CA2422362C - Modulation of meiotic recombination - Google Patents
Modulation of meiotic recombination Download PDFInfo
- Publication number
- CA2422362C CA2422362C CA2422362A CA2422362A CA2422362C CA 2422362 C CA2422362 C CA 2422362C CA 2422362 A CA2422362 A CA 2422362A CA 2422362 A CA2422362 A CA 2422362A CA 2422362 C CA2422362 C CA 2422362C
- Authority
- CA
- Canada
- Prior art keywords
- atspo11
- position corresponding
- protein
- meiotic
- glycine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Abstract
The invention provides methods of modifying the level of expression or functional activity of factors such as enzymes or other catalytic proteins or structural proteins, alone or in concert, to modify the frequency of meiotic homologous recombination involving the exchange of genetic information between non-sister chromatids from homologous maternal and paternal chromosomes. The steps at which modulation may occur include: homologous chromosome pairing, double-strand break formation; resection; strand invasion; branch migration; and resolution. Methods of plant and animal breeding are also provided that utilize the modulation of meiotic homologous recombination.
Description
MODULATION OF MEIOTIC RECOMBINATION
FIELD OF THE INVENTION
The invention is in the field of genetic manipulation of eulcaryotic cells and organisms, particularly the modulation of homologous recombination between non-sister chromatids in meiosis.
BACKGROUND OF THE INVENTION
Mitosis and meiosis are in many ways opposite processes. A principal role of DNA
recombination in mitotic cells is to preserve the fidelity of genetic information and ensure that it is faithfully reproduced and passed on to daughter cells. In contrast, DNA
recombination during meiosis acts to create new permutations of genetic information by facilitating reshuffling or intermixing of the maternal and paternal genomes during gamete formation to enable production of offspring with novel genomes as compared to either parent.
The different purposes of DNA recombination in meiotic versus mitotic cells are reflected in the very different rolls and mechanisms of homologous recombination in each cell type [1-5;
7; 8].
There is a fundamental mechanistic distinction between the primary processes of homologous recombination in meiotic (germ-line) cells compared to mitotic (vegetative/somatic) cells. In meiotic cells, homologous recombination occurs primarily between non-sister chromatids (to shuffle the genome), whereas in mitotic cells homologous recombination occurs primarily between sister chromatids (to correct genomic errors). Sister chromatids are replicated copies of a particular maternal or paternal chromosome.
Recombination between non-sister chromatids (i.e. between a paternal chromatid and a maternal chromatid) occurs 500-1000 fold more frequently in meiotic cells versus mitotic cells [48;50]. The meiotic process of non-sister chromatid exchange (NSCE) facilitates novel recombination of the genetic information from two parents of the organism. In contrast, the mitotic process of sister-chromatid exchange (SCE) resulting from recombination-mediated repair is a primary mechanism for maintaining genome fidelity throughout a multi-cellular organism.
There are a significant number of mechanical distinctions between mitotic SCE
and meiotic NSCE, as these processes are currently understood. Physical interactions and recombination between meiotic chromosomes is associated with formation and function of the synaptonemal complex which is a unique proteinaceous structure that assembles during meiosis and participates in enabling pairing and exchange between non-sister chromatids [156; 157; 158; 159; 160]. Double-strand breaks in meiotic recombination are understood to be catalysed by a conserved, specific enzyme, SPO1 1 [4;9-11], whereas in mitotic cells double-strand breaks generally result from spontaneous lesions [3;7]. SPO1 1 is a Type II
topoisomerase [121] that is responsible for double-strand break formation in meiotic homologous recombination [9;121].
SP011 proteins are identifiable based on their homology with respect to five conserved protein motifs of the archaebacterial subunit A of Topoisomerase VI
[121].
Motif I, as depicted in Figure 1, contains the active site tyrosine, and motifs III to V include what has been called the "Toprim" (topoisomerase and primase) domain [166].
Motif III
includes an invariant glutamate residue (E), and motif V includes a "DXD"
motif. This trio of acidic residues fall within an "acidic pocket" anf appear to coordinate Mg+2 binding to assist catalysis of cleavage of DNA by the active site tyrosine [167].
Mutations in this acidic pocket impair or abolish the ability of SPO1 1 to create double strand breaks in vivo [167].
Table 1. Key Amino Acid Residues in the Five Conserved Motifs Present in SPO1 1 Proteins is Amino acid in TOPVLA Corresponding amino acid from S. Shibataa AtSP011-1b Thr 100 Ser 97 Arg 102 Arg 99 Tyr 106 Tyr 103 Arg 150 Arg 130 Gly 161 Gly 141 Glu 209 Glu 189 Phe 214 Phe 194 Leu 217 Leu 197 Gly 235 Gly 215 Pro 237 Pro 217 Thr 241 Thr 221 Arg 242 Arg 222 Asp 261 Asp 241 Asp 263 Asp 243 Pro 264 Pro 244 Gly 266 Gly 246 Ile 269 Ile 249 a The amino acid numbering for TOP VIA from S. Shibata is taken from Figure 1 of Bergerat et al. [121]
b The amino acid numbering for SPO1 1 from A. thaliana (SEQ ID NO: 40) is taken from Hartung, F. and Puchta, H. [14]
FIELD OF THE INVENTION
The invention is in the field of genetic manipulation of eulcaryotic cells and organisms, particularly the modulation of homologous recombination between non-sister chromatids in meiosis.
BACKGROUND OF THE INVENTION
Mitosis and meiosis are in many ways opposite processes. A principal role of DNA
recombination in mitotic cells is to preserve the fidelity of genetic information and ensure that it is faithfully reproduced and passed on to daughter cells. In contrast, DNA
recombination during meiosis acts to create new permutations of genetic information by facilitating reshuffling or intermixing of the maternal and paternal genomes during gamete formation to enable production of offspring with novel genomes as compared to either parent.
The different purposes of DNA recombination in meiotic versus mitotic cells are reflected in the very different rolls and mechanisms of homologous recombination in each cell type [1-5;
7; 8].
There is a fundamental mechanistic distinction between the primary processes of homologous recombination in meiotic (germ-line) cells compared to mitotic (vegetative/somatic) cells. In meiotic cells, homologous recombination occurs primarily between non-sister chromatids (to shuffle the genome), whereas in mitotic cells homologous recombination occurs primarily between sister chromatids (to correct genomic errors). Sister chromatids are replicated copies of a particular maternal or paternal chromosome.
Recombination between non-sister chromatids (i.e. between a paternal chromatid and a maternal chromatid) occurs 500-1000 fold more frequently in meiotic cells versus mitotic cells [48;50]. The meiotic process of non-sister chromatid exchange (NSCE) facilitates novel recombination of the genetic information from two parents of the organism. In contrast, the mitotic process of sister-chromatid exchange (SCE) resulting from recombination-mediated repair is a primary mechanism for maintaining genome fidelity throughout a multi-cellular organism.
There are a significant number of mechanical distinctions between mitotic SCE
and meiotic NSCE, as these processes are currently understood. Physical interactions and recombination between meiotic chromosomes is associated with formation and function of the synaptonemal complex which is a unique proteinaceous structure that assembles during meiosis and participates in enabling pairing and exchange between non-sister chromatids [156; 157; 158; 159; 160]. Double-strand breaks in meiotic recombination are understood to be catalysed by a conserved, specific enzyme, SPO1 1 [4;9-11], whereas in mitotic cells double-strand breaks generally result from spontaneous lesions [3;7]. SPO1 1 is a Type II
topoisomerase [121] that is responsible for double-strand break formation in meiotic homologous recombination [9;121].
SP011 proteins are identifiable based on their homology with respect to five conserved protein motifs of the archaebacterial subunit A of Topoisomerase VI
[121].
Motif I, as depicted in Figure 1, contains the active site tyrosine, and motifs III to V include what has been called the "Toprim" (topoisomerase and primase) domain [166].
Motif III
includes an invariant glutamate residue (E), and motif V includes a "DXD"
motif. This trio of acidic residues fall within an "acidic pocket" anf appear to coordinate Mg+2 binding to assist catalysis of cleavage of DNA by the active site tyrosine [167].
Mutations in this acidic pocket impair or abolish the ability of SPO1 1 to create double strand breaks in vivo [167].
Table 1. Key Amino Acid Residues in the Five Conserved Motifs Present in SPO1 1 Proteins is Amino acid in TOPVLA Corresponding amino acid from S. Shibataa AtSP011-1b Thr 100 Ser 97 Arg 102 Arg 99 Tyr 106 Tyr 103 Arg 150 Arg 130 Gly 161 Gly 141 Glu 209 Glu 189 Phe 214 Phe 194 Leu 217 Leu 197 Gly 235 Gly 215 Pro 237 Pro 217 Thr 241 Thr 221 Arg 242 Arg 222 Asp 261 Asp 241 Asp 263 Asp 243 Pro 264 Pro 244 Gly 266 Gly 246 Ile 269 Ile 249 a The amino acid numbering for TOP VIA from S. Shibata is taken from Figure 1 of Bergerat et al. [121]
b The amino acid numbering for SPO1 1 from A. thaliana (SEQ ID NO: 40) is taken from Hartung, F. and Puchta, H. [14]
Arabidopsis thaliana has two SPO1 1 proteins, Arabidopsis thaliana SP011-1 (AtSPO1 1-1) and Arabidopsis thaliana SPO1 1-2 (AtSPO1 1-2) [14]. The amino acid sequences of AtSPO1 1-1 and AtSP011-2 are provided in Figures 1B and 1C, respectively.
Table 1 identifies the AtSPO1 1 residues that correspond to the key conserved residues [121].
Upon formation of double strand breaks in either SCE or NSCE, the exposed double-stranded ends are understood to be resected by an exonuclease activity that degrades the DNA to generate single-stranded DNA (ssDNA) ends which have a 3'-hydroxyl group. This resection process is understood to be catalysed by a protein complex composed of at least three known proteins, MRE11, RAD50 and XRS2/NBS1 which are conserved from yeast to plants and humans [12-19]. The ssDNA ends may then be acted upon by another set of proteins so that the ends invade the sister chromatid in mitotic cells or, uniquely, the chromatid of the paired homologous chromosome from the other parent in meiotic cells.
Strand invasion may be catalysed by a group of proteins which are known as RecA
homologues as a consequence of their sequence and functional similarity to the Escherichia coli RecA protein. RecA has been extensively studied and has been demonstrated in vitro to catalyse pairing between homologous DNA molecules and strand invasion [6].
Yeast are reported to have at least four proteins with homology to RecA: RAD51; RAD55;
RAD57;
and DMC1 [5]. These proteins are also highly conserved in plants and humans [21;22;24;25;39]. Eukaryotic RecA homologues also catalyse pairing between homologous DNA molecules and strand invasion [51;52]. Genetic studies illustrate the primacy of this group of proteins in mitotic and meiotic homologous recombination [13;20;23;53-57]. These biochemical and genetic studies demonstrate the high conservation of function of RecA
homologues from lower to higher eukaryotes. Whereas RAD51, RAD55 and RAD57 play a role in both mitotic and meiotic homologous recombination [23;56], DMC1 functions in a meiosis-specific manner [20;54;55]. Biochemical and genetic evidence points to RAD51, RAD55 and RAD57 interacting in a common pathway whereas DMC1 acts in a unique but overlapping pathway [53;56]. The existence of two unique pathways of RecA
homologues acting during meiosis is also supported by cytological studies whereby DMC1 and RAD51 are found at different nodes along the chromosome undergoing recombination [53]. RAD51, RAD55 and RAD57 may only facilitate homologous recombination on DNA molecules with a specific structure and topology unique to this group of proteins [59]. It has been proposed that DMC1 may act on specific DNA structures, potentially not recognized by RAD51, -2a-RAD55 or RAD57, to promote pairing and recombination between homologous maternal and paternal chromosomes and catalyse NSCE [53;60]. These DNA structures may be meiosis-specific, again illustrating the unique attributes of homologous recombination involving NSCE during meiosis versus SCE in mitotic cells.
While RAD51 and DMC1 can apparently catalyse pairing and strand invasion alone, they also act in concert with other proteins that enhance homologous recombination. For example, RAD51 physically interacts with RAD54 [61;62] and RAD52 [42] and both of these proteins are conserved from yeast to humans [64;65]. Inclusion of RAD54 or RAD52 in in vitro assays demonstrate these proteins can stimulate the pairing and strand invasion activity of RAD51 [23;66]. DMC1 does not physically interact with RAD54 [53]
but does interact with a RAD54 homologue, known as TID1 [53], which acts in NSCE during meiosis [49]. This again illustrates the uniqueness of the homologous recombination pathways catalysed by DMC1 versus RAD51. In addition to the promoting effects of RAD54 and RAD52, homologous recombination is enhanced by a complex of proteins which bind ssDNA. In eukaryotes, this protein complex is a heterotrimer known as RPA
[26]. ssDNA-binding proteins function in DNA recombination and repair by reducing secondary structure in ssDNA thereby increasing the ability of RecA-like proteins to bind and act upon the ssDNA [67]. RPA is conserved from yeast to humans [26]. RPA has been demonstrated to physically interact with RAD51 and DMC1 [68], as well as associating with RAD52 [69], and may thereby act in recruiting RecA-homologues and/or other recombination proteins to recombinogenic ends, or assist in forming recombinogenic DNA-protein complexes.
Other participants in the pairing and strand exchange processes leading to homologous recombination in meiotic cells include MSH4, MSH5 and MLH1[27;29;31].
These proteins are also conserved from yeast to plants and humans [28;30;32;33] . MLH1 functions principally in mismatch repair to ensure fidelity of DNA replication in vegetative cells but also plays a role in homologous recombination in meiotic cells [31].
MSH4 and MSH5 are meiosis-specific homologues of a set of proteins, unique from MLH1, which function in mismatch repair in vegetative cells [27; 29] . The biochemical role of MSH4 and MSH5 during meiosis is unclear as yet but evidence points to these proteins participating in DNA exchange between homologous chromosomes [27; 29]. The specificity of MSH4 and MSH5 to homologous recombination in meiotic cells again points to the uniqueness of this homologous recombination process versus that which occurs in vegetative cells.
Table 1 identifies the AtSPO1 1 residues that correspond to the key conserved residues [121].
Upon formation of double strand breaks in either SCE or NSCE, the exposed double-stranded ends are understood to be resected by an exonuclease activity that degrades the DNA to generate single-stranded DNA (ssDNA) ends which have a 3'-hydroxyl group. This resection process is understood to be catalysed by a protein complex composed of at least three known proteins, MRE11, RAD50 and XRS2/NBS1 which are conserved from yeast to plants and humans [12-19]. The ssDNA ends may then be acted upon by another set of proteins so that the ends invade the sister chromatid in mitotic cells or, uniquely, the chromatid of the paired homologous chromosome from the other parent in meiotic cells.
Strand invasion may be catalysed by a group of proteins which are known as RecA
homologues as a consequence of their sequence and functional similarity to the Escherichia coli RecA protein. RecA has been extensively studied and has been demonstrated in vitro to catalyse pairing between homologous DNA molecules and strand invasion [6].
Yeast are reported to have at least four proteins with homology to RecA: RAD51; RAD55;
RAD57;
and DMC1 [5]. These proteins are also highly conserved in plants and humans [21;22;24;25;39]. Eukaryotic RecA homologues also catalyse pairing between homologous DNA molecules and strand invasion [51;52]. Genetic studies illustrate the primacy of this group of proteins in mitotic and meiotic homologous recombination [13;20;23;53-57]. These biochemical and genetic studies demonstrate the high conservation of function of RecA
homologues from lower to higher eukaryotes. Whereas RAD51, RAD55 and RAD57 play a role in both mitotic and meiotic homologous recombination [23;56], DMC1 functions in a meiosis-specific manner [20;54;55]. Biochemical and genetic evidence points to RAD51, RAD55 and RAD57 interacting in a common pathway whereas DMC1 acts in a unique but overlapping pathway [53;56]. The existence of two unique pathways of RecA
homologues acting during meiosis is also supported by cytological studies whereby DMC1 and RAD51 are found at different nodes along the chromosome undergoing recombination [53]. RAD51, RAD55 and RAD57 may only facilitate homologous recombination on DNA molecules with a specific structure and topology unique to this group of proteins [59]. It has been proposed that DMC1 may act on specific DNA structures, potentially not recognized by RAD51, -2a-RAD55 or RAD57, to promote pairing and recombination between homologous maternal and paternal chromosomes and catalyse NSCE [53;60]. These DNA structures may be meiosis-specific, again illustrating the unique attributes of homologous recombination involving NSCE during meiosis versus SCE in mitotic cells.
While RAD51 and DMC1 can apparently catalyse pairing and strand invasion alone, they also act in concert with other proteins that enhance homologous recombination. For example, RAD51 physically interacts with RAD54 [61;62] and RAD52 [42] and both of these proteins are conserved from yeast to humans [64;65]. Inclusion of RAD54 or RAD52 in in vitro assays demonstrate these proteins can stimulate the pairing and strand invasion activity of RAD51 [23;66]. DMC1 does not physically interact with RAD54 [53]
but does interact with a RAD54 homologue, known as TID1 [53], which acts in NSCE during meiosis [49]. This again illustrates the uniqueness of the homologous recombination pathways catalysed by DMC1 versus RAD51. In addition to the promoting effects of RAD54 and RAD52, homologous recombination is enhanced by a complex of proteins which bind ssDNA. In eukaryotes, this protein complex is a heterotrimer known as RPA
[26]. ssDNA-binding proteins function in DNA recombination and repair by reducing secondary structure in ssDNA thereby increasing the ability of RecA-like proteins to bind and act upon the ssDNA [67]. RPA is conserved from yeast to humans [26]. RPA has been demonstrated to physically interact with RAD51 and DMC1 [68], as well as associating with RAD52 [69], and may thereby act in recruiting RecA-homologues and/or other recombination proteins to recombinogenic ends, or assist in forming recombinogenic DNA-protein complexes.
Other participants in the pairing and strand exchange processes leading to homologous recombination in meiotic cells include MSH4, MSH5 and MLH1[27;29;31].
These proteins are also conserved from yeast to plants and humans [28;30;32;33] . MLH1 functions principally in mismatch repair to ensure fidelity of DNA replication in vegetative cells but also plays a role in homologous recombination in meiotic cells [31].
MSH4 and MSH5 are meiosis-specific homologues of a set of proteins, unique from MLH1, which function in mismatch repair in vegetative cells [27; 29] . The biochemical role of MSH4 and MSH5 during meiosis is unclear as yet but evidence points to these proteins participating in DNA exchange between homologous chromosomes [27; 29]. The specificity of MSH4 and MSH5 to homologous recombination in meiotic cells again points to the uniqueness of this homologous recombination process versus that which occurs in vegetative cells.
Strand invasion and formation of the initial crossover or chiasma between the sister chromatids in vegetative cells and non-sister chromatids in meiotic cells is followed by branch migration, DNA replication and strand displacement. This increases the length of genetic information exchanged between the two chromatids. A second chiasma then occurs.
The chiasma are acted upon by an enzyme known as a resolvase. This family of enzymes recognize and bind the cruciform structure created by the chiasma between the paired chromatids. Resolvases have been well characterized in microorganisms, including lower eukaryotes[43; 44], and the activity has been detected in humans [161] .
It has been suggested that recombinases may be used to stimulate mitotic homologous recombination between sister chromatids in eukaryotes, which has been proposed as a mechanism to promote gene targeting in vegetative/somatic cells [63;82;85;86].
Gene targeting generally involves the directed alteration of a specific DNA
sequence in its genomic locus in vivo. Problems have however been reported with mitotic gene targeting. It has for example been found that overexpression of RecA-homologues in mitotic cells may cause cell cycle arrest [92]. International Patent Publication WO 97/08331 dated 6 March 1997 summarizes a range of difficulties with earlier suggestions that the E.
colt RecA
recombinase would be useful for stimulating homologous mitotic recombination (as for example had been suggested in International Patent Publications WO 93/22443, WO
94/04032 and WO 93/06221). Utilization of E. colt RecA in eukaryotic cells is potentially problematic because the direction of strand transfer catalysed by RecA is the opposite to the direction of strand transfer catalysed by eukaryotic RecA homologues [52].
Nevertheless, overexpression of E. colt RecA has been reported to promote gene targeting approximately 10-fold in mouse cells [63] and less than two-fold in plants [82]. However, this latter result in plants also demonstrated a very low overall frequency of gene targeting, which would tend to cast doubt on the statistical significance of the result.
In the face of difficulties associated with the use of E. coli RecA in mitotic gene targeting, alternative enzymes have been used to catalyse homologous sister chromatid exchange in mitotic cells. For example, U.S. Patent Nos. 5,780,296 and 5,945,339 disclose methods to promote homologous recombination using Rec2 as an alternative recombinase to overcome problems with the use of RecA [86]. It has been reported that overexpression of human RAD51 (hRAD51) can increase gene targeting frequency by 2-3 fold [85].
In applications other than gene targeting in mitotic cells, other studies have suggested that increased expression of E. colt RecA or RAD51 may increase the resistance of cells to radiation or other DNA damaging agents [82; 85; 87-89; 91], and enhance the frequency of intrachromosomal recombination [88;90;91] and sister-chromatid exchange [82].
It has also been suggested that increased RAD51 activity during meiosis has no effect on the viability of gametes, although no evaluation of homologous recombination in these cells was conducted [87]. Identification of mechanistic steps in meiotic homologous recombination has utilized genetic analysis of mutants to identify genes involved in homologous recombination and DNA repair, and mutants with reduced meiotic homologous recombination have been identified [9;20;23;93]. Null-mutations typically have a severe effect on the whole meiotic process, and can affect viability of gametes [9;20;54;55;93-95] and have pleiotropic effects on the organism at different developmental stages or in different tissues or in response to environmental conditions. For example, rad51 null mutants may have decreased meiotic homologous recombination frequency but they also reportedly have poor DNA
repair and resistance to environmental stresses and DNA damaging agents [96;97], as well as a lethal phenotype in embryos [95].
SUMMARY OF THE INVENTION
The present invention recognizes the need in the art for methods of modifying the frequency of non-sister chromatid exchange in meiosis to facilitate heritable genomic changes during gamete formation, for example to facilitate breeding of plants and animals and for gene targeting in meiotic cells. The invention provides methods of modifying the level of expression or functional activity of factors such as enzymes or other catalytic proteins or structural proteins alone or in concert, to modify the frequency of meiotic homologous recombination involving the exchange of genetic information between non-sister chromatids from homologous maternal and paternal chromosomes. The steps at which modulation may occur include: homologous chromosome pairing, doublestrand break formation; resection; strand invasion; branch migration; and resolution.
In one aspect, the invention provides methods of increasing meiotic homologous recombination in a eukaryote, comprising transforming a eukaryotic cell with a nucleic acid encoding an activator of meiotic homologous recombination. The nucleic acid encoding the activator of meiotic homologous recombination may be operably linked to a promoter, so that the transformed eukaryotic cell is capable of expressing the activator of meiotic homologous recombination. The transformed eukaryotic cell, or its progeny, may then be allowed to undergo meiosis to produce viable gametes under conditions wherein the activator of meiotic homologous recombination is active during meiosis to increase the frequency of homologous non-sister chromatid exchange (NSCE). In alternative embodiments, the activator of meiotic homologous recombination may be an enzyme or other catalytic protein or structural protein, or transcription factor controlling the expression thereof, involved in meiotic homologous recombination, such as a eukaryotic homologue of SPO 1 1 [9-11], MREll [12-15], RAD50 [16;17], XRS2/NBS1 [18;19], DMC1 [20-22], RAD51 [21;23-25], RPA [26], MSH4 [27;28], MSH5 [29;30], MLH1 [31-33], RAD52 [34;35], RAD54 [36;37], TID1 [53], RAD55 [38;39], RAD57 [39;40], Rad59 [41;42] or Resolvase [43;44;161] or chromatin remodeling proteins [152-155] or synaptomemal complex proteins (proteins associated with assembly and function of the synaptonemal complex) [156; 157; 158; 163] . In some embodiments, the frequency of mitotic homologous sister chromatid exchange in the eukaryote may not be altered to a level detrimental to cell viability, growth or reproduction, while the frequency of meiotic homologous recombination is increased or decreased. The promoter may be regulatable by induction or repression or may be a meiosis-specific promoter or a promoter with enhanced expression during meiosis, i.e. a preferentially-meiotic promoter, or a promoter capable of expressing the activator at a level sub-inhibitory to vegetative cells. The invention includes non-human eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of selectively inhibiting meiotic homologous recombination in a eukaryote. Such methods may involve transforming a eukaryotic cell with a nucleic acid encoding an inhibitor of meiotic recombination. The nucleic acid encoding the inhibitor of meiotic recombination may be operably linked to a promoter, such as a promoter regulated by induction or repression, meiosis-specific or preferentially-meiotic promoter, or a promoter capable of expressing the activator at a level sub-inhibitory to vegetative cells, so that the transformed eukaryotic cell may be capable of expressing the inhibitor of meiotic recombination. The transformed eukaryotic cell, or a descendant of the transformed eukaryotic cell, may then be allowed to undergo meiosis to produce viable gametes under conditions wherein the inhibitor of meiotic recombination is active during meiosis to decrease the level of homologous non-sister chromatid exchange.
The inhibitor of meiotic recombination may be a dominant-negative form (such as a mutant endogenous protein or a mutant or wild-type heterologous protein) of an enzyme or other catalytic protein or a structural protein, or transcription factor controlling the expression thereof, involved in meiotic homologous recombination. In some embodiments, the frequency of mitotic homologous sister chromatid exchange in the eukaryote may not be altered to a level detrimental to cell viability, growth or reproduction, while meiotic homologous recombination is increased or decreased. The invention includes non-human eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of plant and animal breeding, in which the frequency of non-sister chromatid exchange in meiotic homologous recombination is modulated, prior to crossing a gamete from the parent organism with a second gamete to obtain progeny. The invention includes non-human eukaryotes produced by such processes.
The invention also provides methods of genomic mapping and map-based gene cloning comprising modulating the frequency of non-sister chromatid exchange in meiotic homologous recombination in a first cell, crossing the first cell with a second cell, and measuring the genetic linkage between markers in a progeny cell.
Various embodiments of the invention provide a method of modulating meiotic homologous recombination in plant cells, comprising: transforming a plant cell of a plant species with a nucleic acid encoding a protein, wherein the protein comprises five conserved motifs present in SPO 1 1 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SP011-1 (AtSP011-1) when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, the protein further comprises: arginine at a position corresponding to arginine 99 of Arabidopsis thaliana SP011-1 (AtSPO 1 1 -1); tyrosine at a position corresponding to tyrosine 103 of AtSP011-1; arginine at a position corresponding to arginine 130 of AtSP011-1;glycine at a position corresponding to glycine 141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of AtSP011-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1; leucine at a position corresponding to leucine 197 of AtSP011-1; glycine at a position corresponding to glycine 215 of AtSP011-1; proline at a position corresponding to proline 217 of AtSP011-1; threonine at a position corresponding to threonine 221 of AtSP011-1; arginine at a position corresponding to arginine 222 of AtSP011-1; aspartate at a position corresponding to aspartate 241 of AtSP011-1;
proline at a position corresponding to proline 244 of AtSP011-1; glycine at a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a position corresponding to isoleucine 249 of AtSP011-1,wherein the protein is operable to initiate meiotic recombination, wherein said nucleic acid is operably linked to a promoter; and allowing the transformed plant cell, or a descendant of the transformed plant cell, to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the transformed plant cell or the descendant increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
Various embodiments of the invention provide a plant cell of a plant species, comprising a recombinant nucleic acid encoding: a protein, wherein the protein comprises five conserved motifs present in SPO1 1 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SP011-1 (AtSP011-1) when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSP011-1);
tyrosine at a position corresponding to tyrosine 103 of AtSP011-1; arginine at a position corresponding to arginine 130 of AtSP011-1; glycine at a position corresponding to glycine 141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of AtSP011-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1;
leucine at a position corresponding to leucine 197 of AtSP011-1; glycine at a position corresponding to glycine 215 of AtSPO1 1-1; proline at a position corresponding to proline 217 of AtSP011-1;
threonine at a position corresponding to threonine 221 of AtSP011-1; arginine at a position corresponding to arginine 222 of AtSP011-1; aspartate at a position corresponding to aspartate 241 of AtSP011-1; proline at a position corresponding to proline 244 of AtSP011-1; glycine at a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a position corresponding to isoleucine 249 of AtSP011-1, wherein said nucleic acid is operably linked to a promoter, and wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the plant cell increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
Various embodiments of the invention provide a plant cell of a plant species, 7a comprising a recombinant nucleic acid encoding: a protein, wherein the protein comprises five conserved motifs present in SPO 1 1 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SPO 1 1-1 (AtSPO 1 1-1) when the amino acid sequences of the protein and AtSPO
1 1-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSP011-1);
arginine at a position corresponding to arginine 130 of AtSP011-1; glycine at a position corresponding to glycine 141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of AtSP011-1; phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1; leucine at a position corresponding to leucine 197 of AtSP011-1;
glycine at a position corresponding to glycine 215 of AtSP011-1; proline at a position corresponding to proline 217 of AtSP011-1; threonine at a position corresponding to threonine 221 of AtSP011-1; arginine at a position corresponding to arginine 222 of AtSP011-1;
aspartate at a position corresponding to aspartate 241 of AtSP011-1; proline at a position corresponding to proline 244 of AtSP011-1; glycine at a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a position corresponding to isoleucine 249 of AtSP011-1, wherein the protein lacks a tyrosine at a position corresponding to tyrosine 103 of AtSP011-1, wherein the protein is operable to inhibit double strand break catalysis by an endogenous SPO 1 1 protein, and wherein said nucleic acid is operably linked to a promoter, wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, and wherein expression of the protein in the plant cell decreases the frequency of homologous non-sister chromatid exchange during the meiotic event.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect of the invention, the frequency of homologous recombination between non-sister chromatids during meiosis is increased or decreased by specifically changing the activity level of one or more activators or inhibitors of meiotic homologous recombination, such as proteins involved in homologous recombination, to affect one or more steps of the homologous recombination process.
7b Taking advantage of the fact that meiotic homologous recombination between homologous non-sister chromatids first requires a double-strand break in one of the paired homologues, one aspect of the present invention facilitates an increase in the potential for homologous recombination events by increasing the number of double-strand breaks. Local chromatin structure plays an important role in the positioning and frequency of meiotic double-strand breaks leading to meiotic homologous recombination [151]. Chromatin structure remodeling may be a result of the action of two groups of enzymes highly conserved among eukaryotes: 1) ATP-dependent remodeling complexes, and 2) histone acetyltransferases and histone deacetylases [152-155]. Thus one may increase the frequency of double-strand breaks by modifying the activity level of chromatin remodeling enzymes to create chromatin structure that facilitates a greater incidence of double-strand break formation. This may be achieved, for example, by enhancing histone acetyl transferase activity. Conversely one may decrease the frequency of double-strand breaks by modifying the activity level of chromatin remodeling enzymes to create chromatin structure that is less amenable to double-strand break formation.
This may be achieved, for example, by 7c enhancing histone deacetylase activity. In addition to the manipulation of chromatin structure, the frequency of double-strand break formation may be achieved, for example, by increasing the level of SPO 1 1 activity during appropriate stages in meiosis or other appropriate stages in the cell cycle. Conversely, one may reduce the frequency of homologous recombination during meiosis by suppressing the function or expression of SPO 1 1 at appropriate stages in meiosis, to decrease the number of double-strand breaks available and, therefore, decrease the frequency of initiating DNA exchange between homologous chromosomes during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be modified by modifying the activity level of enzymes involved in resection of double-stranded DNA (dsDNA) to create ssDNA ends required for strand invasion of the paired homologous chromosome. Thus, activity of MRE11, RAD50 and/or XRS2/NBS1 could be increased to promote creation of recombinogenic ssDNA by increasing the number of double-strand breaks created by SPO 1 1 being converted into recombinogenic ssDNA, to increase the frequency of meiotic homologous recombination. Conversely, frequency of meiotic homologous recombination may be decreased by reducing the activity of MRE11, and/or XRS2/NBS1 so as to decrease the conversion of double-strand breaks created by SPO 1 1 into recombinogenic ends. In addition, modifying the resection process may be used to increase gene targeting frequency by promoting conversion of gene targeting substrates to DNAs having recombinogenic ends, for example by increased activity of SP011, MRE11, RAD50 and/or XRS2/NBS1.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the activity of enzymes and structural proteins involved in pairing of homologous DNA and strand invasion. Thus, activity of RecA homologues such as and DMC1 may be increased in meiosis to promote homologous DNA pairing of non-sister chromatids and initiation of crossovers by strand invasion. Increased activity levels of these proteins may increase conversion of recombinogenic ends created by MRE11, RAD50 and XRS2/NBS1 into functional crossover events thereby increasing homologous recombination frequency. Because RAD51 and DMC1 act in unique but overlapping pathways [53], one may modulate the homologous recombination frequency and frequency of NSCE by increasing the activity of DMC1 and RAD51 individually or in concert.
Conversely, the activity level of DMC1 and RAD51 alone or in concert may be decreased to decrease the frequency of NSCE. Other RecA homologues such as RAD55 and RAD57 may also be used in this way in meiosis. In addition, other proteins participating in homologous DNA pairing and strand-invasion, such as MSH4, MSH5 and MLH1, may be used to increase or decrease meiotic homologous recombination frequency through modulating their activity levels at appropriate stages of meiosis. ssDNA-binding proteins such as EcSSB or RPA
which may function coordinately with RecA homologues may also be used to modulate homologous recombination frequency. For example, during meiosis, reducing the level of RPA in the nucleus or the activity of RPA within the nucleus may affect the activity of RecA
homologues during meiosis and change the homologous recombination frequency.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the activity of proteins that act in conjunction with RecA
homologues to promote DNA pairing and crossing-over. For example, meiotic homologous recombination may be increased by increasing activity level of RAD54 and TID1, alone or in concert, independently or coordinately with RAD51 and/or DMC1 (RAD51 activity is stimulated in vitro by inclusion of RAD54 [66] and TID1 is a homologue of RAD54 that physically interacts with DMC1 [53]). Conversely, meiotic homologous recombination frequency may be decreased by reduction of expression or activity level of RAD54 and/or TID1. In some embodiments, homologous recombination frequency may be modulated by regulating the expression and functional activity of these four proteins independently or in different permutations. This approach of modulating recombination frequency may also be used with other proteins that physically interact directly or indirectly and modify the activity of RecA homologues functioning during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the activity level of resolvase. Thus, activity of resolvase may be increased to promote resolution of crossovers thereby increasing the frequency of exchange of genetic information between non-sister chromatids. It has been reported that, of the total number of crossovers initiated between homologous chromosomes during meiosis, only a fraction are resolved to result in actual exchange of genetic information between the homologous chromosomes, with the rest dissolving without causing exchange of genetic information [72]. In another aspect of the invention, meiotic homologous recombination frequency may be decreased by reducing the level or functional activity of resolvase during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the assembly or function of the synaptonemal complex.
Thus the action of proteins important in assembly and function of the synaptonemal complex such as potential regulatory proteins, like ATM [163] or MEK1 [157], or structural proteins, like HOPI [156], RED1 [164], or ZIP1 [165], or functional homologues thereof, may be inhibited so as to impair formation of the synaptonemal complex and reduce homologous chromosome pairing by decreasing the frequency of non-sister chromatid exchange. In another aspect of the invention, assembly and function of the synaptonemal complex may be promoted to increase recombination frequency during meiosis.
In alternative embodiments, the activator or inhibitor of meiotic homologous recombination may be an anti-sense molecule or a co-suppreseive nucleic acid.
A co-suppreseive nucleic acid is a nucleic acid that supresses the expression of another nucleic acid by means of co-suppression. Anti-sense oligonucleotides, including anti-sense RNA
molecules and anti-sense DNA molecules, generally act to block the translation of mRNA by binding to targeted mRNA and inhibiting protein translation from the bound mRNA. For example, anti-sense oligonucleotides complementary to regions of a DNA
sequence encoding an enzyme involved in meiotic homologous recombination, such as DMC1, may be expressed in transformed plant cells during the appropriate developmental stage to down-regulate the enzyme. Alternative methods of down-regulating protein expression may include the use of ribozymes or other enzymatic RNA molecules (such as hammerhead RNA structures) that are capable of catalysing the cleavage of RNA (as disclosed in U.S. Patent Nos.
4,987,071 and 5,591,610. The mechanism of ribozyme action generally involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Additionally, antibodies or peptides which inhibit the activity of the target protein may be introduced or expressed in meiotic cells to suppress activity of the target protein.
It is well known in the art that some modifications and changes can be made in the structure of a polypeptide without substantially altering the biological function of that peptide, to obtain a biologically equivalent polypeptide. In one aspect of the invention, proteins that modulate meiotic recombination may differ from a portion of the corresponding native sequence by conservative amino acid substitutions. As used herein, the term "conserved amino acid substitutions" refers to the substitution of one amino acid for another at a given location in the peptide, where the substitution can be made without loss of function. In making such changes, substitutions of like amino acid residues can be made, for example, on the basis of relative similarity of side-chain substituents, for example, their size, - _____________ .
charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the peptide by routine testing. In some embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydrophilicity value (e.g., within a value of plus or minus 2.0), where the following hydrophilicity values are assigned to amino acid residues (as detailed in United States Patent No. 4,554,101): Arg (+3.0);
Lys (+3.0); Asp (+3.0); Glu (+3.0); Ser (+0.3); Asn (+0.2); Gin (+0.2); Gly (0);
Pro (-0.5); Thr (-0.4); Ala (-0.5); His (-0.5); Cys (-1.0); Met (-1.3); Val (-1.5); Leu (-1.8);
Ile (-1.8); Tyr (-2.3);
Phe (-2.5); and Trp (-3.4). In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydropathic index (e.g., within a value of plus or minus 2.0). In such embodiments, each amino acid residue may be assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics, as follows: Ile (+4.5); Val (+4.2); Leu (+3.8);
Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); Gly (-0.4); Thr (-0.7); Ser (-0.8); Trp (-0.9); Tyr (-1.3); Pro (-1.6); His (-3.2); Glu (-3.5); Gin (-3.5); Asp (-3.5); Asn (-3.5); Lys (-3.9);
and Arg (-4.5). In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another in the same class, where the amino acids are divided into non-polar, acidic, basic and neutral classes, as follows: non-polar: Ala, Val, Leu, Ile, Phe, Trp, Pro, Met; acidic: Asp, Glu; basic: Lys, Arg, His; neutral: Gly, Ser, Thr, Cys, Asn, Gin; Tyr.
Various aspects of the present invention encompass nucleic acid or amino acid sequences that are homologous to other sequences. As the term is used herein, an amino acid or nucleic acid sequence is "homologous" to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (for example, both sequences function as or encode a selected enzyme or promoter function;
as used herein, the term 'homologous' does not infer evolutionary relatedness). Nucleic acid sequences may also be homologous if they encode substantially identical amino acid sequences, even if the nucleic acid sequences are not themselves substantially identical , a circumstance that may for example arise as a result of the degeneracy of the genetic code.
Two nucleic acid or protein sequences are considered substantially identical if, when optimally aligned, they share at least about 25% sequence identity in protein domains essential for conserved function. In alternative embodiments, sequence identity may for example be at least 50%, 70%, 75%, 90% or 95%. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman,1981, Adv. App!. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. ScL USA 85:
2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA
and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI, U.S.A.). Sequence alignment may also be carried out using the BLAST
algorithm, described in Altschul etal., 1990,1 MoL Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information.
The BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold. Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X
from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST programs may use as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad ScL
USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (which may be changed in alternative embodiments to 1 or 0.1 or 0.01 or 0.001 or 0.0001; although E
values much higher than 0.1 may not identify functionally similar sequences, it is useful to examine hits with lower significance, E values between 0.1 and 10, for short regions of similarity), M=5, N=4, for nucleic acids a comparison of both strands. For protein comparisons, BLASTP may be used with defaults as follows: G=11 (cost to open a gap); E.-4 (cost to extend a gap); E=10 (expectation value, at this setting, 10 hits with scores equal to or better than the defined alignment score, S, are expected to occur by chance in a database of the same size as the one being searched; the E value can be increased or decreased to alter the stringency of the search.); and W=3 (word size, default is 11 for BLASTN, 3 for other blast programs). The BLOSUM matrix assigns a probability score for each position in an alignment that is based on the frequency with which that substitution is known to occur among consensus blocks within related proteins. The BLOSUM62 (gap existence cost = 11; per residue gap cost =-- 1;
lambda ratio = 0.85) substitution matrix is used by default in BLAST 2Ø A
variety of other matrices may be used as alternatives to BLOSUM62, including: PAM30 (9,1,0.87);
(10,1,0.87) BLOSUM80 (10,1,0.87); BLOSUM62 (11,1,0.82) and BLOSUM45 (14,2,0.87).
One measure of the statistical similarity between two sequences using the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. In alternative embodiments of the invention, nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
An alternative indication that two nucleic acid sequences are substantially identical is that the two sequences hybridize to each other under moderately stringent, or preferably stringent, conditions. Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65 C, and washing in 0.2 x SSC/0.1% SDS at 42 C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
Alternatively, hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65 C, and washing in 0.1 x SSC/0.1% SDS at 68 C (see Ausubel, et al. (eds), 1989, supra). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology --Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). Generally, stringent conditions are selected to be about 5 C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
In some embodiments, the invention provides methods of increasing meiotic homologous recombination in the context of methods for breeding agricultural species, and plants and animals produced by such processes. Increased recombination frequency may be desirable to facilitate breeding of agricultural species, for example by facilitating the exchange of alleles at tightly linked genetic loci. Where breeding stock are modified to increase the level of meiotic homologous recombination, for example, the effort required to identify progeny which have lost an undesirable allele at a genetic locus of interest may be reduced.
One aspect of the invention involves the modulation of meiotic homologous recombination frequency in plant breeding, for example of Bras sica sp. In a prophetic example of such an embodiment, the following conditions may apply:
a) Locus 1:
-controls a quality trait such as saturated fatty acid content in seed oil.
¨allele "A" confers high saturate content, which is undesirable in the context of this example.
¨allele "a" confers low saturate content, which is desirable in the context of this example.
b) Locus 2:
-controls the agronomic trait of lodging which is related to stem rigidity.
¨allele "B" confers a weak stem which results in lodging of the crop causing it to be difficult to harvest.
¨allele "b" confers a rigid stem resulting in an upright plant at maturity that increases harvestability with reduced seed loss which is desirable because it may increase yield.
c) Variety X under development has the genotype "aB/aB" conferring desirable oil properties but poor harvestiblity because of susceptibility to lodging.
d) Accession line Z has the genotype "Ab/Ab" giving it the properties of poor oil quality but lodging resistance.
e) Locus 1 and 2 have tight genetic linkage to each other.
f) Goal: To remove the deleterious "B" allele at Locus 2 from Variety X and transfer into Variety X the lodging resistance trait conferred by the "b" allele at Locus 2 in Accession Line Z using sexual crosses between Variety X and Accession Z.
In such an example, with natural levels of meiotic recombination frequency, a large population may be required to represent a gamete with the desired "ab"
genotype in the progeny resulting from the Fl plant. This is because Locus 1 and 2 are tightly linked resulting in few crossover events between the two loci carried by homologous chromosomes from Variety X and Accession Z in the Fl hybrid. Using the present invention to provide an increased meiotic homologous recombination frequency, the representation of the "oh"
The chiasma are acted upon by an enzyme known as a resolvase. This family of enzymes recognize and bind the cruciform structure created by the chiasma between the paired chromatids. Resolvases have been well characterized in microorganisms, including lower eukaryotes[43; 44], and the activity has been detected in humans [161] .
It has been suggested that recombinases may be used to stimulate mitotic homologous recombination between sister chromatids in eukaryotes, which has been proposed as a mechanism to promote gene targeting in vegetative/somatic cells [63;82;85;86].
Gene targeting generally involves the directed alteration of a specific DNA
sequence in its genomic locus in vivo. Problems have however been reported with mitotic gene targeting. It has for example been found that overexpression of RecA-homologues in mitotic cells may cause cell cycle arrest [92]. International Patent Publication WO 97/08331 dated 6 March 1997 summarizes a range of difficulties with earlier suggestions that the E.
colt RecA
recombinase would be useful for stimulating homologous mitotic recombination (as for example had been suggested in International Patent Publications WO 93/22443, WO
94/04032 and WO 93/06221). Utilization of E. colt RecA in eukaryotic cells is potentially problematic because the direction of strand transfer catalysed by RecA is the opposite to the direction of strand transfer catalysed by eukaryotic RecA homologues [52].
Nevertheless, overexpression of E. colt RecA has been reported to promote gene targeting approximately 10-fold in mouse cells [63] and less than two-fold in plants [82]. However, this latter result in plants also demonstrated a very low overall frequency of gene targeting, which would tend to cast doubt on the statistical significance of the result.
In the face of difficulties associated with the use of E. coli RecA in mitotic gene targeting, alternative enzymes have been used to catalyse homologous sister chromatid exchange in mitotic cells. For example, U.S. Patent Nos. 5,780,296 and 5,945,339 disclose methods to promote homologous recombination using Rec2 as an alternative recombinase to overcome problems with the use of RecA [86]. It has been reported that overexpression of human RAD51 (hRAD51) can increase gene targeting frequency by 2-3 fold [85].
In applications other than gene targeting in mitotic cells, other studies have suggested that increased expression of E. colt RecA or RAD51 may increase the resistance of cells to radiation or other DNA damaging agents [82; 85; 87-89; 91], and enhance the frequency of intrachromosomal recombination [88;90;91] and sister-chromatid exchange [82].
It has also been suggested that increased RAD51 activity during meiosis has no effect on the viability of gametes, although no evaluation of homologous recombination in these cells was conducted [87]. Identification of mechanistic steps in meiotic homologous recombination has utilized genetic analysis of mutants to identify genes involved in homologous recombination and DNA repair, and mutants with reduced meiotic homologous recombination have been identified [9;20;23;93]. Null-mutations typically have a severe effect on the whole meiotic process, and can affect viability of gametes [9;20;54;55;93-95] and have pleiotropic effects on the organism at different developmental stages or in different tissues or in response to environmental conditions. For example, rad51 null mutants may have decreased meiotic homologous recombination frequency but they also reportedly have poor DNA
repair and resistance to environmental stresses and DNA damaging agents [96;97], as well as a lethal phenotype in embryos [95].
SUMMARY OF THE INVENTION
The present invention recognizes the need in the art for methods of modifying the frequency of non-sister chromatid exchange in meiosis to facilitate heritable genomic changes during gamete formation, for example to facilitate breeding of plants and animals and for gene targeting in meiotic cells. The invention provides methods of modifying the level of expression or functional activity of factors such as enzymes or other catalytic proteins or structural proteins alone or in concert, to modify the frequency of meiotic homologous recombination involving the exchange of genetic information between non-sister chromatids from homologous maternal and paternal chromosomes. The steps at which modulation may occur include: homologous chromosome pairing, doublestrand break formation; resection; strand invasion; branch migration; and resolution.
In one aspect, the invention provides methods of increasing meiotic homologous recombination in a eukaryote, comprising transforming a eukaryotic cell with a nucleic acid encoding an activator of meiotic homologous recombination. The nucleic acid encoding the activator of meiotic homologous recombination may be operably linked to a promoter, so that the transformed eukaryotic cell is capable of expressing the activator of meiotic homologous recombination. The transformed eukaryotic cell, or its progeny, may then be allowed to undergo meiosis to produce viable gametes under conditions wherein the activator of meiotic homologous recombination is active during meiosis to increase the frequency of homologous non-sister chromatid exchange (NSCE). In alternative embodiments, the activator of meiotic homologous recombination may be an enzyme or other catalytic protein or structural protein, or transcription factor controlling the expression thereof, involved in meiotic homologous recombination, such as a eukaryotic homologue of SPO 1 1 [9-11], MREll [12-15], RAD50 [16;17], XRS2/NBS1 [18;19], DMC1 [20-22], RAD51 [21;23-25], RPA [26], MSH4 [27;28], MSH5 [29;30], MLH1 [31-33], RAD52 [34;35], RAD54 [36;37], TID1 [53], RAD55 [38;39], RAD57 [39;40], Rad59 [41;42] or Resolvase [43;44;161] or chromatin remodeling proteins [152-155] or synaptomemal complex proteins (proteins associated with assembly and function of the synaptonemal complex) [156; 157; 158; 163] . In some embodiments, the frequency of mitotic homologous sister chromatid exchange in the eukaryote may not be altered to a level detrimental to cell viability, growth or reproduction, while the frequency of meiotic homologous recombination is increased or decreased. The promoter may be regulatable by induction or repression or may be a meiosis-specific promoter or a promoter with enhanced expression during meiosis, i.e. a preferentially-meiotic promoter, or a promoter capable of expressing the activator at a level sub-inhibitory to vegetative cells. The invention includes non-human eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of selectively inhibiting meiotic homologous recombination in a eukaryote. Such methods may involve transforming a eukaryotic cell with a nucleic acid encoding an inhibitor of meiotic recombination. The nucleic acid encoding the inhibitor of meiotic recombination may be operably linked to a promoter, such as a promoter regulated by induction or repression, meiosis-specific or preferentially-meiotic promoter, or a promoter capable of expressing the activator at a level sub-inhibitory to vegetative cells, so that the transformed eukaryotic cell may be capable of expressing the inhibitor of meiotic recombination. The transformed eukaryotic cell, or a descendant of the transformed eukaryotic cell, may then be allowed to undergo meiosis to produce viable gametes under conditions wherein the inhibitor of meiotic recombination is active during meiosis to decrease the level of homologous non-sister chromatid exchange.
The inhibitor of meiotic recombination may be a dominant-negative form (such as a mutant endogenous protein or a mutant or wild-type heterologous protein) of an enzyme or other catalytic protein or a structural protein, or transcription factor controlling the expression thereof, involved in meiotic homologous recombination. In some embodiments, the frequency of mitotic homologous sister chromatid exchange in the eukaryote may not be altered to a level detrimental to cell viability, growth or reproduction, while meiotic homologous recombination is increased or decreased. The invention includes non-human eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of plant and animal breeding, in which the frequency of non-sister chromatid exchange in meiotic homologous recombination is modulated, prior to crossing a gamete from the parent organism with a second gamete to obtain progeny. The invention includes non-human eukaryotes produced by such processes.
The invention also provides methods of genomic mapping and map-based gene cloning comprising modulating the frequency of non-sister chromatid exchange in meiotic homologous recombination in a first cell, crossing the first cell with a second cell, and measuring the genetic linkage between markers in a progeny cell.
Various embodiments of the invention provide a method of modulating meiotic homologous recombination in plant cells, comprising: transforming a plant cell of a plant species with a nucleic acid encoding a protein, wherein the protein comprises five conserved motifs present in SPO 1 1 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SP011-1 (AtSP011-1) when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, the protein further comprises: arginine at a position corresponding to arginine 99 of Arabidopsis thaliana SP011-1 (AtSPO 1 1 -1); tyrosine at a position corresponding to tyrosine 103 of AtSP011-1; arginine at a position corresponding to arginine 130 of AtSP011-1;glycine at a position corresponding to glycine 141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of AtSP011-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1; leucine at a position corresponding to leucine 197 of AtSP011-1; glycine at a position corresponding to glycine 215 of AtSP011-1; proline at a position corresponding to proline 217 of AtSP011-1; threonine at a position corresponding to threonine 221 of AtSP011-1; arginine at a position corresponding to arginine 222 of AtSP011-1; aspartate at a position corresponding to aspartate 241 of AtSP011-1;
proline at a position corresponding to proline 244 of AtSP011-1; glycine at a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a position corresponding to isoleucine 249 of AtSP011-1,wherein the protein is operable to initiate meiotic recombination, wherein said nucleic acid is operably linked to a promoter; and allowing the transformed plant cell, or a descendant of the transformed plant cell, to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the transformed plant cell or the descendant increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
Various embodiments of the invention provide a plant cell of a plant species, comprising a recombinant nucleic acid encoding: a protein, wherein the protein comprises five conserved motifs present in SPO1 1 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SP011-1 (AtSP011-1) when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSP011-1);
tyrosine at a position corresponding to tyrosine 103 of AtSP011-1; arginine at a position corresponding to arginine 130 of AtSP011-1; glycine at a position corresponding to glycine 141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of AtSP011-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1;
leucine at a position corresponding to leucine 197 of AtSP011-1; glycine at a position corresponding to glycine 215 of AtSPO1 1-1; proline at a position corresponding to proline 217 of AtSP011-1;
threonine at a position corresponding to threonine 221 of AtSP011-1; arginine at a position corresponding to arginine 222 of AtSP011-1; aspartate at a position corresponding to aspartate 241 of AtSP011-1; proline at a position corresponding to proline 244 of AtSP011-1; glycine at a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a position corresponding to isoleucine 249 of AtSP011-1, wherein said nucleic acid is operably linked to a promoter, and wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the plant cell increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
Various embodiments of the invention provide a plant cell of a plant species, 7a comprising a recombinant nucleic acid encoding: a protein, wherein the protein comprises five conserved motifs present in SPO 1 1 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SPO 1 1-1 (AtSPO 1 1-1) when the amino acid sequences of the protein and AtSPO
1 1-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSP011-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSP011-1);
arginine at a position corresponding to arginine 130 of AtSP011-1; glycine at a position corresponding to glycine 141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of AtSP011-1; phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1; leucine at a position corresponding to leucine 197 of AtSP011-1;
glycine at a position corresponding to glycine 215 of AtSP011-1; proline at a position corresponding to proline 217 of AtSP011-1; threonine at a position corresponding to threonine 221 of AtSP011-1; arginine at a position corresponding to arginine 222 of AtSP011-1;
aspartate at a position corresponding to aspartate 241 of AtSP011-1; proline at a position corresponding to proline 244 of AtSP011-1; glycine at a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a position corresponding to isoleucine 249 of AtSP011-1, wherein the protein lacks a tyrosine at a position corresponding to tyrosine 103 of AtSP011-1, wherein the protein is operable to inhibit double strand break catalysis by an endogenous SPO 1 1 protein, and wherein said nucleic acid is operably linked to a promoter, wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, and wherein expression of the protein in the plant cell decreases the frequency of homologous non-sister chromatid exchange during the meiotic event.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect of the invention, the frequency of homologous recombination between non-sister chromatids during meiosis is increased or decreased by specifically changing the activity level of one or more activators or inhibitors of meiotic homologous recombination, such as proteins involved in homologous recombination, to affect one or more steps of the homologous recombination process.
7b Taking advantage of the fact that meiotic homologous recombination between homologous non-sister chromatids first requires a double-strand break in one of the paired homologues, one aspect of the present invention facilitates an increase in the potential for homologous recombination events by increasing the number of double-strand breaks. Local chromatin structure plays an important role in the positioning and frequency of meiotic double-strand breaks leading to meiotic homologous recombination [151]. Chromatin structure remodeling may be a result of the action of two groups of enzymes highly conserved among eukaryotes: 1) ATP-dependent remodeling complexes, and 2) histone acetyltransferases and histone deacetylases [152-155]. Thus one may increase the frequency of double-strand breaks by modifying the activity level of chromatin remodeling enzymes to create chromatin structure that facilitates a greater incidence of double-strand break formation. This may be achieved, for example, by enhancing histone acetyl transferase activity. Conversely one may decrease the frequency of double-strand breaks by modifying the activity level of chromatin remodeling enzymes to create chromatin structure that is less amenable to double-strand break formation.
This may be achieved, for example, by 7c enhancing histone deacetylase activity. In addition to the manipulation of chromatin structure, the frequency of double-strand break formation may be achieved, for example, by increasing the level of SPO 1 1 activity during appropriate stages in meiosis or other appropriate stages in the cell cycle. Conversely, one may reduce the frequency of homologous recombination during meiosis by suppressing the function or expression of SPO 1 1 at appropriate stages in meiosis, to decrease the number of double-strand breaks available and, therefore, decrease the frequency of initiating DNA exchange between homologous chromosomes during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be modified by modifying the activity level of enzymes involved in resection of double-stranded DNA (dsDNA) to create ssDNA ends required for strand invasion of the paired homologous chromosome. Thus, activity of MRE11, RAD50 and/or XRS2/NBS1 could be increased to promote creation of recombinogenic ssDNA by increasing the number of double-strand breaks created by SPO 1 1 being converted into recombinogenic ssDNA, to increase the frequency of meiotic homologous recombination. Conversely, frequency of meiotic homologous recombination may be decreased by reducing the activity of MRE11, and/or XRS2/NBS1 so as to decrease the conversion of double-strand breaks created by SPO 1 1 into recombinogenic ends. In addition, modifying the resection process may be used to increase gene targeting frequency by promoting conversion of gene targeting substrates to DNAs having recombinogenic ends, for example by increased activity of SP011, MRE11, RAD50 and/or XRS2/NBS1.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the activity of enzymes and structural proteins involved in pairing of homologous DNA and strand invasion. Thus, activity of RecA homologues such as and DMC1 may be increased in meiosis to promote homologous DNA pairing of non-sister chromatids and initiation of crossovers by strand invasion. Increased activity levels of these proteins may increase conversion of recombinogenic ends created by MRE11, RAD50 and XRS2/NBS1 into functional crossover events thereby increasing homologous recombination frequency. Because RAD51 and DMC1 act in unique but overlapping pathways [53], one may modulate the homologous recombination frequency and frequency of NSCE by increasing the activity of DMC1 and RAD51 individually or in concert.
Conversely, the activity level of DMC1 and RAD51 alone or in concert may be decreased to decrease the frequency of NSCE. Other RecA homologues such as RAD55 and RAD57 may also be used in this way in meiosis. In addition, other proteins participating in homologous DNA pairing and strand-invasion, such as MSH4, MSH5 and MLH1, may be used to increase or decrease meiotic homologous recombination frequency through modulating their activity levels at appropriate stages of meiosis. ssDNA-binding proteins such as EcSSB or RPA
which may function coordinately with RecA homologues may also be used to modulate homologous recombination frequency. For example, during meiosis, reducing the level of RPA in the nucleus or the activity of RPA within the nucleus may affect the activity of RecA
homologues during meiosis and change the homologous recombination frequency.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the activity of proteins that act in conjunction with RecA
homologues to promote DNA pairing and crossing-over. For example, meiotic homologous recombination may be increased by increasing activity level of RAD54 and TID1, alone or in concert, independently or coordinately with RAD51 and/or DMC1 (RAD51 activity is stimulated in vitro by inclusion of RAD54 [66] and TID1 is a homologue of RAD54 that physically interacts with DMC1 [53]). Conversely, meiotic homologous recombination frequency may be decreased by reduction of expression or activity level of RAD54 and/or TID1. In some embodiments, homologous recombination frequency may be modulated by regulating the expression and functional activity of these four proteins independently or in different permutations. This approach of modulating recombination frequency may also be used with other proteins that physically interact directly or indirectly and modify the activity of RecA homologues functioning during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the activity level of resolvase. Thus, activity of resolvase may be increased to promote resolution of crossovers thereby increasing the frequency of exchange of genetic information between non-sister chromatids. It has been reported that, of the total number of crossovers initiated between homologous chromosomes during meiosis, only a fraction are resolved to result in actual exchange of genetic information between the homologous chromosomes, with the rest dissolving without causing exchange of genetic information [72]. In another aspect of the invention, meiotic homologous recombination frequency may be decreased by reducing the level or functional activity of resolvase during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be modulated by modifying the assembly or function of the synaptonemal complex.
Thus the action of proteins important in assembly and function of the synaptonemal complex such as potential regulatory proteins, like ATM [163] or MEK1 [157], or structural proteins, like HOPI [156], RED1 [164], or ZIP1 [165], or functional homologues thereof, may be inhibited so as to impair formation of the synaptonemal complex and reduce homologous chromosome pairing by decreasing the frequency of non-sister chromatid exchange. In another aspect of the invention, assembly and function of the synaptonemal complex may be promoted to increase recombination frequency during meiosis.
In alternative embodiments, the activator or inhibitor of meiotic homologous recombination may be an anti-sense molecule or a co-suppreseive nucleic acid.
A co-suppreseive nucleic acid is a nucleic acid that supresses the expression of another nucleic acid by means of co-suppression. Anti-sense oligonucleotides, including anti-sense RNA
molecules and anti-sense DNA molecules, generally act to block the translation of mRNA by binding to targeted mRNA and inhibiting protein translation from the bound mRNA. For example, anti-sense oligonucleotides complementary to regions of a DNA
sequence encoding an enzyme involved in meiotic homologous recombination, such as DMC1, may be expressed in transformed plant cells during the appropriate developmental stage to down-regulate the enzyme. Alternative methods of down-regulating protein expression may include the use of ribozymes or other enzymatic RNA molecules (such as hammerhead RNA structures) that are capable of catalysing the cleavage of RNA (as disclosed in U.S. Patent Nos.
4,987,071 and 5,591,610. The mechanism of ribozyme action generally involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Additionally, antibodies or peptides which inhibit the activity of the target protein may be introduced or expressed in meiotic cells to suppress activity of the target protein.
It is well known in the art that some modifications and changes can be made in the structure of a polypeptide without substantially altering the biological function of that peptide, to obtain a biologically equivalent polypeptide. In one aspect of the invention, proteins that modulate meiotic recombination may differ from a portion of the corresponding native sequence by conservative amino acid substitutions. As used herein, the term "conserved amino acid substitutions" refers to the substitution of one amino acid for another at a given location in the peptide, where the substitution can be made without loss of function. In making such changes, substitutions of like amino acid residues can be made, for example, on the basis of relative similarity of side-chain substituents, for example, their size, - _____________ .
charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the peptide by routine testing. In some embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydrophilicity value (e.g., within a value of plus or minus 2.0), where the following hydrophilicity values are assigned to amino acid residues (as detailed in United States Patent No. 4,554,101): Arg (+3.0);
Lys (+3.0); Asp (+3.0); Glu (+3.0); Ser (+0.3); Asn (+0.2); Gin (+0.2); Gly (0);
Pro (-0.5); Thr (-0.4); Ala (-0.5); His (-0.5); Cys (-1.0); Met (-1.3); Val (-1.5); Leu (-1.8);
Ile (-1.8); Tyr (-2.3);
Phe (-2.5); and Trp (-3.4). In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydropathic index (e.g., within a value of plus or minus 2.0). In such embodiments, each amino acid residue may be assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics, as follows: Ile (+4.5); Val (+4.2); Leu (+3.8);
Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); Gly (-0.4); Thr (-0.7); Ser (-0.8); Trp (-0.9); Tyr (-1.3); Pro (-1.6); His (-3.2); Glu (-3.5); Gin (-3.5); Asp (-3.5); Asn (-3.5); Lys (-3.9);
and Arg (-4.5). In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another in the same class, where the amino acids are divided into non-polar, acidic, basic and neutral classes, as follows: non-polar: Ala, Val, Leu, Ile, Phe, Trp, Pro, Met; acidic: Asp, Glu; basic: Lys, Arg, His; neutral: Gly, Ser, Thr, Cys, Asn, Gin; Tyr.
Various aspects of the present invention encompass nucleic acid or amino acid sequences that are homologous to other sequences. As the term is used herein, an amino acid or nucleic acid sequence is "homologous" to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (for example, both sequences function as or encode a selected enzyme or promoter function;
as used herein, the term 'homologous' does not infer evolutionary relatedness). Nucleic acid sequences may also be homologous if they encode substantially identical amino acid sequences, even if the nucleic acid sequences are not themselves substantially identical , a circumstance that may for example arise as a result of the degeneracy of the genetic code.
Two nucleic acid or protein sequences are considered substantially identical if, when optimally aligned, they share at least about 25% sequence identity in protein domains essential for conserved function. In alternative embodiments, sequence identity may for example be at least 50%, 70%, 75%, 90% or 95%. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman,1981, Adv. App!. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. ScL USA 85:
2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA
and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI, U.S.A.). Sequence alignment may also be carried out using the BLAST
algorithm, described in Altschul etal., 1990,1 MoL Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information.
The BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold. Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X
from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST programs may use as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad ScL
USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (which may be changed in alternative embodiments to 1 or 0.1 or 0.01 or 0.001 or 0.0001; although E
values much higher than 0.1 may not identify functionally similar sequences, it is useful to examine hits with lower significance, E values between 0.1 and 10, for short regions of similarity), M=5, N=4, for nucleic acids a comparison of both strands. For protein comparisons, BLASTP may be used with defaults as follows: G=11 (cost to open a gap); E.-4 (cost to extend a gap); E=10 (expectation value, at this setting, 10 hits with scores equal to or better than the defined alignment score, S, are expected to occur by chance in a database of the same size as the one being searched; the E value can be increased or decreased to alter the stringency of the search.); and W=3 (word size, default is 11 for BLASTN, 3 for other blast programs). The BLOSUM matrix assigns a probability score for each position in an alignment that is based on the frequency with which that substitution is known to occur among consensus blocks within related proteins. The BLOSUM62 (gap existence cost = 11; per residue gap cost =-- 1;
lambda ratio = 0.85) substitution matrix is used by default in BLAST 2Ø A
variety of other matrices may be used as alternatives to BLOSUM62, including: PAM30 (9,1,0.87);
(10,1,0.87) BLOSUM80 (10,1,0.87); BLOSUM62 (11,1,0.82) and BLOSUM45 (14,2,0.87).
One measure of the statistical similarity between two sequences using the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. In alternative embodiments of the invention, nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
An alternative indication that two nucleic acid sequences are substantially identical is that the two sequences hybridize to each other under moderately stringent, or preferably stringent, conditions. Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65 C, and washing in 0.2 x SSC/0.1% SDS at 42 C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
Alternatively, hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65 C, and washing in 0.1 x SSC/0.1% SDS at 68 C (see Ausubel, et al. (eds), 1989, supra). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology --Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). Generally, stringent conditions are selected to be about 5 C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
In some embodiments, the invention provides methods of increasing meiotic homologous recombination in the context of methods for breeding agricultural species, and plants and animals produced by such processes. Increased recombination frequency may be desirable to facilitate breeding of agricultural species, for example by facilitating the exchange of alleles at tightly linked genetic loci. Where breeding stock are modified to increase the level of meiotic homologous recombination, for example, the effort required to identify progeny which have lost an undesirable allele at a genetic locus of interest may be reduced.
One aspect of the invention involves the modulation of meiotic homologous recombination frequency in plant breeding, for example of Bras sica sp. In a prophetic example of such an embodiment, the following conditions may apply:
a) Locus 1:
-controls a quality trait such as saturated fatty acid content in seed oil.
¨allele "A" confers high saturate content, which is undesirable in the context of this example.
¨allele "a" confers low saturate content, which is desirable in the context of this example.
b) Locus 2:
-controls the agronomic trait of lodging which is related to stem rigidity.
¨allele "B" confers a weak stem which results in lodging of the crop causing it to be difficult to harvest.
¨allele "b" confers a rigid stem resulting in an upright plant at maturity that increases harvestability with reduced seed loss which is desirable because it may increase yield.
c) Variety X under development has the genotype "aB/aB" conferring desirable oil properties but poor harvestiblity because of susceptibility to lodging.
d) Accession line Z has the genotype "Ab/Ab" giving it the properties of poor oil quality but lodging resistance.
e) Locus 1 and 2 have tight genetic linkage to each other.
f) Goal: To remove the deleterious "B" allele at Locus 2 from Variety X and transfer into Variety X the lodging resistance trait conferred by the "b" allele at Locus 2 in Accession Line Z using sexual crosses between Variety X and Accession Z.
In such an example, with natural levels of meiotic recombination frequency, a large population may be required to represent a gamete with the desired "ab"
genotype in the progeny resulting from the Fl plant. This is because Locus 1 and 2 are tightly linked resulting in few crossover events between the two loci carried by homologous chromosomes from Variety X and Accession Z in the Fl hybrid. Using the present invention to provide an increased meiotic homologous recombination frequency, the representation of the "oh"
gamete in the progeny from the Fl may be increased. This is because increased homologous recombination potential results in more crossover events in the genome of the Fl hybrid. As a result, there is an increased chance for crossovers to occur between Locus 1 and 2 leading to a greater frequency of breaking the linkage between the desirable "a"
allele for low saturate content and the undesirable "B" allele for increase lodging at the closely linked loci 1 and 2 to produce the highly desirable hybrid chromosome carrying the "a"
allele for reduced saturate content and the "b" allele for reduced lodging.. Thus the frequency of the "ab"
gamete in the progeny will be increased versus that found under conditions of natural recombination frequency.
In one aspect of the invention, the 'enhanced recombination factor' is introduced into Variety X so that Variety X has increased meiotic homologous recombination potential. The 'enhanced recombination factor' conferring the increased homologous recombination potential may be detectable by a molecular marker. Variety X may then be sexually crossed with Accession Z and the resulting hybrid will have increased recombination potential.
During gamete formation by this Fl, frequency of crossovers and exchange of genetic information between homologous chromosomes from Variety X and Accession Z will be increased versus the wild-type situation. As a result, there will be increased chance of exchange between Locus 1 and 2 resulting in increased frequency of gametes with the desired "ab" genotype. Representation of the "ab" genotype in the F1 progeny will thus be increased versus the wild-type situation. When plants of interest carrying the "ab"
genotype are found in the progeny, the factor conferring increased recombination frequency can be removed by backcrossing to Variety X. During gamete formation in this new plant meiotic homologous recombination and/or independent assortment of chromosomes during meiosis will cause the 'enhanced recombination factor' to segregate from Loci 1 and 2. By using molecular markers, the resultant progeny can be screened to identify plants which retain the "ab"
genotype but no longer carry the 'enhanced recombination factor' and, thus, these plants will be restored to wild-type levels of meiotic homologous recombination. In alternative aspects of the invention, the 'enhanced recombination factor' may be removed from the genome of a particular plant line by flanking the 'enhanced recombination factor' with recognition sites for a site-specific recombinase. Exposing the plant line to the action of the site-specific recombinase will thus excise the 'enhanced recombination factor' from the genome of the plant line.
allele for low saturate content and the undesirable "B" allele for increase lodging at the closely linked loci 1 and 2 to produce the highly desirable hybrid chromosome carrying the "a"
allele for reduced saturate content and the "b" allele for reduced lodging.. Thus the frequency of the "ab"
gamete in the progeny will be increased versus that found under conditions of natural recombination frequency.
In one aspect of the invention, the 'enhanced recombination factor' is introduced into Variety X so that Variety X has increased meiotic homologous recombination potential. The 'enhanced recombination factor' conferring the increased homologous recombination potential may be detectable by a molecular marker. Variety X may then be sexually crossed with Accession Z and the resulting hybrid will have increased recombination potential.
During gamete formation by this Fl, frequency of crossovers and exchange of genetic information between homologous chromosomes from Variety X and Accession Z will be increased versus the wild-type situation. As a result, there will be increased chance of exchange between Locus 1 and 2 resulting in increased frequency of gametes with the desired "ab" genotype. Representation of the "ab" genotype in the F1 progeny will thus be increased versus the wild-type situation. When plants of interest carrying the "ab"
genotype are found in the progeny, the factor conferring increased recombination frequency can be removed by backcrossing to Variety X. During gamete formation in this new plant meiotic homologous recombination and/or independent assortment of chromosomes during meiosis will cause the 'enhanced recombination factor' to segregate from Loci 1 and 2. By using molecular markers, the resultant progeny can be screened to identify plants which retain the "ab"
genotype but no longer carry the 'enhanced recombination factor' and, thus, these plants will be restored to wild-type levels of meiotic homologous recombination. In alternative aspects of the invention, the 'enhanced recombination factor' may be removed from the genome of a particular plant line by flanking the 'enhanced recombination factor' with recognition sites for a site-specific recombinase. Exposing the plant line to the action of the site-specific recombinase will thus excise the 'enhanced recombination factor' from the genome of the plant line.
If meiotic homologous recombination frequency is increased during this breeding procedure, in accordance with the present invention, recombinants between the two loci would be at a higher frequency in the progeny, and the breeder may develop a new variety in a less expensive and more efficient manner.
An alternative aspect of the invention involves increasing meiotic homologous recombination to enhance efficiency of genetic mapping and map-based cloning, for example in agricultural species. Genetic distance between chromosomal loci is governed by meiotic recombination frequency between homologous chromosomes on which the loci under consideration are located. By monitoring the frequency of co-inheritance of phenotypic or molecular markers corresponding to the loci under consideration, the genetic distance and order of the loci can be established. If two loci, 1 and 2, are on the same chromosome but are physically separated by a large region of the chromosome, numerous opportunities exist for recombination events to occur along this long stretch of DNA to combine alleles carried by the maternal and paternal chromosomes at these loci. The loci are considered linked if the frequency of new combinations of maternal and paternal alleles at Loci 1 and 2 observed in the progeny is less than 50%. The genetic distance between the two loci corresponds to this frequency. If Loci 1 and 3 are physically closer to one another along the chromosome than Loci 1 and 2, then there is generally less chance of recombination to occur between these loci to make new combinations of maternal and paternal alleles at Loci 1 and 3.
Again, this is determined by observing the frequency of coinheritance of allelic combinations in the progeny. By determining the frequency of combinations of alleles at Loci 1, 2 and 3 in the progeny, genetic distance and order of the loci can be determined. For example, if combinations of maternal and paternal alleles at locus 1 and 2 are found in the progeny at a frequency of 40%, and combinations between locus 2 and 3 are found to be 25%, but combinations between 1 and 3 are found to be 15%, then the order of the loci is 1-3-2 with map distances between the ordered loci being 15 and 25 units. This type of information can be compiled for loci conferring phenotypic effects as well as loci corresponding to molecular markers such as RFLP's, RAPD's, AFLP's, SNP's, and microsatellites [98-100].
Detailed genetic maps can be determined for agricultural organisms. In this manner, for example, molecular markers can be linked to desirable traits. The markers can then be used to assist breeders in transferring desirable traits to varieties that are released to producers.
Reliance on natural levels of meiotic homologous recombination frequency to determine the distance between markers may present difficulties with existing mapping techniques. For example, two markers may be deemed to be very tightly linked genetically but could still be physically separated by very long stretches of DNA. Thus the invention enabling enhanced meiotic recombination frequency will enable markers with tighter linkage to the target loci to be defined while reducing the population size required to do so versus what is possible when relying on natural levels of recombination frequency.
Such markers with tighter linkage to the target locus will enable more reliable monitoring of the segregation of the desired locus in a breeding program.
Genetic maps defined with molecular markers may also be used to clone genes responsible for traits of interest. This process of map-based gene cloning involves linking molecular markers to the desired trait by determining the frequency of co-inheritance of molecular markers with the trait [98-100]. Once a marker has been found which is inherited at high frequency with the target trait, it can be used as a molecular probe to screen a DNA
library of the organism to identify a fragment of DNA which encodes the cognate gene. One major difficulty with map-based gene cloning is that the relationship between genetic distance and physical distance can vary between species and even between different regions of the genome in a given species. Therefore a molecular marker may show absolute linkage to the target trait locus but it may be physically hundreds of kilobases away from the actual gene of interest. This makes identifying and cloning the actual gene responsible for the trait difficult because there may be vast stretches of DNA to evaluate in order to identify the gene.
In addition, one might map more than one molecular marker showing absolute linkage to the target trait locus. However, using a reasonable population size, it may not be possible to identify which marker is physically closer to the target gene. Thus, while one marker may be 10 kilobases from the target gene and the other is 400 kilobases from the target gene, with conventional methods relying on natural levels of recombination frequency there may be no way of differentiating which of the two markers should be used to most efficiently clone the target gene. It would therefore be beneficial to map-based cloning projects to utilize the present invention to provide elevated meiotic homologous recombination levels so as to increase precision in determining genetic distance between molecular markers and target trait loci.
In an alternative aspect, the invention provides methods of decreasing meiotic homologous recombination, for example to enhance efficiency of breeding agricultural species. Decreased recombination frequency may be desirable in directed breeding of agricultural species to promote linkage drag, thereby maintaining genotypic integrity during sexual crosses conducted to introgress desirable traits. This may, for example, reduce the number of plants per backcross generation required to restore the genotype of the recurrent parent. For example, in plant breeding of Brassica sp., the following conditions may apply:
a) Variety X: -has favourable quality and agronomic characteristics and is an established variety in the industry but is susceptible to a disease due to allele "A" at Locus 1.
b) Accession Z: -has poor quality and agronomic characteristics but is resistant to the same disease due to allele "a" at Locus 1.
c) Goal: To transfer disease resistance trait from Accession Z to Variety X
and maintain all of the favourable quality and agronomic characteristics of Variety X.
A conventional approach might involve a sexual cross between Variety X and Accession Z in an attempt to transfer the disease resistance trait to Variety X. During meiosis in the Fl plant, natural levels of recombination between Variety X and Accession Z
homologous chromosomes may result in extensive mixing of the two genomes. This may indeed combine the favourable disease resistance allele "a" from Accession Z
with a Variety X chromosome. However, many detrimental alleles responsible for poor quality and agronomic characteristics in Accession Z become intermixed with the favourable alleles from the Variety X genome. This may necessitate several rounds of backcrossing the hybrid plant to Variety X, the recurrent parent, to restore the favourable characteristics of Variety X while selecting for the disease resistance allele introduced from Accession Z. To restore the original genotype of Variety X might require in excess of seven backcross generations.
Using the present invention, it may be desirable to expedite the process of variety development through the use of plants with modified meiotic homologous recombination frequency. An engineered decrease in meiotic homologous recombination frequency may be used to reduce the mixing of genomes and genetic information between Variety X
and Accession Z, to provide a higher frequency of progeny from the initial hybrid which have the "a" allele conferring disease resistance transferred to the Variety X
chromosome with the rest of the Variety X genome largely intact.
In alternative embodiments, variety X may be modified to have decreased meiotic homologous recombination potential by introduction of a 'suppressed-recombination factor'.
The 'suppressed-recombination factor' conferring the decreased homologous recombination potential may be detectable by a molecular marker. Variety X may then be sexually crossed with Accession Z, so that the resulting hybrid will have decreased recombination potential.
An alternative aspect of the invention involves increasing meiotic homologous recombination to enhance efficiency of genetic mapping and map-based cloning, for example in agricultural species. Genetic distance between chromosomal loci is governed by meiotic recombination frequency between homologous chromosomes on which the loci under consideration are located. By monitoring the frequency of co-inheritance of phenotypic or molecular markers corresponding to the loci under consideration, the genetic distance and order of the loci can be established. If two loci, 1 and 2, are on the same chromosome but are physically separated by a large region of the chromosome, numerous opportunities exist for recombination events to occur along this long stretch of DNA to combine alleles carried by the maternal and paternal chromosomes at these loci. The loci are considered linked if the frequency of new combinations of maternal and paternal alleles at Loci 1 and 2 observed in the progeny is less than 50%. The genetic distance between the two loci corresponds to this frequency. If Loci 1 and 3 are physically closer to one another along the chromosome than Loci 1 and 2, then there is generally less chance of recombination to occur between these loci to make new combinations of maternal and paternal alleles at Loci 1 and 3.
Again, this is determined by observing the frequency of coinheritance of allelic combinations in the progeny. By determining the frequency of combinations of alleles at Loci 1, 2 and 3 in the progeny, genetic distance and order of the loci can be determined. For example, if combinations of maternal and paternal alleles at locus 1 and 2 are found in the progeny at a frequency of 40%, and combinations between locus 2 and 3 are found to be 25%, but combinations between 1 and 3 are found to be 15%, then the order of the loci is 1-3-2 with map distances between the ordered loci being 15 and 25 units. This type of information can be compiled for loci conferring phenotypic effects as well as loci corresponding to molecular markers such as RFLP's, RAPD's, AFLP's, SNP's, and microsatellites [98-100].
Detailed genetic maps can be determined for agricultural organisms. In this manner, for example, molecular markers can be linked to desirable traits. The markers can then be used to assist breeders in transferring desirable traits to varieties that are released to producers.
Reliance on natural levels of meiotic homologous recombination frequency to determine the distance between markers may present difficulties with existing mapping techniques. For example, two markers may be deemed to be very tightly linked genetically but could still be physically separated by very long stretches of DNA. Thus the invention enabling enhanced meiotic recombination frequency will enable markers with tighter linkage to the target loci to be defined while reducing the population size required to do so versus what is possible when relying on natural levels of recombination frequency.
Such markers with tighter linkage to the target locus will enable more reliable monitoring of the segregation of the desired locus in a breeding program.
Genetic maps defined with molecular markers may also be used to clone genes responsible for traits of interest. This process of map-based gene cloning involves linking molecular markers to the desired trait by determining the frequency of co-inheritance of molecular markers with the trait [98-100]. Once a marker has been found which is inherited at high frequency with the target trait, it can be used as a molecular probe to screen a DNA
library of the organism to identify a fragment of DNA which encodes the cognate gene. One major difficulty with map-based gene cloning is that the relationship between genetic distance and physical distance can vary between species and even between different regions of the genome in a given species. Therefore a molecular marker may show absolute linkage to the target trait locus but it may be physically hundreds of kilobases away from the actual gene of interest. This makes identifying and cloning the actual gene responsible for the trait difficult because there may be vast stretches of DNA to evaluate in order to identify the gene.
In addition, one might map more than one molecular marker showing absolute linkage to the target trait locus. However, using a reasonable population size, it may not be possible to identify which marker is physically closer to the target gene. Thus, while one marker may be 10 kilobases from the target gene and the other is 400 kilobases from the target gene, with conventional methods relying on natural levels of recombination frequency there may be no way of differentiating which of the two markers should be used to most efficiently clone the target gene. It would therefore be beneficial to map-based cloning projects to utilize the present invention to provide elevated meiotic homologous recombination levels so as to increase precision in determining genetic distance between molecular markers and target trait loci.
In an alternative aspect, the invention provides methods of decreasing meiotic homologous recombination, for example to enhance efficiency of breeding agricultural species. Decreased recombination frequency may be desirable in directed breeding of agricultural species to promote linkage drag, thereby maintaining genotypic integrity during sexual crosses conducted to introgress desirable traits. This may, for example, reduce the number of plants per backcross generation required to restore the genotype of the recurrent parent. For example, in plant breeding of Brassica sp., the following conditions may apply:
a) Variety X: -has favourable quality and agronomic characteristics and is an established variety in the industry but is susceptible to a disease due to allele "A" at Locus 1.
b) Accession Z: -has poor quality and agronomic characteristics but is resistant to the same disease due to allele "a" at Locus 1.
c) Goal: To transfer disease resistance trait from Accession Z to Variety X
and maintain all of the favourable quality and agronomic characteristics of Variety X.
A conventional approach might involve a sexual cross between Variety X and Accession Z in an attempt to transfer the disease resistance trait to Variety X. During meiosis in the Fl plant, natural levels of recombination between Variety X and Accession Z
homologous chromosomes may result in extensive mixing of the two genomes. This may indeed combine the favourable disease resistance allele "a" from Accession Z
with a Variety X chromosome. However, many detrimental alleles responsible for poor quality and agronomic characteristics in Accession Z become intermixed with the favourable alleles from the Variety X genome. This may necessitate several rounds of backcrossing the hybrid plant to Variety X, the recurrent parent, to restore the favourable characteristics of Variety X while selecting for the disease resistance allele introduced from Accession Z. To restore the original genotype of Variety X might require in excess of seven backcross generations.
Using the present invention, it may be desirable to expedite the process of variety development through the use of plants with modified meiotic homologous recombination frequency. An engineered decrease in meiotic homologous recombination frequency may be used to reduce the mixing of genomes and genetic information between Variety X
and Accession Z, to provide a higher frequency of progeny from the initial hybrid which have the "a" allele conferring disease resistance transferred to the Variety X
chromosome with the rest of the Variety X genome largely intact.
In alternative embodiments, variety X may be modified to have decreased meiotic homologous recombination potential by introduction of a 'suppressed-recombination factor'.
The 'suppressed-recombination factor' conferring the decreased homologous recombination potential may be detectable by a molecular marker. Variety X may then be sexually crossed with Accession Z, so that the resulting hybrid will have decreased recombination potential.
During gamete formation by this Fl plant, the frequency of meiotic crossovers and exchange of genetic information between homologous chromosomes from Variety X and Accession Z
will be decreased compared to the wild-type frequency. Thus the frequency of Fl progeny plants containing high proportions of the Variety X genome and its favourable characteristics plus disease resistance may be increased versus that possible with wild-type levels of meiotic homologous recombination. When such plants are identified, they may be backcrossed to Variety X to remove vestiges of the Accession Z genome. During gamete formation in such a plant, meiotic homologous recombination and/or independent assortment of chromosomes during meiosis may cause the inhibitor of meiotic recombination, such as a suppressed-recombination factor', to segregate from the disease resistance gene. By using molecular markers, the resultant progeny may be screened to identify plants which retain the disease resistance gene in the favourable Variety X genome but no longer carry the 'suppressed-recombination factor' so that these plants may be restored to wild-type levels of meiotic homologous recombination. In alternative aspects of the invention, the 'suppressed-recombination factor' may be removed from the genome of a particular plant line by flanking the 'suppressed-recombination factor' with recognition sites for a site-specific recombinase.
Exposing the plant line to the action of the site-specific recombinase will thus excise the the 'suppressed-recombination factor' from the genome of the plant line.
In an alternative aspect, the invention provides methods to increase meiotic homologous recombination leading to enhanced efficiency of gene targeting.
Homologous recombination activities are at an elevated state in meiotic cells compared to mitotic cells in which recombination activities must generally be induced by DNA damage. Thus supplying gene targeting substrates to meiotic cells, in accordance with one aspect of the present invention, takes advantage of endogenous meiotic enzymes and DNA states to promote recombination with the target locus. The present invention may also be used to increase recombination potential in meiotic cells to further enhance meiotic gene targeting frequency.
In one aspect of the present invention, increasing one or more meiotic homologous recombination functions by providing an activator of meiotic homologous recombination can increase meiotic homologous recombination frequency. Thus, in accordance with this aspect of the invention, by supplying gene targeting substrate to meiotic cells one may increase gene targeting frequency. Gene targeting has been successfully applied in a variety of eukaryotic species including fungi [101], plants [82;102-104] and lower [105;106] and higher animals [63;85;107]. However, these gene targeting strategies involve only vegetative/somatic cells undergoing mitosis.
In one aspect of the present invention, increasing gene targeting frequency by performing the process in meiotic cells may facilitate the rapid generation of homozygous lines with targeted changes. In this aspect, the gene targeting event may occur at meiosis I, resulting in four gametes, each of which may have the targeted change. In plants and other monoecious organisms where both male and female gametes are produced by the same individual, simply self-crossing the individual may result in a high frequency of diploid progeny which are homozygous for the targeted genetic change. In addition, in the case of plants, one may obtain individuals homozygous for the targeted genetic change by performing microspore culture after delivering gene targeting substrate to the meiotic cells or the microspores themselves. Microspores are haploid cells resulting from meiosis in the plant anther. These cells may be cultured to regenerate entire plants. The plants may be chemically treated to create a diploid chromosome content so that they are homozygous for all genetic information. Therefore, microspores carrying the targeted genetic change as a result of treating meiotic cells or microspores with gene targeting substrate may be cultured and converted into plants that are homozygous for the targeted change.
Alternatively, where male and female gametes are produced by different individuals, the gene targeting process may be done simultaneously in both a male and female plant, so that the male and female plants may be crossed. The gene targeting methods of the invention may be contrasted with conventional gene targeting strategies in which transformed organisms are hemizygous for the targeted change resulting in a need for further crosses to generate homozygous progeny.
Conventional gene targeting strategies also generally rely on methods for regenerating organisms from transformed totipotent cells [82;102-104].
In one aspect of the invention, targeted changes in either maternal or paternal chromosomes may be obtained by delivering gene targeting substrate specifically to either female or male reproductive organs. This is not possible with conventional strategies that target somatic cells. Specific targeting of maternal or paternal derived chromosomes may for example be used to investigate and exploit such epigenetic processes as parental genomic imprinting.
In some aspects of the invention, transformed plant cells may be cultured to regenerate whole plants having a transformed genotype and displaying a desired phenotype as, for example, modified by the expression of a protein encoded by a recombinant nucleic acid construct mediated by a transcriptional regulatory region of the invention. A variety of plant culture techniques may be used to regenerate whole plants, such as are described in Gamborg and Phillips, "Plant Cell, Tissue and Organ Culture, Fundamental Methods", Springer Berlin, 1995); Evans et al. "Protoplasts Isolation and Culture", Handbook of Plant Cell Culture, Macmillian Publishing Company, New York, 1983; or Binding, "Regeneration of Plants, Plant Protoplasts", CRC Press, Boca Raton, 1985; or in Klee et al., Ann. Rev. of Plant Phys. 38:467 (1987). A cell, tissue, organ, or organism into which has been introduced a foreign nucleic acid, is considered "transformed", "transfected", or "transgenic". A
transgenic or transformed cell or organism also includes progeny of the cell or organism and progeny produced from a breeding program employing a transgenic plant as a parent in a cross and exhibiting an altered phenotype resulting from the presence of a recombinant nucleic acid construct. A transgenic plant is therefore a plant that has been transformed with a recombinant nucleic acid construct, or the progeny of such a plant that includes the transgene.
The invention provides vectors, such as vectors for transforming plants or plant cells. The term "vector" in reference to nucleic acid molecule generally refers to a molecule that may be used to transfer a nucleic acid segment(s) from one cell to another. One of skill will recognize that after the nucleic acid is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques may be used, depending upon the species to be crossed.
In various embodiments, the invention comprises plants or animals transformed with the nucleic acids of the invention. Accordingly, an aspect of the invention relates to transformed embodiments of all higher plants, including monocots and dicots, such as, non-exclusively, species from the genera Brassica, Sinapis, Triticum, Zea, Hordeum, Avena, Oriza, Glycine, Linum, Medicago, Lens,Pisum, Cicer, Solanum, Lycopersicon, Secale, Populus, Gossypium, Raphanus, Triflorium, Phaseolus, Bromus,Phleum, Agropyron, Helianthus, Beta, Malus,Prunus,Cucurbita, Phoenix, Abies, Acer, Quercus, Olea, Allium, Washingtonia, Papaver, Rosa, Carthamus, Vicia, Fragaria, Lotus, Onobrychis, Trigonelia, Vigna, Citrus,Geranium, Manihot, Daucus, Arabidopsis, Atropa, Capsicum, Picea, Prunus, Pyrus, Pinus, Hyoscyamus, Nicotianaõ Arachus, Asparagus, Heterocatlis, Nemesia, Pelargonium, Panicum, Penniserum, Ranunculus, Senecio, Salpiglossis, Cucarnis, Browallia, Cedrus, Lolium, Sorghum, Datura,Petunia, Digitalis, Majorana, Cichorium, Lactuca, Antirrhinum, and Manihot.
will be decreased compared to the wild-type frequency. Thus the frequency of Fl progeny plants containing high proportions of the Variety X genome and its favourable characteristics plus disease resistance may be increased versus that possible with wild-type levels of meiotic homologous recombination. When such plants are identified, they may be backcrossed to Variety X to remove vestiges of the Accession Z genome. During gamete formation in such a plant, meiotic homologous recombination and/or independent assortment of chromosomes during meiosis may cause the inhibitor of meiotic recombination, such as a suppressed-recombination factor', to segregate from the disease resistance gene. By using molecular markers, the resultant progeny may be screened to identify plants which retain the disease resistance gene in the favourable Variety X genome but no longer carry the 'suppressed-recombination factor' so that these plants may be restored to wild-type levels of meiotic homologous recombination. In alternative aspects of the invention, the 'suppressed-recombination factor' may be removed from the genome of a particular plant line by flanking the 'suppressed-recombination factor' with recognition sites for a site-specific recombinase.
Exposing the plant line to the action of the site-specific recombinase will thus excise the the 'suppressed-recombination factor' from the genome of the plant line.
In an alternative aspect, the invention provides methods to increase meiotic homologous recombination leading to enhanced efficiency of gene targeting.
Homologous recombination activities are at an elevated state in meiotic cells compared to mitotic cells in which recombination activities must generally be induced by DNA damage. Thus supplying gene targeting substrates to meiotic cells, in accordance with one aspect of the present invention, takes advantage of endogenous meiotic enzymes and DNA states to promote recombination with the target locus. The present invention may also be used to increase recombination potential in meiotic cells to further enhance meiotic gene targeting frequency.
In one aspect of the present invention, increasing one or more meiotic homologous recombination functions by providing an activator of meiotic homologous recombination can increase meiotic homologous recombination frequency. Thus, in accordance with this aspect of the invention, by supplying gene targeting substrate to meiotic cells one may increase gene targeting frequency. Gene targeting has been successfully applied in a variety of eukaryotic species including fungi [101], plants [82;102-104] and lower [105;106] and higher animals [63;85;107]. However, these gene targeting strategies involve only vegetative/somatic cells undergoing mitosis.
In one aspect of the present invention, increasing gene targeting frequency by performing the process in meiotic cells may facilitate the rapid generation of homozygous lines with targeted changes. In this aspect, the gene targeting event may occur at meiosis I, resulting in four gametes, each of which may have the targeted change. In plants and other monoecious organisms where both male and female gametes are produced by the same individual, simply self-crossing the individual may result in a high frequency of diploid progeny which are homozygous for the targeted genetic change. In addition, in the case of plants, one may obtain individuals homozygous for the targeted genetic change by performing microspore culture after delivering gene targeting substrate to the meiotic cells or the microspores themselves. Microspores are haploid cells resulting from meiosis in the plant anther. These cells may be cultured to regenerate entire plants. The plants may be chemically treated to create a diploid chromosome content so that they are homozygous for all genetic information. Therefore, microspores carrying the targeted genetic change as a result of treating meiotic cells or microspores with gene targeting substrate may be cultured and converted into plants that are homozygous for the targeted change.
Alternatively, where male and female gametes are produced by different individuals, the gene targeting process may be done simultaneously in both a male and female plant, so that the male and female plants may be crossed. The gene targeting methods of the invention may be contrasted with conventional gene targeting strategies in which transformed organisms are hemizygous for the targeted change resulting in a need for further crosses to generate homozygous progeny.
Conventional gene targeting strategies also generally rely on methods for regenerating organisms from transformed totipotent cells [82;102-104].
In one aspect of the invention, targeted changes in either maternal or paternal chromosomes may be obtained by delivering gene targeting substrate specifically to either female or male reproductive organs. This is not possible with conventional strategies that target somatic cells. Specific targeting of maternal or paternal derived chromosomes may for example be used to investigate and exploit such epigenetic processes as parental genomic imprinting.
In some aspects of the invention, transformed plant cells may be cultured to regenerate whole plants having a transformed genotype and displaying a desired phenotype as, for example, modified by the expression of a protein encoded by a recombinant nucleic acid construct mediated by a transcriptional regulatory region of the invention. A variety of plant culture techniques may be used to regenerate whole plants, such as are described in Gamborg and Phillips, "Plant Cell, Tissue and Organ Culture, Fundamental Methods", Springer Berlin, 1995); Evans et al. "Protoplasts Isolation and Culture", Handbook of Plant Cell Culture, Macmillian Publishing Company, New York, 1983; or Binding, "Regeneration of Plants, Plant Protoplasts", CRC Press, Boca Raton, 1985; or in Klee et al., Ann. Rev. of Plant Phys. 38:467 (1987). A cell, tissue, organ, or organism into which has been introduced a foreign nucleic acid, is considered "transformed", "transfected", or "transgenic". A
transgenic or transformed cell or organism also includes progeny of the cell or organism and progeny produced from a breeding program employing a transgenic plant as a parent in a cross and exhibiting an altered phenotype resulting from the presence of a recombinant nucleic acid construct. A transgenic plant is therefore a plant that has been transformed with a recombinant nucleic acid construct, or the progeny of such a plant that includes the transgene.
The invention provides vectors, such as vectors for transforming plants or plant cells. The term "vector" in reference to nucleic acid molecule generally refers to a molecule that may be used to transfer a nucleic acid segment(s) from one cell to another. One of skill will recognize that after the nucleic acid is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques may be used, depending upon the species to be crossed.
In various embodiments, the invention comprises plants or animals transformed with the nucleic acids of the invention. Accordingly, an aspect of the invention relates to transformed embodiments of all higher plants, including monocots and dicots, such as, non-exclusively, species from the genera Brassica, Sinapis, Triticum, Zea, Hordeum, Avena, Oriza, Glycine, Linum, Medicago, Lens,Pisum, Cicer, Solanum, Lycopersicon, Secale, Populus, Gossypium, Raphanus, Triflorium, Phaseolus, Bromus,Phleum, Agropyron, Helianthus, Beta, Malus,Prunus,Cucurbita, Phoenix, Abies, Acer, Quercus, Olea, Allium, Washingtonia, Papaver, Rosa, Carthamus, Vicia, Fragaria, Lotus, Onobrychis, Trigonelia, Vigna, Citrus,Geranium, Manihot, Daucus, Arabidopsis, Atropa, Capsicum, Picea, Prunus, Pyrus, Pinus, Hyoscyamus, Nicotianaõ Arachus, Asparagus, Heterocatlis, Nemesia, Pelargonium, Panicum, Penniserum, Ranunculus, Senecio, Salpiglossis, Cucarnis, Browallia, Cedrus, Lolium, Sorghum, Datura,Petunia, Digitalis, Majorana, Cichorium, Lactuca, Antirrhinum, and Manihot.
In one aspect, the invention includes mechanisms for achieving meiosis-specific or preferentially-meiotic expression, or activity, of factors that modulate meiotic homologous recombination. In one aspect, this may involve the use of meiosis-specific or preferentially meiotic promoters (i.e. promoters that are expressed exclusively or primarily during meiosis, respectively) operably linked to a gene of interest for expression during meiosis. Examples of such promoters may be found in the meiotic recombination factor genes described herein, including homologues obtainable from species from yeast to plants and animals.
Specific examples of published promoters tested to be meiosis-specific are DMC1 [138]
and MSH4 [27]. Additional promoters may be obtainable from genes that are expressed in meiosis-specific manner (for example, see [21]) or genes that are induced during meiosis [137].
Preferentially-meiotic promoters may include promoters active in vegetative cells or germ-line cells which lead to meiotic cells, wherein expression is mediated sufficiently close to the onset of meiosis. New promoters may be engineered to be meiosis-specific or preferentially meiotic, such as promoters that are initially active in both mitotic and meiotic cells. Such promoters may be modified by deletion or inactivation of mitotic expression elements so that their expression becomes preferential or specific during meiosis.
Certain transcription factors (e.g. NDT80) and promoter consensus sequences (e.g.
URS1) are understood to be responsible for meiosis-specific expression [137].
Constitutive or vegetatively active promoters may be converted to meiosis-specific or preferentially-meiotic promoters by modifying the promoter to contain the recognition sequences for meiosis-specific transcription factors and to be active only when the promoter binds these transcription factors.
Bipartite promoters may be used to provide meiosis-specific expression.
Bipartite systems consists of 1) a minimal promoter containing a recognition sequence for 2) a specific transcription factor. The bipartite promoter is inactive unless it is bound by the transcription factor. The gene of interest may be placed behind the minimal promoter so that it is not expressed, and the transcription factor may be linked to a meiosis-specific promoter. The transcription factor may be a naturally occurring protein or a hybrid protein composed of a DNA-binding domain and a transcription-activating domain. Because the activity of the minimal promoter is dependent upon binding of the transcription factor, the operably-linked coding sequence will not be expressed in vegetative cells. In meiotic cells, the meiosis-specific promoter will be turned on facilitating expression of the transcription factor. The transcription factor will act in trans and bind to the DNA recognition sequence in the minimal promoter via the cognate DNA-binding domain. The activation domain of the transcription factor will then be in the appropriate context to aid recruitment of RNA
polymerase and other components of the transcription machinery. This will cause transcription of the target gene.
With this bipartite system, the gene of interest will only be expressed in cells entering or undergoing meiosis since the necessary transcription factor is linked to a meiosis-specific promoter and will only be expressed at the desired developmental stage (i.e.
the target gene will be expressed in a spatial and temporal pattern mirroring the meiosis-specific promoter expressing the transcription factor). In addition, a bipartite system could be used to coordinate expression of more than one gene during meiosis. Different genes could be placed behind individual minimal promoters all of which have the same recognition sequence for a specific transcription factor and whose expression, therefore, is reliant upon the presence of the transcription factor. The transcription factor is linked to a meiosis-specific promoter.
Therefore, when cells enter meiosis, the promoter expressed the transcription factor which then can coordinately activate expression of the suite of target genes. Use of a bipartite system may have the advantage that if expression of the target genes is no longer required in a particular plant or animal line, then the transcription factor may be bred out, so that without the transcription factor present, the target gene(s) will no longer be expressed in this line. If the target genes are desired to be expressed at a later stage, the promoter:
:transcription factor locus may be bred back into the line. In addition, the bipartite system may be used to modulate the level of expression of a target gene. Bipartite promoters may be operably linked to a variety of sequences, such as:
1) positive factors to increase homologous recombination frequency: wild-type endogenous genes to facilitate overexpression of particular homologous recombination enzymes or other catalytic proteins or structural proteins or regulatory proteins; heterologous genes which promote homologous recombination; or, 2) negative factors to decrease homologous recombination frequency: altered endogenous proteins or wild-type or altered heterologous proteins capable of causing dominant-negative effect; anti-sense RNA to target genes; antibodies which bind and inhibit action of target proteins.
Minimal promoter elements in bipartite promoters may include, for example:
1) truncated CaMV 35S (nucleotides ¨59 to +48 relative to the transcription start site) [139];
Specific examples of published promoters tested to be meiosis-specific are DMC1 [138]
and MSH4 [27]. Additional promoters may be obtainable from genes that are expressed in meiosis-specific manner (for example, see [21]) or genes that are induced during meiosis [137].
Preferentially-meiotic promoters may include promoters active in vegetative cells or germ-line cells which lead to meiotic cells, wherein expression is mediated sufficiently close to the onset of meiosis. New promoters may be engineered to be meiosis-specific or preferentially meiotic, such as promoters that are initially active in both mitotic and meiotic cells. Such promoters may be modified by deletion or inactivation of mitotic expression elements so that their expression becomes preferential or specific during meiosis.
Certain transcription factors (e.g. NDT80) and promoter consensus sequences (e.g.
URS1) are understood to be responsible for meiosis-specific expression [137].
Constitutive or vegetatively active promoters may be converted to meiosis-specific or preferentially-meiotic promoters by modifying the promoter to contain the recognition sequences for meiosis-specific transcription factors and to be active only when the promoter binds these transcription factors.
Bipartite promoters may be used to provide meiosis-specific expression.
Bipartite systems consists of 1) a minimal promoter containing a recognition sequence for 2) a specific transcription factor. The bipartite promoter is inactive unless it is bound by the transcription factor. The gene of interest may be placed behind the minimal promoter so that it is not expressed, and the transcription factor may be linked to a meiosis-specific promoter. The transcription factor may be a naturally occurring protein or a hybrid protein composed of a DNA-binding domain and a transcription-activating domain. Because the activity of the minimal promoter is dependent upon binding of the transcription factor, the operably-linked coding sequence will not be expressed in vegetative cells. In meiotic cells, the meiosis-specific promoter will be turned on facilitating expression of the transcription factor. The transcription factor will act in trans and bind to the DNA recognition sequence in the minimal promoter via the cognate DNA-binding domain. The activation domain of the transcription factor will then be in the appropriate context to aid recruitment of RNA
polymerase and other components of the transcription machinery. This will cause transcription of the target gene.
With this bipartite system, the gene of interest will only be expressed in cells entering or undergoing meiosis since the necessary transcription factor is linked to a meiosis-specific promoter and will only be expressed at the desired developmental stage (i.e.
the target gene will be expressed in a spatial and temporal pattern mirroring the meiosis-specific promoter expressing the transcription factor). In addition, a bipartite system could be used to coordinate expression of more than one gene during meiosis. Different genes could be placed behind individual minimal promoters all of which have the same recognition sequence for a specific transcription factor and whose expression, therefore, is reliant upon the presence of the transcription factor. The transcription factor is linked to a meiosis-specific promoter.
Therefore, when cells enter meiosis, the promoter expressed the transcription factor which then can coordinately activate expression of the suite of target genes. Use of a bipartite system may have the advantage that if expression of the target genes is no longer required in a particular plant or animal line, then the transcription factor may be bred out, so that without the transcription factor present, the target gene(s) will no longer be expressed in this line. If the target genes are desired to be expressed at a later stage, the promoter:
:transcription factor locus may be bred back into the line. In addition, the bipartite system may be used to modulate the level of expression of a target gene. Bipartite promoters may be operably linked to a variety of sequences, such as:
1) positive factors to increase homologous recombination frequency: wild-type endogenous genes to facilitate overexpression of particular homologous recombination enzymes or other catalytic proteins or structural proteins or regulatory proteins; heterologous genes which promote homologous recombination; or, 2) negative factors to decrease homologous recombination frequency: altered endogenous proteins or wild-type or altered heterologous proteins capable of causing dominant-negative effect; anti-sense RNA to target genes; antibodies which bind and inhibit action of target proteins.
Minimal promoter elements in bipartite promoters may include, for example:
1) truncated CaMV 35S (nucleotides ¨59 to +48 relative to the transcription start site) [139];
2) DNA recognition sequences: E. coil lac operator [140, 141], yeast GAL4 upstream activator sequence [139]; TATA BOX, transcription start site, and may also include a ribosome recruitment sequence.
Bipartite promoters may for example include transcription factors such as: the yeast GAL4 DNA-binding domain fused to maize Cl transcription activator domain [139]; E. coil lac repressor fused to yeast GAL4 transcription activator domain [140]; or the E. coil lac repressor fused to herpes virus VP16 transcription activator domain [141].
Meiosis-specific promoters may be used directly to express factors for promoting or suppressing meiotic homologous recombination frequency by fusing the factor coding sequence to the promoter. However, some meiosis-specific promoters may promote transcription at too low of a level (i.e. weakly expressed) or at too high of a level (i.e.
strongly expressed) to achieve the desired effect on homologous recombination frequency.
Therefore, for example, a weak meiosis-specific promoter may be used to express a transcription factor which can promote a high level of expression when it binds to the minimal promoter adjacent to the target gene. Thus while the target gene might only be expressed at a low level if it was directly fused to the meiosis-specific promoter, this promoter can indirectly facilitate high level expression of the target gene by expressing a very active transcription factor. The transcription factor may be present at low levels but because it is so effective at activating transcription at the minimal promoter fused to the target gene, a higher level of expression of the target gene will be achieved than if the gene was directly fused to the weak meiosis-specific promoter. In addition, the transcription factor may also be engineered so that its mRNA transcript is more stable or is more readily translated, or that the protein itself is more stable. Conversely, if the meiosis-specific promoter is too strong for a desired application, it may be used to express a transcription factor with low ability to promote transcription at the minimal promoter adjacent to the target gene.
In alternative aspects of the invention, inducible promoters may be provided.
A
sequence encoding an inhibitor or activator of meiotic homologous recombination may be cloned behind an inducible or repressible promoter. The promoter may then be induced (or de-repressed) by appropriate external treatment of the organism when organismal development proceeds to a point when meiosis is initiated. Regulation of such promoters may be mediated by environmental conditions such as heat shock [142], or chemical stimulus.
Examples of chemically regulatable promoters active in plants and animals include the ecdysone, dexamethasone, tetracycline and copper .systems [143; 144; 145; 146;
147; 148].
Bipartite promoters may for example include transcription factors such as: the yeast GAL4 DNA-binding domain fused to maize Cl transcription activator domain [139]; E. coil lac repressor fused to yeast GAL4 transcription activator domain [140]; or the E. coil lac repressor fused to herpes virus VP16 transcription activator domain [141].
Meiosis-specific promoters may be used directly to express factors for promoting or suppressing meiotic homologous recombination frequency by fusing the factor coding sequence to the promoter. However, some meiosis-specific promoters may promote transcription at too low of a level (i.e. weakly expressed) or at too high of a level (i.e.
strongly expressed) to achieve the desired effect on homologous recombination frequency.
Therefore, for example, a weak meiosis-specific promoter may be used to express a transcription factor which can promote a high level of expression when it binds to the minimal promoter adjacent to the target gene. Thus while the target gene might only be expressed at a low level if it was directly fused to the meiosis-specific promoter, this promoter can indirectly facilitate high level expression of the target gene by expressing a very active transcription factor. The transcription factor may be present at low levels but because it is so effective at activating transcription at the minimal promoter fused to the target gene, a higher level of expression of the target gene will be achieved than if the gene was directly fused to the weak meiosis-specific promoter. In addition, the transcription factor may also be engineered so that its mRNA transcript is more stable or is more readily translated, or that the protein itself is more stable. Conversely, if the meiosis-specific promoter is too strong for a desired application, it may be used to express a transcription factor with low ability to promote transcription at the minimal promoter adjacent to the target gene.
In alternative aspects of the invention, inducible promoters may be provided.
A
sequence encoding an inhibitor or activator of meiotic homologous recombination may be cloned behind an inducible or repressible promoter. The promoter may then be induced (or de-repressed) by appropriate external treatment of the organism when organismal development proceeds to a point when meiosis is initiated. Regulation of such promoters may be mediated by environmental conditions such as heat shock [142], or chemical stimulus.
Examples of chemically regulatable promoters active in plants and animals include the ecdysone, dexamethasone, tetracycline and copper .systems [143; 144; 145; 146;
147; 148].
=
In alternative embodiments, a meiosis-specific promoter may be used to express a heterologous RNA-polymerase which recognizes specific sequences not naturally present in the cell. For example, T7 RNA Polymerase may be used in eukaryotes to specifically promote transcription of a target gene linked to the T7 RNA
Pol recruitment DNA sequence [149]. Genes affecting homologous recombination may then be regulated by the expression of T7 RNA Polymerase.
In some aspects, the present invention provides meiosis-specific expression of inhibitors or activators of meiotic homologous recombination (meiosis recombination factors), which may avoid deleterious effects that may otherwise be caused by expression of such factors during vegetative/mitotic growth. Constitutive expression of recombination factors, as exemplified here by RAD51, was found to severely inhibit cell proliferation: the growth rate of cells expressing the recombinase was reduced by approximately 5-fold versus the control, a result that is in accordance with observations made in animal cells where overexpression of recombinases has been found to inhibit cell proliferation by arresting cell division [92].
In alternative embodiments, the invention provides isolated nucleic acids and proteins. By isolated, it is meant that the isolated substance has been substantially separated or purified away from other biological components with which it would otherwise be associated, for example in vivo. The term 'isolated' therefore includes substances purified by standard purification methods, as well as substances prepared by recombinant expression in a host, as well as chemically synthesized substances.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is an annotated alignment of SPO1 1 protein sequences taken from sequence accessions provided in the prior art. Identical or highly conserve amino acids are shaded. The position of the essential tyrosine residue of the active site is highlighted with a double asterisk. Location of the five conserved motifs present in SPO1 1 proteins are indicated by lines above the alignment.
Location of the Toprim domain is indicated by a line beneath the sequences. Locations of the invariant glutamate residue (E) and "DXD" motif are indicated by asterisks.
Figure 2 is the amino acid sequence of Arabidopsis thaliana SP011-1 (AtSP011-1).
Figure 3 is the amino acid sequence of Arabidopsis thaliana SP011-2 (AtSP011-2).
In alternative embodiments, a meiosis-specific promoter may be used to express a heterologous RNA-polymerase which recognizes specific sequences not naturally present in the cell. For example, T7 RNA Polymerase may be used in eukaryotes to specifically promote transcription of a target gene linked to the T7 RNA
Pol recruitment DNA sequence [149]. Genes affecting homologous recombination may then be regulated by the expression of T7 RNA Polymerase.
In some aspects, the present invention provides meiosis-specific expression of inhibitors or activators of meiotic homologous recombination (meiosis recombination factors), which may avoid deleterious effects that may otherwise be caused by expression of such factors during vegetative/mitotic growth. Constitutive expression of recombination factors, as exemplified here by RAD51, was found to severely inhibit cell proliferation: the growth rate of cells expressing the recombinase was reduced by approximately 5-fold versus the control, a result that is in accordance with observations made in animal cells where overexpression of recombinases has been found to inhibit cell proliferation by arresting cell division [92].
In alternative embodiments, the invention provides isolated nucleic acids and proteins. By isolated, it is meant that the isolated substance has been substantially separated or purified away from other biological components with which it would otherwise be associated, for example in vivo. The term 'isolated' therefore includes substances purified by standard purification methods, as well as substances prepared by recombinant expression in a host, as well as chemically synthesized substances.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is an annotated alignment of SPO1 1 protein sequences taken from sequence accessions provided in the prior art. Identical or highly conserve amino acids are shaded. The position of the essential tyrosine residue of the active site is highlighted with a double asterisk. Location of the five conserved motifs present in SPO1 1 proteins are indicated by lines above the alignment.
Location of the Toprim domain is indicated by a line beneath the sequences. Locations of the invariant glutamate residue (E) and "DXD" motif are indicated by asterisks.
Figure 2 is the amino acid sequence of Arabidopsis thaliana SP011-1 (AtSP011-1).
Figure 3 is the amino acid sequence of Arabidopsis thaliana SP011-2 (AtSP011-2).
In the context of the present invention, "promoter" means a nucleotide sequence capable of mediating or modulating transcription of a nucleotide sequence of interest, when the transcriptional regulatory region is operably linked to the sequence of interest. A
transcriptional regulatory region and a sequence of interest are "operably linked" when the sequences are functionally connected so as to permit transcription of the sequence of interest to be mediated or modulated by the transcriptional regulatory region. In some embodiments, to be operably linked, a transcriptional regulatory region may be located on the same strand as the sequence of interest. The transcriptional regulatory region may in some embodiments be located 5' of the sequence of interest. In such embodiments, the transcriptional regulatory region may be directly 5' of the sequence of interest or there may be intervening sequences between these regions. The operable linkage of the transcriptional regulatory region and the sequence of interest may require appropriate molecules (such as transcriptional activator -25a-proteins) to be bound to the transcriptional regulatory region, the invention therefore encompasses embodiments in which such molecules are provided, either in vitro or in vivo.
The term "recombinant" means that something has been recombined, so that when made in reference to a nucleic acid construct the term refers to a molecule that is comprised of nucleic acid sequences that are joined together or produced by means of molecular biological techniques. The term "recombinant" when made in reference to a protein or a polypeptide refers to a protein or polypeptide molecule which is expressed using a recombinant nucleic acid construct created by means of molecular biological techniques. The term "recombinant" when made in reference to genetic composition refers to a gamete or progeny with new combinations of alleles that did not occur in the parental genomes.
Recombinant nucleic acid constructs may include a nucleotide sequence which is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature.
Recombinant nucleic acid constructs therefore indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e. by human intervention. Recombinant nucleic acid constructs may for example be introduced into a host cell by transformation. Such recombinant nucleic acid constructs may include sequences derived from the same host cell species or from different host cell species, which have been isolated and reintroduced into cells of the host species.
Recombinant nucleic acid construct sequences may become integrated into a host cell genome, either as a result of the original transformation of the host cells, or as the result of subsequent recombination events. Transformation techniques that may be employed include plant cell membrane disruption by electroporation, microinjection and polyethylene glycol based transformation (such as are disclosed in Paszkowski etal. EMBO J. 3:2717 (1984);
Fromm etal., Proc. Natl. Acad. Sci. USA 82:5824 (1985); Rogers etal., Methods Enzymol.
118:627 (1986); and in U.S. Patent Nos. 4,684,611; 4,801,540; 4,743,548 and 5,231,019), biolistic transformation such as DNA particle bombardment (for example as disclosed in Klein, et al.,Nature 327: 70 (1987); Gordon-Kamm, etal. "The Plant Cell" 2:603 (1990);
and in U.S. Patent Nos. 4,945,050; 5,015,580; 5,149,655 and 5,466,587);
Agrobacterium-mediated transformation methods (such as those disclosed in Horsch etal.
Science 233: 496 (1984); Fraley etal., Proc. Nat'l Acad Sci. USA 80:4803 (1983); and U.S.
Patent Nos.
4,940,838 and 5,464,763).
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance , .
with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. In the specification, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to", and the word "comprises" has a corresponding meaning. Citation of references herein shall not be construed as an admission that such references are prior art to the present invention.
EXAMPLES
To demonstrate methods for increasing and decreasing homologous recombination frequency during meiosis in accordance with various aspects of the present invention, Saccharomyces cerevisiae was used as a eukaryote model system. To demonstrate mechanisms for engineering modified meiotic homologous recombination frequency, proteins involved in different steps of the homologous recombination pathway have been utilized, including:
a) SPO1 1, which catalyses formation of the initial double-strand break in one member of a pair of aligned homologous maternal and paternal chromosomes. The double-strand break is then processed to become recombinogenic and participate in a cross-over event.
SPO1 1 is hi *My conserved amongst eukaryotic species from yeast to plants and humans [9-11].
b) DMC1, which is a meiosis-specific RecA homologue that acts on ssDNA
resulting from the processing of double-strand breaks created by SPO1 1. DMC1 facilitates the paring of homologous sequences on paired homologous chromosomes and catalyses invasion of the ssDNA strand into the paired duplex DNA of a non-sister chromatid. DMC1 accumulates only in meiotic cells [20; 21; 22; 138;] and appears to have no function in homologous recombination occurring in mitotic cells [20;49;53-55]. DMC1 is highly conserved amongst eukaryotic species from yeast to plants and humans [20-22]. DMC1 acts in a unique but overlapping pathway regarding other RecA homologues functioning during meiosis [53].
DMC1 is unique from RAD51 in that it forms octameric complexes when it binds ssDNA
transcriptional regulatory region and a sequence of interest are "operably linked" when the sequences are functionally connected so as to permit transcription of the sequence of interest to be mediated or modulated by the transcriptional regulatory region. In some embodiments, to be operably linked, a transcriptional regulatory region may be located on the same strand as the sequence of interest. The transcriptional regulatory region may in some embodiments be located 5' of the sequence of interest. In such embodiments, the transcriptional regulatory region may be directly 5' of the sequence of interest or there may be intervening sequences between these regions. The operable linkage of the transcriptional regulatory region and the sequence of interest may require appropriate molecules (such as transcriptional activator -25a-proteins) to be bound to the transcriptional regulatory region, the invention therefore encompasses embodiments in which such molecules are provided, either in vitro or in vivo.
The term "recombinant" means that something has been recombined, so that when made in reference to a nucleic acid construct the term refers to a molecule that is comprised of nucleic acid sequences that are joined together or produced by means of molecular biological techniques. The term "recombinant" when made in reference to a protein or a polypeptide refers to a protein or polypeptide molecule which is expressed using a recombinant nucleic acid construct created by means of molecular biological techniques. The term "recombinant" when made in reference to genetic composition refers to a gamete or progeny with new combinations of alleles that did not occur in the parental genomes.
Recombinant nucleic acid constructs may include a nucleotide sequence which is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature.
Recombinant nucleic acid constructs therefore indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e. by human intervention. Recombinant nucleic acid constructs may for example be introduced into a host cell by transformation. Such recombinant nucleic acid constructs may include sequences derived from the same host cell species or from different host cell species, which have been isolated and reintroduced into cells of the host species.
Recombinant nucleic acid construct sequences may become integrated into a host cell genome, either as a result of the original transformation of the host cells, or as the result of subsequent recombination events. Transformation techniques that may be employed include plant cell membrane disruption by electroporation, microinjection and polyethylene glycol based transformation (such as are disclosed in Paszkowski etal. EMBO J. 3:2717 (1984);
Fromm etal., Proc. Natl. Acad. Sci. USA 82:5824 (1985); Rogers etal., Methods Enzymol.
118:627 (1986); and in U.S. Patent Nos. 4,684,611; 4,801,540; 4,743,548 and 5,231,019), biolistic transformation such as DNA particle bombardment (for example as disclosed in Klein, et al.,Nature 327: 70 (1987); Gordon-Kamm, etal. "The Plant Cell" 2:603 (1990);
and in U.S. Patent Nos. 4,945,050; 5,015,580; 5,149,655 and 5,466,587);
Agrobacterium-mediated transformation methods (such as those disclosed in Horsch etal.
Science 233: 496 (1984); Fraley etal., Proc. Nat'l Acad Sci. USA 80:4803 (1983); and U.S.
Patent Nos.
4,940,838 and 5,464,763).
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance , .
with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. In the specification, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to", and the word "comprises" has a corresponding meaning. Citation of references herein shall not be construed as an admission that such references are prior art to the present invention.
EXAMPLES
To demonstrate methods for increasing and decreasing homologous recombination frequency during meiosis in accordance with various aspects of the present invention, Saccharomyces cerevisiae was used as a eukaryote model system. To demonstrate mechanisms for engineering modified meiotic homologous recombination frequency, proteins involved in different steps of the homologous recombination pathway have been utilized, including:
a) SPO1 1, which catalyses formation of the initial double-strand break in one member of a pair of aligned homologous maternal and paternal chromosomes. The double-strand break is then processed to become recombinogenic and participate in a cross-over event.
SPO1 1 is hi *My conserved amongst eukaryotic species from yeast to plants and humans [9-11].
b) DMC1, which is a meiosis-specific RecA homologue that acts on ssDNA
resulting from the processing of double-strand breaks created by SPO1 1. DMC1 facilitates the paring of homologous sequences on paired homologous chromosomes and catalyses invasion of the ssDNA strand into the paired duplex DNA of a non-sister chromatid. DMC1 accumulates only in meiotic cells [20; 21; 22; 138;] and appears to have no function in homologous recombination occurring in mitotic cells [20;49;53-55]. DMC1 is highly conserved amongst eukaryotic species from yeast to plants and humans [20-22]. DMC1 acts in a unique but overlapping pathway regarding other RecA homologues functioning during meiosis [53].
DMC1 is unique from RAD51 in that it forms octameric complexes when it binds ssDNA
[108]. DMC1 also has proteins that interact with it during homologous recombination which are unique from those interacting with other RecA homologues [49;53].
c) RAD51, which is a RecA homologue that also acts on ssDNA resulting from the processing of double-strand breaks created by SPO1 1. RAD51 functions in both meiotic and mitotic cells [23;53;58]. RAD51 is highly conserved amongst eukaryotic species from yeast to plants and humans [21;23-25]. It is unique from DMC1 in that it forms a hexameric complex like E. coli RecA when it binds ssDNA [109;110]. It acts in a unique pathway from DMC1 and has proteins that specifically interact with it and not DMC1 [49;53;56].
d) MRE11, which is a nuclease that acts in resection of double-strand breaks created by SPO 1 1 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
MREll is highly conserved amongst eukaryotic species from yeast to plants and humans [12-15].
MREll functions in both meiotic and mitotic cells [13;93;111;112].
e) ssDNA-binding proteins, which act to maintain ssDNA ends created by MREll and associated proteins free of secondary structure [67]. By doing so, the ssDNA ends are in an optimum topology for the action of RecA homologues like RAD51 and DMC1.
ssDNA-binding proteins are highly conserved from yeast to humans [26]. Eukaryotic ssDNA-binding protein function is facilitated by a heterotrimeic complex known as RPA [26].The ssDNA-binding protein in E. coli., known as SSB, is an ancestor of the eukaryotic proteins [74;113]. SSB binds ssDNA principally as a homotetramer, but may also bind as a monomer [76]. As a result, SSB provides an efficient system to test the effect of modifying the cellular level of ssDNA-binding proteins on homologous recombination, versus studying the effects of each individual subunit of the eukaryotic heterotrimeric RPA. A cloned E.
coli SSB gene was evaluated for its effect on meiotic homologous recombination frequency. To assist movement of this prokaryotic protein into the eukaryotic nucleus, it was engineered to encode a nuclear localization sequence derived from Simian virus 40 T-antigen [114].
In alternative aspects of the invention, homologous recombination frequency is increased by increasing the amount of a limiting factor through increased expression of the cognate gene, enhanced translational capacity of the cognate mRNA, decreased turnover of the protein or cognate mRNA; or by expressing an altered form of the protein with enhanced activity potential.
To reduce meiotic homologous recombination frequency, expression of the cognate gene for a target protein may be reduced, for example by antisense or cosuppression of the gene, by reducing translation of the cognate mRNA or increasing degradation of the mRNA
c) RAD51, which is a RecA homologue that also acts on ssDNA resulting from the processing of double-strand breaks created by SPO1 1. RAD51 functions in both meiotic and mitotic cells [23;53;58]. RAD51 is highly conserved amongst eukaryotic species from yeast to plants and humans [21;23-25]. It is unique from DMC1 in that it forms a hexameric complex like E. coli RecA when it binds ssDNA [109;110]. It acts in a unique pathway from DMC1 and has proteins that specifically interact with it and not DMC1 [49;53;56].
d) MRE11, which is a nuclease that acts in resection of double-strand breaks created by SPO 1 1 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
MREll is highly conserved amongst eukaryotic species from yeast to plants and humans [12-15].
MREll functions in both meiotic and mitotic cells [13;93;111;112].
e) ssDNA-binding proteins, which act to maintain ssDNA ends created by MREll and associated proteins free of secondary structure [67]. By doing so, the ssDNA ends are in an optimum topology for the action of RecA homologues like RAD51 and DMC1.
ssDNA-binding proteins are highly conserved from yeast to humans [26]. Eukaryotic ssDNA-binding protein function is facilitated by a heterotrimeic complex known as RPA [26].The ssDNA-binding protein in E. coli., known as SSB, is an ancestor of the eukaryotic proteins [74;113]. SSB binds ssDNA principally as a homotetramer, but may also bind as a monomer [76]. As a result, SSB provides an efficient system to test the effect of modifying the cellular level of ssDNA-binding proteins on homologous recombination, versus studying the effects of each individual subunit of the eukaryotic heterotrimeric RPA. A cloned E.
coli SSB gene was evaluated for its effect on meiotic homologous recombination frequency. To assist movement of this prokaryotic protein into the eukaryotic nucleus, it was engineered to encode a nuclear localization sequence derived from Simian virus 40 T-antigen [114].
In alternative aspects of the invention, homologous recombination frequency is increased by increasing the amount of a limiting factor through increased expression of the cognate gene, enhanced translational capacity of the cognate mRNA, decreased turnover of the protein or cognate mRNA; or by expressing an altered form of the protein with enhanced activity potential.
To reduce meiotic homologous recombination frequency, expression of the cognate gene for a target protein may be reduced, for example by antisense or cosuppression of the gene, by reducing translation of the cognate mRNA or increasing degradation of the mRNA
or protein. Alternatively, activity of the target wild-type protein may be inhibited through coexpression of an alternative form of the protein that acts in a 'dominant' fashion to inhibit (i.e. 'negatively' affect) the activity of the endogenous wild-type protein.
This 'dominant-negative' effect may result by one or more modes of action. A non-exclusive list of possible modes of action includes:
1) Titration of substrate, in which an alternate form of the protein of interest binds to the target substrate of the wild-type endogenous protein, wherein the alternate-form protein cannot complete the catalytic or other normal functions performed by the wild-type protein.
By binding the substrate, the alternate-form protein titrates the substrate thereby inhibiting access to the substrate by the endogenous wild-type protein. The functional activity of the endogenous wild-type protein is therefore inhibited.
2) Titration of cofactors or co-members of protein complexes, in which the alternate-form protein binds to cofactors required for full activity of the endogenous wild-type protein;
the cofactors may be organic or inorganic compounds or other proteins which are co-members of heteromeric protein complexes (i.e. the complex is composed of more than one type of protein). For example, many proteins, including those involved in many DNA
recombination processes, act in multi-protein heteromeric complexes. If one member of the complex is absent or in limiting amounts, the function and activity level of the entire complex is reduced. Therefore if an alternate-form of a target protein, which may be non-functional or having reduced function itself but still capable of interacting with members of its normal protein complex, is expressed in a cell it can reduce activity of the endogenous wild-type protein by binding with and titrating members of the protein complex. These members of the complex are then no longer available to form functional complexes with the wild-type protein and, therefore, the function of the endogenous wild-type protein is reduced.
3) Direct inhibition of endogenous wild-type protein, in which the alternate-form protein may bind with the wild-type protein directly to inhibit its activity.
Many proteins, including those participating in different steps of DNA recombination, form homomeric protein complexes (i.e. the complex is composed of a single type of protein).
If one member of the homomeric complex is inactive in the correct biochemical context, it may poison (i.e.
inhibit) the activity of the entire complex. Therefore, if an alternate-form protein, which has reduced or absent activity itself but which can still interact with endogenous wild-type protein to form complexes, is expressed in a cell it can reduce activity of the entire complex.
The cell therefore has a combination of complexes composed of the following:
This 'dominant-negative' effect may result by one or more modes of action. A non-exclusive list of possible modes of action includes:
1) Titration of substrate, in which an alternate form of the protein of interest binds to the target substrate of the wild-type endogenous protein, wherein the alternate-form protein cannot complete the catalytic or other normal functions performed by the wild-type protein.
By binding the substrate, the alternate-form protein titrates the substrate thereby inhibiting access to the substrate by the endogenous wild-type protein. The functional activity of the endogenous wild-type protein is therefore inhibited.
2) Titration of cofactors or co-members of protein complexes, in which the alternate-form protein binds to cofactors required for full activity of the endogenous wild-type protein;
the cofactors may be organic or inorganic compounds or other proteins which are co-members of heteromeric protein complexes (i.e. the complex is composed of more than one type of protein). For example, many proteins, including those involved in many DNA
recombination processes, act in multi-protein heteromeric complexes. If one member of the complex is absent or in limiting amounts, the function and activity level of the entire complex is reduced. Therefore if an alternate-form of a target protein, which may be non-functional or having reduced function itself but still capable of interacting with members of its normal protein complex, is expressed in a cell it can reduce activity of the endogenous wild-type protein by binding with and titrating members of the protein complex. These members of the complex are then no longer available to form functional complexes with the wild-type protein and, therefore, the function of the endogenous wild-type protein is reduced.
3) Direct inhibition of endogenous wild-type protein, in which the alternate-form protein may bind with the wild-type protein directly to inhibit its activity.
Many proteins, including those participating in different steps of DNA recombination, form homomeric protein complexes (i.e. the complex is composed of a single type of protein).
If one member of the homomeric complex is inactive in the correct biochemical context, it may poison (i.e.
inhibit) the activity of the entire complex. Therefore, if an alternate-form protein, which has reduced or absent activity itself but which can still interact with endogenous wild-type protein to form complexes, is expressed in a cell it can reduce activity of the entire complex.
The cell therefore has a combination of complexes composed of the following:
a) the alternate-form protein (which may directly titrate substrate (see "1"));
b) hybrid complexes of the alternate-form protein and the endogenous wild-type protein. These complexes may have reduced or absent activity.
c) homogenous endogenous wild-type protein complexes wherein the activity level and function of the wild-type complexes is reduced because i) there is decreased number of functional form homogenous wild-type complexes because of titration of wild-type protein into the hybrid complexes composed of alternate-form and wild-type protein monomers, and ii) there is decreased function of homogenous wild-type complexes because they may interact with hybrid complexes or homogenous alternate-form complexes and/or lose the competition for substrate which is titrated by the hybrid complexes or homogenous alternate-form complexes.
To assess the effect of alternative forms of recombination proteins on meiotic homologous recombination frequency, heterologous proteins were expressed and mutant proteins engineered to have reduced or no function. To demonstrate the effect of heterologous protein expression, the DMC1 gene from Arabidopsis thaliana (AtDMC1) was expressed during meiosis in S. cerevisiae. AtDMC1 has approximately 40% similarity to ScDMC1. In alternative embodiments, heterologous expression of AtDMC1 may, therefore, function to promote homologous recombination frequency by compensating for a potentially limiting amount of endogenous ScDMC1, or it may decrease homologous recombination frequency by a dominant-negative effect, as outlined above, due to direct or indirect inhibition of endogenous ScDMC1 activity. To demonstrate the effect of altered forms of recombination proteins on meiotic homologous recombination frequency, novel forms of DMC1, and SPO1 1, and MREll were created and assessed.
a) RAD51, a RecA homologue that catalyses strand exchange between homologous DNA [52]. ATP-binding is necessary for full activity in DNA pairing and strand exchange in vitro [115-117]. ATP-binding is facilitated by protein motifs known as Walker A and Walker B boxes [118]. Mutations inhibiting ATP binding and/or hydrolysis decrease biological activity of RAD51 regarding its role in recombination-mediated repair of DNA
damage caused by radiation [96]. ScRAD51 and AtRAD51 were cloned and it was found that their protein sequences have 62% similarity and the conserved Walker A and B Box motifs. We engineered the genes to encode proteins with decreased ability for ATP-binding and hydrolysis by changing a glycine residue within the Walker A box to aspartic acid (i.e.
b) hybrid complexes of the alternate-form protein and the endogenous wild-type protein. These complexes may have reduced or absent activity.
c) homogenous endogenous wild-type protein complexes wherein the activity level and function of the wild-type complexes is reduced because i) there is decreased number of functional form homogenous wild-type complexes because of titration of wild-type protein into the hybrid complexes composed of alternate-form and wild-type protein monomers, and ii) there is decreased function of homogenous wild-type complexes because they may interact with hybrid complexes or homogenous alternate-form complexes and/or lose the competition for substrate which is titrated by the hybrid complexes or homogenous alternate-form complexes.
To assess the effect of alternative forms of recombination proteins on meiotic homologous recombination frequency, heterologous proteins were expressed and mutant proteins engineered to have reduced or no function. To demonstrate the effect of heterologous protein expression, the DMC1 gene from Arabidopsis thaliana (AtDMC1) was expressed during meiosis in S. cerevisiae. AtDMC1 has approximately 40% similarity to ScDMC1. In alternative embodiments, heterologous expression of AtDMC1 may, therefore, function to promote homologous recombination frequency by compensating for a potentially limiting amount of endogenous ScDMC1, or it may decrease homologous recombination frequency by a dominant-negative effect, as outlined above, due to direct or indirect inhibition of endogenous ScDMC1 activity. To demonstrate the effect of altered forms of recombination proteins on meiotic homologous recombination frequency, novel forms of DMC1, and SPO1 1, and MREll were created and assessed.
a) RAD51, a RecA homologue that catalyses strand exchange between homologous DNA [52]. ATP-binding is necessary for full activity in DNA pairing and strand exchange in vitro [115-117]. ATP-binding is facilitated by protein motifs known as Walker A and Walker B boxes [118]. Mutations inhibiting ATP binding and/or hydrolysis decrease biological activity of RAD51 regarding its role in recombination-mediated repair of DNA
damage caused by radiation [96]. ScRAD51 and AtRAD51 were cloned and it was found that their protein sequences have 62% similarity and the conserved Walker A and B Box motifs. We engineered the genes to encode proteins with decreased ability for ATP-binding and hydrolysis by changing a glycine residue within the Walker A box to aspartic acid (i.e.
ScRAD51: G190D; AtRAD51: G135D). The effect of these mutant protein forms on meiotic homologous recombination was then demonstrated. This glycine and other amino acid residues essential for homologous recombination activity are highly conserved amongst the RAD51-like family of proteins in eukaryotes. Other amino acids in the Walker A
and B Box motifs may be changed to affect ATP-binding.
b) DMC1, a RecA homologue that catalyses strand exchange between homologous DNA [51]. ATP-binding motifs, Walker A and B boxes, are conserved in this family of proteins [20]. Genetic analysis demonstrates that wild-type sequence in the Walker A Box is essential for wild-type activity in vivo [53]. A mutant form of DMC1, DMC1-G126D which has a similar amino acid change at a corresponding residue in the Walker A box as outlined above for RAD51, was created. ScDMC1 and AtDMC1 were cloned and it was found that their protein sequences have 40% similarity and the conserved Walker A and B
Box motifs.
The genes were engineered to encode proteins with decreased ATP-binding and hydrolysis ability by changing a glycine residue within the Walker A box to aspartic acid (i.e. ScDMC1:
G1 90D; AtDMC1: G135D). The effect of these mutant protein forms on meiotic homologous recombination was then demonstrated. Other amino acids in the Walker A and B Box motifs may be changed to affect ATP-binding. In some embodiments, identification of candidate mutations for interfering with DMC1 function may be predicted by alignment of DMC1 with RAD51 and EcRecA protein sequences. The crystal structure for EcRecA
has been determined [119;120] so protein domains responsible for intra-complex and inter-complex interactions may be determined. Therefore, through sequence alignments between DMC1 with RAD51 and EcRecA, one may predict which domains of DMC1 are involved in intra- and inter-complex interactions. These regions are highly conserved amongst DMC1 genes from many diverse species from yeast to plants and animals, including humans.
ScDMC1 was cloned and engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation G126D;
ii) ATP-induced conformational change with mutation N263Y; and, iii) monomer-monomer interactions with mutation A288T.
Combinations of these mutations were also created to evaluate any synergistic or additive effects resulting from two or more mutations in the same protein.
c) SPO1 1, a Type II topoisomerase [121] that is responsible for double-strand break formation in meiotic homologous recombination [9;121]. Type II topoisomerases have five conserved motifs which are also present in SPO1 1 proteins from low and high eukaryotic species [121]. Mutation of key amino acids in these motifs can inactivate SPO1 1. When such a mutant is present in a homozygous state, double-strand break formation is prevented [121] thereby inhibiting meiotic homologous recombination. ScSP011 and AtSP011 were cloned to demonstrate the use and application of SPO 1 1 in a dominant-negative approach to reduce meiotic homologous recombination. The two protein sequences have approximately 20% sequence similarity and possess the five characteristic Type II
topoisomerase motifs including a key tyrosine residue essential for catalytic activity [121]. Genes were engineered to encode proteins with decreased ability to generate double-strand breaks by changing the tyrosine residue in "Motif 1" (i.e. ScSP011: Y135F; AtSP011: Y103F). The effect of these mutant protein forms on meiotic homologous recombination was then demonstrated.
d) MRE11, a nuclease responsible for resection of double-strand breaks created by SPO 1 1 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
Phophoesterase motifs are conserved in this family of proteins. Biochemical analysis demonstrates mutation of key amino acids within these motifs can inactivate the nuclease activity of this protein and impair its biological activity [111;112;122].
Conserved amino acids outside of the phosphoesterase domains can also affect function of MREll [111].
AtMREll and ScMREll were cloned to demonstrate the use of MREll in a dominant-negative approach to reduce homologous recombination. AtMREll was engineered to encode a protein defective for phosphoesterase activity by changing a key amino acid residue in Motif I from aspartate to alanine (i.e. AtMRE11: Motif I:D-A).
A. Cloning and evaluation of target genes Target genes were cloned using specific oligonucleotides designed to prime DNA
synthesis in a PCR reaction with either cDNA or genomic DNA (gDNA) from the appropriate species as template. The primers were designed to incorporate convenient restriction sites into the amplicon to facilitate initial cloning of the gene and its subcloning into various expression vectors. Genes cloned and the oligo primers used to achieve this are described in TABLE 1. PCR conditions were as described [123] or as recommended by the supplier of the thermostable DNA polymerase Pfu (Stratagene) or Taq (Pharmacia). PCR
reactions were conducted using a thermocycler (Perkin-Elmer Model 9700).
1) AtDMC1 Template DNA was derived from a commercially available cDNA library of Arabidopsis thaliana ecotype Columbia in the vector lambda ZAP II
(Stratagene). The library was mass-excised following the protocol supplied by the manufacture.
The resultant phagemid suspension was concentrated by a combination of precipitation with polyethylene glycol as described by Ausubel et al. (1998) and desiccation using a Speed Vac (Savant). In this manner, the phagemid suspension was concentrated at least 5-fold. One hundred microlitres of the concentrated phagemid suspension was extracted with phenol and chloroform following standard procedures to remove protein and other contaminants from DNA with subsequent precipitation using ethanol [123]. In this manner, DNA
from approximately 2 ml of phagemid suspension was concentrated and resuspended in 20 1 of LTE ((lmM Tris-HC1 , 0.1 mM EDTA (pH 8.0)) with RNase A (20 pg/m1)).
A primary PCR reaction was performed with 1 j.il Arabidopsis cDNA library phagemid, 0.5 pmole 0L11434, 0.5 pmole OL11433, 0.2 mM dNTP's (i.e. dATP, dCTP, dGTP, dTTP; Pharmacia), 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 25 1. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30s @94 C, 45 s @60 C and 2 mm @72 C, followed by 10 min @72 C
and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 ul of the above reaction used as template with 1.0 pmol OL11434 and 1.0 pmol OL11435 and other constituents as above except using 2.5 U Pfu and a final volume of 50 1. Two independent secondary reactions were done with identical PCR conditions as above. The two reactions were pooled and DNA fragments were resolved by agarose electrophoresis using a 1% gel and following standard procedures [123]. A DNA fragment of 1 kilobase pair (kb) expected to correspond to AtDMC1 was excised and the DNA recovered from the agarose using the Qiaquick Gel Extraction Kit (Qiagen) and protocol supplied by the manufacturer.
DNA was digested with XhoI and phosphorylated with T4-polynucleotide kinase following standard procedures [123]. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with EcoRV and XhoI. The amplicon and vector DNA were purified by agarose electrophoresis and recovered as above. Amplicon and vector DNA were then mixed in the presence of T4 DNA ligase (Gibco-BRL) to covalently link the two molecules following standard procedures [123] in a final volume of 25 1. After 2 h at room temperature, 1 p.1 of glycogen (20 mg/ml) was added to the ligation mixture made up to 100 IA with distilled water. After precipitation with ethanol [123], the DNA was resuspended in 4 pl of distilled water. E. coli strain DH5alpha (Gibco-BRL) was transformed with 2.5 p.1 of the concentrated ligation following standard procedures [123] and plated on sterile TYS medium (per litre distilled water: 10 g Tryptone (Difco); 5 g yeast extract (Difco); 5 g NaC1 (Sigma); 15 g agar (Sigma)) containing ampicillin (100 pg/m1). Putative clones were propagated in liquid TYS
(i.e. without agar) and ampicillin (100 jig/ml). Plasmid DNA was isolated by standard alkaline-lysis "mini-prep" procedure [123]. The DNA sequence of the resultant clone, pKR225, was determined at a commercial sequencing facility (Plant Biotechnology Institute, Saskatoon, Canada). Cloning of all other genes in this invention followed the same principles as for pKR225 with noted exceptions.
2) AtSPOli A primary PCR reaction was performed with 2 1 Arabidopsis cDNA library phagemid (isolated as described for cloning of AtDMC1), 0.5 pmole AtSP011-5'Sma oligo, 0.5 pmole AtSP011-3'X oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 25 pl. The PCR
conditions were 5 min @ 94 C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 60 C and 2.5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 pi of the above reaction used as template with 1.0 pmol AtSP011-5'Sma oligo and 1.0 pmol AtSP011-3'PstNot oligo and other constituents as per the primary PCR
reaction except using 2.5 U Pfu and a final volume of 50 4 Two independent secondary reactions were done with identical PCR conditions as above except replacing the step at 60 C
with 63 C. The two reactions were pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript II SK- (Stratagene) was digested with EcoRV and PstI. DNA
fragments of interest corresponding to AtSP011 (-1.1 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above.
The fragments were ligated together, transformed into E. coil and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pTK82, was determined to confirm it encoded AtSP011.
3. AtRAD51 Template for use in amplifying AtRAD51 was obtained from cDNA generated from RNA isolated from A. thaliana ecotype Columbia total plant tissues treated with gamma radiation. Plants were grown in sterile culture as follows. Seeds of A.
thaliana ec. Columbia were surface sterilized by first rinsing in 70% (v/v) ethanol for one minute followed by washing for 5-7 min with a solution of 50% (v/v) bleach, 0.05% (w/v) Tween 20 (Sigma).
After rinsing three times with sterile distilled water, the seeds were resuspended in 0.1%
(w/v) agarose. Seeds were then dispensed in a grid pattern (-30 seeds/plate) with 1-2 cm spacing on sterile growth medium (0.5X Mirashige and Skoog basal salt media (Sigma) containing 1% (w/v) sucrose, nicotinic acid (1 pg/m1), thiamine-HC1 (10 g/ml), pyridoxine-HC1 (1 p.g/m1), myo-inositiol (100 g/m1) and solidified with 1.0% (w/v) agar in 100 mm x 15 mm or 150 mm x 15 mm petri plates (Fisher). The plates were then placed at 4 C for 48 h and transferred to a controlled environment chamber with temperature of 18-22 C and a light regime of 16 h light and 8 h dark. After approximately 3 weeks plants were treated with gamma radiation using a Gamma-Cell 40 irradiator with a Co6 radiation source.
Plates containing plants were placed in the irradiator and left for time periods corresponding to desired dosages estimated from the calibrated emission from the radiation source and accounting for decay over time. Plant tissues were collected after 5-10 min recovery time and rapidly frozen using liquid N2. For RNA extraction, plant tissues were first ground to a fine powder in the presence of liquid N2 using a mortar and pestle, and then RNA was isolated using the Rneasy Plant Kit (Qiagen) following the instructions provided by the manufacturer. cDNA was prepared from total RNA extracted from the plants exposed to 20 or 40 krad of gamma radiation using a SuperScript Preamplification System for First Strand cDNA Synthesis following directions of the manufacturer (GIBCO-BRL). First strand cDNA
from 5-10 lig total RNA from plants treated with 20 or 40 krad of gamma radiation was primed using oligo-dT supplied with the kit.
A primary PCR reaction was performed with 4 1 first-strand cDNA from either the had or 40 had treated plants, 0.5 pmole AtRAD51-5'Bam oligo, 0.5 pmole AtRAD51-20 3'X oligo, 0.2 mM dNTP's, 2.5 U Taq (Pharmacia) and Taq buffer constituents recommended by the manufacturer in a volume of 251.11. The PCR conditions were 5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 75 s @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. Two secondary PCR reactions were then performed for each of the above reactions using either 5 or 10 p.1 of the primary reactions in separate reactions as template with 1.0 pmole AtRAD51-5'Bam oligo and 1.0 pmole AtRAD51-3'Pst oligo and other constituents as above except using 5 U Taq and a final volume of 50 pl. Two independent secondary reactions were done for each template sample with identical PCR
conditions as above. The two respective reaction series were pooled and DNA
fragments were digested with BamHI and PstI. The plasmid cloning vector pBluescript II
KS-(Stratagene) was digested with BamHI and PstI. DNA fragments of interest corresponding to AtRAD51 (-1.2kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. Two clones were selected: pRH2 and pRH7 derived from cDNA from plants treated with 20 or 40 krad of gamma radiation, respectively. Determination of the DNA sequence of these clones revealed both had mutations at different positions of the open reading frame.
To resynthesize a gene encoding a wild-type AtRAD51, restriction fragments from pRH2 and pRH7 were combined as follows: pRH2 was digested with XbaI and BamHI and a ¨400 bp fragment was purified; pRH7 was digested with PstI and XbaI and a ¨770bp fragment was purified; both fragments were combined and ligated into pBluescript II KS- (Stratagene) digested with BamHI and PstI. The resulting clone, pRH15, was sequenced and found to encode a wild-type AtRAD51.
3. AtMREll Using the first 1000 bp of hMREll cDNA sequence [124] to query public DNA
sequence databanks with the BLAST search algorithm [125], an Arabidopsis genomic sequence (ACCESSION #AB010695) was identified with some sequence homology.
Based on this genomic DNA sequence, oligonucleotide primers were designed to amplify a ¨450 bp fragment that would encode the ¨250 bp of the 5' region of the putative AtMREll coding sequence and ¨200 bp of a potential intron sequence. The ¨450 bp fragment was amplified by PCR using genomic DNA from A. thaliana ec. Columbia which was isolated following the method of Junghans and Mezlaff (1990) [126]. Plants from which DNA was isolated were first grown at 18-22 C with 16 h light and 8 h dark for 3-4 wk. Aerial tissues were collected and rapidly frozen with liquid N2 before storage at ¨80 C until processing.
For PCR a primary reaction included 1.2 g of genomic DNA, 0.5 pmole 0L12414 oligo, 0.5 pmole 0L12413 oligo, 0.2 mM dNTP's, 1.25 U Tag (Pharmacia) and Taq buffer constituents recommended by the manufacturer in a volume of 25 1. The PCR conditions were 5 min @
94 C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 58 C and 1.0 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 .1 of the above reaction used as template with 1.0 pmol 0L12414 oligo and 1.0 pmol 0L12415 oligo and other constituents as per the primary PCR reaction except using 2.5 U Taq and a final volume of 50 1. Two independent secondary reactions were done with identical PCR
conditions as above. The 450 bp fragment was purified by agarose gel electrophoresis and recovered from the gel as described above. Approximately 100 ng of this DNA
fragment was labeled with alpha-32P-dCTP by random priming as per standard procedure [123].
A cDNA
library of A. thaliana ec. Columbia obtained from a commercial supplier (Stratagene) was plated on 150 mm x 15 mm petri plates (Fisher) at a plaque density approaching confluence, following directions of the manufacturer. Plaque lifts from six such plates were performed using Hybond-N membranes (Amersham) following directions of the supplier.
Membranes were probed with the radiolabelled 450 bp fragment following the method of Church and Gilbert (1984), with ¨1x106 cpm of probe per millilitre of hybridization solution.
Hybridization was performed overnight at 60 C using a rotisserie incubator (Robbins Scientific). Non-specific binding of the probe was reduced by washing membranes following standard procedures [123] with two 10 min washes at 22 C with 60-80 ml of 4.73xS SC, 0.1%
(w/v) SDS, followed by two 30 mm washes at 50 C with 60-80 ml of the same solution prewarmed to 50 C. Filters were then transferred to a solid support, wrapped in plastic film and placed in an X-ray cassette. After overnight exposure at ¨80 C, the film was developed and twelve putative clones (C1-C12) were identified which hybridized to the 450 bp fragment. These clones were purified from contaminating phage following standard procedures [123] and using the 450 bp fragment as probe with identical conditions as above.
One clone, phi-C7A, was characterized further. The insert was isolated by conversion to plasmid vector following directions of the manufacturer (Stratagene) resulting in pKR242.
pKR242 was sequenced using primers flanking the multiple cloning site of the vector, as suggested by the manufacturer (Stratagene), and 0L12779 and 0L12780 (Table 1).
The entire sequence of pKR242 was determined and shown to encode an homologue MREll genes from other species. The cDNA, encoding the coding region of the gene was compared to the genomic sequence in the public database (ACCESSION #AB010695) which disclosed that the gene contains twenty introns. Comparison of predicted amino acid sequence encoded by pKR242 with other MREll protein sequences illustrated it was not full-length.
Comparison of genomic DNA sequence to genes from other species enabled prediction of a putative start codon for AtMRE11. To clone the 5' portion of AtMREll not present in pKR242 PCR was employed. First-strand cDNA was synthesized from total RNA
isolated from A. thaliana ec. Columbia treated with 30 bad of gamma radiation as described above. A
primary PCR reaction was performed with 2 1 first-strand cDNA, 0.5 pmole oligo, 0.5 pmole OL12413 oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 25 1. The PCR
conditions were 5 min @94 C, followed by 25 cycles of 30 s @94 C, 30s @5 C and 60s @72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. Two secondary PCR
reactions were then performed using 2 pi of the primary reaction as template with 1.0 pmole 0L12414 oligo =
and 1.0 pmole 01 12415 oligo and other constituents as above except using 2.5 U Pfu and a final volume of 50 pl. The two reactions were pooled and DNA was digested with EcoRI
and XbaI. The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with EcoRI and XbaI. DNA fragments of interest corresponding to the 5' end of AtMREll (-225 bp) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the DNA fragment identified as described above. One clone, pRH1 was sequenced to confirm it encodes the 5' end of AtMRE11. To resynthesize a gene encoding a full-length AtMRE11, restriction fragments from pRH1 and pKR242 were combined as follows: pRH1 was digested with HindIII and XbaI and a ¨225 bp fragment was purified; pKR242 was digested with XbaI and XhoI and a ¨2. kb fragment was purified; both fragments were combined and ligated into pSPORT2 (Gibco-BRL) digested with HindIII and Sall. The resulting clone, pNH2 was sequenced and found to encode a wild-type AtMRE11.
Comparison of the conceptual protein encoded by the cloned AtMREll gene to other MREll proteins from other organisms confirms it is a homologue of this family of proteins.
The conservation extends to phophoesterase motifs which have been determined to be essential for the function of this family of proteins [111;112;122]. Alternate forms of AtMRE11 may be engineered to confer a dominant-negative effect as described above for other proteins. For example, the phosphesterase motifs responsible for nuclease activity are highly conserved within the MREll family. Mutations of different amino acids within these motifs may inactivate MREll function [111;112;122]. Mutations outside of these motifs may also suppress function of the protein [111].
6. ScDMC1 a) genomic clone ScDMC1 gene in yeast contains a single intron which may be excised in a meiosis-specific manner [20]. Template for amplifying ScDMC1 was genomic DNA from Saccharomyces cerevisiae strain RK1308 [128] isolated by standard procedure [123]. Two PCR reactions were performed with approximately 1 p,g of genomic DNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 pl.
The PCR
conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 2 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with SmaI and PstI. DNA fragments of interest corresponding to ScDMC1 (-1.1 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pMW13, was determined to confirm it encoded ScDMC1-genomic.
b) cDNA clone Template for use in amplifying ScDMC1-cDNA was obtained from cDNA generated from RNA isolated from S. cerevisiae cells undergoing meiosis. Strain RK1308 [128]was grown in YPD liquid medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose) to cell density of ¨2x107 cells/ml at 30 C with shaking at 225 RPM. Cells were collected by centrifugation, washed and resuspended in SPM medium ( 0.3% (w/v) potassium acetate, 0.02% (w/v) raffinose, 5 m/mluracil, 5 1-1,g/m1 histidine, 25 g/ml leucine) then cultured as above for 2.5 h. Cells from 10 ml of culture were collected by centrifugation, washed with sterile distilled water (SDW) and resuspended in 1 ml SDW before rapid freezing in a dry-ice/ methanol bath and stored at ¨80 C. Total RNA was extracted from these cells following a standard protocol [123]. Approximately 41.ig of RNA was used to create cDNA
primed with oligo-dT using the Superscript Preampification System for First Strand cDNA Synthesis (Gibco/BRL) following directions of the manufacturer. Two PCR reactions were performed with 3 !al of first strand cDNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 Ti Pfu (Stratagene) and Pfu buffer constituents provided by the manufacturer in a volume of 50 pl. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30s @94 C, 30s @55 C and 2 min @72 C, followed by 10 min @72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with PstI.
The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with SmaI and PstI.
DNA fragments of interest corresponding to ScDMC1-cDNA (-1.1 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pMW19, was determined to confirm it encoded ScDMC1-cDNA.
7. ScRAD51 Template for amplifying ScRAD51 was genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were performed with approximately 1 lAg of genomic DNA, 1.0 pmol yR51-5'Bam oligo and 1.0 pmol yR51-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents provided by the manufacturer in a volume of 50 p1. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 58 C and 2.5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with BamHI and PstI. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with BamHI and PstI. DNA fragments of interest corresponding to ScRAD51 (-1.2 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA
sequence of the resultant clone, pMW35, was determined to confirm it encoded ScRAD51.
8. ScRAD52 Template for amplifying ScRAD52 was genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were performed with approximately 1 jig of genomic DNA, 1.0 pmol yR52-5'Pme oligo and 1.0 pmol yR52-3'Not oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 1. The PCR conditions were 5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 60 C and 2 mM @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA
was digested with EcoRI and NotI. The plasmid cloning vector pBluescript II SK-(Stratagene) was digested with EcoRI and NotI. DNA fragments of interest corresponding to ScRAD52 (-1.5 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA
sequence of the resultant clone, pTK50, was determined to confirm it encoded ScRAD52.
9. ScRAD54 Template for amplifying ScRAD54 was genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were performed with approximately 1 1.ig of genomic DNA, 1.0 pmol yR54-5'RI oligo and 1.0 pmol yR54-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 1. The PCR conditions were 5 mM @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 60 C and 5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA
was digested with PstI. The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with SmaI and PstI. DNA fragments of interest corresponding to ScRAD54 (-2.7 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coil and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pMW34, was determined to confirm it encoded ScRAD54.
10. ScSPO1 1 Template for amplifying ScSPO1 lwas genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR reactions were performed with approximately 1 g of genomic DNA, 1.0 pmol ySPO-5'Bam oligo and 1.0 pmol ySPO -3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 1. The PCR conditions were 5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 63 C and 2.5 min @ 72 C, followed by 10 mM @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with BamHI and PstI. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with BamHI and PstI. DNA fragments of interest corresponding to ScSP011 (-1.2 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA
sequence of the resultant clone, pTK81, was determined to confirm it encoded ScSP011.
11. EcSSB
Template for amplifying SSB was genomic DNA from E. coil strain CC106 [130].
Genomic DNA from the strain was isolated as follows: 1) cells were cultured to mid-log phase in TYS liquid medium at 37 C; 2) cells were pelleted by centrifugation and washed with sterile distilled water; 3) 20 ml of cell culture was centrifuged and the cell pellet resuspended in 0.5 ml TE/Tween buffer (10 mM Tris-HC1 (pH 8.0), 1 mM EDTA, 0.01%
(w/v) Tween 20); 4) cells were incubated at 85 C for 20-30 mM and then pelleted by microcentrifugation for 5-10 min; 5) the supernatant was collected and 50 p1 of TE-RNase (RNase A 20 g/ml) was added before incubation at room temperature for 30 min;
6) the supernatant was extracted with phenol and chloroform and precipitated with ethanol as per standard procedure [123]. 7) the DNA was resuspended in 20 1 of LTE (TE
diluted 1:10 with distilled water).
and B Box motifs may be changed to affect ATP-binding.
b) DMC1, a RecA homologue that catalyses strand exchange between homologous DNA [51]. ATP-binding motifs, Walker A and B boxes, are conserved in this family of proteins [20]. Genetic analysis demonstrates that wild-type sequence in the Walker A Box is essential for wild-type activity in vivo [53]. A mutant form of DMC1, DMC1-G126D which has a similar amino acid change at a corresponding residue in the Walker A box as outlined above for RAD51, was created. ScDMC1 and AtDMC1 were cloned and it was found that their protein sequences have 40% similarity and the conserved Walker A and B
Box motifs.
The genes were engineered to encode proteins with decreased ATP-binding and hydrolysis ability by changing a glycine residue within the Walker A box to aspartic acid (i.e. ScDMC1:
G1 90D; AtDMC1: G135D). The effect of these mutant protein forms on meiotic homologous recombination was then demonstrated. Other amino acids in the Walker A and B Box motifs may be changed to affect ATP-binding. In some embodiments, identification of candidate mutations for interfering with DMC1 function may be predicted by alignment of DMC1 with RAD51 and EcRecA protein sequences. The crystal structure for EcRecA
has been determined [119;120] so protein domains responsible for intra-complex and inter-complex interactions may be determined. Therefore, through sequence alignments between DMC1 with RAD51 and EcRecA, one may predict which domains of DMC1 are involved in intra- and inter-complex interactions. These regions are highly conserved amongst DMC1 genes from many diverse species from yeast to plants and animals, including humans.
ScDMC1 was cloned and engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation G126D;
ii) ATP-induced conformational change with mutation N263Y; and, iii) monomer-monomer interactions with mutation A288T.
Combinations of these mutations were also created to evaluate any synergistic or additive effects resulting from two or more mutations in the same protein.
c) SPO1 1, a Type II topoisomerase [121] that is responsible for double-strand break formation in meiotic homologous recombination [9;121]. Type II topoisomerases have five conserved motifs which are also present in SPO1 1 proteins from low and high eukaryotic species [121]. Mutation of key amino acids in these motifs can inactivate SPO1 1. When such a mutant is present in a homozygous state, double-strand break formation is prevented [121] thereby inhibiting meiotic homologous recombination. ScSP011 and AtSP011 were cloned to demonstrate the use and application of SPO 1 1 in a dominant-negative approach to reduce meiotic homologous recombination. The two protein sequences have approximately 20% sequence similarity and possess the five characteristic Type II
topoisomerase motifs including a key tyrosine residue essential for catalytic activity [121]. Genes were engineered to encode proteins with decreased ability to generate double-strand breaks by changing the tyrosine residue in "Motif 1" (i.e. ScSP011: Y135F; AtSP011: Y103F). The effect of these mutant protein forms on meiotic homologous recombination was then demonstrated.
d) MRE11, a nuclease responsible for resection of double-strand breaks created by SPO 1 1 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
Phophoesterase motifs are conserved in this family of proteins. Biochemical analysis demonstrates mutation of key amino acids within these motifs can inactivate the nuclease activity of this protein and impair its biological activity [111;112;122].
Conserved amino acids outside of the phosphoesterase domains can also affect function of MREll [111].
AtMREll and ScMREll were cloned to demonstrate the use of MREll in a dominant-negative approach to reduce homologous recombination. AtMREll was engineered to encode a protein defective for phosphoesterase activity by changing a key amino acid residue in Motif I from aspartate to alanine (i.e. AtMRE11: Motif I:D-A).
A. Cloning and evaluation of target genes Target genes were cloned using specific oligonucleotides designed to prime DNA
synthesis in a PCR reaction with either cDNA or genomic DNA (gDNA) from the appropriate species as template. The primers were designed to incorporate convenient restriction sites into the amplicon to facilitate initial cloning of the gene and its subcloning into various expression vectors. Genes cloned and the oligo primers used to achieve this are described in TABLE 1. PCR conditions were as described [123] or as recommended by the supplier of the thermostable DNA polymerase Pfu (Stratagene) or Taq (Pharmacia). PCR
reactions were conducted using a thermocycler (Perkin-Elmer Model 9700).
1) AtDMC1 Template DNA was derived from a commercially available cDNA library of Arabidopsis thaliana ecotype Columbia in the vector lambda ZAP II
(Stratagene). The library was mass-excised following the protocol supplied by the manufacture.
The resultant phagemid suspension was concentrated by a combination of precipitation with polyethylene glycol as described by Ausubel et al. (1998) and desiccation using a Speed Vac (Savant). In this manner, the phagemid suspension was concentrated at least 5-fold. One hundred microlitres of the concentrated phagemid suspension was extracted with phenol and chloroform following standard procedures to remove protein and other contaminants from DNA with subsequent precipitation using ethanol [123]. In this manner, DNA
from approximately 2 ml of phagemid suspension was concentrated and resuspended in 20 1 of LTE ((lmM Tris-HC1 , 0.1 mM EDTA (pH 8.0)) with RNase A (20 pg/m1)).
A primary PCR reaction was performed with 1 j.il Arabidopsis cDNA library phagemid, 0.5 pmole 0L11434, 0.5 pmole OL11433, 0.2 mM dNTP's (i.e. dATP, dCTP, dGTP, dTTP; Pharmacia), 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 25 1. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30s @94 C, 45 s @60 C and 2 mm @72 C, followed by 10 min @72 C
and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 ul of the above reaction used as template with 1.0 pmol OL11434 and 1.0 pmol OL11435 and other constituents as above except using 2.5 U Pfu and a final volume of 50 1. Two independent secondary reactions were done with identical PCR conditions as above. The two reactions were pooled and DNA fragments were resolved by agarose electrophoresis using a 1% gel and following standard procedures [123]. A DNA fragment of 1 kilobase pair (kb) expected to correspond to AtDMC1 was excised and the DNA recovered from the agarose using the Qiaquick Gel Extraction Kit (Qiagen) and protocol supplied by the manufacturer.
DNA was digested with XhoI and phosphorylated with T4-polynucleotide kinase following standard procedures [123]. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with EcoRV and XhoI. The amplicon and vector DNA were purified by agarose electrophoresis and recovered as above. Amplicon and vector DNA were then mixed in the presence of T4 DNA ligase (Gibco-BRL) to covalently link the two molecules following standard procedures [123] in a final volume of 25 1. After 2 h at room temperature, 1 p.1 of glycogen (20 mg/ml) was added to the ligation mixture made up to 100 IA with distilled water. After precipitation with ethanol [123], the DNA was resuspended in 4 pl of distilled water. E. coli strain DH5alpha (Gibco-BRL) was transformed with 2.5 p.1 of the concentrated ligation following standard procedures [123] and plated on sterile TYS medium (per litre distilled water: 10 g Tryptone (Difco); 5 g yeast extract (Difco); 5 g NaC1 (Sigma); 15 g agar (Sigma)) containing ampicillin (100 pg/m1). Putative clones were propagated in liquid TYS
(i.e. without agar) and ampicillin (100 jig/ml). Plasmid DNA was isolated by standard alkaline-lysis "mini-prep" procedure [123]. The DNA sequence of the resultant clone, pKR225, was determined at a commercial sequencing facility (Plant Biotechnology Institute, Saskatoon, Canada). Cloning of all other genes in this invention followed the same principles as for pKR225 with noted exceptions.
2) AtSPOli A primary PCR reaction was performed with 2 1 Arabidopsis cDNA library phagemid (isolated as described for cloning of AtDMC1), 0.5 pmole AtSP011-5'Sma oligo, 0.5 pmole AtSP011-3'X oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 25 pl. The PCR
conditions were 5 min @ 94 C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 60 C and 2.5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 pi of the above reaction used as template with 1.0 pmol AtSP011-5'Sma oligo and 1.0 pmol AtSP011-3'PstNot oligo and other constituents as per the primary PCR
reaction except using 2.5 U Pfu and a final volume of 50 4 Two independent secondary reactions were done with identical PCR conditions as above except replacing the step at 60 C
with 63 C. The two reactions were pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript II SK- (Stratagene) was digested with EcoRV and PstI. DNA
fragments of interest corresponding to AtSP011 (-1.1 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above.
The fragments were ligated together, transformed into E. coil and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pTK82, was determined to confirm it encoded AtSP011.
3. AtRAD51 Template for use in amplifying AtRAD51 was obtained from cDNA generated from RNA isolated from A. thaliana ecotype Columbia total plant tissues treated with gamma radiation. Plants were grown in sterile culture as follows. Seeds of A.
thaliana ec. Columbia were surface sterilized by first rinsing in 70% (v/v) ethanol for one minute followed by washing for 5-7 min with a solution of 50% (v/v) bleach, 0.05% (w/v) Tween 20 (Sigma).
After rinsing three times with sterile distilled water, the seeds were resuspended in 0.1%
(w/v) agarose. Seeds were then dispensed in a grid pattern (-30 seeds/plate) with 1-2 cm spacing on sterile growth medium (0.5X Mirashige and Skoog basal salt media (Sigma) containing 1% (w/v) sucrose, nicotinic acid (1 pg/m1), thiamine-HC1 (10 g/ml), pyridoxine-HC1 (1 p.g/m1), myo-inositiol (100 g/m1) and solidified with 1.0% (w/v) agar in 100 mm x 15 mm or 150 mm x 15 mm petri plates (Fisher). The plates were then placed at 4 C for 48 h and transferred to a controlled environment chamber with temperature of 18-22 C and a light regime of 16 h light and 8 h dark. After approximately 3 weeks plants were treated with gamma radiation using a Gamma-Cell 40 irradiator with a Co6 radiation source.
Plates containing plants were placed in the irradiator and left for time periods corresponding to desired dosages estimated from the calibrated emission from the radiation source and accounting for decay over time. Plant tissues were collected after 5-10 min recovery time and rapidly frozen using liquid N2. For RNA extraction, plant tissues were first ground to a fine powder in the presence of liquid N2 using a mortar and pestle, and then RNA was isolated using the Rneasy Plant Kit (Qiagen) following the instructions provided by the manufacturer. cDNA was prepared from total RNA extracted from the plants exposed to 20 or 40 krad of gamma radiation using a SuperScript Preamplification System for First Strand cDNA Synthesis following directions of the manufacturer (GIBCO-BRL). First strand cDNA
from 5-10 lig total RNA from plants treated with 20 or 40 krad of gamma radiation was primed using oligo-dT supplied with the kit.
A primary PCR reaction was performed with 4 1 first-strand cDNA from either the had or 40 had treated plants, 0.5 pmole AtRAD51-5'Bam oligo, 0.5 pmole AtRAD51-20 3'X oligo, 0.2 mM dNTP's, 2.5 U Taq (Pharmacia) and Taq buffer constituents recommended by the manufacturer in a volume of 251.11. The PCR conditions were 5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 75 s @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. Two secondary PCR reactions were then performed for each of the above reactions using either 5 or 10 p.1 of the primary reactions in separate reactions as template with 1.0 pmole AtRAD51-5'Bam oligo and 1.0 pmole AtRAD51-3'Pst oligo and other constituents as above except using 5 U Taq and a final volume of 50 pl. Two independent secondary reactions were done for each template sample with identical PCR
conditions as above. The two respective reaction series were pooled and DNA
fragments were digested with BamHI and PstI. The plasmid cloning vector pBluescript II
KS-(Stratagene) was digested with BamHI and PstI. DNA fragments of interest corresponding to AtRAD51 (-1.2kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. Two clones were selected: pRH2 and pRH7 derived from cDNA from plants treated with 20 or 40 krad of gamma radiation, respectively. Determination of the DNA sequence of these clones revealed both had mutations at different positions of the open reading frame.
To resynthesize a gene encoding a wild-type AtRAD51, restriction fragments from pRH2 and pRH7 were combined as follows: pRH2 was digested with XbaI and BamHI and a ¨400 bp fragment was purified; pRH7 was digested with PstI and XbaI and a ¨770bp fragment was purified; both fragments were combined and ligated into pBluescript II KS- (Stratagene) digested with BamHI and PstI. The resulting clone, pRH15, was sequenced and found to encode a wild-type AtRAD51.
3. AtMREll Using the first 1000 bp of hMREll cDNA sequence [124] to query public DNA
sequence databanks with the BLAST search algorithm [125], an Arabidopsis genomic sequence (ACCESSION #AB010695) was identified with some sequence homology.
Based on this genomic DNA sequence, oligonucleotide primers were designed to amplify a ¨450 bp fragment that would encode the ¨250 bp of the 5' region of the putative AtMREll coding sequence and ¨200 bp of a potential intron sequence. The ¨450 bp fragment was amplified by PCR using genomic DNA from A. thaliana ec. Columbia which was isolated following the method of Junghans and Mezlaff (1990) [126]. Plants from which DNA was isolated were first grown at 18-22 C with 16 h light and 8 h dark for 3-4 wk. Aerial tissues were collected and rapidly frozen with liquid N2 before storage at ¨80 C until processing.
For PCR a primary reaction included 1.2 g of genomic DNA, 0.5 pmole 0L12414 oligo, 0.5 pmole 0L12413 oligo, 0.2 mM dNTP's, 1.25 U Tag (Pharmacia) and Taq buffer constituents recommended by the manufacturer in a volume of 25 1. The PCR conditions were 5 min @
94 C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 58 C and 1.0 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 .1 of the above reaction used as template with 1.0 pmol 0L12414 oligo and 1.0 pmol 0L12415 oligo and other constituents as per the primary PCR reaction except using 2.5 U Taq and a final volume of 50 1. Two independent secondary reactions were done with identical PCR
conditions as above. The 450 bp fragment was purified by agarose gel electrophoresis and recovered from the gel as described above. Approximately 100 ng of this DNA
fragment was labeled with alpha-32P-dCTP by random priming as per standard procedure [123].
A cDNA
library of A. thaliana ec. Columbia obtained from a commercial supplier (Stratagene) was plated on 150 mm x 15 mm petri plates (Fisher) at a plaque density approaching confluence, following directions of the manufacturer. Plaque lifts from six such plates were performed using Hybond-N membranes (Amersham) following directions of the supplier.
Membranes were probed with the radiolabelled 450 bp fragment following the method of Church and Gilbert (1984), with ¨1x106 cpm of probe per millilitre of hybridization solution.
Hybridization was performed overnight at 60 C using a rotisserie incubator (Robbins Scientific). Non-specific binding of the probe was reduced by washing membranes following standard procedures [123] with two 10 min washes at 22 C with 60-80 ml of 4.73xS SC, 0.1%
(w/v) SDS, followed by two 30 mm washes at 50 C with 60-80 ml of the same solution prewarmed to 50 C. Filters were then transferred to a solid support, wrapped in plastic film and placed in an X-ray cassette. After overnight exposure at ¨80 C, the film was developed and twelve putative clones (C1-C12) were identified which hybridized to the 450 bp fragment. These clones were purified from contaminating phage following standard procedures [123] and using the 450 bp fragment as probe with identical conditions as above.
One clone, phi-C7A, was characterized further. The insert was isolated by conversion to plasmid vector following directions of the manufacturer (Stratagene) resulting in pKR242.
pKR242 was sequenced using primers flanking the multiple cloning site of the vector, as suggested by the manufacturer (Stratagene), and 0L12779 and 0L12780 (Table 1).
The entire sequence of pKR242 was determined and shown to encode an homologue MREll genes from other species. The cDNA, encoding the coding region of the gene was compared to the genomic sequence in the public database (ACCESSION #AB010695) which disclosed that the gene contains twenty introns. Comparison of predicted amino acid sequence encoded by pKR242 with other MREll protein sequences illustrated it was not full-length.
Comparison of genomic DNA sequence to genes from other species enabled prediction of a putative start codon for AtMRE11. To clone the 5' portion of AtMREll not present in pKR242 PCR was employed. First-strand cDNA was synthesized from total RNA
isolated from A. thaliana ec. Columbia treated with 30 bad of gamma radiation as described above. A
primary PCR reaction was performed with 2 1 first-strand cDNA, 0.5 pmole oligo, 0.5 pmole OL12413 oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 25 1. The PCR
conditions were 5 min @94 C, followed by 25 cycles of 30 s @94 C, 30s @5 C and 60s @72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. Two secondary PCR
reactions were then performed using 2 pi of the primary reaction as template with 1.0 pmole 0L12414 oligo =
and 1.0 pmole 01 12415 oligo and other constituents as above except using 2.5 U Pfu and a final volume of 50 pl. The two reactions were pooled and DNA was digested with EcoRI
and XbaI. The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with EcoRI and XbaI. DNA fragments of interest corresponding to the 5' end of AtMREll (-225 bp) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the DNA fragment identified as described above. One clone, pRH1 was sequenced to confirm it encodes the 5' end of AtMRE11. To resynthesize a gene encoding a full-length AtMRE11, restriction fragments from pRH1 and pKR242 were combined as follows: pRH1 was digested with HindIII and XbaI and a ¨225 bp fragment was purified; pKR242 was digested with XbaI and XhoI and a ¨2. kb fragment was purified; both fragments were combined and ligated into pSPORT2 (Gibco-BRL) digested with HindIII and Sall. The resulting clone, pNH2 was sequenced and found to encode a wild-type AtMRE11.
Comparison of the conceptual protein encoded by the cloned AtMREll gene to other MREll proteins from other organisms confirms it is a homologue of this family of proteins.
The conservation extends to phophoesterase motifs which have been determined to be essential for the function of this family of proteins [111;112;122]. Alternate forms of AtMRE11 may be engineered to confer a dominant-negative effect as described above for other proteins. For example, the phosphesterase motifs responsible for nuclease activity are highly conserved within the MREll family. Mutations of different amino acids within these motifs may inactivate MREll function [111;112;122]. Mutations outside of these motifs may also suppress function of the protein [111].
6. ScDMC1 a) genomic clone ScDMC1 gene in yeast contains a single intron which may be excised in a meiosis-specific manner [20]. Template for amplifying ScDMC1 was genomic DNA from Saccharomyces cerevisiae strain RK1308 [128] isolated by standard procedure [123]. Two PCR reactions were performed with approximately 1 p,g of genomic DNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 pl.
The PCR
conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 2 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with SmaI and PstI. DNA fragments of interest corresponding to ScDMC1 (-1.1 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pMW13, was determined to confirm it encoded ScDMC1-genomic.
b) cDNA clone Template for use in amplifying ScDMC1-cDNA was obtained from cDNA generated from RNA isolated from S. cerevisiae cells undergoing meiosis. Strain RK1308 [128]was grown in YPD liquid medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose) to cell density of ¨2x107 cells/ml at 30 C with shaking at 225 RPM. Cells were collected by centrifugation, washed and resuspended in SPM medium ( 0.3% (w/v) potassium acetate, 0.02% (w/v) raffinose, 5 m/mluracil, 5 1-1,g/m1 histidine, 25 g/ml leucine) then cultured as above for 2.5 h. Cells from 10 ml of culture were collected by centrifugation, washed with sterile distilled water (SDW) and resuspended in 1 ml SDW before rapid freezing in a dry-ice/ methanol bath and stored at ¨80 C. Total RNA was extracted from these cells following a standard protocol [123]. Approximately 41.ig of RNA was used to create cDNA
primed with oligo-dT using the Superscript Preampification System for First Strand cDNA Synthesis (Gibco/BRL) following directions of the manufacturer. Two PCR reactions were performed with 3 !al of first strand cDNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 Ti Pfu (Stratagene) and Pfu buffer constituents provided by the manufacturer in a volume of 50 pl. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30s @94 C, 30s @55 C and 2 min @72 C, followed by 10 min @72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with PstI.
The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with SmaI and PstI.
DNA fragments of interest corresponding to ScDMC1-cDNA (-1.1 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pMW19, was determined to confirm it encoded ScDMC1-cDNA.
7. ScRAD51 Template for amplifying ScRAD51 was genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were performed with approximately 1 lAg of genomic DNA, 1.0 pmol yR51-5'Bam oligo and 1.0 pmol yR51-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents provided by the manufacturer in a volume of 50 p1. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 58 C and 2.5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with BamHI and PstI. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with BamHI and PstI. DNA fragments of interest corresponding to ScRAD51 (-1.2 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA
sequence of the resultant clone, pMW35, was determined to confirm it encoded ScRAD51.
8. ScRAD52 Template for amplifying ScRAD52 was genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were performed with approximately 1 jig of genomic DNA, 1.0 pmol yR52-5'Pme oligo and 1.0 pmol yR52-3'Not oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 1. The PCR conditions were 5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 60 C and 2 mM @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA
was digested with EcoRI and NotI. The plasmid cloning vector pBluescript II SK-(Stratagene) was digested with EcoRI and NotI. DNA fragments of interest corresponding to ScRAD52 (-1.5 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA
sequence of the resultant clone, pTK50, was determined to confirm it encoded ScRAD52.
9. ScRAD54 Template for amplifying ScRAD54 was genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were performed with approximately 1 1.ig of genomic DNA, 1.0 pmol yR54-5'RI oligo and 1.0 pmol yR54-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 1. The PCR conditions were 5 mM @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 60 C and 5 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA
was digested with PstI. The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with SmaI and PstI. DNA fragments of interest corresponding to ScRAD54 (-2.7 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coil and putative clones of the gene identified as described above. The DNA sequence of the resultant clone, pMW34, was determined to confirm it encoded ScRAD54.
10. ScSPO1 1 Template for amplifying ScSPO1 lwas genomic DNA from Saccharomyces cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR reactions were performed with approximately 1 g of genomic DNA, 1.0 pmol ySPO-5'Bam oligo and 1.0 pmol ySPO -3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 1. The PCR conditions were 5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 63 C and 2.5 min @ 72 C, followed by 10 mM @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested with BamHI and PstI. The plasmid cloning vector pBluescript II KS-(Stratagene) was digested with BamHI and PstI. DNA fragments of interest corresponding to ScSP011 (-1.2 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene identified as described above. The DNA
sequence of the resultant clone, pTK81, was determined to confirm it encoded ScSP011.
11. EcSSB
Template for amplifying SSB was genomic DNA from E. coil strain CC106 [130].
Genomic DNA from the strain was isolated as follows: 1) cells were cultured to mid-log phase in TYS liquid medium at 37 C; 2) cells were pelleted by centrifugation and washed with sterile distilled water; 3) 20 ml of cell culture was centrifuged and the cell pellet resuspended in 0.5 ml TE/Tween buffer (10 mM Tris-HC1 (pH 8.0), 1 mM EDTA, 0.01%
(w/v) Tween 20); 4) cells were incubated at 85 C for 20-30 mM and then pelleted by microcentrifugation for 5-10 min; 5) the supernatant was collected and 50 p1 of TE-RNase (RNase A 20 g/ml) was added before incubation at room temperature for 30 min;
6) the supernatant was extracted with phenol and chloroform and precipitated with ethanol as per standard procedure [123]. 7) the DNA was resuspended in 20 1 of LTE (TE
diluted 1:10 with distilled water).
The SSB gene was amplified with two primer sets to create two clones of the gene with different restriction sites at the 5' end. PCR reactions were performed with 4 1 of genomic DNA, 1.0 pmol SSB-5 'Barn oligo and 1.0 pmol SSB-3'Pst oligo, or 1.0 pmol SSB-Sma oligo and 1.0 pmol SSB-3'Pst oligo, plus 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer in a volume of 50 pl.
The PCR
conditions were 5 mm @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C
and 1.0 min @ 72 C, followed by 10 mm @ 72 C and storage at 4 C or ¨20 C. The amplified DNA
from the PCR reactions using SSB-5'Bam oligo and SSB-3'Pst oligo or SSB-5'Sma oligo and SSB-3'Pst oligo was digested with BamHI and PstI or SmaI and PstI, respectively. The corresponding plasmid cloning vector pBluescript II KS- (Stratagene) was also digested with BamHI and PstI or SmaI and PstI, respectively. DNA fragments of interest corresponding to SSB (-0.55 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E.coli and putative clones of the SSB gene identified as described above.
The DNA sequence of the resultant clones, pTK27 and pTK28, were determined to confirm they encoded SSB with flanking restriction sites of BamHI and PstI or SmaI and PstI, respectively.
A SSB derivative was also created so that the resultant protein would encode a nuclear localization sequence (i.e. NLS-SSB). A synthetic oligonucleotide was created which encoded the nuclear localization sequence (NLS) corresponding to that found in simian virus 40 T-antigen [114]. The nucleotide sequence (GGATCCAAAAAAATGGCTCCTAAGAAGAAG-AGAAAGGTTGGAGGAGGACCCGGG) encodes a BamHI site, in-frame start codon, and SmaI site (underlined). A plasmid containing this cloned NLS sequence and derived from pBluescript II KS- (Stratagene) was digested with SmaI and PstI and the DNA
fragment corresponding to the vector (-3 kb) was gel purified. pTK28 was also digested with SmaI
and PstI and the DNA fragment corresponding to the SSB gene (-0.55 kb) was also gel purified. The DNA fragments were recovered from agarose, ligated together, transformed into E. coli and putative clones of the NLS-SSB gene identified as described above. The DNA sequence of the resultant clone, pTK29, was determined to confirm it encoded NLS-SSB.
B. Engineering and cloning of altered forms of target genes Altered forms of genes were engineered to encode proteins with altered amino acid sequences and modified function. Site-directed mutagenesis was performed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene), unless otherwise stated, following directions of the manufacturer using a thermocycler (Perkin-Elmer Model 9700) and the thermostable DNA polymerase Pfu (Stratagene). Base-pair changes of interest were incorporated into oligonucleotides which were then used to prime replication of an altered form of the target gene. Oligonucleotides used to incorporate the desired base changes in target genes are listed in TABLE 1.
1. DMC1 ScDMC1 was engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation ScDMC1:G126D;
ii) ATP-induced conformational change with mutation ScDMC1:N263Y;
iii) monomer-monomer interactions with mutation ScDMC1:A288T.
To create these mutations the protocol of the QuickChange Site-Directed Mutagenesis Kit (Stratagene) was followed. The mutagenesis reactions contained ¨50 ng of pMW13 as template, the appropriate oligonucleotides and reaction constituents and Pfu polymerase (Stratagene) as recommended by the manufacturer. The reactions were incubated in a thermocycler for 30 s @ 95 C followed by 12 cycles of 30 s @ 95 C, 1 min @ 55 C and 8 min 20 s @ 68 C before storage at 4 C or ¨20 C. ScDMC1:G126D was created using oligos yDMC-G126D-sense and yDMC-G126D-antisense resulting in the plasmid pTK68-3.
ScDMC1:N263Y was created using oligos yDMC-N263Y-sense and yDMC-N263Y -antisense resulting in the plasmid pTK70-5. ScDMC1:A288T was created using oligos yDMC-A288T-sense and yDMC-A288T-antisense resulting in the plasmid pTK64-1.
All clones were sequenced to confirm the presence of the mutation.
Combinations of these mutations were also created using two methods. Firstly, the QuickChange Site-Directed Mutagenesis Kit (Stratagene) and supplied protocol were used with the template being one of the mutant gene forms from above and a oligonucleotide pair which confers a mutation at a different site. ScDMC1:G126D+A288T was created in a reaction containing ¨50 ng of pTK64-1 (i.e. ScDMC1:A288T) as template with oligonucleotides yDMC-G126D-sense and yDMC-G126D-antisense resulting in the plasmid pTK67-3. Likewise ScDMC1:N263Y +A288T was created in a reaction containing ¨50 ng of pTK64-1 (i.e. ScDMC1:A288T) as template with oligonucleotides yDMC-N263Y-sense and yDMC-N263Y -antisense resulting in the plasmid pTK69-6. Secondly, a combination of restriction fragments from various constructs was used to create genes with multiple mutations. ScDMC1:G126D+ N263Y was created by digesting pTK68-3 (i.e.
ScDMC1:G126D) with NdeI and PstI, purifying ¨3.5 kb fragment and ligating to this a ¨550 bp fragment purified from pTK70-5 (i.e. ScDMC1:N263Y) digested with NdeI and PstI
resulting in the plasmid pTK71-1. Likewise ScDMC1:G126D+ N263Y+A288T was created by digesting pTK68-3 (i.e. ScDMC1:G126D) with NdEI and PstI, purifying ¨3.5 kb fragment and ligating this to a ¨550 bp fragment purified from pTK69-6 (i.e.
ScDMC1:N263Y
+A288T) digested with NdeI and PstI resulting in the plasmid pTK72-1. All clones were sequenced to confirm the presence of the mutation.
2. RAD51 ScRAD51 was engineered to encode mutations potentially responsible for ATP-binding and hydrolysis with mutation ScRAD51:G190D. Site-directed mutatgenesis was performed as above with the exception that pMW35 was used as template and the oligonucleotides were yRAD51-G190D-sense and yRAD51-G190D-antisense resulting in the plasmid pTK84. The clone was sequenced to confirm the presence of the mutation.
3. SPO1 1 ScSPO1 1 was engineered to encode mutations potentially responsible for topoisomerase-like DNA cleavage activity with mutation ScSP011:Y135F. Site-directed mutatgenesis was performed as above with the exception that pTK81 was used as template and the oligonucleotides were ySPO-Y135F-sense and ySPO-Y135F -antisense resulting in the plasmid pTK83-3. The clone was sequenced to confirm the presence of the mutation.
4. MREll AtMREll was engineered to encode mutations responsible for nuclease activity with mutation AtMRE11: Motif I:D-A. This was done using PCR and an oligonucleotide that incorporates a base change into the gene resulting in the desired changed amino acid sequence. The insert of pNH2 corresponding to AtMREll was first isolated by digesting the plasmid with EcoRI and purifying the ¨2.2 kb fragment corresponding to AtMREll by agarose gel electrophoresis. This was ligated to pBluescript KS+ previously digested with EcoRI. The resultant clone of AtMREll was denoted pF01. A primary PCR reaction was performed with ¨30 ng of pF01 as template DNA, 50 pmol MRE-F1 oligo and 50 pmol OL
12413 oligo, 0.2 mM dNTP's, 2.5 U PfuTurbo (Stratagene) and PfuTurbo buffer constituents recommended by the manufacturer in a volume of 50 pd. The PCR conditions were 3 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 1 min @ 52 C and 1 min @ 72 C, followed by 3 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR reaction was then performed using a 10 1 aliquot of the primary reaction as template and other conditions identical to above except that 25 pmol each of MRE-F2 oligo and OL 12415 oligo were used, and that the extension step was 45 s @ 72 C. A tertiary PCR reaction was then performed with a 5 1 aliquot of the secondary reaction as template and all other conditions identical to the secondary reaction except that the annealing step was 30 s @ 58 C. A
quaternary PCR
reaction was then performed using a 5 pl aliquot of the tertiary reaction as template and all other conditions identical to the tertiary reaction. The amplified DNA was digested with PstI
and XbaI and a ¨250 bp fragment corresponding to the 5' portion of AtMREll was gel-purified. The middle region of AtMREll was isolated by digestion of pF01 with XbaI and Avail, and a 1.3 kb fragment was gel-purified. The 3' end of AtMREll was amplified by PCR using 25 ng of pF01 as template DNA, 50 pmol MRE-AVA oligo and 50 pmol MRE-R1 oligo, 0.2 mM dNTP's, 2.5 U cloned Pfu (Stratagene) and cloned Pfu buffer constituents recommended by the manufacturer in a volume of 50 p1. The PCR conditions were 3 min @
94 C, followed by 10 cyCles of 30 s @94 C, 30s @52 C and 2 min @72 C, followed by 20 cycles of 30 s @ 94 C, 30 s @ 58 C and 2 min @ 72 C, followed by 2 min @72 C
and storage at 4 C or ¨20 C. The amplified DNA was digested with Avail and Sail, and a 650 bp DNA fragment was gel-purified. The plasmid cloning vector pBluescript KS+
(Stratagene) was digested with PstI and Sall, and also gel-purified. To resynthesize a gene representing an open reading frame encoding AtMRE11: Motif I:D-A, the fragments prepared above were combined and ligated together, transformed into E. coli, and putative clones of the gene were identified as described above. The DNA sequence of the resulting clone, pF012, was determined to confirm it encodes AtMRE11: Motif I:D-A, with the desired altered basepair mutation in the 5' region of AtMRE11, and that 5' and 3' ends amplified by PCR
had the correct sequence of AtMRE11.
C. Genetic Assay To demonstrate alternative mechanisms for increasing and decreasing meiotic homologous recombination, a genetic assay was employed to examine the effects of different proteins on meiotic homologous recombination and non-sister chromatid exchange. A
diploid strain of S. cerevisiae, BR2495 [27] was used which possesses heteroalleles at genes essential for biosynthesis of different metabolites required for cell growth and/or division or viability. The allele for a particular gene carried on the maternal chromosome has a mutation and encodes a non-functional protein. The allele for the same gene. on the paternal chromosome also has a mutation making its gene product non-functional.
However, the mutation of the paternal allele is at a different position in the gene than the mutation in the maternal allele. Because both maternal and paternal alleles are both mutated, the diploid cell cannot make a functional gene product. After meiosis, gametes and progeny that inherit only the maternal or paternal allele also cannot make a functional gene product.
However, if a recombination event occurs whereby genetic information is exchanged between maternal and paternal chromosomes within the DNA region between the mutations carried by the two alleles, then a functional allele can result. Progeny carrying this recombined allele resulting from exchange between non-sister chromatids may therefore encode a functional gene product. Thus we have a genetic assay to monitor exchange of genetic information between non-sister chromatids from homologous maternal and paternal chromosomes. The system used here employed S. cerevisiae BR2495 strain [27] with genotype as follows:
Mata leu2-27 his4-280 / Mata (Mat alpha) leu2-3,112 his4-260; ura3-1 / ura3-1; p1-289 /
trp1-1;
CYH10 / cyh10; ag4-8 thrl-1 / ARG4 thr1-4; ade2-1 / ade2-1. BR2495 has heteroalleles to conveniently assay for non-sister chromatid exchange at four loci:
i.) his4 which when functional encodes histidinol dehydrogenase which participates in biosynthesis of histidine enabling cells to grow in absence of external histidine;
ii.) leu2 which when functional encodes 3-isopropylmalate dehydrogenase which participates in biosynthesis of leucine enabling cells to grow in absence of external leucine;
iii.) trpl which when functional encodes phosphoribosylanthranilate isomerase which participates in biosynthesis of tryptophan enabling cells to grow in absence of external tryptophan;
iv.) thrl which when functional encodes homoserine kinase which participates in biosynthesis of threonine enabling cells to grow in absence of external threonine.
The strain or progeny carrying defective alleles are termed auxotrophic for histidine, leucine, tryptophan and threonine because they are unable to grow in the absence of these compounds being provided externally for them. Recombinants resulting in genetic exchange between non-sister chromatids of homologous maternal and paternal chromosomes leading to functional alleles are termed prototrophs because they can make their own histidine, leucine, tryptophan and threonine and do not require an external source of these compounds for growth and cell division.
The exemplified assay system involves growth of a BR2495 strain expressing the test gene of interest. The strain is induced to undergo meiosis. Progeny are assayed for viability and the ability to grow in the absence of histidine, leucine, tryptophan or threonine. By determining the number of prototrophic and viable progeny in a given treatment, recombination frequency can be determined (i.e. # prototrophic progeny per #
viable progeny). By comparing recombination frequency between different test genes, the effect of the test gene being expressed on either increasing or decreasing meiotic homologous recombination can be determined.
D. Gene Expression To test the effect of different genes in strategies to modulate meiotic homologous recombination frequency a gene expression system and plasmid vectors functional in S.
cerevisiae were employed. The exemplified expression system used was based on the plasmids described by Gari et al. (1997). Briefly, a series of S. cerevisiae expression vectors were created with variation in vector copy-number per cell and variations in strength of transcription promoter. Therefore, by using different vectors combining different cell copy-number with different promoter strengths, the effect of expressing genes at different levels can be evaluated. The plasmids are based on pCM188 and pCM189 with copy-number of 1-2 plasmids per cell and pCM190 with copy-number of upto 40 plasmids per cell [131]. The transcription promoters on these plasmids is a hybrid system developed by Gari et al. (1997) which permits suppression or induction of gene expression by varying growth medium constituents. The promoter system employs a DNA-binding protein, tetR, fused to a transcription activator derived from the VP16 protein [132]. tetR us a natural component of the regulatory system controlling expression of tetracycline resistance in prokaryotes [132].
In the absence of tetracycline, tetR is bound to a defined DNA sequence, tet0, and prevents expression of tetracycline resistance genes. In the presence of tetracycline, tetR binds tetracycline resulting in a conformational change that causes it to release tet0 and thereby permitting expression of tetracycline resistance. By fusing tetR with VP16 and incorporating tet0 sites with basal transcription promoter sequences, Gari et al. (1997) created a regulatable transcription promoter system. In the presence of tetracycline or doxycycline, an analogue of tetracycline, transcription of the target gene is suppressed because the tetR-VP16 fusion cannot bind to the promoter to initiate transcription. Conversely, when tetracycline or doxycycline is absent the tetR-VP16 fusion protein can bind to tet0, recruit RNA polymerase and facilitate transcription of the target gene. By varying the number of tet0 sites from two (pCM188) to seven (pCM189 and pCM190) the promoter strength can be increased ¨2-fold [132]. The combination of vector copy number and promoter strength allows target gene expression to be varied ¨5-fold (pCM188 versus pCM190).
The exemplified regulatable expression system discloses strategies to affect meiotic homologous recombination frequency by enabling the promotion of gene expression in cells preparing for and undergoing meiosis. By promoting transcription in cells specifically at this stage one suppresses the effects or any artifactual results due to constitutive expression of test genes during all stages of vegetative growth leading to meiosis.
Alternatively, a promoter could be used which is expressed during meiosis or is meiosis-specific.
In summary, the exemplified system involves cloning genes of interest into pCM188 or pCM190. The cells are cultured in the presence of doxycycline to suppress expression of test genes during vegetative growth. The cells are prepared to undergo meiosis and the doxycyline is removed to enable expression of the test gene. The cells are induced to undergo meiosis and resulting progeny cells are tested for viability and frequency of prototrophy resulting from recombination between heteroalleles on non-sister chromatids.
The frequency of meiotic homologous recombination can thus be determined for each test gene enabling evaluation and comparison of strategies to modify meiotic homologous recombination.
2. Single gene expression constructs a) AtDMC1 To show the effect of heterologous expression of DMC1 genes on meiotic homologous recombination frequency, AtDMC1 was cloned and expressed in S.
cerevisiae cells undergoing meiosis. AtDMC1 was cloned into the expression vectors pCM188, pCM189 and pCM190. All three vectors were digested with PmeI and the free ends were dephosphorylated using calf-intestinal phosphatase (New England BioLabs) following the protocol supplied by the manufacturer. pKR225 was digested with SmaI and ThoI
and treated with the Klenow fragment of DNA polymera' se (Gibco/BRL) following standard procedures [123]. The DNA fragment released from pKR225 corresponding to AtDMC1 (-1.1 kb) was purified by agarose gel electrophoresis and recovered from the agarose as described above. The AtDMC1 fragment was then ligated to the prepared vector fragments, transformed into E. coli and putative clones identified as described above.
The resultant clones of AtDMC1 in pCM188, pCM189 and pCM190 were denoted pTK45, pTK5 and pTK6, respectively.
b) ScDMC1 To show the effect of increased expression of native DMC1 on meiotic homologous recombination frequency, ScDMC1 was cloned and expressed in S. cerevisiae cells undergoing meiosis. ScDMC1 was cloned into pCM190 by first digesting this vector with PmeI and PstI. pMW13 was digested with XbaI and treated with T4 DNA polymerase following standard procedures [123] before subsequent digestion with PstI. DNA
fragments of interest corresponding to ScDMC1 (-1.1 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above.
The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ScDMC1 in pCM190 was denoted pTK58.
To show the effect of expression of mutant DMC1 on meiotic homologous recombination frequency, yDMC1:G126D was cloned and expressed in S. cerevisiae cells undergoing meiosis. yDMC1:G126D was cloned into pTK77, a derivative of pCM190 containing the additional restriction sites SmaI, EcoRV, FseI and SwaI, in 5'-3' order, located adjacent to but 5' of the unique HindIII site of pCM190 and 3' of the CYC1 terminator of the vector.
The pTK77 vector was digested with PmeI and PstI. pTK68-3 was digested with XbaI and treated with Klenow polymerase following standard procedures [123] before subsequent digestion with PstI. DNA fragments of interest corresponding to yDMC1:G126D (-1.1 kb) and pTK77 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of yDMC1:G126D in the pCM190 derived pTK77 was denoted pTK85.
c) ScRAD51 To show the effect of increased expression of native RAD51 on meiotic homologous recombination frequency, ScRAD51 was cloned and expressed in S. cerevisiae cells undergoing meiosis. ScRAD51 was cloned into pCM190 by first digesting this vector with BamHI and PstI. pMW35 was also digested with BamHI and PstI. DNA fragments of interest corresponding to ScRAD51 (-1.2 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ScRAD51 in pCM190 was denoted pTK53.
To show the effect of expression of mutant RAD51 on meiotic homologous recombination frequency, yRAD51:G190D was cloned and expressed in S. cerevisiae cells undergoing meiosis. yRAD51:G190D was cloned into pCM190 by first digesting this vector with BamHI
and PstI. pTK84 was also digested with BamHI and PstI. DNA fragments of interest corresponding to yRAD51:G190D (-1.2 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of yRAD51:G190D in pCM190 was denoted pTK95.
d) EcSSB
To show the effect of increased ssDNA-binding protein on meiotic homologous recombination frequency, SSB and NLS-SSB were cloned and expressed in S.
cerevisiae cells undergoing meiosis. SSB and NLS-SSB were cloned individually into pCM190 [132]
by first digesting this vector with BamHI and PstI. pTK27 (SSB) and pTK29 (NLS-SSB) were also digested with BamHI and PstI. DNA fragments of interest corresponding to SSB
or NLS-SSB (-0.6 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The SSB and NLS-SSB DNA
fragments were ligated independently to the DNA fragment corresponding to pCM190, transformed into E. coli and putative clones of the genes in the expression vector were identified. The resultant clones of SSB and NLS-SSB in pCM190 were denoted pTK35 and pTK36, respectively.
e) SeSPO1 1 To show the effect of increased expression of native SPO1 1 on meiotic homologous recombination frequency, ScSP011 was cloned and expressed in S. cerevisiae cells undergoing meiosis. ScSPO1 1 was cloned into pCM190 by first digesting this vector with BamHI and PstI. pTK81 was also digested with BamHI and PstI. DNA fragments of interest corresponding to ScSP011 (-1.2 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ScSPO1 1 in pCM190 was denoted pTK89.
To show the effect of expression of mutant SPO1 1 on meiotic homologous recombination frequency ySPO1 1:Y135F was cloned and expressed in S.
cerevisiae cells undergoing meiosis. ySPO1 1:Y135F was cloned into pCM190 by first digesting this vector with BamHI and PstI. pTK83-3 was also digested with BamHI and PstI. DNA
fragments of interest corresponding to ySPO 1 1:Y135F (-1.2 kb) and pCM190 (-8'kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above.
The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ySPO 1 1:Y135F
in pCM190 was denoted pTK94.
E. Biological Assay To demonstrate the effect of different genes on meiotic homologous recombination frequency, plasmids containing the candidate genes were first created, as described above, __ and then introduced into S. cerevisiae BR2495 to create different strains.
These strains were then grown, induced to undergo meiosis and the resultant progeny scored for phenotypic markers to determine meiotic homologous recombination frequency. Comparison of the homologous recombination frequency in the various strains to control strains containing only the corresponding parental vector containing no test gene enabled assessment of the genetic __ and biological effects of the test genes.
Expression vectors containing the test genes were introduced into S.
cerevisiae BR2495 cells following the method of Geitz et al. [133]. Exemplified genes and the corresponding expression plasmids are outlined in TABLE 2. Cell lines carrying these plasmid constructs were selected for by culturing cells in minimal medium lacking uracil (i.e.
__ SC-URA; [134]): BR2495 is homozygous for the defective ura3-1 allele [27]
and therefore cannot synthesize this essential metabolite; expression plasmids based on pCM188, pCM189 and pCM190 have a functional URA3 gene and therefore BR2495 cells possessing such plasmids will be able to synthesize uracil and be able to grow on medium lacking uracil.
Cells were cultured in the presence of doxycycline (10 Kg/m1 for solid media;
5 pg/ml for __ liquid media) to suppress expression of test genes until desired growth stages.
To assay meiotic homologous recombination frequency, single colonies from each test strain were used to first inoculate 3 ml of SC-URA+DOX (i.e. SC-URA
containing doxycycline at 5 ig/m1) in a 15 ml tube (Falcon) which was then incubated at 30 C with =
shaking (200 RPM) for ¨1.5 d. Ten cultures were prepared for each test strain, including __ BR2495 possessing the parental expression vector without a test gene and possessing the various expression plasmids containing the test genes. Cells from 1 ml of culture were pelleted by centrifugation at 9000 RPM for 2 mm in a standard microcentrifuge (Brinkman) and resuspended in 1 ml of sterile-distilled water (SDW). The cells were used to inoculate 5 ml of SC-A pre-meiosis medium (per litre: 1.7 g yeast nitrogen free base (Difco), g ammonium acetate (Sigma), 20 g potassium acetate (Sigma), 2 g amino acid drop out mix [134]; and in some experiments doxycycline at 5 g/ml) in a 50 ml tube (Falcon) at a 1:50 dilution. The cultures were then incubated at 30 C with shaking (225 RPM) for 2 d. Aliquots 5 of cells from each culture were then collected to assay for mitotic homologous recombination frequency occurring during vegetative growth. Dilutions of these cells were plated on YPD
medium (per litre: 10 g Bacto-yeast extract, 20 g Bacto-peptone, 20 g glucose, 20 g Bacto-agar; [134]) to determine viable cell number, and plated on minimal media lacking particular amino acids so as to examine homologous recombination at different test genomic loci in BR2495 (i.e. SC minus histidine (SC-his), leucine (SC-leu), threonine (SC-thr), or tryptophan (SC-trp) [134]). These plates were incubated at 30 C for 2-4 d and then colonies were counted. The remaining cells in each culture in pre-meiosis medium were pelleted by centrifugation at 4000 RPM for 10 min at 4 C. For cultures containing doxycyline in the pre-meiosis medium, the pellet was resuspended in 5 ml of SC-A pre-meiosis medium and incubated at room temperature for 3 h. These cells, and those cells incubated in pre-meiosis medium without doxycycline, were then pelleted by centrifugation at 4000 RPM
for 10 min at 4 C and resuspended in 4 ml SPM meiosis-induction medium (0.3% (w/v) potassium acetate, 0.02% (w/v) raffinose, 5 i_tg/m1 histidine, 25 jig/m1 leucine, 5 jig/m1 tryptophan, 50 iAg/m1threonine, 5 1...tg/m1 adenine). The cells were again pelleted by centrifugation at 4000 RPM for 10 mm at 4 C and resuspended in 3.5 ml SPM meiosis-induction medium.
Cultures were then incubated at 30 C with shaking (225 RPM) for 2 d to enable cells to undergo meiosis. Dilutions of the cells were made using SDW and cells were then plated on YPD to determine viable cell number, and on minimal media lacking particular amino acids so as to examine meiotic homologous recombination at different test genomic loci in BR2495, as described above. Duplicate dilutions and plating of each culture were performed. Plates were incubated at 30 C for 2-4 d and then colonies were counted. Frequency of recombinants for each culture was determined by dividing the number of prototrophs conferred by restoration of function for a particular test locus hetero allele by the viable cell number, taking into consideration the dilution factors. Meiotic homologous recombination frequency for each culture was corrected when necessary for background recombinants resulting during vegetative growth by subtraction of the mitotic homologous recombination frequency determined prior to placing the cells in SPM meiosis-induction medium. Mean values for the 10 replicates of each test strain were determined using the corrected values.
Inclusion of the values from all 10 replicates in determining the mean was evaluated by the Q-test [135] and values from individual replicates were excluded from the final mean if the statistic indicated a significant deviation from the values of other replicates. Comparison of means of meiotic homologous recombination frequency from test genes to that from control strains was done to determine the effect of the test gene. Statistical significance of the differences between these values was confirmed by evaluation using the t-test [136].
Results As shown in TABLE 2, results from the exemplified embodiments demonstrate modification of meiotic homologous recombination frequency and non-sister chromatid exchange (increases and decreases) through modifying the expression and activity of components of the DNA recombination process. The genetic evidence shows that non-sister chromatid exchange during meiosis is modified by the exemplified embodiments.
1. Reduced meiotic homologous recombination frequency Meiotic homologous recombination may for example be reduced by a dominant-negative effect conferred by heterologous expression of a protein or expression of a mutant form of a native protein. This reduction occurs at different genomic loci both on the same and different chromosomes. In the exemplified embodiments, heterologous expression of AtDMC1 in S. cerevisiae results in up to a 34% reduction in meiotic homologous recombination. The suppression is found at three different genetic loci , his4 and leu2, located on chromosome III, and trpl, located on chromosome IV. The level of suppression of meiotic homologous recombination may also be regulatable by controlling the level of expression of the inhibitory factor, as demonstrated by the estimated 3-fold difference in expression between pTK5 and pTK6 resulting in ¨20% difference in inhibiting meiotic homologous recombination frequency. ScDMC1 expressed in plants or animals may also be used to decrease meiotic homologous recombination or an animal protein may be used to decrease meiotic homologous recombination in plants, or an animal protein may be used to decrease meiotic homologous recombination in an evolutionarily distant animal species.
These results also demonstrate the efficacy of a dominant-negative effect to reduce meiotic homologous recombination frequency. In alternative embodiments, this may also be achieved by expressing an altered form of a native protein. In the exemplified embodiments, expression of a mutant form of ScDMC1 results in up to a 24% reduction in meiotic homologous recombination frequency; expression of a mutant form of ScRAD51 results in up to a 44% reduction in meiotic homologous recombination frequency; and expression of a mutant form of ScSPO 1 1 results in up to a 48% reduction in meiotic homologous recombination frequency. The suppression is found at different genetic loci and on different chromosomes demonstrating the effect is general to the whole genome. The results demonstrate how affecting the activity level of proteins involved in meiotic homologous recombination can be used to reduce homologous recombination frequency. These results also demonstrate the efficacy of using a dominant-negative effect to reduce meiotic homologous recombination frequency. Mutant forms of proteins involved in meiotic recombination and non-sister chromatid exchange may also be used in plant and animal species to modulate meiotic homologous recombination frequency.
2. Increased meiotic homologous recombination frequency In the exemplified embodiments, meiotic homologous recombination frequency occurs at different genomic loci both on the same and different chromosomes.
Increased expression of either ScDMC1 or ScRAD51 or ScSPO 1 1 is shown to increase meiotic homologous recombination frequency by up to ¨5-fold, ¨3-fold, or ¨2-fold, respectively.
The increase is shown at three different genetic loci, his4 and leu2 , located on chromosome III, and trpl , located on chromosome IV demonstrating the effect is general to the whole genome. Increased expression or activity level of proteins involved in meiotic recombination and non-sister chromatid exchange may also be used in plant and animal species to modulate meiotic homologous recombination frequency.
In alternative exemplified embodiments, expression of prokaryotic proteins is shown to increase or decrease homologous meiotic recombination. Heterologous expression of a ssDNA-binding protein, SSB, is shown to decrease or increase homologous recombination frequency depending upon the genomic locus. A dominant-negative effect results at some loci to suppress homologous recombination, as shown at the leu2 locus where a reduction of homologous recombination frequency by ¨40% was shown. In contrast, a stimulation of homologous recombination occurs at some loci, as shown by the his4 locus where homologous recombination frequency was enhanced by 13%. In both cases, the action of SSB in eukaryotes was promoted ¨10% by addition of a nuclear localization sequence to the protein (i.e. NLS-SSB). In alternative embodiments, modifying the function or expression of endogenous native ssDNA-binding proteins may also be used to modify meiotic homologous recombination frequency.
The PCR
conditions were 5 mm @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C
and 1.0 min @ 72 C, followed by 10 mm @ 72 C and storage at 4 C or ¨20 C. The amplified DNA
from the PCR reactions using SSB-5'Bam oligo and SSB-3'Pst oligo or SSB-5'Sma oligo and SSB-3'Pst oligo was digested with BamHI and PstI or SmaI and PstI, respectively. The corresponding plasmid cloning vector pBluescript II KS- (Stratagene) was also digested with BamHI and PstI or SmaI and PstI, respectively. DNA fragments of interest corresponding to SSB (-0.55 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E.coli and putative clones of the SSB gene identified as described above.
The DNA sequence of the resultant clones, pTK27 and pTK28, were determined to confirm they encoded SSB with flanking restriction sites of BamHI and PstI or SmaI and PstI, respectively.
A SSB derivative was also created so that the resultant protein would encode a nuclear localization sequence (i.e. NLS-SSB). A synthetic oligonucleotide was created which encoded the nuclear localization sequence (NLS) corresponding to that found in simian virus 40 T-antigen [114]. The nucleotide sequence (GGATCCAAAAAAATGGCTCCTAAGAAGAAG-AGAAAGGTTGGAGGAGGACCCGGG) encodes a BamHI site, in-frame start codon, and SmaI site (underlined). A plasmid containing this cloned NLS sequence and derived from pBluescript II KS- (Stratagene) was digested with SmaI and PstI and the DNA
fragment corresponding to the vector (-3 kb) was gel purified. pTK28 was also digested with SmaI
and PstI and the DNA fragment corresponding to the SSB gene (-0.55 kb) was also gel purified. The DNA fragments were recovered from agarose, ligated together, transformed into E. coli and putative clones of the NLS-SSB gene identified as described above. The DNA sequence of the resultant clone, pTK29, was determined to confirm it encoded NLS-SSB.
B. Engineering and cloning of altered forms of target genes Altered forms of genes were engineered to encode proteins with altered amino acid sequences and modified function. Site-directed mutagenesis was performed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene), unless otherwise stated, following directions of the manufacturer using a thermocycler (Perkin-Elmer Model 9700) and the thermostable DNA polymerase Pfu (Stratagene). Base-pair changes of interest were incorporated into oligonucleotides which were then used to prime replication of an altered form of the target gene. Oligonucleotides used to incorporate the desired base changes in target genes are listed in TABLE 1.
1. DMC1 ScDMC1 was engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation ScDMC1:G126D;
ii) ATP-induced conformational change with mutation ScDMC1:N263Y;
iii) monomer-monomer interactions with mutation ScDMC1:A288T.
To create these mutations the protocol of the QuickChange Site-Directed Mutagenesis Kit (Stratagene) was followed. The mutagenesis reactions contained ¨50 ng of pMW13 as template, the appropriate oligonucleotides and reaction constituents and Pfu polymerase (Stratagene) as recommended by the manufacturer. The reactions were incubated in a thermocycler for 30 s @ 95 C followed by 12 cycles of 30 s @ 95 C, 1 min @ 55 C and 8 min 20 s @ 68 C before storage at 4 C or ¨20 C. ScDMC1:G126D was created using oligos yDMC-G126D-sense and yDMC-G126D-antisense resulting in the plasmid pTK68-3.
ScDMC1:N263Y was created using oligos yDMC-N263Y-sense and yDMC-N263Y -antisense resulting in the plasmid pTK70-5. ScDMC1:A288T was created using oligos yDMC-A288T-sense and yDMC-A288T-antisense resulting in the plasmid pTK64-1.
All clones were sequenced to confirm the presence of the mutation.
Combinations of these mutations were also created using two methods. Firstly, the QuickChange Site-Directed Mutagenesis Kit (Stratagene) and supplied protocol were used with the template being one of the mutant gene forms from above and a oligonucleotide pair which confers a mutation at a different site. ScDMC1:G126D+A288T was created in a reaction containing ¨50 ng of pTK64-1 (i.e. ScDMC1:A288T) as template with oligonucleotides yDMC-G126D-sense and yDMC-G126D-antisense resulting in the plasmid pTK67-3. Likewise ScDMC1:N263Y +A288T was created in a reaction containing ¨50 ng of pTK64-1 (i.e. ScDMC1:A288T) as template with oligonucleotides yDMC-N263Y-sense and yDMC-N263Y -antisense resulting in the plasmid pTK69-6. Secondly, a combination of restriction fragments from various constructs was used to create genes with multiple mutations. ScDMC1:G126D+ N263Y was created by digesting pTK68-3 (i.e.
ScDMC1:G126D) with NdeI and PstI, purifying ¨3.5 kb fragment and ligating to this a ¨550 bp fragment purified from pTK70-5 (i.e. ScDMC1:N263Y) digested with NdeI and PstI
resulting in the plasmid pTK71-1. Likewise ScDMC1:G126D+ N263Y+A288T was created by digesting pTK68-3 (i.e. ScDMC1:G126D) with NdEI and PstI, purifying ¨3.5 kb fragment and ligating this to a ¨550 bp fragment purified from pTK69-6 (i.e.
ScDMC1:N263Y
+A288T) digested with NdeI and PstI resulting in the plasmid pTK72-1. All clones were sequenced to confirm the presence of the mutation.
2. RAD51 ScRAD51 was engineered to encode mutations potentially responsible for ATP-binding and hydrolysis with mutation ScRAD51:G190D. Site-directed mutatgenesis was performed as above with the exception that pMW35 was used as template and the oligonucleotides were yRAD51-G190D-sense and yRAD51-G190D-antisense resulting in the plasmid pTK84. The clone was sequenced to confirm the presence of the mutation.
3. SPO1 1 ScSPO1 1 was engineered to encode mutations potentially responsible for topoisomerase-like DNA cleavage activity with mutation ScSP011:Y135F. Site-directed mutatgenesis was performed as above with the exception that pTK81 was used as template and the oligonucleotides were ySPO-Y135F-sense and ySPO-Y135F -antisense resulting in the plasmid pTK83-3. The clone was sequenced to confirm the presence of the mutation.
4. MREll AtMREll was engineered to encode mutations responsible for nuclease activity with mutation AtMRE11: Motif I:D-A. This was done using PCR and an oligonucleotide that incorporates a base change into the gene resulting in the desired changed amino acid sequence. The insert of pNH2 corresponding to AtMREll was first isolated by digesting the plasmid with EcoRI and purifying the ¨2.2 kb fragment corresponding to AtMREll by agarose gel electrophoresis. This was ligated to pBluescript KS+ previously digested with EcoRI. The resultant clone of AtMREll was denoted pF01. A primary PCR reaction was performed with ¨30 ng of pF01 as template DNA, 50 pmol MRE-F1 oligo and 50 pmol OL
12413 oligo, 0.2 mM dNTP's, 2.5 U PfuTurbo (Stratagene) and PfuTurbo buffer constituents recommended by the manufacturer in a volume of 50 pd. The PCR conditions were 3 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 1 min @ 52 C and 1 min @ 72 C, followed by 3 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR reaction was then performed using a 10 1 aliquot of the primary reaction as template and other conditions identical to above except that 25 pmol each of MRE-F2 oligo and OL 12415 oligo were used, and that the extension step was 45 s @ 72 C. A tertiary PCR reaction was then performed with a 5 1 aliquot of the secondary reaction as template and all other conditions identical to the secondary reaction except that the annealing step was 30 s @ 58 C. A
quaternary PCR
reaction was then performed using a 5 pl aliquot of the tertiary reaction as template and all other conditions identical to the tertiary reaction. The amplified DNA was digested with PstI
and XbaI and a ¨250 bp fragment corresponding to the 5' portion of AtMREll was gel-purified. The middle region of AtMREll was isolated by digestion of pF01 with XbaI and Avail, and a 1.3 kb fragment was gel-purified. The 3' end of AtMREll was amplified by PCR using 25 ng of pF01 as template DNA, 50 pmol MRE-AVA oligo and 50 pmol MRE-R1 oligo, 0.2 mM dNTP's, 2.5 U cloned Pfu (Stratagene) and cloned Pfu buffer constituents recommended by the manufacturer in a volume of 50 p1. The PCR conditions were 3 min @
94 C, followed by 10 cyCles of 30 s @94 C, 30s @52 C and 2 min @72 C, followed by 20 cycles of 30 s @ 94 C, 30 s @ 58 C and 2 min @ 72 C, followed by 2 min @72 C
and storage at 4 C or ¨20 C. The amplified DNA was digested with Avail and Sail, and a 650 bp DNA fragment was gel-purified. The plasmid cloning vector pBluescript KS+
(Stratagene) was digested with PstI and Sall, and also gel-purified. To resynthesize a gene representing an open reading frame encoding AtMRE11: Motif I:D-A, the fragments prepared above were combined and ligated together, transformed into E. coli, and putative clones of the gene were identified as described above. The DNA sequence of the resulting clone, pF012, was determined to confirm it encodes AtMRE11: Motif I:D-A, with the desired altered basepair mutation in the 5' region of AtMRE11, and that 5' and 3' ends amplified by PCR
had the correct sequence of AtMRE11.
C. Genetic Assay To demonstrate alternative mechanisms for increasing and decreasing meiotic homologous recombination, a genetic assay was employed to examine the effects of different proteins on meiotic homologous recombination and non-sister chromatid exchange. A
diploid strain of S. cerevisiae, BR2495 [27] was used which possesses heteroalleles at genes essential for biosynthesis of different metabolites required for cell growth and/or division or viability. The allele for a particular gene carried on the maternal chromosome has a mutation and encodes a non-functional protein. The allele for the same gene. on the paternal chromosome also has a mutation making its gene product non-functional.
However, the mutation of the paternal allele is at a different position in the gene than the mutation in the maternal allele. Because both maternal and paternal alleles are both mutated, the diploid cell cannot make a functional gene product. After meiosis, gametes and progeny that inherit only the maternal or paternal allele also cannot make a functional gene product.
However, if a recombination event occurs whereby genetic information is exchanged between maternal and paternal chromosomes within the DNA region between the mutations carried by the two alleles, then a functional allele can result. Progeny carrying this recombined allele resulting from exchange between non-sister chromatids may therefore encode a functional gene product. Thus we have a genetic assay to monitor exchange of genetic information between non-sister chromatids from homologous maternal and paternal chromosomes. The system used here employed S. cerevisiae BR2495 strain [27] with genotype as follows:
Mata leu2-27 his4-280 / Mata (Mat alpha) leu2-3,112 his4-260; ura3-1 / ura3-1; p1-289 /
trp1-1;
CYH10 / cyh10; ag4-8 thrl-1 / ARG4 thr1-4; ade2-1 / ade2-1. BR2495 has heteroalleles to conveniently assay for non-sister chromatid exchange at four loci:
i.) his4 which when functional encodes histidinol dehydrogenase which participates in biosynthesis of histidine enabling cells to grow in absence of external histidine;
ii.) leu2 which when functional encodes 3-isopropylmalate dehydrogenase which participates in biosynthesis of leucine enabling cells to grow in absence of external leucine;
iii.) trpl which when functional encodes phosphoribosylanthranilate isomerase which participates in biosynthesis of tryptophan enabling cells to grow in absence of external tryptophan;
iv.) thrl which when functional encodes homoserine kinase which participates in biosynthesis of threonine enabling cells to grow in absence of external threonine.
The strain or progeny carrying defective alleles are termed auxotrophic for histidine, leucine, tryptophan and threonine because they are unable to grow in the absence of these compounds being provided externally for them. Recombinants resulting in genetic exchange between non-sister chromatids of homologous maternal and paternal chromosomes leading to functional alleles are termed prototrophs because they can make their own histidine, leucine, tryptophan and threonine and do not require an external source of these compounds for growth and cell division.
The exemplified assay system involves growth of a BR2495 strain expressing the test gene of interest. The strain is induced to undergo meiosis. Progeny are assayed for viability and the ability to grow in the absence of histidine, leucine, tryptophan or threonine. By determining the number of prototrophic and viable progeny in a given treatment, recombination frequency can be determined (i.e. # prototrophic progeny per #
viable progeny). By comparing recombination frequency between different test genes, the effect of the test gene being expressed on either increasing or decreasing meiotic homologous recombination can be determined.
D. Gene Expression To test the effect of different genes in strategies to modulate meiotic homologous recombination frequency a gene expression system and plasmid vectors functional in S.
cerevisiae were employed. The exemplified expression system used was based on the plasmids described by Gari et al. (1997). Briefly, a series of S. cerevisiae expression vectors were created with variation in vector copy-number per cell and variations in strength of transcription promoter. Therefore, by using different vectors combining different cell copy-number with different promoter strengths, the effect of expressing genes at different levels can be evaluated. The plasmids are based on pCM188 and pCM189 with copy-number of 1-2 plasmids per cell and pCM190 with copy-number of upto 40 plasmids per cell [131]. The transcription promoters on these plasmids is a hybrid system developed by Gari et al. (1997) which permits suppression or induction of gene expression by varying growth medium constituents. The promoter system employs a DNA-binding protein, tetR, fused to a transcription activator derived from the VP16 protein [132]. tetR us a natural component of the regulatory system controlling expression of tetracycline resistance in prokaryotes [132].
In the absence of tetracycline, tetR is bound to a defined DNA sequence, tet0, and prevents expression of tetracycline resistance genes. In the presence of tetracycline, tetR binds tetracycline resulting in a conformational change that causes it to release tet0 and thereby permitting expression of tetracycline resistance. By fusing tetR with VP16 and incorporating tet0 sites with basal transcription promoter sequences, Gari et al. (1997) created a regulatable transcription promoter system. In the presence of tetracycline or doxycycline, an analogue of tetracycline, transcription of the target gene is suppressed because the tetR-VP16 fusion cannot bind to the promoter to initiate transcription. Conversely, when tetracycline or doxycycline is absent the tetR-VP16 fusion protein can bind to tet0, recruit RNA polymerase and facilitate transcription of the target gene. By varying the number of tet0 sites from two (pCM188) to seven (pCM189 and pCM190) the promoter strength can be increased ¨2-fold [132]. The combination of vector copy number and promoter strength allows target gene expression to be varied ¨5-fold (pCM188 versus pCM190).
The exemplified regulatable expression system discloses strategies to affect meiotic homologous recombination frequency by enabling the promotion of gene expression in cells preparing for and undergoing meiosis. By promoting transcription in cells specifically at this stage one suppresses the effects or any artifactual results due to constitutive expression of test genes during all stages of vegetative growth leading to meiosis.
Alternatively, a promoter could be used which is expressed during meiosis or is meiosis-specific.
In summary, the exemplified system involves cloning genes of interest into pCM188 or pCM190. The cells are cultured in the presence of doxycycline to suppress expression of test genes during vegetative growth. The cells are prepared to undergo meiosis and the doxycyline is removed to enable expression of the test gene. The cells are induced to undergo meiosis and resulting progeny cells are tested for viability and frequency of prototrophy resulting from recombination between heteroalleles on non-sister chromatids.
The frequency of meiotic homologous recombination can thus be determined for each test gene enabling evaluation and comparison of strategies to modify meiotic homologous recombination.
2. Single gene expression constructs a) AtDMC1 To show the effect of heterologous expression of DMC1 genes on meiotic homologous recombination frequency, AtDMC1 was cloned and expressed in S.
cerevisiae cells undergoing meiosis. AtDMC1 was cloned into the expression vectors pCM188, pCM189 and pCM190. All three vectors were digested with PmeI and the free ends were dephosphorylated using calf-intestinal phosphatase (New England BioLabs) following the protocol supplied by the manufacturer. pKR225 was digested with SmaI and ThoI
and treated with the Klenow fragment of DNA polymera' se (Gibco/BRL) following standard procedures [123]. The DNA fragment released from pKR225 corresponding to AtDMC1 (-1.1 kb) was purified by agarose gel electrophoresis and recovered from the agarose as described above. The AtDMC1 fragment was then ligated to the prepared vector fragments, transformed into E. coli and putative clones identified as described above.
The resultant clones of AtDMC1 in pCM188, pCM189 and pCM190 were denoted pTK45, pTK5 and pTK6, respectively.
b) ScDMC1 To show the effect of increased expression of native DMC1 on meiotic homologous recombination frequency, ScDMC1 was cloned and expressed in S. cerevisiae cells undergoing meiosis. ScDMC1 was cloned into pCM190 by first digesting this vector with PmeI and PstI. pMW13 was digested with XbaI and treated with T4 DNA polymerase following standard procedures [123] before subsequent digestion with PstI. DNA
fragments of interest corresponding to ScDMC1 (-1.1 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above.
The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ScDMC1 in pCM190 was denoted pTK58.
To show the effect of expression of mutant DMC1 on meiotic homologous recombination frequency, yDMC1:G126D was cloned and expressed in S. cerevisiae cells undergoing meiosis. yDMC1:G126D was cloned into pTK77, a derivative of pCM190 containing the additional restriction sites SmaI, EcoRV, FseI and SwaI, in 5'-3' order, located adjacent to but 5' of the unique HindIII site of pCM190 and 3' of the CYC1 terminator of the vector.
The pTK77 vector was digested with PmeI and PstI. pTK68-3 was digested with XbaI and treated with Klenow polymerase following standard procedures [123] before subsequent digestion with PstI. DNA fragments of interest corresponding to yDMC1:G126D (-1.1 kb) and pTK77 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of yDMC1:G126D in the pCM190 derived pTK77 was denoted pTK85.
c) ScRAD51 To show the effect of increased expression of native RAD51 on meiotic homologous recombination frequency, ScRAD51 was cloned and expressed in S. cerevisiae cells undergoing meiosis. ScRAD51 was cloned into pCM190 by first digesting this vector with BamHI and PstI. pMW35 was also digested with BamHI and PstI. DNA fragments of interest corresponding to ScRAD51 (-1.2 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ScRAD51 in pCM190 was denoted pTK53.
To show the effect of expression of mutant RAD51 on meiotic homologous recombination frequency, yRAD51:G190D was cloned and expressed in S. cerevisiae cells undergoing meiosis. yRAD51:G190D was cloned into pCM190 by first digesting this vector with BamHI
and PstI. pTK84 was also digested with BamHI and PstI. DNA fragments of interest corresponding to yRAD51:G190D (-1.2 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of yRAD51:G190D in pCM190 was denoted pTK95.
d) EcSSB
To show the effect of increased ssDNA-binding protein on meiotic homologous recombination frequency, SSB and NLS-SSB were cloned and expressed in S.
cerevisiae cells undergoing meiosis. SSB and NLS-SSB were cloned individually into pCM190 [132]
by first digesting this vector with BamHI and PstI. pTK27 (SSB) and pTK29 (NLS-SSB) were also digested with BamHI and PstI. DNA fragments of interest corresponding to SSB
or NLS-SSB (-0.6 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The SSB and NLS-SSB DNA
fragments were ligated independently to the DNA fragment corresponding to pCM190, transformed into E. coli and putative clones of the genes in the expression vector were identified. The resultant clones of SSB and NLS-SSB in pCM190 were denoted pTK35 and pTK36, respectively.
e) SeSPO1 1 To show the effect of increased expression of native SPO1 1 on meiotic homologous recombination frequency, ScSP011 was cloned and expressed in S. cerevisiae cells undergoing meiosis. ScSPO1 1 was cloned into pCM190 by first digesting this vector with BamHI and PstI. pTK81 was also digested with BamHI and PstI. DNA fragments of interest corresponding to ScSP011 (-1.2 kb) and pCM190 (-8 kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above. The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ScSPO1 1 in pCM190 was denoted pTK89.
To show the effect of expression of mutant SPO1 1 on meiotic homologous recombination frequency ySPO1 1:Y135F was cloned and expressed in S.
cerevisiae cells undergoing meiosis. ySPO1 1:Y135F was cloned into pCM190 by first digesting this vector with BamHI and PstI. pTK83-3 was also digested with BamHI and PstI. DNA
fragments of interest corresponding to ySPO 1 1:Y135F (-1.2 kb) and pCM190 (-8'kb) were purified by agarose gel electrophoresis and recovered from the agarose as described above.
The fragments were ligated together, transformed into E. coli and putative clones of the gene in the expression vector were identified. The resultant clone of ySPO 1 1:Y135F
in pCM190 was denoted pTK94.
E. Biological Assay To demonstrate the effect of different genes on meiotic homologous recombination frequency, plasmids containing the candidate genes were first created, as described above, __ and then introduced into S. cerevisiae BR2495 to create different strains.
These strains were then grown, induced to undergo meiosis and the resultant progeny scored for phenotypic markers to determine meiotic homologous recombination frequency. Comparison of the homologous recombination frequency in the various strains to control strains containing only the corresponding parental vector containing no test gene enabled assessment of the genetic __ and biological effects of the test genes.
Expression vectors containing the test genes were introduced into S.
cerevisiae BR2495 cells following the method of Geitz et al. [133]. Exemplified genes and the corresponding expression plasmids are outlined in TABLE 2. Cell lines carrying these plasmid constructs were selected for by culturing cells in minimal medium lacking uracil (i.e.
__ SC-URA; [134]): BR2495 is homozygous for the defective ura3-1 allele [27]
and therefore cannot synthesize this essential metabolite; expression plasmids based on pCM188, pCM189 and pCM190 have a functional URA3 gene and therefore BR2495 cells possessing such plasmids will be able to synthesize uracil and be able to grow on medium lacking uracil.
Cells were cultured in the presence of doxycycline (10 Kg/m1 for solid media;
5 pg/ml for __ liquid media) to suppress expression of test genes until desired growth stages.
To assay meiotic homologous recombination frequency, single colonies from each test strain were used to first inoculate 3 ml of SC-URA+DOX (i.e. SC-URA
containing doxycycline at 5 ig/m1) in a 15 ml tube (Falcon) which was then incubated at 30 C with =
shaking (200 RPM) for ¨1.5 d. Ten cultures were prepared for each test strain, including __ BR2495 possessing the parental expression vector without a test gene and possessing the various expression plasmids containing the test genes. Cells from 1 ml of culture were pelleted by centrifugation at 9000 RPM for 2 mm in a standard microcentrifuge (Brinkman) and resuspended in 1 ml of sterile-distilled water (SDW). The cells were used to inoculate 5 ml of SC-A pre-meiosis medium (per litre: 1.7 g yeast nitrogen free base (Difco), g ammonium acetate (Sigma), 20 g potassium acetate (Sigma), 2 g amino acid drop out mix [134]; and in some experiments doxycycline at 5 g/ml) in a 50 ml tube (Falcon) at a 1:50 dilution. The cultures were then incubated at 30 C with shaking (225 RPM) for 2 d. Aliquots 5 of cells from each culture were then collected to assay for mitotic homologous recombination frequency occurring during vegetative growth. Dilutions of these cells were plated on YPD
medium (per litre: 10 g Bacto-yeast extract, 20 g Bacto-peptone, 20 g glucose, 20 g Bacto-agar; [134]) to determine viable cell number, and plated on minimal media lacking particular amino acids so as to examine homologous recombination at different test genomic loci in BR2495 (i.e. SC minus histidine (SC-his), leucine (SC-leu), threonine (SC-thr), or tryptophan (SC-trp) [134]). These plates were incubated at 30 C for 2-4 d and then colonies were counted. The remaining cells in each culture in pre-meiosis medium were pelleted by centrifugation at 4000 RPM for 10 min at 4 C. For cultures containing doxycyline in the pre-meiosis medium, the pellet was resuspended in 5 ml of SC-A pre-meiosis medium and incubated at room temperature for 3 h. These cells, and those cells incubated in pre-meiosis medium without doxycycline, were then pelleted by centrifugation at 4000 RPM
for 10 min at 4 C and resuspended in 4 ml SPM meiosis-induction medium (0.3% (w/v) potassium acetate, 0.02% (w/v) raffinose, 5 i_tg/m1 histidine, 25 jig/m1 leucine, 5 jig/m1 tryptophan, 50 iAg/m1threonine, 5 1...tg/m1 adenine). The cells were again pelleted by centrifugation at 4000 RPM for 10 mm at 4 C and resuspended in 3.5 ml SPM meiosis-induction medium.
Cultures were then incubated at 30 C with shaking (225 RPM) for 2 d to enable cells to undergo meiosis. Dilutions of the cells were made using SDW and cells were then plated on YPD to determine viable cell number, and on minimal media lacking particular amino acids so as to examine meiotic homologous recombination at different test genomic loci in BR2495, as described above. Duplicate dilutions and plating of each culture were performed. Plates were incubated at 30 C for 2-4 d and then colonies were counted. Frequency of recombinants for each culture was determined by dividing the number of prototrophs conferred by restoration of function for a particular test locus hetero allele by the viable cell number, taking into consideration the dilution factors. Meiotic homologous recombination frequency for each culture was corrected when necessary for background recombinants resulting during vegetative growth by subtraction of the mitotic homologous recombination frequency determined prior to placing the cells in SPM meiosis-induction medium. Mean values for the 10 replicates of each test strain were determined using the corrected values.
Inclusion of the values from all 10 replicates in determining the mean was evaluated by the Q-test [135] and values from individual replicates were excluded from the final mean if the statistic indicated a significant deviation from the values of other replicates. Comparison of means of meiotic homologous recombination frequency from test genes to that from control strains was done to determine the effect of the test gene. Statistical significance of the differences between these values was confirmed by evaluation using the t-test [136].
Results As shown in TABLE 2, results from the exemplified embodiments demonstrate modification of meiotic homologous recombination frequency and non-sister chromatid exchange (increases and decreases) through modifying the expression and activity of components of the DNA recombination process. The genetic evidence shows that non-sister chromatid exchange during meiosis is modified by the exemplified embodiments.
1. Reduced meiotic homologous recombination frequency Meiotic homologous recombination may for example be reduced by a dominant-negative effect conferred by heterologous expression of a protein or expression of a mutant form of a native protein. This reduction occurs at different genomic loci both on the same and different chromosomes. In the exemplified embodiments, heterologous expression of AtDMC1 in S. cerevisiae results in up to a 34% reduction in meiotic homologous recombination. The suppression is found at three different genetic loci , his4 and leu2, located on chromosome III, and trpl, located on chromosome IV. The level of suppression of meiotic homologous recombination may also be regulatable by controlling the level of expression of the inhibitory factor, as demonstrated by the estimated 3-fold difference in expression between pTK5 and pTK6 resulting in ¨20% difference in inhibiting meiotic homologous recombination frequency. ScDMC1 expressed in plants or animals may also be used to decrease meiotic homologous recombination or an animal protein may be used to decrease meiotic homologous recombination in plants, or an animal protein may be used to decrease meiotic homologous recombination in an evolutionarily distant animal species.
These results also demonstrate the efficacy of a dominant-negative effect to reduce meiotic homologous recombination frequency. In alternative embodiments, this may also be achieved by expressing an altered form of a native protein. In the exemplified embodiments, expression of a mutant form of ScDMC1 results in up to a 24% reduction in meiotic homologous recombination frequency; expression of a mutant form of ScRAD51 results in up to a 44% reduction in meiotic homologous recombination frequency; and expression of a mutant form of ScSPO 1 1 results in up to a 48% reduction in meiotic homologous recombination frequency. The suppression is found at different genetic loci and on different chromosomes demonstrating the effect is general to the whole genome. The results demonstrate how affecting the activity level of proteins involved in meiotic homologous recombination can be used to reduce homologous recombination frequency. These results also demonstrate the efficacy of using a dominant-negative effect to reduce meiotic homologous recombination frequency. Mutant forms of proteins involved in meiotic recombination and non-sister chromatid exchange may also be used in plant and animal species to modulate meiotic homologous recombination frequency.
2. Increased meiotic homologous recombination frequency In the exemplified embodiments, meiotic homologous recombination frequency occurs at different genomic loci both on the same and different chromosomes.
Increased expression of either ScDMC1 or ScRAD51 or ScSPO 1 1 is shown to increase meiotic homologous recombination frequency by up to ¨5-fold, ¨3-fold, or ¨2-fold, respectively.
The increase is shown at three different genetic loci, his4 and leu2 , located on chromosome III, and trpl , located on chromosome IV demonstrating the effect is general to the whole genome. Increased expression or activity level of proteins involved in meiotic recombination and non-sister chromatid exchange may also be used in plant and animal species to modulate meiotic homologous recombination frequency.
In alternative exemplified embodiments, expression of prokaryotic proteins is shown to increase or decrease homologous meiotic recombination. Heterologous expression of a ssDNA-binding protein, SSB, is shown to decrease or increase homologous recombination frequency depending upon the genomic locus. A dominant-negative effect results at some loci to suppress homologous recombination, as shown at the leu2 locus where a reduction of homologous recombination frequency by ¨40% was shown. In contrast, a stimulation of homologous recombination occurs at some loci, as shown by the his4 locus where homologous recombination frequency was enhanced by 13%. In both cases, the action of SSB in eukaryotes was promoted ¨10% by addition of a nuclear localization sequence to the protein (i.e. NLS-SSB). In alternative embodiments, modifying the function or expression of endogenous native ssDNA-binding proteins may also be used to modify meiotic homologous recombination frequency.
TABLE 1: Oligonucleotides for amplifying and modifying target genes Oligo name Target Sequence (5 '-3') Gene OL11434 AtDMC1 CATATGATGGCTTCTCTTAAGGCTG
OL11433 AtDMC1 GACATATAAAAGAGTTCGCTCC
OL11435 AtDMC1 AAACTCGAGCTAATCCTTCGCGTCAGCAATG
AtSPO-5' Sma AtSP011 GGGTATGGAGGGAAAATTCGCTAG
AtSPO-3 'X AtSPO 1 1 CCTTGAGTTGGAGACTAGTTATC
AtSPO-3'PstNot AtSPO 1 1 ATCCTGCAGGCGGCCGCTCATCAAGGAGAGCTTACTTCAC
AtRAD51-5'Bam AtRAD51 GGGGGATCCAAAAAAATGACGACGATGGAGCAGCG
AtRAD51-3'X AtRAD51 GAAGCAAGGCATTGTTGTGG
AtRAD51-3'Pst AtRAD51 AACTGCAGTTATCAATCCTTGCAATCTGTTACAC
0L12414 AtMREll CGGAATTCATGATTGTAAAACTTGACAGGG
0L12413 AtMREll GGTCGCTGACTACTTGAAAC
0112415 AtMREll TCATTCAGACAGTGGCGACG
0L12779 AtMRE 1 1 GGCCTGAAGTTCAAGAAG
0L12780 AtMREll GCTCGACTTCTTCGCTTG
MRE-F1 AtMREll GCGCTGCAGCATATGCCCGGGGAATTCATGTCTAGGGAGG
ATTTTAGTGATACACTT
MRE-F2 AtMREll GCGCTGCAGCATATGCCCGGGGAATTCATGTCTAGGGAGG
ATTTTAGTGATACACTTCGAGTACTTGTTGCAACTGCTTG
CCACTTGGGCTAC
MRE-R1 AtMREll CGCGTCGACCCCGGGTTAAGGCGCGCCTCTTCTTAGAGCT
CCATAG
MRE-AVA AtMREll GATAGGTCCACTCGACCCACTGG
YDMC-5 'Barn ScDMC1 GGGGGATCCAAAAAAATGTCTGTTACAGGAACTGAG
YDMC-3 'Pst ScDMC1 AACTGCAGCTACTAGTCACTTGAATCGGTAATACC
YDMC-G126D- ScDMC1 GGTGAATTTAGGTGTGATAAGACACAGATGTCTC
sense YDMC-G126D- ScDMC1 GAGACATCTGTGTCTTATCACACCTAAATTCACC
antisense YDMC-N263Y- ScDMC1 GCAGTATTTCTGACATACCAAGTTCAATCAGAC
sense YDMC-N263Y- ScDMC1 GTCTGATTGAACTTGGTATGTCAGAAATACTGC
antisense YDMC-A288T- ScDMC1 GAGGGCACGTTCTGACACATGCGTCAGC
sense YDMC-A288T- ScDMC1 GCTGACGCATGTGTCAGAACGTGCCCTC
antisense YR51-5'Bam ScRAD51 GGGGGATCCAAAAAAATGTCTCAAGTTCAAGAACAAC
YR51-3'Pst ScRAD51 AACTGCAGTTACTACTCGTCTTCTTCTCTGGGG
YRAD51-G190D- ScRAD51 CGGTGAATTCAGGACAGATAAGTCCCAGCTATGTC
sense Table 1 continued Oligo name Target Sequence (5'-3') Gene YR52-5'Pme ScRAD52 AAAGAATTCGTTTAAACATGGCGTTTTTAAGCTATTTTG
YR52-3'Not ScRAD52 ATCGCGGCCGCTCATCAAGTAGGCTTGCGTGCA
YR54-5'RI 5cRAD54 GGGGAATTCAAAAAAATGGCAAGACGCAGATTAC
YR54-3'Pst ScRAD54 AAACTGCAGTCATCAATGTGAAATATATTGAAATGC
YSPO-5'Bam ScSPO1 1 ATCGGATCCAAAAAAATGGCTTTGGAGGGATTG
Yspo-3'Pst ScSPO1 1 GGGCTGCAGTCATCATTTGTATTCAAAAATTCTGG
YSPO-Y135F-sense ScSPO1 1 GTGAGAGATATCTTCTTCTCCAACGTGGAATTG
YSPO-Y135F- ScSP011 CAATTCCACGTTGGAGAAGAAGATATCTCTCAC
antisense Table 2 =
t..) Expression Plasmid His4 Lela Tip]
Gene Experiment Plasmid Vector Promoterb Copy Prototroph Ratio Mean Prototroph Ratio Mean Prototroph Ratio Mean Ratio r..) oe Construct Number' Frequencyd of HiRe Ratio of Frequency of HR Ratio of Frequency of HR
of HR 1--, 1--, , HR , HR
1 contror pCM188 Weak Low 6.26x1(Y' 0.68 pTK45 pCM188 Weak Low 4.23x10' 0.70 0.02 control pCM188 Weak Low 5.57x10"
5.33x10-5 2 0.72 0.84 0.84 pTK45 pCM188 Weak Low 4.01x10-3 4.49x10-5 control pCM189 Strong Low 5.86x10' 1.44x104 1 0.62 0.76 pTK5 pCM189 Strong Low 3.61x10' 1.09x10-4 AtDMC I 0.73 0.11 0.84 0.08 control pCM189 Strong Low 3.95x I 0' 1.20x10-4 2, 0.83 0.91 n pTK5 pCM189 Strong Low 3.29x10-1.09x104 _ control pCM190 Strong High 1.3 Ox I 0-2 3.60x104 1.) 1 0.82 , 0.61 .i.
pTK6 pCM190 Strong High 1.06x10-2 2.20x10 0.73 0.13 0.66 0.05 control pCM190 Strong High 1.47x10-2 2.30x104 u.)"
c7, 2 0.63 , 0.70 1.) ' pTK6 pCM190 Strong High 9.28x10' 1.60x10 ' LA
1.) .---1 .
u.) control pCM190 Strong High 1.81x10-3 5.25x10-5 3.64x105 , 1 2.59 2.59 2.26 1.42 0 pTK58 pCM190 Strong High 4.70x10-3 1.19x104 5.15x10-5 co ScDMC1 5.24+2.98 1.71+0.30 I
control pCM190 Strong High 2.69x10-5 4.14x10-5 2 _a 8.22 2.02 col-pTK58 pCM190 Strong High 2.21x10 ' 8.36x10-5 control pCM190 Strong High 1.81X10' 2.69X10-5 3.39x10-5 ScRAD51 1 1.87 1.87 2.07 2.07 1.83 1.83 pTK53 pCM190 Strong High 3.39X10' 5.58X10-5 6.22x10-5 , control pCM190 Strong High 6.96x10' 1.58x10-4 SSB 1 1.131.13 0.61 0.61 pTK3 5 pCM190 Strong High 7.89x10' -9.58x10,-- IV
n control pCM190 Strong High 6.96x10-3 1.58x104 n NLS-SSB 1 1.29 1.29 0.54 0.54 pTK36 pCM190 Strong High 9.00x10-3 8.61x10-5 C;
.--...
o 1--, o cA
o t..) t..) Table 2 (continued) Expression Plasmid His4 Leu2 Trpl Gene Experiment Plasmid Vector Promoterb Copy Prototroph Ratio Mean Prototroph Ratio Mean Prototroph Ratio Mean Ratio Construct Number c Frequencyd of HR e Ratio of Frequency of HR Ratio of Frequency of HR of HR
HR
BR
yDMC1: control pCM190 Strong High 8.81x10-3 1.69x104 10.76 0.76 0.91 0.91 G126D pTK85 pCM190 Strong High 6.72x10-3 1.53x10-4 1.) , .i.
1.) oo control pCM190 Strong High 8.81x10-3 1.69x10-4 7.64x10-5 1.) , 1., 0.5610.17 0.39 0.39 0.38 u.) yRAD51: pTK95 pCM190 Strong High 3.43x10- 6.58x10-5 2.88x10-5 m 1.) 0.5910.20 _______________________________________________________________________________ ________________________ 0.6610.28 G190D control pCM190 Strong High 5.21x10-3 1.23x104 5.12x10-5 1.) 20.73 0.78 0.94 0 pTK95 pCM190 Strong High 3.82x10-3 9.58x10-5 4.83x10-5 0 u.) u.) control pCM190 Strong High 4.37x10-3 6.14x10-5 4.90x10-5 I
ScSP011 11.80 1.80 1.87 1.87 1.64 1.64 H
pTK89 pCM190 Strong High 7.87x10-3 1.15x10-4 8.04x1 0 - 5 CA
ySP011: control pCM190 Strong High 6.93x10-3 1.23x10-4 5.72x10-5 Y135F pTK94 pCM190 Strong High 4.53x10-3 0.65 0.65 6.41x10-5 0.52 0.52 4.49x10-5 0.79 0.79 aControl plasmid contained no gene for expression.
bPromoter strength was indicated as "weak" for plasmids containing 2 copies of tet0 and "strong' for plasmids containing 7 copies of tet0.
'Plasmid copy number was "low" with 1-2 copies per cell and "high" for plasmids with upto 40 copies per cell.
dPrototroph frequency determined as the number of prototrophs per viable cell number. Value represents the mean from 10 independent cultures. 00 'Meiotic homologous recombination frequency determined by dividing the prototroph frequency of the strain with the test gene with that of the control. n ,-i n =
=
cA
REFERENCES
The following documents, to which reference may be made elsewhere herein by number.
1. Hall,RM, Collis,CM: Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol.Microbiol. 15: 593-600 (1995).
2. Critchlow,SE, Jackson,SP: DNA end-joining: from yeast to man. Trends Biochem.Sci. 23: 394-398 (1998).
3. Lindahl,T, Wood,RD: Quality control by DNA repair. Science 286: 1897-1905 (1999).
4. Roeder,GS: Meiotic chromosomes: it takes two to tango. Genes Dev. 11: 2600-(1997).
5. Paques,F, Haber,JE: Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol.Mol.Biol.Rev. 63: 349-404 (1999).
6. Kowalczykowski,SC, Dixon,DA, Eggleston,AK, Lauder,SD, Rehrauer,WM:
Biochemistry of homologous recombination in Escherichia coli. Microbiol.Rev.
58:
401-465 (1994).
7. Haber,JE: DNA recombination: the replication connection. Trends Biochem.Sci. 24:
271-275(1999).
_ 8. Strickberger,MW: Genetics. Macmillan Publishing Company, New York (1985).
9. Keeney,S, Giroux,CN, Kleckner,N: Meiosis-specific DNA double-strand breaks are catalysed by Spoil, a member of a widely conserved protein family. Cell 88:
(1997).
10. Cha,RS, Weiner,BM, Keeney,S, Dekker,J, Kleckner,N: Progression of meiotic DNA
replication is modulated by interchromosomal interaction proteins, negatively by Spollp and positively by Rec8p. Genes Dev. 14: 493-503 (2000).
11. Hartung,F, Puchta,H: Molecular characterisation of two paralogous SPO1 homologues in Arabidopsis thaliana. Nucleic Acids Res. 28: 1548-1554 (2000).
12. Johzuka,K, Ogawa,H: Interaction of Mrell and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae. Genetics 139: 1521-1532 (1995).
13. Rozwadowski,K, Kreiser,T, Hasnadka,R, Lydiate,D. AtMRE11: a component of meiotic recombination and DNA repair in plants. 10th International Conference on Arabidopsis Research, Melbourne, Australia, July 4-8, 1999. 1999.
Ref Type: Abstract 14. Hartung,F, Puchta,H: Isolation of the complete cDNA of the Mrel1 homologue of Arabidopsis indicates conservation of DNA recombination mechanisms between plants and other eukaryotes. Plant Physiol. 121: 312 (1999).
15. Petrini,JH, Walsh,ME, DiMare,C, Chen,XN, Korenberg,JR, Weaver,DT:
Isolation and characterization of the human MREll homologue. Genomics 29: 80-86 (1995).
16. Alani,E, Subbiah,S, Kleckner,N: The yeast RAD50 gene encodes a predicted 153-kD
protein containing a purine nucleotide-binding domain and two large heptad-repeat regions. Genetics 122: 47-57 (1989).
17. Dolganov,GM, Maser,RS, Novikov,A, Tosto,L, Chong,S, Bressan,DA, Petrini,JH:
Human Rad50 is physically associated with human Mrell: identification of a conserved multiprotein complex implicated in recombinational DNA repair.
Mol.Cell Biol. 16: 4832-4841 (1996).
18. Ivanov,EL, Sugawara,N, White,CI, Fabre,F, Haber,JE: Mutations in XRS2 and RAD50 delay but do not prevent mating-type switching in Saccharomyces cerevisiae.
Mol.Cell Biol. 14: 3414-3425 (1994).
19. Carney,JP, Maser,RS, Olivares,H, Davis,EM, Le Beau,M, Yates,JR, III, Hays,L, Morgan,WF, Petrini,JH: The hMrell/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA
damage response. Cell 93: 477-486 (1998).
20. Bishop,DK, Park,D, Xu,L, Kleckner,N: DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69: 439-456 (1992).
21. Kobayashi,T, Kobayashi,E, Sato,S, Hotta,Y, Miyajima,N, Tanaka,A, Tabata,S:
Characterization of cDNAs induced in meiotic prophase in lily microsporocytes.
DNA Res. 1: 15-26 (1994).
22. Habu,T, Taki,T, West,A, Nishimune,Y, Morita,T: The mouse and human homologs of DMC1, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 24: 470-(1996).
23. Shinohara,A, Ogawa,H, Ogawa,T: Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell 69: 457-470 (1992).
24. Doutriaux,MP, Couteau,F, Bergounioux,C, White,C: Isolation and characterisation of the RAD51 and DMC1 homologs from Arabidopsis thaliana. Mol.Gen.Genet. 257:
283-291 (1998).
25. Shinohara,A, Ogawa,H, Matsuda,Y, Ushio,N, Ikeo,K, Ogawa,T: Cloning of human, mouse and fission yeast recombination genes homologous to RAD51 and recA.
Nat.Genet. 4: 239-243 (1993).
26. Wold,MS: Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu.Rev.Biochem. 66: 61-92 (1997).
27. Ross-Macdonald,P, Roeder,GS: Mutation of a meiosis-specific MutS homolog decreases crossing over but not mismatch correction. Cell 79: 1069-1080 (1994).
28. Paquis-Flucklinger,V, Santucci-Darmanin,S, Paul,R, Saunieres,A, Turc-Carel,C, Desnuelle,C: Cloning and expression analysis of a meiosis-specific MutS
homolog:
the human MSH4 gene. Genomics 44: 188-194 (1997).
29. Hollingsworth,NM, Ponte,L, Halsey,C: MSH5, a novel MutS homolog, facilitates meiotic reciprocal recombination between homologs in Saccharomyces cerevisiae but not mismatch repair. Genes Dev. 9: 1728-1739 (1995).
30. Winand,NJ, Panzer,JA, Kolodner,RD: Cloning and characterization of the human and Caenorhabditis elegans homologs of the Saccharomyces cerevisiae MSH5 gene.
Genomics 53: 69-80 (1998).
31. Hunter,N, Borts,RH: Mlhl is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev. 11: 1573-1582 (1997).
32. Kolodner,RD, Hall,NR, Lipford,J, Kane,MF, Morrison,PT, Finan,PJ, Burn,J, Chapman,P, Earabino,C, Merchant,E: Structure of the human MLH1 locus and analysis of a large hereditary nonpolyposis colorectal carcinoma kindred for mlhl mutations. Cancer Res. 55: 242-248 (1995).
33. Jean,M, Pelletier,J, Hilpert,M, Belzile,F, Kunze,R: Isolation and characterization of AtMLH1, a MutL homologue from Arabidopsis thaliana. Mol.Gen.Genet. 262: 633-642 (1999).
34. Milne,GT, Weaver,DT: Dominant negative alleles of RAD52 reveal a DNA
repair/recombination complex including Rad51 and Rad52. Genes Dev. 7: 1755-(1993).
35. Muris,DF, Bezzubova,O, Buerstedde,JM, Vreeken,K, Balajee,AS, Osgood,CJ, Troelstra,C, Hoeijmakers,JH, Ostermann,K, Schmidt,H: Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination. Mutat.Res. 315: 295-305 (1994).
36. Emery,HS, Schild,D, Kellogg,DE, Mortimer,RK: Sequence of RAD54, a Saccharomyces cerevisiae gene involved in recombination and repair. Gene 104:
106 (1991).
37. Kanaar,R, Troelstra,C, Swagemakers,SM, Essers,J, Smit,B, Franssen,JH, Pastink,A, Bezzubova,0Y, Buerstedde,JM, Clever,B, Heyer,WD, Hoeijmakers,JH: Human and mouse homologs of the Saccharomyces cerevisiae RAD54 DNA repair gene:
evidence for functional conservation. Curr.Biol. 6: 828-838 (1996).
38. Lovett,ST: Sequence of the RAD55 gene of Saccharomyces cerevisiae:
similarity of RAD55 to prokaryotic RecA and other RecA-like proteins. Gene 142: 103-106 (1994).
39. Dosanjh,MK, Collins,DW, Fan,W, Lennon,GG, Albala,JS, Shen,Z, Schild,D:
Isolation and characterization of RAD51C, a new human member of the RAD51 family of related genes. Nucleic Acids Res. 26: 1179-1184 (1998).
40. Kans,JA, Mortimer,RK: Nucleotide sequence of the RAD57 gene of Saccharomyces cerevisiae. Gene 105: 139-140 (1991).
41. Bai,Y, Symington,LS: A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 10: 2025-2037 (1996).
42. Benson,FE, Baumann,P, West,SC: Synergistic actions of Rad51 and Rad52 in recombination and DNA repair . Nature 391: 401-404 (1998).
43. Kleff,S, Kemper,B, Sternglanz,R: Identification and characterization of yeast mutants and the gene for a cruciform cutting endonuclease. EMBO J. 11: 699-704 (1992).
44. Kupfer,C, Kemper,B: Reactions of mitochondrial cruciform cutting endonuclease 1 (CCE1) of yeast Saccharomyces cerevisiae with branched DNAs in vitro.
Eur.J.Biochem. 238: 77-87 (1996).
45. Trelles-Sticken,E, Loidl,J, Scherthan,H: Bouquet formation in budding yeast:
initiation of recombination is not required for meiotic telomere clustering.
J.Cell Sci.
112 ( Pt 5): 651-658 (1999).
46. Scherthan,H, Weich,S, Schwegler,H, Heyting,C, Harle,M, Cremer,T:
Centromere and telomere movements during early meiotic prophase of mouse and man are associated with the onset of chromosome pairing. J.Cell Biol. 134: 1109-1125 (1996).
47. Bass,HW, Marshall,WF, Sedat,JW, Agard,DA, Cande,WZ: Telomeres cluster de novo before the initiation of synapsis: a three-dimensional spatial analysis of telomere positions before and during meiotic prophase. J.Cell Biol. 137: 5-18 (1997).
48. Bishop,DK: RecA homologs Dmcl and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis. Cell 79: 1081-1092 (1994).
49. Arbel,A, Zenvirth,D, Simchen,G: Sister chromatid-based DNA repair is mediated by RAD54, not by DMC1 or TID1. EMBO J. 18: 2648-2658 (1999).
50. Roeder,GS: Chromosome synapsis and genetic recombination: their roles in meiotic chromosome segregation. Trends Genet. 6: 385-389 (1990).
51. Li,Z, Golub,EI, Gupta,R, Radding,CM: Recombination activities of HsDmel protein, the meiotic human homolog of RecA protein. Proc.Natl.Acad.Sci.U.S.A 94: 11221-11226 (1997).
52. Sung,P, Robberson,DL: DNA strand exchange mediated by a RAD51-ssDNA
nucleoprotein filament with polarity opposite to that of RecA. Cell 82: 453-(1995).
53. Dresser,ME, Ewing,DJ, Conrad,MN, Dominguez,AM, Barstead,R, Jiang,H, Kodadek,T: DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway. Genetics 147: 533-544 (1997).
54. Couteau,F, Belzile,F, Horlow,C, Grandjean,O, Vezon,D, Doutriaux,MP: Random chromosome segregation without meiotic arrest in both male and female meiocytes of a drncl mutant of Arabidopsis. Plant Cell 11: 1623-1634 (1999).
55. Pittman,DL, Cobb,J, Schimenti,KJ, Wilson,LA, Cooper,DM, Brignull,E, Handel,MA, Schimenti,JC: Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for Dmcl, a germline-specific RecA homolog. Mol.Cell 1: 697-705 (1998).
56. Johnson,RD, Symington,LS: Functional differences and interactions among the putative RecA homologs Rad51, Rad55, and Rad57. Mol.Cell Biol. 15: 4843-4850 (1995).
OL11433 AtDMC1 GACATATAAAAGAGTTCGCTCC
OL11435 AtDMC1 AAACTCGAGCTAATCCTTCGCGTCAGCAATG
AtSPO-5' Sma AtSP011 GGGTATGGAGGGAAAATTCGCTAG
AtSPO-3 'X AtSPO 1 1 CCTTGAGTTGGAGACTAGTTATC
AtSPO-3'PstNot AtSPO 1 1 ATCCTGCAGGCGGCCGCTCATCAAGGAGAGCTTACTTCAC
AtRAD51-5'Bam AtRAD51 GGGGGATCCAAAAAAATGACGACGATGGAGCAGCG
AtRAD51-3'X AtRAD51 GAAGCAAGGCATTGTTGTGG
AtRAD51-3'Pst AtRAD51 AACTGCAGTTATCAATCCTTGCAATCTGTTACAC
0L12414 AtMREll CGGAATTCATGATTGTAAAACTTGACAGGG
0L12413 AtMREll GGTCGCTGACTACTTGAAAC
0112415 AtMREll TCATTCAGACAGTGGCGACG
0L12779 AtMRE 1 1 GGCCTGAAGTTCAAGAAG
0L12780 AtMREll GCTCGACTTCTTCGCTTG
MRE-F1 AtMREll GCGCTGCAGCATATGCCCGGGGAATTCATGTCTAGGGAGG
ATTTTAGTGATACACTT
MRE-F2 AtMREll GCGCTGCAGCATATGCCCGGGGAATTCATGTCTAGGGAGG
ATTTTAGTGATACACTTCGAGTACTTGTTGCAACTGCTTG
CCACTTGGGCTAC
MRE-R1 AtMREll CGCGTCGACCCCGGGTTAAGGCGCGCCTCTTCTTAGAGCT
CCATAG
MRE-AVA AtMREll GATAGGTCCACTCGACCCACTGG
YDMC-5 'Barn ScDMC1 GGGGGATCCAAAAAAATGTCTGTTACAGGAACTGAG
YDMC-3 'Pst ScDMC1 AACTGCAGCTACTAGTCACTTGAATCGGTAATACC
YDMC-G126D- ScDMC1 GGTGAATTTAGGTGTGATAAGACACAGATGTCTC
sense YDMC-G126D- ScDMC1 GAGACATCTGTGTCTTATCACACCTAAATTCACC
antisense YDMC-N263Y- ScDMC1 GCAGTATTTCTGACATACCAAGTTCAATCAGAC
sense YDMC-N263Y- ScDMC1 GTCTGATTGAACTTGGTATGTCAGAAATACTGC
antisense YDMC-A288T- ScDMC1 GAGGGCACGTTCTGACACATGCGTCAGC
sense YDMC-A288T- ScDMC1 GCTGACGCATGTGTCAGAACGTGCCCTC
antisense YR51-5'Bam ScRAD51 GGGGGATCCAAAAAAATGTCTCAAGTTCAAGAACAAC
YR51-3'Pst ScRAD51 AACTGCAGTTACTACTCGTCTTCTTCTCTGGGG
YRAD51-G190D- ScRAD51 CGGTGAATTCAGGACAGATAAGTCCCAGCTATGTC
sense Table 1 continued Oligo name Target Sequence (5'-3') Gene YR52-5'Pme ScRAD52 AAAGAATTCGTTTAAACATGGCGTTTTTAAGCTATTTTG
YR52-3'Not ScRAD52 ATCGCGGCCGCTCATCAAGTAGGCTTGCGTGCA
YR54-5'RI 5cRAD54 GGGGAATTCAAAAAAATGGCAAGACGCAGATTAC
YR54-3'Pst ScRAD54 AAACTGCAGTCATCAATGTGAAATATATTGAAATGC
YSPO-5'Bam ScSPO1 1 ATCGGATCCAAAAAAATGGCTTTGGAGGGATTG
Yspo-3'Pst ScSPO1 1 GGGCTGCAGTCATCATTTGTATTCAAAAATTCTGG
YSPO-Y135F-sense ScSPO1 1 GTGAGAGATATCTTCTTCTCCAACGTGGAATTG
YSPO-Y135F- ScSP011 CAATTCCACGTTGGAGAAGAAGATATCTCTCAC
antisense Table 2 =
t..) Expression Plasmid His4 Lela Tip]
Gene Experiment Plasmid Vector Promoterb Copy Prototroph Ratio Mean Prototroph Ratio Mean Prototroph Ratio Mean Ratio r..) oe Construct Number' Frequencyd of HiRe Ratio of Frequency of HR Ratio of Frequency of HR
of HR 1--, 1--, , HR , HR
1 contror pCM188 Weak Low 6.26x1(Y' 0.68 pTK45 pCM188 Weak Low 4.23x10' 0.70 0.02 control pCM188 Weak Low 5.57x10"
5.33x10-5 2 0.72 0.84 0.84 pTK45 pCM188 Weak Low 4.01x10-3 4.49x10-5 control pCM189 Strong Low 5.86x10' 1.44x104 1 0.62 0.76 pTK5 pCM189 Strong Low 3.61x10' 1.09x10-4 AtDMC I 0.73 0.11 0.84 0.08 control pCM189 Strong Low 3.95x I 0' 1.20x10-4 2, 0.83 0.91 n pTK5 pCM189 Strong Low 3.29x10-1.09x104 _ control pCM190 Strong High 1.3 Ox I 0-2 3.60x104 1.) 1 0.82 , 0.61 .i.
pTK6 pCM190 Strong High 1.06x10-2 2.20x10 0.73 0.13 0.66 0.05 control pCM190 Strong High 1.47x10-2 2.30x104 u.)"
c7, 2 0.63 , 0.70 1.) ' pTK6 pCM190 Strong High 9.28x10' 1.60x10 ' LA
1.) .---1 .
u.) control pCM190 Strong High 1.81x10-3 5.25x10-5 3.64x105 , 1 2.59 2.59 2.26 1.42 0 pTK58 pCM190 Strong High 4.70x10-3 1.19x104 5.15x10-5 co ScDMC1 5.24+2.98 1.71+0.30 I
control pCM190 Strong High 2.69x10-5 4.14x10-5 2 _a 8.22 2.02 col-pTK58 pCM190 Strong High 2.21x10 ' 8.36x10-5 control pCM190 Strong High 1.81X10' 2.69X10-5 3.39x10-5 ScRAD51 1 1.87 1.87 2.07 2.07 1.83 1.83 pTK53 pCM190 Strong High 3.39X10' 5.58X10-5 6.22x10-5 , control pCM190 Strong High 6.96x10' 1.58x10-4 SSB 1 1.131.13 0.61 0.61 pTK3 5 pCM190 Strong High 7.89x10' -9.58x10,-- IV
n control pCM190 Strong High 6.96x10-3 1.58x104 n NLS-SSB 1 1.29 1.29 0.54 0.54 pTK36 pCM190 Strong High 9.00x10-3 8.61x10-5 C;
.--...
o 1--, o cA
o t..) t..) Table 2 (continued) Expression Plasmid His4 Leu2 Trpl Gene Experiment Plasmid Vector Promoterb Copy Prototroph Ratio Mean Prototroph Ratio Mean Prototroph Ratio Mean Ratio Construct Number c Frequencyd of HR e Ratio of Frequency of HR Ratio of Frequency of HR of HR
HR
BR
yDMC1: control pCM190 Strong High 8.81x10-3 1.69x104 10.76 0.76 0.91 0.91 G126D pTK85 pCM190 Strong High 6.72x10-3 1.53x10-4 1.) , .i.
1.) oo control pCM190 Strong High 8.81x10-3 1.69x10-4 7.64x10-5 1.) , 1., 0.5610.17 0.39 0.39 0.38 u.) yRAD51: pTK95 pCM190 Strong High 3.43x10- 6.58x10-5 2.88x10-5 m 1.) 0.5910.20 _______________________________________________________________________________ ________________________ 0.6610.28 G190D control pCM190 Strong High 5.21x10-3 1.23x104 5.12x10-5 1.) 20.73 0.78 0.94 0 pTK95 pCM190 Strong High 3.82x10-3 9.58x10-5 4.83x10-5 0 u.) u.) control pCM190 Strong High 4.37x10-3 6.14x10-5 4.90x10-5 I
ScSP011 11.80 1.80 1.87 1.87 1.64 1.64 H
pTK89 pCM190 Strong High 7.87x10-3 1.15x10-4 8.04x1 0 - 5 CA
ySP011: control pCM190 Strong High 6.93x10-3 1.23x10-4 5.72x10-5 Y135F pTK94 pCM190 Strong High 4.53x10-3 0.65 0.65 6.41x10-5 0.52 0.52 4.49x10-5 0.79 0.79 aControl plasmid contained no gene for expression.
bPromoter strength was indicated as "weak" for plasmids containing 2 copies of tet0 and "strong' for plasmids containing 7 copies of tet0.
'Plasmid copy number was "low" with 1-2 copies per cell and "high" for plasmids with upto 40 copies per cell.
dPrototroph frequency determined as the number of prototrophs per viable cell number. Value represents the mean from 10 independent cultures. 00 'Meiotic homologous recombination frequency determined by dividing the prototroph frequency of the strain with the test gene with that of the control. n ,-i n =
=
cA
REFERENCES
The following documents, to which reference may be made elsewhere herein by number.
1. Hall,RM, Collis,CM: Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol.Microbiol. 15: 593-600 (1995).
2. Critchlow,SE, Jackson,SP: DNA end-joining: from yeast to man. Trends Biochem.Sci. 23: 394-398 (1998).
3. Lindahl,T, Wood,RD: Quality control by DNA repair. Science 286: 1897-1905 (1999).
4. Roeder,GS: Meiotic chromosomes: it takes two to tango. Genes Dev. 11: 2600-(1997).
5. Paques,F, Haber,JE: Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol.Mol.Biol.Rev. 63: 349-404 (1999).
6. Kowalczykowski,SC, Dixon,DA, Eggleston,AK, Lauder,SD, Rehrauer,WM:
Biochemistry of homologous recombination in Escherichia coli. Microbiol.Rev.
58:
401-465 (1994).
7. Haber,JE: DNA recombination: the replication connection. Trends Biochem.Sci. 24:
271-275(1999).
_ 8. Strickberger,MW: Genetics. Macmillan Publishing Company, New York (1985).
9. Keeney,S, Giroux,CN, Kleckner,N: Meiosis-specific DNA double-strand breaks are catalysed by Spoil, a member of a widely conserved protein family. Cell 88:
(1997).
10. Cha,RS, Weiner,BM, Keeney,S, Dekker,J, Kleckner,N: Progression of meiotic DNA
replication is modulated by interchromosomal interaction proteins, negatively by Spollp and positively by Rec8p. Genes Dev. 14: 493-503 (2000).
11. Hartung,F, Puchta,H: Molecular characterisation of two paralogous SPO1 homologues in Arabidopsis thaliana. Nucleic Acids Res. 28: 1548-1554 (2000).
12. Johzuka,K, Ogawa,H: Interaction of Mrell and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae. Genetics 139: 1521-1532 (1995).
13. Rozwadowski,K, Kreiser,T, Hasnadka,R, Lydiate,D. AtMRE11: a component of meiotic recombination and DNA repair in plants. 10th International Conference on Arabidopsis Research, Melbourne, Australia, July 4-8, 1999. 1999.
Ref Type: Abstract 14. Hartung,F, Puchta,H: Isolation of the complete cDNA of the Mrel1 homologue of Arabidopsis indicates conservation of DNA recombination mechanisms between plants and other eukaryotes. Plant Physiol. 121: 312 (1999).
15. Petrini,JH, Walsh,ME, DiMare,C, Chen,XN, Korenberg,JR, Weaver,DT:
Isolation and characterization of the human MREll homologue. Genomics 29: 80-86 (1995).
16. Alani,E, Subbiah,S, Kleckner,N: The yeast RAD50 gene encodes a predicted 153-kD
protein containing a purine nucleotide-binding domain and two large heptad-repeat regions. Genetics 122: 47-57 (1989).
17. Dolganov,GM, Maser,RS, Novikov,A, Tosto,L, Chong,S, Bressan,DA, Petrini,JH:
Human Rad50 is physically associated with human Mrell: identification of a conserved multiprotein complex implicated in recombinational DNA repair.
Mol.Cell Biol. 16: 4832-4841 (1996).
18. Ivanov,EL, Sugawara,N, White,CI, Fabre,F, Haber,JE: Mutations in XRS2 and RAD50 delay but do not prevent mating-type switching in Saccharomyces cerevisiae.
Mol.Cell Biol. 14: 3414-3425 (1994).
19. Carney,JP, Maser,RS, Olivares,H, Davis,EM, Le Beau,M, Yates,JR, III, Hays,L, Morgan,WF, Petrini,JH: The hMrell/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA
damage response. Cell 93: 477-486 (1998).
20. Bishop,DK, Park,D, Xu,L, Kleckner,N: DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69: 439-456 (1992).
21. Kobayashi,T, Kobayashi,E, Sato,S, Hotta,Y, Miyajima,N, Tanaka,A, Tabata,S:
Characterization of cDNAs induced in meiotic prophase in lily microsporocytes.
DNA Res. 1: 15-26 (1994).
22. Habu,T, Taki,T, West,A, Nishimune,Y, Morita,T: The mouse and human homologs of DMC1, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 24: 470-(1996).
23. Shinohara,A, Ogawa,H, Ogawa,T: Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell 69: 457-470 (1992).
24. Doutriaux,MP, Couteau,F, Bergounioux,C, White,C: Isolation and characterisation of the RAD51 and DMC1 homologs from Arabidopsis thaliana. Mol.Gen.Genet. 257:
283-291 (1998).
25. Shinohara,A, Ogawa,H, Matsuda,Y, Ushio,N, Ikeo,K, Ogawa,T: Cloning of human, mouse and fission yeast recombination genes homologous to RAD51 and recA.
Nat.Genet. 4: 239-243 (1993).
26. Wold,MS: Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu.Rev.Biochem. 66: 61-92 (1997).
27. Ross-Macdonald,P, Roeder,GS: Mutation of a meiosis-specific MutS homolog decreases crossing over but not mismatch correction. Cell 79: 1069-1080 (1994).
28. Paquis-Flucklinger,V, Santucci-Darmanin,S, Paul,R, Saunieres,A, Turc-Carel,C, Desnuelle,C: Cloning and expression analysis of a meiosis-specific MutS
homolog:
the human MSH4 gene. Genomics 44: 188-194 (1997).
29. Hollingsworth,NM, Ponte,L, Halsey,C: MSH5, a novel MutS homolog, facilitates meiotic reciprocal recombination between homologs in Saccharomyces cerevisiae but not mismatch repair. Genes Dev. 9: 1728-1739 (1995).
30. Winand,NJ, Panzer,JA, Kolodner,RD: Cloning and characterization of the human and Caenorhabditis elegans homologs of the Saccharomyces cerevisiae MSH5 gene.
Genomics 53: 69-80 (1998).
31. Hunter,N, Borts,RH: Mlhl is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev. 11: 1573-1582 (1997).
32. Kolodner,RD, Hall,NR, Lipford,J, Kane,MF, Morrison,PT, Finan,PJ, Burn,J, Chapman,P, Earabino,C, Merchant,E: Structure of the human MLH1 locus and analysis of a large hereditary nonpolyposis colorectal carcinoma kindred for mlhl mutations. Cancer Res. 55: 242-248 (1995).
33. Jean,M, Pelletier,J, Hilpert,M, Belzile,F, Kunze,R: Isolation and characterization of AtMLH1, a MutL homologue from Arabidopsis thaliana. Mol.Gen.Genet. 262: 633-642 (1999).
34. Milne,GT, Weaver,DT: Dominant negative alleles of RAD52 reveal a DNA
repair/recombination complex including Rad51 and Rad52. Genes Dev. 7: 1755-(1993).
35. Muris,DF, Bezzubova,O, Buerstedde,JM, Vreeken,K, Balajee,AS, Osgood,CJ, Troelstra,C, Hoeijmakers,JH, Ostermann,K, Schmidt,H: Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination. Mutat.Res. 315: 295-305 (1994).
36. Emery,HS, Schild,D, Kellogg,DE, Mortimer,RK: Sequence of RAD54, a Saccharomyces cerevisiae gene involved in recombination and repair. Gene 104:
106 (1991).
37. Kanaar,R, Troelstra,C, Swagemakers,SM, Essers,J, Smit,B, Franssen,JH, Pastink,A, Bezzubova,0Y, Buerstedde,JM, Clever,B, Heyer,WD, Hoeijmakers,JH: Human and mouse homologs of the Saccharomyces cerevisiae RAD54 DNA repair gene:
evidence for functional conservation. Curr.Biol. 6: 828-838 (1996).
38. Lovett,ST: Sequence of the RAD55 gene of Saccharomyces cerevisiae:
similarity of RAD55 to prokaryotic RecA and other RecA-like proteins. Gene 142: 103-106 (1994).
39. Dosanjh,MK, Collins,DW, Fan,W, Lennon,GG, Albala,JS, Shen,Z, Schild,D:
Isolation and characterization of RAD51C, a new human member of the RAD51 family of related genes. Nucleic Acids Res. 26: 1179-1184 (1998).
40. Kans,JA, Mortimer,RK: Nucleotide sequence of the RAD57 gene of Saccharomyces cerevisiae. Gene 105: 139-140 (1991).
41. Bai,Y, Symington,LS: A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 10: 2025-2037 (1996).
42. Benson,FE, Baumann,P, West,SC: Synergistic actions of Rad51 and Rad52 in recombination and DNA repair . Nature 391: 401-404 (1998).
43. Kleff,S, Kemper,B, Sternglanz,R: Identification and characterization of yeast mutants and the gene for a cruciform cutting endonuclease. EMBO J. 11: 699-704 (1992).
44. Kupfer,C, Kemper,B: Reactions of mitochondrial cruciform cutting endonuclease 1 (CCE1) of yeast Saccharomyces cerevisiae with branched DNAs in vitro.
Eur.J.Biochem. 238: 77-87 (1996).
45. Trelles-Sticken,E, Loidl,J, Scherthan,H: Bouquet formation in budding yeast:
initiation of recombination is not required for meiotic telomere clustering.
J.Cell Sci.
112 ( Pt 5): 651-658 (1999).
46. Scherthan,H, Weich,S, Schwegler,H, Heyting,C, Harle,M, Cremer,T:
Centromere and telomere movements during early meiotic prophase of mouse and man are associated with the onset of chromosome pairing. J.Cell Biol. 134: 1109-1125 (1996).
47. Bass,HW, Marshall,WF, Sedat,JW, Agard,DA, Cande,WZ: Telomeres cluster de novo before the initiation of synapsis: a three-dimensional spatial analysis of telomere positions before and during meiotic prophase. J.Cell Biol. 137: 5-18 (1997).
48. Bishop,DK: RecA homologs Dmcl and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis. Cell 79: 1081-1092 (1994).
49. Arbel,A, Zenvirth,D, Simchen,G: Sister chromatid-based DNA repair is mediated by RAD54, not by DMC1 or TID1. EMBO J. 18: 2648-2658 (1999).
50. Roeder,GS: Chromosome synapsis and genetic recombination: their roles in meiotic chromosome segregation. Trends Genet. 6: 385-389 (1990).
51. Li,Z, Golub,EI, Gupta,R, Radding,CM: Recombination activities of HsDmel protein, the meiotic human homolog of RecA protein. Proc.Natl.Acad.Sci.U.S.A 94: 11221-11226 (1997).
52. Sung,P, Robberson,DL: DNA strand exchange mediated by a RAD51-ssDNA
nucleoprotein filament with polarity opposite to that of RecA. Cell 82: 453-(1995).
53. Dresser,ME, Ewing,DJ, Conrad,MN, Dominguez,AM, Barstead,R, Jiang,H, Kodadek,T: DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway. Genetics 147: 533-544 (1997).
54. Couteau,F, Belzile,F, Horlow,C, Grandjean,O, Vezon,D, Doutriaux,MP: Random chromosome segregation without meiotic arrest in both male and female meiocytes of a drncl mutant of Arabidopsis. Plant Cell 11: 1623-1634 (1999).
55. Pittman,DL, Cobb,J, Schimenti,KJ, Wilson,LA, Cooper,DM, Brignull,E, Handel,MA, Schimenti,JC: Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for Dmcl, a germline-specific RecA homolog. Mol.Cell 1: 697-705 (1998).
56. Johnson,RD, Symington,LS: Functional differences and interactions among the putative RecA homologs Rad51, Rad55, and Rad57. Mol.Cell Biol. 15: 4843-4850 (1995).
57. Basile,G, Aker,M, Mortimer,RK: Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51. Mol.Cell Biol. 12: 3235-3246 (1992).
58. Ogawa,T, Yu,X, Shinohara,A, Egelman,EH: Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science 259: 1896-1899 (1993).
59. Sugawara,N, Ivanov,EL, Fishman-Lobell,J, Ray,BL, Wu,X, Haber,JE: DNA
structure-dependent requirements for yeast RAD genes in gene conversion.
Nature 373: 84-86 (1995).
structure-dependent requirements for yeast RAD genes in gene conversion.
Nature 373: 84-86 (1995).
60. Rockmill,B, Sym,M, Scherthan,H, Roeder,GS: Roles for two RecA homologs in promoting meiotic chromosome synapsis. Genes Dev. 9: 2684-2695 (1995).
61. Clever,B, Interthal,H, Schmuckli-Maurer,J, King,J, Sigrist,M, Heyer,WD:
Recombinational repair in yeast: functional interactions between Rad51 and Rad54 proteins. EMBO J. 16: 2535-2544 (1997).
Recombinational repair in yeast: functional interactions between Rad51 and Rad54 proteins. EMBO J. 16: 2535-2544 (1997).
62. Jiang,H, Xie,Y, Houston,P, Stemke-Hale,K, Mortensen,UH, Rothstein,R, Kodadek,T:
Direct association between the yeast Rad51 and Rad54 recombination proteins.
J.Biol.Chem. 271: 33181-33186 (1996).
Direct association between the yeast Rad51 and Rad54 recombination proteins.
J.Biol.Chem. 271: 33181-33186 (1996).
63. Shcherbakova,OG, Lanzov,VA, Ogawa,H, Filatov,MV: Overexpression of bacterial RecA protein stimulates homologous recombination in somatic mammalian cells.
Mutat.Res. 459: 65-71 (2000).
Mutat.Res. 459: 65-71 (2000).
64. Milne,gene targeting, Weaver,DT: Dominant negative alleles of RAD52 reveal a DNA repair/recombination complex including Rad51 and Rad52. Genes Dev. 7:
=
1755-1765 (1993).
=
1755-1765 (1993).
65. Muris,DF, Bezzubova,O, Buerstedde,JM, Vreeken,K, Balajee,AS, Osgood,CJ, Troelstra,C, Hoeijmakers,JH, Ostermann,K, Schmidt,H: Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination. Mutat.Res. 315: 295-305 (1994).
66. Petukhova,G, Stratton,S, Sung,P: Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 proteins. Nature 393: 91-94 (1998).
67. Sugiyama,T, Zaitseva,EM, Kowalczykowski,SC: A single-stranded DNA-binding protein is needed for efficient presynaptic complex formation by the Saccharomyces cerevisiae Rad51 protein. J.Biol.Chem. 272: 7940-7945 (1997).
68. Golub,EI, Gupta,RC, Haaf,T, Wold,MS, Radding,CM: Interaction of human rad51 recombination protein with single-stranded DNA binding protein, RPA. Nucleic Acids Res. 26: 5388-5393 (1998).
69. Gasior,SL, Wong,AK, Kora,Y, Shinohara,A, Bishop,DK: Rad52 associates with RPA
and functions with rad55 and rad57 to assemble meiotic recombination complexes.
Genes Dev. 12: 2208-2221 (1998).
and functions with rad55 and rad57 to assemble meiotic recombination complexes.
Genes Dev. 12: 2208-2221 (1998).
70. Baumann,P, West,SC: Heteroduplex formation by human Rad51 protein: effects of DNA end-structure, hRP-A and hRad52. J.Mol.Biol. 291: 363-374 (1999).
71. Mazin,AV, Zaitseva,E, Sung,P, Kowalczykowski,SC: Tailed duplex DNA is the preferred substrate for Rad51 protein-mediated homologous pairing. EMBO J. 19:
1148-1156 (2000).
1148-1156 (2000).
72. Kleckner,N: Meiosis: how could it work? Proc.Natl.Acad.Sci.U.S.A 93: 8167-(1996).
73. Shalev,G, Sitrit,Y, Avivi-Ragolski,N, Lichtenstein,C, Levy,AA: Stimulation of homologous recombination in plants by expression of the bacterial resolvase ruvC.
Proc.Natl.Acad.Sci.U.S.A 96: 7398-7402 (1999).
Proc.Natl.Acad.Sci.U.S.A 96: 7398-7402 (1999).
74. Philipova,D, Mullen,JR, Maniar,HS, Lu,J, Gu,C, Brill,SJ: A hierarchy of SSB
protomers in replication protein A. Genes Dev. 10: 2222-2233 (1996).
protomers in replication protein A. Genes Dev. 10: 2222-2233 (1996).
75. Alani,E, Thresher,R, Griffith,JD, Kolodner,RD: Characterization of DNA-binding and strand-exchange stimulation properties of y-RPA, a yeast single-strand-DNA-binding protein. J.Mol.Biol. 227: 54-71 (1992).
76. Meyer,RR, Laine,PS: The single-stranded DNA-binding protein of Escherichia coli.
Microbiol.Rev. 54: 342-380 (1990).
Microbiol.Rev. 54: 342-380 (1990).
77. Citovsky,V, Wong,ML, Zambryski,P: Cooperative interaction of Agrobacterium VirE2 protein with single-stranded DNA: implications for the T-DNA transfer process. Proc.Natl.Acad.Sci.U.S.A 86: 1193-1197 (1989).
78. Gutierrez,C, Martin.,G, Sogo,JM, Salas,M: Mechanism of stimulation of DNA
replication by bacteriophage phi 29 single-stranded DNA-binding protein p5.
J.Biol.Chem. 266: 2104-2111(1991).
replication by bacteriophage phi 29 single-stranded DNA-binding protein p5.
J.Biol.Chem. 266: 2104-2111(1991).
79. Williams,KR, LoPresti,MB, Setoguchi,M: Primary structure of the bacteriophage T4 DNA helix-destabilizing protein. J.Biol.Chem. 256: 1754-1762 (1981).
80. Monaghan,A, Webster,A, Hay,RT: Adenovirus DNA binding protein: helix destabilising properties. Nucleic Acids Res. 22: 742-748 (1994).
81. Citovsky,V, Knorr,D, Schuster,G, Zambryski,P: The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell 60:
(1990).
(1990).
82. Reiss,B, Schubert,I, Kopchen,K, Wendeler,E, Schell,J, Puchta,H: RecA
stimulates sister chromatid exchange and the fidelity of double-strand break repair, but not gene targeting, in plants transformed by Agrobacterium. Proc.Natl.Acad.Sci.U.S.A
97:
3358-3363 (2000).
stimulates sister chromatid exchange and the fidelity of double-strand break repair, but not gene targeting, in plants transformed by Agrobacterium. Proc.Natl.Acad.Sci.U.S.A
97:
3358-3363 (2000).
83. Shao,RG, Cao,CX, Zhang,H, Kohn,KW, Wold,MS, Pornmier,Y: Replication-mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-dependent protein kinase and dissociates RPA:DNA-PK complexes. EMBO J. 18:
1397-1406 (1999).
1397-1406 (1999).
84. Biswas,EE, Zhu,FX, Biswas,SB: Stimulation of RTH1 nuclease of the yeast Saccharomyces cerevisiae by replication protein A. Biochemistry 36: 5955-5962 (1997).
85. Yanez,RJ, Porter,AC: Gene targeting is enhanced in human cells overexpressing hRAD51. Gene Ther. 6: 1282-1290 (1999).
86. Rubin,BP, Ferguson,DO, Holloman,WK: Structure of REC2, a recombinational repair gene of Ustilago maydis, and its function in homologous recombination between plasmid and chromosomal sequences. Mol.Cell Biol. 14: 6287-6296 (1994).
87. Asleson,EN, Okagaki,RJ, Livingston,DM: A core activity associated with the N
terminus of the yeast RAD52 protein is revealed by RAD51 overexpression suppression of C-terminal rad52 truncation alleles. Genetics 153: 681-692 (1999).
terminus of the yeast RAD52 protein is revealed by RAD51 overexpression suppression of C-terminal rad52 truncation alleles. Genetics 153: 681-692 (1999).
88. Reiss,B, Klemm,M, Kosak,H, Schell,J: RecA protein stimulates homologous recombination in plants. Proc.Natl.Acad.Sci.U.S.A 93: 3094-3098 (1996).
89. Schild,D: Suppression of a new allele of the yeast RAD52 gene by overexpression of RAD51, mutations in srs2 and ccr4, or mating-type heterozygosity. Genetics 140:
115-127 (1995).
115-127 (1995).
90. Amaudeau,C, Helleday,T, Jenssen,D: The RAD51 protein supports homologous recombination by an exchange mechanism in mammalian cells. J.Mol.Biol. 289:
1231-1238 (1999).
1231-1238 (1999).
91. Vispe,S, Cazaux,C, Lesca,C, Defais,M: Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation. Nucleic Acids Res. 26: 2859-2864 (1998).
92. Havre,PA, Rice,MC, Noe,M, Kmiec,EB: The human REC2/RAD51B gene acts as a DNA damage sensor by inducing G1 delay and hypersensitivity to ultraviolet irradiation. Cancer Res. 58: 4733-4739 (1998).
93. Ajimura,M, Leem,SH, Ogawa,H: Identification of new genes required for meiotic recombination in Saccharomyces cerevisiae. Genetics 133: 51-66 (1993).
94. Takanami,T, Sato,S, Ishihara,T, Katsura,I, Takahashi,H, Higashitani,A:
Characterization of a Caenorhabditis elegans recA-like gene Ce-rdh-1 involved in meiotic recombination. DNA.Res. 5: 373-377 (1998).
Characterization of a Caenorhabditis elegans recA-like gene Ce-rdh-1 involved in meiotic recombination. DNA.Res. 5: 373-377 (1998).
95. Tsuzuki,T, Fujii,Y, Sakumi,K, Tominaga,Y, Nakao,K, Sekiguchi,M, Matsushiro,A, Yoshimura,Y, MoritaT: Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. Proc.Natl.Acad.Sci.U.S.A 93: 6236-6240 (1996).
96. Chanet,R, Heude,M, Adjiri,A, Maloisel,L, Fabre,F: Semidominant mutations in the yeast Rad51 protein and their relationships with the Srs2 helicase. Mol.Cell Biol. 16:
4782-4789 (1996).
4782-4789 (1996).
97. Sonoda,E, Sasaki,MS, Buerstedde,JM, BezzubOva,O, Shinohara,A, Ogawa,H, Takata,M, Yamaguchi-Iwai,Y, Takeda,S: Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J. 17: 598-608 (1998).
98. Primrose,SB: Principles of Genome Analysis. Blackwell Science Ltd., Oxford (1995).
99. Kumar,LS: DNA markers in plant improvement: An overview. Biotechnol.Adv.
17:
143-182 (1999).
17:
143-182 (1999).
100. Paterson,AH, Tanksley,SD, Sorrells,ME: DNA markers in plant improvement.
Advances in Agronomy 46: 39-90 (1997).
Advances in Agronomy 46: 39-90 (1997).
101. Rothstein,R: Targeting, disruption, replacement, and allele rescue:
integrative DNA
transformation in yeast. Methods Enzymol. 194: 281-301 (1991).
integrative DNA
transformation in yeast. Methods Enzymol. 194: 281-301 (1991).
102. Offringa,R, De Groot,MJ, Haagsman,HJ, Does,MP, van den Elzen,PJ, Hooykaas,PJ:
Extrachromosomal homologous recombination and gene targeting in plant cells after Agrobacterium mediated transformation. EMBO J. 9: 3077-3084 (1990).
Extrachromosomal homologous recombination and gene targeting in plant cells after Agrobacterium mediated transformation. EMBO J. 9: 3077-3084 (1990).
103. Miao,ZH, Lam,E: Targeted disruption of the TGA3 locus in Arabidopsis thaliana.
Plant J. 7: 359-365 (1995).
Plant J. 7: 359-365 (1995).
104. Zhu,T, Mettenburg,K, Peterson,DJ, Tagliani,L, Baszczynski,CL: Engineering herbicide-resistant maize using chimeric RNA/DNA oligonucleotides.
Nat.Biotechnol. 18: 555-558 (2000).
Nat.Biotechnol. 18: 555-558 (2000).
105. Broverman,S, MacMorris,M, Blumenthal,T: Alteration of Caenorhabditis elegans gene expression by targeted transformation. Proc.Natl.Acad.Sci.U.S.A 90: 4359-(1993).
106. Rong,YS, Golic,KG: Gene targeting by homologous recombination in drosophila.
Science 288: 2013-2018 (2000).
Science 288: 2013-2018 (2000).
107. Thompson,S, Clarke,AR, Pow,AM, Hooper,ML, Melton,DW: Germ line transmission and expression of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell 56: 313-321 (1989).
108. Passy,SI, Yu,X, Li,Z, Radding,CM, Masson,JY, West,SC, Egelman,EH: Human Dmcl protein binds DNA as an octameric ring. Proc.Natl.Acad.Sci.U.S.A 96:
10688 (1999).
10688 (1999).
109. Baumann,P, Benson,FE, Hajibagheri,N, West,SC: Purification of human Rad51 protein by selective spermidine precipitation. Mutat.Res. 384: 65-72 (1997).
110. Yu,X, Egelman,EH: The RecA hexamer is a structural homologue of ring helicases .
Nat.Struct.Biol. 4: 101-104 (1997).
Nat.Struct.Biol. 4: 101-104 (1997).
111. Tsubouchi,H, Ogawa,H: A novel mrell mutation impairs processing of double-strand breaks of DNA during both mitosis and meiosis. Mol.Cell Biol. 18: 260-268 (1998).
112. Furuse,M, Nagase,Y, Tsubouchi,H, Murakami-Murofushi,K, Shibata,T, Ohta,K:
Distinct roles of two separable in vitro activities of yeast Mrell in mitotic and meiotic recombination. EMBO J. 17: 6412-6425 (1998).
Distinct roles of two separable in vitro activities of yeast Mrell in mitotic and meiotic recombination. EMBO J. 17: 6412-6425 (1998).
113. Chedin,F, Seitz,EM, Kowalczykowski,SC: Novel homologs of replication protein A
in archaea: implications for the evolution of ssDNA-binding proteins. Trends Biochem.Sci. 23: 273-277 (1998).
in archaea: implications for the evolution of ssDNA-binding proteins. Trends Biochem.Sci. 23: 273-277 (1998).
114. Kalderon,D, Roberts,BL, Richardson,WD, Smith,AE: A short amino acid sequence able to specify nuclear location. Cell 39: 499-509 (1984).
115. Gupta,RC, Bazemore,LR, Golub,EI, Radding,CM: Activities of human recombination protein Rad51. Proc.Natl.Acad.Sci.U.S.A 94: 463-468 (1997).
116. Zaitseva,EM, Zaitsev,EN, Kowalczykowski,SC: The DNA binding properties of Saccharomyces cerevisiae Rad51 protein. J.Biol.Chem. 274: 2907-2915 (1999).
117. Sung,P, Stratton,SA: Yeast Rad51 recombinase mediates polar DNA strand exchange in the absence of ATP hydrolysis. J.Biol.Chem. 271: 27983-27986 (1996).
118. Walker,JE, Saraste,M, Runswick,MJ, Gay,NJ: Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1: 945-951 (1982).
119. Story,RM, Weber,IT, Steitz,TA: The structure of the E. coli recA protein monomer and polymer . Nature 355: 318-325 (1992).
120. Story,RM, Steitz,TA: Structure of the recA protein-ADP complex . Nature 355: 374-376 (1992).
121. Bergerat,A, de Massy,B, Gadelle,D, Varoutas,PC, Nicolas,A, Forterre,P: An atypical topoisomerase II from Archaea with implications for meiotic recombination .
Nature 386: 414-417 (1997).
Nature 386: 414-417 (1997).
122. Bressan,DA, Olivares,HA, Nelms,BE, Petrini,JH: Alteration of N-terminal phosphoesterase signature motifs inactivates Saccharomyces cerevisiae Mrel 1.
Genetics 150: 591-600 (1998).
Genetics 150: 591-600 (1998).
123. Current Protocols in Molecular Biology. Ausubel,FM, Brent,R, Kingston,RE, Moore,DD, Seidman,JG, Smith,JA, Struhl,K eds. 1987. John Wiley and Sons, Inc.
Ref Type: Serial (Book,Monograph) 124. Chamankhah,M, Wei,YF, Xiao,W: Isolation of hMRE11B: failure to complement yeast mrell defects due to species-specific protein interactions. Gene 225:
(1998).
Ref Type: Serial (Book,Monograph) 124. Chamankhah,M, Wei,YF, Xiao,W: Isolation of hMRE11B: failure to complement yeast mrell defects due to species-specific protein interactions. Gene 225:
(1998).
125. Altschul,SF, Gish,W, Miller,W, Myers,EW, Lipman,DJ: Basic local alignment search tool. J.Mol.Biol. 215: 403-410 (1990).
126. Junghans,H, Metzlaff,M: A simple and rapid method for the preparation of total plant DNA. Biotechniques 8: 176 (1990).
127. Hebsgaard,SM, Korning,PG, Tolstrup,N, Engelbrecht,J, Rouze,P, Brunak,S:
Splice site prediction in Arabidopsis thaliana pre-mRNA by combining local and global sequence information. Nucleic Acids Res. 24: 3439-3452 (1996).
Splice site prediction in Arabidopsis thaliana pre-mRNA by combining local and global sequence information. Nucleic Acids Res. 24: 3439-3452 (1996).
128. Tishkoff,DX, Johnson,AW, Kolodner,RD: Molecular and genetic analysis of the gene encoding the Saccharomyces cerevisiae strand exchange protein Sep 1. Mol.Cell Biol.
11: 2593-2608 (1991).
11: 2593-2608 (1991).
129. Link,AJ, Olson,MV: Physical map of the Saccharomyces cerevisiae genome at kilobase resolution. Genetics 127: 681-698 (1991).
130. Cupples,CG, Miller,JH: A set of lacZ mutations in Escherichia coli that allow rapid detection of each of the six base substitutions. Proc.Natl.Acad.Sci.U.S.A 86:
5349 (1989).
5349 (1989).
131. Schneider,JC, Guarente,L: Vectors for expression of cloned genes in yeast: regulation, overproduction, and underproduction. Methods Enzymol. 194: 373-388 (1991).
132. Gari,E, Piedrafita,L, Aldea,M, Herrero,E: A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13: 837-848 (1997).
133. Gietz,RD, Schiestl,RH, Willems,AR, Woods,RA: Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11: 355-360 (1995).
134. Adams,A, Gottschling,DE, Kaiser,CA, Stearns,T: Mehods in Yeast Genetics.
Cold Spring Harbor Laboratory Press, (1997).
Cold Spring Harbor Laboratory Press, (1997).
135. Dean,RB, Dixon,W: Simplified statistics for small numbers of observations.
Anal.Chem. 23: 636-638 (1951).
Anal.Chem. 23: 636-638 (1951).
136. Devore,JL: Probability and Statistics. Duxbury Press, (1995).
137. Chu,S, DeRisi,J, Eisen,M, Mulholland,J, Botstein,D, Brown,P0, Herskowitz,I: The transcriptional program of sporulation in budding yeast. Science 282: 699-705 (1998).
138. Klimyuk,VI, Jones,JD: AtDMC1, the Arabidopsis homologue of the yeast DMC1 gene:
characterization, transposon-induced allelic variation and meiosis-associated expression. Plant J. 11: 1-14 (1997).
' 27-05-2002 002 .10:48 FR W.GEORGIA VA
c AN co 02 4u2v2 E3 6R26 02 040 36- 0032- 1 04 2 7 4 T
s 139. Guyer,D, Tuttle,A, RouSe,S, Volrath,S, Johnson,M, Potter,S, Gorlach,J, Goff,S, Crossland,L, Ward,E: Activation of latent transgenes in Arabidopsis using a hybrid transcription factor. Genetics 149: 633-639 (1998).
characterization, transposon-induced allelic variation and meiosis-associated expression. Plant J. 11: 1-14 (1997).
' 27-05-2002 002 .10:48 FR W.GEORGIA VA
c AN co 02 4u2v2 E3 6R26 02 040 36- 0032- 1 04 2 7 4 T
s 139. Guyer,D, Tuttle,A, RouSe,S, Volrath,S, Johnson,M, Potter,S, Gorlach,J, Goff,S, Crossland,L, Ward,E: Activation of latent transgenes in Arabidopsis using a hybrid transcription factor. Genetics 149: 633-639 (1998).
140. Moore,I, Galweiler,L, Grosskopf,D, Schell,J, Pahne,K: A transcription activation = system for regulated gene expression in transgenic plants.
Proc.Natl.Acad.Sci.U.S.A 95:
376-381 (1998).
Proc.Natl.Acad.Sci.U.S.A 95:
376-381 (1998).
141. Labow,MA, Bairn,SB, Shenk,T) Levine,AJ: Conversion of the lac repressor into an allosterically regulated transcriptional activator for mammalian cells.
Mol.Cell Biol. 10:
3343-3356 (1990).
Mol.Cell Biol. 10:
3343-3356 (1990).
142. Ain1ey,WM, Key,JL: Development Of a heat shock inducible expression cassette for plants: characterization of parameters for its use in transient expression assays. Plant Mol.Biol. 14: 949-967 (1990).
143. Martinez,A, Sparks,C, Hart,CA, Thompson,J, Jepson,i: Ecdysone agonist inducible transcription in transgenic tobacco plants. Plant I. 19: 97-106 (1999).
144. Bohner,S, Lenk,I, Rieping,M, klerold,M, Gatz,C: Technical advance:
transcriptional activator TGV mediates dexamethasone-inducible and tetracycline-inactivatable gene expression. Plant J. 19: 87-95 (1999).
transcriptional activator TGV mediates dexamethasone-inducible and tetracycline-inactivatable gene expression. Plant J. 19: 87-95 (1999).
145. Gatz,C, Kaiser,A, Wendenburg,R: Regulation of a modified CaMV 35S
promoter by the Tri10-encoded Tet repressor in transgenic tobacco. Mol.Gen.Genet. 227:229-(1991).
promoter by the Tri10-encoded Tet repressor in transgenic tobacco. Mol.Gen.Genet. 227:229-(1991).
146. Weinmarm,P, Gossen,IVI, Hillen,W, Bujard,H, Gatz,C: A chimeric transactivator allows tetracycline-responsive gene expression in whole plants. Plant 3. 5: 559-569 (1994).
147. Mett,VL, Podivinsky,E, Termant,AM, Lochhead,LP, Jones,WT, Reynolds,PH:A
system for tissue-specific copper-controllable gene expression in transgenic plants:
nodule-specific antisense of aspaxtate atninotransferase-P2. Transgenic Res.
5:105-113 (1996).
system for tissue-specific copper-controllable gene expression in transgenic plants:
nodule-specific antisense of aspaxtate atninotransferase-P2. Transgenic Res.
5:105-113 (1996).
148. Mett,VL, Lochhead,LP, Reynolds,PH: Copper-controllable gene expression system for whole plants. Proc.Natl.Acad.Sci.U.S.A 90: 4567-4571 (1993).
149. Benton,BM, Eng,WK, Dunn,JI, Studier,FW, Sterriglanz,R, Fisher,PA: Signal-mediated =
import of bacteriophage T7 RNA polymerase into the Saccharomyoes cerevisiae nucleus and specific transcription of target genes. Mol.Cell Biol. 10: 353-360 (1990).
import of bacteriophage T7 RNA polymerase into the Saccharomyoes cerevisiae nucleus and specific transcription of target genes. Mol.Cell Biol. 10: 353-360 (1990).
150. Church,G.M., Gilbert,W. : Genomic sequencing. Proc.Natl.Acad.Sci.U.S.A
81: 1991-1995 (1984).
81: 1991-1995 (1984).
151. Ohta K, Shibata T, Nicolas A.: Changes in chromatin structure at recombination initiation sites during yeast meiosis. EMBO I. 13;5754-63 (1994).
152. Peterson CL.: ATP-dependent chromatin =modeling: going mobile. FEBS Lett.
476:68-72 (2000).
EmPfangsl AMENDED SHEET
-_ =
476:68-72 (2000).
EmPfangsl AMENDED SHEET
-_ =
153. Peterson CL, Logie C.: Recruitment of chromatin remodeling machines. J
Cell Biochem.78:179-85 (2000) .
Cell Biochem.78:179-85 (2000) .
154. Sterner DE, Berger SL.:Acetylation of histones and transcription-related factors.
Microbiol Mol Biol Rev. 64:435-59 (2000).
Microbiol Mol Biol Rev. 64:435-59 (2000).
155. Cress WD, Seto E.:Histone deacetylases, transcriptional control, and cancer.
J Cell Physiol. 184:1-16 (2000).
J Cell Physiol. 184:1-16 (2000).
156. Hollingsworth,NM, Goetsch,L, Byers,B: The HOPI gene encodes a meiosis-specific component of yeast chromosomes. Cell 61: 73-84 (1990).
157. Rockmill,B, Roeder,GS: A meiosis-specific protein kinase homolog required for chromosome synapsis and recombination. Genes Dev. 5: 2392-2404 (1991).
158. Roeder,GS: Sex and the single cell: meiosis in yeast. Proc Natl Acad Sci U S A 92:
10450-10456 (1995).
10450-10456 (1995).
159. Chen,Q, Pearlman,RE, Moens,PB: Isolation and characterization of a cDNA
encoding a synaptonemal complex protein. Biochem Cell Biol 70: 1030-1038 (1992).
encoding a synaptonemal complex protein. Biochem Cell Biol 70: 1030-1038 (1992).
160. Schmekel,K, Meuwissen,RL, Dietrich,AJ, Vink,AC, van Marle,J, van Veen,H, Heyting,C: Organization of SCP1 protein molecules within synaptonemal complexes of the rat. Exp Cell Res 226: 20-30 (1996).
161. Hyde,H, Davies,AA, Benson,FE, West,SC: Resolution of recombination intermediates by a mammalian activity functionally analogous to Escherichia coli RuvC resolvase. J.Biol.Chem. 269: 5202-5209 (1994).
162. Vispe,S, Cazaux,C, Lesca,C, Defais,M: Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation. Nucleic Acids Res. 26: 2859-2864 (1998).
163. Xu,Y, Ashley,T, Brainerd,EE, Bronson,RT, Meyn,MS, Baltimore,D: Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev. 10: 2411-2422 (1996).
164. Rockmill,B, Roeder,GS: RED1: a yeast gene required for the segregation of chromosomes during the reductional division of meiosis. Proc Natl Acad Sci U S
A
85: 6057-6061 (1988).
A
85: 6057-6061 (1988).
165. Sym,M, Roeder,GS: Zipl-induced changes in synaptonemal complex structure and polycomplex assembly. J Cell Biol 128: 455-466 (1995).
166. Romanienko, Peter J. and R. Daniel Camerini-Otero: Cloning, Characterization, and Localization of Mouse and Human SP011. Genomics. 61, 156-169 (1999).
167. Nichols, Matthew D., DeAngelis, Kristen, Keck, James L., and Berger, James M.
Structure and function of an archaeal topoisomerase VI subunit with homology to the meiotic recombination factor SpollEMBO J. 18: 6177-6188 (1999).
SEQUENCE LISTING
<110> HER MAJESTY IN RIGHT OF CANADA AS REPRESENTED BY
THE MINISTER OF AGRICULTURE AND AGRI-FOOD CANADA
<120> MODULATION OF MEIOTIC RECOMBINATION
<130> 81601-36 <140> CA 2,422,362 <141> 2001-09-12 <150> CA 2,319,247 <151> 2000-09-15 <150> US 60/249,296 <151> 2000-11-17 <150> US 60/256,490 <151> 2000-12-20 <160> 38 <170> PatentIn Ver. 2.0 <210> 1 <211> 54 <212> DNA
<213> Artificial Sequence <220>
<221> misc_binding <222> (1)..(6) <223> BamHI restriction site <220>
<221> misc_feature <222> (13)..(15) <223> in-frame start codon <220>
<221> misc_binding <222> (49)..(54) <223> SmaI restriction site <220>
<223> Description of Artificial Sequence: Nuclear localization sequence (NLS) corresponding to that found in simian virus 40 T-antigen <400> 1 ggatccaaaa aaatggctcc taagaagaag agaaaggttg gaggaggacc cggg 54 <210> 2 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11434) for amplifying and - 74a -modifying target gene AtDMC1) <400> 2 catatgatgg cttctcttaa ggctg 25 <210> 3 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11433) for amplifying and modifying target gene (AtDMC1) <400> 3 gacatataaa agagttcgct cc 22 <210> 4 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11435) for amplifying and modifying target gene (AtDMC1) <400> 4 aaactcgagc taatccttcg cgtcagcaat q 31 <210> 5 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-5'Sma) for amplifying and modifying target gene (AtSP011) <400> 5 gggtatggag ggaaaattcg ctag 24 <210> 6 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-3'X) for amplifying and modifying target gene (AtSP011) <400> 6 ccttgagttg gagactagtt atc 23 <210> 7 <211> 41 <212> DNA
<213> Artificial Sequence - 74h -<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-3'PstNot) for amplifying and modifying target gene (AtSP011) <400> 7 atcctgcagg cggccgctca tcaaqgagag cttacttcac g 41 <210> 8 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-5"Bam) for amplifying and modifying target gene (AtRAD51) <400> 8 gggggatcca aaaaaatgac gacgatggag cagcg 35 <210> 9 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-3"X) for amplifying and modifying target gene (AtRAD51) <400> 9 gaagcaaggc attgttgtgg 20 <210> 10 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-3'Pst) for amplifying and modifying target gene (AtRAD51) <400> 10 aactgcagtt atcaatcctt gcaatctgtt acac 34 <210> 11 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12414) for amplifying and modifying target gene (AtMRE11) <400> 11 cggaattcat gattgtaaaa cttgacaggg 30 - 74c -<210> 12 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12413) for amplifying and modifying target gene (AtMRE11) <400> 12 ggtcgctgac tacttgaaac 20 <210> 13 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12415) for amplifying and modifying target gene (AtMRE11) <400> 13 tcattcagac agtggcgacg 20 <210> 14 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12779) for amplifying and modifying target gene (AtMRE11) <400> 14 ggcctgaagt tcaagaag 18 <210> 15 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12780) for amplifying and modifying target gene (AtMRE11) <400> 15 gctcgacttc ttcgcttg 18 <210> 16 <211> 57 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonuclectide (MRE-F1) for amplifying and modifying target gene (AtMRE11) - 74d -<400> 16 gcgctgcagc atatgcccgg ggaattcatg tctagggagg attttagtga tacactt 57 <210> 17 <211> 93 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-F2) for amplifying and modifying target gene rAtMRE11) <400> 17 gcgctgcagc atatgcccgg ggaattcatg tctagggagg attttagtga tacacttcga 60 gtacttgttg caactgcttg ccacttgggc tac 93 <210> 18 <211> 46 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-R1 for amplifying and modifying target gene (AtMRE11) <400> 18 cgcgtcgacc ccgggttaag gcgcgcctct tcttagagct ccatag 46 <210> 19 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-AVA) for amplifying and modifying target gene (AtMRE11) <400> 19 gataggtcca ctcgacccac tgg 23 <210> 20 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-5'Eam) for amplifying and modifying target gene (ScDMC1) <400> 20 gggggatcca aaaaaatgtc tgttacagga actgag 36 <210> 21 <211> 35 <212> DNA
<213> Artificial Sequence - 74e -<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-3'Pst) for amplifying and modifying target gene (ScDMC1) <400> 21 aactgcagct actagtcact tgaatcggta atacc 35 <210> 22 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-G126D-sense) for amplifying and modifying target gene (ScDMC1) <400> 22 ggtgaattta ggtgteataa gacacagatg tctc 34 <210> 23 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description. of Artificial Sequence:
Oligonuclectide (YDMC-G126D-antisense) for amplifying and modifying target gene (ScDMC1) <400> 23 gagacatctg tgtcttatca cacctaaatt cacc 34 <210> 24 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-N263Y-sense) for amplifying and modifying target gene (ScDMC1) <400> 24 gcagtatttc tgacatacca agttcaatca gac 33 <210> 25 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-N263Y-antisense) for amplifying and modifying target gene (ScDMC1) <400> 25 gtctgattga acttggtatg tcagaaatac tgc 33 <210> 26 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-A288T-sense) for amplifying and modifying target gene (ScDMC1) <400> 26 gagggcacgt tctgacacat gcgtcagc 28 <210> 27 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-A288T-antisense) fox amplifying and modifying target gene (ScDMC1) <400> 27 gctgacgcat gtgtcagaac gtgccctc 28 <210> 28 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR51-5'Bam) for amplifying and modifying target gene .ScRAD51) <400> 28 gggggatcca aaaaaatgtc tcaagttcaa gaacaac 37 <210> 29 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR51-3'Pst) for amplifying and modifying target gene (ScRAD51) <400> 29 aactgcagtt actactegtc ttcttotctg ggg 33 <210> 30 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YRADS1-G190D-sense) for amplifying and modifying target gene (ScRAD51) - 74g -<400> 30 cggtgaattc aggacagata agtcccagct atgtc 35 <210> 31 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR52-5'Pme) for amplifying and modifying target gene (ScRAD52) <400> 31 aaagaattcg tttaaacatg gcgtttttaa gctattttq 39 <210> 32 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonuclectide (YR52-'PNot) for amplifying and modifying target gene (ScRAD52) <400> 32 atcgcggccg ctcatcaagt aggcttqcgt gca 33 <210> 33 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR54-5'RI) for amplifying and modifying target gene (ScRAD54) <400> 33 ggggaattca aaaaaatggc aagacgcaga ttac 34 <210> 34 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR54-3'Pst) for amplifying and modifying target gene (ScRAD54) <400> 34 aaactgcagt catcaatgtg aaatatattg aaatgc 36 <210> 35 <211> 33 <212> DNA
<213> Artificial Sequence - 74h -<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPC-5'13am) for amplifying and modifying target gene (ScSP011) <400> 35 atcggatcca aaaaaatggc tttggaggga ttg 33 <210> 36 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPC-3'Pst) for amplifying and modifying target gene ScSP011) <400> 36 gggctgcagt catcatttgt attcaaaaat tctgg 35 <210> 37 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPO-Y135F-sense) for amplifying and modifying target gene (ScSP011) <400> 37 gtgagagata tcttcttctc caacgtggaa ttg 33 <210> 38 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPO-Y135F-antisense) for amplifying and modifying target gene (ScSP011) <400> 38 caattccacg ttggagaaga agatatctct cac 33 - 74i -
Structure and function of an archaeal topoisomerase VI subunit with homology to the meiotic recombination factor SpollEMBO J. 18: 6177-6188 (1999).
SEQUENCE LISTING
<110> HER MAJESTY IN RIGHT OF CANADA AS REPRESENTED BY
THE MINISTER OF AGRICULTURE AND AGRI-FOOD CANADA
<120> MODULATION OF MEIOTIC RECOMBINATION
<130> 81601-36 <140> CA 2,422,362 <141> 2001-09-12 <150> CA 2,319,247 <151> 2000-09-15 <150> US 60/249,296 <151> 2000-11-17 <150> US 60/256,490 <151> 2000-12-20 <160> 38 <170> PatentIn Ver. 2.0 <210> 1 <211> 54 <212> DNA
<213> Artificial Sequence <220>
<221> misc_binding <222> (1)..(6) <223> BamHI restriction site <220>
<221> misc_feature <222> (13)..(15) <223> in-frame start codon <220>
<221> misc_binding <222> (49)..(54) <223> SmaI restriction site <220>
<223> Description of Artificial Sequence: Nuclear localization sequence (NLS) corresponding to that found in simian virus 40 T-antigen <400> 1 ggatccaaaa aaatggctcc taagaagaag agaaaggttg gaggaggacc cggg 54 <210> 2 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11434) for amplifying and - 74a -modifying target gene AtDMC1) <400> 2 catatgatgg cttctcttaa ggctg 25 <210> 3 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11433) for amplifying and modifying target gene (AtDMC1) <400> 3 gacatataaa agagttcgct cc 22 <210> 4 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11435) for amplifying and modifying target gene (AtDMC1) <400> 4 aaactcgagc taatccttcg cgtcagcaat q 31 <210> 5 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-5'Sma) for amplifying and modifying target gene (AtSP011) <400> 5 gggtatggag ggaaaattcg ctag 24 <210> 6 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-3'X) for amplifying and modifying target gene (AtSP011) <400> 6 ccttgagttg gagactagtt atc 23 <210> 7 <211> 41 <212> DNA
<213> Artificial Sequence - 74h -<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-3'PstNot) for amplifying and modifying target gene (AtSP011) <400> 7 atcctgcagg cggccgctca tcaaqgagag cttacttcac g 41 <210> 8 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-5"Bam) for amplifying and modifying target gene (AtRAD51) <400> 8 gggggatcca aaaaaatgac gacgatggag cagcg 35 <210> 9 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-3"X) for amplifying and modifying target gene (AtRAD51) <400> 9 gaagcaaggc attgttgtgg 20 <210> 10 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-3'Pst) for amplifying and modifying target gene (AtRAD51) <400> 10 aactgcagtt atcaatcctt gcaatctgtt acac 34 <210> 11 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12414) for amplifying and modifying target gene (AtMRE11) <400> 11 cggaattcat gattgtaaaa cttgacaggg 30 - 74c -<210> 12 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12413) for amplifying and modifying target gene (AtMRE11) <400> 12 ggtcgctgac tacttgaaac 20 <210> 13 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12415) for amplifying and modifying target gene (AtMRE11) <400> 13 tcattcagac agtggcgacg 20 <210> 14 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12779) for amplifying and modifying target gene (AtMRE11) <400> 14 ggcctgaagt tcaagaag 18 <210> 15 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12780) for amplifying and modifying target gene (AtMRE11) <400> 15 gctcgacttc ttcgcttg 18 <210> 16 <211> 57 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonuclectide (MRE-F1) for amplifying and modifying target gene (AtMRE11) - 74d -<400> 16 gcgctgcagc atatgcccgg ggaattcatg tctagggagg attttagtga tacactt 57 <210> 17 <211> 93 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-F2) for amplifying and modifying target gene rAtMRE11) <400> 17 gcgctgcagc atatgcccgg ggaattcatg tctagggagg attttagtga tacacttcga 60 gtacttgttg caactgcttg ccacttgggc tac 93 <210> 18 <211> 46 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-R1 for amplifying and modifying target gene (AtMRE11) <400> 18 cgcgtcgacc ccgggttaag gcgcgcctct tcttagagct ccatag 46 <210> 19 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-AVA) for amplifying and modifying target gene (AtMRE11) <400> 19 gataggtcca ctcgacccac tgg 23 <210> 20 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-5'Eam) for amplifying and modifying target gene (ScDMC1) <400> 20 gggggatcca aaaaaatgtc tgttacagga actgag 36 <210> 21 <211> 35 <212> DNA
<213> Artificial Sequence - 74e -<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-3'Pst) for amplifying and modifying target gene (ScDMC1) <400> 21 aactgcagct actagtcact tgaatcggta atacc 35 <210> 22 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-G126D-sense) for amplifying and modifying target gene (ScDMC1) <400> 22 ggtgaattta ggtgteataa gacacagatg tctc 34 <210> 23 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description. of Artificial Sequence:
Oligonuclectide (YDMC-G126D-antisense) for amplifying and modifying target gene (ScDMC1) <400> 23 gagacatctg tgtcttatca cacctaaatt cacc 34 <210> 24 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-N263Y-sense) for amplifying and modifying target gene (ScDMC1) <400> 24 gcagtatttc tgacatacca agttcaatca gac 33 <210> 25 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-N263Y-antisense) for amplifying and modifying target gene (ScDMC1) <400> 25 gtctgattga acttggtatg tcagaaatac tgc 33 <210> 26 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-A288T-sense) for amplifying and modifying target gene (ScDMC1) <400> 26 gagggcacgt tctgacacat gcgtcagc 28 <210> 27 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-A288T-antisense) fox amplifying and modifying target gene (ScDMC1) <400> 27 gctgacgcat gtgtcagaac gtgccctc 28 <210> 28 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR51-5'Bam) for amplifying and modifying target gene .ScRAD51) <400> 28 gggggatcca aaaaaatgtc tcaagttcaa gaacaac 37 <210> 29 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR51-3'Pst) for amplifying and modifying target gene (ScRAD51) <400> 29 aactgcagtt actactegtc ttcttotctg ggg 33 <210> 30 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YRADS1-G190D-sense) for amplifying and modifying target gene (ScRAD51) - 74g -<400> 30 cggtgaattc aggacagata agtcccagct atgtc 35 <210> 31 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR52-5'Pme) for amplifying and modifying target gene (ScRAD52) <400> 31 aaagaattcg tttaaacatg gcgtttttaa gctattttq 39 <210> 32 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonuclectide (YR52-'PNot) for amplifying and modifying target gene (ScRAD52) <400> 32 atcgcggccg ctcatcaagt aggcttqcgt gca 33 <210> 33 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR54-5'RI) for amplifying and modifying target gene (ScRAD54) <400> 33 ggggaattca aaaaaatggc aagacgcaga ttac 34 <210> 34 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR54-3'Pst) for amplifying and modifying target gene (ScRAD54) <400> 34 aaactgcagt catcaatgtg aaatatattg aaatgc 36 <210> 35 <211> 33 <212> DNA
<213> Artificial Sequence - 74h -<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPC-5'13am) for amplifying and modifying target gene (ScSP011) <400> 35 atcggatcca aaaaaatggc tttggaggga ttg 33 <210> 36 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPC-3'Pst) for amplifying and modifying target gene ScSP011) <400> 36 gggctgcagt catcatttgt attcaaaaat tctgg 35 <210> 37 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPO-Y135F-sense) for amplifying and modifying target gene (ScSP011) <400> 37 gtgagagata tcttcttctc caacgtggaa ttg 33 <210> 38 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPO-Y135F-antisense) for amplifying and modifying target gene (ScSP011) <400> 38 caattccacg ttggagaaga agatatctct cac 33 - 74i -
Claims (15)
1. A method of modulating meiotic homologous recombination in plant cells, comprising:
transforming a plant cell of a plant species with a nucleic acid encoding a protein, wherein the protein comprises five conserved motifs present in SPO11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SPO11-1 (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana SPO11-1 (AtSPO11-1);
tyrosine at a position corresponding to tyrosine 103 of AtSPO11-1;
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein the protein is operable to initiate meiotic recombination, wherein said nucleic acid is operably linked to a promoter; and allowing the transformed plant cell, or a descendant of the transformed plant cell, to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the transformed plant cell or the descendant increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
transforming a plant cell of a plant species with a nucleic acid encoding a protein, wherein the protein comprises five conserved motifs present in SPO11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SPO11-1 (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana SPO11-1 (AtSPO11-1);
tyrosine at a position corresponding to tyrosine 103 of AtSPO11-1;
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein the protein is operable to initiate meiotic recombination, wherein said nucleic acid is operably linked to a promoter; and allowing the transformed plant cell, or a descendant of the transformed plant cell, to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the transformed plant cell or the descendant increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
2. The method of claim 1, wherein the level of expression of the protein is regulated to control the degree of increase in the frequency of meiotic homologous recombination.
3. A method of modulating meiotic homologous recombination in plant cells, comprising:
transforming a plant cell of a plant species with a nucleic acid encoding a protein, wherein the protein comprises five conserved motifs present in SPO11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SPO11-1 (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSPO11-1);
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1 ;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein the protein lacks a tyrosine at a position corresponding to tyrosine of AtSPO11-1, wherein the protein is operable to inhibit catalysis of double strand break formation by an endogenous SPO11 protein, and wherein said nucleic acid is operably linked to a promoter; and allowing the transformed plant cell, or a descendent of the transformed plant cell, to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the transformed plant cell or the descendant decreases the frequency of homologous non-sister chromatid exchange during the meiotic event.
transforming a plant cell of a plant species with a nucleic acid encoding a protein, wherein the protein comprises five conserved motifs present in SPO11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana SPO11-1 (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSPO11-1);
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1 ;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein the protein lacks a tyrosine at a position corresponding to tyrosine of AtSPO11-1, wherein the protein is operable to inhibit catalysis of double strand break formation by an endogenous SPO11 protein, and wherein said nucleic acid is operably linked to a promoter; and allowing the transformed plant cell, or a descendent of the transformed plant cell, to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the transformed plant cell or the descendant decreases the frequency of homologous non-sister chromatid exchange during the meiotic event.
4. The method of claim 3, wherein the level of expression of the protein may be regulated to control the degree of decrease in the frequency of meiotic homologous recombination.
5. The method of claim 3 or claim 4, wherein the protein is expressed so that it has a dominant-negative effect on meiotic homologous recombination.
6. The method of any one of claims 1 to 5, wherein the frequency of mitotic homologous sister chromatid exchange in the transformed plant cell is not altered to a level detrimental to viability, growth or reproduction of a plant generated from the transformed plant cell.
7. The method of any one of claims 1 to 6, wherein the promoter is regulatable by induction or repression.
8. The method of any one of claims 1 to 7, wherein the promoter is meiotic or operable to express the protein at a level sub-inhibitory to vegetative cells.
9. The method of any one of claims 1 to 7, wherein the promoter is meiosis-specific.
10. The method of any one of claims 1 to 9, wherein the protein has an amino acid sequence that has at least 90% sequence identity to a naturally occurring protein obtained from the plant species when aligned using the BLAST
algorithm.
algorithm.
11. A method of plant breeding, comprising modulating meiotic homologous recombination in a plant cell according to the method of any one of claims 1 to 10, and crossing a first gamete generated by the meiotic event with a second gamete to obtain a progeny plant.
12. A method of genomic mapping comprising modulating the frequency of non-sister chromatid exchange in meiotic homologous recombination during a meiotic event in a first cell according to the method of any one of claims 1 to 10, crossing the viable gamete produced by the meiotic event with a second gamete to obtain progeny plants, and measuring the genetic linkage between genetic markers in the progeny plants.
13. A plant cell of a plant species, comprising a recombinant nucleic acid encoding:
a protein, wherein the protein comprises five conserved motifs present in SPO 11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSPO11-1);
tyrosine at a position corresponding to tyrosine 103 of AtSPO11-1;
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein said nucleic acid is operably linked to a promoter, and wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the plant cell increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
a protein, wherein the protein comprises five conserved motifs present in SPO 11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSPO11-1);
tyrosine at a position corresponding to tyrosine 103 of AtSPO11-1;
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein said nucleic acid is operably linked to a promoter, and wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, wherein expression of the protein in the plant cell increases the frequency of homologous non-sister chromatid exchange during the meiotic event.
14. A plant cell of a plant species, comprising a recombinant nucleic acid encoding:
a protein, wherein the protein comprises five conserved motifs present in SPO11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSPO11-1);
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein the protein lacks a tyrosine at a position corresponding to tyrosine of AtSPO11-1, wherein the protein is operable to inhibit double strand break catalysis by an endogenous SPO11 protein, and wherein said nucleic acid is operably linked to a promoter, wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, and wherein expression of the protein in the plant cell decreases the frequency of homologous non-sister chromatid exchange during the meiotic event.
a protein, wherein the protein comprises five conserved motifs present in SPO11 proteins, wherein the five conserved motifs correspond to residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis thaliana (AtSPO11-1) when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, and wherein, when the amino acid sequences of the protein and AtSPO11-1 are aligned using the BLAST algorithm, the protein further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana (AtSPO11-1);
arginine at a position corresponding to arginine 130 of AtSPO11-1;
glycine at a position corresponding to glycine 141 of AtSPO11-1;
glutamate at a position corresponding to glutamate 189 of AtSPO11-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSPO11-1;
leucine at a position corresponding to leucine 197 of AtSPO11-1;
glycine at a position corresponding to glycine 215 of AtSPO11-1;
proline at a position corresponding to proline 217 of AtSPO11-1;
threonine at a position corresponding to threonine 221 of AtSPO11-1;
arginine at a position corresponding to arginine 222 of AtSPO11-1;
aspartate at a position corresponding to aspartate 241 of AtSPO11-1;
proline at a position corresponding to proline 244 of AtSPO11-1;
glycine at a position corresponding to glycine 246 of AtSPO11-1; and isoleucine at a position corresponding to isoleucine 249 of AtSPO11-1, wherein the protein lacks a tyrosine at a position corresponding to tyrosine of AtSPO11-1, wherein the protein is operable to inhibit double strand break catalysis by an endogenous SPO11 protein, and wherein said nucleic acid is operably linked to a promoter, wherein the plant cell is operable to undergo a meiotic event to produce a viable gamete, and wherein expression of the protein in the plant cell decreases the frequency of homologous non-sister chromatid exchange during the meiotic event.
15. The plant cell of claim 13 or claim 14, wherein the protein has an amino acid sequence that has at least 90% sequence identity to a naturally occurring protein obtained from the plant species when using the BLAST algorithm.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA2422362A CA2422362C (en) | 2000-09-15 | 2001-09-12 | Modulation of meiotic recombination |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA 2319247 CA2319247A1 (en) | 2000-09-15 | 2000-09-15 | Modulation of meiotic recombination |
CA2,319,247 | 2000-09-15 | ||
US24929600P | 2000-11-17 | 2000-11-17 | |
US60/249,296 | 2000-11-17 | ||
US25649000P | 2000-12-20 | 2000-12-20 | |
US60/256,490 | 2000-12-20 | ||
CA2422362A CA2422362C (en) | 2000-09-15 | 2001-09-12 | Modulation of meiotic recombination |
PCT/CA2001/001306 WO2002022811A2 (en) | 2000-09-15 | 2001-09-12 | Modulation of meiotic recombination |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2422362A1 CA2422362A1 (en) | 2002-03-21 |
CA2422362C true CA2422362C (en) | 2015-03-24 |
Family
ID=27427643
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA2422362A Expired - Lifetime CA2422362C (en) | 2000-09-15 | 2001-09-12 | Modulation of meiotic recombination |
Country Status (1)
Country | Link |
---|---|
CA (1) | CA2422362C (en) |
-
2001
- 2001-09-12 CA CA2422362A patent/CA2422362C/en not_active Expired - Lifetime
Also Published As
Publication number | Publication date |
---|---|
CA2422362A1 (en) | 2002-03-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8674179B2 (en) | Modifying the DNA recombination potential in eukaryotes | |
Vergunst et al. | Recombination in the plant genome and its application in biotechnology | |
US20040101880A1 (en) | Replicative in vivo gene targeting | |
US8932860B2 (en) | Retrons for gene targeting | |
US9309525B2 (en) | Modulation of meiotic recombination | |
EP1027447A2 (en) | Methods for obtaining plant varieties | |
US8716022B2 (en) | Modulation of meiotic recombination | |
CA2422366A1 (en) | Targeted genetic manipulation using mu bacteriophage cleaved donor complex | |
CA2422362C (en) | Modulation of meiotic recombination | |
EP1362114B1 (en) | Replicative in vivo gene targeting | |
AU2008200988B2 (en) | Replicative in vivo gene targeting | |
Cuming | Mosses as model organisms for developmental, cellular, and molecular biology | |
Jia | DNA repair and gene-targeting in plant end-joining mutants | |
CA2437790C (en) | Replicative in vivo gene targeting | |
CA2319247A1 (en) | Modulation of meiotic recombination | |
ROZWADOWSKI et al. | Patent 2488328 Summary | |
ROZWADOWSKI et al. | Sommaire du brevet 2488328 | |
AU2002229450A1 (en) | Replicative in vivo gene targeting | |
Kuang | Studies of site-specific DNA double strand break repair in plants | |
Kyryk | DSB repair by illegitimate and homologous DNA recombination in Arabidopsis thaliana | |
Kumar | Genetic transformation of plants by gene targeting. | |
Fritsch | Isolation and characterization of" Arabidopsis" mutants with altered homologous recombination levels: a new function for an INO80 SWI/SNF ATPase | |
Yehuda | Characterization of meiotic recombination in Arabidopsis thaliana | |
SHRIVASTAVA | Gene Targeting in Higher Plants |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKEX | Expiry |
Effective date: 20210913 |