CA2413022A1

CA2413022A1 - Whole cell engineering by mutagenizing a substantial portion of a starting genome, combining mutations, and optionally repeating

Info

Publication number: CA2413022A1
Application number: CA002413022A
Authority: CA
Inventors: Jay M. Short
Original assignee: Individual
Current assignee: BASF Enzymes LLC
Priority date: 2000-06-14
Filing date: 2001-06-14
Publication date: 2001-12-20
Also published as: AU2001266978A1; WO2001096551A3; EP1294869A2; WO2001096551A2

Abstract

An invention comprising cellular transformation, directed evolution, and screening methods for creating novel transgenic organisms having desirable properties. Thus in one aspect, this invention relates to a method of generating a transgenic organism, such as a microbe or a plant, having a plurality of traits that are differentially activatable. Also, a method of retooling genes and gene pathways by the introduction of regulatory sequences, such as promoters, that are operable in an intended host, thus conferring operability to a novel gene pathway when it is introduced into an intended host. For example a novel man-made gene pathway, generated based on microbially-derived progenitor templates, that is operable in a plant cell.
Furthermore, a method of generating novel host organisms having increased expression of desirable traits, recombinant genes, and gene products.

Description

DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

~~ TTENANT LES PAGES 1 A 267 NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:

WHOLE CELL ENGINEERING
BY MUTAGENIZING A SUBSTANTIAL PORTION OF A STARTING GENOME, COMBINING MUTATIONS, AND OPTIONALLY REPE~4TINC~
A - FIELD OF THE INVENTION
This invention relates to the field of cellular and whole organism engineering.
Specifically, this invention relates to a cellular transformation, directed evolution, and screening method for creating novel transgenic organisms having desirable properties.
Thus in one aspect, this invention relates to a method of generating a transgenic organism, such as a microbe or a plant, having a plurality of traits that are differentially activatable.
This invention also relates to the field of protein engineering. Specifically, this invention relates to a directed evolution method for preparing a polynucleotide encoding a polypeptide. More specifically, this invention relates to a method of using mutagenesis to generate a novel polynucleotide encoding a novel polypeptide, which novel polypeptide is itself an improved biological molecule &/or contributes to the generation of another improved biological molecule. More specifically still, this invention relates to a method of performing both non-stochastic polynucleotide chimeri~.ation and non-stochastic site-directed point mutagenesis.
Thus, in one aspect, this invention relates to a method of generating a progeny set of chimeric polynucleotide(s) by means that are synthetic and non-stochastic, and where the design of the progeny polynucleotide(s) is derived by analysis of a parental set of polynucleotides &/or of the polypeptides correspondingly encoded by the parental polynucleotides. In another aspect this invention relates to a method of performing site-directed mutagenesis using means that are exhaustive, systematic, and non-stochastic.
Furthermore this invention relates to a step of selecting from among a generated set of progeny molecules a subset comprised of particularly desirable species, including by a process termed end-selection, which subset may then be screened further. This invention also relates to the step of screening a set of polynucleotides for the production of a polypeptide &/or of another expressed biological molecule having a useful property.

Novel biological molecules whose manufacture is taught by this invention include genes, gene pathways, and any molecules whose expression is affected thereby, including directly encoded polypetides &/or any molecules affected by such polypeptides.
Said novel biological molecules include those that contain a carbohydrate, a lipid, a nucleic acid, &/or a protein component, and specific but non-limiting examples of these include antibiotics, antibodies, enzymes, and steroidal and non-steroidal hormones.
In a particular non-limiting aspect, the present invention relates to enzymes, parkicularly to thermostable enzymes, and to their generation by directed evolution. More particularly, the present invention relates to thermostable enzymes which are stable at high temperatures and which have improved activity at lower temperatures.
B-BACKGROUND
General Overview of the Problem to Be Solved Brief Summary: It is instantly appreciated that the process of performing a genetic manipulation on a organism to achieve a genetic alteration, whether it is on a unicellular or on a mufti-cellular organism, can lead to harmful, toxic, noxious, or even lethal effects on the manipulated organism. This is particularly true when the genetic manipulation becomes sizable. From a technical point of view, this problem is seen as one of the current obstacles that hinder the creation of genetically altered organisms having a large number of transgenic traits.
On the marketing side, is instantly appreciated that the purchase price of a genetically altered organism is often dictated by, or proportional to, the number of transgenic traits that have been introduced into the organism. Consequently, a genetically altered organism having a large number of stacked transgenic traits can be quite costly to produce and purchase and economically in low demand.
On the other hand, the generation of organism having but a single genetically introduced trait can also lead to the incurrence of undesirable costs, although for other reasons. It is thus appreciated that the separate production, marketing, &
storage of genetically altered organisms each having a single transgenic traits can incur costs, including inventory costs, that are undesirable. For example, the storage of such organisms may require a separate bin to be used for each trait. Furthermore, the value of an organisms having a single particular trait is often intimately tied to the marketability of that particular

2 trait, and when that marketability diminishes, inventories of such organisms cannot be sold in other markets.
The instant invention solves these and other problems by providing a method of producing genetically altered organisms having a large number of stacked traits that are differentially activatable. Upon purchasing such a genetically altered organism (having a large number of differentially activatable stacked traits), the purchasing customer has the option of selecting and paying for particular traits among the total that can then be activated differentially. One economic advantage provided by this invention is that the storage of such genetically altered organisms is simplified since, for example, one bin could be used to store a large number of traits. Moreover, a single organism of this type can satisfy the demands for a variety of traits; consequently, such an organism can be sold in a vaxiety of markets.
To achieve the production of genetically altered organisms having a large number of stacked traits that are differentially activatable, this invention provides -in one specific aspect - a process comprising the step of monitoring a cell or organism at holistic level. This serves as a way of collecting holistic - rather than isolated - information about a working cell or organism that is being subjected to a substantial amount of genetic manipulation. This invention further provides that this type of holistic monitoring can include the detection of all morphological, behavioral, and physical parameters.
Accordingly, the holistic monitoring provided by this invention can include the identification &/or quantification of all the genetic material contained in a working cell or organism (e.g. all nucleic acids including the entire genome, messenger RNA's, tRNA's, rRNA's, and mitochondria) nucleic acids, plasmids, phages, phagemids, viruses, as well as all episomal nucleic acids and endosyrnbiont nucleic acids). Furthermore this invention provides that this type of holistic monitoring can include all gene products produced by the working cell or organisms.
Furthermore, the holistic monitoring provided by this invention can include the identification &/or quantification of all molecules that are chemically at least in part protein in a working cell or organism. The holistic monitoring provided by this invention can also include the identification &/or quantification of all molecules that are chemically at least in part carbohydrate in a working cell or organism. The holistic monitoring provided by this invention can also include the identification &/or quantification of all molecules that are chemically at least in part proteoglycan in a working cell or organism. The holistic monitoring provided by this invention can also include the identification &/or quantification

3 of all molecules that are chemically at least in part glycoprotein in a working cell or organism. The holistic monitoring provided by this invention can also include the identification &/or quantification of all molecules that are chemically at least in part nucleic acids in a working cell or organism. The holistic monitoring provided by this invention can also include the identification &/or quantification of all molecules that are chemically at least in part lipids in a working cell or organism.
In one aspect, this invention provides that the ability to differentially activate a trait from among many, such as a enzyme from among many enzymes, depends the enzymes) to be activated having a unique activity profile (or activity fingerprint). An enzyme's activity profile includes the reactions) it catalyzes and its specificity.
Thus, an enzymes activity profile includes its:
~ Catalyzed reactions) ~ Reaction type ~ Natural substrates) ~ Substrate spectrum ~ Product spectrum ~ Inhibitors) ~ Cofactor(s)/prostetic groups) ~ Metal compounds/salts that affect it ~ Turnover number ~ Specific activity ~ Km value ~ pH optimum ~ pH range ~ Temperature optimum ~ Temperature range It is also instantly appreciated that enzymes are differentially affected by exposure to varying degrees of processing (e.g. upon extraction &/or purification) and exposure (e.g.
to suboptimal storage conditions). Accordingly, enzyme differences may surface after exposure to:
~ Isolation/Preparation ~ Purification ~ Crystallization ~ Renaturation

4 It is instantly appreciated that differences in molecular stability can also be used advantageously to differentially activate or inactivate selected enzymes, by exposing the enzymes for an appropriate time to variations in:
~ pH
~ Temperature ~ Oxidation ~ Organic solvents) ~ Miscellaneous storage conditions It is thus appreciated that in order to be able to differentially activate selected traits among a plurality of stacked traits, it is desirable to introduce into a working cell or organism traits conferred by molecules (e.g. enzymes) having very unique profiles (e.g.
unique enzyme fingerprints). Furthermore , it is appreciated that in order to obtain the molecules having a representation of a wide range of molecular fingerprints, it is advantageous to harvest molecules from the widest possible reaches nature's diversity. Thus, it is beneficial to harvest molecules not only from cultured mesophilic organisms, but also from extremophiles that are largely uncultured.
In another aspect, it is instantly appreciated that harvesting the full potential of nature's diversity can include both the step of discovery and the step of optimizing what is discovered. For example, the step of discovery allows one to mine biological molecules that have commercial utility. It is instantly appreciated that the ability to harvest the full richness of biodiversity, i.e. to mine biological molecules from a wide range of environmental conditions, is critical to the ability to discover novel molecules adapted to fixntion under a wide variety of conditions, including extremes of conditions, such as may be found in a commercial application.
However, it is also instantly appreciated that only occassionally are there criteria for selection &/or survival in nature that point in the exact direction of particular commercial needs. Instead, it is often the case that a naturally occurring molecule will require a certain amount of change - from fine tuning to sweeping modification - in order to fulfill a particular unmet commercial need. Thus, to meet certain commercial needs (e.g., a need for a molecule that is fucntional under a specific set of commercial processing conditions) it is sometimes advantageous to experimentally modify a naturally expresed molecule to achieve properties beyond what natural evolution has provided &/or is likely to provide in the near future.

The approach, termed directed evolution, of experimentally modifying a biological molecule towards a desirable property, can be achieved by mutagenizing one or more parental molecular templates and by idendifying any desirable molecules among the progeny molecules. Currently available technologies in directed evolution include methods for achieving stochastic (i.e. random) mutagenesis and methods for achieving non-stochastic (non-random) mutagenesis. However, critical shortfalls in both types of methods are identified in the instant disclosure.
In prelude, it is noteworthy that it may be argued philosophically by some that all mutagenesis - if considered from an obj ective point of view - is non-stochastic; and furthermore that the entire universe is undergoing a process that - if considered from an objective point of view - is non-stochastic. Whether this is true is outside of the scope of the instant consideration. Accordingly, as used herein, the terms "randomness", "uncertainty", and "unpredictability" have subjective meanings, and the knowledge, particularly the predictive knowledge, of the designer of an experimental process is a determinant of whether the process is stochastic or non-stochastic.
By way of illustration, stochastic or random mutagenesis is exemplified by a situation in which a progenitor molecular template is mutated (modified or changed) to yield a set of progeny molecules having mutations) that are not predetermined. Thus, in an in vitro stochastic mutagenesis reaction, for example, there is not a particular predetermined product whose production is intended; rather there is an uncertainty - hence randomness - regarding the exact nature of the mutations achieved, and thus also regarding the products generated.
.In contrast, non-stochastic or non-random mutagenesis is exemplified by a situation in which a progenitor molecular template is mutated (modified or changed) to yield a progeny molecule having one or more predetermined mutations. It is appreciated that the presence of background products in some quantity is a reality in many reactions where molecular processing occurs, and the presence of these background products does not detract from the non-stochastic nature of a mutagenesis process having a predetermined product.
Thus, as used herein, stochastic mutagenesis is manifested in processes such as error-prone PCR and stochastic shuffling, where the mutations) achieved are random or not predetermined. In contrast, as used herein, non-stochastic mutagenesis is manifested in instantly disclosed processes such as gene site-saturation mutagenesis and synthetic ligation reassembly, where the exact chemical structures) of the intended products) are predetermined.

In brief, existing mutagenesis methods that are non-stochastic have been serviceable in generating from one to only a very small number of predetermined mutations per method application, and thus produce per method application from one to only a few progeny molecules that have predetermined molecular structures. Moreover, the types of mutations currently available by the application of these non-stochastic methods are also limited, and thus so are the types of progeny mutant molecules.
In contrast, existing methods for mutagenesis that are stochastic in nature have been serviceable for generating somewhat larger numbers of mutations per method application -though in a random fashion & usually with a large but unavoidable contingency of undesirable background products. Thus, these existing stochastic methods can produce per method application larger numbers of progeny molecules, but that have undetermined molecular structures. The types of mutations that can be achieved by application of these current stochastic methods are also limited, and thus so are the types of progeny mutant molecules.
It is instantly appreciated that there is a need for the development of non-stochastic mutagenesis methods that:
1) Can be used to generate large numbers of progeny molecules that have predetermined molecular structures;
2) Can be used to readily generate more types of mutations;
3) Can produce a correspondingly larger variety of progeny mutant molecules;
4) Produce decreased unwanted background products;

5) Can be used in a manner that is exhaustive of all possibilities; and

6) Can produce progeny molecules in a systematic & non-repetitive way.
The instant invention satisfies all of these needs.
Directed Evolution Supplements Natural Evolution: Natural evolution has been a springboard for directed or experimental evolution, serving both as a reservoir of methods to be mimicked and of molecular templates to be mutagenized. It is appreciated that, despite its intrinsic process-related limitations (in the types of favored &/or allowed mutagenesis processes) and in its speed, natural evolution has had the advantage of having been in process for millions of years & and throughout a wide diversity of environments.
Accordingly, natural evolution (molecular mutagenesis and selection in nature) has resulted

7 in the generation of a wealth of biological compounds that have shown usefulness in certain commercial applications.
However, it is instantly appreciated that many unmet commercial needs are discordant with any evolutionary pressure &/or direction that can be found in nature.
Moreover, it is often the case that when commercially useful mutations would otherwise be favored at the molecular level in nature, natural evolution often overrides the positive selection of such mutations, e.g. when there is a concurrent detriment to an organism as a whole (such as when a favorable mutation is accompanied by a detrimental mutation).
Additionally, natural evolution is often slow, and favors fidelity in many types of replication.
Additionally still, natural evolution often favors a path paved mainly by consecutive beneficial mutations while tending to avoid a plurality of successive negative mutations, even though such negative mutations may prove beneficial when combined, or may lead - through a circuitous route - to final state that is beneficial.
Moreover, natural evolution advances through specific steps (e.g. specific mutagenesis and selection processes), with avoidance of less favored steps.
For example, many nucleic acids do not reach close enough proximity to each other in a operative environment to undergo chimerization or incorporation or other types of transfers from one species to another. Thus, e.g., when sexual intercourse between 2 particular species is avoided in nature, the chimerization of nucleic acids from these 2 species is likewise unlikely, with parasites common to the two species serving as an example of a very slow passageway for inter-molecular encounters and exchanges of DNA. For another example, the generation of a molecule causing self toxicity or self lethality or sexual sterility is avoided in nature. For yet another example, the propagation of a molecule having no particular immediate benefit to an organism is prone to vanish in subsequent generations of the organism. Furthermore, e.g., there is no selection pressure for improving the performance of molecule under conditions other than those to which it is exposed in its endogenous environment; e.g. a cytoplasmic molecule is not likely to acquire functional features extending beyond what is required of it in the cytoplasm. Furthermore still, the propagation of a biological molecule is susceptible to any global detrimental effects -whether caused by itself or not - on its ecosystem. These and other characteristics greatly limit the types of mutations that can be propagated in nature.
On the other hand, directed (or experimental) evolution - particularly as provided herein - can be performed much more rapidly and can be directed in a more streamlined

8 manner at evolving a predetermined molecular property that is commercially desirable where nature does not provide one &/or is not likely to provide. Moreover, the directed evolution invention provided herein can provide more wide-ranging possibilities in the types of steps that can be used in mutagenesis and selection processes. Accordingly, using templates harvested from nature, the instant directed evolution invention provides more wide-ranging possibilities in the types of progeny molecules that can be generated and in the speed at which they can be generated than often nature itself might be expected to in the same length of time.
In a particular exemplification, the instantly disclosed directed evolution methods can be applied iteratively to produce a lineage of progeny molecules (e.g.
comprising successive sets of progeny molecules) that would not likely be propagated (i.e., generated &/or selected for) in nature, but that could lead to the generation of a desirable downstream mutagenesis product that is not achievable by natural evolution.
Previous Directed Evolution Methods Are Suboptimal:
Mutagenesis has been attempted in the past on many occasions, but by methods that are inadequate for the purpose of this invention. For example, previously described non-stochastic methods have been serviceable in the generation of only very small sets of progeny molecules (comprised often of merely a solitary progeny molecule). By way of illustration, a chimeric gene has been made by joining 2 polynucleotide fragments using compatible sticky ends generated by restriction enzyme(s), where each fragment is derived from a separate progenitor (or parental) molecule. Another example might be the mutagenesis of a single codon position (i.e. to achieve a codon substitution, addition, or deletion) in a parental polynucleotide to generate a single progeny polynucleotide encoding for a single site-mutagenized polypeptide.
Previous non-stochastic approaches have only been serviceable in the generation of but one to a few mutations per method application. Thus, these previously described non-stochastic methods thus fail to address one of the central goals of this invention, namely the exhaustive and non-stochastic chimerization of nucleic acids. Accordingly previous non-stochastic methods leave untapped the vast majority of the possible point mutations, chimerizations, and combinations thereof, which may lead to the generation of highly desirable progeny molecules.
In contrast, stochastic methods have been used to achieve larger numbers of point mutations and/or chimerizations than non-stochastic methods; for this reason, stochastic

9 methods have comprised the predominant approach for generating a set of progeny molecules that can be subjected to screening, and amongst which a desirable molecular species might hopefully be found. However, a major drawback of these approaches is that -because of their stochastic nature - there is a randomness to the exact components in each set of progeny molecules that is produced. Accordingly, the experimentalist typically has little or no idea what exact progeny molecular species are represented in a particular reaction vessel prior to their generation. Thus, when a stochastic procedure is repeated (e.g. in a continuation of a search for a desirable progeny molecule), the re-generation and re-screening of previously discarded undesirable molecular species becomes a labor-intensive obstruction to progress, causing a circuitous - if not circular - path to be taken. The drawbacks of such a highly suboptirnal path can be addressed by subjecting a stochastically generated set of progeny molecules to a labor-incurring process, such as sequencing, in order to identify their molecular structures, but even this is an incomplete remedy.
Moreover, current stochastic approaches are highly unsuitable for comprehensively or exhaustively generating all the molecular species within a particular grouping of mutations, for attributing functionality to specific structural groups in a template molecule (e.g. a specific single amino acid position or a sequence comprised of two or more amino acids positions), and for categorizing and comparing specific grouping of mutations.
Accordingly, current stochastic approaches do not inherently enable the systematic elimination of unwanted mutagenesis results, and are, in sum, burdened by too many inherently shortcomings to be optimal for directed evolution.
In a non-limiting aspect, the instant invention addresses these problems by providing non-stochastic means for comprehensively and exhaustively generating all possible point mutations in a parental template. In another non-limiting aspect, the instant invention further provides means for exhaustively generating all possible chimerizations within a group of chimerizations. Thus, the aforementioned problems are solved by the instant invention.
Specific shortfalls in the technological landscape addressed by this invention include:
1) Site-directed mutagenesis technologies, such as sloppy or low-fidelity PCR, are ineffective for systematically achieving at each position (site) along a polypeptide sequence the full (saturated) range of possible mutations (i.e. all possible amino acid substitutions).
2) There is no relatively easy systematic means for rapidly analyzing the large amount of information that can be contained in a molecular sequence and in the potentially colossal number or progeny molecules that could be conceivably obtained by the directed evolution of one or more molecular templates.
3) There is no relatively easy systematic means for providing comprehensive empirical information relating structure to function for molecular positions.
4) There is no easy systematic means for incorporating internal controls, such as positive controls, for key steps in certain mutagenesis (e.g. chimerization) procedures.
5) There is no easy systematic means to select for a specific group of progeny molecules, such as full-length chimeras, from among smaller partial sequences.
An exceedingly large number of possibilities exist for the purposeful and random combination of amino acids within a protein to produce useful hybrid proteins and their corresponding biological molecules encoding for these hybrid proteins, i.e., DNA, RNA.
Accordingly, there is a need to produce and screen a wide variety of such hybrid proteins for a desirable utility, particularly widely varying random proteins.
The complexity of an active sequence of a biological macromolecule (e.g., polynucleotides, polypeptides, and molecules that are comprised of both polynucleotide and polypeptide sequences) has been called its information content ("IC"), which has been defined as the resistance of the active protein to amino acid sequence variation (calculated from the minimum number of invariable amino acids (bits) required to describe a family of related sequences with the same function). Proteins that are more sensitive to random mutagenesis have a high information content.
Molecular biology developments, such as molecular libraries, have allowed the identification of quite a large number of variable bases, and even provide ways to select functional sequences from random libraries. In such libraries, most residues can be varied (although typically not all at the same time) depending on compensating changes in the context. Thus, while a 100 amino acid protein can contain only 2,000 different mutations, 20100 sequence combinations are possible.
Information density is the IC per unit length of a sequence. Active sites of enzymes tend to have a high information density. By contrast, flexible linkers of information in enzymes have a low information density.
Current methods in widespread use for creating alternative proteins in a library format are error-prone polymerase chain reactions and cassette mutagenesis, in which the specific region to be optimized is replaced with a synthetically mutagenized oligonucleotide. In both cases, a substantial number of mutant sites are generated around certain sites in the original sequence.
Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long sequence. In a mixture of fragments of unknown sequence, error-prone PCR can be used to mutagenize the mixture. The published error-prone PCR protocols suffer from a low processivity of the polymerase.
Therefore, the protocol is unable to result in the random mutagenesis of an average-sized gene. This inability limits the practical application of error-prone PCR. Some computer simulations have suggested that point mutagenesis alone may often be too gradual to allow the large-scale block changes that are required for continued and dramatic sequence evolution. Further, the published error-prone PCR protocols do not allow for amplification of DNA fragments greater than 0.5 to 1.0 kb, limiting their practical application. In addition, repeated cycles of error-prone PCR can lead to an accumulation of neutral mutations with undesired results, such as affecting a protein's immunogenicity but not its binding affinity.
In oligonucleotide-directed mutagenesis, a short sequence is replaced with a synthetically mutagenized oligonucleotide. This approach does not generate combinations of distant mutations and is thus not combinatorial. The limited library size relative to the vast sequence length means that many rounds of selection are unavoidable for protein optimization. Mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round followed by grouping them into families, arbitrarily choosing a single family, and reducing it to a consensus motif.
Such motif is re-synthesized and reinserted into a single gene followed by additional selection. This step process constitutes a statistical bottleneck, is labor intensive, and is not practical for many rounds of mutagenesis.
Error-prone PCR and oligonucleotide-directed mutagenesis are thus useful for single cycles of sequence fine-tuning, but rapidly become too limiting when they are applied for multiple cycles.
Another limitation of error-prone PCR is that the rate of down-mutations grows with the information content of the sequence. As the information content, library size, and mutagenesis rate increase, the balance of down-mutations to up-mutations will statistically prevent the selection of further improvements (statistical ceiling).

In cassette mutagenesis, a sequence block of a single template is typically replaced by a (partially) randomized sequence. Therefore, the maximum information content that can be obtained is statistically limited by the number of random sequences (i.e., library size). This eliminates other sequence families which are not currently best, but which may have greater long term potential.
Also, mutagenesis with synthetic oligonucleotides requires seduencing of individual clones after each selection round. Thus, such an approach is tedious and impractical for many rounds of mutagenesis.
Thus, error-prone PCR and cassette mutagenesis are best suited, and have been widely used, for fine-tuning areas of comparatively low information content.
One apparent exception is the selection of an RNA ligase ribozyme from a random library using many rounds of amplification by error-prone PCR and selection.
In nature, the evolution of most organisms occurs by natural selection and sexual reproduction. Sexual reproduction ensures mixing and combining of the genes in the offspring of the selected individuals. During meiosis, homologous chromosomes from the parents line up with one another and cross-over part way along their length, thus randomly swapping genetic material. Such swapping or shuffling of the DNA allows organisms to evolve more rapidly.
In recombination, because the inserted sequences were of proven utility in a homologous environment, the inserted sequences are likely to still have substantial information content once they are inserted into the new sequence.
Theoretically there are 2,000 different single mutants of a 100 amino acid protein.
However, a protein of 100 amino acids has 20100 possible sequence combinations, a number which is too large to exhaustively explore by conventional methods. It would be advantageous to develop a system which would allow generation and screening of all of these possible combination mutations.
Some workers in the art have utilized an in vivo site specific recombination system to generate hybrids of combine light chain antibody genes with heavy chain antibody genes for expression in a phage system. However, their system relies on specific sites of recombination and is limited accordingly. Simultaneous mutagenesis of antibody CDR
regions in single chain antibodies (scFv) by overlapping extension and PCR
have been reported.

Others have described a method for generating a large population of multiple hybrids using random in vivo recombination. This method requires the recombination of two different libraries of plasmids, each library having a different selectable marker. The method is limited to a finite number of recombinations equal to the number of selectable markers existing, and produces a concomitant linear increase in the number of marker genes linked to the selected sequence(s).
In vivo recombination between two homologous, but truncated, insect-toxin genes on a plasmid has been reported as a method of producing a hybrid gene. The in vivo recombination of substantially mismatched DNA sequences in a host cell having defective mismatch repair enzymes, resulting in hybrid molecule formation has been reported.
C - SUMMARY OF THE INVENTION
This invention relates generally to the field of cellular and whole organism engineering. Specifically, this invention relates to a cellular transformation, directed evolution, and screening method for creating novel transgenic organisms having desirable properties. Thus in one aspect, this invention relates to a method of generating a transgenic organism, such as a microbe or a plant, having a plurality of traits that are differentially activatable.
In one embodiment, this invention is directed to a method of producing an improved organism having a desirable trait to by: a) obtaining an initial population of organisms, b) generating a set of mutagenized organisms, such that when all the genetic mutations in the set of mutagenized organisms are taken as a whole, there is represented a set of substantial genetic mutations, and c) detecting the presence of said improved organism. This invention provides that any of steps a), b), and c) can be further repeated in any particular order and any number of times; accordingly, this invention specifically provides methods comprised of any iterative combination of steps a), b), and c), with a number of iterations.
In another embodiment, this invention is directed to a method of producing an improved organism having a desirable trait to by: a) obtaining an initial population of organisms, which can be a clonal population or otherwise, b) generating a set of mutagenized organisms each having at least one genetic mutation, such that when all the genetic mutations in the set of mutagenized organisms are taken as a whole, there is represented a set of substantial genetic mutations c) detecting the manifestation of at least two genetic mutations, and d) introducing at least two detected genetic mutations into one organism. Additionally, this invention provides that any of steps a), b), c), and d) can be further repeated in any particular order and any number of times; accordingly, this invention specifically provides methods comprised of any iterative combination of steps a), b), c), and d), with a total number of iterations can be from one up to one million, including specifically every integer value in between.
In a preferred aspect of embodiments specified herein the step of b) generating a second set of mutagenized organisms is comprised of generating a plurality of organisms, each of which organisms has a particular transgenic mutation.
As used herein, "generating a set of mutagenized organisms having genetic mutations" can be achieved by any means known in the art to mutagenized including any radiation known to mutagenized, such as ionizing and ultra violet. Further examples of serviceable mutagenizing methods include site-saturation mutagenesis, transposon-based methods, and homologous recombination.
"Combining" means incorporating a plurality of different genetic mutations in the genetic makeup (e.g. the genome) of the same organism; and methods to achieve this "combining" step including sexual recombination, homologous recombination, and transposon-based methods.
As used herein, an "initial population of organisms" means a "working population of organisms", which refers simply to a population of organisms with which one is working, and which is comprised of at least one organism. An "initial population of organisms" which can be a clonal population or otherwise.
Accordingly, in step 1) an "initial population of organisms" may be a population of multicellular organisms or of unicellular organisms or of both. An "initial population of organisms" may be comprised of unicellular organisms or multicellular organisms or both.
An "initial population of organisms" may be comprised of prokaryotic organisms or eukaryotic organisms or both. This invention provides that an "initial population of organisms" is comprised of at least one organism, and preferred embodiments include at least that .
By "organism" is meant any biological form or thing that is capable of self replication or replication in a host. Examples of "organisms" include the following kinds of organisms (which kinds are not necessarily mutually-exclusive): animals, plants, insects, cyanobacteria, microorganisms, fungi, bacteria, eukaryotes, prokaryotes, mycoplasma, viral organisms (including DNA viruses, RNA viruses), and prions.
Non-limiting particularly preferred examples of kinds of "organisms" also include Archaea (archaebacteria) and Bacteria (eubacteria). Non-limiting examples of Archaea (archaebacteria) include Crenarchaeota, Euryarchaeota, and Korarchaeota. Non-limiting examples Bacteria (eubacteria) include Aquificales, CFB/Green sulfur bacteria group, Chlamydiales/Verrucomicrobia group, Chrysiogenes group, Coprothermobacter group, Cyanobacteria & chloroplasts, Cytophaga/Flexibacter /Bacteriods group, Dictyoglomus group, Fibrobacter/Acidobacteria group, Firmicutes, Flexistipes group, Fusobacteria, Green non-sulfur bacteria, Nitrospira group, Planctomycetales, Proteobacteria, Spirochaetales, Synergistes group, Thermodesulfobacterium group, Thermotogales, Thermus/Deinococcus group. As non-limiting examples, particularly preferred kinds of organisms include Aquifex, Aspergillus, Bacillus, Clostridium, E. coli, Lactobacillus, Mycobacterium, Pseudomonas, Streptomyces, and Thermotoga. As additional non-limiting examples, particularly preferred organisms include cultivated organisms such as CHO, VERO, BHK, HeLa, COS, MDCK, Jurkat, HEK-293, and WI38. Particularly preferred non-limiting examples of organisms further include host organisms that are serviceable for the expression of recombinant molecules. Organisms further include primary cultures (e.g. cells from harvested mammalian tissues), immortalized cells, all cultivated and culturable cells and multicellular organisms, and all uncultivated and uculturable cells and multicellular organisms.
In a preferred embodiment, knowledge of genomic information is useful for performing the claimed methods; thus, this invention provides the following as preferred but non-limiting examples of organisms that are particularly serviceable for this invention, because there is a significant amount of - if not complete - genomic sequence information (in terms of primary sequence &/or annotation) for these organisms: Human, Insect (e.g.
Drosophila melanogaster), Higher plants (e.g. Arabidopsis thaliana), Protozoan (e.g.
Plasmodium falciparum), Nematode (e.g. Caenorhabditis elegans), Fungi(e.g.
Saccharomyces cerevisiae), Proteobacteria gamma subdivision (e.g. Escherichia coli K-12 Haemophilus influenzae Rd, Xylella fastidiosa 9a5c, Vibrio cholerae El Tor N16961, Pseudomonas aeruginosa PAOI, Buchnera sp. APS), Proteobacteria beta subdivision (e.g.
Neisseria meningitidis MC58 (serogroup B), Neisseria meraingitidis 22491 (serogroup A)), Proteobacteria other subdivisions (e.g. Helicobacter pylori 26695, Helicobacter pylori J99, Campylobacterjejuni NCTCl 1168, Rickettsia prowazekii), Gram-positive bacteria (e.g. Bacillus subtilis, Mycoplasma genitalium, Mycoplasma pneumoniae, Ureaplasma urealyticurn, Mycobacterium tuberculosis H37Rv), Chlamydia (e.g. Chlamydia trachomatisserovar D, Chlarnydia muridarum (Chlarnydia trachomatis MoPn), Chlamydia pneumoniae CWL029, Chlamydia pneumoniae AR39, Chlamydia pneumoriiae J138), Spirochete (e.g. Borrelia burgdorferi B31, Treponema pallidum), Cyanobacteria (e.g.
Synechocystis sp. PCC6803), Radioresistant bacteria (e.g. Deinococcus radiodurans Rl), Hyperthermophilic bacteria (e.g. Aquifex aeolicus VFS, Thermotoga maritima MSB8), and Archaea (e.g. Methanococcus jannaschii, Methanobacterium thermoautotrophicum deltaH, Archaeoglobus fulgidus, Pyrococcus horikoshii OT3, Pyrococcus abyssi, Aeropyrum pernixxl).
Non-limiting particularly preferred examples of kinds of plant "organisms"
include those listed in Table 1.
Table 1. Non-limiting examples of plant organisms and sources of transgenic molecules (e.g. nucleic acids & nucleic acid products) 1. Alfalfa 39.Pepper 2. Amelanchier laevis 40.Persimmon 3. Apple 41.Petunia 4. Arab. thaliana 42.Pine 5. Arabidopsis 43.Pineapple 6. AspergilIus flavus 44.Pink bollworm 7. Barley 45.Plum 8. Beet 46.Poplar 9. Belladonna 47.Potato

10.Brassica oleracea 48.Pseudomonas

11.Carrot 49.Pseudomonas putida

12.Chrysanthemum 50.Pseudomonas syringae

13.Cichorium intybus 51.Rapeseed

14.Clavibacter 52.Rhizobium

15.Clavibacter xyli 53.Rhizobium etli

16.Coffee 54.Rhizobium fredii

17.Corn 55.Rhizobium leguminosarum

18.Cotton 56.Rhizobium meliloti

19.Cranberry 57.Rice

20.Creeping bentgrass 58.Rubusidaeus

21.Cryphonectria parasitica 59.Spruce

22.Eggplant 60.Soybean

23.Festuca arundinacea 61.Squash

24.Fusarium graminearum 62.Squash-cucumber

25.Fusarium moniliforme 63.Squash-cucurbita texana

26.Fusarium sporotrichioides 64.Strawberry

27.Gladiolus 65.Sugarcane

28.Grape 66.Sunflower

29.Heterorhabditis bacteriophora67.Sweet potato

30.Kentucky bluegrass 68.Sweetgum

31.Lettuce 69.TMV

32.Melon 70.Tobacco

33.Oat 71.Tomato

34.Onion 72.Walnut

35.Papaya 73.Watermelon

36.Pea 74.Wheat

37.Peanut 75.Xanthomonas

38.Pelargonium 76.Xanthomonas campestris As used herein, the meaning of "generating a set of mutagenized organisms having genetic mutations" includes the steps of substituting, deleting, as well as introducing a nucleotide sequence into organism; and this invention provides a nucleotide sequence that serviceable for this purpose may be a single-stranded or double-stranded and the fact that its length may be from one nucleotide up to 10,000,000,000 nucleotides in length including specifically every integer value in between.
A mutation in an organism includes any alteration in the structure of one or more molecules that encode the organism. These molecules include nucleic acid, DNA, RNA, prionic molecules, and may be exemplified by a variety of molecules in an organism such as a DNA that is genomic, episomal, or nucleic, or by a nucleic acid that is vectoral (e.g.
viral, cosmid, phage, phagemid).
In one aspect, as used herein, a "set of substantial genetic mutations" is preferably a disruption (e.g. a functional knock-out) of at least about 15 to about 150,000 genomic locations or nucleotide sequences (e.g. genes, promoters, regulatory sequences, codons etc.), including specifically every integer value in between. In another aspect, as used herein, a "set of substantial genetic mutations" is preferably an alteration in an expression level (e.g. decreased or increased expression level) or an alteration in the expression pattern (e.g. throughout a period of time) of at least about 15 to about 150,000 genes, including specifically every integer value in between. Corresponding to another aspect, as used herein, a "set of substantial genetic mutations" is preferably an alteration in an expression level (e.g. decreased or increased expression level) or an alteration in the expression pattern (e.g. throughout a period of time) of at least about 15 to about 150,000 gene products &/or phenotypes &/or traits, including specifically every integer value in between.
In another aspect, as used herein, a "set of substantial genetic mutations"
with respect to an organism (or type of organism) is preferably a disruption (e.g.
a functional knock-out) of at least about 1% to about 100% of genomic locations or nucleotide sequences (e.g. genes, promoters, regulatory sequences, codons etc.) in the organism (or type of organism), including specif cally percentages of every integer value in between. In another aspect, as used herein, a "set of substantial genetic mutations" is preferably an alteration in an expression level (e.g. decreased or increased expression level) or an alteration in the expression pattern (e.g. throughout a period of time) of at least about 1 to about 100% of genes in an organism (or type of organism), including specifically percentages of every integer value in between. Corresponding to another aspect, as used herein, a "set of substantial genetic mutations" is preferably an alteration in an expression level (e.g. decreased or increased expression level) or an alteration in the expression pattern (e.g. throughout a period of time) of at least about 1 % to about 100%
of the gene products &/or phenotypes &/or traits of an organism (or type of organism), including specifically every integer value in between.
In yet another aspect, as used herein, a "set of substantial genetic mutations" is preferably an introduction or deletion of at least about 15 to 150,000 genes promoters or other nucleotide sequences (where each sequence is from 1 base to 10,000,000 bases), including specifically every integer value in between. For example, one can introduce a library of at least about 1 S to 150,000 nucleotides (genes or promoters) produced by "site-saturation mutagenesis" &/or by "ligation reassembly" (including any specific aspect thereof provided herein) into an "initial population of organisms".
It is provided that wherever the manipulation of a plurality of "genes" is mentioned herein, gene pathways (e.g. that ultimately lead to the production of small molecules) are also included. It is appreciated herein that knocking-out, altering expression level, and altering expression pattern can be achieved, by non-limiting exemplification, by mutagenizing a nucleotide sequence corresponding gene as well as a corresponding promoter that affects the expression of the gene.
As used herein, a "mutagenized organism" includes any organism that has been altered by a genetic mutation.
A "genetic mutation" can be, by way of non-limiting and non-mutually exclusive exemplification, and change in the nucleotide sequence (DNA or RNA) with respect to genomic, extra-genomic, episomal, mitochondrial, and any nucleotide sequence associated with (e.g. contained within or considered part of) an organism..
According to this invention, detecting the manifestation of a "genetic mutation"
means "detecting the manifestation of a detectable parameter", including but not limited to a change in the genomic sequence. Accordingly, this invention provides that a step of sequencing (&/or annotating) of and organism's genomic DNA is necessary for some methods of this invention, and exemplary but non-limiting aspects of this sequencing (&/or annotating) step are provided herein.
A detectable "trait", as used herein, is any detectable parameter associated with the organism. Accordingly, such a detectable "parameter" includes, by way of non-limiting exemplification, any detectable "nucleotide knock-in", any detectable "nucleotide knock-outs", any detectable "phenotype", and any detectable "genotype". By way of further illustration, a "trait" includes any substance produced or not produced by the organism. Accordingly, a "trait" includes viability or non-viability, behavior, growth rate, size, morphology. "Trait" includes increased (or alternatively decreased) expression of a gene product or gene pathway product. "Trait" also includes small molecule production (including vitamins, antibiotics), herbicide resistance, drought resistance, pest resistance, production of any recombinant biomolecule (ie.g. vaccines, enzymes, protein therapeutics, chiral enzymes). Additional examples of serviceable traits for this invention are shown in Table 2.
TABLE 2 - Non-limiting examples of serviceable genes, gene products, phenotypes, or traits according to the methods of this invention (e.g. knockouts, knockins, increased or decreased expression level, increased or decreased expression pattern) Table 2 - Part 1. Non-limiting examples of genes or gene products 1. 17 kDa protein 53.Cecropin 2. 3-hydroxy-3-methylglutaryl 54.Cecropin B
CoenzymeA
reductase 3. 4-Coumarate:CoA ligase knockoutS5.Cellulose binding protein 4. 60 kDa protein 56.Chalcone synthase knockout 5. Ac transposable element 57.Chitinase 6. ACC deaminase 58.Chitobiosidase 7. ACC oxidase knockout 59.Chloramphenicol acetyltransferase 8. ACC synthase 60.Cholera toxin B

9. ACC synthase knockout 61.Choline oxidase 10. Acetohydroxyacid synthase 62.Cinnamate 4-hydroxylase variant 11. Acetolactate synthase 63.Cinnamate 4-hydroxylase knockout 12. Acetyl CoA carboxylase 64.Coat protein 13. ACP acyl-ACP thioesterase 65.Coat protein knockout 14. ACP thioesterase 66.Conglycinin 15. Acyl CoA reductase 67.CryIA

16. Acyl-ACP knockout 68.CryIAb 17. Acyl-ACP desaturase 69.CryIAc 18. Acyl-ACP desaturase knockout70.CryIB

19. Acyl-ACP thioesterase 71.CryIIA

20. ADP glucose pyrophosphorylase72.CryIIIA

21. ADP glucose pyrophosphorylase73.CryVIA
knockout 22. Agglutinin 74.Cyclin dependent kinase 23. Aleurone 1 75.Cyclodextrin glycosyltransferase 24. Alpha hordothinonin 76.Cylindrical inclusion protein 25. Alpha-amylase 77.Cystathionine synthase 26. Alpha-hemoglobin 78.Delta-12 desaturase 27. Aminoglycoside 3'-adenylytransferase79.Delta-12 desaturase knockout 28. Amylase 80.Delta-12 saturase 29. Anionic peroxidase 81.Delta-12 saturase knockout 30. Antibody 82.Delta-IS desaturase 31. Antifungal protein 83.Delta-15 desaturase knockout 32. Antithrombin 84.Delta-9 desaturase 33. Antitrypsin 85.Delta-9 desturase knockout 34. Antiviral protein 86.Deoxyhypusine synthase (DHS) 35. Aspartokinase 87.Deoxyhypusine synthase knockout 36. Attacin E 88.Diacylglycerol acetyl tansferase 37. B1 regulatory gene 89.Dihydrodipicolinate synthase 38. B-1,3-glucanase knockout 90.Dihydrofolate reductase

39. B-1,4-endoglucanase knockout91.Diptheria toxin A

40. Bacteropsin 92.Disease resistance response gene 49

41. Bamase 93.Double stranded ribonuclease

42. Barstar 94.Ds transposable element

43. Beta-hemoglobin 95.Elongase

44.B-glucuronidase 96. EPSPS

45.C1 knockout 97. Ethylene forming enzyme knockout

46.C1 regulatory gene 98. Ethylene receptor protein

47.C2 knockout 99. Ethylene receptor protein knockout

48.C3 knockout 100.Fatty acid elongase

49.Caffeate O-methylthransferase101.Fluorescent protein

50.Caffeate O-methyltransferase102.G glycoprotein knockout

51.Caffeoyl CoA O-methyltransferase103.Galactanase knockout

52.Casein 104.Galanthus nivalis agglutinin Table 2 - Part 1.(continued) Non-limiting examples of transgenic genes & gene knockouts 105.Genome-linked protein 157.Omega 3 desaturease knockout _ ~

t06.Glucanase I58.Omega 6 desaturase 107.Glucanase knockout 159.Omega 6 desaturase knockout 108.Glucose oxidase 160.O-methyltransferase 109.Glutamate dehydrogenase 161.Osmotin i Glutamine binding protein 162.Oxalate oxidase 10.

11 Glutamine synthetase 163.Par locus I.

112.Glutenin 164.Pathogenesis protein 1 a 113.Glycerol-3-phosphate acetyl165.Pectate lyase transferase I Glyphosate exidoreductase 166.Pectin esterase 14.

115.Glyphosate oxidoreductase 167.Pectin esterase knockout 116.Green fluorescent protein 168.Pectin methylesterase I Helper component 169.Pectin methylesterase knockout 17.

118.Hemicellulase 170.Pentenlypyrophosphate isomerase 119.Hup locus 171.Phosphinothricin 120.Hygromycin phosphotransferase172.Phosphinothricin acetyl transferase 121.Hyoscamine 6B-hydroxylase 173.Phytochrome A

122.IAA monooxygenase 174.Phytoene synthase 123.Invertase 175.Phleomycin binding protein 124.Invertase knockout 176.Polygalacturonase 125.Isopentenyl transferase 177.Polygalacturonase knockout 126.Ketoacyl-ACP synthase 178.PolygaIacturonase inhibitor protein 127.Ketoacyl-ACP synthase knockout179.Prf regulatory gene 128.Larval serum protein I Prosystemin 80.

129.Leafy homeotic regulatory 181.Protease gene 130.Lectin 182.Protein A

131.Lignin peroxidase 183.Protein kinase 132.Luciferase 184.Proteinase inhibitor I

133.Lysine-2 gene 185.PtiS transcription factor 134.Lysophosphatidic acid acetyl186.R regulatory gene transferase 135.Lysozyme 187.Receptor kinase 136.Maliinlin 188.Recombinase 137.Male sterility protein 189.Reductase 138.Metallothionein 190.Replicase 139.Modifie ethylene receptor 191.Resveratrol synthase protein 140.Modified ethylene receptor 192.Ribonuclease protein knockout 141.Monooxygenase I ro 1 c 93.

142.Movement protein 194.Rol hormone gene 143.Movement protein nonfunctional195.S-adenosylmethione decarboxylase 144.N gene for TMV resistance 196.S-adenosylmethione hydrolase 145.N-acetyl glucosidase 197.S-adenosyimethionine transferase 146.Nitrilase 198.Salicylate hydroxylase 147.Nopaline synthase 199.Satellite RNA

148.Notch 200.Seed storage protein 149.NptII 201.Serine-threonine protein kinase I50.Nuclear inclusion protein 202.Serum albumin a 151.Nuclear inclusion protein 203.Shrunken 2 b 152.Nucleocapsid 204.Sorbitol dehydrogenase 153.Nucleoprotein 205.Sorbitol synthase Table 2 - Part 1.(continued) Non-limiting examples of transgenic genes & gene knockouts 209.Systemic acquired resistance219._ Trichosanthin gene 8.2 ~

210.Tetracycline binding protein220.Trifolitoxin 211.Thioesterase (x2) 221.Trypsin inhibitor 212.Thiolase 222.T-URF13 mitochondria) 213.TobRB7 223.UDP glucose glucosyliransferase 214.Transcriptional activator 224.Violaxanthin de-epoxidase 215.Transposon Tn5 225.Violaxanthin de-epoxidase knockout 216.Trehalase 226.Wheat germ agglutinin 217.Trehalase knockout 227.Xanthosine-N7-methyltransferase knockout 218.Trichodiene synthase 228.Zein storage protein Table 2 - Part 2. Non-limiting examples of input traits/phenotypes 1. 2,4-D tolerant 52. Flowering time altered 2. Alemaria resistant 53. Frogeye leaf spot resistant 3. Altered amino acid composition54. Fruit ripening altered 4. Altemaria solani resistant 55. Fruit ripening delayed 5. Ammonium assimilation increased56. Fruit rot resistant 6. AMV resistant 57. Fruit solids increased 7. Aphid resistant 58. Fruit sweetness increased 8. Apple scab resistant 59. Fungal post-harvest resistant 9. Aspergillus resistant 60. Fungal resistant 10. B-1,4-endoglucanase 61. Fungal resistant general I Bacterial leaf blight resistant62. Fusarium resistant 1.

12. Bacterial speck resistant 63. Glyphosate tolerant 13. BCTV resistant 64. Growth rate altered 14. Blackspot bruise resistant 65. Growth rate reduced I5. BLRV resistant 66. Heat stable glucanase produced 16. BNYVV Resistant 67. Hordothionin produced 17. Botrytis cinerea resistant 68. Imidazolinone tolerant I Botrytis resistant 69. Insect resistant general 8.

19. BPMV resistant 70. Kanamycin resistant 20. Bromoxynil tolerant 71. Lepidopteran resistant 21. BYDV resistant 72. Lesser cornstalk borer resistant 22. BYMV resistant 73. LMV resistant 23. Carbohydrate metabolism 74. Loss of systemic resistance altered 24. Cell wall altered 75. Male sterile 25. Chlorsulfuron tolerant 76. Marssonina resistant 26. Clavibacter resistant 77. MCDV resistant 27. CLRV resistant 78. MCMV resistant 28. CMV resistant 79. MDMV resistant 29. Cold tolerant 80. MDMV-B resistant 30. Coleopteran resistant 81. Mealybug wilt virus resistant 31. Colletotrichum resistant 82. Melamtsora resistant 32. Colorado potato beetle resistant83. Melodgyne resistant 33. Constitutive expression 84. Methotrexate resistant of glutamine synthetase 34. Corynebacterium sepedonicum85. Mexican Rice Borer resistant resistant 35. Cottonwood leaf beetle resistant86. Nucleocapsid protein produced 36. Crown gall resistant 87. Oblique banded leafroller resistant 37. Crown rot resistant 88. PEMV resistant 38. Cucumovirus resistant 89. PeSV resistant 39. Cutting rootability increased90. Phoma resistant 40. Downy mildew resistant 91. Phosphinothricin tolerant 41. Drought tolerant 92. Phratora leaf beetle resistant 42. Erwinia carotovora resistant93. Phytophthora resistant 43. Ethylene production reduced94. PLRV resistant 44. European Com Borer resistant95. Polyamine metabolism altered 45. Female sterile 96. Potyvirus resistant 46. Fenthion susceptible 97. Powdery mildew resistant 47. Fertility altered 98. PPV resistant 48. Fire blight resistant 99. Pratylenchus vulnus resistant 49. Flower and fruit abscission100.Proteinase inhibitors level reduced constitutive 50. Flower and fruit set altered101.- PRSV resistant 51. Flowering altered ~ 102.PRV resistant Table 2 - Part 2.(continued)Non-limiting examples of transgenic input traits/phenotypes 103.PSbMV resistant 128.Streptomyces scabies resistant 104.Pseudomonas syringae resistant129.Sulfonylurea tolerant -I05.PStV resistant 130.Tetracycline binding protein produced 106.PVX resistant 131.TEV resistant 107.PVY resistant 132.Thelaviopsis resistant 108.RBDV resistant 133.TMV resistant 109.l2hizoctonia resistant 134.Tobamovirus resistant 110.Rhizoctonia solani resistant135.ToMoV resistant 111.Ring rot resistance 136.ToMV resistant 112.Root-knot nematode resistant137.Transposon activator 113.SbMV resistant 138.Transposon inserted I Sclerotinia resistant 139.TRV resistant 14.

I SCMV resistant 140.TSWV resistant 15.

116.SCYLV resistant 141.TVMV resistant I Secondary metabolite increased142.TYLCV resistant 17.

I Seed set reduced 143.Tyrosine level increased I
8.

119.Selectable marker 144.Venturia resistant 120.Senescence altered 145.Verticillium dahliae resistant 121.Septoria resistant 146.Verticillium resistant 122.Shorter stems 147.Visual marker 123.Soft rot fungal resistant 148.WMV2 resistant 124.Soft rot resistant 149.WSMV resistant 125.SqMV resistant 150.Yield increased 126.SrMV resistant 151.ZYMV resistant 127.Storage protein altered Table 2 - Part 3. Non-limiting examples of output traits/phenotypes I. ACC oxidase level decreased 36.Oil profile altered 2. Altered lignin biosynthesis 37.Pectin esterase level reduced 3. B-1,4-endoglucanase 38.Pharmaceutical proteins produced 4. Botrytis resistant 39.Phosphinothricin tolerant 5. Carbohydrate metabolism altered40.Phytoene synthase activity increased 6. Carotenoid content altered 41.Pigment metabolism altered 7. Cell wall altered 42.Polygalacturonase level reduced 8. CMV resistant 43.Processing characteristics altered 9. Coleopteran resistant 44.Prolonged shelf life 10.Dry matter content increased45.Protein altered 1 Ethylene production reduced 46.Protein quality altered I.

12.Ethylene synthesis reduced 47.PRSV resistant 13.atty acid metabolism altered48.Root-knot nematode resistant 14.Fire blight resistant 49.Sclerotinia resistant I5.Flower and fruit abscission 50.Seed composition altered reduced 16.Flower and fruit set altered51.Seed methionine storage increased 17.Flowering time altered 52.Seed set reduced 18.Fruit firmness increased 53.Seed storage protein 19.Fruit pecrin esterase levels54.Senescence altered (e.g.
decreased Shelf life increased) 20.Fruit ripening altered ~ 55.Shorter stems 21.Fruit ripening delayed 56.Solids increased 22.Fruit solids increased 57.SqMV resistant 23.Fruit sugar profile altered 58.Starch level increased 24.Fruit sweetness increased 59.Starch metabolism altered 25.Glucuronidase expressing 60.Starch reduced 26.Heat stable glucanase produced61.Sterols increased 27.Heavy metals sequestered 62.Storage protein altered 28.Hordothionin produced 63.Sugar alcohol levels increased 29.Improved fruit quality 64.Tetracycline binding protein produced 30.Industrial enzyme produced 65.Tyrosine level increased 31.Lepidopteran resistant 66.Verticillium resistant 32.Lysine level increased 67.Visual marker 33.Mealybug wilt virus resistant68.WMV2 resistant 34.Methionine level increased 69.Yield increased 35.Nucleocapsid protein produced70.ZYMV resistant Table 2 - Part 4. Non-limiting examples of traits/phenotypes with agronomic properties I. ACC oxidase level decreased 53.Industrial enzyme produced _ 2. Altered amino acid composition54.Lignin levels decreased 3. Altered lignin biosynthesis 55.Lipase expressed in seeds 4. Altered maturing 56.Lysine level increased S. Altered plant development 57.Male sterile 6. Aluminum tolerant 58.Male sterile reversible 7. Ammonium assimilation increased59.Methionine level increased 8. Anthocyanin produced in seed60.Modified growth characteristics 9. B-1,4-endoglucanase 61.Mycotoxin degradation 10.Calmodulin level altered 62.Nitrogen metabolism altered 11.Carbohydrate metabolism altered63.Nucleocapsid protein produced 12.Carotenoid content altered 64.Oil profile altered 13.Cell wall altered 65.Oil uality altered q 14.Cold tolerant 66.Oxidative stress tolerant 15.Constitutive expression of 67.Pectin glutamine synthetase esterase level reduced 16.Cutting root ability increased68.Pharmaceutical proteins produced 17.Development altered 69.Photosynthesis enhanced 18.Drought tolerant 70.Phytoene synthase activity increased 19.Dry matter content increased71.Pigment metabolism altered 20.Environmental stress reduced72.Polyamine metabolism altered 21.Ethylene metabolism altered 73.Polygalacturonase level reduced 22.Ethylene production reduced 74.Pratylenchus wlnus resistant 23.Ethylene synthesis reduced 75.Processing characteristics altered 24.Fatty acid metabolism altered76.Prolonged shelf life 25.Female sterile 77.Protein altered 26.Fenthion susceptible 78.Protein lysine level increased 27.Fertility altered 79.Protein quality altered 28.Fiber quality altered 80.Proteinase inhibitors level constitutive 29.Flower and fruit abscission 81.Salt reduced tolerance increased 30.Flower and fruit set altered82.Seed composition altered 31.Flowering altered 83.Seed methionine storage increased 32.Flower color altered 84.Seed set reduced 33.Flowering time altered 85.Selectable marker 34.Fruit firmness increased 86.Senescence altered 35.Fruit pectin esterase and 87.Shorter levels decreased stems 36.Fruit polygalacturonase level88.Solids decreased increased 37.Fruit ripening altered 89.Starch level increased 38.Fruit ripening delayed 90.Starch metabolism altered 39.Fruit solids increased 91.Starch reduced 40.Fruit sugar profile altered 92.Sterols increased 41.Fruit sweetness increased 93.Storage protein altered 42.Glucuronidase expressing 94.Stress tolerant 43.Growth rate altered 95.Sugar alcohol levels increased 44.Growth rate increased 96. Tetracycline binding protein produced 45.Growth rate reduced 97. Thermostable protein produced 46.Heat stable glucanase produced98. Transposon activator 47.Heat tolerant 99. Transposon inserted 48.Heavy metals sequestered 100.Tyrosine level increased 49.Hordothionin produced 101.Visual marker 50.Improved fruit quality 102.Vivipary increased 51.Increased phosphorus 103.Yield increased 52.Increased stalk strength Table 2 - Part 5. Non-limiting examples of traits/phenotypes with product quality properties I. 2,4-D tolerant 45.Melanin produced in cotton fibers 2. ACC oxidase level decreased 46.Metabolism altered y 3. Altered amino acid composition47.Methionine level increased 4. Altered lignin biosynthesis 48.Mycotoxin degradation 5. Anfhocyanin produced in seed49.Mycotoxin production inhibited 6. Antioxidant enzyme increased50.Nicotine levels reduced 7. Auxin metabolism and increased51.Nitrogen metabolism altered tuber solids 8. B-1,4-endoglucanase 52.Novel protein produced 9. Blackspot bruise resistant 53.Nutritional quality altered 10.Brown spot resistant 54.Oil profile altered I Bruising reduced 55.Oil quality altered I.

12.Caffeine levels reduced 56.Pectin esterase Ievet reduced 13.Carbohydrate metabolism altered57.Photosynthesis enhanced 14.Carotenoid content altered 58.Phytoene synthase activity increased 15.Cell wall altered 59.Pigment metabolism altered 16.Cold tolerant 60.Polyamine metabolism altered 17.Delayed softening 61.Polygalacturonase level reduced 18.Disulfides reduced in endosperm62.Processing characteristics altered 19.Dry matter content increasedb3.Prolonged shelf life 20.Ear mold resistant 64.Protein altered 21.Ethylene production reduced 65.Protein lysine level increased 22.Ethylene synthesis reduced 66.Protein quality altered 23.Extended flower life 67.Proteinase inhibitors level constitutive 24.Fatty acid metabolism altered68.Rust resistant 25.Fiber quality altered 69.Seed composition altered 26.Fiber strength altered 70.Seed methionine storage increased 27.Flavor enhancer 71.Seed number increased 28.Flower and fruit abscission 72.Seed quality altered reduced 29.Fruit firn~ness increased 73.Seed set reduced 30.Fruit invertase level decreased74.Seed weight increased 31.Fruit polygalacturonase level75.Senescence altered decreased 32.Fruit ripening altered 76.Solids increased 33.Fruit ripening delayed 77.Starch level increased 34.Fruit solids increased 78.Starch metabolism altered 35.Fruit sugar profile altered 79.Starch reduced 36.Fruit sweetness increased 80.Steroidal glycoalkaloids reduced 37.Glyphosate tolerant 81.Sterols increased 38.Heat stable glucanase produced82.Storage protein altered 39.Improved fruit quality 83.Sugar alcohol levels increased 40.Tncreased phosphorus 84.Thermostable protein produced 41.Increased protein levels 85.Tryptophan level increased 42.Lignin levels decreased 86.Tuber solids increased 43.Lysine level increased 87.Yield increased 44.Male sterile Table 2 - Part 6. Non-limiting examples of traits/phenotypes with herbicide tolerance properties 1. 2,4-D tolerant I 1. Sulfonylurea tolerant 2. Chloroacetanilide tolerant 12. Northern corn leaf blight resistant 3.Fertility altered 13.Herbicide tolerant 4.Protein altered 14.Isoxazole tolerant 5.Lignin levels decreased 15.Chlorsulfuron tolerant 6.Methionine level increased 16.Glyphosate tolerant 7.Bromoxynil tolerant 17.Lepidopteran resistant 8.Metabolism altered 18.Phosphinothricin tolerant 9.Imidazole tolerant 19.Sulfonylurea tolerant 10.Imidazolinone tolerant Table 2 - Part 7. Non-limiting examples of traits/phenotypes with pest resistance properties Legend me - rsactenat tcesistant NR - Nematode Resistant FR - Fungal Resistant VR - Viral Resistant IR - Insent Resistant 1. _ Agrobacterium resistant- 44. Ear mold resistant- FR
BR

2. Alternaria resistant- FR 45. Erwinia carotovora resistant-BR

3. Alternaria daucii resistant-46. European Com Borer resistant-FR IR

4. Alternaria solani resistant-47. Eyespot resistant - FR
FR

5. AMV resistant - VR 48. Fall annyworm resistant -IR

6. Anthracnoseresistant-FR 49. Fire blight resistant-BR

7. Aphid resistant - IR 50. Frogeye leaf spot resistanT-FR

8. Apple scab resistant-FR S1. Fruit rot resistant-FR

9. Aspergillus resistant- FR 52. Fungal post-harvest resistant - FR

10.Bacterial leaf blight resistant53. Fungal resistant- FR
- BR

11.Bacterial resistant - BR 54. Fungal resistant general - FR

12.Bacterial soft rot resistant-55. Fusarium dehlae resistant BR - FR

13.Bacterial soft rot resistant-56. Fusarium resistant- FR
VR

14.Bacterial speck resistant- 57. Geminivirus resistant- VR
BR

15.BCTV resistant- VR 58. Gray lead spot resistant - FR

16.Black shank resistant - FR 59. Helminthosporium resistant - FR

17.BLRV resistant - VR 60. Hordothionin produced - BR

18.BNYW resistant - VR 61. Insect predator resistant - IR

19.Botrytis cinerea resistant 62. Insect resistant general - FR - IR

20.Botrytis resistant - FR 63. Late blight resistant - FR

21.BPMV resistant- VR 64. Leaf blight resistant- FR

22.Brown spot resistant- FR 65. Leaf spot resistant- FR

23.Bl'DV resistant- VR 66. Lepidopteran resistant- IR

24.BYNiV resistant - VR 67. Lesser cornstalk borer resistant - IR

25.CaMVresistant-VR 68. LMVresistant-VR

26.Cercospora resistant - FR 69. Loss of systemic resistance - VR

27.Clavibacter resistant- BR 70. Marssonina resistant- FR

28.Closteroviursresistant-BR 71. MCDVresistant-VR

29.CLRV resistant- VR 72. MCMV resistant- VR

30.CMVresistant-FR 73. MDMVresistant-VR

31.Coleopteran resistant - IR 74. MDMV-B resistant - VR

32.Colletotrichum resistant- 75. Mealybug wilt virus resistant-FR VR

33.Colorado potato beetle resistant-76. Melamtsora resistant- FR
IR

34.Corn earworm resistant- IR 77. Melodgyne resistant- NR

35.Corynebacterium sepedonicum 78. Meloidogyne resistant-NR
resistant- BR

36.Cottonwood leaf beetle resistant79. Mexican Rice Borer resistant-- IR IR

37.Criconnemellaresistant-NR 80. Mycotoxindegradation-FR

38.Crown gal resistant- BR 81. Nepovirus resistant- VR

39.Cucumovirus resistant- VR 82. Northern com leaf blight resistant- IR

40.Cylindrosporium resistant-FR83. Nucleocapsid protein produced-VR

41.Disease resistant general 84. Oblique banded leafroller - FR resistant - IR

42.D011ar spot resistant- FR 85. Oomycete resistant- FR

43.Downy mildew resistant - 86. Pathogenesis related proteins FR level increased - FR

Table 2 - Part 7. (continued) Non-limiting examples of traits/phenotypes with pest resistance properties 87. PEMV resistant-VR _ 116. SMV resistant-VR

88. PeSV Resistant- VR 117. Sod web worm resistant-_ IR

89. Phatora leaf beetle resistant-1 SoR rot fungal resistant-IR I FR
8.

90. Phoma resistant- FR 119. Soft rot resistant- BR

91. Phytophthora resistant- 120. Southwestern corn borer FR resistant- IR

92. PLRV resistant-VR 121. SPFMV resistant-VR

93. Potyvirus resistant- VR I22. Sphaeropsffs fruit rot resistant-FR

94. Powdery mildew resistant- 123. SqMV resistant- VR
FR

95. PPVresistant-VR 124. SrMVresistant-VR

96. Pratylenchus vulnus resistant-NR125. Streptomyces scabies resistant-BR

97. PRSV resistant- VR 126. Sugar cane borer resistant-IR

98. PRV resistant - VR 127. TEV resistant- VR

99. PSbMVresistant-VR 128.'Thelaviopsisresistant-FR

100. Pseudomonas syringae resistant-BR129. TMV resistant-FR

101. PStV resistant- VR 130. Tobamovirus resistant- VR

102. PVXresistant-VR 131. ToMoVresistant-VR

103. PVY resistant- VR 132. ToMV resistant- VR

104. RBDV resistant-VR 133. TRV resistant-VR

105. Rhizoctoniaresistant-FR 134. TSWVresistant-VR

106. Rhizoctonia solani resistant-135. TVMV resistant- VR
FR

I Ring rot resistance - BR 136. TYLCV resistant - VR
07.

108. Root-knot nematode resistant-137. Venturia resistant - FR
NR

109. Rust resistant-FR 138. Verticillium dahliae resistant-FR

I SbMV resistant- VR 139. Verticillium resistant-FR
10.

111. Sclerotinia resistant - 140. Western corn root worm resistant-FR IR

I SCMV resistant-VR 141. WMV2 resistant-VR
I2.

113. SCYLV resistant-VR 142. WSMV resistant-VR

114. Septoriaresistant-FR 143. ZYMVresistant-VR

115. Smut resistant- FR

Table 2 - Part 8. Non-limiting examples of miscellaneous traits/phenotypes with properties 1. Antibiotic produced 31.Mycotoxin production inhibited 2. Antiprotease producing 32.Mycotoxin restored ___ _ 3. Capable of growth on defined33.Non-lesion forming mutant synthetic media 4. Carbohydrate metabolism altered34.Novel protein produced 5. Cell wall altered 35.Oil quality altered 6. Cold tolerant 36.Peroxidase levels increased 7. Coleopteran resistant 37.Pharmaceutical proteins produced 8. Color altered 38.Phosphinothricin tolerant 9. Color sectors in seeds 39.Pigment metabolism altered 10.Colored sectors in leaves 40.Pollen visual marker I Constitutive expression of 41.Polyamine metablosim altered 1. glutamine synthetase 12.Cre recombinase produced 42.Polymer produced 13.Dalapon tolerant 43.Recombinase produced 14.Development altered 44.Secondary metabolite increased I5.Disease resistant general 45.Seed color altered 16.Ethylene metabolism altered 46.Seed weight increased 17.Expression optimization 47.Selectable marker 18.Fenthion susceptible 48.Spectromycin resistant 19.Glucuronidase expressing 49.Sterile 20.Glyphosate tolerant 50.Sterols increased 21.Growth rate reduced 51.Sulfonylurea susceptible 22.Heavy metals sequestered 52.Syringomycin deficient 23.Hygromycin tolerant 53.Transposon activator 24.Inducible DNA modification 54.Transposon elements inserted 25.Industrial enzyme produced 55.Transposon inserted 26.Kanamycin resistant 56.Trifolitoxin producing 27.Lipase expressed in seeds 57.Trifolitoxin resistant In a particular examplification, "producing an organism having a desirable trait"
includes an organism that is with respect to an organ or a part of an organ but not necessarily altered anywhere else.
By "trait" is meant any detectable parameter associated with an organism under a set of conditions. Examples of "detectable parameters" include the ability to produce a substance, the ability to not produce a substance, an altered pattern of (such as an increased or a decreased) ability to produce a substance, viability, non-viability, behaviour, growth rate, size, morphology or morphological characteristic, In another embodiment, this invention is directed to a method of producing an organism having a desirable trait or a desirable improvement in a trait by: a) obtaining an initial population of organisms comprised of at least one starting organism, b) mutagenizing the population such that mutations occur throughout a substantial part of the genome of at least one initial organism, c) selecting at least one mutagenized organism having a desirable trait or a desirable improvement in a trait, and d) optionally repeating the method by subjecting one or more mutagenized organisms to a repetition of the method. A mutagenized organism having a desirable trait or a desirable improvement in a trait can be referred to as an "up-mutant", and the associated mutations) contained in an up-mutant organism can be referred to as up-mutation(s).
In one embodiment, step c) is comprised of selecting at least two different mutagenized organisms, each having a different mutagenized genome, and the method of producing an organism having a desirable trait or a desirable improvement in a trait is comprised of a) obtaining a starting population of organisms comprised of at least one starting organism, b) mutagenizing the population such that mutations occur throughout a substantial part of the genome of at least one starting organism, c) selecting at least two mutagenized organism having a desirable trait or a desirable improvement in a trait, d) creating combinations of the mutations of the two or more mutagenized organisms, e) selecting at least one mutagenized organism having a desirable trait or a desirable improvement in a trait, and f) optionally repeating the method by subjecting one or more mutagenized organisms to a repetition of the method.
In one embodiment, the method is repeated. Thus, for example, an up-mutant organism can serve as a starting organism for the above method. Also, for example, an up mutant organism having a combination of two or more up-mutations in its genome can serve as a starting organism for the above method.
Thus, in one embodiment, this invention is directed to a method of producing an organism having a desirable trait or a desirable improvement in a trait by: a) obtaining a starting population of organisms comprised of at least one starting organism, b) mutagenizing the population such that mutations occur throughout a substantial part of the genome of at least one starting organism, c) selecting at least one mutagenized organism having a desirable trait or a desirable improvement in a trait, and d) optionally repeating the method by subjecting one or more mutagenized organisms to a repetition of the method. A mutagenized organism having a desirable trait or a desirable improvement in a trait can be referred to as an "up-mutant", and the associated mutations) contained in an up-mutant organism can be referred to as up-mutation(s).
Mutagenizing a starting population such that mutations occur throughout a substantial part of the genome of at least one starting organism refers to mutagenizing at least approximately 1% of the genes of a genome, or at least approximately 10%
of the genes of a genome, or at least approximately 20% of the genes of a genome, or at least approximately 30% of the genes of a genome, or at least approximately 40% of the genes of a genome, or at least approximately 50% of the genes of a genome, or at least approximately 60% of the genes of a genome, or at least approximately 70% of the genes of a genome, or at least approximately 80% of the genes of a genome, or at least approximately 90% of the genes of a genome, or at least approximately 95% of the genes of a genome, or at least approximately 98% of the genes of a genome.
In a particular embodiment, this invention provides a method of producing an organism having a desirable trait or a desirable improvement in a trait by: a) obtaining sequence information of a genome; b) annotating the genomic sequence obtained;
c) mutagenizing a substantial part of the genome the genome; d) selecting at least one mutagenized genome having a desirable trait or a desirable improvement in a trait; and e) optionally repeating the method by subjecting one or more mutagenized genomes to a repetition of the method.
Thus in one aspect, this invention provides a process comprised of 1.) Subjecting a working cell or organism to holistic monitoring (which can include the detection and/or measurement of all detectable functions and physical parameters).
Examples of such parameters include morphology, behavior, growth, responsiveness to stimuli (e.g., antibiotics, different environment, etc.). Additional examples include all measurable molecules, including molecules that are chemically at least in part a nucleic acids, proteins, carbohydrates, proteoglycans, glycoproteins, or lipids. In a particular aspect, performing holistic monitoring is comprised of using a microarray-based method.
In another aspect, performing holistic monitoring is comprised of sequencing a substantial portion of the genome, i.e. for example at least approximately 10% of the genome, or for example at least approximately 20% of the genome, or for example at least approximately 30% of the genome, or for example at least approximately 40% of the genome, or for example at least approximately SO% of the genome, or for example at least approximately 60% of the genome, or for example at least approximately 70% of the genome, or for example at least approximately 80% of the genome, or for example at least approximately 90% of the genome, or for example at least approximately 95% of the genome, or for example at least approximately 98% of the genome.
2) Introducing into the working cell or organism a plurality of traits (stacked traits), including selectively and differentially activatable traits. Serviceable traits for this purpose include traits conferred by genes and traits conferred by gene pathways.
3) Subjecting the working cell or organism to holistic monitoring.
4) Compiling the information obtained from steps 1) and 3), and processing &lor analyzing it to better understand the changes introduced into the working cell or organisms. Such data processing includes identifying correlations between and/or among the measured parameters.

S) Repeating any number or all of steps 2), 3), and 4).
This invention provides that molecules serviceable for introducing transgenic traits into a plant include all known genes and nucleic acids. By way of non-limiting exemplification, this invention specifically names any number &/or combination of genes listed herein or listed in any reference incorporated herein by reference .
Furthermore, by way of non-limiting exemplification, this invention specifically names any number &/or combination of genes & gene pathways listed herein as well as in any reference incorporated by reference herein. This invention provides that molecules serviceable as detectable parameters include molecule, any enzyme, substrate thereof, product thereof, and any gene or gene pathway listed herein including in any figure or table herein as well as in any reference incorporated by reference herein.
This invention also relates generally to the field of nucleic acid engineering and correspondingly encoded recombinant protein engineering. More particularly, the invention relates to the directed evolution of nucleic acids and screening of clones containing the evolved nucleic acids for resultant activity(ies) of interest, such nucleic acid activity(ies) &/or specified protein, particularly enzyme, activity(ies) of interest.
Mutagenized molecules provided by this invention may have chimeric molecules and molecules with point mutations, including biological molecules that contain a carbohydrate, a lipid, a nucleic acid, ~lor a protein component, and specific but non-limiting examples of these include antibiotics, antibodies, enzymes, and steroidal and non-steroidal hormones.
This invention relates generally to a method of 1) preparing a progeny generation of molecules) (including a molecule that is comprised of a polynucleotide sequence, a molecule that is comprised of a polypepdde sequence, and a molecules that is comprised in part of a polynucleotide sequence and in part of a polypeptide sequence), that is mutagenized to achieve at least one point mutation, addition, deletion, &/or chimerization, from one or more ancestral or parental generation template(s); 2) screening the progeny generation molecules) -preferably using a high throughput method - for at least one property of interest (such as an improvement in an enzyme activity or an increase in stability or a novel chemotherapeutic effect); 3) optionally obtaining &/or cataloguing structural &/or and functional information regarding the parental &/or progeny generation molecules; and 4) optionally repeating any of steps 1) to 3).
In a preferred embodiment, there is generated (e.g. from a parent polynucleotide template) - in what is termed "codon site-saturation mutagenesis" - a progeny generation of polynucleotides, each having at least one set of up to three contiguous point mutations (i.e. different bases comprising a new codon), such that every codon (or every family of degenerate codons encoding the same amino acid) is represented at each codon position.
Corresponding to - and encoded by - this progeny generation of polynucleotides, there is also generated a set of progeny polypeptides, each having at least one single amino acid point mutation. In a preferred aspect, there is generated - in what is termed "amino acid site-saturation mutagenesis" - one such mutant polypeptide for each of the 19 naturally encoded polypeptide-forming alpha-amino acid substitutions at each and every amino acid position along the polypeptide. This yields - for each and every amino acid position along the parental polypeptide - a total of 20 distinct progeny polypeptides including the original amino acid, or potentially more than 21 distinct progeny polypeptides if additional amino acids are used either instead of or in addition to the 20 naturally encoded amino acids Thus, in another aspect, this approach is also serviceable for generating mutants containing - in addition to &/or in combination with the 20 naturally encoded polypeptide-forrriing alpha-amino acids - other rare &/or not naturally-encoded amino acids and amino acid derivatives. In yet another aspect, this approach is also serviceable for generating mutants by the use of - in addition to &/or in combination with natural or unaltered codon recognition systems of suitable hosts - altered, mutagenized, &lor designer codon recognition systems (such as in a host cell with one or more altered tRNA
molecules).
In yet another aspect, this invention relates to recombination and more specifically to a method for preparing polynucleotides encoding a polypeptide by a method of in vivo re-assortment of polynucleotide sequences containing regions of partial homology, assembling the polynucleotides to form at least one polynucleotide and screening the polynucleotides for the production of polypeptide(s) having a useful property.

In yet another preferred embodiment, this invention is serviceable for analyzing and cataloguing - with respect to any molecular property (e.g. an enzymatic activity) or combination of properties allowed by current technology - the effects of any mutational change achieved (including particularly saturation mutagenesis). Thus, a comprehensive method is provided for determining the effect of changing each amino acid in a parental polypeptide into each of at least I9 possible substitutions. This allows each amino acid in a parental polypeptide to be characterized and catalogued according to its spectrum of potential effects on a measurable property of the polypeptide.
In another aspect, the method of the present invention utilizes the natural property of cells to recombine molecules and/or to mediate reductive processes that reduce the complexity of sequences and extent of repeated or consecutive sequences possessing regions of homology.
It is an object of the present invention to provide a method for generating hybrid polynucleotides encoding biologically active hybrid polypeptides with enhanced activities.
In accomplishing these and other objects, there has been provided, in accordance with one aspect of the invention, a method for introducing polynucleotides into a suitable host cell and growing the host cell under conditions that produce a hybrid polynucleotide.
In another aspect of the invention, the invention provides a method for screening for biologically active hybrid polypeptides encoded by hybrid polynucleotides.
The present method allows for the identification of biologically active hybrid polypeptides with enhanced biological activities.
Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

In yet another aspect, this invention relates to a method of discovering which phenotype corresponds to a gene by disrupting every gene in the organism.
Accordingly, this invention provides a method for determining a gene that alters a characteristic of an organism, comprising: a) obtaining an initial population of organisms, b) generating a set of mutagenized organisms, such that when all the genetic mutations in the set of mutagenized organisms are taken as a whole, there is represented a set of substantial genetic mutations, and c) detecting the presence an organism having an altered trait, and d) determining the nucleotide sequence of a gene that has been mutagenized in the organism having the altered trait.
In yet another aspect, this invention relates to a method of improving a trait in an organism by functionally knocking out a particular gene in the organism, and then transferring a libiary of genes, which only vary from the wild-type at one codon position, into the organism.
Accordingly, this invention provides a method method for producing an organism with an improved trait, comprising:
a) functionally knocking out an enogenous gene in a substantially clonal population of organisms;
b) transfernng the set of altered genes into the clonal population of organisms, wherein each altered gene differs from the endogenous gene at only one codon;
and c) detecting a mutagenized organism having an improved trait; and d) determining the nucleotide sequence of a gene that has been transferred into the detected organism.
D. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Exonuclease Activity Figure 1 shows the activity of the enzyme exonuclease III. This is an exemplary enzyme that can be used to shuffle, assemble, reassemble, recombine, and/or concatenate polynucleotide building blocks. The asterisk indicates that the enzyme acts from the 3' direction towards the 5' direction of the polynucleotide substrate.

Figure 2. Generation of A Nucleic Acid Building Block by PoIymerase-Based Amplification. Figure 2 illustrates a method of generating a double-stranded nucleic acid building block with two overhangs using a polymerase-based amplification reaction (e.g., PCR). As illustrated, a first polymerase-based amplification reaction using a first set of primers, F2 and R~, is used to generate a blunt-ended product (labeled Reaction 1, Product 1), which is essentially identical to Product A. A second polymerase-based amplification reaction using a second set of primers, FI and R2, is used to generate a blunt-ended product (labeled Reaction 2, Product 2), which is essentially identical to Product B.
These two products are then mixed and allowed to melt and anneal, generating a potentially useful double-stranded nucleic acid building block with two overhangs. In the example of Fig. 1, the product with the 3' overhangs (Product C) is selected for by nuclease-based degradation of the other 3 products using a 3' acting exonuclease, such as exonuclease III.
Alternate primers are shown in parenthesis to illustrate serviceable primers may overlap, and additionally that serviceable primers may be of different lengths, as shown.
FIGURE 3. Unique Overhangs And Unique Couplings. Figure 3 illustrates the point that the number of unique overhangs of each size (e.g. the total number of unique overhangs composed of 1 or 2 or 3, etc. nucleotides) exceeds the number of unique couplings that can result from the use of all the unique overhangs of that size. For example, there are 4 unique 3' overhangs composed of a single nucleotide, and 4 unique 5' overhangs composed of a single nucleotide. Yet the total number of unique couplings that can be made using all the 8 unique single-nucleotide 3' overhangs and single-nucleotide S' overhangs is 4.
FIGURE 4. Unique Overall Assembly Order Achieved by Sequentially Coupling the Building Blocks Figure 4 illustrates the fact that in order to assemble a total of "n" nucleic acid building blocks, "n-1" couplings are needed. Yet it is sometimes the case that the number of unique couplings available for use is fewer that the "n-1" value. Under these, and other, circumstances a stringent non-stochastic overall assembly order can still be achieved by performing the assembly process in sequential steps. In this example, 2 sequential steps are used to achieve a designed overall assembly order for five nucleic acid building blocks. In this illustration the designed overall assembly order for the five nucleic acid building blocks is: 5'-(#1-#2-#3-#4-#5)-3', where #1 represents building block number l, etc.
FIGURE 5. Unique Couplings Available Using a Two-Nucleotide 3' Overhang.
Figure 5 further illustrates the point that the number of unique overhangs of each size (here, e.g. the total number of unique overhangs composed of 2 nucleotides) exceeds the number of unique couplings that can result from the use of all the unique overhangs of that size. For example, there are 16 unique 3' overhangs composed of two nucleotides, and another 16 unique S' overhangs composed of two nucleotides, for a total of 32 as shown.
Yet the total number of couplings that are unique and not self binding that can be made using all the 32 unique double-nucleotide 3' overhangs and double-nucleotide 5' overhangs is 12. Some apparently unique couplings have "identical twins"
(marked in the same shading), which are visually obvious in this illustration. Still other overhangs contain nucleotide sequences that can self bind in a palindromic fashion, as shown and labeled in this figure; thus they not contribute the high stringency to the overall assembly order.
Figure 6. Generation of an Exhaustive Set of Chimeric Combinations by Synthetic Ligation Reassembly. Figure 6 showcases the power of this invention in its ability to generate exhaustively and systematically all possible combinations of the nucleic acid building blocks designed in this example. Particularly large sets (or libraries) of progeny chimeric molecules can be generated. Because this method can be performed exhaustively and systematically, the method application can be repeated by choosing new demarcation points and with correspondingly newly designed nucleic acid building blocks, bypassing the burden of re-generating and re-screening previously examined and rejected molecular species. It is appreciated that, codon wobble can be used to advantage to increase the frequency of a demarcation point. In other words, a particular base can often be substituted into a nucleic acid building block without altering the amino acid encoded by progenitor codon (that is now altered codon) because of codon degeneracy. As illustrated, demarcation points are chosen upon alignment of 8 progenitor templates.
Nucleic acid building blocks including their overhangs (which are serviceable for the formation of ordered couplings) are then designed and synthesized. In this instance, 18 nucleic acid building blocks are generated based on the sequence of each of the 8 progenitor templates, for a total of 144 nucleic acid building blocks (or double-stranded oligos).
Performing the ligation synthesis procedure will then produce a library of progeny molecules comprised of yield of 81g (or over 1.8 x 1016) chimeras.
Figure 7. Synthetic genes from oligos:. According to one embodiment of this invention, double-stranded nucleic acid building blocks are designed by aligning a plurality of progenitor nucleic acid templates. Preferably these templates contain some homology and some heterology. The nucleic acids may encode related proteins, such as related enzymes, which relationship may be based on function or structure or both. Figure 7 shows the alignment of three polynucleotide progenitor templates and the selection of demarcation points (boxed) shared by all the progenitor molecules. In this particular example, the nucleic acid building blocks derived from each of the progenitor templates were chosen to be approximately 30 to 50 nucleotides in length.
Figure 8. Nucleic acid building blocks for synthetic ligation gene reassembly.
Figure 8 shows the nucleic acid building blocks from the example in Figure 7.
The nucleic acid building blocks are shown here in generic cartoon form, with their compatible overhangs, including both 5' and 3' overhangs. There are 22 total nucleic acid building blocks derived from each of the 3 progenitor templates. Thus, the ligation synthesis procedure can produce a library of progeny molecules comprised of yield of 32a (or over 3.1 x 101°) chimeras.
Figure 9. Addition of Introns by Synthetic Ligation Reassembly. Figure 9 shows in generic cartoon form that an intron may be introduced into a chimeric progeny molecule by way of a nucleic acid building block. It is appreciated that introns often have consensus sequences at both termini in order to render them operational. It is also appreciated that, in addition to enabling gene splicing, introns may serve an additional purpose by providing sites of homology to other nucleic acids to enable homologous recombination. For this purpose, and potentially others, it may be sometimes desirable to generate a large nucleic acid building block for introducing an intron. If the size is overly large easily genrating by direct chemical synthesis of two single stranded oligos, such a specialized nucleic acid building block may also be generated by direct chemical synthesis of more than two single stranded oligos or by using a polymerase-based amplification reaction as shown in Figure 2.
Figure 10. Ligation Reassembly Using Fewer Than All The Nucleotides Of An Overhang. Figure 10 shows that coupling can occur in a manner that does not make use of every nucleotide in a participating overhang. The coupling is particularly lively to survive (e.g. in a transformed host) if the coupling reinforced by treatment with a ligase enzyme to form what may be referred to as a "gap ligation" or a "gapped ligation". It is appreciated that, as shown, this type of coupling can contribute to generation of unwanted background product(s), but it can also be used advantageously increase the diversity of the progeny library generated by the designed ligation reassembly.
Figure 11. Avoidance of unwanted self ligation in palindromic couplings. As mentioned before and shown in Figure S, certain overhangs are able to undergo self coupling to form a palindromic coupling. A coupling is strengthened substantially if it is reinforced by treatment with a ligase enzyme. Accordingly, it is appreciated that the lack of S' phosphates on these overhangs, as shown, can be used advantageously to prevent this type of palindromic self ligation. Accordingly, this invention provides that nucleic acid building blocks can be chemically made (or ordered) that lack a 5' phosphate group (or alternatively they can be remove - e.g. by treatment with a phosphatase enzyme such as a calf intestinal alkaline phosphatase (CIAP) - in order to prevent palindromic self ligations in ligation reassembly processes.
Figure 12. Pathway Engineering. It is a goal of this invention to provide ways of making new gene pathways using ligation reassembly, optionally with other directed evolution methods such as saturation mutagenesis. Figure 12 illustrates a preferred approach that may be taken to achieve this goal. It is appreciated that naturally-occurring microbial gene pathways are linked more often than naturally-occurring eukaryotic (e.g.
plant) gene pathways, which are sometime only partially linked. In a particular embodiment, this invention provides that regulatory gene sequences (including promoters) can be introduced in the form of nucleic acid building blocks into progeny gene pathways generated by Iigation reassembly processes. Thus, originally linked microbial gene pathways, as well as originally unlinked genes and gene pathways, can be thus converted to acquire operability in plants and other eukaryotes.
Figure 13. Avoidance of unwanted self ligation in palindromic couplings.
Figure 13 illustrates that another goal of this invention, in addition to the generation of novel gene pathways, is the subjection of gene pathways - both naturally occurring and man-made -to mutagenesis and selection in order to achieve improved progeny molecules using the instantly disclosed methods of directed evolution (including saturation mutagenesis and synthetic ligation reassembly). In a particular embodiment, as provided by the instant invention, both microbial and plant pathways can be improved by directed evolution, and as shown, the directed evolution process can be performed both on genes prior to linking them into pathways, and on gene pathways themselves.
Figure 14. Conversion of Microbial Pathways to Eukaryotic Pathways. In a particular embodiment, this invention provides that microbial pathways can be converted to pathways operable in plants and other eukaryotic species by the introduction of regulatory sequences that function in those species. Preferred regulatory sequences include promoters, operators, and activator binding sites. As shown, a preferred method of achieving the introduction of such serviceable regulatory sequences is in the form of nucleic acid building blocks, particularly through the use of couplings in ligation reassembly processes. These couplings in Fig. 14 are marked with the letters A, B, C, D
and F.
Fig.15. Holistic engineering of differentially activatable stacked traits in noveltransgenic plants using directed evolution and whole cell monitoring.
Fig.16. Differential Activation of Selected Traits Can Be Achieved by Adjusting and Controlling the Environment of the Traits.
Fig.17. Harvesting, Processing, Storage.
Fig. l8. Processing.

Fig.19. Cellular Mutagenesis.
Figure Z0. Differential Activation of Selected Precursor (Inactive) Gene Products.
Figure 21. Starting population comprised of an organism strain to be subjected to improvement or evolution in order to produce a resultant population comprised of an improved organism strain that has a desired trait.
Figure 22. Starting population comprised of a genomic sequence to be subjected to improvement or evolution in order to produce a resultant population comprised of an improved genomic sequence that has a desired trait.
Fig. 23. Strain Improvement.
Fig. 24. Iterative Strain Improvement.
E. DEFINITIONS OF TERMS
In order to facilitate understanding of the examples provided herein, certain frequently occurring methods and/or terms will be described.
The term "agent" is used herein to denote a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds (e.g., a VLSIPS
peptide array, polynucleotide array, and/or combinatorial small molecule array), biological macromolecule, a bacteriophage peptide display library, a bacteriophage antibody (e.g., scFv) display library, a polysome peptide display library, or an extract made form biological materials such as bacteria, plants, fungi, or animal (particular mammalian) cells or tissues. Agents are evaluated for potential activity as anti-neoplastics, anti-inflammatories or apoptosis modulators by inclusion in screening assays described hereinbelow. Agents are evaluated for potential activity as specific protein interaction inhibitors (i.e., an agent which selectively inhibits a binding interaction between two predetermined polypeptides but which doe snot substantially interfere with cell viability) by inclusion in screening assays described hereinbelow.

An "ambiguous base requirement" in a restriction site refers to a nucleotide base requirement that is not specified to the fullest extent, i.e. that is not a specific base (such as, in a non-limiting exemplification, a specific base selected from A, C, G, and T), but rather may be any one of at least two or more bases. Commonly accepted abbreviations that are used in the art as well as herein to represent ambiguity in bases include the .
following: R=GorA;Y=CorT;M=AorC;K=GorT;S=GorC;W=AorT;H=
AorCorT;B=GorTorC;V=GorCorA;D=GorAorT;N=AorCorGorT.
The term "amino acid" as used herein refers to any organic compound that contains an amino group (-NHZ) and a carboxyl group (-COOH); preferably either as free groups or alternatively after condensation as part of peptide bonds. The "twenty naturally encoded polypeptide-forming alpha-amino acids" are understood in the art and refer to: alanine (ala or A), arginine (arg or R), asparagine (asn or I~, aspartic acid (asp or D), cysteine (cys or C), gluatamic acid (glu or E), glutamine (gln or Q), glycine (gly or G), histidine (his or H), isoleucine (ile or I), leucine (leu or L), lysine (lys or K), methionine (met or M), phenylalanine (phe or F), proline (pro or P), serine (ser or S), threonine (thr or T), tryptophan (trp or W~, tyrosine (tyr or Y), and valine (val or V).
The term "amplification" means that the number of copies of a polynucleotide is increased.
The term "antibody", as used herein, refers to intact immunoglobulin molecules, as well as fragments of immunoglobulin molecules, such as Fab, Fab', (Fab')a, Fv, and SCA fragments, that are capable of binding to an epitope of an antigen. These antibody fragments, which retain some ability to selectively bind to an antigen (e.g., a polypeptide antigen) of the antibody from which they are derived, can be made using well known methods in the art (see, e.g., Harlow and Lane, supra), and are described further, as follows.
(1) An Fab fragment consists of a monovalent antigen-binding fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain.
(2) An Fab' fragment of an antibody molecule can be obtained by treating a whole antibody molecule with pepsin, followed by reduction, to yield a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per antibody molecule treated in this manner.
(3) An (Fab')2 fragment of an antibody can be obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction. A
(Fab')2 fragment is a dimer of two Fab' fragments, held together by two disulfide bonds.
(4) An Fv fragment is defined as a genetically engineered fragment containing the variable region of a light chain and the variable region of a heavy chain expressed as two chains.
(5) An single chain antibody ("SCA") is a genetically engineered single chain molecule containing the variable region of a light chain and the variable region of a heavy chain, linked by a suitable, flexible polypeptide linker.
The term "Applied Molecular Evolution" ("AME") means the application of an evolutionary design algorithm to a specific, useful goal. While many different library formats for AME have been reported for polynucleotides, peptides and proteins (phage, lacI and polysomes), none of these formats have provided for recombination by random cross-overs to deliberately create a combinatorial library.
A molecule that has a "chimeric property" is a molecule that is: 1) in part homologous and in part heterologous to a first reference molecule; while 2) at the same time being in part homologous and in part heterologous to a second reference molecule;
without 3) precluding the possibility of being at the same time in part homologous and in part heterologous to still one or more additional reference molecules. In a non-limiting embodiment, a chimeric molecule may be prepared by assemblying a reassortment of partial molecular sequences. In a non-limiting aspect, a chimeric polynucleotide molecule may be prepared by synthesizing the chimeric polynucleotide using plurality of molecular templates, such that the resultant chimeric polynucleotide has properties of a plurality of templates.
The term "cognate" as used herein refers to a gene sequence that is evolutionarily and functionally related between species. For example, but not limitation, in the human genome the human CD4 gene is the cognate gene to the mouse 3d4 gene, since the sequences and structures of these two genes indicate that they are highly homologous and both genes encode a protein which functions in signaling T cell activation through MHC
class II-restricted antigen recognition.
A "comparison window," as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith (Smith and Waterman, AdvAppl Math, 1981;
Smith and Waterman, J Teor Biol, 1981; Smith and Waterman, JMoI Biol, 1981;
Smith et al, JMoI Evol, 1981), by the homology alignment algorithm of Needleman (Needleman and Wuncsch, 1970), by the search of similarity method of Pearson (Pearson and Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.
As used herein, the term "complementarity-determining region" and "CDR"
refer to the art-recognized term as exemplified by the Rabat and Chothia CDR
definitions also generally known as supervariable regions or hypervariable loops (Chothia and Lesk, 1987; Clothia et al, 1989; Kabat et al, 1987; and Tramontano et al, 1990).
Variable region domains typically comprise the amino-terminal approximately 105-115 amino acids of a naturally-occurring immunoglobulin chain (e.g., amino acids 1-110), although variable domains somewhat shorter or longer are also suitable for forming single-chain antibodies.
"Conservative amino acid substitutions" refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are : valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine.
The term "corresponds to" is used herein to mean that a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence. In contradistinction, the term "complementary to" is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TATAC"
corresponds to a reference "TATAC" and is complementary to a reference sequence "GTATA."
The term "degrading effective" amount refers to the amount of enzyme which is required to process at least SO% of the substrate, as compared to substrate not contacted with the enzyme. Preferably, at least 80% of the substrate is degraded.
As used herein, the term "defined sequence framework" refers to a set of defined sequences that are selected on a non-random basis, generally on the basis of experimental data or structural data; for example, a defined sequence framework may comprise a set of amino acid sequences that are predicted to form a 13-sheet structure or may comprise a leucine zipper heptad repeat motif, a zinc-finger domain, among other variations. A
"defined sequence kernal" is a set of sequences which encompass a limited scope of variability. Whereas (1) a completely random 10-mer sequence of the 20 conventional amino acids can be any of (20)i° sequences, and (2) a pseudorandom 10-mer sequence of the 20 conventional amino acids can be any of (20)I° sequences but will exhibit a bias for certain residues at certain positions and/or overall, (3) a defined sequence kernal is a subset of sequences if each residue position was allowed to be any of the allowable 20 conventional amino acids (and/or allowable unconventional aminolimino acids).
A
defined sequence kernal generally comprises variant and invariant residue positions and/or comprises variant residue positions which can comprise a residue selected from a defined subset of amino acid residues), and the like, either segmentally or over the entire length of the individual selected library member sequence. Defined sequence kernels can refer to either amino acid sequences or polynucleotide sequences. Of illustration and not limitation, the sequences (I~lNK)~° and (NNM)1°, wherein N
represents A, T, G, or C; K
represents G or T; and M represents A or C, are defined sequence kernels.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
For analytical purposes, typically 1 ug of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ~1 of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically S to SO p.g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes axe specified by the manufacturer. Incubation times of about I hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions.
After digestion the reaction is electrophoresed directly on a gel to isolate the desired fragment.
"Directional ligation" refers to a ligation in which a 5' end and a 3' end of a polynuclotide are different enough to specify a preferred ligation orientation. For example, an otherwise untreated and undigested PCR product that has two blunt ends will typically not have a preferred ligation orientation when ligated into a cloning vector digested to produce blunt ends in its multiple cloning site; thus, directional ligation will typically not be displayed under these circumstances. In contrast, directional ligation will typically displayed when a digested PCR product having a 5' EcoR I-treated end and a 3' Barnes I-is ligated into a cloning vector that has a multiple cloning site digested with EcoR
I and Barnes I.
The term "DNA shuffling" is used herein to indicate recombination between substantially homologous but non-identical sequences, in some embodiments DNA
shuffling may involve crossover via non-homologous recombination, such as via cer/lox and/or flp/frt systems and the like.
As used in this invention, the term "epitope" refers to an antigenic determinant on an antigen, such as a phytase polypeptide, to which the paratope of an antibody, such as an phytase-specific antibody, binds. Antigenic determinants usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three-dimensional structural characteristics, as well as specific charge characteristics. As used herein "epitope" refers to that portion of an antigen or other macromolecule capable of forming a binding interaction that interacts with the variable region binding body of an antibody. Typically, such binding interaction is manifested as an intermolecular contact with one or more amino acid residues of a CDR.
The terms "fragment", "derivative" and "analog" when refernng to a reference polypeptide comprise a polypeptide which retains at least one biological function or activity that is at least essentially same as that of the reference polypeptide. Furthermore, the terms "fragment", "derivative" or "analog" are exemplified by a "pro-form"
molecule, such as a low activity proprotein that can be modified by cleavage to produce a mature enzyme with significantly higher activity.
A method is provided herein for producing from a template polypeptide a set of progeny polypeptides in which a "full range of single amino acid substitutions" is represented at each amino acid position. As used herein, "full range of single amino acid substitutions" is in reference to the naturally encoded 20.naturally encoded polypeptide-forming alpha-amino acids, as described herein.

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
"Genetic instability", as used herein, refers to the natural tendency of highly repetitive sequences to be lost through a process of reductive events generally involving sequence simplification through the loss of repeated sequences. Deletions tend to involve the loss of one copy of a repeat and everything between the repeats.
The term "heterologous" means that one single-stranded nucleic acid sequence is unable to hybridize to another single-stranded nucleic acid sequence or its complement.
Thus areas of heterology means that areas of polynucleotides or polynucleotides have areas or regions within their sequence which are unable to hybridize to another nucleic acid or polynucleotide. Such regions or areas are for example areas of mutations.
The term "homologous" or "homeologous" means that one single-stranded nucleic acid nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentrations as discussed later. Preferably the region of identity is greater than about 5 bp, more preferably the region of identity is greater than 10 bp.
An immunoglobulin light or heavy chain variable region consists of a "framework"
region interrupted by three hypervariable regions, also called CDR's. The extent of the framework region and CDR's have been precisely defined; see "Sequences of Proteins of Immunological Interest" (Kabat et al, 197). The sequences of the framework regions of different light or heavy chains are relatively conserved within a specie. As used herein, a "human framework region" is a framework region that is substantially identical (about ~5 or more, usually 90-95 or more) to the framework region of a naturally occurring human immunoglobulin. the framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDR's. The CDR's are primarily responsible for binding to an epitope of an antigen.

The benefits of this invention extend to "commercial applications" (or commercial processes), which term is used to include applications in commercial industry proper (or simply industry) as well as non-commercial commercial applications (e.g.
biomedical research at a non-profit institution). Relevant applications include those in areas of diagnosis, medicine, agriculture, manufacturing, and academia.
The term "identical" or "identity" means that two nucleic acid sequences have the same sequence or a complementary sequence. Thus, "areas of identity" means that regions or areas of a polynucleotide or the overall polynucleotide are identical or complementary to areas of another polynucleotide or the polynucleotide.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurnng). For example, a naturally-occurring polynucleotide or enzyme present in a living animal is not isolated, but the same polynucleotide or enzyme, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or enzymes could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
By "isolated nucleic acid" is meant a nucleic acid, e.g., a DNA or RNA
molecule, that is not immediately contiguous with the 5' and 3' flanking sequences with which it normally is immediately contiguous when present in the naturally occurring genome of the organism from which it is derived. The term thus describes, for example, a nucleic acid that is incorporated into a vector, such as a plasmid or viral vector; a nucleic acid that is incorporated into the genome of a heterologous cell (or the genome of a homologous cell, but at a site different from that at which it naturally occurs); and a nucleic acid that exists as a separate molecule, e.g., a DNA fragment produced by PCR amplification or restriction enzyme digestion, or an RNA molecule produced by in vitro transcription. The term also describes a recombinant nucleic acid that forms part of a hybrid gene encoding additional polypeptide sequences that can be used, for example, in the production of a fusion protein.

As used herein "ligand" refers to a molecule, such as a random peptide or variable segment sequence, that is recognized by a particular receptor. As one of skill in the art will recognize, a molecule (or macromolecular complex) can be both a receptor and a ligand. In general, the binding partner having a smaller molecular weight is referred to as the ligand and the binding partner having a greater molecular weight is referred to as a receptor.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Sambrook et al, 1982, p. 146;
Sambrook, 1989).
Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 pg of approximately equimolar amounts of the DNA fragments to be ligated.
As used herein, "linker" or "spacer" refers to a molecule or group of molecules that connects two molecules, such as a DNA binding protein and a random peptide, and serves to place the two molecules in a preferred configuration, e.g., so that the random peptide can bind to a receptor with minimal steric hindrance from the DNA
binding protein.
As used herein, a "molecular property to be evolved" includes reference to molecules comprised of a polynucleotide sequence, molecules comprised of a polypeptide sequence, and molecules comprised in part of a polynucleotide sequence and in part of a polypeptide sequence. Particularly relevant - but by no means limiting -examples of molecular properties to be evolved include enzymatic activities at specified conditions, such as related to temperature; salinity; pressure; pH; and concentration of glycerol, DMSO, detergent, &lor any other molecular species with which contact is made in a reaction environment. Additional particularly relevant - but by no means limiting -examples of molecular properties to be evolved include stabilities - e.g. the amount of a residual molecular property that is present after a specified exposure time to a specified environment, such as may be encountered during storage.
The term "mutations" includes changes in the sequence of a wild-type or parental nucleic acid sequence or changes in the sequence of a peptide. Such mutations may be point mutations such as transitions or transversions. The mutations may be deletions, insertions or duplications. A mutation can also be a "chimerization", which is exemplified in a progeny molecule that is generated to contain part or all of a sequence of one parental molecule as well as part or all of a sequence of at least one other parental molecule. This invention provides for both chimeric polynucleotides and chimeric polypeptides.
As used herein, the degenerate "N,N,G/T" nucleotide sequence represents 32 possible triplets, where "N" can be A, C, G or T.
The term "naturally-occurring" as used herein as applied to the object refers to the fact that an obj ect can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurnng. Generally, the term naturally occurnng refers to an object as present in a non-pathological (un-diseased) individual, such as would be typical for the species.
As used herein, a "nucleic acid molecule" is comprised of at least one base or one base pair, depending on whether it is single-stranded or double-stranded, respectively.
Furthermore, a nucleic acid molecule may belong exclusively or chimerically to any group of nucleotide-containing molecules, as exemplified by, but not limited to, the following groups of nucleic acid molecules: RNA, DNA, genomic nucleic acids, non-genomic nucleic acids, naturally occurring and not naturally occurnng nucleic acids, and synthetic nucleic acids. This includes, by way of non-limiting example, nucleic acids associated with any organelle, such as the mitochondria, ribosomal RNA, and nucleic acid molecules comprised chimerically of one or more components that are not naturally occurring along with naturally occurnng components.
Additionally, a "nucleic acid molecule" may contain in part one or more non-nucleotide-based components as exemplified by, but not limited to, amino acids and sugars. Thus, by way of example, but not limitation, a ribozyme that is in part nucleotide-based and in part protein-based is considered a "nucleic acid molecule".

In addition, by way of example, but not limitation, a nucleic acid molecule that is labeled with a detectable moiety, suchas a radioactive or alternatively a non-radioactive label, is likewise considered a "nucleic acid molecule".
The terms "nucleic acid sequence coding for" or a "DNA coding sequence of or a "nucleotide sequence encoding" a particular enzyme - as well as other synonymous terms - refer to a DNA sequence which is transcribed and translated into an enzyme when placed under the control of appropriate regulatory sequences. A "promotor sequence" is a DNA regulatory region capable of binding RNA polymerise in a cell and initiating transcription of a downstream (3' direction) coding sequence. The promoter is part of the DNA sequence. This sequence region has a start codon at its 3' terminus. The promoter sequence does include the minimum number of bases where elements necessary to initiate transcription at levels detectable above background. However, after the RNA
polymerise binds the sequence and transcription is initiated at the start codon (3' terminus with a promoter), transcription proceeds downstream in the 3' direction. Within the promotor sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S1) as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerise.
The terms "nucleic acid encoding an enzyme (protein)" or "DNA encoding an enzyme (protein)" or "polynucleotide encoding an enzyme (protein)" and other synonymous terms encompasses a polynucleotide which includes only coding sequence for the enzyme as well as a polynucleotide which includes additional coding and/or non-coding sequence.
In one preferred embodiment, a "specific nucleic acid molecule species" is defined by its chemical structure, as exemplified by, but not limited to, its primary sequence. In another preferred embodiment, a specific "nucleic acid molecule species" is defined by a function of the nucleic acid species or by a function of a product derived from the nucleic acid species. Thus, by way of non-limiting example, a "specific nucleic acid molecule species" may be defined by one or more activities or properties attributable to it, including activities or properties attributable its expressed product.

The instant definition of "assembling a working nucleic acid sample into a nucleic acid library" includes the process of incorporating a nucleic acid sample into a vector-based collection, such as by ligation into a vector and transformation of a host. A
description of relevant vectors, hosts, and other reagents as well as specific non-limiting examples thereof are provided hereinafter. The instant definition of "assembling a working nucleic acid sample into a nucleic acid library" also includes the process of incorporating a nucleic acid sample into a non-vector-based collection, such as by ligation to adaptors. Preferably the adaptors can anneal to PCR primers to facilitate amplification by PCR.
Accordingly, in a non-limiting embodiment, a "nucleic acid library" is comprised of a vector-based collection of one or more nucleic acid molecules. In another preferred embodiment a "nucleic acid library" is comprised of a non-vector-based collection of nucleic acid molecules. In yet another preferred embodiment a "nucleic acid library" is comprised of a combined collection of nucleic acid molecules that is in part vector-based and in part non-vector-based. Preferably, the collection of molecules comprising a library is searchable and separable according to individual nucleic acid molecule species.
The present invention provides a "nucleic acid construct" or alternatively a "nucleotide construct" or alternatively a "DNA construct". The term "construct" is used herein to describe a molecule, such as a polynucleotide (e.g., a phytase polynucleotide) may optionally be chemically bonded to one or more additional molecular moieties, such as a vector, or parts of a vector. In a specific - but by no means limiting -aspect, a nucleotide construct is exemplified by a DNA expression DNA
expression constructs suitable for the transformation of a host cell.
An "oligonucleotide" (or synonymously an "oligo") refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides may or may not have a 5' phosphate. Those that do not will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated. To achieve polymerase-based

53 amplification (such as with PCR), a "32-fold degenerate oligonucleotide that is comprised of, in series, at least a first homologous sequence, a degenerate N,N,G/T
sequence, and a second homologous sequence" is mentioned. As used in this contest, "homologous" is in reference to homology between the oligo and the parental polynucleotide that is subjected to the polymerase-based amplification.
As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked"
when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
A coding sequence is "operably linked to" another coding sequence when RNA
polymerase will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein.
As used herein the term "parental polynucleotide set" is a set comprised of one or more distinct polynucleotide species. Usually this term fis used in reference to a progeny polynucleotide set which is preferably obtained by mutagenization of the parental set, in which case the terms "parental", "starting" and "template" are used interchangeably.
As used herein the term "physiological conditions" refers to temperature, pH, ionic strength, viscosity, and like biochemical parameters which are compatible with a viable organism, and/or which typically exist intracellularly in a viable cultured yeast cell or mammalian cell. For example, the intracellular conditions in a yeast cell grown under typical laboratory culture conditions are physiological conditions. Suitable in vitro reaction conditions for in vitro transcription cocktails are generally physiological conditions. In general, in vitro physiological conditions comprise 50-200 mM
NaCI or KCI, pH 6.5-8.5, 20-45 C and 0.001-10 mM divalent cation (e.g., Mg++, Ca~;
preferably

54 about 150 mM NaCI or ICI, pH 7.2-7.6, 5 mM divalent cation, and often include 0.01-1.0 percent nonspecific protein (e.g., BSA). A non-ionic detergent (Tween, NP-40, Triton X-100) can o$en be present, usually at about 0.001 to 2%, typically 0.05-0.2%
(v/v).
Particular aqueous conditions may be selected by the practitioner according to conventional methods. For general guidance, the following buffered aqueous conditions may be applicable: 10-250 mM NaCI, 5-50 mM Tris HCI, pH 5-~, with optional addition of divalent cation(s) and/or metal chelators and/or non-ionic detergents and/or membrane fractions and/or anti-foam agents and/or scintillants.
Standard convention (5' to 3') is used herein to describe the sequence of double standed polynucleotides.
The term "population" as used herein means a collection of components such as polynucleotides, portions or polynucleotides or proteins. A "mixed population:
means a collection of components which belong to the same family of nucleic acids or proteins (i.e., are related) but which differ in their sequence (i.e., are not identical) and hence in their biological activity.
A molecule having a "pro-form" refers to a molecule that undergoes any combination of one or more covalent and noncovalent chemical modifications (e.g.
glycosylation, proteolytic cleavage, dimerization or oligomerization, temperature-induced or pH-induced conformational change, association with a co-factor, etc.) en route to attain a more mature molecular form having a property difference (e.g. an increase in activity) in comparison with the reference pro-form molecule. When two or more chemical modification (e.g. two proteolytic cleavages, or a proteolytic cleavage and a deglycosylation) can be distinguished en route to the production of a mature molecule, the referemce precursor molecule may be termed a "pre-pro-form" molecule.
As used herein, the term "pseudorandom" refers to a set of sequences that have limited variability, such that, for example, the degree of residue variability at another position, but any pseudorandom position is allowed some degree of residue variation, however circumscribed.

"Quasi-repeated units", as used herein, refers to the repeats to be re-assorted and are by definition not identical. Indeed the method is proposed not only for practically identical encoding units produced by mutagenesis of the identical starting sequence, but also the reassortment of similar or related sequences which may diverge significantly in some regions. Nevertheless, if the sequences contain Buff cient homologies to be reassorted by this approach, they can be referred to as "quasi-repeated"
units.
As used herein "random peptide library" refers to a set of polynucleotide sequences that encodes a set of random peptides, and to the set of random peptides encoded by those polynucleotide sequences, as well as the fusion proteins contain those random peptides.
As used herein, "random peptide sequence" refers to an amino acid sequence composed of two or more amino acid monomers and constructed by a stochastic or random process. A random peptide can include framework or scaffolding motifs, which may comprise invariant sequences.
As used herein, "receptor" refers to a molecule that has an affinity for a given ligand. Receptors can be naturally occurnng or synthetic molecules. Receptors can be employed in an unaltered state or as aggregates with other species. Receptors can be attached, covalently or non-covalently, to a binding member, either directly or via a specific binding substance. Examples of receptors include, but are not limited to, antibodies, including monoclonal antibodies and antisera reactive with specific antigenic determinants (such as on viruses, cells, or other materials), cell membrane receptors, complex carbohydrates and glycoproteins, enzymes, and hormone receptors.
"Recombinant" enzymes refer to enzymes produced by recombinant DNA
techniques, i.e., produced from cells transformed by an exogenous DNA
construct encoding the desired enzyme. "Synthetic" enzymes are those prepared by chemical synthesis.
The term "related polynucleotides" means that regions or areas of the polynucleotides are identical and regions or areas of the polynucleotides are heterologous.

"Reductive reassortment", as used herein, refers to the increase in molecular diversity that is accrued through deletion (and/or insertion) events that are mediated by repeated sequences.
The following terms are used to describe the sequence relationships between two or more polynucleotides: "reference sequence," "comparison window," "sequence identity," "percentage of sequence identity," and "substantial identity."
A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least SO
nucleotides in length. Since two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides and (2) may further comprise a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
"Repetitive Index (RI)", as used herein, is the average number of copies of the quasi-repeated units contained in the cloning vector.
The term "restriction site" refers to a recognition sequence that is necessary for the manifestation of the action of a restriction enzyme, and includes a site of catalytic cleavage. It is appreciated that a site of cleavage may or may not be contained within a portion of a restriction site that comprises a low ambiguity sequence (i.e. a sequence containing the principal determinant of the frequency of occurrence of the restriction site).
Thus, in many cases, relevant restriction sites contain only a low ambiguity sequence with an internal cleavage site (e.g. G/AATTC in the EcoR I site) or an immediately adjacent cleavage site (e.g. /CCWGG in the EcoR II site). In other cases, relevant restriction enzymes [e.g. the Eco57 I site or CTGAAG(16/14)] contain a low ambiguity sequence (e.g. the CTGAAG sequence in the Eco57 I site) with an external cleavage site (e.g. in the N~6 portion of the Eco57 I site). When an enzyme (e.g. a restriction enzyme) is said to "cleave" a polynucleotide, it is understood to mean that the restriction enzyme catalyzes or facilitates a cleavage of a polynucleotide.
In a non-limiting aspect, a "selectable polynucleotide" is comprised of a 5' terminal region (or end region), an intermediate region (i.e. an internal or central region), and a 3' terminal region (or end region). As used in this aspect, a 5' terminal region is a region that is located towards a 5' polynucleotide terminus (or a 5' polynucleotide end);
thus it is either partially or entirely in a 5' half of a polynucleotide.
Likewise, a 3' terminal region is a region that is located towards a 3' polynucleotide terminus (or a 3' polynucleotide end); thus it is either partially or entirely in a 3' half of a polynucleotide.
As used in this non-limiting exemplification, there may be sequence overlap between any two regions or even among all three regions.
The term "sequence identity" means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. This "substantial identity", as used herein, denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence having at least 80 percent sequence identity, preferably at least 85 percent identity, often 90 to 95 percent sequence identity, and most commonly at least 99 percent sequence identity as compared to a reference sequence of a comparison window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison.

As known in the art "similarity" between two enzymes is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one enzyme to the sequence of a second enzyme. Similarity may be determined by procedures which are well-known in the art, for example, a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Information).
As used herein, the term "single-chain antibody" refers to a polypeptide comprising a VH domain and a VL domain in polypeptide linkage, generally liked via a spacer peptide (e.g., [Gly-Gly-Gly-Gly-Ser]X), and which may comprise additional amino acid sequences at the amino- and/or carboxy- termini. For example, a single-chain antibody may comprise a tether segment for linking to the encoding polynucleotide. As an example, a scFv is a single-chain antibody. Single-chain antibodies are generally proteins consisting of one or more polypeptide segments of at least 10 contiguous amino substantially encoded by genes of the immunoglobulin superfamily (e.g., see Williams and Barclay, 1959, pp. 361-365, which is incorporated herein by reference), most frequently encoded by a rodent, non-human primate, avian, porcine bovine, ovine, goat, or human heavy chain or light chain gene sequence. A functional single-chain antibody generally contains a sufficient portion of an immunoglobulin superfamily gene product so as to retain the property of binding to a specific target molecule, typically a receptor or antigen (epitope).
The members of a pair of molecules (e.g., an antibody-antigen pair or a nucleic acid pair) are said to "specifically bind" to each other if they bind to each other with greater affinity than to other, non-specific molecules. For example, an antibody raised against an antigen to which it binds more efficiently than to a non-specific protein can be described as specifically binding to the antigen. (Similarly, a nucleic acid probe can be described as specifically binding to a nucleic acid target if it forms a specific duplex with the target by base pairing interactions (see -above).) "Specific hybridization" is defined herein as the formation of hybrids between a first polynucleotide and a second polynucleotide (e.g., a polynucleotide having a distinct but substantially identical sequence to the first polynucleotide), wherein substantially unrelated polynucleotide sequences do not form hybrids in the mixture.

The term "specific polynucleotide" means a polynucleotide having certain end points and having a certain nucleic acid sequence. Two polynucleotides wherein one polynucleotide has the identical sequence as a portion of the second polynucleotide but different ends comprises two different specific polynucleotides.
"Stringent hybridization conditions".means hybridization will occur only if there is at least 90% identity, preferably at least 95% identity and most preferably at least 97%
identity between the sequences. See Sambrook et al, 1989, which is hereby incorporated by reference in its entirety.
Also included in the invention are polypeptides having sequences that are "substantially identical" to the sequence of a phytase polypeptide, such as one of SEQ ID
1. A "substantially identical" amino acid sequence is a sequence that differs from a reference sequence only by conservative amino acid substitutions, for example, substitutions of one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine).
Additionally a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence or by one or more non-conservative substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site the molecule, and provided that the polypeptide essentially retains its behavioural properties. For example, one or more amino acids can be deleted from a phytase polypeptide, resulting in modification of the structure of the polypeptide, without significantly altering its biological activity. For example, amino- or carboxyl-terminal amino acids that are not required for phytase biological activity can be removed. Such modifications can result in the development of smaller active phytase polypeptides.
The present invention provides a "substantially pure enzyme". The term "substantially pure enzyme" is used herein to describe a molecule, such as a polypeptide (e.g., a phytase polypeptide, or a fragment thereof) that is substantially free of other proteins, lipids, carbohydrates, nucleic acids, and other biological materials with which it is naturally associated. For example, a substantially pure molecule, such as a polypeptide, can be at least 60%, by dry weight, the molecule of interest. The purity of the polypeptides can be determined using standard methods including, e.g., polyacrylamide gel electrophoresis (e.g., SDS-PAGE), column chromatography (e.g., high performance liquid chromatography (HPLC)), and amino-terminal amino acid sequence analysis.
As used herein, "substantially pure" means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual macromolecular species in the composition), and preferably substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition will comprise more than about 80 to 90 percent of all macromolecular species present in the composition. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species. Solvent species, small molecules (<500 Daltons), and elemental ion species are not considered macromolecular species.
As used herein, the term "variable segment" refers to a portion of a nascent peptide which comprises a random, pseudorandom, or defined kernel sequence. A
variable segment" refers to a portion of a nascent peptide which comprises a random pseudorandom, or defined kernel sequence. A variable segment can comprise both variant and invariant residue positions, and the degree of residue variation at a variant residue position may be limited: both options are selected at the discretion of the practitioner.
Typically, variable segments are about 5 to 20 amino acid residues in length (e.g., 8 to 10), although variable segments may be longer and may comprise antibody portions or receptor proteins, such as an antibody fragment, a nucleic acid binding protein, a receptor protein, and the like.
The term "wild-type" means that the polynucleotide does not comprise any mutations. A "wild type" protein means that the protein will be active at a level of activity found in nature and will comprise the amino acid sequence found in nature.

The term "working", as in "working sample", for example, is simply a sample with which one is working. Likewise, a "working molecule", for example is a molecule with which one is working.

F. DETAILED DESCRIPTION OF THE INVENTION
1. GENOMIC CHARACTERIZATION METHODS
In one aspect, this invention describes a new method to sequence DNA. The improvements over the existing DNA sequencing technologies are high speed, high throughput, no electrophoresis and gel reading artifacts due to the complete absence of an electrophoretic step, and no costly reagents involving various substitutions with stable isotopes. The invention utilizes the Sanger sequencing strategy and assembles the sequence information by analysis of the nested fragments obtained by basespecific chain termination via their different molecular masses using mass spectrometry, as for example, MALDI or ES mass spectrometry. A father increase in throughtput can be obtained by introducing massmodifications in the oligonucleotide primer, chain-terminating nucleoside triphosphates and/or in the chainelongating nucleoside triphosphates, as well as using integrated tag sequences which allow multiplexing by hybridization of tag specific probes with mass differentiated molecular weights.
The present invention pertains to a method for sequencing genomes. The method comprises the steps of obtaining nucleic acid material from a genome.
Then there is the step of constructing a clone library and one or more probe libraries from the nucleic acid material. Next there is the step of comparing the libraries to form comparisons. Then there is the step of combining the comparisons to construct a map of the clones relative to the genome. Next there is the step of determining the sequence of the genome by means of the map.
The present invention also pertains to a system for sequencing a genome. The system comprises a mechanism for obtaining nucleic acid material from a genome.
The system also comprises a mechanism for constructing a clone library and one or more probe libraries. The constructing mechanism is in communication with the nucleic acid material from a genome. Additionally, the system comprises a mechanism for comparing said libraries to form comparisons. The comparing mechanism is in communication with the said libraries. The system also comprises a mechanism for combining the comparisons to construct a map of the clones relative to the genome. The said combining mechanism is in communication with the comparisons. Further, the system comprises a mechanism for determining the sequence of the genome by means of said map. The said determining mechanism is in communication with said map. The present invention additionally pertains to a method for producing a gene of a genome.
An efficient method for sequencing Iarge fragments of DNA is described. A
subclone path through the fragment is first identified; the collection of subclones that define this path is then sequenced using transposon-mediated direct sequencing techniques to an extent sufficient to provide the complete sequence of the fragment.
Improved techniques are provided for DNA sequencing, and particularly for sequencing of the entire human genome. Different base-specific reactions are utilized to use different sets of DNA fragments from a piece of DNA of unknown sequence.
Each of the different sets of DNA fragments has a common origin and terminates at a particular base along the unknown sequence. The molecular weight of the DNA
fragments in each of the different sets is detected by a matrix assisted laser absorption mass spectrometer to determinelthe sequence of the different bases in the DNA.
The methods and apparatus of the present invention provide a relatively simple and low cost technique which may be automated to sequence thousands of gene bases per hour, and eliminates the tedious and time consuming geI electrophoresis separation technique conventionally used to determine the masses of DNA fragments.
Processes and kits for simultaneously amplifying and sequencing nucleic acid molecules, and performing high throughput DNA sequencing are described.
A new contiguous genome sequencing method is described which allows the contiguous sequencing of a very long DNA without need to be subcloned. It uses the basic PCR technique but circumvents the usual need of this technique for the knowledge two primers for contiguous sequencing, enabling the knowledge of only one primer sufficient. The present invention makes it possible to PCR amplify a DNA
adjacent to a known sequence with which one primer can be made without the knowledge of the second primer binding site present in the unknown sequence.
The present invention could thus be used to contiguously sequence a very long DNA
such as that contained in a YAC clone or a cosmid clone, without the need fox subcloning smaller fragments, using the standard PCR technique. It can also be used to sequence a whole chromosome or genome without any need to subclone it.
Methods and means are provided for the massively parallel characterization of complex molecules and of molecular recognition phenomena with parallelism and redundancy attained through single molecule examination methods. Applications include ultra-rapid genome sequencing, affinity characterization, pathogen characterization and detection means for clinical use and use in the development and construction of cybernetic immune systems. Novel methods for single molecule examination and manipulation are provided, including scanned beam light microscopic means and methods, and detection means availing of optoelectronic array devices. Various apparatus for rate control, including stepping control for various reactions are combined with molecular recognition, signal amplification and single molecule examination methods. Inclusion of internal control in samples, algorithm-based dynamically responsive manipulation controls, and sample redundancy, are availed to provide an arbitrarily high degree of accuracy in final data.

1.I SEQUENCING
The present invention relates to sequencing of DNA and is in the field of determining the nucleotide sequence of large segments of DNA. More specifically, the invention provides an improved method to obtain the complete nucleotide sequence of genomic DNA provided in fragments of over 30 kb.
The present invention pertains to a process for determining the DNA sequence of the genome of an organism. And more particularly, the invention relates to the sequencing of the entire human genome.
More specifically, the present invention is related to constructing clone maps of organisms, and then using these maps to direct the sequencing effort. The invention also pertains to systems that can effectively use this sequence and map information.
The invention relates to the massively parallel single molecule examination of associations or reactions between large numbers of first complex molecules, which may be diverse, and second single or plural probing molecules, which may or may not be diverse, with applications to biology, biotechnology, pharmacology, immunology, the novel field of cybernetic immunology, molecular evolution, cybernetic molecular evolution, genomics, comparative genomics, enzymology, clinical enzymology, pathology, medical research, and clinical medicine.
The present invention has applications in the area of polynucleotide sequence determination, including DNA sequencing.

1. 2 SEQUENCING METHODS
1.2.1 Importance of DNA sequencing:
Current knowledge regarding gene structure, the control of gene activity and the function of cells on a molecular Level alI arose based on the determination of the base sequence of millions of DNA molecules. DNA sequencing is still critically important in research and for genetic therapies and diagnostics, (e.g., to verify recombinant clones and mutations).
DNA, a polymer of deoxyribonucleotides, is found in all living cells and some viruses. DNA is the Garner of genetic information, which is passed from one generation to the next by homologous replication of the DNA molecule.
Information for the synthesis of all proteins is encoded in the sequence of bases in the DNA. DNA
sequence information represents the information required for gene organization and regulation of most life forms. Accordingly, the development of reliable methodology for sequencing DNA has contributed significantly to an understanding of gene structure and function.
Since the genetic information is represented by the sequence of the four DNA
building blocks deoxyadenosine- (dpA), deoxyguanosine- (dpG), deoxycytidine-(dpC) and deoxythyraidine-5'-phosphate (dpT), DNA sequencing is one of the most fundamental technologies in molecular biology and the life sciences in general.. The ease and the rate by which DNA sequences can be obtained greatly affects related technologies such as development and production of new therapeutic agents and new and useful varieties of plants and microorganisms via recombinant DNA
technology.
In particular, unraveling the DNA sequence helps in understanding human pathological conditions including genetic disorders, cancer and AIDS. In some cases, very subtle differences such as a one nucleotide deletion, addition or substitution can create serious, in some cases even fatal., consequences. Recently, DNA
sequencing has become the core technology of the Human Genome Sequencing Project (e.g., J.E.
Bishop and M. Waldholz, 1991, Genome: The Story of the Most Astonishing Scientific Adventure of Our Time - The Attempt to Map All the Genes in the Human Body, Simon & Schuster, New York). Knowledge of the complete human genome DNA sequence will certainly help to understand, to diagnose, to prevent and to treat human diseases. To be able to tackle successfully the determination of the approximately 3 billion base pairs of the human genome in a reasonable time frame and in an economical way, rapid, reliable, sensitive and inexpensive methods need to be developed, which also offer the possibility of automation. The present invention provides such a technology. The need for highly rapid, accurate, and inexpensive sequencing technology is nowhere more apparent than in a demanding sequencing project.such as the human genome project.
The present invention relates to the field of nucleic acid analysis, detection, and sequencing. More specifically, in one embodiment the invention provides improved techniques for synthesizing arrays of nucleic acids, hybridizing nucleic acids, detecting mismatches in a double-stranded nucleic acid composed of a single-stranded probe and a target nucleic acid, and determining the sequence of DNA
or RNA or other polymers.
A human being has 23 pairs of chromosomes consisting of a total of about 100,000 genes. The human genome consists of those genes. A single gene which is defective may cause an inheritable disease, such as Huntington's disease, Tay-Sachs disease or cystic fibrosis. The human chromosomes consist of large organic linear molecules of double-strand DNA (deoxyribonucleic acid) with a total length of about 3.3 billion "base pairs". The base pairs are the chemicals that encode information along DNA. A typical gene may have about 30,000 base pairs. By correlating the inheritance of a "marker" (a distinctive segment of DNA) with the inheritance of a disease, one can find a mutant (abnormal) gene to within one or two million base pairs. This opens the way to clone the DNA segment, test is activity, follow its inheritance, and diagnose carriers and future disease victims.
The mapping of the human genome is to accurately determine the location and composition of each of the 3.3 billion bases. The complexity and large scale of such a mapping has placed it, in terms of cost, effort and scientific potential of such projects, as one of the largest and most important projects of the 1990's and beyond.
Recent reviews of today's methods together with future directions and trends are given by Barrell (The FASEB Journal 1, 40-45 (1991)), and Trainor (Anal.
Chem.
62, 418-26 (1990)).

1.2.2 Previously developed methods:
The problem of DNA sequence analysis is that of determining the order of the four bases on the DNA strands. DNA sequencing is a technique by which the four DNA nucleotides (characters) in a linear DNA sequence is ordered by chemical and biochemical means. Generally, strategies for determining the nucleotide sequence of DNA involve the generation of a DNA substrate i.e., DNA fragments suitable for sequencing a region of the DNA, enzymatic or chemical reactions, and analysis of DNA fragments that have been separated according to their lengths to yield sequence information. More specifically, to sequence a given region of DNA, labeled DNA
fragments are typically generated in four separate reactions. In each of the four reactions, the DNA fragments typically have one fixed end and one end that terminates sequentially at each of the four nucleotide bases, respectively.
The products of each reaction are fractionated by gel electropheresis on adjacent lanes of a polyacrylamide gel. As all of the nucleotides are represented among the four lanes, the sequence of a given region of DNA can be determined from the four "ladders" of DNA fragments. The present status of techniques for determining such sequences is described in some detail in an article by Lloyd M. Smith published in the American Biotechnology Laboratory, Volume 7, Number 5, May 1989, pp 10-17. Since the early 1970's, two methods have been developed for the determination of DNA
sequence: (1) the enzymatic chain-termination sequencing method, which relies on the template directed incorporation of nucleotides which themselves do not supply the necessary chemical functionalities required for subsequent enzymatic polymerization of a daughter strand polynucleotide, developed by Sanger and colleagues (F.
Sanger, S. Nicklen, and A. R. Coulson, "DNA sequencing with chain- terminating inhibitors."
Proc. Nati. Acad. Sci, USA, 74:5463-5467 (1977)), which is most commonly used for sequence determination; and (2) the base-specific chemical degradation (modification and cleavage) method, developed by Maxam and Gilbert (A. M. Maxam, and W.
Gilbert, "A new method of sequencing DNA." Proceedings of the National Academy of Sciences, USA, 74:560-564 (1977)), which similarly yields polynucleotide molecules terminated at sites containing a specific base according to the chemical treatment applied to the sample. Both of these techniques are based on similar principals, and employ gel electrophoresis to separate DNA fragments of different lengths with high resolution. On these gels it is thus possible to separate a DNA

fragment 600 bases in length from one 601 bases in length. No distinct method preferable to these has yet been validated. Both methods require a large number of complex manipulations, such as isolation of homogeneous DNA fragments, elaborate and tedious preparation of samples, preparation of a separating gel, application of samples to the gel, electrophoresing the samples on the gel, working up of the finjshed gel, and analysis of the results of the procedure.
1. 2.2.1 Chemical/Maxam and Gilbert method for sequencing:
In the chemical method, the DNA strand is isotropically labeled on one end, broken down into smaller fragments at sequence locations ending with a particular nucleotide (A, T, C, or G) by chemical means, and the fragments ordered based on this information. Base specific modifications result in a base specific cleavage of the radioactive or fluorescently labeled DNA fragment. After the DNA substrate is end labeled, it is subjected to chemical reactions designed to cleave the DNA at positions adjacent to a given base or bases. The labeled DNA fragments will, therefore, have a common labeled terminus while the unlabeled termini will be defined by the positions of chemical cleavage. This results in the generation of DNA fragments (four sets of nested fragments) which can be separated according to length by polyacrylamide geI
electrophoresis (PAGE) and identified. Alternatively, unlabeled DNA fragments can be separated after complete restriction digestion and partial chemical cleavage of the DNA, and hybridized with probes homologous to a region near the region of the DNA
to be sequenced. See, Church et al., Proc. Natl. Acad. Sci., 81:1991 (1984).
After autoradiography, the sequence can be read directly since each band (fragment) in the gel originates from a base specific cleavage event. Thus, the fragment lengths in the four "ladders" directly translate into a specific position in the DNA
sequence.
1. 2.2.2 EnzymaticlSanger method for sequencing:
In the enzymatic method, the four base specific sets of DNA fragments are formed by starting with a primer/template system elongating the primer into the unknown DNA sequence area and thereby copying the template and synthesizing complementary strands using a DNA polymerase in the presence of chain-terminating reagents. The chain-terminating event is achieved by incorporating into the four separate reaction mixtures in addition to the four normal deoxynucleoside triphosphates, dATP, dGTP, dTTP and dCTP, only one of the chain-terminating dideoxynucleoside triphosphates, ddATP, ddGTP, ddTTP or ddCTP, respectively, in a limiting small concentration. The incorporation of a ddNTP lacking the 3' hydroxyl function into the growing DNA strand by the enzyme DNA polymerise leads to chain termination through preventing the formation of a 3'-5'-phosphodiester bond by DNA
polymerise. Due to the random incorporation of the ddNTPs, each reaction leads to a population of base specific terminated fragments of different lengths, which all together represent the sequenced DNA-molecule. The four sets of resulting fragments produce, after electrophoresis, four base specific ladders from which the DNA
sequence can be determined.
In the enzymatic method, the following basic steps are involved:
(a) annealing an oligonucleotide primer to a suitable single or denatured double stranded DNA template; (ii) extending the primer with DNA polymerise in four separate reactions, each containing one - I abeled dNTP or ddNTP
(alternatively a labeled primer can be used), a mixture of unlabeled dNTPs, and one chain-terminating dideoxynucleoside- 5'-triphosphate (ddNTP); (iii) resolving the four sets of reaction products, which include a distribution of DNA fragments having primer-defined 5' termini and differing dideoxynucleotides at the 3' termini,on a high resolution polyacrylamide-urea gel; and (iv) producing an auto radiographic image of the gel that can be examined to infer the DNA sequence. Alternatively, fluorescently labeled primers or nucleotides can be used to identify the reaction products.
Known dideoxy sequencing methods utilize a DNA polymerise such as the Klenow fragment of E. cola DNA polymerise, a DNA polymerise from Thermus aquaticus, reverse transcriptase, a modified T7 DNA polymerise, or the Taq polymerise.
1. 2.2.3 Similarities, differences and other details of the two methods:
The two sequencing methods differ in the techniques employed to produce the DNA fragments, but are otherwise similar. In the Maxim-Gilbert method, four different base-specific reactions are performed on portions of the DNA
molecules to be sequenced, to produce four sets of radiolabeled DNA fragments. These four fragment sets are each loaded in adjacent lanes of a polyacrylamide slab gel, and are separated by electrophoresis. Autoradiographic imaging of the pattern of the radiolabeled DNA bands in the gel reveals the relative size, corresponding to band mobilities, of the fragments in each lane, and the DNA sequence is deduced from this pattern.

While numerous modifications and improvements to the strategies referred to above have been developed, most sequencing techniques require the presence of a known primer binding site for every 300 to S00 nucleotides to be sequenced either, for example, for initiation of DNA synthesis or for hybridization to different length DNA fragments having a common end. However, as such approaches utilize a "ladder" of DNA fragments containing the primer binding site (or its complement), the amount of sequence information that can be obtained is limited by the present inability to resolve DNA fragments greater than 500 nucleotides in length on sequencing gels.
Both of these methods yield a population of molecules comprising a nested set which together may be analyzed to determine the base sequence of the sample.
At least one of these two techniques is employed in essentially every laboratory concerned with molecular biology, and together they have been employed to sequence more than 26 million bases of DNA. Currently a skilled biologist can produce about 30,000 bases of finished DNA sequence per year under ideal conditions.
These methods and several variations thereupon, as well as their severe limitations with respect to the economy and rapidity of accumulation of sequence data, are well known to those in the relevant arts. Various lower resolution techniques, generally falling within the category termed genome mapping, have been developed to circumvent these limitations for applications where more "broad spectrum"
examination of genetic material is required but less detailed information about sequence will suffice.
1. 2.2.4 Cloning/Subcloning steps:
On the upfront end, the DNA to be sequenced has to be fragmented into sequencable pieces of currently not more than S00 to 1000 nucleotides.
Starting from a genome, this is a multi-step process involving cloning and subcloning steps using different and appropriate cloning vectors such as YAC, cosmids, plasmids and vectors (Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989). Finally, for Sanger sequencing, the fragments of about 500 to 1000 base pairs are integrated into a specific restriction site of the replicative form I (RF I) of a derivative of the M13 bacteriophage (Vieria and Messing, Gene 19, 259(1982)) and then the double-stranded form is transformed to the single-stranded circular form to serve as a template for the Sanger sequencing process having a binding site for a universal primer obtained by chemical DNA
synthesis (Sinha, Biernat, McManus and Koster, Nucleic Acids Res. 12, 4539-57 (1984); U.S. Patent No. 4725677 upstream of the restriction site into which the unknown DNA fragment has been inserted. Under specific conditions, unknown DNA
sequences integrated into supercoiled double-stranded plasmid DNA can be sequenced directly by the Sanger method (Chen and Seeburg, DNA 4, 165-170 (1985)) and Lim et al., Gene Anal., Techn. 5, 32-39 (1988), and, with the Polymerase Chain Reaction (PCR) (PCR Protocols- A Guide to Methods and Applications.
Innis et al., editors, Academic Press, San Diego (1990)) cloning or subcloning steps could be omitted by directly sequencing off chromosomal DNA by first amplifying the DNA segment by PCR and then applying the Sanger sequencing method (Innis et al., Proc. Nad. Acad. Sci. USA 85, 9436-9440 (1988)). In this case, however, the DNA
sequence in the interested region most be known at least to the extent to bind a sequencing primer.
1. 2.2.5 Methodology described by Guo and Wu Methodology described by Guo and Wu, Nucleic Acids Res., 10:2065 (1982);
and Meth. Enz., 100:60 (1983), which is not dependent upon primer binding sites, is highly desirable for sequencing DNA greater than S00 nucleotides. This method involves partially digesting linear double stranded DNA with E. coli exonuclease III
to produce DNA fragments with 3' ends shortened to varying lengths, performing the dideoxy primer extension reactions of Sanger, supra, with the shortened 3' ends as primers for DNA synthesis, and digesting the DNA with a selected restriction enzyme that cleaves near one end of the molecule adjacent to, but not within, the labeled region of DNA. By digestion of the DNA with a selected resfiriction enzyme, the labeled DNA strands from one end of the molecule are made small enough to be resolved on a sequencing gel. Each successive deletion in length, therefore, brings "new" regions of the target DNA into sequencing range.
However, certain disadvantages inherent in the methodology of Guo and Wu, supra, limit its usefulness for the large scale sequencing of DNA. For example, this approach depends upon the selection of appropriate restriction enzymes which cleave at restriction sites in close proximity to particular E. coli exonuclease III
endpoints, but not within the labeled DNA as this would result in two or more superimposed sequence ladders. The selection of appropriate restriction enzymes generally requires, therefore, the restriction mapping of DNA fragments to identify sites in close proximity to the numerous exonuclease III endpoints. However, the determination of restriction maps tends to be both time consuming and labor intensive.
Specifically, restriction mapping to the resolution needed for DNA sequencing involves the digestion of each region of DNA with combinations of 20 or more enzymes to uncover the relative position of restriction sites. This may require over 100 enzymatic reactions followed by numerous electrophoretic separations. Further, significant amounts of DNA are consumed in the mapping process and interpretation of the data generally requires a substantial amount of time.

1. 2.3 3'-hydroxy-protected and labeled nucleotides:
A modified nucleotide compound possessing two properties particularly useful for purposes of the present invention has been described by N. Williams and P.S.
Coleman). This compound is 3'-O-(4-benzoyl)benzoyl adenosine 5'-triphosphate.
This nucleotide bears a 3' protecting group linked via an ester function which should be susceptible to hydrolysis by appropriate chemical treatments. The protecting moiety is suitable for photoactivation, and this property was utilized by those investigators to probe the stl-ucture of mitochondria) F~-ATPase, indicating that this analog will interact properly with at least some enzymes. Under appropriate circumstances, the protecting moiety may also serve as a label.
Very recently, B Canard and R.S. Sarfati have described similar nucleotides, here comprising all four nucleobases, with chemically removable 3'-hydroxyl protecting groups. Said protecting groups comprise various fluorescent dye moieties.
These investigators have shown that these compounds may be added to appropriately primed polynucleotides by polymerases according to Watson-Crick base-pairing rules, and serve to terminate chain elongation in a manner which may be reversed by removal of said protecting groups by appropriate chemical treatments, admitting resumption of polymerization. These workers propose that such compounds may form the basis of a novel sequencing methodology availing steppinq control by means of said removable protecting groups and detection of labels following their release from the nascent strand by appropriate chemical treatment. Such a method, while a potential advance over electrophoretic resolution methods, does not avail of great parallelism because only one molecule or an identical population of molecules may be sequenced at once (within a single vessel) by such a method, due to the release of the labeling moiety prior to detection, according to this proposed scheme.
Further, this limitation requires that any attempt to avail of parallelism entail elaborate parallel fluidics. Low or no parallelism entails that stepping rate will be critical to the throughput attained with such a sequencing scheme. The results published by these authors suggests that the rate of chemical removal of 3'-hydroxy protecting groups (less than 90% removal after 10 minutes of treatment with O.1M NaOI~ will be unacceptably low for such an inherently serial sequencing scheme.
Additional references regarding such compounds and in most instances their properties as substrates for various enzymes including polymerases have been found in the biological literature: Churchich, J.E.; 1995. Eur. J. Biochem., 231:736. Metzket, M.L.; Gibbs, R.A.; et al.; 1994. Nucleic Acids Research, 22:4259.
Beabealashvilli, R.S.; Kulchanova, M.K.; et al.; 1986. Biochimica et Biophysica Acta, 868:136.
Chidgeavadze, Z.G.; Kukhanova, M.K.; et al.; 1986. Biochimica et Biophysica Acta, 868:145. Hiratsulca, T; 1983. Biochimica et Biophysica Acta, 742:496. Jeng, S.J.;
Guillory, R.J.; 1975. J. Supramolecular Structure, 3:448.

1. 2.4 Related Base Addition Sequencing Schemes:
Various other investigators have also independently devised polynucleotide sequencing methodologies which depend on the addition of a polymerization terminating labeled nucleotide to a primed or elongated daughter strand on a polynucleotide sample with template dependent polynucleotide polymerases.
Most, but not all, of these methods (referred to herein as previously disclosed base-addition sequencing schemes) avail nucleotide triphosphate monomers with some base-specific label which may be removed by some deprotection treatment. It must be emphasized that all of these other previously disclosed base-addition sequencing schemes examine not single molecules individually but rather large homogeneous populations of substantially identical molecules, wherein the observed signal used to identify label type originates from the totality of such a population of molecules rather than an individual molecule. It must be further emphasized that conventional usage does not generally reveal this distinction: phrases such a "a molecule" or "a sample molecule"
refer not to an individual molecule considered separately or in isolation from other molecules including separately from other molecules of identical composition and structure, but to populations comprising millions or more molecules of identical structure. A careful reading of these prior disclosures reveals that these investigators are not working with samples consisting of single molecules but rather with samples comprising a plurality of identical molecules. In particular, even where these investigators do not (as is consistent with conventional usage) explicitly note this point, they take measures which would apply only to samples of pluralities of identical molecules, and do not take measures associated with working with single molecules.

1.2.5 Labeling 1. 2.5.1 Sequencing from PAGE using radioisotopes:
In order to be able to read the sequence from PAGE, detectable labels have to be used in either the primer (very often at the 5'-end) or in one of the deoxynucleoside triphosphates, dNTP. Using radioisotopes such as Sap, 33P, or 3sS is still the most frequently used technique. After PAGE, the gels are exposed to X-ray films and silver grain exposure is analyzed. The use of radioisotopic labeling creates several problems. Most labels useful for autoradiographic detection of sequencing fragements have relatively short half lives which can limit the useful time of the labels. The emission high energy beta radiation, particularly from 3aP, can lead to breakdown of the products via radiolysis so that the sample should be used very quickly after labeling. In addition, high energy radiation can also cause a deterioration of band sharpness by scattering. Some of these problems can be reduced by using the less energetic isotopes such as 33P or 3sS (see, e.g., Ornstein et al., Biotechniques 2, 476 (1985)). Here, however, longer exposure times have to be tolerated. Above all, the use of radioisotopes poses significant health risks to the experimentalist and, in heavy sequencing projects, decontamination and handling the radioactive waste are other severe problems and burdens.
1. 2.5.2 Integration of non-radioactive labeling techniques into partly automated DNA sequencing:
In response to the above mentioned problems related to the use of radioactive labels, non-radioactive labeling techniques have been explored and, in recent years, integrated into partly automated DNA sequencing procedures. All these improvements utilize the Sanger sequencing strategy. The fluorescent label can be tagged to the primer (Smith et al., Nature M, 674-679 (1986) and EPO Patent No. 873 00998.9; Du Pont De Nemours EPO Application No. 03 59225; Ansorge et al., L
Biochem. Biophys. Method 13, 325-32 (1986)) or to the chain-terminating dideoxynucloside triphosphates (Prober et al. Science M, 336-41 (1987);
Applied Biosystems, PCT Application WO 91/05060). Based on either labeling the primer or the ddNTP, systems have been developed by Applied Biosystems (Smith et al., Science 235, G89 (1987); U.S. Patent Nos. 570973 and 689013), Du Pont De Nemours (Prober et al., Science 238, 336-341 (1987); U.S. Patents Nos. 881372 and 57566), Pharmacia-LKB (Ansorge et al. Nucleic Acids Res. 15-, 4593-4602 (1987) and EMBL Patent Application DE P3724442 and P3805808.1) and Hitachi (JP 1-90844 and DE 4011991 Al). A somewhat similar approach was developed by Brumbaugh et al. (Proc. Natl. Sci. USA 85, 5610-14 (1988) and U.S. Patent No.
4,729,947). An improved method for the Du Pont system using two electrophoretic lanes with two different specific labels per lane is described (PCT
Application W092/02635). A different approach uses fluorescently labeled avidin and biotin labeled primers. Here, the sequencing ladders ending with biotin are reacted during electrophoresis with the labeled avidin which results in the detection of the individual sequencing bands (Brumbaugh et al., U.S. Patent No. 594676).
More recently even more sensitive non-radioactive labeling techniques for DNA using chemiluminescence triggerable and amplifyable by enzymes have been developed (Beck, O'Keefe, Coull and Koster, Nucleic Acids Res. 7, 5115- 5123 (1989) .L7 and Beck and Koster, Anal. Chem. 62 2258-2270 (1990)). These labeling methods were combined with multiplex DNA sequencing (Church et al., Science 240, 185-188 (1988) to provide for a strategy aimed at high throughput DNA
sequencing (Koster et al., Nucleic Acids Res. Symposium Ser. No. 24, 318-321 (1991), University of Utah, PCT Application No. WO 90/I5883); this strategy still suffers from the disadvantage of being very laborious and difficult to automate.
1. 2.5.2.1 Fluorescent labeling ing in methods for automated DNA sequencing Of particular interest in DNA sequencing are methods of automated sequencing, in which fluorescent labels are employed to label the size separated fragments or primer extension products of the enzymatic method. Currently, three different methods are used for automated DNA sequencing. In the first method, the DNA fragments are labeled with one fluorophore and then run in adjacent sequencing lanes, one lane for each base. See Ansorge et al., Nucleic Acids Res.
(1987)15:4593-4602. In the second methods, the DNA fragments are labeled with oligonucleotide primers tagged with four fluorophores and all of the fragments are run in one lane.
See Smith et al., Nature (1986) 321:674- 679. In the third method, each of the different chain terminating dideoxynucleotides is labeled with a different fluorophore and all of the fragments are run in one lane. See Prober et al., Science (1987) 238:336-341. The first method has the potential problems of lane-to-lane variations as well as a low throughput. The second and third methods require that the four dyes be well excited by one laser source, and that they have distinctly different emission spectra. Otherwise, multiple lasers have to be used, increasing the complexity and the cost of the detection instrument.
With the development of Energy Transfer primers which offer strong fluorescent signals upon excitation at a common wavelength, the second method produces robust sequencing data in currently commercial available sequencers.
However, even with the use of Energy Transfer primers, the second method is not entirely satisfactory. In the second method, all of the false terminated or false stop fragments are detected resulting in high backgrounds. Furthermore, with the second method it is difficult to obtain accurate sequences for DNA templates with long repetitive sequences. See Robbins et al., Biotechniques (1996) 20: 862-868.
The third method has the advantage of only detecting DNA fragments incorporated with a terminator. Therefore, backgrounds caused by the detection of false stops are not detected. However, the fluorescence signals offered by the dye-labeled terminators are not very bright and it is still tedious to completely clear up the excess of dye-terminators even with AmpliTaq DNA Polymerase (FS enzyme).
Furthermore, non-sequencing fragments are detected, which contributes to background signal. Applied Biosystems Model 373 A DNA Sequencing System User Bulletin, November 17,P3,August 1990.
Thus, there is a need for the development of improved methodology which is capable of providing for highly accurate sequencing data, even for long repetitive sequences. Such methodology would ideally include a means for isolating the DNA
sequencing fragments from the remaining components of the sequencing reaction mixtures such as salts, enzymes, excess primers, template and the like, as well as false stopped sequencing fragments and non-sequencing fragments resulting from contaminated RNA and nicked DNA templates.

1. 2.6 Simplifying DNA sequencing using solid supports:
In an attempt to simplify DNA sequencing, solid supports have been introduced. In most cases published so far, the template strand for sequencing (with or without PCR amplification) is immobilized on a solid support most frequently utilizing the strong biotin-avidin/streptavidin interaction (Orion-Yhtyma Oy, U.S.
Patent No. 277643; M. Uhlen et al. Nucleic Acids Res. 16, 3025-38 (1988); Cemu Bioteknik, PCT Application No. WO 89/09282 and Medical Research Council, GB, PCT Application No. WO 92/03575). The primer extension products synthesized on the immobilized template strand are purified of enzymes, other sequencing reagents and by-products by a washing step and then released under denaturing conditions by loosing the hydrogen bonds between the Watson-Crick base pairs and subjected to PAGE separation. In a different approach, the primer extension products (not the template) from a DNA sequencing reaction are bound to a solid support via biotin/avidin (Du Pont De Nemours, PCT Application WO 91/11533). In contrast to the above mentioned methods, here, the interaction between biotin and avidin is overcome by employing denaturing conditions (formamide/EDTA) to release the primer extension products of the sequencing reaction from the solid support for PAGE
separation. As solid supports, beads, (e. g., magnetic beads (Dynabeads) and Sepharose beads), filters, capillaries, plastic dipsticks (e.g., polystyrene strips) and microtiter wells are being proposed.

1.2.7 Electrophoresis 1. 2.7.1 Drawbacks and limitations of polyacrylamide gel electrophoresis (PAGE):
All methods discussed so far have one central step in common:
polyacrylarnide gel electrophoresis (PAGE). In many instances, this represents a major drawback and limitation for each of these methods. Preparing a homogeneous gel by polymerization, loading of the samples, the electrophoresis itself, detection of the sequence pattern (e.g., by autoradiography), removing the gel and cleaning the glass plates to prepare another gel are very laborious and time-consuming procedures.
Moreover, the whole process is error-prone, difficult to automate, and, in order to improve reproducibility and reliability, highly trained and skilled personnel are required.
In the case of radioactive labeling, autoradiography itself can consume from hours to days. In the case of fluorescent labeling, at least the detection of the sequencing bands is being performed automatically when using the laser-scanning devices integrated into commercial available DNA sequencers. One problem related to the fluorescent labeling is the influence of the four different base-specific fluorescent tags on the mobility of the fragments during electrophoresis and a possible overlap in the spectral bandwidth of the four specific dyes reducing the discriminating power between neighboring bands, hence, increasing the probability of sequence ambiguities. Artifacts are also produced by base- specific interactions with the polyacrylamide gel matrix (Frank and Koster, Nucleic Acids Res. -6, 2069 (1979)) and by the formation of secondary structures which result in "band compressions" and hence do not allow one to read the sequence. This problem has, in part, been overcome by using 7-deazadeoxyguanosine triphosphates (Barr et al., Biotechniques 4, 428 (1986)). However, the reasons for some artifacts and conspicuous bands are still under investigation and need fiu-ther improvement of the gel electrophoretic procedure.
1. 2.7.2 Capillary zone electrophoresis (CZE):
A recent innovation in electrophoresis is capillary zone electrophoresis (CZE) (Jorgenson et al., J. Chromatography 352, 337 (1986); Gesteland et al., Nucleic Acids Res. 18, 141 S-1419 (1990)) which, compared to slab gel electrophoresis (PAGE), significantly increases the resolution of the separation, reduces the time for an electrophoretic run and allows the analysis of very small samples. Here, however, other problems arise due to the miniaturization of the whole system such as wall effects and the necessity of highly sensitive on-line detection methods.
Compared to PAGE, another drawback is created by the fact that CZE is only a "one-lane"
process, whereas in PAGE samples in multiple lanes can be electrophoresed simultaneously.
1. 2.7.3 DNA sequencing without the electrophoretic step:
Analysis methods have heretofore relied on electrophoretic separation and resolution of the products of Sanger or Maxam and Gilbert reactions according to the length of said products. Analysis thus suffers all of the limitations associated with electrophoresis including limited separation range (i.e. limited dynamic range, where separative resolution is related exponentially to fractional differences in molecular length), limitations on parallelism, time requirements, etc., despite much effort in improving these reparative methodologies. With presently available equipment and trained personnel, sequencing the human genone would require about 100 years of total effort if no other sequencing projects were done. While very useful, the present sequencing methods are extremely tedious and expensive, yet require the services of highly skilled scientists. Moreover, these methods utilize hazardous chemicals and radioactive isotopes, which have inhibited their consideration and further development. Large scale sequencing projects, as that of the human genome, thus appear to be impractical using these well-established techniques.
In addition to being slow, the present DNA sequencing techniques involve a large number of cumbersome handling steps which are difficult to automate.
Recent improvements include replacing the radioactive labels with fluorescent tags.
These developments have improved the speed of the process and have removed some of the tedious manual steps, although present technology continues to employ the relatively slow gel electrophoresis technique for separating the DNA fragments.
Due to the severe limitations and problems related to having PAGE as an integral and central part in the standard DNA sequencing protocol, several methods have been proposed to do DNA sequencing without an electrophoretic step. One approach calls for hybridization or fragmentation sequencing (Bains, Biotechnology 10, 757-58 (1992) and Mirzabekov et al., FEBS Letters 256, 118-122 (1989)) utilizing the specific hybridization of known short oligonucleotides (e.g., octadeoxynucleotides which gives 65,536 different sequences) to a complementary DNA sequence.
Positive hybridization reveals a short stretch of the unknown sequence. Repeating this process by performing hybridizations with all possible octadeoxynucleotides should theoretically determine the sequence. In a completely different approach, rapid sequencing of DNA is done by unilaterally degrading one single, immobilized DNA
fragment by an exonuclease in a moving flow stream and detecting the cleaved nucleotides by their specific fluorescent tag via laser excitation (Jett et al., J.
Biomolecular Structure & D3mamics 7, 3 O1-3 09, (1989), United States Department of Energy, PCT Application No. WO 89/03432). In another system proposed by Hyman Anal. Biochem. 174, 423-436 (1988)), the pyrophosphate generated when the correct nucleotide is attached to the growing chain on a primer-template system is used to determine the DNA sequence. The enzymes used and the DNA are held in place by solid phases (DEAF-Sepharose and Sepharose) either by ionic interactions or by covalent attachment. In a continuous flow- through system, the amount of pyrophosphate is determined via bioluminescence (luciferase). A synthesis approach to DNA sequencing is also used by Tsien et al. (PCT Application No. WO
91/06678).
Here, the incoming dNTP's are protected at the T-end by various blocking groups such as acetyl or phosphate groups and are removed before the next elongation step, which makes this process very slow compared to standard sequencing methods.
The template DNA is immobilized on a polymer support. To detect incorporation, a fluorescent or radioactive label is additionally incorporated into the modified dNTP's.
1. 2.7.4 Apparatus to automate DNA sequencing without electrophoretic step(mass spectrometry):
PCT Application No. WO 91/06678 also describes an apparatus designed to automate the sequencing process.
Mass Spectrometry is a well known analytical technique which can provide fast and accurate molecular weight information on relatively complex mixtures of organic molecules. Mass spectrometry has historically had neither the sensitivity nor resolution to be useful for analyzing mixtures at high mass. A series of articles in 1988 by Hillenkamp and Karas do suggest that large organic molecules of about 10, 000 to 100,000 Daltons may be analyzed in a time of flight mass spectrometer, although resolution at lower molecular weights is not as sharp as conventional magnetic field mass spectrometry. Moreover, the Hillenkamp and Karas technique is very time-consuming, and requires complex and costly instrumentation.
Mass spectrometry, in general., provides a means of "weighing" individual molecules by ionizing the molecules in vacuo and making them "fly" by volatilization.
Under the influence of combinations of electric and magnetic fields, the ions follow trajectories depending on their individual mass (m) and charge (z). In the range of molecules with low molecular weight, mass spectrometry has long been part of the routine physical-organic repertoire for analysis and characterization of organic molecules by the determination of the mass of the parent molecular ion. In addition, by arranging collisions of this parent molecular ion with other particles (e.g., argon atoms), the molecular ion is fragmented forming secondary ions by the so-called collision induced dissociation (CID). The fragmentation pattern/pathway very often allows the derivation of detailed structural information. Many applications of mass spectrometric methods in the known in the art, particularly in biosciences, and can be found summarized in Methods in Enzymology, Vol. 193: "Mass Spectrometry" Q.A.
McCloskey, editor), 1990, Academic Press, New York.
Due to the apparent analytical advantages of mass spectrometry in providing high detection sensitivity, accuracy of mass measurements, detailed structural information by CID in conjunction with an MS/MS configuration and speed, as well as on-line data transfer to a computer, there has been considerable interest in the use .
of mass spectrometry for the structural analysis of nucleic acids. Recent reviews summarizing this field include K. H. Schram, "Mass Spectrometry of Nucleic Acid Components, Biomedical Applications of Mass Spectrometry" 34, 203-287 (1990);
and P.F. Crain, "Mass Spectrometric Techniques in Nucleic Acid Research," Mass Spectrometry Reviews 9, 505-554 (1990). The biggest hurdle to applying mass spectrometry to nucleic acids is the difficulty of volatilizing these very polar biopolymers.

1. 2.8 Mass Spectrometry 1. 2.8.1 Limitation in applying mass spectrometry due to the difficulty of volatilizing nucleic acids:
Therefore, "sequencing" has been limited to low molecular weight synthetic oligonucleotides by determining the mass of the parent molecular ion and through this, confirming the already known sequence, or alternatively, confirming the known sequence through the generation of secondary ions (fragment ions) via CID in an MS/MS configuration utilizing, in particular, for the ionization and volatilization, the method of fast atomic bombardment (FAB mass spectrometry) or plasma desorption (PD mass spectrometry). As an example, the application of FAB to the analysis of protected dimeric blocks for chemical synthesis of oligodeoxynucleotides has been described (Koster et al., Bioedical Environmental Mass SpectrometricE 14, 111-(1987)).
1. 2.8.2 Two more ionization/desorption techniques (ES and MALDI):
Two more recent ionization/desorption techniques are electrospray/ionspray (ES) and matrix-assisted laser desorption/ionization (MALDI). ES mass spectrometry has been introduced by Fenn et al. J. Phys. Chem. 18, 4451-59 (1984); PCT
Application No. WO 90/14148) and current applications are summarized in recent review articles (R.D. Smith et al., Anal. Chem. 62, 882-89 (1990) and B.
Ardrey, Electrospray Mass Spectrometry, Spectroscopy Europe 4, 10-18 (1992)). The molecular weights of the tetradecanucleotide d(CATGCCATGGCATG) (Covey et al.
"The Determination of Protein, Oligonucleotide and Peptide Molecular Weights by Ionspray Mass Spectrometry," Rapid Communications in Mass SpectrometJ3~, 2, 249- 256 (1988)), of the 21-mer d(AAATTGTGCACATCCTGCAGC) and without giving details of that of a tRNA with 76 nucleotides Methods in Enzymolop-L 1.
23, "Mass Spectrometry" (McCloskey, editor), p. 425, 1990, Academic Press, New York) have been published. As a mass analyzer, a quadrupole is most frequently used.
The determination of molecular weights in ferntomole amounts of sample is very accurate due to the presence of multiple ion peaks which all could be used for the mass calculation.
MALDI mass spectrometry, in contrast, can be particularly attractive when a time-of flight (TOF) configuration is used as a mass analyzer. The MALDI-TOF
mass spectrometry has been introduced by Hillenkamp et al. ("Matrix Assisted UV-Laser Desorption/Ionization: A New Approach to Mass Spectrometry of Large Biomolecules, Biological Mass Spectrometry (Burlingame and McCloskey, editors), Elsevier Science Publishers, Amsterdam, pp. 49-60, 1990.) Since, in most cases, no multiple molecular ion peaks are produced with this technique, the mass spectra, in principle, look simpler compared to ES mass spectrometry. Although DNA
molecules up to a molecular weight of 410,000 daltons could be desorbed and volatilized (Williams et al., "Volatilization of High Molecular Weight DNA by Pulsed Laser Ablation of Frozen Aqueous Solutions," Science, 246, 1585-87 (1989)), this technique has so far only been used to determine the molecular weights of relatively small oligonucleotides of known sequence, e.g., oligothymidylic acids up to 18 nucleotides (Huth-Fehre et al., "Matrix- Assisted Laser Desorption Mass Spectrometry of Oligodeoxythymidylic Acids," Rapid Communications in Mass Spectrometry, 6, 209-13 (1992)) and a double-stranded DNA of 28 base pairs (Williams et al., "Time-of Flight Mass Spectrometry of Nucleic Acids by Laser Ablation and Ionization from a Frozen Aqueous Matrix," Rapid Communications in Mass Spectrometry, 4, 348-351 (1990)). In one publication (Ruth- Fehre et al., 1992 , supra), it was shown that a mixture of all the oligothymidylic acids from n=12 to n=18 nucleotides could be resolved.
1. 2.8.3 Producing fragments, separating by electrophoresis and using matrix method to sequence In U.S. Patent No. 5,064,754, RNA transcripts extended by DNA both of which are complementary to the DNA to be sequenced are prepared by incorporating NTP's, dNTP's and, as terminating nucleotides, ddNTP's which are substituted at the 5'- position of the sugar moiety with one or a combination of the isotopes 12C,13C, 14C, ~H, ZH, 3H,160, 1~0 and I80. The polynucleotides obtained are degraded to 3'-nucleotides, cleaved at the N-glycosidic linkage and the isotopically labeled 5'-functionality removed by periodate oxidation and the resulting formaldehyde species determined by mass spectrometry. A specific combination of isotopes serves to discriminate base-specifically between internal nucleotides originating from the incorporation of NTPs and dNTP's and terminal nucleotides caused by linking ddNTP's to the end of the polynucleotide chain. A series of RNA/DNA fragments is produced, and in one embodiment, separated by electrophoresis, and, with the aid of the so-called matrix method of analysis, the sequence is deduced.

1. 2.8.4 Mass spectrometry using atoms which normally do not occur in DNA
In Japanese Patent No. 59-131909, an instrument is described which detects nucleic acid fragments separated either by electrophoresis, liquid chromatography or high speed gel filtration. Mass spectrometric detection is achieved by incorporating into the nucleic acids atoms which normally do not occur in DNA such as S, Br, I or Ag, Au, Pt, Os, Hg. The method, however, is not applied to sequencing of DNA
using the Sanger method. In particular, it does not propose a base-specif c correlation of such elements to an individual ddNTP.
1. 2.8.5 Sequencing with the Sanger method by using four stable isotopes to label the ddNTP's PCT Application No. WO 89/12694 (Brennan et al., Proc. SPIE-Int. Soc. Opt.
Eng. 1206, (New Technol. Cytom. Mot. Biol.), pp. 60-77 (1990); and Brennan, U.S.
Patent No. 5,003,059) employs the Sanger methodology for DNA sequencing by using a combination of either the four stable isotopes 325, 335 345 365 or 35C1; 3~C1, ~9Br, 8lBr to specifically label the chain-terminating ddNTP's. The sulfur isotopes can be located either in the base or at the alpha-position of the triphosphate moiety whereas the halogen isotopes are located either at the base or at the 3'-position of the sugar ring.
The sequencing reaction mixtures are separated by an electrophoretic technique such as CZE, transferred to a combustion unit in which the sulfur isotopes of the incorporated ddNTP's are transformed at about 900°C in an oxygen atmosphere. The 502 generate with masses of 64, 65, 66 or 68 is determined on-line by mass spectrometry using, e.g., mass analyzer, a quadrupole with a single ion-multiplier to detect the ion current.
1. 2.8.6 Using resonance ionization spectroscopy in conjunction with a magnetic sector mass analyzer A similar approach is proposed in U.S. Patent No. 5,002,868 (Jacobson a al., Proc. SPIE-Int. Soc. Opt. Eng. 1435, 9pt. Methods Ultrasensitive Detect. Anal.
Tech.
26-35 (1991)) using Sanger sequencing with four ddNTP's specifically substituted at the alpha-position of the triphosphate moiety with one of the four stable sulfur isotopes as described above and subsequent separation of the four sets of nested sequences by tube gel electrophoresis. The only difference is the use of resonance ionization spectroscopy (RIS) in conjunction with a magnetic sector mass analyzer as disclosed in U.S. Patent No. 4,442,354 to detect the sulfur isotopes corresponding to th specific nucleotide terminators, and by this, allowing the assignment of the DNA
sequence.
1. 2.8.7 Using tube gel electrophoresis, a nebulizer and a mass analyzer to sequence EPO Patent Applications No. 0360676 Al and 0360677 Al also describe Sanger sequencing using stable isotope substitutions in the ddNTP's such as D, 13C, ISN, m0, 1g0, 325, 335 345' 365' i9F~ ssCl~ 3~C1, ~9Br, $IBr and 12~I or function groups such as CF3 or Si(CH3)3 at the base, the sugar or the alpha position of the triphosphate moiety according to chemical functionality. The Sanger sequencing reaction mixtures are separated by tube gel electrophoresis. The effluent is converted into an aerosol by the electrospray/thermospray nebulizer method and then atomized and ionize by a hot plasma (7000 to 8000°K) and analyzed by a simple mass analyzer. An instrument is proposed which enables one to automate the analysis of the Sanger sequencing reaction mixture consisting of tube electrophoresis, a nebulizer and a mass analyzer.
The application of mass spectrometry to perform DNA sequencing by the hybridization/fragment method (see above) has been recently suggested (Bains, "DNA
Sequencing by Mass Spectrometry: Outline of a Potential Future Application, Chimicaoiggi 2, 13-I6 (1991)).

1.2.9 Probes 1. 2.9.1 Using large arrays of nucleic acid probes on a substrate Alternative techniques have been proposed for sequencing a nucleic acid. PCT
patent Publication No. 92110588, incorporated herein by reference for all purposes, describes one improved technique in which the sequence of a labeled, target nucleic acid is determined by hybridization to an array of nucleic acid probes on a substrate.
Each probe is located at a positionally distinguishable location on the substrate. When the labeled target is exposed to the substrate, it binds at locations that contain complementary nucleotide sequences. Through knowledge of the sequence of the probes at the binding locations, one can determine the nucleotide sequence of the target nucleic acid. The technique is particularly efficient when very large arrays of nuleic acid probes are utilized.
Such arrays can be formed according to the techniques described in U.S.
Patent No. 5,143,854 issued to Pirrung et al. See also U.S. application Serial No.
07/805,727, both incorporated herein by reference for all purposes.
1. 2.9.2 Employing sequencing by hybridization when the probes are shorter than the target When the nucleic acid probes are of a length shorter than the target, one can employ a reconstruction technique to determine the sequence of the larger target based on affinity data from the shorter probes. See U.S. Patent No. 5,202,231 to Drmanac-et al., and PCT patent Publication No. 89/10977 to Southern. One technique for overcoming this difficulty has been termed sequencing by hybridization or SBH.
For example, assume that a 12-mer target DNA 5'-AGCCTAGCTGAA is mixed with an array of all octanucleotide probes. If the target binds only to those probes having an exactly complementary nucleotide sequence, only five of the 65,536 octamer probes (3'-TCGGATCG, CGGATCGA, GGATCGAC, GATCGACT, and ATCGACTT) will hybridize to the target. Alignment of the overlapping sequences from the hybridizing probes reconstructs the complement of the original 12-mer target:
TCGGATCG
CGGATCGA
GGATCGAC

GATCGACT
ATCGACTT
TCGGATCGACTT
While meeting with much optimism, prior techniques have also met with certain limitations. For example, practitioners have 45 encountered substantial difficulty in analyzing probe arrays hybridized to a target nucleic acid due to the hybridization of partially mismatched sequences, among other difficulties. The present invention provides significant advances in sequencing with such arrays.

1. 2.10 DNA Amplification DNA can be amplified by a variety of procedures including cloning (Sambrook et at., Molecular Cloning : A Laboratory Manual., Cold Spring Harbor Laboratory Press, 1989), polymerase chain reaction (PCR) (C.R. Newton and A.
Graham, PCF, BIOS Publishers, 1994), ligase chain reaction (LCR) (F. Barany Proc.
Natl. Acad Sci USA 88, 189-93 (1991), strand displacement amplification (SDA) (G.
Terrance Walker et al., Nucleic Acids Res. 22, 2670-77 (1994)) and variations such as RT-PCR, allele-specific amplification (ASA) etc.
- The polymerase chain reaction (Mullis, K. et al., Methods Enzymol., 155:335-350 1987) permits the selective in vitro amplification of a particular DNA
region by mimicking the phenomena of in vivo DNA replication. Required reaction components are single stranded DNA, primers (oligonucleotide sequences complementary to the 5' and 3' ends of a defined sequence of the DNA template), deoxynucleotidetriphosphates and a DNA polymerase enzyme. Typically, the single stranded DNA is generated by heat denaturation of provided double strand DNA.
The reaction buffers contain magnesium ions and co-solvents for optimum enzyme stability and activity.
The amplification results from a repetition of such cycles in the following manner: The two different primers, which bind selectively each to one of the complementary strands, are extended in the first cycle of amplification. Each newly synthesized DNA then contains a binding site for the other primer. Therefore each new DNA strand becomes a template for any further cycle of amplification enlarging the template pool from cycle to cycle. Repeated cycles theoretically lead to exponential synthesis of a DNA-fragment with a length defined by the S' termini of the primer.
The PCR amplification procedure has been used to sequence the DNA being amplified (e.g. "Introduction to the AmpliTaq Cycle Sequencing Kit Protocol", a booklet from Perkin Elmer Cetus Corporation). The DNA could be first amplified and then it could be sequenced using the two conventional DNA sequencing techniques.
Modified methods for sequencing PCR-amplified DNA have also been developed (e.g. Bevan et al., "Sequencing of PCR-Amplified DNA" PCR Meth. App. 4:222 ( 1992)).

1. 2.11 Additional Sequencing Methods 1. 2.11.1 Sanger sequencing using the degradation of phosphorothioate-containing DNA fragments A recent modification of the Sanger sequencing strategy involves the degradation of phosphorothioate-containing DNA fragments obtained by using alpha-thio dNTP instead of the normally used ddNTPs during the primer extension reaction mediated by DNA polymerase (Labeit et al., MA 5, 173-177 (1986); Amersham, PCT- Application GB86/00349; Eckstein et al., Nucleic Acids Res. l~, 9947 (1988)).
Here, the four sets of base-specific sequencing ladders are obtained by limited digestion with exonuclease III or snake venom phosphodiesterase, subsequent separation on PAGE and visualization by radioisotopic labeling of either the primer or one of the dNTPs. In a further modification, the base-specific cleavage is achieved by alkylating the sulphur atom in the modified phosphodiester bond followed by a heat treatment (Max- Planck- Geselischaft, DE 3930312 Al). Both methods can be combined with the amplification of the DNA via the Polymerase Chain Reaction (PCR).
1. 2.11.2 Sanger sequencing using modified polymerization reation (at high temperature) Initial PCR experiments used thermolabile DNA polymerase. However, thermolabile DNA polymerase must be continually added to the reaction mixture after each denaturation cycle. Major advances in PCR practice were the development of a polymerase, which is stable at the near-boiling temperature (Saiki, R. et al., Science 239:487-491 1998) and the development of automated thermal cyclers.
The discovery of thermostable polymerases also allowed modification of the Sanger sequencing reaction with significant advantages. The polymerization reaction could be carned out at high temperature with the use of thermostable DNA
polymerase in a cyclic manner (cycle sequencing). The conditions of the cycles are similar to those of the PCR technique and comprise denaturation, annealing, and extension steps. Depending on the length of the primers only one annealing step at the beginning of the reaction may be sufficient. Carrying out a sequencing reaction at high temperature in a cyclic manner provides the advantage that each DNA
strand can serve as template in every new cycle of extension which reduces the amount of DNA

necessary for sequencing, thereby providing access to minimal volumes of DNA, as well as resulting in improved specificity of primer hybridization at higher temperature and the reduction of secondary structures of the template strand.
1. 2.11.3 Semi-exponential cycle. sequencing using a second reverse primer in the sequencing reaction However, amplification of the terminated fragments is linear in conventional cycle sequencing approaches. A recently developed method, called semi-exponential cycle sequencing shortens the time required and increases the extent of amplification obtained from conventional cycle sequencing by using a second reverse primer in the sequencing reaction. However, the reverse primer only generates additional template strands if it avoids being terminated prior to reaching the sequencing primer binding site. Needless to say, terminated fragments generated by the reverse primer can not serve as a sufficient template. Therefore, in practice, amplification by the semi-exponential approach is not entirely exponential. (Sarkat, G. and Bolander Mark E., Semi Exponential Cycle Sequencing Nucleic Acids Research, 1995, Vol. 23, No.
7, p.
1269-1270).
1. 2.11.4 Need to facilitate highthroughput sequencing In addition to the foregoing limitations inherent in current sequencing techniques, the generation of DNA substrate molecules for each 300 to 500 nucleotides to be sequenced is presently required. Assuming no overlapping sequence between substrate molecules, the sequencing of both strands of an entire mammalian genome would, therefore, require the generation of at least 20 million DNA
substrate molecules.
As pointed out above, current nucleic acid sequencing methods require relatively large amounts (typically about 1 g) of highly purified DNA
template. Often, however, only a small amount of template DNA is available. Although amplifications may be performed, amplification procedures are typically time consuming, can be limited in the amount of amplified template produced and the amplified DNA
must be purified prior to sequencing. A streamlined process for amplifying and sequencing DNA is needed, particularly to facilitate highthroughput nucleic acid sequencing.

1. 2.12 Strategies for obtaining the initial sequence Methods currently used to sequence large segments of DNA do not lend themselves to large-scale determination of genomic sequences. In general., the initial determination of a genomic clone sequence results in ambiguities and discrepancies that are resolved by assembling and editing the raw sequencing data into a consensus sequence. There are also, generally, holes in the sequence that need to be filled in in order to create a finished sequence. There are two general strategies for obtaining the initial sequence: shotgun sequencing and transposon-mediated directed sequencing.
1. 2.12.1 Shotgun sequencing In the currently existing methods for sequencing very long DNA of millions of nucleotides, the DNA is fragmented into smaller, overlapping fragments, and sub-cloned to produce numerous clones containing overlapping DNA sequences. These clones are sequenced randomly and the sequences assembled by "overlap sequence-matching" to produce the contiguous sequence. In this shot-gun sequencing method, approx. ten times more sequencing than the length of the DNA being sequenced is required to assemble the contiguous sequence. Shotgun sequencing is reasonably appropriate for generating the initial sequences of the genomic clone. In this method, the clone is digested with a multiplicity of restriction enzymes and the individual fragments are sequenced. When sufficient sequence is obtained to putatively cover the length of the genomic clone (1 x total sequence length) statistically 65% of the genomic clone sequence will have successfully been determined. The shotgun strategy relies on assembly algorithms to piece together a final sequence by determining relationships between a selected set of random templates. Although this assembly process is semiautomated, it remains labor-intensive, especially in complex regions that contain highly related tandem repeats. In addition, since the selection of subclones is not random, gaps of unknown distance are included between islands of known sequence. Linking up the islands requires either sequencing additional subclones or ordering custom oligonucleotides to generate sequence into the gaps.
The weaknesses of shotgun sequencing performed on substantial lengths of nucleotide sequence are thus 1) the difficulties involved in sequence assembly and 2) the need for hole-filling.
A non-ordered approach to sequencing, e.g., shotgun sequencing, would require the generation of 100 to 200 million DNA templates. Although there has been effort directed to automating the steps presently involved in DNA substrate generation, e.g., restriction mapping, preparation of subfragments for subcloning, identification of subclones, growing bacterial cultures, and purifying nucleic acids, it is unlikely that human intervention can be substantially eliminated from the process.
Current approaches, therefore, are less than optimal for the large scale sequencing of DNA, particularly sequencing the human genome.
Although the problems enumerated above are not intended to be exhaustive, the limitations inherent in methods presently available for sequencing DNA are readily apparent. Accordingly, there exists a need for an improved method of sequencing DNA that circumvents the need for primer binding sites as well as the need to determine restriction maps. Additionally, there exists a need for an improved method which extends the amount of sequence information obtainable from a DNA
substrate, thus substantially reducing the number of DNA substrate molecules required to sequence a given region of DNA. The present invention meets these needs.
1. 2.12.2 Transposon-mediated directed sequencing On the other hand, the transposon-mediated sequencing method described by Strathmann, M. et al. Proc Natl Acad Sci USA (1991) 88:1247- 1250, provides an orderly approach to generating subclones for sequencing. The method uses a .gamma..delta. bacterial transposable element bracketed by sequencing primers.
The primer-flanked transposon permits the introduction of evenly spaced priming sites across a fragment with an unknown DNA sequence. The number of template sequences required to obtain the complete sequence information can be calculated from the length of the fragment. In the "directed" sequencing method, the linear order of the DNA clones has to be first determined by "physical mapping" of the clones. As the transposon insertions are random, the positions of the insertions are mapped, for example, using the polymerase chain reaction (PCR) using primers that amplify the intervening sequence between the transposon insertion site and the vector sequences at each end of the inserted fragment to be sequenced. The lengths of the amplified products thus define a map position for the transposon. Sequencing can be conducted based on the sequencing primers flanking the transposon, and since the position of the transposon has been mapped prior to sequencing, a fully automated assembly process is possible. There are no gaps since an ordered set of sequencing templates which cover the DNA fragment is produced.
1. 2.12.3 Drawbacks of these two strategies, "primer-walking" method However, transposon sequencing can only be used on fragments containing 2-kb; preferably 3-4 kb. Thus, to use the transposon method on larger fragments, smaller subclones of the original fragment must be generated and organized into an ordered overlapping set. The shotgun strategy is not completely appropriate for this purpose. Neither is an alternative strategy termed dog-tagging. Dog-tagging is a "walking" process, a contiguous DNA sequencing method called the "primer-walking" method using the Sanger's DNA polymerase enzymatic sequencing procedure, that scans through a 30-hit subclone library for sequences that are near the end of the last walking step. It is labor-intensive and does not always succeed. In this method, the DNA copying has to occur always from the template DNA during DNA
sequencing. In contrast, in the PCR procedure, the target DNA amplified in the first rounds from the original input template DNA will function as the template DNA
in subsequent cycles of amplification. After a certain cycles of amplification, the DNA
sequencing reaction will be started by adding the sequencing "cocktail". Thus in the PCR reaction, only one copy of template DNA is theoretically sufficient to amplify into millions of copies, and therefore a very little genomic (or template) DNA
is sufficient for sequencing. The advantage of DNA amplification that exists in PCR is lacking in the conventional Sanger procedure. Thus, this primer-walking method will require a larger amount of template DNA compared to the PCR sequencing method.
Also, because the long DNA has a tendency to re-anneal back to duplex DNA, the sequencing gel pattern may not be as clean as in a PCR procedure, when a very long DNA is being sequenced. This may limit the length of the DNA, that could be contiguously sequenced without breaking the DNA, using the primer- walking procedure. The PCR method also enables the reduction of non-specific binding of the primers to the template DNA because the enzymes used in these protocols function at high-temperatures, and thus allow "stringent" reaction conditions to be used to improve sequencing.
The present method of contiguous DNA sequencing using the basic PCR
technique has thus many advantages over the primer walking method. Also, so far no method exists for contiguously sequencing a very long DNA using PCR technique.

The present invention thus offers a unique and very advantageous procedure for contiguous DNA sequencing.
1. 2.12.4 Amplification and equencing a long genomic DNA without subcloning into smaller fragments In one embodiment, the present invention provides a method for contiguous sequencing of very long DNA using a modification of the standard PCR technique without the need for breaking down and subcloning the long DNA.
The PCR technique enables the amplification of DNA which lies between two regions of known,sequence (K. B. Mullis et al., U.S. Pat. Nos. 4,683,202;
7/1987;
435/91; and 4,683,195, 7/1987; 435/6). Oligonucleotides complementary to these known sequences at both ends serve as "primers" in the PCR procedure. Double stranded target DNA is first melted to separate the DNA strands, and then oligonucleotide (oligo) primers complementary to the ends of the segment which is desired to be amplified are annealed to the template DNA. The oligos serve as primers for the synthesis of new complementary DNA strands, using a DNA polymerase enzyme and a process known as primer extension. The orientation of the primers with respect to one another is such that the 5' to 3' extension product from each primer contains, when extended far enough, the sequence which is complementary to the other oligo. Thus, each newly synthesized DNA strand becomes a template for synthesis of another DNA strand beginning with the other oligo as primer.
Repeated cycles of melting, annealing of oligo primers, and primer extension lead to a (near) doubling, with each cycle, of DNA strands containing the sequence of the template beginning with the sequence of one oligo and ending with the sequence of the other oligo.
The key requirement for this exponential increase of template DNA is the two oligo primers complementary to the ends of the sequence desired to be amplified, and oriented such that their 3' extension products proceed toward each other. If the sequence at both ends of the segment to be amplified is not known, complementary oligos cannot be made and standard PCR cannot be performed. The object of the present invention is to overcome the need for sequence information at both ends of the segment to be amplified, i.e. to provide a method which allows PCR to be performed when sequence is known for only a single region, and to provide a method for the contiguous sequencing of a very long DNA without the need for subcloning of the DNA.
Amplifying and sequencing using the PCR procedure requires that the sequences at the ends of the DNA (the two primer sequences) be known in advance.
Thus, this procedure is limited in utility, and cannot be extended to contiguously sequence a long DNA strand. If the knowledge of only one primer is sufficient without anything known about the other primer, it would be greatly advantageous for sequencing very long DNA molecules using the PCR procedure. It would then be possible to use such a method for contiguously sequencing a long genomic DNA
without the need for subcloning it into smaller fragments, and knowing only the very first, beginning primer in the whole long DNA.
1. 2.12.5 Large-scale sequencing throught the generation of a subclone path In another embodiment, the present invention provides a large-scale sequencing method which combines efficient method to generate a subclone path through the large original fragment, such as a genomic clone, wherein the subclones are accessible to transposon sequencing, in combination with sequencing these subclones using the transposon method.

1. 2.13 Constructing ordered clone maps of DNA sequences A primary goal of the human genome project is to determine the entire DNA
sequence for the genomes of human, model, and other useful organisms. A
related goal is to construct ordered clone maps of DNA sequences at 100 kilobase (kb) resolution for these organisms (D. R. Cox, E. D. Green, E. S. Lander, D.
Cohen, and R. M. Myers, "Assessing mapping progress in the Human Genome Project,"
Science, vol. 265, no. 5181, pp. 2031- 2, 1994), incorporated by reference. Integrated maps that localize clones together with polymorphic genetic markers (J. Weber and P. May, "Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction," Am. J. Hum. Genet., vol. 44, pp. 388-396, 1989), incorporated by reference, are particularly useful for positionally cloning human disease genes (F. Collins, "Positional cloning: lets not call it reverse anymore," Nature Genet., vol. l, no. 1, pp. 3-6, 1992), incorporated by reference. The greatest need, however, is for sequence-ready maps. Also useful are maps of expressed sequences.
Mapping techniques include restriction enzyme analysis of genetic material., and the hybridization and detection of specific oligonucleotides which test for the presence or absence of particular alleles or loci, and may further be used to gain spatial information about the occurrence of their targets when appropriate analytic techniques are subsequently applied. Note that such characterizations presently are methodologically and operationally distinct from other processes comprehended within the biotechnological and related arts. Human DNA sequences now exist as genomic libraries in a variety of small- and large-insert capacity cloning vectors, with yeast artificial chromosomes (YACs) (D. T. Burke, G. F. Carle, and M. V.
Olson, "Cloning of large exogenous DNA into yeast by means of artificial chromosomes,"
Science, vol. 236, pp. 806-812, 1987), incorporated by reference, used extensively in mapping large regions. Efficient strategies for performing the requisite experimentation are critical for sequencing and mapping chromosomes or entire genomes.
1. 2.13.1 Sequence-tagged site The starting point for an effective sequencing method is a complete ordered clone map of a genome. Current strategies for ordering clones build contiguous sequences (contigs) using short-range comparison data. Sequence-tagged site (STS) (M. Olson, L. Hood, C. Cantor, and D. Botstein, "A common language for physical mapping of the human genome," Science, vol. 245, pp. 1434-35, 1989), incorporated by reference, comparisons with clones are used in STS-content mapping (SCM) (E.
D. Green and P. Green, "Sequence-tagged site (STS) content mapping of human chromosomes: theoretical considerations and early experiences," PCR Methods and Applications, vol. 1, pp. 77-90, 1991), incorporated by reference. For chromosomal or genome-wide SCM, very large YACs (megaYACs) are required for the currently available STS densities (R. Arratia, E. S. Larder, S. Tavare, and M. S.
Waterman, "Genomic mapping by anchoring random clones: a mathematical analysis,"
Genomics, vol. 11, pp. 806-827, 1991; W. J. Ewers, C. J. Bell, P. J. Donnelly, P.
Dunn, E. Matallana, and J. R. Esker, "Genome mapping with anchored clones:
theoretical aspects," Genomics, vol. 11, pp. 799-805, 1991), incorporated by reference; these large YACs are often chimeric or contain gaps. Restriction fragment fingerprint mapping has been done with hybridization (C. Bellanne-Chantelot, B.
Lacroix, P. Ougen, A. Billault, S. Beaufils, S. Bertrand, S. Georges, F.
Gliberr, I.
Gros, G. Lucotte, L. Susini, J.-J. Codani, P. Gesnouin, S. Pook, G. Vaysseix, J. Lu-Kuo, T. Ried, D. Ward, I. Chumakov, D. Le Paslier, E. Barillot, and D. Cohen, "Mapping the whole genome by fingerprinting yeast artificial chromosomes,"
Cell, vol. 70, pp. 1059-1068, 1992; R. L. Stallings, D. C. Torney, C. E: Hildebrand, J. L.
Longmire, L. L. Deaven, J. H. Jett, N. A. Doggert, and R. K. Moyzis, "Physical mapping of human chromosomes by repetitive sequence hybridization," Proc.
Natl.
Acad. Sci. USA, vol. 87, pp. 6218-6222, 1990), incorporated by reference, or without hybridization (A. Coulson, J. Sulston, S. Brenner, and J. Karn, "Toward a physical map of the genome of the nematode Caenorhaboditis elegans," Proc. Natl. Acad.
Sci.
USA, vol. 83, pp. 7821-7825, 1986), incorporated by reference. With hybridization fingerprinting, path analysis of YAC fingerprints is not always reliable when constructing contigs. Hybridizing an internal clone sequence (e.g., end-clone sequence, Alu- PCR probes) against a library to determine neighboring sequences builds unpositioned YAC contigs (M. T. Ross and V. P. J. Stanton, "Screening large-insert libraries by hybridization," in Current Protocols in Human Genetics, vol. 1, N.
J. Dracopoli, J. L. Haines, B. R. Korf, C. C. Morton, C. E. Seidman, J. G.
Seidman, D.
T. Moir, and D. Smith, ed. New York: John Wiley and Sons, 1995, pp. 5.6.1-5.6.34), incorporated by reference, although walking techniques are generally reserved for closing gaps.

1. 2.13.2 Gridding library onto nylon filters, and hybridizing with probes to reduce cost, increase throughput The number of experiments needed for these short-range clone mapping approaches increases with the number of clones in the library. While considerable efficiency is gained by using multiplexed experiments with pooled reagents (G.
A.
Evans and K. A. Lewis, "Physical mapping of complex genomes by cosmid multiplex analysis," Proc. Natl. Acad. Sci. USA, vol. 86, no. 13, pp. 5030-4, 1989; E.
D. Green and M. V. Olson, "Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction," Proc. Natl. Acad. Sci. USA, vol. 87, no. 3, pp.
1213-7, 1990), incorporated by reference, the experimental requirements are at least proportional to the number of clones. A useful goal is to significantly reduce cost and increase throughput by achieving a number of required experiments largely independent of library size. One step toward this independence has been achieved by gridding an entire library onto nylon filters, and then hybridizing these filters with a set of probes (H. Lehrach, A. Drmanac, J. Hoheisel, Z. Larin, G. Lennon, A. P.
Monaco, D. Nizetic, G. Zehetner, and A. Poustka, "Hybridization fingerprinting in genome mapping and sequencing, " in Genetic and Physical Mapping I: Genome Analysis, K. E. Davies and S. M. Tilghman, ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1990, pp. 39-81; A. P. Monaco, V. M. S. Lam, G.
Zehetner, G. G. Lennon, C. Douglas, D. Nizetic, P. N. Goodfellow, and H.
Lehrach, "Mapping irradiation hybrids to cosmid and yeast artificial chromosome libraries by direct hybridization of Alu-PCR products," Nucleic Acids Res., vol. 19, no.
12, pp.
3315-3318, 1991), incorporated by reference. For example, contigs of small genomic regions have been constructed by oligonucleotide fingerprinting of gridded cosmid filters (A. G. Craig, D. Nizetic, J. D. Hoheisel, G. Zehetner, and H. Lehrach, "Ordering of cosmid clones covering the herpes simplex virus type I," Nucleic Acids Res., vol. 18, no. 9, pp. 2653-60, 1990; A. J. Cuticchia, J. Arnold, and W. E.
Timberlake, "ODS: ordering DNA sequences, a physical mapping algorithm based on simulated annealing," CABIOS, vol. 9, no. 2, pp. 215- 219, 1992), incorporated by reference.

1. 2.13.3 Radiation hybrid mapping To efficiently span larger genomic regions, radiation hybrid (RH) mapping (D.
R. Cox, M. Burmeister, E. R. Price, S. Kim, and R. M. Myers, "Radiation hybrid mapping: a somatic cell genetic method for constructing high-resolution maps of mammalian chromosomes," Science, vol. 250, pp. 245-250, 1990), incorporated by reference, has been used to localize small DNA sequences (though not clones) into high-resolution bins. Relatively few PCR experiments with one 96-well plate library of RHs generally suffice for mapping STSs or genes to unique bins having 250 kb to 1 Mb average resolution. The very large multiple fragments in each RH clone efficiently cover much of a chromosome (or genome). Assaying a sequence for intersection against a set of RHs provides long- range relational information for localization much akin to somatic cell hybrid (SCH) mapping (M. C. Weiss and H.
Green, "Human-mouse hybrid cell lines containing partial complements of human chromosomes and functioning human genes," Proc. Natl. Acad. Sci. USA, vol. 58, pp.
1104-1111, 1976), incorporated by reference. However, RH mapping offers much greater resolution than SCH or fluorescent in situ hybridization (FISH) mapping.
1. 2.13.4 Combining RH mapping with filter hybridization techniques For highly optimized experimentation, it would be desirable to combine high-resolution long-range RH mapping with low-cost high-throughput filter hybridization techniques to map clones. One can serially probe a gridded clone library with a set of RHs (H. Lehrach, A. Drmanac, J. Hoheisel, Z. Larin, G. Lennon, A. P. Monaco, D.
Nizetic, G. Zehetner, and A. Poustka, "Hybridization fingerprinting in genome mapping and sequencing," in Genetic and Physical Mapping I: Genome Analysis, K.
E. Davies and S. M. Tilghman, ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory, 1990, pp. 39-81), in principle requiring a number of experiments that is independent of the clone library size and logarithmically related to the desired map resolution. However, complex hybridization probes such as RHs (or their Alu-PCR products) generate data containing considerable noise. This inherent uncertainty, together with the large clone insert size (which complicates conventional RH
analysis), has thus far precluded high-resolution mapping of clones using RHs (J.
Kumlien, T. Labella, G. Zehetner, R. Vatcheva, D. Nizetic, and H. Lehrach, "Efficient identification and regional positioning of YAC and cosmid clones to human chromosome 21 by radiation fusion hybrids," Mammalian Genome, vol. 5, no. 6, pp.
365-71, 1994), incorporated by reference.
1. 2.13.5 Inner product mapping Inner product mapping (IPM) is a hybridization-based method for achieving high-throughput, high-resolution RH mapping of clones (M. W. Perlin and A.
Chakravarti, "Efficient construction of high-resolution physical maps from yeast artificial chromosomes using radiation hybrids: inner product mapping,"
Genomics, vol. 18, pp. 283-289, 1993), incorporated by reference, that overcomes this barrier.
Experimental data have established that IPM is a highly rapid, inexpensive, accurate, and precise large-scale long-range mapping method, particularly when preexisting RH
maps are available, and that IPM can replace or complement more conventional short-range mapping methods.
1. 2.13.6 Obtaining improved mapping results Improved mapping results can be obtained incrementally by gradually enlarging the data tables, a process which provides useful feedback to both experimentation and analysis. With additional RHs, the signal-to-noise characteristics of the clone profiles improve. This incremental process, and the relatively few RHs required for accurate mapping, follows the logarithmic number of the probes needed for IPM. For best mapping results, as many STS-typed RHs as feasible are used:
with currently available high-throughput, robotically-assisted hybridization methods, the localization benefits of performing many filter hybridizations outweigh the relatively low experimentation costs. The incremental construction also highlights IPM's indirect inference of map location: STS-content mapping directly compares clones with STSs, and can not map small-insert clones against STSs which are insufficiently dense .
1. 2.13.7 Building accurate maps and partitioning data noise IPM builds accurate maps from low-confidence data. IPM's partitioning of the experiments into two data tables of (A) clones vs. RHs and (B) RHs vs. STSs also partitions the data noise. Table B is formed from relatively noiseless PCR-based comparisons of STSs against RH DNA, and can thus accurately order and position the STS bins using combinatorial mapping procedures (M. Boehnke, "Radiation hybrid mapping by minimization of the number of obligate chromosome breaks," Genetic Analysis Workshop 7: Issues in Gene Mapping and the Detection of Major Genes.

Cytogenet Cell Genet, vol. 59, pp. 96-98, 1992; M. Boehnke, K. Large, and D.
R.
Cox, "Statistical methods for multipoint radiation hybrid mapping," Am. J.
Hum.
Genet., vol. 49, pp. 1174-1188, 1991), incorporated by reference. Table A is formed from inherently unreliable and inconsistently replicated hybridizations of complex RH
probes against gridded filters. Inner product mapping uses the table B data matrix to ameliorate these data errors and robustly translate a clones's noisy RH
signature vector (a row of table A) into a chromosomal profile, whose peak bins the clone.
1. 2.13.8 Mapping YAC's using IPM
IPM is a proven approach for mapping YACs (C. W. Richard III, D. J.
Duggan, K. Davis, J. E. Farr, M. J. Higgins, S. Qin, L. Zhang, T. B. Shows, M.
R.
James, and M. W. Perlin, "Rapid construction of physical maps using inner product mapping: YAC coverage of chromosome 11," in Fourth International Conference on Human Chromosome 1 l, Sep. 22-24, Oxford, England, 1994), incorporated by reference, and is a candidate method for mapping PACs (P. A. Ioannou, C. T.
Amemiya, J. Games, P. M. Kroisel, H. Shizuya, C. Chen, M. A. Batzer, and P. J.
de Jong, "A new bacterophage P1-derived vector for the propagation of large human DNA fragments," Nature Genet., vol. 6, no. l, pp. 84-89, 1994), incorporated by reference, cosmids, expressed sequences (M. D. Adams, J. M. Kelley, J. D.
Gocayne, M. Dubnick, M. H. Polymeropoulos, H. Xiao, C. R. Merril, A. Wu, B. Olde, R. F.
Moreno, A. R. Kerlavage, W. R. McCombie, and J. C. Venter, "Complementary DNA
sequencing: Expressed sequence tags and human genome project," Science, vol.
252, pp. 1651-1656, 1991), incorporated by reference, and other physical reagents (J. D.
McPherson, C. Wagner- McPherson, M. Perlin, and J. J. Wasmuth, "A physical map of human chromosome 5 (Abstract)," Amer. J. Hum. Genet., vol. 55, no. 3 Supplement, pp. A265, 1994), incorporated by reference. Hybridization efficiency for table A can be improved by using long and IRE-bubble PCR (D. J. Munroe, M.
Haas, E. Bric, T. Whirton, H. Aburatani, K. Hunter, D. Ward, and D. E. Housman, "IRE-bubble PCR: a rapid method for efficient and representative amplification of human genomic DNA sequences from complex sources," Genomics, vol. 19, no. 3, pp. 506-14, 1994), incorporated by reference, to reduce false negative errors, providing controls and redundant DNA spotting for internal calibration, and directly acquiring signals (e.g., via a phosphorimager, Molecular Dynamics, Sunnyvale, Calif.) to facilitate automated scoring. Current robotic technologies enable the high-throughput construction of gridded filters (A. Copeland and G. Lennon, "Rapid arrayed filter production using the 'ORCA' robot," Nature, vol. 369, no. 6479, pp. 421-422, 1994);
incorporated by reference; single use of these filters would reduce the time and error related to stripping and reprobing. Robots similarly provide high-throughput PCR
comparisons for constructing table B. Alternatively, existing RH mapping data can be rapidly extended (at low cost) into inner product maps of libraries (U.
Francke, E.
Chang, K. Comeau, E.-M. Geigl, J. Giacalone, X. Li, J. Luna, A. Moon, S.
Welch, and P. Wilgenbus, "A radiation hybrid map of human chromosome 18," Cytogenet.
Cell Genet., vol. 66, pp. 196-213, 1994), incorporated by reference.
1. 2.13.9 Whole genome RH libraries Whole human genome RH (WG-RH) libraries of 0.5 and 1.0 Mb resolution have been constructed (D. R. Cox, K. O'Connor, S. Hebert, M. Harris, R. Lee, B.
Stewart, G. DiSibio, M. Boehnke, K. Large, R. Goold, and R. M. Myers, "Construction and analysis of a panel of 'whole genome' radiation hybrids (Abstract)," Amer. J. Hum. Genet., vol. 55, no. 3 Supplement, pp. A23, 1994;
M. A.
Walter, D. J. Spillerr, P. Thomas, J. Weissenbach, and P. N. Goodfellow, "A
method for constructing radiation hybrid maps of whole genomes," Nature Genet., vol.
7, no.
1, pp. 22-28, 1994), incorporated by reference, and have been characterized for the STSs used in the genome-wide CEPH megaYAC STS-content map (T. Hudson, S.
Foote, S. Gerety, J. Ma, S.-h. Xu, X. Hu, J. Bae, J. Silva, J. Valle, S.
Maitra, A.
Colbert, L. Horton, M. Anderson, M. P. Reeve, M. Daly, A. Kaufinan, C.
Rosenberg, L. Stein, N. Goodman, J. Orlin, D. C. Page, and E. S. Larder, "Towards an STS-content map of the human genome (Abstract)," Amer. J. Hum. Genet., vol. 55, no. 3 Supplement, pp. A23, 1994), incorporated by reference. The availability of this WG-RH table B resource suggests that constructing table A by performing hybridizations between species specific (e.g., Alu-PCR) products of these RHs and gridded clones or expressed sequences, and then combining tables A and B to build a genome-wide inner product map, is a fast, accurate, and inexpensive approach to whole genome physical mapping. IPM has localized the components of chimeric YACs as distinct multiple peaks. IPM is therefore useful in verifying and extending current megaYAC
mapping projects, and in multiplexed experimental designs that pool sequences from well-separated bins.

1. 2.13.10 Using short-range data to determine the orders and distances of clone subsets in proximate bins IPM provides long-range mapping information for DNA sequences relative to RH bins through DNA hybridization. This binning information can be complemented with short-range mapping data, such, as oligonucleotide fingerprint hybridizations (H.
Lehrach, A. Drmanac, J. Hoheisel, Z. Larin, G. Lennon, A. P. Monaco, D.
Nizetic, G.
Zehetner, and A. Poustka, "Hybridization fingerprinting in genome mapping and sequencing," in Genetic and Physical Mapping I: Genome Analysis, I~. E. Davies and S. M. Tilghman, ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1990, pp. 39-81), incorporated by reference, and (R. Drmanac, Z. Strezoska, I.
Labat, S.
Drmanac, and R. Crkvenjakov, "Reliable hybridization of oligonucleotides as short as six nucleotides, " DNA Cell Biol., vol. 9, no. 7, pp. 527-534, 1990), incorporated by reference. Combining the data from these two high-throughput hybridization studies enables a two-pass BIN-SORT (A. V. Aho, J. E. Hopcroft, and J. D. Ullman, Data Structures and Algorithms. Reading, Mass.: Addison-Wesley, 1983), incorporated by reference, strategy to high-resolution mapping: first use IPM to bin the clones, and then use short-range data to determine the orders and distances of clone subsets in proximate bins. This strategy can rapidly construct minimum-length paths of sequence-ready clones that tile the genome. Crucially, such IPM- derived contigs overcome the short-range limitations of all other known mapping methods, and enable the coordinated sequencing of the human genome, which is a well-recognized goal (F.
Collins and D. Galas, "A new five-year plan for the U.S. Human Genome Project,"
Science, vol. 262, pp. 43-46, 1993), incorporated by reference. Such combination approaches can be highly effective for other purposes, such as using short-range proximity data to sharpen long-range inner product map results. IPM's experimental efficiencies enable effective determination of genome-wide DNA sequences, and the construction of high-resolution integrated genome maps for human, model organism, and agricultural species.
In one embodiment, this invention pertains to determining the sequence of the genome of an organism or species through the use of a novel, unobvious, and highly effective clone mapping strategy. Such sequence information can be used for finding genes of known utility, determining structure/function properties of genes and their products, elucidating metabolic networks, understanding the growth and development of humans and other organisms, and making comparisons of genetic information between species. From these studies, diagnostic tests and pharmacological agents can be developed of great utility for preventing and treating human and other disease.
Disclosures of this type, yielded in a search, are:
Patent Number: Inventor Issued* US 5,302,509 Cheeseman, Peter C. 12 April 1994 WO 93/2134 Rosenthal., A; et al. 28 October 1993 DE 41 41 178 Al Ansorge, Wilhelm 16 June 1993 Wo 93/01583 Gibbs, Richard A.; et al. 18 March 1993 Wo 91/06678 Tsien, Roger Y.; et al. 16 May 1991 WO 90113666 Garland, Peter B.; et al.
15 November 1990 Included in some of these above disclosures are descriptions of nucleotide triphosphates comprising removable fluorescent 3' protecting groups.

1.3 ALTERNATIVE SEQUENCING METHODS
The present invention provides an improved method of determining the nucleotide base sequence of DNA. In one embodiment, the method of the invention involves the preparation of a DNA substrate comprising at a set of molecules, each having a template strand and a primer strand, wherein the 3' ends of the primer strands of the molecules terminate at about the same nucleotide position on the template strands of the molecules within each set. Preferably, the template and primer strands of the molecules are of unequal lengths wherein the 3' ends of the primer strands of the molecules terminate at about the same nucleotide position on the template strands of the molecules within each set. DNA synthesis is induced to obtain labeled reaction products comprising newly sythesized DNA complementary to the template strands using the 3' ends of the primer strands to prime DNA synthesis, labeled nucleoside triphosphates, at least one modified nucleoside triphosphate, and preferably, a suitable chain terminator, wherein the modified nucleoside triphosphate is selected to substantially protect newly synthesized DNA from cleavage. Thereafter, the labeled reaction products are cleaved at one or more selected sines to obtain labeled DNA
fragments wherein newly synthesized DNA is substantially protected from cleavage by the incorporation of the modified nucleotide. The labeled DNA fragments obtained in the preceding step are separated and their nucleotide base sequence is identified by suitable means. The advantages of the present invention over prior art methods will become apparent after consideration of the accompanying drawings and the following detailed description of the invention.

1.3.1 One-step process for generating from a DNA template According to one process of the invention, a combined amplification and termination reaction is performed using at least two different polymerise enzymes, each having a different affinity for the chain terminating nucleotide, so that polymerization by an enzyme with relatively low affinity for the chain terminating nucleotide leads to exponential amplification whereas an enzyme with relatively high affinity for the chain terminating nucleotide terminates the polymerization and yields sequencing products.
In another aspect, the invention features kits for directly amplifying nucleic acid templates and generating base specifically terminated fragments. In one embodiment, the kit can comprise an appropriate amount of: i) a complete set of chain- elongating nucleotides; ii) at least one chain-terminating nucleotide;
(iii) a first DNA polymerise, which has a relatively low affinity towards the chain terminating nucleotide., and (iv) a second DNA polymerise, which has a relatively high affinity towards the chain terminating nucleotide. The kit can also optionally include an appropriate primer or primers, appropriate buffers as well as instructions for use.
The instant invention allows DNA amplification and termination to be performed in one reaction vessel. Due to the use of two polymerises with different affinities for dideoxy nucleotide triphosphates, exponential amplification of the target sequence can be accomplished in combination with a termination reaction nucleotide.
In addition, the process obviates the purification procedures, which are required when amplification is performed separately from base terminated fragment generation.
Further, the instant process requires less time to accomplish than separate amplification and base specific termination reactions.
When combined with a detection means, the process can be used to detect and/
or quantitate a particular nucleic acid sequence where only small amounts of template are available and fast and accurate sequence data acquisition is desirable.
For example, when combined with a detection means, the process is useful for sequencing unknown genes or other nucleic acid sequences and for diagnosing or monitoring certain diseases or conditions, such as genetic diseases, chromosomal abnormalities, genetic predispositions to certain diseases (e.g. cancer, obesity, artherosclerosis) and pathogenic (e.g. bacterial., viral., fungal., protistal) infections. Further, when double stranded DNA molecules are used as the starting material., the instant process provides an opportunity to simultaneously sequence both strands, thereby providing greater certainty of the sequence data obtained or acquiring sequence information from both ends of a longer template.

1.3.2 Base-specific Reactions Used on DNA fragments from a piece of an unknown sequence In accordance with the present invention, there is also provided a method and apparatus for determining the sequence of the bases in DNA by measuring the , molecular mass of each of the DNA fragments in mixtures prepared by either the Maxam-Gilbert or Sanger-Coulson techniques. The fragments are preferably prepared as in these standard techniques, although the fragments need not be tagged with radioactive tracers. These standard procedures produce from each section of DNA to be sequenced four separate collections of DNA fragments, each set containing fragments terminating at only one or two of the four bases. In the Maxam-Gilbert method, the four separated collections contain fragments terminating at G, both G and A, both C and T, or C positions, respectively. Each of these collections is sequentially loaded into an ultraviolet laser desorption mass spectrometer, and the mass spectrum of each collection is recorded and stored in the memory of a computer. These spectra are recorded under conditions such that essentially no fragmentation occurs in the mass spectrometer, so that the mass of each ion measured corresponds to the molecular weight of one of the DNA fragments in the collection, plus a proton in the positive ion spectrum, and minus a proton in the negative ion spectrum.
Spectra obtained from the four spectra are compared using a computer algorithm, and the location of each of the four bases in the sequence is unambiguously determined.
It is also possible, in principle, to obtain the DNA sequence from a single mass spectrum obtained from a more complex single mixture containing all possible fragments, but both the resolution and mass accuracy required are much higher than in the preferred method described above. As a result the accuracy of the DNA
sequence obtained from the single spectrum method will generally be inferior, and the gain in raw sequence speed will be counterbalanced by the need for more repetitions to assure accuracy of the sequence.
The DNA fragments to be analyzed are dissolved in a liquid solvent containing a matrix material. Each sample is radiated with a UV laser beam at a wavelength of between 260 nm to 560 nm, and pulses of from 1 to 20 ns pulsewidth.
It is an objective of the present invention to provide a method and apparatus for the rapid and accurate sequencing of human genome and other DNA material.

It is a further objective of the present invention to provide an instrument and method which are relatively simple to operate, relatively low in cost, and which may be automated to sequence thousands of gene bases per hour.
It is a further objective of the present invention to obtain much faster and more accurate DNA sequence data by eliminating the gel electrophoresis separation technique used in conventional DNA sequencing methods to determine the masses of the DNA fragments in a mixture.

1.3.3 Sequencing Through Exposure To Immobilized Probes Of Shorter Length According to one embodiment of the invention, a target oligonucleotide is exposed to a large number of immobilized probes of shorter length. The probes are collectively referred to as an "array." In the method, one identifies whether a target nucleic acid is complementary to a probe in the array by identifying first a core probe having high affinity to the target, and then evaluating the binding characteristics of all probes with a single base mismatch as compared to the core probe. If the single base mismatch probes exhibit a characteristic binding or affinity pattern, then the core probe is exactly complementary to at least a portion of the target nucleic acid.
The method can be extended to sequence a target nucleic acid larger than any probe in the array by evaluating the binding affinity of probes that can be termed "left" and "right" extensions of the core probe. The correct left and right extensions of the core are those that exhibit the strongest binding affinity andlor a specific hybridization pattern of single base mismatch probes.
The binding affinity characteristics of single base mismatch probes follow a characteristic pattern in which probe/target complexes with mismatches on the 3' or 5' termini are more stable than probe/target complexes with internal mismatches.
The process is then repeated to determine additional Left and right extensions of the core probe to provide the sequence of a nucleic acid target.
In some embodiments, such as in diagnostics, a target is expected to have a particular sequence. To determine if the target has the expected sequence, an array of probes is synthesized that includes a complementary probe and all or some subset of all single base mismatch probes. Through analysis of the hybridization pattern of the target to such probes, it can be determined if the target has the expected sequence and, if not, the sequence of the target may optionally be determined.
Kits for analysis of nucleic acid targets are also provided by virtue of the present invention. According to one embodiment, a kit includes an array of nucleic acid probes. The probes may include a perfect complement to a target nucleic acid.
The probes also include probes that are single base substitutions of the perfect complement probe. The kit may include one or more of the A, C, T, G, and/or U
substitutions of the perfect complement. Such kits will have a variety of uses, including analysis of targets for a particular genetic sequence, such as in analysis for genetic diseases.
A further understanding of the nature and advantages of the inventions herein may be realized by reference to the remaining portions of the specification and the attached drawings.

1.3.4 Sequencing Contiguously, Without The Need For Fragmenting And Sub-Cloning The DNA
The present invention also enables the amplification of a DNA adjacent to a known sequence using the PCR, without the knowledge of the sequence for a second primer.
The present primary invention also provides a new method for sequencing a contiguously very long DNA sequence using the PCR technique, thereby enabling contiguous genomic sequencing. It,will avoid the need for mapping or sub-cloning of shorter DNA fragments from haploid genomes such as the bacterial genomes. This method can be used on very large DNA inserts into vectors such as the YAC.
Thus, diploid genomes can be sequenced without any further need to sub-clone from the YAC clones. The cloned inserts can be of any length, of several million nucleotides.
Alternatively, wherever purified chromosomes are available, this method can be directly applied to sequence the whole chromosome without any need to fragment the chromosome or obtain YAC clones from the chromosome. This method can also be used on whole unpurified genomes with appropriate modifications to account for the allelic variations of the two alleles present on the two chromosomes. In essence, using the method of the present invention, one can generate contiguous genomic sequence information in a manner not possible with any other known protocol using PCR.
The extended invention that enables the sequencing of an unknown region of very long DNA (e.g. genomic DNA) of totally unknown sequence would also find many applications in biology and medicine. For instance, it can be used to physically "map" a chromosome or genome. It would, for example, enable the production of an inventory of many about 500 nucleotide long sequences and the exact primer associated with each of them. This method would also enable the cloning of the amplified DNA sequences from arbitrary regions from a genomic DNA without the need for breaking down the DNA. Using appropriately longer partly fixed primers (as the second primers), very long DNA pieces (several kilobases long) could be amplified and cloned by using this method.
1.3.4.1 PCR Technique with 1 Primer In one embodiment, the present invention enables the amplification of a DNA
stretch using the PCR procedure with the knowledge of only one primer. Using this basic method, the present invention describes a procedure by which a very long DNA

of the order of millions of nucleotides can be sequenced contiguously, without the need for fragmenting and sub-cloning the DNA. In this method, the general PCR
technique is used, but the knowledge of only one primer is sufficient, and the knowledge of the other primer is derived from the statistics of the distributions of oligonucleotide sequences of specified lengths.
Present DNA sequencing methods using the separation of DNA fragments on a gel has a limitation of resolving the products of length up to about 1000 nucleotides.
Thus, in a single step, the sequence of a DNA fragment up to a length of only about 1000 nucleotides can be obtained by the two conventional DNA sequencing methods.
A DNA sequence of a few nucleotides up to many thousand nucleotides can be amplified by the PCR procedure. Thus the PCR procedure can be combined with the DNA sequencing procedure successfully.
A primer is usually of length twelve nucleotides and longer. Let the sequence of one primer is known in a long DNA sequence from which the DNA sequence is to be worked out. From this primer sequence, a specific sequence of four nucleotides occurs statistically at an average distance of 256 nucleotides. It has been worked out by Senapathy that a particular sequence of four characters would occur anywhere from zero distance up to about 1500 characters with a 99.9% probability (P.
Senapathy, "Distribution and repetition of sequence elements in eukaryotic DNA:
New insights by computer aided statistical analysis," Molecular Genetics (Life Sciences Advances), 7:53-65 (1988)). The mean distance for such an occurrence is 256 characters and the median is 180 characters. Similarly, a 5 nucleotide long specific sequence will occur at a mean distance of 1024 characters, with 99.99% of them occurnng within 6000 characters from the first primer. The median distance for the occurrence of a 5-nucleotide specific sequence is 730 nucleotides.
Similarly, a particular 6 nucleotide long sequence will occur at a mean distance of 4096 nucleotides and a median distance of 2800 nucleotides. A primer of known length, say length 14 can be prepared with a known sequence of 6 characters and the rest of the sequence being random in sequence. It means that any of the four nucleotides can occur at the "random" sequence locations. With a fixed 5, 6 or 7 nucleotide sequence within the second primer, a primer of length 12-18 can be prepared with high specificity of binding.
1.3.4.2 Non-Random Primer (Partly Fixed Primer) Such a partially non-random primer (hereafter called the partly fixed primer, or partly non-random primer, meaning that part of its sequence is fixed) can "anneal"
to only the sequence at which the fixed sequence exists. That is, from the first primer, the partly fixed primer will bind at an average distance of 1024 characters (for a fixed five nucleotide characters). This primer will bind specifically only at the location of the occurrence of the particular five nucleotide sequence with respect to the first primer. The average distance between the first primer and the second non-random primer is ideal for DNA amplification and DNA sequencing. In this situation, the first primer is labeled. Thus, although there would be many locations in the long DNA
molecule at which the non-random primer can bind, it would not affect the DNA
sequencing because it is dependent only upon the labeled primer.
1.3.4.3 Partly Fixed 2°d Primer Although the partly fixed second primer has a random sequence component in it, a sub-population of the primer molecules will have the exact sequence that would bind with the exact target sequence. The proportion of the molecules with exact sequence that would bind with the exact target sequence will vary depending on the number of random characters in the partly fixed second primer. For example, in a second primer 11 nucleotides long with 6 characters fixed and 5 characters random, one in 1000 molecules will have the exact sequence complementary to the target sequence on the template. By increasing the concentration of the partly fixed second primer appropriately, a comfortable level of PCR amplification required for sequencing can be achieved. When primer concentration is increased, it requires an increase in the concentration of Magnesium, which is required for the function of the polymerase enzyme. The excess primers (and "primer- dimers" formed due to excess of primers) can be removed after amplification reaction by a gel-purification step.
Any non-specific binding by any population of the second primers to non-target sequences could be avoided by adjusting (increasing) the temperature of re-annealing appropriately during DNA amplification. It is well known that the change of even one nucleotide due to point-mutation in some cancer genes can be detected by DNA-hybridization. This technique is routinely used for diagnosing particular cancer genes (e.g. John Lyons, "Analysis of ras gene point mutations by PCR and oligonucleotide hybridization," in PCR Protocols: A guide to methods and applications, edited by Michael A Innis et al., (1990), Academic Press, New York).

This is done by adjusting the "re-annealing" or "melting- temperature", and fine-tuning the reaction conditions. Thus the binding of non-specific sequences even with just one nucleotide difference compared to the target binding-site in the template sequence can be avoided.
It should also be noted that non-specific binding sites for the partly fixed second primers could be expected to occur statistically on a long genomic DNA
at many places other than the target site which is close to the first primer.
Amplification of non-specific DNA between these primer binding sites that could occur on opposite strands of the template DNA could happen. However, this would not affect the objective of the present invention of specific DNA sequencing of the target sequence.
Because only the first primer is labeled radioactivity or fluorescently, only the reaction products of the target DNA will be visualized on the sequencing gel pattern.
The presence of such non-specific amplification products in the reaction mixture will also not affect the DNA sequencing reaction.
Amplification of DNA will occur not only between the first primer and the partly fixed second primer that occurs closest downstream from the first primer, but also between the first primer and one or two subsequently occurring second primers, depending upon the distance at which they occur. However, these amplification products will all start from the first primer and will proceed up to these second primers. Since the DNA sequencing products are visualized by labeling the first primer, and since the DNA synthesis during the sequencing reaction proceeds from the first primer, the presence of two or three amplification products that start from the first primer will not affect the DNA sequencing products and their visualization on gels. At the most, the intensity of the bands that are subsets of different amplification products will vary slightly on the gel, but not affect the gel pattern. In fact, it is expected that this phenomenon will enable the sequencing of a longer DNA
strand where the closest downstream primer is too close to the first primer--thereby avoiding the need for sequencing from the first primer again using another partly fixed second primer.
The minimum length of primer for highly specific amplification between primers on a template DNA is usually considered to be about 15 nucleotides.
However, in the present invention, this length can be reduced by increasing the G/C
content of the fixed sequence to 12-14 nucleotides.

In essence, the basic procedure of the present invention is fully viable and feasible, and any non-specificity can be avoided by fine-tuning the reaction conditions such as adjusting the annealing temperature and reaction temperature during amplification, and/or adjusting the length and G/G content of the primers, which are routinely done in the standard PCR amplification protocol.
1.3.4.4 Sequence DNA of 2"d Primer The primary advantage of the present invention is to provide an extremely specific second primer that would bind precisely to a sequence at an appropriate distance from the first primer resulting in the ability to sequence a DNA
without the prior knowledge of the second primer. From the newly worked out DNA sequence, a primer sequence can be made complementary to a sequence located close to the downstream end. This can be used as the first primer in the next DNA
amplification-sequencing reaction, and the unknown sequence downstream from it can be obtained by again using the same partly fixed primer that was used in the first round of sequencing as the second primer. Thus, knowing only one short sequence in a contiguously long DNA molecule, the entire sequence can be worked out using the present invention.
When the length of the fixed sequence in the partly fixed second primer is increased in the present invention, the distance from the first primer at which the second primer will bind on the template will also be correspondingly increased. For a 6 nucleotide fixed sequence, the median length of DNA amplified will be 2800 nucleotides (mean 4096 nucleotides), and for a 7 nucleotide fixed sequence, the median length of amplified DNA will be ~l 1,000 nucleotides (mean= 16,000 nucleotides). However, even if the length of amplified DNA is several thousand nucleotides, still this DNA can be used in DNA sequencing procedures.
Furthermore, the present invention can be used to amplify a DNA of length which is limited only by the inherent ability of PCR amplification. A technique known as "long PCR" is used to amplify long DNA sequences (Kainz et at., "In vitro amplification of DNA
Fragments > 10 kb," Anal Biochem., 202:46 (1992); Ponce & Micol, "PCR
amplification of long DNA fragments" Nucleic Acids Research, 20:623 (1992)).
Existing genome sequencing methods employ the breaking down of a very long genomic DNA into many small fragments, sub-cloning them, sequencing them, and then assembling the sequence of the long DNA. Typically, a genomic DNA is broken down and cloned into overlapping fragments of approx. one million nucleotides in "YAC" (Yeast Artificial Chromosome) clones, each YAC clone is again fragmented and sub-cloned into overlapping fragments of 25,000 nucleotides in "cosmid" clones, and each cosmid clone in turn sub-cloned into overlapping fragments of 1000 nucleotides in "M13 phage" or "plasmid" clones. These are sequenced randomly to assemble the larger sequences in the hierarchy. The present invention circumvents the need for breaking down and sub-cloning steps, making it greatly advantageous for contiguously sequencing long genomic DNA.
1.3.4.5 The 2°d Partly Fixed Primer Enabling Sequencing Extending the above invention, another invention is presented here. This extended invention would enable the sequencing of 500 nucleotide long sequence somewhere within a given long DNA with no prior information of any sequence at all within the long DNA. The probability that any specific primer of length 10 nucleotides would occur somewhere in a DNA of about one million nucleotides is approximately 1. The probability that any primer of length 15 nucleotides occur somewhere in a genome of about one billion nucleotides is approximately 1.
Thus, use of any exact primer of about 15 nucleotide sequence on a genomic DNA in the present invention as the first primer, and the use of the second partly fixed primer will enable the sequencing of the DNA sequence bracketed by the two primers somewhere in the genome. °Thus, this procedure can be used to obtain an exact sequence of about 500 characters somewhere from a genome without the prior knowledge of any of its sequence at all. Thus, by using many different primers with arbitrary but exact sequences, one can obtain many 500-nucleotide sequences at random locations within a genome. Using these sequences as the starting points for contiguous genome sequencing in the present invention, the whole genomic sequence can be closed and completed. Thus an advantage of the present invention is that without any prior knowledge of any sequence in a genome, the whole sequence of a genome can be obtained.
It must be noted that every 15-nucleotide arbitrary primer may not always have a complementary sequence in a genome (of one billion nucleotides long).
However, most often it would be present and would be useful in performing the above-mentioned sequencing. In some cases, there may be more than one occurrence of the primer sequence in the genome, and so may not be useful in obtaining the sequence. However, the frequency of successful single-hits can be extremely high (~90%) and can be further refined by using an appropriate length of the arbitrary primer. For genomes (or long DNAs) that are shorter than a billion nucleotides, shorter exact sequences in the first primers (say 10 characters) could be used, and the rest could be random or "degenerate" nucleotides. While this primer will still bind at the sequence complementary to the exact sequence, the longer primer will aid in avoiding non-specific DNA amplification. The length of the first primer can thus be increased using degenerate nucleotides at the ends to a desired extent, without affecting any specificity. Once a sequence is known in an unknown genomic DNA, then the present method can be performed to extend a contiguous sequence in both directions of the DNA from this starting point.
The present invention can also be useful to amplify the DNA between the first primer and the partly fixed second primer, with an aim to using this amplified DNA
for purposes other than DNA sequencing, such as cloning. Although there would be sufficient quantity of the target specific amplified DNA in the reaction products, the reaction products will, however, contain the population of non-specific DNA
amplif ed between the non-specifically occurring second primer binding sites on opposite strands. However, by introducing a purification step from this reaction mixture, such as using an immobilized column containing only the first primer, the amplified target DNA can be purified and used for any other purposes.

1.3.5 Sequencing large fragments of DNA (end-sequencing-based method of subclone pathway generation through the fragment with efficient transposon-based sequencing of the identified subclones) The invention also provides a systematic and efficient way to sequence large fragments of DNA, in particular genomic DNA. It combines an end-sequencing-based method of subclone pathway generation through the fragment with efficient transposon-based sequencing of the identified subclones.
Thus, in one aspect, the invention is directed to a method to sequence a fragment of DNA, said fragment typically having a length of more than about 30 kb.
The method comprises the following steps.
First, the fragment is provided in a host cloning vector capable of accommodating it. The size of the fragment that can be sequenced will depend on the nature of the host cloning vector. Cloning vectors are available that can accommodate large fragments of DNA; even the approximately 30-40 kb fragments that are suitable for insertion into cosmids are of sufficient length that the method of the invention is usefully applicable to them.
A composition comprising said vector containing the inserted fragment is then randomly sheared, such as by sonication, to obtain subfragments of approximately 3 kb. The length of the subfragments is appropriate to the transposon-mediated directed sequencing method that will ultimately be applied. The 3 kb length is an approximation; it is intended only as an order of magnitude. Generally speaking, subfragments of 2-5 kb are susceptible to this approach.
The subfragments are then inserted into host cloning vectors to obtain a library of subclones. These host cloning vectors are ideally of minimal size, containing only a selectable marker, an origin of replication, and appropriate insertion sites for the subfragments. The desirability of minimizing the available plasmid DNA in the performance of transposon-mediated sequencing is described by Strathmann, et al.
(supra}.
Sufficient subclones that contain subfragments derived from the original fragment are then recovered to provide lx coverage of the fragment when the end of each subfragment is sequenced. A stretch of about 400-450 bases can be sequenced with assurance using available automated sequencing techniques. Thus, the sequencing can be conducted using the sequencing primers based on the vector sequences adjacent the inserts to proceed into the insert to approximately this distance. For a 1 x coverage of the original fragment, the number of subclones required can be calculated by dividing the length of the original fragment by the intended sequencing distance--i.e., by approximately 400- 450.
There should also be sufficient subclones in the library so that when the complete sequence of each is determined, the coverage of the original fragment will be about 7-8 x. This provides, as described below, a high probability that every nucleotide present in the fragment will be present in the library. This number can, of course, be determined by multiplying the length of the fragment by 7 or 8 and dividing by the length of the subfragments generated.
It is preferable to assure that all of the subclones in the library contain pieces of the original fragment. This can be done by recovering only those subclones that hybridize to the fragments.
A sufficient portion of one of the ends of each recovered subclone containing fragment-derived DNA is then sequenced and this sequence information is placed into a searchable database. The database is searched for subclones that contain subfragments with nucleotide sequences matching those that characterize the host vector that accommodated the original fragment. To the extent that these subfragments also contain sequence from the original fragment, that sequence must be at one or the other end of the original fragment. This illustrates why the efficiency of the method is improved by introducing a prescreening step which eliminates any subclones which do not contain portions of the original fragment. If the prescreening has been done, these subclones contain oligonucleotide sequence from either end of the original fragment. The identified subclones are recovered.
1.3.5.1 "Second End" Sequence A partial sequence of each of the identified subclones is determined from the opposite end of the subfragment insert from that originally placed in the database.
This provides "second end" sequence information concerning sequence further removed from the end of the original fragment. This information is then used to search the database in order to identify subclones containing nucleotide sequence that matches this second end sequence. Such subclones are likely to represent regions of the original fragment that are farther removed from the ends and provide further progress in constructing a path across the fragment. These subclones are recovered as well, and sequenced from the end opposite to that which was sequenced to provide the information for the database and this new information, in turn, used to search the database for a matching sequence. The steps of second end sequencing, searching the database with the resulting sequence information, and recovery of subclones which contain a match are repeated sequentially until subclones have been identified that represent the complete original fragment. The resulting collection of subclones consists of an ordered minimum set that collectively represent the original fragment.
The appropriate sequence of such subclones to span the original fragment from end to end is also known.
It remains only to obtain sufficient portions of the complete nucleotide sequence of each subclone from the subclone collection using transposon-mediated sequencing to provide the complete sequence of the original fragment.
In another aspect, the invention is directed to kits suitable for conducting the method of the invention.

1.3.6 Improvements in high speed, high throughput, no required eIec.:-ophoresis (and, thus, no geI reading artifacts due to the complete absence of an electrophoretic step) The invention also describes a new method to sequence DNA. The improvements over the existing DNA sequencing technologies include high speed, high throughput, no required electrophoresis (and, thus, no gel reading artifacts due to the complete absence of an electrophoretic, step), and no costly reagents involving various substitutions with stable isotopes. The invention utilizes the Sanger sequencing strategy and assembles the sequence information by analysis of the nested fragments obtained by base-specific chain termination via their different molecular masses using mass spectrometry, for example, MALDI or ES mass spectrometry. A
further increase in throughput can be obtained by introducing mass modifications in the oligonucleotide primer, the chain-terminating nucleoside triphosphates andlor the chain- elongating nucleoside triphosphates, as well as using integrated tag sequences which allow multiplexing by hybridization of tag specific probes with mass differentiated molecular weights.

1.3.7 A method and a system for sequencing a genome The present invention pertains to a method for sequencing genomes. The method comprises the steps of obtaining nucleic acid material from a genome.
Then there is the step of constructing a clone library and one or more probe libraries from the nucleic acid material. Next there is the step of comparing the libraries to form comparisons. Then there is the step of combining the comparisons to construct a map of the clones relative to the genome. Next there is the step of determining the sequence of the genome by means of the map.
The present invention pertains to a system for sequencing a genome. The system comprises a mechanism for obtaining nucleic acid material from a genome.
The system also comprises a mechanism for constructing a clone library and one or more probe libraries. The constructing mechanism is in communication with the nucleic acid material from a genome. Additionally, the system comprises a mechanism for comparing said libraries to form comparisons. The comparing mechanism is in communication with the said libraries. The system also comprises a mechanism for combining the comparisons to construct a map of the clones relative to the genome. The said combining mechanism is in communication with the comparisons. Further, the system comprises a mechanism for determining the sequence of the genome by means of said map. The said determining mechanism is in communication with said map.
1.3.7.1 A method for producing a gene of a genome The present invention additionally pertains to a method for producing a gene of a genome. The method comprises the steps of obtaining nucleic acid material from a genome. Then there is the step of constructing libraries from the nucleic acid material. Next there is the step of comparing the libraries to form comparisons. Then there is the step of combining the comparisons to construct a map of the clones relative to the genome. Next there is the step of localizing a gene on the map. Then there is the step of cloning the gene from the map.

1.3.8 Methods and means for the massively parallel characterization of complex molecules and of molecular recognition phenomena with parallelism and redundancy attained through single molecule examination methods In another embodiment, the present invention approaches the vastness of biological complexity through massive parallelism, which may conveniently be attained through various single molecule examination (SME) methods variously referred to heretofore as single molecule detection (SMD), single molecule visualization (SMV) and single molecule spectroscopy (SMS) techniques.
Used within appropriate procedures, single molecule examination methods can enable molecular parallelism.
Molecular parallelism may be applied to the examination of the composition of complex molecules (including co-polymers of natural or of synthetic origin) or to determinations of interactions between large numbers of molecules. The former case may be applied to genome-scale sequencing methods. The latter case may be applied to rapid determination of molecular complementarity, with applications in (biological or non-biological) affinity characterization, immulogical study, clinical pathology, molecular evolution (e.g. in vitro evolution), and the construction of a cybernetic immune system as well as prostheses based thereupon. In both cases, molecular recognition phenomena are observed with molecular parallelism.
Note that within said affinity characterization applications, both kinetics of both binding association and dissociation, and binding equilibria, may be examined.
Kinetics may be examined by observing the rates of occupation of appropriate sites or diverse populations thereof by some homogenous or heterogeneous sample, and the rates of vacancy formation from occupied sites. Equilibria constants may be determined by observing the proportion (number of occupied sites divided by number of total sites) of sites occupied under equilibrium conditions, with greater quantitative confidence yielded by, for example, examining more binding sites.
Sequencing of polynucleotide molecules may be effected by the (preferably end-wise) immobilization of a library of such molecules to a surface at a density convenient for detection, which will vary according to the detection methodology availed. Several methods capable of effecting such immobilization will be obvious to those skilled in the arts of recombinant DNA technology and molecular biology, among others. Priming, which may be random or non-random, is effected by any of a variety of methods, most of which are obvious to those skilled in the relevant arts.
Genome sequencing applications availing of enzymatic polymerization's and corresponding embodiments of the present invention, rely upon control over polymerization rate and nucleotide incorporation specificity, consistent with the well-known Watson-Crick base pairing rules which may be enforced (upon single nucleotides in a processive manner, as conditions permit) by the use of DNA
polymerases or analogs thereof, in combination with repeatable single molecule detection applied to a large population of diverse molecules. A sequencing cycle comprises the steps of: (l.) polymerizing one or less nucleotides, which carry some removable or neutralizable molecular label and may optionally be reversibly 3' protected (or otherwise protected in anv manner which modulates polymerization rate onto each sample molecule at the primer or at subsequent extensions thereof and in opposition to (and pairing with) a single, unique, base of the template polynucleotide strand; (2.) optionally washing away any unreacted labeled nucleotides; (3.) detecting, by either direct or indirect methods, said labeled nucleotides incorporated into said sample molecules, in a manner which repeatably associates information obtained about the type of label observed with the unique identity of the template molecule under observation, which may be uniquely distinguished by a variety of methods (which include: a mappable location of immobilization of the sample template molecule on a substrate surface; a mappable location of immobilization of the sample template molecule within some matrix volume element; microscopic labeling with some readily identifiable, e.g. combinatorially or permutationally diverse and readily examined particle or molecule or group of molecules and detection of the thus marked identity of individual free molecules in solution; and, scanning of a liquid sample may serve to modulate monomer addition rate to the strand being copied from the template molecule) from the nucleotide added during the present cycle, if these are distinct from any cleavably linked labeling moieties; (6.) optionally checking that the removal or neutralization of said label in step (4) was successful for any particular molecule of the sample, by repeating a similar detection procedure. Said sequencing cycle comprising an appropriate subset of steps 1-6 may be repeated as many times as convenient, but must be repeated a sufficient number of times to obtain sequence information of sufficient complexity from each individual molecule to permit unambiguous alignment of all such sequence information determined for all of the molecules of the sample. This minimum number of cycles will be approximately related to the complexity C of the sample to be treatated as part of the same macroscopic reaction (i.e. a macroscopic sample preparation subjected to unitary macroscopic manipulations) by the formula C<4° where n is the number of cycles.
Beyond this minimum, there are tradeoffs between the number of cycles to be performed and the number of molecules to be examined, and the confidence for sequence data obtained.
Note that unused reagents and enzymes may be recovered from washes and recycled.
1.3.8.1 Advantages of Parallelism In contrast to the previously disclosed base-addition sequencing schemes, the sequence determination applications of the present invention enjoys substantial advantages deriving from sample manipulation in the single-molecule-regime.
Working instead in the distinct single-molecule-regime rather than with populations of identical molecules provides substantial advantages of parallelism, facility of use and implementatiol, (including automated implementation,) and operability.
Among these are unanticipated advantages: (1) because a single molecule is necessarily monodisperse, failure of a molecule to undergo addition in a cycle does not cause a loss of sample monodispersion (i.e. lead to uneven sample molecules dispersity or polydispersion); such addition failure is unproblematic when single molecules are examined individually because it is readily detected and accounted for in data analysis; in contrast, samples comprising multiple identical molecules may thus take on non-identical lengths, complicating data collection and analysis; (2) samples comprising a plurality of individually distinct single molecules (species) may be handled unitarily without requiring any handling measures to keep distinct molecules apart, providing a large reduction in manipulations required on a per-species basis and not requiring the use of many separate, parallel fluid handling steps or means; (3) inadvertent multiple base additions are more readily detected and their extent is more readily quantified because these changes in quantity are large compared to the signal expected from the incorporation of a single base (i.e. single label) into a single molecular species; (4) deprotection or delabeling failures may also be readily detected and noted for the correct single molecule, such that addition failure, the presence of a label, or overlabeling in the subsequent cycle may be correctly interpreted (according to the unlabeling and single stepping methods used in a particular embodiment.) These advantages are expected to be important in the competitiveness of these present methods over conventional polynucleotide sequencing methods.
Various techniques are included to address any non-idealities encountered which may arise because of deviations from conventional polymerization or detection methods. These generally take the form of different types of redundancy, which may be employed to either prevent or resolve any such errors. Prominent among these redundancies is oversampling, i.e. the examination of some multiple (j) of the number (m) of sample molecules suggested by combinatoric computations to be minimally sufficient for full alignment of data from a sample of a given complexity.
Such oversampling redundancy will increase the confidence interval for accuracy of collected data and reduce the likelihood of artifacts arising from sequence duplications which may occur in any given sample.
1.3.8.2 Oversampling Redundancy Oversampling redundancy may be availed to increase data confidence by providing the opportunity to score and match multiple occurrences of the same sequence segment and thus detect and eliminate erroneous sequence segment information by virtue of its less frequent occurrence. Erroneous sequence segment information may arise, for instance, by nucleotide incorporation errors which are an inevitable feature of polymerization with polymerases having a characteristic fidelity, i.e. displaying a characteristic nucleotide misincorporation rate, Such methods will be particularly useful where polynucleotide polymerases fidelity would otherwise be unacceptably low. It should be noted that an error rate of one percent or more has been deemed conventionally acceptable for genome informatic purposes.

1.3.8.3 Controls/Data Further, known molecules having sequences that are highly unrelated to the sample may be included as internal controls to monitor the efficiency and accuracy of a particular sequence collection process; such internal control sequences will present negligibly small overhead because molecular parallelism may easily accommodate any such comparatively small increase in sample complexity, even though it might be considered large with respect to pre-existing methods.
After raw data have been collected for each molecule, these are all mutually compared by some appropriate matching algorithm and aligned so as to reconstruct the full sequence of the sample. The computational complexity of completing such an alignment may be estimated as the mufti- phase comparison and sorting of (j)(m) strings each of length n.
Alternatively, data alignment may be performed in tandem or parallel with later cycles and may be monitored by appropriate computational algorithms for data quality and confidence of sequence information, and cycling may continue till desired criteria are satisfied. Computer, microprocessor, electronic or other automated control of instrumentation, including fluidics and robotics for the manipulation of samples, and the automated effectuation of the various methods of the present invention, all according to parameterized algorithms, may be accomplished by means obvious from the present disclosure to those skilled in the relevant arts (e.g. fluidics, robotics, electronics, microelectronics, computer science and engineering, and mechanical engineering). Concurrent data alignment and monitoring will permit modifications of the sequencing cycle described above, such as dynamic adjustment of polymerization reaction conditions and durations, label removal or neutralization procedure parameters, polymerization deprotection conditions, and any other desired parameter, so as to permit optimization of procedures and results.
With appropriately flexible design, automated systems and instruments such as those described above for genome applications may readily be adapted, with appropriate changes in samples and labeling methods and reagents, to cybernetic molecular evolution, cybernetic immune system, broad spectrum pathogen characterization and other applications of the present invention.
1.3.8.4 Double/Single Stranded Polynucleotide Sequencing Method According to the embodiment availed, double or single stranded polynucleotides may be examined. Where single stranded polynucleotide molecules are preferred, second strands may be removed by performing said immobilization so as to only involve only one strand in covalent linkage with said surface and then performing a denaturation of the sample with washing. Priming means required by any particular enzyme must then be provided, usually by hybridization of a complementary oligo- or polynucleotide to the sample template molecules, though other means are possible. Other methods which will be obvious to those skilled in the arts of recombinant DNA technology may also be employed to yield immobilized or otherwise uniquely~identifiable single stranded polynucleotide samples.
Where double stranded molecules are preferred, said second strands may be treated with an appropriate exonuclease under appropriate conditions and for an appropriate lengths of time to provide a good distribution of lengths of said second strands such that the termini of the undegraded portions of said second strands provide convenient priming for enzymatic nucleotide polymerization (i.e. DNA
directed DNA synthesis or DNA replication, DNA directed RNA synthesis or transcription, RNA directed DNA synthesis or reverse transcription, or RNA
directed RNA synthesis or RNA replication).
Note that the polynucleotide sequencing methods of the present invention represent the converse of conventional enzymatic and chemical sequencing methods in that those conventional methods rely upon the production of multiple homogeneous sub-populations of DNA molecules which together comprise a nested set, and the detection of each of such sub-population (with deviant chain terminator misincorporation molecules arising with significantly lower frequency and thus constituting a poorly detected population), while the present invention relies on alignment of information from a highly inhomogeneous population molecules and repeatable detection of single molecules. Further note that by previous methods, each species yields information about only one base at one position within the sample sequence, while with the methods of the present invention, each individual sample template molecule may yield information about the identity of several bases.
Note also that under conventional methods, some effort has been expended in increasing the number of bases yielding information per sample, i.e. lengthening the linear sequence information obtained from any one segment of a sample, which is substantially frustrated by the inherent limitations of electrophoretic separation and particularly gel electrophoresis, while the present invention readily accomplishes the information yielded per unitary manipulation through increases in the facility and practicable extent of parallelism.
There are several levels of parallelism and pipelining possible with the methods of the present invention. An arbitrarily large number of molecules may be subjected to any given manipulation at once if they are part of the same unitary sample. Detection will have constraints entailed by the particular instrumentation and method used, but many degrees of freedom exist with regard to means of providing parallelism in detection instrumentation (e.g. multiple microscopy instruments or appropriately arranged objective lenses and controlled light paths for light microscopic based detection, multiple optoelectronic device arrays [e.g. CCDs or SLMs] for the respective types of detection; multiple probes [i.e. in arrays with parallel detection provided] for scanning probe microscopic detection methods with various degrees of freedom with respect to eachother during scanning, etc.) Means for pipelining the steps of the methods disclosed herein will be readily apparent when one considers that dedicated instrumentation or robotics may perform each relevant step, and that the ensemble of such instrumentation may readily be integrated to form a coordinated system, for example matching throughput at different stages by adjusting the parallelism of appropriate stages. Thus economy, throughput and data accuracy are tradeoffs, but may individually vastly exceed any such measures attainable with conventional methods.

1.4 EXEMPLARY GENOMIC CHARACTERIZATION METHODS
1.4.1 Employing Mass Spectrometry To Analyze The Sanger Sequencing Reaction Mixtures In one embodiment, this invention describes an improved method of sequencing DNA. In particular, this invention employs mass spectrometry to analyze the Sanger sequencing ieaction mixtures.
In Sanger sequencing, four families of chain-terminated fragments are obtained. The mass difference per nucleotide addition is 289.19 for dpC, 313.21 for dpA, 329.21 for dpG and 304.2 for dpT, respectively.
1.4.1.1 Mass Modified In one embodiment, through the separate determination of the molecular weights of the four base-specifically terminated fragment families, the DNA
sequence can be assigned via superposition (e.g., interpolation) of the molecular weight peaks of the four individual experiments. In another embodiment, the molecular weights of the four specifically terminated fragment families can be determined simultaneously by MS, either by mixing the products of all four reactions run in at least two separate reaction vessels (i.e., all run separately, or two together, or three together) or by running one reaction having all four chain-terminating nucleotides (e.g., a reaction mixture comprising dTTP, ddTTP, dATP, ddATP, dCTP, ddCTP, dGTP, ddGTP) in one reaction vessel. By simultaneously analyzing all four base-specifically terminated reaction products, the molecular weight values have been, in effect, interpolated.
Comparison of the mass difference measured between fragments with the known masses of each chain-terminating nucleotide allows the assignment of sequence to be carried out. In some instances, it may be desirable to mass modify, as discussed below, the chain-terminating nucleotides so as to expand the difference in molecular weight between each nucleotide. It will be apparent to those skilled in the art when mass-modification of the chain- terminating nucleotides is desirable and can depend, for instance, on the resolving ability of the particular spectrometer employed. By way of example, it may be desirable to produce four chain- 12 3 1 terminating nucleotides, ddTTP, ddCTP , ddATP and ddGTP where ddCTP ddATP 2 and ddGTP
3 have each been mass-modified so as to have molecular weights resolvable from one another by the particular spectrometer being used.

The terms chain-elongating nucleotides and chain-terminating nucleotides are well known in the art. For DNA, chain-elongating nucleotides include 2'-deoxyribonucleotides and chain-terminating nucleotides include 2', 3'-dideoxyribonucleotides. For RNA, chain-elongating nucleotides include ribonucelotides and chain-terminating nucleotides include 3'-deoxyribonucleotides.
The term nucleotide is also well known in the art. For the purposes of this invention, nucleotides include nucleoside mono-, di-, and triphosphates. Nucleotides also include modified nucleotides such as phosphorothioate nucleotides.
Since mass spectrometry is a serial method, in contrast to currently used slab gel electrophoresis which allows several samples to be processed in parallel, in another embodiment of this invention, a further improvement can be achieved by multiplex mass spectrometric DNA sequencing to allow simultaneous sequencing of more than one DNA or RNA fragment. As described in more detail below, the range of about 300 mass units between one nucleotide addition can be utilized by employing either mass modified nucleic acid sequencing primers or chain-elongating and/or terminating nucleoside triphosphates so as to shift the molecular weight of the base-specifically terminated fragments of a particular DNA or RNA species being sequenced in a predetermined manner. For the first time, several sequencing reactions can be mass spectrometrically analyzed in parallel. In yet another embodiment of this invention, multiplex mass spectrometric DNA sequencing can be performed by mass modifying the fragment families through specific oligonucleotides (tag probes) which hybridize to specific tag sequences within each of the fragment families. In another embodiment, the tag probe can be covalently attached to the individual and specific tag sequence prior to mass spectrometry.
1.4.1.2 Mass Spectrometer Formats Used (MALDI, ES, ICR, Fourier Transform) Preferred mass spectrometer formats for use in the invention are matrix assisted laser desorption ionization (MALDI), electrospray (ES), ion cyclotron resonance (ICR) and Fourier Transform. For ES, the samples, dissolved in water or in a volatile buffer, are injected either continuously or discontinuously into an atmospheric pressure ionization interface (API) and then mass analyzed by a quadrupole. The generation of multiple ion peaks which can be obtained using ES
mass spectrometry can increase the accuracy of the mass determination. Even more detailed information on the specific structure can be obtained using an MS/N4S
quadrupole configuration In MALDI mass spectrometry, various mass analyzers can be used, e.g., magnetic sector/magnetic deflection instruments in single or triple quadrupole mode (MS/MS), Fourier transform and time-of flight (TOF) configurations as is known in the art of mass spectrometry. For the desorption/ionization process, numerous matrix/laser combinations can be used.
Ion-trap and reflectron configurations can also be employed.
In one embodiment of the invention, the molecular weight values of at least two base-specifically terminated fragments are determined concurrently using mass spectrometry. The molecular weight values of preferably at least five and more preferably at least ten base-specifically terminated fragments are determined by mass spectrometry. Also included in the invention are determinations of the molecular weight values of at least 20 base-specifically terminated fragments and at least 30 base- specifically terminated fragments. Further, the nested base-specifically terminated fragments in a specific set can be purified of all reactants and by-products but are not separated from one another. The entire set of nested base-specifically terminated fragments is analyzed concurrently and the molecular weight values are determined. At least two base-specifically terminated fragments are analyzed concurrently by mass spectrometry when the fragments are contained in the same sample.
1.4.1.3 Process of Mass Spectrometric DNA Sequencing In general, the overall mass spectrometric DNA sequencing process will start with a library of small genomic fragments obtained after first randomly or specifically cutting the genomic DNA into large pieces which then, in several subcloning steps, are reduced in size and inserted into vectors like derivatives of M 13 or pUC
(e.g., Ml3mpl8 or M13mp19). In a different approach, the fragments inserted in vectors, such as M 13, are obtained via subcloning starting with a cDNA library. In yet another approach, the DNA fragments to be sequenced are generated by the polymerase chain reaction (e.g., Higuchi et al., "A General Method of in vitro Preparation and Mutagenesis of DNA Fragments: Study of Protein and DNA
Interactions," Nucleic Acids Res., 16, 7351-67 (1988)). As is known in the art, Sanger sequencing can start from one nucleic acid primer (UP) binding to the plus-strand or from another nucleic acid primer binding to the opposite minus-strand. Thus, either the complementary sequence of both strands of a given unknown DNA sequence can be obtained (providing for reduction of ambiguity in the sequence determination) or the length of the sequence information obtainable from one clone can be extended by generating sequence information from both ends of the unknown vector- inserted DNA fragment.
The nucleic acid primer carries, preferentially at the 5'-end, a linking functionality, L, which can include a spacer of sufficient length and which can interact with a suitable functionality, L', on a solid support to form a reversible linkage such as a photocleavable bond. Since each of the four Sanger sequencing families starts with a nucleic acid primer this fragment family can be bound to the solid support by reacting with functional groups, L', on the surface of a solid support and then intensively washed to remove all buffer salts, triphosphates, enzymes, reaction by- products, etc. Furthermore, for mass spectrometric analysis, it can be of importance at this stage to exchange the canon at the phosphate backbone of the DNA
fragments in order to eliminate peak broadening due to a heterogeneity in the rations bound per nucleotideunit. Since the L-L' linkage is only of a temporary nature with the purpose to capture the nested Sanger DNA or RNA fragments to properly condition them for mass spectrometric analysis, there are different chemistries which can serve this purpose. In addition to the examples given in which the nested fragments are coupled covalently to the solid support, washed, and cleaved off the support for mass spectrometric analysis, the temporary linkage can be such that it is cleaved under the conditions of mass spectrometry, i.e., a photocleavable bond such as a charge transfer complex or a stable organic radical. Furthermore, the linkage can be formed with L'being a quaternary ammonium group. In this case, preferably, the surface of the solid support carries negative charges which repel the negatively charged nucleic acid backbone and thus facilitates desorption. Desorption will take place either by the heat created by the laser pulse and/or, depending on L; by specific absorption of laser energy which is in resonance with the L' chromophore. The functionalities, L and L,' can also form a charge transfer complex and thereby form the temporary L-L' linleage. Various examples for appropriate functionalities with either acceptor or donator properties are depicted without limitation herein.
Since in many cases the "charge-transfer band" can be determined by LTV/vis spectrometry (see e.g. Organic Charge Transfer Complexes by R. Foster, Academic Press, 1969), the laser energy can be tuned to the corresponding energy of the charge-transfer wavelength and, thus, a specific desorption off the solid support can be initiated.
Those skilled in the art will recognize that several combinations can serve this purpose and that the donor functionality can be either on the solid support or coupled to the nested Sanger DNA/RNA fragments or vice versa.
In yet another approach, the temporary linkage L-L' can be generated by homolytically forming relatively stable radicals. As described herein, a combination of the approaches using charge-transfer complexes and stable organic radicals is shown. Here, the nested Sanger DNAlRNA fragments are captured via the formation of a charge transfer complex. Under the influence of the laser pulse, desorption (as discussed above) as well as ionization will take place at the radical position. In other examples described herein, under the influence of the laser pulse, the L-L' linkage will be cleaved and the nested Sanger DNA/RNA fragments desorbed and subsequently ionized at the radical position formed. Those skilled in the art will recognize that other organic radicals can be selected and that, in relation to the dissociation energies needed to homolytically cleave the bond between them, a corresponding laser wavelength can be selected (see e.g. Reactive Molecules by C. Wentrup, John Wiley & Sons, 1984). In yet another approach, the nested Sanger DNA/RNA fragments are captured via Watson-Crick base pairing to a solid support- bound oligonucIeotide complementary to either the sequence of the nucleic acid primer or the tag oligonucleotide sequence. The duplex formed will be cleaved under the influence of the laser pulse and desorption can be initiated. The solid support- bound base sequence can be presented through natural oligoribo- or oligodeoxyribonucleotide as well as analogs (e.g. thio-modified phosphodiester or phosphotriester backbone) or employing oligonucleotide mimetics such as PNA analogs (see e.g. Nielsen et al., Science, 254, 1497 (1991)) which render the base sequence less susceptible to enzymatic degradation and hence increases overall stability of the solid support-bound capture base sequence. With appropriate bonds, L-L', a cleavage can be obtained directly with a laser tuned to the energy necessary for bond cleavage. Thus, the immobilized nested Sanger fragments can be directly ablated during mass spectrometric analysis.
1.4.1.3.1 Conditioning Prior to mass spectrometric analysis, it may be useful to "condition" nucleic acid molecules, for example to decrease the laser energy required for volatization, to minimize fragmentation or to otherwise increase the sensitivity of mass spectrometeric detection. For example, nucleic acids can be "conditioned" by adding positive or negative charges, i.e. charge tags (CTs). CTs increase the mass spectrometer detection sensitivity by increasing the degree of ionization during the mass spectrometric (e.g.MALDI) process. A CT can be linked either to the external 3' or 5' position or internally e.g. at the 2' position or at the base, e.g. at C-5 in uracil, C-methyl group of thymine, C-5 at cytosine, at C' or C$ guanine, adenine and hypoxanthine or at the phosphate ester moiety. Charge tags, CTs, can function molecules with permanent (i.e. pH-independent) ionization, such as:
Me Me - N -- CHZCHZ - O --lVle or molecules which generate a positive charge upon MALD 1 and which are stabilized by delocalization of the positive charge by mesomeric effects in unsaturated and/or aromatic systems such as:
R
OLIGOS X
~R-~--' R' wherein, R, R', R' = H,OA1 (wherein A1= e.g.
lower alley], methyl, ethyl, propyl), N02,CN, C02H, C02 active ester, or halogen; and X = -0-, -NH-, -S-, C=O, OCO either in the para or meta position.

For example, the positive charge of a trityl cation is produced during MALDI
by the removal of a moiety such as: -OR, where R = a lower alkyl, or an anion such as C104, SbF6-, BF4- and the like.

In an alternative scheme, the trityl group is used to anchor the oligonucleotide to a solid support via the tertiary carbon and this bond is cleaved during mass spectrometry (e.g. MALDI), leaving a positive charge on the desorbing and high vacuum flying oligonucleotide.
X-- OLIGOS
- CH2-O -C - ~, I MAZ,DI
- CHz-O+ ~ R R"
OLIGOS
-~~-x-R' -One of skill in the art can readily appreciate several variations to the schemes described above. In addition to employing the charge tag array alone, one of skill in the art can employ a charge tag array in conjunction with another conditioning means.
Particularly preferred means to be used in conjunction with the CT include treating the phosphodiester bond with trialkylsilyl halides or the phosphomonothiodiester bond with alkyliodides to render the polyanionic backbone neutral.
1.4.1.3.1.1 Modification of pbosphodiester Backbone of Nucleic Acid Molecule Another example of conditioning is modification of the phosphodiester backbone of the nucleic acid molecule (e.g. cation exchange), which can be useful for eliminating peak broadening due to a heterogeneity in the cations bound per nucleotide unit. In addition, a nucleic acid molecule can be contacted with an alkylating agent such as alkyliodide, iodoacetamide, l3-iodoethanol, or 2,3 -epoxy- 1 -propanol, the monothio phosphodiester bonds of a nucleic acid molecule can be transformed into a phosphotriester bond. Likewise, phosphodiester bonds may be transformed to uncharged derivatives employing trialkylsilyl chlorides.
Further conditioning involves incorporating nucleotides which reduce sensitivity for depurination (fragmentation during MS) such as N7- or N9-deazapurine nucleotides, or RNA building blocks or using oligonucleotide triesters or incorporating phosphorothioate functions which are alkylated or employing oligonucleotide mimetics such as PNA.

Modification of the phosphodiester backbone can be accomplished by, for example, using alpha-thin modified nucleotides for chain elongation and termination.
With alkylating agents such as akyliodides, iodoacetarnide,13- iodoethanol, 2,3-epoxy-1- propanol, the monothio phosphodiester bonds of the nested Sanger fragments are transformed into phosphotriester bonds. Multiplexing by mass modification in this case is obtained by mass-modifying the nucleic acid primer (UP) or the nucleoside triphosphates at the sugar or the base moiety. To those skilled in the art, other modifications of the nested Sanger fragments can be envisioned. In one embodiment of the invention, the linking chemistry allows one to cleave off the so-purified nested DNA enzymatically, chemically or physically. By way of example, the L- L' chemistry can be of a type of disulfide bond (chemically cleavable, for example, by mcrcaptoethanol or dithioerythrol), a biotin/streptavidin system, a heterobifunctional derivative of a trityl ether group (K6ster et al., "A
Versatile Acid-Labile Linker for Modification of Synthetic Biomolecules," Tetrahedron Letters 31, 7095 (1990)) which can be cleaved under mildly acidic conditions, a levulinyl group cleavable under almost neutral conditions with a hydrazinium/acetate buffer, an arginine- arginine or lysine-lysine bond cleavable by an endopeptidase enzyme like trypsin or a pyrophosphate bond cleavable by a pyrophosphatase, a photocleavable bond which can be, for example, physically cleaved and the like. Optionally, another cation exchange can be performed prior to mass spectrometric analysis. In the instance that an enzyme-cleavable bond is utilized to immobilize the nested fragments, the enzyme used to cleave the bond can serve as an internal mass standard during MS analysis.
1.4.1.3.2 Purification Process The purification process and/or ion exchange process can be carried out by a number of other methods instead of, or in conjunction with, immobilization on a solid support. For example, the base-specifically terrainated products can be separated from the reactants by dialysis, filtration (including ultrafiltration), and chromatography.
Likewise, these techniques can be used to exchange the cation of the phosphate backbone with a counter-ion which reduces peak broadening.
The base-specifically terminated fragment families can be generated by standard Sanger sequencing using the Large Klenow fragment of E. coli DNA
polymerase I, by Sequenase, Taq DNA polymerase and other DNA polymerases suitable for this purpose, thus generating nested DNA fragments for the mass spectrometric analysis. Tt is, however, part of this invention that base-specifically terminated RNA transcripts of the DNA fragments to be sequenced can also be utilized for mass spectrometric sequence determination. In this case, various RNA
polyrnerases such as the SP6 or the T7 RNA polymerise can be used on appropriate vectors containing, for example, the SP6 or the T7 promoters (e.g. Axelrod et al., "Transcription from Bacteriophage T7 and SP6 RNA Polymerise Promoters in the Presence of 3' Deoxyribonucleoside 5' triphosphate Chain Terminators,"
Biochemistry 24, 5716-23 (1985)). In this case, the unknown DNA sequence fragments are inserted downstream from such promoters. Transcription can also be initiated by a nucleic acid primer (Pitulle et al., "Initiator Oligonucleotides for the Combination of Chemical and Enzymatic RNA Synthesis, " Gene 112, 101- 105 (1992)) which carries, as one embodiment of this invention, appropriate linking functionalities, L, which allow the immobilization of the nested RNA fragments, as outlined above, prior to mass spectrometric analysis for purification and/or appropriate modification and/or conditioning.
1.4.1.3.3 Immobilization Process For this immobilization process of the DNA/RNA sequencing products for mass spectrometric analysis, various solid supports can be used, e.g., beads (silica gel, controlled pore glass, magnetic beads, SephadexlSepharose beads, cellulose beads, etc.), capillaries, glass fiber filters, glass surfaces, metal surfaces or plastic material.
Examples of useful plastic materials include membranes in Blter or microtiter plate formats, the latter allowing the automation of the purification process by employing microtiter plates which, as one embodiment of the invention, carry a permeable membrane in the bottom of the well functionalized with L'. Membranes can be based on polyethylene, polypropylene, polyamide, polyvinylidenedifluoride and the like.
Examples of suitable metal surfaces include steel, gold, silver, aluminum, and copper.
After purification, cation exchange, and/or modification of the phosphodiester backbone of the L-L' bound nested Singer fragments, they can be cleaved ofFthe solid support chemically, enzymatically or physically. Also, the L-L'bound fragments can be cleaved from the support when they are subjected to mass spectrometric analysis by using appropriately chosen L-L linkages and corresponding laser energies/intensities as described above and herein.

1.4.1.4 Data Analysis (ES, MALDI) The highly purified, four base-specifically terminated DNA or RNA fragment families are then analyzed with regard to their fragment lengths via determination of their respective molecular weights by MALDI or ES mass spectrometry.
For ES, the samples, dissolved in water or in a volatile buffer, are injected either continuously or discontinuously into an atmospheric pressure ionization interface (API) and then mass analyzed by a quadrupole. With the aid of a computer program, the molecular weight peaks are searched for the known molecular weight of the nucleic acid primer (UP) and determined which of the four chain terminating nucleotides has been added to the UP. This represents the first nucleotide of the unknown sequence. Then, the second, the third, the n 'h extension product can be identified in a similar manner and, by this, the nucleotide sequence is assigned. The generation of multiple ion peaks which can be obtained using ES mass spectrometry can increase the accuracy of the mass determination.
1.4.1.5 Process for Multiplex Mass Spectrometric DNA Sequencing Employing Mass Modiefied Reagents As illustrative embodiments of this invention, three different basic processes for multiplex mass spectrometric DNA sequencing employing the described mass-modified reagents are described below:
A) Multiplexing by the use of mass-modified nucleic acid primers (LJP) for Sanger DNA or RNA sequencing, B) Multiplexing by the use of mass-modified nucleoside triphosphates as chain elongators and/or chain terminators for Sanger DNA or RNA sequencing, and C) Multiplexing by the use of tag probes which specifically hybridize to tag sequences which are integrated into part of the four Sanger DNA/RNA base-specifically terminated fragment families. Mass modification here can be achieved as described hereing, or alternately, by designing different oligonucleotide sequences having the same or different length with unmodified nucleotides which, in a predetermined way, generate appropriately differentiated molecular weights.
The process of multiplexing by mass-modified nucleic acid primers (UP) is illustrated by way of example herein for mass analyzing four different DNA
clones simultaneously. The first reaction mixture is obtained by standard Sanger DNA

sequencing having unknown DNA fragment 1 (clone 1 ) integrated in an appropriate vector (e.g., M13mp18), employing an unmodified nucleic acid primer UP
°, and a standard mixture of the four unmodified deoxynucleoside triphosphates, dNTP
° and with 1110th of one of the four dideoxynucleoside triphosphates, ddNTP . A
second reaction mixture for DNA fragment 2 (clone 2) is obtained by employing a mass-modified nucleic acid primer UP ' and, as before, the four unmodified nucleoside triphosphates, 0 dNTP , containing in each separate Sanger reaction I/10°' of the chain- terminating unmodified dideoxynucleoside triphosphates ddNTP . In the other two experiments, the four Sanger reactions have the following compositions:
DNA
fragment 3 (clone 3 ), UPZ, dNTP° , ddNTP° and DNA fragment 4 (clone 4), UP3 , dNTP° , ddNTP° . For mass spectrometric DNA sequencing, all base-specifically terminated reactions of the four clones are pooled and mass analyzed. The various mass peaks belonging to the four dideoxy-terminated (e.g., ddT-terminated) fragment families are assigned to specifically elongated and ddT-terminated fragments by searching (such as by a computer program) for the known molecular ion peaks of UP°, UP' , UP2 and UP3 extended by either one of the four dideoxynucleoside triphosphates, UP° ddN° , UP' ddN° , UPa ddN° and UP3 - ddN °. In this way, the first nucleotides of the four unknown DNA sequences of clone 1 to 4 are determined.
The process is repeated, having memorized the molecular masses of the four specific first extension products, until the four sequences are assigned. Unambiguous mass/sequence assignments are possible even in the worst case scenario in which the four mass-modified nucleic acid primers are extended by the same dideoxynucleo side triphosphate, the extension products then being, for example, UP° ddT, UP' -ddT, UP
2 -ddT and UP 3 -ddT, which differ by the known mass increment differentiating the four nucleic acid primers. In another embodiment of this invention, an analogous technique is employed using different vectors containing, for example, the SP6 and/or T7 promoter sequences, and performing transcription with the nucleic acid primers UP o, UP', UP 2 and UP 3 and either an RNA polymerase (e.g., SP6 or T7 RNA
polymerase) with chain-elongating and terminating unmodified nucleoside triphosphates NTP ° and 3'-dNTP °. Here, the DNA sequence is being determined by Sanger RNA sequencing.
Illustrated herein is the process of multiplexing by mass-modified chain-elongating or/and terminating nucleoside triphosphates in which three different DNA

fragments (3 clones) are mass analyzed simultaneously. The first DNA Sanger sequencing reaction (DNA fragment l, clone 1) is the standard mixture employing unmodified nucleic acid primer UP° , dNTP° and in each of the four reactions one of the four ddNTP° . The second (DNA fragment 2, clone 2) and the third (DNA
fragment 3, clone 3) have the following contents: UP° , dNTP° , ddNTPI and UP° , dNTP° , ddNTP2 , respectively. In a variation of this process, an amplification of the mass increment in mass-modifying the extended DNA fragments can be achieved by either using an equally mass-modified deoxynucleoside triphosphate (i.e., dNTP1 , dNTP2 ) for chain elongation alone or in conjunction with the homologous equally mass-modified dideoxynucleoside triphosphate. For the three clones depicted above, the contents of the reaction mixtures can be as follows: either UP °
/dNTP ° /ddNTP °
UP ° /dNTP 1 lddNTP ° and UP ° /dNTP 2 /ddNTP ° or UP ° /dNTP ° lddNTP° , UP °
/dNTP I /ddNTP 1 and UP ° /dNTP 2 /ddNTP 2 . As described above, DNA
sequencing can be performed by Sanger RNA sequencing employing unmodified nucleic acid primers, UP , and an appropriate mixture of chain-elongating and terminating nucleoside triphosphates. The mass-modification can be again either in the chain-terminating nucleoside triphosphate alone or in conjunction with mass-modified chain-elongating nucleoside triphosphates. Multiplexing is achieved by pooling the three base-specifically terminated sequencing reactions (e.g., the ddTTP
terminated products) and simultaneously analyzing the pooled products by mass spectrometry.
Again, the first extension products of the known nucleic acid primer sequence are assigned, e.g., via a computer program. Mass/sequence assignments are possible even in the worst case in which the nucleic acid primer is extended/terminated by the same nucleotide, e.g., ddT, in all three clones. The following configurations thus obtained can be well differentiated by their different mass modifications: UP°
ddT°, UP° ddTl, UP ° ddTa.
In yet another embodiment of this invention, DNA sequencing by multiplex mass spectrometry can be achieved by cloning the DNA fragments to be sequenced in "plex-vectors" containing vector specific "tag sequences" as described (Koster et al., "Oligonucleotide Synthesis and Multiplex DNA Sequencing Using Chemiluminescent Detection," Nucleic Acids Re. Symposium Ser. No. 24, 318-321 (1991)); then pooling clones from different plex-vectors for DNA preparation and the four separate Sanger sequencing reactions using standard dNTP° /ddNTP° and nucleic acid primer UP°

purifying the four multiplex fragment families via linking to a solid support through the linking group, L, at the 5'-end of UP°; washing out all by-products, and cleaving the purified multiplex DNA fragments off the support or using the L-L' bound nested Sanger fragments as such for mass spectrometric analysis as described above;
performing de- multiplexing by one-by-one hybridization of specific "tag probes";
and subsequently analyzing by mass spectrometry. As a reference point, the four base-specifically terminated multiplex DNA fragment families are run by the mass spectrometer and all ddT° , ddA ddC and ddG° terminated molecular ion peaks are respectively detected and memorized. Assignment of, for example, ddT °
terminated DNA fragments to a specific fragment family is accomplished by another mass spectrometric analysis after hybridization of the specific tag probe (TP) to the corresponding tag sequence contained in the sequence of this specific fragment family.
Only those molecular ion peaks which are capable of hybridizing to the specific tag probe are shifted to a higher molecular mass by the same known mass increment (e.g. of the tag probe). These shifted ion peaks, by virtue of all hybridizing to a specific tag probe, belong to the same fragment family. For a given fragment family, this is repeated for the remaining chain terminated fragment families with the same tag probe to assign the complete DNA sequence. This process is repeated i-I
times corresponding to i clones multiplexed (the i-th clone is identified by default).
The differentiation of the tag probes for the different multiplexed clones can be obtained just by the DNA sequence and its ability to Watson-Crick base pair to the tag sequence. It is well known in the art how to calculate stringency conditions to provide for specific hybridization of a given tag probe with a given tag sequence (see, for example, Molecular Cloning: A laboratory manual Zed, ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: NY, 1989, Chapter 11 ).
Furthermore, differentiation can be obtained by designing the tag sequence for each plea-vector to have a sufficient mass difference so as to be unique just by changing the length or base composition or by mass-modifications. In order to keep the duplex between the tag sequence and the tag probe intact during mass spectrometric analysis, it is another embodiment of the invention to provide for a covalent attachment mediated by, for example, photoreactive groups such as psoralen and ellipticine and by other methods known to those skilled in the art (see, for example, Helene et al., Nature 344, 358 (1990) and Thuong et at. "Oligonucleotides Attached to Intercalators, Photoreactive and Cleavage Agents" in F. Eckstein, Oligonucleotides and Analogues A Practical Approach, IRL Press, Oxford 1991, 283-306).
The DNA sequence is unraveled again by searching for the lowest molecular weight molecular ion peak corresponding to the known UP ° -tag sequence/tag probe molecular weight plus the first extension product, e.g., ddT ° , then the second, the third, etc.
In a combination of the latter approach with the previously described multiplexing processes, a fiu-ther increase in multiplexing can be achieved by using, in addition to the tag probe/tag sequence interaction, mass-modified nucleic acid primers andlor mass-modified deoxynucleoside, dNTP °-', andlor dideoxynucleoside triphosphates, ddNTP °-'. Those skilled in the art will realize that the tag sequence/tag probe multiplexing approach is not limited to Sanger DNA sequencing generating nested DNA fragments with DNA polymerases. The DNA sequence can also be determined by transcribing the unknown DNA sequence from appropriate promoter-containing vectors (see above) with various RNA polymerases and mixtures of NTP
o-r 3~ dNTP °-I , thus generating nested RNA fragments.
In yet another embodiment of this invention, the mass-modifying functionality can be introduced by a two or multiple step process. In this case, the nucleic acid primer, the chain-elongating or terminating nucleoside triphosphates and/or the tag probes are, in a first step, modified by a precursor functionality such as azido, - N3, or modified with a functional group in which the R in XR is H thus providing temporary functions, e.g., but not limited to -OH, NHa, -NHR, -SH, -NCS, -OCO(CH2)rCOOH
(r =1-20), -NHCO(CH2)rCOOH (r =1-20), -OSOZOH, -OCO(CH2)r' (r =1-20), -OP(O-Alkyl)N(Alkyl)2. These less bulky functionalities result in better substrate properties for the enzymatic DNA or RNA synthesis reactions of the DNA sequencing process.
The appropriate mass-modifying functionality is then introduced after the generation of the nested base-specifically terminated DNA or RNA fragments prior to mass spectrometry. Several examples of compounds which can serve as mass-modifying functionalities are depicted herein without limiting the scope of this invention.
1.4.1.6 Kits for Sequencing Nucleic Acid by Mass Spectrometry Another aspect of this invention concerns kits for sequencing nucleic acids by mass spectrometry which include combinations of the above-described sequencing reactants. For instance, in one embodiment, the kit comprises reactants for multiplex mass spectrometric sequencing of several different species of nucleic acid.
The kit can include a solid support having a linking functionality (L 1 ) for immobilization of the base- specifically terminated products; at least one nucleic acid primer having a linking group (L) for reversibly and temporarily linking the primer and solid support through, for example, a photocleavable bond; a set of chain-elongating nucleotides (e.
g., dATP, dCTP, dGTP and dTTP, or ATP, CTP, GTP and UTP); a set of chain-terminating nucleotides (such as 2',3'-dideoxynucleotides for DNA synthesis or 3' deoxynucleotides for RNA synthesis); and an appropriate polymerase for synthesizing complementary nucleotides. Primers and/or terminating nucleotides can be mass-modified so that the base-specifically terminated fragments generated from one of the species of nucleic acids to be sequenced can be distinguished by mass spectrometry from all of the others. Alternative to the use of mass-modified synthesis reactants, a set of tag probes (as described above) can be included in the kit. The kit can also include appropriate buffers as well as instructions for performing multiplex mass spectrometry to concurrently sequence multiple species of nucleic acids.
In another embodiment, a nucleic acid sequencing kit can comprise a solid support as described above, a primer for initiating synthesis of complementary nucleic acid fragments, a set of chain-elongating nucleotides and an appropriate polymerase.
The mass-modified chain-terminating nucleotides are selected so that the addition of one of the chain terminators to a growing complementary nucleic acid can be distinguished by mass spectrometry.

1.4.2 A Method And System For Determining The Sequence Of Genomes 1.4.2.1 A Process For Directly Amplifying And Base Specifically Terminating A
Nucleic Acid Molecule For Sequencing In general., the invention features a process for directly amplifying and base specifically terminating a nucleic acid molecule. According to the process of the invention, a combined amplification and termination reaction is performed on a nucleic acid template using: i) a complete set of chain-elongating nucleotides; ii) at least one chain-terminating nucleotide; and (iii) a first DNA polymerase, which has a relatively low affinity towards the chain terminating nucleotide; and (iv) a second DNA polymerase, which has a relatively high affinity towards the chain terminating nucleotide, so that polymerization by the enzyme with relatively low affinity for the chain terminating nucleotide leads to amplification of the template, whereas the enzyme with relatively high affinity for the chain terminating nucleotide terminates the polymerization and yields sequencing products.
The combined amplification and sequencing can be based on any amplification procedure that employs an enzyme with polynucleotide synthetic ability (e.g. polymerase). One preferred process, based on the polymerase chain reaction (PCR), is comprised of the following three thermal steps: 1) denaturing a double stranded (ds) DNA molecule at an appropriate temperature and for an appropriate period of time to obtain the two single stranded (ss) DNA molecules (the template:
sense and antisense strand); 2) contacting the template with at least one primer that hybridizes to at least one ss DNA template at an appropriate temperature and for an appropriate period of time to obtain a primer containing ss DNA template; 3) contacting the primer containing template at an appropriate temperature and for an appropriate period of time with: (i) a complete set of chain elongating nucleotides, (ii) at least one chain terminating nucleotide, (iii) a first DNA polyrnerase, which has a relatively low affinity towards the chain terminating nucleotide; and (iv) a second DNA polyrnerase, which has a relatively high affinity towards the chain terminating nucleotide.
Steps 1)- 3) can be sequentially performed for an appropriate number of times (cycles) to obtain the desired amount of amplified sequencing ladders. The quantity of the base specifically terminated fragment desired dictates how many cycles are performed. Although an increased number of cycles results in an increased level of amplification, it may also detract from the sensitivity of a subsequent detection. It is therefore generally undesirable to perform more than about 50 cycles, and is more preferable to perform less than about 40 cycles (e.g. about 20-30 cycles). In a preferred embodiment, the first denaturation step is performed at a temperature in the range of about 85°C to about 100°C (most preferably about 92°C to about 96°C) far about 20 seconds (s) to about 2 minutes (most preferably about 30s- 1 minute).
The second hybridization step is preferably performed at a temperature, which is in the range of about 40°C to about 80°C (most preferably about 45°C to about 72°C) for about 20s to about 2 minutes (most preferably about 30s-1 minute). The third, primer extension step is preferably performed at about 65°C to about 80°C (most preferably about 70°C to about 74°C) for about 30 s to about 3 minutes (most preferably about 1 to about 2 minutes).
In order to obtain sequence information on both the sense and antisense strands of a DNA molecule simultaneously, each of the single stranded sense and antisense templates generated from the denaturing step can be contacted with appropriate primers in step 2), so that amplified and chain terminated nucleic acid molecules generated in step 3), are complementary to both strands.
Another preferred process for simulataneously amplifying and chain terminating a nucleic acid sequence is based on strand displacement amplification (SDA) (G. Terrance Walker et al., Nucleic Acids Res. 22, 2670-77 (1994);
European Patent Publication Number 0 684 315 entitled Strand Displacement Amplification Using Thermophilic Enzymes). In essence, this process involves the following three steps, which altogether comprise a cycle: 1) denaturing a double stranded (ds) DNA
molecule containing the sequence to be amplified at an appropriate temperature and for an appropriate period of time to obtain the two single stranded (ss) DNA
molecules (the template: sense and antisense strand); 2) contacting the template with at least one primer (P), that contains a recognition/cleavage site for a restriction endonuclease (RE) and that hybridizes to at least one ss DNA template at an appropriate temperature and for an appropriate period of time to obtain a primer containing ss DNA template; 3) contacting the primer containing template at an appropriate temperature and for an appropriate period of time with: (i) a complete set of chain elongating nucleotides; (ii) at least one chain terminating nucleotide, (iii) a first DNA polymerase, which has a relatively low affinity towards the chain terminating nucleotide; (iv) a second DNA polymerise, which has a relatively high affinity towards the chain terminating nucleotide; and (v) an RE that nicks the primer recognition/cleavage site.
Steps 1 ) - 3) can be sequentially performed for an appropriate number of times (cycles) to obtain the desired amount of amplified sequencing ladders. As with the PCR based process, the quantity of the base specifically terminated fragment desired dictates how many cycles are performed. Preferably, less than 50 cycles, more preferably less than about 40 cycles and most preferably about 20 to 30 cycles are performed.
The amplified sequencing ladders obtained as described above, can be separated and detected and/or quantitated using well established methods, such as polyacrylamide gel electrophoresis (PAGE), or capillary zone electrophoresis (CZE) (Jorgenson et al., J. Chromatography 352, 337 (1986); Gesteland et al., Nucleic Acids Res. L8, 1415-1419 (1990)); or direct blotting electrophoresis (DBE) (Beck and Pohl, EMBO J, vol. 3: Pp. 2905-2909 (1984)) in conjunction with, for example, colorimetry, fluorimetry, chemiluminescence and radioactivity.
Dye-terminator chemistry can be employed in the combined amplification and sequencing reaction to enable the simultaneous generation of forward and reverse sequence ladders, which can be separated based on the streptavidin-biotin system when one biotinylated primer is provided.
Depicted herein is a scheme for the combined amplification and sequencing using two polymerises and dye-labeled chain terminating nucleotide (ddNTP) for detection and two reverse oriented primers. A means of separation for the simultaneously generated forward and reverse sequence ladders is shown. Step A
represents the exponential amplification of a target sequence by the polymerise with a low affinity for ddNTPs. One of the sequence specific oligonucleotide primers is biotinylated. Step B represents the generation of a sequence ladder either from the original template or the simultaneously generated amplification product carried out by the polymerise with a high affinity for ddNTPs. After completion of the reaction, the products are incubated with a streptavidin coated solid support (Step C).
Biotinylated forward sequencing products and reverse products hybridized to the forward template are immobilized. In order to obtain readable sequence information, the forward and reverse sequence ladders are separated in Step D. The immobilized strands are washed and separated by denaturation with ammonium hydroxide at room temperature. The non-biotinylated reverse sequencing products are removed from the beads with ammonium hydroxide supernatant during this procedure. The biotinylated forward sequencing products remain immobilized to the beads and are re-solubilized with ammonium hydroxide at 60°C. After ethanol precipitation, both sequencing species can be resuspended in loading dye and run on an automated sequencer, for example.
When mass spectrometry is used in conjunction with the direct amplification and chain termination processes, the sequencing ladders can be directly detected without first being separated using several mass spectrometer formats.
Amenable formats for use in the invention include ionization techniques such as matrix-assisted laser desorption (MALDI), continuous or pulsed electrospray (ESI) and related methods (e.g. Ionspray or Thermospray), and massive cluster impact (MSI); these ion sources can be matched with a detection format, such as linear or reflectron time-of flight (TOF), single or multiple quadrupole, single or multiple magnetic sector, Fourier Transform ion cyclotron resonance (FTICR), ion trap, or combinations of these to give a hybrid detector (e.g. ion trap-TOF). For ionization, numerous matrix/wavelength combinations (MALDI) or solvent combinations (ESI) can be employed.
The above-described process can be performed using virtually any nucleic acid molecule as the source of the DNA template. For example, the nucleic acid molecule can be: a) single stranded or double stranded; b) linear or covalently closed circular in supercoiled or relaxed form; or c) RNA if combined with ieverse transcription to generate a cDNA. For example, reverse transcription can be performed using a suitable reverse transcriptase (e.g. Moloney marine leukemia virus reverse transcriptase) using standard techniques (e.g. Kawasaki (1990) in PCR
Protocols: A Guide to Methods and Applications, Innis et al., eds., Academic Press, Berkeley, CA pp21- 27).
Sources of nucleic acid templates can include: a) plasmids (naturally occurring or recombinant); b) RNA- or DNA- viruses and bacteriophages (naturally occurring or recombinant); c) chromosomal or episomal replicating DNA (e. g. from tissue, a blood sample, or a biopsy); d) a nucleic acid fragment (e.g. derived by exonuclease, unspecific endonuclease or restriction endonuclease digestion or by physical disruption (e.g. sonication or nebulization)); and e) RNA or RNA transcripts like mRNAs.
The nucleic acid to be amplified and sequenced can be obtained from virtually any biological sample. As used herein, the term "biological sample" refers to any material obtained from any living source (e.g. human, animal., plant, bacteria, fungi, protist, virus). Examples of appropriate biological samples for use in the instant invention include: solid materials (e.g tissue, cell pellets, biopsies) and biological fluids (e.g. urine, blood, saliva, amniotic fluid, mouth wash, spinal fluid).
The nucleic acid to be amplified and sequenced can be provided by unpuri~ed whole cells, bacteria or virus.
Alternatively, the nucleic acid can first be purified from a sample using standard techniques, such as: a) cesium chloride gradient centrifugation; b) alkaline lysis with or without RNAse treatment; c) ion exchange chromatography; d) phenol/chloroform extraction; e) isolation by hybridization to bound oligonucleotides;
f) gel electrophoresis and elution; alcohol precipitation and h) combinations of the above.
As used herein, the phrases "chain-elongating nucleotides" and "chain-terminating nucleotides" are used in accordance with their art recognized meaning.
For example, for DNA, chain-elongating nucleotides include 2'-deoxyribonucleotides (e.g. dATP, dCTP, dGTP and dTTP) and chain-terminating nucleotides include 2', 3'-dideoxyribonucleotides, (e.g. ddATP, ddCTP, ddGTP, ddTTP). For RNA, chain-elongating nucleotides include ribonucleotides (e.g., ATP, CTP, GTP and UTP) and chain-terminating nucleotides include 3'-deoxyribonucleotides (e.g. 3'dA, 3'dC, 3'dG
and 3'dU). A complete set of chain elongating nuclectides refers to dATP, dCTP, dGTP and dTTP. The term "nucleotide" is also well known in the art. For the purposes of this invention, nucleotides include nucleoside mono-, di-, and triphosphates. Nucleotides also include modified nucleotides, such as phosphorothioate nucleotides and deazapurine nucleotides. A complete set of chain-elongating nucleotides refers to four different nucleotides that can hybridize to each of the four different bases comprising the DNA template.
If the amplified sequencing ladders are to be detected by mass spectrometric analysis, it may be useful to "condition" nucleic acid molecules, for example to decrease the laser energy required for volatization and/or to minimize fragmentation.

Conditioning is preferably performed while the sequencing ladders are immobilized.
An example of conditioning is modification of the phosphodiester backbone of the nucleic acid molecule (e.g. cation "change), which can be useful for eliminating peals broadening due to a heterogeneity in the cations bound per nucleotide unit.
Contacting a nucleic acid molecule, which contains an -thio-nucleoside-triphosphate during polymerization with an alkylating agent such as akyliodide, iodoacetamide, - iodoethanol, or 2,3-epoxy-1-propanol, the monothio phosphodiester bonds of a nucleic acid molecule can be transformed into a phosphotriester bond.
Further conditioning involves incorporating nucleotides which reduce sensitivity for depurination (fragmentation during MS), e.g. a purine analog such as N7- or N9-deazapurine nucleotides, and partial RNA containing oligodeoxynucleotide to be able to remove the unmodified primer from the amplified and modified sequencing ladders by RNAse or alkaline treatment. In DNA sequencing using fluorescent detection and gel electrophoretic separation, the N7 deazapurine nucleotides reduce the formation of secondary structure resulting in band compression from which no sequencing information can be generated.
1.4.2.2 The Use of Two Polymerise Enzymes Each Having Different Affinities for the Chain Terminating Nucleotides Critical to the novel process of the invention is the use of appropriate amounts of two different polymerise enzymes, each having a different affinity for the particular chain terminating nucleotide, so that polymerization by the enzyme with relatively low affinity for the chain terminating nucleotide leads to amplification whereas the enzyme with relatively high affinity for the chain terminating nucleotide terminates the polymerization and yields sequencing products. Preferably about 0.5 to about 3 units of polymerise is used in the combined amplification and chain termination reaction. Most preferably about I to 2 units is used. Particularly preferred polymerises for use in conjunction with PCR or other thermal amplification process are thermostable polymerises, such as Taq DNA polymerise (Boehringer Mannheim), AmpliTiq FS DNA polymerise (Perkin-Elmer), Deep Vent (exo-), Vent, Vent (exo-) and Deep Vent DNA polymerises (New England Biolabs), Thermo Sequenase (Amersham) or exo(- ) Pseudococcusfuriosus (Pfu) DNA polymerise (Stratagene, Heidelberg Germany). AmpliTaq, Ultmin, 9 degree Nm, Tth, Hot Tub, and Pyrococcusfuriosus. In addition, preferably the polymerase does not have 5'-3' exonuclease activity.
The process of the invention can be carried out using AmpliTaq FS DNA
polymerase (Perkin-Elmer), which has a relatively high affinity and Taq DNA
polymerase, which has a relatively low affinity for chain terminating nucleotides.
Other appropriate polymerase pairs for use in the instant invention can be determined by one of skill in the art. (See e.g. S. Tabor and C.C. Richardson (1995) Proc. Nat.
Acad. Sci. (LJSA), vol. 92: Pp. 6339-6343.) in addition to polymerases, which have a relatively high and a relatively low affinity to the chain terminating nucleotide, a third polymerase, which has proofreading capacity (e.g. Pyrococcus woesei (Pwo)) DNA
polymerase may also be added to the amplification mixture to enhance the fidelity of amplification.
Oligonucleotide primers, for use in the invention, can be designed based on knowledge of the 5' and/or 3' regions of the nucleotide sequence to be amplified and sequenced,' e.g., insert flanking regions of cloning and sequencing vectors (such as M13, pLTC, phagemid, costaid). Optionally, at least one primer used in the chain extension and termination reaction can be linked to a solid support to facilitate purification of amplified product from primers and other reactants, thereby increasing yield or to separate the Sanger ladders from the sense and antisense template strand where simultaneous amplification-sequencing of both a sense and antisense strand of the template DNA has been performed.
Examples of appropriate solid supports include beads (silica gel, controlled pore glass, magnetic beads, Sephadex/Sepharose beads, cellulose beads, etc.), capillaries, flat supports such as glass fiber filters, glass surfaces, metal surfaces (steel, gold, silver, aluuiinum, and copper), plastic materials or membranes (polyethylene, polypropylene, polyamide, polyvinylidenedifluoride) or beads in pits of flat surfaces such as wafers (e.g. silicon wafers), with or without filter plates.
1.4.2.3 Immobilization Based on Hybridization Immobilization can be accomplished, for example, based on hybridization between a capture nucleic acid sequence, which has already been immobilized to the support and a complementary nucleic acid sequence, which is also contained within the nucleic acid molecule containing the nucleic acid sequence to be detected.
So that hybridization between the complementary nucleic acid molecules is not hindered by the support, the capture nucleic acid can include a spacer region of at least about five nucleotides in length between the solid support and the capture nucleic acid sequence.
The duplex formed will be cleaved under the influence of the laser pulse and desorption can be initiated. The solid support-bound base sequence can be presented through natural oligoribo- or oligodeoxyribo- nucleotide as well as analogs (e.g. thio-modified phosphodiester or phosphotriester backbone) or employing oligonucleotide mimetics such as PNA analogs (see e.g. Nielsen et al., Science, 254, 1497 (1991)) which render the base sequence less susceptible to enzymatic degradation and hence increases overall stability of the solid support-bound capture base sequence.
1.4.2.4 Linkage Alternatively, a target detection site can be directly linked to a solid support via a reversible or irreversible bond between an appropriate functionality (L') on the target nucleic acid molecule and an appropriate functionality (L) on the capture molecule. A reversible linkage can be such that it is cleaved under the conditions of mass spectrometry (i.e., a photocleavable bond such as a trityl ether bond or a charge transfer complex or a labile bond being formed between relatively stable organic radicals). Furthermore, the linkage can be formed with L' being a quaternary ammonium group, in which case, preferably, the surface of the solid support carries negative charges which repel the negatively charged nucleic acid backbone and thus facilitate the desorption required for analysis by a mass spectrometer.
Desorption can occur either by the heat created by the laser pulse and/or, depending on L,' by specific absorption of laser energy which is in resonance with the L' chromophore.
By way of example, the L-L' chemistry can be of a Type of disulfide bond (chemically cleavable, for example, by mercaptoethanol or dithioerythrol), a biotin/streptavidin system, a heterobifunctional derivative of a trityl ether group (Koster et al., "A Versatile Acid-Labile Linker for Modification of Synthetic Biomolecules," Tetrahedron Letters 31, 7095 (1990)) which can be cleaved under mildly acidic conditions as well as under conditions of mass spectromehy, a levulinyl group cleavable under almost neutral conditions with a hydrazinium/acetate buffer, an arginine-arginine or lysine-lysine bond cleavable by an endopeptidase enzyme like trypsin or a pyrophosphate bond cleavable by a pyrophosphatase or a ribonucleotide in between a deoxynucleotide sequence cleavable by an RNAse or alkali.

The functionalities, L and L,' can also form a charge transfer complex and thereby form the temporary L-L' linkage. Since in many cases the "charge-transfer band" can be determined by UV/vis spectrometry (see e.g. Organic Charge Transfer Complexes by R. Foster, Academic Press, 1969), the laser energy can be tuned to the corresponding energy of the charge-transfer wavelength and, thus, a specific desorption off the solid support can be initiated. Those skilled in the art will recognize that several combinations can serve this purpose and that the donor functionality can be either on the solid support or coupled to the nucleic acid molecule to be detected or vice versa.
In yet another approach, a reversible L-L' linkage can be generated by homolytically forming relatively stable radicals. Under the influence of the laser pulse, desorption (as discussed above) as well as ionization will take place at the radical position. Those skilled in the art will recognize that other organic radicals can be selected and that, in relation to the dissociation energies needed to homolytically cleave the bond between them, a corresponding laser wavelength can be selected (see e.g. Reactive Molecules by C. Wentrup, John Wiley & Sons, 194). An anchoring function L' can also be incorporated into a target capturing sequence by using appropriate primers during an amplification procedure, such as PCR, LCR or transcription amplification.
For certain applications, it may be useful to simultaneously amplify and chain terminate more than one (mutated) Ioci on a particular captured nucleic acid fragment (on one spot of an array) or it may be useful to perform parallel processing by using oligonucleotide or oligonucleotide mimetic arrays on various solid supports.
"Multiplexing" can be achieved either by the sequence itself (composition or length) or by the introduction of mass-modifying functionalities into the primer oligonucleotide. Such multiplexing is particularly useful in conjunction with mass spectrometric DNA sequencing or mobility modified gel based fluorescence sequencing.
1.4.2.5 Mass or Mobility Modification Without limiting the scope of the invention, the mass or mobility modification can be introduced by using oligo/polyethylene glycol derivatives. The .
oligo/polyethylene glycols can also be monoalkylated by a lower alkyl such as methyl, ethyl, propyl, isopropyl, t-butyl and the like. Other chemistries can be used in the mass-modified compounds, as for example, those described recently in Oligonucleotides and Analogues- A Practical Approach, F. Eckstein, editor IRL
Press, Oxford, 1991.
In yet another embodiment, various mass or mobility modifying functionalities, other than oligo/polyethylene glycols, can be selected and attached via appropriate linking chemistries. A simple modification can be achieved by using different alkyl, aryl or aralkyl moieties such as methyl, ethyl, propyl, isopropyl, t-butyl, hexyl, phenyl, substituted phenyl or benzyl. Yet another modification can be obtained by attaching homo- or heteropeptides to the nucleic acid molecule (e.g., primer) or nucleoside triphosphates. Simple oligoamides also can be used.
Numerous other possibilities, in addition to those mentioned above, can be performed by one skilled in the art.
Different mass or mobility modified primers allow for multiplex sequencing via simultaneous detection of primer-modified Sanger sequencing ladders.
Mass or mobility modifications can be incorporated during the amplification process through nucleoside triphosphates or modified primers.
1.4.2.6 Kits for Amplified Base Specifically Terminated Fragments Another aspect of this invention concerns kits for directly generating from a nucleic acid template, amplified base specifically terminated fragments. Such kits include combinations of the above-described reactants. For instance, in one embodiment, the kit can comprise: i) a set of chain-elongating nucleotides;
ii) a set of chain-terminating nucleotides; and (iii) a first DNA polymerase, which has a relatively low affinity towards the chain terminating nucleotide; and (iv) a second DNA polymerase, which has a relatively high affinity towards the chain terminating nucleotide. The kit can also include appropriate solid supports for capture/purification and buffers as well as instructions for use.
For use with certain detection means, such as polyacrylamide gel electrophoresis (PAGE), detectable labels must be used in either the primer (typically at the 5'-end) or in one of the chain extending nucleotides, or chain terminating nucleotides.
Using radioisotopes such as Sap, 33P~ or 31 S is still the most frequently used technique.

After PAGE, the gels are exposed to X-ray films and silver grain exposure is analyzed.

1.4.3 Hybridization Oligonucleotide arrays can be used in a wide variety of applications, including hybridization studies. In a hybridization study, the array can be exposed to a receptor (R) of interest. The receptor can be labelled with an appropriate label (*), such as fluorescein. The locations on the substrate where the receptor has bound are determined and, through knowledge of the sequence of the oligonucleotide probe at that location one can then determine, if the receptor is an oligonucleotide, the sequence of the receptor.
Sequencing by hybridization (SBH) is most efficiently practiced by attaching many probes to a surface to form an array in which the identity of the probe at each site is known. A labeled target DNA or RNA is then hybridized to the array, and the hybridization pattern is examined to determine the identity of all complementary probes in the array. Contrary to the teachings of the prior art, which teaches that mismatched probe/target complexes are not of interest, the present invention provides an analytical method in which the hybridization signal of mismatched probe/target complexes identifies or confirms the identity of the perfectly matched probe/target complexes on the array.
Arrays of oligonucleotides are efficiently generated for the hybridization studies using light-directed synthesis techniques.
1.4.3.1 Light Directed Synthesis As discussed below, an array of alI tetranucleotides was produced in sixteen cycles, which required only 4 hours to complete. Because combinatorial strategies are used, the number of different compounds on the array increases exponentially during synthesis, while the number of chemical coupling cycles increases only linearly. For example, expanding the synthesis to the complete set of 48 (65,536) octanucleotides adds only 4 hours (or less) to the synthesis due to the 16 additional cycles required.
Furthermore, combinatorial synthesis strategies can be implemented to generate arrays of any desired probe composition. For example, because the entire set of dodecamers (41a) can be produced in 48 photolysis and coupling cycles or less (b°
compounds requires no more than b x n cycles), any subset of the dodecamers (including any subset of shorter oligonucleotides) can be constructed in 48 or fewer chemical coupling steps. The number of compounds in an array is limited only by the density of synthesis sites and the overall array size. The present invention has been practiced with arrays with probes synthesized in square sites 25 microns on a side. At this resolution, the entire set of 65,536 octanucleotides can be placed in an array measuring only 0.64 cm2. The set of 1,048,576 dodecanucleotides requires only a 2.56 cm2 array at this individual probe site size.
The success of genome sequencing projects depends on efficient DNA
sequencing technologies. Current methods are highly reliant on complex procedures and require substantial manual effort. SBH offers the potential for automating many of the manual efforts in current practice. Light-directed sythesis offers an efficient means for large scale production of miniaturized arrays not only for SBH but for many other applications as well.
Although oligonucleotide arrays can be used for primary sequencing applications, many diagnostic methods involve the analysis of only a few nucleotide positions in a target nucleic acid sequence. Because single base changes cause multiple changes in the hybridization pattern of the target on a probe array, the oligonucleotide arrays and methods of the present invention enable one to check the accuracy of previously elucidated DNA sequences, or to scan for changes or mutations in certain specific sequences within a target nucleic acid. The latter as is important, for example, for genetic disease, quality control, and forensic analysis.
With an octanucleotide probe set, a single base change in a target nucleic acid can be detected by the loss of eight perfect hybrids, and the generation of eight new perfect hybrids. The single base change can also be detected through altered mismatch probe/target complex formation on the array. Perhaps even more surprisingly, such single base changes in a complex nucleic acid dramatically alter the overall hybridization pattern of the target to the array. According to the present invention such changes in the overall hybridization pattern are used to actually simplify the analysis.
The high information content of light-directed oligonucleotide arrays greatly benefits genetic diagnostic testing. Sequence comparisons of hundreds to thousands of different mutations can be assayed simultaneously instead of in a one-at-a-time format.
1.4.3.2 Arrays Constructed to Contain Genetic Markers Arrays can also be constructed to contain genetic markers for the rapid identification of a wide variety of pathogenic organisms, and to study the sequence specificity of RNA/RNA, RNA/DNA, protein/RNA or protein/DNA, interactions.
One can use non Watson- Crick oligonucleotides and novel synthetic nucleoside analogs for antisense, triple helix, or other applications. Suitably protected RNA
monomers can be employed for RNA synthesis, and a wide variety of synthetic and non-naturally occurring nucleic acid analogues can be used, depending upon the motivations of the practitioner. See, e.g., PCT patent Publication Nos.
91/19813, 92105285, and 92114843, incorporated herein by reference. In addition, the oligonucleotide arrays can be used to deduce thermodynamic and kinetic rules governing the formation and stability of oligonucleotide complexes.
1.4.3.2.1 Hybridization of Targets to Surface Oligonucleotides The support bound octanucleotide probes discussed above were hybridized to a target of 5'GCGTAGGC-fluorescein in the hybridization chamber by incubation for 15 minutes at 15°C.
The array surface was then interrogated with an epifluorescence microscope (488 nm argon ion excitation). The fluorescence intensity pattern matches the X 1280 pm stripe used to direct the synthesis of the probe. Furthermore, the signal intensities are high (four times over the background of the glass substrate), demonstrating specific binding of the target to the probe.
The behavior of the target-probe complex was investigated by increasing the temperature of the hybridization solution. After a minute equilibration at each temperature, the substrate was scanned for signal. The duplex melted in the temperature range expected for the sequence under study (Tm~28°C
obtained from the rule Tm [2°(A+T)+4°(G+C)]). The probes in the array were stable to temperature denaturation of the target-probe complex as demonstrated by rehybridization of target DNA.
1.4.3.2.2 Sequence Specificity of Target Hybridization To demonstrate the sequence specificity of target hybridization, two different probes were synthesized in 800 x 1280 ~m stripes. The probe S-3'-CGCATCCG
was synthesized in stripes l, 3 and S. The probe S-3'-CGCTTCCG was synthesized in stripes 2, 4 and 6. The results of hybridizing a 5'-GCGTAGGC-fluorescein target to the substrate at 15°C are depicted herein.
Although the probes differ by only one internal base, the target hybridizes specifically to its complementary sequence 0500 counts above background in stripes 1, 3 and 5) with little or no detectable signal in positions 2, 4 and 6 (~10 counts).
1.4.3.2.3 Combinatorial Synthesis of, and Hybridization of a Nucleic Acid Target to, a Probe Matrix In a light-directed synthesis, the location and composition of products depends on the pattern of illumination and the order of chemical coupling reagents (see Fodor et al., Science (1991) 251:767-773, for a complete description).
Consider the synthesis of 256 tetranucleotides. Mask 1 activates one fourth of the substrate surface for coupling with the first of four nucleosides in the first round of synthesis. In cycle 2, mask 2 activates a different quarter of the substrate for coupling with the second nucleoside. The process is continued to build four regions of mononucleotides. The masks of round 2 are perpendicular to those of round l, and each cycle of round 2 generates four new dinucleotides. The process continues through round 2 to form sixteen dinucleotides. The masks of round 3 further subdivide the synthesis regions so that each coupling cycle generates trimers. The subdivision of the substrate is continued through round 4 to form the tetranucleotides. The synthesis of this probe matrix can be compactly represented in polynomial notation as (A+C+G+T)4. Expansion of this polynomial yields the 256 tetranucleotides.
The application of an array of 256 probes synthesized by light-directed combinatorial synthesis to generate a probe matrix is illustrated herein. The polynomial for this synthesis is given by: 3'-CG(A+G+C+T)4CG. All possible tetranucleotides were synthesized flanked by CG at the 3'- and 5'-ends.
Hybridization of target 5'-GCGGCGGC-fluorescein to this array at 15°C
correctly yielded the S-3'-CGCCGCCG complementary probe as the most intense position (2,698 counts). Significant intensity was also observed for the following mismatches: S-3'-CGCAGCCG (554 counts), S-3'-CGCCGACG (317 counts), S-3'-CGCCGTCG (272 counts), S-3'-CGACGCCG (242 counts), S-3'-CGTCGCCG
(203 counts), S-3'-CGCCCCCG (180 counts), S-3'-CGCTGCCG (163 counts), S-3'-CGCCACCG (125 counts), and S-3'-CGCCTCCG (78 counts).
1.4.3.3 Mismatch Analysis 1.4.3.3.1 Arrays Used to Determine the Gene Sequence of Oligos of Length "n"
Using Array of Probes of Shorter Length "k"
The arrays discussed herein can be utilized in the present method to determine the nucleic acid sequence of an oligonucleotide of length n using an array of probes of shorter length k. In a simple example, the target has a sequence 5'-XXYXY-3', where X and Y are complementary nucleic acids such as A and T or C and G. For discussion purposes, the example is simplified by using only two bases and very short sequences, but the technique can easily be extended to larger nucleic acids with, for example, all 4 RNA or DNA bases.
The sequence of the target is, generally, not known ab initio. One can determine the sequence of the target using the present method with an array of shorter probes. In this example, an array of all possible X and Y 4-mers is synthesized and then used to determine the sequence of a 5-mer target.
Initially, a "core" probe is identified. The core probe is exactly complementary to a sequence in the target using the mismatch analysis method of the present invention. The core probe is identified using one or both of the following criteria:
1. The core probe exhibits stronger binding affinity to the target than other probes, typically the strongest binding affinity of any probe in the array (that has not been identified as a core probe in a previous cycle of analysis).
2. Probes that are mismatched with the target, as compared to the core probe sequence, exhibit a characteristic pattern, discussed in greater detail below, in which probes that mismatch at the 3'- and S'-end of the probe bind more strongly to the target than probes that mismatch at interior positions.
In this particular example, selection criteria #1 identifies a core 4-mer probe with the strongest binding affinity to the target that has the sequence 3'-YYXY. The probe 3'-YYXY (corresponding to the 5'-XXYX position of the target) is, therefore, chosen as the "core" probe.
Selection criteria #2 is utilized as a "check" to ensure the core probe is exactly complementary to the target nucleic acid.
The second selection criteria evaluates hybridization data (such as the fluorescence intensity of a labeled target hybridized to an array of probes on a substrate, although other techniques are well known to those of skill in the art) of probes that have single base mismatches as compared to the core probe. In this particular case, the core probe has been selected as S-3'-YYXY. The single base mismatched probes of this core probe are: S-3'-XYXY, S-3'-YXXY, S-3'-YYYY, and S-3'-YYXX. The binding affinity characteristics of these single base mismatches are utilized to ensure that a "correct" core has been selected, or to select the core probe from among a set of probes exhibiting similar binding affinities.
1.4.3.3.2 Binding Affinity vs. Mismatch Position An illustrative, hypothetical plot of expected binding affintity versus mismatch position is provided herein. The binding affinity values (typically fluorescence intensity of labeled target hybridized to probe, although many other factors relating to affinity may be utilized) are all normalized to the binding affinity of S-3'-YYXY to the target, which is plotted as a value of 1. Because only two nucleotides are involved in this example, the value plotted for a probe mismatched at position 1 (the nucleotide at the 3'-end of the probe) is the normalized binding affinity of S-3'-XYXY.
The value plotted for mismatch at position 2 is the normalized affinity of S-3'-YXXY.
The value plotted for mismatch at position 3 is the normalized affinity of S-3'-YYYY, and the value plotted for mismatch position 4 is the normalized affinity of S-3'-YYXX.
As noted above, "affinity" may be measured in a number of ways including, for example, the number of photon counts from fluorescence markers on the target.
The affinity of all three mismatches is lower than the core in this illustration.
Moreover, the affinity plot shows that a mismatch at the 3'-end of the probe has less impact than a mismatch at the 51-end of the probe in this particular case, although this may not always be the case. Further, mismatches at the end of the probe result in less disturbance than mismatches at the center of the probe. These features, which result in a "smile" shaped graph when plotted, will be found in most plots of single base mismatch after selection of a "correct" core probe, or after accounting for a mismatched probe that is a core probe with respect to another portion of the target sequence. This information will be utilized in either selecting the core probe initially or in checking to ensure that an exactly matched core probe has been selected.
Of course, in certain situations, as noted in in the section above, identification of a core is all that is required such as in, for example, forensic or genetic studies, and the like.

In sequencing studies, this process is then repeated for left and/or right extensions of the core probe. In one example, only right extensions of the core probe are possible. The possible 4-mer extension probes of the core probe are 3'-YXYY and 31-YXYX. Again, the same selection criteria are utilized. Between 31-YXYY and 3'-YXYX, it would normally be found that 31-YXYX would have the strongest binding affinity, and this probe is selected as the correct probe extension. This selection may be confirmed by again plotting the normalized binding affinity of probes with single base mismatches as compared to the core probe.
When a hypothetical plot is illustrated, again, the characteristic "smile"
pattern is observed, indicating that the "correct" extension has been selected, i.e., 3'-YXYX.
From this information, one would correctly conclude that the sequence of the target is 51-XXYXY.

1.4.4 A Method for Sequencing Genomes In one embodiment, a method is described for sequencing genomes that is comprised of the steps:
(1) Obtaining a clone library to be sequenced and mapped;
(2) Preparing DNA from individual clones in the clone library for comparison experiments;
(3) Obtaining a long-range probe library relative to the clone library;
(4) Preparing DNA from members of the long-range probe library for comparison experiments;
(5) Comparing DNA from the clone library with DNA from the long-range probe library;
(6) Producing a clone library characterized by long-range probes;
(7) Obtaining a bin probe library suitable for positioning the DNA sequences of long-range probes relative to the genome;
(8) Comparing DNA from the bin probe library with DNA from the long-range probe library;
(9) Producing a long-range probe library whose DNA sequences have been characterized by binning information relative to the genome;
(10) Combining the clone vs. long-range probe characterization from step 6, together with the long-range probe vs. genome binning characterization from step 9;
( 11 ) Producing a binning of the clone library;
(12) Obtaining a short-range probe library relative to the clone library;
(13) Comparing DNA from the clone library with DNA from the short-range probe library;
(14) Producing a clone library characterized by short-range probes;
(15) Combining the long-range binning of the clone library, together with the short-range probing of the clone library from;
(16) Producing a contig of the clone library which bins and orders clones relative to the genome;
(17) Forming a tiling path of clones that span genome regions;
(18) Determining the sequence of said clones, and of the entire genome.
1.4.4.1 Obtaining a clone library to be sequenced and mapped.

The clones may be comprised of large-sized clones that have genomic inserts greater than 250 kb (e.g., YACs), medium-sized clones that have genomic inserts greater than 50 kb, but less than 250 kb (e.g., PACs, BACs, Pls, or YACs), or small-sized clones that have genomic inserts less than SO kb (e.g., cosmids, plasmids, phage, phagemids, or cDNAs). In the preferred embodiment, the clone library has at least two-fold redundancy relative to the genome. The technology for constructing these clones is well described (F. M. Ausubel, R. Brent, R. E. Kingston, D. D.
Moore, J. G.
Seidman, J. A. Smith, and K. Struhl, ed., Current Protocols in Molecular Biology.
New York, N.Y.: John Wiley and Sons, 1995; N. J. Dracopoli, J. L. Haines, B.
R.
Korf, C. C. Morton, C. E. Seidman, J. G. Seidman, D. T. Moir, and D. Smith, ed., Current Protocols in Human Generics. New York: John Wiley and Sons, 1995; J.
Sambrook, E. F. Fritsch, and T. Maniatis, Molecular Cloning, Second Edition.
Plainview, N.Y.: Cold Spring Harbor Press, 1989), incorporated by reference.
Chromosome-specific cosmid clones are available from Los Alamos National Laboratories (Los Alamos, N.Mex.), genome-wide PAC clones from Pieter de Jong (Roswell Park, Buffalo, N.Y.), and the Genethon YAC libraries from the national genome center GESTECs, including the Whitehead Institute (Cambridge, Mass.).
Libraries are also provided by commercial vendors, including cDNA libraries (ATCC, Rockville, Md.), P 1 libraries (DuPont/Merck Pharmaceuticals, Glenolden, Pa.), BAC
libraries (Research Genetics, Huntsville, Ala.), and cDNAs and other genome-wide resources (BIOS Labs, New Haven, Conn.).
1.4.4.1.1 Preparing DNA from individual clones in the clone library for comparison experiments.
In the preferred embodiment, DNA from the clones is prepared for DNA
hybridization experiments. For DNA derived from bacterial clones (cosmids, PACs, etc.), two straightforward protocols are: (a) growing up colonies for each clone, and then lysing the bacterial cells to expose the cloned insert DNA, or (b) specifically extracting the DNA material from the clone using DNA prep such as an ion exchange column (Qiagen, Chatsworth, Calif.). When using vectors with more complex genomes (e.g., yeast cells), a species-specific DNA prep (e.g., Alu-PCR or IRE-bubble PCR) is preferred. This DNA from each clone is then gridded onto nylon membranes such as Hybond N+ (Amersham, Arlington Heights, Ill.) to prepare for subsequent DNA hybridization experiments (Hybond N+ product protocol, ver. 2), incorporated by reference.
1.4.4.1.2 Obtaining a long-range probe library relative to the clone library.
The preferred long-range multiplexed probe is the radiation hybrid (RH) (D.
R. Cox, M. Burmeister, E. R. Price, S. Kim, and R. M. Myers, "Radiation hybrid mapping: a somatic cell genetic method for constructing high-resolution maps of mammalian chromosomes," Science, vol. 250, pp. 245-250, 1990; S. J. Goss and H.
Harris, "New method for mapping genes in human chromosomes," Nature, vol. 255, pp. 680-684, 1975; S. J. Goss and H. Hams, "Gene transfer by means of cell fusion:
statistical mapping of the human X-chromosome by analysis of radiation-induced gene segregation," J. Cell. Sci., vol. 25, pp. 17-37, 1977), incorporated by reference.
Chromosome-specific RH libraries have been constructed for other human chromosomes (M. R. James, C. W. Richard III, J.-J. Schott, C. Yousry, K.
Clark, J.
Bell, J. Hazan, C. Dubay, A. Vignal., M. Agrapart, T. Imai, Y. Nakamura, M.
Polymeropoulos, J. Weissenbach, D. R. Cox, and G. M. Lathrop, "A radiation hybrid map of 506 STS markers spanning human chromosome 11," Nature Genetics, vol. 8, no. l, pp. 70-76, 1994; S. H. Shaw, J. E. W. Farr, B. A. Thief, T. C. Matise, J.
Weissenbach, A. Chakravarti, and C. W. Richard, "A radiation hybrid map of 95 STSs spanning human chromosome 13q," Genomics, vol. 27, no. 3, pp. 502-510, 1995; U. Francke, E. Chang, K. Comeau, E.-M. Geigl, J. Giacalone, X. Li, J.
Luna, A.
Moon, S. Welch, and P. wilgenbus, "A radiation hybrid map of human chromosome 18," Cytogenet. Cell Genet., vol. 66, pp. 196-213, 1994), incorporated by reference.
Whole-genome RHs (WG-RHs) for humans and other mammalian genomes have also been developed (M. A. Walter, D. J. Spillett, P. Thomas, J. Weissenbach, and P. N.
Goodfellow, "A method for constructing radiation hybrid maps of whole genomes,"
Nature Genet., vol. 7, no. 1, pp. 22-28, 1994), incorporated by reference, including the high-energy Stanford set (David Cox, Stanford, Calif.) and the low-energy Genethon set; the DNAs from both WG-RH sets are available (Research Genetics, Huntsville, Ala.).
There are alternative embodiments that can construct long-range multiplexed probes. One alternative embodiment is the use of rare cutter restriction enzymes (e.g., Notl partial digests) to develop large DNA sequences from genomes. These fragments can be purified using pulsed-field gel electrophoresis (D. C.
Schwartz and C. R. Cantor, "Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis," Cell, vol. 37, pp. 67-75, 1984), incorporated by reference, and then selectively pooled. A second alternative embodiment is the use of a second clone library that has a larger average insert size than the first clone library in step 1.
Subsets of these larger insert clones can be pooled together to form a long-range probe library (relative to the first clone library). A third alternative embodiment which is particularly useful in animal models is the use of genetically inbred strains. With an Fl backcross between strains A and B, the meiotic events produce an interleaving of large chromosomal fragments of strains A and B. A subtractive hybridization can selectively remove the DNA from strain B, leaving behind just the large chromosomal regions of strain A for each backcross individual. This procedure constructs a long-range probe library (relative to the strain A clone library). The subtractive hybridization can be performed by first digesting the backcross individual genome with restriction enzymes, and then using whole genome DNA from strain B bound to solid support to selectively remove the strain B DNA.
1.4.4.1.3 Preparing DNA from members of the long-range probe library for comparison experiments.
The long-range probe DNA often resides in a complex background genome. In the RH embodiment, the background is marine genome, while in the pooled YAC
embodiment, the background is the yeast genome. Therefore, the DNA
preparations for these long-range probe embodiments preferrably use a species-specific DNA
extraction and amplification. The particular assay often depends on the clone library used.
When the clonal inserts reside in a complex background genome, such as YACs, inter-Alu hybridization is the preferred approach in step 5. In this case, Alu-PCR preparation of the long-range probes (M. T. Ross and V. P. J. Stanton, "Screening large-insert libraries by hybridization," in Current Protocols in Human Genetics, vol. 1, N. J. Dracopoli, J. L. Haines, B. R. Korf, C. C. Morton, C.
E.
Seidman, J. G. Seidman, D. T. Moir, and D. Smith, ed. New York: John Wiley and Sons, 1995, pp. 5.6.1-5.6.34), incorporated by reference, is the preferred embodiment.
An alternative embodiment when background hybridization noise may be greater is IRE-bubble PCR (D. J. Munroe, M. Haas, E. Bric, T. Whirton, H. Aburatani, K.
Hunter, D. Ward, and D. E. Housman, "IRE-bubble PCR: a rapid method for efficient and representative amplification of human genomic DNA sequences from complex sources," Genomics, vol. 19, no. 3, pp. 506-14, 1994), incorporated by reference.
When the clonal inserts are sufficiently large to contain inter-Alu regions, and the vector genome is not complex (e.g., bacterial), then IRE-bubble PCR is the preferred embodiment. This situation applies to many clone libraries, including cosmids, PACs, BACs, and P 1 s.
When the clonal inserts are too small to contain inter-Alu subsequences detectable by hybridization (such as cDNAs), an assay that provides for more uniform DNA expression from the long-range probes may be needed. The most preferred embodiment is then to use a multiplicity of restriction enzyme digests, each followed by long PCR between Alu repeats, and to then pool the PCR products to construct a probe. A second approach is a variation on direct selection (M. Lovett, J.
Kere, and L.
M. Hinton, "Direct selection: a method for the isolation of cDNAs encoded by large genomic regions," Proc. Natl. Acad. Sci. U.S.A., vol. 88, pp. 9628-9632, 1991), incorporated by reference. In this approach, Lovett's cDNAs are replaced by a full restriction digest with a frequent-cutter of the long-range probe DNA, and Lovett's genomic contig is replaced with repetitive DNA (e.g., Alu or Cot-1) that selects for the same genome as the species-specific long-range probe. The result is a PCR
amplification (via the end priming sites) of the long-range probe that is species specific (via the Alu selection).
The species-specific DNA is then amplified and labeled for use as a hybridization probe. In the preferred embodiment, this amplification and labeling is performed using a labeled dNTP with the random primer method (A. P. Feinberg and B. Vogelstein, "A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity," Analyt. Biochem., vol. 132, pp. 6-13, 1983; N.J.
Dracopoli, J. L. Haines, B. R. Korf, C. C. Morton, C. E. Seidman, J. G.
Seidman, D.
T. Moir, and D. Smith, ed., Current Protocols in Human Genetics. New York:
John Wiley and Sons, 1995), incorporated by reference. In one embodiment, 3zP- dNTP
is incorporated into a random primer PCR amplification, possibly using a kit such as the DECprime II DNA labeling kit (Ambion, Austin, Tex.). Other isotopes such as 355 or 33P can be used. In alternative embodiments, nonisotopic labeling is performed (L. J.
Kricka, ed., Nonisotopic Probing, Blotting, and Sequencing, Second Edition.
San Diego, Calif.: Academic Press, 1995), incorporated by reference.

1.4.4.1.4 Comparing DNA from the clone library with DNA from the long-range probe library.
The labeled long-range probe DNA is hybridized against the gridded clone library (A. P. Monaco, V. M. S. Lam, G. Zehetner, G. G. Lennon, C. Douglas, D.
Nizetic, P. N. Goodfellow, and H. Lehrach, "Mapping irradiation hybrids to cosmid and yeast artificial chromosome libraries by direct hybridization of Alu-PCR
products," Nucleic Acids Res., vol. 19, no. 12, pp. 3315-3318, 1991 ), incorporated by reference. In an alterative embodiment, the roles of the long-range probe library and the clone library are reversed, with the long-range probe immobilized on the membrane and the label on the clone.
The hybridization comparison is done by preannealing the probe with 25 ng of Cot-1 DNA (Gibco-BRL, Grand Island, N.Y.) for 2 hours at 37°C. before adding to the prehybridization mix. The nylon filters containing the spotted clone DNA
is then prehybridized overnight per manufacturer's instructions (Amersham, Arlingon Heights, Ill.), except for the addition of sheared, denatured human placental DNA at a final concentration of 50 ng/ml. Filters are hybridized overnight at 68°C., washed three times with final wash of 0.1 SSPE/0.1% SDS at 72° C., before exposing to autoradiographic film for 1 to 8 days. The exposed film image is then electronically scanned into a computer with memory. A phosphorimager (Molecular Dynamics, Sunnyvale, Calif.) or other electronic device can be used for imaging without the use of film.
For every RH hybridization probing, each of the clone positions on the autoradiographs of the gridded filters are scored on a numerical scale, such as 1-5, with 1 negative, 2 equivocal., 3 weakly positive, 4 positive, and 5 strongly positive.
When duplicate typings are available, the maximum of the two scores is used, since there is a very high false-negative rate in the hybridization data. This data entry can be facilitated by use of an interactive computer program that presents the electronic image of the filter on a computer display, or by automated computer interpretation of the scanned image.
1.4.4.2 Producing a clone library characterized by long-range probes.
The hybridization experiments construct a table of scores that compare the DNA from clones against DNA from long-range probes for detectable sequence similarity, and thus presumed genomic colocalization. The scores are resealed so that the new scaling is approximately linear (C. C. Clogg and E. S. Shihadeh, Statistical Models for Ordinal Variables. Thousand Oaks, Calif.: Sage Press, 1994), incorporated by reference. That is, a unit increase in the scaling indicates a unit increase in the confidence one holds that the clone actually hybridized with the long-range probe. An equivocal event is scored as a 0, since it was equally likely to be negative or positive.
A negative event is scored as -l, since there is high confidence that no observable hybridization has occurred; both positive and strongly positive events are scored as l, since there is certainty that a hybridization event has occurred. A weakly positive event can be scored at 0.67 when a single typing is available, since there is considerably more confidence that it is positive than negative, and is considered equivocal when duplicate typings were available. For any scale used, the data is scored in a manner determined by the laboratory investigator and data analyst.
This resealed clone vs. probe comparison table A is stored in the memory of a computational device.
With perfectly clean comparison data (i.e., very low false negative and false positive rates), this table A might suffice for ordering the clones using conventional RH mapping methods. However, the high-throughput hybridization experiments incur a large noise cost. Therefore, some correction data is required to accurately map the clones. This correction stage is performed in the following steps.
1.4.4.2.1 Obtaining a bin probe library suitable for positioning the DNA
sequences of long-range probes relative to the genome.
In the preferred embodiment, the bin probe library is comprised of sequence-tagged sites (STSs). For positional cloning applications, many of the STSs are preferrably made polymozphic. The genetic or physical markers to be used for each STS are obtained as PCR primer sequences pairs and PCR reaction conditions from available Internet databases (Genbank, Bethseda, Md.; GDB, Baltimore, Md.;
EMBL, Cambridge, UK; Genethon, Ervy, France; Stanford Genome Center, Stanford, Calif.;
Whitehead Institute Genome Center, Cambridge, MA; G. Gyapay, J. Morissette, A.
Vignal., C. Dib, C. Fizames, P. Millasseau, S. Mare, G. Bernardi, M. Lathrop, and J.
Weissenbach, "'The 1993-94 Genethon Human Genetic Linkage Map," Nature Genetics, vol. 7, no. 2, pp. 246-339, 1994; Hilliard, Davison, Doolittle, and Roderick, Jackson laboratory mouse genome database, Bar Harbor, Me.; MapPairs, Research Genetics, Huntsville, Ala.), incorporated by reference. Alternatively, STSs can be constructed using existing techniques (Sambrook, J., Fritsch, E. F., and Manjarls, T.
1989. Molecular Cloning, second edition. Plainview, N.Y.: Cold Spring Harbor Press;
N. J. Dracopoli, J. L. Haines, B. R. Korf, C. C. Morton, C. E. Seidman, J. G.
Seidman, D. T. Moir, and D. Smith, ed., Current Protocols in Human Genetics. New York:
John Wiley and Sons, 1995), incorporated by reference.
In a first alternative embodiment, the locations of the long-range probe fragments are localized on the genome by fluorescence in situ hybridization (FISH) studies. In these FISH studies, the nuclear DNA of the genome serves as the bin probe. In a second alternative embodiment, the binning is effected by comparison with previously positioned DNA probes, including mapped clone libraries, ESTs, or PCR primers.
1.4.4.2.2 Comparing DNA from the bin probe library with DNA from the long-range probe library.
In the preferred embodiment, PCR amplifications are carried out between the STSs in the bin probe library and the RH (or other) DNAs in the long-range probe library. Subsequent detection for presence or absence of PCR products (+/-scores) is carried out either by gel electrophoresis or by internal oligonucleotide hybridizations.
The orders of the STSs relative to the genome are then determined using computational or statistical methods (M. Boehnke, "Radiation hybrid mapping by minimization of the number of obligate chromosome breaks," Genetic Analysis Workshop 7: Issues in Gene Mapping and the Detection of Major Genes. Cytogenet Cell Genet, vol. 59, pp. 96- 98, 1992; M. Boehnke, K. Large, and D. R. Cox, "Statistical methods for multipoint radiation hybrid mapping," Am. J. Hum.
Genet., .
vol. 49, pp. I 174-1188, 1991; A. Chakravarti and J. E. Reefer, "A theory for radiation hybrid (Goss-Harris) mapping: application to proximal 21 q markers," Generic Analysis Workshop 7: Issues in Gene Mapping and the Detection of Major Genes.
Cytogenet Cell Genet, vol. 59, pp. 99-101, 1992), incorporated by reference.
Physical distances are then computed using maximum likelihood estimation.
In the first alternative FISH embodiment of step 7, DNA from the long-range probes (e.g., specifies-specific PCR products) are fluorescently labeled, and then hybridized back onto the genome. The fragment positions on the genome of the probes are then visualized using fluorescent microscopic imaging. Linear fractional length measurements on the metaphase spreads of chromosomes are then performed to determine the bin positions of the fragments. In the second alternative embodiment of step 7, DNA from the previously positioned bin probes is hybridized to DNA
from the long-range probes.
Detailed protocols for these methods have been described (F. M. Ausubel, R.
Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, ed., Current Protocols in Molecular Biology. New York, N.Y.: John Wiley and Sons, 1995; N. J. Dracopoli, J. L. Haines, B. R. Korf, C. C. Morton, C. E. Seidman, J. G.
Seidman, D. T. Moir, and D. Smith, ed., Current Protocols in Human Genetics.
New York: John Wiley and Sons, 1995), incorporated by reference.
1.4.4.2.3. Producing a long-range probe library whose DNA sequences have been characterized by binning information relative to the genome.
The procedures produce a data table which compares the DNA content of the long-range probes to bins on the genome. In the preferred embodiment, this is a table B of long-range probes (the rows of B) vs. ordered STSs (the columns of B).
The pairwise distance information between the ordered STSs is also recorded. In alternative embodiments, the table can be arranged similarly.
Knowledge of the genomic positions of the RH fragments enables the desired correction of noisy RH hybridization data, as described next.
1.4.4.3 Producing a binning of the clone library.
The procedures of step 10 produce a table which bins each clone relative to the genome. In the preferred embodiment, this is a table C of clones (the rows of C) vs.
ordered bins (the columns of C). Each entry in the table describes the confidence that the clone is located in the bin.
Note that this result C is a binning of clones, not a contig. To form the desired set of mapped overlapping clones, a short-range probing is preferrably performed.
This probing and contig formation is performed in the following steps.
1.4.4.3.1 Obtaining a short-range probe library relative to the clone library.
Since current clone mapping technology is based on short-range probing, there is a large number of workable approaches. The preferred embodiment uses hybridization assays based on oligonucleotide probes. The design of such experiments has been described (A. J. Cuticchia, J. Arnold, and W. E. Timberlake, "PCAP:
probe choice and analysis package, a set of programs to aid in choosing synthetic oligomers for contig mapping," CABIOS, vol. 9, no. 2, pp. 201-203, 1992; Y.-X. Fu, E. W.
Timberlake, and J. Arnold, "On the design of genome mapping experiments using short synthetic oligonucletides," Biometrics, vol. 48, pp. 337-359, 1992; H.
Lehrach, A. Drmanac, J. Hoheisel, Z. Larin, G. Lennon, A. P. Monaco, D. Nizetic, G.
Zehetner, and A. Poustka, "Hybridization fingerprinting in genome mapping and sequencing,"
in Genetic and Physical Mapping I: Genome Analysis, K. E. Davies and S. M.
Tilghman, ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1990, pp.
39- 81; A. Poustka, T. Pohl, D. P. Barlow, G. Zehetner, A. Craig, F. Michiels, E.
Erlich, A.-M. Frischauf, and H. Lehrach, "Molecular approaches to mammalian genetics," in Cold Spring Harbor Symp. Quant. Biol., vol. 51. 1986, pp. 131-139), incorporated by reference.
An efficient design produces 25 to 200 small (preferrably 5 bp-15 bp) oligonucleotides which each hybridize, on average, to 5%-95% of the clones.
The oligonucleotide sequences are generally designed to preferentially detect sequences that are related to the genes in the genome, rather than to repetitive elements in the genome or to the cloning vector. This selective bias can be achieved either by experimental probings, or by examination of the sequences to be compared. Once designed, these oligonucleotides are preferrably ordered from a DNA synthesis service (Research Genetics, Huntsville, Ala.). Alternatively, they can be synthesized on a DNA synthesizer (Applied Biosystems, Foster City, Calif.).
Alternative hybridization embodiments include using clones (or their PCR
products) to probe clone libraries, using pools of clones as hybridization probes, and using Southern blotting of digested clones with repetitive element hybridization probes. Enzymatic methods include gel electrophoresis of restriction endonuclease digests of clones, PCR-based STS comparisons, and hybrid methods such as Alu fingerprinting. Other short-range probes can be formed by selective or random retention of fragments produced by genome cutting.
For experimental efficiency, many of these short-range probes work in a multiplexed way, and probe one or more genome regions simultaneously. These probes include oligonucleotides, pooled clones, and repetitive-element fingerprint probes.
L4.4.3.2 Comparing DNA from the clone library with DNA from the short-range probe library.

This is done by comparison experiments using standard protocols. In the preferred embodiment, DNA from the clones in the clone library is spotted onto nylon membranes. This DNA is comprised of lysed colonies, DNA preps, or species-specific PCR products. The membranes are then prepared for hybridization. Each oligonucleotide short-range probe is then labeled, preferrably with 32P using a kinase.
The labeled probe is then hybridized to the membranes, followed by rinsing, stringent washing, and autoradiography. The filters may be stripped for subsequent reuse. The autoradiograph spots are then scored on a binary or more continuous (e.g., 0-255) scale.
Specific oligonucleotide hybridization protocols for particular clone libraries and oligonucleotides have been described (A. G. Craig, D. Nizetic, J. D.
Hoheisel, G.
Zehetner, and H. Lehrach, "Ordering of cosmid clones covering the herpes simplex virus type I," Nucleic Acids Res., vol. 18, no. 9, 2653-60, 1990; R. Drmanac, Z.
Strezoska, I. Labat, S. Drmanac, and R. Crkvenjakov, "Reliable hybridization of oligonucleotides as short as six nucleotides," DNA Cell Biol., vol. 9, no. 7, pp. 527-534, 1990; J. D. Hoheisel, G. G. Lennon, G. Zehetner, and J. Lehrach, "Use of high coverage reference libraries of Drosophila melanogaster for relational analysis," J.
Mol. Biol., vol. 220, pp. 903- 914, 1991; F. Michiels, A. G. Craig, G.
Zehetner, G. P.
Smith, and H. Lehrach, "Molecular approaches to genome analysis: a strategy for the construction of ordered overlapping clone libraries," CABIOS, vol. 3, pp. 203-210, 1987; D. Nizetic, R. Drmanac, and J. Lehrach, "An improved bacterial colony lysis procedure enables direct DNA hybridization using short (10, 11 bases) oligonucleotides to cosmids," Nucleic Acids Res., vol. 19, pp. 182, 1991), incorporated by reference.
For alternative short-range probes, the comparison protocols are described (see cited references above).
1.4.4.3.3 Producing a clone library characterized by short-range probes.
The comparison experiments of the previous step construct a table D of scores that compare the DNA from clones against DNA from short-range probes. These provide measures of genomic colocalization and distance.
In this step, or in the following step 15, contigs can be formed from the short-range characterization data of the clones. In the preferred embodiment, each clone's score signature relative to the oligonucleotides is compared against other clones' score signatures. Pairs of clones having similar score signatures are inferred to be close, and their distances can be estimated. The preferred ordering method is simulated annealing (W. H. Press, B. P. Flannery, S. A. Teukolsky, and W. T. Vetterling, Numerical Recipes in C: The Art of Scientific Computing. Cambridge: Cambridge University Press, 1988), incorporated by reference. Effective contiging algorithms have been described (A. J. Cuticchia, J. Arnold, and W. E. Timberlake, "ODS:
ordering DNA sequences, a physical mapping algorithm based on simulated annealing," CABIOS, vol. 9, no. 2, pp. 215-219, 1992; A. J. Cuticchia, J.
Arnold, and W. E. Timberlake, "The Use of Simulated Annealing in Chromosome Reconstruction Experiments Based on Binary Scoring," Genetics, vol. 132, pp. 591-601, 1992;
A.
Milosavljevic, Z. Strezoska, M. Zeremski, D. Grujic, T. Paunesku, and R.
Crkvenjakov, "Clone clustering by hybridization," Genomics, vol. 27, no. 1, pp. 83-89, 1995), incorporated by reference.
For alternative short-range probes, the contiging analysis procedures use analogous comparison data and search procedures, and have been described (D.
O.
Nelson and T. P. Speed, "Statistical issues in constructing high resolution physical maps," Statistical Science, vol. 9,~no. 3, pp. 334-354, 1994; E. Branscomb, T.
Slezak, R. Pae, D. Galas, and al., "Optimizing restriction-fragment fingerprinting methods for ordering large genomic libraries," Genomics, vol. 8, pp. 351-366, 1990; S. G.
Fisher, E. Cayanis, J. J. Russo, I. Sunjevaric, B. Boukhgalter, P. Zhang, M.-T. Yu, R.
Rothstein, D. Warburton, I. S. Edelman, and A. Efstratiadis, "Assembly of ordered contigs of cosmids selected with YACs of human chromosome 13," Genomics, vol.
21, pp. 525-537, 1994; R. Mort, A. Grigoriev, E. Maier, J. Hoheisel, and H.
Lehrach, "Algorithms and software tools for ordering clone libraries: application to the mapping of the genome of Schizosaccharomyces pombe," Nucleic Acids Research, vol. 21, no. 8, pp. 1965-1974, 1993), incorporated by reference.
1.4.4.3.4 Forming a tiling path of clones that span genome regions.
From an accurate clone map of a genome, a (not necessarily unique) subset of clones that cover the genome can be identified. This identification is done by starting from a leftmost clone by moving rightward from a selected clone A, selecting a neighbor B which overlaps A, and then iteratively continuing from B. A
constraint can be placed on this process to find tiling paths having small or minimal length, where length is defined as the sum of the insert sizes of the component clones.
In the preferred embodiment, (minimal) tiling paths have immediately utility for finding genes. This is because the inner product map integrates genetic markers (polymorphic STSs) together with the clones that fully cover the genome region containing the gene of interest. This considerably reduces the search effort for cloning the gene. Even greater utility for positional/candidate cloning (F. S.
Collins, "Positional cloning moves from perditional to traditional.," Nature Genet., vol. 9, no.
4, pp. 347-350, 1995), incorporated by reference, is present when a map of ESTs, expressed cDNAs, or exons is also integrated into the map.
1.4.4.3.5 Determining the sequence of said clones, and of the entire genome.
In the preferred embodiment, each mapped clone is selected in turn from a minimum tiling path. This clone is then subcloned into M13 sequencing vectors.
For each M13 subclone, nested deletions are constructed for use in DNA sequencing.
For each deletion clone, a DNA sequencing template is prepared. This template is then sequenced by the dideoxy method, preferrably using an automated DNA sequencer, such as an A. L. F. (Pharmacia Biotech, Piscataway, N.J.) or an ABI/373 or (Applied Biosystems, Foster City, Calif.) , and 100-500 by of sequence determined. In addition to this "shotgun" phase, in which an initial read is taken from each subclone using a universal primer, a "walking" phase takes additional reads from selected subclones by use of custom primers. Complete protocols for these and related sequencing steps have been described (F. M. Ausubel, R. Brent, R. E. Kingston, D. D.
Moore, J. G. Seidman, J. A. Smith, and K. Struhl, ed., Current Protocols in Molecular Biology. New York, N.Y.: John Wiley and Sons, 1995; N. J. Dracopoli, J. L.
Hairies, B. R. Korf, C. C. Morton, C. E. Seidman, J. G. Seidman, D. T. Moir, and D.
Smith, ed., Current Protocols in Human Genetics. New York: John Wiley and Sons, 1995).
The sequences of the nested deletion clones are assembled into the complete sequence of the subclone by matching overlaps. The subclone sequences are then assembled into the sequence of the mapped clone. The sequences of the mapped clones are assembled into the complete sequence of the genome by matching overlaps. Computer programs are available for these tasks (Rodger Staden programs, Cambridge, UK; DNAStar, Madison, Wis.). Following sequence assembly, current analysis practice includes similarity and homology searches relative to sequence databases (Genbank, Bethesda, Md.; EMBL, Cambridge, UK; Phil Green's GENEFINDER, Seattle, Wash.) to identify genes and repetitive elements, infer function, and determine the sequence's relation to other parts of the genome and cell.
1.4.4.4.6 Application of Strategies Such strategies have been successfully applied to sequencing the genomes of several bacteria (Human Genome Sciences, Gaithersburg, Md.), including E. coli (G.
Plunkerr and al., "Analysis of the Escherichia coli genome. III. DNA sequence of the region from 87.2 to 89.2 minutes," Nucl. Acids Res., vol. 21, pp. 3391-3398, 1993), incorporated by reference, and higher organisms, including yeast (S. G. Oliver and al., "The complete sequence of yeast chromosome III," Nature, vol. 357, pp. 38-46, 1992); incorporated by reference, human (A. Martin-Gallardo and al., "Automated DNA sequencing and analysis of 106 kilobases from human chromosome 19q13.3,"
Nature Genet., vol. 1, pp. 34-39, 1992), incorporated by reference, mouse (R.
K.
Wilson and al., "Nucleotide sequence analysis of 95 kb near the 3' end the marine T-cell receptor alpha/delta chain locus: strategy and methodology," Genomics, vol. 13, pp. 1198-1208, 1992), incorporated by reference, and C. elegans (R. Wilson and al., "2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans,"
Nature, vol. 368, pp. 32-38, 1994; J. Sulston, Z. Du, K. Thomas, R. Wilson, L.
Hillier, R. Staden, N. Halloran, P. Green, J. Thierry-Mieg, L. Qiu, S. Dear, A.
Coulson, M.
Craxton, M. Durbin, M. Berks, M. Metzstein, T. Hawkins, R. Ainscough, and R.
Waterston, "The C. elegans genome sequencing project: a beginning," Nature, vol.
356, pp. 37-41, 1992), incorporated by reference. The automated sequencing of large genome regions from mapped cosmid (or other) clones is now routine in several centers (Sanger Center, Cambridge, UK; Washington University, St. Louis, Mo.), with very low error at an average cost of $0.50 or less per base. Specific strategies and protocols for these efforts have been detailed (H. G. Griffin and A. M.
Griffin, ed., DNA Sequencing: Laboratory Protocols. New Jersey: Humana, 1992), incorporated by reference.
The current best mode for sequencing is gel electrophoresis on polyacrylamide gels, possibly using fluorescence detection. Newer technologies for DNA size separation axe being developed that are applicable to DNA sequencing, including ultrathin gel slabs (A. J. Kostichka, M. L. Marchbanks, R. L. Bromley Jr., H.
Drossman, and L. M. Smith, "High speed automated DNA sequencing in ultrathin slab gels," Bio/Technology, vol. 10, pp. 78-81, 1992), incorporated by reference, capillary arrays (R. A. Mathies and X. C. Huang, "Capillary array electrophoresis: an approach to high-speed, high-throughput DNA sequencing," Nature, vol. 359, pp.
167-169, 1992), incorporated by reference, and mass spectrometry (K. J. Wu, A.
Stedding, and C. H. Becker, "Matrix-assisted laser desorption time-of flight mass spectrometry of oligonucleotides using 3-hydroxypicolinic acid as an ultraviolet-sensitive matrix," Rapid Commun. Mass Spectrom., vol. 7, pp. 142-146, 1993), incorporated by reference. DNA sequencing without the use of gel electrophoresis has also been done using sequencing by hybridization methodologies (R. Drmanac, S.
Drmanac, Z. Strezoska, T. Paunesku, I. Labat, M. Zeremski, J. Snoddy, W. K.
Funkhouser, B. Koop, and L. Hood, "DNA sequence determination by hybridization:
a strategy for efficient large-scale sequencing," Science, vol. 260, pp. 1649-1652, 1993; E. M. Southern, U. Maskos, and J. K. Elder, "Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucletides: evaluation using experimental models," Genomics, vol. 13, pp. 1008-10017, 1991; S. P. A. Fodor, J. L.
Read, M. C. Pirrung, L. Stryer, A. T. Lu, and D. Solas, "Light-directed spatially addressable parallel chemical synthesis," Science, vol. 251, pp. 767-773, 1991), incorporated by reference. Another approach is base addition sequencing strategy (BASS), which uses synchronized DNA polymer construction to determine the sequence of unknown DNA templates (P. C. Cheeseman, "Method for sequencing polynucleotides," U.S. Pat. No. 5,302,509; filed Feb. 27, 1991, published Apr.
12, 1994; A. Rosenthal., K. Close, and S. Brenner, "DNA sequencing method," Patent #PCT WO 93/21340; filed Apr. 22, 1992, published Oct. 28, 1993; R. Y. Tsien, P.
Ross, M. Fahenstock, and A. J. Johnston, "DNA sequencing," Patent #PCT WO
91/06678; filed Oct. 26, 1990, published May 16, 1991), incorporated by reference.

1.4.5 Insertion of a Genomic Fragment into an Appropriate Host Vector In another embodiment, the process begins with a fragment of DNA, such as a genomic fragment, which is inserted into an appropriate host vector capable of accommodating it. For example, a BAC vector can accommodate approximately 140 kb of DNA; a cosmid vector can accommodate approximately 40 kb. A composition comprised of these insert-containing vectors is randomly sheared using standard methods, such as sonication, to obtain fragments suitable for transposon-based sequencing--i.e., about 2-5 kb, preferably 3-4 kb, on the average.
The resulting subfragments are ligated into cloning vectors to create a first library of subclones representing the original fragment. Because the subclones in this library will be used as target plasmids for transposon-mediated sequencing, the size of the cloning vector should be minimized; preferably it should contain only a selectable marker, an origin of replication, and an insertion site. A suitable host plasmid is pOT2; the subfragments obtained by shearing the original composition are end-repaired, ligated to suitable restriction site containing adapters, and inserted into the host vector. Suitable adapters for the pOT2 vector contain BstXI sites.
The resulting cloning vectors with their inserts are then transfected into bacteria, typically E. coli, for clonal growth. This first library should contain a 15-20-fold representation of the original fragment of DNA. For example, if the original fragment is approximately 40 kb, and the subclones contain inserts of approximately 4 kb, 200 such clones would be required for a 20-fold representation of the original fragment.
1.4.5.1 Hybridization Screening As pointed out above, this first library will contain subclones which do not contain DNA derived from the original fragment to be sequenced. In order to eliminate these subclones, a preliminary hybridization screen is conducted.
The required number of subclones is prepared for hybridization screening, for example, by plating in 96-well plates and transferring to filters. The filters are then probed with the original fragment insert to weed out any colonies which do not contain DNA
which represents portions of the original fragment. This checks the quality of the library and eliminates subclones that contain only host cloning vector for the original fragment or contaminating bacterial DNA.
1.4.5.2 2"a Library Formation by Subclones that Contain Inserts The subclones confirmed to contain inserts derived from the fragment to be sequenced form a second library. The number of subclones in this library should be sufficient to contain a 7-8x times. representation of the fragment. Each subclone is individually sequenced from one end of the insert. This is straightforward, since the sequence information in the cloning vector provides sufficient information to design appropriate primers. Typically, about 400-450 nucleotides into the insert is read. In addition to the requirement for 7-8x times. coverage of the fragment when the complete insert sequences of the subclones are obtained, there must be sufficient sequence information available from this end sequencing to represent a lx times.
coverage of the fragment. Thus, if the original fragment contained 40 kb and nucleotides into the insert is read, 100 clones would be required. The resulting sequence information is organized into a computer-readable form for searching.
A
DNA sequence comparison algorithm can be used for subsequent comparisons, such as the NCBI program BLASTN.
The criteria used to determine the number of subclones used to establish the database in the method described above are that low sequencing redundancy must be maintained and a complete path must be available within the set of subclones chosen to provide complete coverage of the original fragment. In addition, the number must be chosen so that there is a high probability of finding the next subclone when searching with the newly sequenced end sequence.
A method similar to that employed by Chen, E. et al. Genomics (1993) 17:651-666, is used. Larder and Waterman (cite) conclude that the maximum number of sequence islands occurs at C=(1-.theta.)-1, where C is the sequence coverage and theta is the ratio of the number of bases required to detect the true overlap to the sequence read length. As theta approaches zero, sequence coverage of 1 will produce the maximum number of sequence islands. In order to achieve the highest efficiency database, enough end-sequence data should be generated to obtain about lx times.
coverage.
In addition, the subclone coverage--i.e., the redundancy based on the complete sequence contained in the number of subclones chosen--is important. A subclone coverage factor of 7x-8x times provides a 99.9% probability that each nucleotide in the fragment will actually reside in the library. This requires only about 100 subclones averaging 3 kb in size for a 40 kb fragment.

Sequence information from the host vector for the original fragment is~used as the first query and reveals which subclones in the library are hybrid vector/fragment insert subclones. These will identify the two ends of the original fragment.
One subclone representing each end, preferably that containing the least amount of vector sequence, is selected for further sequencing. The insert of the identified subclone will be sequenced from the opposite end from that previously sequenced-- i.e., opposite the end containing the vector sequence. The new sequence information (which is now derived from the fragment) is used as the next query. This identifies additional subclones which contain additional nucleotide sequence farther in from the end of the original fragment. The next identified subclone is then also sequenced from the opposite end of the insert from that used to place it in the database and the new sequence information used as the next query. The process is continued sequentially until a subclone path through the fragment is obtained. The subclone path will represent the collection of subclones which completely define the fragment from which they originated, and their correct relative positions are known.
At any point in this process, if there are no responses to the query, additional sequence can be obtained from the subclones already identified and this sequence used as the query.
Once the subclone path is determined, it remains only to complete the sequencing of the subclones involved in the path. According to the method of the invention, this is accomplished using the transposon- mediated method of Strathmann incorporated by reference hereinabove. Use of this method to complete the sequence information for the fragment has been designated "minimal assembled path"
(MA.P) sequencing. The name is apt because the information provided by the subclone path can be used to determine the minimal sequencing path through the identified subclones. For example, if two subclones overlap over 1 kb, transposon insertions can be selected so that the overlap region is sequenced only once. Thus, although theoretically each of the subclones obtained to define the path can be completely sequenced using the transposon-mediated method, only sufficient portions of these subclones need be sequenced to obtain he complete sequence of the original fragment.

1.4.6 Methods of Determining A Nucleic Acid Sequence through Enzymatic Sequencing In another embodiment, improved methods of determining a nucleic acid sequence through enzymatic sequencing are provided. In the subject methods, primers are used in combination with capturable chain terminators to produce primer extension products capable of being captured on a solid phase, where the primer extension products may be labeled, e. g. by employing labeled primers to generate the primer extension products. Following generation of the primer extension products, the primer extension products are isolated through capture on a solid phase. The isolated primer extension products are then released from the solid phase, size separated and detected to yield sequencing data from which the nucleic acid sequence is determined.
Methods of determining the sequence of a nucleic acid, e.g. DNA, by enzymatic sequencing are well known in the art and described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989) and Griffin and Griffin, "DNA Sequencings, Recent Innovations and Future Trends," Applied Biochemistry and Biotechnology (1993) 38: 147-159, the disclosures of which are herein incorporated by reference. The Sanger method is shown schematically herein. Generally, in enzymatic sequencing methods, which are also referred to as Sanger dideoxy or chain termination methods, differently sized oligonucleotide fragments representing termination at each of the bases of the template DNA are enzymatically produced and then size separated yielding sequencing data from which the sequence of the nucleic acid is determined. The results of such size separations are shown herein. The first step in such methods is to produce a family of differently sized oligonucleotides for each of the different bases in the nucleic acid to be sequenced, e.g. for a strand of DNA comprising all four bases (A, G, C, and T) four families of differently sized oligonucleotides are produced, one for each base. To produce the family of differently sized oligonucleotides, each base in the sequenced nucleic acid, i.e. template nucleic acid, is combined with an oligonucleotide primer, a polymerase, nucleotides and a dideoxynucleotide corresponding to one of the bases in the template nucleic acid. Each of the families of oligonucleotides are then size separated, e.g. by electrophoresis, and detected to obtain sequencing data, e.g. a separation pattern or electropherogram, from which the nucleic acid sequence is determined.

Before further describing the subject methods in greater detail, the critical chain terminator reagents employed in the subject methods will be discussed.
Critical to the subject methods is the use of capturable chain terminators to produce the families of different sized oligonucleotide fragments (hereinafter referred to as primer extension products) comprising a capture moiety at the 3' terminus. The primer sequences employed to generate the primer extension products will be sufficiently long to hybridize the nucleic acid comprising the target or template nucleic acid under chain extension conditions, where the length of the primer will generally range from 6 to 40, usually 15 to 30 nucleotides in length. The primer will generally be a synthetic oligonucleotide, analogue or mimetic thereof, e.g. a peptide nucleic acid.
Although the primer may hybridize directly to the 3' terminus of the target nucleic acid where a sufficient portion of this terminus of the target nucleic acid is known, conveniently a universal primer may be employed which anneals to a known vector sequence flanking the target sequence. Universal primers which are known in the art and commercially available include pUC/M 13, g t 10, gtl 1 and the like.
1.4.6.1 Primers Comprise a Detectable Label In one preffered embodiment of the subject invention, the primers employed in the subject invention will comprise a detectable label. A variety of labels are known in the art and suitable for use in the subject invention, including radioisotopic, chemiluminescent and fluorescent labels. As the subject methods are particularly suited for use with methods employing automated detection of primer extension products, fluorescent labels are preferred. Fluorescently labeled primers employed in the subject methods will generally comprise at least one fluorescent moiety stably attached to one of the bases of the oligonucleotide.
The primers employed in the subject invention may be labeled with a variety of different fluorescent moieties, where the fluorescer or fluorophore should have a high molar absorbance, where the molar absorbance will generally be at least 104crri 1M-1, usually at least 104 cm 1M-1 and preferably at least 105 cm IM-I, and a high fluorescence quantum yield, where the fluorescence quantum yield will generally be at least about 0.1, usually at least about 0.2 and preferably at least about 0.5.
For primers labeled with a single fluorescer, the wavelength of light absorbed by the fluorescer will generally range from about 300 to 900 nm, usually from about 400 to 800 nm, where the absorbance maximum will typically occur at a wavelength ranging from about 500 to 800 nm. Specific fluorescers of interest for use in singly labeled primers include: fluorescein, rhodamine, BODIPY, cyanine dyes and the like, and are farther described in Smith et al., Nature (1986) 321: 647-679, the disclosure of which is herein incorporated by reference.
Of particular interest for use in the subject methods are energy transfer labeled fluorescent primers, in which the primer comprises both a donor and acceptor fluorescer component in energy transfer relationship. Energy transfer labeled primers are described in PCT/LTS95/01205 and PCT/L1S96113134, as well as in Ju et al., Nature Medicine (1996)2:246-249, the disclosures of which are herein incorporated by reference.
In an alternative embodiment of the subject invention, instead of using labeled primers labeled deoxynucleotides are employed, such as fluorescently labeled dUTP, which are incorporated into the primer extension product resulting in a labeled primer extension product.
The dideoxynucleotides employed as capturable chain terminators in the subject methods will comprise a functionality capable of binding to a functionality present on a solid phase. The bond arising from reaction of the two functionalities should be sufficiently strong so as to be stable under washing conditions and yet be readily disruptable by specific chemical or physical means. Generally, the chain terminator dideoxynucleotide will comprise a member of a specific binding pair which is capable of specifically binding to the other member of the specific binding pair present on the solid phase. Specific binding pairs of interest include ligands and receptors, such as antibodies and antigens, biotin and strept/avidin, sulfide and gold (Cheng & Brajter-Toth, Anal.Chem. (1996)68:4180-4185, and the like, where either the ligand or the receptor, but usually the ligand, member of the pair will be present on the chain terminator. Of particular interest for use as chain terminators are biotinylated dideoxymicleotides, where such dideoxymicleotides are known in the art and available commercially, e. g. biotin- I I -ddATP, biotin- I I -ddGTP, biotin- I I -ddCTP and biotin- 11 -ddTTP, and the like.
1.4.6.2 Subject Methods Turning now to the subject methods, the nucleic acids which are capable of being sequenced by the subject methods are generally deoxyribonucleic acids that have been cloned in appropriate vector, where a variety of vectors are known in the art and commercially available, and include M I3mp 18, pGEM, pSport and the like.
The first step in the subject method is to prepare a reaction mixture for each of the four different bases of the sequence to be sequenced or target DNA. Each of the reaction mixtures comprises an enzymatically generated family of primer extension products, usually labeled primer extension products, terminating in the same base. In other words, in practicing the subject method, one will first generate an "A
", G," "C,"
and "T," family of differently sized primer extension products using the target DNA
as template. To generate the four families of differently sized primer extension products, template DNA, a DNA polymerise, primer (which may be labeled), the four different deoxynucleotides, and capturable dideoxynucleotides are combined in a primer extension reaction mixture. The components are reacted under conditions sufficient to produce primer extension products which are differently sized due to the random incorporation of the capturable dideoxynucleotide and subsequent chain termination. Thus, to generate the "A" family of differently sized primer extension products, the above listed reagents will be combined into a reaction mixture, where the dideoxynucleotide is ddATP modified to comprise a capiurable moiety, e.g.
biotinylated ddATP, such as biotin- 11 -ddATP. The remaining "G", C," and "T"
families of differently sized primer extension products will be generated in an analogous manner using the appropriate dideoxynucleotide.
Where labeled primers are employed to generate each of the families of primer extension products, the labeled primers may be the same or different.
Preferably, the labeled primer employed will be different for production of each of the four families of primer extension products, where the labels will be capable of being excited at substantially the same wavelength and yet will provide a distinguishable signal. The use of labels with distinguishable signals affords the opportunity of separating the differently sized primer extension products when such products are together in the same separation medium. This results in superior sequencing data and therefore more accurate sequence determination. For example, one can prepare the "A" family of primer extension products with a first fluorescent label capable of excitation at a wavelength from about 470 to 480 nm which fluoresces at 525 nm. The label used in production of "G," "C," and "T" families will be excitable at the same wavelength as that used in the "A" family, but will emit at 555 nm, 580 nm, and 605 nm respectively. Accordingly, the primer extension labels are designed so that all four of the labels absorb at substantially the same wavelength but emit at different wavelengths, where the wavelengths of the emitted light differ in detectable and differentiatable amounts, e.g. differ by at least 15 nm. The next step in the subject method is isolation of the primer extension products. The primer extension products are isolated by first capturing the primer extension products on a solid phase through the capture moiety at the 3' terminus of the primer extension product and then separating the solid phase from the remaining components of the reaction mixture.
Capture of the primer extension products occurs by contacting the reaction mixture comprising the family of primer extension products with a solid phase.
The solid phase has a member of a specific binding pair on its surface. The other member of the specific binding pair is bonded to the primer extension products, as described above. Contact will occur under conditions sufficient to provide for stable binding of the specific binding pair members. A variety of different solid-phases are suitable for use in the subject methods, such phases being known in the art and commercially available. Specific solid phases of interest include polystyrene pegs, sheets, beads, magnetic beads, gold surface and the like. The surfaces of such solid phases have been modified to comprise the specific binding pair member, e.g. for biotinylated primer extension products, streptavidin coated magnetic bead may be employed as the solid phase.
Following capture of the primer extension reaction products on the solid phase, the solid phase is then separated from the remaining components of the reaction mixture, such as template DNA, excess primer, excess deoxy- and dideoxymicleotides, polymerase, salts, extension products which do not have the ' capture moiety, and the like. Separation can be accomplished using any convenient methodology. The methodology will typically comprise washing the solid phase, where further steps can include centrifugation, and the like. The particular method employed to separate the solid-phase is not critical to the subject invention, as long as the method employed does not disrupt the bond linking the primer extension reaction product from the solid-phase.
The primer extension products are then released from the solid phase. The products may be released using any convenient means, including both chemical and physical means, depending on the nature of the bond between the specific binding pair members. For example, where the bond is a biotin-streptavidin bond, the bond may be disrupted by contacting the solid phase with a chemical disruption agent, such as formamide, and the like, which disrupts the biotin-streptavidin bond and thereby releases the primer extension product from the solid phase. The released primer extension products are then separated from the solid phase using any convenient means, including elution, centrifugation and the like.
The next step in the subject method is to size separate the primer extension products. Size separation of the primer extension products will generally be accomplished through electrophoresis, in which the primer extension products are moved through a separation medium under the influence of an electric field applied to the medium, as is known in the art. Alternatively, for sequencing with Mass Spectrometry (MS) where unlabeled primer extension products are detected, the sequencing fragments are separated by the time of the flight chamber and detected by the mass of the fragments. See Roskey et al., Proc. Natl. Acad. Sci. USA
(1996) 93:
4724-4729. The subject methodology is especially important for obtaining accurate sequencing data with MS, because the subject methodology offers a means to load only the primer extension products terminated with the capturable chain terminators, eliminating all other masses"thereby producing accurate results.
In methods in which the fragments are size separated, the size separated primer extension products are then detected, where detection of the size separated products yields sequencing data from which the sequence of the target or template DNA is determined. For example, where the families of fragments are separated in a traditional slab gel in four separate lanes, one corresponding to each base of the target DNA, sequencing data in the form of a separation pattern is obtained. From the separation pattern, the target DNA sequence is then determined, e.g. by reading up the gel. Alternatively, where automated detectors are employed and all of the reaction products are separated in the same electrophoretic medium, the sequencing data may take the form of an electropherogram, as is known in the art, from which the DNA
sequence is determined.
Where labeled primers are employed, the nature of the labeled primers will, in part, determine whether the families of labeled primer extension products may be separated in the same electrophoretic medium, e.g. in a single lane of slab gel or in the same capillary, or in different electophoretic media, e.g. in different lanes of a slab gel or in different capillaries. Where the same labeled primer generating the same detectable single is employed to generate the primer extension products in each of the different families, the families of primer extension products will be electrophoretically separated in different electrophoretic media, so that the families of primers extension products corresponding to each base in the nucleic acid can be distinguished.
Where different labeled primers are used for generating each family of primer extension products, the families of products may be grouped together and electrophoretically separated in the same electrophoretic medium. In this preferred method, the families of primer extension products may be combined or pooled together at any convenient point following the primer extension product generation step. Thus, the primer extension products can be pooled either prior to contact with the solid phase, while bound to the solid phase or after separation from the solid phase but prior to electrophoretic separation.
Kits for practicing the subject sequencing methods are also provided. At a minimum such kits will comprise capturable chain terminators, e.g.
biotinylated-ddATP; -ddTTP; - ddCTP and -ddGTP. For embodiments in which the primer extension products are labeled, the kits will further comprise a means fox generating labeled primer extension products, such as labeled deoxynucleotides, or preferably labeled primers, where the labeled primers are preferably Energy Transfer labeled primers which absorb at the same wavelength and provide distinguishable fluorescent signals. Conveniently, the kits may further comprise one or more additional reagents useful in enzymatic sequencing, such as vector, polymerase, deoxynucleotides, buffers, and the like. The kits may further comprise a plurality of containers, wherein each contain may comprise one or more of the necessary reagents, such as labeled primer, unlabled primer or degenerate primer, dNTPs, dNTPs containing a fraction of fluorescent dNTPs, capturable ddNTP, polymerase and the like. The kits may also further comprise solid phase comprising a moiety capable of binding with the capturable ddNTP, such as streptavidin coated magnetic beads and the like.

1.4.7 Production of the DNA Fragments In another embodiment, the DNA fragments are preferably prepared according to either the enzymatic or chemical degradation sequencing techniques previously described, but the fragments are not tagged with radioactive tracers. These standard procedures produce, from each section of DNA to be sequenced, four separate collections of DNA fragments, each set containing fragments terminating at only one of the four bases. These four samples, suitably identif ed, are provided as a few microliters of liquid solution.
1.4.7.1 Sample Preparation and Introduction To obtain intact molecular ions from large molecules, such as DNA fragments, by UV laser desorption mass spectrometry, the samples should be dispersed in a solid matrix that strongly absorbs light at the laser wavelength. Suitable matrices for this purpose include cinnamic acid derivatives such as (4-hydroxy, 3-methoxy) cinnamic acid (ferulic acid), (3,4-dihydroxy) cinnamic acid (caffeic acid) and (3,5-dimethoxy, 4- hydroxy) cinnamic acid (sinapinic acid). These materials may be dissolved in a suitable solvent such as 3:2 mixture of 0.1 % aqueous trifluoroacetic acid and acetonitrile at concentrations which are near saturation at room temperature.
One technique for introducing samples into the vacuum of the mass spectrometer is to deposit each sample and matrix as a liquid solution at specific spots on a disk or other media having a planar surface. To prepare a sample for deposit, approximately 1 microliter of the sample solution is mixed with 5-10 microliters of the matrix solution. An aliquot of this mixed solution for each DNA sample is placed on the disk at a specific location or spot, and the volatile solvents are removed by room temperature evaporation. When the solution containing the samples and thousand-fold or more excess of matrix is dried on the disk, the result should be a solid solution of samples each in the matrix at a specific site on the disk.
Each molecule of the sample should be fully encased in matrix molecules and isolated from other sample molecules. Aggregation of sample molecules should not occur. The matrix need not be volatile, but it must be rapidly vaporized following absorption of photons. This can occur as the result of photochemical conversion to more volatile substances. In addition, the matrix must transfer ionization to the sample. To form protonated positive molecular ions from the sample, the proton amity of the matrix must be less than that of the basic sites on the molecule, and to form deprotonated negative ions, the gas phase acidity of the matrix must be less than that of acidic sites on the sample molecule. Although it is necessary for the matrix to strongly absorb photons at the laser wavelength, it is preferable that the sample does not absorb laser photons to avoid radiation damage and fragmentation of the sample.
Therefore, matrices which have absorption bands at longer wavelengths are preferred, such as at 355 nm, since DNA fragment molecules do not absorb at the longer wavelengths.
Depicted herein is a suitable automated DNA sample preparation and loading technique. In this approach, a commercially available autosampler is used to add matrix solution from container to the separated DNA samples. A large number of DNA fragment samples, for example 120 samples, may be loaded into a sample tray.
The matrix solution may be added automatically to each sample using procedures available on such an autosampler, and the samples may then be spotted sequentially as sample spots on an appropriate surface, such as the planar surface of the disk rotated by stepper motor. Sample spot identification is entered into the data storage and computing system which controls both the autosampler and the mass spectrometer.
The location of each spot relative to a reference mark is thus recorded in the computer. Sample preparation and loading onto the solid surface is done off line from the mass spectrometer, and multiple stations may be employed for each mass spectrometer if the time required for sample preparation is longer than the measurement time.
Once the samples in suitable matrix are deposited on the disk, the disk may be inserted into the ion source of a mass spectrometer through the vacuum lock.
Any gas introduced in this procedure must be removed prior to measuring the mass spectrum.
Loading and pump down of the spectrometer typically requires two to three minutes, and the total time for measurement of each sample to obtain a spectrum is typically one minute or less. Thus 50 or more complete DNA spectrum may be determined per hour according to the present invention. Even if the samples were manually loaded, less than one hour would be required to obtain sequence data on a particular segment of DNA, which might be from 400 to 600 bases in length. Even this latter technique is much faster than the conventional DNA sequencing techniques, and compares favorably with the newer automated sequencers using fluorescence labeling. The technique of the present invention does not, however, require the full- time attention of a dedicated, trained operator to prepare and load the samples, and preferably is automated to produce 50 or more spectrum per hour.
Greater detail of the preferred technique for DNA sequencing is depicted herein. Under the control of the computer, the disk may be rotated by another stepper motor relative to the reference mark to sequentially bring any selected sample to the position for measurement. If the disk contains 120 samples, operator intervention is only required approximately once every two hours to insert a new sample disk, and less than five minutes of each two hour period is required for loading and pumpdown.
With this approach, a single operator can service several spectrometers. The particular disk geometry shown for the automated system is chosen for illustrative purposes only. Other geometries, employing for example linear translation of the planar surface, could also be used.
1.4.7.2 The Mass Spectrometer The present invention preferably utilizes a laser desorption time of flight (TOF) mass spectrometer. The disk has a planar face containing a plurality of sample spots, each being approximately equal to the laser beam diameter. The disk is maintained at a voltage V 1 and may be manually inserted and removed from the spectrometer. Ions are formed by sequentially radiating each spot on the disk with a laser beam from source.
The ions extracted from the face of the disk are attracted and pass through the grid covered holes in the metal plates. The plates are at voltages V2 and V3.
Preferably V3 is at ground, and V1 and V2 are varied to set the accelerating electrical potential., which typically is in the range of 15,000-50,000 volts. A suitable voltage VI -V2 is 5000 volts and a suitable range of voltages VZ -V3 is 10,000 to 45,000 volts.
The low mass ions are almost entirely prevented from reaching the detector by the deflection plates. The ions travel as a beam between the deflection plates which suitably are spaced 1 cm. apart and are 3-10 cm long. The first plate is at ground and a second plate receives square wave pulses, for example, at 700 volts with a pulse width in the order of 1 microsecond after the laser strikes the tip. Such pulses suppress the unwanted low mass ions, for example, those under 1,000 Daltons, by deflecting them, so that the low weight ions do not reach the detector, while the higher weight ions pass between the plates after the pulse is off, so they are not deflected, and are detected by detector.

An ion detector is positioned at the end of the spectrometer tube and has its front face maintained at voltage Vd. The gain of the ion detector is set by Vd which typically is in the range of -1500 to -2500 volts. The detector is a chevron-type tandem microchannel plate array with a front plate at about -2000 volts. The spectrometer tube is straight and provides a linear flight path, for example, 1l2 to 4 meters in length, and preferably about two meters in length. The ions are accelerated in two stages and the total acceleration is in the range of about 15,000-50,000 volts, positive or negative. The spectrometer is held under high vacuum, typically 10 uPa, which may be obtained, for example, a$er 2 minutes of introduction of the samples.
The face of the disk is struck with a laser beam to form the ions. Preferably the laser beam is from a solid laser. A suitable laser is an HY-400 Nd-YAG laser (available from Lumonics Inc., Kanata (Ottawa), Ontario, Canada), with a 2nd, 3rd and 4th harmonic generation/selection option. The laser is tuned and operated to produce maximum temporal and energy stability. Typically, the laser is operated with an output pulse width of 10 ns and an energy of 15 mj of UV per pulse. To improve the spatial homogeneity of the beam, the amplifier rod is removed from the laser.
The output of the laser is attenuated with a 935-5 variable attenuator (available from Newport Corp., Fountain Valley, Calif.), and focused onto the sample on the face, using a 12-in. focal length fused-slica lens. The incident angle of the laser beam, with respect to the normal of the disk's sample surface, is 70°. The spot illuminated on the disk is not circular, but a stripe of approximate dimensions 100x300 um or larger.
The start time for the data system (i.e., the time the laser actually fired) is determined using a beam splitter and a PS-O1 fast pyroelectric detector (available from Molectron Detector Inc., Campbell, Calif.). The Laser is operated in the Q switched mode, internally triggering at 5 Hz, using the Pockels cell Q-switch to divide that frequency to a 2. S Hz output.
The data system for recording the mass spectra produced is a combination of a TR8828D transient recorder and a 6010 CAMAC crate controller (both manufactured by Lecroy, Chestnut Ridge, N.Y.). The transient recorder has a selectable time resolution of 5-20 ns. Spectra may be accumulated for up to 256 laser shots in 131,000 channels, with the capability of running at up to 3 Hz, or with fewer channels up to 10 Hz. The data is read from the CAMAC crate using a Proteus IBM AT
compatible computer. During the operation of the spectrometer, the spectra (shot-to-shot) may be readily observed on a 2465A 350 MHz oscilloscope (available from Tektronix, Inc., Beaverton, Oreg.). A suitable autosampler for mixing the matrix solution and each of the separated DNA samples and for depositing the mixture on a solid planar surface is the Model 738 Autosampler (available from Alcott Co., Norcoss, Ga.).
This linear TOF system may be switched from positive to negative ions easily, and both modes may be used to look at a single sample. The sample preparation was optimized for the production of homogeneous samples in order to produce similar signals from each DNA sample spot.
1.4.7.3 Data Analysis and Determination of Sequence The raw data obtained from the laser desorption mass spectrometer 30 consists of ion current as a function of time after the laser pulse strikes the target containing the sample and matrix. This time delay corresponds to the "time-of flight"
required for an ion to travel from the point of formation in the ion source to the detector, and is proportional to the mass-to-charge ratio of the ion. By reference to results obtained for materials whose molecular weights are known, this time scale can be converted to mass with a precision of 0.01 % or better.
In a graph of intensity v. time-of flight of the pseudomolecularion region of a TOF mass spectrum of Not I Linker (DNA) in which the matrix is ferulic acid and the wavelength is 355 nm, four consecutive spectra can be obtained using the present invention by the successive measurement of the four collections of DNA
fragments obtained from fragmentation of each sample of DNA. Each of these spectra will correspond to the set of fragments ending in a particular base or bases G, G
and A, C
and T, or C. To determine the order of the peaks in the four spectra, a simple computer algorithm may be utilized.
It should be noted that the data obtained from the mass spectra contains significantly more useful information that the corresponding traces from electrophoresis.
Not only can the mass order of the peaks be determined with good accuracy and precision, but also the absolute mass differences between adjacent peaks, both in individual spectra and between spectra, can be determined with high accuracy and precision. This information may be used to detect and correct sequence errors which might otherwise go undetected. For example, a common source of error which often occurs in conventional sequencing results from variations the amounts of the individual fragments present in a mixture due to variations in the cleavage chemistry.
Because of this variation it is possible for a small peak to go undetected using conventional sequencing techniques. With the present invention, such errors can be immediately detected by noting that the mass differences between detected peaks do not match the apparent sequence. In many cases, the error can be quickly corrected by calculating the apparent mass of the missing base from the observed mass differences across the gap. As a result, the present invention provides sequence data not only much faster than conventional techniques, but also data which is more accurate and reliable. This correction technique will reduce the number of extra runs which are required to establish the validity of the result.

1.4.8 The Amplification Of A DNA Stretch Using The Pcr Procedure With The Knowledge Of Only One Primer In another embodiment, the present invention enables the amplification of a DNA stretch using the PCR procedure with the knowledge of only one primer.
Using this basic method, the present invention describes a procedure by which a very Long DNA of the order of millions of nucleotides can be sequenced contiguously, without the need for fragmenting and sub-cloning the DNA. In this method, the general PCR
technique is used, but the knowledge of only one primer is sufficient, and the knowledge of the other primer is derived from the statistics of the distributions of oligonucleotide sequences of specified lengths.
1.4.8.1 Method of Sequencing without the Need for Fragmenting or Subcloning The objects and advantages of the present invention are also achieved by a method comprising:
a) synthesizing a partly fixed primer, with 4, 5, 6 nucleotide, or longer sequence characters fixed within it. The fixed sequence can be any sequence, with some preferred sequences such as those containing many G-C pairs that increases binding affinity. The fixed position within the primer can be anywhere, with some preferred positions;
b) taking a very long genomic DNA, either uncloned or a cloned large insert such as the YAC or cosmid in which a short sequence of about 20 characters somewhere within the DNA is known;
c) synthesizing a primer from the sequence known from the DNA in step b;
d) radiolabeling the primer in step c;
e) annealing the primers (from step a, and step d or step g as appropriate) to the DNA in step b, and amplifying the DNA between the attached primers;
f) performing DNA sequencing of the amplified DNA by the chemical degradation method of Maxam and Gilbert, or carrying out DNA sequencing by the Sanger method, or by modified PCR-sequencing method;
g) after obtaining the DNA sequence from step f, selecting an appropriate first primer towards the 3' end of the sequence, synthesizing it, and radiolabeling it;

h) repeating the steps a through g with the two primers (the same partly fixed unknown primer as the second primer and the newly synthesized primer from step g as the first primer);
i) if the sequence obtained in step f is too short to be of value, using another partly fixed primer with a different fixed sequence and the same first primer to obtain a longer DNA sequence.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed herein are standard methodologies well known to one of ordinary skill in the art.
The partly fixed primer used to perform DNA amplification and sequencing are, of course, not limited to those described under the examples. Further modification in the method may be made by varying the length, content and position of the fixed sequence and the length of the random sequence. Additional obvious modifications include using different DNA polymerases and altering the reaction conditions of DNA
amplification and DNA sequencing. Furthermore, the basic technique can be used for sequencing RNA using appropriate enzymes.
Instead of preparing the first primer completely, it can also be prepared as follows. Two or three shorter oligonucleotides that would comprise the complete primer could be ligated, by joining end-to-end after annealing to the template DNA, as described under another patent (Helmut Blocker, U.S. Pat. No. 5,114,839, 435/6, 5/1992) or as described in the publication (L. E. Kotler, et al., Proceedings of the National Academy of Science, USA, 90:4241-4245 (1993)). Alternatively, it can be synthesized using the single-stranded DNA binding protein, the subject of another invention (J. Kieleczawa, et al., Science, 258:1787-1791 (1992)). One of such procedures, or an improved version thereof, can be used to make the first primer in the present invention. All in all, the first primer need not be synthesized at every PCR
reaction while contiguously sequencing a long DNA, and can be directly constructed from an oligonucleotide bank. Based on the present invention, the second primer also can be chosen from a set of only a few pre-prepared primers. This enables the direct automation of sequencing the whole long DNA by incorporating the primer elements into the series of sequential PCR reactions.

1.4.8.2 Advantages of Method An advantage of the present invention is that from a known sequence in a very long DNA, sequencing can be performed in both directions on the DNA. Two first primers can be' prepared, one on each strand, running in the opposite directions, and the sequence can be extended on both directions until the two very ends of the long DNA are reached by the present invention, using a small set of pre-prepared partly fixed second primers.
One of the major advantages of the present invention is that it is highly amenable to various kinds of automation. Instead of radiolabeling the first known primer, it can be fluorescently labeled, and with this the DNA sequencing can be performed in an automated procedure on machines such as that marketed by the Applied Biosystems ("373 DNA Sequencer: Automated sequencing, sizing, and quantitation", a pamphlet from the Applied Biosystems, A Division of Perkin-Elmer Corporation (1994)). In the present invention there is no need to newly synthesize any primers to sequence a very long DNA. Thus, with the pre- prepared set of partly fixed second primers, an oligonucleotide bank for the synthesis of the first primer, and a large supply of the template genomic DNA (or any long DNA), the sequencing of the whole long DNA can be automated using robots almost without any human intervention, except for changing the sequencing gels.
1.4.8.3 Applications of Method The following processes can be computer controlled: 1) the selection of the appropriate sequence for constructing the first primer close to the 3' end of the newly worked out sequence, 2) determining whether the sequence obtained is too short and selection of a different partly fixed second primer, 3) assembling the contiguous DNA
sequences from the various lanes and various gels and appending to a database, and other such processes. Thus the present invention enables the construction of a fully automated contiguous DNA sequencing system. Any such automations are obvious modifications to the present invention.
The present invention is not limited to only unknown genomic DNA, and can be used to sequence any DNA under any situations. DNAs or RNAs of many different origins (e.g. viral, cDNA, mRNA) can be sequenced not only limited to research or information gathering purposes, but also to other purposes such as disease diagnosis and treatment, DNA testing, and forensic applications.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.
It should be noted that any kit or process used for research, diagnostic, forensic, treatment, production or other purposes that uses the present invention is covered under these claims. Furthermore, the various sequences of the partly fixed second primers that can be used in the present invention are covered under this patent.
Thus, any kit or process that uses this method and/or the DNA strands with the sequences that would comprise the partly fixed second primers will also be covered under this.
In addition to contiguous DNA sequencing, the present invention will cover the amplification of the DNA strands that are bounded between the known primer and the partly fixed second primer (either from claim 1 or from claim 2). The DNA
amplification can also be performed for long DNA strands using the long PCR
amplification protocols.

L4.9 Polynucleotide Sequencing With Random Surface Immobilization And Light Microscopic Detection Of Affinity Labels Coupled To Microscopic Beads A DNA sample is prepared by shearing or digestion at a first sequence with a first restriction enzyme producing a 3' overhang terminus, to some appropriate, known size distribution, and labeled with a digoxigenin bearing nucleotide by the action of terminal deoxynucleotidyl transferase.
After such digoxigenin labeling, said DNA sample is then subjected to random internal cleavage, for example by shearing so as to produce a population of molecules with an average length half that produced in the previous sizing step, or digestion with a second restriction enzyme recognizing a distinct, second recognition sequence.
Sample molecules of said sample are then bound at some convenient surface density to a transparent surface modified with a monolayer or a sub-monolayer density of anti-digoxigenin antibody. Said sample molecules, which will thus be bound to said transparent surface by the 3' termini of one strand, are then subjected to treatment by a 3' to 5' exonuclease, which will only act at the 3' terminus which does not bear the digoxigenin moiety due to the hindrance of this latter 3' terminus by its interaction with the surface, preferably not to completion of digestion of susceptible strands.
Thus primed DNA sample template molecules bound to a transparent surface in an end-wise manner are prepared.
Using a single nucleotide labeling affinity moiety in a manner similar to the example provided for one-bit binary labeling systems, utilizing for example each of the four nucleotides derrivatized to effect communication of said nucleotides with a biotin moiety via a chemically cleavable linker, such as those described by S.W. Ruby et a1.34 polymerization directed by the template provided by each involved DNA
sample template molecule is effected with an appropriate DNA polymerase lacking a 3' to 5' exonuclease activity, such as Sequenase 2.0,35 with only one nucleotide type present during each polymerization step sub-cycle, at sufficiently low concentration to effect equilibrium controlled stepping. Polymerization reagents are then washed away, and may favorably be recycled after quantitation and readjustment of respective labeled nucleotide content.
After each such polymerization sub-cycle step, which will add a biotin labeled nucleotide to only a fraction of those sample template molecules having only the base complementary to the nucleotide of said sub-cycle located immediately 5' to the base opposite the 3' terminal base of the strand priming this nucleotide addition, biotin bearing molecules may be labeled with microscopic streptavidin coated beads.
Unbound beads are then washed away. Bead labeled molecules may then be observed by a video microscope, and the position of said bead labeled molecules within a sample may be recorded by image analysis of digital images thus obtained, in a manner similar to that used by Finzi and Gelles. Dithiothreitol or other reagents capable of cleaving said linker holding said biotin in communication with said nucleotide incorporated during the previous polymerization sub-cycle are then used to treat sample molecules to cleave said linkers and thus release said biotin labeling moieties and the beads which have bound to them. A wash step is then performed to remove said beads. The extent of bead removal may be checked with another video microscopy detection step if needed; and further cleavage treatment may be performed if decoupling was not adequate. The same subcycle (comprising polymerization, bead association, video microscopic examination, bead and label cleavage and removal by washing, and optionally a bead removal confirmation video microscopic examination step) is then repeated in succession for each of the three remaining nucleotide types, to complete a full base sequencing cycle (which as noted may yield information about more than one base location for some template molecules according to the sequence composition and the order of sub-cycles, and no information for other sample template molecules). Multiple said base sequence cycles are repeated until enough data have been accumulated relative to the total complexity of the initial DNA sample. Recorded data are then used to reconstruct sequence information for a segment of each sample template molecule, and segment sequence data are then aligned by appropriate computational algorithms.
Note that this embodiment avails only existing and generally available materials and devices, relies on relatively simple manipulations which are known to be highly reproducible according to their general use in the relevant fields, but due to the novel process of the present invention may yield genome sequence information far more rapidly and inexpensively than highly complex robotic instruments with sequencing methods utilizing electrophoretic separation.
Note that microscopic detection may be performed with a computer controlled stepable sample stage to effect the automated examination of large surface areas and hence very large numbers of sample molecules.

Alternatively, the transparent substrate providing the surface for immobilization may be that of a spooled film, which may be advanced at an appropriate rate before the objective of said video microscope of the present embodiment. Further, with such a spooled sample arrangement, said film may be circular, and continuously advanced through multiple video microscope apparata and wells effecting polymerization sub-cycles, all in appropriate order such that benefit of full pipelining of each step may be enjoyed. The construction of such instrumentation and rudimentary robotic actuation systems will be straightforward to those skilled in the relevant engineering arts.
Surface immobilization with single photon detection of plural fluorescent labels coupled to photodetachable 31-hydroxyl protecting groups. Sequence determination may additionally effected by the random immobilization at some appropriate density of appropriately prepared and primed sample molecules on the surface of a transparent film, and stepwise polymerization with some appropriate polymerase, of all four nucleotides, all of which are protected at the 3'-hydroxyl with a photolabile (and hence photoremovable) protecting group in communication with labeling moieties which distinctly correspond to each nucleoside base type of the respective nucleotide. Label incorporation is detected, for example by the scanned beam light microscopic methods of the present invention, or with highly sensitive CCDs, and assigned to the spatial region occupied by a particular molecule.
Said film is translated appropriately such that the full complexity of the sample may be examined after each polymerization cycle.
Data are recorded electronically and according to the molecule for which they are obtained. Illumination of the sample with an appropriate frequency and intensity of light to effect 3'-hydroxy deprotection and hence also labeling moiety removal is performed, and a wash step is performed to remove freed label. Such polymerization, detection and deprotection cycles are repeated until the sample is su~ciently well characterized.
1.4.9.1 Random And Non-Random Immobilization To Optical Detection Array Devices With Optical Labels 1.4.9.1.1 Detection And Classification Of Pathogens In Clinical Samples Methods of the present invention may be combined with the immobilization of highly diverse libraries of binding specificities with either encoding labels or phenogenocouples, which may therefore be characterized dynamically and related to any detected binding of particles of interest from a sample. Clinical samples are interacted with said libraries. All retained material is then interacted with some general label such as a polynucleotide binding dye (e.g. ethidium bromide, DAPI) or some chromophorigenic or photoemissive or labeled competitive inhibitor analog reagent detecting some metabolically fundamental reaction such as ATP
hydrolysis, or the presence enzymes catalyzing said metabolically fundamental reaction. Pathogens containing polynucleotides or capable of said metabolically fundamental reaction may thus be detected.
The essential features of such a system are massively parallel screening for affinity interactions, generalized labeling methodology, and automated sample characterization. Because pathogen culturing is not required, and many types of highly specific information may be obtained in one assay procedure, without any previous knowledge of the state of the organism from which said clinical sample was obtained, this represents the basis for extremely powerful diagnostic methods.
Note that various implementations may distribute binding specificities of known composition in a spatially controlled manner, and thus rely on spatial information to encode specificity type and hence, if known, composition of each specificity type. Note also that said libraries may comprise known mimetics or small molecules of known binding specificity.
The profile of any sample type from an individual organism according to such an assay may be monitored over time, and a profile is preferably obtained for a state of presumed health for comparison to samples correlated to states of disease, deficiency or degeneration or other states of ill health (i.e. longtitudinal tracking of individuals stratified by sample type). Samples of similar type may also be compared across populations and subpopulations, and the profile of these samples also correlated with state of health of the respective individuals (cross-sectional comparison).
For additional selectivity of detection, such a sample characterized as above may be further characterized according to the immunocharacterization method below.
1.4.9.1.2 Automated Immunocharacterization And Cyber-Immune Detection Such a system resembles that used for the detection and characterization of clinical samples, except that said highly libraries of binding specificities comprises a large number of immunoglobulin specificities. Libraries comprising immunoglobulin specificities may include such specificities in the form of immunoglobulins expressed on bacteriophages, viruses, or in the form of the phenogenocouples of the present invention.
Banks comprising all of the specificities of a library may be maintained as monoclones, and upon detection of a pathogen in association with one or more binding specificity contained in some library, and the identification andlor characterization of said one or more binding specificity, an alignment of the respective said monoclone, from one of said banks, may can be provided to the organism. Such analysis and provision of one or more monoclones be automated and controlled by algorithms.
Similar rapidity and broad characterization advantages are attained as with the preceding method for the characterization of clinical sample.
1.4.9.1.3 Massively Parallel Enzymological Assays:
In a manner similar to the preceding embodiments, several enzymes contained within some sample may be analyzed according to their binding probability, binding duration or dissociation rate and conformational or phosphorylation or other status. Such assays may favorably be performed by the methods of the present invention, with immobilized libraries which may include competitive inhibitors, and with pre- or post-binding labeling of sample enzymes by encoded label antibodies, to permit classification of sample enzyme type on a molecule by molecule basis, which classification data may be combined with the data obtained in this assay.
1.4.9.2 Hybridization Based Detection Of Polynucleotide Sequences.
Various methods have been developed to test for the presence of short polynucleotide sequences and combinations of such sequences (according to stringency) in polynucleotide samples by hybridizing oligonucleotides or polynucleotides of known sequence to said polynucleotide samples. Such methods are sometimes terined'gene-probe" methods and often involve the use of immobilized, ordered arrays of oligonucleotides of known composition.

Said ordered arrays have been formed on the surfaces of integrated electronic devices. It has been shown that, provided stringency can be made sufficiently high to prevent binding with even one base mismatch, such methods may be used to obtain sequence information about a sufficiently small sample.
The methods of the present invention provide a more rapid and convenient method for testing for the binding of known oligonucleotides to a complex polynucleotide sample, owing largely to the higher degree of parallelism which may be accomplished with single molecule methods. Here, each oligonucleotide, of known sequence, to be used as a specific gene probe, is synthesized with some perceptible encoded label, as described above, where the codes assigned to the sequence of said each oligonucleotide are known (due to the synthetic scheme by which they are produced and concurrently labeled). These are then hybridized to sample polynucleotide molecules, which either have previously been or will subsequently be immobilized, or may otherwise be separated from probe oligonucleotides, and the presence or absence of said each oligonucleotide in the sample polynucleotide containing fraction, which is a direct result of the success or failure of said each oligonuclectide to bind said sample polynucleotide molecules, will be readily ascertained through the detection and discrimination of the perceptible encoding labels corresponding to said each oligonucleotide. Contrary to the conventional gene-probe methodology, known probing molecules are generally unbound in this variation of the method as may be used with the present invention.
If the complexity of the polynucleotide sample is not too large, and the population made up of said oligonucleotides is sufficiently large and complex, preferably exhaustively enumerating all possible oligonucleotides of the respective and sufficiently long length, and provided hybridization may be sufficiently stringent, which stringency is affected by a large number of known factors but also has sequence dependent components, information about the binding of said each oligonucleotide, which may be related to the respective known sequence and by Watson-Crick pairing rules to the respective sample polynucleotide sequence segment (or by identity with the strand complementary to the strand to which said each oligonucleotide has bound) may thus be obtained. As with other methods, alignment of such data may yield information about the sequence of the sample. The methods of the present invention further provide for the quantitation of such oligonucleotide hybridization by way of counting the number of times a particular perceptible encoded label is retained by a said polynucleotide sample, which may be availed both in the monitoring and correcting of errors and in the modulation of binding (hybridization) conditions.
Alternatively, probing may be accomplished by oligomeric sequences immobilized in some known configuration, for example by spatially patterned methods such as those of S.P.A. Fodor et a1.37 or by the lattices produced hierarchically by the method of N.C. Seeman noted above but comprising an ordered array (the order of which is predetermined by the incorporation or association of single stranded oligonucleotides or other single stranded termini of known sequence into or with modular components used to build up said lattices) of short single stranded regions of known sequence and preferably one free terminus (so as not to hinder conformational changes required for hybridization), but detected by the methods of the present invention, where sample polynucleotides are labeled with some appropriate discernible label, such as the dye YOYO-I, to facilitate the detection of their presence in association with each of said oligomeric sequences.
A yet further variation for effecting the spatially predetermined distribution of, for example and exhaustively enumerated population of single stranded oligonucleotides, may be effected by the used of the methods of N.C. Seeman to produce a uniform two dimensional lattice with a repeating pattern of short single stranded sequences with photo protected termini, for example all of the 256 possible 4-mers. Such a lattice may have a periodicity substantially smaller than the wavelength of visible light. Said short single stranded sequences may be comprise some synthetic backbone so as to be resistant to enzymatic cleavage, which backbone preferably also is non-ionic (for example, of alkyl or beta-cyanoethyl derivation, peptide-nucleic-acid composition, or methylphosphonate composition) so as to denature from a complementary sequence only at markedly elevated temperatures relative to ordinary oligonucleotides. Thus, a pattern of oligonucleotide complexity may be distributed in a predetermined manner below the resolution of light directed patterning.
Light patterning techniques may then be availed to spatially direct the photodeprotection of said short single stranded sequences at lower resolution.
Such light directed syntheses are preferably terminated with some comonomer which will prevent exonucleolytic degradation of said short single stranded sequences, or all of said short single stranded sequences are of a polarity opposite to that specified by the exonuclease to be subsequently used. By this combination of methods, patterning resolution is not limited by the properties of light, but may avail of the convenience of light directed patterning at lower resolutions. After a known distribution of all possible single stranded sequences of sufficient complexity has thus been produced, a denatured, labeled polynucleotide sample produced by extensive nick translation, with fluorescent labeled nucleotides, of a naturally occurring polynucleotide sample is hybridized to said lattice. Hybridized molecules are treated mildly with a single strand specific nuclease, followed by an exonuclease, to degrade or by the same process to free those regions which are not bound to the probing said short single stranded sequences. Label incorporated into the nick translation products of said polynucleotide sample is then detected and spatially mapped by the methods of the present invention, and binding is thus scored according to the known probing said short single stranded sequences. This method thus avails the molecular parallelism made possible by the molecular recognition, high density and high resolution detection methods availed with the present invention.
Note, finally, that higher density patterning than attainable by conventional light patterning methods may also be effected by scanning probe lithographic methods, such as the use of NFSOM lithography with photodeprotectable groups.
1.4.9.2.1 Methods For Repeatable Detection And Identification Of Single Molecules Repeatable detection and identification of single molecules is achievable by microscopic labeling with some readily identifiable, e.g. combinatorially or permutationally diverse and readily examined particle or molecule or group of molecules and detection of the thus marked identity of individual free molecules in solution, with removal of excess nucleotides (e.g. by filtration); and, scanning of a liquid sample volume where sample molecules and sample conditions are matched to ensure manageably slow free diffusion of sample molecules permitting tracking of the motions of free individual molecules in solution, as observed by T.T. Perkins et al. for reptation of DNA in solution, in which instance unreacted labeled monomers may be removed, for instance, according to their more rapid diffusion, possibly through a filter, and detection may favorably comprise observation of reduced mobility of a labeling moiety after it has become attached to a sample molecule.) According to the labeling methods employed, various detection methods may satisfy the requirements of signal detection with repeatable assignability to a particular unique sample template molecule.
Prominent among these detection methods are microscopy methods such as video microscopy including confocal fluorescence microscopy with or without enhancement, and with or without variations incorporated into the present invention near field scanning optical microscopy (NFSOM) and variations thereof; contact and non-contact varieties of scanning force microscopy (SFM; also termed atomic force microscopy (AFMI) and variations thereof; other scanning probe microscopies including scanning tunneling microscopy (STM), scanning tunneling spectroscopy (STS), and so-called field emission mode STM (which is more accurately described as microscopy by field emission from a scanned conductive probe, or scanning field emission microscopy, SFEM, because no tunneling actually occurs). Any enhancements of scanning probe microscopy, including multiple probe parallelism, may readily be availed in the practice of the present invention.
Additionally, optical detection methods employing optoelectronic array devices (OADs), such as spatial light modulators (SLMs), laser diode arrays (LDAs), light-emitting diode arrays, or charge coupled photo-diode arrays (conventionally termed CCDs), in combination with appropriately high sensitivity detection methods, may also be employed, particularly with samples immobilized such that the maximal proportion of pixel elements of said array will be involved with the detection of a signal from exactly one sample molecule. CCD and SLM array device are presently available at pixel densities of approximately 105 to 106 per cm2. LDAs of comparable density are currently under development. Device level constraints upon parallelism will thus be significant, but may be overcome by increasing the data obtained per molecule (i.e. processivity or sequence segment length.) Such devices may be employed remotely, i.e. in some arrangement where light passes through the sample under study and is detected by some apparatus involving said array devices, or in close or direct contact with said sample, as for instance, polynucleotides have been immobilized to integrated circuits for other applications. Appropriate arrangements of such devices for the appropriate detection scheme in which each device type is appropriately used will be obvious to those skilled in the arts of optics and optoelectronics.
Note that for purposes of those variations of the present invention involving the immobilization of sample molecules, said immobilization may be conveniently effected in a random manner, relying upon some appropriate surface or volume density which yields a corresponding random surface or volume distribution, and appropriate detection methods to permit repeatable resolution of most sample molecules from each other. The length of the molecules in question will be an important factor in the determination of a desirable said density. Generally speaking, for random surface immobilization and without the use of measures to orient or order sample molecules, for molecules of length L (which may additionally account for any labeling bead diameter), and detection methods relying on spatial resolution R, maximum practical molecule number density will generally be the less than I /(2L+R)a. This assumes the worst case configuration of two end immobilized molecules extending directly towards each other and both labeled near their respective termini. Similar calculations may be applied to three dimensional cases.
Alternatively, one may consider (2L+R)2 or (2L+R)3 to be an average bin size, and determine via the Poison distribution the optimal molecular number density corresponding to the largest number of bins being occupied by precisely one sample template molecule.
Alternatively, molecules may be labeled by a first label, for example with a particular fluorescent dye incorporated by nick translation, in a manner identifying a portion of the molecule near the site of polymerization, and proximity of said first label to the perceptibly distinct labeling moieties used for nucleotide incorporation detection and discrimination will permit the detection of unacceptable proximity of two distinct sample molecules. Such a method is consistent with the tracking methods described below for free sample molecules. in such a case, the data collected during the cycle in which said unacceptable proximity is observed for the affected molecules may be ignored, and lack of information from this cycle noted for the respective molecules. Conditions, such as solution viscosity, sample molecule diffusion rate, sample molecule concentration, sample dimensions, etc., may be optimized to reduce the occurrence of such unacceptable proximity, and oversampling methods described in other portions of the present disclosure may be applied to preclude this form of error from degrading final data quality. These methods may be applied to either immobilized or unimmobilized sample molecules.
1.4.9.2.1.1 Microscopy Based Detection Light microscopic visualization represents a particularly convenient and technically simple detection and unique molecule localization method. A
visualization method of particular interest for purposes of the present invention in higher performance or more demanding applications is video enhanced confocal fluorescence microscopy (VECFM), preferably utilizing optics well matched to the refractive index of the reaction or detection medium.
As discussed above, various scanning probe microscopies may also be advantageously used within the present invention according to labeling agents and methods used. Most prominent among these are NFSOM and variations thereof, and both contact and non-contact SFM, and variations thereof.
Generally speaking, a microscopy based detection method must be sufficiently convenient, capable of use with a stepper translated or otherwise translatable sample, not destructive of the sample, and capable of detection of any labeling methodology to be used with it. Thus, it is quite likely that many microscopy methodologies not yet developed may readily be employed with the present invention. Further, microscopy and corresponding apparata shall comprehend any miniaturized or microfabricated microscopy devices or other comparable integrated detection means.
1.4.9.2.1.2 HIGH SENSITIVITY AND SCANNED EXCITATION BEAM
FLUORESCENCE CONFOCAL MICROSCOPY
A modification of VECFM which is particularly suited for SMD and SMV
relies upon selective fluorescent excitation of an appropriate dye molecule label (or of molecules within a sample with appropriate fluorescent properties independent of labeling) in some sample by means of some tightly defined beam, with dimensions at or near the resolution limit of the apparatus, of an appropriate frequency, or of parametrically controllable frequency, where said beam is caused to scan in a controlled manner through the sample region within the visual field. This microscopy, including numerous variations, may be termed either scanned beam confocal microscopy or steered beam confocal microscopy (in either case, SBCM).
Scanning of said beam through the sample within the visual field may be accomplished by introducing said beam into the optical path of the VECFM via mobile mirrors which may effect said controlled scanning, or by first producing said beam with a pinhole which is itself scanned, before deflection towards the sample via said mirrors, which in the present case may be fixed in position, through the use of pinholes in a rotating disk arranged in one or more spiral arms to effect an approximately rastering illumination of the sample as said disk rotates, or by other means which will be obvious to those skilled in the design of optical instrumentation and microscopy. Said beam will excite fluorescence in any appropriately responsive molecules which occur in its path. An optical splitter may then redirect a fraction of the light transmitted from the sample through the objective lens, and direct it through a narrow bandwidth, high transmissiveness filter, which may be specific for a fixed or for a parametrically controllable variable frequency, to uniquely select the appropriate fluorescent emission frequency, to a highly sensitive photodetector, which may record either intensity as intensity information or as the number of photons detected per unit time, as a function of the region being subjected to fluorescence exiting illumination or being distinctly observed (see below). Thus a high resolution map of the fluorescence of the sample may be reconstructed, and further overlayed images obtained for the same sample and sample location by conventional VECFM means.
Alternatively, the entire sample of visual field may be subjected to illumination by an appropriate excitation frequency, and a pinhole scanned through the portion of the output of said optical splitter, such that light passing through said pinhole will reach said highly sensitive photodetector.
In yet a third, albeit technically more complex implementation, an SLM, may be used in place of said pinhole (in either configuration), and fluorescent excitatory illumination may be either broadly distributed or scanned.
In a fourth, albeit technically more complex implementation, sensitive photodetection may be accomplished with a highly sensitive CCD, and fluorescent excitatory illumination may be either broadly distributed or scanned. At present, CCD
sensitivity approaching single photon detection is technically possible though is not practical for high volume applications.
In a fifth implementation, said scanned beam may originate from a laser diode array device or a light emitting diode array device, where only one of, or a contiguous group of elements of, such an array is active at any particular time so as to produce a particular beam, and the group of active elements of said such an array is changed as a function of time to effect scanning of the sample by the coordinated activation and deactivation of the plural beams thus produced.
In all of the above implementations, spatial information is gained about any particular fluorescent emission, and this may then be combined with other visual information obtained via the same VECFM apparatus.
Note that for scanned beam methodologies, where beams are used for excitation or detection, even where said beams may have inhomogeneous but invariant distribution of internal flux density, known samples such as individual dye molecules may be imaged for calibration purposes and information useful for algorithmic enhancement may be collected. This information represents the characterization of the convolution of the beam and optics properties with the signal actually owing to the known sample, and thus localization of fluorescent sample features may be accomplished at better than optical resolution limitations.
For example, a single, immobilized fluorescent molecule may be examined by such an apparatus, and the intensity as a function of beam position may be recorded for the full duration of its presence within the beam's path as said beam scans the sample, and the data thus obtained may then be used to determine the change in observed intensity as the sample molecule enters the extremity of the beam, traverses the beam and exits the beam. This information may then be subjected, for instance to averaging or other computations to determine the relationship between the location of the molecule within the beam and the intensity observed, and finally that information used to estimate the intensity which would be observed when such a calibration sample molecule is in the precise center of the beam. This information may then be used in image enhancement of unknown samples. Note, however, that localization to below optical resolution limitations is distinct from increasing the resolution capability for two nearby objects.
Scanning beam microscopies will be of particular advantage where it is desirable to use particular illumination frequencies to modify the sample. For purposes of the present invention, a beam of predetermined frequency, for instance delimited and scanned by means of a pinhole as described above, may be used to selectively modify a particular sample molecule. For example, a beam of predetermined frequency may be used to effect the photobleaching of the labeling moiety on a particular sample molecule. to selectively remove a photocleavable protecting group on a particular sample molecule, to selectively remove a moiety joined to a sample molecule by a photocleavable linker, or selectively control any photochemical reactions in a highly localized but non-invasive manner.
Note that implementations permitting variations of illumination frequency and/or variations of the frequency or frequencies selected b". * filters for detection purposes constitute microspectroscopy or microfluorimetry, and may be applied to any of the various light microscopies.

1.4.9.2.1.3 REPEATABILITY BY IMMOBILIZATION WITH DISCERNIBLE
LOCATION
Surface Immobilization A large number of methods presently exist to effect the immobilization of macromolecules and other molecules to various surfaces including the, surfaces of optically transparent materials. In general, such methods on the chemical modification of said surfaces such that they will be reactive with or have specific affinity for particular chemical functional groups placed on said macromolecules or molecules.
Applicable methods include those described by S.P.A. Fodor et al effect micropatterned surface immobilization and controlled synthesis polypeptides and polynucleotides, those described by M. Hegner et a1.14 ' effect the end-wise immobilization of terminally thiol modified double helical DNA molecules to a gold coated surface, or those methods recently used by L. Finzi and J. Gel1es15 to effect end-wise attachment of DNA molecules to an antibody coated glass surface. Many alternative methods will be obvious to those skilled in the relevant arts.
For purposes of genome sequencing applications of the present invention, DNA from a cosmid library which may have been prepared from total genomic material., from a cDNA library derived from a particular tissue type, from a cosmid library which may have been prepared for a single chromosome or group of chromosomes or particular chromosome segments, or directly purified genomic DNA
or directly purified RNA from a particular cell type, etc., may be subjected to fragmentation. Physical methods such as shearing with a hypodermic apparatus may be suitable. Where the sample is in the form of duplex DNA, it may be treated with restriction enzymes, which preferably restrict either 6- or 4-base recognition sequences, so as to produce sample molecules of mean length of either 4 kilobases or 256 bases, respectively. Such lengths are sufficiently short to yield a high number density of sample molecules. Said sample molecules may then be appropriately derrivatized, for example by fill-in reactions at 5' overhang cohesive termini produced by said restriction enzymes with nucleotides bearing an affinity label or an appropriately reactive chemical functional group.

1.4.9.2.1.4 MATRIX IMMOBILIZATION
There has been increasing interest and progress in the field of affinity chromatography which relies upon varyingly specific affinity interactions between molecules immobilized to a chromatographic matrix or polymeric matrix and the molecules contained in some sample. Of particular relevance are matrices with polynucleotides immobilized thereupon. An example which is widely known and used within the relevant fields is oligo-dT cellulose. Further, many chemistries and methods used to immobilize macromolecules to surfaces will be similarly applicable to immobilization to a polymeric matrix provided said matrix is chosen so as to have appropriate reactivities and not pose any difficulties associated with non-specific interactions. Most methods capable of effecting such matrix immobilization will be acceptable for purposes of the present invention. Note, however, that any matrix used in the present invention must admit the sufficiently rapid transport or diffusion of reagents, enzymes and buffers, as required by the particular embodiment.
1.4.9.2.1.5 FOCAL PLANE SCANNING
For detection an discrimination within a volume, whether for matrix immobilized samples or diffusion constrained free molecules in solution, especially where fluorescent labeling of one form or another has been employed, a sample may be examined by microscopy with reconstruction of three-dimensional spatial information by scanning the focal plane through the depth of the sample and collecting image data at appropriate intervals. Such methods of three-dimensional reconstruction are well known within the art of microscopy.
1.4.9.2.1.6 PLANE EXCITATORY ILLUMINATION
Alternatively, optical means such as moving slits or SLMs or laser diode arrays may be employed to selectively illuminate a particular region, preferably a single plane (of thickness similar to the wavelength of light employed or feature size of integrated device means employed), to examine a particular subset of sample template molecules and labels associated with them, providing spatial reconstructability of the data thus collected.
1.4.9.2.2 TWO BEAM METHODS INCLUDING PLANE ILLUMINATION

Volume distributed samples may also be examined with methods closely analogous to those recommended for three dimensional optical mass data storage, for instance, by Sadik Esener in U.S. Patent Number 5,325.324. Here, labels requiring excitation by photons of two distinct frequencies for photoemission may be employed.
Alternatively, the related methods of illuminating an entire plane of a sample with one of said distinct frequencies may be availed as a mechanism for imaging with spatial reconstructability.
1.4.9.2.3 Immobilization Via Concatenation For the various applications of the present invention involving the interaction of enzymes with extended linear macromolecules such as polynucleotides, when said extended linear molecules may be conveniently circularized by appropriate treatments (which will generally be obvious to those skilled in the relevant arts), immobilization of said extended linear molecules may be conveniently effected by their concatenation with second extended linear molecules which are likewise conveniently circularized by appropriate treatments (which will again generally be obvious to those skilled in the relevant arts) bearing chemical properties (i.e. functional groups such as thiols or affinity moieties such as biotin) favorable for convenient, specific immobilization to a surface, matrix or other solid support. For purposes of, for example, certain sequencing applications of the present invention, said second extended linear molecules are favorably bound (with methods which will generally be obvious to those skilled in the relevant arts) at a predetermined location along their length, to some protein, which may be an enzyme such as a polymerase, before immobilization.
Said second extended linear molecules may have termini with reactive chemical functional groups which may be bound together by the addition of some appropriate reagent such as a chemical cross-linking agent, or with some affinity moiety such as an oligo- or polynucleotide which may be bound together by an appropriately complementary oligonucleotide or polynucleotide (with or without ligation thereof), or some appropriate multifuctional binding protein or receptor. Such an arrangement permits the following steps to be performed: said second extended linear molecule is bound to said enzyme; said protein is caused to bind to said first extended linear molecule (which may be circularized either in a prior or subsequent step);
said second extended linear molecule to which said protein has been bound is caused to circularize by appropriate treatment; and if said first extended linear molecule is at this stage linear, it is caused to circularize. Without any special measures, there is a fifty percent chance that such a process will result in concatenation of the first extended linear molecule with the second extended linear molecule. Numerous methods, such as size separation followed by retention by immobilization, may be used to purify the resulting desired concatenate. Where said second extended linear molecule was chosen to be relatively short, such an assemblage will provide for the retention of said first extended linear molecule, now in concatenated circular form, in proximity to said protein, with specific immobilization or convenient immobilizability. Thus, said protein and said first extended linear molecule now in concatenated circular form have a high effective concentration with respect to eachother upon dissociation, and said protein and said first extended linear molecule now in concatenated circular form will not interact with the molecules of other such assemblages when said assemblages are at sufficiently low density or said second extended linear molecule now in concatenated circular form is particularly short (i.e. effectively shackles said first extended linear molecule now in concatenated circular form to said protein whether or not said first extended linear molecule now in concatenated circular form is bound by said protein.) Such an immobilization scheme will be particularly desirable in, for example, sequencing applications of the present invention where a polymerise must perform a cycle, in which it binds, modifies and releases a sample molecule, at a high rate. A
particular instance in which such desirability obtains is.for samples to be analyzed with long sequence segments (e.g. hundreds or thousands of bases) where dissociation of the polymerise is necessary to permit either 3' hydroxy deprotection (e.g.
removal of a photolabile protecting group) and or labeling moiety removal by appropriate means. Note that by immobilizing the enzyme, and hence the spatial location at which the labeling moiety first comes into physical communication with a sample molecule, the above stated limitation on sample molecule density may be overcome, with the new limit being that imposed by the detection method, thus increasing sample density and in some embodiments the parallelism that thence may readily be achieved with detection methods such as microscopy. It is therefore feasible, with such assemblages, to collect sequence data dynamically from each molecule at a rate approaching the limits imposed by the slower of the characteristic nucleotide incorporation rate of the polymerise; or, the diffusion rate limit of nucleotide association with the nucleotide binding site of the polymerase (divided by four) when nucleotides are -at a sufficiently low concentration that their presence as labeled but free molecules in the detection field does not interfere with the detection (which may be time averaged according to the particular instrumentation used) of incorporated labeled nucleotides, which concentration will be dependent in part on the geometry of the liquid volume;
or, the maximum rate of single label detection (but note that such a rate need not be low because detection rate will increase for multimeric labels, which may be employed).
Such an immobilization method will favorably be employed for embodiments locating sample molecules on or near the surface of a CCD or SLM. Note that kinetic control of polymerization rate (and hence stepping rate, e.g. by adjusting nucleotide concentration) is also enhanced by the .use of such a concatenation methodology.
1.4.9.3 IMMOBILIZATION WITH NON-RANDOM DISTRIBUTION
While the above methods are convenient precisely because they require only the simple optimization of sample molecule density, the resulting random distribution will less than fully utilize available substrate or matrix space and fewer than all sample molecules will be sufficiently well separated for unambiguous resolution of two adjacent sample molecules. Due to the inherent advantages provided by molecular parallelism, this will not in general be a significant constraint.
For applications in which a high degree of instrumentation miniaturization is desired, however, a better effective density of usable sample molecules, distributed in either two or three dimensions, may be effected as needed by non-random immobilization methods.
One such random immobilization method may avail of the invention of N.C.
Seeman, described in U.S. Patent Number 5,278,051, which provides a process for the construction of complex geometrical objects. These methods may be applied to the production of regular two- and three-dimensional molecular lattices from .
polynucleotide compositions. The process of this invention may be extended by the incorporation of appropriate affinity groups at predetermined locations within the objects, which for present purposes may favorably be small ligands such as biotin or digoxigenin, which may then be used as the target for a sample molecule which has been terminally labeled by a similar small ligand which has subsequently been bound by (an excess of) an appropriate multimeric receptor. Said multimeric receptor will then recognize and bind the complementary small molecule ligand incorporated into the structure of said lattice, and thus effect sample molecule immobilization according to the non-random pattern predetermined by the precise structure of said lattice and the precise distribution of ligands thereupon. Note that because the objects provided by the invention of N. C. Seeman comprise polynucleotide structures, care must be taken in using such a sample substrate with the methods of the present invention to ensure that said objects will be stable to all treatments which are to be applied to sample molecules, including denaturation, exonucleolytic degradation, primer hybridization, exposure to active polymerases, etc. Generally, these constraints may be met by effecting topological closure of all strands such that no free polynucleotide terminus is carried on such a lattice, and no denaturation procedures will result in matrix dissociation; the methods of the invention of N.C. Seeman may be availed in a manner meeting these constrains.
Note that to ensure complete regularity of lattices constructed by such means, or any other molecular lattices which do not have complete internal rigidity, the extremities of these lattices may be bound to solid supports which are then positioned so as to apply tensile stresses to said molecular lattices which will enforce constraints limiting flexural internal degrees of freedom and enforcing substantial spatial regularity on sample molecule distributions.
Any other method which provides a regular array of binding sites to which sample molecules may selectively be associated will also suffice for the purpose of non-random immobilization of sample molecules in two- or three-dimensions for the present invention.
Note also that said appropriate affinity groups incorporated (directly or, by conjugation or other methods, indirectly) at appropriate sites in a lattice may be chosen so as to interact directly with polynucleotide sample molecules in a sequence dependent or independent manner. Sequence dependent affinity binding may be effected with oligonucleotides or analogs thereof capable of forming double-, triple-or quadruple helices with said sample polynucleotides, ribozymes, or sequence dependent binding proteins including but not limited to: transcriptional activators (e.g.
TATA- Binding Protein), enhancers and repressors; integrases; restriction enzymes;
replicator proteins (e.g. DnaA); DNA repair proteins; anti- polynucleotide antibodies, RNA processing complexes (e.g. snRNPs); and RNA binding proteins all under conditions permitting desired selectivity, specificity or stringency but, where appropriate, preventing polynucleotide cleavage or degradation. Where sequence specific binding is desired, and hierarchically prepared lattices are used, the distribution of particular specificities may be controlled by the staged incorporation of said affinity groups at various hierachial levels of the synthetic procedure.
This will permit classification of sequence data according to the location of the sample template molecule from which it is obtained in the lattice (i.e. on the surface or within the matrix). Sequence independent binding of polynucleotides may be effected by the use of proteins such as RecA, histones, Ul, etc.
1.4.9.3.1 Repeatable Identification Of Unimmobilized Molecules:
Single molecule tracking with controlled diffusion- For samples under continuous observation, e.g. continuously within as visual field of a video microscope, molecules may be perceptibly labeled, for example by perceptible microscopic beads or the incorporation of a first fluorescent label, and tracked by the use of image analysis algorithms. Said algorithms will recognize only the appropriate type of label and track the motions of the respective sample molecule as it slowly diffuses in solution, so as to permit the unambiguous direct correlation or assignment of the signal associated with the addition of a labeled nucleotide to said respective sample molecule. For these methods, nucleotide labeling does not necessitate the use of large beads or other complexes for detection. Instead, single or oligomeric fluorescent labeling moieties, or enzymatic label amity conjugation are preferred, such that labels may be removed without greatly disturbing the trajectory of said respective sample molecules. Either the direct colocalization (to within the resolution of the imaging method) of nucleotide label with said first fluorescent label or reductions in the Brownian motion of said nucleotide Label sufficiently near (e.g.
closest to) said first fluorescent label may be exploited in the detection of nucleotide label incorporation.
Note that manipulation with a laser trap, as for instance described by T.T.
Perkins et al. for reptation of DNA in solution, may be employed with such free molecules.
1.4.9.3.2 Unique Labeling Of Sample Molecules And Identification Methods Various methods may be employed to uniquely label individual sample molecules. The complexity of such unique labels must be greater than the number of sample molecules contained within a unitary sample preparation, such that any label is highly unlikely to occur more than once within said unitary sample preparation.
Labels may be visually discriminatable, or may be diverse affinity labels or combinations thereof. Labels of this type may conveniently be random combinations of some basis set of distinct labels, formed for example, by a random coupling or polymerization of such labeling moieties to a defined chemical site provided by chemical modification of sample molecules.
Visual labeling may be accomplished by the use of a sufficient number of distinguishable fluorescent dye molecules, or other visual labels, such that the presence or absence of association of any one of said distinguishable fluorescent dye molecules may comprise the state of a bit in a binary code. Such labeling is similar to the combinatorial encoding described by S. Brenner and R.A. Lerner, but differs in that: perceptible labels may be used for encoding; labels need not be genetic material or linear copolymers; where only unique identifiability is required, the label moiety employed for encoding may be synthesized separately and possibly randomly, and bound possibly randomly with sample molecules; the information contained by each labeling moiety need not depend on its precise spatial association with sample molecules, or its location within a sequence, only its sufficient proximity;
and, because of such modes of independence between the encoding, which serves here only for purposes of unique labeling, difficulties which may arise for particular orthogonal polymerization chemistries of different copolymer types may be avoided either by separate synthesis. Alternatively, for biopolymers, and, possibly for specifically encoded libraries, the use of specific enzymes which may for example ligate polynucleotides or polypeptides, may be used to specifically control reactions and prevent polymerizations of one biopolymer from affecting a second, linked biopolymer. Note that moieties different from biologically occurring comonomers may be used as encoding: label moieties, via functionalization of appropriate biopolymer segment with such moieties, in synthetic manners which will be obvious to those skilled in the relevant arts, or may be used, similarly, as constitutes the random library thus encoded. This latter case is, for example accomplished with the use of multiple distinct short double stranded DNA molecules with appropriately complementary cohesive termini which each carry some particular affinity or photolabel type, and which may be ligated together in a manner stepped by the addition of appropriate adaptor linkers, even in the presence of other biopolymers (such synthetic methods being further favorably facilitated by the use of solid phase synthetic methodologies). Depending on the sensitivity of the detection methods used, multimers of each single type of fluorescent dye moiety, or detectable multiplications of other photolabels, may be used to effect higher modulo coding of labels.
1.4:9.4 ENCODING BY SYNTHESIS WITH MULTIMACROMONOMERS
Note that the labeling methods of the present invention suggest a convenient solution to the problem recognized by Brenner and Lerner, as limiting the facility of their encoding system, i.e. the requirement of separate distinct comonomer (or co-oligomer) type addition steps for each polymer type. This prevents the use of highly random (but step- controlled) synthetic preparation of such encoded libraries, because the information encoded is realized by individual preparative synthetic steps, i.e. all of the information content of the encoding is conferred upon these compounds by the intervention or agency of a chemist (or automated systems) at each step. Such encoded libraries, of either the sequence encoded or modulo encoded types, including compounds comprising more than two polymer types, may be prepared with the following stepped random method in one container (with or without the favorable use of solid phase synthetic methodologies). Note that the term random here refers to the mixture of two or more multimacromonomers in each addition step, such that addition to all compounds under preparation will occur in a random manner within the reaction mixture, in a manner weighted according to the relative concentration of each such multimacromonomer. Such multimacromonomers may also be used in more directly controlled addition schemes with advantages which will be obvious to those skilled in the relevant arts.
Multimacromonomers comprising two or more monomer (or macromonomer) types (e.g. comprising an amino acid monomer and a trinucleotide oligomer, or an amino acid monomer, a trinucleotide oligomer and a fluorescent or affinity labeling moiety) may be prepared by joining some or all of said two or more monomer (or macromonomer) types by cleavable linkers such as those described in other sections of the present disclosure. Thus, each multimacromonomer may be added to compounds under synthesis by addition of one of the monomer or macromonomer types to the corresponding polymer or macropolymer types of said compounds under synthesis by appropriate polymer synthesis chemistry, followed by addition of some or all of each of the remaining monomer or macromonomer types to the respective corresponding polymer or macropolymer types of said compounds under synthesis by appropriate polymer synthesis chemistry. Control over the details of such additions may be effected by control over, for example, removal of distinct protecting groups from distinct polymer or macropolymer types of said compounds under synthesis by appropriate polymer synthesis chemistry. Linkers or specific linker branches may be cleaved at appropriate steps or after synthesis has otherwise been completed.
Thus, correspondence between the composition of each polymer or macropolymer type comprised within each molecule of the compound under synthesis (which final composition may vary widely from molecule to molecule of the compound under synthesis, but strictly observe the correspondence between composition of some or all of each of the polymers or macropolymers comprised within each molecule of the compound under synthesis) is provided by the communication of the distinct monomer or macromonomer types comprised within each multimacromonomer. The first bond formed between a first monomer or first macromonomer of a multimacromonomer and a molecule of the compound under synthesis will thus ensure that other monomer or macromonomer types of the multimacromonomer which will be added at the respective multimacromonomer addition stage will correspond to the identity of the first monomer or first macromonomer thus added.
Thus correspondence of some or all of each of the polymer or macropolymer types of final compounds is enforced (by the communication effected by, for example, linkers) even where the composition of some or all of the polymer or macropolymer types is respectively random.
Preferably, such linkers (which may be multiply branched, each of such branches possibly comprising cleavable groups susceptible to distinct cleaving treatments) are held in communication with some or all of the two or more distinct monomer or macromonomer types (which are added to the compounds under synthesis with distinct and mutually non-interfering addition or polymerization, deprotection and/or activation chemistries, termed "orthogonal" chemistries in the respective art) by attachment to the protecting groups used to effect the stepping of additions of each such multimacromonomer. Said diverse amity labels may be used in conjunction with multiple affinity separation paths and nucleotide label detection that associates the detected said nucleotide label with the resolved location of the respective affinity labeled sample molecule, thus accomplishing the required assignment of detection and discrimination of the appropriate nucleotide label precisely to the correct respective sample molecule. Alternatively, said diverse affinity labels may be added to sample molecules so as to be independently recognizable by appropriate receptor molecules or other affinity means, each complementarity type of which is respectively labeled with some distinct independently perceptible label.
Such labeling methods permit the processing of samples in fluid flow based apparata without the loss of single molecule identifiability or assignability of results.
Also note that manipulation with a laser trap, as for instance described by T.T.
Perkins et al., may be employed with such uniquely labeled molecules.
Note that a case of encoding of particular interest is that of a functional molecule coupled to an informational molecule which is sufficient to direct the synthesis of said functional molecule in an appropriate, (e.g. biological or biological derived) system. Libraries of polypeptides expressed on the surface of, for example, bacteriophages carrying genetic material specifying said polypeptides, have found great use in the in vitro selection of binding specificities. Encoding which may additionally direct synthesis may be availed in the affinity characterization and molecular evolution applications of the present invention. The communication of a synthesis directing informational molecule (favorably DNA or RNA) with the correspondingly synthesized one or more functional molecules (generally a polypeptide) may be effected by the in vivo coupling or otherwise compartmentally enforced unique one-to- one corresponding coupling of said informational and said functional molecule. A particularly convenient instance of such a molecules comprises the fused expression of said functional molecule or molecules as segments of the terminal proteins of the informational molecules (i.e. DNA) of various virus (e.g. adenovirus) or bacteriophage (e.g. PRDI or phi29) genomes.
Alternatively, said functional molecules may be fused with some molecule which associates in a specific manner with said terminal proteins, and which has su~cient opportunity during its in vivo synthesis, without or preferably with concurrent viral or bacteriophage replication, to associate with the terminal protein of the genomic material which determines the composition of said functional molecules, such that upon purification or lysis functional molecules remain in communication with the genetic material that determines their composition. Because biosynthesis of functional and informational moieties may favorably occur within the confines of a single cell, cross-coupling of inappropriate molecules may be readily avoided. Alternatively, the communication between polypeptide and polynucleotide moieties may be effected with some intermediate snRNP or snRNP-like moiety, where such an intermediate moiety may be targeted on the one hand by an appropriate affinity characteristic of one or more polypeptides to which said functional molecules are fused, and on the other hand by a polynucleotide sequence complementary (according to appropriate rules for double-, triple- or quadruple- helix formation) with the polynucleotide moiety of said intermediate snRNP or snRNP-like moiety.
Such complexes comprising an intermediate snRNP or snRNP-like moiety may also favorably be formed within the confines of a single cell.
1.4.9.5 CYBERNETIC MOLECULAR EVOLUTION AND ALGORITHM
MEDIATED CYBERNETIC MOLECULAR EVOLUTION OF
PHENOGENOCOUPLES
Such polynucleotide-polypeptide chimera, or other molecule types comprising thus communicating and informationally corresponding chimera (e.g. where the polypeptide moiety has further been subjected to post-translational modification such as specific glycosylation and has been associated by some method to the respective genetic material determining its composition, for example by the sorting of individual cells carrying said genetic material in the form of a DNA vector with terminal proteins and expressing and processing said polypeptide, into distinct wells or vessels followed by disruption of membranes such that terminal proteins fused with peptides having affinity for the particular polypeptide of interest may come into contact with the processed polypeptide of interest, comprising a method for the molecular evolution of multiple-biopolymer containing macromolecules), which may be termed phenogenocouples, may be used as sample molecules with the broad methods of the present invention to effect the affinity characterization (including either or both equilibrium and kinetic characterization of molecular recognition including catalytic recognition and catalysis) of functional moieties and then the characterization and transcription of informational moieties thus determined to be of interest.
Where algorithms control such a process, cybernetic molecular evolution is embodied.
Selected informational molecules may be selectively replicated or transcribed by activatable (e.g. photodeprotectable and especially 3' hydroxyl photodeprotectable) primers with appropriate complementarity to some region which bounds the informational content specifying said functional molecule or molecules.
Alternatively, immobilization of a sample to be subjected to such manipulations may be effected so as to comprise some photolabile linkage, which may then be subjected to selective photodegradation to effect specific release. For immobilized samples, informational molecules which carry the relevant genetic component of a phenogenocouple may thus be released by either of these methods either singly, or as the population of multiple such molecules simultaneousl" copied or otherwise released according to the pattern of deprotection.
Alternatively, successive generations of molecules need only be related informationally, by analysis of composition of one generation, by, for example, the massively parallel characterization methods of the present invention, followed by de novo synthesis of molecules carrying the desired complexity and diversity of the succeeding generation. This is a particular distinguishing feature of cybernetic molecular evolution; selection, amplification and mutation may be directed strictly by algorithms which manipulate data gathered about one generation to determine the composition of a succeeding generation.
Released molecules may then be recovered for subsequent amplification, mutation and subsequent rounds of selection by similar or other methods, as will be obvious to those skilled in the art of in vitro molecular evolution.
Note that post transcriptionally modified polypeptide moieties or other phenogenocouples may also be selected and otherwise subjected to in vitro evolution by conventional means as well as by the massively parallel examination and modification methods of the present invention.
Because of the correspondence between the diversity generation and selection aspects of molecular evolution, and immunological recognition and memory, all of these methods may be directly applied to cybernetic immune system applications of the present invention.
Labeled reagents and signal amplification and elimination techniques:

The categories enumerated below are included for description and not limitation; other appropriate labeling methods will be obvious to those skilled in the arts of biotechnology, cell biology and cytology, microscopy, organic chemistry, biochemistry or recombinant DNA techniques.
Each category will comprehend a variety of specific variations, as will be obvious to those skilled in the relevant arts. Various labeling methods will generally correspond best to various detection methods.

1.4.10 DETECTION METHODS FOR THE PRESENT INVENTION
Non-radioactive labeling techniques have been explored and, in recent years, integrated into partly automated DNA sequencing procedures. These improvements utilize the Sanger sequencing strategy. The label (e.g. fluorescent dye) can be tagged to the primer (Smith et al., Nature M, 674-679 (1986) and EPO Patent No.
87300998.9; Du Pont De Nemours EPO Application No. 0359225; Ansorge et al., J.
Biochem. Biophys. Methods 13, 325-32 (1986)) or to the chain- terminating dideoxynucloside triphosphates (Prober et al. Science 218, 336-41 (1987);
Applied Biosystems, PCT Application WO 91/05060). Based on either labeling the primer or the ddNTP, systems have been developed by Applied Biosystems (Smith et al., S
cience 23 S, G89 (1987); U. S. Patent Nos. 5 70973 and 689013), Du Pont De Nemours (Prober et al., Science 238, 336-341 (1987); U.S. Patents Nos. 881372 and 57566), Pharmacia-LKB (Ansorge et al., Nucleic Acids Res. 1 l, 4593-4602 (1987) and EMBL Patent Application DE P3 724442 and P3 805 808. 1) and Hitachi (JP I -90844 and DE 4011991 AI). A somewhat similar approach was developed by Brumbaugh et al., (Proc. Nad. Sci. US A85 5610-14 (1988) and U.S. Patent No.
4,729,947). An improved method for the Du Pont system using two electrophoretic lanes with tyvo different specific labels per lane is described (PCT
Application W092/02635). A different approach uses fluorescently labeled avidin and biotin labeled primers. Here, the sequencing ladders ending with biotin are reacted during electrophoresis with the labeled avidin which results in the detection of the individual sequencing bands (Brumbaugh et al., U.S. Patent No. 594676).
More recently even more sensitive non-radioactive labeling techniques for DNA using chemiluminescence triggerable and amplifyable by enzymes have been developed (Beck, OKeefe, Coull and Koster, Nucleic Acids Res. 12, 5115- S 123 (1989) and Beck and Koster, Anal. Chem. Q 2258-2270 (1990)). These labeling methods were combined with multiplex DNA sequencing (Church et al., Science 240, 185-188 (1988) and direct blotting electrophoresis (DBE) (Beck and Pohl, EMBO
I
Vol. 3: p 2905-2909 (1984)) to -provide for a strategy aimed at high throughput DNA
sequencing (Koster et al., Nucleic Acids Res. Symposium Ser. No. 2,4, 318- 321 (1991), University of Utah, PCT Application No. WO 90/15883). However, this strategy still suffers from the disadvantage of being very laborious and difficult to automate.

Multiple distinctly labeled primers can be used to discriminate sequencing patterns. For example, four differently labeled sequencing primers specific for the single termination reactions, e.g. with fluorescent dyes and online detection using laser excitation in an automated sequencing device. The use of eight differently labeled primers allow the discrimination of the sequencing pattern from both strands.
Instead of labeled primers, labeled ddNTP may be used for detection, if separation of the sequencing fragments derived from both strand is provided, With one biotin labeled primer, sequencing fragments from one strand can be isolated for example via biotin-streptavidin coated magnetic beads. Possible is also the isolation via immunoaffinity chromatography in the case of a digoxigenin labeled primer or with affinity chromatography in case of complementary oligonucleotides bound to a solid support.
1.4.10.1 Fluorescent labels In automated sequencing, fluorescence labeled DNA fragments are detected during migration through the sequencing gel by laser excitation. Fluorescence label is incorporated during the sequencing reaction via labeled primers or chain extending nucleotides (Smith, L. et. al., Fluorescence detection in automated DNA
sequence analysis, Nature 321.674-89 1986), (Knight, P., Automated DNA sequencers, Biotechnology 6:1095-96 1988).
Detection methods for the present invention may favorably exploit fluorescent labeling techniques.
Genome sequencing applications of the present invention may thus avail of established fluorescent modification and detection methods. Other applications of the present invention may also benefit from the application of fluorescence modification and detection methods.
Much effort has already been invested in the development of fluorescently labeled nucleotide triphosphate compounds and analogs thereof. Many such compounds are acceptable substrates for polynucleotide polymerase molecules.
These compounds have therefore proven suitable for use in various electrophoresis based DNA sequencing methodologies utilizing fluorescence detection, as well as in other applications such as chromatin mapping. There are therefore various compounds comprising a fluorescent dye moiety and a nucleotide triphosphate moiety commercially available.

Fluorescent labels find use in variety of different biological., chemical., medical and biotechnological applications. One example of where such labels find use is in polynucleotide sequencing, particularly in automated DNA sequencing, which is becoming of critical importance to Iarge scale DNA sequencing projects, such as the Human Genome Project.
In methods of automated DNA sequencing, differently sized fluorescently labeled DNA fragments which terminate at each base in the sequence are enzymatically produced using the DNA to be sequenced as a template. Each group of fragments corresponding to termination at one of the four labeled bases are labeled with the same label. Thus, those fragments terminating in A are labeled with a first label, while those terminating in G, C and T are labeled with second, third and fourth labels respectively. The labeled fragments are then separated by size in an electrophoretic medium and an electropherogram is generated, from which the DNA
sequence is determined.
As methods of automated DNA sequencing have become more advanced, of increasing interest is the use of sets of fluorescent labels in which all of the labels are excited at a common wavelength and yet emit one of four different detectable signals, one for each of the four different bases. Such labels provide for a number of advantages, including high fluorescence signals and the ability to electrophoretically separate all of the labeled fragments in a single lane of an electrophoretic medium which avoids problems associated with lane to lane mobility variation.
Although such sets of labels have been developed for use in automated DNA
sequencing applications, heretofore the differently labeled members of such sets have each emitted at a different wavelength. Thus, conventional automated detection devices currently employed in methods in which all of the enzymatically produced fragments or primer extension products are separated in the same lane must be able to detect emitted fluorescent light at four different wavelengths. This requirement can prove to be an undesirable limitation. More specifically, carrying out sequencing on vast numbers of different DNA templates simultaneously increases the number of different fragments and corresponding labels required. At the same time, there is a need for a reduction in the complexity of the detection device, e.g. a device which can operate with light detection at only two wavelengths is preferable.

Sets of fluorescent labels, particularly sets of fluorescently labeled primers, and methods for their use in mufti component analysis applications, particularly nucleic acid enzymatic sequencing applications, are provided. At least two of the label members of the set are energy transfer labels having a common donor and acceptor fluorophore separated by sufficiently different distances so that the two labels provide distinguishable fluorescent signals upon excitation at a common wavelength. In further describing the subject invention, the subject sets will first be described in greater detail followed by a discussion of methods for their use in mufti component analysis applications.
Before the subject invention is further described, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims.
It must be noted that as used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural reference unless the context clearly dictates otherwise. Unless defined otherwise all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.
The subject sets of fluorescent labels comprise a plurality of different types of labels, wherein each type of label in a given set is capable of producing a distinguishable fluorescent signal from that of the other types of labels in different sets. Labels in the different sets generate different signals, preferably, though not necessarily upon excitation at a common excitation wavelength. For DNA
sequencing applications, the subject sets will comprise at least 2 different types of labels, and may comprise 8 or more different types of labels, where for many applications the number of different types of labels in the set will not exceed 6, and will usually not exceed four, where at least two of the different types of labels are energy transfer labels sharing a common donor and acceptor fluorescer, as described in greater detail below.
For other applications, such as fluorescence in situ hybridization (FISIT), substantially more than 8 labels are ideal so that multiple targets can be analyzed.

The distinguishable signals generated by the "at least two energy transfer labels" will at least comprise the intensity of emitted light at one to two wavelengths.
Preferably, the distinguishable signals produced by the "at least two energy transfer labels" will comprise distinguishable fluorescence emission patterns, which patterns are generated by plotting the intensity of emitted light from differently sized fragments at two wavelengths with respect to time as differently labeled fragments move relative to a detector, which patterns are known in the art as electropherograms.
For analyses not based on electrophoresis, such as micro- array chip based assays, different targets tagged with a specific label can be differentiated from each other by the unique fluorescence patterns. For example, in one type of label of a set the intensity of emitted light at a first wavelength may be twice that of the intensity of emitted light at a second wavelength and in the second label the magnitude of the intensities of light emitted at the two wavelengths may be reversed, or light may be emitted at only one intensity. The different patterns are generated by varying the distance between the donor and acceptor. These patterns emitted from each of these labels are thus distinguishable.
The subject sets will comprise a plurality of different types of fluorescent labels, where at least two of the labels and usually all of the labels are energy transfer labels which comprise at least one acceptor fluorophore and at least one donor fluorophore in energy transfer relationship, where such labels may have more complex configurations, such as multiple donors and/or multiple acceptors, e.g. donor l, acceptor I and acceptor 2. Critical to the subject sets is that at least two of the labels of the sets have common donor and accceptor fluorophores, where the only difference between the labels is the distance between these common acceptor and donor fluorophores. Thus, for sets of labels in which each label comprises a single donor and a single acceptor, at least one of the energy transfer labels will have a donor fluorophore and acceptor fluorophore in energy transfer relationship separated by a distance x and at least one of the energy transfer labels will comprise the same donor and acceptor fluorophores in energy transfer relationship separated by a different distance y, where the distances x and y are sufficiently different to provide for distinguishable fluorescence emission patterns upon excitation at a common wavelength, as described above.

In those sets comprising a third label having the same donor and acceptor fluorophores as the first and second label, the distance z between the donor and acceptor fluorophore will be sufficiently different from x and y to ensure that the third label is capable of providing a distinguishable fluorescence emission pattern from the first and second labels. Thus, in a particular set of labels, one may have a plurality of labels having the same donor and acceptor fluorophores, where the only difference among the labels is the distance between the donor and acceptor fluorophores.
To ensure that different types of labels of a set having common donor and acceptor fluorophores yield distinguishable fluorescence emission patterns, the distances between the donor and acceptor fluorophores will differ by at least about 5 %, usually by at least about 10 % and more usually by at least about 20 % and will generally range from about from about 4 to 200 ~ , usually from about 12 to 100 ~ and more usually from about 15 to 80 ~, where the minimums in such distances are determined based on currently available detection devices and may be reduced as detection technology becomes more sensitive, therefore more distinct labels can be generated.
In one preferred embodiment, at least a portion of, up to and including all of, the labels of the subject sets will comprise a donor and acceptor fluoresces component in energy transfer relationship and covalently bonded to a spacer component, i.e.
energy transfer labels. Thus, one could have a set of a plurality of labels in which only two of the labels comprise the above mentioned donor and acceptor fluoresces components and the remainder of the labels comprise a single fluoresces component.
Preferably, however, all of the labels will comprise a donor and acceptor fluoresces component. Generally, for one donor and one acceptor ET systems, if a set comprises n types of energy transfer labels, the number of different types of acceptor fluorophores present in the energy transfer labels of the set will not exceed n- 1. Thus, if the number of different types of energy transfer labels in the set is four, the number of different acceptor fluorophores in the set will not exceed 3, and will usually not exceed 2.
In other preferred embodiments, additional combinations of labels are possible. Thus, in a set of labels, two of the labels could be energy transfer labels sharing common donor and acceptor fluorophores separated by different distances and the remaining labels could be additional energy transfer labels with different donor and/or acceptor fluorophores, non-energy transfer fluorescent labels, and the like.

In the energy transfer labels of the subject sets, the spacer component to which the fluorescer components are covalently bound will typically be a polymeric chain or other chemical moiety capable of acting as a spacer for the donor and acceptor fluorophore components, such as a rigid chemical moiety, such as chemicals with cyclic ring or chain structures which can separate the donor and acceptor and which also can be incorporated with an active group for attaching to the targets to be analyzed, where the spacer component will generally be a polymeric chain, where the fluorescer components are covalently bonded through linking groups to monomeric units of the chain, where these monomeric units of the chain are separated by a plurality of monomeric units sufficient so that energy transfer can occur from the donor to acceptor fluorescer components. The polymeric chains will generally be either polynucleotides, analogues or mimetics thereof , or peptides, peptide analogues or mimetics thereof, e.g. peptoids. For polynucleotides, polynucleotide analogues or mimetics thereof, the polymeric chain will generally comprise sugar moieties which may or may not be covalently bonded to a heterocyclic nitrogenous base, e.g.
adenine, guanine, cytosine, thymine, uracil etc., and are linked by a linking group.
The sugar moieties will generally be five membered rings, e.g. ribose, or six membered rings, e.
g. hexose, with five membered rings such as ribose being preferred. A number of different sugar linking groups may be employed, where illustrative linking groups include phosphodiester, phosphorothioate, methylene(methyl imino)(MMI), methophosphonate, phosphoramadite, guanidine, and the like. See Matteucci &
Wagner, Nature (1996) Supp 84: 20-22. Peptide, peptide analogues and mimetics thereof suitable for use as the polymeric spacer include peptoids as described in WO
91119735, the disclosure of which is herein incorporated by reference, where the individual monomeric units which are joined through amide bonds may or may not be bonded to a heterocyclic nitrogenous base, e.g, peptide nucleic acids. See Matteucci &
Wagner supra. Generally, the polymeric spacer components of the subject labels will be peptide nucleic acid, polysugarphosphate as found in energy transfer cassettes as described in PCT/LJS96/13134, the disclosure of which is herein incorporated by reference, and polynucleotides as described in PCT/US95/01205, the disclosure of which is herein incorporated by reference.
Both the donor and acceptor fluorescer components of the subject labels will be covalently bonded to the spacer component, e.g. the polymeric spacer chain, through a linking group. The linking group can be varied widely and is not critical to this invention. The linking groups may be aliphatic, alicyclic, aromatic or heterocyclic, or combinations thereof. Functionalities or heteroatoms which may be present in the linking group include oxygen, nitrogen, sulfur, or the like, where the heteroatom functionality which may be present is oxy, oxo, thio, thiono, amino, amido and the like. Any of a variety of the linleing groups may be employed which do not interfere with the energy transfer and gel electrophoresis, which may include purines or pyrimidines, particularly uridine, thymidine, cytosine, where substitution will be at an annular member, particularly carbon, or a side chain, e.g.
methyl in thymidine. The donor andlor fluorescer component may be bonded directly to a base or through a linking group of from 1 to 6, more usually from 1 to 3 atoms, particularly carbon atoms. 'The linking group may be saturated or unsaturated, usually having not more than about one site of aliphatic unsaturation.
Though not absolutely necessarily, generally for DNA sequencing applications at least one of the donor and acceptor fluorescer components will be linked to a terminus of the polymeric spacer chain, where usually the donor fluorescer component will be bonded to the terminus of the chain, and the acceptor fluorescer component bonded to a monomeric unit internal to the chain. For labels comprising polynucleotides, analogues or mimetics thereof as the polymeric chain, the donor fluorescer component will generally be at the 5' terminus of the polymeric chain and the acceptor fluorescer component will be bonded to the polymeric chain at a position 3' position to the 5' terminus of the chain. For other applications, such as FISH, a variety of labeling approaches are possible.
The donor fluorescer components will generally be compounds which absorb in the range of about 300 to 900 nrn, usually in the range of about 350 to 800 nm, and are capable of transferring energy to the acceptor fluorescer component. The donor component will have a strong molar absorbance co-eff dent at the desired excitation wavelength, desirably greater than about 104 preferably greater than about 105 cm iM~
1 . The molecular weight of the donor component will usually be less than about 2.0 kD, more usually less than about 1.5 kD. A variety of compounds may be employed as donor fluorescer components, including fluorescein, phycoerythrin, BODIPY, DAPI, Indo-1, cournarin, dansyl, cyanine dyes, and the like. Specific donor compounds of interest include fluorescein, rhodamine, cyanine dyes and the like.

Although the donor and acceptor fluoresces component may be the same, e. g both may be FAM, where they are different the acceptor fluoresces moiety will generally absorb light at a wavelength which is usually at least 10 nm higher, more usually at least 20 nm or higher, than the maximum absorbance wavelength of the donor, and will have a fluorescence emission maximum at a wavelength ranging from about 400 to 900 run. As with the donor component, the acceptor fluoresces component will have a molecular weight of less than about 2.0 kD, usually less than about 1.5 kD. Acceptor fluoresces moieties may be rhodamines, fluorescein derivatives, BODIPY and cyanine dyes and the like. Specifc acceptor fluoresces moieties include FAM, JOE, TAM, ROX, BODIPY and cyanine dyes.
The distance between the donor and acceptor fluoresces components will be chosen to provide for energy transfer from the donor to acceptor fluoresces, where the efficiency of energy transfer will be from 20 to 100 %. Depending on the donor and acceptor fluoresces components, the distance between the two will generally range from 4 to 200 ~, usually from 12 to 100A and more usually from 15 to 80 ~, as described above.
For the most part the labels of the subject sets will be described by the following formula:
D-N-X
A
wherein: D is the donor fluoresces component, which may consist of more than two different donors separated by a spacer;
N is the spacer component, which may be a polymeric chain or rigid chemical moiety, where when N is a polymeric spacer that comprises nucleotides, analogues or mimetics thereof, the number of monomeric units in N will generally range from about 1 to 50, usually from about 4 to 20 and more usually from about 4 to 16;
A is the acceptor fluoresces component, which may consist of more than two different acceptors separated by a spacer; and X is optional and is generally present when the labels are incorporated into oligonucleotide primers, where X is a functionality, e.g an activated phosphate group, for linking to a mono- or polynucleotide, analogue or mimetic thereof, particularly a deoxyribonucleotide, generally of from 1 to 50, more usually from 1 to 25 nucleotides.
For sets to be employed in nucleic acid enzymatic sequencing in which the labels are to be employed as primers, the labels of the subject sets will comprise either the donor and acceptor fluoresces components attached directly to a hybridizing polymeric backbone, e.g. a polynucleotide, peptide nucleic acid and the like, or the donor and acceptor fluoresces components will be present in an energy transfer cassette attached to a hybridizable component, where the energy transfer cassette comprises the fluoresces components attached to a non-hybridizing polymeric backbone, e.g. a universal spacer. See PCT/LJS96/13134 and Ju et al., Nat.
Med.
(1996) supra, the disclosures of which are herein incorporated by reference.
The hybridizable component will typically comprise from about 8 to 40, more usually from about 8 to 25 nucleotides, where the hybridizable component will generally be complementary to various commercially available vector sequences such that during use, synthesis proceeds from the vector into the cloned sequence. The vectors may include single-stranded filamentous bacteriophage vectors, the bacteriophage lambda vector, pUC vectors, pGEM vectors, or the like. Conveniently, the primer may be derived from a universal primer, such as pUC/M13, g t I O, gtl 1, and the like, (See Sambrook et al., Molecular Cloning: A Laboratory Manual., 2nd ed., CSHL, 1989, Section 13), where the universal primer will have been modified as described above, e.g. by either directly attaching the donor and acceptor fluoresces components to bases of the primer or by attaching an energy transfer cassette comprising the fluoresces components to the primer.
Sets of preferred energy transfer labels comprising donor and acceptor fluorescers covalently attached to a polynucleotide backbone in the above D-N-A
format include: (1) F6R, F 13R, F16R and F16F; where different formats can employed as long as the four primers display distinct fluorescence emission patterns.
The fluorescent labels of the subject sets can be readily synthesized according to known methods, where the subject labels will generally be synthesized by oligomerizing monomeric units of the polymeric chain of the label, where certain of the monomeric units will be covalently attached to a fluoresces component.
The subject sets of fluorescent labels find use in applications where at least two components of a sample or mixture of components are to be distinguishably detected. In such applications, the set will be combined with the sample comprising the to be detected components under conditions in which at least two of the components of the sample if present at all will be labeled with first and second labels of the set, where the first and second labels of the set comprise the same donor and acceptor fluorescer components which are separated by different distances.
Thus, a first component of the sample is labeled with a first label of the set comprising donor and acceptor fluorescer components separated by a first distance X. A second component of the sample is labeled with a second label comprising the same donor and fluorescer components separated by a second distance Y, where X and Y are as described above. The labeled first and second components, which may or may not have been separated from the remaining components of the sample, are then irradiated by light at a wavelength capable of a being absorbed by the donor fluorescer components, generally at a wavelength which is maximally absorbed by the donor fluorescer components. Irradiation of the labeled components results in the generation of distinguishable fluorescence emission patterns from the labeled components, a first fluorescence emission pattern generated by the first label and second pattern being attributable to the second label. The distinguishable fluorescence emission patterns are then detected. Applications in which the subject labels find use include a variety of multicomponent analysis applications in which fluorescent labels are employed, including FISH, micro-array chip based assays where the labels may be used as probes which specifically bind to target components, DNA sequencing where the labels may be present as primers, and the like.
The subject sets of labels find particular use in polynucleotide enzymatic sequencing applications, where four different sets of differently sized polynucleotide fragments terminating at a different base are generated (with the members of each set terminating at the same base) and one wishes to distinguish the sets of fragments from each other. In such applications, the sets will generally comprise four different labels which are capable of acting as primers for enzymatic extension, where at least two of the labels will be energy transfer labels comprising differently spaced common donor and acceptor fluorescer components that are capable of generating distinguishable fluorescence emission patterns upon excitation at a common wavelength of light.
Using methods known in the art, a first set of primer extension products all ending in A will be generated by using a first of the labels of the set as a primer.
Second, third and fourth sets of primer extension products terminating in G, C and T will be also be enzymatically produced. The four different sets of primer extension products will then be combined and size separated, usually in an electrophoretic medium. The separated fragments will then be moved relative to a detector (where usually either the fragments or the detector will be stationary). The intensity of emitted light from each labeled fragment as it passes relative to the detector will be plotted as a function of time, i.e. an electropherogram will be produced. Since, the labels of the subject sets will generally emit light in only two wavelengths, the plotted electropherogram will comprise light emitted in two wavelengths. Each peak in the electropherogram will correspond to a particular type of primer extension product (i.e. A, G, C or T), where each peak will comprise one of four different fluorescence emission patterns.
To determine the DNA sequence, the electropherogram will be read, with each different fluorescence emission pattern related to one of the four different bases in the DNA
chain.
Where desired, two sets of labels according to the subject invention may be employed, where the distinguishable fluorescence emission patterns produced by the labels in the first set will comprise emissions at a first and second wavelength and the patterns produced by the second set of labels will comprise emissions at a third and fourth wavelength. By using two such sets in conjunction with one another, one could detect primer extension products produced from two different template DNA
strands at essentially the same time in a conventional four color detector, thereby doubling the throughput of the detector.
The subject sets of labels may be sold in kits, where the kits may or may not comprise additional reagents or components necessary for the particular application in which the label set is to be employed. Thus, for sequencing applications, the subject sets may be sold in a kit which further comprises one or more of the additional requisite sequencing reagents, such as polymerase, nucleotides, dideoxymicleotides and the like.
The following examples are offered by way of illustration and not by way of limitation. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject sets of fluorescent labels.

1.4.10.2 Affinity labels Other single molecule detection methods have availed of compounds having well studied affinity interactions with other molecules, such as receptor-ligand interactions.
Genome sequencing applications of the present invention may thus avail of established affinity labeling and detection methods. Other applications of the present invention my also benefit from the application of affinity labeling and detection methods.
Various compounds comprising a nucleotide triphosphate moiety and a small molecule affinity moiety are commercially available and suitable as substrates for DNA polymerases. Said compounds have been used, in conjunction with DNA
polymerases, to effect the affinity labeling of various polynucleotide molecules, and thus labeled polynucleotides are routinely subjected to manipulations comprising the formation of an affinity association with an appropriate receptor molecule.
Two common examples are the use of biotin as said affinity moiety and streptavidin as said receptor molecule, and digoxigenin as said affinity moiety and anti-digoxigenin antibodies or fragments thereof as the respective said receptor molecule. it will be obvious to those skilled in the relevant arts that there are numerous other possible ligand-receptor interactions which may be exploited for afFnity labeling purposes as well as immobilization purposes of the present invention, and that multiple distinct affinity interactions may be employed simultaneously.
For detection purposes, said affinity labels may be used to bind a microscopic colloid or bead which has been modified with an appropriate complementary affinity group such as a receptor.
1.4.10.1 Affinity Label Detection With Microscopic Beads In recent years a number of different methods and materials have been developed to permit the affinity binding of beads to molecules. Such binding is commonly accomplished by coating said beads with receptor molecules, such as streptavidin or Protein A (also known as Staph A, to which immunoglobulin G
antibodies may subsequently be bound). Bead types include polymeric spheres of micron or submicron dimensions, metallic colloids such as colloidal gold, silica beads and magnetic beads. As will be obvious to those skilled in the art of polymer chemistry, polymer beads including dendrimers may incorporate dyes or liquid crystal molecules as side chains or within polymeric backbones, and these may facilitate optical detection methods. Attachment of appropriate receptor or affinity molecules to the surfaces of such beads yields a reagent suitable for the detection of an affinity labeled molecule. One such detection scheme was utilized by Finzi and Gelles, albeit for different purposes.
1.4.10.3 Multimeric labels:
Where sensitivity to a single labeling moiety is insufficient, labeled reagents may comprise multiple occurrences of said labeling moiety in a manner that does not interfere with the corresponding molecular recognition and monomer addition processes, to increase the likelihood of correct signal amplification of any labeled molecule. For example, the ordinary single biotin moiety attached to a nucleotide by a linker may be replaced with a polymer having multiple biotin moieties as side chains, such that the likelihood of a streptavidin molecule interacting with this multimeric affinity label is increased. Fluorescent labels may similarly multiplied, as may any other labeling moieties. Measures must be taken in the design and synthesis of such multimerically labeled reagents to ensure that solubility is retained. This may be accomplished by choosing a highly soluble polymer as the backbone carrying said labeling moieties comprising the multimeric label.
1.4.10.4 Polymerization nucleating labels:
Any compound capable of serving as an initiator for some aqueous polymerization may also serve as a labeling moiety. This initiator nucleates the formation of a perceptible polymer attached to the sample molecule. Such a polymer, may, for example, comprise multiple fluorescent moieties, or simple effect a local change in transmitance of light or a local change of refractive index. After detection has been accomplished, said perceptible polymer is degraded or otherwise removed from the sample molecule. Such polymerizations may be self limiting, as is the case for some dendrimeric polymers.
For this label detection methodology, polymerization is caused to occur in a step after the labeled nucleotide is added to the sample molecule, and must proceed via a chemistry that leaves the sample molecule in tact. Degradation or removal of said perceptible polymer must also leave the sample molecule in tact. Subject to the above stated limitation, any polymer and respective detection method may be employed.
1.4.10.5 Enzymatic labels and conjugates thereof 1.4.10.5.1 Photochemical labeling Various methods have been developed for the photochemical labeling of molecules and especially biological macromolecules. These include detection of affinity labels such as biotin with conjugates of streptavidin and an appropriate enzyme capable of catalysing the formation of a chromophore from a chromophorigenic substrate, or capable of catalysing a photon liberating chemical reaction, as with the enzyme luciferase. Such photochemical labeling methods will be readily applicable as detection methods for various embodiments of the present invention.
Note that multimeric affinity labels accessible for simultaneous association with multiple such enzymes will enable greater signal amplification, as will secondary enzyme amplification techniques and other techniques known within the molecular biological and microscopic arts.
1.4.10.5.2 Cleavable linkers Labeling moieties are favorably in communication with or coupled to nucleotides via a linker of sufficient length to ensure that the presence of said labeling moieties on said nucleotides will not interfere with the action of a polymerase enzyme on said nucleotides. Linkers will also necessarily be of some minimal length when stepping control is effected through the use of various preformed enzyme-nucleotide complexes (as described below). Once a nucleotide has been added by polymerization to (the daughter strand of) a sample molecule, and the accompanying label has been detected, proper detection and discrimination of subsequent nucleotides requires the elimination of said accompanying label. This may favorably be accomplished through the cleavage of said linkers which have been designed and synthesized to admit of cleavage by treatments which will not degrade or otherwise modify the relevant state or information content of sample molecules.
Cleavability may be provided for in a number of ways which will be obvious to those skilled in the arts of organic and synthetic chemistry. For example, said linker may include along its length one or more ester linkages, which will be susceptible to hydrolysis, which may be sufficiently mild for various ester functional groups. Amide linkages may similarly be employed. Linkages comprising disulfide bonds within their length have been developed to provide for cleavability;
reagents comprising such linkages are commercially available and have been used to modify nucleotides in a manner which may be conveniently reversed by treatment with mild reducing agents such as dithiothreitol. Cieavable linkages may be provided so as to minimize the portion of the linker which remains on the sample molecule.
Because polymerases are relatively tolerant of linkers which may extend from various atoms of nucleotide molecules, it is not, however, critical that all of said linkers be cleaved away from the nucleotides incorporated into said sample molecules in the process of label removal.
Note that commercially available biotin derived nucleotides frequently contain, along the linker joining said biotin moiety to said nucleotide moiety, one or more ester or amide bonds, which is susceptible to cleavage by various chemical treatments.
Note also that for linkers comprising appropriate bonds along their length, enzymatic cleavage may be performed.
1.4.10.5.3 Dissociative cleavage:
Note that cleavage of a labeling moiety may also be effected by the disruption of some affinity interaction which effects the communication between said labeling moiety and the nucleotide moiety. In such cases, moieties joined by non-covalent associations may, for example, be dissociated by physical or chemical changes which do not necessarily cleave covalent bonds.
Photocleavable moieties may also comprise an intermediate portion of linkers joining labeling moieties to nucleotide moieties, such that upon photocleavage of said photocleavable moieties, communication between the termini of said linker is disrupted and the label moiety is liberated from the nucleotide moiety.
Because photodeprotection or photocleavage reactions generally proceed quite rapidly, with appropriate detection and photoexcitation means, detection, label removal and nucleotide incorporation rates per sample molecule may approach the limit imposed by any particular polymerase enzyme and the processivity of said enzyme. Long linkers with photocleavable termini have been synthesized.
Similarly, compounds which thermally degrade into two or more portions may comprise an intermediate portion of such linkers, such that thermal cycling may be employed to effect linker cleavage. Thermostable polymerases may be conveniently employed in embodiments availing thermolabile linkers.
1.4.10.5.4 Photomodification Single dye molecule photobleaching has been directly observed. Fluorescent labels of nucleotides, particularly when only one or a small number of such moieties are used for labeling, may be neutralized by photobleaching, such that while some product of said fluorescent label may remain in communication with the sample molecule ~(e.g. the daughter strand of a polynucleotide being sequenced) it will no longer provide a signal sufficiently strong to interfere with the detection and discrimination of subsequently added labels.
Beyond photobleaching of fluorescent labels, affinity labels with appropriate photochemical properties may be subjected to photochemical modification rendering them inert to binding, generally subsequent to dissociation of the corresponding receptor by appropriate means.
For affinity labels, fluorescent labels or any other labeling moieties, chemical modification appropriate to the chemistries of said labels which effects a change or reduction in the detectable signal provided by said label may be availed to prevent interference of said labels with similar or distinct labels subsequently added to sample molecules or complexes thereof.
1.4.10.5.5 Labeling with activation and thermodynamic decay:
Compounds such as spirobenzopyran, which have labile, structurally and photochemically distinct but interconvertible isomers, may be used as labeling moieties. Here, an excited state of such a moiety may be used as a means of detection.
After said detection has been successfully effected, chemical modification of one or another state of such interconvertible molecules may then neutralize it.
Alternatively, activation may cause such a label to convert to some unstable but discernible state, which then irreversibly degrades according to characterizable kinetics. Such molecules must be chosen so as to remain in said discernible state for a sufFcient time period to permit detection, but reliably degrade (to completion for a population of such molecules) within a practical time period.
1.4.10.5.6 Binding reaction inhibition detection methods:
Agents which specifically inhibit binding reactions may be identified rapidly through the detection of molecules, of a diverse library each molecular species of which is uniquely labeled, not bound by particles some sample which may comprise many different species, in the presence test reagent, which is labeled, and permitted to associate with said sample' (preferably during a preincubation step before the addition of said diverse library to said sample,) in analogy to blocking antibody assays.
Results are compared to those obtained with an aliquot of said diverse library and another portion of the same said sample. Such an assay may be performed for increasing concentrations of said test reagent.
1.4.10.5.7 Enzymatically enforced associations at defined molecular sites:
Methods are provided to enforce highly specific associations and reactions, including molecular recognition processes, on individual sample molecules or on populations and subpopulations of sample molecules. These are described for genome sequencing applications, but the methods included thereunder have broad applicability, including to any molecular affinity interaction.
1.4.10.5.8 Enzymatically enforced template directed copolymer addition at defined site:
Controlled comonomer addition Various methods may be used to accomplish the controlled addition of monomers, including nucleotides and especially labeled or protected nucleotides, to the daughter strand of a sample template molecule.
1.4.10.6 Rate control or accommodation:
Means of slowing the time required for the addition of a single nucleotide to a sample molecule will circumvent the requirement of stepping control. This will be particularly applicable for detection mechanisms not requiring separate manipulation steps (such as the separate association of beads to affinity labeled sample molecules).
For example, the four nucleotides, each respectively labeled with unique, removable or neutralizable fluorescent labels, may be added to appropriately primed sample template molecules in the presence of polymerases, at low concentrations. Said concentrations must be sufficiently low that two nucleotides are not added to the sample molecule in less than the time required to accomplish the detection of the first such addition. Because all labels are present in the observation field, detection is accomplished through the observation of the reduction of the Brownian motion of a fluorescent moiety due to its addition to the sample molecule, in close analogy to the experiments of Finzi and Gelles, but it will be noted that the change in mobility is much larger in the present case. Alternatively detection may be understood to depend on an increase in the net residence of some fluorescent moiety within a defined region or the occupancy of said a region, above the occupancy arising from the background of unbound labeled nucleotides.
Such detection is preferably conducted with a scanning excitation beat fluorescence confocal microscopic method as described above, or with a scanning detection light path, as also described above. Conditions (particularly nucleotide concentration) are chosen such that on average less than one labeled nucleotide will be present within the area illuminated by such a beam or thus observed, so that a light pulse of appropriate frequency passing through, for example, the pinhole which effects the scanning of the excitation beam, may be used to photobleach or photocleave the fluorescent label from the sample molecule after it has been detected to have been added to the sample molecule, without the appreciable accumulation of incidentally unlabeled nucleotides. Alternatively, an SLM may be used to spatially control illumination of the sample by an appropriate frequency of light to effect photochemical unlabeling, and thus permit the simultaneous unlabeling of multiple sample molecules.
This method may be understood as concentration modulated control of the kinetics of polymerization processivity, which is used to facilitate direct observation of successive addition of individual (labeled) nucleotides, with controlled unlabeling.
Scanning rate and other instrumentation dependent parameters will influence optimal conditions and concentrations. Thus, direct observation of the addition of comonomers is dynamically observed, and sequence information for the respective sample molecule may be reconstructed accordingly.
1.4.10.7 Stepping control by equilibrium means:
A simple method to effect adequate stepping control for sequencing applications of the present invention relies on equilibrium control. In this method, nucleotides (which are labeled) are limiting, and there is a relative excess.of sample molecules. Exonuclease activity intrinsic to most polynucleotide polymerises is circumvented by the use of alpha- phosphorothioate nucleotides (which are appropriately labeled) which are resistant to such degradation, in this method. Other nucleotide derivatives or analogs suitable as substrates for polymerises and yielding exonuclease resistant polynucleotides may likewise be employed.

As an example of equilibrium controlled stepping, a thirty-three-fold excess of sample molecules relative to labeled complementary nucleotides per cycle may be chosen. Polymerase molecules are preferably provided in excess of sample template molecules. Each sample molecule has a three percent chance of undergoing a single nucleotide addition. Nucleotides are rapidly depleted. Any sample molecule which has undergone one nucleotide addition has a further three percent chance, or in total approximately a 0.1 % chance of undergoing a second nucleotide addition. For a sequencing segment run of 20 bases per sample molecule, each segment will experience an error contribution of (20)(0.1 %) or 2% from multiple additions within a cycle. Such erroneous segment data will be conspicuous when oversamplIng is performed due to the correspondingly low frequency with which it occurs.
Alternatively, for tenfold excess of sample molecules with respect to labeled complementary nucleotides, there is a 1 % chance per base of multiple additions to the same molecule, or, again for sequencing runs of bases, a 20% chance that a segment experiences at least one duplicate addition event. For five-fold oversampling, the binomial distribution indicates that there is approximately a 94.2% chance that three or more segments including a particular base contain correct data regarding that base.
Any specific individual data error is highly unlikely to occur more than once for fivefold oversampling. Note that in practice such calculations will also have to account for label amplification error and label detection error, but these error contributions should be susceptible to reduction to manageably low levels.
More generally, for a ratio x of nucleotide molecules to sample template molecules with a complementary base properly located relative to the primer, for x<lthere is a probability p equal to x that a particular sample molecule will experience the addition of at least one nucleotide and a probability pk that any sample molecule will experience at least k nucleotide additions within the same sequencing cycle. Multiple nucleotide additions to a sample molecule within the same sequencing cycle will result in erroneous sequence information being obtained from said sample molecule. The probability (d) of such a multiple incorporation error occurring within the sequence segment data obtained from a particular sample molecule in a sequencing run of n bases will be less than 2(n)(p2). The net sequence information per sample molecule obtained per sequencing cycle will be x bases, and the net sequence information for a sample with N molecules will be (x)(I~
bases, which will be Iarge for Iarge N. For example, with x=. 03 and N=3.3x101°, there will be a net raw data accumulation of approximately 109 bases per cycle, which, with one-hundred-fold oversampling (i.e. due to each sequence being represented 100 times in the sample) will yield 10' bases of data per cycle; for a desired segment length of n=15 bases, n/x=(15)/(.03) or approximately 500 sequencing cycles will be required per run, and the run will yield 1.5x108 bases of information. For polymerase fidelity of 95% (an extremely low value chosen for purposes of illustration) there will be a 5% error rate (e) per base or a segment error rate of (n)(e)=75% per molecule, but the probability of two erroneous sequence segments having identical sequences will be e2(1-e)°-I for segments with a single base error, which will be the most frequent error species. For this example, this yields a 0.12% frequency. Methods similar to those used to determine consensus sequences may thus be employed to obtain highly accurate data in spite of less than perfect polymerization fidelity. Thus, fidelity error components will be negligible compared to multiple base incorporation errors.
For this example, multiple base incorporation error components will yield an error rate of less than (2)(15)(.03)a or about 3% per molecule. Again, oversampling will readily detect such errors, which will occur identically for two molecules with only d2=(.03)2 or less than 0.1 % probability, yielding a far lower error rate for over sampled data.
1.4.10.8 Stepping control by removable protecting groups:
Stepping control may favorably be applied to any polymerization process useful within the scope of the present invention, including both genome sequencing and amity characterization applications.
Template directed polymerization depends on the processive addition of comonomers at the terminus of a growing daughter strand as specified by the respective complementary base of the parent template strand. Complementarity may be enforced through molecular recognition of said complementarity of protected analogs of said comonomers with the appropriate base of a template molecule, by the action upon such protected comonomers of appropriate polymerase enzymes.
Numerous monomers which may thus be added but do not provide an appropriate chemical functional group for subsequent elongation of the polynucleotide strand to which they have been enzymatically added are known within the relevant arts, and are generally referred to as chain terminators. Any such terminators which may be chemically or photochemically modified, particularly in a rilanner not disrupting the sample molecule, to a form which may support subsequent addition of comonomers in the usual manner, may be employed to effect controlled stepping of polymerization addition.
Removable protecting groups are particularly advantageous for the genome sequencing applications of the present invention because they may be utilized to permit and ensure that exactly one nucleotide is added to a sample molecule per sequencing cycle. This will permit an even greater rate of data accumulation than may be achieved by equilibrium control methods, with which only a fraction of the sample molecule population per cycle yields data.
Photoremovable protecting groups may be used to gain similar advantage but further permit controlled spatial localization of deprotection. Examples of such nucleosides have been prepared.31 Because photodeprotection reactions generally proceed rapidly, with appropriate detection and photoexcitation means, processivity and nucleotide incorporation rates per sample molecule may approach the limit imposed by any particular polymerase enzyme.
Nucleotide analogs comprising such removable protecting groups preferably further comprise labeling moieties. A particularly convenient category of such compounds comprises a labeling moiety or multimer thereof in communication with the nucleotide moiety exclusively through said removable protecting group. For such compounds, removal of said removable protecting group will simultaneously effect removal of said labeling moiety. Simultaneous removal of both protecting moiety and labeling moiety will conveniently prepare a sample molecule for the next sequencing cycle in a single step.
Enzymological evidence concerning binding of 3' acetate esterified nucleotides and 5'-triphosphate-3'-(nucleoside-5'-monophosphate) to the triphosphate binding site of E. coli Polymerase I supports the acceptability of 3' modified nucleotides as substrates for this enzyme. Such protecting groups should therefore be compatible with either naturally occurring or genetically modified polymerases.
Note that in other applications of the present invention, primers comprising a photodeprotectable 3' hydroxyl terminus (which may be synthesized by the polymerization of an appropriate 3' protected nucleotide onto the unprotected 3' hydroxyl of an oligo- or poly-nucleotide, for instance, by the action of terminal deoxynucleotidyl transferase) may provide for the selective polymerization of a polynucleotide moiety selectable by control over illumination of the appropriate region of the sample. A polynucleotide moiety to which such a primer is hybridized and then selectively deprotected may thus be subjected to amplification techniques such as PCR in a selectable manner. Such modified primers shall simply be referred to as photoactivatable primers.
The 3' deprotectable nucleotides employed in some variations on the present invention may also find other uses in molecular biology and biotechnology.
They may be used as chain terminators in conventional enzymatic sequencing methods. If such manipulations are performed, any species terminating in a particular base may be extracted from the resolution medium (conventionally polyacrylamide gel), deprotected and then subjected to other manipulations requiring an active 3' hydroxyl group, such as ligation.

1.4.10.9 Enzyme adaptation to specific substrates:
The emergence of resistance to chain terminating nucleotide analogs by various viral polynucleotide polymerases suggests a convenient method for the in vitro evolution of polymerases capable of using reversibly 3' protected nucleotide analogs, or nucleotide analogs which otherwise serve as chain terminators which may be reactively modified to form an elongation competent molecule after incorporation into a polvnucleotide. Further selection constraints may be concurrently or subsequently applied to fidelity, as the inclusion of non-sense condons in the coding region of a dominant lethal protein coding gene which is carried by the same genetic material carrying the polymerase gene under selection, such that misreading of the non-sense codon, by the polymerase under selection, will effect lethality to the host and thus select against low-fidelity polymerases.
As stated above, such deprotectable compounds may serve as a convenient stepping control means for polymerization. Included among such deprotectable nucleotides are nucleotides with photocleavable protecting groups, including those which reside on the 3' hydroxyl of a nucleotide.
1.4.10.10 Label encoding and labeling methods for data collection:
Various systems may be used to represent the data corresponding to the occurrence of an affinity interaction. The complexity required of such a representational system will be determined by the types of molecules and associations being examined and the extent to which manipulative steps are to be minimized.
The most rudimentary encoding system will be a one-bit binary labeling system, consisting of only one label moiety type, indicating whether or not an association of only one resolvable type occurred during the preceding association step.
For example, consider a sequencing application employing only a single nucleotide labeling moiety. Such a system may avail each of the four nucleotides modified with a biotin moiety attached by a sufficiently long, cleavable linker arm. In such a case, a polymerization sub-cycle comprises: the incubation of sample template molecules bearing appropriate primers with an appropriate polymerase and limiting quantities of only one labeled nucleotide (and no unlabeled nucleotides) such that this monomer will be added only if the template molecule has the complementary base in the template position immediately 5' to the base opposite the 3' terminal base of the primer, and no monomers will be added otherwise; sample molecules are then washed to remove any remaining free nuclectides; the sample is then exposed to excess quantities of streptavidin modified fluorescently labeled beads for a sufFcient length of time to ensure that all biotin moieties are bound by said labeled beads, and then all unbound beads are washed away; detection is then performed and data recorded;
linkers are then cleaved. Said sub-cycle is repeated for the remaining three nucleotides, to constitute a cycle which successively tests for tile presence in the sample template molecule of each type of base immediately to the base opposite the 3' terminal base of the primer. If a sample molecule does not bind any label through such a cycle, then it was most likely "missed" due to the limiting concentration of nucleotides used to effect stepping of polymerization. If a sample molecule is labeled multiply during such a cycle, then the respective subsequent bases are detected as occurring in the template according to the pattern of labeling.
A somewhat more efficient encoding system is provided if two distinct labeling moieties may be availed. Each nucleotide will be indicated by the presence or absence of each of the two moiety types, as a binary code. The moieties may, for instance be biotin (B) and digoxigenin (D). For example, the representation may be:
A=B+D; T=B; G=D. These three nucleotides are added for a first polymerization sub-cycle, and all unbound reagents then washed away. Either two perceptibly distinct bead types may be used for simultaneous detection, provided distinct affinity labels are sufficiently well separated by extended linkers for simultaneous binding, or a single bead type with two distinct receptor molecules may be used in two separate binding and release cycles, in which case the release of one bead type will have to leave the remaining affinity moiety bound to sample molecules.
After detection of bead labels, all remaining beads are removed and a second subcycle with C nucleotides affinity labeled with only one moiety are then polymerized onto sample molecules and appropriate detection is performed.
Where protecting groups are used to effect stepping control, only one sub-cycle is needed and C may be unlabeled. In such cases unlabeled molecules will be detected as having added a cytidine.
More conveniently, nucleotides of each of the four types distinctly labeled with a fluorescent dye moiety may be used with fluorescence detection means, and a sequencing cycle consisting of only one sub-cycle. Alternatively, four antibodies (or four other appropriate receptor molecules or affinity reagents) which each bind each of the four distinct dye moieties may be bound to each of four perceptibly distinct beads. In another arrangement, nucleotides may each be labeled with some distinct combination of multiple dye moieties, again encoding a unique binary label.

1.4.11 UTILITY OF THE SEQUENCE OF A GENOME
The present invention provides methods of detection and discrimination which address the complexity found in biological systems, though they may further be applied to non-natural systems including but not limited to mimetics. Much of this complexity derives from combinations or permutations of simple units such as the four nucleotide bases of polydeoxyribonucleic acids and polyribonucleic acids, or the twenty common amino acids found in polypeptides and proteins.
This complexity, which underlies the most diverse and nuanced of biological processes, has presented both the promise that ultimately much mechanistic knowledge of biological processes may be gained through the accumulation of greater information about underlying structures and biopolymer sequences, and the correspondingly motivated challenge of full enumeration and determination of these structures and sequences.
Because typical eukarvotic qenomes contain between 10' and 101°
DNA base pairs, and because there are several well studied organisms of particular interest, economical and technically simple methods capable of determining the full genome sequence of an individual organism over a convenienth short period of time would be particularly desirable.
The present invention can find applications in many fields, for instance, medical, diagnostic, forensic, genetics, biotechnology, and genome research.
It should be noted that this technique would be applicable in many other fields and instances, and such applications would be discernible by people of ordinary skills in the respective fields.
The availability of such sequencing methods would enable greater clinical applications of molecular medicine, would facilitate greater and safer application of gene therapy, would permit timely completion of the several genome projects within fiscal constraints, and would enable facile gathering of genome information on populations of individuals, which would have applications in such areas as the study of polygenic diseases, epidemiology and field ecology. Such applications are presently limited by the cost and cumbersome nature of existing sequencing methodologies.
Combinatorial chemistry, affinity characterization, therapeutic synthetic immunochemistry, pharmacology and drug development, in vitro evolution and other fields concerned with the elaboration of a diverse population of molecules, their characterization according to desired properties, and recovery or identification of molecules displaying suitable characteristics may be favorably improved by the availability of methods which permit the introduction of and both qualitative and quantitative characterization of kinetic and equilibrium properties of molecular recognition and binding phenomena, particularly where such parameters may be used as selective constraints.
There has further been some interest in rebuilding or supplementing the immune systems of immunocompromized individuals, and in the development of highly specific antibiotic agents targeted to antibiotic, antifungal or antiviral resistant or otherwise poorly treatable pathogens. Both of these goals may be furthered by the use of the methods of the present invention as they may readily be applied to the determination of pathogen specificity and antigenicity.
1.4.11.1. Application: Gene finding An integrated clone map is constructed by the method described herein. When the bin probes include polymorphic genetic markers, and these markers are typed against the DNAs of member of families carrying a genetic trait, that trait can be genetically localized on the map relative to one or more bin probes. Depending on the study design, this genetic localization can be carried out using one of a variety of methods (G. M. Lathrop and J.-M. Lalouel, "Efficient computations in multilocus linkage analysis," Amer. J. Hum. Genet., vol. 42, pp. 498-505, 1988; T. C.
Matise, M.
W. Perlin, and A. Chakravarti, "Automated construction of genetic linkage maps using an expert system (MultiMap): application to 1268 human microsatellite markers," Nature Genetics, vol. 6, no. 4, pp. 384-390, 1994; E. S. Lander and D.
Botstein, "Mapping Complex Genetic Traits in Humans: New Methods Using a Complete RFLP Linkage Map," in Cold Spring Harbor Symposia on Quantitative Biology, vol. LI, Cold Spring Harbor, Cold Spring Harbor Laboratory, 1986, pp.

62; L. Penrose, Ann. Eugenics, vol. 18, pp. 120-124, 1953; N. E. Morton, Am.
J.
Hum. Genet., vol. 35, pp. 201-213, 1983; N. Risch, Am. J. Hum. Genet., vol.
40, pp.
1-14, 1987; E. Lander and D. Botstein, Genetics, vol. 121, pp. 185-199, 1989;
N.
Risch, "Linkage strategies for genetically complex traits," in three parts, Am. J. Hum.
Genet., vol. 46, pp. 222-253, 1990; N. Risch, Genet. Epidemiol., vol. 7, pp. 3-16, 1990; N. Risch, Am. J. Hum. Genet., vol. 48, pp. 1058-1064, 1991; P. Holmans, "Asymptotic Properties of Affected-Sib-Pair Linkage Analysis," Am. J. Hum.
Genet., vol. 52, pp. 362-374, 1993; N. Risch,~S. Ghosh, and J. A. Todd, "Statistical Evaluation of Multiple-Locus Linkage Data in Experimental Species and Its Relevance to Human Studies: Application to Nonobese Diabetic (NOD) Mouse and Human Insulin-dependent Diabetes Mellitus (IDDM)," Am. J. Hum. Genet., vol.
53, pp. 702-714, 1993; R. C. Elston, in Genetic Approaches So Mental Disorders, E.
S.
Gershon and C. R. Cloninger, ed. Washington DC: American Psychiatric Press, 1994, pp. 3- 21 ), incorporated by reference.
Following genetic localization relative to the bin probes, the integrated contiged clone map provides an immediate means to proceed with positional cloning procedures. (D. Cohen, I. Chumakov, and J. Weissenbach, Nature, vol. 366, pp.

701, 1993; B.-S. Kerem, J. M. Rommens, J. A. Buchanan, D. Markiewicz, T. K.
Cox, A. Chakravarti, M. Buchwald, and L.-C. Tsui, "Identification of the cystic fibrosis gene: genetic analysis," Science, vol. 245, pp. 1073-1080, 1989; J. R.
Riordan, J. M.
Rommens, B.-S. Kerem, N. Alon, R. Rozmahel, Z. Grzelczak, J. Zielenski, S.
Lok, N.
Playsic, J.-L. Chou, M. L. Drumm, M. C. Iannuzzi, F. S. Collins, and L.-C.
Tsui, "Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA," Science, vol. 245, pp. 1066-1073, 1989), incorporated by reference. When an expression of candidate genes is included in the mapping resource (e.g.; ESTs, cDNAs), the search may proceed more rapidly. When the genome sequences of the clones in the region have been determined, the gene search may be done in part using computer searches for candidate genes.
1.4.11.2 Application: Structure/function relation The sequence of a genome is determined by the method described herein.
From this genome sequence, the relation of a gene or its promoters to other known functions may be determined using similarity or homology searches. Protocols for these determinations are well described (N. J. Dracopoli, J. L. Haines, B. R.
Korf, C.
C. Morton, C. E. Seidman, J. G. Seidman, D. T. Moir, and D. Smith, ed., Current Protocols in Human Genetics. New York: John Wiley and Sons, 1995), incorporated by reference. The use of expressed sequence tag (EST) databases (Merck Gene Index, St. Louis, Mo.; Human Genome Sciences, Gathersburg, Md.) together with the genome sequence provides a highly effective means for rapidly correlating a gene's sequence with the structure and function of its protein products.
1.4.11.3 Application: Metabolic network determination The sequence of a genome is determined by the method described herein.
Using the RT-PCR technique of differential display, perturbations on the cell state can be assayed in terms of DNA expression. Select perturbations can elucidate the metabolic networks of coupled enzyme systems in the cell. Reference back to the DNA sequence of the genome provides information about local control and gene/promoter interactions. This information can be used to understand disease mechanisms and to develop new pharmaceutical agenst to alleviate said diseases.
1.4.11.4 Application: Growth and development The sequence of a genome is determined by the method described herein. A
method is described for constructing an integrated genetic-physical-expression map that includes the genome sequence and cDNAs. It is currently impractical to map very large numbers of cDNAs at high resolution, due to the currently used technology of sequencing each cDNA, constructing PCR primers for it, and then performing multiple PCR amplifications and detections relative to a panel of RHs to accurately map even a single cDNA. However unobvious it may currently seem to those skilled in the art, it would nonetheless be extremely desirable for elucidating the mechanism of cell growth and organism development to construct and map tissue-specific cDNA
expression libraries at numerous points (e.g., at least every 24 hours) early in organism development. Further, the mapping of these expressed sequences back to their genomic locations would provide information on candidate genes, local gene expression, the coordination of normal and diseased cellular function under genetic control, and the time course of development in different tissues that would be highly useful in developing new diagnostic tests and therapeutic treatments for human disease. The method of the said examples provides such a novel means for practical rapid and high-resolution mapping of many expression libraries that would otherwise be neither constructed nor mapped.

1.4.1L5 Application: Drug development A sequence and map of a genome is determined by the method described herein. The sequence of the human genome or integrated clone maps can be used to identify genes that are causative for human disease. From such genes, and their DNA
promoters and protein products, mechanisms of diseases related to said genes can be determined. Pharmacological agents that intervene at key junctures in gene-related functions can then be devised to specifically circumvent and treat diseases related to these genes.
1.4.11.6 Application: Diagnostic testing A sequence and map of a genome is determined by the method described herein. The sequence of the human genome or integrated clone maps can be used to identify genes that are causative for human disease. From such genes, and their DNA
promoters and protein products, mechanisms of diseases related to said genes can be determined. Diagnostic tests that detect key junctures in gene-related structures and functions can then be devised to diagnose diseases related to these genes, and develop kits.
1.4.11.7 Application: Animal models The sequence of a genome is determined by the method described herein. In the current art, sequencing even one complete mammalian genome is a highly debated and very expensive proposition (estimated to cost around one billion dollars) which is not likely to be performed more than once. However, the novel sequencing method described renders sequencing more practical., since it produces a high-resolution clone map which can be used to cost-effectively direct the sequencing effort and to practically assemble the resulting sequences. Given the pressing medical need for sequencing a mammalian genome, and the absence of any such useful coordinating map, clearly the described invention is highly nonobvious.
By constructing a map as described in the method described herein, the upfront burden of building maps for mammalian species other than humans is considerably reduced. Further, since the cost per base of sequencing is expected to diminish, particularly as newer sequencing technologies become established, the described method provides the first useful starting point for beginning (and eventually completing) the DNA sequence determination of model animal genomes. Comparison of the DNA sequences and genes between human and model organisms is a well-established route for understanding and treating human disease. .
1.4.11. Application: Somatic cell hybrids The method described herein describes an inner product mapping analysis mechanism. Localization profiles are produced that can localize DNA sequences to high resolution. This inner product operation can be applied to somatic cell hybrid deletion panel data, thereby increasing the utility of such data by providing more confident and higher resolution localizations.
L4.11.9 Application: Genome mismatch scanning Genome mismatch scanning (GMS) (S. F. Nelson, J. H. McCusker, M. A.
Sander, Y. Kee, P. Modrich, and P. O. Brown, "Genomic mismatch scanning: a new approach to genetic linkage mapping," Nature Genetics, vol. 4, no. May, pp. 11-18, 1993), incorporated by reference, has been described as powerful hybridization-based approach to genetic linkage mapping. GMS has applications both in the mapping of genetic traits and in the diagnosis and prevention of disease. What is currently impeding practical application of the GMS method is the lack of a sequence or map of the human (or animal model) genome that would provide densely spaced (e.g., 1 Mb) hybridization probes for the genome sampling step that scans the mismatched genome DNAs. Applicant's invention discloses a practical method for constructing such a sequence or map of a genome using the method described in the specification.
In a preferred embodiment, densely spaced subsequences from the constructed sequence of a genome are used as hybridization probes in GMS. In an alternative embodiment, densely spaced clones (or subsequences therefrom) from the constructed map of a genome are used as hybridization probes in GMS.
1.4.1110 Application: Reliable maps from unreliable data A sequence and map of a genome is determined by the method described herein. It is generally believed that such maps can be reliably constructed only from highly reliable and relatively complete data. This belief adds considerably to the time, expense, and effort currently expended in constructing genome maps. However, the method described herein discloses a novel mechanism for constructing highly reliable maps from unreliable and incomplete data (J. von Neumann, "Probabilistic logics and the synthesis of reliable organisms from unreliable components," in Automata Studies, C. E. Shannon and J. McCarthy, ed. Princeton, N.J.: Princeton University Press, 1956, pp. 43-9~), incorporated by reference.
Specifically:
In step 6, table A's long-range characterization of the clone library can be comprised of very noisy, highly unreliable hybridization data exhibiting large error rates.
In step 9, table B's characterization of the long-range probe library can be sparsely sampled. In some embodiments, a>=l Mb average inter-bin distance suffices for accurate mapping and contig construction.
In step 14, table D's short-range characterization of the clone library has a high tolerance for data errors.
This unobvious result is due to the considerable redundancy in the three data tables, and to the noise filtering and consistency cross- checking capabilities of the analysis methods:
In step 11, table C is a highly reliable binning because the clean PCR-based data table B is used as a global corrective for the noisy complex hybridization-based data table A. This has been empirically demonstrated for human chromosome 11.
In step 16, table E is a highly reliable contiging because every clone has been probed with both long-range and short-range data. Therefore, the global binning information relaxes the requirements on the short-range probings:
useful comparisons can be made within a~relatively small bin region using imperfect data.
1.4.11.11 Application: Mutation Detection The techniques described herein will have a wide range of applications, particularly wherever desired to determine if a target nucleic acid has a particular nucleotide sequence or some other sequence differing from a known sequence.
For example, one application of the inventions herein is found in mutation detection.
These techniques may be applied in a wide variety of fields including diagnostics, forensics, bioanalytics, and others.
For example, assume a "wild-type" nucleic acid has the sequence 5' N~NZN3N4 where, again, N refers to a monomer such as a nucleotide in a nucleic acid and the subscript refers to position number. Assume that a target nucleic acid is to be evaluated to determine if it is the same as 51-N~NaN3N4 or if it differs from this sequence, and so contains a mutation or mutant sequence. The target nucleic acid is initially exposed to an array of typically shorter probes, as discussed above.
Thereafter, one or more "core" sequences are identified, each of which would be expected to have a high binding affinity to the target, if the target does not contain a mutant sequence or mutation. In this particular example, one probe that would be expected to exhibit high binding affinity would be the complement to S'-N,N2N3 3'-PlPzP3, assuming a 3-mer array is utilized. Again, it will be recognized that the probes and/or the target may be part of a longer nucleic acid molecule.
As an initial screening tool, the absolute binding affinity of the target to the 3'-P1P2P3 probe will be utilized to determine if the first three positions of the target are of the expected sequence. If the complement to 5'-NIN2N3 does not exhibit strong binding to the target, it can be properly concluded that the target is not of the wild-type.
The single base mismatch profile can also be utilized according to the present invention to determine if the target contains a mutant or wild-type sequence.
As shown herein, the single base mismatch plots for wild-type targets generally follow the typical., smile-shaped plot. Conversely, when the target has a mutation at a particular position, not only will the absolute binding affinity of the target to a particular core probe be less, but the single base mismatch characteristics will deviate from expected behavior.
According to one aspect of the invention, a substrate having a selected group of nucleic acids (otherwise referred to herein as a "library" of nucleic acids") is used in the determination of whether a particular nucleic acid is the same or different than a wild-type or other expected nucleic acid. Libraries of nucleic acids will normally be provided as an array of probes or "probe array." Such probe arrays are preferably formed on a single substrate in which the identity of a probe is determined by ways of its location on the substrate. Optionally, such substrates will not only determine if the nucleotide sequence of a target is the same as the wild-type, but it will also provide sequence information regarding the target. Such substrates will find use in fields noted above such as in forensics, diagnostics, and others. Merely by way of specific example, the invention may be utilized in diagnostics associated with sickle cell anemia detection, detection of any of the large number of P-53 mutations, for any of the large number of cystic fibrosis mutations, for any particular variant sequence associated with the highly polymorphic HLA class 1 or class 2 genes (particularly class 2 DP, DQ and DR beta genes), as well as many other sequences associated with genetic diseases, genetic predisposition, and genetic evaluation.
When a substrate is to be used in such applications, it is not necessary to provide all of the possible nucleic acids of a particular length on the substrate. Instead, it will be necessary using the present invention to provide only a relatively small subset 4S of all the possible sequences. For example, suppose a target nucleic acid comprises a S-base sequence of particular interest and that one wishes to develop a substrate that may be used to detect a single substitution in the S-base sequence.
According to one aspect of the invention, the substrate will be formed with the expected S-base sequence formed on a surface thereof, along with all or most of the single base mismatch probes of the S-base sequence. Accordingly, it will not be necessary to include all possible S-base sequences on the substrate, although larger arrays will often be preferred. Typically, the length of the nucleic acid probes on the substrate according to the present invention will be between about S and 100 bases, between about S and SO bases, between about 8 and 30 bases, or between about 8 and 1 S bases.
By selection of the single base mismatch probes among all possible probes of a certain length, the number of probes on the substrate can be greatly limited. For example, in a 3-base sequence there are 69 possible DNA base sequences, but there will be only one exact complement to an expected sequence and 9 possible single base mismatch probes. By selecting only these probes, the diversity necessary for screening will be reduced. Preferably, but not necessarily, all of such single base mismatch probes are synthesized on a single substrate. While substrates will often be formed including other probes of interest in addition to the single base mismatches, such substrates will normally still have less than SO% of all the possible probes of n-bases, often less than 30% of all the possible probes of n-bases, often less than 20% of all the possible probes of n-bases, often less than 10% of the possible probes of n-bases, and often less than S% of the possible probes of n-bases.
Nucleic acid probes will often be provided in a kit for analysis of a specific genetic sequence. According to one embodiment the kits will include a probe complementary to a target nucleic acid of interest. In addition, the kit will include single base mismatches of the target. The kit will normally include one or more of C, G, T, A and/or U single base mismatches of such probe. Such kits will often be provided with appropriate instructions for use of the complementary probe and single base mismatches in determining the sequence of a particular nucleic acid sample in accordance with the teachings herein. According to one aspect of the invention, the kit provides for the complement to the target, along with only the single base mismatches. Such kits will often be utilized in assessing a particular sample of genetic material to determine if it indicates a particular genetic characteristic. For example, such kits may be utilized in the evaluation of a sample as mentioned above in the detection of sickle cell anemia, detection of any of the large number of P-53 mutations, detection of the large number of cystic fibrosis mutations, detection of particular variant sequence associated with the highly polymorphic HLA class 1 or class 2 genes (particularly class 2 DP, DQ and DR beta genes), as well as detection of many other sequences associated with genetic diseases, genetic predisposition, and genetic evaluation.
Accordingly, it is seen that substrates with probes selected according to the present invention will be capable of performing many mutation detection and other functions, but will need only a limited number of probes to perform such functions.

DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

~~ TTENANT LES PAGES 1 A 267 NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:

Claims

What is claimed is:

1. A method of producing an improved organism having a desirable trait comprising:
a) obtaining an initial population of organisms, b) generating a set of mutagenized organisms, such that when all the genetic mutations in the set of mutagenized organisms are taken as a whole, there is represented a set of substantial genetic mutations, and c) detecting the presence of said improved organism.

2. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of a knocking out of at least 15 different genes.

3. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of a knocking out of at least 50 different genes.

4. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of a knocking out of at least 100 different genes.

5. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of an introduction of at least 15 different genes.

6. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of an introduction of at least 50 different genes.

7. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of an introduction of at least 100 different genes.

8. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of an alteration in the expression of at least 15 different genes.

9. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of an alteration in the expression of at least 50 different genes.

10. The method of claim 1, wherein the set of substantial genetic mutations in step b) is comprised of an alteration in the expression of at least 100 different genes.

11. A method of producing an improved organism having a desirable trait comprising:
a) obtaining an initial population of organisms, b) generating a set of mutagenized organisms each having at least one genetic mutation, such that when all the genetic mutations in the set of mutagenized organisms are taken as a whole, there is represented a set of substantial genetic mutations c) detecting the manifestation of at least two genetic mutations, d) introducing at least two detected genetic mutations into one organism, and e) optionally repeating any of steps a), b), c), and d).

12. The method of claim 11, wherein step d) is comprised of a knocking out of at least 15 different genes in one organism.

13. The method of claim 11, wherein step d) is comprised of a knocking out of at least 50 different genes in one organism.

14. The method of claim 11, wherein step d) is comprised of a knocking out of at least 100 different genes in one organism.

15. The method of claim 11, wherein step d) is comprised of an introduction of at least 15 different genes into one organism.

I6. The method of claim 11, wherein step d) is comprised of an introduction of at least 50 different genes into one organism.

17. The method of claim 11, wherein step d) is comprised of an introduction of at least 100 different genes into one organism.

18. The method of claim 11, wherein step d) is comprised of an alteration in the expression of at least 15 different genes in one organism.

19. The method of claim 11, wherein step d) is comprised of an alteration in the expression of at least 50 different genes in one organism.

20. The method of claim 11, wherein step d) is comprised of an alteration in the expression of at least 100 different genes in one organism.

21. A method for identifying a gene that alters a trait of an organism, comprising: a) obtaining an initial population of organisms, b) generating a set of mutagenized organisms, such that when all the genetic mutations in the set of mutagenized organisms are taken as a whole, there is represented a set of substantial genetic mutations, and c) detecting the presence an organism having said altered trait, and d) determining the nucleotide sequence of a gene that has been mutagenized in the organism having the altered trait.

22. A method for producing an organism with an improved trait, comprising: a) functionally knocking out an enogenous gene in a substantially clonal population of organisms; b) transferring a library of altered genes into the substantially clonal population of organisms, wherein each altered gene differs from the endogenous gene at only one codon; c) detecting a mutagenized organism having an improved trait; and d)determining the nucleotide sequence of an gene that has been transferred into the detected organism.