CA2445596A1 - Method for replicating the hepatitis c virus - Google Patents

Abstract

The invention concerns the use of cells capable of carrying out a process of prenylation of proteins coded by the hepatitis C virus (HCV) genome, such as prenylation of the NS5A protein, for replicating and, if required, the production of HCV or derivative viable mutants, in a suitable culture medium.

Description

HEPATITIS C VIRUS REPLICATION PROCESS
A method of replicating the hepatitis C virus is provided.
The invention also relates to a method for screening for virus inhibitors.
of Hepatitis C.
The hepatitis C virus or HCV, identified in 1989 by the Choo team (Choo and al., 1989), is the major agent of viral infections called during long time hepatitis non-A non-B. The terminology "non-A non-B" has been introduced in the years 70 to designate hepatitis whose etiological agents, not yet identified, ' appear serologically distinct from hepatitis A and B, thanks to the in place of immunological tests (Feinstone et al., 1975; Prince et al., 1974).
Clinically, hepatitis C virus infection is characterized by a strong predominance of asymptomatic forms and frequency of evolution around the chronicity.
Molecular cloning and sequencing of the hepatitis C virus have been initially made by Choo et al. (1988 and 1989) and confirmed by others teams (Kato et al., 1990; Okamoto et al., 1992; Inchauspé et al., 1991). analysis sequence of the HCV genome reveals an open unique reading phase which AUG
initiator is located in position 342 of the genome. As with some viruses RNA
positive, the 5 'non-coding region of HCV is involved in the process initiation of translation by the presence of an internal ribosome or IRES entry site (Tsukiyama-Kohara et al., 1992; Reynolds et al., 1995).
The construction of a cDNA coding for the entire polyprotein of the virus of hepatitis C, and its expression in various procaiotic vectors or eukaryotes, have allowed to specify the organization of the genome, and to characterize the various protein from the maturation of the polyprotein. Different cleavage processes this polyprotein, involving viral and cellular proteases, generate the protein structural and non-structural. In vitro translation studies and expression in vivo (Grakoui et al., 1993; Hijikata et al., 1991) helped establish order in which the proteins are encoded by the genome and which is schematized as follows: H2N-C-E ~ -EZ-p7-NS2-NS3-NS4A-NS4B-NSSA = ~ TSSB-COOH.

2 The first third of the hepatitis C genome codes for protein structural C, E1, E2 and p7. The different proteins of the structural region are the result of the involvement of proteases of cellular origin.
Protein C, with a molecular weight of around 21 kDa, containing 173 acids amino, is the capsid protein. This protein is the main constituent of the HCV nucleocapsid. The carboxy-terminal region located between the acids amino 174 to 191 constitutes the signal peptide of the glycoprotein E1. This sequence is cleaved by a signalase. The capsid protein C, of very basic composition, in reason for his rich in amino acids arginine and lysine (23.5% of amino acids in the region N-terminal) could be involved in RNA-protein interactions.
The glycoproteins El and E2, of respective molecular weights 31 and 70 kDa, constitute the envelope glycoproteins. These are glycoproteins membranes of type I, they each have at their carboxy-terminal end a domain hydrophobic. In addition, they each have a hydrophobic signal sequence with the N-terminal end allowing a translocation in the reticulum endoplasmic and maturation of these proteins by cellular signalases. Acids amino between 174-191 and amino acids between 371-383 of the polyprotein from HCV correspond to the signal peptides of glycoproteins E1 and E2. The last acid amino acid of the E2 sequence is located at position 746 of the HCV polyprotein and the last amino acid of the El glycoprotein is at position 383 of the polyprotein this which implies that the signal peptide of glycoprotein E2 is part integral of E1.
Between E2 and the NS2 protein, we identified a small protein p7, which we unknown still function.
The remaining two-thirds of the HCV genome encodes non-protein structural NS2, NS3, NS4A, NS4B, NSSA and NSSB.
The NS2 protein is a 23 kDa hydrophobic protein including the amino acid N-terminal is in position 810 and the C-terminal amino acid in position 1026 on the polyprotein. The NS2 protein and the N-terminal third of NS3 would have a function of protease ensuring the cleavage between the proteins NS2 and NS3 (Grakoui et al., 1993). This protease would be a zinc-dependent metallo-protease. This observation is based on the fact that the activity of this protein would be inhibited by EDTA and stimulated with ZnCl2.
Histidine at position 952 and cysteine at position 993 appear involved in the catalytic activity of this enzyme.

3 The NS3 protein is a 70 kDa protein. Located between amino acids 1027 and 1657 of the HCV polyprotein, it has two domains functional distinct: the N-terminal part of the protein codes for a protease and the domain C-terminal for a TARN-dependent NTPase / helicase.
The NS4A protein is a protein with an apparent molecular weight of 8 kDa.
She is located on the polyprotein between amino acids 1658 and 1711. Its function would to play a cofactor role for the NS3 protease because studies have shown that the cleavage of the NS3 / NS4A, NS4A / NS4B and NS4B / NSSA junctions requires the protein NS4A. This protein, without being essential, also accelerates the cleavage NSSA / NSSB.
The HCV NS4B protein with a molecular weight of 27 kDa has no function known to date. The NS4B protein is located between amino acids 1712 and 1972 of the HCV polyprotein. In addition, the NS4B protein appears as a protein basic.
The HCV NSSA protein with a molecular weight of 56 kDa is a protein that interacts with the NSSB protein and presumably participates in the HCV replication.
The NSSA protein is located between amino acids 1973 and 2420 of the polyprotein HCV genotype la. However, according to the different genotypes observed, this protein can have different amino acid insertions:
so understands 466 amino acids for genotype 2a, 452 amino acids for genotype 3a so that it contains only 466 amino acids for the genotype la. If the function primary of this protein is still unknown, it nevertheless presents some characteristics. Thus (expression of a 56 kDa protein and a protein 58 kDa a been observed. It corresponds to a phosphorylation and a hyperphosphorylation of the NSSA protein respectively leading to the production of the proteins of 56 and 58 kDa.
The NSSB protein with a molecular weight of 68 kDa is positioned between the amino acids 2421 and 3011 of the polyprotein. The presence of patterns Gly- peptides Asp-Asp or GDD motif, analogous to those encountered in the sequence polypeptide RNA RNA polymerases dependent on many RNA viruses, allows propose the NSSB protein as a candidate for the replicase function.
The hepatitis C virus seems to express its pathogenic power exclusively in the liver of infected patients or animals (Negro et al., 1992). However of the attempted viral spread to or from human hepatocytes

4 chimpanzees have led to abortive cycles (Lanford et al., 1994). other works reported by Seipp et al. (1997), and concerning (infection of different lines cells (HuH7 and HepG2) or cells of porcine origin (PK15) have leash appear the possibility of viral infection and replication. It is currently difficult to consider exploiting these cellular systems for a viral production massive. Replication of the viral genome in blood lymphocytes device of hepatitis C patients, or in a subpopulation of monocytes / macrophages PBMC (peripheral blood mononuclear cells) has been described by different authors (Bouffard et al., 1992). But, more recently, Shimizu and his contributors (Shimizu et al., 1992; Shimizu et al., 1994) have shown that replication of the HCV
could be done either in a line coming from a leukemia lymphoblastic to T cells (Molt4 cells) either in an HPB-Ma cell line infected with prior by a marine retrovirus (marine leukemia virus). An infectious cycle has also been reproduced in these latter cells. The capacity of these cells to be able replicate the HCV viral genome enabled; the establishment of neutralization test in vitro (Shimizu et al., 1994). This is how neutralizing the virus after incubation with some patient sera has been correlated with loss of replication of HCV on these cell lines. In addition, using the cell line HPB-Ma, the The authors were also able to show the reinfection of the cells by HCV and the sensitivity virus (interferon (Shimizu et al., 1994).
By the way, it was shown recently by CM Rice groups (Kolykhalov et al., 1997) and RH Purcell (Yanagi et al., 1997) that it is possible to piece together Infectious HCV cDNA. Indeed, chimpanzees having received inj ection intrahepatic of RNA transcribed from the complete cDNA ~ 'of HCV, were capable reproduce an infection after a few weeks.
European patent application EP 1 043 399 relates to a system for the cell culture of the hepatitis C virus, which mainly includes cell eukaryotes containing specific genetic material for transfected HCV, characterized by the fact that eukaryotic cells are human hepatoma cells and that the specific genetic material of the transfected HCV is a RNA construct of the HCV
which includes HCV specific RNA segments: 5'NTR, NS3, NS4A, NS4B, NSSA, NSSB and 3'NTR as well as an additional selection marker gene (gene of selection). The cells concerned are HuH7 cells of human hepatomas and the hepatitis C virus genotype used is genotype lb (Lohmann et al., 1997).
However, this replication process is not applicable to the genotype la of HCV.
The major problem in studying the hepatitis C virus (HCV) is the absence a cellular system capable of reproducing the viral cycle of HCV. Indeed, he is

5 currently difficult to make any hypotheses to explain it the reasons.
However, the possibility of the ~~ hepatitis C virus to replicate on some lines cellular has sometimes been mentioned (Kato and Shimotohno, 2000). It results that all the knowledge acquired on the hepatitis C virus, in particular on its structure, the assembly of its proteins and its genomic organization are based on studies of translation of complementary HCV DNA performed in vitro into a system acellular and in vivo in cultured cells. So the mechanisms of propagation and some little is known about viral replication. Blockages can occur at different molecular levels. They can take place at the level of the adsorption of the particle virus and its receptor, decapsidation of the viral particle, the expression of genome or replication.
Thus, one aspect of the invention is the use of cells which present specific cellular factors, allowing replication of the genome of the virus hepatitis C in these cells.
One of the other aspects of the invention is the use of these cells for the replication as well as the multiplication and therefore the production of the virus hepatitis C.
One of the other aspects of the invention is to provide a new method of replication and production of the hepatitis C virus genotype la, by transformation appropriate cells.
One of the other aspects of the invention is to provide a new method of screening for anti-HCV agents and thereby providing virus inhibitors hepatitis C.
The invention relates to the use of cells capable of performing a process of prenylation of proteins encoded by the hepatitis C virus (HCV) genome, such as prenylation of the NSSA protein, for replication and, where appropriate, the production HCV or viable mutants derived therefrom, in an appropriate culture medium.
Many proteins of cellular origin, but also viral, undergo post-translational modifications that orient their localization cellular. Some of these proteins thus carry fatty acid modifications. A
change particularly interesting is the prenylation which corresponds to the alkylation a

6 cysteine by a farnesyl (15 carbon atoms) or geranylgeranyl group (20 carbon atoms), these groups being derived from the polymerization of acid rnévalonique.
The presence of two cysteine residues (CC) at the carboxy-terminal end of the NSSA protein (Grakoui et al., 1993) suggests that this protein can to be modified by prenylation (Casey PJ, 1992). Prenyltransferases can add to the cysteine in the C-terminal position a farnesyl or geranylgeranyl group of 15 to 20 carbon atoms, respectively, which are derived from the polymerization of (acid mevalonic. The reasons identified ~: and responsible for these modifications are often from type CAAX or CC, where C is cysteine, A is an aliphatic amino acid and X
is a amino acid such as M (Methionine), S (Serine), Q (Glutamine) or L (Leucine).
"HCV replication" means the molecular process (es) resulting in the synthesis of a strand of negative polarity which will be used to generate new strands of positive polarity constituting the genomic material of HCV.
"HCV production" means the possibility for a cell given to reproduce infectious particles of the hepatitis C virus (cycle of multiplication viral).
The term “derived viable mutants” designates viable variants which cannot come only from the selection of the HCV replicon under different pressures of selection.
This selection pressure must generate the selection of mutations in the genome of HCV resulting in better replication, more expression quantitative of different proteins and therefore better resistance of cells opposite of the selection product. Only viable mutations to resist pressure selection are observed. The other mutations, which are not viable, cause death of the cell.
The expression "in an appropriate culture medium" denotes the medium in which the cell line is the most apt to grow. The culture medium can be particular DMEM / 10% FCS medium (fetal calf serum) supplemented by the elements necessary for selection, for example neomycin (G418) or hygromycin B.
An advantageous use of the invention is the use, as defined this-above, mammalian cells, in particular monkey kidney cells, again designated Vero cells.

7 Vero cells are normal kidney cells from green monkeys from Africa (Cercopithecus aethiops, ATCC: CCL81) The invention also relates to the use as defined above, of Vero cells transformed by an antibiotic resistance gene, such as that the neomycin, especially from Vero / G418 cells.
According to an advantageous embodiment of the invention, the cells used come from the particular VnS cell line, derived from the transformation of a Vero cell by the antibiotic resistance gene, such as neomycin. These Vn5 or Véro / G418 cells are described by Frese et al. (1995).
According to an advantageous embodiment of the invention, the resistance gene has a antibiotic can be chosen from the genes for resistance to bleomycin, the phleomycin, zeocin or puromycin.
The invention relates to the use as defined above, of cells, such that Vero cells, if necessary transformed by a gene for resistance to a antibiotic, such as neomycin, said cells being transformed by an acid nucleic acid containing all or part of the genome of HCV or mutants derived from HCV.
According to an advantageous embodiment of the invention, the Vero cells can be transformed by the following antibiotic resistance genes:
genes of resistance to bleomycin, phleomycin or zeocin; or the genes of resistance to there puromycin, hygromycin B or neomycin.
In order to transform the cells, and in particular the Vero / G418 cells, the acid The ribonucleic acid used includes the following parts of the HCV genome:
5 'regions and 3 'non-coding, part of the sequences coding for the protein of capsid C
(sequence between 50 and 100 nucleotides) and the region coding for protein non-structural, namely NS2, NS3, NS4A, NS4B, NSSA and NSSB or NS3, NS4A, NS4B, NSSA and NSSB.
The viable variants of HCV advantageously come from the selection of the replicon under different selection pressures. This pressure causes then selection of mutations in the genome that lead to better resistance against the selection product.
The invention also relates to the use as defined above, characterized in that the nucleic acid is chosen from - those coding for structural and non-structural proteins of HCV or WO 02/08833

8 PCT / FR02 / 01422 - those coding for non-structural proteins of HCV or - replicons containing a gene for resistance to an antibiotic, in particular hygromycin B, and a nucleotide sequence encoding non-protein of HCV.
A nucleic acid encoding structural and non-structural proteins of HCV is for example the nucleotide sequence SEQ ID NO: 2.
A nucleic acid encoding non-structural HCV proteins is by example the nucleotide sequence SEQ ID NO: 1.
Among the structural proteins of HCV are proteins such as mentioned above, namely proteins C, E1, E2 and p7.
Among the non-structural proteins of HCV, we include the NS2 proteins, NS3, NS4A, NS4B, NSSA and NSSB.
The expression "replicon containing an antibiotic resistance gene, in particular hygromycin B, and a nucleotide sequence coding for the protein HCV non-structural "means, a nucleic acid containing the S 'regions and 3 'no HCV genome coders, part of the protein coding sequence of HCV capsid C followed by nucleotide sequences coding for Hygromycin-B-phosphotransferase (HPH) and nucleotide sequences encoding the protein NS2, NS3, NS4A, NS4B, NSSA and NSSB, defined above (see Figure 1).
The possibility of replacing all or part of the structural proteins having summer performed for other positive RNA viruses and currently having a cDNA
full of HCV, a replicon of HCV was built keeping some of the coding sequences for capsid protein C. Indeed, it has been shown by the team from Dr. Jackson (Reynolds et al., 1995) that these sequences played a role important in initiation of HCV translation via IRES (internal entry site for ribosomes).
In order to maintain the integrity of this IRES and under HCV conditions, a part of sequences coding for the capsid protein were retained. The sequence of protein structure has thus been substituted, by the sequence coding for the gene for resistance to hygromycin B. By this approach, it is possible to maintain cells under selection pressure with hygromycin B in order to select clones cell resistant. These results can only be explained by the maintenance of the replicon to inside the cell. However, other selection markers may to be used to facilitate this selection, such as puromycin, zeocin or bleomycin.

9 The invention relates to the use as defined above, characterized in this that the cells are transformed by a nucleic acid chosen from among sequences nucleotides SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
The sequence SEQ LD NO: 1 corresponds to the part of the HCV sequence of S genotype encoding it for non-structural proteins, namely proteins NS2, NS3, NS4A, NS4B, NSSA and NSSB.
The sequence SEQ ID N0: 2 corresponds to the entire HCV sequence of genotype 1a (structural and non-structural proteins).
The sequence SEQ ID NO: 3 corresponds to the replicon obtained by fusion of a gene resistance to hygromycin B with the HCV sequence part of genotype the coding for non-structural proteins.
The invention relates to the use as defined above, for the replication, and where appropriate, the production of HCV type la.
The type la genotype of HCV is described in particular by Peter Simmonds (2001).
The main characteristic of the HCV genotypes is their variability. In effect, genomes differ from each other by their nucleotides with a percentage varying from 31 34%, which also leads to variability in amino acids.
The invention relates to the use as defined above, of cells as deposited with the CNCM on April 13, 2001 under the numbers I-2658 and I-2659.
The strain, registered under number I-2659, corresponds to the cells Vero / G418 (Vn5), as defined above.
The strain, registered under number I-2658, corresponds to cells Vero / G418 + replicon, which are Vero / G418 cells in. which was inserted the sequence SEQ ID NO: 3, as defined above.
The invention relates to a nucleotide sequence characterized in that it includes or is made up of SEQ ID NO: 1.
The invention relates to a nucleotide sequence characterized in that it includes or is made up of SEQ ID NO: 3.
The invention relates to a recombinant vector, in particular plasmid, cosmid, phage or virus DNA, containing a nucleotide sequence as defined this-above.

An advantageous vector of the invention is a recombinant vector as defined this-above, containing the elements necessary for (expression in a host cell of the polypeptides encoded by nucleic acids as defined above, inserted in said vector.
5 According to an advantageous embodiment of the invention, the vector recombinant defined above contains in particular a promoter recognized by RNA polymerase of the host cell, in particular an inducible promoter and possibly a sequence of transcription, termination, and optionally an etlou signal sequence anchor.
According to another advantageous embodiment of the invention, the vector

10 recombinant, as defined above, contains the elements which allow expression of a nucleotide sequence, as defined above, as mature protein or fusion protein.
According to an advantageous embodiment of the invention, the vector used for the HCV cloning is the vector pGEM 3Zf (+) (Proméga). This vector contains the uncomfortable of ampicillin resistance, the origin of replication of the plasmid and the fragment phage f1. In addition, the HCV fragments are placed under control of T7 or SP6 promoter.
The invention also relates to a host cell, chosen in particular from bacteria, viruses, yeasts, fungi, plants or cells of mammals, said host cell being transformed, in particular using a vector recombinant as defined above.
According to an advantageous embodiment of the invention, the host cell as than defined above, contains the regulatory elements allowing expression withered nucleotide sequences as defined above.
According to an advantageous embodiment of the invention, the bacteria DHS a, marketed by Gifco. These bacteria are used to amplify, after transfection, the plasmids pGEM3Zf (Proméga) which have the HCV complementary sequences or replicon sequences. All plasmids containing HCV sequences are used for the transformation of bacteria DHSA. HCV sequences are stable in this bacterium.
According to an advantageous embodiment of the invention, the cells used for viral production of recombinant vaccine viruses include Tk- cells (see experimental part, I-3) or 1L CV cells.

11 Recombinant vaccine viruses are produced from pTM1 plasmids (Moss et al., 1990) and recombined according to the experimental procedure. These viruses recombinant contain the sequences encoding the NSSA protein or truncated forms in N-terminal part of the NSSA protein.
The CVl cell strain is a continuous line derived from kidneys green monkeys from Afi ~ ique (AGMK) and the CV1-L strain comes from a subcloning of the CV strain 1.
The invention relates to any transformed cell constituted by a cell.
Vero / G418, comprising a nucleic acid chosen from - those coding for structural and non-structural proteins of HCV or - those coding for non-structural proteins of HCV or - replicons containing a gene for resistance to an antibiotic, in particular :vs hygromycin B, and a nucleotide sequence encoding non-protein of HCV.
An advantageous cell according to the invention is a cell as defined above above, constituted by a Véro / G418 cell comprising a replicon constituted by a nucleic acid chosen from those containing a gene for resistance to a antibiotic, such than hygromycin B, and a nucleotide sequence coding for proteins no HCV structural, namely NS2, NS3, NS4A, NS4B, NSSA and NSSB.
An advantageous cell of the invention is a cell as defined above above, such as cell Véro / G418 deposited at the CNCM on April 13, 2001 under the number I-2659.
An advantageous cell according to the invention is a cell as defined above above, such as the Vero / G418 cell, comprising a nucleic acid containing a gene for resistance to an antibiotic, such as hygromycin B, and a sequence nucleotide encoding non-structural proteins from HCV, and deposited at the CNCM on April 13, 2001 under number I-2658.
An advantageous cell according to the invention is a cell as defined above above, constituted by a Vero / G418 cell comprising a nucleic acid containing a gene for resistance to an antibiotic, in particular hygromycin B, and a sequence nucleotide encoding non-structural proteins, and having the property of replicate HCV at a concentration of antibiotic, including hygromycin B, from 800 to 1000 wg / ml.

12 The invention also relates to a method for producing the hepatitis virus.
C, which includes infection of Vero / G418 cells, especially cells Vero / G418 as filed with the CNCM 1e. 13 April 2001 under number I-2659, by the virus hepatitis C and the cultivation under appropriate conditions of these cell infected.
The Vero / G418 + replicon cells are first tested by infection from a titrated HCV viral stock to determine if this cell line may be infected and likely to produce virus.
Then it is necessary to clone the sequences of the most replicons functional to put them back into the full HCV cDNA and then to transfect the Vero / G418 + replicon or Vero / G418 cells to determine if there is infectivity and viral production.
The most functional replicon is advantageously obtained from the cell which withstands the highest concentration of hygromycin B. The growth of the cell indicates greater expression of the hygromycin B resistance gene who is related to the replication efficiency of ~ replicon.
The infectivity determined here is the infectivity of the complementary DNA of the HCV, that is to say the possibility of reconstituting viral particles infectious after transfection of cells with RNA from transcription of the cDNA of the HCV. The virus is then able to spread to an appropriate cell culture and produce quantity of viral particles.
The invention also relates to a method of replicating the hepatitis C
by transformation of Vero / G418 cells with a nucleic acid such as defined above above, and in particular by transformation of Vero / G418 cells such as filed on

April 13, 2001 at the CNCM under the number I-2659, to obtain cells Vero / G418 transformed, in particular those deposited on April 13, 2001 at the CNCM under the number I-2658, and by culturing these transformed cells under conditions appropriate.
HCV replication could only take place in certain cells that it Is usefull to select. For this, we use a replicon, minimum unit of replication, which contains the hygromycin B resistance gene sequences inserted into the place of sequences encoding the structural proteins of HCV. The possibility that some cells have to grow in a selective medium (for example DMEM / 10% FCS and hygromycin B) is an indication of the replication of the HCV genome because the gene resistance to hygromycin B is provided by HCV. By selecting cell resistant, we also select HCV genomes capable of reply in these cells. Therefore, HCV replication is linked to selection of resistant cells.
This process is therefore based on a method of selecting susceptible cells.
of replicate the genome of HCV.
The invention also relates to a method for producing the hepatitis virus.
VS
by transformation of Vero / G418 cells, in particular Vero / G418 cells as ' deposited on April 13, 2001 at the CNCM under the number I-2659, with an acid nucleic coding for structural and non-structural proteins of HCV, by putting in culture under appropriate conditions transformed Vero / G418 cells and the recovery particles of HCV virus.
Initially, cells growing under pressures of 1.5 to 2.0 mg / ml of hygromycin B are selected, then the total RNA of these cells is extract to convert HCV RNA into DNA. This is then cloned into a vector pGEM 3Zf (Proméga) in which only the sequence coding for the proteins not of the replicon is reintroduced in place of the complete cDNA
HCV.
Thus, we introduce all the variations necessary for a better HCV replication on the cells used. The DNA obtained is then converted into RNA and this ARN is used to transfection of Vero / G418 cells to determine if production viral is possible on these cells.
The invention also relates to a method for screening for anti-HCV agents, which includes the following steps - bringing the compound tested for its anti-HCV properties into contact with transformed cells, constituted by Vero / G418 cells, comprising a acid nucleic acid chosen from ~ those coding for structural and non-structural proteins of HCV. or ~ those coding for non-structural proteins of HCV or ~ replicons containing an antibiotic resistance gene, in particular hygromycin B, and a nucleotide sequence coding for : non-structural proteins of HCV,

14 and in particular with cells as deposited on April 13, 2001 at the CNCM
under the number I-2658, - the extraction of total RNA on said cells, and - analysis of the possible decrease in the rate of synthesis of HCV RNA
of said cells with respect to a control value corresponding to the rates of synthesis of HCV RNA from cells in the absence of said test compound.
Vero / G418 + replicon cells growing at hygromycin concentrations B ranging from 800 to 2000 pg / ml are subject to the action of inhibitors specific of 3-hydroxy-3-methylglutaryl coenzyme A reductase, such as mevastatin or the lovastatin. Then, RNA extractions are performed at times variables on cells treated with these inhibitors. The synthesis of HCV RNA is then analyzed by one-step RT-PCR using a device called LightCycler (Roche) or by hybridization on RNA filters using radioactive probes specific to HCV.
We can also use the following system which consists in reproducing a replicon also containing the sequences coding for the GFP protein, the property is to fluoresce naturally under a certain wavelength. In addition, we chooses this protein with a relatively short half-life. In these conditions there there is no need to fix cells and fluorescence can be observed in time real. If an effective HCV inhibitor is contacted with cells Vero / G418 +
replicon and that inhibition of HCV RNA synthesis is observed, this is also observed at the level of the synthesis of the proteins produced, and by consequent on the fluorescence intensity produced by GFP. The half-life of GFP
then being very short, a decrease in the fluorescence of the GFP in cells.
The invention relates to the use of cholesterol lowering agents, in particular statins, and more particularly lovastatin, mevastatin, simvastatin, pravastatin and fluvastatin, for the manufacture of medicines for the treatment for hepatitis C.
Statins are products used for the treatment of hypercholesterolemia. They act at the level of the enzyme hydroxymethylglutaryl (HMG) CoA synthetase to block the synthesis of mevalonic acid.
The acid mevalonic, which is involved in the cholesterol biosynthesis pathway, product also by polymerization geranyl or farnesyl.

So the statives, by blocking the synthesis of mevalonic acid, affect also the synthesis of farnesyl or geranyl groups; so they have a effect indirect on prenylation.
These statives can therefore be used to verify the process of anti screening 5 HCV as defined above.
Static chemical formulas Lovastatin Pravastatin HO O HO
--COONa OO OH
I _ HC ~ ~ HO

Simvastatin Fluvastatin HO OF
, O
O Na +

The invention also relates to the use of prenylation inhibitors, for the manufacture of drugs for the treatment of hepatitis C, if applicable in combination with an antiviral.
The invention relates to a method for preparing Vero / G418 cells.
comprising a nucleic acid chosen from - those coding for structural and non-structural proteins of HCV or - those coding for non-structural proteins of HCV or - the replicons containing a hygromycin B resistance gene and a nucleotide sequence coding for non-structural proteins of HCV, said method comprising the following steps * the insertion of one of the nucleotide sequences as defined above in Vero / G418 cells, * subjecting the cells thus obtained to hygromycin concentrations B increasing, in particular from 800 to 1000 pg / ml.
The invention relates to cells as obtained by covering the process as defined above.
The invention relates to a pharmaceutical composition, characterized in that what comprises, as active substance, a compound inhibiting prenylation, in combination with an antiviral agent and an excipient pharmacologically acceptable.
Prenylation is important for the NSSA protein because it promotes protein-protein interactions; all the disturbances from these interactions act on the HCV replication processes and decrease its effectiveness.
The combination of a prenylation inhibitor which decreases the rate of replication of HCV also causes a decrease in the viral load of HCV in a patient infected. Therefore, the action combined with an antiviral agent should lead to a better elimination of the virus in infected patients.
The invention relates to a pharmaceutical composition, characterized in that what comprises, as active substance, a cholesterol-lowering compound, in association with an antiviral agent and a pharmacologically acceptable excipient.
A compound acting on the synthesis of mevalonic acid has an action on the prenylation rate of the HCV NSSA protein and therefore on the replication of HCV. The association of a cholesterol-lowering compound, which acts indirectly on the replication of HCV, also leads to a decrease in the viral load of the HCV

in an infected patient. Therefore, the action combined with an antiviral agent must lead to better elimination of the virus in infected patients.
The hypercholesterolemic compound used is chosen from lovastatin, mevastatin, simvastatin, pravastatin and fluvastatin.
The pharmaceutical compositions according to the invention are in particular under the form of 20 mg tablets, the daily intake being between 10 and 40 mg.
DESCRIPTION OF THE FIGURES
Figure 1 is a diagram of the hepatitis 1 genotype 1a replicon vs.
Said replicon contains: the 5 ′ and 3 ′ sequences corresponding to the regions not coding HCV; the nucleotide sequence coding for part of the protein capsid (C '), that is to say the 246 nucleotides (amino acids 1 to 82); the sequence nucleotide encoding the Hygromycin B phosphotransferase gene which is the gene for selection (noted Hygromycin R on the diagram); nucleotide sequences coding for the non-structural proteins corresponding to: NS2-NS3-NS4A-NS4B-NSSA-NSSB and noted NS2 - ~ NSSB. The Asp 718 site is one of the restriction sites included in the nucleotide sequence of the capsid protein which was used to insert the sequences encoding the selection gene. The XbaT restriction site is the site that is used to linearize DNA before transcription. This site is then modified according to the method described in the "Materials and Methods" section.
FIGS. 2A to 2D represent immunofluorescence results on the Vero / G418 + replicon cells. Vero / G418 cells are grown on slats of glass in the absence of hygromycin B (Figure 2D) and Vero / G418 + cells replicon in presence of hygromycin B (800 pg / ml) (Figures 2A, 2B and 2C). These cells are then treated according to the methods described in the "Materials and Methods".
FIG. 2A corresponds to the indirect immunofluorescence obtained on Vero / G418 + replicon cells using a mouse monoclonal antibody directed against capsid protein C.
Figure 2B corresponds to the indirect immunofluorescence obtained on Vero / G418 + replicon cells using a serum from a patient infected with HCV.

Figure 2C corresponds to the indirect immunofluorescence obtained on Vero / G418 + replicon cells using a polyclonal antibody produced in the rabbit and raised against the protein NS4.
Figure 2D corresponds to the indirect immunofluorescence obtained on Vero / G418 cells (control cells) using a polyclonal antibody produced at the rabbit and directed against the NS4 protein.
Figures 3A, 3B, 3C and 3D relate to the characterization of prenylation of the hepatitis C virus NSSA protein FIG. 3A represents the result of the immunoprecipitations, obtained at ugly a rabbit polyclonal antibody directed against the protein NSSA, and performed on cell extracts from Vero / G418 (or Vn5) cells, infected either only by the recombinant vaccinia virus vTF7-3 (line 1), or by the viruses recombinant vTF7-3 and wNSSA vaccines (line 2), and labeled either in the presence of acid mevalonic H3, ie in the presence of methionine 535. The protein NSSA
immunoprecipitated is indicated by an arrow.
Figure 3B shows the result of immunoprecipitations obtained using a rabbit polyclonal antibody directed against the protein NSSA and performed on cell extracts from Vn5 cells (Vero / G418) infected with virus recombinant vaccines vTF7-3 alone (line 1), vTF7-3 and wNSSA.la (line 2) and vTF7-3 and wNS2-SB (line 3). The presence of the NSSA protein is indicated by a arrow.
Figure 3C shows the result of immunoprecipitations obtained using of a rabbit polyclonal antibody against the protein.NSSA and performed on the cell extracts from Vn5 cells (Vero / G418) infected with virus recombinant vaccines vTF7-3 alone (line 1), vTF7-3 and vvNSSA.la dll (deletion of the amino acids located between positions 1973 and 2100, line 2), vTF7-3 and wNSSA.la d12 (deletion of amino acids located between positions 1973 and 2073, line 3), vTF7-3 and wNSSA.Ia d13 (deletion of amino acids located between positions 1973 and line 4), and vTF7-3 and wNSSA.la (line 5), and labeled either in the presence of acid mevalonic H3, i.e. in the presence of methionine 535. The position of different truncated NSSA.la proteins is indicated by a line on the side of the Fig.
Figure 3D shows the result of immunoprecipitations obtained using a rabbit polyclonal antibody directed against the protein NSSA and performed on cell extracts from Vn5 cells (Vero / G418) infected with virus recombinant vaccines vTF7-3 and wNSSA of genotype la, vTF7-3 and wNSSA of genotype lb from two different patients (lines 1 and 2), and labeled in presence of mevalonic acid H3. The position of the NSSA protein is indicated by one arrow.
EXPERIMENTAL PART
I - PREENYLATION: MATERIALS AND METHODS
1. Cells and maintenance conditions.
Vero / G418 cells: Vero / G418 (or Vn5) cells (Frese et al., 1995) are cultured in a thin layer in 10 mm boxes and in a DMEM medium (Middle de Eagle modified by Dulbecco) and / containing 10% fetal calf serum (SVF).
The cells can be cultured under neomycin pressure at 300 p, g / ml (value for these cells). They are taken off every 5 or 6 days by a solution trypsin / versene (NaCl 8g / 1; KCl 0.4g / 1; dextrose 1g / 1; NaHC03 0.58g / 1 ; trypsin 0.045 g / l crystallized; 0.2 g / 1 Versene) and 1-106 cells are transferred in a box 100 mm, which corresponds to a 1/10 dilution. The medium is changed all both at three days.
2. Cloning the hepatitis C virus genome Using primers specific to the hepatitis C virus sequence, we have synthesized a cDNA according to the method of Gübler and Hoffin ~ 'n (Gübler and Hoffman, 1983). Then, thanks to primers of known sequences, the hepatitis genome It stinks then be amplified by the so-called "nested primers" method (Munis and Faloona, 1987).
DNA fragments corresponding to different regions of the HCV genome as well than the sequences corresponding to the non-coding ends of the genome of the HCV virus have been cloned into a vector pGEM 3Zf (+) (proméga) at the unique restriction site Smal.
This vector contains the resistance gene to (ampicillin, the origin of replication of plasmid and the intergenic fragment of phage f1. In addition, the fragments are placed under the control of the T7 promoter at the 5 'end of HCV or SP6 at the 3' end of HCV. All of these clones were constructed with overlapping DNA sequences to to facilitate in vitro recombination. After total digestion or partial of the DNA of these different clones, fragments were purified on gel of agarose and leagues between them so as to reconstitute the genome of the hepatitis C virus.
and a Long cDNA of 9623 nucleotides to be generated.

3. Construction of the recombinant pTM1 plasmids and production of the viruses recombinants of the corresponding vaccinia.
Different DNA fragments coding for HCV proteins and in particular of the HCV NSSA protein were generated by enzymatic amplification from of HCV genome (pG / HCV 1-9623). These DNAs have been inserted at the site level of EcoRI restriction in the multiple cloning region of the plasmid pTM1 (Moss and al.
1990). This region is located immediately. downstream of the RNA promoter polymerizes phage T7 and IRES (internal ribosome entry site) of the EMCV virus (Encephalomyocarditis virus).

The corresponding recombinant vaccinia viruses were generated by homologous recombination according to the principle defined by Kieny et al. (1984). The virus vs;
recombinants are purified by plaque formation on 143 B tk- cells (cells thymidine kinase deficient, ATCC CRL-8303) in the presence of bromodeoxyuridine (50 pg / ml). Each viral stock derived from an isolated range was amplified on cell 20 CV1-L (strain from sub-cloning of green monkey kidney cells from Africa) after infection to a multiplicity of infection (me) of 1 unit forming range by cell (LJFP / cell) (Fourmilliez et al., 1996).
4. Analysis of the proteins expressed using recombinant vaccinia viruses HCV.
Protein labeling (35S): Vero / G418 (Vn5) cells have been infected either with the vTF7.3 virus (Fuerst et al., 1986) alone, or co-infected with this virus and a recombinant viruses expressing the NSSA protein of HCV, each to a month of 5 Pfu / cell. After one hour at 37 ° C, the inoculum is removed and replaced by middle :, DMEM containing S% fetal wish serum. At 4 p.m. post-infection, the cells are washed with DMEM medium without methionine, then incubated in this medium for 1 to 2 hours, then, marked 3 hours with 100 ~ Ci / ml of methionine (35S) (35S-Protein Labeling Mix (NEN), labeling solution). After this time, the middle is eliminated and the cells are then washed with PBS, and finally are lysed at using a lysis buffer for cytoplasmic extraction (50 mM Tris-HCl pH 7.5; 150 mM
NaCI; 1mM EDTA; NP40 (or Igepal) 1% (Sigma); 0.1% Na deoxycholate;
Aprotinin 10 pg / ml; TPCK (Sigma) and PMSF (Sigma), 20 pg / ml) or for extraction Total S by a lysis solution containing: SO mM Tris-HCl pH 7.5; 150 mM
NaCI;
1mM EDTA; 0.5% NP40; 0.5% deoxycholated Na; 0.2% SDS; Aprotinin 10 p, g / ml ;
TPCK and PMSF, 20 p, g / ml. The HCV proteins are then immunoprecipitated to from this lysate using polyclonal rabbit sera as described by Wychowski i et al. (1985) and the precipitates were analyzed by SDS-PAGE.
Marking with mevalonic acid (3H) of proteins: Vero / G418 cells (Vn5) were infected with either the vTF7.3 virus (Fuerst et al., 1986) alone, either co-infected with this virus and one of the recombinant viruses expressing the NSSA protein of HCV, each to an ego of S UFP / cell. After one hour at 37 ° C, the inoculum is removed and replaced with DMEM medium containing 10% fetal wish serum in presence of Mevastatin (100 p, g / ml). After 4 hours, 100 mCi / ml of acid mevalonic (3H) are added to the medium. After 18h post-infection, the cells are washed with DMEM medium, the medium is eliminated and the cells are washed with a PBS solution before being lysed with a buffer containing: 50 mM Tris-HCl pH 7.5; 150 mM
NaCI;
1mM EDTA; 0.5% NP40; 0.5% Na deoxycholate; 0.2% SDS; Aprotinin 10 pg / ml ;
TPCK and PMSF, 20 pg / ml. The HCV proteins are then immunoprecipitated to from this lysate using polyclonal rabbit sera as described previously and the precipitates are analyzed by SDS-PAGE.
II - ANALYZES OF THE HCV REPLICON: MATERIALS AND METHODS
1. Construction of the HCV replicon from the complementary DNA of HCV.
From the clone containing the entire HCV sequence (pG / HCV 1-9623), an HCV replicon was originally constructed in which the sequences coding for structural proteins have been substituted with sequences encoding the Neomycin. The DNA corresponding to the neomycin gene was introduced between the Asp718 restriction sites (position 579 of the HCV nucleotide sequence of genotype 1 a) and the Eco47III restriction site (position 2847 of the sequence HCV nucleotide genotype la). A DNA fragment corresponding to the Neomycin coding sequence was amplified using primers Additional of the sequence coding for Neomycin and containing in S 'and 3' the sites of restriction Asp718 and Eco47III. The amplified fragment was purified on low melting gel (gel low melting point agarose), then this fragment was digested by enzymes above mentioned restriction. This fragment was then integrated into the plasmid pG / HCV 1-9623, deleted from its sequence between Asp718 and Eco47III. The sequences have been thus inserted so as to be in phase with a remaining part of the sequences encoding for the capsid protein and with the sequences coding for the NS2 protein.
However, due to the position of the Eco47III restriction site, the portion NS2 terminal has been deleted. Therefore, all of the sequences NS2 was reconstituted by amplifying by PCR all the sequences coding for NS2 and an part of the sequence encoding the NS3 protein. The primer in position 5 'of the sequence also contains the SpeI restriction site sequences. The fragment 1 S of DNA was amplified and purified according to the usual procedures, then it was digested by the enzymes SpeI and the enzyme Bstl 107I whose position of this site is in point 3640 of the genotype 1 HCV nucleotide sequence a. Finally, this fragment has summer integrated between the SpeI and Bst1107 I restriction sites. The plasmid resulting pG / Neo 2-SB has been obtained. This plasmid contains the 5 'and 3' non-coding regions, a part of the sequence coding for the Capside C protein, the sequences of the resistance to neomycin and all of the sequences encoding the non-protein region of HCV. It appears in this construction that the part of eastside fused with the neomycin resistance gene and the HCV NS2 product. The other HCV proteins will normally be produced by cleavages which will generated by the two HCV viral proteases. The Vero / G418 cells being resistant to the neomycin, the plasmid pG / Neo 2-SB was used to substitute the sequences encoding for neomycin by the sequences coding for the resistance gene to hygromycin B. A DNA fragment containing the sequences of resistance to hygromycin B
so that the sequences of the restriction sites Asp718 and XbaI located respectively to 5 'and 3' ends was amplified. The XbaI site is compatible with the site SpeI, but after hybridization the SpeI and Xbal sites will not be generated. The unique site Spel disappears from the sequence. This DNA fragment was thus integrated between the Asp718 sites and SpeI of the plasmid pG / Neo 2-SB. After transformation and selection, a plasmid pG / Hygro 2-SB was obtained in which the sequences coding for the gene for resistance to neomycin have been replaced by those encoding the resistance gene at hygromycin B and the other sequences being completely preserved.
2. Transcription of complementary HCV DNA into RNA
Transcription for transfection: For large production of RNA the kit of at Proméga (Ribo MAX TMLarge Scale RNA production system-T7) was used.
The DNA corresponding to the replicon has been linearized beforehand and made ends francs. AT
i the 3 'end of the HCV genome, a restriction site was placed so after Xbal restriction enzyme digestion and Mung bean treatment nuclease (Biolabs) (Kowalski et al., 1976), the excess bases are digested, who therefore corresponds to the authentic end of the HCV RNA. The treatment East carried out on 5 μg of DNA. After extraction with phenol and chloroform of the , 3 DNA preparation, the DNA is recovered by ethanol precipitation. Once centrifuged DNA is taken up in sterile water which has been treated with DEPC
(Diethylpyrocarbonate), to avoid any trace of Rnase. DNA can then to be transcribed into RNA. Thus, in a sterile eppendorf tube, 20 p, l of DNA (approximately 5 pg) are supplemented by: 20 p, l of water treated with DEPC, 20 ~, l of buffer SX transcription (Hepes-KOH (pH 7.5) 400 nM, MgCl2 120 mM, spermidine 10 mM, DTT 200 mM), 30 ~, 1 of rNTPs (25mM ATP, CTP, GTP, UTP), 10 ~ l Enzyme Mix (T7) (Proméga) and the mixture is incubated at 37 ° C for 2 to 4 hours. Once the DNA
transcribed by RNA
T7 polymerase, the DNA matrix is degraded by 5 p, l of RQ1 Dnase (Rnase free) (Prégéga) for 15 to 30 minutes at 37 ° C. An extraction phenol / cloroform is performed and the aqueous solution containing the RNA is precipitated by adding 1/10 acetate of sodium 3M and two volumes of ethanol. After one night, it is centrifuged to recover the RNA pellet. This is then washed with a 70% ethanol solution, then dried slightly on the bench then finally resolubilized with sterile water treated at DEPC. The RNA thereafter will be stored at -80 ° C.
Transcription for radioactive labeling: We use a transcription kit Promega. The DNA used as a template for the production of radioactive RNA comes from DNA amplified by the PCR method and in which the primers in position S 'or 3 ' contain promoter sequences for bacteriophages T7 or SP6 ce who thus makes it possible to produce RNAs of negative or positive polarity depending on whether one will seek to characterize respectively RNAs of positive polarity or negative of replicon. For DNA produced by PCR, it is not necessary to linearize by a restriction enzyme since the ends are blunt ends. However, the fragments DNA will be purified on lovv ~ melting gel (low point agarose gel fusion) before to be transcribed. 3 ~ l of DNA (corresponding to 1-2 ~, g) are complemented by 4p.1 of 5X transcription buffer (Tris-HCl (pH 7.9 at 25 ° C) 200 mM, NaCl 50 mM, MgCl2 30 mM, 10 mM spermidine), 2 ~ 1 of a 100 mM DTT solution, 0.5 p, 1 of RNasin (inhibitor) (40 U / p, l) (Blackburn and Moore, 1982), 4 ~ .1 of a mixture of rNTPs (rATP, '~
rUTP and rGTP, 2.5 mM each) in which rCTP was omitted, 5.5 p, 1 of water treated at DEPC, 1p, 1 of T7 polymerase enzyme (20 U / p, l) and 50 pCi of dCTP aP32 lyophilized.
The DNA is transcribed for 1 hour at 37 ° C. Then the DNA is degraded as described previously and the RNA is precipitated and then resolubilized in water treated with DEPC.
3. Electroporation technique This technique was performed according to a procedure described by Liljestrôm and al.
(1991). The device used for electroporations is from the BioRad brand (BioRad Gene Pulsar with Pulse controller) ~ Vero / G418 cells have been seeded on 100 mm dishes and in DMEM medium supplemented with 10% calf serum fetal (SVF) and they were left in culture until a confluence from 80 to 90% is reached. It should be noted that 5,106 cells are required to each electroporation. Consequently, the number of boxes is calculated to have a sufficient quantity of cells. The cells to be electroporated are washed with a solution of PBS and then are released using a trypsin solution containing EDTA.
This solution is eliminated, and after a few minutes the cells which drop out are taken up in DMEM medium 10% of FCS and centrifuged at 800 rpm for 6 minutes. The cells are then taken up and rewashed with a PBS solution.
then the cell pellet, after centrifugation, is taken up in a volume of medium PBS so that the final cell concentration is 1.10 'cells / ml. Those-these are kept in ice. In a 0.2 mm electroporation tank of the Mark BioRad, 500 p, 1 of the cell suspension at 1.10 'cells / ml are put in contact with 30 ~ g of RNA (replicon RNA) and the same tube is placed in the apparatus electroporation which was calibrated at 1.75 kV and 25 pFD, while the controller resistance was in the infinite position (oo button on the device). The cells thus received two electric shocks. The percentage of cells that survive these shocks is 20 to 30%. After these shocks, the cells are taken up in DMEM medium 10% SVF
and they are kept at room temperature for 10 minutes before being reseeded on a 100 mm box. Then all the boxes are placed in 5 COZ oven at a temperature of 37 ° C. They are then ready to undergo the selection pressure with hygromycin B.
4. Selection of cells resistant to hygromycin B.
Vero / G418 cells electroporated in the presence of HCV RNA and containing 10 hygromycin B resistance gene were used for pressure progressive in the presence of hygromycin B. Once electroporated, as described previously, cells are initially placed on 100 mm dishes. After 48 hours the cells are subjected to a low pressure of 100 ~, g / ml of hygromycin B
then 200 ~, g / ml until they reach a confluence. They are then taken off by 15 action of the trypsin / versene mixture and they are transferred to 60 mm boxes, while keeping the initial selection pressure. The cells are maintained for five ten passages (variable) at this concentration to stabilize the population cellular. The transplanting is done at the beginning approximately every three weeks with a dilution 1/2 of cells and a change of medium every three to four days. After one stabilization 20 of cell growth (transplanting on average every 10 to 15 days, comments also with the general condition of the cell), these are subject to pressures increasing in hygromycin B of the order of 50 to 100 ~, g / ml depending on the circumstances. The cell stabilization often occurs after five passages under the defined pressure.
Total RNA from cells growing under selection pressure was extracted and subject to RT-PCR (PCR using retrotranscriptase) in the 5 'regions and 3 'no coding. These being positive, the selection pressure was maintained and gradually raised. However studies by indirect immunofluorescence have not allow detection of HCV proteins. Detection by immunofluorescence was only possible for cells growing under pressures in hygromycin B
greater than 600 ~ g / ml. The cells were also frozen at pressures of intermediate selection. Currently we have cells growing under a hygromycin B pressure of 1000 ~ g / ml.

5. Cells and maintenance conditions.
Véro / G418 / Replicon HCV cells: Cells are cultured in layers thin in 75 cm2 flasks and in DMEM medium containing 10% serum of fetal calf (SVF) and hygromycin B. The concentration of hygromycin B
depend on cell selection. This varies from 200 to 1000 ~, g / ml. The bottles of 75 cmz are usually seeded with 5.106 cells which corresponds to a dilution half and they are maintained for 10 to 15 days depending on their density.
At the time from their passage, the medium of these cells is eliminated and the cells are washed twice with a trypsin / versene medium (NaCl 8 g / 1, KCl 0.4 g / 1, dextrose 1 g / 1, NaHC03 0.58 g / 1, Trypsin crystallized 0.045 g / 1, Versene 0.2 g / 1). The cells take off very quickly after a few minutes ~ (2 to 5 minutes). We then take these cells by DMEM medium containing the appropriate concentration of hygromycin B and the cells are divided into two bottles. The cells are allowed to settle and settle on the bottle and the medium is not changed until three to four days after, then both after up to the 1 S desired cell density (8 to 10.106 cells / 75 cm2 bottle).
6. Analysis of proteins by indirect immunofluorescence.
Vero / G418 cells are cultured on glass slides in the absence hygromycin B and Vero / G418 + replicon cells in the presence of hygromycin B
(800 pg / ml). After 3 days of culture, the cells are fixed in a PBS solution containing 4% paraformaldehyde. Cells attached to paraformaldehyde are then treated with a solution of Triton X-100 to promote labeling intracellularly. The cells are then brought into contact with antibodies specific against different HCV proteins and diluted in '' TBS (Tris buffered saline: 20 mM Tris-HCl pH 7.5; 137 mM NaCl; 2 mM EDTA). These antibodies are is monoclonal antibodies directed against the capsid protein, NS3 or NSS and prepared in mice, polyclonal antibodies recognizing the NS4 protein or NSSA or B and prepared in rabbits, i.e. anti-HCV antibodies from patients infected with HCV. After several rinses, the cells are then incubated with a secondary antibody coupled to rhodamine (anti-mouse immunoglobulins produced in rabbits; DAKO) or fluorescein (anti-mouse immunoglobulins produced in the donkey; Jackson), or secondary antibodies coupled to rhodamine or to the fluorescein and recognizing rabbit immunoglobulins or immunoglobulins human. The cells thus labeled are then observed under a microscope at fluorescence (Zeiss) and photographed (see Figure 2).
7. Purification of RNAs.
a) According to the method described in the Proméga kit (SV "Total RNA Kit Isolation System ".
The RNA purifications can be carried out on 1.5 × 10 3 to 5 × 10 6 cells.
The extraction procedures are carried out with the Proméga kit (SV Total RNA
Insulation System) and described according to the Proméga manual. For adherent cells, the middle east removed and the cells are washed twice with a solution trypsin / poured, once that the cells have been taken down. These are then taken up by the middle of culture then are centrifuged at 300g for 5 minutes. The middle is then sucked and the cells are taken up in a PBS solution and recentrifuged as described previously. The medium is aspired and the cell pellet may be treated for the further handling is stored at -80 ° C. The rest of the protocol corresponds to the description of the Proméga procedure: the cell pellet is taken up by 175 ~ .l of the lysis solution (SV RNA Lysis Buffer, supplied with the Kit: 4M GTC (guanidine isothiocyanate); 10 mM Tris-HCl pH 7.5; 0.97% (3-mercaptoethanol). The nerve East then dispersed by pipetting several times. If the concentration of cells is understood between 1,106 and 5,106 cells, it is necessary to break the DNA by doing so go to through a very fine needle. Then add 350 w1 of an SV RNA buffer Dilution Buffer (Proméga) at 175 ~ 1 of the lysis solution. We mix by inverting the tube three four times and the tube is then placed in a water bath brought to 70 ° C and we leave incubate for 3 minutes (do not exceed this time 'so as not to to risk degrade RNA). Centrifuge at 12000-14000 g for 10 minutes at 20-25 ° C and on use the tubes that are given with the kit, for the rest of the handling. Through t elsewhere, it is necessary to identify each tube for each preparation used and wear gloves to avoid RNases contamination. The lysis solution East transferred to another centrifuge tube and avoid putting the base in suspension. 200 p, 1 of ethanol at 95 ° C. are added to the solution aqueous. We mix in pipetting three to four times, then this solution is transferred to a micro-column contained in the centrifuge tube and centrifuged at 12,000-14,000 g during a minute. The micro-column is removed from the tube, the liquid present in the tube collection is eliminated then the micro-column is replaced on the original tube. We add 600 p.1 of the RNA washing solution on the micro-column (RNA washing solution : 60 mM potassium acetate, 10 mM Tris-HCl pH 7.5 and 60% Ethanol). Centrifuge at 000-14,000 g for one minute. The collection tube is again emptied and relocated like before. For each preparation to be purified, the following solution East prepared (and in order): 40 p1 Yellow Buffer (22.5 mM Tris-HCl pH 7.5;
1.125 M
NaCI; 0.0025% Yellow dye (Proméga) (w / v), 5 p1 0.09M MnCl2 and 5 p.1 DNase I
enzyme. The mixture should not be vortexed but should be mixed gently.
All is kept in ice and if the enzyme needs to be thawed, it must be leave in the ice cream. The 50 p1 of this solution are added to the Spin membrane Basketball. It is necessary to ensure that the solution covers the membrane perfectly. We let act for 15 minutes at 20-25 ° C (benchtop temperature). After this time incubation, 200 p, 1 of an activity stop solution are added enzymatic (5V
DNase stop solution) (2M guanidine isothiocyanate, 4 mM Tris-HCl pH 7.5 and 57 ethanol). The micro-column is centrifuged at 12,000-14,000 g for one minute. We add 600 μl of an RNA wash solution (5V RNA wash solution) and centrifugal at 12000-14000 g for one minute. 250 p, 1 of the solution of washing of RNAs. Centrifuge at maximum speed for two minutes. We remove a elution tube of the initial kit for each preparation and the micro-column in another centrifuge tube. 100 μl of water treated with DEPC is added on the membrane of the micro-column. Centrifuge at 12000-14000g for one minute.
The AltN solution is contained in the elution tube and is stored at -80 ° C.
b) For larger amounts of RNA, use the Promega kit (Total RNA isolation system, t6ta1 RNA isolation system).
The values given here are to be used for 1.10 'cells. The preparation of the cells is done in the same way as previously described. The principle extraction RNA is based on the method described by Chomczynski and Sacchi (1987) and who uses thiocyanate guanidium. The cell pellet is taken up by 1.2 ml of one denaturing solution containing: 26 mM sodium citrate (pH 6.8), 0.5%
NOT-lauryl sarcosine, 0.125 M (3-merca ~ toethanol and 4M guanidine thiocyanate.
solution is separated into two eppendorf tubes thus containing 600 p, 1 of the solution.
We add then in each tube 60 p1 of 2M sodium acetate and mixed gently through inversion of the tubes (4 to 5 times). This solution is then extracted by 600 p, 1 of phenol: chloroform: IA.A (isoamyl alcohol) and the tubes are then placed in the ice for 15 minutes. After this time, the aqueous solution is recovered in centrifuge the tubes for 30 minutes at 14,000 rpm at 4 ° C in a machine Eppendorf. To the aqueous solution, then add an equivalent volume of isopropanol and after mixing, the whole is left at -20 ° C. for 15 minutes. We centrifuged at 14,000 rpm at 4 ° C for 30 minutes to recover the pellet DNA that will be washed with a 75% ethanol solution. We centrifuge again, then eliminates ethanol, and let the pellet dry slightly which will be taken up in 50 p.1 of water Rnase free (treated with DEPC). Purified RNA solutions can be gathered between them. The RNAs are then stored at -80 ° C.
c) Purification of RNAs by Cesium trifluoroacetate: CsTFATM (product Pharmacia) Total RNA extracts prepared from cells or in some cases to from biopsies by the classical guanidium method of thiocyanate are also purified by centrifugation on Cesium trifluoroacetate (CsTFA) according to procedure described by Zarlenga and Gamble (1987). This allows to obtain a preparation of RNA devoid of DNA, proteins and in some cases of glycogen for AIZN isolated from hepatocytes. AItN previously isolated by guanidium thiocyanate is then purified on CsTFA (Pharmacia). RNA is taken back with a solution of CsTFA at a density of 2.0 g / ml to be at the end at a concentration of 1.65 g / ml and containing BET (ethidium bromide) at a concentration of 0.5 ~, g / ml. The solution contained in polyallomer tubes (Beclanan) of 5 ml is then centrifuged in a SW 55 Ti rotor (Beckman) for 44 hours at 15 ° C and 200000g. After this time of ' centrifugation, RNA is sampled and precipitated in a 0.3 M solution of sodium acetate and in 2 volumes of ethanol at -20 ° C overnight. Then centrifuged to recover the RNA pellet, this pellet is washed with 70% ethanol, then the pellet and on takes up the RNA with water treated with DEPC. Other purifications are not more required. The RNA thus prepared can be used for the manipulations amplifications or for hybridization manipulations on filters.

8. Hybridization of the total RNA of cells containing the replicon by radioactive probes.
Preparation of the filters: The denaturation of the RNA is done by a solution of glyoxal, then, after denaturation, the RNAs are fixed on Nitrocellulose by 5 aspiration (Device used, BioDot SF from BioRad). Purified RNAs, as previously described, are treated as follows: 22 ~ 1 of RNA are mixed with 9 p.1 of a 100 mM sodium phosphate solution (pH 7.0), 45 p, 1 of DMSO (dimethyl sulfoxide (Sigma)) and 13.2 ~ 1 of a 6M glyoxal solution (Sigma). Everything is mixed then centrifuged ', to collect all of the liquid. The mixture formed by the RNA and the denaturing solution 10 is thus incubated for one hour at 50 ° C, then the sample is cooled in ice.
Two volumes of 20XSSC solution (3M NaCl; 0.3M sodium citrate pH 7.0) are then added to each sample before their passage on the membrane of nitrocellulose which will have been previously treated in an IOXSSC solution (1.5 M NaCI; 0.15 M citrate sodium pH 7.0). To remove the remaining glyoxal, the filter is passed through a solution 1 S heated to 95 ° C: 20 mM Tris-HCl, pH 8.0; 1 mM EDTA and which is left under weak stirring at room temperature. Each filter is then placed in a vacuum oven (at 80 ° C) for one to two hours.
Prehybridization and hybridization of filters: Place the filter inside of a bag plastic and the prehybridization solution (10 mM EDTA; 7% SDS;
0.5M
Na2HP04, pH 7.2). The plastic bag is sealed and we leave everything in pre-hybridization for 5 minutes at 65 ° C. Then cut a corner of the plastic bag and we remove the pre-hybridization solution. Then add the same solution to the bag with the probe radioactive at 106 cpm / ml. The content is thus left to hybridize for 4 at 24 hours at 65 ° C.
25 Washing the filters: Different washes are carried out: first two washings for S to 10 minutes with a mixture containing a 2X SSC solution (0.3 M
NaCI;
0.03 M sodium citrate pH 7.0) and 0.1% SDS. Then we do two washes at 50 ° C for 15 minutes each with a mixture containing a solution O, 1X SSC
(1.5.10-2 M NaCl; 1.5.10-3 M sodium citrate pH 7.0), 0.1% SDS.

III - Process for producing HCV ~ by infection This method tests whether the cells containing the replicon can produce HCV particles by infection.
Currently, there is no cellular system capable of producing the virus hepatitis C. The establishment of cells capable of replicating the genome of HCV
involves the selection of factors which also favor multiplication of the virus.
Once such cells have enabled viral amplification, one can consider the purification of the virus as well as inactivation thereof for testing vaccination.
To infect cells from H strain virus stocks (Feinstone and al., 1981) (this is the same strain that was used to clone the cDNA
full of HCV), or from viruses from infected patients, cell of origin Vero / G418 (or Vn5), Vero / G418 + replicon cells under pressure hygromycin B or Vero / G418 + replicon cells without pressure hygromycin B.
These cells are maintained in a normal medium (DMEM / 10% SVF) and without hygromycin B in order to attenuate the action of the replicon. RT-PCR is performed on the initial virus, which allows quantification of viral material (presence of RNA) without for as much to determine its infectious nature. The cells are then infected with viruses as mentioned above. Cells are maintained and studied to different moments to determine if there is amplification of HCV genetic material.
For this, cell samples are taken and the total RNA of these cells is extract to quantify HCV RNA either by RT-PCR or by hybridization of RNA
on filters. Furthermore, we are trying to find out if the virus is capable of lyse cells or if he persists in the cell. If there is cell lysis, just take back the lysates cells to infect other cells. Quantification of the virus can then be done by various methods used in virology. In addition, if the viral infection do not drive at cell lysis, the multiplication of HCV can be observed by indirect immunofluorescence using antibodies to proteins HCV.

IV - Infectivity test of the complete cDNA of the HCV reconstituted with the replicon sequences by cell transfection It is essential to reclon the sequences of the most replicons functional, that is, those who have shown the most effective replication by allowing to the cell to resist very high hygromycin B concentrations. So the RNAs of these cells are extracted according to the procedures described above. The RNA of replicons is amplified by RT-PCR in a single step, so that all variations corresponds to the same replicon molecule. DNA is sequenced and RNA issued of the DNA transcription is transfected again to check its power replicative on cells. In the DNA sequence thus obtained, the sequences corresponding to hygromycin B resistance gene are substituted by sequences encoding for the HCV structural proteins. These sequences are cloned into a vector so to be capable of producing RNA by transcription from DNA. These cDNAs are used to produce RNA to transfect by electroporation (see above) cell Vero / G418 (or Vn5), Vero / G418 + replicon cells under pressure hygromycin B
or Vero / G418 + replicon cells without hygromycin B pressure. Tests identification are then performed as described above.
V - Method for screening for anti-HCV agents Cell growth under high pressures of hygromycin B being dependent on the replication efficiency of the HCV replicon, we tested different anti-viral HCV agents which can inhibit either directly or indirectly the HCV replication.
Vero / G418 + replicon cells and Vero / G418 (or Vn5) control cells are subjected in parallel to the action of different antivirals and to concentrations variables. Any action on the replication of the replicon necessarily has a impact on the synthesis of HCV RNA and therefore on protein synthesis.
So the Total RNA from cells subjected to the action of antivirals are extracted, then fixed on filters and finally hybridized with specific HCV probes. Through elsewhere, the protein synthesis being affected by decreased replication, a marking proteins are made and the expression of different proteins is studied by immunoprecipitation using antibodies to proteins specific of HCV.
One can also use a replicon containing in its sequence the sequences coding for GFP. For this, we choose a GFP whose half-life is short (Clontech): The regeneration of this protein depends on the rate of synthesis but also replication of the replicon. Inhibitors acting on the replication of HCV affect protein synthesis and therefore protein synthesis GFP.
The advantage of this approach is that there is no need to fix the cells for i detecting GFP by immunofluorescence because it has the property of fluoresce naturally under certain wavelengths. Cells containing the replicon and the GFP and subjected to the action of anti-viral agents can be observed at different moments. Photos can be taken and we can then analyze immunofluorescence of GFP. Any decrease or disappearance of GFP immunofluorescence attests of the viral friendliness of HCV.
VI - Study of the prenylation of the NSSA protein of the HCV genotype la and lb For this study, different recombinant vaccine viruses were used. They express all of the HCV NSSA protein of genotype Ia or genotype lb.
For this latter genotype, the sequences coding for the protein NSSA were amplified from two patients infected with HCV genotype lb.
Some constructions of the HCV NSSA protein contain deletions of the sequence protein located in the amino terminal part of the protein. These different viruses recombinants correspond to: wNSSA.Ia dll (del 1973-2100 aa), wNSSA.la d12 (of the 1973-2073 aa) and wNSSA.la d13 (del 1973-2001 aa). Between the parentheses are indicated the amino acids which are deleted in the NSSA protein. For more of details, the number that corresponds to the position of the amino acid in the polyprotein HCV was kept. Thus, del 1973-2100 aa corresponds to a deletion of the sequence peptide between amino acids 1973 and 2100 of the polyprotein of HCV.
This deletion of the protein concerns the amino-terminal part of the NSSA protein.
In addition, a recombinant vaccinia virus, wNS2-SB, which expresses NS2 proteins up to the HCV NSSB protein, i.e. NS2, NS3, NS4A, NS4B, NSSA and NSSB, was also used.
The cells thus infected are used to carry out markings metabolic either in the presence of mevalonic acid (H3) or in the presence of methionine S S35. The procedures used for these markings are detailed below.
a) Marking with mevalonic acid (H3) of proteins Vero / G418 (Vn5) cells were seeded on 6-well plates (Costar) at 106 cells / well and in a DMEM medium (Modified Eagle medium through i Dubelcco) containing 10% fetal calf serum (SVF). These cells are placed in a COZ oven at 37 ° C for 24 hours. They are then infected with either the vTF7.3 virus alone (Fuerst et al., 1986), or co-infected with this virus and a viruses recombinants expressing the HCV NSSA protein previously described, each at a me from S UFP / cell. After one hour at 37 ° C, the inoculum is removed and replaced by DMEM medium (Dulbecco's modified Eagle's medium) containing 10% serum 1 Fetal calf and 100 pg / ml of Mevastatin for a 4 hour pretreatment following which is added to the medium 100 pCi / ml of mevalonic acid (H3). After 18 hours post-infection, the cells are washed with DMEM medium, the medium is eliminated and cells are washed with a PBS solution before being lysed by a buffer containing 50 mM Tris-HCl pH 7.5; 1 SO mM NaCI; 1mM EDTA; 0.5% NP40; 0.5% Na deoxycholate; 0.2% SDS; Aprotinin 10 p, g / ml; TPCK and PMSF, 20 pg / ml. The HCV NSSA protein is then immunoprecipitated from this lysate at using a polyclonal rabbit serum directed against the NSSA protein according to a procedure already described (Wychowski et al., 1985) and the precipitate is analyzed by SDS-PAGE. The result of these markings is indicated in Figures 3A, 3B, 3C 'and 3D. The markings at mevalonic acid are indicated by: Mev.H3. In Figures 3A, 3B and 3C, the lines 1 indicate the result obtained on a lysate from cells infected with recombinant virus vTF7.3. In this case, it is a control measure.
b) Labeling (S35) of proteins Vero / G418 (Vn5) cells were infected with the same viruses recombinant than those mentioned above. After one hour of contacting 37 ° C, the inoculum is removed and replaced with DMEM medium containing 5% of serum wish fetal. At 16h post-infection, the cells are washed with DMEM medium without methionine, then incubated in this medium for 1 to 2 hours, then labeled 3 hours with 100 pCi / ml methionine (35S) (35S-Protein Labeling Mix (NEN), solution of marking). After this time, the medium is eliminated and the cells are then washed by PBS, and finally are lysed using a lysis buffer containing: 50 mM Tris-HCl pH 7.5; 150 mM NaCl; 1mM EDTA; 0.5% NP40; 0.5% Na deoxycholate; 0.2%
5 SDS; Aprotinin 10 p, g / ml; TPCK and PMSF, 20 pg / ml. HCV NSSA protein East then immunoprecipitated from the lysates using a polyclonal serum rabbit as described by Wychowski et al. (1985) and the precipitate is analyzed by SDS-PAGE.
The markings with methionine S35 are indicated in FIGS. 3A and 3C by Met.S35. In Figures 3A and 3C, lines 1 indicate the result obtained on a lysate 10 from cells infected with the recombinant virus vTF7.3 and labeled to the methionine 535. This is a control measure in this case.
We notice that the HCV NSSA protein of genotype la or lb is prenylated in Vero / G418 cells (Vn5) (see Figures 3A and 3D). This prenylation has location when the NSSA protein is expressed alone or in the context of polyprotein 15 (see Figures 3B, lines 2 and 3 respectively). The prenylation is a process of post-translational modification mainly concerning the NSSA protein HCV
of genotype la or lb, and may relate to other genotypes.

REFERENCES
- Blackburn P. and Moore S. (1982) The Enzymes, Vol. XV, Part. B, Academic Press, BY,, i - Bouffard et al. (1992) The J. Infect. Diseases, 166, 1276-1280, - Casey PJ (1992) Journal of Lipid Research, 33, 1731-1740, - Chomczynski and Sacchi (1987) Anal. Biochem, 162, 156-159, - Choo et al. (1988) Proc. Natl. Acad. Sci. USA, 88, 2451-2455, - Choo et al. (1989) Science, 244, 359-362, - Feinstone et al. (1975) N. Engl. J. Med., 292, 767-770, - Feinstone et al. (1981) J. Infect. Dis., 144, 588-598, - Fourmillier et al. (1996) J. Gen. Virol., 77, 1055-1064, - Frese et al. (1995) J. Virol., 69, 3904-3909, - Fuerst et al. (1986) Proc. Natl. Acad. Sci. USA, 83, 8122-8126, - Grakoui et al. (1993) J. Virol., 67, 1385-1395, - Grakoui et al. (1993) J. Virol., 67, 2832-2843, - Grakoui et al. (1993) Proc .: Natl. Acad. Sci. USA, 90, 10583-10587, - Gübler U. and Hoffman BJ (1983) Gene, 25, 263-269, - Hijikata et al. (1991) Proc. Natl. Acad. Sci. USA, 88, 5547-5551, - Inchauspé et al. (1991) Proc. Natl. Acad. Sci. USA, 88, 10292-10296, - Kato and Shimotohno (2000) Curr Top Microbiol Immunol, 242, 261-278, - Kato et al. (1990) Proc. Natl. Acad. Sci. USA, 87, 9524-9528, - Kieny et al. (1984) Nature, 312, 163-166, - Kolykhalov et al. (1997) Science, 277, 570-574, - Kowalski et al. (1976) Biochemistry, 15, 4457-4463, - Lanford et al. (1994) Yirology, 202, 606-614, - Liljestr ~ m et al (1991) J. Virol., 65, 4107-4113, - Lohmann et al. (1997) Science, 285, 110-113, - Moss et al. (1990) Nature, 348, 91-92, - Mullis, KB and Faloona FA (1987) Meth. Enzymol., 155, 335-350, - Negro; et al. (1992) Proc. Natl. Acad. Sci. USA, 1992, 89, 2247-2251, - Okamoto et al. (1992) Virology, 188, 331-341, - Prince et al. (1974) Lancet, 2, 241-246, - Reynolds et al. (1995) The EMBO J., 14, 6010-6020, - Seipp et al. (1997) J. Gen. Virol., 2467-2476, - Shimizu et al. (1992) Proc. Natl. Acad. Sci. USA, 89, 5477-5481, - Shimizu et al. (1994) J. Yirol., 68, 1494-1500, - Shimizu et al. (1994) J. Virol., 68, 8406-8408, - Simmonds P. (2001) J. Gen. Virol., 82, 693-712, - Tsukiyama-Kohara et al. (1992) J. Virol., 66, 1476-1483, i:
- Wychowski et al. (1985), Gene, 37, 63-71, - Yanagi et al. (1997) Proc. Natl. Acad. Sci. USA, 94, 8738-8743, - Zarlenga and Gamble (1987) Analytical Biochemistry, 162, 569-574.

SEQUENCE LIST
<110> CNRS
<120> METHOD FOR REPLICATING HEPATITIS C VIRUS
<130> WOB Ol AA CNR GENO
<150> FR 01/05732 <151> 2001-04-27 <160> 3 <170> PatentIn version 3.1 <210> 1 <211> 6609 <212> DNA
<213> artificial sequence <220>
<223> fragment of the nucleotide sequence of HCV of genotype la <400> 1 ctggacacggaggtggccgcgtcgtgtggcggcgttgttcttgtcgggttaatggcgctg60 actctgtcaccatattacaagcgctatatcagctggtgcatgtggtggcttcagtatttt120 ctgaccagagtagaagcgcaactgcacgtgtgggttccccccctcaacgtccgggggggg180 cgcgatgccgtcatcttactcatgtgtgttgtacacccgactctggtatttgacatcacc240 aaactactcctggccatcttcggacccctttggattcttcaagccagtttgtttaaagtc300 ccctacttcgtgcgcgttcaaggccttctccggatctgcgcgctagcgcggaagatgacc360 ggaggtcattacgtgcaaatggccatcatcaagttgggggcgcttactggcacctatgtg420 tataaccatctcacccctcttcgagactgggcgcacaacggcctgcgagatctggccgtg480 gctgtggaaccagtcgtcttctcccgaatggagaccaagctcatcacgtggggggcagat540 accgccgcgtgcggtgacatcatcaacggcttgcccgtctctgcccgtaggggccaggag600 atactgcttgggccagccgacggaatggtctccaaggggtggaggttgctggcgcccatc660 acggcgtacgcccagcagacgagaggcctcctagggtgtataatcaccagcctgactggc720 cgggacaaaaaccaagtggagggtgaggtccagatcgtgtcaactgctacccaaaccttc780 ctggcaacgtgcatcaatggggtatgctggactgtctaccacggggccggaacgaggacc840 atcgcatcacccaagggtcctgtcatccagatgtataccaatgtggaccaagaccttgtg900 ggctggcccgctcctcaaggttcccgctcattgacaccctgcacctgcggctcctcggac960 ctttacctggtcacgaggcacgccgacgtcattcccgtgcgccggcgaggtgatagcagg1020 ggtagcctgcttttgccccggcccatttcctacctaaaaggctcctcggggggtccgctg1080 ttgtgccccgcgggacacgccgtgggcctattcagggccgcggtgtgcacccgtggagtg1140 gccaaggcgtggactttatccctgtggagaacctagaga. atccccggtg1200 g caaccatgag ' ttcacggacaactcctctccaccagcagtgccccagagcttccaggtggcccacctgcat1260 gctcccaccggcagtggtaagagcaccaag.;, gtcccggctg cgtacgcagcccagggctac1320 aaggtgttggtgctcaacccctctgttgctgcaacgctgggctttggtgcttacatgtcc1380 aaggcccatggggtcgatcctaatatcaggaccggggtgagaacaattaccactggcagc1440 cccatcacgtactccacctacggcaagttccttgccgacggcgggtgctcaggaggcgct1500 tatgacataataatttgtgacgagtgccactccacggatgccacatccatcttgggcatc1560 ggcactgtccttgacaagcagagactgcgggggcgagattggttgtgctcgccactgct1620 acccctccgggctccgtcactgtgtcccatcctaacatcgaggaggttgctctgtccacc1680 accggagagatccctttctacggcaaggctatccccctcgaggtgatcaaggggggaaga1740 catctcatcttctgtcactcaaagaagaagtgcgacgagctcgccgcgaagctggtcgca1800 ttgggcatcaatgccgtggcctactaccgcggacttgacgtgtctgtcatcccgaccagc1860 ggcgatgttgtcgtcgtgtcgaccgatgctctcatgactggctttaccggcgacttcgac1920 tctgtgatagactgcaacacgtgtgtcactcagacagtcgatttcagccttgaccctacc1980 tttaccattgagacaaccacgctcccccaggatgctgtctccaggactcagcgccggggc2040 aggactggcagggggagccaggcatctacagatttgtggcaccgggggagcgcccctcc2100 ggcatgttcgactcgtccgtcctctgtgagtgctatgacgcgggctgtgcttggtatgag2160 ctcatgcccgccgagactacagttaggctacgagcgtacatgaacaccccggggcttccc2220 gtgtgccaggaccatcttgaattttgggagggcgtctttacgggcctcacccatatagat2280 gcccactttctatcccagacaaagcagagtggggagaactttccttacctggtagcgtac2340 caagccaccgtgtgcgctagggctcaagcccctcccccatcgtgggaccagatgtggaag2400 tgtttgatccgccttaaacccaccctccatgggccaacacccctgctatacagactgggc2960 gctgttcagaatgaagtcaccctgacgcacccaatcaccaaatacatcatgacatgcatg2520 ~

tcggccgacctggaggtcgtcacgagcacctgggtgctcgttggcggcgtcctggctgct2580 ctggccgcgtattgcctgtcaacaggctgcgtggtcatagtgggcaggattgtcttgtcc2640 gggaagccggcaattatacctgacagggaggttctctaccaggagttcgatgagatggaa2700 gagtgctctcagcacttaccgtacatcgagcaagggatgatgctcgctgagcagttcaag2760 cagaaggccctcggcctcctgcagaccgcgtcccgccatgcagaggttatcacccctgct2820 gtccagaccaactggcagaaactcgaggtcttctgggcgaagcacatgtggaatttcatc2880 agtgggatacaatatttggcgggcctgtcaacgctgcctggtaaccccgccattgcttca2940 ttgatggcttttacagctgccgtcaccagcccactaaccactggccaaaccctcctcttc3000 aacatattgggggggtgggtggctgcccagctcgccgcccccggtgccgctaccgccttt3060 gtgggcgctggcttagctggcgccgccatcggcagcgttggactggggaaggtcctcgtg3120 gacattcttgcagggtatggcgcgggcgtggcgggagctcttgtagcattcaagatcatg3180 agcggtgaggtcccctccacggaggacctggtcaatctgctacccgccatcctctcgcct3240 ggagcccttgtagtcggtgtggtctgcgcagcaatactgcgccggcacgttggcccgggc3300 gagggggcagtgcaatggatgaaccggctaatagccttcgcctcccgggggaaccatgtt3360 tcccccacgcactacgtgccggagagcgatgcagccgcccgcgtcactgccatactcagc3920 agcctcactgtaacccagctcctgaggcgactacatcagtggataagctcggagtgtacc3480 actccatgctccggctcctggctaagggacatctgggactggatatgcgaggtgctgagc3540 gactttaagacctggctgaaagccaagctcatgccacaactgcctgggattccctttgtg3600 tcctgccagcgcgggtataggggggtctggcgaggagacggcattatgcacactcgctgc3660 cactgtggagctgagatcactggacatgtcaaaaacgggacgatgaggatcgtcggtcct3720 aggacctgcaggaacatgtggagtgggacgttccccattaacgcctacaccacgggcccc3780 tgtactccccttcctgcgccgaactataagttcgcgctgtggagggtgtctgcagaggaa3890 tacgtggagataaggcgggtgggggacttcactacgtatcgggtatgactactgacaat3900 cttaaatgcccgtgccagatcccatcgcccgaatttttcacagaattggacggggtgcgc3960 ctacataggtttgcgcccccttgcaagcccttgctgcgggaggaggtatcattcagagta4020 ggactccacgagtacccggtggggtcgcaattaccttgcgagcccgaaccggacgtagcc4080 gtgttgacgtccatgctcactgatccctcccatataacagcagaggcggccgggagaagg4140 ttggcgagagggtcacccccttctatggccagctcctcggccagccagctgtccgctcca4200 tctctcaaggcaacttgcaccgccaaccatgactcccctgacgccgagctcatagaggct4260 aacctcctgtggaggcaggagatgggcggcaacatcaccagggttgagtcagagaacaaa4320 gtggtgattctggactccttcgatccgcttgtggcagaggaggatgagcgggaggtctcc4380 gtacccgcagaaattctgcggaagtctcggagattcgcccgggccctgcccgtttgggcg4940 cggccggactacaaccccccgctagtagagacgtggaaaaagcctgactacgaaccacct4500 gtggtccatggctgcccgctaccacctccacggtcccctcctgtgcctccgcctcggaaa4560 aagcgtacggtggtcctcaccgaatcaaccctacctactgccttggccgagcttgccacc4620 aaaagttttggcagctcctcaacttccggcattacgggcgacaatatgacaacatcctct4680 gagcccgccccttctggctgcccccccgactccgacgttgagtcctatt.cttccatgccc9790 cccctggagggggagcctggggatccggatttcagcgacgggtcatggtcgacggtcagt4800 ' agtggggccgacacggaagatgtcgtgtgctgctcaatgtcttatacctg'gacaggcgca4860 ctcgtcaccccgtgcgctgcggaagaacaaaaactgcccatcaacgcactgagcaactcg4920 ttgctacgccatcacaatctggtatattccaccacttcacgcagtgcttgccaaaggcag4980 aagaaagtcacatttgacagactgcaagttctggacagccattaccaggacgtgctcaag5040 gaggtcaaagcagcggcgtcaaaagtgaaggctaacttgctatccgtagaggaagcttgc5100 agcctgacgcccccacattcagccaaatccaagtttggctatggggcaaaagacgtccgt5160 tgccatgccagaaaggccgtagcccacatcaactccgtgtggaaagaccttctggaagac5220 agtgtaacaccaatagacactatcatcatggccaagaacgaggtcttctgcgttcagcct5280 gagaaggggggtcgtaagccagctcgtctcatcgtgttccccgacctgggcgtgcgcgtg5390 tgcgagaagatggccctgtacgacgtggttgcaaactccccctggccgtgatgggaagc5900 tcctacggattccaatactcaccaggacagcgggttgaattcctcgtgcaagcgtggaag5960 tccaagaagaccccgatggggttcccgtatgatacccgctgttttgactccacagtcact5520 gagagcgacatccgtacggaggaggcaatttaccaatgttgtgacctggacccccaagcc5580 cgcgtggccatcaagtccctcactgagaggctttatgttgggggccctcttaccaattca5640 aggggggaaaactgcggctatcgcaggtgccgcgcgagcggcgtactgacaactagctgt5700 ggtaacaccctcacttgctacatcaaggcccgggcagcccgtcgagccgcagggctccag5760 gactgcaccatgctcgtgtgtggcgacgacttagtcgttatctgtgaaagtgcgggggtc5820 caggaggacgcggcgagcctgagagcctttacggaggctatgaccaggtactccgccccc5880 cccggggaccccccacaaccagaatacgacttggagcttataacatcatgctcctccaac5940 gtgtcagtcgcccacgacggcgctggaaaaagggtctactaccttacccgtgaccctaca6000 acccccctcgcgagagccgcgtgggagacagcaagacacactccagtcaattcctggcta6060 ggcaacataatcatgtttgcccccacactgtgggcgaggatgatactgatgacccatttc6120 tttagcgtcctcatagccagggatcagcttgaacaggctcttaactgtgagatctacgca6180 gcctgctactccatagaaccactggatctacctccaatcattcaaagactccatggcctc6240 agcgcattttcactccacagttactctccaggtgaagtcaatagggtggccgcatgcctc6300 agaaaacttggggtcccgcccttgcgagcttggagacaccgggcccggagcgtccgcgct6360 aggcttctgtccaggggaggcagggctgccatatgtggcaagtacctcttcaactgggca6920 gtaagaacaaagctcaaactcactccaatagcggccgctggccggctggacttgtccggt6480 tggttcacggctggctacagcgggggagac., atttatcacagcgtgtctcagcccggccc 6540 ~ t cgctggttctggttttgcctactcctgctc'gctgcaggggtaggcatctacctcctcccc6600 aaccggtga 6609 <210> 2 <211> 9622 <212> DNA
<213> Hepatitis C virus <400> 2 gccagccccctgatgggggcgacactccaccatagatcactcccctgtgaggaactactg60 tcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggac120 cccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgccag180 gacgaccgggtcctttcttggataaacccgctcaatgcctggagatttgggcgtgccccc240 gcaagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagg300 gtgcttgcgagtgccccgggaggtctcgtagaccgtgcaccatgagcacgaatcctaaac360 ctcaaagaaaaaccaaacgtaacaccaaccgtcgcccacaggacgtcgagttcccgggtg420 gcggtcagatcgttggtggagtttacttgttgccgcgcaggggccctagattgggtgtgc480 gcgcgacgaggaagacttccgagcggtcgcaacctcgtggtagacgtcagcctatcccca540 aggcacgtcggcccgagggcaggacctgggctcagcccgggtacccttggcccctctatg600 gcaatgagggttgcgggtgggcgggatggctcctgtctccccgtggctctcggcctagct660 ggggccccacagacccccggcgtaggtcgcgcaatttgggtaaggtcatcgataccctta720 cgtgcggcttcgccgacctcatggggtacataccgctcgtcggcgcccctcttggaggcg780 ctgccagggccctggcgcatggcgtccggg ~, cggcgtgaactatgcaacag840 ~ ttctggaaga ggaaccttcctggttgctctttctctatcttccttctggccctgctctcttgcctgactg900 tgcccgcttcagcctaccaagtgcgcaattcctcggggctttaccatgtcaccaatgatt960 gccctaattcgagtattgtgtacgaggcggccgatgccatcctgcacactccggggtgtg1020 tcccttgcgttcgcgagggtaacgcctcgaggtgttgggtggcggtgacccccacggtgg1080 ccaccagggacggcaaactccccacaacgcagcttcgacgtcatatcgatctgcttgtcg1140 ggagcgccaccctctgctcagccctctacgtgggggacctgtgcgggtctgtttttcttg1200 ttggtcaactgtttaccttctctcccaggcgccactggacgacgcaaagctgcaattgtt1260 ctatctatcccggccatataacgggtcatcgcatggcatgggatatgatg ~ atgaactggt1320 cccctacggcagcgttggtggtagctcagctgctccggatcccacaagcc'atcatggaca1380 tgatcgctggtgctcactggggagtcctggcgggcatagcgtatttctccatggtgggga1490 actgggcgaaggtcctggtagtgctgctgctatttgccggcgtcgacgcggaaacccacg1500 tcaccgggggaagtgccggccacaccacggctgggcttgttggtctccttacaccaggcg1560 ccaagcagaacatccaactgatcaacaccaacggcagttggcacatcaatagcacggcct1620 tgaactgcaacgatagccttaccaccggctggttagcagggctcttctatcgccacaaat1680 tcaactcttcaggctgtcctgagaggttggccagctgccgacgccttaccgattttgccc1740 agggctggggtcccatcagttatgccaacggaagcggccttgacgaacgcccctactgtt1800 ggcactaccctccaagaccttgtggcattgtgcccgcaaagagcgtgtgtggcccggtat1860 attgcttcactcccagccccgtggtggtgggaacgaccgacaggtcgggcgcgcctacct1920 acagctggggtgcaaatgatacggatgtcttcgtccttaacaacaccaggccaccgctgg1980 gcaattggttcggttgtacctggatgaactcaactggattcaccaaagtgtgcggagcgc2040 ccccttgtgtcatcggaggggtgggcaacaacaccttgctctgccccactgattgcttcc2100 gcaaacatccggaagccacatactctcggtgcggctccggtccctggattacacccaggt2160 gcatggtcgactacccgtataggctttggc., actatccttgtactatcaattacaccatat2220 tcaaagtcaggatgtcgtgggaggggtcgagcacaggctggaagcggcctgcaactgga2280 cgcggggcgaacgctgtgatctggaagacagggacaggtccgagctcagcccattgctgc2340 tgtccaccacacagtggcaggtccttccgtgttctttcacgaccctgccagccttgtcca2400 ccggcctcatccacctccaccagaacattgtggacgtgcagtacttgtacggggtggggt2960 caagcatcgcgtcctgggccattaagtgggagtacgtcgttctcctgttccttctgcttg2520 cagacgcgcgcgtctgctcctgcttgtggatgatgttactcatatcccaagcggaggcgg2580 ctttggagaacctcgtaatactcaatgcagcatccctggccgggacgcacggtcttgtgt2640 ccttcctcgtgttcttctgctttgcgtggtatctgaagggtaggtgggtgcccggagcgg2700 tctacgccttctacgggatgtggcctctcctcctgctcctgctggcgttgcctcagcggg2760 catacgcactggacacggaggtggccgcgtcgtgtggcggcgttgttcttgtcgggttaa2820 tggcgctgactctgtcaccatattacaagcgctatatcagctggtgcatgtggtggcttc2880 agtattttctgaccagagtagaagcgcaactgcacgtgtgggttccccccctcaacgtcc2940 ggggggggcgcgatgccgtcatcttactcatgtgtgttgtacacccgactctggtatttg3000 acatcaccaaactactcctggccatcttcggacccctttggattcttcaagccagtttgt3060 ttaaagtcccctacttcgtgcgcgttcaaggccttctccggatctgcgcgctagcgcgga3120 agatgaccggaggtcattacgtgcaaatggccatcatcaagttgggggcgcttactggca3180 cctatgtgtataaccatctcacccctcttcgagactgggcgcacaacggcctgcgagatc3240 tggccgtggctgtggaaccagtcgtcttctcccgaatggagaccaagctcatcacgtggg3300 gggcagataccgccgcgtgcggtgacatcatcaacggcttgcccgtctctgcccgtaggg3360 gccaggagatactgcttgggccagccgacg..gaatggtctccaaggggtggaggttgctgg3420 cgcccatcacggcgtacgcccagcagacga ~ gaggcctcctagggtgtataatcaccagcc3480 tgactggccgggacaaaaaccaagtggagggtgaggtccagatcgtgtcaactgctaccc3540 aaaccttcctggcaacgtgcatcaatggggtatgctggactgtctaccacggggccggaa3600 cgaggaccatcgcatcacccaagggtcctgtcatccagatgtataccaatgtggaccaag3660 accttgtgggctggcccgctcctcaaggttcccgctcattgacaccctgcacctgcggct3720 cctcggacctttacctggtcacgaggcacgccgacgtcattcccgtgcgccggcgaggtg3780 atagcaggggtagcctgcttttgccccggcccatttcctacctaaaaggctcctcggggg3840 gtccgctgttgtgccccgcgggacacgccgtgggcctattcagggccgcggtgtgcaccc3900 gtggagtggccaaggcggtggactttatccctgtggagaacctagagacaaccatgagat3960 ccccggtgttcacggacaactcctctccaccagcagtgccccagagcttccaggtggccc4020 acctgcatgctcccaccggcagtggtaagagcaccaaggtcccggctgcgtacgcagccc4080 agggctacaaggtgttggtgctcaacccctctgttgctgcaacgctgggctttggtgctt4190 acatgtccaaggcccatggggtcgatcctaatatcaggaccggggtgagaacaattacca4200 ctggcagccccatcacgtactccacctacggcaagttccttgccgacggcgggtgctcag4260 gaggcgcttatgacataataatttgtgacgagtgccactccacggatgccacatccatct4320 tgggcatcggcactgtccttgaccaagcagagactgcgggggcgagattggttgtgctcg4380 ccactgctacccctccgggctccgtcactgtgtcccatcctaacatcgaggaggttgctc4440 tgtccaccaccggagagatccctttctacggcaaggctatccccctcgaggtgatcaagg4500 ggggaagacatctcatcttctgtcactcaaagaagaagtgcgacgagctcgccgcgaagc.

tggtcgcattgggcatcaatgccgtggcctactaccgcggacttgacgtgtctgtcatcc4620 cgaccagcggcgatgttgtcgtcgtgtcgaccgatgctctcatgactggctttaccggcg4680 acttcgactctgtgatagactgcaacacgtgtgtcactcagacagtcgatttcagccttg9740 accctacctttaccattgagacaaccacgctcccccaggatgctgtctccaggactcagc9800 gccggggcaggactggcagggggaagccaggcatctacagatttgtggcaccgggggagc4860 gcccctccggcatgttcgactcgtccgtcctctgtgagtgctatgacgcgggctgtgctt4920 ggtatgagctcatgcccgccgagactacagttaggctacgagcgtacatgAaacaccccgg4980 ggcttcccgtgtgccaggaccatcttgaattttgggagggcgtctttacg'ggcctcaccc5040 atatagatgcccactttctatcccagacaaagcagagtggggagaactttccttacctgg5100 tagcgtaccaagccaccgtgtgcgctagggctcaagcccctcccccatcgtgggaccaga5160 tgtggaagtgtttgatccgccttaaacccaccctccatgggccaacacccctgctataca5220 gactgggcgctgttcagaatgaagtcaccctgacgcacccaatcaccaaatacatcatga5280 catgcatgtcggccgacctggaggtcgtcacgagcacctgggtgctcgttggcggcgtcc5340 tggctgctctggccgcgtattgcctgtcaacaggctgcgtggtcatagtgggcaggattg5400 tcttgtccgggaagccggcaattatacctgacagggaggttctctaccaggagttcgatg5960 agatggaagagtgctctcagcacttaccgtacatcgagcaagggatgatgctcgctgagc5520 agttcaagcagaaggccctcggcctcctgcagaccgcgtcccgccatgcagaggttatca5580 cccctgctgtccagaccaactggcagaaactcgaggtcttctgggcgaagcacatgtgga5690 atttcatcagtgggatacaatatttggcgggcctgtcaacgctgcctggtaaccccgcca5700 ttgcttcattgatggcttttacagctgccgtcaccagcccactaaccactggccaaaccc5760 tcctcttcaacatattgggggggtgggtggctgcccagctcgccgcccccggtgccgcta5820 ccgcctttgtgggcgctggcttagctggcgccgccatcggcagcgttggactggggaagg5880 tcctcgtggacattcttgcagggtatggcgcgggcgtggcgggagctcttgtagcattca5940 agatcatgagcggtgaggtcccctccacggaggacctggtcaatctgctacccgccatcc6000 tctcgcctggagcccttgtagtcggtgtggtctgcgcagcaatactgcgccggcacgttg6060 gcccgggcgagggggcagtgcaatggatgaaccggctaatagccttcgcctcccggggga6120 accatgtttcccccacgcactacgtgccggagagcgatgcagccgcccgcgtcactgcca6180 tactcagcagcctcactgtaacccagctcctgaggcgactacatcagtggataagctcgg6240 agtgtaccactccatgctccggctcctggctaagggacatctgggactggatatgcgagg6300 tgctgagcgactttaagacctggctgaaagccaagctcatgccacaactgcctgggattc6360 cctttgtgtcctgccagcgcgggtataggggggtctggcgaggagacggcattatgcaca6420 ctcgctgccactgtggagctgagatcactggacatgtcaaaaacgggacgatgaggatcg6480 tcggtcctaggacctgcaggaacatgtggagtgggacgttccccattaacgcctacacca6540 cgggcccctgtactccccttcctgcgccgaactataagttcgcgctgtggagggtgtctg6600 cagaggaatacgtggagataaggcgggtgggggacttccactacgtatcgggtatgacta6660 ctgacaatcttaaatgcccgtgccagatcccatcgcccgaatttttcacagaattggacg6720 gggtgcgcctacataggtttgcgcccccttgcaagcccttgctgcgggaggaggtatcat6780 tcagagtaggactccacgagtacccggtggggtcgcaattaccttgcgagcccgaaccgg6840 acgtagccgtgttgacgtccatgctcactgatccctcccatataacagcagaggcggccg6900 ggagaaggttggcgagagggtcacccccttctatggccagctcctcggccagccagctgt6960 ccgctccatctctcaaggcaacttgcaccgccaaccatgactcccctgacgccgagctca7020 tagaggctaacctcctgtggaggcaggagatgggcggcaacatcaccagggttgagtcag7080 agaacaaagtggtgattctggactccttcgatccgcttgtggcagaggaggatgagcggg7140 aggtctccgtacccgcagaaattctgcggaagtctcggagattcgcccgggccctgcccg7200 tttgggcgcggccggactacaaccccccgctagtagagacgtggaaaaagcctgactacg7260 aaccacctgtggtccatggctgcccgctaccacctccacggtcccctcctgtgcctccgc7320 ctcggaaaaagcgtacggtggtcctcaccgaatcaaccctacctactgccttggccgagc7380 ttgccaccaaaagttttggcagctcctcaacttccggcattacgggcgacaatatgacaa7440 catcctctgagcccgccccttctggctgcccccccgactccgacgttgagtcctattctt7500 ccatgccccccctggagggggagcctggggatccggatttcagcgacgggtcatggtcga7560 cggtcagtagtggggccgacacggaagatgtcgtgtgctgctcaatgtcttatacctgga7620 caggcgcactcgtcaccccgtgcgctgcggaagaacaaaaactgcccatcaacgcactga7680 gcaactcgttgctacgccatcacaatctggtatattccaccacttcacgcagtgcttgcc7740 aaaggcagaagaaagtcacatttgacagactgcaagttctggacagccattaccaggacg7800 tgctcaaggaggtcaaagcagcggcgtcaaaagtgaaggctaacttgctatccgtagagg7860 aagcttgcagcctgacgcccccacattcagccaaatccaagtttggctatggggcaaaag7920 acgtccgttgccatgccagaaaggccgtagcccacatcaactccgtgtggaaagaccttc7980 tggaagacagtgtaacaccaatagacactatcatcatggccaagaacgaggtcttctgcg8040 ttcagcctgagaaggggggtcgtaagccagctcgtctcatcgtgttccccgacctgggcg8100 tgcgcgtgtgcgagaagatggccctgtacgacgtggttagcaaactccccctggccgtga8160 tgggaagctcctacggattccaatactcaccaggacagcgggttgaattcctcgtgcaag8220 cgtggaagtccaagaagaccccgatggggttcccgtatgatacccgctgttttgactcca8280 cagtcactgagagcgacatccgtacggaggaggcaatttaccaatgttgtgacctggacc8340 cccaagcccgcgtggccatcaagtccctcactgagaggctttatgttgggggccctctta8400 ccaattcaaggggggaaaactgcggctatcgcaggtgccgcgcgagcggcgtactgacaa8460 ctagctg.tggtaacaccctcacttgctacatcaaggcccgggcagcccgtcgagccgcag8520 ggctccaggactgcaccatgctcgtgtgtggcgacgacttagtcgttatctgtgaaagtg8580 cgggggtccaggaggacgcggcgagcctgagagcctttacggaggctatg, accaggtact8640 ccgccccccccggggaccccccacaaccagaatacgacttggagcttata ~ acatcatgct8700 cctccaacgtgtcagtcgcccacgacggcgctggaaaaagggtctactaccttacccgtg8760 accctacaacccccctcgcgagagccgcgtgggagacagcaagacacactccagtcaatt8820 cctggctaggcaacataatcatgtttgcccccacactgtgggcgaggatgatactgatga8880 cccatttctttagcgtcctcatagccagggatcagcttgaacaggctcttaactgtgaga8940 tctacgcagcctgctactccatagaaccactggatctacctccaatcattcaaagactcc9000 atggcctcagcgcattttcactccacagttactctccaggtgaagtcaatagggtggccg9060 catgcctcagaaaacttggggtcccgcccttgcgagcttggagacaccgggcccggagcg9120 tccgcgctaggcttctgtccaggggaggcagggctgccatatgtggcaagtacctcttca9180 actgggcagtaagaacaaagctcaaactcactccaatagcggccgctggccggctggact9240 tgtccggttggttcacggctggctacagcgggggagacatttatcacagcgtgtctcatg9300 cccggccccgctggttctggttttgcctactcctgctcgctgcaggggtaggcatctacc9360 tcctccccaaccggtgaaggttggggtaaacactccggcctcttaggccatttccctttt9420 tttttttttttttttttttccctttttttttttttttttttttttttttttttttttttt9480 tccttttccttcttttttccctttctcttcctcccttctttaatggtggctccatcttag9540 ccctagtcacggctagctgtgaaaggtccgtgagccgcatgactgcagagagtgctgata9600 ctggcctctctgcagatcatgt 9622 <210> 3 <211> 8451 <212> DNA
<213> artificial sequence <220>
<223> replicon obtained by fusion of a resistance gene with hygromycin B with the sequence SEQ ID NO: 1 <900> 3 gccagccccctgatgggggcgacactccaccatagatcactcccctgtgaggaactactg60 tcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggac120 cccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgccag180 gacgaccgggtcctttcttggataaacccgctcaatgcctggagatttgggcgtgccccc240 gcaagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagg300 gtgcttgcgagtgccccgggaggtctcgtagaccgtgcaccatgagcacgaatcctaaac360 ctcaaagaaaaaccaaacgtaacaccaaccgtcgcccacaggacgtcgagttcccgggtg420 gcggtcagatcgttggtggagtttacttgttgccgcgcaggggccctagattgggtgtgc980 gcgcgacgaggaagacttccgagcggtcgcaacctcgtggtagacgtcagcctatcccca590 aggcacgtcggcccgagggcaggacctgggctcagcccgggtaccctatgaaaaagcctg600 aactcaccgcgacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacc660 tgatgcagctctcggagggcgaagaatctcgtgctttagcttcgatgtaggagggcgtg720 gatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatc780 ggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggaattcagcg840 agagcctgacctattgcatctcccgccgtgcacagggtgtcacgttgcaagacctgcctg900 aaaccgaactgcccgctgttctgcagccggtcgcggaggccatggatgcgatcgctgcgg960 ccgatcttagccagacgagcgggttcggcccattcggaccgcaaggaatcggtcaataca1020 ctacatggcgtgatttcatatgcgcgattgctgatccccatgtgtatcactggcaaactg1080 tgatggacgacaccgtcagtgcgtccgtcgcgcaggctctcgatgagctgatgctttggg1140 ccgaggactgccccgaagtccggcacctcgtgcacgcggatttcggctccaacaatgtcc1200 tgacggacaatggccgcataacagcggtcattgactggagcgaggcgatgttcggggatt1260 cccaatacgaggtcgccaacatcttcttctggaggccgtggttggcttgtatggagcagc1320 agacgcgctacttcgagcggaggcatccggagcttgcaggatcgccgcggctccgggcgt1380 atatgctccgcattggtcttgaccaactctatcagagcttggttgacggcaatttcgatg1440 atgcagcttgggcgcagggtcgatgcgacgcaatcgtccgatccggagccgggactgtcg1500 ggcgtacacaaatcgcccgcagaagcgcggccgtctggaccgatggctgtgtagaagtac1560 tcgccgatagtggaaaccgacgccccagcactcgtggggatcgggagatgggggaggcta1620 actctagtctggacacggaggtggccgcgtcgtgtggcggcgttgttcttgtcgggttaa1680 tggcgctgactctgtcaccatattacaagcgctatatcagctggtgcatgtggtggcttc1? 40 agtattttctgaccagagtagaagcgcaactgcacgtgtgggttccccccctcaacgtcc1800 ggggggggcgcgatgccgtcatcttactcatgtgtgttgtacacccgactctggtatttg1860 acatcaccaaactactcctggccatcttcggacccctttggattcttca_agccagtttgt1920 ttaaagtcccctacttcgtgcgcgttcaaggccttctccggatctgcgcgctagcgcgga1980 agatgaccggaggtcattacgtgcaaatggccatcatcaagttgggggcg ~ cttactggca2040 cctatgtgtataaccatctcacccctcttcgagactgggcgcacaacggcctgcgagatc2100 tggccgtggctgtggaaccagtcgtcttctcccgaatggagaccaagctcatcacgtggg2160 gggcagataccgccgcgtgcggtgacatcatcaacggcttgcccgtctctgcccgtaggg2220 gccaggagatactgcttgggccagccgacggaatggtctccaaggggtggaggttgctgg2280 cgcccatcacggcgtacgcccagcagacgagaggcctcctagggtgtataatcaccagcc2340 tgactggccgggacaaaaaccaagtggagggtgaggtccagatcgtgtcaactgctaccc2400 aaaccttcctggcaacgtgcatcaatggggtatgctggactgtctaccacggggccggaa2460 cgaggaccatcgcatcacccaagggtcctgtcatccagatgtataccaatgtggaccaag2520 accttgtgggctggcccgctcctcaaggttcccgctcattgacaccctgcacctgcggct2580 cctcggacctttacctggtcacgaggcacgccgacgtcattcccgtgcgccggcgaggtg2640 atagcaggggtagcctgcttttgccccggcccatttcctacctaaaaggctcctcggggg2700 gtccgctgttgtgccccgcgggacacgccgtgggcctattcagggccgcggtgtgcaccc2760 gtggagtggccaaggcggtggactttatccctgtggagaacctagagacaaccatgagat2820 ccccggtgttcacggacaactcctctccaccagcagtgccccagagcttccaggtggccc2880 acctgcatgctcccaecggcagtggtaagagcaccaaggtcccggctgcgtacgcagccc2940 agggctacaaggtgttggtgctcaacccctctgttgctgcaacgctgggctttggtgctt3000 acatgtccaaggcccatggggtcgatcctaatatcaggaccggggtgagaacaattacca3060 WO_ 02/088338 PCT / FR02 / 01422 ctggcagccccatcacgtactccacctacggcaagttccttgccgacggcgggtgctcag3120 gaggcgcttatgacataataatttgtgacgagtgccactccacggatgccacatccatct3180 tgggcatcggcactgtccttgaccaagcagagactgcgggggcgagattggttgtgctcg3240 ccactgctacccctccgggctccgtcactgtgtcccatcctaacatcgaggaggttgctc3300 tgtccaccaccggagagatccctttctacggcaaggctatccccctcgaggtgatcaagg3360 ggggaagacatctcatcttctgtcactcaaagaagaagtgcgacgagctcgccgcgaagc3420 tggtcgcattgggcatcaatgccgtggcctactaccgcggacttgacgtgtctgtcatcc3480 cgaccagcggcgatgttgtcgtcgtgtcgaccgatgctctcatgactggctttaccggcg3590 acttcgactctgtgatagactgcaacacgtgtgtcactcagacagtcgatttcagccttg3600 accctacctttaccattgagacaaccacgctcccccaggatgctgtctccaggactcagc3660 gccggggcaggactggcagggggaagccaggcatctacagatttgtggcaccgggggagc3720 gcccctccggcatgttcgactcgtccgtcctctgtgagtgctatgacgcgggctgtgctt3780 ggtatgagctcatgcccgccgagactacagttaggctacgagcgtacatgaacaccccgg3840 ggcttcccgtgtgccaggaccatcttgaattttgggagggcgtctttacgggcctcaccc3900 atatagatgcccactttctatcccagacaaagcagagtggggagaactttccttacctgg3960 tagcgtaccaagccaccgtgtgcgctagggctcaagcccctcccccatcgtgggaccaga4020 tgtggaagtgtttgatccgccttaaacccaccctccatgggccaacacccctgctataca4080 gactgggcgctgttcagaatgaagtcaccctgacgcacccaatcaccaaatacatcatga4140 catgcatgtcggccgacctggaggtcgtcacgagcacctgggtgctcgttggcggcgtcc4200 tggctgctctggccgcgtattgcctgtcaacaggctgcgtggtcatagtgggcaggattg4260 tcttgtccgggaagccggcaattatacctgacagggaggttctctaccaggagttcgatg4320 agatggaagagtgctctcagcacttaccgtacatcgagcaagggatgatgctcgctgagc4380 agttcaagcagaaggccctcggcctcctgcagaccgcgtcccgccatgcagaggttatca9440 cccctgctgtccagaccaactggcagaaactcgaggtcttctgggcgaagcacatgtgga4500 atttcatcagtgggatacaatatttggcgggcctgtcaacgctgcctggtaaccccgcca4560 ttgcttcattgatggcttttacagctgccgtcaccagcccactaaccactggccaaaccc4620 tcctcttcaacatattgggggggtgggtggctgcccagctcgccgcccccggtgccgcta4680 ccgcctttgtgggcgctggcttagctggcgccgccatcggcagcgttggactggggaagg4740 tcctcgtggacattcttgcagggtatggcgcgggcgtggcgggagctcttgtagcattca4800 agatcatgagcggtgaggtcccctccacggaggacctggtcaatctgctacccgccatcc4860 tctcgcctggagcccttgtagtcggtgtggtctgcgcagcaatactgcgccggcacgttg4920 gcccgggcgagggggcagtgcaatggatgaaccggctaatagccttcgcctcccggggga4980 accatgtttcccccacgcactacgtgccggagagcgatgcagccgcccgcgtcactgcca5040 tactcagcagcctcactgtaacccagctcctgaggcgactacatcagtggataagctcgg5100 agtgtaccactccatgctccggctcctggctaagggacatctgggactggatatgcgagg5160 tgctgagcgactttaagacctggctgaaagccaagctcatgccacaactgcctgggattc5220 cctttgtgtcctgccagcgcgggtataggggggtctggcgaggagacggcattatgcaca5280 ctcgctgccactgtggagctgagatcactggacatgtcaaaaacgggacgatgaggatcg5340 tcggtcctaggacctgcaggaacatgtggagtgggacgttccccattaacgcctacacca5400 cgggcccctgtactccccttcctgcgccgaactataagttcgcgctgtggagggtgtctg5460 cagaggaatacgtggagataggcgggtgggggacttccactacgtatcgggtatgacta5520 ctgacaatcttaaatgcccgtgccagatcccatcgcccgaatttttcacagaattggacg5580 gggtgcgcctacataggtttgcgcccccttgcaagcccttgctgcgggag ~ gaggtatcat5690 tcagagtaggactccacgagtacccggtggggtcgcaattaccttgcgag'cccgaaccgg5700 acgtagccgtgttgacgtccatgctcactgatccctcccatataacagcagaggcggccg5760 ggagaaggttggcgagagggtcacccccttctatggccagctcctcggccagccagctgt5820 ccgctccatctctcaaggcaacttgcaccgccaaccatgactcccctgacgccgagctca5880 tagaggctaacctcctgtggaggcaggagatgggcggcaacatcaccagggttgagtcag5990 agaacaaagtggtgattctggactccttcgatccgcttgtggcagaggaggatgagcggg6000 aggtctccgtacccgcagaaattctgcggaagtctcggagattcgcccgggccctgcccg6060 tttgggcgcggccggactacaaccccccgctagtagagacgtggaaaaagcctgactacg6120 aaccacctgtggtccatggctgcccgctaccacctccacggtcccctcctgtgcctccgc6180 ctcggaaaaagcgtacggtggtcctcaccgaatcaaccctacctactgccttggccgagc6240 ttgccaccaaaagttttggcagctcctcaacttccggcattacgggcgacaatatgacaa6300 catcctctgagcccgccccttctggctgcccccccgactccgacgttgagtcctattctt6360 ccatgccccccctggagggggagcctggggatccggatttcagcgacgggtcatggtcga6420 cggtcagtagtggggccgacacggaagatgtcgtgtgctgctcaatgtcttatacctgga6480 caggcgcactcgtcaccccgtgcgctgcggaagaacaaaaactgcccatcaacgcactga6540 gcaactcgttgctacgccatcacaatctggtatattccaccacttcacgcagtgcttgcc6600 aaaggcagaagaaagtcacatttgacagactgcaagttctggacagccattaccaggacg6660 tgctcaaggaggtcaaagcagcggcgtcaaaagtgaaggctaacttgctatccgtagagg6720 aagcttgcagcctgacgcccccacattcagccaaatccaagtttggctatggggcaaaag6780 acgtccgttgccatgccagaaaggccgtagcccacatcaactccgtgtggaaagaccttc6840 tggaagacagtgtaacaccaatagacactatcatcatggccaagaacgaggtcttctgcg6900 ttcagcctgagaaggggggtcgtaagccagctcgtctcatcgtgttccccgacctgggcg6960 tgcgcgtgtgcgagaagatggccctgtacgacgtggttagcaaactccccctggccgtga7020 tgggaagctcctacggattccaatactcaccaggacagcgggttgaattcctcgtgcaag7080 cgtggaagtccaagaagaccccgatggggttcccgtatgatacccgctgttttgactcca7140 cagtcactgagagcgacatccgtacggaggaggcaatttaccaatgttgtgacctggacc7200 cccaagcccgcgtggccatcaagtccctcactgagaggctttatgttgggggccctctta7260 ccaattcaaggggggaaaactgcggctatcgcaggtgccgcgcgagcggcgtactgacaa7320 ctagctgtggtaacaccctcacttgctacatcaaggcccgggcagcccgtcgagccgcag7380 ggctccaggactgcaccatgctcgtgtgtggcgacgacttagtcgttatctgtgaaagtg7440 cgggggtccaggaggacgcggcgagcctgagagcctttacggaggctatgaccaggtact7500 ccgccccccccggggaccccccacaaccagaatacgacttggagcttataacatcatgct7560 cctccaacgtgtcagtcgcccacgacggcgctggaaaaagggtctactaccttacccgtg7620 accctacaacccccctcgcgagagccgcgtgggagacagcaagacacactccagtcaatt7680 cctggctaggcaacataatcatgtttgcccccacactgtgggcgaggatgatactgatga7740 cccatttctttagcgtcctcatagccagggatcagcttgaacaggctcttaactgtgaga7800 tctacgcagcctgctactccatagaaccactggatctacctccaatcattcaaagactcc7860 atggcctcagcgcattttcactccacagttactctccaggtgaagtcaatagggtggccg7920 catgcctcagaaaacttggggtcccgcccttgcgagcttggagacaccgggcccggagcg7980 tccgcgctaggcttctgtccaggggaggcagggctgccatatgtggcaagtacctcttca8040 actgggcagtaagaacaaagctcaaactcactccaatagcggccgctggccggctggact8100 tgtccggttggttcacggctggctacagcgggggagacatttatcacagcgtgtctcatg8160 cccggccccgctggttctggttttgcctactcctgctcgctgcaggggtaggcatctacc8220 tcctccccaaccggtgacatttccctttttttttttttttttttttttcccttttttttt8280 ttttttttttttttttttttttttttttttccttttccttcttttttccctttctcttcc8340 tcccttctttaatggtggctccatcttagccctagtcacggctagctgtgaaaggtccgt8400 gagccgcatgactgcagagagtgctgatactggcctctctgcagatcatgt 8451

Claims (23)

1. Use of cells capable of carrying out a process of prenylation of proteins encoded by the hepatitis C virus (HCV) genome, such as prenylation of the NSSA protein, for the replication and, if necessary, the production of the HCV or derived viable mutants, in an appropriate culture medium. 2. Use according to claim 1, of mammalian cells, in particular monkey kidney cells, also called Vero cells. 3. Use according to one of claims 1 to 2, of Vero cells transformed by a gene for resistance to an antibiotic, such as neomycin, in particular Vero/G418 cells. 4. Use according to one of claims 1 to 3, of cells, such as them Vero cells, where appropriate transformed by a gene for resistance to a antibiotic, such as neomycin, said cells being transformed with an acid nucleic containing all or part of the HCV genome or HCV-derived mutants. 5. Use according to claim 4, characterized in that the acid nucleic is chosen from:

- those coding for the structural and non-structural proteins of HCV or - those coding for the non-structural proteins of HCV or - replicons containing a gene for resistance to an antibiotic, in particular hygromycin B, and a nucleotide sequence coding for the proteins not structures of HCV. 6. Use according to claim 4 or 5, characterized in that the cells are transformed by a nucleic acid chosen from the sequences nucleotides SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. 7. Use according to one of claims 1 to 6, for replication, and the case applicable, the production of HCV type 1a. 8. Use according to one of claims 1 to 7, of cells such as filed with the CNCM on April 13, 2001 under numbers I-2658 and I-2659. 9. Nucleotide sequence characterized in that it comprises or is consisting of SEQ ID NO: 1. 10. Nucleotide sequence characterized in that it comprises or is consisting of SEQ ID NO: 3. 11. Recombinant vector, in particular plasmid, cosmid, phage or DNA of virus, containing a nucleotide sequence according to claim 9 or 10. 12. Host cell, chosen in particular from bacteria, viruses, yeasts, fungi, plants or mammalian cells, said cell host being transformed, using a recombinant vector according to claim 11. 13. Transformed cell consisting of a Vero/G418 cell, comprising a nucleic acid chosen from - those coding for the structural and non-structural proteins of HCV or - those coding for the non-structural proteins of HCV or - replicons containing a gene for resistance to an antibiotic, in particular hygromycin B, and a nucleotide sequence coding for the proteins not structures of HCV. 14. Cell according to claim 13, consisting of a Vero/G418 cell comprising a replicon consisting of a nucleic acid chosen from those containing a gene for resistance to an antibiotic, such as hygromycin B, and a sequence nucleotide coding for the non-structural proteins of HCV, namely NS2, NS3, NS4A, NS4B, NS5A and NS5B. 15. Cell according to one of claims 13 or 14, such as the cell Vero/G418 filed with the CNCM on April 13, 2001 under number I-2659. 16. Cell according to one of claims 13 to 15, such as the cell Vero/G418, comprising a nucleic acid containing a resistance gene to a antibiotic, such as hygromycin B, and a nucleotide sequence encoding for the non-structural proteins of HCV, and deposited at the CNCM on April 13, 2001 under the number I-2658. 17. Cell according to one of claims 13 to 16, consisting of a cell Vero/G418 comprising a nucleic acid containing a resistance gene to a antibiotic, in particular hygromycin B, and a nucleotide sequence encoding for non-structural proteins, and having the property of replicating HCV to a concentration of antibiotic, especially hygromycin B, from 800 to 1000 µg/ml. 18. Process for producing hepatitis C virus, which includes infection of Vero/G418 cells, in particular Vero/G418 cells as deposited at the CNCM
on April 13, 2001 under the number I-2659, by the hepatitis C virus and the culturing under appropriate conditions of these infected cells. 19. Hepatitis C virus replication process by transformation of Vero/G418 cells either with a nucleic acid as defined in the claim 9 or 10, either with a nucleic acid characterized in that it comprises or is consisting of SEQ ID NO: 2, and in particular by transformation of Vero/G418 cells such that filed on April 13, 2001 with the CNCM under number I-2659, to obtain cells Véro/G418 transformed, in particular those filed on April 13, 2001 with the CNCM
under the number I-2658, and by culturing these transformed cells in appropriate conditions. 20. Process for the production of hepatitis C virus by transformation of Vero/G418 cells, in particular Vero/G418 cells as filed on 13 april 2001 at the CNCM under the number I-2659, with a nucleic acid coding for the structural and non-structural proteins of HCV, by culturing in of the appropriate conditions of Vero/G418 transformed cells and recovery of the HCV virus particles. 21. A method for screening anti-HCV agents, which comprises the following steps - bringing the compound tested for its anti-HCV properties into contact with transformed cells, consisting of Vero/G418 cells, comprising a acid nucleic acid chosen from:
.cndot. those encoding HCV structural and non-structural proteins Where .cndot. those encoding non-structural proteins of HCV or .cndot. replicons containing an antibiotic resistance gene, in particular hygromycin B, and a nucleotide sequence coding for HCV non-structural proteins, and in particular with cells as deposited on April 13, 2001 at the CNCM
under the number I-2658, - the extraction of total RNA on said cells, and - analysis of the possible decrease in the rate of synthesis of HCV RNA
of said cells with respect to a control value corresponding to the rates of synthesis of HCV RNA from cells in the absence of said test compound. 22. Process for the preparation of Vero/G418 cells comprising an acid nucleic acid chosen from - those coding for the structural and non-structural proteins of HCV or - those coding for the non-structural proteins of HCV or - the replicons containing a gene for resistance to hygromycin B and a nucleotide sequence coding for HCV non-structural proteins, said method comprising the following steps:
* the insertion of one of the nucleotide sequences according to one of the claims 9 to 11 in the Vero/G418 cells, * subjecting the cells thus obtained to concentrations of hygromycin B increasing, in particular from 800 to 1000 µg/ml. 23. Cells as obtained by implementing the method according to claim 22.