CA2381204A1 - Pcr-based detection and quantification of tapesia yallundae and tapesia acuformis - Google Patents

Abstract

The present invention provides primers and probes for use in TaqManTM
quantitative PCR assays for the detection of Tapesia yallundae (syn.
Pseudocercosporella herpotrichoides W-type) and Tapesia acuformis (syn.
Pseudocercosporella herpotrichoides R-type). The present invention also provides primers and probes for use in TaqManTM quantitative PCR control assays for the detection of wheat DNA.

Description

PCR-Based Detection and Quantification of Tapesia yallundae and Tapesia acuformis The present invention relates to the use of primers and probes in TaqManT""
quantitative PCR assays for the detection of Tapesia yallundae (syn. Pseudocercosporella herpotrichoides W-type) and Tapesia acuformis (syn. Pseudocercosporella herpotrichoides R-type). The use of these assays enables the detection of specific fungal pathogens and their quantification in plant populations. The invention also relates to the use of primers and probes in TaqManT"" quantitative PCR assays for the detection of host wheat DNA for use as an endogenous reaction control.
Diseases in plants cause considerable crop loss from year to year resulting both in economic deprivation to farmers and, in many parts of the world, to shortfalls in the nutritional provision for local populations. The widespread use of fungicides has provided considerable security against plant pathogen attack. However, despite $1 billion worth of expenditure on fungicides, worldwide crop losses amounted to approximately 10%
of crop value in 1981 (James, 1981; Seed Sci. & Technol. 9: 679-685).
The severity of the destructive process of disease depends on the aggressiveness of the pathogen and the response of the host. One aim of most plant breeding programs is to increase the resistance of host plants to disease. Typically, different races of pathogens interact with different varieties of the same crop species differentially, and many sources of host resistance only protect against specific pathogen races. Furthermore, some pathogen races show early signs of disease symptoms, but cause little damage to the crop. Jones and Clifford (1983; Cereal Diseases, John Wiley) report that virulent forms of the pathogen are expected to emerge in the pathogen population in response to the introduction of resistance into host cultivars and that it is therefore necessary to monitor pathogen populations. In addition, there are several documented cases of the evolution of fungal strains that are resistant to particular fungicides. As early as 1981, Fletcher and Wolfe (1981; Proc. 1981 Brit. Crop Prot Conf.) contended that 24% of the powdery mildew populations from spring barley and 53% from winter barley showed considerable variation in response to the fungicide triadimenol and that the distribution of these populations varied between varieties, with the most susceptible variety also giving the highest incidence of less susceptible types. Similar variation in the sensitivity of fungi to fungicides has been documented for wheat mildew (also to triadimenol), Botrytis (to benomyl), Pyrenophora (to organomercury), Pseudocercosporella (to MBC-type fungicides) and Mycosphaerella fijiensis to triazoles to mention just a few (Jones and Clifford; Cereal Diseases, John Wiley, 1983).
Cereal species are grown world-wide and represent a major fraction of world food production. Although yield loss is caused by many pathogens, the necrotizing pathogens Septoria and Pseudocercosporella are particularly important in the major cereal growing areas of Europe and North America (Jones and Clifford; Cereal Diseases, John Wiley, 1983). In particular, the differential symptomology caused by different isolates and species of these fungi make the accurate predictive determination of potential disease loss difficult.
Consequently, the availability of improved diagnostic techniques for the rapid and accurate identification of specific pathogens will be of considerable use to field pathologists.
Eyespot of wheat is caused by the pathogens Tapesia acuformis and Tapesia yallundae.
These have previously been considered varieties of the same species Pseudocercosporella herpotrichoides (Fron) Deighton. Wheat, rye, oats and other grasses are susceptible to the eyespot disease, which occurs in cool, moist climates and is prevalent in Europe, North and South America, Africa and Australia. Wheat is the most susceptible cereal species, but isolates have been identified that are also virulent on other cereals. The R-strain of the fungus (Tapesia acuformis), for example, has also been isolated from rye and grows more slowly on wheat than the W-strain (Tapesia yallundae) which has been isolated from wheat.
Eyespot is restricted to the basal culm of the plant and can kill tillers or plants outright;
however, it more usually causes lodging and/or results in a reduction in kernel size and number. Yield losses associated with eyespot are of even greater magnitude than those associated with Septoria tritici and Septoria nodorum. Typical control measures for eyespot include treatment with growth regulators to strengthen internodes, as well as fungicide treatment. However, the differing susceptibility of cultivars to different strains of the fungus render the predictive efficacy of fungicide treatments difficult.
In view of the above, there is a real need for the development of technology that will allow the identification of specific races of pathogen fungi early in the infection process. By identifying the specific race of a pathogen before disease symptoms become evident in the crop stand, the agriculturist can assess the likely effects of further development of the pathogen in the crop variety in which it has been identified and can choose an appropriate fungicide if such application is deemed necessary.

TaqManT"" chemistry and the AB17700 (Perkin Elmer, Applied Biosystems Division, Foster City, CA) provide a means of creating precise, reproducible quantitative assays of DNA and RNA. The foundation of TaqManT"" chemistry is the polymerase chain reaction (PCR). In conventional PCR assays, oligonucleotide primers are designed complementary to the 5' and 3' ends of a DNA sequence of interest. During thermal cycling, DNA is first heat denatured. The sample is then brought to annealing and extension temperatures in which the primers bind their specific complements and are extended by the addition of nucleotide tri-phosphates by Taq polymerase. With repeated thermal cycling, the amount of template DNA is amplified.
In TaqManT"" chemistry, an oligonucleotide probe is designed that is complementary to the sequence region between the primers within the PCR amplicon. The probe contains a fluorescent reporter dye at its 5' end and a quencher dye at its 3' end. When the probe is intact, its fluorescent emissions are quenched by the phenomena of fluorescent resonance energy transfer (FRET). During thermal cycling, the probe hybridizes to the target DNA
downstream of one of the primers. TaqManT"" chemistry relies on the 5' exonuclease activity of Taq polymerase to cleave the fluorescent dye from the probe. As PCR product accumulates, fluorescent signal is increased. By measuring this signal, the amplified product can be quantified. This method allows the quantitation of disease pressure by targeting pathogen DNA. In combination with the PCR primers, the probe provides another level of specificity in assays to differentiate pathogens.
The present invention thus provides:
an oligonucleotide primer selected from the group consisting of SEQ ID NOs:3-6, 8-23, 25-26, 28, 30, 42, and 43, in particular, wherein said primer is selected from the group consisting of SEQ ID NOs:3-6, 8-23, 25-26, 28, and 30 ~ a pair of oligonucleotide primers, wherein at least one of said primers is the oligonucleotide primer as mentioned hereinbefore ~ a pair of oligonucleotide primers mentioned hereinbefore, wherein said pair consists of SEQ ID N0:14 and SEQ ID N0:18 or SEQ ID N0:3 and SEQ ID N0:8 ~ an oligonucleotide primer mentioned hereinbefore, wherein said primer is selected from the group consisting of SEQ ID NOs:42 and 43 ~ a pair of oligonucleotide primers, wherein at least one of said primers is the oligonucleotide primer consisting of SEQ ID NOs:42 and 43 ~ a pair of oligonucleotide primers, wherein said pair consists of SEO ID
N0:42 and SEQ
ID N0:43.
The invention further provides ~ methods for the detection of a fungal pathogen, in particular of Tapesia yallundae and Tapesia acuformis, comprising:
(a) isolating DNA from a plant leaf infected with a pathogen;
(b) subjecting said DNA to polymerase chain reaction amplification using at least one primer according to the invention; and (c) detecting said fungal pathogen by visualizing the product or products of said polymerase chain reaction amplification.
~ methods for the detection of a fungal pathogen, in particular of Tapesia yallundae and Tapesia acuformis, comprising:
(a) isolating DNA from plant tissue infected with said fungal pathogen;
(b) amplifying a part of the Internal Transcribed Spacer sequence of said fungal pathogen using said DNA as a template in a polymerase chain reaction with a pair of primers according to claim 3; and (c) detecting said fungal pathogen by visualizing the amplified part of the Internal Transcribed Spacer sequence.
The invention further provides diagnostic kit used in detecting a fungal pathogen, comprising the primer of as mentioned hereinbefore.
The invention further provides methods for the detection of wheat DNA, comprising:
(a) isolating DNA from wheat tissue infected with a pathogen;
(b) subjecting said DNA to polymerase chain reaction amplification using a pair of primers according to the invention; and (c) detecting said wheat DNA by visualizing the product or products of said polymerase chain reaction amplification.
Furthermore, the invention provides oligonucleotide probes for use in amplification-based detection of a fungal Internal Transcribed Spacer sequence, wherein said probe comprises:

(a) a nucleotide sequence complementary to at least 10 consecutive nucleotides of a sequence selected from the group consisting of: ITS1 of Tapesia yallundae, ITS2 of Tapesia yallundae, ITS1 of Tapesia acuformis and ITS2 of Tapesia acuformis;
(b) a fluorescent reporter dye at a 5' end of said nucleotide sequence; and (c) a quencher dye at a 3' end of said nucleotide sequence.
The invention further provides oligonucleotide probes according as mentioned hereinbefore, wherein said nucleotide sequence is complementary to at least 10 consecutive nucleotides of a sequence selected from the group consisting of: nucleotides 31-263 of SEQ
ID N0:37, nucleotides 420-570 of SEQ ID N0:37, nucleotides 31-262 of SEQ ID N0:38, and nucleotides 419-568 of SEO ID N0:38, but in particular wherein said nucleotide sequence is selected from the group consisting of: SEQ ID N0:7, SEO ID N0:24, SEQ ID
N0:27, and SEQ ID N0:29.
The invention further provides oligonucleotide probes for use in amplification-based detection of wheat DNA, wherein said probe comprises:
(a) a nucleotide sequence complementary to at least 10 consecutive nucleotides of SEQ
ID N0:41 or SEQ ID N0:44;
(b) a fluorescent reporter dye at a 5' end of said nucleotide sequence; and (c) a quencher dye at a 3' end of said nucleotide sequence.
The invention further provides an oligonucleotide primer pair/probe set for quantifying fungal DNA, wherein said primer pair consists of the pair of primers according to the invention and the probe is SEQ ID N0:24, SEQ ID N0:7 or SEQ ID N0:44.
In order to ensure a clear and consistent understanding of the specification and the claims, the following definitions are provided:
Gene: refers to a coding sequence and associated regulatory sequences wherein the coding sequence is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA
or antisense RNA. Examples of regulatory sequences are promoter sequences, 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
Identi : The percentage of sequence identity is determined using computer programs that are based on dynamic programming algorithms. Computer programs that are preferred within the scope of the present invention include the BLAST (Basic Local Alignment Search Tool) search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. Version BLAST 2.0 (Gapped BLAST) of this search tool has been made publicly available on the Internet (currently http://www.ncbi.nlm.nih.gov/BLAST~. It uses a heuristic algorithm which seeks local as opposed to global alignments and is therefore able to detect relationships among sequences which share only isolated regions. The scores assigned in a BLAST
search have a well-defined statistical interpretation. Said programs are preferably run with optional parameters set to the default values.
Plant: refers to any plant, particularly to seed plants.
Plant material: refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, pollen tubes, ovules, embryo sacs, egg cells, zygotes, embryos, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant The present invention is drawn to methods of identification and quantification of different species of plant pathogenic fungi. The invention provides primer and probe DNA
sequences useful in TaqManT"" quantitative PCR assays. Such DNA sequences are useful in the method of the invention as they are used in polymerase chain reaction (PCR) and TaqManT""-based diagnostic assays. These primers generate unique fragments in PCR
reactions in which the DNA template is provided by specific fungal pathogens.
In combination with the hybridization of the TaqManT"" probe, they can be used to detect and quantify the specific pathogens in host plant material before the onset of disease symptoms.
In a preferred embodiment, the invention provides ITS-derived diagnostic primers and TaqManT"" probes for the detection of Tapesia yallundae (syn.
Pseudocercosporella herpotrichoides W-type) and Tapesia acuformis (syn. Pseudocercosporella herpotrichoides R-type).
This invention provides the possibility of assessing potential damage in a specific crop variety-pathogen strain relationship and of utilizing judiciously the diverse armory of fungicides that is available. Furthermore, the invention can be used to provide detailed information on the development and spread of specific pathogen races over extended geographical areas. The invention provides a method of quantification of disease pressure on a given crop.

_7-Kits useful in the practice of the invention are also provided. The kits find particular use in the identification and quantification of the fungal pathogens Tapesia yallundae and Tapesia acuformis.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
SEQ ID NOs:1-34 are the following oligonucleotide probes and primers useful for PCR-based detection of the fungal pathogens Tapesia yallundae and Tapesia acuformis:
Sequence Oligo Target Oligo Sequence IdentifierName (5'->3') SEQ ID ITS1 Fungal 18S tccgtaggtgaacctgcgg rDNA

N0:1 SEQ ID ITS4 Fungal 25S tcctccgcttattgatatgc rDNA

N0:2 SEQ ID J103W Tapesia yallundaeggctaccctacttggtag N0:3 (V11) SEQ ID J104W Tapesia yallundaecctgggggctaccctacttg N0:4 (W ) SEQ ID J105W Tapesia yallundaegggggctaccctacttggtag N0:5 (W) SEQ ID J106W Tapesia yallundaetgggggctaccctacttggtag N0:6 (V11) SEQ ID J107W Tapesia yallundae(FAM)-tttagagtcgtcaggcctctcggagaagc-N0:7 (W) (TAMRA) SEQ ID J108W Tapesia yallundaeatttattcaagggtggaggtcctga N0:8 (W ) SEQ ID J109W Tapesia yallundaeaagggtggaggtctgaaccag N0:9 (W ) SEQ ID J110W Tapesia yallundaeaagggtggaggtctgaacca N0:10 (W) SEQ ID J111 Tapesia yallundaecaagggtggaggtctgaacc W

N0:11 (V11) _g_ SEQ ID J112R Tapesia acuformistcaagggtggaggtctgaacc N0:12 (R) SEQ ID J100R Tapesia acuformisgggccaccctacttcggtaa N0:13 (R) SEQ ID J101 Tapesia acuformisgaaatcctgggggccaccctacttc R

N0:14 (R) SEQ ID J102R Tapesia acuformiscctgggggccaccctact N0:15 (R) SEQ ID J113R Tapesia acuformisgccaccctacttcggtaaggtt N0:16 (R) SEQ ID J114R Tapesia acuformiscaccctacttcggtaaggtttagagtc N0:17 (R) SEQ ID J115R Tapesia acuformisaggtaatttattcaagggtggaggt N0:18 (R) SEQ ID J116R Tapesia acuformisaggtaatttattcaagggtggaggtc N0:19 (R) SEQ ID J117R Tapesia acuformisaaggtaatttattcaagggtggaggt N0:20 (R) SEQ ID J118R Tapesia acuformisttattcaagggtggaggtctgg N0:21 (R) SECT ID J119R Tapesia acuformistattcaagggtggaggtctgga N0:22 (R) SEQ ID J120R Tapesia acuformiscctgccaaagcaacaaaggta N0:23 (R) SEQ ID J121 Tapesia acuformis(FAM)-cgggcctctcggagaagcctgg-(TAMRA) R

N0:24 (R) SEQ ID J122R Tapesia acuformiscctacttcggtaaggtttagagtcgt N0:25 (R) SEQ ID J123R Tapesia acuformistctccgagaggcccgac N0:26 (R) SEQ ID J124R Tapesia acuformis(FAM)-aagcctggtccagacctccaccc-(TAMRA) N0:27 (R) _g_ SEQ ID J125R Tapesia acuformisaaggatcattaatagagcaatggatagac N0:28 (R) SEQ ID J126R Tapesia acuformis(FAM)-cgccccgggagaaatcctgg-(TAMRA) N0:29 (R) SEO ID J127R Tapesia acuformistgggggccaccctacttc N0:30 (R) SEQ ID JB537 Tapesia yallundaegggggctaccctacttggtag N0:31 (W) SEQ ID JB541 Tapesia yallundaeccactgattttagaggccgcgag N0:32 (W ) SEQ ID JB540 Tapesia acuformisgggggccaccctacttcggtaa N0:33 (R) SEQ ID JB542 Tapesia acuformisccactgattttagaggccgcgaa N0:34 (R) SEQ ID N0:35 is a forward sequencing primer.
SEQ ID N0:36 is a reverse sequencing primer.
SEQ ID N0:37 is a DNA sequence for the Internal Transcribed Spacer of Tapesia acuformis (syn. P. herpotrichoides R-type), NRRL accession no. B-21234, comprising in the 5'to 3' direction: 3' end of the small subunit rRNA gene (nucleotides 1-30), Internal Transcribed Spacer 1 (nucleotides 31-263), 5.8 S rRNA gene (nucleotides 264-419), Internal Transcribed Spacer 2 (nucleotides 420-570), and 5' end of the large subunit rRNA
gene (nucleotides 571-627).
SEQ ID N0:38 is a DNA sequence for the Internal Transcribed Spacer of Tapesia yallundae (syn. P. herpotrichoides W-type), NRRL accession no. B-21231, comprising in the 5' to 3' direction: 3' end of the small subunit rRNA gene (nucleotides 1-30), Internal Transcribed Spacer 1 (nucleotides 31-262), 5.8 S rRNA gene (nucleotides 263-418), Internal Transcribed Spacer 2 (nucleotides 419-569), and 5' end of the large subunit rRNA
gene (nucleotides 570-626).
SEQ ID N0:39 is a consensus DNA sequence of the partial ITS region PCR-amplified from wheat extracts from three different locations (Barton, Elmdon, Teversham) infected with Tapesia acuformis, comprising in the 5' to 3' direction: partial Internal Transcribed Spacer 1 sequence, 5.8 S rRNA gene, and partial Internal Transcribed Spacer 2 sequence.

SEQ ID N0:40 is a consensus DNA sequence of the partial ITS region PCR-amplified from wheat extracts from three different locations (Barton, Elmdon, Teversham) infected with Tapesia yallundae, comprising in the 5' to 3' direction: partial Internal Transcribed Spacer 1 sequence, 5.8 S rRNA gene, and partial Internal Transcribed Spacer 2 sequence.
SEQ ID N0:41 is the nucleotide sequence of the gene for cytochrome b-559 in wheat chloroplast DNA (Hird, et al., Mol. Gen. Genet. 203: 95-100 (1986)).
SEQ ID NOs:42-44 are the following oligonucleotide primers and probe useful for PCR-based detection of wheat chloroplast DNA:
Sequence Oligo PrimerOligo Sequence IdentifierName Name (5'->3') SEQ ID Forward WCP2 cagtgcgatggctggctatt N0:42 Primer SEQ ID Reverse WCP3 cgttggatgaactgcattgct N0:43 Primer SEQ ID TaqMan'"" WCP1 (VIC)-acggactagctgtacctactgtttttttcttgggatc-N0:44 Probe (TAMRA) The present invention provides unique DNA sequences that are useful in identifying and quantifying different pathotypes of plant pathogenic fungi. Particularly; the DNA sequences can be used as primers in TaqManT"" PCR-based analysis for the identification of fungal pathotypes. The DNA sequences of the invention include primers and probes derived from Internal Transcribed Spacer (ITS) sequences of the ribosomal RNA gene regions of particular fungal pathogens, which are capable of identifying the particular pathogen. The ITS DNA sequences from different pathotypes within a pathogen species or genus, which vary between the different members of the species or genus, can be used to identify those specific members.
Biomedical researchers have used PCR-based techniques for some time and with moderate success to detect pathogens in infected animal tissues. Only recently, however, has this technique been applied to detect plant pathogens. The presence of Gaumannomyces graminis in infected wheat has been detected using PCR of sequences specific to the pathogen mitochondrial genome (Schlesser et al., 1991; Applied and Environ.
Microbiol. 57:
553-556), and random amplified polymorphic DNA (i.e. RAPD) markers were able to distinguish numerous races of Gremmeniella abietina, the causal agent of scleroderris canker in conifers. U.S. Patent No. 5,585,238 (herein incorporated by reference in its entirety) describes primers derived from the ITS sequences of the ribosomal RNA gene region of strains of Septoria, Pseudocercosporella, and Mycosphaerella and their use in the identification of these fungal isolates using PCR-based techniques. In addition, WO
95/29260 (herein incorporated by reference in its entirety) describes primers derived from the ITS sequences of the ribosomal RNA gene region of strains of Fusarium and their use in the identification of these fungal isolates using PCR-based techniques.
Furthermore, U.S. Patent No. 5,800,997 (herein incorporated by reference in its entirety) describes primers derived from the ITS sequences of the ribosomal RNA gene region of strains of Cercospora, Helminthosporium, Kabatiella, and Puccinia and their use in the identification of these fungal isolates using PCR-based techniques.
Ribosomal genes are suitable for use as molecular probe targets because of their high copy number. Despite the high conservation between mature rRNA sequences, the non-transcribed and transcribed spacer sequences are usually poorly conserved and are thus suitable as target sequences for the detection of recent evolutionary divergence. Fungal rRNA genes are organized in units, each of which encodes three mature subunits of 18S
(small subunit), 5.8S, and 28S (large subunit). These subunits are separated by two Internal Transcribed Spacers, ITS1 and ITS2, of around 300 by (White etaL, 1990; In: PCR
Protocols; Eds.: Innes et al.; pages 315-322). In addition, the transcriptional units are separated by non-transcribed spacer sequences (NTSs). The ITS and NTS
sequences are particularly suitable for the detection of specific pathotypes of different fungal pathogens.
The DNA sequences of the invention are from the Internal Transcribed Spacer sequences of the ribosomal RNA gene region of particular plant pathogens. The ITS DNA
sequences from different pathotypes within a pathogen species or genus vary among the different members of the species or genus. Once having determined the ITS sequences of a pathogen, these sequences can be aligned with other ITS sequences. In this manner, primers can be derived from the ITS sequences. That is, primers can be designed based on regions within the ITS sequences that contain the greatest differences in sequence among the fungal pathotypes. These sequences and primers based on these sequences can be used to identify specific pathogens.
Sequences of representative oligonucleotide primers derived from ITS sequences are disclosed in SEQ ID NOs:1-34. The sequences find use in TaqManT"" quantitative PCR-based identification of the pathogens of interest.

Methods for the use of the primer sequences of the invention in PCR analysis are well known in the art. For example, see U.S. Patent Nos. 4,683,195 and 4,683,202, as well as Schlesser ef al. (1991 ) Applied and Environ. Microbiol. 57:553-556. See also, Nazar et al.
(1991; Physiol. and Molec. PIantPathol. 39: 1-11), which used PCR
amplification to exploit differences in the ITS regions of Verticillium albo-atrum and Verticillium dahliae and therefore distinguish between the two species; and Johanson and Jeger (1993;
Mycol. Res.
97: 670-674), who used similar techniques to distinguish the banana pathogens Mycosphaerella fijiensis and Mycosphaerella musicola.
The TaqManT"" methodology has recently been used in medical research for the quantitative detection of herpes simplex virus (HSV) DNA in clinical samples (J. Clin.
MicrobioL 37(6):
1941-7 (June, 1999)) in veterinary medicine for the detection of parasitic microbes in host animals (J. Clin. Microbiol. 37(5): 1329-31 (May, 1999)), and has been shown to be useful in the screening of ground beef for bacterial pathogens (Appl. Envir. Micro.
62(4): 1347-1353 (Apr., 1996)). Only recently has the TaqManT"" method been used for the identification and/or quantification of fungal pathogens in crop plants (Phytopathology. 89 (9): 796-804 (1999).
The ITS DNA sequences of the invention can be cloned from fungal pathogens by methods known in the art. In general, the methods for the isolation of DNA from fungal isolates are known. See, Raeder & Broda (1985) Letters in Applied Microbiology 2.17-20; Lee et al.
(1990) Fungal Genetics Newsletter 35:23-24; and Lee and Taylor (1990) In: PCR
Protocols: A Guide to Methods and Applications, Innes et al. (Eds.); pages 282-287.
The ITS sequences are compared within each pathogen group to locate divergences that might be useful to test in TaqManT"" PCR assays to distinguish the different species and/or strains. From the identification of divergences, numerous primers are synthesized for each probe and tested in TaqManT"" assays. Templates used for TaqManT"" assays are firstly purified pathogen DNA, and subsequently DNA isolated from infected host plant tissue.
Thus, it is possible to identify probe-primer combinations that are diagnostic, i.e. that identify one particular pathogen species or strain but not another species or strain of the same pathogen.
Preferred primer-probe combinations are able to distinguish between the different species or strains in infected host tissue, i.e. host tissue that has previously been infected with a specific pathogen species or strain. This invention provides numerous primer-probe combinations that fulfill this criterion for Tapesia yallundae and Tapesia acuformis. The primers and probes of the invention are designed based on sequence differences among the fungal ITS regions. A minimum of one base pair difference between sequences can permit design of a discriminatory primer or probe. Primer-probe combinations designed to a specific fungal pathogen's ITS region can be used in combination with a primer or probe made to a conserved sequence region within the ribosomal gene's coding region to detect amplification of species-specific PCR fragments. In general, primers should have a theoretical melting temperature (TM) near 59°C to achieve good sensitivity and should be void of significant secondary structure and 3' overlaps between primer combinations.
Primer pairs' TMs are typically within 2°C of one another. Primers generally have sequence identity with at least about 5-10 contiguous nucleotide bases of ITS1 or ITS2.
In preferred embodiments, primers are anywhere from approximately 5-30 nucleotide bases long.
Probes are generally designed to have a TM 10°C higher than that of the primers.
All wheat extractions contain the host wheat DNA as well as any fungal pathogen DNA
present. Thus, an endogenous control assay targeting the wheat DNA can be run on extracts to account for any differences among sample extractions. The present invention describes a control assay targeting the cytochrome b-559 gene. The cytochrome b-559 gene is a conserved gene among wheat varieties, necessary for the life of the host plant.
These control assays provide a control against false negatives. That is, a negative result for fungal DNA that could be attributed to inhibition of the PCR reaction is verified by an endogenous control assay. These control assays also provide a target against which the fungal DNA quantity is normalized for sample to sample comparison. The present invention describes the use of these control assays in reactions separate from the fungal pathogen assays and in multiplexed reactions. The present invention lends itself readily to the preparation of "kits" containing the elements necessary to carry out the process. Such a kit may comprise a carrier being compartmentalized to receive in close confinement therein one or more container, such as tubes or vials. One of the containers may contain unlabeled or detestably labeled DNA primers. The labeled DNA primers may be present in lyophilized form or in an appropriate buffer as necessary. One or more containers may contain one or more enzymes or reagents to be utilized in TaqManTM PCR reactions. These enzymes may be present by themselves or in admixtures, in lyophilized form or in appropriate buffers.
Finally, the kit may contain all of the additional elements necessary to carry out the technique of the invention, such as buffers, extraction reagents, enzymes, pipettes, plates, nucleic acids, nucleoside triphosphates, filter paper, and other consumables of the like.

The examples below show typical experimental protocols that can be used in the selection of suitable primer and probe sequences, the testing of primers and probes for selective and diagnostic efficacy, and the use of such primers and probes for disease and fungal isolate detection and quantification. Such examples are provided by way of illustration and not by way of limitation.
EXAMPLES
Standard recombinant DNA and molecular cloning techniques used here are well known in the art and are described by J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor laboratory, Cold Spring Harbor, NY
(1989) and by T.J. Silhavy, M.L. Berman, and L.W. Enquist,_Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and by Ausubel, F.M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987).
EXAMPLE 1: Fungal Isolates and Fungal genomic DNA Extraction Table 1 provides a listing of the fungal test isolates used and their source.
Fungi are grown in 150 ml potato dextrose broth inoculated with mycelial fragments from PDA
(Potato Dextrose Agar) cultures. Cultures are incubated on an orbital shaker at 28°C for 7-11 days.
Alternatively, mycelia are isolated directly from a PDA plate. Mycelia are pelleted by centrifugation and then ground in liquid nitrogen, and total genomic DNA is extracted using the protocol of Lee and Taylor (1990; In: PCR Protocols: A Guide to Methods and Applications; Eds.: Innes et aL; pages 282-287).
Table 1: Source of Test Isolates Isolate Organism Source Origin 358 Tapesia acuformis Novartis' ---308 Tapesia acuformis Novartis' -44643 Tapesia yallundae ATCC' Germany 44614 Tapesia yallundae ATCC' Ireland 60973 Tapesia acuformis ATCC' Germany 42040 Pseudocercosporella herpotrichoidesATCC' ---var.
herpotrichoides 62012 Pseudocercosporella aestiva ATCC' Germany 24425 Septoria nodorum ATCC' Montana 26517 Septoria tritici ATCC' Minnesota 38699 Septoria glycines ATCC' Illinois 22585 Septoria passerine ATCC' Minnesota 26380 Septoria avenae f.sp. triticea Bergstrom/Minnesota Ueng3 52182 Ceratobasidium cereale ATCC' Ohio 11404 Drechslera sorokiniana ATCC' Minnesota R-5391 Fusarium culmorum Nelson" Germany 4551 Fusarium moniliforme Novartis' Indiana R-8637 Fusarium graminearum Nelson'' Morocco T-534 Fusarium poae Nelson'' Pennsylvanni a 18222 Gerlachia nivalis ATCC' United Kingdom 093 Microdochium nivale var. majus Novartis' ---'Novartis Agribusiness Biotechnology Research, Inc., Research Triangle Park, NC, USA
2American Type Culture Collection, Rockville, Maryland, USA
3Dr. Gary Bergstrom, Cornell University, and Dr. Peter Ueng, USDA-ARS, Beltsville, Maryland.
4Dr. Paul Nelson, Penn State University, State College, Pennsylvania EXAMPLE 2: DNA Extraction from Wheat Stem Tissue DNA is extracted from wheat stem tissues (identified in Table 2) as follows:
(1 ) Up to 25 wheat samples are placed on a clean surface. A sterile scalpel is used to cut the stem just above the first tiller or root. Another cut is made 4 cm above this cut. This 4 cm section constitutes the stem tissue sample which is pooled with the additional wheat samples for bulk maceration.

(2) The stem sample is placed in a Bioreba (Reinach, Switzerland) heavy duty plastic bag (cat#490100). The plant tissue is weighed, plastic bag with sample minus the tare (weight of the plastic bag).
(3) An equal volume (mL) of Muller Extraction Buffer (0.1 % w/v Tween-80;
0.040 M Tris base; 0.15 M Sodium chloride; 0.1 % w/v Bovine serum albumin (Pentex Fraction V); 0.01 w/v Sodium azide; 0.20 M EDTA; pH to 7.7, Store at 4°C) is added per weight (g) of wheat tissue. Tissue is macerated using a Bioreba Homex 6 homogenizer set at 70. The tissue is ground until fibrous.
(4) Extraction juice is aliquoted into Eppendorf tubes on ice.
(a) Extracts are boiled for 5 minutes.
(b) Boiled extracts are kept on ice. The boiled extract is microfuged for 5 minutes at 12,000 x G.
(c) 1:20 dilutions of the supernatant are made from the microfuged extract in dH20.
(d) The diluted extracts are stored on ice until ready to use.
Table 2: Origin of Wheat Samples Used in Primer and Probe Development Sample Description Origin W(Barton) Eyespot infected wheat United Kingdom W(Elmdon) Eyespot infected wheat United Kingdom W(Teversham)Eyespot infected wheat United Kingdom R(Barton) Eyespot infected wheat United Kingdom R(Elmdon) Eyespot infected wheat United Kingdom R(Teversham)Eyespot infected wheat United Kingdom Table 3: Origin of Wheat Samples Used for Assay Development Sample Description Origin 1999 H Uninfected wheat Greenhouse 1999 #5 Eyespot infected wheat Fairfield, WA

1999 #6 Eyespot infected wheat Genesee, ID

1999 #8 Eyespot infected wheat Walla Walla, WA

1999 #10 Eyespot infected wheaf Connell, WA

1999 #16 Eyespot infected wheat Connell, WA

1999 #21 Eyespot infected wheat Colfax, WA

1999 #23 Eyespot infected wheat Colfax, WA

1999# 33 Eyespot infected wheat Athena, OR

1999 #38 Eyespot infected wheat Leland, ID

1999 #41 Eyespot infected wheat Coulee City, WA

1999 #43 Eyespot infected wheat Genesee, ID

1999 #46 Eyespot infected wheat Leland, ID

1999 #47 Eyespot infected wheat Leland, ID

1999 #54 Eyespot infected wheat Wilur, WA

1999 #56 Eyespot infected wheat Ritzville, WA

1999 #57 Eyespot infected wheat Sprague, WA

1999 #72 Eyespot infected wheat Grangeville, 1999 #73 Eyespot infected wheat Grangeville, 1999 #74 Eyespot infected wheat Grangeville, 1999 #80 Eyespot infected wheat Ritzville, WA

1999 #82 Eyespot infected wheat Edwall, WA

1999 #84 Eyespot infected wheat Genesee, ID

1999 #93 Eyespot infected wheat Davenport, WA

1999 #88 Eyespot infected wheat Wilbur, WA

1999 #89 Eyespot infected wheat Coulee City, WA

1999 #94 Eyespot infected wheat Plummee, ID

1999 #95 Eyespot infected wheat Pendleton, OR

1999 #96 Eyespot infected wheat Harrington, WA

1999 #100 Eyespot infected wheat Creston, WA

1999 #108 Eyespot infected wheat Wilbur, WA

1999 #111 Eyespot infected wheat Ferdinand, ID

EXAMPLE 3: Isolation and Sequencing of the Internal Transcribed Spacer (ITS) Region DNA from Tapesia yallundae and Tapesia acuformis Infected Wheat Samples Approximately 420-by truncated ITS region fragments are PCR-amplified from wheat extracts identified in Table 2 infected with Tapesia yallundae using the Tapesia yallundae-specific primers JB537 (SEQ ID N0:31 ) and JB541 (SEQ ID N0:32). Similarly, the Tapesia acuformis truncated ITS fragments are amplified from Tapesia acuformis-infected wheat extracts using Tapesia acuformis-specific primers JB540 (SEQ ID N0:33) and JB542 (SEQ
ID N0:34). Polymerase chain reactions are performed with the GeneAmp Kit from Perkin-Elmer (Foster City, CA; part no. N808-0009) using 50 mM KCI, 2.5 mM MgCl2, 10 mM Tris-HCI, pH 8.3, containing 200 p,M of each dTTP, dATP, dCTP, and dGTP, 50 pmol each primer, 2.5 units of Taq polymerase and 1 p.1 1:10 diluted wheat extract in a final volume of 50 ~.I. Reactions are run at 94°C for 15 s and 1 min. at 75°C
for 35 cycles in a Perkin-Elmer Model 9700 thermal cycles.
The PCR products are cloned into the pCR02.1-TOPO TA-cloning vector using the TOPO-TA Cloning Kit (Invitrogen, Carlsbad, CA; part no. K4550-40) according to manufacturer's directions. Clones containing the ITS fragment inserts are sequenced using the TA cloning vector's FORWARD (5'-gtaaaacgacggccagt-3'; SEQ ID N0:35) and REVERSE (5'-caggaaacagctatgac-3'; SEQ ID N0:36) primers. Sequencing is performed on an ABI
PRISM 377T"" DNA sequences (Perkin Elmer Applied Biosystems, Foster City, California).
EXAMPLE 4: Synthesis and Purification of Oligonucleotides Oligonucleotides and TaqManT"" probes (primers and probes) are synthesized and purified by, for example, either Integrated DNA Technologies (Coralville, IA) or Midland Certified Reagent Company (Midland, Texas).
EXAMPLE 5: Selection of Species-Specific Primers and Probes A multiple sequence alignment is made of ITS region consensus sequences of Tapesia yallundae (SEQ ID N0:40) and Tapesia acuformis (SEQ ID N0:39) obtained from infected wheat tissue as described in Example 3. Also included in the alignment are ITS
region sequences from Tapesia yallundae and Tapesia acuformis fungal DNAs referenced in U.S.
Patent No. 5,585,238 (SEQ ID N0:37 and SEQ ID N0:38, respectively). PCR
primers and TaqManT"" probes are designed to the regions that contain the greatest differences in sequence between the fungal species. This produces primers and probes designed to be specific to either Tapesia acuformis or Tapesia yallundae. The oligonucleotide primers and probes shown below in Tables 3 and 4 are synthesized according to Example 4.
The previously described (U.S. Patent No. 5,585,238) Tapesia yallundae-specific primers JB537 (SEQ ID N0:31 ) and JB541 (SEQ ID N0:32), and Tapesia acuformis-specific primers JB540 (SEQ ID N0:33) and JB542 (SEQ ID N0:34) are also synthesized. In addition, the ribosomal gene-specific primers ITS1 (SEQ ID N0:1 ) and ITS4 (SEQ ID N0:2) published by White et al. (1990: In: PCR Protocols; Eds.: Innes et al. Pages 315-322) are synthesized for testing in combination with the primers specific for the ITS regions.
Table 4: Primers and Probes for TaqManT"" Amplification of Tapesia acuformis DNA
SequenceOligo Target Oligo Sequence IdentifierName (5'->3') SEQ ID ITS1 Fungal 18S rDNA tccgtaggtgaacctgcgg N0:1 SEQ ID ITS4 Fungal 25S rDNA tcctccgcttattgatatgc N0:2 SEQ ID J112R Tapesia acuformistcaagggtggaggtctgaacc (R) N0:12 SEQ ID J100R Tapesia acuformisgggccaccctacttcggtaa (R) N0:13 SEQ ID J101 Tapesia acuformisgaaatcctgggggccaccctacttc R (R) N0:14 SEQ ID J102R Tapesia acuformiscctgggggccaccctact (R) N0:15 SEQ ID J113R Tapesia acuformisgccaccctacttcggtaaggtt (R) N0:16 SEQ ID J114R Tapesia acuformiscaccctacttcggtaaggtttagagtc (R) N0:17 SEQ ID J115R Tapesia acuformisaggtaatttattcaagggtggaggt (R) N0:18 SEQ ID J116R Tapesia acuformisaggtaatttattcaagggtggaggtc (R) N0:19 SEQ ID J117R Tapesia acuformisaaggtaatttattcaagggtggaggt (R) N0:20 SEQ ID J118R Tapesia acuformisttattcaagggtggaggtctgg (R) N0:21 SEQ ID J119R Tapesia acuformistattcaagggtggaggtctgga (R) N0:22 SEQ ID J120R Tapesia acuformiscctgccaaagcaacaaaggta (R) N0:23 SEQ ID J121 Tapesia acuformis(FAM)-cgggcctctcggagaagcctgg-(TAMRA) R (R) N0:24 SEQ ID J122R Tapesia acuformiscctacttcggtaaggtttagagtcgt (R) N0:25 SEQ ID J123R Tapesia acuformistctccgagaggcccgac (R) N0:26 SEQ ID J124R Tapesia acuformis(FAM)-aagcctggtccagacctccaccc-(TAMRA) (R) N0:27 SEQ ID J125R Tapesia acuformisaaggatcattaatagagcaatggatagac (R) N0:28 SEQ ID J126R Tapesia acuformis(FAM)-cgccccgggagaaatcctgg-(TAMRA) (R) N0:29 SEQ ID J127R Tapesia acuformistgggggccaccctacttc (R) N0:30 SEQ ID JB540 Tapesia acuformisgggggccaccctacttcggtaa (R) N0:33 SEQ ID JB542 Tapesia acuformisccactgattttagaggccgcgaa (R) N0:34 Table 5: Primers and Probes for TaqManT"" Amplification of Tapesia yallundae DNA
Sequence Primer Target Oligo Sequence IdentifierName (5'->3') SEQ ID ITS1 Fungal 18S rDNA tccgtaggtgaacctgcgg N0:1 SEQ ID ITS4 Fungal 25S rDNA tcctccgcttattgatatgc N0:2 SEQ ID J103W Tapesia yallundaeggctaccctacttggtag N0:3 (W ) SEQ ID J104W Tapesia yallundaecctgggggctaccctacttg N0:4 (W) SEQ ID J105W Tapesia yallundaegggggctaccctacttggtag N0:5 (W ) SEQ ID J106W Tapesia yallundaetgggggctaccctacttggtag N0:6 (W ) SEQ ID J107W Tapesia yallundae(FAM)-tttagagtcgtcaggcctctcggagaagc-N0:7 (W) (TAMRA) SEQ ID J108W Tapesia yallundaeatttattcaagggtggaggtcctga N0:8 (W ) SEQ ID J109W Tapesia yallundaeaagggtggaggtctgaaccag N0:9 (W) SEQ ID J110W Tapesia yallundaeaagggtggaggtctgaacca N0:10 (W) SEQ ID J111 W Tapesia yallundaecaagggtggaggtctgaacc N0:11 (VII) SEQ ID JB537 Tapesia yallundaegggggctaccctacttggtag N0:31 (W ) SEQ ID JB541 Tapesia yallundaeccactgattttagaggccgcgag N0:32 (W ) EXAMPLE 6: Initial Screening of the Primer-Probe Library The species-specific primer libraries designed in Example 5 are tested in initial TaqManT""
screens. Primer and probe combinations are tested for their ability to amplify from the target pathogen's DNA. All other reaction conditions are held constant (1X
TaqManT""
Universal Master Mix (Perkin Elmer, Norwalk, CT; part no. N430-4447), 200 nM
each primer, 100 nM probe, 0.04 ng/~.L fungal target genomic DNA, thermal cycling:
50°C for 2 min., 95°C for 10 min., 40 cycles of 95°C for 15 s, 60°C
for 60 s). Pathogen-specific primers and probes are determined by identifying those that best amplify the targeted DNA.

EXAMPLE 7: TaqManT"" Primer Optimization Once a primer pair specific for the targeted pathogen's DNA has been identified, the primer concentrations are optimized in a single TaqManT"" run. A matrix of different concentrations of the forward primer are run against those of the reverse primer with all other reaction conditions held constant (1 X TaqManT"" Universal Master Mix (Perkin Elmer), 100 nM probe, 0.4 ng/pL fungal target genomic DNA, thermal cycling: 50°C for 2 min., 95°C for 10 min., 40 cycles of 95°C for 15 s, 60°C for 60 s).
EXAMPLE 8: TaqManT"" Probe Optimization Once optimal primer concentrations are determined as in Example 7, the probe concentration is optimized. With primers at their optimal concentrations, different concentrations of probe are run in a typical TaqManT"" run. The probe concentration that gives the best signal in reporting the PCR amplification is chosen. The optimal primers and probe for quantification of Tapesia acuformis and Tapesia yallundae are recorded along with their optimal reaction concentrations (Tables 5 and 6, respectively). The Tapesia acuformis and Tapesia yallundae assays are established with an annealing temperature of 60°C over 35 cycles.
Table 6: Primer and Probe Combinations Specific for Tapesia acuformis Target Oligo Sequence Primer Optimized Identifier Name Concentration (nM) Tapesia acuformis (R) ForwardSEQ ID N0:14 J10150 Primer R

Reverse Primer SEQ ID N0:18 J115R900 TaqMan'"" Probe SEQ ID N0:24 J121700 R

Table 7: Primer and Probe Combinations Specific for Tapesia yallundae Target Oligo Sequence Primer Optimized IdentifierName Concentration (nM) Tapesia yallundae (W) ForwardSEQ ID J103W 300 Primer N0:3 Reverse Primer SEQ ID J108W 300 N0:8 TaqMan'"" Probe SEQ ID J107W 200 N0:7 EXAMPLE 9: Determination of TaqManT"' Assay Specificity to Fungal Genomic DNA
The TaqManT"" assay is validated against a panel of DNA from other cereal pathogens for cross-reactivity (Table 1 ). TaqManTM reactions are prepared using the optimal primer and probe concentrations as determined in Examples 7 and 8 and tested against 0.2 ng/p,L of the genomic DNA from the cereal pathogens as prepared in Example 1. Depending on the results, changes are made to the thermal cycling parameters to make the assay more stringent. These include changing the annealing/extension temperature or the number of cycles in the run. A successful TaqManT"" assay is sensitive to sub-picogram amounts of target DNA without any cross-reactivity to the panel of cereal pathogens or the plant DNA.
In Table 8 results of the Tapesia acufonnis (R-type) and Tapesia yallundae (V11-type) assays documented under Example 8 are shown. CT values are used to show amplification among isolates screened. Those isolates with a CT value of 35 give no amplification with the assays.
Table 8: Results of Tapesia acuformis TaqManT"" Assay on Fungal Genomic DNA
Samples IsolateOrganism CT Value CT Value R-type W-type assay assay 358 Tapesia acuformis 18.52 35 308 Tapesia acuformis 18.65 35 44643 Tapesia yallundae 35 44614 Tapesia yallundae 35 17.18 60973 Tapesia acuformis 31.36 35 42040 Pseudocercosporella herpotrichoides35 18.7 var.
herpotrichoides 62012 Pseudocercosporella aestiva 35 35 24425 Septoria nodorum 35 35 26517 Septoria tritici 35 35 38699 Septoria glycines 35 35 22585 Septoria passerini 35 35 26380 Septoria avenae f.sp. triticea 35 35 52182 Ceratobasidium cereale 35 35 11404 Drechslera sorokiniana 35 35 R- Fusarium culmorum 35 35 4551 Fusarium moniliforme 35 35 R- Fusarium graminearum 35 35 T-534 Fusarium poae 35 35 18222 Gerlachia nivalis 35 35 093 Microdochium nivale var. majus 35 35 Note: CT value or threshold cycle, represents the PCR cycle at which an increase in reporter fluorescence above a baseline signal can first be detected. The Sequence Detection software generates a Standard Curve of CT vs. (LogN) Starting Copy Number for all standards and then determines the starting copy number of unknowns by interpolation.
EXAMPLE 10: Determination of TaqManT"" Assay Specificity to Pathogen in Infected Wheat Wheat samples are identified as Tapesia acuformis and/or Tapesia yallundae infected based on analysis using the assays described in Example 3. Wheat samples are also tested using the primer combinations listed in Table 6 and the PCR conditions in Example 8. Using Sequence Detection Systems software (Perkin Elmer-Applied Biosciences), the amplification of pathogen DNA from the wheat samples is quantified against a standard curve of the fungal target's genomic DNA (Table 9). Results for the Tapesia acuformis specific assay are presented in Table 10. DNA from Tapesia acuformis is detected and quantified in all infected samples. Results for the Tapesia yallundae specific assay are presented in Table 11. DNA from Tapesia yallundae is detected and quantified in all infected samples. No cross-reactivity is observed in uninfected wheat tissue for either assay.
Table 9: Standard Curve of Tapesia acuformis and T, yallundae Genomic DNAs Run in Duplicate Against the R-type and W-type Assays, Respectively R-type Assay W-type Assay Tapesia acuformis CT Value Tapesia yallundae CT Value #308 #42040 DNA DNA

ng 18.57 5 ng 18.13 18.38 17.92 500 pg 21.3 500 pg 21.83 21.35 22.02 50 pg 23.57 50 pg 25.26 24.27 25.37 5 pg 27.82 5 pg 29.53 27.89 29.88 500 fg 31.47 500 fg 33.32 31.17 35 50 fg 34.13 No Template Control35 34.01 35 No Template Control35 Table 10: Results of the Tapesia acuformis TaqManT"" Assay on Wheat Extractions.
Samples Are Run in Duplicate and are Documented with Results of Conventional PCR
Assays TaqMan Results ample for CR Testing Tapesia Results Number acuformis (0 to +5 assay scale) CT Template T, acuformis Standard T. yallundae Mean Value (pg) Deviation (pg) 6 35 2.50E-020 0.02 35 2.50E-020 0.02 57 31.07 4.60E-010.03 0.44 +

31.20 4.20E-010.03 0.44 47 31.13 4.40E-010.14 0.54 +

30.62 6.40E-010.14 0.54 84 33.68 7.00E-020.01 0.06 +

33.96 5.70E-020.01 0.06 23 29.42 1.50E+000.28 1.71 ++

29.10 1.90E+000.28 1.71 46 28.67 2.60E+000.44 2.90 ++

28.37 3.20E+000.44 2.90 73 30.54 6.70E-010.06 0.72 ++

30.37 7.60E-010.06 0.72 21 27.34 6.80E+002.28 5.15 +++

28.24 3.50E+002.28 5.15 38 30.04 9.70E-010.71 1.47 +++

29.05 2.00E+000.71 1.47 43 26.12 1.60E+010.97 16.94 +++

26.01 1.80E+010.97 16.94 41 24.07 7.20E+0119.75 57.57 ++++

24.75 4.40E+0119.75 57.57 72 28.01 4.20E+000.29 3.96 ++++

28.16 3.80E+000.29 3.96 74 26.01 1.80E+013.03 19.75 ++++

25.71 2.20E+013.03 19.75 26.72 1.10E+011.50 9.51 +++++

27.03 8.50E+001.50 9.51 82 26.74 1.00E+011.29 9.51 +++++

27.01 8.60E+001.29 9.51 93 26.05 1.70E+012.12 18.68 +++++ +

25.82 2.00E+012.12 18.68 96 24.07 7.10E+013.75 68.50 +++++ ++

24.18 6.60E+013.75 68.50 Table 11: Results of the Tapesia yallundae TaqManTM Assay on Wheat Extractions.
Samples Are Run in Duplicate and are Documented with Results of Conventional PCR
Assays TaqMan'""
Results ample for CR Testing Tapesia Results Number acuformis (0 to +5 assay scale) CT Template T. acuformis Standard T. yallundae Mean Value (pg) Deviation (pg) 82 33.41 4.5E-01 0.07 0.40 +++++

33.78 3.6E-01 94 33.29 5.2 E-010.21 0.37 + +

34.68 2.2E-01 108 34.41 2.6E-01 0 0.26 +++ +

34.40 2.7E-01 111 33.21 5.4 E-010.02 0.53 ++ +

33.28 5.2E-01 33 24.67 9.1 E+0137.45 64.30 ++ ++

26.13 3.8 E+01 54 28.09 1.2E+01 6.31 16.10 +++ ++

27.14 2.1 E+01 80 26.43 3.1 E+013.62 34.03 ++++ ++

26.18 3.7E+01 95 29.98 3.8E+00 0.08 3.7 ++

30.03 3.6 E+00 100 27.16 2.0E+01 1.40 21.32 +++ +++

27.01 2.2E+01 8 25.63 5.1 E+019.96 57.91 + +++

25.22 6.5E+01 22.36 3.6E+02 79.1 418.46 ++ +++

21.91 4.7E+02 16 23.77 1.6 E+026.18 150.78 ++ ++++

23.87 1.5E+02 56 25.14 6.8E+01 2.26 66.56 ++++ ++++

25.22 6.5 E+01 88 24.48 1.0E+02 21.89 85.90 ++ ++++

25.09 7.0E+01 89 23.87 1.5 E+0216.48 157.85 ++++ +++++

23.63 1.7E+02 EXAMPLE 11: An Endogenous Control To Be Used With The Fungal Pathogen TaqManT"' Assays All wheat extractions contain the host wheat DNA as well as any fungal pathogen DNA
present. Thus, an endogenous control assay targeting the wheat DNA is run on extracts to account for any differences among sample extractions. These assays provide a control against false negatives. That is, a negative result for fungal DNA that could be attributed to inhibition of the PCR reaction is verified by this endogenous control assay.
These assays also provide a target against which the fungal DNA quantity is normalized for sample to sample comparison.
EXAMPLE 12: Selection Of Endogenous Control Primers And Probes Primers and probes for the amplification and detection of wheat chloroplast DNA are drawn to the coding sequence of the cytochrome b-599 gene (SEQ ID N0:41 ). Selection of primer and probe sequences is performed using the ABI Primer Express program (PE
Applied Biosystems, Foster City, CA, USA) according to manufacturer's instructions.
This program selects TaqManT"" primer and probe sets optimized by melting temperature, secondary structure, base composition, and amplicon length. From the sets chosen by the software, a best set is selected by manually finding primers with the fewest number of thermodynamically stable bases at the 3' end. The primer/probe set chosen for the amplification of wheat DNA as an endogenous control is documented in Table 12.
These are synthesized as in Example 4.

Table 12: Primer And Probe Combinations For An Endogenous Control Reaction Targeting Wheat (Triticum aesfivum) Chloroplast DNA
Oligo Sequence Primer Oligo Sequence Identifier Name (5'->3') Forward SEQ ID N0:42WCP2 cagtgcgatggctggctatt Primer Reverse SEQ ID N0:43WCP3 cgttggatgaactgcattgct Primer TaqMan"" SEQ ID N0:44WCP1 (VIC)-acggactagctgtacctactgtttttttcttgggatc-Probe (TAMRA) EXAMPLE 13: Use Of A TaqManT"" Assay To Gluantify Wheat DNA In Wheat Extractions Extractions of wheat tissue are made as in Example 2. The assay presented in Example 11 is run against these tissues as follows: Reactions are prepared in thin-walled optical grade PCR tubes (PE Applied Biosystems, Foster City, CA, USA). Reaction mixtures are made by bringing forward and reverse primer concentrations to 900 nM and probe concentration to 250 nM in a 1X solution of TaqMan Universal Master Mix (PE Applied Biosystems, Foster City, CA, USA). One microliter of 1:20 diluted wheat extract is added.
Additionally, cross-reactivity with fungal DNA is tested by adding 1 p.L of 5 ng/pL fungal DNA
preparation. The reactions are carried out in a ABI 7700 instrument (PE Applied Biosystems, Foster City, CA, USA), thermal cycling: 50°C for 2 min., 95°C for 10 min., 40 cycles of 95°C for 15 s, 60°C
for 60 s). The ABI 7700 software determines the CT value at which the fluoresence of each reaction reaches a threshold value of 0.4. This data is presented in Table 13.
The CT
values presented correspond inversely with the amount of wheat target DNA
present in each sample. Samples in which a CT of 40 are reported show no amplification.
Table 13 shows that the endogenous control assay detects the cytochrome b-559 gene in multiple varieties of wheat. The TaqManT"" assay for wheat chloroplast DNA also shows that different amounts of host DNA are present in each sample. By using dilutions of target DNA, a standard curve can be generated as described in Example 10 against which the wheat DNA can be quantified.

Table 13: CT Values Reported For A TaqManT"" Assay Targeting Wheat Chloroplast DNA
In Wheat And Fungal DNA Extractions Sample Wheat CT
Number Variety Value 6 Madsen 17.17 57 Madsen 19.48 73 Lambert 20.71 21 Brundage18.9 41 Eltan 20.23 13 Mixed 19.99 Madsen 19.19 5 ng 40 Tapesia acuformis DNA #308 Example 14: Multiplexing Of TaqManT"" Assays For Fungal Pathogens And Control Assay For Host DNA
The reaction presented in Example 13 is multiplexed with reactions for quantification of fungal DNA such that both tests take place in the same reaction tube. The probe and primers for Tapesia acuformis documented in Table 6 at their optimized concentrations are added to the reactions described in Example 13. These reactions are run as described on infected wheat tissue. The data presented here show that TaqManT"" fungal pathogen assays may be run in the same reaction tube as an endogenous control reaction for the wheat tissue.
Table 14: CT Values Reported For A TaqManT"" Assay Targeting Wheat Chloroplast DNA
In Wheat DNA Extractions Sample Wheat R-type Assay PCR Testing Results assay Number CT ValueCT Value Calculated(0 to +5 scale) Concentration T. T.
(pg) acuformis yallundae 6 17.09 40 0 41 27.70 20.65 24.3 ++++

13 30.9 19.99 3.69 +++++ +

While the present invention has been described with reference to specific embodiments thereof, it will be appreciated that numerous variations, modifications, and further embodiments are possible, and accordingly, all such variations, modifications and embodiments are to be regarded as being within the scope of the present invention.

SEQUENCE LISTING
<110> Novartis AG
<120> PCR-BASED DETECTION AND QUANTIFICATION OF TAPESIA
YALLUNDAE AND TAPESIA ACUFORMIS
<130> PB/5-31084A
<140>
<141>
<150> US 09/371,749 <151> 1999-08-10 <150> US 60/168,326 <151> 1999-12-O1 <160> 44 <170> PatentIn Ver. 2.1 <210> 1 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:ITSl <400> 1 tccgtaggtg aacctgcgg 19 <210> 2 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:ITS2 <400> 2 tcctccgctt attgatatgc 20 <210> 3 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J103W
<400> 3 ggctacccta cttggtag 18 <210> 4 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J104W
<400> 4 cctgggggct accctacttg 20 <210> 5 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J105W
<400> 5 gggggctacc ctacttggta g 21 <210> 6 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J106W
<400> 6 tgggggctac cctacttggt ag 22 <210> 7 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J107W
<400> 7 tttagagtcg tcaggcctct cggagaagc 29 <210> 8 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J108W
<400> 8 atttattcaa gggtggaggt cctga 25 <210> 9 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J109W
<400> 9 aagggtggag gtctgaacca g 21 <210> 10 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J110W
<400> 10 aagggtggag gtctgaacca 20 <210> 11 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J111W
<400> 11 caagggtgga ggtctgaacc 20 <210> 12 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J112R
<400> 12 tcaagggtgg aggtctgaac c 21 <210> 13 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J100R
<400> 13 gggccaccct acttcggtaa 20 <210> 14 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J101R
<400> 14 gaaatcctgg gggccaccct acttc 25 <210> 15 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J102R
<400> 15 cctgggggcc accctact 18 <210> 16 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J113R
<400> 16 gccaccctac ttcggtaagg tt 22 <210> 17 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J114R
<400> 17 caccctactt cggtaaggtt tagagtc 27 <210> 18 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J115R
<400> 18 aggtaattta ttcaagggtg gaggt 25 <210> 19 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J116R
<400> 19 aggtaattta ttcaagggtg gaggtc 26 <210> 20 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J117R
<400> 20 aaggtaattt attcaagggt ggaggt 26 <210> 21 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J118R
<400> 21 ttattcaagg gtggaggtct gg 22 <210> 22 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J119r <400> 22 tattcaaggg tggaggtctg ga 22 <210> 23 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J120R
<400> 23 cctgccaaag caacaaaggt a 21 <210> 24 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J121R
<400> 24 cgggcctctc ggagaagcct gg 22 <210> 25 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J122R
<400> 25 cctacttcgg taaggtttag agtcgt 26 <210> 26 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J123R
<400> 26 tctccgagag gcccgac 17 <210> 27 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J124R
<400> 27 aagcctggtc cagacctcca ccc 23 <210> 28 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J125R
<400> 28 aaggatcatt aatagagcaa tggatagac 29 _7_ <210> 29 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J126R
<400> 29 cgccccggga gaaatcctgg 20 <210> 30 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:J127R
<400> 30 tgggggccac cctacttc 18 <210> 31 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:JB537 <400> 31 gggggctacc ctacttggta g 21 <210> 32 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:JB541 <400> 32 ccactgattt tagaggccgc gag 23 <210> 33 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:JB540 <400> 33 gggggccacc ctacttcggt as 22 _g_ <210> 34 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:JB542 <400> 34 ccactgattt tagaggccgc gaa 23 <210> 35 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: forward sequencing primer <400> 35 gtaaaacgac ggccagt 17 <210> 36 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: reverse sequencing primer <400> 36 caggaaacag ctatgac 17 <210> 37 <211> 627 <212> DNA
<213> Tapesia acuformis <400> 37 tccgtaggtg aacctgcgga aggatcatta atagagcaat ggatagacag cgccccggga 60 gaaatcctgg gggccaccct acttcggtaa ggtttagagt cgtcgggcct ctcggagaag 120 cctggtccag acctccaccc ttgaataaat tacctttgtt gctttggcag ggcgcctcgc 180 gccagcggct tcggctgttg agtacctgcc agaggaccac aactcttgtt tttagtgatg 240 tctgagtact atataatagt taaaactttc aacaacggat ctcttggttc tggcatcgat 300 gaagaacgca gcgaaatgcg ataagtaatg tgaattgcag aattcagtga atcatcgaat 360 ctttgaacgc acattgcgcc ctctggtatt ccggggggca tgcctgttcg agcgtcatta 420 taaccactca agctctcgct tggtattggg gttcgcgtct tcgcggcctc taaaatcagt 480 ggcggtgcct gtcggctcta cgcgtagtaa tactcctcgc gattgagtcc ggtaggttta 540 cttgccagca acccccaatt ttttacaggt tgacctcgga tcaggtaggg atacccgctg 600 aacttaagca tatcaataag cggagga 627 <210> 38 <211> 626 <212> DNA

<213> Tapesia yallundae <400> 38 tccgtaggtg aacctgcgga aggatcatta atagagcaat gaacagacag cgccccggga 60 gaaatcctgg gggctaccct acttggtagg gtttagagtc gtcaggccgc tcggagaagc 120 ctggttcaga cctccaccct tgaataaatt acctttgttg ctttggcagg gcgcctcgcg 180 ccagcggctt cggctgttga gtacctgcca gaggaccaca actcttgttt ttagtgatgt 240 ctgagtacta tataatagtt aaaactttca acaacggatc tcttggttct ggcatcgatg 300 aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgaatc 360 tttgaacgca cattgcgccc tctggtattc cggggggcat gcctgttcga gcgtcattat 420 aaccactcaa gctctcgctt ggtattgggg ttcgcgtcct cgcggcctct aaaatcagtg 480 gcggtgcctg tcggctctac gcgtagtaat actcctcgcg attgagtccg gtaggtttac 540 ttgccagtaa cccccaattt tttacaggtt gacctcggat caggtaggga tacccgctga 600 acttaagcat atcaataagc ggagga 626 <210> 39 <211> 415 <212> DNA
<213> Tapesia acuformis <400> 39 gggggccacc ctacttcggt aaggtttaga gtcgtcgggc ctctcggaga agcctggtcc 60 agacctccac ccttgaataa attacctttg ttgctttggc agggcgcctc gcgccagcgg 120 cttcggctgt tgagtacctg ccagaggacc acaactcttg tttttagtga tgtctgagta 180 ctatataata gttaaaactt tcaacaacgg atctcttggt tctggcatcg atgaagaacg 240 cagcgaaatg cgataagtaa tgtgaattgc agaattcagt gaatcatcga atctttgaac 300 gcacattgcg ccctctggta ttccgggggg catgcctgtt cgagcgtcat tataaccact 360 caagctctcg cttggtattg gggttcgcgt cttcgcgggc ctctaaaatc agtgg 415 <210> 40 <211> 415 <212> DNA
<213> Tapesia yallundae <400> 40 gggggctacc cctacttggt agggtttaga gtcgtcaggc ctctcggaga agcctggttc 60 agacctccca cccttgaata aattaccttt gttgctttgg cagggcgcct cgcgccagcg 120 gcttcggctg ttgagtacct gccagaggac cacaactctt gtttttagtg atgtctgagt 180 actatataat agttaaaact ttcaacaacg gatctcttgg ttctggcatc gatgaagaac 240 gcagcgaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa 300 cgcacattgc gccctctggt attccggggg gcatgcctgt tcgagcgtca ttataaccac 360 tcaagctctc gcttggtatt ggggttcgcg tcctcgcggc ctctaaaatc agtgg 415 <210> 41 <211> 554 <212> DNA
<213> Triticum aestivum <220>
<221> misc_feature <222> (104)..(355) <223> cytochrome b-559 coding sequence <400> 41 tctcacaagg aatgaaatat cagtaatttt ctatttactg gtcgatccca tcttttacgg 60 aatcaattcc tttttgaatg tacaaaaatt ttgggagttc agcatgtctg gaagcacggg 120 agaacgttct tttgctgata ttattaccag tattcgatac tgggttattc atagcattac 180 tataccttcc ctattcattg cgggttggtt atttgtcagt acgggtttag cttatgacgt 240 gtttggaagt cctaggccaa acgagtattt cacggaaagc cgacaaggaa ttccgttaat 300 aaccgaccgt tttgattctt tagaacaact cgatgaattt agtagatcct tttaggaggc 360 cctcaatgac catagatcga acctatccta tttttacagt gcgatggctg gctattcacg 420 gactagctgt acctactgtt tttttcttgg gatcaatatc agcaatgcag ttcatccaac 480 gataaaccaa attccaacta tagaactatg acacaatcaa acccgaatga acaaaatgtt 540 gaattgaatc gtag 554 <210> 42 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: WCP2 <400> 42 cagtgcgatg gctggctatt 20 <210> 43 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: WCP3 <400> 43 cgttggatga actgcattgc t 21 <210> 44 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: WCP1 <400> 44 acggactagc tgtacctact gtttttttct tgggatc 37

Claims (23)

What is claimed is:

1. An oligonucleotide primer selected from the group consisting of SEQ ID
NOs:3-6, 8-23, 25-26, 28, 30, 42, and 43.

2. An oligonucleotide primer according to claim 1, wherein said primer is selected from the group consisting of SEQ ID NOs:3-6, 8-23, 25-26, 28, and 30.

3. A pair of oligonucleotide primers, wherein at least one of said primers is the oligonucleotide primer of claim 2.

4. A pair of oligonucleotide primers according to claim 3, wherein said pair consists of SEQ ID NO:14 and SEQ ID NO:18.

5. A pair of oligonucleotide primers according to claim 3, wherein said pair consists of SEQ ID NO:3 and SEQ ID NO:8.

6. An oligonucleotide primer according to claim 1, wherein said primer is selected from the group consisting of SEQ ID NOs:42 and 43.

7. A pair of oligonucleotide primers, wherein at least one of said primers is the oligonucleotide primer of claim 6.

8. A pair of oligonucleotide primers according to claim 7, wherein said pair consists of SEQ ID NO:42 and SEQ ID NO:43.

9. A method for the detection of a fungal pathogen, comprising:
(a) isolating DNA from a plant leaf infected with a pathogen;
(b) subjecting said DNA to polymerase chain reaction amplification using at least one primer according to claim 2; and (c) detecting said fungal pathogen by visualizing the product or products of said polymerase chain reaction amplification.

10. The method of claim 9, wherein said fungal pathogen is selected from Tapesia yallundae and Tapesia acuformis.

11. A method for the detection of a fungal pathogen, comprising:
(a) isolating DNA from plant tissue infected with said fungal pathogen;
(b) amplifying a part of the Internal Transcribed Spacer sequence of said fungal pathogen using said DNA as a template in a polymerase chain reaction with a pair of primers according to claim 3; and (c) detecting said fungal pathogen by visualizing the amplified part of the Internal Transcribed Spacer sequence.

12. The method of claim 11, wherein said fungal pathogen is selected from Tapesia yallundae and Tapesia acuformis.

13. A diagnostic kit used in detecting a fungal pathogen, comprising the primer of claim 2.

14. A diagnostic kit used in detecting a fungal pathogen, comprising the pair of primers of claim 3.

15. A method for the detection of wheat DNA, comprising:
(a) isolating DNA from wheat tissue infected with a pathogen;
(b) subjecting said DNA to polymerase chain reaction amplification using a pair of primers according to claim 7; and (c) detecting said wheat DNA by visualizing the product or products of said polymerase chain reaction amplification.

16. An oligonucleotide probe for use in amplification-based detection of a fungal Internal Transcribed Spacer sequence, wherein said probe comprises:
(a) a nucleotide sequence complementary to at least 10 consecutive nucleotides of a sequence selected from the group consisting of: ITS1 of Tapesia yallundae, ITS2 of Tapesia yallundae, ITS1 of Tapesia acuformis and ITS2 of Tapesia acuformis;
(b) a fluorescent reporter dye at a 5' end of said nucleotide sequence; and (c) a quencher dye at a 3' end of said nucleotide sequence.

17. An oligonucleotide probe according to claim 16, wherein said nucleotide sequence is complementary to at least 10 consecutive nucleotides of a sequence selected from the group consisting of: nucleotides 31-263 of SEQ ID NO:37, nucleotides 420-570 of SEQ ID
NO:37, nucleotides 31-262 of SEQ ID NO:38, and nucleotides 419-568 of SEQ ID
NO:38.

18. An oligonucleotide probe according to claim 17, wherein said nucleotide sequence is selected from the group consisting of: SEQ ID NO:7, SEQ ID NO:24, SEQ ID
NO:27, and SEQ ID NO:29.

19. An oligonucleotide probe for use in amplification-based detection of wheat DNA, wherein said probe comprises:
(a) a nucleotide sequence complementary to at least 10 consecutive nucleotides of SEQ
ID NO:41;
(b) a fluorescent reporter dye at a 5' end of said nucleotide sequence; and (c) a quencher dye at a 3' end of said nucleotide sequence.

20. An oligonucleotide probe according to claim 19, wherein said nucleotide sequence is SEQ ID NO:44.

21. An oligonucleotide primer pair/probe set for quantifying fungal DNA, wherein said primer pair consists of the pair of primers according to claim 4 and the probe is SEQ ID
NO:24.

22. An oligonucleotide primer pair/probe set for quantifying fungal DNA, wherein said primer pair consists of the pair of primers according to claim 5 and the probe is SEQ ID
NO:7.

23. An oligonucleotide primer pair/probe set for quantifying wheat DNA, wherein said primer pair consists of the pair of primers according to claim 8 and the probe is SEQ ID
NO:44.