CA2456777A1 - Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders - Google Patents
Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders Download PDFInfo
- Publication number
- CA2456777A1 CA2456777A1 CA002456777A CA2456777A CA2456777A1 CA 2456777 A1 CA2456777 A1 CA 2456777A1 CA 002456777 A CA002456777 A CA 002456777A CA 2456777 A CA2456777 A CA 2456777A CA 2456777 A1 CA2456777 A1 CA 2456777A1
- Authority
- CA
- Canada
- Prior art keywords
- cis element
- nucleic acid
- binding
- seq
- acid molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Abstract
The nucleic acid upstream of the TIGR protein encoding sequence can be used to diagnose glaucoma. Polymorphisms, base substitutions, base additions located with the upstream and within TIGR exons can also be used to diagnose glaucoma. In addition, polymorphisms, base substitutions, base additions located with the upstream and within TIGR exons can also be used to prognose glaucoma.
Description
~~.F OF THF INVEN''1'IDN:
METHODS FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF
GLAUCOMA AND RELATED DISORDERS
The present invention is in the fields of diagnostics, prognosis, and treatment, and concerns methods and reagents for diagnosing and treating glaucoma and ,~.
related disorders.
"Glaucomas" are a group of debilitating eye diseases that are the leading cause of preventable blindness in the United States and other developed nations.
Priaaary Open Angle Glaucoma ("POAG'~ is the most eomrnon form of glaucoma.
The disease is characterized by the alteration of the trabecular meshwork, leading to obstruction of the normal ability of aqueous humor to leave the eye without closure of the spare (e:g., the "angle") between the iris and cornea (see, Vaughan, D.
et al., In: General Ophthalmology, Appleton & Lange, Norwalk, CT, pp. 213-230 (1992)).
A
characteristic of such obstruction in this disease is an increased intraocular pressure ("IOP"), resulting in progressive visual Ioss and blindness if not treated appropriately and in a timely fashion.
The disease is estimated to affect between 0.4% and 3.3% of all adults over 40 years old (Leske, M.C. et aL, Amer. J. Epidemiol. l I3:1843-1846 (1986);
Bengtsson, B., Br. J. OphthamoI: 73:483-487 (1989); Strong, N:P., Ophthul. Physiol. Opt. 12:3-7 (1992)).
Moreover, the prevalence of the disease rises with age to over 6% of those 75 years - 30 or older (Strong, N.P., Ophthal. Physiol. Opt. T2:3-7 (1992)).
A link between the IOP response of patients to glucocorticoids and the disease of POAG has long been suspected. While only 5% of the normal population shown a high IOP increase {16 mm Hg) to topical glucocorticoid testing, greater than ' 40-50% of patients with POAG show this response: In addition; an Open Angle glaucoma may be induced by exposure to glucocorticoids. This observation has suggested that an increased or abnormal glucocorticoid response in trabecular cells may be involved in POAG {than, G.L. et al., Exper. dye Res. 54:211-218 (1992); Yun, A.j. et al., Invest. Ophtharnol. Vis. Sci. 30:2012-2022 (1989);
Clark, A.F., Exper. Eye Res.
55:265 (1992); Klemetti, A., Acts Ophthamol. 68:29 33 {1990); Knepper, P.A.; U.S.
Patent No. 4,617,299). The ability of glucocorticoids to induce a glaucoma-Iike condition has led to efforts to identify genes or gene products that would be induced by the cells of the trabecular meshwork in response to glucocorticoids {Polansky, J.R et al., in: Glaucoma Lipdate IV, Springer-Verlag, Berlin, pp. 20-29 {1991)). Initial efforts using short-term exposure to dexamethasone revealed only changes in specific protein synthesis. Extended exposure to relatively high-levels of dexamethasone was, however, found to induce the expression of related 66 kD and 55 kD proteins that could be visualized by gel electrophoresis (Polansky, j:It et al.;
in: Glaucoma i.Ipdate IV, Springer-Verlag, Berlin, pp. 20-29 (1991)).
The induction kinetics of these proteins as well as their dose response characteristics were similar to the kinetics that were required for steroid-induced IOP eie~ration in human subjects (Polansky, J.R et al.; In: Glaucoma i,ipdate IV, Springer-Verlag, Berlin; pp. 20-29 (1991)). Problems of aggregation and apparent instability or loss of protein in the purification process were obstacles in obtaining a direct protein sequence.
Because increased IOP is a readily measurable characteristic of glaucoma, the diagnosis of the disease is largely screened for by measuring intraocular pressure {tonometry) (Strong, N.P., Ophthal. Physiol. Opt. 22:3-7 (1992);
Greve, M. et al.; Can. J.
Ophthamol. 28:201-206 (1993)). Unfortunately, because glaucomatous and normal pressure ranges overlap, such methods are of limited value unless multiple readings are obtained (Hitchings, RA:, Br. j. Ophfhamol. 7T:326 (1993); Tuck, M.W: et al.;
Ophthal. PhysioL Opt: 23:227-232 (1993); Vaughan, D. et al., In:
General Ophthamology, Appleton & Lange, Norwalk, C"T, pp. 213-230 (1992); Vernon, S.A., Eye 7:134-137 (1993)). For this reason, additional methods; such as direct examination of the optic disk and determination of the extent of a patient's visual field loss are soften conducted to improve the accuracy of diagnosis (Greve, M. et aL, Can. ]: Ophthamol.
28:201- 206 (1993)). Moreover, these techniques are of limited prognostic value.
Nguyen et al., U.S. Patent Number 5,789,169, disclosed a novel protein sequence highly induced by glucocorticoids in the endothelial lining cells of the human trabecular meshwork. Nguyen et al., U.S. Patent Number 5,789,169 also disclosed the cDNA sequence for that protein, the protein itself, molecules that bind to it, and nucleic acid molecules that encode it, and provided improved methods and reagents for diagnosing glaucoma and related disorder, as well as for diagnosing other diseases or conditions, such as cardiovascular, immunological, or other diseases or conditions that affect the expression or activity of the protein.
The present invention provides improved diagnostic agents, prognostic agents.; therapeutic agents and methods.
S.IIMMARY OF THE L~.VE~(,O~j:
An object of the invention is to provide a method for diagnosing glaucoma in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic acid molecule, said marker nucleic and molecule comprising a nueleotide sequence of a polynucleotide that specifically hxbridizes to a polxnucleotide that is linked to a TIER promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of said patient, wherein nucleic acid hybridization between said marker nucleic acid molecule, and said complementary nucleic acid molecule obtained from said patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in said patient; (B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule obtained- from said patient; and (C) detecting the presence of said polymorphism, wherein the detection of the polymorphism is cliagnostie of glaucoma.
Another object of the invention is to provide a method for , prognosing glaucoma in a patient which comprises the steps: (A) incubating under conditions ~0 permitting nucleic acid hybridization: a marker nucleic acid molecule, said marker nucleic acid molecule comprising a nucleotide sequence of a polynucleotide that specifically hxbridizes to a polynudeotide that is linked to a TIGR promoter, and a complernentar~,.r nucteic acid molecule obtained from a cell or a bodily fluid of said patient, wherein nucleic acid hybridization between said marker nucleic acid molecule, and said complementary nucleic add molecule obtained from said patient permits the detection of a poly~orpi~ism whose presence js predicgve of a mutation affecting TIGR response in said patient; {B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule obtained from said patient; and (C) detecting the presence of said polymorphism, wherein the detection of the polymorphism is prognostic of glaucoma. -Another object of the invention is to provide marker nucleic acid molecules capable of specifically detecting TIGRmtI, TlGRmt2, TIGRmt3, TIGRmt4, TIGRmtS
and TIGRsvI .
Another object of the invention is to provide a method for diagnosing steroid sensitivity in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic and molecule, the marker nucleic acid molecule comprising a nucleotide sequence of a polynudeotide that is linked to a TIGR promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of the patient, wherein nucleic add hybridization between the marker nucleic add molecule, and the complementary nucleic add molecule obtained from the patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in the patient;
{B) permitting hybridization between said TIER-encoding marker nucleic acid molecule and the complementary nucleic acid molecule obtained from the patient; and (C).
detecting the presence of the polymorphism, wherein the detection of the polymorphism is diagnostic of steroid sensitivity.
Further objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 1, recombinant DNA molecules containing a polynudeotide that specifically hybridizes to SEQ ID NO: 1 and substantially purified molecules that specifically bind to a nueleic acid molecule that comprises the sequence of SEQ ID NO:1.
Further objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 3, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 3 and substantially --- .-.
purified molecules that specifically bind to a nucleic add molecule that comprises the sequence of SEQ ID NO: 3.
Additional objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 4 and substantially z purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4.
Additional objects of. the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 5, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID N0: 5 and substantially purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID N0: 5.
An additional object of the present invention is to provide a method of treating glaucoma which comprises administering to a glaucomatous patient an effective amount of an agent that inhibits the synthesis of a TIGR protein.
Indeed, the molecules of the present invention may be used to diagnose diseases or conditions which are characterized by alterations in the expression of extracellular proteins.
According to one aspect of the present invention, there is provided a method for diagnosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID N0: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism; (B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule; and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma:
According to another aspect of the present invention, there is provided a method for diagnosing steroid sensitivity in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1; SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule;
and (C) detecting the presence of said polymorphism; wherein the detection of said polymorphism is diagnostic of steroid sensitivity.
According to still another aspect of the present invention, there is provided a method for prognosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR
gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of 5a SEQ ID NO: 1, SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule;
and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma.
According to yet another aspect of the present invention, there is provided a use of an agent capable of binding a cis element located within SEQ ID NO: 1 to treat glaucoma.
According to yet another aspect of the present invention, there is provided an oligonucleotide comprising a nucleic acid fragment from about 15 to about 250 nucleotides having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or complements thereof.
According to a further aspect of the present invention, there is provided an oligonucleotide that binds to an about 15 to about 250 nucleotide fragment of SEQ ID NO: l, SEQ LD NO: 2 or their complements, wherein said oligonucleotide may be used for detecting the presence of the TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmt5, or TIGRsvI mutations.
According to yet a further aspect of the present invention, there is provided a method for detecting the specific binding of a molecule to a nucleic acid comprising the steps of providing the nucleic acid as described herein, contacting the nucleic acid with a sample containing the 5b molecule to be tested, and identifying binding of the molecule to the nucleic acid.
According to still a further aspect of the present invention, there is provided a method of prognosticating an increased susceptibility to glaucoma, a progressive ocular hypertensive disorder resulting in loss of visual field, or the presence of steroid sensitivity in a patient by determining the genotype of an individual with regard to the presence of the TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, TIGRm t5, or TIGRsv2 mutations, said method comprising the steps of:
(a) providing a nucleic acid as described herein, (b) contacting the nucleic acid with a sample containing the molecule to be tested, and (c) identifying binding of the molecule to the nucleic acid:
BRIEF DESCRIPTION OF THE FIGURES:
Figures 1A, 1B, 1C, 1D and 1E provide the nucleic acid sequence of a TIGR promoter region (SEQ ID NO: 1) from an individual without glaucoma.
Figures 2A, 2B, 2C and 2D provide the location and sequence changes highlighted.in bold and underlined that are associated with the TIGRm t1, TIGRm t2, TIGRmt3; TIGRmt4, TIGRmtS, and TIGRsvI mutations in SEQ ID NO: 2.
Figures 3A, 3B, 3C, 3D, 3E, 3F, and 3G provide nucleic acid sequences of a TIGR promoter, and TIGR exons, TIGR introns and TIGR downstream sequences (SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5).
Figure 4 provides a diagrammatic representation of the location of primers on the TIGR gene promoter for Single Strand Conformational Polymorphism (SSCP) analysis.
5c Figure 5 provides a diagrammatic representation of the TIGR exons and the arrangement of SSCP primers.
Figure 6 provides a homology analysis of TIER
homology with olfactomedin and olfactomedin-related proteins.
Figure 7 shows the nucleotide sequence of TIGR
(SEQ ID N0: 26) .
Figure 8 shows the amino acid sequence of TIGR
(SEQ ID NO: 32) .
DETAILED DESCRIPTION OF TFiE INVENTION:
I. Agents of the Invention 5d As used herein, the term "glaucoma" has its art recognized meaning, and includes both primary glaucomas, secondary glaucomas, juvenile glaucomas, congenital glaucomas, and familial glaucomas, including, without limitation, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. The methods of the present invention are particularly relevant to the diagnosis of POAG, OAG, juvenile glaucoma, and inherited glaucomas. The -methods of the present invention are also particularly relevant to the prognosis of POAG, OAG, juvenile glaucoma, and inherited glaucomas. A disease or condition is said to be related to glaucoma if it possesses or exh~its a symptom of glaucoma, 20 for example, an increased intro-ocular pressure resulting from aqueous outflow resistance (see, Vaughan, D. et aL; in: General Ophtha'nology, Appleton &
Lange, Norwalk, CT, pp. 2T3-230 (1992)). The preferred agents of the present invention are discussed in detail below.
The agents of the present invention are capable of being used to diagnose the presence or severity of glaucoma and its related diseases in a patient suffering from glaucoma (a "glaucomatous patient'. The agents of the present invention are also capable of being used to progwose the presence or severity of glaucoma and its related diseases in a person not yet suffering from any clinical manifestations of glaucoma. Such agents may be either naturally occurring or non-naturally occurring. As used herein, a naturally occurring molecule may be "substantially purified," if desired, such that one,or more molecules that is or may be present in a naturally occurring preparation containing that molecule will have been removed or will be present at a lower concentration than that at which it would normally be found.
The agents of the present invention will preferably be "biologically active"
with respect to either a structural attribute, such as the capacity of a nucleic acid to hybridize to another nucleic acid molecule, or the ability of a protein to be bound by antibody (or to compete with another molecule for such binding).
Alternatively, such an attribute may be catalytic, and thus involve the capacity of the agent to mediate a chemical reaction or response.
As used herein, the term '">3GR protein" refers to a protein having the amino acid sequence of SEQ ID NO: 32. As used herein, the agents of the present invention comprise nucleic acid molecules, proteins, and orgar<ic molecules.
As indicated above, the trabecular meshwork has been proposed to play an important role in the normal flow of the aqueous, and has been presumed to be the major site of outflow resistance in glaucomatous eyes. Human trabecutar meshwork (F~TA~I) cells are endothelial Like cells which line the outflow channels by which aqueous humor e~cits the eye; altered synthetic function of the cells may be involved in the pathogenesis of steroid glaucoma and other types of glaucoma. Sustained S steroid treatment of these cells are interesting because it showed that a major difference was observed when compared to 1-2 day glucocorticoid (GC) exposure.
This difference appears relevant to the conical onset of steroid glaucoma (1-6 weeks).
Although trabecular meshwork cells had been found to induce specific 10~ proteins in response to glucocorticoids (see, Polansky, J.R.; In: "Basic Aspects of Glaucoma Restarch III", Schattauer, New York 307-318 (1993)), efforts to purify the expressed protein were encumbered by insolubility and other problems. Nguyen, T.D: et aL, (In: "Basic Aspects of Glaucoma Research III", Schattauer, Nem York, 331-343 (199-3y) used a molecular cloning approach to ' -iS isolate a highly induced mRNA species from glueocorticoid-induced human trabecular cells. . The mRNA exhibited a time course of induction that was similar to the glucocorticoid-induced proteins. The clone was designated "IL2" (ATCC No:
9994, American Type Culture Colle~ion,, Rocl~v~.le Maryland):
Nguyea et al., U.S. Pateat Number 5,171,788, 20 isolated a IL2 clone which enrnded a novel secretory protein that is induced in cells of the trabecular meshwork upon exp~ure to glucocorticoids. - It has been proposed that this protein may become deposited in the extracellular spaces of the trabecular meshwork and bind to the surface of the endothelial cells that line the trabecular meshwork, thus causing a decrease in aqueous #low. 6~uantitative dot blot analysis 2S. and PCR evaluations have shown that the mRNA exhibits a progressive induction yvith time whereas other known GC=inductions from other systems and found in HTM cells (metallothionein, alpha-1 acid glycoprotein and alpha-1 antichymotrypsin) reached maximum level at one day or earlier. Cf particular interest, the induction level of this clone was very high (4-6% total cellular mRNA) 30 with control levels undetectable without PCR method: Based on studies of methionine cell labeling; the clone has the characteristics recently discovered for the major GC-induced extracellular glyaoprotein in these cells, which is a sialenated, N-glycosylated molecule with a putative inositol phosphate anchor: The induction of mRNA agproa~ched 4% of the total cellular mRNA. The mRNA increased 3S progressively over 10 days of dexamethasone treatment. The IL2 clone is 2:0 Kb whereas the Northern blotting shows a band of .2.~5 Kb. Although not including a poly A tail; the 3' end ~of the clone contains two consensus polyadenylation signals.
A genomic clone was isolated and designated PITIGR clone (A?'CC No:
97570, American Type Culture Collection, Rockville; Maryland). In-situ hybridization using the P1TIGR clone shows a TfGR gene and/or a sequence or sequences that specifically hybridize to the TIGR gene located at chromosome 1, q21-27, and more preferably to the T'1GR gene located at chromosome 1, q~2-26, and most preferably to the TIGR gene located at duomosome 1, q24. Clone PiTIGR
comprises human genomic sequences that specifically hybridize to the TIGR gene cloned into the BamHI site of vector pCYPAC (ioaru~ou ef al., fVature Gene~fics, fi:84-89 (1994) ) .
.As used herein, the term "TIGR gex~p refers to the region of DNA involved in producing a TiGR protein; it includes, without limitation, iaegions pr~eceeding and following the coding region as well as intervening sequences between individual coding regions.
As used herein, the term "TIGR axon" refers to any interrupted region of the TIGR gene that serves as a template for a mature 3'IGR mRNA molecule. As used herein, the term "TIGR intron" refers to a region of the TIGR gene which is non-coding and serves as a template for a TIGR mRNA molecule.
Localization stuclies using a Stanford G3 radiation hybrid panel mapped the TIGR gene near the D1S2536 marker with a LOD score of 6:0 (Richard e# aL, American Journal of Human Genetics 53:5: 915-921 (i993),r Frazer et al., Genomics 14.3: 574 578 (1992) ~ .
Research Genetics, Huntsville, Alabama): Other markers in this region include: D1S210; D1S1552; DIS2536; DIS2790; SHC~-12820; and D18.
Sequences located upstream of the ~'IGR coding region are isolated and sequenced in a non-glaucomic individual. The upstream sequence is set forth in SEQ ID. No: 1. Sequence comparisons of the upstream .region of a non :.glaucoma individual and individuals with glaucoma identify a number of anutations in individuals with glaucoma. These mutations are illustrated in'~'rigure 2. Five mutations are identified. TIGRmf1 is the result of a replacement of a cytosine with a guanine at position 4337 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ TD iyl0: 3).
TIGRrnt2 is the result of a replacement of a cytosine with a thvfr~~,~e afi position 4950 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3)» TIGRmf3 is the result of an addition in the following order of a guanine, a thymine, a guanine, and a thymine (GTGT) at position 4998 {SEQ ID NO: I, SEQ ID NO: 2, and SEQ ID NO: 3):
TIGRmt4 is the result of a replacement of an adenine with a guanine at position 4256 {SEQ ID NO: 1, SEQ ID NO: 2; and SEQ ID NO: 3). TIGRmtS is the result of a replacement of a guanine with an adenine at position 4262 {SEQ ID NO: 1, SEQ
ID
NO: 2 and SEQ iD NO: 3). One or more of TIGRmt I, TIGRmf2, TIGRrnt3, TTGRmt4, and TIGRmfS canbe homozygous or heterozygous.
Sequence comparisons of the upstream region of a non-glaucoma individual and individuals with glaucoma identify at least one sequence variation in individuals with glaucoma. One such sequence variant is illustrated in Figure 2.
TlGRsvI is the result of a replacement of an adenine with a guanine at position 4406 (SEQ ID NO: I, SEQ ID NO: 2 and SEQ ID NO: 3).
Molecules comprising sequences upstream of the TIGR coding region provide useful markers for polymorphic studies. Such molecules include primers suitable far single strand conformational polymorphic studies; examples of which are as follows: forward primer "Sk-la": 5'-TGA GGC TTC CTC TGG AAA C-3' (SEQ
ID NO: 6); reverse primer "cat": 5'-TGA AAT CAG CAC ACC AGT AG3' (SEQ ID
NO: 7); forward primer "CA2": 5'-GCA CCC ATA CCC CAA TAA TAGS' (SEQ ID
NO: 8); reverse primer "Pr+1 ": 5'-AGA GTT CCC CAG ATT TCA CC-3' (SEQ ID
NO: 9); forward primer NPr-1": 5' ATC TGG GGA ACT CTT CTC AG ;3' (SEQ ID
NO: 10); reverse primer "Pr+2(4A2)": 5'-TAC AGT TGT TGC AGA TAC G3' (SEQ
ID NO: 11); forward primer °'Pr-2{4A)": 5'-ACA ACG TAT CTG CAA CAA
CTG3' (SEQ ID NO: 12); reverse primer "Pr+3(4A)": 5'-TCA GGC TTA ACT GCA GAA
CC-3' (SEQ ID NO: I3); forward primer "Pr-3(4A)": 5'-TTG GTT CTG CAG TTA
AGC C-3' (SEQ ID NO: I4); reverse primer "Pr+2(4A1)": 5'-AGC AGC ACA AGG
GCA ATC C-3' (SEQ ID NO: 15); reverse primer "Pr+1(4A)": 5'-ACA GGG CTA
TAT TGT GGG3' (SEQ ID NO: I6).
In addition, molecules conlprisiztg sequences within TIGR exons provide useful markers for polymorphic studies. Such molecules include primers suitable for single strand conformational polymorphic studies, examples of which are as follows: forward primer "KSIX": 5'-CCT GAG ATG CCA GCT GTC C=3' (SEQ ID
NO: I7); reverse primer "SK1XX": 5'-CTG AAG CAT TAG AAG CCA AC 3' (SEQ
ID NO: 18); forward primer "KS2a1": 5'-ACC TTG GAC CAG GCT GCC AG3' (SEQ ID N0:19); reverse primer "SK3" 5' AGG TTT GTT CGA GTT CCA G3' (SEQ
ID NO: 20); forward primer "KS4": 5'-ACA ATT ACT GGC AAG TAT GG3' (SEQ
ID NO: 21 ); reverse primer "SK6A": 5'-CCT TCT CAG CCT TGC TAC C-3' (SEQ ID
NO: 22); forward primer "KS5": 5'-ACA CCT CAG CAG ATG CTA CC-3' (SEQ ID
NO: 23); reverse primer "SK8": 5'-ATG GAT GAC TGA CAT GGC C 3' (SEQ ID NO:
24); forward primer "KS6": 5'-AAG GAT GAA CAT GGT CAC C-3' (SEQ ID NO:
The locations of primers: Sk-1 a, cat, CA2, Pr+1, Pr-1, Pr+2(4A2), Pr-2(4A);
Pr+3(4A), Pr-3(4A), Pr-3(4A), Pr+2(4AI), and Pr+1(4A) are diagramatically set forth in Figure 4. The location of primers: KSIX, SKIXX, Ks2al, SK3, KS4, SK6A, KSS, SKB, and KS6 are diagramatically set forth in Figure 5.
The primary structure of the TIGR coding region initiates from an ATG
IO initiation site (SEQ iD N0:3, residues 5337-5339) and includes a 20 amino acid consensus signal sequence a second ATG (SEQ ID NO: 3, residues 5379-5381), indicating that the protein is a secretory protein. The nucleotide sequence for the TIGR coding region is depicted in Figure 7 (SEQ ID NO: 26). The protein contains an N-linked glycosylation site located in the most hydrophilic region of the molecule. The amino terminal portion of the protein is highly polarized and adopts alpha helical structure as shown by its hydropathy profile and the Gamier-Robison structure analysis. In contrast, the protein contains a 25 amino acid hydrophobic region near its carboxy terminus. This region may comprise a glucocorticoid induced protein (GIP) anchoring sequence. The amino acid sequence of TIGR is depicted in Figure 8 (SEQ ID NO: 33).
Study of cyclohexamide treatment in the absence and presence of GC suggest that the induction of TIGR may involve factors in addition to the GC receptor.
The TIGR gene may be involved in the cellular stress response since it is also indueed by stimulants such as H202, 12-0-tetradecanolyphorbol-I3-acetate (TPA), and high glucose; this fact may relate to glaucoma pathogenesis and treatment:
Sequence comparison of the upstream region identify a number of DNA
motifs (cis elements). These DNA motifs or cis elements are shown in Figure 1:
These motifs include, without limitation, glucocorticoid response motif(s), shear stress response motif(s), NFxB recognition motif(s), and API motif(s). The locations of these and other motifs axe diagramaticaily set forth in Figure 1. As used herein, the term "cis elements capable of binding" refers to the ability of one or more of the described cis elements to specifically bind an agent: Such binding may be by any chemical, physical or biological interaction between the cis element ar,d the agent, including, but not limited, to any covalent, steric, agostic, electronic and ionic interaction between the cis element and the agent. As used herein, the term IO
"specifically binds" refers to the ability of the agent to bind to a specified cis element but not to wholly unrelated nucleic acid sequences.
A preferred loss of agents comprises TIGR nucleic acid molecules (NTIGR
molecules'. Such molecules may be either DNA or RNA. A second preferred class 5._. of agents ('"ITGR molecules") comprises the TIGR protein, its peptide fragments, fusion proteins, and analogs.
Expression of the rat PRL gene is highly restricted to pituitary lackotroph cells and is. induced by the CAMP-dependent protein lcinase A pathway. At least one of the redundant pituitary specific elements (PRL-FP11I) of the proximal rat PRL
promotor is required for this protein kinase A effect (Rajnarayan et aL, Molecular Endochrvnoiogy 4: 502-512 (1995), herein incorporated by reference). A
sequence corresponding to an upstream motif or cis element characteristic of PRL-Fell l is set forth in Figure 1 at residues 370-388 and 4491-4502, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected bx agents capable of altering the biochemical properties or concentration of molecules that bind the PRL-FPlll upstream motif or cis element: Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment uch agents can be used in the treatment of glaucoma.
A consensus sequence (GR/PR), recognized by both the glucocorticoid receptor of rat liver and the progesterone receptor from rabbit uterus, has been reported to be involved in glucocorticoid and progesterone-dependent gene expression (Von der Ahe ef aL, Nature 3t3: 706-7~09~ (1985'). __ A. sequence corresponding to a GC/PR upstream .motif or cis element is set forth in Figure 1 at residues 433-44,5. In accordance with the embodiments of the present invention; transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of glucocorticoid or progesterone or their homologues, including, but not limited to, the concentration of glucocorticoid or progesterone or their homologues bound to an GC/PR upstream 34 motif or cis element. Such agents can be used in the study of glaucoma pathogenesis: In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another . embodiment such agents can be used in the treatment of glaucoma.
Shear stress motif (SSRE) or cis element has been identified in a number of ;.
genes including platelet-derived growth factor B chain, tissue plasaiinogen activator (tPA), ICAM-1 and TGF-~1 (Resnick et aL, Proc. NatL Acad. Sci. (LISA) 80: 4591-4595) .
METHODS FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF
GLAUCOMA AND RELATED DISORDERS
The present invention is in the fields of diagnostics, prognosis, and treatment, and concerns methods and reagents for diagnosing and treating glaucoma and ,~.
related disorders.
"Glaucomas" are a group of debilitating eye diseases that are the leading cause of preventable blindness in the United States and other developed nations.
Priaaary Open Angle Glaucoma ("POAG'~ is the most eomrnon form of glaucoma.
The disease is characterized by the alteration of the trabecular meshwork, leading to obstruction of the normal ability of aqueous humor to leave the eye without closure of the spare (e:g., the "angle") between the iris and cornea (see, Vaughan, D.
et al., In: General Ophthalmology, Appleton & Lange, Norwalk, CT, pp. 213-230 (1992)).
A
characteristic of such obstruction in this disease is an increased intraocular pressure ("IOP"), resulting in progressive visual Ioss and blindness if not treated appropriately and in a timely fashion.
The disease is estimated to affect between 0.4% and 3.3% of all adults over 40 years old (Leske, M.C. et aL, Amer. J. Epidemiol. l I3:1843-1846 (1986);
Bengtsson, B., Br. J. OphthamoI: 73:483-487 (1989); Strong, N:P., Ophthul. Physiol. Opt. 12:3-7 (1992)).
Moreover, the prevalence of the disease rises with age to over 6% of those 75 years - 30 or older (Strong, N.P., Ophthal. Physiol. Opt. T2:3-7 (1992)).
A link between the IOP response of patients to glucocorticoids and the disease of POAG has long been suspected. While only 5% of the normal population shown a high IOP increase {16 mm Hg) to topical glucocorticoid testing, greater than ' 40-50% of patients with POAG show this response: In addition; an Open Angle glaucoma may be induced by exposure to glucocorticoids. This observation has suggested that an increased or abnormal glucocorticoid response in trabecular cells may be involved in POAG {than, G.L. et al., Exper. dye Res. 54:211-218 (1992); Yun, A.j. et al., Invest. Ophtharnol. Vis. Sci. 30:2012-2022 (1989);
Clark, A.F., Exper. Eye Res.
55:265 (1992); Klemetti, A., Acts Ophthamol. 68:29 33 {1990); Knepper, P.A.; U.S.
Patent No. 4,617,299). The ability of glucocorticoids to induce a glaucoma-Iike condition has led to efforts to identify genes or gene products that would be induced by the cells of the trabecular meshwork in response to glucocorticoids {Polansky, J.R et al., in: Glaucoma Lipdate IV, Springer-Verlag, Berlin, pp. 20-29 {1991)). Initial efforts using short-term exposure to dexamethasone revealed only changes in specific protein synthesis. Extended exposure to relatively high-levels of dexamethasone was, however, found to induce the expression of related 66 kD and 55 kD proteins that could be visualized by gel electrophoresis (Polansky, j:It et al.;
in: Glaucoma i.Ipdate IV, Springer-Verlag, Berlin, pp. 20-29 (1991)).
The induction kinetics of these proteins as well as their dose response characteristics were similar to the kinetics that were required for steroid-induced IOP eie~ration in human subjects (Polansky, J.R et al.; In: Glaucoma i,ipdate IV, Springer-Verlag, Berlin; pp. 20-29 (1991)). Problems of aggregation and apparent instability or loss of protein in the purification process were obstacles in obtaining a direct protein sequence.
Because increased IOP is a readily measurable characteristic of glaucoma, the diagnosis of the disease is largely screened for by measuring intraocular pressure {tonometry) (Strong, N.P., Ophthal. Physiol. Opt. 22:3-7 (1992);
Greve, M. et al.; Can. J.
Ophthamol. 28:201-206 (1993)). Unfortunately, because glaucomatous and normal pressure ranges overlap, such methods are of limited value unless multiple readings are obtained (Hitchings, RA:, Br. j. Ophfhamol. 7T:326 (1993); Tuck, M.W: et al.;
Ophthal. PhysioL Opt: 23:227-232 (1993); Vaughan, D. et al., In:
General Ophthamology, Appleton & Lange, Norwalk, C"T, pp. 213-230 (1992); Vernon, S.A., Eye 7:134-137 (1993)). For this reason, additional methods; such as direct examination of the optic disk and determination of the extent of a patient's visual field loss are soften conducted to improve the accuracy of diagnosis (Greve, M. et aL, Can. ]: Ophthamol.
28:201- 206 (1993)). Moreover, these techniques are of limited prognostic value.
Nguyen et al., U.S. Patent Number 5,789,169, disclosed a novel protein sequence highly induced by glucocorticoids in the endothelial lining cells of the human trabecular meshwork. Nguyen et al., U.S. Patent Number 5,789,169 also disclosed the cDNA sequence for that protein, the protein itself, molecules that bind to it, and nucleic acid molecules that encode it, and provided improved methods and reagents for diagnosing glaucoma and related disorder, as well as for diagnosing other diseases or conditions, such as cardiovascular, immunological, or other diseases or conditions that affect the expression or activity of the protein.
The present invention provides improved diagnostic agents, prognostic agents.; therapeutic agents and methods.
S.IIMMARY OF THE L~.VE~(,O~j:
An object of the invention is to provide a method for diagnosing glaucoma in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic acid molecule, said marker nucleic and molecule comprising a nueleotide sequence of a polynucleotide that specifically hxbridizes to a polxnucleotide that is linked to a TIER promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of said patient, wherein nucleic acid hybridization between said marker nucleic acid molecule, and said complementary nucleic acid molecule obtained from said patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in said patient; (B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule obtained- from said patient; and (C) detecting the presence of said polymorphism, wherein the detection of the polymorphism is cliagnostie of glaucoma.
Another object of the invention is to provide a method for , prognosing glaucoma in a patient which comprises the steps: (A) incubating under conditions ~0 permitting nucleic acid hybridization: a marker nucleic acid molecule, said marker nucleic acid molecule comprising a nucleotide sequence of a polynucleotide that specifically hxbridizes to a polynudeotide that is linked to a TIGR promoter, and a complernentar~,.r nucteic acid molecule obtained from a cell or a bodily fluid of said patient, wherein nucleic acid hybridization between said marker nucleic acid molecule, and said complementary nucleic add molecule obtained from said patient permits the detection of a poly~orpi~ism whose presence js predicgve of a mutation affecting TIGR response in said patient; {B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule obtained from said patient; and (C) detecting the presence of said polymorphism, wherein the detection of the polymorphism is prognostic of glaucoma. -Another object of the invention is to provide marker nucleic acid molecules capable of specifically detecting TIGRmtI, TlGRmt2, TIGRmt3, TIGRmt4, TIGRmtS
and TIGRsvI .
Another object of the invention is to provide a method for diagnosing steroid sensitivity in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic and molecule, the marker nucleic acid molecule comprising a nucleotide sequence of a polynudeotide that is linked to a TIGR promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of the patient, wherein nucleic add hybridization between the marker nucleic add molecule, and the complementary nucleic add molecule obtained from the patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in the patient;
{B) permitting hybridization between said TIER-encoding marker nucleic acid molecule and the complementary nucleic acid molecule obtained from the patient; and (C).
detecting the presence of the polymorphism, wherein the detection of the polymorphism is diagnostic of steroid sensitivity.
Further objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 1, recombinant DNA molecules containing a polynudeotide that specifically hybridizes to SEQ ID NO: 1 and substantially purified molecules that specifically bind to a nueleic acid molecule that comprises the sequence of SEQ ID NO:1.
Further objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 3, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 3 and substantially --- .-.
purified molecules that specifically bind to a nucleic add molecule that comprises the sequence of SEQ ID NO: 3.
Additional objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 4 and substantially z purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4.
Additional objects of. the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 5, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID N0: 5 and substantially purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID N0: 5.
An additional object of the present invention is to provide a method of treating glaucoma which comprises administering to a glaucomatous patient an effective amount of an agent that inhibits the synthesis of a TIGR protein.
Indeed, the molecules of the present invention may be used to diagnose diseases or conditions which are characterized by alterations in the expression of extracellular proteins.
According to one aspect of the present invention, there is provided a method for diagnosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID N0: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism; (B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule; and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma:
According to another aspect of the present invention, there is provided a method for diagnosing steroid sensitivity in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1; SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule;
and (C) detecting the presence of said polymorphism; wherein the detection of said polymorphism is diagnostic of steroid sensitivity.
According to still another aspect of the present invention, there is provided a method for prognosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR
gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of 5a SEQ ID NO: 1, SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule;
and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma.
According to yet another aspect of the present invention, there is provided a use of an agent capable of binding a cis element located within SEQ ID NO: 1 to treat glaucoma.
According to yet another aspect of the present invention, there is provided an oligonucleotide comprising a nucleic acid fragment from about 15 to about 250 nucleotides having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or complements thereof.
According to a further aspect of the present invention, there is provided an oligonucleotide that binds to an about 15 to about 250 nucleotide fragment of SEQ ID NO: l, SEQ LD NO: 2 or their complements, wherein said oligonucleotide may be used for detecting the presence of the TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmt5, or TIGRsvI mutations.
According to yet a further aspect of the present invention, there is provided a method for detecting the specific binding of a molecule to a nucleic acid comprising the steps of providing the nucleic acid as described herein, contacting the nucleic acid with a sample containing the 5b molecule to be tested, and identifying binding of the molecule to the nucleic acid.
According to still a further aspect of the present invention, there is provided a method of prognosticating an increased susceptibility to glaucoma, a progressive ocular hypertensive disorder resulting in loss of visual field, or the presence of steroid sensitivity in a patient by determining the genotype of an individual with regard to the presence of the TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, TIGRm t5, or TIGRsv2 mutations, said method comprising the steps of:
(a) providing a nucleic acid as described herein, (b) contacting the nucleic acid with a sample containing the molecule to be tested, and (c) identifying binding of the molecule to the nucleic acid:
BRIEF DESCRIPTION OF THE FIGURES:
Figures 1A, 1B, 1C, 1D and 1E provide the nucleic acid sequence of a TIGR promoter region (SEQ ID NO: 1) from an individual without glaucoma.
Figures 2A, 2B, 2C and 2D provide the location and sequence changes highlighted.in bold and underlined that are associated with the TIGRm t1, TIGRm t2, TIGRmt3; TIGRmt4, TIGRmtS, and TIGRsvI mutations in SEQ ID NO: 2.
Figures 3A, 3B, 3C, 3D, 3E, 3F, and 3G provide nucleic acid sequences of a TIGR promoter, and TIGR exons, TIGR introns and TIGR downstream sequences (SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5).
Figure 4 provides a diagrammatic representation of the location of primers on the TIGR gene promoter for Single Strand Conformational Polymorphism (SSCP) analysis.
5c Figure 5 provides a diagrammatic representation of the TIGR exons and the arrangement of SSCP primers.
Figure 6 provides a homology analysis of TIER
homology with olfactomedin and olfactomedin-related proteins.
Figure 7 shows the nucleotide sequence of TIGR
(SEQ ID N0: 26) .
Figure 8 shows the amino acid sequence of TIGR
(SEQ ID NO: 32) .
DETAILED DESCRIPTION OF TFiE INVENTION:
I. Agents of the Invention 5d As used herein, the term "glaucoma" has its art recognized meaning, and includes both primary glaucomas, secondary glaucomas, juvenile glaucomas, congenital glaucomas, and familial glaucomas, including, without limitation, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. The methods of the present invention are particularly relevant to the diagnosis of POAG, OAG, juvenile glaucoma, and inherited glaucomas. The -methods of the present invention are also particularly relevant to the prognosis of POAG, OAG, juvenile glaucoma, and inherited glaucomas. A disease or condition is said to be related to glaucoma if it possesses or exh~its a symptom of glaucoma, 20 for example, an increased intro-ocular pressure resulting from aqueous outflow resistance (see, Vaughan, D. et aL; in: General Ophtha'nology, Appleton &
Lange, Norwalk, CT, pp. 2T3-230 (1992)). The preferred agents of the present invention are discussed in detail below.
The agents of the present invention are capable of being used to diagnose the presence or severity of glaucoma and its related diseases in a patient suffering from glaucoma (a "glaucomatous patient'. The agents of the present invention are also capable of being used to progwose the presence or severity of glaucoma and its related diseases in a person not yet suffering from any clinical manifestations of glaucoma. Such agents may be either naturally occurring or non-naturally occurring. As used herein, a naturally occurring molecule may be "substantially purified," if desired, such that one,or more molecules that is or may be present in a naturally occurring preparation containing that molecule will have been removed or will be present at a lower concentration than that at which it would normally be found.
The agents of the present invention will preferably be "biologically active"
with respect to either a structural attribute, such as the capacity of a nucleic acid to hybridize to another nucleic acid molecule, or the ability of a protein to be bound by antibody (or to compete with another molecule for such binding).
Alternatively, such an attribute may be catalytic, and thus involve the capacity of the agent to mediate a chemical reaction or response.
As used herein, the term '">3GR protein" refers to a protein having the amino acid sequence of SEQ ID NO: 32. As used herein, the agents of the present invention comprise nucleic acid molecules, proteins, and orgar<ic molecules.
As indicated above, the trabecular meshwork has been proposed to play an important role in the normal flow of the aqueous, and has been presumed to be the major site of outflow resistance in glaucomatous eyes. Human trabecutar meshwork (F~TA~I) cells are endothelial Like cells which line the outflow channels by which aqueous humor e~cits the eye; altered synthetic function of the cells may be involved in the pathogenesis of steroid glaucoma and other types of glaucoma. Sustained S steroid treatment of these cells are interesting because it showed that a major difference was observed when compared to 1-2 day glucocorticoid (GC) exposure.
This difference appears relevant to the conical onset of steroid glaucoma (1-6 weeks).
Although trabecular meshwork cells had been found to induce specific 10~ proteins in response to glucocorticoids (see, Polansky, J.R.; In: "Basic Aspects of Glaucoma Restarch III", Schattauer, New York 307-318 (1993)), efforts to purify the expressed protein were encumbered by insolubility and other problems. Nguyen, T.D: et aL, (In: "Basic Aspects of Glaucoma Research III", Schattauer, Nem York, 331-343 (199-3y) used a molecular cloning approach to ' -iS isolate a highly induced mRNA species from glueocorticoid-induced human trabecular cells. . The mRNA exhibited a time course of induction that was similar to the glucocorticoid-induced proteins. The clone was designated "IL2" (ATCC No:
9994, American Type Culture Colle~ion,, Rocl~v~.le Maryland):
Nguyea et al., U.S. Pateat Number 5,171,788, 20 isolated a IL2 clone which enrnded a novel secretory protein that is induced in cells of the trabecular meshwork upon exp~ure to glucocorticoids. - It has been proposed that this protein may become deposited in the extracellular spaces of the trabecular meshwork and bind to the surface of the endothelial cells that line the trabecular meshwork, thus causing a decrease in aqueous #low. 6~uantitative dot blot analysis 2S. and PCR evaluations have shown that the mRNA exhibits a progressive induction yvith time whereas other known GC=inductions from other systems and found in HTM cells (metallothionein, alpha-1 acid glycoprotein and alpha-1 antichymotrypsin) reached maximum level at one day or earlier. Cf particular interest, the induction level of this clone was very high (4-6% total cellular mRNA) 30 with control levels undetectable without PCR method: Based on studies of methionine cell labeling; the clone has the characteristics recently discovered for the major GC-induced extracellular glyaoprotein in these cells, which is a sialenated, N-glycosylated molecule with a putative inositol phosphate anchor: The induction of mRNA agproa~ched 4% of the total cellular mRNA. The mRNA increased 3S progressively over 10 days of dexamethasone treatment. The IL2 clone is 2:0 Kb whereas the Northern blotting shows a band of .2.~5 Kb. Although not including a poly A tail; the 3' end ~of the clone contains two consensus polyadenylation signals.
A genomic clone was isolated and designated PITIGR clone (A?'CC No:
97570, American Type Culture Collection, Rockville; Maryland). In-situ hybridization using the P1TIGR clone shows a TfGR gene and/or a sequence or sequences that specifically hybridize to the TIGR gene located at chromosome 1, q21-27, and more preferably to the T'1GR gene located at chromosome 1, q~2-26, and most preferably to the TIGR gene located at duomosome 1, q24. Clone PiTIGR
comprises human genomic sequences that specifically hybridize to the TIGR gene cloned into the BamHI site of vector pCYPAC (ioaru~ou ef al., fVature Gene~fics, fi:84-89 (1994) ) .
.As used herein, the term "TIGR gex~p refers to the region of DNA involved in producing a TiGR protein; it includes, without limitation, iaegions pr~eceeding and following the coding region as well as intervening sequences between individual coding regions.
As used herein, the term "TIGR axon" refers to any interrupted region of the TIGR gene that serves as a template for a mature 3'IGR mRNA molecule. As used herein, the term "TIGR intron" refers to a region of the TIGR gene which is non-coding and serves as a template for a TIGR mRNA molecule.
Localization stuclies using a Stanford G3 radiation hybrid panel mapped the TIGR gene near the D1S2536 marker with a LOD score of 6:0 (Richard e# aL, American Journal of Human Genetics 53:5: 915-921 (i993),r Frazer et al., Genomics 14.3: 574 578 (1992) ~ .
Research Genetics, Huntsville, Alabama): Other markers in this region include: D1S210; D1S1552; DIS2536; DIS2790; SHC~-12820; and D18.
Sequences located upstream of the ~'IGR coding region are isolated and sequenced in a non-glaucomic individual. The upstream sequence is set forth in SEQ ID. No: 1. Sequence comparisons of the upstream .region of a non :.glaucoma individual and individuals with glaucoma identify a number of anutations in individuals with glaucoma. These mutations are illustrated in'~'rigure 2. Five mutations are identified. TIGRmf1 is the result of a replacement of a cytosine with a guanine at position 4337 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ TD iyl0: 3).
TIGRrnt2 is the result of a replacement of a cytosine with a thvfr~~,~e afi position 4950 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3)» TIGRmf3 is the result of an addition in the following order of a guanine, a thymine, a guanine, and a thymine (GTGT) at position 4998 {SEQ ID NO: I, SEQ ID NO: 2, and SEQ ID NO: 3):
TIGRmt4 is the result of a replacement of an adenine with a guanine at position 4256 {SEQ ID NO: 1, SEQ ID NO: 2; and SEQ ID NO: 3). TIGRmtS is the result of a replacement of a guanine with an adenine at position 4262 {SEQ ID NO: 1, SEQ
ID
NO: 2 and SEQ iD NO: 3). One or more of TIGRmt I, TIGRmf2, TIGRrnt3, TTGRmt4, and TIGRmfS canbe homozygous or heterozygous.
Sequence comparisons of the upstream region of a non-glaucoma individual and individuals with glaucoma identify at least one sequence variation in individuals with glaucoma. One such sequence variant is illustrated in Figure 2.
TlGRsvI is the result of a replacement of an adenine with a guanine at position 4406 (SEQ ID NO: I, SEQ ID NO: 2 and SEQ ID NO: 3).
Molecules comprising sequences upstream of the TIGR coding region provide useful markers for polymorphic studies. Such molecules include primers suitable far single strand conformational polymorphic studies; examples of which are as follows: forward primer "Sk-la": 5'-TGA GGC TTC CTC TGG AAA C-3' (SEQ
ID NO: 6); reverse primer "cat": 5'-TGA AAT CAG CAC ACC AGT AG3' (SEQ ID
NO: 7); forward primer "CA2": 5'-GCA CCC ATA CCC CAA TAA TAGS' (SEQ ID
NO: 8); reverse primer "Pr+1 ": 5'-AGA GTT CCC CAG ATT TCA CC-3' (SEQ ID
NO: 9); forward primer NPr-1": 5' ATC TGG GGA ACT CTT CTC AG ;3' (SEQ ID
NO: 10); reverse primer "Pr+2(4A2)": 5'-TAC AGT TGT TGC AGA TAC G3' (SEQ
ID NO: 11); forward primer °'Pr-2{4A)": 5'-ACA ACG TAT CTG CAA CAA
CTG3' (SEQ ID NO: 12); reverse primer "Pr+3(4A)": 5'-TCA GGC TTA ACT GCA GAA
CC-3' (SEQ ID NO: I3); forward primer "Pr-3(4A)": 5'-TTG GTT CTG CAG TTA
AGC C-3' (SEQ ID NO: I4); reverse primer "Pr+2(4A1)": 5'-AGC AGC ACA AGG
GCA ATC C-3' (SEQ ID NO: 15); reverse primer "Pr+1(4A)": 5'-ACA GGG CTA
TAT TGT GGG3' (SEQ ID NO: I6).
In addition, molecules conlprisiztg sequences within TIGR exons provide useful markers for polymorphic studies. Such molecules include primers suitable for single strand conformational polymorphic studies, examples of which are as follows: forward primer "KSIX": 5'-CCT GAG ATG CCA GCT GTC C=3' (SEQ ID
NO: I7); reverse primer "SK1XX": 5'-CTG AAG CAT TAG AAG CCA AC 3' (SEQ
ID NO: 18); forward primer "KS2a1": 5'-ACC TTG GAC CAG GCT GCC AG3' (SEQ ID N0:19); reverse primer "SK3" 5' AGG TTT GTT CGA GTT CCA G3' (SEQ
ID NO: 20); forward primer "KS4": 5'-ACA ATT ACT GGC AAG TAT GG3' (SEQ
ID NO: 21 ); reverse primer "SK6A": 5'-CCT TCT CAG CCT TGC TAC C-3' (SEQ ID
NO: 22); forward primer "KS5": 5'-ACA CCT CAG CAG ATG CTA CC-3' (SEQ ID
NO: 23); reverse primer "SK8": 5'-ATG GAT GAC TGA CAT GGC C 3' (SEQ ID NO:
24); forward primer "KS6": 5'-AAG GAT GAA CAT GGT CAC C-3' (SEQ ID NO:
The locations of primers: Sk-1 a, cat, CA2, Pr+1, Pr-1, Pr+2(4A2), Pr-2(4A);
Pr+3(4A), Pr-3(4A), Pr-3(4A), Pr+2(4AI), and Pr+1(4A) are diagramatically set forth in Figure 4. The location of primers: KSIX, SKIXX, Ks2al, SK3, KS4, SK6A, KSS, SKB, and KS6 are diagramatically set forth in Figure 5.
The primary structure of the TIGR coding region initiates from an ATG
IO initiation site (SEQ iD N0:3, residues 5337-5339) and includes a 20 amino acid consensus signal sequence a second ATG (SEQ ID NO: 3, residues 5379-5381), indicating that the protein is a secretory protein. The nucleotide sequence for the TIGR coding region is depicted in Figure 7 (SEQ ID NO: 26). The protein contains an N-linked glycosylation site located in the most hydrophilic region of the molecule. The amino terminal portion of the protein is highly polarized and adopts alpha helical structure as shown by its hydropathy profile and the Gamier-Robison structure analysis. In contrast, the protein contains a 25 amino acid hydrophobic region near its carboxy terminus. This region may comprise a glucocorticoid induced protein (GIP) anchoring sequence. The amino acid sequence of TIGR is depicted in Figure 8 (SEQ ID NO: 33).
Study of cyclohexamide treatment in the absence and presence of GC suggest that the induction of TIGR may involve factors in addition to the GC receptor.
The TIGR gene may be involved in the cellular stress response since it is also indueed by stimulants such as H202, 12-0-tetradecanolyphorbol-I3-acetate (TPA), and high glucose; this fact may relate to glaucoma pathogenesis and treatment:
Sequence comparison of the upstream region identify a number of DNA
motifs (cis elements). These DNA motifs or cis elements are shown in Figure 1:
These motifs include, without limitation, glucocorticoid response motif(s), shear stress response motif(s), NFxB recognition motif(s), and API motif(s). The locations of these and other motifs axe diagramaticaily set forth in Figure 1. As used herein, the term "cis elements capable of binding" refers to the ability of one or more of the described cis elements to specifically bind an agent: Such binding may be by any chemical, physical or biological interaction between the cis element ar,d the agent, including, but not limited, to any covalent, steric, agostic, electronic and ionic interaction between the cis element and the agent. As used herein, the term IO
"specifically binds" refers to the ability of the agent to bind to a specified cis element but not to wholly unrelated nucleic acid sequences.
A preferred loss of agents comprises TIGR nucleic acid molecules (NTIGR
molecules'. Such molecules may be either DNA or RNA. A second preferred class 5._. of agents ('"ITGR molecules") comprises the TIGR protein, its peptide fragments, fusion proteins, and analogs.
Expression of the rat PRL gene is highly restricted to pituitary lackotroph cells and is. induced by the CAMP-dependent protein lcinase A pathway. At least one of the redundant pituitary specific elements (PRL-FP11I) of the proximal rat PRL
promotor is required for this protein kinase A effect (Rajnarayan et aL, Molecular Endochrvnoiogy 4: 502-512 (1995), herein incorporated by reference). A
sequence corresponding to an upstream motif or cis element characteristic of PRL-Fell l is set forth in Figure 1 at residues 370-388 and 4491-4502, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected bx agents capable of altering the biochemical properties or concentration of molecules that bind the PRL-FPlll upstream motif or cis element: Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment uch agents can be used in the treatment of glaucoma.
A consensus sequence (GR/PR), recognized by both the glucocorticoid receptor of rat liver and the progesterone receptor from rabbit uterus, has been reported to be involved in glucocorticoid and progesterone-dependent gene expression (Von der Ahe ef aL, Nature 3t3: 706-7~09~ (1985'). __ A. sequence corresponding to a GC/PR upstream .motif or cis element is set forth in Figure 1 at residues 433-44,5. In accordance with the embodiments of the present invention; transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of glucocorticoid or progesterone or their homologues, including, but not limited to, the concentration of glucocorticoid or progesterone or their homologues bound to an GC/PR upstream 34 motif or cis element. Such agents can be used in the study of glaucoma pathogenesis: In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another . embodiment such agents can be used in the treatment of glaucoma.
Shear stress motif (SSRE) or cis element has been identified in a number of ;.
genes including platelet-derived growth factor B chain, tissue plasaiinogen activator (tPA), ICAM-1 and TGF-~1 (Resnick et aL, Proc. NatL Acad. Sci. (LISA) 80: 4591-4595) .
3'ranscription of these genes has been assotiated with humoral stimuli such as cytolcines and bacterial products as well as hemodynamic stress forces. Sequences corresponding to a upstream shear stress motif or cis element are set forth in Figure 1 at residues 44G-4a1, 128&1293, 3602, 4~1-477b, and 5240-5245, respectively. In accordance with the :embodiments .
of the present invention, transcription of TdGR molecules can be effected by agents capable of altering the biochemical properties or concentration of ~olecules~capable of binding the shear stress motif. Such agents can be used in the study of.
glaucoma pathogenesis. in another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for a glucocorticoid response upstream motif (GRE) or cis element has been characterized (Beato, CeII 56: 335-344 (1989); Beclcer et al:, Nature 324: 686-688 (1986), herein incorporated by reference; Salcai et aL, Genes acrd DeveIoprnent Z: II44-1154 (I988), herein incorporated by reference). Genes containing this upstream motif or cis element are regulated by glucocorticoids, progesterone, androgens and mineral corticoids (Beato, Cel156: 335-344 (1989)). .
Sequences corresponding to glucocorticoid response upstream 'motif or cis element are set forth in Figure 1 at residues 574-600,1042-1055, 2444-2468, 2442-?369, 3563, 4574-4593, 4595-4b14, 4851-4865; 4844-4864, 5079 X084; and 5083-5111, respectively. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of al#ering the biochemical properties or concentration of molecules capable of binding a glucocorticoid response upstream motif or cis element. ~5uch agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such ag~nfs can be used in the treatment of glaucoma.
A sequence specific binding site (CBE) for the wild type nuclear phosphoprotein, p53, has been identified and appears to be ~ associated with replication origins (Kern et aI. Science 252: 1708-1711 (1991~))~
A sequence rnrresponding to an C8E upstream motif or cis element is set forth in Figure 1 at residues 735-74b. In accordance with the embadunents of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or eoncentration of p53 or its homologues, including, but not limited to, the concentration of p53. or its homologues bound to an CBE upstream motif or cis element. Such agents can be used in the study of glaucoma pathogene..~is. in another embodiment, such agents can also be used in the studg of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaurnma.
Nuclear factor ets-like (NFE); a transcriptional activator that facilitates p50 and c-Rel-dependent IgH 3' enhancer activit~r has been shown to bind to an NFE
site in the Rel-dependent IgH 3' er~han~r (Linderson et aL; European j. lrnmunoiogy 27:
468-475 (199~.j . A sequence corresponding to an NF'E upstream motif or cis element is set forth in Figure, l at residues 774-795. In accordance with the embodi~atents of the present invention, transcription of TIGR
molecules. can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an NFE
upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
An upstream motif or cis element (K'TF.1-CS) for a control element 3' to the human keratin 1 gene that regulates cell type and differentiation-specific expression has been identified (Huff et al., J. Biological Chemistry 268: 377 3$4 (1993) ) .
A sequence corresponding to an upstream motif or cis element characteristic of KTF.I-CS is set forth in Figure 1 at residues 843-854: In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected bx agents capable of altering the biochemical prorperties or concentration of KTF.1-CS or its homologues, including, but not limited to, the concentration of K'TF.I-CS. or its homologues bound to a KTF.1-CS upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis.
In another embodiment, such agents can also be used ~in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A progesterone responsive element (PRE) that maps to the far upstream steroid dependent DNase hypersensitive site of chicken lysozyme chromatin has been characterized (Hecht et aL, EMBO J. 7:2063-2073 (1988).:) .
The element confers hormonal regulation to a heterologous promoter and is composed of a cluster of progesterone receptor binding sites. A
sequence corresponding to an ups~irearn motif or cis element characteristic of P~ is set forth in Figure 1 at residues 987-1026. In accordance with the embodiments of the present invention, transcription of TiGR molecules can be effected by agent capable of altering the biochemical properties or concentrati~ri of molecules capable of binding a progesterone responsive PRE upstream motif or cis.element. Such agents may be useful in the study of glaucoma pathogenesis: In another e~bodia~ent, such agents can also be used in the study of giaurnma prognosis. In another eriibodiment such agents cain be used in the treatment of glaucoma.
A sequence (ETP-EGFR) has been characterized which serves as a motif ~'ror a traps-active transcription factor that regulates expression of the epidermal growth factor receptor (Regec et al., Blood 85:2711-2719 (199'a~):
A sequence corresponding to an ETF-EGFR upstream motif or cis element is set forth in Figure 1 at residues 1373-1388. In accordance v~ith the embodiments of the present invention, transcription of 'T1GR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an ETF-EGFR upstream motif or~cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A common traps-acting factor (SRE-cFos) has been shown to regulate skeletal and cardiac alpha-Actin gene transcription in muscle (A~Iuscat ef al.;
Molecular and Cellular Biology 10: 4120-4133 (1988)) - A sequence corresponding to an SRE-cFos upstream motif or cis element is set forth in figure 1 at residues 1447-1456. In accordance with the embodiments of the present invention, transcription of TiGR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear 'factors or their homologues bound to an SRE-cFos upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prQ~osis. In another~embodiment such agents can be used in the treatment of ~giaumma.
Alu repetitive elements are unique to primates and are interspersed within the human genome with an average spacing of 4Kb. While some Alu sequences are actively transcribed bx polymerase III; normal transcripts may also contain Alu derived sequences in 5' or 3' untranslated regions (Jurka and Mikahanljaia, J:
MoI.
Evolution 32: 105-121 (1991j, Claveria and Makalowski, Nature 3~I: 251-752 (1994)?, A
sequence corresponding to an Alu upstream motif or Gis element is set forth in Figure 1 at residues 1331-1550. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues. bound to an Alu upstream motif or cis element. Such agents can be used in the study of glaueoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for a vitellogenin gene-binding protein (VBP) upstream motif or cis element has been characterized (Iyer et aL, Molecular and Cellular Biology T 1: 4863-48?5 (1991)x. Expression of the VBP gene commences early in liver ontogeny and is not subject to circadian control. A sequence corresponding to an upstream motaf or cIS element capable of binding VBP is set forth in Figure 1 at residues 1?86-1797. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of VBP or its homologues, including, but not limited to, the concentration of VBP
or its homologues bound to an VBP upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A structural motif (Malt-CS) or cis element involved in the -activation of all promoters of the maltose operons in Escherichia toll and KlebsieIIa pneunwniae has been characterized (Vidal-Ingigliardi et aL, J. Mol: Biol. 2I8: 323-334 (1991),x, A sequence corresponding to a upstream Malt-CS motif or crs element is set forth in Figure 1 at residues 1832-1841. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules capable of binding the upstream Malt-CS motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. in another embooiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such.agents can be used in the treatment of glaurnma.
A consensus sequence for an estrogen receptor upstream motif or cis ele;nent has been characterized (ERE) (Forman ef al., MoI. ~ndocri»olagy 4: 1293-2301 (199U) ;
de Verneuii et aL, Nucleic Acid Res. 38: 4489-4497 (1990), herein incorporated by refs; Gaub ef aL, Cell'63:1~67 176 (19900:
A sequence corresponding to half an upstream motif or cis element capable of binding estrogen receptor is set forth in Figure 1 at residues 2166-2195, 3413-3429, and 3892-3896, respectively. In accordance with the embodiments of the present invention, transcription of TTGR molecules can be effected b~ agents capable of altering the biochemical properties or concentration, of the estrogen receptor or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment; such agents can also be used in the study of .glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucoma.
Certain proteiirbinding sites (NF mutagen) in Ig gene enhancers which determine transcriptional activity and induc~ility have been shown to interact with nuclear factors (Lenardo et aL, Science X236:1573-1'577 (198Tj ) .
A sequence corresponding to an NF mutagen upstream motif or cis element is set forth in Figure 1 at residues 2329-2338. In accordance with the embodiments of the present invention, transcription of TTGR molecules van be effected by agents capable of altering the biochemical propertses or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an NF-mutagen ups#ream motif or cis element. Such agents can be used lm the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents carp be used in the trea#~nent of glaucoma.
A consensus sequence for a transcriptional repressor of c-myc ~~(myc-PRF) upstream motif or cis element has been identified (ICalckis.et al., Nature 339: 718-719 (3989)) , Myc-PRF interacts wig another widely ' v distributed protein, myc-CFl (comalon factor 1), which binds nearby and this 3'~ association may be important in myc-PRF repression A sequence corresponding to w 1,6 an upstream motif or cis element capable of binding myc-PRF is set forth in Figure 1 at residues 2403-241b. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of myc-PRF or its homologues, including, but not limited to, the concentration of myc-PRF or its homologues bound to an mxc-PRF upsfream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. . In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can'be used in the treatment of glaucoma.
Human transcription factor activator protein 2 (AP2) is a transcription factor that has been shown to bind to Spl, nuclear factor 1 (NFl) and simian virus 40 transplantation (SV40 T) antigen binding sites. It is developmentally regulated (Williams and Tijan, Gene Dev. 5: 670-682 (1991);
Mitchell et aL, Genes Dea. 5: 105-7:19 (1991); Coubois ef al., Nucleic Acid Researcls I8: 57-64 (1990); Comb et al., NucI'eic Acid Research I8: 39?5 3982 (1990);
Winings et aL, Nucleic Acid Research I9: 3709 3714 (1991) ) .
Sequences ~rresponding to an upstream motif or cis element capable of binding AP2 are set forth in Figure 1 at residues 2520-2535, and '5170-5187, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effecfied by agents capable of altering.the biochemical properties or concentration of AP2 or its homologues, including, but not limited to, the concentration of AP2 or its homologues bound to an upstream motif or cis element. Such agents may be useful in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Drosophila RNA polymerase II heat shock transcription factor (I~STF) is a transcription factor that has been shown to be required for active transcription of an hsp 70 gene (Parker and Topoi, CeII 37:. 273-283 (1984) ) .
vequences corresponding to an upstream motif or cis element capable of binding HSTF .are set forth in Figure 1 at residues 2622-2635, and 5105-SI32.
In accordance with the embodiments of the present invention, transcription of TIGR
f molecules can be effected by agents capable of altering the biochemical properties or concentration of HSTF or its homologues, including, but not limited to, the concentration of I~ or its homologues bound to an ~STF upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of . glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma. ~ w A sequence corresponding to an upstream motif or cis element characteristic of SBF is set forth in Figure 1 at residues 2733-2743 (Shore et al., I:MBO j.
t;: 461-467 (1987)). In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biocheaucal properties or concentration of molecules that bind the SBF upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
IS An NFl motif or cis element has been identified which recognizes a family of at least six proteins (Courtois, ef aL, Nucleic Acid Res. 18: 57-64 tI990);
Mul et aL, j. Virol. b4: X510=6518 (1990);
Rossi et al., Cell 52: 405-414 (1988) ;
Gounari et al., EMBO j. L0: 559-5b6 (1990);
Goyal et aL, MoI. Cell BioL 10: 1041-1048 (1990); .
Mermond et aL, Nature 332: 557-561 (1988);
Gronosta~ski ef al:; Molecular and Cellular Biology 5: 9b4-971 (1985) ;
Hennighausen ef aL, EMBO j. 5: 1367-1371 (198~~. ;
Chodosh et aL, CeII a3: 11-24 (I988)> .
The IVFl protein will bind to an NFl motif or cis element either as a dimer (if the motif is palindromic) or as an single molecule (if the motif is not palindromic). The IVF1 protein is induced by TGF~ (Faisst and Meyer, Nucleic Acid ~ Z0: 3-26 (1992). Sequences correespotiding to an upstream motif or cis element capable of binding ~TFI are set forth in Figure 1 at residues 2923-2938, 4143-4167, and 4886-4900, respectively. in accordance with the embodiments of the present invention, transcription of ~TGR molecules can be effected by agents capable of altering the biochemical properties or concentration of NFl or its homologues, including; but not limited to, the roncentr anon of ~3 or i~
homologues bound to an upstream motif or cis element. 'Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the teeatment of glaucoma.
Conserved regulatory sequences (NF-MHCIIA/B} of a rabbit major histocompatability complex (MHC) class II gene are responsible for binding two 5. ~distlnct nuclear factors NF-MI~iCIIA and NF-MfICIIB and are believed to be - involved in the regulation of coordinate expression of the class II genes -eg. MHC
class II gene in B lymphocytes (Sittisombut Molecular and Cellular Biology 5:
2041 (1988) ) . A sequence corresponding to an NF
MHCIIA/B upstream motif or cis element is set forth in Figure 1 at residues 10~ 2944. In accordance with the embodiments of the present invention, .transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of NF-MHCIIA or NF-MHCITiB or their homologues, including, but not limited to, the concentration of NF-MHCIIA or NF-MHCIIB or 'their homologues bound to an NF-MI-ICIIA/B upstreaan motif or cis element.
Such 15 agents can be used in the study of glaucoma pathogenesis. 1n another embodiment;
such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment 'of glaucoma.
PEA 1 binding motifs or cis elements have been identified (Piette and Yaniv, EMBO j. 5:1331-1337 (198, herein incorporated by reference). The PEAL protein is 20 a transcription factor that is reported to bind to both the polyoma virus and c~'os enhancers A sequence corresponding to an upstream motif or cis element capable of binding PEAL is set forth in Figure 1 at residues 3285-3298. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of 25. PEAL or its homologues, including, but not limited to, the concentration of PEAL or its. homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatnnent of glaucoma.
30 A conserved cis-acting regulatory element (ICS} has been shown to bind traps-acting constituitive nuclear factors present in lymphocytes and fibroblasts which are involved in the interferon ((IFNNj-mediated transcriptional enhancement of MF3C lass I and other genes (Shirayoshi et aL, Proc. Nafl. Acad. Sci. (LISA) 85: 5884-5888 (1988}) .. A sequence corresponding to an ICS ' 3S upstream motif or cis element is set forth in Figure 1 at residues 3688-3699. In accordance with the embodiments of the present invention, transcription .of TIGIt molecules can be effected by agents capab2e of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an ICS
upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in he study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for an ISGF2 upstream motif or cis element has been characterized (Iman ef aL, Nucleic Acids Res.18: 6573~r~80 X1990);
Harada ef aL, CeII 63: 303-312 (1990);
Yu-Lee et aL, Ivlol. CeII Biol. 10: 3087-3094 (1990), Pine et al., MoI. Cell Biol. I0: 32448-2457 (1990) ) ISGF2 is induced by interferon a and 7, prolactin and virus infections. A
sequence corresponding to an upstream motif or cis element capable of binding ~2 is set forth in Figure 1 at residues 4170-4179. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents.~capable of altering the biochemical properties or concentration of ISGF2 or its homologues, including, but not limited to, the concentration of i9GF2 or its homologues bound to an upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the s#udy of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A sequence corresponding to an upstream motif or cis element capable of binding zinc is set forth in Figure 1 at residues 4285-492. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of zinc: Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaurnma.
A sequence corresponding to an upstream motif or cis element characteristic of C:AP/CRP-gal0 is set forth in Figure 1 at residues 4379-4404 (Taniguchi et al:, Proc. Natd. Acad. Sci (LISA) ?6: 5090-5094 (1979 7 - In accordance with the embodiments of the present invention, transcription of ~iG
molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules that bind the CAP/CRP-gal0 upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of giaucroma.
Human transcription factor activator protein 1 (API) is a transcription factor that has been shown to regulate genes, which are highly expressed in transformed cells such as stromelysin, c 'os; al-anti-trypsin and collagenase (Gutman and 4llasxixk, EMBD j. ~:7: 2241-2246 (1990}, herein incorporated by reference;
Martin et al:, Proc. Natl. Acrid. Sri. LISA 85: 5839-5843 (1988), herein incorporated by reference;
Jones et al:, Genes and Development 2: 267-281 (1988) Faissx and Meyer, Nucleic Acid Research 20: 3-26 (1992);
-Kim et aL, Molecular and Cellular Biology I0: 1492-1497 (1990) Baumhueter et al., ~EMBO j. 7: 2485-2493 (19$x8)). The APl transcription factor has been associated with genes that are activated by 12-O-tetradecanolyphorbol-13-acetate (TPA) (Gutman and Wasylyk, EMBO j.7: 2241-2246 (1990)). Sequences corresponding to an upstream motif or cis element capable of binding APl are set forth in Figure 1 at residues 4428-4434 and 4627-4639, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of AP1 or its homologues, including; but not limited to, the concentration of APl or its homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another eraabodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
The sex-determining region of the Y chromosome gene, sry, is expressed in the fetal mouse for a brief period, just prior to testis differentiation SRY
is a DNA
binding protein known to bind to a CACA-rich region in the sry gene (Vriz et aL;
Biochemistry and Molecular Biology International 37: 1137-1146 (1995) ) .
A sequence corresponding~to an upstream motif or cis element capable of binding SRY is set forth in Figure 1 at residues 4625-4634.
In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or ro concentration of SRY or its homologues, including, but not limited to, the concentration of SRY or its homologues bound to an upstream moti# or cis element.
Such agents may be useful in the study of glaucoma pathogenesis. in another embodiment, such agents can also be used in the study of .glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucomae A sequence rnrresponding to arr upstream motif or cis element charaMe~#ic ' of GC2-GH is set forth in Figure 1 at residues 4689-4711 (West ef al., Molecular and Cellular Biology 7: 1193-1197 (1987): ~
accordance with the embodiments of the present invention, transcription of ~'IGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of GC2-GH or its homologues, including; but not limited to, the concentration of GC2-GH or its homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of ;glaucoma prognosis. In another embodiment such agents can be used in thetreatment of glaucoma.
PEA 3 binding motifs or cis elements have been identified (Martin et aL, Prnc.
NatI. Acad. Sci. ltISA) 85: 5839-5843 (1988);
Gutman and Wasylyk, EMBD J. 7: 2241-2246 (1990) ) .
The PEAS protein is a transcription factor that is xeported to interact with APl like proteins (Martin et al., Proc. Nail. Acad. Sci. (11SA) 85: 5839-ai843 (1988);
herein incorporated by reference): Sequences corresponding to an upstreann motif or cis element capable of binding PEAS is set forth in Figure 1 at residues 476'x-4769.
In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of PEA3 or its homologues, including, but not limited to, the concentration of PEA3 or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
in another embodiment such agents can be used in the treatment of glaucoma.
Mammalian interspersed repetitive (MIR) is an element involved in the coding and processing sequences of mammalian genes. The MIR element is at least 260 by in length and numbers about 105 copies within the mammalian gervome (Murnane ef al., Nucleic Aciris Researck 15: ?837-2839 (1995) ) .
A sequence corresponding to an MIR upstream motif or cis element is set forth in Figure 1 at residues 4759-4954. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an Ivi~t upstream motif ~r cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Normal liver and differentiated hepatoma cell lines contain a hepatocyte specific nuclear factor (H~iF-1) which binds cis-acting element equences within the ~.0 promoters of the alpha and beta chains of fibrinogen and alpha 1-antitrypsin (Baumhueter et al.; EMBO j. 8: 2485-2493,- A
sequence corresponding to an HNF-1 upstream motif or cis element is set forth in Figure 1 at residues 4923-4941. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of HNF-1 or its homologues, including, but not limited to, the concentration of HNF-1 or its homologues bound to an HNF-1 upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A number of cis elements or upstream motifs halve been associated with gene regulation by steroid and thyroid hormones {e.g: glucocorticoid and estrogen}(Beato; Cedl 56: 335-344 (1989)' Brent et ut., Molecular Endocrinology 89:1996-2000 (1989}; Glass ef al., Cell 54: 313-323 (1988); Evans, Science 240:
889-895 {1988) ) .
A consensus sequence for a thyroid receptor upstream motif or cis element (TRE} has been characterized (B.eato, CeII 56: 335-344 (1989}, herein incorporated by reference}, A sequence corresponding to a -thyroid receptor upstream motif or cis element is set forth in Figure 1 at residues 5151-5156: Thyroid hornnones are capable of regulating genes containing a thyroid receptor upstream motif or cis element (Glass et al., CedI 54: 313-323 (1988) ) .
Thyroid hormones can negatively regulate TIGR. In accordance with the emiiodiments of the present invention; transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules capable of binding a thyroid receptor upstream motif or cis element.
Such agents can be used in the-study of :giaucocna. pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis:
In another embodiment such agents can be used in the treatment of glaucoma:
NFxB is a transcription factor that is reportedly also~ated with a number of biological processes including T-cell activation and cytokine regulation {Lenardo et aL, CeId 58: 227 229 (1989) ). A consensus upstream motif or cis element capable of binding NFxB has been reported (Lenardo et aL, Neil 58: 227-229 (1989)). Sequences corresponding to an upstream motif or cis element capable of binding NFxB are set forth in Figure 1 at residues ~516b-5175: In accordance with the embodiments of the present invention; transcription of TIER
molecules can be effected by agents capable of altering the biochemical properties or concentration of NFxB or its homologues, including, but not limited to, the concentration of NFxB or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucoma.
Where one or more of the agents is a nucleic acid molecule, such nucleic acid molecule may be sense, antisense or triplex oligonucleotides corresponding to any part of the TIGR promoter, TIGR cDNA, TIGR intron, TIGR axon or TIGR gene.
The TIGR promoter, or fragment thereof; of the present invention may be cloned into a suitable vector and utilized to promote the expression of a marker gene (e.g. firefly luciferase {de Wet, MoI. Cell Baol. 7: ~2'S-737 (1987).
or GUS 9efferson ef aL, EMBO J. a6: 3901-3907 (1987; ~.
25In another embodiment of the present invention, a TIGR promoter may be cloned into a suitable vector and utilized ~o promote the expression of a TIGR gene in a suitable eukaryotic or prokaryotic host cell (e.g. human trabecular cell, Chinese hamster cell, ~. coli). In another embodiment of the present invention, a TIGR promoter may be cloned into a suitable vector and utilized to promote the expression of a homologous or heterologous gene in a suitable eukaryotic or prokaryotic host cells (e.g.
human trabecular cell lines, Chinese hamster cells, ~: coh~.
Practitioners are familiar with the standard resource mater3ais which des~be specific conaitions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, Etc.), generation of recombinant organs and the screening and isolating of c>aa~es, (see for example, Sambrook et al., In MoI~Clo~in~: A Ldboratory Marsual f Cold Sprirvg Harbor Press (1989.;
.Old .and .Primios~e, In Principles of Cane Ivlaxupulation: An lntrflductiQn 'To Ceitetic Engineering, Blackwell (19~94~) .
The ~CxR promoter or any portion thereof of the present invention may be used-in a gel-retardation or band shift assay (Old and Primrose, In Principles of Gene Manipulation: An Introduction To Genetic Engineering, Blackwell (1994)).
Any of the cis elements identified in the -pinvention may be used in a gel-retardation or band shift assay to isolate proteins capable of binding the cis element..
. Suitable D1~A fragments or molecules comprise' or consist ofvone or more of the following: sequences corresponding to ~ an upstream motif or cis element characteristic of PRL-FPlll as set forth in: Figure 1 at residues 370-388, and 4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figured at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in ~.gure 1 at residues 44b-45I, 1288-2293, 3597 X602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600; 1042-1056, 2444-2468, 2442 2269, 2a 3563, 45~~4-4593, 4595-4614, 4851-4865, 4844 4864, 5079-5084, 5083-5111, respectively, a sequence 'corresponding to ~an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an . , ~.
upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues Tf4-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF:1-CS ~s set forth in Figure 1 at residues 843-854, . a , sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1, at . residues 987 1026, a sequence corresponding to an upstream motif or cis element capable of binding fiTF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence odrresponding to an upstream motif or cis element capable of binding Alu as set forth in. Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VEP as set forth in Figure,1 at residues 1786-1797', a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of,binding ERE as set forth in Figure 1 at resiaues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding mutagen as set forth in Figure l at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HST'F as set forth in Figure 1 at residues 2622-2635; and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-IviHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434; and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequenee corresponding to an upstream motif or cis element capable of binding PEAS as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5275:
A preferred class of agents of the present invention comprises nucleic acid molecules wiU encode all or a fragment of "TTGR promoter" or flanking gene sequences. As used herein, the terms "'TIER promoter" or "promoter" is used in an expansive sense to refer to the regulatory sequences) that control mRNA
production: Such sequences include RNA polymerise binding sites, glucocorticoid response elements, enhancers, etc. All such TTGR molecules may be used to diagnose the presence of glaucoma and severity of glaucoma. Such molecules may ' be either DNA or RNA.
Fragment nucleic acid molecules may encode significant portions) of, or indeed most of, SEQ ID N0:1 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5.
Alternatively, the fragments may comprise smaller oligonucleotides (having from about 15 to about 250 nucleotide residues, and more preferably, about 15 to about 30 nucleotide residues.). Such oligonucleotides include SEQ ID N0: 6; SEQ ID NO:
7, SEQ ID NO: 8; SEQ ID NO: 9, SEQ ID N0:10, SEQ ID NO:11, SEQ ID N0:12, SEQ
ID NO: 13, SEQ TD NO: 14; SEQ ID NO: 15, SEQ iD NO: 16, SEQ ID N0:17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22; SEQ ID
NO: 23; SEQ ID NO: 24, SEQ ID NO: 25.
Alternatively such oligonucleotides may derive from either the TIGR
promoter, TIGR introns, TIGR exons, TIGR cDNA and TIGR downstream sequences comprise or consist of one or more of the following: sequences corresponding to an upstream motif or cis element characteristic of PRL-FPI11 as set forth.in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure l at residues 446-451,1288-1293, 3597 3602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600,1042-1056, 2444-2468, 2442-2269, 3536-3563; 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5084, 5083-5111, respectively, a sequence rnrresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a seauence corresponding to an upstream motif or cis element cacable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding FRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding ~ an upstream motif or cis element capable of binding ETF EGFR
as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motaf or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an uvstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832=1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myo-PRF
as set forth in Figure Z at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187; respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622 2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCBA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 465-4634, a sequence corresponding to an upstream motif or _cis element characteristic of GC2 as set forth in Figure 1 at residues 468-4?ll, a sequence coaesponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIIt as set forth in Figure 1 at residues 4T59-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF 1 as set forth in Figure 1 at residues 49?3-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth iw Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues SI66-5175. For such purpose, the oligonucleorides must be capable of specifically hybridizing to a nucleic acid molecule genetically or physically linked to the TTGR gene. As used herein, the term "linked" refers to genetically, physically or . ogerablg linked:
As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic arid structure, whereas they are unable to form a double-stranded structure when incubated with a non TIGR nucleic and molecule. Awucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarity. .As used herein, molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally completrientary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under. at. least conventional "Low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another. under conventional "high-stringency" conditions. Conventional. stringency., conditions are described by Sambrook, j., et al., (In: Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring.Harbor, New York (1989)), and by Haymes, B:D., et al. (In: Nucleic Aciai Hybridization, A Practical Alrproach,1RL Press;
Washington, DC
(1985)) . , Departures from complete complementarity are therefore permissible, as long as such departures do not 35- completely preclude the capacity of the molecules to form a double-stranded structure. Thus, in order for an oligonucleotide to serve as a primer it need only be sufficiently complennentary in sequence to be able to foraz a stable double-stxar~ded struchue under the particular solvent and salt concentrations employed.
Apart from their diagnostic or prognostic uses, such oligonucleotides may be employed to obtain other TIGR nucleic acid molecules. Such molecules include the TIGR-encoding nucleic acid molecule of non-human animals (particularly, cats, monkeys, rodents and dogs), fragments thereof, as well as their promoters and flanking sequences. Such molecules can be readily obtained by using the above described primers to screen cDNA or genomic libraries obtained from non-human species. Methods for forming such libraries are well known in the art. Such analogs may differ in their nucleotide sequences from that of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ II7 NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID N0:12, SEQ ID NO:
13, SEQ ID N0:14, SEQ ID N0:15, SEQ ID N0:16, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or from molecules consisting of sequences corresponding to an upstream motif or cis element characteristic of PRL-Fl'I11 as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451, 1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively; sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600, 1042-1056, 2444-2468, 2442-2269; 3536-3563; 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cas element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS
as set forth in Figure i at residues 843-854, a sequence corresponding o an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding E~'F-EGFE, as set fobth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding .Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively; sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively; a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEA1 as set forth in Figure 1 at residues 3285 3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at xesidues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SIZY as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEAS as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759-4954, a sequence correspoa~ding town upstream motif or cis element capable of binding NF-HIV~i as set forth in Figure 1 at residues 4923-4941; a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a seguence, corresponding to an upstream motif or cis element ca~sable of binding NFKB as set forth in Figure 1 at residues 5166-5175 because complete complementarit~ is not needed for stable hybridization. The TIGR nucleic acid molecules of the present invention therefore also include molecules that, although capable of specifically hybridizing with TIGR nucleic acid molecules may lack .,complete complementarity."
Any of a variety of methods may be used to obtain the above-described nucleic acid molecules (Ellen, Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases.; ~ Humana Press (1996) ). SEQ
ID NO:1, SEø. ID N~ 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: S, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8; SEQ ID NC7: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ
ID N4.12, SEQ ID NO: I3, SEQ ID N0:14, SEQ ID N0:15, SEQ ID NO:16, SEQ ID
NO: I7~; SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO24, SEQ ID NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL FP1II as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress. motif or .cis , element as set forth in Figure 1 at residues 446-451,128&1293, 3597-3602, 4771-4776, arid 5240-5245, respectively, sequences corresponding to glucocorticoid response 25. upstream motif or cis element as set forth in Figure 1-at residues 574 600,1042-1056, 2444-2468, 2442-2263; 3536-3563, 45T4-4593, 4595-4614, 4851-4865, 4844-4864;
5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues ?74-795, a sequence corresponding to an upstream motif or cis element capable of binding ICTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figu>re 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR
as 35~ set forth in Figure 1 at residues 1373-1388; a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-I45b, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues I33I-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 38923896;
respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF
as set forth in Figure I at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5287, respectively, sequences corresponding to an upstream motif or I5 cis element capable of binding I3STF as set forth in Figure 1 at residues 2b22-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues, 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-I as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif ar cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944; a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream.. motif or cas element capable of binding ICS as set forth in Figure I at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 41?0-4179, a sequence corresponding to an upstream motif or cis element capable -of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues. 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4b25-4634, a sequence corresponding to an upstream motif or ca element characteristic of GC2 as set forth in Figure I at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis~ element= capable of -MIR as set forth in Figure 1 at residues 4759-='_ 954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence con~espanding t~ a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NF~cB as set forth in Figure 1 at residues 5166-5175 may be used to synthesize all or any portion of the TIGR
promoter or anx of the TIGR upstream motifs or portions the TIGR cDNA
(Zameclvk et al., Pros. Naft. Acad. Sci. (LLS.A.) 83:4143 (1986); Goodchild et aL, Proc.
NatI. Acad. Sci. (LI:S.A.) 85:55t?~ (1988); Wickstrom et aL; Proc. Natl: Acad.
Sa. (ILS.A.) 85:1028; Holt, j.T. et at., Motec. CeII. Biol. 8:963 (1988); Gervvirtz, A..M.
et al., Science 242:1303 (1988}; Anfossi, G:, et aL, Proc: Natl. Acad. Sci. (LLS:A:) 86:3379 (1989);
Becker, D., et aL, EMBC? J. 8:367'9 (1989)..) .
Automated nucleic and synthesizers may be employed for this purpose. In lieu of such synthesis, the disclosed SEQ ID NO:1, SEQ ID NO: 2; SEQ ID NO: 3, SEQ
ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8; SEQ ID NO:
9, SEQ ID NO: 10r SEQ ID NO:11, SEQ ID N0:12, SEQ ID N0:13, SEQ ID N0:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 1?, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID . NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL-FP111 as set forth in Figure 1 at residues 370-388; and 4502; respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451,128&1293; 3597-3602, 4T~1=4T76, and 5240-5245;
respectively,, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 5?4-600, 1042-105.6, 2444-2468, 2442-2269, 3536-3563, 457'4-45,93, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5~3-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as, set forth in Figure 1 at residues 735-746, a sequence corresponding to _ an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 7?4 795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 9871026, a sequence corresponding to an upstream motif or cis element capable of binding E3'F-fiGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 144?-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure l at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cfs element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure I at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622 2635; and ZO 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938; 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding -ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404;
sequences corresponding to an upstream motif or cis element capable of binaing A.Pl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or crts element capable of binding SRY
as set ffTrttl in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element 5- capable of binding PF.A3 as set forth in Figure ~ 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues.4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 may be used to define a pair of primers that can be used with the polymerase chain reaction (Mullis, K. et al.; Cold Spring Harbor Symp. Quant.
Biol.
5I:263-273 (1986); Erlich H. et al., EP 50,424; EP 84,796, EP 258,017, EP
237,362;
Mullis, K., EP 201,184; Mullis K. ef al., US 4,683,202; Erlich, H., US
of the present invention, transcription of TdGR molecules can be effected by agents capable of altering the biochemical properties or concentration of ~olecules~capable of binding the shear stress motif. Such agents can be used in the study of.
glaucoma pathogenesis. in another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for a glucocorticoid response upstream motif (GRE) or cis element has been characterized (Beato, CeII 56: 335-344 (1989); Beclcer et al:, Nature 324: 686-688 (1986), herein incorporated by reference; Salcai et aL, Genes acrd DeveIoprnent Z: II44-1154 (I988), herein incorporated by reference). Genes containing this upstream motif or cis element are regulated by glucocorticoids, progesterone, androgens and mineral corticoids (Beato, Cel156: 335-344 (1989)). .
Sequences corresponding to glucocorticoid response upstream 'motif or cis element are set forth in Figure 1 at residues 574-600,1042-1055, 2444-2468, 2442-?369, 3563, 4574-4593, 4595-4b14, 4851-4865; 4844-4864, 5079 X084; and 5083-5111, respectively. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of al#ering the biochemical properties or concentration of molecules capable of binding a glucocorticoid response upstream motif or cis element. ~5uch agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such ag~nfs can be used in the treatment of glaucoma.
A sequence specific binding site (CBE) for the wild type nuclear phosphoprotein, p53, has been identified and appears to be ~ associated with replication origins (Kern et aI. Science 252: 1708-1711 (1991~))~
A sequence rnrresponding to an C8E upstream motif or cis element is set forth in Figure 1 at residues 735-74b. In accordance with the embadunents of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or eoncentration of p53 or its homologues, including, but not limited to, the concentration of p53. or its homologues bound to an CBE upstream motif or cis element. Such agents can be used in the study of glaucoma pathogene..~is. in another embodiment, such agents can also be used in the studg of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaurnma.
Nuclear factor ets-like (NFE); a transcriptional activator that facilitates p50 and c-Rel-dependent IgH 3' enhancer activit~r has been shown to bind to an NFE
site in the Rel-dependent IgH 3' er~han~r (Linderson et aL; European j. lrnmunoiogy 27:
468-475 (199~.j . A sequence corresponding to an NF'E upstream motif or cis element is set forth in Figure, l at residues 774-795. In accordance with the embodi~atents of the present invention, transcription of TIGR
molecules. can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an NFE
upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
An upstream motif or cis element (K'TF.1-CS) for a control element 3' to the human keratin 1 gene that regulates cell type and differentiation-specific expression has been identified (Huff et al., J. Biological Chemistry 268: 377 3$4 (1993) ) .
A sequence corresponding to an upstream motif or cis element characteristic of KTF.I-CS is set forth in Figure 1 at residues 843-854: In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected bx agents capable of altering the biochemical prorperties or concentration of KTF.1-CS or its homologues, including, but not limited to, the concentration of K'TF.I-CS. or its homologues bound to a KTF.1-CS upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis.
In another embodiment, such agents can also be used ~in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A progesterone responsive element (PRE) that maps to the far upstream steroid dependent DNase hypersensitive site of chicken lysozyme chromatin has been characterized (Hecht et aL, EMBO J. 7:2063-2073 (1988).:) .
The element confers hormonal regulation to a heterologous promoter and is composed of a cluster of progesterone receptor binding sites. A
sequence corresponding to an ups~irearn motif or cis element characteristic of P~ is set forth in Figure 1 at residues 987-1026. In accordance with the embodiments of the present invention, transcription of TiGR molecules can be effected by agent capable of altering the biochemical properties or concentrati~ri of molecules capable of binding a progesterone responsive PRE upstream motif or cis.element. Such agents may be useful in the study of glaucoma pathogenesis: In another e~bodia~ent, such agents can also be used in the study of giaurnma prognosis. In another eriibodiment such agents cain be used in the treatment of glaucoma.
A sequence (ETP-EGFR) has been characterized which serves as a motif ~'ror a traps-active transcription factor that regulates expression of the epidermal growth factor receptor (Regec et al., Blood 85:2711-2719 (199'a~):
A sequence corresponding to an ETF-EGFR upstream motif or cis element is set forth in Figure 1 at residues 1373-1388. In accordance v~ith the embodiments of the present invention, transcription of 'T1GR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an ETF-EGFR upstream motif or~cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A common traps-acting factor (SRE-cFos) has been shown to regulate skeletal and cardiac alpha-Actin gene transcription in muscle (A~Iuscat ef al.;
Molecular and Cellular Biology 10: 4120-4133 (1988)) - A sequence corresponding to an SRE-cFos upstream motif or cis element is set forth in figure 1 at residues 1447-1456. In accordance with the embodiments of the present invention, transcription of TiGR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear 'factors or their homologues bound to an SRE-cFos upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prQ~osis. In another~embodiment such agents can be used in the treatment of ~giaumma.
Alu repetitive elements are unique to primates and are interspersed within the human genome with an average spacing of 4Kb. While some Alu sequences are actively transcribed bx polymerase III; normal transcripts may also contain Alu derived sequences in 5' or 3' untranslated regions (Jurka and Mikahanljaia, J:
MoI.
Evolution 32: 105-121 (1991j, Claveria and Makalowski, Nature 3~I: 251-752 (1994)?, A
sequence corresponding to an Alu upstream motif or Gis element is set forth in Figure 1 at residues 1331-1550. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues. bound to an Alu upstream motif or cis element. Such agents can be used in the study of glaueoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for a vitellogenin gene-binding protein (VBP) upstream motif or cis element has been characterized (Iyer et aL, Molecular and Cellular Biology T 1: 4863-48?5 (1991)x. Expression of the VBP gene commences early in liver ontogeny and is not subject to circadian control. A sequence corresponding to an upstream motaf or cIS element capable of binding VBP is set forth in Figure 1 at residues 1?86-1797. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of VBP or its homologues, including, but not limited to, the concentration of VBP
or its homologues bound to an VBP upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A structural motif (Malt-CS) or cis element involved in the -activation of all promoters of the maltose operons in Escherichia toll and KlebsieIIa pneunwniae has been characterized (Vidal-Ingigliardi et aL, J. Mol: Biol. 2I8: 323-334 (1991),x, A sequence corresponding to a upstream Malt-CS motif or crs element is set forth in Figure 1 at residues 1832-1841. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules capable of binding the upstream Malt-CS motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. in another embooiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such.agents can be used in the treatment of glaurnma.
A consensus sequence for an estrogen receptor upstream motif or cis ele;nent has been characterized (ERE) (Forman ef al., MoI. ~ndocri»olagy 4: 1293-2301 (199U) ;
de Verneuii et aL, Nucleic Acid Res. 38: 4489-4497 (1990), herein incorporated by refs; Gaub ef aL, Cell'63:1~67 176 (19900:
A sequence corresponding to half an upstream motif or cis element capable of binding estrogen receptor is set forth in Figure 1 at residues 2166-2195, 3413-3429, and 3892-3896, respectively. In accordance with the embodiments of the present invention, transcription of TTGR molecules can be effected b~ agents capable of altering the biochemical properties or concentration, of the estrogen receptor or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment; such agents can also be used in the study of .glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucoma.
Certain proteiirbinding sites (NF mutagen) in Ig gene enhancers which determine transcriptional activity and induc~ility have been shown to interact with nuclear factors (Lenardo et aL, Science X236:1573-1'577 (198Tj ) .
A sequence corresponding to an NF mutagen upstream motif or cis element is set forth in Figure 1 at residues 2329-2338. In accordance with the embodiments of the present invention, transcription of TTGR molecules van be effected by agents capable of altering the biochemical propertses or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an NF-mutagen ups#ream motif or cis element. Such agents can be used lm the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents carp be used in the trea#~nent of glaucoma.
A consensus sequence for a transcriptional repressor of c-myc ~~(myc-PRF) upstream motif or cis element has been identified (ICalckis.et al., Nature 339: 718-719 (3989)) , Myc-PRF interacts wig another widely ' v distributed protein, myc-CFl (comalon factor 1), which binds nearby and this 3'~ association may be important in myc-PRF repression A sequence corresponding to w 1,6 an upstream motif or cis element capable of binding myc-PRF is set forth in Figure 1 at residues 2403-241b. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of myc-PRF or its homologues, including, but not limited to, the concentration of myc-PRF or its homologues bound to an mxc-PRF upsfream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. . In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can'be used in the treatment of glaucoma.
Human transcription factor activator protein 2 (AP2) is a transcription factor that has been shown to bind to Spl, nuclear factor 1 (NFl) and simian virus 40 transplantation (SV40 T) antigen binding sites. It is developmentally regulated (Williams and Tijan, Gene Dev. 5: 670-682 (1991);
Mitchell et aL, Genes Dea. 5: 105-7:19 (1991); Coubois ef al., Nucleic Acid Researcls I8: 57-64 (1990); Comb et al., NucI'eic Acid Research I8: 39?5 3982 (1990);
Winings et aL, Nucleic Acid Research I9: 3709 3714 (1991) ) .
Sequences ~rresponding to an upstream motif or cis element capable of binding AP2 are set forth in Figure 1 at residues 2520-2535, and '5170-5187, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effecfied by agents capable of altering.the biochemical properties or concentration of AP2 or its homologues, including, but not limited to, the concentration of AP2 or its homologues bound to an upstream motif or cis element. Such agents may be useful in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Drosophila RNA polymerase II heat shock transcription factor (I~STF) is a transcription factor that has been shown to be required for active transcription of an hsp 70 gene (Parker and Topoi, CeII 37:. 273-283 (1984) ) .
vequences corresponding to an upstream motif or cis element capable of binding HSTF .are set forth in Figure 1 at residues 2622-2635, and 5105-SI32.
In accordance with the embodiments of the present invention, transcription of TIGR
f molecules can be effected by agents capable of altering the biochemical properties or concentration of HSTF or its homologues, including, but not limited to, the concentration of I~ or its homologues bound to an ~STF upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of . glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma. ~ w A sequence corresponding to an upstream motif or cis element characteristic of SBF is set forth in Figure 1 at residues 2733-2743 (Shore et al., I:MBO j.
t;: 461-467 (1987)). In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biocheaucal properties or concentration of molecules that bind the SBF upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
IS An NFl motif or cis element has been identified which recognizes a family of at least six proteins (Courtois, ef aL, Nucleic Acid Res. 18: 57-64 tI990);
Mul et aL, j. Virol. b4: X510=6518 (1990);
Rossi et al., Cell 52: 405-414 (1988) ;
Gounari et al., EMBO j. L0: 559-5b6 (1990);
Goyal et aL, MoI. Cell BioL 10: 1041-1048 (1990); .
Mermond et aL, Nature 332: 557-561 (1988);
Gronosta~ski ef al:; Molecular and Cellular Biology 5: 9b4-971 (1985) ;
Hennighausen ef aL, EMBO j. 5: 1367-1371 (198~~. ;
Chodosh et aL, CeII a3: 11-24 (I988)> .
The IVFl protein will bind to an NFl motif or cis element either as a dimer (if the motif is palindromic) or as an single molecule (if the motif is not palindromic). The IVF1 protein is induced by TGF~ (Faisst and Meyer, Nucleic Acid ~ Z0: 3-26 (1992). Sequences correespotiding to an upstream motif or cis element capable of binding ~TFI are set forth in Figure 1 at residues 2923-2938, 4143-4167, and 4886-4900, respectively. in accordance with the embodiments of the present invention, transcription of ~TGR molecules can be effected by agents capable of altering the biochemical properties or concentration of NFl or its homologues, including; but not limited to, the roncentr anon of ~3 or i~
homologues bound to an upstream motif or cis element. 'Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the teeatment of glaucoma.
Conserved regulatory sequences (NF-MHCIIA/B} of a rabbit major histocompatability complex (MHC) class II gene are responsible for binding two 5. ~distlnct nuclear factors NF-MI~iCIIA and NF-MfICIIB and are believed to be - involved in the regulation of coordinate expression of the class II genes -eg. MHC
class II gene in B lymphocytes (Sittisombut Molecular and Cellular Biology 5:
2041 (1988) ) . A sequence corresponding to an NF
MHCIIA/B upstream motif or cis element is set forth in Figure 1 at residues 10~ 2944. In accordance with the embodiments of the present invention, .transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of NF-MHCIIA or NF-MHCITiB or their homologues, including, but not limited to, the concentration of NF-MHCIIA or NF-MHCIIB or 'their homologues bound to an NF-MI-ICIIA/B upstreaan motif or cis element.
Such 15 agents can be used in the study of glaucoma pathogenesis. 1n another embodiment;
such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment 'of glaucoma.
PEA 1 binding motifs or cis elements have been identified (Piette and Yaniv, EMBO j. 5:1331-1337 (198, herein incorporated by reference). The PEAL protein is 20 a transcription factor that is reported to bind to both the polyoma virus and c~'os enhancers A sequence corresponding to an upstream motif or cis element capable of binding PEAL is set forth in Figure 1 at residues 3285-3298. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of 25. PEAL or its homologues, including, but not limited to, the concentration of PEAL or its. homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatnnent of glaucoma.
30 A conserved cis-acting regulatory element (ICS} has been shown to bind traps-acting constituitive nuclear factors present in lymphocytes and fibroblasts which are involved in the interferon ((IFNNj-mediated transcriptional enhancement of MF3C lass I and other genes (Shirayoshi et aL, Proc. Nafl. Acad. Sci. (LISA) 85: 5884-5888 (1988}) .. A sequence corresponding to an ICS ' 3S upstream motif or cis element is set forth in Figure 1 at residues 3688-3699. In accordance with the embodiments of the present invention, transcription .of TIGIt molecules can be effected by agents capab2e of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an ICS
upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in he study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for an ISGF2 upstream motif or cis element has been characterized (Iman ef aL, Nucleic Acids Res.18: 6573~r~80 X1990);
Harada ef aL, CeII 63: 303-312 (1990);
Yu-Lee et aL, Ivlol. CeII Biol. 10: 3087-3094 (1990), Pine et al., MoI. Cell Biol. I0: 32448-2457 (1990) ) ISGF2 is induced by interferon a and 7, prolactin and virus infections. A
sequence corresponding to an upstream motif or cis element capable of binding ~2 is set forth in Figure 1 at residues 4170-4179. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents.~capable of altering the biochemical properties or concentration of ISGF2 or its homologues, including, but not limited to, the concentration of i9GF2 or its homologues bound to an upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the s#udy of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A sequence corresponding to an upstream motif or cis element capable of binding zinc is set forth in Figure 1 at residues 4285-492. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of zinc: Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaurnma.
A sequence corresponding to an upstream motif or cis element characteristic of C:AP/CRP-gal0 is set forth in Figure 1 at residues 4379-4404 (Taniguchi et al:, Proc. Natd. Acad. Sci (LISA) ?6: 5090-5094 (1979 7 - In accordance with the embodiments of the present invention, transcription of ~iG
molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules that bind the CAP/CRP-gal0 upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of giaucroma.
Human transcription factor activator protein 1 (API) is a transcription factor that has been shown to regulate genes, which are highly expressed in transformed cells such as stromelysin, c 'os; al-anti-trypsin and collagenase (Gutman and 4llasxixk, EMBD j. ~:7: 2241-2246 (1990}, herein incorporated by reference;
Martin et al:, Proc. Natl. Acrid. Sri. LISA 85: 5839-5843 (1988), herein incorporated by reference;
Jones et al:, Genes and Development 2: 267-281 (1988) Faissx and Meyer, Nucleic Acid Research 20: 3-26 (1992);
-Kim et aL, Molecular and Cellular Biology I0: 1492-1497 (1990) Baumhueter et al., ~EMBO j. 7: 2485-2493 (19$x8)). The APl transcription factor has been associated with genes that are activated by 12-O-tetradecanolyphorbol-13-acetate (TPA) (Gutman and Wasylyk, EMBO j.7: 2241-2246 (1990)). Sequences corresponding to an upstream motif or cis element capable of binding APl are set forth in Figure 1 at residues 4428-4434 and 4627-4639, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of AP1 or its homologues, including; but not limited to, the concentration of APl or its homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another eraabodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
The sex-determining region of the Y chromosome gene, sry, is expressed in the fetal mouse for a brief period, just prior to testis differentiation SRY
is a DNA
binding protein known to bind to a CACA-rich region in the sry gene (Vriz et aL;
Biochemistry and Molecular Biology International 37: 1137-1146 (1995) ) .
A sequence corresponding~to an upstream motif or cis element capable of binding SRY is set forth in Figure 1 at residues 4625-4634.
In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or ro concentration of SRY or its homologues, including, but not limited to, the concentration of SRY or its homologues bound to an upstream moti# or cis element.
Such agents may be useful in the study of glaucoma pathogenesis. in another embodiment, such agents can also be used in the study of .glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucomae A sequence rnrresponding to arr upstream motif or cis element charaMe~#ic ' of GC2-GH is set forth in Figure 1 at residues 4689-4711 (West ef al., Molecular and Cellular Biology 7: 1193-1197 (1987): ~
accordance with the embodiments of the present invention, transcription of ~'IGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of GC2-GH or its homologues, including; but not limited to, the concentration of GC2-GH or its homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of ;glaucoma prognosis. In another embodiment such agents can be used in thetreatment of glaucoma.
PEA 3 binding motifs or cis elements have been identified (Martin et aL, Prnc.
NatI. Acad. Sci. ltISA) 85: 5839-5843 (1988);
Gutman and Wasylyk, EMBD J. 7: 2241-2246 (1990) ) .
The PEAS protein is a transcription factor that is xeported to interact with APl like proteins (Martin et al., Proc. Nail. Acad. Sci. (11SA) 85: 5839-ai843 (1988);
herein incorporated by reference): Sequences corresponding to an upstreann motif or cis element capable of binding PEAS is set forth in Figure 1 at residues 476'x-4769.
In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of PEA3 or its homologues, including, but not limited to, the concentration of PEA3 or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
in another embodiment such agents can be used in the treatment of glaucoma.
Mammalian interspersed repetitive (MIR) is an element involved in the coding and processing sequences of mammalian genes. The MIR element is at least 260 by in length and numbers about 105 copies within the mammalian gervome (Murnane ef al., Nucleic Aciris Researck 15: ?837-2839 (1995) ) .
A sequence corresponding to an MIR upstream motif or cis element is set forth in Figure 1 at residues 4759-4954. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an Ivi~t upstream motif ~r cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Normal liver and differentiated hepatoma cell lines contain a hepatocyte specific nuclear factor (H~iF-1) which binds cis-acting element equences within the ~.0 promoters of the alpha and beta chains of fibrinogen and alpha 1-antitrypsin (Baumhueter et al.; EMBO j. 8: 2485-2493,- A
sequence corresponding to an HNF-1 upstream motif or cis element is set forth in Figure 1 at residues 4923-4941. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of HNF-1 or its homologues, including, but not limited to, the concentration of HNF-1 or its homologues bound to an HNF-1 upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A number of cis elements or upstream motifs halve been associated with gene regulation by steroid and thyroid hormones {e.g: glucocorticoid and estrogen}(Beato; Cedl 56: 335-344 (1989)' Brent et ut., Molecular Endocrinology 89:1996-2000 (1989}; Glass ef al., Cell 54: 313-323 (1988); Evans, Science 240:
889-895 {1988) ) .
A consensus sequence for a thyroid receptor upstream motif or cis element (TRE} has been characterized (B.eato, CeII 56: 335-344 (1989}, herein incorporated by reference}, A sequence corresponding to a -thyroid receptor upstream motif or cis element is set forth in Figure 1 at residues 5151-5156: Thyroid hornnones are capable of regulating genes containing a thyroid receptor upstream motif or cis element (Glass et al., CedI 54: 313-323 (1988) ) .
Thyroid hormones can negatively regulate TIGR. In accordance with the emiiodiments of the present invention; transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules capable of binding a thyroid receptor upstream motif or cis element.
Such agents can be used in the-study of :giaucocna. pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis:
In another embodiment such agents can be used in the treatment of glaucoma:
NFxB is a transcription factor that is reportedly also~ated with a number of biological processes including T-cell activation and cytokine regulation {Lenardo et aL, CeId 58: 227 229 (1989) ). A consensus upstream motif or cis element capable of binding NFxB has been reported (Lenardo et aL, Neil 58: 227-229 (1989)). Sequences corresponding to an upstream motif or cis element capable of binding NFxB are set forth in Figure 1 at residues ~516b-5175: In accordance with the embodiments of the present invention; transcription of TIER
molecules can be effected by agents capable of altering the biochemical properties or concentration of NFxB or its homologues, including, but not limited to, the concentration of NFxB or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucoma.
Where one or more of the agents is a nucleic acid molecule, such nucleic acid molecule may be sense, antisense or triplex oligonucleotides corresponding to any part of the TIGR promoter, TIGR cDNA, TIGR intron, TIGR axon or TIGR gene.
The TIGR promoter, or fragment thereof; of the present invention may be cloned into a suitable vector and utilized to promote the expression of a marker gene (e.g. firefly luciferase {de Wet, MoI. Cell Baol. 7: ~2'S-737 (1987).
or GUS 9efferson ef aL, EMBO J. a6: 3901-3907 (1987; ~.
25In another embodiment of the present invention, a TIGR promoter may be cloned into a suitable vector and utilized ~o promote the expression of a TIGR gene in a suitable eukaryotic or prokaryotic host cell (e.g. human trabecular cell, Chinese hamster cell, ~. coli). In another embodiment of the present invention, a TIGR promoter may be cloned into a suitable vector and utilized to promote the expression of a homologous or heterologous gene in a suitable eukaryotic or prokaryotic host cells (e.g.
human trabecular cell lines, Chinese hamster cells, ~: coh~.
Practitioners are familiar with the standard resource mater3ais which des~be specific conaitions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, Etc.), generation of recombinant organs and the screening and isolating of c>aa~es, (see for example, Sambrook et al., In MoI~Clo~in~: A Ldboratory Marsual f Cold Sprirvg Harbor Press (1989.;
.Old .and .Primios~e, In Principles of Cane Ivlaxupulation: An lntrflductiQn 'To Ceitetic Engineering, Blackwell (19~94~) .
The ~CxR promoter or any portion thereof of the present invention may be used-in a gel-retardation or band shift assay (Old and Primrose, In Principles of Gene Manipulation: An Introduction To Genetic Engineering, Blackwell (1994)).
Any of the cis elements identified in the -pinvention may be used in a gel-retardation or band shift assay to isolate proteins capable of binding the cis element..
. Suitable D1~A fragments or molecules comprise' or consist ofvone or more of the following: sequences corresponding to ~ an upstream motif or cis element characteristic of PRL-FPlll as set forth in: Figure 1 at residues 370-388, and 4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figured at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in ~.gure 1 at residues 44b-45I, 1288-2293, 3597 X602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600; 1042-1056, 2444-2468, 2442 2269, 2a 3563, 45~~4-4593, 4595-4614, 4851-4865, 4844 4864, 5079-5084, 5083-5111, respectively, a sequence 'corresponding to ~an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an . , ~.
upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues Tf4-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF:1-CS ~s set forth in Figure 1 at residues 843-854, . a , sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1, at . residues 987 1026, a sequence corresponding to an upstream motif or cis element capable of binding fiTF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence odrresponding to an upstream motif or cis element capable of binding Alu as set forth in. Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VEP as set forth in Figure,1 at residues 1786-1797', a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of,binding ERE as set forth in Figure 1 at resiaues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding mutagen as set forth in Figure l at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HST'F as set forth in Figure 1 at residues 2622-2635; and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-IviHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434; and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequenee corresponding to an upstream motif or cis element capable of binding PEAS as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5275:
A preferred class of agents of the present invention comprises nucleic acid molecules wiU encode all or a fragment of "TTGR promoter" or flanking gene sequences. As used herein, the terms "'TIER promoter" or "promoter" is used in an expansive sense to refer to the regulatory sequences) that control mRNA
production: Such sequences include RNA polymerise binding sites, glucocorticoid response elements, enhancers, etc. All such TTGR molecules may be used to diagnose the presence of glaucoma and severity of glaucoma. Such molecules may ' be either DNA or RNA.
Fragment nucleic acid molecules may encode significant portions) of, or indeed most of, SEQ ID N0:1 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5.
Alternatively, the fragments may comprise smaller oligonucleotides (having from about 15 to about 250 nucleotide residues, and more preferably, about 15 to about 30 nucleotide residues.). Such oligonucleotides include SEQ ID N0: 6; SEQ ID NO:
7, SEQ ID NO: 8; SEQ ID NO: 9, SEQ ID N0:10, SEQ ID NO:11, SEQ ID N0:12, SEQ
ID NO: 13, SEQ TD NO: 14; SEQ ID NO: 15, SEQ iD NO: 16, SEQ ID N0:17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22; SEQ ID
NO: 23; SEQ ID NO: 24, SEQ ID NO: 25.
Alternatively such oligonucleotides may derive from either the TIGR
promoter, TIGR introns, TIGR exons, TIGR cDNA and TIGR downstream sequences comprise or consist of one or more of the following: sequences corresponding to an upstream motif or cis element characteristic of PRL-FPI11 as set forth.in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure l at residues 446-451,1288-1293, 3597 3602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600,1042-1056, 2444-2468, 2442-2269, 3536-3563; 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5084, 5083-5111, respectively, a sequence rnrresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a seauence corresponding to an upstream motif or cis element cacable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding FRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding ~ an upstream motif or cis element capable of binding ETF EGFR
as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motaf or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an uvstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832=1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myo-PRF
as set forth in Figure Z at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187; respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622 2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCBA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 465-4634, a sequence corresponding to an upstream motif or _cis element characteristic of GC2 as set forth in Figure 1 at residues 468-4?ll, a sequence coaesponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIIt as set forth in Figure 1 at residues 4T59-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF 1 as set forth in Figure 1 at residues 49?3-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth iw Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues SI66-5175. For such purpose, the oligonucleorides must be capable of specifically hybridizing to a nucleic acid molecule genetically or physically linked to the TTGR gene. As used herein, the term "linked" refers to genetically, physically or . ogerablg linked:
As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic arid structure, whereas they are unable to form a double-stranded structure when incubated with a non TIGR nucleic and molecule. Awucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarity. .As used herein, molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally completrientary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under. at. least conventional "Low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another. under conventional "high-stringency" conditions. Conventional. stringency., conditions are described by Sambrook, j., et al., (In: Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring.Harbor, New York (1989)), and by Haymes, B:D., et al. (In: Nucleic Aciai Hybridization, A Practical Alrproach,1RL Press;
Washington, DC
(1985)) . , Departures from complete complementarity are therefore permissible, as long as such departures do not 35- completely preclude the capacity of the molecules to form a double-stranded structure. Thus, in order for an oligonucleotide to serve as a primer it need only be sufficiently complennentary in sequence to be able to foraz a stable double-stxar~ded struchue under the particular solvent and salt concentrations employed.
Apart from their diagnostic or prognostic uses, such oligonucleotides may be employed to obtain other TIGR nucleic acid molecules. Such molecules include the TIGR-encoding nucleic acid molecule of non-human animals (particularly, cats, monkeys, rodents and dogs), fragments thereof, as well as their promoters and flanking sequences. Such molecules can be readily obtained by using the above described primers to screen cDNA or genomic libraries obtained from non-human species. Methods for forming such libraries are well known in the art. Such analogs may differ in their nucleotide sequences from that of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ II7 NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID N0:12, SEQ ID NO:
13, SEQ ID N0:14, SEQ ID N0:15, SEQ ID N0:16, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or from molecules consisting of sequences corresponding to an upstream motif or cis element characteristic of PRL-Fl'I11 as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451, 1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively; sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600, 1042-1056, 2444-2468, 2442-2269; 3536-3563; 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cas element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS
as set forth in Figure i at residues 843-854, a sequence corresponding o an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding E~'F-EGFE, as set fobth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding .Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively; sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively; a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEA1 as set forth in Figure 1 at residues 3285 3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at xesidues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SIZY as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEAS as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759-4954, a sequence correspoa~ding town upstream motif or cis element capable of binding NF-HIV~i as set forth in Figure 1 at residues 4923-4941; a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a seguence, corresponding to an upstream motif or cis element ca~sable of binding NFKB as set forth in Figure 1 at residues 5166-5175 because complete complementarit~ is not needed for stable hybridization. The TIGR nucleic acid molecules of the present invention therefore also include molecules that, although capable of specifically hybridizing with TIGR nucleic acid molecules may lack .,complete complementarity."
Any of a variety of methods may be used to obtain the above-described nucleic acid molecules (Ellen, Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases.; ~ Humana Press (1996) ). SEQ
ID NO:1, SEø. ID N~ 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: S, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8; SEQ ID NC7: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ
ID N4.12, SEQ ID NO: I3, SEQ ID N0:14, SEQ ID N0:15, SEQ ID NO:16, SEQ ID
NO: I7~; SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO24, SEQ ID NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL FP1II as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress. motif or .cis , element as set forth in Figure 1 at residues 446-451,128&1293, 3597-3602, 4771-4776, arid 5240-5245, respectively, sequences corresponding to glucocorticoid response 25. upstream motif or cis element as set forth in Figure 1-at residues 574 600,1042-1056, 2444-2468, 2442-2263; 3536-3563, 45T4-4593, 4595-4614, 4851-4865, 4844-4864;
5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues ?74-795, a sequence corresponding to an upstream motif or cis element capable of binding ICTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figu>re 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR
as 35~ set forth in Figure 1 at residues 1373-1388; a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-I45b, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues I33I-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 38923896;
respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF
as set forth in Figure I at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5287, respectively, sequences corresponding to an upstream motif or I5 cis element capable of binding I3STF as set forth in Figure 1 at residues 2b22-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues, 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-I as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif ar cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944; a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream.. motif or cas element capable of binding ICS as set forth in Figure I at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 41?0-4179, a sequence corresponding to an upstream motif or cis element capable -of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues. 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4b25-4634, a sequence corresponding to an upstream motif or ca element characteristic of GC2 as set forth in Figure I at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis~ element= capable of -MIR as set forth in Figure 1 at residues 4759-='_ 954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence con~espanding t~ a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NF~cB as set forth in Figure 1 at residues 5166-5175 may be used to synthesize all or any portion of the TIGR
promoter or anx of the TIGR upstream motifs or portions the TIGR cDNA
(Zameclvk et al., Pros. Naft. Acad. Sci. (LLS.A.) 83:4143 (1986); Goodchild et aL, Proc.
NatI. Acad. Sci. (LI:S.A.) 85:55t?~ (1988); Wickstrom et aL; Proc. Natl: Acad.
Sa. (ILS.A.) 85:1028; Holt, j.T. et at., Motec. CeII. Biol. 8:963 (1988); Gervvirtz, A..M.
et al., Science 242:1303 (1988}; Anfossi, G:, et aL, Proc: Natl. Acad. Sci. (LLS:A:) 86:3379 (1989);
Becker, D., et aL, EMBC? J. 8:367'9 (1989)..) .
Automated nucleic and synthesizers may be employed for this purpose. In lieu of such synthesis, the disclosed SEQ ID NO:1, SEQ ID NO: 2; SEQ ID NO: 3, SEQ
ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8; SEQ ID NO:
9, SEQ ID NO: 10r SEQ ID NO:11, SEQ ID N0:12, SEQ ID N0:13, SEQ ID N0:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 1?, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID . NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL-FP111 as set forth in Figure 1 at residues 370-388; and 4502; respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451,128&1293; 3597-3602, 4T~1=4T76, and 5240-5245;
respectively,, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 5?4-600, 1042-105.6, 2444-2468, 2442-2269, 3536-3563, 457'4-45,93, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5~3-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as, set forth in Figure 1 at residues 735-746, a sequence corresponding to _ an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 7?4 795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 9871026, a sequence corresponding to an upstream motif or cis element capable of binding E3'F-fiGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 144?-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure l at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cfs element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure I at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622 2635; and ZO 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938; 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding -ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404;
sequences corresponding to an upstream motif or cis element capable of binaing A.Pl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or crts element capable of binding SRY
as set ffTrttl in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element 5- capable of binding PF.A3 as set forth in Figure ~ 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues.4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 may be used to define a pair of primers that can be used with the polymerase chain reaction (Mullis, K. et al.; Cold Spring Harbor Symp. Quant.
Biol.
5I:263-273 (1986); Erlich H. et al., EP 50,424; EP 84,796, EP 258,017, EP
237,362;
Mullis, K., EP 201,184; Mullis K. ef al., US 4,683,202; Erlich, H., US
4,582,788; and Saiki, R et aly US 4,683,194)) to amplify and obtain any desired TIGR gene DNA
molecule or fragment.
The TIGR promoter sequences} and TIGR flanking sequences can also be obtained by incubating oligonucleotide probes of TIGR oligonucleotides with 2t~ members of genomic human libraries and recovering clones that hybridize to the probes. In a second embodiment, methods of "chromosome walking," or 3' or 5°
RACE may be used (Frohman, M.A. et aL, Proc. Natl. Acad. Sci. (I,LS.A.) 85:8998-9002 (1988}; ~ Ohara, O: ef al., Proc. Natl. Acad. Sci.
(LLS.A.) 86:5673-5677 (1989)) to obtain such sequences.
IL Uses of the Molecules of the Invention in the Diagnosis and Prognosis of Glaucoma and Related Diseases A particularly desired use of the present invention relates to the diagnosis of glaucoma, POAG, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. Another particularly desired use of the present invention relates to the prognosis of glaucoma, POAG, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. As used Herein the term "glaucoma" includes both primary glaucomas, secondary glaucomas; juvenile glaucomas, congenital glaucomas, and familial glaucomas, including, without limitation, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases: As indicated above, methods for diagnosing or prognosing glaucoma suffer from inaccuracy, or require multiple examinations. The molecules of the present invention may be used to define superior assays for glaucoma. Quite apart from such usage, the molecules of the present invention may be used to dia~wsis or predict an individual's sensitivity to elevated intraocular pressure upon administration of steroids such as glucornrtimids or corticosteroids, or anti-inflammatory steroids):
Dexamethasone;
cortisol and prednisolone are preferred steroids for this purpose. Medical conditions such as inflammatory and allergic disorders, as deli as organ ~a~plantation recipients, benefit from treatment with glucocorticoids. Certain individuals exhibit an increased sensitivity to such steroids (i.e., "steroid sensitivity"), which is manifested by an undesired increase in intraocular pressure.
The present invention may be employed to diagnosis or predict such sensitivity, as well as glaucoma and related diseases.
In a first embodiment, the TIGR molecules of the present invention are used to determine whether an individual has a mutation affecting the level (i.e., the concentration of TIGR mRNA or protein in a sample, etc.) or pattern (i.e., the kinetics of expression; rate of decomposition, stability profile, etc.) of the TIGR
expression (collectively, the °"TIGR response" of a cell or bodily fluid) (for example;
a mutation in the TIGR gene, or in a regulatory regions) or other genes) that control or affect the expression of TIGR), and being predictive of individuals who would be predisposed to glaucoma (prognosis), related diseases, or steroid sensitivity. As used herein, the TIGR response manifested by a cell or bodily fluid is said to be "altered" if it differs from the TIER response of cells or of bodily fluids of normal individuals. Such alteration may be manifested by either abnormally increased or abnormally diminished TIGR response. To determine whether a TIER
response is altered, the TIGR response manifested by the cell or bodily fluid of .the patient is compared with that of a similar cell sample (or bodily fluid sample) of normal individuals. As will be appreciated, it is not necessary to re-determine the TIGR response of the cell sample (or bodily fluid sample) of normal individuals each time such a comparison is made; rather, the TIGR response of a particular individual may be compared with previously obtained values of normal individuals.
In one sub-embodiment, such an analysis is conducted by determining the presence and/or identity of polymorphism(s) in the TIGR gene or its flanking regions which are associated with glaucoma, or a predisposition (prognosis) to glaucoma, related diseases, or steroid sensitivity. As used herein, the term "TIER
flanking regions" refers to those regions which are located either upstream or downstream of the TIGR coding region.
Any of a variety of molecules can be used to identify such polymorphism(s).
In one embodiment, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ
ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ II7 NO: 24, SEQ ID NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL-FPlli as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-X45, sequences corresponding to an upstream spar stress motif or cis element as set forth in Figure Z at residues 451, 1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively, sequences rnrresponding to glucocorticoid response upstream motif or cis element as set forth in Figure l at residues 574-600, 1042-1056, 2444-2468, 2442 2269, 3536-3563, 4593, 4595:4614, 4851-4865, 4844-4864; 5079-5084, 5083-S1I1; respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure I at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding ICTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure I
at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure I at residues 1447-1456, a sequence coaesponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-I550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS
as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429; and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding .
HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth fn Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding IeTF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAI as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS
as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAl'/CRl'=gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequenee corresponding to an upstream motif or cis element capable of MtR as set forth in Figure 1 at residues.4759-4954, a sequence corresponding to an upstream anotif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure I at residues 5151-5156, and a sequence corresponaing to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 (or a sub-sequence thereof) may be employed as a marker nucleic acid molecule to identify such polymorphism(s).
Alternatively; such polymorphisms can be detected through the use of a marker nucleic acid molecule or a marker protein that is genetically linked to (i.e.; a polynucleotide that co-segregates with) such polymorphism(s). As stated above, the ~'iGR gene and/or a sequence or sequences that specifically hybridize to the TIGR
gene have been mapped to chromosome iq, 21-32, and more preferably to the TIER
gene located at chromosome 1, q21-27, and more preferably to this TIER gene located at chromosome 1, q22-26, and most preferably to the TIGR gene located at chromosome I, q24. In a preferred aspect of this embodiment, such marker nucleic acid molecules will have the nucleotide sequence of a polynucleotide that is closely genetically linked to such polymorphism(s) (e.g., markers located at chromosome 1, q19-25 (and more pxeferably chromosome 1, q23-25, and most preferably chromosome 1; q24.
Localization studies using a Stanford G3 radiation hybrid panel mapped the TIGR gene with the D1S2536 marker nucleic acid molecules at the D1S2536 locus with a LOD score of 6Ø Other marker nucleic acid molecules in this region include:
D1S210; D1S1552; D1S2536; D1S2790; SI3GC-12820; and D1S2558. Other polynucleotide markers that map to such locations are known and can be employed to identify such polymorphism(s).
The genomes of animals and plants naturally undergo spontaneous mutation in the course of their continuing evolution (Gusella, J.F., Ann. Rev. Biochem.
55:831-854 (1986)). A "polymorphism" in the TIGR gene or its flanking regions is a variation or difference in the sequence of the TIGR gene or its flanking regions that arises in some of the members of a species. The variant sequence and the "original"
sequence co-exist in the species' population In some instances, such co-existence is in stable or quasi-stable equilibrium.
A polymorphism is thus said to be "allelic," in that, due to the existence of the polymorphism, some members of a species may have the original sequence ~(i.e.
the original '°alleie") whereas other members may have the variant sequence (i.e. the variant "allele"). In the simplest case, only one variant sequence may exist, and the polymorphism is thus said to be di-allelic. In other cases, the species' population may contain multiple alleles, and the polurnorphism is termed tri-allelic, etc. A
single gene may have multiple different unrelated polymorphisms. For example, it may have a di-allelic pollnnorphism at one site, and a mufti-allelic polymorphism at another site.
The variation that defines the polymorphism may range from a single nucleotide variation to the insertion or deletion of extended regions within a gene.
5~ In sonne cases, the DNA sequence variations are in regions of -the genoine that are characterized bx short tandem repeats (STRs) that include tandem dl- or tri-nucleotide repeated motifs of nucleotides. Polymorphisms characterized by such tandem repeats are referred to as "variable number tandem repeat" ("VIvTTR") poly~no~phisms. VNTRs have been used in identity and paternity analysis (Weber,:
J.L., >;1:S. Patent 5,0T5,21?; Armour, J.A:L. d al., FEBS Left. 307:113-Ii5 (1992); Jones; .
L. et al., Eur. j..Haernafol. 39:144-I4?. (1987); Horn, G.T. et al., PCT' Application W09~1/14003; Jeffreys, A.J., European Patent Application 3?0,719; Jeffreys, A.J., U.S.
Patent 5~,1?5;~~ jeffreys. A.J. et al., Amen. ): Hum. Genet. 39:11-24 (1986);
Jeffieys.
A.J. et al., Nature 3I'6:?6-?9 (1985); Gray, LC. et al.; PrQC. R: Acad. Soc:
Land: 243:241-253 (1991); Moore, S.S. et al., Genomies 10:654-660 (1991); Jeffreys, A.J. et al.,Anim.
Genet. T 8:I-15 (198; I~llel, J. et aL, Anim. Genet. 20:145-155 (1989); ~llel, J. et al., Genet. I24:?83-7°81 (1990)?
In an alternative embodiment, such polymorphisms can be detected through the use of a marker nucleic acid molecule that is physically linked to ,such 24 polxatorphism(s). For this purpose, marker nucleic acid molecules comprising a nucleotide sequence of a polynudeotide located within 1 mb of the .
polynnorphism(s}, and more preferably within 100 kb .of the polymprphism(s), and most preferably within IO kb of the golymo=phism(s) can be employed. EXamples of such marker nucleic ands are set out in SE(~ ID NC1: 1, SEQ ID NO: 2, SEQ 1D
NO: 3, SEQ .ID NO: 4, SEQ ID NO: 5; SEQ ID NO: 6, SEQ ID NO: ?, SEQ ID NO: 8, SEQ ID
N0: ,9; SEQ ID NO:10, SEQ ID NO: II, SEQ ID N0:12, SEQ ID NO: I3, SEQ ID NO:
I4, SEQ ID NO: I5, SEQ ID N0:16, SEQ ID NO:1?, SEQ Ip NO:18, SEQ ID N0:19;
SEQ ID~ NO: 20, SEQ ID N4: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25.
In another embodiment a marker nucleic acid will be used that is capable of specifically deteding~TIGRrntI, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmtS, TTGRsaI,or a combinatiori of these mutations. Methods to detect bases) substitutions;
base(s), deletions and bases) additions are known in the art (i,e. methods to genotype an indivitduai). For example, the ~'~;enetic Bit Analysis ("GBA") method ' disclosed by.
Goelet, P. ef aL, WO 32/157'12, gay ~ u~d for detecting the single nucleotide polymorphisms of the present invention. GBA is a method of polymorph~c site iraerrogation id which the nucleotide sequence infonriation surrounding the site of variation in a target DNA sec~uente is used to design an oiigonudeotide primer that is complementary to the region immediately adjacent to, but not including, the variable nucleotide in the target DNA. The target DNA template is selected from the biological sample ar<d hybridized to the interrogating primer. This primer is extended by a single labeled dideoxynucleotide using DNA polymerise in the presence of two, and preferably all four chain termiinatitig nucleoside triphosphate precursors. Cohere, D. et al:, (PCT
Application IO W091/02087) descn'bes a related method of genotyping.
Other primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. ef al., Nucl.
Acids. lies.
17:7779-7784 {1989)~:'Sokolov; B. P., hTucl. Acids R~es. ' T 8:3671 (1990) ; Syvanen, A.-C:, et al., Genamics 8:654 - 692 {1990), r Kuppuswamy, M.N. et ii., Proc..
NafI. Acid. Sci. (II:S.A.) 88:1143-1147 (1991).; ' Prezant, T.R. et al., Hum.-Mufaf. 1:159-164 (1992),.
Ugozzoli, L. ef al., GATA 9:107-112 (1992); ,; Nyr6n, P. et aL, Anal. Biochem. 208:171-175 {1993) ) .
The detection of polymorphic sites in a. sample of DNA may be facilitated through the use of nucleic acid amplification methods. Such methods specifically increase the concentration of polynucleotides th~s.t span the polymorphic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis or other means.
Another preferred method of achieving such amplification employs the polymerise chain reaction ("PCR") (Mullis, K. et aL, Cold Spring Harbor Symp.
Quartt.
JBiol. 51:263-273 (1986); .'a MK. ,ef uL. US.1'a~nt hio.
4,683,202; Eriich, H., U.S. Patent No. 482,788; and Saiki, R ef al., U.S.
Patent No.
4,683,194); using primer pairs that are capable of hybridizing to the proximal sequences that define a polymorphism in its double-stranded form.
In lieu of PCR, a3ternat;ve methods, such as the "Ligasp wChain &eaon"
("LCR") may be used (Barany, F., Proc. Nafl. Acid. yci. (LLS.A.> 88:189-193 (1991)) .
LCR uses two pairs of oligonucleotide probes to exponentially amplify a specific target. The sequences of each pair of oligonucleotides is selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependent ligase. As with PCR, the resulting products thus sense as a template in subsequent cycles and an exponential S amplification of the desired sequence is obtained.
LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a polymorphic site: In one embodiment, either oligonudeotide will be designed to include the actual poiymorphic site of the polymorphism. In such an embodiment, the reaction conditions are selected such 1i? that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the polymorphic site present on the oligonucleotide. Alternatively, the oligonucleotides may be selected such that they do not include the polymorphic site (see, Segev, D., PCT
Application WO 90/01069).
15 The "Oligonucleotide Ligation Assay" ("OLA") may alternatively be employed (Landegren, U. et aL, Science 24I:10?7:1080 (1988)). The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. OLA, like LCR, is particularly suited for the detection of point mutations. Unlike LCR, however, OLA results in ZO "linear" rather than exponential amplification of the target sequence.
Nickerson, D.A. et al., have described a nucleie acid detection assay that cofnbines- attributes of PCR and OLA (Nickerson, D.A. et aL, Proc. Nufl. Acad:
Sci.
(LLS.A.) 8t:89~3-892 (1990)). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA. In addition to 25 requiring multiple, and separate, processing steps, one problem associated with such combinations is that they inherit all of the problems associated with PCR
and Schemes based on Iigation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby 30 amplifying the di-oligonucleotide, are also known (Wu, I~.Y. ef aL, Genomics 4:560 (1989)), and may be readily adapted to the purposes of the present invention Other known nucleic acid amplification procedures, such as allele-specific aligomers, branched DNA technology, transcription~ased amplification systems, or isothermal amplification methods may also be used to amplify and analyze such 35- polymorphisms (Malek, L.T: et al., U.S. Patent 5,130,238r Schuster ~t ~k., ~~.f.S, Pat~xrat 5,1~69f7~6l~v~~oh; W: et~ ui., Pro; . ~Va#1.
Acad. aci. ~~,i.S.A.) f~:ali~ (1989); Walker, G.T. et al., Pros: Nail. Acad. , Sci. (U.S.A.) 89:392-(1992)). ~l the foregoing nucleic aeid amplification methods could be used to predict or diagnose glaucoma.
The identification of a polymorphism in the TIGR gene can be determined iar a variety of ways. By correlating the presence or absence of glaucoma in an individual with the presence or absence of a polymorphism in the TIER gene or its flanking regions, it is possible to diagnose the predisposition (prognosis) of an asymptomatic patient to glaucoma; related diseases, or steroid sensitivity: If a polymorphism creates or destroys a restriction endonuclease cleavage site, or if it results in the loss or insertion of DNA (e.g., a ~1VTR polymor~hism)~ it will alter the size or profile of the DNA fragments that are generated by digestion with that restriction endonuclease. As such, individuals that possess a variant sequence can be distinguished from those having the original sequence by restriction fragment analysis. Polymorphisms that can be identified in this manner are termed "restriction fragment length polymorphisms" ("RFhPs"). RPLP's have been widely used in human and animal genetic analyses ( Skolnick, M:H. et al., Cytogen.
Cell Genet. 32:'58-67 (1982); liotstein, D: ef al., Ate. j. ~ Hum. Genet. 32:314-331 (7t91~0) , zo The role of TIvR in glaucoma pathogenesis indicates that the presence of genetic alterations (e.g., DNA polymorphisms) that affect the TIGR response can be employed to predict glaucoma A preferred method of achieving such identification employs the single-strand rnnformational polymorphism (SSCP) approach. The SSCP technique is a method capable of identifying most sequence variations in a single strand of DNA, typically between 150 and 250 nucleotides in length (Ellen, Methods in Molecular Medicine: Molecular Diagnosis of Genetic .Diseases, Humans Press (1996).;
prita et aL, Ger~omics 5: 874-879 X1989) ) .
Under denaturing conditions a single strand of i~IVA
will adopt a conformation that is uniquely dependent on its sequence conformation.
This conformation usually will be dL~terent, even if only a single base is ~chauged.
Most conformations have been reported to alter the physical configuration or siie sufficiently to be detectable by electrophoresis. A number of protocols have been described for SSCP including, but not limited to Lee et al., Arxal. Bioche~xx.
205: 289-' 293 (1992); Suzuki et al., Anal. Bioclze>7x.192: 82-84 (1991); Lo et al., Nucleic Acids S Research 20:1005-1009 (1992); Sarkar et al., Gerxomics 13: 441-443 (1992).
In accordance with this embodiment of the invention, a sample DNA is obtained from a patient's cells. In a preferred embodiment, the DNA sample is obtained from the patient's blood. However, any source of DNA may be used. The DNA is subjected to restriction endonuclease digestion. TIGR is used as a probe in IO accordance with the above-described RFLP methods. By comparing the RFLP
pattern of the TIGR gene obtained from normal and glaucomatous patients, one can determine a patient's predisposition (prognosis) to glaucoma. The polymorphism obtained in this approach can then be-cloned to identify the mutation at the coding region which alters the protein's structure or regulatory region of the gene which 15 affects its. expression level. Changes involving promoter interactions with other regulatory proteins can be identified by, for example, gel shift assays using I-TTM
cell extracts; fluid from the anterior chamber of the eye, serum, etc.
Interactions of TIER protein in glaucomatous cell extracts, fluid from the anterior chamber of the . eye, serum, etc. can be compared to control samples to thereby identify changes in 20 those properties of TTGR that relate to the pathogenesis of glaucoma:
Similarly such extracts and fluids. as well as others (blood, etc) can be used to diagnosis or predict steroid sensitivity.
- Several different classes of polymorphisms may be identified through such methods. Examples of such classes include: {1) polymorphisms present in the TIGR
25. cDNA of different individuals; {2) polymorphisms in non-translated TIGR
gene sequences, including the promoter or other regulatory regions of the T'IGR
gene; (3) polvmorphisms in genes whose products interact with TIGR regulatory sequences;
{4) polvmorphisms in gene sequences whose products interact with the TIGR
protein, or to which the TIGR protein binds.
~a In an alternate sub-embodiment, the evaluation is conducted using oligonucleotide "probes" whose sequence is complementary to that of a portion of ~EQ ID NO: 1, SEQ ID NO: 2 SEQ ID NO: 3; SEQ ID NO: 4, or SEQ ID NO: 5. Such molecules are then incubated with cell extracts of a patient under conditions sufficient to permit nucleic acid hybridization.
In one sub-embodiment of this aspect of the present invention, one can diagnose or predict glaucoma, related diseases and steroid sensitivity by ascertaining the TIGR response in a biopsy (or a macrophage or other blood cell sample), or other cell sample, or more preferably, in a sample of bodily fluid (especially, blood, serum, plasma, tears, buccal cavity, etc.). Since the TIGR
gene is induced in response to the presence of glucocorticoids, a highly preferred embodiment of this method comprises ascertaining such TIGR response prior to, during and/or subsequent to, the administration of a giucocorticoid. Thus, by way of illustration, glaucoma could be diagnosed or predicted by determining whether the administration of a glucocorticoid (administered topically, intraocularly, intramuscularly, systemically, or otherwise) alters the TIGR response of a particular individual, relative to that of normal individuals. Most preferably, for this purpose, at least a "TIGR gene-inducing amount" of the glucocorticoid will be provided.
As used herein, a TIER gene-inducing amount of a glucocorticoid is an amount of glucocorticoid sufficient to cause a detectable induction of TIGR expression in cells of glaucomatous or non-glaucomatous individuals.
III. Methods of Administration The agents of the present invention can be formulated according to known methods to prepare pharmacologically acceptable compositions, whereby these '.
materials, or their functional derivatives, having the desired degree of purity are combined in admixture with a physiologically acceptable carrier, excipient, or stabilizer. Such materials are non-toxic to recipients at the. dosages and concentrations employed. The active component of such compositions may be agents analogs or mimetics of such molecules. Where nucleic and molecules are employed, such molecules may be sense, antisense or triplex oligonucleotides of the TIGR promoter, TIGR cDNA, TIGR intron, TIGR exon or TIGR gene.
A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient patient. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
Suitable vehicles and their formulation, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pha~wnaceuncal jciences 116th ed.; Osol, A., Rd., Mack, ~aston PA (19&0 j j.
If the composition is to be water soluble, it may be formulated in a buffer such as phosphate or other organic acid salt preferably at.a pH of about 7 to 8. If the composition is only partially soluble in water, it may be , prepared as a microemulsion by formulating it with a nonionic surfactant such as Tweeri,.
Pluronics, or PEG, eg., Tween 80; in an amount af, for example, 0.04-0.05%
(w/v), bn incfease its solubility. The term "water soluble" as applied to the polysaccharides and polyethylene glycols is meant to include colloidal solutions and dispersions. In general, the solubility of the cellulose derivatives is determined by the degree of substitution of ether groups, and the stabilizing derivatives useful herein should have a sufficient quantity of such ether groups per anhydroglucose unit in .the celluiose chain to render the derivatives water soluble. A degree of ether substitution of at least 0.35 ether groups per anhydroglucose unit is generally sufficient. Additionally, the cellulose derivatives may be in the form of alkali metal salts, for example, the Li, Na, K or Cs salts.
Optionally other ingredients may be added such as antioxidants, e.g., ascorbic acid; low molecular weight (less than about ten residues) poiypeptides, e.g.;
polyargirune or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinyl pyrrolidone; amino acids, such as glycine, glutamic acid, aspartic and, or arginine;
monosaccharides, disaccl~aridesr and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; and sugar alcohols such as mannitol or sorbibol.
Additional pharmaceutical methods may be employed to control the duration of action. Controlled or sustained release preparations may be achieved through the use of polymers to complex or absorb the TIGR molecule{s) of the composition The controlled delivery may be exercised by selecting appropriate macromolecules (for example polyesters; polyamino acids, polyvinyl pyrrolidone, ethylenevinylacetate; methylcellulase, carboxymethylcellulose, or protamine sulfate) and the concentration of macromolecules as well as the methods of incorporation in order to control release.
Sustained release formulations may also be prepared, and include the formation of microcapsular particles and implantable articles. For preparing sustained-release compositions, the TIGR molecule{s) of the composition is preferably incorporated into a biodegradable matrix or microcapsule. A
suitable material for this purpose is a polylactide, although other polymers of poly-{a-*Trade-mark 4?
hydroxycarboxylic acids), such as poly-D-{-)-3-hydroxybutyric acid, ~P
133,988A), can be used. Other biodegradable polymers iniclude poly~{lafito~es);
poly(orthoesters), polyamino acids, hydrogels, or poly~(orthocarbona~es) poly(acetais). The polymeric material may also comprise polyesters, poly(la~etic acid) or ethylene vinylacetate copolymers. For examples of sustained ~~elease compositions, see U.S. Patent No. 3;773;919, EP ~58,481A, U.S. Patent Ne.
3,887;°99, .
EP 158,277A, Canadian Patent No. 1176565, Sidman, U. et aL, Biopoiymers 22:547 (1983), and Larger, R et al., Chtm. Teelr:12:98 (I982).
Alternatively, instead of incorporating the TIER molecules) of the composition into polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, by ooacervatian techniques or by interfacial polymerization, for example; hydroxymethylcellulose or gelatine-mi~ocapsules and poly(methylmethacylate) micxocapsules, respectively, or in colloidal drug delivery systems, for example, liposomes, albuaun microspheres, microemulsions;
nanoparticles, and nanocapsules or in macroemulsions: Such techniques are disclosed in Remington's Pharmaceutical Sciences (19811).
In an alternative embodiment, liposome formulations and methods that permif intracellular uptake of the molecule will be emuloved. Suitable methods are known in the art, see, for example, ..._y~~h, D.B. (US.
Patent No: 5,190,762), Callahan, M.V. ef at. (U.S. Patent No. ~5,270,OS2) and Gonzalezro, R.J. (PCT Application 91/0577i).
Having now generaDy described the invention, the same will be more readily understood through reference to the following examples which are provided by ?5 way of illustration, and are not intended to be limiting of the present invention, unless specified.
Single strand conformational polymorphism ,(SSCP) screening is~caned out according to the procedure of Hue et al., The Journal of Invesfigative Ophtlralrnolo~y 105.4: 529-632 (1995)_. SSCP primers are constructed corresponding to sequences found within the TIGR promoter and two of exons of TIGR The following primers are canst~ucted: forwa~3 primer "Sk-1a":
5' TGA GGC TTC CTC TGG AAA C 3' (SEQ ID NO: 6); reverse primer "1a2":
°'S'-TGA AAT CAG CAC ACC AGT AG3' (SEQ ID NO: 7); forward primer "CA2": ~S'-~ CCC ATA CCC CAA TAA TAG3' (SEQ ID NO: 8); reverse primer "Pr+1": 5'-AGA GTT CCC CAG ATT.TCA CC-3'' (SEQ ID NO: 9); forward primer "Pr-I": 5'-ATC TGG GGA ACT CTT CTC AG3' (SEQ ID NO:10); reverse primer "Pr+2(4A2)":
5'-'FAC AGT TGT TGC AGA TAC G3' (SEQ ID NO: 11); forward primer "Pr-2(4A)": 5' ACA ACG TAT CTG CAA CAA CTG3' (SEQ ID N0:12); reverse primer "Pr+3(4A)": 5' TCA GGC TTA ACT GCA GAA CC-3' (SEQ ID NO: I3); forward primer "Pr-3(4A)": 5' TTG GTT CTG CAG TTA AGC C-3° (SEQ ID NO: 14);
reverse primer "Pr+2(4A1)": 5'-AGC AGC ACA AGG GCA ATC C-3' (SEQ ID NO: 15);
reverse primer "1'r+1(4A}": 5'-ACA GGG CTA TAT TGT GGG-3' (5EQ ID NO: 16);
forward primer "KSIX": 5'fiCT GAG ATG CCA GCT GTC C-3' (SEQ ID NO: 1~;
reverse primer "SK1XX": 5'-CTG AAG CAT TAG AAG CCA AC 3' (SEQ ID NO:
18); forward primer "KS2aI": 5'-ACC TTG GAC CAG GCT GCC AG3' (SEQ ID
NO:1~.}; reverse primer "SK3" 5'-AGG TTT GTT CGA GTT CCA G3' (SEQ ID NO:
20}forward primer "KS4": 5'-ACA ATT ACT GGC AAG TAT GG-3' (SEQ ID NO:
21); reverse primer "SK6A": 5'-CCT TCT CAG CCT TGC TAC C-3' (SEQ ID NO: 22);
forward primer "ICSS": 5'-ACA CCT CAG CAG ATG CTA CC3' (SEQ ID NO: 23);
reverse primer "SK8": 5'-ATG GAT GAC TGA CAT GGC C-3' (SEQ ID NO: 24);
forward primer "KS6": 5' AAG GAT GAA CAT GGT CAC C 3' (SEQ ID NO: 25).
The locations of primers: Sk-la, cat; CA2, Pr+I, Pr-1, Pr+2(4A2), Pr-2(4A), Pr+3(4A}, Pr-3 (4A), Pr-3(4A}, Pr+2(4A1), and Pr+1(4A) are diagramatically set forth in Figure 4. . The location of primers: KS1X, SKIXX, Ks2al, SK3, KS4, SK6A, KSS, SK8, and KS6 are diagramatically set forth in F'igu=e 5.
Families with a history of POAG in Klamath Falls, Oregon, are screened by SSCP according to the method of Hue et aL, The journal o~' Investigative O~htluiImoIogy 25r 2U5.4; 529-G32 (1995). SSCP primers SK-Ia; ca2, CA2, Pr+1, Pr-2(4A), Pr+3(4A), SK1XX, and KS6 detect single strand conformational r polymorphisms in .this population. An SSCP is detected using SSCP primers Pr+3(4A) and Pr-2(4A). 70 family. members of the Klamath Fall, Oregon are screened with these primers and the results are set forth in Table 1.
~'e~tai SSCP+
Glaucoma ,positive individuals) 12 12 0 Glaucoma negative individuals 13 0 13 Spouses (glaurnma negative) 16 2 T4 -' Others2 29 6 23 1= glaucoma positive individuals as determined by IOP of greater than 25 mmHg 2 = unidentified glaucoma due to the age of the individual.
A second SSCP is detected using SSCP primers Pr+1 and CA2. 14 #amily members of the Kiamath Fall, Oregon are screened with these primers. A
characteristic polymorphism is found in the 6 affected family, members but absent in the,8 unaffected members. A third SSCP is detected using SSCP primers cat and sk-la. The same 14 family members of the Klamath Fall, Oregon that are screened with Pr+1 and CA2 are screened with cat and sk-la primers. A characteristic polymorphism is found in the 6 affected family members but absent in the 8 unaffected members. A fourth SSCP is detected using SSCP primers KS6 and SK1XX. 22 family members of the Klamath Fall, Oregon and 10 members of a Portland; Oregon pedigree are screened with these primers. A polymorphism is found in exon 3. The results are as set forth in Table 2.
_ TABLE 2 Total SSCP+ SSCP-IQamath Fall, Oregon Glaucoma positive individuals)3 3 0 Glaucoma negative individuals6 0 6 Others2 13 6 7 Portland, Oregon Glaucoma positive individuals)6 6 0 Glaucoma negative individuals4 0 4 O.thers2 0 0 0 1= glaucoma positive individuals d by IOP of greater than 25 mmHg as determine 2 = unidentified glaucoma individual.
due to the age of the SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
(ii) TITLE OF INVENTION: METHODS FOR THE DIAGNOSIS, PROGNOSTSAND
TREATMENT OF GLAUCOMA AND RELATED DISORDERS
(iii) NUMBER OF SEQUENCES: 32 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SMART & BIGGAR
(B) STREET: P.O. BOX 2999, STATION D
(C) CITY: OTTAWA
(D) STATE: ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) CURRENT APPLICATTON DATA:
(A) APPLICATION NUMBER: Division of CA 2,278,782 (B) FILING DATE: 09-JAN-1998 (C) CLASSIFICATTON:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/791,154 (B) FILING DATE: 28-JAN-1997 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/938,669 (B) FILING DATE: 26-SEP-1997 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SMART & BIGGAR
(B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 73185-12D
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)-232-2486 (B) TELEFAX: (613)-232-8440 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5300 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
AATGTGAAAG
TAAAGAATCA
ATTTTAGTGA
ATGGTAAATC
AAAATGCCAG
GGAAAAAATG
TCCAAATTGG
AAAATGGGAA
AAAACCAGAT
TAACAATAAC
CTTTCATAAC
GAACACAAAA
ATTGACTGGG CTAAGCCTGG ACTTTCAAGG GAAATATGAA AAACTGAGAG 7$0 CAAAACAAAA
CCCCTCAGCA
TAAGAAACTC
GCATAATCAG
TCCCAGCTCC
GGATAGGTCA GAAATCATTA GAAATCACTG TGTCCCCATC CTAACTTTTT 10$0 CAGAATGATC
GTAGTAACTG AGGCTGTAAGATTACTTAGTTTCTCCTTATfiAGGAACTCTTTTTCTCTGT3720 TTATACTATA TTACAGTTGTTGCAGATACGTTGTAAGTGAAATATTTATACTCAAAA.CTA4440 AGGGGGGAAA TCTGCCGCTTCTATAGGAAfiGCTCTCCCTGGAGCCTGGTAGGGTGCTGTC4800 TATAAACTAG
(2) INFORMATTON ID N0:2:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH:
base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY:linear (xi) SEQUENCE SEQ ID
DESCRIPTION: N0:2:
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6169 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID
N0:3:
AAATTAGAAA GCTAGGGGTG
GTTCTCCCAA
AGATACACAG
(2) INFORMATION ID N0:4:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 926 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION:SEQ ID
N0:4:
(2) INFORMATION ID N0:5:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 2099 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION:SEQ ID
N0:5:
(2) INFORMATION ID N0:6:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH:
19 base pairs (B) TYPE: eic acid nucl (C) STRANDEDNESS:
single (D) TOPOLOGY:linear (xi) SEQUENCE SEQ ID
DESCRTPTION: N0:6:
(2) INFORMATION ID N0:7:
FOR SEQ
(i) SEQUENCE
CHARACTERTSTICS:
(A) LENGTH: base pairs (B) TYPE: eic acid nucl (C) STR.ANDEDNESS:
single (D) TOPOLOGY:linear (xi) SEQUENCE SEQ ID :
DESCRIPTION: N0:7 (2 ) INFORMATION FOR ID N0:8:
SEQ
(i) S EQUENCE S:
CHARACTERISTIC
(A) LENGTH: base pairs (B) TYPE: eic acid nucl (C) STRANDEDNESS: single (D) TOPOLOGY:linear (xi) SEQUENCE SCRIPTION:SEQ ID :
DE N0:8 SO
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
(2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
(2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
(2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
(2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
(2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
(2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:
(2) INFORMATION ID N0:25:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION:SEQ ID
N0:25:
(2) INFORMATION ID N0:26:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 1548 base rs pai (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
cDNA
(xi) SEQUENCE DESCRIPTION:SEQ ID
N0:26:
(2) INFORMATION ID N0:27:
FOR SEQ
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 178 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
Thr Gly Ala val Val Tyr Ser Gly Ser Leu Tyr Phe Gln Gly Ala Glu Ser Arg Thr Val Ile Arg Tyr Glu Leu Asn Thr Glu Thr Val Lys Ala Glu Lys Glu Ile Pro Gly Ala Gly Tyr His Gly Gln Phe Pro Tyr Ser Trp Gly Gly Tyr Thr Asp Ile Asp Leu Ala Val Asp Glu Ala Gly Leu Trp Val Ile Tyr Ser Thr Asp Glu Ala Lys Gly Ala Ile Val Leu Ser Lys Leu Asn Pro Glu Asn Leu Glu Leu Glu Gln Thr Trp Glu Thr Asn Ile Arg Lys Gln Ser Val Ala Asn Ala Phe Ile Ile Cys Gly Thr Leu Tyr Thr Val Ser Ser Tyr Thr Ser Ala Asp Ala Thr Val Asn Phe Ala Tyr Asp Thr Gly Thr Gly Ile Ser Lys Thr Leu Thr Ile Pro Phe Lys Asn Arg Tyr Lys Tyr Ser Ser Met Ile Asp Tyr Asn Pro Leu Glu Lys Lys Leu Phe Ala Trp Asp Asn Leu Asn Met Val Thr Tyr Asp Ile Lys Leu Ser (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 131 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
Arg Phe Asp Leu Lys Thr Glu Thr Ile Leu Lys Thr Arg Ser Leu Asp Tyr Ala Gly Tyr Asn Asn Met Tyr His Tyr Ala Trp Gly Gly His Ser Asp Ile Asp Leu Met Val Asp Glu Ser Gly Leu Trp Ala Val Tyr Ala Thr Asn Gln Asn Ala Gly Asn Ile Val Val Ser Arg Leu Asp Pro Val Ser Leu Gln Thr Leu Gln Thr Trp Asn Thr Ser Tyr Pro Lys Arg Xaa Pro Gly Xaa Ala Phe Ile Ile Cys Gly Thr Cys Tyr Val Thr Asn Gly Tyr Ser Gly Gly Thr Lys Val His Tyr Ala Tyr Gln Thr Asn Ala Ser Thr Tyr Glu Tyr Ile Asp Ile Pro Phe Gln Asn Lys Leu Xaa Pro His Phe Pro Cys (2) INFORMATION ID N0:29:
FOR
SEQ
(i) CS:
SEQUENCE
CHARACTERISTI
(A) LENGTH:178amino ids ac (B) TYPE: acid amino (C) STRANDEDNESS:
single (D) TOPOLOGY:
linear (ii) TYPE:
MOLECULE None (xi) DESCRIPTION: SEQID N0:29:
SEQUENCE
Gly ThrGly Gln ValTyr Asn GlySerIleTyr PheAsn LysPhe Val Gln SerHis Ile IleArg Phe AspLeuLysThr GluThr IleLeu Ile Lys ThrArg Ser AspTyr Ala GlyTyrAsnAsn MetTyr HisTyr Leu Ala TrpGly Gly SerAsp Ile AspLeuMetVal AspGlu AsnGly His Leu TrpAla Val AlaThr Asn GlnAsnAlaGly AsnIle ValIle Tyr Ser LysLeu Asp ValSer Leu GlnIleLeuGln ThrTrp AsnThr Pro Ser TyrPro Lys SerAla Gly GluAlaPheIle IleCys GlyThr Arg Leu TyrVal Thr GlyTyr Ser GlyGlyThrLys ValHis TyrAla Asn Tyr GlnThr Asn SerThr Tyr GluTyrIleAsp IlePro PheGln Ala Asn LysTyr Ser IleSer Met LeuAspTyrAsn ProLys AspArg His Ala LeuTyr Ala AsnAsn Gly HisGlnThrLeu TyrAsn ValThr Trp Leu Phe (2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 177 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
Gly Ala Gly Val Val Val His Asn Asn Asn Leu Tyr Tyr Asn Cys Phe Asn Ser His Asp Met Cys Arg Ala Ser Leu Thr Ser Gly Val Tyr Gln Lys Lys Pro Leu Leu Asn Ala Leu Phe Asn Asn Arg Phe Ser Tyr Ala Gly Thr Met Phe Gln Asp Met Asp Phe Ser Ser Asp Glu Lys Gly Leu Trp Val Ile Phe Thr Thr Glu Lys Ser Ala Gly Lys Ile Val Val Gly Lys Val Asn Val Ala Thr Phe Thr Val Asp Asn Ile Trp Ile Thr Thr Gln Asn Lys Ser Asp Ala Ser Asn Ala Phe Met Tle Cys Gly Val Leu Tyr Val Thr Arg Ser Leu Gly Pro Lys Met Glu Glu Val Phe Tyr Met Phe Asp Thr Lys Thr Gly Lys Glu Gly His Leu Ser Ile Met Met Glu Lys Met Ala Glu Lys Val His Ser Leu Ser Tyr Asn Ser Asn Asp Arg Lys Leu Tyr Met Phe Ser Glu Gly Tyr Leu Leu His Tyr Asp Ile Ala Leu (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 74 amino acids (B) TYPE: amino acid (C) STRANDEDNESS; single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:
Gly Val Val Tyr Ser Arg Leu Thr Glu Thr Leu Ala Gly Tyr Asn Asn Tyr Ala Trp Gly Gly Asp Ile Asp Leu Val Asp Glu Gly Leu Trp Tyr Thr Ala Gly Ile Val Ser Lys Leu Pro Leu Gln Thr Trp Thr Lys Ala Phe Ile Ile Cys Gly Thr Leu Tyr Val Thr Tyr Val Tyr Ala Tyr Thr Ile Tyr Asp Tyr Asn Pro Lys Leu Tyr Leu (2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 504 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (v) FRAGMENT TYPE: N-terminal (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:
Met Arg Phe Phe Cys Ala Arg Cys Cys Ser Phe Gly Pro Glu Met Pro Ala Val Gln Leu Leu Leu Leu Ala Cys Leu Val Trp Asp Val Gly Ala Arg Thr Ala Gln Leu Arg Lys Ala Asn Asp Gln Ser Gly Arg Cys G.ln Tyr Thr Phe Ser Val Ala Ser Pro Asn Glu Ser Ser Cys Pro Glu Gln Ser Gln Ala Met Ser Val Ile His Asn Leu Gln Arg Asp Ser Ser Thr Gln Arg Leu Asp Leu Glu Ala Thr Lys Ala Arg Leu Ser Ser Leu Glu Ser Leu Leu His Gln Leu Thr Leu Asp Gln Ala Ala Arg Pro Gln Glu Thr Gln Glu Gly Leu Gln Arg Glu Leu Gly Thr Leu Arg Arg Glu Arg Asp Gln Leu Glu Thr Gln Thr Arg Glu Leu Glu Thr Ala Tyr Ser Asn Leu Leu Arg Asp Lys Ser Val Leu Glu Glu Glu Lys Lys Arg Leu Arg Gln Glu Asn Glu Asn Leu Ala Arg Arg Leu Glu Ser Ser Ser Gln Glu Val Ala Leu ArgArgGly GlnCys ProGlnThr ArgAspThr Ala Arg Arg AlaValPro FroGlySer ArgGlu ValSerThr TrpAsnLeu Asp Thr LeuAlaPhe GlnGluLeu LysSer GluLeuThr GluValPro Ala Ser ArgIleLeu LysGluSer ProSer GlyTyrLeu ArgSerGly Glu Gly AspThrGly CysGlyGlu LeuVal TrpValGly GluProLeu Thr Leu ArgThrAla GluThrIle ThrGly LysTyrGly ValTrpMet Arg Asp ProLysPro ThrTyrPro TyrThr GlnGluThr ThrTrpArg Ile Asp ThrValGly ThrAspVal ArgGln ValPheGlu TyrAspLeu Ile Ser GlnPheMet GlnGlyTyr ProSer LysValHis IleLeuPro Arg Pro LeuGluSer ThrGlyAla ValVal TyrSerGly SerLeuTyr Phe Gln GlyAlaGlu SerArgThr ValIle ArgTyrGlu LeuAsnThr Glu Thr ValLysAla GluLysGlu IlePro GlyAlaGly TyrHisGly Gln Phe ProTyrSer TrpGlyGly TyrThr AspIleAsp LeuAlaVal Asp Glu AlaGlyLeu TrpValIle TyrSer ThrAspGlu AlaLysGly Ala Ile ValLeuSer LysLeuAsn ProGlu AsnLeuGlu LeuGluGln Thr Trp GluThrAsn IleArgLys GlnSer ValAlaAsn AlaPheIle Ile Cys GlyThrLeu TyrThrVal SerSer TyrThrSer AlaAspAla Thr Val AsnPheAla TyrAspThr GlyThr GlyIleSer LysThrLeu Thr Ile ProPheLys AsnArgTyr LysTyr SerSerMet IleAspTyr Asn Pro LeuGluLys LysLeuPhe AlaTrp AspAsnLeu AsnMetVal Thr Tyr AspIleLys LeuSerLys Met
molecule or fragment.
The TIGR promoter sequences} and TIGR flanking sequences can also be obtained by incubating oligonucleotide probes of TIGR oligonucleotides with 2t~ members of genomic human libraries and recovering clones that hybridize to the probes. In a second embodiment, methods of "chromosome walking," or 3' or 5°
RACE may be used (Frohman, M.A. et aL, Proc. Natl. Acad. Sci. (I,LS.A.) 85:8998-9002 (1988}; ~ Ohara, O: ef al., Proc. Natl. Acad. Sci.
(LLS.A.) 86:5673-5677 (1989)) to obtain such sequences.
IL Uses of the Molecules of the Invention in the Diagnosis and Prognosis of Glaucoma and Related Diseases A particularly desired use of the present invention relates to the diagnosis of glaucoma, POAG, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. Another particularly desired use of the present invention relates to the prognosis of glaucoma, POAG, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. As used Herein the term "glaucoma" includes both primary glaucomas, secondary glaucomas; juvenile glaucomas, congenital glaucomas, and familial glaucomas, including, without limitation, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases: As indicated above, methods for diagnosing or prognosing glaucoma suffer from inaccuracy, or require multiple examinations. The molecules of the present invention may be used to define superior assays for glaucoma. Quite apart from such usage, the molecules of the present invention may be used to dia~wsis or predict an individual's sensitivity to elevated intraocular pressure upon administration of steroids such as glucornrtimids or corticosteroids, or anti-inflammatory steroids):
Dexamethasone;
cortisol and prednisolone are preferred steroids for this purpose. Medical conditions such as inflammatory and allergic disorders, as deli as organ ~a~plantation recipients, benefit from treatment with glucocorticoids. Certain individuals exhibit an increased sensitivity to such steroids (i.e., "steroid sensitivity"), which is manifested by an undesired increase in intraocular pressure.
The present invention may be employed to diagnosis or predict such sensitivity, as well as glaucoma and related diseases.
In a first embodiment, the TIGR molecules of the present invention are used to determine whether an individual has a mutation affecting the level (i.e., the concentration of TIGR mRNA or protein in a sample, etc.) or pattern (i.e., the kinetics of expression; rate of decomposition, stability profile, etc.) of the TIGR
expression (collectively, the °"TIGR response" of a cell or bodily fluid) (for example;
a mutation in the TIGR gene, or in a regulatory regions) or other genes) that control or affect the expression of TIGR), and being predictive of individuals who would be predisposed to glaucoma (prognosis), related diseases, or steroid sensitivity. As used herein, the TIGR response manifested by a cell or bodily fluid is said to be "altered" if it differs from the TIER response of cells or of bodily fluids of normal individuals. Such alteration may be manifested by either abnormally increased or abnormally diminished TIGR response. To determine whether a TIER
response is altered, the TIGR response manifested by the cell or bodily fluid of .the patient is compared with that of a similar cell sample (or bodily fluid sample) of normal individuals. As will be appreciated, it is not necessary to re-determine the TIGR response of the cell sample (or bodily fluid sample) of normal individuals each time such a comparison is made; rather, the TIGR response of a particular individual may be compared with previously obtained values of normal individuals.
In one sub-embodiment, such an analysis is conducted by determining the presence and/or identity of polymorphism(s) in the TIGR gene or its flanking regions which are associated with glaucoma, or a predisposition (prognosis) to glaucoma, related diseases, or steroid sensitivity. As used herein, the term "TIER
flanking regions" refers to those regions which are located either upstream or downstream of the TIGR coding region.
Any of a variety of molecules can be used to identify such polymorphism(s).
In one embodiment, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ
ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ II7 NO: 24, SEQ ID NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL-FPlli as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-X45, sequences corresponding to an upstream spar stress motif or cis element as set forth in Figure Z at residues 451, 1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively, sequences rnrresponding to glucocorticoid response upstream motif or cis element as set forth in Figure l at residues 574-600, 1042-1056, 2444-2468, 2442 2269, 3536-3563, 4593, 4595:4614, 4851-4865, 4844-4864; 5079-5084, 5083-S1I1; respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure I at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding ICTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure I
at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure I at residues 1447-1456, a sequence coaesponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-I550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS
as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429; and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding .
HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth fn Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding IeTF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAI as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS
as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAl'/CRl'=gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequenee corresponding to an upstream motif or cis element capable of MtR as set forth in Figure 1 at residues.4759-4954, a sequence corresponding to an upstream anotif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure I at residues 5151-5156, and a sequence corresponaing to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 (or a sub-sequence thereof) may be employed as a marker nucleic acid molecule to identify such polymorphism(s).
Alternatively; such polymorphisms can be detected through the use of a marker nucleic acid molecule or a marker protein that is genetically linked to (i.e.; a polynucleotide that co-segregates with) such polymorphism(s). As stated above, the ~'iGR gene and/or a sequence or sequences that specifically hybridize to the TIGR
gene have been mapped to chromosome iq, 21-32, and more preferably to the TIER
gene located at chromosome 1, q21-27, and more preferably to this TIER gene located at chromosome 1, q22-26, and most preferably to the TIGR gene located at chromosome I, q24. In a preferred aspect of this embodiment, such marker nucleic acid molecules will have the nucleotide sequence of a polynucleotide that is closely genetically linked to such polymorphism(s) (e.g., markers located at chromosome 1, q19-25 (and more pxeferably chromosome 1, q23-25, and most preferably chromosome 1; q24.
Localization studies using a Stanford G3 radiation hybrid panel mapped the TIGR gene with the D1S2536 marker nucleic acid molecules at the D1S2536 locus with a LOD score of 6Ø Other marker nucleic acid molecules in this region include:
D1S210; D1S1552; D1S2536; D1S2790; SI3GC-12820; and D1S2558. Other polynucleotide markers that map to such locations are known and can be employed to identify such polymorphism(s).
The genomes of animals and plants naturally undergo spontaneous mutation in the course of their continuing evolution (Gusella, J.F., Ann. Rev. Biochem.
55:831-854 (1986)). A "polymorphism" in the TIGR gene or its flanking regions is a variation or difference in the sequence of the TIGR gene or its flanking regions that arises in some of the members of a species. The variant sequence and the "original"
sequence co-exist in the species' population In some instances, such co-existence is in stable or quasi-stable equilibrium.
A polymorphism is thus said to be "allelic," in that, due to the existence of the polymorphism, some members of a species may have the original sequence ~(i.e.
the original '°alleie") whereas other members may have the variant sequence (i.e. the variant "allele"). In the simplest case, only one variant sequence may exist, and the polymorphism is thus said to be di-allelic. In other cases, the species' population may contain multiple alleles, and the polurnorphism is termed tri-allelic, etc. A
single gene may have multiple different unrelated polymorphisms. For example, it may have a di-allelic pollnnorphism at one site, and a mufti-allelic polymorphism at another site.
The variation that defines the polymorphism may range from a single nucleotide variation to the insertion or deletion of extended regions within a gene.
5~ In sonne cases, the DNA sequence variations are in regions of -the genoine that are characterized bx short tandem repeats (STRs) that include tandem dl- or tri-nucleotide repeated motifs of nucleotides. Polymorphisms characterized by such tandem repeats are referred to as "variable number tandem repeat" ("VIvTTR") poly~no~phisms. VNTRs have been used in identity and paternity analysis (Weber,:
J.L., >;1:S. Patent 5,0T5,21?; Armour, J.A:L. d al., FEBS Left. 307:113-Ii5 (1992); Jones; .
L. et al., Eur. j..Haernafol. 39:144-I4?. (1987); Horn, G.T. et al., PCT' Application W09~1/14003; Jeffreys, A.J., European Patent Application 3?0,719; Jeffreys, A.J., U.S.
Patent 5~,1?5;~~ jeffreys. A.J. et al., Amen. ): Hum. Genet. 39:11-24 (1986);
Jeffieys.
A.J. et al., Nature 3I'6:?6-?9 (1985); Gray, LC. et al.; PrQC. R: Acad. Soc:
Land: 243:241-253 (1991); Moore, S.S. et al., Genomies 10:654-660 (1991); Jeffreys, A.J. et al.,Anim.
Genet. T 8:I-15 (198; I~llel, J. et aL, Anim. Genet. 20:145-155 (1989); ~llel, J. et al., Genet. I24:?83-7°81 (1990)?
In an alternative embodiment, such polymorphisms can be detected through the use of a marker nucleic acid molecule that is physically linked to ,such 24 polxatorphism(s). For this purpose, marker nucleic acid molecules comprising a nucleotide sequence of a polynudeotide located within 1 mb of the .
polynnorphism(s}, and more preferably within 100 kb .of the polymprphism(s), and most preferably within IO kb of the golymo=phism(s) can be employed. EXamples of such marker nucleic ands are set out in SE(~ ID NC1: 1, SEQ ID NO: 2, SEQ 1D
NO: 3, SEQ .ID NO: 4, SEQ ID NO: 5; SEQ ID NO: 6, SEQ ID NO: ?, SEQ ID NO: 8, SEQ ID
N0: ,9; SEQ ID NO:10, SEQ ID NO: II, SEQ ID N0:12, SEQ ID NO: I3, SEQ ID NO:
I4, SEQ ID NO: I5, SEQ ID N0:16, SEQ ID NO:1?, SEQ Ip NO:18, SEQ ID N0:19;
SEQ ID~ NO: 20, SEQ ID N4: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25.
In another embodiment a marker nucleic acid will be used that is capable of specifically deteding~TIGRrntI, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmtS, TTGRsaI,or a combinatiori of these mutations. Methods to detect bases) substitutions;
base(s), deletions and bases) additions are known in the art (i,e. methods to genotype an indivitduai). For example, the ~'~;enetic Bit Analysis ("GBA") method ' disclosed by.
Goelet, P. ef aL, WO 32/157'12, gay ~ u~d for detecting the single nucleotide polymorphisms of the present invention. GBA is a method of polymorph~c site iraerrogation id which the nucleotide sequence infonriation surrounding the site of variation in a target DNA sec~uente is used to design an oiigonudeotide primer that is complementary to the region immediately adjacent to, but not including, the variable nucleotide in the target DNA. The target DNA template is selected from the biological sample ar<d hybridized to the interrogating primer. This primer is extended by a single labeled dideoxynucleotide using DNA polymerise in the presence of two, and preferably all four chain termiinatitig nucleoside triphosphate precursors. Cohere, D. et al:, (PCT
Application IO W091/02087) descn'bes a related method of genotyping.
Other primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. ef al., Nucl.
Acids. lies.
17:7779-7784 {1989)~:'Sokolov; B. P., hTucl. Acids R~es. ' T 8:3671 (1990) ; Syvanen, A.-C:, et al., Genamics 8:654 - 692 {1990), r Kuppuswamy, M.N. et ii., Proc..
NafI. Acid. Sci. (II:S.A.) 88:1143-1147 (1991).; ' Prezant, T.R. et al., Hum.-Mufaf. 1:159-164 (1992),.
Ugozzoli, L. ef al., GATA 9:107-112 (1992); ,; Nyr6n, P. et aL, Anal. Biochem. 208:171-175 {1993) ) .
The detection of polymorphic sites in a. sample of DNA may be facilitated through the use of nucleic acid amplification methods. Such methods specifically increase the concentration of polynucleotides th~s.t span the polymorphic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis or other means.
Another preferred method of achieving such amplification employs the polymerise chain reaction ("PCR") (Mullis, K. et aL, Cold Spring Harbor Symp.
Quartt.
JBiol. 51:263-273 (1986); .'a MK. ,ef uL. US.1'a~nt hio.
4,683,202; Eriich, H., U.S. Patent No. 482,788; and Saiki, R ef al., U.S.
Patent No.
4,683,194); using primer pairs that are capable of hybridizing to the proximal sequences that define a polymorphism in its double-stranded form.
In lieu of PCR, a3ternat;ve methods, such as the "Ligasp wChain &eaon"
("LCR") may be used (Barany, F., Proc. Nafl. Acid. yci. (LLS.A.> 88:189-193 (1991)) .
LCR uses two pairs of oligonucleotide probes to exponentially amplify a specific target. The sequences of each pair of oligonucleotides is selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependent ligase. As with PCR, the resulting products thus sense as a template in subsequent cycles and an exponential S amplification of the desired sequence is obtained.
LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a polymorphic site: In one embodiment, either oligonudeotide will be designed to include the actual poiymorphic site of the polymorphism. In such an embodiment, the reaction conditions are selected such 1i? that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the polymorphic site present on the oligonucleotide. Alternatively, the oligonucleotides may be selected such that they do not include the polymorphic site (see, Segev, D., PCT
Application WO 90/01069).
15 The "Oligonucleotide Ligation Assay" ("OLA") may alternatively be employed (Landegren, U. et aL, Science 24I:10?7:1080 (1988)). The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. OLA, like LCR, is particularly suited for the detection of point mutations. Unlike LCR, however, OLA results in ZO "linear" rather than exponential amplification of the target sequence.
Nickerson, D.A. et al., have described a nucleie acid detection assay that cofnbines- attributes of PCR and OLA (Nickerson, D.A. et aL, Proc. Nufl. Acad:
Sci.
(LLS.A.) 8t:89~3-892 (1990)). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA. In addition to 25 requiring multiple, and separate, processing steps, one problem associated with such combinations is that they inherit all of the problems associated with PCR
and Schemes based on Iigation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby 30 amplifying the di-oligonucleotide, are also known (Wu, I~.Y. ef aL, Genomics 4:560 (1989)), and may be readily adapted to the purposes of the present invention Other known nucleic acid amplification procedures, such as allele-specific aligomers, branched DNA technology, transcription~ased amplification systems, or isothermal amplification methods may also be used to amplify and analyze such 35- polymorphisms (Malek, L.T: et al., U.S. Patent 5,130,238r Schuster ~t ~k., ~~.f.S, Pat~xrat 5,1~69f7~6l~v~~oh; W: et~ ui., Pro; . ~Va#1.
Acad. aci. ~~,i.S.A.) f~:ali~ (1989); Walker, G.T. et al., Pros: Nail. Acad. , Sci. (U.S.A.) 89:392-(1992)). ~l the foregoing nucleic aeid amplification methods could be used to predict or diagnose glaucoma.
The identification of a polymorphism in the TIGR gene can be determined iar a variety of ways. By correlating the presence or absence of glaucoma in an individual with the presence or absence of a polymorphism in the TIER gene or its flanking regions, it is possible to diagnose the predisposition (prognosis) of an asymptomatic patient to glaucoma; related diseases, or steroid sensitivity: If a polymorphism creates or destroys a restriction endonuclease cleavage site, or if it results in the loss or insertion of DNA (e.g., a ~1VTR polymor~hism)~ it will alter the size or profile of the DNA fragments that are generated by digestion with that restriction endonuclease. As such, individuals that possess a variant sequence can be distinguished from those having the original sequence by restriction fragment analysis. Polymorphisms that can be identified in this manner are termed "restriction fragment length polymorphisms" ("RFhPs"). RPLP's have been widely used in human and animal genetic analyses ( Skolnick, M:H. et al., Cytogen.
Cell Genet. 32:'58-67 (1982); liotstein, D: ef al., Ate. j. ~ Hum. Genet. 32:314-331 (7t91~0) , zo The role of TIvR in glaucoma pathogenesis indicates that the presence of genetic alterations (e.g., DNA polymorphisms) that affect the TIGR response can be employed to predict glaucoma A preferred method of achieving such identification employs the single-strand rnnformational polymorphism (SSCP) approach. The SSCP technique is a method capable of identifying most sequence variations in a single strand of DNA, typically between 150 and 250 nucleotides in length (Ellen, Methods in Molecular Medicine: Molecular Diagnosis of Genetic .Diseases, Humans Press (1996).;
prita et aL, Ger~omics 5: 874-879 X1989) ) .
Under denaturing conditions a single strand of i~IVA
will adopt a conformation that is uniquely dependent on its sequence conformation.
This conformation usually will be dL~terent, even if only a single base is ~chauged.
Most conformations have been reported to alter the physical configuration or siie sufficiently to be detectable by electrophoresis. A number of protocols have been described for SSCP including, but not limited to Lee et al., Arxal. Bioche~xx.
205: 289-' 293 (1992); Suzuki et al., Anal. Bioclze>7x.192: 82-84 (1991); Lo et al., Nucleic Acids S Research 20:1005-1009 (1992); Sarkar et al., Gerxomics 13: 441-443 (1992).
In accordance with this embodiment of the invention, a sample DNA is obtained from a patient's cells. In a preferred embodiment, the DNA sample is obtained from the patient's blood. However, any source of DNA may be used. The DNA is subjected to restriction endonuclease digestion. TIGR is used as a probe in IO accordance with the above-described RFLP methods. By comparing the RFLP
pattern of the TIGR gene obtained from normal and glaucomatous patients, one can determine a patient's predisposition (prognosis) to glaucoma. The polymorphism obtained in this approach can then be-cloned to identify the mutation at the coding region which alters the protein's structure or regulatory region of the gene which 15 affects its. expression level. Changes involving promoter interactions with other regulatory proteins can be identified by, for example, gel shift assays using I-TTM
cell extracts; fluid from the anterior chamber of the eye, serum, etc.
Interactions of TIER protein in glaucomatous cell extracts, fluid from the anterior chamber of the . eye, serum, etc. can be compared to control samples to thereby identify changes in 20 those properties of TTGR that relate to the pathogenesis of glaucoma:
Similarly such extracts and fluids. as well as others (blood, etc) can be used to diagnosis or predict steroid sensitivity.
- Several different classes of polymorphisms may be identified through such methods. Examples of such classes include: {1) polymorphisms present in the TIGR
25. cDNA of different individuals; {2) polymorphisms in non-translated TIGR
gene sequences, including the promoter or other regulatory regions of the T'IGR
gene; (3) polvmorphisms in genes whose products interact with TIGR regulatory sequences;
{4) polvmorphisms in gene sequences whose products interact with the TIGR
protein, or to which the TIGR protein binds.
~a In an alternate sub-embodiment, the evaluation is conducted using oligonucleotide "probes" whose sequence is complementary to that of a portion of ~EQ ID NO: 1, SEQ ID NO: 2 SEQ ID NO: 3; SEQ ID NO: 4, or SEQ ID NO: 5. Such molecules are then incubated with cell extracts of a patient under conditions sufficient to permit nucleic acid hybridization.
In one sub-embodiment of this aspect of the present invention, one can diagnose or predict glaucoma, related diseases and steroid sensitivity by ascertaining the TIGR response in a biopsy (or a macrophage or other blood cell sample), or other cell sample, or more preferably, in a sample of bodily fluid (especially, blood, serum, plasma, tears, buccal cavity, etc.). Since the TIGR
gene is induced in response to the presence of glucocorticoids, a highly preferred embodiment of this method comprises ascertaining such TIGR response prior to, during and/or subsequent to, the administration of a giucocorticoid. Thus, by way of illustration, glaucoma could be diagnosed or predicted by determining whether the administration of a glucocorticoid (administered topically, intraocularly, intramuscularly, systemically, or otherwise) alters the TIGR response of a particular individual, relative to that of normal individuals. Most preferably, for this purpose, at least a "TIGR gene-inducing amount" of the glucocorticoid will be provided.
As used herein, a TIER gene-inducing amount of a glucocorticoid is an amount of glucocorticoid sufficient to cause a detectable induction of TIGR expression in cells of glaucomatous or non-glaucomatous individuals.
III. Methods of Administration The agents of the present invention can be formulated according to known methods to prepare pharmacologically acceptable compositions, whereby these '.
materials, or their functional derivatives, having the desired degree of purity are combined in admixture with a physiologically acceptable carrier, excipient, or stabilizer. Such materials are non-toxic to recipients at the. dosages and concentrations employed. The active component of such compositions may be agents analogs or mimetics of such molecules. Where nucleic and molecules are employed, such molecules may be sense, antisense or triplex oligonucleotides of the TIGR promoter, TIGR cDNA, TIGR intron, TIGR exon or TIGR gene.
A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient patient. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
Suitable vehicles and their formulation, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pha~wnaceuncal jciences 116th ed.; Osol, A., Rd., Mack, ~aston PA (19&0 j j.
If the composition is to be water soluble, it may be formulated in a buffer such as phosphate or other organic acid salt preferably at.a pH of about 7 to 8. If the composition is only partially soluble in water, it may be , prepared as a microemulsion by formulating it with a nonionic surfactant such as Tweeri,.
Pluronics, or PEG, eg., Tween 80; in an amount af, for example, 0.04-0.05%
(w/v), bn incfease its solubility. The term "water soluble" as applied to the polysaccharides and polyethylene glycols is meant to include colloidal solutions and dispersions. In general, the solubility of the cellulose derivatives is determined by the degree of substitution of ether groups, and the stabilizing derivatives useful herein should have a sufficient quantity of such ether groups per anhydroglucose unit in .the celluiose chain to render the derivatives water soluble. A degree of ether substitution of at least 0.35 ether groups per anhydroglucose unit is generally sufficient. Additionally, the cellulose derivatives may be in the form of alkali metal salts, for example, the Li, Na, K or Cs salts.
Optionally other ingredients may be added such as antioxidants, e.g., ascorbic acid; low molecular weight (less than about ten residues) poiypeptides, e.g.;
polyargirune or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinyl pyrrolidone; amino acids, such as glycine, glutamic acid, aspartic and, or arginine;
monosaccharides, disaccl~aridesr and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; and sugar alcohols such as mannitol or sorbibol.
Additional pharmaceutical methods may be employed to control the duration of action. Controlled or sustained release preparations may be achieved through the use of polymers to complex or absorb the TIGR molecule{s) of the composition The controlled delivery may be exercised by selecting appropriate macromolecules (for example polyesters; polyamino acids, polyvinyl pyrrolidone, ethylenevinylacetate; methylcellulase, carboxymethylcellulose, or protamine sulfate) and the concentration of macromolecules as well as the methods of incorporation in order to control release.
Sustained release formulations may also be prepared, and include the formation of microcapsular particles and implantable articles. For preparing sustained-release compositions, the TIGR molecule{s) of the composition is preferably incorporated into a biodegradable matrix or microcapsule. A
suitable material for this purpose is a polylactide, although other polymers of poly-{a-*Trade-mark 4?
hydroxycarboxylic acids), such as poly-D-{-)-3-hydroxybutyric acid, ~P
133,988A), can be used. Other biodegradable polymers iniclude poly~{lafito~es);
poly(orthoesters), polyamino acids, hydrogels, or poly~(orthocarbona~es) poly(acetais). The polymeric material may also comprise polyesters, poly(la~etic acid) or ethylene vinylacetate copolymers. For examples of sustained ~~elease compositions, see U.S. Patent No. 3;773;919, EP ~58,481A, U.S. Patent Ne.
3,887;°99, .
EP 158,277A, Canadian Patent No. 1176565, Sidman, U. et aL, Biopoiymers 22:547 (1983), and Larger, R et al., Chtm. Teelr:12:98 (I982).
Alternatively, instead of incorporating the TIER molecules) of the composition into polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, by ooacervatian techniques or by interfacial polymerization, for example; hydroxymethylcellulose or gelatine-mi~ocapsules and poly(methylmethacylate) micxocapsules, respectively, or in colloidal drug delivery systems, for example, liposomes, albuaun microspheres, microemulsions;
nanoparticles, and nanocapsules or in macroemulsions: Such techniques are disclosed in Remington's Pharmaceutical Sciences (19811).
In an alternative embodiment, liposome formulations and methods that permif intracellular uptake of the molecule will be emuloved. Suitable methods are known in the art, see, for example, ..._y~~h, D.B. (US.
Patent No: 5,190,762), Callahan, M.V. ef at. (U.S. Patent No. ~5,270,OS2) and Gonzalezro, R.J. (PCT Application 91/0577i).
Having now generaDy described the invention, the same will be more readily understood through reference to the following examples which are provided by ?5 way of illustration, and are not intended to be limiting of the present invention, unless specified.
Single strand conformational polymorphism ,(SSCP) screening is~caned out according to the procedure of Hue et al., The Journal of Invesfigative Ophtlralrnolo~y 105.4: 529-632 (1995)_. SSCP primers are constructed corresponding to sequences found within the TIGR promoter and two of exons of TIGR The following primers are canst~ucted: forwa~3 primer "Sk-1a":
5' TGA GGC TTC CTC TGG AAA C 3' (SEQ ID NO: 6); reverse primer "1a2":
°'S'-TGA AAT CAG CAC ACC AGT AG3' (SEQ ID NO: 7); forward primer "CA2": ~S'-~ CCC ATA CCC CAA TAA TAG3' (SEQ ID NO: 8); reverse primer "Pr+1": 5'-AGA GTT CCC CAG ATT.TCA CC-3'' (SEQ ID NO: 9); forward primer "Pr-I": 5'-ATC TGG GGA ACT CTT CTC AG3' (SEQ ID NO:10); reverse primer "Pr+2(4A2)":
5'-'FAC AGT TGT TGC AGA TAC G3' (SEQ ID NO: 11); forward primer "Pr-2(4A)": 5' ACA ACG TAT CTG CAA CAA CTG3' (SEQ ID N0:12); reverse primer "Pr+3(4A)": 5' TCA GGC TTA ACT GCA GAA CC-3' (SEQ ID NO: I3); forward primer "Pr-3(4A)": 5' TTG GTT CTG CAG TTA AGC C-3° (SEQ ID NO: 14);
reverse primer "Pr+2(4A1)": 5'-AGC AGC ACA AGG GCA ATC C-3' (SEQ ID NO: 15);
reverse primer "1'r+1(4A}": 5'-ACA GGG CTA TAT TGT GGG-3' (5EQ ID NO: 16);
forward primer "KSIX": 5'fiCT GAG ATG CCA GCT GTC C-3' (SEQ ID NO: 1~;
reverse primer "SK1XX": 5'-CTG AAG CAT TAG AAG CCA AC 3' (SEQ ID NO:
18); forward primer "KS2aI": 5'-ACC TTG GAC CAG GCT GCC AG3' (SEQ ID
NO:1~.}; reverse primer "SK3" 5'-AGG TTT GTT CGA GTT CCA G3' (SEQ ID NO:
20}forward primer "KS4": 5'-ACA ATT ACT GGC AAG TAT GG-3' (SEQ ID NO:
21); reverse primer "SK6A": 5'-CCT TCT CAG CCT TGC TAC C-3' (SEQ ID NO: 22);
forward primer "ICSS": 5'-ACA CCT CAG CAG ATG CTA CC3' (SEQ ID NO: 23);
reverse primer "SK8": 5'-ATG GAT GAC TGA CAT GGC C-3' (SEQ ID NO: 24);
forward primer "KS6": 5' AAG GAT GAA CAT GGT CAC C 3' (SEQ ID NO: 25).
The locations of primers: Sk-la, cat; CA2, Pr+I, Pr-1, Pr+2(4A2), Pr-2(4A), Pr+3(4A}, Pr-3 (4A), Pr-3(4A}, Pr+2(4A1), and Pr+1(4A) are diagramatically set forth in Figure 4. . The location of primers: KS1X, SKIXX, Ks2al, SK3, KS4, SK6A, KSS, SK8, and KS6 are diagramatically set forth in F'igu=e 5.
Families with a history of POAG in Klamath Falls, Oregon, are screened by SSCP according to the method of Hue et aL, The journal o~' Investigative O~htluiImoIogy 25r 2U5.4; 529-G32 (1995). SSCP primers SK-Ia; ca2, CA2, Pr+1, Pr-2(4A), Pr+3(4A), SK1XX, and KS6 detect single strand conformational r polymorphisms in .this population. An SSCP is detected using SSCP primers Pr+3(4A) and Pr-2(4A). 70 family. members of the Klamath Fall, Oregon are screened with these primers and the results are set forth in Table 1.
~'e~tai SSCP+
Glaucoma ,positive individuals) 12 12 0 Glaucoma negative individuals 13 0 13 Spouses (glaurnma negative) 16 2 T4 -' Others2 29 6 23 1= glaucoma positive individuals as determined by IOP of greater than 25 mmHg 2 = unidentified glaucoma due to the age of the individual.
A second SSCP is detected using SSCP primers Pr+1 and CA2. 14 #amily members of the Kiamath Fall, Oregon are screened with these primers. A
characteristic polymorphism is found in the 6 affected family, members but absent in the,8 unaffected members. A third SSCP is detected using SSCP primers cat and sk-la. The same 14 family members of the Klamath Fall, Oregon that are screened with Pr+1 and CA2 are screened with cat and sk-la primers. A characteristic polymorphism is found in the 6 affected family members but absent in the 8 unaffected members. A fourth SSCP is detected using SSCP primers KS6 and SK1XX. 22 family members of the Klamath Fall, Oregon and 10 members of a Portland; Oregon pedigree are screened with these primers. A polymorphism is found in exon 3. The results are as set forth in Table 2.
_ TABLE 2 Total SSCP+ SSCP-IQamath Fall, Oregon Glaucoma positive individuals)3 3 0 Glaucoma negative individuals6 0 6 Others2 13 6 7 Portland, Oregon Glaucoma positive individuals)6 6 0 Glaucoma negative individuals4 0 4 O.thers2 0 0 0 1= glaucoma positive individuals d by IOP of greater than 25 mmHg as determine 2 = unidentified glaucoma individual.
due to the age of the SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
(ii) TITLE OF INVENTION: METHODS FOR THE DIAGNOSIS, PROGNOSTSAND
TREATMENT OF GLAUCOMA AND RELATED DISORDERS
(iii) NUMBER OF SEQUENCES: 32 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SMART & BIGGAR
(B) STREET: P.O. BOX 2999, STATION D
(C) CITY: OTTAWA
(D) STATE: ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) CURRENT APPLICATTON DATA:
(A) APPLICATION NUMBER: Division of CA 2,278,782 (B) FILING DATE: 09-JAN-1998 (C) CLASSIFICATTON:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/791,154 (B) FILING DATE: 28-JAN-1997 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/938,669 (B) FILING DATE: 26-SEP-1997 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SMART & BIGGAR
(B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 73185-12D
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)-232-2486 (B) TELEFAX: (613)-232-8440 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5300 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
AATGTGAAAG
TAAAGAATCA
ATTTTAGTGA
ATGGTAAATC
AAAATGCCAG
GGAAAAAATG
TCCAAATTGG
AAAATGGGAA
AAAACCAGAT
TAACAATAAC
CTTTCATAAC
GAACACAAAA
ATTGACTGGG CTAAGCCTGG ACTTTCAAGG GAAATATGAA AAACTGAGAG 7$0 CAAAACAAAA
CCCCTCAGCA
TAAGAAACTC
GCATAATCAG
TCCCAGCTCC
GGATAGGTCA GAAATCATTA GAAATCACTG TGTCCCCATC CTAACTTTTT 10$0 CAGAATGATC
GTAGTAACTG AGGCTGTAAGATTACTTAGTTTCTCCTTATfiAGGAACTCTTTTTCTCTGT3720 TTATACTATA TTACAGTTGTTGCAGATACGTTGTAAGTGAAATATTTATACTCAAAA.CTA4440 AGGGGGGAAA TCTGCCGCTTCTATAGGAAfiGCTCTCCCTGGAGCCTGGTAGGGTGCTGTC4800 TATAAACTAG
(2) INFORMATTON ID N0:2:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH:
base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS:
single (D) TOPOLOGY:linear (xi) SEQUENCE SEQ ID
DESCRIPTION: N0:2:
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6169 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID
N0:3:
AAATTAGAAA GCTAGGGGTG
GTTCTCCCAA
AGATACACAG
(2) INFORMATION ID N0:4:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 926 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION:SEQ ID
N0:4:
(2) INFORMATION ID N0:5:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 2099 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION:SEQ ID
N0:5:
(2) INFORMATION ID N0:6:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH:
19 base pairs (B) TYPE: eic acid nucl (C) STRANDEDNESS:
single (D) TOPOLOGY:linear (xi) SEQUENCE SEQ ID
DESCRTPTION: N0:6:
(2) INFORMATION ID N0:7:
FOR SEQ
(i) SEQUENCE
CHARACTERTSTICS:
(A) LENGTH: base pairs (B) TYPE: eic acid nucl (C) STR.ANDEDNESS:
single (D) TOPOLOGY:linear (xi) SEQUENCE SEQ ID :
DESCRIPTION: N0:7 (2 ) INFORMATION FOR ID N0:8:
SEQ
(i) S EQUENCE S:
CHARACTERISTIC
(A) LENGTH: base pairs (B) TYPE: eic acid nucl (C) STRANDEDNESS: single (D) TOPOLOGY:linear (xi) SEQUENCE SCRIPTION:SEQ ID :
DE N0:8 SO
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
(2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
(2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
(2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
(2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
(2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
(2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:
(2) INFORMATION ID N0:25:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION:SEQ ID
N0:25:
(2) INFORMATION ID N0:26:
FOR SEQ
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 1548 base rs pai (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
cDNA
(xi) SEQUENCE DESCRIPTION:SEQ ID
N0:26:
(2) INFORMATION ID N0:27:
FOR SEQ
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 178 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
Thr Gly Ala val Val Tyr Ser Gly Ser Leu Tyr Phe Gln Gly Ala Glu Ser Arg Thr Val Ile Arg Tyr Glu Leu Asn Thr Glu Thr Val Lys Ala Glu Lys Glu Ile Pro Gly Ala Gly Tyr His Gly Gln Phe Pro Tyr Ser Trp Gly Gly Tyr Thr Asp Ile Asp Leu Ala Val Asp Glu Ala Gly Leu Trp Val Ile Tyr Ser Thr Asp Glu Ala Lys Gly Ala Ile Val Leu Ser Lys Leu Asn Pro Glu Asn Leu Glu Leu Glu Gln Thr Trp Glu Thr Asn Ile Arg Lys Gln Ser Val Ala Asn Ala Phe Ile Ile Cys Gly Thr Leu Tyr Thr Val Ser Ser Tyr Thr Ser Ala Asp Ala Thr Val Asn Phe Ala Tyr Asp Thr Gly Thr Gly Ile Ser Lys Thr Leu Thr Ile Pro Phe Lys Asn Arg Tyr Lys Tyr Ser Ser Met Ile Asp Tyr Asn Pro Leu Glu Lys Lys Leu Phe Ala Trp Asp Asn Leu Asn Met Val Thr Tyr Asp Ile Lys Leu Ser (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 131 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
Arg Phe Asp Leu Lys Thr Glu Thr Ile Leu Lys Thr Arg Ser Leu Asp Tyr Ala Gly Tyr Asn Asn Met Tyr His Tyr Ala Trp Gly Gly His Ser Asp Ile Asp Leu Met Val Asp Glu Ser Gly Leu Trp Ala Val Tyr Ala Thr Asn Gln Asn Ala Gly Asn Ile Val Val Ser Arg Leu Asp Pro Val Ser Leu Gln Thr Leu Gln Thr Trp Asn Thr Ser Tyr Pro Lys Arg Xaa Pro Gly Xaa Ala Phe Ile Ile Cys Gly Thr Cys Tyr Val Thr Asn Gly Tyr Ser Gly Gly Thr Lys Val His Tyr Ala Tyr Gln Thr Asn Ala Ser Thr Tyr Glu Tyr Ile Asp Ile Pro Phe Gln Asn Lys Leu Xaa Pro His Phe Pro Cys (2) INFORMATION ID N0:29:
FOR
SEQ
(i) CS:
SEQUENCE
CHARACTERISTI
(A) LENGTH:178amino ids ac (B) TYPE: acid amino (C) STRANDEDNESS:
single (D) TOPOLOGY:
linear (ii) TYPE:
MOLECULE None (xi) DESCRIPTION: SEQID N0:29:
SEQUENCE
Gly ThrGly Gln ValTyr Asn GlySerIleTyr PheAsn LysPhe Val Gln SerHis Ile IleArg Phe AspLeuLysThr GluThr IleLeu Ile Lys ThrArg Ser AspTyr Ala GlyTyrAsnAsn MetTyr HisTyr Leu Ala TrpGly Gly SerAsp Ile AspLeuMetVal AspGlu AsnGly His Leu TrpAla Val AlaThr Asn GlnAsnAlaGly AsnIle ValIle Tyr Ser LysLeu Asp ValSer Leu GlnIleLeuGln ThrTrp AsnThr Pro Ser TyrPro Lys SerAla Gly GluAlaPheIle IleCys GlyThr Arg Leu TyrVal Thr GlyTyr Ser GlyGlyThrLys ValHis TyrAla Asn Tyr GlnThr Asn SerThr Tyr GluTyrIleAsp IlePro PheGln Ala Asn LysTyr Ser IleSer Met LeuAspTyrAsn ProLys AspArg His Ala LeuTyr Ala AsnAsn Gly HisGlnThrLeu TyrAsn ValThr Trp Leu Phe (2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 177 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
Gly Ala Gly Val Val Val His Asn Asn Asn Leu Tyr Tyr Asn Cys Phe Asn Ser His Asp Met Cys Arg Ala Ser Leu Thr Ser Gly Val Tyr Gln Lys Lys Pro Leu Leu Asn Ala Leu Phe Asn Asn Arg Phe Ser Tyr Ala Gly Thr Met Phe Gln Asp Met Asp Phe Ser Ser Asp Glu Lys Gly Leu Trp Val Ile Phe Thr Thr Glu Lys Ser Ala Gly Lys Ile Val Val Gly Lys Val Asn Val Ala Thr Phe Thr Val Asp Asn Ile Trp Ile Thr Thr Gln Asn Lys Ser Asp Ala Ser Asn Ala Phe Met Tle Cys Gly Val Leu Tyr Val Thr Arg Ser Leu Gly Pro Lys Met Glu Glu Val Phe Tyr Met Phe Asp Thr Lys Thr Gly Lys Glu Gly His Leu Ser Ile Met Met Glu Lys Met Ala Glu Lys Val His Ser Leu Ser Tyr Asn Ser Asn Asp Arg Lys Leu Tyr Met Phe Ser Glu Gly Tyr Leu Leu His Tyr Asp Ile Ala Leu (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 74 amino acids (B) TYPE: amino acid (C) STRANDEDNESS; single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:
Gly Val Val Tyr Ser Arg Leu Thr Glu Thr Leu Ala Gly Tyr Asn Asn Tyr Ala Trp Gly Gly Asp Ile Asp Leu Val Asp Glu Gly Leu Trp Tyr Thr Ala Gly Ile Val Ser Lys Leu Pro Leu Gln Thr Trp Thr Lys Ala Phe Ile Ile Cys Gly Thr Leu Tyr Val Thr Tyr Val Tyr Ala Tyr Thr Ile Tyr Asp Tyr Asn Pro Lys Leu Tyr Leu (2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 504 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (v) FRAGMENT TYPE: N-terminal (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:
Met Arg Phe Phe Cys Ala Arg Cys Cys Ser Phe Gly Pro Glu Met Pro Ala Val Gln Leu Leu Leu Leu Ala Cys Leu Val Trp Asp Val Gly Ala Arg Thr Ala Gln Leu Arg Lys Ala Asn Asp Gln Ser Gly Arg Cys G.ln Tyr Thr Phe Ser Val Ala Ser Pro Asn Glu Ser Ser Cys Pro Glu Gln Ser Gln Ala Met Ser Val Ile His Asn Leu Gln Arg Asp Ser Ser Thr Gln Arg Leu Asp Leu Glu Ala Thr Lys Ala Arg Leu Ser Ser Leu Glu Ser Leu Leu His Gln Leu Thr Leu Asp Gln Ala Ala Arg Pro Gln Glu Thr Gln Glu Gly Leu Gln Arg Glu Leu Gly Thr Leu Arg Arg Glu Arg Asp Gln Leu Glu Thr Gln Thr Arg Glu Leu Glu Thr Ala Tyr Ser Asn Leu Leu Arg Asp Lys Ser Val Leu Glu Glu Glu Lys Lys Arg Leu Arg Gln Glu Asn Glu Asn Leu Ala Arg Arg Leu Glu Ser Ser Ser Gln Glu Val Ala Leu ArgArgGly GlnCys ProGlnThr ArgAspThr Ala Arg Arg AlaValPro FroGlySer ArgGlu ValSerThr TrpAsnLeu Asp Thr LeuAlaPhe GlnGluLeu LysSer GluLeuThr GluValPro Ala Ser ArgIleLeu LysGluSer ProSer GlyTyrLeu ArgSerGly Glu Gly AspThrGly CysGlyGlu LeuVal TrpValGly GluProLeu Thr Leu ArgThrAla GluThrIle ThrGly LysTyrGly ValTrpMet Arg Asp ProLysPro ThrTyrPro TyrThr GlnGluThr ThrTrpArg Ile Asp ThrValGly ThrAspVal ArgGln ValPheGlu TyrAspLeu Ile Ser GlnPheMet GlnGlyTyr ProSer LysValHis IleLeuPro Arg Pro LeuGluSer ThrGlyAla ValVal TyrSerGly SerLeuTyr Phe Gln GlyAlaGlu SerArgThr ValIle ArgTyrGlu LeuAsnThr Glu Thr ValLysAla GluLysGlu IlePro GlyAlaGly TyrHisGly Gln Phe ProTyrSer TrpGlyGly TyrThr AspIleAsp LeuAlaVal Asp Glu AlaGlyLeu TrpValIle TyrSer ThrAspGlu AlaLysGly Ala Ile ValLeuSer LysLeuAsn ProGlu AsnLeuGlu LeuGluGln Thr Trp GluThrAsn IleArgLys GlnSer ValAlaAsn AlaPheIle Ile Cys GlyThrLeu TyrThrVal SerSer TyrThrSer AlaAspAla Thr Val AsnPheAla TyrAspThr GlyThr GlyIleSer LysThrLeu Thr Ile ProPheLys AsnArgTyr LysTyr SerSerMet IleAspTyr Asn Pro LeuGluLys LysLeuPhe AlaTrp AspAsnLeu AsnMetVal Thr Tyr AspIleLys LeuSerLys Met
Claims (4)
1. A method of treating glaucoma which comprises administering to a glaucomatous patient an effective amount of an agent capable of binding a cis element located within SEQ ID NO: 1.
2. The method of claim 1, wherein said agent inhibits the expression of a TIGR mRNA.
3. The method of claim 1, wherein said agent binds a DNA sequence within SEQ ID NO: 1.
4. The method of claim 1, wherein said agent binds a nucleic acid molecule that comprises a cis element characteristic of PRL-FP111, a nucleic acid molecule that comprises a glucocorticoid response cis element, a nucleic acid molecule that comprises a cis element characteristic of GR/PR, a nucleic acid molecule that comprises a shear stress response cis element, a nucleic acid molecule that comprises a glucocorticoid response cis element, a nucleic acid molecule that comprises a cis element characteristic of CBE, a nucleic acid molecule that comprises a cis element capable of binding NFE, a nucleic acid molecule that comprises a cis element capable of binding KTF.1-CS, a nucleic acid molecule that comprises a cis element characteristic of PRE, a nucleic acid molecule that comprises a cis element characteristic of ETF-EGFR, a nucleic acid molecule that comprises a cis element capable of binding SRE-cFos, a nucleic acid molecule that comprises a cis element characteristic of Alu, a nucleic acid molecule that comprises a cis element capable of binding VBP, a nucleic acid molecule that comprises a cis element characteristic of Malt-CS, a nucleic acid molecule that comprises a cis element capable of binding ERE, a nucleic acid molecule that comprises a cis element characteristic of NF-mutagen, a nucleic acid molecule that comprises a cis element capable of binding myc-PRF, a nucleic acid molecule that comprises a cis element capable of binding AP2, a nucleic acid molecule that comprises a cis element capable of binding HSTF, a nucleic acid molecule that comprises a cis element characteristic of SBF, a nucleic acid molecule that comprises a cis element capable of binding NF-1, a nucleic acid molecule that comprises a cis element capable of binding NF-MHCIIA/B, a nucleic acid molecule that comprises a cis element capable of binding PEA1, a nucleic acid molecule that comprises a cis element characteristic of ICS, a nucleic acid molecule that comprises a cis element capable of binding ISGF2, a nucleic acid molecule that comprises a cis element capable of binding zinc, a nucleic acid molecule that comprises a cis element characteristic of CAP/CRP-galO, a nucleic acid molecule that comprises a cis element capable of binding AP1, a nucleic acid molecule that comprises a cis element capable of binding SRY, a nucleic acid molecule that comprises a cis element characteristic of GC2, a nucleic acid molecule that comprises a cis element capable of binding PEA3, a nucleic acid molecule that comprises a cis element characteristic of MIR, a nucleic acid molecule that comprises a cis element capable of binding NF-HNF-1, a nucleic acid molecule that comprises a thyroid receptor cis element, and a nucleic acid molecule that comprises a cis element capable of binding NFKB.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US79115497A | 1997-01-28 | 1997-01-28 | |
| US08/791,154 | 1997-01-28 | ||
| US08/938,669 US6171788B1 (en) | 1997-01-28 | 1997-09-26 | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
| US08/938,669 | 1997-09-26 | ||
| CA002278782A CA2278782C (en) | 1997-01-28 | 1998-01-09 | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002278782A Division CA2278782C (en) | 1997-01-28 | 1998-01-09 | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2456777A1 true CA2456777A1 (en) | 1998-07-30 |
Family
ID=32397320
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002456777A Abandoned CA2456777A1 (en) | 1997-01-28 | 1998-01-09 | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA2456777A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112870379A (en) * | 2021-02-02 | 2021-06-01 | 复旦大学附属眼耳鼻喉科医院 | Response type NO nano-drug, preparation method and application thereof |
| CN113655226A (en) * | 2021-10-20 | 2021-11-16 | 首都医科大学附属北京朝阳医院 | Calibrator matrix for aqueous humor detection and preparation method and application thereof |
-
1998
- 1998-01-09 CA CA002456777A patent/CA2456777A1/en not_active Abandoned
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112870379A (en) * | 2021-02-02 | 2021-06-01 | 复旦大学附属眼耳鼻喉科医院 | Response type NO nano-drug, preparation method and application thereof |
| CN113655226A (en) * | 2021-10-20 | 2021-11-16 | 首都医科大学附属北京朝阳医院 | Calibrator matrix for aqueous humor detection and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0789762B1 (en) | Methods for the diagnosis of glaucoma | |
| Viskochil et al. | Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus | |
| Hani et al. | A missense mutation in hepatocyte nuclear factor-4 alpha, resulting in a reduced transactivation activity, in human late-onset non-insulin-dependent diabetes mellitus. | |
| US20030176341A1 (en) | Interferon-alpha induced gene | |
| EP1009753B1 (en) | Hypoxia-regulated genes | |
| AU1104700A (en) | Compositions and methods of disease diagnosis and therapy | |
| CA2278782C (en) | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders | |
| AU5810999A (en) | Sequences characteristic of hypoxia-regulated gene transcription | |
| US6087107A (en) | Therapeutics and diagnostics for congenital heart disease based on a novel human transcription factor | |
| AU775183B2 (en) | Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders | |
| WO1998032850A9 (en) | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders | |
| US7138511B1 (en) | Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders | |
| CA2456777A1 (en) | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders | |
| US6417342B1 (en) | Macular degeneration diagnostics and therapeutics | |
| AU779634B2 (en) | Diagnostics for the diagnosis or prognosis of glaucoma and related disorders | |
| MXPA99006976A (en) | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders | |
| CA2528692C (en) | Mutations in the slc40a1 gene associated to impaired iron homeostasis | |
| WO2000037617A1 (en) | Glutamine: fructose-6-phosphate aminotransferase ii enzyme and their encoding nucleic acids | |
| NZ580235A (en) | A method for selecting responders to blockade of integrin receptors | |
| WO1999037812A1 (en) | Single nucleotide polymorphisms of the uncoupling protein 2 (ucp2) gene | |
| Milet et al. | Corpuscles of stannius of the eel (Anguilla anguilla L.) encode parathyroid hormone related protein (PTHrp) like products | |
| Rian et al. | The parathyroid hormone-related protein gene is differently regulated by agents that activate protein kinase C and increase cyclic AMP accumulation in two human osteosarcoma cell lines | |
| Pausova et al. | Rapid polymerase chain reaction analysis and characterization of a polymorphism in the human parathyroid hormone-like peptide gene | |
| Hendy et al. | Sublocalization of the mouse parathyroid hormone-like peptide gene to distal chromosome 6 by interspecific backcross analysis and in situ hybridization | |
| JP2002125673A (en) | Gene encoding new uromodulin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Dead |