CA2448112A1 - Lces as modifiers of the p53 pathway and methods of use - Google Patents

Abstract

Human LCE genes are identified as modulators of the p53 pathway, and thus are therapeutic targets for disorders associated with defective p53 function.
Methods for identifying modulators of p53, comprising screening for agents that modulate the activity of LCE are provided.

Description

LCEs AS MODIFIERS OF THE p53 PATHWAY AND METHODS OF USE
REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. provisional patent applications 60/296,076 filed 6/5/2001, 60/328,605 filed 10/10/2001, 60/357,253 filed 2/15/2002, and 60/361,196 filed 3/1/2002. The contents of the prior applications are hereby incorporated in their entirety.
BACKGROUND OF THE INVENTION
The p53 gene is mutated in over 50 different types of human cancers, including familial and spontaneous cancers, and is believed to be the most commonly mutated gene in human cancer (Zambetti and Levine, FASEB (1993) 7:855-865; Hollstein, et al., Nucleic Acids Res. (1994) 22:3551-3555). Greater than 90% of mutations in the p53 gene are missense mutations that alter a single amino acid that inactivates p53 function.
Aberrant forms of human p53 are associated with poor prognosis, more aggressive tumors, metastasis, and short survival rates (Mitsudomi et al., Clin Cancer Res 2000 Oct;
6(10):4055-63; Koshland, Science (1993) 262:1953).
The human p53 protein normally functions as a central integrator of signals including DNA damage, hypoxia, nucleotide deprivation, and oncogene activation (Prives, Cell (1998) 95:5-8). In response to these signals, p53 protein levels are greatly increased with the result that the accumulated p53 activates cell cycle arrest or apoptosis depending on the nature and strength of these signals. Indeed, multiple lines of experimental evidence have pointed to a key role for p53 as a tumor suppressor (Levine, Cell (1997) 88:323-331).
For example, homozygous p53 "knockout" mice are developmentally normal but exhibit nearly 100% incidence of neoplasia in the first year of life (Donehower et al., Nature (1992) 356:215-221).
The biochemical mechanisms and pathways through which p53 functions in normal and cancerous cells are not fully understood, but one clearly important aspect of p53 function is its activity as a gene-specific transcriptional activator. Among the genes with known p53-response elements are several with well-characterized roles in either regulation of the cell cycle or apoptosis, including GADD45, p21/Waf1/Cipl, cyclin G, Bax, IGF-BP3, and MDM2 (Levine, Cell (1997) 88:323-331).
Several essential organs (e.g., lungs, kidney, lymphatic system and vasculature) are made up of complex networks of tube-like structures that serve to transport and exchange fluids, gases, nutrients and waste. The formation of these complex branched networks occurs by the evolutionarily conserved process of branching morphogenesis, in which successive ramification occurs by sprouting, pruning and remodeling of the network.
During human embryogenesis, blood vessels develop via two processes:
vasculogenesis, whereby endothelial cells are born from progenitor cell types; and angiogenesis, in which new capillaries sprout from existing vessels.
Branching morphogenesis encompasses many cellular processes, including proliferation, survival/apoptosis, migration, invasion, adhesion, aggregation and matrix remodeling. Numerous cell types contribute to branching morphogenesis, including endothelial, epithelial and smooth muscle cells, and monocytes. Gene pathways that modulate the branching process function both within the branching tissues as well as in other cells, e.g., certain monocytes can promote an angiogenic response even though they may not directly participate in the formation of the branch structures.
An increased level of angiogenesis is central to several human disease pathologies, including rheumatoid arthritis and diabetic retinopathy, and, significantly, to the growth, maintenance and metastasis of solid tumors (for detailed reviews see Liotta LA
et al, 1991, Cell 64:327-336; Folkman J., 1995 Nature Medicine 1:27-31; Hanahan D and Folkman J, 1996 Cell 86:353-364). Impaired angiogenesis figures prominently in other human diseases, including heart disease, stroke, infertility, ulcers and scleroderma.
The transition from dormant to active blood vessel formation involves modulating the balance between angiogenic stimulators and inhibitors. Under certain pathological circumstances an imbalance arises between local inhibitory controls and angiogenic inducers resulting in excessive angiogenesis, while under other pathological conditions an imbalance leads to insufficient angiogenesis. This delicate equilibrium of pro-and anti angiogenic factors is regulated by a complex interaction between the extracellular matrix, endothelial cells, smooth muscle cells, and various other cell types, as well as environmental factors such as oxygen demand within tissues.
Most known angiogenesis genes, their biochemical activities, and their organization into signaling pathways are employed in a similar fashion during angiogenesis in human, mouse and Zebrafish, as well as during branching morphogenesis of the Drosoplvila trachea. Accordingly, Drosophila tracheal development and zebrafish vascular development provide useful models for studying mammalian angiogenesis (Metzger RJ, Krasnow MA. Science. 1999. 284:1635-9; Roman BL, and Weinstein BM. Bioessays 2000, 22:882-93).

In mammals, most of the fatty acids that are synthesized de novo possess chain lengths of 16-18 carbons. These long chain fatty acids constitute more than 90% of all fatty acids present in cells. They are important components of membranes, and they represent the largest energy storage reservoir in animals. The highest rate of de novo fatty acid synthesis occurs in liver, which converts excess glucose into fatty acids for storage and transport. Glycolysis converts glucose to pyruvate, which is converted to ciliate in the mitochondria and transported to the cytosol. Cytosolic ATP citrate lyase generates acetyl-CoA, the precursor of fatty acids and cholesterol. Acetyl-CoA is carboxylated by acetyl-CoA carboxylase (ACC) to form malonyl-CoA. The multifunction enzyme fatty acid synthase (FAS) uses malonyl-CoA, acetyl-CoA, and NADPH to elongate fatty acids in 2-carbon increments. The principal end product of FAS in rodents is palmitic acid, which contains 16 carbons and is designated 16:0. A high proportion of this palmitic acid is then converted to stearate.
At a molecular Ievel, fatty acid elongases have been characterized most extensively by genetic studies in yeast. Yeast EL01 elongates C14 to C16 fatty acids and is designated a long chain fatty acid elongase (Toke DA et al, 1996, J Biol Chem 271:18413-18422). The EL02 and EL03 genes encode very long chain elongases that produce fatty acids of 24 to 26 carbons (Oh CS et al, 1997, J Biol Chem 272:17376-17384). The mouse gene, Cig30, encodes the mouse version of EL02, and Sscl encodes the ortholog of EL03, both of which are very long chain elongases (Tvrdik P et al., 2000, J Cell Biol 149:707-718).
CIG30 and other Fatty acid elongases have been implicated in sphingolipid biosynthesis.
In certain cells, sphingosine kinase is exported to extracellular space, where it phosphorylates sphingosine to make phospho-sphingosine (S1P) (Hla et al., Science 2001, 294:1875-8). S1P is a potent second messenger that binds to the EDGl GPCR to mediate ' migration, survival, morphogenesis and proliferation. S1P and EDGl have been shown to be involved in endothelial cell migration and vascular maturation in vivo (Ancellin et al., J
Biol Chem 2002, 277:6667-75).
A murine long chain fatty acyl elongase (LCE) that shares sequence identity with previously identified very long chain fatty acid elongases has been identified. LCE
mRNA is highly expressed in liver and adipose tissue and is thought to catalyze the rate limiting condensing step in addition of 2-carbon units to C12-C16 fatty acids (Moon YA
et al., 2001, J Biol Chem 276:45358-66). One of the human LCE genes, ELOVIA~, has been identified as a disease gene -Autosomal Dominant Stargardt-like Macular Dystrophy (STGD3) - associated with inherited forms of macular degeneration characterized by decreased visual acuity, macular atrophy and extensive fundus flecks (Zhang et al., Nat Genet 2001, 27:89-93). AlI afflicted members in five related families carry a 5 by deletion (the so-called 797-801 del AACTT) of the gene.
The ability to manipulate the genomes of model organisms such as Drosophila provides a powerful means to analyze biochemical processes that, due to significant evolutionary conservation, have direct relevance to more complex vertebrate organisms.
Due to a high level of gene and pathway conservation, the strong similarity of cellular processes, and the functional conservation of genes between these model organisms and mammals, identification of the involvement of novel genes in particular pathways and their functions in such model organisms can directly contribute to the understanding of the correlative pathways and methods of modulating them in mammals (see, for example, Mechler BM et al., 1985 EMBO J 4:1551-1557; Gateff E. 1982 Adv. Cancer Res.
37: 33-74; Watson KL., et al., 1994 J Cell Sci. 18: 19-33; Miklos GL, and Rubin GM.
1996 Cell 86:521-529; Wassarman DA, et al., 1995 Curr Opin Gen Dev 5: 44-50; and Booth DR.
1999 Cancer Metastasis Rev. 18: 261-284). For example, a genetic screen can be carried out in an invertebrate model organism having underexpression (e.g. knockout) or overexpression of a gene (referred to as a "genetic entry point") that yields a visible phenotype, Additional genes are mutated in a xandom or targeted manner. When a gene mutation changes the original phenotype caused by the mutation in the genetic entry point, the gene is identified as a "modifier" involved in the same or overlapping pathway as the genetic entry point. When the genetic entry point is an ortholog of a human gene implicated in a disease pathway, such as p53, modifier genes can be identified that may be attractive candidate targets for novel therapeutics.
All references cited herein, including sequence information in referenced Genbank identifier numbers and website references, are incorporated herein in their entireties.

We have discovered genes that modify the p53 pathway in Drosophila, and identified their human orthologs, hereinafter referred to as LCEs, The invention provides methods for utilizing these p53 modifier genes and polypeptides to identify candidate therapeutic agents that can be used in the treatment of disorders associated with defective p53 function. Preferred LCE-modulating agents specifically bind to LCE
polypeptides and restore p53 function. Other preferred LCE-modulating agents are nucleic acid modulators such as antisense oligomers and RNAi that repress LCE gene expression or product activity by, for example, binding to and inhibiting the respective nucleic acid (i.e. DNA or mRNA).
LCE-specific modulating agents may be evaluated by any convenient in vitro or in vivo assay for molecular interaction with an LCE polypeptide or nucleic acid.
In one embodiment, candidate p53 modulating agents are tested with an assay system comprising a LCE polypeptide or nucleic acid. Candidate agents that produce a change in the activity of the assay system relative to controls are identified as candidate p53 modulating agents.
The assay system may be cell-based or cell-free. LCE-modulating agents include LCE
related proteins (e.g. dominant negative mutants, and biotherapeutics); LCE-specific antibodies; LCE-specific antisense oligomers and other nucleic acid modulators; and chemical agents that specifically bind LCE or compete with LCE binding target.
In one specific embodiment, a small molecule modulator is identified using a binding assay. In specific embodiments, the screening assay system is selected from an apoptosis assay, a cell proliferation assay, an angiogenesis assay, and a hypoxic induction assay.
In another embodiment, candidate p53 pathway modulating agents are further tested using a second assay system that detects changes in the p53 pathway, such as angiogenic, apoptotic, or cell proliferation changes produced by the originally identified candidate agent or an agent derived from the original agent. The second assay system may use cultured cells or non-human animals. In specific embodiments, the secondary assay system uses non-human animals, including animals predetermined to have a disease or disorder implicating the p53 pathway, such as an angiogenic, apoptotic, or cell proliferation disorder (e.g. cancer).
The invention further provides methods for modulating the p53 pathway in a mammalian cell by contacting the mammalian cell with an agent that specifically binds a LCE polypeptide or nucleic acid. The agent may be a small molecule modulator, a nucleic acid modulator, or an antibody and may be administered to a mammalian animal predetermined to have a pathology associated the p53 pathway.
The invention further provides methods of identifying candidate branching morphogenesis modulating agents and methods of modulating branching morphogenesis in mammalian cells using an LCE.
DETAILED DESCRIPTION OF THE INVENTION
Genetic screens were designed to identify modifiers of the p53 pathway in Drosoplaila in which p53 was overexpressed in the wing (Ollmann M, et al., Cell 2000 101:
91-101).

The baldspot gene was identified as a modifier of the p53 pathway.
Accordingly, vertebrate orthologs of these modifiers, and preferably the human orthologs, LCE genes (i.e., nucleic acids and polypeptides) are attractive drug targets for the treatment of pathologies associated with a defective p53 signaling pathway, such as cancer.
We have further identified an LCE (ELOVL4) that is involved in branching morphogenesis, specifically angiogenesis and vasculogenesis, as further described in the Examples. Accordingly, ELOVL4 is an attractive drug target for the treatment of pathologies related to branching morphogenesis, including the treatment of tumors whose growth is associated with increased angiogenesis.
In vitro and in vivo methods of assessing LCE function are provided herein.
Modulation of the LCE or their respective binding partners is useful for understanding the association of the p53 pathway and its members in normal and disease conditions and for developing diagnostics and therapeutic modalities for p53 related pathologies.
Modulation of the ELOVL4 or its binding partners is further useful for elucidating the process of branching morphogenesis and the association of branching morphogenesis with the p53 pathway, and for developing diagnostic and therapeutic modalities for pathologies associated with the branching morphogenesis. As used herein, branching morphogenesis encompasses the numerous cellular process involved in the formation of branched networks, including proliferation, survival/apoptosis, migration, invasion, adhesion, aggregation and matrix remodeling. As used herein, pathologies associated with branching morphogenesis encompass pathologies where branching morphogenesis contributes to maintaining the healthy state, as well as pathologies whose course may be altered by modulation of the branching morphogenesis.
LCE-modulating agents that act by inhibiting or enhancing LCE expression, directly or indirectly, for example, by affecting an LCE function such as enzymatic (e.g., catalytic) or binding activity, can be identified using methods provided herein. LCE
modulating agents are useful in diagnosis, therapy and pharmaceutical development.
Nucleic acids and nolypentides of the invention Sequences related to LCE nucleic acids and polypeptides that can be used in the invention are disclosed in Genbank (referenced by Genbank identifier (GI) number) as GI#s 10444344 (SEQ ID NO:1), 13129087 (SEQ ID N0:3), 10440044 (SEQ ID N0:4), 12044042 (SEQ )D N0:5), 12232378 (SEQ m N0:6), and 18576451 (SEQ 1D N0:8) for nucleic acid, and GI#s 10444345 (SEQ m N0:9), 13129088 (SEQ ~ N0:11), 10440045 ac (SEQ ID N0:12), 12044043 (SEQ 1D N0:13), 12232379 (SEQ ID N0:14), and 17454617 (SEQ B7 N0:16) for polypeptides. Additionally, nucleic acid sequences of SEQ
ID NOs:
2 and 7, and polypeptide sequences of SEQ ID NOs: 10 and 15 can also be used in the invention.
LCEs are fatty acid elongase proteins with GNS1/SUR4 domains. The term "LCE
polypeptide" refers to a full-length LCE protein or a functionally active fragment or derivative thereof. A "functionally active" LCE fragment or derivative exhibits one or more functional activities associated with a full-length, wild-type LCE
protein, such as antigenic or immunogenic activity, enzymatic activity, ability to bind natural cellular substrates, etc. The functional activity of LCE proteins, derivatives and fragments can be assayed by various methods known to one skilled in the art (Current Protocols in Protein Science (1998) Coligan et al., eds., John Wiley & Sons, Inc., Somerset, New Jersey) and as further discussed below. For purposes herein, functionally active fragments also include those fragments that comprise one or more structural domains of an LCE, such as a binding domain. Protein domains can be identified using the PFAM program (Bateman A., et al., Nucleic Acids Res, 1999, 27:260-2; http://pfam.wustl.edu). For example, the GNS1/SUR4 domain (PFAM 01151) of LCE from GI#s 10444345, 13129088, 12232379, and 17454617 (SEQ ID NOs:9, I I, I4, and 16, respectively) are located respectively at approximately amino acid residues 1-235, 10 to 265, 9 to 289, and 55 to 270.
Methods for obtaining LCE polypeptides are also further described below. In some embodiments, preferred fragments are functionally active, domain-containing fragments comprising at least 25 contiguous amino acids, preferably at least 50, more preferably 75, and most preferably at least 100 contiguous amino acids of any one of SEQ ID NOs:9, 10, 11, 12, 13, 14, 15, or 16 (an LCE). In further preferred embodiments, the fragment comprises the entire GNS 1/SUR4 (functionally active) domain.
The term "LCE nucleic acid" refers to a I~NA or RNA molecule that encodes a LCE
polypeptide. Preferably, the LCE polypeptide or nucleic acid or fragment thereof is from a human, but can also be an ortholog, or derivative thereof with at least 70%
sequence identity, preferably at least 80%, more preferably 85%, still more preferably 90%, and most preferably at least 95% sequence identity with LCE. Normally, orthologs in different species retain the same function, due to presence of one or more protein motifs and/or 3-dimensional structures. Orthologs are generally identified by sequence homology analysis, such as BLAST analysis, usually using protein bait sequences.
Sequences are assigned as a potential ortholog if the best hit sequence from the forward BLAST result retrieves the original query sequence in the reverse BLAST (Huynen MA and Bork P, Proc Natl Acad Sci (1998) 95:5849-5856; Huynen MA et al., Genome Research (2000) 10:1204-1210). Programs for multiple sequence alignment, such as CLUSTAL
(Thompson JD et al, 1994, Nucleic Acids Res 22:4673-4680) may be used to highlight conserved regions and/or residues of orthologous proteins and to generate phylogenetic trees. In a phylogenetic tree representing multiple homologous sequences from diverse species (e.g., retrieved through BLAST analysis), orthologous sequences from two species generally appear closest on the tree with respect to all other sequences from these two species. Structural threading or other analysis of protein folding (e.g., using software by ProCeryon, Biosciences, Salzburg, Austria) may also identify potential orthologs. In evolution, when a gene duplication event follows speciation, a single gene in one species, such as Drosophila, may correspond to multiple genes (paralogs) in another, such as human. As used herein, the term "orthologs" encompasses paralogs. As used herein, "percent (%) sequence identity" with respect to a subject sequence, or a specified portion of a subject sequence, is defined as the percentage of nucleotides or amino acids in the candidate derivative sequence identical with the nucleotides or amino acids in the subject sequence (or specified portion thereof), after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent sequence identity, as generated by the program WU-BLAST-2.Oa19 (Altschul et al., J. Mol. Biol. (1997) 215:403-410;
http://blast.wustl.edu/blast/README.html) with all the search parameters set to default values. The HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. A %
identity value is determined by the number of matching identical nucleotides or amino acids divided by the sequence length for which the percent identity is being reported.
"Percent (%) amino acid sequence similarity" is determined by doing the same calculation as for determining % amino acid sequence identity, but including conservative amino acid substitutions in addition to identical amino acids in the computation.
A conservative amino acid substitution is one in which an amino acid is substituted for another amino acid having similar properties such that the folding or activity of the protein is not significantly affected. Aromatic amino acids that can be substituted for each other are phenylalanine, tryptophan, and tyrosine; interchangeable hydrophobic amino acids are leucine, isoleucine, methionine, and valine; interchangeable polar amino acids are glutamine and asparagine; interchangeable basic amino acids are arginine, lysine and histidine; interchangeable acidic amino acids are aspartic acid and glutamic acid; and interchangeable small amino acids are alanine, serine, threonine, cysteine and glycine.
Alternatively, an alignment for nucleic acid sequences is provided by the local homology algoritlun of Smith and Waterman (Smith and Waterman, 1981, Advances in Applied Mathematics 2:482-489; database: European Bioinformatics Institute http:l/www.ebi.ac.uk/MPsrch/; Smith and Waterman, 1981, J. of Molec.Biol., 147:195-197; Nicholas et al., 1998, "A Tutorial on Searching Sequence Databases and Sequence Scoring Methods" (www.psc.edu) and references cited therein.; W.R. Pearson, 1991, Genomics 11:635-650). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Dayhoff (Dayhoff: Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA), and normalized by Crribskov (Gribskov 1986 Nucl. Acids Res. 14(6):6745-6763). The Smith-Waterman algorithm may be employed where default parameters are used for scoring (for example, gap open penalty of 12, gap extension penalty of two). From the data generated, the "Match" value reflects "sequence identity."
Derivative nucleic acid molecules of the subject nucleic acid molecules include sequences that hybridize to the nucleic acid sequence of any of SEQ ID NOs: l, 2, 3, 4, 5 ,6 7, or 8. The stringency of hybridization can be controlled by temperature, ionic strength, pH, and the presence of denaturing agents such as formamide during hybridization and washing. Conditions routinely used are set out in readily available procedure texts (e.g., Current Protocol in Molecular Biology, Vol. l, Chap.
2.10, John Wiley & Sons, Publishers (1994); Sambrook et al., Molecular Cloning, Cold Spring Harbor (19$9)). In some embodiments, a nucleic acid molecule of the invention is capable of hybridizing to a nucleic acid molecule containing the nucleotide sequence of any one of SEQ ID NOs:l, 2, 3, 4, 5, 6, 7, or 8 under stringent hybridization conditions that comprise:
prehybridization of filters containing nucleic acid for 8 hours to overnight at 65° C in a solution comprising 6X single strength citrate (SSC) (1X SSC is 0.15 M NaCI, 0.015 M
Na citrate; pH 7.0), 5X Denhardt's solution, 0.05% sodium pyrophosphate and 100 ~,g/ml herring sperm DNA; hybridization for 18-20 hours at 65° C in a solution containing 6X
SSC, 1X Denhardt's solution, 100 ,uglml yeast tRNA and 0.05% sodium pyrophosphate;
and washing of filters at 65° C for 1h in a solution containing 0.2X
SSC and 0.1% SDS
(sodium dodecyl sulfate).

In other embodiments, moderately stringent hybridization conditions are used that comprise: pretreatment of filters containing nucleic acid for 6 h at 40° C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH7.5), SmM EDTA, 0.1 % PVP, 0.1 % Ficoll, 1 % BSA, and 500 ~,g/ml denatured salmon sperm DNA;
hybridization for 18-20h at 40° C in a solution containing 35% formamide, 5X SSC, 50 mM
Tris-HCl (pH7.5), 5mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 ~.g/ml salmon sperm DNA, and 10% (wt/vol) dextran sulfate; followed by washing twice for 1 hour at 55° C in a solution containing 2X SSC and 0.1% SDS.
Alternatively, low stringency conditions can be used that comprise: incubation for 8 hours to overnight at 37° C in a solution comprising 20% forrnamide, 5 x SSC, 50 mM
sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20 p,g/ml denatured sheared salmon sperm DNA; hybridization in the same buffer for 18 to hours; and washing of filters in 1 x SSC at about 37° C for 1 hour.
Isolation, Production, Expression, and Mis-expression of LCE Nucleic Acids and Polypeptides LCE nucleic acids and polypeptides, useful for identifying and testing agents that modulate LCE function and for other applications related to the involvement of LCE in the p53 pathway. LCE nucleic acids and derivatives and orthologs thereof may be obtained using any available method. For instance, techniques for isolating cDNA or genomic DNA sequences of interest by screening DNA libraries or by using polymerase chain reaction (PCR) are well known in the art. In general, the particular use for the protein will dictate the particulars of expression, production, and purification methods.
For instance, production of proteins for use in screening for modulating agents may require methods that preserve specific biological activities of these proteins, whereas production of proteins for antibody generation may require structural integrity of particular epitopes. Expression of proteins to be purified for screening or antibody production may require the addition of specific tags (e.g., generation of fusion proteins). Overexpression of an LCE
protein for assays used to assess LCE function, such as involvement in cell cycle regulation or hypoxic response, may require expression in eukaryotic cell lines capable of these cellular activities. Techniques for the expression, production, and purification of proteins are well known in the art; any suitable means therefore may be used (e.g., Higgins SJ
and Hames BD (eds.) Protein Expression: A Practical Approach, Oxford University Press Inc., New York 1999; Stanbury PF et al., Principles of Fermentation Technology, 2nd edition, Elsevier Science, New York, 1995; Doonan S (ed.) Protein Purification Protocols, Humana Press, New Jersey, 1996; Coligan JE et al, Current Protocols in Protein Science (eds.), 1999, John Wiley & Sons, New York). In particular embodiments, recombinant LCE is expressed in a cell line known to have defective p53 function (e.g.

osteoblasts, H1299 lung cancer cells, C33A and HT3 cervical cancer cells, HT-29 and DLD-1 colon cancer cells, among others, available from American Type Culture Collection (ATCC), Manassas, VA). The recombinant cells are used in cell-based screening assay systems of the invention, as described further below.
The nucleotide sequence encoding an LCE polypeptide can be inserted into any appropriate expression vector. The necessary transcriptional and translational signals, including promoter/enhancer element, can derive from the native LCE gene and/or its flanking regions or can be heterologous. A variety of host-vector expression systems may be utilized, such as mammalian cell systems infected with virus (e.g. vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g. baculovirus);
microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, plasmid, or cosnnid DNA. A host cell strain that modulates the expression of, modifies, andJor specifically processes the gene product may be used.
To detect expression of the LCE gene product, the expression vector can comprise a promoter operably linked to an LCE gene nucleic acid, one or more origins of replication, and, one or more selectable markers (e.g. thymidine kinase activity, resistance to antibiotics, etc.). Alternatively, recombinant expression vectors can be identified by assaying for the expression of the LCE gene product based on the physical or functional properties of the LCE protein in in vitro assay systems (e.g. immunoassays).
The LCE protein, fragment, or derivative may be optionally expressed as a fusion, or chimeric protein product (i.e. it is joined via a peptide bond to a heterologous protein sequence of a different protein), for example to facilitate purification or detection. A
chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other using standard methods and expressing the chimeric product. A chimeric product may also be made by protein synthetic techniques, e.g. by use of a peptide synthesizer (Hunkapiller et al., Nature (1984) 310:105-111).
Once a recombinant cell that expresses the LCE gene sequence is identified, the gene product can be isolated and purified using standard methods (e.g. ion exchange, affinity, and gel exclusion chromatography; centrifugation; differential solubility;
electrophoresis).
Alternatively, native LCE proteins can be purified from natural sources, by standard methods (e.g. immunoaffinity purification). Once a protein is obtained, it may be quantified and its activity measured by appropriate methods, such as immunoassay, bioassay, or other measurements of physical properties, such as crystallography.
The methods of this invention may also use cells that have been engineered for altered expression (mis-expression) of LCE or other genes associated with the p53 pathway. As used herein, mis-expression encompasses ectopic expression, over-expression, under-expression, and non-expression (e.g. by gene knock-out or blocking expression that would otherwise normally occur).
Genetically modified animals Animal models that have been genetically modified to alter LCE expression may be used in iya vivo assays to test for activity of a candidate p53 modulating agent, or t~ further assess the role of LCE in a p53 pathway process such as apoptosis or cell proliferation.
Preferably, the altered LCE expression results in a detectable phenotype, such as decreased or increased levels of cell proliferation, angiogenesis, or apoptosis compared to control animals having normal LCE expression. The genetically modified animal may additionally have altered p53 expression (e.g. p53 knockout). Preferred genetically modified animals are mammals such as primates, rodents (preferably mice), cows, horses, goats, sheep, pigs, dogs and cats. Preferred non-mammalian species include zebrafish, C.
elegans, and Drosophila. Preferred genetically modified animals are transgenic animals having a heterologous nucleic acid sequence present as an extrachromosomal element in a portion of its cells, i.e. mosaic animals (see, for example, techniques described by Jakobovits, 1994, Curr. Biol. 4:761-763.) or stably integrated into its germ line I~NA (i.e., in the genomic sequence of most or all of its cells). Heterologous nucleic acid is introduced into the germ line of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal.
Methods of making transgenic animals are well-known in the art (for transgenic mice see Brinster et al., Proc. Nat. Acad. Sci. USA 82: 4438-4442 (1985), U.S. Pat.
Nos.
4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al., and Hogan, B., Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); for particle bombardment see U.S. Pat. No., 4,945,050, by Sandford et al.; for transgenic Drosophila see Rubin and Spradling, Science (1982) 218:348-53 and U.S. Pat. No. 4,670,388; for transgenic insects see Berghammer A.J. et al., A Universal Marker for Transgenic Insects (1999) Nature 402:370-371; for transgenic Zebrafish see Lin S., Transgenic Zebrafish, Methods Mol Biol. (2000);136:3.75-3830); for microinjection procedures for fish, amphibian eggs and birds see Houdebine and Chourrout, Experientia (1991) 47:897-905; for transgenic rats see Hammer et al., Cell (1990) 63:1099-1112; and for culturing of embryonic stem (ES) cells and the subsequent production of transgenic animals by the introduction of DNA into ES cells using methods such as electroporation, calcium phosphate/DNA precipitation and direct injection see, e.g., Teratocarcinomas and Embryonic Stem Cells, A Practical Approach, E. J.
Robertson, ed., IRL Press (1987)). Clones of the nonhuman transgenic animals can be produced according to available methods (see Wilmut, I. et al. (1997) Nature 385:810-813; and PCT
International Publication Nos. WO 97/07668 and WO 97/07669).
In one embodiment, the transgenic animal is a "knock-out" animal having a heterozygous or homozygous alteration in the sequence of an endogenous LCE
gene that results in a decrease of LCE function, preferably such that LCE expression is undetectable or insignificant. Knock-out animals are typically generated by homologous recombination with a vector comprising a transgene having at least a portion of the gene to be knocked out. Typically a deletion, addition or substitution has been introduced into the transgene to functionally disrupt it. The transgene can be a human gene (e.g., from a human genomic clone) but more preferably is an ortholog of the human gene derived from the transgenic host species. For example, a mouse LCE gene is used to construct a homologous recombination vector suitable for altering an endogenous LCE gene in the mouse genome. Detailed methodologies for homologous recombination in mice are available (see Capecchi, Science (1989) 244:1288-1292; Joyner et al., Nature (1989) 338:153-156). Procedures for the production of non-rodent transgenic mammals and other animals are also available (Houdebine and Chourrout, supra; Pursel et al., Science (1989) 244:1281-1288; Simms et al., Bio/Technology (1988) 6:179-183). In a preferred embodiment, knock-out animals, such as mice harboring a knockout of a specific gene, may be used to produce antibodies against the human counterpart of the gene that has been knocked out (Claesson MH et al., (1994) Scan J Imrnunol 40:257-264; Declerck PJ et al., (1995) J Biol Chem. 270:8397-400).
In another embodiment, the txansgenic aniriial is a "knock-in" animal having an alteration in its genome that results in altered expression (e.g., increased (including ectopic) or decreased expression) of the LCE gene, e.g., by introduction of additional copies of LCE, or by operatively inserting a regulatory sequence that provides for altered expression of an endogenous copy of the LCE gene. Such regulatory sequences include inducible, tissue-specific, and constitutive promoters and enhancer elements.
The knock-in can be homozygous or heterozygous.
Transgenic nonhuman animals can also be produced that contain selected systems allowing for regulated expression of the transgene. One example of such a system that may be produced is the crelloxP recombinase system of bacteriophage P1 (Lakso et al., PNAS (1992) 89:6232-6236; U.S. Pat. No. 4,959,317). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al.
(1991) Science 251:1351-1355; U.S. Pat. No. 5,654,182). In a preferred embodiment, both Cre-LoxP and Flp-Frt are used in the same system to regulate expression of the transgene, and for sequential deletion of vector sequences in the same cell (Sun X et al (2000) Nat Genet 25:83-6).
The genetically modified animals can be used in genetic studies to further elucidate the p53 pathway, as animal models of disease and disorders implicating defective p53 function, and for ifi vivo testing of candidate therapeutic agents, such as those identified in screens described below. The candidate therapeutic agents are administered to a genetically modified animal having altered LCE function and phenotypic changes are compared with appropriate control animals such as genetically modified animals that receive placebo treatment, and/or animals with unaltered LCE expression that receive candidate therapeutic agent.
In addition to the above-described genetically modified animals having altered LCE
function, animal models having defective p53 function (and otherwise normal LCE
function), can be used in the methods of the present invention. For example, a p53 knockout mouse can be used to assess, irZ vivo, the activity of a candidate p53 modulating agent identified in one of the ifa vitro assays described below. p53 knockout mice are described in the literature (Jacks et al., Nature 2001;410:1111-1116, 1043-1044;
Donehower et al., supra). Preferably, the candidate p53 modulating agent when administered to a model system with cells defective in p53 function, produces a detectable phenotypic change in the model system indicating that the p53 function is restored, i.e., the cells exhibit normal cell cycle progression.

Modulating Agents The invention provides methods to identify agents that interact with and/or modulate the function of LCE andlor the p53 pathway. Such agents are useful in a variety of diagnostic and therapeutic applications associated with the p53 pathway, as well as in further analysis of the LCE protein and its contribution to the p53 pathway.
Accordingly, the invention also provides methods for modulating the p53 pathway comprising the step of specifically modulating LCE activity by administering a LCE-interacting or -modulating agent.
In a preferred embodiment, LCE-modulating agents inhibit or enhance LCE
activity or otherwise affect normal LCE function, including transcription, protein expression, protein localization, and cellular or extra-cellular activity. In a further preferred embodiment, the candidate p53 pathway- modulating agent specifically modulates the function of the LCE.
The phrases "specific modulating agent", "specifically modulates", etc., are used herein to refer to modulating agents that directly bind to the LCE polypeptide or nucleic acid, and preferably inhibit, enhance, or otherwise alter, the function of the LCE. The term also encompasses modulating agents that alter the interaction of the LCE with a binding partner or substrate (e.g. by binding to a binding partner of an LCE, or to a proteinlbinding partner complex, and inhibiting function).
Preferred LCE-modulating agents include small molecule compounds; LCE-interacting proteins, including antibodies and other biotherapeutics; and nucleic acid modulators such as antisense and RNA inhibitors. The modulating agents may be formulated in pharmaceutical compositions, for example, as compositions that may comprise other active ingredients, as in combination therapy, and/or suitable carriers or excipients. Techniques for formulation and administration of the compounds may be found in "Remington's Pharmaceutical Sciences" Mack Publishing Co., Easton, PA, 19~
edition.
Small molecule modulators Small molecules, are often preferred to modulate function of proteins with enzymatic function, and/or containing protein interaction domains. Chemical agents, referred to in the art as "small molecule" compounds are typically organic, non-peptide molecules, having a molecular weight less than 10,000, preferably less than 5,000, more preferably less than 1,000, and most preferably less than 500. This class of modulators includes chemically synthesized molecules, for instance, compounds from combinatorial chemical 15~

libraries. Synthetic compounds may be rationally designed or identified based on known or inferred properties of the LCE protein or may be identified by screening compound libraries. Alternative appropriate modulators of this class are natural products, particularly secondary metabolites from organisms such as plants or fungi, which can also be identified by screening compound libraries for LCE-modulating activity.
Methods for generating and obtaining compounds are well known in the art (Schreiber SL, Science (2000) 151: 1964-1969; Radmann J and Gunther J, Science (2000) 151:1947-1948).
Small molecule modulators identified from screening assays, as described below, can be used as lead compounds from which candidate clinical compounds may be designed, optimized, and synthesized. Such clinical compounds may have utility in treating pathologies associated with the p53 pathway. The activity of candidate small molecule modulating agents may be improved several-fold through iterative secondary functional validation, as further described below, structure determination, arid candidate modulator modification and testing. Additionally, candidate clinical compounds are generated with specific regard to clinical and pharmacological properties. For example, the reagents may be derivatized and re-screened using i~ vitro and ifZ vivo assays to optimize activity and minimize toxicity for pharmaceutical development.
Protein Modulators Specific LCE-interacting proteins are useful in a variety of diagnostic and therapeutic applications related to the p53 pathway and related disorders, as well as in validation assays for other LCE-modulating agents. In a preferred embodiment, LCE-interacting proteins affect normal LCE function, including transcription, protein expression, protein localization, and cellular or extra-cellular activity. In another embodiment, LCE-interacting proteins are useful in detecting and providing information about the function of LCE proteins, as is relevant to p53 related disorders, such as cancer (e.g., for diagnostic means).
An LCE-interacting protein may be endogenous, i.e. one that naturally interacts genetically or biochemically with an LCE, such as a member of the LCE pathway that modulates LCE expression, localization, and/or activity. LCE-modulators include dominant negative forms of LCE-interacting proteins and of LCE proteins themselves.
Yeast two-hybrid and variant screens offer preferred methods for identifying endogenous LCE-interacting proteins (Finley, R. L. et al. (1996) in DNA Cloning-Expression Systems:
A Practical Approach, eds. Glover D. ~z. Hames B. D (Oxford University Press, Oxford, England), pp. 169-203; Fashema SF et al., Gene (2000) 250:1-14; Drees BL Curr Opin Chem Biol (1999) 3:64-70; Vidal M and Legrain P Nucleic Acids Res (1999) 27:919-29;
and U.S. Pat. No. 5,928,868). Mass spectrometry is an alternative preferred method for the elucidation of protein complexes (reviewed in, e.g., Pandley A and Mann M, Nature (2000) 405:837-846; Yates JR 3rd, Trends Genet (2000) 16:5-8).
An LCE-interacting protein may be an exogenous protein, such as an LCE-specific antibody or a T-cell antigen receptor (see, e.g., Harlow and Lane (1988) Antibodies, A
Laboratory Manual, Cold Spring Harbor Laboratory; Harlow and Lane (1999) Using antibodies: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). LCE antibodies are further discussed below.
In preferred embodiments, an LCE-interacting protein specifically binds an LCE
protein. In alternative preferred embodiments, an LCE-modulating agent binds an LCE
substrate, binding partner, or cofactor.
Antibodies In another embodiment, the protein modulator is an LCE specific antibody agonist or antagonist. The antibodies have therapeutic and diagnostic utilities, and can be used in screening assays to identify LCE modulators. The antibodies can also be used in dissecting the portions of the LCE pathway responsible for various cellular responses and in the general processing and maturation of the LCE.
Antibodies that specifically bind LCE polypeptides can be generated using known methods. Preferably the antibody is specific to a mammalian ortholog of LCE
polypeptide, and more preferably, to human LCE. Antibodies may be polyclonal, monoclonal (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')₂ fragments, fragments produced by a FAb expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.
Epitopes of LCE which are particularly antigenic can be selected, for example, by routine screening of LCE polypeptides for antigenicity or by applying a theoretical method for selecting antigenic regions of a protein (Hopp and Wood (1981), Proc. Nati.
Acad. Sci.
U.S.A. 78:3824-28; Hopp and Wood, (1983) Mol. Irnmunol. 20:483-89; Sutcliffe et al., (1983) Science 219:660-66) to the amino acid sequence shown in any of SEQ ID
NOs:9, 10, 11, 12, 13, 14, 15, or 16. Monoclonal antibodies with affinities of 1081V1-1 preferably 109 M-1 to 101° M-1, or stronger can be made by standard procedures as described (Harlow and Lane, supra; Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed) Academic Press, New York; and U.S. Pat. Nos. 4,381,292; 4,451,570; and 4,618,577).
Antibodies may be generated against crude cell extracts of LCE or substantially purified fragments thereof. If LCE fragments are used, they preferably comprise at least 10, and more preferably, at least 20 contiguous amino acids of an LCE protein. In a particular embodiment, LCE-specific antigens and/or immunogens are coupled to carrier proteins that stimulate the immune response. For example, the subject polypeptides are covalently coupled to the keyhole limpet hemocyanin (KLH) carrier, and the conjugate is emulsified in Freund's complete adjuvant, which enhances the immune response. An appropriate immune system such as a laboratory rabbit or mouse is immunized according to conventional protocols.
The presence of LCE-specific antibodies is assayed by an appropriate assay such as a solid phase enzyme-linked imrnunosorbant assay (ELISA) using immobilized corresponding LCE polypeptides. Other assays, such as radioimmunoassays or fluorescent assays might also be used.
Chimeric antibodies specific to LCE polypeptides can be made that contain different portions from different animal species. For instance, a human immunoglobulin constant region may be linked to a variable region of a murine mAb, such that the antibody derives its biological activity from the human antibody, and its binding specificity from the murine fragment. Chimeric antibodies are produced by splicing together genes that encode the appropriate regions from each species (Morrison et al., Proc. Natl.
Acad. Sci.
(1984) 81:6851-6855; Neuberger et al., Nature (1984) 312:604-608; Takeda et al., Nature (1985) 31:452-454). Humanized antibodies, which are a form of chimeric antibodies, can be generated by grafting complementary-determining regions (CI?Rs) (Carlos, T.
M., J. M.
Harlan. 1994. Blood 84:2068-2101) of mouse antibodies into a background of human framework regions and constant regions by recombinant I~NA technology (Riechmann LM, et al., 1988 Nature 323: 323-327). Humanized antibodies contain ~10%
murine sequences and ~90% human sequences, and thus further reduce or eliminate immunogenicity, while retaining the antibody specificities (Co MS, and Queen C. 1991 Nature 351: 501-501; Morrison SL. 1992 Ann. Rev. Immun. 10:239-265). Humanized antibodies and methods of their production are well-known in the art (U.S.
Pat. Nos.
5,530,101, 5,585,089, 5,693,762, and 6,180,370).
LCE-specific single chain antibodies which are recombinant, single chain polypeptides formed by linking the heavy and light chain fragments of the Fv regions via an amino acid bridge, can be produced by methods known in the art (U.S. Pat. No. 4,946,778;
Bird, Science (1988) 242:423-426; Huston et al., Proc. Natl. Acad. Sci. USA (1988) 85:5879-5883; and Ward et al, Nature (1989) 334:544-546).
Other suitable techniques for antibody production involve in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively to selection of libraries of antibodies in phage or similar vectors (Huse et al., Science (1989) 246:1275-1281). As used herein, T-cell antigen receptors are included within the scope of antibody modulators (Harlow and Lane, 1988, supra).
The polypeptides and antibodies of the present invention may be used with or without modification. Frequently, antibodies will be labeled by joining, either covalently or non covalently, a substance that provides for a detectable signal, or that is toxic to cells that express the targeted protein (Menard S, et al., Int J. Biol Markers (1989) 4:131-134). A
wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, fluorescent emitting Lanthanide 1S metals, chemiluminescent moieties, bioluminescent moieties, magnetic particles, and the Like (U.5. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437;
4,275,149;
and 4,366,241). Also, recombinant immunoglobulins may be produced (U.5. Pat.
No.
4,816,567). Antibodies to cytoplasmic polypeptides may be delivered and reach their targets by conjugation with membrane-penetrating toxin proteins (U.5. Pat. No.
6,086,900).
When used therapeutically in a patient, the antibodies of the subject invention axe typically administered parenterally, when possible at the target site, or intravenously. The therapeutically effective dose and dosage regimen is determined by clinical studies.
Typically, the amount of antibody administered is in the range of about 0.1 mg/kg -to about 10 mg/kg of patient weight. For parenteral administration, the antibodies are formulated in a unit dosage injectable form (e.g., solution, suspension, emulsion) in association with a pharmaceutically acceptable vehicle. Such vehicles are inherently nontoxic and non-therapeutic. Examples are water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Nonaqueous vehicles such as fixed oils, ethyl oleate, or liposome carriers may also be used. The vehicle may contain minor amounts of additives, such as buffers and preservatives, which enhance isotonicity and chemical stability or otherwise enhance therapeutic potential. The antibodies' concentrations in such vehicles are typically in the range of about 1 mglml to aboutl0 mglml.

Immunotherapeutic methods are further described in the literature (US Pat. No.
5,859,206;
W00073469).
Specific biotherapeutics In a preferred embodiment, an LCE-interacting protein may have biotherapeutic applications. Biotherapeutic agents formulated in pharmaceutically acceptable carriers and dosages may be used to activate or inhibit signal ixansduction pathways.
This modulation may be accomplished by binding a ligand, thus inhibiting the activity of the pathway; or by binding a receptor, either to inhibit activation of, or to activate, the receptor. Alternatively, the biotherapeutic may itself be a ligand capable of activating or inhibiting a receptor. Biotherapeutic agents and methods of producing them are described in detail in U.S. Pat. No. 6,146,628.
LCE ligand(s), antibodies to the ligand(s) or the LCE itself may be used as biotherapeutics to modulate the activity of LCE in the p53 pathway.
Nucleic Acid Modulators Other preferred LCE-modulating agents comprise nucleic acid molecules, such as antisense oligomers or double stranded RNA (dsRNA), which generally inhibit LCE
activity. Preferred nucleic acid modulators interfere with the function of the LCE nucleic acid such as DNA replication, transcription, translocation of the LCE RNA to the site of protein translation, translation of protein from the LCE RNA, splicing of the LCE RNA to yield one or more mRNA species, or catalytic activity which may be engaged in or facilitated by the LCE RNA.
In one embodiment, the antisense oligomer is an oligonucleotide that is sufficiently complementary to an LCE mRNA to bind to and prevent translation, preferably by binding to the 5' untranslated region. LCE-specific antisense oligonucleotides, preferably range from at least 6 to about 200 nucleotides. In some embodiments the oligonucleotide is preferably at least 10, 15, or 20 nucleotides in length. In other embodiments, the oligonucleotide is preferably Iess than 50, 40, or 30 nucleotides in length.
The oligonucleotide can be DNA or RNA or a chimeric mixture or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone. The oligonucleotide may include other appending groups such as peptides, agents that facilitate transport across the cell membrane, hybridization-triggered cleavage agents, and intercalating agents.

In another embodiment, the antisense oligomer is a phosphothioate morpholino .
oligomer (PMO). PMOs are assembled from four different morpholino subunits, each of which contain one of four genetic bases (A, C, G, or T) linked to a six-membered morpholine ring. Polymers of these subunits are joined by non-ionic phosphodiamidate intersubunit linkages. Details of how to make and use PMOs and other antisense oligomers are well known in the art (e.g. see W099118193; Probst JC, Antisense Oligodeoxynucleotide and Ribozyme Design, Methods. (2000) 22(3):271-281;
Summerton J, and Weller D. 1997 Antisense Nucleic Acid Drug Dev. :7:187-95; US Pat. No.
5,235,033; and US Pat No. 5,378,841).
Alternative preferred LCE nucleic acid modulators are double-stranded RNA
species mediating RNA interference (RNAi). RNAi is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by double-stranded RNA
(dsRNA) that is homologous in sequence to the silenced gene. Methods relating to the use of RNAi to silence genes in C. elegans, Dr-osoplaila, plants, and humans are known in the I5 art (Fire A, et al., 1998 Nature 391:806-811; Fire, A. Trends Genet. 15, 358-363 (1999);
Sharp, P. A. RNA interference 2001. Genes Dev. 15, 485-490 (2001); Hammond, S.
M., et al., Nature Rev. Genet. 2, 110-1119 (2001); Tuschl, T. Chem. Biochem. 2, (2001); Hamilton, A. et al., Science 286, 950-952 (1999); Hammond, S. M., et al., Nature 404, 293-296 (2000); Zamore, P. D., et al., Cell 101, 25-33 (2000);
Bernstein, E., et al., Nature 409, 363-366 (2001); Elbashir, S. M., et al., Genes Dev. 15, (2001); WO0129058; W09932619; Elbashir SM, et al., 2001 Nature 411:494-498).
Nucleic acid modulators are commonly used as research reagents, diagnostics, and therapeutics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used to elucidate the function of particular genes (see, for example, U.S. Pat. No. 6,165,790). Nucleic acid modulators are also used, for example, to distinguish between functions of various members of a biological pathway.
For example, antisense oligomers have been employed as therapeutic moieties in the treatment of disease states in animals and man and have been demonstrated in numerous clinical trials to be safe and effective (Milligan JF, et al, Current Concepts in Antisense Drug Design, J Med Chem. (19'93) 36:1923-1937; Tonkinson JL et al., Antisense Oligodeoxynucleotides as Clinical Therapeutic Agents, Cancer Invest. (1996) 14:54-65).
Accordingly, in one aspect of the invention, an LCE-specific nucleic acid modulator is used in an assay to further elucidate the role of the LCE in the p53 pathway, and/or its relationship to other members of the pathway. In another aspect of the invention, an LCE-specific antisense oligomer is used as a therapeutic agent for treatment of p53-related disease states.
Assay Systems The invention provides assay systems and screening methods for identifying specific modulators of LCE activity. As used herein, an "assay system" encompasses all the components required for performing and analyzing results of an assay that detects andlor measures a particular event. In general, primary assays are used to identify or confirm a modulator's specific biochemical or molecular effect with respect to the LCE
nucleic acid or protein. In general, secondary assays further assess the activity of a LCE
modulating agent identified by a primary assay and may confirm that the modulating agent affects LCE in a manner relevant to the p53 pathway. In some cases, LCE modulators will be directly tested in a secondary assay.
In a preferred embodiment, the screening method comprises contacting a suitable assay system comprising an LCE polypeptide with a candidate agent under conditions whereby, but for the presence of the agent, the system provides a reference activity (e.g.
binding activity), which is based on the particular molecular event the screening method detects. A statistically significant difference between the agent-biased activity and the reference activity indicates that the candidate agent modulates LCE activity, and hence the p53 pathway.
Primary Assays The type of modulator tested generally determines the type of primary assay.
Primary assays for small molecule modulators For small molecule modulators, screening assays are used to identify candidate modulators. Screening assays may be cell-based or may use a cell-free system that recreates or retains the relevant biochemical reaction of the target protein (reviewed in Sittampalam GS et al., Curr Opin Chem Biol (1997) 1:384-91 and accompanying references). As used herein the term "cell-based" refers to assays using live cells, dead cells, or a particular cellular fraction, such as a membrane, endoplasmic reticulum, or mitochondria) fraction. The term "cell free" encompasses assays using substantially purified protein (either endogenous or recombinantly produced), partially purified or crude cellular extracts. Screening assays may detect a variety of molecular events, including protein-DNA interactions, protein-protein interactions (e.g., receptor-ligand binding), transcriptional activity (e.g., using a reporter gene), enzymatic activity (e.g., via a property of the substrate), activity of second messengers, immunogenicty and changes in cellular morphology or other cellular characteristics. Appropriate screening assays may use a wide range of detection methods including fluorescent, radioactive, colorimetric, spectrophotometric, and amperometric methods, to provide a read-out for the particular molecular event detected.
Cell-based screening assays usually require systems for recombinant expression of LCE and any auxiliary proteins demanded by the particular assay. Appropriate methods for generating recombinant proteins produce sufficient quantities of proteins that retain their relevant biological activities and are of sufficient purity to optimize activity and assure assay reproducibility. Yeast two-hybrid and variant screens, and mass spectrometry provide preferred methods for determining protein-protein interactions and elucidation of protein complexes. In certain applications, when LCE-interacting proteins are used in screens to identify small molecule modulators, the binding specificity of the interacting protein to the LCE protein may be assayed by various known methods such as substrate processing (e.g. ability of the candidate LCE-specific binding agents to function as negative effectors in LCE-expressing cells), binding equilibrium constants (usually at least about 107 M-1, preferably at least about 108 M-1, more preferably at least about 109 M-1), and immunogenicity (e.g. ability to elicit LCE specific antibody in a heterologous host such as a mouse, rat, goat or rabbit). For enzymes and receptors, binding may be assayed by, respectively, substrate and ligand processing.
The screening assay may measure a candidate agent's ability to specifically bind to or modulate activity of a LCE polypeptide, a fusion protein thereof, or to cells or membranes bearing the polypeptide or fusion protein. The LCE polypeptide can be full length or a fragment thereof that retains functional LCE activity. The LCE polypeptide may be fused to another polypeptide, such as a peptide tag for detection or anchoring, or to another tag.
The LCE polypeptide is preferably human LCE, or is an ortholog or derivative thereof as described above. In a preferred embodiment, the screening assay detects candidate agent-based modulation of LCE interaction with a binding target, such as an endogenous or exogenous protein or other substrate that has LCE -specific binding activity, and can be used to assess normal LCE gene function.
Suitable assay formats that may be adapted to screen for LCE modulators are known in the art. Preferred screening assays are high throughput or ultra high throughput and thus provide automated, cost-effective means of screening compound libraries for lead compounds (Fernandes PB, Curr Opin Chem Biol (1998) 2:597-603; Sundberg SA, Curr Opin Biotechnol 2000, 11:47-53). In one preferred embodiment, screening assays uses fluorescence technologies, including fluorescence polarization, time-resolved fluorescence, and fluorescence resonance energy transfer. These systems offer means to monitor protein-protein or DNA-protein interactions in which the intensity of the signal emitted from dye-labeled molecules depends upon their interactions with partner molecules (e.g., Selvin PR, Nat Struct Biol (2000) 7:730-4; Fernandes PB, supra;
Hertzberg RP and Pope AJ, Curr Opin Chem Biol (2000) 4:445-451).
A variety of suitable assay systems may be used to identify candidate LCE and p53 pathway modulators (e.g. U.S. Pat. No. 6,020,135 (p53 modulation)). Specific preferred assays are described in more detail below.
Elongase assays. Assays for elongases are well-known in the art. In one example, an elongation assay uses chromatographic (e.g., HPLC) analysis of labeled elongation products to assess LCE activity. Long chain fatty acids may be labeled with 14-C (Moon YA et al. (2001) J Biol Chem 276:45358-45366). Briefly, fatty acid elongation activity is measured in microsomes prepared from transfected cells. Fatty acyl-CoAs or BSA
bound fatty acids may be used as substrates for the reactions. Substrate mixtures also include [2-14C]malonyl-CoA. Elongation reactions are initiated when microsomal proteins and substrates are mixed. After termination of the reactions, fatty acids are collected, washed, and counted. Elongase activity is measured and expressed as the amount of radioactivity incorporated into the fatty acids.
Apoptosis assays. Assays for apoptosis may be performed by terminal deoxynucleotidyl transferase-mediated digoxigenin-11-dUTP nick end labeling (TUNEL) assay. The TUNEL assay is used to measure nuclear DNA fragmentation characteristic of apoptosis ( Lazebnik et al., 1994, Nature 371, 346), by following the incorporation of fluorescein-dUTP (Yonehara et al., 1989, J. Exp. Med. 169, 1747). Apoptosis may further be assayed by acridine orange staining of tissue culture cells (Lucas, R., et al., 1998, Blood 15:4730-41). An apoptosis assay system may comprise a cell that expresses an LCE, and that optionally has defective p53 function (e.g. p53 is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the apoptosis assay system and changes in induction of apoptosis relative to controls where no test agent is added, identify candidate p53 modulating agents. In some embodiments of the invention, an apoptosis assay may be used as a secondary assay to test a candidate p53 modulating agents that is initially identified using a cell-free assay system. An apoptosis assay may also be used to test whether LCE function plays a direct role in apoptosis. For example, an apoptosis assay may be performed on cells that over- or under-express LCE relative to wild type cells. Differences in apoptotic response compared to wild type cells suggests that the LCE
plays a direct role in the apoptotic response. Apoptosis assays are described further in US
Pat. No. 6,133,437.
Cell proliferation and cell cycle assays. Cell proliferation may be assayed via bromodeoxyuridine (BRDU) incorporation. This assay identifies a cell population undergoing DNA synthesis by incorporation of BRDU into newly-synthesized DNA.
Newly-synthesized DNA may then be detected using an anti-BRDU antibody (Hoshino et al., 1986, Int. J. Cancer 38, 369; Campana et al., 1988, J. Immunol. Meth.
107, 79), or by other means.
Cell Proliferation may also be examined using [3H]-thymidine incorporation (Chen; J., 1996, Oncogene 13:1395-403; Jeoung, J., 1995, J. Biol. Chem. 270:18367-73).
This assay allows for quantitative characterization of S-phase DNA syntheses. In this assay, cells synthesizing DNA will incorporate [3H]-thymidine into newly synthesized DNA.
Incorporation can then be measured by standard techniques such as by counting of radioisotope in a scintillation counter (e.g., Beckman LS 3800 Liquid Scintillation Counter).
Cell proliferation may also be assayed by colony formation in soft agar (Sambrook et al., Molecular Cloning, Cold Spring Harbor (1989)). For example, cells transformed with LCE are seeded in soft agar plates, and colonies are measured and counted after two weeks incubation.
Involvement of a gene in the cell cycle may be assayed by flow cytometry (Gray JW et al. (1986) Int J Radiat Biol Relat Stud Phys Chem Med 49:237-55). Cells transfected with an LCE may be stained with propidium iodide and evaluated in a flow cytometer (available from Becton Dickinson).
Accordingly, a cell proliferation or cell cycle assay system may comprise a cell that expresses an LCE, and that optionally has defective p53 function (e.g. p53 is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the assay system and changes in cell proliferation or cell cycle relative to controls where no test agent is added, identify candidate p53 modulating agents. In some embodiments of the invention, the cell proliferation or cell cycle assay may be used as a secondary assay to test a candidate p53 modulating agents that is initially identified using another assay system such as a cell-free assay system. A cell proliferation assay may also be used to test whether LCE function plays a direct role in cell proliferation or cell cycle.
For example, a cell proliferation or cell cycle assay rnay be performed on cells that over-or under-express LCE relative to wild type cells. Differences in proliferation or cell cycle compared to wild type cells suggests that the LCE plays a direct role in cell proliferation or cell cycle.
Angiogenesis. Angiogenesis may be assayed using various human endothelial cell systems, such as umbilical vein, coronary artery, or dermal cells. Suitable assays include Alamar Blue based assays (available from Biosource International) to measure proliferation; migration assays using fluorescent molecules, such as the use of Becton Dickinson Falcon HTS FluoroBlock cell culture inserts to measure migration of cells through membranes in presence or absence of angiogenesis enhancer or suppressors; and tubule formation assays based on the formation of tubular structures by endothelial cells on Matrigel~ (Becton Dickinson). Accordingly, an angiogenesis assay system may comprise a cell that expresses an LCE, and that optionally has defective p53 function (e.g.
p53 is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the angiogenesis assay system and changes in angiogenesis relative to controls where no test agent is added, identify candidate p53 modulating agents. In some embodiments of the invention, the angiogenesis assay may be used as a secondary assay to test a candidate p53 modulating agents that is initially identified using another assay system. An angiogenesis assay may also be used to test whether LCE function plays a direct role in cell proliferation. For example, an angiogenesis assay may be performed on cells that over- or under-express LCE relative to wild type cells. Differences in angiogenesis compared to wild type cells suggests that the LCE plays a direct role in angiogenesis.
Hypoxic induction. The alpha subunit of the transcription factor, hypoxia inducible factor-1 (HIF-1), is upregulated in tumor cells following exposure to hypoxia in vitro.
Under hypoxic conditions, HIF-1 stimulates the expression of genes known to be important in tumour cell survival, such as those encoding glyolytic enzymes and VEGF.
Induction of such genes by hypoxic conditions may be assayed by growing cells transfected with LCE in hypoxic conditions (such as with 0.1°Io 02, 5°lo C02, and balance N2, generated in a Napco 7001 incubator (Precision Scientific)) and normoxic conditions, followed by assessment of gene activity or expression by Taqman~. For example, a hypoxic induction assay system may comprise a cell that expresses an LCE, and that optionally has a mutated p53 (e.g. p53 is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the hypoxic induction assay system and changes in hypoxic response relative to controls where no test agent is added, identify candidate p53 modulating agents. In some embodiments of the invention, the hypoxic induction assay may be used as a secondary assay to test a candidate p53 modulating agents that is initially identified using another assay system. A hypoxic induction assay may also be used to test whether LCE function plays a direct role in the hypoxic response.
For example, a hypoxic induction assay may be performed on cells that over- or under-express LCE relative to wild type cells. Differences in hypoxic response compared to wild type cells suggests that the LCE plays a direct role in hypoxic induction.
Cell adhesion. Cell adhesion assays measure adhesion of cells to purified adhesion proteins, or adhesion of cells to each other, in presence or absence of candidate modulating agents. Cell-protein adhesion assays measure the ability of agents to modulate the adhesion of cells to purified proteins. For example, recombinant proteins are produced, diluted to 2.Sg/mL in PBS, and used to coat the wells of a microtiter plate. The wells used for negative control are not coated. Coated wells are then washed, blocked with 1% BSA, and washed again. Compounds are diluted to 2x final test concentration and added to the blocked, coated wells. Cells are then added to the wells, and the unbound cells are washed off. Retained cells are labeled directly on the plate by adding a membrane-permeable fluorescent dye, such as calcein-AM, and the signal is quantified in a fluorescent microplate reader.
Cell-cell adhesion assays measure the ability of agents to modulate binding of cell adhesion proteins with their native ligands. These assays use cells that naturally or recombinantly express the adhesion protein of choice. In an exemplary assay, cells expressing the cell adhesion protein are plated in wells of a multiwell plate.
Cells expressing the ligand are labeled with a membrane-permeable fluorescent dye, such as BCECF , and allowed to adhere to the monolayers in the presence of candidate agents.
Unbound cells are washed off, and bound cells are detected using a fluorescence plate reader.

High-throughput cell adhesion assays have also been described. In one such assay, small molecule ligands and peptides are bound to the surface of microscope slides using a microarray spotter, intact cells are then contacted with the slides, and unbound Bells are washed off. In this assay, not only the binding specificity of the peptides and modulators against cell lines are determined, but also the functional cell signaling of attached cells using immunofluorescence techniques in situ on the microchip is measured (Falsey JR et al., Bioconjug Chem. 2001 May-Jun;l2(3):346-53).
Tubulogenesis. Tubulogenesis assays monitor the ability of cultured cells, generally endothelial cells, to form tubular structures on a matrix substrate, which generally simulates the environment of the extracellular matrix. Exemplary substrates include Matrigel~ (Becton Dickinson), an extract of basement membrane proteins containing laminin, collagen IV, and heparin sulfate proteoglycan, which is liquid at 4° C and forms a solid gel at 37° C. Other suitable matrices comprise extracellular components such as collagen, fibronectin, and/or fibrin. Cells are stimulated with a pro-angiogenic stimulant, and their ability to form tubules is detected by imaging. Tubules can generally be detected after an overnight incubation with stimuli, but longer or shorter time frames may also be used. Tube formation assays are well known in the art (e.g., Jones MK et al., 1999, Nature Medicine 5:1418-1423). These assays have traditionally involved stimulation with serum or with the growth factors FGF or VEGF. Serum represents an undefined source of growth factors. In a preferred embodiment, the assay is performed with cells cultured in serum free medium, in order to control which process or pathway a candidate agent modulates. Moreover, we have found that different target genes respond differently to stimulation with different pro-angiogenic agents, including inflammatory angiogenic factors such as TNF-alpa. Thus, in a further preferred embodiment, a tubulogenesis assay system comprises testing an LCE's response to a variety of factors, such as FGF, VEGF, phorbol myristate acetate (PMA), TNF-alpha, ephrin, etc.
Cell Migration. An invasion/migration assay (also called a migration assay) tests the ability of cells to overcome a physical barrier and to migrate towards pro-angiogenic signals. Migration assays are known in the art (e.g., Paik JH et al., 2001, J
Biol Chem 276:11830-11837). In a typical experimental set-up, cultured endothelial cells are seeded onto a matrix-coated porous lamina, with pore sizes generally smaller than typical cell size. The matrix generally simulates the environment of the extracellular matrix, as described above. The lamina is typically a membrane, such as the transwell polycarbonate membrane (Corning Costar Corporation, Cambridge, MA), and is generally part of an upper chamber that is in fluid contact with a lower chamber containing pro-angiogenic stimuli. Migration is generally assayed after an overnight incubation with stimuli, but longer or shorter time frames may also be used. Migration is assessed as the number of cells that crossed the lamina, and may be detected by staining cells with hemotoxylin solution (VWR Scientific, South San Francisco, CA), or by any other method fox determining cell number. In another exemplary set up, cells are fluorescently labeled and migration is detected using fluorescent readings, for instance using the Falcon HTS
FluoroBlok (Becton Dickinson). While some migration is observed in the absence of stimulus, migration is greatly increased in response to pro-angiogenic factors. As described above, a preferred assay system for migration/invasion assays comprises testing an LCE's response to a variety of pro-angiogenic factors, including tumor angiogenic and inflammatory angiogenic agents, and culturing the cells in serum free medium.
Sprouting assay. A sprouting assay is a three-dimensional in vitro angiogenesis assay that uses a cell-number defined spheroid aggregation of endothelial cells ("spheroid"), embedded in a collagen gel-based matrix. The spheroid can serve as a starting point for the sprouting of capillary-like structures by invasion into the extracellular matrix (termed "cell sprouting") and the subsequent formation of complex anastomosing networks (Korff and Augustin, 1999, J Cell Sci 112:3249-58). In an exemplary experimental set-up, spheroids are prepared by pipetting 400 human umbilical vein endothelial cells into individual wells of a nonadhesive 96-well plates to allow overnight spheroidal aggregation (Korff and Augustin: J Cell Biol 143: 1341-52, 1998).
Spheroids are harvested and seeded in 900p,1 of methocel-collagen solution and pipetted into individual wells of a 24 well plate to allow collagen gel polymerization.
Test agents are added after 30 min by pipetting 100 ~,1 of 10-fold concentrated working dilution of the test substances on top of the gel. Plates are incubated at 37°C for 24h. Dishes are fixed at the end of the experimental incubation period by addition of paraformaldehyde.
Sprouting intensity of endothelial cells can be quantitated by an automated image analysis system to determine the cumulative sprout length per spheroid.

Primary assays for antibody modulators For antibody modulators, appropriate primary assays test is a binding assay that tests the antibody's affinity to and specificity for the LCE protein. Methods for testing antibody affinity and specificity are well known in the art (Harlow and Lane, 1988, 1999, supra).
The enzyme-linked immunosorbant assay (ELISA) is a preferred method for detecting LCE-specific antibodies; others include FACS assays, radioimmunoassays, and fluorescent assays.
Primary assays for nucleic acid modulators For nucleic acid modulators, primary assays may test the ability of the nucleic acid modulator to inhibit or enhance LCE gene expression, preferably mRNA
expression. In general, expression analysis comprises comparing LCE expression in like populations of cells (e.g., two pools of cells that endogenously or recombinantly express LCE) in the presence and absence of the nucleic acid modulator. Methods for analyzing mRNA
and protein expression are well known in the art. For instance, Northern blotting, slot blotting, ribonuclease protection, quantitative RT-PCR (e.g., using the TaqMan~, PE
Applied Biosystems), or microarray analysis may be used to confirm that LCE mRNA
expression is reduced in cells treated with the nucleic acid modulator (e.g., Current Protocols in Molecular Biology (1994) Ausubel FM et al., eds., John Wiley & Sons, Inc., chapter 4;
Freeman WM et al., Biotechniques (1999) 26:112-125; Kallioniemi OP, Ann Med 2001, 33:142-147; Blohm DH and Guiseppi-Elie, A Curr Opin Biotechnol 2001, 12:41-47).
Protein expression may also be monitored. Proteins are most commonly detected with specific antibodies or antisera directed against either the LCE protein or specific peptides.
A variety of means including Western blotting, ELISA, or in situ detection, are available (Harlow E and Lane D, 1988 and 1999, supra).
Secondary Assays Secondary assays may be used to further assess the activity of LCE-modulating agent identified by any of the above methods to confirm that the modulating agent affects LCE
in a manner relevant to the p53 pathway. As used herein, LCE-modulating agents encompass candidate clinical compounds or other agents derived from previously identified modulating agent. Secondary assays can also be used to test the activity of a modulating agent on a particular genetic or biochemical pathway or to test the specificity of the modulating agent's interaction with LCE.

Secondary assays generally compare like populations of cells or animals (e.g., two pools of cells or animals that endogenously or recombinantly express LCE) in the presence and absence of the candidate modulator. In general, such assays test whether treatment of cells or animals with a candidate LCE-modulating agent results in changes in the p53 pathway in comparison to untreated (or mock- or placebo-treated) cells or animals.
Certain assays use "sensitized genetic backgrounds", which, as used herein, describe cells or animals engineered for altered expression of genes in the p53 or interacting pathways.
Cell-based assays Cell based assays may use a variety of mammalian cell lines known to have defective p53 function (e.g. SAOS-2 osteoblasts, H1299 lung cancer cells, C33A and HT3 cervical cancer cells, HT-29 and DLD-1 colon cancer cells, among others, available from American Type Culture Collection (ATCC), Manassas, VA). Cell based assays may detect endogenous p53 pathway activity or may rely on recombinant expression of p53 pathway components. Any of the aforementioned assays may be used in this cell-based format. Candidate modulators are typically added to the cell media but may also be injected into cells or delivered by any other efficacious means.
Aninzal Assays A variety of non-human animal models of normal or defective p53 pathway may be used to test candidate LCE modulators. Models for defective pS3 pathway typically use genetically modified animals that have been engineered to mis-express (e.g., over-express or lack expression in) genes involved in the p53 pathway. Assays generally require systemic delivery of the candidate modulators, such as by oral administration, injection, etc.
In a preferred embodiment, p53 pathway activity is assessed by monitoring neovascularization and angiogenesis. Animal models with defective and normal p53 are used to test the candidate modulator's affect on LCE in Matrigel~ assays.
Matrigel~ is an extract of basement membrane proteins, and is composed primarily of laminin, collagen IV, and heparin sulfate proteoglycan. It is provided as a sterile liquid at 4° C, but rapidly forms a solid gel at 37° C. Liquid Matrigel~ is mixed with various angiogenic agents, such as bFGF and VEGF, or with human tumor cells which over-express the LCE.
The mixture is then injected subcutaneously(SC) into female athymic nude mice (Taconic, Germantown, NY) to support an intense vascular response. Mice with Matrigel~
pellets may be dosed via oral (PO), intraperitoneal (IP), or intravenous (1V) routes with the candidate modulator. Mice are euthanized 5 - 12 days post-injection, and the Matrigel~
pellet is harvested for hemoglobin analysis (Sigma plasma hemoglobin kit).
Hemoglobin content of the gel is found to correlate the degree of neovascularization in the gel.
In another preferred embodiment, the effect of the candidate modulator on LCE
is assessed via tumorigenicity assays. In one example, xenograft human tumors are implanted SC into female athymic mice, 6-7 week old, as single cell suspensions either from a pre-existing tumor or from in vitro culture. The tumors which express the LCE
endogenously are injected in the flank, 1 x 105 to 1 x 10~ cells per mouse in a volume of 100 p,L using a 27gauge needle. Mice are then ear tagged and tumors are measured twice weekly. Candidate modulator treatment is initiated on the day the mean tumor weight reaches 100 mg. Candidate modulator is delivered IV, SC, IP, or PO by bolus administration. Depending upon the pharmacokinetics of each unique candidate modulator, dosing can be performed multiple times per day. The tumor weight is assessed.
by measuring perpendicular diameters with a caliper and calculated by multiplying the measurements,of diameters in two dimensions. At the end of the experiment, the excised tumors maybe utilized for biomarker identification or further analyses. For immunohistochemistry staining, xenograft tumors are fixed in 4%
paraformaldehyde, O.1M phosphate, pH 7.2, for 6 hours at 4°C, immersed in 30% sucrose in PBS, and rapidly frozen in isopentane cooled with liquid nitrogen.
Diagnostic and therapeutic uses Specific LCE-modulating agents are useful in a variety of diagnostic and therapeutic applications where disease or disease prognosis is related to defects in the p53 pathway, such as angiogenic, apoptotic, or cell proliferation disorders. Accordingly, the invention also provides methods for modulating the p53 pathway in a cell, preferably a cell pre-determined to have defective p53 function, comprising the step of administering an agent to the cell that specifically modulates LCE activity. Preferably, the modulating agent produces a detectable phenotypic change in the cell indicating that the p53 function is restored, i.e., for example, the cell undergoes normal proliferation or progression through the cell cycle.
The discovery that LCE is implicated in p53 pathway provides for a variety of methods that can be employed for the diagnostic and prognostic evaluation of diseases and disorders involving defects in the p53 pathway and for the identification of subjects having a predisposition to such diseases and disorders.
Various expression analysis methods can be used to diagnose whether LCE
expression occurs in a particular sample, including Northern blotting, slot blotting, ribonuclease protection, quantitative RT-PCR, and microarray analysis. (e.g., Current Protocols in Molecular Biology (1994) Ausubel FM et al., eds., John Wiley & Sons, Inc., chapter 4;
Freeman WM et al., Biotechniques (1999) 26:112-125; Kallioniemi OP, Ann Med 2001, 33:142-147; Blohm and Guiseppi-Elie, Curr Opin Biotechnol 2001, 12:41-47).
Tissues having a disease or disorder implicating defective p53 signaling that express an LCE, are identified as amenable to treatment with an LCE modulating agent. In a preferred application, the p53 defective tissue overexpresses an LCE relative to normal tissue. For example, a Northern blot analysis of mRNA from tumor and normal cell lines, or from tumor and matching normal tissue samples from the same patient, using full or partial LCE
cDNA sequences as probes, can determine whether particular tumors express or overexpress LCE. Alternatively,~the TaqMan~ is used for quantitative RT-PCR
analysis of LCE expression in cell lines, normal tissues and tumor samples (PE Applied Biosystems).
Various other diagnostic methods may be performed, for example, utilizing reagents such as the LCE oligonucleotides, and antibodies directed against an LCE, as described above for: (1) the detection of the presence of LCE gene mutations, or the detection of either over- or under-expression of LCE mRNA relative to the non-disorder state; (2) the detection of either an over- or an under-abundance of LCE gene product relative to the non-disorder state; and (3) the detection of perturbations or abnormalities in the signal transduction pathway mediated by LCE.
Thus, in a specific embodiment, the invention is drawn to a method for diagnosing a disease in a patient, the method comprising: a) obtaining a biological sample from the patient; b) contacting the sample with a probe for LCE expression; c) comparing results from step (b) with a control; and d) determining whether step (c) indicates a likelihood of disease. Preferably, the disease is cancer, most preferably a cancer as shown in TABLE 1.
The probe may be either DNA or protein, including an antibody.
EXAMPLES
The following experimental section and examples are offered by way of illustration and not by way of limitation.

I. Droso~hila p53 screen The Drosophila p53 gene was overexpressed specifically in the wing using the vestigial margin quadrant enhancer. Increasing quantities of Drosophila p53 (titrated using different strength transgenic inserts in 1 or 2 copies) caused deterioration of normal wing morphology from mild to strong, with phenotypes including disruption of pattern and polarity of wing hairs, shortening and thickening of wing veins, progressive crumpling of the wing and appearance of dark "death" inclusions in wing blade. In a screen designed to identify enhancers and suppressors of Drosophila p53, homozygous females carrying two copies of p53 were crossed to 5663 males carrying random insertions of a piggyBac transposon (Eraser M et al., Virology (1985) 145:356-361). Progeny containing insertions were compared to non-insertion-bearing sibling progeny for enhancement or suppression of the p53 phenotypes. Sequence information surrounding the piggyBac insertion site was used to identify the modifier genes. Modifiers of the wing phenotype were identified as members of the p53 pathway. baldspot was an enhancer of the wing phenotype.
Human orthologs of the modifiers are referred to herein as LCE.
BLAST analysis (Altschul et al., supra) was employed to identify Targets from Drosophila modifiers. [For example, representative sequences from LCE, GI#s 10444345, 13129088, 12232379, and 17454617 (SEQ ID NOs:9, 11, 14, and 16, respectivley) share 45%, 48%, 25%, and 41% amino acid identity, respectively, with the l~rosophila.baldspot.
Various domains, signals, and functional subunits in proteins were analyzed using the PSORT (Nakai K., and Horton P., Trends Biochem Sci, 1999, 24:34-6; Kenta Nakai, Protein sorting signals and prediction of subcellular localization, Adv.
Protein Chem. 54, 277-344 (2000)), PFAM (Bateman A., et al., Nucleic Acids Res, 1999, 27:260-2;
htt~://pfam.wustl.edu), SMART (Ponting CP, et al., SMART: identification and annotation of domains from signaling and extracellular protein sequences. Nucleic Acids Res. 1999 Jan 1;27(1):229-32), TM-HMM (Erik L.L. Sonnhammer, Gunnar von Heijne, and Anders Krogh: A hidden Markov model for predicting transmembrane helices in protein sequences. In Proc. of Sixth Int. Conf. on Intelligent Systems for Molecular Biology, p 175-I82 Ed J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C.
Sensen Menlo Park, CA: AAAI Press, 1998), and clust (Remm M, and Sonnhammer E.
Classification of transmembrane protein families in the Caenorhabditis elegans genome and identification of human orthologs. Genome Res. 2000 Noe;lO(11):1679-89) programs.
Using PFAM, GNS1/SUR4 domain (PFAM 01151) of LCE from GI#s 10444345, 13129088, 12232379, and 17454617 (SEQ ID NOs:9, 11, 14, and 16, respectively) are located respectively at approximately amino acid residues I-235, 10 to 265, 9 to 289, and 55 to 270. Further, using TM-HMM, GI# 10444345 (SEQ ID N0:9) has 7 transmembrane domains with start and end amino acids of (4,21) (26,48) (52,74) (81,103) (131,153) (166,188) (203,225); GI# 13129088 (SEQ ll~ NO:11) has 6 transmembrane domains with start and end coordinates of (34,51) (66,88) (137,156) (161,183) (195,217) (232,254);
GI#12232379 (SEQ ID N0:14) has 7 transmembrane domains with start and end coordinates of (47,64) (77,99) (125,147) (154,173) (183,205) (217,239) (249,267); and GI#17454617 (SEQ m N0:16) has 7 transmembrane domains with start and end coordinates of (33,55) (60,82) (86,108) (115,137) (165,187) (200,222) (237,259).
II. High-Throughput In Vitro Fluorescence Polarization Assay Fluorescently-labeled LCE peptide/substrate are added to each well of a 96-well microtiter plate, along with a test agent in a test buffer (10 mM HEPES, 10 mM
NaCI, 6 mM magnesium chloride, pH 7.6). Changes in fluorescence polarization, determined by using a Fluorolite FPM-2 Fluorescence Polarization Microtiter System (Dynatech Laboratories, Inc), relative to control values indicates the test compound is a candidate modifier of LCE activity.
III. Fligh-Throughput In Vitro Binding Assay_ 33P-labeled LCE peptide is added in an assay buffer (100 mM ICI, 20 mM HEPES
pH
7.6, I mM MgCl2, I% glycerol, O.S% NP-40, 50 mM beta-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors) along with a test agent to the wells of a Neutralite-avidin coated assay plate and incubated at 25°C for 1 hour.
Biotinylated substrate is then added to each well and incubated for 1 hour. Reactions are stopped by washing with PBS, and counted in a scintillation counter. Test agents that cause a difference in activity relative to control without test agent are identified as candidate p53 modulating agents.
IV. Immunoprecipitations and Immunoblotting For coprecipitation of transfected proteins, 3 x 106 appropriate recombinant cells containing the LCE proteins are plated on 10-cm dishes and transfected on the following day with expression constructs. The total amount of DNA is kept constant in each transfection by adding empty vector. After 24 h, cells are collected, washed once with phosphate-buffered saline and lysed for 20 min on ice in 1 ml of lysis buffer containing 50 mM Hepes, pH 7.9, 250 mM NaCI, 20 mM -glycerophosphate, 1 mM sodium orthovanadate, 5 mM p-nitrophenyl phosphate, 2 mM dithiothreitol, protease inhibitors (complete, Roche Molecular Biochemicals), and 1% Nonidet P-40. Cellular debris is removed by centrifugation twice at 15,000 x g for 15 min. The cell lysate is incubated with 25 ~,l of M2 beads (Sigma) for 2 h at 4 °C with gentle rocking.
After extensive washing with lysis buffer, proteins bound to the beads are solubilized by boiling in SDS sample buffer, fractionated by SDS-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane and blotted with the indicated antibodies. The reactive bands are visualized with horseradish peroxidase coupled to the appropriate secondary antibodies and the enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Pharmacia Biotech).
V. Expression analysis All cell lines used in the following experiments are NCI (National Cancer Institute) lines, and are available from ATCC (American Type Culture Collection, Manassas, VA
20110-2209). Normal and tumor tissues were obtained from Impath, UC Davis, Clontech, Stratagene, and Ambion.
TaqMan analysis was used to assess expression levels of the disclosed genes in various samples.
RNA was extracted from each tissue sample using Qiagen (Valencia, CA) RNeasy kits, following manufacturer's protocols, to a final concentration of 50ng/N,1. Single stranded cDNA was then synthesized by reverse transcribing the RNA samples using random hexamers and 500ng of total RNA per reaction, following protocol 4304965 of Applied Biosystems (Foster City, CA, http://www.a~~liedbiosystems.com/ ).
Primers for expression analysis using TaqMan assay (Applied Biosystems, Foster City, CA) were prepared according to the TaqMan protocols, and the following criteria: a) primer pairs were designed to span introns to eliminate genomic contamination, and b) each primer pair produced only one product.
Taqman reactions were carried out following manufacturer's protocols, in 25 N.l total volume for 96-well plates and 10 ~,l total volume for 384-well plates, using 300nM primer and 250 nM probe, and approximately 25ng of cDNA. The standard curve for result analysis was prepared using a universal pool of human cDNA samples, which is a mixture of cDNAs from a wide variety of tissues so that the chance that a target will be present in appreciable amounts is good. The raw data were normalized using 18S rRNA
(universally expressed in all tissues and cells).

For each expression analysis, tumor tissue samples were compared with matched normal tissues from the same patient. A gene was considered overexpressed in a tumor when the level of expression of the gene was 2 fold or higher in the tumor compared with its matched normal sample. In cases where normal tissue was not available, a universal pool of cDNA samples was used instead. In these cases, a gene was considered overexpressed in a tumor sample when the difference of expression levels between a tumor sample and the average of all normal samples from the same tissue type was greater than 2 times the standard deviation of all normal samples (i.e., Tumor -average(all normal samples) > 2 x STDEV(all normal samples) ).
Results are shown in Table 1. Data presented in bold indicate that greater than 50% of tested tumor samples of the tissue type indicated in row 1 exhibited over expression of the gene listed in column 1, relative to normal samples. Underlined data indicates that between 25% to 49% of tested tumor samples exhibited over expression. A
modulator identified by an assay described herein can be further validated for therapeutic effect by administration to a tumor in which the gene is overexpressed. A decrease in tumor growth confirms therapeutic utility of the modulator. Prior to treating a patient with the modulator, the likelihood that the patient will respond to treatment can be diagnosed by obtaining a tumor sample from the patient, and assaying for expression of the gene targeted by the modulator. The expression data for the genes) can also be used as a diagnostic marker for disease progression. The assay can be performed by expression analysis as described above, by antibody directed to the gene target, or by any other available detection method.
Table 1 breast.. . lung . _ colon . o~

GI# 10444344 (SEQ 1 12. 29.3 14. 7 ID NO:1) 8 2 GI#10440044 (SEQ 3 12. 30.9 14. 7 ID N0:4) 4 3 VI. Loss of function of the Drosophila CIG30/LCE gene is associated with tracheal defects Genetic screens were designed to identify modifiers of branching morphogenesis in Drosoplaila. Briefly, Drosophila embryos (approximately stage 16) that were homozygous for lethal insertions of a piggyBac (Eraser M et al., Virology (1985) 145:356-361) or P-element transposon were screened for tracheal defects using monoclonal antibody 2A12 (Samakovlis C, et al., Development (1996) 122:1395-1407; Patel NH. (1994) Practical Uses in Cell and Molecular Biology. Eds LSB Goldstein and EA Fryberg. Vol 44 pp446-488. San Diego Academic Press). Sequence information surrounding the transposon insertion site was used to identify the gene mutated by the insertion. The homozygous disruption of the Drosoplaila CIG30 (baldspot) gene was identified as associated with tracheal defects.
VII. Loss of function of a zebrafish LCEs is associated with branching_morpho~enesis defects Using antisense technologies, we identified vasculature defects associated with loss-of-function of the zebrafish (Danio rerio) LCE that we have designated DrCIG30L4, whose nucleic acid and polypeptide sequences are presented, respectively, in SEQ ID
N0:7and SEQ ID N0:15. We have identified ten candidate zebrafish LCE genes. Of these, four were tested for involvement in angiogenesis using essentially the following methods. Wild type, one-cell stage embryos from the Tiibingen strain were treated with antisense morpholino oligonucleotide (PMOs) that targeted predicted zebrafish genes.
PMOs were dissolved in injection buffer (0.4 mM MgSO4, 0.6 mM CaCl2, 0,7 mM
KCI, 58 mM NaCI, 25 mM Hepes [pH 7,6]), and 2-8 ng was injected into zebrafish embryos at the 1-cell stage.
Larvae were fixed at 4 days post fertilization (dpf) in 4% para-formaldehyde in phosphate-buffered saline (PBS) for 30 minutes. Fixed larvae were dehydrated in methanol and stored over night at -20°C. After permeabilization in acetone (30 minutes at -20°C), embryos were washed in PBS and incubated in the staining buffer (100 mM Tris-HCl [pH 9.5], 50mM MgCl2, 100mM NaCI, 0.1 % Tween-20) for 45 minutes. Staining reaction was started by adding 2.25 ~1 nitro blue tetrazolium (NBT, Sigma) and 1.75 p,1 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma) per m1 of staining buffer (stock solutions: 75 mg/ml NBT in 70% N,N-dimethylformamide, 50 mg/ml BLIP in N,N-dimethylformamide).
The fixed specimens were scanned for changes in blood vessel formation.
Treatment of embryos with a PMO corresponding to the complement of nucleotides 692-712 of SEQ
~ N0:7 (nucleotide sequence), produced a dose-dependant block of vasculogenesis and angiogenesis. Following injection of 2ng of the PMO, the intersegmental vessels (ISV) were disrupted; at 4ng of the PMO, the loss of ISV was much more severe.
Following injection of ~ng of PMO, the loss of blood vessels is more severe with few ISV
and the subintestinal vein (SIV) was almost complete disrupted.
VIII. ELOVL4 is an an~o eg~nesis ,gene Based on analysis of the zebrafish DrCIG30L4, we have identified ELOVL4 as an angiogenesis gene. We used computation analysis, specifically BLAST, Smith-Waterrnan, and CLUSTALW analysis, to identify human ELOVL4 ("HsELOVL4,"GI#s 12044043 and 12232379, SEQ ID NOs:l3 and 14) as the ortholog of DrCIG30L4. The Drosophila CIG30 protein sequence was BLASTed against a Homo sapierzs amino acid sequence database to identify the family of CIG30 and ELOV (fatty acid elongases). The Homo Sapiens sequences were similarly used to BLAST analyze the available zebrafish amino acid sequences both from public databases as well as our intexnal sequence databases. Initially, four zebrafish homologs to the CIG30/ELOV family were identified.
To reassess the orthology of the DrCIG30L4 and other zebrafish orthologs, these were BLAST analyzed individually against the Homo Sapiens amino acid sequence database. In the case of DrCIG30L4, the top "hit" was Ho»ao Sapiens ELOVL4. Ho~rao sapiens ELOVL4 amino acid sequence was then used to BLAST against the zebxafish amino acid sequence database; the DrCIG30L4 sequence was the mutual best "hit". ClustalW
alignment and phylogenetic analysis of the zebrafish CIG30/ELOV family also showed that HsELOVL4 and DrCIG30L4 are most closely related.
Without intent to be limiting, we have contemplated links between ELOVLA~ and branching moiphogenesis. As described above, ELOVL4 is associated with Autosomal Dominant Stargardt-like Maculax Dystrophy (STDG3). While a direct link between STGD3, ELOVL4 and angiogenesis has not been made, the PMO results in zebrafish 2,5 suggest a possible causal link between a defect in blood vessel formation and the' phenotypes associated with STGD3.
Thus, we have identified ELOVE4 as an attractive drug target for the treatment of pathologies associated with branching morphogenesis, such as angiogenesis, particularly pathologies that are also associated with defective p53 signaling.

SEQUENCE LISTING
<110> EXELIXIS, INC.
<120> LCEs AS MODIFIERS OF THE p53 PATHWAY AND METHODS OF USE
<130> EX02-0850-PC
<150> US 60/296,076 <151> 2001-06-05 <150> US 60/328,605 <151> 2001-10-10 <150> US 60/357,253 <151> 2002-02-15 <150> US 60/361,196 <151> 2002-03-01 <160> 16 <170> PatentIn version 3.1 <210> 1 <211> 7094 <212> DNA
<213> Homo Sapiens <220>
<221> misc_feature <222> (7004)..(7004) <223> "n" is A, C, G. or T
<400>

ttccggcagtggctcatgtctgtaatctcagcactttgggaagctgaagtgggcagatca60 cttgaggtcaggagttcaagtactagcctggccaacatggcgaaaactgtctctactaaa120 agcacaaaaattagcaaggcgtggtggcacacatctgtagtcccagcactcaggggactg180 aggtacgagaatcgcttgaactcaggaggcagaggttgcggtgagccaagatcaggccac240 tgcactccagcctgggcgacagagcaagactctgtctcataataaaaaattttaaaaaat300 agacatagtccctgcattcatggagctcaagaactagtaggaaaaacaggcattgatcaa360 gaaatcacaaaaacaactaattataaactctcactgaagaaaagaaataccatgctctga420 gaacagtttatataaaataagggtaccagaccaagtccaagggtcaaggaatgtttcctc480 tagaatataatttctgaagatttttcctcttcttttttcttttttgagacagagtctcgc540 tctgttgcccaggctggagtgcagtgacacaatctctgctcagtgcaacccacgcctgcc600 agattcaagcaattctecctgcctcagcctgccaagtagctggaattacaggtatccgcc660 actacacctagctaatttttgtatttttagtggagatggggtttcaccatgtgggccagg720 ctggtcttgaactcctgacctcaggtgatctgcccacctcagectcccaaagtgctggga780 taacaggcgtgagccactgcacctagcttttttttttttttttgagacagagtctcactc840 tgtcacccaggctggagtgcagtggtgtgatcacagctcagtggcacgatcacagctcac900 tgcagccttgacctccctggctcaagtgatCCtCCCtCCtcagtccctgagtagctggga960 ccacaggtgggcgctaccatgcccagctaatttttgtactttttgtagagatggattttc1020 accatgttgcccaggctggtctcaaattcctgggctcaagcaatccccccacctcagctt1080 cctacagtactgggattacaggcgtgagccaccgtgcccagccccgagtgttcttctttc1140 cctcttccacatacacctcctccaagcctcaccattaaacctcacagggaaagacaatgt1200 taaatatcttcacagagaaatccaggactgagtatatattctccatatgcacttgtaaac1260 ctcccataatgattcaccttgccatttccatgtgtctagtccacaatatcattttatcta1320 cattatctggcttgcatactaatcacaaccttgtgacataagcaggcgagtatgactata1380 tgcatttttttctgaagtagaatgtgacaaaggctaggtaacttgcctaaaatcacatgg1440 ctcattaatgggggtgctgggacttgaacttgggtcttgtaagacctagatggcattatt1500 cttgtaatattcattcttttatttattcattcatccatagacatgtattgatcacctttt1560 gattagctgtcaggctatatatggagccatcaggaaccactgaaggtttttttttttttt1620 tttttttttgagacggagtctcactctgtcacccaggctggagtgcagtggcacgatctc1680 tgctcactgcaagctctgcctcccaggttcacgccattctcctgcctcagcctcccgagt1740 agctgggactacaggcgcctgccaccacgcccggctaattttttgtattttttagtagag1800 acggggtttgacggtgttagccaggatggtctcgatctcctgacctcatgatctgcccgc1860 ctcggcctcccaaggtgctgggattacaggcgtgaaccaccgtgcccggccgaaccactg1920 aaggtttttaagcaggaaagcagagctgttttctggatgagcaaacagaaagtagtggtt1980 ttccaagtacagtctgagacaacctataggaccagaatctctgcagttgaggctcaggaa2040 tctggtaatcagccaggtataggaactcttttctgattgcaatgcagtgaagagcagaag2100 cactgtattagagaaagaggcagtgcaaccaggtaacgtgaccaggtgagaagtgatgag2160 gtacagagacaaagagatgcacttttgagtcacttagatggcactgataggacttccact2220 acaccctcgcatagacagtggctgaggttcaggaaatagagctggggttcctacttggat2280 cctctggctctagagctttactgcacatagccatttatacccacatcttgattttaatta2340 ttttatatctatgtttcttagcactttttgcaaatttccaccttatctcaaactgccctc2400 aagccttgtatttctccttcgctttcataaaacctaggaaagaaataagggacagccaag2460 taaaacttttaaaagttttagaacatttatttctttggggctggttacacaggcgagaaa2520 gaagtagatttggttagggagagaaaacaacaggccttggggagatacactggctctccc2580 cctccctaaaccctaagaggcctccaggaaacctgaagacaataattccagaagcccaga2640 gggtgacccc atttcctctc tccatggtta ttactgtcag tctg~agcag ttcaggaatt 2700 caggaaacta taaagaaacc acaacagcct caacaaccca aacatcaaca tcaacaacct 2760 caacaataaaactccttaaaattcatctccttccacccactcacaaccgcagactcgaag2820 ctaggaggtggaagggactacagaagctctgcgttgcccaggttagtatttgctcatcac2880 aggcctgggtttcccaggatctcagggagcctggaaactgacgcctccatttctgggtgg2940 gagcaccaaagcctaaggacacctttcctctctcttcactgctaagcaggtcaagattaa3000 agcaaaccgaggcaaaggccacggttgacagttccaagggaacccgcaaggccgcacagg3060 atggggtggacgttttacgggagaaaaggctggggaagtgggcgggcgatggcctacgac3120 gggacttggggcggggtgtgcgaaacgcctggcaggcgggcccttgagtatgaccaatca3180 gaatgcggactgcgtcccaggggcggagcagaggcgtatcttggtcgagattggatagcg3240 gcggggcgcaggaaagaggtcgcgccagcccgggcaggcagctttgcaagtccgcgttat3300 atatcgcagtggctgcgcccgggatagctggctgcgccgccgcgcacatgcctaggttcg3360 acgccctcctccctttgcccaggagttccttctgtcccggctctgttccgtctcgecccg3420 aggttcacgccatcctcggagccccagcctttcacccagcgcctccaagctttggacctt3480 gacttctgcaaaactagatggtcacagccatgaatgtctcacatgaagtaaatcagctgt3540 tccagccctataacttcgagctgtccaaggacatgaggccctttttcgaggagtattggt3600 gagactttgggagagggaaaggccatgccagggccccggggccggggcgcgagggggtgg3660 cattgaatgcccacaatgattttcttacagagcagagttatgggactcccttgtactggc3720 ttcacactacctttgtccgaggtgcaggtagtatgtggcacctcaaagagattagagctg3780 aaagcaagcaagcagaaataagaggatgagggagaacgtggaaatatacagaagtcaaag3840 agagcgtgtagtgagaagggtcttggaggcgtgaggttgatctgaagccttactagatga3900 cttccccgtcctttgtggctgtgtgtgcgcgcgtgtgtgcacagtgcagggcccggggga3960 cagcctgccctttacaattatcccatcgttccccaggtgctccaccgttcctgctgtgga4020 gaaggaggcgaagtcagagagctcttccaagctttccccaggaagagctctctggctttg4080 ccttaaagctccccagaggttttggaggctgactttatgctccaaccaatttgccatacc4140 ccagccagggagaagctattgccacattcttcttacgccacagccctggtatgcttctag4200 gagccccaaccagggagaagctattgccacacttcttacaccacagccctgggctgcttc4260 taggcgcgggccagacagccgtcacccacctctaaccccactgagagagcaataatcaca4320 gaaaccttggacatagctcctgccctgtgctagatactttgtatacgttaatacccccag4380 gagagatgtagtattcgcgctctacaaatgaggaagccaaggctcagagaattaagttgg4440 tttttccaatgtcacatagctagtaagtggcagaactgggactccaacccagagcactca4500 cctggagagatgagtgggcatttctctaatCagcacccacccatgagcccatccctctgc4560 cttctgcttgccagggcaacctcattccccatagccctgatctacctggttctcatcgct4620 gtggggcagaactacatgaaggaacgcaagggcttcaacctgcaagggcctctcatcctc4680 tggtccttctgccttgcaatcttcaggtaagaccccatcccactccctgcctcttctcta4740 gatcttagaccaccattctatcccttgaagctttcccgattgcatcaacctccatcctgt4800 ccccaagttgccttgtaacactctccccatCtCattCtCggCtttagttCccctcccagc4860 cttcaccctcttctgttatattatcctgttttccttctcttttagacccctacctggtgg4920 tctctgctttgtccctcttgccttcgtagagtctgtactcgcaactaatttctccagcct4980 ctaatagtgtcacctcctaacaccctctctcaagaccctccaataacttccccatatttt5040 ctcccccaaactccttcagtcttcccytatccctctacacatctcctcccaggctcctaa5100 cccctcccaagaaccccattccttaactcaactttcagtcccatccccctgcattccctg5160 atctttctccagccctcrtctcctctagactactgattggatctaccagattggcttcag5220 gatctcaggagctttgacccacccsctgtggacaggtggggaggtggtagagcttggaac5280 acagtaacctggccaagccgggggaagggtggattattggtgcctggggatgacacttac5340 accatcttcctttgtcccatttcagtatcctgggggcagtgaggatgtggggcattatgg5400 ggactgtgctacttaccgggggcctaaagcaaaccgtgtgcttcatcaacttcatcgata5460 attccacagtcaaattctggtcctgggtctttcttctcagcaaggtcatagaactcggtg5520 agtggcaaagctttgtctttctggtgccttgtgaactgcatccttcctcagggccctccc5580 ttcacccatcccatggagggtctctttcctacccttgggtcccaataatacctctcaccc5640 aagcccctctacagattctctgccacaaagacccecttccctcccctgagaatttctccc5700 gtgtccctacatccagtgcagagggtggtcccagcactgggtggtatgccaactatgact5760 ctccatctcccaggagacacagccttcatcatcctgcgtaagcggccactcatctttatt5820 cactggtaccaccacagcacagtgctcgtgtacacaagctttggatacaagaacaaagtg5880 cctgcaggaggctggttcgtcaccatgaactttggtgttcatgccatcatgtacacctac5940 tacactctgaaggctgccaacgtgaagccccccaagatgctgcccatgctcatcaccagc6000 ctgcagatcttgcagatgtttgtaggagccatcgtcagcatcctcacgtacatctggagg6060 caggatcagggatgccacaccacgatggaacacttattctggtccttcatcttgtatatg6120 acctatttcatcctctttgcccacttcttctgccagacctacatcaggcccaaggtcaaa6180 gccaagaccaagagccagtgaaggtttggagagaacaatgaagctccaggctctctcttc6240 tccagggcaccaagaggctgggcttagttttgggagaatgattaggttgccttacctgca6300 tggtttccccagaggatgtgtgccccaaggtggctggaatttttgacagacaagaagggt6360 gaccttgggatgggggtgtggtctgttactttaatgtttctgtttttaatgtgaaggcca6420 agcaggccctgggatgggagtggggcggaggagggtcctaagagctgattatttaatttc6480 tatccagaaatctttcttcttcttgctctgtttttttaaattaaagatttcaacaaaatt6540 ttgagagttgggggatttggggggaaagagggctgctgtgatggcaggaggctgctacca6600 aggggatgatctgcaggtgggacgcctgagggtgtgtggaagggtgagaggcacacacac6660 agacactgaaagaatcctaggcctggtaggcacttaacaaatgtctgttacagaccagaa6720 ttttattgctgttagagacccaagcccctcataggaacagtgagaaacaggtgcagaaag6780 gcggagtaactttatctaaagtcataggctccctgaatagcagagctgacacctacaagg6840 aagcgttggagaccagatctaccagctagcctccctgagaccacgaggtggcgccgcagc6900 accggctgtggccgatgccagccaggtagccggtttcccacgtcccccgcacgcacgcac6960 ctctttgctgcaggaatcccgggctgccccgacctggagtaggnggggtggtgagtggga7020 ctgagtccctagaagcctggaccctcasttcgttccctgtacatccagctcgcctgtaga7080 cagtggggga ggat 7094 <210> 2 <211> 828 <212> DNA
<213> Homo Sapiens <400>

ctagatggtcacagccatgaatgtctcacatgaagtaaatcagctgttccagccctataa60 cttcgagctgtccaaggacatgaggccctttttcgaggagtattgggcaacctcattccc120 catagccctgatctacctggttctcatcgctgtggggcagaactacatgaaggaacgcaa180 gggcttcaacctgcaagggcctctcatcctctggtccttctgccttgcaatcttcagtat240 cctgggggcagtgaggatgtggggcattatggggactgtgctacttaccgggggcctaaa300 gcaaaccgtgtgcttcatcaacttcatcgataattccacagtcaaattctggtcctgggt360 ctttcttctcagcaaggtcatagaactcggagacacagccttcatcatcctgcgtaagcg420 gccactcatctttattcactggtaccaccacagcacagtgctcgtgtacacaagctttgg480 atacaagaacaaagtgcctgcaggaggctggttcgtcaccatgaactttggtgttcatgc540 catcatgtacacctactacactctgaaggctgccaacgtgaagccccccaagatgctgcc600 catgctcatcaccagcctgcagatcttgcagatgtttgta ggagccatcg tcagcatcct660 cacgtacatctggaggcaggatcagggatgccacaccacg atggaacact tattctggtc720 cttcatcttgtatatgacctatttcatcctctttgcccac ttcttctgcc agacctacat780 caggcccaaggtcaaagccaagaccaagagccagtgaa 818 <210> 3 <211> 3045 <212> DNA
<213> Homo Sapiens <400>

actaagaccgcaaggcattcatttcctcctacggtggatgcggacgccgggaggaggaga60 gccccagagagaggagctgggagcggaggcgcaggcaatgctcagccctggatgtagctg120 agaggctgggagaagagacgaccgctggagaccgagcggcgtggggaagacctagggggg180 tgggtgggggaagcagacaggagaacactcgaaatcaagcgctttacagattattttatt240 ttgtatagagaacacgtagcgactccgaagatcagccccaatgaacatgtcagtgttgac300 tttacaagaatatgaattcgaaaagcagttcaacgagaatgaagccatccaatggatgca360 ggaaaactggaagaaatctttcctgttttctgctctgtatgctgcctttatattcggtgg420 tcggcacctaatgaataaacgagcaaagtttgaactgaggaagccattagtgctctggtc480 tctgacccttgcagtcttcagtatattcggtgctcttcgaactggtgcttatatggtgta540 cattttgatgaccaaaggcctgaagcagtcagtttgtgaccagggtttttacaatggacc600 tgtcagcaaattctgggcttatgcatttgtgctaagcaaagcacccgaactaggagatac660 aatattcattattctgaggaagcagaagctgatcttcctgcactggtatcaccacatcac720 tgtgctcctgtactcttggtactcctacaaagacatggttgccgggggaggttggttcat780 gactatgaactatggcgtgcacgccgtgatgtactcttactatgccttgcgggcggcagg840 tttccgagtctcccggaagtttgccatgttcatcaccttgtcccagatcactcagatgct900 gatgggctgtgtggttaactacctggtcttctgctggatgcagcatgaccagtgtcactc960 tcactttcagaacatcttctggtcctcactCatgtaCCtCdgCtaCCttgtgCtCttCtg1O2O

ccatttcttctttgaggcctacatcggcaaaatgaggaaaacaacgaaagctgaatagtg1080 ttggaactgaggaggaagccatagctcagggtcatcaagaaaaataatagacaaaagaaa1140 atggcacaaggaatcacacgtggtgcagctaaaacaaaacaaaacatgagcaaacacaaa1200 acccaaggcagcttagggataattaggttgatttaacccagtaagtttatgatcctttta1260 gggtgaggactcactgagtgcacctccatctccaagcactgctgctggaagaccccattc1320 cctctttatctatcaactctaggacaagggagaacaaaagcaagccagaagcagaggaga1380 ctaatcaaaggcaaacaaaggctattaacacataggaaaatatgtatttactaagtgtca1440 catttctctaagatgaaagatttttactctagaaactgtgcgagcacaacacacacaatc1500 ctttctaactttatggacactaaactggagccaatagaaaagacaaaaatgaaagagaca1560 cagggtgtatatctagaacgataatgcttttgcagaaactaaagcctttttaagaaatgc1620 cagctgctgtagaccccatgagaaaagatgtcttaatcatccttatgaaaacagatgtaa1680 acaactatatttcaactaacttcatcttcactgcatagcctcaggctagtgagtttgcca1740 aaaccaaagggggtgaatacttccccaagattcttcctgggaggatggaaacagtgcagc1800 ccaggtcccatgggggcagctccatcccagagcatttctgatagttgaactgtaatttct1860 actcttaagtgagatatgaagtattatccttttgttcagttgccccgggcttttgaacag1920 aagagtaaatacagaattgaaaaagataaacactcaaccaaacaatgtgaaaacgggttc1980 tgtagtatttgtaaaaaggcccggcccaggaccactgtgagctggaaaagggagaaaggc2040 agtgggaaaagaggtgagccgaagatcaattcgacagacagacggtgtgtatgcccctcc2100 ctgtttgacttcacacacactcataactttccaaatgaaaccccacagtatagcgcatat2160 tttcgatatttttgtgaattccaaaaggaaatcacagggctgttcgaaatattgggggaa2220 cactgtgtttctgcatcatctgcatttgctccccaagcaatgtagaggtgtttaaagggc2280 cctctgctggctgagtggcaatactacaacaaacttcaaggcaagtttggctgaaaacag2340 ttgacaacaaagggcccccatacacttatccctcaaattttaagtgatatgaaatacttg2400 tcatgtctttggccaaatcagaagatattcatcctgcttcaagtcagcttcagaaatgtt2460 ttaaaagggactttagctctggaactcaaaatcaatttattaagagccatattctttaaa2520 aaaaaaagctggataatattatctgtaatatttcagtcctttacaagccaaatacatgtg2580 tcaatgtttctagtatttcaaagaagcaattatgtaaagttgttcaatgtgacataatag2640 tattataattggttaagtagcttaatgattaggcaaactagatgaaaagattaggggctt2700 ccacactgcatagatcacacgcacatagccacgcatacacacacagacacacagatgtgg2760 ggtacactgaatttcaaagcccaaatgaatagaaacacattttctggctagcagaaaaaa2820 acaaaacaaaactgttgtttctctttcttgctttgagagtgtacagtaaaagggattttt2880 tcgaattatttttatattattttagctttaattgtgctgtcgttcatgaaacagagctgc2940 tctgcttttctgtcagagatggcaagggctttttcagcatctcgtttatgtgtggaattt3000 aaaaagaataaagttttattccattctgaaaaaaaaaaaaaaaaa 3045 <210> 4 <211> 3045 <212> DNA
<213> Homo sapiens <400> 4 actaagaccg caaggcattc atttcctcct acggtggatg cggacgccgg gaggaggaga 60 gccccagaga gaggagctgg gagcggaggc gcaggcaatg ctcagccctg gatgtagctg 120 agaggctggg agaagagacg accgctggag accgagcggc gtggggaaga cctagggggg 180 tgggtggggg aagcagacag gagaacactc gaaatcaagc gctttacaga ttattttatt 240 ttgtatagag aacacgtagc gactccgaag atcagcccca atgaacatgt cagtgttgac 300 tttacaagaatatgaattcgaaaagcagttcaacgagaatgaagccatccaatggatgca360 ggaaaactggaagaaatctttcctgttttctgctctgtatgctgcctttatattcggtgg420 tcggcacctaatgaataaacgagcaaagtttgaactgaggaagccattagtgctctggtc480 tctgacccttgcagtcttcagtatattcggtgctcttcgaactggtgcttatatggtgta540 cattttgatgaccaaaggcctgaagcagtcagtttgtgaccagggtttttacaatggacc600 tgtcagcaaattctgggcttatgcatttgtgctaagcaaagcacccgaactaggagatac660 aatattcattattctgaggaagcagaagctgatcttcctgcactggtatcaccacatcac720 tgtgctcctgtactcttggtactcctacaaagacatggttgccgggggaggttggttcat780 gactatgaactatggcgtgcacgccgtgatgtactcttactatgccttgcgggcggcagg840 tttccgagtctcccggaagtttgccatgttcatcaccttgtcccagatcactcagatgct900 gatgggctgtgtggttaactacctggtcttctgctggatgcagcatgaccagtgtcactc960 tcactttcagaacatcttctggtcctcactcatgtacctcagctaccttgtgctcttctg1020 ccatttcttctttgaggcctacatcggcaaaatgaggaaaacaacgaaagctgaatagtg1080 ttggaactgaggaggaagccatagctcagggtcatcaagaaaaataatagacaaaagaaa1140 atggcacaaggaatcacacgtggtgcagctaaaacaaaacaaaacatgagcaaacacaaa1200 acccaaggcagcttagggataattaggttgatttaacccagtaagtttatgatcctttta1260 gggtgaggactcactgagtgcacctccatctccaagcactgctgctggaagaccccattc1320 cctctttatctatcaactctaggacaagggagaacaaaagcaagccagaagcagaggaga1380 ctaatcaaaggcaaacaaaggctattaacacataggaaaatatgtatttactaagtgtca1440 catttctctaagatgaaagatttttactctagaaactgtgcgagcacaacacacacaatc1500 ctttctaactttatggacactaaactggagccaatagaaaagacaaaaatgaaagagaca1560 cagggtgtatatctagaacgataatgcttttgcagaaactaaagcctttttaagaaatgc1620 cagctgctgtagaccccatgagaaaagatgtcttaatcatccttatgaaaacagatgtaa1680 acaactatatttcaactaacttcatcttcactgcatagcctcaggctagtgagtttgcca1740 aaaccaaagggggtgaatacttccccaagattcttcctgggaggatggaaacagtgcagc1800 ccaggtcccatgggggcagctccatcccagagcatttctgatagttgaactgtaatttct1860 actcttaagtgagatatgaagtattatccttttgttcagttgccccgggcttttgaacag1920 aagagtaaatacagaattgaaaaagataaacactcaaccaaacaatgtgaaaacgggttc1980 tgtagtatttgtaaaaaggcccggcccaggaccactgtgagctggaaaagggagaaaggc2040 agtgggaaaagaggtgagccgaagatcaattcgacagacagacggtgtgtatgcccctcc2100 ctgtttgacttcacacacactcataactttccaaatgaaaccccacagtatagcgcatat2160 tttcgatatttttgtgaattccaaaaggaaatcacagggctgttcgaaatattgggggaa2220 cactgtgtttctgcatcatctgcatttgctccccaagcaatgtagaggtgtttaaagggc2280 cctctgctggctgagtggcaatactacaacaaacttcaaggcaagtttggctgaaaacag2340 ttgacaacaaagggcccccatacacttatccctcaaattttaagtgatatgaaatacttg2400 tcatgtctttggccaaatcagaagatattcatcctgcttcaagtcagcttcagaaatgtt2460 ttaaaagggactttagctctggaactcaaaatcaatttattaagagccatattctttaaa2520 aaaaaaagctggataatattatctgtaatatttcagtcctttacaagccaaataCatgtg2580 tcaatgtttctagtatttcaaagaagcaattatgtaaagttgttcaatgtgacataatag2640 tattataattggttaagtagcttaatgattaggcaaactagatgaaaagattaggggctt2700 ccacactgcatagatcacacgcacatagccacgcatacacacacagacacacagatgtgg2760 ggtacactgaatttcaaagcccaaatgaatagaaacacattttctggctagcagaaaaaa2820 acaaaacaaaactgttgtttctctttcttgctttgagagtgtacagtaaaagggattttt2880 tcgaattatttttatattattttagctttaattgtgctgtcgttcatgaaacagagctgc2940 tctgcttttetgtcagagatggcaagggctttttcagcatctcgtttatgtgtggaattt3000 aaaaagaataaagttttattccattctgaaaaaaaaaaaaaaaaa 3045 <210> 5 <211> 2900 <212> DNA
<213> Homo Sapiens <400>

tgaggagcaggagaagacgcagccgggccgccgccgttagaggggttcccggccgccgct60 cgccccgtcggccgccaccgcctccggggtcagccctctctctgggtctccgctttctcc120 tgccgccagcgcccgctcatcgccgcgatggggctcctggactcggagccgggtagtgtc180 ctaaacgtagtgtccacggcactcaacgacacggtagagttctaccgctggacctggtcc240 atcgcagataagcgtgtggaaaattggcctctgatgcagtctccttggcctacactaagt300 ataagcactctttatctcctgtttgtgtggctgggtccaaaatggatgaaggaccgagaa360 ccttttcagatgcgtctagtgctcattatctataattttgggatggttttgcttaacctc420 tttatcttcagagagttattcatgggatcatataatgcgggatatagctatatttgccag480 agtgtggattattctaataatgttcatgaagtcaggatagctgctgctctgtggtggtac540 tttgtatctaaaggagttgagtatttggacacagtgttttttattctgagaaagaaaaac600 aaccaagtttctttccttcatgtgtatcatcactgtacgatgtttaccttgtggtggatt660 ggaattaagtgggttgcaggaggacaagcattttttggagcccagttgaattcctttatc720 catgtgatta tgtactcata ctatgggtta actgcatttg gcccatggat tcagaaatat 780 ctttggtgga aacgatacct gactatgttg caactgattc aattccatgt gaccattggg 840 cacacggcac tgtctcttta cactgactgc cccttcccca aatggatgca ctgggctcta 900 attgcctatg caatcagctt catatttctc tttcttaact tctacattcg gacatacaaa 960 gagcctaagaaaccaaaagctggaaaaacagccatgaatggtatttcagcaaatggtgtg1020 agcaaatcagaaaaacaactcatgatagaaaatggaaaaaagcagaaaaatggaaaagca1080 aaaggagattaaattgaactgggccttaactgttgttgacagtgaggaaaaactcccata1140 tcatataaaatttcagggaaaacagaagcaaaggagagcttgggggtggggagaaaagac1200 aaatgtgctctatgtcctagtaactcttagactgagtaaagtgttaataccatacccaga1260 tgttttatttatgaagtttttattttaaacattttttttaaaaattagccttgatattct1320 ccagaccaaagcaatcattaagtgactttggggattctccccctgttcacatccagttgt1380 ctaaaggatgagatttttcatgtatcttatagtcactcattcttcggtctgaattttaga1440 cgatcacagaaacggtctttatgaattattttgataaattactaattatcttatctactg1500 actgaaatcagtggtgttacattttcttgtccaaagctgaaaatgtgtatacacttaaac1560 ttgcacatttgaattcatttgctgaccggaatggtcaaatctctccacctctagtcagag1620 tataattttggttgtaattaaatttttaaaatctgctgatctctgtagaatcttagaggc1680 ttgatgatgatggtgttggtgaaaataagaaagaattgcagtaaagtcttgtctggtgac1740 ccagagatcaccatgacttgaggcacaaatcactgtggggaaacaattttttgtgatgaa1800 aaggcagcatttgaatactcctgttagtagcagaaatatattatgaaattaagattattg1860 tctgattgaaacatgaaacaactcatgtctttattagtaacatcataagatagttacatt1920 tatgtgctgttagaatatgttaatttttatcaggctttccttgttttgatttatggctgt1980 tcctgatttttcatatgtggaaatatacctacctcttccgttggaaagaacatttaaaat2040 taaataaattttaattaaaaaatcaaggagtcttctaatgtaaattttaatgttaacttt2100 caaatccactagtattttttttgcttttatgacaaatagcatacaccaaacatttctgtg2160 aaactatccttctctttcaatgtgtttaattttggagtaacgttttccttgtgactaagt2220 tgcaagatcttatttattaactaggtatgaagtataaacccattttggtgcaatattctt2280 gactccttggtgctaaagattgttaaattcaatgcttgatgttacaaggtgttgttaaaa2340 cacaaaatgaataaaagtgagagtagtcagaactataacattcaatttgctatttacaaa2400 tgaagtatttcatgtaatataagtgaacaactggaaataaagtaggaaagaatttgtatc2460 atgttttactacataggttaattttttaagggatgttgcaaagggattactagagaaaga2520 caaaatgtgaccaaaaaaaagcatgaatatttcttaagtatctcaacaacatgtcaaagc2580 tgcatgtgtaggatgtatgctgtttgtacaaactatttcagaatattttgtaagctataa2640 catatttattgtgcattaaaattaaatactttttccccaaaggcatgcagtcatgagaat2700 tacagaaaatttgcaacatataaagtagtttgatctaagaggattcaacacctttgtttt2760 gttgctcagtgtgtaatgactgagatttgtaaatctttgtgaacattctgtactggttcc2820 caagagctattcattccctgctacctgatttcagcacaataaatatacttctgctgtggg2880 aaaaaaaaaa aaaaaaaaaa 2900 <210> 6 <211> 2900 <212> DNA
<213> Homo sapiens <400>

tgaggagcaggagaagacgcagccgggccgccgccgttagaggggttcccggccgccgct60 cgccccgtcggccgccaccgcctccggggtcagccctctctCtgggtCtCCgCtttctCC120 tgccgccagcgcccgctcatcgccgcgatggggctcctggactcggagccgggtagtgtc180 ctaaacgtagtgtccacggcactcaacgacacggtagagttctaccgctggacctggtcc240 atcgcagataagcgtgtggaaaattggcctctgatgcagtctccttggcctacactaagt300 ataagcactctttatctcctgtttgtgtggctgggtccaaaatggatgaaggaccgagaa360 ccttttcagatgcgtctagtgctcattatctataattttgggatggttttgcttaacctc420 tttatcttcagagagttattcatgggatcatataatgcgggatatagctatatttgccag480 agtgtggattattctaataatgttcatgaagtcaggatagctgctgctctgtggtggtac540 tttgtatctaaaggagttgagtatttggacacagtgttttttattctgagaaagaaaaac&00 aaccaagtttctttccttcatgtgtatcatcactgtacgatgtttaccttgtggtggatt660 ggaattaagtgggttgcaggaggacaagcattttttggagcccagttgaattcctttatc720 catgtgattatgtactcatactatgggttaactgcatttggcccatggattcagaaatat780 ctttggtggaaacgatacctgactatgttgcaactgattcaattccatgtgaccattggg840 cacacggcactgtctctttacactgactgccccttccccaaatggatgcactgggctcta900 attgcctatgcaatcagcttcatatttctctttcttaacttctacattcggacatacaaa960 gagcctaagaaaccaaaagctggaaaaacagccatgaatggtatttcagcaaatggtgtg1020 agcaaatcagaaaaacaactcatgatagaaaatggaaaaaagcagaaaaatggaaaagca1080 aaaggagattaaattgaactgggccttaactgttgttgacagtgaggaaaaactcccata1140 tcatataaaatttcagggaaaacagaagcaaaggagagcttgggggtggggagaaaagac1200 aaatgtgctctatgtcctagtaactcttagactgagtaaagtgttaataccatacccaga1260 tgttttatttatgaagtttttattttaaacattttttttaaaaattagccttgatattct1320 ccagaccaaagcaatcattaagtgactttggggattctccccctgttcacatccagttgt1380 ctaaaggatgagatttttcatgtatcttatagtcactcattcttcggtctgaattttaga1440 cgatcacagaaacggtctttatgaattattttgataaattactaattatcttatctactg1500 actgaaatcagtggtgttacattttcttgtccaaagctgaaaatgtgtatacacttaaac1560 ttgcacatttgaattcatttgctgaccggaatggtcaaatctctccacctctagtcagag1620 tataattttggttgtaattaaatttttaaaatctgctgatctctgtagaatcttagaggc1680 ttgatgatgatggtgttggtgaaaataagaaagaattgcagtaaagtcttgtctggtgac1740 ccagagatcaccatgacttgaggcacaaatcactgtggggaaacaattttttgtgatgaa1800 aaggcagcatttgaatactcctgttagtagcagaaatatattatgaaattaagattattg1860 tctgattgaaacatgaaacaactcatgtctttattagtaacatcataagatagttacatt1920 tatgtgctgttagaatatgttaatttttatcaggctttccttgttttgatttatggctgt1980 tcctgatttttcatatgtggaaatatacctacctcttccgttggaaagaacatttaaaat2040 taaataaattttaattaaaaaatcaaggagtcttctaatgtaaattttaatgttaacttt2100 caaatccactagtattttttttgcttttatgacaaatagcatacaccaaacatttctgtg2160 aaactatccttctctttcaatgtgtttaattttggagtaacgttttccttgtgactaagt2220 tgcaagatcttatttattaactaggtatgaagtataaacccattttggtgcaatattctt2280 gactccttggtgctaaagattgttaaattcaatgcttgatgttacaaggtgttgttaaaa2340 cacaaaatgaataaaagtgagagtagtcagaactataacattcaatttgctatttacaaa2400 tgaagtatttcatgtaatataagtgaacaactggaaataaagtaggaaagaatttgtatc2460 atgttttactacataggttaattttttaagggatgttgcaaagggattactagagaaaga2520 caaaatgtgaccaaaaaaaagcatgaatatttcttaagtatctcaacaacatgtcaaagc2580 tgcatgtgtaggatgtatgctgtttgtacaaactatttcagaatattttgtaagctataa2640 catatttattgtgcattaaaattaaatactttttccccaaaggcatgcagtcatgagaat2700 tacagaaaatttgcaacatataaagtagtttgatctaagaggattcaacacctttgtttt2760 gttgctcagtgtgtaatgactgagatttgtaaatctttgtgaacattctgtactggttcc2820 caagagctattcattccctgctacctgatttcagcacaataaatatacttctgctgtggg2880 aaaaaaaaaa aaaaaaaaaa 2900 <210> 7 <211> 1307 <212> DNA
<213> Danio rerio <400> 7 cgagcgcaccggcatgagccccacatggcgcgactgcgcatgctcagttgcggacagacc60 ggtgtccagtcaccgtcagacgcaccgctcagaagcgtttgcctcatatgctccggtccc120 gttagtgacactccgtttgccttcgcgttattattgccaaaaaactgcggggttgatgcg180 tttaaacgtacgctgtagatttaaatatagacaattattcactcgcatattttacctggg240 ctgcagcacacctgatgtcgacataggcacgcgctcgtaaggataatcatcttagaacta300 gcgccatggagacggtcgttcacctgatgaatgactctgtagagttttacaaatggagcc360 ttaccatagcagacaagcgtgtggagaaatggccgatgatgtcatctcctctgcccactc420 tggggatcagtgttttgtacctgctcttcctttgggccggccctctttacatgcagaacc480 gcgagcctttccagctcaggaaaacactcattgtgtacaacttcagcatggtgctgctta540 acttctacatctgcaaagagctgctcctgggctccagagcagccggatacagctacctct600 gccagcctgtcaactactccaatgatgttaatgaagtcaggatagcatctgctctgtggt660 ggtattacatctccaagggagtggagtttctggacacggtcttcttcatcatgaggaaga720 agtttaatcaggtcagcttcctgcacgtctatcaccactgcacaatgttcatcctgtggt780 ggatcggcatcaagtgggttcctggtggacagtctttctttggcgcaacgattaactcag840 gcattcatgtgctgatgtacggctactacggcctggcagcgtttggcccgaagatccaga900 agtacctgtggtggaagaaatacctcactattattcagatgatccagttccacgtcacca960 ttgtccatgctgcttactctctctacacgggctgtccattcccagcatggatgcaaagtg1020 ctttgattggctatgccgatacattcatcatcctgttggccaatttttactaccagacct1080 accgtcgccagccacttcctaagacagccaaattcgcagttaacggcgtctccatgtcaa1140 ccaacggcaccagcaagacagccgaggtcacggaaaatggaaagaaacag acgaaaggaa1200 aaggaaagcacgattaaaacgaatcttggatggagataaaccattacaga ctgtttggta1260 gttgtaaaaacaaaacaaacatgctgattgtatttctgggacaataa 1307 <210> 8 <211> 1338 <212> DNA
<213> Homo sapiens <400>

gcagtggctgcgcccgggatagctggctgcgccgccgcgcacatgcctaggttcgacgcc60 ctcctccctttgcccaggagttccttctgtcccggctctgttccgtctcgccccgaggtt120 cacgccatcctcggagccccagcctttcacccagcgcctccaagctttggaccttgactt180 ctgcaaaactagatggtcacagccatgaatgtctcacatgaagtaaatcagctgttccag240 ccctataacttcgagctgtccaaggacatgaggccctttttcgaggagtattgggcaacc300 tcattccccatagccctgatctacctggttctcatcgctgtggggcagaactacatgaag360 gaacgcaagggcttcaacctgcaagggcctctcatcctctggtccttctgccttgcaatc420 ttcagtatcctgggggcagtgaggatgtggggcattatggggactgtgctacttaccggg480 ggcctaaagcaaaccgtgtgcttcatcaacttcatcgataattccacagtcaaattctgg540 tcctgggtctttcttctcagcaaggtcatagaactcggagacacagccttcatcatcctg600 cgtaagcggccactcatctttattcactggtaccaccacagcacagtgctcgtgtacaca660 agctttggatacaagaacaaagtgcctgcaggaggctggttcgtcaccatgaactttggt720 gttcatgccatcatgtacacctactacactctgaaggctgccaacgtgaagccccccaag780 atgctgcccatgctcatcaccagcctgcagatcttgcagatgtttgtaggagccatcgtc840 agcatcctcacgtacatctggaggcaggatcagggatgccacaccacgatggaacactta900 ttctggtccttcatcttgtatatgacctatttcatcctctttgcccacttcttctgccag960 acctacatcaggcccaaggtcaaagccaagaccaagagccagtgaaggtttggagagaac1020 aatgaagctccaggctctctcttctccagggcaccaagaggctgggcttagttttgggag1080 aatgattaggttgccttacctgcatggtttccccagaggatgtgtgccccaaggtggctg1140 gaatttttgacagacaagaagggtgaccttgggatgggggtgtggtctgttactttaatg1200 tttctgtttttaatgtgaaggccaagcaggccctgggatgggagtggggcggaggagggt1260 cctaagagctgattatttaatttctatccagaaatctttcttcttcttgctctgtttttt1320 taaattaaagatttcaac 1338 <210> 9 <211> 236 <212> PRT
<213> Homo sapiens <400> 9 Ala Thr Ser Phe Pro Ile Ala Leu Ile Tyr Leu Val Leu Ile Ala Val Gly Gln Asn Tyr Met Lys Glu Arg Lys Gly Phe Asn Leu Gln Gly Pro Leu Ile Leu Trp Ser Phe Cys Leu Ala Ile Phe Ser I1e Leu Gly Ala Va1 Arg Met Trp Gly Ile Met Gly Thr Val Leu Leu Thr Gly Gly Leu Lys Gln Thr Val Cys Phe Ile Asn Phe Ile Asp Asn Ser Thr Val Lys Phe Trp Ser Trp Val Phe Leu Leu Ser Lys Val Ile Glu Leu Gly Asp Thr Ala Phe Ile Ile Leu Arg Lys Arg Pro Leu Ile Phe Ile His Trp Tyr His His Ser Thr Val Leu Val Tyr Thr Ser Phe Gly Tyr Lys Asn Lys Val Pro Ala Gly Gly Trp Phe Val Thr Met Asn Phe Gly Val His Ala Ile Met Tyr Thr Tyr Tyr Thr Leu Lys Ala Ala Asn Val Lys Pro Pro Lys Met Leu Pro Met Leu Ile Thr Ser Leu Gln Ile Leu Gln Met Phe Val Gly Ala Ile Val Ser Ile Leu Thr Tyr Ile Trp Arg Gln Asp Gln Gly Cys His Thr Thr Met Glu His Leu Phe Trp Ser Phe Ile Leu Tyr Met Thr Tyr Phe Ile Leu Phe Ala His Phe Phe Cys Gln Thr Tyr Ile Arg Pro Lys Val Lys Ala Lys Thr Lys Ser Gln <210> 10 <211> 270 <212> PRT
<213> Homo sapiens <400> 20 Met Val Thr Ala Met Asn Val Ser His Glu Val Asn Gln Leu Phe Gln l 5 10 15 Pro Tyr Asn Phe Glu Leu Ser Lys Asp Met Arg Pro Phe Phe Glu Glu Tyr Trp Ala Thr Ser Phe Pro Ile Ala Leu Ile Tyr Leu Val Leu Ile Ala Val Gly Gln Asn Tyr Met Lys Glu Arg Lys Gly Phe Asn Leu Gln Gly Pro Leu Ile Leu Trp Ser Phe Cys Leu Ala Ile Phe Ser Ile Leu G1y Ala Val Arg Met Trp Gly Ile Met Gly Thr Val Leu Leu Thr Gly Gly Leu Lys Gln Thr Val Cys Phe Ile Asn Phe Ile Asp Asn Ser Thr Val Lys Phe Trp Ser Trp Val Phe Leu Leu Ser Lys Val Ile Glu Leu Gly Asp Thr Ala Phe Ile Ile Leu Arg Lys Arg Pro Leu Ile Phe Ile His Trp Tyr His His Ser Thr Val Leu Val Tyr Thr Ser Phe Gly Tyr Lys Asn Lys Val Pro Ala Gly Gly Trp Phe Val Thr Met Asn Phe Gly Val His Ala Ile Met Tyr Thr Tyr Tyr Thr Leu Lys Ala Ala Asn Val Lys Pro Pro Lys Met Leu Pro Met Leu Ile Thr Ser Leu Gln Ile Leu Gln Met Phe Val Gly Ala Ile Val Ser I1e Leu Thr Tyr Ile Trp Arg Gln Asp Gln Gly Cys His Thr Thr Met Glu His Leu Phe Trp Ser Phe Ile Leu Tyr Met Thr Tyr Phe Ile Leu Phe Ala His Phe Phe Cys Gln Thr Tyr Ile Arg Pro Lys Val Lys Ala Lys Thr Lys Ser Gln <210> 11 <211> 265 <212> PRT
<213> Homo sapiens <400> 11 Met Asn Met Ser Val Leu Thr Leu Gln Glu Tyr Glu Phe Glu Lys Gln Phe Asn Glu Asn Glu Ala Ile Gln Trp Met Gln Glu Asn Trp Lys Lys Ser Phe Leu Phe Ser Ala Leu Tyr Ala Ala Phe Ile Phe Gly Gly Arg His Leu Met Asn Lys Arg Ala Lys Phe Glu Leu Arg Lys Pro Leu Val Leu Trp Ser Leu Thr Leu Ala Val Phe Sex Ile Phe Gly Ala Leu Arg Thr Gly Ala Tyr Met Val Tyr Ile Leu Met Thr Lys Gly Leu Lys Gln Ser Val Cys Asp Gln Gly Phe Tyr Asn Gly Pro Val Ser Lys Phe Trp Ala Tyr Ala Phe Val Leu Ser Lys Ala Pro Glu Leu Gly Asp Thr Ile Phe Ile Ile Leu Arg Lys Gln Lys Leu Ile Phe Leu His Trp Tyr His His Ile Thr Val Leu Leu Tyr Ser Trp Tyr Ser Tyr Lys Asp Met Val Ala Gly Gly Gly Trp Phe Met Thr Met Asn Tyr Gly Val His Ala Val Met Tyr Ser Tyr Tyr Ala Leu Arg Ala Ala Gly Phe Arg Val Ser Arg Lys Phe Ala Met Phe Ile Thr Leu Ser Gln Ile Thr Gln Met Leu Met Gly Cys Val Val Asn Tyr Leu Val Phe Cys Trp Met Gln His Asp Gln Cys His Ser His Phe Gln Asn Ile Phe Trp Ser Ser Leu Met Tyr Leu Ser Tyr Leu Val Leu Phe Cys His Phe Phe Phe Glu A1a Tyr Ile Gly Lys Met Arg Lys Thr Thr Lys Ala Glu <210> 12 <211> 265 <212> PRT
<213> Homo Sapiens <400> 12 Met Asn Met Ser Val Leu Thr Leu Gln Glu Tyr Glu Phe Glu Lys Gln Phe Asn Glu Asn Glu A1a Ile Gln Trp Met Gln Glu Asn Trp Lys Lys Ser Phe Leu Phe Ser Ala Leu Tyr Ala Ala Phe Ile Phe Gly Gly Arg His Leu Met Asn Lys Arg Ala Lys Phe Glu Leu Arg Lys Pro Leu Val Leu Trp Ser Leu Thr Leu Ala Val Phe Ser Ile Phe Gly Ala Leu Arg Thr Gly Ala Tyr Met Val Tyr Ile Leu Met Thr Lys Gly Leu Lys Gln Ser Val Cys Asp Gln Gly Phe Tyr Asn Gly Pro Val Ser Lys Phe Trp Ala Tyr Ala Phe Val Leu Ser Lys Ala Pro Glu Leu Gly Asp Thr Ile Phe Ile Ile Leu Arg Lys Gln Lys Leu Ile Phe Leu His Trp Tyr His His Ile Thr Val Leu Leu Tyr Ser Trp Tyr Ser Tyr Lys Asp Met Val Ala Gly Gly Gly Trp Phe Met Thr Met Asn Tyr Gly Val His Ala Val Met Tyr Ser Tyr Tyr Ala Leu Arg Ala Ala Gly Phe Arg Val Ser Arg Lys Phe Ala Met Phe Ile Thr Leu Ser Gln Ile Thr Gln Met Leu Met Gly Cys Val Val Asn Tyr Leu Val Phe Cys Trp Met Gln His Asp Gln Cys His Ser His Phe Gln Asn Ile Phe Trp Ser Ser Leu Met Tyr Leu Ser Tyr Leu Val Leu Phe Cys His Phe Phe Phe Glu Ala Tyr Ile Gly Lys Met Arg Lys Thr Thr Lys Ala Glu <210> 13 <211> 314 <212> PRT
<213> Homo Sapiens <400> 13 Met Gly Leu Leu Asp Ser Glu Pro Gly Ser Val Leu Asn Val Val Ser Thr Ala Leu Asn Asp Thr Val Glu Phe Tyr Arg Trp Thr Trp Ser Ile Ala Asp Lys Arg Val Glu Asn Trp Pro Leu Met Gln Ser Pro Trp Pro Thr Leu Ser Ile Ser Thr Leu Tyr Leu Leu Phe Val Trp Leu Gly Pro Lys Trp Met Lys Asp Arg Glu Pro Phe Gln Met Arg Leu Val Leu Ile Ile Tyr Asn Phe Gly Met Val Leu Leu Asn Leu Phe Ile Phe Arg Glu Leu Phe Met Gly Ser Tyr Asn Ala Gly Tyr Ser Tyr Ile Cys Gln Ser Val Asp Tyr Ser Asn Asn Val His Glu Val Arg Ile Ala Ala Ala Leu Trp Trp Tyr Phe Val Ser Lys Gly Val Glu Tyr Leu Asp Thr Val Phe Phe Ile Leu Arg Lys Lys Asn Asn Gln Val Ser Phe Leu His Val Tyr His His Cys Thr Met Phe Thr Leu Trp Trp Ile Gly Ile Lys Trp Val Ala Gly Gly Gln Ala Phe Phe Gly Ala Gln Leu Asn Ser Phe Ile His Val Ile Met Tyr Ser Tyr Tyr Gly Leu Thr Ala Phe Gly Pro Trp Ile Gln Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr Met Leu Gln Leu Ile Gln Phe His Val Thr Ile Gly His Thr Ala Leu Ser Leu Tyr Thr Asp Cys Pro Phe Pro Lys Trp Met His Trp Ala Leu Ile Ala Tyr Ala Ile Ser Phe Ile Phe Leu Phe Leu Asn Phe Tyr Ile Arg Thr Tyr Lys Glu Pro Lys Lys Pro Lys Ala Gly Lys Thr Ala Met Asn Gly Ile Ser Ala Asn Gly Val Ser Lys Ser Glu Lys Gln Leu Met Ile Glu Asn Gly Lys Lys Gln Lys Asn Gly Lys Ala Lys Gly Asp <210> 14 <211> 314 <212> PRT
<213> Homo sapiens <400> 14 Met Gly Leu Leu Asp Ser Glu Pro Gly Ser Val Leu Asn Val Val Ser Thr Ala Leu Asn Asp Thr Val Glu Phe Tyr Arg Trp Thr Trp Ser Ile Ala Asp Lys Arg Val Glu Asn Trp Pro Leu Met Gln Ser Pro Trp Pro Thr Leu Ser Ile Ser Thr Leu Tyr Leu Leu Phe Val Trp Leu Gly Pro Lys Trp Met Lys Asp Arg Glu Pro Phe Gln Met Arg Leu Val Leu Ile Ile Tyr Asn Phe Gly Met Val Leu Leu Asn Leu Phe Tle Phe Arg Glu Leu Phe Met Gly Ser Tyr Asn Ala Gly Tyr Ser Tyr Ile Cys Gln Ser 100 105 ' 110 Val Asp Tyr Ser Asn Asn Val His Glu Val Arg Ile Ala Ala Ala Leu Trp Trp Tyr Phe Val Ser Lys Gly Val Glu Tyr Leu Asp Thr Val Phe Phe Ile Leu Arg Lys Lys Asn Asn Gln Val Ser Phe Leu His Val Tyr His His Cys Thr Met Phe Thr Leu Trp Trp Ile Gly Ile Lys Trp Val Ala Gly Gly Gln Ala Phe Phe Gly Ala Gln Leu Asn Ser Phe Ile His Val Ile Met Tyr Ser Tyr Tyr Gly Leu Thr Ala Phe Gly Pro Trp Ile Gln Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr Met Leu Gln Leu Ile Gln Phe His Val Thr Ile Gly His Thr Ala Leu Ser Leu Tyr Thr Asp Cys Pro Phe Pro Lys Trp Met His Trp Ala Leu Ile Ala Tyr Ala Ile Ser Phe Ile Phe Leu Phe Leu Asn Phe Tyr Ile Arg Thr Tyr Lys Glu Pro Lys Lys Pro Lys Ala Gly Lys Thr Ala Met Asn Gly Ile Ser Ala Asn Gly Val Ser Lys Ser Glu Lys Gln Leu Met Ile Glu Asn Gly Lys 290 ~ 295 300 Lys Gln Lys Asn Gly Lys Ala Lys Gly Asp <210> 15 <211> 303 <212> PRT
<213> Danio rerio <400> 15 Met Glu Thr Val Val His Leu Met Asn Asp Ser Val Glu Phe Tyr Lys Trp Ser Leu Thr Ile Ala Asp Lys Arg Val Glu Lys Trp Pro Met Met Ser Ser Pro Leu Pro Thr Leu GIy Ile Ser Val Leu Tyr Leu Leu Phe Leu Trp Ala Gly Pro Leu Tyr Met Gln Asn Arg Glu Pro Phe Gln Leu Arg Lys Thr Leu Ile Val Tyr Asn Phe Ser Met Val Leu Leu Asn Phe Tyr Ile Cys Lys Glu Leu Leu Leu Gly Ser Arg Ala Ala Gly Tyr Ser Tyr Leu Cys Gln Pro Val Asn Tyr Ser Asn Asp Vat Asn Glu Val Arg Ile Ala Ser Ala Leu Trp Trp Tyr Tyr Ile Ser Lys Gly Val Glu Phe Leu Asp Thr Val Phe Phe Ile Met Arg Lys Lys Phe Asn Gln Val Ser Phe Leu His Val Tyr His His Cys Thr Met Phe Ile Leu Trp Trp Ile Gly Ile Lys Trp Val Pro Gly Gly Gln Ser Phe Phe Gly Ala Thr Ile Asn Ser Gly Ile His Val Leu Met Tyr Gly Tyr Tyr Gly Leu Ala Ala Phe Gly Pro Lys Ile Gln Lys Tyr Leu Trp Trp Lys Lys Tyr Leu Thr Ile I1e Gln Met Ile Gln Phe His Val Thr Ile Val His Ala Ala Tyr Ser Leu Tyr Thr Gly Cys Pro Phe Pro Ala Trp Met Gln Ser Ala Leu Ile Gly Tyr Ala Asp Thr Phe Ile Ile Leu Leu Ala Asn Phe Tyr Tyr Gln Thr Tyr Arg Arg Gln Pro Leu Pro Lys Thr Ala Lys Phe Ala Val Asn Gly Val Ser Met Ser Thr Asn Gly Thr Ser Lys Thr Ala Glu Val Thr Glu Asn Gly Lys Lys Gln Thr Lys Gly Lys Gly Lys His Asp <210> 16 <211> 270 <212> PRT
<213> Homo sapiens <400> 16 Met Val Thr Ala Met Asn Val Ser His Glu Val Asn Gln Leu Phe Gln Pro Tyr Asn Phe Glu Leu Ser Lys Asp Met Arg Pro Phe Phe G1u Glu 'Tyr Trp Ala Thr Ser Phe Pro Ile Ala Leu Ile Tyr Leu Val Leu Ile Ala Val Gly Gln Asn Tyr Met Lys Glu Arg Lys Gly Phe Asn Leu Gln Gly Pro Leu Ile Leu Trp Ser Phe Cys Leu Ala Ile Phe Ser Ile Leu Gly Ala Val Arg Met Trp Gly Ile Met Gly Thr Val Leu Leu Thr Gly Gly Leu Lys Gln Thr Val Cys Phe Ile Asn Phe Ile Asp Asn Ser Thr Val Lys Phe Trp Ser Trp Val Phe Leu Leu Ser Lys Val Ile Glu Leu Gly Asp Thr Ala Phe Ile Ile Leu Arg Lys Arg Pro Leu I1e Phe Ile His Trp Tyr His His Ser Thr Val Leu Val Tyr Thr Ser Phe Gly Tyr Lys Asn Lys Val Pro Ala Gly Gly Trp Phe Val Thr Met Asn Phe Gly Val His Ala Ile Met Tyr Thr Tyr Tyr Thr Leu Lys Ala Ala Asn Val Lys Pro Pro Lys Met Leu Pro Met Leu Ile Thr Ser Leu Gln Ile Leu Gln Met Phe Val Gly Ala Ile Val Ser Ile Leu Thr Tyr Ile Trp Arg Gln Asp Gln Gly Cys His Thr Thr Met Glu His Leu Phe Trp Ser Phe Ile Leu Tyr Met Thr Tyr Phe Ile Leu Phe Ala His Phe Phe Cys Gln Thr Tyr Ile Arg Pro Lys Val Lys Ala Lys Thr Lys Ser Gln

Claims (32)

WHAT IS CLAIMED IS:

1. A method of identifying a candidate p53 pathway modulating agent, said method comprising the steps of:
(a) providing an assay system comprising a purified LCE polypeptide or nucleic acid or a functionally active fragment or derivative thereof;
(b) contacting the assay system with a test agent under conditions whereby, but for the presence of the test agent, the system provides a reference activity; and (c) detecting a test agent-biased activity of the assay system, wherein a difference between the test agent-biased activity and the reference activity identifies the test agent as a candidate p53 pathway modulating agent.

2. The method of Claim 1 wherein the assay system comprises cultured cells that express the LCE polypeptide.

3. The method of Claim 2 wherein the cultured cells additionally have defective p53 function.

4. The method of Claim 1 wherein the assay system includes a screening assay comprising a LCE polypeptide, and the candidate test agent is a small molecule modulator.

5. The method of Claim 4 wherein the assay is a binding assay.

6. The method of Claim 1 wherein the assay system is selected from the group consisting of an apoptosis assay system, a cell proliferation assay system, an angiogenesis assay system, and a hypoxic induction assay system.

7. The method of Claim 1 wherein the assay system includes a binding assay comprising a LCE polypeptide and the candidate test agent is an antibody.

8. The method of Claim 1 wherein the assay system includes an expression assay comprising a LCE nucleic acid and the candidate test agent is a nucleic acid modulator.

9. The method of claim 8 wherein the nucleic acid modulator is an antisense oligomer.

10. The method of Claim 8 wherein the nucleic acid modulator is a PMO.

11. The method of Claim 1 additionally comprising:
(d) administering the candidate p53 pathway modulating agent identified in (c) to a model system comprising cells defective in p53 function and, detecting a phenotypic change in the model system that indicates that the p53 function is restored.

12. The method of Claim 11 wherein the model system is a mouse model with defective p53 function.

13. A method for modulating a p53 pathway of a cell comprising contacting a cell defective in p53 function with a candidate modulator that specifically binds to a LCE
polypeptide comprising an amino acid sequence selected from group consisting of SEQ ID
NOs:9, 10, 11, 12, 13, 14, 15, and 16, whereby p53 function is restored.

14. The method of claim 13 wherein the candidate modulator is administered to a vertebrate animal predetermined to have a disease or disorder resulting from a defect in p53 function.

15. The method of Claim 13 wherein the candidate modulator is selected from the group consisting of an antibody and a small molecule.

16. The method of Claim 1, comprising the additional steps of:
(d) providing a secondary assay system comprising cultured cells or a non-human animal expressing LCE, (e) contacting the secondary assay system with the test agent of (b) or an agent derived therefrom under conditions whereby, but for the presence of the test agent or agent derived therefrom, the system provides a reference activity; and (f) detecting an agent-biased activity of the second assay system, wherein a difference between the agent-biased activity and the reference activity of the second assay system confirms the test agent or agent derived therefrom as a candidate p53 pathway modulating agent, and wherein the second assay detects an agent-biased change in the p53 pathway.

17. The method of Claim 16 wherein the secondary assay system comprises cultured cells.

18. The method of Claim 16 wherein the secondary assay system comprises a non-human animal.

19. The method of Claim 18 wherein the non-human animal mis-expresses a p53 pathway gene.

20. A method of modulating p53 pathway in a mammalian cell comprising contacting the cell with an agent that specifically binds a LCE polypeptide or nucleic acid.

21. The method of Claim 20 wherein the agent is administered to a mammalian animal predetermined to have a pathology associated with the p53 pathway.

22. The method of Claim 20 wherein the agent is a small molecule modulator, a nucleic acid modulator, or an antibody.

23. A method for diagnosing a disease in a patient comprising:
(a) obtaining a biological sample from the patient;
(b) contacting the sample with a probe for LCE expression;
(c) comparing results from step (b) with a control;
(d) determining whether step (c) indicates a likelihood of disease.

24. The method of claim 23 wherein said disease is cancer.

25. The method according to claim 24, wherein said cancer is a cancer as shown in Table 1 as having >25% expression level.

26. A method of identifying a candidate branching morphogenesis modulating agent, said method comprising the steps of:
(a) providing an assay system comprising an ELOVL4 polypeptide or nucleic acid;
(b) contacting the assay system with a test agent under conditions whereby, but for the presence of the test agent, the system provides a reference activity; and (c) detecting a test agent-biased activity of the assay system, wherein a difference between the test agent-biased activity and the reference activity identifies the test agent as a candidate branching morphogenesis modulating agent.

27. The method of Claim 26 wherein the assay system comprises cultured cells or a non-human animal expressing ELOVL4, and wherein the assay system includes an assay that detects an agent-biased change in branching morphogenesis.

28. The method of Claim 27 wherein the branching morphogenesis is angiogenesis.

29. The method of Claim 27 wherein the assay system comprises cultured cells and wherein the assay detects an event selected from the group consisting of cell proliferation, cell cycling, apoptosis, tubulogenesis, cell migration, cell sprouting and response to hypoxic conditions.

30. The method of Claim 27 wherein the assay system comprises a non-human animal and wherein the assay system includes a matrix implant (Matrigel) assay or a xenograft assay.

31. The method of Claim 26, comprising the additional steps of:
(d) providing a second assay system comprising cultured cells or a non-human animal expressing ELOVL4, (e) contacting the second assay system with the test agent of (b) or an agent derived therefrom under conditions whereby, but for the presence of the test agent or agent derived therefrom, the system provides a reference activity; and (f) detecting an agent-biased activity of the second assay system, wherein a difference between the agent-biased activity and the reference activity of the second assay system confirms the test agent or agent derived therefrom as a candidate branching morphogenesis modulating agent, and wherein the second assay system includes a second assay that detects an agent-biased change in an activity associated with branching morphogenesis.

32. A method of modulating branching morphogenesis in a mammalian cell comprising contacting the cell with an agent that specifically binds an ELOVL4 polypeptide or nucleic acid.