtttcgcggta420 atgtcagttagcactcgccacggtgatgactgaactcgcggctggcacgatcaacaacgt480 agggcccgagccttcagcagaggaggatcgtattattcatataaaatgctcacacaagca540 aacatggaggccaggaagggcaccgtggtcggtgatcggtgctgcatctgtcagcaggcgb00 gcgaaggttggtgtcaatgtactaaatccggtgttgtcccagtgcagacacacattggcg660 ttgagctatacagaagcgacagtcgctctcacacttatccattttgggtctgtgacacaa720 gcactgtaaataaatggcagtgcgagctactggtgtagctgggtgaaacaatcatcggaa780 ctgcgcccttagagcgtactgcataatgccacatagttgtctttcttattattgacctgt840 aactattgtaaatcactgtcttggtcggtgcctgtgcaactgccttcacttatcccttct900 tttttgtcaatttctttctttctcggtgcctgtaaagtgatgctccttgtaaaatgacat960 atgttgcttcaataggtattccaaagttaaaaattccaacatttgcgtatttcgtgatac1020 aaaggatccatccaacgccaataaaatagacaattttttgatctaaaacaacagtagtta1080 tgtgaatatcggaacgttcccactttttagtatatgttcctatagtgatgttttggatac1140 ttggaataaaaagacggttatactcttccaggaaataataggctccttcaaattattcgt1200 tacataacttttatgaaggggtagaatatatgatatgcctgggcaaagttactaaaaatg1260 cgaagtcattaagagtgtatcagatgggccactttactctatccttattatgactcagca1320 ttttgccatcaagcttgcggaaggatatgaaatgtggcatataaaagcactctatgttat1380 ttgtggaataggtttctacattgaatagcctaataaccatcagcaagataaaattatcca1440 gtattatttgtttgttaacaggtgcaagctctatccttgctttggagccggctttgcaag1500 aggaaatagagggtgcagagccaaagccttatg atg a gtt 1554 gtg gca agg atc cc Met Met o Val Val Ala Arg Ile Pr ggc aag gtc agc g act ggc aag gca gac 1602 aac ac ttg gtg aac gat cgg GIy Lys Val Ser r Thr Gly Lys Ala Asp Asn Th Leu Val Asn Asp Arg gca gtg gcg acg t acg gta ggc act ttg 1650 gcc ag get ggg gcg gtc agc Ala Val Ala Thr r Thr Val Gly Thr Leu Ala Se Ala Gly Ala Val Ser gtg gat ggc aag c gca gcg acg acg get 1698 cgg aa gac gca agt gtg gcc Val Asp GIy Lys n Ala Ala Thr Thr Ala Arg As Asp Ala Ser Val Ala cgg gtc gta ggc g act ggg gtc ctc gta 1746 agc gc ttg gtg aga gca atg Arg Val Val Gly a Thr Gly Val Leu Va1 Sex Al Leu Val Arg Ala Met ggc gcg tgc cta att atg agc aga gtc gcg agc agg ccc gga aaa ttg 1794 Gly Ala Cys Leu Ile Met Ser Arg Val Ala Ser Arg Pro Gly Lys Leu aaa cta ggc gca aca atg atg agg aat ctg aat tca act atc tca ctc 1842 Lys Leu Gly Ala Thr Met blet Arg Asn Leu Asn Ser Thr Ile Ser Leu aga tgagcaaggc ttgatctcgg cgctgaggat ctgctgtatg agcgcagcta 1895 Arg tggtggcgttgacagggacttgcaatatcgggcttatggtgatgattatgatgaagatga1955 cttcgattaaagccccagacgcagttttggccataatgatgaaaattcactgatcagact2015 ataaagttgctttggaaaataagtcatattggcgatggactcgtggcaagacacttagat2075 acttgaatttcttcagtattaaatgacatgacaactatccacagtgaattctgaaaaata2135 aacataaaaacaataatcttatgacccattttcatgtaaactgaatatagacgatagcaa2195 tacattttctctatattttgtactctggaagcttctgcgagtgactaccatttgatggcc2255 acgtttacctccttcgtcagcaggtatccaggtacttaaattaatcacttcacagcacta2315 aatgtggcttttattcggttttattccaagaatacggatctctgagacacttgagccccc2375 tagtttagttacaacagtagcttccgaaagctacgaataatagttatagattttctgctc2435 tcacgtgattcgcttacataaataacccgataaaaccatgagaaatatgtccatgtagct2495 gtgtgacgtatatatgggataaggctgggtaggcctctagccatctatttgcccgctgtc2555 ttttggtacaatagcccaacgaaaatccgagcgtacctctacgtgtg 2602 <210> 78 <211> 105 <212> PRT
<213> Ashbya gossypii <220>
<221> misc_feature <223> Oligo 18 <400> 78 Met Met Val Ala Ile Pro Val Arg Gly Lys Asn Val Ser Thr Thr Leu Val Asp Arg Gly Lys Asn Ala Asp Ala Val AIa Ala Thr Ser Thr Ala Gly Val Ser Val Gly Ala Thr Leu Val Asp Arg Gly Lys Asn Ala Asp Ala Val Ala Ala Thr Ser Thr Ala Arg Val Ser Val Gly AIa Thr Leu Val Ala Met Gly VaI Arg Leu Val Gly Ala Cys Leu Ile Met Ser Arg Val Ala Ser Arg Pro Gly Lys Leu Lys Leu Gly Ala Thr Met Met Arg Asn Leu Asn Ser Thr Ile Ser Leu Arg

Claims (24)

We claim:

1. A polynucleotide which can be isolated from Ashbya gossypii and codes for a protein which is associated with transcription, RNA processing and/or translation in A.gossypii.

2. A polynucleotide as claimed in claim 1 which is associated with transcription, RNA processing and/or translation in A.gossypii and has a structural and/or functional property indicated in table 1.

3. A polynucleotide as claimed in claim 1 or 2 comprising a nucleic acid sequence as shown in SEQ ID NO: 1, 6, 12, 17, 21, 26, 31, 38, 42, 48, 53, 58, 63, 67, or 74 which can be isolated preferably from Ashbya gossypii; the polynucleotide complementary thereto; and the sequences derived from these polynucleotides through the degeneracy of the genetic code.

4. A polynucleotide as claimed in claim 3 which comprises a nucleic acid sequence as shown in SEQ ID NO: 4, 10, 14, 19, 24, 29, 36, 40, 46, 51, 56, 60, 65, 70, or 77 or a fragment thereof.

5. An oligonucleotide which hybridizes with a polynucleotide as claimed in any of the preceding claims, in particular under stringent conditions.

6. A polynucleotide which hybridizes with an oligonucleotide as claimed in claim 5, in particular under stringent conditions, and codes for a gene product from microorganisms of the genus Ashbya or a functional equivalent of this gene product.

7. A polypeptide which is encoded by a polynucleotide which comprises a nucleic acid sequence as claimed in any of claims 1 or 4 or a fragment thereof, or by a polynucleotide as claimed in claim 6; or which has an amino acid sequence which comprises at least 10 consecutive amino acid residues as shown in SEQ ID NO: 2, 3, 5, 7, 8, 9, 11, 13, 15, 16, 18, 20, 22, 23, 25, 27, 28, 30, 32, 33, 34, 35, 37, 39, 41, 43, 44, 45, 47, 49, 50, 52, 54, 55, 57, 59, 61, 62, 64, 66, 68, 69, 71, 73, 76, or SEQ ID NO: 78; and functional equivalents thereof, especially those which have activity as per the definition in claim 2.

8. An expression cassette comprising a nucleic acid sequence as claimed in any of claims 1 to 6 operatively linked to at least one regulatory nucleic acid sequence.

9. A recombinant vector comprising at least one expression cassette as claimed in claim 8.

10. A prokaryotic or eukaryotic host transformed with at least one vector as claimed in claim 9.

11. A prokaryotic or eukaryotic host in which the functional expression of at least one gene which codes for a polypeptide as claimed in claim 7 is modulated; or in which a biological activity of a polypeptide as claimed in claim 7 is reduced or increased.

12. A host as claimed in claim 10 or 11 from the genus Ashbya.

13. The use of an expression cassette as claimed in claim 8, of a vector as claimed in claim 9 ar of a host as claimed in any of claims 10 to 12 for the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof.

14. The use of an expression cassette as claimed in claim 8, of a vector as claimed in claim 9 or of a host as claimed in any of claims 10 to 12 for the recombinant production of a polypeptide as claimed in claim 7.

15. A method for detecting an effector target for modulating the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof, where a microorganism capable of the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof is treated with an effector which interacts, in particular binds, with a target selected from a polypeptide as claimed in claim 7 or a nucleic acid sequence coding therefor, the effect of the effector on the amount of the microbiologically produced vitamin B2 and/or of the precursor and/or of a derivative thereof is validated; and the target is isolated where appropriate.

16. A method for modulating the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof, where a microorganism capable of the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof is treated with an effector which interacts with a target selected from a polypeptide as claimed in claim 7 or a nucleic acid sequence coding therefor.

17. An effector for a target selected from a polypeptide as claimed in claim 7 or a nucleic acid sequence coding therefor, where the effector is selected from:
a) antibodies or antigen-binding fragments thereof;
b) polypeptide ligands which are different from a) and which interact with the polypeptide as claimed in claim 7;
c) low molecular weight effectors which modulate the biological activity of a polypeptide as claimed in claim 7;
d) antisense nucleic acid sequences.

18. A method for the microbiological production of vitamin B2 and/or precursors and/or derivatives thereof, where a host as claimed in any of claims 10 to 12 is cultured under conditions favoring the production of vitamin B2 and/or precursors and/or derivatives thereof, and the desired product(s) is(are) isolated from the culture mixture.

19. A method as claimed in claim 18, where the host is treated with an effector as claimed in claim 17 before and/or during its culturing.

20. A method as claimed in claim 18 or 19, where the host is selected from microorganisms of the genus Ashbya.

21. A method as claimed in any of claims 18 to 20, where the microorganism is a host as claimed in any of claims 10 to 12.

22. The use of a polynucleotide as claimed in any of claims 1 to 4 and 6 or of a polypeptide as claimed in claim 7 as target for modulating the production of vitamin B2 and/or precursors and/or derivatives thereof in a microorganism of the genus Ashbya.

23. The use of a polynucleotide as claimed in any of claims 1 to 4 and 6 or of a polypeptide as claimed in claim 7 as target for modulating transcription, RNA
processing and/or translation in a microorganism of the genus Ashbya during culturing for microbiological production of vitamin B2 and/or precursors and/or derivatives thereof.

24. A host as claimed in claim 13 with improved adaptability to environmental and metabolic conditions, in particular with modified transcription, RNA
processing and/or translation for an improved vitamin B2 production.