CA2453195A1 - Sir2 activity - Google Patents

Abstract

This invention relates to methods of screening compounds that modulate cellular and organismal processes by modification of the activity of SIR2 and/or transcription factors, e.g., p53, particularly methods of screening f or compounds that modify lifespan and/or metabolism of a cell or an organism by modulation of the activity of SIR2 and/or transcription factors, e.g., p53, and more particularly to methods of screening for compounds that modulate th e activity of Sir2 and/or transcription factors, e.g., p53. In particular, the present invention relates to a method for screening a compound, by providing a test mixture comprising a transcription factor, Sir2, and a Sir2 cofactor wi th the compound, and evaluating an activity of a component of the test mixture in the presence of the compound. The invention further relates to therapeutic uses of said compounds. The invention further relates to a method of modifyi ng the acetylation status of a transcription factor binding site on histone or DNA by raising local concentrations of Sir2.

Description

SIRZ ACTIVITY
CLAIM OF PRIORITY
This application claims priority under 35 USC ~119(e) to U.S. Patent Application Serial No. 60/303,370, filed on July 6, 2001, and U.S. Patent Application Serial No.
60/303,456, also filed on July 6, 2001, the entire contents of which are hereby incorporated by reference.
GOVERNMENT SUPPORT
The invention was supported, in whole or in part, by a grant RO1 CA78461 to RAW;
NHLBI/NIH Fellowship to SKD K08 HL04463. The U.S. Government has certain rights in the invention.
BACKGROUND
Regulation of the cell cycle is important in homeostasis of both cells and organisms (e.g., mammalian cells or mammals). Disruptions in the normal regulation of the cell cycle can occur, for example, in tumors which proliferate uncontrollably, in response to DNA
damage (e.g., ionizing radiation) to the cell or organism, and under conditions of stress (e.g., oxidative stress) in the cell or organism.
The p53 tumor suppressor protein exerts anti-proliferative effects, including growth arrest, apoptosis, and cell senescence, in response to various types of stress, e.g., DNA damage (Levine, 1997; Giaccia and Kastan, 1998; Prives and Hall, 1999; Oren, 1999;
Vogelstein et al., 2000). Inactivation of p53 function appears to be critical to tumorigenesis (Hollstein et al., 1999). Mutations in the p53 gene have been shown in more than half of all human tumors (Hollstein et al., 1994). Accumulating evidence further indicates that, in the cells that retain wild-type p53, other defects in the p53 pathway also play an important role in tumorigenesis (Prives and Hall, 1999; Lohrum and Vousden, 1999; Vousden, 2000). The molecular function of p53 that is required for tumor suppression involves its ability to act as a transcriptional factor in regulating endogenous gene expression. A number of genes which are critically involved in either cell growth arrest or apoptosis have been identified as p53 direct targets, including p21CIP1/WAF1, Mdm2, GADD45, Cyclin G, 14-3-3F, Noxa, p53AIP1, PUMA and others (Nakano and Vousden, 2001; Yu et al., 2001; Oda et al., 2000a, 2000b; El-Deriry et al., 1993;
Wu et al., 1993; Barak et al., 1993; Kastan et al., 1992; Olcamoto and Beach, 1994).
p53 is a short-lived protein whose activity is maintained at low levels in normal cells.
Tight regulation of p53 is essential for its effect on tumorigenesis as well as maintaining normal cell growth. The precise mechanism by which p53 is activated by cellular stress is not completely understood. It is generally thought to involve primarily post-translational modifications of p53, including phosphorylation and acetylation (reviewed in Appella and Anderson, 2000; Giaccia and Kastan, 1998). Early studies demonstrated that CBP/p300, a histone acetyl-transferase (HAT), acts as a coactivator of p53 and potentiates its transcriptional activity as well as biological function in viv~ (Gu et al., 1997; Lill et al., 1997; Avantaggiati et al., 1997). Genetic studies have also revealed that p300 mutations are present in several types of tumors, and that mutations of CBP in human Rubinstein-Taybi syndrome as well as CBP
knockout mice lead to higher risk of tumorigenesis, further supporting an important role for this interaction in the tumor suppressor pathway (reviewed in Goodman and Smolik, 2000; Gile et al., 1998; Kung et al., 2000; Gayther et al., 2000). Significantly, the observation of functional synergism between p53 and CBP/p300 together with its intrinsic HAT activity led to the discovery of a novel FAT (Transcriptional factor acetyl-transferase) activity of CBP/p300 on p53 which suggests that acetylation represents a general functional modification for non-histone proteins in vivo (Gu and Roeder, 1997) which has been shown for other transcriptional factors (reviewed in Kouzarides, 2000; Sterner and Berger, 2000; Muth et al., 2001).
p53 is specifically acetylated at multiple lysine residues (Lys 370, 371, 372, 381, 382) of the C-terminal regulatory domain by CBP/p300. The acetylation of p53 can dramatically stimulate its sequence-specific DNA binding activity, perhaps as a result of an acetylation-induced conformational change (Gu and Roeder, 1997; Sakaguchi et al., 1998;
Liu et al., 1999).
By developing site-specific acetylated p53 antibodies, CBP/p300 mediated acetylation of p53 was confirmed ih vivo by a number of studies (reviewed in Chao et al., 2000;
Ito et al., 2001). In addition, p53 can be acetylated at Lys320 by another HAT cofactor, PCAF, although the ifz vivo functional consequence needs to be further elucidated (Sakaguchi et al., 1998;
Liu et al., 1999;
Liu et al., 2000). Steady-state levels of acetylated p53 are stimulated in response to various types of stress (reviewed in Ito et al., 2001).

Recently, by introducing a transcription defective pS3 mutant (pS3Q2SS26) into mice, it was found that the mutant mouse thymocytes and ES cells failed to undergo DNA
damage-induced apoptosis (Chao et al., 2000; Jimenez et al., 2000). Interestingly, this mutant protein was phosphorylated normally at the N-terminus in response to DNA damage but could not be acetylated at the C-terminus (Chao et al., 2000), supporting a critical role of pS3 acetylation in transactivation as well as pS3-dependent apoptotic response (Chao et al., 2000; Luo et al., 2000).
Furthermore, it has been found that oncogenic Ras and PML upregulate acetylated pS3 in normal primary fibroblasts, and induce premature senescence in a pS3-dependent manner (Pearson et al., 2000; Ferbeyre et al., 2000). Additionally acetylation, not phosphorylation of the pS3 C-terminus, may be required to induce metaphase chromosome fragility in the cell (Yu et al., 2000). Thus, CBP/p300-dependent acetylation of pS3 may be a critical event in pS3-mediated transcriptional activation, apoptosis, senescence, and chromosome fragility In contrast, much less is known about the role of deacetylation in modulating pS3 function. Under normal conditions, the proportion of acetylated pS3 in cells remains low. This may reflect the action of strong deacetylase activities in viv~. The acetylation level of pS3 is enhanced when the cells are treated with histone deacetylase (HDAC) inhibitors such as Trichostatin A (TSA). These observations led to identification of a HDAC1 complex which is directly involved in pS3 deacetylation and functional regulation (Luo et al., 2000; Juan et al., 2000). PID/MTA2, a component of the HDAC1 complex, acts as an adaptor protein to enhance HDAC1-mediated deacetylation of pS3 which is repressed by TSA (Luo et al., 2000). In addition, Mdm2, a negative regulator of pS3, actively suppresses CBP/p300-mediated pS3 acetylation, and this inhibitory effect can be abrogated by tumor suppressor p 19ARF..
Acetylation may have a critical role in the pS3-MDM2-pI9ARF feed back loop (Ito et al., 2001;
Kobet et al., 2000).
The Silent Information Regulator (SIR) family of genes represents a highly conserved group of genes present in the genomes of organisms ranging from archaebacteria to a variety of eukaryotes (Frye, 2000). The encoded SIR proteins are involved in diverse processes from regulation of gene silencing to DNA repair. The proteins encoded by members of the SIR2 gene family show high sequence conservation in a 2S0 amino acid core domain. A well-characterized gene in this family is S. ce~evisiae SIR2, which is involved in silencing HM
loci that contain information specifying yeast mating type, telomere position effects and cell aging (Guarente, 1999; Kaeberlein et al., 1999; Shore, 2000). The yeast Sir2 protein belongs to a family of histone deacetylases (reviewed in Guarente, 2000; Shore, 2000). The Sir2 homolog, CobB, in Salrraonella typhiryaurium, functions as an NAD (nicotinamide adenine dinucleotide)-dependent ADP-ribosyl transferase (Tsang and Escalante-Semerena, 1998).
The Sir2 protein is a deacetylase which uses NAD as a cofactor (Imai et al., 2000;
Moazed, 2001; Smith et al., 2000; Tanner et al., 2000; Tanny and Moazed, 2001). Unlike other deacetylases, many of which are involved in gene silencing, Sir2 is insensitive to histone deacetylase inhibitors like trichostatin A (TSA) (Imai et al., 2000; Landry et al., 2000a; Smith et al., 2000).
Deacetylation of acetyl-lysine by Sir2 is tightly coupled to NAD hydrolysis, producing nicotinamide and a novel acetyl-ADP ribose compound (1-O-acetyl-ADP-ribose) (Tanner et al., 2000; Landry et al., 2000b; Tanny and Moazed, 2001). The NAD-dependent deacetylase activity of Sir2 is essential for its functions which can connect its biological role with cellular metabolism in yeast (Guarente, 2000; Imai et al., 2000; Lin et al., 2000;
Smith et a1.,~2000).
Mammalian Sir2 homologs have NAD-dependent histone deacetylase activity (Imai et al., 2000;
Smith et al., 2000). Most information about Sir2 mediated functions comes from the studies in yeast (Gartenberg, 2000; Gottschling, 2000).
Among Sir2 and its homolog proteins (HSTs) in yeast, Sir2 is the only protein localized in nuclei, which is critical for both gene silencing and extension of yeast life-span (reviewed in Guarente, 2000). Based on protein sequence homology analysis, mouse Sir2a and its human ortholog SIRT1 (or human Sir2a or hSir2) are the closest homologs to yeast Sir2 (Imai et al., 2000; Frye, 1999, 2000) and both exhibit nuclear localization (Figure 7C).
Homologues of Sir2 have been identified in almost all organisms examined including bacteria, which has no histone proteins (reviewed in Gray and Ekstrom, 2001; Frye, 1999; 2000; Brachrnann et al., 1995). For this reason it is likely that Sir2 also targets non-histone proteins for functional regulation (Muth et al., 2001).
The S. ce~evisiae Sir2 is involved in DNA damage responses (Martin et al., 1999;
McAinsh et al., 1999; Mills et al., 1999). Tn mammalian cells, one of the primary mediators of the DNA damage response is the p53 protein (Levine, 1997; Oren, 1999;
Vogelstein et al., 2000). Following DNA damage, the p53 protein is protected from rapid degradation and acquires transcription-activating functions, these changes being achieved largely through post-translational modifications (Abraham et al., 2000; Canman et al., 1998; Chehab et al., 1999;
Sakaguchi et al., 1998; Shieh et al., 2000; Siliciano et al., 1997).
Transcriptional activation of p53 protein in turn upregulates promoters of a number of genes including p2lWAFl (el-Deiry et al., 1993) that promotes cell cycle exit or death-inducing proteins like PIDD
(Lin et al., 2000).
The p53 protein is phosphorylated in response to DNA damage (Siliciano et al., 1997).
There are at least 13 different residues both at the N and C terminal portions of p53 protein that are phosphorylated by various kinases (Appella and Anderson, 2000). For example, the ATM
and ATR proteins phosphorylate p53 at residue SerlS (Khanna et al., 1998;
Siliciano et al., 1997; Tibbetts et al., 1999) and Chkl/2 kinases at residue Ser20 (Chehab et al., 1999; Shieh et al., 2000).
Modification of SerlS is important for the functional activation of the p53 protein.
Phosphorylation of SerlS may increase the affinity of the p300 acetylase for p53 (Dumaz and Meek, 1999; Lambent et al., 1998).
p53 is acetylated ih vitro by p300 at Lys 370-372, 381 and 382 (Gu and Roeder, 1997).
In response to DNA damage, p53 is also acetylated i~z vivo at Lys 373 and Lys 382 (Abraham et al., 2000; Sakaguchi et al., 1998). Other factors that can affect acetylation of p53 include MDM2 protein, which is involved in the negative regulation of p53 (Oren, 1999) and can suppress acetylation of p53 protein by p300 (Ito et al., 2001; Kobet et al., 2000). While acetylation by p300 and deacetylation by the TSA-sensitive HDAC1 complex (Luo et al., 2000) have been shown to be important in regulation of p53 protein activity, the remaining factors responsible for its regulation as a transcription factor remain elusive.
Analogs of NAD that inhibit endogenous ADP-ribosylases reduce induction of p21 WAFT
in response to DNA damage and overcome p53-dependent senescence (Vaziri et al., 1997). In addition, p53 protein can bind to the NAD-dependent poly-ADP-ribose polymerase.
The SIR complex in Sacchay~omyces ce~evisiae was originally identified through its involvement in the maintenance of chromatin silencing at telomeres and at mating type loci. It is composed of four components, Sirlp, Sir2p, Sir3p, and Sir4p, that normally reside at yeast telomeres. In response to DNA damage, the SIR complexes relocate to the site of double-stranded breaks where they participate in the repair of the lesions by non-homologous end joining. This DNA damage response is dependent on the function of the checkpoint pathway MEClis a homolog of the ATM protein that coordinates the DNA damage response in mammalian cells, in part by triggering the cascade of events that lead to the stabilization of the p53 protein (Canman et al., 1998). Another major function of Sir2, gene silencing, is closely tied to the regulation of lifespan in S. cerevisiae (Guarente, 1999).
Double-strand breaks in the genome of mammals invoke a cascade of signaling events that ultimately cause phosphorylation and subsequent stabilization of p53 protein. In addition, these strand breaks lead to activation of p53 protein as a transcription factor. This activation may be due largely to its acetylation (Gu and Roeder, 1997; Sakaguchi et al., 1998). The resulting stabilized, activated p53 protein contributes to the upregulation of cyclin-dependent kinase inhibitors such as p21 WAF1 and hence to the cytostatic effects of p53.
Alternatively, depending on the cellular background or degree of damage, the apoptotic effects of p53 may predominate through its ability to induce expression of pro-apoptotic proteins such as PmD
(Lin et al., 2000).
These various phenomena indicate that specific components of the machinery that moiutors the integrity of the genome are clearly able to alert p53 to the presence of genetic damage, leading to its functional activation. Conversely, in the event that damage has been successfully repaired, signals must be conveyed to p53 in order to deactivate it. Thus, a cell cycle advance that has been halted by p53 to enable repair to proceed should be relieved following completion of repair, enabling the cell to return to its active growth state. For this reason, the inactivation of p53 becomes as important physiologically as its activation.
In light of this information, modulators of Sir2 a~idlor p53 activity would be useful in modulating various cellular processes including, e.g., repair of DNA damage, apoptosis, oncogenesis, gene silencing and senescence, inter alia.
SUMMARY
In one aspect, the present invention relates to methods and compositions employing p53 and Sir2 proteins. Cellular and organismal processes are regulated by modulating the activity of Sir2 and/or p53. In some cases the regulated processes control a program of regulated aging and/or metabolism of a cell or an organism. Compounds that regulate the activity of Sir2 and/or p53 can be identified, for example, by a method described herein.
As used herein, the term "Sir2" refers to a protein that is at least 25%
identical to the 250 amino acid conserved Sir2 core catalytic domain, amino acids 258-451 of SEQ ID
NO. 12. A

Sir2 protein can be for example, at least 30, 40, 50, 60, 70, 80, 85, 90, 95, 99% identical to amino acids 258-451 of SEQ ID NO. 12. For example, the Sir2 protein is human SIRTl, GenBank Accession No: AF083106. There are at least seven different Sir2 homologs present in mammalian cells (Frye, 1999, 2000; Imai et al., 2000; Gray and El~strom, 2001). The mouse Sir2a and human SIRT1, are preferred Sir2 proteins.
Sir2 can be a protein (e.g., SEQ ID NOS. 8, 10, 12, 14, 16 or 18) or a fragment of the protein capable of deacetylating a substrate in the presence or NAD and/or an NAD analog and/or a fragment capable of binding to a target protein, e.g., a transcription factor. Such functions can be evaluated by a method described herein. A Sir2 fragment can include a "domain" which is a structurally stable folded unit of the full-length protein. The Sir2 protein can be encoded by the nucleic acid sequence of SEQ ID NOS. 7, 9, 11, 13, 15 or 17. In a preferred embodiment, the Sir2 is a human Sir2. A model of the three-dimensional structure of a Sir2 protein has been determined (see, e.g., Bedalov et al. (2001), Min et al.
(2001), Finnin et al., (2001)) and provides guidance for identifying domains of Sir2. ' A "full length" Sir2 protein refers to a protein that has at least the length of a naturally-occurring Sir2 protein. A "full length" Sir2 protein or a fragment thereof can also include other sequences, e.g., a purification tag., or other attached compounds, e.g., an attached fluorophore, or cofactor.
The invention includes sequences and variants that include one or more substitutions, e.g., between one and six substitutions, e.g., with respect to a naturally-occurring protein.
Whether or not a particular substitution will be tolerated can be determined by a method described herein. One or more or all substitutions may be conservative. A
"conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 50%
identity, preferably 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., the C.
elegans proteins provided herein), when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a sequence comparison methodology such as BLAST or BLAST 2.0 with default parameters described below, or by manual alignment and visual inspection. Such sequences are then said to be "substantially identical." Tlus definition also refers to, or may be applied to, the complement of a test nucleic acid sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algoritlnns can account for gaps and the like.
Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is at least 50 or 100 amino acids or nucleotides in length.
The p53 polypeptide can have greater than or equal to 25%, 50%, 75%, 80%, 90%
overall identity or greater than or equal to 30%, 50%, 75%, 80%, 90% overall similarity to SEQ
lD NO. 3. Preferably, the Sir2 or p53 polypeptide is a human protein (e.g., as described herein), although it may also be desirable to analyze Sir2 or p53 polypeptides isolated from other organisms such as yeast, worms, flies, fish, reptiles, birds, mammals (especially rodents), and primates using the methods of the invention.
In one aspect, the invention features a method of screening a compound. The method includes providing a reaction mixture including Sir2, a transcription factor, and the compound, and determining if the compound modulates Sir2 interaction with, e.g., binding, of the transcription factor. Determining if the compound modulates Sir2binding may be accomplished by methods known in the art, including comparing the binding of Sir2 to the transcription factor at a first concentration of the compound and at a second concentration of the compound. In a further embodiment, either of the first or second concentration of the compound may be zero, e.g., as a reference or control.
In a further embodiment, the reaction mixture also includes a Sir2 cofactor, such as NAD
or an NAD analog.

In a further embodiment, the transcription factor is p53 or a Sir-2 binding fragment thereof. The transcription factor, e.g., p53, or fragment thereof may be acetylated or labeled. In a preferred embodiment, the transcription factor is an acetylated p53 fragment, and the fragment includes lysine 382.
In a further embodiment, the Sir2 included in the reaction mixture is a Sir2 variant, e.g., a variant that has reduced deacetylase activity, such as the H363Y mutation. The Sir2 may be human, e.g., human SIRT1. Alternatively, the Sir2 may be marine, e.g., Sir2a.
In one embodiment of the inventions, the Sir2 is exogenous and expressed from a heterologous nucleic acid. Additionally, in a further embodiment, the transcription factor may be exogenous and expressed from a heterologous nucleic acid.
The method of screening can be used to identify compounds that modulate, e.g., increase or decrease, cell growth, modulate, e.g., slow or speed, aging, modulate, e.g., increase or decrease, lifespan, modulate cellular metabolism, e.g., by increasing or decreasing a metabolic function or rate.
In another aspect, the invention features a method of screening a compound by providing a reaction mixture comprising Sir2, a transcription factor, and the compound, and determining if the compound modulates Sir2-mediated deacetylation of the transcription factor. The step of determining if the compound modulates Sir2-mediated deacetylation of the transcription factor may be performed by methods lenown in the art, including comparing the binding of Sir2 to the transcription factor at a first concentration of the compound and at a second concentration of the compound. In a further embodiment, either of the first or second concentration of the compound may be zero, e.g., as a reference or control. In a further embodiment, the reaction mixture also includes a Sir2 cofactor, such as NAD or an NAD analog.
In a further embodiment, the transcription factor is p53 or a Sir-2 binding fragment thereof. The p53 or fragment thereof may be acetylated or labeled. In a preferred embodiment, the transcription factor is an acetylated p53 fragment, and the fragment includes lysine 382.
In a further embodiment, the Sir2 included in the reaction mixture is a Sir2 variant that has reduced deacetylase activity, such as the H363Y mutation. The Sir2 may be human, e.g., human SIRT1. Alternatively, the Sir2 may be marine, e.g., Sir2a. In one embodiment of the inventions, the Sir2 is exogenous and expressed from a heterologous nucleic acid. Additionally, in a further embodiment, the transcription factor may be exogenous and expressed from a heterologous nucleic acid.
The method of screening can be used to identify compounds that modulate, e.g., increase or decrease, cell growth, modulate, e.g., slow or speed, aging, modulate, e.g., increase or decrease, lifespan, modulate cellular metabolism, e.g., by increasing or decreasing a metabolic function or rate.
The present invention also relates to a method of screening a compound by providing a compound that interacts with Sir2, e.g., a compound that binds Sir2;
contacting the compound with a cell or a system; and determining if the compound modulates transcription of a p53-regulated gene. Determining if the compound modulates transcription of a p53-regulated gene may be by any of the methods known in the art, including comparing the modulation of transcription of a p53-regulated gene at a first concentration of the compound and at a second concentration of the compound. In a further embodiment, either of the first or second concentration of the compound may be zero, e.g., as a reference or control.
In a related aspect, the invention features a method of evaluating a compound, the method comprising: contacting Sir2 or a transcription factor, e.g., p53, with a test compound; evaluating an interaction between the test compound and the Sir2 or the transcription factor, e.g., p53;
contacting a cell or organism that produces the Sir2 or transcription factor polypeptide with the test compound; and evaluating the effect of the test compound on the rate of aging on the cell or organism. The interaction can, for example, be a physical interaction, e.g., a direct binding interaction, a covalent change in one or both of the test compound or the Sir2 or transcription factor, a change in location of the test compound (e.g., a change in subcellular localization), or a functional interaction (e.g., an alteration in activity, stability, structure, or activity of the polypeptide).
In some embodiments, the method is repeated one or more times such that, e.g., a library of test compounds can be evaluated. In an related embodiment, the evaluating of the interaction with the test compound and the Sir2 or the transcription factor, e.g., p53, is repeated, and the evaluating of the rate of aging is selectively used for compounds for which an interaction is to detected. Possible test compounds include, e.g., small organic molecules, peptides, antibodies, and nucleic acid molecules.
In some embodiments, the interaction between the test compound and the Sir2 or transcription factor, e.g., p53, is evaluated in vitro, e.g., using an isolated polypeptide. The Sir2 or transcription factor, e.g., p53, polypeptide can be in solution (e.g., in a micelle) or bound to a solid support, e.g., a colurmi, agarose beads, a plastic well or dish, or a chip (e.g., a microarray).
Similarly, the test compound can be in solution or bound to a solid support.
In other embodiments, the interaction between the test compound and the Sir2 or transcription factor, e.g., p53, is evaluated using a cell-based assay. For example, the cell can be a yeast cell, an invertebrate cell (e.g., a fly cell), or a vertebrate cell (e.g., a Xefzopus oocyte or a mammalian cell, e.g., a mouse or human cell). In preferred embodiments, the cell-based assay measures the activity of the Sir2 or transcription factor, e.g., p53, polypeptide.
In preferred embodiments, the effect of the test compound on the rate of aging of a cell or animal is evaluated only if an interaction between the test compound and the Sir2 or transcription factor, e.g., p53, is observed.
In some embodiments, the cell is a transgenic cell, e.g., a cell having a transgene. In some embodiments, the transgene encodes a protein that is normally exogenous to the tTansgenic cell. In some embodiments, the transgene encodes a human protein, e.g., a human Sir2 or transcription factor, e.g., p53, polypeptide. In some embodiments, the transgene is linked to a heterologous promoter. In other embodiments, the transgene is linked to its native promoter. In some embodiments, the cell is isolated from an organism that has been contacted with the test compound. In other embodiments, the cell is contacted directly with the test compound.
In other embodiments, the rate of aging of an organism, e.g., an invertebrate (e.g., a worm or a fly) or a vertebrate (e.g., a rodent, e.g., a mouse) is determined.
The rate of aging of an organism can be determined by a variety of methods, e.g., by one or more of: a) assessing the life span of the cell or the organism; (b) assessing the presence or abundance of a gene transcript or gene product in the cell or organism that has a biological age-dependent expression pattern;
(c) evaluating resistance of the cell or organism to stress, e.g., genotoxic stress (e.g., etopicide, UV irradition, exposure to a mutagen, and so forth) or oxidative stress; (d) evaluating one or more metabolic parameters of the cell or organism; (e) evaluating the proliferative capacity of the cell or a set of cells present in the organism; (f) evaluating physical appearance or behavior of the cell or organism, and (g) assessing the presence or absence of a gene transcript or gene product in the cell or organism that has a p53-regulation-dependent expression pattern. In one example, evaluating the rate of aging includes directly measuring the average life span of a group of animals (e.g., a group of genetically matched animals) and comparing the resulting average to the average life span of a control group of animals (e.g., a group of animals that did not receive the test compound but are genetically matched to the group of animals that did receive the test compound). Alternatively, the rate of aging of an organism can be determined by measuring an age-related parameter. Examples of age-related parameters include: appearance, e.g.; visible signs of age; the expression of one or more genes or proteins (e.g., genes or proteins that have an age-related expression pattern); resistance to oxidative stress; metabolic parameters (e.g., protein synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.); and cellular proliferation (e.g., of retinal cells, bone cells, white blood cells, etc.). In some embodiments, the organism is a transgenic animal. The transgenic animal can include a transgene that encodes, e.g., a copy of a Sir2 or transcription factor protein, e.g., a p53 protein, e.g., the Sir2 or transcription factor, e.g., a p53 polypeptide that was evaluated for an interaction with the test compound.
In some embodiments, the transgene encodes a protein that is normally exogenous to the transgenic animal. For example, the transgene can encode a human protein, e.g., a human Sir2 or transcription factor, e.g., p53, polypeptide. In some embodiments, the transgene is linleed to a heterologous promoter. In other embodiments, the transgene is liuced to its native promoter. In some embodiments, the transgenic animal further comprises a genetic alteration, e.g.; a point mutation, insertion, or deficiency, in a gene encoding an endogenous Sir2 or transcription factor, e.g., p53, protein, such that the expression or activity of the endogenous Sir2 or transcription factor protein is reduced or eliminated.
In some embodiments, the organism is on a calorically rich diet, while in other embodiments the organism is on a calorically restricted diet.
In some embodiments, a portion of the organism's life, e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, of the expected life span of the organism, has elapsed prior to the organism being contacted with the test compound.

In another aspect, the invention features a method of evaluating a protein, comprising:
identifying or selecting a candidate protein, wherein the candidate protein is a Sir2 or transcription factor, e.g. p53, polypeptide; altering the sequence, expression or activity of the candidate protein in a cell or in one or more cells of an organism; and determining whether the alteration has an effect on the interaction, e.g., binding, of Sir2 with a transcription. factor, e.g.
p53, or on the deacetylation of transcription factor, e.g. p53.
In some embodiments, the candidate protein is identified by amplification of the gene or a portion thereof encoding the candidate protein, e.g., using a method described herein, e.g., PCR
amplification or the screening of a nucleic acid library. In preferred embodiments, the candidate protein is identified by searching a database, e.g., searching a sequence database for protein sequences homologous to Sir2 or a transcription factor, e.g., p53.
In preferred embodiments, the candidate protein is a human protein. In other embodiments, the candidate protein is a mammalian protein, e.g., a mouse protein. In other embodiments, the protein is a vertebrate protein, e.g., a fish, bird or reptile protein, or an invertebrate protein, e.g., a worm or insect protein. In still other embodiments, the protein is a eukaryotic protein, e.g., yeast protein.
In another aspect, the invention features method of evaluating a protein, the method comprising a) identifying or selecting a candidate protein, wherein the candidate protein is Sir2 or a transcription factor, e.g., p53; b) identifying one or more polymorphisms in a gene, e.g., one or more SNPs that encodes the candidate protein; and c) assessing correspondence between the presence of one or more of the polymorphisms and an interaction, e.g., binding, of Sir2 with the transcription factor, e.g., p53, or with the deacetylation of the transcription factor, e.g., p53. The pol~nnorphisms can be naturally occurnng or laboratory induced. In one embodiment, the organism is an invertebrate, e.g., a fly or nematode; in another embodiment the organism is a mammal, e.g., a rodent or human. A variety of statistical and genetic methods can be used to assess correspondence between a polymorphism and longevity. Such correlative methods include determination of linkage disequilibrium, LOD scores, and the like.

In another aspect, the invention features a method of modulating cell growth in an animal, e.g., a mammal, by modulating the Sir2-mediated deacetylation of a transcription factor in the animal.
In one embodiment, the method includes modulating cell growth by increasing acetylation of p53. In a further embodiment, the method includes inactivating Sir2, e.g., by the use of antisense, RNAi, antibodies, intrabodies, NAD depletion, a dominant negative mutant of Sir2, or by the addition of Sir2 cofactor-analogs, e.g., NAD analogs such as those described in Vaziri et al. (1997) or nicotinamide. In a further embodiment, the method includes introducing a deacetylation-resistant form of p53. In still another embodiment, the invention is a method for treating a mammal, e.g., a mammal having a disease characterized by unwanted cell proliferation, e.g., cancer, accelerated senescence-related disorders, inflammatory and autoimmune disorders, Alzheimer's disease, and aging-related disorders.
In another embodiment, the method includes modulating cell growth by decreasing acetylation of p53. In a further embodiment, the method includes increasing NAD
concentrations. In a further embodiment, the method includes increasing Sir2 concentrations, e.g.
by addition of purified Sir2, by expression of Sir2 from heterologous genes, or by increasing the expression of endogenous Sir2, or by the addition of Sir2 cofactor-analogs, e.g., NAD analogs such as those described in Vaziri et al. (1997).
The present invention also relates to a method of modulating the growth of a cell in vivo or iyz vitro by modulating the Sir2-mediated deacetylation of a transcription factor in the cell.
In one embodiment, the method includes modulating the growth of a cell by increasing acetylation of p53, thereby decreasing cell growth. Tn a further embodiment, the method includes inactivating Sir2, e.g., by the use of antisense, RNAi, antibodies, intrabodies, NAD
depletion, a dominant negative mutant of Sir2, or nicotinamide, or decreasing Sir2 activity by the addition of Sir2 cofactor-analogs, e.g., NAD analogs such as those described in Vaziri et al.
(1997). In a further embodiment, the method includes introducing a deacetylation-resistant form of p53.
In one embodiment, the method includes modulating the growth of a cell by decreasing acetylation of p53, thereby increasing cell growth. In a further embodiment, the method includes increasing NAD concentrations. W a further embodiment, the method includes increasing Sir2 concentrations, e.g. by addition of purified Sir2, by expression of Sir2 from heterologous genes, or by increasing the expression of endogenous Sir2, or by the addition of Sir2 cofactor-analogs, e.g., NAD analogs such as those described in Vaziri et al. (1997).
In one aspect the invention features a method of directing Sir2 to a transcription factor binding site, e.g., a p53 binding site, and thereby modifying the acetylation status of the binding site on histone or DNA. The method includes providing a Sir2-transcription factor complex under conditions such that the transcription factor targets Sir2 to the transcription factor binding site, allowing the Sir 2 to modify the acetylation status of histones and DNA
at the transcription factor binding site.
In a preferred embodiment, the method is performed in vivo or ih vitro, e.g., in an animal or in a cell.
In a preferred embodiment, the Sir2-transcription factor complex is provided at a different stage of development of the cell or animal or at a greater concentration than occurs naturally.
In a preferred embodiment, the Sir2 or transcription factor or both is increased, e.g., by supplying exogenous Sir2 and/or transcription factor, e.g., pS3, by supplying an exogenous nucleic acid encoding Sir2 or transcription factor, e.g., p53, or by inducing endogenous production of Sir2 or a transcription factor, e.g., p53.
In one embodiment, the present invention relates to a method of evaluating a compound, e.g., a potential modulator of Sir2 or transcription factor, e.g., p53 activity, comprising the steps of contacting the transcription factor, e.g., p53, Sir2, and NAD or an NAD
analog with the compound; evaluating an interaction between the compound and one or more of the transcription factor, e.g., p53, Sir2, and a cofactor such as NAD or an NAD analog;
contacting the compound with a cell or organism having transcription factor, e.g., p53 or Sir2 activity; and evaluating the rate of aging of the cell or organism. In a preferred embodiment, evaluating the rate of aging comprises one or more of:
a) assessing the life span of the cell or organism;
b) assessing the presence or absence of a gene transcript or gene product in the cell or organism that has a biological age-dependent expression pattern;

c) evaluating resistance of the cell or organism to stress;
d) evaluating one or more metabolic parameters of the cell or organism;
e) evaluating the proliferative capacity of the cell or a set of cells present in the organism;
f) evaluating physical appearance, behavior, or other characteristic of the cell or organism; and g) assessing the presence or absence of a gene transcript or gene product in the cell or organism that has a p53-regulation-dependent expression pattern.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
DESCRIPTION OF DRAWINGS
Figure 1. Interactions between p53 and mammalian Sir2a both iya vitro and in vivo.
(A) is an autoradiograph demonstrating direct interactions of Sir2a with GST
p53. The GST p53 full length protein (GST p53) (lane 1), the N-terminus of p53 protein (1-73) (lane 2), the middle part of p53 (100-290) (lane 3), the C-terminus of p53 (290-393) (lane 4), and GST
alone (lane 6) were used in GST pull-down assay with ifs. vitro translated 35S-labeled full length mouse Sir2a. (B) is two western blots demonstrating p53 interactions with Sir2a in H1299 cells.
Western blot analyses of the indicated whole cell extract (WCE) (lanes 1, 3, 5, 7), or the p53 immunoprecipitates with M2 antibody (IP/Flag-p53) prepared from the transfected H1299 cells (lane 6, 8), or the Sir2a immunoprecipitates (IP/Flag-Sir2a) with M2 antibody prepared from the transfected H1299 cells (lanes 2, 4) with either anti-p53 monoclonal antibody (DO-1) (lanes 1-4), or anti-Sir2a polyclonal antibody (lanes 5-8). The cells were either firansfected with p53 (lanes 3, 4) or Sir2a (lanes 7, 8) alone, or cotransfected with p53 and Sir2a (lanes 1, 2, 5, 6). (C) is a schematic representation of the high homology regions between mouse Sir2a and human SIRT1 (hSIRTI). The core domain represents the very conserved enzymatic domain among all Sir2 family proteins (Frye, 1999, 2000). (D) is a western blot demonstrating p53 interactions with human SIRT1 in H1299 cells. Western blot analyses of the indicated whole cell extract (WCE) (lanes 1, 3) or the Flag-hSIRTl immunoprecipitates with M2 antibody (IP/hSIRTl) (lanes 2, 4) prepared from either the hSIRTI and p53 cotransfectedH1299 cells (lanes 1, 2) or the p53 alone transfected cells (lanes 3, 4) with anti-p53 monoclonal antibody (DO-1).
Figure 2. P53 interacts with mammalian Sir2a (mouse Sir2a and hSIRTl) in normal cells.
(A) is two western blots demonshating the interaction between p53 and hSIRTl in H460 cells. (B) is two western blots demonstrating the interaction between p53 and Sir2a in F9 cells.
(C) The interaction between p53 and hSIRTl un HCT116 cells either at the normal condition (lanes, 1-3) or after DNA damage treatment by etoposide (lanes, 4-6). Western blot analyses of the indicated whole cell extract (WCE) (lanes 1, 4), or immunoprecipitates with anti-Sir2a antibody (IP/anti-Sir2a) (lanes 2, 5) prepared from different cell extracts, or control immunoprecipitates with pre-irmnunoserum from the same extracts (lanes 3, 6), with anti-p53 monoclonal antibodies (DO-I for human p53, 42I for mouse p53), or anti-Sir2a antibody.
Figure 3. TSA-insensitive deacetylation of p53 by mammalian Sir2a.
(A) Colloidal blue staining of a SDS-PAGE gel containing protein Marker (lane 1), a control eluate from M2 loaded with untransfected cell extract (lane 2), and 100 ng of the highly purified Flag-tagged Sir2a recombinant protein (lane 3). (B) Deacetylation of p53 by Sir2a, 2.5 dug of 14C-labeled acetylated p53 (lane 1) was incubated with either the control eludate (lane 4), the purified 10 ng of Sir2a (lanes 2 and 3), or the same amount of Sir2a in the presence of 500 nM TSA (lane 5) for 60 min at 30EC. NAD (50 ~.m) was also added in each reaction except lane 2. The proteins were analyzed by resolution on SDS-PAGE and autoradiography (upper) or Coomassie blue staining (lower). (C). Reduction of the steady-state levels of acetylated p53 by both mouse Sir2a and human SIRTl expression. Western blot analysis of H1299 cell extracts from the cells cotransfected with p53 and p300 (lane 1), or in combination with Sir2a (lane 2), or in combination with hSIRTl (lane 4), or in combination with Sir2aH355A (lane 3), in combination with hSIRTS (lane 5), or in combination with PARP (lane 6) by acetylated p53-specific antibody (upper) or DO-1 for total p53 (lower). (D) Deacetylation of p53 by Sir2a in the presence of TSA. Western blot analysis of acetylated p53 levels in H1299 cells cotransfected with p53 and p300 (lanes 1, 3), or cotransfected with p53, p300 and Sir2a (lanes 2, 4) by acetylated p53-specific antibody (upper) or OF-1 for total p53 (lower). Cells were either not treated (lanes 1, 2) or treated with S00 nM TSA (lanes 3, 4).
Figure 4. Abrogation of mammalian Sir2a mediated deacetylation of p53 by nicotinamide.
(A) Sir2a-mediated deacetylation of p53 is inhibited by nicotinamide. 2.5 :g of 14C-labeled acetylated p53 (lane 1) was incubated with 10 ng of purified Sir2a and 50 pM NAD
alone (lane 2), or in the presence of either SmM of nicotinamide (lane 3) or 3 mM of 3-AB (3-aminobenzamide) (lane 4) for 60 min at 30EC. The proteins were analyzed by resolution on SDS-PAGE and autoradiography (upper) or Coomassie blue staining (lower). (B) The Sir2a-mediated deacetylation of endogenous p53 was abrogated in the presence of nicotinamide. Cell extracts from the mock-infected MEF p53 (+/+) cell (lanes 1-2, 5-6), or the pBabe-Sir2ainfected cells (lanes 3-4, 7-8), either untreated (lanes 1, 3, 5, 7), or treated with etoposide and TSA (lane 2, 4), or in combination with nicotinamide (lanes 6, 8) for 6 hr were analyzed by Western blot with acetylated p53-specific antibody (upper) or DO-1 for total p53 (lower).
(C) Synergistic induction of p53 acetylation levels by TSA and nicotinamide during DNA damage response.
Western blot analysis of cell extracts from the H460 cells treated with etoposide alone (lane 2), or in combination with TSA (lane 3), or TSA and nicotinamide (lane 4), or TSA
and 3-AB (lane 5) for 6 hr by acetylated p53-specific antibody (upper) or DO-1 for total p53 (lower). The cell extracts from untreated cells (lane 1), or treated with a proteasome inhibitor LLNL (50 :M) were also included (lane 6).
Figure 5. Bar graphs illustrating repression of p53-mediated transcriptional activation by mammalian Sir2a.
(A), (B) MEF (p53-/-) cells were transiently transfected with 10 ng of CMV p53 alone, or in combination with indicated Sir2a constructs together with either the PG13-Luc reporter construct (A), or a control reporter construct (TIC-Luc) (B) by calcium phosphate precipitation essentially as previously described (Luo et al., 2000). (C), (D) MEF (p53-l-) cells were transiently transfected with 10 ng of CMV p53 alone, or in combination with S:g of either CMV
Sir2a, or CMV hSlRTl, or CMV hSlRTS (C), or CMV Sir2aH355A as indicated (D) together with the PG13-Luc reporter construct. All transfections were done in duplicate and , representative experiments depict the average of three experiments with standard deviations indicated.
Figure 6. Inhibition of pS3-dependent apoptosis by Sir2a.
(A) H1299 cells were transfected with pS3 alone, or cotransfected with pS3 and Sir2a, or cotransfected with pS3 and Sir2aH3SSA. After transfection, the cells were fixed, stained for pS3 by FITC-conjugated a-pS3 antibody, and analyzed by flow cyrntometry for apoptotic cells (subG1) according to DNA content (PI staining). (B) The experiments were repeated at least three times; this bar graph depicts the average of three experiments with standard deviations indicated.
Figure 7. Inhibition of pS3-dependent apoptotic response to stress by mammalian Sir2a.
(A) Repression of the apoptotic response to DNA damage by Sir2a. Both mock infected cells and p/babe-Sir2a infected MEF pS3(+/+) cells were either not treated (1 and 2) or treated with either 20 ~,M etoposide. The cells were analyzed by flow cytometry for apoptotic cells (subGl) according to DNA content (PI staining). (B) Similar results were obtained for three times, and this bar graph of representative data depicts the average of three experiments with standard deviations indicated (B).
Figure 8. Co-precipitation of hSir2 and pS3 protein.
(A) Immunoprecipitation of hSir2 with a C-terminal polyclonal rabbit antibody followed by immunoblotting with the same antibody revealed the existence of a 120Kd protein in normal BJ fibroblasts (left panel), and increased levels in these cells expressing the wild type (middle panel) and HY mutant (right panel) of hSir2. (B) Immunofluorescence analysis of hSir2 indicated the existence of a nuclear protein with a punctuate staining pattern. (C) Nuclear lysates from H1299 cells ectopically expressing pS3 and hSir2 were precipitated with the anti-hSir2 antibody The blot was probed the anti-hSir2 antibody and a polyclonal sheep anti-pS3 antibody (bottom panel). (D) pS3 protein was immunoprecipitated with the Do-1 anti-pS3 antibody from lysates of non-irradiated and irradiated (6Gy) BJT cells (expressing telomerase) that had been stably infected with pYESir2wt and pYESir2HY mutant vectors. The blot was probed with anti-hSir2 antibody and rabbit anti-pS3 polyclonal antibodies (CMl+SC6243).

Figure 9. Effect of hSir2 expression on p53 acetylation in vitro.
The deacetylation activity of mSir2 on the human p53 C-terminal peptide (residues 368-386) di-acetylated at positions 373 and 382. (A, B) HPLC chromatograms of products of deacetylation assays with mSir2 and the indicated concentrations of NAD. Peaks 1 and 2 correspond to the monomeric and dimeric forms of the p53 peptide, respectively. Peals 3 corresponds to the singly deacetylated monomer identified by mass spectroscopy. (C-F) Amino-terminal Edman sequencing of peaks 1 and 3. Chromatograms of positions 373 and 382 are shown. Peaks of acetyl-lysine (AcK) and simple lysine (K) are indicated in each panel. Small peaks of lysine in panels C, D and F are due to residual fractions of previous lysines at positions 372 and 381.
Figure 10. hSir2 effects on p53 acetylation in vivo.
(A) Reconstitution of the acetylation and deacetylation cascade in immortal human epithelial H1299 cells by transient co-transfection of the indicated genes.
After co-transfection of the mentioned constructs, the cellular lysates were analyzed by Western blot analysis, using Ab-1 to detect K382 p53, DO-1 for total p53 or [3 actin for loading control. Lane 3, co-transfection of CMVwtp53 and p300 generates acetylated p53 at K382, lane 4, co-transfection of the acetylation mutant K382R of p53 with p300. Lane 5, Same as 4 but with co-transfected wild type hSir2.
Lanes 7-8, co-transfection of the acetylation mutant K320R with or without wild type hSir2.
Lane 9, Co-transfection of CMVwtp53, CMVp300 and wild type hSir2.
(B) BJ cells expressing telomerase (BJT), were stably infected with either a wild type hSir2 or a mutant hSir2HY virus. The hSir2-expressing mass cultures were subj ected to 6Gy of ionizing radiation in presence of low concentrations of TSA (O.lmg/ml) and the p53 acetylation was measured at indicated time points by immunoblotting with Ab-1 that recognizes specifically the deacetylated K382 p53 protein. The blots were subsequently probed with anti-p53, anti-p21, anti-(3~ actin and anti-hSir2 antibodies. Time (hrs) post 6 Gy of irradiation is shown inside the brackets.
(C) Deacetylation of p53 in vivo in MCF7 cells. Four-fold ectopic expression of wild type hSir2 or hSir2HY mutant in MCF7 cells radiated with 6Gy of ionizing radiation and its effect on p53 acetylation at K382. The blot was probed for acetylation with Ab-1 and reprobed with other antibodies as in (B). Times shown are post irradiation in hours.
Figure 11. hSir2 expression and its influence on p53 activity (A) is a bar graph depicting transcriptional activity of p53 protein, as measured in H1299 cells by co-transfection p53 with a p21 WAF1 promoter-luciferase construct (p2lPluc).
Transcriptional activity of p53 protein was measured upon ectopic expression of wild type hSir2, hSir2HY (B) is a bar graph illustrating results from control SV40-Luciferase transfections with CMVp53 and increasing amounts of wild type hSir2 in to H1299 cells and luciferase activity was measured and expressed as Relative Light Unit (%RLU). (C) Is an immunoblot demonstrating levels of p21 WAF1 in MCF73L cells expressing wt hSir2 or hSir2HY protein in response to 6Gy of ionizing radiation. The blot was probed with Do 1 for detection of p53 and (3 actin for loading control.
Figure 12. Effects of hSir2 on p53-dependent apoptosis and radiosensitivity (A) is a bar graph illustrating ectopic expression of hSir2wt and its influence on p53-dependent apoptosis in H1299 cells. H1299 cells were transfected with a wild type p53 expression construct to induce p53-dependent apoptosis. Amiexin V positive and propidium iodide negative cells were measured.
(B) is a line graph comparison of gamma-ray survival. Dose-response curves are shown for different types of BJ cells treated with ionizing radiation while growing exponentially and asynchronously. Twelve days after radiation the colonies were counted and survival calculated as described previously (Dhar et al., 2000). The ataxia-telangiectasia (A-T) cell line was used a positive control to indicate radiosensitivity in an exponentially growing population.
Figures 13A and 13B. The coding nucleic acid (SEQ ID NO. 2) and deduced amino acid (SEQ ID NO. 3) of human p53.
Figure 14. The nucleic acid (SEQ ID NO. 4) sequence of human p53 (GenBanlc Accession No: K03199).

Figures 15A, B, C and D. The nucleic acid (SEQ ID NO. 5) and deduced amino acid sequence (SEQ ID NO. 6) of mouse Sir2.
Figures 16A, B and C. The nucleic acid (SEQ ID NO. 7) and deduced amino acid sequence (SEQ m NO. 8) of mouse Sir2 GenBanlc Accession No: AF214646.
Figures 17A and B. The nucleic acid (SEQ m NO. 9) and deduced amino acid sequence (SEQ m NO. 10) of human Sir2 SIRT2 GenBanlc Accession No: AF083107.
Figures 18A, B and C. The nucleic acid (SEQ m NO. 11) and deduced amino acid sequence (SEQ ID NO. 12) of human Sir2 SIRTl GenBank Accession No: AF083106.
Figure 19. The nucleic acid (SEQ m NO. 13) and deduced amino acid sequence (SEQ
m NO. 14) of human Sir2 SIRT3 GenBank Accession No: AF083108.
Figures 20A and B. The nucleic acid (SEQ m NO. 15) and deduced amino acid sequence (SEQ m NO. 16) of human Sir2 SIRT4 GenBanlc Accession No: AF083109.
Figures 21A and B. The nucleic acid (SEQ m NO. 17) and deduced amino acid sequence (SEQ m NO. 18) of human Sir2 SIRTS GenBank Accession No: AF083110.
DETAILED DESCRIPTION
As described below, hSir2 directly binds the human p53 protein both iya vitYO
and ih vivo and can deacetylate p53, e.g., at the K382 residue of p53. A functional consequence of this deacetylation is an attenuation of the p53 protein's activity, e.g., as a transcription factor operating at a cellular promoter, e.g., the p2lWAFl promoter. In another cellular context, in which the DNA damage response leads to apoptosis, hSir2 activity attenuates the p53-dependent apoptotic response. Hence, hSir2 can negatively regulate a program of cellular death.
Sir2 proteins can also deacetylate histones. For example, Sir2 can deacetylate lysines 9 or 14 of histone H3. Histone deacetylation alters local chromatin structure and consequently can regulate the transcription of a gene in that vicinity. Sir2 proteins can bind to a number of other proteins, termed "Sir2,-binding partners." For example, hSIRTl binds to p53.
In many instances the Sir-2 binding partners are transcription factors, e.g., proteins that recognize specific DNA
sites. W teraction between Sir2 and Sir2-binding partners delivers Sir2 to specific regions of a genome and can result in local modification of substrates, e.g., histones and transcription factors localized to the specific region. Accordingly, cellular processes can be regulated by compounds that alter (e.g., enhance or diminish) the ability of a Sir2 protein to interact with a Sir2-binding parW er or that alter that ability of a Sir2 protein to modify a substrate.
While not wishing to be bound by theory, a Sir2-transcription factor complex may be directed to a region of DNA with a transcription factor binding site; once there, Sir2 may alter the acetylation status of the region, e.g., by deacetylating histones, non-histone proteins, and/or DNA. This would locally raise the concentration of Sir2 and may potentially result in the Sir2-mediated silencing of genes located at or near transcription-factor binding sites. Certain organismal programs such as aging or metabolism and disorders such as cancer can be controlled using such compounds.
While not wishing to be bound by theory, in mammalian cells, signals indicating the successful completion of DNA repair may be relayed via hSir2 to acetylated proteins like p53 that have been charged with the task of imposing a growth arrest following DNA
damage. These signals enable hSir2 to reverse part or all of the damage-induced activation of p53 as a transcription factor by deacetylating the K3 ~2 residue of p53. By doing so, hSir2 reduces the likelihood of subsequent apoptosis and, at the same time, makes it possible for cells to re-enter the active cell cycle, enabling them to return to the physiological state that they enjoyed prior to sustaining damage to their genomes.
W activation of the p53 signaling pathway is involved in the pathogenesis of most if not all human tumors (Hollstein et al., 1994; Lohrum and Vousden, 1999). In about half of these tumors, mutation of the p53 gene itself suffices to derail function. In some of the remaining tumors, loss of p 14A~, which acts to down-regulate p53 protein levels, has been implicated (Lohrum and Vousden, 1999; Prives and Hall, 1999). The present invention is related to the discovery of a novel mode by which an incipient cancer cell attenuate at least some p53 functions via modulation of the activity of hSir2, which, like the other two genetic strategies, may result in the inactivation of both the cytostatic and pro-apoptotic functions of p53.

The invention is thus based in part on the discovery of the existence of a p53 regulatory pathway that is regulated by mammalian Sir2oc. Sir2a is involved in gene silencing and extension of life span in yeast and C. elegayZS (reviewed in Guarente, 2000;
Shore, 2000;
I~aeberlein et al., 1999; Tissenbaun and Guarente, 2001). p53 binds to mouse Sir2a as well as its human ortholog hSIRTI both iya vitro and in vivo. p53 is a substrate for the NAD-dependent deacetylase activity of mammalian Sir2a. Sir2a-mediated deacetylation antagonizes p53-dependent transcriptional activation and apoptosis. Sir2a-mediated deacetylation of p53 is inhibited by nicotinamide both ih vitro and ifa vivo. Sir2a specifically inhibits p53-dependent apoptosis in response to DNA damage and/or oxidative stress, but not p53-independent, Fas-mediated cell death. Accordingly, compounds that alter (e.g., decrease or enhance) the interaction between Sir2 and p53 can be used to regulate processes downstream of p53, e.g., apoptosis. Such compounds may alter the catalytic activity of Sir2 for a substrate such as p53 or may alter the interaction between Sir2 and p53.
The present invention relates to the discovery that p53 is a binding partner of mammalian Sir2a, which physically binds to p53 both ifa vitro and isz vivo. In some cases, p53 is also a substrate of Sir2. Sir2a specifically represses p53-mediated functions including p53-dependent apoptotic response to stress.
p53 can be, for example, the mature protein (e.g., SEQ ID NO. 3) or a fragment thereof.
The p53 protein can be encoded by the nucleic acid sequence of SEQ ID NOS. 2 and/or 4). In a preferred embodiment, p53 is the human p53. Deacetylation of p53 can be mediated by Sir2,e.g., in combination with a cofactor, such as NAD and/or an NAD analog.
The phrase "deacetylating p53" refers to the removal of one or more acetyl groups (e.g., CH3COa-) from p53 that is acetylated on at least one amino acid residue. Tn a preferred embodiment, p53 is deacetylated at a lysine of p53 selected from the group consisting of lysine 370, lysine 371, lysine 372, lysine 381 and lysine 382 of SEQ ID NO. 3. p53 can be deacetylated in the presence or absence of DNA damage or oxidative cellular stress. The DNA
damage can be caused by, for example, ionizing radiation (e.g., 6 Gy of ionizing radiation), or a tumor or some other uncontrolled cell proliferation. p53 is deacetylated in the presence of DNA
damage or oxidative stress by combining p53, Sir2, NAD and/or an NAD analog.
Sir2 can be the mature protein (e.g., SEQ ID NOS. 8, 10, 12, 14, 16 or 18) or a fragment of the mature protein capable of deacetylating p53 in the presence or NAD
and/or an NAD

analog. The Sir2 protein can be encoded by the nucleic acid sequence of SEQ m NOS. 7, 9, 11, 13, 15 or 17). In a preferred embodiment, the Sir2 is human Sir2.
In one embodiment, the invention is a method of deacetylating p53 comprising the step of combining Sir2 and NAD and/or an NAD analog with p53. The combination can be performed in the presence or the absence of cells. Such combinations can be in tissue culture (e.g., BJT
cells, MCF-7 cells) or in an organism (e.g., a mammal, e.g., as a human).
Combination of p53, Sir2 and NAD andlor an NAD analog can be any placement of p53, Sir 2 and NAD
or a NAD
analog in sufficient proximity to cause Sir2 to deacetylate p53 that is acetylated on at least one amino acid residue, which deacetylation by Sir2 requires the presence of NAD
and/or an NAD
analog.
"NAD" refers to nicotinamide adenine dinucleotide. An "NAD analog" as used herein refers to a compound (e.g., a synthetic or naturally occurring chemical, drug, protein, peptide, small organic molecule) which possesses structural similarity to component groups of NAD
(e.g., adenine, ribose and phosphate groups) or functional similarity (e.g., deacetylates p53 in the presence of Sir2). For example, an NAD analog can be 3-aminobenzamide or 1,3-dihydroisoquinoline (H. Vaziri et al., EMBO J. 16:6018-6033 (1997), the entire teachings of which are hereby incorporated by reference).
"p53 activity" refers to one or more activity of p53, e.g., p-53 mediated apoptosis, cell cycle arrest, and/or senescence, .
"Modulating p53 activity" refers to increasing or decreasing p53 activity, e.g., p-53 mediated apoptosis, cell cycle arrest, and/or senescence, e.g. by altering the acetylation or phosphorylation status of p53.
"Acetylation status" refers to the presence or absence of one or more acetyl groups (e.g., CH3C02-) at one or more lysine (K) residues, e.g., K370, K371, K372, K381, and/or K382 of SEQ )D NO. 3. "Altering the acetylation status" refers to adding or removing one or more acetyl groups (e.g., CH3COa-) at one or more lysine (K) residues, e.g., K370, K371, K372, K381, and/or .
K382 of SEQ m NO. 3, e.g., by modulating Sir2 activity Similarly, "phosphorylation status" refers to the presence or absence of one or more phosphate groups (P03 ) at one or more residues, e.g., serine 15 and/or serine 20 of SEQ ID NO.
3. "Altering the phosphorylation status" refers to adding or removing one or more phosphate groups (P03-) at one or more residues, e.g., serine 15 and/or serine 20 of SEQ
m NO. 3.

"Sir2 activity" refers to one or more activity of Sir2, e.g., deacetylation of p53 or histone proteins.
"Modulating Sir2 activity" refers to increasing or decreasing one or more activity of Sir2, e.g., deacetylation of p53 or histone proteins, e.g., by altering the binding affinity of Sir2 and p52, introducing exogenous Sir2 (e.g., by expressing or adding purified recombinant Sir2), increasing or decreasing levels of NAD and/or an NAD analog (e.g., 3-aminobenzamide, 1,3-dihydroxyisoquinoline), and/or increasing or decreasing levels of a Sir2 inhibitor, e.g., nicotinamide and/or a nicotinamide analog. Additionally or alternatively, modulating Sir2 activity can be accomplished by expressing, e.g. by transfection, a dominant negative gene of Sir2 (e.g., SirHY). The dominant negative gene can, for example, reduce the activity of endogenous Sir2 on p53 deacetylation thereby modulating the activity of Sir2.
A "nicotinamide analog" as used herein refers to a compound (e.g., a synthetic or naturally occurring chemical, drug, protein, peptide, small organic molecule) which possesses structural similarity to component groups of nicotinamide or functional similarity (e.g., reduces Sir2 deacetylation activity ofp53).
The Sir2a-mediated pathway is critical for cells under stress It is believed that there are multiple pathways in cells for regulation of p53 function (Prives and Hall, 1999; Giaccia and Kastan, 1998; Ashcroft et al., 2000). In normal cells, Mdm2 is the major negative regulator for p53, and Mdm2-mediated repression appears sufficient to downregulate p53 activity. Sir2 regulation of p53 may be an Mdm2-independent, negative regulatory pathway for p53. Interestingly, while no obvious effect by Sir2a expression was observed in cells at normal conditions, Sir2a became critical in protecting cells from apoptosis when cells were either treated by DNA damage or under oxidative stress (Figure 7). Thus, Sir2a-mediated pathway can be critical for cell survival when the p53 negative-control mediated by Mdm2 is severely attenuated in response to DNA damage or other types of stress.
p53 is often found in latent or inactive forms and the levels of p53 protein are very low in unstressed cells, mainly due to the tight regulation by Mdm2 through functional inhibition and protein degradation mechanisms (reviewed in Freedman et al., 1999). However, in response to DNA damage, p53 is phosphorylated at multiple sites at the N-terminus; these phosphorylation events contribute to p53 stabilization and activation by preventing Mdm2 binding to p53 (reviewed in Appella and Anderson, 2000; Giaccia and Kastan, 1998; Shieh et al., 1997, 2000;
Unger et al., 1999; Hirao et al., 2000). Mdm2 itself is also phosphorylated by ATM during DNA
damage response, and this modification attenuates its inhibitory potential on p53 (Maya et al.,.
2001). Furthermore, while p53 is strongly stabilized and highly acetylated in stressed cells, acetylation of the C-terminal multiple lysine sites may occur at the same sites responsible for Mdm2-mediated ubiquitination (Rodriguez et al., 2000; Nakamura et al., 2000), and the highly acetylated p53 may not be effectively degraded by Mdm2 without deacetylation (Ito et al., 2001). Thus, in contrast to unstressed cells, the main p53 negative regulatory pathway mediated by Mdm2 is blocked at several levels in response to DNA damage (Maya et al., 2001). Under these circumstances, Sir2a-mediated regulation may become a major factor in controlling p53 activity, making it possible for cells to adjust p53 activity to allow time for DNA repair before committing to apoptosis.
In oncogene-induced premature senescence of cells, the p53 negative regulatory pathway controlled by Mdm2 may be blocked (reviewed in Sherr and Weber, 2000;
Sharpless and Depinho, 1999; Serrano et al., 1997). However, in contrast to DNA damage response, the Mdm2-mediated pathway is abrogated by induction of p 14A~ (or mouse p 19A~) in these cells (Honda and Yasuda, 1999; Weber et al., 1999; Tao et al., 1999a, 1999b; Zhang et al., 1998;
Pomerantz et al., 1998). Furthermore, when primary fibroblasts undergo senescence, a progressive increase of the p53 acetylation levels was observed in serially passaged cells (Pearson et al., 2000). Oncogenic Ras and PML induced p53-dependent premature senescence, and upregulated the p53 acetylation levels in both mouse and human normal fibroblasts (Pearson et al., 2000; Ferbeyre et al., 2000). Thus, mammalian Sir2a-mediated regulation may also play an important role in oncogene-induced premature senescence.
Attenuation of p53-mediated transactivation by Sir2a Earlier studies indicated that p53-mediated transcriptional activation is sufficient and also absolutely required for its effect on cell growth arrest, while both transactivation-dependent and -independent pathways are involved in p53-mediated apoptosis (reviewed in Prives and Hall, 1999; Vousden, 2000). p53 may be effective to induce apoptosis by activating pro-apoptotic genes ih vivo (reviewed in Nalcano and Vousden, 2001; Yu et al., 2001). Thus, tight regulation of pS3-mediated transactivation is critical for its effect on both cell growth and apoptosis (Chao et al., 2000; Jimenez et al., 2000).
Recent studies indicate that the intrinsic histone deacetylase activity of Sir2a is essential for its mediated functions (reviewed in Gurante, 2000). Reversible acetylation was originally identified in histones (reviewed in Cheung et al., 2000; Wolffe et al., 2000);
however, accumulating evidence indicates that transcriptional factors are also functional targets of acetylation (reviewed in Serner and Bergen 2000; Kouzarides, 2000). Thus, the transcriptional attenuation mediated by histone deacetylases may act through the effects on both histone and non-histone transcriptional factors (Sterner and Berger, 2000; Kuo and Allis, 1998). Microarray surveys for transcriptional effects of Sir2 in yeast revealed that Sir2 appears to repress amino acid biosynthesis genes, which are not located at traditional "silenced" loci (Bernstein et al., 2000). Thus, in addition to silencing (repression) at telomeres, mating type loci and ribosomal DNA (reviewed in Guarente, 2000; Shore, 2000), Sir2 may also be targeted to specific endogenous genes for transcriptional regulation in yeast.
In contrast to the yeast counterpart Sir2, the mouse Sir2a protein does not colocalize with nucleoli, telomeres or centromeres by co-immunofluorescence assay, indicating that this protein is not associated with the most highly tandemly repeated DNA in the mouse genome. The immunostaining pattern of human SIRTl as well as mouse Sir2a indicates that mammalian Sir2cc is, similar to HDAC1, broadly localized in the nucleus, further supporting the notion that mammalian Sir2a may be recruited to specific target genes for transcriptional regulation in vivo.
Mammalian Sir2a may inhibit pS3-mediated functions by attenuation of the transcriptional activation potential of pS3. Since deacetylation of pS3 is critical, but may not be the only function mediated by this Sir2a-pS3 interaction, additional functions mediated by Sir2a, such as histone deacetylation, may also contribute to this regulation. As one theory, riot meant to be limiting, pS3 and Sir2a may strongly interact to deacetylate pS3 and possibly recruit the pS3-Sir2a complex to the target promoter. The subsequent transcription repression may act both through decreasing pS3 transactivation capability and through Sir2a-mediated histone deacetylation at the target promoter region. In contrast to HDAC 1-mediated effect, this transcriptional regulation is not affected by TSA treatment. Other cellular factors may use a similar mechanism to recruit Sir2a for TSA-insensitive transcriptional regulation in mammalian cells.

Novel implications for cancer therapy Inactivation of p53 fiuictions has been well documented as a common mechanism for tumorigenesis (Hollstein et al., 1999; Vogelstein et al., 2000). Many cancer therapy drugs have been designed based on either reactivating p53 functions or inactivating p53 negative regulators.
Since p53 is strongly activated in response to DNA damage, mainly through attenuation of the Mdm2-mediated negative regulatory pathway (Maya et al., 2001), many DNA damage-inducing drugs such as etoposide are very effective antitumor drugs in cancer therapy (reviewed in Chresta and Hickman, 1996; Lutzker and Levine, 1996). Maximum induction of p53 acetylation in normal cells, however, requires both types of deacetylase ii~lubitors in addition to DNA
damage, and there may be at least three different p53 negative regulatory pathways in mammalian cells. Inhibitors for HDAC-mediated deacetylases, including sodium butyrate, TSA, SAHA and others, have been also proposed as antitumor drugs (Butler et al., 2000; Finnin et al., 1999; Taunton et al., 1996; Yoshida et al., 1995; Buckley et al., 1996).
Combining DNA
damage drugs, HDAC-mediated deacetylase inhibitors, and Sir2a-mediated deacetylase inhibitors, may have synergistic effects in cancer therapy for maximally activating p53.
In contrast to PID/HDAC1-mediated p53 regulation (Luo et al., 2000), the invention shows that mammalian Sir2a-mediated effect on p53 is NAD-dependent, indicating that this type of regulation is closely linked to cellular metabolism (reviewed Guarente 2000; Alfred, 2000;
Campisi, 2000; Min et al., 2001). In fact, null mutants of NPT1, a gene that functions in NAD
synthesis, show phenotypes similar to that of Sir2 mutants in gene silencing (Smith et al., 2000) and in life extension in response to caloric restriction in yeast (Lin et al., 2000). Thus, metabolic rate may play a role in Sir2a-mediated regulation of p53 function and, perhaps, modulate the sensitivity of cells in p53-dependent apoptotic response.
In yet another embodiment, the invention is a method of modulating p53-mediated apoptosis by modulating Sir2 activity. Sir2 activity can be modulated as described' herein (e.g., overexpressing Sir2, transfecting a cell with a dominant negative regulating gene). An increase in Sir2 activity (e.g., by overexpressing Sir2) can result in a decrease in p53-mediated apoptosis.

A decrease in Sir2 activity (e.g., transfecting a cell with a dominant negative gene) can result in an increase in p53-mediated apoptosis.
In still another embodiment, the invention is a method of screening for a compound(e.g., a small organic or inorganic molecule) which modulates (e.g., increases or decreases) Sir2-mediated deacetylation of p53. In the method, Sir2, p53, NAD and/or an NAD
analog, and the compound to be tested are combined, the Sir2-mediated deacetylation of p53 is measured and compared to the Sir2-mediated deacetylation of p53 measured in the absence of the compound.
An increase in the Sir2-mediated deacetylation of p53 in the presence of the compound being tested compared to the Sir2-mediated deacetylation of p53 in the absence of the compound indicates that the compound increases Sir2 deacetylation of p53. Lileewise, a decrease in the Sir2-mediated deacetylation of p53 in the presence of the compound being tested compared to the Sir2-mediated deacetylation of p53 in the absence of the compound indicates that the compound decreases deacetylation of p53 by Sir2. As used herein, "Sir2-mediated deacetylation" refers to the NAD-dependent removal of acetyl groups which requires Sir2.
In another embodiment, the present invention relates to a method of screening a compound by providing an in vitro test mixture comprising a transcription factor or a fragment thereof, Sir2, and a Sir2 cofactor with the compound, evaluating an activity of a component of the test mixture in the presence of the compound, and comparing the activity in the presence of the compound to a reference obtained in the absence of the compound.
In another embodiment, the present invention relates to a method of screening a compound that is a potential NAD analog by providing an in vitro test mixture comprising a transcription factor or a fragment thereof, Sir2, and the compound, evaluating an activity of a component of the test mixture in the presence of the compound, and comparing the activity in the presence of the compound to a reference obtained in the absence of the compound, In one embodiment the Sir2 is human, e.g., human SIRT1. In another embodiment, the Sir2 is marine, e.g., marine Sir2a.
In one embodiment the Sir2 cofactor is NAD or an NAD analog.
In another embodiment the transcription factor is p53 or a fragment thereof, and it may be acetylated and/or labeled.
In a further embodiment, the evaluated activity is Sir2 activity, e.g., deacetylation of a protein, e.g., deacetylation of a histone protein, and/or deacetylation of the transcription factor, e.g., deacetylation of p53. The Sir2 activity may also be binding of a protein, e.g., binding of a histone protein and/or binding of the transcription factor, e.g.,. binding of p53. The Sir2 activity may be evaluated by detecting production of nicotinamide.
In a further embodiment, the evaluated activity is p53 activity The p53 activity may be evaluated by detecting cell cycle arrest, apoptosis, senescence, and/or a change in the levels of transcription or translation products of a gene regulated by p53. Methods for detecting such changes and genes regulated by p53 are known in the art and include those methods and genes disclosed in U.S. Pat. No. 6,171,789, which is incorporated herein by reference in its entirety.
In one embodiment, the test mixture is provided in a cell-free system.
In another embodiment, the test mixture is provided in a cell-based system, wherein one of the components is exogenous. The term "exogenous" refers to a component that is either added directly, or expressed from a heterologous DNA source, such as transfected DNA. Many methods are known in the art for expression of heterologous or exogenous gene products.
In a further embodiment, the evaluated activity is an effect on the rate of aging of a cell or organism. Such an effect may be evaluated by contacting the compound with a cell or organism having p53 or Sir2 activity, e.g., endogenous or exogenous p53 or Sir2 activity; and evaluating the rate of aging of the cell or organism. The rate of aging may be evaluated by several methods, including:
a) assessing the life span of the cell or organism;
b) assessing the presence or absence of a gene transcript or gene product in the cell or organism that has a biological age-dependent expression pattern;
c) evaluating resistance of the cell or organism to stress;
d) evaluating one or more metabolic parameters of the cell or organism;
e) evaluating the proliferative capacity of the cell or a set of cells present in the organism;
f) evaluating physical appearance, behavior, or other characteristic of the cell or organism; and (g) assessing the presence or absence of a gene transcript or gene product in the cell or organism that has a p53-regulation-dependent expression pattern.
The compounds identified by the methods of the invention can be used, for example, to treat cancer (e.g., a compound which decreases Sir2-mediated deacetylation of p53) or prevent p53-mediated apoptosis (e.g., acompound which increases Sir2-mediated deacetylation of p53).
The compounds can be used in methods of treating a cell or an organism, e.g., a cell or organism that has been exposed to DNA-damaging ionizing radiation, by modulating Sir2 activity in the cell. In the method of treating cancer in a mammal, Sir2 activity can be reduced. In a preferred embodiment, Sir2 activity is reduced by nicotinamide or a nicotinamide analog.
In yet another embodiment, the invention is a method of screening for analogs of NAD.
In the method, Sir2, p53 and a compound to be tested as an analog of NAD
(e.g., a srilall organic or inorganic molecule) are combined. Deacetylation of the p53 by the Sir2 is measured and compared to the measured deacetylation of p53 by Sir2 in the presence of NAD.
A compound which, for example, promotes Sir2-mediated deacetylation of p53 when combined with Sir2 and p53, is an NAD analog and can be used in place of NAD, for example, as a cofactor with Sir2 to prevent or decrease p53-mediated apoptosis.
In a further embodiment, the invention is a method of treating cancer in a mammal comprising the step of modulating Sir2 activity in tumor cells to cause an increase in p53 activity The Sir2 activity can be modulated as described herein (e.g., overexpression of Sir2, transfection of a cell with a dominant negative regulatory gene, or nicotinamide or a nicotinamide analog).
In another embodiment, the invention includes a method of treating a cell that has been exposed to ionizing radiation, the method comprising modulating Sir2 activity in the cell. In a particular embodiment, in a cell which has undergone DNA damage or oxidative stress, Sir2 activity can be modulated to reduce Sir2 activity (e.g., by transfecting a cell with a dominant negative regulatory gene, or by addition or expression of nicotinamide or a nicotinamide analog) which can result in the arrest of the growth cycle of the cell, allowing the cell to repair at least a portion of the DNA damage caused by the ionizing radiation. Once the cell has repaired a portion of the DNA damage, the reduction in Sir2 activity can be removed and the cell cycle of the cell resumed.
In still another embodiment, the invention includes an isolated protein complex of Sir2 and acetylated p53. p53 cam also be phosphorylated (e.g., on one or both of serine 15 or serine 20 of SEQ m NO. 3).
The compounds or NAD analogs identified by the methods of the invention can be used in the treatment of diseases or conditions such as cancer, or following DNA
damage or oxidative stress. The compounds or NAD analogs can be administered alone or as mixtures with conventional excipients, such as pharmaceutically, or physiologically, acceptable organic, or inorganic earner substances such as water, salt solutions (e.g., Ringer's solution), alcohols, oils and gelatins. Such preparations can be sterilized and, if desired, mixed with lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, andlor aromatic substances and the like which do not deleteriously react with the NAD analogs or compounds identified by the methods of the invention.
The dosage and frequency (single or multiple doses) of the compound or NAD
analog administered to a mammal can vary depending upon a variety of factors, including the duration of DNA damage, oxidative stress or cancer condition.
In some embodiments of the present invention, the rate of aging of a cell, e.g., a yeast cell, invertebrate cell (e.g., fly cell), or vertebrate cell (e.g., mammalian cell, e.g., human or mouse cell) is determined. For example, the rate of aging of the cell can be evaluated by measuring the expression of one or more genes or proteins (e.g., genes or proteins that have an age-related expression pattern), by measuring the cell's resistance to stress, e.g., genotoxic stress or oxidative stress, by measuring one or more metabolic parameters (e.g., protein synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels within the cell, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.), by measuring cellular proliferation, or any combination of measurements thereof.
In other embodiments, the rate of aging of an organism, e.g., an invertebrate (e.g., a worm or a fly) or a vertebrate (e.g., a rodent, e.g., a mouse) is determined. The rate of aging of an organism can be determined by directly measuring the average life span of a group of animals (e.g., a group of genetically matched animals) and comparing the resulting average to the average life span of a control group of animals (e.g., a group of animals that did not receive the test compound but are genetically matched to the group of animals that did receive the test compound). Alternatively, the rate of aging of an organism can be determined visually, e.g., by looking for visible signs of age (e.g., physical appearance or behavior), by measuring the expression of one or more genes or proteins (e.g., genes or proteins that have an age-related expression pattern), by measuring the cell's resistance to genotoxic (e.g., caused by exposure to etoposide, W irradiation, mutagens, etc.) or oxidative stress, by measuring one or.more metabolic parameters (e.g., protein synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.), by measuring cellular proliferation (e.g., of retinal cells, bone cells, white blood cells, etc.), or any combination of measurements thereof. In one embodiment, the visual assessment is for evidence of apoptosis, e.g., nuclear fragmentation.
All animals typically go through a period of growth and maturation followed by a period of progressive and irreversible physiological decline ending in death. The length of time from birth to death is known as the life span of an organism, and each organism has a characteristic average life span. Aging is a physical manifestation of the charges underlying the-passage of time as measured by percent of average life span.
In some cases, characteristics of aging can be quite obvious. For example, characteristics of older humans include skin wrinkling, graying of the hair, baldness, and cataracts, as well as hypermelanosis, osteoporosis, cerebral cortical atrophy, lymphoid depletion, thymic atrophy, increased incidence of diabetes type II, atherosclerosis, cancer, and heart disease. Nehlin et al.
(2000), Annals NY Acad Sci 980:176-79. Other aspects of mammalian aging include weight loss, lordokyphosis (hunchback spine), absence of vigor, lymphoid atrophy, decreased bone density, dermal thickening and subcutaneous adipose tissue, decreased ability to tolerate stress (including heat or cold, wounding, anesthesia, and hematopoietic precursor cell ablation), Iiver pathology, atrophy of intestinal villi, skin ulceration, amyloid deposits, and joint diseases. Tyner et al. (2002), Nature 415:45-53.
Careful observation reveals characteristics of aging in other eukaryotes, including invertebrates. For example, characteristics of aging in the model organism C.
elegans include slow movement, flaccidity, yolk accumulation, intestinal autofluorescence (lipofuscin), loss of ability to eat food or dispel waste, necrotic cavities in tissues, and germ cell appearance.
Those skilled in the art will recognize that the aging process is also manifested at the cellular level, as well as in mitochondria. Cellular aging is manifested in loss of doubling capacity, increased levels of apoptosis, changes in differentiated phenotype, and changes in metabolism, e.g., decreased levels of protein synthesis and turnover.
Given the programmed nature of cellular and organismal aging, it is possible to evaluate the "biological age" of a cell or organism by means of phenotypic characteristics that are correlated with aging. For example, biological age can be deduced from patterns of gene expression, resistance to stress (e.g., oxidative or genotoxic stress), rate of cellular proliferation, and the metabolic characteristics of cells (e.g., rates of protein synthesis and turnover, mitochondrial function, ubiquinone biosynthesis, cholesterol biosynthesis, ATP
levels within the cell, levels of a Krebs cycle intermediate in the cell, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, etc.). As used herein, "biological age" is a measure of the age of a cell or organism based upon the molecular characteristics of the cell or organism.
Biological age is distinct from "temporal age," which refers to the age of a cell or organism as measured by days, months, and years.
Described below are exemplary methods for identifying compounds that can reduce the rate of aging of an organism and thereby slow or ameliorate the pathologies associated with increased temporal age. Activation of p53 may lead to cell cycle arrest or to apoptosis; Sir2 can suppress this effect by deacetylating p53. Accordingly, the expression or activity of p53 andlor Sir2 gene products in an organism can be a determinant of the rate of aging and life span of the organism. Reduction in the level and/or activity of such gene products would reduce the rate of aging and may ameliorate (at least temporarily) the symptoms of aging. A
variety of techniques may be utilized to inhibit the expression, synthesis, or activity of such target genes andlor proteins. Such molecules may include, but are not limited to small organic molecules, peptides, antibodies, antisense, ribozyme molecules, triple helix molecules, and the like.
The following assays provide methods (also referred to herein as "evaluating a compound" or "screening a compound") for identifying modulators, i.e., candidate or test compounds (e.g., peptides, peptidomimetics, small molecules or other drugs) which modulate Sir2 or p53 activity, e.g., have a stimulatory or inhibitory effect on, for example, Sir2 or p53 expression or activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of a Sir2 or p53 substrate. Such compounds can be agonists or antagonists of Sir2 or p53 function. These assays may be performed in animals, e.g., mammals, in organs, in cells, in cell extracts, e.g., purified or unpurified nuclear extracts, intracellular extracts, in purified preparations, in cell-free systems, in cell fractions enriched for certain components, e.g., organelles or compounds, or in other systems known in the art. Given the teachings herein and the state of the art, a person of ordinary skill in the art would be able to choose an appropriate system and assay for practicing the methods of the present invention.

Some exemplary screening assays for assessing activity or function include one or more of the following features:
- use of a transgenic cell, e.g., with a transgene encoding Sir2 or p53 or a mutant thereof;
- use of a mammalian cell that expresses Sir2 or p53;
- detection of binding of a labeled compound to Sir2 or a transcription factor where the compound is, for example, a peptide, protein, antibody or small organic molecule; e.g., the compound interferes with or disrupts an interaction between Sir2 and a transcription factor - use of proximity assays that detect interaction between Sir2 and a transcription factor (e.g., p53), or fragments thereof, for example, fluorescence proximity assays..
- use of a two hybrid assay to detect interaction between Sir2 and a transcription factor (e.g., p53) or fragments thereof. In some instances, the two hybrid assay can be evaluated in the presence of a test compound, e.g., to determine if the test compound disrupts or interferes with an interaction. Two hybrid assays can, for example, be conducted using yeast or bacterial systems.
- use of radio-labelled substrates, e.g. 355, 3H,14C, e.g., to determine acetylation status, metabolic status, rate of protein synthesis, iyater alia.
- use of antibodies specific for certain acetylated or de-acetylated forms of the substrate.
One embodiment herein accordingly comprises methods for the identification of small molecule drug candidates from large libraries of compounds that appear to have therapeutic activity to affect metabolic maintenance and/or to reverse or prevent cell death and thus exhibits potential therapeutic utility, such as the ability to enhance longevity. Small organic molecules and peptides having effective inhibitory activity may be designed de novo, identified through assays or screens, or obtained by a combination of the two techniques. Non-protein drug design may be carried out using computer graphic modeling to design non-peptide, organic molecules able to bind to p53 or Sir2. The use of nuclear magnetic resonance (NMR) data for modeling is also lcnown in the art, as described by Lam et al., Scieh.ce 263: 380, 1994, using information from x-ray crystal structure studies of p53 or Sir2, such as that described in Min, J. et al., Cell 105:269-279, 2001.
Small molecules may also be developed by generating a library of molecules, selecting for those molecules which act as ligands for a specified target, (using protein functional assays, for example), and identifying the selected ligands. See, e.g., Kohl et al., Scieface 260: 1934, 1993. Techniques for constructing and screening combinatorial libraries of small molecules or oligomeric biomolecules to identify those that specifically bind to a given receptor protein are known. Suitable oligomers include peptides, oligonucleotides, carbohydrates, nonoligonucleotides (e.g., phosphorothioate oligonucleotides; see Chem. and Engineering News, page 20, 7 Feb. 1994) and nonpeptide polymers-(see, e.g., "peptoids" of Simon et al., Proc. Natl.
Acad. Sci. USA 89 9367, 1992). See also U.S. Pat. No. 5,270,170 to Schatz;
Scott and Smith, Science 249: 386-390, 1990; Devlin et al., Science 249: 404-406, 1990;
Edgington, BIOlTechnology, 11: 285, 1993. Libraries may be synthesized in solution on solid supports, or expressed on the surface of bacteriophage viruses (phage display libraries).
Known screening methods may be used by those skilled in the art to screen combinatorial libraries to identify active molecules. For example, an increase (or decrease) in pS3 or Sir2 activity due to contact with an agonist or antagonist can be monitored.
In one embodiment, assays for screening candidate or test compounds that are substrates of a Sir2 or p53 protein or polypeptide or biologically active portion thereof are provided. In another embodiment, assays for screening candidate or test compounds which bind to or modulate the' activity of a Sir2 or pS3 protein or polypeptide or biologically active portion thereof, e.g., modulate the ability of Sir2 or pS3 to interact with a ligand, are provided. In still another embodiment, assays for screening candidate or test compounds for the ability to bind to or modulate the activity of a Sir2 or pS3 protein or polypeptide and to also alter the rate of aging of a cell or an organism are provided.
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90: 6909, 1993; Erb.
et al., Proc. Natl.
Acad. Sci. USA 91: 11422, 1994; Zuckermann et al., J. Med. Clzem. 37: 2678, 1994; Cho et al., Science 261: 1303, 1993; Carrell et al., Angew. Claena. Int. Ed. Engl. 33:
2059, 1994; Carell et al., Angew. Clzem. Int. Ed. Engl. 33: 2061, 1994; and in Gallop et al., J.
Med. Chem. 37:1233, 1994.
Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:
4I2-421, 1992), or on beads (Lam, Nature 354: 82-84, 1991), chips (Fodor, Nature 364: SSS-556, 1993), bacteria (Ladner U.S. P.N. 5,223,409), spores (Ladner U.S. P.N.
'409), plasmids (Cull et al., P~oc Natl Acad Sci USA 89: 1865-1869, 1992) or on phage (Scott and Smith, Science 249:

386-390, 1990); (Devlin, Science 249: 404-406, 1990); (Cwirla et al., P~oc.
Natl. Acad. Sci U.S.A. 87: 6378-6382, 1990); (Felici, J. Mol. Biol. 222: 30I-310, 1991);
(Ladner supra.).
The compounds tested as modulators of Sir2 or p53 can be any small chemical compound, or a biological entity, such as a protein, e.g., an antibody, a sugar, a nucleic acid, e.g., an antisense oligonucleotide or a ribozyme, or a lipid. Alternatively, modulators can be genetically altered versions of Sir2 or p53. Typically, test compounds will be small chemical molecules and peptides, or antibodies, antisense molecules, or ribozymes.
Essentially any chemical compound can be used as a potential modulator or ligand in the assays of the invention, although most often compounds that can be dissolved in aqueous or organic (especially DMSO-based) solutions are used. The assays are designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). It will be appreciated that there are many suppliers of chemical compounds, including Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma-Aldrich (St. Louis, MO), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.
In one preferred embodiment, high throughput screening methods known to one of ordinary skill in the art involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic compounds (potential modulator or ligand compounds).
Such "combinatorial chemical libraries" or "ligand libraries" are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds" or can themselves be used as potential or actual therapeutics.
A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks" such as reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks. Moreover, a combinatorial library can be designed to sample a family of compounds based on a parental compound, e.g., based on the chemical structure of NAD or nicotinamide.
Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide Libraries (see, e.g., U.S. Patent 5,010,175, Furlca, Irat. J. Pept. Prot. Res.
37:487-493 (1991) and Houghton et al., Nature 354:84-88 (1991)). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to:
peptoids (e.g., PCT
Publication No. WO 91/19735), encoded peptides (e.g., PCT Publication No. WO
93/20242), random bio-oligomers (e.g., PCT Publication No. WO 92/00091), benzodiazepines (e.g., U.S.
Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypeptides (Hagihara et al., J. AnZeY Chena. Soc. 114:6568 (1992)), nonpeptidal peptidomimetics with glucose scaffolding (Hirsclmlann et al., J. Amer Chem. Soc. 114:9217-9218 (1992)), analogous organic syntheses of small compound libraries (Chen et al., J. Amef: C7Zem. Soc. 116:2661 (1994)), oligocarbamates (Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates (Campbell et al., J. Org.
Chem. 59:658 (1994)), nucleic acid libraries (see Ausubel, Berger and Sambrook, all supra), peptide nucleic acid libraries (see, e.g., U.S. Patent 5,539,083), antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology, 14(3):309-314 (1996) and PCT/LTS96/10287), carbohydrate Libraries (see, e.g., Liang et al., Science, 274:1520-1522 (1996) and U.S.
Patent 5,593,853), small organc molecule libraries (see, e.g., benzodiazepines, Baum C&EN, Jan 18, page 33 (1993);
isoprenoids, U.S. Patent 5,569,588; thiazolidinones and metathiazanones, U.S.
Patent 5,54.9,974;
pyrrolidines, U.S. Patents 5,525,735 and 5,519,134; morpholino compounds, U.S.
Patent 5,506,337; benzodiazepines, 5,288,514, and the like).
Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville ICY, Symphony, Rainin, Woburn, MA, 433AApplied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, MO, ChemStar, Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, PA, Martelc Biosciences, Columbia, MD, etc.).
In one embodiment, the invention provides solid phase based in vitro assays in a high throughput format, e.g., where each assay includes a cell or tissue expressing Sir2 and/or p53. In a high throughput assays, it is possible to screen up to several thousand different modulators or ligands in a single day. In particular, each well of a microtiter plate can be used to run a separate assay against a selected potential modulator, or, if concentration or incubation time effects are to be observed, every S-10 wells can test a single modulator. Thus, a single standard microtiter plate can assay about 96 modulators. If 1536 well plates are used, then a single plate can easily assay from about 100- about 1500 different compounds. It is possible to assay many plates per day; assay screens for up to about 6,000, 20,000, 50,000, or 100,000 or more different compounds are possible using the integrated systems of the invention.
Candidate Sir2- or p53-interacting molecules encompass many chemical classes.
They can be organic molecules, preferably small organic compounds having molecular weights of 50 to 2,500 Daltons. The candidate molecules comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, for example, carbonyl, hydroxyl, and carboxyl groups. The candidate molecules can comprise cyclic carbon or heterocyclic structures and aromatic or polyaromatic structures substituted with the above groups. In one embodiment, the candidate molecules are structurally and/or chemically related to NAD or to nicotinamide.
Other techniques are known in the art for screening synthesized molecules to select those with the desired activity, and for labeling the members of the library so that selected active molecules may be identified, as in U.S. P.N. 5,283,173 to Fields et al., (use of genetically altered Saccharomyces cerevisiae to screen peptides for interactions). As used herein, "combinatorial library" refers to collections of diverse ohigomeric biomolecuhes of differing sequence, which can be screened simultaneously for activity as a ligand for a particular target.
Combinatorial libraries may also be referred to as "shape libraries", i.e., a population of randomized fragments that are potential ligands. The shape of a molecule refers to those features of a molecule that govern its interactions with other molecules, including Van der Waals, hydrophobic, electrostatic and dynamic.
Nucleic acid molecules may also act as ligands for receptor proteins. See, e.g., Edgington, BIOlTechfzology 11: 285, 1993. U.5. P.N. 5,270,163 to Gold and Tuerk describes a method for identifying nucleic acid ligands for a given target molecule by selecting from a library of RNA molecules with randomized sequences those molecules that bind specifically to the target molecule. A method for the in vitro selection of RNA molecules immunohogically cross-reactive with a specific peptide is disclosed in Tsai et al., P~oc.
Natl. Acad. Sci. USA 89:

8864, (1992); and Tsai et al. Immunology 150:1137, (1993). In the method, an antiserum raised against a peptide is used to select RNA molecules from a library of RNA
molecules; selected RNA molecules and the peptide compete for antibody binding, indicating that the RNA epitope functions as a specific inhibitor of the antibody-antigen interaction.
Antibodies that are both specific for a target gene protein and that interfere with its activity may be used to inhibit target gene function. Such antibodies may be generated using standard techniques, against the proteins themselves or against peptides corresponding to portions of the proteins. Such antibodies include but are not limited to polyclonal, monoclonal, Fab fragments, single chain antibodies, chimeric antibodies, and the like.
Where fragments of the antibody are used, the smallest inhibitory fragment which binds to the target protein's binding domain is preferred. For example, peptides having an amino acid sequence corresponding to the domain of the variable region of the antibody that binds to the target gene protein may be used.
Such peptides may be synthesized chemically or produced via recombinant DNA
technology using methods well known in the art (e.g., see Sambrook et al., Eds., Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, (1989), or Ausubel, F. M. et al., eds. Current Protocols in Molecular Biology (1994).
Alternatively, single chain neutralizing antibodies that bind to intracellular target gene epitopes may also be administered. Such single chain antibodies may be administered, for example, by expressing nucleotide sequences encoding single-chain antibodies within the target cell population by utilizing, for example, techniques such as those described in Marasco et al., PYOC. Natl. Acad. Sci. USA 90: 7889-7893 (1993).
Also encompassed are assays for cellular proteins that interact with Sir2 or p53. Any method suitable for detecting protein-protein interactions may be used. The traditional methods that may be used include, for example, co-immunoprecipitation, crosslinking, and co-purification through gradients or chromatographic columns. For these assays, Sir2 or p53 can be a full-length protein or an active fragment. Additional methods include those methods that allow for the simultaneous identification of genes that encode proteins that interact with Sir2 or p53.
These methods include, for example, probing expression libraries using a labeled Sir2 or p53 protein, Sir2 or p53 fragment, or Sir2 or p53 fusion protein.
One method to detect protein-protein interaction in vivo is the two-hybrid system, see, for example, Chien et al., Proc. Natl. Acad. Sci, USA 88: 9578-9582 (1991). In brief, the two-hybrid system utilizes plasmids constructed to encode two hybrid proteins: one plasmid comprises the nucleotides encoding the DNA binding domain of a transcriptional activator protein fused to the Sir2 or p53 nucleotide sequence encoding the Sir2 or p53 polypeptide, and the other plasmid comprises the nucleotides encoding the transcriptional activator protein's activation domain fused to a cDNA encoding an unknown protein that has been recombined into the plasmid from a cDNA library. The DNA binding domain fusion plasmid and the cDNA fusion protein library plasmids are transformed into a strain of yeast that contains a reporter gene, for example lacZ, whose regulatory region contains the activator's binding site. Either hybrid protein alone cannot activate translation of the reporter gene because it is lacking either the DNA
binding domain or the activator domain. Interaction of the two hybrid proteins, however, reconstitutes a functional activator protein and results in activation of the reporter gene that is detected by an assay for the reporter gene product. The colonies that reconstitute activator activity are purified and the library plasmids responsible for reporter gene activity are isolated and sequenced. The DNA
sequence is then used to identify the protein encoded by the library plasmid.
Macromolecules that interact with Sir2 or p53 are referred to as Sir2 or p53 binding partners. Sir2 or p53 binding partners are likely to be involved in the regulation of Sir2 or p53 function. Therefore, it is possible to identify compounds that interfere with the interaction between Sir2 or p53 and its binding partners. The basic principle of assay systems used to identify compounds that interfere with the interaction of Sir2 or p53 and a binding partner is to prepare a reaction mixture containing Sir2 or p53 or a Sir2 or p53 fragment and the binding partner under conditions that allow complex formation. The reaction mixture is prepared in the presence or absence of the test compound to test for inhibitory activity The test compound may be added prior to or subsequent to Sir2/ or p53/binding partner complex formation. The formation of a complex in a control but not with the test compound confirms that the test compound interferes with complex formation. The assay can be conducted either in the solid phase or in the liquid phase.
In another embodiment, an assay is a cell-based assay comprising contacting a cell expressing Sir2 or p53 with a test compound and determining the ability of the test compound to modulate (e.g. stimulate or inhibit) the activity of Sir2 or p53. A preferred activity is the deacetylation function of Sir2 on p53; a further preferred activity is the ability of p53 to cause ERU cycle arrest or apoptosis. Determining the ability of the test compound to modulate the activity of Sir2 or p53 can be accomplished, for example, by determining the ability of Sir2 or p53 to bind to or interact with the test molecule, or by determining the ability of the test molecule to stimulate or inhibit the activity of Sir2 or p53. Cell-based systems can be used to identify compounds that inhibit Sir2 or p53. Such cells can be recombinant or non-recombinant, such as cell lines that express the Sir2 or p53 gene. Preferred systems are mammalian or yeast cells that express Sir2 or p53. In utilizing such systems, cells are exposed to compounds suspected of ameliorating body weight disorders or increasing lifespan. After exposure, the cells are assayed, for example, for expression of the Sir2 or p53 gene or activity of the Sir2 or p53 protein. Alternatively, the cells are assayed for phenotypes such as those resembling body weight disorders or lifespan extension. The cells may also be assayed for the inhibition of the deacetylation function of Sir2 on p53, or the apoptotic or cytostatic function of p53.
Another preferred cell for a cell-based assay comprises a yeast cell transformed with a vector comprising the Sir2 or p53 gene. One use for a yeast cell expressing Sir2 or p53 is to mutagenize the yeast and screen for yeast that will survive only when the Sir2 or p53 polypeptide is functioning normally. Synthetic lethal screens are described in Holtzman et al. (1993), J. Cell Bio. 122: 635-644. The yeast that require Sir2 or p53 function for survival can then be used to screen test compounds for those that iWibit Sir2 or p53 activity. Test compounds that results in a decrease in yeast survival are likely inhibitors of Sir2 or p53 in this system.
In yet another embodiment, an assay is a cell-free assay in which Sir2 or p53 protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to bind to the Sir2 or p53 protein or biologically active portion thereof is determined.
Binding of the test compound to the Sir2 or p53 protein can be determined either directly or indirectly as described above. In a preferred embodiment, the assay includes contacting the Sir2 or p53 protein or biologically active portion thereof with a known compound which binds Sir2 or p53 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with an Sir2 or p53 protein, wherein determining the ability of the test compound to interact with an Sir2 or p53 protein comprises determining the ability of the test compound to preferentially bind to Sir2 or p53 or a biologically active portion thereof as compared to the known compound.
W yet another embodiment, an assay is a cell-free system in which Sir2 protein or biologically active portion thereof is contacted with p53 protein or biologically active portion thereof, to form a mixture comprising a detectable amount bound p53:Sir complex. And a test compound is contacted with the mixture, and the ability of the compound to effect the stability or formation of the p53:Sir2 complex is determined. Interaction of the test compound with he p53:Sir2 complex may be determined directly or by methods known in the art. W
a preferred embodiment, the method comprises contacting p53 with Sir2 to form a mixture comprising the p53:Sir2 complex, further contacting the mixture with a compound to be tested, and evaluating the binding kinetics of p53:Sir2 complex both in the presence and the absence of the test compound to directly bind the p53:Sir2 complex is evaluated. The cell-free assays are amenable to use of both soluble and/or membrane-bound forms of proteins. In the case of cell-free assays in which a membrane-bound form of a protein is used it may be desirable to utilize a solubilizing agent such that the membrane-bound form of the protein is maintained in solution. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton X-100, Triton X-114, Thesit, Isotridecypoly(ethylene glycol ether)n, 3-[(3-cholamidopropyl)dimethylammonio]-1-propane sulfonate (CHAPS), 3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propane sulfonate (CHAPSO), or N-dodecyl,N,N-dimethyl-3-amino-1-propane sulfonate.
In more than one embodiment of the above assay methods, it may be desirable to immobilize either Sir2 or p53 or its target molecule to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of a test compound to an Sir2 or p53 protein, or interaction of an Sir2 or p53 protein with a target molecule in the presence and absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows one or both of the proteins to be bound to a matrix. For example, glutathione-S-transferase/Sir2 or /p53 fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the test compound or the test compound and either the non-adsorbed target protein or Sir2 or p53 protein, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above.
Alternatively, the complexes can be dissociated from the matrix, and the level of Sir2 or p53 binding or activity deternlined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either a Sir2 or p53 protein or a Sir2 or p53 target molecule can be immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated Sir2 or p53 protein or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with Sir2 or p53 protein or target molecules but which do not interfere with binding of the Sir2 or p53 protein to its target molecule can be derivatized to the wells of the plate, and unbound target Sir2 or p53 protein trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the GST
irninobilized complexes, include immunodetection of complexes using antibodies reactive with the Sir2 or p53 protein or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the Sir2 or p53 protein or target molecule.
In addition to cell-based and in vitro assay systems, non-human organisms, e.g., transgenic non-human organisms, can also be used. A transgenic organism is one in which a heterologous DNA sequence is chromosomally integrated into the germ cells of the animal. A
transgenic organism will also have the transgene integrated into the chromosomes of its somatic cells. Organisms of any species, including, but not limited to: yeast, worms, flies, fish, reptiles, birds, mammals (e.g., mice, rats, rabbits, guinea pigs, pigs, micro-pigs, and goats), and non-human primates (e.g., baboons, monkeys, chimpanzees) may be used in the methods of the invention.
Accordingly, in another embodiment, the invention features a method of identifying a compound that alters the rate of aging of a cell or an organism, comprising:
contacting a Sir2 or p53 polypeptide with a test compound; evaluating an interaction between the test compound and the Sir2 or p53 polypeptide; and further evaluating the effect of the test compound on the rate of aging of a cell or organism.

The interaction between a test compound and the Sir2 or p53 polypeptide can be performed by any of the methods described herein, e.g., using cell-based assays or cell-free irZ
vitro assays. Weather the interaction between the test compound and the Sir2 or p53 polypeptide is evaluated prior to the evaluation of the effect of the text compound on the rate of aging of a cell or organism is not critical to the method. However, it is preferable to evaluate the interaction between the test compound and Sir2 or p53 polypeptide first, so that test compounds that do not interact with the Sir2 or p53 polypeptide do not have to be tested for their effect upon the rate of aging. It can also be preferable to use an assay for evaluating the interaction between the test compound and the Sir2 or p53 polypeptide that can be adapted for lugh throughput screening, thus making it possible to screen one or more libraries of test compounds.
Possible test compounds include, e.g., small organic molecules, peptides, antibodies, and nucleic acid molecules, as described above.
The rate of aging of an organism can be determined using methods known in the art. For example, the rate of aging of an organism can be determined by directly measuring the life span of the organism. Preferably, a statistical measure, e.g., an average or median value, of the life span of a group of animals, e.g., a group of genetically matched animals, will be determined and the resulting statistical value compared to an equivalent statistical value, e.g, an average of median value, of the life span of a control group of animals, e.g., a group of animals that did not receive the test compound but are genetically matched to the group of animals that did receive the test compound. Such methods are suitable for organisms that have a short life span, such as worms or flies. See, for example, Rogina et al. (2000), SciefZCe 290:2137-40.
Direct measurement of life span can also be preformed with other organisms such as rodents, as discussed, for example, in Weindruch et al. (196), .Iouf°nal ofNutritiora 116(4):641-54. Those skilled in the art will recognize that there are many ways of measuring the statistical difference (e.g., using the Student's T test) between two sets of data, any of which may be suitable for the methods of the invention.
To reduce the time that it takes to measure a change in the rate of aging using data on the Iife span of the organisms treated with the test compound, various modifications or treatments of the organisms can be implemented. For example, anmals fed on a calorically rich diet tend to live shorter lives, thus reducing the time that needs to elapse to determine when the average life span of the test group of animals has exceeded the average life span of the control group of animals. Alternatively, the test compound can be administered to test animals that have already lived for 50%, 60%, 70%, 80%, 90%, or more of their expected life span. Thus, the test compound can be administered to an adult organism, or even an old adult organism. Other possibilities include the use of genetically modified organisms. For example, the organisms could harbor mutations (e.g., a Hyperhinetic~ or Shapers mutation in Drosoplzila, or a mutation in a silent information regulator gene (e.g., Sir2), or a catalase or superoxide dismutase gene) or transgenes (e.g., encoding a transporter protein (e.g., a carboxylate transport protein such as INDY) or a protein involved in insulin signaling and metabolic regulation (e.g., IGF-1)) that reduce their average Iife span. See Rogina et al. (1997), Pi°oc. Natl.
Acad. Sci., USA 94:6303-6;
Rogina and Helfand (2000), Biogerofztology 1:163-9; and Guarente and Kenyon (2000), Nature 408:255-62. Those skilled in the art will understand that it may also be desirable to practice the methods of the invention using organisms that are long-lived, such as calorically restricted animals, or animals carrying mutations or transgenes that increase their Iife span.
A proxy for rate of aging of a cell or an organism can be determined using biomarkers that are indicative of the biological age of the organism (i.e., age-related parameters). Using biomarkers for determining biological age can greatly facilitate screens for compounds that alter the rate of aging, as they bypass the requirement of waiting for the animal to die in order to determine the rate of aging. Biomarkers suitable for use in the present invention include, but are not limited to, levels of protein modification, e.g., accumulation of glycosylated proteins, rates or levels of protein turnover, levels or composition of T cell populations, protein activity, physical characteristics, macular degeneration, and/or increased copper and zinc concentrations in neuronal tissues. The expression of genes whose regulation is biological age-dependent is a particularly preferred biomarker for use in the methods of the invention.
Numerous genes are known to be expressed in a biological age-dependent manner. In Drosophila, for example, such genes include wingless and engrailed. See Rogina and Helfand (1997), Meclzaniszns of Development 63:89-97. In mice, the expression of the ras oncogene is elevated in older animals.
See Hass et al. (1993), Mutat. Res. 295(4-6):281-9. Similarly, in rodents and worms, genes that are differentially expressed in young and old organisms have been identified by transcriptional profiling using microarrays. See, e.g., Lee et al. (1999), Science 285:1390-93; WO 01/12851;
and Hill et al. (2000), Science 290:809-812. For example, Hill et al. (2000) Science 90:809 discloses genes whose transcripts are up-regulated in nematodes that are at 2 weeks in development. Examples of such genes include the genes described in cluster (4,1):69 of Hill, supra. Any gene whose regulation is biological age-dependent is suitable for the methods of the invention. Preferably, more than one gene is analyzed so as to improve the accuracy of the determination. Analysis of gene expression can be performed by any technique known in the art, including Northern, in-situ hybridization, quantitative PCR, and transcriptional profiling using microarrays. Methods of determining biological age based on gene expression patterns are described in WO 01/12851.
Metabolic parameters can also be used to evaluate the rate of aging of a cell or organism.
For example, the rate of protein synthesis and degradation decreases in biologically aged cells, and the levels proteins having advanced glycosylation end product modifications increases. See, Lambert and Merry (2000), Exp. Gerontol 35(5):583-94; and WO 01/79842. In addition, animals that harbor mutations conferring longer life span (and thus a reduced rate of aging) can show defects in ubiquinone biosynthesis, mitochondrial biogenesis, glucose metabolism, nucleic acid metabolism, ribosomal translation rates, and cholesterol biosynthesis.
See, for example, WO 98/17823 and WO 99/10482. Thus, by measuring any of these parameters or some combination thereof, it is possible to indirectly evaluate the rate of aging of a cell or an organism.
Methods of analyzing protein synthesis, degradation, and modification with advanced glycosylation end products are known in the art, as described in Lambert and Merry (2000), Exp.
Gerontol 35(5):583-94 and WO 01/79842. Similarly, methods of analyzing ubiquinone biosynthesis, mitochondrial biogenesis, and glucose metabolism are known in the art (see, e.g.,.
Marbois et al. J. Biol. Chern. 271:2995; Proft et al. EMBO J. 14:6116; and WO
98/17823), as are methods of analyzing nucleic acid metabolism, ribosomal translation rates, and cholesterol biosynthesis (see, e.g., WO 99/10482).
Cellular proliferation is another parameter that can be used to evaluate the biological age of a cell or organism. Cells from biologically aged organisms demonstrate reduced proliferative capacity as compared to the cells of a corresponding younger orgaiusm. See Li et al. (1997), Invest. Ophthalmol. 38(1):100-7; and Wolf and Pendergrass (1999), J Ge~oyztol.
A Biol. Sci. Med.
Sci. 54(11):B502-17. It will be understood by one skilled in the art that there are many methods for evaluating the proliferative capacity of cells that are suitable for use in the methods of the invention. For example, cells can be labeled in vitro (or in vivo) with BrdU
to determine the percent of dividing cells or evaluated using a colony forming assay, as described in Li et al.

(1997), supra. Cells suitable for the analysis of proliferative capacity include cells grown in tissue culture, cells isolated from an animal that has been treated with a test compound, cells that are part of a live animal, or cells that are part of a tissue section obtained from an animal. With respect to cells present in an animal or tissue section thereof, preferable cells include lens epithelial cells, osteoblasts, osteoclasts, and lymphoid cells.
Basically, any biomarlcer that is altered in a biological age-dependent manner has the potential to be used to evaluate the effect of a test compound upon the rate of aging of a cell or an organism. Thus, additional biomarkers include visual appearance, resistance to oxidative stress, cellular transformation (the ability to adopt a transformed (i.e., cancerous or malignant) phenotype), or DNA methylation (e.g., of a ras oncogene). See, for example, Finkel and Holbrook (2000), Nature 408:239-47; Kari et al. (1999), JNutr Health Aging 3(2):92-101; and Hass et al. (1993), Mutat. Res. 295(4-6):281-9.
A cell used in the methods of the invention can be from a stable cell line or a primary culture obtained from an organism, e.g., a organism treated with the test compound.
A transgenic cell or animal used in the methods of the invention can include a transgene that encodes, e.g., a copy of a Sir2 or p53 protein, e.g., the Sir2 or p53 polypeptide that was evaluated for an interaction with the test compound. The transgene can encode a protein that is normally exogenous to the transgenic cell or animal, including a human protein, e.g., a human Sir2 or p53 polypeptide. The transgene can be linked to a heterologous or a native promoter.
Transgenic Organisms This disclosure further relates to a method of producing transgenic animals, e.g., mice or flies. In one embodiment, the transgenic animal is engineered to express, overexpress or ectopically express Sir2 or p53, which method comprises the introduction of several copies of a segment comprising at least the polynucleotide sequence encoding SEQ m NO. 2 with a suitable promoter into the cells of an embryo at an early stage. Techniques known in the art may be used to introduce the Sir2 or p53 transgene into animals to produce the founder line of animals. Such techniques include, but are not limited to: pronuclear microinjection (U.5.
P.N. 4,873,191);
retrovirus mediated gene transfer into germ lines (Van der Putten et al., Proc. Natl. Acad. Sci.
LISA 82: 6148-6152, 1985; gene targeting in embryonic stem cells (Thompson et al., Cell 56:
313-321, 1989; electroporation of embryos (Lo, Mol. Cell Biol. 3: 1803-1814, 1983; and sperm-mediated gene transfer (Lavitrano, et al., Cell 57: 717-723, 1989; etc. For a review of such techniques, see Gordon, Intl. Rev. Cytol. 115: 171-229, 1989.
Gene targeting by homologous recombination in embryonic stem cells to produce a transgenic animal with a mutation in the Sir2 or p53 gene ("knock-out"
mutation) can also be performed . In such so-called "knock-out" animals, there is inactivation of the Sir2 or p53 gene or altered gene expression, such that the animals can be useful to study the function of the Sir2 or p53 gene, thus providing animals models of human disease, which are otherwise not readily available through spontaneous, chemical or irradiation mutagenesis.
A particularly useful transgenic animal in one in which the Sir2 or p53 homolog has been disrupted or knocked out.
Transgenic animals such as mice, for example, may be used as test substrates for the identification of drugs, pharmaceuticals, therapies and interventions that can be used for the ameliorating or slowing the effects of aging.
Accordingly, the invention features a transgenic organism that contains a transgene encoding a Sir2 or p53 polypeptide. In preferred embodiments, the Sir2 or p53 r polypeptide is a human Sir2 or p53 polypeptide. The Sir2 or p53 polypeptide can be exogenous to (z.e., not naturally present in) the transgenic organism.
The transgenic organism can be a yeast cell, an insect, e.g., a worm or a fly, a fish, a reptile, a bird, or a mammal, e.g., a rodent.
The transgenic organism can further comprise a genetic alteration, e.g., a point mutation, insertion, or deficiency, in an endogenous gene. The endogenous gene harboring the genetic alteration can be a gene involved in the regulation of life span, e.g., a gene in the insulin signaling pathway, a gene encoding a Sir2 or transcription factor protein, or both. In cases where the genetically altered gene is a Sir2 or transcription factor, e.g., p53, polypeptide, it is preferable that the expression or activity of the endogenous Sir2 or transcription factor, e.g., p53, protein is reduced or eliminated.
Therapeutic Uses In another embodiment, the invention features a method of altering the expression or activity of a Sir2 or p53 polypeptide, comprising administering to a cell or an organism a compound that increases or decreases the expression or activity of the Sir2 or p53 polypeptide in an amount effective to increase or decrease the activity of the Sir2 or p53 polypeptide.

The Sir2 or p53 polypeptide can also be a yeast, invertebrate (e.g., worm or fly), or vertebrate (e.g., fish, reptile, bird, or mammal (e.g., mouse)) protein. .
The cell to which the compound is administered can be an invertebrate cell, e.g., a worm cell or a fly cell, or a vertebrate cell, e.g., a fish cell (e.g., zebrafish cell), a bird cell (e.g., chiclcen cell), a reptile cell (e.g., amphibian cell, e.g., Xen.opus cell), or a mammalian cell (e.g., mouse or human cell). Similarly, the organism to which the compound is administered can be an invertebrate, e.g., a worm or a fly, or a vertebrate, e.g., a fish (e.g., zebrafish), a bird (e.g., chicken), a reptile (e.g., amphibian, e.g., Xenopus), or a mammal (e.g., rodent or a human).
When the organism is a human, it is preferred that the human is not obese or diabetic.
The compound that is administered to the cell or organism can be an agonist that increases the expression or activity of the Sir2 ox p53 polypeptide or an antagonist that decreases the expression or activity of the Sir2 or p53 polypeptide. Whether agonist or antagonist, the compound can be a small organic compound, an antibody, a polypeptide, or a nucleic acid molecule.
The agonist or antagonist can alter the concentration of metabolites, e.g., Krebs Cycle intermediates, e.g., succinate, citrate, or a-keto-glutarate, within the cell or within one or more cells of the organism. Such action is expected to alter the cell's or the organism's resistance to oxidative stress. For example, an antagonist could increase the cell's or the organism's resistance to oxidative stress. In addition, the agonist or antagonist can alter one or more aging-related parameters, e.g., the expression of one or more genes or proteins (e.g., genes or proteins that have an age-related expression pattern), or the value of one or more metabolic parameters (e.g., one or more metabolic parameters that reflect the rate of aging of the cell or organism). , the agonist or antagonist alters the rate of aging of the cell or organism.
Ideally, the compound reduces, e.g., partially reduces, the expression of the Sir2 or p53 polypeptide. For example, anti-sense RNA, or ribozymes can be used to reduce the expression of the Sir2 or p53 polypeptide. Double-stranded inhibitory RNA is particularly useful as it can be used to selectively reduce the expression of one allele of a gene and not the other, thereby achieving an approximate SO% reduction in the expression of the Sir2 or p53 polypeptide. See Garrus et al. (2001), Cell 107(1):55-65.
In one embodiment, treatment of aging comprises modulating the expression of a Sir2 or p53 polypeptide. A cell or subject can be treated with a compound that modulates the expression of a Sir2 or p53 gene. These compounds can be nucleic acid molecules substantially complementary to a Sir2 or p53 gene. Such approaches include oligonucleotide-based therapies such as antisense, ribozymes, and triple helices .
Oligonucleotides may be designed to reduce or inhibit mutant target gene activity.
Techniques for the production and use of such molecules are well lcnown to those of ordinary skill in the art. Antisense RNA and DNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. With respect to antisense DNA, oligodeoxyribonucleotides derived from the translation initiation site, e.g., between the -10 and +10 regions of the target gene nucleotide sequence of interest, are preferred.
Antisense oligonucleotides are preferably 10 to 50 nucleotides in length, and more preferably 15 to 30 nucleotides in length. An antisense compound is an antisense molecule corresponding to the entire Sir2 or p53 mRNA or a fragment thereof.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage.
The composition of ribozyrne molecules includes one or more sequences complementary to the target gene mRNA, and includes the well known catalytic sequence responsible for mRNA
cleavage disclosed, for example, in U.S. P.N. 5,093,246. Within the scope of this disclosure are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences encoding target gene proteins.
Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the molecule of interest for ribozyme cleavage sites that include the sequences GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features, such as secondary structure, that may render the oligonucleotide sequence unsuitable.
The suitability of candidate sequences may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
Nucleic acid molecules used in triple helix formation for the inhibition of transcription should be single stranded and composed of deoxyribonucleotides. The base composition of these oligonucleotides are designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either purines or pyrimidines to be present on one strand of a duplex. Nucleotide sequences may be pyrimidine-based, which will result in TAT
and CGC triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules may be chosen that are purine-rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex.
Alternatively, the potential sequences targeted for triple helix formation may be increased by creating a "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex.
The antisense, ribozyme, andlor triple helix molecules described herein may reduce or inhibit the transcription (triple helix) and/or translation (antisense, ribozyrne) of mRNA produced by both normal and mutant target gene alleles. If it is desired to retain substantially normal levels of target gene activity, nucleic acid molecules that encode and express target gene polypeptides exhibiting normal activity may be introduced into cells wia gene therapy methods that do not contain sequences susceptible to whatever antisense, ribozyme, or triple helix treatments are being utilized. Alternatively, it may be preferable to coadminister normal target gene protein into the cell or tissue in order to maintain the requisite level of cellular or tissue target gene activity.
Antisense RNA and DNA, ribozyme, and triple helix molecules may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides, for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA
molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA
molecule. Such DNA sequences may be incorporated into a wide variety of vectors that incorporate suitable RNA polymerise promoters such as the T7 or SP6 polymerise promoters.

Alternatively, antisense cDNA constructs that synthesize antisense RNA
constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines. Various well-lrnown modifications to the DNA molecules may be introduced as a means of increasing intracellular stability and half life. Possible modifications include but are not limited~to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides of the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
Modulators of Sir2 or p53 expression can be identified by a method wherein a cell is contacted with a candidate compound and the expression of Sir2 or p53 mRNA or protein in the cell is determined. The level of expression of Sir2 or p53 mRNA or protein in the presence of the candidate compound is compared to the level of expression of mRNA or protein in the absence of the candidate compound. The candidate compound can then be identified as a modulator of Sir2 or p53 expression based on this comparison. For example, when expression of Sir2 or p53 mRNA or protein is greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of Sir2 or p53 mRNA or protein expression.
Alternatively, when expression of Sir2 or p53 mRNA or protein is less in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of Sir2 or p53 mRNA or protein expression. The level of Sir2 or p53 mRNA or protein expression in the cells can be determined by methods described herein for detecting Sir2 or p53 mRNA or protein.
Delivery of antisense, triplex agents, ribozymes, and the like can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system or by injection. Useful virus vectors include adenovirus, herpes virus, vaccinia, and/or RNA virus such as a retrovirus. The retrovirus can be a derivative of a marine or avian retrovirus such as Moloney marine leukemia virus or Rous sarcoma virus. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated. The specific nucleotide sequences that can be inserted into the retroviral genome to allow target specific delivery of the retroviral vector containing an antisense oligonucleotide can be determined by one of skill in the art.
Another delivery system for polynucleotides is a colloidal dispersion system.
Colloidal dispersion systems include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles and liposomes.
A preferred colloidal delivery system is a liposome, an artificial membrane vesicle useful as in vivo or in vitro delivery vehicles. The composition of a liposome is usually a combination of phospholipids, usually in combination with steroids, particularly cholesterol.
The Sir2 or p53 gene may also be underexpressed.
Methods whereby the level of Sir2 or p53 gene activity may be increased to levels wherein disease symptoms are ameliorated also include increasing the level of gene activity, for example by either increasing the level of Sir2 or p53 gene present or by increasing the level of gene product which is present.
For example, a target gene protein, at a level sufficient to ameliorate metabolic imbalance symptoms, may be administered to a patient exhibiting such symptoms. One of skill in the art will readily know how to determine the concentration of effective, non-toxic doses of the normal target gene protein. Additionally, RNA sequences encoding target gene protein may be directly administered to a patient exhibiting disease symptoms, at a concentration sufficient to produce a level of target gene protein such that the disease symptoms are ameliorated.
Administration may be by a method effective to achieve intracellular administration of compounds, such as, for example, liposome administration. The RNA molecules may be produced, for example, by recombinant techniques such as those described above.
Further, patients may be treated by gene replacement therapy. One or more copies of a normal target gene, or a portion of the gene that directs the production of a normal target gene protein with target gene function, may be inserted into cells using vectors that include, but are not limited to adenovirus, adenoma-associated virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes. Additionally, techniques such as those described above may be utilized for the introduction of normal target gene sequences into human cells.
Cells, preferably autologous cells, containing and expressing normal target gene sequences may then be introduced or reintroduced into the patient at positions which allow for the amelioration of metabolic disease symptoms. Such cell replacement techniques may be preferred, for example, when the target gene product is a secreted, extracellular gene product.
In instances where the target gene protein is extracellular, or is a transmembrane protein, any of the administration techniques described, below which are appropriate for peptide administration may be utilized to effectively administer inhibitory target gene antibodies to their site of action.
The identified compounds that inhibit target gene expression, synthesis and/or activity can be administered to a patient at therapeutically effective doses to treat or ameliorate or delay the symptoms of aging. A therapeutically effective dose refers to that amount of the compound sufficient to result in amelioration or delay of symptoms of aging.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 l ED50. Compounds that exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with Iittle or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. .
Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.

For oral administration, the pharmaceutical compositions may take the form of, fox example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups, or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils);
and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring, and sweetening agents as appropriate.
Preparations for oral administration may be suitably formulated to give controlled release of the active compound. For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g.
gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. hi addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as m emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
All references cited herein are incorporated by reference in their entirety The invention is illustrated by the following non-limiting examples.
Materials and Methods Plasmids and antibodies To construct mSir2a expression constructs, the full-length cDNA was subcloned from pET28a-Sir2a (Imai et al., 2000) into pcDNA3 or pBabepuro vector. Site-directed mutation was generated in the plasmid pRS305-Sir2a using the Gene Edit system (Promega). To construct the human SIRT1 expression construct, DNA sequences corresponding to the full-length hSIRTl (Frye, 1999) were amplified by PCR from Marathon-Ready Hela cDNA (Clontech), and initially subcloned into pcDNA3.1/VS-His-Topo vector (Invitrogen), and then subcloned with a Flag-tag into a pCIN4 vector for expression (Gu et al., 1999). To prepare the Sir2a antibody that can recognize both human and mouse Sir2a, a polyclonal antibody against the highly conserved C-terminus of Sir2a was generated. DNA sequences corresponding to this region (480-737) were amplified by PCR and subcloned into pGEX-2T (Pharmacia). a-Sir2a antisera was raised in rabbits against the purified GST-Sir2a (480-737) fusion protein (Covance), and further affinity-purified on both protein-A and antigen columns. By Western blot analysis and immunofluorescent staining, this antibody can detect both mouse Sir2a and human SIRTI
proteins.
To construct hSir2 expression constructs, BamHI/SnaBI fragment of hSIR2SlRT1 cDNA
was inserted into pBabe-Y-Puro. The resulting plasmid was designated pYESir2-puro. Similarly a BamHI/SnaBI fragment of hSir2 that was mutated at residue 363 from Histidine (H) to Tyrosine (Y) by site-directed mutagenesis (Stratagene) was used to create the retroviral vector pYESir2HY. pBabe-hTERT-hygro contained an EcoRI/SaII fragment of hTERT cloned into EcoRI/SaII site of pBabe-Hygro. pCMVwtp53, pCMVK382R and pCMVK320R were a gift from Dr. E. Appella (NITi).
Cell culture and derivation of cell lines All cells were grown in presence of 20% OZ and 5% COZ at 37°C in humidified chambers. Human diploid fibroblast BJ cells, human epithelial breast carcinoma cell line MCF7 and H1299 human epithelial carcinoma cell lines were grown in DME +10% FCS.
PBS(-/-) (phosphate buffered saline) without magnesium or calcium was used for washing cells and other applications described herein.
Amphotrophic viruses were produced by transient co-transfection of pCL-pCL-Ampho with the LTR containing pBabe vectors (Morgenstern and Land, 1990), pYESir2 or pYESir2HY
in to 293T cell line using Fugene6 (Ruche). Three days post transfection supernatants were collected and filtered with 0.4 micron filters. Primary BJ cells or MCF7 cells were infected with retrovirus containing media in presence of 8 mg/ml of polybrene overnight and 48 hours later cells were selected in puromycin at 1 mg/ml.
Following selection and during the experimentation all the mass cultures were maintained in presence of puromycin. These selected BJ cells were subsequently infected and selected with a pBabe-hTERT virus carrying the hygromycin resistance gene (200mg/ml). The resulting cells were: BJT (carrying pYE-Puro backbone and pBabe-hTERT-hygro), BJThSir2wt (carrying pYESir2 wild type hSir2 and pBabe-hTERT hygro) and BJThSir2HY (pYESir2HY
mutant hSir2 and pBabe-hTERT-hygro). MCF7 cells were transfected with the vector p2lP-luc (Vaziri et al., 1997) and pCMVneo, clones were selected in 500 mg/ml of 6418 and the clone designated MCF73L was selected that was able to upregulate the p21WAF1 promoter-luciferase in response to treatment with 6 Gy of ionizing radiation. MCF7 cells or MCF73L were infected with the same viruses as described before to yield the following cell lines: MCF73LP
(carrying pBabe Y-puro backbone), MCF73L-hSir2wt and MCF73L-hSir2HY. Cells were kept under appropriate selection throughout experiments.
ha vitro p53 deacetylation Assay The Flag-tagged Sir2a-expressing cells were established and expanded in DMEM
medium, and cell extracts were prepared essentially as previously described (Luo et al., 2000;
Gu et al., 1999; Ito et al., 1999). The proteins were purified under a very high stringency condition (300 mM NaCI and 0.5 % NP-40). The eluted proteins were resolved by a SDS-PAGE
gel and analyzed by colloidal blue staining (Novex). Acetylated GST-p53 was prepared by p53 acetylation assay as previously described (Gu and Roeder, 1997) and further purified on glutathione-Sepharose (Luo et al., 2000). The 14C-labeled acetylated p53 (2.5 ~,g) was incubated with purified Sir2a (10 ng) at 30 °C for 1 hr either in the presence of 50 ,uM NAD or as indicated. The reactions were performed in a buffer containing 50 mM Tris-HCl (pH 9.0), SOmM NaCI, 4 mM MgClz, 0.5 mM DTT, 0.2 mM PMSF, 0.02% NP-40 and 5% glycerol.
The reactions were resolved on SDS-PAGE and analyzed by Coornassie blue staining and autoradiography.
Immunoprecipitation and Immunofluorescence H1299 cells transiently expressing p53 and hSir2 were lysed using the NP40 buffer and lysates described above and immunoprecipitated with lul of anti-hSir2 antibody overnight.
Protein G-sepharose beads (50 ml) were added to the lysates and rotated at 4°C for 3hrs. The immune complexes were collected, washed 3 times, and resolved using the Nupage gradient 4-12% Bis-Tris MOPS (3-N-morpholino propane sulfonic acid) protein gel (Novex) in the presence of provided anti-oxidant (Novex).
The gels used were transferred to nitrocellulose and probed with anti-p53 antibody (pAb7 sheep anti human polyclonal antibody, Oncogene Science), signal detected using a goat anti-sheep HRP secondary antibody. The membranes were subsequently washed and reprobed with anti-hSir2 antibody.
For immunoprecipitation in BJ cells, lmg of protein per reaction were incubated with lul of Ab-6(anit-p53 monoclonal, Oncogene Science) and immunoprecipitation was performed as described above except that the time of incubation in primary antibody was 2hrs and 4 times higher concentrations of protease inhibitors were used, due to the observed high instability of p53 protein in BJ cells. Immune complexes were resolved as previously described using the Novex system (Invitrogen) and membranes were exposed to a mix of polyclonal antibodies at 1:1000 dilution (SC6432, polyclonal rabbit and CM1, polyclonal rabbit). A
secondary goat anti-rabbit HRP was used at 1:30,000 concentration for detection. Membranes were subsequently blocked again and re-probed with anti-hSir2 antibody.
GO

hnmunofluorescence of U20S and BJ cells was undertaken by fixing the cells in microchamber slides (LabTek) in 70% Ethanol and subsequent staining with anti-hSir2 antibody at 1:500 dilution. A secondary goat anti-rabbit FITC antibody at 0.5 ug/ml was used for detection of signal.
GST pull-down assay and co-immunoprecipitation assay , GST fusion proteins were expressed in E. coli, extracted with buffer BC500 (20 mM
Tris-HC1, pH 8.0, 0.5 mM EDTA, 20% glycerol, 1mM DTT and 0.5 mM PMSF) containing 50 mM KC1 and 1% NP-40, and purified on glutathione-sepharose (Pharmacia). 35S-labeled Sir2a was in vitro translated by ~a TNT kit (Promega) using pcDNA3-Sir2a as a template. 5 ~,l of 35S-labeled Sir2a were incubated at 4°C for 60 min with each of the different immobilized GST
fusion proteins in BC200 buffer containing 200 mM KCl and 0.2% NP-40. Beads were then washed five times in 0.5 ml of the same buffer. Bound proteins were eluted with an equal volume of SDS sample buffer, resolved by SDS-PAGE, and analyzed by Coomassie blue staining and autoradiography.
The co-immunoprecipitation assay was performed essentially as described previously (Luo et al., 2000). Cells were extracted with lysis buffer (25mM HEPES-KOH, pH
8.0, 150 mM
KCl, 2mM EDTA, 1mM DTT, 1mM PMSF, l0,ug/ml aprotinin, l0,ug/ml leupeptin, l,ug/ml pepstatin A, 20 mM NaF, 0.1% NP-40). After centrifugation, the supernatants were incubated with M2 beads (Sigma) for 4 hr at 4°C. The M2 beads were washed five times with 0.5 ml lysis buffer, after which the associated proteins were eluted with Flag peptides to avoid the cross-reaction from the mouse IgG in western blot analysis. In the case of the co-immunoprecipitation in normal cells, 50 million cells were extracted in the same lysis buffer. The supernatants were incubated with 20 ,ug a-Sir2a antibody or pre-immune antiserum from the same rabbit and 40 ~.l protein A/G plus-agarose (Santa Cruz) for overnight. The agarose beads were washed five times with 0.5 ml of lysis buffer, after which the associated proteins were eluted with BC1000 (20 mM
Tris-HCl, pH 8.0, 0.5 mM EDTA, 20% glycerol, 1mM DTT and 0.5 mM PMSF) containing 1 M
NaCI, 1% NP-40, 0.5% Deoxycholic Acid. The eluted proteins were resolved on 8%
SDS
PAGE and Western blot with a-Sir2a antibody and a-p53 (DO-1) for human cells and a-p53 (421) for mouse cell.

Immunoblot analysis For detection of acetylated forms of p53 in BJ cells and MCF7 cells, equal numbers of cells were plated 24 hrs before the experiment. l.SxlO~ BJ cells or 10' MCF7 cells exponentially growing phase in 150 cm2 dishes were exposed to 6Gy of ionizing radiation (137Cesium gamma source at dose rate of 1 Gy/min). At the appropriate time point, cells were washed and harvested by trypsinization and subsequent neutralization with 10% serum. After washing the cells once in PBS(-/-), cell pellets were frozen on dry ice instantly at the appropriate time point. Once all time points were collected, cell pellets were all lysed on ice at once by adding 0.5% NP40, 150 mM NaCI (in the presence of complete protease inhibitor mix, Roche), for 30 minutes and vortexing. Cell lysates were prepared by centrifugation for 20 minutes at 4°C. Protein content of lysates were measured using Lowry based assay (BioRad DC protein assay).
Protein (300 mg) was resolved on gradient 4-20% criterion Tris-HC gels (Biorad), transferred to nitrocellulose and blocked in 10% skim milk.
The resulting membrane was incubated overnight in 1:400 dilution of Ab-1 (Oncogene Science, peptide based rabbit polyclonal anti K382 p53). This membrane was then washed twice in PBS(-/-) containing 0.05%Tween 20 for 15 minutes. Secondary Goat anti-rabbit antibody conjugated to HRP (Pierce) was used at a concentration of 1:30,000 for lhr in 1% Milk.
Membrane was subsequently washed twice for 30 minutes total time.
The membrane was incubated with Supersignal west femto maximum substrate (Pierce) for 2 minutes and exposed to X-GMAT sensitive film (Kodak) for up to 30 minutes. The membrane was subsequently blotted with a monoclonal p21 WAF1 antibody (F5, Santa Cruz Biotech), p53 antibody (SC6243, polyclonal rabbit, Santa Cruz) (Ab-6, Oncogene Science), anti-hSir2 (polyclonal rabbit). ~3-actin was used (Abcam) for loading control.
96715 is an anti-acetyl H3 Lys9 was a monoclonal antibody (Cell Signaling).
Virus infection and stress response All MEF cells were maintained in DMEM medium supplemented with 10% fetal bovine serum, and the ftVIR-90 cells were maintained in Eagle's minimal essential medium supplemented with 10% fetal bovine serum and non-essential amino acids. The virus infection and selection were essentially as described previously (Ferbeyre et al., 2000). After one-week selection, the cells were either frozen for stock or immediately used for further analysis. About 500,000 MEF cells were plated on a 10-cm dish 24 hr before treatment. The cells were then exposed to etoposide (20 Vim) for 12 hr. After treatment, the cells were washed with PBS and fed with normal medium. Another 36 hrs later, the cells were stained with PI
and analyzed by flow cytometric analysis for apoptotic cells (SubGl) according to DNA content.
In case of the Fas-mediated apoptosis assay, the cells were treated with actinomycin D (0.25 ~g/ml) and Fas antibody (100 ng/ml) as previously described (Di Cristofano et al., 1999). In the case of oxidative stress response, the IMR-90 cells were treated with HZOZ (200 ~.M) for 24 hrs.
Luciferase and apoptosis assays H1299 cells were transfected using the Fugene6 protocols (Roche) with pCMVwtp53 in presence or absence of pCMVp300 and 5 ~,g of p2lP-Luc (containing a 2.4kb fragment of p21 Iinked to luciferase gene) as previously described (Vaziri et al., 1997). All experiments were performed in triplicates.
Apoptosis was measured at approximately 48 hrs post transfection using the annexin V
antigen and propidium iodide exclusion (Clontech laboratories).
Radiation survival curves of BJ cells were performed as described previously (Dhar et al., 2000; Vaziri et al., 1999).
FAGS analysis for apoptosis assay Both adherent and floating cells were combined and washed in cold PBS. For SubGl/FACs analysis, cells were fixed in methanol for 2 hr at -20 °C, rehydrated in PBS for 1 hr at 4 °C, and then reacted with the primary antibody (DO-1) for 30 min at room temperature.
Cells were washed twice in PBS and incubated with a goat anti-mouse FITC-conjugated secondary antibody for 30 min at room temperature. Following incubation, cells were washed in PBS and treated with RNase A (50 ,ug/ml) for 30 min at room temperature.
Propidum iodide (PI:
2.5 ,ug/ml) was added to the cells, and samples were then analyzed in a FACSCalibur (BD). A
region defining high FITC fluorescence was determined, and the cells falling into this region were collected separately. The PI staining was recorded simultaneously in the red channel.
Immunofluorescence Assay Immmtmofluorescence was performed essentially as the standard protocol (Guo et al., 2000). After fixation, cells were exposed to two primary antibodies: p53 monoclonal antibody DO-1 (Santa Cruz) and a-Sir2a for 1 hr at room temperature. The cells were washed three times with 1% BSA plus 0.2% Tween-20 in PBS and then treated with two secondary antibodies [a goat anti-rabbit IgG conjugated to Alexa 568 (Molecular Probes), and anti-mouse IgG-FITC
(Santa-Cruz)]. DAPI was used for counter-staining to identify nuclei. The cells were further washed four times. Images were acquired from a Nikon Eclipse E600 fluorescent microscope (Hamamatsu Photonics).
Detecting acetylation levels of p53 in cells The cells (human lung carcinoma cell lines H460 (wild-type p53) and H1299 (p53-null), human colon carcinoma HCT116 (wild-type p53), mouse embryonal carcinoma cell line F9 (wild-type p53), mouse embryonic fibroblast MEFs or others) were maintained in DMEM
medium supplemented with 10% fetal bovine serum. For DNA damage response, about 1 million cells were plated on a 10-cm dish 24 hr before treatment. The cells were then exposed to etoposide (20~,M) and or other drugs (0.5 ~M of TSA, 5 mM of nicotinamide, and 50 ~,M of LLNL) as indicated for 6 hr.
After treatment, the cells were harvested for Western blot analysis. The rabbit polyclonal antibody specific for p300-mediated acetylated p53 [a-p53(Ac)-C] was raised and purified against the acetylated human p53 C-terminal peptide [p53 (Ac)-C: H-SSSGQSTSRHSSLMF-OH SEQ. ID No:l (5 = acetylated Lysine)] as described before (Luo et al., 2000).
This antibody recognizes the p300-mediated acetylated forms of both human and mouse p53. In the case of cotransfection assays testing for p53 acetylation levels, H1299 cells were transfected with 5 p,g of CMV-p53 plasmid DNA, 5 ~.g of CMV-p300 plasmid DNA, and 10 ~g of pcDNA2-Sir2a plasmid DNA as indicated. 24 hr after the transfection, the cells were lysed in a Flag-lysis buffer (50 mM Tris, 137 mM NaCI, 10 mM NaF, 1mM EDTA, 1% Triton X-and 0.2% Sarkosyl, 1 mM DTT, 10% glycerol, pH 7.8) with fresh proteinase inhibitors, 10 ~M
TSA and SmM nicotinamide (Sigma). The cell extracts were resolved by either 8%
or 4-20%
SDS-PAGE gels (Novex) and analyzed by Western blot with a-p53 (Ac)-C and a-p53 (DO-1).
Deacetylation assay of the p53 C-terminal peptide The human p53 C-terminal peptide (residues 368-386+Cys;
HLKSK(AcK)GQSTSRHK(AcK)LMFKC); (SEQ m NO. 1) di-acetylated at positions 373 and 382 was synthesized and purified with HPLC. Deacetylation assays of tlus peptide by Sir2 and analyses of the reaction products were performed as described previously (Imai et al., 2000).
EXAMPLES
Example 1. Mammalian Sir2a interacts with p53 both i~a vitro and i~z vivo.
Mouse Sir2a interacts with p53. The p53 protein can be divided into three distinct functional domains (Gu and Roeder, 1997): an amino-terminus that contains the transcriptional activation domain (NT: residues 1-73), a central core that contains the sequence-specific DNA-binding domain (M: residues 100-300), and the multifunctional carboxyl-terminus (CT:
residues 300-393). The GST-p53 fusion proteins containing each domain as well as the full-length protein were expressed in bacteria and purified to near homogeneity on gluthathione-agrose beads. As shown in Figure 1A, 35S-labeled ira vitro translated Sir2a strongly bound to immobilized GST-p53 but not to immobilized GST alone (lane 1 vs. 6). Sir2a was tightly bound to the C-terminal domain of p53 (GST-p53CT) (lane 4, Figure 1A), also bound to the central DNA-binding domain (GST-p53M), but showed no binding to the N-terminal domain of p53 (GST-p53NT) (lane 3 vs. 2, Figure 1A).
To test for the interactions between p53 and Sir2a in cells, extracts from transiently-transfected p53-null cells (H1299) were immunoprecipitated with anti-Flag monoclonal antibody (M2). As shown in Figure 1B, p53 was detected in the imtnunoprecipitate obtained from H1299 cells cotransfected with constructs encoding Flag-Sir2a and p53 (lane 2), but not from cells transfected with the p53 construct alone (lane 4). Conversely, Sir2a was detected in the immunoprecipitates obtained from H1299 cells cotransfected with constructs encoding Sir2a and Flag-p53 (lane 6, Figure 1B), but not from cells transfected with the Sir2a construct alone (lane 8, Figure 1B). p53 interacts similarly with human SIRTl (hSIRTl) (Figure 1C, D), the human ortholog of mouse Sir2a (Frye, 1999; 2000), showing that p53 and mammalian Sir2a interact.
Since mouse Sir2a shares a highly conserved region at the C-terminus with human SIRT1 (Figure 1C), but not with any other mammalian Sir2 homologs (Frye, 1999;
2000), a polyclonal antibody against the C-terminus (amino acid 480-737) of mouse Sir2a was developed. Anti-Sir2a antisera (a-Sir2a) was raised in rabbits against the purified GST-Sir2a(4S0-737) fusion protein. As shown in Western blots, this antibody can detect both mouse Sir2a and human SIRTl proteins, but not other human Sir2 homologs (Figure 2A, B).
p53 interaction with Sir2a or hSlRT1 in normal cells without overexpression was studied employing this antibody. Cell extracts from human (H460) and mouse cells (F9), which express wild-type p53 proteins, were immunoprecipitated with a-Sir2a, or with the pre-immune serum.
Western blot analysis revealed that this antibody immunoprecipitated both Sir2a and hSIRTl (lower panels, Figure 2A, 2B). Human and mouse p53 were detected in the respective a-Sir2a immunoprecipitations from cell extracts, but not in the control irmnunoprecipitations with the preimmune serum, showing that p53 interacts with mammalian Sir2a in normal cells. In contrast to abrogation of the Mdm2-p53 interaction by DNA damage as previously reported (Shieh et al., 1997), this interaction was stronger in cells after DNA damage treatment (Figure 2C), which shows mammalian Sir2a is involved in regulating p53 during the DNA-damage response. Thus, p53 interacts with mammalian Sir2a both ira vitro and ih vivo.
Example 2. Deacetylation of p53 by mammalian Sir2a p53 was deacetylated by mammalian Sir2a i~r. vita°o. Mouse Sir2a protein was expressed with the N-terminal Flag epitope in cells and purified to near homogeneity on the M2-agrose affinity column (lane 3, Figure 3A to determine). The GST-p53 fusion protein was acetylated by p300 in the presence of [14C]-acetyl-CoA, and the acetylated p53 protein was purified on the GST affinity column. These highly purified recombinant proteins were used in this assay in order to avoid possible contamination by either inhibitory factors or other types of deacetylases.
As shown in Figure 3B,14C-labeled acetylated p53 was efficiently deacetylated by purified Sir2a (lane 3), but not by a control eluate (lane 4). NAD is required for Sir2a-mediated deacetylation of p53 (lane 2 vs. 3, Figure 3B). Further, the deacetylase inhibitor TSA, which significantly abrogates HDAC1-mediated deacetylase activity on p53 (Luo et al., 2000), had no apparent effect on Sir2a-mediated p53 deacetylation (lane 5, Figure 3B). These results show that Sir2a can strongly deacetylate p53 ih vitro, and that this activity depends on NAD.
A role for mammalian Sir2a in deacetylating p53 in cells was established using acetylated p53-specific antibody to monitor the steady-state levels of acetylated p53 ina vivo (Luo et ezl., 2000). As shown in Figure 3C, a high level of acetylated p53 was detected in the cells cotransfected with p300 and p53 (lane 1). However, p53 acetylation levels were significantly abolished by expression of either Sir2a or hSIRTl (lanes 2, 4). In contrast, a Sir2a mutant (Sir2aH355A) containing a point mutation at the highly conserved core domain causing defective histone deacetylase activity ifz vitro had almost no effect (lane 3 vs. 2, Figure 3C).
Furthermore, neither SILtTS, another human Sir2 homolog, nor poly (ADP-ribose) polymerise (PARP), whose activity is also NAD-dependent (reviewed in Vaziri et al., 1997), had any significant effect on p53 acetylation (lanes 5, 6, Figure 3C). h1 addition, in contrast to HDAC-mediated deacetylation of p53 (Luo et al., 2000) Sir2a still strongly deacetylated p53 in the presence of TSA (lane 4 vs. 3, Fig. 3D) even though the steady state level of acetylated p53 was elevated when the cells were treated with TSA (lane 3 vs. 1, Fig. 3D). Thus, mammalian Sir2a has robust TSA-independent p53 deacetylation activity.
Example 3. Inhibition of Sir2a-mediated p53 deacetylation by nicotinamide Sir2a-mediated deacetylase activity of p53 can be inhibited. Deacetylation of acetyl-lysine by Sir2a is tightly coupled to NAD hydrolysis, producing nicotinamide and a novel acetyl-ADP-ribose compound (1-O-acetyl-ADPribose) (Landry et al., 2000b;
Tanner et al., 2000; Tinny and Moazed, 2001). The formation of an enzyme-ADP-ribose intermediate through NAD hydrolysis may be critical for this chemical reaction (Landry et al., 2000b). Since nicotinamide is the first product from hydrolysis of the pyridinium-N-glycosidic bond of NAD, it may function as an inhibitor for its deacetylase activity (Landry et al., 2000b). Nicotinamide is able to inhibit the deacetylase activity of Sir2a on acetylated p53 ih vitro.
Similar reactions as described above (Figure 3B), were set up by incubating labeled p53 substrate, recombinant Sir2a and NAD (50 ~,M) alone, or in combination with nicotinamide (SmM). As shown in Figure 4A, 14C-labeled acetylated p53 was efficiently deacetylated by Sir2a (lane 2) however, the deacetylation activity was completely inhibited in the presence of nicotinamide (lane 3 vs. lane 2 Figure 4A). As a negative control, 3-AB (3-aminobenzamide), a strong inhibitor of PARP which is involved in another type of NAD-dependent protein modification (Vaziri et al., 1997), showed no significant effect on Sir2a mediated deacetylation (lane 4 vs. 3, Figure 4A).
To further investigate the role of mammalian Sir2et-mediated regulation in vivo, the effect of Sir2a expression on p53 acetylation levels during the DNA damage response was determined. Mouse embryonic fibroblast (MEF) cells, which express the wild type of p53, were infected with either a pBabe-puro retrovirus empty vector or a pBabe-puro retrovirus containing Sir2a, and cultured for a week under pharmacological selection. The protein levels of p53 activation in response to DNA damage in these cells was determined by Western blot analysis.
Similar protein levels of p53 activation were induced in the pBabe vector infected cells and pBabe-Sir2a infected cells after etoposide treatment for 6 hrs (lanes 3, 4 vs.
lanes 1, 2, lower panel, Figure 4B).
Tn the mock-infected cells, the acetylation level of p53 was significantly enhanced by DNA damage (lane 2 vs. lane 1, Upper panel, Figure 4B). However, DNA damage treatment failed to stimulate the p53 acetylation in the pBabe-Sir2a infected cells even in the presence of TSA (lane 4 vs. lane 2, Upper panel, Figure 4B), showing that Sir2tx expression results in deacetylation of endogenous p53. This Sir2a-mediated effect was completely abrogated by nicotinamide treatment (lane 8 vs. lane 6, Figure 4B). Thus, Sir2a mediated deacetylation of p53 can be inhibited by nicotinamide both ifa vitro and ifa vivo.
Example 4. Maximum induction of p53 acetylation levels in normal cells requires inhibition of endogenous Sir2a activity Endogenous Sir2a in the regulation of p53 acetylation levels in nornlal cells during the DNA damage response was determined.
As shown in Figure 4C, after the wild-type p53 containing human lung carcinoma cells (H460) were treated by etoposide, acetylation of p53 was induced (lane 2 vs.
lane 1). No significant p53 acetylation was detected in the cells treated with a proteasorne inhibitor LLNL
(lane 6, Figure 4C), indicating that the observed stimulation of p53 acetylation is induced by DNA damage, not through p53 stabilization.
p53 can be deacetylated by a PIDlMTA2lHDACI complex, whose activity is completely abrogated in the presence of TSA (Luo et al., 2000). The mild enhancement of the acetylation level of p53 by TSA during DNA damage response may be due mainly to its inhibitory effect on endogenous HDACl-mediated deacetylase activity (lane 3 vs. lane 2, Figure 4C).
A super induction of p53 acetylation was showed when the cells were treated with both TSA and nicotinamide (lane 4 vs. lane 3, Figure 4C). In contrast, 3-AB treatment had no effect on the level of p53 acetylation (lane 5 vs. lane 3, Figure 4C), indicating that PARP-mediated poly-ADP
ribosylation has no effect on p53 acetylation. Similar results were also observed in other cell types including either mouse cells (MEFs, F9) or human cells (BL2, HCT116).
Thus, maximum induction of p53 acetylation requires inhibitors for both types of deacetylases (HDAC1 and Sir2a), and endogenous Sir2a plays a major role in the regulation of the p53 acetylation levels induced by DNA damage.
Example 5. Repression of p53-mediated functions by mammalian Sir2a requires its deacetylase activity The functional consequence of mammalian Sir2a-mediated deacetylation of p53 was determined by testing its effect on p53-mediated transcriptional activation. A
mammalian p53 expression vector (CMV-p53), alone or in combination with different amounts of mouse Sir2a expressing vector (CMV-Sir2a), was cotransfected into MEF (p53-~-) cells along with a reporter construct containing synthetic p53 binding sites placed upstream of the luciferase gene (PG13-Luc).
As shown in Figure SA, Sir2a strongly repressed p53-mediated transactivation in a dose-dependent manner (up to 21 fold), but had no significant effect on the transcriptional activity of the control reporter construct (TIC-Luc) (Figure SB), which has no p53 binding site at the promoter region. Also, expression of human SIRT1 showed a similar effect on the p53 target promoter (Figure SC). Neither the Sir2aH355A mutant or SIRTS, both of which are defective in p53 deacetylation (Figure 3C), had any effect on the p53-mediated transactivation (Figure SC, D). Thus, mammalian Sir2a specifically represses p53-dependent transactivation, and that this repression requires its deacetylase activity.
The modulation of Sir2 on p53-dependent apoptosis was determined. p53 null cells (H1299) were transfected with p53 alone or cotransfected with p53 and Sir2a.
The transfected cells were fixed, stained for p53, and analyzed for apoptotic cells (SubGl) (Luo et al., 2000). As indicated in Figure 6A, overexpression of p53 alone induced significant apoptosis (32.3%
SubGl). However, co-transfection of p53 with Sir2a significantly reduced the level of apoptosis (16.4% SubGl), while the mutant Sir2aH355A was impaired in this effect (29.5%
SubGl) (Figure 6A, B). Thus, mammalian Sir2a is involved in the regulation of both p53 mediated transcriptional activation and p53-dependent apoptosis, and deacetylase activity is required for these Sir2a-mediated effects on p53.

Example 6. The role of mammalian Sir2a in stress induced apoptotic response Mammalian Sir2a can deacetylate p53 both i~z vitro and ifa vivo (Figure 3).
Sir2a can bloclc the induction of endogenous p53 acetylation levels by DNA damage (Figure 4B, 4C). To elucidate the physiological significance for this Sir2a mediated regulation, the effect on DNA
damage-induced apoptotic response was determined.
MEF (p53+~+) cells as described above (Figure 4B), were infected with either a pBabe-puro retrovirus empty vector or a pBabe-puro retrovirus containing Sir2cc.
After the DNA
damage treatment by etoposide, the cells were stained with PI and analyzed by flow cytometric analysis for apoptotic cells (SubGl) according to DNA content. As shown in Figure 7A, the cells mock infected with the pBabe-vector, were susceptible to etoposide-induced cell death, with about 48% of the cells apoptotic. after exposure to 20 ~,M of etoposide (3 vs. 1, Figure 7A).
In contrast, the pBabe-Sir2a infected MEF (p53+~+) cells were more resistant to apoptosis induced by the same dose of etoposide, with only 16.4% apoptotic cells (4 vs.
3, Figure 7A).
Since no significant apoptosis was detected in MEF (p53-~-) cells by the same treatment, the induced apoptosis observed in MEF (p53+~*) cells is totally p53-dependent.
Thus, Sir2a significantly inhibits p53-dependent apoptosis in response to DNA damage.
The role of mammalian Sir2a in the oxidative stress response was determined.
Recent studies have indicated that oxidative stress-induced cell death is p53-dependent (Yin et al., 1998;
Migliaccio et al., 1999). Early-passage normal human fibroblast (NHF) IMR-90 cells were employed for this study since p53-dependent apoptosis can be induced by hydrogen peroxide treatment in these cells (Chen et al., 2000).
nVIR-90 cells were infected with either a pBabe-puro retrovirus empty vector or a pBabe-puro retrovirus containing Sir2a, and cultured for a week under pharmacological selection. By immunofluorescence staining, p53, in these infected cells, was induced significantly after hydrogen peroxide treatment, along with Sir2a localized in the nuclei detected by immunostaining with specific antibodies (Figure 7C). Sir2a expression significantly promotes cell survival under oxidative stress. As indicated in Figure 7D, the cells mock infected with the pBabe-vector, were susceptible to HZOZ-induced cell death, with more than 80%
of the cells being killed after 24 hr exposure to 200 ~,M Ha02 (II vs. I). In contrast, the pBabe-Sir2a infected cells were much more resistant to death by the same dose of H202, with about 70% of the cells surviving after 24 hr of H202 treatment (IV vs. III, Figure 7D).
Mammalian Sir2a promotes cell survival under stress by inhibiting p53-dependent apoptosis.
Example 7. Mammalian Sir2a has no effect on p53-independent cell death induced by anti-Fas The specificity of mammalian Sir2a-mediated protection of cells from apoptosis was examined by determining whether Sir2a has any effect of p53-independent, Fas-mediated apoptosis. The MEF (p53-~-) cells were first infected with either a pBabe-puro retrovirus empty vector or a pBabe-puro retrovirus containing Sir2a, then cultured for a week under pharmacological selection. After the treatment by anti-Fas (100 ng/ml) for 24 hrs, the cells were harvested and further analyzed for apoptotic cells (SubGl).
Cells mock infected with the pBabe vector, were susceptible to anti-Fas induced cell death, with about 31.7% of the cells becoming apoptotic. However, in contrast to the strong protection of p53-dependent apoptosis by Sir2a during DNA damage response in the MEF
(p53+~+) cells (Figure 7A, B), Sir2cx expression had no significant effect on Fas-mediated apoptosis in the MEF (p53-~-) cells. Thus, mammalian Sir2a regulates p53-mediated apoptosis.
Mammalian Sir2a has no effect on the Fas mediated apoptosis. (A) Both mock infected cells and pBabe-Sir2a infected MEF p53(-/-) cells were either not treated (1 and 2) or treated with 100 ng/ml Fas antibody in presence of actinomycin D (0.25 ~,g/ml) (3 and 4). The cells were analyzed for apoptotic cells (subGl) according to DNA content (PI
staining). The representative results depict the average of three experiments with standard deviations indicated.
Example 8. Physical interaction of hSir2 with p53 p53 protein is acetylated in response to DNA damage and the acetylation contributed to the functional activation of p53 as a transcription factor (Abraham et al., 2000; Sakaguchi et al., 1998). Sir2 is a deacetylase of p53, thereby modulating functioning of p53 as a transcription factor:
In order to study the functional interaction between p53 and hSir2, a full length human hSir2SIRTl cDNA clone (obtained from the IMAGE consortium (Frye, 1999)) was introduced into a pBabe-based retroviral expression vector which also carries puromycin resistance gene as a selectable marker. The resulting construct was termed pYESirwt. A retroviral construct bearing a derived, mutant allele of Sir2 and ternied pYESirHY was constructed and used in parallel as control. This mutant allele encodes an amino acid substitution at residue 363, at which site the normally present histidine is replaced by tyrosine. This H to Y
substitution results in an alteration of the highly conserved catalytic site of the hSir2 protein and subsequent neutralization of its deacetylase activity. These vector constructs were used to transduce the hSIR2SIRT1 gene both by transfection and retroviral infection.
A polyclonal rabbit antibody that specifically recognizes the C-terminal portion of hSir2 was developed and its specificity validated by immunoprecipitation and Western blotting (Figure 8A). Both the endogenous and the ectopically expressed hSir2 proteins were detected as protein species of 120 Kilodalton (Kd) rather than as 80Kd polypeptide predicted from the known primary sequence of hSIR2SIRT1(Figure 8A). Localization of hSir2 protein by immunofluorescence using the hSir2 antibody showed a punctate nuclear staining pattern (Figure 8B).
The physical interactions between hSir2 and p53 were evaluated by co-transfecting the pYESir2wt plasmid and a vector expressing wt p53 under the control of the cytomegalovirus promoter (pCMV-wtp53) transiently into H1299 human non-small cell lung carcinoma cells (Brower et al., 1986) which have a homozygous deletion of the p53 gene and produce no p53 mRNA or protein (Mitsudomi et al., 1992). Cell lysates were subsequently mixed with the rabbit anti-hSir2 antibody and resulting immune complexes were collected by protein G
and analyzed by SDS-PAGE electrophoresis and immunoblotting. The immunoblot was probed with a sheep anti-p53 antibody (Figure 8C) and reprobed it subsequently with an anti-hSir2 antibody (top panel) to verify presence of hSir2 in the complex. As indicated in Figure 8C, immunoprecipitation of hSir2 resulted in co-precipitation of p53.
hl the reciprocal experiment, lysates of BJT cells, human fibroblasts into which the telomerase gene has been introduced, were examined. In addition, these cells express either the wild type hSir2 vector or the hSir2HY mutant. Two cell populations were created by infection of mass cultures of BJT cells with the respective vectors and subsequent selection in puromycin.
The anti-p53 antibody was employed to immunoprecipitate complexes and subsequently probe the resulting immunoblot with either polyclonal anti-p53 antibodies or an anti-hSir2 antibody.
These immunoblots demonstrated a physical interaction between hSir2 and p53 proteins (Figure 8D). Formation of these complexes was unaffected by the H to Y mutation introduced into the hSir2 catalytic site (Figure 8D). Furthermore, radiation used to increase the levels of p53 protein in BJ cells had no effect on the levels of p53:hSir2 complexes. Comparison of the immunoprecipitated p53 to total input p53 resulted in an estimate of approximately 1 % of the cells complement of p53 protein was present in physical complexes with hSir2.
Example 9. Deacetylation of p53 by hSir2 i~a vits~o Since hSir2 forms physical complexes with p53, the ability of Sir2 to deacetylate human p53 in vitro was evaluated. Since adequate quantities of bacterially produced hSir2 were not available, bacterially expressed mouse SIR2 (mSir2a) enzyme was used in in vitYO assays (Imai et al., 2000). A 20 residue-long oligopeptide that contains the sequence corresponding to residues 368-386+Cys of the human p53 protein was used as a substrate in these reactions.
Lysine residues corresponding to residues 373 and 382 of the p53 protein were synthesized in acetylated form in this oligopeptide substrate. These two residues of p53 are known.to be acetylated by p300 (Gu and Roeder, 1997) following y or UV irradiation (Liu et al., 1999;
Sakaguchi et al., 1998) with acetylation of lysine residue 382 being favored in response to ionizing radiation in vivo (Abraham et al., 2000). This p53 oligopeptide serves as an excellent surrogate p53 substrate in vitro for acetylation studies (Gu and Roeder, 1997).
The deacetylase activity of hSir2 utilizes NAD as a co-factor (Imai et al., 2000; Moazed, 2001; Smith et al., 2000; Tanner et al., 2000; Tanny et al., 1999). Iii the absence of added NAD, incubation of mSir2 with p53 oligopeptide gave rise to a single prominent peak (peak 1) and a small, minor peak (peak 2) upon high pressure liquid chromatography (HPLC), corresponding to the monomeric and dimeric forms of the peptide, respectively (Figure 9A).
However, incubation in the presence of 1mM NAD produced a singly deacetylated species as the major product (peak 3, Figure 9B). Edman sequencing of this singly deacetylated species revealed that mSir2 preferentially deacetylated the residue corresponding to Lys 382 of p53 (Figure 9, C-F), having relatively weak effect on Lys 373. Thus, the acetylated p53 peptide acted as a substrate for hSir2 and indicated that the de-acetylation of p53 at Lys 382 by mammalian Sir2 is specific and not the result of an indiscriminate deacetylase function.
Example 10. Deacetylation of p53 by hSir2 i~a vivo The ability of hSir2 to deacetylate intact p53 protein in vivo was evaluated.
To produce acetylated p53 in vivo, the p53 expression plasmid was co-transfected with one expressing p300.
This protocol leads to acetylation of p53 in the absence of exposure to DNA-damaging agents (Luo et al., 2000). The ability of hSir2 to deacetylate the p53 protein at its K382 residue in H1299 cells that lack endogenous p53 gene was determined. The levels of acetylation of p53 at Lys382 were monitored by using a rabbit polyclonal antibody, termed Ab-1, which had been raised against the acetylated K382 of p53 protein. The specificity of the Ab-1 antibody has been demonstrated (Sakaguchi et al., 1998).
Co-transfection of plasmids expressing wild-type p53 and p300 into H1299 cells showed that p53 protein is readily acetylated at K382, as detected by probing the immunoblot with the Ab-1 antibody (Figure 10A, lane 3). Recognition of this acetylated form of p53 by the Ab-1 antibody was specific, since a mutant p53 protein that was expressed in a parallel culture of H1299 cells and carries an arginine rather than a lysine at residue 382 was not recognized by the Ab-1 antibody, despite ectopic expression of the p300 acetylase. (Figure 10A, lane 6).
Co-transfection of the hSir2-expression plasmid with the p53- and p300-expressing plasmids substantially decreased the acetylated p53 that could be detected by the Ab-1 antibody.
(Figure 10A, Iane 5). The residual level of acetylated p53 could be further reduced by increasing the amount of co-transfected hSir2 expression plasmid. Thus, hSir2 can deacetylate p53 protein at the Lys382 residue ira vivo.
The hSir2HY vector, which expresses the mutant-catalytically inactive hSir2, was introduced into these H1299 cells. The mouse equivalent of this hSir2HY mutant lacks 95% of its deacetylase activity (Imai et al., 2000). The hSir2HY mutant failed to deacetylate wt p53 efficiently, indicating that the catalytic activity of the introduced wild type hSir2 gene product was required for specific deacetylation of p53 Lys 382 (Figure 10A, lane 9).
The lysine 320 residue of p53 is also acetylated by PCAF in response to DNA
damage (Sakaguchi et al., 1998). Whether the state of acetylation of residue 320 affected the ability of hSir2 to deacetylate residue 382 was determined. A mutant p53 allele that specifies a lysine-to-arginine substitution at residue 320 was expressed. This amino acid substitution did not affect the ability of hSir2 to deacetylate the K382 residua in H1299 cells, indicating that the action of hSir2 on the acetylated K382 residue is independent of the state of acetylation of the K320 residue (Figure 10A, lanes 7, 8).

As a measure of the substrate specificity of hSir2, the effects of hSir2 on histone acetylation, specifically the acetylated residue lysine 9 of histone H3, were determined using cell nuclei from the above experiments. H3 Lys9 acetylation was monitored through the use of the 9671 S monoclonal antibody. The 9671 S antibody specifically recognizes histone H3 that is acetylated at this position.
Neither wildtype hSir2 nor the catalytically inactive hSir2HY altered the acetylation of histone H3 at this position (Figure 10A, bottom). Thus, de-acetylation of p53 Lys382 ih. vivo reflects a defined substrate specificity of hSir2 and not a non-specific consequence of its over-expression.
Example 11. liSir2 and p53 acetylation in primary and tumor cell lines Acetylation of lysine residue 382 of p53 accompanies and mediates the functional activation of p53 as a transcription factor following exposure of a cell to ionizing radiation (Sakaguchi et al., 1998). To determine whether hSir2 could antagonize and reverse this activation of p53, by its deacetylase function, either wildtype hSir2 or the mutant form specified by the hSir2HY vector was expressed in BJT human fibroblast cells. Ectopic expression of the telomerase enzyme in these BJT cells, undertaken to extend their lifespan, had no effect on either their activation of p53 protein or their responses to DNA damage (Vaziri et al., 1999).
In order to facilitate detection of ifa vivo acetylated p53 protein, BJT cells were expressed to 6Gy of ionizing radiation in the presence of low trichostatin A (TSA) concentrations. While not directly inhibiting hSir2 catalytic activity (Imai et al., 2000), TSA
appears to increase the stability of acetylated p53 protein (Sakaguchi et czl., 1998), perhaps by inhibiting nori-hSir2 deacetylases that also recognize the acetylated p53 K382 residue. The resulting immunoblot was probed with the polyclonal rabbit antiserum (Ab-1) which specifically recognizes the acetylated K382 form of p53.
Following 6 Gy of ionizing radiation, a 1.5-2 fold increase in the level of acetylated p53 protein was observed, as indicated by the levels of p53 protein recognized by the Ab-1 antiserum (Figure l OB). A four-fold increase in hSir2 levels, achieved through ectopic expression of hSir2, resulted in the reversal of the radiation-induced increase in acetylated K382 p53 protein (Figure l OB). In contrast, expression of the catalytically inactive hSirHY protein at comparable levels increased the radiation-induced levels of p53 acetylated at residue K382 (Figure l OB) suggesting that the hSir2HY mutant may act in a dominant negative fashion in BJT cells. A
re-probing of this immunoblot with a polyclonal anti-p53 antibody showed normal stabilization of p53 in control cells in response to DNA damage and at most, slightly reduced levels of stabilization in the presence of ectopically expressed wild type hSir2 (Figure 10B). Hence, while hSir2 is able to reverse the radiation-induced acetylation of p53 in these cells, it has only minimal effects on the metabolic stabilization of p53 induced by exposure to radiation.
A similar phenomenon was observed in MCF-7 human breast carcinoma line cells, which have retained an apparently intact p53-dependent checkpoint in response to ionizing radiation.
Irradiation of these cells led to a three-fold increase in acetylated p53 levels, while a four-fold ectopic expression of wild type hSir2 in irradiated MCF-7 cells led to deacetylation of p53 protein (Figure l OC). In contrast to BJT cells, no significant change in the stability of total p53 protein was observed. However, MCF-7 cells expressing the hSirHY mutant showed a level of radiation-induced acetylation that was comparable to control irradiated cells (Figure Z OC). Thus, hSir2 is able to reverse the radiation-induced acetylation in both BJT and MCF-7 cells, suggesting that hSir2 acts as an antagonist of p53 function ih vivo.
The differences observed in deacetylation activities of hSir2HY in MCF7 and BJT cells may reflect the ability of hSir2HY to act as a dominant-negative allele in BJT
cells. BJT cells do express significantly lower levels of endogenous hSir2 when compared with MCF7 cells. These lower levels of hSir2 in BJT cells may enable hSir2HY to form inhibitory complexes with endogenous wild type hSir2 or with other proteins required for its function.
In tlus context, evidence in yeast suggests that H363Y mutant does indeed act as a potent dominant-negative (Tanny et al., 1999).
Example 12. Effects of hSir2 on the transcriptional activity of p53 protein The effects of hSir2 on the transcriptional activity of p53 were determined by co-transfecting H1299 cells transiently with a p53 expression plasmid and a reporter construct in which the promoter of the p21WAF1 gene (el-Deiry et al., 1993), a known target of transcriptional activity by p53, is able t~ drive expression of a luciferase reporter gene (Vaziri et al., 1997). As indicated in Figure 11A, luciferase activity increased in response to increasing amount of co-transfected wtp53 expression vector. Conversely, the transcriptional activity of p53 protein was suppressed by co-expression of wild type hSir2 in a dose-dependent fashion.

The catalytically inactive hSir2HY mutant had no effect on p53 transcriptional activity (Figure 1 1A). The specificity of hSir2 in affecting promoter activity was determined using a constitutively active SV40 promoter liuced to the luciferase gene. Expression of this control construct was not affected by increasing amounts of hSir2 expression vector at any level (Figure 11B).
The above observations were confirmed in a more physiologic context using a subline of MCF-7L cells. The subline of MCF-7 cells was stably transfected with a p21WAF1 promoter-reporter construct. In addition, these cells were infected stably with retroviral vector constructs expressing either the wild type hSir2 or the mutant hSir2HY. These cells were expressed to 6 Gy of ionizing radiation and subsequently measured total p53 and p21WAF1 protein levels (Figure 11 C).
p53 protein levels increased normally in all cell populations in response to irradiation of these cells. However, the levels of p21 WAF1 protein were reduced in cells expressing wild type hSir2 (Figure 11C). Moreover, MCF-7L cells expressing the mutant hSir2HY
protein had a higher level of p21 WAF 1 when compared with the irradiated controls and with the wild type hSir2-overexpressing cells (Figure 11 C) showing that the hSir2HY mutant may act in a dominant-negative fashion in these cells. Thus, hSir2 can antagonize the transcriptional activities of p53 that enable it to exert cytostatic effects via transcriptional activation of the p21WAF1 gene.
Example 13. Inhibition of p53-dependent apoptosis by hSir2 hSir2 can antagonize the ability of p53 to act in a cytostatic fashion through induction of p21 WAF1 synthesis. The ability of hSir2 to blunt the pro-apoptotic functions of p53 was determined. Restoration of wild-type p53 function in H1299 cells, achieved via introduction of a wt p53-expressing vector, induces apoptosis, as indicated by the expression of the cell surface annexin V antigen (Figure 12A). Co-transfection of a p300 vector with the p53 gene increased this p53-dependent apoptosis (Figure 12A). This apoptotic response was abolished in a dose-dependent manner in cells co-transfected with increasing amounts of the wt hSir2 expression plasmid (Figure 12A). Hence, hSir2 antagonizes both the cytostatic effects of p53 (as mediated byp21WAF1) and its pro-apoptotic effects.

Example 14. Effects of mutant hSir2HY on radiosensitivity of human fibroblasts In contrast to the behavior of many other murine or human cell lines, human fibroblasts become relatively radioresistant upon inactivation of p53 function (Tsang et al., 1995). This behavior suggested an additional test of the ability of hSir2 to antagonize p53 function, which depended on measuring the long-term survival of human BJT fibroblasts cells following exposure to various doses of low-level ionizing radiation.
Ectopic expression of wild type hSir2 in these cells led to a greater long-term.survival (Figure 12B, triangles), while expression of the mutant hSir2HY in BJT cells led to a radiosensitive phenotype (Figure 12B, diamonds) consistent with hSir2HY
constructs acting in a dominant-negative fashion in BJT cells. A positive control cell line derived from an individual with ataxia telangiecstasia (AT) was highly radiosensitive (Figure 12B, circles). The central role of p53 in these various responses was also shown in the behavior of a subline of BJT fibroblasts that express a dominant-negative form of p53 and also have acquired a measure of radioresistance (Figure 12B, open square). Thus, wt hSir2 antagonizes p53 activity while the hSir2HY mutant potentiates its activity.
REFERENCES
Appella E. and Anderson C.W. (2000) Signaling to p53: brealcing the posttranslational modification code. Pathol. Biol., 48:227-245.
Avantaggiati M.L., Ogryzko V., Gardner K., Giordano A., Levine A.S. and Kelly K.
(1997) Recruitment of p300/CBP in p53-dependent signal pathways. Cell, 89:1175-1184.
Bernstein B.E., Tong J.K. and Schreiber S.L. (2000) Genomewide studies of histone deacetylase function in yeast. Proc. Natl. Acad. Sci. USA, 97:13708-13713.
Butler L.M., Agus D.B., Scher H.L, Higgins B., Rose A., Cordon-Cardo C., Thaler H.T., Rifkind R.A., Marks P.A, and Richon V.M. (2000) Suberoylanilide hydroxamic acid, an inhibitor of histone deacetylase suppresses the growth of prostate cancer cells in vitro and in vivo. Cancer Res., 60:5165-5170.
7s Campisi J. (2000) Aging, chromatin, and food restriction-coimecting the dots.
Science, 289:2062-2063.
Chao C., Saito S., Kang J., Anderson C.W., Appella E. and Xu Y. (2000) p53 transcriptional activity is essential fox p53-dependent apoptosis following DNA damage. EMBO
J., 19:4967-4975.
Chen Q.M., Liu J. and Merrett J.B. (2000) Apoptosis or senescence-like growth arrest:
influence of cell-cycle position, p53, p21 and bax in H2O2 response of normal human fibroblasts. Biochem. J., 347:543-551.
Chresta C.M. and Hickman J.A. (1996) Oddball p53 in testicular tumors. Nat.
Med., 2:745-746.
Di Cristofano A., Kotsi P., Peng Y.F., Cordon-Cardo C., Elkon K.B. and Pandolfi P.P.
(1999) Impaired Fas response and autoimmunity in Pten+/- mice. Science, 285:2122-2125.
Ferbeyre G., de Stanchina E., Querido E., Baptiste N., Prives C. and Lowe S.W.
(2000) PML is induced by oncogenic ras and promotes premature senescence. Genes Dev., 14:2015-2027.
Frye R.A. (1999) Characterization of five human cDNAs with homology to the yeast SIR2 gene: Sir2-like proteins (sirtuins) metabolize NAD and may have protein ADP-.
ribosyltransferase activity. Biochem. Biophys. Res. Commun., 260:273-279.
Frye R.A. (2000) Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins. Biochem. Biophys. Res. Commun., 273:793-798.
Gu W. and Roeder R.G. (1997) Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell, 90:595-606.

Gu W., Shi X.L. and Roeder R.G. (1997) Synergistic activation of transcription by CBP
and p53. Nature, 387:819-823.
Gu W., Malik S., Ito M., Yuan C.X., Fondell J.D., Zhang X., Martinez E., Qin J. and Roeder R.G. (1999) A novel human SRB/MED-containing cofactor complex, SMCC, involved in transcription regulation. Mol. Cell, 3:97-108.
Guarente L. (2000) Sir2 links chromatin silencing, metabolism, and aging.
Genes Dev., 14:1021-1026.
Guo A., Salomoni P., Luo J., Shih A., Zhong S., Gu W. and Pandolfi P.P. (2000) The function of PML in p53-dependent apoptosis. Nat. Cell Biol., 2:730-736.
Imai S., Armstrong C.M., Kaeberlein M. and Guarente L. (2000) Transcriptianal silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase.
Nature, 403:795-800.
Ito A., Lai C., Zhao X., Saito S., Hamilton M., Appella E. and Yao T. (2001) p300/CBP-mediated p53 acetylation is commonly induced by p53-activating agents and inhibited by MDM2. EMBO J., 20:1331-1340.
Jimenez G.S., Nister M., Stommel J.M., Beeche M., Barcarse E.A., Zhang X.Q., O'Gorman S. and Wahl G.M. (2000) A transactivation-deficient mouse model provides insights into Trp53 regulation and function. Nat. Genet., 26:37-43.
Kouzarides T. (2000) Acetylation: a regulatory modification to rival phosphorylation?
EMBO J., 19:1176-1179.
Landry J., Slama J.T. and Sternglanz R. (2000) Role of NAD(+) in the deacetylase activity of the SIR2-like proteins. Biochem. Biophys. Res. Commun., 278:685-690.

Landry J., Sutton A., Tafrov S.T., Heller R.C., Stebbins J., Pillus L. and Sternglanz R.
(2000) The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases.
Proc. Natl. Acad. Sci. USA, 97:5807-5811.
Levine A.J. (1997) p53, the cellular gatekeeper for growth and division. Cell, 88:323-331.
LiII N.L., Grossman S.R., Ginsberg D., DeCaprio J. and Livingston D.M. (1997) Binding and modulation of p53 by p300/CBP coactivators. Nature, 387:823-827.
Lin S.J., Defossez P.A. and Guarente L. (2000) Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science, 289:2126-2128.
Luo J., Su F., Chen D., Shiloh A. and Gu W. (2000) Deacetylation of p53 modulates its effect on cell growth and apoptosis. Nature, 408:377-381.
Lutzker S.G. and Levine A.J. (1996) A functionally inactive p53 protein in teratocarcinoma cells is activated by either DNA damage or cellular differentiation. Nat. Med., 2:804-810.
Marks P.A., Rifkind R.A., Richon V.M. and Breslow R. (2001) hlhibitors of histone deacetylase are potentially effective anticancer agents. Clin. Cancer Res., 7:759-760.
Maya R., Balass M., Kim S.T., Shkedy D., Leal J.F., Shifman O., Moas M., Buschmann T., Ronai Z. and Shiloh Y. et al. (2001) ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage. Genes Dev., 15:1067-1077.
Migliaccio E., Giorgio M., Mele S., Pelicci G., Reboldi P., Pandolfi P.P., Lanfrancone L.
and Pelicci P.G. (1999) The p66shc adaptor protein controls oxidative stress response and life span in mammals. Nature, 402:309-313.

Nakamura S., Roth J.A. and Mukhopadhyay T. (2000) Multiple lysine mutations in the C-terminal domain of p53 interfere with MDM2-dependent protein degradation and ubiquitination. Mol. Cell. Biol., 20:9391-9398.
Nakano K. and Vousden K. (2001) PUMA, a novel proapoptotic gene, is induced by p53.
Mol. Cell, 7:683-694.
Pearson M., Carbone R., Sebastiani C., Cioce M., Fagioli M., Saito S., Higashimoto Y., Appella E., Minucci S., Pandolfi P.P. and Pelicci P.G. (2000) PML regulates p53 acetylation and premature senescence induced by oncogenic Ras. Nature, 406:207-210.
Prives C. and Hall P.A. (1999) The p53 pathway. Pathol. J., 187:112-126.
Rodriguez M.S., Desterro J.M., Lain S., Lane D.P. and Hay R.T. (2000) Multiple C-terminal lysine residues target p53 for ubiquitin-proteasome-mediated degradation. Mol. Cell.
Biol., 20:8458-8467.
Shieh S.Y., Ikeda M., Taya Y. and Prives C. (1997) DNA damage-induced phosphorylation of p53 alleviates inhibition MDM2. Cell, 91:325-334.
Shore D. (2000) The Sir2 protein family: A novel deacetylase for gene silencing and more. Proc. Natl. Acad. Sci. USA, 97:14030-14032.
Smith J.S., Brachmann C.B., Celic L, Kenna M.A., Muhammad S., Starai V.J., Avalos J.L., Escalante-Semerena J.C., Grubmeyer C., Wolberger C. and Boeke J.D.
(2000) A
phylogenetically conserved NAD-dependent protein deacetylase activity in the Sir2 protein family. Proc. Natl. Acad. Sci. USA, 97:6658-6663.
Sterner D.E. and Berger S.L. (2000) Acetylation of histones and transcription-related factors. Microbiol. Mol. Biol., 64:435-459.

Tanner K.G., Landry J., Sternglanz R. and Denu J.M. (2000) Silent information regulator 2 family of NAD-dependent histone/protein deacetylases generates a unique product, 1-O-acetyl-ADP-ribose. Proc. Natl. Acid. Sci. USA, 97:14178-14182.
Tinny J.C. and Moazed D. (2001) Coupling of histone deacetylation to NAD
breakdown by the yeast silencing protein Sir2: Evidence for acetyl transfer from substrate to am NAD
breakdown product. Proc. Natl. Acid. Sci. USA, 98:415-420.
Tissenbaum H.A. and Guarente L. (2001) Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. Nature, 410:227-230.
Vaziri H., West M.D., Allsopp R.C., Davison T.S., Wu Y.S., Arrowsmith C.H., Poirier G.G. and Benchimol S. (1997) ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly(ADP-ribose) polymerise. EMBO J., 16:6018-6033.
Vaziri H., Dessain S.K., Ng-Eaton E., Tinai S.L, Frye R.A., Pandita T.K., Guarente L. and Weinberg R.A. (2001) hSIR2S1RT1 functions as an NAD-dependent p53 deacetylase.
Cell, 107:149-159.
Vogelstein B., Lane D. and Levine A.J. (2000) Surfing the p53 network. Nature, 408:307-310.
Yin Y., Terauchi Y., Solomon G.G., Aizawa S., Rangarajan P.N., Yazaki Y., Kadowaki T. and Barrett J.C. (1998) Involvement of p85 in p53-dependent apoptotic response to oxidative stress. Nature, 391:707-710.
Yoshida M., Horinouchi S. and Beppu T. (1995) Trichostatin A and trapoxin:
novel chemical probes for the role of histone acetylation in chromatin structure and function.
Bioessays, 5:423-430.

Yu A., Fan H., Lao D., Bailey A.D. and Weiner A.M. (2000) Activation of p53 or loss of the Cockayne syndrome group B repair protein causes metaphase fragility of human Ul, U2, and SS genes. Mol. Cell, 5:801-810.
Yu J., Zhang L., Hwang P., Kinzler K. and Vogelstein B. (2001) PUMA induces the rapid apoptosis of colorectal cancer cells. Mol. Cell, 7:673-682.
All patents, patent applications, and published references cited herein are hereby incorporated by reference.
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

SEQUENCE LISTING
<110> Guarente, Leonard Vaziri, Homayoun Imai, Shin-Ichiro Gu, Wei <120> Sir2 and p53 Deacetylation <130> 13407-015001 <150> US 60/303,456 <151> 2001-07-06 <150> US60/303,370 <151> 2001-07-06 <160> 18 <170> PatentIn version 3.1 <210>1 <211>18 <212>PRT

<213>homo Sapiens <400> 1 His Leu Lys Ser Lys Gly Gln Ser Thr Ser Arg His Lys Leu Met Phe Lys Cys <210> 2 <211> 1546 <212> DNA

<213> homoSapiens <400> 2 atggaggagccgcagtcagatcctagcgtcgagccccctctgagtcaggaaacattttca gacctatggaaactacttcctgaaaacaacgttctgtcccccttgccgtcccaagcaatg gatgatttgatgctgtccccggacgatattgaacaatggttcactgaagacccaggtcca gatgaagctcccagaatgccagaggctgctccccccgtggcccctgcaccagcagctcct acaccggcggcccctgcaccagccccctcctggcccctgtcatcttctgtcccttcccag aaaacctaccagggcagctacggtttccgtctgggcttcttgcattctgggacagccaag tctgtgacttgcacgtactcccctgccctcaacaagatgttttgccaactggccaagacc tgccctgtgcagctgtgggttgattccacacccccgcccggcacccgcgtccgcgccatg gccatctacaagcagtcacagcacatgacggaggttgtgaggcgctgcccccaccatgag cgctgctcagatagcgatggtctggcccctcctcagcatcttatccgagtggaaggaaat ttgcgtgtgg agtatttgga tgacagaaac acttttcgac atagtgtggt ggtgccctat gagccgcctg aggttggctc tgactgtacc accatccact acaactacat gtgtaacagt tcctgcatgg gcggcatgaa ccggaggccc atcctcacca tcatcacact ggaagactcc agtggtaatc tactgggacg gaacagcttt gaggtgcatg tttgtgcctg tcctgggaga gaccggcgca cagaggaaga gaatctccgc aagaaagggg agcctcacca cgagctgccc ccagggagca ctaagcgagc actgcccaac aacaccagct cctctcccca gccaaagaag aaaccactgg atggagaata tttcaccctt cagatccgtg ggcgtgagcg cttcgagatg ttccgagagc tgaatgaggc cttggaactc aaggatgccc aggctgggaa ggagccaggg loso gggagcaggg ctcactccag ccacctgaag tccaaaaagg gtcagtctac ctcccgccat aaaaaactca tgttcaagac agaagggcct gactcagact gacattctcc acttcttgtt ccccactgac agcctcccac ccccatctct ccctcccctg ccattttggg ttttgggtct ttgaaccctt gcttgcaata ggtgtgcgtc agaagcaccc aggacttcca tttgctttgt cccggggctc cactgaacaa gttggcctgc actggtgttt tgttgtgggg aggaggatgg ggagtaggac ataccagctt agattttaag gtttttactg tgagggatgt ttgggagatg taagaaatgt tcttgcagtt aagggttagt ttacaatcag ccacattcta ggtagggacc cacttcaccg tactaaccag ggaagctgtc cctcactgtt gaattc <210> 3 <211> 393 <212> PRT
<2l3> homo Sapiens <400> 3 Met Glu Glu Pro Gln Ser Asp Pro Ser Val Glu Pro Pro Leu Ser Gln Glu Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro Glu Asn Asn Val Leu Ser Pro Leu Pro Ser Gln Ala Met Asp Asp Leu Met Leu Ser Pro Asp Asp Zle Glu Gln Trp Phe Thr Glu Asp Pro Gly Pro Asp Glu Ala Pro Arg Met Pro Glu Ala Ala Pro Pro Val Ala Pro Ala Pro Ala Ala Pro Thr Pro Ala Ala Pro Ala Pro Ala Pro Ser Trp Pro Leu Ser Ser Ser Val Pro Ser Gln Lys Thr Tyr Gln Gly Ser Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr Ala Lys Ser Val Thr Cys Thr Tyr Ser Pro Ala Leu Asn Lys Met Phe Cys Gln Leu Ala Lys Thr Cys Pro Val Gln Leu Trp Val Asp Ser Thr Pro Pro Pro Gly Thr Arg Val Arg Ala Met Ala Ile Tyr Lys Gln Ser Gln His Met Thr Glu Val Val Arg Arg Cys Pro His His Glu Arg Cys Ser Asp Ser Asp Gly Leu Ala Pro Pro Gln His Leu Ile Arg Val Glu Gly Asn Leu Arg Val Glu Tyr Leu Asp Asp Arg Asn Thr Phe Arg His Ser Val Val Val Pro Tyr Glu Pro Pro Glu Val Gly Ser Asp Cys Thr Thr I1e His Tyr Asn Tyr Met Cys Asn Ser Ser Cys Met Gly Gly Met Asn Arg Arg Pro Ile Leu Thr Ile Ile Thr Leu Glu Asp Ser Ser Gly Asn Leu Leu Gly Arg Asn Ser Phe Glu Val His Val Cys Ala Cys Pro Gly Arg Asp Arg Arg Thr G1u Glu Glu Asn Leu Arg Lys Lys Gly Glu Pro His His G1u Leu Pro Pro Gly Ser Thr Lys Arg Ala Leu Pro Asn Asn Thr Ser Ser Ser Pro Gln Pro Lys Lys Lys Pro Leu Asp G1y G1u Tyr Phe Thr Leu G1n Ile Arg G1y Arg Glu Arg Phe Glu Met Phe Arg Glu Leu Asn Glu Ala Leu Glu Leu Lys Asp Ala Gln Ala Gly Lys Glu Pro Gly Gly Ser Arg Ala His Ser Ser His Leu Lys Ser Lys Lys Gly Gln Ser Thr Ser Arg His Lys Lys Leu Met Phe Lys Thr Glu Gly Pro Asp Ser Asp <210> 4 <211> 1760 <212> DNA
<2l3> Homo Sapiens <400> 4 gtcgaccctt tccacccctg gaagatggaa ataaacctgc gtgtgggtgg agtgttagga caaaaaaaaa aaaaaaaaag tctagagcca ccgtccaggg agcaggtagc tgctgggctc cggggacact ttgcgttcgg gctgggagcg tgctttccac gacggtgaca cgcttccctg gattggcagc cagactgcct tccgggtcac tgccatggag gagccgcagt cagatcctag 35 cgtcgagccc cctctgagtc aggaaacatt ttcagaccta tggaaactac ttcctgaaaa caacgttctg tcccccttgc cgtcccaagc aatggatgat ttgatgctgt ccccggacga tattgaacaa tggttcactg aagacccagg tccagatgaa gctcccagaa tgccagaggc tgctcccccc gtggcccctg caccagcagc tcctacaccg gcggcccctg caccagcccc ctcctggccc ctgtcatctt ctgtcccttc ccagaaaacc taccagggca gctacggttt 540 , ccgtctgggc ttcttgcatt ctgggacagc caagtctgtg acttgcacgt actcccctgc cctcaacaag atgttttgcc aactggccaa gacctgccct gtgcagctgt gggttgattc cacacccccg cccggcaccc gcgtccgcgc catggccatc tacaagcagt cacagcacat gacggaggtt gtgaggcgct gcccccacca tgagcgctgc tcagatagcg atggtctggc ccctcctcag catcttatcc gagtggaagg aaatttgcgt gtggagtatt tggatgacag aaacactttt cgacatagtg tggtggtgcc ctatgagccg cctgaggttg gctctgactg taccaccatc cactaca~act acatgtgtaa cagttcctgc atgggcggca tgaaccggag gcccatcctc accatcatca cactggaaga ctccagtggt aatctactgg gacggaacag ctttgaggtg catgtttgtg cctgtcctgg gagagaccgg cgcacagagg aagagaatct ccgcaagaaa ggggagcctc accacgagct gcccccaggg agcactaagc gagcactgcc caacaacacc agctcctctc cccagccaaa gaagaaacca ctggatggag aatatttcac ccttcagatc cgtgggcgtg agcgcttcga gatgttccga gagctgaatg aggccttgga actcaaggat gcccaggctg ggaaggagcc aggggggagc agggctcact ccagccacct gaagtccaaa aagggtcagt ctacctcccg ccataaaaaa ctcatgttca agacagaagg gcctgactca gactgacatt ctccacttct tgttccccac tgacagcctc ccacccccat ctctccctcc cctgccattt tgggttttgg gtctttgaac ccttgcttgc aataggtgtg cgtcagaagc acccaggact tccatttgct ttgtcccggg gctccactga acaagttggc ctgcactggt gttttgttgt ggggaggagg atggggagta ggacatacca gcttagattt taaggttttt actgtgaggg atgtttggga gatgtaagaa atgttcttgc agttaagggt tagtttacaa tcagccacat tctaggtagg gacccacttc accgtactaa ccagggaagc tgtccctcac tgttgaattc <210> 5 <211> 3869 <212> DNA

<213> Mus musculus <400> 5 gcggagcagaggaggcgagggcggagggccagagaggcagttggaagatggcggacgagg tggcgctcgcccttcaggccgccggctccccttccgcggcggccgccatggaggccgcgt cgcagccggcggacgagccgctccgcaagaggccccgccgagacgggcctggcctcgggc gcagcccgggcgagccgagcgcagcagtggcgccggcggccgcggggtgtgaggcggcga gcgccgcggccccggcggcgctgtggcgggaggcggcaggggcggcggcgagcgcggagc gggaggccccggcgacggccgtggccggggacggagacaatgggtccggcctgcggcggg agccgagggcggctgacgacttcgacgacgacgagggcgaggaggaggacgaggcggcgg cggcagcggcggcggcagcgatcggctaccgagacaacctcctgttgaccgatggactcc tcactaatggctttcattcctgtgaaagtgatgacgatgacagaacgtcacacgccagct ctagtgactggactccgcggccgcggataggtccatatacttttgttcagcaacatctca 10 .

tgattggcaccgatcctcgaacaattcttaaagatttattaccagaaacaattcctccac ctgagctggatgatatgacgctgtggcagattgttattaatatcctttcagaaccaccaa agcggaaaaaaagaaaagatatcaatacaattgaagatgctgtgaagttactgcaggagt gtaaaaagataatagttctgactggagctggggtttctgtctcctgtgggattcctgact tcagatcaagagacggtatctatgctcgccttgcggtggacttcccagacctcccagacc ctcaagccatgtttgatattgagtattttagaaaagacccaagaccattcttcaagtttg caaaggaaatatatcccggacagttccagccgtctctgtgtcacaaattcatagctttgt cagataaggaaggaaaactacttcgaaattatactcaaaatatagataccttggagcagg ttgcaggaatccaaaggatccttcagtgtcatggttcctttgcaacagcatcttgcctga tttgtaaatacaaagttgattgtgaagctgttcgtggagacatttttaatcaggtagttc ctcggtgccctaggtgcccagctgatgagccacttgccatcatgaagccagagattgtct tctttggtgaaaacttaccagaacagtttcatagagccatgaagtatgacaaagatgaag 11 .

ttgacctcct cattgttatt ggatcttctc tgaaagtgag accagtagca ctaattccaa gttctatacc ccatgaagtg cctcaaatat taataaatag ggaacctttg cctcatctac attttgatgt agagctcctt ggagactgcg atgttataat taatgagttg tgtcataggc taggtggtga atatgccaaa ctttgttgta accctgtaaa gctttcagaa attactgaaa aacctccacg cccacaaaag gaattggttc atttatcaga gttgccacca acacctcttc atatttcgga agactcaagt tcacctgaaa gaactgtacc acaagactct tctgtgattg ctacacttgt agaccaagca acaaacaaca atgttaatga tttagaagta tctgaatcaa gttgtgtgga agaaaaacca caagaagtac agactagtag gaatgttgag aacattaatg tggaaaatcc agattttaag gctgttggtt ccagtactgc agacaaaaat gaaagaactt cagttgcaga aacagtgaga aaatgctggc ctaatagact tgcaaaggag cagattagta agcggcttga gggtaatcaa tacctgtttg taccaccaaa tcgttacata ttccacggtg ctgaggtata ctcagactct gaagatgacg tcttgtcctc tagttcctgt ggcagtaaca 12 .

gtgacagtgg cacatgccag agtccaagtt tagaagaacc cttggaagat gaaagtgaaa ttgaagaatt ctacaatggc ttggaagatg atacggagag gcccgaatgt gctggaggat ctggatttgg agctgatgga ggggatcaag aggttgttaa tgaagctata gctacaagac aggaattgac agatgtaaac tatccatcag acaaatcata acactattga agctgtccgg attcaggaat tgctccacca gcattgggaa ctttagcatg tcaaaaaaat gaatgtttac ttgtgaactt gaacaaggaa atctgaaaga tgtattattt atagactgga aaatagattg tcttcttgga taatttctaa agttccatca tttctgtttg tacttgtaca ttcaacactg ttggttgact tcatcttcct ttcaaggttc atttgtatga tacattcgta tgtatgtata attttgtttt ttgcctaatg agtttcaacc ttttaaagtt ttcaaaagcc attggaatgt taatgtaaag ggaacagctt atctagacca aagaatggta tttcacactt ttttgtttgt aacattgaat agtttaaagc cctcaatttc tgttctgctg aacttttatt tttaggacag 2700 .
ttaacttttt aaacactggc attttccaaa acttgtggca gctaactttt taaaatcaca 13 .

gatgacttgt aatgtgagga gtcagcaccg tgtctggagc actcaaaact tgggctcagt gtgtgaagcg tacttactgc atcgtttttg tacttgctgc agacgtggta atgtccaaac aggcccctga gactaatctg ataaatgatt tggaaatgtg tttcagttgt tctagaaaca atagtgcctg tctatatagg tccccttagt ttgaatattt gccattgttt aattaaatac ctatcactgt ggtagagcct gcatagatct tcaccacaaa tactgccaag atgtgaatat gcaaagcctt tctgaatcta ataatggtac ttctactggg gagagtgtaa tattttggac tgctgttttt ccattaatga ggaaagcaat aggcctctta attaaagtcc caaagtcata agataaattg tagctcaacc agaaagtaca ctgttgcctg ttgaggattt ggtgtaatgt atcccaaggt gttagccttg tattatggag atgaatacag atccaatagt caaatgaaac tagttcttag ttatttaaaa gcttagcttg ccttaaaact agggatcaat tttctcaact gcagaaactt ttagcctttc aaacagttca cacctcagaa agtcagtatt tattttacag acttctttgg aacattgccc ccaaatttaa atattcatgt gggtttagta tttattacaa 14 .

aaaaatgatt tgaaatatag ctgttcttta tgcataaaat acccagttag gaccattact gccagaggag aaaagtatta agtagctcat ttccctacct aaaagataac tgaatttatt tggctacact aaagaatgca gtatatttag ttttccattt gcatgatgtg tttgtgctat agacaatatt ttaaattgaa aaatttgttt taaattattt ttacagtgaa gactgttttc agctcttttt atattgtaca tagactttta tgtaatctgg catatgtttt gtagaccgtt taatgactgg attatcttcc tccaactttt gaaatacaaa aacagtgttt tatactaaaa aaaaaaaaag tcgacgcggc cgcgaattc <210> 6 <211> 737 <212> PRT
<213> Mus musculus <400> 6 Met Ala Asp Glu Val Ala I~eu Ala Zeu Gln Ala Ala Gly Ser Pro Ser Ala Ala Ala Ala Met Glu Ala Ala Ser Gln Pro Ala Asp Glu Pro Leu 15 .

Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Gly Arg Ser Pro Gly Glu Pro Ser Ala Ala Val Ala Pro Ala Ala Ala Gly Cys Glu Ala Ala Ser Ala Ala Ala Pro Ala Ala Leu Trp Arg Glu Ala Ala Gly Ala Ala Ala Ser Ala Glu Arg Glu Ala Pro Ala Thr Ala Val Ala Gly Asp Gly Asp Asn Gly Ser Gly Leu Arg Arg Glu Pro Arg Ala A1a Asp Asp Phe l00 105 l10 Asp Asp Asp Glu Gly Glu Glu Glu Asp Glu Ala Ala Ala Ala Ala A1a 115 l20 125 Ala A1a A1a Ile Gly Tyr Arg Asp Asn Leu Leu Leu Thr Asp Gly Leu Leu Thr Asn Gly Phe His Ser Cys Glu Ser Asp Asp Asp Asp Arg Thr 145 150 155 16.0 Ser His Ala Ser Ser Ser Asp Trp Thr Pro Arg Pro Arg Ile Gly Pro 16 .

Tyr Thr Phe Val Gln Gln His Leu Met Ile Gly Thr Asp Pro Arg Thr Ile Leu Lys Asp Leu Leu Pro Glu Thr Ile Pro Pro Pro Glu Leu Asp Asp Met Thr Leu Trp Gln Ile Val Ile Asn Ile Leu Ser Glu Pro Pro 210 2l5 220 Lys Arg Lys Lys Arg Lys Asp Ile Asn Thr Ile Glu Asp Ala Val Lys Leu Leu Gln Glu Cys Lys Lys Ile Ile Val Leu Thr Gly Ala Gly Val Ser Val Ser Cys Gly Ile Pro Asp Phe Arg Ser Arg Asp Gly Ile Tyr Ala Arg Leu Ala Val Asp Phe Pro Asp Leu Pro Asp Pro G1n Ala Met Phe Asp Ile Glu Tyr Phe Arg Lys Asp Pro Arg Pro Phe Phe Lys Phe Ala Lys Glu Ile Tyr Pro Gly Gln Phe Gln Pro Ser Leu Cys His Lys 305 310 315 32'0 17 .

Phe Ile Ala Leu Ser Asp Lys Glu Gly Lys Leu Leu Arg Asn Tyr Thr Gln Asn Ile Asp Thr Leu Glu Gln Val Ala Gly Ile Gln Arg Ile Leu Gln Cys His Gly Ser Phe Ala Thr Ala Ser Cys Leu Ile Cys Lys Tyr Lys Val Asp Cys Glu Ala Val Arg Gly Asp Ile Phe Asn Gln Va1 Val Pro Arg Cys Pro Arg Cys Pro Ala Asp Glu Pro Leu Ala Ile Met Lys Pro Glu Ile Val Phe Phe Gly Glu Asn Leu Pro Glu Gln Phe His Arg Ala Met Lys Tyr Asp Lys Asp Glu Val Asp Leu Leu Ile Val Ile Gly Ser Ser Leu Lys Val Arg Pro Val Ala Leu Ile Pro Ser Ser Ile Pro His Glu Val Pro Gln Ile Leu Ile Asn Arg Glu Pro Leu Pro His Leu 18 .

His Phe Asp Val Glu Leu Leu Gly Asp Cys Asp Val Ile Ile Asn Glu Leu Cys His Arg Leu Gly Gly Glu Tyr Ala Lys Leu Cys Cys Asn Pro Val Lys Leu Ser Glu Ile Thr G1u Lys Pro Pro Arg Pro Gln Lys Glu Leu Val His Leu Ser Glu Leu Pro Pro Thr Pro Leu His Ile Ser Glu Asp Ser Ser Ser Pro Glu Arg Thr Val Pro Gln Asp Ser Ser Val Ile Ala Thr Leu Val Asp Gln Ala Thr Asn Asn Asn Val Asn Asp Leu Glu Val Ser Glu Ser Ser Cys Val Glu Glu Lys Pro G1n Glu Val Gln Thr Ser Arg Asn Val Glu Asn Ile Asn Va1 Glu Asn Pro Asp Phe Lys Ala 580 ' 585 590 Val Gly Ser Ser Thr Ala Asp Lys Asn Glu Arg Thr Ser Val Ala Glu 19 .
gca Thr Val Arg Lys Cys Trp Pro Asn Arg Leu Ala Lys Glu Gln Ile Ser Lys Arg Leu Glu G1y Asn Gln Tyr Leu Phe Val Pro Pro Asn Arg Tyr Ile Phe His Gly Ala Glu Val Tyr Ser Asp Ser Glu Asp Asp Val Leu Ser Ser Ser Ser Cys Gly Ser Asn Ser Asp Ser Gly Thr Cys Gln Ser Pro Ser Leu Glu Glu Pro Leu Glu Asp Glu Ser G1u Ile Glu G1u Phe Tyr Asn Gly Leu Glu Asp Asp Thr Glu Arg Pro Glu Cys Ala Gly Gly Ser Gly Phe Gly Ala Asp Gly Gly Asp Gln Glu Val Val Asn Glu Ala Ile A1a Thr Arg Gln Glu Leu Thr Asp Val Asn Tyr Pro Ser Asp Lys Ser 20 .

<210> 7 <211> 3849 <212> DNA
<213> Mus musculus <400> 7 gcggagcaga ggaggcgagg gcggagggcc agagaggcag ttggaagatg gcggacgagg tggcgctcgc ccttcaggcc gccggctccc cttccgcggc ggccgccatg gaggccgcgt cgcagccggc ggacgagccg ctccgcaaga ggccccgccg agacgggcct ggcctcgggc gcagcccgggcgagccgagcgcagcagtggcgccggcggccgcggggtgtgaggcggcga 25 gcgccgcggccccggcggcgctgtggcgggaggcggcaggggcggcggcgagcgcggagc gggaggccccggcgacggccgtggccggggacggagacaatgggtccggcctgcggcggg agccgagggcggctgacgacttcgacgacgacgagggcgaggaggaggacgaggcggcgg cggcagcggcggcggcagcgatcggctaccgagacaacctcctgttgaccgatggactcc tcactaatggctttcattcctgtgaaagtgatgacgatgacagaacgtcacacgccagct 21 .

ctagtgactg,gactccgcgg ccgcggatag gtccatatac ttttgttcag caacatctca tgattggcac cgatcctcga acaattctta aagatttatt accagaaaca attcctccac ctgagctgga tgatatgacg ctgtggcaga ttgttattaa tatcctttca gaaccaccaa agcggaaaaa aagaaaagat atcaatacaa ttgaagatgc tgtgaagtta ctgcaggagt gtaaaaagat aatagttctg actggagctg gggtttctgt ctcctgtggg attcctgact tcagatcaag agacggtatc tatgctcgcc ttgcggtgga cttcccagac ctcccagacc ctcaagccat gtttgatatt gagtatttta gaaaagaccc aagaccattc ttcaagtttg caaaggaaat atatcccgga cagttccagc cgtctctgtg tcacaaattc atagctttgt cagataagga aggaaaacta cttcgaaatt atactcaaaa tatagatacc ttggagcagg ttgcaggaat ccaaaggatc cttcagtgtc atggttcctt tgcaacagca tcttgcctga tttgtaaata caaagttgat tgtgaagctg ttcgtggaga catttttaat caggtagttc ctcggtgccc taggtgccca gctgatgagc cacttgccat catgaagcca gagattgtct 22 .

tctttggtga aaacttacca gaacagtttc atagagccat gaagtatgac aaagatgaag ttgacctcdt ~cattgttatt ggatcttctc tgaaagtgag accagtagca ctaattccaa gttctatacc ccatgaagtg cctcaaatat taataaatag ggaacctttg cctcatctac attttgatgt agagctcctt ggagactgcg atgttataat taatgagttg tgtcataggc taggtggtga atatgccaaa ctttgttgta accctgtaaa gctttcagaa attactgaaa aacctccacg cccacaaaag gaattggttc atttatcaga gttgccacca acacctcttc atatttcgga agactcaagt tcacctgaaa gaactgtacc acaagactct tctgtgattg ctacacttgt agaccaagca acaaacaaca atgttaatga tttagaagta tctgaatcaa gttgtgtgga agaaaaacca caagaagtac agactagtag gaatgttgag aacattaatg tggaaaatcc agattttaag gctgttggtt ccagtactgc agacaaaaat gaaagaactt cagttgcaga aacagtgaga aaatgctggc ctaatagact tgcaaaggag cagattagta agcggcttga gggtaatcaa tacctgtttg taccaccaaa tcgttacata ttccacggtg 23 .

ctgaggtata ctcagactct gaagatgacg tcttgtcctc tagttcctgt ggcagtaaca gtgacagtgg cacatgccag agtccaagtt tagaagaacc cttggaagat gaaagtgaaa ttgaagaatt ctacaatggc ttggaagatg atacggagag gcccgaatgt gctggaggat ctggatttgg agctgatgga ggggatcaag aggttgttaa tgaagctata gctacaagac aggaattgac agatgtaaac tatccatcag acaaatcata acactattga agctgtccgg attcaggaat tgctccacca gcattgggaa ctttagcatg tcaaaaaaat gaatgtttac ttgtgaactt gaacaaggaa atctgaaaga tgtattattt atagactgga aaatagattg tcttcttgga taatttctaa agttccatca tttctgtttg tacttgtaca ttcaaca'ctg ttggttgact tcatcttcct ttcaaggttc atttgtatga tacattcgta tgtatgtata attttgtttt ttgcctaatg agtttcaacc ttttaaagtt ttcaaaagcc attggaatgt taatgtaaag ggaacagctt atctagacca aagaatggta tttcacactt ttttgtttgt aacattgaat agtttaaagc cctcaatttc tgttctgctg aacttttatt tttaggacag 24 .

ttaacttttt aaacactggc attttccaaa acttgtggca gctaactttt taaaatcaca gatgacttgt aatgtgagga gtcagcaccg tgtctggagc actcaaaact tgggctcagt gtgtgaagcg tacttactgc atcgtttttg tacttgctgc agacgtggta atgtccaaac aggcccctga gactaatctg ataaatgatt tggaaatgtg tttcagttgt tctagaaaca atagtgcctg tctatatagg tccccttagt ttgaatattt gccattgttt aattaaatac ctatcactgt ggtagagcct gcatagatct tcaccacaaa tactgccaag atgtgaatat gcaaagcctt tctgaatcta ataatggtac ttctactggg gagagtgtaa tattttggac tgctgttttt ccattaatga ggaaagcaat aggcctctta attaaagtcc caaagtcata agataaattg tagctcaacc agaaagtaca ctgttgcctg ttgaggattt ggtgtaatgt atcccaaggt gttagccttg tattatggag atgaatacag atccaatagt caaatgaaac tagttcttag ttatttaaaa gcttagcttg ccttaaaact agggatcaat tttctcaact gcagaaactt ttagcctttc aaacagttca cacctcagaa agtcagtatt tattttacag 25 .

acttctttgg aacattgccc ccaaatttaa atattcatgt gggtttagta tttattacaa aaaaatgatt tgaaatatag ctgttcttta tgcataaaat acccagttag gaccattact gccagaggag aaaagtatta agtagctcat ttccctacct aaaagataac tgaatttatt tggctacact aaagaatgca gtatatttag ttttccattt gcatgatgtg tttgtgctat agacaatatt ttaaattgaa aaatttgttt taaattattt ttacagtgaa gactgttttc agctcttttt atattgtaca tagactttta tgtaatctgg catatgtttt gtagaccgtt taatgactgg attatcttcc tccaactttt gaaatacaaa aacagtgttt tatactaaaa aaaaaaaaa <210> 8 <211> 737 <212> PRT
<213> Mus musculus <400> 8 Met Ala Asp Glu Val Ala Zeu Ala Zeu Gln Ala Ala Gly Ser Pro Ser 26 .

Ala Ala Ala Ala Met Glu Ala Ala Ser Gln Pro A1a Asp Glu Pro Leu Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Gly Arg Ser Pro Gly Glu Pro Ser Ala Ala Val Ala Pro Ala Ala Ala Gly Cys Glu Ala Ala Ser Ala Ala Ala Pro Ala A1a Leu Trp Arg Glu Ala Ala Gly Ala Ala Ala Ser Ala Glu Arg Glu A1a Pro Ala Thr Ala Val Ala Gly Asp Gly Asp Asn Gly Ser G1y Leu Arg Arg Glu Pro Arg Ala Ala Asp Asp Phe Asp Asp Asp Glu Gly G1u Glu Glu Asp Glu Ala Ala Ala Ala A1a Ala Ala Ala Ala Ile Gly Tyr Arg Asp Asn Leu Leu Leu Thr Asp Gly Leu Leu Thr Asn Gly Phe His Ser Cys Glu Ser Asp Asp Asp Asp Arg Thr 27 .

Ser His Ala Ser Ser Ser Asp Trp Thr Pro Arg Pro Arg Ile Gly Pro Tyr Thr Phe Val Gln Gln His Leu Met Ile Gly Thr Asp Pro Arg Thr Ile Leu Lys Asp Leu Leu Pro Glu Thr Ile Pro Pro Pro Glu Leu Asp Asp Met Thr Leu Trp G1n Ile Val Ile Asn Ile Leu Ser G1u Pro Pro 2l0 215 220 Lys Arg Lys Lys Arg Lys Asp Ile Asn Thr Ile Glu Asp Ala Val Lys Leu Leu Gln Glu Cys Lys Lys Ile Ile Val Leu Thr Gly Ala Gly Val Ser Val Ser Cys Gly Ile Pro Asp Phe Arg Ser Arg Asp Gly Ile Tyr Ala Arg Leu Ala Val Asp Phe Pro Asp Leu Pro Asp Pro Gln Ala Met Phe Asp Ile Glu Tyr Phe Arg Lys Asp Pro Arg Pro Phe Phe Lys Phe 28 .

Ala Lys Glu Ile Tyr Pro Gly Gln Phe Gln Pro Ser Leu Cys His Lys Phe Ile Ala Leu Ser Asp Lys Glu Gly Lys Leu Leu Arg Asn Tyr Thr Gln Asn Ile Asp Thr Leu Glu Gln Val Ala Gly Ile Gln Arg Ile Leu Gln Cys His Gly Ser Phe Ala Thr Ala Ser Cys Leu Ile Cys Lys Tyr Lys Val Asp Cys Glu Ala Val Arg Gly Asp Ile Phe Asn Gln Val Val Pro Arg Cys Pro Arg Cys Pro Ala Asp Glu Pro Leu Ala Ile Met Lys Pro Glu Ile Val Phe Phe Gly Glu Asn Leu Pro Glu G1n Phe His Arg Ala Met Lys Tyr Asp Lys Asp Glu Val Asp Leu Leu Ile Val Ile Gly Ser Ser Leu Lys Val Arg Pro Val Ala Leu Ile Pro Ser Ser Ile Pro 29 .

His Glu Val Pro Gln Ile Leu Ile Asn Arg Glu Pro Leu Pro His Leu His Phe Asp Val Glu Leu Leu Gly Asp Cys Asp Val Ile Ile Asn Glu Leu Cys His Arg Leu Gly Gly Glu Tyr Ala Lys Leu Cys Cys Asn Pro Val Lys Leu Ser Glu Ile Thr Glu Lys Pro Pro Arg Pro Gln Lys Glu Leu Val His Leu Ser Glu Leu Pro Pro Thr Pro Leu His Ile Ser Glu Asp Ser Ser Ser Pro Glu Arg Thr Val Pro Gln Asp Ser Ser Val Ile Ala Thr Leu Val Asp Gln Ala Thr Asn Asn Asn Val Asn Asp Leu Glu Val Ser Glu Ser Ser Cys Val Glu Glu Lys Pro Gln Glu Val Gln Thr Ser Arg Asn Val Glu Asn Ile Asn Val Glu Asn Pro Asp Phe Lys Ala 30 .

Val Gly Ser Ser Thr Ala Asp Lys Asn Glu Arg Thr Ser Val Ala Glu Thr Val Arg Lys Cys Trp Pro Asn Arg Leu Ala Lys Glu Gln Ile Ser Lys Arg Leu Glu Gly Asn Gln Tyr Leu Phe Val Pro Pro Asn Arg Tyr Ile Phe His~Gly Ala Glu Val Tyr Ser Asp Ser Glu Asp Asp Val Leu Ser Ser Ser Ser Cys Gly Ser Asn Ser Asp Ser Gly Thr Cys Gln Ser Pro Ser Leu Glu Glu Pro Leu Glu Asp Glu Ser Glu Ile Glu Glu Phe Tyr Asn Gly Leu Glu Asp Asp Thr Glu Arg Pro Glu Cys Ala Gly Gly Ser Gly Phe G1y Ala Asp Gly Gly Asp Gln Glu Val Val Asn Glu Ala 2le Ala Thr Arg Gln Glu Leu Thr Asp Val Asn Tyr Pro Ser Asp Lys 31 .

Ser <2l0> 9 <211> 1963 <212> DNA

<213> Homo Sapiens <400> 9 gtgttgtacgaaagcgcgtctgcggccgcaatgtctgctgagagttgtagttctgtgccc tatcacggccactcccatttctggtgccgtcacgggacagagcagtcggtgacaggacag agcagtcggtgacgggacacagtggttggtgacgggacagagcggtcggtgacagcctca agggcttcagcaccgcgcccatggcagagccagacccctctcaccctctggagacccagg cagggaaggtgcaggaggctcaggactcagattcagactctgagggaggagccgctggtg gagaagcagacatggacttcctgcggaacttattctcccagacgctcagcctgggcagcc agaaggagcgtctgctggacgagctgaccttggaaggggtggcccggtacatgcagagcg aacgctgtcgcagagtcatctgtttggtgggagctggaatctccacatccgcaggcatcc ccgactttcgctctccatccaccggcctctatgacaacctagagaagtaccatcttccct 32 .

acccagaggccatctttgagatcagctatttcaagaaacatccggaacccttcttcgccc tcgccaaggaactctatcctgggcagttcaagccaaccatctgtcactacttcatgcgcc tgctgaaggacaaggggctactcctgcgctgctacacgcagaacatagataccctggagc gaatagccgggctggaacaggaggacttggtggaggcgcacggcaccttctacacatcac actgcgtcagcgccagctgccggcacgaatacccgctaagctggatgaaagagaagatct tctctgaggtgacgcccaagtgtgaagactgtcagagcctggtgaagcctgatatcgtct tttttggtgagagcctcccagcgcgtttcttctcctgtatgcagtcagacttcctgaagg tggacctcctcctggtcatgggtacctccttgcaggtgcagccctttgcctccctcatca gcaaggcacccctctccacccctcgcctgctcatcaacaaggagaaagctggccagtcgg accctttcctggggatgattatgggcctcggaggaggcatggactttgactccaagaagg cctacagggacgtggcctggctgggtgaatgcgaccagggctgcctggcccttgctgagc tccttggatggaagaaggagctggaggaccttgtccggagggagcacgccagcatagatg 33 .

cccagtcggg ggcgggggtc cccaacccca gcacttcagc ttcccccaag aagtccccgc cacctgccaa ggacgaggcc aggacaacag agagggagaa accccagtga cagctgcatc tcccaggcgg gatgccgagc tcctcaggga cagctgagcc ccaaccgggc ctggccccct cttaaccagc agttcttgtc tggggagctc agaacatccc ccaatctctt acagctccct ccccaaaact ggggtcccag caaccctggc ccccaacccc agcaaatctc taacacctcc tagaggccaa ggcttaaaca ggcatctcta ccagccccac tgtctctaac cactcctggg ctaaggagta acctccctca tctctaactg cccccacggg gccagggcta ccccagaact tttaactctt ccaggacagg gagcttcggg cccccactct gtctcctgcc cccgggggcc tgtggctaag taaaccatac ctaacctacc ccagtgtggg tgtgggcctc tgaatataac ccacacccag cgtaggggga gtctgagccg ggagggctcc cgagtctctg ccttcagctc ccaaagtggg tggtgggccc ccttcacgtg ggacccactt cccatgctgg atgggcagaa gacattgctt attggagaca aattaaaaac aaaaacaact aac 34 .

<210> 10 <211> 389 <212> PRT
<213> Homo Sapiens <400> 10 Met Ala Glu Pro Asp Pro Ser His Pro Leu G1u Thr Gln Ala Gly Lys Val Gln Glu Ala Gln Asp Ser Asp Ser Asp Ser Glu Gly Gly Ala Ala Gly Gly Glu Ala Asp Met Asp Phe Leu Arg Asn Leu Phe Ser Gln Thr Leu Ser Leu Gly Ser Gln Lys Glu Arg Leu Leu Asp Glu Leu Thr Leu Glu Gly Va1 Ala Arg Tyr Met Gln Ser G1u Arg Cys Arg Arg Val Ile 65 70 75 80~
Cys Leu Val G1y Ala Gly Ile Ser Thr Ser Ala Gly Ile Pro Asp Phe Arg Ser Pro Ser Thr Gly Leu Tyr Asp Asn Leu Glu Lys Tyr His Leu 35 .

Pro Tyr Pro Glu Ala Ile Phe Glu Ile Ser Tyr Phe Lys Lys His Pro Glu Pro Phe Phe Ala Leu Ala Lys Glu Leu Tyr Pro Gly Gln Phe Lys Pro Thr I1e Cys His Tyr Phe Met Arg Leu Leu Lys Asp Lys Gly Leu 145 150 155 l60 Leu Leu Arg Cys Tyr Thr Gln Asn Ile Asp Thr Leu Glu Arg Ile Ala Gly Leu Glu Gln Glu Asp Leu Val Glu Ala His Gly Thr Phe Tyr Thr Ser His Cys Val Ser Ala Ser Cys Arg His Glu Tyr Pro Leu Ser Trp Met Lys Glu Lys Ile Phe Ser Glu Val Thr Pro Lys Cys Glu Asp Cys Gln Ser Leu Val Lys Pro Asp Ile Val Phe Phe Gly Glu Ser Leu Pro Ala Arg Phe Phe Ser Cys Met Gln Ser Asp Phe Leu Lys Val Asp Leu 36 .

Leu Leu Val Met Gly Thr Ser Leu Gln Val Gln Pro Phe Ala Ser Leu Ile Ser Lys Ala Pro Leu Ser Thr Pro Arg Leu Leu Ile Asn Lys Glu Lys Ala Gly Gln Ser Asp Pro Phe Leu Gly Met Tle Met Gly Leu Gly Gly Gly Met Asp Phe Asp Ser Lys Lys Ala Tyr Arg Asp Val Ala Trp Leu Gly Glu Cys Asp Gln Gly Cys Leu Ala Leu Ala Glu Leu Leu Gly Trp Lys Lys Glu Leu Glu Asp Leu Val Arg Arg G1u His Ala Ser Ile Asp Ala Gln Ser G1y Ala Gly Val Pro Asn Pro Ser Thr Ser Ala Ser Pro Lys Lys Ser Pro Pro Pro Ala Lys Asp Glu Ala Arg Thr Thr Glu Arg Glu Lys Pro Gln 37 .

<210> 11 <2l1> 4086 <2l2> DNA

<213> Homo sapiens <400> 11 gtcgagcgggagcagaggaggcgagggaggagggccagagaggcagttggaagatggcgg acgaggcggccctcgcccttcagcccggcggctccccctcggcggcgggggccgacaggg aggccgcgtcgtcccccgccggggagccgctccgcaagaggccgcggagagatggtcccg gcctcgagcggagcccgggcgagcccggtggggcggccccagagcgtgaggtgccggcgg cggccaggggctgcccgggtgcggcggcggcggcgctgtggcgggaggcggaggcagagg cggcggcggcaggcggggagcaagaggcccaggcgactgcggcggctggggaaggagaca atgggccgggcctgcagggcccatctcgggagccaccgctggccgacaacttgtacgacg aagacgacgacgacgagggcgaggaggaggaagaggcggcggcggcggcgattgggtacc gagataaccttctgttcggtgatgaaattatcactaatggttttcattcctgtgaaagtg atgaggaggatagagcctcacatgcaagctctagtgactggactccaaggccacggatag 38 .

gtccatatac ttttgttcag caacatctta tgattggcac agatcctcga acaattctta aagatttatt gccggaaaca atacctccac ctgagttgga tgatatgaca ctgtggcaga ttgttattaa tatcctttca gaaccaccaa aaaggaaaaa aagaaaagat attaatacaa ttgaagatgc tgtgaaatta ctgcaagagt gcaaaaaaat tatagttcta actggagctg gggtgtctgt ttcatgtgga atacctgact tcaggtcaag ggatggtatt tatgctcgcc ttgctgtaga cttcccagat cttccagatc ctcaagcgat gtttgatatt gaatatttca gaaaagatcc aagaccattc ttcaagtttg caaaggaaat atatcctgga caattccagc catctctctg tcacaaattc atagccttgt cagataagga aggaaaacta cttcgcaact atacccagaa catagacacg ctggaacagg ttgcgggaat ccaaaggata attcagtgtc atggttcctt tgcaacagca tcttgcctga tttgtaaata caaagttgac tgtgaagctg tacgaggaga tatttttaat caggtagttc ctcgatgtcc taggtgccca gctgatgaac cgcttgctat catgaaacca gagattgtgt tttttggtga aaatttacca gaacagtttc 39 .

atagagccat gaagtatgac aaagatgaag ttgacctcct cattgttatt gggtcttccc tcaaagtaag accagtagca ctaattccaa gttccatacc ccatgaagtg cctcagatat taattaatag agaacctttg cctcatctgc attttgatgt agagcttctt ggagactgtg atgtcataat taatgaattg tgtcataggt taggtggtga atatgccaaa ctttgctgta accctgtaaa gctttcagaa attactgaaa aacctccacg aacacaaaaa gaattggctt atttgtcaga gttgccaccc acacctcttc atgtttcaga agactcaagt tcaccagaaa gaacttcacc accagattct tcagtgattg tcacactttt agaccaagca gctaagagta atgatgattt agatgtgtct gaatcaaaag gttgtatgga agaaaaacca caggaagtac aaacttctag gaatgttgaa agtattgctg aacagatgga aaatccggat ttgaagaatg ttggttctag tactggggag aaaaatgaaa gaacttcagt ggctggaaca gtgagaaaat gctggcctaa tagagtggca aaggagcaga ttagtaggcg gcttgatggt aatcagtatc tgtttttgcc accaaatcgt tacattttcc atggcgctga ggtatattca gactctgaag 40 .

atgacgtctt atcctctagt tcttgtggca gtaacagtga tagtgggaca tgccagagtc caagtttaga agaacccatg gaggatgaaa gtgaaattga agaattctac aatggcttag aagatgagcc tgatgttcca gagagagctg gaggagctgg atttgggact gatggagatg atcaagaggc aattaatgaa gctatatctg tgaaacagga agtaacagac atgaactatc catcaaacaa atcatagtgt aataattgtg caggtacagg aattgttcca ccagcattag gaactttagc atgtcaaaat gaatgtttac ttgtgaactc gatagagcaa ggaaaccaga aaggtgtaat atttataggt tggtaaaata gattgttttt catggataat ttttaacttc attatttctg tacttgtaca aactcaacac taactttttt ttttttaaaa aaaaaaaggt actaagtatc ttcaatcagc tgttgggtca agactaactt tcttttaaag gttcatttgt atgataaatt catatgtgta tatataattt tttttgtttt gtctagtgag tttcaacatt tttaaagttt tcaaaaagcc atcggaatgt taaattaatg taaagggaca gctaatctag accaaagaat ggtattttca cttttctttg taacattgaa tggtttgaag tactcaaaat 41 .

ctgttacgct aaacttttga ttctttaaca caattatttt taaacactgg cattttccaa aactgtggca gctaactttt taaaatctca aatgacatgc agtgtgagta gaaggaagtc aacaatatgt ggggagagca ctcggttgtc tttactttta aaagtaatac ttggtgctaa gaatttcagg attattgtat ttacgttcaa atgaagatgg cttttgtact tcctgtggac atgtagtaat gtctatattg gctcataaaa ctaacctgaa aaacaaataa atgctttgga aatgtttcag ttgctttaga aacattagtg cctgcctgga tccccttagt tttgaaatat ttgccattgt tgtttaaata cctatcactg tggtagagct tgcattgatc ttttccacaa gtattaaact gccaaaatgt gaatatgcaa agcctttctg aatctataat aatggtactt ctactgggga gagtgtaata ttttggactg ctgttttcca ttaatgagga gagcaacagg cccctgatta tacagttcca aagtaataag atgttaattg taattcagcc agaaagtaca tgtctcccat tgggaggatt tggtgttaaa taccaaactg ctagccctag tattatggag atgaacatga tgatgtaact tgtaatagca gaatagttaa tgaatgaaac tagttcttat 42 .

aatttatctt tatttaaaag cttagcctgc cttaaaacta gagatcaact ttctcagctg caaaagcttc tagtctttca agaagttcat actttatgaa attgcacagt aagcatttat ttttcagacc atttttgaac atcactccta aattaataaa gtattcctct gttgctttag tatttattac aataaaaagg gtttgaaata tagctgttct ttatgcataa aacacccagc taggaccatt actgccagag aaaaaaatcg tattgaatgg ccatttccct acttataaga tgtctcaatc tgaatttatt tggctacact aaagaatgca gtatatttag ttttccattt gcatgatgtt tgtgtgctat agatgatatt ttaaattgaa aagtttgttt taaattattt ttacagtgaa gactgttttc agctcttttt atattgtaca tagtctttta tgtaatttac tggcatatgt tttgtagact gtttaatgac tggatatctt ccttcaactt ttgaaataca aaaccagtgt tttttacttg tacactgttt taaagtctat taaaattgtc atttgacttt tttctg <210> 12 43 .

<211> 747 <212> PRT
<213> Homo Sapiens <400> 12 Met Ala Asp Glu Ala Ala Leu Ala Leu Gln Pro Gly Gly Ser Pro Ser Ala Ala Gly Ala Asp Arg Glu Ala Ala Ser Ser Pro Ala Gly Glu Pro Leu Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Glu Arg Ser Pro Gly Glu Pro Gly Gly Ala Ala Pro Glu Arg Glu Val Pro Ala Ala Ala Arg G1y Cys Pro Gly Ala Ala Ala Ala Ala Leu Trp Arg Glu Ala Glu Ala Glu Ala Ala Ala Ala Gly G1y Glu G1n Glu Ala Gln Ala Thr Ala Ala Ala Gly Glu Gly Asp Asn Gly Pro Gly Leu Gln G1y Pro Ser Arg Glu Pro Pro Leu Ala Asp Asn Leu Tyr Asp Glu Asp Asp Asp Asp Glu 44 .

Gly Glu Glu Glu Glu Glu Ala Ala Ala Ala Ala Ile Gly Tyr Arg Asp Asn Leu Leu Phe Gly Asp Glu Ile Ile Thr Asn Gly Phe His Ser Cys Glu Ser Asp Glu Glu Asp Arg Ala Ser His Ala Ser Ser Ser Asp Trp Thr Pro Arg Pro Arg Ile Gly Pro Tyr Thr Phe Val Gln Gln His Leu Met Ile Gly Thr Asp Pro Arg Thr Ile Leu Lys Asp Leu Leu Pro Glu Thr Ile Pro Pro Pro Glu Leu Asp Asp Met Thr Leu Trp G1n Ile Va1 Ile Asn Ile Leu Ser Glu Pro Pro Lys Arg Lys Lys Arg Lys Asp Ile Asn Thr Ile Glu Asp Ala Val Lys Leu Leu Gln Glu Cys Lys Lys Ile Ile Val Leu Thr Gly Ala Gly Val Ser Val Ser Cys Gly Ile Pro Asp .

Phe Arg Ser Arg Asp Gly Ile Tyr Ala Arg Leu Ala Val Asp Phe Pro Asp Leu Pro Asp Pro G1n Ala Met Phe Asp 2le Glu Tyr Phe Arg Lys Asp Pro Arg Pro Phe Phe Lys Phe Ala Lys Glu Ile Tyr Pro Gly Gln 305 3l0 315 320 Phe Gln Pro Ser Leu Cys His Lys Phe Ile Ala Leu Ser Asp Lys Glu Gly Lys Leu Leu Arg Asn Tyr Thr Gln Asn Ile Asp Thr Leu Glu Gln Val Ala Gly Ile Gln Arg Ile Ile Gln Cys His Gly Ser Phe Ala Thr Ala Ser Cys Leu 21e Cys Lys Tyr Lys Val Asp Cys G1u Ala Val Arg Gly Asp Ile Phe Asn Gln Val Va1 Pro Arg Cys Pro Arg Cys Pro A1'a Asp Glu Pro Leu Ala Ile Met Lys Pro Glu Ile Val Phe Phe Gly Glu 4 0 5 410 4 l 5 46 .

Asn Leu Pro Glu Gln Phe His Arg Ala Met Lys Tyr Asp Lys Asp Glu . 420 425 430 ' Val Asp Leu Leu Ile Val Ile Gly Ser Ser Leu Lys Val Arg Pro Val Ala Leu Ile Pro Ser Ser Ile Pro His Glu Val Pro Gln Ile Leu Ile Asn Arg Glu Pro Leu Pro His Leu His Phe Asp Val Glu Leu Leu Gly Asp Cys Asp Val Ile Ile Asn Glu Leu Cys His Arg Leu Gly Gly Glu Tyr A1a Lys Leu Cys Cys Asn Pro Va1 Lys Leu Ser Glu Ile Thr Glu Lys Pro Pro Arg Thr Gln Lys Glu Leu Ala Tyr Leu Ser Glu Leu Pro Pro Thr Pro Leu His Val Ser Glu Asp Ser Ser Ser Pro Glu Arg Thr Ser Pro Pro Asp Ser Ser Va1 Ile Val Thr Leu Leu Asp Gln Ala Ala 47 .

Lys Ser Asn Asp Asp Leu Asp Val Ser Glu Ser Lys Gly Cys Met Glu Glu Lys Pro Gln Glu Val Gln Thr Ser Arg Asn Val Glu Ser Ile A1a Glu Gln Met Glu Asn Pro Asp Leu Lys Asn Val Gly Ser Ser Thr Gly Glu Lys Asn Glu Arg Thr Ser Val Ala Gly Thr Val Arg Lys Cys Trp Pro Asn Arg Val Ala Lys Glu Gln Ile Ser Arg Arg Leu Asp Gly Asn Gln Tyr Leu Phe Leu Pro Pro Asn Arg Tyr Ile Phe His Gly Ala Glu Val Tyr Ser Asp Ser Glu Asp Asp Val Leu Ser Ser Ser Ser Cys Gly Ser Asn Ser Asp Ser Gly Thr Cys Gln Ser Pro Ser Leu Glu Glu Pro Met Glu Asp Glu Ser Glu Ile Glu Glu Phe Tyr Asn Gly Leu Glu Asp 48 .

Glu Pro Asp Val Pro Glu Arg Ala Gly Gly Ala Gly Phe Gly Thr Asp Gly Asp Asp Gln Glu Ala Ile Asn Glu Ala Ile Ser Val Lys Gln Glu Val Thr Asp Met Asn Tyr Pro Ser Asn Lys Ser <210> 13 <211> 1869 <212> DNA
<213> Homo sapiens <400> 13 ggcgccgggg gcgggggtgg gaggcggagg cggggccggg gcgccgcggg cggggcgccg ggggcggggc gagtccggag gactcctcgg actgcgcgga acatggcgtt ctggggttgg cgcgccgcgg cagccctccg gctgtggggc cgggtagttg aacgggtcga ggccggggga ggcgtggggc cgtttcaggc ctgcggctgt cggctggtgc ttggcggcag ggacgatgtg agtgcggggc tgagaggcag ccatggggcc cgcggtgagc ccttggaccc ggcgcgcccc 49 .

ttgcagaggc ctcccagacc cgaggtgccc agggcattcc ggaggcagcc gagggcagca gctcccagtt tcttcttttc gagtattaaa ggtggaagaa ggtccatatc tttttctgtg ggtgcttcaagtgttgttggaagtggaggcagcagtgacaaggggaagctttccctgcag gatgtagctgagctgattcgggccagagcctgccagagggtggtggtcatggtgggggcc ggcatcagcacacccagtggcattccagacttcagatcgccggggagtggcctgtacagc aacctccagcagtacgatctcccgtaccccgaggccatttttgaactcccattcttcttt cacaaccccaagccctttttcactttggccaaggagctgtaccctggaaactacaagccc aacgtcactcactactttctccggctgcttcatgacaaggggctgcttctgcggctctac acgcagaacatcgatgggcttgagagagtgtcgggcatccctgcctcaaagctggttgaa gctcatggaacctttgcctctgccacctgcacagtctgccaaagacccttcccaggggag gacattcgggctgacgtgatggcagacagggttccccgctgcccggtctgcaccggcgtt gtgaagcccgacattgtgttctttggggagccgctgccccagaggttcttgctgcat.gtg .

gttgatttcc ccatggcaga tctgctgcte atccttggga cctccctgga ggtggagcct tttgccagct tgaccgaggc cgtgcggagc tcagttcccc gactgctcat caaccgggac ttggtggggc ccttggcttg gcatcctcgc agcagggacg tggcccagct gggggacgtg gttcacggcg tggaaagcct agtggagctt ctgggctgga cagaagagat gcgggacctt gtgcagcggg aaactgggaa gcttgatgga ccagacaaat aggatgatgg ctgcccccac acaataaatg gtaacatagg agacatccac atcccaattc tgacaagacc tcatgcctga agacagcttg ggcaggtgaa accagaatat gtgaactgag tggacacccg aggctgccac tggaatgtct tctcaggcca tgagctgcag tgactggtag ggctgtgttt acagtcaggg 1500 .
ccaccccgtc acatatacaa aggagctgcc tgcctgtttg ctgtgttgaa ctcttcactc tgctgaagct cctaatggaa aaagctttct tctgactgtg accctcttga actgaatcag accaactgga atcccagacc gagtctgctt tctgtgccta gttgaacggc aagctcggca tctgttggtt acaagatcca gacttgggcc gagcggtccc cagccctctt catgttccga 51 .

agtgtagtct tgaggccctg gtgccgcact tctagcatgt tggtctcctt tagtggggct atttttaatg agagaaaatc tgttctttcc agcatgaaat acatttagtc tcctcaaaaa aaaaaaaca <210> 14 <211> 399 <212> PRT
<213> Homo Sapiens <400> 14 Met Ala Phe Trp G1y Trp Arg Ala Ala Ala Ala Leu Arg Leu Trp Gly Arg Va1 Val Glu Arg Val Glu Ala Gly Gly Gly Val Gly Pro Phe Gln 30 Ala Cys Gly Cys Arg Leu Val Leu Gly Gly Arg Asp Asp Val Ser Ala Gly Leu Arg Gly Ser His Gly Ala Arg Gly Glu Pro Leu Asp Pro Ala Arg Pro Leu Gln Arg Pro Pro Arg Pro G1u Val Pro Arg A1a Phe Arg 52 .

Arg Gln Pro Arg Ala Ala Ala Pro Ser Phe Phe Phe Ser Ser Ile Lys Gly Gly Arg Arg Ser Ile Ser Phe Ser Val Gly Ala Ser Ser Val Val l00 105 1l0 Gly Ser Gly Gly Ser Ser Asp Lys Gly Lys Leu Ser Leu Gln Asp Val Ala Glu Leu Ile Arg Ala Arg Ala Cys Gln Arg Val Val Val Met Val Gly Ala Gly Ile Ser Thr Pro Ser Gly Tle Pro Asp Phe Arg Ser Pro Gly Ser Gly Leu Tyr Ser Asn Leu Gln Gln Tyr Asp Leu Pro Tyr Pro Glu Ala Ile Phe Glu Leu Pro Phe Phe Phe His Asn Pro Lys Pro Phe Phe Thr Leu Ala Lys Glu Leu Tyr Pro Gly Asn Tyr Lys Pro Asn Va1 Thr His Tyr Phe Leu Arg Leu Leu His Asp Lys Gly Leu Leu Leu Arg 53 .

Leu Tyr Thr Gln Asn Ile Asp Gly Leu Glu Arg Val Ser Gly Ile Pro Ala Ser Lys Leu Val Glu Ala His Gly Thr Phe Ala Ser Ala Thr Cys Thr Val Cys Gln Arg Pro Phe Pro Gly Glu Asp Ile Arg Ala Asp Val Met Ala Asp Arg Val Pro Arg Cys Pro Val Cys Thr Gly Val Val Lys Pro Asp Ile Val Phe Phe Gly Glu Pro Leu Pro Gln Arg Phe Leu Leu His Val Val Asp Phe Pro Met Ala Asp Leu Leu Leu Ile Leu Gly Thr Ser Leu Glu Val Glu Pro Phe Ala Ser Leu Thr Glu Ala Va1 Arg Ser Ser Val Pro Arg Leu Leu Ile Asn Arg Asp Leu Va1 Gly Pro Leu Ala Trp His Pro Arg Ser Arg Asp Val Ala Gln Leu Gly Asp Val Val His 54 .

Gly Val Glu Ser Leu Val Glu Leu Leu Gly Trp Thr G1u Glu Met Arg Asp Leu Val Gln Arg Glu Thr Gly Lys Leu Asp Gly Pro Asp Lys <210> 15 <211> 1174 <212> DNA
<213> Homo Sapiens <400> l5 gtccgtagag ctgtgagaga atgaagatga gctttgcgtt gactttcagg tcagcaaaag gccgttggat cgcaaacccc agccagccgt gctcgaaagc ctccattggg ttatttgtgc cagcaagtcc tcctctggac cctgagaagg tcaaagagtt acagcgcttc atcacccttt ccaagagact ccttgtgatg actggggcag gaatctccac cgaatcgggg ataccagact acaggtcaga aaaagtgggg ctttatgccc gcactgaccg caggcccatc cagcatggtg attttgtccg gagtgcccca atccgccagc ggtactgggc gagaaacttc gtaggctggc ctcaattctc ctcccaccag cctaaccctg cacactgggc tttgagcacc tgggagaaac 55 .

tcggaaagct gtactggttg gtgacccaaa atgtggatgc tttgcacacc aaggcgggga gtcggcgcct gacagagctc cacggatgca tggacagggt cctgtgcttg gattgtgggg aacagactcc ccggggggtg ctgcaagagc gtttccaagt cctgaacccc acctggagtg ctgaggccca tggcctggct cctgatggtg acgtctttct ctcagaggag caagtccgga gctttcaggt cccaacctgc gttcaatgtg gaggccatct gaaaccagat gtcgttttct tcggggacac agtgaaccct gacaaggttg attttgtgca caagcgtgta aaagaag.ccg actccctctt ggtggtggga tcatccttgc aggtatactc tggttacagg tttatcctca ctgcctggga gaagaagctc ccgattgcaa tactgaacat tgggcccaca cggtcggatg acttggcgtg tctgaaactg aattctcgtt gtggagagtt gctgcctttg atagacccat gctgaccaca gcctgatatt ccagaacctg gaacagggac tttcacttga atcttgctgc taaatgtaaa tgccttctca aatgacagat tccagttccc attcaacaga gtagggtgca 1080 .
ctgacaaagt atagaaggtt ctaggtatct taatgtgtgg atattcttaa ttaaaactca 56 .

ttttttttaa ataaaaaatt gttcagcttt aaaa <2l0> 16 <2l1> 314 <212> PRT

<213> Homo sapiens <400> 16 Met Lys Met Ser Phe Ala Leu Thr Phe Arg Ser Ala Lys Gly Arg Trp Ile A1a Asn Pro Ser Gln Pro Cys Ser Lys Ala Ser Ile Gly Leu Phe Val Pro Ala Ser Pro Pro Leu Asp Pro Glu Lys Val Lys Glu Leu Gln Arg Phe Ile Thr Leu Ser Lys Arg Leu Leu Val Met Thr Gly Ala Gly Ile Ser Thr Glu Ser Gly Ile Pro Asp Tyr Arg Ser Glu Lys Val Gly Leu Tyr Ala Arg Thr Asp Arg Arg Pro Ile Gln His Gly Asp Phe Val Arg Ser A1a Pro Ile Arg Gln Arg Tyr Trp Ala Arg Asn Phe Val Gly 57 .

Trp Pro Gln Phe Ser Ser His Gln Pro Asn Pro Ala His Trp Ala Leu Ser Thr Trp Glu Lys Leu Gly Lys Leu Tyr Trp Leu Val Thr Gln Asn Val Asp Ala Leu His Thr Lys Ala Gly Ser Arg Arg Leu Thr Glu Leu His Gly Cys Met Asp Arg Val Leu Cys Leu Asp Cys Gly Glu Gln Thr Pro Arg Gly Val Leu Gln Glu Arg Phe Gln Val Leu Asn Pro Thr Trp Ser Ala Glu Ala His Gly Leu Ala Pro Asp Gly Asp Val Phe Leu Ser Glu G1u Gln Val Arg Ser Phe Gln Val Pro Thr Cys Val Gln Cys Gly Gly His Leu Lys Pro Asp Val Val Phe Phe Gly Asp Thr Val Asn Pro Asp Lys Val Asp Phe Val His Lys Arg Val Lys Glu A1a Asp Ser Leu 58 .

. 245 250 255 Leu Val Val Gly Ser Ser Leu Gln Val Tyr Ser Gly Tyr Arg Phe Ile Leu Thr Ala Trp Glu Lys Lys Leu Pro Ile Ala Ile Leu Asn Ile Gly Pro Thr Arg Ser Asp Asp Leu Ala Cys Leu Lys Leu Asn Ser Arg Cys Gly G1u Leu Leu Pro Leu Ile Asp Pro Cys <2l0> 17 <2l1> 1633 <212> DNA
<213> Homo Sapiens <400> 17 cgcctctagg agaaagcctg gaacgcgtac cggagggtac cagagctctt agcgggccgg cagcatgtgc ggggccaagt aaatggaaat gttttctaac atataaaaac ctacagaaga agaaaataat tttctggatc aaattagaag tctgtattat attgatgtct ccagattcaa atatattaga aagcagccgt ggagacaacc atcttcattt tgggagaaat aactaaagcc 59 .

cgcctcaagc attagaactacagacaaaccctgatgcgacctctccagattgtcccaagt cgattgattt cccagctatattgtggcctgaagcctccagcgtccacacgaaaccagatt tgcctgaaaa tggctcggccaagttcaagtatggcagattttcgaaagttttttgcaaaa gcaaagcaca tagtcatcatctcaggagctggtgttagtgcagaaagtggtgttccgacc ttcagaggag ctggaggttattggagaaaatggcaagcccaggacctggcgactcccctg gcctttgccc acaacccgtcccgggtgtgggagttctaccactaccggcgggaggtcatg gggagcaaggagcccaacgccgggcaccgcgccatagccgagtgtgagacccggctgggc aagcagggccggcgagtcgtggtcatcacccagaacatcgatgagctgcaccgcaaggct ggcaccaagaaccttctggagatccatggtagcttatttaaaactcgatgtacctcttgt ggagttgtggctgagaattacaagagtccaatttgtccagctttatcaggaaaaggtgct ccagaacctggaactcaagatgccagcatcccagttgagaaacttccccggtgtgaagag gcaggctgcgggggcttgctgcgacctcacgtcgtgtggtttggagaaaacctggatcct 60 .

gccattctgg aggaggttga cagagagctc gcccactgtg atttatgtct agtggtgggc acttcctctg tggtgtaccc agcagccatg tttgcccccc aggtggctgc caggggcgtg ccagtggctg aatttaacac ggagaccacc ccagctacga acagattcag gtttcat.ttc cagggaccct gtggaacgac tcttcctgaa gcccttgcct gtcatgaaaa tgaaactgtt tcttaagtgt cctggggaag aaagaaatta cagtatatct aagaactagg ccacacgcag aggagaaatg gtcttatggg tggtgagctg agtactgaac aatctaaaaa tagcctctga ttccctcgct ggaatccaac ctgttgataa gtgatggggg tttagaagta gcaaagagca cccacattca aaagtcacag aactggaaag ttaattcata ttatttggtt tgaactgaaa cgtgaggtat ctttgatgtg tatggttggt tattgggagg gaaaaatttt gtaaattaga ttgtctaaaa aaaatagtta ttctgattat atttttgtta tctgggcaaa gtagaagtca aggggtaaaa accctactat tctgattttt gcacaagttt tagtggaaaa taaaatcaca ctctacagta ggt 61 .

<210> 18 <2l1> 310 <212> PRT
<213> Homo Sapiens <400> 18 Met Arg Pro Leu Gln Ile Val Pro Ser Arg Leu Ile Ser Gln Leu Tyr Cys Gly Leu Lys Pro Pro Ala Ser Thr Arg Asn Gln I1e Cys Leu Lys Met Ala Arg Pro Ser Ser Ser Met Ala Asp Phe Arg Lys Phe Phe Ala Lys Ala Lys His Tle Val Ile Ile Ser Gly Ala Gly Val Ser Ala Glu Ser Gly Val Pro Thr Phe Arg Gly Ala Gly Gly Tyr Trp Arg Lys Trp Gln Ala Gln Asp Leu Ala Thr Pro Leu Ala Phe Ala His Asn Pro Ser Arg Val Trp Glu Phe Tyr His Tyr Arg Arg Glu Val Met Gly Ser Lys 62 .

Glu Pro Asn Ala Gly His Arg Ala Ile Ala Glu Cys Glu Thr Arg Leu Gly Lys Gln Gly Arg Arg Val Val Val Ile Thr Gln Asn I1e Asp Glu l30 135 140 Leu His Arg Lys Ala Gly Thr Lys Asn Leu Leu Glu Ile His Gly Ser Leu Phe Lys Thr Arg Cys Thr Ser Cys Gly Val Val Ala Glu Asn Tyr Lys Ser Pro Tle Cys Pro Ala Leu Ser Gly Lys Gly Ala Pro Glu Pro Gly Thr Gln Asp Ala Ser Ile Pro Val Glu Lys Leu Pro Arg Cys Glu Glu Ala Gly Cys Gly Gly Leu Leu Arg Pro His Val Val Trp Phe Gly Glu Asn Leu Asp Pro Ala Ile Leu Glu Glu Val Asp Arg Glu Leu Ala His Cys Asp Leu Cys Leu Val Val Gly Thr Ser Ser Val Val Tyr Pro 63 .

Ala Ala Met Phe Ala Pro Gln Val Ala Ala Arg Gly Val Pro Val Ala Glu Phe Asn Thr Glu Thr Thr Pro Ala Thr Asn Arg Phe Arg Phe His Phe Gln Gly Pro Cys Gly Thr Thr Zeu Pro Glu Ala Leu Ala Cys His Glu Asn Glu Thr Val Ser 64 .

Claims (41)

WHAT IS CLAIMED IS:

1. A method of screening a compound, comprising the steps of:
(a) providing a reaction mixture comprising Sir2, a transcription factor, and the compound; and (b) determining if the compound modulates Sir2 interaction with the transcription factor, thereby screening the compound.

2. The method of claim 1, wherein the Sir2 interaction with the transcription factor is direct binding, covalent modification in one or both of the Sir2 or transcription factor, a change in cellular location of the test compound, Sir2 or the transcription factor, or an alteration in activity, stability, or structure.

3. The method of claim 2, wherein the determining includes comparing the binding of Sir2 to the transcription factor at a first concentration of the compound and at a second concentration of the compound.

4. The method of claim 3, wherein the first or second concentration of the compound is zero.

5. The method of claim 1, wherein the reaction mixture further comprises a Sir2 cofactor.

6. The method of claim 5, wherein the Sir2 cofactor is NAD or an NAD analog.

7. The method of claim 1 wherein the Sir2 is a Sir2 variant that has reduced deacetylase activity.

8. The methods of claim 1, wherein the Sir2 is human.

9. The method of claim 8, wherein the Sir2 is human SIRT1.

10. The method of claim 1, wherein the Sir2 is murine.

11. The method of claim 10, wherein the Sir2 is murine Sir2.alpha..

12. The method of claim 1, wherein the Sir2 is exogenous and expressed from a heterologous nucleic acid.

13. The method of claim 1, wherein the transcription factor is exogenous and expressed from a heterologous nucleic acid.

14. The method of claim 1, further comprising the steps of:
(c) repeating steps (a) and (b) to confirm a modulatory effect of the compound on Sir2 interaction with the transcription factor, and (d) contacting or administering the compound with or to a cell or animal to evaluate the effect of the compound on the cell or animal.

15. A method of screening a compound, comprising the steps of:
(a) providing a reaction mixture comprising Sir2, a transcription factor, and the compound; and (b) determining if the compound modulates Sir2-mediated deacetylation of the transcription factor, thereby screening the compound.

16. The method of claim 15, wherein the determining includes comparing the acetylation status of the transcription factor, at a first concentration of the compound and at a second concentration of the compound.

17. The method of claim 16, wherein the first or second concentration of the compound is zero.

18. The method of claim 17, wherein the reaction mixture further comprises a Sir2 cofactor.

19. The method of claim 18, wherein the Sir2 cofactor is NAD or an NAD analog.

20. The method of claim 15, wherein the Sir2 is a Sir2 variant that has reduced deacetylase activity

21. The methods of claim 15, wherein the Sir2 is human.

22. The method of claim 21, wherein the Sir2 is human SIRT1.

23. The method of claim 15, wherein the Sir2 is murine.

24. The method of claim 23, wherein the Sir2 is murine Sir2.alpha..

25. The method of claim 15, wherein Sir2 is exogenous and expressed from a heterologous nucleic acid.

26. The method of claim 15, wherein the transcription factor is exogenous and expressed from a heterologous nucleic acid.

27. The method of claim 15, further comprising the steps of:
(c) repeating steps (a) and (b) to confirm a modulatory effect of the compound on Sir2-mediated deacetylation of the transcription factor, and (d) contacting or administering the compound with or to a cell or animal to evaluate the effect of the compound on the cell or animal.

28. A method of screening a compound, comprising the steps of:
(a) providing a compound that interacts with Sir2;
(b) contacting the compound with a cell or a system; and (c) determining if the compound modulates transcription of a transcription factor-regulated gene, thereby screening the compound.

29. The method of claim 28, wherein the compound binds Sir2 directly.

30. The method of claim 28, wherein the determining includes comparing the modulation of transcription of a transcription factor-regulated gene at a first concentration of the compound and at a second concentration of the compound.

31. The method of claim 30, wherein the first or second concentration of the compound is zero.

32. The method of claim 15, further comprising the steps of:
(c) repeating steps (a) and (b) to confirm a modulatory effect of the compound on transcription of transcription factor-regulated genes, and (d) contacting or administering the compound with or to a cell or animal to evaluate the effect of the compound on the cell or animal.

33. A method of modifying the acetylation status of a transcription factor binding site on histone or DNA, the method comprising the steps of:
(a) providing a Sir2-transcription factor complex;
(b) allowing the transcription factor to target the Sir2-transcription factor to the transcription factor binding site; and (c) allowing the Sir2 to modify the acetylation status of the transcription factor binding site.

34. The method of claim 33, wherein the method is performed in vitro or in vivo.

35. The method of claim 34, wherein the method is performed in cell culture..

36. The method of claim 35, wherein the method is performed in an animal.

37. The method of claim 34, wherein the Sir2-transcription factor complex is supplied at concentrations greater than those which occur naturally in vitro or in vivo.

38. The method of claim 33, wherein the Sir2-transcription factor complex is supplied at a different stage of development than occurs naturally in vitro or in vivo.

39. The method of claim 33, wherein the Sir2-transcription factor complex is expressed from one or more exogenous genes.

40. The method of claim 33, wherein the Sir2-transcription factor complex is supplied as exogenous Sir2-transcription factor complex.

41. The method of claim 33, wherein the Sir2-transcription factor complex is supplied by inducing endogenous expression of one or more of Sir2 or a transcription factor complex.