CA2422288A1 - Novel mammalian receptor genes and uses - Google Patents

Abstract

The present invention relates to novel mammalian biogenic amine receptor proteins and genes that encode such proteins. The invention is directed towa rd the isolation and characterization of mammalian trace amine receptor protein s. The invention specifically provides isolated complementary DNA copies of mRN A corresponding to rat and human homologues of a mammalian trace amine recepto r gene. Also provided are recombinant expression constructs capable of expressing the mammalian trace amine receptor genes of the invention in cultures of transformed prokaryotic and eukaryotic cells, as well as such cultures of transformed cells that synthesize the mammalian trace amine receptor proteins encoded therein. The invention also provides methods for screening compounds in vitro that are capable of binding to the mammalian trace amine receptor proteins of the invention, and further characterizing t he binding properties of such compounds and functional consequences thereof in comparison with known trace amine receptor agonists and antagonists. Improve d methods of pharmacological screening are provided thereby.

Description

NOVEL MAMMALIAN RECEPTOR GENES AND USES
This invention was made with government support under National Institute of Health grants DA08562. The government has certain rights to this invention.
BACKGROUND OF THE INVENTION
1. Field of the Invention This invention relates to biogenic amine receptors from mammalian species and the genes corresponding to such receptors. Specifically, the invention relates to the isolation, cloning and sequencing of complementary DNA (cDNA) copies of messenger RNA (mRNA) encoding a novel mammalian biogenic amine receptor gene. The invention also relates to the construction of recombinant expression constructs comprising cDNA of this novel receptor gene, said recombinant expression constructs being capable of expressing receptor protein in cultures of transformed prokaryotic and eulcaryotic cells. Production of the receptor protein in such cultures is also provided. The invention relates to the use of such cultures of such transformed cells to produce homogeneous compositions of the novel biogenic amine receptor protein. The invention also provides cultures of such cells producing this receptor protein for the characterization of novel and useful drugs. Antibodies against and epitopes of this novel biogenic amine receptor protein are also provided by the invention.

2. Background of the Invention Biogenic amines are a class of naturally-occurring amino acid derivatives having a variety of physiological effects in the peripheral and central nervous systems.
The parent compound is ~-phenylethylamine, and derivatives of this compound include the biogenic amines. The biogenic amines are a large and diverse class of compounds that include dopamine, noradrenaline, epinephrine, norepinephrine, and serotonin. The biogenic amines are implicated in a variety of psychiatric and neurologic disorders.
In the periphery, biogenic amines are released by the sympathetic nervous system and adrenal medulla and are involved in integrating physiological responses to stress, while in the central nervous system the biogenic amines constitute some of the most important neurotransmitter systems.

The effects of biogenic amines are mediated thr ough their receptors and their associated cell signaling systems (reviewed in Hoffman & Leflcowitz,1982, Ann.
Rev.
Physiol. 44: 475-484; Civelli et al., 1993, Ann. Rev. Pha~°m. & Tox.
33: 281-307).
These receptors are located in the plasma membr ane of biogenic amine-sensitive cells.
Structurally, they are characterized by having a pattern of seven transmembrane domains (see, for ezanaple, U.S. Patent Nos. 5,422,265, 5,569,601, 5,594,108, 5,883,226, 5,880,260, 5,427,942 and 5,686,573). Functionally, certain of these receptors interact with adenylate cyclase, either stimulating or inhibiting the production of cyclic AMP thereby. These receptors include the adrenergic receptors l o (the a-1, a-2, b-1, b-2, and b- 3 adrenergic receptors) and the dopamine receptors (the DI-, DZ-, D3-, D_~-, and DS- dopamine receptors).
Fox example, epinephr ine (adrenaline) and norepinephrine, as well as synthetic agonists of these biogenic amines which mimic their biological functions, and antagonists which block these biological functions, exert their effects by binding to specific recognition sites, (membrane receptors) situated on the cell membranes in the nervous system; Two principal classes of adrenergic receptors have been defined, the alpha-adrenergic receptors and the beta-adrenergic receptors: Five subtypes of adrenergic receptors (a-1, a-2, b-1, b-2, and b-3 adrenergic receptors) have now been distinguished. The genes encoding these receptors have been isolated and identified (Cotecchia et al., 1988, Proc. Natl. Acad. Sci. USA 85: 715,9-7163; I~obillca et al., 1987, Science 238: 650-656; Frielle et al., 1987, Proc. Natl. Acad. Sci. USA
84:
7920-7924; Emorine et al., 1987, Proc. Natl. Acad. Sci. USA 84: 6995-6999;
Emorine et al., 1989, Scierace 245: 1118-1121). Analysis of these genes has made it possible to recognize that they belong to a family of integral membrane receptors exhibiting some homology (Dixon et al., 1998, Annual Reports in Medicinal Chemistry, 221-223;
Emorine et al., 1988, Proc. NATO Adv. Res. YForhshop), especially at portions of the seven transmembrane regions that are coupled to regulatory proteins, called G
proteins, capable of binding molecules of guanosine triphosphate (GTP).
These membrane receptors, after they have bound the appropriate ligand (agonist or antagonist), are understood to undergo a conformational change that induces an intracellular signal that modifies the behavior of the target cell.
Beta-adrenergic receptors catalyze the activation of a class of G proteins, which in turn stimulates the activity of adenylate cyclase when they bind with biogenic amine agonists, whereas alpha-adrenergic receptor antagonists act in competition with the agonists for the binding to the receptor and prevent the activation of adenylate cyclase.
When adenylate cyclase is activated, it catalyses the production of an intracellular mediator or second messenger, especially cyclic AMP.
In the central nervous system, dopamine is a biogenic amine neurotransmitter that modulates neuronal cells involved in movement initiation, appetitive behavior, hormone release, and visual darle adaptation. In the periphery dopamine plays a role in modulating blood pressure and renal function (see generally Cooper et al., 1978, THE BIOCHEMICAL BASIS OF NEUROPHARMACOLOGY, 3d ed., Oxford University Press, New York, pp, 161-195). The diverse physiological actions of dopamine are in turn 1 o mediated by its interaction with a family of distinct dopamine receptors subtypes that are either "D 1-like" or "D2-like,", which respectively stimulate and inhibit the enzyme adenylate cyclase (Kebabian & Calne, 1979, Nature 277: 93-96). Alterations in the number or activity of these receptors may be a contributory factor in disease states such as Parlcinson's disease (a movement disorder) and schizophrenia (a behavioral disorder) and attention deficit hyperactivity disorder (ADHD).
A gr eat deal of information has accumulated regarding the biochemistry of the D1 and D2 dopamine receptors, and methods have'been developed to solubilize and purify these receptor proteins (see Senogles et al., 1986, Biochemistry 25:
749-753;
Sengoles et al., 1988, J. Biol. Chem. 263: 18996-19002; Gingrich et al., 1988, , Bioclzemistzy 27: 3907-3912). The D1 dopamine receptor in several tissues appears to be a glycosylated membrane protein of about 72 1cD (Amlailcy et al., 1987, Mol.
Phaz°znacol. 31: 129-134; Ninzik et al., 1988, Bioclzeznistzy 27: 7594-7599). The D2 receptor can also be glycosylated and has been suggested to have a higher molecular weight of about 90-150 1D (Amlaiky & Caron, 1985, J. Biol. Claem. 260: 1983-1986;
2s Amlailcy & Caron, 1986, J. Neuroclzenz. 47: 196-204; Jarvie et al., 1988, Mol.
Plzaz°zzzacol. 34: 91-97).
Dopamine receptors are primary targets in the clinical treatment of psycho-motor disorders such as Parkinson's disease and affective disorders such as schizophrenia (Seeman et al., 1987, Neuropsych.opharzn. 1: 5-15; Seeman, 1987, 3o Synapse 1: 152-333). Five different dopamine receptor genes (D1, D2, D3, D4 and DS) and various splice variants of their transcripts have been cloned as a result of nucleotide sequence homology which exists between these receptor genes (Bunzow et al., 1988, Nature 336: 783-787; Grandy et al., 1989, Pz°oc. Natl. Acad.
~S"ci. USA 86:
9762-9766; Dal Toso et al., 1989, EMBO J. 8: 4025-4034; Zhou et al., 1990, Nature 346: 76-80; Sunahara et al., 1990, Nature 346: 80-83; Solcoloff et al., 1990, Nature 347: 146-151; Civelli et al., 1993, Anrau. Rev. Phar~sraacol. Toxicol. 33: 281-307; Van Tol et al., 1991, Nature 350: 610-4).
Biogenic amine receptors are also targets for a host of therapeutic agents for the treatment of shoclc, hypertension, arrhythmias, asthma, migraine headache, and anaphylactic reactions, and include antipsychotic drugs that are used to treat schizophrenia and (3-bloclcers used to control high blood pressure.
In addition to these compounds, a number of biogenic amines are present in much lower quantities (less than 1 % of the biogenic amines) and are therefore known 1o as trace amines. The trace amines include such compounds as para-tyramine (p tyramine), yneta-tyramine (rn-tyramine), phenylethylamine, octopamine, and tryptamine. The trace amines (3-phenethylamine ((3 -PEA), p-tyramine, tryptamine, and octopamine are found in peripheral tissues as well as the central nervous system (Tallman et al., 1976, JPlaa~°snacol Exp Then 199: 216-221; Paterson et al., 1990, J
Nem°oclaern 55: 1827-37). In vivo ~3 -PEA andp-tyramine can be synthesized from phenylalanine or tyrosine by the enzyme amino acid decarboxylase. (Boulton and Dyclc, 1974, Life Sci 14: 2497-2506; Tallman et al., 1976, ibid.).
Investigations into the effects of trace amines on smooth muscle and glandular preparations early in the twentieth century clearly demonstrated that amines produced 2o by putrefaction and lacking the catechol nucleus were capable of producing robust sympathomimetic effects (Barger and Dale, 1910, JPhysiol 41: 19-59). Currently it is thought thatp-tyramine and (3 -PEA manifest their peripheral effects by promoting the efflux of catecholamines from sympathetic neurons and adrenals (Schonfeld and Trendelenburg, 1989, Naunyn Schyniedebe~°g's Anch Phas°macol 339: 433-440;
Mundorf et al., 1999, J Neuf°oclaefn 73: 2397-2405) which results in the indirect stimulation of adrenergic receptors (Black et al., 1980, Eur JPhanrraacol 65:
1-10).
Sensitive techniques have been developed to detect low concentrations of trace amines in the central nervous system. Such studies have revealed that trace amines in the centxal nervous system have a high turnover rate (Meek et al., 1970, J.
3o Neurochena.17: 1627-1635; Lemberger et al., 1971, J. Pha~°naac. Exp.
Ther. 177:169 176; Wu & Boulton, 1974, Can. J. Biochem. 52: 374-381; Durden & Philips, 1980, J
Neurocherra. 34: 1725-1732). Trace amines are expressed throughout the brain in a heterogenous pattern and at least two of them can pass easily across the blood-brain-barrier (Boulton, 1974, Lafacet ii: 7871; Oldendorf, 1971, Afn. J Plzysiol.
221: 1629-1639). Trace amines are also lcnown to potentiate caudate neuronal firing in response to dopamine application and act as sympathomimetics by stimulating release of biogenic amines from brain preparations and synaptosomes when applied at high concentrations. Para-tyramine may act as a "false transmitter" in a manner similar to that of amphetamine by triggering release of neurotransmitters such as dopamine.
The abilities ofp-tyramine and (3-PEA to deplete neurotr ansmitter from storage vesicles, compete with neurotransmitters for uptake, and stimulate outward neurotransmitter flux through the plasma membrane carriers are similar to the actions of the [3-PEA analog, a-methyl-(3-phenethylamine, better known as amphetamine (Amara and Sonders, 1998, Drug Alco7~ol Depend 51:87-96; Seiden et al., 1993).
Amphetamines were originally marketed as stimulants and appetite suppressants, but their clinical use is now mostly limited to treating attention deficit hyperactivity disorder (Seiden et al., 1993, Annu Rev Plaaj°tnacol Toxicol 33:639-677): Although listed as controlled substances, amphetamines are widely consumed because of their ability to produce wakefulness and intense euphoria. Some substituted amphetamines, such as MDMA ("ecstasy") and DOI, are taken for their "empathogenic" and hallucinogenic effects. (Eisner, 1994, Ecstasy: The MDMA stofy. Ronin Books, Berlceley, CA; Shulgin and Shulgin, 1991, PiHKAL: A cl2enaical love stoYy.
Transform Press, Berkeley, CA). Numerous liabilities are associated with the use of 2o amphetamines including hyperthermia (Byard et al., 1998, Am JForensic Med Pathol 19: 261-265), neurotoxicity (Ricaurte and McCann, 1992, Ann NYAcad Sci 648:

382), psychosis (Seiden et al., 1993, ibid.), and psychological dependence (hurray, 1998, J Psychol 132: 227-237). In addition to the actions of amphetamines at biogenic amine transporters, it is also clear that a subset of amphetamine analogs, especially those with hallucinogenic properties, can act directly on 5-HT
receptors as they have much higher affinities for these sites than for the transporters (hare1c and Aghajanian, 1998, Drug Alcohol Depend 51:189-198).
The importance of biogenic amines and their receptors, particularly in the brain and central nervous system, has created the need for the isolation of additional biogenic amine receptors, particularly trace amine receptors, for the development of therapeutic agents for the treatment of disorders, including disorders of the CNS and most preferably treatment of disorders on mental health such as psychosis, in which biogenic amines and their receptors have been implicated. There is also a need for developing new tools that will permit identification of new drug lead compounds for developing novel drugs. This is of particular importance for psychoactive and psychotropic drugs, due to their physiological importance and their potential to greatly benefit human patients treated with such drugs. At present, few such economical systems exist. Conventional screening methods require the use of animal brain slices in binding assays as a first step. This is suboptimal for a number of reasons, including interference in the binding assay by non-specific binding of heterologous (i.
e., non-receptor) cell surface proteins expressed by brain cells in such slices;
differential binding by cells other than neuronal cells present in the brain slice, such as glial cells or blood cells; and the possibility that putative drug binding behavior in animal brain 1o cells will differ from the binding behavior in human brain cells in subtle but critical ways. The ability to synthesize human biogenic amine receptor molecules ifa vitro would provide an efficient and economical means for rational drug design and rapid screening of potentially useful compounds. For these and other reasons, development of ifz vita°o screening methods for psychotropic drugs has numerous advantages and is a major research goal in the pharmaceutical industry.
SUMMARY OF THE INVENTION
The present invention relates to the cloning, expression and functional characterization of a mammalian biogenic amine receptor gene. The invention 2o comprises nucleic acids having anucleotide sequence of a novel mammalian biogenic amine receptor gene .that specifically binds to trace amines. The nucleic acids provided by the invention comprise a complementary DNA (cDNA) copy of the corresponding mRNA transcribed ih vivo from the biogenic amine receptor genes of the invention. In one preferred embodiment, the marmnalian biogenic amine receptor ' is a human biogenic amine receptor. In another preferred embodiment, the mammalian biogenic amine receptor is a rat (Rattus nonvegicus) biogenic amine receptor.
Also provided are the deduced,amino acid sequence of the cognate proteins of the cDNAs provided by the invention, methods ofmalcing said cognate proteins by expressing the cDNAs in cells transformed with recombinant expression constructs comprising said 3o cDNAs, and said recombinant expression constructs and cells transformed thereby.
This invention in a first aspect provides nucleic acids, nucleic . acid hybridization probes, recombinant eulcaryotic expression constructs capable of expressing the biogenic amine receptors of the invention in cultures of transformed cells, and such cultures of transformed eulcaryotic cells that synthesize the biogenic amine receptors of the invention. In another aspect, the invention provides homogeneous compositions of the biogenic amine receptor proteins of the invention, and membrane and cytosolic preparations from cells expressing the biogenic amine receptor proteins of the invention, as well as antibodies against and epitopes of the biogenic amine receptor proteins of the invention. The invention in another aspect provides methods for malting said homogenous preparations and membrane and cytosolic preparations using cells transformed with the recombinant expression constructs of the invention and expressing said biogenic amine receptor proteins thereby. Methods for characterizing the receptor and biochemical properties of these 1o receptor proteins and methods for using these proteins in the development of agents having pharmacological uses related to these receptors are also provided by the -invention.
In a first aspect, the invention provides a nucleic acid having a nucleotide sequence encoding a mammalian biogenic amine receptor. In a first preferred embodiment, the nucleic acid encodes a human biogenic amine receptor. In this embodiment of the invention, the nucleotide sequence comprises 1125 nucleotides of human biogenic amine receptor cDNA comprising 1040 nucleotides of coding sequence, 20 nucleotides of 5' untranslated sequence and 85 nucleotides of 3'.
untranslated sequence. In this embodiment of the invention, the nucleotide sequence of the biogenic amine receptor is the nucleotide sequence depicted in Figure 1 (SEQ
ID No: l). The sequence shown inFigure 1 will be understood to represent one specific embodiment of a multiplicity of nucleotide sequences that encode the human biogenic amine receptor amino acid sequence (SEQ ID No,.: 2) of the invention and that these different nucleotide sequences are functionally equivalent and are intended.
to be encompassed by the claimed inveritiori. Further, it will be understood that the.
coding sequence comprising 1040 nucleotides-can be used to express the cognate protein without inclusion of either the 5' or 3' untranslated sequences. Iri addition, it will be understood that different organisms and cells derived therefrom express preferentially certain tRNAs corresponding to subsets of the degenerate.collection of 3o tRNAs capable of encoding certain of the naturally-occurring amino acids, and that embodiments of the multiplicity of nucleotide sequences encoding the amino acid sequence of the human biogenic amine receptor protein of the invention that are optimized for expression in specific prokaryotic and eulcaryotic cells are also encompassed by the claimed invention. Isolated nucleic acid derived from human genomic DNA and isolated by conventional methods using the human cDNA
provided by the invention is also within the scope of the claimed invention.
Finally, it will be understood that allelic variations of the human biogenic amine receptor, including naturally occurring and irr. vitro modifications thereof are within the scope of this invention. Each such variant will be understood to have essentially the same amino acid sequence as the sequence of the human biogenic amine receptor disclosed herein.
In a second preferred embodiment of this aspect of the invention, the nucleic acid encodes the rat biogenic amine receptor. In this embodiment of the invention, the 1o nucleotide sequence includes 999 nucleotides of the rat biogenic amine receptor cDNA comprising the coding sequence. In this embodiment of the invention, the nucleotide sequence of the biogenic amine receptor is the nucleotide sequence depicted in Figure 2 (SEQ ID No: 3). The sequence shown in Figure 2 will be understood to represent one specific embodiment of a multiplicity of nucleotide sequences that encode the rat biogenic amine receptor amino acid sequence (SEQ
ID
No.: 4) of the invention and that these different nucleotide sequences are functionally equivalent and are intended to be encompassed by the claimed invention. In addition, it will be understood that different organisms and cells derived therefrom express preferentially certain tRNAs corresponding to subsets of the degenerate collection of 2o tRNAs capable of encoding certain of the naturally-occurring amino acids, and that embodiments of the multiplicity of nucleotide sequences encoding the amino acid sequence of the rat biogenic amine receptor protein of the invention that are optimized for expression in specific prokaryotic and eulcaryotic cells are also encompassed by the claimed invention. Isolated nucleic acid derived from rat genomic DNA and isolated by conventional methods using the rat cDNA provided by the invention is also within the scope of the claimed invention. Finally, it will be understood that allelic variations of the rat biogenic amine receptor, including naturally occurring and iya vitro modifications thereof are within the scope of this invention. Each such variant will be understood to have essentially the same amino acid sequence as the sequence of the human biogenic amine receptor disclosed herein.
Mammalian biogenic amine receptor proteins corresponding to the human and rat cDNAs of the invention are a second aspect of the claimed invention. In a first embodiment, the mammalian biogenic amine receptor protein is a human biogenic amine receptor having a deduced amino acid sequence shown in Figure 1 (SEQ ID

No.: 2). In a second embodiment is provided said human biogenic amine receptor protein comprising a membrane or cytosolic preparation from a cell, most preferably a recombinant cell, expressing a nucleic acid encoding a human biogenic amine of the invention. In a thin d embodiment, the mammalian biogenic amine receptor protein is a s r at biogenic amine receptor having a deduced amino acid sequence shown in Figure 2 (SEQ ID No.:4). In a fourth embodiment is provided said rat biogenic amine receptor protein comprising a membrane or cytosolic preparation from a cell, most preferably a recombinant cell, expressing a nucleic acid encoding a rat biogenic amine of the invention.
1 o As provided in this aspect of the invention is a homogeneous composition of a mammalian biogenic amine receptor having a molecular weight of about 39kD or derivative thereof that is a human biogenic amine receptor having an amino acid sequence shown in Figure 1 and identified by SEQ ID No.: 2, said size being understood to be the predicted size of the protein before any post-translational 15 modifications thereof. Also provided is a homogeneous composition of a marmnalian biogenic amine receptor having a molecular weight of about 381cD or derivative thereof that is a rat biogenic amine receptor having an amino acid sequence shown in Figure 2 and identified by SEQ ID No.: 4, said size being understood to be the predicted size of the protein before any post-translational modifications thereof.
20 This invention provides both nucleotide and amino acid probes derived from the sequences herein provided. The invention includes probes isolated from either cDNA or genomic DNA, as well as probes made synthetically with the sequence information derived therefrom. The invention specifically includes but is not limited to oligonucleotide, nick-translated, random primed, or in vits°o amplified probes made 25 using cDNA or genomic clone of the invention encoding a mammalian biogenic amine receptor or fragment thereof, and oligonucleotide and other synthetic probes synthesized chemically using the nucleotide sequence information of cDNA or genomic clone embodiments of the invention.
It is a further object of this invention to provide such nucleic acid 3o hybridization probes to determine the pattern, amount and extent of expression of the biogenic amine receptor gene in various tissues of mammals, including humans.
It is also an object of the present invention to provide nucleic acid hybridization probes derived from the sequences of mammalian biogenic amine receptor genes of the invention to be used for the detection and diagnosis of genetic diseases. It is an object of this invention to provide nucleic acid hybridization probes derived from the nucleic acid sequences of the mammalian biogenic amine receptor genes herein disclosed to be used for the detection of novel related receptor genes.
The present invention also includes synthetic peptides made using the nucleotide sequence information comprising the cDNA embodiments of the invention.
The invention includes either naturally occurring or synthetic peptides which may be used as antigens for the production of biogenic amine receptor-specific antibodies, or useful as competitors of biogenic amine receptor molecules for agonist, antagonist or drug binding, or to be used for the production of inhibitors of the binding of agonists or antagonists or analogues hereof to such biogenic amine receptor molecules.
The present invention also provides antibodies against and epitopes of the mammalian biogenic amine receptor molecules of the invention. It is an object of the present invention to provide antibodies that are imW unologically ieactive to the biogenic amine receptors of the invention. It is a particular object to provide monoclonal antibodies against these biogenic amine receptors. Ilybridoma cell lines producing such antibodies are also objects of the invention. It is envisioned that such hybridoma cell lines may be produced as the 'result of fusion between a non-immunoglobulin producing mouse myeloma cell line and spleen cells derived from a mouse immunized with a cell line which expresses antigens or' epitopes of a 2o mammalian biogenic amine receptor of the invention. The present invention also provides hybridoma cell lines that produce such antibodies, and can be injected into a living mouse to provide an ascites fluid from the mouse that is comprised of such antibodies. It is a further object of the invention to provide immunologically-active epitopes of the mammalian biogenic amine receptor proteins of the invention.
Chimeric antibodies immunologically reactive against the biogenic amine receptor proteins of the invention are also within the scope of this invention.
The present invention provides recombinant expression constructs comprising a nucleic acid encoding a mammalian biogenic amine receptor of the invention wherein the construct is capable of expressing the encoded biogenic amine receptor in 3o cultures of cells transformed with the construct. A preferred embodiment of'such constructs comprises a human biogenic amine receptor cDNA depicted in Figure 1 (SEQ ID No.: 1), such constructsbeing capable of expressing the human biogenic amine receptor encoded therein in cells transformed with the construct.
Another preferred embodiment of such constructs comprises a rat biogenic amine receptor to cDNA depicted in Figure 2 (SEQ ID No.: 3), such constructs being capable of expressing the rat biogenic amine receptor encoded therein in cells transformed with the construct.
The invention also provides prokaryotic and more preferably eulcaryotic cells transformed with the recombinant expression constructs of the invention, each such cells being capable of and indeed expressing the mammalian biogenic amine receptor encoded in the transforming construct, as well as methods for preparing mammalian biogenic amine receptor proteins using said transformed cells.
The present invention also includes within its scope protein preparations of to prokaryotic and eulcaryotic cell membranes containing the biogenic amine receptor protein of the invention, derived from cultures of prokaryotic or eulcaryotic cells, respectively, transformed with the recombinant expression constructs of the invention.
The present invention also includes within its scope protein preparations of prolcaryotic and eulcaryotic cytoplasmic fractions containing the biogenic amine receptor protein of the invention, derived from cultures of prolcaiyotic or eulcaryotic cells, respectively, transformed with the recombinant expression constructs of the invention.
The invention also provides methods for screening compounds for their ability to inhibit, facilitate or modulate the biochemical activity of the mammalian biogenic 2o amine receptor molecules of the invention, for use in the in vitro screening of novel agonist and antagonist compounds. In preferred embodiments, cells transformed with a recombinant expression construct of the invention are contacted with such a compound, and the binding capacity of the compounds, as well as the effect of the compound on binding of other, known biogenic amine receptor agonists and antagonists, is assayed. Additional preferred embodiments comprise quantitative analyses of such effects.
The present invention is also useful for the detection of analogues, agonists or antagonists, lrnown or unlrnown, of the mammalian biogenic amine receptors of the invention, either naturally occurring or embodied as a drug. In preferred 3o embodiments, such analogues, agonists or antagonists may be detected in blood, saliva, semen, cerebrospinal fluid, plasma, lymph, or any other bodily fluid.
The biogenic amine receptors of the present invention are directly activated by a wide variety of clinically and socially important drugs, including amphetamines, ergot derivatives, and adrenergic agents. Thus, the receptors of the invention are useful for developing alternative pharmaceutical agents having the beneficial properties of these drugs without at least some of the deleterious effects, for example a propensity for addiction, as well as compounds that can inhibit or overcome said propensity for addition.
Specific preferred embodiments of the present invention will become evident from the following more detailed description of certain preferred embodiments and the claims.
to DESCRIPTION OF THE DRAWINGS
Figure I illustrates the nucleotide (SEQ ID No.: I) and amino acid (SEQ ID
No.:2) sequences of a human trace amine receptor.
Figure 2 illustrates the nucleotide (SEQ ID No.: 3) and amino acid (SEQ ID
No.:4) sequences of a rat trace amine receptor.
Figure 3 presents_ deduced amino acid sequences for the rat and human trace amine receptors aligned with other homologous G protein-coupled receptors.
Identities are outlined in black. Abbreviations are: rTAR, rat trace amine receptor;
hTAR, human trace amine receptor; NTR, orphan NeuroTransmitter receptor;
orphan GPCR57 and 58; D 1R, dopamine D1 receptor; B2aR, B2 adrenergic receptor;
SHT4c, 2o serotonin 5HT4C receptor. Arrowheads indicate positions designated as 5.42 and 5.43.
Figure 4 is a photograph of an autoradiogram of Northern analysis of total cellular RNA (20~g/lane) from human HEK293 cells expressing the human biogenic amine.receptor of the invention after transformation with a recombinant expression construct.
Figure SA is a photograph of an ethidium bromide-stained and ultraviolet light irradiated agarose gel containing DNA fragments produced by RT-PCR of RNA from rat brain tissues. The PCR products resolved on this gel are from the following rat brain regions, from which cDNA was synthesized from oligo(dT)-primed total RNA:
lane 1, pituitary gland; lane 2, hindbrain; lane 3, midbrain; lane 4, locus coeruleus;
lane 5, hypothalamus; lane 6, striatum; lane 7, olfactory bulb; lane 8, olfactory tubercle; lane 9, hippocampus; lane 10, cortex; lane 11, cerebellum; lane,12, thalamus;
lane 13, 1:100 dilution of human trace amine plasmid DNA.

Figure SB is an autoradiogram of a nylon membrane containing DNA
fragments transferred from the agarose gel shown in Figure SA and probed with labeled nucleic acid prepared from the coding sequence of the rat genomic clone encoding the rat trace amine receptor of the invention.
Figure 6 is a photograph of an autoradiogram of Northern analysis of RNA
from various rat cell lines expressing the rat trace amine receptor of the invention after transfection with a recombinant expression construct encoding the rat receptor. RNA
shown in this gel was obtained from the following cell lines: lane 1, LBP;
lane 2, baby hamster lcidney (BHK) cells; lane 3, rat insulinoma (RIMS) cells; lane 4, AR42J rat to pancreatic tumor cell line; lane 5, CHW cells; lane 6, GH4 rat pituitary cells; lane 7, GH3 rat pituitary cells; lane 8, AtT20 rat pituitary cells; lane 9, PC 12 rat adrenal gland cells; lane 10, SK-N-MC human neuroblastoma cells; lane 11, N4TG1 rat neuroblastoma cells; lane 12, NB4 cells; lane 13, LCS cells; lane 14, R2C rat Ledig cells.
Figure 7 is a photograph of an autoradiogram of Northern analysis of mRNA
expressed in various cell lines expressing a mammalian biogenic amine receptor ofthe invention after transfection with a recombinant expression construct encoding the rat biogenic amine receptor.
Figure 8A is a photograph of an ethidium bromide-stained and ultraviolet light irradiated agarose gel containing DNA fragments produced by RT-PCR ofRNA from rat tissues. The PCR products resolved on this gel are from the following rat tissues:
lane 1, liver, (oligo(dT) primed); lane 2, brain (dT); lane 3, spleen (dT);
lane 4, lung (dT); lane 5, heart (dT); lane 6, testis (dT); lane 7, kidney (dT); lane 8, intestine (dT);
lane 9, GOS-7 cell oligo(dT)-selected mRNA from cells transformed with the RC-RSV/rat biogenie amine receptor construct of the invention; lane 10, striatum (dT);
lane 11, midbrain (random primed; rp); lane 12, olfactory tubercle (rp); lane 13, cortex (ip + dT); lane 14, midbrain (dT); lane 15, olfactory tubercle (rp); lane 16, olfactory bulb (dT); lane 17, hippocampus (dT); lane 18, midbrain (dT); lane 19, thalamus (dT);
lane 20, striatum (dT); lane 21, olfactory bulb (dT); lane 22, water (negative control).
3o Figure 8B is an autoradiogram of a nylon membrane containing DNA
fragments transferred from the agarose gel shown in Figure 8A and probed with 3zP-labeled nucleic acid prepared from the full-length rat genomic clone encoding the rat trace amine receptor of the invention.

Figures 9A through 9D are photographs of fluorescence in. situ hybridization analysis of human chromosomes probed with a fluorescently-labeled human artificial chromosome (BAC) containing the human biogenic amine receptor DNA (BAC
obtained from Research Genetics, Release IV of DNA pools, Catalog #96001;
clone address: plate 278, Row D, Column 22). Figure 9E is a schematic diagr am of human chromosome 6 denoting the location of the human biogenic amine locus at 6q23.2.
Figures 10A is a graph showing the ability of various endogenous compounds to stimulate the rat trace amine receptor heterologously expressed in HEK 293 cells in a dose-dependent manner.
to Figure lOB is a graph showing the ability of various synthetic compounds to stimulate the rat trace amine receptor heterologously expressed in HEK 293 cells in a dose-dependent manner.
Figures 11A through 11 C .are photographs of immunohistochemical staining of FiEK 293 cells expressing epitope-tagged rat trace amine receptor. M1 tagged receptors were bound to anti-FLAG antibodies followed by Cy5 goat anti-mouse IgG
in the absence (Figure 11A) or presence (Figure 11B) of 0.1% Triton X-100.
Control cells shown in Figure 11C express dopamine D1 ,receptors and were stained with antibodies, in the presence of Triton X-100.
Figures 12A through-12G are graphs showing assays of cAMP production in 2o HEK 293 cells stably transfected with the rat receptor of the invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The terms "mammalian biogenic amine receptor" and "trace amine receptor"
as used herein refer to proteins consisting essentially of, and having substantially the same biological activity as, the protein encoded by the amino acid depicted in Figure 1 (SEQ ID No.: 2) and Figure 2 (SEQ ID No.: 4). This definition is intended to encompass natural allelic variations in the disclosed biogenic, trace amine receptor.
Cloned nucleic acid provided by the present invention may encode trace amine receptor protein of any species of origin, including, for example, mouse, rat, rabbit, cat, and human, but preferably the nucleic acid provided by the invention encodes trace amine receptors of mammalian, most preferably rat and human, origin.
The nucleic acids provided by the invention comprise DNA or RNA having a nucleotide sequence encoding a mammalian trace amine receptor. Specific embodiments of said nucleic acids are depicted in Figure 1 (SEQ ID No.: 1) or Figure 2 (SEQ ID No.: 3), and include any nucleotide sequence encoding a mammalian biogenic amine receptor having an amino acid sequence as depicted in Figure 1 (SEQ
ID No.: 2) or Figure 2 (SEQ ID No.: 4). Nucleic hybridization probes as provided by the invention comprise any portion of a nucleic acid of the invention effective in nucleic acid hybridization under stringency conditions sufficient for specific hybridization. Mixtures of such nucleic acid hybridization probes are also within the scope of this embodiment of the invention. Nucleic acid probes as provided herein are useful for isolating mammalian species analogues of the specific embodiments of the 1 o nucleic acids provided by the invention. Nucleic acid probes as provided herein are also useful for detecting mammalian trace amine receptor gene expression in cells and tissues using techniques well-known in the art, including but not limited to Northern blot hybridization, izz situ hybridization and Southern hybridization to reverse transcriptase - polymerase chain reaction product DNAs. The probes provided by the present invention, including oligonucleotides probes derived therefrom, are also useful for Southern hybridization of mammalian, preferably human, genomic DNA for screening for restriction fragment length polymorphism (RFLP) associated with certain genetic disorders.
The pr oduction of proteins such as mammalian biogenic amine receptors from cloned genes by genetic engineering means is well known in this art. The discussion that follows is accordingly intended as an overview of this held, and is not intended to reflect the full state of the art.
Nucleic acid encoding a trace amine receptor may be obtained, in view of the instant disclosure, by chemical synthesis, by screening reverse transcripts of mRNA
from appropriate cells or cell line cultures, by screening genomic libraries from appropriate cells, or by combinations of these procedures, in accordance with known procedures as illustrated below. Additionally, sequences of such receptors can be obtained from any species in which the contentof the species genomic DNA has been determined and assembled in a database or other searchable compilation, using search 3o programs lrnown in the art and the sequences of the trace amine receptors disclosed herein. Screening of mRNA or genomic DNA may be carried out with oligonucleotide probes generated from the nucleic acid sequence information from mammalian trace amine receptor nucleic acid as disclosed herein. Probes may be labeled with a detectable. group such as a fluorescent group, a radioactive atom or a chemiluminescent group in accordance with lrnown procedures and used in conventional hybridization assays, as described in greater detail in the Examples below. In the alternative, mammalian biogenic amine receptor nucleic acid sequences may be obtained by use of the polymerase chain reaction (PCR) procedur e, using PCR
oligonucleotide primers corresponding to nucleic acid sequence information derived from a biogenic amine receptor as provided herein. See U.S. Patent Nos.
4,683,195 to Mullis et al. and 4,683,202 to Mullis.
Mammalian trace amine receptor protein may be synthesized in host cells transformed with a recombinant expression construct comprising a nucleic acid 1o encoding said receptor and comprising genomic DNA or cDNA. Such recombinant expression constructs can also be comprised of a vector that is a replicable DNA
construct. Vectors are used herein either to amplify DNA encoding a trace amine receptor and/or to express DNA encoding a trace amine receptor gene. For the purposes of this invention, a recombinant expression construct is a replicable DNA .
construct in which a nucleic acid encoding a trace amine receptor is operably linked to suitable control sequences capable of effecting the expression of the receptor in a suitable host.
The need for such control sequences will vary depending upon the host selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter, an optional operator or enhancer sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of tr anscription and translation.
Amplification vectors do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants. See, Sambroolc et al., 1990, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press: New Yorlc).
Vectors useful for practicing the present invention include plasmids, viruses (including phage and W ammalian DNA and RNA viruses), retroviruses; and integratable DNA fragments (i.e., fragments integratable into the host genome by 3o homologous recombination). The vector can replicate the gene of interest and function independently of the host genome, or can, in some instances, integrate into the genome itself. Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. A
preferred vector is RcRSV (obtained from Invitrogen, San Diego, CA). Another preferred vector is pcDNA3.1/VS/His-TOPO (Invitrogen, San Diego, CA). The pcDNA3.1/VS/His-TOPO vector expresses a receptor preceded at its amino terminus by a cleavable 16 amino acid signal sequence of the influenza hemaglutinin virus immediately followed by the 8 amino acid M 1-Flag epitope and then a two amino acid linker (MetGly) just before the initiation methionine (Guar et al., 1992, JBiol Chena, 267:21995-21998).
Transformed host cells are cells that have been transformed or transfected with recombinant expression constructs made using recombinant DNA techniques and comprising nucleic acid encoding a trace amine receptor protein. Cultures of cells to derived from multicellular organisms are a desirable host for recombinant biogenic amine receptor protein synthesis. In principal, any higher eulcaryotic cell culture is useful, whether from vertebrate or invertebrate culture. However, mammalian cells are preferred, as illustrated in the Examples. Propagation of such cells in cell culture has become a routine procedure. See Tissue Culture, Academic Press, Kruse &
Patterson, editors (1973). Examples of useful host cell lines are human embryonic lcidney (HEK) 293 cells, VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, mouse Ltlc cell lines and WI138, BHK, COS-7, CV, and MDCK cell lines.
Preferred host cells are HEK293 cells, COS-7 cells (Gluzman, 1981, Cell 23:

182) and Ltlt cells. Transformed host cells may express the trace amine receptor protein, but host cells transformed for purposes of cloning or amplifying nucleic acid hybridization probe DNA need not express the receptor. The trace amine receptor of the invention can be located in the host cell cytosol. Accordingly, the invention provides preparations of cell cytosolic fractions comprising the trace amine receptor protein of the invention, as well as purified, homogeneous preparations of the receptor protein itself. See, Sambroolc et al., ibid. The receptor of the invention may also be located in membranes from the host cell. Therefore, the invention provides preparations of said cell membranes comprising the trace amine receptor protein of the invention. See, Sambroolc et al., ibid.
The invention provides homogeneous compositions of mammalian trace amine 3o receptor protein produced by transformed eulcaryotic cells as provided herein. Each such homogeneous composition is intended to be comprised of a trace amine receptor protein that comprises at least 75%, more preferably at least 80%, and most preferably at least 90% of the protein in such a homogenous composition; in said homogeneous preparations, individual contaminating protein species are expected to comprise less than 5%, more preferably less than 2% and most preferably less than 1% of the preparation. The invention also provides membrane and cytosolic preparations from cells expressing mammalian trace amine receptor protein as the result of transformation with a recombinant expression construct, as described herein.
s Mammalian trace amine receptor pr oteins made from cloned genes in accordance with the present invention may be used for screening trace amine analogues, or trace amine receptor agonists or antagonists of trace amine binding, or for determining the amount of such agonists or antagonists are present in a solution of interest (e.g., blood plasma, cerebrospinal fluid or serum). For example, host cells may be transformed with a 1 o recombinant expression construct of the present invention, a mammalian trace amine receptor expressed in those host cells, and the cells, membranes or cytosolic fractions thereof used to screen compounds for their effect on trace amine receptor agonist binding activity. By selection of host cells that do not ordinarily express a trace amine receptor, pure preparations of membranes or cytosolic fractions containing the 15 receptor can be obtained. In a preferred embodiment, agonists (also referred to herein as stimulators) of the receptor of the present invention can be endogenous .
neurotransmitters or drugs. Neurotransmitters and drugs that activate the receptor are further described in the Examples section herein, and include p-tyramine, phenylethylaW ine, tryptamine, octopamine, synephrine, dopamine, serotonin, na-20 tyramine, . amphetamines, methamphetamines, MDMA, p-chloroamphetamine, betahistine, 1-phenylpiporazine, phemylephritie, apomorphine, metergoline, and ergot allcaloids. Agoiiists. fo'r the, trace 'amiye receptor include, bLlt are not limited to (3-phenethylamine (PEA), hordenine , L-tyrosinol, S,R-amphetamine (+ and. ), 4-OH-R(-)-amphetamine, rizethamphetamine (+ and -), (~~DOI, phenelzine, tranylcypromine, 25 3,4-DiMeO-PEA>Mescaliue, (~)MDMA, 3,4-dihydroxybenzylguanidine, 3-phenylpropylamine; 1; methyl-3'=phenylpropylamine, N,N-dimethylpropiophenone, N-phenylethylenediamine, ' lcyriuramine, 4-phenylbutylamine, tryptamine, 2-thiopheneethylamine, betahistine, 2>4>3-pyridylethylamine, 1-phenylpiperazine;

(1-napthyl)piperazine, 1;2,3,4-tetrahydroisoquinoline, (~)salsolinol, hydrocotarnine, 30 nomifensine, R(-)apomorphine, S(+)2-aminotetralin, R(-)2-aminotetralin, (~)2-amino-1,2-dihydronapthalene, (~)3A6HC, (~)2-aminoindan, MPTP, 4-phenyl-1,2,3,6-tetrahydropyridine, tolazoline, naphazoline, phentolamine, agroclavine, bromocriptine, lisuride, d-LSD, metergoline, (~)fenfluramine, fenspiride, 2-phenyl-2-imidazoline, methylphenidate, pargyline, 2,2-diphenylethylamine, trans-cinnamyl-piperazine, 1-benzyl-piperidine, rimantidine, tripelennamine, tryptamine/5-Me0-DMT, forslcolin, amphetamine/phentermine, cyproheptadine, dopamine, dihydroergotamine, fenoterol, HVA:D1 receptor, imidazoline/naphazoline, imidazoline/oxymetazoline, imidazoline/phentolamine, imidazoline/tolazoline, isoproterenol, metanephrine DL, methamphetamine/2-MeO, octopamine, PEA/2-amino 4-OH, PEA/3,4 dimethoxy, 4-OH-PEA/3-MeO, 4-amino-PEA, 4-methoxy-PEA, AEBSF-PEA, phenylephrine, piperazine/mCPP, piperazine/TFMPP, phenylpiperazine, prenylamine, 2-(2aminoethyl)pyradine, 3-(2aminoethyl)pyradine, 4-(2aminoethyl)pyradine, ritodrine, synephrine, tetralin/ADTN/6,7, 5-Fluoro-l0 tryptamine, N,N-dimethyl-tryptamine, tryptophanol (~), m-tyramine, p-tyramine, and most preferably 3-hyrdoxytyramine. Antagonists of the trace amine r eceptor include, but are not limited to phenylalanine, (~)N-ethylamphetamine, propylhexedrine, fenfluramine, deprenyl, norepinephrine, epinephrine, N,N,N-trimethyldopamine, dopamine-guanidine, dimethylsulfonium-DA, benzylamine, pargyline, tryptophan, carbooxamidotyptamine, histamine, 2-(2aminoethyl)1,3-dioxolane, iproniazid, isoniazid, l,l-dimethyl-4-phenylpiperazinium,, trans-1-cinnamylpiperazine, 1-(4Acetophenone)piperazine, quipazine, SH-I-101, PAPP (LY165,163), 4-OH,4-phenylpiperidine, HA-1, HA-2, HA-3, HA-4, HA-5, prazosin, 4-phenylpyrimidine, hydrastinine, boldine, (+)butaclamol, 3-aminocoumarin, MPP+, clonidine~
methysergide, aminorex, norapomorphine, N-butyl-amphetamine, benztropine, cis-fluphenthixol, diphenylpyraline, flunarizine, fluspirilene, GBR 12909, GBR
12935, LY (741, 626), nicardipine, reserpine, ritanserin, spiperone, thioridazine, and trifluoperazine.
A compound identified in a screen may be useful for treating various conditions associated with effects of unregulated trace amine activity as a result of endogenous or exogenous stimulation. , The present invention provides a pharmaceutical composition comprising the compound in admixture with a pharmaceutically acceptable carrier. In a preferred embodiment, a therapeutically effective amount of the pharmaceutical composition is administered to a patient with a 3o condition associated with unregulated trace amine activity. For example, the pharmaceutical composition of the present invention can be used to reduce sympathomimetic effects of enhanced trace amine transmission induced by elevated levels of trace amines or certain drugs. Common sympathomimetic effects include rapid heart rate, high blood pressure, agitation, cardiac arrythmia, seizures, and coma.

The pharmaceutical composition can also be used to treat peripheral effects of drugs, such as amphetamine. For example, the pharmaceutical composition of the present invention can be used to treat hyperthermia caused by amphetamine action. Some conditions that can be treated using a pharmaceutical composition of the present invention are pathological, such as schizophrenia, depression, etc. In addition, the pharmaceutical composition of the present invention can be used to treat drug addiction in a mammal, preferably a human.
Pharmaceutical compositions of the present invention can be manufactured in a manner that is itself known, e.g., by means of a conventional mixing, dissolving, l0 granulating, dragee-malting, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical compositions of the compounds of the present invention can be formulated and administered through a variety of means, including systemic, localized, or topical administration. Techniques for formulation and administration can be found in "Remington's Pharmaceutical Sciences," Maclc Publishing Co., Easton, PA. Pharmaceutical compositions for use in accordance with the present invention thus can be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
Non-toxic pharmaceutical salts include salts of acids such as hydrochloric, phosphoric, hydrobromic, sulfuric, sulfinic, formic, toluenesulfonic, methanesulfonic, nitic, benzoic, citric, tartaric, malefic, hydroiodic, allcanoic such as acetic, HOOC-(CHI)"-CHI where n is 0-4, and the like. Non-toxic pharmaceutical base addition salts include salts of bases such as sodium, potassium, calcium, ammonium, and the like. , Those slcilled in the art will recognize a wide variety of non-toxic pharmaceutically acceptable addition salts.
For injection, the compounds of the invention can be formulated in appropriate 3o aqueous solutions, such as physiologically compatible buffers such as Hanlcs's solution, Ringer's solution, or physiological saline buffer. For transmucosal and transcutaneous administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well lrnown in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the lilce, for oral ingestion by a patient to be treated.
Pharmaceutical preparations for oral use can be obtained with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions can be used, which can optionally contain gum arabic, talc, polyvinyl pyn olidone, carbopol gel, polyethylene glycol, andlor titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active compounds in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration should be in dosages suitable for such administration. For buccal administration, the compositions can take the form of 3o tablets or lozenges formulated in conventional manner.
For administration by inhalation, the active compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the active compound and a suitable powder base 'such as lactose or starch.
The active compounds can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, 1 o solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing andlor dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
1s Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension can also contain suitable stabilizers or agents that increase the 2o solubility of the compounds to allow for the preparation of highly concentrated solutions. Alternatively, the active compounds can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The active compounds can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter 25 or other glycerides.
In addition to the formulations described previously, the active compounds can also be formulated as a depot preparation. Such long acting, formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Tlius, for example, the active compounds can be formulated 3o with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions also can comprise suitable solid or gelphase carriers°or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
The active compounds of the invention can be provided as salts with pharmaceutically compatible counterions. Pharmaceutically compatible salts can be fomned with many acids, including but not limited to hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, phosphoric, hydrobromic, sulfinic, formic, toluenesulfonic, methanesulfonic, nitic, benzoic, citric, tartaric, malefic, hydroiodic, allcanoic such as acetic, HOOC-(CHZ)"-CH3 where n is 0-4, and the like. Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free 1 o base forms. Non-toxic pharmaceutical base addition salts include salts of bases such as sodium, potassium, calcium, ammonium, and the like. Those skilled in the art will recognize a wide variety of non-toxic pharmaceutically acceptable addition salts.
The mode of administration can be selected to maximize delivery to a desired target site in the body. Suitable routes of administration can, for example, include oral, rectal, transmucosal, transcutaneous, or intestinal administration;
parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intrariasal, or intraocular injections. Alternatively, one can administer the compound in a local rather than systemic manner, for example, via injection of the compound directly into 2o a specific tissue, often in a depot or sustained release formulation.
Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount effective to prevent development of or to alleviate the existing symptoms of the subject being treated. Determination of the effective amounts is well within the capability of those slcilled in the art, .especially in light of the detailed disclosure provided herein. ' For any compound used in the method of the invention, the therapeutically .
effective dose can be estimated initially from cell culture assays, as disclosed herein.
For example, a dose can be formulated in 'animal models to achieve a circulating concentration range that includes the EC50 (effective dose for 50% increase) as determined in cell culture, i. e.', the concentration of the test compound which achieves a half maximal inhibition of tumor cell growth in vitro. 'Such information can be used to more accurately determine useful doses in humans.
23 , It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination, the severity of the particular disease undergoing therapy and the judgment of the prescribing physician.
For administration to non-human animals, the drug or a pharmaceutical composition containing the drug may also be added to the animal feed or drinking water. It will be convenient to formulate animal feed and drinking water products 1o with a predetermined dose of the drug so that the animal takes in an appropriate quantity of the drug along with its diet. It will also be convenient to add a premix containing the drug to the feed or drinking water approximately immediately prior to consumption by the animal.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD5,0 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio between LD50 and ED50. Compounds that exhibit high therapeutic indices are 2o preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of, such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g. Fingl et czl., 1975, in "The Pharmacological Basis of Therapeutics", Ch.l, p.1).
The recombinant expression constructs of the present invention are useful in molecular biology to transform cells that do not ordinarily express a trace amine 3o receptor to thereafter express this receptor. Such cells are useful as intermediates for malting cell membrane or cytosolic preparations useful for receptor binding activity assays, which are in turn useful for drug screening. The recombinant expression constructs of the present invention thus provide a method for screening potentially useful drugs at advantageously lower cost than conventional animal screening protocols. While not completely eliminating the need for ultimate iu vivo activity and toxicology assays, the constructs and cultures of the invention provide an important first screening step for the vast number of potentially useful drugs synthesized, discovered or extracted from natural sources each year.
The recombinant expression constructs of the present invention are useful in molecular biology to detect, isolate, characterize and identify novel endogenous trace amine receptor agonists and antagonists found in plasma, serum, lymph, cerebrospinal fluid, seminal fluid, or other potential sources of such compounds. This utility thereby enables rational drug design of novel therapeutically-active drugs using currently-to available techniques (see Walters, "Computer-Assisted Modeling of Drugs", isa Klegennan & Groves, eds., 1993, Pharmaceutical Biotechnolo~y, Interpharm Press:
Buffalo Grove,.IL,, pp. 165-174).
The recombinant expression constructs of the present invention may also be useful in gene therapy. Cloned genes of the present invention, or fragments thereof, may also be used in gene therapy carried out homologous recombination or site-directed mutagenesis. See generally Thomas & Capecchi, 1987, Cell 51: 503-512;
Bertling, 1987, Bioscience Reports 7: 107-112; Smithies et al.; 1985, Nature 317:
230-234.
Nucleic acid and oligonucleotide probes as provided by the present invention 2o are useful as diagnostic tools for probing trace amine receptor gene expression in tissues of humans and other animals. For example, tissues are probed ira situ with oligonucleotide probes carrying detectable groups by conventional autoradiographic or other detection techniques, to investigate native expression of this receptor or pathological conditions relating thereto. Further, chromosomes can be probed to investigate the presence or absence of the corresponding trace amine receptor gene, and potential pathological conditions related thereto.
The invention also provides antibodies that are immunologically reactive to the trace amine receptor protein or epitopes thereof provided by the invention.
The antibodies provided by the invention may be raised, using methods well lrnown in the art, in animals by inoculation with cells that express a trace amine receptor or epitopes thereof, cell membranes from such cells, whether crude membrane preparations or membranes purified using methods well known in the art, cytosolic preparations, or purified preparations of proteins, including fusion proteins, particularly fusion proteins comprising epitopes of the trace amine receptor protein of the invention fused to heterologous proteins and expressed using genetic engineering means in bacterial, yeast or eulcaryotic cells, said proteins being isolated from such cells to varying degrees of homogeneity using conventional biochemical methods. Synthetic peptides made using established synthetic methods in vitf~o and optionally conjugated with heterologous sequences of amino acids, are also encompassed in these methods to produce the antibodies of the invention. Animals that are useful for such inoculations include individuals from species comprising cows, sheep, pigs, chiclcens, mice, rats, rabbits, hamsters, goats and primates. Preferred animals for inoculation are rodents (including mice, rats, hamsters) and rabbits. The most preferred animal is the mouse.
Cells that can be used for such inoculations, or for any of the other means used in the invention, include any cell line which naturally expresses the trace amine receptor provided by the invention, or more preferably any cell or cell line that expresses the trace amine receptor of the invention, or any epitope thereof, as a result of molecular or genetic engineering, or that has been treated to increase the expression of an endogenous or heterologous trace amine receptor protein . by physical, biochemical or genetic means. Preferred cells are mammalian cells, most preferably cells syngeneic with a rodent, most preferably a mouse host, that have been transformed with a recombinant expression construct ofthe invention encoding a trace amine receptor protein, and that express the receptor therefrom.
The present invention also provides monoclonal antibodies that are immunologically reactive with an epitope derived from a trace amine receptor of the invention, or fragment thereof, present on the surface of such cells. Such antibodies are made using methods and techniques well known to those of slcill in the art.
Monoclonal antibodies provided by the present invention are produced by hybridoma cell lines, that are also provided by the invention and that are made by methods well lcnown in the art.
Hybridoma cell lines are made by fusing individual cells of a myeloma cell line with spleen cells derived from animals immunized with cells expressing a trace amine receptor of the invention, as described above. The myeloma cell lines used in 3o the invention include lines derived from myelomas of mice, rats, hamsters, primates and humans. Preferred myeloma cell lines are from mouse, and the most preferred mouse myeloma cell line is P3X63-Ag8.653. The animals from which spleens are obtained after immunization are rats, mice and hamsters, preferably mice, most preferably Balb/c mice. Spleen cells and myeloma cells are fused using a number of methods well lrnown in the art, including but not limited to incubation with inactivated Sendai virus and incubation in the presence of polyethylene glycol (PEG). The most preferred method for cell fusion is incubation in the presence of a solution of 45%
(w/v) PEG-1450. Monoclonal antibodies produced by hybridoma cell lines can be s harvested from cell culture supernatant fluids :from in vitro cell growth;
alternatively, hybridoma cells can be inj ected subcutaneously and/or into the peritoneal cavity of an animal, most preferably a mouse, and the monoclonal antibodies obtained from blood and/or ascites fluid.
Monoclonal antibodies provided by the.present invention are also produced by 1o recombinant genetic methods well lrnown to those of skill in the art, and the present invention encompasses antibodies made by such methods that are immunologically reactive with an epitope of a trace amine receptor of the invention. , The present invention also encompasses fragments, including but not limited to Flab) and F(ab)~Z
fragments, of such antibody. Fragments are produced by any number of methods, 1 s including but not limited to proteolytic; or chemical cleavage, chemical synthesis or preparation of such fragments by means of genetic engineering technology. The present invention also encompasses single-chain antibodies that are immunologically reactive with an epitope of a trace amine receptor; made by methods known to those of skill in the art.
20 The present invention also encompasses an epitope of a trace amine receptor of the invention, comprised of sequences and/or a conformation of sequences present in the receptor molecule. This epitope may be naturally occurring, or may be the result .
of chemical or proteolytic cleavage of a receptor molecule and isolation of an epitope-containing peptide or may be obtained by chemical or isi vitro synthesis of an epitope-25 containing peptide using methods well lrnown to those skilled in the art.
The present, invention also encompasses epitope peptides produced as a result of genetic engineering technology and synthesized by genetically engineered prokaryotic or eulcaryotic cells.
The invention also includes chimeric antibodies, comprised of light chain and 30 heavy chain peptides immunologically reactive to a biogenic amine receptor-derived epitope. The chimeric antibodies embodied in the present invention include those that are derived from naturally occurring antibodies as well as chimeric antibodies made by means of genetic engineering technology well known to those of skill in the art.

The Examples that follow are illustrative of specific embodiments of the invention, and various uses thereof. They set forth for explanatory purposes only, and are not to be taken as limiting the invention.

Isolation of a Mammalian Biogenic Amine Receptor Probe by Random PCR Amplification of Rat Insulinoma cDNA Using Degenerate Oligonucleotide Primers In order to clone novel mammalian G-protein coupled receptors, cDNA
prepared from total cellular RNA obtained from a rat pancreatic tumor cell line AR42J
(ATCC Accession No. CRL-1492) was used as template for a polymerase chain reaction (PCR)-based random cloning experiment. PCR was performed using a pair of degenerate oligonucleotide primers corresponding to a consensus sequence of the third and sixth tr ansmembrane regions of known G-coupled receptors. PCR
products obtained in this experiment were characterized by nucleotide sequencing. A
full length clone was obtained by screening a rat genomic library using a cloned PCR
product encoding a novel G-protein coupled receptor as deduced by nucleotide sequencing and comparison with a sequence database (GenBanlc).
The PCR amplification experiments were performed as follows. Total RNA
2o was isolated from AR42J cells by the guanidinium thiocyanate method (Chirgwin et al., 1979, Biochemistry 18: 5294-5299). First-strand cDNA was prepared from this RNA using- standard techniques (see Sambrook et al., 1990, Molecular Cloning:
A
Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor Laboratory, N.Y.) using murine reverse transcriptase (BRL, Gaithersburg, MD) and oligo-dT
priming (Sambroolc et al., ibid.). The rat cDNA preparation was then subjected to 35 cycles of PCR amplification using 500 picomoles of degenerate oligonucleotide primers having the following sequence:
Primer III (sense):
GAGTCGACCTGTG(C/T)G(C/T)(C/G)AT(C/T)(A/G)CIIT(G/T)GAC(C/A)G(C/G)T
3o AC
(SEQ ID NO: 5) and Primer VI (antisense):
CAGAATTCAG(T/A)AGGGCAICCAGCAGAI(G/C)(G/A)(T/C)GAA
(SEQ 1D NO: G) in 30 ~L of a solution containing 50 mM Tris-HGl (pH 8.3), 2.5 mM MgCl2, 0.01%
gelatin, 250 ~M each dNTP, and 2.5 units of Taq polymerase (Sailci et al., 1988, Science 239: 487-491). Each PCR amplification cycle consisted of incubations at 94°C for 90 sec (denaturation), 50°C for 90 sec (annealing), and 72°C for 120 sec (extension) for 35 dycles.
Amplified products of the PCR reaction were separated on a 1.0% agarose gel (see Sambroolc et al., ibid.), and fragments ranging in size from 400 basepairs (bps) to 750 by were subcloned in the plasmid vector pBluescript (Stratagene, LaJolla, CA).
1 o Plasmid DNA from these clones was purified and the nucleotide sequence of the insert cDNA determined by the dideoxynucleotide chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. USA 74: 5463-5467) using Sequenase~ (U.S.
Biochemical Corp., Cleveland, OH). PCR products were identified by screening the GenBanlc database and identified a cloned fragment having a high degr ee of homology . to known biogenic amine receptors, as well as containing sequence motifs that are common to the G-protein coupled family of receptors, but that was not identical to any previously-identified biogenic amine receptor sequence.

20. Isolation of a Novel Mammalian Trace Amine Receptor cDNA
The cloned PCR product obtained in Example 1 was used to isolate a full-length clone from a rat genomic DNA library (obtained from Clonetech, Palo Alto, CA) as follows.
The 0.4 kb DNA fragment generated by PCR having high homology to known biogenic amine receptors was 32P-labeled using the random priming technique (Stratagene, San Diego CA). This probe was used to screen a rat genomic library that had been transferred to nylon membranes (Gene Screen Plus, NEN, Boston MA).
Hybridization was performed in 50% formamide, 5X SSC, 1% SDS, 5X Denhardt' solution, and salmon sperm DNA (50 ~g/mL) with the radioactive probe at 2x10 3o cpm/mL at 37°C for overnight. The nylon filters were then washed as follows: at room temperature in a solution of 2X SSC/ 0.1% SDS for 10 minutes, followed by a wash at 55°C in a solution of 2X SSC/ 0.1% SDS for 15 minutes, and finally a wash at 55°C in a solution of 0.5X SSC/ 0.1% SDS for 5 minutes. Filters were then exposed to XOMAT X-ray film (I~odalc) overnight. Filter hybridization was performed in duplicate to confine positive signals. Secondary and tertiary screens were performed until single homogenous clones were isolated.
This isolated genomic clone was then subjected to nucleotide sequence analysis. Nucleotide sequence analysis was performed essentially as described in Example l, and revealed the sequence of the rat biogenic amine receptor shown in Figure 2 (SEQ ID No.: 3). The putative protein product of the gene is also shown in Figure 2 (SEQ ID No: 4). The sequence was found to have an open reading frame comprising 996 nucleotides encoding a protein 332 amino acids in length, and having a predicted molecular weight of about 381cD lcilodaltons prior to post-translational modification. The sequence immediately 5' to the proposed initiation codon was found to contain several translation termination codons in-frame with the open reading frame, supporting the assignment of the translation start site. Predicted transmembrane domains ,(using the algorithm of Eisenberg et al. (1984, J.
Molec.
Biol. 179: 125-142)) are boxed and identified by Roman numerals (I-VII), and two sites of possible N-linlced glycosylation are identified in the amino-terminal portion of the protein with solid triangles. A potential protein lcinase C site was also found in the C-terminal tail.
The predicted amino acid sequences of the transmembrane domains of the novel biogenic amine receptor were compared with the corresponding sequences in the orphan NeuroTransmitter receptor, orphan GPCR57 and 5 8, human dopamine D

receptor, B2~ adrenergic receptor, and serotonin SHT4C receptor; the results of these comparisons are shown in Figure 3: Amino acid residues that are found in common between the different mammalian biogenic amine receptors are outlined in black. The predicted amino acid sequences of the transmembrane domains were also compared with corresponding sequences in human D 1 dopamine receptor, human D2 dopamine receptor, rat serotonin =lc receptor, rat al-b adrenergic receptor, rat serotonin 4 receptor, rat serotonin. la~receptor, human a-2 adrenergic receptor, and human histamine receptor (Probst et al., 1992, DNA Cell Biology 11: 1-20). A more detailed comparison of these amino acid sequences are quantified in Table I, showing the 3o percentage extent of homology in pairwise fashion between the different biogenic amine receptors.

TABLE I
Receptor % Identity human D 1 dopamine 40 human D2 dopamine 37 rat al-b adrenergic37 rat serotonin lc 35 rat a1 adrenergic 35 rat serotonin 4 35 rat serotonin la 34 human a2 adrenergic33 human H-2 histamine33 Comparisons are made individually at each transmembrane domain (TMI-TMVII), as an average over all transmembrane domains (TM avg) and as the average degree of amino acid sequence homology for each protein as a whole (avg/all).
These results support the conclusion that the novel mammalian receptor disclosed herein is a biogenic amine receptor. In addition, the certain amino acid residues in other G-' protein coupled receptors (such as Asp'°3 in TM III) were also found in the novel cloned receptor described herein. These data are consistent with the fact that the l0 biogenic amine receptors have a significantly higher homology to the novel receptor disclosed herein that' any other members of the G-protein coupled receptor family.
The sequence DRY (amino acids 120-123 in the human sequence and amino acids 119-122 in the rat sequence) is conserved in the majority of G-protein coupled receptors. Expression of this receptor in a rat insulinoma 'suggests that biogenic amines may play a role in pancreatic cell function.
The Asp in TMIII is thought to be a counterion to the positively charged amino group present in biogenic amines. In addition, the deduced amino acid sequence predicts a Ser in TMV, which would be able to form a hydrogen bond with the para-hydroxyl group of molecules such as the dopamine, norepinephrine, and epinephrine, as well as the trace amines para-tyramine, octopamine, and synephrine. One Ser was found in the receptor compared with the adrenergic and dopamine receptors, which contain an additional one or two Ser residues N-terniinal to the "SerPheTyrXaaPro"
(where "Xaa" is any residue) motif in TMV. However, an additional Thr is found directly N-terminal to the Ser that might hydrogen bond with ligands. In TMIV, there is a Trp that is found in the rhodopsin family of G-protein coupled receptors.
Distal and two residues proximal to this Trp, the receptor displays significant homology to members of the biogenic amine receptor family. In the C-terminal portion of,the deduced TMIV sequence there is a Pro residue G amino acids N-terminal of the 1 o generally conserved Pro residue found in TMIV of biogenie amine receptors.
Also, the two Ser residues in TMIV that are conserved among GPCRs activated by biogenic amines are not present in the novel receptor of the invention.
These results support the conclusion that the novel G-protein coupled receptor genes of the invention are biogenic amine receptors.

Construction of a Recombinant Expression Constructs, DNA Transfection and Functional Expression of the Novel Mammalian Biogenic Amine Receptor W order to biochemically characterize the novel mammalian (rat) biogenic amine receptor described in Example 2, and to confirm that it encodes a novel biogenic amine receptor, the rat cDNA was cloned into a mammalian expression construct (pRcRSVneo, obtained from Invitrogen, San Diego, CA), the resulting recombinant expression constl-uct transfected into COS-7 cells (for transient expression assays) and human embryonic lcidney cells (HEK293) for stable expression assays, and cell membranes (COS-7) or cell lines (HEK293) were generated that expressed the receptor protein in cellular membranes at the cell surface. Such cells and membranes isolated from such cells were used for biochemical characterization 3o experiments described below.
The entire coding region of the receptor DNA insert was amplified using PCR
as described above with primers specific for flanlcing sequences; such PCR
primers advantageously contained restriction enzyme digestion recognition sites at the 5' termini such that digestion with said restriction enzymes allowed facile cloning of the receptor cDNA into the RcRSVneo mammalian expression construct. PCR products generated in this way were subcloned in to the RcRSV vector using conventional techniques (see Sambroolc et al., ibid.) and the orientation of the inserted cDNA
confirnzed by restriction enzyme digestion analysis of insert-containing subclones.
Such recombinant expression constructs were introduced into COS-7 cells using the calcium-phosphate precipitation technique (Chen & Olcayama, 1987, Molec. Cell.
Biol. 7: 2745-2752), the transfected cells allowed to express the receptor for between 24-96 hours, and then cell membranes containing the receptor were isolated.
Such membranes were harvested fiom cells grown on l5cm plates by pelleting the cells at 20,000 rpm in a solution of 50mM Tris-HCl (pH 7.4). The protein concentration was adjusted to 15-80 ~g/sample for each of the binding studies described below.
to These recombinant expression constructs were also introduced into HEK293 cells using the calcium-phosphate precipitation technique, and stably-transfected clones were selected by growth in the mammalian neomycin analog 6418 (Grand Island Biological Co., Long Island, NY), as the vector RcRSV contains a functional copy of a bacterial neomycin resistance gene. Stable cell lines were then selected for membrane binding studies based on mRNA expression levels of individual neomycin-resistant transfected clones determined by Northern analysis (see Sambrook et al., ibid.). Cell membranes were prepared and used as described above for COS-7 cell transfectants.
Expression of the biogenic amine receptor gene in transfected cells was 2o verified by Northern blot analysis of individual transfectants, performed using conventional techniques. Total cellular was extracted from transfected cells using and RNA Easy lcit (obtained from Qiagen, Valencia, CA). For Northern hybridization,10 ~g of total cellular RNA was subjected to electrophoresis in a 1.2% agarose gel using HEPES/ EDTA buffer (pH 7.8) overnight. The electrophoresed RNA was then transferred to a GeneScreen Plus membrane (New England Nuclear, Boston, MA) by capillary transfer, and fixed to the membrane by balcing at 85°C for 1h. The membrane was then prehybridized overnight at 37°C in the following buffer: 50%
formamide, 1% sodium dodecyl sulfate (SDS), SX SSC (where 1X SSC is O.15M
NaCl/ O.O15M sodium citrate, pH 7), SO~g/mL denatured salmon sperm DNA, and SX
3o P-buffer (comprising 0.25M Tris, pH 7.5, 0.5% sodium pyrophosphate, 0.5%
SDS, 1% bovine serum albumin, 1% polyvinylpyrrolidone and 1% Ficoll (400,000 MW)).
After prehybridization, 32P-labeled DNA prepared from the full-length genomic receptor clone described above was added at a concentration of 3 x 106 cpm/mL
and the membrane hybridized overnight at 37°C. The hybridized membrane was then washed using the following high-stringency washing conditions: 10 min at room temperature in a wash solution of 2X SSC/ 1% SDS; 10 min at 60°C in 2X
SSC/ 1%
SDS; and finally 5 min at 60°G in 0.5X SC/ 1% SDS, where the washing solutions were changed between each washing step. The washed membrane was then exposed overnight to X-ray film (X-omat, I~odalc, Rochester, NY).
The results of these experiments are shown in Figure 4. As shown in the photograph, the transfected biogenic amine receptor is expressed in transfected HEK293 cells.
Specific binding assays using a variety of biogenic amine receptor agonists 1 o and antagonists were performed on membranes from both transient and stable transfectants. Ligand binding experiments were performed essentially as described in Bunzow et al. (1988; Nature 336: 783-787). In binding experiments, increasing amounts of membrane protein (from 15-80~g) was incubated with each of the radioactively-labeled biogenic amine agonist or antagonist to be tested for 120 min at 22°C in a total volume of l mL.

Distribution of Biogenic Amine Receptor Expression in Mammalian Cell Lines, Rat Brain and Peripheral Tissues The distribution of mRNA corresponding to expression of the biogenic amine receptor gene in various regions of the rat brain was determined by reverse transcription/polymerase chain reaction (RT-PCR) performed as follows. Total RNA
from various rat brain sections was isolated using the RNA Easy lcit (Qiagen) described in Example 3 and converted to single-stranded cDNA using reverse transcriptase (BRL, Gaithersburg, MD) primed by oligo dT or random primers or a combination of both these primers. PCR was then performed using the 5' sense primer (TCT CTG AGT GAT GCA TCT TTG; SEQ ID No. 7) corresponding to the 5"extent of the receptor coding sequence and either an antisense 3o primer (AGC AGT GCT CAA'CTG TTC TCA CCA TGC; SEQ ID No.: 8) having its 3' end at nucleotide residue 243 of the SEQ ID No. 3 (resulting in a PCR
product of about 250bp in length) or an antisense primer (GCA CGA TTA ATT GAC CTC GCT
TG; SEQ ID No.: 9) having its 3' end'at nucleotide residue 650 of the SEQ ID
No. 3 (resulting in a PCR product of about 650bp in length). Using either primer pair, PCR

was performed for 35 cycles, wherein one cycle consisted of incubations at 94°C for 90 sec (denaturation), 55°C.for 90 sec (annealing), and 72°C for 120 sec (extension).
The resulting fragments were resolved from 30~IL reaction mixture using 1%
agarose gel electrophoresis and visualized by ethidium bromide staining and UV
illumination.
The fragments were then transferred onto a nylon membrane (GeneScreen Plus, NEN) by capillary transfer and hybridized under' high stringency conditions as described above with a 3zP-labeled probe prepared from the full-length rat genomic clone encoding the novel biogenic amine receptor of the invention as described herein.
Hybridized fragments were detected using a phosphoimager (Molecular Devices, l0 Mountain View, CA).
The results of these experiments are shown in Figures SA and 5B. Figure 5A
shows a photograph of an ethidium bromide stained 1% agarose gel viewed under ultraviolet light illumination. PCR product (10~L of a 30~L reaction mixture) was electrophoresed as described above, and bands specific for the predicted fragments of the rat biogenic amine receptor of the invention (250 or 650bp) were detected.
Figure 5B shows the results of the hybridization assay, which results in greater sensitivity of detection of PCR-amplified fragments.' These results indicated that the biogenic amine receptor was expressed strongly in midbrain and olfactory tubercle, less strongly in the olfactory bulb, moderately in the striatum and weakly in the 2o hypothalamus.
Northern analysis of total RNA was performed as described in Example 2 above to detect biogenic amine receptor expression in various established mammalian cell lines. These results are shown in Figure 6. Expression of the biogenic amine receptor gene of the invention was detected only in rat insulinoma cell line RIMS, while the AR42J cell line from which the cloned cDNA was obtained did not show a signal in this experiment, indicating it was present only at low levels and could not be detected in a Northern blot prepared from total cellular RNA (i.e., not having been enriched for mRNA, for exarfaple, by selection with oligo(dT)).
The results of RT-PCR analysis performed on mRNA obtained from various rat tissues as described above are shown in Figure 8A, and hybridization analysis of these results is shown in Figure 8B to increase detection of PCR-amplified fragments.
The transcript was widely distributed throughout the brain, with the highest levels of expression detected in the olfactory bulb, nucleus accumbens/olfactory tubercle, prefrontal cortex and other cortical regions, midbrain regions consisting of substantia , ' nigra and ventral tegmentum, cerebellum, and pons/medulla. Among peripheral tissues, the highest level was observed in the liver, with lesser expression detected in kidney, gastrointestinal tract, spleen, pancreas, and heart.
These results indicated the following pattern of biogenic amine receptor expression in these tissues:
olfactory tubercle > intestine ~midbrain, cortex, spleen > heart, kidney The receptor was also expressed at detectable levels in lung, transfected COS
cells, 1 o and olfactory bulb. These results are consistent with known patterns of trace amine receptor expression in olfactory tubercle and midbrain.

Cloning the Human Trace Amine Receptor Gene The novel mammalian trace amine receptor cDNA obtained in Example 2 was used to isolate a partial genomic clone from a libr ary of human genomic DNA
cloned in lambda EMBL3 (obtained from Clontech, Palo Alto, CA) as follows. The full-length rat receptor cDNA (~1 kb in length) was 32P-labeled by the random priming technique a lcit obtained from Stratagene (San Diego, CA) according to the manufacturer's instructions. This probe was then used to screen the human genomic libraryx which had been plated and then transferred to nylon membranes (Gene Screen Plus, NEN, Boston, MA). Hybridization was performed in a solution of 50%
formamide, SXSSC, 1% SDS, SX Denhardt solution, and salmon sperm DNA (50 micrograms/mL) with the radioactive probe at 2 x 10~ cprri/mL and at a temperature of 37°C overnight. The nylon filters were then washed at room temperature in a solution of 2X SSC/ 0.1 % SDS for 10 minutes, followed by a wash at 55°C in a solution of 2X
SSC/ 0.1% SDS for 15 minutes, and finally a wash at 55°C in a solution of 0.5X SSC/
3o 0.1% SDS for 5 minutes. Filters were then exposed to XOMAT X-ray film (Kodalc) overnight at -80°C. Filter hybridization was performed in duplicate to confirm positive signals. Secondary and tertiary screens were performed until single homogenous clones were identified.
Individual genomic clones were then isolated and the nucleotide sequence determined. The nucleotide sequence analysis, performed essentially as described in Example 1, revealed that the longest insert contained a partial N-terminal sequence of the human homologue of the rat trace amine receptor. Based on this information a set of oligonucleotide primers were synthesized having the following sequence:
Primer VII (sense):
5' TTGACAGCCCTCAGGAATGATG 3' (SEQ. ID: NO:10) and Primer VIII (antisense):
5' ATGGAAAATGGAGGCTGAGCTCAG 3' (SEQ. ID NO:11 ) These primers were then used to identify a bacterial artificial chromosome (BAC) clone encoding the entire human trace amine receptor gene. Pools of BAC
DNA obtained from. Research Genetics (Release IV, Catalogue #96011) were subjected to PCR in a 30 micoliter solution that contained primers VII and VIII in addition to 50 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 0.01% gelatin, 250 ~M each dNTP, and 2.5 units of Taq polymerase (Sailci et al., 1988, Science 239: 487-491).
Each PCR amplification cycle consisted of incubations at 94°C for 90 sec (denaturation), 50°C for 90 sec (annealing), and 72°C for 120 sec (extension) for 35 cycles.
Amplified products of the PCR reaction were separated on a 1.0% agarose gel (see Sambroolc et al., ibid.). Fragments of the expected size (630 bp) were subcloned into the plasmid vector pBluescript (Stratagene, LaJolla, CA) and sequence analysis of the inserts confirmed that the BAC contained the human trace amine receptor gene of interest. To obtain' the complete DNA sequence of the novel human trace amine receptor gene sense oligonucleotide primers were designed based on the sequence information obtained from the BAC and EMBL3 clones. The resulting sequence information was then used in the design of additional primers. This process was repeated until the end of the coding region was reached.
Consistent with its rat homologue the novel human trace amine receptor is 3o encoded by a single coding exon. The sequence of the human receptor is presented in Figure 1. Interestingly, the open reading frame of the human homologue of the trace amine receptor gene is 21 bases longer than the rat (1017 vs 996, respectively) which translates into a human receptor that is 339 amino acids long compared to a receptor of 332 amino acids in the rat (shown in Figure 2). A comparison between the primary amino acid sequences of the human and rat receptors is presented in Figure 3.

Chromosomal Mapping of the Genomic Locus of the Human Bioaenic amine Receptor Gene The chromosomal locus of the human trace amine receptor gene of the to invention was mapped by fluorescence itt situ hybridization as follows.
BAC DNA encoding the human trace amine receptor described in Example 5 was niclc-translated using digoxigenin-11-UTP for use as a probe for irr situ chromosomal mapping-to localize the gene. This fluorescently labeled DNA was hybridized ira situ to denatured human metaphase chromosomes for 16 hours.
Signal was detected in the presence of DAPI (4,6-diamidino-2-phenylindole) counter staining and the chromosome was identified by sequential G-banding. The hybridization signal appeared to be consistent with a chromosomal location on the distal long arm of chromosome 6. By alignment of the hybridized metaphases with an ideogram of chromosome 6 (at the 400 band stage), the human trace amine receptor gene was assigned to the locus 6q23.
The results of these experiments are shown in Figures 9A through 9D, and a schematic representation of these results is shown in Figure 9E. As can be seen in these Figures, the human trace amine receptor gene corresponding to the cDNA
provided by the invention was mapped to human chromosome 6, specifically at 6q23.2.
This chromosomal localization is particularly noteworthy because it is one of the few regions that have been reproducibly associated with schizophrenia in linkage studies (Cao et al., 1997, Gertotrtics 43: 1-8; Martinez et al., 1999, Am JHurta Ge>zet 88: 337-343; Levinson, et al. 2000, Arst J Hurya Gertet 67: 652-663; Mowry and Nancarrow, 2001, Clin Exp Phat~traacol Physiol 28: 66-69), suggesting the possibility that hTARl may be involved in the mechanism of psychosis. The relevance of this receptor to the etiology ofpsychosis is enhanced by the evidence that 3-MT is apotent and efficacious agonist. 3-MT is the major metabolite of dopamine produced by the enzyme COMT, a variant of which was recently found to be transmitted with greater frequency to schizophrenic offspring in a family based association study (Egan et al., 2001, Pr~oc Natl Acad Sci USA 98: 6917-6922).

Detection of MAP Kinase Pathway Stimulation by the Human Trace Amine Receptor Gene It has been determined that G-protein coupled receptors are capable of stimulating the MAP (microtubule-associated protein) lcinase assay in mammalian cells. The recognition of this role of G-protein coupled receptors has facilitated the to development of an assay for testing the response of G-protein coupled receptors to potential ligands in vity~o, thereby simplifying characterization of said receptors.
In this assay, activation of the pathway by ligand binding to receptor results in increased phosphorylation of mammalian transcription factor Ellc by the MK
kinase.
The phosphorylated Ellc transcription factor then binds to promoters containing cis-sequences responsive to this transcription factor. Transcription factor binding results in increase transcription of sequences operatively linlced and under the transcriptional control of such Ellc-responsive promoters. Most advantageously, reporter genes, such as (3-galactosid'ase or firefly luciferase are operatively linked to such Ellc-responsive promoters, thereby permitting ligand binding to a receptor to be linlced with 2o expression of the reporter gene.
HEIR 293 cells were transfected with the full-length human clone encoding the trace amine receptor of the invention contained ilnthe pcDNA 3.1 expression vector (Invitrogen), wherein the first 22 nucleotides of the 5' untranslated region is followed by an initiation codon (ATG, Met), followed by nucleotides encoding an 8-amino acid FLAG sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys; SEQ ID No.: 12), followed by a nucleotide sequence encoding the 21 amino acids of the human D2 receptor (as disclosed in co-owned U.S. PatentNo. 5,880,260, issued March 9, 1999, incorporated by reference in its entirety herein) that follow the Met initiation codon in the native D2 sequence, which is followed by the complete sequence of the human trace amine 3o receptor; this construct was termed H2-3pcDNA3.1.
Control cells were transfected with pcDNA3.1 without the rat trace amine receptor sequences. All cells were also co-transfected with 2 additional constructs:
one (ells-gal) that encoded the yeast transcription factor gal under the transcriptional control of an Ellc-responsive promoter; and another encoding firefly luciferase under the transcriptional control of a gal-responsive promoter. In cells containing the rat trace amine-encoding construct, ligand binding to the receptor expressed thereby activated the map lcinase (MK) pathway, which results in phosphorylation of the endogenous Ellc transcription factor. In its phosphorylated state, Ellc interacts with the ells DNA binding site and leads to activation of transcription of the gal gene contained in the ells-gal plasmid. In turn, transcription of the luciferase gene is activated in the co-transfected luciferase construct. Luciferase transciption was quantified using a luminometer, and gave an indirect measure of MK activation by each ligand. The results of these experiments as shown in Table II, showing the fold stimulation for each potential ligand compared with cells incubated in the absence of the ligand.
1 o TABLE II
L~ H2-3 pcDNA3.1pcDNA3.l Dopamine 1.21 1.04 Serotonin 1.22 1 Norepinephrine 1.69 1.3 Clonidine' 1.47 1.07 SKF82958z 2.52 0.79 ADTN673. 1.93 0.78 Quinpirole3 2.14 0.6 i az-adrenergic and imidazoline receptor agonist D 1 dopamine receptor agonist a-2 adrenergic receptor agonist IS
These results indicate that the cloned rat genomic DNA disclosed herein encodes a receptor that is specifically activated by drugs that target certain biogenic amine receptors. However, the profile for this activation.does not con-espond to that for any of the known biogenic amine receptors, indicating that this is a novel, brain-2o specific, biogenic amine-binding receptor having a unique pharmacology useful thereby as a therapeutic target.

Cellular Localization of the Novel Trace Amine Receptor Enhanced expression of the receptor was achieved by cloning the full-length rat cDNA into the mammalian expression vector pcDNA3.11V5/His-TOPO
(Invitrogen). A PCR product was generated that upon expression produced the rat receptor sequence preceded at its amino terminus by a cleavable 16 amino acid signal sequence of the influenza hemaglutinin virus immediately followed by the 8 amino acid M1-Flag epitope and then a two amino acid linker (MetGly) just before the to initiation methionine (Guan et al., 1992, JBiol Chezzz. 267: 21995-21998).
HEI~293 cells were transfected using the Lipofectamine transfection reagent and cells stably expressing the construct were selected in 6418. The flag-tagged receptor was analyzed by immunofluorescence to determine cellular localization. For comparison, localization of the Dl receptor in HEI~293 cells stably expressing the cloned flag-tagged human D 1 receptor was also examined. Cells were maintained in DMEM media containing 10% fetal calf serum and 700 ~Ig/mL 6418 (Life Technologies, Bethesda, MD). Confluent cells were detached with PBS solution containing 0.05% trypsin and 0.53 mM EDTA, harvested, diluted 1:10, and plated on glass microscope coverslips coated with poly-D-lysine and grown at 37°C
for 48 2o hours. Cells were washed twice with PBS and fixed with 2.5%
paraformaldehyde in PBS for 20 minutes. Cells were then incubated for 30 minutes with anti-FLAG
monoclonal antibody (1:500; Sigma) in blocking buffer solution (3% dry mills, 1 mM
CaCl2, 50 mM Tris HCl Ph 7.5) with or without 0.1% Triton X-100. After 3 washes with Tris-buffered saline containing 1 mM CaCh, cells were incubated for 30 minutes with goat anti-mouse IgG conjugated to Cy5 (Jackson Immuno Research Laboratories, Ins., West Grove, PA) diluted 1:200 in blocking solution. Cells were washed three times and mounted onto microscope slides with Mowiol0 (Aldrich, Milwaukee, WI) and analyzed by confocal microscopy using an MRC-1000 laser scanning confocal imaging system (Bio-Rad Laboratories, Richmond, CA) equipped with an Optiphot II
Nikon microscope and a Plan Apo 60 x 1.4 oil immersion objective. In the absence of Triton X-100, little staining was observed in the cells for the receptor. In the presence of Triton X-100, which permeablizes the cell membrane, the receptor showed pronounced staining in the cytoplasm accompanied by some staining in the plasma membrane. As expected, the D1 receptors were found primarily on the plasma 3s membrane.

Stimulation of the Novel Receptor in Stably Transfected HEK293 Cells in Response to Various Endogenous and Synthetic Compounds HEK293 cells stably transfected with the pcDNA3.1/VS/His-TOPO expression vector containing the full-length rat cDNA clone described above were assayed for cAMP production in response to various ligands.
In the performance of these assays, HEK293 cells were harvested in Krebs-l0 Ringer buffer (KRH; Sigma) and preincubated in KRH with 200 p,M IBMX. For drug treatments, cells were incubated in KRH with 100 wM IBMX with the test compound (or 10 pM forslcolin) for 1 hour at 37°C. The cells were then boiled for 20 min after adding an equal volume of 0.5 mM sodium acetate buffer, centrifuged to remove cell debris, and the resulting extract was analyzed for cAMP content using competitive binding of 3H-cAMP to a CAMP binding protein (Diagnostic Products Corp., Los Angeles, CA). Data were normalized according to protein content as determined using the Bradford reagent (Bio-Rad, Richmond, CA). Concentration-response curves were plotted and ECso's calculated with, GraphPad Prism software (San Diego, CA).
Using this assay, levels of cAMP stimulation in response to 1 p,M
2o concenhations of test.compounds were measured and levels were normalized to the levels of cAMP elicited by 1 ~M p-tyramine. The results of the CAMP assays are shown in Figures 12A through 12G and are summarized in the following Tables.
Table III shows the potencies and efficacies of compounds stimulating the receptor.
Drugs that are strong, medium, and wealc stimulators of the receptor are listed in Table IV and neurotrarisrriitters that are stimulators of the receptor are listed in Table V.
Compounds that demonstrate strong responses have affinities and/or efficacies that are -comparable or higher than those of p-tyramine. Compounds that display weak stimulation of cAMP are either inactive or antagonists. Medium stimulators illicit a response less than the strong stimulators but greater than the weak stimulators.
TABLE III
nM+SEM Maximal Stimulation NeurotransmittersECso ( ) _ (~~o+SEM) p-tyramine G9_+9 100 Phenethylamine 237_+71 7G+1 G

Tryptamine 309_+7G 90+G

Syne hrine 584+100 90+2 Octo amine 1298+_350 102_+3 m-tyramine 5375_+1184 74+3 Do amine 5920_+2639 48+5 5-hydroxytryptamine12800+4181 47+9 Drugs ECso (nMSEM)Maximal Stimulation (/"+SEM) 4-h droxyam 51+12 79+2 hetamine MPTP 99+11 93+7 R-amphetamine 209_+44 48+7 S-amphetamine 440_+10 84+3 MDMA 1749+1152 GS+13 'rValues are expressed as percent of stimulation by p-tyramine NEUROTRANSMITTERS DRUGS

EC50 (nM) EC50 (nM) P-tyramine 44.9 82 R-OH am hetamine11.3 Phenylethylamine218 124 -tyramine 20.2 Tryptamine 248.4 519 S-am hetamine 64.2 ' Octo amine 873.5 1400 R-am hetamine 108 Do amine 4818.0 4000 MDMA 179 Serotonin 1913.0 8000 S-methamphetamine188 m-tyramine 7189.0 5800 R-methamphetamine236 Syne brine ND - p-methoxy PEA 346 Noradrenaline0 -TABLE IV
DRUGS

STRONG MEDIUM WEAK
STIMULATOR STIMULATOR STIMULATOR.

4-OH am' hetaminePhentolamineN- henyle brine S-am hetamine 3-hen 1 ro Clonidine , ylamine R-am hetamine ErgotmetrineQuinpirole' .

S-methamphetamineR-ephedrine Quipazine R-methamphetamineTolazoline 4-benzylpipeYidine ~

MDMA Pren lamine -chloroam hetamineMescaline Betahistine -methoX -PEA

4-NH-PEA , 3,4 dimethoicy PEA

2-thiophenylethylamineReboxetine 1-phenylpiporazineAEBSF

Phenyle urine Hydrocotarnomine A omor hine Bromocry ~ tine meter oline 6,7 ADTN

TABLE V
NEUROTRANSMITTERS

STRONG MEDIUM NO
STIMULATORSTIMULATOR STIMULATION

-tyramine Do amine pore ine brine PhenylethylamineSerotonin Try taminem-tyramine Octo amine Synephrine In summary, these molecules had ECsos in the following rank order (lowest to highest):
p-tyramine < (3-PEA < tryptamine < synephrine < octopamine < naeta-tyramine (na-tyramine) < dopamine < 5-HT « norepinephrine, epinephrine.
The ranlc order of potencies observed for the human trace amine receptor 1o indicates that a hydroxyl group at the meta position on ~i-PEA analogs or at the 5-position on tryptamine has deleterious effects on agonist potency, ,a trend that is contrary to that observed for catecholamine receptors. Comparison of the amino acid sequence of the trace amine receptor with those of catecholamine and 5-HT
receptors suggests a structural basis for this change in selectivity. It has been proposed from rnutagenesis studies of the (32-AR and the 5-HT1A receptor (Ho et al., 1992, FEBSLett 301: 303-306) that serine residues in transmembrane domain V contribute to the binding affinity of agonists, and that Sersv2 and/or Ser5~43 form a hydrogen bond networlc with the catecholamine rneta-hydroxyl groups (Liapalcis, et al. 2000, J Biol Chern 275: 37779-37788). The Ser residue in position 5.42 is conserved in every 2o catecholamine receptor. Curiously, the corresponding residues in the mammalian trace amine receptor of the invention are instead A1a5~4' and Phe5~a3 (Fig. 1) whereas the more deeply positioned SerSV', proposed to interact with thepar~a-hydroxyl group, is found in the instant receptors and in the catecholamine receptors alike (Liapalcis et al., ibicl.). The absence of Ser residues in positions 5.42 and 5.43 of rTARl diminishes the potencies of phenethylamine agonists that have rneta-hydroxyl groups (e.g. catecholaniines, na-tyramine) as compared to those that do not.
Another trend observed in the pharmacological survey also differentiates the instant trace amine receptor from known biogenic amine receptors and, furthermore, may hint at a physiological role of the receptor. The rneta-O-methyl metabolites of 3o the catecholamines-3-methoxytyramine (3-methyldopamine), 3-methoxy-(3-4-dihydroxy-(3-phenethylamine (normetanephrine); and 3-methoxy-(3-4-dihydroxy-N-methyl-/3-phenethylamine (metanephrine) - are efficacious activators of the trace amine receptor of the invention, and are significantly more potent than their precursors dopamine, norepinephrine, and epinephrine (Fig. 3B). This finding is unusual because at other known catecholamine receptors, these meta-O-methyl metabolites generated by catechol-O-methyltransferase have vastly diminished affinities andlor intrinsic efficacies as compared with their parent catecholamines (Langer and Rubio, 1973, Naunyr~ Schmiedeberg's Ar~cla Pha~°macol 276:
71-88;
Seeman, 1980, Plaarsraacol Rev 32: 230-313). The data disclosed herein indicated that 1 o increasing lipophilicity of catecholamine meta-substituents by O-methylation actually increases their affinity for the trace amine receptors of the invention. These data are consistent with the finding of Liapalcis et al. (ibid.) that replacement of Ser5v2 in the (32-AR with Ala or Val residues decreased the affinities of (3-PEA analogs containing meta-hydroxyl groups but increased the potencies of analogs Iaclcing them.
Accordingly, endogenous agonists of the trace amine receptors of the invention may include some "inactive" catecholamine metabolites such as 3-methoxytyramine, the principal extracellular metabolite of dopamine (Wood and Altar, 1988, Pharnaacol Rev 40: 163-187). It is important to note that 3-methoxy-4-hydroxyphenylacetic acid (homovanillic acid), the oxidized metabolite of 3-methoxytyramine lacking the amine 2o group, displayed no detectible activity towards the trace amine receptors of the invention. The tissues that contain the highest levels of mRNA encoding a trace amine receptor of the invention were the same tissues known to express high levels of catechol-O-methyltransferase -liver, lcidney, gastrointestinal tract and brain (reviewed in Mannisto and Kaalclcola, 1999, Plaa~°rnaeol Rev 51: 593-628).
Surprisingly, the trance amine receptor is more potently activated by the presumably "inactive" catecholamine metabolites 3-methoxytyramine (3-MT), normetanephrine and metanephrine than by the neurotransmitters dopamine, norepinephrine, and epinephrine themselves.
Given the structural similarity of amphetamine to [3-PEA and p-tyramine, it 3o was of obvious interest to determine whether amphetamine analogs including methamphetamine and its congener MDMA (" ecstasy") could activate the trace amine receptors of the invention. These and several other amphetamine analogs potently - stimulated cAMP production in recombinant cells expressing this receptor.
Amphetamines act directly on the receptor, since these drugs (at 1 ~.M
concentrations) produced no cAMP stimulation in control cells transfected either with an empty vector or with the human D I receptor. Amphetamine analogs that activate the receptor include both classic neurotransmitter transporter substrates as well as a prototypical hallucinogenic amphetamine, 2-amino,(1-[2,5-dimethoxy-4-iodophenyl]propane, which has poor affinity for transporters but high affinity for 5-HTz receptors (Marelc and Aghajanian, 1998, ibid:). Some structural modifications of amphetamine significantly changed their potencies at the receptor: p-OH-amphetamine (a-methyl-p-tyramine), the major amphetamine metabolite (Cho and I~umagai, 1994, in Anaphetar~zi~e a~ad Its Analogs: PsychoplzaYnaacology, Toxicology, anal Abuse (Cha l0 AK and Segal DS eds), Academic Press: San Diego, pp 43-77), proved to be the most potent agonist of the trace amine receptor of the invention yet identified. In contrast, two N-ethyl analogs, (~)fenfluramine and (~)N-ethylamphetamine, had substantially lower activities than the N-methyl congeners, methamphetamine and MDMA or than the primary amine congeners.
The ability of tryptamine to activate the rTARl suggested that some ergot alkaloids might act as agonists. A variety of widely used ergot alkaloids and ergoline derivatives, including ergometrine, dihydroergotamine, D-LSD, and the antiparlcinsonian agents bromocriptine and lisuride, potently activate the trace amine receptor. Recognition that this receptor is involved in the biological response to these 2o compounds increases the ability to elucidate their complex iya vivo pharmacology.
Antagonists of biogenic amine receptors and transporters were also found to stimulate camp production in recombinant cells expressing the trace amine receptors of the invention. Such compounds include the adrenergic antagonists phentolamine and tolazoline, the serotonergic antagonists cyproheptadine, dihydroergotamine, and metergoline, and the nonsubstrate inhibitors of dopamine transporter protein nomifensine and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. The antipsychotic drug chlorpromazine, typically considered to be a dopamine receptor antagonist, also acted as a wealc agonist with the trace amine receptors of this invention.
None of the biogenic amine receptor antagonists tested were able to antagonize trace amine receptor binding or activity when coincubated (at 1 or 10 p,M concentrations) with ECSO concentrations of (3-PEA or p-tyramine (data not shown). Although the trace amine receptor of this invention displayed a broad ligand selectivity when expressed in HEK293 cells, it is not activated by many compounds including acetylcholine, nicotine, GABA, glutamate, morphine (data not shown) and histamine.

It should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims.

SEQUENCE LISTING
<1l0> Grandy, David IC
Bunzow, James R
Sonders, Mark <120> Mammalian Receptor Genes and Uses <130> Biogenic amine receptor genes <140>
<141>
<160> 8 <170> PatentIn Ver. 2.0 <2l0> 1 <211> 1125 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (21)..(1037) <400> l ctaattgaca gccctcagga atg atg ccc ttt tgc cac aat ata att aat att 53 Met Met Pro Phe Cys His Asn Ile I1e Asn Ile tcc tgt gtg aaa aac aac tgg tca aat gat gtc cgt get tcc ctg tac 101 Sex Cys Val Lys Asn Asn Trp Ser Asn Asp Val Arg Ala Ser Leu Tyr agtttaatggtgctcata attctgaccacactcgttggcaatctgata 149 SerLeuMetValLeuIle I1eLeuThrThrLeuValGlyAsnLeuIle gttattgtttctatatca cacttcaaacaacttcataccccaacaaat 197 ValIleValSerIleSer HisPheLysGlnLeuHisThrProThrAsn tggctcattcattccatg gccactgtggactttcttctggggtgtctg 245 TrpLeuIleHisSerMet AlaThrValAspPheLeuLeuGlyCysLeu gtcatgccttacagtatg gtgagatctgetgagcactgttggtatttt 293 ValMetProTyrSerMet ValArgSerAlaG1uHisCysTrpTyrPhe ggagaagtcttctgtaaa attcacacaagcaccgacattatgctgagc 341 GlyGluValPheCysLys IleHisThrSerThrAspIleMetLeuSer tcagcctccattttccat ttgtctttcatctccattgaccgctactat 389 SerAlaSerIlePheHis LeuSerPheIleSerIleAspArgTyrTyr getgtgtgtgatccactg agatataaagccaagatgaatatcttggtt 437 AlaValCysAspProLeu ArgTyrLysAlaLysMetAsnIleLeuVal att tgt gtg atg atc ttc att agt tgg agt gtc cct get gtt ttt gca Ile Cys Val Met Ile Phe Ile Ser Trp Ser Val Pro Ala Val Phe Ala 140 145 l50 155 ttt gga atg atc ttt ctg gag cta aac ttc aaa ggc get gaa gag ata Phe Gly Met Ile Phe Leu Glu Leu Asn Phe Lys Gly A1a Glu Glu Ile tat tac aaa cat gtt cac tgc aga gga ggt tgc ctc gtc ttc ttt agc Tyr Tyr Lys His Val His Cys Arg Gly Gly Cys Leu Val Phe Phe Ser l75 180 185 aaa ata tct ggg gta ctg acc ttt atg act tct ttt tat ata cct gga Lys Tle Ser Gly Val Leu Thr Phe Met Thr Ser Phe Tyr Ile Pro Gly tct att atg tta tgt gtc tat tac aga ata tat ctt atc get aaa gaa Ser Ile Met Leu Cys Val Tyr Tyr Arg Tle Tyr Leu Tle Ala Lys Glu cag gca aga tta att agt gat gcc aat cag aag ctc caa att gga ttg Gln Ala Arg Leu Tle Ser Asp Ala Asn Gln Lys Leu Gln Ile Gly Leu gaa atg aaa aat gga att tca caa agc aaa gaa agg aaa get gtg aag Glu Met Lys Asn Gly Tle Ser Gln Ser Lys Glu Arg Lys Ala Val Lys aca ttg ggg att gtg atg gga gtt ttc cta ata tgc tgg tgc cct ttc Thr Leu Gly Ile Val Met Gly Val Phe Leu Ile Cys Trp Cys Pro Phe ttt atc tgt aca gtc atg gac cct ttt ctt cac tca att att cca cct Phe Tle Cys Thr Val Met Asp Pro Phe Leu His Ser Ile Ile Pro Pro act ttg aat gat gta ttg att tgg ttt ggc tac ttg aac tet aca ttt Thr Leu Asn Asp Val Leu Ile Trp Phe Gly Tyr Leu Asn Ser Thr Phe aat cca atg gtt tat gca ttt ttc tat cct tgg ttt aga aaa gca ctg Asn Pro Met Val Tyr Ala Phe Phe Tyr Pro Trp Phe Arg Lys Ala Leu 300 305 3l0 315 aag atg atg ctg ttt ggt aaa att ttc caa aaa gat tca tcc agg tgt Lys Met Met Leu Phe Gly Lys Ile Phe G1n Lys Asp Ser Ser Arg Cys aaa tta ttt ttg gaa ttg agt tca tagaattatt atattttact gttttgcaaa Lys Leu Phe Leu Glu Leu Ser Ser tcggttgatg atcatattta tgaacacaac ataacgaacc acatgcacca accacatg <210> 2 <211> 339 <212> PRT
<213> Homo sapiens <400> 2 Met Met Pro Phe Cys His Asn Tle Ile Asn Ile Ser Cys Val Lys Asn 1 5 ~ 10 15 Asn Trp Ser Asn Asp Val Arg Ala Ser Leu Tyr Ser Leu Met Val Leu Ile Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Val Ile Val Ser Ile Ser His Phe Lys Gln Leu His Thr Pro Thr Asn Trp Leu Tle His Ser Met Ala Thr Val Asp Phe Leu.Leu Gly Cys Leu Val Met Pro Tyr Ser 65 70 75 $0 Met Val Arg Ser Ala Glu His Cys Trp Tyr Phe Gly Glu Val Phe Cys Lys Tle His Thr Ser Thr Asp Ile Met Leu Ser Ser A1a Ser Ile Phe His Leu Ser Phe Ile Ser Ile Asp Arg Tyr Tyr Ala Val Cys Asp Pro Leu Arg Tyr Lys Ala Lys Met Asn Tle Leu Val Ile Cys Val Met Ile Phe Ile Ser Trp Ser Val Pro Ala Val Phe Ala Phe Gly Met Ile Phe Leu Glu Leu Asn Phe Lys Gly Ala Glu Glu Ile Tyr Tyr Lys His Val 165 l70 175 His Cys Arg Gly Gly Cys Leu Val Phe Phe 5er Lys Ile Ser Gly Val Leu Thr Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Tle Met Leu Cys Val Tyr Tyr Arg Ile Tyr Leu Ile A1a Lys Glu Gln Ala Arg Leu Ile Ser Asp Ala Asn Gln Lys Leu Gln Ile Gly Leu Glu Met Lys Asn Gly Ile Ser Gln Ser Lys Glu Arg Lys Ala Val Lys Thr Leu Gly Ile Val Met Gly Val Phe Leu Ile Cys Trp Cys Pro Phe Phe Tle Cys Thr Val Met Asp Pro Phe Leu His Ser,Ile Ile Pro Pro Thr Leu Asn Asp Val Leu Ile Trp Phe Gly.Tyr Leu Asn,Ser Thr Phe Asn Pro Met Val Tyr Ala Phe Phe Tyr Pro Trp Phe Arg Lys Ala Leu Lys Met Met.Leu Phe Gly Lys Ile Phe,Gln Lys Asp Ser Ser Arg Cys Lys Leu Phe Leu Glu Leu Ser Ser <210> 3 <211> 999 <212> DNA
<213> Rattus norvegicus <220>
<221> CDS
<222> (1)..(996) <400> 3 atg cat ctt tgc cac aat agc gcg aat att tcc cac acg aac agg aac Met His Leu Cys His Asn Ser Ala Asn Ile Ser His Thr Asn Arg Asn l 5 l0 15 tgg tca agg gat gtc cgt get tca ctg tac agc tta ata tca ctc ata Trp Ser Arg Asp Val Arg Ala Ser Leu Tyr Ser Leu Tle Ser Leu Tle att cta acc act ctg gtt ggc aac tta ata gta atc att tcg ata tcc Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Va1 Ile 21e Ser Ile Ser cac ttc aag caa att cac acg ccc aca aat tgg ctc ctt cat tcc atg His Phe Lys Gln Ile His Thr Pro Thr Asn Trp Leu Leu His Ser Met gcc gtt gtc gac ttt ctg ctg ggc tgt ctg gtc atg cec tac agc atg Ala Val Val Asp Phe Leu Leu Gly Cys Leu Val Met Pro Tyr Ser Met gtg aga aca gtt gag cac tgc tgg tac ttt ggg gaa ctc ttc tgc aaa Val Arg Thr Va1 Glu His Cys Trp Tyr Phe Gly Glu Leu Phe Cys Lys ctt cac acc agc act gat atc atg ctg agc tcg gca tcc att ctc cac Leu His Thr Ser Thr Asp Ile Met Leu Ser Ser Ala Ser Ile Leu His cta gcc ttc att tcc att gac cgc tac tat get gtg tgc gac cct tta Leu Ala Phe Tle Ser Ile Asp Arg Tyr Tyr A1a Val Cys Asp Pro Leu aga tac aaa gcc aag atc aat ctc gcc gcc att ttt gtg,atg atc ctc Arg Tyr Lys Ala Lys Ile Asn Leu Ala Ala Ile Phe Val Met Ile Leu att agc tgg agc ctt cct get gtt ttt gca ttt ggg atg atc ttc ctg Ile Ser Trp Ser Leu Pro Ala Val Phe Ala Phe Gly Met Ile Phe Leu gag ctg aac tta gaa gga gtt gag gag cag tat cac aat cag gtc ttc Glu Leu Asn Leu Glu Gly Val Glu Glu Gln Tyr His Asn Gln Val Phe tgc ctg cgc ggc tgt ttt cta ttc ttc agt aaa gta tct ggg gta ctg Cys Leu Arg Gly Cys Phe Leu Phe Phe 5er Lys Val Ser G1y Val Leu gca ttc atg acg tct ttc tat ata cct ggg tct gtt atg tta ttt gtt Ala Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Val Met Leu Phe Val tac tat gag ata tat ttc ata get aaa gga caa gcg agg tca att aat Tyr Tyr Glu Ile Tyr Phe Tle Ala Lys Gly Gln Ala Arg Ser Ile Asn cgt gca aac ctt caa gtt gga ttg gaa ggg gaa agc aga gcg cca caa Arg Ala Asn Leu Gln Val Gly Leu Glu Gly Glu Ser Arg Ala Pro Gln agc aag gaa aca aaa gcc gcg aaa acc tta ggg atc atg gtg ggc gtt Ser Lys Glu Thr Lys Ala Ala Lys Thr Leu Gly Ile Met Val Gly Val ttc ctc ctg tgc tgg tgc ccg ttc ttt ttc tgc atg gtc ctg gac cct Phe Leu Leu Cys Trp Cys Pro Phe Phe Phe Cys Met Val Leu Asp Pro ttc ctg ggc tat gtt atc cea ccc act ctg aat gac aca ctg aat tgg Phe Leu G1y Tyr Val Ile Pro Pro Thr Leu Asn Asp Thr Leu Asn Trp ttc ggg tac ctg aac tct gcc ttc aac ccg atg gtt tat gcc ttt ttc Phe Gly Tyr Leu Asn Ser Ala Phe Asn Pro Met Val Tyr Ala Phe Phe tat ccc tgg ttc aga aga gcg ttg aag atg gtt ctc ttc ggt aaa att Tyr Pro Trp Phe Arg Arg Ala Leu Lys Met Val Leu Phe Gly Lys Ile ttc caa aaa gat tca tct agg tct aag tta ttt ttg taa Phe Gln Lys Asp Ser Ser Arg Ser Lys Leu Phe Leu <210> 4 <2l1> 332 <212> PRT
<213> Rattus norvegicus <400> 4 Met His Leu Cys His Asn Ser Ala Asn Ile Ser His Thr Asn Arg Asn 1 5 l0 15 Trp Ser Arg Asp Val Arg Ala Ser Leu Tyr Ser Leu Ile Ser Leu Ile Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Val Ile Ile Ser Ile Ser His Phe Lys Gln Ile His Thr Pro Thr Asn Trp Leu Leu His Ser Met Ala Val Val Asp Phe Leu Leu Gly Cys Leu Val Met Pro Tyr Ser Met Val Arg Thr Val Glu His Cys Trp Tyr Phe Gly Glu Leu Phe Cys Lys Leu His Thr Ser Thr Asp Ile Met Leu Ser Ser Ala Ser Ile Leu His 100 105 l10 Leu Ala Phe Tle Ser Ile Asp Arg Tyr Tyr Ala Val Cys Asp Pro Leu Arg Tyr Lys Ala Lys Ile Asn Leu Ala Ala Ile Phe Val Met I1e Leu Ile Ser Trp Ser Leu Pro Ala Val Phe Ala Phe Gly Met Ile Phe Leu Glu Leu Asn Leu Glu Gly Va1 Glu Glu Gln Tyr His Asn Gln Val Phe Cys Leu Arg Gly Cys Phe Leu Phe Phe Ser Lys Val Ser Gly Val Leu l80 185 190 Ala Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Val Met Leu Phe Val Tyr Tyr Glu Tle Tyr Phe Ile Ala Lys Gly Gln Ala Arg Ser Ile Asn Arg Ala Asn Leu Gln Val Gly Leu Glu Gly Glu Ser Arg Ala Pro Gln Ser Lys Glu Thr Lys Ala Ala Lys Thr Leu Gly Ile Met Val Gly Val Phe Leu Leu Cys Trp Cys Pro Phe Phe Phe Cys Met Val Leu Asp Pro Phe Leu Gly Tyr Va1 Ile Pro Pro Thr Leu Asn Asp Thr Leu Asn Trp Phe Gly Tyr Leu Asn Ser Ala Phe Asn Pro Met Val Tyr Ala Phe Phe Tyr Pro Trp Phe Arg Arg Ala Leu Lys Met Val Leu Phe Gly Lys Ile Phe Gln Lys Asp Ser Ser Arg Ser Lys Leu Phe Leu <210> 5 <211> 35 <2l2> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: 0ligonucleotide primer.

<400> 5 gagtcgacct gtgygysaty rciitkgac mgstac <210> 6 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 6 cagaattcag wagggcaicc agcagaisr ygaa <210> 7 <211> 21 <212> DNA y <213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 7 tctctgagtg atgcatcttt g <210> 8 , <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 8 agcagtgctc aactgttctc accatgc <210> 9 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 9 gcacgattaa ttgacctcgc ttg <210> 10 <21l> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 10 ttgacagccc tcaggaatga tg <210> 11 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> DeSCription of Artificial Sequence: Oligonucleotide primer.
<400> 11 atggaaaatg gaggctgagc tcag <210> 12 <211> 8 <212> peptide <213> Artificial Sequence <220>
<223> Description of Artificial Sequence: FLAG sequence <400> 12 Asp Tyr Lys Asp Asp Asp Asp Lys

Claims (55)

WHAT WE CLAIM IS:

1. A nucleic acid comprising a nucleotide sequence encoding a mammalian biogenic amine receptor.

2. A nucleic acid according to Claim 1 wherein the mammalian biogenic amine receptor is a human trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No. 2.

3. A nucleic acid according to Claim 1 wherein the mammalian biogenic amine receptor is a rat trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 4.

4. A homogeneous composition of a mammalian trace amine receptor or derivative thereof having a molecular weight of about 39 kilodaltons and an amino acid sequence identified by (SEQ ID No.: 2).

5. A homogeneous composition of a mammalian trace amine receptor or derivative thereof having a.molecular weight of about 38 kilodaltons and an amino acid sequence identified by (SEQ ID No.: 4).

6. A nucleic acid hybridization probe comprising a nucleotide sequence identified by Seq ID No. 1.

7. A nucleic acid hybridization probe comprising a nucleotide sequence identified by Seq ID No. 3.

8. A recombinant expression construct comprising a nucleic acid having a nucleotide sequence encoding a mammalian trace amine receptor according to claim 1, wherein the construct is capable of expressing the receptor in a transformed culture of eulcaryotic or prokaryotic cells.

9. A recombinant expression construct according to Claim 8 wherein the mammalian biogenic amine receptor is a human trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 2.

10. A recombinant expression construct according to Claim 8 wherein the mammalian biogenic amine receptor is a rat trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ
ID
No. 4.

11. A cell culture transformed with the recombinant expression construct of Claim 8, wherein the transformed cell culture expresses the mammalian trace amine receptor.

12. A cell culture transformed with the recombinant expression construct of Claim 9, wherein the transformed cell culture expresses the human trace amine receptor.

13. A cell culture transformed with the recombinant expression construct of Claim 10, wherein the transformed cell culture expresses the rat trace amine receptor.

14. A method of screening a compound for binding to a mammalian trace amine receptor in cells expressing the receptor, the method comprising the steps of:

(a) transforming a host cell with a recombinant expression construct encoding a mammalian trace amine receptor according to Claim 1, wherein the cells of the transformed cell culture express the receptor;
and (b) assaying the transformed cell culture with the compound to determine whether the compound binds to the mammalian trace amine receptor.

15. The method of Claim 14 wherein the mammalian trace amine receptor is a human trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 2.

16. The method of Claim 14 wherein the mammalian trace amine receptor is a rat trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 4.

17. A method of Claim 14 comprising the additional step of:
(c) comparing binding of the compound with binding of additional compounds that are lrnown to bind to mammalian trace amine receptors, wherein said additional compounds comprise naturally-occurring and synthetic receptor agonists and antagonists.

18. A method of screening a compound for competitive binding to a mammalian trace amine receptor in cells expressing the receptor, the method comprising the following steps:

(a) transforming a host cell with a recombinant expression construct encoding a mammalian trace amine receptor according to Claim 1, wherein the cells of the transformed cell culture express the receptor;

(b) assaying the transformed cell with the compound in the presence and in the absence of an agonist for the receptor; and (c) determining whether the compound competes with the agonist for binding to the receptor.

19. The method of Claim 18 wherein the mammalian trace amine receptor is a human trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 2.

20. The method of Claim 18 wherein the mammalian trace amine receptor is a rat trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 4.

21. The method of Claim 18, wherein the compound is delectably-labeled.

22. The method of Claim 18, wherein the receptor agonist is detectably-labeled.

23. The method of Claim 18, wherein the mammalian trace amine receptor competitor is quantitatively characterized by assaying the transformed cell culture with varying amounts of the competitor in the presence of a detestably-labeled receptor agonist and measuring the extent of competition with receptor binding thereby.

24. A method of screening a compound to determine if the compound is an inhibitor of a mammalian trace amine receptor in cells expressing the receptor, the method comprising the following steps:

(a) transforming a host cell with a recombinant expression construct encoding a mammalian trace amine receptor according to Claim 1, wherein the cells of the transformed cell culture express the receptor;

(b) assaying the transformed cell culture with the compound to determine whether the compound is capable of inhibiting trace amine receptor binding by a receptor agonist.

25. The method of Claim 24 wherein the mammalian trace amine receptor is a human trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 2.

26. The method of Claim 24 wherein the mammalian trace amine receptor is a rat trace amine receptor and the nucleotide sequence of the nucleic acid encodes an amino acid sequence identified by SEQ ID No.: 4.

27. The method of Claim 24, wherein the compound is detectably-labeled.

28. The method of Claim 24, wherein the receptor agonist is detectably-labeled.

29. The method of Claim 24, wherein the trace amine receptor inhibitor is quantitatively characterized by assaying the transformed cell culture with varying amounts of the inhibitor in the presence of a detestably-labeled trace amine receptor agonist and measuring the extent of inhibition of agonist binding thereby.

30. A nucleic acid comprising a nucleotide sequence encoding a mammalian trace amine receptor that hybridizes to a nucleic acid having a nucleotide sequence identified by Seq.ID No.1, under conditions of 37°C in a buffer comprising 50% formamide, 1% sodium dodecyl sulfate, 5X SSC, SOµg/mL denatured salmon sperm DNA, and 5X P-buffer comprising 0.25M Tris, pH 7.5, 0.5% sodium pyrophosphate, 0.5% SDS, 1% bovine serum albumin, 1% polyvinylpyrrolidone and 1 % Ficoll.

31. A nucleic acid according to , claim 30, wherein the nucleic acid hybridizes to a nucleic acid having a nucleotide sequence identified by Seq.ID
No.1, under washing conditions of 10 minutes at room temperature in a wash solution of 2X
SSC/ 1% SDS, followed by 10 min at 60°C in 2X SSC/ 1% SDS, followed by 5 min at 60°C in O.5X SC/1% SDS.

32. A nucleic acid comprising a nucleotide sequence encoding a mammalian trace amine receptor that hybridizes to a nucleic acid having a nucleotide sequence identified by Seq.ID No.3, under conditions of 37°C in a buffer comprising 50% formamide, 1% sodium dodecyl sulfate, 5X SSC, 50µg/mL denatured salmon sperm DNA, and 5X P-buffer comprising 0.25M Tris, pH 7.5, 0.5% sodium pyrophosphate, 0.5% SDS, 1% bovine serum albumin, 1% polyvinylpyrrolidone and 1 % Ficoll.

33. A nucleic acid according to claim 32, wherein the nucleic acid hybridizes to a nucleic acid having a nucleotide sequence identified by Seq.ID
No.3, under washing conditions of 10 minutes at room temperature in a wash solution of 2X
SSC/ 1% SDS, followed by 10 min at 60°C in 2X SSC/1% SDS, followed by 5 min at 60°C in O.5X SC/1% SDS.

34. A cell membrane preparation comprising a mammalian trace amine receptor or derivative thereof having a molecular weight of about 39 kilodaltons and an amino acid sequence identified by SEQ ID No.:2.

35. A cell membrane preparation comprising a mammalian trace amine receptor or derivative thereof having a molecular weight of about 38 kilodaltons and an amino acid sequence identified by SEQ ID No.:4.

36. A cytosolic preparation comprising a mammalian trace amine receptor or derivative thereof having a molecular weight of about 39 kilodaltons and an amino acid sequence identified by SEQ ID No.:2.

37. A cytosolic preparation comprising a mammalian trace amine receptor or derivative thereof having a molecular weight of about 38 kilodaltons and an amino acid sequence identified by SEQ ID No.:4.

38. The method of claim 17, 18, or 24 wherein the agonist is a neurotransmitter.

39. The method of claim 38 wherein the neurotransmitter is p-tyramine, phenylethylamine, tryptamine, octopamine, synephrine, dopamine, serotonin, or m-tyramine.

40. The method of claim 17, 18, or 24 wherein the agonist is a drug.

41. The method of claim 40 wherein the drug is [.beta.-phenethylamine (PEA), hordenine , L-tyrosinol, S,R-amphetamine (+ and -), 4-OH-R(-)-amphetamine, methamphetamine (+ and -), (~)DOI, phenelzine, tranylcypromine, 3-methoxytyramine>dopamine, 3,4-DiMeO-PEA>Mescaline, (~)MDMA, 3,4-dihydroxybenzylguanidine, 3-phenylpropylamine, 1-methyl-3-phenylpropylamine, N,N-dimethylpropiophenone, N-phenylethylenediamine, kynuramine, 4-phenylbutylamine, tryptamine, 2-thiopheneethylamine, betahistine, 2>4>3-pyridylethylamine, 1-phenylpiperazine, 1-(1-napthyl)piperazine, 1,2,3,4-tetrahydroisoquinoline, (~)salsolinol, hydrocotarnine, nomifensine, R(-)apomorphine, S(+)2-aminotetralin, R(-)2-aminotetralin, (~)2-amino-1,2-dihydronapthalene, (~)3A6HC, (~)2-aminoindan, MPTP, 4-phenyl-1,2,3,6-tetrahydropyridine, tolazoline, naphazoline, phentolamine, agroclavine, biomocriptine, lisuride, d-LSD, metergoline, (~)fenfluramine, fenspiride, 2-phenyl-2-imidazoline, methylphenidate, pargyline, 2,2-diphenylethylamine, trans-cinnamyl-piperazine, 1-benzyl-piperidine, rimantidine, tripelennamine, tryptamine/5-MeO-DMT, forskolin, amphetamine/phentermine, cyproheptadine, dopamine, dihydroergotamine, fenoterol, HVA:D1 receptor, imidazoline/naphazoline, imidazoline/oxymetazoline, imidazoline/phentolamine, imidazoline/tolazoline, isoproterenol, metanephrine DL, methamphetamine/2-MeO, octopamine, PEA/2-amino 4-OH, PEA/3,4 dimethoxy, 4-OH-PEA/3-MeO, 4-amino-PEA, 4-methoxy-PEA, AEBSF-PEA, phenylephrine, piperazine/mCPP, piperazine/TFMPP, phenylpiperazine, prenylamine, 2-(2aminoethyl)pyradine, 3-(2aminoethyl)pyradine, 4-(2aminoethyl)pyradine, ritodrine, synephrine, tetralin/ADTN/6,7, 5-Fluoro-tryptamine, N,N-dimethyl-tryptamine, tryptophanol(~), m-tyramine, p-tyramine, or 3-hydroxytyramine.

42. A pharmaceutical composition comprising the compound of claim 17, 18, or 24 in admixture with a pharmaceutically acceptable carrier.

43. A method of reducing sympathomimetic effects of enhanced trace amine dependent synaptic transmission in a mammal comprising administering to said mammal a therapeutically effective amount of the pharmaceutical composition of claim 42.

44. The method of claim 43 wherein the mammal is a human.

45. A method of treating peripheral effects of a drug that binds to or affects the binding to trace amine receptors in a mammal comprising administering to said mammal a therapeutically effective amount of the pharmaceutical composition of claim 42.

46. The method of claim 45 wherein the peripheral effect is hyperthermia, rapid heart rate, high blood pressure, migraine, cardiac arrythmia, seizures, coma and diabetes.

47. The method of claim 45 wherein the mammal is a human.

48. A method of treating a pathological condition associated with elevated levels of trace amines in a mammal comprising administering to said mammal a therapeutically effective amount of the pharmaceutical composition of claim 42.

49. The method of claim 48 wherein the pathological condition is schizophrenia.

50. The method of claim 48 wherein the pathological condition is depression.

51. The method of claim 48 wherein the pathological condition is shock, hypertension, cardiac arrhythmia, asthma, migraine headache, psychosis, anaphylactic reactions and iatrogenic conditions.

52. The method of claim 48 wherein the mammal is a human.

53. A method of treating drug addiction in a mammal comprising administering to said mammal a therapeutically effective amount of the pharmaceutical composition of claim 42.

54. The method of claim 53 wherein the drug is .beta.-phenethylamine (PEA), hordenine , L-tyrosinol, S,R-amphetamine (+ and -), 4-OH-R(-)-amphetamine, methamphetamine (+ and -), (~)DOI, phenelzine, tranylcypromine, 3-methoxytyramine>dopamine, 3,4-DiMeO-PEA>Mescaline, (~)MDMA, 3,4-dihydroxybenzylguanidine, 3-phenylpropylamine, 1-methyl-3-phenylpropylamine, N,N-dimethylpropiophenone, N-phenylethylenediamine, kynuramine, 4-phenylbutylamine, tryptamine, 2-thiopheneethylamine, betahistine, 2>4>3-pyridylethylamine, 1-phenylpiperazine, 1-(1-napthyl)piperazine, 1,2,3,4-tetrahydroisoquinoline, (~)salsolinol, hydrocotarnine, nomifensine, R(-)apomorphine, S(+)2-aminotetralin, R(-)2-aminotetralin, (~)2-amino-1,2-dihydronapthalene, (~)3A6HC, (~)2-aminoindan, MPTP, 4-phenyl-1,2,3,6-tetrahydropyridine, tolazoline, naphazoline, phentolamine, agroclavine, bromocriptine, lisuride, d-LSD, metergoline, (~)fenfluramine, fenspiride, 2-phenyl-2-imidazoline, methylphenidate, pargyline, 2,2-diphenylethylamine, trans-cinnamyl-piperazine, 1-benzyl-piperidine, rimantidine, tripelennamine, tryptamine/5-MeO-DMT, forskolin, amphetamine/phentermine, cyproheptadine, dopamine, dihydroergotamine, fenoterol, HVA:D1 receptor, imidazoline/naphazoline, imidazoline/oxymetazoline, imidazoline/phentolamine, imidazoline/tolazoline, isoproterenol, metanephrine DL, methamphetamine/2-MeO, octopamine, PEA/2-amino 4-OH, PEA/3,4 dimethoxy, 4-OH-PEA/3-MeO, 4-amino-PEA, 4-methoxy-PEA, AEBSF-PEA, phenylephrine, piperazine/mCPP, piperazine/TFMPP, phenylpiperazine, prenylamine, 2-(2aminoethyl)pyradine, 3-(2aminoethyl)pyradine, 4-(2aminoethyl)pyradine, ritodrine, synephrine, tetralin/ADTN/6,7, 5-Fluoro-tryptamine, N,N-dimethyl-tryptamine, tryptophanol(~), m-tyramine, p-tyramine, or 3-hydroxytyramine.

55. The method of claim 53 wherein the mammal is a human.