CA2418780A1 - Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof - Google Patents

Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof Download PDF

Info

Publication number
CA2418780A1
CA2418780A1 CA002418780A CA2418780A CA2418780A1 CA 2418780 A1 CA2418780 A1 CA 2418780A1 CA 002418780 A CA002418780 A CA 002418780A CA 2418780 A CA2418780 A CA 2418780A CA 2418780 A1 CA2418780 A1 CA 2418780A1
Authority
CA
Canada
Prior art keywords
leu
val
ser
ala
thr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002418780A
Other languages
French (fr)
Inventor
Serge Dea (Deceased)
Bernard Massie
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de La Recherche Scientifique INRS
National Research Council of Canada
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CA002418780A priority Critical patent/CA2418780A1/en
Publication of CA2418780A1 publication Critical patent/CA2418780A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides for codon-optimized nucleic acid molecules and expression constructs and their use to immunize swine against Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). These codon-optimized nucleic acid molecules encode PRRSV
proteins or fragments thereof.

Description

FIELD OF THE INVENTION
The present invention pertains to the field of recombinant mammalian vectors, particularly to novel PRRSV-related sequences in vectors for the immunization of animals against porcine reproductive and respiratory syndrome virus (PRRSV).
BACKGROUND
Strains of PRRSV
Porcine reproductive and respiratory syndrome virus (PRRSV) has been found to be the causative agent of porcine reproductive and respiratory syndrome (PRRS), an economically important viral disease that affects swine worldwide. Although the clinical syndromes associated with PRRSV infection are similar in North America and Europe, strains from the two continents are distinct and DNA sequence analysis of both North American and European strains has revealed high genomic variations (Mardassi et al., (1994) J. Gen. Virol.
75:681-685; Mardassi et al., (1994) J. Clin. Microbiol. 32:2197-2203; Meng et al., (1995) Arch. Virol.
140:745-755;
Murtaugh et al. , (1995) Arch. Virol. 140:1451-1460). The prototype European strain of PRRSV
is the Lelystad virus (LV). This virus was described in EP 0 587 780 B1.
North American and European strains of PRRSV display a high degree of variability in their ORF 2, 3, S, and 7 coding regions with less than 60% amino acid identities (Mardassi et al., (1995) Arch. Virol. 140:1405-1418; Meng et al., (1995) J. Gen. Virol. 76:3181-3188; Meng et al., (1995) Arch. Virol. 140:745-755; Murtaughetal., (1995) Arch. Virol.
140:1451-1460).
Unique PRRSV strains have been isolated in Quebec (Dea et al., (1992) Can.
Vet. J. 33:801-808;
Mardassi et al., (1994) Can. J. Vet. Res. 58:55-64; Mardassi et al., (1994) J.
Gen. Virol. 75:681-685). One such strain was adapted to grow in cell culture and is known as the Quebec reference cytopathic strain IAF-Klop (Mardassi et al., (1995) Arch. Virol. 140:1405-1418).
PRRSV
2S PRRSV was first isolated in the Netherlands (Wensvoort et al., (1991) Vet.
Q. 13:121-130) in the early 1990s, being associated with a similar syndrome in most of the pig producing countries within the next three year-period (reviewed in Dea et al. , (2000) Arch.
Virol. 145:659-688).
PRRSV belongs to the recently recognized Arteriviridae family in the genus Arterivirus, order Nidovirales along with equine arteritis virus (EAV), simian hemorrhagic fever virus (SHFV) and lactate dehydrogenase elevating virus (LDV) (Cavanagh, (I997) Arch. Virol.
142:629-633; de Vries et al., (1997) Seminars in Virology 8:33-47). The disease is clinically characterized by reproductive disorders in sows and gilts and respiratory problems affecting pigs of all ages (Goyal, (1993) J. Vet. Diagnostic Investigations 5:656-664).
The viral genome consists of a positive single-stranded RNA molecule of approximately 1S kb in length, composed of nine open reading frames (ORFla, ORFIb, ORF2a, ORF2b and ORF3-7).
The ORF1, which represents nearly 75% of the viral genome, encodes for proteins with apparent replicase and polymerase. The ORFs 5 to 7 encode for the envelope glycoprotein GPS (25-26 kDa), the non-glycosylated membrane protein M (18-19 kDa) and the nucleocapsid protein N
(14-15 kDa), which are the three major structural proteins of PRRSV. These PRRSV structural proteins are closely associated both in the infected cells and in the viral particles, the GP5 and M
proteins being associated in the form of heterodimers. The structural nature of the ORF3 product, a highly glycosylated protein with an apparent M~ of 42 kDa, is still being debated, in view of the apparently conflicting data on its presence on the virions of North American and European PRRSV strains. The ORFs 2a and 4 encode for the GPZ and GP4 glycoproteins, with respective Mr of 29 and 31 kDa, and have been identified as minor structural glycoproteins of the virion.
Recently, it has been demonstrated that the ORF2 is a bicistronic gene, an additional 10-kDa protein being encoded by a second ORF, named ORF2b, which start codon is only 6 nucleotides downstream of the adenine of the ORF2a start codon (Dea et al., (2000) Arch.
Virol. 145:659-688; Snijder & Meulenberg, (1998) J. Gen. Virol. 79:961-979; Wu et al., (2001) Virology 297:183-191 ).
Vaccines Anti-PRRSV swine immunization practices have used live attenuated viral vaccines to mimic a natural infection, however a serious disadvantage of such vaccines is their pathogenicity in immunosuppressed recipients exposed to environmental stress, such as the poor housing and over-crowding that are often prevalent in intensive animal raising operations.
This can be of great concern in veterinary medicine where clinical outbreaks are sometimes reported shortly after prophylactic immunization. These vaccines also require special handling to maintain viability and to avoid tissue culture contaminants.
Administration of live modified vaccines is also problematic because such vaccines may result in virus persistence, which in turn contributes to the generation of mutants through selective immune pressure on the resident variants. Persistently infected animals may eventually shed newly generated mutants, particularly in the case of unstable pathogens such as RNA viruses, and these mutants may be responsible for new outbreaks.
Production and purification of large quantities of viral particles for use in whole viral inactivated vaccines or their immunogenic structural proteins is economically unfeasible for low yield viruses such as PRRSV. Antigenic viral peptides may be expressed recombinantly in bacteria, yeast, or even mammalian cells and harvested for use in immunizations, however they often require extensive treatment to ensure appropriate antigenicity.
Circulating antibodies in PRRSV-infected pigs responsible for viral neutralization in cell cultures are mainly directed against GPS (Gonin etal., (1999) J. Vet. Diagnostic Investigation 11:20-26).
Immunization experiments of mice with E.rcherichia coli-expressed GST-ORFS
recombinant fusion protein, as well as with purified PRRSV, induced specific anti-GPS
neutralizing monoclonal antibodies (Pirzadeh & Dea, (1997) J. Ger.. Virol. 73:1867-1873;
Zhang et al., (1998) Veterinary Microbiology 63:125-136). Furthermore, genetic immunization of pigs, with plasmidic DNA expressing the ORFS gene under the control of the human cytomegalovirus immediate-early promotor/enhancer, not only triggered the production of neutralizing antibodies to PRRSV but also conferred protection against development of clinical disease and lung lesions following an intratracheal challenge with a high dose of PRRSV (Pirzadeh &
Dea, (1998) J. Gen.
Virol. 79:989-999; Gagnon et al., (2001) Adv Exp Med Biol. 494:225-31).
However, DNA immunization is apparently not sufficient to inhibit virus persistence and shedding in the respiratory tract of PRRSV challenged pigs (Pirzadeh & Dea, (1998) J. Gen.
Virol. 79:989-999). Although these constructs were able to induce a specific immune response, circulating antibody titres were transient and low. On the other hand, when the E. coli-expressed GST-ORFS recombinant fusion protein was used as an immunogen prior to a challenge with the pathogenic virus, the disease was more severe despite the development of high titres (> 1:2048) of non-neutralizing antibodies to GPS. This observation suggests that an antibody-dependent enhancement (ADE) phenomenon could be involved where such anti-GPS antibodies may facilitate PRRSV infection through the attachment of the immune complexes to Fc receptors present at the surface of alveolar macrophages (Molitor et al., (1997) Vet.
Microbiol. 55:265-276; Pirzadeh & Dea, (1998) J. Gen. Virvl. 79:989-999). These findings also suggest that the amounts of GPS synthesized in the infected cells, as well as the conformation of the mature protein which rnay be influenced by the type of oligosaccharide side chains present on the molecule, are apparently crucial to trigger an effective humoral immune response to PRRSV.
Due to the correlation apparent amongst protection, clinical course of the disease, and seroneutralizing antibody titres (Loemba et al., (1996) Arch. Virol. 141:751-761; Pirzadeh &
Dea, (1998) J. Gen. Virol. 79:989-999; Vezina et al.. (1996) Can. J. Vet. Res.
60:94-99), an increase in the efficacy of genetic immunization against antigenic determinants of the major GPS
envelope-associated glycoprotein could provide improved response.
Considering the increased incidence of PRRSV infection through the world, a need remains for an effective vaccine against PRRSV infection. The vaccine should be safe for use in swine, including pregnant sows and suckling, unweaned, and growing pigs. As well, a test is needed for the serological diagnosis of PRRSV infection that can differentiate between vaccination and infection with naturally occurring strains of PRRSV.
This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention. Publications referred to throughout the specification are hereby incorporated by reference in their entireties in this application.
SUMMARY OF THE INVENTION
The present invention is directed to synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and uses thereof. In accordance with an aspect of the present invention, there is provided an isolated nucleic acid molecule comprising a nucleotide sequence that encodes the amino acid sequence of a porcine reproductive and respiratory syndrome virus (PRRSV) polypeptide, said nucleotide sequence having at least one non-preferred codon replaced by a preferred codon.
In accordance with another aspect of the present invention, there is provided a vector comprising a nucleic acid molecule of the invention.
In accordance with another aspect of the present invention, there is provided a host cell genetically engineered with a nucleic acid molecule of the invention or with a vector of the invention.
In accordance with another aspect of the present invention, there is provided a process for producing recombinant a host cell capable of expressing a PRRSV polypeptide or fragment thereof, comprising genetically engineering said cell with a nucleic acid molecule of the invention, or with a vector of the invention.
In accordance with another aspect of the present invention, there is provided a process for producing a PRRSV polypeptide or a fragment thereof, comprising culturing a host cell of the invention, and recovering the polypeptide encoded by the nucleotide sequence from the culture.
In accordance with another aspect of the present invention, there is provided an isolated polypeptide having an amino acid sequence encoded by a nucleic acid molecule of the invention, or produced by culturing a host cell of the invention, and recovering the polypeptide encoded by the nucleotide sequence from the culture.
In accordance with another aspect of the present invention, there is provided a use of a nucleic acid molecule of the invention or a vector of the invention, in the preparation of a composition.
In accordance with another aspect of the present invention, there is provided a composition, comprising a nucleic acid molecule of the invention or a vector of the invention and a carrier or adjuvant.
In accordance with another aspect of the present invention, there is provided a kit, comprising a composition of the invention, and a storage container suitable for containing said composition.
I5 In accordance with another aspect of the present invention, there is provided a use of a composition of the invention for immunization of a pig in need thereof.
In accordance with another aspect of the present invention, there is provided a method of making antibodies against one or more PRRSV proteins comprising administering to an animal a nucleic acid molecule of the invention, or a vector of the invention or a composition of the invention, collecting at least one blood sample at a suitable times post-administration, and isolating a serum fraction containing antibodies against one or more PRRSV proteins.
In accordance with another aspect of the invention, there is provided antibodies against one or more PRRSV proteins prepared by a method comprising administering to an animal a nucleic acid molecule of the invention, or a vector of the invention or a composition of the invention, collecting at least one blood sample at a suitable times post-administration, and isolating a serum fraction containing antibodies against one or more PRRSV proteins.
In accordance with another aspect of the present invention, there is provided an isolated serum composition suitable for immunization of a pig against PRRSV, comprising an effective amount of semi-purified blood serum obtained from a mammal inoculated with a composition of the invention.
In accordance with another aspect of the present invention, there is provided a use of a serum obtained from a mammal inoculated with a composition of the invention to immunize a pig in need thereof.
In accordance with another aspect of the present invention, there is provided a kit for detecting in a sample an antibody that specifically recognizes a PRRSV polypeptide or an antigenic fragment thereof, comprising a nucleic acid molecule of the invention, or a vector of the invention, or a host cell of the invention, which is capable of expressing one or more PRRSV
polypeptides and/or one or more antigenic fragments thereof.
In accordance with another aspect of the invention, there is provided a diagnostic composition comprising a nucleic acid molecule of the invention, or a vector of the invention and optionally a diluent or carrier.
In accordance with another aspect of the invention, there is provided a primer capable of specifically hybridizing a nucleic acid molecule of the invention.
In accordance with another aspect of the invention, there is provided a method for detecting in a sample obtained from a pig, the presence of a nucleic acid molecule of the invention, or a portion thereof, comprising: obtaining a sample from a pig; contacting said sample with at least one primer of the invention under hybridizing conditions; and determining the presence of a hybridizing nucleic acid sequence in said sample, wherein said pig was previously immunized with a composition comprising a nucleic acid molecule of the invention, and said nucleotide sequence is not complimentary to a nucleic acid molecule of the invention.
In accordance with another aspect of the invention, there is provided a kit for detecting in a sample obtained from a pig, the presence of a polynucleotide specific to the nucleic acid molecule of the invention or a fragment thereof, comprising at least one primer of the invention, and a suitable container for containing said at least one primer.
Various other objects and advantages of the present invention will become apparent from the detailed description of the invention.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Figure 1 shows sequence of a codon-optimized ORFS polynucleotide that encodes fragments of a modified ORFS polypeptide from the IAF-94-287 strain of PRRSV.

Figure 2. Figure 2 shows the sequence of the 603-by ORFS of the IAF-Klop strain of PRRSV
(GenBank Accession No U64928) and that of the synthesized (synORFS) with the deduced amino acid sequence. Changed codons for synORFS are underlined. Deduced amino acid sequences from both wtORFS and synORFS genes are identical.
Figure 3. Figure 3 shows the immunofluorescence staining of 293 cells at 48 h post-transfection with the pRc/CMV2 (control), pRc/CMV2/wtORFS (WT) or pRc/CMV2/synORFS (SYNT) recombinant plasmids. Expression of GPS of PRRSV (strain IAF-Klop) was confirmed by indirect immunofluorescence (IIF) following incubation in the presence of the rabbit anti-a5 monospecific serum.
Figure 4. Figure 4 shows co-expression in the simian MARC-I45 cells of the reporter gene GFPq (green fluorescent protein) inserted upstream of the wtORFS or synORFS
genes in the constructed hAdVs. (Left) Intensity of fluorescence spontaneously released by the GFPq protein in MARL-145 cell monolayers co-infected with AdVCMV/tTA and hAdV/TR5/DC/GFPq/wtORFS at a multiplicity of infection (moi) of 100 after 24, 48 and 70h of incubation, respectively. (Right) Intensity of fluorescence spontaneously released by the GFPq protein in MARC-145 cell monolayers co-infected with AdVCMV/tTA and hAdV/TR5/DC/GFPq/synORFS at a moi of 100 after 24 , 48 and 70 h of incubation, respectively.
Figure S. Figure 5 shows the expression in the simian MARC-145 cells of the recombinant GPS
envelope glycoprotein of PRRSV (strain IAF-Klop) by hAdVs expressing the wtORFS or synORFS genes. MARL-145 cell monolayers were co-infected with AdCMV/tTA and hAdV/TR5/DC/GFPq/wtORFS (lane WT) or hAdV/TR5/DC/GFPq/synORFS (lane SYNT) at a moi of 100 PFU, then fixed with cold acetone and washed twice with PBS after 24, 48 and 70 h of incubation, respectively, to eliminate spontaneous GFPq fluorescence.
Expression of GPS of PRRSV was confirmed by specific IIF following incubation in the presence of the rabbit anti-a5 monospecific serum.
Figure 6. Both panels of Figure 6 show the radioimmunoprecipitation of GPS
protein from lysates of 293rtTA cells infected 48 h earlier with either hAdVlTRS/DC/GFPq/wtORFS (lane WT) or hAdV/TR5/DC/GFPq/synORFS (lane SYNT). The immune complexes obtained after incubation in the presence of rabbit anti-a5 monospecific serum were adsorbed on protein A-sepharose beads, then analysed by SDS-PAGE and revealed by fluorography and autoradiography. The major structural proteins of the PRRSV (proteins N, M and GPS, having relative molecular weights of 14, 19 and 24-26 kDa respectively), could be immunoprecipitated from lysates of PRRSV-infected cells (lane V, left panel only) but not from lysates of mock-infected cells (-). The ratio of lysate cpm loaded in each lane is shown at the bottom on each panel. '°C-radiolabelled molecular weight size standards (in kDa) were migrated in lane L.
Figure 7. Figure 7 shows the increased anti-GPS humoral immune response of pigs immunized with synORFS or control vaccine mixtures as revealed by Western blot. Piglets were injected intradermally twice at 32 day-interval with either AdCMVS/tTA alone (tTA), a 1:5 mixture of hAdV/TR5/DC/GFPq/wtORFS + AdCMV/tTA (wtORFS) or a 1:5 mixture of hAdV/TR5/DC/GFPq/synORFS + AdCMV/tTA (synORFS), as described in the materials and methods section. They were challenged intranasally four weeks after the booster injection with 105 TCIDso of the homologous IAF-Klop strain of PRRSV. Western blot strips were prepared using sucrose-gradient purified PRRSV (IAF-Klop strain) as antigen. The reactivity profiles of serum from all 9 pigs are illustrated for serum collected 10 days (panel A) and 21 days post-challenge (panel B). The positive control (+) corresponds to the reactivity of the a5 rabbit monospecific hyperimmune serum with the sucrose gradient purified virus (Mardassi et al., 1996). These data are also presented in Table 4: (-) no GPS band; (w) weak band; (+) moderate or strong band.
Figure 8. Figure 8 shows the sequence of (top line) a completely codon-optimized ORFS
sequence (synORFS) of the IAF-Klop strain of PRRSV. This nucleotide sequence is compared to (middle line) a partially codon-optimized ORES polynucleotide (synORFS
variant) based on a modified (non-wild-type) ORFS sequence, and (bottom line) the 603-by wild-type ORFS
sequence (GenBank Accession No U64928). Compared to the synORF5 sequence, only the replaced nucleotides are shown for the variant and wild-type sequences.
Variant nucleotides that are underlined differ from those used in the synORFS sequence, and variant nucleotides that are in boxes alter the amino acid expressed relative to the synORFS (and wild-type) sequence. The synORFS variant is the partially codon-optimized version and the deduced amino acid sequence differs from the wild type in having C48Y, A63S, W155L and G183A. For example the amino acid at position 183 is G in the protein expressed from the wild-type ORFS and synORFS
sequences, and is A in the protein expressed from the modified ORFS and synORF5 variant sequences. Deduced amino acid sequences from the wtORFS gene and synORFS
polynucleotide are identical.
Figure 9. Figure 9 shows the expression in 293 cells of the partially codon-optimized ORFS
sequence of Figure 8. The synORFS variant sequence and an unoptimized wild-type sequence (ORFS sequence of the IAF-Klop strain) were each cloned into a pVAX plasmid vector (Invitrogen Canada Inc., Burlington, Ontario) and transfected into 293 cells as described previously. Cells were fixed after 48 h of incubation and expression of the transfected ORFS
polynucleotides was confirmed by specific IIF following incubation in the presence of the rabbit anti-a5 monospecific serum. Expression of the ORFS proteins was increased for both vectors compared to a control vector (pVAX), and greatest for the synORFS variant.
Figure 10. Figure 10 shows the sequence of the 537-by ORF4 (GenBank accession number AF003345) of the IAF-Klop strain of PRRSV, and that of a codon-optimized ORF4 polynucleotide. The nucleotides substituted in order to optimize the codons of synORF4 are shown. Deduced amino acid sequences from both wtORF4 and synORF4 polynucleotides are identical.
Figure 11. Figure 11 shows the sequence of the 525-by ORF6 of the IAF-Klop strain of PRRSV
(GenBank Accession No U64928) and that of a codon-optimized ORF6 polynucleotides.
Deduced amino acid sequences from both wtORF6 and synORFb polynucleotides are identical.
Figure 12. Figure shows a hydrophilicity plot for the GP5 protein (encoded by the wtORFS
polynucleotide) of 4 different strains of PRRSV.
Tables Table 1. North American PRRSV strains and their GenBank accession numbers.
Table 2. Examples of preferred codons for optimal expression in mammalian cells.
Table 3a. Table 3a shows the frequency of codon occurrence in humans (H) and in the ORFS
protein (GPs) of the IAF-Klop strain of PRRSV. The frequencies of the individual codons are shown as percentages for each of the degenerately encoded amino acids, as well as the number of each amino acid for GPS (in parentheses). The most prevalent codon is shown underlined in bold.
Table 3b. Table 3b shows the frequency of codon occurrence in humans (H) and in the ORF4 gene (encoding the GPI protein) of the IAF-Klop strain of PRRSV. The frequencies of the individual codons are shown as percentages for each of the degenerately encoded amino acids, as well as the number of each amino acid for GPI (in parentheses). The most prevalent codon is shown underlined in bold.
Table 3c. Table 3c shows the frequency c>f codon occurrence in humans (H) and in the ORF6 gene (encoding the M protein) of the IAF-Klop strain of PRRSV. The frequencies of the individual codons are shown as percentages for each of the degenerately encoded amino acids, as well as the number of each amino acid for the M protein (in parentheses). The most prevalent codon is shown underlined in bold.
Table 4. Post-challenge antibody response to immunization with vaccines expressing either the wild type or synthetic codon-optimized PRRSV ORFS gene.
Table 5. Oligonucleotide primers used in PCR amplification of the synthetic ORFS (synORFS of IAF-Klop, Figure 2, SEQ ID NO: 1) DETAILED DESCRIPTION OF THE INVENTION
The present invention resides in the discovery that use of a codon-optimized nucleic acid sequence encoding a PRRSV protein to immunize swine results in increased expression of the protein product and an enhanced immune response in swine.
The present invention provides for codon-optimized PRRSV ORF nucleic acid sequences and expression constructs and their use to immunize swine against PRRSV. Fragments of a full length ORF gene that encode fragments of the full-length PRRSV protein can also be constructed and used.
Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Reference can be made to, for example, " Immunobiology" (5th ed. CA Janeway et al. Garland Publishing, c2001) regarding immunological terms and concepts in the art. The following terms and abbreviations are used throughout the specification and in the claims.
As used herein, "nucleic acid molecule" refers to a polymeric form of nucleotides of any length, both to ribonucleic acid sequences and to deoxyribonucleic acid sequences. In principle, this term refers to the primary structure of the molecule; thus, this term includes double and single stranded DNA, as well as double and single stranded RNA, and modifications thereof. This term may be used interchangeably with the terms "polynucleotide" and "nucleic acid sequence".
As used herein, "expression construct" encompasses, for example, expression cassettes and expression vectors, and refers to a genetic construct containing one or more nucleic acid sequences coding for all or part of one or more gene products, which are capable of being transcribed. The transcript may be translated into a protein, but it need not be. Thus, in certain embodiments, expression includes both transcription of the nucleic acid sequence and translation of the mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid sequence. The nucleic acid sequences coding for all or part of one or more gene products can be a subunit of an expression construct.
"Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
"Control sequence" refers to polynucleotide sequences which are necessary to effect the expression of coding and non-coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence; in eukaryotes, generally, such control sequences include promoters and transcription termination sequence. The term "control sequences" is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
As used herein, "porcine reproductive and respiratory syndrome", or "PRRS"
refers to the disease syndromes Mystery Swine Disease, Mystery Pig Disease, Mystery Disease, Mystery Reproductive Syndrome, swine plague, New Pig Disease, Wabash syndrome, abortus blau, Blue Eared Pig Disease, Porcine Epidemic Abortion and Respiratory Syndrome (PEARS), swine infertility and respiratory syndrome (SIRS), Epidemic Late Abortion of Swine (ELAS), Hyperthermia, Anorexia and Abortion Syndrome of the Sow (HAASS), Porcine Arterivirus, the disease caused by the Iowa strain of PRRSV, and closely-related variants of these diseases which have appeared and which will appear in the future. The symptoms of this syndrome are well known in the art, and include but are not limited to reproductive disorders and respiratory problems (Goyal et al., (1993) J Vet Diagn Invest 5:656-664). Severe reproductive disorder is characterized by mummified fetuses, stillbirths, late term abortions, premature farrowings and an increase in neonatal mortality associated with weak-born piglets. Severe respiratory distress is more pronounced in newborn and nursing pigs but can affect pigs of all ages and is characterized by chronic pneumonia cause by interstitial pneumonia, in severe case mouth breathing can be observed. Also, the PRRS disease has the appearance of an influenza like syndrome. Other symptoms may occurs like conjunctivitis, blue discoloration of the skin, fever, lethargy, poor appetite, sneezing, vomiting and in rare case central nervous system signs may develop (Goyal et al., (1993) J Vet Diagn Invest 5:656-664).
As used herein, "porcine reproductive and respiratory virus (PRRSV)" refers to the causative agent of a porcine reproductive and respiratory syndrome, as described above.
As used herein, a "vaccine" refers to an agent used to vaccinate (immunize) swine, i.e. to protect swine, against PRRS resulting from infection by PRRS virus. "Vaccine" can additionally mean an agent whereby, after administration of the agent to an unaffected swine, and subsequent exposure to a PRRSV, lesions in the lung or symptoms of the syndrome do not appear or are not as severe as in infected, untreated swine. An unaffected swine is one that has either not been exposed to a PRRSV, or that has been exposed to a PRRSV but is not showing symptoms of the syndrome. An affected swine is one that is showing symptoms of the syndrome.
As used herein, "ORF" refers to an open reading frame of a nucleotide sequence encoding a PRRSV protein. That is, in the context of the present invention an ORF is a sequence of a nucleic acid molecule that encodes a PRRSV polypeptide. An ORF polynucleotide sequence can be a wild-type sequence or a modified sequence. It is further understood that the term ORF can refer to the full length of an ORF gene or ORF coding sequence, or less than the full length of these sequences, i.e. to fragments or subsequences of an ORF gene. PRRSV
proteins are known in the art by various names, including as ORF proteins distinguished by including a numeral after the prefix "ORF". e.g. ORFS, ORF6, ORF2a, etc.
As used herein, "codon" refers to a sequence of three consecutive nucleotides, of either ribonucleic acid or deoxyribonucleic acid, which constitutes the instruction for incorporation of a specific amino acid in a specific position in a polypeptide chain during protein synthesis. An amino acid may be encoded by more than one codon and frequency of codon-usage varies between species. A codon that is rarely used by a species is herein referred to as a "non-preferred codon", and a codon that is most frequently used by a species is herein referred to as a "preferred" codon.
As used herein, "codon optimization" refers to the design of a nucleic acid sequence encoding a known amino acid sequence so that one or more non-preferred codons is replaced by a preferred codon whereby the designed (optimized) nucleic acid sequence encodes the same known amino acid sequence as the unoptimized sequence.

As used herein, "codon-optimized nucleic acid sequence" or "codon-optimized polynucleotide"
or "synthetic ORF" or "synORF" refers to a codon-optimized nucleotide sequence encoding a PRRSV ORF protein or fragment thereof.
As used herein, "immune response" refers to a cellular or humoral response of the immune system.
As used herein, "specific immune response" refers to an adaptive immune response, i.e. one that is specific for an infecting pathogen, such as the production of antibodies against a particular pathogen. It may be naturally-induced, for example by a naturally infecting pathogen, or artificially induced, for example by passive or active immunization. A
specific immune response is distinct from a non-specific or innate immune response. A non-specific or innate immune response is not specific to a particular infecting pathogen, for example, the response of macrophages that are immediately available to combat a wide range of pathogens without requiring prior exposure. Non-specific modulators of the immune system are modulators of the non-specific immune repsonses. These concepts and distinctions are understood in the art (see for example Chapter 1 in " Immunobiology" 5th ed. CA Janeway et al. Garland Publishing, c2001 ).
As used herein, "immunologically active" or "biologically active" refers to an activity that promotes the generation of a specific immune response against PRRSV in an animal, or in an in vitro, ex vivo or other system that is predictive of a specific immune response against PRRSV in an animal. This activity can be the result of a direct interaction with the immune system or isolated components of the immune system, such as the activity of an antigenic peptide fragment binding an antibody. A molecule, such as a peptide, is also considered immunologically active when it promotes the generation of an anti-PRRSV immune response that does not involve a direct interaction with the immune system or components thereof. Examples of interaction that indirectly generate an anti-PRRSV immune response include stabilization of an antigenic conformation of an antigenic peptide, when the stabilizing component does not itself necessarily have antibody-binding epitopes. A peptide that is not antigenic in the absence of other peptides is nonetheless considered immunotogically active if it participates directly in the generation of an antigenic epitope upon homo- or hetero- dimerization. In the context of this invention, "immunologically active" does not refer to activities that non-specifically modulate the immune system, i.e activities that modulate a non-specific or innate immune response.
"Stringent" hybridization conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCI/0.0015 M sodium citrate /
0.1%SDS at 50C), or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1%Ficoll/0.1%
polyvinylpyrrolidone/50 nm sodium phosphate buffer at pH 6.5 with 750 mM NaCI, 75 mM
sodium citrate at 42C. Another example is hybridization in SO% formamide, 5x SSC (0.75M
NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 ug/ml), 0.1% SDS, and 10% dextran sulfate at 42C, with washes at 42C in 0.2x SSC and 0.1% SDS. A skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal.
Codon-optimization of PRRSV ORF nucleic acid sequences Preferential codon usage is known in the art and preferred codons for expression in mammalian cells are shown in Table 2. Codon optimization has been reported with varying degrees of success. See, for example, Grosjean et al. (1982) Gene 18:199-209, Haas et al.
(1998) Current Biology 6:315-324, Andre et al. (1998) J. Virol. 72:1497-1503, Corbet et al.
(2000) AIDS Res Hum Retroviruses 16:1997-2008. Codon optimization is described in W097/28273, W099/03997, WO00/65076 and WO00/188141.
The genomic sequences for a number of PRRSV strains are known in the art, and many have been deposited in GenBank, the NIH genetic sequence database. Polynucleotide sequences encoding proteins of North American PRRSV strains are used in the instant application.
Examples of PRRSV strains and accession numbers for their genomic and/or protein-encoding sequences are given in Table 1. The wild-type ORF sequences for PRRSV strains not listed in GenBank are readily obtainable by those skilled in the art by generally applicable molecular biology techniques such as Southern blotting and colony hybridization.
PRRSV ORFs contemplated for use in the present invention include ORFS, ORF6, ORF4, ORF2a, or ORF2b, ORFIa, ORFIb, ORF3 or ORF7, in which case they could be referred to, for example, as synORFS, synORF6, synORF4 or synORF2a, or synORF2b, synORFla, synORFlb, synORF3 or synORF7 respectively.
wtORF sequence GenBank Reference (IAF-Klop strain of PRRSV) I Accession No.
ORF2 AF003343 Gonin et al., ORF3 AF003344 I (1999) J Vet Diagn Invest 11:20-26 ORF4 AF003345 ~
ORES U64928 j Pirzadeh et al., ORF6 U64928 (1998) Can J Vet Res 62:170-177 ORF7 U64928 Gagnon et Dea, (1998) Can J Vet Res 62:110-116 In an exemplary embodiment, the unoptimized ORF nucleic acid sequences are from IAF-BAJ
(e.g. GenBank accession # U64929), or from IAF-94-287 (e.g. U64934), or from the Quebec reference cytopathic strain IAF-Klop (Mardassi et al., (1994) Can. J. Vet.
Res. 58:55-64;
Mardassi et al. , (1995) Arch. Virol. 140:1405-1418), e.g. GenBank Accession Number U64928.
The unoptimized PRRSV nucleic acid sequence upon which the optimized synORF
sequence is based can encode a wild type PRRSV polypeptide or a modification (mutation) of the wild-type PRRSV amino acid sequence. Illustrative amino acid modifications are encoded by nucleotide substitutions, additions, deletions, inversions and transversions. The modified PRRSV
polypeptides encoded by the colon-optimized sequences of the invention are biologically active (immunologically active). In accordance with the present invention, the contemplated amino acid sequence modifications include, but are not limited to, those that contribute to the utility of the synORF polynucleotide sequences of the invention, for example as a vaccine, by improving efficacy (immunological activity) and/or bioavailability of the synORF
expression product and/or reduce its toxicity. Such modifications may give rise to mutant po(ypeptides that are functionally altered with respect to, for example, transcription or translation efficiency, sequence length (e.g. truncated polypeptides), intracellular location, interactions with other polypeptides (e.g. homo- or hetero- dimerization), and/or undergo altered post-translational processing of the polypeptide, for example by mutation of phosphorylation sites, or asparagine residues that are N-glycosylation sites. Alternatively, synORF potynucleotide sequences of the invention can be based on unoptimized PRRSV polypeptide sequences that incorporate modifications introduced for technical reasons, e.g. for technical convenience.
In accordance with the present invention, an optimized ORF nucleic acid sequence can be a completely optimized sequence in which all of the non-preferred colons are replaced by preferred colons, or a partially optimized nucleic acid sequence in which less than all of the non-preferred colons are replaced by a preferred colon. For example, I or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 15 or more, 20 or more, or 30 or more or 40 or more or 50 or more, or 75 or more or 100 or more, non-preferred colons may be replaced by preferred colons, or at least about 50%, 60%, 70%, 80%, 90%, 95%, or at least about 98% of the non-preferred colons may be replaced by preferred colons, or all but 10, all but 9, all but 8, all but 7, all but 6, alt but 5, all but 4, all but 3, all but 2, or all but 1 of the non-preferred codons are replaced by preferred codons. In other words, the percent of non-preferred codons replaced by preferred codons may be 100% or less, 98% or less, 95% or less, 93% or less, 90% or less, 85% or less, 80% or less, 75% or less, 66% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less, for example.
Candidate synthetic sequences are tested to determine if the complete or partial optimization has improved expression over that of the unopt.imized ORF polynucleotide sequence.
Efficacy of the construct in eliciting an immune response and cytotoxicity of the constructs can also be assessed, according to the methods described below (see also Examples).
In accordance with the present invention, a synORFS sequence based on the IAF-Klop strain is provided, having 130 nucleotide substitutions such that all of the non-preferred codons of the unoptimized sequence are replaced with preferred codons in the optimized synORFS
polynucleotide (see Figure 2, SEQ ID NO: 1). A related embodiment of the invention is a synthetic ORFS polynucleotide variant ("synORFS variant") designed from a modified ORFS
sequence and having less than all codons optimized (see Figure 8, SEQ ID NO:
40). The nucleotide sequence of a third codon-optimized ORFS sequence, "synORFS
variant2", is provided in SEQ ID NO: 71 and encodes the wild type amino acid sequence of ORFS of IAF-Klop (and thus the same polypeptide as synORFS). The synORFS variant2 and synORFS
nucleotide sequences differ in 6 positions.
Completely optimized synORF4 and synORF6 polynucleotide sequences are also provided (see Figure 10 and Figure I 1 ) and, in accordance with the present invention, synORF sequences can also be based on the unoptimized sequences of ORFIa, ORFlb, ORF2a, ORF2b, ORF3 or ORF7.
The codon-optimized ORF nucleic acid sequences according to the present invention can encode an entire nucleic acid sequence of a PRRSV ORF polynucleotide or one or more fragments thereof that are biologically active (immunologically active). Fragments of ORF nucleic acid molecules typically encode ORF protein fragments that are themselves antigenic or that can less directly enhance an anti-PRRSV immune response (in vitro and/or in vivo). Such fragments will generally contain at least 7, or at least 10 amino acids to generate an epitope, and typically these will be consecutive amino acids from the PRRSV polypeptide sequence.
Candidate fragments are selected non-randomly, for example based on evidence predicting that they will be antigenic or less toxic, e.g. based on hydrophilicity plots (Figure I2) or experimental data. For example work by Fernandez et al. ((2002) Virus Res 83:103-118) indicates that domains within the N-terminal 119 amino acids of PRRSV ORF5 play a major rote in the induction of apoptosis, and thus of cytotoxicity that might lower expression of synORFS
polynucleotides of the invention. Alternatively or in addition, fragments can be randomly selected and screened for immunological activity. The fragments can be screened for immunological activity using in vitro and/or in vivo methods described below (see also the Examples). In accordance with the present invention candidate fragments can also be screened for bioavailability (e.g. expression) and/or toxicity and/or other characteristics considered relevant to the uses of the present invention by a worker skilled in the art (see below, and Examples).
Antigenic peptides that can be used include, for example, fragments that contain one or more neutralizing epitopes, including fragments that form the extracellular domains) of the PRRSV
polypeptide. In an exemplary embodiment, such a fragment will be from the hydrophilic region of an ORFS polypeptide, for example nucleotides 106-156 (amino acids 36-52) of an ORFS
protein of the IAF-Klop strain (Plagemann et al., (2002) Arch Virol 147:2327-2347), or smaller or larger fragments containing consecutive sequences of at least 7 or at least 10 amino acids from within this domain. SynORF polynucleotides of the invention can also encode ORFS
polypeptide fragments such as amino acids 1-42 (nucleotides I-126), and/or amino acids 47-200 (nucleotides 139-603); in another illustrative embodiment these synORFS
polynucleotides are encoding peptide fragments from a modified ORFS protein of IAF-94-287 PRRSV
strain.
Methods of producing fragments for activity screening purposes include, but are not limited to cleavage of precursor molecules (for example using restriction enzymes for DNA
molecules and proteases for polypeptides)> and chemical, enzymatic or other synthetic methods known in the art. Sequences encoding the synthetic polynucleotide fragments for use in the instant application will typically be synthesized using molecular biological methods.
In accordance with the present invention a codon-optimized ORF nucleic acid molecule can comprise one or more ORF genes, one or more ORF gene fragments, or a combination thereof.
For example, without necessarily including the entire ORF sequence, one, more than one, or all of the epitopes of an unoptimized protein can be encoded on same codon-optimized ORF nucleic acid molecule and used, for example, to immunize swine against PRRSV. As there are common PRRSV antigenic epitopes among different PRRSV strains, it is contemplated that synORFs designed based on one strain of PRRSV could be effective to immunize swine against other strains of PRRSV. It is also envisaged that the synthetic codon-optimized ORF
sequence of the present invention can encode epitopes from more than one strain of PRRSV, thereby providing for immunization against more than one strain of PRRSV.
The synORF sequences of the invention may be chosen for their ability to evoke an immune response, in vitro or in vivo, when provided alone or when provided in combination with another S molecule. For example, an immune response that is elicited in a pig by a polypeptide may be enhanced by the presence of another polypeptide that does not by itself evoke an immune response. For example, a peptide may indirectly contribute to an immune response by binding with another molecule such that it is processed more favourably, is stabilized, is less cytotoxic, or shares one or more new epitopes are generated that are useful in the immunization of swine against PRRSV. The mechanism by which a peptide might indirectly enhance an immune response is not critical to the use of the sequence in instant invention, and in the context the peptide is considered biologically active in the context of immunization. In accordance with the present invention, such peptides may be provided as codon-optimized PRRSV ORF
polynucleotide sequences or fragments thereof.
I S Selection of sequences Sequences for use in the instant invention, including complete PRRSV ORF
sequences and fragments, wild-type or modified, may be selected based on their known or predicted beneficial biological activities and/or lack of undesirable effects. Alternatively or in addition, candidate fragments may be sampled from a library of fragments randomly generated, for example, from a particular PRRSV ORF or an entire PRRSV genome, and tested for expression, efficacy and toxicity. Candidate fragments may be tested preliminarily as unoptimized sequences in addition to being tested after codon-optimization. In an exemplary embodiment, an adenovirus-based library of truncated synORFS clones is constructed and truncated ORFS (GPs) peptides expressed and tested.
The ability to elicit a favourable immune response may be tested using a variety of assays known in the art. For example a candidate sequence may be administered to a suitable animal such as a pig in an in vivo challenge, and at one or more appropriate times post-challenge the animal serum collected and assayed for the presence of specific antibodies by any of the various suitable serological test procedures known in the art. Exemplary assays include virus neutralization, indirect immunofluorescence (IIF), ELISA, blastogenic transformation test, virus isolation, Western Blot, necropsy and histopathological examination (see below). Animals other than the pig, such as mice, may also be useful for such in vivo assays. A worker skilled in the art will be able to determine which animals are suited to such uses, based on parameters such as the expression vector used, for example.
In vitro assays may alternatively or additionally be used to assess efficacy of candidate sequences. For example, cell lines expressing peptides from an expression vector of the instant invention may be tested for immunoreactivity with available polyclonal or monoclonal antibodies that are known to bind epitopes of the full-length ORF sequence from which the test sequence was derived.
It is desirable to accomplish the immunization of swine against PRRSV with minimal side-effects. Cytotoxicity related to the expressed sequence may be reduced or avoided by selection of appropriate expression sequences. For example, PRRSV ORFs sequences for use in the instant invention may be included or excluded based on their ability to cause or prevent apoptosis. To test for toxicity in vitro, for, example, cells may be infected with adenoviral vectors expressing a candidate sequence and monitored, at various times post-infection, using a number of assays. A worker skilled in the art will be able to select an assay appropriate for the detection of cytotoxicity. As indicators of apoptosis, abnormal proliferation or gross cellular changes may be observed visually. Other exemplary assays of apoptosis include DNA
fragmentation assays (e.g. using TUNEL microscopy), and caspase activity assays. Suitable cells for use in such assays include MARC-145 cells and alveolar macrophages. (See below).
Generation of codon-optimized PRRSV ORF nucleic acid molecules Replacement of non-preferred codons in the unoptimized ORF nucleic acid sequence with preferred codons to generate a synORF sequence can be achieved using standard techniques known in the art. For example, the optimized nucleic acid sequence may be chemically synthesized in its entirety in vitro, or fragments of the unoptimized sequence may be replaced by chemically synthesized polynucleotides containing the requisite nucleotide changes.
Alternatively, the optimized nucleic acid sequence can be assembled using one or more amplification reactions, such as PCR. Methods of generating synthetic genes in this manner are known in the art. For example, in one embodiment, synthetic oligonucteotides designed to cover the entire ORF gene and contain suitable nucleotide overlaps, can be synthesized and used in a series of single overlap polymerise chain reactions to reconstruct a synthetic (codon-optimized) form of the full gene (Holler et al. , (1993) Gene 136:323-328). Optionally, following the first single overlap PCR, the amplified DNA product is isolated before use in a subsequent single overlap PCR amplification with new primers. This procedure is repeated until the entire codon-optimized gene had been assembled.

Cloning codon-optimized PRRSV ORF nucleic acid molecules into an expression vector A codon-optimized ORF nucleic acid sequence can be designed and constructed as part of an expression cassette, and may be combined with elements that direct efficient transcription and translation of the inserted DNA. Desirable elements include such components as promoters, enhancers, polyadenylation signals and terminators. Such elements can integral to the expression cassette containing a codon-optimized ORF nucleic acid sequence, and/or present in an expression vector.
In one embodiment of the present invention, the hCMV promoter is used as it has previously been found to be very efficient in DNA immunization experiments in pigs against Aujesky's disease (Gerdts et al., (1997) J Gen Virol. 78( Pt 9):2139-46) and PRRSV
(Pirzadeh and Dea, (1998) J. Gen. Virol. 79:989-999. The hCMV provides for constitutive expression of the downstream gene. The use of other promoters, such as other CMV promoters or tissue specific promoters is also contemplated.
In an exemplary embodiment, a regulatable promoter such as the CMV cumate promoter or a tetracycline derivative responsive promoter, may be preferable if control over expression of the downstream gene is desirable, for example if constitutive expression would cause cellular cytotoxicity (Massie et al., (1998) Cytotechnolo~y 28:53-64). In another embodiment of the present invention the ORF gene is placed downstream of a tetracycline regulated TR5 promoter to permit controlled expression of the gene. A tTA or rtTA regulation system might alternatively be used, allowing the control of expression of the transgene either by administering tetracycline or withdrawing its administration respectively. An exemplary terminator element for use in the practice of the invention is the bovine growth hormone terminator. It would also be apparent to one of skill in the art that other regulatable promoters, and terminators could be used in the expression cassettes of the expression vectors of the invention.
It is contemplated that co-expression of one or more other proteins may be desirable in the practice of the invention, and to this end the expression cassettes and vectors of the invention can be adapted for co-expression of a plurality of polynucleotides, at least one of which would be a synORF polynucleotide of the invention. The expression cassette containing the synORF
polynucleotide of the invention can include the polynucleotide sequence encoding another peptide positioned directly before or after the synORF polynucleotide, so as to generate a fusion protein upon expression. Peptides useful in such fusion proteins include but are not limited to peptides that serve as haptens to enhance immune response, and marker proteins such as fluorescent polypeptides to facilitate expression monitoring, e.g. Green Fluorescent Protein (GFP).
Alternatively, a synORF expression cassette can be a dicistronic or polycistronic expression cassette, encoding at least one other polynucleotide sequence that is transcribed and translated to generate a distinct peptide product, co-expressed with the synORF
polynucleotide. An IRES
(internal ribosomal entry site) sequence can be inserted between polynucleotide sequences to allow continuous transcription of the two or more polynucleotide sequences starting from a promoter upstream of the most 5' sequence. Alternatively transcription for different co-expressed sequences can be initiated from different promoters.
In another approach, a synORF polynucleotide and one or more polynucleotides for co-expression with the synORF polynucleotide can be placed into separate expression cassettes and/or into separate expression vectors. Co-expression of non-fusion proteins in any of the above-described expression cassette and expression vector combinations can be arranged, if desired, for example by using the same regulatable promoter system to direct transcription of synORF and other polynucleotide(s).
Peptides that may be co-expressed with a codon-optimized ORF nucleic acid sequence of the invention include other PRRSV ORFs and other immunologically active proteins or fragments thereof, and cytokines and other non-specific modulators the immune system or fragments thereof. Exemplary cytokines include gamma-interferon, IL-2, IL-4 (Hornef et al., (2000) Med Microbiol Immunol 189:97-104), IL-12 (Palendira et al., (2002) Infect Immun 70:1949-1956), IL-5, IL-6 (Braciak et al., (2000) Immunology 101:388-396).
Experimental evidence indicates that an interaction between protein M (encoded by ORF6) and GP5 (encoded by ORFS) of a PRRSV-related virus enhances the immune response when co-expressed (Balasuriya et al., (2000) J Virol 74:10623-10630; Balasuriya et al., (2002) Vaccine 20:1609-1617), though a response was not seen with ORFS alone. In an exemplary embodiment, synORFS or fragments thereof might be co-expressed with a fragment or complete PRRSV
peptide such as ORF6 or ORF2a or ORF4. Other examples include PRRSV ORFla, ORFlb, ORF2b, ORF3 or ORF7. The polynucleotides encoding these ORFs, or fragments thereof, may be wild-type or modified sequences, unoptimized sequences, or optimized sequences of the invention.
Once the expression cassette containing the codon-optimized ORF nucleic acid sequence has been constructed, it may be inserted into an appropriate expression vector.
Such expression vectors are well known in the art and include bacterial plasmids, modified viral nucleotides (e.g.

retrovirus, vaccinia virus, baculovirus, adeno-associated virus, poxvirus or adenovirus), phage DNA, and combinations of plamid and phage or viral DNA (e.g. phagemids). An appropriate expression vector is chosen based on a number of parameters well known in the art, including for example, host cell, expression control, expression efficiency and technical feasibility.
I. Plasmids In one embodiment of the invention, the codon-optimized ORF nucleic acid sequences are inserted into a plasmid vector. Plasmid vectors offer many advantages.
Firstly, methods of generating and purifying plasmid DNA are rapid and straightforward. This fact, combined with simple quality control, facilitates technology transfer and reduces the cost of production.
Secondly, plasmid DNA typically does not integrate into the genome of the host cell, but is maintained in an episomal location as a discrete entity eliminating genotoxicity issues that chromosomal integration may raise.
A variety of plasmids are now readily available commercially and include those derived from Escherichia coli and Bacillus subtilis, with many being designed particularly for use in mammalian systems. Specific plasmids that could be used in the present invention include, but are not limited to, the eukaryotic expression vectors pRc/CMV (Invitrogen), pCR2.1 (Invitrogen), pAd/CMV and pAd/TRS/GFPq (Massie et al., (1998) Cytotechnology 28:53-64).
In an exemplary embodiment, the ptasmid is pRc/CMV, pRc/CMV2 (Invitrogen), pAdCMVS
(IRB-NRC), pcDNA3 (Invitrogen), pAdMLPS (IRB-NRC), or pVAX (Invitrogen).
In one embodiment, the plasmid contains a codon-optimised ORFS nucleic acid.
In a related embodiment, the plasmid is pRc/CMV/synORFS, pAd/TRS/GFPq/synORFS, pRc/CMV2/synORFS, pAdCMVS/synORFS, pcDNA3/synORFS, pAdMLPS/synORFS, or pVAX/synORFS. In exemplary embodiments, the plasmid is pAd/TRS/GFPq/synORFS.
II. Viral vectors In another embodiment of the present invention, the codon-optimized ORF
nucleic acid sequence is inserted into a virus or engineered construct derived from a viral genome.
The ability of certain viruses to enter cells via receptor-mediated endocytosis and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells. A viral vector is often but not necessarily replication-defective. The use of such a replication-competent virus vector that is packaging-and/or dissemination- defective is also contemplated. In an illustrative embodiment, a dissemination-defective virus vector is capable of replication in infected cells, but does not encode the protein (e.g. adenovirus protease) necessary for viral particle assembly and dissemination so replication does not proceed beyond a first round. See, for example, Elahi et al.
(Gene Ther (2002) 9:1238-1246 and U.S. Patent No. 6,291, 266). The nature of the viral vector is not otherwise believed to be crucial to the successful practice of the invention.
In one embodiment of the present invention, the codon-optimized ORF nucleic acid sequence is inserted into an adenovirus vector. An advantage of adenovirus vectors is that, like plasmid DNA, they typically do not integrate into the host genome and thus foreign genes delivered by adenovirus vectors remain episomal (Graham and Prevec (1991) Meth. Mot. Biol.
7:109-128).
The human adenovirus (hAdV) may be one of the 47 or more different known serotypes or subgroups A-F, hAdV type 2 and hAdV type 5 (hAdVS) are often used. Generation and propagation of replication-defective human adenovirus vectors requires a unique helper cell line.
Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus, i.e. that provide, in trans, a sequence necessary to allow for replication of a replication-deficient virus. Such cells include, for example, 293 cells, Vero cells or other monkey embryonic mesenchymal or epithelial cells. The use of non-human adenovirus vectors, such as porcine or bovine adenovirus vectors is also contemplated. A
worker skilled in the art will be able to select an appropriate viral vector and helper cell line if necessary.
In one embodiment of the present invention, expression of a gene of the present invention can be accomplished, for example, using the Ad/CMVIacZ expression vector, a replication-defective E1-deleted (and, optionally, E3-deleted) hAdVS, propagated in 293 helper cells (ATCC CRL-1573) to complement the functions of the E1-deleted genomic region of Ad/CMV/gene and thereby permit the replication of replication-defective hAdVs.
In an exemplary embodiment of the present invention, the adenovirus "shuttle"
or "transfer"
vector is pAd/TR5 or pAd/TR5/GFPq (Massie et al., (1998) Cytotechnology 28:53-64), derived from the adenovirus type 5 of subgroup C, and the helper cell line is 293, derived from human embryonic kidney cells (Graham et al., (1997) J. Gen. Virol. 36 :59-72). In this shuttle vector, the tetracycline-regulable promoter, TRS, drives expression of the gene. The expression cassette replaces the E1 gene and is flanked on one end by the encapsidation and packaging signals and on the other end by an adenovirus sequence allowing recombination and generation of replication-defective recombinant virus. In this cassette, which was derived from pAdBMS (US
Patent No. 5, _518,913), expression of heterologous genes is optimized by the presence of the adenovirus tripartite leader sequence and the adenovirus major late enhancer flanked by splice donor and acceptor sites.
In this exemplary system, recombinant adenovirus is generated by homologous recombination between the shuttle vector and a provirus vector. Due to the possibility of recombination between two proviral vectors, wild-type adenovirus may be generated from this process;
therefore, it is customary to isolate a single clone of the virus from an individual plaque and examine its genomic structure, if wild-type (dissemination-competent) viruses are to be avoided, as is usually the case. The use of a two plasmid based approach, or of the YAC system or other alternative approaches known in the art for the production of recombinant adenovirus are also contemplated.
III. Construction of an expression vector Those skilled in the field of molecular biology will understand that a variety of routine methods may be employed to clone the codon-optimized ORF gene (and control non-optimized gene) or gene fragments into the required vectors and that the expression construct may then be replicated in and isolated from a number of possible host organisms.
In one embodiment of the present invention, once a synORF gene or fragment thereof has been constructed, the entire synORF gene is amplified by PCR using a forward primer that comprises the first ATG codon of the synORF gene downstream of a Kozak motif for initiation of translation in vertebrates (Kozak (1987) Molecular Biology 196:947-950), and a reverse primer that comprises the stop codon of the viral gene.
Alternatively, for directional cloning, restriction sites can be added at the 5' ends of the sense and antisense primers respectively (Pirzadeh and Dea (1987) J. Gen. Virol. 79:989-999), and the synORF gene, or fragment thereof, can then be cloned into the corresponding restriction sites of an expression vector, downstream of the vector promoter, producing a recombinant plasmid useful for the expression of the synthetic codon-optimized ORF gene product.
For construction of recombinant viral vectors, the synORF nucleic acid sequence or expression cassette is typically inserted into a shuttle vector and recombinant viral vectors are subsequently generated by co-transfecting the helper cell line with the shuttle vector and simultaneously infecting them with the helper virus. In another embodiment of the present invention, a PCR
amplified synORF gene is inserted into a unique restriction site of an adenovirus shuttle vector, in which expression of the synORF gene is under the control of a regulatable promoter.
Recombinant adenoviruses are subsequently generated in helper cells by homologous recombination with a replication defective vector such as Ad/CMVIacZ, as detailed in Jani et al.

(1997) J. Virological Methods 64:111-124. Recombinant viruses are identified by analysing for expression of the protein encoded by the ORF nucleic acids. For example, recombinant Ad/TR5/GFPq/synORFS viruses are identified by analysing for expression of the recombinant GP5 protein, for example by Western immunoblot analysis or radioirnmunoprecipitation assays.
Delivery of codon-optimized PRRSV ORF nucleic acid molecules into mammalian cells In order to effect expression of ORF constructs, the expression construct must be delivered into a cell. This delivery can be accomplished in vitro, as in laboratory procedures for transfecting or transforming cells lines, in vivo, or ex vivo (see below). As described above, an exemplary mechanism for delivery is via viral infection where the expression construct is encapsidated in an infectious viral particle.
In accordance with the present invention, recombinant viruses such as adenoviruses can be administered to different animal tissues via a variety of routes including, for example, subcutaneous and intraperitoneal administration, trachea instillation ( Rosenfeld etal., (1992) Cell 68:143-155), muscle injection (Ragot et al., (1993) Nature 361:647-650), peripheral intravenous injection (Herz and Gerard (1993) Proc. Natl. Acad. Sci. USA
90:2812-2816), and stereotactic inoculation into the brain (Le Gal La Salle et al., (1993) Science 259:988-990).
Several non-viral methods for the transfer of the synORF nucleic acid molecules, expression cassettes, expression vectors into cultured mammalian cells also are contemplated by the present invention. These include calcium phosphate co-precipitation technique, linear 25 kDa polyethyleneimine (PEI), DEAF-dextran, electroporation, direct microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes, cell sonication, gene bombardment using high velocity microprojectiles> and receptor-mediated transfection, all of which are known in the art.
The use of "naked" DNA to deliver DNA to cells is also known in the art (Felgner). Some of these techniques may be successfully adapted for in vivo or ex vivo use.
In an exemplary embodiment, non-viral constructs would be delivered to swine via intradermal and/or intramuscular injection using a gene gun transfection system (see below) or using a 27-gauge needle The intramuscular injection is given into the tibialis cranalis muscle, whereas the intradermal injection is given into the dorsal surface of the ear or in the skin beneath the ear.
Transferring DNA expression constructs into cells could involve particle bombardment (Johnston 30 and Tang (1994) "Gene Gun Transfection of Animal Cells and Genetic Immunization" In Methods in Cell Biology, 43:353-366). This method depends on the ability to accelerate DNA
coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them. Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force. The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads. Selected organs, including the liver, skin, and muscle tissue of rats and mice, have been bombarded in vivo. This may require surgical exposure of the S tissue or cells, to eliminate intervening tissue between the gun and the target organ, i.e., ex vivo treatment. Again, DNA encoding an ORF may be delivered via this method within the scope of the present invention.
In a further embodiment of the invention, the expression construct may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers. Also contemplated are lipofectamine-DNA complexes. Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al., ((1987) Methods in Enzynolo~,y 149:157-176) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
In certain embodiments, gene transfer may more easily be performed under ex vivo conditions.
Ex vivo gene therapy refers to the isolation of cells from an animal, the delivery of a nucleic acid into the cells in vitro, and then the return of the modified cells back into the animal. This may involve the surgical removal of tissue or organs from an animal or the primary culture of cells and tissues. U.S. Pat. No. 5,399,346 discloses ex vivo therapeutic methods.
In one embodiment of the invention, the expression construct may consist of DNA plasmids.
Transfer of the construct may be performed, for example, by one of the methods mentioned above that physically or chemically permeabilizes the cell membrane. This is particularly applicable for transfer in vitro, but it may be applied to in vivo use as well. Dubensky et al.
(1984) Proc. Natl. Acad. Sci. USA 81:7529-7533 successfully injected polyomavirus DNA in the form of CaP04 precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) Proc.
Natl. Acad. Sci. USA
83:9551-9555 also demonstrated that direct intraperitoneal injection of CaP04 precipitated plasmids results in expression of the transfected genes. It is envisioned that ORF DNA could also be transferred in vivo in a similar manner to express the encoded protein.

Once the expression construct has been delivered into the cell, the ORF
nucleic acid can locate to a variety of intracellular sites, for example it can be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" typically encode sequences sufficient to permit maintenance and replication independent of or in synchronization S with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.
Primary mammalian cell cultures may be prepared in various ways. In order for the cells to be kept viable while in vitro and in contact with the expression construct, it is necessary to ensure that the cells maintain contact with the correct ratio of oxygen and carbon dioxide and nutrients but are protected from microbial contamination. Cell culture techniques are well documented.
During in vitro culture, the expression construct may deliver and express protein encoded by an ORF into the cells. The cells may then be reintroduced into the original animal, or administered into a different animal, in a pharmaceutically acceptable form, for example by one of the means described below.
Evaluation of expression of the codon-optimized ORF construct Verification of the in vivo expression of PRRSV protein from an ORF expression vector by immunizing CD-1 or BALBlc mice.
The in vivo expression of a PRRSV protein from a vector, for example the expression of GPS
from the pRc/CMVS plasmid vector, can be shown following genetic immunization of CD-1 and Balb/c mice. See, for example, Pirzadeh and Dea, (1998), J. Gen. Virol. 79:989-999.
Indirect Immunofluorescence (IIF) assay for transient expression Transient expression experiments in confluent monolayers of 293 cells may be used to assay for the expression of a pRc/CMV/synORF construct. Cells can be easily transfected with the plasmid by use of the Fugene 6 Transfection ReagentT"~' (Roche Diagnostics) and expression of the ORF
protein product can be visualized by indirect immunofluorescence (IIF). In this procedure, cells are fixed at various times post-transfection, then reacted with anti-ORF
rabbit monospecific hyperimmune serum (Mardassi et al., (1996) Virology 221:98-I 12) and the immune reaction revealed following incubation with fluorescein-conjugated goat anti-rabbit Ig (Boehringer Mannheim) as previously described (Loemba et al., (1996) Archives of Virology 141:751-761).
Fluorescein fluorescence is indicative of the presence of the PRRSV protein and consequently of ORF expression.

Direct fluorescence from a Reporter Protein To easily monitor expression of the recombinant clones or hAdVs, a gene encoding for a fluorescent protein such as the GFPq protein (Green fluorescent protein) can be used as a reporter gene. For example, the reporter protein can be cloned downstream of a multiple cloning site in an expression vector, e.g. an adenoviral shuttle vector, under the control of an internal ribosomal entry site (IRES) such that it is co-expressed with the upstream recombinant clone. At various times post-infection, the intensity of the fluorescence is observed as an indication of recombinant protein expression, i.e. fluorescence increases with an increase in ORF
protein expression.
Western immunoblot analysis Alternatively, the expression of an ORF protein product in cells transfected with an expression construct can be tested by Western blot. Lysates of cells carrying the expression construct are subjected to sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred onto nitrocellulose membranes. The PRRSV protein can then be visualized following incubation of the membranes with an anti-ORF rabbit monospecific hyperimmune serum as described previously (Mardassi et al., (1996) Virology 221:98-112).
Radioimmunoprecipitation assay Expression of an ORF polypeptide or fragment thereof may also be detected by radioimmunoprecipitation assays (RIPA). Radiolabelling of the recombinant protein produced in transfected cells with (35S]-methionine can be carried out as described previously (Mardassi et al., (1996) Virology 221:98-112). Clarified lysates of the transfected cells can then be reacted with an anti-ORF rabbit monospecific hyperimmune serum and the resultant immune complexes adsorbed onto protein A-sepharose beads (Pharmacia). Electrophoresis of the dissolved beads on SDS-polyacrylamide gels followed by fluorography and autoradiography will reveal the presence of the immune complexes and, consequently, of the PRRSV protein.
In vitro evaluation of cytotoxicity of codon-optimized ORF nucleic acid molecules To evaluate the cytotoxicity of hAdV-expressed recombinant PRRSV ORF proteins or fragments thereof, monolayers of non-helper cells, such as MARC-145 cells, are co-infected with the adenovirus recombinant vector, for example with hAdV/TR5/ORF, and hAdV/CMV/tTA
in the presence or absence of doxycycline. The hAdV/CMV/tTA permits constitutive expression of tTA in infected non-helper cells using the constitutive human CMV immediate-early promoter/enhancer. The tTA is essential to the expression of the foreign gene in hAdV-infected cells, and doxycycline (1 pg/mI) is used to inhibit the expression of the foreign gene in hAdV-infected cells (Massie et al., (1998) Cytotechnology 28:53-64). Alternatively, if transfected into TetOn 293 cells, which constitutively express the reverse tetracycline transactivator (rtTA), then the hAdV/CMV/tTA vector is excluded and the expression of the PRRSV protein from hAdV
vectors enhanced when cultivated in the presence of doxycycline (1 ftg/ml).
Experimental controls typically include mock-infected MARC-14.5 cells, and cells that have been infected with either hAdV/CMV/tTA or an hAdV/vector carrying the unoptimized ORF alone.
Abnormal proliferation or gross cellular changes that occur upon intracellular synthesis of the recombinant PRRSV protein are visualised under a light microscope (Leyca, Leitz), for example under epifluorescent and phase contrast microscopy, at various times post-infection. MARL-145 cells are not permissive to replication defective (E1 deleted) recombinant hAdVs since they do not complement their E1 gene functions, so cellular degeneration or abnormalities observed can be attributed to the toxicity of the expression of synORF (encoded PRRSV
protein, or fragments thereof). Synthesis of the recombinant proteins can be followed in parallel by western blotting.
Assessing the immune response to vaccination Clinical observations:
Vaccinated and unvaccinated pigs may be observed and examined for the development of clinical signs of respiratory disease, beginning 1 to 3 days and continuing for several weeks after virus challenge. For example, some of the principal signs of respiratory disease include a decrease in growth and in feed consumption, persistent hyperthermia, eyelid oedema, laboured breathing (abdominal respiration) and/or rasping and crowing sounds heard during inspiration.
Virus neutralization (VN) and serological tests To test for the generation of an immune response to a vaccine, challenged animals are typically bled on day 0 (control) and on several occasions in the weeks and months post-challenge. Long term effects of vaccination can be determined by testing serum samples collected months and years post-challenge. The sera can be assayed for the presence of specific antibodies by any of the various suitable serological test procedures known in the art, for example by virus neutralization, indirect immunofluorescence (IIF), ELISA and Western Blotting.
In a virus neutralization (VN) test, also known as a seroneutralization assay, serial dilutions of heat-inactivated test and control serum samples are pre-incubated with a constant dose of 100 TCIDS~ of the infective agent and then added to confluent layers of test cells. The cells are monitored regularly for cytopathic effects, and after about 5 days fixed and tested for expression of a viral protein other than that encoded by the vaccine. For example, if ORFS is being used in the vaccine, then expression of PPRSV nucleocapsid (N) protein can be monitored by IIF using the N protein specific monoclonal antibody Mab IAF-K8 (Dea et al. , (1996) J.
Clin. Microbiol.
34:1488-1493). Neutralizing titres are expressed as the reciprocal of the highest dilution that completely inhibits the expression of viral N protein.
A competitive ELISA for detection of antibodies to PRRSV using recombinant E.
coli-expressed N protein as antigen can also be used to monitor humoral immune response following challenging of hyper-immunized pigs (Dea et al., (2000) J. Virol. Methods 87:109-122). A
commercial indirect ELISA (Idexx) for detection of anti-PRRSV antibodies can also be used, following the manufacturer's directions. Alternatively, or in addition, the presence of anti-PRRSV antibodies in the sera of the immunized animals can be assayed by other methods, including, for example, Western blotting using sucrose gradient purified-PRRSV
as antigen (Mardassi etal., (1994) Can. J. Vet. Res. 58:55-64).
Blastogenic transformation test In the blastogenic transformation test, cell proliferation is triggered by antigen-exposure in peripheral blood mononuclear cells (PBMC) isolated from pigs that have been successfully immunized with a PRRSV ORF.
At regular post-immunization intervals, pigs are medicated with Xylazine (Bayers) at a dose of lmg/Kg and blood samples collected from the anterior versa cava in vacuum tubes containing 1/10 volume 150 mM sodium citrate in PBS, and then diluted I:3 in sterile RPMI. Peripheral blood mononuclear cells are separated by Ficoll-Paque (density 1.077;
Pharmacia) centrifugation at 1,200 g for 20 min. The mononuclear cells are collected from the huffy coat and pelleted. The residual red blood cells are lysed by incubating cells with 0.53% ammonium chloride for 10 min at 37C. After 2 washes in RPMI, the leukocytes are adjusted to a suspension of 2 X 106 cells per ml in RPMI containing 20% homologous heat inactivated PRRSV negative porcine serum, 50 U/ml of penicillin, and 50 pg/ml of streptomycin.
The antigen-specific (ORF-triggered) PBMC proliferation is determined by incubating the isolated PBMC in microtitration plates (4 X 10' cells in 200ft1/well in triplicates) during 72 h in the presence of variable concentrations ((l, 0.1, 10, and 25p,g/ml) of an ORF-pH protein or an effective fragment thereof. Blastogenic capacity of the PBMC under test conditions is confirmed by including positive control triplicates containing 2.5, 5, or 10 pg/ml of the mitogen Concanavaline A (ConA, Sigma Chemicals). After a 72 h stimulation period, the cells are labelled for 18 h with 0.1 pCi of [3H]thymidine (Amersham) per well, and harvested with a semiautomatic cell harvester (Skatron Instruments). The incorporated radiolabelled nucleotide is measured by scintillation counting after addition of a fluorescent liquid scintillant (Cytoscint, ICN). The level of proliferation is expressed as the mean of counts per minute (CPM) of the test wells minus the mean of the background CPM in control wells. Control for background levels consists of PBMC cultures in media alone.
Necropsy finding Necropsy findings can also be compared in vaccinated and unvaccinated virus challenged pigs that have been euthanised. The respiratory tract, thoracic cavity and other organs and tissues are assessed by examining for both gross lesions and for microscopic lesions.
Histopathologieal examination Thin sections (5 pm thick) of formalin-fixed, paraffin-embedded tissues from the lungs, spleen, liver, kidneys, and thoracic and mesenteric lymph nodes of pigs are routinely processed for the hematoxylin-phloxin-safran (HPS) staining, as described by Dea et al., (1991) Journal of Veterinary Diagnostic Investigation 3:275-282.
Virus isolation In virus isolation, tissue samples are collected from various organs of pre-vaccinated and/or unvaccinated animals following viral challenge, and tissue homogenates are inoculated onto host cell monolayers, and these cells are then observed for cytopathic effects and assayed for viral protein by indirect immunofluorescence.
After collection of blood samples, pigs are euthanised by rapid intravenous injection of sodium pentobarbital (MTC Pharmaceuticals). Specimens are aseptically collected various organs (for example lungs, spleen, kidneys, liver, and mediastinal and mesenteric lymph nodes). Tissue homogenates are prepared in DMEM to final concentrations of 1:20 and 1:100.
Following clarification by centrifugation at 10,000 g for 10 min, tissue homogenates are inoculated onto monolayers of cells, such as MARL-145 cells in 24 well-culture plates or PAMs (porcine alveolar macrophages) seeded in 96 well-microtitration plates. Cells are harvested by 2 freeze-thaw cycles at 4-5 days post-inoculation. Tissue culture supernatants are clarified and used for a second passage. Cultures are observed daily for cytopathic effects (CPE) until day 5 post-inoculation, at which time, infected monolayers are fixed with cold acetone for indirect immunofluorescence.
RT-PCR may also be used to reveal the presence of the viral genome in various tissues from test and control pigs. Total RNA is extracted from tissues collected from challenged animals and from cells, such as MARC-145 cells, inoculated with tissue homogenates. RT-PCR
is performed using the oligonucleotide primers appropriate to amplify the desired ORF
region, as described by Mardassi et al., (1995) Archives of Virology 140:1405-1418.
The occurrence of virus and/or viral CPE in a range of cultures (i.e.
inoculated with many different tissue homogenates) is indicative of generalized viremia in the pig.
Homogenates from successfully immunized animals might, for example, require a higher homogenate concentration for positive observation and/or show a delayed CPE (indicative of tow viral titres), and/or indicate a more localized viral presence, for example restricted mainly to the respiratory tract.
Uses The plasmid expression constructs of the present invention can be used as transfer vectors to construct other expression vectors, such as adenovirus expression constructs described previously.
Active Immunization The compositions of the present invention can be used for the active immunization of swine against porcine reproductive and respiratory syndrome virus (PRRSV).
Immunization can be of swine not yet exposed to the PRRSV virus, in which case the immunization can confer prevent the swine from becoming infected with the virus. It is also desirable to immunize swine that have or may have already been infected with the virus, to prevent or reduce viral shedding.
Approaches to "sanitize" swine are known in the art.
The compositions of the present invention include vaccine compositions which can be administered in a conventional active immunization scheme: single or repeated inoculations in a manner compatible with the dosage formulation and in such amount as will be prophylactically effective and immunogenic, i. e. the amount of expression construct capable of expressing a codon-optimized ORF polypeptide that will induce immunity in an animal against challenge by a virulent PRRSV. Immunity is defined as the induction of a higher level of protection in a population of animals after vaccination compared to an unvaccinated group.
The amount of synORF polynucleotide, expression cassette or expression vector to be introduced into a vaccine recipient can be determined by a worker of skill in the art, and will depend on the strength of the transcriptional and translational promoters, and the type of vector used, among other things. In addition, the magnitude of the immune response will depend on the level of protein expression and the ability of the expressed ORF gene product to elicit an immune response.
Intramuscular injection, intraperitoneal or subcutaneous injection, intradennal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also suitable. In an exemplary embodiment, administration is intramuscular or intradermal, for example injection at a site behind the ear.
It is also contemplated that single or multiple booster vaccinations may be provided.
The compositions of the present invention are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared if testing demonstrates activity is retained in the solid form. A typical composition for such purpose comprises a pharmaceutically acceptable carrier. For instance, the composition may contain 10 mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per millilitre of phosphate buffered saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients including salts, preservatives, buffers, stabilizers (such as skimmed milk or casein hydrolysate), and the like. Examples of non-aqueous solvents are glycerol, propylene glycol, polyethylene glycol, vegetable oil, and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, anti-oxidants, chelating agents, and inert gases. The pH and exact concentration of the various components of the composition are adjusted according to well-known parameters.
Adjuvant can also be included where an antigenic polypeptide is being administered. Adjuvants can conventional adjuvants as are known to workers skilled in the art, for example dimethyldioctadecyiammonium bromide in water (DDA) and sulfolipo-cyclodextrin in squalene in water. Adjuvants can alternatively or in addition be administered as plasmids containing immunostimulatory CpG motifs, and/or coding for immunostimulatory polypeptides, for example cytokines gamma interferon or interleukin-12 (see, for example, BS
McKenzie et al, Immunol Res (2001) 24:225-44, Eo et al, Expert Opin Biol Ther (2001) 1:213-25).
Passive Immunization In accordance with the present invention, immunization can also be passive immunization, in which anti-PRRSV antibodies or serum containing such antibodies is administered to an animal.
Using standard techniques known in the art, the plasmid expression constructs of the present invention can be used to inoculate swine, following which PRRSV-neutralizing serum is obtained from these swine. This serum can then be used for the passive immunization of other swine. Indeed, vaccinated pregnant sows could secrete large amounts of specific anti-PRRSV
antibodies via their colostrum and milk which would protect suckling piglets.
Also, serum from vaccinated animals, or purified gammaglobulin preparations, can be injected parenterally (intramuscular, intravenous or intraperitoneal injection) to naive or immunodeprived pigs in order to protect them temporarily from natural PRRSV infection.
Expressed proteins The expressed recombinant proteins can also be used for the generation of antibodies or as antigens for the development of diagnostic procedures or using standard techniques known in the art.
Antibodies For the production of antibodies and antibody fragments raised against a target protein, various hosts including goats, rabbits, rats, mice, humans, and others can be immunized by injection with the target protein, or with a fragment or oligopeptide thereof that has immunogenic properties.
In accordance with the present invention, the target protein is a PRRSV
protein and the oligopeptides, peptides, or fragments used to induce antibodies are encoded by the codon-optimized nucleic acid molecules and/or vectors of the invention.
Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, Keyhole limpet hemolysin (KLH), and dinitrophenol.
Examples of adjuvants used in humans include, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.

The oligopeptides, peptides, or fragments used to induce antibodies can have an amino acid sequence consisting of as tittle as about 5 amino acids. In one embodiment of the present invention, amino acid sequences of at least about 10 amino acids are used.
These oligopeptides, peptides, or fragments can be identical to a portion of the amino acid sequence of the wild-type protein that contains the entire amino acid sequence of a small, naturally occurring molecule. If required, short stretches of amino acids of the target protein can be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule can be produced Monoclonal antibodies to a target protein can be prepared using techniques that provide for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (see, for example, Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D.
et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc.
Natl. Acad. Sci. USA, 80:2026-2030; and Cole, S. P. et al. (1984) Mol. Cell Biol. 62:109-120). For example, the monoclonal antibodies according to the present invention can be obtained by immunizing animals, such as mice or rats, with purified protein. Spleen cells isolated from the immunized animals are then immortalized using standard techniques. Those isolated immortalized cells whose culture supernatant contains an antibody that causes an inhibition of the activity of the target protein with an ICS of less than 100 ng/ml are then selected and cloned using techniques that are familiar and known to one skilled in the art. The monoclonal antibodies produced by these clones are then isolated according to standard protocols.
The immortalization of the spleen cells of the immunized animals can be carried out by fusing these cells with a myeloma cell line, such as P3X63-Ag 8.653 (ATCC CRL 1580) according to the method in (1980) J. Imm. Meth. 39:285-308. Other methods known to a person skilled in the art can also be used to immortalize spleen cells. In order to detect immortalized cells that produce the desired antibody against the target protein, a sample of the culture supernatant is tested for reactivity using an enzyme linked immunosorbent assay (ELISA). In order to obtain those antibodies that inhibit the activity of the target protein, the culture supernatant of clones that produce antibodies that bind to the protein is additionally examined for inhibition of protein activity using an appropriate assay, such as those described herein. Those clones whose culture supernatant shows the desired inhibitory activity are expanded and the antibodies produced by these clones are isolated according to known methods.
1n addition, techniques developed for the production of "chimeric antibodies,"
such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison, S. L. et al. (1984) Proc. Natl.

Acad. Sci. 81:6851-6855; Neuberger, M. S. et al. (1984) Nature 312:604-608;
and Takeda, S. et al. (1985) Nature 314:452-454). Alternatively, techniques described for the production of single chain antibodies can be adapted, using methods known in the art, to produce single chain antibodies specific to the target protein. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobulin libraries (see, for example, Burton D. R. (1991) Proc. Natl.
Acad. Sci. USA, 88:10134-10137).
Antibodies can also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. 86: 3833-3837; Winter, G. et al.
( 1991 ) Nature 349:293-299).
Antibody fragments which contain specific binding sites for the target protein can also be generated. For example, such fragments include, but are not limited to, F(ab')2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulphide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries can be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (see, for example, Huse, W. D. et al. (1989) Sciene,e 246:1275-1281).
Various immunoassays can be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between the target protein and its specific antibody. Examples of such techniques include ELISAs, radioimmunoassays (RIAs), and fluorescence activated cell sorting (FRCS).
Alternatively, a two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering epitopes, or a competitive binding assay can be used (see, Maddox, D. E. et al. (1983) J. Exp. Med. 158:1211-1216). These and other assays are well known in the art (see, for example, Hampton, R. et al. (1990) Serological Methods: A Laboratory Manual, APS Press, St Paul, Minn., Section IV; Coligan, J. E. et al. (1997, and periodic supplements) Current Protocols in Immunology, Wiley & Sons, New York, N.Y.; Maddox, D. E. et al. (1983) J.
Exp. Med.
158:1211-1216).
Diagnostics The expression constructs of the present invention can also be used for diagnostic purposes.
Recombinant adenoviruses or recombinant plasmid DNA vectors carrying the codon-optimized PRRSV ORF polynucleotide may be used to infect or transfect cell cultures (e.g. COS7, 293, A549, MARL-145, or KB cells) resulting in high levels of expression of the ORF
protein carrying major antigenic determinants in the cell cultures. These cells cultures can be used for diagnostic purposes; for example, one can determine whether an animal contains specific S antibodies in its serum that are directed to the expressed ORF protein using immunochemical techniques such as indirect immunofluorescence, immunoperoxidase, immunogold silver staining, or enzyme linked immunosorbant assay (ELISA). The recombinant ORF
protein can also be recovered from the supernatant fluids of homogenates of the adenovirus-infected cell cultures and used as a source of antigens for ELISA, radioimmunoassay (RIA), and agglutination assays.
Standard nucleic acid techniques known in the art can be used in combination with at least one primer specific to a synORF polynucleotide sequence of the invention, to detect the presence of that synORF polynucleotide in a pig previously imnwnized with that synORF. In general, a biological sample, for example a tissue or a bodily fluid, is first obtained from the pig. The cells within the sample can be lysed and the crude lysate used in the assay or nucleic acids can be isolated from the sample. The nucleic acids can be used directly in the assay or they can be subjected to an initial amplification step. The present invention also contemplates the adaptation of the diagnostic screening to high-throughput technology.
A nucleic acid detection procedure can be used to verify expression of the synORF sequence used in immunization. It is also in accordance with the present invention to use the results of such an assay in conjunction with an assay to detect the presence of nucleic acid sequences representing PRRSV infection in an immunized animal. When both tests are run on the same sample (potentially, but not necessarily on different aliquots of the same sample) primer sequences can be chosen so that the amplified sequences will be specific to each of the synORF
polynucleotide and the infectious PRRSV agent. Alternatively primers used in an assay to detect potential PRRSV infection in an animal previously immunized with a synORF
polynucleotide can be targeted to a sequence not present in the synORF polynucleotide so as to avoid false positive results. That is, at least one primer can be chosen that does not hybridize specifically with the synORF polynucleotide used to immunize the pig. The assay conditions under which the ability of a primer and polynucleotide to specifically hybridize may be tested are well known in the art, and require relatively stringent hybridization conditions.

Primers Primers for use in synthesis or in assays to detect in a sample the presence of codon-optimized nucleic acid molecules of the invention can be designed and made using standard techniques known by a worker skilled in the art. To generate a specific synthetic or diagnostic result, at least one of each pair of primers used in an amplification technique such as PCR is specific to the target polynucleotide. As is understood by a worker skilled in the art, primers are designed and selected based on their ability to hybridize with a level of specificity appropriate to the application. Nucleic acid hybridization will be affected by the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridizing nucleic acids, in addition to such conditions as salt concentration, temperature, and solvents, as will be readily appreciated by those skitled in the art.
Primers for use in the synthesis of codon-optimized nucleic acid molecules of the invention are shown in Table 5 and contain sequences specific to the synORFS polynucleotide.
Primers for use in diagnostic assays include these primers, or fragments of these primers that are from 15-30, or 18-25, or 20-23 nucleotides long. A diagnostic assay that distinguishes between the presence of a sequence encoding a PRRSV ORF (e.e. present due to a natural PRRSV
infection) and a codon-optimized ORF (e.g. present in a sample due to inoculation with a synORF
nucleic acid of the invention), will employ primers that detect the synORF or fragments thereof but not t the wtORF nucleotide sequence. Examples of such primers, for the detection of synORFS, include (nucleotide numbers refer to the synORFS sequence of Figure 2 and SEQ ID NO:
1):
Primers (sense or antisense) comprising at least a 14-mer sequence corresponding to nt 94-107 at the most 3' end, e.g. a 18-mer sense primer having the sequence of nt 90-107, or a 20-mer antisense primer capable of hybridizing to nt 111-94.
A 20-mer sense primer containing at least a sequence corresponding to nt 310-329, i.e.
having the sequence 5'- GGCCGCTACGTGCTGTCCTC -3'.
Primers (sense or antisense) comprising at least a 16-mer sequence corresponding to nt 573-588 at the most 3' end, e.g. a 20-mer sense primer having the sequence of nt 569-588, or a 20-mer antisense primer capable of hybridizing to nt 573-592.
Primers (sense or antisense) comprising at least a 16-mer sequence corresponding to nt 372-387 at the most 3' end, e.g. a 20-mer sense primer having the sequence of nt 368-387 or a 20-mer antisense primer capable of hybridizing to nt 372-391.

Primers (sense or antisense) comprising at least a 14-mer sequence corresponding to nt 36-49 at the most 3' end, e.g. a 18-mer sense primer having the sequence of nt 32-49 or a 18-mer antisense primer capable of hybridizing to nt 36-53.
Thus, for example, a synORFS primer set could include the sense oligonucleotide primer for the sequence of nucleotides 310-329, in combination with the antisense oligonucleotide primer for the sequence of nucleotides 592-573, yielding an amplified fragment 283 nucleotides long. A
second exemplary synORFS primer set could include the sense primer having the sequence of nucleotides 90-107 in combination with the antisense primer capable of hybridizing to synORFS
nucleotides 331-312, which would generate a PCR fragment 242 nucleotides long.
Kits A kit can be assembled comprising some or all of the essential materials and reagents required for vaccinating swine with polynucleotides of the invention or antiserum raised against polynucleotides of the invention, for constructing expression vectors encoding synORF
polynucleotides, for transforming cells with expression vectors of the invention, for detecting synORF polynucleotides of the invention, or for detecting PRRSV infection.
This generally will comprise selected expression constructs, andlor anti-PRRSV ORF antiserum or specific or monoclonal antibodies, and/or primers. Also included may be various media for replication of the expression constructs and host cells for such replication. Such kits will typically comprise distinct containers for individual reagents.
When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area of the animal, such as the lungs, injected into an animal, or even applied to and mixed with the other components of the kit.
The components of the kit may also be provided in dried or lyophilized forms.
When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.
Irrespective of the number or type of containers, the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle suited to use in the instant invention.
To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.

EXAMPLES
FXAMPI.F 1 Materials and methods PRRS Virus and cells The IAF-Klop strain of PRRSV has been found to be highly pathogenic for MARL-145 cells, a clone of MA-104 cells highly permissive to PRRSV (Kim et al., 1993), as previously described (Mardassi et al., 1994). PRRSV can also be propagated effectively on primary cultures of pulmonary alveolar macrophages, as well as in blood monocytes (Therrien et al., (2000) Arch Virol. 145:1099-116).
Isolation of propogated PRRSV
To eliminate cellular membranes and debris from viral suspension, lysates of the infected cells (approximately 200 ml) are clarified by centrifugation at 8,000 X g for 15 min. Then, the viral particles in the supernatant fluid are concentrated by differential ultracentrifugation through a cushion of 30% sucrose (wt/wt) in 0,05M Tris-buffered saline, pH 7.0 to 7.5 (TBS). Thereafter, the viral pellet is gently dispersed, diluted in 1 or 2 ml of TBS for an isopycnik ultracentrifugation through a 1.2 tol.5 CsCI continuous density gradient. The opalescent viral bands are recovered in the fractions corresponding to a density of 1.18 to 1.20 g/ml of CsCI
(Mardassi et al. (1994) Can. J. Vet. Res. 58:55-64). Negative stain electron microscopy can be used to reveal the presence and morphology of viral particles.
Adenovirus vectors and cells Ad/CMVIacZ (Acsadi et al., 1994), a replication-defective E1- and E3-deleted hAdVS, as well as generated hAdVs, were propagated in 293 cells (ATCC CRL-1573), to complement the functions of the E1-deleted genomic region of Ad/CMVIacZ and thereby permit the replication of replication-defective hAdVs. Infectivity titres of hAdVs were determined by calculation of the plaque forming units (PFU/ml) on 293 cell monolayers, as detailed elsewhere (Massie et al. , 1998c). AdCMV/tTA permits the constitutive expression of the tetracycline transactivator (tTA) in infected cells using the constitutive human CMV immediate-early promoter/enhancer. The tTA is essential to allow expression in hAdV-infected cells of the foreign gene that has been cloned downstream and under the control of the TR5 promoter. Doxycycline (Sigma), an analogue of tetracycline was used at a concentration of 1 pg/ml to inhibit the expression of the foreign gene in hAdV-infected cells (Massie et aL, 1998b). The 293 TetOn cells (Clonetech Inc) are 293 transformed cells that constitutively express the reverse tetracycline transactivator (rtTA). These cells were cultivated in the presence of 1 pg/ml of doxycycline to enhance the expression by hAdVs of the transgene placed under the control of the tetracycline-regulable promoter (TR5) (Massie et al., 1998b). BMAdEl cells, an A549 cell line expressing AdEI
proteins from a vector designed to eliminate the generation of replication competent hAdVs (Massie, 1998x), were propagated in the same conditions as the 293 cells (Acsadi etal., 1994).
Design and construction of the synthetic ORFSgene of PRRSV
Tables 3a-c show the colon usage of the ORFS, ORF4 and ORF6 proteins of the IAF-Klop strain of PRRSV, in comparison with colon usage in highly expressed human (H) genes.
The frequencies (x 100) of the individual colons are shown for each of the degenerately encoded amino acids, as well as the number of each amino acids for the PRRSV protein in parenthesis, and the most prevalent colon is shown in bold. The sequence of a synthetic polynucleotide encoding a wild-type amino acid sequence (SEQ ID NO: 2) is shown in Figure 2 and SEQ ID NO: 1. The colons most frequently used by mammalian cells were used in the synORFS gene according to Haas et al. (1998). In the construction of the completely optimized synthetic ORFS polynucleotide (synORF.S) of Figure 2 (SEQ ID NO: 1), a total of 130 nucleotides were optimized over the entire IAF-Klop ORFS sequence.
To construct the synORFS, 21 long synthetic oligonucleotides of 20-60 mers covering the entire ORFS gene of the IAF-Klop strain of PRRSV with 30 mer overlaps were synthesized using an automated synthesizer (Pharmacia Biotech Inc., Baie d'Urfe, Quebec) (Table 5).
The synORF5 gene was assembled by single overlap PCR, as described by Holler et al., ((1993) Gene 136:323-328). The PCR reactions were performed in 50-~l reaction mixture containing each deoxynucleoside triphosphate at a concentration of 0.2 mM, plus 50 pmol of each forward and reverse primer, 20mM Tris-HCI, 50 mM HCI, 1.5 mm MgCl2 (GIBCO BRL), and 10 U
of Taq DNA polymerase (GIBCO BRL). The PCR amplifications were performed in a DNA
Engine Thermocycler (MJ Research model PTC-100, with hot bonnet) using the following protocol: 33 amplification cycles of denaturation at 94 °C for 60 s, primer annealing at 55 °C for 60 s, and elongation at 72°C for 90 s, followed by a final extension step at 72 °C for 10 min. Aliquots of 10 p1 of the amplified products were visualized by electrophoresis on 1,5%
agarose gels in TAE
buffer (0.04 M Tris-acetate pH 8.5, 0,002 M EDTA ) in the presence of ethidium bromide at 100 V for 1 h and then visualized under UV illumination. The bands of the expected size were cut and the DNA was purified by using the QiaGen DNA Extraction kit (QiaGen Inc., Mississauga, ON, Canada). The purified DNA was then used in the next step of extension of the gene. The final PCR product containing the entire synORFS gene with A overhangs was cloned into pCR2.1 vector using Topo-TA cloning kit (Invitrogen Co., San Diego, CA), according to the S manufacturer's directions.
In an alternative approach, the entire wtORFS and synORFS genes were cloned into pRc/CMV2 (Invitrogen) eukaryotic vector by adding Hind III and Xba I restriction sites at the 5' ends of the sense and antisense oligonucleotide primers, respectively. The resultant recombinant plasmids were digested with BamHl or Hind III endonucleases to verify the size of cloned DNA fragment.
The nucleotide sequence of the wtORFS and synORFS genes were verified by sequencing both strands by the dideoxynucleotide chain-termination method (Sanger et al., 1977) using the T7 DNA polymerase (Pharmacia) in an Automated Laser Fluorescent DNA sequencer (Pharmacia LKB). To assess the error rate of the reverse transcriptase and Tag polymerase, clones from three different PCR events were sequenced. Subsequently, the nucleotide (nt) and amino acid sequences were computer analyzed with the GeneWorks 2.4 program (IntelliGenetics Inc., Mountain View, Calif.). Corrections of the errors made in the synORFS were made by other runs of PCR using as template the synORFS cloned into the pRc/CMV2 plasmid, using the DNA
Vents polymerase (New England Biolabs) and sense and antisense primers corresponding to the regions where the errors occurred.
Antisera Rabbit monospecific a5-hyperimmune serum to E. coli-expressed ORFS product of the homologous PRRSV strain was obtained from previous studies (Mardassi et al., 1996). The hyperimmune porcine anti-PRRSV serum was obtained following experimental inoculation of SPF piglets (Loemba et al., 1996).
Cloning of the nazi ve ORFS and synORFS genes in eukaryotic plasmids for transient expression experiments.
Viral RNA was extracted from PRRSV-infected MARC-145 cells by the one-step guanidinium isothiocyanate-acid phenol method (Chornczynski & Sacchi, 1987). The native ORFS encoding region, as well as synORFS within the pCR2.1 vector, were cloned into the Hind III and Xba I
cloning sites of the eukaryotic expression vector pRc/CMV2 (Invitrogen), downstream of the human cytomegalovirus (HCMV) promoter to produce pRc/CMV2/wtORF.S and pRc/CMV2/synORFS recombinant piasmids. The sequences of the oligonucleotide primers used for the latter amplification were as follows:
ETS 5': 5'- CC GGATCC GCC GCC GCC ATG TTG GGG AAA TGC CTG ACC- 3', (SEQ ID
NO: 5) or ETS 5' syn: 5'- CAT GGATCC GCC GCC GCC ATG CTG GGC AAG TGC TTG ACC- 3' (SEQ ID NO: 6) which are forward primers that comprise the first ATG codon of the wtORFS (ETS
S') and synORFS (ETS 5' syn) genes downstream of a Kozak motif for initiation of translation in vertebrates (Kozak, 1987), and ETRS: 5'- TCTAGA GGCAAAAGTCATCTAGGG-3' (SEQ ID NO: 7) a reverse primer which comprises the C-terminal stop codon of the viral gene.
The nucleotide sequence accession number (EMBL/GenBank/DDBJ libraries) of ORFS of the IAF-Klop strain is U64928 (Gagnon & Dea, 1998). For directional cloning, Hind III and Xba I
restriction sites were added at the 5' ends of the sense and antisense oligonucleotide primers, respectively, and the synORFS gene cloned into the corresponding Hind III and Xba I sites of the expression vector pRc/CMV (Invitrogen) downstream of the human cytomegalovirus (CMV) promoter, producing the plasmid pRc/CMV2/synORFS. Both strands of pRc/CMV2/wtORFS and pRc/CMV2/synORFS were sequenced in an Automated Laser Fluorescent DNA
sequences (Pharmacia LKB) in order to confirm that no error has occurred as a result of PCR amplification.
Transient expression of the GPSglycoprotein Ex-vivo expression of pRc/CMV2/wtORFS and pRc/CMV2/synORF5 constructs were tested in transient expression experiments in cells maintained as confluent monolayers.
Cells in 6 cm-tissue culture plates were transfected with 15 pg of plasmid DNA using Fugene 6 transfection reagentTM (Roche Diagnostics, Laval, Qc, Canada) and incubated at 37 °C. For indirect immunofluorescence (IIF), cells were rinsed twice in PBS and fixed with 80%
cold acetone for 20 min at 4 °C at variable times (18 to 72 h) post-transfection. The monolayers were then reacted for 30 min with rabbit monospecific a5-hyperimmune serum (Mardassi et al., 1996) and the immune reaction was revealed following incubation with fluorescein-conjugated goat anti-rabbit Ig (Roche Diagnosis Ins., Laval, Canada), as previously described (Loemba et al., 1996).

Generation of recombinant replication-defective hAdVs expressing the PRRSV
native ORFS and synORFS genes.
The entire wtORFS (SEQ ID NOs: 3 and 4) and synORFS genes (SEQ ID NOs: 1 and 2, or 8 and 9) of the IAF-Klop strain of PRRSV were amplified by RT-PCR using specific sets of oligonucleotide primers which have been designed from the previously described sequence of the virus (EMBL/Genbank accession No. U64928: Gagnon & Dea, 1998; Pirzadeh et al., 1998).
Both primers contained two BamHI restriction sites at their 5' end, and in the case of sense primer, the ATG initiator codon was preceded by a triple GCC motif in order to provide an optimal Kozak consensus sequence for efficient translation (Kozak, 1987). For each reaction, the amplified product was inserted into the unique BamHI site of the adenovirus transfer vectors pAdTRS/DCIGFPq (Massie et al., 1998c) so that the wtORFS and synORFS coding sequences would be under the control of the TR.S promoter (Massie et al., 1998b).
The recombinant plasmids were linearized by digestion at the unique Cla I site and rescued into the genome of Ad/CMVIacZ, a replication-defective E1- and E3-deleted hAdVs, by homologous recombination in 293 cells, as described elsewhere (Jani etal., 1997). The 293 cells, were used to propagate hAdVs to complement the functions of the E1-deleted genomic region of Ad/CMVIacZ and thereby permit the replication of replication-defective hAdVs.
Upon cotransfection, virus plaques were isolated, amplified in 293 cells, and analyzed for the expression of the recombinant GPS protein either by western blotting or by radioimmunoprecipitation assays (RIPA). The hAdVs AdTRS/DC/GFPq/wtORFS
(hAdV/TRS/wtORFS), and AdTRS/DC/GFPq/synORFS (hAdV/TR5/synORFS), which efficiently evoked the expression of the GPS , were subjected to three consecutive rounds of plaque purification on BMAdEl clone 78, then selected viral clones were amplified on BMAdEl clone 220 cells (up to 3X10' cells), as previously described (Massie et al., 1998a). Infectivity titres of the hAdVs were determined by calculation of the plaque forming units (PFU/ml) on 293 cell monolayers, as detailed in Massie et al. (1998b).
Western blotting experiments Lysates of MARC-145 cells, infected with PRRSV, or infected with hAdV/TRS/wtORFS or hAdV/TRS/synORFS together with hAdV/CMV/tTA, or with hAdV/CMV/tTA alone, were prepared in LB-2 lysis buffer (Mardassi et al. , 1996) and denatured by boiling in the presence of S% (V/V) ~3-mercaptoethanol, subjected to 12% SDS-PAGE and electrotransferred onto nitrocellulose membranes (45 pm pore size, Schleicher and Schuell Inc.) (Loemba et al., 1996).
Immunological identification of native or recombinant viral proteins was confirmed following incubation of the saturated nitrocellulose membranes in the presence of 1:100 to 1:1000 dilution of the rabbit monospecific a5-hyperimmune serum or hyperimmune porcine anti-PRRSV serum, as previously described (Mardassi et al. , 1994; 1996).
Metabolic labeling and immunoprecipitation of PRRSV native or recombinant proteins Radiolabelling with (35S]-methionine (specific activity of 1,120 Ci/mmole, Amersham Searle Co., Oakville, Ontario) of viral proteins synthesized in PRRSV-infected MARC-145 cells, as well as recombinant proteins synthesized in 293 or 293 TetOn cells infected with hAdVs, was carried out essentially as previously described (Mardassi et al., 1994, 1996).
These cells were cultivated in the presence of 1 ~g/ml of doxycycline (Sigma chemical Inc., St-Louis, Mo) to enhance the expression by hAdVs of the foreign genes placed under the control of the TRS
promoter (Massie et al., 1998c). Aliquots (adjusted to 1 x 10'cpm per 500 p1 of RIPA buffer) of clarified lysates of PRRSV-infected, hAdVs-infected or mock-infected cells were incubated overnight at 4°C with 5 to 15 p1 of the rabbit aS monospecific antiserum or anti-PRRSV
hyperimmune pig serum. The immune complexes were then adsorbed for 2 h to protein A-sepharose CL4B beads (Amersham Inc.) and dissolved directly in electrophoresis sample buffer containing 5% (3-mercaptoethanol. Following electrophoresis on 12,5 % SDS-polyacrylamide gels, the immune complexes were revealed by fluorography and autoradiography, as previously described (Dea et al., 1989).
Animals Nine crossbred F1 (Landrace x Yorkshire) castrated specific pathogen-free (SPF) piglets 4 to-5 week of age were obtained from a breeding farm located in southern Quebec, Canada. The breeding stock and piglets were tested and proven to be seronegative for PRRSV, encephalomyocarditis virus (EMCV), porcine parvovirus (PPV), haemagglutinating encephalo-myelitis virus (HEV), transmissible gastroenteritis virus (TGEV) and Mycoplasma hyopneumoniae. The piglets used in this study were from 2 different litters and were randomly divided into one control group and two experimental groups (3 piglets /group) kept in facilities equipped with a microorganism-free, filtered in-flowing and out-flowing air system. The animals were fed with commercial feed and water ad libitum.
Pig immunization protocol and challenge Groups of 3 piglets were given two injections, 32 days apart, of 1) a volume of 100 p.1 of a suspension containing 109PFU of hAdV/TR5/wtORFS mixed with 5 x 109 PFU of the hAdV/CMV/tTA in PBS containing 0,02% of the poloxamer SP1017 (Lemieux et al., 2000) (Suprateck Pharma Inc., Laval, QC, Canada); 2) a volume of 100p,1 of a suspension containing 1 x lO~PFU of hAdV/TR5/synORFS mixed 1:5 with hAdV/CMV/tTA prepared in the mixture described above; or 3) a volume of 100 pL of a suspension containing 5 x 10 9 PFU of hAdV/CMV/tTA prepared in the SP1017 poloxamer solution (control pigs). The suspensions of hAdVs were injected intradermally under the right ear using a 30 gauge needle.
The animals received a booster of the same antigenic mixture at day 32, and were challenged intranasally at day 60 with a dose of 105 TCIDS~ of the IAF-K(op strain in 5 ml of clarified cell culture supernatant. Pigs were bled at days 0, 10 and 21 post-challenge.
Virus neutralization and serological tests Pig sera were tested for the presence of specific anti-GP; antibodies by virus neutralization (VN), IIF, ELISA and Western blotting (WB) tests. The VN test was performed in triplicates with 100 p1 of serial dilutions of heat-inactivated (56 °C, 45 min) test sera, incubated for 60 min at 37 °C in the presence of 100 TCIDSO of the virus in DMEM containing 20% normal SPF pig serum (Yoon et al. , 1994). The mixtures were put in contact with confluent monolayers of MARL-145 cells in 96 well microtitration plates, incubated at 37 °C in a humidified atmosphere containing 5% COZ, and observed daily for up to 5 days for the appearance of cytopathic effects (CPE) (Loemba et al., 1996). The monolayers were then fixed with a solution of 80% cold acetone in PBS buffer, and tested for expression of the PRRSV nucleocapsid protein by IIF (Magar et al. , 1995), using N protein specific MAb IAF-K8 (Dea et al., 1996). The immune reaction was visualized after an incubation of 45 min. with FITC-labelled goat anti-mouse IgG (Roche Diagnosis Inc.).
Neutralizing titres were expressed as the reciprocal of the highest dilution that completely inhibited the expression of viral N protein. A competitive ELISA for detection of antibodies to PRRSV using recombinant E. coli-expressed N protein as antigen was used to monitor humoral immune response following challenging of hyper-immunized pigs (Dea etal., 2000b). A
commercial indirect ELISA (Idexx) for detection of anti-PRRSV antibodies was also used, following the manufacturer's directions. Western blotting was performed as described above, using sucrose gradient purified-PRRSV as antigen (Mardassi et al., 1994).
Results Construction of a synthetic ORFS gene based on optimal codon usage Initially, PCR was adopted for multiple simultaneous single-overlap extension for gene assembly by mixing a series of internal oligonucleotides designed to alternate in sequence on the sense and antisense strands, together with an excess of flanking primers in one reaction mix. No product of the expected size of 603-by could be detected by agarose gel electrophoresis of the initial reaction mixture. Changes in oligonucleotide concentration and thermal cycling parameters did not improve upon this result. In an alternative approach, the most C-terminal I80-by was first amplified, and the gene was then extended by next PCR amplification mixing the upstream overlap oligonucleotides and the previous PCR product. Two short oligonucleotides flanking the entire ORFS gene were used to amplify the whole synthetic gene (Gonin et al., 1999).
The first clone obtained was totally sequenced. A total of 14 errors were detected in the 603 nucleotide sequence to give an overall error rate of one per 58 nucleotides.
This high error rate was probably due to the numerous cycles of amplification using Tag polymerase.
Eleven of the errors corresponded to nucleotide substitutions occurring at wobble base, thus leading to silent amino acid mutations (amino acid residues unchanged). Three errors resulted from single by substitutions leading to amino acid changes: G for A at position 143, and G
for T at both positions 187 and 464. These by substitutions correspond to amino acid changes at positions 47 (Cys for Tyr), 62 (Ala for Ser) and 155 (Try for Leu) of the authentic GPS
envelope glycoprotein, respectively. Four silent mutations occurred within the first 204 by of the entire cDNA and were corrected by repeating PCR of that region. This corrected portion of the cDNA, with the exception of the A and T at positions 143 and 155 was then assembled with the remaining portion of cDNA, with the single non-silent error at position 464, to obtain the preliminary entire synORFS gene. After a final PCR amplification using ET5'syn and ETRS primers pair, the temporary uncorrected synORFS was inserted into the eukaryotic pRc/CMV2 expression plasmid and used as DNA template for final correction by PCR using the appropriate 60-mer oligonucleotides as primers and the Vent' DNA polymerase (New England Biolab).
The parental recombinant plasmid (pRcICMV2IsynORFS) was used in its circular form. In a first step, an appropriate primer pair was used to obtain a first PCR product corresponding to DNA of the entire parental plasmid containing the synORFS with targeted mutations G143A and GI87T. The advantage in obtaining an amplified product with blunt ends permits recirculation of the plasmid by simple ligation, the latter being used to transform E. coli competent cells (DHSa strain) for amplification and verification of the corrections by sequencing analysis. This latter recombinant plasmid was in turn used for reverse PCR using a second primer pair to correct the mutation G464T. Final sequencing analysis of the inserted synORFS indicated that the errors have been corrected (Figure 2). The final construct of synORFS contains a total of 130 nucleotide substitutions compared to the wtORFS gene, resulting in an overall 78,4 % (473/603) identity at the nucleotide Level, but deduced amino acid sequences from both wtORFS and synORFS genes were 100 % identical. Thus, a new gene coding for the major GP5 envelope glycoprotein of a North American strain of PRRSV, the IAF-Klop strain, was successfully created.
Transient expression of wild type and synthetic ORFSgenes in 293 and MARC-145 cells Ex-vivo expression of pRc/CMV2/wtORFS and pRe/CMV2/synORFS constructs were tested in transient expression experiments in cells maintained as confluent monolayers.
The synthesis of GPS in both human 293 and simian MARL-145 cells was confirmed by indirect immunofluorescence (IIF) following incubation of cells transfected with the recombinant eukaryotic plasmids in the presence of monospecific a5- rabbit hyperimmune serum and the appropriate fluorescein-labelled goat anti-rabbit Ig conjugate. In both cases, the optimal number of transfected cells, as well as the optimal intensity of the fluorescence, were observed at 48 h post-transfection (Figure 3). A specific cytoplasmic fluorescence of weak intensity was observed in approximately 5 to 10% of the cells transfected with the wild type gene, while up to 20 to 25%
of the synORFS-transfected cells displayed a more intense cytoplasmic fluorescence that tended to accumulate near the perinuclear region. Surprisingly, both the number of cells transfected with the synORFS recombinant plasmid, and the intensity of fluorescence per cell, were higher.
Generation of inducible replication-defective adenoviral vectors for the expression of synORFS
gene In MARC-145 cells, as well as in 293 cells, co-infection of hAdVs constitutively expressing the tTA transactivator (AdCMV/tTA), and hAdVs expressing the PRRSV major GP5 envelope-associated gene under the control of the tetracycline-regulated promoter (hAdV/TR5/wtORFS or hAdV/TR5/synORFS), allowed efficient controlled expression of the PRRSV
recombinant protein. The addition of doxycycline in the medium completely abrogated expression of the transgenes (Gagnon et al., 2001, 2003), confirming that the tetracycline regulated expression system was effective.
To facilitate the identification of the recombinant clones or hAdVs, the gene encoding for the GFPq protein (Green fluorescent protein) was cloned as a reporter gene downstream of the multiple cloning site of the shuttle vector under the control of an internal ribosomal entry site (IRES). As illustrated in Figure 4, at 24, 48 and 70 h post-infection at a multiplicity of infection (moi) of 100 PFU per cell, the intensity of the spontaneous GFPq fluorescence was higher in cells infected with the recombinant hAdVs expressing the synORFS gene than those expressing the wtORFS gene. This suggests that, suprisingly, transcription of the synORFS
gene was more efficient than that of the wtORFS gene, thus allowing a higher interaction of the GFPq gene with cellular enzymes involved in mRNAs synthesis and ribosomes for translation.
In agreement with these findings, expression of the GP5 major envelope glycoprotein per se was also higher in cells infected with synORFS than those infected with wtORFS.
MARC-145 cell monolayers were co-infected with AdCMV/tTA (control lane) or AdCMV/tTA and hAdV/TRS/DC/GFPq/wtORFS (lane WT) or hAdV/TR5/DC/GFPq/synORFS (lane SYNT) at a moi of 100 PFU. After incubation for 24 or 48 h (Figure 5) or 70 h (not shown) cells were fixed with cold acetone and washed twice with PBS to eliminate spontaneous GFPq fluorescence.
Expression of GPS of PRRSV was confirmed by specific IIF following incubation in the presence of the rabbit anti-a5 monospecific serum. The intensity of the cytoplasmic fluorescence was optimal at 48 h post-infection (Figure 5).
When cultivated in 293 TetOn cells (cells that constitutively express the reverse tetracycline transactivator (rtTA) thus repressing expression in the absence of doxycycline) the presence of 1 pg/ml of doxycycline enhanced the expression of GP5 from both hAdV/TRS/wtORFS
and hAdV/TRS/synORFS vectors (data not shown).
Expression of the wild type and synthetic GPS as revealed by radio-immunoprecipitation In order to correlate data obtained by immunofluorescence with the levels of synthesis of the GP5 major envelope glycoprotein of PRRSV, RIPA experiments were conducted with lysates of 293 rtTA cells infected with either hAdV/TR.S/wtORFS or hAdV/TR5/synORFS
recombinant viruses.
The immune complexes obtained after incubation in the presence of rabbit monospecific a5-hyperimmune serum were adsorbed on protein A-sepharose beads, then analysed by SDS-PAGE
and revealed by fluorometry and autoradiography. As shown in Fig 6 (left and right panels), immunoprecipitation of cell lysates harvested 48 h post-infection, revealed an increased expression of GP5 in cell cultures infected with hAdV/TR5/synORFS in comparison to the level of GP5 synthesized in cell cultures infected with hAdV/TR5/wtORFS. Using densitometry it was determined that the amount of the PRRSV GP5 major envelope glycoprotein synthesized in hAdV/TRS/synORFS-infected 293 rtTA cells (Figure 6) or MARL-145 cells (data not shown) was 6 to 20 times the amount of the same protein synthesized in hAdV/TR5/wtORFS infected cells. In Figure 6, left panel, hAdV/'TRS/synORFS-infected 293 rtTA cells synthesized 11 times more GPS than hAdV/TRS/wtORFS-infected cells, whereas in Figure 6, right panel, the amount of the GPS synthesized in hAdV/TRS/synORFS-infected cells was 6 times the amount synthesized in hAdV/TR5/wtORFS-infected cells, considering that the WT lane was loaded with 3 times more cell lysates (in cpm) than the SYN lane. The ratio of lysate cpm loaded in each lane differed and is shown at the bottom of each panel in Figure 6.
Antibody response in pigs immunized with hAd UlTRSlwtORFS or hAdYlTRSlsynORFS
Following two intradermal injections of the control or test vaccine mixtures, and before exposure to PRRSV, none of the immunized piglets developed significant antibody titres as revealed either by indirect immunofluorescence (significant titres >16) on PRRSV-infected-MARC-145 cells or the virus neutralization assay (VN) (significant titres > 8). Furthermore, reactivity to expression of the authentic (wild type) GPS viral protein could not be demonstrated by Western blotting (Table 4, "Pre" data).
However, within 10 days of an intranasal viral challenge (Figure 7a and Table 4 "d10" data), the three pigs pre-immunized with the test mixture of hAdV/TRS/synORFS and AdCMV/tTA
developed significant antibody titres to the authentic viral GPS protein, as demonstrated by IIF, indirect ELISA, VN and Western blotting. Control pigs pre-immunized either with hAdV/TRS/wtORFS and AdCMV/tTA, or with the AdCMV/tTA vector alone displayed antibody titres similar to synORFS-immunized pigs as detected by IIF and indirect ELISA, but did not develop significant VN antibody titres 10 days post-challenge. In the case of hAdV/TR5/wtORFS a weak reaction to the GPS protein was only demonstrated by Western blotting at 21 days post-challenge, while the pigs immunized with hAdV/TR5/synORFS
developed a high specific immune response against the GP5 protein over the same period (Figure 7b, Table 4 "d21" data). Thus only the pigs pre-immunized with the codon-optimized synORFS
DNA rapidly developed significant VN antibody titres following viral challenge. The data for each pig are shown on a separate row in Table 4.

EXAMPLE 2: Codon-optimized ORF polynucleotides encoding ORF fragments Materials and Methods Construction of adenovirus-based fragment librariesl2, Synthetic ORF polynucleotides encoding fragments (4synORFS) of IAF-Klop ORFS
protein are being made by the exonuclease III technique' using a pCR2.l/synORFS
recombinant vector. The synthetic ORFS is first cloned into the transfer vector pAdCMVS-P2DC-GFPq/K7PSmlp (obtained from Dr B. Massie). This vector permits the expression of both a synthetic ORFS gene and a GFPq (green fluorescence protein) reporter gene from a dicistronic mRNA.
The synthetic ORFS is under the control of the CMV cumate promotor," which inhibits the expression of toxic truncated proteins in cells that constitutively express the cumate repressor, CymR. The transfer vector also possesses the protease gene (PS), which is essential for the formation of viral infectious particles. The PS gene provided by the transfer vector complements the adenovirus deleted for the PS gene. Consequently, 100%a of the adenoviruses recovered from infected (with adenovirus deleted for El and PS genes) and transfected (with the recombinant transfer vector) 293 CymR cells (cells that constituvely express the eumate repressor for the inhibition of the transgene and complement the E1 deleted adenovirus) are 100% recombinant'2.
Importantly, this new generation of replication competent adenoviruses do not require co-infection of cells with an adenovirus expressing a transactivator (AdCMV/tTA) for the expression of the transgene. These truncated translation products of these fragments will be tested for expression, efficacy, cytotoxicity, and/or for their ability to interact with other PPRSV proteins or fragments, to select those sequences most useful in the invention.
Between amino acid positions 26 to 39, some North American strains of PRRSV
ORFS protein have no N-glycosylation site while others have three N-glycosylation sites (positions 30, 33 and 34). SynORFS encodes the wild-type ORFS protein and possesses three N-glycosylation sites (positions 30, 44 and 51) of which two (44 and 51) are highly conserved in the wild-type protein3'. Direct mutagenesis will be used to replace the N asparagine residue at positions 30, 44 and 51 simultaneously or independently in the full-length synORFS
polynucleotide and in truncated variants (hAdV/~synORFS/ON). These N-mutant constructs will be tested for expression, efficacy, cytotoxicity, and/or for their ability to interact with other PPRSV proteins or fragments, to select those sequences most useful in the invention.
Expression of the truncated and N mutated synthetic ORFS recombinant adenoviruses.
The transient expression of truncated ORFS proteins expressed by the pAdCMVS-GFPq/K7PSmlp/OsynORFS will be tested as previously described. Western blotting experiments can be done as previously described except that the new generation of recombinant adenoviruses do not need a co-infection with another adenovirus expressing a transgene.
Toxicity of the truncated and N mutated synthetic ORFS recombinant adenoviruses.
The deleted synthetic ORFS recombinant adenoviruses (hAdV/OsynORFS) will be used to evaluate which part of the protein is toxic and able to induced apoptosis. As described above, monolayers of non-helper cells (where the hAdV/~synORF5 could not replicate), such as MARC-145 cells (permissive cell line to PRRSV), will be infected at a MOI of 100 plaque forming unit (PFU) per cell's and the toxicity will be evaluated by different techniques as previously described'S. Alternatively or in addition, alveolar macrophages (the primary infected cells in swine4~ 'o, zz. aa. as) will be infected in order to evaluate the cytotoxicity and apoptosis associated with deletion variants of the ORFS protein fragments. Abnormal proliferation or gross cellular changes that occur upon intracellular synthesis of the truncated and N-mutated ORFS peptides will be visualised under light microscope (Leyca, Leitz) at various times up to 72 hours post-infection'S~'~. MARL-145 cells are not permissive to replication defective (E1 deleted) recombinant hAdVs since they do not complement their E1 gene functions, so any cellular degeneration or abnormalities observed can be attributed to the toxicity of the expression of the PRRSV ORF5 peptide variants encoded by the synORFS variants. Two techniques will be used to characterize the cytopathic effect observe in hAdV-infected cells: the fluorescence TUNEL assay and the caspase 3 activation3;. The TUNEL assay detects the fragmentation of DNA which is characteristic of apoptosis. A commercial TUNEL assay (In Situ cell death detection kit, fluorescein, Roche, Laval, Quebec, Canada) will be used for the detection of DNA
fragmentation in PRRSV and hAdVs-infected cells using the procedure recommended by the manufacturer. For the detection of caspase 3 activation, MARC-145 cells infected with hAdV/OsynORFS's wilt be disrupted at different times post-infection (p.i.) in the lysis solution provided in the ApoAlert Caspase~ Fluorescent Assay Kit (BD Biosciences Clonetech, Palo Alto, CA). Five pl (typically corresponding to 60 to 75 pg of protein) of the cell lysates will be added to 90 pl of a solution containing SO mM HEPES, pH 7.0, 10% glycerol, 0.1% CHAPS, 2mM EDTA and 5mM dithiothreitol (DTT). 10 pM of the DEVD-AFC fluorogenic substrate specific for caspase 3, (Biomol Research Laboratories Inc., Plymouth Meeting, PA), will then be added and the rate of fluorescence released monitored using a 96-well plate fluorimeter (Cytofluor, Perseptive Biosystems, Foster City, CA). The results are expressed as fluorescence released (fluorescence unit or FU) per sec per pg of cell lysate.
Epitopes of synORFS implicated in the viral neutralization phenomenon.
Monocloanl antibodies (MoAbs) capable of neutralizing the viral infectivity in MARC-145 cells of the IAF-Klop strain of PRRSV are known in the art29~ 3' and can be used in the virus neutralization test (VN) described above. Other MoAbs directed specifically against the GPS
protein are being produced and characterized using standard techniques known in the art. Those with the appropriate anti-PRRSV activity can also be used in the VN test.
These antibodies can also be used in IIF assays as follows: Monolayers of continuous cell lines, such as MARC-145 cells, and 293 cells, are infected with synORF
polynucleotides expressing fragments or variants. At different time p.i., cell will be fixed with a cold 80% acetone solutiong~
'4. An indirect immunofluorescence test (IIF, previously described) performed with an array of neutralizing MoAbs will establish their specificity against each of the epitopes of the GPS
protein. A positive result with a particular ORF variant will help identify a neutralizing epitope of the GPS protein, which can be exploited in the design of further candidate ORF constructs with improved efficacy.
Immunization of animals with the truncated and N mutated synthetic ORFS
polynucleotides The immunization procedure and follow up assays to evaluate the immune response induced in immunized pigs are described above (VN, IIF, ELISA, necropsy, histopathological examination, western blot, blastogenic transformation test, virus isolation).
EXAMPLE 3: synORF4 and synORF6 While the major glycosylated envelope protein GP5''~ m. z7-3o. 32. 36 plays a major role in inducing neutralizing antibodies and a protective immune response in pigs, other proteins also likely to contribute to the immune response include the major structural protein M 2"'' S encoded by ORF6, and the minor structural protein GP4'~ encoded by ORF4.

It as been demonstrated that for a related virus, the equine arteritis virus (EAV), that an improved immune response is obtained when animals (mice and horse) are immunized with a recombinant alphavirus vaccine that expresses the heterodimer GP5-M versus those that express the GPS
alonez~'. Also the highest cellular immune response in pigs is specifically directed against the M
S proteins. Thus it is contemplated that expression of the M protein or fragments thereof may be useful in the development of an efficient vaccine against PRRSV.
The glycosylated minor structural protein GP4, encoded by ORF4 of PRRSV, may also play a role in the induction of a protective immune response. The GP4 of a European strain of PRRSV
was able to induce an appreciable level of neutralizing antibodies26 however only very low levels of neutralizing antibodies could be detected upon immunization with the GP4 of a North American PRRSV strain2' which is 68% identical at the amino acid level. The poor expression of the ORF4 gene in PRRSV infected cells and by recombinant vectorszs and low quantity of purified infectious viral particles, may explain why experimentally infected pigs did not develop significant level of neutralizing antibodies". A completely optimized full-length synORF4 polynucleotide sequence was designed based on the wild type ORF4 of IAF-Klop strain of PRRSV.
Materials and Methods The procedure used to construct the synthetic ORF4 and ORF6 of PRRSV is described above.
Figures 10 and 11 show nucleotide sequences of the optimized synORF4 and synORF6 nucleic acid molecules. The nucleotide identities of synORF4 and synORF6 compared to their wild-type genes are 78% and 79% respectively. In each case, preferred codons have been substituted for 104 non-preferred codons without altering the deduced amino acid sequence. 58%
and 59% of the codons have been replaced in the sequence of synORF4 and synORF6, respectively. Table 3b and Table 3c show the proportion of codons used to encode each amino acid in the wild-type sequences of the IAF-Klop strain of PRRSV, compared with the codons used in human cells.
EXAMPLE 4: Partial codon-o timization of ORFS
Figure 8 and SEQ ID NO: 42 show the nucleotide sequence of the partially optimized synORFS
variant and the modified amino acid sequence it encodes is provided in SEQ ID
NO: 43. This polypeptide differs from the wild-type ORF_5 protein sequence at 4 positions:
at amino acid position 48, Y replaces C, at amino acid position 63, S replaces A, at amino acid position 155 L
replaces W, and at amino acid position 183, A replaces G. The altered nucleotides underlying these amino acid substitiutions are shown boxed in Figure 8. The identity of the polypeptide expressed from the synORFS variant is 98% compared to the polynucleotide of the wild-type (and completely optimized synthetic). As shown in Figure 8, a total of 14 nucleotide are different in the synORFS variant compared to the synORFS, corresponding to a nucleotide identity of 97%.
The wild-type ORF5 and the synORFS variant were cloned into the plasmid vector pVAX
(Invitrogen Canada Inc, Burlington, Ontario). 293 cells were transfected with these recombinant vectors, and a pVAX control vector, as previously described. Expression of the GP5 protein was monitored using the IIF technique previously described. Figure 9 demonstrates that an increased expression level was also obtained with the partially optimized synORFS
variant.
The invention being thus described, it will be obvious that the same may be varied in many ways.
Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims. Patents and publications referred to throughout this application are hereby incorporated by reference in their entirety.

REFERENCES
Ausubel, F. M., R. Brent, R. E. Kingston, et al. 1991. Current protocols in molecular biology. Greene Publishing Associates and Wiley-Interscience.
2 Balasuriya, U. B., H. W. Heidner, N. L. Davis, et al. 2002. Alphavirus replicon particles expressing the two major envelope proteins of equine arteritis virus induce high level protection against challenge with virulent virus in vaccinated horses. Vaccine 20:1609-17.
3 Balasuriya, U. B., H. W. Heidner, J. F. Hedges, et al. 2000. Expression of the two major envelope proteins of equine arteritis virus as a heterodimer is necessary for induction of neutralizing antibodies in mice immunized with recombinant Venezuelan equine encephalitis virus replicon particles. J Virol 74:10623-30.
4 Bautista, E. M., S. M. Goyai, I. J. Yoon, et al. 1993. Comparison of porcine alveolar macrophages and CL 2621 for the detection of porcine reproductive and respiratory syndrome (PRRS) virus and anti-PRRS
antibody. J Vet Diagn Invest 5:163-5.
5 Bautista, E. M., P. Suarez and T. W. Molitor. 1999. T cell responses to the structural polypeptides of porcine reproductive and respiratory syndrome virus. Arch Virnl 144:117-34.
6 Chen, Z., K. Li and P. G. Plagemann. 2000. Neuropathogenicity and sensitivity to antibody neutralization of Lactate dehydrogenase-elevating virus are determined by polylactosaminoglycan chains on the primary envelope glycoprotein. Vimlngy 266:88-98.
7 Chen, Z., K. Li, R. R. Rowland, et al. 1998. Neuropathogenicity and susceptibility to immune response are interdependent properties of lactate dehydrogenase-elevating virus (C,DV) and correlate with the number of N-linked polylactosaminoglycan chains on the ectodomain of the primary envelope glycoprotein. Adv Exp Med Biol 440:583-92.
8 Dea, S., C. A. Gagnon, H. Mardassi, et al. 1996. Antigenic variability among North American and European strains of porcine reproductive and respiratory syndrome virus as defined by monoclonal antibodies to the matrix protein. J Clin Microbial 34:1488-93.
9 Dea, S., C. A. Gagnon, H. Mardacsi, et al. 2000. Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Arch Virol 145:659-88.
10 Duan, X., H. J. Nauwynck and M. B. Pensaert. 1997. Effects of origin and state of differentiation and activation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV). Arch Viml 142:2483-97.
11 Eaton, R. W. 1997. p-Cymene catabolic pathway in Pseudomonas putida Fl:
cloning and characterization of DNA encoding conversion of p-cymene to p-cumate. JBacteriol 179:3171-80.
12 Elahi, S. M., W. Oualikene, L. Naghdi, et aL 2002. Adenovirus-based libraries: efficient generation of recombinant adenoviruses by positive selection with the adenovirus protease.
Gene Ther 9:1238-46.
13 Fernandez, A., P. Suarez, J. M. Castr~ et al. 2002. Characterization of regions in the GP5 protein of porcine reproductive and respiratory syndrome virus required to induce apoptotic cell death. Virus Res 83:103-18.
14 Gagnon. C. A. and S. Dea. 1998. Differentiation between porcine reproductive and respiratory syndrome virus isolates by restriction fragment length polymorphism of their ORFs 6 and 7 genes. Can J Vet Res b2:1 I U-6.
15 Gagnon, C. A., G. Lachapelle, Y. Langelier, et al. 2003. Adenoviral-expressed GP5 is distinct from the authentic protein that is included in the porcine reproductive and respiratory syndrome virions. Arch Virol:In press.
16 Gagnon, C. A., Y. Langelier, B. Massie, et al. 2001. Biochemical properties and processing of the three major structural proteins of PRRS virus expressed by recombinant adenoviruses.
Structural, functional and community aspects. Adv Exp Med Biol 494:225-31.
17 Gonin, P., B. Pirzadeh, C. A. Gagnorry et al. 1999. Seroneutralization of porcine reproductive and respiratory syndrome virus correlates with antibody response to the GP5 major envelope glycoprotein. J
Vet Diagn Invest 11:20-6.
18 Halbur, P. G., P. S. Paul, M. L. Frey, et al. 1996. Comparison of the antigen distribution of two US
porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus. Vet Pathol 33: I 59-70.
19 Halbur, P. G., P. S. Paul, M. L. Frey, e1 n1. 1995. Comparison of the pathogenicity of two US porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus. Vet Pathol 32:648-60.
20 Halbur, P. G., P. S. Paul and X. J. Meng. 1994. Marked variability in pathogenicity of nine US porcine reproductive and respiratory syndrome virus (PRRSV) isolates in 5-weeks-old CDCD pigs. Proceedings of the 13th International Pig Veterinary Congress:59.
21 Kwang, J., F. Zuckermann, G. Ross, et al. 1999. Antibody and cellular immune responses of swine following immunisation with plasmid DNA encoding the PRRS virus ORF's 4, 5. 6 and 7. Res Vet Sci 67:199-ZO 1.
22 Larochelle, R., H. Mardassi, S. Dea, et al. 1996. Detection of porcine reproductive and respiratory syndrome virus in cell cultures and formalin-fixed tissues by in situ hybridization using a digoxigenin-labeled probe. J Vet Diagrr Invest 8:3-10.
23 Massie, B., F. Couture, L. Lamoureux, et al. 1998. Inducible overexpression of a toxic protein by an adenovirus vector with a tetracycline-regulatable expression cassette. J Virol 72:2289-96.
24 Meng, X. J., P. S. Paul, P. G. Halbur, et al. 1996. Characterization of a high-virulence US isolate of porcine reproductive and respiratory syndrome virus in a continuous cell line, ATCC CRL11171. J Vet Diagn Invest 8:374-81.
25 Meulenberg. J. J., A. Petersen-den Besten, E. P. De Kluyver, et al. 1995.
Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206:155-63.
26 Meulenberg, J. J., A. P. van Nieuwstadt, A. van Essen-Zandbergen, et al.
1997. Posttranslational processing and identification of a neutralization domain of the GP4 protein encoded by ORF4 of Lelystad virus. J Virol 71:6061-7.
27 Osorio, F. A., J. A. Galeota, E. Nelson, et al. 2002. Passive transfer of virus-specific antibodies confers protection against reproductive failure induced by a virulent strain of porcine reproductive and respiratory syndrome virus and establishes sterilizing immunity. Virology 302:9-20.
28 Ostrowski, M., J. A. Galeota, A. M. Jar, et al. 2002. Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GPS
ectodomain. J Virol76:4241-.50.
29 Pirzadeh, B. and S. Dea. 1997. Monoclonal antibodies to the ORFS product of porcine reproductive and respiratory syndrome virus define linear neutralizing determinants. JGen Virol 78:1867-73.
30 Pirzadeh, B. and S. Dea. 1998. Immune response in pigs vaccinated with plasmid DNA encoding ORFS
of porcine reproductive and respiratory syndrome virus..l Gen Virnl 79:989-99.
31 Pirzadeh, B., C. A. Gagnon and S. Dea. 1998. Genomic and antigenic variations of porcine reproductive and respiratory syndrome virus major envelope GPS glycoprotein. Can J Vet Res 62:170-7.
32 Plagemann, P. G., R. R. Rowland and K. S. Faaberg. 2002. The primary neutralization epitope of porcine respiratory and reproductive syndrome virus strain VR-2332 is located in the middle of the GPS
ectodomain. Arch Virol 147:2327-47.
33 Thornberry, N. A. and Y. Lazebnik. 1998. Caspases: enemies within. Science 281:1312-6.
34 Voicu, I. L., A. Silim, M. Morin, et al. 1994. Interaction of porcine reproductive and respiratory syndrome virus with swine monocytes. Vet Rec 134:422-3.
35 Wensvoort, G., C. Terpstra, J. M. Pol, et al. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q 13:121-30.
36 Zhang, Y., R. D. Sharma and P. S. Paul. 1998. Monoclonal antibodies against conformationally dependent epitopes on porcine reproductive and respiratory syndrome virus. Ver Microbiol 63:125-36.

Table 1. North American PRRSV strains and their GenBank accession numbers.
PRRSV Strain AccessionReference tar-atop t~uenec U64928 Mardassi et u1., (1994) Can. J.
reference cytopathic Vet. Res. 58:55-64 strain) IAF-DESR U64930 Pirzadeh et al., (1998) Can J Vet Res 62:170-177 IAF-BAJ U64929 Pirzadeh et al., (1998) Can J Vet IAF-CM AF013106 Res 62:170-177 Pirzadeh et al., (1998) Can J Vet Res 62:170-177 IAF-93-653 U64931 Pirzadeh et al. , (1998) Can J Vet IAF-94-3182 U64933 Res 62:170-177 Pirzadeh et al., (1998) Can J Vet Res 62:170-177 IAF-94-287 U64934 Pirzadeh etal., (1998) Can J Vet Res 62:170-177 IAF-93-2616 U64932 Pirzadeh etal., (1998) Can J Vet Res 62:170-177 ONT-TS U64935 Pirzadeh et al., (1998) Can J Vet Res 62:170-177 tso ate Magar et al. , (1995) Can J Vet US isolate 91-22778 Res 59:232-234 US isolate 91-1453 ATCC VR-2332 U87392 Nelsen et al., (1999) J Virol 73:270-280 (US reference strain) ATCC VR-2332 ~1~~4- NieIseo et al.~ (2003) J Virol 77:
(US reference strain) in press ATCC VR-2385 U03040 Meng et al., (1994) Arch Virol 75:1795-1801 (US reference strain) ISUVDL 98-38803 AF535152 Opriessnig et al., (2002) J Virol 76:11837-11844 Table 2. Examples of preferred codons for optimal expression in mammalian cells AMINO ACID POSSIBLE CODONS PREFERRED CODON

Alanine GCA GCT GCC

Arginine CGA AGG CGC
CGT AGA
-. _ -. _ sparagme ~~ AA~
_ spartic ci ~ _ ysteme _ fig.

utamme utamic ci AAA

Glycine GGA GGT GGC

Histidme ~H~ ~H i Isoleucine ATT ~ ATC

Leucine CTA TTG CTG
CTT TTA

ysme HH~ rah Proline CCA CCT CCC
- - _ _ _ eny a amne Serine TCA AGT TCC
TCT AGC

Threonine ACA ACT ACC
___ _ _ _ yrosme ~ TAC

Valine GTT GTC I GTG

Table 3a. Frequency of codon occurrence in humans (H) and in ORFS of PRRSV ' nucleotide# H PRRSV nucleotide# H PRRSV nucleotide# H PRRSV
GPS GPS GPS

AA I % % (#) AA 1 % % (#) AA 1 & % % (#) & & 2 3 Ala GC C 53 27 (4) Gly GG C 50 33 (4) Phe TT C 80 33 (3) T 17 20 (3) T 12 33 (4) T 20 67 (6) A 13 20 (3) A 14 8 (1) G 17 33 (5) G 24 25 (3) Ser TC C 28 26 (5) T 13 5 (1) Arg CG C 37 12,5 His CA C 79 50 (2) A 5 16 (3) (1) T 8 25 (2) T 21 SO (2) G 9 10,5 (2) A 6 0 (0) AG C 34 37 (7) G 21 25 (2) Ile AT C 77 45 (5) T 10 5 (1) AG A 10 25 (2) T 10 36 (4) G 18 12,5 A 5 18 (2) Thr AC C 57 57 (1) (8) (3) Leu CT C 28 17 (4) A 14 7 ( 1 ) Asn AA C 78 57 (4) T 5 13 (3) G 15 14 (2) T 22 43 (3) A 3 0 (0) G 58 30 (7) Tyr TA C 74 33 (3) Asp GA C 75 43 (3) TT A 2 0 (0) T 26 67 (6) T 25 57 (4) G 8 39 (9) Val GT C 25 42 (8) Cys TG C 68 45 (5) Lys AA A 18 78 (7) T 7 26 (5) T 32 55 (6) G 82 22 (2) A 5 5 (1) (5) Gln CA A 12 75 (3) Pro CC C 48 33 (2) G 88 25 (1) T 19 50 (3) A 16 0 (0) Glu GA A 25 20 (1) G 17 17 (1) G 75 80 (4) ' The frequencies of the individual codons are shown as percentages for each of the degenerately encoded amino acids, as well as the number of each amino acid for ORF (in parentheses). The nu>st prevalent codon is shown underlined in bold. The ORF protein is from the IAF-Klop strain of PRRSV.

Table 3b. Frequency of codon occurrence in humans (H) and in ORF4 of PRRSV

AlaC 53 31 (4) A 25 25 (Z) Pro C 4$-GLU

GCT 17 15 (2) GA G 75 75 (6) CC T 19 SO (2) A 13 23 (3) A 16 25 (1) G 17 31 (4) Gly - G 17 0 (0) GG T 12 17 (1) A 14 17 (1) Phe Arg- G 24 17 ( TT T 20 36 (4) 1 ) CGT 8 14 (1) A 6 14 (1) His Ser _ G 21 0 (0) CA T 21 80 (4) TC T 9 36 (8) A 8 9 (2) AGA 10 0 (0) Ite G 19 9 (2) G 18 29 (2) AT T 17 33 (4) A 6 2S (3) AG C 10 9 (2) T 17 18 (4) Asn~ 7~~~ Leu AAT 22 60 (3) CT T 5 33 (7) Thr A 3 0 (0) AC T 14 7 (1) G 59 10 (2) A 14 27 (4) G 1 S 20 (3) Asp- TT A 2 10 (2) GAT 32 20 (1) G .5 19 (4) Tyr TA T 26 60 (3) Cys- Lys TGT 32 57 (4) AA G 82 60 (3) Val GT T 7 31 (5) A 5 6 (1) Gln G 63 31 (5) CAG 88 40 (2) Table 3c. Frequency of codon occurrence in humans (H) and in ORF6 of PRRSV
H M H M H M

-Ala~ ~ 39 i~ A Pro GLU

GC T 17 11 (2) GA G 75 50 (1) CC T 19 17 (1) A 13 22 (4) A 16 33 (2) G 17 28 (5) Gly - G 17 17 (1) GG T 12 8 (1) A 14 15 (2) Phe Arg~ _ G 24 31 (4) TT T 20 40 (4) CG T 8 22 (2) A 6 11 (1) His Ser _ G 21 22 (2) CA T 21 17 (1) TC T 9 8 (1) A 8 8 (1) AG A 10 22 (2) Ile G 19 8 (1) G 18 0 (0) AT T 17 43 (3) A 6 29 (2) AG C 10 17 (2) T 17 33 (4) Asn~ Leu AA T 22 50 (3) CT T .5 13 ( 3) Thr A 3 17 (4) AC T 14 17 (2) G 59 22 (5) A 14 2S (3) G 15 25 (3) - --AspC TT A 2 4 (1 ) 61~
75Z3j GA T 32 25 (1) G 5 22 (5) Tyr TA T 26 50 (3) -CysC Lys -TG T 32 25 (1) AA G 82 30 (3) Val GT T 7 22 (4) A 5 28 (5) Gln G 63 28 (5) CA G 88 50 (I) Table 4. Post-challenge antibody response to immunization with DNA vaccines expressing either the wild type or synthetic codon-optimized PRRSV ORES gene.
Sero- Immuno-Western blotneutralisation' fluorescencez IDEXX
Ratio Antibody Antibody (ELISA) titres titres VirusesPre d10 d21 Pre d10 Pre d10 d21 Pre d10 d21 - - 16 < 64 >1024 0 0,489 1,243 Ad /tTA- - - < >256 >1024 0 1,050 1,401 16 <512 12 < 256 >1024 0 0,772 1,478 Ad/syn + + 256 < 128 >1024 0 1,239 1,443 ORFS

w w + 128 < >64 <128>1024 0 0,673 1,211 +

Ad/tTA + + 256 < 64 >1024 0 0,700 1,529 Ad/wt w ~'~' - < >16 <64 >1024 0 0,605 1,281 ORFS

- + 8 < >16 <64 >1024 0 0,730 1,509 Ad/tTA - ~'~' 8-16 < 16 >1024 0 0,480 1,265 Seroneutralisation antibody titres are expressed as the reciprocal of highest serum dilution which inhibited cytopathic changes produced by 100 TCIDSO of the IAF-Klop Strain of PRRSV in MARC-145 cells.
Z Immunofluorescence antibody titres are expressed as the reciprocal of the highest serum dilution at which specific fluorescence was observed in PRRSV-infected cells.

Table 5. Oligonucleotide primers used in PCR amplification of the synthetic ORFS.
Name SEQ Sense Positions" SEQUENCEb ID

NO:

1 50 + -9 to 60 5' accggatccA
T
GCTGGGCAAGTGCCTGACCGCCGGCTGT

_ 3' _ TGCTCCCAGCTGCCCTTCCTGTGGTGTATC

2 51 + 61 to 120 5' GTGCCCTTCTGTTTCGCCGCCCTGGTGAAC

GCCTCCTCCTCC'TCCTCCTCCCAGCTGCAG3' 3 52 + 121 to 180 15'TCCATCTACAACCTGACCATCTGTGAGCTG

AACGGCAC'.CGACTGGCTGAACAAGAACTTC3' 4 53 + 181 to 240 5' GACTGGGCCGTGGAGACCTTCGTGATCTTC

('CCGTGCTGACCCACATCGTGTCCTACGGC3' 54 + 241 to 300 5' C;CCCTGACCACCTCCCACTTCC'PGGACGCC

GTGGGCCI'GATCACCGTGTCCACCGCCGGC3' 6 55 + 301 to 360 5' TACTACCACGGCCGCTACGTGCTGTCCTCC

C;TGTACGCCGTGTGCGCCCTGGCCGCCCTG3' 7 56 + 361 to 420 5' ATCTGCTTCGTGATCCGCCTGACCAAGAAC

TGCATGTCCTC;GCGCTACTCCTGTACCCGC3' 8 57 + 421 to 980 5' TACACCAACTTCC'"GCTGGACTCCAAGGGC

AAGCTGTACCGCTGGCGCTCCCCCGTGATC3' 9 58 + 481 to 540 5' ATCGAGAAGGGCGGCAAGGTGGAGGTGGAC

GGCCACCTGATCGACCTGAAGCGCGTGGTG3' 59 + 541 to 600 5' CTGGACGGCTCCG(_'CGCC.'ACCCCCGTGACC

AAGGTGTCCGCCGAGCAGTGGTGTCGCCCC3' 11RC 60 - 30 to 1 5' ACAGCCGGCGGTCAGGCACTTGCCCAGCAT3' 1RC 61 - 90 to 31 5' GTTCACC:AGGGCGGCGAAACAGAAGGGCAC

GATACACCACAGGAAGGGCAGCTGGGAGCA3' 2RC 62 - 150 to 91 5' C:AGCTCACAGATGGTCAGGTTGTAGATGGA
~

CTGCAGCTGGGAGGAGGAGGAGGAGGAGGC3' 3RC 63 - 210 to 151 5' GAAGATCACGAAGGTCTCCACGGCCCAGTC

__ C;AAGTTC,'T'rGT'TC~'~GCC.'AGTCGGTGCCGTT3' 4RC 64 - 270 to 211 S' GGCGTCCAGGAAGTGG<~F.GGTGGTCAGGGC
' ' GCCGTAGGACACGATGTGGGTCAGCACGGG3' 5RC 65 - 330 to 2 S' GGAGGACAGCACGTAGC.'GGCCGTGGTAGTA

~' GCCGGCGGTGGAC~'1CGC.Z'(,ATCAGGCCCAC3' 6RC 66 - 390 to 331 5' GTTCTTGGTCAGG!'GGA'C(=ACGAAGCAGAT
~i C.'AGGG(.',GGCCAGGGCC;C'ACACGGCGTACAC3' 7RC 67 - 450 to 391 5' GCCCTTGGAGTCCAGCAGGAAGTTGGTGTA
;

GCGGGTACAGGAGTAGCGCCAGGACATGCA3' 8RC 68 - 510 to _ S' GTCCACCTCCACC'rTGC'CGCCCTTCTCGAT

' __ GATCACGGGi,GAGCGCC'AGCGGTACAGCTT3' 9RC 69 - 570 to 511 5' GGTCAC.GGGGGTGGCGGCGGAGCCGTCCAG

CACCACGCGCTTCAGGTC'GATCAGGTGGCC3' lORC 70 - 611 to 5 5' ggccrgatcCT
7 AGGGGCC;ACACCACTGCTCG
I

_ (~CGGACACC'1'.C 3' a Positions are indicated according to the predesigned entire synthetic ORFS
sequence, A in the initiation codon being the +1 position.
° Upper cases refer to synthetic ORFS specific nucleotides. Lower cases refer to non-ORFS sequence-extra nucleotides containing BamHI restriction site. Start and stop codons are underlined.

Sequence Listing (1) GENERAL INFORMATION:
(I)APPLICANT: Institut national de la Recherche Scientific Dea, Serge (ii) TITLE OF INVENTION: Synthetic Genes Encoding Proteins Of Porcine Reproductive And Respiratory Syndrome Virus And Use Thereof (iii) NUMBER OF SEQUENCES: 72 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: MBM & C0.
(B) STREET: P.O. BOX 809, STATION B
(C) CITY: OTTAWA
(D) PROVINCE: ONTARIO
(E) COUNTRY: CANADA
(F) POSTAL CODE: K1P 5P9 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: Windows (D) SOFTWARE: Word (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: N/A
(B) FILING DATE: February 28, 2002 (C) CLASSIFICATION.
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SWAIN, Margaret (B) REGISTRATION NUMBER: 10926 (C) REFERENCE/DOCKET NUMBER: 255-130 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 613/567-0762 (B) TELEFAX: 613/563-7671 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: synORF5 encoding GP5 of PRRSV strain IAF-Klop (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

AAG

MetLeuGlyLysCys LeuThrAla GlyCysCys PheGlnLeu ProPhe LeuTrpCysIleVal ProPheCys PheAlaAla LeuValAsn AlaSer SerSerSerSerSer GlnLeuGln SerIleTyr AsnLeuThr IleCys GluLeuAsnGlyThr AspTrpLeu AsnLysAsn PheAspTrp ProVal GluThrPheValIle PheProVal LeuThrHis IleValSer TyrGly AlaLeuThrThrSer HisPheLeu AspAlaVal GlyLeuIle ThrVal SerThrAlaGlyTyr TyrHisGly ProTyrVal LeuSerSer ValTyr AlaValCysAlaLeu AlaAlaLeu IleCysPhe ValIleArg LeuThr LysAsnCysMetSer TrpArgTyr SerCysThr ArgTyrThr AsnPhe LeuLeuAspSerLys GlyLysLeu TyrArgTrp ArgSerPro ValIle IleGluLysGlyGly LysValGlu ValAspGly HisLeuIle AspLeu LysArgValValLeu AspGlySer AlaAlaThr ProValThr LysVal SerAlaGluGlnTrp CysArgPro 2) INFORMATION
FOR
SEQ
ID
N0:2:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(D) OTHER INFORMATION:SynORFS of PRRSV strain IAF-Klop (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Phe Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Pro Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Pro Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1563 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM:Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: wtORF5 encoding GP5 of PRRSV
strain IAF-Klop GENBank accession #U64928 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro 2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(D) OTHER INFORMATION: wtORF5 forward primer (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(D) OTHER INFORMATION: synORFS forward primer (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:

(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(D) OTHER INFORMATION: ORF5 reverse primer (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:

(2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 620 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
{A) NAME/KEY:CDS
(B) LOCATION: (10)...(612) (D) OTHER INFORMATION: synORFS encoding GP5 of PRRSV strain IAF-94-287 (Figure 1) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Phe Gln Leu Pro Phe Leu Trp Cys Met Val Pro Phe Cys Leu Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Met Asn Leu Thr Met Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Leu Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys His Pro 2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:199 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(D) OTHER INFORMATION: synORFS of PRRSV strain IAF-KLOP
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Phe Gln Leu Pro Phe Leu Trp Cys Met Val Pro Phe Cys Leu Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Met Asn Leu Thr Met Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Leu Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys His Pro (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE
CHARACTERISTICS:

(A) LENGTH: basepairs (B) TYPE:Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii)MOLECULE DNA
TYPE:

(vi)ORIGINAL
SOURCE:

(A) ORGANISM:Sus scrofa (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION: (1)...(603) (D) OTHERINFORMATION : ORF encoding GP5 of PRRSV
wt strain IAF-BAJ Accession GenBank #

(xi)SEQUENCE SEQID
DESCRIPTION: NO;10:

TGC

MetLeu Gly Lys Leu ThrAlaGlyCys CysSerGln LeuProPhe Cys GTG

LeuTrp Cys Ile Pro PheCysPheAla AlaLeuVal AsnAlaSer Val TCC

AsnAsn Ser Ser Gln LeuGlnSerIle TyrAsnLeu ThrIleCys Ser ACA

GluLeu Asn Gly Asp TrpLeuAsnLys AsnPheAsp TrpAlaVal Thr ATC

GluThr Phe Val Phe ProValLeuThr HisIleVal SerTyrGly Ile AGC

AlaLeu Thr Thr His PheLeuAspThr ValGlyLeu IleThrVal Ser TAT

SerThr Ala Gly Tyr HisGlyArgTyr ValLeuSer SerValTyr Tyr TTG

AlaVal Cys Ala Ala AlaLeuIleCys PheValIle ArgLeuThr Leu TCC

LysAsn Cys Met Trp ArgTyrSerCys ThrArgTyr ThrAsnPhe Ser AAG

LeuLeu Asp Ser Gly LysLeuTyrArg TrpArgSer ProValIle Lys Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro 2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Asn Asn Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr 1~

Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1563base rs pai (B) TYPE: Nucleicacid (C) STRANDEDNESS:Single (D) TOPOLOGY: ear Lin (ii)MOLECULE TYPE:
DNA

(vi)ORIGINAL SOURCE:

(A) ORGANISM: scrofa Sus (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION: ...(603) (1) (D) OTHER INFORMATION: encoding PRRSV
wtORF5 GP5 strain of IAF-DESR GenBank cession 930 Ac #U64 (xi)SEQUENCE DESCRIPTION: ID
SEQ N0:12:

ACC GGC

MetLeu Gly Lys Cys Leu Val Tyr CysSerGln LeuProPhe Thr Gly TTC TTT

LeuTrp Cys Ile Val Pro Cys Ala AlaLeuVal AsnAlaSer Phe Phe TTA TTG

SerThr Ser Ser Ser His Gln Ile TyrAsnLeu ThrIleCys Leu Leu TGG AAT

GluLeu Asn Gly Thr Asp Leu Glu LysPheAsp TrpAlaVal Trp Asn CCT TTG

GluThr Phe Val Ile Phe Val Thr HisIleVal SerTyrGly Pro Leu TTC GAC

AlaLeu Thr Thr Ser His Leu Thr ValGlyLeu ValThrVal Phe Asp CAT CGG

SerThr Ala Gly Tyr Tyr Gly Tyr ValLeuSer SerIleTyr His Arg Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Val Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Val Glu Lys Arg Gly Lys Val Glu Val Gly Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro 2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: 5EQ ID N0:13:
Met Leu GIy Lys Cys Leu Thr Val Gly Tyr Cys Ser GIn Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Thr Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Glu Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Val Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Val Glu Lys Arg Gly Lys Val Glu Val Gly Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1566 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1) ... (603) (D) OTHER INFORMATION: wtORF5 encoding GP5 of PRRSV strain IAF-653 GenBank Accession #U64931 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Val Ala Leu Val Asn Ala Asn Thr Asp Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Asp Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Ala Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Arg Gln Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val Ser Ala Glu Arg Trp Gly Arg Pro 2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Val Ala Leu Val Asn Ala Asn Thr Asp Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Asp Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ile Thr Val Ser Thr Ala GIy Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Ala Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Arg Gln Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val Ser Ala Glu Arg Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1563 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: wtORFS encoding GP5 of PRRSV strain IAF-93-2616 GenBank Accession #U64932 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Pro Phe IS

Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Asn Ser Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asp Lys Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Tle Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu VaI Glu Gly Gln Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Ile Thr Lys Val Ser Ala Glu Gln Trp Gly Arg Pro 2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Asn Ser Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asp Lys Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly Gln Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Ile Thr Lys Val Ser Ala Glu Gln Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1563 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
l~

(vi) ORIGINAL SOURCE:
(A) Sus scrofa ORGANISM:

(ix)FEATURE:

(A) NAME/KEY:CDS

(B) (1) ...(603) LOCATION:

(D) INFORMATION :wtORF5 encoding GP5 of OTHER PRRSV
strain IAF-94- 3182GenBank Acc ession #U64933 (xi)SEQUENCE SEQID :
DESCRIPTION: N0:18 MetLeuGly LysCysLeuThr AlaGlyCys CysSerArg LeuProPhe LeuTrpCys IleValProPhe CysPheAla ValLeuVal AsnAlaSer ProAsnSer SerSerHisLeu GlnLeuIle TyrAsnLeu ThrIleCys GluLeuAsn GlyThrAspTrp LeuAsnAla ArgPheAsp TrpAlaVaI

GluThrPhe ValIlePhePro ValValThr HisIleVal SerTyrGly AlaLeuThr ThrSerHisPhe LeuAspThr ValGlyLeu ValThrVal SerThrAla GlyTyrTyrHis GlyArgTyr ValLeuSer SerIleTyr GCTGTCTGT GCCCTAGCTGCG TTGATTTGC TTCGTCATT AGGTTGgcg 384 AlaValCys AlaLeuAlaAla LeuIleCys PheValIle ArgLeuAla LysAsnCys MetSerTrpArg TyrSerCys ThrArgTyr ThrAsnPhe LeuLeuAsp ThrLysGlyLys LeuTyrArg TrpArgSer ProValIle IleGluLys ArgGlyLysVal GluValGlu GlyHisLeu IleAspLeu LysArgVal ValLeuAspGly SerAlaAla ThrProVal ThrArgVal CCATGACAGC

SerAlaGlu GlnTrpCysArg Pro 2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Val Leu Val Asn Ala Ser Pro Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr IIe Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Ala Arg Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Val Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:20:
(i)SEQUENCE
CHARACTERISTICS:

(A) LENGTH: pairs 1563 base (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii)MOLECULE DNA
TYPE:

(vi)ORIGINAL
SOURCE:

(A) ORGANISM:Sus scrofa (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION: (1) ...(603) (D) OTHER INFORMATION: wtORFS encodingGP5of PRRSV
strain IAF-94-287 Accession #U6 4934 GenBank (xi)SEQUENCE ID
DESCRIPTION: N0:20:
SEQ

TGC

MetLeuGly Lys LeuThr AlaGlyCys CysSer GlnLeuProPhe Cys GTG

LeuTrpCys Ile ProPhe CysPheAla AlaLeu ValAsnAlaSer Val TCC

AsnAsnSer Ser HisLeu GlnLeuIle TyrAsn LeuThrIleCys Ser ACA

GluLeuAsn Gly AspTrp LeuAsnAsp LysPhe AspTrpAlaVal Thr ATT

GluThrPhe Val PhePro ValLeuThr HisIle ValSerTyrGly Ile AGC

AlaLeuThr Thr HisPhe LeuAspThr ValGly LeuIleThrVal Ser TAT

SerThrAla Gly TyrHis GlyArgTyr ValLeu SerSerIleTyr Tyr CTG

AlaValCys Ala AlaAla LeuIleCys PheVal IleArgLeuAla Leu TCC

LysAsnCys Met TrpArg TyrSerCys ThrArg TyrThrAsnPhe Ser AAG

LeuLeuAsp Thr GlyArg LeuTyrArg TrpArg SerProValIle Lys Ile Glu Lys Lys Gly Lys Val Glu Val Glu Gly Gln Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro 2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Asn Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Asp Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Lys Gly Lys Val Glu Val Glu Gly Gln Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1563base rs pai {B) TYPE: Nucleicacid (C) STRANDEDNESS:Single (D) TOPOLOGY:
Linear (ii)MOLECULE TYPE:
DNA

(vi)ORIGINAL SOURCE:

(A) ORGANISM:Susscrofa (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION: ...(603) (1) (D) OTHER INFORMATION: ORFSencoding PRRSV
wt GP5 strain of ONT-TS GenBank ssion Acce #U64935 (xi)SEQUENCE DESCRIPTION: ID
SEQ N0:22:

ACC GGC

MetLeu Gly Lys Cys Leu Ala Cys CysSerGln LeuLeuPhe Thr Gly TCC TTT

LeuTrp Cys Ile Val Pro Trp Val AlaLeuVal SerAlaSer Ser Phe TTA TTG

AsnSer Ser Ser Ser His Gln Ile TyrAsnLeu ThrLeuCys Leu Leu TGG GCC

GluLeu Asn Gly Thr Asp Leu Asp LysPheAsp TrpAlaVal Trp Ala CCC TTA

GluThr Phe Val Ile Phe Val Thr HisIleVal SerTyrGly Pro Leu TTC GAC

AlaLeu Thr Thr Ser His Leu Thr ValGlyLeu ValThrVal Phe Asp CAC CGG

SerThr Ala Gly Phe His Gly Tyr ValLeuSer SerIleTyr His Arg Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro 2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Leu Phe Leu Trp Cys Ile Val Pro Ser Trp Phe Val Ala Leu Val Ser Ala Ser Asn Ser Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Asp Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr Val Ser Thr Ala Gly Phe His His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: wtORF5 encoding the GP5 of PRRSV
strain IAF-CM GenBank Accession #AF013106 (ix) FEATURE:
(A) NAME/KEY:misc feature (B) LOCATION: 106 (C) Xaa = Ser or Tyr (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys AAT AAT

GluLeuAsn GlyThrAsp TrpLeuAsn LysAsnPheAsp TrpAlaVal GluThrPhe ValIlePhe ProValLeu ThrHisIleVal SerTyrGly AlaLeuThr ThrSerHis PheLeuAsp AlaValGlyLeu IleThrVal SerThrAla GlyTyrTyr HisGlyArg XaaValLeuSer SerValTyr AlaValCys AlaLeuAla AlaLeuIle CysPheValIle ArgLeuThr LysAsnCys MetSerTrp ArgTyrSer CysThrArgTyr ThrAsnPhe LeuLeuAsp SerLysGly LysLeuTyr ArgTrpArgSer ProValIle IleGluLys GlyGIyLys ValGluVal AspGlyHisLeu IleAspLeu LysArgVal ValLeuAsp GlySerAla AlaThrProVal ThrLysVal SerAlaGlu GlnTrpCys ArgPro 2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(C) Xaa = Ser or Tyr (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Xaa Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15411 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM:Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (13788)...(14390) (D) OTHER INFORMATION: wtORF5 encoding GP5 of PRRSV strain VR-2332 GenBank Accession #U87392 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:

CGTGCGACCA GGTCGTCACT TATCGACCTG TGCGATCGGT 'L'TTGTGCGCC AAAAGGAATG 4500 7g Met Leu Glu LysCysLeuThr AlaGlyCys CysSerArg LeuLeuSerLeu TrpCys IleValProPhe CysPheAla ValLeuAla AsnAlaSerAsn AspSer SerSerHisLeu GlnLeuIle TyrAsnLeu ThrLeuCysGlu LeuAsn GlyThrAspTrp LeuAlaAsn LysPheAsp TrpAlaValGlu SerPhe ValIlePhePro ValLeuThr HisIleVal SerTyrGlyAla LeuThr ThrSerHisPhe LeuAspThr ValAlaLeu ValThrValSer ThrAla Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Thr Cys Phe Val Ile Arg Phe Ala Lys Asn Cys Met Ser Trp Arg Tyr Ala Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro 2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
Met Leu Glu Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Leu Ser Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Val Leu Ala Asn Ala Ser Asn Asp Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Asn Lys Phe Asp Trp Ala Val Glu Ser Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Ala Leu Val Thr Val Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Thr Cys Phe Val Ile Arg Phe Ala Lys Asn Cys Met Ser Trp Arg Tyr Ala Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15411 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM:Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (12073)...(12843) (D) OTHER INFORMATION: wtORF2 of PRRSV strain VR-2332 GenBank Accession #U87392 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:

Met Lys Trp Gly Pro Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe Leu Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg Ala Leu Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu Ala Phe Leu Ser Gln Cys Gln Val Asp Ile Pro Thr Trp Gly Thr Lys His Pro Leu Gly Met Leu Trp His His Lys Val Ser Thr Leu Ile Asp Glu Met Val Ser Arg Arg Met Tyr Arg Ile Met Glu Lys Ala Gly Gln Ala Ala Trp Lys Gln Val Val Ser Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val Val Ala His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Gln Val Phe Ala Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His Asp Phe Gln Gln Trp Leu Ile Ala Val His Ser Ser Ile Phe Ser Ser Val Ala Ala Ser Cys Thr Leu Phe Val Val Leu Trp Leu Arg Val Pro Ile Leu Arg Thr Val Phe Gly Phe Arg Trp Leu Gly Ala Ile Phe Leu Ser Asn Ser Gln 2) INFORMATION FOR SEQ TD N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:256 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:
Met Lys Trp Gly Pro Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe Leu Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg Ala Leu Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu Ala Phe Leu Ser Gln Cys Gln Val Asp Ile Pro Thr Trp Gly Thr Lys His Pro Leu Gly Met Leu Trp His His Lys Val Ser Thr Leu Ile Asp Glu Met Val Ser Arg Arg Met Tyr Arg Ile Met Glu Lys Ala Gly Gln Ala Ala Trp Lys Gln Val Val Ser Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val Val Ala His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Gln Val Phe Ala Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His Asp Phe Gln Gln Trp Leu Ile Ala Val His Ser Ser Ile Phe Ser Ser Val Ala Ala Ser Cys Thr Leu Phe Val Val Leu Trp Leu Arg Val Pro Ile Leu Arg Thr Val Phe Gly Phe Arg Trp Leu Gly Ala Ile Phe Leu Ser Asn Ser Gln (2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15411 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM:Sus scrofa (1x) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (13241)...(13777) (D) OTHER INFORMATION: wt0RF4 of PRRSV strain VR-2332 GenBank Accession #U87392 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
4t Met Ala Ser Ser Leu LeuPheLeu ValValGlyPhe LysCysLeu LeuValSerGln AlaPhe AlaCysLys ProCysPheSer SerSerLeu AlaAspIleLys ThrAsn ThrThrAla AlaAlaSerPhe AlaValLeu GlnAspIleSer CysLeu ArgHisArg AspSerAIaSer GluAlaIle ArgLysIlePro GlnCys ArgThrAla IleGlyThrPro ValTyrVal ThrIleThrAla AsnVal AAT

ThrAspGlu AsnTyrLeu HisSerSer AspLeuLeu MetLeuSer 5er CysLeuPhe TyrAlaSer GluMetSer GluLysGly PheLysVal Val PheGlyAsn ValSerGly IleValAla ValCysVal AsnPheThr Ser TyrValGln HisValLys GluPheThr GlnArgSer LeuValVal Asp HisValArg LeuLeuHis PheMetThr ProGluThr MetArgTrp Ala ThrValLeu AlaCysLeu PheAlaIle LeuLeuAla Ile 2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:178 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:
Met Ala Ser Ser Leu Leu Phe Leu Val Val Gly Phe Lys Cys Leu Leu Val Ser GIn Ala Phe Ala Cys Lys Pro Cys Phe Ser Ser Ser Leu Ala Asp Ile Lys Thr Asn Thr Thr Ala Ala Ala Ser Phe Ala Val Leu Gln Asp Ile Ser Cys Leu Arg His Arg Asp Ser Ala Ser Glu Ala Ile Arg Lys Ile Pro Gln Cys Arg Thr Ala Ile Gly Thr Pro Val Tyr Val Thr Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp Leu Leu Met Leu Ser Ser Cys Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys Gly Phe Lys Val Val Phe Gly Asn Val Ser Gly Ile Val Ala Val Cys Val Asn Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg Ser Leu Val Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu Ala Ile (2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: wtORFS of PRRSV strain 98-37120-2 GenBank Accession #AF339499 (ix) FEATURE:
(A) NAME/KEY:Misc feature (B1 LOCATION: (0) . . . (0) (D) OTHER INFORMATION: n = a, t, g,or c (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:

Met Leu Glu Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe LeuTrpCys IleVal ProPheCysPhe AlaValLeu ValAspAla Ser AsnAsnAsn SerSer HisLeuGlnLeu IleTyrAsn LeuThrLeu Cys GluLeuAsn GlyThr AspTrpLeuAla GluLysPhe AspTrpAla Val GluSerPhe ValIle PheProValLeu ThrHisIle ValSerTyr Gly AlaLeuThr ThrSer HisPheLeuAsp ThrValAla LeuValThr Val SerThrAla GlyPhe ValHisGlyArg TyrValLeu SerSerIle Tyr AlaValCys AlaLeu AlaAlaLeuThr CysPheVal IleArgPhe Ala LysAsnCys MetSer TrpArgTyrAla CysThrArg TyrThrAsn Phe LeuLeuAsp ThrLys GlyArgLeuTyr ArgTrpArg SerProVal Ile IleGluLys ArgGly LysValGluVal GluGlyHis LeuIleAsp Leu LysArgVal ValLeu AspGlySerVal AlaThrPro IleThrArg Val SerAlaGlu GlnTrp GlyArgPro 2) INFORMATION FOR SEQ ID N0:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:33:

Met Leu Glu Lys Cys Leu Thr Ala Gly Cys Cys Sex Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Val Leu Val Asp Ala Ser Asn Asn Asn Ser Ser His Leu Gln Leu IIe Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Glu Lys Phe Asp Trp Ala Val Glu Ser Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Ala Leu Val Thr Val Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Thr Cys Phe Val Ile Arg Phe Ala Lys Asn Cys Met Ser Trp Arg Tyr Ala Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Gly Arg Pro (2) INFORMATION FOR SEQ ID N0:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2050 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM:Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (426)...(1028) (D) OTHER INFORMATION: wtORF5 of PRRSV strain VR-2385 GenBank Accession #U03040 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:34:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Leu Phe Leu Trp Cys Ile Val Pro Ser Cys Phe Val Ala Leu Val Ser Ala Asn Gly Asn Ser Gly Ser Asn Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Asn Lys Phe Asp Trp Ala Val Glu Cys Phe Val Tle Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr Val Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Met Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val Ser Ala Glu Gln Trp Ser Arg Pro 2) INFORMATION FOR SEQ ID N0:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:35:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Leu Phe Leu Trp Cys Ile Val Pro Ser Cys Phe Val Ala Leu Val Ser Ala Asn Gly Asn Ser Gly Ser Asn Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Asn Lys Phe Asp Trp Ala Val Glu Cys Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr Val Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Met Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg val Ser Ala Glu Gln Trp Ser Arg Pro (2) INFORMATION FOR SEQ ID N0:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (1i) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: wtROF5 of PRRSV strain 98-5579-1 GenBank Accession #AF339500 (xij SEQUENCE DESCRIPTION: SEQ ID N0:36:

MetLeuGly ArgCysLeu ThrAlaGlyTyr CysSerArg LeuLeuSer LeuTrpCys IleValPro PheTrpPheAla ValLeuVal AsnAlaAsn SerAsnSex SerSerHis PheGlnLeuIle TyrAsnLeu ThrLeuCys GluLeuAsn GlyThrAsp TrpLeuAlaGlu LysPheAsp TrpAlaVal GluThrPhe ValIlePhe ProValLeuThr HisIleVal SerTyrGly AlaLeuThr ThrSerHis PheLeuAspThr ValGlyLeu AlaThrVal SerThrAla GlyPheTyr HisArgArgTyr ValLeuSer SerIleTyr GCTGTCTGT GCTCTGGCT GCGTTGATTTGC TTCGTTATC AGGTTTgcg 384 AlaValCys AlaLeuAla AlaLeuIleCys PheValIle ArgPheAla AAGAACTGC ATGTCCTGG CGCTACTCATGT ACCAGATAC ACCAACttc 432 LysAsnCys MetSerTrp ArgTyrSerCys ThrArgTyr ThrAsnPhe LeuLeuAsp ThrLysGly ArgLeuTyrArg TrpArgSer ProValIle IleGluLys GlyGlyLys ValGluValGlu GlyHisLeu IleAspLeu LysArgVal ValLeuAsp GlySerValAla ThrProLeu ThrArgVal SerAlaGlu GlnTrpCys ArgPro 2) INFORMATION
FOR
SEQ
ID
N0:37:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (Bj TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:37:
Met Leu Gly Arg Cys Leu Thr Ala Gly Tyr Cys Ser Arg Leu Leu Ser Leu Trp Cys Ile Val Pro Phe Trp Phe Ala Val Leu Val Asn Ala Asn Ser Asn Ser Ser Ser His Phe Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Glu Lys Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Ala Thr Val Ser Thr Ala Gly Phe Tyr His Arg Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Phe Ala Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Leu Thr Arg Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM:Sus scrota (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: wtORFS of PRRSV strain PRRSV57 GenBank Accession #AF176477 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:38:

Met Leu Glu Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Leu Ser $~

Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Ala Asn Ala Ser Asn Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Asp Asn Phe Asp Trp Ala Val Glu Ser Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr GIy Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Ala Leu Val Thr Val Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Thr Cys Phe Val Ile Arg Phe Ala Lys Asn Cys Met Ser Trp Arg Tyr Ala Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile G1u Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Asp Arg Pro 2) INFORMATION FOR SEQ ID N0:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:39:

Met Leu Glu Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Leu Ser Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Ala Asn Ala Ser Asn Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys Glu Leu Asn Gly Thr Asp Trp Leu Ala Asp Asn Phe Asp Trp Ala Val Glu Ser Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Ala Leu Val Thr Val Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala Val Cys Ala Leu Ala Ala Leu Thr Cys Phe Val Ile Arg Phe Ala Lys Asn Cys Met Ser Trp Arg Tyr Ala Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val Ser Ala Glu Gln Trp Asp Arg Pro (2) INFORMATION FOR SEQ ID N0:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: synORF5 variant of IAF-Klop (Figure 8) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:40:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Tyr AAC AAC AAC

GluLeuAsnGly ThrAspTrp LeuAsnLys AsnPheAspTrp SerVal GluThrPheVal IlePhePro ValLeuThr HisIleValSer TyrGly AlaLeuThrThr SerHisPhe LeuAspAla ValGlyLeuIle ThrVal SerThrAlaGly TyrTyrHis GlyArgTyr ValLeuSerSer ValTyr AlaValCysAla LeuAlaAla LeuIleCys PheValIleArg LeuThr LysAsnCysMet SerTrpArg TyrSerCys ThrArgTyrThr AsnPhe LeuLeuAspSer LysGlyLys LeuTyrArg LeuArgSerPro ValIle IleGluLysGly GlyLysVal GluValAsp GlyHisLeuIle AspLeu LysArgValVal LeuAspAla SerAlaAla ThrProValThr LysVal SerAlaGluGln TrpCysArg Pro (2) INFORMATION FOR SEQ ID N0:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 200 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Single (D) TOPOLOGY:
(ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:41:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Tyr Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Ser Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Leu Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Ala Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro (2) INFORMATION FOR SEQ ID N0:42:
(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 537 base pairs (B) TYPE: Nucleicacid (C) STRANDEDNESS:Single (D) TOPOLOGY:
Linear (ii)MOLECULE TYPE:
DNA

(vi)ORIGINAL SOURCE:

(A) ORGANISM: scrofa Sus (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION: ...(537) (1) (D) OTHER INFORMATION: of IAF-Klop (GenBank wtORF4 #AF003345) (xi)SEQUENCE
DESCRIPTION:
SEQ
ID
N0:42:

TTC TTG

MetAlaAla Ser Leu Leu Leu Val GlyPheGluArg LeuLeu Phe Leu TGC CCA

ValSerGln Ala Phe Ala Lys Cys PheSerSerSer LeuSer Cys Pro ACC GCA

AspIleGlu Thr Asn Thr Thr Ala SerSerValVal LeuGln Thr Ala CAT TAC

AspIleSer Cys Leu Arg Gly Ser SerSerGluThr IleArg His Tyr ACG ATA

LysIlePro Gln Cys Arg Ala Gly ThrProValTyr IleThr Thr Ile Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp Leu LeuMetLeu SerSerCysLeu PheTyrAla SexGluMet SerGluLys GlyPheLys ValIlePheGly AsnValSer GlyIleVal SerValCys ValAsnPhe ThrSerTyrVal GlnHisVal LysGluPhe ThrGlnArg SerLeuIle ValAspHisVal ArgLeuLeu HisPheMet ThrProGlu ThrMetArg TrpAlaThrVal LeuAlaCys LeuPheAla IleLeuLeu AlaIIe (2) INFORMATION FOR SEQ ID N0:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 178 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Single (D) TOPOLOGY:
(ii) MOLECULE TYPE: Protien (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4~:
Met Ala Ala Ser Leu Leu Phe Leu Leu Val Gly Phe Glu Arg Leu Leu Val Ser GIn Ala Phe AIa Cys Lys Pro Cys Phe Ser Ser Ser Leu Ser Asp Ile Glu Thr Asn Thr Thr Thr Ala Ala Ser Ser Val Val Leu Gln Asp Ile Ser Cys Leu Arg His Gly Tyr Ser Ser Ser Glu Thr Ile Arg Lys Ile Pro Gln Cys Arg Thr Ala Ile Gly Thr Pro Val Tyr Ile Thr Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp Leu Leu Met Leu Ser Ser Cys Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys Gly Phe Lys Val Ile Phe Gly Asn Val Ser Gly Ile Val Ser Val Cys Val Asn Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg Ser Leu Ile Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu Ala Ile (2) INFORMATION FOR SEQ ID N0:44:
(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 37 pairs 5 base (B) TYPE: leicaci d Nuc (C) STRANDEDNESS: Sin gle (D) TOPOLOGY:Linear (ii)MOLECULE TYPE:DNA

(vi)ORIGINAL SOURCE:

(A) ORGANISM:Susscrofa (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION:(1)...(537) (D) OTHER : IAF-Klop INFORMATION synORF4 of (xi)SEQUENCE ID :
DESCRIPTION: N0:44 SEQ

CTG

MetAlaAla Ser Leu PheLeu LeuValGly PheGluArg LeuLeu Leu GCC

ValSerGln Ala Phe CysLys ProCysPhe SerSerSer LeuSer Ala ACC

AspIleGlu Thr Asn ThrThr AlaAlaSer SerValVal LeuGln Thr CGC

AspIleSer Cys Leu HisGly TyrSerSer SerGluThr IleArg Arg CGC

LysIlePro Gln Cys ThrAla IleGlyThr ProValTyr IleThr Arg ACC

IleThrAla Asn Val AspGlu AsnTyrLeu HisSerSer AspLeu Thr TGC

LeuMetLeu Ser Ser LeuPhe TyrAlaSer GluMetSer GluLys Cys TTT

GlyPheLys Val Ile GlyAsn ValSerGly IleValSer ValCys Phe TAC

Val Asn Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg Ser Leu Ile Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu Ala Ile (2) INFORMATION FOR SEQ ID N0:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 178 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:45:
Met Ala Ala Ser Leu Leu Phe Leu Leu Val Gly Phe Glu Arg Leu Leu Val Ser Gln Ala Phe Ala Cys Lys Pro Cys Phe Ser Ser Ser Leu Ser Asp Ile Glu Thr Asn Thr Thr Thr Ala Ala Ser Ser Val Val Leu Gln Asp Ile Ser Cys Leu Arg His Gly Tyr Ser Ser Ser Glu Thr Ile Arg Lys Ile Pro Gln Cys Arg Thr Ala Ile Gly Thr Pro Val Tyr Ile Thr Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp Leu Leu Met Leu Ser Ser Cys Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys Gly Phe Lys Val Ile Phe Gly Asn Val Ser Gly Ile Val Ser Val Cys Val Asn Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg Ser Leu Ile Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu Ala Ile (2) INFORMATION FOR SEQ ID N0:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 525 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii)MOLECULE DNA
TYPE:

(vi)ORIGINAL
SOURCE:

(A) ORGANISM: Susscrofa (ix)FEATURE:

(A) NAME/KEY:CDS

(B) LOCATION: (1)...(525) (D) OTHERINFORMATION : of IAF-Klop(GenBank wtORF6 #
U64928) (xi)SEQUENCE ID
DESCRIPTION: N0:46:
SEQ

CTA

MetVal Ser Ser Asp AspPheCysAsn AspSerThr AlaProGln Leu GCG

LysVal Leu Leu Phe SerIleThrTyr ThrProVal MetIleTyr Ala AGT

AlaLeu Lys Val Arg GlyArgLeuLeu GlyLeuLeu HisLeuLeu Ser TGT

IlePhe Leu Asn Ala PheThrPheGly TyrMetThr PheAlaHis Cys AAT

PheGln Ser Thr Lys ValAlaLeuThr MetGlyAla ValValAla Asn 65 70 75 $0 GTG

LeuLeu Trp Gly Tyr SerAlaIleGlu ThrTrpLys PheIleThr Val TTG

SerArg Cys Arg Cys LeuLeuGlyArg LysTyrIle LeuAlaPro Leu GAG

AlaHis His Val Ser AlaAlaGlyPhe HisProIle AlaAlaSer Glu TTT

AspAsn His Ala Val ValArgArgPro GlySexThr ThrValAsn Phe CCC

GlyThr Leu Val Gly LeuLysSerLeu ValLeuGly GlyArgLys Pro GGA

AlaVal Lys Arg Val ValAsnLeuVal LysTyrAla Lys Gly S$

(2) INFORMATION FOR SEQ ID N0:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 174 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:47:
Met Val Ser Ser Leu Asp Asp Phe Cys Asn Asp Ser Thr Ala Pro Gln Lys Val Leu Leu Ala Phe Ser Ile Thr Tyr Thr Pro Val Met Ile Tyr Ala Leu Lys Val Ser Arg Gly Arg Leu Leu Gly Leu Leu His Leu Leu Ile Phe Leu Asn Cys Ala Phe Thr Phe Gly Tyr Met Thr Phe Ala His Phe Gln Ser Thr Asn Lys Val Ala Leu Thr Met Gly Ala Val Val Ala Leu Leu Trp Gly Val Tyr Ser Ala Ile Glu Thr Trp Lys Phe Ile Thr Ser Arg Cys Arg Leu Cys Leu Leu Gly Arg Lys Tyr Ile Leu Ala Pro Ala His His Val Glu Ser Ala Ala Gly Phe His Pro Ile Ala Ala Ser Asp Asn His Ala Phe Val Val Arg Arg Pro Gly Ser Thr Thr Val Asn Gly Thr Leu Val Pro Gly Leu Lys Ser Leu Val Leu Gly Gly Arg Lys Ala Val Lys Arg Gly Val Val Asn Leu Val Lys Tyr Ala Lys (2) INFORMATION FOR SEQ ID N0:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 525 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(525) (D) OTHER INFORMATION: synORF6 of IAF-Klop (xi) SEQUENCE DESCRIPTION: SEQ ID N0:48:

Met Val Ser Ser Leu Asp Asp Phe Cys Asn Asp Ser Thr Ala Pro Gln LysValLeu LeuAlaPheSer IleThrTyr ThrProValMet IleTyr AlaLeuLys ValSerArgGly ArgLeuLeu GlyLeuLeuHis LeuLeu IlePheLeu AsnCysAlaPhe ThrPheGly TyrMetThrPhe AlaHis PheGlnSer ThrAsnLysVal AlaLeuThr MetGlyAlaVal ValAla LeuLeuTrp GlyValTyrSer AlaIleGlu ThrTrpLysPhe IleThr SerArgCys ArgLeuCysLeu LeuGlyArg LysTyrIleLeu AlaPro AlaHisHis ValGluSerAla AlaGlyPhe HisProIleAla AlaSer AspAsnHis AlaPheValVal ArgArgPro GlySerThrThr ValAsn GlyThrLeu ValProGlyLeu LysSerLeu ValLeuGlyGly ArgLys AlaValLys ArgGlyValVal AsnLeuVal.LysTyrAlaLys (2)INFORMATION FORSEQID
N0:49:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 174 Amino acid (B) TYPE: amino acid (C) STRANDEDNESS: Single (D) TOPOLOGY:
(ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Sus scrofa (xi) SEQUENCE DESCRIPTION: SEQ ID N0:49:
Met Val Ser Ser Leu Asp Asp Phe Cys Asn Asp Ser Thr Ala Pro Gln Lys Val Leu Leu Ala Phe Ser Ile Thr Tyr Thr Pro Val Met Ile Tyr Ala Leu Lys Val Ser Arg Gly Arg Leu Leu Gly Leu Leu His Leu Leu Ile Phe Leu Asn Cys Ala Phe Thr Phe Gly Tyr Met Thr Phe Ala His Phe Gln Ser Thr Asn Lys Val Ala Leu Thr Met Gly Ala Val Val Ala Leu Leu Trp Gly Val Tyr Ser Ala Ile Glu Thr Trp Lys Phe Ile Thr Ser Arg Cys Arg Leu Cys Leu Leu Gly Arg Lys Tyr Tle Leu Ala Pro Ala His His Val Glu Ser Ala Ala Gly Phe His Pro Ile Ala Ala Ser Asp Asn His Ala Phe Val Val Arg Arg Pro Gly Ser Thr Thr Val Asn Gly Thr Leu Val Pro Gly Leu Lys Ser Leu Val Leu Gly Gly Arg Lys Ala Val Lys Arg Gly Val Val Asn Leu Val Lys Tyr Ala Lys (2) INFORMATION FOR SEQ ID N0:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 69 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 1 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:50:

(2) INFORMATION FOR SEQ ID N0:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 2 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:51:

(2) INFORMATION FOR SEQ ID N0:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 3 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:52:

(2) INFORMATION FOR SEQ ID N0:53:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 4 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:53:

(2) INFORMATION FOR SEQ ID N0:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 5 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:54:

(2) INFORMATION FOR SEQ ID N0:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 6 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:55:

(2) INFORMATION FOR SEQ ID N0:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 7 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:56:

(2) INFORMATION FOR SEQ ID N0:57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 8 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:57:

(2) INFORMATION FOR SEQ ID N0:58:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 9 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:58:

(2) INFORMATION FOR SEQ ID N0:59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 10 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:59:

(2) INFORMATION FOR SEQ ID N0:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 11RC

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:60:

(2) INFORMATION FOR SEQ ID N0:61:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 1RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:61:

(2) INFORMATION FOR SEQ ID N0:62:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 2RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:62:

(2) INFORMATION FOR SEQ ID N0:63:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:

(D) OTHER INFORMATION: oligonucleotide primer 3RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:63:

(2) INFORMATION FOR SEQ ID N0:64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 4RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:64:

(2) INFORMATION FOR SEQ ID N0:65:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 5RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:65:

(2) INFORMATION FOR SEQ ID N0:66:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 6RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:66:

(2) INFORMATION FOR SEQ ID N0:67:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 7RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:67:

(2) INFORMATION FOR SEQ ID N0:68:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer 8RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:68:

(2) INFORMATION FOR SEQ ID N0:69:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATTON: oligonucleotide primer 9RC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:69:

(2) INFORMATION FOR SEQ ID N0:70:
(i) SEQUENCE CHARACTERISTICS:
{A) LENGTH: 41 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(D) OTHER INFORMATION: oligonucleotide primer lORC
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:70:

(2) INFORMATION FOR SEQ ID N0:71:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial sequence (ix) FEATURE:
(A) NAME/KEY:CDS
(B) LOCATION: (1)...(603) (D) OTHER INFORMATION: synORFS variant2 of IAF-Klop strain of PRRSV
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:71:

Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser AAC

SerSerSer SerSerGln LeuGlnSer IleTyrAsnLeu ThrIleCys GluLeuAsn GlyThrAsp TrpLeuAsn LysAsnPheAsp TrpAlaVal GluThrPhe ValIlePhe ProValLeu ThrHisIleVal SerTyrGly AlaLeuThr ThrSerHis PheLeuAsp AlaValGlyLeu IleThrVal SerThrAla GlyTyrTyr HisGlyArg TyrValLeuSer SerValTyr AlaValCys AlaLeuAla AlaLeuIle CysPheValIle ArgLeuThr LysAsnCys MetSerTrp ArgTyrSer CysThrArgTyr ThrAsnPhe LeuLeuAsp SerLysGly LysLeuTyr ArgTrpArgSer ProValIle IleGluLys GlyGlyLys ValGluVal AspGlyHisLeu IleAspLeu LysArgVal ValLeuAsp GlySerAla AlaThrProVal ThrLysVal SerAlaGlu GlnTrpCys ArgPro 2) INFORMATION FOR SEQ ID N0:72:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:200 amino acids (B) TYPE: Amino Acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence (ix) FEATURE:
(D) OTHER INFORMATION: synORF5 variant2 of IAF-Klop strain of PRRSV

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:72:
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Pro Phe Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Ala Leu Val Asn Ala Ser Ser Ser Ser Ser Ser Gln Leu Gln Ser Ile Tyr Asn Leu Thr Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu Asn Lys Asn Phe Asp Trp Ala Val Glu Thr Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly Ala Leu Thr Thr Ser His Phe Leu Asp Ala Val Gly Leu Ile Thr Val Ser Thr Ala Gly Tyr Tyr His Gly Arg Tyr Val Leu Ser Ser Val Tyr Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe Val Ile Arg Leu Thr Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu Leu Asp Ser Lys Gly Lys Leu Tyr Arg Trp Arg Ser Pro Val Ile Ile Glu Lys Gly Gly Lys Val Glu Val Asp Gly His Leu Ile Asp Leu Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Lys Val Ser Ala Glu Gln Trp Cys Arg Pro

Claims (40)

1. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes the amino acid sequence of a porcine reproductive and respiratory syndrome virus (PRRSV) polypeptide, said nucleotide sequence having at least one non-preferred codon replaced by a preferred codon.
2. The nucleic acid molecule according to claim 1, wherein all of the non-preferred codons of the nucleotide sequence have been replaced by preferred codons.
3. The nucleic acid molecule according to claim 1, wherein at least about 75%
of the non-preferred codons of the nucleotide sequence have been replaced by preferred codons.
4. The nucleic acid molecule according to claim 1, wherein at least about 50%
of the non-preferred codons of the nucleotide sequence have been replaced by preferred codons.
5. The nucleic acid molecule according to any one of claims 1-4, wherein the nucleotide sequence encodes an amino acid sequence of a modified PRRSV polypeptide.
6. The nucleic acid molecule according to any one of claims 1-4, wherein the nucleotide sequence encodes a fragment of an amino acid sequence of a PRRSV polypeptide.
7. The nucleic acid molecule according to any one of claims 1-4 wherein the nucleotide sequence encodes the amino acid sequence set forth in SEQ ID NO: 4, 41, 43 or 47 or a fragment thereof.
8. The nucleic acid molecule according to any one of claims 1-4, wherein the nucleotide sequence comprises the polynucleotide sequence set forth in SEQ ID NO: 1, 40, 44 or 48, or a fragment thereof.
9. The nucleic acid molecule according to any one of claims 1-8, operatively associated with expression control sequences allowing expression of the nucleotide sequence in prokaryotic or eukaryotic host cells.
10. A vector comprising the nucleic acid molecule of any one of claims 1 - 9.
11. The vector according to claim 10, wherein the vector is a replication-defective adenoviral vector.
12. The vector according to claim 10, wherein the vector is a replication-competent, dissemination-defective adenoviral vector.
13. The vector according to claim 10, further comprising a nucleotide sequence which encodes a second polypeptide or fragment thereof.
14. The vector according to claim 13, wherein said second polypeptide is an immunologically active polypeptide.
15. The vector according to claim 14, wherein said immunologically active polypeptide is a PRRSV polypeptide.
16. A host cell genetically engineered with the nucleic acid molecule according to any one of claims 1-9, or with the vector according to any one of claims 10-15.
17. A host cell comprising the nucleic acid molecule according to any one of claims 1-9 operatively associated with a heterologous regulatory control sequence that controls gene expression.
18. A process for producing a host cell capable of expressing a PRRSV
polypeptide or fragment thereof, comprising genetically engineering said cell with the nucleic acid molecule according to any one of claims 1-9, or with the vector according to any one of claims 10-15.
19. A process for producing a host cell capable of expressing a PRRSV
polypeptide or fragment thereof, comprising genetically engineering said cell with the nucleic acid molecule according to any one of claims 5 or 6.
20. A host cell produced by the process according to claim 18 or 19.
21. A process for producing a PRRSV polypeptide or a fragment thereof, comprising culturing the host cell according to any one of claims 16, 17 or 20, and recovering the polypeptide encoded by the nucleotide sequence from the culture.
22. An isolated polypeptide having an amino acid sequence encoded by the nucleic acid molecule according to any one of claims 5 or 6, or produced by the process according to claim 19.
23. Use of a nucleic acid molecule according to any one of claims 1-9, or a vector according to any one of claims 10-15. in the preparation of a composition.
24. A composition, comprising the nucleic acid molecule according to any one of claims 1-9, or of the vector according to any one of claims 10-15, and a carrier or adjuvant.
25. The composition according to claim 24, further comprising a nucleotide sequence which encodes a second polypeptide or fragment thereof.
26. The composition according to claim 25, wherein said second polypeptide is an immunologically active polypeptide
27. The composition according to claim 26, wherein said immunologically active polypeptide is a PRRSV polypeptide.
28. A kit, comprising the composition according to any one of claims 24-27, and a storage container suitable for containing said composition.
29. Use of the composition according to any one of claims 24-27, for the immunization of a pig in need thereof.
30. The use according to claim 29, wherein said immunization comprises an initial inoculation and the single or multiple booster inoculations to the pig.
31. A method of making antibodies against one or more PRRSV proteins comprising:
administering to an animal the nucleic acid molecule according to any one of claims 1-9 or the vector according to any one of claims 10-15, or the composition according to any one of claims 24-27, collecting at least one blood sample at a suitable times post-administration, and isolating a serum fraction containing antibodies against one or more PRRSV proteins.
32. Antibodies prepared by the method of claim 31.
33. The antibody according to claim 32, which is polyclonal, monoclonal, chimeric, a single chain, a human antibody, a humanized antibody or a Fab fragment.
34. An isolated serum composition suitable for the immunization of a pig against PRRSV, comprising an effective amount of semi-purified blood serum obtained from an animal inoculated with the composition according to any one of claims 24-27.
35. Use of the serum according to claim 34 to immunize a pig in need thereof.
36. A kit for detecting in a sample an antibody that specifically recognizes a PRRSV
polypeptide or an antigenic fragment thereof, comprising the nucleic acid molecule according to any one of claims 1-9, or the vector according to any one of claims 10-15, or the host cell of any one of claims 16, 17 or 20, which is capable of expressing one or more PRRSV polypeptides and/or one or more antigenic fragments thereof.
37. A diagnostic composition comprising the nucleic acid molecule according to any one of claims 1-9, or the vector according to any one of claims 10-15 and optionally a diluent or carrier.
38. A primer capable of specifically hybridizing the nucleic acid molecule according to any one of claims 1-9.
39. A method for detecting in a sample obtained from a pig, the presence of the nucleic acid molecule according to any one of claims 1-9, or a portion thereof, comprising:

(a) obtaining a sample from a pig, (b) contacting said sample with at least one primer according to claim 38 under hybridizing conditions; and (c) determining the presence of a hybridizing nucleic acid sequence in said sample, wherein said pig was previously immunized with a composition comprising the nucleic acid molecule according to any one of claims 1-9, and said nucleotide sequence is not complimentary to said nucleic acid molecule according to any one of claims 1-9.
40. A kit for detecting in a sample obtained from a pig, the presence of a polynucleotide specific to the nucleic acid molecule of any one of claims 1-9 or a fragment thereof, comprising at least one primer according to claim 38, and a suitable container for containing said at least one primer.
CA002418780A 2002-02-28 2003-02-28 Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof Abandoned CA2418780A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA002418780A CA2418780A1 (en) 2002-02-28 2003-02-28 Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CA2,372,578 2002-02-28
CA2372578 2002-02-28
CA002418780A CA2418780A1 (en) 2002-02-28 2003-02-28 Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof

Publications (1)

Publication Number Publication Date
CA2418780A1 true CA2418780A1 (en) 2003-08-28

Family

ID=27805907

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002418780A Abandoned CA2418780A1 (en) 2002-02-28 2003-02-28 Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof

Country Status (1)

Country Link
CA (1) CA2418780A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104547870A (en) * 2015-01-28 2015-04-29 邱骏 Traditional Chinese medicine preparation for treating porcine reproductive and respiratory syndromes as well as preparation method and application thereof
US9149518B2 (en) 2012-12-07 2015-10-06 The Board Of Trustees Of The University Of Illinois Porcine reproductive and respiratory syndrome virus compositions and uses thereof
CN108872601A (en) * 2018-07-10 2018-11-23 安徽九川生物科技有限公司 A kind of the immunofluorescence immue quantitative detection reagent box and its application method of porcine reproductive and respiratory syndrome antibody
CN110878379A (en) * 2019-12-11 2020-03-13 天津农学院 Matched identification and detection method for attenuated live vaccine similar to NADC30 PRRSV and application thereof
CN116333060A (en) * 2023-05-15 2023-06-27 广州悦洋生物技术有限公司 Porcine reproductive and respiratory syndrome virus GP5 protein, preparation method and application thereof, gene, kit and detection method

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9149518B2 (en) 2012-12-07 2015-10-06 The Board Of Trustees Of The University Of Illinois Porcine reproductive and respiratory syndrome virus compositions and uses thereof
US9687543B2 (en) 2012-12-07 2017-06-27 The Board Of Trustees Of The University Of Illinois Porcine reproductive and respiratory syndrome virus compositions and uses thereof
CN104547870A (en) * 2015-01-28 2015-04-29 邱骏 Traditional Chinese medicine preparation for treating porcine reproductive and respiratory syndromes as well as preparation method and application thereof
CN108872601A (en) * 2018-07-10 2018-11-23 安徽九川生物科技有限公司 A kind of the immunofluorescence immue quantitative detection reagent box and its application method of porcine reproductive and respiratory syndrome antibody
CN110878379A (en) * 2019-12-11 2020-03-13 天津农学院 Matched identification and detection method for attenuated live vaccine similar to NADC30 PRRSV and application thereof
CN116333060A (en) * 2023-05-15 2023-06-27 广州悦洋生物技术有限公司 Porcine reproductive and respiratory syndrome virus GP5 protein, preparation method and application thereof, gene, kit and detection method
CN116333060B (en) * 2023-05-15 2023-07-21 广州悦洋生物技术有限公司 Porcine reproductive and respiratory syndrome virus GP5 protein, preparation method and application thereof, gene, kit and detection method

Similar Documents

Publication Publication Date Title
AU2021201224B2 (en) PRRS virus variant, European PRRS virus cDNA clone, and uses thereof
JP4125385B2 (en) Vaccines that enhance the immune response to viruses that cause respiratory and genital diseases in pigs, methods for protecting pigs from diseases caused by the viruses, methods for producing vaccines that enhance immune responses against the viruses, and from the viruses DNA obtained
JP6997574B2 (en) Effective pre-weaning vaccination against porcine reproductive and respiratory syndrome (PRRS) virus
KR101321153B1 (en) Prrs viruses, infectious clones, mutants thereof, and methods of use
US6251397B1 (en) Proteins encoded by polynucleic acids isolated from a porcine reproductive and respiratory syndrome virus and immunogenic compositions containing the same
US6592873B1 (en) Polynucleic acids isolated from a porcine reproductive and respiratory syndrome virus (PRRSV) and proteins encoded by the polynucleic acids
US6380376B1 (en) Proteins encoded by polynucleic acids of porcine reproductive and respiratory syndrome virus (PRRSV)
JP5793197B2 (en) North American porcine reproductive and respiratory syndrome (PRRS) virus and use thereof
BRPI0615610A2 (en) processes and compositions for vaccination of animals with higher immunogenicity prrsv antigens
JP2004534522A (en) A live attenuated PRRS virus strain
CA2418780A1 (en) Synthetic genes encoding proteins of porcine reproductive and respiratory syndrome virus and use thereof
KR20200081225A (en) Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same
KR20170002393A (en) A non-naturally occuring porcine reproductive and respiratory syndrome virus (prrsv) and methods of using
CA2410694A1 (en) Porcine reproductive and respiratory syndrome virus (prrsv) dna vaccines
AU771883B2 (en) Vaccines inducing an immune response against viruses causing porcine respiratory and reproductive diseases
CA2240779A1 (en) Porcine reproductive and respiratory syndrome virus (prrsv) dna vaccines
AU734320B2 (en) Vaccines inducing an immune response against viruses causing porcine respiratory and reproductive diseases
MX2008003046A (en) Methods and compositions for vaccination of animals with prrsv antigens with improved immunogenicity

Legal Events

Date Code Title Description
FZDE Discontinued