CA2448796C - Vaccine against the nile fever virus - Google Patents

Abstract

The invention concerns in vivo and in vitro expression vectors comprising a polynucleotide coding for the structural protein E of the Nile fever virus or the WN virus, optionally associated with a polynucleotide coding for the pre-membrane protein prM and/or for the membrane protein M, in particular in the form coding for prM-M-E. Said in vivo expression vectors are incorporated in live vaccines. The in vivo expression vectors are used for producing in vitro proteins which can then be used in subunit vaccines. The invention also concerns multivalent vaccines comprising a vaccine constituent against the WN virus and a vaccine constituent against another pathogen. The invention is particularly designed for horses, dogs, cats, cattle, pigs and birds.

Description

t VACCINE AGAINST THE NILE FEVER VIRUS

The present invention relates to in vivo and in vitro expression vectors comprising and expressing at least one polynucleotide of the West Nile fever virus, as well as immunogenic compositions and vaccines against West Nile fever. It also relates to methods for immunizing and vaccinating against the virus.

The West Nile fever virus (WNV) was first identified in man in 1937 in Ouganda in the West Nile Province (Zeller H. G., Med. Trop., 1999, 59, 490-494).

Widespread in Africa, it is also encountered in India, Pakistan and the Mediterranean basin and was identified for the first time in the USA in 1999 in New York City (Anderson J. F. et al., Science, 1999, 286, 2331-2333).

The West Nile fever virus affects birds as well as mammals, together with man.
The fever is characterized in birds by an attack of the central nervous system and death. The lesions include encephalitis, hemorrhages in the myocardium and hemorrhages and necroses in the intestinal tract.

In chickens, experimental infections by subcutaneous inoculations of the West Nile fever virus isolated on crows led to necroses of the myocardium, nephrites and pneumonia 5 to 10 days after inoculation and moderate to severe encephalitis 21 days after inoculation (Senne D. A. et al., Avian Disease, 2000, 44, 642-649).

The West Nile fever virus also affects horses, particularly in North Africa and Europe (Cantile C. et al., Equine Vet. J., 2000, 32 (1), 31-35). These horses reveal signs of ataxia, weakness of the rear limbs, paresis evolving towards tetraplegia and death.
Horses and camels are the main animals manifesting clinical signs in the form of encephalitis.

Anti-WNV antibodies were detected in certain rodents, in livestock, particularly bovines and ovines, as well as in domestic animals, particularly in the dog (Zeller H. G., Med. Trop., 1999, 59, 490-494; Lundstrom J.O., Journal of Vector Ecology, 1999, 24 (1), 1-39).

1a The West Nile fever virus also affects with a number of symptoms the human species (Sampson B. A., Human pathology, 2000, 31 (5), 527-531; Marra C. M., Seminars in Neurology, 2000, 20 (3), 323-327).

The West Nile fever virus is transmitted to birds and mammals by the bites of certain mosquitoes (e.g. Culex, Aedes, Anopheles) and ticks.

Wild and domestic birds are a reservoir for the West Nile virus and a propagation vector as a result of their migrations.

The virions of the West Nile fever virus are spherical particles with a diameter of 50 nm constituted by a lipoproteic envelope surrounding an icosahedric nucleocapsid containing a positive polarity, single-strand RNA.
A single open reading frame (ORF) encodes all the viral proteins in the form of a polyprotein. The cleaving and maturation of this polyprotein leads to the production of about ten different viral proteins. The structural proteins are encoded by the 5' part of the genome and correspond to the nucleocapsid designated C (14 kDa), the envelope glycoprotein designated E (50 kDa), the pre-membrane protein designated prM (23 kDa), the membrane protein designated M (7 kDa). The non-structural proteins are encoded by the 3' part of the genome and correspond to the proteins NS1 (40 kDa), NS2A (19 kDa), NS2B (14 kDa), NS3 (74 kDa), NS4A (15 kDa), NS4B (29 kDa), NS5 (97 kDa).

Parrish C. R. et al. (J. Gen. Virol., 1991, 72, 1645-1653), Kulkami A. B. et al. (J. Viroi., 1992, 66 (6), 3583-3592) and Hill A. B. et at. (J. Gen. Virol., 1992, 73, 1115-1123), on the basis of the vaccinia virus, constructed in vivo expression vectors containing various inserts corresponding to nucleotide sequences coding for non-structural proteins of the Kunjin virus, optionally associated with structural proteins. These vectors were administered to the mouse to evaluate the immune cell response.
The authors stress the importance of the cell response, which is essentially stimulated by non-structural proteins and especially NS3, NS4A and NS4B. These articles reveal the difficulty in providing a good vaccination strategy against West Nile fever.

Hitherto there is no vaccine preventing infection by the WN virus.

The present invention relates to a means for preventing and/or combating diseases caused by the WN virus.
Another objective of the invention is to propose such a means usable in different animal species sensitive to the disease caused by said virus and in particular equine and avian species.

Another objective of the invention is to propose immunization and vaccination methods for the target species.

Yet another objective of the invention is to propose means and methods making it possible to ensure a differential diagnosis.
Thus, the first object of the invention is in vitro and/or in vivo expression vectors comprising a polynucleotide encoding the envelope protein E of the WN virus. These vectors also comprise the elements necessary for the expression of the polynucleotide in the host cell.

In addition to the polynucleotide encoding E, the expression vectors according to the invention can comprise one or more other polynucleotides encoding other proteins of the WN virus, preferably structural proteins of the WN virus and said sequences are preferably chosen from among those encoding the pre-membrane protein prM and the membrane protein M.
The vector preferably comprises a polynucleotide forming a single encoding frame corresponding e.g. to prM-E, WE and more particularly prM-M-E. A vector comprising several separate polynucleotides encoding the different proteins (e.g. prM and/or M and E) also falls within the scope of the present invention. The vector, more particularly in vivo, can also comprise polynucleotides corresponding to more than one WN
virus strain, particularly two or more polynucleotides encoding E or prM-M-E
of different strains. As will be shown hereinafter, the vector, particularly in vivo, can comprise one or more nucleotide sequences encoding immunogens of other pathogenic agents and/or cytokins.

According to a preferred embodiment of the invention, the expression vector comprises a polynucleotide encoding prM-M-E and preferably in a single reading frame.

The term polynucleotide encoding a protein of the WN virus mainly means a DNA
fragment encoding said protein, or the complementary strand of said DNA fragment. An RNA is not excluded.

In the sense of the invention, the term protein covers fragments, including peptides and polypeptides. By definition, the protein fragment is immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humorai and/or cellular type directed against the protein.
Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises at least one epitope or antigenic determinant. The term epitope relates to a protein site able to induce an immune reaction of the humoral type (B cells) and/or cellular type (T cells).

Thus, the minimum structure of the polynucleotide is that encoding an epitope or antigenic determinant of the protein in question. A polynucleotide encoding a fragment of the total protein more particularly comprises a minimum of 21 nucleotides, particularly at least 42 nucleotides and preferably at least 57, 87 or 150 consecutive nucleotides of the sequence in question. Epitope determination procedures are well known to the one skilled in the art and it is more particularly possible to use overlapping peptide libraries (Hemmer B. et al., Immunology Today, 1998, 19 (4), 163-168), Pepscan (Geysen H. M. et al., Proc. Nat. Acad. Sci.
USA, 1984, 81 (13), 3998-4002; Geysen H. M. et al., Proc. Nat. Aced. Sci. USA, 1985, 82 (1), 178-182; Van der Zee R. et al., Eur. J. Immunol., 1989, 19 (1), 43-47; Geysen H. M., Southeast Asian J. Trop. Med. Public Health, 1990, 21 (4), 523-533; Multipin Peptide Synthesis Kits de Chiron) and algorithms (De Groot A. et al., Nature Biotechnology, 1999, 17, 533-561).

In particular the polynucleotides according to the invention comprise the nucleotide sequence encoding one or two transmembrane domains and preferably two of them, located in the terminal part C of the protein E.

For the WNV NY99 strain, these domains correspond to amino acid sequences 742 to 766 and 770 to 791 of GenBank AF196835.

Elements necessary for the expression of the polynucleotide or polynucleotides are present. In minimum manner, this consists of an initiation codon (ATG), a stop codon and a promoter, as well as a polyadenylation sequence for the plasmids and viral vectors other than poxviruses. When the polynucleotide encodes a polyprotein fragment, e.g. prM-E, M-E, prM-M-E, an ATG is placed at 5' of the reading frame and a stop codon is placed at 3'. As will be explained hereinafter, other elements making it possible to control the expression could be present, such as enhancer sequences, stabilizing sequences and signal sequences permitting the secretion of the protein.

The present invention also relates to preparations comprising such expression vectors. It more particularly relates to preparations comprising one or more in vivo expression vectors, comprising and expressing one or more of the above polynucleotides, including that encoding E, in a pharmaceutically acceptable excipient or vehicle.

According to a first embodiment of the invention, the other vector or vectors in the preparation comprise and express one or more other proteins of the WN virus, e.g. prM, M, prM-M.

According to another embodiment, the other vector or vectors in the preparation comprise and express one or more proteins of one or more other WN virus strains. In particular, the preparation comprises at least two vectors expressing, particularly in vivo, polynucleotides of different WN
strains encoding the same proteins and/or for different proteins, preferably for the same proteins. This is more particularly a matter of vectors expressing in vivo E or prM-M-E of two, three or more different WN strains.
The invention is also directed at mixtures of vectors expressing prM, M, E, prM-M, prM-E or M-E of different strains.

According to yet another embodiment and as will be shown in greater detail hereinafter, the other vector or vectors in the preparation comprise and express one or more cytokins and/or one or more.immunogens of one or more other pathogenic agents.
The invention also relates to various combinations of these different embodiments.

The preparations comprising an in vitro or in vivo expression vector comprising and expressing a polynucleotide encoding prM-M-E constitute a preferred embodiment of the invention.
According to a special embodiment of the invention, the in vivo or in vitro expression vectors comprise as the sole polynucleotide or polynucleotides of the WN virus, a polynucleotide encoding the protein E, optionally associated with prM and/or M, preferably encoding prM-M-E and optionally a signal sequence of the WN virus.

4a In one aspect, the present invention relates to a composition comprising a pharmaceutically acceptable vehicle or excipient, and a vector comprising a recombinant canarypox virus that encodes and expresses in vivo in an animal West Nile Virus (WNV) polyprotein prM-M-E.

According to a special embodiment, one or more of the non-structural proteins NS2A, NS2B and NS3 are expressed jointly with the structural proteins according to the invention, either via the same expression vector, or via their own expression vector. They are preferably expressed together on the basis of a single polynucleotide.

Thus, the invention also relates to an in vivo or in vitro expression vector comprising the polynucleotide encoding NS2A, NS2B, NS3, their combinations and preferably for NS2A-NS2B-NS3.
Basically said vector can be one of the above-described vectors comprising a polynucleotide encoding one or more structural proteins, particularly E or prM-M-E. As an alternative, the invention relates to a preparation as described hereinbefore, also incorporating at least one of these vectors expressing a non-structural protein and optionally a pharmaceutically acceptable vehicle or excipient.

In order to implement the expression vectors according to the invention, the one skilled in the art has various strains of the WN virus and the description of the nucleotide sequence of their genome, of. particularly Savage H. M. et al. (Am. J. Trop. Med. Hyg. 1999, 61 (4), 600-611), table 2, which refers to 24 WN virus strains and gives access references to polynucleotide sequences in GenBank.

Reference can e.g. be made to strain NY99 (GenBank AF196835). In GenBank, for each protein the corresponding DNA sequence is given (nucleotides 466-741 for prM, 742-966 for M, 967-2469 for E, or 466-2469 for prM-M-E, 3526-4218 for NS2A, 4219-4611 for NS2B and 4612-6468 for NS3, or 3526-6468 for NS2A-NS2B-NS3). By comparison and alignment of the sequences, the determination of a polynucleotide encoding such a protein in another WNV strain is immediate.

It was indicated hereinbefore that polynucleotide was understood to mean the sequence encoding the protein or a fragment or an epitope specific to the WN virus. Moreover, by equivalence, the term polynucleotide also covers the corresponding nucleotide sequences of the different WN virus strains and nucleotide sequences differing by the degeneracy of the code.

Within the family of WN viruses, identity between amino acid sequences prM-M-E
relative to that of NY99 is equal to or greater than 90%. Thus, the invention covers polynucleotides encoding an amino acid sequence, whose identity with the native amino acid sequence is equal to or greater than 90%, particularly 92%, preferably 95% and more specifically 98%. Fragments of these homologous polynucleotides specific with respect to WN viruses, are also considered equivalents.

Thus, on referring to a polynucleotide of the WN virus, this term covers equivalent sequences within the sense of the invention.

It has also been seen that the term protein covers immunologically active peptides and polypeptides. For the requirements of the invention, it covers:
a) corresponding proteins of the different WN virus strains, b) proteins differing therefrom, but maintaining with a native WN protein an identity equal to or greater than 90%, particularly 92%, preferably 95% and more specifically 98%.

Thus, on referring to a protein of the WN virus, this term covers equivalent proteins within the sense of the invention.

Different WN virus strains are accessible in collections, particularly in the American Type Culture Collection (ATCC), e.g. under access numbers VR-82 or VR-1267. The Kunjin virus is in fact considered to be a WN
virus.
According to the invention, preferably the polynucleotide also comprises a nucleotide sequence encoding a signal peptide, located upstream of the expressed protein in order to ensure the secretion thereof. It can consequently be an endogenic sequence, i.e. the natural signal sequence when it exists (coming from the same WN virus or another strain). For example, for the NY99 WN virus, the endogenic signal sequence of E
corresponds to nucleotides 922 to 966 of the GenBank sequence and for prM it is a matter of nucleotides 421 to 465. It can also be a nucleotide sequence encoding a heterologous signal peptide, particularly that encoding the signal peptide of the human tissue plasminogen activator (tPA) (Hartikka J. et al., Human Gene Therapy, 1996, 7, 1205-1217). The nucleotide sequence encoding the signal peptide is inserted in frame and upstream of the sequence encoding E or its combinations, e.g. prM-M-E.
According to a first embodiment of the invention, the in vivo expression vectors are viral vectors.

These expression vectors are advantageously poxviruses, e.g. the vaccinia virus or attenuated mutants of the vaccinia virus, e.g. MVA (Ankara strain) (Stick) H. and Hochstein-Mintzel V., Munch. Med. Wschr., 1971, 113, 1149-1153; Sutter G. et at., Proc. Natl. Acad. Sci. U.S.A., 1992, 89, 10847-10851; commercial strain ATCC VR-1508; MVA being obtained after more than 570 passages of the Ankara vaccine strain on chicken embryo fibroblasts) or NYVAC (its construction being described in US-A-5 494 807, particularly in examples 1 to 6, said patent also describing the insertion of heterologous genes in sites of this recombinant and the use of matched promoters - reference also to be made to WO-A-96/40241), avipox (in particular canarypox, fowlpox, pigeonpox, quailpox), swinepox, raccoonpox and camelpox, adenoviruses, such as avian, canine, porcine, bovine, human adenoviruses and herpes viruses, such as equine herpes virus (EHV serotypes I
and 4), canine herpes virus (CHV), feline herpes virus (FHV), bovine herpes viruses (BHV serotypes I and 4), porcine herpes virus (PRV), Marek's disease virus (MDV serotypes I and 2), turkey herpes virus (HVT or MDV serotype 3), and duck herpes virus. When a herpes virus is used, the vector HVT is preferred for the vaccination of the avian species and the vector EHV for the vaccination of horses.

According to one of the preferred embodiments of the invention, the poxvirus expression vector is a canarypox or a fowipox, whereby such poxviruses can possibly be attenuated.
Reference can be made to the canarypox commercially available from ATCC under access number VR-111.
Attenuated canarypox viruses were described in US-A-5,756,103 and WO-A-01/05934. Numerous fowipox virus vaccination strains are available, e.g. the DIFTOSEC CT strain marketed by MERIAL and the NOBILIS VARIOLE
vaccine marketed by Intervet.

For poxviruses, the one skilled in the art can refer to WO-A-90112882 and more particularly for the vaccinia virus to US-A-4,769,330; US-A-4,722,848; US-A-4,603,112; US-A-5,1 10,587; US-A-5,494,807; US-A-5,762,938; for fowlpox to US-A-5,174,993; US-A-5,505,941; US-5,766,599; for canarypox to US-A-5,756,103; for swinepox to US-A-5,382,425 and for raccoonpox to WO-A-00/03030.

When the expression vector is a vaccinia virus, the insertion sites for the polynucleotide or polynucleotides to be expressed are in particular the gene of thymidine kinase (TK), the gene of hemagglutinin (HA), the region of the inclusion body of the A type (ATI). In the case of canarypox, the insertion sites are more particularly located in or are constituted by ORFs, C3, C5 and C6. In the case of fowlpox, the insertion sites are more particularly located in or constituted by the ORFs F7 and F8.

The insertion of genes in the MVA virus has been described in various publications, including Carroll M. W.
et al., Vaccine, 1997, 15 (4), 387-394; Stittelaar K. J. et at., J. Viral., 2000, 74 (9), 4236-4243; Sutter G. et al., 1994, Vaccine, 12 (11), 1032-1040, to which the one skilled in the art can refer. The complete MVA
genome is described in Antoine G., Virology, 1998, 244, 365-396, which enables the one skilled in the art to use other insertion sites or other promoters.
Preferably, when the expression vector is a poxvirus, the polynucleotide to be expressed is inserted under the control of a specific poxvirus promoter, particularly the vaccine promoter 7.5 kDa (Cochran et at., J.
Virology, 1985, 54,30-35), the vaccine promoter 13L (Riviere et al., J.
Virology, 1992, 66, 3424-3434), the vaccine promoter HA (Shida, Virology, 1986, 150, 451-457), the cowpox promoter ATI (Funahashi et al., J.
Gen. Viral., 1988, 69, 35-47), or the vaccine promoter H6 (Taylor J. at al., Vaccine, 1988, 6, 504-508; Guo P. et al. J. Viral., 1989, 63, 4189-4198; Perkus M. et al., J. Viral., 1989, 63, 3829-3836).

Preferably, for the vaccination of mammals the expression vector is a canarypox. Preferably, for the vaccination of avians, particularly chickens, ducks, turkeys and geese, the expression vector is a canarypox or a fowlpox.

When the expression vector is a herpes virus HVT, appropriate insertion sites are more particularly located in the BamHl I fragment or in the BamHI M fragment of HVT. The HVT BamHl I
restriction fragment comprises several open reading frames (ORFs) and three intergene regions and comprises several preferred insertion zones, namely the three intergene regions 1, 2 and 3, which constitute preferred regions, and ORF UL55 (FR-A-2 728 795, US-A-5 980 906). The HVT BamHl M restriction fragment comprises ORF
UL43, which is also a preferred insertion site (FR-A-2 728 794, US-A-5 733 554).

When the expression vector is an EHV-1 or EHV-4 herpes virus, appropriate insertion sites are in particular TK, UL43 and UL45 (EP-A-668355).

Preferably, when the expression vector is a herpes virus, the polynucleotide to be expressed is inserted under the control of a strong eukaryote promoter, preferably the CMV-IE
promoter. These strong promoters are described hereinafter in the part of the description relating to plasmids.
According to a second embodiment of the invention, the in vivo expression vectors are plasmidic vectors known as plasmids.

The term plasmid covers any DNA transcription unit in the form of a polynucleotide sequence comprising a polynucleotide according to the invention and the elements necessary for its in vivo expression. Preferably there is a supercoiled or non-supercoiled, circular plasmid. The linear form also falls within the scope of the invention.

Each plasmid comprises a promoter able to ensure, in the host cells, the expression of the polynucleotide inserted under its dependency. In general, it is a strong eukaryote promoter.
The preferred strong eukaryote promoter is the early cytomegalovirus promoter (CMV-IE) of human or murine origin, or optionally having another origin such as the rat or guinea pig. The CMV-IE promoter can comprise the actual promoter part, which may or may not be associated with the enhancer part. Reference can be made to EP-A-260 148, EP-A-323 597, US-A-5 168 062, US-A-5 385 839, US-A-4 968 615, WO-A-87/03905. Preference is given to human CMV-IE (Boshart M. et al., Cell., 1985,41, 521-530) or murine CMV-IE.

In more general terms, the promoter has either a viral ore cellular origin.
Astrong viral promoter other than CMV-IE is the early/late promoter of the SV40 virus or the LTR promoter of the Rous sarcoma virus. A
strong cellular promoter is the promoter'of a gene of the cytoskeleton, such as e.g. the desmin promoter (Kwissa M. et al., Vaccine, 2000, 18 (22), 2337-2344), or the actin promoter (Miyazaki J. et aL, Gene, 1989, 79 (2), 269-277).

By equivalence, the sub-fragments of these promoters, maintaining an adequate promoting activity are included within the present invention, e.g. truncated CMV-IE promoters according to WO-A-98/00166. The notion of the promoter according to the invention consequently includes derivatives and sub-fragments maintaining an adequate promoting activity, preferably substantially similar to that of the actual promoter from which they are derived. For CMV-IE, this notion comprises the actual promoter part and/or the enhancer part, as well as derivatives and sub-fragments.

Preferably, the plasmids comprise other expression control elements. It is in particular advantageous to incorporate stabilizing sequences of the intron type, preferably intron If of the rabbit {3-globin gene (van Ooyen et al., Science, 1979, 206: 337-344).

As the polyadenylation signal (polyA) for the plasmids and viral vectors other than poxviruses, use can more particularly be made of the one of the bovine growth hormone (bGH) gene (US-A-5 122 458), the one of the rabbit R-globin gene or the one of the SV40 virus.

The other expression control elements usable in plasmids can also be used in herpes virus expression vectors.

According to another embodiment of the invention, the expression vectors are expression vectors used for the in vitro expression of proteins in an appropriate cell system. The proteins can be harvested in the culture supernatant after or not after secretion (if there Is no secretion a cell lysis is done), optionally concentrated by conventional concentration methods, particularly by ultrafiltration and/or purified by conventional purification means, particularly affinity, ion exchange or gel filtration-type chromatography methods.

Production takes place by the transfection of mammal cells by plasmids, by replication of viral vectors on mammal cells or avian cells, or by Baculovirus replication (US-A-4 745 051;
Vialard J. et all., J. Virol., 1990 64 (1), 37-50; Verne A., Virology, 1988, 167, 56-71), e.g. Autographa californica Nuclear Polyhedrosis Virus AcNPV, on insect cells (e.g. Sf9 Spodoptera frugiperda cells, ATCC CRL 1711).
Mammal cells which can be used are in particular hamster cells (e.g. CHO or BHK-21) or monkey cells (e.g. COS or VERO). Thus, the invention also covers expression vectors incorporating a polynucleotide according to the invention, the thus produced WN proteins or fragments and the preparations containing the same.

Thus, the present invention also relates to WN protein-concentrated and/or purified preparations. When the polynucleotide encodes several proteins, they are cleaved, and the aforementioned preparations then contain cleaved proteins.

The present invention also relates to immunogenic compositions and vaccines against the WN virus comprising at least one in vivo expression vector according to the invention and a pharmaceutically acceptable excipient or vehicle and optionally an adjuvant.
The immunogenic composition notion covers any composition which, once administered to the target species, induces an immune response directed against the WN virus. The term vaccine is understood to mean a composition able to induce an effective protection. The target species are equines, canines, felines, bovines, porcines, birds, preferably the horse, dog, cat, pig and in the case of birds geese, turkeys, chickens and ducks and which by definition covers reproducing animals, egg-layers and meat animals.

The pharmaceutically acceptable vehicles or excipients are well known to the one skilled in the art. For example, it can be a 0.9% NaCl saline solution or a phosphate buffer. The pharmaceutically acceptable vehicles or excipients also cover any compound or combination of compounds facilitating the administration of the vector, particularly the transfection, and/or improving preservation.

The doses and dose volumes are defined hereinafter in the general description of immunization and vaccination methods.

5 The immunogenic compositions and vaccines according to the invention preferably comprise one or more adjuvants, particularly chosen from among conventional adjuvants. Particularly suitable within the scope of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS), particularly oligodeoxyribonucleotide sequences having one ore more non-methylated CpG units (Klinman D. M. et al., Proc. Natl. Acad.
Scl., USA, 1996, 93,2879-10 2883; WO-A1-98/16247), (3) an oil in water emulsion, particularly the SPT
emulsion described on p 147 of "Vaccine Design, The Subunit and Adjuvant Approach" published by M. Powell, M.
Newman, Plenum Press 1995, and the emulsion MF59 described on p 183 of the same work, (4) cation lipids containing a quaternary ammonium salt, (5) cytokins or (6) their combinations or mixtures.

The oil in water emulsion (3). which is particularly appropriate for viral vectors, can in particular be based on:
- light liquid paraffin oil (European pharmacopoeia type), - isoprenoid of such as squalane, squalene, - oil resulting from the oligomerization of alkenes, particularly isobutene or decene, - esters of acids or alcohols having a straight-chain alkyl group, - more particularly vegetable oils, ethyl oleate, propylene glycol, di(caprylate/caprate), glycerol tri(caprylate/caprate) and propylene glycol dioleate, - esters of branched, fatty alcohols or acids, particularly isostearic acid esters.

The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, particularly:
- esters of on the one hand sorbitan, mannide (e.g. anhydromannitol oleate), glycerol, polyglycerol or propylene glycol and on the other hand oleic, isostearic, ricinoleic or hydroxystearic acids, said esters being optionally ethoxylated, - polyoxypropylene-polyoxyethylene copolymer blocks, particularly Pluronic , especially L121.

Among the type (1) adjuvant polymers, preference is given to polymers of crosslinked acrylic or methacrylic acid, particularly crosslinked by polyalkenyl ethers of sugars or polyalcohols. These compounds are known under the name carbomer (Pharmeuropa, vol. 8, no. 2, June 1996). The one skilled in the art can also refer to US-A-2 909 462, which describes such acrylic polymers crosslinked by a polyhydroxyl compound having at least three hydroxyl groups, preferably no more than eight such groups, the hydrogen atoms of at least three hydroxyl groups being replaced by unsaturated, aliphatic radicals having at least two carbon atoms.
The preferred radicals are those containing 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals can also contain other substituents, such as methyl.
Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly suitable. They are in particular crosslinked by allyl saccharose or by allyl pentaerythritol. Among them particular reference can be made to Carbopol 974P, 934P and 971 P.

Among the maleic anhydride-alkenyl derivative copolymers, preference is given to EMA (Monsanto), which are straight-chain or crosslinked ethylene-maleic anhydride copolymers and they are e.g. crosslinked by divinyl ether. Reference can be made to J. Fields et al., Nature 186: 778-780, June 4, 1960.

With regards to their structure, the acrylic or methacrylic acid polymers and EMA are preferably formed by basic units having the following formula:

I

--- i -- CHH - i +HZ)y---COOH COOH

in which:
- R, and R2, which can be the same or different, represent H or CH3 - x = 0 or 1, preferably x = 1 - y= 1 or2,withx+y=2.

For EMA , x = 0 and y = 2 and for carbomers x = y = 1.

These polymers are dissolved in water or physiological salt solution (20 g/l NaCI) and the pH is adjusted to 7.3 to 7.4 by, soda, in order to give the adjuvant solution in which the expression vectors will be incorporated.
The polymer concentration in the final vaccine composition can range between 0.01 and 1.5% w/v, more particularly 0.05 to I% w/v and preferably 0.1 to 0.4% w/v.

The cationic lipids (4) containing a quaternary ammonium salt and which are particularly but not exclusively suitable for plasmids, are preferably those complying with the following formula:

C
R,-O-CHZ i H-CHZ i -RZ X
OR, CH3 in which R, is a saturated or unsaturated straight-chain aliphatic radical having 12 to 18 carbon atoms, R2 is another aliphatic radical containing 2 or 3 carbon atoms and X is an amine or hydroxyl group.

Among these cationic lipids, preference is given to DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propane ammonium ; WO-A-96/34109), preferably associated with a neutral lipid, preferably DOPE (dioleoyl-phosphatidyl-.ethanol amine; Behr J. P., 1994, Bioconjugate Chemistry, 5, 382-389) in order to form DMRIE-DOPE.
Preferably, the plasmid mixture with said adjuvant is formed extemporaneously and preferably, prior to its administration, the mixture formed in this way is given time to complex, e.g.
for between 10 and 60 minutes and in particular approximately 30 minutes.

When DOPE is present, the DMRIE:DOPE molar ratio is preferably 95:5 to 5:95, more particularly 1:1.

The DMRIE or DMRIE-DOPE adjuvant:plasmid weight ratio is between 50:1 and 1:10, particularly 10:1 and 1:5 and preferably 1:1 and 1:2.

The cytokin or cytokins (5) can be supplied in protein form to the composition or vaccine, or can be co-expressed in the host with the immunogen or immunogens. Preference is given to the co-expression of the cytokin or cytokins, either by the same vector as that expressing the immunogen, or by its own vector.

The cytokins can in particular be chosen from among: interleukin 18 (IL-18), interleukin 12 (IL-12), interleukin 15 (IL-15), MIP-1a (macrophage inflammatory protein Ia; Marshall E. et ai., Br. J. Cancer, 1997, 75 (12), 1715-1720), GM-CSF (Granulocyte-Macrophage Colony-Stimulating Factor). Particular reference is made to avian cytokins, particularly those of the chicken, such as c1L-18 (Schneider K. et al., J. Interferon Cytokine Res., 2000, 20 (10), 879-883), cIL-15 (Xin K. -Q. et at., Vaccine, 1999, 17, 858-866), and equine.
cytokins, particularly equine GM-CSF (WO-A-00177210). Preferably, use is made of cytokins of the species to be vaccinated.

WO-A-00/77210 describes the nucleotide sequence and the amino acid sequence corresponding to equine GM-CSF, the in vitro GM-CSF production and the construction of vectors (plasmids and viral vectors) permitting the in vivo equine GM-CSF expression. These proteins, plasmids and viral vectors can be used in immunogenic compositions and equine vaccines according to the invention.
For example, use can be made of the plasmid pJP097 described in example 3 of said earlier-dated application or use can be made of the teaching of the latter in order to produce other vectors or for the in vitro production of equine GM-CSF
and the incorporation of said vectors or said equine GM-CSF in immunogenic compositions or equine vaccines according to the invention.
The present invention also relates to immunogenic compositions and so-called subunit vaccines, incorporating the protein E and optionally one or more other proteins of the WN virus, particularly prM or M
and preferably produced by in vitro expression in the manner described hereinbefore, as well as a pharmaceutically acceptable vehicle or excipient.

The pharmaceutically acceptable vehicles or excipients are known to the one skilled in the art and can e.g.
be 0.9% NaCl saline solution or phosphate buffer.

The immunogenic compositions and subunit vaccines according to the invention preferably comprise one or more adjuvants, particularly chosen from among conventional adjuvants.
Particularly suitable within the scope of the present invention are (1) an acrylic or methacrylic acid polymer, a maleic anhydride and alkenyl derivative polymer, (2) an immunostimulating sequence (ISS), particularly an oligodeoxyribonucleotide sequence having one or more non-methylated CpG units (Klinman D. M. at al., Proc. Nati. Acad. Sci. USA, 1996, 93,2879-2883; WO-A1-98/16247), (3) an oil in water emulsion, particularly the emulsion SPT
described on p 147 of "Vaccine Design, The Subunit and Adjuvant Approach", published by M. Powell, M.
Newmann, Plenum Press 1995, and the emulsion MF59 described on p 183 of the same work, (4) a water in oil emulsion (EP-A-639 071), (5) saponin, particularly Quil-A, or (6) alumina hydroxide or an equivalent. The different types of adjuvants defined under 1), 2) and 3) have been described in greater detail herein before in connection with the expression vector-based vaccines.

The doses and dose volumes are defined hereinafter in connection with the general description of immunization and vaccination methods.

According to the invention, the vaccination against the WN virus can be combined with other vaccinations within the framework of vaccination programs, in the form of immunization or vaccination kits or in the form of immunogenic compositions and multivalent vaccines, i.e. comprising at least one vaccine component against the WN virus and at least one vaccine component against at least one other pathogenic agent. This also includes the expression by the same expression vector of genes of at least two pathogenic agents, including the WN virus.
The Invention also relates to a multivalent immunogenic composition or a multivalent vaccine against the WN virus and against at least one other pathogen of the target species, using the same in vivo expression vector containing and expressing at least one polynucleotide of the WN virus according to the invention and at least one polynucleotide expressing an immunogen of another pathogen.
The thus expressed "immunogen" is understood to mean a protein, glycoprotein, polypeptide, peptide, epitope or derivative, e.g. fusion protein, inducing an immune response, preferably of a protective nature.
As was stated hereinbefore, these multivalent compositions or vaccines also comprise a pharmaceutically acceptable vehicle or excipient, and optionally an adjuvant.

The invention also relates to a multivalent immunogenic composition or a multivalent vaccine comprising at least one in vivo expression vector in which at least one polynucleotide of the WN virus is inserted and at least a second expression vector in which a polynucleotide encoding an immunogen of another pathogenic agent is inserted. As stated before, those multivalent compositions or vaccines also comprise a pharmaceutically acceptable vehicle or excipient, and optionally an adjuvant.

For the immunogenic compositions and multivalent vaccines, the other equine pathogens are more particularly chosen from among the group including viruses of equine rhinopneumonia EHV-1 and/or EHV-4 (and preferably there is a combination of immunogens of EHV-1 and EHV-4), equine influenza virus EIV, eastern encephalitis virus EEV, western encephalitis virus WEV, Venezuelan encephalitis virus VEV
(preference. is given to a combination of the three EEV, WEV and VEV), Clostridium tetani (tetanus) and their mixtures. Preferably, for EHV a choice is made of the genes gB and/or gD; for EIV the genes HA, NP
and/or N; for viruses of encephalitis C and/or E2; and for Clostridium tetani the gene encoding all or part of the subunit C of the tetanic toxin. This includes the use of polynucleotides encoding an immunologically active fragment or an epitope of said immunogen.

The other avian pathogens are more particularly chosen from among the group including viruses of the Marek's disease virus MDV (serotypes I and 2, preferably 1), Newcastle disease virus NDV, Gumboro disease virus IBDV, infectious bronchitis virus IBV, infectious anaemia virus CAV, infectious laryngotracheitis virus iLTV, encephalomyelitis virus AEV (or avian leukosis virus ALV), virus of hemorragic enteritis of turkeys (HEV), pneumovirosis virus (TRTV), fowl plague virus (avian influenza), chicken hydropericarditis virus, avian reoviruses, Escherichia coil, Mycoplasma gaiinarum, Mycoplasma gallisepticum, Haemophr7us avium, Pasteurella gallinarum, Pasteurella multocida gallicida, and mixtures thereof. Preferably, for MDV a choice is made of the genes gB and/or gD, for NDV the genes HN and/or F;
for IBDV the gene VP2; for IBV the genes S (more particularly S1), M and/or N;
for CAV the genes VPI
and/or VP2; for ILTV the genes gB and/or gD; for AEV the genes env and/or gag/pro; for HEV the genes 100K and hexon; for TRTV the genes F and/or G and for fowl plague the genes HA, N and/or NP. This includes the use of polynucleotides encoding an immunologically active fragment or an epitope of said immunogen.

By way of example, in a multivalent immunogenic composition or a multivalent vaccine according to the invention, to which an adjuvant has optionally been added in the manner described hereinbefore and which is intended for the equine species, it is possible to incorporate one or more of the plasmids described in WO-A-98103198 and particularly in examples 8 to 25 thereof, and those described in WO-A-00/77043 and which relate to the equine species, particularly those described in examples 6 and 7 thereof. For the avian species, it is e.g. possible to incorporate one or more of the plasmids described in WO-A1-98/03659, particularly in examples 7 to 27 thereof.
The immunogenic compositions or recombinant vaccines as described hereinbefore can also be combined with at least one conventional vaccine (inactivated, live attenuated, subunits) directed against at least one other pathogen.

In the same way, the immunogenic compositions and subunit vaccines according to the invention can form the object of combined vaccination. Thus, the invention also relates to multivalent immunogenic compositions and multivalent vaccines comprising one or more proteins according to the invention and one or more immunogens (the term immunogen having been defined hereinbefore) of at least one other 5 pathogenic agent (particularly from among the above list) and/or another pathogenic agent in inactivated or attenuated form. In the manner described hereinbefore, these multivalent vaccines or compositions also incorporate a pharmaceutically acceptable vehicle or exciplent and optionally an adjuvant.

The present invention also relates to methods for the immunization and vaccination of the target species 10 referred to hereinbefore.

These methods comprise the administration of an effective quantity of an immunogenic composition or vaccine according to the invention. This administration can more particularly take place by the parenteral route, e.g. by subcutaneous, intradermic or intramuscular administration, or by oral and/or nasal routes.

15 One or more administrations can take place, particularly two administrations.

The different vaccines can be injected by a needleless, liquid jet injector.
For plasmids it is also possible to use gold particles coated with plasmid and ejected in such a way as to penetrate the cells of the skin of the subject to be immunized (Tang et al., Nature 1992, 356, 152-154).
The immunogenic compositions and vaccines according to the invention comprise an effective expression vector or polypeptide quantity.

In the case of immunogenic compositions or vaccines based on plasmid, a dose consists in general terms about in 10 pg to about 2000 pg, particularly about 50 pg to about 1000 pg.
The dose volumes can be between 0.1 and 2 ml, preferably between 0.2 and 1 ml.

These doses and dose volumes are suitable for the vaccination of equines and mammals..

For the vaccination of the avian species, a dose is more particularly between about 10 .tg and about 500 gg and preferably between about 50 jig and about 200 pg. The dose volumes can in particular be between 0.1 and I mi, preferably between 0.2 and 0.5 mi.

The one skilled in the art has the necessary skill to optimize the effective plasmid dose to be used for each immunization or vaccination protocol and for defining the optimum administration route.

In the case of immunogenic compositions or vaccines based on poxviruses, a dose is in general terms between about 102 pfu and about 109 pfu.

For the equine species and mammals, when the vector is the vaccinia virus, the dose is more particularly between about 104 pfu and about 109 pfu, preferably between about 106 pfu and about 108 pfu and when the vector is thecanarypox virus, the dose is more particularly between about 106 pfu and about 109 pfu and preferably between about 1055 pfu or 106 pfu and about 108 pfu.
For the avian species, when the vector is the canarypox virus, the dose is more particularly between about 103 pfu and about 107 pfu, preferably between about 104 pfu and about 108 pfu and when the vector is the fowipox virus, the dose is more particularly between about 102 pfu and about 105 pfu, preferably between about 103 pfu and about 105 pfu.
In the case of immunogenic compositions or vaccines based on the viral vector other than poxviruses, particularly herpes viruses, a dose is generally between about 103 pfu and about 108 pfu. In the case of immunogenic compositions or avian vaccines a dose is generally between about 103 pfu and about 106 pfu.
In the case of immunogenic compositions or equine vaccines a dose is generally between about 106 pfu and about 108 pfu.

The dose volumes of the immunogenic compositions and equine vaccines based on viral vectors are generally between 0.5 and 2.0 mi, preferably between 1.0 and 2.0 mi, preferably 1.0 mi. The dose volumes of immunogenic compositions and avian vaccines based on viral vectors are generally between 0.1 and 1.0 ml, preferably between 0.1 and 0.5 ml and more particularly between 0.2 and 0.3 ml. Also in connection with such a vaccine, the one skilled in the art has the necessary competence to optimise the number of administrations, the administration route and the doses to be used for each immunization protocol. In particular, there are two administrations in the horse, e.g. at 35 day intervals.

In the case of immunogenic compositions or subunit vaccines, a dose comprises in general terms about 10 g to about 2000 g, particularly about 50 g to approximately 1000 j. g. The dose volumes of the immunogenic compositions and equine vaccines based on viral vectors are generally between 1.0 and 2.0 ml, preferably between 0.5 and 2.0 ml and more particularly 1.0 mi. The dose volumes of the immunogenic compositions and avian vaccines based on viral vectors are generally between 0.1 and 1.0 mi, preferably between 0.1 and 0.5 mi, and more particularly between 0.2 and 0.3 mi. Also for such a vaccine, the one skilled in the art has the necessary skill to optimise the number of administrations, the administration route and the doses to be used for each immunization protocol.

The invention also relates to the use of an in vivo expression vector or a preparation of vectors or polypeptides according to the invention for the preparation of an immunogenic composition or a vaccine intended to protect target species against the WN virus and possibly against at least one other pathogenic agent. The different characteristics indicated in the description are applicable to this object of the invention.
A vaccine based on plasmid or a viral vaccine expressing one or more proteins of the WN virus or a WN
subunit vaccine according to the present invention will not induce in the vaccinated animal the production of antibodies against other proteins of said virus, which are not represented in the immunogenic composition or vaccine. This feature can be used for the development of differential diagnostic methods making it possible to make a distinction between animals infected by the WN pathogenic virus and animals vaccinated with vaccines according to the invention. In the former, these proteins and/or antibodies directed against them are present and can be detected by an antigen-antibody reaction. This is not the case with the animals vaccinated according to the invention, which remain negative. In order to bring about this discrimination, use is made of a protein which is not represented in the vaccine (not present or not expressed), e.g. protein C or protein NS1, NS2A, NS2B or NS3 when it is not represented in the vaccine.

Thus, the present invention relates to the use of vectors, preparations and polypeptides according to the invention for the preparation of immunogenic compositions and vaccines making it possible to discriminate between vaccinated animals and infected animals.

It also relates to an immunization and vaccination method associated with a diagnostic method permitting such a discrimination.

The protein selected for the diagnosis or one of its fragments or epitopes is used as the antigen in the diagnostic test and/or is used for producing polyclonal or monoclonal antibodies. The one skilled in the art has sufficient practical knowledge to produce these antibodies and to implement antigens and/or antibodies in conventional diagnostic methods, e.g. ELISA tests.

The invention will now be described in greater detail using embodiments considered as non-(imitative examples.

Examples All the constructions are implemented using standard molecular biology methods (cloning, digestion by restriction enzymes, synthesis of a complementary single-strand DNA, polymerase chain reaction, elongation of an oligonucleotide by DNA polymerase...) described by Sambrook J. at at. (Molecular Cloning:
A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor. New York, 1989). All the restriction fragments used for the present invention, as well as the various polymerase chain reaction (PCR) are isolated and purified using the Geneclean kit (B10101 Inc. La Jolla, CA).

Example 1: Culture of the West Nile fever virus For their amplification, West Nile fever viruses NY99 (Lanciotti R. S. at al., Science, 1999, 286, 2333-7)) are cultured on VERO cells (monkey renal cells), obtainable from the American Type Culture Collection (ATCC) under no. CCL-81.

The VERO cells are cultured in 25 cm2 Falcon with eagle-MEM medium supplemented by 1 % yeast extracts and 10% calf serum containing approximately 100,000 cells/mi. The cells are cultured at +37 C under a 5%
CO2 atmosphere.

After three days the cellular layer reaches to confluence. The culture medium is then replaced by the eagle-MEM medium supplemented by 1 % yeast extracts and 0.1 % cattle serum albumin and the West Nile fever virus is added at a rate of 5 pfu/cell.

When the cytopathogenic effect (CPE) is complete (generally 48 to 72 hours after the start of culturing), the viral suspensions are harvested and then clarified by centrifugation and frozen at -70 C. In general, three to four successive passages are necessary for producing a viral batch, which is stored at -70 C.

Example 2: Extraction of viral RNA from the West Nile fever virus The viral RNA contained in 100 mi of viral suspension of the West Nile fever virus strain NY99 is extracted after thawing with solutions of the High Pure Viral RNA Kit Cat # 1 858 882, Roche Molecular Biochemicals, whilst following the instructions of the supplier for the extraction stages.
The RNA sediment obtained at the end of extraction is resuspended with I to 2 ml of RNase-free, sterile distilled water.

Example 3: Construction of plasmid pFC 101 The complementary DNA (ADNC) of the West Nile fever virus NY99 is synthesized with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions supplied by the manufacture.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) is carried out with 50 pl of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
CF101 (30 mer) (SEQ ID NO:1) 57TTITTGAATTCGTTACCCTCTCTAACTTC 3' and FC102 (33 mer) (SEQ ID NO:2) 5.11 T1Ti i CTAGATTACCTCCGACTGCGTCTTGA 3' This pair of oligonucleotides allows the incorporation of an EcoRl restriction site, a Xbal restriction site and a stop codon at 3' of the insert.
The synthesis of the first DNAc strand takes place by elongation of oligonucleotide FC102, following the hybridization of the latter with the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The conditions of the PCR reaction in the presence of the pair of oligonucleotides FC101 and FC102 area temperature of 95 C for 2 min, then 35 cycles (95 C for I
min, then 62 C for 1 min and 72 C for 2 min) and finally 72 C for 7 min to produce a 302 bp fragment.

This fragment is digested by EcoRl and then by Xbal in order to isolate, following agarose gel electrophoresis, the approximately 290 bp EcoRI-Xbal fragment, which is called fragment A.

The pVR1020 eukaryote expression plasmid (C. J. Luke et al. of Infectious Diseases, 1997, 175, 95-97) derived from the plasmid pVR1012 (fig. 1 and example 7 of WO-A-98/03199 -Hartikka J. et al., 1997, Human Gene Therapy, 7, 1205-1217), contains the frame encoding the signal sequence of the human tissue plasminogen activator (tPA).

A pVR1020 plasmid is modified by BamHI-BglIl digestion and insertion of a sequence containing several cloning sites (BamHI, NotI, EcoRl, Xbal, Pmll, Pstl, BgIII) and resulting from the hybridization of the following oligonucleotides.
BP326 (40 mer) (SEQ ID NO: 3) 5'GATCTGCAGCACGTGTCTTAGAGGATATCGAATTCGCGGCC 3' and BP329 (40 mer) (SEQ ID No: 4) 5'GATCCGCGGCCGCGAATTCGATATCCTCTAGACACGTGCT3' The thus obtained vector with a size of approximately 5105 base pairs (or bp) is called pABI 10.
Fragment A is ligatured with the pAB110 expression plasmid previously digested by Xbal and EcoRl, in order to give the plasmid pFC101 (5376 bp). Under the control of the early promoter of human cytomegalovirus or hCMV-IE (human Cytomegalovirus Immediate Early), said plasmid contains an insert encoding the signal sequence of the activator of tPA followed by. the sequence encoding the protein prM.
Example 4: Construction of plasmid pFC102 The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions provided by the supplier.

A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes place with 50 gl of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
FC103 (30 mer) (SEQ ID NO: 5) 57TTTT GAATTCTCACTGACAGTGCAGACA 3' and FC104 (33 mer) (SEQ ID NO: 6) 59 iii i I"CTAGATTAGCTGTAAGCTGGGGCCAC 3' This pair of oligonucleotides allows the incorporation of an EcoRl restriction site and a Xbal restriction site and a stop codon at 3' of the insert.

The first DNAc strand is synthesized by elongation of oligonucleotide FC104, following the hybridization of 5 the latter on the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The conditions of the PCR reaction in the presence of the pair of oligonucleotides FC103 and FC1 04 are a temperature of 95 C for 2 min, then 35 cycles (95 C for I min, then 62 C for 1 min 10 and 72 C for 2 min) and finally 72 C for 7 min to produce a 252 bp fragment.

This fragment is digested by EcoRl and then Xbal in order to isolate, following agarose gel electrophoresis, the approximately 240 bp EcoRI-Xbal fragment. This fragment is ligatured with the pAB110 expression plasmid (example 3) previously digested by Xbal and EcoRl in order to give the plasmid pFC102 (5326 bp).
15 Under the control of the early human cytomegalovirus or hCMV-IE (human Cytomegalovirus Immediate Early) promoter, this plasmid contains an insert encoding the signal sequence of the activator of tPA, followed by the sequence encoding the protein M.

Example 5: Construction of plasmid pFC103 The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions provided by the supplier.

A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes place with 50 l of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
FC105 (30 mer) (SEQ ID NO: 7) .
5'TTTTTGAATTCTTCAACTGCCTTGGAATG 3' and FC106 (33 mer) (SEQ ID NO: 8) 5' I T i f f CTAGATfAAGCGTGCACGTTCACGGA 3'.

This pair of oligonucleotides allows the incorporation of an EcoRl restriction site and a Xbal restriction site, together with a stop codon at 3' of the insert.

The synthesis of the first DNAc strand takes place by elongation of oligonucleotide FC106, following its hybridization with the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The PCR reaction conditions in the presence of the pair of oligonucleotides FC105 and FC106 are a temperature of 95 C for 2 min, then 35 cycles (95 C for 1 min, then 62 C for I min and 72 C for 2 min), and finally 72 C for 7 min for producing a 1530 bp fragment.

This fragment is digested by EcoRl and then by Xbal in order to isolate, following agarose gel electrophoresis, the approximately 1518 bp EcorRI-Xbal fragment. This fragment is ligatured with the pAB
110 expression plasmid (example 3) previously digested by Xbal and EcoRl in order to give the plasmid pFC103 (6604 bp). Under the control of the early promoter of human cytomegalovirus or hCMV-IE (human Cytomegalovirus Immediate Early), said plasmid contains an insert encoding the signal sequence of the activator of tPA, followed by the sequence encoding the protein E.
Example 6: Construction of plasmid pFC104 The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions provided by the supplier.

A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes place with 50 pi of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
FC101 (30 mer) (SEQ ID NO :1) and FC106 (33 mer) (SEQ ID NO :8) This pair of oligonucleotides allows the incorporation of an EcoRl restriction site, a Xbai restriction site and a stop codon at 3' of the insert.

Synthesis of the first DNAc strand takes place by elongation of oligonucleotide FC106, following its hybridization with the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The PCR reaction conditions in the presence of the pair of oligonucleotides FC101 and FC106 are a temperature of 95 C for 2 min, then 35 cycles (95 C for 1 min, then 62 C for 1 min and 72 C for 2 min) and finally 72 C for 7 min in order to produce a 2031 bp fragment.

This fragment is digested by EcoRI and then Xbal in order to isolate, following agarose gel electrophoresis, the approximately 2019 bp EcoRI-Xbal fragment. This fragment is ligatured with the pABI 10 expression plasmid (example 3), previously digested by Xbal and EcoRl in order to give the pFC104 plasmid (7105 bp).
Under the control of the early human cytomegalovirus promoter or hCMV-IE
(human Cytomegalovirus Immediate Early), said plasmid contains an insert encoding the signal sequence of the activator of tPA, followed by the sequence encoding the protein prM-M-E.

Example 7: Construction of plasmid pFC105 The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions provided by the supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes place with 50 gi of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
CF107 (36 mer) (SEQ ID NO :9) 57,TTTTTGATATCACCGGAATTGCAGTCATGATTGGC 3' and FC106 (33 mer) (SEQ ID NO :8).

This pair of oligonucleotides allows the incorporation of an EcoRV restriction site, a Xbal restriction site and a stop codon at 3' of the insert.

Synthesis of the first DNAc strand takes place by elongation of the FC106 oligonucleotide, following its hybridization with the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The PCR reaction conditions in the presence of the pair of oligonucleotides FC106 and FC107 are a temperature of 95 C for 2 min, then 35 cycles (95 C for I min, then 62 C for 1 min and 72 C for 2 min) and finally 72 C for 7 min in order to produce a 2076 bp fragment.

This fragment is digested by EcoRV and then Xbal in order to isolate, following agarose gel electrophoresis, the approximately 2058 bp EcoRV-Xbal fragment.
This fragment is ligatured with the pVR1012 expression plasmid, previously digested by Xbal and EcoRV, in order to give the plasmid pFC105 (6953 bp). Under the control of the early human cytomegalovirus promoter or hCMV-lE (human Cytomegalovirus Immediate Early), this plasmid contains an insert encoding the polyprotein prM-M-E.
Example 8: Construction of plasmid pFC106 The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions provided by the supplier.

A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes place with 50 pI of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
FC108 (36 mer) (SEQ ID NO :10) 5' I I L i i TGATATCATGTATAATGCTGATATGATTGAC 3' and FC109 (36 mer) (SEQ ID NO :11) 5'TTTTTfTCTAGATTAACGTiTTCCCGAGGCGAAGTC 3' This pair of oligonucleotides allows the incorporation of an EcoRV restriction site, a Xbal restriction site, an initiating ATG codon in 5' and a stop codon at 3' of the insert.

Synthesis of the first DNAc strand takes place by elongation of the oligonucleotide FC109, following its hybridization with the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The PCR reaction conditions in the presence of the pair of nucleotides FC108 and FC109 are a temperature of 95 C for 2 min, then 35 cycles (95 C for I min, 62 C for 1 min and then 72 C
for 2 min) and finally 72 C for 7 min to produce a 2973 bp fragment.

This fragment is digested by EcoRV and then Xbal in order to isolate, following agarose gel electrophoresis, the approximately 2955 bp EcoRV-Xbal fragment.

This fragment is ligatured with the pVR 1012 expression plasmid previously digested by Xbal and EcoRV in order to give the plasmid pFC106 (7850 bp). Under the control of the early human cytomegalovirus promoter or hCMV-IE (human Cytomegalovirus Immediate Early), this plasmid contains an insert encoding the polyprotein NS2A-NS2B-NS3.

Example 9: Construction of the donor plasmid for insertion in site C5 of the ALVAC canarypox virus Fig. 16 of US patent 5,756,103 shows the sequence of a genomic DNA 3199 bp fragment of the canarypox virus. Analysis of this sequence has revealed an open reading frame (ORF) called C51_, which starts at position 1538 and ends at position 1859. The construction of an insertion plasmid leading to the deletion of the ORF C5L and its replacement by a multiple cloning site flanked by transcription and translation stop signals was implemented in the following way.
A PCR reaction was performed on the basis of the matrix constituted by genomic DNA of the canarypox virus and with the following oligonucleotides:
C5A1 (42 mer) (SEQ ID NO :12):
5'ATCATCGAGCTCCAGCTGTAATTCATGGTCGAAAAGAAGTGC 3' and C5B1 (73 mer) (SEQ ID NO :13):
5'GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTGAGAGTACCACTrCAGCTA
CCTC 3' in order to isolate a 223 bp PCR fragment (fragment B).

A PCR reaction was carried out on the basis of the matrix constituted by genomic DNA of the canarypox virus and with the following oligonucleotides:
C5C1 (72 mer) (SEQ ID NO :14):
5'CCCGGGCTGCAGCTCGAGGAATTCTI'TTTATTGATTAACTAGTCATTATAAAGATCTAAAATGCATAAT
TTC 3' and C5D1 (45 mer) (SEQ ID NO :15):
5'GATGATGGTACCGTAAACAAATATAATGAAAAGTATTCTAAACTA3' in order to isolate a 482 bp PCR fragment (fragment C).

Fragments B and C were hybridized together in order to serve as a matrix for a PCR reaction performed with the oligonucleotides C5AI (SEQ ID NO :12) and C5DI (SEQ ID NO :15) in order to generate a 681 bp PCR
fragment. This fragment was digested by the restriction enzymes Sad and Kpnl in order to isolate, following agarose get electrophoresis, a 664 bp Sacl-Kpnl fragment. This fragment was ligatured with the bplueScript ti SK+ vector (Stratagene, La Jolla, USA, Cat # 2.12205), previously digested by the restriction enzymes Sacl and Kpnl, in order to give the piasmid pC5L. The sequence of this plasmid was verified by sequencing. This plasmid contains 166 bp of sequences upstream of ORF C5L
(left flanking arm C5), an early transcription stop vaccine signal, stop codons in 6 reading frames, a "multiple cloning site containing restriction sites Smal, Pstl, Xhol and EcoRl and finally 425 bp of sequences located downstream of ORF
C5L (right flanking arm C5).
The plasmid pMP528HRH (Perkus M. et al. J. Viral. 1989,63,3829-3836) was used as the matrix for amplifying the complete sequence of the vaccine promoter H6 (GenBank access no. M28351) with the following oligonucleotides:
JCA291 (34 mer) (SEQ ID NO :16) 5'AAACCCGGGTTCTT7ATTCTATACTfAAAAAGTG 3' and JCA292 (43 mer) (SEQ ID NO :17) 5'AAAAGAATTCGTCGACTACGATACAAACTTAACGGATATCGCG3' in order to amplify a 149 bp PCR fragment. This fragment was digested by restriction enzymes Smal and EcoRI in order to isolate, following agarose gel electrophoresis, a 138 bp Smal-EcoRl restriction fragment.
This fragment was then ligatured with the plasmid pC5L, previously digested by Smal and EcoRl, in order to give the plasmid pFC107.

Example 10: Construction of the recombinant virus vCP1712 A PCR reaction was performed using the plasmid pFC105 (example 7) as the matrix and the following oligonucleotides:
FC110 (33 mer (SEQ ID NO : 18):
5 I i 1 I CGCGAACCGGAATTGCAGTCATGATTGGC 3' and FC111 (39 mer) (SEQ ID NO : 19):
5TrrTGTCGACGCGGCCGCTTAAGCGTGCACGTTCACGGA 3' in order to amplify an approximately 2079 bp PCR fragment. This fragment was digested by restriction enzymes Nrul and Sall in order to isolate, following agarose gel electrophoresis, an approximately 2068 bp Nrul-Sall restriction fragment. This fragment was then ligatured with plasmid pFC107 (example 9) previously digested by restriction enzymes Nrui and Sail in order to give the piasmid pFC1 08.

Plasmid pFC108 was linearized by Noti, then transfected in primary chicken embryo cells infected with the canarypox virus (ALVAC strain) according to the previously described calcium phosphate precipitation method (Panicali et Paoletti Proc. Nat. Acad. Sci. 1982, 79, 4927-4931;
Piccini et al. In Methods in Enzymology, 1987, 153, 545-563, publishers Wu R. and Grossman L. Academic Press). Positive plaques 10 were selected on the basis of a hybridization with a radioactively labelled probe specific to the nucleotide sequence of the envelope glycoprotein E. These plaques underwent 4 successive selection/purification cycles until a pure population was isolated. A representative plaque corresponding to in vitro recombination between the donor piasmid pFC108 and the genome of the ALVAC canarypox virus was then amplified and the recombinant virus stock obtained was designated vCP1712.
Example 11: Construction of the recombinant virus vCP1713 Plasmid pFC104 (example 6) was digested by the restriction enzyme Sail and Pmll in order to isolate, following agarose gel electrophoresis, an approximately 2213 bp Pmil-Sail restriction fragment. This fragment was ligatured with piasmid pFC107 (example 9) previously digested by the Nrul and Sall restriction enzymes in order to give the plasmid pFC109.

Plasmid pFC1 09 was linearized by Noti, then transfected in primary chicken embryo cells infected with the canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque corresponding to in vitro recombination between the donor plasmid pFC109 and the genome of the ALVAC
canarypox virus was selected on the basis of a hybridization of a radioactively labelled probe specific to the nucleotide sequence of the envelope glycoprotein E and was then amplified. The recombinant virus stock obtained was designated vCP1713.

Example 12: Construction of the recombinant virus vCP1714 Plasmid pFC103 (example 5) was digested by the Sall and Pmll restriction enzymes in order to isolate, following agarose gel electrophoresis, an approximately 1712 bp Pmll-Sall restriction fragment. This fragment was ligatured with the plasmid pFC107 (example 9) previously digested by the Nrul and Sall restriction enzymes in order to give the piasmid pFC110.

Plasmid pFC110 was linearized by Nod, then transfected in primary chicken embryo cells infected with the canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque corresponding to in vitro recombination between the donor plasmid pFC110 and the genome of the ALVAC
canarypox virus was selected on the basis of a hybridization with a radioactively labelled probe specific to the nucleotide sequence of the envelope glycoprotein E and was then amplified.
The recombinant virus stock obtained was then designated vCPI 714.

Example 13: Construction of the recombinant virus vCP1715 Plasmid pFC102 (example 4) was digested by the Sall and Pmll restriction enzymes in order to isolate, following agarose gel electrophoresis, an approximately 434 bp Pmll-Sall restriction fragment. This fragment was ligatured with the plasmid pFC107 (example 9) previously digested by the Nrul and Sall restriction enzymes to give the plasmid pFC1 11.
Plasmid pFC111 was linearized by Noti, then transfected in primary chicken embryo cells infected with the canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque corresponding to in vitro recombination between the donor plasmid pFC111 and the genome of the ALVAC
canarypox virus was selected on the basis of hybridization with a radioactively labelled probe specific to the nucleotide sequence of the membrane M glycoprotein and was then amplified. The recombinant virus stock obtained was designated vCP1715.

Example 14: Construction of the recombinant virus vCPI716 Plasmid pFC101 (example 3) is digested by the Sall and Pmll restriction enzymes in order to isolate, following agarose gel electrophoresis, an approximately 484 bp Pmlt-Salt restriction fragment. This fragment is ligatured with the plasmid pFC107 (example 9) previously digested by the Nrul and Sall restriction enzymes to give the plasmid pFCI 12.

Plasmid pFC112 was linearized by Noti and then transfected in primary chicken embryo cells infected with the canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque corresponding to in vitro recombination between the donor plasmid pFC112 and the genome of the ALVAC
canarypox virus was selected on the basis of a hybridization with a radioactively labelled probe specific to the nucleotide sequence of the pre-membrane prM glycoprotein and was then amplified. The recombinant virus stock obtained was designated vCP1716.

Example 15: Construction of the donor plasmid for insertion in site C6 of the ALVAC canarypox virus Fig. 4 of WO-A-01/05934 shows the sequence of a 3700 bp genomic DNA fragment of the canarypox virus.
Analysis of this sequence revealed an open reading frame (ORF) called CM, which starts at position 377 and ends at position 2254. The construction of an insertion plasmid leading to the deletion of the ORF C6L
and its replacement by a multiple cloning site flanked by transcription and translation stop signals was implemented in the following way.

A PCR reaction was performed on the basis of the matrix constituted by the genomic DNA of the canarypox virus and with the following oligonucleotides:
C6AI (42 mer) (SEQ ID NO :20):
5'ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT 3' and C6B1 (73 mer) (SEQ ID NO :21):
5'GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGTAAGTAAGTATTT TATT
TAA 3' to isolate a 432 bp PCR fragment (fragment D).

A PCR reaction was performed on the basis of the matrix constituted by the genomic DNA of the canarypox virus and with the following oligonucleotides:
C6C1 (72 mer) (SEQ ID NO :22):
5'CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTATATATAATTGAAAAAG
TAA 3' and C6DI (45 mer) (SEQ ID NO :23):
5'GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG 3' to isolate a 1210 bp PCR fragment (fragment E).

Fragments D and E were hybridized together to serve as a matrix for a PCR
reaction performed with the oligonucleotides C6A1 (SEQ ID NO :20) and C6D1 (SEQ ID NO :23) to generate a 1630 bp PCR fragment.
This fragment was digested by the Sacl and Kpnl restriction enzymes to isolate, after agarose gel electrophoresis, a 1613 bp Sacl-Kpnl fragment. This fragment was ligatured with the bplueScript II SK+
vector (Stratagene, La Jolla, CA, USA, Cat # 212205) previously digested by the Sac[ and Kpnl restriction enzymes to give the plasmid pC6L. The sequence of this plasmid was verified by sequencing. Said plasmid contains 370 bp of sequences upstream of ORF C6L (C6 left flanking arm), an early transcription stop vaccinia signal, stop codons in the six reading frames, a multiple cloning site containing the Smal, Pstl, Xhol and EcoRl restriction sites and finally 1156 bp of sequences downstream of the ORF C6L (C6 right flanking arm).

Plasmid pMPIVC (Schmitt J. F. C. et al., J. Viral., 1988, 62, 1889-1897, Saiki R. K. et al., Science, 1988, 239, 487-491) was used as the matrix for amplifying the complete sequence of the I3L vaccine promoter with the following oligonucleotides:
FC1 12 (33 mer) (SEQ ID NO :24):
5'AAACCCGGGCGGTGGTTTGCGATTCCGAAATCT3' and FC113 (43 mer) (SEQ ID NO :25):
5'AAAAGAATTCGGATCCGATTAAACCTAAATAATTGTACTTTGT3' to amplify a 151 bp PCR fragment. This fragment was digested by the Smal and EcoRl restriction enzymes in order to isolate, following agarose get electrophoresis, an approximately 136 bp Smal-EcoRl restriction fragment. This fragment was then ligatured with plasmid pC6L previously digested by Smal and EcoRl to give the plasmid pFC113.

Example 16: Construction of recombinant viruses vCP1717 and vCP1718 A PCR reaction was performed using the plasmid pFC106 (example 8) as the matrix and the following oligonucleotides:
FC114 (33 mer) (SEQ ID NO :26):
5'TTTCACGTGATGTATAATGCTGATATGATTGAC3 and FC115 (42 mer) (SEQ ID NO :27):
57TTTGGATCCGCGGCCGCTTAACGTTTTCCCGAGGCGAAGTC 3' to amplify an approximately 2973 bp PCR fragment. This fragment was digested with the Pmll and BamHl restriction enzymes to isolate, following agarose gel electrophoresis, the approximately 2958 bp Pmll-BamHl restriction fragment (fragment F). Plasmid pFC1 13 (example 15) was digested by the PmlI and BamHI
restriction enzymes to isolate, following agarose gel electrophoresis, the approximately 4500 bp Pmll-BamHl restriction fragment (fragment G). Fragments F and G were then ligatured together to give the plasmid pFC114.

Plasmid pFC114 was linearized by Nod, then transfected in primary chicken embryo cells infected with canarypox virus vCP1713 (example 11) according to the previously described calcium phosphate precipitation method (Panicali et Paoletti Proc. Nat. Acad. Sci. 1982, 79, 4927-4931; Piccini at al. In Methods in Enzymology, 1987, 153, 545-563, publishers Wu R. and Grossman L. Academic Press). Positive plaques were selected on the basis of a hybridization with a radioactively labelled probe specific to the nucleotide sequence of envelope glycoprotein E. These ranges underwent four successive selection/purification cycles of the ranges until a pure population was isolated. A representative plaque corresponding to in vitro recombination between the donor plasmid pFC1 14 and the genome of the ALVAC
canarypox virus was then amplified and the recombinant virus stock obtained was designated vCP1717.

The Notl-linearized pFC1 14 plasmid was also used for transfecting primary chicken embryo cells infected with the vCP1 712 canarypox virus (example 10) using the procedure described hereinbefore. The thus obtained recombinant virus stock was designated vCP1718.
Example 17: Construction of plasmid pFC115 The complementary DNA (DNAc) of the West Nile fever virus NY99 was synthesized with Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions provided by the supplier.

A reverse transcriptase polymerase chain reaction (RT-PCR reaction) was carried out with 50 pi of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the following oligonucleotides:
FC116 (39 mer) (SEQ ID NO :28) 57TTTTTGATATCATGACCGGAATTGCAGTCATGATTGGC 3' and FC106 (33 mer) (SEQ ID NO :8).

This pair of oligonucleotides makes it possible to incorporate an EcoRV
restriction site, a Xbal restriction site, an initiator code at 5' and a stop code at 3' of the insert.
Synthesis of the first DNAc strand takes place by elongation of the oligonucleotide FC106, following its hybridization with the RNA matrix.

The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min and finally 4 C for 5 min. The conditions of the PCR reaction in the presence of the pair of oligonucleotides FC 106 and FC116 are a temperature of 95 C for 2 min, then 35 cycles (95 C for I min, 62 C for 1 min and then 72 C for 2 min) and finally 72 C for 7 min to produce a 2079 bp fragment.

This fragment is digested by EcoRV and then Xbal to isolate, following agarose gel electrophoresis, the approximately 2061 bp EcoRV-Xbal fragment.

This fragment is ligatured with the pVR1 012 expression plasmid previously digested by Xbal and EcoRV to give the plasmid pFC1 15 (6956 bp). Under the control of the early human cytomegalovirus promoter or hCMV-IE (human Cytomegalovirus Immediate Early), this plasmid contains an insert encoding the polyprotein prM-M-E.

Example 18: Construction of the recombinant viruses vCP2017 A PCR reaction was carried out using the plasmid pFC115 (example 17) as the matrix and the following oligonucleotides:
FC117 (36 mer) (SEQ ID NO :29):
5T fTTCGCGAATGACCGGAATTGCAGTCATGATTGGC3' and FC111 (39 mer) (SEQ ID NO :19) to amplify an approximately 2082 bp PCR fragment. This fragment was digested by Nrul and Sall restriction enzymes to isolate, after agarose gel electrophoresis, an approximately 2071 bp Nrl-Sall restriction fragment. This fragment was then ligatured with plasmid pFC107 (example 9) previously digested by the Nrul and Sail restriction enzymes to give the plasmid pFC1 16.

Plasmid pFC116 was linearized by Notl and then transfected in primary chicken embryo cells infected with canarypox virus (ALVAC strain) using the procedure of example 10. A
representative plaque corresponding to in vitro recombination between the donor plasmid pFC1 16 and the genome of the ALVAC canarypox virus was selected on the basis of a hybridization with a radioactively labelled probe specific to the nucleotide sequence of the envelope glycoprotein E and was then amplified. The recombinant virus stock obtained was designed vCP2017.

Example 19: Production of recombinant vaccines For the preparation of equine vaccines, the recombinant canarypox vCP1712 virus (example 10) is adjuvanted with carbomer solutions, namely CarbopolTM974P manufactured by BF
Goodrich, Ohio, USA
5 (molecular weight about 3,000,000).

A 1.5% CarbopolTM974P stock solution is initially prepared in distilled water containing 1 g/l of sodium chloride. This stock solution is then used for the preparation of a 4 mg/ml CarbopolTM974P solution in physiological salt solution. The stock solution is mixed.with the adequate volume of said physiological salt 10 solution, either in a single stage or in several successive stages, the pH
value being adjusted in each stage with a 1 N sodium hydroxide solution (or even more concentrated) in order to obtain a final pH value of 7.3 to 7.4.

The ready-to-use CarbopolTM974P solution obtained in this way is used for taking up recombinant, 15 lyophilized viruses or for diluting concentrated, recombinant virus stock solutions. For example, to obtain a viral suspension containing 108 pfu/1 ml dose, a viral stock solution is diluted so as to obtain a titer of 108'3 pfu/ml, followed by dilution in equal parts with said ready-to-use 4 mg/ml CarbopolTM974P solution.
Recombinant vaccines can also be produced with recombinant canarypox viruses vCP1713 (example 11) or 20 vCP1717 (example 16) or vCP1718 (example 16) or vCP2017 (example 18) or a mixture of three canarypox viruses vCP1714 (example 12), vCP1715 (example 13) and vCP1716 (example 14) according to the procedure described hereinbefore.

Example 20: Production of DNA vaccines for equines An DNA solution containing the plasmid pFC104 (example 6) is concentrated by ethanolic precipitation in the manner described by Sambrook et al (1989). The DNA sediment is taken up by a 0.9% NaCl solution so as to obtain a concentration of 1 mg/ml. A 0.75 mM DMRIE-DOPE solution is prepared by taking up a DMRIE-DOPE lyophilizate by a suitable sterile H2O volume.
The formation of plasmid-lipid DNA complexes is brought about by diluting in equal parts the 0.75 mM
DMRIE-DOPE solution (1:1) with the I mg/ml DNA solution in 0.9% NaCl. The DNA
solution is progressively introduced with the aid of a 26G crimped needle along the wall of the flask containing the cationic lipid solution so as to prevent the formation of foam. Gentle stirring takes place as soon as the two solutions have mixed. Finally a composition comprising 0.375 mM of DMRIE-DOPE
and 500 g/ml plasmid is obtained.

It is desirable for all the solutions used to be at ambient temperature for all the operations described hereinbefore. DNA/DMRIE-DOPE complexing takes place at ambient temperature for 30 minutes before immunizing the animals.

31, DNA vaccines can also be produced with DNA solutions containing plasmids pFC104 (example 6) and pFC106 (example 8) or containing plasmids pFC105 (example 7) and pFC106, plasmids pFC115 (example 17) and pFC106, or containing plasmid pFC101, pFC102 and pFC103 (examples 3 to 5), or containing plasmid pFC105 or pFC1 15 according to the procedure described in the present example.
Example 21: In vitro expression tests The expression of WN proteins is tested for each construction by conventional indirect immunofluorescence and Western Blot methods.

These tests are carried out on 96 well plates containing CHO cells cultured in monolayers and transfected by plasmids or containing CEF cells cultured in monolayers and infected by recombinant viruses.

The WN proteins are detected by the use of infected chicken or horse sera and of labelled anti-sera.
The size of the fragments obtained after migration on agarose gel is compared with those expected.
Example 22: Effectiveness on animals The recombinant vaccines and plasmid vaccines are injected twice at approximately two week intervals into approximately seven day old, unvaccinated SPF chickens by the intramuscular route and in a volume of approximately 0.1 mi. An unvaccinated control group is included in the study.

The chickens are challenged by subcutaneous administration into the neck of I034TCID50 of pathogenic WN virus.

Virernia, antibody response and mortality are observed. Autopsies are carried out to observe lesions.
Example 23: Titration anti-WNV neutralizing antibodies Dilution series are produced for each serum at a rate of 3 in DMEM medium to which was added 10% fetal calf serum in 96 well plates of the cellular culture type. To 0.05 ml of diluted serum is added 0.05 mi of culture medium containing approximately 100 CCIP50Iml of WNV. This mixture is incubated for 2 hours at 37 C in an oven in an atmosphere containing 5% C02.

0.15 mi of a suspension of VERO cells containing approximately 100,000 cells/ml was then added to each mixture. The cytopathic effect (CPE) was observed by phase contrast microscopy after 4 to 5 days culturing at 37 C in an atmosphere containing 5% CO2. The neutralizing titers of each serum are calculated using the Karber method. The titers are given in the form of the largest dilution inhibiting the cytopathic effect for 50%

of the wells. The titers are expressed in log10 VN50. Each serum is titrated at least twice and preferably four times.

Example 24: Test on horses of vCP2017 Recombinant vaccines containing vCP2017 (example 18) formulated extemporaneously with 1 ml of Carbopol 974P adjuvant (4 mg/ml) were injected twice at 35 day intervals into horses aged more than three months and which had not been previously vaccinated, using the intramuscular route and a volume of approximately I ml. Three groups of animals were vaccinated, with doses of 10'ICCID50 (i.e. 105*64pfu) for group 1, 108'8CCID50 (i.e.108-' pfu) for group 2 and 107'8CCID50 (i.e. 107.64 pfu) for group 3. An unvaccinated control group was included in the study.

The serology was observed. The neutralizing antibody titers were established and expressed in logI 0 VN50, as indicated in example 23.

Group Titers at day 0 Titers at day 35 Titers at day 49 1 < 0.6 < 0.78 2.66 2 < 0.6 1.14 2.58 3 <0.6 1.16 2.26 control < 0.6 < 0.6 < 0.6 SEQUENCE LISTING IN ELECTRONIC FORM

In accordance with Section 111(1) of the Patent Rules, this description contains a sequence listing in electronic form in ASCII text format (file: 51440-28 Seq v2.txt).

A copy of the sequence listing in electronic form is available from the Canadian Intellectual Property Office.

The sequences in the sequence listing in electronic form are reproduced in the following table.

SEQUENCE TABLE

<110> Merial Limited LOOSMORE, SHEENA MAY
MINKE, JULES MAARTEN
AUDONNET, JEAN-CHRISTOPHE FRANCIS

<120> RECOMBINANT VACCINE AGAINST WEST NILE VIRUS
<130> MER FLH3161 <140> WO PCT/FR02/01200 <141> 2002-04-05 <150> FR 01/04737 <151> 2001-04-06 <160> 31 <170> Patentln Ver. 3.2 <210> 1 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 1 ttttttgaat tcgttaccct ctctaacttc 30 <210> 2 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2 tttttttcta gattacctcc gactgcgtct tga 33 <210> 3 <211> 40 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 3 gatctgcagc acgtgtctag aggatatcga attcgcggcc 40 <210> 4 <211> 40 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 4 gatccgcggc cgcgaattcg atatcctcta gacacgtgct 40 <210> 5 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 5 ttttttgaat tctcactgac agtgcagaca 30 <210> 6 <211> 33 <212> DNA
<213> Artificial Sequence <220>
5 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 6 tttttttcta gattagctgt aagctggggc cac 33 <210> 7 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 7 ttttttgaat tcttcaactg ccttggaatg 30 <210> 8 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 8 tttttttcta gattaagcgt gcacgttcac gga 33 <210> 9 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 9 ttttttgata tcaccggaat tgcagtcatg attggc 36 <210> 10 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 10 ttttttgata tcatgtataa tgctgatatg attgac 36 <210> 11 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 11 tttttttcta gattaacgtt ttcccgaggc gaagtc 36 <210> 12 <211> 42 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 12 atcatcgagc tccagctgta attcatggtc gaaaagaagt gc 42 <210> 13 <211> 73 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 13 gaattcctcg agctgcagcc cgggttttta tagctaatta gtcatttttt gagagtacca 60 cttcagctac ctc 73 <210> 14 <211> 72 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 14 cccgggctgc agctcgagga attcttttta ttgattaact agtcattata aagatctaaa 60 atgcataatt tc 72 <210> 15 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 15 gatgatggta ccgtaaacaa atataatgaa aagtattcta aacta 45 <210> 16 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 16 aaacccgggt tctttattct atacttaaaa agtg 34 <210> 17 <211> 43 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 17 aaaagaattc gtcgactacg atacaaactt aacggatatc gcg 43 <210> 18 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 18 ttttcgcgaa ccggaattgc agtcatgatt ggc 33 <210> 19 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 19 ttttgtcgac gcggccgctt aagcgtgcac gttcacgga 39 <210> 20 <211> 42 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 20 atcatcgagc tcgcggccgc ctatcaaaag tcttaatgag tt 42 <210> 21 <211> 73 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 21 gaattcctcg agctgcagcc cgggttttta tagctaatta gtcatttttt cgtaagtaag 60 tatttttatt taa 73 <210> 22 <211> 72 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 22 cccgggctgc agctcgagga attcttttta ttgattaact agtcaaatga gtatatataa 60 ttgaaaaagt as 72 <210> 23 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 23 gatgatggta ccttcataaa tacaagtttg attaaactta agttg 45 <210> 24 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 24 aaacccgggc ggtggtttgc gattccgaaa tct 33 <210> 25 <211> 43 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 25 aaaagaattc ggatccgatt aaacctaaat aattgtactt tgt 43 <210> 26 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide 5 <400> 26 tttcacgtga tgtataatgc tgatatgatt gac 33 <210> 27 10 <211> 42 <212> DNA
<213> Artificial Sequence <220>
15 <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 27 ttttggatcc gcggccgctt aacgttttcc cgaggcgaag tc 42 <210> 28 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 28 ttttttgata tcatgaccgg aattgcagtc atgattggc 39 <210> 29 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 29 ttttcgcgaa tgaccggaat tgcagtcatg attggc 36 <210> 30 <211> 11029 <212> DNA
<213> West Nile virus <220>
<221> CDS
<222> (97)..(10395) <400> 30 agtagttcgc ctgtgtgagc tgacaaactt agtagtgttt gtgaggatta acaacaatta 60 acacagtgcg agctgtttct tagcacgaag atctcg atg tct aag aaa cca gga 114 Met Ser Lys Lys Pro Gly ggg ccc ggc aag agc cgg get gtc aat atg cta aaa cgc gga atg ccc 162 Gly Pro Gly Lys Ser Arg Ala Val Asn Met Leu Lys Arg Gly Met Pro cgc gtg ttg tcc ttg att gga ctg aag agg get atg ttg agc ctg atc 210 Arg Val Leu Ser Leu Ile Gly Leu Lys Arg Ala Met Leu Ser Leu Ile gac ggc aag ggg cca ata cga ttt gtg ttg get ctc ttg gcg ttc ttc 258 Asp Gly Lys Gly Pro Ile Arg Phe Val Leu Ala Leu Leu Ala Phe Phe agg ttc aca gca att get ccg acc cga gca gtg ctg gat cga tgg aga 306 Arg Phe Thr Ala Ile Ala Pro Thr Arg Ala Val Leu Asp Arg Trp Arg ggt gtg aac aaa caa aca gcg atg aaa cac ctt ctg agt ttt aag aag 354 Gly Val Asn Lys Gln Thr Ala Met Lys His Leu Leu Ser Phe Lys Lys gaa cta ggg acc ttg acc agt get atc aat cgg cgg agc tca aaa caa 402 Glu Leu Gly Thr Leu Thr Ser Ala Ile Asn Arg Arg Ser Ser Lys Gln aag aaa aga gga gga aag acc gga att gca gtc atg att ggc ctg atc 450 Lys Lys Arg Gly Gly Lys Thr Gly Ile Ala Val Met Ile Gly Leu Ile gcc agc gta gga gca gtt acc ctc tct aac ttc caa ggg aag gtg atg 498 Ala Ser Val Gly Ala Val Thr Leu Ser Asn Phe Gln Gly Lys Val Met atg acg gta aat get act gac gtc aca gat gtc atc acg att cca aca 546 Met Thr Val Asn Ala Thr Asp Val Thr Asp Val Ile Thr Ile Pro Thr get gut gga aag aac cta tgc att gtc aga gca atg gat gtg gga tac 594 Ala Ala Gly Lys Asn Leu Cys Ile Val Arg Ala Met Asp Val Gly Tyr atg tgc gat gat act atc act tat gaa tgc cca gtg ctg tcg get ggt 642 Met Cys Asp Asp Thr Ile Thr Tyr Glu Cys Pro Val Leu Ser Ala Gly aat gat cca gaa gac atc gac tgt tgg tgc aca aag tca gca gtc tac 690 Asn Asp Pro Glu Asp Ile Asp Cys Trp Cys Thr Lys Ser Ala Val Tyr gtc agg tat gga aga tgc acc aag aca cgc cac tca aga cgc agt cgg 738 Val Arg Tyr Gly Arg Cys Thr Lys Thr Arg His Ser Arg Arg Ser Arg agg tca ctg aca gtg cag aca cac gga gaa agc act cta gcg aac aag 786 Arg Ser Leu Thr Val Gln Thr His Gly Glu Ser Thr Leu Ala Asn Lys aag ggg get tgg atg gac agc acc aag gcc aca agg tat ttg gta aaa 834 Lys Gly Ala Trp Met Asp Ser Thr Lys Ala Thr Arg Tyr Leu Val Lys aca gaa tca tgg atc ttg agg aac cct gga tat gcc ctg gtg gca gcc 882 Thr Glu Ser Trp Ile Leu Arg Asn Pro Gly Tyr Ala Leu Val Ala Ala gtc att ggt tgg atg ctt ggg agc aac acc atg cag aga gtt gtg ttt 930 Val Ile Gly Trp Met Leu Gly Ser Asn Thr Met Gln Arg Val Val Phe gtc gtg cta ttg ctt ttg gtg gcc cca get tac agc ttc aac tgc ctt 978 Val Val Leu Leu Leu Leu Val Ala Pro Ala Tyr Ser Phe Asn Cys Leu gga atg agc aac aga gac ttc ttg gaa gga gtg tct gga gca aca tgg 1026 Gly Met Ser Asn Arg Asp Phe Leu Glu Gly Val Ser Gly Ala Thr Trp gtg gat ttg gtt ctc gaa ggc gac agc tgc gtg act atc atg tct aag 1074 Val Asp Leu Val Leu Glu Gly Asp Ser Cys Val Thr Ile Met Ser Lys gac aag cct acc atc gat gtg aag atg atg aat atg gag gcg gcc aac 1122 Asp Lys Pro Thr Ile Asp Val Lys Met Met Asn Met Glu Ala Ala Asn ctg gca gag gtc cgc agt tat tgc tat ttg get acc gtc agc gat ctc 1170 Leu Ala Glu Val Arg Ser Tyr Cys Tyr Leu Ala Thr Val Ser Asp Leu tcc acc aaa get gcg tgc ccg acc atg gga gaa get cac aat gac aaa 1218 Ser Thr Lys Ala Ala Cys Pro Thr Met Gly Glu Ala His Asn Asp Lys cgt get gac cca get ttt gtg tgc aga caa gga gtg gtg gac agg ggc 1266 Arg Ala Asp Pro Ala Phe Val Cys Arg Gln Gly Val Val Asp Arg Gly tgg ggc aac ggc tgc gga cta ttt ggc aaa gga agc att gac aca tgc 1314 Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys Gly Ser Ile Asp Thr Cys gcc aaa ttt gcc tgc tct acc aag gca ata gga aga acc atc ttg aaa 1362 Ala Lys Phe Ala Cys Ser Thr Lys Ala Ile Gly Arg Thr Ile Leu Lys gag aat atc aag tac gaa gtg gcc att ttt gtc cat gga cca act act 1410 Glu Asn Ile Lys Tyr Glu Val Ala Ile Phe Val His Gly Pro Thr Thr gtg gag tcg cac gga aac tac tcc aca cag gtt gga gcc act cag gca 1458 Val Glu Ser His Gly Asn Tyr Ser Thr Gln Val Gly Ala Thr Gln Ala ggg aga ttc agc atc act cct gcg gcg cct tca tac aca cta aag ctt 1506 Gly Arg Phe Ser Ile Thr Pro Ala Ala Pro Ser Tyr Thr Leu Lys Leu gga gaa tat gga gag gtg aca gtg gac tgt gaa cca cgg tca ggg att 1554 Gly Glu Tyr Gly Glu Val Thr Val Asp Cys Glu Pro Arg Ser Gly Ile gac acc aat gca tac tac gtg atg act gtt gga aca aag acg ttc ttg 1602 Asp Thr Asn Ala Tyr Tyr Val Met Thr Val Gly Thr Lys Thr Phe Leu gtc cat cgt gag tgg ttc atg gac ctc aac ctc cct tgg agc agt get 1650 Val His Arg Glu Trp Phe Met Asp Leu Asn Leu Pro Trp Ser Ser Ala gga agt act gtg tgg agg aac aga gag acg tta atg gag ttt gag gaa 1698 Gly Ser Thr Val Trp Arg Asn Arg Glu Thr Leu Met Glu Phe Glu Glu cca cac gcc acg aag cag tct gtg ata gca ttg ggc tca caa gag gga 1746 Pro His Ala Thr Lys Gln Ser Val Ile Ala Leu Gly Ser Gln Glu Gly get ctg cat caa get ttg get gga gcc att cct gtg gaa ttt tca agc 1794 Ala Leu His Gln Ala Leu Ala Gly Ala Ile Pro Val Glu Phe Ser Ser aac act gtc aag ttg acg tcg ggt cat ttg aag tgt aga gtg aag atg 1842 Asn Thr Val Lys Leu Thr Ser Gly His Leu Lys Cys Arg Val Lys Met gaa aaa ttg cag ttg aag gga aca acc tat ggc gtc tgt tca aag get 1890 Glu Lys Leu Gln Leu Lys Gly Thr Thr Tyr Gly Val Cys Ser Lys Ala ttc aag ttt ctt ggg act ccc gca gac aca ggt cac ggc act gtg gtg 1938 Phe Lys Phe Leu Gly Thr Pro Ala Asp Thr Gly His Gly Thr Val Val ttg gaa ttg cag tac act ggc acg gat gga cct tgc aaa gtt cct atc 1986 Leu Glu Leu Gin Tyr Thr Gly Thr Asp Gly Pro Cys Lys Val Pro Ile tcg tca gtg get tca ttg aac gac cta acg cca gtg ggc aga ttg gtc 2034 Ser Ser Val Ala Ser Leu Asn Asp Leu Thr Pro Val Gly Arg Leu Val act gtc aac cct ttt gtt tca gtg gcc acg gcc aac get aag gtc ctg 2082 Thr Val Asn Pro Phe Val Ser Val Ala Thr Ala Asn Ala Lys Val Leu att gaa ttg gaa cca ccc ttt gga gac tca tac ata gtg gtg ggc aga 2130 Ile Glu Leu Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val Val Gly Arg gga gaa caa cag atc aat cac cat tgg cac aag tct gga agc agc att 2178 Gly Glu Gln Gln Ile Asn His His Trp His Lys Ser Gly Ser Ser Ile ggc aaa gcc ttt aca acc acc ctc aaa gga gcg cag aga cta gcc get 2226 Gly Lys Ala Phe Thr Thr Thr Leu Lys Gly Ala Gln Arg Leu Ala Ala cta gga gac aca get tgg gac ttt gga tca gtt gga ggg gtg ttc acc 2274 Leu Gly Asp Thr Ala Trp Asp Phe Gly Ser Val Gly Gly Val Phe Thr tca gtt ggg aag get gtc cat caa gtg ttc gga gga gca ttc cgc tca 2322 Ser Val Gly Lys Ala Val His Gln Val Phe Gly Gly Ala Phe Arg Ser ctg ttc gga ggc atg tcc tgg ata acg caa gga ttg ctg ggg get ctc 2370 Leu Phe Gly Gly Met Ser Trp Ile Thr Gln Gly Leu Leu Gly Ala Leu ctg ttg tgg atg ggc atc aat get cgt gat agg tcc ata get ctc acg 2418 Leu Leu Trp Met Gly Ile Asn Ala Arg Asp Arg Ser Ile Ala Leu Thr ttt ctc gca gtt gga gga gtt ctg ctc ttc ctc tcc gtg aac gtg cac 2466 Phe Leu Ala Val Gly Gly Val Leu Leu Phe Leu Ser Val Asn Val His get gac act ggg tgt gcc ata gac atc agc cgg caa gag ctg aga tgt 2514 Ala Asp Thr Gly Cys Ala Ile Asp Ile Ser Arg Gln Glu Leu Arg Cys gga agt gga gtg ttc ata cac aat gat gtg gag get tgg atg gac cgg 2562 Gly Ser Gly Val Phe Ile His Asn Asp Val Glu Ala Trp Met Asp Arg tac aag tat tac cct gaa acg cca caa ggc cta gcc aag atc att cag 2610 Tyr Lys Tyr Tyr Pro Glu Thr Pro Gin Gly Leu Ala Lys Ile Ile Gln aaa get cat aag gaa gga gtg tgc ggt cta cga tca gtt tcc aga ctg 2658 Lys Ala His Lys Glu Gly Val Cys Gly Leu Arg Ser Val Ser Arg Leu gag cat caa atg tgg gaa gca gtg aag gac gag ctg aac act ctt ttg 2706 Glu His Gln Met Trp Glu Ala Val Lys Asp Glu Leu Asn Thr Leu Leu 10 aag gag aat ggt gtg gac ctt agt gtc gtg gtt gag aaa cag gag gga 2754 Lys Glu Asn Gly Val Asp Leu Ser Val Val Val Glu Lys Gln Glu Gly atg tac aag tca gca cct aaa cgc ctc acc gcc acc acg gaa aaa ttg 2802 15 Met Tyr Lys Ser Ala Pro Lys Arg Leu Thr Ala Thr Thr Glu Lys Leu gaa att ggc tgg aag gcc tgg gga aag agt att tta ttt gca cca gaa 2850 Glu Ile Gly Trp Lys Ala Trp Gly Lys Ser Ile Leu Phe Ala Pro Glu ctc gcc aac aac acc ttt gtg gtt gat ggt ccg gag acc aag gaa tgt 2898 Leu Ala Asn Asn Thr Phe Val Val Asp Gly Pro Glu Thr Lys Glu Cys ccg act cag aat cgc get tgg aat agc tta gaa gtg gag gat ttt gga 2946 Pro Thr Gln Asn Arg Ala Trp Asn Ser Leu Glu Val Glu Asp Phe Gly ttt ggt ctc acc agc act cgg atg ttc ctg aag gtc aga gag agc aac 2994 Phe Gly Leu Thr Ser Thr Arg Met Phe Leu Lys Val Arg Glu Ser Asn aca act gaa tgt gac tcg aag atc att gga acg get gtc aag aac aac 3042 Thr Thr Glu Cys Asp Ser Lys Ile Ile Gly Thr Ala Val Lys Asn Asn ttg gcg atc cac agt gac ctg tcc tat tgg att gaa agc agg ctc aat 3090 Leu Ala Ile His Ser Asp Leu Ser Tyr Trp Ile Glu Ser Arg Leu Asn gat acg tgg aag ctt gaa agg gca gtt ctg ggt gaa gtc aaa tca tgt 3138 Asp Thr Trp Lys Leu Glu Arg Ala Val Leu Gly Glu Val Lys Ser Cys acg tgg cct gag acg cat acc ttg tgg ggc gat gga atc ctt gag agt 3186 Thr Trp Pro Glu Thr His Thr Leu Trp Gly Asp Gly Ile Leu Glu Ser gac ttg ata ata cca gtc aca ctg gcg gga cca cga agc aat cac aat 3234 Asp Leu Ile Ile Pro Val Thr Leu Ala Gly Pro Arg Ser Asn His Asn cgg aga cct ggg tac aag aca caa aac cag ggc cca tgg gac gaa ggc 3282 Arg Arg Pro Gly Tyr Lys Thr Gln Asn Gln Gly Pro Trp Asp Glu Gly cgg gta gag att gac ttc gat tac tgc cca gga act acg gtc acc ctg 3330 Arg Val Glu Ile Asp Phe Asp Tyr Cys Pro Gly Thr Thr Val Thr Leu agt gag agc tgc gga cac cgt gga cct gcc act cgc acc acc aca gag 3378 Ser Glu Ser Cys Gly His Arg Gly Pro Ala Thr Arg Thr Thr Thr Glu agc gga aag ttg ata aca gat tgg tgc tgc agg agc tgc acc tta cca 3426 Ser Gly Lys Leu Ile Thr Asp Trp Cys Cys Arg Ser Cys Thr Leu Pro cca ctg cgc tac caa act gac agc ggc tgt tgg tat ggt atg gag atc 3474 Pro Leu Arg Tyr Gln Thr Asp Ser Gly Cys Trp Tyr Gly Met Glu Ile aga cca cag aga cat gat gaa aag acc ctc gtg cag tca caa gtg aat 3522 Arg Pro Gln Arg His Asp Glu Lys Thr Leu Val Gln Ser Gln Val Asn get tat aat get gat atg att gac cct ttt cag ttg ggc ctt ctg gtc 3570 Ala Tyr Asn Ala Asp Met Ile Asp Pro Phe Gln Leu Gly Leu Leu Val gtg ttc ttg gcc acc cag gag gtc ctt cgc aag agg tgg aca gcc aag 3618 Val Phe Leu Ala Thr Gln Glu Val Leu Arg Lys Arg Trp Thr Ala Lys atc agc atg cca get ata ctg att get ctg cta gtc ctg gtg ttt ggg 3666 Ile Ser Met Pro Ala Ile Leu Ile Ala Leu Leu Val Leu Val Phe Gly ggc att act tac act gat gtg tta cgc tat gtc atc ttg gtg ggg gca 3714 Gly Ile Thr Tyr Thr Asp Val Leu Arg Tyr Val Ile Leu Val Gly Ala get ttc gca gaa tct aat tcg gga gga gac gtg gta cac ttg gcg ctc 3762 Ala Phe Ala Glu Ser Asn Ser Gly Gly Asp Val Val His Leu Ala Leu atg gcg acc ttc aag ata caa cca gtg ttt atg gtg gca tcg ttt ctc 3810 Met Ala Thr Phe Lys Ile Gln Pro Val Phe Met Val Ala Ser Phe Leu aaa gcg aga tgg acc aac cag gag aac att ttg ttg atg ttg gcg get 3858 Lys Ala Arg Trp Thr Asn Gln Glu Asn Ile Leu Leu Met Leu Ala Ala gtt ttc ttt caa atg get tat cac gat gcc cgc caa att ctg ctc tgg 3906 Val Phe Phe Gln Met Ala Tyr His Asp Ala Arg Gln Ile Leu Leu Trp gag atc cct gat gtg ttg aat tca ctg gcg gta get tgg atg ata ctg 3954 Glu Ile Pro Asp Val Leu Asn Ser Leu Ala Val Ala Trp Met Ile Leu aga gcc ata aca ttc aca acg aca tca aac gtg gtt gtt ccg ctg cta 4002 Arg Ala Ile Thr Phe Thr Thr Thr Ser Asn Val Val Val Pro Leu Leu gcc ctg cta aca ccc ggg ctg aga tgc ttg aat ctg gat gtg tac agg 4050 Ala Leu Leu Thr Pro Gly Leu Arg Cys Leu Asn Leu Asp Val Tyr Arg ata ctg ctg ttg atg gtc gga ata ggc agc ttg atc agg gag aag agg 4098 Ile Leu Leu Leu Met Val Gly Ile Gly Ser Leu Ile Arg Glu Lys Arg agt gca get gca aaa aag aaa gga gca agt ctg cta tgc ttg get cta 4146 Ser Ala Ala Ala Lys Lys Lys Gly Ala Ser Leu Leu Cys Leu Ala Leu gcc tca aca gga ctt ttc aac ccc atg atc ctt get get gga ctg att 4194 Ala Ser Thr Gly Leu Phe Asn Pro Met Ile Leu Ala Ala Gly Leu Ile gca tgt gat ccc aac cgt aaa cgc gga tgg ccc gca act gaa gtg atg 4242 Ala Cys Asp Pro Asn Arg Lys Arg Gly Trp Pro Ala Thr Glu Val Met aca get gtc ggc cta atg ttt gcc atc gtc gga ggg ctg gca gag ctt 4290 Thr Ala Val Gly Leu Met Phe Ala Ile Val Gly Gly Leu Ala Glu Leu gac att gac tcc atg gcc att cca atg act atc gcg ggg ctc atg ttt 4338 Asp Ile Asp Ser Met Ala Ile Pro Met Thr Ile Ala Gly Leu Met Phe get get ttc gtg att tct ggg aaa tca aca gat atg tgg att gag aga 4386 Ala Ala Phe Val Ile Ser Gly Lys Ser Thr Asp Met Trp Ile Glu Arg acg gcg gac att tcc tgg gaa agt gat gca gaa att aca ggc tcg agc 4434 Thr Ala Asp Ile Ser Trp Glu Ser Asp Ala Glu Ile Thr Gly Ser Ser gaa aga gtt gat gtg cgg ctt gat gat gat gga aac ttc cag ctc atg 4482 Glu Arg Val Asp Val Arg Leu Asp Asp Asp Gly Asn Phe Gln Leu Met aat gat cca gga gca cct tgg aag ata tgg atg ctc aga atg gtc tgt 4530 Asn Asp Pro Gly Ala Pro Trp Lys Ile Trp Met Leu Arg Met Val Cys ctc gcg att agt gcg tac acc ccc tgg gca atc ttg ccc tca gta gtt 4578 Leu Ala Ile Ser Ala Tyr Thr Pro Trp Ala Ile Leu Pro Ser Val Val gga ttt tgg ata act ctc caa tac aca aag aga gga ggc gtg ttg tgg 4626 Gly Phe Trp Ile Thr Leu Gln Tyr Thr Lys Arg Gly Gly Val Leu Trp gac act ccc tca cca aag gag tac aaa aag ggg gac acg acc acc ggc 4674 Asp Thr Pro Ser Pro Lys Glu Tyr Lys Lys Gly Asp Thr Thr Thr Gly gtc tac agg atc atg act cgt ggg ctg ctc ggc agt tat caa gca gga 4722 Val Tyr Arg Ile Met Thr Arg Gly Leu Leu Gly Ser Tyr Gln Ala Gly gcg ggc gtg atg gtt gaa ggt gtt ttc cac acc ctt tgg cat aca aca 4770 Ala Gly Val Met Val Glu Gly Val Phe His Thr Leu Trp His Thr Thr aaa gga gcc get ttg atg agc gga gag ggc cgc ctg gac cca tac tgg 4818 Lys Gly Ala Ala Leu Met Ser Gly Glu Gly Arg Leu Asp Pro Tyr Trp ggc agt gtc aag gag gat cga ctt tgt tac gga gga ccc tgg aaa ttg 4866 Gly Ser Val Lys Glu Asp Arg Leu Cys Tyr Gly Gly Pro Trp Lys Leu cag cac aag tgg aac ggg cag gat gag gtg cag atg att gtg gtg gaa 4914 Gln His Lys Trp Asn Gly Gln Asp Glu Val Gln Met Ile Val Val Glu cct ggc aag aac gtt aag aac gtc cag acg aaa cca ggg gtg ttc aaa 4962 Pro Gly Lys Asn Val Lys Asn Val Gln Thr Lys Pro Gly Val Phe Lys aca cct gaa gga gaa atc ggg gcc gtg act ttg gac ttc ccc act gga 5010 Thr Pro Glu Gly Glu Ile Gly Ala Val Thr Leu Asp Phe Pro Thr Gly aca tca ggc tca cca ata gtg gac aaa aac ggt gat gtg att ggg ctt 5058 Thr Ser Gly Ser Pro Ile Val Asp Lys Asn Gly Asp Val Ile Gly Leu tat ggc aat gga gtc ata atg ccc aac ggc tca tac ata agc gcg ata 5106 Tyr Gly Asn Gly Val Ile Met Pro Asn Gly Ser Tyr Ile Ser Ala Ile gtg cag ggt gaa agg atg gat gag cca atc cca gcc gga ttc gaa cct 5154 Val Gln Gly Glu Arg Met Asp Glu Pro Ile Pro Ala Gly Phe Glu Pro gag atg ctg agg aaa aaa cag atc act gta ctg gat ctc cat ccc ggc 5202 Glu Met Leu Arg Lys Lys Gln Ile Thr Val Leu Asp Leu His Pro Gly gcc ggt aaa aca agg agg att ctg cca cag atc atc aaa gag gcc ata 5250 Ala Gly Lys Thr Arg Arg Ile Leu Pro Gln Ile Ile Lys Glu Ala Ile aac aga aga ctg aga aca gcc gtg cta gca cca acc agg gtt gtg get 5298 Asn Arg Arg Leu Arg Thr Ala Val Leu Ala Pro Thr Arg Val Val Ala get gag atg get gaa gca ctg aga gga ctg ccc atc cgg tac cag aca 5346 Ala Glu Met Ala Glu Ala Leu Arg Gly Leu Pro Ile Arg Tyr Gln Thr tcc gca gtg ccc aga gaa cat aat gga aat gag att gtt gat gtc atg 5394 Ser Ala Val Pro Arg Glu His Asn Gly Asn Glu Ile Val Asp Val Met tgt cat get acc ctc acc cac agg ctg atg tct cct cac agg gtg ccg 5442 Cys His Ala Thr Leu Thr His Arg Leu Met Ser Pro His Arg Val Pro aac tac aac ctg ttc gtg atg gat gag get cat ttc acc gac cca get 5490 Asn Tyr Asn Leu Phe Val Met Asp Glu Ala His Phe Thr Asp Pro Ala agc att gca gca aga ggt tac att tcc aca aag gtc gag cta ggg gag 5538 Ser Ile Ala Ala Arg Gly Tyr Ile Ser Thr Lys Val Glu Leu Gly Glu gcg gcg gca ata ttc atg aca gcc acc cca cca ggc act tca gat cca 5586 Ala Ala Ala Ile Phe Met Thr Ala Thr Pro Pro Gly Thr Ser Asp Pro ttc cca gag tcc aat tca cca att tcc gac tta cag act gag atc ccg 5634 Phe Pro Glu Ser Asn Ser Pro Ile Ser Asp Leu Gln Thr Glu Ile Pro gat cga get tgg aac tct gga tac gaa tgg atc aca gaa tac acc ggg 5682 Asp Arg Ala Trp Asn Ser Gly Tyr Glu Trp Ile Thr Glu Tyr Thr Gly aag acg gtt tgg ttt gtg cct agt gtc aag atg ggg aat gag att gcc 5730 Lys Thr Val Trp Phe Val Pro Ser Val Lys Met Gly Asn Glu Ile Ala ctt tgc cta caa cgt get gga aag aaa gta gtc caa ttg aac aga aag 5778 Leu Cys Leu Gln Arg Ala Gly Lys Lys Val Val Gln Leu Asn Arg Lys tcg tac gag acg gag tac cca aaa tgt aag aac gat gat tgg gac ttt 5826 Ser Tyr Glu Thr Glu Tyr Pro Lys Cys Lys Asn Asp Asp Trp Asp Phe gtt atc aca aca gac ata tct gaa atg ggg get aac ttc aag gcg agc 5874 Val Ile Thr Thr Asp Ile Ser Glu Met Gly Ala Asn Phe Lys Ala Ser 5 agg gtg att gac agc cgg aag agt gtg aaa cca acc atc ata aca gaa 5922 Arg Val Ile Asp Ser Arg Lys Ser Val Lys Pro Thr Ile Ile Thr Glu gga gaa ggg aga gtg atc ctg gga gaa cca tct gca gtg aca gca get 5970 10 Gly Glu Gly Arg Val Ile Leu Gly Glu Pro Ser Ala Val Thr Ala Ala agt gcc gcc cag aga cgt gga cgt atc ggt aga aat ccg tcg caa gtt 6018 Ser Ala Ala Gln Arg Arg Gly Arg Ile Gly Arg Asn Pro Ser Gln Val ggt gat gag tac tgt tat ggg ggg cac acg aat gaa gac gac tcg aac 6066 Gly Asp Glu Tyr Cys Tyr Gly Gly His Thr Asn Glu Asp Asp Ser Asn ttc gcc cat tgg act gag gca cga atc atg ctg gac aac atc aac atg 6114 Phe Ala His Trp Thr Glu Ala Arg Ile Met Leu Asp Asn Ile Asn Met cca aac gga ctg atc get caa ttc tac caa cca gag cgt gag aag gta 6162 Pro Asn Gly Leu Ile Ala Gln Phe Tyr Gln Pro Glu Arg Glu Lys Val tat acc atg gat ggg gaa tac cgg ctc aga gga gaa gag aga aaa aac 6210 Tyr Thr Met Asp Gly Glu Tyr Arg Leu Arg Gly Glu Glu Arg Lys Asn ttt ctg gaa ctg ttg agg act gca gat ctg cca gtt tgg ctg get tac 6258 Phe Leu Glu Leu Leu Arg Thr Ala Asp Leu Pro Val Trp Leu Ala Tyr aag gtt gca gcg get gga gtg tca tac cac gac cgg agg tgg tgc ttt 6306 Lys Val Ala Ala Ala Gly Val Ser Tyr His Asp Arg Arg Trp Cys Phe gat ggt cct agg aca aac aca att tta gaa gac aac aac gaa gtg gaa 6354 Asp Gly Pro Arg Thr Asn Thr Ile Leu Glu Asp Asn Asn Glu Val Glu gtc atc acg aag ctt ggt gaa agg aag att ctg agg ccg cgc tgg att 6402 Val Ile Thr Lys Leu Gly Glu Arg Lys Ile Leu Arg Pro Arg Trp Ile gac gcc agg gtg tac tcg gat cac cag gca cta aag gcg ttc aag gac 6450 Asp Ala Arg Val Tyr Ser Asp His Gln Ala Leu Lys Ala Phe Lys Asp ttc gcc tcg gga aaa cgt tct cag ata ggg ctc att gag gtt ctg gga 6498 Phe Ala Ser Gly Lys Arg Ser Gln Ile Gly Leu Ile Glu Val Leu Gly aag atg cct gag cac ttc atg ggg aag aca tgg gaa gca ctt gac acc 6546 Lys Met Pro Glu His Phe Met Gly Lys Thr Trp Glu Ala Leu Asp Thr atg tac gtt gtg gcc act gca gag aaa gga gga aga get cac aga atg 6594 Met Tyr Val Val Ala Thr Ala Glu Lys Gly Gly Arg Ala His Arg Met gcc ctg gag gaa ctg cca gat get ctt cag aca att gcc ttg att gcc 6642 Ala Leu Glu Glu Leu Pro Asp Ala Leu Gln Thr Ile Ala Leu Ile Ala tta ttg agt gtg atg acc atg gga gta ttc ttc ctc ctc atg cag cgg 6690 Leu Leu Ser Val Met Thr Met Gly Val Phe Phe Leu Leu Met Gln Arg aag ggc att gga aag ata ggt ttg gga ggc get gtc ttg gga gtc gcg 6738 Lys Gly Ile Gly Lys Ile Gly Leu Gly Gly Ala Val Leu Gly Val Ala acc ttt ttc tgt tgg atg get gaa gtt cca gga acg aag atc gcc gga 6786 Thr Phe Phe Cys Trp Met Ala Glu Val Pro Gly Thr Lys Ile Ala Gly atg ttg ctg ctc tcc ctt ctc ttg atg att gtg cta att cct gag cca 6834 Met Leu Leu Leu Ser Leu Leu Leu Met Ile Val Leu Ile Pro Glu Pro gag aag caa cgt tcg cag aca gac aac cag cta gcc gtg ttc ctg att 6882 Glu Lys Gln Arg Ser Gln Thr Asp Asn Gln Leu Ala Val Phe Leu Ile tgt gtc atg acc ctt gtg agc gca gtg gca gcc aac gag atg ggt tgg 6930 Cys Val Met Thr Leu Val Ser Ala Val Ala Ala Asn Glu Met Gly Trp cta gat aag acc aag agt gac ata agc agt ttg ttt ggg caa aga att 6978 Leu Asp Lys Thr Lys Ser Asp Ile Ser Ser Leu Phe Gly Gin Arg Ile gag gtc aag gag aat ttc agc atg gga gag ttt ctt ttg gac ttg agg 7026 Glu Val Lys Glu Asn Phe Ser Met Gly Glu Phe Leu Leu Asp Leu Arg ccg gca aca gcc tgg tca ctg tac get gtg aca aca gcg gtc ctc act 7074 Pro Ala Thr Ala Trp Ser Leu Tyr Ala Val Thr Thr Ala Val Leu Thr cca ctg cta aag cat ttg atc acg tca gat tac atc aac acc tca ttg 7122 Pro Leu Leu Lys His Leu Ile Thr Ser Asp Tyr Ile Asn Thr Ser Leu acc tca ata aac gtt cag gca agt gca cta ttc aca ctc gcg cga ggc 7170 Thr Ser Ile Asn Val Gln Ala Ser Ala Leu Phe Thr Leu Ala Arg Gly ttc ccc ttc gtc gat gtt gga gtg tcg get ctc ctg cta gca gcc gga 7218 Phe Pro Phe Val Asp Val Gly Val Ser Ala Leu Leu Leu Ala Ala Gly tgc tgg gga caa gtc acc ctc acc gtt acg gta aca gcg gca aca ctc 7266 Cys Trp Gly Gln Val Thr Leu Thr Val Thr Val Thr Ala Ala Thr Leu ctt ttt tgc cac tat gcc tac atg gtt ccc ggt tgg caa get gag gca 7314 Leu Phe Cys His Tyr Ala Tyr Met Val Pro Gly Trp Gln Ala Glu Ala atg cgc tca gcc cag cgg cgg aca gcg gcc gga atc atg aag aac get 7362 Met Arg Ser Ala Gln Arg Arg Thr Ala Ala Gly Ile Met Lys Asn Ala gta gtg gat ggc atc gtg gcc acg gac gtc cca gaa tta gag cgc acc 7410 Val Val Asp Gly Ile Val Ala Thr Asp Val Pro Glu Leu Glu Arg Thr aca ccc atc atg cag aag aaa gtt gga cag atc atg ctg atc ttg gtg 7458 Thr Pro Ile Met Gln Lys Lys Val Gly Gln Ile Met Leu Ile Leu Val tct cta get gca gta gta gtg aac ccg tct gtg aag aca gta cga gaa 7506 Ser Leu Ala Ala Val Val Val Asn Pro Ser Val Lys Thr Val Arg Glu gcc gga att ttg atc acg gcc gca gcg gtg acg ctt tgg gag aat gga 7554 Ala Gly Ile Leu Ile Thr Ala Ala Ala Val Thr Leu Trp Glu Asn Gly gca ago tct gtt tgg aac gca aca act gcc atc gga ctc tgc cac atc 7602 Ala Ser Ser Val Trp Asn Ala Thr Thr Ala Ile Gly Leu Cys His Ile atg cgt ggg ggt tgg ttg tca tgt cta tcc ata aca tgg aca ctc ata 7650 Met Arg Gly Gly Trp Leu Ser Cys Leu Ser Ile Thr Trp Thr Leu Ile aag aac atg gaa aaa cca gga cta aaa aga ggt ggg gca aaa gga cgc 7698 Lys Asn Met Glu Lys Pro Gly Leu Lys Arg Gly Gly Ala Lys Gly Arg acc ttg gga gag gtt tgg aaa gaa aga ctc aac cag atg aca aaa gaa 7746 Thr Leu Gly Glu Val Trp Lys Glu Arg Leu Asn Gln Met Thr Lys Glu gag ttc act agg tac cgc aaa gag gcc atc atc gaa gtc gat cgc tca 7794 Glu Phe Thr Arg Tyr Arg Lys Glu Ala Ile Ile Glu Val Asp Arg Ser gcg gca aaa cac gcc agg aaa gaa ggc aat gtc act gga ggg cat cca 7842 Ala Ala Lys His Ala Arg Lys Glu Gly Asn Val Thr Gly Gly His Pro gtc tct agg ggc aca gca aaa ctg aga tgg ctg gtc gaa cgg agg ttt 7890 Val Ser Arg Gly Thr Ala Lys Leu Arg Trp Leu Val Glu Arg Arg Phe ctc gaa ccg gtc gga aaa gtg att gac ctt gga tgt gga aga ggc ggt 7938 Leu Glu Pro Val Gly Lys Val Ile Asp Leu Gly Cys Gly Arg Gly Gly tgg tgt tac tat atg gca acc caa aaa aga gtc caa gaa gtc aga ggg 7986 Trp Cys Tyr Tyr Met Ala Thr Gin Lys Arg Val Gin Glu Val Arg Gly tac aca aag ggc ggt ccc gga cat gaa gag ccc caa cta gtg caa agt 8034 Tyr Thr Lys Gly Gly Pro Gly His Glu Glu Pro Gin Leu Val Gin Ser tat gga tgg aac att gtc acc atg aag agt gga gtg gat gtg ttc tac 8082 Tyr Gly Trp Asn Ile Val Thr Met Lys Ser Gly Val Asp Val Phe Tyr aga cct tct gag tgt tgt gac acc ctc ctt tgt gac atc gga gag tcc 8130 Arg Pro Ser Glu Cys Cys Asp Thr Leu Leu Cys Asp Ile Gly Glu Ser tcg tca agt get gag gtt gaa gag cat agg acg att cgg gtc ctt gaa 8178 Ser Ser Ser Ala Glu Val Glu Glu His Arg Thr Ile Arg Val Leu Glu atg gtt gag gac tgg ctg cac cga ggg cca agg gaa ttt tgc gtg aag 8226 Met Val Glu Asp Trp Leu His Arg Gly Pro Arg Glu Phe Cys Val Lys gtg ctc tgc ccc tac atg ccg aaa gtc ata gag aag atg gag ctg ctc 8274 Val Leu Cys Pro Tyr Met Pro Lys Val Ile Glu Lys Met Glu Leu Leu caa cgc cgg tat ggg ggg gga ctg gtc aga aac cca ctc tca cgg aat 8322 Gin Arg Arg Tyr Gly Gly Gly Leu Val Arg Asn Pro Leu Ser Arg Asn tcc acg cac gag atg tat tgg gtg agt cga get tca ggc aat gtg gta 8370 Ser Thr His Glu Met Tyr Trp Val Ser Arg Ala Ser Gly Asn Val Val cat tca gtg aat atg acc agc cag gtg ctc cta gga aga atg gaa aaa 8418 His Ser Val Asn Met Thr Ser Gin Val Leu Leu Gly Arg Met Glu Lys agg acc tgg aag gga ccc caa tac gag gaa gat gta aac ttg gga agt 8466 Arg Thr Trp Lys Gly Pro Gin Tyr Glu Glu Asp Val Asn Leu Gly Ser gga acc agg gcg gtg gga aaa ccc ctg ctc aac tca gac acc agt aaa 8514 Gly Thr Arg Ala Val Gly Lys Pro Leu Leu Asn Ser Asp Thr Ser Lys atc aag aac agg att gaa cga ctc agg cgt gag tac agt tcg acg tgg 8562 Ile Lys Asn Arg Ile Glu Arg Leu Arg Arg Glu Tyr Ser Ser Thr Trp cac cac gat gag aac cac cca tat aga acc tgg aac tat cac ggc agt 8610 His His Asp Glu Asn His Pro Tyr Arg Thr Trp Asn Tyr His Gly Ser tat gat gtg aag ccc aca ggc tcc gcc agt tcg ctg gtc aat gga gtg 8658 Tyr Asp Val Lys Pro Thr Gly Ser Ala Ser Ser Leu Val Asn Gly Val gtc agg ctc ctc tca aaa cca tgg gac acc atc acg aat gtt acc acc 8706 Val Arg Leu Leu Ser Lys Pro Trp Asp Thr Ile Thr Asn Val Thr Thr atg gcc atg act gac act act ccc ttc ggg cag cag cga gtg ttc aaa 8754 Met Ala Met Thr Asp Thr Thr Pro Phe Gly Gin Gin Arg Val Phe Lys gag aag gtg gac acg aaa get cct gaa ccg cca gaa gga gtg aag tac 8802 Glu Lys Val Asp Thr Lys Ala Pro Glu Pro Pro Glu Gly Val Lys Tyr gtg ctc aat gag acc acc aac tgg ttg tgg gcg ttt ttg gcc aga gaa 8850 Val Leu Asn Glu Thr Thr Asn Trp Leu Trp Ala Phe Leu Ala Arg Glu aaa cgt ccc aga atg tgc tct cga gag gaa ttc ata aga aag gtc aac 8898 Lys Arg Pro Arg Met Cys Ser Arg Glu Glu Phe Ile Arg Lys Val Asn agc aat gca get ttg ggt gcc atg ttt gaa gag cag aat caa tgg agg 8946 Ser Asn Ala Ala Leu Gly Ala Met Phe Glu Glu Gin Asn Gin Trp Arg agc gcc aga gaa gca gtt gaa gat cca aaa ttt tgg gag atg gtg gat 8994 Ser Ala Arg Glu Ala Val Glu Asp Pro Lys Phe Trp Glu Met Val Asp gag gag cgc gag gca cat ctg cgg ggg gaa tgt cac act tgc att tac 9042 Glu Glu Arg Glu Ala His Leu Arg Gly Glu Cys His Thr Cys Ile Tyr aac atg atg gga aag aga gag aaa aaa ccc gga gag ttc gga aag gcc 9090 Asn Met Met Gly Lys Arg Glu Lys Lys Pro Gly Glu Phe Gly Lys Ala aag gga agc aga gcc att tgg ttc atg tgg ctc gga get cgc ttt ctg 9138 Lys Gly Ser Arg Ala Ile Trp Phe Met Trp Leu Gly Ala Arg Phe Leu gag ttc gag get ctg ggt ttt ctc aat gaa gac cac tgg ctt gga aga 9186 Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu Asp His Trp Leu Gly Arg 10 aag aac tca gga gga ggt gtc gag ggc ttg ggc ctc caa aaa ctg ggt 9234 Lys Asn Ser Gly Gly Gly Val Glu Gly Leu Gly Leu Gln Lys Leu Gly tac atc ctg cgt gaa gtt ggc acc cgg cct ggg ggc aag atc tat get 9282 15 Tyr Ile Leu Arg Glu Val Gly Thr Arg Pro Gly Gly Lys Ile Tyr Ala gat gac aca get ggc tgg gac acc cgc atc acg aga get gac ttg gaa 9330 Asp Asp Thr Ala Gly Trp Asp Thr Arg Ile Thr Arg Ala Asp Leu Glu aat gaa get aag gtg ctt gag ctg ctt gat ggg gaa cat cgg cgt ctt 9378 Asn Glu Ala Lys Val Leu Glu Leu Leu Asp Gly Glu His Arg Arg Leu gcc agg gcc atc att gag ctc acc tat cgt cac aaa gtt gtg aaa gtg 9426 Ala Arg Ala Ile Ile Glu Leu Thr Tyr Arg His Lys Val Val Lys Val atg cgc ccg get get gat gga aga acc gtc atg gat gtt atc tcc aga 9474 Met Arg Pro Ala Ala Asp Gly Arg Thr Val Met Asp Val Ile Ser Arg gaa gat cag agg ggg agt gga caa gtt gtc acc tac gcc cta aac act 9522 Glu Asp Gln Arg Gly Ser Gly Gln Val Val Thr Tyr Ala Leu Asn Thr ttc acc aac ctg gcc gtc cag ctg gtg agg atg atg gaa ggg gaa gga 9570 Phe Thr Asn Leu Ala Val Gln Leu Val Arg Met Met Glu Gly Glu Gly gtg att ggc cca gat gat gtg gag aaa ctc aca aaa ggg aaa gga ccc 9618 Val Ile Gly Pro Asp Asp Val Glu Lys Leu Thr Lys Gly Lys Gly Pro aaa gtc agg acc tgg ctg ttt gag aat ggg gaa gaa aga ctc agc cgc 9666 Lys Val Arg Thr Trp Leu Phe Glu Asn Gly Glu Glu Arg Leu Ser Arg atg get gtc agt gga gat gac tgt gtg gta aag ccc ctg gac gat cgc 9714 Met Ala Val Ser Gly Asp Asp Cys Val Val Lys Pro Leu Asp Asp Arg ttt gcc acc tcg ctc cac ttc ctc aat get atg tca aag gtt cgc aaa 9762 Phe Ala Thr Ser Leu His Phe Leu Asn Ala Met Ser Lys Val Arg Lys gac atc caa gag tgg aaa ccg tca act gga tgg tat gat tgg cag cag 9810 Asp Ile Gln Glu Trp Lys Pro Ser Thr Gly Trp Tyr Asp Trp Gln Gln gtt cca ttt tgc tca aac cat ttc act gaa ttg atc atg aaa gat gga 9858 Val Pro Phe Cys Ser Asn His Phe Thr Glu Leu Ile Met Lys Asp Gly aga aca ctg gtg gtt cca tgc cga gga cag gat gaa ttg gta ggc aga 9906 Arg Thr Leu Val Val Pro Cys Arg Gly Gln Asp Glu Leu Val Gly Arg get cgc ata tct cca ggg gcc gga tgg aac gtc cgc gac act get tgt 9954 Ala Arg Ile Ser Pro Gly Ala Gly Trp Asn Val Arg Asp Thr Ala Cys ctg get aag tct tat gcc cag atg tgg ctg ctt ctg tac ttc cac aga 10002 Leu Ala Lys Ser Tyr Ala Gln Met Trp Leu Leu Leu Tyr Phe His Arg aga gac ctg cgg ctc atg gcc aac gcc att tgc tcc get gtc cct gtg 10050 Arg Asp Leu Arg Leu Met Ala Asn Ala Ile Cys Ser Ala Val Pro Val aat tgg gtc cct acc gga aga acc acg tgg tcc atc cat gca gga gga 10098 Asn Trp Val Pro Thr Gly Arg Thr Thr Trp Ser Ile His Ala Gly Gly gag tgg atg aca aca gag gac atg ttg gag gtc tgg aac cgt gtt tgg 10146 Glu Trp Met Thr Thr Glu Asp Met Leu Glu Val Trp Asn Arg Val Trp ata gag gag aat gaa tgg atg gaa gac aaa acc cca gtg gag aaa tgg 10194 Ile Glu Glu Asn Glu Trp Met Glu Asp Lys Thr Pro Val Glu Lys Trp agt gac gtc cca tat tca gga aaa cga gag gac atc tgg tgt ggc agc 10242 Ser Asp Val Pro Tyr Ser Gly Lys Arg Glu Asp Ile Trp Cys Gly Ser ctg att ggc aca aga gcc cga gcc acg tgg gca gaa aac atc cag gtg 10290 Leu Ile Gly Thr Arg Ala Arg Ala Thr Trp Ala Glu Asn Ile Gln Val get atc aac caa gtc aga gca atc atc gga gat gag aag tat gtg gat 10338 Ala Ile Asn Gln Val Arg Ala Ile Ile Gly Asp Glu Lys Tyr Val Asp tac atg agt tca cta aag aga tat gaa gac aca act ttg gtt gag gac 10386 Tyr Met Ser Ser Leu Lys Arg Tyr Glu Asp Thr Thr Leu Val Glu Asp aca gta ctg tagatattta atcaattgta aatagacaat ataagtatgc 10435 Thr Val Leu ataaaagtgt agttttatag tagtatttag tggtgttagt gtaaatagtt aagaaaattt 10495 tgaggagaaa gtcaggccgg gaagttcccg ccaccggaag ttgagtagac ggtgctgcct 10555 gcgactcaac cccaggagga ctgggtgaac aaagccgcga agtgatccat gtaagccctc 10615 agaaccgtct cggaaggagg accccacatg ttgtaacttc aaagcccaat gtcagaccac 10675 gctacggcgt gctactctgc ggagagtgca gtctgcgata gtgccccagg aggactgggt 10735 taacaaaggc aaaccaacgc cccacgcggc cctagccccg gtaatggtgt taaccagggc 10795 gaaaggacta gaggttagag gagaccccgc ggtttaaagt gcacggccca gcctgactga 10855 agctgtaggt caggggaagg actagaggtt agtggagacc ccgtgccaca aaacaccaca 10915 acaaaacagc atattgacac ctgggataga ctaggagatc ttctgctctg cacaaccagc 10975 cacacggcac agtgcgccga caatggtggc tggtggtgcg agaacacagg atct 11029 <210> 31 <211> 3433 <212> PRT
<213> West Nile virus <400> 31 Met Ser Lys Lys Pro Gly Gly Pro Gly Lys Ser Arg Ala Val Asn Met Leu Lys Arg Gly Met Pro Arg Val Leu Ser Leu Ile Gly Leu Lys Arg Ala Met Leu Ser Leu Ile Asp Gly Lys Gly Pro Ile Arg Phe Val Leu Ala Leu Leu Ala Phe Phe Arg Phe Thr Ala Ile Ala Pro Thr Arg Ala Val Leu Asp Arg Trp Arg Gly Val Asn Lys Gin Thr Ala Met Lys His Leu Leu Ser Phe Lys Lys Glu Leu Gly Thr Leu Thr Ser Ala Ile Asn 50 Arg Arg Ser Ser Lys Gin Lys Lys Arg Gly Gly Lys Thr Gly Ile Ala Val Met Ile Gly Leu Ile Ala Ser Val Gly Ala Val Thr Leu Ser Asn Phe Gln Gly Lys Val Met Met Thr Val Asn Ala Thr Asp Val Thr Asp Val Ile Thr Ile Pro Thr Ala Ala Gly Lys Asn Leu Cys Ile Val Arg Ala Met Asp Val Gly Tyr Met Cys Asp Asp Thr Ile Thr Tyr Glu Cys Pro Val Leu Ser Ala Gly Asn Asp Pro Glu Asp Ile Asp Cys Trp Cys Thr Lys Ser Ala Val Tyr Val Arg Tyr Gly Arg Cys Thr Lys Thr Arg His Ser Arg Arg Ser Arg Arg Ser Leu Thr Val Gln Thr His Gly Glu Ser Thr Leu Ala Asn Lys Lys Gly Ala Trp Met Asp Ser Thr Lys Ala Thr Arg Tyr Leu Val Lys Thr Glu Ser Trp Ile Leu Arg Asn Pro Gly Tyr Ala Leu Val Ala Ala Val Ile Gly Trp Met Leu Gly Ser Asn Thr Met Gln Arg Val Val Phe Val Val Leu Leu Leu Leu Val Ala Pro Ala Tyr Ser Phe Asn Cys Leu Gly Met Ser Asn Arg Asp Phe Leu Glu Gly Val Ser Gly Ala Thr Trp Val Asp Leu Val Leu Glu Gly Asp Ser Cys Val Thr Ile Met Ser Lys Asp Lys Pro Thr Ile Asp Val Lys Met Met Asn Met Glu Ala Ala Asn Leu Ala Glu Val Arg Ser Tyr Cys Tyr Leu Ala Thr Val Ser Asp Leu Ser Thr Lys Ala Ala Cys Pro Thr Met Gly Glu Ala His Asn Asp Lys Arg Ala Asp Pro Ala Phe Val Cys Arg Gln Gly Val Val Asp Arg Gly Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys Gly Ser Ile Asp Thr Cys Ala Lys Phe Ala Cys Ser Thr Lys Ala Ile Gly Arg Thr Ile Leu Lys Glu Asn Ile Lys Tyr Glu Val Ala Ile Phe Val His Gly Pro Thr Thr Val Glu Ser His Gly Asn Tyr Ser Thr Gln Val Gly Ala Thr Gln Ala Gly Arg Phe Ser Ile Thr Pro Ala Ala Pro Ser Tyr Thr Leu Lys Leu Gly Glu Tyr Gly Glu Val Thr Val Asp Cys Glu Pro Arg Ser Gly Ile Asp Thr Asn Ala Tyr Tyr Val Met Thr Val Gly Thr Lys Thr Phe Leu Val His Arg Glu Trp Phe Met Asp Leu Asn Leu Pro Trp Ser Ser Ala Gly Ser Thr Val Trp Arg Asn Arg Glu Thr Leu Met Glu Phe Glu Glu Pro His Ala Thr Lys Gln Ser Val Ile Ala Leu Gly Ser Gln Glu Gly Ala Leu His Gln Ala Leu Ala Gly Ala Ile Pro Val Glu Phe Ser Ser Asn Thr Val Lys Leu Thr Ser Gly His Leu Lys Cys Arg Val Lys Met Glu Lys Leu Gln Leu Lys Gly Thr Thr Tyr Gly Val Cys Ser Lys Ala Phe Lys Phe Leu Gly Thr Pro Ala Asp Thr Gly His Gly Thr Val Val Leu Glu Leu Gin Tyr Thr Gly Thr Asp Gly Pro Cys Lys Val Pro Ile Ser Ser Val Ala Ser Leu Asn Asp Leu Thr Pro Val Gly Arg Leu Val Thr Val Asn Pro Phe Val Ser Val Ala Thr Ala Asn Ala Lys Val Leu Ile Glu Leu Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val Val Gly Arg Gly Glu Gln Gln Ile Asn His His Trp His Lys Ser Gly Ser Ser Ile Gly Lys Ala Phe Thr Thr Thr Leu Lys Gly Ala Gln Arg Leu Ala Ala Leu Gly Asp Thr Ala Trp Asp Phe Gly Ser Val Gly Gly Val Phe Thr Ser Val Gly Lys Ala Val His Gln Val Phe Gly Gly Ala Phe Arg Ser Leu Phe Gly Gly Met Ser Trp Ile Thr Gln 10 Gly Leu Leu Gly Ala Leu Leu Leu Trp Met Gly Ile Asn Ala Arg Asp Arg Ser Ile Ala Leu Thr Phe Leu Ala Val Gly Gly Val Leu Leu Phe Leu Ser Val Asn Val His Ala Asp Thr Gly Cys Ala Ile Asp Ile Ser Arg Gln Glu Leu Arg Cys Gly Ser Gly Val Phe Ile His Asn Asp Val Glu Ala Trp Met Asp Arg Tyr Lys Tyr Tyr Pro Glu Thr Pro Gln Gly Leu Ala Lys Ile Ile Gln Lys Ala His Lys Glu Gly Val Cys Gly Leu Arg Ser Val Ser Arg Leu Glu His Gln Met Trp Glu Ala Val Lys Asp Glu Leu Asn Thr Leu Leu Lys Glu Asn Gly Val Asp Leu Ser Val Val Val Glu Lys Gln Glu Gly Met Tyr Lys Ser Ala Pro Lys Arg Leu Thr Ala Thr Thr Glu Lys Leu Glu Ile Gly Trp Lys Ala Trp Gly Lys Ser Ile Leu Phe Ala Pro Glu Leu Ala Asn Asn Thr Phe Val Val Asp Gly Pro Glu Thr Lys Glu Cys Pro Thr Gln Asn Arg Ala Trp Asn Ser Leu Glu Val Glu Asp Phe Gly Phe Gly Leu Thr Ser Thr Arg Met Phe Leu Lys Val Arg Glu Ser Asn Thr Thr Glu Cys Asp Ser Lys Ile Ile Gly Thr Ala Val Lys Asn Asn Leu Ala Ile His Ser Asp Leu Ser Tyr Trp Ile Glu Ser Arg Leu Asn Asp Thr Trp Lys Leu Glu Arg Ala Val Leu Gly Glu Val Lys Ser Cys Thr Trp Pro Glu Thr His Thr Leu Trp Gly Asp Gly Ile Leu Glu Ser Asp Leu Ile Ile Pro Val Thr Leu Ala Gly Pro Arg Ser Asn His Asn Arg Arg Pro Gly Tyr Lys Thr Gln Asn Gln Gly Pro Trp Asp Glu Gly Arg Val Glu Ile Asp Phe Asp Tyr Cys Pro Gly Thr Thr Val Thr Leu Ser Glu Ser Cys Gly His Arg Gly Pro Ala Thr Arg Thr Thr Thr Glu Ser Gly Lys Leu Ile Thr Asp Trp Cys Cys Arg Ser Cys Thr Leu Pro Pro Leu Arg Tyr Gln Thr Asp Ser Gly Cys Trp Tyr Gly Met Glu Ile Arg Pro Gin Arg His Asp Glu Lys Thr Leu Val Gln Ser Gln Val Asn Ala Tyr Asn Ala Asp Met Ile Asp Pro Phe Gln Leu Gly Leu Leu Val Val Phe Leu Ala Thr Gln Glu Val Leu Arg Lys Arg Trp Thr Ala Lys Ile Ser Met Pro Ala Ile Leu Ile Ala Leu Leu Val Leu Val Phe Gly Gly Ile Thr Tyr Thr Asp Val Leu Arg Tyr Val Ile Leu Val Gly Ala Ala Phe Ala Glu Ser Asn Ser Gly Gly Asp Val Val His Leu Ala Leu Met Ala Thr Phe Lys Ile Gln Pro Val Phe Met Val Ala Ser Phe Leu Lys Ala Arg Trp Thr Asn Gln Glu Asn Ile Leu Leu Met Leu Ala Ala Val Phe Phe Gln Met Ala Tyr His Asp Ala Arg Gln Ile Leu Leu Trp Glu Ile Pro Asp Val Leu Asn Ser Leu Ala Val Ala Trp Met Ile Leu Arg Ala Ile Thr Phe Thr Thr Thr Ser Asn Val Val Val Pro Leu Leu Ala Leu Leu Thr Pro Gly Leu Arg Cys Leu Asn Leu Asp Val Tyr Arg Ile Leu Leu Leu Met Val Gly Ile Gly Ser Leu Ile Arg Glu Lys Arg Ser Ala Ala Ala Lys Lys Lys Gly Ala Ser Leu Leu Cys Leu Ala Leu Ala Ser Thr Gly Leu Phe Asn Pro Met Ile Leu Ala Ala Gly Leu Ile Ala Cys Asp Pro Asn Arg Lys Arg Gly Trp Pro Ala Thr Glu Val Met Thr Ala Val Gly Leu Met Phe Ala Ile Val Gly Gly Leu Ala Glu Leu Asp Ile Asp Ser Met Ala Ile Pro Met Thr Ile Ala Gly Leu Met Phe Ala Ala Phe Val Ile Ser Gly Lys Ser Thr Asp Met Trp Ile Glu Arg Thr Ala Asp Ile Ser Trp Glu Ser Asp Ala Glu Ile Thr Gly Ser Ser Glu Arg Val Asp Val Arg Leu Asp Asp Asp Gly Asn Phe Gin Leu Met Asn Asp Pro Gly Ala Pro Trp Lys Ile Trp Met Leu Arg Met Val Cys Leu Ala Ile Ser Ala Tyr Thr Pro Trp Ala Ile Leu Pro Ser Val Val Gly Phe Trp Ile Thr Leu Gin Tyr Thr Lys Arg Gly Gly Val Leu Trp Asp Thr Pro Ser Pro Lys Glu Tyr Lys Lys Gly Asp Thr Thr Thr Gly Val Tyr Arg Ile Met Thr Arg Gly Leu Leu Gly Ser Tyr Gin Ala Gly Ala Gly Val Met Val Glu Gly Val Phe His Thr Leu Trp His Thr Thr Lys Gly Ala Ala Leu Met Ser Gly Glu Gly Arg Leu Asp Pro Tyr Trp Gly Ser Val Lys Glu Asp Arg Leu Cys Tyr Gly Gly Pro Trp Lys Leu Gln His Lys Trp Asn Gly Gln Asp Glu Val Gln Met Ile Val Val Glu Pro Gly Lys Asn Val Lys Asn Val Gln Thr Lys Pro Gly Val Phe Lys Thr Pro Glu Gly Glu Ile Gly Ala Val Thr Leu Asp Phe Pro Thr Gly Thr Ser Gly Ser Pro Ile Val Asp Lys Asn Gly Asp Val Ile Gly Leu Tyr Gly Asn Gly Val Ile Met Pro Asn Gly Ser Tyr Ile Ser Ala Ile Val Gln Gly Glu Arg Met Asp Glu Pro Ile Pro Ala Gly Phe Glu Pro Glu Met Leu Arg Lys Lys Gln Ile Thr Val Leu Asp Leu His Pro Gly Ala Gly Lys Thr Arg Arg Ile Leu Pro Gln Ile Ile Lys Glu Ala Ile Asn Arg Arg Leu Arg Thr Ala Val Leu Ala Pro Thr Arg Val Val Ala Ala Glu Met Ala Glu Ala Leu Arg Gly Leu Pro Ile Arg Tyr Gln Thr Ser Ala Val Pro Arg Glu His Asn Gly Asn Glu Ile Val Asp Val Met Cys His Ala Thr Leu Thr His Arg Leu Met Ser Pro His Arg Val Pro Asn Tyr Asn Leu Phe Val Met Asp Glu Ala His Phe Thr Asp Pro Ala Ser Ile Ala Ala Arg Gly Tyr Ile Ser Thr Lys Val Glu Leu Gly Glu Ala Ala Ala Ile Phe Met Thr Ala Thr Pro Pro Gly Thr Ser Asp Pro Phe Pro Glu Ser Asn Ser Pro Ile Ser Asp Leu Gln Thr Glu Ile Pro Asp Arg Ala Trp Asn Ser Gly Tyr Glu Trp Ile Thr Glu Tyr Thr Gly Lys Thr Val Trp Phe Val Pro Ser Val Lys Met Gly Asn Glu Ile Ala Leu Cys Leu Gln Arg Ala Gly Lys Lys Val Val Gln Leu Asn Arg Lys Ser Tyr Glu Thr Glu Tyr Pro Lys Cys Lys Asn Asp Asp Trp Asp Phe Val Ile Thr Thr Asp Ile Ser Glu Met Gly Ala Asn Phe Lys Ala Ser Arg Val Ile Asp Ser Arg Lys Ser Val Lys Pro Thr Ile Ile Thr Glu Gly Glu Gly Arg Val Ile Leu Gly Glu Pro Ser Ala Val Thr Ala Ala Ser Ala Ala Gln Arg Arg Gly Arg Ile Gly Arg Asn Pro Ser Gln Val Gly Asp Glu Tyr Cys Tyr Gly Gly His Thr Asn Glu Asp Asp Ser Asn Phe Ala His Trp Thr Glu Ala Arg Ile Met Leu Asp Asn Ile Asn Met Pro Asn Gly Leu Ile Ala Gln Phe Tyr Gln Pro Glu Arg Glu Lys Val Tyr Thr Met Asp Gly Glu Tyr Arg Leu Arg Gly Glu Glu Arg Lys Asn Phe Leu Glu Leu Leu Arg Thr Ala Asp Leu Pro Val Trp Leu Ala Tyr Lys Val Ala Ala Ala Gly Val Ser Tyr His Asp Arg Arg Trp Cys Phe Asp Gly Pro Arg Thr Asn Thr Ile Leu Glu Asp Asn Asn Glu Val Glu Val Ile Thr Lys Leu Gly Glu Arg Lys Ile Leu Arg Pro Arg Trp Ile Asp Ala Arg Val Tyr Ser Asp His Gln Ala Leu Lys Ala Phe Lys Asp Phe Ala Ser Gly Lys Arg Ser Gln Ile Gly Leu Ile Glu Val Leu Gly Lys Met Pro Glu His Phe Met Gly Lys Thr Trp Glu Ala Leu Asp Thr Met Tyr Val Val Ala Thr Ala Glu Lys Gly Gly Arg Ala His Arg Met Ala Leu Glu Glu Leu Pro Asp Ala Leu Gln Thr Ile Ala Leu Ile Ala Leu Leu Ser Val Met Thr Met Gly Val Phe 10 Phe Leu Leu Met Gln Arg Lys Gly Ile Gly Lys Ile Gly Leu Gly Gly Ala Val Leu Gly Val Ala Thr Phe Phe Cys Trp Met Ala Glu Val Pro Gly Thr Lys Ile Ala Gly Met Leu Leu Leu Ser Leu Leu Leu Met Ile Val Leu Ile Pro Glu Pro Glu Lys Gln Arg Ser Gln Thr Asp Asn Gln Leu Ala Val Phe Leu Ile Cys Val Met Thr Leu Val Ser Ala Val Ala Ala Asn Glu Met Gly Trp Leu Asp Lys Thr Lys Ser Asp Ile Ser Ser Leu Phe Gly Gln Arg Ile Glu Val Lys Glu Asn Phe Ser Met Gly Glu Phe Leu Leu Asp Leu Arg Pro Ala Thr Ala Trp Ser Leu Tyr Ala Val Thr Thr Ala Val Leu Thr Pro Leu Leu Lys His Leu Ile Thr Ser Asp Tyr Ile Asn Thr Ser Leu Thr Ser Ile Asn Val Gln Ala Ser Ala Leu Phe Thr Leu Ala Arg Gly Phe Pro Phe Val Asp Val Gly Val Ser Ala Leu Leu Leu Ala Ala Gly Cys Trp Gly Gln Val Thr Leu Thr Val Thr Val Thr Ala Ala Thr Leu Leu Phe Cys His Tyr Ala Tyr Met Val Pro Gly Trp Gln Ala Glu Ala Met Arg Ser Ala Gln Arg Arg Thr Ala Ala Gly Ile Met Lys Asn Ala Val Val Asp Gly Ile Val Ala Thr Asp Val Pro Glu Leu Glu Arg Thr Thr Pro Ile Met Gln Lys Lys Val Gly Gln Ile Met Leu Ile Leu Val Ser Leu Ala Ala Val Val Val Asn Pro Ser Val Lys Thr Val Arg Glu Ala Gly Ile Leu Ile Thr Ala Ala Ala Val Thr Leu Trp Glu Asn Gly Ala Ser Ser Val Trp Asn Ala Thr Thr Ala Ile Gly Leu Cys His Ile Met Arg Gly Gly Trp Leu Ser Cys Leu Ser Ile Thr Trp Thr Leu Ile Lys Asn Met Glu Lys Pro Gly Leu Lys Arg Gly Gly Ala Lys Gly Arg Thr Leu Gly Glu Val Trp Lys Glu Arg Leu Asn Gln Met Thr Lys Glu Glu Phe Thr Arg Tyr Arg Lys Glu Ala Ile Ile Glu Val Asp Arg Ser Ala Ala Lys His Ala Arg Lys Glu Gly Asn Val Thr Gly Gly His Pro Val Ser Arg Gly Thr Ala Lys Leu Arg Trp Leu Val Glu Arg Arg Phe Leu Glu Pro Val Gly Lys Val Ile Asp Leu Gly Cys Gly Arg Gly Gly Trp Cys Tyr Tyr Met Ala Thr Gln Lys Arg Val Gln Glu Val Arg Gly Tyr Thr Lys Gly Gly Pro Gly His Glu Glu Pro Gln Leu Val Gln Ser Tyr Gly Trp Asn Ile Val Thr Met Lys Ser Gly Val Asp Val Phe Tyr Arg Pro Ser Glu Cys Cys Asp Thr Leu Leu Cys Asp Ile Gly Glu Ser Ser Ser Ser Ala Glu Val Glu Glu His Arg Thr Ile Arg Val Leu Glu Met Val Glu Asp Trp Leu His Arg Gly Pro Arg Glu Phe Cys Val Lys Val Leu Cys Pro Tyr Met Pro Lys Val Ile Glu Lys Met Glu Leu Leu Gin Arg Arg Tyr Gly Gly Gly Leu Val Arg Asn Pro Leu Ser Arg Asn Ser Thr His Glu Met Tyr Trp Val Ser Arg Ala Ser Gly Asn Val Val His Ser Val Asn Met Thr Ser Gin Val Leu Leu Gly Arg Met Glu Lys Arg Thr Trp Lys Gly Pro Gin Tyr Glu Glu Asp Val Asn Leu Gly Ser Gly Thr Arg Ala Val Gly Lys Pro Leu Leu Asn Ser Asp Thr Ser Lys Ile Lys Asn Arg Ile Glu Arg Leu Arg Arg Glu Tyr Ser Ser Thr Trp His His Asp Glu Asn His Pro Tyr Arg Thr Trp Asn Tyr His Gly Ser Tyr Asp Val Lys Pro Thr Gly Ser Ala Ser Ser Leu Val Asn Gly Val Val Arg Leu Leu Ser Lys Pro Trp Asp Thr Ile Thr Asn Val Thr Thr Met Ala Met Thr Asp Thr Thr Pro Phe Gly Gin Gin Arg Val Phe Lys Glu Lys Val Asp Thr Lys Ala Pro Glu Pro Pro Glu Gly Val Lys Tyr Val Leu Asn Glu Thr Thr Asn Trp Leu Trp Ala Phe Leu Ala Arg Glu Lys Arg Pro Arg Met Cys Ser Arg Glu Glu Phe Ile Arg Lys Val Asn Ser Asn Ala Ala Leu Gly Ala Met Phe Glu Glu Gin Asn Gin Trp Arg Ser Ala Arg Glu Ala Val Glu Asp Pro Lys Phe Trp Glu Met Val Asp Glu Glu Arg Glu Ala His Leu Arg Gly Glu Cys His Thr Cys Ile Tyr Asn Met Met Gly Lys Arg Glu Lys Lys Pro Giy Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile Trp Phe Met Trp Leu Gly Ala Arg Phe Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu Asp His Trp Leu Gly Arg Lys Asn Ser Gly Gly Gly Val Glu Gly Leu Gly Leu Gln Lys Leu Gly Tyr Ile Leu Arg Glu Val Gly Thr Arg Pro Gly Gly Lys Ile Tyr Ala Asp Asp Thr Ala Gly Trp Asp Thr Arg Ile Thr Arg Ala Asp Leu Glu Asn Glu Ala Lys Val Leu Glu Leu Leu Asp Gly Glu His Arg Arg Leu Ala Arg Ala Ile Ile Glu Leu Thr Tyr Arg His Lys Val Val Lys Val Met Arg Pro Ala Ala Asp Gly Arg Thr Val Met Asp Val Ile Ser Arg Glu Asp Gln Arg Gly Ser Gly Gln Val Val Thr Tyr Ala Leu Asn Thr Phe Thr Asn Leu Ala Val Gln Leu Val Arg Met Met Glu Gly Glu Gly Val Ile Gly Pro Asp Asp Val Glu Lys Leu Thr Lys Gly Lys Gly Pro Lys Val Arg Thr Trp Leu Phe Glu Asn Gly Glu Glu Arg Leu Ser Arg Met Ala Val Ser Gly Asp Asp Cys Val Val Lys Pro Leu Asp Asp Arg Phe Ala Thr Ser Leu His Phe Leu Asn Ala Met Ser Lys Val Arg Lys Asp Ile Gln Glu Trp Lys Pro Ser Thr Gly Trp Tyr Asp Trp Gln Gln Val Pro Phe Cys Ser Asn His Phe Thr Glu Leu Ile Met Lys Asp Gly Arg Thr Leu Val Val Pro Cys Arg Gly Gln Asp Glu Leu Val Gly Arg Ala Arg Ile Ser Pro Gly Ala Gly Trp Asn Val Arg Asp Thr Ala Cys Leu Ala Lys Ser Tyr Ala Gln Met Trp Leu Leu Leu Tyr Phe His Arg Arg Asp Leu Arg Leu Met Ala Asn Ala Ile Cys Ser Ala Val Pro Val Asn Trp Val Pro Thr Gly Arg Thr Thr Trp Ser Ile His Ala Gly Gly Glu Trp Met Thr Thr Glu Asp Met Leu Glu Val Trp Asn Arg Val Trp Ile Glu Glu Asn Glu Trp Met Glu Asp Lys Thr Pro Val Glu Lys Trp Ser Asp Val Pro Tyr Ser Gly Lys Arg Glu Asp Ile Trp Cys Gly Ser Leu Ile Gly Thr Arg Ala Arg Ala Thr Trp Ala Glu Asn Ile Gln Val Ala Ile Asn Gln Val Arg Ala Ile Ile Gly Asp Glu Lys Tyr Val Asp Tyr Met Ser Ser Leu Lys Arg Tyr Glu Asp Thr Thr Leu Val Glu Asp Thr Val Leu

Claims (13)

CLAIMS:

1. A composition comprising a pharmaceutically acceptable vehicle or excipient, and a vector comprising a recombinant canarypox virus that encodes and expresses in vivo in an animal West Nile Virus (WNV) polyprotein prM-M-E.

2. The composition of claim 1, wherein the canarypox virus is ALVAC.

3. The composition of claim 2, wherein the recombinant ALVAC virus is vCP2017.

4. The composition of claim 1, wherein the nucleic acid molecule comprises nucleotides 466-741, 742-966 and 967-2469 of GenBank AF196835(SEQ ID NO: 30) encoding WNV prM, M and E, respectively.

5. The composition of claim 1, wherein the nucleic acid molecule comprises nucleotides 466-2469 of GenBank AF196835(SEQ ID NO: 30) encoding WNV protein prM-M-E.

6. The composition of claim 1, wherein the nucleic acid molecule comprises nucleotides 421-2469 of GenBank AF196835(SEQ ID NO: 30) encoding WNV protein prM-M-E and the signal peptide of prM.

7. The composition of any one of claims 1 to 6, further comprising an adjuvant.

8. The composition according to claim 7, wherein the adjuvant is a carborner.

9. The composition of any one of claims 1 to 8 further comprising an antigen or immunogen or epitope thereof of a pathogen other than WNV of the animal, or a vector that contains and expresses in vivo in the animal a nucleic acid molecule encoding the antigen, immunogen or epitope thereof, or an inactivated or attenuated pathogen other than WNV of the animal.

10. The composition of any one of claims 1 to 9, wherein the animal is a cat or a horse.

11. Use, for inducing a protective immune response against WNV in an animal, of the composition according to any one of claims 1 to 8.

12. Use, for inducing a protective immune response against WNV in an animal, of (a) the composition according to any one of claims 1 to 8, and (b) a WNV isolated antigen, immunogen or epitope thereof, wherein (a) is adapted for administration prior to (b) in a prime-boost regimen, or (b) is adapted for administration prior to (a) in a prime-boost regimen, or (a) and (b) are adapted for administration either sequentially or in admixture.

13. The use of claim 11 or 12, wherein the animal is a cat or a horse.