CA2398861A1 - Gene disruption methodologies for drug target discovery - Google Patents

Abstract

The present invention provides methods and compositions that enable the experimental determination as to whether any gene in the genome of a diploid pathogenic organism is essential, and whether it is required for virulence o r pathogenicity. The methods involve the construction of genetic mutants in which one allele of a specific gene is inactivated while the other allele of the gene is placed under conditional expression. The identification of essential genes and those genes critical to the development of virulent infections, provides a basis for the development of screens for new drugs against such pathogenic organisms. The present invention further provides Candida albicansgenes that are demonstrated to be essential and are potential targets for drug screening. The nucleotide sequence of the target genes can be used for various drug discovery purposes, such as expression of the recombinant protein, hybridization assay and construction of nucleic aci d arrays. The uses of proteins encoded by the essential genes, and genetically engineered cells comprising modified alleles of essential genes in various screening methods are also encompassed by the invention.

Description

GENE DISRUPTION METHODOLOGIES
FOR DRUG TARGET DISCOVERY
S This application claims priority to the United States provisional application serial no. 60/183,534, filed February 18, 2000, which is incorporated herein by reference in its entirety.
1. INTRODUCTION
The present invention is directed toward (1) methods for constructing strains useful for identification and validation of gene products as effective targets for therapeutic intervention, (2) methods for identifying and validating gene products as effective targets for therapeutic intervention, (3) a collection of identified essential genes, and (4) screening methods and assay procedures for the discovery of new drugs.

2. BACKGROUND OF THE INVENTION
Validation of a cellular target for drug screening purposes generally involves an experimental demonstration that inactivation of that gene product leaves the cell inviable.
Accordingly, a drug active against the same essential gene product expressed, for example, by a pathogenic fungus, would be predicted to be an effective therapeutic agent. Similarly, a gene product required for fungal pathogenicity and virulence is also expected to provide a suitable target for drug screening programs. Target validation in this instance is based upon a demonstration that inactivation of the gene encoding the virulence factor creates a fungal strain that is shown to be either less pathogenic or, ideally, avirulent, in animal model studies. Identification and validation of drug targets are critical issues for detection and discovery of new drugs because these targets form the basis for high throughput screens within the pharmaceutical industry.
Target discovery has traditionally been a costly, time-consuming process, in which newly-identified genes and gene products have been individually analyzed as potentially-suitable drug targets. DNA sequence analysis of entire genomes has markedly accelerated the gene discovery process. Consequently, new methods and tools are required to analyze this information, first to identify all of the genes of the organism, and .then, to discern which genes encode products that will be suitable targets for the discovery of effective, non-toxic drugs. Gene discovery through sequence analysis alone does not validate either known or novel genes as drug targets. Elucidation of the function of a gene from the underlying and a determination of whether or not that gene is essential still present substantial obstacles to the identification of appropriate drug targets. These obstacles are especially pronounced in diploid organisms.
C. albicans is a major fungal pathogen of humans. An absence of identified specific, sensitive, and unique drug targets in this organism has hampered the development of effective, non-toxic compounds for clinical use. The recent completion of the DNA
sequence analysis of the entire C. albicans genome has rejuvenated efforts to identify new antifungal drug targets. Nevertheless, two primary obstacles to the exploitation of this information for the development of useful drug targets remain: the paucity of suitable markers for genetic manipulations in C. albicans and the inherent difficulty in establishing, in this diploid organism, whether a specific gene encodes an essential product. Co-pending provisional patent application, filed February 18, 2000, discloses the identification of dominant selectable markers, and the construction of two genes encoding those markers, which are suitable for transformation and gene disruption in C. albicans.
Current methods for gene disruption in C. albicans (Fig. l ) typically involve a multistep process employing a "URA blaster" gene cassette which is recombined into the genome, displacing the target gene of interest. The URA blaster cassette comprises the CaURA3 marker which is selectable in the corresponding auxotrophic host and which is flanked by direct repeats of the Salmonella typhimurium HisG gene. The URA
blaster cassette also carnes flanking sequences corresponding to the gene to be replaced, which facilitate precise replacement of that gene by homologous recombination.
Putative heterozygous transformants, which have had one allele of the target gene deleted, are selected as uracil prototrophs, and their identity and chromosomal structure confirmed by Southern blot and PCR analyses. Isolates within which intrachromosomal recombination events have occurred between HisG repeats, leading to excision of the CaURA3 gene and loss of the integrated cassette, are selected on 5-fluoroorotic acid (5-FOA) containing media. This allows a repetition of the entire process, including reuse of the Ura-blaster cassette, for disruption of the second allele of the target gene. In those instances in which the target gene is nonessential, homozygous gene disruptions are produced in the second round gene replacement and identified by Southern blot and PCR analyses.
However, homozygous deletion strains, which lack both alleles of a gene that is essential will not be viable. Accordingly, the Ura blaster method will not provide an unequivocal result, establishing the essential nature of the target gene since alternative explanations, including poor growth of a viable mutant strain, may be equally likely for the negative results obtained. More recent approaches for identification of essential genes, including those disclosed by Wilson, R.B., Davis, D., Mitchell, A.P. (1999) J.
Bacteriol.

181:1868-74, employ multiple auxotrophic markers and a PCR-based gene disruption strategy. Although such methods effectively overcome the need to use the Ura Blaster cassette, determination of whether a given gene is essential, and therefore, a potentially useful target, remains labor-intensive and unsuitable for genome-wide analyses. Substantial effort is required to support a statistically valid conclusion that a given gene is essential when using either the Ura blaster cassette or multiple auxotrophic marker-based methods for gene disruption in Candida albicans. Typically, between 30 and 40 second round transformants must all be confirmed as reconstructed heterozygous strains (using PCR or Southern blot analysis) resulting from homologous recombination between the disruption fragment and previously constructed disruption allele, before statistical support to the claim that the gene is essential can be made. Moreover, since secondary mutations may be selected in either the transformation step or 5-FOA counterselection (if the Ura blaster cassette is reused), two independently constructed heterozygous strains are preferably examined during the attempted disruption of the second allele. In addition, demonstration that a particular phenotype is linked to the homozygous mutation of the target gene (and not a secondary mutation) requires complementation of the defect by transforming a wild type copy of the gene back into the disruption strain.
Finally, the Ura blaster method precludes direct demonstration of gene essentiality. Therefore, one is unable to critically evaluate the terminal phenotype characteristic of essential target genes. Consequently, establishing whether inactivation of a validated drug target gene results in cell death (i.e., a cidal terminal phenotype) versus growth inhibition (i.e., a static terminal phenotype) is not possible with current approaches;
despite the value such information would provide in prioritizing drug targets for suitability in drug development.
Clearly, since current gene disruption methods are labor intensive and largely refractile to a high throughput strategy for target validation, there is a need for effective methods and tools for unambiguous, rapid, and accurate identification of essential genes in diploid, pathogenic fungi, and particularly, in Candida albicans. The present invention overcomes these limitations in current drug discovery approaches by enabling high throughput strategies that provide rapid identification, validation, and prioritization of drug targets, and consequently, accelerate drug screening.

3. SUMMARY OF THE INVENTION
The present invention provides effective and efficient methods that enable, for each gene in the genome of an organism, the experimental determination as to whether that gene is essential, and for a pathogenic organism, in addition, whether it is required for virulence or pathogenicity. The identification and validation of essential genes and those genes critical to the development of virulent infections, provides a basis for the development of high-throughput screens for new drugs against the pathogenic organism.
The present invention can be practiced with any organism independent of ploidy, and in particular, pathogenic fungi. Preferably, the pathogenic fungi are diploid pathogenic fungi, including but not limited to Candida albicans, Aspergillus fumigatus, Cryptococcus neoformans and the like.
In one embodiment, the present invention is directed toward a method for constructing a diploid fungal strain in which one allele of a gene is modified by insertion of or replacement by a cassette comprising an expressible dominant selectable marker. This cassette is introduced into the chromosome by recombination, thereby providing a heterozygous strain in which the first allele of the gene is inactivated.
The other allele of the gene is modified by the introduction, by recombination, of a promoter replacement fragment comprising a heterologous promoter, such that the expression of the second allele of the gene is regulated by the heterologous promoter. Expression from the heterologous promoter can be regulated by the presence of a transactivator protein comprising a DNA-binding domain and transcription-activation domain. The DNA-binding domain of this transactivator protein recognizes and binds to a sequence in the heterologous promoter and increases transcription of that promoter. The transactivator protein can be produced in the cell by expressing a nucleotide sequence encoding the protein.
This method for the construction of a diploid fungus having both alleles of a gene modified, is carried out, in parallel, with each and every gene of the organism, thereby allowing the assembly a collection of diploid fungal cells each of which comprises the modified alleles of a gene. This collection, therefore, comprises modified alleles of substantially all of the genes of the diploid organism. As used herein, the term "substantially all" includes at least 60%, 70%, 80%, 90%, 95% or 99% of the total.
Preferably, every gene in the genome of the diploid organism is represented in the collection.
The present invention also encompasses diploid organisms, such as diploid pathogenic fungal strains, comprising modified alleles of a gene, where the first allele of a gene is inactivated by insertion of or replacement by a nucleotide sequence encoding an expressible dominant selectable marker; and where the second allele of the gene has also been modified so that expression of the second allele is regulated by a heterologous promoter. In one aspect of the present invention, the alleles modified in the mutant diploid pathogenic fungal strain correspond to an essential gene, which is required for growth, viability and survival of the strain. In another aspect of the present invention, the modified alleles correspond to a gene required for the virulence and pathogenicity of the diploid pathogenic fungal strain against a host organism. In both cases, the essential gene and the virulence/pathogenicity gene are potential drug targets.
Accordingly, the present invention encompasses collections of mutant diploid fungal strains wherein each collection comprises a plurality of strains, each strain containing the modified alleles of a different gene. The collections of strains of the invention include modified alleles for substantially all the different essential genes in the genome of a fungus or substantially all the different virulence genes in the genome of a pathogenic fungus.
In another embodiment, the present invention is also directed to nucleic acid microarrays which comprise a plurality of defined nucleotide sequences disposed at identifiable positions in an array on a substrate. The defined nucleotide sequences can comprise oligonucleotides complementary to, and capable of hybridizing with, the nucleotide sequences of the essential genes of the diploid pathogenic organism that are required for the growth and survival of the diploid pathogenic organism, the nucleotide sequences of genes contributing to the pathogenicity or virulence of the organism, and/or the unique molecular tags employed to mark each of the mutant strains.
The present invention is also directed to methods for the identification of genes essential to the survival of a diploid organism, and of genes that contribute to the virulence and/or pathogenicity of the diploid pathogenic organism. First, the invention provides mutants of diploid organisms, such as mutant fungal cells, having one allele of a gene inactivated by insertion of or replacement with a disruption cassette, and the other allele modified by a nucleic acid molecule comprising a heterologous regulated promoter, such that expression of that second allele is under the control of the heterologous promoter.
Second, such mutant cells are cultured under conditions where the second allele of the modified gene is substantially not expressed. The viability or pathogenicity of the cells are then determined. The resulting loss of viability or exhibition of a severe growth defect indicates that the gene that is modified in the mutant cells is essential to the survival of a pathogenic fungus. Similarly, the resulting loss of virulence and/or pathogenicity of the mutant cells indicates that the gene that is modified contributes to the virulence and/or pathogenicity of the pathogenic fungus.
In yet another embodiment of the present invention, the mutant pathogenic fungal strains constructed according to the methods disclosed are used for the detection of antifungal agents effective against pathogenic fungi. Mutant cells of the invention are cultured under differential growth conditions in the presence or absence of a test compound.
The growth rates are then compared to indicate whether or not the compound is active against a target gene product. The second allele of the target gene may be substantially underexpressed to provide cells with enhanced sensitivity to compounds active against the gene product expressed by the modified allele. Alternatively, the second allele may be substantially overexpressed to provide cells with increased resistance to compounds active against the gene product expressed by the modified allele of the target gene.
In yet another embodiment of the present invention, the strains constructed according to the methods disclosed are used for the screening of therapeutic agents 1 S effective for the treatment of non-infectious diseases in a plant or an animal, such as a human. As a consequence of the similarity of a target's amino acid sequence with a plant or animal counterpart, or the lack of sequence similarity, active compounds so identified may have therapeutic applications for the treatment of diseases in the plant or animal, in particular, human diseases, such as cancers and immune disorders.
The present invention, in other embodiments, further encompasses the use of transcriptional profiling and proteomics techniques to analyze the expression of essential andlor virulence genes under a variety of conditions, including in the presence of known drugs. The information yielded from such studies can be used to uncover the target and mechanism of known drugs, to discover new drugs that act in a similar fashion to known drugs, and to delineate the interactions between gene products that are essential to growth and survival of the organism and that are instrumental to virulence and pathogenicity of the organism.
In a further embodiment of the present invention, a set of genes of a pathogenic organism are identified as potential targets for drug screening.
Such genes comprise, genes that have been determined, using the methods and criteria disclosed herein, to be essential for survival of a pathogenic fungus and/or for the virulence and/or pathogenicity of the pathogenic fungus. The polynucleotides of the essential genes or virulence genes of a pathogenic organism (i.e., the target genes) provided by the present invention can be used by various drug discovery purposes. Without limitation, the polynucleotides can be used to express recombinant protein for characterization, screening or therapeutic use; as markers for host tissues in which the pathogenic organisms invade or reside (either permanently or at a particular stage of development or in a disease states); to compare with DNA sequences of other related or distant pathogenic organisms to identify potential orthologous essential or virulence genes; for selecting and making oligomers for attachment to a nucleic acid array for examination of expression patterns; to raise anti-protein antibodies using DNA immunization techniques; as an antigen to raise anti-DNA
antibodies or elicit another immune response; and as a therapeutic agent (e.g., antisense).
Where the polynucleotide encodes a protein which binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the polynucleotide can also be used in assays to identify polynucleotides encoding the other protein with which binding occurs or to identify inhibitors of the binding interaction.
The polypeptides or proteins encoded by the essential genes and virulence genes (i.e. the target gene products) provided by the present invention can also be used in assays to determine biological activity, including its uses as a member in a panel or an array of multiple proteins for high-throughput screening; to raise antibodies or to elicit immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as a marker for host tissues in which the pathogenic organisms invade or reside (either permanently or at a particular stage of development or in a disease states); and, of course, to isolate correlative receptors or ligands (also referred to as binding partners) especially in the case of virulence factors. Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction.
Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction, such as those involved in invasiveness, and pathogenicity of the pathogenic organism.
Any or all of these drug discovery utilities are capable of being developed into a kit for commercialization as research products. The kits may comprise polynucleotides and/or polypeptides corresponding to a plurality of essential genes and virulence genes of the invention, antibodies, and/or other reagents.

4. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts the URA blaster method for gene disruption in Candida albicans.
Figure 2 depicts the GRACE method for constructing a gene disruption of one allele of a gene (CaKRE9), and promoter replacement of the second allele of the target gene, placing the second allele under conditional, regulated control by a heterologous promoter.
Figure 3 presents conditional gene expression , using GRACE technology, with KREI, KRES, KRE6 and KRE9.
Figure 4 presents conditional gene expression using GRACE technology with CaKREI, CaTUBI, CaALG7, CaAURI, CaFKSI and CaSAT2.
Figure 5 presents a Northern Blot Analysis of CaHIS3, CaALRI, CaCDC24 and CaKRE9 mRNA isolated from GRACE strains to illustrate elevated expression under non-repressing conditions.
Figure 6 presents growth of a CaHIS3 heterozygote strain and a tetracycline promoter-regulated CaHIS3 GRACE strain compared to growth of a wild-type diploid CaHIS3 strain in the presence and absence of 3-aminotriazole (3-AT).
Figure 6A depicts growth of a wild-type strain and a CaHIS3 heterozygote strain as compared with a CaHIS3 GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of inhibitory levels of 3-aminotriazole.
Figure 6B depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
Figure 6C depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain minimally expressing the tetracycline _g_ promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
Figure 6D demonstrates the hypersensitivity of the CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
5. DETAILED DESCRIPTION OF THE INVENTION
5.1 Gene Disruption And Drug Target Discovery The present invention provides a systematic and efficient method for drug target identification and validation. The approach is based on genomics information as well as the biological function of individual genes.
The methods of the invention generates a collection of genetic mutants in which the dosage of specific genes can be modulated, such that their functions in growth, survival, and/or pathogenicity can be investigated. The information accrued from such investigations allows the identification of individual gene products as potential drug targets:
The present invention further provides methods of use of the genetic mutants either individually or as a collection in drug screening and for investigating the mechanisms of drug action.
Generally, in gene disruption experiments, the observation that homozygous deletions cannot be generated for both alleles of a gene in a diploid organism, cannot, per se, support the conclusion that the gene is an essential gene. Rather, a direct demonstration of expression of the gene in question that is coupled with viability of the cell carrying that gene, is required for the unambiguous confirmation that the gene in question is essential.
A direct demonstration that a given gene is essential for survival of a cell can be established by disrupting its expression in diploid organisms which have a haploid stage.
For example, in Saccharomyces cerevisiae, this is achieved by complete removal of the gene product through gene disruption methods in a diploid cell type, followed by sporulation and tetrad dissection of the meiotic progeny to enable direct comparison of haploid yeast strains possessing single mutational differences. However, such an approach .
is not applicable to asexual yeast strains, which include most diploid pathogenic cell types, and alternative methods are required for eliminating expression of a putative essential gene.

In one embodiment, the invention provides a method for creating a diploid mutant cell of an organism in which the dosage of a specific gene can be modulated. By this method of the invention, one allele of a target gene in a diploid cell of an organism is disrupted while the second allele is modified by having its promoter replaced by a regulated promoter of heterologous origin. A strain constructed in this manner is said to comprise a modified allelic pair, i.e., a gene wherein both alleles are modified as described above.
Where the genomic DNA sequence of the organism is available, this process may be repeated with each and every gene of the organism, thereby constructing a collection of mutant organisms each harboring a disrupted allele and an allele which can be conditionally expressed. This gene disruption strategy, therefore, provides a substantially complete set of potential drug target genes for that organism. This collection of mutant organisms, comprising a substantially complete set of modified allelic pairs, forms the basis for the development of high throughput drug screening assays. A collection of such mutant organisms can be made even when the genomic sequences of an organism are not 1 S completely sequenced. It is contemplated that a smaller collection of mutant organisms can be made, wherein in each mutant organism, one allele of a desired subset of gene is disrupted, and the other allele of the genes in this subset is placed under conditional expression. The method of the invention employed for the construction of such strains is referred to herein as the GRACE method, where the acronym is derived from the phrase gene replacement and conditional expression.
The GRACE method, which involves disruption of one allele coupled with conditional expression of the other allele, overcomes limitations relying upon repeated cycles of disruption with the URA blaster cassette followed by counterselection for its loss.
The GRACE method permits large scale target validation in a diploid pathogenic microorganism, such as a pathogenic fungus.
The GRACE method of the invention, as applied to a diploid cell involves two steps: (i) gene replacement resulting in disruption of the coding and/or non-coding regions) of one wild type allele by insertion, truncation, and/or deletion, and (ii) conditional expression of the remaining wild type allele via promoter replacement or conditional protein instability (Fig. 2). Detailed descriptions of the method is provided in later sections.
Isolated mutant organisms resulting from the application of the GRACE
method are referred to herein as GRACE strains of the organism. Such mutant strains of an organism are encompassed by the invention. In a particular embodiment, a collection of GRACE strains which are generated by subjecting substantially all the different genes in the genome of the organism to modification by the GRACE method is provided. In this collection, each strain comprises the modified alleles of a different gene, and substantially all the genes of the organism are represented in the collection. It is intended that a GRACE
strain is generated for every gene in an organism of interest. Alternatively, a smaller collection of GRACE strains of an organism can be generated wherein a desired subset of the genes in the organism are modified by the GRACE method.
A gene is generally considered essential when viability and/or normal growth of the organism is substantially coupled to or dependent on the expression of the gene. An essential function for a cell depends in part on the genotype of the cell and in part the cell's environment. Multiple genes are required for some essential function, for example, energy metabolism, biosynthesis of cell structure, replication and repair of genetic material, etc.
Thus, the expression of many genes in an organism are essential for its growth and/or survival. Accordingly, when the viability or normal growth of a GRACE strain under a defined set of conditions is coupled to or dependent on the conditional expression of the remaining functional allele of a modified allelic gene pair, the gene which has been modified in this strain by the GRACE method is referred to as an "essential gene" of the organism.
A gene is generally considered to contribute to the virulence/pathogenicity of an organism when pathogenicity of the organism is associated at least in part to the expression of the gene. Many genes in an organism are expected to contribute to the virulence and/or pathogenicity of the organism. Accordingly, when the virulence and/or pathogenicity of a GRACE strain to a defined host or to defined set of cells from a host is associated with the conditional expression of the remaining functional allele of a modified allelic gene pair, the gene which has been modified in this strain by the GRACE method is referred to as a "virulence gene" of the organism.
The present invention provides a convenient and efficient method to identify essential genes of a pathogenic organism, and to validate their usefulness in drug discovery programs. The method of the invention can similarly be used to identify virulence genes of a pathogenic organism. The identities of these essential genes and virulence genes of an organism as identified by the GRACE method are encompassed in the present invention.
substantially all of the essential genes and virulence genes of an organism can be identified and validated by the GRACE method of the invention.
Each of the essential genes and virulence genes so identified represent a potential drug target for the organism, and can be used individually or as a collection in various methods of drug screening. Depending on the objective of the drug screening program and the target disease, the essential genes and virulence genes of the invention can be classified and divided into subsets based on the structural features, functional properties, and expression profile of the gene products. The gene products encoded by the essential genes and virulence genes within each subset may share similar biological activity, similar intracellular localization, structural homology, and/or sequence homology.
Subsets may S also be created based on the homology or similarity in sequence to other organisms in a similar or distant taxonomic group, e.g. homology to Saccharomyces cerevisiae genes, or to human genes, or a complete lack of sequence similarity or homology to genes of other organisms, such as S. cerevisiae or human. Subsets may also be created based on the display of cidal terminal phenotype or static terminal phenotype by the organism bearing the modified gene. Such subsets, referred to as essential gene sets or virulence gene sets, which can be conveniently investigated as a group in a drug screening program, are provided by the present invention. Accordingly, the present invention provides a plurality of mutant organisms, such as a collection of GRACE strains, each comprising the modified alleles of a different gene, wherein each gene is essential for the growth and/or survival of the cells.
In a specific embodiment, substantially all of the essential genes in the genome of a pathogenic fungus are identified by the GRACE method, and the GRACE
strains containing the modified allelic pairs of essential genes are included in a collection of GRACE strains. In another specific embodiment, substantially all of the virulence genes in the genome of a pathogenic fungus are identified by the GRACE method, and the GRACE
strains containing the modified allelic pairs of virulence genes are included in a collection of GRACE strains.
For Candida albicans, a GRACE strain collection for the entire genome may comprise approximately 7000 modified allelic pairs of genes based on analysis of the C.
albicans genome sequence. The complete set of essential genes of C. albicans is estimated to comprise approximately 1000 genes. The present invention provides the identities of some of these genes in C. albicans, and the various uses of these genes and their products as drug targets. In addition, estimates as to the number of genes participating in the virulence of this pathogen range between 100 and 400 genes. Once the identity of an essential gene is known, various types of mutants containing one or more copies of the mutated essential gene created by other methods beside the GRACE method are contemplated and encompassed by the invention.
The invention also provides biological and computational methods, and reagents that allow the isolation and identification of genes that are homologous to the identified essential and virulence genes of C. albicans. Information obtained from the GRACE strains of diploid organisms can be used to identify homologous sequences in haploid organisms. The identities and uses of such homologous genes are also encompassed by the present invention.
For clarity of discussion, the invention is described in the subsections below by way of example for the pathogenic fungus, Candida albicans. However, the principles may be analogously applied to the essential and virulence genes of other pathogens and parasites, of plants and animals including humans. The GRACE method can be applied to any pathogenic organisms that has a diploid phase in their life cycles. Hence, the term diploid pathogenic organism is not limited to organism that exist exclusively in diploid form, but encompasses also organisms that have both haploid and diploid phases in their life cycle.
For example, the GRACE method for drug target identification and validation can be directly applied to other pathogenic fungi. Deuteromycetous fungi, i. e.
those lacking a sexual cycle and classical genetics, (in which C. albicans is included), represent the majority of human fungal pathogens. Aspergillus fumigatus is another medically-significant member of this phylum, which, more strictly, includes members of the Ascomycota and the Basidiomycota. A. fumigatus, an Ascomycte is the predominant air borne infectious fungal agent causing respiratory infection, or invasive aspergillosis (IA), in immunocompromised patients. While relatively unknown 20 years ago, today the number of IA cases is estimated to be several thousand per year. Moreover, IA
exhibits a mortality rate exceeding 50% and neither amphothericin B nor fluconazole are highly efficacious.
Compounding these problems is that identification of novel drug targets is limited by the current state of target validation in this organism.
The GRACE method demonstrated for C. albicans is readily adapted for use with A. fumigatus, for the following reasons. Although, A. fumigatus possesses a haploid genome, the GRACE method could be simplified to one step-conditional promoter replacement of the wild type promoter. Since A. fumigatus, in contrast to Candida albicans, adheres to the universal genetic code, extensive site-directed mutagenesis, like that required to engineer the GRACE method for C. albicans, would not be required. Moreover, essential molecular biology techniques such as transformation and gene disruption via homologous recombination have been developed for A. fumigatus. Selectable markers are available for these techniques in A. fumigatus, and include genes conferring antibiotic resistance to hygromycin B and phleomycin, and the auxotrophic marker, ura3. Furthermore, both public and private A. fumigatus genome sequencing projects exist. Therefore, sequence information is available both for the identification of putative essential genes as well as for ~e experimental validation of these drug targets using the GRACE method.
Additional pathogenic deuteromycetous fungi to which the GRACE method may be applied include Aspergillus,flavus, Aspergillus niger, and Coccidiodes immitis.
In another aspect of the present invention, the GRACE method for drug target identification and validation is applied to Basidiomycetous pathogenic fungi. One particular, medically-significant member of this phylum is Cryptococcus neoformans. This air borne pathogen represents the fourth (7-8%) most commonly recognized cause of life-threatening infections in AIDS patients. Transformation and gene disruption strategies exist for C. neoformans and a publically funded genome sequencing project for this organism is in place. C. neoformans possesses a sexual cycle, thus enabling the GRACE
method to be employed with both haploid and diploid strains. Other medically-significant Basidiomycetes include Trichosporon beigelii and Schizophylum commune.
In the same way medically relevant fungal pathogens are suitable for a rational drug target discovery using the GRACE method, so too may plant fungal pathogens and animal pathogens be examined to identify novel drug targets for agricultural and 1 S veterinary purposes. The quality and yield of many agricultural crops including fruits, nuts, vegetables, rice: soybeans, oats, barley and wheat are significantly reduced by plant fungal pathogens. Examples include the wheat fungal pathogens causing leaf blotch (Septoria tritici, glume blotch (Septoria nodorum), various wheat rusts (Puccinia recondita, Puccinia graminis); powdery mildew (various species), and stem/stock rot (Fusarium spp.) Other p~icularly destructive examples of plant pathogens include, Phytophthora infestans, the causative agent of the Irish potato famine, the Dutch elm disease causing ascomycetous fungus, Ophiostoma ulmi, the corn smut causing pathogen, Ustilago maydis and the rice-blast-causing pathogen Magnapurtla grisea. The emerging appearance of fungicidal-resistant plant pathogens and increasing reliance on monoculture practices, clearly indicate a growing need for novel and improved fungicidal compounds. Accordingly, the present invention encompasses the application of the GRACE method to identify and validate drug targets in pathogens and parasites of plants and livestock. Table I lists exemplary groups of haploid and diploid fungi of medical, agricultural, or commercial value.

Table I: Exemplary Haploid and Diploid Fungi Ascomycota Animal patho ens: Plant Pathoogens: General Commercial Significance Aspergillus fumigatusAlternaria solanii Aspergillus niger Alternaria spp Gaeumannomyces graminisSchizosaccharomyces pombe Blastomyces dermatidisCercospora zeae-maydisPichia pastoris Candida spp includingBotrytis cinerea Hansenula polymorpha Candida dublinensis Claviceps purpurea Ashbya gossipii Candida glabrata Corticum rolfsii Aspergillus nidulans Candida krusei Endothia parasitica Trichoderma reesei Candida lustaniae Sclerotinia sclerotiorumAureobasidium pullulans Candida parapsilopsisErysiphe gramini Yarrowia lipolytica Candida tropicalis Erysiphe triticii Candida utilis Coccidioides immitis Fusarium spp. Kluveromyces lactis Exophalia dermatiditisMagnaporthe grisea Fusarium oxysporum Plasmopara viticola Histoplasma capsulatumPenicillium digitatum Pneumocystis carinii Ophiostoma ulmi Rhizoctonia species including oryzae Septoria species including - Septoria avenae Septoria nodorum Septoria passerinii Septoria triticii Venturia inequalis Verticillium dahliae Verticillium albo-atrum Basidiomycota Animal pathogens: Plant Patho,_ens: General commercial significance Cryptococcus neoformans Puccinia spp includingAgaricus campestris Trichosporon beigelii Puccinia coronata Phanerochaete chrysosporium Puccinia graminis Gloeophyllum trabeum Puccinia recondita Trametes versicolor Puccinia striiformis Tilletia spp including Tilletia caries Tilletia controversa Tilletia indica Tilletia tritici Tilletiafoetida Ustilago maydis Ustilago hordeii Zygomycota Animal ~atho~.~ens: Plant Patho ens: General commercial si~~nificance Absidia corymbifera Mucor rouxii Rhizomucor pusillus Rhizopus arrhizus All Candida species except Candida glabrata are obligate diploid species that lack a haploid phase in its life cycle, and are thus subject to the application of the GRACE
methods.
5.2 Construction of GRACE Strains According to the invention, in a GRACE strain of a diploid organism, only one allele of a gene is eliminated, while the second allele is placed under the control of the heterologous promoter, the activity of which is regulatable. Where the gene is essential, elimination of both alleles will be lethal or severely crippling for growth.
Therefore, in the present invention, a heterologous promoter is used to provide a range of levels of expression of the second allele. Depending on the conditions, the second allele can be non-expressing, underexpressing, overexpressing, or expressing at a normal level relative to that when the allele is linked to its native promoter. A heterologous promoter is a promoter from a different gene from the same pathogenic organism, or it can be a promoter from a different species.
Precise replacement of a target gene is facilitated by using a gene disruption cassette comprising a selectable marker, preferably a dominant selectable marker, that is expressible in the strain of interest. The availability of two distinct dominant selectable markers allows the gene replacement process to be engineered at both alleles of the target gene, without the required counterselection step inherent in existing methods.
In particular, the present invention encompasses a method for constructing a strain of diploid pathogenic fungal cells, in which both alleles of a gene are modified, the method comprising the steps of (a) modifying a first allele of a gene in diploid pathogenic fungal cells by recombination using a gene disruption cassette comprising a nucleotide sequence encoding a selectable marker that is expressible in the cells, thereby providing heterozygous pathogenic fungal cells in which the first allele of the gene is inactivated; and (b) modifying the second allele of the gene in the heterozygous diploid pathogenic fungal cells by recombination with a promoter replacement fragment comprising a heterologous promoter, such that the expression of the second allele of the gene is regulated by the heterologous promoter.

The process can be repeated for a desired subset of the genes such that a collection of GRACE strains is generated wherein each strain comprises a modified allelic pair of a different gene. By repeating this process for every gene in a pathogenic fungus, a complete set of GRACE strains representing the entire genome of the pathogenic fungus can S be obtained. Thus, the present invention provides a method of assembling a collection of diploid pathogenic fungal cells, each of which comprises the modified alleles of a different gene. The method comprises repeating the steps of modifying pairs of alleles a plurality of times, wherein a different pair of gene alleles is modified with each repetition, thereby providing the collection of diploid pathogenic fungal cells each comprising the modified alleles of a different gene.
A preferred embodiment for the construction of GRACE strains, uses the following two-step method. C. albicans is used as an example.
5.2.1 Heterozygote Construction By Gene Disruption Several art-known methods are available to create a heterozygote mutant. In less preferred embodiments, auxotrophic markers, such as but not limited to CaURA3, CaHIS3, CaLEU2, or CaTRPl, could be used for gene disruption if desired.
However, the preferred method of heterozygote construction in diploid fungi employs a genetically modified dominant selectable marker. G albicans is sensitive to the nucleoside-like antibiotic streptothricin at a concentration of 200 micrograms per milliliter.
The presence of the Escherichia coli SAT1 gene within C. albicans allows acetylation of the drug rendering it nontoxic and permitting the strain to grow in the presence of streptothricin at a concentration of 200 micrograms per milliliter. Expression of the SAT1 gene in C. albicans is made possible by engineering the gene so that its DNA sequence is altered to conform to the genetic code of this organism and by providing a CaACTl promoter (Morschhauser et al. .(1998) Mol. Gen. Genet. 257:412-420) and a CaPCKI terminator sequence (Leuker et al.
(1997) Gene 192: 235-40). This genetically modified marker is referred to as CaSATI which is the subject of a copending United States nonprovisional application, filed February 16, 2001.
C. albicans is also sensitive to a second fungicidal compound, blasticidin, whose cognate resistance gene from Bacillus cereus, BSR, has similarly been genetically engineered for expression in C. albicans (CaBSRI ), and has been shown to confer a dominant drug resistance phenotype. PCR amplification of either dominant selectable marker so as to include about 65 by of flanking sequence identical to the sequence 5' and 3' of the C. albicans gene to be disrupted, allows construction of a gene disruption cassette for any given C. albicans gene.
By employing the method of Baudin et al. ( 1993, Nucleic Acids Research 21:3329-30), a gene disruption event can be obtained following transformation of a C.
albicans strain with the PCR-amplified gene disruption cassette and selection for drug resistant transformants that have precisely replaced the wild type gene with the dominant selectable marker. Such mutant strains can be selected for growth in the presence of a drug, such as but not limited to streptothricin. The resulting gene disruptions are generally heterozygous in the diploid C. albicans, with one copy of the allelic pair on one homologous chromosome disrupted, and the other allele on the other homologous chromosome remaining as a wild type allele as found in the initial parental strain. The disrupted allele is non-functional, and expression from this allele of the gene is nil. By repeating this process for all the genes in the genome of an organism, a set of gene disruptions can be obtained for every gene in the organism. The method can also be applied to a desired subset of genes.
5.2.2 Conditional Expression By a Tetracycline-Regulatable Promoter The conditional expression system used in this embodiment of the invention comprises a regulatable promoter and a means for regulating promoter activity.
Conditional expression of the remaining wild type allele in a heterozygote constructed as set forth in Section 5.1.1 is achieved by replacing its promoter with a tetracycline-regulatable promoter . . system that is developed initially for S. cerevisiae but which is modified for use in C. albicans. See Gari et al., 1997, Yeast 13:837-848; and Nagahashi et al., 1997, Mol. Gen.
Genet. 255:372-375.
Briefly, conditional expression is achieved by first constructing a transactivation fusion protein comprising the E. coli TetR tetracycline repressor domain or DNA binding domain (amino acids 1-207) fused to the transcription activation domain of S.
cerevisiae GAL4 (amino acids 785-881 ) or HAP4 (amino acids 424-554). Multiple CTG
codon corrections were introduced to comply with the C. albicans genetic code.
The nucleotide sequences encoding the transactivation fusion proteins of E. coli TetR (amino acids 1-207) plus S. cerevisiae GAL4 (amino acids 785-881), and of E. coli TetR (amino acids 1-207) plus S. cerevisiae HAP4 (amino acids 424-554), both of which have been modified for proper expression in C. albicans are encompassed by the present invention.
Accordingly, the invention provides haploid or diploid cells that can comprise a nucleotide sequence encoding a transactivation fusion protein expressible in the cells, wherein the transactivation fusion protein comprises a DNA binding domain and a transcription activation domain.
Constitutive expression of the transactivation fusion protein in C. albicans can be achieved by providing a CaACTI promoter and CaACTI terminator sequence.
However, it will be appreciated that any regulatory regions, promoters and terminators, that are functional in C. albicans can be used to express the fusion protein. Thus, a nucleic acid molecule comprising a promoter functional in C. albicans, the coding region of a transactivation fusion protein, and a terminator functional in C. albicans, are encompassed by the present invention. Such a nucleic acid molecule can be a plasmid, a cosmid, a transposon, or a mobile genetic element. In a preferred embodiment, the TetR-Gal4 or TetR-Hap4 transactivators can be stably integrated into a C. albicans strain, by using either ura3 and his3 auxotrophic markers.
In this embodiment, the invention further provides that a promoter replacement fragment comprising a nucleotide sequence encoding heterologous promoter which comprises at least one copy of a nucleotide sequence which is recognized by the DNA binding domain of the transactivation fusion protein, and wherein binding of the transactivation fusion protein increases transcription of the heterologous promoter. The heterologous tetracycline promoter initially developed for S cerevisiae gene expression, contains an ADHI 3' terminator sequence, variable number of copies of the tetracycline operator sequence (2, 4, or 7 copies), and the CYCI basal promoter. The tetracycline promoter has been subcloned adjacent to both CaHIS3 and CaSATI selectable markers in the orientation favoring tetracycline promoter-dependent regulation when placed immediately upstream the open reading frame of the gene of interest. PCR
amplification of the CaHIS3-Tet promoter cassette incorporates 65bp of flanking sequence homologous to the promoter sequence around nucleotide positions -200 and -1 (relative to the start codon) of the target gene, thereby producing a conditional promoter replacement fragment for transformation. When transformed into a C. albicans strain made heterozygous as described in Section 5.1.1 using the CaSATI disruption cassette, homologous recombination between the promoter replacement fragment and the promoter of the wild type allele generates a strain in which the remaining wild type gene is conditionally regulated gene by the tetracycline promoter. Transformants are selected as His prototrophs and verified by Southern blot and PCR analysis.
In this particular embodiment, the promoter is induced in the absence of tetracycline, and repressed by the presence of tetracycline. Analogs of tetracycline, including but not limited to chlortetracycline, demeclocycline, doxycycline, meclocycline, methocycline, minocycline hydrochloride, anhydrotetracycline, and oxytetracycline, can also be used to repress the expression of the modified gene allele in a GRACE
strain.
The present invention also encompasses alternative variants of the tetracycline promoter system, based upon a mutated tetracycline repressor (tetR) molecule, designated tetR', which is activated (i. e. binds to its cognate operator sequence) by binding of the antibiotic effector molecule to promote expression, and is repressed (i. e. does not bind to the operator sequence) in the absence of the antibiotic effectors, when the tetR' is used instead of, or in addition to, the wild-type tetR. For example, the GRACE
method could be performed using tetR' instead of tetR in cases where repression is desired under conditions which lack the presence of tetracycline, such as shut off of a gene participating in drug transport (e.g. CaCDRI, CaPDRS, or CaMDRI). Also, the GRACE method could be adapted to incorporate both the tetR and tetR' molecules in a dual activator/repressor system where tetR is fused to an activator domain and tetR' is fused to a general repressor (e.g.
CaSsr6 or CaTupl) to enhance or further repress expression in the presence of the antibiotic effector molecules (Belli et al., 1998, Nucl Acid Res 26:942-947 which is incorporated herein by reference). These methods of providing conditional expression are also contemplated.
In another embodiment of the invention, the method may also be applied to haploid pathogenic fungi by modifying the single allele of the gene via recombination of the allele with a promoter replacement fragment comprising a nucleotide sequence encoding a heterologous promoter, such that the expression of the gene is conditionally regulated by the heterologous promoter. By repeating this process for a preferred subset of genes in a haploid pathogenic organism, or its entire genome, a collection or a complete set of conditional mutant strains can be obtained. A preferred subset of genes comprises genes that share substantial nucleotide sequence homology with target genes of other organisms, e.g.~ C. albicans and S. cerevisiae. For example, this variation to the method of the invention may be applied to haploid fungal pathogens including, but not limited to, animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida glabrata, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species.
The means to achieve conditional expression are not restricted to the tetracycline promoter system and can be performed using other conditional promoters. Such conditional promoter may, for example, be regulated by a repressor which repress transcription from the promoter under particular condition or by a transactivator which increases transcription from the promoter, such as, when in the presence of an inducer. For example, the C. albicans CaPCKl promoter is not transcribed in the presence of glucose but has a high level of expression in cells grown on other carbon sources, such as succinate, and therefore could also be adopted for conditional expression of the modified allele in a GRACE strain. To this end, it has been shown that both CaHISI and CaSATl are essential for growth on glucose-containing medium using the CaPCKI promoter as an alternative to the tetracycline promoter in the above description. In this instance, the CaPCKl promoter is heterologous to the gene expressed and not to the organism, and such heterologous promoters are also encompassed in the invention. Alternative promoters that could functionally replace the tetracycline promoter include but are not limited to other antibiotic-based regulatable promoter systems (e.g., pristinamycin-induced promoter or PIP) as well as Candida albicans conditionally-regulated promoters such as MET25, MAL2, PHOS, GALI,10, STE2, or STE3.
In a preferred embodiment of the GRACE method, performing the gene disruption first enables heterozygous strains to be constructed and separately collected as a heterozygote strain collection during the process of drug target validation.
Such a C albicans heterozygote strain collection enables drug screening approaches based on haploinsufficiency for validated targets within the collection. As used herein, the term "haploinsufficiency" refers to the phenomenon whereby heterozygous strains for a given gene express approximately half the normal diploid level of a particular gene product.
Consequently, these strains provide constructions having a diminished level of the encoded gene product, and they may be used directly in screens for antifungal compounds. Here differential sensitivity of a diploid parent, as compared with its heterozygous derivative, will indicate that a drug is active against the encoded gene product.
It is clear to those skilled in the art that the order of allele modification followed in this embodiment of the invention is not critical, and that it is feasible to perform these steps in a different order such that the conditional-expressing allele is constructed first ~d ~e disruption of the remaining wild type gene allele be performed subsequently.
However, where the promoter replacement step is carried out first, care should be taken to delete sequences homologous to those employed in the gene disruption step.
A specific application of the GRACE method, as used to construct modified alleles of the target gene CaKRE9 is provided in Section 6.

5.2.3 Alternative Methods of Conditional Expression In other embodiments of the invention, conditional expression could be achieved by means other than the reliance of conditional promoters. For example, conditional expression could be achieved by the replacement of the wild type allele in heterozygous strains with temperature sensitive alleles derived in vitro, and their phenotype would then be analyzed at the nonpermissive temperature. In a related approach, insertion of a ubiquitination signal into the remaining wild type allele to destabilize the gene product during activation conditions can be adopted to examine phenotypic effects resulting from gene inactivation. Collectively, these examples demonstrate the manner in which C.
albicans genes can be disrupted and conditionally regulated using the GRACE
method.
In an alternative embodiment of the present invention, a constitutive promoter regulated by an excisable transactivator can be used. The promoter is placed upstream to a target gene to repress expression to the basal level characteristic of the promoter. For example, in a fungal cell, a heterologous promoter containing lexA operator elements may be used in combination with a fusion protein composed of the lexA
DNA
binding domain and any transcriptional activator domain (e.g. GAL4, HAP4, VP16) to provide constitutive expression of a target gene. Counterselection mediated by 5-FOA can be used to select those cells which have excised the gene encoding the fusion protein. This procedure enables an examination of the phenotype associated with repression of the target gene to the basal level of expression provided by the lexA heterologous promoter in the absence of a functional transcription activator. The GRACE strains generated by this approach can be used for drug target validation as described in detail in the sections below.
In this system, the low basal level expression associated with the heterologous promoter is critical. Thus, it is preferable that the basal level of expression of the promoter is low to make this alternative shut-off system more useful for target validation.
Alternatively, conditional expression of a target gene can be achieved without the use of a transactivator containing a DNA binding, transcriptional activator domain. A cassette could be assembled to contain a heterologous constitutive promoter downstream of, for example, the URA3 selectable marker, which is flanked with a direct repeat containing homologous sequences to the 5' portion of the target gene.
Additional homologous sequences upstream of the target, when added to this cassette would facilitate homologous recombination and replacement of the native promoter withe above-described heterologous promoter cassette immediately upstream of the start codon of the target gene or open reading frame. Conditional expression is achieved by selecting strains, by using S-FOA containing media, which have excised the heterologous constitutive promoter and URA3 marker (and consequently lack those regulatory sequences upstream of the target gene required for expression of the gene) and examining the growth of the resulting strain versus a wild type strain grown under identical conditions.
5.3 Identification of Essential Genes and Virulence Genes 5.3.1 Essential Genes The present invention provides methods for determining whether the gene that has been modified in a GRACE strain is an essential gene or a virulence gene in a pathogenic organism of interest. To determine whether a gene is an essential gene in an organism, a GRACE strain containing the modified alleles of the gene is cultured under conditions wherein the second modified allele of the gene which is under conditional expression, is substantially underexpressed or not expressed. The viability and/or growth of the GRACE strain is compared with that of a wild type strain cultured under the same conditions. A loss or reduction of viability or growth indicates that the gene is essential to the survival of a pathogenic fungus. Accordingly, the present invention provides a method for identifying essential genes in a diploid pathogenic organism comprising the steps of culturing a plurality of GRACE strains under culture conditions wherein the second allele of each of the gene modified in the respective GRACE strain is substantially underexpressed or not expressed; determining viability and/or growth indicators) of the cells;
and comparing that with the viability and/or growth indicators) of wild type cells. The level of expression of the second allele can be less than 50% of the non-modified allele, less than 30%, less than 20%, and preferably less than 10%. Depending on the heterologous promoter used, the level of expression can be controlled by, for example, antibiotics, metal ions, specific chemicals, nutrients, pH, temperature, etc.
Candida albicans is used herein as an example which has been analyzed by the GRACE methodology.
For example, C. albicans conditional gene expression using the GRACE
method was performed using CaKREI, CaKRES, CaKRE6, and CaKRE9 (Fig. 3).
CaKRES, CaKRE6, and CaKRE9 are predicted to be essential or conditionally essential (CaKRE9 null strains are nonviable on glucose but viable on galactose), in C.
albicans as demonstrated by gene disruption using the Ura blaster method. CaKREI has been demonstrated as a nonessential gene using the Ura blaster method in C.
albicans. Strains heterozygous for the above genes were constructed by PCR-based gene disruption method using the CaSATl disruption cassette followed by tetracycline regulated promoter replacement of the native promoter of the wild type allele. Robust growth of each of these strains suggests expression proceeds normally in the absence of tetracycline.
When tetracycline is added to the growth medium, expression of these tetracycline promoter-regulated genes is greatly reduced or abolished. In the presence of tetracycline, the GRACE
strain cells containing each one of the three essential C. albicans genes cited above stop growing. As expected, only the CaKREI GRACE strain demonstrates robust growth despite repression of CaKREI expression.
To further examine the utility of the GRACE method in target validation, growth of four additional GRACE strains controlling expression of the known essential genes CaTUBI, CaALG7, CaAURI, and CaFKSI, as well as the predicted essential gene CaSAT2, and CaKREI were compared under inducing versus repressing conditions (Fig. 4).
As expected, GRACE strains of CaTUBl, CaALG7, CaAURI and CaFKSI failed to grow under repressing conditions, unlike the non-essential CaKREl GRACE strain.
Furthermore, as predicted, the CaSAT2 GRACE strain demonstrates essentiality of this gene in C.
albicans. The CaSAT2 gene, which has been engineered as a dominant selectable marker for use in,C. albicans, is a C. albicans gene that is homologous to a S.
cereviaiae gene but is unrelated to the Satl gene of E. coli.
In all cases based on other disruption data that have been generated, this is the expected response if the tetracycline regulated gene is repressed to a level where it is nonfunctional in the presence of tetracycline. Furthermore. in applying the GRACE
methodology of conditional gene disruption to two additional C. albicans genes (CaYPDI, and CaYNLl94c) whose S cerevisiae counterpart is known not to be essential, no inhibition of growth was observed when these strains were incubated in the presence of tetracycline.
These results establish that the method of conditional gene expression using a GRACE
strain is a reliable indicator of gene essentiality.
Furthermore, the utility of the present method, as a rapid and accurate means to identifying the complete set of essential genes in C. albicans, has been demonstrated by an analysis of the null phenotype of a large number of genes using the GRACE
two-step method of gene disruption and conditional expression. Target genes were selected as being ~g~ Specific and essential. Such genes are referred to as target essential genes in the screening assays described below.
A literature search identified reports of URA blaster-based gene disruption experiments on a total of 89 genes, of which 13 genes were presumed to be essential, based on the inability to construct homozygous deletion strains. The 13 genes are CaCCT8 (Rademacher et al., Microbiology, UK 144, 2951-2960 (1998)); CaFKSl (Mio et al., J.

Bacteriol, 179, 4096-105 (1997); and Douglas, et al., Antimicrob Agents Chemother 41, 2471-9 (1997)); CaHSP90 (Swoboda et al., Infect Immun 63, 4506-14 (1995));
CaKRE6 (Mio et al., J. Bacteriol 179, 2363-72 (1997)); CaNMTl (Weinberg et al., Mol Microbiol 16, 241-50 (1995)); CaPRSl (Payne et al., J. Med. Vet. Mycol. 35, 305-12 (1997));
CaPSAI
(Care et al., Mol Microbiol 34, 792-798 (1999)); CaRAD6 (Care et al., Mol Microbiol 34, 792-798 (1999)); CaSEC4 (Mao et al., J. Bacteriol 181, 7235-7242 (1999));
CaSECl4 (Monteoliva et al., Yeast 12, 1097=105 (1996)); CaSNFI (Petter et al., Infect Immun. 65, 4909-17 (1997)); CaTOP2 (Keller, et al., Biochem J., 329-39 (1997)); and CaEFT2 (Mendoza et al., Gene 229, 183-1991 (1999)). These 13 putatively essential genes and CaTUBl, CaALGI, and CaAURIof C. albicans are not initially identified by the GRACE
method. However, GRACE strains containing modified alleles of any one of these 17 genes and their uses are encompassed by the invention, for example, the CaTUBl , CaALGI , and CaAURl GRACE strains in Fig. 4 and the CaKRE6 GRACE strain in Fig. 3. Any of these 17 genes may be included as a control for comparisons in the methods of the invention, or 1 S as a positive control for essentiality in the collections of essential genes of the invention.
The nucleic acid molecules comprising a nucleotide sequence corresponding to any of these 17 genes may be used in the methods of drug discovery of the invention as drug targets, or they may be included individually or in subgroups as controls in a kit or in a nucleic acid microarray of the invention.
In contrast to the use of conventional method, application of the GRACE
method has already identified significantly more C. albicans essential genes than previously determined by the collective efforts of the entire C. albicans research community. The data presented herewith establishes the speed inherent to the approach of the invention and, therefore, the feasibility of extending the GRACE method to the examination of all the genes of the C. albicans genome, the identification of the complete set of essential genes of this diploid fungal pathogen, and its application to other species.
An alternative method is available for assessing the essentiality of the modified gene in a GRACE strain. According to the invention, repression of expression of the modified gene allele within a GRACE strain may be achieved by homologous recombination-mediated excision of the gene encoding the transactivator protein. In a preferred embodiment, where conditional expression of a target gene is achieved using the tetracycline-regulated promoter, constitutive expression (under nonrepressing conditions) may be repressed by homologous recombination-mediated excision of the transactivator gene (TetR-GAL4AD). In this way, an absolute achievable repression level is produced independently of that produced by tetracycline-mediated inactivation of the transactivator protein. Excision of the transactivator gene is made possible by virtue of the selectable marker and integration strategy used in GRACE strain construction. Stable integration of the CaURA3-marked plasmid containing the TetR-GAL4AD transactivator gene into the CaLEU2 locus results in a tandem duplication of CaLEU2 flanking the integrated plasmid.
S Counterselection on 5-FOA-containing medium can then be performed to select for excision of the CaURA3-marked transactivator gene and to directly examine whether this alternative repression strategy reveals the target gene to be essential.
Three examples of genes defined as essential on S-FOA containing medium but lacking any detectable growth impairment on tetracycline supplemented medium are the genes, CaYCL052c, CaYNLl94c and CaYJR046c. Presumably, this is due to the target gene exhibiting a lower basal level of expression under conditions where the transactivator gene has been completely eliminated than its gene product incompletely inactivated by addition of tetracycline. Thus, the GRACE method offers two independent approaches for the determination of whether or not a given gene is essential for viability of the host strain.
5.3.2 Virulence/Pathogenicity Genes The present invention also provides methods of using the GRACE strains of a diploid pathogenic organism to identify virulence/pathogenicity genes. In addition to uncovering essential genes of a pathogenic organism, the GRACE methodology enables the identification of other genes and gene products potentially relevant to the screening of drugs useful .for the treatment of diseases caused by the pathogenic organism.
Nonessential genes and their gene products of a pathogen which nevertheless display indispensable roles in the pathogenesis process, may therefore serve as potential drug targets for prophylactic drug development and could be used in combination with existing cidal therapeutics to improve treatment strategies. Thus, genes and their products implicated in virulence and/or pathogenicity represent another important class of potential drug targets.
Moreover, some of the genes implicated in virulence and pathogenicity may be species-specific, and unique to a particular strain of pathogen. It has been estimated that approximately 6-7% of the genes identified through the C. albicans sequencing project are absent in S
cerevisiae. This represents as many as 420 Candida albicans-specific genes which potentially participate in the process of pathogenesis or virulence. Such a large scale functional evaluation of this gene set can only be achieved using the GRACE methodology of the invention.
Although essential genes provide preferred targets, value would also be placed on those nonessential C. albicans specific genes identified. The potential role of nonessential C. albicans-specific genes in pathogenesis maybe evaluated and prioritized according to virulence assays (e.g. buccal epithelial cell adhesion assays and macrophage assays) and various C. albicans infection studies (e.g. oral, vaginal, systemic) using mouse or other animal models. In the same manner described above for essential genes, it is equally feasible to demonstrate whether nonessential genes comprising the GRACE strain collection are required for pathogenicity in a cellular assay or in a mouse model system.
Accordingly, GRACE strains that fail to cause fungal infection in mice under conditions of gene inactivation by tetracycline (or alternative gene inactivation means) define the GRACE
virulence/pathogenicity subset of genes. More defined subsets of pathogenicity genes, for example those genes required for particular steps in pathogenesis (e. g.
adherence or invasion) can be determined by applying the GRACE pathogenicity subset of strains to in vitro assays which measure the con esponding process. For example, examining GRACE
pathogenicity strains in a buccal adhesion or macrophage assay by conditional expression of individual genes would identify those pathogenicity factors required for adherence or cell invasion respectively. Moreover, essential genes that display substantially reduced virulence and growth rate when only partially inactivated represent "multifactorial" drug targets for which even minimally inhibitory high specificity compounds would display therapeutic value.
Accordingly, to determine whether a gene contributes toward the virulence/pathogenicity of a pathogenic organism in a host, a GRACE strain of the pathogen containing the modified alleles of the gene is allowed to infect host cells or animals under conditions wherein the second modified allele of the gene which is under conditional expression, is substantially underexpressed or not expressed. After the host cells and/or animals have been contacted with the GRACE strain for an appropriate period of time, the condition of the cells and/or animals is compared with cells and/or animals infected by a wild type strain under the same conditions. Various aspects of the infected cell's morphology, physiology, and/or biochemistry can be measured by methods known in the art.
When an animal model is used, the progression of the disease, severity of the symptoms, and/or survival of the host can be determined. Any loss or reduction of virulence or pathogenicity displayed by the GRACE strain indicates that the gene modified in the strain contributes to or is critical to the virulence andlor pathogenicity of the virus. Such genes are referred to as target virulence genes in the screening assays described below.
In another aspect of the present invention, GRACE methodology can be used for the identification and delineation of genetic pathways known to be essential to the development of pathogenicity. For example, extensive work in S. cerevisiae has uncovered a number of processes including cell adhesion, signal transduction, cytoskeletal assembly, that play roles in the dimorphic transition between yeast and hyphal morphologies. Deletion of orthologous genes participating in functionally homologous cellular pathways in pathogenic fungi such as C. albicans, A. fumigatus, and C. neoformans, has clearly demonstrated a concomitant loss of virulence. Therefore, the use of GRACE
strains of S orthologous genes found in C. albicans and other pathogenic fungi could rapidly validate potential antifungal drug target genes whose inactivation impairs hyphal development and pathogenicity.
5.3.3 Validation of Genes Encoding Drug Targets Target gene validation refers to the process by which a gene product is identified as suitable for use in screening methods or assays in order to find modulators of the function or structure of that gene product. Criteria used for validation of a gene product as a target for drug screening, however, may be varied depending on the desired mode of action that the compounds sought will have, as well as the host to be protected.
In one aspect of the present invention, a set of GRACE strains identified and grouped as having only modified alleles of essential genes can be used directly for drug screening.
In another aspect, the initial .set of essential genes is further characterized using, for example, nucleotide sequence comparisons, to identify a subset of essential genes which include only those genes specific to fungi - that is, a subset of genes encoding essential genes products which do not have homologs in a host of the pathogen, such as humans. Modulators, and preferably inhibitors, of such a subset of genes in a fungal pathogen of humans would be predicted to be much less likely to have toxic side effects when used to treat humans.
Similarly, other subsets of the larger essential gene set could be defined to include only those GRACE strains carrying modified allele pairs that do not have a homologous sequence in one or more host (e.g., mammalian) species to allow the detection of compounds expected to be used in veterinary applications. In addition, using other homology criteria, a subset of GRACE strains could be identified that would be used for the detection of anti-fungal compounds active against agricultural pathogens, inhibiting targets that do not have homologs in the crop to be protected.
Current C. albicans gene disruption strategies identify nonessential genes and permit the inference that other genes are essential, based on a failure to generate a homozygous null mutant. The null phenotype of a drug target predicts the absolute efficaciousness of the "perfect" drug acting on this target. For example, the difference between a cidal (cell death) versus static (inhibitory growth) null terminal phenotype for a particular drug target. Gene disruption of CaERGIl, the drug target of fluconazole, is presumed to be essential based on the failure to construct a homozygous CaERGII deletion strain using the URA blaster method. However, direct evaluation of its null phenotype being cidal or static could not be performed in the pathogen, and only after the discovery of fluconazole was it possible to biochemically determine both the drug, and presumably the drug target to be static rather than as cidal. Despite the success fluconazole enjoys in the marketplace, its fungistatic mode of action contributes to its primary limitation, i.e., drug resistance after prolonged treatment. Therefore, for the first time, the ability to identify and evaluate cidal null phenotypes for validated drug targets within the pathogen as provided by the invention, now enables directed strategies to identifying antifungal drugs that specifically display a fungicidal mode of action.
Using a single GRACE strain or a desired collection of GRACE strains comprising essential genes, one or more target genes can be directly evaluated as displaying either a cidal or static null phenotype. This is determined by first incubating GRACE
strains under repressing conditions for the conditional expression of the second allele for varying lengths of time in liquid culture, and measuring the percentage of viable cells following plating a defined number of cells onto growth conditions which relieve repression. The percentage of viable cells that remain after return to non-repressing 2U . conditions reflects either a cidal (low percent survival) or static (high percent survival) phenotype. Alternatively, .vital dyes such as methylene blue or propidium iodide could be used to quantify percent viability of cells for a particular strain under repressing versus inducing conditions. As known fungicidal drug targets are included in the GRACE strain collection (e.g CaAURl), direct comparisons can be made between this standard fungicidal drug target and novel targets comprising the drug target set. In this way each member of the target set can be immediately ranked and prioritized against an industry standard cidal drug target to select appropriate drug targets and screening assays for the identification of the most rapid-acting cidal compounds.
5.4 Essential Genes and Virulence Genes 5.4.1 Nucleic Acids Encoding Targets, Vectors, and Host Cells By practice of the methods of the invention, the essentiality and the contribution to virulence of substantially all the genes in the genome of an organism can be determined. The identities of essential genes and virulence genes of a diploid pathogenic organism, such as Candida albicans, once revealed by the methods of the invention, allow the inventors to study their functions and evaluate their usefulness as drug targets.
Information regarding the structure and function of the gene product of the individual essential gene or virulence gene allows one to design reagents and assays to find compounds that interfere with its expression or function in the pathogenic organism.
Accordingly, the present invention provides information on whether a gene or its products) is essential to growth, survival, or proliferation of the pathogenic organism, or that a gene or its products) contributes to virulence or pathogenicity of the organism with respect to a host. Based on this information, the invention further provides, in various embodiments, novel uses of the nucleotide and/or amino acid sequences of genes that are essential and/or that contributes to virulence or pathogenicity of a pathogenic organism, for purpose of discovering drugs that act against the pathogenic organism. Moreover, the present invention provides specifically the use of this information to identify orthologs of these essential genes in a non-pathogenic yeast, such as Saccharomyces cerevisiae, and the use of these orthologs in drug screening methods. Although the nucleotide sequence of the orthologs of these essential genes in S.
cerevisiae may be known, it was not appreciated that these S. cerevisiae genes can be useful for discovering drugs against pathogenic fungi.
As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising a nucleotide sequence encoding a polypeptide or a biologically active ribonucleic acid (RNA). The term can further include nucleic acid molecules comprising upstream, downstream, and/or intron nucleotide sequences. The term "open reading frame (ORF)," means a series of nucleotide triplets coding for amino acids without any termination codons and the triplet sequence is translatable into protein using the codon usage information appropriate for a particular organism.
As used herein, the term "target gene" refers to either an essential gene or a virulence gene useful in the invention, especially in the context of drug screening. The terms "target essential gene" and "target virulence gene" will be used where it is appropriate to refer to the two groups of genes separately. However, it is expected that some genes will contribute to virulence and be essential to the survival of the organism. The target genes of ~e invention may be partially characterized, fully characterized, or validated as a drug target, by methods known in the art and/or methods taught hereinbelow. As used herein, the term "target organism" refers to a pathogenic organism, the essential and/or virulence genes of which are useful in the invention.
The term "nucleotide sequence" refers to a heteropolymer of nucleotides, including but not liriiited to ribonucleotides and deoxyribonucleotides, or the sequence of these nucleotides. The terms "nucleic acid" and "polynucleotide" are also used interchangeably herein to refer to a heteropolymer of nucleotides, which may be unmodified or modified DNA or RNA. For example, polynucleotides can be single-stranded or double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, hybrid molecules comprising DNA and RNA with a mixture of single-stranded and double-stranded regions. In addition, the polynucleotide can be composed of triple-stranded regions comprising DNA, RNA, or both. A polynucleotide can also contain one or modified bases, or DNA or RNA backbones modified for nuclease resistance or other reasons.
Generally, nucleic acid segments provided by this invention can be assembled from fragments of the genome and short oligonucleotides, or from a series of oligonucleotides, or from individual nucleotides, to provide a synthetic nucleic acid.
The term "recombinant," when used herein to refer to a polypeptide or protein, means that a polypeptide or protein is derived from recombinant (e.
g., microbial or mammalian) expression systems. "Microbial" refers to recombinant polypeptides or proteins made in bacterial or fungal (e.g., yeast) expression systems. As a product, "recombinant microbial" defines a polypeptide or protein essentially unaccompanied by associated native glycosylation. Polypeptides or proteins expressed in most bacterial cultures, e. g., E coli, will be free of glycosylation modifications;
polypeptides or proteins expressed in yeast will be glycosylated.
The term "expression vehicle or vector" refers to a plasmid or phage or virus, for expressing a polypeptide from a nucleotide sequence. An expression vehicle can comprise a transcriptional unit, also referred to as an expression construct, comprising an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and which is operably linked to the elements of (1); and (3)~appropriate transcription initiation and termination sequences.
"Operably linked" refers to a link in which the regulatory regions and the DNA
sequence to be expressed are joined and positioned in such a way as to permit transcription, and ultimately, translation. In the case of C. albicans, due to its unusual codon usage, modification of a coding sequence derived from other organisms may be necessary to ensure a polypeptide having the expected amino acid sequence is produced in this organism.
Structural units intended for use in yeast or eukaryotic expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where a recombinant protein is expressed without a leader or transport sequence, it may include an N-terminal methionine residue. This residue may or may not be subsequently cleaved from the expressed recombinant protein to provide a final product.
The term "recombinant host cells" means cultured cells which have stably integrated a recombinant transcriptional unit into chromosomal DNA or carry stably the recombinant transcriptional unit extrachromosomally. Recombinant host cells as defined S herein will express heterologous polypeptides or proteins, and RNA encoded by the DNA
segment or synthetic gene in the recombinant transcriptional unit. This term also means host cells which have stably integrated a recombinant genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers.
Recombinant expression systems as defined herein will express RNA, polypeptides or proteins endogenous to the cell upon induction of the regulatory elements linked to the endogenous DNA segment or gene to be expressed. The cells can be prokaryotic or eukaryotic.
The term "polypeptide" refers to the molecule form by joining amino acids to each other by peptide bonds, and may contain amino acids other than the twenty commonly used gene-encoded amino acids. The term "active polypeptide" refers to those forms of the polypeptide which retain the biologic and/or immunologic activities of any naturally occurring polypeptide. The term "naturally occurring polypeptide" refers to polypeptides produced by cells that have not been genetically engineered and specifically contemplates various polypeptides arising from post-translational modifications of the polypeptide including, but not limited to, proteolytic processing, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation.
The term ".isolated" as used herein refers to a nucleic acid or polypeptide separated from at least one macromolecular component (e.g., nucleic acid or polypeptide) present with the nucleic acid or polypeptide in its natural source. In one embodiment, the polynucleotide or polypeptide is purified such that it constitutes at least 95% by weight, more preferably at least 99.8% by weight, of the indicated biological macromolecules present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000 daltons, can be present).
Table II lists a set of fungal specific genes that are demonstrated to be essential in C. albicans when conditionally expressed under the tetracycline repression system in the respective GRACE strains or when the gene encoding the transactivator protein is excised in the respective GRACE strain.in a 5-FOA assay.

Table II
Gene designationDNA Protein PrimerPrimerPrimerPrimerPrimerPrimer S ID Se ID KOu KOdn tet tet A B
a do CaYBR070C SAT21 63 124 185 246 307 368 429 CaYBR167C POP72 64 125 186 247 308 369 430 CaYBR243C ALG73 65 126 187 248 309 370 431 CaYCL031C RRP74 66 127 188 249 310 371 432 CaYDL105W 5 67 128 189 250 311 372 433 CaYDL153C SAS106 68 129 190 251 312 373 434 CaYDR052C DBF47 69 130 191 252 313 374 435 CaYDR118W APC48 70 131 192 253 314 375 436 CaYDR361C 9 71 132 193 254 315 376 437 CaYDR412W 10 72 133 194 255 316 377 438 CaYDR498C SEC2011 73 134 195 256 317 378 439 CaYER026C CHO112 74 135 196 257 318 379 440 CaYGR090W 13 75 136 197 258 319 380 441 CaYGR245C 14 76 137 198 259 320 381 442 CaYHR007C ERGI115 77 138 199 260 321 382 443 CaYHR036W 16 78 139 200 261 322 383 444 CaYHR058C MED617 79 140 201 262 323 384 445 CaYHR118C ORC618 80 141 202 263 324 385 446 CaYHR172W (SPC9719 81 142 203 264 325. 386 447 CaYHR196VV 20 82 143 204 265 326' 387 448 CaYIROI1C(STS121 83 144 205 266 327 388 449 CaYJL069C 22 84 145 206 267 328 389 450 CaYJL090C DPB1123 85 146 207 268 329, 390 451 CaYJR041C 24 86 147 208 269 330' 391 452 CaYJR112W F1 25 87. 148 209 270 331 392 453 CaYKL004W AUR126 88 149 210 271 332 393 454 CaYKL033 W 27 89 150 211 272 333 394 455 CaYKR025W RPC3728 90 151 212 273 334 395 456 CaYKR063C LAS129 91 152 213 274 335 396 457 CaYKR071C 30 92 153 214 275 336 397 458 CaYKR081C 31 93 154 215 276 337 398 459 CaYKR083C 32 94 155 216 277 338 399 460 CaYLL003W SFI133 95 156 217 278 339 400 461 CaYLR002C 34 96 157 218 279 340 401 462 CaYLR103C CDC4535 97 158 219 280 341 402 463 CaYLR342W FKS136 98 159 220 281 342 403 464 CaYLR355C ILVS37 99 160 221 282 343 404 465 CaYML025C YML638 100 161 222 283 344 405 466 CaYML085C TUB139 101 162 223 284 345 406 467 CaYMR149W SWP140 102 163 224 285 346 407 468 CaYMR200W ROT141 103 164 225 286 347 408 469 CaYMR220W ERG842 104 165 226 287 348 .409 470 CaYMR277W FCPI43 105 166 227 288 349 410 471 CaYNL132W 44 106 167 228 289 350 411 472 CaYNL149C 45 107 168 229 290 351 412 473 CaYNL151C RPC3146 108 169 230 291 352 413 474 CaYNL181W 47 109 170 231 292 353 414 475 CaYNL232W CSL448 I10 171 232 293 354 415 476 CaYNL245C 49 111 172 233 294 355 416 477 CaYNL256W 50 112 173 234 295 356 417 478 CaYNL260C 51 113 174 235 296 357 418 479 CaYOR004W 52 114 175 236 297 358 419 480 CaYOR075W UFE153 115 176 237 298 359 420 481 CaYOR148C SPP254 116 177 238 299 360 421 482 CaYOR206W 55 117 178 239 300 361 422 483 CaYOR287C 56 118 179 240 301 362 423 484 CaYPL128C TBF157 119 180 241 302 363 424 485 CaYPL160W CDC6058 120 181 242 303 364 425 486 CaYPL228W CET159 121 182 243 304 365 426 487 CaYPR165W RHO160 122 183 244 305 366 427 488 CaYPR175W DPB261 123 184 245 306 367 428 489 CaYPL160W CDC6062 N/A 181 242 303 364 425 486 In one embodiment, the present invention provides the identities of 61 essential genes. Although the nucleotide sequence and the reading frame of a number of these genes are known, the fact that these genes are essential to the growth and/or survival of Candida albicans was not known until the inventors' discovery. Thus, the uses of these genes and their gene products are encompassed by the present invention. Also provided in Table II are SEQ ID NOs: that are used herein to identify the open reading frame, the deduced amino acid sequence and related oligonucleotide sequences for each identified essential gene.
Accordingly, SEQ ID NO:1 through to SEQ ID N0:62 each identifies a nucleotide sequence of the opening reading frame (ORF) of an identified essential gene.
The nucleotide sequences labeled as SEQ ID NO:1-62 were obtained from a Candida w albicans genomic sequence database version 6 assembled by the Candida albicans Sequencing Project and is accessible by Internet at the web sites of Stanford University and University of Minnesota (See http://www-sequence.stanford.edu:8080/ and http://alces.med.umn.edu/Candida.html).
The predicted amino acid sequence of the identified essential genes are set forth in SEQ ID N0:63 through to SEQ ID N0:123 which are obtained by conceptual translation of the nucleotide sequences of SEQ ID NO: 1 through to 61 once the reading frame is determined. As it is well known in the art, the codon CTG is translated to a serine residue in C. albicans, instead of the usual leucine in other organisms.
Accordingly, the conceptual translation of the ORF is performed using the codon usage of C.
albicans.
The DNA sequences were generated by sequencing reactions and may contain minor errors which may exist as misidentified nucleotides, insertions, and/or deletions. However, such minor errors, if present, in the sequence database should not disturb the identification of the ORF as an essential gene of the invention.
Since clones containing the ORF are available, one can readily repeat the sequencing and correct the minor error(s). Moreover, minor sequence errors do not affect the construction of GRACE
strains and the uses of the GRACE strains, since these methods do not require absolute sequence identity between the chromosomal DNA sequences and the sequences of the gene in the primers or recombinant DNA. In some instances, the correct reading frame of the C.
albicans gene can be identified by comparing its overall amino acid sequence with known S
cerevisiae sequences.
Thus, in one embodiment of the invention, conceptual translation of the nucleotide sequence of SEQ ID NO: 62 leads to an apparently premature termination of the opening reading frame when compared to its ortholog in S. cerevisiae. To maintain the reading frame, four nucleotides were added to create SEQ ID NO: 58 which results in the amino acid sequence of SEQ ID NO: 120. In another embodiment, the invention provides the genomic sequence of an identified essential gene, wherein the genomic sequence as set forth in SEQ ID NO: 490 contains an intron. The unpublished nucleotide sequence which does not contain intron sequence and encodes a protein is set forth in SEQ ID
NO: 39.
SEQ ID N0:124-486 refers to oligonucleotide primers and probes that were designed for and used in the construction of the GRACE strain for the corresponding identified essential gene. (i.e., SEQ ID N0:124-184 knockout upstream primer (KO-I1P);
SEQ ID N0:185-245 knockout downstream primer (KO-Down); SEQ ID N0:246-306 tetracycline promoter upstream primer (Tet-Up); SEQ ID N0:307-367 Tetracycline promoter downstream primer (Tet-Down); and SEQ ID N0:368-489 primers for identification of the respective GRACE strains (primers A and B). Therefore, each set of oligonucleotides can be used to identify a unique essential gene and a unique GRACE
strain, e.g. by hybridization, or PCR.
The essential genes listed in Table II can be obtained using cloning methods well known to those of skill in the art, and include but are not limited to the use of appropriate probes to detect the genes within an appropriate cDNA or gDNA
(genomic' DNA) library. (See, for example, Sambrook et al., 1989, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratories, which is incorporated herein by reference in its entirety.) Probes for the sequences identified herein can be synthesized based on the DNA
sequences disclosed herein in SEQ ID NO:1-62.
As used herein, "target gene" i.e. essential and/or virulence gene) refers to (a) a gene containing at least one of the DNA sequences and/or fragments thereof that are set forth in SEQ ID NO:1 through to SEQ ID N0:62; (b) any DNA sequence or fragment thereof that encodes the amino acid sequence that are set forth in SEQ ID
N0:63 through to SEQ ID N0:123 using the universal genetic code or the codon usage of C.
albicans; (c) any DNA sequence that hybridizes to the complement of the nucleotide sequences set forth in SEQ ID NO:I through to SEQ ID N0:62 under stringent conditions, e.g., hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2xSSC/0.1% SDS at about SO-65°C, or under highly stringent conditions, e.g., hybridization to filter-bound nucleic acid in 6xSSC at about 45°C followed by one or more washes in O.IxSSC/0.2% SDS at about 68°C, or under other hybridization conditions which are apparent to those of skill in the art (see, for example, Ausubel, F.M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York, at pp. 6.3.1-6.3.6 and 2.10.3).
Preferably, the polynucleotides that hybridize to the complements of the DNA
sequences disclosed herein encode gene products, e.g., gene products that are functionally equivalent to a gene product encoded by a target gene. As described above, target gene sequences include not only degenerate nucleotide sequences that encode the amino acid sequences of SEQ ID N0:63 to 123 in C. albicans, but also degenerate nucleotide sequences that when translated in organisms other than C Albicans, would yield a polypeptide comprising one of the amino acid sequences of SEQ ID N0:63 to 123, or a fragment thereof. One of skill in the art would know how to select the appropriate codons or modify the nucleotide sequences of SEQ ID NO: 1 to 62 when using the target gene sequences in G albicans or in other .
organisms. Moreover, the term "target gene" encompasses genes that are naturally occurring in Saccharomyces cerevisiae or variants thereof, that share extensive nucleotide sequence homology with C albicans genes having one of the DNA sequences that are set forth in SEQ ID NO:1 through to SEQ ID N0:62, i.e., the orthologs in S.
cerevisiae. It is contemplated that methods for drug screening that can be applied to C.
albicans genes can also be applied to orthologs of the same genes in the non-pathogenic S.
cerevisiae.
In another embodiment, the invention also encompasses the following polynucleotides, host cells expressing such polynucleotides and the expression products of such nucleotides: (a) polynucleotides that encode portions of target gene product that corresponds to its functional domains, and the polypeptide products encoded by such nucleotide sequences, and in which, in the case of receptor-type gene products, such domains include, but are not limited to signal sequences, extracellular domains (ECD), transmembrane domains (TM) and cytoplasmic domains (CD); (b) polynucleotides that encode mutants of a target gene product, in which all or part of one of its domains is deleted or altered, arid which, in the case of receptor-type gene products, such mutants include, but are not limited to, mature proteins in which the signal sequence is cleaved, soluble receptors in which all or a portion of the TM is deleted, and nonfunctional receptors in which all or a portion of CD is deleted; and (d) polynucleotides that encode fusion proteins containing a target gene product or one of its domains fused to another polypeptide.
The invention also includes polynucleotides, preferably DNA molecules, that hybridize to, and are therefore the complements of, the DNA sequences of the target gene sequences. Such hybridization conditions can be highly stringent or less highly stringent, as described above and known in the art. The nucleic acid molecules of the invention that hybridize to the above described DNA sequences include oligodeoxynucleotides ("oligos") which hybridize to the target gene under highly stringent or stringent conditions. In general, for oligos between 14 and 70 nucleotides in length the melting temperature (Tm) is calculated using the formula: Tm(°C) = 81.5 + 16.6(log[monovalent cations (molar)] + 0.41 (% G+C) - (500/N) where N is the length of the probe. If the hybridization is carried out in a solution containing formamide, the melting temperature may be calculated using the equation:
Tm(°C) = 81.5 + 16.6(log[monovalent cations (molar)]) + 0.41(%
G+C) -(0.61 ) (% formamide) - (500/N).
where N is the length of the probe. In general, hybridization is carried out at about 20-25 degrees below Tm (for DNA-DNA hybrids) or about 10-15 degrees below Tm (for RNA-DNA hybrids). Other exemplary highly stringent conditions may refer,. e.
g. , to .washing in 6xSSC/0.05% sodium pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base oligos), SS°C (for 20-base oligos), and 60°C (for 23-base oligos). Examples of such oligos are set forth in SEQ ID N0:124-489.
These nucleic acid molecules can encode or act as target gene antisense molecules, useful, for example, in target gene regulation and/or as antisense primers in . amplification reactions of target gene nucleotide sequences. Further, such sequences can be used as part of ribozyme and/or triple helix sequences, also useful 'for target gene regulation.
Still further, such molecules can be used as components of diagnostic methods whereby the presence of the pathogen can be detected. The uses of these nucleic acid molecules are discussed in detail below.
Fragments of the target genes of the invention can be at least 10 nucleotides in length. In alternative embodiments, the fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more contiguous nucleotides in length. Alternatively, the fragments can comprise nucleotide sequences that encode at least 10, 20, 30, 40, S0, 100, 150, 200, 250, 300, 350, 400, 450 or more contiguous amino acid residues of the target gene products. Fragments of the target genes of the invention can also refer to exons or introns of the above described nucleic acid molecules, as well as portions of the coding regions of such nucleic acid molecules that encode functional domains such as signal sequences, extracellular domains (ECD), transmembrane domains (TM) and cytoplasmic domains (CD).
5.4.2 Homologous Target Genes In addition to the nucleotide sequences of Candida albicans described above, homologs or orthologs of these target gene sequences, as can be present in other species, can be identified and isolated by molecular biological techniques well known in the art, and without undue experimentation, used in the methods of the invention. For example, homologous target genes in Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Coccidiodes immitis, Cryptococcus neoformans, Histoplasma capsulatum, Phytophthora infestans, Puccinia seconditii, Pneumocystis carinii, or any species falling within the genera of any of the above species. Other yeasts in the genera of Candida, Saccharomyces;
Schizosaccharomyces, Sporobolomyces, Torulopsis, Trichosporon, Tricophyton, Dermatophytes, Microsproum, Wickerhamia, Ashbya. Blastomyces, Candida, Citeromyces, Crebrothecium, Cryptococcus, Debaryomyces, Endomycopsis, Geotrichum, Hansenula, Kloeckera, Kluveromyces, Lipomyces, Pichia, Rhodosporidium, Rhodotorula, and Yarrowia ~.e also contemplated. Also included are homologs of these target gene sequences can be identified im and isolated from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Alternaria solanii, Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Sclerotinia sclerotiorum, Septoria triticii, Tilletia controversa, Ustilago maydis, Yenturia inequalis, Verticullium dahliae or any species falling within the genera of any of the above species.
Accordingly, the present invention provides nucleotide sequences that are hybridizable to the polynucleotides of the target genes, and that are of a species other than Saccharomyces cerevisiae and Candida albicans. In one embodiment, the present invention encompasses an isolated nucleic acid comprising a nucleotide sequence that is at least 50%
identical to a nucleotide sequence selected from the group consisting of SEQ
ID No. 1 through to SEQ ID N0:62. In another embodiment, the present invention encompasses an isolated nucleic acid comprising a nucleotide sequence that hybridizes under medium stringency conditions to a second nucleic acid that consists of a nucleotide sequence selected from the group consisting of SEQ ID NO:1 through to SEQ ID N0:62.
In yet another embodiment, the present invention includes an isolated nucleic acid comprising a nucleotide sequence that encodes a polypeptide the amino acid sequence of which is at least 50% identical to an amino acid sequence selected from the group consisting of SEQ ID No.63 through to 123, wherein the polypeptide is that of a species other than Saccharomyces cerevisiae and Candida albicans.
Although the nucleotide sequences and amino acid sequences of homologs or orthologs of such genes in S. cerevisiae is mostly published, uses of such homologs or orthologs in S. cerevisae in drug screening are not known and are thus specifically provided by the invention. To use such nucleotide and/or amino acid sequences of S
cerevisiae, public databases, such as Stanford Genomic Resources (www-genome.stanford.edu), Munich Information Centre for Protein Sequences (www.mips.biochem.mpg.del, or proteome (www.proteome.coml may be used to identify and retrieve the sequences. In cases where the ortholog or homolog of a C. albicans gene in S cerevisiae is known, the name of the S. cerevisiae gene is indicated in parenthesis in column 1 of Table I. Orthologs of S. cerevisiae can also be identified by hybridization assays using nucleic acid probes consisting of any one of the nucleotide sequences of SEQ ID NO: 1 to 61, and 490.
The nucleotide sequences of the invention still further include nucleotide sequences that have at least 40%, 45%, SS%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more nucleotide sequence identity to the nucleotide sequences set forth in SEQ ID
NO:1 through to SEQ ID N0:62. The nucleotide sequences of the invention also include nucleotide sequences that encode polypeptides having at least 25%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or higher amino acid sequence identity or similarity to the amino acid sequences set forth in SEQ ID N0:63 through to123.
To determine the percent identity of two amino acid sequences or of two nucleotide sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleotide sequence for optimal alignment with a second amino acid or nucleotide sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a action of the number of identical positions shared by the sequences (i.e., %
identity =

number of identical overlapping positions/total number of positions x 100%).
In one embodiment, the two sequences are the same length.
The determination of percent identity between two sequences can also be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol.
Biol. 215:403-0. BLAST nucleotide searches can be performed with the NBLAST
nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present invention.
BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score-50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in Altschul et al., 1997, Nucleic Acids Res.
25:3389-3402.
Alternatively, PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., of XBLAST and ' NBLAST) can be used (see, e.g., http://www.ncbi.nlm.nih.gov). Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) CABIOS 4:1.1-17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG
sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
To isolate homologous target genes, the C. albicans target gene sequence described above can be labeled and used to screen a cDNA library constructed from mRNA
obtained from the organism of interest. Hybridization conditions should be of a lower stringency when the cDNA library was derived from an organism different from the type of organism from which the labeled sequence was derived. cDNA screening can also identify clones derived from alternatively spliced transcripts in the same or different species.
Alternatively, the labeled fragment can be used to screen a genomic library derived from the organism of interest, again, using appropriately stringent conditions. Low stringency conditions will be well known to those of skill in the art, and will vary predictably depending on the specific organisms from which the library and the labeled sequences are derived. For guidance regarding such conditions see, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, (Green Publishing Associates and Wiley Interscience, N.Y.).
Further, a homologous target gene sequence can be isolated by performing a polymerase chain reaction (PCR) using two degenerate oligonucleotide primer pools designed on the basis of amino acid sequences within the target gene of interest. The template for the reaction can be cDNA obtained by reverse transcription of mRNA prepared from the organism of interest. The PCR product can be subcloned and sequenced to ensure that the amplified sequences represent the sequences of a homologous target gene sequence.
The PCR fragment can then be used to isolate a full length cDNA clone by a variety of methods well known to those of ordinary skill in the art. -Alternatively, the labeled fragment can be used to screen a genomic library.
PCR technology can also be utilized to isolate full length cDNA sequences.
For example, RNA can be isolated, following standard procedures, from an organism of interest. A reverse transcription reaction can be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis. The resulting RNA/DNA hybrid can then be "tailed"
with guanines using a standard terminal transferase reaction, the hybrid can be digested with RNAase H, and second strand synthesis can then be primed with a poly-C primer. Thus, cDNA
sequences upstream of the amplified fragment can easily be isolated. For a review of cloning strategies which can be used, see e.g., Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual, Cold Springs Harbor Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, (Green Publishing Associates and Wiley Interscience, N.Y.).
Additionally, an expression library can be constructed utilizing DNA isolated from or cDNA synthesized from the organism of interest. In this manner, gene products made by the homologous target gene can be expressed and screened using standard antibody screening techniques in conjunction with antibodies raised against the C.
albicans gene product, as described, below. (For screening techniques, see, for example, Harlow, E. and Lane, eds., 1988, "Antibodies: A Laboratory Manual," Cold Spring Harbor Press, Cold Spring Harbor). Library clones detected via their reaction with such labeled antibodies can be purified and subjected to sequence analysis by well known methods.
Alternatively, homologous target genes or polypeptides may be identified by searching a database to identify sequences having a desired level of homology to a target gene or polypeptide involved in proliferation, virulence or pathogenicity. A
variety of such databases are available to those skilled in the art, including GenBank and GenSeq. In various embodiments, the databases are screened to identify nucleic acids with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% identity to a target nucleotide sequence, or a portion thereof. In other embodiments, the databases are screened to identify polypeptides having at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% identity or similarity to a polypeptide involved in proliferation, virulence or pathogenicity or a portion thereof.
Alternatively, functionally homologous target sequences or polypeptides may be identified by creating mutations that have phenotypes by removing or altering the fimction of a gene. This can be done for one or all genes in a given fungal species including, for example:
Saccharomyces cerevisiae, Candida albicans, and Aspergillus fumigates. Having mutants in the genes of one fungal species offers a method to identify fimctionally similar genes (orthologs) or related genes (paralogs) in another species, by use of a functional complementation test.
A library of gene or cDNA copies of messenger RNA of genes can be made from a given species, e.g. Candida albicans, and the library cloned into a vector permitting expression (for example, with the Candida albicans promoters or a Saccharomyces cerevisiae promoter) of the genes in a second species, e.g. Saccharomyces cerevisiae.
Such a library is referred to as a "heterologous library." Transfornlation of the Candida albicans heterologous library into a defined mutant of Saccharomyces cerevisiae that is functionally deficient with respect to the identified gene, and screening or selecting for a gene in the heterologous library that restores phenotypic function in whole or in part of the mutational defect is said to be "heterologous fimctional complementation" and in this example, permits identification of gene in Candida albicarrs that are functionally related to the mutated gene in Saccharomyces cerevisiae. Inherent in this fimctional-complementation method, is the ability to restore gene fimction without the requirement for sequence similarity of nucleic acids or polypeptides; that is, this method permits interspecific identification of genes with conserved biological fimction, even where sequence similarity comparisons fail to reveal or suggest such conservation.
In those instances in which the gene to be tested is an essential gene, a number of possibilities exist regarding performing heterologous fiznctional complementation tests. The mutation in the essential gene can be a conditional allele, including but not limited to, a temperature-sensitive allele, an allele conditionally expressed from a regulatable promoter, or an 3 S ~lele that has been rendered the mRNA transcript or the encoded gene product conditionally unstable. Alternatively, the strain carrying a mutation in an essential gene can be propagated using a copy of the native gene (a wild type copy of the gene mutated from the same species) on a vector comprising a marker that can be selected against, permitting selection for those strains carrying few or no copies of the vector and the included wild type allele. A
strain constructed in this manner is transformed with the heterologous library, and those clones in which a heterologous gene can functionally complement the essential gene mutation, are selected on medium non-permissive for maintenance of the plasmid carrying the wild type gene.
In the following example, the identification, by functional complementation, of a Candida albicans homolog of a Saccharomyces cerevisiae gene, KRE 9, is described. (Lussier et al. 1998, "The Candida albicans KRE 9 gene is required for cell wall ~i-1,6-glucan synthesis and is essential for growth on glucose," Proc. Natl. Acad Sci. USA 95: 9825-30).
The host strain was a Saccharomyces cerevisiae haploid null mutant in KRE 9, kre 9::HIS3, which has a severe growth defect phenotype. The host strain carried a wild type copy of the native Saccharomyces cerevisiae KRF 9 gene on a LYS-2 based pRS317 shuttle vector and was transformed with a Candida albicans genomic library. This heterologous library was constructed using, as a vector, ~e multicopy plasmid YEp352, which carries the URA3 gene as a selectable marker. To screen for plasmids supporting growth of the kre 9::HIS 3 mutant host, approximately 20,000 colonies capable of growth in the absence of histidine, lysine, and uracil, were replica-plated onto minimal medium containing a-amino adipate as a nitrogen source to allow selection for cells that have lost the LYS2 plasmid-based copy of KRE 9 and that possess a copy of a fictionally-complementing Candida albicans ortholog, CaKRE 9. These cells were tested further for loss of the pRS317-KRE 9 plasmid by their inability to grow in the absence of lysine, and YEp352-based Candida albicans genomic DNA was recovered from them. On retransformation of the Saccharomyces cerevisiae kre 9::HIS3 mutant, a specific genomic insert of 8kb of Candida albicans was recovered that was able to restore growth partially. Following fiirther subcloning using functional complementation for selection, a 1.6 kb DNA fi~agment was obtained that contained the fimctional Candida albicans KRE 9 gene.
A heterologous fimctional complementation test is not restricted to the exchange of genetic information between Candida albicans and Saccharomyces cerevisiae;
functional complementation tests can be performed, as described above, using any pair of fungal species.
For example, the CRE1 gene of the fungus Sclerotininia sclerotiorum can fimctionally complement the creAD30 mutant of the CREA gene of Aspergillus nidulans (see Vautard et al.
1999, "The glucose repressor gene CRE1 from Sclerotininia sclerotiorum is fi.mctionally related to CREA from Aspergillus nidulans but not to the Mig proteins from Saccharomyces cerevisiae," FEBS Lett. 453: 54-58).
In yet another embodiment, where the source of nucleic acid deposited on a gene expression array and the source of the nucleic acid probe being hybridized to the array are from two different species of organisms, the results allow rapid identification of homologous genes in the two species.
In yet another embodiment, the invention also encompasses (a) DNA vectors that contain a nucleotide sequence comprising any of the foregoing coding sequences of the target gene and/or their complements (including antisense); (b) DNA expression vectors that contain a nucleotide sequence comprising any of the foregoing coding sequences operably linked with a regulatory element that directs the expression of the coding sequences;
and (c) genetically engineered host cells that contain any of the foregoing coding sequences of the target gene operably linked with a regulatory element that directs the expression of the coding sequences in the host cell. Vectors, expression constructs, expression vectors, and genetically engineered host cells containing the coding sequences of homologous target genes of other species (excluding S
cerevisiae) are also contemplated. Also contemplated are genetically engineered host cells containing mutant alleles in homologous target genes of the other species. As used herein, regulatory elements include but are not limited to inducible and non-inducible promoters, enhancers; operators and other elements known to those skilled in the art that drive and regulate expression. Such regulatory elements include but are not limited to the lac system, the trp system, the tet system and other antibiotic-based repression systems (e.g.PIP), the TAC system, the TRC system, the major operator and promoter regions of phage A, the control regions of fd coat protein, and the fungal promoters for 3-phosphoglycerate kinase, acid phosphatase, the yeast mating pheromone responsive promoters (e.g. STE2 and STE3), and promoters isolated from genes involved in carbohydrate metabolism (e.g. GAL promoters), phosphate-responsive promoters (e.g. PHOS), or amino acid metabolism (e.g. MET genes). The invention includes fi~agments of any of the DNA vector sequences disclosed herein.
A variety of techniques can be utilized to further characterize the identified essential genes and virulence genes. First, the nucleotide sequence of the identified genes can be used to reveal homologies to one or more known sequence motifs which can yield information regarding the biological fimction of the identified gene product. Computer programs well known in the art can be employed to identify such relationships. Second, the sequences of the identified genes can be used, utilizing standard techniques such as in situ hybridization; to place the genes onto chromosome maps and genetic maps which can be correlated with similar maps constructed for another organism, e.g., Saccharomyces cerevisiae. The information obtained through such characterizations can suggest relevant methods for using the polynucleotides and polypeptides for discovery of drugs against Candida albicans and other pathogens.
~ Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include without limitation "Molecular Cloning: A
Laboratory Manual," 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E. F. Fritsch and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide to Molecular Cloning Techniques," Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987. Many of the uses of the polynucleotides and polypeptides of the identified essential genes are discussed in details hereinbelow.
5.4.3 Target Gene Products The target gene products used and encompassed in the methods and compositions of the present invention include those gene products (e.g., RNA
or proteins) that are encoded by the target essential gene sequences as described above, such as, the target gene sequences set forth in SEQ ID NO:1 through to 62. In Table II, the amino acid sequences of SEQ ID NO: 63 to 123 are deduced using the codon usage of C. albicans from the respective nucleotide sequences of SEQ ID NO: 1 to 61. However, when expressed in an organism other 1 S than C. albicans, protein products of the target genes having the amino acid sequences of SEQ
ID NO: 63 to 123 may be encoded by nucleotide sequences that are translated using the universal genetic code. One of skill in the art would know the modifications that are necessary to accommodate for such a dii~erence in codon usage.
In addition, however, the methods and compositions of the invention also use and encompass proteins and polypeptides that represent functionally equivalent gene products.
Such functionally equivalent gene products include, but are not limited to, natural variants of the polypeptides having an amino acid sequence set forth in SEQ ID N0:63 through to 123.
Such equivalent target gene products can contain, e.g., deletions, additions or substitutions of amino acid residues within the amino acid sequences encoded by the target gene sequences described above, but which result in a silent change, thus producing a functionally equivalent target gene product. Amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved. For example, nonpolar (i.e., hydrophobic) amino acid residues can - include alanine (Ala or A), leucine (Leu or L), isoleucine (Ile or I), valine (Val or ~, proline (Pro or P), phenylalanine (Phe or F), tryptophan (Trp or V~ and methionine (Met or M); polar neutral amino acid residues can include glycine (Gly or G), serine (Ser or S), threonine (Thr or T), cysteine (Cys or C), tyrosine (Tyr or ~, asparagine (Asn or N) and glutamine (Gln or Q);
positively charged (i.e., basic) amino acid residues can include arginine (Arg or R), lysine (Lys or K) and histidine (His or H); and negatively charged (i.e., acidic) amino acid residues can include aspartic acid (Asp or D) and glutamic acid (Glu or E).

In one particular embodiment, a composition comprising a mixture of natural variants of the polypeptides having one of SEQ ID N0:63 through to 123 is provided. Since it is known in the art that, in C. albicans, 99% of the tRNA molecules that recognize the codon CTG
is charged with a serine residue, and 1 % are charged with a leucine residue, there is a possibility S that during biosynthesis, a leucine is incorporated into a growing polypeptide chain..
Accordingly, when a nucleotide sequence comprising the codon CTG is translated in C.
albicans, a small percentage of the resulting polypeptides may have a leucine residue in positions where a serine residue encoded by CTG (conforniing to the codon usage of C.
albicans) is expected. The product of translation of such a nucleotide sequence may comprise a I 0 mixture of polypeptides with minor leucine/serine variations at positions that correspond to a CTG codon in the nucleotide sequence.
"Functionally equivalent," as the term is utilized herein, refers to a polypeptide capable of exhibiting a substantially similar in vivo activity as the Candida albicans target gene product encoded by one or more of the target gene sequences described in Table II.
15 Alternatively, when utilized as part of assays described hereinbelow, the term "functionally equivalent" can refer to peptides or polypeptides that are capable of interacting with other cellular or extracellular molecules in a manner substantially similar to the way in which the corresponding portion of the target gene product would interact with such other. molecules.
Preferably, the functionally equivalent target gene products of the invention are also the same .
20 sirx or about the same size as a target gene product encoded by one or more of the target gene sequences described in Table II.
In another embodiment of the invention, the use of target gene products that are RNA or proteins of Saccharomyces cerevisiae are provided.
Peptides and polypeptides corresponding to one or more domains of the target 25 gene products (e.g., signal sequence, TM, ECD, CD, or ligand-binding domains), truncated or deleted target gene products (e.g., polypeptides in which one or more domains of a target gene product are deleted) and fusion target gene proteins (e.g., proteins in which a full length or truncated or deleted target gene product, or a peptide or polypeptide corresponding to one or more domains of a target gene product is fused to an unrelated protein) are also within the scope 30 of the present invention. Such peptides and polypeptides (also referred to as chimeric protein or polypeptides) can be readily designed by those skilled in the art on the basis of the target gene nucleotide and amino acid sequences listed in Table II. Exemplary fusion proteins can include, .
but are not limited to, epitope tag-fusion proteins which facilitates isolation of the target gene product by affinity chromatography using reagents that binds the epitope.
Other exemplary 35 fusion proteins include fusions to any amino acid sequence thaf allows, e.g., the fusion protein to be anchored to a cell membrane, thereby allowing target gene polypeptides to be exhibited on a cell surface; or fusions to an enzyme (e.g., ~3-galactosidase encoded by the LAC4 gene of Kluyveronmyces lactis (Leuker et al., 1994, Mol. Gen. Genet., 245:212-217)), to a fluorescent protein (e.g., from Renilla reniformis (Srikantha et al., 1996, J. Bacteriol.
178:121-129), or to a luminescent protein which can provide a marker function. Accordingly, the invention provides a fission protein comprising a fragment of a first polypeptide fused to a second polypeptide, said fi~agment of the first polypeptide consisting of at least 6 consecutive residues of an amino acid sequence selected from one of SEQ ID NO: 63 to 123.
Other modifications of the target gene product coding sequences described above can be made to generate polypeptides that are better suited, e.g., for expression, for scale up, etc.
in a chosen host cell. For example, cysteine residues can be deleted or substituted with another amino acid in order to eliminate disulfide bridges.
The target gene products of the invention preferably comprise at least as many contiguous amino acid residues as are necessary to represent an epitope fi~agment (that is, for the gene products to be recognized by an antibody directed to the target gene product). For example, such protein fiagments or peptides can comprise at least about 8 contiguous amino acid residues from a fill length differentially expressed or pathway gene product. In alternative embodiments, the protein fragments and peptides of the invention can comprise about 6, 10, 20, .
30, 40, 50,60, 70, 80, 90, 10.0, 150, 200, 250, 300, 350, 400, 450 or more contiguous amino acid residues of a target gene product.
.The target gene products used and encompassed in the methods and compositions of the present invention also encompass amino acid sequences encoded by one or more of the above-described target gene sequences of the invention wherein domains often encoded by one or more exons of those sequences, or fragments thereof, have been deleted. The target gene products of the invention can still further comprise post translational modifications, including, but not limited to, glycosylations, acetylations and myristylations.
The target gene products of the invention can be readily produced, e.g., by synthetic techniques or by methods of recombinant DNA technology using techniques that are well known in the art. Thus, methods for preparing the target gene products of the invention are discussed herein. First, the polypeptides and peptides of the invention can be synthesized or prepared by techniques well known in the art. See, for example, Creighton, 1983, Proteins:
Structures and Molecular Principles, W.H. Freeman and Co., N.Y., which is incorporated herein by reference in its entirety. Peptides can, for example, be synthesized on a solid support or in solution.
Alternatively, recombinant DNA methods which are well known to those skilled in the art can be used to construct expression vectors containing target gene protein coding sequences such as those set forth in SEQ ID NO: 1 through to 61, and appropriate transcriptionaUtranslational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. See, for example, the techniques described in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., Pla et al., Yeast 12:1677-1702 (1996), which are incorporated by reference herein in their entireties, and Ausubel, 1989, supra. Alternatively, RNA capable of encoding target gene protein sequences can be chemically synthesized using, for example, synthesizers. See, for example, the techiliques described in Oligonucleotide Synthesis, 1984, Gait, M.J. ed., IRL
Press, Oxford, which is incorporated by reference herein in its entirety.
A variety of host-expression vector systems can be utilized to express the target gene coding sequences of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest can be produced and subsequently purified, but also represent cells which can, when transformed or transfected with the appropriate nucleotide coding sequences, exhibit the target gene protein of the invention in situ.
These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing target gene protein coding sequences; yeast (e.g., Saccharomyces, Schizosaccarhomyces, Neurospora, Aspergillus, Candida, Pichia) transformed with recombinant yeast expression vectors containing the target gene protein coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the target gene protein coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing target gene protein coding sequences; or mammalian cell systems (e.g. COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). If necessary, the nucleotide sequences of coding regions may be ~ modified according to the codon usage of the host such that the translated product has the correct amino acid sequence.
In bacterial systems, a number of expression vectors can be advantageously selected depending upon the use intended for the target gene protein being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of antibodies or to screen peptide libraries, for example, vectors which direct the expression of high levels of fusion protein products that are readily purified can be desirable.
Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791 ), in which the target gene protein coding sequence can be ligated individually into the vector in fi~ame with the lacZ coding region so that a fusion protein is produced; p1N vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J.
Biol. Chem. 264:5503-5509); and the like. pGEX vectors can also be used to express foreign polypeptides as fission proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene protein can be released from the GST moiety.
When a target gene is to be expressed in mammalian host cells, a number of viral-based expression systems can be utilized. In cases where an adenovirus is used as an expression vector, the target gene coding sequence of interest can be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
This chimeric gene can then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing target gene protein in .
infected hosts, (e.g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA
81:3655-3659).
Specific initiation signals can also be required for efficient translation of inserted target gene coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire target gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals can be needed. However, in cases where only a portion of the target gene coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG
initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading fi~ame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic.
The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements; transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol.
153:516-544).
In addition, a host cell strain can be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products can be important for the fiznction of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins.
Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and S phosphorylation of the gene product can be used.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the target gene protein can be engineered. Host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc. ), and a selectable marker. Following the introduction of the foreign DNA, engineered cells can be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can advantageously be used to engineer cell lines which express the target gene protein. Such engineered cell lines can be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the target gene protein.
A number of selection systems can be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine.
phosphoribosyltransferase (Szybalska Bc Szybalski, 1962, Proc. Natl. Acad.
Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Natl.
Acad. Sci. USA 77:3567; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA
78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl.
Acad. Sci. USA
78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1 ); and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147) genes.
Alternatively, any fission protein may be readily purified by utilizing an antibody specific for the fi.ision protein being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fission proteins expressed in human cells lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972-8976). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading fi~ame is translationally fused to an amino-terminal tag consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded onto -SO-Ni2+witriloacetic acid-agarose columns and histidine-tagged proteins are selectively eluted with imidazole-containing buffers. Fusions at the carboxy terminal of the target gene product are also contemplated.
When used as a component in assay systems such as those described herein, the target gene protein can be labeled, either directly or indirectly, to facilitate detection of a complex formed between the target gene protein and a test substance. Any of a variety of suitable labeling systems can be used including but not limited to radioisotopes such as ~ZSI;
enzyme labeling systems that generate a detectable colorimetric signal or light when exposed to substrate; and fluorescent labels.
Indirect labeling involves the use of a protein, such as a labeled antibody, which specifically binds to either a target gene product. Such antibodies include but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')Z fi~agments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fiagments of any of the above.
Following expression of the target gene protein encoded by the identified target nucleotide sequence, the protein is purified. Protein purification techniques are well known in the art. Proteins encoded and expressed from identified exogenous nucleotide sequence 17 s can be partially purified using precipitation techniques, such as precipitation with polyethylene glycol. Alternatively, epitope.tagging of the protein can be used to allow simple one step purification of the protein. In addition, chromatographic methods such as ion-exchange chromatography, gel filtration, use of hydroxyapaptite columns, immobilized reactive dyes, chromatofocusing, and use of high-performance liquid chromatography, may also be used to purify the protein. Electrophoretic methods such as one-dimensional gel electrophoresis, high-resolution two-dimensional polyacrylamide electrophoresis, isoelectric focusing, and others are contemplated as purification methods. Also, ai~mity chromatographic methods, comprising solid phase bound- antibody, ligand presenting columns and other af~mity chromatographic matrices are contemplated as purification methods in the present invention.
In addition, the purified target gene products, fi-agments thereof, or derivatives hereof may be administered to ari individual in a pharmaceutically acceptable carrier to induce an immune response against the protein or polypeptide. Preferably, the immune response is a protective immune response which protects the individual. Methods for determining appropriate dosages of the protein (including use of adjuvants) and pharmaceutically acceptable carriers are familiar to those skilled in the art.

5.4.4 Antibodies Specific for Target Gene Products Described herein are methods for the production of antibodies capable of specifically recognizing epitopes of one or more of the target gene products described above.
Such antibodies can include, but are not limited to, polyclonal antibodies, monoclonal antibodies S (mAbs), human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')Z fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.
For the production of antibodies to a target gene or gene product, various host animals can be immunized by injection with a target gene protein, or a portion thereof. Such host animals can include but are not limited to rabbits, mice, and rats, to name but a few.
Various adjuvants can be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
Accordingly, the invention provides a method of eliciting an immune response in an animal, comprising introducing into the animal an immunogenic composition comprising an isolated polypeptide, the amino acid sequence of which comprises at least 6 consecutive residues of one of SEQ ID NO: 63 to 123.
Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigey such as target gene product, or an antigenic functional derivative thereof. For the production of polyclonal antibodies, host animals such as those described above, can be immunized by injection with differentially . expressed or pathway gene product supplemented with adjuvants as also described above. The antibody titer in the immunized animal can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide. If desired, the antibody molecules can be isolated from the animal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography to obtain the IgG
fraction.
Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, can be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and U.S. Patent No.
4,376,110), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies can be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention can be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently preferred method of production.
Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody directed against a polypeptide of the invention can be identified and isolated by screening a recombinant,combinatorial immunoglobulin library (e.g., an antibody phage display library) with the polypeptide of interest. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-O1; and the Stratagene SurfZAPTMPhage Display Kit, Catalog No.
240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, U.S. Patent No.
5,223,409; PCT Publication No. WO 92/18619; PCT Publication No. WO 91/17271;
PCT
Publication No. WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication No. WO
93/01288; PCT Publication No. WO 92/01047; PCT Publication No. WO 92/09690;
PCT
Publication No. WO 90/02809; Fuchs-et al. (1991 ) BiolTechnolo~ 9:1370-1372;.
Hay et al.
(1992) Hum. Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffiths et.al. (1993) .EMBO J. 12:725-734.
Additionally, recombinant antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a marine mAb and a human immunoglobulin constant region. (See, e.g., Cabilly et al., U.S. Patent No.
4,816,567; and Boss et al., U.S. Patent No. 4,816397, which are incorporated herein by reference in their entirety.) Humanized antibodies are antibody molecules from non-human species having one or more complementarily determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule. (See, e.g., Queen, U.S. Patent No. 5,585,089, which is incorporated herein by reference in its entirety.) Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT Publication No. WO 87/02671; European Patent Application 184,187; European Patent Application 171,496; European Patent Application 173,494; PCT Publication No. WO 86/01533; U.S. Patent No. 4,816,567; European Patent Application 125,023; Better et al. (1988) Science 240:1041-1043; Liu et al.
(1987) Proc. Natl.

Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al. (1987) Canc. Res.
47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J. Natl. Cancer Inst.
80:1553-1559);
Morrison (1985) Science 229:1202-1207; Oi et al. (1986) Biol!'echniques 4:214;
U.S. Patent 5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988) Science 239:1534;
and Beidler et al. (1988) J. Immunol. 141:4053-4060.
Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Such antibodies can be produced using transgenic mice which are incapable of expressing endogenous immunoglobulin heavy and light chains genes, but which can express human heavy and light chain genes. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA and IgE
antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., U.S. Patent 5,625,126; U.S. Patent 5,633,425; U.S.
Patent 5,569,825;
U.S. Patent 5,661,016; and U.S. Patent 5,545,806.
Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as "guided selection." In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al. (1994) Bioltechnology 12:899-903).
Antibody fragments which recognize specific epitopes can be generated by known techniques. For example, such fragments include but are not limited to:
the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
Alternatively, Fab expression libraries can be constructed (Hose et al., 1989, Science 246:1275 1281 ) to allow rapid and easy identification of monoclonal Fab fi~agments with the desired specificity.
Antibodies of the present invention may also be described or specified in terms of their binding affinity to a target gene product. Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10~ M, 10'~M, 5 X 10'' M, 10''M, 5 X
10'8 M, 10-8 M, 5 X 10-9 M, 10-9 M, 5 X 10''° M, 10-'° M, 5 X 10-" M, 10-" M, 5 X
10''2 M, 10-'Z M, 5 X 10-'3 M, 10-'3 M, S X 10-'4 M, 10-'4 M, 5 X 10-'5 M, or 10-'S M.
Antibodies directed against a target gene product or fragment thereof can be used to detect the a target gene product in order to evaluate the abundance and pattern of expression of the polypeptide under various environmental conditions, in different morphological forms (mycelium, yeast, spores) and stages of an organism's life cycle.
Antibodies directed against a target gene product or fragment thereof can be used diagnostically to monitor levels of a target gene product in the tissue of an infected host as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen.
Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125h 131h 35g or 3H.
Further, antibodies directed against a target gene product or fragment thereof can be used therapeutically to treat an infectious disease by preventing infection, and/or inhibiting growth of the pathogen. Antibodies can also be used to modify a biological activity of a target gene product. Antibodies to gene products related to virulence or pathogenicity can also be used to prevent infection and alleviate one or more symptoms associated with infection by the organism. To facilitate or enhance its therapeutic effect, an antibody (or fragment thereof) may be conjugated to a therapeutic moiety such as a toxin or fungicidal agent.
Techniques for conjugating a therapeutic moiety to antibodies are well known, see, e.g., Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol.
Rev., 62:119-58 (1982).
An antibody with or without a therapeutic moiety conjugated to it can be used as a therapeutic that is administered alone or in combination with chemotherapeutic agents.

5.4.5 Antisense Molecules The use of antisense molecules as inhibitors of gene expression may be a specific, genetically based therapeutic approach (for a review, see Stein, in Ch. 69, Section 5 "Cancer: Principle and Practice of Oncology", 4th ed., ed. by DeVita et al., J.B. Lippincott, Philadelphia 1993). The present invention provides the therapeutic or prophylactic use of nucleic acids of at least six nucleotides that are antisense to a target essential or virulence gene or a portion thereof. An "antisense" target nucleic acid as used herein refers to a nucleic acid capable of hybridizing to a portion of a target gene RNA (preferably mRNA) by virtue of some sequence complementarity. The invention further provides pharmaceutical compositions comprising an effective amount of the antisense nucleic acids of the invention in a pharmaceutically acceptable carrier, as described infra.
In another embodiment, the invention is directed to methods for inhibiting the expression of a target gene in an organism of interest, such as C. albicans in vitro or in vivo comprising providing the cell with an effective amount of a composition comprising an antisense nucleic acid of the invention. Multiple antisense polynucleotides hybridizable to different target genes may be used in combinations, sequentially or simultaneously.
In another embodiment, the present invention is directed toward methods for modulating expression of an essential gene which has been identified by the methods described supra, in which an antisense RNA molecule, which inhibits translation of mRNA
transcribed from an essential gene, is expressed from a regulatable promoter. In one aspect of this embodiment, the antisense RNA molecule is expressed in a GRACE strain of Candida albicans or another GRACE strain constructed from another diploid pathogenic organism.
In other aspects of this embodiment, the antisense RNA molecule is expressed in a wild-type or other non-GRACE strain of Candida albicans or another diploid pathogenic organism, including animal fugal pathogens such as Aspergillus fumigates, Aspergillus niger, Aspergillus flavis, Candida.tropicalis, Candida parapsilopsis, Candida Irrusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydiss, or any species falling within the genera of any of the above species.
The nucleic acid molecule comprising an antisense nucleotide sequence of the invention may be complementary to a coding and/or noncoding region of a target gene mRNA.
~e ~fisense molecules will bind to the complementary target gene mRNA
transcripts and reduce or prevent translation. Absolute complementarity, although preferred, is not required. A
sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA
may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
Nucleic acid molecules that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
Nucleic acid molecules comprising nucleotide sequences complementary to the 5' untranslated region of the mRNA can include the complement of the AUG start codon.
Antisense nucleic acid molecules complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention.
Whether designed to hybridize to the 5'-, 3'- or coding region of target gene mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, at least 50 nucleotides, or at least 200 nucleotides.
Regardless of the choice of target gene sequence, it is preferred that in vitro studies are first performed to quantitate the ability of the antisense molecule to inhibit gene expression. It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also preferred that these studies compare levels of the target RNA or protein with that of an internal control RNA
or protein. Additionally, it is envisioned that results obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide. It is preferred that the control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.
The antisense molecule can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The antisense molecule can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The antisense molecule may include other appended groups such as peptides (e.g., for targeting cell receptors in vivo), hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the antisense molecule may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
The antisense molecule may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, ~hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, S-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense:molecule may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense molecule comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense molecule is an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ~i-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (moue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (moue et al., 1987, FEBS Lett. 215:327-330).
Antisense molecules of the invention may be synthesized by standard methods .
known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl.
Acids Res.

16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
While antisense nucleotides complementary to the coding region of a target gene could be used, those complementary to the transcribed untranslated region are also preferred.
Pharmaceutical compositions of the invention comprising an effective amount of an antisense nucleic acid in a pharmaceutically acceptable carrier, can be administered to a subject infected with the pathogen of interest.
The amount of antisense nucleic acid which will be effective in the treatment of a particular disease caused by the pathogen will depend on the site of the infection or condition, and can be determined by standard techniques. Where possible, it is desirable to determine the antisense cytotoxicity of the pathogen to be treated in vitro, and then in useful animal model systems prior to testing and use in humans.
A number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site in which the pathogens are residing, or modified antisense molecules, designed to target the desired cells (e.g., antisense molecule linked to peptides or antibodies that specifically bind receptors or antigens expressed on the pathogen's cell surface) can be administered systemically. Antisense molecules can be delivered to the desired cell population via a delivery complex. In a specific embodiment, pharmaceutical compositions comprising antisense nucleic acids of the target genes are administered via biopolymers (e.g., poly-~3-1 ~4-N-acetylglucosamine polysaccharide), liposomes, microparticles, or microcapsules. In various embodiments of the invention, it may be useful to use such compositions to achieve sustained release of the antisense nucleic acids. In a specific embodiment, it may be desirable to utilize liposomes targeted via antibodies to specific identifiable pathogen antigens (Leonetti et al., 1990, Proc. Natl. Acad. Sci.
U.S.A. 87:2448-2451; Renneisen et al., 1990, J. Biol. Chem. 265:16337-16342).
5.4.6 Ribozyme Molecules Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA (For a review see, for example Rossi, J., 1994, Current Biology 4:469-471).
The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage.
The composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA
cleavage. For this sequence, see U.S. Pat. No. 5,093,246, which is incorporated by reference herein in its entirety. As such, within the scope of the invention are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences encoding target gene proteins.
Ribozyme molecules designed to catalytically cleave specific target gene mRNA
transcripts can also be used to prevent translation of target gene mRNA and expression of target genes. While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy target gene mRNAs, the use of hammerhead ribozymes is preferred.
Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target gene mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more filly in Haseloff and Gerlach, 1988, Nature, 334:585-591. Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the target gene mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
The ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578;
Zaug and Cech, 1986, Science, 231:470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present m a target gene.
As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express the target gene in vivo. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
Multiple ribozyme molecules directed against different target genes can also be used in combinations, sequentially or simultaneously.
~fi_~~e RNA and DNA, ribozyme, and triple helix molecules of the invention can be prepared by any method known in the art for the synthesis of DNA and RNA
molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules can be generated by in vitro and in vivo ripfion~of DNA sequences encoding the antisense RNA rriolecule. Such DNA
sequences can be incorporated into a wide variety of vectors which incorporate suitable RNA polymerise promoters such as the T7 or SP6 polymerise promoters. Alternatively, antisense cDNA
constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines. These nucleic acid constructs can be administered selectively to the desired cell population via a delivery complex.
Various well-known modifications to the DNA molecules can be introduced as a means of increasing intracellular stability and half life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy-nucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phospho-diesterase linkages within the oligodeoxyribonucleotide backbone.
5.5 SCREENING ASSAYS
The following assays are designed to identify compounds that bind to target gene products, bind to other cellular proteins that interact with the target gene product, and to 1 S compounds that interfere with the interaction of the target gene product with other cellular proteins. Compounds identified via such methods can include compounds which modulate the activity of a polypeptide encoded by a target gene of the invention (that is, increase or decrease its activity, relative to activity observed in the absence of the compound).
Alternatively, compounds identified via such methods can include compounds which modulate the expression of me polynucleotide (that is, increase or decrease expression relative to 'expression levels observed in the absence of the compound), or increase or decrease the stability of the expressed product encoded by that polynucleotide. Compounds, such as compounds identified via the methods of the invention, can be tested using standard assays .well known to those of skill in the art for their ability to modulate acfivity/expression.
Accordingly, the present invention provides a method for identifying an antimycotic compound comprising screening a plurality of compounds to identify a compound that modulates the activity or level of a gene product, said gene product being encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 61, or a nucleotide sequence that is naturally occurring in Saccharomyces cerevisiae and that is the ortholog of a gene having a nucleotide sequence selected from the group consisting of SEQ ID
NO: 1 to 61.
5.5.1 In Vitro Screening Assays In vitro systems are designed to identify compounds capable of binding the target gene products of the invention. Compounds identified in this manner are useful, for example, in modulating the activity of wild type and/or mutant target gene products, are usefi>I in elucidating the biological function of target gene products, are utilized in screens for identifying other compounds that disrupt normal target gene product interactions, or are useful themselves for the disruption of such interactions.
The principle of the assays used to identify compounds that bind to the target gene product involves preparing a reaction mixture comprising the target gene product and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex which is removed and/or detected within the reaction mixture.
These assays are conducted in a variety of ways. For example, one method involves anchoring target gene product or the test substance onto a solid phase and detecting target gene product/test compound complexes anchored, via the intermolecular binding reaction, to the solid phase at the end of the reaction. In one embodiment of such a method, the target gene product is anchored onto a solid surface, and the test compound, which is not anchored, is labeled, either directly or indirectly.
In practice, microtiter plates are conveniently utilized as the solid phase.
The anchored component is immobilized by non-covalent or covalent attachments. Non-covalent attachment can be accomplished by simply coating the solid surface with a solution of the protein and drying the coated surface. Alternatively, an immobilized antibody, preferably a monoclonal antibody, specific for the protein to be immobilized is used to anchor the protein to the solid surface. The surfaces are prepared in advance and stored.
In order to conduct the assay, the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e. g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored'on the solid surface is accomplished in a number of ways. Where the previously nonimmobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously nonimmobilized component is not pre-labeled, an indirect label is used to detect complexes anchored on the surface; ~, using a labeled antibody specific for the previously nonimmobilized component (the antibody, in tum, is directly labeled or indirectly labeled with a labeled anti-Ig antibody).
Alternatively, a reaction is conducted in a liquid phase, the reaction products are separated from unreacted components, and complexes are detected; e.g., using an immobilized antibody specific for the target gene product or for the test compound, to anchor complexes formed in solution, and a second labeled antibody, specific for the other component of the complex to allow detection of anchored complexes.

5.5.1.1 Assays For Proteins That Interact With A Target Gene Product Any method suitable for detecting protein-protein interactions can be employed for identifying novel target protein-cellular or extracellular protein interactions.
The target gene products of the invention interact, in vivo, with one or more cellular or extracellular macromolecules, such as proteins. Such macromolecules include, but are not limited to, nucleic acid molecules and proteins identified via methods such as those described above. For purposes of this discussion, such cellular and extracellular macromolecules are referred to herein as "binding partners." Compounds that disrupt such interactions can be useful in regulating the activity of the target gene protein, especially mutant target gene proteins. Such compounds include, but are not limited to molecules such as antibodies, peptides, and the like, as described.
The basic principle of the assay systems used to identify compounds that interfere with the interaction between the target gene product and its cellular or extracellular binding partner or partners involves preparing a reaction mixture containing the target gene product and the binding partner under conditions and for a time sufficient to allow the two to interact and bind, thus forming a complex. In order to test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound is initially included in the reaction mixture, or added at a time subsequent to the addition of target gene product and its cellular or extracellular binding partner. Control reaction textures are incubated without the test compound. The formation of complexes between the target gene protein and the cellular or extracellular binding partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the target gene protein and the interactive binding partner. Additionally, complex formation within reaction mixtures Wing ~e test compound and normal target gene protein can also be compared to complex formation within reaction mixhires containing the test compound and a mutant target gene protein. This comparison can be important in those cases wherein it is desirable to identify compounds that disrupt intermolecular interactions involving mutant but not normal target gene proteins.
The assay for compounds that interfere with the interaction of the target gene products and binding partners is conducted in either a heterogeneous or a homogeneous format.
Heterogeneous assays involve anchoring either the target gene product or the binding partner onto a solid phase and detecting complexes anchored on the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants is varied to obtain dii~erent information about the compounds being tested. For example, test compounds that interfere with the interaction between the target gene products and the binding partners, e.g., by competition, are identified by conducting the reaction in the presence of the test substance; i. e., by adding the test substance to the reaction mixture prior to or simultaneously with the target gene protein and an interacting cellular or extracellular binding partner. Alternatively, test compounds that disrupt preformed complexes, e.g_ compounds with higher binding constants that displace one of the components from the complex, are tested by adding the test compound to the reaction mixture after complexes have been formed. The various formats are described briefly below.
In a heterogeneous assay system, either the target gene protein or the interactive cellular or extracellular binding partner, is anchored onto a solid surface, while the non-anchored species is labeled, either directly or indirectly. In practice, microtiter plates are conveniently utilized. The anchored species is immobilized either by non-covalent or covalent attachment.
Non-covalent attachment is accomplished simply by coating the solid surface with a solution of the target gene product or binding. partner and drying the coated surface.
Alternatively, an immobilized antibody specific for the species to be anchored is used to anchor the species to the solid surface. The surfaces can be prepared in advance and stored.
In order to conduct the assay, the partner of the immobilized species is exposed to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface is accomplished in a number of ways. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the initially non-immobilized species (the antibody, in turn, is directly labeled or indirectly labeled with a labeled anti-Ig antibody). Depending upon the order of addition of reaction components, test compounds which inhibit complex formation or which disrupt preformed complexes are detected.
Alternatively, the reaction is conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for one of the binding components to anchor any complexes formed in solution, and a second, labeled antibody specific for the other partner to detect anchored complexes. Again, depending uporrthe order of addition of reactants to the liquid phase, test compounds which inhibit complex or which disrupt preformed complexes are identified.
' In an alternate embodiment of the invention, a homogeneous assay can be used.

In this approach, a preformed complex of the target gene protein and the interacting cellular or extracellular binding partner is prepared in which either the target gene product or its binding partner is labeled, but the signal generated by the label is quenched due to complex formation (see, e.g., U.S. Patent No. 4,109,496 by Rubenstein which utilizes this approach for immunoassays). The addition of a test substance that competes with and displaces one of the species from the preformed complex results in the generation of a signal above background. In this way, test substances which disrupt target gene protein/cellular or extracellular binding partner interaction are identified.
In a particular embodiment, the target gene product is prepared for immobilization using recombinant DNA techniques described above. For example, the target gene coding region is fused to a glutathione-S-transferase (GST) gene using a fusion vector, such as pGEX-5X-1, in such a manner that its binding activity is maintained in the resulting fusion protein. The interactive cellular or extracellular binding partner is purified and used to raise a monoclonal antibody, using methods routinely practiced in the art and as described above. This antibody is labeled with the radioactive isotope'ZSI, for example, by methods routinely practiced in the art. In a heterogeneous assay, eg, the GST-target gene fusion protein is anchored to glutathione-agarose beads. The interactive cellular or extracellular binding partner is then added in the presence or absence of the test compound in a manner that allows interaction and binding to occur. At the end of the reaction period, unbound material can be washed away, and the labeled monoclonal antibody is added to the system and allowed to bind to the complexed components. The interaction between the target gene protein and the interactive cellular or extracellular binding partner is detected by measuring the amount of radioactivity that remains associated with the glutathione-agarose beads. A
successful inhibition of the interaction by the test compound results in a decrease in measured radioactivity.
Alternatively, the GST-target gene fusion protein and the interactive cellular or extracellular binding partner are mixed together in liquid in the absence of the solid glutathione-agarose beads. The test compound is added either during or after the species are allowed to interact. This mixture is added to the glutathione-agarose beads and unbound material is washed away. Again the extent of inhibition of the target gene product/binding partner interaction is detected by adding the labeled antibody and measuring the radioactivity associated with the beads.
In another embodiment of the invention, these same techniques are employed using peptide figments that correspond to the binding domains of the target gene product and/or the interactive cellular or extracellular binding partner (in cases where the binding partner 3 S is a protein), in place of one or both of the full length proteins. Any number of methods routinely practiced in the art are used to identify and isolate the binding sites. These methods include, but are not limited to, mutagenesis of the gene encoding one of the proteins and screening for disruption of binding in a co-immunoprecipitation assay.
Compensating mutations in the gene encoding the second species in the complex are then selected.
Sequence analysis of S the genes encoding the respective proteins reveals the mutations that correspond to the region of the protein involved in interactive binding. Alternatively, one protein is anchored to a solid surface using methods described above, and allowed to interact with and bind to its labeled binding partner, which has been treated with a proteolytic enzyme, such as trypsin. After washing, a short, labeled peptide comprising the binding domain remains associated with the solid material, and can be isolated and identified by amino acid sequencing.
Also, once the gene coding for the cellular or extracellular binding partner is obtained, short gene segments are engineered to express peptide fi~agments of the protein, which are tested for binding activity and purified or synthesized.
For example, and not by way of limitation, a target gene product is anchored to a solid material as described, above, by making a GST-target gene fusion protein and allowing it to bind to .glutathione agarose beads. The interactive cellular or extracellular binding partner is labeled with a radioactive isotope, such as 355, and cleaved with a proteolytic enzyme such as .
trypsin. Cleavage products are added to the anchored GST-target gene fusion protein and allowed to bind. After washing away unbound peptides, labeled bound material, representing the cellular or extracellular binding partner binding domain, is eluted, purified, and analyzed for amino acid sequence by well known methods. Peptides so identified are produced synthetically or fiised to appropriate facilitative proteins using well known recombinant DNA technology.
5.5.1.2 Screening a Combinatorial Chemical library In one embodiment of the present invention, the proteins encoded by the fiuigal genes identified using the methods of the present invention are isolated and expressed. These recombinant proteins are then used as targets in assays to screen libraries of compounds for potential drug candidates. The generation of chemical libraries is well known in the art. For example, combinatorial chemistry is used to generate a library of compounds to be screened in ~e ~~ys described herein. A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building block" reagents. For example, a linear combinatorial-chemical library such as a polypeptide library is formed by combining amino acids in every possible combination to yield peptides of a given length. Millions of chemical compounds theoretically ~ ~ ~~es~ ~.ough such combinatorial mixings of chemical building blocks. For example, one commentator observed that the systematic, combinatorial mixing of interchangeable chemical building blocks results in the theoretical synthesis of 100 million tetrameric compounds or 10 billion pentameric compounds. (Gallop et al., "Applications of Combinatorial Technologies to Drug Discovery, Background and Peptide Combinatorial Libraries," Journal of Medicinal Chemistry, Vol. 37, No. 9, 1233-1250 (1994).
Other chemical libraries known to those in the art may also be used, including natural product libraries.
Once generated, combinatorial libraries are screened for compounds that possess desirable biological properties. For example, compounds which may be useful as drugs or to develop drugs would likely have the ability to bind to the target protein identified, expressed and p~ fed as discussed above. Further, if the identified target protein is an enzyme, candidate compounds would likely interfere with the enzymatic properties of the target protein. For example, the enzymatic function of a target protein may be to serve as a protease, nuclease, phosphatase, dehydrogenase, transporter protein, transcriptional enzyme, replication component, and any othei type of enzyme known or unknown. Thus, the present invention contemplates ~~g ~e protein products described above to screen combinatorial chemical libraries.
In some embodiments of the present invention, the biochemical activity of the protein, as well as the chemical structure of a substrate on which the protein acts is known. In other embodiments of the present invention, the biochemical activity of the target protein is unknown and the target protein has no known substrates.
In some embodiments of the present invention, libraries of compounds are screened to identify compounds that function as inhibitors of the target gene product. First, a library of small molecules is generated using methods of combinatorial library formation well known in the art. U.S. Patent NOs. 5,463,564 and 5,574, 656, to Agrafiotis, et al., entitled "System and Method of Automatically Generating Chemical Compounds with Desired properties," the disclosures of which are incorporated herein by reference in their entireties, are two such teachings. Then the library compounds are screened to identify those compounds that possess desired structural and functional properties. U.S. Patent No.
5,684,711, the disclosure of which is incorporated herein by reference in its entirety, also discusses a method for screening libraries.
To illustrate the screening process, the target gene product, an enzyme, and chemical compounds of the library are combined and permitted to interact with one another. A
labeled substrate is added to the incubation. The label on the substrate is such that a detectable signal is emitted from metabolized substrate molecules. The emission of this signal permits one 3 S to measure the effect of the combinatorial library compounds on the enzymatic activity of target enzymes by comparing it to the signal emitted in the absence of combinatorial library compounds. The characteristics of each library compound are encoded so that compounds demonstrating activity against the enzyme can be analyzed and features common to the various compounds identified can be isolated and combined into future iterations of libraries.
Once a library of compounds is screened, subsequent libraries are generated using those chemical building blocks that possess the features shown in the first round of screen to have activity against the target enzyme. Using this method, subsequent iterations of candidate compounds will possess more and more of those structural and fimctional features required to inhibit the function of the target enzyme, until a group of enzyme inhibitors with high specificity for the enzyme can be found. These compounds can then be further tested for their safety and e~cacy as antibiotics for use in mammals.
It will be readily appreciated that this particular screening methodology is exemplary only. Other methods are well known to those skilled in the art. For example, a wide variety of screening techniques are known for a large number of naturally-occurring targets when the biochemical function of the target protein is known. For example, some t~~ques involve the generation and use of small peptides to probe and analyze target proteins both biochemically and genetically .in order to identify and develop drug leads. Such techniques include the methods described in PCT publications No. W09935494, W09819162, W09954728, the disclosures of which are incorporated herein by reference in their entireties.
Similar methods may be used to identify compounds which inhibit the activity of proteins from organisms other than Candida albicans which are homologous to the Candida albicans target proteins described herein. For example, the proteins may be from animal fugal pathogens such as Aspergillus fumigates, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fimgal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species. In some embodiments, the proteins are from an organism other than Saccharomyces cerevisiae.
5.5.1.3 In vitro Enzyme Assays GRACE methods and strains are used to develop in vitro assays for biochemical activities that are shown to be essential to cell viability. A number of essential genes identified by ~e GRACE conditional expression methodologies display statistically significant similarity to biochemically characterized gene products from other organisms. For example, based on amino acid sequence similarity, a number of essential and fimgal specific genes listed in Table II
are predicted to possess the following biochemical activities:
CaRH01 GTPase involved in (1,3)-(3-glucan synthesis and polarity CaYHR118c (ORC6) Origin of replication complex subunit CaYPLl28c (T'BPI) Telomere binding protein CaYNL256w Dihydropteroate synthase CaYKL004w (AURI) Phosphatidylinositol: ceramide phosphoinositol transferase CaYJL090c (DPBlI) DNA polB subunit CaYOLl49w (DCPI) mRNA decapping enzyme CaYNL151 c (RPC31) RNA poIIII subunit CaYORl48c (SPP2) RNA splicing CaYER026c (CHOI) Phosphatidylserine synthase Therefore, a number of well characterized standard in vitro biochemical assays (e.g., DNA binding, RNA processing, GTP binding and hydrolysis, and phosphorylation) are readily adapted for these validated drug targets. For example the validated target, CaRH0l, is used within a in vitro-based drug screen by adapting standard GTPase assays developed for a wide range of such proteins. Alternatively, novel assays are developed using biochemical ~.o~ation pertaining to validated drug targets within our GRACE strain collection. Any assays known in the art for enzymes with similar biochemical activities (e.g., mechanism of action, class of substrate) are adapted for screening for inhibitors of the enzymes encoded by these essential C. albicans genes.
For example, a number of features make the C. albicarrs gene, CaTBFI, a candidate for in vitro assay development. CaTBFl shares significant homology to its S.
cerevisiae counterpart, TBFI , a telomere binding factor. In addition, the DNA
sequence CaTBFIp recognizes is known and is relatively short (Koering et al., Nucleic Acid Res.
28:2519-2526, which is incorporated herein by reference in its entirety), enabling inexpensive s~~esis of oligonucleotides corresponding to this element. Moreover since this assay only requires the target protein and a DNA fragment containing the nucleotide sequence it recognizes, only purification of CaTBFIp protein is necessary in order to develop an in vitro binding assay.
One preferred embodiment of this in vitro assay involves crosslinking the DNA
element to the bottom of a well, incubation of radiolabeled CaTBF 1 p to facilitate protein-DNA binding, a ones of washes to remove unbound material, and deten~nination of the percentage of bound radiolabeled CaTBFIp. Alternatively, purified CaTBFlp is attached to the well and radiolabeled oligonucleotides added. Drug screening, including the use of high throughput screening technique, is performed by searching for compounds that inhibit the protein-DNA
binding measured in this assay.
Similarly, a second validated drug target, CaORC6, is used in this type of assay since its S. cerevisiae homolog, ORC6, directly binds a DNA element within the origin of replication of yeast chromosomes (Mizushima et al., 2000, Genes & Development 14:1631-1641, which is incorporated herein by reference in its entirety). Biochemical purification of any of these targets could be achieved, for example, by PCR-based construction of C. albicans heterozygbus strains in which the gene encoding the CaORC6 protein has been modified to include a carboxy-terminal hexahistidine tag enabling purification of the chimeric protein using standard Ni+z affinity column chromatography techniques.
For other targets like CaDPBI l , a homolog of which in S. cerevisiae encode proteins that physically associate with Sld2p (Kamimura et al., 1998, Cell Biol. 18:6102-6109, which is incorporated herein by reference in its entirety), in vitro assays similar to those 1 S described above are developed. In addition, two-hybrid assays based on known physical interactions are developed for any validated targets within the GRACE strain collection.
The present invention also provides cell extracts useful in establishing in vitro assays for suitable biochemical targets. For example, in an embodiment of the present invention, GRACE-derived C. albicans strains are grown either under constitutive expression conditions or transcription repression conditions to either overproduce or deplete a particular gene product. Cellular extracts resulting from strains incubated under these two conditions are compared with extracts prepared from identically-grown wild type strains.
These extracts are then used for the rapid evaluation of targets using existing in vitro assays or new assays directed toward novel gene products, without having to purify the gene product. Such a whole cell extract approach to in vitro assay development is typically necessary for targets involved in cell wall biosynthetic pathways (e. g. (1,3)-~i-glucan synthesis or chitin synthesis) which involve multiple gene products that transit the secretory pathway before receiving essential post-translational modifications required for their functional activity. GRACE-derived strains for conditional expression of target genes involved in these, or other cell wall pathways (e. g. (1,6)-(3-glucan synthesis) enable in vitro assays to be performed directly in C.
albicans.

5.5.2 Cell-based Screening Assays Current cell-based assays used to identify or to characterize compounds for drug discovery and development frequently depend on detecting the ability of a test compound to modulate the activity of a target molecule located within a cell or located on the surface of a cell.
Most often such target molecules are proteins such as enzymes, receptors and the like.
However, target molecules also include other molecules such as DNAs, lipids, carbohydrates and RNAs including messenger RNAs, ribosomal RNAs, tRNAs and the like. A
number of highly sensitive cell-based assay methods are available to those of skill in the art to detect binding and interaction of test compounds with specific target molecules.
However, these methods are generally not highly effective when the test compound binds to or otherwise interacts with its target molecule with moderate or low affinity. In addition, the target molecule may not be readily accessible to a test compound in solution, such as when the target molecule is located inside the cell or within a cellular compartment such as the periplasm of a bacterial cell.
Thus, current cell-based assay methods are limited in that they are not effective in identifying or characterizing compounds that interact with their targets with moderate to low affinity or compounds that interact with targets that are not readily accessible.
The cell-based assay methods of the present invention have substantial advantages over current cell-based assays. These advantages derive from the use of sensitized cells in which the level or activity of at least one gene product required for fungal proliferation, virulence, or pathogenicity (the target molecule) has been specifically reduced to the point where the presence or absence of its function becomes a rate-determining step for fungal growth, survival, proliferation, virulence, or pathogenicity. Such sensitized cells become much more sensitive to compounds that are active against the affected target molecule.
For example, sensitized cells are obtained by growing a GRACE strain in the presence of a concentration of inducer or repressor which provides a level of a gene product required for fungal growth, survival, proliferation, virulence, or pathogenicity such that the presence or absence of its function becomes a rate-determining step for fungal growth, survival, proliferation, virulence, or pathogenicity. Thus, cell-based assays of the present invention are capable of detecting compounds exhibiting low or moderate potency against the target molecule of interest because such compounds are substantially more potent on sensitized cells than on non-sensitized cells.
The effect may be such that a test compound may be two to several times more potent, at least 10 times more potent, at least 20 times more potent, at least SO times more potent, at least 100 times more potent, at least 1000 times more potent, or even more than 1000 times more potent when tested on the sensitized cells as compared to the non-sensitized cells.
Due in part to the increased appearance of antibiotic resistance in pathogenic microorganisms and to the significant side-erects associated with some currently used antibiotics, novel antibiotics acting at new targets are highly sought after in the art. Yet, another limitation in the current art related to cell-based assays is the problem of repeatedly identifying hits against the same kinds of target molecules in the same limited set of biological pathways.
This may occur when compounds acting at such new targets are discarded, ignored or fail to be detected because compounds acting at the "old" targets are encountered more frequently and are more potent than compounds acting at the new targets. As a result, the majority of antibiotics in use currently interact with a relatively small number of target molecules within an even more I
limited set of biological pathways.
The use of sensitized cells of the current invention provides a solution to the above problems in two ways. First, desired compounds acting at a target of interest, whether a new target or a previously known but poorly exploited target, can now be detected above the "noise" of compounds acting at the "old" targets due to the specific and substantial increase in potency of such desired compounds when tested on the sensitized cells of the current invention.
Second, the methods used to sensitize cells to compounds acting at a target of interest may also sensitize these cells to compounds acting at other target molecules within the same biological pathway. For example, expression of a gene encoding a ribosomal protein at a level such that the function of the ribosomal protein becomes rate limiting for fiuigal growth, survival, proliferation, virulence, or-pathogenicity is expected to sensitize the cell to compounds acting at.
fat ribosomal protein to compounds acting at any of the ribosomal components (proteins or rRNA) or even to compounds acting at any target which is part of the protein synthesis pathway.
'Thus an important advantage of the present invention is the ability to reveal new targets and pathways that were previously.not readily accessible to drug discovery methods.
Sensitized cells of the present invention are prepared by reducing the activity or level of a target molecule. The target molecule may be a gene product, such as an RNA or polypeptide produced from the nucleic acids required for fixngal growth, survival, proliferation, virulence, or pathogenicity described herein. In addition, the target may be an RNA or polypeptide in the same biological pathway as the nucleic acids required for fungal growth, s~'ival, proliferation, virulence, or pathogenicity as described herein. Such biological pathways include, but are not limited to, enzymatic, biochemical and metabolic pathways as well as pathways involved in the production of cellular structures such as the cell membrane.
Current methods employed in the arts of medicinal and combinatorial chemistries are able to make use of structure-activity relationship information derived from testing compounds in various biological assays including direct. binding assays and cell-based assays. Occasionally compounds are directly identified in such assays that are sufficiently potent to be developed as drugs. More often, initial hit compounds exhibit moderate or low potency. Once a hit compound is identified with low or moderate potency, directed libraries of compounds are synthesized and tested in order to identify more potent leads.
Generally these directed libraries are combinatorial chemical libraries consisting of compounds with structures related to the hit compound but containing systematic variations including additions, subtractions and substitutions of various structural features. When tested for activity against the target molecule, structural features are identified that either alone or in combination with other features enhance or reduce activity. This information is used to design subsequent directed libraries containing compounds with enhanced activity against the target molecule. After one or several iterations of this process, compounds with substantially increased activity against the target molecule are identified and may be fiuther developed as drugs. 'This process is facilitated by use of the sensitized cells of the present invention since compounds acting at the selected targets exhibit increased potency in such cell-based assays, thus; more compounds can now be characterized providing more useful information than would be obtained otherwise.
'Thus, it is now possible using cell-based assays of the present invention to identify or characterize compounds that previously would not have been readily identified or characterized including compounds that act at targets that previously were not.readily exploited using cell-based assays. The process of evolving potent drug leads from initial hit compounds is also substantially improved by the cell-based assays of the present invention because, for the ~e number of test compounds, more structure-function relationship information is likely to be revealed.
The method of sensitizing a cell entails selecting a suitable gene. A suitable gene is one whose expression is required for the growth, survival, proliferation, virulence, or pa~ogenicity of the cell to be sensitized. The next step is to obtain a cell in which the level or activity of the target can be reduced to a level where it is rate limiting for growth, survival, proliferation, virulence or pathogenicity. For example, the cell may be a GRACE strain in which the selected gene is under the control of a regulatable promoter. The amount of RNA
transcribed from the selected gene is limited by varying the concentration of an inducer or repressor which acts on the regulatable promoter, thereby varying the activity of the promoter driving transcription of the RNA. Thus, cells are sensitized by exposing them to an inducer or repressor concentration that results in an RNA level such that the function of the selected gene product becomes rate limiting for fungal growth, survival, proliferation, virulence, or pathogenicity.
In one embodiment of the cell-based assays, GRACE strains, in which the sequences required for fungal growth, survival, proliferation, virulence, or pathogenicity of Candida albicans described herein are under the control of a regulatable promoter, are grown in the presence of a concentration of inducer or repressor which causes the fiuiction of the gene products encoded by these sequences to be rate limiting for fimgal growth, survival, proliferation, virulence, or pathogenicity. To achieve that goal, a growth inhibition dose curve of inducer or repressor is calculated by plotting various doses of inducer or repressor against the corresponding growth inhibition caused by the limited levels of the gene product required for fimgal proliferation. From this dose-response curve, conditions providing various growth rates, from 1 to 100% as compared to inducer or repressor-free growth, can be determined. For example, if the regulatable promoter is repressed by tetracycline, the GRACE
strain may be grown in the presence of varying levels of tetracyline. Similarly, inducible promoters may be used. In this case, the GRACE strains are grown in the presence of varying concentrations of inducer. For example, the highest concentration of the inducer or repressor that does not reduce the growth rate significantly can be estimated firm the dose-response curve.
Cellular proliferation can be monitored by growth medium turbidity via OD measurements.
In another example, the concentration of inducer or repressor that reduces growth by 25%
can be predicted from the dose-response curve. In still another example, a concentration of inducer or repressor that reduces growth by 50% can be calculated from the dose-response curve.
Additional parameters such as colony forming units (cfix) are also used to measure cellular growth, survival and/or viability.
In another embodiment of the present invention, an individual haploid strain may similarly be used as the basis for detection of an antifixngal or therapeutic agent. In this embodiment, the test organism (e.g. Aspergillus, fumigatus, Cryptococcus neoformans, Magnaportha grisea or.any other haploid organisms represented in Table I) is a strain constructed by modifying the single allele of the target gene in one step by recombination with a promoter replacement fiagment comprising a heterologous regulatable promoter, such that the expression of the gene is conditionally regulated by the heterologous promoter. Like individual diploid GRACE strains, sensitized haploid cells may similarly be used in whole cell-based assay methods to identify compounds displaying a preferential activity against the affected target.
In various embodiments, the modified strain is grown under a first set of conditions where the heterologous promoter is expressed at a relatively low level (i.e. partially repressed) and the extent of growth determined. This experiment is repeated in the presence of a test compound and a second measurement of growth obtained. The extent of growth in the presence and in the absence of the test compound are then compared to provide a first indicator v~ue. Two fiuther experiments are performed, using non-repressing growth conditions where the target gene is expressed at substantially higher levels than in the first set of conditions. The extent of growth is determined in the presence and absence of the test compound under the second set of conditions to obtain a second indicator value. The first and second indicator values are then compared. If the indicator values are essentially the same, the data suggest that the test compound does not inhibit the test target. However, if the two indicator values are substantially different, the data indicates that the level of expression of the target gene product may determine the degree of inhibition by the test compound and, therefore, it is likely that the gene product is the target of that test compound. Whole-cell assays comprising collections or subsets of multiple sensitized strains may also be screened, for example, in a series of 96-well, 384-well, or even 1586-well microtiter plates, with each well containing individual strains sensitized to identify compounds displaying a preferential activity against each affected target comprising a target set or subset selected from, but not limited to the group consisting of fungal-specific, pathogen-specific, desired biochemical-function, human-homolog, cellular localization, and signal transduction cascade target sets.
Cells to be assayed are exposed to the above-determined concentrations of ~ducer or repressor. The presence of the inducer or repressor at this sub-lethal concentration reduces the amount of the proliferation-required gene product to the lowest amount in the cell that will support growth. Cells grown in the presence of this concentration of inducer or repressor are therefore specifically more.sensitive to inhibitors of the proliferation-required protein or RNA of interest as well as to inhibitors of proteins or RNAs in the same biological pathway as the proliferation-required protein or RNA of interest but not °specifically more sensitive to inhibitors of unrelated proteins or RNAs.
Cells pretreated with sub-inhibitory concentrations of inducer or repressor, .. which therefore contain a reduced amount of proliferation-required target gene product, are used to screen for compounds that reduce cell growth. The sub-lethal concentration of inducer or repressor may be any concentration consistent with the intended use of the assay to identify candidate compounds to which the cells are more sensitive than are control cells in which this gene product is not rate-limiting. For example, the sub-lethal concentration of the inducer or repressor may be such that growth inhibition is at least about 5%, at least about 8%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% at least about 75%, , at least 80%, at least 90%, at least 95% or more than 95%. Cells which are pre-sensitized using the preceding method are more sensitive to inhibitors of the target protein because these cells contain less target protein to inhibit than wild-type cells.
It will be appreciated that similar methods may be used to identify compounds which inhibit virulence or pathogenicity. In such methods, the virulence or pathogenicity of cells exposed to the candidate compound which express rate limiting levels of a gene product involved in virulence or pathogenicity is compared to the virulence or pathogenicity of cells exposed to the candidate compound in which the levels of the gene product are not rate limiting. Virulence or pathogenicity may be measured using the techniques described herein.
In another embodiment of the cell-based assays of the present invention, the level or activity of a gene product required for fungal growth, survival, proliferation, virulence, or pathogenicity is reduced using a mutation, such as a temperature sensitive mutation, in the sequence required for fungal growth, survival, proliferation, virulence, or pathogenicity and an inducer or repressor level which, in conjunction with the temperature sensitive mutation, provides levels of the gene product required for fungal growth, survival, proliferation, virulence, or pathogenicity which are rate limiting for proliferation. Growing the cells at an intermediate temperature between the permissive and restrictive temperatures of the temperature sensitive mutant where the mutation is in a gene required for fungal growth, survival, proliferation, virulence, or pathogenicity produces cells with reduced activity of the gene product required for growth, survival, proliferation, virulence, or pathogenicity. The concentration of inducer or repressor is chosen so as to further reduces the activity of the gene product required for fungal growth, survival, proliferation, virulence, or pathogenicity. Drugs that may not have been found using either the temperature sensitive mutation or the inducer or repressor alone may be identified by determining whether cells in which expression of the nucleic acid encoding the proliferation-required gene product has been reduced and which are grown at a temperature between the permissive temperature and the restrictive temperature are substantially more sensitive to a test compound than cells in which expression of the gene product required for fungal growth, survival,-proliferation, virulence, or pathogenicity has not been reduced and which are grown at a permissive temperature. Also drugs found previously from either the use of the inducer or repressor alone or the temperature sensitive mutation alone may have a different sensitivity profile when used in cells combining the two approaches, and that sensitivity profile may indicate a ~ more specific action of the drug in inhibiting one or more activities of the gene product.
Temperature sensitive mutations may be located at different sites within a gene and may lie within different domains of the protein. For example, the dnaB gene of Escherichia coli encodes the replication fork DNA helicase. DnaB has several domains, including domains for oligomerization, ATP hydrolysis, DNA binding, interaction with primase, interaction with DnaC, and interaction with DnaA. .Temperature sensitive mutations in different domains of DnaB confer different phenotypes at the restrictive temperature, which include either an abrupt stop or a slow stop in DNA
replication either with or without DNA breakdown (Wechsler, J.A. and Gross, J.D. 1971 Escherichia coli mutants temperature-sensitive for DNA synthesis. Mol. Gen. Genetics 113:273-284) and termination of growth or cell death. Thus, temperature sensitive mutations in different domains of the protein may be used in conjunction with GRACE strains in which expression of the protein is under the control of a regulatable promoter.
It will be appreciated that the above method may be performed with any mutation which reduces but does not eliminate the activity or level of the gene product which is required for fungal growth, survival, proliferation, virulence, or pathogenicity.
When screening for antimicrobial agents against a gene product required for fungal growth, survival, proliferation, virulence, or pathogenicity, growth inhibition, virulence or pathogenicity of cells containing a limiting amount of that gene product can be assayed. Growth inhibition can be measured by directly comparing the amount of growth, measured by the optical density of the culture relative to uninoculated growth medium, between an experimental sample and a control sample. Alternative methods for assaying cell proliferation include measuring green fluorescent protein (GFP) reporter 'construct emissions, various enzymatic activity assays, and other methods well known in the art.
Virulence and pathogenicity may be measured using the techniques described herein.
It will be appreciated that the above method may be performed in solid phase, liquid phase, a combination of the two preceding media., or in vivo.
For example, cells grown on nutrient agar containing the inducer or repressor which acts on the regulatable promoter used to express the proliferation required gene product may be exposed to compounds spotted onto the agar surface. A compound's effect may be judged from the diameter of the resulting killing zone, the area around the compound application point in which cells do not grow. Multiple compounds may be transferred to agar plates and simultaneously tested using automated and semi-automated equipment including but not restricted to mufti-channel pipettes (for example the Beckman Multimek) and mufti-channel spotters (for example the Genomic Solutions Flexys). In this way multiple plates and thousands to millions of compounds may be tested per day.
The compounds are also tested entirely in liquid phase using microtiter plates as described below. Liquid phase screening may be performed in microtiter plates containing 96, 384, 1536 or more wells per microtiter plate to screen multiple plates and thousands to millions of compounds per day. Automated and semi-automated equipment are used for addition of reagents (for example cells and compounds) and for determination of cell density.
-77_ The compounds are also tested in vivo using the methods described herein.
It will be appreciated that each of the above cell-based assays may be used to identify compounds which inhibit the activity of gene products from organisms other than Candida albicans which are homologous to the Candida albicans gene products described herein. For example, the target gene products may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus_flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia ~orymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controver-sa, Ustilago maydis, or any species falling within the genera of any of the above species.
In some embodiments, the gene products are from an organism other than Saccharomyces cerevisiae.
1 S 5,5.2.1 Cell-Based Assays Using GRACE Strains GRACE strains in which one allele of a gene required for fungal growth, survival, proliferation, virulence, or pathogenicity is inactivated while the other allele is under the control of a regulatable promoter are constructed using the methods described herein. For the purposes of the present example, the regulatable promoter may be the tetracycline regulated promoter described herein, but it will be appreciated that any regulatable promoter may be used.
In one embodiment of the present invention, an individual GRACE strain is used as the basis for detection of a therapeutic agent active against a diploid pathogenic fungal cell. In this embodiment, the test organism is a GRACE strain having a modified allelic gene pair, where the first allele of the gene has been inactivated by the insertion of, or replacement by, a nucleotide sequence encoding an expressible, dominant selectable marker and the second allele has been modified, by recombination, to place the second allele under the controlled expression of a heterologous promoter. This test GRACE strain is then grown under a first set of conditions where the heterologous promoter is expressed at a relatively low level ("repressing") and the extent of growth determined. This measurement may be carried out using any appropriate standard known to those skilled in the art including optical density, wet weight of pelleted cells, total cell count, viable count, DNA
content, and the like.. This experiment is repeated in the presence of a test compound and a second measurement of growth obtained. The extent of growth in the presence and in the absence of the test compound, which can conveniently be expressed in terms of indicator _78_ values, are then compared. A dissimilarity in the extent of growth or indicator values provides an indication that the test compound may interact with the target essential gene product.
To gain more information, two further experiments are performed, using a second set of "non-repressing" growth conditions where the second allele, under the control of the heterologous promoter, is expressed at a level substantially higher than in the first set of conditions described above. The extent of growth or indicator values is determined in the presence and absence of the test compound under this second set of conditions.
The extent of growth or indicator values in the presence and in the absence of the test compound are then compared. A dissimilarity in the extent of growth or indicator values provides an indication that may interact with the target essential gene product.
Furthermore, the extent of growth in the first and in the second set of growth conditions can also be compared. If the extent of growth is essentially the same, the data suggest that the test compound does not inhibit the gene product encoded by the modified allelic gene pair carried by the GRACE strain tested. However, if the extent of growth are substantially different, the data indicate that the level of expression of the subject gene product may determine the degree of inhibition by the test compound and, therefore, it is likely that the subject gene product is the target of that test compound.
Although each GRACE strain can be tested individually, it will be more efficient to screen entire sets or subsets of a GRACE strain collection at one time.
Therefore in one aspect of this invention, arrays may be established, for example in a series of 96-well microtiter plates, with each well containing a single GRACE strain.
In one representative, but not limiting approach, four microtiter plates are used, comprising two pairs where the growth medium in one pair supports greater expression of the heterologous promoter controlling the remaining active allele in each strain, than the medium in the other pair of plates. One member of each pair is supplemented with a compound to be tested and measurements of growth of each GRACE strain is determined using standard procedures to provide indicator values for each isolate tested. The collection of diploid pathogenic GRACE strains used in such a method for screening for therapeutic agents may comprise, for example, a substantially complete set of all the modified allelic gene pairs of the organism, the substantially complete set of all the modified allelic essential gene pairs of the organism or the collection may be selected from a subset of GRACE strains selected from, but not limited to the group consisting of fungal-specific, pathogen-specific, desired biochemical-function, human-homolog, cellular localization, and signal transduction c~cade target sets.

The GRACE strains are grown in medium comprising a range of tetracycline concentrations to obtain the growth inhibitory dose-response curve for each strain. First, seed cultures of the GRACE strains are grown in the appropriate medium.
Subsequently, aliquots of the seed cultures are diluted into medium containing varying concentrations of tetracycline. For example, the GRACE strains may be grown in duplicate cultures containing two-fold serial dilutions of tetracycline. Additionally, control cells are grown in duplicate without tetracycline. The control cultures are started from equal amounts of cells derived from the same initial seed culture of a GRACE strain of interest. The cells are grown for an appropriate period of time and the extent of growth is determined using any appropriate technique. For example, the extent of growth may be determined by measuring the optical density of the cultures. When the control culture reaches mid-log phase the percent growth (relative to the control culture) for each of the tetracycline containing cultures is plotted against the log concentrations of tetracycline to produce a growth inhibitory dose response curve for tetracycline. The concentration of tetracycline that i~ibits cell growth to 50% (ICso) as compared to the 0 mM tetracyline control (0% growth inhibition) is then calculated from the curve. Alternative methods of measuring growth are also contemplated. Examples of these methods include measurements of proteins, the .
expression of which is engineered into the cells being tested and can readily be measured.
Examples of such proteins include green fluorescent protein (GFP) and various enzymes.
Cells are pretreated with the selected concentration of tetracycline and then used to test the sensitivity of cell populations to candidate compounds. For example, the cells may be pretreated with a concentration of tetracycline which inhibits growth by at least about 5%, at least about 8%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% at least about 75%,.at least 80%, at least 90%, at least 95% or more than 95%. The cells are then contacted with the candidate compound and growth of the cells in tetracycline containing medium is compared to growth of the control cells in medium which lacks tetracycline to determine whether the candidate compound inhibits growth of the sensitized cells (i.e. the cells grown in the presence of tetracycline). For example, the growth of the cells in tetracycline containing medium may be compared to the growth of the cells in medium lacking tetracycline to determine whether the candidate compound inhibits the growth of the sensitized cells (i.e. the cells grown in the presence of tetracyline) to a greater extent than the candidate compound inhibits the growth of cells grown in the absence of tetracycline. For example, if a significant difference in growth is. obseived between the sensitized cells (i.e. the cells grown in the presence of tetracycline) and the non-sensitized cells (i.e. the cells grown in the absence of tetracycline), the candidate compound may be used to inhibit the proliferation of the organism or may be further optimized to identify compounds which have an even greater ability to inhibit the growth, survival, or proliferation of the organism.
Similarly, the virulence or pathogenicity of cells exposed to a candidate compound which express a rate limiting amount of a gene product required for virulence or pathogenicity may be compared to the virulence or pathogenicity of cells exposed to the candidate compound in which the level of expression of the gene product required for virulence or pathogenicity is not rate limiting. In such methods, test animals are challenged with the GRACE strain and fed a diet containing the desired amount of tetracycline and the c~didate compound. Thus, the GRACE strain infecting the test animals expresses a rate limiting amount of a gene product required for virulence or pathogenicity (i.e. the GRACE
cells in the test animals are sensitized). Control animals are challenged with the GRACE
strain and are fed a diet containing the candidate compound but lacking tetracycline. The virulence or pathogenicity of the GRACE strain in the test animals is compared to that in ~e control animals. For example, the virulence or pathogenicity of the GRACE
strain in the test animals may be compared to that in the control animals to determine whether the candidate compound inhibits the virulence or pathogenicity of the sensitized GRACE cells (i.e. the cells in the animals whose diet included tetracyline) to a greater extent'than the candidate compound inhibits the growth of the GRACE cells in animals whose diet lacked tetracycline. For example, if a significant difference in growth is observed between the sensitized GRACE cells (i.e. the cells in animals whose diet included tetracycline) and the non-sensitized cells (i.e. the GRACE cells animals whose diet did not include tetracycline), the candidate:compound may be used to inhibit the virulence or pathogenicity of the organism or may be further optimized to identify compounds which have an even greater ability to inhibit the virulence or pathogenicity of the organism. Virulence or pathogenicity may be measured using the techniques described therein.
It will be appreciated that the above cell-based assays may be used to identify compounds which inhibit the activity of gene products from organisms other than Candida albicans which are homologous to the Candida albicans gene products described herein. For example, the gene products may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species.
In some embodiments, the gene products are from an organism other than Saccharomyces cerevisae.
The cell-based assay described above may also be used to identify the biological pathway in which a nucleic acid required for fungal proliferation, virulence or pathogenicity or the gene product of such a nucleic acid lies. In such methods, cells expressing a rate limiting level of a target nucleic acid required for fungal proliferation, virulence or pathogenicity and control cells in which expression of the target nucleic acid is not rate limiting are contacted with a panel of antibiotics known to act in various pathways.
If the antibiotic acts in the pathway in which the target nucleic acid or its gene product lies, cells in which expression of target nucleic acid is rate limiting will be more sensitive to the antibiotic than cells in which expression of the target nucleic acid is not rate limiting.
As a control, the results of the assay may be confirmed by contacting a panel of cells in which the levels of many different genes required for proliferation, virulence or pa~ogenicity, including the target gene, is rate limiting. If the antibiotic is acting specifically, heightened sensitivity to the antibiotic will be observed only in the cells in which the target gene is rate limiting (or cells in which genes in the same pathway as the target gene is rate limiting) but will not be observed generally in which a gene product required for proliferation, virulence or pathogenicity is rate limiting.
It will be appreciated that the above method for identifying the biological pathway in which a nucleic.acid required for proliferation, virulence or pathogenicity lies may be applied to nucleic acids from organisms other than Candida albicans which are homologous to the Candida albicans nucleic acids described herein. For example, the nucleic acids may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant gal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species. In some embodiments, the nucleic acids are from an organism other than Saccharomyces cerevisae.
Similarly, the above method may be used to determine the pathway on which a test compound, such as a test antibiotic acts. A panel of cells, each of which expresses a rate limiting amount of a gene product required for fungal proliferation, virulence or pathogenicity where the gene product lies in a known pathway, is contacted with a compound for which it is desired to determine the pathway on which it acts.
The sensitivity of the panel of cells to the test compound is determined in cells in which expression of the nucleic acid encoding the gene product required for proliferation, virulence or pathogenicity is at a rate limiting level and in control cells in which expression of the gene product required for proliferation, virulence or pathogenicity is not at a rate limiting level. If the test compound acts on the pathway in which a particular gene product required for proliferation, virulence, or pathogenicity lies, cells in which expression of that particular gene product is at a rate limiting level will be more sensitive to the compound than the cells in which gene products in other pathways are at a rate limiting level. In addition, control cells in which expression of the particular gene required for fungal proliferation, virulence or pathogenicity is not rate limiting will not exhibit heightened sensitivity to the compound. In this way, the pathway on which the test compound acts may be determined.
It will be appreciated that the above method for determining the pathway on which a test compound acts may be applied to organisms other than Candida albicans by using panels of cells in which the activity or level of gene products which are homologous to the Candida albicans gene products described herein is rate limiting. For example, the gene products may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida ~.~ei, Cryptococcus ncoformans, Coccidioides immitis, Exophalia dermatiditis, Fusariumv oxysporum; Histoplasma capsulatum, Pneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Llstilago maydis, or any species falling within the genera of any of the above species. In some embodiments, the gene products are from an organism other than Saccharomyces cerevisiae. Example 6.4, infra, provided below describes one method for performing such assays.
One skilled in the art will appreciate that further optimization of the assay conditions, such as the concentration of inducer or repressor used to produce rate limiting levels of a gene product required for fungal proliferation, virulence or pathogenicity and/or the growth conditions used for the assay (for example incubation temperature and medium components) may further increase the selectivity and/or magnitude of the antibiotic sensitization exhibited.
It will be appreciated that the above methods for identifying the pathway in which a gene required for growth, survival, proliferation, virulence or pathogenicity lies or the pathway on which an antibiotic acts may be performed using organisms other than Candida albicans in which gene products homologous to the Candida albicans gene products described herein are rate limiting. For example, the gene products may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Pneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species. In some embodiments, the gene products are from an organism other than Saccharomyces cerevisae.
Furthermore, as discussed above, panels of GRACE strains may be used to characterize the point of intervention of any compound affecting an essential biological pathway including antibiotics with no known mechanism of action.
Another embodiment of the present invention is a method for determining the pathway against which a test antibiotic compound is active, in which the activity of proteins or nucleic acids involved in pathways required for fungal growth, survival, proliferation; virulence or pathogenicity is reduced by contacting cells with a sub-lethal concentration of a known antibiotic which acts against the protein or nucleic acid. The method is similar to those described above for determining which pathway a test antibiotic acts against, except that rather than reducing the activity or level of a gene product required for fungal proliferation, virulence or pathogenicity by expressing the gene product at a rate limiting amount in a GRACE strain, the activity or level of the gene product is reduced using a sub-lethal level of a known antibiotic which acts against the gene product.
Growth inhibition resulting from the presence of sub-lethal concentration of the known antibiotic may be at least about 5%, at least about 8%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, °r at least about 75%, at least 80%, at least 90%, at least 95% or more than 95%.
Alternatively, the sub-lethal concentration of the known antibiotic may be determined by measuring the activity of the target proliferation-required gene product rather than by measuring growth inhibition.
Cells are contacted with a combination of each member of a panel of known ~tibiotics at a sub-lethal level and varying concentrations of the test antibiotic. As a control, the cells are contacted with varying concentrations of the test antibiotic alone. The ICS° of the test antibiotic in the presence and absence of the known antibiotic is determined.
If the ICS°s in the presence and absence of the known drug are substantially similar, then the test drug and the known drug act on different pathways. If the ICsos are substantially different, then the test drug and the known drug act on the same pathway.
Similar methods may be performed using known antibiotics which act on a gene product homologous to the Candida albicans sequences described herein.
The homolgous gene product may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, F'usarium oxysporum, Histoplasma capsulatum, Pneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species. In some embodiments, the gene products are from an organism other than Saccharomyces cerevisae.
Another embodiment of the present invention is a method for identifying a candidate compound for use as an antibiotic in which the activity of target proteins or nucleic acids involved in pathways required for fungal proliferation, virulence'or pathogenicity is reduced by contacting cells with a sub-lethal concentration of a known ~tibiotic which acts against the target protein or nucleic acid. The method is similar to those described above for identifying candidate compounds for use as antibiotics except that rather than reducing the activity or level of a gene product required for proliferation, virulence or pathogenicity using GRACE strains which express a rate limiting level of the gene product, the activity or level of the gene product is reduced using a sub-lethal level of a known antibiotic which acts against the proliferation required gene product.
The growth inhibition from the sub-lethal concentration of the known antibiotic may be at least about 5%, at least about 8%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or at least about 75%, or more.
Alternatively, the sub-lethal concentration of the known antibiotic may be determined by measuring the activity of the target proliferation-required gene product rather than by measuring growth inhibition.
In order to characterize test compounds of interest, cells are contacted with a peel of known antibiotics at a sub-lethal level and one or more concentrations of the test compound. As a control, the cells are contacted with the same concentrations .of the test compound alone. The ICso of the test compound in the presence and absence of the known antibiotic is determined. If the ICso of the test compound is substantially different in the presence and absence of the known drug then the test compound is a good candidate for use as an antibiotic. As discussed above, once a candidate compound is identified using the above methods its structure may be optimized using standard techniques such as combinatorial chemistry.
Similar methods may be performed using known antibiotics which act on a gene product homologous to the Candida albicans sequences described herein.
The homolgous gene product may be from animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Pneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe gj.isea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species. In some embodiments, the gene products are from an organism other than Saccharomyces cerevisae.
An exemplary target gene product is encoded by CaTBFI. A number of features make this C. albicans gene product a valuable drug target. First, the protein encoded by CaTBFI is compatible with in vitro high throughput screening of compounds that inhibit its activity: Modulated expression of this gene product in whole cell assays could be performed in parallel with in vitro assays to broaden the spectrum of possible inhibitory compounds identified. In addition, demonstration of the predicted physical interaction between CaTbflp and chromosomal telomerases could be used to develop two-hybrid assays for drug screening purposes. Finally, because CaTBFI is a fungal specific gene, its nucleotide sequence could serve in designing PCR-based diagnostic tools for fungal infection.
Other validated drug targets included in the GRACE-derived strain collection that represent preferred drug targets include the products encoded by the following C. albicans genes: CaRH0l, CaERGB, CaAURI, and CaCH0l, as well as those encoded by SEQ ID NOs.:I-62. The ability to manipulate these genes using GRACE methods of the present invention will improve drug screening practices now in use that are designed to identify inhibitors of these critical gene products.
In another embodiment of the present invention, all potential drug targets of a pathogen could be screened simultaneously against a library of compounds using, for example a 96 well microtiter plate format, where growth, measured by optical density or pellet size after centrifugation, may be determined for each well. A genomic approach to drug screening eliminates reliance upon potentially arbitrary and artificial criteria used in evaluating which target to screen and instead allows all potential targets to be screened.
This approach not only offers the possibility of identifying specific compounds which inhibit a preferred process (e. g. cell wall biosynthetic gene products) but also the possibility of identifying all fungicidal compounds within that library and linking them to their cognate cellular targets.
In still another embodiment of the present invention, GRACE strains could be screened to identify synthetic lethal mutations, and thereby uncover a potentially novel class of drug targets of significant therapeutic value. For example two separate genes may encode homologous proteins that participate in a common and essential cellular function, where the essential nature of this function will only become apparent upon inactivation of both family members. Accordingly, examination of the null phenotype of each gene separately would not reveal the essential nature of the combined gene products, and consequently, this potential .drug target would not be identified. Provided the gene products are highly homologous to one another, compounds found to inhibit one family member are likely to inhibit the other and are therefore predicted to approximate the synthetic growth inhibition demonstrated genetically. In other cases however, synthetic lethality may uncover seemingly unrelated (and often nonessential) processes, which when combined produce a . . synergistic growth impairment (cell death). For example, although disruption of the S. cerevisiae gene RVS161 does not present any discernable vegetative growth phenotype in yeast carrying this single mutation, at least 9 other genes are known to display a synthetic lethal effect when combined with inactivation of RYSl6l. These genes participate in processes ranging from cytoskeletal assembly and endocytosis, to signal transduction and lipid metabolism and identifies multiple avenues to pursuing a combination drug target strategy. A directed approach to uncovering synthetic lethal interactions with essential and nonessential drug targets is now performed where a GRACE strain or heterozygote strain is identified as displaying an enhanced sensitivity to the tested compound, not because it expresses a reduced level of activity for the drug target, but because its mutation is synthetically lethal in combination with inhibition of a second drug target.
Discerning whether the compound specifically inhibits the drug target in the sensitized GRACE strain or heterozygote strain or a second target may be achieved by screening the entire GRACE or heterozygote strain sets for additional mutant strains displaying equal or greater sensitivity to the compound, followed by genetic characterization of a double mutant strain demonstrating synthetic lethality between the two mutations.
5.5.2.2 Screening for Non-antifungal Therapeutic Agents With GRACE
Strains The biochemical similarity existing between pathogenic fungi and the mammalian hosts they infect limits the range of clinically useful antimycotic compounds.
However, this similarity can be exploited using a GRACE strain collection to facilitate the discovery of therapeutics that are not used as antimycotics, but are useful for treatment a ode-range of diseases, such as cancer, inflammation, etc.
In this embodiment of the invention, fungal genes that are homologous to disease-causing genes in an animal or plant, are selected and GRACE strains of this set of genes are used for identification of compounds that display potent and specific bioactivity towards the products of these genes, and therefore have potential medicinal value for the treatment of diseases. Essential and non-essential genes and 'the corresponding GRACE
strains carrying modified allelic pairs of such genes are useful in this embodiment of the invention. It has been predicted that as many as 40% of the genes found within the C.
albicans genome share human functional homologs. It has also been predicted that as many as 1% of human genes are involved inhuman diseases and therefore may serve as potential drng targets. Accordingly, many genes within the GRACE strain collection are homologs to .. ~ disease-causing human.genes.and compounds that specifically inactivate individual members of this gene set may in fact have alternative therapeutic value. The invention provides a pluralities of GRACE strains in which the modified alleles are fungal genes that share sequence, structural and/or functional similarities to genes that are associated with one or more diseases of the animal or plant.
For example, much of the signal transduction machinery that promotes cell cycle progression and is often perturbed in a variety of cancers is conserved in fungi. Many of these genes encode for cyclins, cyclin-dependent kinases (CDK), CDK
inhibitors, phosphatases, and transcription factors that are both structurally and functionally related.
As a result, compounds found to display specificity towards any of these functional classes of proteins could be evaluated by secondary screens to test for potential anticancer activity.
However, cytotoxic compounds identified in this way need not act on cancer causing targets to display therapeutic potential. For example the taxol family of anti-cancer compounds, which hold promise as therapeutics for breast and ovarian cancers, bind tubulin and promote microtubule assembly, thereby disrupting normal microtubule dynamics.
Yeast tubulin displays similar sensitivity to taxol, suggesting that additional compounds affecting other fundamental cellular processes shared between yeast and man could similarly be identified and assessed for antitumor activity.
The phenomenon of pathogenesis extends far beyond the taxonomic borders of microbes and ultimately reflects the underlying physiology. In many ways, the phenomenon of cancer is analogous to the process of pathogenesis by an opportunistic pathogen such as C. albicans. Both are non-infectious diseases caused by either the body's own cells, or microbes from its natural fauna. These cells grow in a manner unchecked by the immune system and in both cases disease manifests itself by colonization of vital organs and eventual tissue damage resulting in death. Effective drug-based treatment is also elusive for both diseases primarily because the causative agent in both cases is highly related to the host.
In fact, a number of successful therapeutic drugs affecting processes unrelated to cancer have also been discovered through anti-fungal drug screening programs.
One clinically-important class of compounds includes the immunosuppressant molecules rapamycin, cyclosporin A, and FK506, which inhibit conserved signal transduction components. Cyclosporin A and FK506, form distinct drug-prolyl isomerase complexes (CyPA- Cyclosporin A and FKBP12-FK506 respectively) which bind and inactivate the regulatory subunit of the calcium and calmodulin-dependent phosphatase, .calcineurin.;
Rapamycin also complexes with FKBP12, but this drug-protein complex also binds to the TOR family of .phosphatidylinositol kinases to inhibit translation and cell cycle progression.
In each case. both the mechanism of drug action, and the drug targets themselves are highly conserved from yeast to humans.
The identification of C. albicans drug targets, and grouping the targets into essential-gene, fungal-specific, and pathogen-specific target sets provide the basis for the development~of whole=cell screens for compounds that interact with and inhibit individual members of any of these targets. Therefore, similar analyses can be used to identify other sets of GRACE strains having modified allelic pairs of genes encoding drug targets with other specific common functions or attributes. For example, GRACE strain subsets can be established which comprise gene targets that are highly homologous to human 'genes, or gene targets that display a common biochemical function, enzymatic activity, or that are involved in carbon compound catabolism, bosynthesis, transport of molecules (transporter activity), )cellular localization, signal transduction cascades, cell cycle control, cell adhesion, transcription, translation, DNA replication, etc.

5.5.2.3 Target Gene Dosage-Based Whole Cell Assays Experiments involving modulating the expression levels of the encoding gene to reveal phenotypes from which gene function may be inferred can be carried out in a pathogenic diploid fungus, such as Candida albicans, using the strains and methods of the present intention. The principle of drug-target-level variation in drug screening involves modulating the expression level of a drug target to identify specific drug resistance or drug sensitivity phenotypes, thereby linking a drug target to a particular compound. Often, these phenotypes are indicative of the target gene encoding the bona fide drug target of this compound. In examples where this is not the case, the candidate target gene may nonetheless provide important insight into the true target gene that is functioning either in a pathway or process related to that inhibited. by the compound (e.g. producing synthetic phenotype), or instead functioning as a drug resistance mechanism associated with the identified compound.
Variation of the expression levels of the target protein is also incorporated Within both drug screening and drug target identification procedures. The total, cellular expression level of a gene product in a diploid organism is modified by disrupting one allele of the gene encoding that product, thereby reducing its functional activity in half; creating a "haploinsufficient" phenotype. A heterozygous S. cerevisiae strain collection has been used in such a haploinsufficiency screen to link drug-based resistance and hypersensitive phenotypes to heterozygous drug targets. Nonessential genes are screened directly using a haploid deletion strain collection against a compound library for specific phenotypes or "chemotypes." However, this procedure cannot be used in a haploid organism where the target gene is an essential one.
The expression level of a given gene product is also elevated by cloning the gene into a plasmid vector that is maintained at multiple copies in the cell.
Overexpression of the encoding gene is also achieved by fusing the corresponding open reading frame of the gene product to a more powerful promoter carried on a multicopy plasmid. Using these strategies, a number of overexpression screens have been successfully employed in S.
~erevisiae to discover novel compounds that interact with characterized drug targets as well as to identify the protein targets bound by existing therapeutic compounds.
The GRACE strain collection replaces the surrogate use of S. cerevisiae in whole cell drug screening by providing a dramatic range in gene expression levels for drug targets directly within the pathogen (Fig. 5). In one embodiment of the invention, this is achieved using the C. albicans-adapted tetracycline promoter system to construct GRACE
strains. Northern Blot analysis of 30 different GRACE strains grown under nonrepressing conditions (i.e. no tetracycline) reveals that 83% of conditionally expressed genes tested maintain an overexpression level greater than or equal to 3 fold of wild type, and 60% of all genes examined express greater than or equal to 5 times that of the wild type C. albicans strain used for GRACE strain construction. As each GRACE strain is in fact heterozygous, this expression range is presumably doubled if compared against their respective heterozygote strain. For most GRACE strains then, this represents an elevated expression level rivaling that typically achieved in S. cerevisiae using standard 2,u-based multicopy plasmids, and an absolute level of constitutive expression comparable to that provided by the CaACTl promoter. Therefore, the GRACE strain collections of the invention are not only useful in target validation under repressing conditions, but are also useful as a collection of strains overexpressing these same validated drug targets under wonrepressing conditions for whole cell assay development and drug screening.
Variation in the level of expression of a target gene product in a GRACE
strain is also used to explore resistance to antimycotic compounds. Resistance to existing ~tifungal therapeutic agents reflects both the limited number of antifungal drugs available and the alarming dependence and reliance clinicians have in prescribing them.
For example, dependence on azole-based compounds such as fluconazole for the treatment of fungal infections, has dramatically undermined the clinical therapeutic value for this compound.
The GRACE strain collection is used to combat fluconazole resistance by identifying gene products that interact with the cellular target of fluconazole. Such products are used to identify drug targets which, when inactivated in concert with ~fluconazole, provide a synergistic effect and thereby overcome resistance to fluconazole seen when this compound is used alone. This is accomplished, for example, by using the GRACE strain collection to overexpress genes that enhance drug resistance. Such genes include novel.or known plasma membrane exporters including ATP-binding cassette (ABC) transporters and multidrug resistance (MDR) efflux pumps, pleiotropic drug resistance (PDR) transcription factors, and protein kinases and phosphatases. Alternatively, genes specifically displaying a differential drug sensitivity are identified by screening GRACE strains expressing reduced levels (either by haploinsufficiency or threshold expression via the tetracycline promoter) individual members of the target set. Identifying such genes provides important clues to drug resistance mechanisms that could be targeted for drug-based inactivation to enhance the efficacy of existing antifungal therapeutics.
In another aspect of the present invention, overexpression of the target gene for whole cell assay purposes is supported with promoters other than the tetracycline promoter system. (see Section 5.3.1 ) For example, the CaPGKI promoter is used to overexpress C. albicans drug targets genes. In S. cerevisiae, the PGK1 promoter is known to provide strong constitutive expression in the presence of glucose. See, Guthrie, C., and G.
R. Fink. 1991. Guide to yeast genetics and molecular biology. Methods Enzymol.
194:373-398. A preliminary analysis of five C. albicans genes placed under the control of the CaPGKI promoter (CaKRE9, CaERGIl, CaALG7, CaTUBI and CaAURI) revealed dramatic overexpression versus wild type as judged by Northern blot analysis.
The level of overexpression achieved for all genes exceeds that obtained by the tetracycline promoter by 3-4 fold. Moreover, CaAURl, which was not overexpressed significantly when constitutively expressed using the tetracycline promoter, was overexpressed 5-fold relative to wild type CaAURl expression levels, suggesting that the CaPGKl promoter is useful in overexpressing genes normally not overexpressed by the tetracycline promoter.
In another aspect of the present invention, intermediate expression levels of individual drug targets within the GRACE strain collection may are engineered to provide strains tailored for the development of unique whole cell assays. In this embodiment of the invention, GRACE strains are grown in a medium containing a tetracycline concentration determined to provide only a partial repression of transcription. Under these conditions, it is possible to maintain an expression level between that of the constitutively expressed overproducing strain and that of wild type strain, as well as levels of expression lower than.
that of the wild-type strain. That is, it is possible to titrate the level of expression to the minimum required for cell viability. By repressing gene expression to this critical state, novel phenotypes, resembling those produced by a partial loss of function mutation (r. e.
phenocopies of hypomorphic mutants) may be produced and offer additional target expression levels applicable for whole cell assay development and drug screening.
Repressing expression of the remaining allele of an essential gene to the threshold level required for viability, therefore will provide a strain with enhanced sensitivity toward compounds active against this essential gene product.
In order to demonstrate the utility of target level expression in whole cell assays for. drug screening, both a CaHIS3 heterozygote strain and a tetracycline promoter-regulated CaHIS3 GRACE strain were compared against a wild type (diploid) CaHIS3 s~.ain for sensitivity towards the 3-aminotriazole (3-AT) (Example 6.3). The data derived from these experiments clearly indicate that distinct levels of target gene products synthesized within the pathogen could be directly applied in whole cell assay based drug screens to identify novel antifungal compounds active against novel drug targets validated using the GRACE method.

5.5.2.4 Uses of Tagged strains In still another aspect of the present invention, unique oligonucleotide sequence tags or "bar codes" are incorporated into individual mutant strains included within a heterozygous strain collection of validated targets. The presence of these sequence tags enables an alternative whole cell assay approach to drug screening. Multiple target strains may be screened simultaneously in a mixed population (rather than separately) to identify phenotypes between a particular drug target and its inhibitory agent.
Large-scale parallel analyses are performed using mixed populations of the entire bar coded heterozygous essential strain collection target set and comparing the relative representation of individual strains within a mixed population prior to and after growth in the presence of a compound. Drug-dependent depletion or overrepresentation of a unique bar-coded strain is determined by PCR-amplifying and fluorescently labeling all bar codes within the mixed population and hybridizing the resulting PCR products to an array of complementary oligonucleotides. Differential representation between bar coded strains indicates gene-specific hypersensitivity or resistance and suggests the corresponding gene product may represent the molecular target of the compound tested.
In one specific embodiment, the mutant strains are GRACE strains, and each of the GRACE strains of the set comprises a unique molecular tag, which, generally, is incorporated within the cassette used to replace the first allele of the gene pair to be modified. Each molecular tag is flanked by primer sequences which are common to all members of the set being tested. Growth is carried out in repressive and non-repressive media, in the presence and absence of the compound to be tested. The relative growth of each strain is assessed by carrying out simultaneous PCR amplification of the entire collection of embedded sequence tags.
In one non-limiting aspect of the present invention, the PCR amplification is performed in an asymmetric manner with fluorescent primers and the resulting single stranded nucleic acid product hybridized to an oligonucleotide array fixed to a surface and comprises the entire corresponding set of complementary sequences. Analysis of the level of each fluorescent molecular tag sequence is then determined to estimate the relative amount of growth of GRACE strain of the set, in those media, in the presence and absence of the compound tested.
Therefore, for each GRACE strain of the set tested, there could be, in one non-limiting example of this method, four values for the level of the corresponding molecular tag found within the surviving population. They would correspond to cell growth under repressing and non-repressing conditions, both in the presence and absence of the compound being tested. Comparison of growth in the presence and absence of the test compound provides a value or "indicator" for each set of growth media; that is, an indicator derived under repressing and non-repressing conditions. Again, comparison of the two indicator values will reveal if the test compound is active against the gene product expressed by the modified allelic gene pair carried by that specific member of the GRACE
set tested.
In still another aspect of the present invention, each potential drug target gene in this heterozygous tagged or bar-coded collection, may be overexpressed by subsequently introducing either the Tet promoter or another strong, constitutively expressed promoter (e. g. CaACTI , CaADHI and CaPGKI ) upstream of the remaining non-disrupted allele. These constructions allow a further increase in the dosage of the encoded target gene product of individual essential genes to be used in mixed-population drug susceptibility studies. Although overexpression may itself disrupt the normal growth rate of numerous members of the population, reliable comparisons could still be made between mock and drug-treated mixed cultures to identify compound-specific growth differences.
In S. cerevisiae, the molecular drug targets of several well-characterized compounds including 3-amino-triazol, benomyl, tunicamycin and fluconazole were identified by a similar approach. In that study, bar-coded strains bearing heterozygous mutations in HIS3, TUB1, ALG7, and ERG11, (i.e. the respective drug targets to the compounds listed above) displayed significantly greater sensitivity when challenged with their respective compound than other heterozygote bar-coded strains when grown together in a mixed population.
In another aspect of the present invention, screens for antifungal compounds can be carried out using complex mixtures of compounds that comprise at least one compound active against the target strain. Tagging'or bar-coding the GRACE
strain collection facilitates a number of large scale analyses necessary to identify gene sets as well as evaluate and ultimately evaluate individual targets within particular gene sets. For example, mixed-population drug screening using a bar-coded GRACE strain collection effectively functions as a comprehensive whole cell assay. Minimal amounts of a complex compound library are sufficient to identify compounds that act on individual essential target genes within the collection. This is done without the need to array the collection. Also, strong predictions as to the 'richness' of any particular compound library could be made before committing to it in drug screening. It becomes possible then to assess whether, for example, a carbohydrate-based chemical library possesses greater fungicidal activity than a natural product or synthetic compound library. Particularly potent compounds within any complex library of molecules can be immediately identified and evaluated according to the priority of targets and assays available for drug screening. Alternatively, the invention provides applying this information to developing "tailored" screens, in which only those targets which were demonstrated to be inactivated in mixed population experiments by a particular compound library would be included in subsequent array-formatted screens.
Traditionally, drug discovery programs have relied on an individual or a limited set of validated drug targets. The preceding examples emphasize that such an approach, is no longer necessary and that high throughput target evaluation and drug screening are now possible. However, a directed approach based on selecting individual targets may still be preferred depending on the expertise, interest, strategy, or budget of a drug discovery program.
5.5.3 Target Evaluation in an Animal Model System.
Currently, validation of an essential drug target is demonstrated by examining the effect of gene inactivation under standard laboratory conditions. Putative drug target genes deemed nonessential under standard laboratory conditions may be examined within an animal model, for example, by testing the pathogenicity of a strain homozygous for a deletion in the target gene versus wild type. However, essential drug targets are precluded from animal model studies. Therefore, the most desirable drug targets are omitted from.the most.pertinent conditions to their target evaluation.
In an embodiment of the invention, conditional expression, provided by the :GRACE essential.strain collection, overcomes .this longstanding limitation to target validation within a host environment. Animal studies can be performed using mice inoculated with GRACE essential strains and examining the effect of gene inactivation by conditional expression. In a preferred embodiment of the invention, the effect on mice injected with a lethal inoculum of a GRACE essential strain could be determined depending on whether the mice were provided with an appropriate concentration of tetracycline to inactivate expression of a drug target gene. The lack of expression of a gene demonstrated to be essential under laboratory conditions can thus be correlated with prevention of a terminal C albicans infection. In this type of experiment, only mice "treated"
with tetracycline-supplemented water, are predicted to survive infection because inactivation of the target gene has killed the GRACE strain pathogen within the host.
In yet another embodiment of the invention, conditional expression could be achieved using a temperature-responsive promoter to regulate expression of the target gene or a temperature sensitive allele of a particular drug target, such that the gene is functional at 3 S 30 ° C but inactivated within the normal body temperature of the mouse.

In the same manner as described above for essential genes, it is equally feasible to demonstrate whether nonessential genes comprising the GRACE strain collection are required for pathogenicity in a mouse model system. Included in this set are multiple genes whose null phenotype results in a reduced growth rate and may attenuate the virulence of the pathogen. Many mutants demonstrating a slow growth phenotype may represent hypomorphic mutations in otherwise essential genes (as demonstrated by alternative methods) which are simply not completely inactivated by the conditional expression method used to construct the GRACE strain. One important use of such strains is to assess whether any given essential gene doubly functions in the process of virulence.
Essential genes that display substantially reduced virulence and growth rate when only partially inactivated represent "multifactorial" drug targets for which even minimally inhibitory high specificity compounds would display therapeutic value. Collectively, all GRACE strains that fail to cause fungal infection in mice under conditions of gene inactivation by tetracycline (or alternative gene inactivation means) define a subset of genes that are required for pathogenicity, i.e., GRACE pathogenicity subset. More defined subsets of pathogenicity genes, for example those genes required for particular steps in pathogenesis (e.g. adherence or invasion) may be determined by applying the GRACE pathogenicity subset of strains to in vitro assays which measure the corresponding process. For example, examining GRACE
pathogenicity strains in a buccal adhesion or macrophage assay by conditional expression of individual genes would identify those pathogenicity factors required for adherence ~or cell invasion respectively.
The GRACE strain collection or a desired subset thereof is also well suited for evaluating acquired resistance/suppression or distinguishing between fungicidal/fungistatic phenotypes for an inactivated drug target within an animal model system. In this embodiment of the invention, GRACE strains repressed for expression of different essential drug target genes would be inoculated into mice raised on tetracycline-supplemented water. Each of the GRACE strains would then be compared according to the frequency of death associated with the different mice populations they infected. It is expected that the majority of infected mice will remain healthy due to fungal cell death caused by tetracycline-dependent inactivation of the essential gene in the GRACE
strain. However, a GRACE strain harboring a drug target more likely to develop extragenic suppressors because it is a fungistatic target rather than fungicidal one, or suppressed by an alternative physiological process active within a host environment, can be identified by the higher incidence of lethal infections detected in mice infected with this particular strain. By this method', it is possible to evaluate/rank the likelihood that individual drug target genes may develop resistance within the host environment.
5.5.4 Rational Design of Binding Compounds Compounds identified via assays such as those described herein can be useful, for example, for inhibiting the growth of the infectious agent and/or ameliorating the symptoms of an infection. Compounds can include, but are not limited to, other cellular proteins. Binding compounds can also include, but are not limited to, peptides such as, for example, soluble peptides, comprising, for example, extracellular portions of target gene product transmembrane receptors, and members of random peptide libraries (see, e.g., Lam et al., 1991, Nature 354:82-84; Houghten et al., 1991, Nature 354:84-86) made of D-and/or L-configuration amino acids, rationally-designed antipeptide peptides, (see e.g., Hurby et al., Application of Synthetic Peptides: Antisense Peptides," In Synthetic Peptides, A User's Guide, W.H. Freeman, NY (1992), pp. 289-307), antibodies (including, but not limited to polyclonal, monoclonal, human, humanized, anti-idiotypic, chimeric or single chain ~tibodies,.and FAb, F(ab')2 and FAb expression library fragments, and epitope-binding fragments thereof), and small organic or inorganic molecules. In the case of receptor-type target molecules, such compounds can include organic molecules (e.g., peptidomimetics) that bind to the ECD and either mimic the activity triggered by the natural ligand (i.e., agonists); as well as peptides, antibodies or fragments thereof, and other organic compounds fat mimic the ECD (or a portion thereof) and bind to a "neutralize" natural ligarid.' Computer modeling and searching technologies permit identification of compounds, or the improvement of already identified compounds, that can modulate target gene expression or activity. Having identified such a compound or composition, the active sites or regions are preferably identified. In the case of compounds affecting receptor molecules, such active sites might typically be ligand binding sites, such as the interaction domains of ligand with receptor itself. The active site is identified using methods known in the art including, for example, from the amino acid sequences of peptides, from the nucleotide sequences of nucleic acids, or from study of complexes of the relevant compound or composition with its natural ligand. In the latter case, chemical or X-ray crystallographic methods are used to find the active site by finding where on the factor the complexed ligand is found.
The three-dimensional geometric structure of the active site is then preferably determined. This is done by known methods, including X-ray crystallography, which determines a complete molecular structure. Solid or liquid phase NMR is also used to determine certain infra-molecular distances within the active site and/or in the ligand binding complex. Other experimental methods of structure determination known to those of skill in the art, are also used to obtain partial or complete geometric structures. The geometric structures are measured with a complexed ligand, natural or artificial, which increases the accuracy of the active site structure determined. Methods of computer based numerical modeling are used to complete the structure (e.g., in embodiments wherein an incomplete or insufficiently accurate structure is determined) or to improve its accuracy.
Finally, having determined the structure of the active site, either experimentally, by modeling, or by a combination, candidate modulating compounds are identified by searching databases containing compounds along with information on their molecular structure. Such a search seeks compounds having structures that match the determined active site structure and that interact with the groups defining the active site.
Such a search can be manual, but is preferably computer assisted. These compounds found from this search are potential target or pathway gene product modulating compounds.
Alternatively, these methods are used to identify improved modulating compounds from an already known modulating compound or ligand. The composition of the known compound is modified and the structural effects of modification are determined using the experimental and computer modeling methods described above applied to the new composition. The altered structure is then compared to the active site structure of the compound to determine if an improved fit or interaction results. In this manner systematic variations in composition, such as by varying side groups, are quickly evaluated to obtain modified modulating compounds or ligands of improved specificity or activity.
Further experimental and computer modeling methods useful to identify modulating compounds based upon identification of the active sites of target or pathway gene or gene products and related transduction and transcription factors are apparent to those of skill in the art.
There are a number of articles that review the art of computer modeling of drugs that interact with specific proteins, including the following: Rotivinen et al., 1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, (June 16, 1988), New Scientist 54-57;
McKinaly and Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry and Davies, OSAR: Quantitative Structure Activity Relationships in Drug Design pp.

(Alan R. Liss, Inc. 1989); Lewis and Dean, 1989 Proc. R. Soc. Lond. 236:125-140 and 1-162; and, with respect to a model receptor for nucleic acid components, Askew et al., 1989, J. Am. Chem. Soc. 111:1082-1090.
Although generally described above with reference to design and generation of compounds which could alter binding, one could also screen libraries of known compounds, including natural products or synthetic chemicals, as well as other biologically active materials, including proteins, for compounds which are inhibitors or activators.
5.6 Transcriptional Profiling S
5.6.1 Analysis of Gene Expression Gene expression profiling techniques are important tools for the identification of suitable biochemical targets, as well as for the determination of the mode of action of known compounds. Completion of the C. albicans genome sequence and development of nucleic acid microarrays incorporating this information, will enable genome-wide gene expression analyses to be carried out .with this diploid pathogenic fungus. Therefore, the present invention provides methods for obtaining the transcriptional response profiles for both essential and virulence/pathogenicity genes of Candida albicans.
Conditional expression of essential genes serves to delineate, for example, regulatory interactions valuable for the design of drug screening programs focused upon C. albicans.
In an embodiment of the present invention, the GRACE strain collection is used for the analysis of expression of essential genes within this pathogen.
One particularly.
powerful application of such a strain collection involves the construction of a comprehensive transcriptional profile database for the entire essential gene set or a desired subset of essential genes within a pathogen. Such a database is used to compare the response profile characteristic of lead antimycotic compounds with the profile obtained with new anti-fungal compounds to distinguish those with similar from those with distinct modes of action. Matching (or even partially overlapping) the transcriptional response profiles determined after treatment of the strain with the lead compound with that obtained with a p~icular essential target gene under repressing conditions, is used to identity the target and possible mode of action of the drug.
Gene expression analysis of essential genes also permits the biological function and regulation of those genes to be examined within the pathogen, and this information is incorporated within a drug screening program. For example, transcriptional profiling of essential drug targets in C. albicans permits the identification of novel drug targets which participate in the same cellular process or pathway uncovered for the existing drug target and which could not otherwise be identified without direct experimentation within the pathogen. These include genes not only unique to the pathogen but also broad-range gene classes possessing a distinct function or subject to different regulation in the pathogen. Furthermore, pathogen-specific pathways may be uncovered and exploited for the first time.
In another aspect of the present invention, the gene expression profile of GRACE-derived strains under nonrepressing or induced conditions is established to evaluate the overexpression response profile for one or more drug targets. For example, overexpression of genes functioning in signal transduction pathways often display unregulated activation of the pathway under such conditions. Moreover, several signaling pathways have been demonstrated to function in the pathogenesis process.
Transcriptional response profiles generated by overexpressing C. albicans GRACE strains provide information concerning the set of genes regulated by such pathways; any of which may .
potentially serve an essential role in pathogenesis and therefore representing promising drug targets. Furthermore, analysis of the expression profile may reveal one or more genes whose expression is critical to the subsequent expression of an entire regulatory cascade.
Accordingly, these genes are particularly important targets for drug discovery and mutants carrying the corresponding modified allelic pair of genes form the basis of a mechanism-of action based screening assays. Presently such an approach is not possible.
Current drug discovery practices result in an exceedingly large number of "candidate"
compounds and little understanding of their mode of action. A transcriptional response database comprising both gene shut-off and overexpression profiles generated using the GRACE strain collection offers a solution to this drug discovery bottleneck by 1) determining the transcriptional response or profile resulting from an antifungal's inhibition of a wild type strain, and 2) comparing this response to the transcriptional profiles resulting from inactivation or overexpression of drug targets comprising the GRACE strain collection.
Matching or significantly correlating transcriptional profiles resulting from both genetic alteration of a drug target and chemical/compound inhibition of wild type cells provides evidence linking the compound to its cellular drug target and suggests its mechanism of action.
Accordingly, the invention provides a method for evaluating a compound ag~nst a target gene product encoded by a nucleotide sequence comprising one of SEQ ID
NO: 1 to 61, said method comprising the steps of (a) contacting wild type diploid fungal cells or control cells with the compound and generating a first transcription profile; (b) determining the transcription profile of mutant diploid fungal cells, such as a GRACE
strain, which have been cultured under conditions wherein the second allele of the target gene is substantially underexpressed, not expressed or overexpressed and generating a second transcription profile for the cultured cells; and comparing the first transcription profile with the second transcription profile to identify similarities in the profiles. For comparisons, similarities of profiles can be expressed as an indicator value;
and the higher the indicator value, the more desirable is the compound.
5.6.2 Identification of Secondary Targets Methods are described herein for the identification of secondary targets.
"Secondary target," as used herein, refers to a gene whose gene product exhibits the ability to interact with target gene products involved in the growth and/or survival of an organism (i.e., target essential gene ,products), under a set of defined conditions, or in the pathogenic mechanism of the organism, (i.e., target virulence gene products) during infection of a host.
Any method suitable for detecting protein-protein interactions can be employed for identifying secondary target gene products by identifying interactions between gene products and target gene products. Such known gene products can be cellular or extracellular proteins. Those gene products which interact with such known gene products represent secondary target gene products and the genes which encode them represent secondary targets.
Among the traditional methods employed are co-immunoprecipitation, crosslinking and co-purification through gradients or chromatographic columns:
Utilizing procedures.such as these allows for the identification of secondary target gene products.
Once identified, a secondary .target gene product is used, in conjunction with standard techniques, to identify its corresponding secondary target. For example, at least a portion of the amino acid sequence of the secondary target gene product is ascertained using techniques well known to those of skill in the art, such as via the Edman degradation technique (see, e.g., Creighton, 1983, "Proteins: Structures and Molecular Principles,"
W,H. Freeman & Co., N.Y., pp.34-49). The amino acid sequence obtained can be used as a guide for the generation of oligonucleotide mixtures that can be used to screen for secondary target gene sequences. Screening can be accomplished, for example, by standard hybridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and for screening are well-known. (See, e.g., Ausubel, supra., and PCR Protocols:
A Guide to Methods and Applications, 1.990, Innis, M. et al., eds. Academic Press, Inc., New York).
Additionally, methods are employed which result in the simultaneous identification of secondary targets which encode proteins interacting with a protein involved in the growth and/or survival of an organism under a set of defined conditions, or in the pa~ogenic mechanism of the organism during infection of a host. These methods include, for example, probing expression libraries with labeled primary target gene protein known or suggested to be involved in or critical to these mechanisms, using this protein in a manner similar to the well known technique of antibody probing of ~.gtl 1 phage libraries.
One method which detects protein interactions in vivo, the two-hybrid system, is described in detail for illustration purposes only and not by way of limitation.
One version of this system has been described (Chien et al., 1991, Proc. Natl.
Acad. Sci.
USA, 88:9578-9582) and is commercially available from Clontech (Palo Alto, CA).
Briefly, utilizing such a system, plasmids are constructed that encode two hybrid proteins: one consists of the DNA-binding domain of a transcription activator protein fused to a known protein, in this case, a protein known to be involved in growth of the organism, or in pathogenicity, and the other consists of the activator protein's activation domain fused to an unknown protein that is encoded by a cDNA which has been recombined into this plasmid as part of a cDNA library. The plasmids are transformed into a strain of the yeast S. cerevisiae that contains a reporter gene (e.g., lacZ) whose regulatory region contains the transcription activator's binding sites. Either hybrid protein alone cannot activate transcription of the reporter gene, the DNA-binding domain hybrid cannot because it does not provide activation function, and the activation domain hybrid cannot because it cannot localize to the activator's binding sites. Interaction of the two hybrid proteins reconstitutes the functional activator protein and results in expression of the reporter gene, . which is detected by an assay for the reporter gene product.
The two-hybrid system or related methodology is used to screen activation domain libraries for proteins that interact with a known "bait" gene product.
By way of example, and not by way of limitation, target essential gene products and target virulence gene products are used as the bait gene products. Total genomic or cDNA
sequences encoding the target essential gene product, target virulence gene product, or portions thereof, are fused to the DNA encoding an activation domain. This library and a plasmid encoding a hybrid of the bait gene product fused to the DNA-binding domain are cotransformed into a yeast reporter strain, and the resulting transformants are screened for those that express the reporter gene. For example, and not by way of limitation, the bait gene is cloned into a vector such that it is translationally fused to the DNA
encoding the DNA-binding domain of the GAL4 protein. These colonies are purified and the library plasmids responsible for reporter gene expression are isolated. DNA sequencing-is then used to identify the pioteins encoded by the library plasmids.
A cDNA library of the cell.line from which proteins that interact with bait gene product are to be detected is made using methods routinely practiced in the art.

According to the particular system described herein, for example, the cDNA
fragments are inserted into a vector such that they are translationally fused to the activation domain of GAL4. This library is co-transformed along with the bait gene-GAL4 fusion plasmid into a yeast strain which contains a lacZ gene driven by a promoter which contains activation sequence. A cDNA encoded protein, fused to GAL4 activation domain, that interacts with bait gene product reconstitutes an active GAL4 protein and thereby drive expression of the lacZ gene. Colonies which express lacZ are detected by their blue color in the presence of X-gal. The cDNA can then be purified from these strains, and used to produce and isolate the bait gene-interacting protein using techniques routinely practiced in I 0 the art.
Once a secondary target has been identified and isolated, it is further characterized and used in drug discovery by the methods of the invention.
5.6.3 Use of Gene Expression Arrays To carry out profiling, gene expression arrays and microarrays can be employed. Gene expression arrays are high density arrays of DNA samples deposited at specific locations on a glass surface, silicon, nylon membrane, or the like.
Such arrays are used by researchers to quantify relative gene expression under different conditions. An example of this technology is found in U.S. Patent No. 5807522, which is hereby incorporated by reference.
It is possible to' study the expression of substantially all of the genes in the genome of a particular microbial organism using a single array. For example, the arrays may consist of 12 x 24 cm nylon filters containing PCR products corresponding to ORFs from Candida albicans. 10 ngs of each PCR product are spotted every 1.5 mm on the filter.
Single stranded labeled cDNAs are prepared for hybridization to the array (no second strand synthesis or amplification step is done) and placed in contact with the filter. Thus the labeled cDNAs are of "antisense" orientation. Quantitative analysis is done using a phosphorimager.
Hybridization of cDNA made from a sample of total cell mRNA to such an ~.ay followed by detection of binding by one or more of various techniques known to those in the art provides a signal at each location on the array to which cDNA
hybridized. The intensity of the hybridization signal obtained at each location in the array thus reflects the amount of mRNA for that specific gene that was present in the sample.
Comparing the results obtained for mRNA isolated from cells grown under different conditions thus allows for a comparison of the relative amount of expression of each individual gene during growth under the different conditions.
Gene expression arrays are used to analyze the total mRNA expression pattern at various time points after reduction in the level or activity of a gene product required for fungal proliferation, virulence or pathogenicity. Reduction of the level or activity of the gene product is accomplished by growing a GRACE strain under conditions in which the product of the nucleic acid linked to the regulatable promoter is rate limiting for fungal growth, survival, proliferation, virulence or pathogenicity or by contacting the cells with an agent which reduces the level or activity of the target gene product. Analysis of the expression pattern indicated by hybridization to the array provides information on other genes whose expression is influenced by reduction in the level or activity of the gene product. For example, levels of other mRNAs may be observed to increase, decrease or stay the same following reduction in the level or activity of the gene product required for growth, survival, proliferation, virulence or pathogenicity. Thus, the mRNA expression pattern observed following reduction in the level or activity of a gene product required for growth, 1 S survival, proliferation, virulence or pathogenicity identifies other nucleic acids required for growth, survival, proliferation, virulence or pathogenicity. In addition, the mRNA
expression patterns observed when the fungi are exposed to candidate drug compounds or known antibiotics are compared to those observed when the level or activity of a gene product required for fungal growth; survival, proliferation, virulence or pathogenicity is reduced. If the mRIVA expression pattern observed with the candidate drug compound is sirriilar to that observed when the level of the gene product is reduced, the drug compound is a promising therapeutic candidate. Thus, the assay is useful in assisting in the selection of promising candidate drug compounds for use in drug development.
In cases where the source of nucleic acid deposited on the array and the source of the nucleic acid being hybridized to the array are from two different microorganisms, gene expression identify homologous genes in the two microorganisms.
5.7 Proteomics Assays In another embodiment of the present invention, and in much the same way that the GRACE strain collection enables transcriptional profiling within a pathogen, a GRACE strain collection provides an invaluable resource for the analysis of the expressed protein complement of a genome. By evaluating the overall protein expression by members of a GRACE strain collection under repressing and non-repressing growth conditions,. a correlation between the pattern of protein expression of a cell can be made with the non-expression or the level of expression of an essential gene. Accordingly, the invention provides a pattern of expression of a set of proteins in a GRACE strain as determined by methods well known in the art for establishing a protein expression pattern, such as two-dimensional gel electrophoresis. A pluralities of protein expression patterns will be generated for a GRACE strain when the strain is cultured under different conditions and different levels of expression of one of the modified allele.
In yet another embodiment, defined genetic mutations can be constructed to create strains exhibiting protein expression profiles comparable to those observed upon treatment of the strain with a previously uncharacterized compound. In this way, it is possible to distinguish between antimycotic compounds that act on multiple targets in a complicated manner from other potential lead compounds that act on unique fungal-specific targets and whose mode of action can be determined.
Evaluation of the full complement of proteins expressed within a cell depends upon definitive identification of all protein species detectable on two-dimensional polyacrylamide gels or by other separation techniques. However, a significant fraction of these proteins are of lower abundance and fall below the threshold level required for positive identification by peptide sequencing or mass spectrometry.
Nevertheless, these "orphan" proteins are detectable using an analysis of protein expression by individual GRACE strains. Conditional expression of low abundance gene products facilitates their positive identification by comparing protein profiles of GRACE strains under repressing versus nonrepressing or overexpression conditions. In some cases, a more complex protein profile results because of changes of steady state levels for multiple proteins, which is caused indirectly by manipulating the low abundance gene in question.
Overexpression of individual targets within the GRACE strain collection can also directly aid orphan protein identification by providing sufficient material for peptide sequencing or mass spectrometry.
In various embodiments, the present invention provides a method of quantitative analysis of the expressed protein complement of a diploid pathogenic fungal cell: a first protein expression profile is developed for a control diploid pathogenic fungus, which has two, unmodified alleles for the target gene. Mutants of the control strain, in which one allele of the target gene is inactivated, for example, in a GRACE
strain, by insertion by or replacement with a disruption cassette, is generated. The other allele is modified such that expression of that second allele is under the control of a heterologous regulated promoter. A second protein expression profile is developed for this mutant fungus, under conditions where the second allele is substantially overexpressed as compared to the expression of the two alleles of the gene in the control strain.
Similarly, if desired, a third protein expression profile is developed, under conditions where the second allele is substantially underexpressed as compared to the expression of the two alleles of the gene in the control strain. The first protein expression profile is then compared with the second expression profile, and if applicable, a third protein expression profile to identify an expressed protein detected at a higher level in the second profile, and if applicable, at a lower level in the third profile, as compared to the level in first profile.
Accordingly, the invention provides a method for evaluating a compound against a target gene product encoded by a nucleotide sequence comprising one of SEQ ID
NO: 1 to 61, said method comprising the steps of (a) contacting wild type diploid fungal cells or control cells with the compound and generating a first protein expression profile; (b) determining the protein expression profile of mutant diploid fungal cells, such as a GRACE
strain, which have been cultured under conditions wherein the second allele of the target gene is substantially underexpressed, not expressed or overexpressed and generating a second protein expression profile for the cultured cells; and comparing the first protein expression profile with the second protein expression profile to identify similarities in the profiles. For comparisons, similarities of profiles can be expressed as an indicator value;
and the higher the indicator value, the more desirable is the compound.
5.8 Pharmaceutical Compositions And Uses Thereof Compounds including nucleic acid molecules that are identified by the methods of the invention as described herein can be administered to a subject at therapeutically effective doses to treat or prevent infections by a pathogenic organism, such as Candida albicans. Depending on the target, the compounds may also be useful for treatment of a non-infectious disease in a subject, such as but not limited to, cancer. A
therapeutically effective dose refers to that amount of a compound (including nucleic acid molecules) sufficient to result in a healthful benefit in the treated subject.
Typically, but not so limited, the compounds act by reducing the activity or level of a gene product encoded by a nucleic acid comprising a sequence selected from the group consisting of SEQ
ID NO: 1 to 62. The subject to be treated can be a plant, a vertebrate, a mammal, an avian, or a h~~. ~ese compounds can also be used for preventing or containing contamination of an object by Candida albicans, or used for preventing or inhibiting formation on a surface of a biofilm comprising Candida albicans. Biofilm comprising C. albicans are found on surfaces of medical devices, such as but not limited to surgical tools, implanted devices, catheters and stems.

5.8.1 Effective Dose Toxicity and therapeutic efficacy of compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LDso (the dose lethal to 50% of the population) and the EDSO
(the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LDSO/EDSO.
Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage ~of such compounds lies preferably within a range of circulating concentrations that include the EDSO
with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the ICso (i.e., the concentration of the test compound which achieves a half maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
Levels in plasma can be measured, for example, by high performance liquid chromatography. A
useful dosage can range from 0.001 mg/kg body weight to 10 mg/kg body weight.
5.8.2 Formulations and Use Pharmaceutical compositions for use in accordance with the present invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
Thus, the compounds and their physiologically acceptable salts and solvents can be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
For oral administration, the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats);
emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations can also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
Preparations for oral administration can be suitably formulated to give controlled release of the active compound.
For buccal administration the compositions can take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e:g., dichlorodifluoromethane, trichlorofluorometharie, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined . by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds can be formulated for parenteral administration (i.e., intravenous or intramuscular) by injection, via, for example, bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredient can be in powder form for constitution.with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
~ In addition to the formulations described previously, the compounds can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
6. EXAMPLES
6.1 Construction of a GRACE strain containing modified alleles of CaKRE9 Oligonucleotide primers for PCR amplification of the SAT selectable marker used in Step 1 (i. e. gene replacement) contain 25 nucleotides complementary to the SAT
disruption cassette in pRC 18-ASP, and 65 nucleotides homologous to regions flanking the CaKRE9 open reading frame. Figure 2 illustrates the 2.2 kb cakre9d: : SAT
disruption fragment produced after PCR amplification and resulting gene replacement of the first wild type CaKRE9 allele via homologous recombination following transformation. PCR
conditions were as follows: 5-50 rig pRC 18-ASP, 100 pmol of each primer, 200 p,M dNTPs, 10 mM Tris- pH 8.3, 1.5 mM MgCl2, 50 mM KCI, 1 unit Taq DNA polymerase (Gibco).
PCR amplification times were: 5 min 94°C, 1 min 54°C, 2 min 72°C, for 1 cycle; 45 sec 94°C, 45 sec 54°C, 2 min 72°C, for 30 cycles.
Transformation was performed using the lithium acetate method adapted for C'. albicans, by Braun and Johnson,-(Braun, B. R., and A. D. Johnson (1997), Control of filament formation in Candida albicans by the transcriptional repressor TUP1, Science 277:105-109), with minor modifications, including shorter incubation times at 30 ° C and 42 ° C ( 1 hr and 5 min respectively) and a greater amount of material transformed (50 ~g of ethanol-precipitated cakre9d: : SAT
PCR product).
Transformed cells were spread onto YPD plates and incubated overnight at 30 ° C, providing a preincubation period for expression of SAT prior to replica plating onto YPD
medium containing streptothricin (400p,g/ml). Streptothricin-resistant colonies were detected after 36 hr and cakre9d: : SATlCaKRE9 heterozygotes identified by PCR analysis using suitable Primers which amplify both CaKRE9 and cakre9d: : SAT alleles.
Oligonucleotide primers for PCR amplification of the conditional promoter used in Step 2 (i.e. promoter replacement) contain 25 nucleotides complementary to the CaHIS3-marked tetracycline regulated promoter cassette in pBSK-HT4 and 65 nucleotides of homologous sequence corresponding to promoter regions -270 to -205, relative to the point of transcription initiation, and nucleotides 1-65 of the CaKRE9 open reading frame.

The resulting 2.2 kb PCR product was transformed into the cakre9d: ~SATICaKRE9 heterozygous strain produced in step 1, and His+ transformants selected on YNB
agar.
Bonafide CaKRE9 GRACE strains containing both a cakre9d::SAT allele and CaHIS3-Tet-CaKRE9 allele were determined by PCR analysis. Typically, 2 independent GRACE
strains are constructed and evaluated to provide a reliable determination of the terminal phenotype of any given drug target. Terminal phenotype is that phenotype caused by the absence of the gene product of an essential gene 6.2 Phenotype determination of the CaKRE9 Grace strain The terminal phenotype of the resulting GRACE strains was evaluated in three independent methods. In the first, rapid determination of the CaKRE9 GRACE strain terminal phenotype was achieved by streaking approximately 1.0 X 106 cells onto both a YNB plate and YNB plate containing 100pg/ml tetracycline and comparing growth rate after 48 hr at room temperature. For essential genes, such as CaKRE9, no significant growth is detected in the presence of tetracycline. In the second approach, the essential nature of a gene may be determined by streaking C.,aKRE9 GRACE cells onto a casamino acid plate containing 625 pg/ml 5-fluroorotic acid (SFOA) and 100 pg/ml uridine to select for ura cells which have excised (via recombination between CaLEU2 sequence duplications created during targeted integration) the transactivator gene that is normally required for expression of the tetracycline promoter-regulated target gene. Again, whereas nonessential GRACE strains demonstrate robust growth under such conditions, essential GRACE
strains fail to grow. Quantitative evaluation of the terminal phenotype associated with an essential GRACE strain is performed using 2 x 103 cells/ml of overnight culture inoculated into 5.0 ml YNB either lacking or supplemented with 100 pg/ml tetracycline and measuring optical density (O.D.6~) after 24 and 48 hr incubation at 30°C. Typically, for essential GRACE
strains, no significant increase in optical density is detected after 48 hrs.
Discrimination between cell death (cidal) and growth inhibitory (static) terminal phenotypes for a demonstrated essential gene is achieved by determining the percentage of viable cells (as Judged by the number of colony forming units (CFU) from an equivalent of 2 x 103 washed cells at T=0) from the above tetracycline-treated cultures after 24 and 48 hours of incubation. Essential GRACE strains producing a cidal terminal phenotype are those which display a reduction in percent viable cells (i.e. < 2 x 103 CFU) following incubation under repressing conditions.

6.3 Target Level Variation in Whole Cell Assays In order to demonstrate the utility of target level expression in whole cell assays for drug screening, both a CaHIS3 heterozygote strain and a tetracycline promoter-regulated CaHIS3 GRACE strain were compared against a wild type (diploid) CaHIS3 strain for sensitivity towards the 3-aminotriazole (3-AT) (Fig.6). 3-AT
is a competitive inhibitor of the enzyme encoded by CaHIS3, imidazoleglycerol phosphate dehydratase, and together serve as a model for a drug and drug target respectively.
Overexpression, achieved by the constitutive expression level of CaHIS3 maintained by the tetracycline promoter, confers 3-AT resistance at concentrations sufficient to completely inhibit growth of both wild type and CaHIS3 heterozygote strains (Fig 6A). The phenotype observed is consistent with that expected in light of the predicted 7.5 fold overexpression of CaHIS3 determined by Northern bolt analysis (see Fig 5). A heterozygous CaHIS3 strain demonstrates enhanced sensitivity (i.e. haploinsufficient phenotype) to an intermediate 3-AT concentration unable to effect either wild type or tetracycline promoter-based overproducing CaHIS3 strains noticeably (Fig 6B). A third CaHIS3 expression level evaluated for differential sensitivity to 3-AT was produced by partial repression of the GRACE CaHIS3 strain using a threshold concentration of tetracycline 0.1 % that normally is used to achieve complete shut-off.
This level of CaHIS3 expression represents the minimum expression level required for viability and as predicted, demonstrates an enhanced drug sensitivity relative the heterozygous CaHIS3 strain at an intermediate 3-AT concentration (Fig 6C).
Similarly, GRACE strain-specific drug resistance and sensitivity phenotypes to fluconazole and tunicamycin have been demonstrated by increasing and decreasing the level of expression of their respective known drug targets, CaERGIl and CaAlG7. Together these results demonstrate that three different levels of expression are achieved using the C. albicans GRACE strain collection, and that they exhibit the predicted drug sensitivity phenotypes between known drugs and their known drug target. Moreover, these experiments clearly indicate how distinct levels of target gene products synthesized within the pathogen could be directly applied in whole cell assay based drug screens to identify novel antifungal compounds against those novel drug targets validated using the GRACE method.
6.4 Identification of a Target Pathway A target pathway is a genetic or biochemical pathway wherein one or more of the components of the pathway (e.g., enzymes, signaling molecules, etc) is a drug target as determined by the methods of the invention.

6.4.1. Preparation of Stocks of GRACE Strains for Assay To provide a consistent source of cells to screen, frozen stocks of host GRACE strains are prepared using standard microbiological techniques. For example, a single clone of the microorganism can be isolated by streaking out a sample of the original stock onto an agar plate containing nutrients for cell growth and an antibiotic for which the GRACE strain contains a gene which confers resistance. After overnight growth an isolated colony is picked from the plate with a sterile needle and transferred to an appropriate liquid growth medium containing the antibiotic to which the GRACE strain is resistant. The cells ~.e incubated under appropriate growth conditions to yield a culture in exponential growth.
Cells are frozen using standard techniques.
6.4.2. Growth of GRACE Strains for Use in the Assay Prior to performing an assay, a stock vial is removed from the freezer, rapidly thawed and a loop of culture is streaked out on an agar plate containing nutrients for cell growth and an antibiotic for which the GRACE strain contains a gene which confers resistance. After overnight growth, randomly chosen, isolated colonies are transferred from the plate (sterile inoculum loop) to a sterile tube containing medium containing the antibiotic to which the GRACE strain contains a gene which confers resistance.
After vigorous mixing fo form a homogeneous cell suspension. the optical density. of the suspension is measured and if necessary an aliquot of the suspension is diluted into a second tube of medium plus antibiotic. The culture is then incubated until the cells reach an optical density suitable for use in the assay.
6.4.3. Selection of Medium to be Used in Assay Two-fold dilution series of the inducer or repressor for the regulatable promoter which is linked to the gene required for the fungal proliferation, virulence or pathogenicity of the GRACE strain are generated in culture medium containing the appropriate antibiotic for which the GRACE strain contains a gene which confers resistance.
Several medium are tested side by side and three to four wells are used to evaluate the effects of the inducer or repressor at each concentration in each media. Equal volumes of test media-inducer or repressor and GRACE cells are added to the wells of a 384 well microtiter plate and mixed. The cells are prepared as described above and diluted in the appropriate medium containing the test antibiotic immediately prior to addition to the microtiter plate wells. For a control, cells are also added to several wells of each medium that do not contain inducer or repressor. Cell growth is monitored continuously by incubation by monitoring the optical density of the wells. The percent inhibition of growth produced by each concentration of inducer or repressor is calculated by comparing the rates of logarithmic growth against that exhibited by cells growing in medium without inducer or repressor. The medium yielding greatest sensitivity to inducer or repressor is selected for use in the assays described below.
6.4.4. Measurement of Test Antibiotic Sensitivity in GRACE Strains in which the Level of the Target Gene Product is not Rate Limiting Two-fold dilution series of antibiotics of known mechanism of action are generated in the culture medium selected for further assay development that has been supplemented with the antibiotic used to maintain the GRACE strain. A panel of test antibiotics known to act on different pathways is tested side by side with three to four wells being used to evaluate the effect of a test antibiotic on cell growth at each concentration.
Equal volumes of test antibiotic and cells are added to the wells of a 384 well microtiter plate and mixed. Cells are prepared as described above using the medium selected for assay development supplemented with the antibiotic required to maintain the GRACE
strain and are diluted in identical medium immediately prior to addition to the microtiter plate wells. .
For a control, cells are also added to several wells that lack antibiotic, but contain the solvent used to dissolve the antibiotics. Cell growth is monitored continuously by w incubation in a microtiter plate reader monitoring the optical density of the wells. The percent inhibition of growth produced by each concentration of antibiotic is calculated by comparing the.rates of logarithmic growth against that exhibited by cells growing in medium without antibiotic. A plot of percent inhibition against log [antibiotic concentration] allows extrapolation of an ICSO value for each antibiotic.
6.4.5. Measurement of Test Antibiotic Sensitivity in the GRACE
Strains in which the Level of the Target Gene Product is Rate Limiting The culture medium selected for use in the assay is supplemented with inducer or repressor at concentrations shown to inhibit cell growth by a desired amount as described above, as well as the antibiotic used to maintain the GRACE strain.
Two fold dilution series of the panel of test antibiotics used above are generated in each of these media. Several antibiotics are tested side by side in each medium with three to four wells being used to evaluate the effects of an antibiotic on cell growth at each concentration.

Equal volumes of test antibiotic and cells are added to the wells of a 384 well microtiter plate and mixed. Cells are prepared as described above using the medium selected for use in the assay supplemented with the antibiotic required to maintain the GRACE
strain. The cells are diluted 1:100 into two aliquots of identical medium containing concentrations of inducer that have been shown to inhibit cell growth by the desired amount and incubated under appropriate growth conditions. Immediately prior to addition to the microtiter plate wells, the cultures are adjusted to an appropriate optical density by dilution into warm sterile medium supplemented with identical concentrations of the inducer and antibiotic used to maintain the GRACE strain. For a control, cells are also added to several wells that contain solvent used to dissolve test antibiotics but which contain no antibiotic. Cell growth is monitored continuously by incubation under suitable growth conditions in a microtiter plate reader monitoring the optical density of the wells. The percent inhibition of growth produced by each concentration of antibiotic is calculated by comparing the rates of logarithmic growth against that exhibited by cells growing in medium without antibiotic. A
plot of percent inhibition against log [antibiotic concentration] allows extrapolation of an ICso value for each antibiotic:
6.4.6. Determining the Specificity of the Test Antibiotics A comparison of the ICsos generated by antibiotics of known mechanism of action under conditions in which the level of the gene product required for fungal proliferation, virulence or pathogenicity is rate limiting or is not rate limiting allows the pathway in which a gene product required for fungal proliferation, virulence or pathogenicity lies to be identified. If cells expressing a rate limiting level of a gene product required for fungal proliferation, virulence or pathogenicity are selectively sensitive to an antibiotic acting via a particular pathway, then the gene product encoded by the gene linked to the regulatable promoter in the GRACE strain is involved in the pathway on which the antibiotic acts.
6.4.7. Identification of Pathway in which a Test Antibiotic Acts As discussed above, the cell-based assay may also be used to determine the pathway against which a test antibiotic acts. In such an analysis, the pathways against in which the gene under the control of the regulatable promoter in each member of a panel of GRACE strains lies is identified as described above. A panel of cells, each containing a regulatable promoter which directs transcription of a proliferation, virulence or pathogenicity-required nucleic acid which lies in a known biological pathway required for fungal proliferation, virulence or pathogenicity, is contacted with a test antibiotic for which it is desired to determine the pathway on which it acts under conditions in which the gene product of the nucleic acid is rate limiting or is not rate limiting. If heightened sensitivity is observed in cells in which the gene product is rate limiting for a gene product which lies in a particular pathway but not in cells expressing rate limiting levels of gene products which lie in other pathways, then the test antibiotic acts against the pathway for which heightened sensitivity was observed.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.

SEQUENCE LISTING
<110> Roemer, Terry Jiang, Bo Boone, Charles Bussey, Howard <120> Gene Disruption Methodologies for Drug Targets Discovery <130> 10182-004-999 <160> 490 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 660 <212> DNA
<213> Candida albicans <400>

atggatatcgaaactgccgcttgcttttcaatagcatttatagccacaccgatcctcata 60 gtattggtaagattgctattcattcttccatcattaagacttccaacctccgtaaagaaa 120 aagaaaaagctcattcaggaatgccaactttcaatcttgcttggttcaggtggccatact 180 ggggagatgatgagaattatatctaaacttgacatgggaaaagtttctcgtacatggata 240 tacacttcgggcgacaatgcgtccttagcaaaggcacaggattatgaaaggaaatcgggt 300 acatccctgcagtacataccaatcccaagagcacggacagtgggccaatcatatatactg 360 agcattccaaccaccatatactcattcttgttttctgcaattgcgatgctcaaacacaga 420 ccagcagtgatacttttgaacggcccaggtacttgtgttcccgtggcatacattttgttt 480 ctctataaactccttggattatgcaatacaaagataatttatattgaaagtttagctaga 540 gtgaacaagttgagtctcagtggattactattattaccgatcagcgatcgatttattgtc 600 cagtgggaaagtttatatcaacagtatagccgtgtcgagtattatggtatattgatatag 660 <210> 2 <211> 504 <212> DNA
<213> Candida albicans <400> _ atgggaaccaacaacaaaactgtcactaataagtcaaacaagagaatccaagggaaacga 60 catatcaaacatagtcccaacttgactccctttaatgaaacacaaaatgcttcgaatttt 120 ttaatcaaatcatcaactccttatatatcagctatcaaacaaattaccaagaaattgaat 180 aaattctccaaatcaaagaatagtcacacgataaataaatttcaaaatgaacaatacaag 240 acgatcaaatatatagccgtcaaaggtatgggtaaaacaattgaaaaagtggcgagtatt 300 ggtactcatttccaaaaggattataaagttgatgtgttgacagggtctactacagtgtta 360 gatgagtttgcaccaattgaatcaaaccaagagcctgataatgagaacaagagtgatgat 420 gatgacgacgacgacgacgaaactatatataagaaacgtactgtgagttctatagagatt 480 agaatatggataaaacgagattaa 504 <210> 3 <211> 1485 <212> DNA
<213> Candida albicans <400> 3 atgctagcaa ggcttttgaa acttgcaata gtagttgcag caatagcggc aatcacaccc 60 aataacccaatacgtacactgatttcatttgggtgtataggttacgtggcaaccttactg120 gtaataccgaaagttagcccaagttttgtcaagatcgggctcaaagggaaagatttatct180 aaaccaccaccggtgtcagaaatacccgaaacaatggggctagtggcgtcaactacatat240 atgtttcttatgtttggtcttatcccatttatttttttcaaataccttgtttcttttgga300 tcaatgtctaacgacgaggtgataactaaaaattacttgtctcaatatcaatcgcttgcc360 gacaacaggttattcccccacaataagttggcagaatacttgagtgccttgttgtgttta420 cagagtaccacattgttgggattactagacgacttgtttgatatcaggtggcgtcacaag480 tttttcttacctgcagttgcatcattgcccttattgattgtatactacgtcgactttagt540 gtaacttcagtcgtgatccccaagtttgtcactgaattccctggaggctacgttctaatt600 aatactataaatttttttataaagtatagtaaccatttggtcacaagtatcactgggctt660 tcatttagaactttacaaacagactatgttgttcctgacagttcaccaaagttgattgat720 ttgggaattttctactacgtatacatgtcggctatttcaattttctcaccgaattcaatc780 aatattcttgcaggcgttaacggtttggaggttggacaatcattagttttagcagccata840 tttttaattaatgatttctgctatcttttttcaccgggaatatcacaagcagctcatgat900 tcacacatgttttctgttgtatttataattccttttgtcggagtgtcattggctttattg960 caatacaactggttccctgcaagagtatttgttggtgatacgtattgttatttcagtggc1020 atggtatttgctattgttggtattataggtcatttttccaaaactcttttgatatttttg1080 ttacctcaaataatcaattttgtgtattcagttcctcagttgtttcacatcttgccctgt1140 ccaagacacagattacccagatttagtattgaggatggtttgatgcatcccagttttgca1200 gaattaaagaaagcaagccgtctaaacttggcgattttagaaactctcagttttttcaag1260 ctcataaaagtggaaaggggttccaaactgaatcagattgttagattttccaatatgacc' ataatcaatcttacgttggtgtgggtaggacctttacgagaagaccaattatgtatatct1380 attttggtcgttcaatttgttattggcgtgacaatgatagttgttagacataccattgga1440 ccatggttatttggatacgataatttatcatggggtgtaaaataa 1485 <210> 4 <211> 843 <212> DNA
<213> Candida albicans <400>

atggcacctacagaaataaaagggttttatgtgttgcctctcaagttaacaggtaccaaa 60 tcaatacattacatatactttaagaaacatgaactgaaaggcactgccaatgataacaga 120 tcattatttatttgcaacttgccaatatccacagacttgtctactatcaaaaaatttttt 180 cagaaagtagccataggatctacaatagaactgtttataaactcacttttgactgattat 240 cctgaagacatatggattaatttaaccaaactaacatcggacttggatttggtcgacgct 300 gttgatgaacaagcaagcaagttacctaaaaactgtggtattgtggcatttatagataag 360 gcctctttcacactagcctttaactcattgaaaaagttatcatctagccttactgagtgt 420 gaatggccaatacaacagttcacatcaaattattatttgaaacaatatcagaagcagata 480 ctagacccaaatagcttaacagaagaagtctcccaagcgttaatagattttgacaaagca 540 gaacaacagtcaattgaagaattacaactgcaaagaaatttggttgatgaagatgggttc 600 actttggtggtcggtagtcacagaaaaaccaaagcgggtattttgggcaaacagaaatta 660 gcatcaaccgttggagttgtgaaagctcaatccaagatgaagagtaaggaaaaacaagac 720 ttttatagatttcaattgaggcaacgaaagaaggaagaaatgaatgagttgttgaataag 780 ttcaaattggatcaagaaaaggtcagaatgatgaaggaaaagaaaagatttagaccttat 840 tag 843 <210> 5 <211> 1116 <212> DNA
<213> Candida albicans <400>

atgacggatacacaaccaaggaaaatacgtaaagtgtctactcaagagcaaattgaagat60 tatgaaaaacttcgtcaaagaatcaaaaatcatttcaaagatgcccttaaaggtaaagga120 tcatctatgctgttgcattatattgatgaaataaccgaattatataaaagagttcaatca180 caaaaagttaaagatacaagagttcatttagaagattctgaagttttcaaagaagcatcg240 gattttgctgccttgaatgcacgtaatatagttttcgatgattcgggaattgctcttgat300 gataaagaatttttcaaatgtttaagaagatttgctgttactgatcctagtcttttaagt360 cgtaatgatataggagataatgatggcaataatagtaacgatgaggatgacgtagatgat420 gatgatctggatgaagaagaagaagctattactgatgaatacacattcaataaaacaaat480 tggttaaaacttgggattctttatcatcaagttagtaaaaaatccatactggtagatttt540 ttaaatggacccttaaaagcagaaaagaggaaaatagttcgagcaagaaatgttgatgat600 actaaaggtagcgggatggcgaaaactgctcgacaagttcaagctagtgatatttctggt660 aatcaagaacaaaatactgccaacatggttaaatcagtttatcaaacatatattgaaaaa720 tatgatggtaatggtgttaatttatttaaattttttataaaccctagatcatttggtcaa780 agtgtggagaatttattttacaccagtttcctcgttaaagatggtcgattgaaattatat840 gtgaataatgacgggatgccttgtattcaaagagtgagtagtgatgaaatcagagaggct900 caattggaaagcaataaaatttttgctagtcatcatattgctagttttaattacaaagca960 tggaagaaatatactcaattatataacataagagaagcatttttgggacatcgtgatgaa1020 cctgaagaccaaatgccacctgaagatataattgattataatgacgaggaacctataccg1080 tcatctcaaagaagggatctgaattcatcggattaa 1116 <210> 6 <211> 1695 <212> DNA
<213> Candida albicans <400>

atggctagaagaaatagaaataaaactgtgaatgaagaagagattgaacttgatgaagtt60 gactcatttaatgccaatagagaaaagatattattagatgaagctggagaatatggacgt120 gatgatcaatcggaggaagatgattctgaagaggaagtcatgcaggtagaagaagatagt180 gaggatgacgaagaagatcaagaagacgaagaagaggaggaggaggaggaagaaggggaa240 gaagaagaagaagaggaggaaaaaggatggggaggaagacagaattattatggaggagat300 gatctaagtgatgatgaagatgctaaacaaatgacagaagaagcattgagacaacagaag360 aaacatttacaagaattagcaatggatgattatttggatgatgagatgatggaagattgg420 cagaaaaaggctgattcatatgacaataaagacacactgtcatcaacccagcagcagcaa480 caacaacaacttatcattgaaagcaatagttctattgcgaatttggaagatagtgataaa540 ttgaaattacttcaacaatcattccctgaatttattccattattaaaagaattgaacagt600 ttgaaagttaaattagaagatttacaaaaattagaggataaaaacaaatgcatagagaca660 aagattgtagcattatcagcatatttgggagctatatcgtcatattttgccatatttgtt720 gataatttgaacaatgaagaatcgtttgtatcgatgaaagataatccaatcatggaaact780 atattgagttctagagagatttggagacaagcaaatgaattacctgatgatattaaattg840 gatgatgttaaagtacatgtttccgatgttgtttcttctagtgatattgatgacgaagac900 aattttgttgacgccaaagaagaacaatctgaagatgaagagatatcagaagaagaagtt960 tctcaagacgaagacgaagatcaatcagatgatcttgacattgatgctaattcagaaaga1020 attatcaagcatgtttccaaaaaacacggtgatgatttcacagaagctgatatcgaagat1080 attgatatggaggataaacaacgtcgtaaaaagacattaagattctacacttccaaaatt1140 gataaagctgcagctaaaaaagaccaatcatattctggtgatatagatgttccatataaa1200 gaaagattgtttgaaagacaacagcgtctacttgaagaagcaagaaaacgaggattacaa1260 aaacaagatgatgaaaatatatcggataatgacaatgacaatgacggtgtcaatgatgat1320 gaaggatttgaacaaggtgatgattattacgaatcaataaaacaacataaattaaataag1380 aaacaatccagaaaatcagctcatgaagctgcggttaaagctgctaaggaaggtaaattg1440 gcagaattacaagaagctgttggtcaagatggtaaaagagcaattaattatcaaattctt1500 aagaacaaaggtcttacgcctcacagaaagaaggaatatagaaactccagagtcaaaaag1560 agaaaacaatacgaaaaggcacaaaagaaacttaaatctgttagacaagtctatgatgct1620 aataatagaggtccatatgaaggtgaaaagacaggtatcaagaaagggttatcaaaatca1680 gttaaattggtgtaa <210> 7 <211> 1521 <212> DNA
<213> Candida albicans <400> 7 atgtcgaaagtggaagagcatgagagtgtgaataacctaaagaggaaattcccctcgttg60 gcaaaacccagacagccgttgaaagagacgaattctaacatcccatcaccacataagcgt120 gctaaaatagaatccccaagtaaacaacaatcaacgcaacaacctcaacagcaaccacaa180 ccacaaccacaaccacaaccacaacaagaaaaggctactcacaagccaaagaaatcatca240 catcagctgaaaaataatgacaagcttgctggggatgaaatgcacgaatggcaacagtct300 tggagaagaattatgaagagttcaattgtttactttgaaggagaccagcaactgctagaa360 tatagaaaagcacataaactattgagactagttgggtgcaaagtgactcctttttatgac420 aacaatgtaactataattatttctaaacgtccgtacgacagtaagacagaatattctccg480 catgacattttcagcaacgtaagcaaagcgagtatcaaggtttggaactatgataaagtg540 tttcgttttttaaaacatcttggtattaatatccagaccggggtagacgagcttgcggtt600 aacacacatacaattcttcctccatcgttgaccaataacaatgagaaacccgatttatac660 aatttgttgaaagaagaaaaaatatatggctcaaccgatagagatcctaatgcaaagcgt720 gatgatttgcattatttgggcaagaactatttatatgtttatgacttgacccagacagta780 cggcccattgccattcgtgaatggagtgaccattatccggttatgcagttatcattggac840 ggcaagtgtccatttatagaagatcccacagaccagaacctggagagaaaacggcttaaa900 cgattaagaaagttcgaagctaatcaagcgcatcgtgaggctttgagattggccacatat960 aagatgatcaatggcatttcaatgagtgtgcatggtttcactgccacgagcaccagcaca1020 gacaaggttgatgaagaggaggattccactgtcaaggaacctagtgaagatccaagattc1080 cgtcaaccacttaacagaaactcttcttgcatgcagtcaaaggcatttgaggcaatggct1140 tctggatataatggggcatctaatgcggttcagccctcaatggattctaacttgaatagt1200 gctgctgcaatggctggcgggaacggtttaggtccagcattatcacaggttccttccaaa1260 cagttaaataacttgaagagaaggattttgatgaagaagaaaacgacaaacacaactgaa1320 aagaaagataaggaacatgcctcgggttattgtgagaactgtcgtgttaagtatactaat1380 tttgatgaacatattatgaccaataggcatcgcaattttgcttgtgatgatagaaatttt1440 caagatatagatgagttaattgctagtttgagggaaagaaaaagtttgggaaatgtcatc1500 tcaaacggcgattatgtatag 1521 <210> 8 <211> 1599 <212> DNA
<213> Candida albicans <400> 8 atgaaaccaatggtgaccacactttataatggcaagctcccgttggcgttggctgaccct60 aatgggatattcacatggtgtccgcatttgaatttgatatttatagccatgaacaagatg120 tcgatctggtgttatcgaatgaatggcgagcgaatatattccatcaacaacaaatcgatt180 gtcaaacatatagcgttttaccgcgagtacttttgtttgtcggggacagacaacttgatc240 aagatatatgattctaataatgggcagttggtgaaggtgttgccgcaggagtttgatggt300 gttgagtttgttgggtggaatgggactgagtatagagtgctggtgtcgatgccgatggtt360 tatgacttggttagtgagttggattatttggtggtgagcgacggcaagaggatggcgatt420 acgtttaaccagttgttgacggtggactgggagtgtgagatgagtgtgcaccagcaacta480 aatagggacttgttcaaccaagtgtatgtcgctggggataagctagttagggtcaggttt540 gttgtcgacaaccagaagttgtatacggagcagattatcaaggtgtgtcagcttatcagt600 ttgctagagtatggggagcagcacatacaaaagattaaggggttggtggtaccgtttttg660 ctggcgatggaccggtatatgtcgaatttggaatctgagtgtggtgatttggcgcagtac720 ttgtctgatcttgttgttagtaatatcattcctgaattttctaaagatttctggctaaac780 cagtatggcgagcgtggacacaagaggatggttaaattggcaggggtgtatgagagttgt840 gtaaaggatacgtaccagcacttggtgagcaccacagagagggtgatttcgattgtgggg900 gagttgattggtgtgtccaaatgggagcaaggattgttggcgacaacggagttggaggcc960 ttgttagaccaggcgaagctgcagctaaagttttattataggtttatttgggatttgcag1020 actgagcggcagcaggtaagtcagtttttggtatggacaaagagtattatcgatatgcta1080 aatgatcaggagtgtgatattgcctattcgactacagatgtgttgtgctttatcaatggg1140 gcacttacgaagagtgtgatgctaaagtattttgatatcaagggggtaccagaaacgcca1200 atgacgaatattagtatggatttgactacaattggtgagtaccaccggtcgagggttgag1260 gtggaggtgttgcagaacatttcattaccgtctgtctatacaaacctaaaactagcccaa1320 tgggaggaggtggtggttacctatcaacaaggtaacgcccttgttattgctaatgtggat1380 ggtgtggtgtcaacggtgcaagatgtgtactcctatcaacacaggcagaccgatttggtg1440 gcgttgacgagcaagtcgttgttgattattgattcgtcgtcgtgtataccgattgcactt1500 ccggaaacac tgttccaacc gaccaagcta attcttaacc aagagtatgg tgtgttgctc 1560 gactcaacgagacagcactattcaatatttaggatgtag 1599 <210>

<211>

<212>
DNA

<213>
Candida albicans <400>

atgggtaaaagaagagtagatgaagaatctgattcagatattgatgttagttcacccgat60 tcagaaactgaattagaaagcacgcaccaccaccaccaccaccaagaaggtgctactaca120 attcaagaaactgttgatgttgattttgatttttttgatttaaatcctcaaattgatttc180 catgctactaagaattttttaagacaattatttggtgatgataatggagaatttaattta240 agtgaaatagccgatttaattttacgagaaaattccgtggggacatcaattaaaactgaa300 ggaatggaaagtgatccatttgcaattttaagtgtaattaatttaactaataatttaaat360 gtggccgtgattaaacaattgattgaatatattttaaataaaaccaaatctaaaactgaa420 ttcaatattattttgaaaaaattgttaaccaatcagaacgatactactagagataggaaa480 tttaaaactggattaataattagtgaaagatttataaatatgccagttgaagtgattcca540 ccaatgtataaaatgcttttacaagaaatggaaaaagctgaagatgctcatgaaaattay600 gaatttgattattttttaattatatcaagagtttatcaattagttgatccagtggaaaga660 gaagatgaagatcacgaaaaagaatccaatcgtaaaaagaagaacaagaataagaagaag720 aaattggctaataatgaaccaaaaccaatagaaatggattatttccatcttgaagatcaa780 attttggaatyaaatactcaatttaaaggaatatttgaatataataatgaaaataaacaa840 gaaacagattcaagaagagtatttactgaatatggtattgatcctaaattaagtttaatc900 ttaattgataaggataatttagctaaatcagtcattgaaatggaacaacaattcccacct960 ccataa 966 <210> 10 <211> 801 <212> DNA
<213> Candida albicans <400>

atggcaggatttaaaaagaatagagaaattttaactggaggtaagaaatatatccaacaa 60 aaacaaaagaaacatttagttgatgaagttgtatttgataaagaatcccgtcatgaatat 120 ttaactggtttccataaacgtaaattacaacgacagaaaaaagctcaagaatttcataaa 180 gaacaagaacggttagctaaaattgaagaacgtaaacaattaaaacaagaacgtgaacga 240 gatttacaaaatcaattacaacaatttaagaaaactgctcaagaaattgctgccataaat 300 aatgatattggatttgatcaatcagatgacaataatgacaatgataatgaagaatggagt 360 ggattccaagaagatgaagaaggagaaggagaagaagtaactgatgaagatgacgaagat 420 aaggaaaaacctttgaaggggattttacatcatactgaaatatataaacaagatccatca 480 ttatcaaatattactaataatggtgccataatagatgatgaaacaacagtagtggtagaa 540 tcattagataatccaaatgctgttgatactgaagaaaaacttcaacaattggctaaatta 600 aataatgttaatcttgataaatctgatcaaattttagaaaaatctattgaacgagctaaa 660 aattatgctgtgatatgtggagttgctaaacctaatccaatcaaacaaaagaagaagaaa 720 ttcagatatttaacaaaagcagaacgtagagaaaatgttcgtaaagagaaatcaaaatca 780 aaatcaaagggcaagaagtaa 801 <210> 11 <211> 999 <212> DNA
<213> Candida albicans <400> 11 atgtcaacag tatattataa aaaactagat aaattacaat tccagattta cgacttgttc 60 agctctttgc ttcaattatc cgaagctgaa gatgaatctg tctacaaggc cagctttgat 120 gacaccgtgc aagaaattga tctgttattg attgctttca aagacctcct tagactttta 180 cgacccaaag ataaatccaa caaattcgat acatacgaat tgaaatttca ttctttgaag 240 cacaaattgcgtgagttgcaagtatttattaatgatcaacaacaagacaagttgcatgaa300 tataggataaagcatttccatctacaagatctgcctgtggataccatcaataacgaattt360 gctcgagaccaattatttgctgatcgttccactaagaagactaagaaagaaatggaagcg420 tctataaatcaacaaattgtcagccaaaataaacaaataacaaaatccttgcaagcatcg480 agacaattgttatcagcaggtatattgcagagtgaattgaacattgacaacattgatcag540 caaaccaaggatttatacaagttaaatgaaggatttatccaattcaacgatttgttaaat600 agatctaagaaaattgtcaagtttattgaaaagcaagataaagctgaccgtcaacgtata660 tatttgagtatggggttcttcatactttgttgttcttgggtggtttatagaagaatttta720 aggcgaccacttaaaatattcttgtggtcctttttcaagatctttaatattttcaactgg780 ttgcttggaggtggtagaagtaaagggttatctgcaagtgatatgatagtttcatctgtg840 attgctgctaccacggaaatcgtcgactatgaggcaacgaaaactttgttggataccttg900 tcgaacgctgtggactctaatacagcgattgatacacttgcaatggtagtggaatctctt960 acgacatcatcaatggaacatattgtagatgaactatag 999 <210> 12 <211> 822 <212> DNA
<213> Candida albicans <400>

atgacagactcatcagctaccgggttctccaagcaccaagaatcagcaattgtatcagat 60 tcagaaggagatgcaattgattccgaattgcacatgagtgccaacccacctttattgaga 120 agatcatcttcattattctccttatcctcgaaagatgacttgccaaaacccgattccaaa 180 gaatatttgaaattcattgacgataatagacatttcagtatgattagaaacttgcacatg 240 gccgactttatcactttattaaatgggtttagtgggttttattctattatttcatgttta 300 agatacactttaactggacaaactcattacgtacaaagagcacattttttcatattgttg 360 gggttatttttcgatttttttgatggtagagttgcaagattaagaaataaatcatcatta 420 atgggacaagagttagattcattagctgatttggtatcatttggggtatctccagcaaca 480 attgcctttgctattggattcagaacaactgttgatgtgttatttttggccttttgggtt 540 ttatgtggattaacaagattggctagatttaatatctccgtcaataacattcctaaagat 600 aaacacggtaaatcacaatattttgagggattgccaattccaacaaatttgttttgggtc 660 ggattcatggctttattggtgtacaaagattggattcatgacaacttaccatttggaata 720 gttttccaagatactctgtttgaattccatttggtcacaataggatttgttttacaaggg 780 tgtgctgaaatctcaaaatctttaaaaattcctaaaccatag 822 <210> 13 <211> 3528 <212> DNA
<213> Candida albicans <400>

atggcaaaacggaagttagaggaaaatgatatttctaccattgaagatgatgaattcaag60 tccttttccgatcgagatgaacaaatagatgaactcagcaacggccatgcaaagcataga120 gagaacaacgcacaggagagtgatgaccacagtgcaagtgaagacgacgatgatgaagac180 gatgaggaagagggagaaaaatcagtacaaccacctaataagaaacaaaaaaagcagctt240 tctgcacaagatgtccaagtagccagagagacagctgaattattcaaatctaatatattt300 aaacttcagattgacgaactaatgaaagaagtgaaagtaaagaaagctcacgaagaaaaa360 attgagaaagtattgcaccgtttgcatgatttgattaaacaagtgccacctgtggaaaat420 ctaactttacaacaagcagaacaacattttaatcccaagaaattagtcatcccatttcca480 gatcccaaaccaacaaaagtaaactatagattttcttatttgccactgggagatctttct540 ttggttgggtcgtacggattaaaaacagctattaaccaaccacatggacaaagtatcgaa600 gtagcactaactatgcctaa.agaattgtttcaaccaaaagattatttaaattatagagca660 ttatataaaaagtcattttatttggcatacttgggtgagaatttaatccatttgtcgaaa720 aagaataatttgccgatcaaggtgtcgtatcaattcttcaatgacgatgtattgaacccc780 gtcttaaaaatagagagtatccaaactgaaaatcccgaagatttgacttttactaaaact840 aaaattgctattaatttaatagtagcattcccatttggtgtttttgactcgaaaaagcta900 cttcctgataaaaactgtatccgtgtgcaatcagacaccgagactttgccacctactcca960 ttgtacaattctagcgtgttatcacaaacatcctacgactattatttaaagtatttatat1020 accaccaaaaaatcaacagaagcattcaaagatgcatgtatgttggggaaactttggttg 1080 cagcaaagagggttcaattcgtctctcaataatggggggttcggtcattttgaatttgct 1140 attttaatgagcgcgttgttgaatggaggtggattaaacggtaacaagatattgttgcat 1200 ggattttcctcataccaattattcaaaggtaccatcaagtacttggctacaatggatcta 1260 aatggagggtatttatctttctcgtctttaattggagaaaacattgcatcgaaatacaaa 1320 tcagatgggtttaatgttcctaccatattcgataaaaacaccaaattaaacatcttatgg 1380 aaaatgaccaagagttcttacaagagtcttcaattgcaagcacaacagactttggaatta 1440 ttgaatgacgttgtaaaagacagatttgacgccattttgcttcaaaagtctgattttgat 1500 ccgatgagatacgatattgtcttcaagttatcagcacctgaagagttgtacgattctttt 1560 ggtccattggaaaagatagcatacattacttttgataattatttcaagagcagattattt 1620 gcaattttaacaaaagcattaggtgaaagaatagaactgattgttattaaaaatgaacac 1680 ccttcaaacacatttgccatccacaagagaaagccatcacacacaagctcaacctttgtt 1740 attggtttgcaattaaatccafiaagaatgtgacaaattagtaaccaaaggtccgaataat 1800 gaagataaggatgctggtatcaaattcagatccttttgggggaacaaagcatctttgaga 1860 agattcaaagatggatctatccaacattgtgttgtttggaatattaaagatcaagagcca 1920 gtggtaatgaacattatcaaatatgctttagatactcacttgcaatctgaaatatcacaa 1980 catttggcatctctgatcagttattttgataagaaattgccagttccattattgccttca 2040 gcaacaaatcaagtgatcacatctttaagcagctttactgctttaaggaactcatttgaa 2100 aacttgagtaaagtcttgacaaatttagagttaccacttagtgtgaagacagttttgccc 2160 gcatcatctggtttaagatacacgtcagtattacagccagtgccatttgcagcatccaac 2220 cctgatttctggaactactgtgtattacaatttgagacttcaacaagatggccagatgaa 2280 ctaagtgcattggagaaaacaaagacggcatttttattgaaaattagcgaagaattagct 2340 gaaacagaatacaattcatttatttcaaaagatgaatcagtacctttcaatgaaaatata 2400 actttgttgaacattttaactccagaaggttacggattcagaatcagagcttttacagaa 2460 cgtgacgaattgttatacttgagagcagtatcaaacgcagacaaacagaaagcgttagtc 2520 caagatgtttatttgaaattcaatgaaaaatatatgggctcagtaaagcacaccagatct 2580 gtaacacaacttgcacaacattttcacttttattcaccaactgtcagattttttaaacaa 2640 tggttggattcccaattacttttgcaacatttcagcgaagaattggtggaactcattgct 2700 ttgaaaccatttgttgacccagctccatactcaattccccattctgttgaaaatggattt 2760 ttacaaattttgaatttcctagccagctggaattggaaagaagacccattagttcttgac 2820 ttagttaaaagttctgctgatgatgatatcaaattaagtgataagttaactatacaagca 2880 catagaatcattgagcaaaattttgaaaaaattagaaaaacagacccttcaggtattaaa 2940 acacagtattttattggatcgaaagatgacccttctggaatattatggtctcataattta 3000 actttaccaatttctactaggctaactgcattgtctcgagctgccatccagttgcttaga 3060 aaggaaggcattactgaaaccaacttggatttgatatttactccagcattacaggattat 3120 gacttcactattaaggtcaaggcgaataacgttactacttcttcaggtattttaccacca 3180 aacacatttaaaaacttaattcaaccattaacttcattccctgatgatataactacaaaa 3240 tacgatttggttcaaggttatgttgatgaattgaataaaaaatttggtaatgctattata 3300 ttttcaagtaaaaagttcacaggtttatgcaagaacaatgaaaacgtcattggtggtatt 3360 tttgttcctaccaacttgaccaaaaagaaattcagggtcaatttgggcattaacgttaaa 3420 cctttggatgataaaggagatgaagttataatcaacaccagctccatatacgatgaaatt 3480 gaattacttggtggagatttaattaaagcattcgataaacgtaaataa. 3528 <210> 14 <211> 2280 <212> DNA
<213> Candida albicans <400>

atggctaaaaaaagaagagctgctatattgcctaccaacattattcttttacagaatgtt 60 gtgcgtagagatcctgaatcataccatgaagaattcttacagcaattttcccattatgaa 120 tctcttcgagatttgtatttaattaatccgaccggtgtggatgctaactctacaaccgag 180 tttattgatttaataggatttatgtcagctgtatgtaactgctatccaaaagagactgct 240 aattttcctaatgaattaaaagagatattattaaacaaccatcgtgatttaactcccgag 300 ttacgtgaga,aaattatccaatgcttgacaatgttaagaaataaagacattatatctgct 360 gaaatgttgatacagacaatattcccattattaattactagtaatgctggacagcaagtg 420 aagcaaatgagaaaacaaatttattccactttgattgcattgttgaaatctgttaataca 480 ggcacaaagaaccagaaattgaatagatcaactcaggcattattgtttaatttattggag 540 caaagggacaatcaagggttatgggctactaaattgacaagggaattatggagaagaggt600 atttgggatgattccagaaccgttgaaataatgactcaggctgctttacatccagatgtc660 aaagttgccgtcgcaggtgctaggttctttttaggggctgacaaggaaagggaagacaat720 tttgaagagagttcagatgaagatggtttcgatatgaatgagttgagacataaaatgcaa780 attaataaaaagacatccaaaagaggtaagaagttggagcaagctgtaaaagccatgaaa840 aagaagaataattccaaacattcagcaacttacttgaacttttctgccattcatttatta900 agagatccccaaggctttgcggaacaaatgtttgataatcatttgagcagtaaaaattcc960 aataaatttgatttggatcaaaagattttgtttatgaatttgatttcaagattaattggt1020 acacataaacttattgtgttgggtgtatatacatttttcttgaaatatctcactccaaag1080 caaagaaatgtcactcaaattatggctgccgctgctcaagcatcacacgatttggtacca1140 ccagagtcaattcaaattgtcgtgagaaaaattgctgacgaattcgttagtgatggtgtt1200 gctgcagaagtagcatcagcaggtataaacaccattagagaaatattagccagagcccca1260 ttggctatcgacgctccgttattgcaagatttgactgaatataagggttcaaaatctaaa1320 gcagtgatgatggcagcaagatcattgatttctttgtatcgtgaagtagcacccgaaatg1380 ttgttgaaaaaagatcgtggtaaggtggctagcatagaattgcagaagggtgagaaaagt1440 ggcttgcctcaatatggggttgagaataacgttacttcaattccaggtattgaattatta1500 gctaaatggaagaaagagcaaggcttagatagtagagaggacgaagaagatgatgccaat1560 tgggaggttgacgatgatgaagatgcaagtgatatcgaaggtgattggatagatgttgaa1620 tctgacaaagagatcaatatttcagatagtgatgatgacaatgaagaggatgagcaagaa1680 caagaaccagagaaaggtaaagcaaaaataggtaaagcagaagataacgaagatgaagtt1740 tctgatttagagttgtcatcagatgacgacgatgaagatagcgaggagaacaaagatgga1800 aaagcagttgctgattcagaagaacctcctaccaagaagcaaaagatcagaaacgaaaat1860 gcagatatcaatgccgaacaagccatgaatgagttactttccagcagaatattgacacca1920 gctgatttcgccaaattagaagaattaaggacagaagcaggtgtatcgaagattatgggt1980 atttcaaatgaagaagctgttgattctacttccttggtaggtaaagtcaaatacaaacaa2040 ttgcgagaagaaagaattgctcatgctaaagagggtaaggaagatcgtgagaagtttggc2100 tctagaaaaggtaagagagatactcctcattctactaccaataaggaaaaggcaagaaag2160 aagaattttgtcatgatgattcataaaaaagctgttcaaggtaaacagaaactttcttta2220 cgtgatagacaaagggttttaagagcacatataacgaagcaaaagaagaaagggttatag2280 <210> 15 <211> 1587 <212> DNA
<213> Candida albicans <400>

atggctattgttgaaactgtcattgatggcattaattattttttgtcccttagtgttaca60 caacagatcagtatattattaggggttccatttgtttacaacttagtatggcaatattta120 tattcattaagaaaagatagagctccattagtgttttattggattccttggtttggttct180 gcagcttcatatggtcaacaaccttatgaatttttcgaatcatgtcgtcaaaagtatggt240 gatgtattttcatttatgttattagggaaaattatgacggtttatttaggtccaaaaggt300 catgaatttgttttcaatgctaaattatctgatgtttctgctgaagaagcttataagcat360 ttaactactccagttttcggtaaaggggttatttatgattgtccaaattctagattaatg420 gaacaaaaaaaatttgctaaatttgctttgactactgattcatttaaaagatatgttcct480 aagattagagaagaaattttgaattattttgttactgatgaaagtttcaaattgaaagaa540 aaaactcatggggttgccaatgttatgaaaactcaaccagaaattactattttcactgct600 tcaagatctttatttggtgatgaaatgagaagaatttttgaccgttcatttgctcaacta660 tattctgatttagataaaggttttacccctattaattttgttttccctaatttaccttta720 cctcattattggagacgtgatgctgctcaaaagaaaatctctgctacttatatgaaagaa780 attaaactgagaagagaacgtggtgatattgatccaaatcgtgatttaattgattcctta840 ttgattcattcaacttataaagatggtgtgaaaatgactgatcaagaaattgctaatctt900 ttaattggtattcttatgggtggtcaacatacttctgcttctacttctgcttggttcttg960 ttacatttaggtgaaaaacctcatttacaagatgttatttatcaagaagttgttgaattg1020 ttgaaagaaaaaggtggtgatttgaatgatttgacttatgaagatttacaaaaattacca1080 tcagtcaataacactattaaggaaactcttagaatgcatatgccattacattctattttt1140 agaaaagttactaacccattaagaatccctgaaaccaattatattgttccaaaaggtcat1200 tatgttttagtttctccaggttatgctcatactagtgaaagatattttgataaccctgaa1260 gattttgatccaactagatgggatactgctgctgccaaagctaattctgtttcatttaac1320 g tcttctgatgaagttgattatgggtttgggaaagtttctaaaggggtttcttcaccttat1380 ttaccatttggtggtggtagacatagatgtattggggaacaatttgcttatgttcaattg1440 ggaaccattttaactacttttgtttataacttaagatggactattgatggttataaagtg1500 cctgaccctgattatagttcaatggtggttttacctactgaaccagcagaaatcatttgg1560 gaaaaaagagaaacttgtatgttttaa 1587 <210> 16 <211> 1302 <212> DNA
<213> Candida albicans <400> 16 atgcctagtcatgttaccaatgtatataacgatattgatgatggaatgcttctactgtct60 ttgtcattaaatgagagatcaaatgatagaagaggtttggaaattgaagaggtatacgac120 tccagttttgatgatcctatggatattgatgatacaggtgagttgtcgaatcacatggat180 atagatgatacaacttttgagatagatcacgtcgcaagtgataactacgcaaataaaaga240 gaagacgacaatgatactaataacgaagaagaacgtcgggaagatgggttgttttcttta300 ctatctcctacgttgatgggggcaaaacttgcaatcaaaaagccattactattaatgcct360 ccgcccactgtttcggaacaatctgattcaaaaactgaaagtgcatcttctgttgattat420 gaatatgacactagttcattcaaacccatgaaaagcaatggattgattacacgaaaaacc480 aatagcagtacatttcagccaagcaatatagactcgtttttattccacagtgatggaatt540 tcactgggtcagctgttaggtggttatcaagatttacatagcaattatcaacagccagtg600 actatccataatcatcaccatcactattactattacaataaagatgaatcagtaccgtcg660 ccaccttctaacaacaatttacaatcacttgaacacgagcaaagaaatttgcagatgcaa720 caatacaaacaacaattagaggagcatcagttatatttacaagagtataaacgtaacaat780 caaatacttttaccttctccttggcagcataatatatctccaatagaaagagtcccctat840 ctattgatgtcctacttacaaatgttgataaatttcattgcttcgttatatggtgtatat900 cttgtttattgtttatttcgaacgataaatacagacatcaaaaccaaaatagaggaacaa960 caaacgaatttgattatcagcattgagtcctgtcgtcgatcgtactatcagaatggctgt1020 gacgacaaggataacttggtcccattattggtatccaaatgtcaaaaatttgagaaatgt1080 atgaaacaggacccttacaaattaagtaacgtttccattatgagtgctgagattattgga1140 atgatcatcaactcattaattgaacctttaagtttaaaattttacttgtttatgttagca1200 tttatattaattatatttgcatgcaattttacgtttggatatattcgagccaaggcatat1260 tatggtggtagtatgaagtatagtcttgacaaactcgattag 1302 <210> 17 <211> 792 <212> DNA
<213> Candida albicans <400>

atggaatcattagacgaaatacagtggaaatctccagagttcatacaagagagagggctt 60 aataccaataatgtgttggagtacttttctttatcgccattctacgaccgaacatcgaac 120 aaccaagtgttgatgatgcaatttcagtaccagcagatacaaataccacctggtgtatca 180 ttccaccaatactttcagtcgcggttgagtgagatgaccggaatagagtttgttattgcg 240 tatactaaagagcctgatttttggataatcagaaaacaaaaacgacaggacccccagaac 300 actgtgacactacaagattactacataataggagcaaatgtttaccaggcaccgaggatc 360 tacgatgtgttgtcatcgagactccttgcaagcgttttgtcgataaagaactccactgac 420 ctattaaatgacatgacaagctatcatatctcagacgggggtcattcctatatcaactcc 480 atacacggcagctcctcgaaaccatcacagtcatcggctgtctcgaagccactgtcaaca 540 aatactggaacgaatgcaactactaccccgatcactttgacgactccactgggtgctact 600 gtcccgagcacagtgtccaatggaatctcaaccagcacagagattgccagcggagtgttt 660 gatacgttgttgaatgatgtggtgatgaatgatgatcacttgtacatcgatgagattcca 720 ttatatggtgagggaagcacacttgagagacttgggttaaagggaaataaagatgcgggt 780 ttgagtctatga 792 <210> 18 <211> 1092 <212> DNA
<213> Candida albicans <400>

atgtcctcttctcaagcacgaaaagctcttcaagatgtaattcccaattatttaggtgaa60 tttacacccaagctactagattatatcaattccttatatcaacttagtttaaggaaacaa120 gcaatactaccaaataaatcggaaattgcacgttttcatctatgtgctgttgttattgtt180 gaaaaatataaacaatcttttgaattgccgactcctgatgtgtcaagaataccaacacaa240 cctaaagtagcagcaaagttactagacacttttcgtgagttgatagaacaaatctccgca300 gccagcacacctgtatcaagtcccaaaaaggtgaaaccaccatcccaaagtccactgaca360 ccaacaaagagtcgaacaagcaaagagaatttgaaatcaggatcccctttaaaacgtctt420 cgagcagaaatgttgcaagaagaccaggtcaatggtaactcccccgatggccaacttaag480 gatgtagactctccctttaacccaaagaaaagaaaagaatccaaggcaggcaccccaaca540 cataaagtttataaatacgataagaaacacgttctgatagcagattttatagcattctgc600 aacactttccttataccaggtgatatcaccgccaagatggtgggcacatttttaacgcat660 caacacaagtttcttaaaaaaagtgattggtcattggcctgtggtatggtttatgcggca720 tacattcggataaataacagattacttgcacaactggttggcaccaagtcagagttcacg780 aaacaattgttacaataccagaagggaggtttactgctaggggccatgcaatcttggtgt840 ggtataatcgaagaatggattcaagatgaaccatggattcaagagatagaaaagacttac900 gcttatggtagcaaaacagctgaagaaaccagaaattcttttgaaagaaaagcgaaaata960 ggtgaaggctgggacctaatggaacagtttggggctatgattcatggcgagacaatttcg1020 ttatcaagtcaccaagaagagtattacaaaaactggcgtaaagaggctttagagaaatgt1080 gaccaactatas 1092 <210> 19 <211> 2616 <212> DNA
<213> Candida albicans <400> 19 atgaatacgttttcatccccaccaaacgtgatacgagagtataatgactccacatatcag 60 ctgccattgaattcacaattccaccaatcaccattcttgcagactcaatcaccagactat 120.

gtcagcttacgagaagaagaggatgataataatgataagaatctagacatcatgtcatca 180 tgtatagtagattcagtaatatataaatcacaaaaaattgctggcccactattgagtcaa 240 atatccaatttgaacattcagcaagcattgattatacgagaactactattcacattgtta 300 ggacatgaaggtcattacattcaatatagtaaacgttatgatccaacctcacaaatcagc 360 cgaattgaaggaccggactataagattgcaaagaacttggatataagtcttaaagttatc 420 accaagaaattggtcaaatttggaaagttttacagtgggttaaaatcgtttattcaagta 480 tttgataataacaaatttgggaaaattgtgcaaaagttttgctctgaagtgagaaagttt 540 ttatcgagttatcaacaagtgctaataaatgttgagcatgagttcaagtttaataagaat 600 tttaatttgaatatgttggatctgctcttacatcaagaaatatcgaatgaaatgactcat 660 ttatatcaaattggaatagagattagtcggataacggaagaaagacagaaaatgtcacag 720 gcggaaatcatgggtaattttgaaccaacgactttggcaaacacaagtatgaatgggatc 780 aattccgagcctaatttgtattatggcaaatttgattgttgtaaaggtggactattactt 840 caagttattcaggaaagaatggtttattataaaggtgatcctacatctctagatttttta 900 actcaactttttgatattgttagttcggattatattgggatgttgaatcagtggcttttg 960 gaaggtgtaataaatgatccgtttgatgagttcatgattagagaaaaacgagtgccagac 1020 tcctttatggaaatatttcaaagtaaaagtgaatactattggaacgaattgtttttaatt 1080 aaaatagatggattactcaatcaatttcagaattcaaccatacagtcgaaaattctcaat 1140 acagggaaatacttgaatatattcaaacgatgcacagggttacacaattttgaatcatta 1200 aaagaaaaattgacaactataactagtttggcagctcctgatttggaacttaagattgat 1260 gagttttatcatagagcaaacaaaatgttgatgaagttgcttttcgatggatataatttc 1320 ccaagtgtggtgaacatatttcaaagattatttcttttcgctgattcttttcaaatcgac 1380 aactttattgatagtactttcagtgaattgaaacgtgggaaactcaaaatctcagtttcc 1440 agactacaaaagcaatatgatgatatattcaaagaaaaaattgaaaataaagttggagta 1500 cggccaagtgtatacgacgtgttgaagaaaaatcagaagctatcggtaacgtcggagtca 1560 ttgtataaagtggttgaggaattaatggaaaagaacctggattatttgatttcagacaac 1620 aatttgcgtgggatatttcatcgagtggcgtcgttaagagacgacctgcgacttaccata 1680 ctgagtactgctgattctgcaactgaaaacgtgaaggatgaaccaacaataactagtgtt1740 gatcttactataccgttgccattcccattaaatttggttttgaatcaacaattgtcatac1800 caatatgaaataatgtttaaattattaattaatatcaagtttatttcaaaatataatagt1860 tccaattggcaagagatgaattattctaaaatttggacaaattcgcatttcaactcgagt1920 gtgaaaaaatggatattgcgttgcagagtattgcattcgagaatttgcagttttattcat1980 gaacttgaaaactatatagtgcatgatgtcattgaacataattttgaggaaatcaaaaat2040 ttgattcacaccacggctactaacttggcgacaagtgaactaggatcagacataaatgat2100 gaaggtgataatatattcaatggatctttgattcgaggtacatttaacaataattcgatc2160 tttgattccaaagttcacaaacataggacaacaacatacgtggaaggtatttcaacagtt2220 gaacaattaattcaaaaatttctagattattcaagtactttgttgaatgattcgttgctt2280 acccgtgaagagtcgttgcgtcaattacgtaaaatgttggacttcattttccatttcaat2340 aattacattgtccaagtaaagaaagttttggtattgttgaaccatgaattgttcaatgag2400 tattctaaggaattccctaccaagtttgaaaagccaatggatcaagagctgatagataaa2460 agatttgcaaacttgagtgatacttttctaatgcagtacgaaaagtttggtgaaaatctt2520 gttacatttttagccaccattaaacaggttggtgaaagagaaaaccaaggattattggaa2580 ttaagtaatagactagaactttgtttcccagaatag 2616 <210> 20 <211> 1911 <212> DNA
<213> Candida albicans <400> 20 atgtcaggaccaataatttgttcaaagtttgatcagtcggggaactatttggcaaccggt 60 atggttgctcttgattcccatcaagtcaaagttcaatccataacctcatctcaagcatcg 120 ttaaatacatcattcaccttggaaaaatcaaacaaattagtaaatttagcatggatccca 180 tcagattcaatacaattgttagctctttgtttatccaagggaagtattttgatatattct 240 cctcaaacaaatgaaattgttctggaattgattagttctgcaaatgtctcaattttggat 300 ttccattactcaacaactactagaactgggtggtcttgcgatatagaaggaaacgtgtac 360 gaatgggatttgaattcttatttgttagttgattctttcaaagtcaatgaatacattgaa 420 tctgttgattcgataaatagaatatctacagtaatgttcaattctcaaccgcatttattg 480 cttggttcaaacgcagtctaccttttcaatattaaacaaagagaacttgtgaaaactttc 540 ccaggtcatattcaaccagtaaactcgataacagctttaaacaacgacatgtttttaacg 600 agtgctaaaggtgaccgatttgtcaatttgtatcaacttgataaaactgccacaaaggca 660 gtctttgtgggtctgtcctcagtatcgagcttatcagtttctataaaagacgacaagtca 720 gttttggtgattattaatgaagaaggtgatattgagattttcaacaatccattagcagac 780 gccaaatctcaagtttccactcctgtaccgaaaaagaaaagaaagcaagttggtgtttct 840 tcaagatcattcaatgcatcaattaaattatctcgtccagaaccagaaatcaaaagccca 900 caagatacacatttatttatcaatgctgtttccactgaagataacttgatcacattcact 960 tggttggaaaattcaactatcccattctttgacacccttaaatggattgatgaaaccggt 1020 tctttgcttcttgaatcagccaaagtattgctaaaatctaaaccaaattt.aaaagtcact1080 caacatttgactaacggtcacgatgtggccgcaccaaaactttatactgaagggcacacc 1140 attgtgagtgatggcagtaatatcagagatttggaatttcaagaccatcaagaggatgaa 1200 gaggacactgaggaatctttggctgaaaaattagagcgattggcaatggatcaaacttca 1260 caacaaaaatcaagaagaaggaaactagaagaggcaagaagtggtgtatctttatcgatt 1320 gtattaacccaatctttgaaaaataatgatcaagctttattagaaaccgtgttatcgaat 1380 cgtgatcctatcactattcaaaacacaatcagtagattagacccttattcatgtgtcaca 1440 tttttggataaattgagtgagaagattcaacgtcaaccaacaagatttgatcaagtgagt 1500 ttttggctcaaatggatccttgtgattcatggtccaactatggcttctttgccaaacttg 1560 agcatcaaactatctagcttacgtgcagtattaaataagaaagctgaagaattgccaaga 1620 ttattagaattacaaggtagattgaaattaatggatgattctgctgcattgagaaatgag 1680 tttagtgctgaagaaatagctgaagatcttgaagaacgaagtgatattgaatacaatgaa 1740 gaaattgatgatgcaaagtatgttggggtgatcagcgacgacgaaagcatggatgatgtg 1800 gatgactttgatgatcttgacgatgaagaggaagaggaagaggaagaagaggaagatggt.1860 attcctgatgctgcaaatttagatg~tagagaagattctgatcttgaataa 1911 <210> 21 <211> 984 <212> DNA
<213> Candida albicans <400>

atgatgtccacaaattttcaatggccaggaaccaataagaatgataatacagaagtatct 60 gttgaaacaccatcaagcacagatcctcatgtccctcgctatccatttaccgcaatgtca 120 catgcgacggcaagcacaactatgaagaaaagaaagcgagacgattttgatggcgacaag 180 tcaacaactatcaccatgaataccacgacaacacgtaaatacatacaatcatctttagga 240 tcttccaagttcaagaaggccaaaacacccaaaatcagtgggcaacctttgccactacct 300 agattgattgaatcattagacaaatccaatttacaaaaacttgtgcaagatttaataact 360 gttcatcctgaattacaatctacattaattaaaatttcccctagaccttctattcaagat 420 tccattcaacttttacaagacaaatttgatatgattatatctcatttaccttacaaatgt 480 gatgttgaaagtgattattcatatttaagaatcaaacctcatttgcaagaatttttatca 540 tcagtgtctgattttattttaaattatttacccccattagaaacaaatatgacacattct 600 ttgcaatttttacacgaaactaccaaattagtgtataacttgcctaatttcactaatcaa 660 gaatttcaatacaccaagtcctctgcattagaacagattgctaactgttggttgattgta 720 ttaagccaggatgaagaaaaagaaggaaacactgatgtggtgaaagttatacaagaattg 780 gaattgttagagaaattacacgaacataatgagatatcattcaataagtttgaaaaagtt 840 gttgattattgtaaagacaagttagaacaacatgaattaatcatgaataataacgaagcc 900 ggctctggtgttacatcgtcaataagtgacttgatcactgtggattattctaaatactct 960 atagccaatacaacttctatatag 984 <210> 22 <211> 1659 <212> DNA
<213> Candida albicans <400>

atgcccacaaacatacaaggagaagaagtgataatacctcctaaagatgaagaggaaata60 ttgttggagaaattagtatttggagatgccgcagggtttgaaaataacttgaaaaaatta120 gacaacttatatgattattcagacgaggaggaagagatagatgaaaaaggtctggagaaa180 gaatcagatattgaagatttacaagatgaagacctattttttattgatgatgggaataat240 gaagagcatagcagtggtgatgatatggaaatagatcaatccgaagacgaagaagaaggc300 gaagatcaagattcagataatgcatgggaggatagcgatgatgaaaaggttaacatttcc360 ttattaacatcagataaattgaaaaagttgagaaaaacaccacaggattcagttatatct420 ggcaagtcatatattattagattgagatcccaatttgaaaagatatacccaagaccacaa480 tggatagaggatatagaaaacaacagcgatgatgagaaagacttgtcggacgaagacaag540 gttgacgatgaagaaggacaagtaggatcaacaactgcattattaaacatcttgtcaagt600 actgaaaaattcataaacacaaagcaattgaaactaattgctgcaaataaaatatctata660 accagattgaaagatgcaaactataaaagaatcggtaaatcgggtatccagaccattgac720 ttccatccaaactatcctattttgctaacaggtgggtttgataagactattagaatttac780 caaattgacgggaaatcaaacaactttatcacttcatactttttgaaaaactgtccaata840 atggaagccagcttctatccacaattgtcaggcgatgacaccaaaaccagcaacttaata900 tatgctagtggtcgaagaagatatatgaataaaatcaacttgtcaactggggaaatagag960 aaaatcagtcgattatatgggcatgagcagacacaaaagtcgtttgagtacttcaaaata1020 agtcctcaaggtaaatacattggattgactggtaacaacggatggtgtaacttattaaat1080 gctcaaaccgggcattgggttcatgggttcaaaattgaaggaacaatagtcgactttgca1140 tttgccaacgatgaatcatttattatgattgtaaattctgctggtgaagtatgggagttt1200 gctctcgaagggaaaatcacttccaaaaccccaaacaaaatcattcgcagatggtacgat1260 gatggtggtgtcggaatcacaaagctacaaattggtggtaaaaacaatcgttgggtcgcc1320 attggtaacaataacgggatagtcaatatctacgatcgatcagtatttgctcctgaaaca1380 acacacccaaaaccaatcaaaacagtggaaaacttaatcacatcaatatcttcgttggtt1440 ttcaaccccgacggacaattattatgtattgcatcaagagctaaacgtgatgctttgagg1500 ttggtgcacttaccaagtggttcagtgtatagtaactggccaaccagtggcacaccttta1560 ggtaaggttaccagtattgcattctcgccaaataacgagatgttggccattgggaaccaa1620 accggtaaggtcactttgtggcgtttgaaccattattaa 1659 <210> 23 <211> 2148 <212> DNA
<213> Candida albicans <400>

atgtcattgaaaccatttacggggttattattctgttgcactgggttggaatcaaccaca60 cgacgagaggtggtagagaagatagagacccttgggggaattcattattcagatttaatg120 acagatgtcaattatcttat~agtgggagatagagacactgagaaatatcgattttgcatt180 aaatatagacctgacattatttttattgatgctgattccattttcacaattcataaacat240 tggataaacggtgaagatgagaacctggacttactacgaatagagaaatataggttggca300 atatttgctcaattgaatgcatgtttctcaagaatagaaatgtcaacctctcaaattgat360 catttagtcaacacagtaaaatttcgacagcgtactaatacttcacctgagtattttcgc420 ccgaaaaatttattcaaattgtttgttgataatggtggtattgccaaagaatctttactg480 tgtcatcagaattttattatcacagctgatccacgaggaacacgatacaacaaggctctt540 gaatggaatgtacccgcaatacatcctatttggattgtcgatagtgtattgagaggtgct600 gcattagattggaaagattatattttaaacaacaatccaaatgattgctatgatcgaggg660 tgtgatgtttggcccgaagttttcgattgtcaggagaaacaaaaacagaaatctcaacaa720 caacctaaaagattagagtctactgaaccagaagtaaaacggaaaatcaccaataataaa780 accaatgctgatatttggaactcgattatggatcataccaagaagcaaacaaagcaattg840 attcacgacaagacctgggatgatgatgaggaggaggaagataatgatgatgatggtgat900 acccaaaccaaaaatgaaaagaataatcaatacaagaatattactacaattcctaaagat960 ggaaagcaaaaaccagaattaaacggtaaaatacataatttggatcttaaattggtgtca1020 gaaagtaaagaaaactcaccaaatgtcctggaaagtcaattatttttagggttcaactat1080 tatacggtcggttttgactctcgtgagtttgacttgttatccaaagcaattgaaaactac1140 ctgggagaaatatctaatgatccaaatgacgattctatcactcatgtggttattcctgca1200 aaaaaggggtatcagtcaatgctggttttgaaagtcttacctgctgaccttaagctgaga1260 attgcaaatgggtttgtcaaaattgttactgagtttttcattgaaagatgtatgttttac1320 aagaaaattatattagatagatggggacagccaatgaagggattagtgccgtctaaaaaa1380 tcatttaaaatttgtaccactgggtttactggcattgaattattgcatattgaaaaacta1440 atacggtcgtttaactttgaatattgtgaaacattgtcagaacagagagatctactaatt1500 ctcaacgtaaatttatttaaaaaaagcttgatgaattcgccaaagttatttcaatacaaa1560 tgtaaggacatcatcaattgtccaactggtggatctgtgtcgttgatgtcatctaaacac1620 aaagttgaagctgcaaaacgatggaacattcctgttgtttcagtggcatatttgtgggag1680 attttagaactttcaactaataaatcacatattattatgccggatattacagatttgcaa1740 tggtgtgtctttgcaccgagcaactataataaaccgaaatcattattggagtacgtgaag1800 aatttggataaggctagtagagaaagttcttttagtcccaaaagtcaagaaaatgaagca1860 ttggaagaacccacaatggataatctggtgagattgccatcaccacgaagagttaatctg1920 aaacaaaaatacggtaaattagtgggaggcaaatctcccaaatcaattaaacggaaatta1980 ctcgaagctgcaaatctgtttgctgatggacagaatgatcatagtattaatccagatgtt2040 acaattgaagaggatctgatgtctcaaataaggtatcaagacaacgaatcaatgatcaac2100 caagaaagattattagagaaattggatggatcagctgtgcttgtgtaa 2148 <210> 24 <211> 3363 <212> DNA
<213> Candida albicans <400>

atggggaaggatttgttgactgcagaagcggtgactaaactattaagatcgaaggacacc60 tccatcacagagattgtcaatactgcaaatagtcttttgaataatacattggatatatat120 ttacctggaaaagaagtgtttgtattgaacttactatgtgacagattgaatgacaaatca180 aatggtaaatttggaaagtggaagtttaacaaggatgtatggaatttgcttcttctggtt240 tggtcgaaattaaatcaccagaaggtagacagacaaagggtaatacagagattgaaaatc300 attgagattataattttggttttacagcagaacaatgacaatgaagtcttctcgagcttg360 tttgagtttcttggtattatgtttcaagagtcttacattattgcagatgaaaattctgct420 acacaattattgaaatgctttgttgaacacatggatgttctccaagctagcgattcaatt480 gtgagttggactgaactagttcgagatatatatactcgtgcctgcctgaaaatcagttta540 gaaggatcaaagaagttttacaataagttttttgaagattgttgtttccccttgatcgag600 tatttagccatttctgaaggtctgtctgtctcaccaatattaaaggagttgttaattcaa660 ggggtgttcaatgcggattccacaaagtactaccaatcaagtttagagcgggagctcaaa720 aagaaagacatcaaagaggtatcagtgatatatttatacaccttaacggtgcaacttttc780 agtgccaaacatatggaaatatgtgaaggggtatattctatcatggcttcaaagtgtcct840 gacttggcagaaaagctattgtctattttggcaagctgcaggaaaacaatttctaaacca900 tttatagagctgatttacaaagtagaggttgctgataagccttttaaacaattaaactgg960 gacatggttaaacatatatttgcaattgatagtgagttggcaattagcaaatcagggttt1020 ttgttcaagacttacaagtctgaatttcagttggatgacaaagttgtacctgttgctgaa1080 gtgattgttgatggttttgcaagaaaccgcgaattgctggatttttttacaaaagtgtgg1140 cccaaagccataaagagagacgagatatgggaatcagatgagttcatacatactgtatca1200 cagcatgttaagactttttcagggaaacagttaattgatgtcatcgaaagctcgttttat1260 gcggataaggggagtcaacgtgcgatttttacagcaattacaaagggactaaccagttca1320 tctgcaaacctaattgatgccgtcaaacagacattattagaccgcagcaactatttcaat1380 gccacagagaatttttggtgtattcgttattacttgctctgtttatatggcacggatttt1440 actattgctgaacagaatatgaaacagaatattgatttgtactatcatttttctattttc1500 agattattggagttacaggttatcaaggagtattcaaagtctgatcaaaagtattttatt1560 gcttgcattgaaggggagaaggaaatgatatctccgattttcaaaagatggttggtcatt1620 ttcaacaaattttttgatagtgacttgttgattaagttaattctgcttggatatccagac1680 attgaatttgacgatgtatttttcgaacaaccaaagctaacaacttcattgattagattc1740 attactgagaatttaccagcaagaatggatcttatcgcttctatacctattgtttgcttt1800 aataaagcattcaaaaaggagttacttaatggtttgtttgtcttatttgtaagcaatccc1860 actaaggaaacactcgaaaacattcagtatttgcttggccagcctacttacctgtctatt1920 ttggagacaaattttgataacatgttaaaattgttgactgttagtactgaggaatcaaaa1980 ttgatagcttataatgtcattgaaattgtatggaaaaataatgtccggcagattaaaaat2040 gaagagaatcaaaagtatgtcaacgatgctatctcgaaattgagtagttatttggactcc2100 atgtcacaacaaataattctgcctgaactagaagcaattctgataatacttacaaatact2160 aaggaagttggtttattcgaaaatacggaaaaggggttgaataagttaaatgaaaagttt2220 acaaactattgtattaacactttaaacaactgcaacacccaaaattttattactgtaagg2280 tggctattacaggcacttgtaatgttgccacctaaatcattgtcttttgaaaatgtcatt2340 tcctgtacaaaaagattagatccaaatattttgaaagacaactctattcaatccacattg2400 tttcaattgatttgcaagacaatagactttaactacaagagtttggtctatgttttgagt2460 ttgtttgtctctttgctgtctgggagaaatacggagttgtatacagtgttaaagtcgtta2520 tttcaaaaattttctaaacattcgcagttatattttgaagtctttgatttttttacccgt2580 tcaattgatgctgtcccagttgaattcaatttaagttttgcacagattgcttccatattt2640 ttgagcacagttccaaaagacgcagatgccaatcgctacaacagcaaatgttttactttt2700 tatgttaacgctttacaatctggaaacgaatgtgtggccatgcagattttgactagctta2760 aaagatttgttgactaaccagtcctggattttcaaacaaaatttgctagaaataacttta2820 gttattgttaaaaccggattgcaaaaactaaactcttttgccaaccaagaacaaatttat2880 attttatcaacccaaattgtttcccatatcttgttgtatcacaggtttaagattgccact2940 agacaccatcttgttttgaacgtgatgtcaagtttattgaagtacctagcagatggaact3000 tcaaagttatcatcaaacacagaagctgcatctgcctatgctcgtttattgagtaatcta3060 tgtgaaccttcggagagagttggagataagatgtttcacttaacaacttcggcaagttat3120 ttcaaaaaattgttaagaaaacatttgtctgttttattaagcaattatatctattttaat3180 ttgaagtacacttttactcgtactgtgaatgatgctataatgccaggaatttacagtatg3240 tttactgttttgtcacaaaatgaattgagagtagttaatgattctttggactacggtggg3300 aaagcattct gtataatgattacaaagatc gaaagatcaa3360 ataaaacttt atgggaaatg taa <210> 25 <211> 591 <212> DNA
<213> Candida albicans <400> 25 atgtccgccg atgaaaataa caaagtgaga tttgagcggt tgaggcttgt tgccaggaaa 60 gccttagaac aactgattaa aaagtctttg actatggagc aagtaaaaac atgttttccg 120 actctagtga cttctcaaga tggagtcaga tcactcgaat tggccctttc acaaatgtcc 180 gggttttggc atgcaaactc gttggacgaa tttgatctaa tatataaaga aaaagatatt 240 gaatctaaactagatgaattggacgatataatacagaatgctcaacggactaaagacagt 300 gggaaagaaccaagtaatatagatcagctttcacctttagaaattgttgattccacgatt 360 gttagcaatagcaaaaatgttttggatagtcttcaaatgatatacgaccaattgtgtctc 420 gataatgctgagctatatacagaactttcagaactcacaaaagaaagcactagaatcaat 480 aattctataaaatccggtattgaacaattaaacaaagaagctaatagtgttgagctagaa 540 aaagcgggacttcaaattgacaaattaatagatatccttgaagaaaaataa 591 <210> 26 <211> 1416 <212> DNA
<213> Candida albicans <400> 26 atggcgtcttctattttgcgttccaaaataatacaaaaaccgtaccaattattccactac60 tattttctcctggagaaggctcctggttctacagttagtgatttgaattttgatacaaac120 atacaaacgagtttacgtaaattaaagcatcatcattggacggtgggagaaatattccat180 tatgggtttttggtttccatactttttttcgtgtttgtggttttcccagcttcatttttt240 ataaaattaccaataatcttagcatttgctacttgttttttaatacccttaacatcacaa300 ttttttcttcctgccttgcccgttttcacttggttggcattatattttacgtgtgctaaa360 atacctcaagaatggaaaccagctatcacagttaaagttttaccagctatggaaacaatt420 ttgtacggcgataatttatcaaatgttttggcaaccatcactaccggagtgttagatata480 ttggcatggttaccatatgggattattcatttcagtttcccatttgtacttgctgctatt540 atatttttatttgggccaccgacggcattaagatcatttgggtttgcctttggttatatg600 aacttgcttggagtcttgattcaaatggcattcccagctgctcctccatggtacaaaaac660 ttgcacggattagaaccagctaattattcaatgcacgggtctcctggtggacttggaagg720 atagataaattgttaggtgttgatatgtataccaccggattttccaattcatcaatcatt780 tttggggcattcccatcgttacattcaggatgttgtatcatggaagtgttatttttgtgt840 tggttgtttccacgattcaagtttgtgtgggttacatacgcatcttggctttggtggagc900 acgatgtatttgactcatcactactttgtcgatttgattggtggagccatgttatctttg960 actgtttttgaattcaccaaatataaatatttgccaaaaaacaaagaaggccttttctgt1020 cgttggtcatacactgaaattgaaaaaatcgatatccaagaaattgaccctttatcatac1080 aattatatccctatcaacagcaatgataatgaaagcagattgtatacgagagtgtaccaa1140 gagtctcaggttagtcccccactgagagctgaaacacctgaagcatttgagatgtcaaat1200 ttttctaggtccagacaaagctcaaagactcaggttccattgagtaatcttactaacaat1260 gatcaagtgcctggaattaacgaagaggatgaagaagaagaaggcgatgaaatttcgtcg1320 agtactccttcggtgtttgaagacgaaccacagggtagcacatatgctgcatcctcagct1380 acatcagtagatgatttggattccaaaagaaattag 1416 <210> 27 <211> 3540 <212> DNA
<213> Candida albicans <400>

atgacatcaagttcacaattatctgcttcttccaacgaactgattcaaaatgagagatta 60 ttatctctgctgttatttgaccaaataaggccggtttgcatagaactatcagaagcttca 120 actctgcaaccattcaacacaaacaaagttgtcaatttgatgatatcaatggaagacatt 180 cttaaaaagcaccacgatgagtataataaggatggaaattttagaatctatcagctatcg 240 cccaagctagcagattatatcttttaccctttatccaatatattgaaacagccggcttta 300 gatgatacaattatacagcatttgttcggaataattagattcctagttgaatactcttgg 360 agcttcaacgttaattttgttcttaccgatcagttacttcctttagtgatatacctttcc 420 agtggagatttgaacaaggaaccattactcataacaaagaaatccatacaattcaaaata 480 gcaacagtttctgtattatatactattacgagcactttgaacaaggaatattttcaatcc 540 ctaactgaaaaaagactattgtttataagcaatgtcataactatttgtttaagtatcata 600 gtcggcctgcgagtggaatctcaagatacaatacaattggtcctcaaatgtcttagttta 660 atctccaacgtgaaaaggtatttgaattcgagtcagatatcaataattcttccaggtatt 720 gtttcttcgataactaaatttatatcactaaatttaaatttaaattatcaaatcataatc 780 caattcttgcgattattatcaggtttcatatgcgcttcctttaatgataaagagttagat 840 gcccaaatcgagttgaacgaaggtataagtgatatttcagaaatccatgtcggatgggac900 gacgacaatgagactttgggcaacaattcattatattcagatgtcactattacagagaat960 gatcataggtcaagtgcatggttaaaagccacttccaaacaattgaaattatcattaata1020 atcatttttaagtcgatactacttggatcaagaaatagacatcggttgagatccaagcaa1080 gaactatacgatgagattcttggatttgttgagactattttgaaaaattgtttcaacagc1140 ttgtttaaagaatttgcctcattggcaattgacatagtatcaattcttggatacgtaaca1200 tctgaagacaacaaagaaatggccgataaaaccaacaaactatcaaatacactttgcatg1260 attattgaaggtgaaaccaacaaagaggaagttcttttcgaattagttaaaactaaactt1320 gctgatttaattgataataaactatcagggattgtttttgccttagatgaagataagata1380 tcgtcaactgtagcatcaatgatgttcaattttagtcttttgttatgtttatcaagaaaa1440 gtaaaacttgattgtgaggacttggattcattgaaacaaagatgtttggccctattaaca1500 gaatatgttgcggataggttcaaattcgagagttccaaaccgatcaaaagctctaatgct1560 agtgggttactcgaaacgtcttcaatgacaaatcaactagactcgatcgaattacctggg1620 tacattaatgcaaaaagtgttgtaaaacaagaaccattgaagaaagaacaggacaagagg1680 gcttatattcataatttgaaaacaatttcccgcaattggaataccaatgaaattaataac1740 tcttctggtaatacactaattggtataagttctaagttttcagagacaatactacagaac1800 tttattaattatttatcaagcttaaagtacgaagctagcaacagttcaacgttaacagaa1860 ttggagaatatttttgaattagctgacgataatgacatgattactaaaagtacctctctt1920 tgggttgcttctaattattacaaacgatcaacccttggcaaagtgatcaattttgattta1980 ggaaaatacttggttttagatgatgatgaagatatggaaatagatgatgataccaaagaa2040 atgtcatttttagttttatcaagggcagaagagttacttgaagagatttccgagaaccaa2100 gaaaagtactcttcacaaacttatatcctagcttacaatgcagcattacaatcaattaaa2160 gttgttgctggctcgatcccacttgatcagtttagaaccaattttttgatggatcatttg2220 ttgtcagtatttcaagcattaacgtataatgatatgccagaaatacaattacaggcacag2280 tcgacgttgaaagtggtattggatacatattataatggttcgatggtcaacttgatttct2340 gataatctggattatcttattgacagcataagcttgcagatgtcagtggctagtaattta2400 accccaatgcttccaggtattcttttgatcattgtaaagattgccggaatccaattattg2460 gagtcgaatcaattgcacgatgttttgactgatatgtttgtgatacttgactcctttcat2520 ggttacaataaactcgttgaaagttttttcatagtgtttgaggctttgatagatcagatc2580 catcataagttcgacagtcaacttaaagttgaatttaaggagtcttcgaaaacaaacact2640 tcattgtataagccatggggaatgaccaataaggatcaactattggaactacttaacgag2700 tcaaacaaaatggtcgataaatatgaaggttatgatagtaacaaggagtattttaaaaga2760 aaagctgacttgcctttttcggagatggatgcagattctgatgacgaagaagaggacgat2820 gaagcaaatattgatgacaatggagaagaagaagaagaaaaagaggaaatatggagctca2880 cccgtctcaaaggacatttatatgatttcactacgaatatttaattatggttttacattg2940 gtatcacaggaatcttacacattgaaaacacaaattatcaaaacactaagattgttattg30.00 cctttgctttgcaccaattacaaattattattacctgtattagccttaaattggcagatg3060 ctaattgctttagtgacaggttcaaaatctttatctacaagtattgaaagcaatggtgaa3120 tatgcttcggaagatattggtgtcatgaccgaggcccttcaattggtgactgaaatatta3180 gaagaggataaaaggagatatgaacatttcttcagtaaaaagtttcaggaagcttgggaa3240 ttcatatctcgacactcaaaactagtgcgccaaagagaagtcacatcaacaactaatatt3300 agagaacaaaagcaactagttgtttctgaaaaagcgatatatactttcagaaactatcca3360 ttactaaagacatcactagtaacgtttttaattactggtgtacaaaattatgaaaaaatg3420 atccctgatattcaccgctttgagattatcaaattgtgctatgaattgcaaattcctcaa3480 agtattcctttatctagggatacaatcggcgtactagaagttcttaaaaatacaacgtaa3540 <210> 28 <211> 837 <212> DNA
<213> Candida albicans <400> 28 atgagcctgttattcattaatgaggaggatgatatgactcccgaaccatataaaccatca 60 acatctacaatcagggaggaagaagaagaagtgcaagtgaaacaagaatttccagacgag 120 aagatggttgatccagatgaagatgatccaatagtcgaatcgataccattacttataaac 180 acagtaccagaaagggcgaaacagtcattacatgttttgcaatatgccggtcgacccaaa 240 tcacgcccaaatagagctggaaattgccatgcctcaataaaaccagaatcacaatatctt 300 caagtgaaagtaccccttgatactgaaaaattctttaacgtcgacaaaattcaagaatgg 360 ggtgaacaaattgttgaacaaaccattctgggtgtgctagatgggtcttatgaagtagga 420 aactatgctgcaaaaataataaatgacagcgatggaagaagagttgtattgattccagtg 480 gatagtacagtccaattaaaaccttcattcaagtacattgacgatttggaagcccaaagt 540 atccaacaaagaagacaacaagagagtactaatgaaaaaccagcaaatgtccaaatttta 600 caatcagctgctaagcattctactcaatctggagaatttctgcattctttgggagactca 660 ttgaaactggtaaagcattttgaagaagaggaatggcaaaatctaatttggaaaagaggc 720 gatgatgatgtaaccaagagtataaagtttggtttagatcaccacacagatactaatatt 780 gaattaaaaacaaacacttcatatgatgaatacatagacatgttaataaataactga 837 <210> 29 <211> 1479 <212> DNA
<213> Candida albicans <400>

atgaaacaacatccacttgtcacggcatataaaggcattgatgacttgcaacaattgaaa 60 aaatggttttacgagtataatgacacaatagaccatagaaaaaaagcaatatcaaaagta 120 aaaggattgttaaccagagggaaattaccacatggagttgaagccacatcgcttctaaca 180 tccatagttttggatgatttgcaaagaaaagacattgactcttgtgtgttacagttatct 240 tacaccatggctttgattagatttgttaatgggttgttagatccttatcagcagtcaaac 300 tatgccattcctatgcacctattggcaaaacaattgaacctacctacatattttgtagaa 360 ttgcgacacatggggactcatgaaaacttgccaagcctagatatattgagaagtacttgt 420 tcaaaagcattgacttggctttatgacaattattggtgtcatgtggaagaagcaaatcag 480 gataaacaagtttctattggggggccattgactgatgccgttgaatttcgaagtaatgat 540 ctaaggacaagaattgaagattctcagatttacaataatttgaaagcgttcaagcgaata 600 cggaaacaagatctaaacaaggtttacgagaagaatgatacaacgagcgatttagctgcg 660 acatatcataggtgtgttctggacatagtcgaatttgctaaagaaaattgtgatttatta 720 gtgaatgttttattgctcaagaattaccttatatacccttcttcaaaagtcaaagataag 780 aaactgaaattcaatcccttgattataaaattgtatgaaccattatttgacgcattgggg 840 ttgtcatttaaactcaaatgtttttccaagactatcgaattgattgaggcgaccccttca 900 agttttgtggacaagaaggtatatcgaaagcttggttttactgaaaagtttgagtatgac 960 gaactcttccaagtaatggaatgggtgttatatttcatgcaagaccttttgagaaacgaa 1020 aatgttcccctgccagtccacaacaagaatgagttggtaatcttatttttggacagtctc 1080 aaactgatagaacaaaagatatcacaatcacttttgcctagttttgcaaaaatcttgcaa 1140 ggtctttgtgacgtggtgaacgatggagttaaatctgaaattgatccagaaactgtacaa 1200 aagttggatgcttggaataaactgcttaataacctacatagtacaaagaagatttttgag 1260 ttgccaccatccttggacgatttattaggattatcgccgtcgcctggtccaatcccagag 1320 acaacttccagcaacccaatgaaacatgtcttagatgatgatgatgatgaagaggaagaa 1380 ggtgttcgtagaaagcagcaccactcgagtgatagtaaaacctatattttgaaaccccat 1440 aagaattggaggcccgttccttttgggacatgtatttag 1479 <210> 30 <211> 1230 <212> DNA
<213> Candida albicans <400>

atgacttcactgatcaatattttattattacttcatccaacagtagtcactgatgcccaa 60 ttagtagaacaaatcaaactgaaaatttatcaatcacataataacaataacaacaacaat 120 ggtggcactacaacgacgacaacaggaacagtgaatatcaatcttaatcaacaaataata 180 gatagagtcactaaagggatcattgaattaccatatgattattatgatgaaataatatat 240 attaacccaaataatgaatctcaatatcgagaaattcctattctgttaatgcaattaatt 300 tataaattattgaaatcaaatgggaaatttaaaggtgatttaccattagatcaaaattta 360 gatgttttaatgacaggatttataatagaagaagaagaaaaagaaaaagaaaaagaagaa 420 aacaatcttgaaggtgaattagttaatgtatgggttaaaccaatacctgttgatgaacca 480 gtggtgacattattgaaaaagaaaacaactactagtaatactactaccataaaaaaatca 540 ttgccgttatttaaaaaactaaataaagatgaaattaataattctgataaagatattaac 600 aatgataatataactaataataataataataataataataaaagaaaattggtggagaca 660 aaattaacttattttagtagtgatgatgaaaatagttctgatggatcagttttggagaat720 gatgacattgatgatgatgatgaacttatagatgaaaatgatttacttaactttaacaac780 aacaacaacacaaatggtgggagtttattatctgataaattaattacaccaagaaaatgt840 gatatatcattaaatggaggtaaaaaaagaaaaaaagcttgtaaagattgtacttgtgga900 ttaaaagaattggaagaattagaagtatcaaatcaacaaaatttacaagatcaaatttta960 ggtaaattggctcaatcagcaactttagaagctataaaaattgaagaaagattaaaacag1020 caacaacaacaacaacaacagaaagttaaagttaaatttactgaagaagatttatcagaa1080 atagatttcaccgtacaaggtaaaactggtggttgtggactgtgtgctcttggtgatgca1140 tttagatgtgatggatgtccttatttaggattaccaccttttaaacctggtgaagttgtt1200 aaattagatggatttggtgaagatatctaa 1230 <210> 31 <211> 984 <212> DNA
<213> Candida albicans <400>

atgattaggacgatcaaaccaaagaatgctcgttctaaaagagcattagctaaaaaggaa 60 gctaaattagttgaaaacaccaaatcagcattatttgttccaggttcaacggggaataaa 120 tttttacatgatgccatgtgtgatttaatggcatttaaaaaaccatttgccaaaaaattt 180 tccaaaaaaaatgaaattagaccatttgaagattctagtcaattagaattttttgcagaa 240 aagaatgattcatcattaatggtattttcatcaaataataaaaaaagaccaaagacttta 300 acgtttgtaagatttttcaattttaaagtttatgatatgattggattatcaatacaagaa 360 aatcataaattattacaagattttaaaaaattaacatttacaattggattaaaaccaatg 420 tttgtttttaatggtccaatttttgatagtcatccagtttatcaacatattaaatcttta 480 tttcttgattttttccgtggtgaagaaactgatttacaagatgttgctgggttacaatat 540 gtgattgccttatctgctggagaagtcgaagatttaaataatgataaagtattaccatta 600 gttcatttcagagtgtataaattgaaatcttataaatcaggtcaaaaattaccaagaatt 660 gaattggatgaaattggtcctcgttttgattttaaaattggtagaagaattactcctact 720 ccagatgttgaaaaagaagctactaaaaaaccaaaacaattggaagctaaagtcaaaaag 780 aatgtcactaccgatttcatgggtgataaagttgctcaaatacatgtgggtaaacaagat 840 ttgagtaaattacaaacaagaaagatgaaaggattgaaagaaaaatacgatcaagaaagt 900 gaagaagaagatgtgtatgtttctgatgaagagtactttggtgaagatatagaagaacca 960 gagactaaaagacaaaaagtatag 984 <210> 32 <211> 378 <212> DNA
<213> Candida albicans <400> 32 atgctgaaaacaaatactgctatataccaaaagattgctgaaaaaagagcaaacttggaa 60 cgatttagggaatttaaagaattgacagatgatttggttttacaactagagtctataggt 120 gacaaattagagacgatgaatggaggaactgccagtgtagcattaattttagcaaactgg 180 aagagtgtggtacaatctatttcattagcatctctagctttaatgaaagagtctaatgat 240 aataacaaag~aggctttccctgaaccattagtaagagtgcgtgttggacaatcaaatgaa 300 gaaaatcaagacgatgaagaagcagatgaagaagaaggtgttagagatagtgaagaagtt 360 gaagaatccacggaataa 378 <210> 33 <211> 3363 <212> DNA
<213> Candida albicans <400> 33 atggattacc aagatctact acataaaata ataaaggagt tccactcact caaagagttc 60 aaaccatggg atagcagtgt tttgtatgag acgttacttc gatcagtatt aactactttg 120 atcgaacttt tgggcataga caatccaccc agttatctac acctcaccac caacaatgat 180 agtataggtgatttgaaaataaaatactatggaaatgcattaagcaagtcaatcaacggt 240 catagcatgttgcaatatcttgaatcaaagcatgtatcgatattacaggccgtggttgag 300 attattaatacgcgatcatatagaatcaaagagtcttattctgctgttttcaaagacgtt 360 tctcatttatttgaaaaactactaaaggaaagatatgaagctgaatctaatctagaggat 420 tatatattgcagtgcttgatgtacgagacccaattttaccaaggaattgttgataatgtt 480 ttaactgccgatgacaccgaaaaattggctagttttttggggacacgactatctgaagaa 540 gattcgatgtttagctatagggatatagattatccactagagttaaacattaataatgaa 600 tctcttgaaaagatatataaaattttcttaggagtcattggcaccaaaagattcgatatc 660 aaggaggttgcgtctgctgttgttggtgtgtataaacgacaccagagaatagatcatttt 720 gaaaagttggattcagatgagattttgggaaagtttttcagaaatatattgccacaactg 780 ttccagagtgtgacaaataaggttttccgggaatttcacaaagaggtagatgacccacca 840 tcggacgtgctagaccagctagataatattgttgatgactttattgcggttggaattgaa 900 ggggtagatttgggctttccggctttgttcagacactacataaaattcatgaacgaaatt 960 tttcccactgtggtcgaggatgctgaccgcgattttgttgcaagaattaatagtttaatt 1020 gctcaagtcttggagtttaaagacgatgaaaaatcctgtgatatcaatcaagtggtatct 1080 gaatttgtttcattacaaagtttgctacttaagaataactatctttcaccatctacatta 1140 ttgatgcgtgcaagtactcacgattactataaaaatttacagatcgtgaaaataaccttt 1200 gatggatggaatgagaattcaaagaggatattgaaattggagaacagcggctttttacaa 1260 agcaagacattgccaaagtatttaaaattatggtactcaaaaagtatgaagttgaatgaa 1320 ttatgtaaccgggtagatgaattttataatggagaactttgtcggaaagtttggcattgt 1380 tggaggtcacaacaaaatgtctataatctcaaaatggaggttgctgacaaacgtctccta 1440 aatcaatattatatcaaatggcggaaaaaagagaaggatatgaaagccaatcttactata 1500 gctgttgaatttgatcattttcatttattggataaaagctttaagatattgaaagggtac 1560 ttcaacttggccaaaaacagtgatgtcctcgcaatgtctctatttcagtcatttgaggag 1620 aatcgcgacagccgtatcaagttgaagtattttcaatactggaatctaaaaatatctgat 1680 agagtacacggcttgactatgaaattagagaagtttcaccaagttaaggacaaatttgta 1740 ttaggaaattattttgaaacatggtattataaacataatctcgttgaaaagtctaacaat 1800 ttcgtttctgctaaagatttgcagttattggcgaaaacttttaccaatacatggctaaag 1860 aaattcttgctatacaagaaagcattcaaaattgaagaagagcttggcgctgatttaaaa 1920 aggaaaacttttgatagatggaaggaggctgtccaacttgaagtcaaggcaaaggagttt 1980 cacgagcgacatcttctagagactgcatttcatgaatggaagttgaaactgattttgata 2040 agtaacagggcttcatttgatcatattttggtacagcgttgctttcaaacttggtccgtg 2100 gaaataaaacttcgagaactacagcaaaaacaagatactcgtttggtagtgaacattttt 2160 caaaaatggagaaccaggcaactcgagctagcaaaacttgacgaaaagtctcaggcattt 2220 tatgaatcaaatatgaaacatttggtagtgcaaaaatggaatgtcgaaaacagtaatatt 2280 ggactattagagaaacgagcagatcgatttttcattcgaagatttttcatccagaaatgg 2340 caatcaaaaatgacaaagtatgaggacatcactgtttatcacttggaagatgaaattgcc 2400 acaaaattagcctacaaagtatggaggcagagatattttgaaaactacgaagaaaagttg 2460 gataacttacttgaaacaatggataccagtgcagcagatactgtacgctgttcgcgatat 2520 ttcggtctatggcgggccaaattgcagaccgtgaagcaaattgaagaacgcgtatctacg 2580 tctgtagcacctagtgttgcaatacattttaaaaactggcacgtcaagagccagcagaag 2640 caagagttattggaaaatgccttgcagtttgaagaaataaacttgtcgcgttttcttctc 2700 atttggtttcagcgtctacaagaagtgagtcagttggaagatcaggcagaggacttattg 2760 gctcaaactaatttcaatttactacgtaatgctgttcataaatggtctatgctctacaac 2820 aaaaacatcaagcgacataaacaattgtgtgaggattttatagcaagaaaagagacggca 2880 aaagtcagatctatttttgatttatggctatacaagatcaaagaaatcgaagccaatacc 2940 accatcataagcaatccttcacctctttccaaaagatttcagcatcaaagagagatgggc 3000 ttgacccctcaaaagaaaaactctcctaccaaagtttttacccccaccacttccaaagat 3060 ccgagtccaactaaactccaagaaactacccaaagaatgagaaaccagaacattagtgct 3120 ttgagggagcattttggaagggcacgggcatcgtctacacctaaaaagttatctcctgtc 3180 cggctctcgtatactaatattccttccaatcttcggccgcaactgccaccaaaattcgat 3240 gattcagatattgctactgccaagagtttgggtcgtatcagacccatggtgtttccaata 3300 gatgatcaagcaaatttttcacctatggatagaacaaaattacaatctagaaatgctatg 3360 tag 3363 <210> 34 <211> 2238 <212> DNA

<213> Candida albicans <400> 34 atggctaaacgaaaaagtaaacaacaagatttagaaaaaaagaagaaacttaaacaaagt 60 caagatgaacaattatctacgggattgttcaataatgttggacagggacaacaccaaggg 120 gatgatgacgatgaagaaggtgatgaaatagattgggataatcaagagatggattatgaa 180 ttaataccaaggaaaatcaccaccaagaaaacaattgaagcattaccaattaaaaaatcc 240 gacgggactatagaaagagttgttagagaagttgaagaagaagaagaggaagaggaagag 300 gaagagcctgaagaagagcctgaattagaaaatgatgttgaaaatgaaccatcaaaacaa 360 gaaaacaaagaaaataaagaggagggggatattgataccgacgacacattaacaccacaa 420 gaaaagttaattcaaacaaaagaagaaattgcagaattaggatcaaaattaattgaagat 480 cctgaagaaaatatagtttgtcttactagattaagaaaaatgtctgaatcgaaaaatttc 540 atgacatctcaattatcaatattagcattaataccaatttttaaatctcttgctccatct 600 tataagataagaccattaactgatactgaaaaaagagaaaaagttagtcgtgaaatagct 660 aaattaagaaattttgaacaaaatttagtgataaattataaagcttacattgaattatta 720 acaaaatatctgaaaatatcatattcaaattctatgaataataataaaatcactagtgat 780 caattgaaacgaggcaatattgctttaaaagcagccactgaactttgtttaagttcatta 840 agacattttaatttccgagaagaattatttactattattattaaacgattaaataaaaaa 900 cctcaacatcaacaagattatccaatatttataaaatctttaagagttttagaaacttta 960 ttaaaagatgatgctgaacatggagatattacttttgatataataaaaatcatgacaaaa 1020 tcaattaaagataaaaaattccgagttgatgaatcagttgttaatgtttttttatcaatt 1080 tcattattagaagattatgatcctaataataataataataataaagatgatcatcacaac 1140 accactttaaaaccaaaattaaaaaaaaaggatcgaattcatttatctaaaaaagaacgg 1200 aaagctcgtaaagaaagaaaagaaattgaagaagaaatacaaaaggctgaacaagccatc 1260 actgttgaacaacgagaaaaatatcaagctcaagtattaaaaatggtattaactttatat 1320 ctagaaatattaaaagcagggtcgtctagttcacaattaattgatggtgatggtaaaaaa 1380 actaaaaatgatgctagtttgttaatgggggcggttttagaaggattatcaagatttggt 1440 caaatgtcaaatttagatttattaggtgattttttggaagtattaagagaaattatgacc 1500 gatatcattgaagaacataaacaaagtggtgataatgataatgataatgataatgatgat 1560 gaaagtggggggatgtatagtgggaatgaattaagaacaatattattatgtattgccaca 1620 tcattttcattagtattaaatcataattctatggggaaattacctatggcaatagattta 1680 agtaaatttgtttccacattatatattattttaaccgatttggcattagatcctgattta 1740 gaatttagtcataaaacattaagattagctgatccattatcatcatcatcattatcaaat 1800 gaattagagaataataaaccagcagttaatgtttcaactaaagcagaattattattaaga 1860 tgtcttgattttatttttttccgatcgaaaaatggtactatacctcgagcaacagcattt 1920 attaaacgattatatatattaacattacaaacaccagagaaaactagtttggccaatttg 1980 aaatttattggtaaattaatgaatagatatggtgaaaatattaaaggattatggaacacc 2040 gaagaaagaattagtggtgaaggaaattatattttaggaattgaacgacaaaataaagat 2100 aaagatgttgaattagaacgaagtaatagtggtgcagcaacattatgggaaaatgtatta 2160 ttagataaacattattcaataatgattaaagatggttcaaggtcgttaatgaaaaatagt 2220 aaagccaacaccaattga 2238 <210> 35 <211> 1740 <212> DNA
<213> Candida albicans <400> 35 atgtatataaccccgaaccaatatgcaaagacgttccaagatataaaacgctcatcatta 60 tctcactccacctgtaaacttgttatatttgtttcttgcttagatgtggatgcattatgt 120 gctgccaaaattttgagtttacttttaagaaaagaattaatccaatatcaattaattcct 180 acaacaggatactcggatttaaaattgcattatgataagttggatagtgaggtcacaaat 240 ataatactaattggatgtggtgccatgttggatttagaaggatttttcgatgtcaatcca 300 gaagagtttttaggtgataattctactaccaatggccacacaatagataacgacactgaa 360 ttagaactagatgcagtgaaaactgacaattttgccttgacaagaaaaatctatgttgta 420 gatggacacagaccgtggaatttggataatttatttgggtcggccatggttgtttgtttg 480 gataatgggtatattgatgggaacttgaacgaagaaaaggaagcatacaatgtgttggta 540 gaaatgagtatagtgaagag gatgaagggcacaaccagaacggtcatact 600 cgaagatgaa gatgatgaccaagagggagacaaaactgatgctgatgatgaaaatgacgaatcaagtgtt 660 tcaacatcacgcaaaggagttaaatccatcaatgaagataagattcagacatattacaac 720 cagtcatcaacaatagcaagctcatgctcgataacagtttatgcattagttagtgccatc 780 ggtgagaccaatgttgacaacttatggttaggcattgtcggtgccagtggatttgattgt 840 tctatatttgtcgacgaagtgaggcgtttctcgaccgattctggtattcatatggaacgt 900 gggacgtaccttccgttgttgcgacattcttctctttacgatgccttgctttataactgg 960 attgacggtgacaagagaatacacaagattcttgcaaaaatgggtgttccgattgttgct 1020 gcaaaacaacaatggcaatatttagatccaccaatcaagaacaaactacctggattattg 1080 aagaaatatctacctgaactcccacaagttgaaatattttaccgatgtggtgtcacgtcc 1140 atggacgtgtttgtttcattaactgcattattagagaccggggttggtctcaacaatact 1200 agtgctaatagtattgaccatggtgaccttgaagatgaaaatgaactaattcgaagagaa 1260 attaaaagcagagagtcaagctacattcgaaatttttggtcagcctttgattcagtaagt 1320 tcttttgggatttccaacaacattggattagaaaagggaataacagcagcaaaattggtt 1380 caaaaagaattattccaaactatcaaatacataattgaacaaaaattaattaaaaattta 1440 aaagtttatcgactttgcattttaaaagatgagtcctcgcatctgggttttgataatcca 1500 gtattgttaattaaattgtctaatcgtatcatggattatttaaaacaacaaacactgaaa 1560 cctttagtggtagcagcagaactttccaatacatatttcgttttgggtatgggaattaac 1620 aatgcattttctaaaatttctggtgcccaaatgaagaaggatttctttgaagcatcatta 1680 gtggaaattaaaaaggaagatttggctccatttttggaacagttgaccttcaatttataa 1740 <210> 36 <211> 5694 <212> DNA
<213> Candida albicans <400>

atgtcgtataacgataataataatcattattacgaccctaatcaacagggcggtatgcca 60 cctcatcaaggaggagaagggtattaccaacaacagtatgatgatatgggtcaacaacca 120 caccaacaagattattacgatccaaatgctcaatatcaacaacaaccatatgacatggat 180 ggatatcaagaccaagccaactatggtggtcaaccaatgaatgcccagggttataatgct 240 gacccagaagccttttctgactttagttatggtggtcaaactcctggaactcctggttat 300 gatcaatacggtactcaatacaccccatctcaaatgagttatggtggtgatccaagatct 360 tctggtgcttcaacaccaatttatggtggtcaaggtcaaggttacgatccaactcaattc 420 aatatgtcatcgaacttgccatatccagcttggtctgctgatcctcaagctccaattaag 480 attgaacacatcgaagatattttcattgatttgactaataaatttggtttccaaagagat 540 tctatgagaaacatgtttgattactttatgacattgttggactcgagatcttcccgtatg 600 tcaccagctcaggccttgttgagtttacatgctgattatattggtggtgacaatgccaat 660 tatagaaaatggtatttttcttcacaacaagatttggatgattccttaggttttgctaat 720 atgactttaggtaaaattggtagaaaagccagaaaagcttccaagaaatccaaaaaagct 780 agaaaagctgctgaagaacatggtcaagatgtcgatgctcttgctaatgaattagaaggt 840 gattattcattggaagccgctgaaatcagatggaaagccaagatgaactctttgactcca 900 gaagaaagagtaagagaccttgctctttatttgttgatatggggtgaagccaatcaagtt 960 cgttttactcctgaatgtttgtgttacatttacaaatctgccactgattatttaaattct 1020 ccattgtgtcaacaaagacaagaaccagtgcctgaaggtgattacttgaaccgtgtgatc 1080 actccactttacagattcatcagatctcaagtttatgaaatttatgatggaagatttgtc 1140 aagcgtgaaaaagaccacaacaaggtcattggttatgatgatgtcaatcaattgttttgg 1200 tacccagaaggtatttccagaattatttttgaagatggaaccagattggttgatatccct 1260 caagaagaacgtttcttgaaattaggtgaagttgaatggaagaatgttttcttcaaaact 1320 tataaggaaatcagaacctggttgcatttcgttaccaattttaatagaatctggattatc 1380 catggtaccatctactggatgtacactgcttacaactccccaaccttgtatactaaacat 1440 tatgtccaaaccataaatcaacaaccacttgcttcgtcaagatgggctgcttgtgccatt 1500 ggtggtgttcttgcttcatttattcaaattcttgccacacttttcgaatggattttcgtg 1560 cctagagaatgggccggtgctcaacatttgagtcgtcgtatgctatttttggtgttaatt 1620 ttcttactcaatttggttccaccagtttatacattccaaattaccaaattggtgatttat 1680 tcgaaatcggcatatgctgtgtcgattgttggatttttcattgctgtggccactttagta 1740 ttctttgccgtcatgccattgggtggtttattcacttcatacatgaacaagagatcaaga 1800 agatatattgcatcacaaacatttactgccaactacattaaattgaaaggtttagatatg ~

tggatgtcttatttgttatggtttttggttttccttgccaaattggttgaatcttatttc 1920 ttctcgactt agaaacttgtcgaccatgac 1980 tgtctttaag aatgagatgt agatcctatt gttggtgaag tgtagaaaccaagccaagat 2040 tttggtacaa tgtcttgggg agatattgtt ttgatgtatcttgttgatttgttattgttctttttggatacttatatgtg 2100 gtacattatt tgtaactgta tggtcgttcattctatttgggtatttccattttgactcct2160 tcttctccat tggagaaacattttcaccag agaatttattccaagattttagctaccacg2220 attgccaaag gaaatggaaatcaaatataaacctaaagttttgatttcacaaatttggaatgccattgtt2280 atttccatgtacagagaacatttgttagccattgatcacgttcaaaaattattgtatcat2340 caagttccatctgaaattgaaggcaagagaactttgagagctccaactttctttgtttct2400 caagatgacaacaattttgaaacggaatttttcccaagaaattctgaagctgaaagaaga2460 atttcatttttcgctcaatctttggctacaccaatgccagaaccattaccagttgataat2520 atgccaacttttactgttttcactcctcattattcggaaaagattttgttatctttgaga2580 gaaatcattagagaagatgatcaattctcaagagtgacattattggaatatttgaaacaa2640 ttacatccagttgaatgggattgttttgttaaggacaccaagattttggctgaagaaact2700 gctgcttatgaaaatggtgatgattctgaaaaattatctgaagatggattgaaatccaag2760 attgatgatttaccattctattgtattggtttcaagtctgccgcccctgaatatacttta2820 agaacaagaatttgggcttcattgagatcccaaactttgtacagaactgtatctgggttt2880 atgaattatgccagagccattaaattgttatacagagtggaaaacccagaattggttcaa2940 tatttcggtggtgaccctgaaggattagaattagctttagaaagaatggccagaagaaag3000 tttagatttttggtttctatgcaaagattgtctaaattcaaagatgatgaaatggaaaat3060 gctgagttcttattgcgtgcttaccctgatttgcaaattgcttacttggatgaagaaccg3120 gctttgaatgaggacgaggaaccaagagtatactctgccttgattgatggtcattgtgaa3180 atgttagaaaatggtagacgtcgtcctaaattcagagttcaattgtctggtaatccaatt3240 ttgggtgatggtaaatctgataatcaaaatcatgcggttattttccatagaggtgaatat3300 attcaattgattgatgctaatcaagataattatttggaagaatgtttgaagattagatca3360 gttttggctgaatttgaagaaatgaatgttgaacatgttaatccatatgcaccaaatttg3420 aaatctgaagataataacaccaagaaggatccagtggcatttttgggtgctagagaatat3480 attttctcagaaaattctggtgttttgggtgatgttgctgctggtaaagaacaaactttt3540 ggtacattgtttgcaagaactttggcacaaattggaggtaaattgcattatggtcatccg3600 gattttttgaatgctacatttatgttaactagaggtggtgtttctaaagcacaaaagggt3660 ttacatttgaatgaagatatttatgctggtatgaatgccatgatgagaggtggtaaaatc3720 aagcattgtgaatattatcaatgtggtaaaggtagagatttaggttttggatccattttg3780 aatttcaccaccaagattggtgctggtatgggagaacaaatgctttcaagagaatatttc3840 tatttgggtactcaacttccattggatagatttttgtcattttactatggtcatccaggt3900 ttccatattaataacttgtttattcaattgtctttacaagtgtttattttggtgttgggt3960 aacttgaattcattagctcatgaagctatcatgtgttcttacaacaaagatgtcccagtt4020 actgatgttttgtatccatttggttgttacaatattgctcctgccgttgattggattaga4080 cgttatactttgtctattttcattgttttcttcatttctttcattccattggttgtacaa4140 gaattgattgaaagaggggtatggaaagcgttccaaagatttgttagacattttatttcc4200 atgtcaccatttttcgaagttttcgttgcccaaatttattcatcatcggttttcactgat4260 ttgaccgttggtggtgctagatatatttccactggtagaggttttgccacttcaagaatt4320 ccattttcaatcttgtattcacgttttgctgattcatccatttatatgggagcaagattg4380 atgttgattttattatttggtacagtttctcattggcaagcaccattattatggttctgg4440 gcttcattatcggctttaatgttctccccattcattttcaatcctcatcaatttgcttgg4500 gaagactttttccttgattacagagatttcattagatggttatctagaggtaacactaaa4560 tggcacagaaactcatggattggttatgttagactttctagatcacgtatcactggtttc4620 aaacgtaagttgactggtgatgtttctgaaaaagctgctggtgatgcttcaagagctcat4680 agatccaatgttttgtttgctgatttcttaccaacattgatttatactgctggtctttat4740 gttgcttatacttttattaatgctcaaactggggttactagttatccatatgaaatcaat4800 ggatctactgatccacaaccagttaattctactttgagacttattatttgtgctttagct4860 ccagttgttattgatatgggatgtttaggtgtttgtcttgccatggcatgttgtgctggt4920 ccaatgttaggattatgttgtaaaaagactggtgctgttattgctggtgttgcccatggt4980 gttgccgtcattgttcatattattttctttattgttatgtgggtcactgaaggtttcaat5040 tttgccagattaatgttgggtattgccaccatgatttatgttcaaagattattattcaag5100 tttttgacattatgtttcttgactagagaatttaagaatgataaagccaatactgctttc5160 tggactggtaaatggtataatactggtatg cttttactcaaccatctcgt5220 ggatggatgg gaatttgttgctaaaatcattgaaatgtcg gtgatttcgttttggcacat5280 gaatttgctg attatattattctgtcaattaccattattg tagttgatagatggcattca5340 tttattccat atgatgttattctggttgaaaccatcaaga caccaatttattctttgaaa5400 ttgattagac caagccagattaagaaagagaatggtgagaaaatattgtgttttatattttgccgtgttg 5460 atattatttattgtcattattgttgcaccagcagttgcttcgggacaaattgctgttgat 5520 caatttgccaatattggtggatctggttctattgctgatggattattccaaccaagaaat 5580 gtcagtaataatgatactggtaatcatagaccaaaaacctacacttggagttatttgagt 5640 actcgttttactggaagtaccaccccttattctacaaatccattcagagtttaa 5694 <210> 37 <211> 1203 <212> DNA
<213> Candida albicans <400>

atgtctttcagaactacttccatgagaatggctagattagccactgccaaagctactttg 60 tccaagagaaccttctccttattggccaatgctaccaccagatacactgctgcttcatct 120 gctgctaaagctatgactccaatcacctcaatccgtggtgttaaaaccatcaactttggt 180 ggtaccgaagaagttgtccacgaaagagctgattggccaaaggaaagattattagactat 240 ttcaaaaacgacacctttgctttaattggttacggttcccaaggttacggtcaaggttta 300 aacttgagagataacggtttaaacgttattattggtgttagaaaaggttcttcttgggaa 360 gctgccgttgaagatggttgggttccaggtgaaaacttgtttgaagttgacgaagctatt 420 tctagaggtaccatcattatggacttgttatcagatgctgctcaatctgaaacctggttt 480 cacattaaaccacaattgactgaaggtaaaaccttgtacttctcccacggtttctcccca 540 gttttcaaagacttgactcacgttgaaccaccatcaaacattgatgtcatcttggctgct 600 ccaaaaggttctggtagaactgtcagatctttattcaaagaaggtagaggtatcaactcc 660 tcatacgctgtctggaacgatgttaccggtaaagctgaagaaaaagctattgccatggcc 720 attgctattggttctggttatgtttacaagaccactttcgaaagagaagtcaactccgat 780 ttatatggtgaacgtggttgtcttatgggtggtatccacggtatgttcttggctcaatac 840 gaagtcttgagagaaaacggtcacactccatctgaagctttcaatgaaaccgttgaagaa 900 gctactcaatcattgtacccattgattggtaaatacggtatggactacatgtacgatgct 960 tgttccactactgccagaagaggtgctttggactggtacccaagattcaaagatgctttg 1020 aaaccagttttcgaagaattgtacgaatctgttaagaacggttctgaaaccaagagatct 1080 ttggaattcaactctagatctgattacaaagaaagattagaagaagaattacaaactatc 1140 agaaatatggaaatctggagagttggtaaagaagttagaaaattgcgtccagaaaaccaa 1200 tag 1203 <210> 38 <211> 837 <212> DNA
<213> Candida albicans <400>

atgttcaaacaatccatacgtagtctagctaccaagtcaccaatttcaagtgctgctgcc 60 acgaccaccaccgctagtaccaccagcactaccaccacagcttccttgaattttgcaaaa 120 ccaccatcttatacattagctcaattacgtgaattcccaagtttagaaccaaaaacattt 180 attccattaccaacgacatttttcaacaccgaaaaacctattcgtagagatatattatgg 240 agttgtgttacatatgaagccgataaggcccgagtaggatcaaattatgcaattttaaaa 300 tcggattcaccttattctaatcgtaaattacgtcctcaaaaaggttcaggtcgtgctcgt 360 ttaggtgatgccaattctccacatatggataatgaaattaaagctcatgctataaaggga 420 cctcatgattggagtactgatttacctagtaaaatatattctcgtggtattcaaaatgct 480 tttactatgcattataaacaaggaaatttaaatgttgttgaaaatgaattagatttccaa 540 tatggatatgatattataactcaactgtttgtttcagtgcataatttgaataaattgaat 600 ttattatttataactaatgaaccaagagataatttaatggaaagtattaaaaaattctac 660 attaatgaaaaagaatttaattcattaaataaaaaggaaaaaccaaaatatttacagaaa 720 ttaaaaggcaaagtattgacaaaggaagatgttgaagttagagatatattaagagctcat 780 agagtattcattgaatcttctgctttacaatggttcatcactaaacatactgtttaa 837 <210> 39 <211> 1347 <212> DNA
<213> Candida albicans <400>

atgagagaagtcatcagtattaatgttggtcaagccgggtgtcaaattggtaacgcctgt60 tgggaattgtattcacaggaacatggtattagaccagatgggtatttacaagaaggttta120 gacagaccaaagggaggagaagaaggtttttctacttttttcagtgaaactggttcaggt180 aaatacgttcctcgtgccttgtatgttgatttggaaccaaatgtcattgatgaagttcgt240 actggtgtttacaaagatttattccaccctgaacaattgattgccggtaaagaagatgcc300 gccaataatt atgctagaggtcactacactgttggaagagaaattttagacgacatttta 360 gatagagtca gaagaatgagtgatcaatgtgacggattacaaggtttccttttcacccac 420 tctttgggtg gtggtaccggttccggtttgggttctttgttattggaacaattatctttg 480 gattacggta aaaaatccaaattggaatttgctgtttacccagctccacaagtgtccact 540 tcagttgttg aaccatataatactgtgttgactacccacaccactttggaacacgccgat 600 tgtactttta tggttgataatgaagccatctacgatatgtgtagaagaaacttggatatt 660 gccagaccaa attttagttcattgaacaacttgattgctcaagttgtgtcatccgttacc 720 gcctctttga gatttgacggttccttgaatgttgatttgaatgaattccaaactaacttg 780 gttccatacc caagaatccatttcccattggtcagttatgctccagttttctccaagagt 840 agagctaccc atgaagccaactctgtttctgaaattactcaatcttgttttgaaccaggt 900 aaccaaatgg tcaaatgtgacccaagaactggtaaatacatggccacctgtttgttatac 960 cgtggtgatg ttgttactagagacgttcaaaatgctgttgctcaagttaaatctaaaaag 1020 actgttcaat tagtcgattggtgtccaactggtttcaagattggtatctgttaccaacca 1080 ccaactgcca ttaagggatctgaattggccagtgcttctagagctgtttgtatgttgtct 1140 aacactactg ccattgctgaagcttggagaagaattgacagaaaattcgacttgatgtac 1200 tctaagagag cctttgttcactggtacgttggtgaaggtatggaagaaggtgaattcact 1260 gaagctagag aagacttggctgctttagagagagattatattgaagttggtactgattct 1320 ttccctgaag aagaagaagaatattag 1347 <210> 40 <211> 828 <212> DNA
<213> Candida albicans <400>

atgaaaacgtcagtatttatagcaatcttcaatttacttgtttgcgctcttgcgtacaca 60 gacttgacaggatcaattaaaatcaatgacaaaaagattacccttggtgagttcaatact 120 caagaagttaaacaattgacaatcaattctccaaaggatataatagaaattgacttaaaa 180 agtaaagatatcaagggtaaacctgagcagattatggttagtttggcagatgtcaaaaac 240 ccagctatttctacgcattatgttcctgtggtcaaagaatcgaaaatcaagttgaacatc 300 aaagcactttcaatcccggaagttttgaaaactaaagacaaattagttttgactattgta 360 attgccgactcaaaatcaaagaataacatgattagaagattggttgaagttttgccaagt 420 cccgagtttaagagtacaagcaggtaccaggctaaaccaagaattggaatacaaccagag 480 atccatcacattttcagagaggatgagaggactgttaacccaattgtgccagttgtattt 540 ataattgcagcttttactttacttcttggtttgtttggctcgtgggttggttttattgga 600 attgataatttatttagaacgttcaagactattagtaaagttcaattgttacacaacgtt 660 agctttttgatttcagttttggggtttgaattgaattttgtcaagtactatttgggtcaa 720 tcaattttcaccactttgttttacggatttattttgagcattccatgtgtttactttgga 780 gtcagcgttttgagaagtttagcaaaaaaccgtgctttaggcaagtaa 828 <210> 41 <211> 582 <212> DNA
<213> Candida albicans <400> 41 atgctaatgt acaccatcct tataccaagc cttttataca ttgctttgac aatcgcatca 60 tccgagttattgaattccatacagggaacatggcaaagtcaaagtgaacgagtaattact 120 ggaccaactttttttgatccccagaaggaattgctagaagaacctaagctaccaggtata 180 tcatattcatttaaaaatggatactgggaactggcacaatatattgtcatggggaataat 240 agaaaccaccaatgtcctcaagcaatgttaatttggcaacatgggaaatataatttaaaa 300 cgaggaaaacttgtgcttattcccaatagaaatgacggtcgacaattaatcagcgatcct 360 tgtttggataatggtaaatctgaatataaaaggtttcataacggagaaacattagaagtt 420 gatattagatttgatggatattttggtaattggaagttggttttggtagattatcttaca 480 ggtaaaaagaagcaaccaatgtggttgacactgagaaatgccacaatgttgcccacagga 540 accataacctctacaaagaggaaatatgttaaaaaagagtag 582 <210> 42 <211> 1299 <212> DNA
<213> Candida albicans <400>

atgtcaaaagcatttagtgcacctggaaaagcatttcttgctggtggatatttggttctt60 gagccaatttatgatgcttatgtgacagcattgtcatcacgaatgcatgcagttataaca120 ccaaaaggaaccagtttgaaagaatctagaatcaaaatttcttcaccccaatttgcaaac180 ggagaatgggaatatcacatatcatcaaatacagaaaaacccaaagaagttcagtcacgc240 ataaatccatttttagaggcaactatattcatcgttttagcttatattcaaccgaccgaa300 gcatttgatcttgaaatcattatttactcggaccctggatatcattcacaagaagatact360 gaaaccaagacatcctcgaatggagaaaaaacttttctttaccattctcgtgccattacc420 gaagtggaaaagaccggattaggttcatcggcaggattagtgtcagttgttgccacaagt480 ttattatcccattttatccccaatgttatcagtacgaataaagatattttgcacaacgtt540 gcacagattgcacattgttatgcccaaaaaaagataggatctgggtttgatgttgcaact600 gcaatttatggtctgattgtatatagaagatttcagccagctttgataaatgacgtgttt660 caggttctagaaagtgatcctgagaagttccccacagagttgaaaaaattgattgcaagt720 aactgggaattcaaacatgaaagatgtacattaccacacggaatcaagttattaatgggt780 gacgtcaagggtggctcagaaacacccaaattggtatcacgagtactccaatggaaaaag840 gaaaagccagaagaaagctctgttgtgtatgaccagcttaatagtgccaatttacagttt900 atgaaggaattgagggaaatgcgtgaaaaatacgactcagacccagagacttatattaaa960 gagttagatcattctgttgagcctttgactgttgcgattaagaacatcagaaaagggtta1020 caagcattaacacaaaaatcagaggttccaattgaacctgatgtccaaacccagttgttg1080 gaccgttgtcaagagattcctggttgtgttggtggtgtggttccaggtgctggtggatac1140 gatgcaatagctgtattagtgttggaaaatcaagtgggaaattttaagcagaaaactctt1200 gaaaatccagattattttcataatgtttactgggttgatttggaagagcaaacagaaggt1260 gtacttgaagaaaaaccagaagactatataggtttataa 1299 <210> 43 <211> 2307 <212> DNA
<213> Candida albicans <400> 43 atgtcggacctaactccaattaaacttccttcgtccgctccatttccggttgtcatatca 60 tctgtattatgcaaacctggagatacaatttccaagcacaagactatattcaagtacaaa 120 tactgggactaccaagatgatccaacttcaaaggaggacccacctaagaaaatacgagta 180 gaacggttaggtacatttgagagtcccatagaaggcgaaattgaccagattaacatcaag 240 ccattgcaagaagtgatgcatagtgatgtggatttgttatttgttaaagaagcatgtcct 300 catactgtgcaatacagtgggttatgtgcattatgtggcaaatccttagaagaagaaaag 360 gattattcaggatacaattacgaagacagggccacaattgaaatgtcccatgacaacact 420 ggcttgaaaattagttttgatgaagcagctaaaatcgaacacaacacaactgaccgatta 480 attgatgaaagaaagttgattcttgttgttgacttggatcaaactgttatacatgccacc 540 gtggacccaactgttggagagtggcaactggacccagccaatcccaactatgctgctgtc 600 aaagacgttaagacattttgtttggaagaagaggcaattgttcctcctggatggacaggt 660 ccgaaattggctccaacaaaatgcacctattatgtcaaactccgtccagggttgctggag 720 tttttggagaaaatggctgagaaatatgaaatgcatatttacacaatggccacaagaaac 780 tatgcgttatcgattgctaaaatcattgatccagatgggaaatattttggtgatagaata 840 cttagtcgtgatgaaagtggttctttgactcataaaaacttgaagagattgttccccgtg 900 gaccaatcgatggtagttattattgatgataggggagatgtgtggcaatgggaaagcaat 960 ttaattaaggtggttccctatgatttctttgttggtattggagacatcaattcgagtttc 1020 ttaccgaagaaaaatggtcaattaacaggaccaaccaaaaagaggaaatctatagccaaa 1080 ttagaagctgctgctgaactagccaaggaatcagataccaataatgacaagcaagagact 1140 gaatcgggggaagaagagggtgaagaagatgctgatggtcactcggacgtgtcaaactcc 1200 cctgttgaaagaatccttgaactcggaggaggtgaaggaaacactagtttattgttggaa 1260 caatcattgacaagaaatcagtcaatagaagaacaacaacagaagcgtccattagcaaag 1320 ttgcaacacgatttggaacaaatgcatgagcatcgccacgatagtgatagcaagtcagag 1380 agtggttctgatgatgagagtgatgaagaagacaatttgttatttgatgatgataatgaa 1440 ttagcagccttggataaagtcttggggaatatccatcaagggtattataacttgtttgat 1500 aaagacaaaatcaacaaaccggatttgactgaaatcataccgtcaatgaaaagcaagaca 1560 ttggaagggataacggtcttgttctcgggt-attattccattgggaattaatttggattct 1620 gccgatatcgtgatatggtgcagacaatttggtgtgaaagttgtcaatgaagtgtaccca 1680 gaagttactcacgttgtttgccgcgatgttagtgaaggtgctggaccaacattcaagacc 1740 agagttgcaagaaaactatatcctgacactatcaaaattgtcaatccagattggctattt 1800 gcatgtttgagtaactggacaaaagttgatgaaaaagattatttgatttcaactgatgat 1860 acaaagctttggaccgtgaaagagaatgagattaccaagtaccagaaagctttggaagac 1920 agaagtgctttggcaaatgctactcatattgattctattgagtcatttgatgagtacgat 1980 ttggatgaagctaatcaagaagttgatgatttcttggcagggttaagtgatgatgatgag 2040 gaagaagaggaggaagaagaagatgaagagatcgagaatccagaatcaaataatgatgat 2100 gaagaaatctatgagcaatcaaccaatggacatgattcatttatcaaggatgcttatagt 2160 aagaagagaaatagagatgaagaggaggtacaacttgttaaaaagcaaaaaatagaaaat 2220 ggagaaaatggagaaaatgaaaatgaaaatgatttagacgatttggaaaaagaactactt 2280 gacggttttgacgacttggaagaataa <210> 44 <211> 3129 <212> DNA
<213> Candida albicans <400> 44 atgggtaaaaaagcaattgatgcacgtattcctgccttgatacgtaatggcgttcaagaa 60 aagcaaagatcttttttcatcattgtgggtgataaagctcgtaatcaattaccaaacttg 120 cattatttgatgatgagtgctgatttgaagatgaataagtcagtattatgggcatacaag 180 aaaaaattattaggcttcacctcccacagacagaagcgtgaagcaaaaattaagaaagac 240 ataaagcgtggaattagagaagtcaacgaacaagatccttttgaagcatttatatctaat 300 caacatatcagatatgtttactacaaagaaactgaaaaaatcttgggtaacacttacgga 360 atgtgtattctacaagattttgaagccatcacccctaatttgttggctagaacaattgaa 420 acagtcgaaggtggtggattagttgttatcttgctcaagaatatgacatcattgaagcag 480 ttatatactatgtccatggatatacattcaagatacagaactgaagcacatgatgatgtt 540 gttgccagattcaatgaaagattcttactttctttagggtcttgcgaaaattgtttagtt 600 gttgatgatgaattgaatgtcttacctatttcagggggcaaacatgttaaaccattgcca 660 cctaaagacgacgacgaattgactcctaatgccaaggaattaaaggagttgaaagagagt 720 cttgctgacgtacaacctgctgggtcattagtggccttgtccaaaactataaatcaagca 780 caagcaattttgacttttattgatgtcatctcagaaaagacattgagaaatacagtcaca 840 ttaactgcaggaagaggtcgtggtaaatctgctgctttaggtattgctattgctgcagct 900 atttcccatggatattccaatatttttgttacttcaccatcacctgaaaacttgaagaca 960 ttgtttgaatttattttcaaaggttttgatgcattaggatataccgaacatatggattat 1020 gacattattcagtctactaatccatctttcaacaaagctattgtcagagttgatgttaaa 1080 agagaacacagacaaacgattcagtacatttctccaaatgatagtcatgttttaggacaa 1140 gcagaattattgattatcgatgaagcagcagccataccacttccaatcgtgaaaaaattg 1200 atggggccctatttgatttttatggcttctaccattaatgggtatgaaggtactggaaga 1260 tcattatcattgaaattgattcaacaattgagaactcagtccaataatgcaacaccttca 1320 gaaactaccgtggtatccagagataagaaatccaatgaaattactggagctttgactaga 1380 acattgaaagaagttgtattggatgagcctattagatatgcaccaggcgaccctattgaa 1440 aaatggttaaataaattgctttgtcttgatgtttcattatctaaaaatgccaagtttgca 1500 acaaagggcactccacatccatctcagtgtcaacttttctatgtaaatagagatactttg 1560 ttctcctatcaccctgtctctgaagcattcttacaaaagatgatggcattgtatgttgct 1620 tctcattacaaaaattcacctaatgatttacaattgatgagtgatgctccagcacatcag 1680 ttattcgtgttgttacctccaatagaggcaggtgataatagagtacctgacccattgtgt 1740 gttattcaattagcattggagggtgaaatatccaaagaaagtgtaagaaaatctttatct 1800 cgtggacaaagagccggaggggatttgataccttggttaatctcacaacaattccaagac 1860 gaagaatttgcctcattgtcaggtgcaagagttgttagaatcgctacaaaccccgaatac 1920 tctggtatgggttatgggtctagagcaatggaattattgagggactattactccggtaag 1980 tttaccgatatcagtgaatccaccgaattgaatgatcacacaattacaagagtcactgat 2040 agcgaattggccaacgcatcactaaaagatgaaattaagttgagagacgttaagacatta 2100 cctccgttgttattgaaattatcagaaaaagccccttactacttgcactacttgggtgtc 2160 tcttatggtttcacgtctcaattacacaaattctggaagaaagcagggttcactccagtt 2220 tatttgagacaaacacctaatgaattaactggggaacatacttcggttgttataagtgtt 2280 , ctaccaggaagagaagataaatggttacatgaattctcgaaagatttccacaaaagattt 2340 ttgagtttgttatcatatgaattcaaaaaattccaggcttcccaagctttaagcattatt 2400 gaagctgcagagcaaggcgaaggtgatgaaactactagtcaaaaattaaccaaagaacaa 2460 ttagatctgttgttgtctccatttgatttaaagagattggactcgtatgccaataattta 2520 ttggattatcatgtaattgttgatatgttaccactaatctcccaattgtttttttcaaaa 2580 aaaactgggcaagatatcagtttatcatcagttcaatctgccattttattggctattggg 2640 ttgcagcataaagacatggaccagatagcaaaagagttgaacttaccaacgaaccaagcc 2700 atggcaatgtttgctaaaattattcgtaaattctcaacctatttcagaaaagttctcagt 2760 aaagcaattgaagaaagtatgccagatttagaagatgagaatgtcgacgccatgaatggt 2820 aaggaaacggaacaaatcgattataaagccattgagcagaaattgcaagatgacttggaa 2880 gaggctggtgatgaggcaataaaagaaatgagagaaaaacaacgtgaattgattaatgct 2940 cttaatttagataaatatgctattgcagaagatgctgaatgggatgaaaaatcaatggat 3000 aaagctactaagggaaaaggtaatgttgttagtattaagagtgggaaaaggaaatctaaa 3060 gaaaatgctaatgatatttatgagaaagaaatgaaagcagttaagaaatcaaagaaatca 3120 aaaaaataa 3129 <210> 45 <211> 384 <212> DNA
<213> Candida albicans <400> 45 atggctgcatttgatgaaatatttgattatgtcgatagagatacttttttccaatatttc 60 cgattgacattagttgtttgtacttatttgattttccgtaaatattattcttcatgggcc 120 attaaaaagcaaacagcaacacaattagaacaagataaaagagaacaatctgaaaaatct 180 gaaagagaagctaaagaatctaaagaaaaatttgatactatttctaatgaagctaaagaa 240 tttggttggggtaaaaaaactagaaataatgttaaattaactgaagcagtattagctgaa 300 tatagtgaacaacaaagacaaagaaatcaaactagttatgatgctcaagaagatgctgat 360 attgatgatttattagaagattga 384 <210> 46 <211> 870 <212> DNA
<213> Candida albicans <400>

atgtcatttagaggtggtggtggtagtggtggtagatcaactcaaagaactattcttcca 60 tttggattagattatgctgatattatatcatcaactcaagagacggaaaaaccacaatta 120 ttattacccataaatggagatataactgaaattgaatcaattattgctaaacaatcaatg 180 aatttcactaaactaatgtcagaaggtccatttttcacggggaatctagatagtattgaa 240 atcaccaaaaaacgtaatcataatgatagtgaaaatgaagaagaagaagaagaagaagga 300 ggagatacagagaatactggcgatagaaagaaaaagaaatcaaagactaatggtgatggt 360 agtagtagtggtagtggtagtggtagtgccagtggtgatggaatagaaagatattccgat 420 cgatataaaaaaatccaaaaaattggtagaacaattgatgaacatccatatcaaccagaa 480 tatttccctagtgaattatattcagtcatgggaataactaataaacatgataagaagaaa 540 tttttattattatcgaaatttaaatcaaatggaggattaaaacaaatattatccaatgaa 600 aaattggaaaatttagatgaacaatcaaaattaaattcaatgaaagaaaaaatgttaagt 660 atgattgataatagtgtgaatgtcaatgatgatgataataataatgatgggaaaacacgt 720 agtggagatgaacaagaaattgatgaagatgatttggatgatgaatttgaagatgaagat 780 gatgatgattataatgctgagaaatatttcgatgatggtgatgacgatgatggaggtgat 840 gatggaggtgatgatgaagcagcattttaa 870 <210> 47 <211> 1524 <212> DNA
<213> Candida albicans <400>

atgttagcactgaaaaaaaaaaggacaagaagaataaaaaggcaaccaatttgtgaacaa 60 attccaacctccaatacagcatttttcttcactcttgatataccaattatgccagtgaat 120 tttttaactagtgttgtgtttgatgggccagaggtgattccatattgggaccaaattaaa 180 gaatatggacctaccgttcttcccattctattaactcttgctggagccaagtattatttc 240 catggtgccaccaatacgtgggagcgagacatgcatgggaaagtgtttatgattactggt 300 gggaccagtggtattggagctcaaatagcatatgaattgggacaacgaggagcacaacta 360 atattacttactagaagaaccaatgatcaatgggtggctgagtatattgaagatttacgt 420 gataaaactaat.aatggtttgatatatgccgaagaatgtgatttgagttcactttattca 480 atcagaaagtttgctacaagatggcttgataatcagccaccaagaagattagatggagtc 540 atttgttgtgctgctgaatgtatcccacgaggaaaatccagacaaataactatggatgga 600 gttgaacgacaaatcggtattaattatttggctcatttccatttgttgactttattgggt 660 ccatcactaagggttcaacctcctgatagaaatgtacgggtgttgattgcaacatgttcg 720 tcgcaaaatttgggagatgttgatttaaacgatttattgtggagtaacaagaggtatcca 780 gcaactcagccatggaaggtatatggaacatcgaaattacttttagggttatttgccaaa 840 gagtatcaaagacagttgatgggatatgagcgtaaagataaggccccttgtaatgttcgt 900 atcaatttaatcaaccctggtattgttagaacaccgtcaacaagaagatttttgtctttg 960 ggcactgtatgggggttgattatctacttgattttattcccgatctggtggttgtttttc 1020 aaaagtgctgagcaaggtgctcaatcattttactttgcgttatttgctcctattttcatg 1080 aaaatcgaaggtggtaacgtggtacaagaatgtaaaataatgactaaagttagaaaagaa 1140 tatactgatgatgacttgcaacaaaaagttttccacaacactgaagaattgatcaaacaa 1200 attgaaacaaaatcagctattgaacgtaaaaaacatgaaaacgctaaaaagactccagaa 1260 caaaaagccaaggaaaggcaagaggaattgaatagaaagagggatttgcatattaaacca 1320 gaaactccggaggaactagaactgaaattaaatctgttgagaaatcaaattggtatgggg 1380 actggtattctgtctaatgaaatgccattgttccccgatgacgaaactctcaagaaggtg 1440 atcagttccaagaagaatgctagtagtaataatagtggtggtctgaaatcaaataagagt 1500 caaaagaaatctaaaaaagtatag 1524 <210> 48 <211> 993 <212> DNA
<213> Candida albicans <400>

atgacagatatgtcaaacactactactgatggtaatgtttctagtattgttgttccagga 60 caatatattagtcctacttataaattagaaaatagcaacaacgattcatctataccagtg 120 aaatatattcctggatcggggacaataatatcaaatatcaatatcccatcgccaaacacc 180 tcaacaaactcagttaaatcaatgccaattatagtatcgacaatattagggaatgtatcc 240 atctcacctattgatcaaaccccaacatcaaaaccatccaacaatgatgatatggttatc 300 gataatgagcaaactaaactggatgaagataaagataaagataaatatgttaaaagttat 360 ttagtttctgtgataccaaaatctaccaaacatcaatccaccacctccaccactactagt 420 aatcaatcaggctccaaggcaatttcagcaattgcattacctaaagaaaatgatattgta 480 ttagttcgtattactaaaatcactaaaatccaagcatattgtgaaatcatatcattagat 540 accaccaccaacattttaccagattcaggtcttggtaataatgggaatggatcacatgta 600 tcaatgtcaattaccggaagtaattctcaacataatttcaatcaaaattcaattgcttct 660 agtcaatcaactaatcaatcagtacaaatttatgaattgggagaaaattttaaagggata 720 attagaattaatgatattagatcgactgaaagagataaattaaaattaattgattgtttt 780 aaacccggtgatattgttaaagctcaagttatatcattaggtgatggatctaattattat 840 ttaacaacggcaaaaaatgagttaggggttgttttcgctaaaagtgaaaatggtgctggt 900 gatttaatgtatcctattgattggcaaaatatgattgatattaatagtggggttatagaa 960 aaacgtaaaaatgccaatccatttttacaataa 993 <210> 49 <211> 666 <212> DNA
<213> Candida albicans <400>

atggcaggtgatctaaatctaaaaaagtcttggaatccagcattagttaagaaccagcaa 60 aaagtttgggaagaagaacaacaaaagttagatgaacttaaacgaataaaagagagaaat 120 caggagtataaacaagaacaagaatacttggaattactaaagctacagcatggagatcaa 180 tttcaaattaaagacttgaacaaacagcagaagctcaaaatatccaaactaaattggatg 240 tatgatgatgtaccatttgaaggcaatgagaaagtggaagagaattcaagtgggtttatt 300 gaatcaaatgtagagtttacagatggcaaatccaaagttgagaatttattaaaaggaaat 360 catgttgtgggcaagaagagagatggtagtggaaccagtgatagaataaataagataatt 420 ggggtggggatgaccaaatcaagtaaagtcagctattccgatgatccattactcaaaata 480 aaacagcagcaacaacaggcacaaagagttgcccgaaaacaacatcctagtgataagcat 540 tctcatcgttttagacatagttccaaaagttcatccgatagagtgcacaaatcacatgag 600 cacgagagaagtcgaaagcataattcctcacatactcgtcacaaagatggatcaccccac 660 agataa 666 <210> 50 <211> 2367 <212> DNA
<213> Candida albicans <400>

atgttgaaaaacgataccgttttcactaaagatatttcttgtacggcgataactggtaaa 60 gatgcctggaatcgrccaacaccacaaccaatcactatatcattatctttcartactgat 120 ttccakaaggcatcggaattggataatttgaaatrctcaattaattatgctgttattacc 180 agaaatgtaactgaatttatgaaatcaaatgagcatttaaatttcaagtcattaggaaat 240 attgctcaagcaattagtgatattggattagatcaatctagaggtggtggatctattgtg 300 gatgtgacgataaaaagtttgaaatcagaaataagagctgaaagtgtcgaatataaaatt 360 aatagaaacactttgggtcaacccgttccattagatattttccaagttaataaattgaga 420 ttattgacrattattggrgttttcacatttgaaagattacaaaaacaaatagttgatgtt 480 gatttrcaatttaaaattgmacctaattccaatttatatttccatcaaataattgctgat 540 attgtttcatacgtggaatcatctaatttcaaaactgtagaagcattggtgtctaagatt 600 ggtcaattgacatttcagaaatatgacggagtagctgaagttgttgctactgtcactaaa 660 ccgaatgcattyagtcatgttgaaggtgttggagtatcatctaccatggtcaaagrcaat 720 ttcaaagatatggaaccagttaaatttgaaaacacaattgctcaaactaatagagcattc 780 aatttacctgttgaaaatgagaaaactgaggattataccgggtaccacactgcatttatt 840 gcctttggatccaatactggaaatcaagtagaaaatattaccaattcattcgaattgttg 900 caaaaatatggaatcaccatagaagcaacttcatcattgtacatttctaaaccaatgtat 960 tacttggatcaaccagattttttcaatggagtaattaaagtgaatttccaaaacatttca 1020 cctttccagttgttgaaaattctaaaagatattgaatataaacatttagaaaggaaaaaa 1080 gactttgataatgggcccagatcaatagatttggatattatactatatgacgatttacaa 1140 ttaaataccgagaatctaattattccacataaatcaatgttagaaagaacatttgtatta 1200 caaccattatgtgaagtattgccccctgattatattcatcccatcagtgcagaaagtttg 1260 catagccatttacaacaattaataaatgataaacctcaagagacagtacaagaatcgtct 1320 gatttattacaatttatcccagtctctagattgcctgtcaaagataatattttgaaattt 1380 gatcaaattaatcataaatctcctactttgattatgggtatattgaatatgactcctgat 1440 tcatttagtgatggtgggaaacattttggaaaagaactagataatactgtgaagcaggca 1500 gagaaattagtcagtgagggtgctacgattattgacattggaggagtttccacacgccca 1560 ggaagtgttgaacccactgaggaagaagaattggaacgtgtgattccattaattaaagct1620 attcgtcaatcactgaaccctgatttactgaaggtgttgatttcggttgatacttatcgt1680 aggaacgttgctgaacaaagtttacttgtgggtgctgacataatcaacgatatctcaatg1740 ggcaaatatgatgaaaaaatatttgatgtggttgctaaatacggatgtccttatatcatg1800 aatcatactcgaggatcacctaaaaccatgtctaaattgaccaattatgaatcaaataca1860 aatgatgatattatcgaatatataattgatcctaaattaggacatcaagaattggatttg1920 tcacctgaaatcaagaatttactcaatggaatcagtcgtgaattgagtttacaaatgttt1980 aaagccatggctaaaggagtgaaaaaatggcaaattattttggatcctggtattggattt2040 gctaaaaatttgaatcaaaatttagcagttattcgtaatgcctcgttttttaaaaaatat2100 tctattcaaattaatgaacgtgttgatgatgtgacaatcaaacataaatatttaagtttt2160 aatggtgcttgtgttttggtggggacatcaagaaagaagtttttggggacattaactggt2220 aatgaagtgcctctggatcgagtatttggcactggtgcaacagtgtctgcgtgtattgaa2280 caaaacactgatattgtaagagttcatgatgttaaagaaatgaaagatgtagtatgtata2340 agtgatgcaatttataaaaatgtataa 2367 <210>

<211>

<212>
DNA

<213> da albicans Candi <400>

atgtcagatatagatatagataatgtattaaatttagaagaagaacaatatgaattagga 60 tttaaagaaggtcaaatacaaggaacaaaagatcaatatttagaaggaaaagaatatggt 120 tatcaaactggatttcaacgatttttaatcattggttatattcaagaattaatgaaattt 180 tggttatcccatatagatcaatataataactcttcttcacttcggaatcatttgaataat 240 ttggaaaatattttggcacaaatttctataacgaatggagataaagaagttgaagattat 300 gaaaaaaatattaaaaaggcaagaaataaattaagagtgatagctagtataactaaagaa 360 acttggaaaattgattcattagataatttggtgaaagaagtaggtggaactttacaagtt 420 agtgaaaaccccgatgatatgtggtga 447 <210>

<211>

<212>
DNA

<213>
Candida albicans <400>

atgagacaaaagcgtgccaaggcctataagaaacaaatgagtgtgtatgtccacgcattc 60 aaattcagagaaccataccaaataatagtagacaatgaactcatcaccacttgtcaatca 120 gcatcatttgacattaataaagggtttactcgaactatccaagcagaaaacaaacccatg 180 attactcaatgttgtatccaagcattatatgatactaagaatcaaccagcaatagatatt 240 gctaaatcatttgaacgaagaaaatgtaatcatcgtgaagccatcgatcctagtcaatgt 300 attgaatcaatcgttaatattaaaggacaaaataaacatcgatatatcgttgccagtcaa 360 gatttacaattacgtaaaaaattgcggaaaatccctggagtaccattgatttatatgaat 420 cgatcagtgatggttatggaaccgatcagtgatgttagtaatcaatataatatgaattat 480 gaatcgaaaaaattgaccggaggattgaatgatattgaagctgggaaattggaaaagcaa 540 aatgaaggtgaagatggggatggggatgaactggaagttaaaaagaagaaaagaaaagga 600 cctaaagaaccaaacccattaagtgtcaaaaagaagaaaacagataatgcaactgctgcc 660 agtactaatcaagagcagaaaaagaaaccaaatagaagaaaaagacatggcaagtcaaaa 720 gcagaagagaaggaagaccaagaacaggagcaagtgaacgaagcaacaactaatgaagat 780 gcacaggaggcaataacagctactgaataa 810 <210>

<211>

<212>
DNA

<213>
Candida albicans <400> 53 atgaccgact taacaccatt attccgtcag tgtgttgaca tcgttcagca agagtacaag 60 actcagccaaccacagccaaacaaccttactaccttaacgacacatttattaaggagacg 120 accgcctttttccatgtcttgaccaacttgaaccagttcatcaacgaaaccaaatcaagt 180 tatctagccataaacgatgacacgaaactagctgggtcgattgacgacaaaaacaagatc 240 gacgaagagttcaattacaaggtccagcaaatgtacaagcgattaaatcatttggagaca 300 tacgaaacaaagaggcagtcgttactaccaaagactagcgggtggttcagtttcctagac 360 gaatccaacgaccaggacatatactttgagacattggcgaatcatcgtatgcagatattg 420 cggttcctcatggagacactcaaccatgtaaacaaacgctttgaaaacatccaacaaaaa 480 agattggctcgtgaacgacaactaaacttgttaaacttccaaaactttgaagacggcgag 540 gagttggaggatgtgtttcccacactagaccaaatccagcaagtaccagaactatcccaa 600 caacaaatccaacaacttgaaacggaaaaccaggaatttctcaatatgaaaactagccaa 660 ttgaaacaagtcgaaaaagtgcagcagtcaatactcgacatcgtcaacatccaaaacgaa 720 ttggcatttaagctacaagaccagggccaacagatcgagtcgttgatggactcacatgct 780 gatgttcaaacagaagtccaaatggggaaccggacattaagtcaggctacgaaaaagaat 840 aaaagaggtgctaatatgttggtcatgctatgtatagtactaggtgtgttattagtgttg 900 gtagactatgtatcattctga 921 <210>

<211>

<212>
DNA

<213> da albicans Candi <400>

atgtcaggtataaaaatcagtttaaagaaaaagaatccaaaactaaagaaacttatagtg 60 aataattcacaacaaacagatgaactgtcagagcagcagaagaaattgattacatcatat 120 tctacagaagataagactactcataaagatgaaaccaaaccaataatagttttgaagcaa 180 ccatgtaaaagtatgttacagaaagaaatcgaaattgacgagaaaccaatactaccgtat 240 ggtgtaacaacgtttgaaaaagtggagactacaaaacaatcaatgatcaaaaagatcgaa 300 tcagaagattccgatgatgactccagcgatgatagaaaaatcccaatagatgaatttggt 360 gcagcatttttaagaggacttggttggcaagaagaagaggaaaagaacaaggatgacagc 420 aaatccactaacactcaaaatttatctcataggaaacatggaatcaccttagggattgga 480 gcaaaacctatagatgaagaaataatacaagatttaaactctacggaaaaaggtattcca 540 atcataaaacgacgtaaattaaatcatataaataaataa 579 <210>

<211>

<212>
DNA

<213>
Candida albicans <400>

atggctaaagcatcgaaacaaacaaagaagtttcaaaataagcatttgaaacatacaata 60 gagcaacgtaagaaggttcaggcacagaacaagaaaattgcttccagaaaaaagagtggt 120 agttcatcatctggggaaagcaatgcccccaaacgtgctgatggaaaagccaaggaagtc 180 tttgaagatatgtcagtagacgactttttcggaggtgggtttgaagttcctaaagaaaag.240 aataagaacaagaacaagcaagatacaattgaagaaaacgaagaagaagactcgtcttct 300 gaagaggaagatgaagaagcaatgaaggaaaacttgaaaaaattagaggcagacgatcca 360 gaattttacaaatacttgaaagataatgacaatgatttattagattttgaagctgtcaat 420 cctttagatgccataagtgatgacgagggtgatgaagatgatgacgaagaaattgaaaaa 480 gaagttcctagcgatgatgattctgaggaagaaccaactctaggaaaagtaaaaggatct 540 aaaattgaaataacgaaatcgttggttaaaaaatggaatcaacaattagataagccaacc 600 cctaagattacaagaaacatacttattgcttttaaggcagctgtcaatatccacaattcg 660 gattctgaagattataagttttccataacagaccctaaagcattttctgaattgatgtta 720 ttagttttgaaaaaagttcctatttctgtgcaaaagttggttaaatacaaaactaacact 780 caaggagtaagaactatcccgcaaaagaatcaatatgccactcaaattgcagctattttg 840 aaatcacatgcaggttcattcatcactttattaaacgatatcaccaatactgaaactgct 900 gctttaattttggcttctatttatgaggtgttcccattttatttgtcacacagaagatta 960 ttaaaacaaattttgactgccgttgtaaatgtttggtctagttcttcagatattgatacg 1020 caaatttctacatttgcatttttgaacaatgtatctagagagtatcctaaatcggtcttg 1080 gaaaccgttttgaaattaacttactcgtctttcttacagaattgcagaaaaacaaatgtc 1140 cataccatgg cttttgtaaaaactcagctgtggaattgtttggaatcaat 1200 cccagattaa gaaactttgggttatcaagttggttttgagtatgttagacaattggctatacatttacgt 1260 aacagtatcaatgctacttcgaacgcaaaagagggatacaaaactatatacaactggcaa 1320 tactgtcattcattggatttttggtccagagttttgtctcaacattgtaatcctgaaaaa 1380 gagttgcaaaaccataaatccaaagaatctccattgaggcaattaatttatccattagta 1440 caagttactttgggtgctattagattgatccctaccgctcaattttttccattaagattt 1500 tatttaattagatccttgatcagattatctcaatctaccggcgtgtttattcctttattc 1560 ccattgatttcagagattttatcatctacagcaatgaccaaggcaccaaaagcttctact 1620 ttgcaagctgttgatttcgaacacaatattaaagttaatcaagcatatttgggcactaga 1680 gtttaccaagatgggttatgtgagcaatttatagagttatctggtgaattttttggtttg 1740 tatgcgaagagtattgccttcccagagttggtgaccccagctgtgttagcattgagaaga 1800 tttgtgaaaaaatcaaaaaatgtaaaattcaacaaacaattgcaacaattgatagaaaaa 1860 ttaaatgcaaatgctgttttcattactggaaaaagatccaatgttgagtatggaccatca 1920 aataaagcagaggtacaacaatttttgagtgactttgaatgggaaaagacacctttgggt 1980 caatatgttagtgtacaaagacagttgaaagcagaaagattaagaatcttgaaagaagcc 2040 caagaagaggaagcaaaagcacaagctgaacaaaagaaaaaagaagaagaagaggatgag 2100 caagaagatgaagatattgtaatggaggaggaagatgatgagtag 2145 <210> 56 <211> 846 <212> DNA

<213> Candida albicans <400> 56 atgtcaagaggtaaaacaataagaccgtcgtattacgatgaagaggaatcttcacaagat 60 gaattgagtcacactttaagtaaaggccgttcaaatattggctcacaatcagatgatgaa 120 gaaatgtccaaaatatcatttggtgctcttaatcgagcccaatctaaattgaacaaacac 180 aatcaaaaacataaaacacaggaggacaactataagtcttcagaagaagagtttttcgat 240 tcaggctcagattcagatggtccaccagaggaaacaagttctaaagatactaaaaagaag 300 aaaaacaaacatgctccatcagaatcctcttccaaaagaccagtttcaaggataagagat 360 atacctggattaccgtctagaaaacaacaaactttgcataccgatattaggtttgatgct 420 gcgtatgggaaagctgatttggccaaggcaagaaaagattatgcctttttagatgaatat 480 cgaaagcaagaaatagcgaatatggaaagtttattaaaagataaaaagagtagattgaat 540 gatgatgaaagagaagaaatcaaactacagttacaatcattaaaatctcgtatggatact 600 ttgaaaaatcgtgatttggaaaataatatcttatcaaattataaaaagcaacaaatggaa 660 agtttcaaagaaggtaaagtgaataaaccttattttcttaaacgtagtgataaacgtaag 720 atattacaaaaggccaaatttgattctatgaagcctaaacaaagagaaaaggcaatggaa 780 aggaaaaggaagaagagattgggtaaagaattcagacaattggaattcaaaccaactaat 840 cgttaa <210> 57 <211> 2550 <212> DNA

<213> Candida albicans <400>

atgtccgatcaattagaaaaagatatagaggaatcgatagctaaccttgattatcagcaa 60 aatcaagaacaccatgaaacagaacaagataaagataaagaacatcaagacgtagagaag 120 caatccagcgaagaagaaaccaaaggaattgagcatgttacagattcaaatacagacgat 180 atcggcgtaacaaaactgcaggatacagaagaagtcattgaaaattcgccagtggaccct 240 caattgaaagaacaacaggaatctacaaccaagatgctgttgtctgaaagagatttggta 300 gatgagatagatgagctttttactaactccacgaaaactgtcactgaaaataatcaacca 360 agtgaaactaacaaaagagcctacgaatccgtggagaccccacaggaactaacaccaaat 420 gataaacgccaaaaactagatgcaaatacagaaacctcagtgccaactgaacttgaatct 480 gtaaataaccataacgagcaactgcagcctatagagccaacccaagaaagacaaccctct 540 acaaccgaaacaacttactccatatcagtacccgtttctactacaaatgaggtcgaaaga 600 gcgtcttccctgattaatgaacaagaagatctagaaatgattgccaaacaataccaacaa 660 gctacaaatcttgaaatagagcgagccatggagggtcatggtgatggaggacaacacttt 720 tcaactcaagaaaatggtcagccttctggatcgctgctaatatcttccattgttccttct 780 gattctgaattgctcaacaccaatcaggcatatgctgcatatacttcgctatcttctcaa 840 ttagaacagcatactctggctagtgctatgctttcttctgccacactttctgctttgcct 900 ttgtcgattattgctccagtatatttaccaccaagaattcaattgttaataaatactttg 960 cccacattggacaatttagcaacccagctattacgtacagttgcaactagtccataccaa 1020 aaaataattgatttggcctctaacccagatacatcagcag.gggctacttatagagatttg 1080 acttctttgtttgagtttacaaaaagattatacagtgaagatgatccatttttaactgtt 1140 gaacatatagctcctggtatgtggaaggaaggagaagaaacccctagcatttttaaacct 1200 aaacaacaaagtatagaatctactttacgtaaagtcaacttggcgacatttttggcagcc 1260 actttaggtacgatggaaattgggttcttttaccttaatgaatcgttcctagatgttttt 1320 tgtccgctgaataatttggaccctctgaatgcattatccaatttaggaggttatcaaaat 1380 gggttacaaagtactgatagtcccgtaggtgcgagagtcggaaaattgttaaaacctcaa 1440 gccacgttgtatttagacttgaagacccaagcgtatatctcagccattgaggctggagag 1500 agatcaaaggaagaaattttggaggacattttgcccgatgatctccatgtttatttgatg 1560 tcaagaaggaatgcaaagttgttgagtccaacggaaactgactttgtgtggagatgcaaa 1620 cagagaaaggagctgttattaaattacaccgaggaaacacctttgagtgagcaatatgat 1680 tggtttacatttttgagagacttgtttgattatgtctcgaagaatattgcttatttgata 1740 tggggaaaaatgggtaaaacaatgaaaaatagaagggaagacacacctcatactcaggaa 1800 ttgcttgataatactactggttctactcaaatgccaaatcagttgtcttcatcttctggt 1860 caagcttcatcgacaccatctgttgtagatcctaacaaaatgttagtgtcggagatgaga 1920 gaagcaaatattgcagtgccaaaaccctcacaaagacgggcgtggtctcgagaagaagaa 1980 aaggctttaaggcatgcattagaactcaagggtccacattgggcaacaattctagaatta 2040 tttggtcaaggtggaaagatttcggaagctttgaagaatagaactcaagtgcaattaaaa 2100 gacaaggcaagaaattggaaaaagttttttcttagaagcggtttggaaattcctagttat 2160 ttgcggggtgttacaggtggtgtagatgatggtaaacggaaaaaggataacgttactaag 2220 aaaactgctgctgcacctgttccaaatatgctggaacaattgcaacaacaacaacagcga 2280 caacaagaaaagcaagaaaagcaacaacaagaagagcaacaagcacaacaactggaaaaa 2340 caactagagcagcaacaagagccacaacaagagcagcaacaagagcagcaacaaacagag 2400 aaacaacaagcagagcaagagcagccagatcaaccccaggaggaacaacaacaagagaaa 2460 gaacaaccggatcagcaacaaccagatcaacaacacccagatcgacaacaacaagagcag 2520 atccaacaaccagaaagtctggataaatag 2550 <210> 58 <211> 3294 <212> DNA
<213> Candida albicans <220>
<221> misc_feature <222> (1). .(3294) <223> n = A,T,C or G
<400> 58 atgagtggtcctgttacttttgaaaagacatttcgtagagatgccttaatcgatatagaa 60 aagaaatatcaaaaggtatgggcagaagagaaagtttttgaagttgatgccccaactttt 120 gaagaatgtcctattgaagatgttgaacaagttcaagaagcacatccaaaattctttgcc 180 actatggcttatccttacatgaatggtgtcttgcacgccggtcatgcctttacattgtct 240 aaagttgaatttgcaactgggttccaaagaatgaatggtaagagagcattattcccattg 300 ggtttccattgtacgggtatgccaattaaagcagctgccgataaaatcaaaagagaagtt 360 gaattgtttggatctgatttttctaaagctcctgctgatgacgaagatgcagaagaaagc 420 caacaaccagctaaaaccgaaactaaaagagaagatgtcactaaattctcttccaaaaaa 480 tctaaggctgctgccaaacaaggtagagccaagttccaatatgagatcatgatgcaattg 540 ggaatcccaagagaagaagttgccaagtttgctaacaccgactactggttagagtttttc 600 ccaccattgtgtcaaaaagatgtaactgcttttggggctagagttgattggagacgttct 660 atgatcacaaccgatgctaatccttattatgatgcatttgttagatggcaaattaataga 720 ttgagagatgttggtaaaattaagtttggtgaaagatataccatttattctgaaaaggat 780 ggccaagcatgtttggatcacgatagacaatctggtgaaggtgttggtccacaagaatat 840 gttggtataaaaatcagattaactgatgtagcaccacaagcacaagaacttttcaagaaa 900 gagagtctcgatgtgaaggagaacaaagtttacttggttgctgcaactttaagaccagaa 960 actatgtatggtcaaacttgttgttttgtgagtccaaaaattgattatggtgtttttgat 1020 gctggtaatggtgactatttcattaccactgaacgtgctttcaaaaatatgtctttccaa 1080 aacttgactccgaaaagaggatattataaaccacttttcactatcaatggtaagacattg 1140 attggatctcgaattgatgctccatatgctgtcaacaaaaacttgagagttttgcctatg 1200 gaaacagttcttgcaaccaaaggtactggtgtggtcacttgtgttccatcagattctcca ~

gatgattttgttaccacaagagacttggccaataaaccagagtactatggaattgaaaaa 1320 gactgggtacaaacagatattgttcctattgtccataccgaaaaatacggtgataagtgt 1380 gctgagtttttggttaatgatttgaagatacagtcaccaaaagattctgtgcagttggcc~1440 aacgccaaggaattggcttataaagaaggtttttacaatggtactatgcttattggtaaa 1500 tacaaaggtgataaagttgaagacgccaagcctaaagtcaaacaagacttaattgatgaa 1560 ggtcttgcttttgtttacaatgaaccagaatcccaagttatttctagatctggtgatgat 1620 tgttgtgtatcattggaagatcaatggtatattgattatggtgaagaagcttggttgggt 1680 gaagccttagaatgtcttaagaacatggaaacatactccaaggaaaccagacatggtttc 1740 gaaggtgttttagcctggatgaagaactgggctgtcaccagaaaatttggtttgggtact 1800 aaattgccttgggatcctcaatatttggtcgaatctttgtcagattctactgtctatatg 1860 gcttattatactattgatcgtttcttgcattcagattattacggtaagaaggcaggtaag 1920 ttcgacattaagccagagcaaatgactgatgaagtatttgattacatctttactcgtcgt 1980 gatgacgttgaaactgacattccaaaggaacaattgaaggaaatgagaagagagtttgaa 2040 tatttttacccattagacgtcagagtttcaggaaaagatttgatcccaaatcatttgaca 2100 ttcttcatctatacccatgtcgccttgttcccaaaaagattttggccaagaggtgttaga 2160 gccaacggacatttgttgttgaacaatgctaagatgtccaaatcaactggtaactttatg 2220 actttagaacaaatcattgaaaaattcggagctgatgcctctagaattgctatggccgat 2280 gcaggtgacactgttgaagatgccaactttgacgaagccaatgctaatgctgcaatcttg 2340 agattgacaactttgaaagattggtgtgaagaagaagtgaaaaaccaagataagttaaga 2400 attggtgactacgattccttctttgatgctgcttttgaaaatgaaatgaatgatttgatt 2460 gaaaagacttaccaacaatacactttgagtaattacaaacaagcattgaaatccggattg 2520 tttgatttccaaatcgccagagatatttatagagaaagtgtaaacacaacaggaattggt 2580 atgcacaaggatcttgttttgaaatacattgaataccaagcattgatgttagctccaatt 2640 gctcctcattttgccgaatacctttacagagaagttttaggtaaaaatggaagtgttcaa 2700 ctagcnaagttcccaagagcctcaaagcctgtttccaaagctattcttgatgctctggaa 2760 tatgtcagaagccttaccagatctatccgtgaagcagaaggtcaagctttgaaaaagaag 2820 aaaggaaagtctgatgttgatgggtcaaaaccaatcagcttgacagttttggtttccaac 2880 actttcccagaatggcaagataactatattgaacttgtcagagaattgtttgaacaaaac 2940 aagttggacgacaataatgttataagacaaaaggttggcaaggacatgaa~cgtggtatg 3000 ccatacatccaccaaattaaaactagattggcaactgaagatgctgacactgttttcaac 3060 agaaaattgacttttgatgaaatcgatacattgaaaaatgttgttgaaattgtcaagaat 3120 gccccatactctcttaaagttgaaaaattggagattcttagtttcaataacggtgaaact 3180 aaggggaagaatattattagtggtgaagacaatattgagctcaatttcaagggtaaaata 3240 atggaaaatgctgtacctggtgagcctggtatctttattaaaaatgtcgaataa 3294 <210> 59 <211> 1563 <212> DNA
<213> Candida albicans <400> 59 atgaatgttggatctattttaaatgacgacccaccatcaagtgggaatgcgaatgggaat 60 gatgataataccaagattattaaatcccctactgcatacc-ataaaccttctgttcatgaa 120 cgtcattcaataacgagcatgttgaatgacactccgtcagattcaactccaactaaaaaa 180 ccagaaccgactataagtccagagtttagaaaacccagcataagtctgttaacttctcca 240 agtgttgcacataaacctccgccactaccaccgtcactgagtctggttggaagtagtgag 300 cattcgagtgcaagatcgtccccggctatcacgaagagaaactcgattgcaaacattatc 360 gatgcttatgaagaaccagctactaaaactgaaaaaaaggctgagctaaactcaccaaag 420 ataaaccaactgacaccggtgccaaagcttgaggaacacgagaatgatacaaacaaagta 480 gaaaaggttgtggatagtgcacctgaaccaaaaccaaaaaaggagcctcaaccagttttt 540 gacgaccaagacgatgacttgacaaaaatcaaaaagctcaagcaatctaagaaaccacgt 600 cggtatgaaacacctccaatttgggcccagaggtgggttcccccaaatagacagaaggag 660 gaaactaatgttgatgacgggaatgaagccataactagactttctgaaaaaccggtattt 720 gattataccactaccagaagtgttgatttggagtgtagtattactggtatgataccccca 780 agttcaatcacgagaaaaatagctgaatgggtgtatgccaatttttccaatgttgaagaa 840 aaaagtaaaaggaatgttgaattggagttgaaatttgggaaaattattgacaaaagaagt 900 ggtaatagaattgacttgaatgtggtgacagaatgtattttcactgatcattctagtgtg 960 ttttttgacatgcaagtggaagaggtggcctggaaagaaataacaaaattcttggatgaa 1020 ttggaaaaaagtttccaagaagggaaaaagggaagaaaatttaaaactcttgaatctgat 1080 aatactgacagtttctatcaattggggagaaaaggtgagcaccctaagcggattcgtgta 1140 accaaagacaacttactatcgccaccgagattggttgccatacagaaggaacgtgtggca 1200 gatttatatattcacaatccgggctccttatttgatttgaggttatctatgtcattggaa 1260 ataccagtgccacaggggaacattgagtcgattattaccaagaataagccagagatggtc 1320 agggagaagaagagaatttcttatacacatccacctaccattaccaaatttgacttgact 1380 agggtcattggtaataaaacagaagataaatatgaggtagagttggaggcgggtgttatg 1440 gaaatatttgctgctattgataaaatccagaaaggggtagataatcttagattggaggaa 1500 ttaattgaagtttttttgaacaatgcaagaactctcaataatagattgaacaagatttgc 1560 tag 1563 <210> 60 <211> 597 <212> DNA
<213> Candida albicans <400>

atggttaacggtccagctgaacttcgtagaaaattagtcattgtcggtgatggtgcttgt 60 ggtaagacttgtttattaattgttttttcaaaaggtactttcccagaagtttatgtccca 120 acagtttttgaaaattacgttgctgatgttgaagttgatggtagaaaagttgaattggca 180 ttatgggatactgctggtcaagaagattatgatagattaagaccattatcttatccagat 240 tctaatgttattttgatttgtttttcagttgattcaccagattctttagataacgtttta 300 gaaaaatggatttctgaagttttacatttctgtcaaggtgttccaatcattttagttggt 360 tgtaaatctgatttaagagatgatcctcatactattgaagccttgagacaacaacaacaa 420 caaccagtctcaacttctgaaggccaacaagttgctcaaagaattggtgctgctgattac 480 ttggaatgttctgctaaaaccggtagaggtgttagagaagtgtttgaagctgctactaga 540 gcttctttaagagttaaagaaaagaaggaaaagaagaagaaatgtgttgtcttgtaa 597 <210> 61 <211> 2127 <212> DNA
<213> Candida albicans <400>

atggaagtcacttctttgccaattaaacttcagccatcaaacattagacccatagcattt 60 cgaatattgtctaaaaaacatggattaaatattaatacagatgctttagcaattttaaca 120 gagaccatcggctacaaatttggaactgattggaaaagtgtgagatcacaacaatttctt 180 gaagaggttgccaaagtttggaaaatcgaagatcggggactatttattgatggcgatggg 240 ttaaaacaagttttgaaggatatgaattccaaaagcagcaatgatacaaaaagagctcat 300 cgaactgacaccctagttgatatcactaatgatggtaaccaaaatcatactcatagccac 360 caggataagcaaataagttttgaagataaaaatatggaacatgaagaaagagatgatgta 420 ccaatcaactggcaagattatttcaaagttgtatctcccaataaccaacctactagtata 480 ttcgacaaaacaagaaaacaatttgacatagtatttaaaaataatgatgacaaggataag 540 aaagccgagcgtggcgggaaacttgagtcaattgtggcagagttagtaaaaaatttgcct 600 gcatctattgaatcattcaataatcgatactatctcttaagtgatcgattatcgagaaac 660 gaaaattttcaaaaaaaatcattaatcagtctatcagcgttaaattctttcaaagaagga 720 aaaacagatagtataactggtcatgaaattagtttaatcaaaaatatgttgggtcgagat 780 ggtcaaaaatttttgatattcggtttgctcagtaaaaatgcaaacgatgaatacacattg 840 gaagatgaaacagaccacattgaattaaacttatctcaagcttttaaatctcaaggattg 900 ttttattgtcccggaatgtttctattagtggaaggtatttattctgcaagtgggggtaat 960 tccaaccaggatcatggttatatcggaggatgtttttatgttagtaatatcgggcaccca 1020 ccaagtgaacgaagagagacaagcttagatgtttatgggaatttggattttttagggatg 1080 catagacaaattgcacctgtgacaggtgaaaaaatcaccaaaatatctaaaaagtttaag1140 aagagattggttctaatcgaaaagaccttgtataatcataaacttatttttgtgggtacc1200 gatttatacttggatgatttcaaagttttggatgggttgcgaaagtttttccaaaaatta1260 gaaaattcaattattgaatcaatcgaggacgaagaagggcaaatggccgaaggaaccaat1320 ataccacttgctttagttttcacagggtcatttgtgtcaaaacctttatcagttacaaat1380 tcatcagtgaccaacatcaccaattcagaatcatacaagagcaattttgataatttcaca1440 acaatcgtgagcaaatacccaaacattgtatctcgctgcaaaataatattgattccaggt1500 aaaaatgatccttggcaatctacttattcattgggatcatctagcttaaactattttcct1560 cagtcgtctattccaaaagtgtttatcaatcgattggaaaaattattgcccaagggaaat1620 ttagtagtttcatggaatcccacaagaataaattacttgtcacaagagttggtagtattc1680 aaagacgaattgatgaccaaattgaaacgaaatgacattattttccctcgtgatattcaa1740 gaacaagaagagttgattgcacaagatgaccaaagaactaacgaggagagaatcaataat1800 ttaatccagaataaaaatactcatttgccttcaaaaatcaaacaggcaagaaaactagtg1860 aaaaccattttggatcaaggaaatttacaaccattcttgaagaacctaaaattaatcaac1920 ttggcttatgattatagtttaagaattgaaccattgcccagtgtaattattttgaacgat1980 tcaagtttcgacaattttgaagtgacttataatggttgcaaagtggttaacattacttca2040 gttgtcagcttgaataatagaaaattcaattatgttgaatattatccaggaactaaaaga2100 tttgaatttaaggatttgtatttctaa 2127 <210> 62 <211> 3293 <212> DNA
<213> Candida albicans <400> 62 atgagtggtcctgttacttttgaaaagacatttcgtagagatgccttaatcgatatagaa 60 aagaaatatcaaaaggtatgggcagaagagaaagtttttgaagttgatgccccaactttt 120 gaagaatgtcctattgaagatgttgaacaagttcaagaagcacatccaaaattctttgcc 180 actatggcttatccttacatgaatggtgtcttgcacgccggtcatgcctttacattgtct 240 aaagttgaatttgcaactgggttccaaagaatgaatggtaagagagcattattcccattg 300 ggtttccattgtacgggtatgccaattaaagcagctgccgataaaatcaaaagagaagtt 360 gaattgtttggatctgatttttctaaagctcctgctgatgacgaagatgcagaagaaagc 420 caacaaccagctaaaaccgaaactaaaagagaagatgtcactaaattctcttccaaaaaa 480 tctaaggctgctgccaaacaaggtagagccaagttccaatatgagatcatgatgcaattg 540 ggaatcccaagagaagaagttgccaagtttgctaacaccgactactggttagagtttttc 600 ccaccattgtgtcaaaaagatgtaactgcttttggggctagagttgattggagacgttct 660 atgatcacaaccgatgctaatccttattatgatgcatttgttagatggcaaattaataga 720 ttgagagatgttggtaaaattaagtttggtgaaagatataccatttattctgaaaaggat 780 ggccaagcatgtttggatcacgatagacaatctggtgaaggtgttggtccacaagaatat 840 gttggtataaaaatcagattaactgatgtagcaccacaagcacaagaacttttcaagaaa 900 gagagtctcgatgtgaaggagaacaaagtttacttggttgctgcaactttaagaccagaa 960 actatgtatggtcaaacttgttgttttgtgagtccaaaaattgattatggtgtttttgat 1020 gctggtaatggtgactatttcattaccactgaacgtgctttcaaaaatatgtctttccaa 1080 aacttgactccgaaaagaggatattataaaccacttttcactatcaatggtaagacattg 1140 attggatctcgaattgatgctccatatgctgtcaacaaaaacttgagagttttgcctatg 1200 gaaacagttcttgcaaccaaaggtactggtgtggtcacttgtgttccatcagattctcca 1260 gatgattttgttaccacaagagacttggccaataaaccagagtactatggaattgaaaaa 1320 gactgggtacaaacagatattgttcctattgtccataccgaaaaatacggtgataagtgt 1380 gctgagtttttggttaatgatttgaagatacagtcaccaaaagattctgtgcagttggcc 1440 aacgccaaggaattggcttataaagaaggtttttacaatggtactatgcttattggtaaa 1500 tacaaaggtgataaagttgaagacgccaagcctaaagtcaaacaagacttaattgatgaa 1560 ggtcttgcttttgtttacaatgaaccagaatcccaagttatttctagatctggtgatgat 1620 tgttgtgtatcattggaagatcaatggtatattgattatggtgaagaagcttggttgggt 1680 gaagccttagaatgtcttaagaacatggaaacatactccaaggaaaccagacatggtttc 1740 gaaggtgttttagcctggatgaagaactgggctgtcaccagaaaatttggtttgggtact 1800 aaattgccttgggatcctcaatatttggtcgaatctttgtcagattctactgtctatatg 1860 gcttattatactattgatcgtttcttgcattcagattattacggtaagaaggcaggtaag 1920 ttcgacattaagccagagcaaatgactgatgaagtatttgattacatctttactcgtcgt 1980 gatgacgttgaaactgacattccaaaggaacaattgaaggaaatgagaagagagtttgaa 2040 tatttttacccattagacgtcagagtttcaggaaaagatttgatcccaaatcatttgaca 2100 ttcttcatctatacccatgtcgccttgttcccaaaaagattttggccaagaggtgttaga 2160 gccaacggacatttgttgttgaacaatgctaagatgtccaaatcaactggtaactttatg 2220 actttagaacaaatcattgaaaaattcggagctgatgcctctagaattgctatggccgat 2280 gcaggtgacactgttgaagatgccaactttgacgaagccaatgctaatgctgcaatcttg 2340 agattgacaactttgaaagattggtgtgaagaagaagtgaaaaaccaagataagttaaga 2400 attggtgactacgattccttctttgatgctgcttttgaaaatgaaatgaatgatttgatt 2460 gaaaagacttaccaacaatacactttgagtaattacaaacaagcattgaaatccggattg 2520 tttgatttccaaatcgccagagatatttatagagaaagtgtaaacacaacaggaattggt 2580 atgcacaaggatcttgttttgaaatacattgaataccaagcattgatgttagctccaatt 2640 gctcctcattttgccgaatacctttacagagaagttttaggtaaaaatggaagtgttcaa 2700 ctagcaagttcccaagagcctcaaagcctgtttccaaagctattcttgatgctctggaat 2760 atgtcagaagccttaccagatctatccgtgaagcagaaggtcaagctttgaaaaagaaga 2820 aaggaaagtctgatgttgatgggtcaaaaccaatcagcttgacagttttggtttccaaca 2880 ctttcccagaatggcaagataactatattgaacttgtcagagaattgtttgaacaaaaca 2940 agttggacgacaataatgttataagacaaaaggttggcaaggacatgaaacgtggtatgc 3000 catacatccaccaaattaaaactagattggcaactgaagatgctgacactgttttcaaca 3060 gaaaattgacttttgatgaaatcgatacattgaaaaatgttgttgaaattgtcaagaatg 3120 ccccatactctcttaaagttgaaaaattggagattcttagtttcaataacggtgaaacta 3180 aggggaagaatattattagtggtgaagacaatattgagctcaatttcaagggtaaaataa 3240 tggaaaatgctgtacctggtgagcctggtatctttattaaaaatgtcgaataa 3293 <210> 63 <211> 219 <212> PRT
<213> Candida albicans <400> 63 Met Asp Ile Glu Thr Ala Ala Cys Phe Ser Ile Ala Phe Ile Ala Thr Pro Ile Leu Ile Val Leu Val Arg Leu Leu Phe Ile Leu Pro Ser Leu Arg Leu Pro Thr Ser Val Lys Lys Lys Lys Lys Leu Ile Gln Glu Cys Gln Leu Ser Ile Leu Leu Gly Ser Gly Gly His Thr Gly Glu Met Met Arg Ile Ile Ser Lys Leu Asp Met Gly Lys Val Ser Arg Thr Trp Ile Tyr Thr Ser Gly Asp Asn Ala Ser Leu Ala Lys Ala Gln Asp Tyr Glu Arg Lys Ser Gly Thr Ser Ser Gln Tyr Ile Pro Ile Pro Arg Ala Arg Thr Val Gly Gln Ser Tyr Ile Ser Ser Ile Pro Thr Thr Ile Tyr Ser Phe Leu Phe Ser Ala Ile Ala Met Leu Lys His Arg Pro Ala Val Ile Leu Leu Asn Gly Pro Gly Thr Cys Val Pro Val Ala Tyr Ile Leu Phe Leu Tyr Lys Leu Leu Gly Leu Cys Asn Thr Lys Ile Ile Tyr Ile Glu Ser Leu Ala Arg Val Asn Lys Leu Ser Leu Ser Gly Leu Leu Leu Leu Pro Ile Ser Asp Arg Phe Ile Val Gln Trp Glu Ser Leu Tyr Gln Gln Tyr Ser Arg Val Glu Tyr Tyr Gly Ile Leu Ile <210> 64 <211> 167 <212> PRT
<213> Candida albicans <400> 64 Met Gly Thr Asn Asn Lys Thr Val Thr Asn Lys Ser Asn Lys Arg Ile Gln Gly Lys Arg His Ile Lys His Ser Pro Asn Leu Thr Pro Phe Asn Glu Thr Gln Asn Ala Ser Asn Phe Leu Ile Lys Ser Ser Thr Pro Tyr Ile Ser Ala Ile Lys Gln Ile Thr Lys Lys Leu Asn Lys Phe Ser Lys Ser Lys Asn Ser His Thr Ile Asn Lys Phe Gln Asn Glu Gln Tyr Lys Thr Ile Lys Tyr Ile Ala Val Lys Gly Met Gly Lys Thr Ile Glu Lys Val Ala Ser Ile Gly Thr His Phe Gln Lys Asp Tyr Lys Val Asp Val Leu Thr Gly Ser Thr Thr Val Leu Asp Glu Phe Ala Pro Ile Glu Ser Asn Gln Glu Pro Asp Asn Glu Asn Lys Ser Asp Asp Asp Asp Asp Asp Asp Asp Glu Thr Ile Tyr Lys Lys Arg Thr Val Ser Ser Ile Glu Ile Arg Ile Trp Ile Lys Arg Asp <210> 65 <211> 494 <212> PRT
<213> Candida albicans <400> 65 Met Leu Ala Arg Leu Leu Lys Leu Ala Ile Val Val Ala Ala Ile Ala Ala Ile Thr Pro Asn Asn Pro Ile Arg Thr Ser Ile Ser Phe Gly Cys Ile Gly Tyr Val Ala Thr Leu Ser Val .Ile Pro Lys Val Ser Pro Ser Phe Val Lys Ile Gly Leu Lys Gly Lys Asp Leu Ser Lys Pro Pro Pro Val Ser Glu Ile Pro Glu Thr Met Gly Leu Val Ala Ser Thr Thr Tyr Met Phe Leu Met Phe Gly Leu Ile Pro Phe Ile Phe Phe Lys Tyr Leu Val Ser Phe Gly Ser Met Ser Asn Asp Glu Val Ile Thr Lys Asn Tyr Leu Ser Gln Tyr Gln Ser Leu Ala Asp Asn Arg Leu Phe Pro His Asn Lys Leu Ala Glu Tyr Leu Ser Ala Leu Leu Cys Leu Gln Ser Thr Thr Leu Leu Gly Leu Leu Asp Asp Leu Phe Asp Ile Arg Trp Arg His Lys Phe Phe Leu Pro Ala Val Ala Ser Leu Pro Leu Leu Ile Val Tyr Tyr Val Asp Phe Ser Val Thr Ser Val Val Ile Pro Lys Phe Val Thr Glu Phe Pro Gly Gly Tyr Val Leu Ile Asn Thr Ile Asn Phe Phe Ile Lys Tyr Ser Asn His Leu Val Thr Ser Ile Thr Gly Leu Ser Phe Arg Thr Leu Gln Thr Asp Tyr Val Val Pro Asp Ser Ser Pro Lys Leu Ile Asp Leu Gly Ile Phe Tyr Tyr Val Tyr Met Ser Ala Ile Ser Ile Phe Ser Pro Asn Ser Ile Asn Ile Leu Ala Gly Val Asn Gly Leu Glu Val Gly Gln Ser Leu Val Leu Ala Ala Ile Phe Leu Ile Asn Asp Phe Cys Tyr Leu Phe Ser Pro Gly Ile Ser Gln Ala Ala His Asp Ser His Met Phe Ser Val Val Phe Ile Ile Pro Phe Val Gly Val Ser Leu Ala Leu Leu Gln Tyr Asn Trp Phe Pro Ala Arg Val Phe Val Gly Asp Thr Tyr Cys Tyr Phe Ser Gly Met Val Phe Ala Ile Val Gly Ile Ile Gly His Phe Ser Lys Thr Leu Leu Ile Phe Leu Leu Pro Gln Ile Ile Asn Phe Val Tyr Ser Val Pro Gln Leu Phe His Ile Leu Pro Cys Pro Arg His Arg Leu Pro Arg Phe Ser Ile Glu Asp Gly Leu Met His Pro Ser Phe Ala Glu Leu Lys Lys Ala Ser Arg Leu Asn Leu Ala Ile Leu Glu Thr Leu Ser Phe Phe Lys Leu Ile Lys Val Glu Arg Gly Ser Lys Ser Asn Gln Ile Val Arg Phe Ser Asn Met Thr Ile Ile Asn Leu Thr Leu Val Trp Val Gly Pro Leu Arg Glu Asp Gln Leu Cys Ile Ser Ile Leu Val Val Gln Phe Val Ile Gly Val Thr Met Ile Val Val Arg His Thr Ile Gly Pro Trp Leu Phe Gly Tyr Asp Asn Leu Ser Trp Gly Val Lys <210> 66 <211> 280 <212> PRT
<213> Candida albicans <400> 66 Met Ala Pro Thr Glu Ile Lys Gly Phe Tyr Val Leu Pro Leu Lys Leu Thr Gly Thr Lys Ser Ile His Tyr Ile Tyr Phe Lys Lys His Glu Ser Lys Gly Thr Ala Asn Asp Asn Arg Ser Leu Phe Ile Cys Asn Leu Pro Ile Ser Thr Asp Leu Ser Thr Ile Lys Lys Phe Phe Gln Lys Val Ala Ile Gly Ser Thr Ile Glu Ser Phe Ile Asn Ser Leu Leu Thr Asp Tyr Pro Glu Asp Ile Trp Ile Asn Leu Thr Lys Leu Thr Ser Asp Leu Asp Leu Val Asp Ala Val Asp Glu Gln Ala Ser Lys Leu Pro Lys Asn Cys Gly Ile Val Ala Phe Ile Asp Lys Ala Ser Phe Thr Leu Ala Phe Asn Ser Leu Lys Lys Leu Ser Ser Ser Leu Thr Glu Cys Glu Trp Pro Ile Gln Gln Phe Thr Ser Asn Tyr Tyr Leu Lys Gln Tyr Gln Lys Gln Ile Leu Asp Pro Asn Ser Leu Thr Glu Glu Val Ser Gln Ala Leu Ile Asp Phe Asp Lys Ala Glu Gln Gln Ser Ile Glu Glu Leu Gln Ser Gln Arg Asn Leu Val Asp Glu Asp Gly Phe Thr Leu Val Val Gly Ser His Arg Lys Thr Lys Ala Gly Ile Leu Gly Lys Gln Lys Leu Ala Ser Thr Val Gly Val Val Lys Ala Gln Ser Lys Met Lys Ser Lys Glu Lys Gln Asp Phe Tyr Arg Phe Gln Leu Arg Gln Arg Lys Lys Glu Glu Met Asn Glu Leu Leu Asn Lys Phe Lys Leu Asp Gln Glu Lys Val Arg Met Met Lys Glu Lys Lys Arg Phe Arg Pro Tyr <210> 67 <211> 371 <212> PRT
<213> Candida albicans <400> 67 Met Thr Asp Thr Gln Pro Arg Lys Ile Arg Lys Val Ser Thr Gln Glu Gln Ile Glu Asp Tyr Glu Lys Leu Arg Gln Arg Ile Lys Asn His Phe Lys Asp Ala Leu Lys Gly Lys Gly Ser Ser Met Ser Leu His Tyr Ile Asp Glu Ile Thr Glu Leu Tyr Lys Arg Val Gln Ser Gln Lys Val Lys Asp Thr Arg Val His Leu Glu Asp Ser Glu Val Phe Lys Glu Ala Ser Asp Phe Ala Ala Leu Asn Ala Arg Asn Ile Val Phe Asp Asp Ser Gly Ile Ala Leu Asp Asp Lys Glu Phe Phe Lys Cys Leu Arg Arg Phe Ala Val Thr Asp Pro Ser Leu Leu Ser Arg Asn Asp Ile Gly Asp Asn Asp Gly Asn Asn Ser Asn Asp Glu Asp Asp Val Asp Asp Asp Asp Ser Asp Glu Glu Glu Glu Ala Ile Thr Asp Glu Tyr Thr Phe Asn Lys Thr Asn Trp Leu Lys Leu Gly Ile Leu Tyr His Gln Val Ser Lys Lys Ser Ile Ser Val Asp Phe Leu Asn Gly Pro Leu Lys Ala G1u Lys Arg Lys Ile Val Arg Ala Arg Asn Val Asp Asp Thr Lys Gly Ser Gly Met Ala Lys Thr Ala Arg Gln Val Gln Ala Ser Asp Ile Ser Gly Asn Gln Glu Gln Asn Thr Ala Asn Met Val Lys Ser Val Tyr Gln Thr Tyr Ile Glu Lys Tyr Asp Gly Asn Gly Val Asn Leu Phe Lys Phe Phe Ile Asn Pro Arg Ser Phe Gly Gln Ser Val Glu Asn Leu Phe Tyr Thr Ser Phe Leu Val Lys Asp Gly Arg Leu Lys Leu Tyr Val Asn Asn Asp Gly Met Pro Cys Ile Gln Arg Val Ser Ser Asp Glu Ile Arg Glu Ala Gln Leu Glu Ser Asn Lys Ile Phe Ala Ser His His Ile Ala Ser Phe Asn Tyr Lys Ala Trp Lys Lys Tyr Thr Gln Leu Tyr Asn Ile Arg Glu Ala Phe Leu Gly His Arg Asp Glu Pro Glu Asp Gln Met Pro Pro Glu Asp Ile Ile Asp Tyr Asn Asp Glu Glu Pro Ile Pro Ser Ser Gln Arg Arg Asp Ser Asn Ser Ser Asp <210> 68 <211> 564 <212> PRT
<213> Candida albicans <400> 68 Met Ala Arg Arg Asn Arg Asn Lys Thr Val Asn Glu Glu Glu Ile Glu Leu Asp Glu Val Asp Ser Phe Asn Ala Asn Arg Glu Lys Ile Leu Leu Asp Glu Ala Gly Glu Tyr Gly Arg Asp Asp Gln Ser Glu Glu Asp Asp Ser Glu Glu Glu Val Met Gln Val Glu Glu Asp Ser Glu Asp Asp Glu Glu Asp Gln Glu Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Gly Glu Glu Glu Glu Glu Glu Glu Glu Lys Gly Trp Gly Gly Arg Gln Asn Tyr Tyr Gly Gly Asp Asp Leu Ser Asp Asp Glu Asp Ala Lys Gln Met Thr Glu Glu Ala Leu Arg Gln Gln Lys Lys His Leu Gln Glu Leu Ala Met Asp Asp Tyr Leu Asp Asp Glu Met Met Glu Asp Trp Gln Lys Lys Ala Asp Ser Tyr Asp Asn Lys Asp Thr Ser Ser Ser Thr Gln Gln Gln Gln Gln Gln Gln Leu Ile Ile Glu Ser Asn Ser Ser Ile Ala Asn Leu Glu Asp Ser Asp Lys Leu Lys Leu Leu Gln Gln Ser Phe Pro Glu Phe Ile Pro Leu Leu Lys Glu Leu Asn Ser Leu Lys Val Lys Leu Glu Asp Leu Gln Lys Leu Glu Asp Lys Asn Lys Cys Ile Glu Thr Lys Ile Val Ala Leu Ser Ala Tyr Leu Gly Ala Ile Ser Ser Tyr Phe Ala Ile Phe Val Asp Asn Leu Asn Asn Glu Glu Ser Phe Val Ser Met Lys Asp Asn Pro Ile Met Glu Thr Ile Leu Ser Ser Arg Glu Ile Trp Arg Gln Ala Asn Glu Leu Pro Asp Asp Ile Lys Leu Asp Asp Val Lys Val His Val Ser Asp Val Val Ser Ser Ser Asp Ile Asp Asp Glu Asp Asn Phe Val Asp Ala Lys Glu Glu Gln Ser Glu Asp Glu Glu Ile Ser Glu Glu Glu Val Ser Gln Asp Glu Asp Glu Asp Gln Ser Asp Asp Leu Asp Ile Asp Ala Asn Ser Glu Arg Ile Ile Lys His Val Ser Lys Lys His Gly Asp Asp Phe Thr Glu Ala Asp Ile Glu Asp Ile Asp Met Glu Asp Lys Gln Arg Arg Lys Lys Thr Leu Arg Phe Tyr Thr Ser Lys Ile Asp Lys Ala Ala Ala Lys Lys Asp Gln Ser Tyr Ser Gly Asp Ile Asp Val Pro Tyr Lys Glu Arg Leu Phe Glu Arg Gln Gln Arg Leu Leu Glu Glu Ala Arg Lys Arg Gly Leu Gln Lys Gln Asp Asp Glu Asn Ile Ser Asp Asn Asp Asn Asp Asn Asp Gly Val Asn Asp Asp Glu Gly Phe Glu Gln Gly Asp Asp Tyr Tyr Glu Ser Ile Lys Gln His Lys Leu Asn Lys Lys Gln Ser Arg Lys Ser Ala His Glu Ala Ala Val Lys Ala Ala Lys Glu Gly Lys Leu Ala Glu Leu Gln Glu Ala Val Gly Gln Asp Gly Lys Arg Ala Ile Asn Tyr Gln Ile Leu Lys Asn Lys Gly Leu Thr Pro His Arg Lys Lys Glu Tyr Arg Asn Ser Arg Val Lys Lys Arg Lys Gln Tyr Glu Lys Ala Gln Lys Lys Leu Lys Ser Val Arg Gln Val Tyr Asp Ala Asn Asn Arg Gly Pro Tyr Glu Gly Glu Lys Thr Gly Ile Lys Lys Gly Leu Ser Lys Ser Val Lys Leu Val <210> 69 <211> 506 <212> PRT
<213> Candida albicans <400> 69 Met Ser Lys Val Glu Glu His Glu Ser Val Asn Asn Leu Lys Arg Lys Phe Pro Ser Leu Ala Lys Pro Arg Gln Pro Leu Lys Glu Thr Asn Ser Asn Ile Pro Ser Pro His Lys Arg Ala Lys Ile Glu Ser Pro Ser Lys Gln Gln Ser Thr Gln Gln Pro Gln Gln Gln Pro Gln Pro Gln Pro Gln Pro Gln Pro Gln Gln Glu Lys Ala Thr His Lys Pro Lys Lys Ser Ser His Gln Ser Lys Asn Asn Asp Lys Leu Ala Gly Asp Glu Met His Glu Trp Gln Gln Ser Trp Arg Arg Ile Met Lys Ser Ser Ile Val Tyr Phe Glu Gly Asp Gln Gln Ser Leu Glu Tyr Arg Lys Ala His Lys Leu Leu Arg Leu Val Gly Cys Lys Val Thr Pro Phe Tyr Asp Asn Asn Val Thr Ile Ile Ile Ser Lys Arg Pro Tyr Asp Ser Lys Thr Glu Tyr Ser Pro His Asp Ile Phe Ser Asn Val Ser Lys Ala Ser Ile Lys Val Trp Asn Tyr Asp Lys Val Phe Arg Phe Leu Lys His Leu Gly Ile Asn Ile Gln Thr Gly Val Asp Glu Leu Ala Val Asn Thr His Thr Ile Leu Pro Pro Ser Leu Thr Asn Asn Asn Glu Lys Pro Asp Leu Tyr Asn Leu Leu Lys Glu Glu Lys Ile Tyr Gly Ser Thr Asp Arg Asp Pro Asn Ala Lys Arg Asp Asp Leu His Tyr Leu Gly Lys Asn Tyr Leu Tyr Val Tyr Asp Leu Thr Gln Thr Val Arg Pro Ile Ala Ile Arg Glu Trp Ser Asp His Tyr Pro Val Met Gln Leu Ser Leu Asp Gly Lys Cys Pro Phe Ile Glu Asp Pro Thr Asp Gln Asn Ser Glu Arg Lys Arg Leu Lys Arg Leu Arg Lys Phe Glu Ala Asn Gln Ala His Arg Glu Ala Leu Arg Leu Ala Thr Tyr Lys Met Ile Asn Gly Ile Ser Met Ser Val His Gly Phe Thr Ala Thr Ser Thr Ser Thr Asp Lys Val Asp Glu Glu Glu Asp Ser Thr Val Lys Glu Pro Ser Glu Asp Pro Arg Phe Arg Gln Pro Leu Asn Arg Asn Ser Ser Cys Met Gln Ser Lys Ala Phe Glu Ala Met Ala Ser Gly Tyr Asn Gly Ala Ser Asn Ala Val Gln Pro Ser Met Asp Ser Asn Leu Asn Ser Ala Ala Ala Met Ala Gly Gly Asn Gly Leu Gly Pro Ala Leu Ser Gln Val Pro Ser Lys Gln Leu Asn Asn Leu Lys Arg Arg Ile Leu Met Lys Lys Lys Thr Thr Asn Thr Thr Glu Lys Lys Asp Lys Glu His Ala Ser Gly Tyr Cys Glu Asn Cys Arg Val Lys Tyr Thr Asn Phe Asp Glu His Ile Met Thr Asn Arg His Arg Asn Phe Ala Cys Asp Asp Arg Asn Phe Gln Asp Ile Asp Glu Leu Ile Ala Ser Leu Arg Glu Arg Lys Ser Leu Gly Asn Val Ile Ser Asn Gly Asp Tyr Val <210> 70 <211> 532 <212> PRT
<213> Candida albicans <400> 70 Met Lys Pro Met Val Thr Thr Leu Tyr Asn Gly Lys Leu Pro Leu Ala Leu Ala Asp Pro Asn Gly Ile Phe Thr Trp Cys Pro His Leu Asn Leu Ile Phe Ile Ala Met Asn Lys Met Ser Ile Trp Cys Tyr Arg Met Asn Gly Glu Arg Ile Tyr Ser Ile Asn Asn Lys Ser Ile Val Lys His Ile Ala Phe Tyr Arg Glu Tyr Phe Cys Leu Ser Gly Thr Asp Asn Leu Ile Lys Ile Tyr Asp Ser Asn Asn Gly Gln Leu Val Lys Val Leu Pro Gln Glu Phe Asp Gly Val Glu Phe Val Gly Trp Asn Gly Thr Glu Tyr Arg Val Ser Val Ser Met Pro Met Val Tyr Asp Leu Val Ser Glu Leu Asp Tyr Leu Val Val Ser Asp Gly Lys Arg Met Ala Ile Thr Phe Asn Gln Leu Leu Thr Val Asp Trp Glu Cys Glu Met Ser Val His Gln Gln Leu Asn Arg Asp Leu Phe Asn Gln Val Tyr Val Ala Gly Asp Lys Leu Val Arg Val Arg Phe Val Val Asp Asn Gln Lys Leu Tyr Thr Glu Gln Ile Ile Lys Val Cys Gln Leu Ile Ser Leu Leu Glu Tyr Gly Glu Gln His Ile Gln Lys Ile Lys Gly Leu Val Val Pro Phe Leu Ser Ala Met Asp Arg Tyr Met Ser Asn Leu Glu Ser Glu Cys Gly Asp Leu Ala Gln Tyr Leu Ser Asp Leu Val Val Ser Asn Ile Ile Pro Glu Phe Ser Lys Asp Phe Trp Leu Asn Gln Tyr Gly Glu Arg Gly His Lys Arg Met Val Lys Leu Ala Gly Val Tyr Glu Ser Cys Val Lys Asp Thr Tyr Gln His Leu Val Ser Thr Thr Glu Arg Val Ile Ser Ile Val Gly Glu Leu Ile Gly Val Ser Lys Trp Glu Gln Gly Leu Leu Ala Thr Thr Glu Leu Glu Ala Leu Leu Asp Gln Ala Lys Ser Gln Leu Lys Phe Tyr Tyr Arg Phe Ile Trp Asp Leu Gln Thr Glu Arg Gln Gln Val Ser Gln Phe Leu Val Trp Thr Lys Ser Ile Ile Asp Met Leu Asn Asp Gln Glu Cys Asp Ile Ala Tyr Ser Thr Thr Asp Val Leu Cys Phe Ile Asn Gly Ala Leu Thr Lys Ser Val Met Leu Lys Tyr Phe Asp Ile Lys Gly Val Pro Glu Thr Pro Met Thr Asn Ile Ser Met Asp Leu Thr Thr Ile Gly Glu Tyr His Arg Ser Arg Val Glu Val Glu Val Leu Gln Asn Ile Ser Leu Pro Ser Val Tyr Thr Asn Leu Lys Leu Ala Gln Trp Glu Glu Val Val Val Thr Tyr Gln Gln Gly Asn Ala Leu Val Ile Ala Asn Val Asp Gly Val Val Ser Thr Val Gln Asp Val Tyr Ser Tyr Gln His Arg Gln Thr Asp Leu Val Ala Leu Thr Ser Lys Ser Leu Leu Ile Ile Asp Ser Ser Ser Cys Ile Pro Ile Ala Leu Pro Glu Thr Ser Phe Gln Pro Thr Lys Leu Ile Leu Asn Gln Glu Tyr Gly Val Leu Leu Asp Ser Thr Arg Gln His Tyr Ser Ile Phe Arg Met <210> 71 <211> 319 <212> PRT
<213> Candida albicans <400> 71 Met Gly Lys Arg Arg Val Asp Glu Glu Ser Asp Ser Asp Ile Asp Val Ser Ser Pro Asp Ser Glu Thr Glu Leu Glu Ser Thr His His His His His His Gln Glu Gly Ala Thr Thr Ile Gln Glu Thr Val Asp Val Asp Phe Asp Phe Phe Asp Leu Asn Pro Gln Ile Asp Phe His Ala Thr Lys Asn Phe Leu Arg Gln Leu Phe Gly Asp Asp Asn Gly Glu Phe Asn Leu Ser Glu Ile Ala Asp Leu Ile Leu Arg Glu Asn Ser Val Gly Thr Ser Ile Lys Thr Glu Gly Met Glu Ser Asp Pro Phe Ala Ile Leu Ser Val Ile Asn Leu Thr Asn Asn Leu Asn Val Ala Val Ile Lys Gln Leu Ile Glu Tyr Ile Leu Asn Lys Thr Lys Ser Lys Thr Glu Phe Asn Ile Ile Leu Lys Lys Leu Leu Thr Asn Gln Asn Asp Thr Thr Arg Asp Arg Lys Phe Lys Thr Gly Leu Ile Ile Ser Glu Arg Phe Ile Asn Met Pro Val Glu Val Ile Pro Pro Met Tyr Lys Met Leu Leu Gln Glu Met Glu Lys Ala Glu Asp Ala His Glu Asn Glu Phe Asp Tyr Phe Leu Ile Ile Ser Arg Val Tyr Gln Leu Val Asp Pro Val Glu Arg Glu Asp Glu Asp His Glu Lys Glu Ser Asn Arg Lys Lys Lys Asn Lys Asn Lys Lys Lys Lys Leu Ala Asn Asn Glu Pro Lys Pro Ile Glu Met Asp Tyr Phe His Leu Glu Asp Gln Ile Leu Glu Asn Thr Gln Phe Lys Gly Ile Phe Glu Tyr Asn Asn Glu Asn Lys Gln Glu Thr Asp Ser Arg Arg Val Phe Thr Glu Tyr Gly Ile Asp Pro Lys Leu Ser Leu Ile Leu Ile Asp Lys Asp Asn Leu Ala Lys Ser Val Ile Glu Met Glu Gln Gln Phe Pro Pro Pro <210> 72 <211> 266 <212> PRT
<213> Candida albicans <400> 72 Met Ala Gly Phe Lys Lys Asn Arg Glu Ile Leu Thr Gly Gly Lys Lys Tyr Ile Gln Gln Lys Gln Lys Lys His Leu Val Asp Glu Val Val Phe Asp Lys Glu Ser Arg His Glu Tyr Leu Thr Gly Phe His Lys Arg Lys Leu Gln Arg Gln Lys Lys Ala Gln Glu Phe His Lys Glu Gln Glu Arg Leu Ala Lys Ile Glu Glu Arg Lys Gln Leu Lys Gln Glu Arg Glu Arg Asp Leu Gln Asn Gln Leu Gln Gln Phe Lys Lys Thr Ala Gln Glu Ile Ala Ala Ile Asn Asn Asp Ile Gly Phe Asp Gln Ser Asp Asp Asn Asn Asp Asn Asp Asn Glu Glu Trp Ser Gly Phe Gln Glu Asp Glu Glu Gly Glu Gly Glu Glu Val Thr Asp Glu Asp Asp Glu Asp Lys Glu Lys Pro Leu Lys Gly Ile Leu His His Thr Glu Ile Tyr Lys Gln Asp Pro Ser Leu Ser Asn Ile Thr Asn Asn Gly Ala Ile Ile Asp Asp Glu Thr Thr Val Val Val Glu Ser Leu Asp Asn Pro Asn Ala Val Asp Thr Glu Glu Lys Leu Gln Gln Leu Ala Lys Leu Asn Asn Val Asn Leu Asp Lys Ser Asp Gln Ile Leu Glu Lys Ser Ile Glu Arg Ala Lys Asn Tyr Ala Val Ile Cys Gly Val Ala Lys Pro Asn Pro Ile Lys Gln Lys Lys Lys Lys Phe Arg Tyr Leu Thr Lys Ala Glu Arg Arg Glu Asn Val Arg Lys Glu Lys Ser Lys Ser Lys Ser Lys Gly Lys Lys <210> 73 <211> 332 <212> PRT
<213> Candida albicans <400> 73 Met Ser Thr Val Tyr Tyr Lys Lys Leu Asp Lys Leu Gln Phe Gln Ile Tyr Asp Leu Phe Ser Ser Leu Leu Gln Leu Ser Glu Ala Glu Asp Glu Ser Val Tyr Lys Ala Ser Phe Asp Asp Thr Val Gln Glu Ile Asp Ser Leu Leu Ile Ala Phe Lys Asp Leu Leu Arg Leu Leu Arg Pro Lys Asp Lys Ser Asn Lys Phe Asp Thr Tyr Glu Leu Lys Phe His Ser Leu Lys His Lys Leu Arg Glu Leu Gln Val Phe Ile Asn Asp Gln Gln Gln Asp Lys Leu His Glu Tyr Arg Ile Lys His Phe His Leu Gln Asp Ser Pro Val Asp Thr Ile Asn Asn Glu Phe Ala Arg Asp Gln Leu Phe Ala Asp Arg Ser Thr Lys Lys Thr Lys Lys Glu Met Glu Ala Ser Ile Asn Gln Gln Ile Val Ser Gln Asn Lys Gln Ile Thr Lys Ser Leu Gln Ala Ser Arg Gln Leu Leu Ser Ala Gly Ile Leu Gln Ser Glu Leu Asn Ile Asp Asn Ile Asp Gln Gln Thr Lys Asp Leu Tyr Lys Leu Asn Glu Gly Phe Ile Gln Phe Asn Asp Leu Leu Asn Arg Ser Lys Lys Ile Val Lys Phe Ile Glu Lys Gln Asp Lys Ala Asp Arg Gln Arg Ile Tyr Leu Ser Met Gly Phe Phe Ile Leu Cys Cys Ser Trp Val Val Tyr Arg Arg Ile Leu Arg Arg Pro Leu Lys Ile Phe Leu Trp Ser Phe Phe Lys Ile Phe Asn Ile Phe Asn Trp Leu Leu Gly Gly Gly Arg Ser Lys Gly Leu Ser Ala Ser Asp Met Ile Val Ser Ser Val Ile Ala Ala Thr Thr Glu Ile Val Asp Tyr Glu Ala Thr Lys Thr Leu Leu Asp Thr Leu Ser Asn Ala Val Asp Ser Asn Thr Ala Ile Asp Thr Leu Ala Met Val Val Glu Ser Leu Thr Thr Ser Ser Met Glu His Ile Val Asp Glu Leu <210> 74 <211> 273 <212> PRT
<213> Candida albicans <400> 74 Met Thr Asp Ser Ser Ala Thr Gly Phe Ser Lys His Gln Glu Ser Ala Ile Val Ser Asp Ser Glu Gly Asp Ala Ile Asp Ser Glu Leu His Met Ser Ala Asn Pro Pro Leu Leu Arg Arg Ser Ser Ser Leu Phe Ser Leu Ser Ser Lys Asp Asp Leu Pro Lys Pro Asp Ser Lys Glu Tyr Leu Lys Phe Ile Asp Asp Asn Arg His Phe Ser Met Ile Arg Asn Leu His Met Ala Asp Phe Ile Thr Leu Leu Asn Gly Phe Ser Gly Phe Tyr Ser Ile Ile Ser Cys Leu Arg Tyr Thr Leu Thr Gly Gln Thr His Tyr Val Gln Arg Ala His Phe Phe Ile Leu Leu Gly Leu Phe Phe Asp Phe Phe Asp Gly Arg Val Ala Arg Leu Arg Asn Lys Ser Ser Leu Met Gly Gln Glu Leu Asp Ser Leu Ala Asp Leu Val Ser Phe Gly Val Ser Pro Ala Thr Ile Ala Phe Ala Ile Gly Phe Arg Thr Thr Val Asp Val Leu Phe Leu Ala Phe Trp Val Leu Cys Gly Leu Thr Arg Leu Ala Arg Phe Asn Ile Ser Val Asn Asn Ile Pro Lys Asp Lys His Gly Lys Ser Gln Tyr Phe Glu Gly Leu Pro Ile Pro Thr Asn Leu Phe Trp Val Gly Phe Met Ala Leu Leu Val Tyr Lys Asp Trp Ile His Asp Asn Leu Pro Phe Gly Ile Val Phe Gln Asp Thr Ser Phe Glu Phe His Leu Val Thr Ile Gly Phe Val Leu Gln Gly Cys Ala Glu Ile Ser Lys Ser Leu Lys Ile Pro Lys Pro <210> 75 <211> 1175 <212> PRT
<213> Candida albicans <400> 75 Met Ala Lys Arg Lys Leu Glu Glu Asn Asp Ile Ser Thr Ile Glu Asp Asp Glu Phe Lys Ser Phe Ser Asp Arg Asp Glu Gln Ile Asp Glu Leu Ser Asn Gly His Ala Lys His Arg Glu Asn Asn Ala Gln Glu Ser Asp Asp His Ser Ala Ser Glu Asp Asp Asp Asp Glu Asp Asp Glu Glu Glu Gly Glu Lys Ser Val Gln Pro Pro Asn Lys Lys Gln Lys Lys Gln Leu Ser Ala Gln Asp Val Gln Val Ala Arg Glu Thr Ala Glu Leu Phe Lys Ser Asn Ile Phe Lys Leu Gln Ile Asp Glu Leu Met Lys Glu Val Lys Val Lys Lys Ala His Glu Glu Lys Ile Glu Lys Val Leu His Arg Leu His Asp Leu Ile Lys Gln Val Pro Pro Val Glu Asn Leu Thr Leu Gln Gln Ala Glu Gln His Phe Asn Pro Lys Lys Leu Val Ile Pro Phe Pro Asp Pro Lys Pro Thr Lys Val Asn Tyr Arg Phe Ser Tyr Leu Pro Ser Gly Asp Leu Ser Leu Val Gly Ser Tyr Gly Leu Lys Thr Ala Ile Asn Gln Pro His Gly Gln Ser Ile Glu Val Ala Leu Thr Met Pro Lys Glu Leu Phe Gln Pro Lys Asp Tyr Leu Asn Tyr Arg Ala Leu Tyr Lys Lys Ser Phe Tyr Leu Ala Tyr Leu Gly Glu Asn Leu Ile His Leu Ser Lys Lys Asn Asn Leu Pro Ile Lys Val Ser Tyr Gln Phe Phe Asn Asp Asp Val Leu Asn Pro Val Leu Lys Ile Glu Ser Ile Gln Thr Glu Asn Pro Glu Asp Leu Thr Phe Thr Lys Thr Lys Ile Ala Ile Asn Leu Ile Val Ala Phe Pro Phe Gly Val Phe Asp Ser Lys Lys Leu Leu Pro Asp Lys Asn Cys Ile Arg Val Gln Ser Asp Thr Glu Thr Leu Pro Pro Thr Pro Leu Tyr Asn Ser Ser Val Leu Ser Gln Thr Ser Tyr Asp Tyr Tyr Leu Lys Tyr Leu Tyr Thr Thr Lys Lys Ser Thr Glu Ala Phe Lys Asp Ala Cys Met Leu Gly Lys Leu Trp Leu Gln Gln Arg Gly Phe Asn Ser Ser Leu Asn Asn Gly Gly Phe Gly His Phe Glu Phe Ala Ile Leu Met Ser Ala Leu Leu Asn Gly Gly Gly Leu Asn Gly Asn Lys Ile Leu Leu His Gly Phe Ser Ser Tyr Gln Leu Phe Lys Gly Thr Ile Lys Tyr Leu Ala Thr Met Asp Leu Asn Gly Gly Tyr Leu Ser Phe Ser Ser Leu Ile Gly Glu Asn Ile Ala Ser Lys Tyr Lys Ser Asp Gly Phe Asn Val Pro Thr Ile Phe Asp Lys Asn Thr Lys Leu Asn Ile Leu Trp Lys Met Thr Lys Ser Ser Tyr Lys Ser Leu Gln Leu Gln Ala Gln Gln Thr Leu Glu Leu Leu Asn Asp Val Val Lys Asp Arg Phe Asp Ala Ile Leu Leu Gln Lys Ser Asp Phe Asp Pro Met Arg Tyr Asp Ile Val Phe Lys Leu Ser Ala Pro Glu Glu Leu Tyr Asp Ser Phe Gly Pro Leu Glu Lys Ile Ala Tyr Ile Thr Phe Asp Asn Tyr Phe Lys Ser Arg Leu Phe Ala Ile Leu Thr Lys Ala Leu Gly Glu Arg Ile Glu Ser Ile Val Ile Lys Asn Glu His Pro Ser Asn Thr Phe Ala Ile His Lys Arg Lys Pro Ser His Thr Ser Ser Thr Phe Val Ile Gly Leu Gln Leu Asn Pro Glu Glu Cys Asp Lys Leu Val Thr Lys Gly Pro Asn Asn_Glu Asp Lys Asp Ala Gly Ile Lys Phe Arg Ser Phe Trp Gly Asn Lys Ala Ser Leu Arg Arg Phe Lys Asp Gly Ser Ile Gln His Cys Val Val Trp Asn Ile Lys Asp Gln Glu Pro Val Val Met Asn Ile Ile Lys Tyr Ala Leu Asp Thr His Leu Gln Ser Glu Ile Ser Gln His Leu Ala Ser Ser Ile Ser Tyr Phe Asp Lys Lys Leu Pro Val Pro Leu Leu Pro Ser Ala Thr Asn Gln Val Ile Thr Ser Leu Ser Ser Phe Thr Ala Leu Arg Asn Ser Phe Glu Asn Leu Ser Lys Val Leu Thr~Asn Leu Glu Leu Pro Leu Ser Val Lys Thr Val Leu Pro Ala Ser Ser Gly Leu Arg Tyr Thr Ser Val Leu Gln Pro Val Pro Phe Ala Ala Ser Asn Pro Asp Phe Trp Asn Tyr Cys Val Leu Gln Phe Glu Thr Ser Thr Arg Trp Pro Asp Glu Leu Ser Ala Leu Glu Lys Thr Lys Thr Ala Phe Leu Leu Lys Ile Ser Glu Glu Leu Ala Glu Thr Glu Tyr Asn Ser Phe Ile Ser Lys Asp Glu Ser Val Pro Phe Asn Glu Asn Ile Thr Leu Leu Asn Ile Leu Thr Pro Glu Gly Tyr Gly Phe Arg Ile Arg Ala Phe Thr Glu Arg Asp Glu Leu Leu Tyr Leu Arg Ala Val Ser Asn Ala Asp Lys Gln Lys Ala Leu Val Gln Asp Val Tyr Leu Lys Phe Asn Glu Lys Tyr Met Gly Ser Val Lys His Thr Arg Ser Val Thr Gln Leu Ala Gln His Phe His Phe Tyr Ser Pro Thr Val Arg Phe Phe Lys Gln Trp Leu Asp Ser Gln Leu Leu Leu Gln His Phe Ser Glu Glu Leu Val Glu Leu Ile Ala Leu Lys Pro Phe Val Asp Pro Ala Pro Tyr Ser Ile Pro His Ser Val Glu Asn Gly Phe Leu Gln Ile Leu Asn Phe Leu Ala Ser Trp Asn Trp Lys Glu Asp Pro Leu Val Leu Asp Leu Val Lys Ser Ser Ala Asp Asp Asp Ile Lys Leu Ser Asp Lys Leu Thr Ile Gln Ala His Arg Ile Ile Glu Gln Asn Phe Glu Lys Ile Arg Lys Thr Asp Pro Ser Gly Ile Lys Thr Gln Tyr Phe Ile Gly Ser Lys Asp Asp Pro Ser Gly Ile Leu Trp Ser His Asn Leu Thr Leu Pro Ile Ser Thr Arg Leu Thr Ala Leu Ser Arg Ala Ala Ile Gln Leu Leu Arg Lys Glu Gly Ile Thr Glu Thr Asn Leu Asp Leu Ile Phe Thr Pro Ala Leu Gln Asp Tyr Asp Phe Thr Ile Lys Val Lys Ala Asn Asn Val Thr Thr Ser Ser Gly Ile Leu Pro Pro Asn Thr Phe Lys Asn Leu Ile Gln Pro Leu Thr Ser Phe Pro Asp Asp Ile Thr Thr Lys Tyr Asp Leu Val Gln Gly Tyr Val Asp Glu Leu Asn Lys Lys Phe Gly Asn Ala Ile Ile Phe Ser Ser Lys S~

LysPhe ThrGly Leu Lys Asn Glu Asn Ile GlyGly Ile Cys Asn Val PheVal ProThr Asn Thr LysLysLys Phe Val AsnLeu Gly Leu Arg IleAsn ValLys Pro Asp AspLysGly Asp Val IleIle Asn Leu Glu ThrSer SerIle Tyr Glu IleGluLeu Leu Gly AspLeu Ile Asp Gly LysAla PheAsp Lys Lys Arg <210> 76 <211> 759 <212> PRT
<213> Candida albicans <400> 76 Met Ala Lys Lys Arg Arg Ala Ala Ile Leu Pro Thr Asn Ile Ile Leu Leu Gln Asn Val Val Arg Arg Asp Pro Glu Ser Tyr His Glu Glu Phe Leu Gln Gln Phe Ser His Tyr Glu Ser Leu Arg Asp Leu Tyr Leu Ile Asn Pro Thr Gly Val Asp Ala Asn Ser Thr Thr Glu Phe Ile Asp Leu Ile Gly Phe Met Ser Ala Val Cys Asn Cys Tyr Pro Lys Glu Thr Ala Asn Phe Pro Asn Glu Leu Lys Glu Ile Leu Leu Asn Asn His Arg Asp Leu Thr Pro Glu Leu Arg Glu Lys Ile Ile Gln Cys Leu Thr Met Leu Arg Asn Lys Asp Ile Ile Ser Ala Glu Met Leu Ile Gln Thr Ile Phe Pro Leu Leu Ile Thr Ser Asn Ala Gly Gln Gln Val Lys Gln Met Arg Lys Gln Ile Tyr Ser Thr Leu Ile Ala Leu Leu Lys Ser Val Asn Thr Gly Thr Lys Asn Gln Lys Leu Asn Arg Ser Thr Gln Ala Leu Leu Phe Asn Leu Leu Glu Gln Arg Asp Asn Gln Gly Leu Trp Ala Thr Lys Leu Thr Arg Glu Leu Trp Arg Arg Gly Ile Trp Asp Asp Ser Arg Thr Val Glu Ile Met Thr Gln Ala Ala Leu His Pro Asp Val Lys Val Ala Val Ala Gly Ala Arg Phe Phe Leu Gly Ala Asp Lys Glu Arg Glu Asp Asn Phe Glu Glu Ser Ser Asp Glu Asp Gly Phe Asp Met Asn Glu Leu Arg His Lys Met Gln Ile Asn Lys Lys Thr Ser Lys Arg Gly Lys Lys Leu Glu Gln Ala Val Lys Ala Met Lys Lys Lys Asn Asn Ser Lys His Ser Ala Thr Tyr Leu Asn Phe Ser Ala Ile His Leu Leu Arg Asp Pro Gln Gly Phe Ala Glu Gln Met Phe Asp Asn His Leu Ser Ser Lys Asn Ser $1 Asn Lys Phe Asp Leu.Asp Gln Lys Ile Leu Phe Met Asn Leu Ile Ser Arg Leu Ile Gly Thr His Lys Leu Ile Val Leu Gly Val Tyr Thr Phe Phe Leu Lys Tyr Leu Thr Pro Lys Gln Arg Asn Val Thr Gln Ile Met Ala Ala Ala Ala Gln Ala Ser His Asp Leu Val Pro Pro Glu Ser Ile Gln Ile Val Val Arg Lys Ile Ala Asp G1u Phe Val Ser Asp Gly Val Ala Ala Glu Val Ala Ser Ala Gly Ile Asn Thr Ile Arg Glu Ile Leu Ala Arg Ala Pro Leu Ala Ile Asp Ala Pro Leu Leu Gln Asp Leu Thr Glu Tyr Lys Gly Ser Lys Ser Lys Ala Val Met Met Ala Ala Arg Ser Leu Ile Ser Leu Tyr Arg Glu Val Ala Pro Glu Met Leu Leu Lys Lys Asp Arg Gly Lys Val Ala Ser Ile Glu Leu Gln Lys Gly Glu Lys Ser Gly Leu Pro Gln Tyr Gly Val Glu Asn Asn Val Thr Ser Ile Pro Gly Ile Glu Leu Leu Ala Lys Trp Lys Lys Glu Gln Gly Leu Asp Ser Arg Glu Asp Glu Glu Asp Asp Ala Asn Trp Glu Val Asp Asp Asp Glu Asp Ala Ser Asp Ile Glu Gly Asp Trp Ile Asp Val Glu Ser Asp Lys Glu Ile Asn Ile Ser Asp Ser Asp Asp Asp Asn Glu Glu Asp Glu Gln Glu Gln Glu Pro Glu Lys Gly Lys Ala Lys Ile Gly Lys Ala Glu Asp Asn Glu Asp Glu Val Ser Asp Leu Glu Leu Ser Ser Asp Asp Asp Asp Glu Asp Ser Glu Glu Asn Lys Asp Gly Lys Ala Val Ala Asp Ser Glu Glu Pro Pro Thr Lys Lys Gln Lys Ile Arg Asn Glu Asn Ala Asp Ile Asn Ala Glu Gln Ala Met Asn Glu Leu Leu Ser Ser Arg Ile Leu Thr Pro Ala Asp Phe Ala Lys Leu Glu Glu Leu Arg Thr Glu Ala Gly Val Ser Lys Ile Met Gly Ile Ser Asn Glu Glu Ala Val Asp Ser Thr Ser Leu Val Gly Lys Val Lys Tyr Lys Gln Leu Arg Glu Glu Arg Ile Ala His Ala Lys Glu Gly Lys Glu Asp Arg Glu Lys Phe Gly Ser Arg Lys Gly Lys Arg Asp Thr Pro His Ser Thr Thr Asn Lys Glu Lys Ala Arg Lys Lys Asn Phe Val Met Met Ile His Lys Lys Ala Val Gln Gly Lys Gln Lys Leu Ser Leu Arg Asp Arg Gln Arg Val Leu Arg Ala His Ile Thr Lys Gln Lys Lys Lys Gly Leu <210> 77 <211> 528 <212> PRT
<213> Candida albicans <400> 77 Met Ala Ile Val Glu Thr Val Ile Asp Gly Ile Asn Tyr Phe Leu Ser Leu Ser Val Thr Gln Gln Ile Ser Ile Leu Leu Gly Val Pro Phe Val Tyr Asn Leu Val Trp Gln Tyr Leu Tyr Ser Leu Arg Lys Asp Arg Ala Pro Leu Val Phe Tyr Trp Ile Pro Trp Phe Gly Ser Ala Ala Ser Tyr Gly Gln Gln Pro Tyr Glu Phe Phe Glu Ser Cys Arg Gln Lys Tyr Gly Asp Val Phe Ser Phe Met Leu Leu Gly Lys Ile Met Thr Val Tyr Leu Gly Pro Lys Gly His Glu Phe Val Phe Asn Ala Lys Leu Ser Asp Val Ser Ala Glu Glu Ala Tyr Lys His Leu Thr Thr Pro Val Phe Gly Lys Gly Val Ile Tyr Asp Cys Pro Asn Ser Arg Leu Met Glu Gln Lys Lys Phe Ala Lys Phe Ala Leu Thr Thr Asp Ser Phe Lys Arg Tyr Val Pro Lys Ile Arg Glu Glu Ile Leu Asn Tyr Phe Val Thr Asp Glu Ser Phe Lys Leu Lys Glu Lys Thr His Gly Val Ala Asn Val Met Lys Thr Gln Pro Glu Ile Thr Ile Phe Thr Ala Ser Arg Ser Leu Phe Gly Asp Glu Met Arg Arg Ile Phe Asp Arg Ser Phe Ala Gln Leu Tyr Ser Asp Leu Asp Lys Gly Phe Thr Pro Ile Asn Phe Val Phe Pro Asn Leu Pro Leu Pro His Tyr Trp Arg Arg Asp Ala Ala Gln Lys Lys Ile Ser Ala Thr Tyr Met Lys Glu Ile Lys Ser Arg Arg Glu Arg Gly Asp Ile Asp Pro Asn Arg Asp Leu Ile Asp Ser Leu Leu Ile His Ser Thr Tyr Lys Asp Gly Val Lys Met Thr Asp Gln Glu Ile Ala Asn Leu Leu Ile Gly Ile Leu Met Gly Gly Gln His Thr Ser Ala Ser Thr Ser Ala Trp Phe Leu Leu His Leu Gly Glu Lys Pro His Leu Gln Asp Val Ile Tyr Gln Glu Val Val Glu Leu Leu Lys Glu Lys Gly Gly Asp Leu Asn Asp Leu Thr Tyr Glu Asp Leu Gln Lys Leu Pro Ser Val Asn Asn Thr Ile Lys Glu Thr Leu Arg Met His Met Pro Leu His Ser Ile Phe Arg Lys Val Thr Asn Pro Leu Arg Ile Pro Glu Thr Asn Tyr Ile Val Pro Lys Gly His Tyr Val Leu Val Ser Pro Gly Tyr Ala His Thr Ser Glu Arg Tyr Phe Asp Asn Pro Glu Asp Phe Asp Pro Thr Arg Trp Asp Thr Ala Ala Ala Lys Ala Asn Ser Val Ser Phe Asn Ser Ser Asp Glu Val Asp Tyr Gly Phe Gly Lys Val Ser Lys Gly Val Ser Ser Pro Tyr Leu Pro Phe Gly Gly Gly Arg His Arg Cys Ile Gly Glu Gln Phe Ala Tyr Val Gln Leu Gly Thr Ile Leu Thr Thr Phe Val Tyr Asn Leu Arg Trp Thr Ile Asp Gly Tyr Lys Val Pro Asp Pro Asp Tyr Ser Ser Met Val Val Leu Pro Thr Glu Pro Ala Glu Ile Ile Trp Glu Lys Arg Glu Thr Cys Met Phe <210> 78 <211> 433 <212> PRT
<213> Candida albicans <400> 78 Met Pro Ser His Val Thr Asn Val Tyr Asn Asp Ile Asp Asp Gly Met Leu Leu Ser Ser Leu Ser Leu Asn Glu Arg Ser Asn Asp Arg Arg Gly Leu Glu Ile Glu Glu Val Tyr Asp Ser Ser Phe Asp Asp Pro Met Asp Ile Asp Asp Thr Gly Glu Leu Ser Asn His Met Asp Ile Asp Asp Thr Thr Phe Glu Ile Asp His Val Ala Ser Asp Asn Tyr Ala Asn Lys Arg Glu Asp Asp Asn Asp Thr Asn Asn Glu Glu Glu Arg Arg Glu Asp Gly Leu Phe Ser Leu Leu Ser Pro Thr Leu Met Gly Ala Lys Leu Ala Ile Lys Lys Pro Leu Leu Leu Met Pro Pro Pro Thr Val Ser Glu Gln Ser Asp Ser Lys Thr Glu Ser Ala Ser Ser Val Asp Tyr Glu Tyr Asp Thr Ser Ser Phe Lys Pro Met Lys Ser Asn Gly Leu Ile Thr Arg Lys Thr Asn Ser Ser Thr Phe Gln Pro Ser Asn Ile Asp Ser Phe Leu Phe His Ser Asp Gly Ile Ser Ser Gly Gln Ser Leu Gly Gly Tyr Gln Asp Leu His Ser Asn Tyr Gln Gln Pro Val Thr Ile His Asn His His His His Tyr Tyr Tyr Tyr Asn Lys Asp Glu Ser Val Pro Ser Pro Pro Ser Asn Asn Asn Leu Gln Ser Leu Glu His Glu Gln Arg Asn Leu Gln Met Gln Gln Tyr Lys Gln Gln Leu Glu Glu His Gln Leu Tyr Leu Gln Glu Tyr Lys Arg Asn Asn Gln Ile Leu Leu Pro Ser Pro Trp Gln His Asn Ile Ser Pro Ile Glu Arg Val Pro Tyr Leu Leu Met Ser Tyr Leu Gln Met Leu Ile Asn Phe Ile Ala Ser Leu Tyr Gly Val Tyr Leu Val Tyr Cys Leu Phe Arg Thr Ile Asn Thr Asp Ile Lys Thr Lys Ile Glu Glu Gln Gln Thr Asn Leu Ile Ile Ser Ile Glu Ser Cys Arg Arg Ser Tyr Tyr Gln Asn Gly Cys Asp Asp Lys Asp Asn Leu Val Pro Leu Leu Val Ser Lys Cys Gln Lys Phe Glu Lys Cys Met Lys Gln Asp Pro Tyr Lys Leu Ser Asn Val Ser Ile Met Ser Ala Glu Ile Ile Gly Met Ile Ile Asn Ser Leu Ile Glu Pro Leu Ser Leu Lys Phe Tyr Leu Phe Met Leu Ala Phe Ile Leu Ile Ile Phe Ala Cys Asn Phe Thr Phe Gly Tyr Ile Arg Ala Lys Ala Tyr Tyr Gly Gly Ser Met Lys Tyr Ser Leu Asp Lys Leu Asp <210> 79 <211> 263 <212> PRT
<213> Candida albicans <400> 79 Met Glu Ser Leu Asp Glu Ile Gln Trp Lys Ser Pro Glu Phe Ile Gln Glu Arg Gly Leu Asri Thr Asn Asn Val Leu Glu Tyr Phe Ser Leu Ser Pro Phe Tyr Asp Arg Thr Ser Asn Asn Gln Val Leu Met Met Gln Phe Gln Tyr Gln Gln Ile Gln Ile Pro Pro Gly Val Ser Phe His Gln Tyr 50 ' S5 60 Phe Gln Ser Arg Leu Ser Glu Met Thr Gly Ile Glu Phe Val Ile Ala Tyr Thr Lys Glu Pro Asp Phe Trp Ile Ile Arg Lys Gln Lys Arg Gln Asp Pro Gln Asn Thr Val Thr Leu Gln Asp Tyr Tyr Ile Ile Gly Ala Asn Val Tyr Gln Ala Pro Arg Ile Tyr Asp Val Leu Ser Ser Arg Leu Leu Ala Ser Val Leu Ser Ile Lys Asn Ser Thr Asp Leu Leu Asn Asp Met Thr Ser Tyr His Ile Ser Asp Gly Gly His Ser Tyr Ile Asn Ser Ile His Gly Ser Ser Ser Lys Pro Ser Gln Ser Ser Ala Val Ser Lys Pro Ser Ser Thr Asn Thr Gly Thr Asn Ala Thr Thr Thr Pro Ile Thr Leu Thr Thr Pro Ser Gly Ala Thr Val Pro Ser Thr Val Ser Asn Gly Ile Ser Thr Ser Thr Glu Ile Ala Ser Gly Val Phe Asp Thr Leu Leu Asn Asp Val Val Met Asn Asp Asp His Leu Tyr Ile Asp Glu Ile Pro SS

Leu Tyr Gly Glu Gly Ser Thr Leu Glu Arg Leu Gly Leu Lys Gly Asn Lys Asp Ala Gly Leu Ser Leu <210> 80 <211> 363 <212> PRT
<213> Candida albicans <400> 80 Met Ser Ser Ser Gln Ala Arg Lys Ala Leu Gln Asp Val Ile Pro Asn Tyr Leu Gly Glu Phe Thr Pro Lys Leu Leu Asp Tyr Ile Asn Ser Leu Tyr Gln Leu Ser Leu Arg Lys Gln Ala Ile Leu Pro Asn Lys Ser Glu Ile Ala Arg Phe His Leu Cys Ala Val Val Ile Val Glu Lys Tyr Lys Gln Ser Phe Glu Leu Pro Thr Pro Asp Val Ser Arg Ile Pro Thr Gln Pro Lys Val Ala Ala Lys Leu Leu Asp Thr Phe Arg Glu Leu Ile Glu Gln Ile Ser Ala Ala Ser Thr Pro Val Ser Ser Pro Lys Lys Val Lys Pro Pro Ser Gln Ser Pro Ser Thr Pro Thr Lys Ser Arg Thr Ser Lys Glu Asn Leu Lys Ser Gly Ser Pro Leu Lys Arg Leu Arg Ala Glu Met Leu Gln Glu Asp Gln Val Asn Gly Asn Ser Pro Asp Gly Gln Leu Lys Asp Val Asp Ser Pro Phe Asn Pro Lys Lys Arg Lys Glu Ser Lys Ala Gly Thr Pro Thr His Lys Val Tyr Lys Tyr Asp Lys Lys His Val Ser Ile Ala Asp Phe Ile Ala Phe Cys Asn Thr Phe Leu Ile Pro Gly Asp Ile Thr Ala Lys Met Val Gly Thr Phe Leu Thr His Gln His Lys Phe Leu Lys Lys Ser Asp Trp Ser Leu Ala Cys Gly Met Val Tyr Ala Ala Tyr Ile Arg Ile Asn Asn Arg Leu Leu Ala Gln Ser Val Gly Thr Lys Ser Glu Phe Thr Lys Gln Leu Leu Gln Tyr Gln Lys Gly Gly Leu Ser Leu Gly Ala Met Gln Ser Trp Cys Gly Ile Ile Glu Glu Trp Ile Gln Asp Glu Pro Trp Ile Gln Glu Ile Glu Lys Thr Tyr Ala Tyr Gly Ser Lys Thr Ala Glu Glu Thr Arg Asn Ser Phe Glu Arg Lys Ala Lys Ile Gly Glu Gly Trp Asp Leu Met Glu Gln Phe Gly Ala Met Ile His Gly Glu Thr Ile Ser Leu Ser Ser His Gln Glu Glu Tyr Tyr Lys Asn Trp Arg Lys Glu Ala Leu Glu Lys Cys Asp Gln Leu <210> 81 <211> 871 <212> PRT
<213> Candida albicans <400> 81 Met Asn Thr Phe Ser Ser Pro Pro Asn Val Ile Arg Glu Tyr Asn Asp Ser Thr Tyr Gln Ser Pro Leu Asn Ser Gln Phe His Gln Ser Pro Phe Leu Gln Thr Gln Ser Pro Asp Tyr Val Ser Leu Arg Glu Glu Glu Asp Asp Asn Asn Asp Lys Asn Leu Asp Ile Met Ser Ser Cys Ile Val Asp Ser Val Ile Tyr Lys Ser Gln Lys Ile Ala Gly Pro Leu Leu Ser Gln Ile Ser Asn Leu Asn Ile Gln Gln Ala Leu Ile Ile Arg Glu Leu Leu Phe Thr Leu Leu Gly His Glu Gly His Tyr Ile Gln Tyr Ser Lys Arg Tyr Asp Pro Thr Ser Gln Ile Ser Arg Ile Glu Gly Pro Asp Tyr Lys Ile Ala Lys Asn Leu Asp Ile Ser Leu Lys Val Ile Thr Lys Lys Leu Val Lys Phe Gly Lys Phe Tyr Ser Gly Leu Lys Ser Phe Ile Gln Val Phe Asp Asn Asn Lys Phe Gly Lys Ile Val Gln Lys Phe Cys Ser Glu Val Arg Lys Phe Leu Ser Ser Tyr Gln Gln Val Leu Ile Asn Val Glu His Glu Phe Lys Phe Asn Lys Asn Phe Asn Leu Asn Met Leu Asp Ser Leu Leu His Gln Glu Ile Ser Asn Glu Met Thr His Leu Tyr Gln Ile Gly Ile Glu Ile Ser Arg Ile Thr Glu Glu Arg Gln Lys Met Ser Gln Ala Glu Ile Met Gly Asn Phe Glu Pro Thr Thr Leu Ala Asn Thr Ser Met Asn Gly Ile Asn Ser Glu Pro Asn Leu Tyr Tyr Gly Lys Phe Asp Cys Cys Lys Gly Gly Leu Leu Leu Gln Val Ile Gln Glu Arg Met Val Tyr Tyr Lys Gly Asp Pro Thr Ser Leu Asp Phe Leu Thr Gln Leu Phe Asp Ile Val Ser Ser Asp Tyr Ile Gly Met Leu Asn Gln Trp Leu Leu Glu Gly Val Ile Asn Asp Pro Phe Asp Glu Phe Met Ile Arg Glu Lys Arg Val Pro Asp Ser Phe Met Glu Ile Phe Gln Ser Lys Ser Glu Tyr Tyr Trp Asn Glu Leu Phe Leu Ile Lys Ile Asp Gly Leu Leu Asn Gln Phe Gln Asn Ser Thr Ile Gln Ser Lys Ile Leu Asn Thr Gly Lys Tyr Leu Asn Ile Phe Lys Arg Cys Thr Gly Leu His Asn Phe Glu Ser Leu Lys Glu Lys Leu Thr Thr Ile Thr Ser Leu Ala Ala Pro Asp Leu Glu Leu Lys Ile Asp Glu Phe Tyr His Arg Ala Asn Lys Met Leu Met Lys Leu Leu Phe Asp Gly Tyr Asn Phe Pro Ser Val Val Asn Ile Phe Gln Arg Leu Phe Leu Phe Ala Asp Ser Phe Gln Ile Asp Asn Phe Ile Asp Ser Thr Phe Ser Glu Leu Lys Arg Gly Lys Leu Lys Ile Ser Val Ser Arg Leu Gln Lys Gln Tyr Asp Asp Ile Phe Lys Glu Lys Ile Glu Asn Lys Val Gly Val Arg Pro Ser Val Tyr Asp Val Leu Lys Lys Asn Gln Lys Leu Ser Val Thr Ser Glu Ser Leu Tyr Lys Val Val Glu Glu Leu Met Glu Lys Asn Ser Asp Tyr Leu Ile Ser Asp Asn Asn Leu Arg Gly Ile Phe His Arg Val Ala Ser Leu Arg Asp Asp Ser Arg Leu Thr Ile Ser Ser Thr Ala Asp Ser Ala Thr Glu Asn Val Lys Asp Glu Pro Thr Ile Thr Ser Val Asp Leu Thr Ile Pro Leu Pro Phe Pro Leu Asn Leu Val Leu Asn Gln Gln Leu Ser Tyr Gln Tyr Glu Ile Met Phe Lys Leu Leu Ile Asn Ile Lys Phe Ile Ser Lys Tyr Asn Ser Ser Asn Trp Gln Glu Met Asn Tyr Ser Lys Ile Trp Thr Asn Ser His Phe Asn Ser Ser Val Lys Lys Trp Ile Leu Arg Cys Arg Val Leu His Ser Arg Ile Cys Ser Phe Ile His Glu Leu Glu Asn Tyr Ile Val His Asp Val Ile Glu His Asn Phe Glu Glu Ile Lys Asn Leu Ile His Thr Thr Ala Thr Asn 675 680 . 685 Leu Ala Thr Ser Glu Leu Gly Ser Asp Ile Asn Asp Glu Gly Asp Asn Ile Phe Asn Gly Ser Leu Ile Arg Gly Thr Phe Asn Asn Asn Ser Ile Phe Asp Ser Lys Val His Lys His Arg Thr Thr Thr Tyr Val Glu Gly Ile Ser Thr Val Glu Gln Leu Ile Gln Lys Phe Leu Asp Tyr Ser Ser Thr Leu Leu Asn Asp Ser Leu Leu Thr Arg Glu Glu Ser Leu Arg Gln Leu Arg Lys Met Leu Asp Phe Ile Phe His Phe Asn Asn Tyr Ile Val Gln Val Lys Lys Val Leu Val Leu Leu Asn His Glu Leu Phe Asn Glu Tyr Ser Lys Glu Phe Pro Thr Lys Phe Glu Lys Pro Met Asp Gln Glu Ser Ile Asp Lys Arg Phe Ala Asn Leu Ser Asp Thr Phe Leu Met Gln Tyr Glu Lys Phe Gly Glu Asn Leu Val Thr Phe Leu Ala Thr Ile Lys Gln Val Gly Glu Arg Glu Asn Gln Gly Leu Leu Glu Leu Ser Asn Arg Leu Glu Leu Cys Phe Pro Glu <210> 82 <211> 636 <212> PRT
<213> Candida albicans <400> 82 Met Ser Gly Pro Ile Ile Cys Ser Lys Phe Asp Gln Ser Gly Asn Tyr Leu Ala Thr Gly Met Val Ala Leu Asp Ser His Gln Val Lys Val Gln Ser Ile Thr Ser Ser Gln Ala Ser Leu Asn Thr Ser Phe Thr Leu Glu Lys Ser Asn Lys Leu Val Asn Leu Ala Trp Ile Pro Ser Asp Ser Ile Gln Leu Leu Ala Leu Cys Leu Ser Lys Gly Ser Ile Leu Ile Tyr Ser Pro Gln Thr Asn Glu Ile Val Ser Glu Leu Ile Ser Ser Ala Asn Val Ser Ile Leu Asp Phe His Tyr Ser Thr Thr Thr Arg Thr Gly Trp Ser Cys Asp Ile Glu Gly Asn Val Tyr Glu Trp Asp Leu Asn Ser Tyr Leu Leu Val Asp Ser Phe Lys Val Asn Glu Tyr Ile Glu Ser Val Asp Ser Ile Asn Arg Ile Ser Thr Val Met Phe Asn Ser Gln Pro His Leu Leu Leu Gly Ser Asn Ala Val Tyr Leu Phe Asn Ile Lys Gln Arg Glu Leu Val Lys Thr Phe Pro Gly His Ile Gln Pro Val Asn Ser Ile Thr Ala Leu Asn Asn Asp Met Phe Leu Thr Ser Ala Lys Gly Asp Arg Phe Val Asn Leu Tyr Gln Leu Asp Lys Thr Ala Thr Lys Ala Val Phe Val Gly Ser Ser Ser Val Ser Ser Leu Ser Val Ser Ile Lys Asp Asp Lys Ser Val Leu Val Ile Ile Asn Glu Glu Gly Asp Ile Glu Ile Phe Asn Asn Pro Leu Ala Asp Ala Lys Ser Gln Val Ser Thr Pro Val Pro Lys Lys Lys Arg Lys Gln Val Gly Val Ser Ser Arg Ser Phe Asn Ala Ser Ile Lys Leu Ser Arg Pro Glu Pro Glu Ile Lys Ser Pro Gln Asp Thr His Leu Phe Ile Asn Ala Val Ser Thr Glu Asp Asn Leu Ile Thr Phe Thr Trp Leu Glu Asn Ser Thr Ile Pro Phe Phe Asp Thr Leu Lys Trp Ile Asp Glu Thr Gly Ser Leu Leu Leu Glu Ser Ala Lys Val Leu Leu Lys Ser Lys Pro Asn Leu Lys Val Thr Gln His Leu Thr Asn Gly His Asp Val Ala Ala Pro Lys Leu Tyr Thr Glu Gly His Thr Ile Val Ser Asp Gly Ser Asn Ile Arg Asp Leu Glu Phe Gln Asp His Gln Glu Asp Glu Glu Asp Thr Glu Glu Ser Leu Ala Glu Lys Leu Glu Arg Leu Ala Met Asp Gln Thr Ser Gln Gln Lys Ser Arg Arg Arg Lys Leu Glu Glu Ala Arg Ser Gly Val Ser Leu Ser Ile Val Leu Thr Gln Ser Leu Lys Asn Asn Asp Gln Ala Leu Leu Glu Thr Val Leu Ser Asn Arg'Asp Pro Ile Thr Ile Gln Asn Thr Ile Ser Arg Leu Asp Pro Tyr Ser Cys Val Thr Phe Leu Asp Lys Leu Ser Glu Lys Ile Gln Arg Gln Pro Thr Arg Phe Asp Gln Val Ser Phe Trp Leu Lys Trp Ile Leu Val Ile His Gly Pro Thr Met Ala Ser Leu Pro Asn Leu Ser Ile Lys Leu Ser Ser Leu Arg Ala Val Leu Asn Lys Lys Ala Glu Glu Leu Pro Arg Leu Leu Glu Leu Gln Gly Arg Leu Lys Leu Met Asp Asp Ser Ala Ala Leu Arg Asn Glu Phe Ser Ala Glu Glu Ile Ala Glu Asp Leu Glu-Glu Arg Ser Asp Ile Glu Tyr Asn Glu Glu Ile Asp Asp Ala Lys Tyr Val Gly Val Ile Ser Asp Asp Glu Ser Met Asp Asp Val Asp Asp Phe Asp Asp Leu Asp Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp Gly Ile Pro Asp Ala Ala Asn Leu Asp Asp Arg Glu Asp Ser Asp Leu Glu <210> 83 <211> 327 <212> PRT
<213> Candida albicans <400> 83 Met Met Ser Thr Asn Phe Gln Trp Pro Gly Thr Asn Lys Asn Asp Asn Thr Glu Val Ser Val Glu Thr Pro Ser Ser Thr Asp Pro His Val Pro Arg Tyr Pro Phe Thr Ala Met Ser His Ala Thr Ala Ser Thr Thr Met Lys Lys Arg Lys Arg Asp Asp Phe Asp Gly Asp Lys Ser Thr Thr Ile Thr Met Asn Thr Thr Thr Thr Arg Lys Tyr Ile Gln Ser Ser Leu Gly Ser Ser Lys Phe Lys Lys Ala Lys Thr Pro Lys Ile Ser Gly Gln Pro Leu Pro Leu Pro Arg Leu Ile Glu Ser Leu Asp Lys Ser Asn Leu Gln Lys Leu Val Gln Asp Leu Ile Thr Val His Pro Glu Leu Gln Ser Thr Leu Ile Lys Ile Ser Pro Arg Pro Ser Ile Gln Asp Ser Ile Gln Leu Leu Gln Asp Lys Phe Asp Met Ile Ile Ser His Leu Pro Tyr Lys Cys Asp Val Glu Ser Asp Tyr Ser Tyr Leu Arg Ile Lys Pro His Leu Gln Glu Phe Leu Ser Ser Val Ser Asp Phe Ile Leu Asn Tyr Leu Pro Pro Leu Glu Thr Asn Met Thr His Ser Leu Gln Phe Leu His Glu Thr Thr Lys Leu Val Tyr Asn Leu Pro Asn Phe Thr Asn.Gln Glu Phe Gln Tyr Thr Lys Ser Ser Ala Leu Glu Gln Ile Ala Asn Cys Trp Leu Ile Val Leu Ser Gln Asp Glu Glu Lys Glu Gly Asn Thr Asp Val Val Lys Val Ile Gln Glu Leu Glu Leu Leu Glu Lys Leu His Glu His Asn Glu Ile Ser Phe Asn Lys Phe Glu Lys Val Val Asp Tyr Cys Lys Asp Lys Leu Glu Gln His Glu Leu Ile Met Asn Asn Asn Glu Ala Gly Ser Gly Val Thr Ser Ser Ile Ser Asp Leu Ile Thr Val Asp Tyr Ser Lys Tyr Ser Ile Ala Asn Thr Thr Ser Ile <210> 84 <211> 552 <212> PRT
<213> Candida albicans <400> 84 Met Pro Thr Asn Ile Gln Gly Glu Glu Val Ile Ile Pro Pro Lys Asp Glu Glu Glu Ile Leu Leu Glu Lys Leu Val Phe Gly Asp Ala Ala Gly Phe Glu Asn Asn Leu Lys Lys Leu Asp Asn Leu Tyr Asp Tyr Ser Asp Glu Glu Glu Glu Ile Asp Glu Lys Gly Ser Glu Lys Glu Ser Asp Ile Glu Asp Leu Gln Asp Glu Asp Leu Phe Phe Ile Asp Asp Gly Asn Asn Glu Glu His Ser Ser Gly Asp Asp Met Glu Ile Asp Gln Ser Glu Asp Glu Glu Glu Gly Glu Asp Gln Asp Ser Asp Asn Ala Trp Glu Asp Ser Asp Asp Glu Lys Val Asn Ile Ser Leu Leu Thr Ser Asp Lys Leu Lys Lys Leu Arg Lys Thr Pro Gln Asp Ser Val Ile Ser Gly Lys Ser Tyr Ile Ile Arg Leu Arg Ser Gln Phe Glu Lys Ile Tyr Pro Arg Pro Gln Trp Ile Glu Asp Ile Glu Asn Asn Ser Asp Asp Glu Lys Asp Leu Ser Asp Glu Asp Lys Val Asp Asp Glu Glu Gly Gln Val Gly Ser Thr Thr Ala Leu Leu Asn Ile Leu Ser Ser Thr Glu Lys Phe Ile Asn Thr Lys Gln Leu Lys Leu Ile Ala Ala Asn Lys Ile Ser Ile Thr Arg Leu Lys Asp Ala Asn Tyr Lys Arg Ile Gly Lys Ser Gly Ile Gln Thr Ile Asp Phe His Pro Asn Tyr Pro Ile Leu Leu Thr Gly Gly Phe Asp Lys Thr Ile Arg Ile Tyr Gln Ile Asp Gly Lys Ser Asn Asn Phe Ile Thr Ser Tyr Phe Leu Lys Asn Cys Pro Ile Met Glu Ala Ser Phe Tyr Pro Gln Leu Ser Gly Asp Asp Thr Lys Thr Ser Asn Leu Ile Tyr Ala Ser Gly Arg Arg Arg Tyr Met Asn Lys Ile Asn Leu Ser Thr Gly Glu Ile Glu Lys Ile Ser Arg Leu Tyr Gly His Glu Gln Thr Gln Lys Ser Phe Glu Tyr Phe Lys Ile Ser Pro Gln Gly Lys Tyr Ile Gly Leu Thr Gly Asn Asn Gly Trp Cys Asn Leu Leu Asn Ala Gln Thr Gly His Trp Val His Gly Phe Lys Ile Glu Gly Thr Ile Val Asp Phe Ala Phe Ala Asn Asp Glu Ser Phe Ile Met Ile Val Asn Ser Ala Gly Glu Val Trp Glu Phe Ala Leu Glu Gly Lys Ile Thr Ser Lys Thr Pro Asn Lys Ile Ile Arg Arg Trp Tyr Asp Asp Gly Gly Val Gly Ile Thr Lys Leu Gln Ile Gly Gly Lys Asn Asn Arg Trp Val Ala Ile Gly Asn Asn Asn Gly Ile Val Asn Ile Tyr Asp Arg Ser Val Phe Ala Pro Glu Thr Thr His Pro Lys Pro Ile Lys Thr Val Glu Asn Leu Ile Thr Ser Ile Ser Ser Leu Val Phe Asn Pro Asp Gly Gln Leu Leu Cys-Ile Ala Ser Arg Ala Lys Arg Asp Ala Leu Arg Leu Val His Leu Pro Ser Gly Ser Val Tyr Ser Asn Trp Pro Thr Ser Gly Thr Pro Leu Gly Lys Val Thr Ser Ile Ala Phe Ser Pro Asn Asn Glu Met Leu Ala Ile Gly Asn Gln Thr Gly Lys Val Thr Leu Trp Arg Leu Asn His Tyr <210> 85 <211> 715 <212> PRT
<213> Candida albicans <400> 85 Met Ser Leu Lys Pro Phe Thr Gly Leu Leu Phe Cys Cys Thr Gly Leu Glu Ser Thr Thr Arg Arg Glu Val Val Glu Lys Ile Glu Thr Leu Gly Gly Ile His Tyr Ser Asp Leu Met Thr Asp Val Asn Tyr Leu Ile Val Gly Asp Arg Asp Thr Glu Lys Tyr Arg Phe Cys Ile Lys Tyr Arg Pro Asp Ile Ile Phe Ile Asp Ala Asp Ser Ile Phe Thr Ile His Lys His Trp Ile Asn Gly Glu Asp Glu Asn Ser Asp Leu Leu Arg Ile Glu Lys Tyr Arg Leu Ala Ile Phe Ala Gln Leu Asn Ala Cys Phe Ser Arg Ile Glu Met Ser Thr Ser Gln Ile Asp His Leu Val Asn Thr Val Lys Phe Arg Gln Arg Thr Asn Thr Ser Pro Glu Tyr Phe Arg Pro Lys Asn Leu Phe Lys Leu Phe Val Asp Asn Gly Gly Ile Ala Lys Glu Ser Leu Ser Cys His Gln Asn Phe Ile Ile Thr Ala Asp Pro Arg Gly Thr Arg Tyr Asn Lys Ala Leu Glu Trp Asn Val Pro Ala Ile His Pro Ile Trp Ile Val Asp Ser Val Leu Arg Gly Ala Ala Leu Asp Trp Lys Asp Tyr Ile Leu Asn Asn Asn Pro Asn Asp Cys Tyr Asp Arg Gly Cys Asp Val Trp Pro Glu Val Phe Asp Cys Gln Glu Lys Gln Lys Gln Lys Ser Gln Gln Gln Pro Lys Arg Leu Glu Ser Thr Glu Pro Glu Val Lys Arg Lys Ile Thr Asn Asn Lys Thr Asn Ala Asp Ile Trp Asn Ser Ile Met Asp His Thr Lys Lys Gln Thr Lys Gln Leu Ile His Asp Lys Thr Trp Asp Asp Asp Glu Glu Glu Glu Asp Asn Asp Asp Asp Gly Asp Thr Gln Thr Lys Asn Glu Lys Asn Asn Gln Tyr Lys Asn Ile Thr Thr Ile Pro Lys Asp Gly Lys Gln Lys Pro Glu Leu Asn Gly Lys Ile His Asn Leu Asp Leu Lys Leu Val Ser Glu Ser Lys Glu Asn Ser Pro Asn Val Ser Glu Ser Gln Leu Phe Leu Gly Phe Asn Tyr Tyr Thr Val Gly Phe Asp Ser Arg Glu Phe Asp Leu Leu Ser Lys Ala Ile Glu Asn Tyr Ser Gly Glu Ile Ser Asn Asp Pro Asn Asp Asp Ser Ile Thr His Val Val Ile Pro Ala Lys Lys Gly Tyr Gln Ser Met Ser Val Leu Lys Val Leu Pro Ala Asp Leu Lys Ser Arg Ile Ala Asn Gly Phe Val Lys Ile Val Thr Glu Phe Phe Ile Glu Arg Cys Met Phe Tyr Lys Lys Ile Ile Leu Asp Arg Trp Gly Gln Pro Met Lys Gly Leu Val Pro Ser Lys Lys Ser Phe Lys Ile Cys Thr Thr Gly Phe Thr Gly Ile Glu Leu Leu His Ile Glu Lys Leu Ile Arg Ser Phe Asn Phe Glu Tyr Cys Glu Thr Leu Ser Glu Gln Arg Asp Leu Leu Ile Leu Asn Val Asn Leu Phe Lys Lys Ser Leu Met Asn Ser Pro Lys Leu Phe Gln Tyr Lys Cys Lys Asp Ile Ile Asn Cys Pro Thr Gly Gly Ser Val Ser Leu Met Ser Ser Lys His Lys Val Glu Ala Ala Lys Arg Trp Asn Ile Pro Val Val Ser Val Ala Tyr Leu Trp Glu Ile Leu Glu Leu Ser Thr Asn Lys Ser His Ile Ile Met Pro Asp Ile Thr Asp Leu Gln Trp Cys Val Phe Ala Pro Ser Asn Tyr Asn Lys Pro Lys Ser Leu Leu Glu Tyr Val Lys Asn Leu Asp Lys Ala Ser Arg Glu Ser Ser Phe Ser Pro Lys Ser Gln Glu Asn Glu Ala Leu Glu Glu Pro Thr Met Asp Asn Ser Val Arg Leu Pro Ser Pro Arg Arg Val Asn Ser Lys Gln Lys Tyr Gly Lys Leu Val Gly Gly Lys Ser Pro Lys Ser Ile Lys Arg Lys Leu Leu Glu Ala Ala Asn Ser Phe Ala Asp Gly Gln.Asn Asp His Ser Ile Asn Pro Asp Val Thr Ile Glu Glu Asp Ser Met Ser Gln Ile Arg Tyr Gln Asp Asn Glu Ser Met Ile Asn Gln Glu Arg Leu Leu Glu Lys Leu Asp Gly Ser Ala Val Leu Val <210> 86 <211> 1120 <212> PRT
<213> Candida albicans <400> 86 Met Gly Lys Asp Leu Leu Thr Ala Glu Ala Val Thr Lys Leu Leu Arg Ser Lys Asp Thr Ser Ile Thr Glu Ile Val Asn Thr Ala Asn Ser Leu Leu Asn Asn Thr Leu Asp Ile Tyr Leu Pro Gly Lys Glu Val Phe Val Leu Asn Leu Leu Cys Asp Arg Leu Asn Asp Lys Ser Asn Gly Lys Phe Gly Lys Trp Lys Phe Asn Lys Asp Val Trp Asn Leu Leu Leu Ser Val Trp Ser Lys Leu Asn His Gln Lys Val Asp Arg Gln Arg Val Ile Gln Arg Leu Lys Ile Ile Glu Ile Ile Ile Leu Val Leu Gln Gln Asn Asn Asp Asn Glu Val Phe Ser Ser Leu Phe Glu Phe Leu Gly Ile Met Phe Gln Glu Ser Tyr Ile Ile Ala Asp Glu Asn Ser Ala Thr Gln Leu Leu Lys Cys Phe Val Glu His Met Asp Val Leu Gln Ala Ser Asp Ser Ile Val Ser Trp Thr Glu Leu Val Arg Asp Ile Tyr Thr Arg Ala Cys Ser Lys Ile Ser Leu Glu Gly Ser Lys Lys Phe Tyr Asn Lys Phe Phe Glu Asp Cys Cys Phe Pro Leu Ile Glu Tyr Leu Ala Ile Ser Glu Gly Ser Ser Val Ser Pro Ile Leu Lys Glu Leu Leu Ile Gln Gly Val Phe Asn Ala Asp Ser Thr Lys Tyr Tyr Gln Ser Ser Leu Glu Arg Glu Leu Lys Lys Lys Asp Ile Lys Glu Val Ser Val Ile Tyr Leu Tyr Thr Leu Thr Val Gln Leu Phe Ser Ala Lys His Met Glu Ile Cys Glu Gly Val Tyr Ser Ile Met Ala Ser Lys Cys Pro Asp Leu Ala Glu Lys Leu Leu Ser Ile Leu Ala Ser Cys Arg Lys Thr Ile Ser Lys Pro Phe Ile Glu Ser Ile Tyr Lys Val Glu Val Ala Asp Lys Pro Phe Lys Gln Leu Asn Trp Asp Met Val Lys His Ile Phe Ala Ile Asp Ser Glu Leu Ala Ile Ser Lys Ser Gly Phe Leu Phe Lys Thr Tyr Lys Ser Glu Phe Gln Leu Asp Asp Lys Val Val Pro Val Ala Glu Val Ile Val Asp Gly Phe Ala Arg Asn Arg Glu Leu Ser Asp Phe Phe Thr Lys Val Trp Pro Lys Ala Ile Lys Arg Asp Glu Ile Trp Glu Ser Asp Glu Phe Ile His Thr Val Ser Gln His Val Lys Thr Phe Ser Gly Lys Gln Leu Ile Asp Val Ile Glu Ser Ser Phe Tyr Ala Asp Lys Gly Ser Gln Arg Ala Ile Phe Thr Ala Ile Thr Lys Gly Leu Thr Ser Ser,Ser Ala Asn Leu Ile Asp Ala Val Lys Gln Thr Leu Leu Asp Arg Ser Asn Tyr Phe Asn Ala Thr Glu Asn Phe Trp Cys Ile Arg Tyr Tyr Leu Leu Cys Leu Tyr Gly Thr Asp Phe Thr Ile Ala Glu Gln Asn Met Lys Gln Asn Ile Asp Leu Tyr Tyr His Phe Ser Ile Phe Arg Leu Leu Glu Leu Gln Val Ile Lys Glu Tyr Ser Lys Ser Asp Gln Lys Tyr Phe Ile Ala Cys Ile Glu Gly Glu Lys Glu Met Ile Ser Pro Ile Phe Lys Arg Trp Leu Val Ile Phe Asn Lys Phe Phe Asp Ser Asp Leu Leu Ile Lys Leu Ile Ser Leu Gly Tyr Pro Asp Ile Glu Phe Asp Asp Val Phe Phe Glu Gln Pro Lys Leu Thr Thr Ser Leu Ile Arg Phe Ile Thr Glu Asn Leu Pro Ala Arg Met Asp Leu Ile Ala Ser Ile Pro Ile Val Cys Phe Asn Lys Ala Phe Lys Lys Glu Leu Leu Asn Gly Leu Phe Val Leu Phe Val Ser Asn Pro Thr Lys Glu Thr Leu Glu Asn Ile Gln Tyr Leu Leu Gly Gln Pro Thr Tyr Ser Ser Ile Leu Glu Thr Asn Phe Asp Asn Met Leu Lys Leu Leu Thr Val Ser Thr Glu Glu Ser Lys Leu Ile Ala Tyr Asn Val Ile Glu Ile Val Trp Lys Asn Asn Val Arg Gln Ile Lys Asn Glu Glu Asn Gln Lys Tyr Val Asn Asp Ala Ile Ser Lys Leu Ser Ser Tyr Leu Asp Ser Met Ser Gln Gln Ile Ile Ser Pro Glu Leu Glu Ala Ile Ser Ile Ile Leu Thr Asn Thr Lys Glu Val Gly Leu Phe Glu Asn Thr Glu Lys Gly Leu Asn Lys Leu Asn Glu Lys Phe Thr Asn Tyr Cys Ile Asn Thr Leu Asn Asn Cys Asn Thr Gln Asn Phe Ile Thr Val Arg Trp Leu Leu Gln Ala Leu Val Met Leu Pro Pro Lys Ser Leu Ser Phe Glu Asn Val Ile Ser Cys Thr Lys Arg Leu Asp Pro Asn Ile Leu Lys Asp Asn Ser Ile Gln Ser Thr Leu Phe Gln Leu Ile Cys Lys Thr Ile Asp Phe Asn Tyr Lys Ser Leu Val Tyr Val Leu Ser Leu Phe Val Ser Leu Ser Ser Gly Arg Asn Thr Glu Leu Tyr Thr Val Leu Lys Ser Leu Phe Gln Lys Phe Ser Lys His Ser Gln Leu Tyr Phe Glu Val Phe Asp Phe Phe Thr Arg Ser Ile Asp Ala Val Pro Val Glu Phe Asn Leu Ser Phe Ala Gln Ile Ala Ser Ile Phe Leu Ser Thr Val Pro Lys Asp Ala Asp Ala Asn Arg Tyr Asn Ser Lys Cys Phe Thr Phe Tyr Val Asn Ala Leu Gln Ser Gly Asn Glu Cys Val Ala Met Gln Ile Leu Thr Ser Leu Lys Asp Leu Leu Thr Asn Gln Ser Trp Ile Phe Lys Gln Asn Leu Leu Glu Ile Thr Leu Val Ile Val Lys Thr Gly Leu Gln Lys Leu Asn Ser Phe Ala Asn Gln Glu Gln Ile Tyr Ile Leu Ser Thr Gln Ile Val Ser His Ile Leu Leu Tyr His Arg Phe Lys Ile Ala Thr Arg His His Leu Val Leu Asn Val Met Ser Ser Leu Leu Lys Tyr Leu Ala Asp Gly Thr Ser Lys Leu Ser Ser Asn Thr Glu Ala Ala Ser Ala Tyr Ala Arg Leu Leu Ser Asn Leu~Cys Glu Pro Ser Glu Arg Val Gly Asp Lys Met Phe His Leu Thr Thr Ser Ala Ser Tyr Phe Lys Lys Leu Leu Arg Lys His Leu Ser Val Leu Leu Ser Asn Tyr Ile Tyr Phe Asn Leu Lys Tyr Thr Phe Thr Arg Thr Val Asn Asp Ala Ile Met Pro Gly Ile Tyr Ser Met Phe Thr Val Leu Ser Gln Asn Glu Leu Arg Val Val Asn Asp Ser Leu Asp Tyr Gly Gly Lys Ala Phe Tyr Lys Thr Leu Tyr Asn Asp Tyr Lys Asp His Gly Lys Trp Lys Asp Gln <210> 87 <211> 196 <212> PRT

<213> Candida albicans <400> 87 Met Ser Ala Asp Glu Asn Asn Lys Val Arg Phe Glu Arg Leu Arg Leu Val Ala Arg Lys Ala Leu Glu Gln Ser Ile Lys Lys Ser Leu Thr Met Glu Gln Val Lys Thr Cys Phe Pro Thr Leu Val Thr Ser Gln Asp Gly Val Arg Ser Leu Glu Leu Ala Leu Ser Gln Met Ser Gly Phe Trp His Ala Asn Ser Leu Asp Glu Phe Asp Leu Ile Tyr Lys Glu Lys Asp Ile Glu Ser Lys Leu Asp Glu Leu Asp Asp Ile Ile Gln Asn Ala Gln Arg Thr Lys Asp Ser Gly Lys Glu Pro Ser Asn Ile Asp Gln Leu Ser Pro Leu Glu Ile Val Asp Ser Thr Ile Val Ser Asn Ser Lys Asn Val Leu Asp Ser Leu Gln Met Ile Tyr Asp Gln.Leu Cys Leu Asp Asn Ala Glu Leu Tyr Thr Glu Leu Ser Glu Leu Thr Lys Glu Ser Thr Arg Ile Asn Asn Ser Ile Lys Ser Gly Ile Glu Gln Leu Asn Lys Glu Ala Asn Ser Val Glu Leu Glu Lys Ala Gly Leu Gln Ile Asp Lys Leu Ile Asp Ile Leu Glu Glu Lys <210> 88 <211> 471 <212> PRT
<213> Candida albicans <400> 88 Met Ala Ser Ser Ile Leu Arg Ser Lys Ile Ile Gln Lys Pro Tyr Gln Leu Phe His Tyr Tyr Phe Leu Ser Glu Lys Ala Pro Gly Ser Thr Val Ser Asp Leu Asn Phe Asp Thr Asn Ile Gln Thr Ser Leu Arg Lys Leu Lys His His His Trp Thr Val Gly Glu Ile Phe His Tyr Gly Phe Leu Val Ser Ile Leu Phe Phe Val Phe Val Val Phe Pro Ala Ser Phe Phe Ile Lys Leu Pro Ile Ile Leu Ala Phe Ala Thr Cys Phe Leu Ile Pro Leu Thr Ser Gln Phe Phe Leu Pro Ala Leu Pro Val Phe Thr Trp Leu Ala Leu Tyr Phe Thr Cys Ala Lys Ile Pro Gln Glu Trp Lys Pro Ala Ile Thr Val Lys Val Leu Pro Ala Met Glu Thr Ile Leu Tyr Gly Asp Asn Leu Ser Asn Val Leu Ala Thr Ile Thr Thr Gly Val Leu Asp Ile Leu Ala Trp Leu Pro Tyr Gly Ile Ile His Phe Ser Phe Pro Phe Val Leu Ala Ala Ile Ile Phe Leu Phe Gly Pro Pro Thr Ala Leu Arg Ser Phe Gly Phe Ala Phe Gly Tyr Met Asn Leu Leu Gly Val Leu Ile Gln Met Ala Phe Pro Ala Ala Pro Pro Trp Tyr Lys Asn Leu His Gly Leu Glu Pro Ala Asn Tyr Ser Met His Gly Ser Pro Gly Gly Leu Gly Arg Ile Asp Lys Leu Leu Gly Val Asp Met Tyr Thr Thr Gly Phe Ser Asn Ser Ser Ile Ile Phe Gly Ala Phe Pro Ser Leu His Ser Gly Cys Cys Ile Met Glu Val Leu Phe Leu Cys Trp Leu Phe Pro Arg Phe Lys Phe Val Trp Val Thr Tyr Ala Ser Trp Leu Trp Trp Ser Thr Met Tyr Leu Thr His His Tyr Phe Val Asp Leu Ile Gly Gly Ala Met Leu Ser Leu Thr Val Phe Glu Phe Thr Lys Tyr Lys Tyr Leu.Pro Lys Asn Lys Glu Gly Leu Phe Cys Arg Trp Ser Tyr Thr Glu Ile Glu Lys Ile Asp Ile Gln Glu Ile Asp Pro Leu Ser Tyr Asn Tyr Ile Pro Ile Asn Ser Asn Asp Asn Glu Ser Arg Leu Tyr Thr Arg Val Tyr Gln Glu Ser Gln Val Ser Pro Pro Ser Arg Ala Glu Thr Pro Glu Ala Phe Glu Met Ser Asn Phe Ser Arg Ser Arg Gln Ser Ser Lys Thr Gln Val Pro Leu Ser Asn Leu Thr Asn Asn Asp Gln Val Pro Gly Ile Asn Glu Glu Asp Glu Glu Glu Glu Gly Asp Glu Ile Ser Ser Ser Thr Pro Ser Val Phe Glu Asp Glu Pro Gln Gly Ser Thr Tyr Ala Ala Ser Ser Ala Thr Ser Val Asp Asp Leu Asp Ser Lys Arg Asn <210> 89 <211> 1179 <212> PRT
<213> Candida albicans <400> 89 Met Thr Ser Ser Ser Gln Leu Ser Ala Ser Ser Asn Glu Ser Ile Gln Asn Glu Arg Leu Leu Ser Ser Ser Leu Phe Asp Gln Ile Arg Pro Val Cys Ile Glu Leu Ser Glu Ala Ser Thr Ser Gln Pro Phe Asn Thr Asn Lys Val Val Asn Leu Met Ile Ser Met Glu Asp Ile Leu Lys Lys His His Asp Glu Tyr Asn Lys Asp Gly Asn Phe Arg Ile Tyr Gln Leu Ser Pro Lys Leu Ala Asp Tyr Ile Phe Tyr Pro Leu Ser Asn Ile Leu Lys Gln Pro Ala Leu Asp Asp Thr Ile Ile Gln His Leu Phe Gly Ile Ile Arg Phe Leu Val Glu Tyr Ser Trp Ser Phe Asn Val Asn Phe Val Leu Thr Asp Gln Leu Leu Pro Leu Val Ile Tyr Leu Ser Ser Gly Asp Leu Asn Lys Glu Pro Leu Leu Ile Thr Lys Lys Ser Ile Gln Phe Lys Ile Ala Thr Val Ser Val Leu Tyr Thr Ile Thr Ser Thr Leu Asn Lys Glu Tyr Phe Gln Ser Leu Thr Glu Lys Arg Leu Leu Phe Ile Ser Asn Val Ile Thr Ile Cys Leu Ser Ile Ile Val Gly Ser Arg Val Glu Ser Gln Asp Thr Ile Gln Leu Val Leu Lys Cys Leu Ser Leu Ile Ser Asn Val Lys Arg Tyr Leu Asn Ser Ser Gln Ile Ser Ile Ile Leu Pro Gly Ile Val Ser Ser Ile Thr Lys Phe Ile Ser Leu Asn Leu Asn Leu Asn Tyr Gln Ile Ile Ile Gln Phe Leu Arg Leu Leu Ser Gly Phe Ile Cys Ala Ser Phe Asn Asp Lys Glu Leu Asp Ala Gln Ile Glu Leu Asn Glu Gly Ile Ser Asp Ile Ser Glu Ile His Val Gly Trp Asp Asp Asp Asn Glu Thr Leu Gly Asn Asn Ser Leu Tyr Ser Asp Val Thr Ile Thr Glu Asn Asp His Arg Ser Ser Ala Trp Leu Lys Ala Thr Ser Lys Gln Leu Lys Leu Ser Leu Ile Ile Ile Phe Lys Ser Ile Leu Leu Gly Ser Arg Asn Arg His Arg Leu Arg Ser Lys Gln Glu Leu Tyr Asp Glu Ile Leu Gly Phe Val Glu Thr Ile Leu Lys Asn Cys Phe Asn Ser Leu Phe Lys Glu Phe Ala Ser Leu Ala Ile Asp Ile Val Ser Ile Leu Gly Tyr Val Thr Ser Glu Asp Asn Lys Glu Met Ala Asp Lys Thr Asn Lys Leu Ser Asn Thr Leu Cys Met Ile Ile Glu Gly Glu Thr Asn Lys Glu Glu Val Leu Phe Glu Leu Val Lys Thr Lys Leu Ala Asp Leu Ile Asp Asn Lys Leu Ser Gly Ile Val Phe Ala Leu Asp Glu Asp Lys Ile Ser Ser Thr Val Ala Ser Met Met Phe Asn Phe Ser Leu Leu Leu Cys Leu Ser Arg Lys Val Lys Leu Asp Cys Glu Asp Leu Asp Ser Leu Lys Gln Arg Cys Leu Ala Leu Leu Thr Glu Tyr Val Ala Asp Arg Phe Lys Phe Glu Ser Ser Lys Pro Ile Lys Ser Ser Asn Ala Ser Gly Leu Leu Glu Thr Ser Ser Met Thr Asn Gln Leu Asp Ser Ile Glu Leu Pro Gly Tyr Ile Asn Ala Lys Ser Val Val Lys Gln Glu Pro Leu Lys Lys Glu Gln Asp Lys Arg Ala Tyr Ile His Asn Leu Lys Thr Ile Ser Arg Asn Trp Asn Thr Asn Glu Ile Asn Asn Ser Ser Gly Asn Thr Leu Ile Gly Ile Ser Ser Lys Phe Ser Glu Thr Ile Leu Gln Asn Phe Ile Asn Tyr Leu Ser Ser Leu Lys Tyr Glu Ala Ser Asn Ser Ser Thr Leu Thr Glu Leu Glu Asn Ile Phe Glu Leu Ala Asp Asp Asn Asp Met Ile Thr Lys Ser Thr Ser Leu Trp Val Ala Ser Asn Tyr Tyr Lys Arg Ser Thr Leu Gly Lys Val Ile Asn Phe Asp Leu Gly Lys Tyr Leu Val Leu Asp Asp Asp Glu Asp Met Glu Ile Asp Asp Asp Thr Lys Glu Met Ser Phe Leu Val Leu Ser Arg Ala Glu Glu Leu Leu Glu Glu Ile Ser Glu Asn Gln Glu Lys Tyr Ser Ser Gln Thr Tyr Ile Leu Ala Tyr Asn Ala Ala Leu Gln Ser Ile Lys Val Val Ala Gly Ser Ile Pro Leu Asp Gln Phe Arg Thr Asn Phe Leu Met Asp His Leu Leu Ser Val Phe Gln Ala Leu Thr Tyr Asn Asp Met Pro Glu Ile Gln Leu Gln Ala Gln Ser Thr Leu Lys Val Val Leu Asp Thr Tyr Tyr Asn Gly Ser Met Val Asn Leu Ile Ser Asp Asn Ser Asp Tyr Leu Ile Asp Ser Ile Ser Leu Gln Met Ser Val Ala Ser Asn Leu Thr Pro Met Leu Pro Gly Ile Leu Leu Ile Ile Val Lys Ile Ala Gly Ile Gln Leu Leu Glu Ser Asn Gln Leu His Asp Val Leu Thr Asp Met Phe Val Ile Leu Asp Ser Phe His Gly Tyr Asn Lys Leu Val Glu Ser Phe Phe Ile Val Phe Glu Ala Leu Ile Asp Gln Ile His His Lys Phe Asp Ser Gln Leu Lys Val Glu Phe Lys Glu Ser Ser Lys Thr Asn Thr Ser Leu Tyr Lys Pro Trp Gly Met Thr Asn Lys Asp Gln Leu Leu Glu Leu Leu Asn Glu Ser Asn Lys Met Val Asp Lys Tyr Glu Gly Tyr Asp Ser Asn Lys Glu Tyr Phe Lys Arg Lys Ala Asp Leu Pro Phe Ser Glu Met Asp Ala Asp Ser Asp Asp Glu Glu Glu Asp Asp Glu Ala Asn Ile Asp Asp Asn Gly Glu Glu Glu Glu Glu Lys Glu Glu Ile Trp Ser Ser Pro Val Ser Lys Asp Ile Tyr Met Ile Ser Leu Arg Ile Phe Asn Tyr Gly Phe Thr Leu Val Ser Gln Glu Ser Tyr Thr Leu Lys Thr Gln Ile Ile Lys Thr Leu Arg Leu Leu Leu Pro Leu Leu Cys Thr Asn Tyr Lys Leu Leu Leu Pro Val Leu Ala Leu Asn Trp Gln Met Leu Ile Ala Leu Val Thr Gly Ser Lys Ser Leu Ser Thr Ser Ile Glu Ser Asn Gly Glu Tyr Ala Ser Glu Asp Ile Gly Val Met Thr Glu Ala Leu Gln Leu Val Thr Glu Ile Leu Glu Glu Asp Lys Arg Arg Tyr Glu His Phe Phe Ser Lys Lys Phe Gln Glu Ala Trp Glu Phe Ile Ser Arg His Ser Lys Leu Val Arg Gln Arg Glu Val Thr Ser Thr Thr Asn Ile Arg Glu Gln Lys Gln Leu Val Val Ser Glu Lys Ala Ile Tyr Thr Phe Arg Asn Tyr Pro Leu Leu Lys Thr Ser Leu Val Thr Phe Leu Ile Thr Gly Val Gln Asn Tyr Glu Lys Met Ile Pro Asp Ile His Arg Phe Glu Ile Ile Lys Leu Cys Tyr Glu Leu Gln Ile Pro Gln Ser Ile Pro Leu Ser Arg Asp Thr Ile Gly Val Leu Glu Val Leu Lys Asn Thr Thr <210> 90 <211> 278 <212> PRT
<213> Candida albicans <400> 90 Met Ser Ser Leu Phe Ile Asn Glu Glu Asp Asp Met Thr Pro Glu Pro Tyr Lys Pro Ser Thr Ser Thr-Ile Arg Glu Glu Glu Glu Glu Val Gln Val Lys Gln Glu Phe Pro Asp Glu Lys Met Val Asp Pro Asp Glu Asp Asp Pro Ile Val Glu Ser Ile Pro Leu Leu Ile Asn Thr Val Pro Glu Arg Ala Lys Gln Ser Leu His Val Leu Gln Tyr Ala Gly Arg Pro Lys Ser Arg Pro Asn Arg Ala Gly Asn Cys His Ala Ser Ile Lys Pro Glu Ser Gln Tyr Leu Gln Val Lys Val Pro Leu Asp Thr Glu Lys Phe Phe Asn Val Asp Lys Ile Gln Glu Trp Gly Glu Gln Ile Val Glu Gln Thr Ile Ser Gly Val Leu Asp Gly Ser Tyr Glu Val Gly Asn Tyr Ala Ala Lys Ile Ile Asn Asp Ser Asp Gly Arg Arg Val Val Leu Ile Pro Val Asp Ser Thr Val Gln Leu Lys Pro Ser Phe Lys Tyr Ile Asp Asp Leu Glu Ala Gln Ser Ile Gln Gln Arg Arg Gln Gln Glu Ser Thr Asn Glu Lys Pro Ala Asn Val Gln Ile Leu Gln Ser Ala Ala Lys His Ser Thr Gln Ser Gly Glu Phe Ser His Ser Leu Gly Asp Ser Leu Lys Ser Val Lys His Phe Glu Glu Glu Glu Trp Gln Asn Leu Ile Trp Lys Arg Gly Asp Asp Asp Val Thr Lys Ser Ile Lys Phe Gly Leu Asp His His Thr Asp Thr Asn Ile Glu Leu Lys Thr Asn Thr Ser Tyr Asp Glu Tyr Ile Asp Met Leu Ile Asn Asn <210> 91 <211> 492 <212> PRT
<213> Candida albicans <400> 91 Met Lys Gln His Pro Leu Val Thr Ala Tyr Lys Gly Ile Asp Asp Leu Gln Gln Leu Lys Lys Trp Phe Tyr Glu Tyr Asn Asp Thr Ile Asp His Arg Lys Lys Ala Ile Ser Lys Val Lys Gly Leu Leu Thr Arg Gly Lys Leu Pro His Gly Val Glu Ala Thr Ser Leu Leu Thr Ser Ile Val Leu Asp Asp Leu Gln Arg Lys Asp Ile Asp Ser Cys Val Leu Gln Leu Ser Tyr Thr Met Ala Leu Ile Arg Phe Val Asn Gly Leu Leu Asp Pro Tyr Gln Gln Ser Asn Tyr Ala Ile Pro Met His Leu Leu Ala Lys Gln Leu Asn Leu Pro Thr Tyr Phe Val Glu Leu Arg His Met Gly Thr His Glu Asn Leu Pro Ser Leu Asp Ile Leu Arg Ser Thr Cys Ser Lys Ala Leu Thr Trp Leu Tyr Asp Asn Tyr Trp Cys His Val Glu Glu Ala Asn Gln Asp Lys Gln Val Ser Ile Gly Gly Pro Leu Thr Asp Ala Val Glu Phe Arg Ser Asn Asp Leu Arg Thr Arg Ile Glu Asp Ser Gln Ile Tyr Asn Asn Leu Lys Ala Phe Lys Arg Ile Arg Lys Gln Asp Leu Asn Lys Val Tyr Glu Lys Asn Asp Thr Thr Ser Asp Leu Ala Ala Thr Tyr His Arg Cys Val Ser Asp Ile Val Glu Phe Ala Lys Glu Asn Cys Asp Leu Leu Val Asn Val Leu Leu Leu Lys Asn Tyr Leu Ile Tyr Pro Ser Ser Lys Val Lys Asp Lys Lys Ser Lys Phe Asn Pro Leu Ile Ile Lys Leu Tyr Glu Pro Leu Phe Asp Ala Leu Gly Leu Ser Phe Lys Leu Lys Cys Phe Ser Lys Thr Ile Glu Leu Ile Glu Ala Thr Pro Ser Ser Phe Val Asp Lys Lys Val Tyr Arg Lys Leu Gly Phe Thr Glu Lys Phe Glu Tyr Asp Glu Leu Phe Gln Val Met Glu Trp Val Leu Tyr Phe Met Gln Asp Leu Leu Arg Asn Glu Asn Val Pro Ser Pro Val His Asn Lys Asn Glu Leu Val Ile Leu Phe Leu Asp Ser Leu Lys Ser Ile Glu Gln Lys Ile Ser Gln Ser Leu Leu Pro Ser Phe Ala Lys Ile Leu Gln Gly Leu Cys Asp Val Val Asn Asp Gly Val Lys Ser Glu Ile Asp Pro Glu Thr Val Gln Lys Leu Asp Ala Trp Asn Lys Ser Leu Asn Asn Leu His Ser Thr Lys Lys Ile Phe Glu Leu Pro Pro Ser Leu Asp Asp Leu Leu Gly Leu Ser Pro Ser Pro Gly Pro Ile Pro Glu Thr Thr Ser Ser Asn Pro Met Lys His Val Leu Asp Asp Asp Asp Asp Glu Glu Glu Glu Gly Val Arg Arg Lys Gln His His Ser Ser Asp Ser Lys Thr Tyr Ile Leu Lys Pro His Lys Asn Trp Arg Pro Val Pro Phe Gly Thr Cys Ile <210> 92 <211> 409 <212> PRT
<213> Candida albicans <400> 92 Met Thr Ser Ser Ile Asn Ile Leu Leu Leu Leu His Pro Thr Val Val Thr Asp Ala Gln Leu Val Glu Gln Ile Lys Ser Lys Ile Tyr Gln Ser His Asn Asn Asn Asn Asn Asn Asn Gly Gly Thr Thr Thr Thr Thr Thr Gly Thr Val Asn Ile Asn Leu Asn Gln Gln Ile Ile Asp Arg Val Thr Lys Gly Ile Ile Glu Leu Pro Tyr Asp Tyr Tyr Asp Glu Ile Ile Tyr Ile Asn Pro Asn Asn Glu Ser Gln Tyr Arg Glu Ile Pro Ile Ser Leu Met Gln Leu Ile Tyr Lys Leu Leu Lys Ser Asn Gly Lys Phe Lys Gly Asp Leu Pro Leu Asp Gln Asn Leu Asp Val Leu Met Thr Gly Phe Ile Ile Glu Glu Glu Glu Lys Glu Lys Glu Lys Glu Glu Asn Asn Leu Glu Gly Glu Leu Val Asn Val Trp Val Lys Pro Ile Pro Val Asp Glu Pro Val Val Thr Leu Leu Lys Lys Lys Thr Thr Thr Ser Asn Thr Thr Thr Ile Lys Lys Ser Leu Pro Leu Phe Lys Lys Leu Asn Lys Asp Glu Ile Asn Asn Ser Asp Lys Asp Ile Asn Asn Asp Asn Ile Thr Asn Asn Asn Asn Asn Asn Asn Asn Lys Arg Lys Leu Val Glu Thr Lys Leu Thr Tyr Phe Ser Ser Asp Asp Glu Asn Ser Ser Asp Gly Ser Val Leu Glu Asn Asp Asp Ile Asp Asp Asp Asp Glu Leu Ile Asp Glu Asn Asp Leu Leu Asn Phe Asn Asn Asn Asn Asn Thr Asn Gly Gly Ser Leu Leu Ser Asp Lys Leu Ile Thr Pro Arg Lys Cys Asp Ile Ser Leu Asn Gly Gly Lys Lys Arg Lys Lys Ala Cys Lys Asp Cys Thr Cys Gly Leu Lys Glu Leu Glu Glu Leu Glu Val Ser Asn Gln Gln Asn Leu Gln Asp Gln Ile Leu Gly Lys Leu Ala Gln Ser Ala Thr Leu Glu Ala Ile Lys Ile Glu Glu Arg Leu Lys Gln Gln Gln Gln Gln Gln Gln Gln Lys Val Lys Val Lys Phe Thr Glu Glu Asp Leu Ser Glu Ile Asp Phe Thr Val Gln Gly Lys Thr Gly Gly Cys Gly Ser Cys Ala Leu Gly Asp Ala Phe Arg Cys Asp Gly Cys Pro Tyr Leu Gly Leu Pro Pro Phe Lys Pro Gly Glu Val Val Lys Leu Asp Gly Phe Gly Glu Asp Ile <210> 93 <211> 327 <212> PRT
<213> Candida albicans <400> 93 Met Ile Arg Thr Ile Lys Pro Lys Asn Ala Arg Ser Lys Arg Ala Leu Ala Lys Lys Glu Ala Lys Leu Val Glu Asn Thr Lys Ser Ala Leu Phe Val Pro Gly Ser Thr Gly Asn Lys Phe Leu His Asp Ala Met Cys Asp Leu Met Ala Phe Lys Lys Pro Phe Ala Lys Lys Phe Ser Lys Lys Asn Glu Ile Arg Pro Phe Glu Asp Ser Ser Gln Leu Glu Phe Phe Ala Glu Lys Asn Asp Ser Ser Leu Met Val Phe Ser Ser Asn Asn Lys Lys Arg Pro Lys Thr Leu Thr Phe Val Arg Phe Phe Asn Phe Lys Val Tyr Asp Met Ile Gly Leu Ser Ile Gln Glu Asn His Lys Leu Leu Gln Asp Phe Lys Lys Leu Thr Phe Thr Ile Gly Leu Lys Pro Met Phe Val Phe Asn Gly Pro Ile Phe Asp Ser His Pro Val Tyr Gln His Ile Lys Ser Leu Phe Leu Asp Phe Phe Arg Gly Glu Glu Thr Asp Leu Gln Asp Val Ala Gly Leu Gln Tyr Val Ile Ala Leu Ser Ala Gly Glu Val Glu Asp Leu Asn Asn Asp Lys Val Leu Pro Leu Val His Phe Arg Val Tyr Lys Leu Lys Ser Tyr Lys Ser Gly Gln Lys Leu Pro Arg Ile Glu Leu Asp Glu Ile Gly Pro Arg Phe Asp Phe Lys Ile Gly Arg Arg Ile Thr Pro Thr Pro Asp Val Glu Lys Glu Ala Thr Lys Lys Pro Lys Gln Leu Glu Ala Lys Val Lys Lys Asn Val Thr Thr Asp Phe Met Gly Asp Lys Val Ala Gln Ile His Val Gly Lys Gln Asp Leu Ser Lys Leu Gln Thr Arg Lys Met Lys Gly Leu Lys Glu Lys Tyr Asp Gln Glu Ser Glu Glu Glu Asp Val Tyr Val Ser Asp Glu Glu Tyr Phe Gly Glu Asp Ile Glu Glu Pro Glu Thr Lys Arg Gln Lys Val <210> 94 <211> 125 <212> PRT
<213> Candida albicans <400> 94 Met Ser Lys Thr Asn Thr Ala Ile Tyr Gln Lys Ile Ala Glu Lys Arg Ala Asn Leu Glu Arg Phe Arg Glu Phe Lys Glu Leu Thr Asp Asp Leu Val Leu Gln Leu Glu Ser Ile Gly Asp Lys Leu Glu Thr Met Asn Gly Gly Thr Ala Ser Val Ala Leu Ile Leu Ala Asn Trp Lys Ser Val Val Gln Ser Ile Ser Leu Ala Ser Leu Ala Leu Met Lys Glu Ser Asn Asp Asn Asn Lys Glu Ala Phe Pro Glu Pro Leu Val Arg Val Arg Val Gly Gln Ser Asn Glu Glu Asn Gln Asp Asp Glu Glu Ala Asp Glu Glu Glu Gly Val Arg Asp Ser Glu Glu Val Glu Glu Ser Thr Glu <210> 95 <211> 1120 <212> PRT
<213> Candida albicans <400> 95 Met Asp Tyr Gln Asp Leu Leu His Lys Ile Ile Lys Glu Phe His Ser Leu Lys Glu Phe Lys Pro Trp Asp Ser Ser Val Leu Tyr Glu Thr Leu Leu Arg Ser Val Leu Thr Thr Leu Ile Glu Leu Leu Gly Ile Asp Asn Pro Pro Ser Tyr Leu His Leu Thr Thr Asn Asn Asp Ser Ile Gly Asp Leu Lys Ile Lys Tyr Tyr Gly Asn Ala Leu Ser Lys Ser Ile Asn Gly His Ser Met Leu Gln Tyr Leu Glu Ser Lys His Val Ser Ile Leu Gln Ala Val Val Glu Ile Ile Asn Thr Arg Ser Tyr Arg Ile Lys Glu Ser Tyr Ser Ala Val Phe Lys Asp Val Ser His Leu Phe Glu Lys Leu Leu Lys Glu Arg Tyr Glu Ala Glu Ser Asn Leu Glu Asp Tyr Ile Leu Gln Cys Leu Met Tyr Glu Thr Gln Phe Tyr Gln Gly Ile Val Asp Asn Val Leu Thr Ala Asp Asp Thr Glu Lys Leu Ala Ser Phe Leu Gly Thr Arg Leu Ser Glu Glu Asp Ser Met Phe Ser Tyr Arg Asp Ile Asp Tyr Pro Leu Glu Leu Asn Ile Asn Asn Glu Ser Leu Glu Lys Ile Tyr Lys Ile Phe Leu Gly Val Ile Gly Thr Lys Arg Phe Asp Ile Lys Glu Val Ala Ser Ala Val Val Gly Val Tyr Lys Arg His Gln Arg Ile Asp His Phe Glu Lys Leu Asp Ser Asp Glu Ile Leu Gly Lys Phe Phe Arg Asn Ile Leu Pro Gln Ser Phe Gln Ser Val Thr Asn Lys Val Phe Arg Glu Phe His Lys Glu Val Asp Asp Pro Pro Ser Asp Val Leu Asp Gln Leu Asp Asn Ile Val Asp Asp Phe Ile Ala Val Gly Ile Glu Gly Val Asp Leu Gly Phe Pro Ala Leu Phe Arg His Tyr Ile Lys Phe Met Asn Glu Ile Phe Pro Thr Val Val Glu Asp Ala Asp Arg Asp Phe Val Ala Arg Ile Asn Ser Leu Ile Ala Gln Val Leu Glu Phe Lys Asp Asp Glu Lys Ser Cys Asp Ile Asn Gln Val Val Ser Glu Phe Val Ser Leu Gln Ser Leu Leu Leu Lys Asn Asn Tyr Leu Ser Pro Ser Thr Leu Leu Met Arg Ala Ser Thr His Asp Tyr Tyr Lys Asn Leu Gln Ile Val Lys Ile Thr Phe Asp Gly Trp Asn Glu Asn Ser Lys Arg Ile Leu Lys Leu Glu Asn Ser Gly Phe Leu Gln Ser Lys Thr Leu Pro Lys Tyr Leu Lys Leu Trp Tyr Ser Lys Ser Met Lys Leu Asn Glu Leu Cys Asn Arg Val Asp Glu Phe Tyr Asn Gly Glu Leu Cys Arg Lys Val Trp His Cys Trp Arg Ser Gln Gln Asn Val Tyr Asn Leu Lys Met Glu Val Ala Asp Lys Arg Leu Leu 465 470 475 ~ 480 Asn Gln Tyr Tyr Ile Lys Trp Arg Lys Lys Glu Lys Asp Met Lys Ala Asn Leu Thr Ile Ala Val Glu Phe Asp His Phe His Leu Leu Asp Lys Ser Phe Lys Ile Leu Lys Gly Tyr Phe Asn Leu Ala Lys Asn Ser Asp Val Leu Ala Met Ser Leu Phe Gln Ser Phe Glu Glu Asn Arg Asp Ser Arg Ile Lys Leu Lys Tyr Phe Gln Tyr Trp Asn Leu Lys Ile Ser Asp Arg Val His Gly Leu Thr Met Lys Leu Glu Lys Phe His Gln Val Lys Asp Lys Phe Val Leu Gly Asn Tyr Phe Glu Thr Trp Tyr Tyr Lys His Asn Leu Val Glu Lys Ser Asn Asn Phe Val Ser Ala Lys Asp Leu Gln Leu Leu Ala Lys Thr Phe Thr Asn Thr Trp Leu Lys Lys Phe Leu Leu Tyr Lys Lys Ala Phe Lys Ile Glu Glu Glu Leu Gly Ala Asp Leu Lys Arg Lys Thr Phe Asp Arg Trp Lys Glu Ala Val Gln Leu Glu Val Lys Ala Lys Glu Phe His Glu Arg His Leu Leu Glu Thr Ala Phe His Glu Trp Lys Leu Lys Ser Ile Leu Ile Ser Asn Arg Ala Ser Phe Asp His Ile Leu Val Gln Arg Cys Phe Gln Thr Trp Ser Val Glu Ile Lys Leu Arg Glu Leu Gln Gln Lys Gln Asp Thr Arg Leu Val Val Asn Ile Phe Gln Lys Trp Arg Thr Arg Gln Leu Glu Leu Ala Lys Leu Asp Glu Lys Ser Gln Ala Phe Tyr Glu Ser Asn Met Lys His Leu Val Val Gln Lys Trp Asn Val Glu Asn Ser Asn Ile Gly Leu Leu Glu Lys Arg Ala Asp Arg Phe Phe Ile Arg Arg Phe Phe Ile Gln Lys Trp Gln Ser Lys Met Thr Lys Tyr Glu Asp Ile Thr Val Tyr His Leu Glu Asp Glu Ile Ala Thr Lys Leu Ala Tyr Lys Val Trp Arg Gln Arg Tyr Phe Glu Asn Tyr Glu Glu Lys Leu Asp Asn Leu Leu Glu Thr Met Asp Thr Ser Ala Ala Asp Thr Val Arg Cys Ser Arg Tyr Phe Gly Leu Trp Arg Ala Lys Leu Gln Thr Val Lys Gln Ile Glu Glu Arg Val Ser Thr Ser Val Ala Pro Ser Val Ala Ile His Phe Lys Asn Trp His Val Lys Ser Gln Gln Lys Gln Glu Leu Leu Glu Asn Ala Leu Gln Phe Glu Glu Ile Asn Leu Ser Arg Phe Leu Leu Ile Trp Phe Gln Arg Leu Gln Glu Val Ser Gln Leu Glu Asp Gln Ala Glu Asp Leu Leu Ala Gln Thr Asn Phe Asn Leu Leu Arg Asn Ala Val His Lys Trp Ser Met Leu Tyr Asn Lys Asn Ile Lys Arg His Lys Gln Leu Cys Glu Asp Phe Ile Ala Arg Lys Glu Thr Ala Lys Val Arg Ser Ile Phe Asp Leu Trp Leu Tyr Lys Ile Lys Glu Ile Glu Ala Asn Thr Thr Ile Ile Ser Asn Pro Ser Pro Leu Ser Lys Arg Phe Gln His Gln Arg Glu Met Gly Leu Thr Pro Gln Lys Lys Asn Ser Pro Thr Lys Val Phe Thr Pro Thr Thr Ser Lys Asp Pro Ser Pro Thr Lys Leu Gln Glu Thr Thr Gln Arg Met Arg Asn Gln Asn Ile Ser Ala Leu Arg Glu His Phe Gly Arg Ala Arg Ala Ser Ser Thr Pro Lys Lys Leu Ser Pro Val Arg Leu Ser Tyr Thr Asn Ile Pro Ser Asn Leu Arg Pro Gln Ser Pro Pro Lys Phe Asp Asp Ser Asp Ile Ala Thr Ala Lys Ser Leu Gly Arg Ile Arg Pro Met Val Phe Pro Ile Asp Asp Gln Ala Asn Phe Ser Pro Met Asp Arg Thr Lys Leu Gln Ser Arg Asn Ala Met <210> 96 <211> 745 <212> PRT
<213> Candida albicans <400> 96 Met Ala Lys Arg Lys Ser Lys Gln Gln Asp Leu Glu Lys Lys Lys Lys Leu Lys Gln Ser Gln Asp Glu Gln Leu Ser Thr Gly Leu Phe Asn Asn Val Gly Gln Gly Gln His Gln Gly Asp Asp Asp Asp Glu Glu Gly Asp Glu Ile Asp Trp Asp Asn Gln Glu Met Asp Tyr Glu Leu Ile Pro Arg Lys Ile Thr Thr Lys Lys Thr Ile Glu Ala Leu Pro Ile Lys Lys Ser Asp Gly Thr Ile Glu Arg Val Val Arg Glu Val Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Pro Glu Glu Glu Pro Glu Leu Glu Asn Asp Val Glu Asn Glu Pro Ser Lys Gln Glu Asn Lys Glu Asn Lys Glu Glu Gly Asp Ile Asp Thr Asp Asp Thr Leu Thr Pro Gln Glu Lys Leu Ile Gln Thr Lys Glu Glu Ile Ala Glu Leu Gly Ser Lys Leu Ile Glu Asp Pro Glu Glu Asn Ile Val Cys Leu Thr Arg Leu Arg Lys Met Ser Glu Ser Lys Asn Phe Met Thr Ser Gln Leu Ser Ile Leu Ala Leu Ile Pro Ile Phe Lys Ser Leu Ala Pro Ser Tyr Lys Ile Arg Pro Leu Thr Asp Thr Glu Lys Arg Glu Lys Val Ser Arg Glu Ile Ala Lys Leu Arg Asn Phe Glu Gln Asn Leu Val Ile Asn Tyr Lys Ala Tyr Ile Glu Leu Leu Thr Lys Tyr Ser Lys Ile Ser Tyr Ser Asn Ser Met Asn Asn Asn Lys Ile Thr Ser Asp Gln Leu Lys Arg Gly Asn Ile Ala Leu Lys Ala Ala Thr Glu Leu Cys Leu Ser Ser Leu Arg His Phe Asn Phe Arg Glu Glu Leu Phe Thr Ile Ile Ile Lys Arg Leu Asn Lys Lys Pro Gln His Gln Gln Asp Tyr Pro Ile Phe Ile Lys Ser Leu Arg Val Leu Glu Thr Leu Leu Lys Asp Asp Ala Glu His Gly Asp Ile Thr Phe Asp Ile Ile Lys Ile Met Thr Lys Ser Ile Lys Asp Lys Lys Phe Arg Val Asp Glu Ser Val Val Asn Val Phe Leu Ser Ile Ser Leu Leu Glu Asp Tyr Asp Pro Asn Asn Asn Asn Asn Asn Lys Asp Asp His His Asn Thr Thr Leu Lys Pro Lys Leu Lys Lys Lys Asp Arg Ile His Leu Ser Lys Lys Glu Arg Lys Ala Arg Lys Glu Arg Lys Glu Ile Glu Glu Glu Ile Gln Lys Ala Glu Gln Ala Ile Thr Val Glu Gln Arg Glu Lys Tyr Gln Ala Gln Val Leu Lys Met Val Leu Thr Leu Tyr Leu Glu Ile Leu Lys Ala Gly Ser Ser Ser Ser Gln Leu Ile Asp Gly Asp Gly Lys Lys Thr Lys Asn Asp Ala Ser Leu Leu Met Gly Ala Val Leu Glu Gly Leu Ser Arg Phe Gly Gln Met Ser Asn Leu Asp Leu Leu Gly Asp Phe Leu Glu Val Leu Arg Glu Ile Met Thr Asp Ile Ile Glu Glu His Lys Gln Ser Gly Asp Asn Asp Asn Asp Asn Asp Asn Asp Asp Glu Ser Gly Gly Met Tyr Ser Gly Asn Glu Leu Arg Thr Ile Leu Leu Cys Ile Ala Thr Ser Phe Ser Leu Val Leu Asn His Asn Ser Met Gly Lys Leu Pro Met Ala Ile Asp Leu Ser Lys Phe Val Ser Thr Leu Tyr Ile Ile Leu Thr Asp Leu Ala Leu Asp Pro Asp Leu Glu Phe Ser His Lys Thr Leu Arg Leu Ala Asp Pro Leu Ser Ser Ser Ser Leu Ser Asn Glu Leu Glu Asn Asn Lys Pro Ala Val Asn Val Ser Thr Lys Ala Glu Leu Leu Leu Arg Cys Leu Asp Phe Ile Phe Phe Arg Ser Lys Asn Gly Thr Ile Pro Arg Ala Thr Ala Phe Ile Lys Arg Leu Tyr Ile Leu Thr Leu Gln Thr Pro Glu Lys Thr Ser Leu Ala Asn Leu Lys Phe Ile Gly Lys Leu Met Asn Arg Tyr Gly Glu Asn Ile Lys Gly Leu Trp Asn Thr Glu Glu Arg Ile Ser Gly Glu Gly Asn Tyr Ile Leu Gly Ile Glu Arg Gln Asn Lys Asp Lys Asp Val Glu Leu Glu Arg Ser Asn Ser Gly Ala Ala Thr Leu Trp Glu Asn Val Leu Leu Asp Lys His Tyr Ser Ile Met Ile Lys Asp Gly Ser Arg Ser Leu Met Lys Asn Ser Lys Ala Asn Thr Asn <210> 97 <211> 579 <212> PRT
<213> Candida albicans ~400> 97 Met Tyr Ile Thr Pro Asn Gln Tyr Ala Lys Thr Phe Gln Asp Ile Lys Arg Ser Ser Leu Ser His Ser Thr Cys Lys Leu Val Ile Phe Val Ser Cys Leu Asp Val Asp Ala Leu Cys Ala Ala Lys Ile Leu Ser Leu Leu Leu Arg Lys Glu Leu Ile Gln Tyr Gln Leu Ile Pro Thr Thr Gly Tyr Ser Asp Leu Lys Leu His Tyr Asp Lys Leu Asp Ser Glu Val Thr Asn Ile Ile Leu Ile Gly Cys Gly Ala Met Leu Asp Leu Glu Gly Phe Phe Asp Val Asn Pro Glu Glu Phe Leu Gly Asp Asn Ser Thr Thr Asn Gly His Thr Ile Asp Asn Asp Thr Glu Leu Glu Leu Asp Ala Val Lys Thr Asp Asn Phe Ala Leu Thr Arg Lys Ile Tyr Val Val Asp Gly His Arg Pro Trp Asn Leu Asp Asn Leu Phe Gly Ser Ala Met Val Val Cys Leu Asp Asn Gly Tyr Ile Asp Gly Asn Leu Asn Glu Glu Lys Glu Ala Tyr Asn Val Leu Val Glu Met Ser Asp Ser Glu Asp Glu Asp Glu Asp Glu Gly His Asn Gln Asn Gly His Thr Asp Asp Asp Gln Glu Gly Asp Lys Thr Asp Ala Asp Asp Glu Asn Asp Glu Ser Ser Val Ser Thr Ser Arg Lys Gly Val Lys Ser Ile Asn Glu Asp Lys Ile Gln Thr Tyr Tyr Asn Gln Ser Ser Thr Ile Ala Ser Ser Cys Ser Ile Thr Val Tyr Ala Leu Val Ser Ala Ile Gly Glu Thr Asn Val Asp Asn Leu Trp Leu Gly Ile Val Gly Ala Ser Gly Phe Asp Cys Ser Ile Phe Val Asp Glu Val Arg Arg Phe Ser Thr Asp Ser Gly Ile His Met Glu Arg Gly Thr Tyr Leu Pro Leu Leu Arg His Ser Ser Leu Tyr Asp Ala Leu Leu Tyr Asn Trp Ile Asp Gly Asp Lys Arg Ile His Lys Ile Leu Ala Lys Met Gly Val Pro Ile Val Ala Ala Lys Gln Gln Trp Gln Tyr Leu Asp Pro Pro Ile Lys Asn Lys Leu Pro Gly Leu Leu Lys Lys Tyr Leu Pro Glu Leu Pro Gln Val Glu Ile Phe Tyr Arg Cys Gly Val Thr Ser Met Asp Val Phe Val Ser Leu Thr Ala Leu Leu Glu Thr Gly Val Gly Leu Asn Asn Thr Ser Ala Asn Ser Ile Asp His Gly Asp Leu Glu Asp Glu Asn Glu Leu Ile Arg Arg Glu Ile Lys Ser Arg Glu Ser Ser Tyr Ile Arg Asn Phe Trp Ser Ala Phe Asp Ser Val Ser Ser Phe Gly Ile Ser Asn Asn Ile Gly Leu Glu Lys Gly Ile Thr Ala Ala Lys Leu Val Gln Lys Glu Leu Phe Gln Thr Ile Lys Tyr Ile Ile Glu Gln Lys Leu Ile Lys Asn Leu Lys Val Tyr Arg Leu Cys Ile Leu Lys Asp Glu Ser Ser His Ser Gly Phe Asp Asn Pro Val Leu Leu Ile Lys Leu Ser Asn Arg Ile Met Asp Tyr Leu Lys Gln Gln Thr Ser Lys Pro Leu Val Val Ala Ala Glu Leu Ser Asn Thr Tyr Phe Val Leu Gly Met Gly Ile Asn Asn Ala Phe Ser Lys Ile Ser Gly Ala Gln Met Lys Lys Asp Phe Phe Glu Ala Ser Leu Val Glu Ile Lys Lys Glu Asp Leu Ala Pro Phe Leu Glu Gln Leu Thr Phe Asn Leu <210> 98 <211> 1897 <212> PRT
<213> Candida albicans <400> 98 Met Ser Tyr Asn Asp Asn Asn Asn His Tyr Tyr Asp Pro Asn Gln Gln Gly Gly Met Pro Pro His Gln Gly Gly Glu Gly Tyr Tyr Gln Gln Gln Tyr Asp Asp Met Gly Gln Gln Pro His Gln Gln Asp Tyr Tyr Asp Pro Asn Ala Gln Tyr Gln Gln Gln Pro Tyr Asp Met Asp Gly Tyr Gln Asp Gln Ala Asn Tyr Gly Gly Gln Pro Met Asn Ala Gln Gly Tyr Asn Ala Asp Pro Glu Ala Phe Ser Asp Phe Ser Tyr Gly Gly Gln Thr Pro Gly Thr Pro Gly Tyr Asp Gln Tyr Gly Thr Gln Tyr Thr Pro Ser Gln Met Ser Tyr Gly Gly Asp Pro Arg Ser Ser Gly Ala Ser Thr Pro Ile Tyr Gly Gly Gln Gly Gln Gly Tyr Asp Pro Thr Gln Phe Asn Met Ser Ser Asn Leu Pro Tyr Pro Ala Trp Ser Ala Asp Pro Gln Ala Pro Ile Lys Ile Glu His Ile Glu Asp Ile Phe Ile Asp Leu Thr Asn Lys Phe Gly Phe Gln Arg Asp Ser Met Arg Asn Met Phe Asp Tyr Phe Met Thr Leu Leu Asp Ser Arg Ser Ser Arg Met Ser Pro Ala Gln Ala Leu Leu Ser Leu His Ala Asp Tyr Ile Gly Gly Asp Asn Ala Asn Tyr Arg Lys Trp Tyr Phe Ser Ser Gln Gln Asp Leu Asp Asp Ser Leu Gly Phe Ala Asn Met Thr Leu Gly Lys Ile Gly Arg Lys Ala Arg Lys Ala Ser Lys Lys $l Ser Lys Lys Ala Arg Lys Ala Ala Glu Glu His Gly Gln Asp Val Asp Ala Leu Ala Asn Glu Leu Glu Gly Asp Tyr Ser Leu Glu Ala Ala Glu Ile Arg Trp Lys Ala Lys Met Asn Ser Leu Thr Pro Glu Glu Arg Val Arg Asp Leu Ala Leu Tyr Leu Leu Ile Trp Gly Glu Ala Asn Gln Val Arg Phe Thr Pro Glu Cys Leu Cys Tyr Ile Tyr Lys Ser Ala Thr Asp Tyr Leu Asn Ser Pro Leu Cys Gln Gln Arg Gln Glu Pro Val Pro Glu Gly Asp Tyr Leu Asn Arg Val Ile Thr Pro Leu Tyr Arg Phe Ile Arg Ser Gln Val Tyr Glu Ile Tyr Asp Gly Arg Phe Val Lys Arg Glu Lys Asp His Asn Lys Val Ile Gly Tyr Asp Asp Val Asn Gln Leu Phe Trp Tyr Pro Glu Gly Ile Ser Arg Ile Ile Phe Glu Asp Gly Thr Arg Leu Val Asp Ile Pro Gln Glu Glu Arg Phe Leu Lys Leu Gly Glu Val Glu Trp Lys Asn Val Phe Phe Lys Thr Tyr Lys Glu Ile Arg Thr Trp Leu His Phe Val Thr Asn Phe Asn Arg Ile Trp Ile Ile His Gly Thr Ile Tyr Trp Met Tyr Thr Ala Tyr Asn Ser Pro Thr Leu Tyr Thr Lys His Tyr Val Gln Thr Ile Asn Gln Gln Pro Leu Ala Ser Ser Arg Trp Ala Ala Cys Ala Ile Gly Gly Val Leu Ala Ser Phe Ile Gln Ile Leu Ala Thr Leu Phe Glu Trp Ile Phe Val Pro Arg Glu Trp Ala Gly Ala Gln His Leu Ser Arg Arg Met Leu Phe Leu Val Leu Ile Phe Leu Leu Asn Leu Val Pro Pro Val Tyr Thr Phe Gln Ile Thr Lys Leu Val Ile Tyr Ser Lys Ser Ala Tyr Ala Val Ser Ile Val Gly Phe Phe Ile Ala Val Ala Thr Leu Val Phe Phe Ala Val Met Pro Leu Gly Gly Leu Phe Thr Ser Tyr Met Asn Lys Arg Ser Arg Arg Tyr Ile Ala Ser Gln Thr Phe 595 ~ 600 605 Thr Ala Asn Tyr Ile Lys Leu Lys Gly Leu Asp Met Trp Met Ser Tyr Leu Leu Trp Phe Leu Val Phe Leu Ala Lys Leu Val Glu Ser Tyr Phe Phe Ser Thr Leu Ser Leu Arg Asp Pro Ile Arg Asn Leu Ser Thr Met Thr Met Arg Cys Val Gly Glu Val Trp Tyr Lys Asp Ile Val Cys Arg Asn Gln Ala Lys Ile Val Leu Gly Leu Met Tyr Leu Val Asp Leu Leu Leu Phe Phe Leu Asp Thr Tyr Met Trp Tyr Ile Ile Cys Asn Cys Ile Phe Ser Ile Gly Arg Ser Phe Tyr Leu Gly Ile Ser Ile Leu Thr Pro Trp Arg Asn Ile Phe Thr Arg Leu Pro Lys Arg Ile Tyr Ser Lys Ile Leu Ala Thr Thr Glu Met Glu Ile Lys Tyr Lys Pro Lys Val Leu Ile Ser Gln Ile Trp Asn Ala Ile Val Ile Ser Met Tyr Arg Glu His Leu Leu Ala Ile Asp His Val Gln Lys Leu Leu Tyr His Gln Val Pro Ser Glu Ile Glu Gly Lys Arg Thr Leu Arg Ala Pro Thr Phe Phe Val Ser Gln Asp Asp Asn Asn Phe Glu Thr Glu Phe Phe Pro Arg Asn Ser Glu Ala Glu Arg Arg Ile Ser Phe Phe Ala Gln Ser Leu Ala Thr Pro Met Pro Glu Pro Leu Pro Val Asp Asn Met Pro Thr Phe Thr Val Phe Thr Pro His Tyr Ser Glu Lys Ile Leu Leu Ser Leu Arg Glu Ile Ile Arg Glu Asp Asp Gln Phe Ser Arg Val Thr Leu Leu Glu Tyr Leu Lys Gln Leu His Pro Val Glu Trp Asp Cys Phe Val Lys Asp Thr Lys Ile Leu Ala Glu Glu Thr Ala Ala Tyr Glu Asn Gly Asp Asp Ser Glu Lys Leu Ser Glu Asp Gly Leu Lys Ser Lys Ile Asp Asp Leu Pro Phe Tyr Cys Ile Gly Phe Lys Ser Ala Ala Pro Glu Tyr Thr Leu Arg Thr Arg Ile Trp Ala Ser Leu Arg Ser Gln Thr Leu Tyr Arg Thr Val Ser Gly Phe Met Asn Tyr Ala Arg Ala Ile Lys Leu Leu Tyr Arg Val Glu Asn Pro Glu Leu Val Gln Tyr Phe Gly Gly Asp Pro Glu Gly Leu Glu Leu Ala Leu Glu Arg Met Ala Arg Arg Lys Phe Arg Phe Leu Val Ser Met Gln Arg Leu Ser Lys Phe Lys Asp Asp Glu Met Glu Asn Ala Glu Phe Leu Leu Arg Ala Tyr Pro Asp Leu Gln Ile Ala Tyr Leu Asp Glu Glu Pro Ala Leu Asn Glu Asp Glu Glu Pro Arg Val Tyr Ser Ala Leu Ile Asp Gly His Cys Glu Met Leu Glu Asn Gly Arg Arg Arg Pro Lys Phe Arg Val Gln Leu Ser Gly Asn Pro Ile Leu Gly Asp Gly Lys Ser Asp Asn Gln Asn His Ala Val Ile Phe His Arg Gly Glu Tyr Ile Gln Leu Ile Asp Ala Asn Gln Asp Asn Tyr Leu Glu Glu Cys Leu Lys Ile Arg Ser Val Leu Ala Glu Phe Glu Glu Met Asn Val Glu His Val Asn Pro Tyr Ala Pro Asn Leu Lys Ser Glu Asp Asn Asn Thr Lys Lys Asp Pro Val Ala Phe Leu Gly Ala Arg Glu Tyr Ile Phe Ser Glu Asn Ser Gly Val Leu Gly Asp Val Ala Ala Gly Lys Glu Gln Thr Phe Gly Thr Leu Phe Ala Arg Thr Leu Ala Gln Ile Gly Gly Lys Leu His Tyr Gly His Pro Asp Phe Leu Asn Ala Thr Phe Met Leu Thr Arg Gly Gly Val Ser Lys Ala Gln Lys Gly Leu His Leu Asn Glu Asp Ile Tyr Ala Gly Met Asn Ala Met Met Arg Gly Gly Lys Ile Lys His Cys Glu Tyr Tyr Gln Cys Gly Lys Gly Arg Asp Leu Gly Phe Gly Ser Ile Leu Asn Phe Thr Thr Lys Ile Gly Ala Gly Met Gly Glu Gln Met Leu Ser Arg Glu Tyr Phe Tyr Leu Gly Thr Gln Leu Pro Leu Asp Arg Phe Leu Ser Phe Tyr Tyr Gly His Pro Gly Phe His Ile Asn Asn Leu Phe Ile Gln Leu Ser Leu Gln Val Phe Ile Leu Val Leu Gly Asn Leu Asn Ser Leu Ala His Glu 1315 1320 132'5 Ala Ile Met Cys Ser Tyr Asn Lys Asp Val Pro Val Thr Asp ~Val Leu Tyr Pro Phe Gly Cys Tyr Asn Ile Ala Pro Ala Val Asp Trp Ile Arg Arg Tyr Thr Leu Ser Ile Phe Ile Val Phe Phe Ile Ser Phe Ile Pro Leu Val Val Gln Glu Leu Ile Glu Arg Gly Val Trp Lys Ala Phe Gln Arg Phe Val Arg His Phe Ile Ser Met Ser Pro Phe Phe Glu Val Phe Val Ala Gln Ile Tyr Ser Ser Ser Val Phe Thr Asp Leu Thr Val Gly Gly Ala Arg Tyr Ile Ser Thr Gly Arg Gly Phe Ala Thr Ser Arg Ile Pro Phe Ser Ile Leu Tyr Ser Arg Phe Ala Asp Ser Ser Ile Tyr Met Gly Ala Arg Leu Met Leu Ile Leu Leu Phe Gly Thr Val Ser His Trp Gln Ala Pro Leu Leu Trp Phe Trp Ala Ser Leu Ser Ala Leu Met Phe Ser Pro Phe Ile Phe Asn Pro His Gln Phe Ala Trp Glu Asp Phe Phe Leu Asp Tyr Arg Asp Phe Ile Arg Trp Leu Ser Arg Gly Asn Thr Lys Trp His Arg Asn Ser Trp Ile Gly Tyr Val Arg Leu Ser Arg Ser Arg Ile Thr Gly Phe Lys Arg Lys Leu Thr Gly Asp Val Ser Glu Lys Ala Ala Gly Asp Ala Ser Arg Ala His Arg Ser Asn Val Leu Phe Ala Asp Phe Leu Pro Thr Leu Ile Tyr Thr Ala Gly Leu Tyr Val Ala Tyr Thr Phe Ile Asn Ala Gln Thr Gly Val Thr Ser Tyr Pro Tyr Glu Ile Asn Gly Ser Thr Asp Pro Gln Pro Val Asn Ser Thr Leu Arg Leu Ile Ile Cys Ala Leu Ala Pro Val Val Ile Asp Met Gly Cys Leu Gly Val Cys Leu Ala Met Ala Cys Cys Ala Gly Pro Met Leu Gly Leu Cys Cys Lys Lys Thr Gly Ala Val Ile Ala Gly Val Ala His Gly Val Ala Val Ile Val His Ile Ile Phe Phe Ile Val Met Trp Val Thr Glu Gly Phe Asn Phe Ala Arg Leu Met Leu Gly Ile Ala Thr Met Ile Tyr Val Gln Arg Leu Leu Phe Lys Phe Leu Thr Leu Cys Phe Leu Thr Arg Glu Phe Lys Asn Asp Lys Ala Asn Thr Ala Phe Trp Thr Gly Lys Trp Tyr Asn Thr Gly Met Gly Trp Met Ala Phe Thr Gln Pro Ser Arg Glu Phe Val Ala Lys Ile Ile Glu Met Ser Glu Phe Ala Gly Asp Phe Val Leu Ala His Ile Ile Leu Phe Cys Gln Leu Pro Leu Leu Phe Ile Pro Leu Val Asp Arg Trp His Ser Met Met Leu Phe Trp Leu Lys Pro Ser Arg Leu Ile Arg Pro Pro Ile Tyr Ser Leu Lys Gln Ala Arg Leu Arg Lys Arg Met Val Arg Lys Tyr Cys Val Leu Tyr Phe Ala Val Leu Ile Leu Phe Ile Val Ile Ile Val Ala Pro Ala Val Ala Ser Gly Gln Ile Ala Val Asp Gln Phe Ala Asn Ile Gly Gly Ser Gly Ser Ile Ala Asp Gly Leu Phe Gln Pro Arg Asn Val Ser Asn Asn Asp Thr Gly Asn His Arg Pro Lys Thr Tyr Thr Trp Ser Tyr Leu Ser Thr Arg Phe Thr Gly Ser Thr Thr Pro Tyr Ser Thr Asn Pro Phe Arg Val <210> 99 <211> 400 <212> PRT
<213> Candida albicans <400> 99 Met Ser Phe Arg Thr Thr Ser Met Arg Met Ala Arg Leu Ala Thr Ala Lys Ala Thr Leu Ser Lys Arg Thr Phe Ser Leu Leu Ala Asn Ala Thr Thr Arg Tyr Thr Ala Ala Ser Ser Ala Ala Lys Ala Met Thr Pro Ile Thr Ser Ile Arg Gly Val Lys Thr Ile Asn Phe Gly Gly Thr Glu Glu Val Val His Glu Arg Ala Asp Trp Pro Lys Glu Arg Leu Leu Asp Tyr Phe Lys Asn Asp Thr Phe Ala Leu Ile Gly Tyr Gly Ser Gln Gly Tyr Gly Gln Gly Leu Asn Leu Arg Asp Asn Gly Leu Asn Val Ile Ile Gly Val Arg Lys Gly Ser Ser Trp Glu Ala Ala Val Glu Asp Gly Trp Val Pro Gly Glu Asn Leu Phe Glu Val Asp Glu Ala Ile Ser Arg Gly Thr 8$

Ile Ile Met Asp Leu Leu Ser Asp Ala Ala Gln Ser Glu Thr Trp Phe His Ile Lys Pro Gln Leu Thr Glu Gly Lys Thr Leu Tyr Phe Ser His Gly Phe Ser Pro Val Phe Lys Asp Leu Thr His Val Glu Pro Pro Ser Asn Ile Asp Val Ile Leu Ala Ala Pro Lys Gly Ser Gly Arg Thr Val Arg Ser Leu Phe Lys Glu Gly Arg Gly Ile Asn Ser Ser Tyr Ala Val Trp Asn Asp Val Thr Gly Lys Ala Glu Glu Lys Ala Ile Ala Met Ala Ile Ala Ile Gly Ser Gly Tyr Val Tyr Lys Thr Thr Phe Glu Arg Glu Val Asn Ser Asp Leu Tyr Gly Glu Arg Gly Cys Leu Met Gly Gly Ile His Gly Met Phe Leu Ala Gln Tyr Glu Val Leu Arg Glu Asn Gly His Thr Pro Ser Glu Ala Phe Asn Glu Thr Val Glu Glu Ala Thr Gln Ser Leu Tyr Pro Leu Ile Gly Lys Tyr Gly Met Asp Tyr Met Tyr Asp Ala Cys Ser Thr Thr Ala Arg Arg Gly Ala Leu Asp Trp Tyr Pro Arg Phe Lys Asp Ala Leu Lys Pro Val Phe Glu Glu Leu Tyr Glu Ser Val Lys Asn Gly Ser Glu Thr Lys Arg Ser Leu Glu Phe Asn Ser Arg Ser Asp Tyr Lys Glu Arg Leu Glu Glu Glu Leu Gln Thr Ile Arg Asn Met Glu Ile Trp Arg Val Gly Lys Glu Val Arg Lys Leu Arg Pro Glu Asn Gln <210> 100 <211> 278 <212> PRT
<213> Candida albicans <400> 100 Met Phe Lys Gln Ser Ile Arg Ser Leu Ala Thr Lys Ser Pro Ile Ser Ser Ala Ala Ala Thr Thr Thr Thr Ala Ser Thr Thr Ser Thr Thr Thr Thr Ala Ser Leu Asn Phe Ala Lys Pro Pro Ser Tyr Thr Leu Ala Gln Leu Arg Glu Phe Pro Ser Leu Glu Pro Lys Thr Phe Ile Pro Leu Pro Thr Thr Phe Phe Asn Thr Glu Lys Pro Ile Arg Arg Asp Ile Leu Trp Ser Cys Val Thr Tyr Glu Ala Asp Lys Ala Arg Val Gly Ser Asn Tyr Ala Ile Leu Lys Ser Asp Ser Pro Tyr Ser Asn Arg Lys Leu Arg Pro Gln Lys Gly Ser Gly Arg Ala Arg Leu Gly Asp Ala Asn Ser Pro His Met Asp Asn Glu Ile Lys Ala His_ Ala Ile Lys Gly Pro His Asp Trp Ser Thr Asp Leu Pro Ser Lys Ile Tyr Ser Arg Gly Ile Gln Asn Ala Phe Thr Met His Tyr Lys Gln Gly Asn Leu Asn Val Val Glu Asn Glu Leu Asp Phe Gln Tyr Gly Tyr Asp Ile Ile Thr Gln Ser Phe Val Ser Val His Asn Leu Asn Lys Leu Asn Leu Leu Phe Ile Thr Asn Glu Pro Arg Asp Asn Leu Met Glu Ser Ile Lys Lys Phe Tyr Ile Asn Glu Lys Glu Phe Asn Ser Leu Asn Lys Lys Glu Lys Pro Lys Tyr Leu Gln Lys Leu Lys Gly Lys Val Leu Thr Lys Glu Asp Val Glu Val Arg Asp Ile Leu Arg Ala His Arg Val Phe Ile Glu Ser Ser Ala Leu Gln Trp Phe Ile Thr Lys His Thr Val <210> 101 <211> 448 <212> PRT
<213> Candida albicans <400> 101 Met Arg Glu Val Ile Ser Ile Asn Val Gly Gln Ala Gly Cys Gln Ile Gly Asn Ala Cys Trp Glu Leu Tyr Ser Gln Glu His Gly Ile Arg Pro Asp Gly Tyr Leu Gln Glu Gly Leu Asp Arg Pro Lys Gly Gly Glu Glu Gly Phe Ser Thr Phe Phe Ser Glu Thr Gly Ser Gly Lys Tyr Val Pro Arg Ala Leu Tyr Val Asp Leu Glu Pro Asn Val Ile Asp Glu Val Arg Thr Gly Val Tyr Lys Asp Leu Phe His Pro Glu Gln Leu Ile Ala Gly Lys Glu Asp Ala Ala Asn Asn Tyr Ala Arg Gly His Tyr Thr Val Gly Arg Glu Ile Leu Asp Asp Ile Leu Asp Arg Val Arg Arg Met Ser Asp Gln Cys Asp Gly Leu Gln Gly Phe Leu Phe Thr His Ser Leu Gly Gly Gly Thr Gly Ser Gly Leu Gly Ser Leu Leu Leu Glu Gln Leu Ser Leu Asp Tyr Gly Lys Lys Ser Lys Leu Glu Phe Ala Val Tyr Pro Ala Pro Gln Val Ser Thr Ser Val Val Glu Pro Tyr Asn Thr Val Leu Thr Thr His Thr Thr Leu Glu His Ala Asp Cys Thr Phe Met Val Asp Asn Glu Ala Ile Tyr Asp Met Cys Arg Arg Asn Leu Asp Ile Ala Arg Pro Asn Phe Ser Ser Leu Asn Asn Leu Ile Ala Gln Val Val Ser Ser Val Thr Ala Ser Leu Arg Phe Asp Gly Ser Leu Asn Val Asp Leu Asn Glu Phe g7 Gln Thr Asn Leu Val Pro Tyr.Pro Arg Ile His Phe Pro Leu Val Ser Tyr Ala Pro Val Phe Ser Lys Ser Arg Ala Thr His Glu Ala Asn Ser Val Ser Glu Ile Thr Gln Ser Cys Phe Glu Pro Gly Asn Gln Met Val Lys Cys Asp Pro Arg Thr Gly Lys Tyr Met Ala Thr Cys Leu Leu Tyr Arg Gly Asp Val Val Thr Arg Asp Val Gln Asn Ala Val Ala Gln Val Lys Ser Lys Lys Thr Val Gln Leu Val Asp Trp Cys Pro Thr Gly Phe Lys Ile Gly Ile Cys Tyr Gln Pro Pro Thr Ala Ile Lys Gly Ser Glu Leu Ala Ser Ala Ser Arg Ala Val Cys Met Leu Ser Asn Thr Thr Ala Ile Ala Glu Ala Trp Arg Arg Ile Asp Arg Lys Phe Asp Leu Met Tyr Ser Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu Gly Met Glu Glu Gly Glu Phe Thr Glu Ala Arg Glu Asp Leu Ala Ala Leu Glu Arg Asp Tyr Ile Glu Val Gly Thr Asp Ser Phe Pro Glu Glu Glu Glu Glu Tyr <210> 102 <211> 275 <212> PRT
<213> Candida albicans <400> 102 Met Lys Thr Ser Val Phe Ile Ala Ile Phe Asn Leu Leu Val Cys Ala Leu Ala Tyr Thr Asp Leu Thr Gly Ser Ile Lys Ile Asn Asp Lys Lys Ile Thr Leu Gly Glu Phe Asn Thr Gln Glu Val Lys Gln Leu Thr Ile Asn Ser Pro Lys Asp Ile Ile Glu Ile Asp Leu Lys Ser Lys Asp Ile Lys Gly Lys Pro Glu Gln Ile Met Val Ser Leu Ala Asp Val Lys Asn Pro Ala Ile Ser Thr His Tyr Val Pro Val Val Lys Glu Ser Lys Ile Lys Leu Asn Ile Lys Ala Leu Ser Ile Pro Glu Val Leu Lys Thr Lys Asp Lys Leu Val Leu Thr Ile Val Ile Ala Asp Ser Lys Ser Lys Asn Asn Met Ile Arg Arg Leu Val Glu Val Leu Pro Ser Pro Glu Phe Lys Ser Thr Ser Arg Tyr Gln Ala Lys Pro Arg Ile Gly Ile Gln Pro Glu Ile His His Ile Phe Arg Glu Asp Glu Arg Thr Val Asn Pro Ile Val Pro Val Val Phe Ile Ile Ala Ala Phe Thr Leu Leu Leu Gly Leu Phe Gly Ser Trp Val Gly Phe Ile Gly Ile Asp Asn Leu Phe Arg Thr Phe Lys Thr Ile Ser Lys Val Gln Leu Leu His Asn Val Ser Phe Leu Ile Ser Val Leu Gly Phe Glu Leu Asn Phe Val Lys Tyr Tyr Leu Gly Gln Ser Ile Phe Thr Thr Leu Phe Tyr Gly Phe Ile Leu Ser Ile Pro Cys Val Tyr Phe Gly Val Ser Val Leu Arg Ser Leu Ala Lys Asn Arg Ala Leu Gly Lys <210> 103 <211> 193 <212> PRT
<213> Candida albicans <400> 103 Met Leu Met Tyr Thr Ile Leu Ile Pro Ser Leu Leu Tyr Ile Ala Leu Thr Ile Ala Ser Ser Glu Leu Leu Asn Ser Ile Gln Gly Thr Trp Gln Ser Gln Ser Glu Arg Val Ile Thr Gly Pro Thr Phe Phe Asp Pro Gln Lys Glu Leu Leu Glu Glu Pro Lys Leu Pro Gly Ile Ser Tyr Ser Phe Lys Asn Gly Tyr Trp Glu Ser Ala Gln Tyr Ile Val Met Gly Asn Asn Arg Asn His Gln Cys Pro Gln Ala Met Leu Ile Trp Gln His Gly Lys Tyr Asn Leu Lys Arg Gly Lys Leu Val Leu Ile Pro Asn Arg Asn Asp Gly Arg Gln Leu Ile Ser Asp Pro Cys Leu Asp Asn Gly Lys Ser Glu Tyr Lys Arg Phe His Asn Gly Glu Thr Leu Glu Val Asp Ile Arg Phe Asp Gly Tyr Phe Gly Asn Trp Lys Leu Val Leu Val Asp Tyr Leu Thr Gly Lys Lys Lys Gln Pro Met Trp Leu Thr Ser Arg Asn Ala Thr Met Leu Pro Thr Gly Thr Ile Thr Ser Thr Lys Arg Lys Tyr Val Lys Lys Glu <210> 104 <211> 432 <212> PRT
<213> Candida albicans <400> 104 Met Ser Lys Ala Phe Ser Ala Pro Gly Lys Ala Phe Leu Ala Gly Gly Tyr Leu Val Leu Glu Pro Ile Tyr Asp Ala Tyr Val Thr Ala Leu Ser Ser Arg Met His Ala Val Ile Thr Pro Lys Gly Thr Ser Leu Lys Glu Ser Arg Ile Lys Ile Ser Ser Pro Gln Phe Ala Asn Gly Glu Trp Glu Tyr His Ile Ser Ser Asn Thr Glu Lys Pro Lys Glu Val Gln Ser Arg Ile Asn Pro Phe Leu Glu Ala Thr Ile Phe Ile Val Leu Ala Tyr Ile Gln Pro Thr Glu Ala Phe Asp Leu Glu Ile Ile Ile Tyr Ser Asp Pro Gly Tyr His Ser Gln Glu Asp Thr Glu Thr Lys Thr Ser Ser Asn Gly Glu Lys Thr Phe Leu Tyr His Ser Arg Ala Ile Thr Glu Val Glu Lys Thr Gly Leu Gly Ser Ser Ala Gly Leu Val Ser Val Val Ala Thr Ser Leu Leu Ser His Phe Ile Pro Asn Val Ile Ser Thr Asn Lys Asp Ile Leu His Asn Val Ala Gln Ile Ala His Cys Tyr Ala Gln Lys Lys Ile Gly Ser Gly Phe Asp Val Ala Thr Ala Ile Tyr Gly Ser Ile Val Tyr Arg Arg Phe Gln Pro Ala Leu Ile Asn Asp Val Phe Gln Val Leu Glu Ser Asp Pro Glu Lys Phe Pro Thr Glu Leu Lys Lys Leu Ile Ala Ser Asn Trp Glu Phe Lys His Glu Arg Cys Thr Leu Pro His Gly Ile Lys Leu Leu Met Gly Asp Val Lys Gly Gly Ser Glu Thr Pro Lys Leu Val Ser Arg Val Leu Gln Trp Lys Lys Glu Lys Pro Glu Glu Ser Ser Val Val Tyr Asp Gln Leu Asn Ser Ala Asn Leu Gln Phe Met Lys Glu Leu Arg Glu Met Arg Glu Lys Tyr Asp Ser Asp Pro Glu Thr Tyr Ile Lys Glu Leu Asp His Ser Val Glu Pro Leu Thr Val Ala Ile Lys Asn Ile Arg Lys Gly Leu Gln Ala Leu Thr Gln Lys Ser Glu Val Pro Ile Glu Pro Asp Val Gln Thr Gln Leu Leu Asp Arg Cys Gln Glu Ile Pro Gly Cys Val Gly Gly Val Val Pro Gly Ala Gly Gly Tyr Asp Ala Ile Ala Val Leu Val Leu Glu Asn Gln Val Gly Asn Phe Lys Gln Lys Thr Leu Glu Asn Pro Asp Tyr Phe His Asn Val Tyr Trp Val Asp Leu Glu Glu Gln Thr Glu Gly Val Leu Glu Glu Lys Pro Glu Asp Tyr Ile Gly Leu <210> 105 <211> 768 <212> PRT
<213> Candida albicans <400> 105 Met Ser Asp Leu Thr Pro Ile Lys Leu Pro Ser Ser Ala Pro Phe Pro Val Val Ile Ser Ser Val Leu Cys Lys Pro Gly Asp Thr Ile Ser Lys His Lys Thr Ile Phe Lys Tyr Lys Tyr Trp Asp Tyr Gln Asp Asp Pro Thr Ser Lys Glu Asp Pro Pro Lys Lys Ile Arg Val Glu Arg Leu Gly Thr Phe Glu Ser Pro Ile Glu Gly Glu Ile Asp Gln Ile Asn Ile Lys Pro Leu Gln Glu Val Met His Ser Asp Val Asp Leu Leu Phe Val Lys Glu Ala Cys Pro His Thr Val Gln Tyr Ser Gly Leu Cys Ala Leu Cys Gly Lys Ser Leu Glu Glu Glu Lys Asp Tyr Ser Gly Tyr Asn Tyr Glu Asp Arg Ala Thr Ile Glu Met Ser His Asp Asn Thr Gly Leu Lys Ile Ser Phe Asp Glu Ala Ala Lys Ile Glu His Asn Thr Thr Asp Arg Leu Ile Asp Glu Arg Lys Leu Ile Leu Val Val Asp Leu Asp Gln Thr Val Ile His Ala ~Thr Val Asp Pro Thr Val Gly Glu Trp Gln Ser Asp Pro Ala Asn ~ro~Asn Tyr Ala Ala Val Lys Asp Val Lys Thr Phe Cys Leu Glu Glu Glu Ala Ile Val Pro Pro Gly Trp Thr Gly Pro Lys Leu Ala Pro Thr Lys Cys Thr Tyr Tyr Val Lys Leu Arg Pro Gly Leu Ser Glu Phe Leu Glu Lys Met Ala Glu Lys Tyr Glu Met His Ile Tyr Thr Met Ala Thr Arg Asn Tyr Ala Leu Ser Ile Ala Lys Ile Ile Asp Pro Asp Gly Lys Tyr Phe Gly Asp Arg Ile Leu Ser Arg Asp Glu Ser Gly Ser Leu Thr His Lys Asn Leu Lys Arg Leu Phe Pro Val Asp Gln Ser Met Val Val Ile Ile Asp Asp Arg Gly Asp Val Trp Gln Trp Glu Ser Asn Leu Ile Lys Val Val Pro Tyr Asp Phe Phe Val Gly Ile Gly'Asp Ile Asn Ser Ser Phe Leu Pro Lys Lys Asn Gly Gln Leu Thr Gly Pro Thr Lys Lys Arg Lys Ser Ile Ala Lys Leu Glu Ala Ala Ala Glu Leu Ala Lys Glu Ser Asp Thr Asn Asn Asp Lys Gln Glu Thr Glu Ser Gly Glu Glu Glu Gly Glu Glu Asp Ala Asp Gly His Ser Asp Val Ser Asn Ser Pro Val Glu Arg Ile Leu Glu Leu Gly Gly Gly Glu Gly Asn Thr Ser Leu Leu Leu Glu Gln Ser Leu Thr Arg Asn Gln Ser Ile Glu Glu Gln Gln Gln Lys Arg Pro Leu Ala Lys Leu Gln His Asp Leu Glu Gln Met His Glu His Arg His Asp Ser Asp Ser Lys Ser Glu Ser Gly Ser Asp Asp Glu Ser Asp Glu Glu Asp Asn Leu Leu Phe Asp Asp Asp Asn Glu Leu Ala Ala Leu Asp Lys Val Leu Gly Asn Ile His Gln Gly Tyr Tyr Asn Leu Phe Asp Lys Asp Lys Ile Asn Lys Pro Asp Leu Thr Glu Ile Ile Pro Ser Met Lys Ser Lys Thr Leu Glu Gly Ile Thr Val Leu Phe Ser Gly Ile Ile Pro Leu Gly Ile Asn Leu Asp Ser Ala Asp Ile Val Ile Trp Cys Arg Gln Phe Gly Val Lys Val Val Asn Glu Val Tyr Pro Glu Val Thr His Val Val Cys Arg Asp Val Ser Glu Gly Ala Gly Pro Thr Phe Lys Thr Arg Val Ala Arg Lys Leu Tyr Pro Asp Thr Ile Lys Ile Val Asn Pro Asp Trp Leu Phe Ala Cys Leu Ser Asn Trp Thr Lys Val Asp Glu Lys Asp Tyr Leu Ile Ser Thr Asp Asp Thr Lys Leu Trp Thr Val Lys Glu Asn Glu Ile Thr Lys Tyr Gln Lys Ala Leu Glu Asp Arg Ser Ala Leu Ala Asn Ala Thr His Ile Asp Ser Ile Glu Ser Phe Asp Glu Tyr Asp Leu Asp Glu Ala Asn Gln Glu Val Asp Asp Phe Leu Ala Gly Leu Ser Asp Asp Asp Glu Glu Glu Glu Glu Glu Glu Glu Asp Glu Glu Ile Glu Asn Pro Glu Ser Asn Asn Asp Asp Glu Glu Ile Tyr Glu G1n Ser Thr Asn Gly His Asp Ser Phe Ile Lys Asp Ala Tyr Ser Lys Lys Arg Asn Arg Asp Glu Glu Glu Val Gln Leu Val Lys Lys Gln Lys Ile Glu Asn Gly Glu Asn Gly Glu Asn Glu Asn Glu Asn Asp Leu Asp Asp Leu Glu Lys Glu Leu Leu Asp Gly Phe Asp Asp Leu Glu Glu <210> 106 <211> 1042 <212> PRT
<213> Candida albicans <400> 106 Met Gly Lys Lys Ala Ile Asp Ala Arg Ile Pro Ala Leu Ile Arg Asn Gly Val Gln Glu Lys Gln Arg Ser Phe Phe Ile Ile Val Gly Asp Lys Ala Arg Asn Gln Leu Pro Asn Leu His Tyr Leu Met Met Ser Ala Asp Leu Lys Met Asn Lys Ser Val Leu Trp Ala Tyr Lys Lys Lys Leu Leu Gly Phe Thr Ser His Arg Gln Lys Arg Glu Ala Lys Ile Lys Lys Asp Ile Lys Arg Gly Ile Arg Glu Val Asn Glu Gln Asp Pro Phe Glu Ala Phe Ile Ser Asn Gln His Ile Arg Tyr Val Tyr Tyr Lys Glu Thr Glu Lys Ile Leu Gly Asn Thr Tyr Gly Met Cys Ile Leu Gln Asp Phe Glu Ala Ile Thr Pro Asn Leu Leu Ala Arg Thr Ile Glu Thr Val Glu Gly Gly Gly Leu Val Val Ile Leu Leu Lys Asn Met Thr Ser Leu Lys Gln Leu Tyr Thr Met Ser Met Asp Ile His Ser Arg Tyr Arg Thr Glu Ala His Asp Asp Val Val Ala Arg Phe Asn Glu Arg Phe Leu Leu Ser Leu Gly Ser Cys Glu Asn Cys Leu Val Val Asp Asp Glu Leu Asn Val Leu Pro Ile Ser Gly Gly Lys His Val Lys Pro Leu Pro Pro Lys Asp Asp Asp Glu Leu Thr Pro Asn Ala Lys Glu Leu Lys Glu Leu Lys Glu Ser Leu Ala Asp Val Gln Pro Ala Gly Ser Leu Val Ala Leu Ser Lys Thr Ile Asn Gln Ala Gln Ala Ile Leu Thr Phe Ile Asp Val Ile Ser Glu Lys Thr Leu Arg Asn Thr Val Thr Leu Thr Ala Gly Arg Gly Arg Gly Lys Ser Ala Ala Leu Gly Ile Ala Ile Ala Ala Ala Ile Ser His Gly Tyr Ser Asn Ile Phe Val Thr Ser Pro Ser Pro Glu Asn Leu Lys Thr Leu Phe Glu Phe Ile Phe Lys Gly Phe Asp Ala Leu Gly Tyr Thr Glu His Met Asp Tyr Asp Ile Ile Gln Ser Thr Asn Pro Ser Phe Asn Lys Ala Ile Val Arg Val Asp Val Lys Arg Glu His Arg Gln Thr Ile Gln Tyr Ile Ser Pro Asn Asp Ser His Val Leu Gly Gln Ala Glu Leu Leu Ile Ile Asp Glu Ala Ala Ala Ile Pro Leu Pro Ile Val Lys Lys Leu Met Gly Pro Tyr Leu Ile Phe Met Ala Ser Thr Ile Asn Gly Tyr Glu Gly Thr Gly Arg Ser Leu Ser Leu Lys Leu Ile Gln Gln Leu Arg Thr Gln Ser Asn Asn Ala Thr Pro Ser Glu Thr Thr Val Val Ser Arg Asp Lys Lys Ser Asn Glu Ile Thr Gly Ala Leu Thr Arg Thr Leu Lys Glu Val Val Leu Asp Glu Pro Ile Arg Tyr Ala Pro Gly Asp Pro Ile Glu Lys Trp Leu Asn Lys Leu Leu Cys Leu Asp Val Ser Leu Ser Lys Asn Ala Lys Phe Ala Thr Lys Gly Thr Pro His Pro Ser Gln Cys Gln Leu Phe Tyr Val Asn Arg Asp Thr Leu Phe Ser Tyr His Pro Val Ser Glu Ala Phe Leu Gln Lys Met Met Ala Leu Tyr Val Ala Ser His Tyr Lys Asn Ser Pro Asn Asp Leu Gln Leu Met Ser Asp Ala Pro Ala His Gln Leu Phe Val Leu Leu Pro Pro Ile Glu Ala Gly Asp Asn Arg Val Pro Asp Pro Leu Cys Val Ile Gln Leu Ala Leu Glu Gly Glu Ile Ser Lys Glu Ser Val Arg Lys Ser Leu Ser Arg Gly Gln Arg Ala Gly Gly Asp Leu Ile Pro Trp Leu Ile Ser Gln Gln Phe Gln Asp Glu Glu Phe Ala Ser Leu Ser Gly Ala Arg Val Val Arg Ile Ala Thr Asn Pro Glu Tyr Ser Gly Met Gly Tyr Gly Ser Arg Ala Met Glu Leu Leu Arg Asp Tyr Tyr Ser Gly Lys Phe Thr Asp Ile Ser Glu Ser Thr Glu Leu Asn Asp His Thr Ile Thr Arg Val Thr Asp Ser Glu Leu Ala Asn Ala Ser Leu Lys Asp Glu Ile Lys Leu Arg Asp Val Lys Thr Leu Pro Pro Leu Leu Leu Lys Leu Ser Glu Lys Ala Pro Tyr Tyr Leu His Tyr Leu Gly Val Ser Tyr Gly Phe Thr Ser Gln Leu His Lys Phe Trp Lys Lys Ala Gly Phe Thr Pro Val Tyr Leu Arg Gln Thr Pro Asn Glu Leu Thr Gly Glu His Thr Ser Val Val Ile Ser Val Leu Pro Gly Arg Glu Asp Lys Trp Leu His Glu Phe Ser Lys Asp Phe His Lys Arg Phe Leu Ser Leu Leu Ser Tyr Glu Phe Lys Lys Phe Gln Ala Ser Gln Ala Leu Ser Ile Ile Glu Ala Ala Glu Gln Gly Glu Gly Asp Glu Thr Thr Ser Gln Lys Leu Thr Lys Glu Gln Leu Asp Ser Leu Leu Ser Pro Phe Asp Leu Lys Arg Leu Asp Ser Tyr Ala Asn Asn Leu Leu Asp Tyr His Val Ile Val Asp Met Leu Pro Leu Ile Ser Gln Leu Phe Phe Ser Lys Lys Thr Gly Gln Asp Ile Ser Leu Ser Ser Val Gln Ser Ala Ile Leu Leu Ala Ile Gly Leu Gln His Lys Asp Met Asp Gln Ile Ala Lys Glu Leu Asn Leu Pro Thr Asn Gln Ala Met Ala Met Phe Ala Lys Ile Ile Arg Lys Phe Ser Thr Tyr Phe Arg Lys Val Leu Ser Lys Ala Ile Glu Glu Ser Met Pro Asp Leu Glu Asp Glu Asn Val Asp Ala Met Asn Gly Lys Glu Thr Glu 930 935 ~ 940 Gln Ile Asp Tyr Lys Ala Ile Glu Gln Lys Leu Gln Asp Asp Leu Glu Glu Ala Gly Asp Glu Ala Ile Lys Glu Met Arg Glu Lys Gln Arg Glu Leu Ile Asn Ala Leu Asn Leu Asp Lys Tyr Ala Ile Ala Glu Asp Ala Glu Trp Asp Glu Lys Ser Met Asp Lys Ala Thr Lys Gly Lys Gly Asn Val Val Ser Ile Lys Ser Gly Lys Arg Lys Ser Lys Glu Asn Ala Asn Asp Ile Tyr Glu Lys Glu Met Lys Ala Val Lys Lys Ser Lys Lys Ser Lys Lys <210> 107 <211> 127 <212> PRT
<213> Candida albicans <400> 107 Met Ala Ala Phe Asp Glu Ile Phe Asp Tyr Val Asp Arg Asp Thr Phe Phe Gln Tyr Phe Arg Leu Thr Leu Val Val Cys Thr Tyr Leu Ile Phe Arg Lys Tyr Tyr Ser Ser Trp Ala Ile Lys Lys Gln Thr Ala Thr Gln Leu Glu Gln Asp Lys Arg Glu Gln Ser Glu Lys Ser Glu Arg Glu Ala Lys Glu Ser Lys Glu Lys Phe Asp Thr Ile Ser Asn Glu Ala Lys Glu Phe Gly Trp Gly Lys Lys Thr Arg Asn Asn Val Lys Leu Thr Glu Ala Val Leu Ala Glu Tyr Ser Glu Gln Gln Arg Gln Arg Asn Gln Thr Ser Tyr Asp Ala Gln Glu Asp Ala Asp Ile Asp Asp Leu Leu Glu Asp <210> 108 <211> 289 <212> PRT
<213> Candida albicans <400> 108 Met Ser Phe Arg Gly Gly Gly Gly Ser Gly Gly Arg Ser Thr Gln Arg Thr Ile Leu Pro Phe Gly Leu Asp Tyr Ala Asp Ile Ile Ser Ser Thr Gln Glu Thr Glu Lys Pro Gln Leu Leu Leu Pro Ile Asn Gly Asp Ile Thr Glu Ile Glu Ser Ile Ile Ala Lys Gln Ser Met Asn Phe Thr Lys Leu Met Ser Glu Gly Pro Phe Phe Thr Gly Asn Leu Asp Ser Ile Glu Ile Thr Lys Lys Arg Asn His Asn Asp Ser Glu Asn Glu Glu Glu Glu Glu Glu Glu Gly Gly Asp Thr Glu Asn Thr Gly Asp Arg Lys Lys Lys Lys Ser Lys Thr Asn Gly Asp Gly Ser Ser Ser Gly Ser Gly Ser Gly Ser Ala Ser Gly Asp Gly Ile Glu Arg Tyr Ser Asp Arg Tyr Lys Lys Ile Gln Lys Ile Gly Arg Thr Ile Asp Glu His Pro Tyr Gln Pro Glu Tyr Phe Pro Ser Glu Leu Tyr Ser Val Met Gly Ile Thr Asn Lys His Asp Lys Lys Lys Phe Leu Leu Leu Ser Lys Phe Lys Ser Asn Gly Gly Leu Lys Gln Ile Leu Ser Asn Glu Lys Leu Glu Asn Leu Asp Glu Gln Ser Lys Leu Asn Ser Met Lys Glu Lys Met Leu Ser Met Ile Asp Asn Ser Val Asn Val Asn Asp Asp Asp Asn Asn Asn Asp Gly Lys Thr Arg Ser Gly Asp Glu Gln Glu Ile Asp Glu Asp Asp Leu Asp Asp Glu Phe Glu Asp Glu Asp Asp Asp Asp Tyr Asn Ala Glu Lys Tyr Phe Asp Asp Gly Asp Asp Asp Asp Gly Gly Asp Asp Gly Gly Asp Asp Glu Ala Ala Phe <210> 109 <211> 507 <212> PRT
<213> Candida albicans <400> 109 Met Leu Ala Ser Lys Lys Lys Arg Thr Arg Arg Ile Lys Arg Gln Pro Ile Cys Glu Gln Ile Pro Thr Ser Asn Thr Ala Phe Phe Phe Thr Leu Asp Ile Pro Ile Met Pro Val Asn Phe Leu Thr Ser Val Val Phe Asp Gly Pro Glu Val Ile Pro Tyr Trp Asp Gln Ile Lys Glu Tyr Gly Pro Thr Val Leu Pro Ile Leu Leu Thr Leu Ala Gly Ala Lys Tyr Tyr Phe His Gly Ala Thr Asn Thr Trp Glu Arg Asp Met His Gly Lys Val Phe Met Ile Thr Gly Gly Thr Ser Gly Ile Gly Ala Gln Ile Ala Tyr Glu Leu Gly Gln Arg Gly Ala Gln Leu Ile Leu Leu Thr Arg Arg Thr Asn Asp Gln Trp Val Ala Glu Tyr Ile Glu Asp Leu Arg Asp Lys Thr Asn Asn Gly Leu Ile Tyr Ala Glu Glu Cys Asp Leu Ser Ser Leu Tyr Ser Ile Arg Lys Phe Ala Thr Arg Trp Leu Asp Asn Gln Pro Pro Arg Arg Leu Asp Gly Val Ile Cys Cys Ala Ala Glu Cys Ile Pro Arg Gly Lys Ser Arg Gln Ile Thr Met Asp Gly Val Glu Arg Gln Ile Gly Ile Asn Tyr Leu Ala His Phe His Leu Leu Thr Leu Leu Gly Pro Ser Leu Arg Val Gln Pro Pro Asp Arg Asn Val Arg Val Leu Ile Ala Thr Cys Ser Ser Gln Asn Leu Gly Asp Val Asp Leu Asn Asp Leu Leu Trp ~Ser Asn Lys Arg Tyr Pro Ala Thr Gln Pro Trp Lys Val Tyr Gly Thr Ser Lys Leu Leu Leu Gly Leu Phe Ala Lys Glu Tyr Gln Arg Gln Leu Met Gly Tyr Glu Arg Lys Asp Lys Ala Pro Cys Asn Val Arg Ile Asn Leu Ile Asn Pro Gly Ile Val Arg Thr Pro Ser Thr Arg Arg Phe Leu Ser Leu Gly Thr Val Trp Gly Leu Ile Ile Tyr Leu Ile Leu Phe Pro Ile Trp Trp Leu Phe Phe Lys Ser Ala Glu Gln Gly Ala Gln Ser Phe Tyr Phe Ala Leu Phe Ala Pro Ile Phe Met Lys Ile Glu Gly Gly Asn Val Val Gln Glu Cys Lys Ile Met Thr Lys Val Arg Lys Glu Tyr Thr Asp Asp Asp Leu Gln Gln Lys Val Phe His Asn Thr Glu Glu Leu Ile Lys Gln Ile Glu Thr Lys Ser Ala Ile Glu Arg Lys Lys His Glu Asn Ala Lys Lys Thr Pro Glu Gln Lys Ala Lys Glu Arg Gln Glu Glu Leu Asn Arg Lys Arg Asp Leu His Ile Lys Pro Glu Thr Pro Glu Glu Leu Glu Ser Lys Leu Asn Ser Leu Arg Asn Gln Ile Gly Met Gly Thr Gly Ile Ser Ser Asn Glu Met Pro Leu Phe Pro Asp Asp Glu Thr Leu Lys Lys Val Ile Ser Ser Lys Lys Asn Ala Ser Ser Asn Asn Ser Gly Gly Ser Lys Ser Asn Lys Ser Gln Lys Lys Ser Lys Lys Val <210> 110 <211> 330 <212> PRT
<213> Candida albicans <400> 110 Met Thr Asp Met Ser Asn Thr Thr Thr Asp Gly Asn Val Ser Ser Ile Val Val Pro Gly Gln Tyr Ile Ser Pro Thr Tyr Lys Leu Glu Asn Ser Asn Asn Asp Ser Ser Ile Pro Val Lys Tyr Ile Pro Gly Ser Gly Thr Ile Ile Ser Asn Ile Asn Ile Pro Ser Pro Asn Thr Ser Thr Asn Ser Val Lys Ser Met Pro Ile Ile Val Ser Thr Ile Leu Gly Asn Val Ser Ile Ser Pro Ile Asp Gln Thr Pro Thr Ser Lys Pro Ser Asn Asn Asp Asp Met Val Ile Asp Asn Glu Gln Thr Lys Ser Asp Glu Asp Lys Asp Lys Asp Lys Tyr Val Lys Ser Tyr Leu Val. Ser Val Ile Pro Lys Ser Thr Lys His Gln Ser Thr Thr Ser Thr Thr Thr Ser Asn Gln Ser Gly Ser Lys Ala Ile Ser Ala Ile Ala Leu Pro Lys Glu Asn Asp Ile Val Leu Val Arg Ile Thr Lys Ile Thr Lys Ile Gln Ala Tyr Cys Glu Ile Ile Ser Leu Asp Thr Thr Thr Asn Ile Leu Pro Asp Ser Gly Leu Gly Asn Asn Gly Asn Gly Ser His Val Ser Met Ser Ile Thr Gly Ser Asn Ser Gln His Asn Phe Asn Gln Asn Ser Ile Ala Ser Ser Gln Ser Thr Asn Gln Ser Val Gln Ile Tyr Glu Leu Gly Glu Asn Phe Lys Gly Ile Ile Arg Ile Asn Asp Ile Arg Ser Thr Glu Arg Asp Lys Leu Lys Leu Ile Asp Cys Phe Lys Pro Gly Asp Ile Val Lys Ala Gln Val Ile Ser Leu Gly Asp Gly Ser Asn Tyr Tyr Leu Thr Thr Ala Lys Asn Glu Leu Gly Val Val Phe Ala Lys Ser Glu Asn Gly Ala Gly Asp Leu Met Tyr Pro Ile Asp Trp Gln Asn Met Ile Asp Ile Asn Ser Gly Val Ile Glu Lys Arg Lys Asn Ala Asn Pro Phe Leu Gln <210> 111 <211> 221 <212> PRT
<213> Candida albicans <400> 111 Met Ala Gly Asp Leu Asn Leu Lys Lys Ser Trp Asn Pro Ala Leu Val Lys Asn Gln Gln Lys Val Trp Glu Glu Glu Gln Gln Lys Leu Asp Glu Leu Lys Arg Ile Lys Glu Arg Asn Gln Glu Tyr Lys Gln Glu Gln Glu Tyr Leu Glu Leu Leu Lys Leu Gln His Gly Asp Gln Phe Gln Ile Lys Asp Leu Asn Lys Gln Gln Lys Leu Lys Ile Ser Lys Leu Asn Trp Met Tyr Asp Asp Val Pro Phe Glu Gly Asn Glu Lys Val Glu Glu Asn Ser Ser Gly Phe Ile Glu Ser Asn Val Glu Phe Thr Asp Gly Lys Ser Lys Val Glu Asn Leu Leu Lys Gly Asn His Val Val Gly Lys Lys Arg Asp Gly Ser Gly Thr Ser Asp Arg Ile Asn Lys Ile Ile Gly Val Gly Met Thr Lys Ser Ser Lys Val Ser Tyr Ser Asp Asp Pro Leu Leu Lys Ile Lys Gln Gln Gln Gln Gln Ala Gln Arg Val Ala Arg Lys Gln His Pro Ser Asp Lys His Ser His Arg Phe Arg His Ser Ser Lys Ser Ser Ser Asp Arg Val His Lys Ser His Glu His Glu Arg Ser Arg Lys His Asn Ser Ser His Thr Arg His Lys Asp Gly Ser Pro His Arg <210> 112 <211> 778 <212> PRT
<213> Candida albicans <400> 112 Met Leu Lys Asn Asp Thr Val Phe Thr Lys Asp Ile Ser Cys Thr Ala Ile Thr Gly Lys Asp Ala Trp Asn Pro Thr Pro Gln Pro Ile Thr Ile Ser Leu Ser Phe Thr Asp Phe Lys Ala Ser Glu Leu Asp Asn Leu Lys Ser Ile Asn Tyr Ala Val Ile Thr Arg Asn Val Thr Glu Phe Met Lys Ser Asn Glu His Leu Asn Phe Lys Ser Leu Gly Asn Ile Ala Gln Ala Ile Ser Asp Ile Gly Leu Asp Gln Ser Arg Gly Gly Gly Ser Ile Val Asp Val Thr Ile Lys Ser Leu Lys Ser Glu Ile Arg Ala Glu Ser Val Glu Tyr Lys Ile Asn Arg Asn Thr Leu Gly Gln Pro Val Pro Leu Asp Ile Phe Gln Val Asn Lys Leu Arg Leu Leu Ile Ile Val Phe Thr Phe Glu Arg Leu Gln Lys Gln Ile Val Asp Val Asp Gln Phe Lys Ile Pro Asn Ser Asn Leu Tyr Phe His Gln Ile Ile Ala Asp Ile Val Ser Tyr Val Glu Ser Ser Asn Phe Lys Thr Val Glu Ala Leu Val Ser Lys Ile Gly Gln Leu Thr Phe Gln Lys Tyr Asp Gly Val Ala Glu Val Val Ala Thr Val Thr Lys Pro Asn Ala Ser His Val Glu Gly Val Gly Val Ser Ser Thr Met Val Lys Asn Phe Lys Asp Met Glu Pro Val Lys Phe Glu Asn Thr Ile Ala Gln Thr Asn Arg Ala Phe Asn Leu Pro Val Glu Asn Glu Lys Thr Glu Asp Tyr Thr Gly Tyr His Thr Ala Phe Ile Ala Phe Gly Ser Asn Thr Gly Asn Gln Val Glu Asn Ile Thr Asn Ser Phe Glu Leu Leu Gln Lys Tyr Gly Ile Thr Ile Glu Ala Thr Ser Ser Leu Tyr Ile Ser Lys Pro Met Tyr Tyr Leu Asp Gln Pro Asp Phe Phe Asn Gly Val Ile Lys Val Asn Phe Gln Asn Ile Ser Pro Phe Gln Leu Leu Lys Ile Leu Lys Asp Ile Glu Tyr Lys His Leu Glu Arg Lys Lys Asp Phe Asp Asn Gly Pro Arg Ser Ile Asp Leu Asp Ile Ile Leu Tyr Asp Asp Leu Gln Leu Asn Thr Glu Asn Leu Ile Ile Pro His Lys Ser Met Leu Glu Arg Thr Phe Val Leu Gln Pro Leu Cys Glu Val Leu Pro Pro Asp Tyr Ile His Pro Ile Ser Ala Glu Ser Leu His Ser His Leu Gln Gln Leu Ile Asn Asp Lys Pro Gln Glu Thr Val Gln Glu Ser Ser Asp Leu Leu Gln Phe Ile Pro Val Ser Arg Leu Pro Val Lys Asp Asn Ile Leu Lys Phe Asp Gln Ile Asn His Lys Ser Pro Thr Leu Ile Met Gly Ile Leu Asn Met Thr Pro Asp Ser Phe Ser Asp Gly Gly Lys His Phe Gly Lys Glu Leu Asp Asn Thr Val Lys Gln Ala Glu Lys Leu Val Ser Glu Gly Ala Thr Ile Ile Asp Ile Gly Gly Val Ser Thr Arg Pro Gly Ser Val Glu Pro Thr Glu Glu Glu Glu Leu Glu Arg Val Ile Pro Leu Ile Lys Ala Ile Arg Gln Ser Ser Asn Pro Asp Leu Ser Lys Val Leu Ile Ser Val Asp Thr Tyr Arg Arg Asn Val Ala Glu Gln Ser Leu Leu Val Gly Ala Asp Ile Ile Asn Asp Ile Ser Met Gly Lys Tyr Asp Glu Lys Ile Phe Asp Val Val Ala Lys Tyr Gly Cys Pro Tyr Ile Met Asn His Thr Arg Gly Ser Pro Lys Thr Met Ser Lys Leu Thr Asn Tyr Glu Ser Asn Thr Asn Asp Asp Ile Ile Glu Tyr Ile Ile Asp Pro Lys Leu Gly His Gln Glu Leu Asp Leu Ser Pro Glu Ile Lys Asn Leu Leu Asn Gly Ile Ser Arg Glu Leu Ser Leu Gln Met Phe Lys Ala Met Ala Lys Gly Val Lys Lys Trp Gln Ile Ile Leu Asp Pro Gly Ile Gly Phe Ala Lys Asn Leu Asn Gln Asn Leu Ala Val Ile Arg Asn Ala Ser Phe Phe Lys Lys Tyr Ser Ile Gln Ile Asn Glu Arg Val Asp Asp Val Thr Ile Lys His Lys Tyr Leu Ser Phe Asn Gly Ala Cys Val Leu Val Gly Thr Ser Arg Lys Lys Phe Leu Gly Thr Leu Thr Gly Asn Glu Val Pro Ser Asp Arg Val Phe Gly Thr Gly Ala Thr Val Ser Ala Cys Ile Glu Gln Asn Thr Asp Ile Val Arg Val His Asp Val Lys Glu Met Lys Asp Val Val Cys Ile Ser Asp Ala Ile Tyr Lys Asn Val <210> 113 <211> 148 <212> PRT
<213> Candida albicans <400> 113 Met Ser Asp Ile Asp Ile Asp Asn Val Leu Asn Leu Glu Glu Glu Gln Tyr Glu Leu Gly Phe Lys Glu Gly Gln Ile Gln Gly Thr Lys Asp Gln Tyr Leu Glu Gly Lys Glu Tyr Gly Tyr Gln Thr Gly Phe Gln Arg Phe Leu Ile Ile Gly Tyr Ile Gln Glu Leu Met Lys Phe Trp Leu Ser His Ile Asp Gln Tyr Asn Asn Ser Ser Ser Leu Arg Asn His Leu Asn Asn Leu Glu Asn Ile Leu Ala Gln Ile Ser Ile Thr Asn Gly Asp Lys Glu Val Glu Asp Tyr Glu Lys Asn Ile Lys Lys Ala Arg Asn Lys Leu Arg Val Ile Ala Ser Ile Thr Lys Glu Thr Trp Lys Ile Asp Ser Leu Asp Asn Leu Val Lys Glu Val Gly Gly Thr Leu Gln Val Ser Glu Asn Pro Asp Asp Met Trp <210> 114 <211> 269 <212> PRT
<213> Candida albicans <400> 114 Met. Arg Gln Lys Arg Ala Lys Ala Tyr Lys Lys Gln Met Ser Val Tyr Val His Ala Phe Lys Phe Arg Glu Pro Tyr Gln Ile Ile Val Asp Asn Glu Leu Ile Thr Thr Cys Gln Ser Ala Ser Phe Asp Ile Asn Lys Gly Phe Thr Arg Thr Ile Gln Ala Glu Asn Lys Pro Met Ile Thr Gln Cys Cys Ile Gln Ala Leu Tyr Asp Thr Lys Asn Gln Pro Ala Ile Asp Ile Ala Lys Ser Phe Glu Arg Arg Lys Cys Asn His Arg Glu Ala Ile Asp Pro Ser Gln Cys Ile Glu Ser Ile Val Asn Ile Lys Gly Gln Asn Lys His Arg Tyr Ile Val Ala Ser Gln Asp Leu Gln Leu Arg Lys Lys Leu Arg Lys Ile Pro Gly Val Pro Leu Ile Tyr Met Asn Arg Ser Val Met Val Met Glu Pro Ile Ser Asp Val Ser Asn Gln Tyr Asn Met Asn Tyr Glu Ser Lys Lys Leu Thr Gly Gly Leu Asn Asp Ile Glu Ala Gly Lys Leu Glu Lys Gln Asn Glu Gly Glu Asp Gly Asp Gly Asp Glu Ser Glu Val Lys Lys Lys Lys Arg Lys Gly Pro Lys Glu Pro Asn Pro Leu.Ser Val Lys Lys Lys Lys Thr Asp Asn Ala Thr Ala Ala Ser Thr Asn Gln Glu Gln Lys Lys Lys Pro Asn Arg Arg Lys Arg His Gly Lys Ser Lys Ala Glu Glu Lys Glu Asp Gln Glu Gln Glu Gln Val Asn Glu Ala Thr Thr Asn Glu Asp Ala Gln Glu Ala Ile Thr Ala Thr Glu <210> 115 <211> 306 <212> PRT
<213> Candida albicans <400> 115 1~1 Met Thr Asp Leu Thr Pro Leu Phe Arg Gln Cys Val Asp Ile Val Gln Gln Glu Tyr Lys Thr Gln Pro Thr Thr Ala Lys Gln Pro Tyr Tyr Leu Asn Asp Thr Phe Ile Lys Glu Thr Thr Ala Phe Phe His Val Leu Thr Asn Leu Asn Gln Phe Ile Asn Glu Thr Lys Ser Ser Tyr Leu Ala Ile Asn Asp Asp Thr Lys Leu Ala Gly Ser Ile Asp Asp Lys Asn Lys Ile Asp Glu Glu Phe Asn Tyr Lys Val Gln Gln Met Tyr Lys Arg Leu Asn His Leu Glu Thr Tyr Glu Thr Lys Arg Gln Ser Leu Leu Pro Lys Thr Ser Gly Trp Phe Ser Phe Leu Asp Glu Ser Asn Asp Gln Asp Ile Tyr Phe Glu Thr Leu Ala Asn His Arg Met Gln Ile Leu Arg Phe Leu Met Glu Thr Leu Asn His Val Asn Lys Arg Phe Glu Asn Ile Gln Gln Lys Arg Leu Ala Arg Glu Arg Gln Leu Asn Leu Leu Asn Phe Gln Asn Phe Glu Asp Gly Glu Glu Leu Glu Asp Val Phe Pro Thr Leu Asp Gln Ile Gln Gln Val Pro Glu Leu Ser Gln Gln Gln Ile Gln Gln Leu Glu Thr Glu Asn Gln Glu Phe Leu Asn Met Lys Thr Ser Gln Leu Lys Gln Val Glu Lys Val Gln Gln Ser Ile Leu Asp Ile Val Asn Ile Gln Asn Glu Leu Ala Phe Lys Leu Gln Asp Gln Gly Gln Gln Ile Glu Ser Leu Met Asp Ser His Ala Asp Val Gln Thr Glu Val Gln Met Gly Asn Arg Thr Leu Ser Gln Ala Thr Lys Lys Asn Lys Arg Gly Ala Asn Met Leu Val Met Leu Cys Ile Val Leu Gly Val Leu Leu Val Leu Val Asp Tyr Val Ser Phe <210> 116 <211> 192 <212> PRT
<213> Candida albicans <400> 116 Met Ser Gly Ile Lys Ile Ser Leu Lys Lys Lys Asn Pro Lys Leu Lys Lys Leu Ile Val Asn Asn Ser Gln Gln Thr Asp Glu Ser Ser Glu Gln Gln Lys Lys Leu Ile Thr Ser Tyr Ser Thr Glu Asp Lys Thr Thr His Lys Asp Glu Thr Lys Pro Ile Ile Val Leu Lys Gln Pro Cys Lys Ser Met Leu Gln Lys Glu Ile Glu Ile Asp Glu Lys Pro Ile Leu Pro Tyr Gly Val Thr Thr Phe Glu Lys Val Glu Thr Thr Lys Gln Ser Met Ile Lys Lys Ile Glu Ser Glu Asp Ser Asp Asp Asp Ser Ser Asp Asp Arg Lys Ile Pro Ile Asp Glu Phe Gly Ala Ala Phe Leu Arg Gly Leu Gly Trp Gln Glu Glu Glu Glu Lys Asn Lys Asp Asp Ser Lys Ser Thr Asn Thr Gln Asn Leu Ser His Arg Lys His Gly Ile Thr Leu Gly Ile Gly Ala Lys Pro Ile Asp Glu Glu Ile Ile Gln Asp Leu Asn Ser Thr Glu Lys Gly Ile Pro Ile Ile Lys Arg Arg Lys Leu Asn His Ile Asn Lys <210> 117 <211> 714 <212> PRT
<213> Candida albicans <400> 117 Met Ala Lys Ala Ser Lys Gln Thr Lys Lys Phe Gln Asn Lys His Leu Lys His Thr Ile Glu Gln Arg Lys Lys Val Gln Ala Gln Asn Lys Lys Ile Ala Ser Arg Lys Lys Ser Gly Ser Ser Ser Ser Gly Glu Ser Asn Ala Pro Lys Arg Ala Asp Gly Lys Ala Lys Glu Val Phe Glu Asp Met Ser Val Asp Asp Phe Phe Gly Gly Gly Phe Glu Val Pro Lys Glu Lys Asn Lys Asn Lys Asn Lys Gln Asp Thr Ile Glu Glu Asn Glu Glu Glu Asp Ser Ser Ser Glu Glu Glu Asp Glu Glu Ala Met Lys Glu Asn Leu Lys Lys Leu Glu Ala Asp Asp Pro Glu Phe Tyr Lys Tyr Leu Lys Asp Asn Asp Asn Asp Leu Leu Asp Phe Glu Ala Val Asn Pro Leu Asp Ala Ile Ser Asp Asp Glu Gly Asp Glu Asp Asp Asp Glu Glu Ile Glu Lys Glu Val Pro Ser Asp Asp Asp Ser Glu Glu Glu Pro Thr Leu Gly Lys Val Lys Gly Ser Lys Ile Glu Ile Thr Lys Ser Leu Val Lys Lys Trp Asn Gln Gln Leu Asp Lys Pro Thr Pro Lys Ile Thr Arg Asn Ile Leu Ile Ala Phe Lys Ala Ala Val Asn Ile His Asn Ser Asp Ser Glu Asp Tyr Lys Phe Ser Ile Thr Asp Pro Lys Ala Phe Ser Glu Leu Met Leu Leu Val Leu Lys Lys Val Pro Ile Ser Val Gln Lys Leu Val Lys Tyr Lys Thr Asn Thr Gln Gly Val Arg Thr Ile Pro Gln Lys Asn Gln Tyr Ala Thr Gln Ile Ala Ala Ile Leu Lys Ser His Ala Gly Ser Phe Ile Thr Leu Leu Asn Asp Ile Thr Asn Thr Glu Thr Ala Ala Leu Ile Leu Ala Ser Ile Tyr Glu Val Phe Pro Phe Tyr Leu Ser His Arg Arg Leu Leu Lys Gln Ile Leu Thr Ala Val Val Asn Val Trp Ser Ser Ser Ser Asp Ile Asp Thr Gln Ile Ser Thr Phe Ala Phe Leu Asn Asn Val Ser Arg Glu Tyr Pro Lys Ser Val Leu Glu Thr Val Leu Lys Leu Thr Tyr 355 , 360 365 Ser Ser Phe Leu Gln Asn Cys Arg Lys Thr Asn Val His Thr Met Ala Gln Ile Asn Phe Cys Lys Asn Ser Ala Val Glu Leu Phe Gly Ile Asn Glu Thr Leu Gly Tyr Gln Val Gly Phe Glu Tyr Val Arg Gln Leu Ala Ile His Leu Arg Asn Ser Ile Asn Ala Thr Ser Asn Ala Lys Glu Gly Tyr Lys Thr Ile Tyr Asn Trp Gln Tyr Cys His Ser Leu Asp Phe Trp Ser Arg Val Leu Ser Gln His Cys Asn Pro Glu Lys Glu Leu Gln Asn His Lys Ser Lys Glu Ser Pro Leu Arg Gln Leu Ile Tyr Pro Leu Val Gln Val Thr Leu Gly Ala Ile Arg Leu Ile Pro Thr Ala Gln Phe Phe Pro Leu Arg Phe Tyr Leu Ile Arg Ser Leu Ile Arg Leu Ser Gln Ser Thr Gly Val Phe Ile Pro Leu Phe Pro Leu Ile Ser Glu Ile Leu Ser Ser Thr Ala Met Thr Lys Ala Pro Lys Ala Ser Thr Leu Gln Ala Val Asp Phe Glu His Asn Ile Lys Val Asn Gln Ala Tyr Leu Gly Thr Arg Val Tyr Gln Asp Gly Leu Cys Glu Gln Phe Ile Glu Leu Ser Gly Glu Phe Phe Gly Leu Tyr Ala Lys Ser Ile Ala Phe Pro Glu Leu Val Thr Pro Ala Val Leu Ala Leu Arg Arg Phe Val Lys Lys Ser Lys Asn Val Lys Phe Asn Lys Gln Leu Gln Gln Leu Ile Glu Lys Leu Asn Ala Asn Ala Val Phe Ile Thr Gly Lys Arg Ser Asn Val Glu Tyr Gly Pro Ser Asn Lys Ala Glu Val Gln Gln Phe Leu Ser Asp Phe Glu Trp Glu Lys Thr Pro Leu Gly Gln Tyr Val Ser Val Gln Arg Gln Leu Lys Ala Glu Arg Leu Arg Ile Leu Lys Glu Ala Gln Glu Glu Glu Ala Lys Ala Gln Ala Glu Gln Lys Lys Lys Glu Glu Glu Glu Asp Glu Gln Glu Asp Glu Asp Ile Val Met Glu Glu Glu Asp Asp Glu <210> 118 <211> 281 <212> PRT

<213> Candida albicans <400> 118 Met Ser Arg Gly Lys Thr Ile Arg Pro Ser Tyr Tyr Asp Glu Glu Glu Ser Ser Gln Asp Glu Leu Ser His Thr Leu Ser Lys Gly Arg Ser Asn Ile Gly Ser Gln Ser Asp Asp Glu Glu Met Ser Lys Ile Ser Phe Gly Ala Leu Asn Arg Ala Gln Ser Lys Leu Asn Lys His Asn Gln Lys His Lys Thr Gln Glu Asp Asn Tyr Lys Ser Ser Glu Glu Glu Phe Phe Asp Ser Gly Ser Asp Ser Asp Gly Pro Pro Glu Glu Thr Ser Ser Lys Asp Thr Lys Lys Lys Lys Asn Lys His Ala Pro Ser Glu Ser Ser Ser Lys Arg Pro Val Ser Arg Ile Arg Asp Ile Pro Gly Leu Pro Ser Arg Lys Gln Gln Thr Leu His Thr Asp Ile Arg Phe Asp Ala Ala Tyr Gly Lys Ala Asp Leu Ala Lys Ala Arg Lys Asp Tyr Ala Phe Leu Asp Glu Tyr Arg Lys Gln Glu Ile Ala Asn Met Glu Ser Leu Leu Lys Asp Lys Lys Ser Arg Leu Asn Asp Asp Glu Arg Glu Glu Ile Lys Leu Gln Leu Gln Ser Leu Lys Ser Arg Met Asp Thr Leu Lys Asn Arg Asp Leu Glu Asn Asn Ile Leu Ser Asn Tyr Lys Lys Gln Gln Met Glu Ser Phe Lys Glu Gly Lys Val Asn Lys Pro Tyr Phe Leu Lys Arg Ser Asp Lys Arg Lys Ile Leu Gln Lys Ala Lys Phe Asp Ser Met Lys Pro Lys Gln Arg Glu Lys Ala Met Glu Arg Lys Arg Lys Lys Arg Leu Gly Lys Glu Phe Arg Gln Leu Glu Phe Lys Pro Thr Asn Arg <210> 119 <211> 849 <212> PRT
<213> Candida albicans <400> 119 Met Ser Asp Gln Leu Glu Lys Asp Ile Glu Glu Ser Ile Ala Asn Leu Asp Tyr Gln Gln Asn Gln Glu His His Glu Thr Glu Gln Asp Lys Asp Lys Glu His Gln Asp Val Glu Lys Gln Ser Ser Glu Glu Glu Thr Lys Gly Ile Glu His Val Thr Asp Ser Asn Thr Asp Asp Ile Gly Val Thr Lys Ser Gln Asp Thr Glu Glu Val Ile Glu Asn Ser Pro Val Asp Pro Gln Leu Lys Glu Gln Gln Glu Ser Thr Thr Lys Met Ser Leu Ser Glu Arg Asp Leu Val Asp Glu Ile Asp Glu Leu Phe Thr Asn Ser Thr Lys Thr Val Thr Glu Asn Asn Gln Pro Ser Glu Thr Asn Lys Arg Ala Tyr Glu Ser Val Glu Thr Pro Gln Glu Leu Thr Pro Asn Asp Lys Arg Gln Lys Leu Asp Ala Asn Thr Glu Thr Ser Val Pro Thr Glu Leu Glu Ser Val Asn Asn His Asn Glu Gln Ser Gln Pro Ile Glu Pro Thr Gln Glu Arg Gln Pro Ser Thr Thr Glu Thr Thr Tyr Ser Ile Ser Val Pro Val Ser Thr Thr Asn Glu Val Glu Arg Ala Ser Ser Ser Ile Asn Glu Gln Glu Asp Leu Glu Met Ile Ala Lys Gln Tyr Gln Gln Ala Thr Asn Leu Glu Ile Glu Arg Ala Met Glu Gly His Gly Asp Gly Gly Gln His Phe Ser Thr Gln Glu Asn Gly Gln Pro Ser Gly Ser Ser Leu Ile Ser Ser Ile Val Pro Ser Asp Ser Glu Leu Leu Asn Thr Asn Gln Ala Tyr Ala Ala Tyr Thr Ser Leu Ser Ser Gln Leu Glu Gln His Thr Ser Ala Ser Ala Met Leu Ser Ser Ala Thr Leu Ser Ala Leu Pro Leu Ser Ile Ile Ala Pro Val Tyr Leu Pro Pro Arg Ile Gln Leu Leu Ile Asn Thr Leu Pro Thr Leu Asp Asn Leu Ala Thr Gln Leu Leu Arg Thr Val Ala Thr Ser Pro Tyr Gln Lys Ile Ile Asp Leu Ala Ser Asn Pro Asp Thr Ser Ala Gly Ala Thr Tyr Arg Asp Leu Thr Ser Leu Phe Glu Phe Thr Lys Arg Leu Tyr Ser Glu Asp Asp Pro Phe Leu Thr Val Glu His Ile Ala Pro Gly Met Trp Lys Glu Gly Glu Glu Thr Pro Ser Ile Phe Lys Pro Lys Gln Gln Ser Ile Glu Ser Thr Leu Arg Lys Val Asn Leu Ala Thr Phe Leu Ala Ala Thr Leu Gly Thr Met Glu Ile Gly Phe Phe Tyr Leu Asn Glu Ser Phe Leu Asp Val Phe Cys Pro Ser Asn Asn Leu Asp Pro Ser Asn Ala Leu Ser Asn Leu Gly Gly Tyr Gln Asn Gly Leu Gln Ser Thr Asp Ser Pro Val Gly Ala Arg Val Gly Lys Leu Leu Lys Pro Gln Ala Thr Leu Tyr Leu Asp Leu Lys Thr Gln Ala Tyr Ile Ser Ala Ile Glu Ala Gly Glu Arg Ser Lys Glu Glu Ile Leu Glu Asp Ile Leu Pro Asp Asp Leu His Val Tyr Leu Met Ser Arg Arg Asn Ala Lys Leu Leu Ser Pro Thr Glu Thr Asp Phe Val Trp Arg Cys Lys Gln Arg Lys Glu Ser Leu Leu Asn Tyr Thr Glu Glu Thr Pro Leu Ser Glu Gln Tyr Asp Trp Phe Thr Phe Leu Arg Asp Leu Phe Asp Tyr Val Ser Lys Asn Ile Ala Tyr Leu Ile Trp Gly Lys Met Gly Lys Thr Met Lys Asn Arg Arg Glu Asp Thr Pro His Thr Gln Glu Leu Leu Asp Asn Thr Thr Gly Ser Thr Gln Met Pro Asn Gln Leu Ser Ser Ser Ser Gly Gln Ala Ser Ser Thr Pro Ser Val Val Asp Pro Asn Lys Met Leu Val Ser Glu Met Arg Glu Ala Asn Ile Ala Val Pro Lys Pro' Ser Gln Arg Arg Ala Trp Ser Arg Glu Glu Glu Lys Ala Leu Arg His Ala Leu Glu Leu Lys Gly Pro His Trp Ala Thr Ile Leu Glu Leu Phe Gly Gln Gly Gly Lys Ile Ser Glu Ala Leu Lys Asn Arg Thr Gln Val Gln Leu Lys Asp Lys Ala Arg Asn Trp Lys Lys Phe Phe Leu Arg Ser Gly Leu Glu Ile Pro Ser Tyr Leu Arg Gly Val Thr Gly Gly Val Asp Asp Gly Lys Arg Lys Lys Asp Asn Val Thr Lys Lys Thr Ala Ala Ala Pro Val Pro Asn Met Ser Glu Gln Leu Gln Gln Gln Gln Gln Arg Gln Gln Glu Lys Gln Glu Lys Gln Gln Gln Glu Glu Gln Gln Ala Gln Gln Ser Glu Lys Gln Leu Glu Gln Gln Gln Glu Pro Gln Gln Glu Gln Gln Gln Glu Gln Gln Gln Thr Glu Lys Gln Gln Ala Glu Gln Glu Gln Pro Asp Gln Pro Gln Glu Glu Gln Gln Gln Glu Lys Glu Gln Pro Asp Gln Gln Gln Pro Asp Gln Gln His Pro Asp Arg Gln Gln Gln Glu Gln Ile Gln Gln Pro Glu Ser Ser Asp Lys <210> 120 <211> 1096 <212> PRT
<213> Candida albicans <400> 120 Met Ser Gly Pro Val Thr Phe Glu Lys Thr Phe Arg Arg Asp Ala Leu Ile Asp Ile Glu Lys Lys Tyr Gln Lys Val Trp Ala Glu Glu Lys Val Phe Glu Val Asp Ala Pro Thr Phe Glu Glu Cys Pro Ile Glu Asp Val Glu Gln Val Gln Glu Ala His Pro Lys Phe Phe Ala Thr Met Ala Tyr Pro Tyr Met Asn Gly Val Leu His Ala Gly His Ala Phe Thr Leu Ser Lys Val Glu Phe Ala Thr Gly Phe Gln Arg Met Asn Gly Lys Arg Ala Leu Phe Pro Leu Gly Phe His Cys Thr Gly Met Pro Ile Lys Ala Ala Ala Asp Lys Ile Lys Arg Glu Val Glu Leu Phe Gly Ser Asp Phe Ser Lys Ala Pro Ala Asp Asp Glu Asp Ala Glu Glu Ser Gln Gln Pro Ala Lys Thr Glu Thr Lys Arg Glu Asp Val Thr Lys Phe Ser Ser Lys Lys Ser Lys Ala Ala Ala Lys Gln Gly Arg Ala Lys Phe Gln Tyr Glu Ile Met Met Gln Leu Gly Ile Pro Arg Glu Glu Val Ala Lys Phe Ala Asn Thr Asp Tyr Trp Leu Glu Phe Phe Pro Pro Leu Cys Gln Lys Asp Val Thr Ala Phe Gly Ala Arg Val Asp Trp Arg Arg Ser Met Ile Thr Thr Asp Ala Asn Pro Tyr Tyr Asp Ala Phe Val Arg Trp Gln Ile Asn Arg Leu Arg Asp Val Gly Lys Ile Lys Phe Gly Glu Arg Tyr Thr Ile Tyr Ser Glu Lys Asp Gly Gln Ala Cys Leu Asp His Asp Arg Gln Ser Gly Glu Gly Val Gly Pro Gln Glu Tyr Val Gly Ile Lys Ile Arg Leu Thr Asp Val Ala Pro Gln Ala Gln Glu Leu Phe Lys Lys Glu Ser Leu Asp Val Lys Glu Asn Lys Val Tyr Leu Val Ala Ala Thr Leu Arg Pro Glu Thr Met Tyr Gly Gln Thr Cys Cys Phe Val Ser Pro Lys Ile Asp Tyr Gly Val Phe Asp Ala Gly Asn Gly Asp Tyr Phe Ile Thr Thr Glu Arg Ala Phe Lys Asn Met Ser Phe Gln Asn Leu Thr Pro Lys Arg Gly Tyr Tyr Lys Pro Leu Phe Thr Ile Asn Gly Lys Thr Leu Ile Gly Ser Arg Ile Asp Ala Pro Tyr Ala Val Asn Lys Asn Leu Arg Val Leu Pro Met Glu Thr Val Leu Ala Thr Lys Gly Thr Gly Val Val Thr Cys Val Pro Ser Asp Ser Pro Asp Asp Phe Val Thr Thr Arg Asp Leu Ala Asn Lys Pro Glu Tyr Tyr Gly Ile Glu Lys Asp Trp Val Gln Thr Asp Ile Val Pro Ile Val His Thr Glu Lys Tyr Gly Asp Lys Cys Ala Glu Phe Leu Val Asn Asp Leu Lys Ile Gln Ser Pro Lys Asp Ser Val Gln Leu Ala Asn Ala Lys Glu Leu Ala Tyr Lys Glu Gly Phe Tyr Asn Gly Thr Met Leu Ile Gly Lys Tyr Lys Gly Asp Lys Val Glu Asp Ala Lys Pro Lys Val Lys Gln Asp Leu Ile Asp Glu Gly Leu Ala Phe Val Tyr Asn Glu Pro Glu Ser Gln Val Ile Ser Arg Ser Gly Asp Asp Cys Cys Val Ser Leu Glu Asp Gln Trp Tyr Ile Asp Tyr Gly Glu Glu Ala Trp Leu Gly 1~8 Glu Ala Leu Glu Cys Leu Lys Asn Met Glu Thr Tyr Ser Lys Glu Thr Arg His Gly Phe Glu Gly Val Leu Ala Trp Met Lys Asn Trp Ala Val Thr Arg Lys Phe Gly Leu Gly Thr Lys Leu Pro Trp Asp Pro Gln Tyr Leu Val Glu Ser Leu Ser Asp Ser Thr Val Tyr Met Ala Tyr Tyr Thr Ile Asp Arg Phe Leu His Ser Asp Tyr Tyr Gly Lys Lys Ala Gly Lys Phe Asp Ile Lys Pro Glu Gln Met Thr Asp Glu Val Phe Asp Tyr Ile Phe Thr Arg Arg Asp Asp Val Glu Thr Asp Ile Pro Lys Glu Gln Leu Lys Glu Met Arg Arg Glu Phe Glu Tyr Phe Tyr Pro Leu Asp Val Arg Val Ser Gly Lys Asp Leu Ile Pro Asn His Leu Thr Phe Phe Ile Tyr Thr His Val Ala Leu Phe Pro Lys Arg Phe Trp Pro Arg Gly Val Arg Ala Asn Gly His Leu Leu Leu Asn Asn Ala Lys Met Ser Lys Ser Thr Gly Asn Phe Met Thr Leu Glu Gln Ile Ile Glu Lys Phe Gly Ala Asp Ala Ser Arg Ile Ala Met Ala Asp Ala Gly Asp Thr Val Glu Asp Ala Asn Phe Asp Glu Ala Asn Ala Asn Ala Ala Ile Leu Arg Leu Thr Thr Leu Lys Asp Trp Cys Glu Glu Glu Val Lys Asn Gln Asp Lys Leu Arg Ile Gly Asp Tyr Asp Ser Phe Phe Asp Ala Ala Phe Glu Asn Glu Met Asn Asp Leu Ile Glu Lys Thr Tyr Gln Gln Tyr Thr Leu Ser Asn Tyr Lys Gln Ala Leu Lys Ser Gly Leu Phe Asp Phe Gln Ile Ala Arg Asp Ile Tyr Arg Glu Ser Val Asn Thr Thr Gly Ile Gly Met His Lys Asp Leu Val Leu Lys Tyr Ile Glu Tyr Gln Ala Leu Met Leu Ala Pro Ile Ala Pro His Phe Ala Glu Tyr Leu Tyr Arg Glu Val Leu Gly Lys Asn Gly Ser Val Gln Leu Lys Phe Pro Arg Ala Ser Lys Pro Val Ser Lys 900 . 905 910 Ala Ile Leu Asp Ala Ser Glu Tyr Val Arg Ser Leu Thr Arg Ser Ile Arg Glu Ala Glu Gly Gln Ala Leu Lys Lys Lys Lys Gly Lys Ser Asp Val Asp Gly Ser Lys Pro Ile Ser Leu Thr Val Leu Val Ser Asn Thr Phe Pro Glu Trp Gln Asp Asn Tyr Ile Glu Leu Val Arg Glu Leu Phe Glu Gln Asn Lys Leu Asp Asp Asn Asn Val Ile Arg Gln Lys Val Gly Lys Asp Met Lys Arg Gly Met Pro Tyr Ile His Gln Ile Lys Thr Arg Leu Ala Thr Glu Asp Ala Asp Thr Val Phe Asn Arg Lys Leu Thr Phe Asp Glu Ile Asp Thr Leu Lys Asn Val Val Glu Ile Val Lys Asn Ala Pro Tyr Ser Leu Lys Val Glu Lys Leu Glu Ile Leu Ser Phe Asn Asn Gly Glu Thr Lys Gly Lys Asn Ile Ile Ser Gly Glu Asp Asn Ile Glu Leu Asn Phe Lys Gly Lys Ile Met Glu Asn Ala Val Pro Gly Glu Pro Gly Ile Phe Ile Lys Asn Val Glu <210> 121 <211> 520 <212> PRT
<213> Candida albicans <400> 121 Met Asn Val Gly Ser Ile Leu Asn Asp Asp Pro Pro Ser Ser Gly Asn Ala Asn Gly Asn Asp Asp Asn Thr Lys Ile Ile Lys Ser Pro Thr Ala Tyr His Lys Pro Ser Val His Glu Arg His Ser Ile Thr Ser Met Leu Asn Asp Thr Pro Ser Asp Ser Thr Pro Thr Lys Lys Pro Glu Pro Thr Ile Ser Pro Glu Phe Arg Lys Pro Ser Ile Ser Ser Leu Thr Ser Pro Ser Val Ala His Lys Pro Pro Pro Leu Pro Pro Ser Ser Ser Ser Val Gly Ser Ser Glu His Ser Ser Ala Arg Ser Ser Pro Ala Ile Thr Lys Arg Asn Ser Ile Ala Asn Ile Ile Asp Ala Tyr Glu Glu Pro Ala Thr Lys Thr Glu Lys Lys Ala Glu Leu Asn Ser Pro Lys Ile Asn Gln Ser Thr Pro Val Pro Lys Leu Glu Glu His Glu Asn Asp Thr Asn Lys Val Glu Lys Val Val Asp Ser Ala Pro Glu Pro Lys Pro Lys Lys Glu Pro Gln Pro Val Phe Asp Asp Gln Asp Asp Asp Leu Thr Lys Ile Lys Lys Leu Lys Gln Ser Lys Lys Pro Arg Arg Tyr Glu Thr Pro Pro Ile Trp Ala Gln Arg Trp Val Pro Pro Asn Arg Gln Lys Glu Glu Thr Asn Val Asp Asp Gly Asn Glu Ala Ile Thr Arg Leu Ser Glu Lys Pro Val Phe Asp Tyr Thr Thr Thr Arg Ser Val Asp Leu Glu Cys Ser Ile Thr Gly Met Ile Pro Pro Ser Ser Ile Thr Arg Lys Ile Ala Glu Trp Val Tyr Ala Asn Phe Ser Asn Val Glu Glu Lys Ser Lys Arg Asn Val Glu Leu Glu Leu Lys Phe Gly Lys Ile Ile Asp Lys Arg Ser Gly Asn Arg Ile 11~

Asp Leu Asn Val Val Thr Glu Cys Ile Phe Thr Asp His Ser Ser Val Phe Phe Asp Met Gln Val Glu Glu Val Ala Trp Lys Glu Ile Thr Lys Phe Leu Asp Glu Leu Glu Lys Ser Phe Gln Glu Gly Lys Lys Gly Arg Lys Phe Lys Thr Leu Glu Ser Asp Asn Thr Asp Ser Phe Tyr Gln Leu Gly Arg Lys Gly Glu His Pro Lys Arg Ile Arg Val Thr Lys Asp Asn Leu Leu Ser Pro Pro Arg Leu Val Ala Ile Gln Lys Glu Arg Val Ala Asp Leu Tyr Ile His Asn Pro Gly Ser Leu Phe Asp Leu Arg Leu Ser Met Ser Leu Glu Ile Pro Val Pro Gln Gly Asn Ile Glu Ser Ile Ile Thr Lys Asn Lys Pro Glu Met Val Arg Glu Lys Lys Arg Ile Ser Tyr Thr His Pro Pro Thr Ile Thr Lys Phe Asp Leu Thr Arg Val Ile Gly Asn Lys Thr Glu Asp Lys Tyr Glu Val Glu Leu Glu Ala Gly Val Met Glu Ile Phe Ala Ala Ile Asp Lys Ile Gln Lys Gly Val Asp Asn Leu Arg Leu Glu Glu Leu Ile Glu Val Phe Leu Asn Asn Ala Arg Thr Leu Asn Asn Arg Leu Asn Lys 'Ile Cys <210> 122 <211> 198 <212> PRT
<213> Candida albicans <400> 122 Met Val Asn Gly Pro Ala Glu Leu Arg Arg Lys Leu Val Ile Val Gly Asp Gly Ala Cys Gly Lys Thr Cys Leu Leu Ile Val Phe Ser Lys Gly 20 25 30°
Thr Phe Pro Glu Val Tyr Val Pro Thr Val Phe Glu Asn Tyr Val Ala Asp Val Glu Val Asp Gly Arg Lys Val Glu Leu Ala Leu Trp Asp Thr Ala Gly Gln Glu Asp Tyr Asp Arg Leu Arg Pro Leu Ser Tyr Pro Asp Ser Asn Val Ile Leu Ile Cys Phe Ser Val Asp Ser Pro Asp Ser Leu Asp Asn Val Leu Glu Lys Trp Ile Ser Glu Val Leu His Phe Cys Gln Gly Val Pro Ile Ile Leu Val Gly Cys Lys Ser Asp Leu Arg Asp Asp Pro His Thr Ile Glu Ala Leu Arg Gln Gln Gln Gln Gln Pro Val Ser Thr Ser Glu Gly Gln Gln Val Ala Gln Arg Ile Gly Ala Ala Asp Tyr Leu Glu Cys Ser Ala Lys Thr Gly Arg Gly Val Arg Glu Val Phe Glu Ala Ala Thr Arg Ala Ser Leu Arg Val Lys Glu Lys Lys Glu Lys Lys Lys Lys Cys Val Val Leu <210> 123 <211> 708 <212> PRT
<213> Candida albicans <400> 123 Met Glu Val Thr Ser Leu Pro Ile Lys Leu Gln Pro Ser Asn Ile Arg Pro Ile Ala Phe Arg Ile Leu Ser Lys Lys His Gly Leu Asn Ile Asn Thr Asp Ala Leu Ala Ile Leu Thr Glu Thr Ile Gly Tyr Lys Phe Gly Thr Asp Trp Lys Ser Val Arg Ser,Gln Gln Phe Leu Glu Glu Val Ala Lys Val Trp Lys Ile Glu Asp Arg Gly Leu Phe Ile Asp Gly Asp Gly Leu Lys Gln Val Leu Lys Asp Met Asn Ser Lys Ser Ser Asn Asp Thr Lys Arg Ala His Arg Thr Asp Thr Leu Val Asp Ile Thr Asn Asp Gly Asn Gln Asn His Thr His Ser His Gln Asp Lys Gln Ile Ser Phe Glu Asp Lys Asn Met Glu His Glu Glu Arg Asp Asp Val Pro Ile Asn Trp Gln Asp Tyr Phe Lys Val Val Ser Pro Asn Asn Gln Pro Thr Ser Ile Phe Asp Lys Thr Arg Lys Gln Phe Asp Ile Val Phe Lys Asn Asn Asp Asp Lys Asp Lys Lys Ala Glu Arg Gly Gly Lys Leu Glu Ser Ile Val Ala Glu Leu Val Lys Asn Leu Pro Ala Ser Ile Glu Ser Phe Asn Asn Arg Tyr Tyr Leu Leu Ser Asp Arg Leu Ser Arg Asn Glu Asn Phe Gln Lys Lys Ser Leu Ile Ser Leu Ser Ala Leu Asn Ser Phe Lys Glu Gly Lys Thr Asp Ser Ile Thr Gly His Glu Ile Ser Leu Ile Lys Asn Met Leu Gly Arg Asp Gly Gln Lys Phe Leu Ile Phe Gly Leu Leu Ser Lys Asn Ala Asn Asp Glu Tyr Thr Leu Glu Asp Glu Thr Asp His Ile Glu Leu Asn Leu Ser Gln Ala Phe Lys Ser Gln Gly Leu Phe Tyr Cys Pro Gly Met Phe Leu Leu Val Glu Gly Ile Tyr Ser Ala Ser Gly Gly Asn Ser Asn Gln Asp His Gly Tyr Ile Gly Gly Cys Phe Tyr Val Ser Asn Ile Gly His Pro Pro Ser Glu Arg Arg Glu Thr Ser Leu Asp Val Tyr Gly Asn Leu Asp Phe Leu Gly Met His Arg Gln Ile Ala Pro Val Thr Gly Glu Lys Ile Thr Lys Ile Ser Lys Lys Phe Lys Lys Arg Leu Val Leu Ile Glu Lys Thr Leu Tyr Asn His Lys Leu Ile Phe Val Gly Thr Asp Leu Tyr Leu Asp Asp Phe Lys Val Leu Asp Gly Leu Arg Lys Phe Phe Gln Lys Leu Glu Asn Ser Ile Ile Glu Ser Ile Glu Asp Glu Glu Gly Gln Met Ala Glu Gly Thr Asn Ile Pro Leu Ala Leu Val Phe Thr Gly Ser Phe Val Ser Lys Pro Leu Ser Val Thr Asn Ser Ser Val Thr Asn Ile Thr Asn Ser Glu Ser Tyr Lys Ser Asn Phe Asp Asn Phe Thr Thr Ile Val Ser Lys Tyr Pro Asn Ile Val Ser Arg Cys Lys Ile Ile Leu Ile Pro Gly Lys Asn Asp Pro Trp Gln Ser Thr Tyr Ser Leu Gly Ser Ser Ser Leu Asn Tyr Phe Pro Gln Ser Ser Ile Pro Lys Val Phe Ile Asn Arg Leu Glu Lys Leu Leu Pro Lys Gly Asn Leu Val Val Ser Trp Asn Pro Thr Arg Ile Asn Tyr Leu Ser Gln Glu Leu Val Val.Phe Lys Asp Glu Leu Met Thr Lys Leu Lys Arg Asn Asp Ile Ile Phe Pro Arg Asp Ile Gln Glu Gln Glu Glu Leu Ile Ala Gln Asp Asp Gln Arg Thr Asn Glu Glu Arg Ile Asn Asn Leu Ile Gln Asn Lys Asn Thr His Leu Pro Ser Lys Ile Lys Gln Ala Arg Lys Leu Val Lys Thr Ile Leu Asp Gln Gly Asn Leu Gln Pro Phe Leu Lys Asn Leu Lys Leu Ile Asn Leu Ala Tyr Asp Tyr Ser Leu Arg Ile Glu Pro Leu Pro Ser Val Ile Ile Leu Asn Asp Ser Ser Phe Asp Asn Phe Glu Val Thr Tyr Asn Gly Cys Lys Val Val Asn Ile Thr Ser Val Val Ser Leu Asn Asn Arg Lys Phe Asn Tyr Val Glu Tyr Tyr Pro Gly Thr Lys Arg Phe Glu Phe Lys Asp Leu Tyr Phe <210> 124 <211> 86 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 124 ctctctttta tattctcgtc aataaaatcg ctcactcgaa aaccctaaaa aaaagcagac 60 aaccccgctc tagaactagt ggatcc 86 <210> 125 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 125 agaaaaaaaa gtaacccaca atgagatgaactaaaccaac atcaatcaac cattacacac60 caatccgctc tagaactagt gga g3 <210> 126 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 126 ttctattttt cagattgact atcctttaaccttctaatca tttacatctt caagaactaa60 gttcccgctc tagaactagt gga 83 <210> 127 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 127 ctcttcctca tctataaatc tctaatcatctcgagtagat actgttaatc tataacttca60 ctatacgctc tagaactagt gga g3 <210> 128 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 128 aaaatataca ttcaaaatcc ctaaaatcacttcatacttc aacaacaaca ataataaata60 ccattcgctc tagaactagt ggatcc 86 <210> 129 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 129 ttttcttata atgagatgag atttgatttgatacatcgaa ttctacaata attatacaac60 caactcgctc tagaactagt ggatcc g6 <210> 130 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 130 ttgaaacagg acctaagtat aataaagttgattaactaat caccatcaaa caggacgctc60 tagaactagt ggatcc 76 <210> 131 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 131 cgtcaaaaaa aaaaaatttt tctaggttagacgattgagt tgtgattacg taattcgctc60 tagaactagt ggatcc 76 <210> 132 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 132 caccaaaaaa tttttgatat tgatcaatcacttctttctt cattgtgtaa aaactactag60 ccgaccgctc tagaactagt ggatcc g6 <210> 133 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 133 taacacccat agcaatacac caataccgttgattttgaac taaacttatt ccatacgctc60 tagaactagt ggatcc 76 <210> 134 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 134 aaaaaaatgt aggtgttcac caagtgttaacacatactac ttttccattc tctacagctt60 ctaaacgctc tagaactagt ggatcc g6 <210> 135 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 135 cttaaacttc ctcctcacat tcagctcttcttccactttt cttactccac acatacacac60 ctattcgctc tagaactagt ggatcc 86 <210> 136 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 136 tggtattttt cttaagaaag gataattagcatagtaaagg tcattctact atactcatat60 aaaatcgctc tagaactagt ggatcc 86 <210> 137 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 137 gcttgtattg caaaggaagc tttataaattacttttgata atctaatatc ctagagttta60 caacgcgctc tagaactagt gga 83 <210> 138 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 138 cgttatactt tccatattac ttgtcttctttttattatat atataagttt cttttcaaga60 agatccgctc tagaactagt gga 83 <210> 139 <211> 86 <212> DNA

<213> Artificial Sequence .

<220>

<223> DNA primer <400> 139 caaaggtaat ttcattacta ttgtcgttttttaggttttc acttacaatt aatggtctat60 tcttacgctc tagaactagt ggatcc g6 <210> 140 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 140 aaaatagagc aacaaaaaag caacacccacagtatagata tatagttacc ctcaacaata60 gacaacgctc tagaactagt gga 83 <210> 141 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 141 tacttttttt tttttcaaat ttttcaattacgacatcgag tattcacccc aaggtctcag60 tacaacgctc tagaactagt ggatcc g6 <210> 142 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 142 ctaaactaat cacacaacag cttcaactttaatcttacca atcaactgta caaatcgctc60 tagaactagt ggatcc <210> 143 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 143 ctttcttaaa gaagcttctc ttttttttattgtcatttac cataacacac cccttcctaa60 ggatacgctc tagaactagt ggatcc g6 <210> 144 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 144 cttttaactt tttcacatat tataaaagattagacagttt ctcaagcata tatccctcac60 agaaccgctc tagaactagt ggatcc g6 <210> 145 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 145 tgaaattttt tttttttcac ataaaaaagtatctcctaca tctttccgta ctacactcat60 cagcccgctc tagaactagt gga 83 <210> 146 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 146 ttttaactat tcattttttt agtacataattacaatttat tgtgagtccc cattttacta60 aggtccgctc tagaactagt ggatcc 86 <210> 147 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 147 ccatccatat atatctacca ctatcaagatccctatatct tgttgataca cactttttgg60 ttaaacgctc tagaactagt ggatcc 86 <210> 148 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 148 tttttatcat taaaatcata tccctcccctctcaaaaaca actatatatc taatccgctc60 tagaactagt ggatcc 76 <210> 149 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 149 atttagcaaa cataatccgt gttttacatatattattcac ccaatatcat aacaaaaaca60 aactgcgctc tagaactagt ggatcc g6 <210> 150 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 150 ggaaatcatt aataaaacat gcttctagggttgttctaaa gtgaaaaacc acgacaaaca60 cgtcgcgctc tagaactagt ggatcc g6 <210> 151 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 151 ttggaagaac tcctttcctt ttctatagtcattactcgaa gcgaaataca taattcgctc60 tagaactagt ggatcc <210> 152 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 152 gaaaaaaaaa actttttgac agtacgtctaacagattatt gtgatgaact aatcccacat60 atttccgctc tagaactagt ggatcc g6 <210> 153 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 153 ttatttatta aattaatcct taataattcaagcatttcta gacacacaca aatcacgctc60 tagaactagt ggatcc 76 <210> 154 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 154 aaatttcaaa attctctgac acccactctttatcttatta aactcaatac actcccatat60 cacaacgctc tagaactagt gga g3 <210> 155 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 155 aaaataaatc actctaatca tttcattcatcaatacccac cacaaaacct ttcaacgctc60 tagaactagt ggatcc 76 <210> 156 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 156 agaaattgaa acaatcggaa aacaacaatatcaaactgat gcccaataac actgtatgta60 cctagcgctc tagaactagt gga g3 <210> 157 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 157 aatttttcaa tattcaaaaa ctacacttattcattaatca atcatcaacc attaaactat60 ttgtccgctc tagaactagt gga g3 <210> 158 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 158 aatttgaaat tttacaacaa acaacaacattcaacgttca ccaccaccca ccactagtaa60 acacacgctc tagaactagt gga g3 <210> 159 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 159 ccccccttct ttttttttaa atattaaaaaccaacaccca actgatatac taacttatct60 tttttcgctc tagaactagt gga g3 <210> 160 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 160 ctttttttct ttatcaacaa taagaaagaattactcaatt ccgtaatatt tattctacat60 taacacgctc tagaactagt gga g3 <210> 161 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 161 caacaaacga tctatttaaa ggatactctaagaaatcgag gggtgttcaa ccatagctca60 taatccgctc tagaactagt ggatcc 86 <210> 162 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 162 ttcttctacc ctttttttca atagaaacaactacacatat ttttatcgat aatataattc60 aaaaacgctc tagaactagt gga g3 <210> 163 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 163 acttgaaagg taacttgaga ctaaccaatcatagtaacga tacattcgag tcaatcgctc60 tagaactagt ggatcc 76 <210> 164 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 164 tggaaatgga tgcaaatgag attttctactattcttttac catgtttctt tgttatggat60 cgtgccgctc tagaactagt ggatcc, g6 <210> 165 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 165 agattccaac ttcagaatat tcattcagatctgaacattt ctttttctcc gatcatcaat60 tggcacgctc tagaactagt ggatcc 86 <210> 166 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 166 taaatataaa aatccattat tctactgtttttcagctttg cattgctatt tactccgctc60 tagaactagt ggatcc 76 <210> 167 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 167 acttcaactt gcttttcttt tttaaatcctcagttgtaca ttaatcagat tgttcacatt60 aaatccgctc tagaactagt gga 83 <210> 168 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 168 acaacaacaa caacaacatc aacttctaaagcattatact actctttcct tcacgcgctc60 tagaactagt ggatcc 76 <210> 169 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 169 cctcaaaaca gtataacctt tgcctcctttctatcctctt tataattcat taaataatta60 caccccgctc tagaactagt ggatcc g6 <210> 170 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 170 tgaacaaatt cccacctcca atacagcatttttcttcact cttgatatac caattcgctc60 tagaactagt ggatcc 76 <210> 171 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 171 ccacccattc attctttctt tttgaaggtgcttgcagcta agtttaataa cagacgtatt60 ctaatcgctc tagaactagt gga 83 <210> 172 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 172 atcacaaaca ctttcctaaa ttaatccagcgttaattatc tcaatataat caactcgctc60 tagaactagt ggatcc 76 <210> 173 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 173 tcaagtcggc gattaacccg acaataaataaacaatttcg aaaagcattc cattattcta60 tcactcgctc tagaactagt ggatcc g6 <210> 174 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 174 ttccttactt tgaacaactt ccctctcctcctcgtctccc ccctcaccaa cagcccgctc60 tagaactagt ggatcc <210> 175 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 175 tcacataaaa ccacattaac attctttattcttcatttca taactaatca cccacatatt60 ccatccgctc tagaactagt ggatcc g6 <210> 176 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 176 taaatagtgt gtgcagcaac aaaaaattagaaaaaaaaga caactcactt cttcacgctc60 tagaactagt ggatcc 76 <210> 177 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 177 gagcacacaa aaaaaaaaac accacccagtatcgaaccaa cattgtttcc ccaaccccca60 ttcttcgctc tagaactagt ggatcc g6 <210> 178 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 178 tgagaatttt ttaagaaatt taatctgctaataactcttt tctacacaag gaacccgctc60 tagaactagt ggatcc 76 <210> 179 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 179 tttgtatttc tattttgcaa gttctacttttaatatcatt tgatcaagac catctcgctc60 tagaactagt ggatcc 76 <210> 180 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 180 gggaaactat aaacaaagag ttcagatgaggtaatagttt caaggagaag attagttaaa60 aaatacgctc tagaactagt ggatcc g6 <210> 181 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 181 tttttcactt cttgagtcat tcttgtaaccataatccact tttgtttcca acgaactata60 aaatccgctc tagaactagt gga g3 <210> 182 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 182 tctccaaaaa tgtcagaact agcttgttgatgggcaaccg ttgacttgtt tatggccata60 ctgcacgctc tagaactagt gga g3 <210> 183 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 183 tccctcccct cccctcttccccttttaataatacatctat caaatataac atataaactt60 acatacgctc tagaactagtgga g3 <210> 184 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 184 aagacgcgtt gttttaccttctttcaacatcttttagcaa caccacccat tcaataacct60 tcaatcgctc tagaactagtgga g3 <210> 185 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 185 ctctatatca atataccataatactcgacacggctatact gttgatataa actttcccac60 tggacccctc gaggtcgacggtatcg <210> 186 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 186 attatcgtaa cattaaatttatacatcagatatttataat tacacttctt aaataaaata60 ttcagtcgag gtcgacggtatcg g3 <210> 187 <211> 83 <212> DNA

<213> Artificial nce, Seque <220>

<223> DNA primer <400> 187 ctacgatgta tatacatacaaaagctgtacattaatactg atagaacatt taagttatag60 gttcatcgag gtcgacggtatcg 83 <210> 188 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 188 ttcaaggtat ttgcatttta gtttttgctacttctataac attacaaatt atatacaact60 atttgtcgag gtcgacggta tcg g3 <210> 189 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 189 tttgtaaata ttaaatagta cacacacacacaattcttgt atataatacg aacaaacagt60 aatagccctc gaggtcgacg gtatcg g6 <210> 190 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 190 tatatatata tataaatatt tacaaagtgaatcttggata aatatcatac actatcttta60 ctcttccctc gaggtcgacg gtatcg g6 <210> 191 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 191 ggtttgtcac attacacgca. ctacactaaatttatattag ataaaacgaa acattccctc60 gaggtcgacg gtatcg <210> 192 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 192 cttcgccgat cctcaaacaa tacttggctagacagttcta cttagaagac ggaaaccctc60 gaggtcgacg gtatcg 76 <210> 193 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 193 catcatcatc attgtaaatc tatttctttttatggaggtg ggaattgttg ttccatttca60 atgacccctc gaggtcgacg gtatcg g6 <210> 194 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 194 aaataataca attaacttta taacaatatataaatctata ttatcaaaca actacccctc60 gaggtcgacg gtatcg <210> 195 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 195 tagaaactcc ataggatgta taaaaaaaaacacgtatcga attcttatta ctttgtttat60 aaaacccctc gaggtcgacg gtatcg~ g6 <210> 196 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 196 taatcgactc ctacagcgtc tgataataccaaaaaaagag aaaaggattc tattttagaa60 tcatcccctc gaggtcgacg gtatcg g6 <210> 197 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 197 acaacaacac atctaagggt tgtagttattctttacttgt ttgtatcttg tgagattact60 tcaacccctc gaggtcgacg gtatcg g6 <210w 198 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 198 tttttatctc tatatgtaaa gtgtataaaaaaaagaaata caaacctaaa aaacttatat60 gtagatcgag gtcgacggta tcg g3 <210> 199 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 199 gtatatgtgt taatccaact aagtaacaaaatgaaaacaa tctgaacact gaatcgaaag60 aaagttcgag gtcgacggta tcg g3 <210> 200 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 200 catactgaat ttgccaccta cacgaagtgataccaatggc tgtcgtattc tggacaactt60 taaacccctc gaggtcgacg gtatcg g6 <210> 201 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 201 aaatacacgt atccgtacat ttatatgtatatataggtac.attttacctc aatagtatag60 ccagttcgag gtcgacggta tcg 83 <210> 202 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 202 aaatcataaa ctagtcctta acaaatctaatagtctatgc attactaatt atttatctcc60 atgtcccctc gaggtcgacg gtatcg g6 <210> 203 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 203 aaatgtaagt catttataaa aaaaaaaatacaaactttct ttgtttttaa aaaacccctc60 gaggtcgacg gtatcg 76 <210> 204 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 204 taataggatt tatttttata ttaatatgaggtatatttac tatctataaa ggaaaaaaaa60 atcccccctc gaggtcgacg gtatcg 86 <210> 205 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 205 tatgaaataa agtgggtttc taaattagatataacgataa taagtgttgt gtattctttt60 ttgcaccctc gaggtcgacg gtatcg 86 <210> 206 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 206 aaatggtaat ttgtagggtt ttacatattcaatctagaca taacatttat taattgtttc60 ctctatcgag gtcgacggta tcg 83 <210> 207 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 207 agctgatcca tccaatttct ctaataatctttcttggttg atcattgatt cgttgtcttg60 ataccccctc gaggtcgacg gtatcg g6 <210> 208 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 208 gaatattggt aaaatactac ataatgatgcaaatagatat ttatagagac aacaacgaca60 acgacccctc gaggtcgacg gtatcg g6 <210> 209 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 209 taaatcatgt acatatatta ttattttgcattactaatct attactattt tacatccctc60 gaggtcgacg gtatcg <210> 210 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 210 gatagtgtag gtattgaaca taaaatcattaattaggagg aaataaagaa attaatagaa60 actgcccctc gaggtcgacg gtatcg 86 <210> 211 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 211 aggtcaggtc ttacgttgta tttttaagaacttctagtac gccgattgta tccctagata60 aaggaccctc gaggtcgacg gtatcg 86 <210> 212 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 212 ataaatctat attatagtta taaaacctccaaaaaattgt acatcttcct atgtcccctc60 gaggtcgacg gtatcg <210> 213 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 213 aagagagaaa caacttctta catcatacttattaataagt catatataca ttataccagc60 atctaccctc gaggtcgacg gtatcg 86 <210> 214 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 214 aaaaaaagta tggttaaaaa ggaaaaaaaataagctatca tcatcttctt cttaaccctc60 gaggtcgacg gtatcg <210> 215 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 215 tggtgtaaat gagaaatcct tttgcattactactatctac tcattagtat acttatatga60 .

tgacctcgag gtcgacggta tcg 83 <210> 216 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 216 agagttatta tatgtacaca ttttttttaatataaacatg tagcaatata ctttaccctc60 gaggtcgacg gtatcg 76 <210> 217 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 217 ggaaattcga caagatgtaaacgagcagatagacaagttt gaaagtgctg tattataata60 aataatcgag gtcgacggtatcg 83 <210> 218 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 218 tttagtatta agtaaatatctctttctctctctctctcta tatatatata tatatgtatc60 tttgatcgag gtcgacggtatcg 83 <210> 219 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 219 atattattac aaaaattatggtttgaatgcaatatagtag tatatttttc tttcgctttc60 tttcctcgag gtcgacggtatcg g3 <210> 220 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 220 aatggatttg tagaataaggggtggtacttccagtaaaac gagtactcaa ataactccaa60 gtgtatcgag gtcgacggtatcg 83 <210> 221 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 221 cataattttt tatattttgattgaaagaaaatcttgaaaa agttttataa tcccctcaag60 ttaactcgag gtcgacggtatcg g3 <210> 222 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 222 acatgtatta acaaattata taatgacataaaacatttta catctgctag ttcttaaact60 taaacccctc gaggtcgacg gtatcg g6 <210> 223 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 223 agacctttgt aattaaaaaa atttaaacattagcaacaaa gtaagaacac gatcaaccat60 actactcgag gtcgacggta tcg g3 <210> 224 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 224 gatgtttcta tttaatgatt tatagaataaggatatagcg tgttattgca caagcccctc60 gaggtcgacg gtatcg 76 <210> 225 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 225 tccacaaatg tcaaatacat atatttgcacctaccaatta gagggatctt gaattaataa60 cttacccctc gaggtcgacg gtatcg g6 <210> 226 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 226 atatgttaaa acgggtagca gaaaatctaatcgaaatcac cttgtagaca tatcctagtg60 atattccctc gaggtcgacg gtatcg g6 <210> 227 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 227 gtaacatgtc tcaatttagt ttggcatttgaatcgactaa ttcaccccat ttcatccctc60 gaggtcgacg gtatcg <210> 228 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 228 gatagagcta aaaacgttta taacaaattaataatatttg actaaactaa cttcctattc60 acctttcgag gtcgacggta tcg 83 <210> 229 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 229 aatactcata tatatatgta tgtatatatatatattacat aaccattcac cccaaccctc60 gaggtcgacg gtatcg 76 <210> 230 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 230 gagggggtat ttcactccat atttgctctattatttgtaa ttcttgctat ttattatcca60 tggtcccctc gaggtcgacg gtatcg g6 <210> 231 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 231 ttcagttcta gttcctctgg agtttctggtttaatatgca aatccctctt tctatccctc60 gaggtcgacg gtatcg <210> 232 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 232 acccccatat atatttagca tcaatttttataaatgtata ttagatcctt attccactca60 cttattcgag gtcgacggta tcg 83 <210> 233 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 233 taaaaataag taaattataa atgctaatcgtttattatgc agctattcaa ccaagccctc60 gaggtcgacg gtatcg <210> 234 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 234 cgttgggaaa cgtaacagct cccgataaagaaaaagattc ctttttgata ttttttttaa60 tctatccctc gaggtcgacg gtatcg 86 <210> 235 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 235 tgaattggcc ccatatgata tgttttcctatttcttcata tcatctaatt attgcccctc60 gaggtcgacg gtatcg <210> 236 <211> 86 <212> DNA

<213> Artificial Sequence <220> -<223> DNA primer <400> 236 tgtagtacta ttgatattat agcattaaaattttcttcct tttttgtcaa atgtatctgt60 agtatccctc gaggtcgacg gtatcg 86 <210> 237 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer , <400> 237 aatcgttata agaagagagg gtacaactattggcgcaggt acggttattg attttccctc60 gaggtcgacg gtatcg 76 <210> 238 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 238 gaacttgtac atatattaca tacacaaattacggtttatt gtgcattatt ttatctattg60 atttaccctc gaggtcgacg gtatcg g6 <210> 239 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 239 atgtaatatt attatcgtgt attaacacaactgtaaatta tttgttaaat ctaaaccctc60 gaggtcgacg gtatcg 76 <210> 240 <211> 76 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 240 attccaattg tctgaattct tactccaatctctgcttcct tttccttccc attgcccctc60 gaggtcgacg gtatcg <210> 241 <211> 86 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 241 aagatagatt aattaacaat acaaatataatgctacatgg aaataaatag taaatataaa60 aactcccctc gaggtcgacg gtatcg g6 <210> 242 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 242 catagtatta ttgatatctc taaacaaaaagttatgtatt aaaagcaacc taaacaagac60 tctattcgag gtcgacggta tcg <210> 243 , <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 243 taaagactga ttctaggatt acaaatgatacactacatta catcataaca ggtcaggaag60 tcctgtcgag gtcgacggta tcg g3 <210> 244 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 244 aactcataag agggcttcag gtttctttctattctgactt tgccttttgt tgtatttgct60 tgacttcgag gtcgacggta tcg <210> 245 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 245 ggtattcacg ataactgcta gaatgacctacttcttaata caaattactt tctagtatta60 actattcgag gtcgacggta tcg 83 <210> 246 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 246 ttctcttaaa aatgacttat atttaatatacacttgcaaa actgttagta taacgctact60 caaagagtgt gattatgtaa gcaggcg <210> 247 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 247 tgttttcatt catcgaacgc gtgggccaaaaaaaaaacaa tcgattattt agactggtac60 aaatatgatt atgtaagcag gcg g3 <210> 248 <211> 72 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 248 tcaccacgag tactcatctt gtatttctttaaatcggtca ataattactt agtgtgatta60 tgtaagcagg cg 72 <210> 249 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 249 tgtattgtgg gcgtgtctgt gcgtctgtgtgtgtgtacca ctgtcatttt ctttctttcg60 gttgatgatt atgtaagcag gcg g3 <210> 250 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 250 ttttgaattg cgaagaatac gtgtagtaatatggatctta ttttaagtag ggtataactg60 attcaagtgt gattatgtaa gcaggcg <210> 251 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 251 cgatccagaa gatgaagatg aagatactggctttctagga tttaatgatt ccaatcgatt60 agacaagtgt gattatgtaa gcaggcg 87 <210> 252 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 252 taccaaatac ggaagaaagt cagtttcagtgtttactttt tcatgtacat agttgagtgt60 gattatgtaa gcaggcg 77 <210> 253 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 253 atctacctga accactctcg ccaattatcatgatggagaa gttgattgat ttcttagtgt60 gattatgtaa gcaggcg 77 <210> 254 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 254 atgacagaat ttgttgaaat gatccagcaaatgttttcac ttttttaaat ggtggtcgct60 cattaagtgt gattatgtaa gcaggcg <210> 255 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 255 caggttaggg atttgggctg gaatgtattttaatagttgt tcaactggct aggatagtgt60 gattatgtaa gcaggcg 77 <210> 256 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 256 ttagacaaat tacttttatt gtttctttcattacttgtcg gcagcattct aatgttgtct60 agagaagtgt gattatgtaa gcaggcg g7 <210> 257 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 257 aaattgaagc acaaatttca caaatgtcattttcgttcct tgccatttca tttcaaagca60 atcaaagtgt gattatgtaa gcaggcg 87 <210> 258 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 258 tagaacagcc aattctgtta ttatttttttttgtgagtgt gtgtgtcgtc gtgcataatt60 tcattagtgt gattatgtaa gcaggcg g7 <210> 259 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 259 ttattataga tttggtgttt aaaaattagtaatatagtac tttaacttat atttggtttt60 ctttatgatt atgtaagcag gcg 83 <210> 260 <211> 72 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 260 atatcgtacc cgattatgtc gtatattcttttttcaatgt caatttgaga agtgtgatta60 tgtaagcagg cg 72 <210> 261 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 261 tataattaat gtatacaatt aaggtttattaatataaaaa aattatatta aacaggttac60 aaaaaagtgt gattatgtaa gcaggcg g7 <210> 262 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 262 atcagattga ccagatgacc aaaaagaacgaattctccaa aggtgacgag gaaagggtag60 caagatgatt atgtaagcag gcg g3 <210> 263 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 263 tacaatacaa ttgaaaatga tgaaaaccgagaaagtagtg cgaattgcaa caaaacttca60 ggactagtgt gattatgtaa gcaggcg g7 <210> 264 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 264 ggatgatgat gttagcaatg atattgatgaggattctgag tggttaagtt gatagagtgt60 gattatgtaa gcaggcg 77 <210> 265 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 265 taatatttca atatcgaaag acatggaagtgcatgaacct gaagtaaaga agtttaatac60 atgagagtgt gattatgtaa gcaggcg g7 <210> 266 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 266 tttatacact tcatttggac ttaacttttaaaatatatcc atcaatcaac aacttattta60 caaatagtgt gattatgtaa gcaggcg g7 <210> 267 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 267 cacaatttgg atttaaaaga ttttaaaaagtattttatca gttttatcaa caaaatgaaa60 agtggtgatt atgtaagcag gcg g3 <210> 268 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 268 acagacttga attagtatta gaaactagaaccacagcatc tttaaaatca acttatttgc60 atcgaagtgt gattatgtaa gcaggcg 87 <210> 269 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 269 aaagacaaga ttgaaacttt gttgatctaagtagtaaatg caattcaaac tattatttgt60 atataagtgt gattatgtaa gcaggcg 87 <210> 270 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 270 agtctgattc ttccttcaaa aaagaaagggaaaagcaagt gaatttgatt gcataagtgt60 gattatgtaa gcaggcg <210> 271 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 271 tctcttctca tattcccatt ttgtataaaacttcttacaa gtccacttag acaaccaacc60 agcctagtgt gattatgtaa gcaggcg g7 <210> 272 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 272 cttattattt gttcttgttt ataattattaaggaagaaag agtttaaaat attctggtga60 aaattagtgt gattatgtaa gcaggcg g7 <210> 273 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 273 atacgtttcc ttaatgtcaa aatcagccattctagattag ttatgagttg ggagtagtgt60 gattatgtaa gcaggcg _ 77 , <210> 274 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 274 ttctaacaac tatagctgca agtattgttgagcgtttaat attgtgttta aatgaattgg60 atgtgagtgt gattatgtaa gcaggcg g7 <210> 275 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 275 tctgaccaat tcgattacta atctttcacactcactcact ccctcactca tttccagtgt60 gattatgtaa gcaggcg 77 <210> 276 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 276 tcatcaacca cttttattat tggcatcataggtcaaacgt taatactatg ttgctctttc60 ttttttgatt atgtaagcag gcg 83 <210> 277 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 277 tcgtcttgcc cccctatcac taatggggatttccgatctc cttgccatat tttgaagtgt60 gattatgtaa gcaggcg 77 <210> 278 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 278 ttgataagca ctggaaaaat ggaaagaggtattaacacag ggaggattct agataaacgg60 tttcgtgatt atgtaagcag gcg 83 <210> 279 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 279 attgtaatat gatttgatgg ggaaaatagaaattcaactt tcgtagtagt tggttggttg60 gttagtgatt atgtaagcag gcg 83 <210> 280 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 280 caaaatagca tatcgaacat agattcaagt atgttgctat ccccaacaat actttccatt 60 atctttgatt atgtaagcag gcg g3 <210> 281 <211> 77 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 281 ctacgtttca catatactat tatttcaatttcccatcatt gcaacaacaa acgaaagtgt60 gattatgtaa gcaggcg 77 <210> 282 <211> 83 <212> DNA

<213> Artificial Sequence <220> -<223> DNA primer <400> 282 agggcctgca tcgcgcaacg cttatgtacaggattttatg aatcattgaa tgaaaaattt60 tcaattgatt atgtaagcag gcg 83 <210> 283 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 283 tttcggtaca gtggagatta gagatcttgtagatttatat aacgaataat agtttgattt60 ttattagtgt gattatgtaa gcaggcg <210> 284 <211> 72 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 284 aattgtatat gattacacga ccatacaaaaattttgcgaa ttgagattct agtgtgatta60 tgtaagcagg cg 72 <210> 285 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 285 ggattaatat tcacctagga gtcatattttgcagcaccta gtatcaaggg atgttagtgt60 gattatgtaa gcaggcg 77 <210> 286 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 286 taacttggat ttttcttatt tcaacttttttttagcattt gaatctttat atatatatat60 atcgtagtgt gattatgtaa gcaggcg g7 <210> 287 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 287 ttgtaaattc tttaattcag tttccgccatagctatatgt gtaacttgtt tattaactag60 gcttgagtgt gattatgtaa gcaggcg 87 <210> 288 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 288 aagagaaaaa ttaagccaag aagaatgaaaaaagtacaaa aactgtttga ctactagtgt60 gattatgtaa gcaggcg 77 <210> 289 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 289 ttgtatttta tgaacaaaag tggtagcacttggagaactt tttaatagag tgagatctgc60 gcttatgatt atgtaagcag gcg g3 <210> 290 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 290 gattttttta atagccgacg tgaataaaagagctaagtga ttatagagta tcggtagtgt60 gattatgtaa gcaggcg 77 <210> 291 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 291 gtagttaaac aatatatatt gcactaacaccaaaacagta caattttttt ttttcctttc60 taaagagtgt gattatgtaa gcaggcg g7 <210> 292 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 292 tcagctggat caccttgagc tatgtaaaatactacttcat ccatgtttgt gaattagtgt60 gattatgtaa gcaggcg 77 <210> 293 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 293 tcatattctt ttaatgttat tgttggtggtgttgtatcgt tgatatattt tggaagaaat60 gattgtgatt atgtaagcag gcg g3 <210> 294 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 294 agctgtggct ataagaactg taaccagtgttttgatttca gagtgatttc tactgagtgt60 gattatgtaa gcaggcg 77 <210> 295 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 295 ttggttccaa gaggggaaaa aaacaattgactcaaatagt tttttaaatc gttccaactt60 tttagagtgt gattatgtaa gcaggcg <210> 296 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 296 ctcccctttt ccttcttcta ctgctattattcacagtgga ttcaccaaca ttactagtgt60 gattatgtaa gcaggcg 77 <210> 297 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 297 tgaggttcta tgaacataaa gtggtttgtaagttcaacta ataagttggg cgctcacaca60 gaatgagtgt gattatgtaa gcaggcg <210> 298 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 298 gctcccgagt acgtggtcta cgtaaacttttcacccgatg agaaaaagct ctacaagtgt60 gattatgtaa gcaggcg 77 <210> 299 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 299 ctcaccgctt aggttcacat gtaataggttacaaaactag agcatatacc agcgttctat60 gtgtgagtgt gattatgtaa gcaggcg <210> 300 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 300 taagctatac tactggctac aaaatgcattcagaggaaat tttgacgaat taaacagtgt60 gattatgtaa gcaggcg 77 <210> 301 <211> 77 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 301 cagaagagga ttaatacact taaattataccgatataaaa ctctctacaa ttgggagtgt60 gattatgtaa gcaggcg 77 <210> 302 <211> 87 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 302 ggctctggta taccataatc attagcgcatcactctttga tcattcatta tttggtcttt60 taatgagtgt gattatgtaa gcaggcg 87 <210> 303 <211> 72 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 303 ttagtgatta gtcacttaac gaccctaaatagttttgaaa cctcccgtaa agtgtgatta60 tgtaagcagg cg 72 <210> 304 <211> 72 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 304 cgagacctac aaatacaact tttgaacttgtcacaatcat cgcattcttt agtgtgatta60 tgtaagcagg cg 72 <210> 305 <211> 72 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 305 aacttttttc tctctcacac tctcaaaatttcttccaaca acaaaccttt agtgtgatta60 tgtaagcagg cg 72 <210> 306 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 306 tattgtttaa aaagcaaatc aataccttccagataaatcg gtattctcta taactgatta60 tatggtgatt atgtaagcag gcg g3 <210> 307 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 307 aatactatga ggatcggtgt ggctataaatgctattgaaa agcaagcggc agtttcgata60 tccatcgaat tgatccggta atttagtgtg 9p <210> 308 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 308 atatgtcgtt tcccttggat tctcttgtttgacttattag tgacagtttt gttgttggtt60 cccatatccg gtaatttagt gtg 83 <210> 309 <211> 75 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 309 gccgctattg ctgcaactac tattgcaagt ttcaaaagcc ttgctagcat 60 cgaattgatc cggtaattta gtgtg <210> 310 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 310 attgatttgg tacctgttaa cttgagaggc aacacataaa acccttttat 60 ttctgtaggt gccatatccg gtaatttagt gtg g3 <210> 311 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 311 tcataatctt caatttgctc ttgagtagac actttacgta ttttccttgg 60 ttgtgtatcc gtcatcgaat tgatccggta atttagtgtg 9p <210> 312 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 312 gagtcaactt catcaagttc aatctcttct tcattcacag ttttatttct atttcttcta60 gccatcgaat tgatccggta atttagtgtg 9p <210> 313 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 313 aggggaattt cctctttagg ttattcacac tctcatgctc ttccactttc gacatcgaat60 tgatccggta atttagtgtg <210> 314 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 314 cagccaacgc caacgggagc ttgccattataaagtgtggt caccattggt ttcatcgaat60 tgatccggta atttagtgtg g0 <210> 315 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer -<400> 315 tctgaatcgg gtgaactaac atcaatatctgaatcagatt cttcatctac tcttctttta60 cccatcgaat tgatccggta atttagtgtg 9p <210> 316 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 316 ggatatattt cttacctcca gttaaaatttctctattctt tttaaatcct gccatcgaat60 tgatccggta atttagtgtg g0 <210> 317 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 317 gagctgaaca agtcgtaaat ctggaattgtaatttatcta gttttttata atatactgtt60 gacatcgaat tgatccggta atttagtgtg 90 <210> 318 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 318 tctgaatctg atacaattgc tgattcttggtgcttggaga acccggtagc tgatgagtct60 gtcatcgaat tgatccggta atttagtgtg 90 <210> 319 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 319 aaggacttga attcatcatc ttcaatggtagaaatatcat tttcctctaa cttccgtttt60 gccatcgaat tgatccggta atttagtgtg 90 <210> 320 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 320 cgcacaacat tctgtaaaag aataatgttggtaggcaata tagcagctct tcttttttta60 gccatatccg gtaatttagt gtg g3 <210> 321 <211> 75 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 321 agggacaaaa aataattaat gccatcaatgacagtttcaa caatagccat cgaattgatc60 cggtaattta gtgtg 75 <210> 322 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 322 gacaaagaca gtagaagcat tccatcatcaatatcgttat atacattggt aacatgacta60 ggcatcgaat tgatccggta atttagtgtg 90 <210> 323 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 323 gtattaagcc ctctctcttg tatgaactctggagatttcc actgtatttc gtctaatgat60 tccatatccg gtaatttagt gtg g3 <210> 324 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 324 gtaaattcac ctaaataatt gggaattacatcttgaagag cttttcgtgc ttgagaagag60 gacatcgaat tgatccggta atttagtgtg g0 <210> 325 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 325 atgtggagtc attatactct cgtatcacgtttggtgggga tgaaaacgta ttcatcgaat60 tgatccggta atttagtgtg g0 <210> 326 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 326 accataccgg ttgccaaata gttccccgactgatcaaact ttgaacaaat tattggtcct60 gacatcgaat tgatccggta atttagtgtg 90 <210> 327 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 327 tcaacagata cttctgtatt atcattcttattggttcctg gccattgaaa atttgtggac60 atcatcgaat tgatccggta atttagtgtg 9p <210> 328 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 328 aacaatattt cctcttcatc tttaggaggtattatcactt cttctccttg tatgtttgtg60 ggcatatccg gtaatttagt gtg g3 <210> 329 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 329 cgtcgtgtgg ttgattccaa cccagtgcaacagaataata accccgtaaa tggtttcaat60 gacatcgaat tgatccggta atttagtgtg 90 <210> 330 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 330 atggaggtgt ccttcgatct taatagtttagtcaccgctt ctgcagtcaa caaatccttc60 cccatcgaat tgatccggta atttagtgtg 90 <210> 331 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 331 tggcaacaag cctcaaccgc tcaaatctcactttgttatt ttcatcggcg gacatcgaat60 tgatccggta atttagtgtg <210> 332 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 332 aaatagtagt ggaataattg gtacggtttttgtattattt tggaacgcaa aatagaagac60 gccatcgaat tgatccggta atttagtgtg 9p <210> 333 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 333 gataataatc tctcattttg aatcagttcgttggaagaag cagataattg tgaacttgat60 gtcatcgaat tgatccggta atttagtgtg 90 <210> 334 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 334 gtttatatgg ttcgggagtc atatcatcctcctcattaat gaataacagg ctcatcgaat60 tgatccggta atttagtgtg 80 <210> 335 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 335 cattttttca attgttgcaa gtcatcaatgcctttatatg ccgtgacaag tggatgttgt60 ttcatcgaat tgatccggta atttagtgtg 90 <210> 336 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 336 catcagtgac tactgttgga tgaagtaataataaaatatt gatcagtgaa gtcatcgaat60 tgatccggta atttagtgtg 80 <210> 337 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 337 ttagcttcct ttttagctaa tgctcttttagaacgagcat tctttggttt gatcgtccta60 atcatatccg gtaatttagt gtg <210> 338 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 338 agtttgctct tttttcagca atcttttggtatatagcagt atttgttttc agcatcgaat60 tgatccggta atttagtgtg gp <210> 339 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 339 ggtttgaact ctttgagtga gtggaactcctttattattt tatgtagtag atcttggtaa60 tccatatccg gtaatttagt gtg g3 <210> 340 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 340 tcttgacttt gtttaagttt cttctttttttctaaatctt gttgtttact ttttcgttta60 gccatatccg gtaatttagt gtg g3, <210> 341 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 341 tgagataatg atgagcgttt tatatcttggaacgtctttg catattggtt cggggttata60' tacatatccg gtaatttagt gtg 3"

<210> 342 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 342 taccgccctg ttgattaggg tcgtaataatgattattatt atcgttatac gacatcgaat60 tgatccggta atttagtgtg gp <210> 343 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 343 ttggacaaag tagctttggc agtggctaat ctagccattc tcatggaagt agttctgaaa 60 gacatatccg gtaatttagt gtg <210> 344 <211> 90 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 344 gtcgtggcag cagcacttga aattggtgac ttggtagcta gactacgtat ggattgtttg 60 aacatcgaat tgatccggta atttagtgtg g0 <210> 345 <211> 75 <212> DNA
<213> Artificial Sequence <220>

<223> DNA primer <400> 345 acggtaaaca atcactaaga cataccatta atactgatga cttctctcat 60 cgaattgatc cggtaattta gtgtg ~ 75 <210> 346 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 346 acgcaagagc gcaaacaagt aaattgaaga ttgctataaa tactgacgtt 60 ttcatcgaat tgatccggta atttagtgtg g0 <210> 347 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 347 tcggatgatg cgattgtcaa agcaatgtat aaaaggcttg gtataaggat 60 ggtgtacatt agcatcgaat tgatccggta atttagtgtg g0 <210> 348 <211> 90 , <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 348 ggctcaagaa ccaaatatcc accagcaagaaatgcttttc caggtgcact aaatgctttt60 gacatcgaat tgatccggta atttagtgtg 90 <210> 349 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 349 tgacaaccgg aaatggagcg gacgaaggaagtttaattgg agttaggtcc gacatcgaat60 tgatccggta atttagtgtg 80 <210> 350 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 350 tgcttttctt gaacgccatt acgtatcaaggcaggaatac gtgcatcaat tgctttttta60 cccatatccg gtaatttagt gtg g3 <210> 351 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 351 attggaaaaa agtatctcta tcgacataatcaaatatttc atcaaatgca gccatcgaat60 tgatccggta atttagtgtg <210> 352 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 352 ccaaatggaa gaatagttct ttgagttgatctaccaccac taccaccacc acctctaaat60 gacatcgaat tgatccggta atttagtgtg 90 <210> 353 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 353 atggaatcac ctctggccca tcaaacacaacactagttaa aaaattcact ggcatcgaat60 tgatccggta atttagtgtg g0 <210> 354 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 354 tattgtcctg gaacaacaat actagaaacattaccatcag tagtagtgtt tgacatatct60 gtcatatccg gtaatttagt gtg 83 <210> 355 <211> 80 <212> DNA -<213> Artificial Sequence <220>

<223> DNA primer <400> 355 ggttcttaac taatgctgga ttccaagacttttttagatt tagatcacct gccatcgaat60 tgatccggta atttagtgtg <210> 356 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 356 gcatctttac cagttatcgc cgtacaagaaatatctttag tgaaaacggt atcgtttttc60 aacatcgaat tgatccggta atttagtgtg 90 <210> 357 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 357 attcatattg ttcttcttct aaatttaatacattatctat atctatatct gacatcgaat60 tgatccggta atttagtgtg 8p <210> 358 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 358 aatttgaatg cgtggacata cacactcatttgtttcttat aggccttggc acgcttttgt60 ctcatcgaat tgatccggta atttagtgtg 90 <210> 359 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 359 actcttgctg aacgatgtca acacactgacggaataatgg tgttaagtcg gtcatcgaat60 tgatccggta atttagtgtg g0 <210> 360 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 360 ttattcacta taagtttctt tagttttggattctttttct ttaaactgat ttttatacct60 gacatcgaat tgatccggta atttagtgtg 90 <210> 361 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 361 tatgtttcaa atgcttattt tgaaacttctttgtttgttt cgatgcttta gccatcgaat60 tgatccggta atttagtgtg gp <210> 362 <211> 80 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 362 gtgaagattc ctcttcatcg taatacgacggtcttattgt tttacctctt gacatcgaat60 tgatccggta atttagtgtg <210> 363 <211> 90 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 363 tgattttgct gataatcaag gttagctatcgattcctcta tatctttttc taattgatcg60 gacatcgaat tgatccggta atttagtgtg 90 <210> 364 <211> 75 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 364 attaaggcat ctctacgaaa tgtcttttcaaaagtaacag gaccactcat cgaattgatc60 cggtaattta gtgtg 75 <210> 365 <211> 75 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 365 gcattcccac ttgatggtgg gtcgtcatttaaaatagatc caacattcat cgaattgatc60 cggtaattta gtgtg 75 <210> 366 <211> 75 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 366 tcaccgacaa tgactaattt tctacgaagttcagctggac cgttaaccat cgaattgatc60 cggtaattta gtgtg 75 <210> 367 <211> 83 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 367 attcgaaatg ctatgggtct aatgtttgatggctgaagtt taattggcaa agaagtgact60 tccatatccg gtaatttagt gtg 83 <210> 368 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 368 cctgtttgat catcttgatt cg 22 <210> 369 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 369 tgaattgaaa aatgaaaaca gcttcg 26 <210> 370 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 370 ccagtgaaaa tccacgtgta gatgg 25 <210> 371 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 371 ttgtcctttt cccacttcta tcaatg 26 <210> 372 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 372 atttccttta acgcgtttgc tg 22 <210> 373 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 373 gtgttaagta ggagtgggat gg 22 <210> 374 <211> 27 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 374 tgggtattat aggccttgtt tgtcaga 27 <210> 375 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 375 acctgaacca ctctcgccaa t , 21 <210> 376 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 376 gttgccgttt caattgttta gc 22 <210> 377 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 377 tgttctccat ttttggtggt gatt 24 <210> 378 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 378 tatatcacca gccccgttag ac 22 <210> 379 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 379 ccttgccatt tcatttcaaa gc 22 <210> 380 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 380 cgagagagta tttggaaagt cg 22 <210> 381 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 381 cagctgccga tagtgcaaag a 21 <210> 382 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 382 tttgagaaca gccacacgac as 22 <210> 383 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 383 ggagccattc cattcaatag tg 22 <210> 384 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 384 cgcgaatacc aggagttctt cc 22 <210> 385 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 385 tatgagacaa ctgggaagaa gt 22 <210> 386 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA prime r <400> 386 tgctcgaaga tttgtcgttg ga 22 <210> 387 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 387 cgagctgttc aaaactggtt ag 22 <210> 388 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 388 caagtggtag caaaaaccaa gc 22 <210> 389 <211> 27 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 389 cgattaattg ctcaagaaat tgccata 27 <210> 390 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 390 tacagagaca ttcaaacgcg tc 22 <210> 391 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 391 ttgcactgtc tggtgtgagt tg 22 <210> 392 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 392 tcatggaagc ggaagaacct g 21 <210> 393 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 393 atcaggcgac tacaccagaa cc 22 <210> 394 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 394 gttacttaca acttcatggg gc 22 <210> 395 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 395 tgccgcgata ggcatagtca 20 <210> 396 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 396 ggtggtggtg gcagaaatag ga 22 <210> 397 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 397 cggaggagga ggaggaggag 20 <210> 398 <211> 21 <212> DNA

<213> Artificial Sequence .

<220>

<223> DNA primer <400> 398 cctccttgta actccggttc g 21 <210> 399 <211> 25 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 399 tgatgaagaa gaacttgggg gtaga 25 <210> 400 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 400 cgttatcgat gccttccttc g 21 <210> 401 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer , <400> 401 gggttccaga ggttatcatg tgtg 24 <210> 402 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 402 ttgatgggtc cgagatcaag c 21 <210> 403 <211> 26 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 403 ggtcagattc acatttccag atctca 26 <210> 404 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 404 tcccttttcc gctgatccat 20 <210> 405 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 405 gatgagttta taattggcag cg 22 <210> 406 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 406 tcgagtgaat gttaggggag agaga 25 <210> 407 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 407 gtggaggaca atgctcttga gg 22 <210> 408 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 408 ttatccaaac accttttcct gg 22 <210> 409 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 409 ttaattcagt ttccgccata gc 22 <210> 410 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 410 tggaacattg ccgaaactga a 21 <210> 411 <211> 30 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 411 aggtatgata tttgacgttg tttattttgc 30 <210> 412 <211> 23 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 412 tccatttgct gatgatgatg atg 23 <210> 413 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 413 cctttctaaa gaatcccatc gc 22 <210> 414 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 414 ccggaccaat accagttacc g 21 <210> 415 <211> 23 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 415 caagtagttg aagcccacga tgc 23 <210> 416 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 416 tttgaaagga actatcggat tattggt 27 <210> 417 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 417 ccaggaagaa tttgatgcta cc 22 <210> 418 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 418 tcctcctcca gttgttgttg ttg 23 <210> 419 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 419 gatgaaacac aaaacgcaag gc 22 <210> 420 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> DNA primer <400> 420 tgccccagga acattgattg 20 <210> 421 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 421 ggtagtgctc aaaagtcatt gc 22 <210> 422 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 422 catggcactg gtgatgacaa tgta 24 <210> 423 <211> 23 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 423 tccgggtaaa ccaagaagtc aga 23 <210> 424 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 424 atatattctg ctgagcgcat tc 22 <210> 425 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 425 tgattcccac cacagttaga cgaa 24 <210> 426 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 426 tcgtcagatg cagcacacgt t 21 <210> 427 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 427 ttcccagcca aacaccaaaa 20 <210> 428 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 428 aagcaccacc aaatctacac caaa 24 <210> 429 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 429 tcttgggatt ggtatgtact gc <210> 430 <211> 27 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 430 tcgtgtgact attctttgat ttggaga 27 <210> 431 <211> 20 <212> DNA

<213> Artificial Sequence 1~5 <220>

<223> DNA primer <400> 431 ttgacgccac tagccccatt 20 <210> 432 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 432 cgaccaaatc caagtccgat g 21 <210> 433 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 433 ccagatcatc atcatctacg tc 22 <210> 434 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 434 gctgggttga tgacagtgtg tc 22 <210> 435 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 435 tggttgtggt tgtggttgtg g 21 <210> 436 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 436 actcctgcgg caacaccttc 20 <210> 437 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 437 ggatcacttt ccattccttc ag 22 <210> 438 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 438 tggcagcaat ttcttgagca g 21 <210> 439 , <211 > 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 439 ggaacgatca gcaaataatt gg 22 <210> 440 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 440 ggcaattgtt gctggagata cc 22 <210> 441 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 441 gtccatgtgg ttggttaata gc 22 <210> 442 <211> 26 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 442 aaactcggtt gtagagttag catcca 26 <210> 443 <211> 25 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 443 ccttttggac ctaaataaac cgtca 25 <210> 444 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 444 gtcactggct gttgataatt gc 22 <210> 445 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 445 ctcactcaac cgcgactgaa a 21 <210> 446 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 446 ctttatgtgt tggggtgcct gc <210> 447 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 447 tgactcaata gtgggccagc a 21 <210> 448 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 448 tacacgtttc cttctatatc gc 22 <210> 449 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 449 tctaggtagt ggcaaaggtt gc 22 <210> 450 <211> 27 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 450 tctgattctt tctccagacc tttttca 27 <210> 451 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 451 tatctgttcc tcgtggatca gc 22 <210> 452 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 452 tggtagtact ttgtggaatc cg <210> 453 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 453 catgccaaaa cccggacatt 20 <210> 454 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 454 acccgtgcat tgaataatta gc 22 <210> 455 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 455 ttccttgttc aaatctccac tg 22' <210> 456 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 456 tgactgtttc gccctttctg g 21 <210> 457 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 457 i8~

ccttgtttag atcttgtttc cg 22 <210> 458 <211> 25 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 458 ccactggttc atcaacaggt attgg 25 <210> 459 <211> 26 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 459 attggaccat taaaaacaaa cattgg 26 <210> 460 <211> 23 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 460 catttgattg tccaacacgc act 23 <210> 461 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 461 tcattgttgg tggtgaggtg taga 24 <210> 462 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 462 tcttggtggt gattttcctt gg <210> 463 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 463 tccaacatgg caccacatcc 20 <210> 464 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 464 ccctgggcat tcattggttg 20 <210> 465 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 465 gccaatcagc tctttcgtgg a 21 <210> 466 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 466 tgatcctact cgggccttat cg <210> 467 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 467 aacatacaag gcacgaggaa cg 22 <210> 468 <211> 25 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 468 tgccaaacta accataatct gctca 25 <210> 469 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 469 atcgatagac ggaacggaac ag 22 <210> 470 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 470 tggcaacaac tgacactaat cc 22 <210> 471 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 471 tcgccttcta tgggactctc as <210> 472 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 472 cgcttctgtc tgtgggaggt g 21 <210> 473 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 473 ccccaaccaa attctttagc ttca 24 <210> 474 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 474 tttcttgttc atctccacta cg 22 <210> 475 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 475 tgtgctcctc gttgtcccaa t 21 <210> 476 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 476 gttgaggtgt ttggcgatgg 20 <210> 477 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 477 ttttgagctt ctgctgtttg ttca 24 <210> 478 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 478 tatctaatgg aacgggttga cc 22 <210> 479 <211> 25 <212> DNA

<213> Artificial Sequence.

<220>

<223> DNA primer <400> 479 tcaaatgatt ccgaagtgaa gaaga 25 <210> 480 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 480 cccatcttca ccttcatttt gc 22 <210> 481 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 481 cgacccagct agtttcgtgt ca 22 <210> 482 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 482 cgaatttggt gagagatgat gc 22 <210> 483 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 483 tggcttttcc atcagcacgt t 21 <210> 484 <211> 23 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 484 ggaccatctg aatctgagcc tga 23 <210> 485 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 485 tagcttgttg gtattgtttg gc 22 <210> 486 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 486 ggcgtgcaag acaccattca 20 <210> 487 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 487 tggcggaggt ttatgtgcaa 20 <210> 488 <211> 22 <212> DNA

<213>.Artificial Sequence <220>

<223> DNA primer <400> 488 tgagcaactt gttggccttc ag 22 <210> 489 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> DNA primer <400> 489 ccccgatctt cgattttcca 20 <210> 490 <211> 1561 <212> DNA
<213> Candida albicans <400>

atgagagaagtcatcagtattaatggtatgtcttagtgattgtttaccgtttcaaaatcg 60 ccatcagttttttttttggggatggattgaaaacactaagatccggtttttttggttgtc 120 ttgatttcaaagtttgatccaagcttcattagtaagcagccataacaatccatcttaaac 180 gcgtcgatttttgattgaatcaatcaaagaattctgttcatactaacgccattgtatagt'240 tggtcaagccgggtgtcaaattggtaacgcctgttgggaattgtattcacaggaacatgg 300 tattagaccagatgggtatttacaagaaggtttagacagaccaaagggaggagaagaagg 360 tttttctacttttttcagtgaaactggttcaggtaaatacgttcctcgtgccttgtatgt 420 tgatttggaaccaaatgtcattgatgaagttcgtactggtgtttacaaagatttattcca 480 ccctgaacaattgattgccggtaaagaagatgccgccaataattatgctagaggtcacta 540 cactgttggaagagaaattttagacgacattttagatagagtcagaagaatgagtgatca 600 atgtgacggattacaaggtttccttttcacccactctttgggtggtggtaccggttccgg 660 tttgggttctttgttattggaacaattatctttggattacggtaaaaaatccaaattgga 720 atttgctgtttacccagctccacaagtgtccacttcagttgttgaaccatataatactgt 780 gttgactacccacaccactttggaacacgccgattgtacttttatggttgataatgaagc 840 catctacgatatgt.gtagaagaaacttggatattgccagaccaaattttagttcattgaa 900 caacttgattgctcaagttgtgtcatccgttaccgcctctttgagatttgacggttcctt 960 gaatgttgatttgaatgaattccaaactaacttggttccatacccaagaatccatttccc 1020 attggtcagttatgctccagttttctccaagagtagagctacccatgaagccaactctgt 1080 ttctgaaattactcaatcttgttttgaaccaggtaaccaaatggtcaaatgtgacccaag 1140 aactggtaaatacatggcca_cctgtttgttataccgtggtgatgttgttactagagacgt 1200 tcaaaatgctgttgctcaagttaaatctaaaaagactgttcaattagtcgattggtgtcc 1260 aactggtttcaagattggtatctgttaccaaccaccaactgccattaagggatctgaatt 1320 ggccagtgcttctagagctgtttgtatgttgtctaacactactgccattgctgaagcttg 1380 gagaagaattgacagaaaattcgacttgatgtactctaagagagcctttgttcactggta 1440 cgttggtgaaggtatggaagaaggtgaattcactgaagctagagaagacttggctgcttt 1500 agagagagattatattgaagttggtactgattctttccctgaagaagaagaagaatatta 1560 g 1561 Ig~

Claims (75)

What is claimed is:

1. A method for constructing a strain of diploid fungal cells in which both alleles of a gene are modified, the method comprising the steps of:
(a) modifying a first allele of a gene in diploid fungal cells by recombination using a gene disruption cassette comprising a first nucleotide sequence encoding an expressible selectable marker, thereby providing heterozygous diploid fungal cells in which the first allele of the gene is inactivated; and (b) modifying the second allele of the gene in the heterozygous diploid fungal cells by recombination using a promoter replacement fragment comprising a second nucleotide sequence encoding a heterologous promoter, such that expression of the second allele of the gene is regulated by the heterologous promoter.

2. A method of assembling a collection of diploid fungal cells each of which comprises modified alleles of a different gene, the method comprising the steps of:
(a) modifying a first allele of a first gene in diploid fungal cells by recombination using a gene disruption cassette comprising a first nucleotide sequence encoding an expressible selectable marker, thereby providing heterozygous diploid fungal cells in which the first allele of the gene is inactivated;
(b) modifying a second allele of the first gene in the heterozygous diploid fungal cells by recombination using a promoter replacement fragment comprising a second nucleotide sequence encoding a heterologous promoter, such that expression of the second allele of the gene is regulated by the heterologous promoter, thereby providing a first strain of diploid fungal cells comprising a modified allelic pair of the first gene; and (c) repeating steps (a) and (b) a plurality of times, wherein a different gene is modified with each repetition, thereby providing the collection of diploid fungal cells each comprising the modified alleles of a different gene.

3. The method of claim 1 or 2, wherein the selectable marker in the gene disruption cassette is disposed between a first region and a second region, wherein the first region and the second region hybridize separately to non-contiguous regions of the first allele of the gene in the diploid fungal cells.

4. The method of claim 3, wherein the selectable marker is selected from the group consisting of CaSAT1, CaBSR1, CaURA3, CaHIS3, CaLEU2, CaTRP1, and combinations thereof.

5. The method of claim 1, wherein the diploid fungal cells are cells of fungal species selected from the group consisting of Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida albicans, Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Pneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, Absidia corymbigera, Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, and Ustilago maydis.

6. The method of claim 1, wherein the diploid fungal cells are cells of Candida.

7. The method of claim 1 or 2, wherein the method further comprises (c) introducing a nucleotide sequence encoding a transactivation fusion protein that is expressible in the diploid fungal cell, said transactivation fusion protein comprising a DNA binding domain and a transcription activation domain;
and wherein the heterologous promoter in the promoter replacement fragment comprises at least one copy of a nucleotide sequence which is bound by the DNA binding domain of the transactivation fusion protein, such that binding of the transactivation fusion protein increases transcription from the heterologous promoter.

8. The method of claim 7, wherein the promoter replacement fragment further comprises a selectable marker.

9. The method of claim 8, wherein the selectable marker is selected from the group consisting of CaHIS3, CaSAT1, CaBSR1, CaURA3, CaLEU2, CaTRP1, and combinations thereof.

10. A strain of diploid fungal cells comprising modified alleles of a gene, wherein the first allele of the gene is inactivated by recombination using a gene disruption cassette comprising a nucleotide sequence encoding an expressible selectable marker; and the expression of the second allele of the gene is regulated by a heterologous promoter that is operably linked to the coding region of the second allele of the gene.

11. The diploid fungal cells of claim 10 further comprising a nucleotide sequence encoding a transactivation fusion protein that is expressible in the diploid fungal cell, said transactivation fusion protein comprising a DNA binding domain and a transcription activation domain; and wherein the heterologous promoter in the promoter replacement fragment comprises at least one copy of a nucleotide sequence which is bound by the DNA binding domain of the transactivation fusion protein, such that binding of the transactivation fusion protein increases transcription from the heterologous promoter.

12. The strain of diploid fungal cells of claim 10 or 12, wherein the gene is a gene essential for the growth and/or survival of the cells.

13. The strain of diploid fungal cells of claim 10 or 11, wherein the gene is a gene that contributes to the virulence and/or pathogenicity of the fungal cells against a host organism.

14. A collection of diploid fungal strains of claim 10 wherein each strain comprises modified alleles of a different gene, and wherein substantially all the different genes in the genome of the fungus are modified and represented in the collection.

15. A collection of diploid fungal strains of claim 10 each comprising the modified alleles of a different gene, wherein each gene is essential for the growth and/or survival of the cells.

16. The collection of diploid fungal strains of claim 15, wherein substantially all of the essential genes in the genome of the pathogenic fungus are modified and present in the collection.

17. A collection of diploid fungal strains of claim 10 each strain comprising the modified alleles of a different gene, wherein each gene contributes to the virulence and/or pathogenicity of the cells to a host organism.

18. The collection of diploid fungal strains of claim 17, wherein substantially all of the genes in the genome of the diploid fungus that contribute to the virulence and/or pathogenicity of the fungal cells against a host organism are modified and present in the collection.

19. The collection of diploid fungal strains of claim 14, wherein the essential genes present in the collection all share a characteristic selected from the group consisting of: similar biological activity, similar intracellular localization, structural homology, sequence homology, cidal terminal phenotype, static terminal phenotype, sequence homology to human genes, and exclusivity with respect to the organism.

20. The collection of claim 14, 15, 17, or 19 wherein the cells of each strain further comprise a molecular tag of about 20 nucleotides, the sequence of which is unique to each strain.

21. The collection of claim 20, wherein the molecular tag is disposed within the gene disruption cassette.

22. A nucleic acid molecule microarray comprising a plurality of nucleic acid molecules, wherein each nucleic acid molecule comprises a nucleotide sequence that is hybridizable to a target nucleotide sequence selected from the group consisting of SEQ ID
NO:1 through to SEQ ID NO:62.

23. A nucleic acid molecule microarray comprising a plurality of nucleic acid molecules, wherein each nucleic acid molecule comprises a nucleotide sequence that is hybridizable to the nucleotide sequence of a gene that is either essential to the growth of a diploid fungal cell or contributes to the virulence and/or pathogenicity of the diploid fungal cells against a host organism.

24. A method for identifying a gene that is essential to the survival of a fungus comprising the steps of:
(a) culturing the diploid fungal cells of claim 10 under conditions wherein the second allele of the gene is substantially underexpressed or not expressed; and (b) determining viability of the cells; whereby a loss or reduction of viability as compared to a control indicates that the modified gene is essential to the survival of the fungus.

25. A method for identifying a gene that is essential to the growth of a fungus comprising the steps of:
(a) culturing the diploid fungal cells of claim 10 under conditions wherein the second allele of the gene is substantially underexpressed or not expressed; and (b) determining growth of the cells; whereby a loss or reduction of growth of the cells as compared to a control indicates that the modified gene is essential to the growth of the fungus.

26. A method for identifying a gene that contributes to the virulence and/or pathogenicity of a fungus comprising the steps of:
(a) culturing diploid fungal cells of claim 10 or 11 under conditions wherein the second allele of the gene is substantially underexpressed or not expressed; and (b) determining the virulence and/or pathogenicity of the cells toward a host cell or organism; whereby a reduction of virulence and/or pathogenicity as compared to a control indicates that the modified gene contributes to the virulence and/or pathogenicity of the fungus.

27. A method for identifying a gene that contributes to the resistance of a diploid fungus to an antifungal agent comprising the steps of:
(a) culturing the diploid fungal cells of claim 10 under conditions wherein the second allele is substantially overexpressed and in the presence of the antifungal agent; and (b) determining the viability of the cells; whereby an increase in viability as compared to a control indicates that the modified gene contributes to the resistance of the diploid fungus to the antifungal agent.

28. A method for identifying an antifungal agent that inhibits the growth of a diploid fungus comprising the steps of:
(a) providing diploid fungal cells of claim 12; and (b) culturing the diploid fungal cells under conditions wherein the second allele of the gene is underexpressed and in the presence of a test compound;
whereby a loss or reduction of growth of the diploid fungal cells as compared to a control indicates that the test compound is an antifungal agent.

29. A method for identifying a therapeutic agent for treatment of a mammalian disease, the method comprising the steps of:
(a) providing diploid cells of claim 10, wherein the modified gene in the diploid cells is an essential gene and displays sequence homology to a mammalian gene associated with the disease;
(b) culturing diploid fungal cells under conditions wherein the second allele of the gene is overexpressed or underexpressed and in the presence of a test compound;
whereby a difference in growth of the diploid fungal cells as compared to a control indicates that the test compound is a therapeutic agent.

30. A method for correlating changes in the levels of proteins with the inhibition of growth or proliferation of a diploid fungal cell, the method comprising the steps of:
(a) generating a first protein expression profile for a control diploid fungal cell which comprises two wild type alleles of the gene;
(b) culturing diploid fungal cells of claim 12 under conditions wherein the second allele of the gene is substantially underexpressed, not expressed or overexpressed, and generating a second protein expression profile for the cultured cells; and (c) comparing the first protein expression profile with the second protein expression profile to identify changes in the levels of proteins.

31. A method for correlating changes in the levels of gene transcripts with the inhibition of growth or proliferation of a diploid fungal cell, the method comprising the steps of:
(a) generating a transcription profile for a control diploid fungal cell which comprises two wild type alleles of the gene;
(b) culturing diploid fungal cells of claim 12 under conditions wherein the second allele of the gene is substantially underexpressed, not expressed or overexpressed and generating a second transcription profile for the cultured cells; and (c) comparing the first transcription profile with the second transcription profile to identify changes in the levels of gene transcripts.

32. A purified or isolated nucleic acid molecule consisting essentially of a nucleotide sequence encoding a gene product required for proliferation of Candida albicans, wherein said gene product comprises an amino acid sequence of one of SEQ ID
NO:63 to 123.

33. The nucleic acid molecule of claim 32, wherein said nucleotide sequence is one of SEQ ID NO:1 to 61.

34. A nucleic acid molecule comprising a fragment of one of SEQ ID
NO.:1 to 62, said fragment selected from the group consisting of fragments comprising at least 10, at least 20, at least 25, at least 30, at least 50 and at least 100 consecutive nucleotides of one of SEQ ID NO: 1 to 62.

35. A nucleic acid molecule comprising a nucleotide sequence that hybridizes under stringent condition to a second nucleic acid molecule consisting of (a) a nucleotide sequence selected from the group consisting of one of SEQ ID NO.: 1 to 62, or (b) a nucleotide sequence that encodes a polypeptide consisting of an amino acid sequence selected from the group consisting of one of SEQ ID NO.: 63 to 123;
wherein said stringent condition comprises hybridization to filter-bound DNA
in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2xSSC/0.1% SDS at about 50-65°C.

36. The nucleic acid molecule of claim 34 or 35, which consists of the nucleotide sequence selected from the group consisting of one of SEQ ID NO.:
429 to 486.

37. A purified or isolated nucleic acid molecule obtained from an organism other than Candida albicans or Saccharomyces cerevisiae comprising a nucleotide sequence having at least 30% identity to a sequence selected from the group consisting of SEQ ID NO:1-62, fragments comprising at least 25 consecutive nucleotides of SEQ ID NO:1-62, the sequences complementary to SEQ ID NO:1-62 and the sequences complementary to fragments comprising at least 25 consecutive nucleotides of SEQ ID
NO:1-62, as determined using BLASTN version 2.0 with the default parameters.

38. The purified or isolated nucleic acid molecule of Claim 37, wherein said organism is selected from the group consisting of Absidia corymbigera, Aspergillus flavis, Aspergillus fumigatus, Aspergillus niger, Botrytis cinerea, Candida albicans, Candida dublinensis, Candida glabrata, Candida krusei, Candida parapsilopsis, Candida tropicalis, Coccidioides immitis, Cryptococcus neoformans, Erysiphe graminis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Magnaporthe grisea, Mucor rouxii, Pneumocystis carinii, Puccinia graminis, Puccinia recodita, Puccinia striiformis, Rhizomucor pusillus, Rhizopus arrhizus, Septoria avenae, Septoria nodorum, Septoria triticii, Tilletia controversa, Tilletia tritici, Trichosporon beigelii, and Ustilago maydis.

39. A vector comprising a promoter operably linked to the nucleic acid molecule of claim 32, 33, 34, 35, or 37.

40. The vector of Claim 39, wherein said promoter is regulatable.

41. The vector of Claim 39, wherein said promoter is active in an organism selected from the group consisting of Absidia corymbigera, Aspergillus flavis, Aspergillus fumigatus, Aspergillus niger, Botrytis cinerea, Candida albicans, Candida dublinensis, Candida glabrata, Candida krusei, Candida parapsilopsis, Candida tropicalis, Coccidioides immitis, Cryptococcus neoformans, Erysiphe graminis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Magnaporthe grisea, Mucor rouxii, Pneumocystis carinii, Puccinia graminis, Puccinia recodita, Puccinia striiformis, Rhizomucor pusillus, Rhizopus arrhizus, Septoria avenae, Septoria nodorum, Septoria triticii, Tilletia controversa, Tilletia tritici, Trichosporon beigelii, and Ustilago maydis.

42. A host cell containing the vector of claim 39.

43. A purified or isolated polypeptide comprising an amino acid sequence selected from the group consisting of one of SEQ ID NO: 63 to 123.

44. A purified or isolated polypeptide obtained from an organism other than Candida albicans or Saccharomyces cerevisiae comprising an amino acid sequence having at least 30% similarity to an amino acid sequence selected from the group consisting of one of SEQ ID NO:63 to 123 as determined using FASTA version 3.0t78 with the default parameters.

45. The polypeptide of Claim 44, wherein said organism is selected from the group consisting of Absidia corymbigera, Aspergillus flavis, Aspergillus fumigatus, Aspergillus niger, Botrytis cinerea, Candida albicans, Candida dublinensis, Candida glabrata, Candida krusei, Candida parapsilopsis, Candida tropicalis, Coccidioides immitis, Cryptococcus neoformans, Erysiphe graminis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Magnaporthe grisea, Mucor rouxii, Pneumocystis carinii, Puccinia graminis, Puccinia recodita, Puccinia striiformis, Rhizomucor pusillus, Rhizopus arrhizus, Septoria avenae, Septoria nodorum, Septoria triticii, Tilletia controversa, Tilletia tritici, Trichosporon beigelii, and Ustilago maydis.

46. A fusion protein comprising a fragment of a first polypeptide fused to a second polypeptide, said fragment consisting of at least 6 consecutive residues of an amino acid sequence selected from one of SEQ ID NO: 63 to 123.

47. A method of producing a polypeptide, said method comprises introducing into a cell, a vector comprising a promoter operably linked to a nucleotide sequence encoding a polypeptide consisting of an amino acid sequence selected from the group consisting of one of SEQ ID NO:62 to 123; and culturing the cell such that the nucleotide sequence is expressed.

48. A method of producing a polypeptide, said method comprising providing a cell which comprises a heterologous promoter operably linked to a nucleotide sequence encoding a polypeptide consisting of an amino acid sequence selected from the group consisting of one of SEQ ID NO:62 to 123; and culturing the cell such that the nucleotide sequence is expressed.

49. A method for identifying a compound which modulates the activity of a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of one of SEQ ID NO:1 to 62, said method comprising:
(a) contacting said gene product with a compound; and (b) determining whether said compound modulates the activity of said gene product.

50. The method of claim 49, wherein the activity of the gene product is inhibited.

51. The method of Claim 49, wherein said gene product is a polypeptide and said activity is selected from the group consisting of an enzymatic activity, carbon compound catabolism activity, a biosynthetic activity, a transporter activity, a transcriptional activity, a translational activity, a signal transduction activity, a DNA
replication activity, and a cell division activity.

52. A method of eliciting an immune response in an animal, comprising introducing into the animal a composition comprising an isolated polypeptide, the amino acid sequence of which comprises at least 6 consecutive residues of one of SEQ
ID NO: 63 to 123.

53. A strain of Candida albicans wherein a first allele of a gene comprising a nucleotide sequence selected from the group consisting of one of SEQ ID
NO:1 to 62 is inactive and a second allele of the gene is under the control of a heterologous promoter.

54. A strain of Candida albicans comprising a nucleic acid molecule comprising a nucleotide sequence selected from one of SEQ ID NO: 1 to 62 under the control of a heterologous promoter.

55. The strain of claim 53 or 54, wherein said heterologous promoter is regulatable.

56. A method of identifying a compound or binding partner that binds to a polypeptide comprising an amino acid sequence selected from the group consisting of one of SEQ ID NO: 63 to 123 or a fragment thereof said method comprising:
(a) contacting the polypeptide or fragment thereof with a plurality of compounds or a preparation comprising one or more binding partners; and (b) identifying a compound or binding partner that binds to the polypeptide or fragment thereof.

57. A method for identifying a compound having the ability to inhibit growth or proliferation of Candida albicans, said method comprising the steps of:
(a) reducing the level or activity of a gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1 to 62 in a Candida albicans cell relative to a wild type cell, wherein said reduced level is not lethal to said cell;

(b) contacting said cell with a compound; and (c) determining whether said compound inhibits the growth or proliferation of said cell.

58. The method of Claim 57, wherein said step of reducing the level or activity of said gene product comprises transcribing a nucleotide sequence encoding said gene product from a regulatable promoter under conditions in which said gene product is expressed at said reduced level.

59. The method of claim 58, wherein said gene product is a polypeptide comprising a sequence selected from the group consisting of polypeptides encoded by SEQ
ID NO: 63 to 123.

60. A method for inhibiting growth or proliferation of Candida albicans cells comprising contacting the cells with a compound that (i) reduce the level of or inhibit the activity of a nucleotide sequence selected from the group consisting of SEQ ID NO:1 to 62, or (ii) reduce the level of or inhibit the activity of a gene product encoded by a:
nucleotide sequence selected from the group consisting of SEQ ID NO:1 to 62.

61. The method of claim 60, wherein said gene product is a polypeptide comprising an amino acid sequence selected from the group consisting of polypeptides encoded by SEQ ID NO: 63 to 123.

62. The method of claim 60, wherein the compound is an antibody, a fragment of an antibody, an antisense nucleic acid molecule, or a ribozyme.

63. A method for manufacturing an antimycotic compound comprising the steps of:
(a) screening a pluralities of candidate compounds to identify a compound that reduces the activity or level of a gene product encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 61; and (b) manufacturing the compound so identified.

64. The method of claim 63, wherein said. gene product is a polypeptide comprising an amino acid sequence selected from the group consisting of polypeptides encoded by SEQ ID NO: 1 to 61.

65. A method for treating an infection of a subject by Candida albicans comprising administering a pharmaceutical composition comprising a therapeutically effective amount of a compound that reduces the activity or level of a gene product encoded by a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO:
1 to 62 and a pharmaceutically acceptable carrier, to said subject.

66. The method of claim 65, wherein the compound is an antibody, a fragment of an antibody, an antisense nucleic acid molecule, or a ribozyme.

67. A method for preventing or containing contamination of an object by Candida albicans comprising contacting the object with a composition comprising an effective amount of a compound that reduces the activity or level of a gene product encoded by a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO:
1 to 62.

68. A method for preventing or inhibiting formation on a surface of a biofilm comprising Candida albicans, said method comprising contacting the surface with a composition comprising an effective amount of a compound that reduces the activity or level of a gene product encoded by a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO: 1 to 62.

69. A pharmaceutical composition comprising a therapeutically effective amount of an agent which reduces the activity or level of a gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1 to 61 in a pharmaceutically acceptable carrier.

70. The method of claim 65, wherein said subject is selected from the group consisting of a plant, a vertebrate, a mammal, an avian, and a human.

71. An antibody preparation which binds the polypeptide of claim 43 or 44.

72. The antibody preparation of claim 71 which comprises a monoclonal antibody.

73. A method for evaluating a compound against a target gene product encoded by a nucleotide sequence comprising one of SEQ ID NO: 1 to 61, said method comprising the steps of:
(a) contacting wild type diploid fungal cells with the compound and generating a first protein expression profile;
(b) determining the protein expression profile of diploid fungal cells of claim 12 which have been cultured under conditions wherein the second allele of the target gene is substantially underexpressed, not expressed or overexpressed and generating a second protein expression profile for the cultured cells; and (c) comparing the first protein expression profile with the second protein expression profile to identify similarities in the profiles.

74. A method for evaluating a compound against a target gene product encoded by a nucleotide sequence comprising one of SEQ ID NO: 1 to 61, said method comprising the steps of:
(a) contacting wild type diploid fungal cells with the compound and generating a first transcription profile;
(b) determining the transcription profile of diploid fungal cells of claim 12 which have been cultured under conditions wherein the second allele of the target gene is substantially underexpressed, not expressed or overexpressed and generating a second transcription profile for the cultured cells; and (c) comparing the first transcription profile with the second transcription profile to identify similarities in the profiles.

75. A method for identifying an antimycotic compound comprising screening a plurality of compounds to identify a compound that reduces the activity or level of a gene product, said gene product being encoded by a nucleotide sequence that is naturally occurring in Saccharomyces cerevisiae and that is the ortholog of a gene having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 61.