CA2432346A1 - Genome-wide location and function of dna binding proteins - Google Patents

Genome-wide location and function of dna binding proteins Download PDF

Info

Publication number
CA2432346A1
CA2432346A1 CA002432346A CA2432346A CA2432346A1 CA 2432346 A1 CA2432346 A1 CA 2432346A1 CA 002432346 A CA002432346 A CA 002432346A CA 2432346 A CA2432346 A CA 2432346A CA 2432346 A1 CA2432346 A1 CA 2432346A1
Authority
CA
Canada
Prior art keywords
dna
cell
protein
genes
interest
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002432346A
Other languages
French (fr)
Inventor
John Wyrick
Richard A. Young
Bing Ren
Francois Robert
Itamar Simon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Whitehead Institute for Biomedical Research
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2432346A1 publication Critical patent/CA2432346A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection

Abstract

The present invention relates to a method of identifying a region (one or more) of a genome of a cell to which a protein of interest binds. In the methods described herein, DNA binding protein of a cell is linked (e.g., covalently crosslinked) to genomic DNA of a cell. The genomic DNA to which the DNA binding protein is linked is removed and combined or contacted with DNA
comprising a sequence complementary to genomic DNA of the cell under conditions in which hybridization between the identified genomic DNA and the sequence complementary to genomic DNA occurs. Region(s) of hybridization are region(s) of the genome of the cell to which the protein of binds. A method of identifying a set of genes where cell cycle regulator binding correlates with gene expression and of identifying genomic targets of cell cycle transcription activators in living cells is also encompassed.

Description

Genome-Wide Location and Function of DNA Binding Proteins RELATED APPLICATIONS) This application is a continuation-in-part of U.S. Application No.
09/654,409, filed September 1, 2000, which claims the benefit of U.S.
Provisional Application No. 60/151,972, filed on September 1, 1999. This application also claims the benefit of U.S. Provisional Application No. 60/257,455, filed on December 21, 2000 and U.S. Provisional Application No. 60/323,620, filed September 20, 2001.
The entire teachings of the above applications) are incorporated herein by reference.
GOVERNMENT SUPPORT
The invention was supported, in whole or in part, by a grant GM34365 from the National Institutes of Health. The Government has certain rights in the invention.

Many proteins involved in regulating genome expression, chromosomal replication and cellular proliferation function through their ability to bind specific sites in the genome. Transcriptional activators, for example, bind to specific promoter sequences and recruit chromatin modifying complexes and the transcription apparatus to initiate RNA synthesis. The remodeling of gene expression that occurs as cells move through the cell cycle, or when cells sense changes in their environment, is effected in part by changes in the DNA-binding status of transcriptional activators. Distinct DNA-binding proteins are also associated with centromeres, telomeres, and origins of DNA replication, where they regulate chromosome replication and maintenance. Although considerable knowledge of many fundamental aspects of gene expression and DNA replication has been obtained from studies of DNA-binding proteins, an understanding of these proteins and their functions is limited by our knowledge of their binding sites in the genome.
In addition, regulation of the cell cycle clock is effected through a controlled program of gene expression and oscillations in the activity of the cyclin-dependent (CDK) family of protein kinases. Much is known about the control of stage-specific functions by CDKs and their regulators during the cell cycle (Mendenhall and Hodge, 1998; Morgan, 1997; Nurse, 2000). A more complete understanding of cell cycle regulation is constrained, however, by our limited knowledge of the transcriptional regulatory network that controls the clock. Additional knowledge of cell cycle regulation would make it clearer how the transcriptional and post-transcriptional regulatory networks that control the complex and highly regulated processes are involved in the cell cycle and make it possible to produce a genetic/regulatory network map and to not only identify steps in the pathway, but also connect the cell cycle with other cellular functions.
Proteins which bind to a particular region of DNA can be detected using known methods. However, a need exists for a method which allows examination of the binding of proteins to DNA across the entire genome of an organism.
SUMMARY OF THE INVENTION
The present invention relates to a method of identifying a region (one or more) of a genome of a cell to which a protein of interest binds. In the methods 2~ described herein, DNA binding protein of a cell is linked (e.g., covalently crosslinked) to genomic DNA of a cell. The genomic DNA to which the DNA
binding protein is linked is identified and combined or contacted with DNA
comprising a sequence complementary to genomic DNA of the cell (e.g., all or a portion of a cell's genomic DNA such as one or more chromosome or chromosome region) under conditions in which hybridization between the identified genomic DNA and the sequence complementary to genomic DNA occurs. Regions) of hybridization are regions) of the genome of the cell to which the protein of interest binds. The methods of the present invention are preferably performed using living cells.
In one embodiment, proteins which bind DNA in a cell are crosslinked to the cellular DNA. The resulting mixture, which includes DNA bound by protein and DNA which is not bound by protein is subject to shearing conditions. As a result, DNA fragments of the genome crosslinked to DNA binding protein are generated and the DNA fragment (one or more) to which the protein of interest is bound is removed from the mixture. The resulting DNA fragment is then separated from the protein of interest and amplified, using known methods. The DNA fragment is combined with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs; and the region of the sequence complementary to genomic DNA to which the DNA fragment hybridizes is identified. The identified region (one or more) is a region of the genome of the cell, such as a selected chromosome or chromosomes, to which the protein ofinterest binds.
In a particular embodiment, the present invention relates to a method of identifying a region of a genome (such as a region of a chromosome) of a cell (test sample) to which a protein of interest binds, wherein the DNA binding protein of the cell is crosslinked to genomic DNA of the cell using formaldehyde. DNA
fragments of the crosslinked genome are generated and the DNA fragment to which the protein of interest is bound is removed or separated from the mixture, such as through immunoprecipitation using an antibody that specifically binds the protein of interest.
This results in separation of the DNA-protein complex. The DNA fragment in the complex is separated from the protein of interest, for example, by subjecting the complex to conditions which reverse the crosslinks. The separated DNA fragment is amplified (e.g., non-specifically) using ligation-mediated polymerase chain reaction (LM-PCR), and then fluorescently labeled. The labeled DNA fragment is contacted with a DNA microarray comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs. The region of the sequence complementary to genomic DNA to which the DNA fragment hybridizes is identified by measuring fluorescence intensity, and the fluorescence intensity of the region of the sequence complementary to genomic DNA to which the DNA fragment hybridizes is compared to the fluorescence intensity of a control.
Fluorescence intensity in a region of the sequence complementary to genomic DNA which is greater than the fluorescence intensity of the control in that region of the sequence complementary to genomic DNA marks the region of the genome in the cell to which the protein of interest binds.
Also encompassed by the present invention is a method of determining a function of a protein of interest which binds to the genomic DNA of a cell. In this method, DNA binding protein of the cell is crosslinked to the genomic DNA of the cell. DNA fragments of the genome crosslinked to DNA binding protein are then generated, as described above, and the DNA fragment (one or more) to which the protein of interest is bound is removed from the mixture. The resulting DNA
fragment is then separated from the protein of interest and amplified. The DNA
fragment is combined with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA
fragment and a region of the sequence complementary to genomic DNA occurs; and the region of the sequence complementary to genomic DNA to which the DNA
fragment hybridizes is identified. This identified region is a region of the genome of the cell to which the protein of interest binds. The identified region is characterized and the characteristic of the identified region indicates the function of the protein of interest (e.g., a regulatory protein such as a transcription factor; an oncoprotein).
The present invention also relates to a method of determining whether a protein of interest which binds to genomic DNA of a cell functions as a transcription factor. In one embodiment, DNA binding protein of the cell is crosslinked to the genomic DNA of the cell. DNA fragments of the crosslinked genome are generated and the DNA fragment to which the protein of interest is bound is removed from the mixture. The resulting DNA fragment is separated from the protein of interest and amplified. The DNA fragment is combined with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs. The region of the sequence complementary to genomic DNA to which the DNA fragments hybridizes is identified; wherein if the region of the genome is a regulatory region, then the protein of interest is a transcription factor.
The present invention also relates to a method of identifying a set of genes, the members of which are genes for which cell cycle regulator binding correlates with gene expression. The method comprises identifying a set of genes that is bound in vivo by at least one cell cycle regulator (e.g., transcriptional activator) in a selected cell type (e.g., mammalian cell, yeast cell); comparing the set of genes identified with genes whose expression levels vary in a periodic manner during the cell cycle of the selected cell type; and identifying genes that are bound by one or more of the cell cycle regulators, thus identifying a set of genes, the members of which are genes whose expression levels vary in a periodic manner during the cell cycle and are bound by at least one cell cycle regulator, wherein the set identified is referred to as a set of genes, the members of which are genes for which cell cycle regulator binding correlates with gene expression.
The methods described herein facilitate the dissection of the cells regulatory network of gene expression across the entire genome and aid in the identification of gene function. Work described herein provides the basis for constructing a complete map of the transcriptional regulatory network that controls the cell cycle. In one embodiment, it forms the foundation for a complete map of the transcriptional regulatory network that controls the yeast cell cycle.
BRIEF DESCRIPTION OF THE DRAWINGS
The file of this patent contains at least one drawing executed in color.
Copies of this patent with color drawings) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
Figure 1 is an illustration of the Genome-wide Monitoring Protein-DNA
interactions described herein.
Figure 2 shows how the relative binding of the protein of interest to each sequence represented on an array was calculated using a weighted average analysis.
Figure 3 is a graph of chromosomal position versus fold change of Genome wide Monitoring Protein-DNA interactions.
Figure 4 is a graph of chromosome position versus ratio of tagged to untagged for binding of ORC1 to yeast chromosome III.
Figure SA is an example of a scanned image. The unenriched and IP
enriched DNA generates green fluorescence and red fluorescence respectively.
The close-up image shows examples of spots for which the red intensity is over-represented, indicating binding of the targeted protein to these DNA
sequences.
Figure 5B show that small amounts of DNA can be quantitatively amplified and labeled with Cy3 and Cy5 fluorophores. Cy3- and Cy5-labeled DNA from 1 ng of yeast genomic DNA was prepared using the LM-PCR method described in the text. The resulting DNA samples were mixed and hybridized to a yeast intragenic DNA microarray. Low intensity spots have larger variations than high intensity spots, probably due to background noise.
Figure 6A shows the set of 24 genes whose promoter regions are most likely to be bound by Gal4 by the analysis criteria described herein.
Figure 6B is a schematic of the Gal4 binding intergenic regions.
Figure 6C shows the results of conventional ChIP analysis.
Figure 6D shows the results of the AlignAce program used to identify a consensus binding site for the Gal4 activator.
Figure 6E is a bar graph showing relative expression of PLC10 and MTHI .
Figure 6F is a schematic illustrating how the identification of MTH1 and MTH, PCL10 and FUR4 as Gal4-regulated genes reveals how several different metabolic pathways are interconnected.
Figure 6G contains three graphs showing galactose-induced expression of FUR4, MTHl and PLC10 is GAL4-dependent; samples from wild-type and gal4-strains were taken before and after addition of galactose. The expression of FUR4, MTH l and PLC 10 was monitored by quantitative reverse transcriptase-PCR (RT-PCR) ans was quantified by phosphoimaging.
Figure 7 lists the set of genes whose promoter regions are most likely to be bound by Stel 12 by the analysis criteria described herein.
Figure 8 is a schematic of a model summarizing the role of Ste12 target genes in the yeast mating pathway. Gray boxes denote the cellular processes known to be involved in mating; yellow boxes denote cellular processes that are likely associated with mating. Genes in black were previously reported to be associated with the mating process; genes in red are Ste12 targets that likely play a role in mating.
Figures 9A-9C show the cell cycle transcriptional regulators study design.
Figure 9A depicts the stages of the cell cycle together with yeast cell morphology, (brown) and transcriptional regulators (blue); the transcriptional regulators are positioned at the stage during which they have been reported to function (Breedon et al., Curr. Biol., IO:R586-R588(2000), Mendenhall et al., Mol.
Biol. Rev., 62:1191-1243 (1998)).
Figure 9B is a scatter plot of Cy5 versus Cy3 intensities for a control experiment in which aliquots of whole cell extract (WCE) were independently labeled with Cy3 and Cy5 and hybridized to a DNA microarray containing all yeast intergenic regions. The red and blue lines border the regions with confidence levels of p<O,p01 and p<0.01, respectively.
Figure 9C is a scatter plot of an experiments in which the Fkh2 IP-enriched DNA was labeled with Cy5 and the WCE was labeled with Cy3. The red and blue lines border the regions with confidence levels of p<0.001 and p<0.01, respectively.
The cpols whose values have confidence levels of p<0.001 represent promoters most likely bound by the Fkh2 factor.
Figures 10A-1 OB show genome-wide location of the nine cell cycle transcription factors.
Figure 10A show the 213 of the 800 cell cycle genes whose promoter regions were bound by a myc-tagged version of at least one of the nine cell cycle transcription factors (p<0.001) are represented as horizontal lines. The weight-_g_ averaged binding ratios are displayed using a blue and white color scheme (genes with p values <0.001 are displayed in blue). The expression ratios of an a factor synchronization time course from Spellman et al., Mol. Cell Biol. Cell, 9:

(1998) are displayed using a red (induced) and green (repressed) color scheme.
Figure l OB is a schematic in which the circle represents a smoothed distribution of the transcription timing (phase) of the 800 cell cycle genes (Spellman et al., Mol. Cell Biol. Cell, 9: 3273-3297 (1998)). The intensity of the red color, normalized by the maximum intensity value for each factor, represents the fraction of genes expressed at that point that are bound by a specific activator. The similarity in the distribution of color for specific factors (with Swi4, Swi6, and Mbpl, for example) shows that these factors bind to genes that are expressed during the same time frame.
Figures 1 lA-11B are schematics showing transcriptional regulation of cell cycle transcription factor genes.
Figure 11 A shows a summary of previous evidence for regulation of cell cycle transcription factor genes and CLN3 transcriptional regulators (Althoefer et al., Mol. Cell Biol., IS: 5917-5928 (1998); Foster et al. Mol. Cell Biol., 13:3792-3801 (1993); Koranda et al., Nature, 406:94-98 (2000); Kumar et al. Curr.
Biol., 10: 896-906 (2000); Kuo et al., Mol. Cell Biol., l4: 3348-359 (1994); Loy et al. Mol.
Cell Biol., 19: 3312-3327 (1999); Mackay et al. Mol. Cell Biol., 21:4140-4148 (200I); McInerny et al. Genes Dev., 11:1277-1288 (1997); Pic et al. Embo J., 19:3750-3761 (2000); Zhu et al. Nature, 406: 90-94 (2000)). The relationships between the transcription factors and their target genes are indicated by red arrows;
solid lines represent evidence for direct regulation by these factors; and dashed lines represent inferences from indirect evidence. The blue arrows represent posttranscriptional regulation by Cln3/Cdc28 (Dirick et al. Embo. .L, 14:4803-( 1995)).
Figure 11B is a model for the closed regulatory circuit produced by cell cycle transcriptional regulators based on genome-wide binding data. The genome-wide location data indicate that each group of transcriptional activators regulates activators acting in the next cell cycle stage. The red arrows represent binding of a transcription factor to the promoter of another regulatory factor. The blue arrows represent posttranslational regulation.
Figures 12A-12B are schematics showing transcriptional regulation of cyclin and cyclin/CDK regulator genes.
Figure 12A shows a summary of previous evidence for transcriptional regulation of genes encoding the cyclins (green) and cyclin/CDK regulators (red) by the cell cycle transcription factors (Althoefer et al. Mol. Cell Biol., 1 S:

(1998); Dirick et al. Nature, 357: 508-513 (1992); Hollenhorst et al.
Genetics, 154:1533-1548 (2000); Iyer et al. Nature, 409: 533-536 (2001); Knapp et al.
Mol.
Cell Biol., 16: 5701-5707 (1998); Koch et al. Science, 261:1551-1557 (1993);
Koranda et al. Science, 261:1551-1557 (1993); Kumar et al. Curr. Biol., 10:

906 (2000); Kuo et al., Mol. Cell Biol.,14:3348-359 (1994); Loy et al. Mol.
Cell Baol., 19: 3312-3327 (1999); Mackay et al. Mol. Cell Biol., 21:4140-4148 (2001);
McBride et al. J. Biol. Chem., 274:21029-21036 (1999); Mclnerny et al. Genes Dev., 11:1277-1288 (1997); Nasmyth et al. Genes Dev., 11:1277-1288 (1997);
Oehlen et al. Mol. Cell Biol., 16:2830-2837 (1996); Ogas et al. Cell, 66:1015-(1991); Partridge et al. J. Biol. Chem., 272:9071-9077 (1997); Pic et al. Embo J., 19: 3750-3761 (2000); Schwab et al. Genes Dev., 7:1160-1175 (1993); Toyn et al.
Genetics, 145:85-96 (1997); Zhu et al. Nature, 406:90-94 (2000)). The factors, as well as their targets, are positioned according to their approximate time of function.
The relationships between the transcription factors and their target genes are indicated by aiTOws, solid lines represent evidence for direct regulation by these factors, and dashed lines represent inferences from indirect evidence.
Figure 12B is a model for transcriptional regulation of cyclin and cyclin/CDK regulators based on previous studies and on genome-wide binding data.
Each group of transcription factors regulates key cell cycle regulators that are needed for progression through the cell cycle.
Figure 13 is a schematic of the regulation of cell cycle functions by the activators. Stage-specific cell cycle functions under the control of specific factors are shown. The budding category include genes involved in budding and in cell wall biogenesis; the DNA replication category includes genes involved in replication, repair, and sister chromatid cohesion; the chromatin category includes genes encoding histones, chromatin modifiers, and telomere length regulators. The identity and functions of genes in each category are listed in Table 3.
Figures 14A-14C are diagrams showing partial redundancy between S homologous activators.
Figure 14A are Venn diagrams depicting the overlap between the targets of pairs of homologous cell cycle transcriptional regulatory proteins. The numbers in parenthesis under each activator represent the sum of cell cycle genes whose promoters were bound by the protein. The number in the intersection between two circles reflects the numbers of genes whose promoters were bound by both proteins.
Figure 14B are Venn diagrams representing the overlap in target sites between pairs of regulatory proteins that reside within the same complex.
Figure 14C is a Venn diagram representing the overlap in target sites between two transcriptional regulators that are not known to be related.

Understanding how DNA-binding proteins control global gene expression, chromosomal replication and cellular proliferation would be facilitated by identification of the chromosomal locations at which these proteins function in vivo.
Described herein is a genome-wide location profiling method for DNA-bound proteins, which has been used to monitor dynamic binding of gene-specific transcription factors and components of the general transcription apparatus in yeast cells. The genome-wide location method correctly identified known sites of action for the transcriptional activators Gal4 and Stel2 and revealed unexpected functions for these activators. The combination of expression and location profiles identified the global set of genes whose expression is under the direct control of specific activators and components of the transcription apparatus as cells responded to changes in their extracellular environment. Genome-wide location analysis provides a powerful tool for further dissecting gene regulatory networks, annotating gene functions and exploring how genomes are replicated.

Accordingly, the present invention provides methods of examining the binding of proteins to DNA across the genome (e.g., the entire genome or a portion thereof, such as one or more chromosomes or a chromosome regions) of an organism. In particular, the present invention relates to a method of identifying a S region (one or more) of genomic DNA of a cell to which a protein of interest binds.
In one embodiment, proteins which bind DNA in a cell are crosslinked to the cellular DNA. The resulting mixture, which includes DNA bound by protein and DNA which is not bound by protein is subject to shearing conditions. As a result, DNA fragments of the genome crosslinked to DNA binding protein are generated and the DNA fragment (one or more) to which the protein of interest is bound is removed from the mixture. The resulting DNA fragments are then separated from the protein of interest and amplified using known techniques. The DNA fragment is then combined with DNA comprising a sequence complementary to genomic DNA
of the cell, under conditions in which hybridization between the DNA fragments and the sequence complementary to genomic DNA occurs; and the region of the sequence complementary to genomic DNA to which the DNA fragment hybridizes is identified. The identified region is a region of the genome of the cell to which the protein of interest binds.
Also encompassed by the present invention is a method of determining a function of a protein of interest which binds to the genomic DNA of a cell. In this method, DNA binding protein of the cell is crosslinked to the genomic DNA of the cell. DNA fragments of the genome crosslinked to DNA binding protein are then generated, as described above, and the DNA fragment (one or more) to which the protein of interest is bound is removed. The resulting DNA fragment is then separated from the protein of interest and amplified. The DNA fragment is then combined with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs; and the region of the sequence complementary to genomic DNA to which the DNA fragment hybridizes is identified and is a region of the genome of the cell to which the protein of interest binds. The identified region is characterized (e.g., a regulatory region) and the characteristic of the identified region indicates a function of the protein of interest (e.g., a transcription factor; an oncoprotein).
The present invention also relates to a method of determining whether a protein of interest which binds to genomic DNA of a cell functions as a transcription factor. In one embodiment, DNA binding protein of the cell is crosslinked to genomic DNA of the cell and DNA fragments of the crosslinked genome are generated. The DNA fragment to which the protein of interest is bound are removed. The resulting DNA fragment is separated from the protein of interest and amplified. The DNA fragment is combined with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragments and sequence complementary to genomic DNA occurs. The region of the sequence complementary to genomic DNA to which the DNA fragments hybridizes is identified wherein if the region of the genome is a regulatory region, then the protein of interest is a transcription factor.
The methods of the present invention can be used to examine and/or identify DNA binding of proteins across the entire genome of a eukaryotic organism. For example, DNA binding proteins across the entire genome of eukaryotic organisms such as yeast, Drosophila and humans can be analyzed. Alternatively, they can be used to examine and/or identify DNA binding of proteins to an entire chromosome or set of chromosomes of interest.
As also described herein, genome-wide location analysis has been used to identify the in vivo genome binding sites for cell cycle transcription factors, in particular genome binding sites for each of the known yeast cell cycle transcription factors. Such analysis is useful to identify genome binding sites (genomic targets) of cell cycle regulators (transcriptional activators) in a variety of cell types and, as also described herein, has resulted in identification of genomic targets of each of the nine known yeast cell cycle transcription activators. One embodiment of the present invention is a method of identifying genes that are expressed in a periodic manner during the cell cycle of a selected cell type and are bound by a cell cycle regulators) or cell cycle transcription factors, also referred to transcription(al) regulators/activators. The method is, thus, one of identifying a set of genes where cell cycle factor binding correlates with gene expression. In the method, a set of genes whose factor binding correlates with gene expression at a selected level of stringency of the analysis criteria for binding data is identified. For example, the stringency of the analysis criteria for binding data can be p<0.001, p<0.01, p<0.05 or another selected level and preferably will be selected at such a level that few or no false positives are detected. Cell cycle regulators can be identified by the method of the present invention in a wide variety of cell types (referred to as selected cell types, such as eukaryotic (mammalian, nonmammalian) cells, including human and nonhuman cells (including, but not limited to, yeast and other fungi, worm, fly, avian, murine, canine, bovine, feline, equine, and nonhuman primate cells).
The method is carried out, in one embodiment, by identifying a set of genes that is bound in vivo by a cell cycle regulators) or transciption factors) in a selected cell type (e.g., from a particular organism, which can be human or nonhuman, such as those listed above); comparing that set of genes with genes whose expression levels vary in a periodic manner during the cell cycle of that organism; and identifying genes that are bound by one or more of the cell cycle regulators (identifying genes whose factor binding correlates with gene expression), thus identifying genes whose expression levels vary in a periodic manner during the cell cycle and are bound a cell cycle factor(s). Genes identified in this manner can be characterized, as described herein.
As described herein, a set of yeast genes for which factor binding correlates with gene expression has been identified by comparing the set of genes bound by the nine cell cycle transcription factors with the approximately 800 genes whose expression levels vary in a periodic fashion during the yeast cell cycle.
Those genes whose promoters are bound by one or more of the nine transcription factors, particularly those identified with reference to the highest stringency criteria as described herein (highest stringency of analysis criteria for binding data), were investigated and characterized.
Results of work described herein generally support the model for stage-specific regulation of gene expression, described by others, by these activators and extend it to encompass promoters for several hundred cell cycle genes;
confirmed results of earlier studies, which established that genes encoding several of the cell cycle transcriptional regulators are themselves bound by other cell cycle functions;
revealed that cell cycle transcriptional control is effected by a connected regulatory network of transcriptional activators; and identified a set of promoters bound in vivo by each of the cell cycle regulators, which were further analyzed and shown to comprise consensus binding sequence motifs (see Table 2).
A variety of proteins which bind to DNA can be analyzed. For example, any protein involved in DNA replication such as a transcription factor, or an oncoprotein can be examined in the methods of the present invention.
There are a variety of methods which can be used to link DNA binding protein of the cell to the genome of the cell. For example, UV light can be used. In a particular embodiment, formaldehyde is used to crosslink DNA binding proteins to the genomic DNA of a cell.
W the methods of the present invention, identification of DNA fragments 1 ~ bound to the protein of interest can be removed from the mixture comprising DNA
fragments) bound to the protein of interest and DNA fragments which are not bound to the protein of interest, using a variety of methods. For example, immunoprecipitation using an antibody (e.g., polyclonal, monoclonal) or antigen binding fragment thereof which binds (specifically) to the protein of interest, can be used. In addition, the protein of interest can be labeled or tagged using, for example, an antibody epitope (e.g., hemagglutinin (HA)).
The DNA fragments in the methods described herein can be amplified using any suitable method. In one embodiment, the DNA is amplified using a non-specific amplification method. For example, ligation-mediated polymerase chain reaction (e.g., see Current Protocols in Molecular Biology, Ausubel, F.M. et al., eds.
1991, the teachings of which are incorporated herein by reference) can be used.
Thus, the present invention provides a method for non-specifically amplifying DNA
fragments from the entire genome of a cell. As shown herein, non-specific amplification can be used without increasing the signal-to-noise ratio. The ability to non-specifically amplify DNA fragments from an entire genome of a cell constitutes a important distinction over other techniques, such as the ChIP technique which relies upon specific primer-based amplification.
In one embodiment, the amplified DNA can be labeled (e.g., a radioactive label, a non-radioactive label such as a fluorescent label) to facilitate identification.
S In one embodiment, the DNA is labeled using a fluorescent dye, such as Cy5 or Cy3.
The DNA comprising the complement sequence of the genome of the cell can be combined with the isolated DNA fragment to which the protein of interest binds using a variety of methods. For example, the complement sequence can be immobilized on a glass slide (e.g., microarray such as the Corning Microarray Technology (CMTTM) GAPSTM) or on a microchip. In one embodiment, a glass slide is used which can accommodate an entire genome of a cell (e.g., at least about spots (DNA)). Conditions of hybridization used in the methods of the present invention include, for example, high stringency conditions and/or moderate stringency conditions. See e.g., pages 2.10.1-2.10.16 (see particularly 2.10.8-11 ) and pages 6.3.1-6 in Current Protocols in Molecular Biology). Factors such as probe length, base composition, percent mismatch between the hybridizing sequences, temperature and ionic strength influence the stability of hybridization.
Thus, high or moderate stringency conditions can be determined empirically, and depend in part upon the characteristics of the known nucleic acids (DNA, RNA) and the other nucleic acids to be assessed for hybridization thereto.
The methods of the present invention can further comprise comparing the results to a control (control sample). For example, in one embodiment, the methods of the present invention can be carned out using a control protein which is not a DNA binding protein. In one embodiment, immunoprecipitation is perfornled using an antibody against an HA or MYC epitope tag. The results of immunoprecipitating the protein of interest containing the tag, and the protein of interest without the tag are compared. The untagged protein should not be immunoprecipitated, and thus, serves as a negative control. Using the methods of the present invention also provides for the ability to compare the sample with the control sample simultaneously. Generally, a test sample if hybridized to an array and compared to a control sample which has been hybridized to a different array and a ratios is calculated to determine binding results. Using the methods described herein, two samples (e.g., a test sample and a control sample) can be hybridized to the same array which allows for elimination of noise due to the use of two arrays (e.g., an array for the test sample and another array for the control sample). The difference between arrays due to manufacturing artifacts is a major source of noise, which can be eliminated using the methods described herein.
As described in the exemplification, a particular embodiment of the present invention comprises the combined use of Chromatin Immunoprecipitation (ChIP) and Genome-wide expression monitoring microarrays. Chromatin immunoprecipitation allows the detection of proteins that are bound to a particular region of DNA. It involves four steps: (1) formaldehyde cross-linking proteins to DNA in living cells, (2) disrupting and then sonicating the cells to yield small fragments of cross-linked DNA, (3) immunoprecipitating the protein-DNA
crosslinks using an antibody which specifically binds the protein of interest, and (4) 1 ~ reversing the crosslinks and amplifying the DNA region of interest using the Polymerise Chain Reaction (PCR). Analysis of the PCR product yield compared to a non-immunoprecipitated control determines whether the protein of interest binds to the DNA region tested. However, each region of DNA must be tested individually by PCR. Thus, the ChIP technique is limited to the small set of DNA
regions that are chosen to be tested.
In contrast, the present method is not limited to amplifying individual DNA
regions by performing PCR with specific primers. Rather the entire genome (test sample) is amplified (e.g., non-specifically) using a Ligation-mediated PCR
(LMPCR) strategy. The amplified DNA was fluorescently labeled by including fluorescently-tagged nucleotides in the LM-PCR reaction. Finally, the labeled DNA
was hybridized to a DNA microarray containing spots representing all or a subset (e.g., a chromosome or chromosomes) of the genome. The fluorescent intensity of each spot on the microarray relative to a non-immunoprecipitated control demonstrated whether the protein of interest bound to the DNA region located at that particular spot. Hence, the methods described herein allow the detection of protein-DNA interactions across the entire genome.

In particular, DNA microarrays consisting of most of yeast chromosome ITI
plus approximately 15 model genes whose expression have been well studied were constructed. These arrays were used in conjunction with the ChIP technique to study the DNA-binding properties of transcription factors and the transcription apparatus genome-wide. The methods described herein provide insights into the mechanism and regulation of gene expression in eukaryotic cells.
The genome-wide location analysis method described herein allows protein--DNA interactions to be monitored across the entire yeast genome and is diagramed in Figure 1. The method combines a modified Chromatin Immuno~recipitation (ChIP) procedure, which has been previously used to study in vivo protein-DNA
interactions at one or a small number of specific DNA sites, with DNA
microarray analysis. Briefly, cells are fixed with formaldehyde, harvested by sonication, and DNA fragments that are crosslinked to a protein of interest are enriched by immunoprecipitation with a specific antibody. After reversal of the crosslinking, the enriched DNA is amplified and labeled with a fluorescent dye (e.g., Cy5) using ligation-mediated PCR (LM-PCR). A sample of DNA that has not been enriched by immunoprecipitation is subjected to LM-PCR in the presence of a different fluorophore (e.g., Cy3), and both immunoprecipitation (IP)-enriched and unenriched pools of labeled-DNA are hybridized to a single DNA microarray containing all yeast intergenic sequences. A single-array error model (Roberts, et al., Science,287:972 (2000)) was adopted to handle noise associated with low-intensity spots and to permit a confidence estimate for binding (P value). When independent samples of 1 ng of genomic DNA was amplified with the LM-PCR method, signals for greater than 99.8% of genes were essentially identical within the error range (P
value s 10-3). The IP-enriched/unenriched ratio of fluorescence intensity obtained from three independent experiments can be used with a weighted average analysis method to calculate the relative binding of the protein of interest to each sequence represented on the array (see Figure 2).
Four features of the global location profiling method were found to be critical for consistent, high-quality results. First, DNA microarrays with consistent spot quality and even signal background play an obvious role. An example of an image generated by the technique described herein is shown in figure SA.
Second, the LM-PCR method described herein was developed to permit reproducible amplification of very small amounts of DNA; signals for greater than 99.9% of genes were essentially identical within the error range when independent samples of 1 ng of genomic DNA were amplified with the LM-PCR method (Figure SB).
Third, each experiment was carried out in triplicate, allowing an assessment of the reproducibility of the binding data. And fourth, a single-array error model described by Hughs et al, (2000) was adopted to handle noise associated with low intensity spots arid to average repeated experiments with appropriate weights The quantitative amplification of small amount of DNA generates some uncertainty for the low intensity spots. In order to track that uncertainty and to be able to average repeated experiments with appropriate related weights, we adopted an single-array error model that was first described by Hughs et al, (2000).
According to this error model, the significance of a measured ratio at a spot is defined by a statistic X, which takes the form (1) X-(az - a~)~~au ~' az2 + ~ (a~Z + az2)~~
where a,,2 are the intensities measured in the two channels for each spot, o1,2 are the uncertainties due to background subtraction, and f is a fractional multiplicative error such as would come from hybridization non-uniformities, fluctuations in the dye incorporation efficiency, scanner gain fluctuations, ets. X is approximately normal.
The parameters a and f were chosen such that X has unit variance. The significance of a change of magnitude ~ x ~ is then calculated as (2) p=2x(1-Erf(~X~)).
Thus, in the methods of the present invention, the data for the intensity of each spot on an array, as well as the intensity and standard deviation around each spot is measured; and this is calculated for both the test sample and the control sample hybridized on the same array. These measurements are used to calculate the enrichment in a probabilistic fashion using a mathematical model. In the methods described herein, each measurement is weighed allowing replicates to be combined appropriately which addresses the susceptibility of spots with lower signals to generate more noise..

EXEMPLIFICATION
Example 1 DESIGN OF YEAST CHROMOSOME III AND SELECTED
MODEL GENES ARRAY FOR THE CHARACTERIZATION OF
PROTEIN-DNA INTERACTIONS
Array contains all non-overlapping open reading frames (ORF) on Chromosome III (See Table 1). When a sequence contains part or all of two potential reading frames, the larger sequence was chosen to represent the ORF.
Any remaining sequence was included in intergenic fragments.
All intergenic regions larger than 100bp are represented by fragments averaging SOObp. Where regions are greater than 700bp, they are broken into multiple fragments of 300 to 600bps. PCR primers for each region were chosen using the Saccharomyces Genomic Database (SGD) "Design Primers" program from Stanford University. The total number of intergenic fragments equals 241 for Chromosome III.
The location and size of open reading frames were determined from the Saccharomyces Genomic Database (SGD) functional chromosomal map.
An additional 17 model genes (see the Table) were selected based on their high frequency of citation in transcription literature. Each gene was amplified as well as 1-2kb upstream and SOObp downstream of the coding region.
ChIP - Microarray Protocols PCR generation of unmodified yeast ORF DNA
100 q1 reaction generally yields approximately S-6~,g DNA
RXN mix:
10.0 ~l l OX PCR buffer (Perkin Elmer, AmpliTaq) 8.0 ~125n~1VI MgCl2 (Perkin Elmer, AmpliTaq) 10.0 ~l l OX dNTPs (2mM each, Pharmacia 100mM stocks) 1.0-2.0 ~.l ORF DNA (Research Genetics, approximately 10 ng) 2.51 each universal primer (Research Genetics, 20 ~M solution) 1.6 ~,l diluted Pfu DNA polymerise (diluted 1:100 in water, Strategene, 0.02U) 1.0 ~,1 AmpliTaq DNA polymerise (5U, Perkin Eliner) 63.4 ~.1 ddHzO
S PCR Generation of Yeast Intergenic regions 100 ~.1 reaction generally yields approximately 5-6 ug DNA
RXN mix:
10.0 ~,1 l OX PCR buffer (Perkin Elmer, AmpliTaq) 8.0 ~,l 25mM MgCl2 (Perkin Elmer, AmpliTaq) 10.0 ~,l l OX dNTPs (2mM each, Pharmacia 100mM stocks) 1.01 Yeast Genomic DNA (Research Genetics, approximately 100 ng) 5.0 ~l each primer (Research Genetics, 20 qM solution) 1.6 ~.1 diluted Pfu DNA polymerise (diluted 1:100 in water, Strategene 0.02U) 1.01 AmpliTaq DNA polymerise (5U, Perkin Elmer) 58.4 ~,l ddHzO
Cycling for ORF and intergenic DNA
95°C 3 min 30 cycles of:
94°C 30 sec 60°C 30 sec 72°C 2 min PCR Cleanup:
Reactions were cleaned by Qiagen QIAquick 96 PCR purification kits according to the manufacturers' protocol with the following exception. DNA was eluted with 120 ~,l of T.E. 8.0 (lOmmTris, lmm EDTA, pH8.0). T.E. 8.0 was applied to the Qiagen membrane and allowed to sit 5 minutes before elution.
The DNA was collected into a Corning polypropylene 96 well plate.
Reactions were quantified by visualizing 1 ~1 of the purified DNA on an agarose gel compared to a known quantity of lambda DNA cut with HindIll (Promega).
DNA was stored at -20 until shortly before printing. The DNA was then dried down by speed vac in the Corning microtiter plates to less than 5~1.
PRINTING
PCR reactions were resuspended to approximately 0.5 mg/ml in 3XSSC.
SSC was made as a 20X stock (3M NaCI, 0.3M Na3citrate~2H20, pH'd to 7.0 with HCl) and diluted to the desired concentration with H20.
10-15 ~1 of the DNA was placed in a Corning 96 or 384 well plate and GAPS coated slides were printed using the Cartessian Robot. PCR products should be greater than 250 pb.
1 ~ Slide Processing 1. Rehydrated arrays by holding slides over a dish of hot ddH20 (~ 10 sec).
2. Snap-dried each array (DNA side up) on a 100°C hot plate for ~ 3 seconds.
3. UV X-linked DNA to the glass by using a Stratalinker set for 60 mJoules.
4. Dissolved Sg of succinic anhybride (Aldrich) in 31 SmL of n-methyl-pyrnlidinone.
5. To this, added 35mL of 0.2M NaBorate pH 8.0, and stirred until dissolved (Boric Acid pH'd with NaOH).
6. Soaked arrays in this solution for 15 minutes with shaking.
7. Transferred arrays to 95°C water bath for 2 minutes.
8. Quickly transferred arrays to 95% EtOH for 1 minute.
9. Air dried slides array side up at a slight angle (close to vertical).

Slide pre-hybridization 1. Incubated slide in 3.SXSSC, 0.1%SDS, lOmg/ml BSA (Sigma) in a Coplin jar for 20 minutes at 50°C (Place Coplin jar in water bath).
2. Washed slide by dipping in water and then isopropanol.
3. Air dried array side up at slight angle (close to vertical).
Probe preparation 1. The probe volume should be 20-30 p1 for a small coverslip (25 mm2) and 40-60 ~1 for a large cover slip (24 x 60 mm).
2. Brought probe (cDNA or PCR based) up to final hyb volume in 3XSSC, 0.1% SDS with 10 ~gE. coli tRNA (Boehringer-Mannheim).
3. Boiled in heat block for 3-5 minutes.
4. Snaped cool on ice. And spun.
Hybridization 1. Pipetted probe onto slide. Dropped cover slip onto liquid avoiding bubbles.
2. Assembled over SO°C waterbath in hybridization chamber. Clamped shut.
3. Submerged in 50°C waterbath overnight.
Scanning 1. Dissambled hybridization right side up.
2. Removed coverslip with fingers or tweezers.
3. Placed in O.1X SSC, 0.1% SDS at room temperature for S-10 minutes.
4. Transfered slides to O.1X SSC for 2.5 minutes and again for 2.5 minutes.
5. Blew dry and scan slide.
Data Analysis The data generated from scanning was analyzed using the ImaGene software.

Table 1 Yeast ORF Model Genes YCLOOlw RER1 YOL086c ADHl YCLOOIw-a YBR115c LYS2 YCL002c YBR039c PHOS

YCL004w PGS 1 YIR019c FLOl 1 YCLOOSvv YDL215c GDH2 YCL006c YER103w SSA4 YCL007c CWH36 YHR053c CUP1 YCL008c STP22 YKL178c STE3 YCL009c IL,V6 YIL163c SUC2 YCLOIOc YOR202w HIS3 YCLO l 1 c GBP2 YJR048w CYC 1 YCL012w YJR153c INOl YCL014w BUD3 YBR020w GALL

YCL016c YBR019c GAL10 YCL017c NSF1 YDL227c HO

YCL018w LEU2 YPL256c CLN2 YCL019w YGR108w CLB1 YCL020w YCL024w YCL025c AGP1 YCL026ca FRM2 YCL027w FUS 1 YCL028w YCL029w BIK1 YCL030c HIS4 YCL031c RPB7 YCL032w STESO

YCL033c YCL034w Yeast ORF Model Genes YCL03 S c YCL036w YCL037c SR09 YCL038c YCL039w YCL040w GLKl YCL041 c YCL042w YCL043c PDII

YCL044c YCL045c YCL046w YCL047c YCL048w YCL049c YCLOSOc APA1 YCLOSIw LRE1 YCL052c PBN1 YCL054w YCLOSSw KAR4 YCL056w YCL057w PRD1 YCL058c YCL059c KRRI

YCL061 c Yeast ORF Model Genes YCL063w YCL064c ' CHA1 YCL065w YCL066w HMLALPHA1 YCL067c HMLALPHA2 YCL068c YCL069w YCL073c YCL074w YCL075w YCL076w YYCR002c CDC 10 YCR003w MRPL32 YCR004c YCP4 YCR005c CIT2 YCR006c YCR007c YCR008w SAT4 YCR009c RVS161 YCRO l Oc YCRO 11 c ADP 1 YCR012w PGKl YCR014c POL4 YCR015c Yeast ORF Model Genes YCR016w YCR017c YCRO 18c SRD 1 YCRO 18ca YCR019w YCR020c PET18 YCR020wb HTL1 YCR021c HSP30 YCR022c YCR023c YCR024c YCR025c YCR026c YCR027c YCR028c FEN2 YCR030c YCR031 c RPS 14A

YCR032w BPHl YCR033w YCR034w FEN1 YCR035c RRP43 YCR036w RBKl Yeast ORF Model Genes YCR037c PH087 YCR038c BUDS

YCR039c MATALPHA2 YCR040w MATALPHA1 YCR041 w YCR042c TSM1 YCR043c YCR044c YCR045 c YCR046c IMG1 YCR047c YCR048w ARE1 YCR051 w YCR052w RSC6 YCR053w THR4 YCR054c CTR86 YCR057c PWP2 YCR059c YCR060w YCR063w YCR064c YCR065w HCM1 YCR066w RAD 18 YCR067c SED4 Yeast ORF Model Genes YCR068w YCR069w SCC3 YCR071 c IMG2 YCR072c YCR073c SSK22 YCR073wa SOL2 YCR075c ERS1 YCR076c YCR077c PAT1 YCR079w YCR081w SRB8 ., YCR082w YCR083w YCR084c TUP1 YCR085w YCR086w YCR087w YCR088w ABP1 YCR089w FIG2 YCR090c YCR091 w KIN82 YCR092c MSH3 YCR093w CDC39 YCR094w CDC50 YCR095c Yeast ORF Model Genes YCR096c A2 YCR097w A1 YCR098c GIT1 YCR099c YCR100c YCR101c YCR102c YCR102wa YCR104w PAU3 YCR105w YCR 106w YCR107w AAD3 Example 2 GENOME-WIDE LOCATION AND FUNCTION OF DNA-BINDING PROTEINS
Global analysis of Gal4 binding sites To investigate the accuracy of the genome-wide location analysis method, the analysis was used to identify sites bound by the transcriptional activator Gal4 in the yeast genome. Gal4 was selected because it is among the best characterized transcriptional activators, it is known to be responsible for induction of genes necessary for galactose metabolism, and a consensus DNA binding sequence (the UAS~) has been identified for Gal4 in the promoters of the GAL genes. Very little Gal4 is bound at the UAS~ of the GALL and GALIO promoters when cells are grown in glucose (the repressed state), whereas relatively high levels of Gal4 are bound in galactose (the activated state).
The genome-wide location of epitope-tagged Gal4p in both glucose and galactose media was investigated in three independent experiments, as described in more detail below. The location analysis experiment identified seven genes previously reported to be regulated by Gal4 and three additional genes encoding activities that are physiologically relevant to cells that utilize galactose as the sole carbon source, but which were not previously known to be regulated by this activator (Figures 6A).
The set of 24 genes whose promoter regions are most likely to be bound by Gal4 by the analysis criteria (p-value < 0.00001) described herein, is listed in Figure 6A. Gal4 does not functionally activate all of these genes, however, since only a subset of the genes that share intergenic regions bound by Gal4 will be regulated by this activator (Figure 6B). To identify genes that are both bound by Gal4 and activated by galactose, genome-wide expression analysis was carried out. The upper panel of Figure 6A shows genes whose expression is induced in galactose, whereas the lower panel shows genes whose expression is galactose independent. Ten genes were found to be bound by Gal4 (P value s0.001) and induced in galactose using the critical analysis described herein. These included seven genes previously reported to be regulated by Gal4 (GALL, GAL2, GAL3, GAL7, GALL D, GAL80 and GCY~) which were bound Gal4 and were activated in galactose. Three genes whose expression was not previously associated with the Gal4 activator, MTH, PCL10 and FUR4, were also found to be bound by Gal4 and activated in galactose.
Substantially less Gal4 was associated with each of these promoters in cells grown in glucose, as expected. Gal4p was not bound to the promoters of GAL4 and PGM2, genes previously thought to be regulated by GaI4, although direct evidence for Gal4 binding to these promoters had not been demonstrated. Each of these results was confirmed by conventional ChIP analysis (Figure 6C), demonstrating that the microarray results accurately reflect results obtained by the conventional approach, which has until now been used to study binding sites individually.
The ten genes that are both bound and regulated by Gal4 were selected and the AlignAce program was used to identify a consensus binding site for this activator (Figure 6D). This binding site sequence is similar to, but refines, the sequence previously determined for Gal4. The Gal4 binding sequence occurs at approximately 50 sites through the yeast genome where Gal4 binding is not detected, indicating that the simple presence of this sequence is not sufficient for Gal4 binding.
Three genes whose expression was not previously associated with the Gal4 activator, MTH, PCLIO and FUR4, were found to be bound by Gal4 and activated in galactose (Figure 6G). The identification of MTH1, PCL10 and FUR4 as Gal4-regulated genes reveals previously unknown functions for Gal4 and explains how regulators of several different metabolic pathways can be coordinated. It is likely that these three genes are genuine Gal4p targets because they share the following three features with the well established Gal4-dependent GAL genes. MTH, PCLIO
and FUR4 are galactose-induced (Figure 6A). Galactose induction depends on Gal4 (Figure 6C). MTH, PCL10 and FUR4 promoters are bound by Gal4 when cells are grown in galactose but not in glucose (Figure 6A). The binding of Gal4p to the MTH, PCL10 and FUR4 promoters was verified by conventional ChIP analysis (Figure 6C).
The identification of MTHl and MTH, PCLIO and FUR4 as Gal4-regulated genes reveals how regulation of several different metabolic pathways are interconnected (Figure 6F). MTHI encodes a transcriptional repressor of many genes involved in metabolic pathways that would be unnecessary when cells utilize galactose as a sole carbon source. Among the most interesting of its targets are a subset of the HTX genes involved in hexose transport. The results described herein indicate that the cell responds to galactose by modifying (increasing) the concentration of its galactose transporters at the membrane in a Gal4-dependent fashion at the expense of other transporters, In other words, while Gal4 activates expression of the galactose transporter gene GAL2, Gal4 induction of the MTHI
repressor gene, leads to reduced levels of glucose transporter expression. The Pcl 10 cyclin associates with Pho85p and appears to repress the formation of glycogen. The observation that PCL10 is Gal4-activated indicates that reduced glycogenesis occurs to maximize the energy obtained from galactose metabolism. FUR4 encodes a uracil pennease and its induction by Gal4 may reflect a need to increase intracellular pools of uracil to permit efficient uridine S'-diphosphate(UDP) addition to galactose catalyzed by Gal 1.
Previous studies have shown that Gal4 binds to at least some GAL gene promoters when cells are grown on carbon sources other than galactose, as long as glucose is absent. Genome-wide location analysis of Gal4 in cells grown on raffinose was repeated and it was found that the results were essentially identical to those obtained when cells were grown on galactose. These results indicate that Gal4 exhibits the same binding behavior at all its genomic binding sites and demonstrate that the genome-wide location method is highly reproducible.
Global analysis of Stel2 binding sites The genome-wide binding profile of the DNA-binding transcription activator Stel2 was also investigated. Stel2 is of interest because it has a defined cellular role - it is key to the response of haploid yeast to mating pheromones - but only a few genes regulated by Stel2 have been identified. Activation of the pheromone-response pathway by mating pheremones causes cell cycle arrest and transcriptional activation of more than 200 genes in a Stel2-dependent fashion. However, it is not clear which of these genes is directly regulated by Stel2 and which are regulated by other ancillary factors. Expression analysis using stel2 mutant cells has shown that Stel2 is required for the pheromone induction of all of these genes. However, the mechanism by which Stel2 activates transcription of these genes in response to pheromone has not been elucidated.
The genome-wide location of epitope-tagged Stel2p before and after pheromone treatment was investigated in three independent experiments. The set of genes whose promoter regions are most likely to be bound by Ste 12 by the analysis criteria (p-value < 0.005) described herein is listed in Figure 7; the upper panel shows genes whose expression is induced by alpha factor, whereas the lower panel shows genes whose expression is not significantly induced by alpha factor. Of the genes that are induced by alpha factor and are bound by Ste 12, 11 are known to participate in various steps of the mating process (FIG2, AFRl, GIC2, STE12, KARS, FUSl, AGA1, FUS3, CIKI, FAR1, FIGI) (Figure 8). FUS3 and STE12 encode components of the signal transduction pathway involved in the response to pheromone (Madhani et al., Trends Genet., 14:151 (1999)); AFRI and GIC2 are required for the formation of mating projections (Konopka et al., Mol. Cell Biol., 13:6876 (1993); Brown et al., Genes Dev., 11:2972 (1997); Chen et al., Genes Dev., 11:2998 (1997)); FIG2, AGAl, FIGI and FUSl are involved in cell fusion (Erdman et al., J. Cell Biol.,140:461 (1999); Roy et al, Mol. Cell Biol, 11:4196 (1991);
Truehart et al., Mol. Cell biol., 7:2316 (1987); McCaffrey et al., Mol. Cell Biol..
7.'2680 (1987)); and CIK1 and KARS are required for nuclear fusion (Marsh, L.
and Rose, M.D. in The Moelcular and Cellular Biology of the Yeast Saccharomyces, J.R.
Pringle, J.R. Broach, E.W. Jones, Eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1997), vol. 3, pp. 827-888). Furthermore, FUS3 and FARI are required for pheromone-induced cell cycle arrest (Chang et al., Cell, 63: 999 (1990);
Fujimura, Curr. Genet., 18:395 (1990)).
Stel2 binds to some promoters in the absence ofpheromone signaling, however, its binding to most genes is enhanced by alpha factor. Interestingly, Stel2p is bound to its own promoter both before and after pheromone treatment.
Together, the binding and expression data argue that the regulation of the STE12 gene involves a positive feedback loop. STE12 expression is increased immediately after pheromone treatment, indicating that the bound but inactive Stel2 activator is rapidly converted to an active form. Increased expression of STE12 gene would allow more Stel2p to be made and this would, in turn, activate its genes.
Twenty-four genes whose expression were not previously associated with Stel2 and the mating process were found to be bound by Stel2 and activated by alpha factor. Considering that their pheromone induction is eliminated in Stel2 mutant cells, it is likely that these 24 genes are also genuine Stel2 targets.
The identities of these genes indicate interesting details about various steps of the mating process. For example, one Stel2 target gene, PCL2, encodes a G1 cyclin that forms complexes with the cyclin-dependent kinase (cdk) Pho85. The Pcl2-Pho85 and PC11-Pho85 complexes act in concert with Clnl-Cdc28 and Cln-2-Cdc28 cyclin dependent kinase complexes to promote Glcell cycle progression (Measday et al., 1994). The Pcl2-Pho85 kinase complex has a substrate specificity that is overlapping but different from that of the Clnl-Cdc28 and Cln2-Cdc28. During the mating process, haploid yeast cells are arrested at start of the late G1 phase, due to the inhibition of Clnl-Cdc28 and Cln2-Cdc28 activities by Farl, which is encoded by another Stel2 target gene. Activation of PCL2 by Stel2 after pheromone treatment indicates that increased Pho85 complex activities are likely necessary to compensate for the loss of Cdc28 activities.
Most Stel2 target genes identified by analysis of genome locations of Stel2 and expression profiles during pheromone induction encode proteins involved in various steps of the mating response. Among them are 11 previously uncharacterized. The cellular roles for these genes, including YNL279W, YOR129C, YOR343C, YPL192C, YER019W, YIL083C, YIL037C, YIL169C, YNL105W, YOL155C and YNR064C, are therefore most likely related to mating.
Among the Stel2 target genes identified in this study that were not previously reported to be involved in mating, many are involved in processes likely to be relevant to mating. CSHl, PCL2, ERG24, SPC25, HYMI, and PGM1 encode proteins involved in cell wall biosynthesis, cell morphology, membrane biosynthesis, nuclear congression and regulation of gene expression.
Furthermore, YER019W, YOR129C and SCH9 are among genes that are cell cycle regulated (Spellman et al., Mol. Cell Biol., 9: 3273 (1999).
The genes that are regulated by Stel2 can be divided into two classes: those bound by Stel2 both before and after pheromone exposure (e.g., STE12, PLC2, FIG2 and FUS1), and those bound by Stel2 only after exposure to pheromone (e.g., CKI1 and CHS 1 ). The first class of genes is induced immediately after pheromone exposure, most likely by a mechanism that converts an inactive DNA-bound Stel2 protein to an active transcriptional activator. This could take place by removal of repressors of Stel2 such as Digl/Rstl and Dig2/Rst2 (Olson et al., Mol. Cell Biol., 20: 4199 (2000)). In the second class of genes, induction of transcription is relatively slow. In this case, the binding of Stel2 appears to be limited before pheromone exposure. It is also possible that the epitope tag on Stel2 is masked at these promoters before pheromone treatment, perhaps due to the presence of additional regulatory proteins.
Stel2 has also been implicated in other cellular processes. Together with Tecl, Stel2 regulates the filmamentation of diploid cells and invasive growth in haploids. Two genes, TECI and FLOl l, have been identified as Stel2 targets in filamentous growth pathway. Stel2 binding to these genes either in the presence or absence of alpha factor was not detected. It is likely that Stel2p's binding to these promoters is regulated by different physiological conditions.
As shown herein, a combination of genome-wide location and expression analysis can identify the global set of gens whose expression is controlled directly by transcriptional activators in vivo. The application of location analysis to two yeast transcriptional activators revealed how multiple functional pathways are coordinately controlled in vivo during the response to specific changes in the extracellular environment. All of the known targets for these two activators were confirmed, and functional modules were discovered that are regulated directly by these factors.
Expression analysis with DNA microarrays allows identification of changes in mRNA levels in living cells, but the inability to distinguish direct from indirect effects limits the interpretation of the data in terms of the genes that are controlled by specific regulatory factors. Genome-wide location analysis provides information on the binding sites at which proteins reside through the genome under various conditions in vivo.

~',"'°~'' ~ Consensus Banding ~o~i. s of Promoters ~.ound b,y 1'eas~
Celi Cycle Trar.scripti~nai Reaula~ors.
F:acf~;-IVkc~ u,'' i Re~ere>m ce _ b ~'~p1 , Tava.?oie a:
'~ ~~"~~: ~' '! a1_. 199 ~' 'r S ~V1= 't j dVdZ0l:...i . ~~" i0~0 , a CZ ~~' r s h~i cm 1 /Flak. !~ltuoerer .l 2:. 1995 T T
I
Nl:cmi a ' ~ -- ava::ai~ ~t ' ~' aos, al ~,,. .. ,.
I ,, ..

~: ce ;'-' __ %

I

_ Do~l~'n.;an.n ~ C~ ~t ~.., 1~~

r 1. T '~',4 ~~~~' .~ r , ~ T~~b et a1__ 1~~93 T t ~

Fl:hi~: 'c ~ t ?nL c:' :.1..
x,1;.1;? :i ~Ot7O

r .~ Ir_t1i-, _ ' =="

_ ,. .~
_ - _ ~ ~. ~s:~-,' ..

. O

n e=w _ r'~.l'.'~ C-.
Q

~ Sequcccc iuEc (ScnnBidc:~ and S~phcnc~ lyJU) P;~ccrndon a motifs drat~cr_ fovmd axing ti~ F,wcp of A~mo~r,:~ ho!.tnd by atop aavmori ~ u7 input m Aii:~nA~_i _ F'r_~,mad arc mnrifs:p=cific totlro inpu; ~: of prea,ocec~ ;hcst~dfi~t~~ ~cmu ('riu~,5~ e:a!.,?l7Gp) for ;nc moats (app to i~ro~ as 1G'~l.iQ''-', .C'=~"19 's, 10" _ 1t5'14.10-19 IG''-1,10-13. 1L1'.S.ID "x.10'17~ _ b, Itctr_nca fo.~ previoc_ ~c"nc:ptirm: p1 ~m(Isu motite. ' Example 3 SERIAL REGULATION OF TRANSCRIPTIONAL REGULATORS
IN THE YEAST CELL CYCLE
Experimental Procedures Tagging and Yeast Strains The cell cycle activators Swi4, Mbpl, SwiS, Fkhl, Fkh2, Nddl Mcml, and Ace2 were tagged with a multicopy myc epitope by inserting the epitope coding sequence into the normal chromosomal loci of these genes. Vectors developed by Cosma et al. Cell, 97:299-311 (1998) were used for amplifying a fragment that contains the repeated myc tag coding sequence flanked by SO by from both sides of the stop codon of the gene. The PCR products were transformed into the W303 strain 21258 (MATa, ada2-1, lrpl-1, canl-100, leu2-3, 112, his3-11, 15, ura3) to generate the tagged strains (21335, 21372, 21373, 21446, 21370, 21369, 21321, and 21371, respectively). Clones were selected for growth on TRP plates, the insertion of the tagged sequence was confirmed by PCR, and expression of the epitope-tagged protein was confirmed by Western blotting using an anti-Myc antibody (9E11). A strain containing a myc-tagged version of SwiS (21407) was obtained from K. Nasmyth).
Genome-Wide Location Analysis Genome-wide location analysis as described inRen et al. Science, 290: 2306-2309 (2000) was used to identify genome binding sites for the transcription factors.
Briefly, yeast strains containing a myc-tagged version of the protein of interest were grown to mid log phase (OD 0.6-1.0), fixed with 1% formaldehyde for 30 minutes, harvested and disrupted by sonication. The DNA fragments crosslinked to the protein were enriched by immunoprecipitation with anti-myc specific monoclonal antibody (9E11), thus obtaining an enrichment of the in vivo binding sites.
After reversal of the crosslinks, the enriched DNA was amplified and labeled with a fluorescent dye (Cy5) with the use of a ligation-mediated polymerase chain reaction (LM-PCR). A sample of DNA that was not enriched by immunoprecipitation was subjected to LM-PCR in the presence of a different fluorophore (Cy3), and both immunoprecipitation (IP)-enriched and -unenriched pools of labeled DNA were hybridized to a single DNA microarray containing all yeast intergenic sequences.
Microarray design and production was as described in Ren et al. Science, 290:

2309 (2000).
Images of Cy3 and Cy5 fluorescence intensities were generated by scanning the arrays using a GSI Lumonics Scanner. The Cy3 and Cy5 images were analyzed using ArrayVision software, which defined the grid of spots and quantified the average intensity of each spot and the surrounding background intensity. The background intensity was subtracted from the spot intensity to give the final calculated spot intensity. The intensity of the two channels was normalized according to the median. For each spot, the ratio of corrected Cy5/Cy3 intensity was computed. Each experiment was carried out in triplicate, and a single-array error model was used to handle noise, to average repeated experiments with appropriate weights, and to rank binding sites by p value as described (See also httn://web.wi.mit.edul.~g/cellcycle which is incorporated herein by reference;
Ren et al. Science, 290:2306-2309 (2000)).
The intergenic regions present on the array were assigned to the gene or genes found transcriptionally downstream. Where a single intergenic region contains promoters for two divergently transcribed genes, the intergenic region was assigned to the gene or genes expressed during the cell cycle according to the Spellman et al. Mol. Cell Biol. Cell, 9:3273-3297 (1998) analysis. The Spellman et al. 1998 analysis was chosen because it incorporates all available yeast cell cycle expression data. Promoter regions detected with a p value <0.001 were included for further analysis.
Statistics In order to explore the statistical significance of the overlap between the set of targets of a factor and the genes expressed in a particular cell cycle stage, the hypergeometric distribution as described in Tavazole et al. Nat. Genet., 22:281-285 (1998) was used.
Results Genome-wide location analysis (Ren et al., Science, 290:2306-2309 (2000)) was used to identify the in vivo genome binding sites for each of the known cell cycle transcription factors (Figures 9A and 9B). Yeast strains, each containing a myc-tagged version of Mbpl, Swi4, Swi6, Mcml, Fkhl, Fkh2, Nddl, SwiS, or Ace2, were grown in asynchronous cultures to mid log phase and subjected to location analysis as described previously (Ren et al., Science, 290:2306-2309 (2000)). Each experiment was carried out in triplicate, and a single array error model was used to handle noise, to average repeated experiments with appropriate weights, and to rank binding sites by p value (Figures 9B and 9C).
Asynchronous cultures were used because previous studies showed that the results obtained for Swi4 in genome-wide location experiments are essentially identical in unsynchronized and arrested cultures (Iyar et al., Nature, 409:533-536 (2001)), and because it was not feasible to obtain high quality datasets in triplicate at multiple cell cycle time points for all nine factors.
The regulation of the cell cycle expression program by each of the nine factors is summarized in Figures 10A-1 OB. The binding of a transcriptional activator to the promoter region of a gene suggests that the activator has a regulatory effect on the gene, but it is also possible that the activator does not fully or even partially control the gene. For this reason, we have identified the set of genes where factor binding correlates with gene expression, an approach that produced highly accurate information on transcription factor function in previous studies with other factors (Ren et al., Science, 290: 2306-2309 (2000)). The set of genes bound by the nine cell cycle transcription factors was compared to the set of approximately genes whose expression levels vary in a periodic fashion during the yeast cell cycle (Spellman et al. Mol. Cell Biol. Cell, 9: 3273-3297 (1998)). The proportion of the 800 genes whose promoters are bound by one or more of the nine transcription factors studied here varies with the stringency of the one analysis criteria for binding data (27% at p<0.001, 37% at p<0.01; 50% at p< 0.05). Further discussion was focused on results obtained with the highest stringency criteria (p<0.001) because a previous investigation using this approach detected no false positives in followup studies (Ren et al., Science, 290:2306-2309 (2000);
http://web.wi.mit.edu/youn cello http://www.cell.com/csi/content/full/106/6/697/DC 1).
Collaboration of Regulators in Periodic Gene Expression A model for transcriptional control of cell cycle genes has been developed that is based on studies involving a relatively small number of genes. In this model, MBF and SBF control expression of late G1 genes (Koch et al., Curr. Opin. Cell Biol., 6:451-459 (1994)); a complex of Mcml, Nddl, and Fkhl/Fkh2 controls G2/M
genes (Koranda et al., Nature, 406: 94-98 (2000); Kumar et al., Curr. Biol., 10: 896-906 (2000); Pic et al., Embo J., 19: 3750-3761 (2000); Zhu et al., Nature, 406:90-94 (2000)); and Mcml, SwiS, and Ace2 regulate genes expressed in M/G1 (McBride et al., J. Biol. Chem., 274:21029-21036 (1999); McInerny et al., Genes Dev., 11:1277-1288 (1997)). The genome-wide binding data for these activators support this model (Figures l0A-lOB) and provide compelling evidence for collaboration among specific factors in genome-wide regulation. Mbpl, Swi4, and Swi6 bound predominantly to promoter regions of late G1 genes (p<10-'4, p<10-'$, and p<10-Zo respectively), SwiS and Ace2 to M/G1 genes (p<10-'4 and p<10-3, respectively), and Mcml, Fkh2, and Nddl to G2/M genes (p<10-'4, p<10-'S, and p<10-2', respectively).
Thus, the data described herein generally support the model for stage-specific regulation of gene expression by these activators and extend it to encompass promoters for several hundred cell cycle genes.
The data described herein also provide novel insights into stage-specific gene regulation by these factors. Previous studies suggested that Fkhl and Fkh2 are homologs that function in concert with Mcml during G2/M (Zhu et al., Nature, 406: 90-94 (2000)), but it was found that Fkhl and Fkh2 are also associated with genes expressed in G1 and S, where Mcml binding could not be detected (Figures l0A-lOB). The combination of Mcml, Fkh2, and Nddl bound predominantly to G2/M genes, as expected, but Mcml was also bound to genes expressed during M/G1 (p<10-6), where binding by Fkhl, Fkh2, or Nddl could not be detected.
These results indicate that differential regulation of Mcml and Fork-head target genes in different stages of the cell cycle are likely governed by the association of these factors with different regulatory partners. Further identification of the genomic binding sites of all yeast transcriptional activators will likely reveal these partners.
Regulation of Transcriptional Regulators The extent to which the cell cycle transcriptional regulate expression of other regulators was examined. Previous studies established that genes encoding several of the cell cycle transcriptional regulators are themselves bound by other cell cycle regulators (Figure 1 1A), SWI4 is regulated by Mcml and Swi6 (Foster et al., Mol.
Cell Biol., 13:3792-3801 (1993); Mackay et al., Mol. Cell Biol., 21:4140-4148 (2001); Mclnerny et al., Genes Dev., 11:1277-1288 (1997)), SwiS is regulated by Mcml/Fkh2/Nddl complex (Koranda et al., Nature, 406:94-98 (2000); Kumar et al.
Curr. Biol., 1 D: 896-906 (2000); Pic et al., Embo J., 19:3750-3761 (2000);
Zhu et al., Nature, 406.90-94 (2000)), and expression of ACE2 is affected by depletion of Mcml (Althoefer et al., 1995). The genome-wide location data confirmed these results. The location data also revealed that the set of factors that regulates genes during each phase of the cell cycle also regulates expression of one or more activators involved in the next phase of the cell cycle, forming a fully connected regulatory network (Figure 11B).
The regulatory network from the genomic binding data (Figure 11B) described herein can be described as follows. SBF (Swi4/Swi6) and MBF
(Mbpl/Swi6), which are active during late G1, both regulate NDDl. Nddl protein is a limiting component of the complex that activates G2/M genes; Mcml and Fkh2 are bound to promoters throughout the cell cycle, and activation of G2/M genes is dependent on recruitment of Nddl (Koranda et al. Nature, 406: 94-98 (2000)).
The Mcml/Fkh2/Nddl complex regulates SWIS and ACEl. SwiS, Ace2, and Mcml activate MlGI genes. Mcml binds to the SWI4 promoter and contributes to its activation in M/G1, leading to accumulation of the Swi4 subunit of the SBF
transcription factor in Gl . All three M/G1 transcription factors regulate CLN3, whose protein product forms a complex with Cdc28, which in turn activates SBF
and MBF during late G1 (Dirick et al. Embo. J., 14:4803-4813 (1995)). Swi4 transcription is fiu-ther regulated in late G1 by both SBF and MBF. Thus, the serial regulation of cell cycle regulators occurs throughout the cycle, forming a fully connected regulatory network that is itself a cycle.
Cyclin/CDK Regulation The transition between stages of the cell cycle is associated with oscillations in the activity of Cdc28-cyclin complexes; cyclin synthesis is necessary for phase entry, and CDK-cyclin inhibition/degradation is necessary for phase exit (Morgan, Annu. Rev. Cell Biol., 13:261-291 (1997)). The Gl and S cyclins Clnl, Cln2, ClbS, and Clb6 accumulate and associate with Cdc28 in late G1, and cyclins Clbl-Clb4 accumulate and associate with Cdc28 in G2 and M (Nasmyth, 1996). These cyclin-CDK complexes can be inhibited by specific cyclin-CDK inhibitors such as Sicl and Farl (Mendenhall et al. Annu. Rev. Cell Biol., 13:261-291 (1997)), or can be targeted for degradation by, for example, the anaphase promoting complex (APC) (King et al., Science, 274:1652-1659 (1996)).
Previous studies identif ed the transcriptional regulators for most cyclin genes (Figure 12A). SBF and MBF control transcription of Gl and S cyclin genes (Iyar et al. Nature, 409: 533-536 (2001); Koch et al., Curr. Opin. Cell Biol., 6:451-459 (1994)). SBF also participates in the regulation of CLBI and CLB2 (Iyar et al.
Nature, 409: 533-536 (2001)). The Mcml/Fkh2/Nddl complex regulates the CLB2 gene in G2/M (Koranda et al. Nature, 406.94-98 (2000); Kumar et al., Nature, 406:94-98 (2000); Pic et al. Embo J., 19:3750-3761 (2000); Zhu et al. Nature, 406.90-94 (2000)), and Mcml regulates transcription of GLN3 in MJG1 (Mackay et al. Mol. Cell Biol., 21:4140-4148 (2001); Mclnerny et al. Genes Dev., 11:1277-(1997)). Our results confirm these observations and reveal that Fkhl binds the CLB4 promoter. The additional target genes bound by the cell cycle transcriptional regulators described herein reveal that transcriptional regulation is more involved in cell cycle progression than previously reported. Transcription factors that regulate cyclin genes during each phase of the cell cycle also regulate genes encoding key components involved in transitioning to the next stage of the cell cycle (Figure 12B).
The location analysis indicates that SBF and MBF control transcription of G1/M cyclin genes, but also regulate expression of the G2/M cyclin Clb2, which inhibits further expression of the G1/S cyclins Cinl and Cin2 (Amon et al.
Cell, 74:993-1007 (1993)) and promotes entry into mitosis (Surana et al. Cell, 65:145-161 (1991)). SBF and MBF also regulate the transcription of the transcription factor Nddl, which also binds the CLB2 promoter. Thus, SBF, MBF and Nddl ultimately collaborate to regulate transcription of the CLB2 gene. SBF and MBF therefore regulate genes necessary for the transition through Gl/S, as well as genes whose products set the stage for further progression through the cell cycle.
The data also reveal that the G2/M activators (Mcml/Fkh2/Nddl) bind genes whose expression is necessary for both entry into and exit from mitosis. The activators bind and regulate transcription of CLB2, whose product is necessary to enter mitosis (Surana et al. Cell, 65:145-161 (1991)). They also set the stage for exit from mitosis by regulating the gene encoding Cdc20, an activator of the APC, which targets the APC to degrade Pdsl and thus initiate chromosome separation (Visintin et al. Science, 278:450-463 (1997)). Cdc20-activated APC also degrades ClbS
(Shirayama et al. Nature, 402:203-207 (1999)) and thus enables Cdcl4 to promote the transcription and activation of Sicl (Shirayama et al. Nature, 402:203-207 (1999)) and to initiate the degradation of Clb2 (Jaspersen et al., Mol. Biol.
Cell, 9:2803-2817 (1998); Visintin et al., Science, 278:450-463 (1997)). In addition, the G2/M activators Mcml/Fkh2/Nddl regulate transcription of SP012, which encodes a protein that also regulates mitotic exit (Grether et al., Mol. Biol. Cell, 10: 3689-2703 (1999)).
The M/G1 transcriptional regulators (Mcml, Ace2, and SwiS) bind genes that are key to entering and progressing through Gl. SwiS binds to the SICI
promoter, and all three transcriptional regulators bind to the GLN3 promoter.
Sicl inhibits Clb-Cdc28 during mitosis (Toyn et al. Genetics, 145: 85-96 (1997)), thus facilitating exit from mitosis. Cln3-Cdc28 activates SBF and MBF in late G1 (Dirick et al. Embo. J., 14:4803-4813 (1995)), thus setting the stage for another cell cycle circuit. In summary, knowledge of the global set of cyclin and CDK
regulatory genes that are bound by each of the transcriptional activators provides a much enriched model to explain how transcriptional regulation contributes to cell cycle progression (Figure 12B).
Regulation of Stage-Specific Functions The genomic location data revealed how specific factors regulate genes associated with stage-specific cell cycle functions (Figure 13). SBF regulates genes involved in the morphological changes associated with cell budding, and MBF
controls genes involved in DNA replication and repair, confirming a previous study (Iyer et al., Nature, 409:533-536 (2001)). SBF is also bound to the promoters of several histone genes (HTAI, HTA2, HTA3, HTBI, HTB2 and HHO1), which makes it likely that SBF contributes to the increase in histone gene transcription observed at S phase. Fkhl was found to bind various genes that encode proteins associated with chromatin structure and its regulation; these include histones (HHF1 and HHT1), telomere length regulators (TEL2 and CTF18), a shared component of the chromatin remodeling complexes Swi/Snf and RSC (ARP7), and a histone deacetylase (HOS3). The G2/M activators (Mcml/Fkh2/Nddl) bind genes that regulate the transition through mitosis (SWIS, ACE2, CLB1, CDC20 and SP012).
Ace2 and SwiS regulate genes involved in cytokinesis (CTSI and EGT2), whereas Mcml (apparently in absence of Fkhl, Fkh2 and Nddl) regulates genes encoding proteins involved in prereplication complex formation (MCM3, MCMSlCDC4G, MCM6 and CDC~ and in mating (STE2, STE6, FART, MFA1, MFA2, AGAI, and AGA2). A summary of binding data for each of the transcriptional regulators is presented in Table 3.

Table 3. Selected Targets of the Cell Cycle Activators Mcm1l Fkh2/
Gene SBF MBF Fkh1 Fkh2 Ndd1 Mcm1 Ace2 Swi5 Short description Cell Cycle + Cyclin that associates with Pho85p Control CDC6 + + + Protein that regulates initiation of DNA replication SIC1 + P40 inhibitor of Cdc28p-Clb protein kinase complex SW 14 + + + Transcription factor that participates in the SBF complex PCL2 + + + Cyclin, found partly in association CLB6 + + + B-type cyclin appeaaring late in G1 CLB5 + B-type cyclin appeaaring late in G1 SWE1 + + Serine/tyrosine dual-specificity protein kinase PCL1 + + + + G1/S-Specific cyclin CLN2 + G1/S-Specific cyclin CLN1 + + + + G1/S-Specific cyclin OPY2 + Protein that may be involved in cell-cycle regulation NDD1 + Protein required for nuclear division SIM1 + + + Protein involved in the aging process and in cell cycle regulation PCV + Cyclin, associates with Pho85p HSL7 + Negative regulatory protein of the Swe1p protein kinase APC1 +/- Component of the anaphase-promoting complex (APC) ACE2 + + + Metallothionein expression activator CLB2 + + + + G2/M-phase-specific cyclin SWI5 + + Transcription factor that controls cell cycle-specific transcription of HO

HDR1 + Protein involved in meiotic segregation TEM1 + + GTP-binding protein of the ras superfamily involved in termination of M-phase CDC20 + + Protein required for microtubule function at mitosis SP012 + + + Sporulation protein required for chromosome division in meiosis I

CLN3 + + +/- GINS-specific cyclin DBF2 + Serine/threonine protein kinase related to Dbf20p FAR1 + Inhibitor of Cdc28p-CInlp and Cdc28p-CIn2p kinase complexes Table 3.
Continued Mcm1/
Fkh2/
Gene SBF MBF Fkh1 Fkh2Mcm1 Ace2 Swi5 Short description Ndd1 Cell CSH1 + Chitin synthase I
wall biogenesis, budding, and cytokinesis TEC1 + Transcriptional activator EGT2 + + Cell-cycle regulation protein, may be involved in cytokinesis GIC2 + + Putative effector of Cdc42p, important for bud emergence SWC11 + + Putative cell wall protein GIN4 + + Serinefthreonine-protein kinase OCH1 + Alpha-1, 6-mannosyltransferase CTS1 + + + Endochitinase RSR1 + GTP-binding protein of the ras superfamily involved in bud site selection CRH1 + + + Protein for which overproduction suppresses bud emergence defects MSB2 + Cell wall protein MNN1 + Exo-beta-1, 3-glucanase (1/1I) GLS1 + Component of beta-1, 3-glucan synthase GAS1 + Glycophospholipid-anchored surface glycoprotein PSA1 + + Mannose-1 -phosphate guanyltransferase KRE6 + Glucan synthase subunit required for synthase of beta-1, 6-glucan GIC1 + + Putative effector of Cdcfl2p, important for bud emergence CWP1 + + Mannoprotein of the cell wall;

CIS3 + -.__ Cell wall protein -CWP2 + + + + + Protein that controls interaction of bud-neck cytoskeleton with G2 nucleus BUD4 + + + Protein required for axial budding but not for bipolar budding WSC4 + Protein required for maintenance of cell wall integrity BUDB + Protein required for bipolar budding SCW4 + Cell wall protein; similar to gulcanases Rp,X2 + + + Protein involved in bipolar budding SKN1 + Glucan synthase subunit Table 3.
Continued Mcm1/
Fkh2/
Gene SBF MBF Fkh1 Fkh2 Ndd1 Mcm1 Ace2 Swi5 Short description DNA RNR1 + + + Ribonucleotide reductase large replication subunit RAD27 + Single-stranded DNA endonuclease and 5'-3' exonuclease CDC21 + Thymidylate synthase, converts Component of cohesin m~u, * conesm, protein requireo for mitouc chromatid cohesion PDSS + + + Protein required for sister chromatid cohesion RAD51 + + Protein that stimulates pairing and strand-exchange between homologous DUN1 + Protein kinase required for induction of DNA repair genes after DNA
ALK1 + DNA damage-responsive protein Chromatin + Protein required for maintenance CTF18 of normal telomere length HHF1 +/- Histone H4, identical to Hhf2p HHT1 +/- Histone H3, identical to Hht2p HTB2 + Histone H2B, nearly identical to Htblp HTB1 + Histone H2B

HTA1 + Histone H2A, identical to Hta2p HTA2 + Histone H2A, identical to Hta1p HH01 + Histone H1 TEL2 + Protein involved in controlling telomere length and telomerre position effect ARP7 + Component of SWI-SNF and RSC
chromatin remodeling complex HTA3 + Histone-related protein that can suppress histone H4 point mutation HOS3 + Protein with similiarity to Hdai p, Rpd3p, Hos2p, and Hos1p Table 3.

Continued Mcm1/

Fkh2/

Gene SBF MBF Fkh1 Fkh2 Ace2 Swi5 Short description Ndd1 Mcm1 PrereplicationMCM3 + Protein that acts at ARS
elements complex to initiate replication CDC6 + + + Protein that regulates initiation of DNA replication CDC46+ Protein that acts at ARS
elements to initiate replication CDC45+ Protein required for initiation of chromosomal DNA replication MCM2 + Protein that acts at ARS
elements to initiate replication MCM6 + Protein involved in DNA
replication;

member of the MCM/P1 family of proteins Mating ASH1 + GATA-type transcription factor, negative regulator of HO expression AGA2 + a-Agglutinin binding subunit HO + Homothallic switching endonuclease MFA1 + Mating pheromone a-factor;
exported from cell by Ste6p MFA2 + Mating pheromone a-factor;
exported from cell by Ste6p STE6 + Membrane transporter responsible for export of "a" factor mating pheromone STE2 + Pheromone alpha-factor receptor;
has seven transmembrane segments FAR1 + Inhibitor of Cdc28p-CIn1p and Cdc28p-CIn2p kinase complexes A partial list of cell cycle genes whose promoter regions were bound by the indicated cell cycle regulators. +
indicates binding with P<0.001, +/- indicates binding with P<0.0015. A full list of target genes is available at the author's web site (http://web.wi.mit.edu/young/cellcycle). The DNA replication category includes genes that function in DNA synthesis, in DNA repair and in sister chromatid cohesion.

Functional Redundancy The factor location data demonstrate that each of the nine cell cycle transcription factors binds to critical cell cycle genes, yet cells with a single deletion of MBPl, SWI4, SWIG, FKHl, FKH2, ACE2, or SWIS are viable; only MCMI and NDDI are essential for yeast cell survival (Breeden Curr. Biol., 10: R586-R588(2000); Loy et al. Mol. Cell Biol., 19:3312-3327 (1999); Mendenhall et al., Mol. Biol. Rev., 62:1191-1243 (1998)). The conventional explanation for this observation is that each nonessential gene product shares its function with another.
Swi4 and Mbpl share 50% identity in their DNA binding domains (Koch et al.
Science, 261:1551-1557 (1993)). Similarly, Fkhl and Fkh2 are 72% identical (Kumar et al. Curr. Biol., 10: 896-906 (2000)), and SwiS and Ace2 are 83%
identical in their respective DNA binding domains (McBride et al. J. Biol. Chem., 274:21029-21036 (1999)). Each of these pairs of proteins recognizes similar DNA motifs, so it is likely that functional redundancy rescues cells with mutations in individual factors. However, it was not clear whether each of the pairs of factors had truly redundant functions in normal cells, or whether they exhibit redundant function only in mutant cells that lack the other factor.
The data described herein demonstrates that each of the cell cycle factor pairs discussed above does bind overlapping sets of genes in wild-type cells, revealing that the two members of each of the pairs are partially redundant in normal cell populations (Figures 14A-14B). Mbp 1 and Swi4 share 34% of their target genes, Fkhl and Fkh2 share 22%, and Ace2 and SwiS share 25%. It is also clear, however, that this redundancy does not apply to all genes regulated by a pair of related activators in wild-type cells. The partial overlap in genes under the control of pairs of regulators explains why one gene of a pair can rescue defects in the other, yet each member of the pair can be responsible for distinct functions in wild-type cells.
Discussion Identification of the transcriptional regulatory network that controls the cell cycle clock is essential to fully understand how cell cycle control is effected. As described herein, the genomic targets of each of the nine known yeast cell cycle regulators have now been identified using a combination of genome-wide location and expression analysis. The investigation revealed that a connected, circular transcriptional regulatory network has evolved to control the cell cycle, and showed how each of the transcriptional regulators contributes to diverse stage-specific functions Cell Cycle Transcriptional Regulatory Networks A key concept that emerged from this study is that cell cycle transcriptional control is effected by a connected regulatory network of transcriptional activators.
The cell cycle transcriptional regulators that function during one stage of the cell cycle regulate the transcriptional regulators that function during the next stage, and this serial regulation of transcriptional regulators forms a complete regulatory circuit. Thus, the transcriptional regulatory network that controls the cell cycle is itself a cycle of regulators regulating regulators. The discovery of this connected transcriptional regulatory network is important for several reasons. It provides additional understanding of the regulatory mechanism by which cells ensure transitions from one stage into the appropriate next stage. It supplies the foundation for future work on the mechanisms that coordinate gene expression and other aspects of cell cycle regulation. Furthermore, it suggest that a connected, circular transcriptional regulatory network is likely a fundamental feature of cell cycle regulation in other, more complex, organisms.
It is interesting to consider why cells have pairs of cell cycle transcriptional regulators with partially redundant functions. This configuration may help ensure that the cell cycle is completed efficiently, which is critical since the inability to complete the cycle leads to death. At the same time, devoting each of the pair to distinct functional groups of genes enables coordinate regulation of those functions.
It is also likely that partial redundancy helps the cell to make a smoother temporal transition from one mode of operation to another during the cell cycle.
The results described herein identify how the cyclin genes regulated by the nine transcriptional activators. In addition, the results reveal that transcription factors that regulate the cyclin genes during each phase of the cell cycle also regulate genes that are involved in transitioning to the next stage of the cycle (Figures 12A-12B). For example, the G1/S activators SBF and MBF control transcription of cyclin genes, but also regulate expression of G2/M cyclin Clb2, which subsequently inhibits further expression of the G1/S cyclins Cinl and Cin2 and promotes entry into mitosis. Thus, the cell cycle transcriptional regulatory network has evolved so that some transcriptional regulators contribute to the control of both stage entry and exit.
The identification of sets of genes that are bound by each of these regulators reveals how coordinate regulation of a wide variety of stage-specific cell cycle functions is regulated (Figure 13). For example, the G1/S activators regulate genes involved in cell budding, DNA replication and repair, and chromosome maintenance. The G2/M activators bind genes that regulate transition through mitosis. The late M factors regulate genes involved in cytokinesis and prereplication complex formation.
A more comprehensive picture of cell cycle regulation emerges when existing knowledge of cell cycle regulatory mechanisms is combined with the new information on the transcriptional regulatory network. Several key features of this integrated view have important implications for cell cycle regulation. Cells commit to a new cell cycle at START, but only after cell growth is sufficient to ensure completion of the cycle, since the inability to complete the cell cycle can be lethal (Mendenhall et al., Mol. Biol. Rev., 62:1191-1243 (1998)). The emphasis on regulation at the G1/S boundary is evident from the regulatory events involving Swi4 in the model shown in Figure 3B. The Swi4 regulator becomes functionally active at START, via a mechanism that is dependent on Cln3-Cdc28, when the cell reaches a critical size (Dirick et al., Embo. J., 14:4803-4813 (1995)). The promoter is bound by Swi4 itself, indicating that a positive feedback loop exists to ensure that adequate levels of Swi4, and thus, SBF, are present prior to commitment.
The observation that the G1/S regulators SBF and MBF both regulate NDDl suggests how adequate levels of Nddl are produced to initiate the G2/M
transcriptional program. Nddl protein is a limiting component of the complex that activates G2/M genes; Mcml and Fkh2 are bound to promoters throughout the cell cycle, and activation of G2/M genes is dependent on recruitment of Nddl (Koranda et al., Nature, 406: 94-98 (2000). The Mcml/Fkh2/Nddl complex regulates SWIS
and ACE2, whose products become functional only in late anaphase after relocalization to the nucleus in a mechanism that is dependent on low Clb-Cdc28 activity (Nasmyth et al., Cell, 62:631-647 (1990); Shirayama et al., Nature, 402:203-207 (1999)). Later in the cell cycle, the SwiS, Ace2, and Mcml factors all bind to the CLN3 promoter, thus assuring adequate levels of the Cln3 cyclin at START.
The cell cycle transcriptional regulatory network model accounts for several observations relevant to cell cycle regulation. The use of multiple transcription factors to regulate key transcription and cyclin regulators explains why mutations in single transcription factors generally have only limited effects on progression through the cell cycle, whereas mutations in activator pairs can have substantial effects (Breedon, Curr. Biol., 10:8586-R588(2000); Koch, et al., Science, 261:1551-1557 (1993); Mendenhall et al., Mol. Biol. Rev., 62:1191-1243 (1998)).
Nutrient limitation causes yeast cells to arrest cell cycle progression, but rather than counting at the time of nutrient limitation, the arrest is delayed until the cells reach G1 (Mendenhall et al., Mol. Biol. Rev., 62:1191-1243 (1998)). Cells that have entered the cell cycle at START may progress through an entire cycle because of the design of the connected transcriptional regulatory network (Figure 11B), and perhaps then arrest in Gl because of the requirement for adequate levels of CIn3/Cdc28. Several cell cycle checkpoint controls are mediated by regulation of Cdc28 activity (Mendenhall et al., Mol. Biol. Rev., 62:1191-1243 (1998)), but how Cdc28 activity affects the transcription program is not well understood. Since the activity of several of the cell cycle transcriptional regulators is dependent on Cdc28 activity, some checkpoint controls may effect arrest by perturbing the connected transcriptional regulatory circuit.
Importance of Direct Binding Information An impetus for the development of methods that identify the genomic binding sites of factors in vivo was the realization that regulatory networks cannot be accurately deduced from global expression profiles because it is not possible to discriminate between direct and indirect effects due to genetic or other perturbations in living cells (Ren et al., Science, 290:2306-2309 (2000)). A further challenge for understanding global gene regulation is that comparison of wild-type and mutant expression profiles produce valuable information on dependencies when the mutant gene is essential, but it is more difficult to interpret such information when the mutant gene can be rescued by functionally redundant gene products. It was found herein that the direct binding data obtained in the present study was remarkably confirming of previous evidence for gene regulation by specific transcription factors when that evidence was direct. In contrast, evidence in support of many studies in which the involvement of a factor in the regulation of a gene was deduced from indirect evidence was not obtained (Althoefer et al., Mol. Cell Biol., 15:5917-(1998); Gordon, et al., Proc. Natl. Acad. Sci., USA, 88:6058-6062 (1991);
Koch, et al., Science, 261:1551-1557 (1993); Lowndes et all. Nature, 350:247-250 (1991);
Platt et al., Embo J., 14:3788-3799 (1995); Pizzagalli et al., Proc. Natl.
Acad. Sci., USA, 85:3772-3776 (1988); Toone et al., (1995); Verma et al., Proc. Natl.
Acad.
Sci., USA, 88:7155-7158 (1991)).
The identification of the set of promoters bound in vivo by each of the cell cycle regulators allowed identification of consensus sequence motifs (see http://web.wi.mit.edu/young/cellcycle). Two general insights emerged from this analysis. First the binding motifs identified for some factors are found in most, but not all, of the promoters that they bind, indicating that variations of the consensus sequence exist that are not easily recognized by search algorithms or that the transcription factor is modified or associated with binding partners that generate a new binding preference at some genes. In this context, it is interesting that the Mcml binding motif is somewhat different in the promoters of its G2/M targets than in its M/G1 targets, probably reflecting the influence of its binding partners.
Second, the presence of the DNA binding motif in genomic DNA is not by itself a predictor of protein binding in vivo, as the predicted motifs are found at many sites in the genome other than those bound in vivo. There is, therefore, a need for empirical binding data such as that described here in order to accurately identify genuine binding sites.
Discovering Genetic Regulatory Networks Understanding how biological processes are regulated on a genomic scale is a fundamental problem for the coming decades. Maps of metabolic pathways have been key to studying basic biology, uncovering disease mechanisms, and discovering new drugs over the last century. Maps of genomic regulatory networks will play an equally important role in future biological discovery.
The location data presented herein are well adapted to new computational approaches to discovering genetic regulatory networks. The binding of a transcriptional activator to the promoter region of a gene indicates that the activator has a regulatory effect on the gene. However, it is also possible that the activator does not fully or even partially control the gene. Thus, location information must be fused with other data, such as expression data, to fully elaborate the complete mechanism of transcriptional regulation and the form of regulatory networks.
New computational approaches will synergistically combine location data with other data types to form a well-focused picture of cellular function. For example, one way to combine location and expression data is to use the location data to first suggest tentative factor-target pairs with associated p-values. These factor-target pairs represent constraints on the possible genetic regulatory network models, and they can be used to guide the search of network models based on expression data.
This process can discover alternative models of regulatory networks, with a principled measure of likelihood assigned to each hypothesis. The likelihood measure appropriately reflects how consistent the hypothesis is with both location and expression data. This likelihood-based approach can accommodate location data, expression data, and other forms of data (Ross-MacDonald, et al., Nature, 402:

418 (1999); Uetz, et al., Nature, 403:623-627 (2000)) that can be usefully employed to assign probabilities to potential interaction.

Example 4 STUDY DESIGN FOR SERIAL REGULATION OF
TRANSCRIPTIONAL REGULATORS
Serial Regulation of Transcriptional Regulators Study Design Genetic Reagents Oligo Table Strain List Technology Location Analysis Protocols Analysis Location Analysis Quality Control Search for Activator Binding Sites Download Datasets Table of Regulated Genes Previous Evidence of Regulation Gene Expression Data Alpha Factor Synchronization Insights Cell Cycle Regulation Additional Insights Summary Genetic Reagents The cell cycle activators Swi4, Mbpl, Swi6, Fkhl, Fkh2, Nddl, Mcml and Ace2 were tagged with a 9 or 18 copy myc epitope by inserting its coding sequence into the normal chromosomal loci of these genes. Vectors developed by K Nasmyth (Cosma et al., 1999) was used for recombination of the epitope coding sequence into the W303 strain 21256. The specific oligonucleotides used to generate PCR
products are described here. The PCR products were transformed into the strain 21256 to generate the tagged strains. Clones were selected for growth on TRP-plates, and the insertion was confirmed by PCR and expression of the epitope-tagged protein was confirmed by western blotting using an anti-Myc antibody (9E11). A

myc tagged version of SwiS (21407) was obtained from K Nasmyth.
Protocols - Location Analysis The chromatin imunoprecipitation part of that protocol is based on a protocol obtained from the Nasmyth lab and one from Hecht, A., Strahl-Bolsinger, S., and Grunstein, M. , "Spreading of transcriptional repressor SIR3 from telomeric heterochromatin," Nature 383,92-6 (1996). The Nasmyth protocol was optimized for use with W303a strains tagged with a Mycl8 epitope inserted at the C-terminus of various transcription factors (strains obtained from Pia Cosma).
~ Microarray Production ~ Location Analysis Protocols ~ Preparation of cells, cross linking, cell washing and storing ~ Cell lysis, sonication, and immunoprecipitation ~ Bead washing, elution from beads and reversal of cross linking ~ DNA precipitation ~ Blunting DNA and ligation of blunt DNA to linker ~ Ligation-mediated PCR
~ Pre-hybridization, probe preparation, hybridization and wash ~ Appendices:

~ Preparation of ma~etic beads ~ Preparation of unidirectional linker ~ Solutions U
E
C7 ~ H ~ ~ ~ H ~ H H ~ ~ U~
H ~ H~ d~.o d ~ t7 ~ U
c~ ~ c~ H ~t d ~ ~ °.°
C.~7 ~ ~ ~ ~ can U ~ EH-~ ~ ~ C7 coo ~ ~ Ea-~ ~ H ~ ~ ~ own H o~A
bUD ~ ~, U ~ ~ bQ ~ E"~ by ~ U
~U,. U d U ~ V (~ ~ V H U d d-0 d-0 E-d-~ ~ CN7 U E~.., H U U ~ E"'' ~ ~ ~ o~'~.o F-~ E~ r d H H ~ E-, C~,7 E-~ ~ U ~ F'' U
d ~ ~ E-' ~ U H H~ d E-' ~ ~ ~ d d Q a ~ H H U H H H U
d H U C7 ~ E.., U d E.-, E-~ ~ F-~ E-~ H
E-~r d ~ E'' ~' ~ U U ~ ~ ~ ~ U
E-, ~, U E-~ U C7 H d H U ~ ~ ~ C7 E..~.~ E-H E-~ U
H H
U ~ d ~ H H d U H H, ~
m U H ~ C.H7d C7U C~7U E~-~CU7 C~.7U dH
U ~ ~ ~ ~~,, can U ~ ~ ~ C7 tin C~ ~ H on pUp b~0 d U ~ V U U ~ V ~ ~ E-~ U
U' b1! p0 U" ~ ap ~ :~ U b-0 d ~ ~ ~ ~ ~ d v E-~ ~ E..., v U ~a"n U
U~U ~C'7~U~E-~~~U v :.~ U ~, C~ H ~ F., EU-~~~o~nd~ ~dU°nCU7o°~o U a-' ~ ~ d ~ y ~ ~ ~ ~ H ~ U
d U d U ~ U ~ U ~ U U d d ~ U H
E-~' C7 U U EH-~ ~ V H ~ E~'' U U E-~ ~ H
U U EE-~- ~ U U E'-' d ~ ~ U ~ ~ U U
H ~ E-~ H ~ H d U E~ EH-~ U U U H
d c~ d ~ ~ H U ~ H H C7 C~.7 d U ~ ~ ~ d U d U E-, H ~ U U ~ U
U ~ U Cd7 E-' ~ U H ~ H H ~ U U
U d ~"' E'" H H C7 H U
°~ C7UHHU~U~UUC7HHC7UU
d C.d7Cd.7 HH ~~ dU ~ UU
g E-~ ~ U C~ E-~ d C7 C7 C7 ~ ~ C'7 C7 ~, d U d~ d ~ E-~ U E-~ d d U (~ d ~ U U
U U
G .~r. ~'" '"' H ~ ~~ a\
~-"

C7 ~ ~ ~ ~ ~ U N
o.~ ~mMOOOO~
t~ ~O N l~
~n N N N N N N N N

GENE SEQ ID NO. Forward PrimerSEQ ID NO. Reverse Primer Strain List StrainGenotype 21256MATa, ade2-l, trill-l,-100, leu2-3,112, his3-11,15, canl ura3, GAL+, psi+

MATa, ade2-1, trill-l,-100, leu2-3,112, his3-11,15, canl ura3, GAL+,psi+, MBP 1::18-Myc-MBP

MATa, ade2-1, trill-1,-100, leu2-3,112, his3-11,15, canl ura3, GAL+,psi+, S WI4: :18-Myc-S

MATa, ade2-l, trill-l, canl-100, leu2-3,112, his3-11,15, ura3, GAL+,psi+, S WI6::18-Myc-S WI6 ' MATa, ade2-1, trill-1,-100, leu2-3,112, his3-11,15, canl ura3, GAL+,psi+, FKH 1: :9-Myc-FKH

MATa, ade2-l, trill-1,-100, leu2-3,112, his3-11,15, canl ura3, GAL+,psi+, FKH2::18-Myc-FKH2 MATa, ade2-l, trill-l, canl-100, leu2-3,112, his3-11,15, ura3, GAL+,psi+, NDD 1: :18-Myc-NDD

MATa, ade2-l, trill-1,100, leu2-3,112, his3-11,15, canl- ura3, GAL+,psi+, MCM 1: :18-Myc-MCM

MATa, ade2-l, trill-l,100, leu2-3,112, his3-11,15, canl- ura3, GAL+,psi+, ACE2::18-Myc-ACE2 MATa, ade2-1, trill-1, canl-100, leu2-3,112, his3-11,15, ura3, GAL+,psi+, Z

S WIS : :9-Myc-S
WIS

Technology - Location Analysis The genome-wide location analysis method we have developed (Ren et al., 2000) allows protein-DNA interactions to be monitored across the entire yeast genome.
The method combines a modified Chromatin Immunoprecipitation (ChIP) procedure, which has been previously used to study in vivo protein-DNA
interactions at one or a small number of specific DNA sites (Aparicio, O.M., in Current Protocols in Molecular Biology. F. M. Ausubel, et al., Eds. (John Wiley and Sons, Inc., New York, 1999) pp. 21.3.1-21.3.12; Orlando V., "Mapping chromosomal proteins in vivo by formaldehyde-crosslinked-chromatin immunoprecipitation," Trends Biochem Sci 25,99-104 (2000)), with DNA
microarray analysis. Briefly, cells are fixed with formaldehyde, harvested by sonication, and DNA fragments that are crosslinked to a protein of interest are enriched by immunoprecipitation with a specific antibody. After reversal of the crosslinking, the enriched DNA is amplified and labeled with a fluorescent dye using ligation-mediated PCR (LM-PCR). A sample of DNA that has not been enriched by immunoprecipitation is subjected to LM-PCR in the presence of a different fluorophore, and both IP-enriched and unenriched pools of labeled-DNA are hybridized to a single DNA microarray containing all yeast intergenic sequences.
The IP-enriched/unenriched ratio of fluorescence intensity obtained from three independent experiments and a p-value is assign to each spot according to an error model adapted from Roberts, C.J., et al., "Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles,"
Science 287,873-80 (2000). The average ratio is then calculated using a weighted average analysis method, providing the relative binding of the protein of interest to each sequence represented on the array.
Microarray design Yeast Intergenic DNA Array. Using the Yeast Intergenic Region Primer set (Research Genetics) we PCR amplified and printed 6361 spots, representing essentially all of the known intergenic regions in the yeast genome. The average size of the spotted PCR products was 480 bp, and the sizes ranged from 60 by to bp.
Yeast cells expressing an epitope-tagged protein of interest were used; a Myc-epitope coding sequence was integrated into the genome at the 3'-end of the coding sequence for each protein. Cultures of yeast cells were grown to OD600 of 0.8 under appropriate conditions prior to formaldehyde crosslinking. DNA amplification and labeling with LM-PCR was found to produce more reproducible results relative to amplification of enriched DNA as a library in E. coli. Superior and more reproducible results were also obtained when DNA preparations enriched by ChIP
were compared to unenriched DNA preparations (rather than DNA preparations obtained from an untagged strain subjected to ChIP).
Microarray Production The 6361 intergenic regions were amplified using the Yeast Intergenic Region Primers (Research Genetics) primer set. SOpL PCR reactions were performed in well plates with each primer pair with the following conditions: 0.25 pM of each primer, 20 ng of yeast genomic DNA, 250 ~M of each dNTP, 2 mIVI MgCl2, 1 X
PCR buffer (Perkin Elmer), and 0.875 units of Taq DNA polymerase (Perkin Elmer). PCR amplification was performed in MJ Research Thermocyclers beginning with 2 minute denaturation at 95°C, followed by 36 cycles of 30 seconds at 92°C, 45 seconds at 52°C, and 2 minutes at 72°C, with a final extension cycle of 7 minutes at 72°C. 1 ~L of each PCR reaction mix was then reamplified in a 100 pL
PCR
reaction using universal primers (Life Technologies) with the same reagent concentrations and the following thermocycling conditions: 3 minutes at 94 °C, followed by 25 cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 1 minute at 72°C, with a final extension cycle of 7 minutes at 72°C. Each PCR product was verified by gel electrophoresis. The PCR products were then isopropanol precipitated, washed with 70% ethanol, dried overnight, and resuspended in 20 ~L

of 3XSSC. The resuspended DNA was transfered to 384 well plates and printed on GAPS-coated slides (Corning) using a Cartesian robot (Cartesian Technologies).
The printed slides were rehydrated, snap-dried, and UV crosslinked in UV
Stratalinker (Stratagene) set at 60 mJoules. The slides were then stored under vacuum for at least 2 days prior to hybridization.
Preparation of Cells, Cross Linking, Cell Washing and Storing Step 1 - Preparation of cells and cross linking Inoculate fresh media from an overnight culture to OD600=0.1 and allow yeast to grow to OD600=0.6-1.0 (0D600=0.8 is commonly used).
~ The experiments are usually done in triplicate, which means you need to put up 3 overnight cultures (inoculated with 3 independent colonies from the same plate).
Remove 50 ml cells and add to 50 ml Falcon tubes (cat #352070) containing 1.4 ml of Formaldehyde (37% Formaldehyde stock, final concentration 1%, J.T.Baker cat.#2106-O 1 ).
~ Use the liquid dispenser for the formaldehyde and work in a fume hood.
Incubate for 20 minutes at room temperature on a rotating wheel.
~ For some proteins, you may have to optimize the incubation time with formaldehyde.
Transfer to 4°C and incubate overnight on a rotating wheel.
Step 1 a - Preparation of beads If you are planning to continue with the protocol the next day, you also need to incubate the magnetic beads with the anti-Myc antibody overnight.

************* Next steps should be done at 4° C *************
Step 1b - Washing and storage of cells Spin 50 ml Falcon tubes for S minutes at speed 6 (2800 rpm) in a tabletop centrifuge (Sorvall RT6000) to harvest the cells and pour off the supernatant.
Wash 3 times with ~40 ml cold TBS.
~ Add TBS, mix by inversion until the cells are resuspended, spin and pour off the supernatant.
After the last wash, resuspend the yeast pellet using any remaining liquid (add some, if necessary) and transfer to an Eppendorf tube.
Spin for 1 minute at maximum speed at 4°C and remove the remaining supernatant using a P-1000 pipette.
Snap freeze in liquid nitrogen and store at -80°C, or go directly to step 2.
Cell Lysis, Sonication, and Immunoprecipitation Step 2 - Cell lysis Thaw cell pellet on ice.
Resuspend in 700 p1 lysis buffer and transfer to a 1.5 ml Eppendorf tube (cat #2236320-4). ' Add the equivalent of a 0.5 ml PCR tube (USA/Scientific Cat.#1405-4400) of glass beads (425-600 u~m, Sigma Cat.# G-8772).
Vibrax-VXR at maximum power for 2 hours at 4°C.
Pierce the bottom of the tube with a needle (IJse Becton Dickinson Precision Glide 1861 1/2) and set up over a 2 ml screw cap tube.

Spin 3-4 seconds (the material should be transferred to the 2 ml tube, while the beads stay in the 1.5 ml tube).
~ Turn the centrifuge on, allow it to reach 7000rpm and then turn off.
Resuspend and transfer to a new 1.5 ml tube (be sure to have at least 700 p1 in each tube. Add lysis buffer to bring the volume up to 700 u1, as necessary. Smaller volumes may splash out during sonication).
Step 2a - Sonication Shear chromatin by sonicating 4 times for 20 seconds at power 1.5 using a Branson Sonifer 250 - use the'Hold' and 'Constant Power' settings. (This should result in sheared DNA with an average size of 400 bp).
~ Note: Keep samples on ice between each round of sonication. Immerse tip in sample first, turn the power on for 20 seconds, turn the power off and place sample back on ice. Wash the tip with water between sample types (it is not necessary to wash the tip between replicates from the same strain). Before and after use of the sonifier, rinse the tip with 98% EtOH.
Spin for 5 minutes at maximum speed at 4°C and transfer the supernatant to another tube on ice (Supernatant = yeast whole cell extract (yWCE)).
Step 2b - Immunoprecipitation Set up a new tube on ice containing: S00 ~l of yWCE and 30 p1 of a suspension of washed magnetic beads pre-bound to anti-Myc antibody.
~ Vortex the beads well before removing each 30 p1 aliquot to ensure equal amounts of beads are added to each tube and that the beads remain in suspension. Set aside S p1 of WCE in a separate tube (to label as a control later) and store it and the rest of the yWCE at -20°C.

Incubate overnight on a rotating platform at 4°C.
Bead Washing, Elution from Beads and Reversal of Cross Linking Step 3 - Bead Washing *********** Work in the Cold Room ***********
Wash beads using appropriate device (e.g. MPC-E magnet, Dynal), as follows:
~ Put the first 6 tubes into magnet, invert the tubes once, open the tubes and aspirate the supernatant using a vacuum (also aspirate what is left in the cap), add the appropriate washing solution, close the tubes and put them back on the rotating platform. Proceed with the next 6 tubes and so on. Don't forget to turn the rotator on while you are aspirating the supernatant from the next set of tubes etc.
~ For this step, you don't need to add protease inhibitors to the lysis buffer.
Wash 2 times with 1 ml lysis buffer.
Wash 2 times with 1 ml lysis buffer containing an additional 360 mM NaCl ~ 720 p1 of 5 M NaCl in 10 ml lysis buffer - the final concentration of NaCI
is 500 mM.
Wash 2 times with lml wash buffer.
Wash once with 1 ml TE.
After you have removed the TE by aspiration, spin the tubes for 3 minutes at rpm and remove any remaining liquid with a pipette.
Step 3a - Elution from beads and reversal of cross links Add 50 ~1 elution buffer, vortex briefly to resuspend the beads and incubate at 65°C
for 10 minutes. Vortex briefly every 2 minutes during the incubation.

********The next steps should be done at room temperature********
Spin for 30 seconds at maximum speed and transfer 30 ~l of supernatant to a new tube. Discard the rest (unless have a special reason to keep it).
Add 120 w1 of TE/SDS to the supernatant in the new tube in order to reverse the crosslinking reaction.
Also add 95 ~.l of TE/SDS to 5 ~l of yWCE (prepare one yWCE for each IP).
Incubate overnight at 65°C in an incubator.
DNA Precipitation Step 4 - Precipitation of DNA
Add 150 ~,l of "proteinase K mix" to each sample.
Incubate for 2 hours at 37°C in the warm room.
Extract 2 times with 1 volume of phenol (Sigma Cat. P-4557; OK to use at 4°C).
Spin for about 5 minutes at room temperature for each extraction.
Extract once with 1 volume of chloroform/isoamyl alcohol (Sigma Cat.C-0549).
Add NaCI to 200 mM final (use 8 ~ul of 5 M stock for 200 q1 of sample).
Add 2 volumes of cold EtOH and vortex briefly.
Incubate at -20°C for at least 15 minutes.
Spin at 14,000 rpm for 10 minutes at 4°C.
Pour off the supernatant, add 1 ml cold 70% EtOH, vortex briefly and spin at 14,000 rpm for 5 minutes at 4°C.
Pour off the supernatant, spin briefly and remove the remaining liquid with a pipette.

Let the pellet dry for a couple of minutes and resuspend the pellet in 30 ~l TE
containing 10 ~g RNaseA (add 33 p1 of 10 mg/ml RNaseA to 1 ml of TE).
Incubate for 1 hour at 37°C in the warm room.
Purify using Qiagen PCR purification kit. Elute with 50 p1 of 10 mM Tris pH

Store at -20°C or place on ice and proceed to step 5.
Stop at this stage if you are just going to do a gene-specific PCR, without hybridizing to glass slide arrays.
Blunting DNA and Ligation of Blunt DNA to Linker Step 5 - Blunting DNA
In seperate PCR tubes, place 40 ~ul of immunoprecipitated DNA and 1 ~ul of whole cell extract DNA plus 39 p1 ddH20. Place on ice. Save the the ramaining DNAs at -20°C for gene specific PCR analysis.
Note: If you are going to do a "WCE vs WCE control" (recommended), make 2 extra samples with 1 ~1 whole cell extract DNA + 39 p1 ddH20, using the same whole cell extract DNA for each.
Add 70p1 of:
11 ~1 (10X) T4 DNA pol buffer (NE Biolabs cat #007-203) 0.5 ~1 BSA (10 rng/ml) (NE Biolabs cat #007-BSA) 0.5 ~,1 dI~TTP mix (20 mM each) 0.2 ~1 T4 DNA pol (3U/~~,1) (NE Biolabs cat #203L) 57.8 ~,l ddH20 70 ~,l Total Mix by pipetting and incubate at 12°C for 20 minutes in a PCR
machine The program name is "12/20", under "Main" in the 2 heads PCR machine. Do not use the heated lid option.
Place on ice and add 12 ~l of:
11.5 ~,l 3M NaOAc 0.5 ~l glycogen (20 mg/ml) (Roche Molecular Biochemicals cat #901393) 12 ~,l Total Mix, by vortexing, and add 120 ~l of phenol/chloroform/isoamyl alcohol (25:24:
l, Sigma cat.P-3803).
Vortex to mix and spin 5 minutes at maximum speed.
Transfer 110 p1 to a new 1.5 ml Eppendorf tube and add 230 ~I cold EtOH
(100%).
Vortex to mix and spin for 15 minutes at 4°C.
Pour off supernatant and wash pellet with S00 u1 cold 70% EtOH.
Spin for S minutes at 4°C.

Pour off supernatant, spin briefly and remove any remaining liquid with pipette.
Allow to air dry briefly.
Resuspend pellet in 25 p1 ddH~O and place on ice.
Step Sa - Ligation of blunt DNA to linker Add 25 u1 of cold ligase mix:
8 p1 ddH20 ~,l SX DNA ligase buffer (GibcoBRL) 6.7 ~l annealed linkers (15 ~,M) (see appendix #2) 0.5 ~l T4 DNA ligase (Life Technologies) 2~.2 ~,l Total Mix by pipetting and incubate overnight at 16°C.
Ligation-mediated PCR

Step 6 - Ligation-mediated PCR
Add 6 ~l of 3M NaOAc (pH 5.2) to linker-ligated DNA. Mix by vortexing and add 130 ~l cold EtOH.
Mix by vortexing and spin for 15 minutes at 4°C.
Pour off supernatant and wash with S00 p1 70% EtOH.
Spin for 5 minutes at 4°C.
Pour off supernatant, spin and remove any remaining liquid with a pipette.
Resuspend in 25 p1 ddH20 and place on ice.
Add 15 q1 of PCR labeling mix:
4 ~,1 l OX ThermoPol reaction buffer (NE Biolabs) x.75 ~,l ddH20 2 ~.l low T mix (~ mM each dATP, dCTP, dGTP; 2 mM dTTP) 2 ~,l Cy3-dUTP or Cy5-dUTP (use Cy5 for IP DNA and Cy3 for WCE
DNA) 1.25 ~1 oligo oJW 102 (40 ~,M stock) 1 S ~,l Total Try to use Cy3 or Cy5 from the same batch i.e. avoid mixing batches.

Transfer to PCR tubes on ice, place in PCR machine and start program "Cy3" or Cy5" (the programs are stored under "Main" in our PCR machines or under "FR"
in the tetrad PCR machine in the back room):
Step Time/Instruction Temp. Notes 1 2 min 55°C (make this longer if you have a lot of samples) 2 S min 72°C
3 2 min 95°C
4 30 sec 95°C
30 sec 55°C
6 1 min 72 ° C
7 go to step 4 for X* more times 8 4 min 72°C
9 hold 4°C
*32 cycles (total) for Cy5 and 34 cycles for Cy3 Add 10 p l of polymerise mix during step 1 of PCR:
8 ~,l ddH20 1 ~l lOX ThermoPol reaction buffer (NE Biolabs) 1 ~,l Taq polymerise (S U/~,1) (Perkin Elmer: Use Cat. #N801-0060 i.e. regular Taq., do not use AmpliTaq Gold) 0.01 ~,1 PFU Turbo (2.5 U/ql) (Stratagene Cat #600250-Sl) ~.1 Total Run S q1 on a 1.5% agarose gel. (The PCR product should be a smear ranging from 200 by to 600 by with an average size of 400 bp).
Purify with Qiaquick PCR purification kit. Elute in 50 p1.
Add 6 q1 3M NaOAc, mix and add 130 q1 cold EtOH.
Mix and spin for 15 minutes at 4°C.
Pour off supernatant and wash with 500 ~l of 70% EtOH.
Spin for 5 minutes at 4°C.
Pour off supernatant, spin and remove any remaining liquid with a pipette.
Store PCR products at -20°C. Keep in a closed box to prevent exposure to light.

Pre-hybridization, Probe Preparation, Hybridization and Wash Step 7 - Pre-hybridization Incubate slide in 3.5X SSC, 0.1% SDS, 10 mg/ml BSA for 20 minutes at room temperature with agitation (use a stir bar on setting "5") and then 20 minutes at SO°C
suW g a pre-warmed solution (place Coplin jar in water bath; use a fresh solution).
Wash slide using RO water.
Blow-dry with nitrogen or by placing slides in a rack and spinning in a centrifuge for 2 min @ 1 krpm.
Step 7a - Probe preparation During slide pre-hybridization, resuspend each target in 30 p1 of 3X SSC, 0.1%
SDS
(these may be hard to resuspend, place in 37°C heat block and vortex if necessary.
This may take 30-45 min.).
Mix both Cy5 and Cy3 resuspended target, add 4 ~,l of tRNA (8 mg/ml) and mix well by vortexing.
Boil for 5 minutes in a heat block.
Incubate for 5 minutes at 50°C.
Spin briefly.
Step 7b - Hybridization Pipette 50 ~,l of probe onto slide and drop cover slip (use the big one so that it will cover the entire array) onto the liquid. Try to avoid bubbles as they exclude the hybridization solution.
Add water to the holes in the hybridization chamber.
Assemble the chambers and submerge right side up in a 50°C water bath, allow hybridizing for 20-24 hours.

Step 7c - Wash Disassemble hybridization chambers with the right side up.
Remove coverslip and immediately place slide in O.1X SSC, 0.1% SDS at room temperature for 8 minutes with agitation.
Transfer to O.1X SSC for 5 minutes with agitation.
Note: Tranfer slide by slide (do not transfer the whole rack). Rotate slides 180° along the long edge when transfering.
Repeat O.1X SSC wash 2 more times.
Dry by placing slides in a rack and spinning in a centrifuge for 2 min @ 1 krpm and scan immediately or store in the dark until scanning.
Preparation of Magnetic Beads ********* Prepare the day before use *********
Take 50 p1 of beads (4 x108 beads/ml stock e.g. 2X 10' beads per sample) and place in a 15 ml Falcon tube. Use Dynabeads M-450 pre-coated with rat anti-mouse IgG-2a; Cat.#110.13.
Spin for 1 minute at speed 6 (3000 rpm) in a tabletop centrifuge (Sorvall RT6000).
Remove supernatant with a pipette and resuspend in 10 ml 'PBS containing 5mg/ml BSA (make immediately before use from Sigma BSA powder, cat. A-3350).
Wash again.
Incubate overnight with antibody on a rotating platform at 4°C (Use 1 p1 of anti-Myc 9E11 antibody plus 250 p.1 PBS + 5 mg/ml BSA per 50 p,1 of beads).
Note: The 9E11 antibody we are using has been purified from acites and concentrated. The amount used has been determined empirically so that the beads are saturated.

_77_ Spin for 1 minute at speed 6 (3000 rpm) in a tabletop centrifuge (Sorvall RT6000).
Remove supernatant with a pipette and resuspend in 10 ml PBS containing Smg/ml BSA (make immediately before use, as above).
Wash again.
Resuspend each sample in 30 ~l PBS containing Smg/ml BSA.
Preparation of Unidirectional Linker Mix the following:
250 ~l Tris-HCl (1M) pH 7.9 375 ~,1 oligo oJW102 (40 ~.M stock) 375 ~,1 oligo oJW103 (40 ~,M stock) oJW 102: GCGGTGACCCGGGAGATCTGAATTC (SEQ m NO: 29) oJW103: GAATTCAGATC (SEQ m NO: 30) NOTE: Order these oligos dessicated, then resuspend in ddH20.
Make SO or 100p1 aliquots in Eppendorf tubes.
Place in a 95°C heat block for 5 minutes.
Transfer samples to a 70°C heat block (there should be water in the holes).
Place the block at room temperature and allow it to cool to 25°C.
Transfer the block to 4°C and allow to stand overnight.
Store at -20°C.
Solutions _78_ TBS (store at 4°Cl 1X 5X for 1L of 5X
20 mM Tris-HCl pH7.5 100 mM Tris-HCl pH 7.5 100 ml of 1M
150 mM NaCI 750 mM NaCI 150 ml of 5M
Lysis Buffer (make fresh with cold ddH2~
1X for 150 ml for 5 ml 50 mM HEPES-KOH pH7.5 7.5 ml of 1 M 250 ~,l of 140 mM NaCI 4.2 ml of 5 M 140 ~,l of 1 mM EDTA 300 p~,l of 500 10 ~,1 of 500 mM mM

1% Triton X-100 15 ml of 10% 500 ~l of 10%

0.1% Na-deoxycholate 3 ml of 5% 100 ~,l of 5%

1 mM PMSF, 1mM Benzamidine1.5 ml of 100X 50 ~1 of 100X

~~,g/ml Aprotinin, 1.5 ml of 100X 50 ~,l of 1 1 ~~,g/ml OOX

Leupeptin 1 ~~g/ml Pepstatin 1.5 ml of 100X 50 ~l of 1 OOX

Wash Buffer (store at 4C~

1X for 500 ml 10 mM Tris-HCl pH 8.0 5 ml of 1 M

250 mM LiCI 25 ml of 5 M

0.5% NP40 2.5 ml of 100%

0.5% Na-deoxycholate 25 ml of 10%

1 mM EDTA 1 ml of 500 mM

Elution buffer (make with ddHzO, store at room temperature) 1 X for 100 ml 50 mM Tris-HC1 pH8.0 5 ml of 1 M
10 mM EDTA 2 ml of 500 mM
1 % SDS 10 ml of 10%
TE/SDS (make with ddH20 store at room tem~eraturel 1X for 500 ml 10 mM Tris HC1 pH8.0 5 ml of 1 M
1 mM EDTA 1 ml of 500 mM
1%SDS 5~

Proteinase K mix (make fresh For 1 sample For 26 samples 140 ~1 of TE 3640 ~l 3 ~l of glycogen (Boehringer cat# 901393) 78 u1 7.5 ~l of proteinase K (20 mg/ml stock) (Gibco 25530-049) 19~ ~l 20X for 1L solution 3 M NaCI 175.32 g 0.3M Na3citratew2H20 88.23 g pH"d to 7.0 with HCl PMSFBenzamidine mix 100X stock~aliquot and store at -20°C~
1X For 10 ml of 100X
1 mM PMSF 0.1742 g 1 mM Benzamidine 0.1566 g EtOH Bring to a volume of 10 ml Aprotinin/Leupeptinin mix 1 OOX stock~aliduot and store at -20°C~
1X For 10 ml of 100X
~g/ml Aprotinin 0.01 g 1 ~g/ml Leupeptin 0.001 g ddHzO Bring to a volume of 10 ml Pepstatin mix 100X (aliguot and store at -20°C~
1X For 10 ml of 100X
1 ~g/ml Pepstatin 0.001 g DMSO Bring to a volume of 10 ml Location Analysis DNA microarrays with consistent spot quality and even signal background were important for maximizing reproducibility and dynamic range. The LM-PCR method described here was developed to permit reproducible amplification of very small amounts of DNA; signals for greater than 99.8% of genes were essentially identical within the error range (p-value <= 10-3) when independent samples of 1 ng of genomic DNA were amplified with the LM-PCR method. Each experiment was carried out in triplicate, allowing an assessment of the reproducibility of the binding data. Furthermore, a single-array error model was adopted to handle noise associated with low intensity spots and to average repeated experiments with appropriate weights.
Location Analysis: From Scanning Image to Intensity Images of Cy3 and Cy5 fluorescence intensities were generated by scanning the arrays using a GSI Lumonics Scanner. The Cy3 and Cy5 images were analyzed using ArrayVision software, which defined the grid of spots and quantified the average intensity of each spot and the surrounding background intensity. The background intensity was subtracted from the spot intensity to give the final calculated spot intensity. The intensities of all of the spots from the Cy5 and Cy3 scans were summed, and the ratio of total Cy5/Cy3 intensity was set equal to one. For each spot the ratio of corrected Cy5/Cy3 intensity was computed.
Location Analysis: Single Array Error Model The quantitative amplification of small amounts of DNA generates some ~.mcertainty in values for the low intensity spots. In order to track that uncertainty and average repeated experiments with appropriate related weights, we adopted an single-array error model that was first described by Roberts, C.J., et al., " Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles," Science 287,873-80 (2000). According to this error model, the significance of a measured ratio at a spot is defined by a statistic X, which takes the form (1) where a, , are the intensities measured in the two channels for each spot, ~
,,Z are the uncertainties due to background subtraction, and f is a fractional multiplicative error such as would come from hybridization non-uniformities, fluctuations in the dye incorporation efficiency, scanner gain fluctuations, etc. X is approximately normal. The parameters ~-~ and f were chosen such that X has unit variance.
The significance of a change of magnitude ~x~ is then calculated as (2) p = 2(1-Erf(~X~)) Location Analysis: Weighted Average From Triplicate Measurements For each factor, three independent experiments were performed and each of the three samples were analyzed individually using a single-array error model. The average binding ratio and associated p-value from the triplicate experiments were calculated using a weighted average analysis method (Roberts, C.J., et al., " Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles," Science 287,873-80 (2000)).
The method to combine repeated measurements of chromosomal binding is adapted, with a few modifications, from a method by developed by Roberts, C.J., et al., "
Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles," Science 287,873-80 (2000) to average multiple measurements of gene expression. Briefly, the binding ratio is expressed as the log~o(az/a,), where a~,az are the intensities measured in the two channels for each spot. The uncertainty in the log(Ratio) is defined as r (3) ~6~,;~~J.G.t~~ ~ ~~:6 ~- ~O~tCn~~~a' s~.l,~ .,s where X is the statistics derived from single array error model. We use the minimum-variance weighted average to compute the mean log,o(a2/a,) of each spot:
(5) s' - . r'1' i :~ i ~ ~ ~"~
k z,cv Here '~~ ; is the error of log,o(a2/a,) from (3), x; stands for i-th measurement of log~o(a,,/a1), n is the number of repeats.
The error of ~" can be computed in two ways. One is to propagate the errors ~
; , another is from the scatter of x;:
,., For the average of multiple slides, the significance statistic X is computed as:
and the confidence is computed using Equation (2) from the single array error model.
Location Analysis: Gene Assignment The intergenic regions present on the array were assigned to the gene or genes found transcriptionally downstream. In some cases, a single intergenic region contains the promoter for two divergently transcribed genes (e.g. HHF2 and HHT2 or CLN2 and BBP1). In such cases, the intergenic region was assigned to both genes, and gene expression data were used to "discipline" the binding location data. This was accomplished by selecting genes whose promoters were bound by factors and whose expression oscillates during the cell cycle. Among genes whose promoters were bound by at least one of the factors and which were expressed in a cell cycle-dependent fashion, we found only 18 examples of intergenic regions that lie at the center of divergently transcribed genes.
Motif Search In order to identify DNA binding motifs we used a set of promoters commonly regulated by a transcription factor (withp<0.001) as input for AlignACE
(Hughes, J.
D., et al, JMoI Biol 296, 1205-14 (2000)). We ran the program with the default parameters, adjusting only the parameter that defines the size of the expected motif (numcolumn), which we systematically explored within 7 to 25 nucleotides. The identified motifs were run on ScanACE and on Motifstats (Hughes, J. D., et al, J
Mol Biol 296, 1205-14 (2000)) in order to assign motif specificity to the group of promoters that were used as input. In order to determine which promoter contains a given motif, we used ScanACE, and we included all the promoters with scores greater than one standard deviation below the average score of the sites found in the initial AlignACE search.
Statistics In order to explore the statistical significance of the overlap between the set of targets of a factor and the genes expressed in a particular cell cycle stage we used the hypergeometric distribution as described (Tavazoie, S., et al., "Systematic determination of genetic network architecture," Nat Genet 22, 281-5., (1999)) Data and Quality Control Two measures of quality control are described here. First, scatter plots for the array data obtained in each of the experiments are provided. Second, we compare results of these experiments with results reported previously by other investigators.
Comparison to Literature All but one of the transcription factor-promoter interactions previously established in vivo were confirmed by the location data, even when the highest stringency criteria was used (p<0.001). We confirmed that Meml, Fkh2 and Nddl bind to the CLB2, SWIS and YJL051 W promoters (Zhu et al. Nature, 40G: 90-94 (2000); Koranda et al., Nature, 406: 94-98 (2000)), SBF binds to the CLN2 promoter (Koch, C., et al., Genes Dev 10, 129-41 (1996)), Mcml binds to the STE2 promoter (Zhu et al.
Nature, 406: 90-94 (2000)), and Swi4 binds to the HO promoter (Cosma, M. P., et al., Cell 97, 299-311 (1999)).
We did not observe SwiS binding to the HO promoter, which also occurs in vivo (Cosma, M. P., et al., "Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter,"
Cell 97, 299-311 (1999)), because SwiS binding can be detected only in synchronized cells, and even then only transiently (5 minutes duration) (Cosma, M. P., et al., "Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter," Cell 97, 299-311 (1999)).
Additional genes have been suggested as targets of these cell cycle transcription factors based on indirect evidence, but our data do not confirm that all of these genes are direct targets of these regulators (Althoefer, H., et al., "Mcml is required to coordinate G2-specific transcription in Saccharomyces cerevisiae," Mol Cell Biol 15, 5917-28 (1995); Piatti, S., et al., "Cdc6 is an unstable protein whose de novo synthesis in G1 is important for the onset of S phase and for preventing a 'reductionaf anaphase in the budding yeast Saccharomyces cerevisiae," Embo J
14, 3788-99 (1995); Toone et al., 1995; Verma, R., et al., "Identification and -8 $-purification of a factor that binds to the Mlu I cell cycle box of yeast DNA
replication genes," Proc Natl Acad Sci U S A 88, 7155-9 (1991 ); Koch. et al.
Science, 261:1551-1557 (1993); Cordon, C. B., and Campbell, J. L., "A cell cycle-responsive transcriptional control element and a negative control element in the gene encoding DICTA polymerise alpha in Saccharomyces cerevisiae," Proc Natl Acad Sci USA
88, 6058-62 (1991); Pizzagalli, A., et al., "DNA polymerise I gene of Saccharomyces cerevisiae: nucleotide sequence, mapping of a temperature-sensitive mutation, and protein homology with other DNA polymerises," Proc Natl Acad Sci U S A 85, 3772-6 (1988); Igual, J. C., et al., "Coordinated regulation of gene expression by the cell cycle transcription factor Swi4 and the protein kinase C MAP kinase pathway for yeast cell integrity," Embo J 15, 5001-13 (1996); Lowndes, N. F., et al., "Coordination of expression of DNA synthesis genes in budding yeast by a cell-cycle regulated trans factor," Nature 350, 247-50 (1991)).
Download Raw Data The raw data for the location analysis experiments for each of the nine cell cycle activators are available as a single text file with each column separated by tabs.
Descriptions of the contents of each column are provided in the first two rows.
'spot name' refers to an intergenic region. It has been assigned a systematic name that includes the letter'i' followed by the systematic ORF name that is to the left of the intergenic region.
'pcr quality' is a qualitative description of the pcr products as seen on an acrylamide gel. 'good' means that the band was the correct size and cleary visible. 'w' indicates that the band intensity was 'weak', 'vw' indicates 'very weak' intensity. 'no' means that no band was seen, and 's' indicates that the size of the band was not what was expected.
'# of promoters on spot' denotes the number of genes which the intergenic region contains promoters for. 'assigned gene' is the name of each orf whose promoter is contained in the given intergenic region, 'Orf is the gene name.

'p-value' and 'average ratio' are the combined values for replicate experiments for each of the factors tested.
The last columns in the file are the cell cycle stage as described by Spellman, P. T., et al., Mol Biol Cell 9, 3273-97 (1998), the phase of the gene, and the cell cycle stage as described by Cho, R. J., et al., Mol Cell 2, 65-73 (1998).
Serial Regulation of Transcriptional Regulators in the Yeast Cell Cycle Genomic binding sites were identified for the nine known yeast cell cycle transcription activators, revealing how these factors coordinately regulate global gene expression and diverse stage-specific functions to produce a continuous cycle of events. One fundamental insight that emerged from these results is that a complete transcriptional regulatory circuit is formed by activator complexes that control next-stage activators. The results also show that stage-specific activator complexes regulate genes encoding CDK regulators necessary for both stage entry and for progression into the next stage of the cell cycle. This global information provides a map of the regulatory network that controls the cell cycle.

_87_ r y, y L o '° >, ~; :~ U '~ °?
y n N '~ j Q~ YC r ~' J1 N O ~ v~ N N y f3.: h U N
~ ~"' ,~- ~ U
.O ~ p C/) U
'~ U.o~G~~U_r.
f~ ~ ~-r 'C ~_" .~_. G~
cC O O U 4=" ., Wit' L~ v; r' . ~ O
r -~ ~ ._.~ ~ ~ O ~ ~ ~ GU
_ ~ ~ N
U N O
'='~O ~~ ~i'Y _~Y~Qj O v~ ~ ~ vo O ~ U ~ , ~ ~ .N
~~ 10 - 00 '~ N ~ ~U ~ ~ ~, cC
-, o eiN .>,o due' o r U ~. ~. ~ ~ ~ °~ v U a~
N
O
' U
r U -r c G ._ w N
V r v L Z' N_ L
r L
~
U
r U
r_ v a1 .v cp ~ U
U e: v~ c~

U
a~
U ~ 0 0 0 J J
r r U U c o 0 U U U
O ~_ U U _U
bn O U U U
U J U
C_ V N N
U U

_88_ >, y .U ~ .U
O ~ O 4:., ~ ~
_,~ _ ~: ; U .=, i bA O bIJ O N O cU-3 r p ø, ,~. ~ ,~ O'J
., 00 ~ v: O ~ .... N
00 . ~ U
U ~~ C, U V = _: v n. '~ ~s r .= ~ = r~ ~ ~ U
y ~ y a~ a~
~ ~ - ~ ~ '~ c ~ -o r.~U>,~,.U>.~ O
c~ .~ V O '" ,j' p = >, C U > cn N > c~ W p .~ N ci~
U ~ . ~ . .r."". ~, ,r, N r~ C!~ cUn . . ~ ca ;. ~ z ~; ~ z . o U ~ m c~ ~ m ~ ~ ~ - ~ ~. c~ v + + + +
+ + -f-m 3 U
Ci U v? a., y o 0 0 0 w V O O O p U
V ~ U U
U U
U U U U V
~_ U U U U U
U U U

...
r e~ ~ a; ap . . o r~ ~..r o c~G > ~ ~ . C, °) +r ~ C ~ cn ~; O ~ ~ U
~ ~ .. ~ ~ r -' N > a>
U .~ ~ V U U y ~ c~ ~, c~0 cd V U O ~ r ~ cG Ti > y U .-.Ur U w _c/~ U r r:: = .~ O O U 'w N 'J-0 U
w c~.: O U
U U > U r U . O" O
U U U U cn O ~ U b ~ ~ ~ ~ ~ U
U
Vj ~_ W%? ~ ~ ~ ~N U O ~r~~ ''" 'N O
W ~ ~ i 'r "r-i .-~.~ .-U~ ..'"~r ~ N U ,tU-~ ~ :~ '~ ~ it N .7 r E.., ...., ~ C:.w CJ r OU C~ ~r' .~ C/~ ~-- U O "'' c~ ~L
-i -i r I
N N
i U U O
O O p '-' s. Y O
.u ~~ . C
~i U J
I U U U U
II U U
U U
U U U U

G

o ~ ,~ ~ :~ ~s ~.
a,, .~ ~ ~ U
U ' G~ ~ ~_ ~ _c~~ C.., ~ cC
U .~.~ v ... .r, _ Cr-~~d N vU7 t. = ~ "S ~ x cu y ~' cG
r4 cn ~ ~ U '-.~, rU~, ~ L ...U, ~ _N :..., G~'., n c~
~U ~ ~ C G
G C ~ ~: ~ U
c~G ~ ~ ~ r, = O U
.= C3 U ~ U .,~ ~ bl~
vi U > U ~ ~ ~ ~_ C
v, ~ J r, .O '. O
. U fsA .
~, N N p ~ b tcf C7 L 2 U U Z U ~
U
E I
(' -.; ~ U
U va AU., ,~ Q

U
U 'U U U O
U U U U U
i ~_ J J U U U
U

O O _. U ~ U
. U C,.~., '~-_rn U ~ :7 v' O , O
U U_ x ~_~ .~ "~'' ~ o '~ O ' .N O
U ~~ t,_.i U U N a. U .' v~ N ~ ~ ~ ~ c'"~
.N _ ~ .N ~ ~ U O N U
.O ~ ~ U c O U O N U
N ~ .rUn ~ .U . vU .. .by v~U~ _N U_ CJ ..,~ w ~ . 'O by U ~ N N
~ va U U ~ U
rt T

N ...
N
Q
O_ O
;_, ~ O
:r O O O O
U U CU U

U U U U
I V V U U
U U

. -, ~ ~ ,~ c >" cu ~_ U o °
° 'r "_ . ~. U .j :.~ v ~r I O v7 " -O ~ Q ~ . '~ ~. ..~.
Vl Cv y - ~ ~ Q 00 O
c~-3~..~,r'J.~p~yw ~;~UU
O :.., c~ U O :r .> j, v Q ~ ~ U
U i' ~ U
QC~,ALCCi. O~ 'U JU
G.rOa_j~ ~~0~~ ~c.-, ~ ~ r- 'v~ I ~ a~
C~~UC~OG"Un OO.~C\/~
r. ~ '.. Q .O
V
-i + +
~ ~ + , T
C I
'J N
"~ N
,'" U vi U

U U U U
N U U U
U U
U U
U U
U U
U U U

cn o ~~ :.-i v-' r '~ ~ ~ ,c~u ;x a~ ,~ ,r" ~i ~ ~ L
. N . ~ O ,=r U c3 0., 0 . ~ ..~. O U
:-. O ~, a~ O
U U ~ ~ . ,.: c/yn ~ C1. . ~ ~ ~ . cG
W, c3 'Cl ... ~ ~ ~ N ~ O ~ ~.:
0.,~~00._:~~ y~U~re~~"
~ O ~ V ..x ~,r7 ~' U c~ O ~ v -O ~, O . U bJJ ~ L/~ 4i ~ N ~
U N .~ ~ s .~ ~ ~ on 5 ~.
a~
.° ' :~ O ~ c~ a~ ~, "~ a c~. ~ i N ~ p0 , ~ cC O ~U j O V ~ 5p ~ N r...T. y = ~ T7 ~ .'", s:._~3~ U =V.~~ r0 -_-y,.~~O
v Qj r' N U 7 :. O > rr~ aW
U U U U ~ L. U ~ U
-f-N ~ -.~ N
w n _ U H
U ~ W
on ~
I o 0 U U
'~ "O 'C
b U U

a> ~_ c~ ' ~' ' ~ a~ _a~ ~C
N O .3 x N _c~ c~
can O "'' b ~ i n a~ c ~ ~ u. .b o ~, ~o o w ~, o ~. ~ o ~ ° ~ ~ w ~, 'b ;~ ~ o o r-, O.fl c~U S~-,.~.~ G~Jc~C~ t'n~ObU
V ~.. 3 ~ ~ .5~., v~ V . ,-i", ,-' "' O .-. 'G cd f..~
w ~_*'' G~ ~ ~ O 'r" ~" ~ ~ i O .~ ~ ~b ~ N ~ >, ~ O V
..N~ .y.~ ~s.O..~G~O.~~OC~~,GO.C:~rii~0 ~I1, ~~' ~~,.~~'pb'b0. ~~cd~~~'~~,., Gr'r~nC/~~~~C~~Od~OU~O~f3J
-f- +
-f- -y N ~-r ~ Ov U
CD GO b4 bA b~ bl~
.', .'., ..., b ~C 'O b b 'b 'b 'b 'b 'fl 'b 'b :r ~ O

b b ~ b > ~ ~ '"
y ~ ~ V .~ ,O U
_ .; U
~_ '~ CC
L7. 4--yU/l tn O
N ~ ~, Q. O
_ ..~ ~ ~ cd O
U ~, U y b0 3 . ~ 'O c~~C bLl 'b ~ C '*~ ~' C r;
.O ..d p sc~.,.. '~' O GOD ~ cii O
.D ~ O 0~.. ~ Q. c=C s..
CJ ~ ~:.., ~ s.. p O ~ d' ~ w p -.- -r ~, z Gp b4 GD by b b b b b o~ ''i U ~ cUA
O ~ ~ ..fl ' C-0 .+~ .~ Cn , ._.
O 'O ~ ~ U ~ ~ 4-i O
r ~ ~ ~ ~ ~3 0 -° ~ "° ,~ ° ~ ~ 5, v o .o ~ o r, ,~ ~ o ~ . ~ s?.
.~ ~o , ~ s.~ ~ .~ ~ o ~ o 0 U
o ~ ~ 3 ~ o ~ o n. _~. y ,~ ~ a ~s .
~c~~o~~~C ~~ ~CvJ
W ~ U ~' ~ ' n ~ an ~ C'7 L .-.
+ +
+
+ + + + V
W C~x.
cn on on an an .., .., ..., b b b w b b ~ b ~ b o ~ a i U cd O O
r, ~ 3 ~ U~ .~0~ .>GL_~, U ~ ~ ~. ~ ~ c~
b 4. .~ ~ ~ ~ '° ~°
° ~ ° ~ 'ai °' ~ o ~O N . ,'-'-, ~ p L ~;-I
O c~C Qr O ~ cd ~, v' ~ b0 y Q. O
c~ ~ Q ~ ~ ~ ~ p 'd 'd f~"' U ' in W 0.~
-I- -.- + + -f-- -I-C7 U U cep ~n o°n ~ ~ , bn -. ~ ~., b ~ b a U
O
y N in LUr tr ~-r G~ O ~ cr,~d ~ .~,~~,, O' w cC ~ G .~'.~ ~ v~ O
y,~~
~ U b"
UO ~ '~ ~ ~ .~ _N N U ~.
Y~ y C~
.'" U~ U ~p u~ O
p~ ~ .t'. ~ ~ ~ y G> y ~ y S.O..~ O .-~-~.r O U
y ~ ~ G4 . ~ ~ :~ U7 y~, ~ -~ o y oo'~.r~o'~U~~'~ ;.~~.
a. ~ ~ ~ 0., °' U ~ 3 U .°
+ +
U
U
own ~n ~n ~ ~n b o a~ ~ .o .o .~ .
w ~n a, ~ ~ O o "~
.fl O ~ O .~ ~ ~ Q c z ~n ~ ~; U
~ b ~a ~ .~ o a°~ a~°~ ~.
cC U ~ sr U c~ N
b U U U W a ~ '-' U
U U O O
~ .n .d ~ -O .~ GD O ~ a~
a~ O ... ..
X
~r sr U '~ "C7 V7 N G> ~ 'p p .j-'-'' "'' N
C
O O
. c~C
U U
t.
cU

N d0 ~ ~ .~ v~
V ~ ~ ~ .~ ~ 0 . in . ~ s_., a) O
cUn ~in O '~ .~ p ~ 'O
O w ~ ~ U ~
o °s~' .b 3 a, U
o . ~ ,~ . ° .~°? ~ ,~
-, v- o ~ o ~ .o "~"~.~~., ice., V . ~ S.r ~ = C~ 0 U ' :7 --~ ~1" ~ c,_., N
OiG~='~ .~.U O' O
O.~cdi...pU .cG
O ~ ,~ .O .~ U cad 0 0 ,~ z o E-~ b U U U U w + + + +
U '-" p v, q ~ U

o .o ~U U
~' U
t3~ ~. ~ O, c~C c~~d Z e~
-d D b °
' ~ ~ a~
o ~. Z ~' zfil ~ ~.~ ~~c~"., °
fl s.. ~ O ~ ~ ~' v~ U ~ C :~ 4V U
w, U can ~-' s-, c~ z .~". c~ . r. cC by ~/ 4."
n i 'b i- . -r O s...y.~ni ~' .~', O ~. ~ U U U
~ pp ~ O" M s.. ~" 4~ ~ ~-' Q, "O
~ s'~ O ~ 'C
N ~ ~ ~ ~ ~' U
v iC ~
j O _O ~ ~ ~ O U ~ ~' .~.~ '~ O ~""r V
wCp°p~0~~''~~~~ LO y,U~O~~O'r""
p O ~ ~~ b ~ ~ O v~ ~ _O ~' O
_Nv~O~p'UQ''yUy"'d'U'_~~~in~0 ~ O
O'd..'~~'.~b~~0~~~~z0 OOO .~.'~U. y n A. cad ~ c~ c~ 0. ~ ~ ~ ~ C .LO"
+
+
+ V
+ +
w D ~ U
,0 0 0 U U U ~,' ,.r', ;~ . ...
N 4, °' °
'O U U

a.
N
~-x . ~ O O
O
:'' b ~ c~C
..
c~ ,~ ..U. . ,.U., _U
~, fd_ -d Ga ~1 ~ d M N N N N .-a x x ~, x x x x a~ ~ a~ a~ a~
0 0 ~ o o N o ~ o x x ~ o ~ ~ ~ x y v + + + + +
x ~ ~ ~ H
x ~ x x .N L
l~ C~ C~ C~ CC CC3 O O O O O O
U U U U U U

on ~ ~ on c Q0.' V
i op ø' -o ~ ~ ,., Lx. o ~ O ~ ~ : ~ ~ ".~~., '-. cd ~ p U ~.' bD ~ ~ . p cG t~. U Q. w C/~ O ~'U~ vi .~ C ..~ ~'~ ~.~~ Q.i ..5~~.
a~
v~ '~ ~ o 0 0 -v ~ O ~ ~ ~ ~ O a~ x ~ ~ ~ 4:
o ~ ~..~ .r > ~ ~ ..~ U x ~, O
4wr~0.~~'V ~~.~ ~°~a.~~~~1 i o ~ '~ ~ .~' ~ ~ ~ a ~° ~ ~~ a~
_G~ ~ ' y ~ ~ Q. _O _~ _O ~_ (V U r' ."~'I
O c~C ~' ~ U .s"!- ~_n OUycd~~U~'cn '~'''~'cnx~ 4~OU
I
I
i J' M
N
H
I
I

..., . U
w ~ ' O O O O
U U U U

~ -o 0 O .~ O N
r1 ~ ~_ .~ ~, _U Cd ~ ~7 ,~ ~ ' CSC
O ~ ~ " ~ ~ ''' Q ~ O
U cn .~ ~ ..~ s. O -y 4..t t..~ U bA .~-i U ~ O
O ~ i .U ~ 00 ~ .~ '~ W ~ ~ cad O
'y.. ~ U U y .~" *-' 'b c~ cn U := s.U" cd U ~ O N ~,~, 1'U" ~ .~," U
. O y ø, ~ .b 4-a ~ ,~ Q.' Q, ~ . ~ O ~ cd '~-' ~ N c,'., ~ O , t1, p O p ~ ~'""-~ ~ O O O
_v~~~O.cn..~'~y..~s.,UO~.~~~0 s., cn O ,~ ~ U U U U ,~ ~ ~ ~ .-. U
U"~ .r...~.rr7U-y~c~d~~' U~ O~.D
~ 'on ~ ~ a ~ a, i ~ ~ .o ~ ~ L ~ ~ ~ ~ ~ .~ ~ o ~ ~ w JI + + _ I
JI - +- + + I
I
U U U

L
~_ O
U
U
U
U
U
O .~.
O O O O
',r '.~. ' c~ cd cd cd U U U U
. r, d Y
v~ w a~
o v O d '_-~.. °~ .~. '" 'b ~ ~.O O
~:. O
:=' O ~" '' .cd N w Q. ~ by .
~ 4, ~, pn ~3 ~ ~ O
"G ~"' O 'S..,~" s.~ O '~ 'O
..
''-' ~ .j ~O '~ ~ c~
., .~-~ m r~
O' .gyp O O ~ ~ N
N w, . ~ . ~ d C". ~, ~ ~
O ~~ [-~ 0 0 ~ b~D bA
0 0., U ~ v O
°~ na ~ C~ c~ ~ cd cc +
+ + +
U rx Cd7 ~'U
d U
.'., O.. GO d~ b-0 C
.Y .Y .Y
O.

_ _ an b ° o ~ °
~' x ~ U O U ~ O
tf7 v~ ~ cd 4i ~ ~" 4~
,_~ ~ _ .o~a~oO~v~oodv~
...
V
U v~ ~ ~~., s'" '.,.., ~ s.. ',."',, .=, _N ~ ~n .~ N ~ U ,~' ~ ~ U
b '~ ~ ~ .b "~ U
N
O .,S-', ...~~', C,bG)Os"''~~~s~..
cd N ~ U N
-f-N
a a p w w i i own own own U
C7 ~ ~ u. - o U ~ ~ ~ U U ~ ~ U U
s.. O O O c,.~., ~ ~ ~ ~ O
.pu~' ~'GN~~4-1~NU~..~.C~ r .fl ~ '' U ~ ~ (/~ ~ ~ ~ cd Glyn .~ .O N N U ~C O ~ O
~ s.. ~L ~, ~L U .fl ~' ~ 'O ~L 7 °' ~ '~' ~ ~ p U a~ a~ '"
p O
i .~ ~ ~.: -N~ ~ ~ O a. ~ ~ O
o ~ ~ ° .~ U ~ ~ ;~ N S~ ~
f1 w .., vyj ~-' a., cn r. U ..~"'~ U O
U v ~ U ~ O ~ O ~ ~ U ~ U
~, by b0 b0 O G O
C~ cG
O

o ~, o °

4; ~ ~ ~ ~ w N
y ~ ~ ~ ~, C s..
3 ~ ~ ~ ~N o 3 'b ° ~ a~
o O ~ .~ ~ o H
v o ~ ~ _~ ~ ~ Q o 4, o ~ C7 .~, 4..
° ~, 0 3 L ' ~, a, o ~_ ~ ~ ~ c~ ~ ' ~ .~, .~ tin O ~ .~ S~.'~' p... ~ W G~. ~ O~
L C s"' U U
_~n v-, °°
E"
U
a ~ ~ i Y i~ i~.J Y

I o a~
~~ ~ ~ ~cG
i O ~ cn O ~, br,A ~ v U '+-' >, ~ N .~ i~ "~ b O
U r O O ~ ~ O y .~ 'y..,' s"' N ~ ~ .~ U ~ ~ U ~ O 'L3 V
a~ ~,~ U ~~ ~ ~? ~o ~"d 0 bA ' ~ O ~~.. S'.. ,~ ~ p ,~ O 'b w, a, p ~ ~~' 3~~~3w a" "d.n ~b '~ o ~ ~ a~ o -cs o .
~ 'b ~ >, .b ~ U
y ~ O ~ ~ O ~' O ~ ~ ~ U
U va a. °~' a.. ~" o na w ~ ?~ d + + +
~i + +
o .-.
_.
w a o Ci, a, w o ~ .,r 4~ ~ 01 N sØ 4-~cCir ~ O
.b o ,-, .-''''. ~-'UO"-~.N~O~O ~,0~
' s~ l~ y"~
'~ pi....~ ~~Q.'~~ Oar .~ bN,~-'O~~~O~~tz, O ~ .~ ~ .O
.~ ~ rr ~ ~ ~ ~~' cOd ~ Q- p '-' O . ~ O ~, S3, y ~ ~ 3 ~? .~ ~ ~? ~~ ~, :b ..o ~ ~0 0 N _.1a ..r~~ O ..~~. ~" °_~
O ~ ~ ~ .-y",Ir c'~C '~ -~'~"~' .S.i" ~, ar ~ V~ O Ar LSr . ~ ,.0~ a U
~, a~ ~ ~ a~ o b a~
3 ~ .~ 0 0 _o b a> ~, '~ ~ .'-' v b ~.y0 ~0.~.~.~.~,.~~G1 O ~ b ''1$ ,~ ~ C1. , O ~ r~,~. j, tN.r cii ~ ~ ~ (~ p y ~ ._.
~~ ~~o.~..r,.U
~n ~~~~~~w~~'~-~ ~~s..~~
~ .7, ~ ~.~r . ~ ~ cC 'O
p N .~ O~
.., 'G
j?N~'.~?N~? ~? 3 o .v x ,~ o ~, ~~ o ~ ~ o 0 o a ~ o a,.~ w a~ ~aarC7 ~ ~'na, o '' + + +
U
~, w p o 0 0 0 -c 0 0 ~ u1 ~ o >, ~U U O ~ ~ ~U
O ~, 'C3 4= ~ ~ b ~ ~ ~ c~G ~--~ 4, ~ 'b +r ...e~",,, ..~ cG r0. Q, ' O OU
O O~ ~ U . ~ D O cue., O.tn'd.UO"~~cd j ~ ~ ~ ~ ~ O
w ~ 4~ ~., 4r .-. 4-' ~ 4~ ~ U
O ~ O ."'., O ~ ~ ~ ~ O
O
.N .O .47 .~ ~ .N p .N cd .~ .v~ ~ .N
O_ ~ O OOO~~O~ O,°'~,~,~~0 CL, O" ~ w' c_' C1 U O ~ .3 v~
I
U U U
M

s~ i, s., s..
rG~- ~ U N
...-r .C
O O O O

o , o o ~ ~ o ri a, o Wn p ~_ ~' ~
o ~ ~ ~ o ~ ~ ~ N '~ ~ ~ N '~ o .-,U _U~ UU~.~~"U~N U
'" 3 'c'-'n ~ '~ ~ ~ ~ ~ ~ ~ b 'O 'v~ cC b .b 'w C
UO~O ~~30U~ U.~ U .-.
-. ._~ ~ ._~ ..~
3.~~3~~~°'~~ ~3.~'v~3°' o U cn CMG ~ tn M
.COcn.~v~~~U V~oM~O.~,~.~-0 ~' N U O
O ~ '~ O ~ Q ~' -~.~. ~ O O ~ .O .O ~ O O
CL, v~ '' Gr O '~"a O O.. r~'~ ~ c~/~ ~ ~ a. v~ G.
o + + + + o x x a w ~a ~I
y ~ ~ L
O O O O O O

b a~ a 0 o si, a, $ o 'O V "C p b ~ pip N ~ N i..~ ,~ ~ r., ,~ N
o u~ o ~' O ~ ~ p ~ >, rV- ~ C ~"~ ~"' O\ N ,=.
_O O >, >, ~ ,~" ~ c'-'d cd ~ cti ~ ' m C
...Ur ~ V ~ ~"'., V V ~, f~" ._s' ~ cd ~ ~.n ~ ~ ~-1 CC~ . " .'fir o a~ 3 ~ . ~ 3 .~
o ~ o .~ O o ° ~' ~ O
'~' ' ° '°? aJ.°J~o °' '"'°' o o ~ ~ a ~ o ~ i o ~ a ~, a. ~ x A. ~ ~ ~ a, + +
+
+
U U U
M f~
r~ l~ ~O
y~r ~. L~ Y. i.-n O O p O
y O O O O O

' ~ a~
o ~' .r O L"r ''r O ~ ~ O ~ O~O
cG ~ r i'' 'fl ~ ~ 'a ~--~
N a~ .,.., ~ O .-_. .~ O ~
U ~ ;-~ U ~ U by O ~ ~ ~ r ~ f Q. ~ . ' O cn ~-d ci» b . in cG b '.. '~ 's:: U
4- UGr~ U~' U.~N
o ~ ~ ; ~ ~3 ~ y ~3 c o~ ~ ~ ~ .~ o .~ .~ o ~
y '' cO y ~'. M y 4; ~ ~.Ur y ~y O ~ o ~ ~ O ~ O O .fl O 'b a, U ~. v~ ~ H a: v~, ~ v~, a.
U
N M_ r~
~i ~I
i I
i. ~. i. i, N N U U
w i~ it i~
O O O O

II
O
T'r ~ O 'b O O N O O p~ ~ ~ ~ O
>' O ~ M ~ O O ~! .= W
O
y _j, .~ y >, ~ O
'v~ ~3 b ~ ~c~n ~ ~ x 3 ~ ~ ~ I
J _ y v.U'".~ V ~ ~ ' s:., V ~ ,y v' O ~', . ~~ p ,.~.~ 4-r ~ N r, .v~ '~' ~ .cn O .3 .~ ~ ~ .O
O ..,..~ o0 .~ O .~ ~ ,~ ~ .~ c'"d . ~ ~ .-i _~_G~_NO~iO..~ ~ .N
O .~ O .~,' O .fl O O O ~ O ca O. ~ ~ O~ 0. CJ ~ O
M
v~
O o o O

o~,.~obp o a o _°', . ~ -d -d w .~, ~ s., 3 .~ ~ .~ 3 .~ ~°
o ~. ~ v o .~ -c ,.~ 0 0 ,~ ~ .~ U
rr N
r, eCj V '.~' O ...~~ O .S-'~. ~
4.., 'rte' ~ ~ . "' C . ~ ''~" "~-i _O .'~. ~ C,"
. ~.
0 0 ~ o ~ o o .p ~" o ~ o a a, a. ~ a., °' a, o a, ~ °L' + +
+ +
+ + + +
U U
N O ur V7 d ~L G7 I
i N ~ ~ N
r ~ y O O O O O O O

Previous Evidence The genome-wide location data described here identifies the promoters bound in vivo by all known yeast cell cycle transcription factors (Table 5). Some of these factor-promoter interactions were suggested previously using different methods, and a summary of all the targets genes identified by the current study for which previous evidence exists is provided here. The previously reported evidence is separated into four categories:
1. In vivo binding, which includes chromatin immuno-precipitation and in vivo footprinting.
2. In vitro binding, which includes gel retardation assays and DNAse I
footprinting.
3' Genetic analysis, which includes the effects of genetic manipulations (such as mutations or overproduction) on target genes.
4' Sequence analysis, which includes the identification of DNA binding motifs in the promoters of target genes.
A genome-wide location analysis technique has recently been used to identify the set of cell cycle genes controlled by MBF and SBF (Iyer, V. R., et al., Nature 409, 533-8 (2001)). A list of all the target genes identified by the current study that were also identified by Iyer, V. R., et al., Nature 409, 533-8 (2001) is provided here. The overlap between the genes identified by Iyer et al. and this study is approximately 75%.

a\
°o N O O
U in ~
O O
U wr ~. ~.
ci~ -'"
o~
N
M
_ ~ Q
O~
c3 ~ y ,~, cd U ~"'' cd O
U
..S-'.~ .~ ~ U U
O Q O
U
U
r N
b .' W
M
Q\
0\ ~ ~ Q\

o ., :b o ° ~ b O N cC ~ ~ c~
.~ .'-' .~.. ~ w..
O ~ U ~ U
cd y O cad U ~ ~ U
iv > D ~ °' .
.~.
b O
r.
O
. _., ~, _ ~ p ~ c~ ~
~w N
U
H

M
,.., .~ rr ~ r. d ~ ecS p O ~ ~ ~ O
N

o°~, ~ ° o ° o -, ~ .- o ., o M
v~,~~t '~°°'~o°o°~ ~Z

.... ~ N ,-, N O N .~ ~C
C~~7 ~ ...~ cti ~ N c~S .n n Y.. L _n ~ 7-~. n _n ~.r _n C~ C~
r. cd ~ ~ O cG ~ O ~~ c3 ~ c3 00 ~ N c~G '~ .,~ j cad ~ ~ O
V '-' V ~ O ,~ ~ O ~ ~ ~ O O U
a. d ~ ~ ~ ~ ~7 v~
M M

O~ 01 ~_ r. ,~ O O .~,S.~r 0~1 O O
z z .~ c~

~G ~ v~ ~n N ~ o° N
aW ~ a N
N cd cd a) c~ a) c~
'b 'd s~ 'b ~ ~... 'z7 ~n ~ O ~ O ~ ~ O ~ ~ ~ O
'~ O ~' O ~ s, o, ~ 0 0 0 ~ o o .~ ~ 0 0 x b ~n ~ cL z U U
~U ~ U U

r c~ cG U
b4 GO O

U

.--, ,~ r. .-..
U _U U_ . a .--~ . p1 S_"' ,---W_" G\
b '~ ,--n "G
..~-n ~ .--.i ~
cd ,~ c~ td CCS c~
_r CC$ _r .~, _r CG _r wr N
r c~C ~ c~C .'~" ~ On z o z z o z a, U U
~_ cd cd 'a 'D
C
r r z z U
O
V V' V
~3 3 ~3 ~3 U U

o, cd ~ O1 Q\ a1 ~ ~

.. r V ~ ~ cd c~

N ~

N

V O ~ O

W

a1 01 01 ~ rr 01 41 O~

01 a1 .--i p~ r ' r Q1 ~

~ V V V

~ r-,01 a1 O~~' cG ~ ~ D1 ~ O
~

N ~ N ~ ~ ~

N c Wd t~'d O V ~ V ~

O 'b G7 ~ b ~ N
~ '~ N
~

O 7:~ V f=, :.y N
V

CLl j f1~ ~ m ~ c~ cd ~ ~

O ~ W

.--r ~ J 01 ,~

d1 ~ ~ ~ r-~

O~ Ov O~ ~ a\
~ ~

N

r _ U

~ ~ ~ O cC

c N

a r sy ~ -b ~ .

~ ~ ad cG c c O O

Q\

cC

r O

U

'~. v~ N v~ N . d d'~ ~O d' rr _ C/~ Q C/~ d C/~C/~G7 C/~C/~

W

~ U

U U W

~ o~

o o , , Y
Y

d pp ~ ,~ 00 N
O~ 01 ~ D1 D1 a1 ~ ~ ~ ~ ~ ~ Q\

O~ 01 ,~ ~ ,~
~

Y N
-~ .-i cC ~ r. cd ~ G.~

cC CC3 .,.., G7 ~ ~, N
:--n N '~ ~ Qj ~ b N ~ N i.~.~s.~.,7~

Q ~ Q

~ c3 CO
Y Y

it i, ~n ~n ~n ~n U

O 0. U

o, o, a, _; a U

t~
~ 01 01 ~
~, ~
N , ~ c~G
N y .~ C/~
GCS
O ~ ~ V O
N
O
O U
M
O~
c~
td O
N cCi S-, 'd N
O
N -~, ~", '~. ~

a, a, O
O N
C~
O j U_ O O
d1 O O O O

~' ~ O N ~ O p N
O ~ ~ O O 01 N ~ ,.~ ~ N ~ '-' O ~ _ ~ _ c~ ~ cd ~ ~ C N cd 'b ~, L 'b cd cOG ~ ~ c~ N
4 ~' ~ ~' ~' 0. ~ ~ J
o o o N
O ~ o O
O
cC ~ N cd '" N c~ N
s..r 'b c3 L
C~ C~
O O
O O
p p p p O N ~ O
sr N w N N N ..~ . ~ N
cd cJ cC c~ ~ ~ cd N ~ ~ b ~' c~..,C ~ "' ~ O r' ~ O ~ O ~ cd p O
O O ~ O .s~.' ~ w.'Y~r O ,.O
V ~ r ~ 'b r~
w w z h ~n o ., -126-;.x.
Swi4 regulated genes YDR4~ 1 C GLS 1 GIN4 MSB2 CLNl SWI4 YGR189C HTA3 ELOl Mbp 1 regulated genes RAD27 RNRl SPT2 Alpha Factor Synchronization Time course expression data for the cell cycle after alpha factor synchronization of yeast cells is from Spellman, P. T., et al., Mol Biol Cell 9, 3273-97 (1998).
Regulation of late G1 genes Previous molecular and genetic analysis of a small number of genes suggests that SBF (Swi4 and Swi6) and MBF (Mbpl and Swi6) are important activators of late Gl genes (Koch and Nasmyth, 1994). Our results confirm this model: Swi4, Mbpl and Swi6 bound predominantly to promoters of late G1 genes (the significance of the bias toward late G1 genes was tested using a hypergeometric distribution and wasp<10-Ia,p<10-~4 andp<10-2o respectively).
Swi6 as a cofactor for Swi4 (SBF) and Mbpl (MBF) Based on studies of several genes, Swi6 has been shown to function as a subunit of both SBF and MBF (Dirick et al. Nature, 3~ 7: 508-513 (1992)). The genome-wide location analysis data indicates that Swi6 binds to almost all of the promoter regions bound by Mbpl and Swi4 (Figure 2A), indicating that it is a co-factor of these two regulators throughout the genome.
Regulation ofgenes encoding cyclins and cyclin regulator°s The targets of SBF and MBF included key cell cycle regulators (Table 5). SBF
and MBF were found to bind the promoters of CLNl, CLB6 and PCL1, SBF binds the promoters of CLN2 and PCL2 and MBF binds the promoter of CLB6. The location analysis also shows that SBF participates in the regulation of G2/M cyclin (Clb2) activity at three levels. First, as suggested previously (Iyer et al. Nature, 409: 533-536 (2001)) it binds and presumably directly regulates CLB2. Second, SBF
regulates the transcription of the transcription factor Nddl, which in turn also regulates CLB2 transcription. Thus, SBF and Nddl collaborate to regulate transcription of the gene, whose product is necessary to enter mitosis. Third, SBF and MBF reb late SWEI and GIN4. Swel is an inhibitor of Cdc28-Clb2 which delays entry into mitosis in response to bud emergence defects (Sia, R. A., et al., "Cdc28 tyrosine phosphorylation and the morphogenesis checkpoint in budding yeast," Mol Biol Cell 7, 1657-66 (1996)), and Gin4 regulates Swel (Banal, Y., et al., "Niml-related kinases coordinate cell cycle progression with the organization of the peripheral cytoskeleton in yeast," Genes Dev 13, 176-87 (1999)).
Regulation of stage-specific functions SBF and MBF participate in the regulation of genes essential for cellular functions specific to late G1. SBF regulates genes involved in the morphological changes associated with cell budding and MBF controls genes involved in DNA
replication and repair (Table S), confirming a previous study (Iyer et al. Nature, 409:

(2001)). We also found that SBF is bound to the promoters of several histone genes (HTAl , HTA2, HTA3, HTBI , HTB2 and HHOI ), which makes it likely that SBF
contributes to the increase in histone gene transcription observed at S phase.
Redundancy of activators Neither SWI4 nor MBPI is essential for cell viability, but a SWI4 /MBPI double mutant is lethal, suggesting that some redundancy exists between Swi4 and Mbpl (Mendenhall, M. D., and Hodge, A. E., "Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae,"
Microbiol Mol Biol Rev 62, 1191-243 (1998)). We found that most of the cell cycle genes involved in budding are bound by SBF alone and that most cell cycle genes involved in DNA replication are bound by MBF alone. In these cases, it does not appear that SBF and MBF play redundant regulatory roles in wild type cells.
Iyer et al. Nature, 409: 533-536 (2001) also reported that Swi4 and Mbpl bind to different genes involved in distinct cellular functions. However, 34% of all genes bound by SBF or MBF are bound by both factors, indicating that regulation of these genes in a population of wild type cells is normally under the control of both factors and demonstrating that there is substantial redundancy in the regulation of these cell cycle controlled genes in normal cells.
Promoter binding motifs The large number of targets we found enabled us to search for putative DNA
binding motifs. To this end we ran AlignACE (Hughes, J. D., et al, JMoI Biol 296, 1205-14 (2000)), a program that uses a Gibbs sampling algorithm to find common regulatory elements among a collection of promoters. We found a refined version of the known binding sites of Swi4 and of Mbp 1. Although these motifs are highly enriched in the set of target genes identified by our location analysis (p<10-14 and p<10-20 respectively), they also occur in the promoters of many genes that show no evidence of binding to these factors in vivo, suggesting that the presence of this sequence alone is not a predictor of factor binding.
Fkh 1 and Fkh2 Fkhl and Fkh2 are two members of the Forkhead family of proteins that share 82%
similarity in amino acid sequence (Kumar et al. Curr. Biol., 1 D: 896-906 (2000)).
Genetic analysis has suggested that these two genes are involved in cell cycle control, in pseudohyphal growth, and in silencing of HMRa (Hollenhorst et al.
Genetics, 154:1533-1548 (2000)). Their contribution to the regulation of cell cycle genes appears to be in G2/M, since it has been shown that Fkh2, together with Mcml, recruits Nddl and thereby regulates the G2/M specific transcription of CLB2, SWIS and YJLO51 W (Zhu et al. Nature, 406: 90-94 (2000); Koranda et al., Nature, 406.94-98 (2000); Kumar et al. Curr. Biol., 10: 896-906 (2000); Pic et al.
Embo J:, 19: 3750-3761 (2000)). Fkhl appears to have similar roles in regulating G2/M genes as it is also found bound to the CLB2 promoter (Kumar et al. Curr.
Biol., 10: 896-906 (2000)).
Regulation of genes throughout cell cycle Our results confirm that Fkhl and Fkh2 are involved in regulating genes expressed in G2/M, but indicate that these proteins also regulate genes expressed in other cell cycle stages. Fkh2 binds predominantly to promoters of genes expressed in G2/M
(p<10-9), but it is also enriched in G1 (p<10-4) and S/G2 (p<10-3). Fkhl target genes are expressed in G1 (p<10-2), S (p<10-3), S/G2 (p<10-5) and G2/M (p<10-4).

The association of Fkhl or Fkh2 with Mcml is limited to genes expressed in G2/M;
in other stages Fkhl and Fkh2 bind to promoters in the absence of Mcml.
Regulation of genes encoding cyclins and cyclin regulators The targets of Fkhl and Fkh2 include several key cell cycle regulators (Table S).
Fkhl bound to the promoter of the CLB4 gene, which encodes a S/G2 cyclin (Fitch, L, et al., Mol Biol Cell 3, 805-18 (1992)), and Fkh2 bound to the promoter of HSL7, which encodes a regulator of Swel that is necessary for the transition into mitosis (Shulewitz, M. J., et al., Mol Cell Biol 19, 7123-37 (1999)). Fkhl and Fkh2 also bind to promoters of genes involved in exit from mitosis; these include APCl, which encodes for a component of the anaphase-promoting complex (Zachariae, W., and Nasmyth, K. Genes Dev 13, 2039-58 (1999)), and TEMl, which encodes a protein required for activation of Cdcl4p and the mitotic exit pathway (Krishnan, R., et al. Genetics 156, 489-500 (2000)).
Regulation of chromatin Fkhl was found to bind various genes that encode proteins associated with chromatin structure and its regulation; these include histones (HHFI and HHTI
), telomere length regulators (TEL2 and CTF18), a component of the chromatin remodeling complexes Swi/Snf and RSC (ARP7), and histone deacetylase (HOS3).
Redundancy of activator s Genetic analysis has suggested that Fkhl and Fkh2 have distinct roles in cell cycle progression, but redundant roles in pseudohyphal growth (Hollenhorst et al.
Genetics, 154:1533-1548 (2000)). We found that Fkhl and Fkh2 bind to the promoters of 38 and 56 cell cycle genes, respectively, and that 16 of these genes were bound by both proteins. Among the G2/M genes that are targets of Fkh2, three genes (CLB2, ACE2 and BUD4) are also targets of Fkhl.
Promoter binding motifs In order to identify the binding motifs for Fkhl and Fkh2, we ran AlignACE
(Hughes, J. D., et al, JMoI Biol 296, 1205-14 (2000)) on the set of promoters bound by each factor. The program identified the known Forkhead binding motif (GTAAACAA (SEQ ~ NO: 31 )) in the two sets of promoters (p<10-9). However, this sequence was absent from most of the promoters bound by Fkhl and Fkh2, suggesting that additional sequence elements contribute to the binding sites for these proteins. The promoters of Fkhl targets, but not Fkh2 targets, are enriched for several additional motifs.
Mcml and its cofactors, Fkh2 and Nddl Regulation of G2/Mand MlGI genes Previous studies have demonstrated that Mcml is involved in the regulation of cell cycle genes that are expressed both in G2/M and in M/G1. Meml collaborates with Nddl and Fkhl or Fkh2 to regulate G2/M genes (Zhu et al. Nature, 406:90-94 (2000); Koranda et al., Nature, 406: 94-98 (2000); Kumar et al. Curr. Biol., 10: 896-906 (2000); Pic et al. Embo J., 19: 3750-3761 (2000)). Mcml also regulates M/G

genes, but less is known about its functions in this stage of the cell cycle (Mclnerny et al. Genes Dev., 11:1277-1288 (1997)). Our results suggest that differential regulation of Mcml target genes in G2/M and M/G1 is governed by Mcml's association with different regulatory partners. Mcml binds predominantly to promoters of genes in G2/M (p<10-14) and in M/Gl (p<10-6). W contrast, Mcml's cofactors Nddl and Fkh2 bind to promoters of G2/M genes (p<10-21 andp<10-15 respectively) but were absent from promoters of MIGI genes.
Regulation of envy into and exit from mitosis The location analysis indicates that the G2/M activators (Mcml/Fkh2/Nddl) regulate genes necessary for both entry into and exit from mitosis (Table S).
The G2lM activators regulate transcription of CLB2, whose product is necessary to enter mitosis. They also set the stage for exit from mitosis at several levels.
First, they regulate the transcription of SWIS and ACE2, which encode key M/G1 transcriptional activators. Second they bind the promoter of CDC20, an activator of the anaphase promoting complex (APC), which targets the APC to degrade Pdsl and thus initiate chromosome separation (Visintin et al. Science, 278:450-463 (1997)). Cdc20-activated APC also participates in the degradation of ClbS
(Shirayama et al. Nature, 402:203-207 (1999)), and thus enables Cdcl4 to promote the transcription and activation of Sicl (Shirayama et al. Nature, 402:203-207 (1999)) and to initiate degradation of Clb2 (Jaspersen et al., Mol. Biol.
Cell, 9:2803-2817 (1998); Visintin et al., (1998)). Finally these activators regulate transcription of SP012, which encodes a protein that also functions to regulate mitotic exit (Grether et al., Mol. Biol. Cell, 10:3689-2703 (1999)).
The involvement of Mcml in the regulation of genes important for the transition through START has been suggested previously (McInerny et al. Genes Dev., 11:1277-1288 (1997); Ohelen, L. J., Mol Cell Biol 16, 2830-7 (1996)), and our data confirm this notion. Mcm 1 in the absence of Nddl and Fkh2 binds the promoters of SWI4, a late G1 transcription factor, CLN3, a G1 cyclin that is necessary for the activation of G1 transcription machinery (Dirick et al. Embo. J., 14:4803-4813 (1995)) and FAR1, which encodes an inhibitor of the G1 cyclins (Valdivieso, M.
H., et al. Mol Cell Biol 13, 1013-22 (1993)).
Regulation of stage-specific functions Mcml, in the absence of Nddl and Fkh2, participates in the regulation of genes essential for cellular functions specific to late mitosis and early G1. It binds to and apparently regulates genes encoding proteins involved in pre-replication complex formation (MCM3, MCM6, CDC6 and CDC4~ and in mating (STE2, STE6, FAR1, MFA1, MFA2, AGAl and AGA2).
Promoter binding motifs In order to identify DNA binding motifs for Mcml, we ran AlignACE (Hughes, J.
D., et al, JMoI Biol 296, 1205-14 (2000)) on the set of promoters bound by the combination of Mcml Fkh2 and Nddl and on the promoters bound by Mcml alone.

We found that all the promoters of the first group contain a motif with a Mcml binding site adjacent to a Fkh binding site. This combined motif was highly specific (p<10-34) to these promoters. Almost all the promoters from the second group (89%) contain a Mcml binding motif which was also highly specific for these promoters (p<10-27). Interestingly the Mcml motif found in these two groups of promoters was slightly different, with several more nucleotides conserved in the motif found in the promoters of the genes bound by Mcml alone.
Ace2 and SwiS
Ace2 and SwiS have been shown to control certain genes expressed in late mitosis and early G1 phases of the cell cycle (McBride et al. J. Biol. Chem., 274:21029-21036 (1999)). Our results confirm that Ace2 and SwiS bound predominantly to promoters ofM/G1 genes (p<10-3 andp<10-14, respectively).
Regulation ofgenes encoding cyclins and other cell cycle regulators The targets of Ace2 and SwiS included cell cycle regulators (Table S), Ace2 bound to the promoter of PCL9, whose product is the only cyclin known to act in M/G1 (Aerne, B. L., Mol Biol Cell 9, 945-56 (1998)). Both Ace2 and SwiS bound to promoters of two of the G1 cyclin genes (PCL2 and CLN3), and SwiS bound to the gene encoding the cyclin regulator Sicl, which inhibits Clb-CDK activity, allowing exit from mitosis.
Regulation of stage-specific functions Ace2 and SwiS were bound to the promoters of several genes whose products are involved in cell wall biogenesis and cytokinesis (Table 5). SwiS bound to the promoters of 17 Y' genes, which are a subgroup of a larger group of sub-telomeric genes that share DNA sequence similariy and whose expression peaks in early G1 (Spellman, P. T., et al., Mol Biol Cell 9, 3273-97 (1998)).

Redundancy of activators Genetic analysis has suggested that ACE2 and SWIS are redundant; a deletion of either ACE2 or SWIS does not abolish transcription of most of their target genes (McBride et al. J. Biol. ClZem., 274:21029-21036 (1999)). Our results indicate that the functional overlap seen in mutants reflects partial functional redundancy.
Ace2 and SwiS bind to the promoters of 30 and 55 cell cycle genes respectively, and the promoters of 17 of these genes are bound by both factors. This result suggests that the redundancy is limited to a subset of the target genes in wild type cells.
Among the targets that are unique to one or the other factor are genes whose transcription is abolished only in the absence of both Ace2 and SwiS, suggesting that in the absence of one factor, the other one can fill its place. However, in wild type cells only one factor is normally bound to these promoters.
Promoter binding motifs In order to identify the binding motifs of Ace2 and SwiS we ran AlignACE
(Hughes, J. D., et al, JMoI Biol 296, 1205-14 (2000)) on the group of promoters bound by each factor. We were able to identify motifs similar to the published binding sites of these factors that were enriched in the set of promoters bound by Ace2 and SwiS (p<10-6 andp<10-18 respectively). These motifs were found only in about 50% of the promoters, suggesting Ace2 and SwiS can bind DNA through additional binding sites; several candidates are shown in the figure below.
Redundancy The location analysis data demonstrate that each of the nine cell cycle transcription factors binds to critical cell cycle genes, yet cells with a single deletion of MBPI , SWI4, SWIG, FKHl, FKH2, ACE2 or SWIS are viable; only MCMI and NDDl are essential for yeast cell survival. The conventional explanation for this observation is that each non-essential gene product shares its function with another, and the location data support this view, up to a point. Swi4 and Mbpl are identical in 50%
of their DNA binding domains (Koch et al. Science, 261:1551-1557 (1993)), Fkhl and Fkh2 are 72% identical in their DNA binding domains (Kumar et al. Cure.
Biol., 10: 896-906 (2000)), and SwiS and Ace2 are 83% identical in their DNA
binding domains (McBride et al. J. Biol. Clzem., 274:21029-21036 (1999)). Each of these pairs of proteins recognize similar DNA motifs, so it is likely that functional redundancy rescues cells with mutations in individual factors. Until now, however, it was not possible to determine whether each of the pairs of factors had truly redundant functions in normal cells, or whether they can rescue function in mutants that lack the other factor.
Our data demonstrate that each of the cell cycle factor pairs discussed above do bind overlapping sets of genes in wild type cells, revealing that the two members of each of the pairs are partially redundant in normal cell populations. Mbpl and Swi4 share 34% of their target genes, Fkhl and Fkh2 share 22%, and Ace2 and SwiS share 25%. It is also clear, however, that this redundancy doesn't apply in wild type cells to many genes that are normally bound by one member of these pairs. The partial overlap in genes under the control of pairs of regulators explains why one gene of a pair can rescue defects in the other, yet each member of the pair can be responsible for distinct functions in wild type cells.
Why might cells have evolved to have pairs of cell cycle transcriptional regulators with partially redundant functions? This configuration provides cells with two useful parameters particularly relevant to cell cycle function. Pairs of regulators with overlapping function may help ensure that the cell cycle is completed efficiently, even when one activator is not fully functional, which is critical since the inability to complete the cycle leads to death. At the same time, devoting each of the pair to distinct functional groups of genes ensures coordinate regulation of that function.
DNA Binding Motifs Genome-wide location analysis identifies the set of promoters that are bound by the same transcription factor. The availability of a large number of putative targets is ideal for DNA binding motif searching to identify common DNA regulatory elements. In order to identify the consensus binding sites for cell cycle transcription factors, we used the AlignACE program (Hughes, J. D., et al, JMoI Biol 296, 1205-14 (2000)).
Several general insights evolved from our analysis. First, the DNA binding motif alone is not a sufficient predictor of protein binding, since these motifs are generally found in many sites in the genome other than the promoters that are bound in vivo.
Similar observations have been reported by us and others in previous studies (Ren, B., et al., Science 290, 2306-9 (2000); Iyer et al. Nature, 409:533-536 (2001)). This indicates that there is a need for additional empirical data combined and perhaps improved search algorithms in order for investigators to accurately predict genuine binding sites. Second, the binding sites identified here for Mbpl, Swi4 and Mcml are found in most but not all of the promoters of their target genes. This suggests that variations of the consensus sequence that are not easily recognized by search algorithms may also serve for binding, or that the factor of interest is modified or associated with binding partners that generate a new binding preference. In this context, it is interesting that the Mcml binding motif is somewhat different in the promoters of its G2/M targets than in its M/G1 targets, probably reflecting the influence of its binding partners. Finally, we have identified multiple binding motifs for forkhead factors, Ace2 and SwiS, suggesting that these proteins can recognize different motifs or that motif recognition depends on modif canons or partnering with as yet unidentified proteins.
Summary Using the Genome Wide Location Analysis technique, we identified targets of all known cell cycle transcription activators identified genome-wide.
These results reveal how multiple activators collaborate to regulate temporal expression of genes in the cell cycle.
~ Each activator group regulates at least one activator for the next phase.

Each activator group regulates genes involved in phase entry and CDK/cyclin regulators that set the stage for exiting that phase.
~ Specific activators are associated with specific cell cycle functions.
We also identified consensus DNA binding motifs for each of the nine activators profiled.
Finally, partial redundancy between pairs of activators may serve to ensure that the cell cycle is completed efficiently while allowing each activator to regulate distinct functional groups of genes.
While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims (14)

What is claimed is:
1. A method of identifying a region of a genome of a cell to which a protein of interest binds, comprising the steps of:
a) crosslinking DNA binding protein in the cell to genomic DNA of the cell, thereby producing DNA binding protein crosslinked to genomic DNA;
b) generating DNA fragments of the genomic DNA crosslinked to DNA
binding protein in a), thereby producing a mixture comprising DNA
fragments to which DNA binding protein is bound;
c) removing a DNA fragment to which the protein of interest is bound from the mixture produced in b);
d) separating the DNA fragment identified in c) from the protein of interest;
e) amplifying the DNA fragment of d);
f) combining the DNA fragment of e) with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs; and g) identifying the region of the sequence complementary to genomic DNA of f) to which the DNA fragment hybridzes, whereby the region identified in g) is the region of the genome in the cell to which the protein of interest binds.
2. The method of Claim 1 wherein the cell is a eukaryotic cell.
3. The method of Claim 1 wherein the protein of interest is selected from the group consisting of: a transcription factor and an oncogene.
4. The method of Claim 1 wherein the DNA binding protein of the cell is crosslinked to the genome of the cell using formaldehyde.
5. The method of Claim 1 wherein the DNA fragment of c) to which is bound the protein of interest is identified using an antibody which binds to the protein of interest.
6. The method of Claim 1 wherein the DNA fragment of e) is amplified using ligation-mediated polymerase chain reaction.
7. The method of Claim 1 wherein the complement sequence of the genome of f) is a DNA microarray.
8. The method of Claim 1 further comprising:
h) comparing the region identified in g) with a control.
9. A method of identifying a region of a genome of a cell to which a protein of interest binds, comprising the steps of:
a) formaldehyde crosslinking DNA binding protein in the cell to genomic DNA of the cell, thereby producing DNA binding protein crosslinked to genomic DNA;
b) generating DNA fragments of the genomic DNA crosslinked to DNA
binding protein in a), thereby producing DNA fragments to which DNA binding protein is bound;
c) immunoprecipitating the DNA fragment produced in b) to which the protein of interest is bound using an antibody that specifically binds the protein of interest;
d) separating the DNA fragment identified in c) from the protein of interest;
e) amplifying the DNA fragment of d) using ligation-mediated polymerase chain reaction;

f) fluorescently labeling the DNA fragment of e);
g) combining the labeled DNA fragment of e) with a DNA microarray comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA
occurs;
h) identifying the region of the sequence complementary to genomic DNA to which the DNA fragment hybridizes by measuring the fluorescence intensity; and i) comparing the fluorescence intensity measured in h) to the fluorescence intensity of a control, whereby fluorescence intensity in a region of the genome which is greater than the fluorescence intensity of the control in the region indicates the region of the genome in the cell to which the protein of interest binds.
10. A method of determining a function of a protein of interest which binds to a genome of a cell, comprising the steps of:
a) crosslinking DNA binding protein in the cell to genomic DNA of the cell, thereby producing DNA binding protein crosslinked to genomic DNA;
b) generating DNA fragments of the genomic DNA crosslinked to DNA
binding protein in a), thereby producing a mixture comprising DNA
fragments to which DNA binding protein is bound;
c) removing the DNA fragment to which the protein of interest is bound from the mixture produced in b);
d) separating the DNA fragment identified in c) from the protein of interest;
e) amplifying the DNA fragment of d);
f) combining the DNA fragment of e) with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs;
g) identifying the region of the sequence complementary to genomic DNA of f) to which the DNA fragment hybridzes; and h) characterizing the region identified in g), wherein the characteristics of the region of h) indicates a function of the protein of interest which binds to the genome of the cell.
11. A method of determining whether a protein of interest which binds to the genome of a cell functions as a transcription factor, comprising the steps of:
a) crosslinking DNA binding protein in the cell to the genomic DNA of the cell, thereby producing DNA binding protein crosslinked to genomic DNA;
b) generating DNA fragments of the genomic DNA crosslinked to DNA
binding protein in a), thereby producing a mixture comprising DNA
fragments to which DNA binding protein is bound;
c) removing the DNA fragment to which the protein of interest is bound from the mixture produced in b);
d) separating the DNA fragment identified in c) from the protein of interest;
e) amplifying the DNA fragment of d);
f) combining the DNA fragment of e) with DNA comprising a sequence complementary to genomic DNA of the cell, under conditions in which hybridization between the DNA fragment and a region of the sequence complementary to genomic DNA occurs; and g) identifying the region of the sequence complementary to genomic DNA of f) to which the DNA fragment hybridzes, wherein if the region of the sequence complementary to genomic DNA of g) is a regulatory region, then the protein of interest is a transcription factor.
12. A method of identifying a set of genes, the members of which are genes for which cell cycle regulator binding correlates with gene expression, comprising:
(a) identifying a set of genes that is bound in vivo by at least one cell cycle regulator in a selected cell type;
(b) comparing the set of genes identified in (a) with genes whose expression levels vary in a periodic manner during the cell cycle of the selected cell type; and (c) identifying genes that are bound by one or more of the cell cycle regulators, thus identifying a set of genes, the members of which are genes whose expression levels vary in a periodic manner during the cell cycle and are bound by at least one cell cycle regulator, wherein the set identified in (c) is referred to as a set of genes, the members of which are genes for which cell cycle regulator binding correlates with gene expression.
13. The method of claim 12, wherein the selected cell type is a yeast cell.
14. The method of claim 13, wherein the at least one cell cycle regulator is at least one of the nine known yeast cell cycle transcriptional activators.
CA002432346A 2000-12-21 2001-12-21 Genome-wide location and function of dna binding proteins Abandoned CA2432346A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US25745500P 2000-12-21 2000-12-21
US60/257,455 2000-12-21
US32362001P 2001-09-20 2001-09-20
US60/323,620 2001-09-20
PCT/US2001/050396 WO2002059371A2 (en) 2000-12-21 2001-12-21 Genome-wide location and function of dna binding proteins

Publications (1)

Publication Number Publication Date
CA2432346A1 true CA2432346A1 (en) 2002-08-01

Family

ID=26945967

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002432346A Abandoned CA2432346A1 (en) 2000-12-21 2001-12-21 Genome-wide location and function of dna binding proteins

Country Status (3)

Country Link
EP (1) EP1381692A2 (en)
CA (1) CA2432346A1 (en)
WO (1) WO2002059371A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006078313A (en) * 2004-09-09 2006-03-23 Hitachi Software Eng Co Ltd Protein binding position identifying method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6410243B1 (en) * 1999-09-01 2002-06-25 Whitehead Institute For Biomedical Research Chromosome-wide analysis of protein-DNA interactions

Also Published As

Publication number Publication date
EP1381692A2 (en) 2004-01-21
WO2002059371A3 (en) 2003-11-06
WO2002059371B1 (en) 2003-12-18
WO2002059371A2 (en) 2002-08-01

Similar Documents

Publication Publication Date Title
US7575869B2 (en) Genome wide location and function of DNA binding proteins
US6410243B1 (en) Chromosome-wide analysis of protein-DNA interactions
Zeitlinger et al. Program-specific distribution of a transcription factor dependent on partner transcription factor and MAPK signaling
Haeusler et al. Clustering of yeast tRNA genes is mediated by specific association of condensin with tRNA gene transcription complexes
Borneman et al. Target hub proteins serve as master regulators of development in yeast
Rudra et al. Central role of Ifh1p–Fhl1p interaction in the synthesis of yeast ribosomal proteins
Casolari et al. Genome-wide localization of the nuclear transport machinery couples transcriptional status and nuclear organization
Lavoie et al. In vivo requirements for rDNA chromosome condensation reveal two cell-cycle-regulated pathways for mitotic chromosome folding
Lau et al. Cell-cycle control of the establishment of mating-type silencing in S. cerevisiae
Walrad et al. Differential trypanosome surface coat regulation by a CCCH protein that co-associates with procyclin mRNA cis-elements
Brickner et al. The role of transcription factors and nuclear pore proteins in controlling the spatial organization of the yeast genome
Kwon et al. Deciphering the transcriptional-regulatory network of flocculation in Schizosaccharomyces pombe
Haran et al. Telomeric ORFs (TLO s) in Candida spp. Encode Mediator Subunits That Regulate Distinct Virulence Traits
Burke et al. A fluorescence in situ hybridization method to quantify mRNA translation by visualizing ribosome–mRNA interactions in single cells
Sen et al. Functional interplay between DEAD-box RNA helicases Ded1 and Dbp1 in preinitiation complex attachment and scanning on structured mRNAs in vivo
Aligianni et al. The fission yeast homeodomain protein Yox1p binds to MBF and confines MBF-dependent cell-cycle transcription to G1-S via negative feedback
Holmes et al. Whi3, an S. cerevisiae RNA-binding protein, is a component of stress granules that regulates levels of its target mRNAs
Hoggard et al. The Fkh1 Forkhead associated domain promotes ORC binding to a subset of DNA replication origins in budding yeast
Akhter et al. Chromatin association of Gcn4 is limited by post-translational modifications triggered by its DNA-binding in Saccharomyces cerevisiae
Schlecht et al. Genome-wide expression profiling, in vivo DNA binding analysis, and probabilistic motif prediction reveal novel Abf1 target genes during fermentation, respiration, and sporulation in yeast
Kahana-Edwin et al. Multiple MAPK cascades regulate the transcription of IME1, the master transcriptional activator of meiosis in Saccharomyces cerevisiae
Perrot et al. CDK activity provides temporal and quantitative cues for organizing genome duplication
Sharma et al. The translation inhibitor cycloheximide affects ribosome profiling data in a species-specific manner
CA2432346A1 (en) Genome-wide location and function of dna binding proteins
Ishikawa et al. Genetic knockdown of genes that are obscure, conserved and essential using CRISPR interference methods in the fission yeast S. pombe

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued