CA2380955C - Plants having modified response to ethylene - Google Patents

Abstract

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype.

Description

~
PLANTS HAVING MODIFIED RESPONSE TO ETHYLENE

The U.S. Government has certain rights in this invention pursuant to Department of Energy Contract No.
DE-FG03-88ER13873.

Technical Field of the Invention The invention generally relates to modified ETR nucleic acid and plants transformed with such nucleic acid which have a phenotype characterized by a modification in the normal response to ethylene.

Background of the Invention Ethylene has been recognized as a plant hormone since the turn of the century when its effect on pea seedling development was first described. Neijubow (1901), Pflanzen Beih. Bot. ZentraZb. 20:128-139. Since then, numerous reports have appeared which demonstrate that ethylene is an endogenous regulator of growth and development in higher plants. For example, ethylene has been implicated in seed dormancy, seedling growth, flower initiation, leaf abscission, senescence and fruit ripening. Ethylene is a plant hormone whose biosynthesis is induced by environmental stress such as oxygen deficiency, wounding, pathogen invasion and flooding.

Recently, genes encoding some of the enzymes involved in ethylene biosynthesis have been cloned. Sato, et al. (1989) Proc. Nat1. Acad. Sci. U.S.A. 86:6621-6625;
Nakajima, et al. (1990) Plant Cell Phys. Physiol.
29:989-996; Van Der Straeten, et al. (1990) Proc. Nat1.
Acad. Sci U.S.A. 87:4859-4963; Hamilton, et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:7434-7437; and Spanu, et al. (1991) EMBO J. 10:2007-2013. The pathway for ethylene biosynthesis is shown in Fig. 1. As can be seen the amino acid methionine is converted to S-adenosyl-methionine (SAM) by SAM synthetase which in turn is converted to 1-aminocyclopropane-l-carboxylic acid (ACC) by ACC synthase. Adams, et al. (1979) Proc.
Natl. Acad. Sci. U.S.A. 76:170-174. The ACC is then converted to ethylene by way of the enzyme ACC oxidase.
Yang, et al. (1984) Annu. Rev. Plant. Physiol. 35:155-189.

A number of approaches have been taken in an attempt to control ethylene biosynthesis to thereby control fruit ripening. Oeller, et al. (1991) Science 254:437-439 report that expression of an antisense RNA to ACC
synthase inhibits fruit ripening in tomato plants.
Hamilton, et al. (1990) Nature 346:284-287 report the use of an antisense TOM13 (ACC oxidase) gene in transgenic plants. Picton et al. (1993) Plant Journal 3:469-481, report altered fruit ripening and leaf senesence in tomatoes expressing an antisense ethylene-forming enzyme.

- ~ ~

In a second approach, ethylene biosynthesis was reportedly modulated by expressing an ACC deaminase in plant tissue to lower the level of ACC available for conversion to ethylene. See PCT publication No.
W092/12249 published July 23, 1992, and Klee et al.
(1991) Plant Cell 3:1187-1193.

While a substantial amount of information has been gathered regarding the biosynthesis of ethylene, very little is known about how ethylene controls plant development. Although several reports indicate that a high affinity binding site for ethylene is present in plant tissues, such receptors have not been identified.
Jerie, et al. (1979) Planta 144:503; Sisler (1979) Plant Physiol. 64:538; Sisler, et al. (1990) Plant Growth Reg. 9:157-164, and Sisler (1990) "Ethylene-Binding Component in Plants", The Plant Hormone Ethylene, A.K. Mattoo and J.C. Suttle, eds. (Boston) C.R.C. Press, Inc., pp. 81-90. In Arabidopsis, several categories of mutants have been reported. In the first two categories, mutants were reported which produce excess ethylene or reduced ethylene as compared to the wild-type. Guzman, et al. (1990) The Plant Cell 2:513-523. In a third category, mutants failed to respond to ethylene. Id.; Bleecker, et al. (1988) Science 241:1086-1089, Harpham, et al. (1991) Ann. of Botany 68:55-61. The observed insensitivity to ethylene was described as being either a dominant or recessive mutation. Id.

Based upon the foregoing, it is clear that the genetic basis and molecular mechanism of ethylene interaction with plants has not been clearly delineated. Given the wide range of functions regulated by ethylene and the previous attempts to control ethylene function by regulating its synthesis, it would be desirable to have an alternate approach to modulate growth and development in various plant tissues such as fruits, vegetables and flowers by altering the interaction of ethylene with plant tissue.

Accordingly, it is an object of the invention to provide isolated nucleic acids comprising an ethylene response (ETR) nucleic acid.

In addition, it is an object to provide modifications to such ETR nucleic acids to substitute, insert and/or delete one or more nucleotides so as to substitute, insert and/or delete one or more amino acid residues in the protein encoded by the ETR nucleic acid.

Still further, it is an object to provide plant cells transformed with one or more modified ETR nucleic acids. Such transformed plant cells can be used to produce transformed plants wherein the phenotype vis-a-vis the response of one or more tissues of the plant to ethylene is modulated.

Summarv of the Invention In accordance with the foregoing objects, the invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell.

The invention also includes vectors capable of transforming a plant cell to alter the response to ethylene. In one embodiment, the vector comprises a modified ETR nucleic acid which causes a decrease in cellular response to ethylene. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid.

5 Accordingly, an aspect of the present invention is an isolated nucleic acid comprising a plant ETR nucleic acid encoding an ETR protein, said ETR protein having at least 50%
overall similarity to the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3, and at least 55%
similarity to the N-terminal 316 amino acids of said ETR
protein sequence of Arabidopsis thaliana, wherein the expression of said ETR protein encoded by said ETR nucleic acid in a plant cell results in an increased or decreased response to ethylene by said cell.

A further aspect of the present invention is an isolated modified plant ETR nucleic acid comprising a precursor ETR nucleic acid which has been modified to encode a modified ETR protein comprising the substitution, insertion or deletion of an amino acid residue in the N-terminal 316 amino acids of a precursor ETR protein encoded by said precursor ETR nucleic acid, wherein said precursor ETR protein has at least 50%
overall similarity to the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3, and at least 55%
similarity to the N-terminal.316 amino acids of said ETR
protein sequence of Arabidopsis thaliana, wherein the expression of said ETR protein encoded by said ETR nucleic acid in a plant cell results in an increased or decreased response to ethylene by said cell.

A further aspect of the present invention is a recombinant nucleic acid comprising a promoter operably linked to the above-mentioned modified ETR plant nucleic acid.

-5a-The invention also includes methods for producing plants having a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a wild-type plant not containing such a transformed cell. The method comprises transforming at least one plant cell with a modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype.

Accordingly, a further aspect of the present invention is a method for producing a plant having transformed plant cells and a phenotype characterized by a detectable decrease in the response of said transformed plant cells to ethylene as compared to a plant not containing said transformed plant cells, said method comprising the steps of: a) transforming at least one plant cell with a modified ETR nucleic acid comprising a precursor ETR nucleic acid which has been modified to encode a modified ETR protein comprising the substitution, insertion or deletion of an amino acid residue in the ETR protein encoded by said precursor ETR nucleic acid, wherein said modified ETR protein has at least about 50% overall similarity to the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3, and at least about 55% similarity to the N-terminal 316 amino acids of said Arabidopsis thaliana ETR protein; b) regenerating plants from one or more of the thus transformed plant cells; and c) selecting at least one plant having said phenotype.

In another aspect, the invention provides a plant cell transformed with a modified ethylene response (ETR) nucleic acid and having a phenotype characterized by a decrease in the response to ethylene as compared to a corresponding wild-type plant cell, wherein said modified -5b-ETR nucleic acid comprises a precursor ETR nucleic acid that encodes a precursor ETR protein, wherein said precursor ETR
nucleic acid has been substituted at one or more nucleotides which results in the substitution of one or more selected amino acid residues in said precursor ETR protein with a different amino acid, said selected amino acid residue being equivalent to an amino acid residue selected from the group consisting of Ala-31, Ile-62, Cys-65 and Ala-102 in the ETR
protein from Abrabidopsis thaliana as set forth in SEQ ID NO: 3.

In another aspect, the invention provides a plant cell comprising a recombinant nucleic acid, said recombinant nucleic acid comprising a promoter operably linked to a modified plant ethylene response (ETR) nucleic acid, wherein said modified ETR nucleic acid contains the substitution of one or more nucleotides of a precursor ETR nucleic acid which results in the substitution of one or more selected amino acid residues in a precursor ETR protein with a different amino acid, said selected amino acid residue being equivalent to an amino acid residue selected from the group consisting of Ala-31, Ile-62, Cys-65 and Ala-l02 in the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3 and wherein said promoter is heterologous to said precursor ETR nucleic acid and capable of causing expression of said modified ETR nucleic acid in said plant cell.

In another aspect, the invention provides a plant cell comprising a recombinant nucleic acid, said recombinant nucleic acid comprising a promoter operably linked to a modified plant ethylene response (ETR) nucleic acid, wherein said modified plant ETR nucleic acid comprises a precursor ETR nucleic acid which has been modified to encode a modified ETR protein comprising the substitution, insertion or deletion of an amino acid residue in the N-terminal 316 -5c-amino acids of a precursor ETR protein encoded by said precursor ETR nucleic acid, wherein said precursor ETR
protein has at least 75% identity to the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3, and at least 75% identity to the N-terminal 316 amino acid of said ETR protein sequence of Arabidopsis thaliana, wherein the expression of said ETR protein encoded by said ETR nucleic acid in said plant cell results in an increased or decreased response to ethylene by said plant cell.

In another aspect, the invention provides a plant cell comprising a recombinant nucleic acid comprising a promoter operably linked to an ETR nucleic acid that encodes an ethylene response (ETR) protein, wherein said ETR nucleic acid hybridizes with a probe having a nucleic acid sequence complementary to the sequence represented in SEQ ID NO: 2 at hybridization conditions of 50 C in 5xSSPE and washing conditions of 50 C in 0.2xSSPE, wherein the expression of an ETR protein encoded by said recombinant nucleic acid in a plant cell results in an increased or decreased response to ethylene by said cell.

Brief Description of the Drawings Figure 1 depicts the biosynthetic pathway for ethylene.

Figures 2A, 2B and 2C depict the genomic nucleic acid sequence (SEQ ID NO:l) for the ETR gene from Arabidopsis thaliana.

Figures 3A, 3B, 3C and 3D depict the cDNA nucleic acid (SEQ ID NO: 2) and deduced amino acid sequence (SEQ ID NO: 3) for the ETR gene from Arabidopsis thaliana.

-5d-Figures 4A, 413, 4C and 4D through Figures 7A, 73, 7C and 7D depict the cDNA and deduced amino acid sequence for four mutant ETR genes from Arabidopsis thaliana which confer ethylene insensitivity. Each sequence differs from the wild type sequence set forth in Fig. 3 by substitution of one amino acid residue. The etrl-3 (formerly eini-1) mutation in Fig. 4 (SEQ ID NOs: 8 and 9) comprises the substitution of alanine-31 with valine. The etrl-4 mutation in Fig. 5 (SEQ ID NOs: 10 and 11) comprises the substitution of isoleucine-62 with phenylalanine. The etrl-1 (formerly etr) mutation in Fig. 6 (SEQ ID NOs:4 and 5) comprises the substitution of cysteine-65 with tyrosine. The etrl-2 mutation in Fig. 7 (SEQ ID NOs:6 and 7) comprises the substitution of alanine-102 with threonine.

Figure 8 depicts the structure of the cosmid insert used to localize the ETR1 gene from Arabidopsis thaliana. The starting position for the chromosome walk is indicated by a hatched bar. The open bars give the location and length of DNA segments used as probes to detect recombination break points. The maximum number of break points detected by each probe is shown.
The numbers to the right of the ETR1 gene are out of 74 F2 recombinants between etrl-1 and ap-1, and those to the left of the ETR-1 gene are out of 25 F2 recombinants between etri-1 and clv2. Overlapping YAC
clones EG4E4 and EG2G11 are also shown.

Figures 9A and 9B depict the amino acid sequence alignments of the predicted ETR1 protein and the conserved domains of several bacterial histidine kinases and response regulators. Amino acids are shown at positions where there are at least two identities with ETR1. In Fig. 9A, the deduced ETRI
amino acid sequence (SEQ ID NOs:12 and 27) (residues 326 to 562) aligned with the histidine kinase domains of E. coli BarA (SEQ ID NOs:13 and 28), P. syringae LemA (SEQ ID NOs:14 and 29) and X. campestris RpfC(SEQ
ID NOs:15 and 30). Boxes surround the five conserved motifs characteristic of the bacterial histidine kinase domain as compiled by Parkinson and Kofoid (Parkinson et al. (1992) Annu. Rev. Genet. 26:71). The conserved histidine residue that is the supposed site of autophosphorylation is indicated by an asterisk.
Numbers and positions of amino acids not shown are _7_ given in parentheses. In Fig. 9B, the deduced ETR1 amino acid sequence (residues 610 to 729) (SEQ ID
NOs:15 and 31) are aligned with the response regulator domains of B. parapertussis BvgS (SEQ ID NOs:17 and 32), P. syringae LemA (SEQ ID NOs:19 and 34) and E.
coli RscC (SEQ ID NOs:18 and 33). Amino acids are shown in boldface type where there are at least two identities with ETR1. Boxes surround the four highly conserved residues in bacterial response regulators.
The conserved aspartate residue that is the site of phosphorylation is indicated by an asterisk. Numbers and positions of amino acids not shown are given in parentheses. For alignment purposes, a gap (_) was introduced in the ETR1 sequence.

Figures l0A and 10B depict specific DNA sequences for ETR nucleic acids from tomato and Arabidopsis thaliana.
Figure 10A compares the DNA sequence encoding amino acid residues 1 through 123 (SEQ ID NOs:20 and 21).
Figure 10B compares the ETR nucleic acid sequence encoding amino acids 306 through 403 (SEQ ID NOs:22 and 23). The vertical lines in each figure identify homologous nucleotides.

Figures 11A and 11B compare partial amino acid sequences (using single letter designation) for an ETR
protein from tomato and Arabidopsis thaliana. Figure 11A compares the amino acid sequence for the ETR
protein for amino acids 1 through 123 (SEQ ID NOs:24 and 25). Figure 11B compares the amino acid sequence for the ETR protein for residues 306 through 403 (SEQ
ID NOs:26 and 27). The vertical lines indicate exact sequence homology. Two vertical dots indicate that the amino acid residues are functionally conserved. One dot indicates weak functional conservation as between amino acid residues.

Figures 12A, 12B, 12C and 12D depict the genomic nucleic acid sequence (SEQ ID NO:45) and deduced amino acid sequence (SEQ ID NO:46) for the QITR ETR gene from Arabidopsis thaliana.

Figure 13 depicts the cDNA nucleic acid sequence and deduced protein sequence for the QITR ETR gene from Arabidopsis thaliana.

Figure 14 depicts the genomic nucelic acid sequence (SEQ ID NO:41) and deduced amino acid sequence (SEQ ID
NO:42) for the Q8 ETR gene from Arabidopsis thaliana.

Figure 15 depicts the cDNA nucleic acid.sequence (SEQ
ID NO:43) and deduced amino acid sequence (SEQ ID
N0:44) for the Q8 ETR gene from Arabidopsi.s thaliana.
Figure 16 depicts the nucleic acid sequence (SEQ ID
NO:35) and deduced amino acid sequence (SEQ ID NO:36) for the TETR nucleic acid from tomato.

Figure 17 is a comparison of the amino terminal portions of the TETR and ETR1 proteins from tomato and Arabidopsis respectively. The top line is the TETR
sequence and extends through amino acid residue 315.
The lower line represents the ETR1 protein sequence and extends through amino acid residue 316. The vertical lines and single and double vertical dots have the same meaning as set forth in the description of Figures 11A
and 11B. The percent identity between these sequence portions is 73.33%. The percent similarity is 84.76%.
Figure 18 depicts the nucleic acid (SEQ ID NO:37) and deduced amino acid sequence (SEQ ID NO:38) for the TGETRI ETR nucleic acid from tomato.

Figure 19 depicts the nucleic acid (SEQ ID NO:39) and deduced amino acid sequence (SEQ ID NO:40) for a partial sequence of the TGETR2 ETR nucleic acid from tomato.

Figure 20 is a comparison of the amino terminal portions for the TGETRI and ETR1 proteins from tomato and Arabidopsis respectively. The top line is the TGETR1 sequence through amino acid residue 316. The bottom line represents the ETR1 protein sequence through amino acid residue 316. The identity as between these two sequences is 91.75%. The percent similarity is 95.87%. The vertical lines and single and double dots have the same meaning as for Figures 11A and i1B.

Figure 21 is a comparison of an amino terminal portion of the TGETR2 protein with the corresponding ETR1 sequence. The top line is the TGETR2 sequence from amino acid residue 11 through amino acid residue 245.
The lower line is the ETR1 sequence from amino acid residue 1 through amino acid residue 235. The sequence identity is 85.11% as between these two sequences. The sequence similarity is 92.34%. The vertical lines and single and double dots have the same meaning as for Figures 11A and 11B.

Figure 22 depicts the nucleic acid (SEQ ID NO:50) and deduced amino acid sequence (SEQ ID NO:51) for the Nr (Never-ripe) ETR nucleic acid from Never-ripe tomato.
The amino acid sequence in Figure 22 differs from the TETR sequence in Figure 16 in that the amino acid residue proline at residue 36 is replaced with leucine.

Detailed Description The invention provides, in part, plants having cells transformed with a vector comprising an ETR nucleic acid or a modified ETR nucleic acid. Such transformed plant cells have a modulated response to ethylene. In a preferred embodiment, the expression of a modified ETR nucleic acid confers a phenotype on the plant characterized by a decrease in the response to ethylene for at least for those cells expressing the modified ETR nucleic acid as compared to a corresponding non-transformed plant. Thus, for example, when the modified ETR nucleic acid is expressed in fruit such as tomato, the fruit ripening process is retarded thereby reducing spoilage and extending the shelf life and/or harvesting season for the fruit. The invention is similarly useful to prevent spoilage of vegetative tissue and to enhance the longevity of cut flowers.
As used herein, a "plant ETR nucleic acid" refers to nucleic acid encoding all or part of a "plant ETR
protein". ETR nucleic acids can initially be identified by homology to the ETR nucleic acid sequences disclosed herein but can also be identified by homology to any identified ETR nucleic acid or amino acid sequence. Examples of ETR nucleic acids include ETR1, QITR and Q8 from Arabidopsis and TETR, TGETR1 and TGETR2 from tomato. ETR nucleic acids, however, are also defined functionally by their ability to confer a modulated ethylene response upon transformation into plant tissue. For example, an antisense construct of an ETR nucleic acid or modified ETR nucleic acid is capable of reducing the ethylene response in plant tissue expressing the antisense or modified ETR nucleic acid. In addition, transformation with an ETR nucleic acid or modified ETR nucleic acid can result in co-suppression of the endogenous ETR alleles which in turn = ~ .

modifies the ethylene response. Furthermore, ETR
nucleic acids can be modified as described herein to produce modified ETR nucleic acids which when used to transform plant tissue result in varying degrees of ethylene insensitivity in the tissue expressing such modified ETR nucleic acids. When evaluating a putative ETR nucleic acid for the ability of a modified form of the ETR nucleic acid to confer ethylene insensitivity, it is preferred that a codon or combination of codons encoding the amino acid residues equivalent to Ala-31, Ile-62, Cys-65 or Ala-102 in the ETR1 protein of Arabidopsis thaliana or Pro-36 in the TETR protein in tomato be modified so as to substitute a different amino acid residue such as those disclosed herein for the specified residues.

Plant ETR nucleic acids include genomic DNA, cDNA and oligonucleotides including sense and anti-sense nucleic acids as well as RNA transcripts thereof. The genomic DNA sequence (SEQ ID NO:1) for the ETR1 gene from Arabidopsis thaliana is shown in Figure 2. The corresponding cDNA sequence (SEQ ID N0:2) and deduced ETR amino acid sequence (SEQ ID NO:3) are shown in Figure 3. An amino terminal domain (i.e., resides 1 through about 316) of the predicted ETR protein sequence has no homology to known protein sequences.
Approximately midway in the ETR protein (i.e., residues 295 through 313) is a putative transmembrane domain followed by a putative intracellular domain (i.e., residues 314 through 738). A substantial portion of this putative intracellular domain unexpectedly has sequence homology to the two component environmental sensor-regulators known in bacteria. These two families in bacteria form a conserved sensor-regulator system that allows the bacteria to respond to a broad range of environmental fluctuations. It is believed that the amino terminal portion of the ETR protein interacts either directly with ethylene or indirectly (e.g., with an ethylene binding protein or another protein) and that upon such interaction, signal transduction through the intracellular domain occurs.

An ETR nucleic acid or ETR protein can be identified by substantial nucleic acid and/or amino acid sequence homology to a known ETR sequence. Such homology can be based upon the overall nucleic acid or amino acid sequence in which case the overall homology of the protein sequence is preferably greater than about 50%, preferably greater than 60%, still more preferably greater than 75% and most preferably greater than 90%
homologous. Notwithstanding overall sequence homology, it is preferred that the unique amino-terminal portion of an ETR protein sequence or the nucleic acid sequence encoding this portion of the molecule (i.e., the 5' terminal portion) be used to identify an ETR protein or ETR nucleic acid. When using this amino terminal sequence portion, it is preferred that the amino acid sequence homology with the known ETR sequence be greater than about 55%, more preferably about 60%, still more preferably about 70%, more preferably greater than 85% and most preferably greater than 95%
homologous. Homology based on nucleic acid sequence is commensurate with amino acid homology but takes into account the degeneracy in the genetic code and codon bias in different plants. Accordingly, the nucleic acid sequence homology may be substantially lower than that based on protein sequence. Thus, an ETR protein is any protein which has an amino-terminal portion which is substantially homologous to the amino-terminal domain of a known ETR protein. One such known ETR
protein is the ETR1 protein (see Fig. 3) from Arabidopsis thaliana. An ETR nucleic acid by analogy also encodes at least the amino-terminal domain of an ETR protein.

. ~ ; :. = % ~

An ETR nucleic acid from a plant species other than Arabidopsis thaliana can be readily identified by standard methods utilizing known ETR nucleic acid. For example, labelled probes corresponding to a known ETR
nucleic acid or encoding the unique amino-terminal domain can be used for in situ hybridization to detect the presence of an ETR gene in a particular plant species. In addition, such probes can be used to screen genomic or cDNA libraries of a different plant l0 species or to identify one or more bands containing all or part of an ETR gene by hybridization to an electrophoretically separated preparation of genomic DNA digested with one or more restriction endo-nucleases.

The hybridization conditions will vary depending upon the probe used. When a unique nucleotide sequence of an ETR nucleic acid is used, e.g., an oligonucleotide encoding all or part of the amino terminal domain, relatively high stringency, e.g., about 0.1xSSPE at 65 C is used. When the hybridization probe covers a region which has a potentially lower sequence homology to known ETR nucleic acids, e.g., a region covering a portion of the unique amino terminal domain and a portion covering a transmembrane domain, the hybridization is preferably carried out under moderate stringency conditions, e.g., about 5xSSPE at 50 C.
For example, using the above criteria, a ripening tomato cDNA library (Stratagene, LaJolla, California, Catalog No. 936004) was screened with a labeled probe comprising a nucleic acid sequence encoding an amino terminal portion of the Arabidopsis ETR protein sequence disclosed herein in Figure 3A, B, C and D.
Several clones were identified and sequenced by standard techniques. The DNA sequences for this ETR
nucleic acid from tomato (TETR) and Arabidopsis ~ =

thaliana (ETRI) encoding amino acid residues 1 through 123 (SEQ ID NOs:20 and 21) and amino acids 306 through 403 (SEQ ID NOs:22 and 23) are set forth in Figures 10A
and lOB, respectively.

The amino acid sequences for the ETR1 protein from Arabidopsis thaliana and tomato (TETR) for residues 1 through 123 (SEQ ID NOs:25 and 24) and 306 through 403 (SEQ ID NOs:27 and 26) are set forth in Figures 11A and 11B, respectively.

The complete ETR nucleic acid (SEQ ID NO:35) and amino acid sequence (SEQ ID N0:36) for TETR is shown in Fig.
16. A direct comparison of the amino acid sequence between the TETR and ETR1 proteins for the amino terminal 316 amino acid residues is shown in Fig. 17.

As can be seen, there is substantial homology between these particular Arabidopsis and tomato ETR sequences both on the level of DNA sequence and amino acid sequence. In particular, the homology on the DNA level for the sequence encoding amino acids 1 through 45 is slightly greater than 72%. The homology on the amino acid level for amino acid residues 1 through 123 is approximately 79%. For the amino terminal portion (residues 1 through 316) the overall homology is approximately 73%. In the case of amino acid sequence homology, when the differences between the amino acids at equivalent residues are compared and such differences comprise the substitution of a conserved residue, i.e., amino acid residues which are functionally equivalent, the amino acid sequence similarity rises to about 90% for the first 123 residues. The sequence similarity for the amino terminal 316 amino acids rises to almost 85%. Such sequence similarity was determined using a Best Fit sequence program as described by Devereux et al. (1984) Nucl..

Acids Res. 12:387-395. Functionally equivalent (i.e., conserved) residues are identified by double and single data in the comparative sequences. Similarly, the nucleic acid sequence homology between Arabidopsis and tomato for the sequence encoding amino acid residues 306 to 403 is approximately 75%. The sequence homology on the amino acid level for identical amino acids is almost 86% whereas the similarity is almost 96%.

In addition to ETR1 from Arabidopsis and TETR
(sometimes referred to TXTR) from tomato, a number of other ETR nucleic acids have been identified in Arabidopsis and tomato. In Arabidopsis, the QITR and Q8 ETR nucleic acids and proteins have been identified.
See Figs. 12, 13, 14 and 15 and Seq. ID Nos. 41 through 48. For QITR, the overall nucleic acid homology with ETR1 is approximately 69%. With regard to the amino terminal portion between residues 1 and 316, the homology is approximately 71% identical for amino acid sequence and approximately 72% identical in terms of nucleic acid sequence. With reqard to Q8, the overall sequence homology to ETR1 from Arabidopsis is approximately 69% for the overall nucleic acid sequence as compared to approximately 81% homology for that portion of the Q8 encoding the amino terminal 316 amino acids. The homology on the amino acid level for the amino terminal portion is between Q8 and ETR1 is approximatley 72%.

The other ETR nucleic acids identified in tomato include TGETR1 (SEQ ID NO:37) and TGETR2 (SEQ ID
NO:39). the deduced protein sequence for TGETRI (SEQ
ID NO:38) and TGETR2 (SEQ ID NO:40) are set forth in Figures 18 and 19 respectively. The sequence of TGETR2 is incomplete. A comparison of the sequence homology for the first 316 amino acid residues of the TGETR1 protein and the ETR1 protein is shown in Fig. 20. The sequence identity is just under 92%. The sequence similarity rises to almost 96% between this portion of these two proteins. With regard to TGETR2, Fig. 21 sets forth a comparison of the amino terminal portion of this molecule (through amino acid residue 245) with the corresponding portion of the ETR1 protein. The identity of sequences between these two sequence portions is approximately 85%. The sequence similarity rises to just above 92%.

The cloning and sequencing of the ETR nucleic acids from Arabidopsis is described in the examples herein.
However, given the extensive disclosure of the sequences for these ETR nucleic acids, one skilled in the art can readily construct oligonucleotide probes, perform PCR amplification or utilize other standard protocols known to those skilled in the art to isolate the disclosed genes as well as other ETR nucleic acids having homology thereto from other species. When screening the same plant species, relatively moderate to high stringency conditions can be used for hybridization which would vary from between 55 C to 65 C in 5XSSPE. When it is desirable to probe for lower homology or in other plant species, lower stringency conditions such as 50 C at 5XSSPE can be used. Washing conditions however required 0.2XSSPE.
The isolation of the TETRI ETR nucleic acid from tomato is described in the examples. The isolation of this sequence utilized the amino terminal portion of the ETR1 gene from Arabidopsis. The other tomato ETR
nucleic acids disclosed herein (TGETR1 and TGETR2) were identified by probing a tomato genomic library with an ETR1 probe. The genomic library was made from EMBL 3 to which was ligated a partially Sau3A digested genomic DNA extract of tomato. Conditions were 65 C 5XSSC with washes at 2XSSC.

~7--1I ~

In reviewing the overall structure of the various ETR
nucleic acids and proteins identified to date, it appears that at least one class of ETR protein contains a unique amino terminal portion followed by a histidine-kinase domain followed by a response regulatory region.
This is the ETR1 protein in Arabidopsis. A second class of. ETR protein does not contain the response regulatory region. Examples of such ETR proteins include QITR in Arabidopsis and TETR in tomato. The significance of this is not understood at this time.
However, as described hereinafter, mutations in the ETR
nucleic acids encoding members from each class can confer a dominate ethylene insensitivity to transgenic plants containing such nucleic acids.

As described hereinafter, substitution of amino acid residues Ala-31, Ile-62, Cys-65 and ATa -102 with a different amino acid results in modified Arabidopsis ETR nucleic acid which are capable of conferring ethylene insensitivity in a transformed plant. Each of these residues are identical as between the ETR protein of tomato (TETR) and Arabidopsis thaliana (ETR1).
Once the ETR nucleic acid is identified, it can be cloned and, if necessary, its constituent parts recombined to form the entire ETR nucleic acid. Once isolated from its natural source, e.g., contained within a plasmid or other vector or excised therefrom as a linear nucleic acid segment, the ETR nucleic acid can be further used as a probe to identify and isolate other ETR nucleic acids. It can also be used as a "precursor" nucleic acid to make modified ETR nucleic acids and proteins..

As used herein, the term "modified ETR nucleic acid"
refers to an ETR nucleic acid containing the substitution, insertion or deletion of one or more ti1051-2762 nucleotides of a precursor ETR nucleic acid. The precursor ETR nucleic acids include naturally-occurring ETR nucleic acids as well as other modified ETR nucleic acids. The naturally-occurring ETR nucleic acid from Arabidopsis thaliana can be used as a precursor nucleic acid which can be modified by standard techniques, such as site-directed mutagenesis, cassette mutagenesis and the like, to substitute one or more nucleotides at a codon such as that which encodes alanine at residue 31 in the Arabidopsis ETR nucleic acid. Such in vitro codon. modification can result in the generation of a codon at position 31 which encodes any one of the other naturally occurring amino acid residues. Such modification results in a modified ETR nucleic acid.

For example, themutation responsible for the pheno-type observed in the Never-ripe mutant is disclosed in the examples. As described, a single point mutation changes the proline normally present at residue 36 in the TETR protein to leucine. This single mutation is sufficient to confer a dominant ethylene insensitivity phenotype on the wild-type plant. The transformation of tomato and other plants with this modified ETR
nucleic acid is expected to confer the dominant ethylene insensitivity phenotype on such transformed plant cells.

Alternatively, the precursor nucleic acid can be one wherein one or more of the nucleotides of a wild-type ETR nucleic acid have already been modified. Thus, for example, the Arabidopsis thaliana ETR nucleic acid can be modified at codon 31 to form a modified nucleic acid .containing the substitution of that codon with a codon encoding an amino acid other than alanine, e.g., valine. This modified ETR nucleic acid can also act as a precursor nucleic acid to introduce a second modification. For example, the codon encoding Ala-102 can be modified to encode the substitution of threonine in which case the thus formed modified nucleic acid encodes the substitution of two different amino acids at residues 31 and 102.

Deletions within the ETR nucleic acid are also contemplated. For example, an ETR nucleic acid can be modified to delete that portion encoding the putative transmembrane or intracellular domains. The thus formed modified ETR nucleic acid when expressed within a plant cell produces only an amino-terminal portion of the ETR protein which is potentially capable of binding ethylene, either directly or indirectly, to modulate the effective level of ethylene in plant tissue.

In addition, the modified ETR nucleic acid can be identified and isolated from a mutant plant having a dominant or recessive phenotype characterized by an altered response to ethylene. Such mutant plants can be spontaneously arising or can be induced by well known chemical or radiation mutagenesis techniques followed by the determination of the ethylene response in the progeny of such plants. Examples of such mutant plants which occur spontaneously include the Never ripe mutant of tomato and the ethylene insensitive mutant of carnation. Thus, modified ETR nucleic acids can be obtained by recombinant modification of wild-type ETR
nucleic acids or by the identification and isolation of modified ETR alleles from mutant plant species.

It is preferred that the modified ETR nucleic acid encode the substitution, insertion and/or deletion of one or more amino acid residues in the precursor ETR
protein. Upon expression of the modified nucleic acid in host plant cells, the modified ETR protein thus produced is capable of modulating at least the host cell's response to ethylene. In connection with the generation of such a phenotype, a number of codons have been identified in the ETR nucleic acid from Arabidopsis thaliana which when modified and reintroduced into a wild-type plant result in a decrease in the ethylene response by the transformed plant. These codons encode amino acid residues Ala-31, Ile-62, Cys-65 and Ala-102 in the ETR protein of Arabidopsis thaliana. The ETR gene and each of these particular modified amino acid residues were identified by cloning the wild-type ETR gene from Arabidopsis thaliana and chemically modified alleles from four different varieties (etri-2, etrl-2, etrl-3 and etrl-4) of Arabidopsis thaliana (each of which exhibited a dominant phenotype comprising insensitivity to ethylene) and comparing the nucleotide and deduced amino acid sequences. The invention, however, is not limited to modified ETR nucleic acids from Arabidopsis thaliana as described in the examples. Rather, the invention includes other readily identifiable modified ETR nucleic acids which modulate ethylene sensitivity.
The above four varieties exhibiting dominant ethylene insensitivity were generated by chemical modification of seedlings of Arabidopsis thaliana and identified by observing plant development from such modified seedlings with the addition of exogenous ethylene.
Using a similar approach either with or without the addition of exogenous ethylene, the skilled artisan can readily generate other variants of any selected plant species which also have a modulated response to ethylene. Then, using ETR probes based upon the wild-type or modified ETR nucleic acid sequences disclosed herein, other modified ETR nucleic acids can be isolated by probing appropriate genomic or cDNA
libraries of the modified selected plant species. The nucleotide and/or encoded amino acid sequence of such newly generated modified ETR nucleic acids is then preferably compared with the wild-type ETR nucleic acid from the selected plant species to determine which modifications, if any, in the ETR nucleic acid are responsible for the observed phenotype. If the wild-type sequence of the selected plant species is not available, the wild-type or modified ETR sequences disclosed herein for Arabidopsis thaliana or other ETR
sequences which have been identified can be used for comparison. In this manner, other modifications to ETR
proteins can be identified which can confer the ethylene insensitivity. phenotype. Such modifications include the identification of amino acids other than those disclosed herein which can be substituted at residues equivalent to Ala-31,Ile-62, Cys-65 and Ala-102 in the Arabidopsis thaliana ETR protein and the identification of other amino acid residues which can be modified by substitution, insertion and/or deletion of one or more amino acid residues to produce the desired phenotype.

Alternatively, a cloned precursor ETR nucleic acid can be systematically modified such that it encodes the substitution, insertion and/or deletion of one or more amino acid residues and tested to determine the effect of such modification on a plant's ethylene response.
Such modifications are preferably made within that portion of the ETR nucleic acid which encodes the amino-terminal portion of the ETR protein. However, modifications to the carboxy-terminal or putative transmembrane domains to modulate signal transduction are also contemplated (e.g., modifications of the conserved histidine of the histidine kinase domain which is the supposed site of autophosphorylation or the conserved aspartate of the response regulator domain which is the supposed site of phosphorylation).
One method which may be used for identifying particular amino acid residues involved in the direct or indirect + ~ ~ , :. = 3 =

interaction with ethylene is the sequential substitution of the codons of an ETR nucleic acid with codons encoding a scanning amino acid such as glycine or alanine (See, e.g., PCT Publication W090/04788 published May 3, 1990) followed by transformation of each of the thus formed modified nucleic acids into a plant to determine the effect of such sequential substitution on the ethylene response. Other approaches include random modifications or predetermined targeted modifications of the cloned ETR nucleic (See, e.g., PCT Publication No. W092/07090 published April 30, 1992) followed -by transformation of plant cells and the identification of progeny having an altered ethylene response. The ETR nucleic acid from those plants having the desired phenotype is isolated and sequenced to confirm or identify the modification responsible for the observed phenotype.

Amino' acidresidues equivalent to those specifically identified in an ETR protein which can be modified to alter the ethylene response can also be readily identified in ETR proteins from other plant species.
For example, equivalent amino acid residues to those identified in the ETR protein from Arabidopsis thaliana can be readily identified in other ETR proteins. An amino acid residue in a precursor ETR protein is equivalent to a particular residue in the ETR protein of Arabidopsis thaliana if it is homologous in position in either primary or tertiary structure to the specified residue of the Arabidopsis ETR protein.

In order to establish homology by way of primary structure, the primary amino acid sequence of a precursor ETR protein is directly compared by alignment with the primary sequence of the ETR protein from Arabidopsis thaliana. Such alignment is preferably of the amino-terminal domain and will take into account ' . ~ = - , , _ - ,. 3 ~

the potential insertion or deletion of one or more amino acid residues as between the two sequences so as to maximize the amino acid sequence homology. A
comparison of a multiplicity of ETR protein sequences with that of Arabidopsis thaliana provides for the identification of conserved residues among such sequences which conservation is preferably maintained for further comparison of primary amino acid sequence.
Based on the alignment of such sequences, the skilled artisan can readily identify amino acid residues in other ETR proteins which are equivalent to Ala-31, Ile-62, Cys-65, Ala-102 and other residues in Arabidopsis thaliana ETR protein. Such equivalent residues are selected for modifications analogous to those of other modified ETR proteins which confer the desired ethylene responsive phenotype. Such modified ETR proteins are preferably made by modifying a precursor ETR nucleic acid to encode the corresponding substitution, insertion and/or deletion at the equivalent amino acid residue.

In addition to homology at the primary sequence level, equivalent residues can be identified based upon homology at the level of tertiary structure. The determination of equivalency at this level will generally require three-dimensional crystal structures for an ETR protein or modified ETR protein from Arabidopsis (or crystal structure of another ETR
protein having defined equivalent residues) and the crystal structure of a selected ETR protein.
Equivalent residues at the level of tertiary structure are defined as those for which the atomic coordinates of two or more of the main chain atoms of a particular amino acid residue of the selected ETR protein, as compared to the ETR protein from Arabidopsis, are within 0.13 nm and preferably 0.10 nm after alignment.
Alignment is achieved after the best model has been = ' ~ j f ~

oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the ETR proteins in question.

ETR nucleic acids can be derived from any of the higher plants which are responsive to ethylene. Particularly suitable plants include tomato, banana, kiwi fruit, avocado, melon, mango, papaya, apple, peach and other climacteric fruit plants. Non-climacteric species from which. ETR nucleic acids can be isolated include strawberry, raspberry, blackberry, blueberry, lettuce, cabbage, cauliflower, onion, broccoli, brussel sprout, cotton, canola, grape,soybean and oil seed rape. In addition, ETR nucleic acids can be isolated from flowering plants within the Division Magnoliophyta which comprise the angiosperms which include dicotyledons (Class Magnoliopsida and Dicotyledoneae) and monocotyledons (Class Liliopsida). Particularly preferred Orders of angiosperm according to "Taxonomy of Flowering Plants", by A.M. Johnson, The Century Co., NY, 1931 include Rosales, Cucurbitales, Rubiales, Campanulatae, Contortae, Tubiflorae, Plantaginales, Ericales, Primulales, Ebenales, Diapensiales, Primulales, Plumbaginales, Opuntiales, Parietales, Myritiflorae, Umbe11if1orae, Geraniales, Sapindales, Rhamnales, Malvales, Pandales, Rhoendales, Sarraceniales, Ramales, Centrospermae, Santalales, Euphorbiales, Capparales, Aristolochiales, Julianiales, Juglandales, Fagales, Urticales, Myricales, Polygonales, Batidales, Balanopsidales, Proteales, Salicales, Leitneriales, Garryales, Verticillatae and Piperales. Particularly preferred plants include lily, carnation, chrysanthemum, petunia, rose, geranium, violet, gladioli, orchid, lilac, crabapple, sweetgum, maple, poinsettia, locust, ash and linden tree.

. ~. ;
-, ~ =

In addition to providing a source for ETR nucleic acids which can be modified or isolated according to the teachings herein, the foregoing plants can be used as recipients of the modified nucleic acid to produce chimeric or transgenic plants which exhibit an ethylene resistance phenotype in one or more tissue types of the transformed plant.

Once a modified ETR nucleic acid has been cloned, it is used to construct vectors for transforming plant cells.
The construction of such vectors is facilitated by the use of a shuttle vector which is capable of manipulation and selection in both plant and a convenient cloning host such as a prokaryote. Such shuttle vectors thus can include an antibiotic resistance gene for selection in plant cells (e.g., kanamycin resistance) and an antibiotic resistance gene for selection in a bacterial host (e.g. actinomycin resistance). Such shuttle vectors also contain an origin of replication appropriate for the prokaryotic host used and preferably at least one unique restriction site or a polylinker containing unique restriction sites to facilitate vector construction.
Examples of such shuttle vectors include pMON530 (Rogers et a1. (1988) Methods in Enzymology 153:253-277) and pCGN1547 (McBride et al. (1990) Plant Molecular Biology 14:269-276).

In the preferred embodiments, which comprise the best mode for practicing the invention, a promoter is used to drive expression of an ETR or a modified ETR nucleic acid within at least a portion of the tissues of a transformed plant. Expression of an ETR nucleic acid is preferably in the antisense orientation to modulate the ethylene response by reduction in translation of the endogenous ETR RNA transcript. Expression of a modified ETR nucleic acid results in the production of a.

a modified ETR protein which is capable of conferring ethylene insensitivity. Such promoters may be obtained from plants, plant pathogenic bacteria or plant viruses. Constitutive promoters include the 35S and 19S promoters of cauliflower mosaic virus (CaMV35S and CaMV19S), the full-length transcript promoter from the Figwort mosaic virus (FMV35S) (See PCT Publication No.
W092/12249 published July 23, 1992) and promoters associated with Agrobacterium genes such as nopaline, synthase (NOS), mannopine synthase (MOS) or octopine synthase (OCS). Other constitutive promoters include the a-1 and (3-1 tubulin promoters (Silflow et al.
(1987) Devel. Genet. 8:435-460), the histone promoters (Chaubet (1987) Dev1. Genet. 8:461-473) and the promoters which regulate transcription of ETR nucleic acids.

In some embodiments, tissue and/or temporal-specific promoters can be used to control expression of ETR and modified ETR nucleic acids. Examples of fruit specific promoters include the E8, E4, E17 and J49 promoters from tomato (Lincoln et al. (1988) Mo1. Gen. Genet.
212:71-75) and the 2A11, Z130 and Z70 promoters from tomato as described in U.S. Pat. Nos. 4,943,674, 5,175,095 and 5,177,307. In addition, preferential expression in rapidly dividing tissue can be obtained utilizing the plant EF-la promoter as described in U.S.
Pat. No. 5,177,011. Examples of floral specific promoters include the leafy promoter and promoters from the apetala, pistillata and agamous genes. A promoter system for targeting expression in the leaves of a transformed plant is a chimeric promoter comprising the CaMV35S promoter ligated to the portion of the ssRUBISCO gene which represses the expression of ssRUBISCO in the absence of light. In addition, pollen-specific promoters can also be used. Such promoters are well known to those skilled in the art - 1 * ` = i and are readily available. A example of such a promoter is Zn13 (Hamilton et al. (1992) Plant Mol.
Biol. 18:211-218). This promoter was cloned from corn (Monocot) but functions as a strong and pollen-specific promoter when used in tobacco (Dicot).

Examples of inducible promoters which can be used for conditional expression of ETR nucleic acids include those from heat-shock protein genes such as the PHS1 heat-shock protein gene (Takahashi et al. (1989) Mol.
Gen. Genet. 219:365-372) and light-inducible promoters including the three chlorophyll a/b light harvesting protein promoters (Leutwiler et aI.(1986) Nucl. Acids.
Res. 14:4051-4064) and the pre-ferredoxin promoter (Vorst et al. (1990) Plant Mo1. Biol. 14:491-499).

In a further embodiment of the invention, the vector used to transform plant cells is constructed to target the insertion of the ETR nucleic acid into an endogenous promoter within a plant cell. One type of vector which can be used to target the integration of a modified ETR nucleic acid to an endogenous promoter comprises a positive-negative selection vector analogous to that set forth by Monsour, et al. Nature 336:348-352 (1988) which describes the targeting of exogenous DNA to a predetermined endogenous locus in mammalian ES cells. Similar constructs utilizing positive and negative selection markers functional in plant cells can be readily designed based upon the identification of the endogenous plant promoter and the sequence surrounding it. When such an approach is used, it is preferred that a replacement-type vector be used to minimize the likelihood of reversion to the wild-type genotype.

The vectors of the invention are designed such that the promoter sequence contained in the vector or the promoter sequence targeted in the plant cell genome are operably linked to the nucleic acid encoding the ETR or modified ETR nucleic acid. When the positive strand of the ETR nucleic acid is used, the term "operably linked" means that the promoter sequence is positioned relative to the coding sequence of the ETR nucleic acid such that RNA polymerase is capable of initiating transcription of the ETR nucleic acid from the promoter sequence. In such embodiments it is also preferred to provide appropriate ribosome binding sites, transcription initiation and termination sequences, translation initiation and termination sequences and polyadenylation sequences to produce a functional RNA
transcript which. can be translated into ETR protein.
When an antisense orientation of the ETR nucleic acid is used, all that is required is that the promoter be operably linked to transcribe the ETR antisense strand.
Thus, in such embodiments, only transcription start and termination sequences are needed to provide an RNA
transcript capable of hybridizing with the mRNA or other RNA transcript from an endogenous ETR gene or modified ETR nucleic acid contained within a transformed plant cell. In addition to promoters, other expression regulation sequences, such as enhancers, can be added to the vector to facilitate the expression of ETR nucleic acid in vivo.

Once a vector is constructed, the transformation of plants can be carried out in accordance with the invention by essentially any of the various transformation methods known to those skilled in the art of plant molecular biology. Such methods are generally described in Methods and Enzymology, Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman, Academic Press, eds. As used herein, the term "transformation" means the alteration of the genotype of a plant cell by the introduction of exogenous = - ~ .. `-3 ~

nucleic acid. Particular methods for transformation of plant cells include the direct microinjection of the nucleic acid into a plant cell by use of micropipettes.
Alternatively, the nucleic acid can be transferred into a plant cell by using polyethylene glycol (Paszkowski et al. EMBO J. 3:2717-2722 (1984)). Other transformation methods include electroporation of protoplasts (Fromm, et al. Proc. Natl. Acad. Sci.
U.S.A. 82:5824 (1985); infection with a plant specific virus, e.g., cauliflower mosaic virus (Hohn et al.
"Molecular Biology of Plant Tumors", Academic Press, New York (1982), pp. 549-560) or use of transformation sequences from plant specific bacteria such as Agrobacterium tumefaciens, e.g., a Ti plasmid transmitted to a plant cell upon infection by agrobacterium tumefaciens (Horsch et al. Science 233:496-498 (1984); Fraley et al. Proc. Natl. Acad.
Sci. U.S.A. 80:4803 (1983)). Alternatively, plant cells can be transformed by introduction of nucleic acid contained within the matrix or on the surface of small beads or particles by way of high velocity ballistic penetration of the plant cell (Klein et al.
Nature 327:70-73 (1987)).

After the vector is introduced into a plant cell, selection for successful transformation in typically carried out prior to regeneration of a plant. Such selection for transformation is not necessary, but facilitates the selection of regenerated plants having the desired phenotype by reducing wild-type background.
Such selection is conveniently based upon the antibiotic resistance and/or herbicide resistance genes which may be incorporated into the transformation vector.

Practically all plants can be regenerated from cultured cells or tissues. As used herein, the term "regeneration" refers to growing a whole plant from a plant cell, a group of plant cells or a plant part.
The methods for plant regeneration are well known to those skilled in the art. For example, regeneration from cultured protoplasts is described by Evans et al.
"Protoplasts Isolation and Culture", Handbook of Plant Cell Cultures 1:124-176 (MacMillan Publishing Co., New York (1983); M.R. Davey, "Recent Developments in the Culture and Regeneration of Plant Protoplasts", Protoplasts (1983) Lecture Proceedings, pp. 12-29 (Birkhauser, Basil 1983); and H. Binding "Regeneration of Plants", Plant Protoplasts, pp. 21-73 (CRC Press, Bocaraton 1985). When transformation is of an organ part, regeneration can be from the plant callus, explants, organs -or parts. Such methods for regeneration are also known to those skilled in the art. See, e.g., Methods in Enzymology, supra.; Methods in Enzymology, Vol. 118; and Klee et al. Annual Review of Plant Physiology 38:467-486.

A preferred method for transforming and regenerating petunia with the vectors of the invention is described by Horsch, R.B. et al. (1985) Science 227:1229-1231.
A preferred method for transforming cotton with the vectors of the invention and regenerating plants therefrom is describedby Trolinder et al. (1987) Plant Cell Reports 6:231-234.

Tomato plant cells are preferably transformed utilizing Agrobacterium strains by the method as described in McCormick et al., Plant Cell Reports 5:81-84 (1986).
In particular, cotyledons are obtained-from 7-8 day old seedlings. The seeds are surface sterilized for 20 minutes in 30% Clorox bleach and germinated in Plantcons boxes on Davis germination media. Davis germination media is comprised of 4.3 g/l MS salts, 20 g/l sucrose and 10 mis/i Nitsch vitamins, pH 5.8. The a Nitsch vitamin solution is comprised of 100 mg/l myo-inositol, 5 mg/i nicotinic acid, 0.5 mg/l pyridoxine HC1, 0.5 mg/l thiamine HC1, 0.05 mg/l folic acid, 0.05 mg/i biotin, 2 mg/l glycine. The seeds are allowed to germinate for 7-8 days in the growth chamber at 25 C, 40% humidity under cool white lights with an intensity of 80 'einsteins m2-s-1. The photoperiod is 16 hours of light and 8 hours of dark.

Once germination occurs, the cotyledons are explanted using a #15 feather blade by cutting away the apical meristem and the hypocotyl to create a rectangular explant. These cuts at the short ends of the germinating cotyledon increase the surface area for infection. The explants are bathed in sterile Davis regeneration liquid to prevent desiccation. Davis regeneration media is composed of 1X MS salts, 3%
sucrose, 1X Nitsch vitamins, 2.0 mg/l zeatin, pH 5.8.
This solution was autoclaved with 0.8% Noble Agar.

The cotyledons are pre-cultured on "feeder plates"
composed of media containing no antibiotics. The media is composed of 4.3 g/1 MS salts, 30 g/1 sucrose, 0.1 g/1 myo-inositol, 0.2 g/1 KH2PO4r 1.45 mis/1 of a 0.9 mg/mi solution of thiamine HC1, 0.2 mis of a 0.5 mg/ml solution of kinetin and 0.1 ml of a 0.'2 mg/mi solution of 2,4 D. This solution is adjusted to pH 6.0 with KOH. These plates areoveriaid with 1.5 - 2.0 mis of tobacco suspension cells (TXD's) and a sterile Whitman filter soaked in 2C005K media. 2CO05K media is composed of 4.3 g/1 Gibco MS salt mixture, 1 ml B5 vitamins (1000X stock), 30 g/1 sucrose, 2 mis/1 PCPA
from 2 mg/mi stock, and 10 l/i kinetin from 0.5 mg/ml stock. The cotyledons'were cultured for 1 day in a growth chamber at 25 C under cool white lights with a light intensity of 40-50 einsteins m2s-' with a continuous light photoperiod.

Cotyledons are then inoculated with a log phase solution of Agrobacterium containing the modified or wild type ETR nucleic acid. The concentration of the Agrabacterium is approximately 5x108 cells/ml. The cotyledons are allowed to soak in the bacterial solution for six minutes and are then blotted to remove excess solution on sterile Whatman filter disks and subsequently replaced to the original feeder plate where they are allowed to co-culture for 2 days. After the two days, cotyledons are transferred to selection plates containing Davis regeneration media with 2 mg/1 zeatin riboside, 500 gg/ml carbenicillin, and 100 g/ml kanamycin. After 2-3 weeks, cotyledons with callus and/or shoot formation are transferred to fresh Davis regeneration plates containing carbenicillin and kanamycin at the same levels. The experiment is scored for transformants at this time. The callus tissue is subcultured at regular 3 week intervals and any abnormal structures are trimmed so that the developing shoot buds continue to regenerate. Shoots develop within 3-4 months.

Once shoots develop, they are excised cleanly from callus tissue and planted on rooting selection plates.
These plates contain 0.5X MSO containing 50 g/ml kanamycin and 500 g/ml carbenicillin. These shoots form roots on the selection media within two weeks. If no roots appear after 2 weeks, shoots are trimmed and replanted on the selection media. Shoot cultures are incubated in percivals at a temperature of 22 C.
Shoots with roots are then potted when roots were about 2 cm in length. The plants are hardened of f in a growth chamber at 21 Cwith a photoperiod of 18 hours light and 6 hours dark for 2-3 weeks prior to transfer to a greenhouse. In the greenhouse, the plants are grown at a temperature of 26 C during the day and 21 C

during the night. The photoperiod is 13 hours light and 11 hours dark and the plants are allowed to mature.
once plants have been regenerated, one or more plants are selected based upon a change in the ethylene response phenotype. For example, when a modified ETR
nucleic acid is used with its native promoter, selection can be based upon an alteration in any of one of the "triple responses" of seedlings from such plants. Guzman et al. (1990) The Plant Cell 2:523.
Alternatively, or when constitutive promoters are used, various other ethylene responses can be assayed and compared to the wild type plant. Such other ethylene responses include epinasty (which is observed primarily in tomato), epsision, abscission, flower petal senescence and fruit ripening. In addition to overt changes in the ethylene response, the levels of various enzymes can be determined followed by exposure to ethylene to determine the response time for the typical increase or decrease in the level of a particular protein such as an enzyme. Examples of various ethylene responses which can be used to determine whether a particular plant has a decreased response to ethylene are set forth in Chapter 7, The Mechanisms of Ethylene Action in "Ethylene in Plant Biology" 2d Ed.
F.B. Abels, P.W. Morgan and M.E. Salveit, Jr., eds., San Diego, Academic Press, Inc. (1992). When a tissue and/or temporal-specific promoter or inducible promoter is used, the determination of a modulation in the ethylene response is determined in the appropriate tissue at the appropriate time and if necessary under the appropriate conditions to activate/inactivate an inducible promoter. In each case, the ethylene response is preferably compared to the same ethylene response from a wild-type plant.

= ~ ; ,. '; ~

The following are particularly preferred embodiments for modulating the ethylene response in fruit.
However, such embodiments can be readily modified to modulate the ethylene response in vegetative tissue and flowers.

In one approach, a modified ETR nucleic acid operably linked to a constitutive promoter of moderate strength is used to reduce the ethylene response. This results in a lengthening of the time for fruit ripening.

In an alternate embodiment, a modified ETR nucleic acid operably linked to a regulatable (inducible) promoter is used so that the condition that turns on the expression of the modified ETR nucleic acid can be maintained to prevent fruit ripening. The condition that turns off the expression of the modified ETR
nucleic acid can then be maintained to obtain ripening.
For example, a heat-inducible promoter can be used which is active in high (field) temperatures, but not in low temperatures such as during refrigeration. A
further example utilizes an auxin or gibberellin-induced promoter such that transformed plants can be treated with commercial auxin analogs such as 2, 4-D or with commercial gibberellin analogs such as Pro-Gibb to prevent early ripening.

Alternatively, a strong constitutive promoter can be operably linked to a modified ETR nucleic acid to prevent fruit ripening. So as to allow eventual fruit ripening, the plant is also transformed with a wild-type ETR nucleic acid operably linked to an inducible promoter. Expression of the wild-type ETR nucleic acid is increased by exposing the plant to the appropriate condition to which the inducible promoter responds.
When the wild-type ETR nucleic acid expression is increased, the effect of expression of the modified ETR

nucleic acid is reduced such that fruit ripening occurs.

Particular constructs which are desirable for use in transforming plants to confer ethylene insensitivity include the CMV35S promoter operably linked to any other mutant Arabidopsis ETR genomic or cDNA clones including the corresponding modification at residue 36 to convert proline to leucine. Such constructs are expected to confer a dominant ethylene insensitivity phenotype tp cells and plants transformed with and expressing such constructs.

In addition, a preferred construct includes operably linking the FMV promoter to drive expression of the tomato TETR cDNA which has been engineered to contain a mutation analogous to any of those identified in the ETR genes from Arabidopsis as well as the Nr mutation found in the tomato ETR gene. Such constructs are expected to confer a dominant ethylene insensitivity phenotype to cells and plants which are transformed with and express such constructs.

Other preferred constructs include the operable linking the FMV promoter to ETR antisense cDNAs including TETR
and ETR1. Such constructs are expected to confer a dominant ethylene insensitivity phenotype to cells and plants which are transformed with and express such constructs.

The invention can be practiced in a wide variety of plants to obtain useful phenotypes. For example, the invention can be used to delay or prevent floral senescence and abscission during growth or during transport or storage as occurs in flower beds or cotton crops (Hall, et al. (1957) Physiol. Plant 10:306-317) and in ornamental flowers (e.g., carnations, roses) ' 4.

` `= ~ ~

that are either cut (Halevy, et al. (1981) Hort. Rev.
3:59-143) or not cut. In addition, the invention can be practiced to delay or prevent senescence and abscission of leaves and fruits in cucumber (Jackson, et al. (1972) Can. J. Bot. 50:1465-1471), legumes and other crops (Heck, et al. (1962) Texas Agric. Expt.
Sta. Misc. Pub1. MP 613:1-13) and ornamental plants (e.g., holly wreaths) (Curtis et al. (1952) Proc. Am.
Soc. Hort. Sci. 560:104-108). Other uses include the reduction or prevention of bitter-tasting phenolic compounds (isocoumarins) which are induced by ethylene for example in sweet potatoes (Kitinoja (1978) "Manipulation of Ethylene Responses in Horticulture", Reid, ed., Acta. Hort. Vol 201, 377-42) carrots (Coxon et a1. (1973) Phyto. Chem. istry. 12:1881-1885), parsnip (Shattuck et al. (1988) Hort. Sci. 23:912) and Brassica. Other uses include the prevention of selective damage to reproductive tissues as occurs in oats and canola (Reid et al. (1985) in "Ethylene in Plant Development", Roberts, Tucker, eds. (London), Butterworths, pp. 277-286), the loss of flavor, firmness and/or texture as occurs in stored produce such as apples, and watermelons (Risse et al. (1982) Hort. Sci. 17:946-948), russet spotting (a post-harvest disorder) which is ethylene induced in crisphead lettuce (Hyodo et a3. (1978) Plant Physiol. 62:31-35), to promote male flower production (Jaiswal et al.
(1985) Proc. Indian Acad. Sci. (Plantg Sci. 95:453-459) and to increase plant size, e.g., by delaying the formation.of flowers in ornamental bromeliads (Mekers et al. (9183) Acta Hortic 137:217-223). Furthermore, a decrease in ethylene response can be used to delay disease developments such as the preventing of lesions and senescence in cucumbers infected with Colletotrichum lagenarium and to reduce diseases in plants in which ethylene causes an increase in disease development, e.g., in barley, citrus, Douglas fir -37- ~
seedlings, grapefruit, plum, rose, carnation, strawberry, tobacco, tomato, wheat, watermelon and ornamental plants. In addition, the invention can be used to reduce the effect of ethylene found in the environment and indirectly the effect of various environmental stresses which result in the biosynthesis of ethylene in plant tissue. For example, ethylene exists at biologically detrimental levels in localized atmospheres due to fires, automobile exhaust and industry. See, e.g., Chapter 8, Ethylene in the Environment in "Ethylene in Plant Biology", supra. In addition, the invention can be used to minimize the effect of ethylene- synthesized in response to environmental stresses such as flooding, drought, oxygen deficiency, wounding (including pressure and bruising), chilling, pathogen invasion (by viruses, bacteria, fungi, insects, nematodes and the like), chemical exposure (e.g., ozone salt and heavy metal ions) and radiation.

The following is presented by way of example and is not to b.e construed as a limitation on the scope of the invention.

cloning of the ETR1 Gene etr2-i plants were crossed with two lines carrying the recessive visible markers ap1 and c1v2 respectively.
The F, progeny were allowed to self-pollinate.
Phenotypes were scored in the F2. The recombination percentages (using the Kosambi mapping function (D.D.
Kosambi (1944) Ann. Eugen. 12:172)) were determined in centimorgans. The ETR1 locus mapped to the lower portion of chromosome 1 between the visible genetic markers ap1 and c1v2 (6.5 +/-1.0 cM from AP1 and 2.8 +/-l.l cM from CLV2).

etrl-1 was crossed to tester line W100 (ecotype Landsberg (Koornneef et al. (1987) Arabidopsis Inf.
Serv. 23:46) and the F, plants were allowed to self-pollinate. Linkage of RFLP markers to the ETR1 locus 'was analyzed in 56FZ plants as described in Chang, et a.l. (1988) Proc. Nat1. Acad. Sci. U.S.A. 85:6856. Of the RFLP markers that 'reside in this region of chromosome 1, one marker, 1bAt315, completely cosegregated with the etr1-1 mutant phenotype out of 112 chromosomes. The 1bAt315 clone was therefore used as a probe to initiate a chromosome walk in the ETR1 gene region. Various genomic DNA cosmid libraries were utilized. One library contained subclones of two yeast artificial chromosomes (YACs EG4E4 and EG2G11 (Grill et al. (1991) Mol. Gen. Genet. 226:484)) that hybridized to 1bAt315. To subclone the YACs, total DNA from yeast cells harboring EG4E4 or EG2G11 was partially digested with Sau3AI, and cloned into the BglII site of cosmid vector pCIT30 (Ma et al. (1992) Gene 117:161).
Standard cloning and screening methods were used (Sambrook et al, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989) ). A library from the etrl-1 mutant was similarly constructed in pCIT30. The wild type library was constructed previously (Yanofsky et al. (1990) Nature 346:35). By restriction analysis and sequential hybridization to these libraries, overlapping cosmids (a contig) were obtained that spanned a distance of approximately 230 kb. See Fig. 8.

The ETR1 gene was localized to a subregion of approximately 47 kb using fine structure RFLP mapping.

=~ ~

To create the fine structure map, meiotic recombinants were isolated based on phenotype from the F2 self-progeny of the above crosses between the etrZ-1 mutant (ecotype Columbia) and two lines (both ecotype Landsberg) carrying ap1 and cZv2. Recombinants were identified in the F2 progeny as plants that were either wild type at both loci or mutant at both loci. ETR1 was scored in dark grown seedlings (Bleecker et al.
(1988) Science 241:1086). Seventy-four (74) recombinants between ETR1 and AP1 were obtained, and 25 recombinants between ETR1 and CLV2. The recombination break points were mapped using DNA fragments from the chromosome walk as RFLP probes. Given the number of recombinants isolated, the calculated average distance between break points was roughly 20 kb for each cross.
Over the 230 kb contig, the actual density of break points found was consistent with the calculated density on the CLV2 side (with 5 break points in approximately 120 kb). The nearest break points flanking the ETR1 gene defined a DNA segment of approximately 47 kb.

To search for transcripts derived from this 47 kb region, cDNA libraries were screened using DNA
fragments. One cDNA clone was designated XC4 and was detected with the 4.25 kb EcoRI fragment 1 shown in Fig. 8. Because XC4 potentially represented the ETR1 gene, this clone was further characterized.

ETR Gene Characterization The nucleotide sequences of the XC4 cDNA and the corresponding genomic DNA (Figure 2) (SEQ ID No:1) was 5 determined using Sequenase*version 2.0 (United States Biochemical Co., Cleveland, Ohio) and synthetic oligonucleotide primers having a length of 17 nucleotides. The primer sequences were chosen from existing ETR1 sequences in order to extend the sequence 10 until the entire sequence was determined. The initial sequence was obtained using primers that annealed to the cloning vector. Templates were double-stranded plasmids. Both strands of the genomic DNA were sequenced, including 225 bp upstream of the presumed 15 transcriptional start site, and 90 bp downstream of the polyadenylation site. XC4 was sequenced on a single strand.

XC4 was 1812 base pairs long, including a polyA taii of 18 bases. From the DNA sequences and RNA blots 20 (described below), it was determined that XC4 lacked approximately 1000 base pairs of the 5' end.

To obtain longer cDNAs, first strand cDNA was synthesized (RiboClonecDNA Synthesis System, Promega, Madison Wisconsin) from seedling polyA+ RNA using 25 sequence-specific primers internal to XC4. The cDNA
was then amplified by PCR (Saiki, R.K. et al. (1985) Science 230:1350) using various pairs of primers:
3' PCR primers were chosen to anneal to different exons as deduced from the cDNA and genomic DNA
30 sequences, and 5' PCR primers were chosen to anneal to various 5' portions of genomic DNA sequences. Six different primeirs at the 5' end were used. The farthest upstream primer which amplified the cDNA was *
Trade-mark primer Q (5'AGTAAGAACGAAGAAGAAGTG) (SEQ ID NO:26). An overlapping primer, which was shifted twelve bases downstream, also amplified the cDNA. The cDNA could not be amplified using a 5' end primer that was 98 base pairs farther upstream. Genomic DNA templates were used for PCR controls. The longest cDNA was considered to extend to the 5' end of primer Q. The amplified cDNAs were sequenced directly with Sequenase Version 2.0 as follows: after concentrating the PCR reactions by ethanol precipitation, the amplified products were separated by electrophoresis in 0.8% LMP agarose gels.
The DNA fragments were excised, and a mixture of 10 ul excised gel (melted at 70 C), 1 ml 10 mM primer and 1.2 ml 5% Nonidet P-40 was heated at 90 C for two minutes to denature the DNA. The mixture was then cooled to 37 C prior to proceeding with sequencing reactions.
The longest cDNA, which was 2786 bases (not including the polyA tail) , was consistent with the estimated size of 2800 bases from RNA blots, and was presumed to be close to full length. A potential TATA box (5' ATAATAATAA) lies 33 bp upstream of the 5' end in the genomic sequence. Based on comparison of the cDNA and the genomic DNA sequences, the gene has six introns, one of which is in the 5' untranslated leader. The exons contain a single open reading frame of 738 amino acids. See Fig. 3.

The determination that this gene is, in fact, ETR1 was established by comparing the nucleotide sequences of the wild type allele and the four mutant alleles. For each mutant allele, an EcoRI size-selected library was constructed in the vector lambda ZAPII (Stratagene';
LaJolla, California). Clones of the 4.25 kb EcoRI
fragment were isolated by hybridization with the wild type fragment. These clones were converted into plasmids (pBluescripe vector) by in vivo excision ~
Trade-mark according to the supplier (Stratagene) and sequenced.
Two independent clones were sequenced on a single strand for each mutant allele. The 51 ends (535 bp not contained on the 4.25 kb EcoRI fragment) were amplified by PCR and directly sequenced as previously described.
Codon differences were as follows: Codon 65 TGT to TAT
in etrl-1 (Figs. 6A, B, C and D), Codon 102 GCG to ACG
in etrl-2 (Figs. 7A, B, C and D), Codon 31 GCG to GTG
in etrl-3 (Figs. 4A, B, C and D), Codon 62 ATC to TTC
in etrl-4 (Figs. 5A, B, C and D). All four mutations are clustered in the amino-terminal region of the.
deduced protein sequence.

The ETR1 message was examined in standard RNA
electrophoresis (formaldehyde) gel blots. The 2.8 kb ETR1 transcript was present in all plant parts examined - leaves, roots, stems, flowers and seedlings (data not shown). In addition, no differences were observed between ETR1 transcripts of the wild type and the mutant alleles (data not shown). Treatment with ethylene did not detectably alter the amount of ETR1 mRNA in dark-grown wild type seedlings (data not shown).

When the ETR1 gene was hybridized to Arabidopsis genomic DNA blots at normal stringency (i.e., overnight in 5xSSPE (0.9 M NaC1, 50 mM NaH2PO4, 40 mM NaOH, 4.5 mM
EDTA, pH 7.4 at 65 C, with the most stringent wash in 0.1xSSPE at 65 C for 30 minutes), only the expected fragments of the ETR1 locus were observed (data not shown). At reduced stringency (i.e., hybridization in 5xSSPE at 50 C and washs in 5xSSPE at 50 C.), however, numerous fragments were detected, which suggests that a family of similar genes exists in Arabidopsis.

The predicted amino terminal sequence of ETR1 (residues 1-316) has no similarity to sequences in the GenBank ~ = , '== T ~

database (version 77.0). The carboxy-terminal portion, however, is highly similar to the conserved domains of both the sensor and the response regulator of the prokaryotic two-component system of signal transduction. In bacteria, the histidine protein kinase domain of the sensor is characterized by five sequence motifs arranged in a specific order with loosely conserved spacing (Parkinson (1992) Annu. Rev.
Genet. 26:71). The deduced ETR1 sequence contains all five motifs with the same relative order and spacing found in the bacterial proteins (Fig. 9A) . The deduced sequence is most similar to the sequences of Escherichia coli Bar A (Nagasawa et al. (1992) Mol.
Microbiol. 6:3011) and Pseudomonas syringae LemA
(Harbak et al. (1992) J. Bact. 174:3011); over the entire histidine kinase domain (the 241 amino acids from residues 336 through 566), there are 43% and 41%
amino acid identities with BarA and LemA respectively, and 72% and 71% similarities respectively. The function of BarA is unknown, although it was cloned based on its ability to complement a deletion in the E.
coli osmotic sensor protein, EnvZ (Nagasawa, supra.).
LemA is required for pathogenicity of P. syringae on bean plants (Hrabak, supra.). Other bacterial proteins with sequences highly similar to this putative ETR1 domain are: Xanthomonas campestris RpfC (35% identity) which is possibly involved in host recognition for pathogenicity in cruciferous plants (Tang et al (1991) Mol. Gen. Genet. 226:409), E. coli RcsC (34% identity) which is involved in regulation of capsule synthesis (Stout et al. (1990) J. Bacteriol. 172:659) and E. coli ArcB (25% identity) which is responsible for repression of anaerobic enzymes (Luchi et al. (1990) Mol.
Microbiol. 4:715).

Adjacent to the putative histidine kinase domain, the deduced ETR1 sequence exhibits structural characteristics and conserved residues of bacterial response regulators. Structural characteristics of response regulators are based on the known three-dimensional structure of CheY (the response regulator for chemotaxis) in Salmonella typhimurium and E. coli, which consists of five parallel 0-strands surrounded by five a-helices (Stock et al. (1989) Nature 337:745;
Volz et al. (1991) J. Biol. Chem. 266:15511).
Sequences of bacterial response regulators have been aligned to this structure based on residues that are compatible with the hydrophobic core of the CheY (Stock et al. (1989) Microbiological Rev. 53:450). The deduced ETR1 sequence can be similarly aligned (data not shown). At four specific positions, response regulators contain highly conserved residues - three aspartates and a lysine (Parkinson et al. (1992) Annu.
Rev. Genet. 26:71; Stock et al., supra.); the three aspartates form an acidic pocket into which protrudes the side chain of the conserved lysine (Stock et al.
(1989) Nature 337:745; Volz et al. (1991) J. Bio1.
Chem. 266:15511) and the third aspartate is the receiver of the phosphate from phosphohistidine (Stock et al. (1989), supra.). Except for the conservative substitution of glutamate for the second aspartate, these conserved amino acids are found in the same positions in the deduced ETR1 sequence (Fig. 9B) . The deduced sequence in this domain (a stretch of 121 amino acids from residues 609 through 729 in ETR1) is most similar to the sequences of Bordetella parapertussis BvgS (29% identity, 60% similarity) which controls virulence-associated genes for pathogenicity in humans (Arico et al. (1991) Mol. Microbiol. 5:2481), E. coli RcsC (29% identity, 64% similarity), P. syringae LemA
(26% identity, 57% similarity), X. campestris RpfC (25%
identity) and E. coli BarA (20% identity). All of the bacterial proteins that are similar to ETR1 in sequence are also structurally similar to ETR1 in that they contain both the histidine kinase domain and the response regulator domain. Although these features are shared, the sensing functions are clearly diverged.

A potential membrane spanning domain (residues 295-313) exists in the deduced ETR1 sequence based on hydropathy analysis (Kyte et al. (1982) J. Mol. Biol. 157:105), but it is unclear whether ETR1 is actually a transmembrar-e protein since there is no clear signal sequence. There are also no N-linked glycosylation sites. While all of the bacterial proteins to which the deduced ETR1 sequence is similar have two potential membrane spanning domains flanking the amino terminal domain, a few bacterial sensors (those which lack the response regulator) do not.

An etrl Mutant Gene Confers Ethylene Insensitivity to Wild Type Plants Dominant ethylene insensitivity was conferred to wild type Arabidopsis plants when the etr1-1 mutant gene was stably introduced using Agrobacterium-mediated transformation. The gene was carried on a 7.3 kb genomic DNA fragment (fragments 1 and 2 in Fig. 8 which included approximately 2.7 kb upstream of the transcription initiation site, and approximately 1 kb downstream of the polyadenylation site) . It was cloned into binary transformation vector pCGN1547 obtained from Calgene, Inc., Davis, California. The vector also carried a selectable marker for kanamycin resistance in plants.

For the etri-l construct, the 4.25 kb EcoRI plasmid clone containing the etrl-1 mutation was linearized by partial EcoRI digestion and ligated with the 3.1 kb EcoRI fragment which was agarose gel-purified from cosmid clone theta8 (a subclone of YAC EG4E4 in the walk). The resulting plasmid, containing the two EcoRI
fragments in the correct relative orientation, was linearized at polylinker site Asp718, the ends were filled in using Klenow enzyme, and BamHI linkers were ligated to the blunt ends. Finally, the 7.3 kb insert was removed from the plasmid at the polylinker site BamHI, and ligated into the BamHI site of binary transformation vector pCGN1547 (McBride, K.E. et al.
(1990) Plant Molecular Biology 14:269). For the control construct, the wild type 7.3 kb fragment was agarose gel-purified from EcoRI partially digested cosmid theta8, and subcloned into the EcoRI site of pBluescript. The fragment was then removed using the BamHI and KpnI sites of the polylinker, and ligated into pCGN1547 that had been digested with BamHI and KpnI. The mutant and wild type constructs were transformed into Agrobacterium (Holsters et al. (1978) Mol. Gen. Genet. 163:181) strain ASE (Monsanto) (Rogers et al. (1988) Meth. Enzymol. 153:253). Arabidopsis ecotype Nossen was transformed (Valvekens, D. et al.
(1988) Natl. Proc. Acad. Sci. U.S.A. 85:5536) using root-tissue cultured in liquid rather than on solid medium. Triploid plants having one mutant copy.of the ETR1 gene were obtained as the progeny of crosses between the etrl-1 homozygote (diploid) and a tetraploid wild type'in ecotype Bensheim which has the same triple response phenotype as ecotype Columbia.
Triploid wild type plants were similarly obtained by crossing 'the diploid'wild type to the tetraploid.
Ethylene sensitivity was assayed in dark-grown seedlings treated with either ethylene (Bleecker et al., supra.) or 0.5 mM ACC. For ACC treatment, plants were germinated and grown on Murashige and Skoog basal salt mixture (MS, Sigma), pH 5.7, 0.5 mM ACC (Sigma), 1% Bacto-agar (Difco). Kanamycin resistance was measured by the extent of root elongation in one week old seedlings grown on MS pH 5.7 g/ml Kanamycin, 1%
Bacto-agar.

Ten kanamycin resistant plants were produced. Eight of the ten exhibited ethylene insensitive self-progeny as evaluated by the dark-grown seedling response to ethylene. In each line, ethylene insensitivity cosegregated with kanamycin resistance. As a control, transformations were performed using the corresponding 7.3 kb genomic DNA fragment of the wild type from which six kanamycin resistant plants were obtained. These lines gave rise to only ethylene sensitive self-progeny which did not appear to be different from the wild type.

The etrl-1 transformants displayed different levels of ethylene insensitivity. Thus, the wild type gene is capable of attenuating the mutant phenotype and the etrl-1 mutation is not fully dominant in the transformed plants. Of the ten kanamycin resistant lines, six gave completely dominant ethylene insensitivity, indicating the presence of multiple copies of the mutant gene. Two other lines displayed partial dominance, and two lines appeared to be wild type. Reduced ethylene insensitivity was presumably due to low expression levels which can be caused by position effects (e.g., DNA methylation) or possibly by truncation of the transferred DNA.

Vector Constructs Containing Heterologous Promoter This example describes the construction of a plant transformation vector containing a heterologous promoter to control expression of wild type andmutant ETR2 nucleic acids.

The cauliflower mosaic virus 35S protein promoter (Guilley et al. (1982) Cell 30:763-773; Odell, et al.
(1985) Nature 313:810-812 and Sanders et al. (1987) Nuc1. Acids Res. 15:1543-1558) and the 3' end of the Nopaline synthase (NOS) gene were cloned into the pCGN1547 vector to create pCGN18. The 35S promoter, on a HindIII-BamHI fragment of approximately 1.6 kb, was cloned into the unique HindIII-BamHI site of pCGN1547.
The 1 kb BamHI-KpnI NOS fragment was cloned into the unique BamHI-KpnI site of pCGN1547.

The 4.25 kb EcoRI fragment of both the wild type and mutant ETR1-1 allele were independently cloned into the unique BamHI site of the above pCGN18 vector using BamHI linkers. This 4.25 kb EcoRI genomic fragment contains the entire coding sequence including five introns and approximately 1 kb genomic DNA downstream of the polyadenylation site. It does not contain the ETR1 promoter which is on the 3.1 EcoRI fragment 2 in Fig. 5.

These vectors were used to transform root explants as described in Example 3. Kanamycin resistant plants containing the mutant ETR1-1 gene were obtained and demonstrated an ethylene insensitivity phenotype similar to that found in Example 3. Control plants transformed with the wild type ETR1 gene produced only ethylene sensitive self-progeny.

Vector Construct Utilizing Antisense ETR1 Ethylene insensitivity was conferred to wild-type Arabidopsis by expression of an ETRI antisense nucleic acid which was introduced using standard Agrobacterium root transformation procedure. Valvekens et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85:5536. The antisense nucleic acid consisted of a 1.9 kb ETR1 cDNA fragment.
Expression of this fragment, which extended from the MscI restriction site at nucleotide 220 to the first SmaI site at nucleotide 2176 in Figs 3A, 3B, 3C and 3D
was driven in the reverse orientation by the CaMV 35S
promoter. To construct the antisense nucleic acid, BamHI linkers were ligated to the ends of the 1.9 kb MscI-SmaI DNA fragment and the thus formed fragment was ligated into the BamHI site of pCGN 18 transformation vector. Jack et al. (1994) Cell 76:703. The construct was transformed into Agrobacterium strain ASE as described above and then into Arabidopsis.

Seedlings derived from this transformation experiment were tested for sensitivity to ethylene as previously described. Seedlings containing the antisense construct were ethylene insensitive.

Identification of QITR, a Second ETR Nucleic Acid in Arabidopsis Genomic DNA from Arabidopsis thaliana was partially digested with Sau3A and cloned into a XGEM11 (half-site arms) obtained from Promega, Madison, Wisconsin. The genomic digest was partial end filled prior to cloning with XGEM11 and plated on media as suggested by the manufacturer.

The thus cloned library was screened with a 32P-labeled cDNA Xbal fragment extending from nucleotides 993-2308 as set forth in Figures 3B, 3C and 3D. Hybridization conditions were 50 C and 5XSSPE. Washes were made at 50 C 0.2XSSPE. Several positively hybridizing clones were identified, replated and rescreened. Positively hybridizing clones were digested with SacI (which cleaves within the arms of the cloning phage and within the insert). The multiple fragments obtained therefrom were subcloned into bacterial plasmids for sequencing.
The genomic DNA sequence (SEQ ID NO.:45) together with the deduced amino acid sequence (SEQ ID NO.:46 and 48) is set forth in Figure 12. This ETR nucleic acid and amino acid sequence is referred to as the QITR nucleic or amino acid sequence respectively. The QITR cDNA
sequence (SEQ ID N0.:47) and the QITR amino acid sequence (SEQ ID NOs:46 and 48) are shown in Figure 13.
By comparison to the ETR1 Arabidopsis nucleic acid and amino acid sequence (see Figures 2 and 3), the QITR
protein appears to contain an amino terminal portion having a relatively high level of homology to the amino terminal portion of the ETR1 protein and a histidine kinase portion with a moderate level of homology to the same sequence in ETR1. The response regulatory region found in ETR1 is not present in the QITR protein. The overall nucleic acid homology is approximately 69%.
With regard to the amino terminal portion .(i.e., between residues 1 through 316) the homology is approximately 71% identical in terms of amino acid sequence and 72% identical in terms of nucleic acid sequence.

Modification of QITR Nucleic Acid to Confer Ethylene Insensitivity An amino acid substitution was made in a 5 kb QITR
genomic clone which was analogous to that for the ETR2-4 mutation, namely the substitution of the isoleucine at position 62 with phenylalanine. Compare Figure 3A
with Figure 5A at residue 62. As further indicated at Figures 12 and 13, residue 62 in the QITR protein is also isoleucine as in the ETR1 protein.

The amino acid substitution was made to the.QITR
nucleic acid using oligonucleotide-directed in vitro mutagenesis. Kunkel et al. (,1987) Methods in Enzymology 154:367-382. A Muta-geneekit from Bio-Rad Laboratories, Hercules, California, was used in connection with this particular mutation. The sequence of the oligonucleotide used was 5' GGA GCC TTT TTC ATT
CTC. Replacement of nucleotide A with T in the codon ATC changed the amino acid Ile at residue 62 to Phe in the deduced protein sequence.

The QITR nucleic acid spanning approximately 5 kb from the first HindIIl site to the second KpnI site contained approximately 2.4 kb of nucleotides upstream from the start codon. This 5 kb fragment was ligated into the pCGN1547 transformation vector (supra.). This construct was then transformed into Agrobacterium strain ASE as described supra and then into Arabidopsis.

Seedlings derived from this transformation experiment were tested for sensitivity to ethylene as previously described. Seedlings containing the QITR nucleic acid *
Trade-mark containing the modification at residue 62 were ethylene insensitive.

Identification of Arabidopsis ETR Nucleic Acid 08 The ETR nucleic acid Q8 (SEQ ID NOs:41 and 43) was identified by direct sequence comparison with the ETR1 nucleic acid from Arabidopsis. The Arabidopsis Q8 nucleic acid was identified in connection with a chromosome walk on chromosome 3 of Arabidopsis thaliana.

Briefly, overlapping YAC clones were generated which were thereafter subcloned into plasmids. The genomic inserts in such plasmids were extricated by digesting with restriction endonuclease and hybridized to a cDNA
library from Arabidopsis floral tissue.

Positively hybridizing inserts were sequenced to produce the overall genomic sequence (SEQ ID NO.:41) together with the deduced amino acid sequence (SEQ ID
NOs:42 and 44) as set forth in Figure 14. The cDNA
sequence (SEQ ID NO:43) and deduced amino acid sequence (SEQ ID NOs:42 and 44) is set forth in Figure 15.

The overall nucleic acid homology as between the Q8 nucleic acid and the ETR1 nucleic acid is approximately 69%. With regard to the amino terminal portion extending from residues 1 through 316, the overall amino sequence homology is approximately 72% whereas the nucleic acid encoding this sequence is approximately has a sequence homology of approximately 71% as between the Q8 and ETR1 nucleic acids.

Isolation of the TETR cDNA

A 32P-labeled hybridization probe was prepared by random-primer labeling of a 1.3 kb PCR fragment generated by PCR amplification of the Arabidopsis ETR1 gene with the PCR primers "5'BamHI"
(CCCGGATCCATAGTGTAAAAAATTCATAATGG) and "3'BamHIB"
(CCGGATCCGTTGAAGACTTCCATCTTCTAACC).
This probe was used to screen a cDNA library of red tomato fruit mRNA cloned in the EcoRI site of lambda ZAP II~ vector from Stratagene, LaJolla, CA. Twenty (20) positive primary plaques were identified that hybridized to this probe (2X SSC at 65 C wash conditions) and secondary screens were performed on these to obtain pure plaques. In vivo excision was then performed with resultant recombinant phage and 19 independent plasmid clones were obtained.
Complementary DNAs, from plasmid clones containing the largest fragments that hybridized to the ETR1 probe, were sequenced and the nucleotide sequence and predicted amino acid sequences of the longest tomato cDNA (TETR14, also referred to as TXTR) were compared to the ETR3 and QITR sequences. The nucleotide sequence ofTETR14 predicted that the encoded peptide was more similar to the QITR peptide than the ETR1 peptide. This conclusion was based on the fact that the response regulatory domain (which is present in ETR1) is absent in both TETR14 and QITR. The sequence (or partial sequence) of several of the other cDNA
clones was determined and they were found to correspond to the same gene.

*
Trade-mark Analysis of TETR14 Gene Expression Northern analysis was performed with mRNA from developing fruits of normal, or mutant tomato (Ripening inhibitor (rin), Non-ripening (nor) or Never-ripe (Nr)) fruit. Stages of developing fruits used were mature 'green, breaker, breaker plus 7 days, and mature green fruit treated with ethylene. Messenger RNA that hybridized to the TETR14 gene probe was not present at the mature green stage, but was present in breaker, breaker plus 7 days, and ethylene treated mature green fruit. Thus, it was concluded that accumulation of the TETRA14 mRNA was regulated by ethylene. Accumulation of the TETR14 mRNA was attenuated in all three ripening mutants, further supporting the finding that mRNA
accumulation is ethylene regulated.

Analysis of the TETR14 Gene from Pearson and Never-rine DNA

PCR primers were obtained that would specifically amplify the N-terminal region of the TETR14 gene. The amplified portion was between Meti and I1e214 in Figs.
16A and 16B. The primers were (CCGGATCCATGGAATCCTGTGATTGCATTG) and TETR4A (GATAATAGGAAGATTAATTGGC). PCR conditions (Perkin-Elmer Cetus): 1 ug of tomato genomic DNA, 40 picomole of each primer, 1 min 94 C, 2 min 45 C, 2 min 72 C, 35 cycles. PCR products, obtained with these primers, resulting from two independent amplification reactions of pearson and Nr DNA were agarose gel purified and subcloned into either the T/A vector ro + ~ ~

(Invitrogen) or digested with BamHI and XhoI and subcloned into Bluescript KS- that had been linearized with BamHI and SalI. Single stranded template DNA was prepared from the resultant plasmids and sequenced.
The sequence of the PCR products from the pearson DNA
were identical to the sequence of the TETR14 clone.
Sequence analysis revealed that the PCR fragments resulting from PCR of the Nr DNA (TETR14-Nr) were not identical to those obtained from the Pearson DNA. The .10 cytosine nucleotide at position 395 of the TETR14 gene is a thymine in the gene amplified from the Nr DNA.
This nucleotide substitution in TETR14-Nr changes the proline at amino acid position 36=of the predicted peptide to a leucine. See Fig. 22 and Seq. ID Nos. 49 and 50 for the overall nucleic acid and amino acid sequence respectively. This Pro-36 of the TETR14 corresponds to the Pro-36 of the ETR1 peptide and to the Pro-36 of the QITR peptide. This results indicates that a mutation in the tomato TETR14 gene confers dominant ethylene-insensitivity. And thus, it is possible to predict that other changes in the TETR14 gene and other tomato ETRI homologues will result in ethylene insensitivity in tomato.

Having described the preferred embodiments of the invention, it will appear to those of ordinary skill in the art that various modifications may be made to the disclosed embodiments, and that such modifications are intended to be within the scope of the invention.

SEQUENCE LISTING
(1) GENERAL INFORMATION:

(i) APPLICANT: Meyerowitz, Elliott M.
Chang, Caren Bleecker, Anthony B.

(ii) TITLE OF INVENTION: PLANTS HAVING MODIFIED RESPONSE TO
ETHYLENE
(iii) NUMBER OF SEQUENCES: 50 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Richard F. Trecartin (B) STREET: 3400 Embarcadero Center, Suite 3400 (C) CITY: San Francisco (D) STATE: California (E) COUNTRY: USA
(F) ZIP: 94111 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/US94/
(B) FILING DATE: 01-JUL-1994 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/086,555 (B) FILING DATE: 01-JUL-1993 (C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Trecartin, Richard F.
(B) REGISTRATION NUMBER: 31,801 (C) REFERENCE/DOCKET NUMBER: FP57515-1RFT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (415) 781-1989 (B) TELEFAX: (415) 398-3249 (2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3879 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

AGTGTTAAAC CCAACCAATT TTGACT'PGAA AAAAAGCTTC AACGCTCCCC TTTTCTCCTT 300 ACTTTGTGAA GAAATCAGCC GTGTT't'CCGT ATAGATGGGT ACTTGTTCAG TZ".PGGTGCTT 960 TGAATGATGT.CTTAGATCTT TCAAGGTTAG AAGATGGAAG TCTTCAACTT GAACTTGGGA 2100 CATTCAATCT TCATACATTA TTTAGAGAGG TAACTT'ITGA ACAGCTCTAT GTTTCATAAG 2160 AGAAACCGAT GATTATTTTG GTTGCAGGGT AAGTAGAATG G'I'GACGAAGG GACTTCTTGT 3120 ACTCAGTGGT AACACTGACA AATCCACAAA AGAGAAATGC ATGAGCT'I'TG GTCTAGACGG 3360 ` ~ . * ,. =Z , _ ~

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2787 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 188..2401 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

AGTAAGAACG AAGAAGAAGT GTTAAACCCA ACCAAT'M'TG ACTTGAAAAA AAGCTTCAAC 60 Met Glu Val Cys Asn Cys Ile Glu Pro Gln Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Ile GCG TAT TTT TCG ATT CCT CT'I'GAG TTG ATT TAC TTT GTG AAG AAA TCA 325 Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro 95 ' 100 105 110 Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gin Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp 4 ~ ' : t =

Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gin Leu Ser Tyr Thr Leu Arg His Gln His Pro Val Glu Tyr Thr Val Pro Ile G1n Leu Pro Val Ile Asn Gln Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Giu Leu Val Glu Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Clu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gin Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu ; =

Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gln 450 455 . 460 Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn. Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala G1n Thr Gin Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gin Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn TTC ACT GGA CTT AAG GTT CTT GTC A'I'G GAT GAG AAC GGG GTA AGT AGA 2053 Phe Thr G1y Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr GTG AGT TCA AAC GAG GAG TGT CTC CGA GTT GTG TCC CAT GAG'CAC AAA 2149 Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Vai Cys Met Pro Gly Val Glu Asn Tyr Gln Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gln Arg His Gln Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu' Tyr Glu Gly Met (2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 738 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Met Glu Val Cys Asn Cys Ile Glu Pro Gln Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr G1n Tyr Ile Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu = ~ .. , Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr G1n Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln Leu Ser Tyr Thr Leu Arg His Gln His Pro Val Glu Tyr Thr Val Pro Ile Gln Leu Pro Val Ile Asn Gln Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gin Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gin Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Va1 Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Giu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Vai Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gln Arg Leu-Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp ~ s ~ L . 3 =.

Leu Pro Glu Phe Val Va1 Gly Asp Glu Lys Arg Leu Met G}.n Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys 500 505 . 510 Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gln Thr Gln Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gln Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gin Arg His G1n Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Va1 Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2787 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 188..2401 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Met Glu Val Cys Asn Cys Ile Glu Pro G1n Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Va1 Leu Val Gln Phe Gly Ala Phe Ile GTT CTT TAT GGA GCA ACT CAT CTT ATT AAC TTA TGG ACT TTC:ACT ACG 421 Val Leu Tyr Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr CAT TCG AGA ACC GTG GCG CTT GTG ATG ACT ACC GCG AAG GTG.TTA ACC 469 His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro CAT CTT TTG AGT GTT AAG ACT CGG GAG CTT TTC TTG AAA AAT,AAA GCT 565 Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu G1u Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu = ' ~ * 3 =

Leu Gln Leu Ser Tyr Thr Leu Arg His Gln His Pro Val Glu Tyr Thr Val Pro Ile Gln Leu Pro Val Ile Asn Gln Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Clu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gin Arg Leu Met Val 370 375 38:0 GAA ACA ATA CTT AAA AGT AGT AAC CTT TTG GCA ACT TTG ATG.AAT GAT 1381 Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gin Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile 415 420. 425 430 Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala ` , ~ j . . =. ~' =

Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gln Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys G1n Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala GAC TTT TTT GTC GTG CCA ACT GGG AGT CAT TTC TAC TTG AGA G'PG AAG 1717 Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gln Thr Gln Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys GIy Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gin Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gln Arg His Gin Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys ' ' = `~ ' :' 3 ~

Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met TAGTTACATT CTTATAAGAA TTTGGATCGA GTTA'PGGATG CTTGTTGCGT GCATGTATGA 2741 (2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 738 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Met Glu Val Cys Asn Cys Ile Glu Pro Gln Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Tyr Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu I1e Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln Leu Ser Tyr Thr Leu Arg His Gln His Pro Val Giu Tyr Thr Val Pro Ile Gin Leu Pro Val Ile Asn Gin Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gin Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gin Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu GlnLeu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gln Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gln Thr Gin Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gln Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gln Arg His Gin Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2787 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 188..2401 = = CA 02380955 2002-05-07 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Met Glu Val Cys Asn Cys Ile Glu Pro Gin Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr 11e Ser Asp Phe Phe I1e Ala.Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val GTn Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr 80 85 90.

Ala Val Val Ser Cys Ala Thr Thr Leu Met Leu Val His Ile Ile Pro GAT CTT TI'G AGT GTT AAG ACT CGG GAG CTT TTC TTG AAA AAT AAA GCT 565 Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala GCT GAG CTC GAT AGA GAA ATG GGA TT'G ATT CGA ACT CAG GAA GAA ACC 613 Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gin Leu Ser Tyr Thr Leu Arg His Gin His Pro Val Glu Tyr Thr Va1 Pro Ile Gln Leu Pro Val Ile Asn Gln Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gin Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu G1u-Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val ATG AAC CAT GAA ATG CGA ACA CCG ATG CAT GCG A'I'T ATT GCA CTC TCT 1285 Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gln Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Va1 Va1 Gly Asp Glu Lys Arg Leu Met Gin Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn-Pro Gin Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gin Thr Gln Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu G1y'Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Iie Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val SerSer Asn Glu Glu Cys Leu Arg Val Va1 Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Va1 Glu Asn Tyr Gin Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gin Arg His Gin Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu a , . . = 4 ~

Tyr Glu Gly Met CATATCAGAG ATTGTCGGAG CGTIT'I"GGAT GATATCTTAA AACAGAAAGG GAATAACAAA 2561 GGTGGTATAA TCATACCATT TCAGATTACA TGTT'I'GACTA ATGT'IGTATC CTTATATATG 2681 (2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 738 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Met Glu Val Cys Asn Cys Ile Glu Pro Gin Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr I1e Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu I1e Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Thr Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln - ~ ,_ =

Leu Ser Tyr Thr Leu Arg His Gln His Pro Val Glu Tyr Thr Val Pro Ile Gin Leu Pro Val Ile Asn Gin Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Vai His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gin Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gin Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gin Arg Leu Met Val Giu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gln Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gin Thr Gln Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Vai Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Ile Pro Lys Va1 Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys'Leu ArgVal Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gln Ile Ala Leu Arg I1e His Glu Lys Phe Thr Lys Gin Arg His Gin Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2787 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 188..2401 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

~ . ;. Z =

Met Glu Val Cys Asn Cys Ile Glu Pro Gin Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr G1n Tyr Ile Ser Asp Phe Phe Ile Ala Ile Val Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser GCC GTG TTT CCG TAT AGA TGG GTA CZT OTT CAG TZT GGT GCT`ITT ATC 373 Ala Va1 Phe Pro Tyr Arg Trp Val Leu Val G1n Phe Gly Ala Phe Ile Val Leu CysGly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser.Arg Thr Val Ala Leu Va1 Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Zle Pro 95 ' 100 105 110 Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gin Leu Ser Tyr Thr Leu Arg His G1n His Pro Val Glu Tyr Thr Val Pro Ile Gln'Leu Pro Val Ile Asn Gin Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val . ~ y CA 02380955 2002-05-07 Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gin Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gin Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu G1n Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg:Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu G1n G1u Thr Glu Leu Thr Pro Glu Gln Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Va1 Va1 Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala CCA GAT TTG CCA GAA TTT GTT GTT GGG GAT GAG AAA, CGG CTA ATG CAG 1573 Pro Asp Leu ProGlu Phe Val Val Gly Asp Giu Lys Arg Leu Met Gin Ile Ile Leu Asn Ile Val Gly Asn Ala Va1 Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro G1n Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gln Thr'Gin Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn LeuMet Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gin Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gln Arg His Gln Arg Pro Leu Leu Val Ala Leu Ser GlyAsn_Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met = CA 02380955 2002-05-07 ' = ~ a ' . ~ =

s0 (2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 738 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Met Glu Va1 Cys Asn Cys Ile Glu Pro Gln Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Ile Val Tyr 20 25. 30 Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Giy Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln Leu Ser Tyr Thr Leu Arg His Gln His Pro Val Glu Tyr Thr Val Pro Ile Gin Leu Pro Val Ile Asn Gin Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gin Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gln Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gin Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gln Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys.Phe Ala Gln Thr Gln Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser ' *=.

. ~ , =

Gly Leu Gly Leu Ala I1e Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gin Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Veal Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gln Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gln Arg His Gln Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2787 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 188..2401 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

AGTAAGAACG AAGAAGAAGT GTPAAACCCA ACCAATTTI'G ACTTGAAAAA AAGCTTCAAC 60 , s. .

` ~ .. `~` _ =

Met Glu Val Cys Asn Cys Ile Glu Pro Gin Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr G1n Tyr Ile Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys LysSer GCC GTG TTT CCG TAT AGA TGG GTA CTT GTT CAG TTT GGT GCT T'I'T TTC 373 Ala Val Phe Pro Tyr Arg Trp Val Leu Va1 Gln Phe Gly Ala Phe Phe Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr GCT GTT GTC TCG TGT GCT ACT GCG TTG ATG CTT GTT CAT ATT AT'P CCT 517 Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln Leu Ser Tyr Thr Leu Arg His Gin His Pro Val Glu Tyr Thr Val Pro Ile Gin Leu Pro Val Ile Asn Gln Val Phe Gly Thr Ser Arg Ala Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly y Lys Tyr Met Leu Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gin Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gin Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gin Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gin Glu Thr Glu Leu Thr Pro Glu Gln Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Val Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Va1 Val Gly Asp Glu Lys Arg Leu Met Gln Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser Ile Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys . ` ~

Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gin Thr G1n Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Glu Gly Asn Ile Trp Ile Glu Ser Asp Gly Leu Giy Lys Gly Cys Thr Ala Ile Phe Asp Val Zys LeuGly Ile Ser Glu Arg Ser Asn Glu Ser AAA CAG TCG GGC ATA CCG AAA OTT CCA GCC AT'T CCC CGA CAT TCA AAT 2005 Lys Gin Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Vai Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Vai Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Va1 Glu Asn Tyr Gln Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gin Arg His Gln Arg Pro Leu Leu Val Ala Leu Ser G1y Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe G1y Leu Asp G1y Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met CATATCAGAG ATTGTCGGAG CGT'I"I"I'GGAT GATATCTTAA AACAGAAAGG GAATAACAA.A 2561 ATAGAAACTC TAAACCGGTA TGTGTCCGTG GCGATTTCGG TTATAGAGGA ACAAGA'i'GGT 2 621 GGTGGTATAA TCATACCATT TCAGATTACA TGTI"IGACTA ATGTTGTATC CTTATATATG 2681 CATI`GATGCA GTATTATGGC GTCAGCTTTG CGCCGCTTAG TAGAAC 2787 (2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 738 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

Met Glu Val Cys Asn Cys Ile Glu Pro Gln Trp Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Phe Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Giu Met G1y Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu G1u Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln Leu Ser Tyr Thr Leu Arg His G1n His Pro Val Glu Tyr Thr Val Pro Ile Gin Leu Pro Val Ile Asn Gln Val Phe Gly Thr Ser Arg Ala Val - , 3 Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Val Ser Gly Lys Tyr Met Leu Gly Glu Val Va1 Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gin Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg .260 265 270 Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Va1 Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Clu Gln Arg Leu Met Val G1u Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu AspGly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Vai Leu Asn Leu Ile Lys Pro Ile Ala Val Vai Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gin Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln Gly Ser 11e Ser Val Thr Ala Leu Val Thr Lys Ser Asp Thr Arg Ala Ala Asp Phe Phe Val Val Pro Thr Gly Ser His Phe Tyr Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gln Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gin Thr Gln SerLeu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Val Asn Leu Met Giu Gly = 4 CA 02380955 2002-05-07 Asn Ile Trp Ile Glu Ser Asp Gly Leu Gly Lys Gly Cys Thr Ala Ile Phe Asp Val Lys Leu Gly Ile Ser Glu Arg Ser Asn Glu Ser Lys Gln Ser Gly Ile Pro Lys Val Pro Ala Ile Pro Arg His Ser Asn Phe Thr Gly Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Glu Val Thr Thr Val Ser Ser Asn Glu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Va1 Glu Asn Tyr Gln Ile Ala Leu Arg Ile His Glu Lys Phe Thr Lys Gln Arg His Gin Arg Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Va1 Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu Glu Pro Arg Val Leu Tyr Glu Gly Met (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Gln Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Thr Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Iie Ala Leu Ser Ser Leu Leu Gln Glu Thr Glu Leu Thr Pro Glu Gln Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Met Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Glu Leu Gly Thr Phe Asn Leu His Thr Leu Phe Arg Glu Val Leu Asn Leu Ile Lys Pro Ile Ala Va1 Val Lys Lys Leu Pro Ile Thr Leu Asn Leu Ala Pro Asp Leu Pro Glu Phe Val Val Gly Asp Glu Lys Arg Leu Met Gln Ile Ile Leu Asn Ile Val Gly Asn Ala Val Lys Phe Ser Lys Gln G1y Ser Ile (2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

Gln Asn Val Glu Leu Asp Leu Ala Lys Lys Arg Ala Gln G1u Ala Ala Arg Ile Lys Ser Glu Phe Leu Ala Asn Met Ser His Glu Leu Arg Thr Pro Leu Asn Gly Val Ile Gly Phe Thr Arg Leu Thr Leu Lys Thr Glu Leu Thr Pro Thr Gln Arg Asp His Leu Asn Thr Ile Glu Arg Ser Ala Asn Asn Leu Leu Ala Ile Ile Asn Asp Val Leu Asp Phe Ser Lys Leu Glu Ala Gly Lys Leu Ile Leu Glu Ser Ile Pro Phe Pro Leu Arg Ser Thr Leu Asp Glu Val Va1 Thr Leu Leu Ala His Ser Ser His Asp Lys Gly Leu Glu Leu Thr Leu Asn Ile Lys Ser Asp Val Pro Asp Asn Val Ile Gly Asp Pro Leu Arg Leu Gin Gln Ile Ile Thr Asn Leu Val Gly Asn Ala Ile Lys Phe Thr Glu Asn Gly Asn Ile (2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

Gin Asn Ile Glu Leu Asp Leu Ala Arg Lys Glu Ala Leu Glu Ala Ser Arg Ile Lys Ser Glu Phe Leu Ala Asn Met Ser His Glu Ile Arg Thr Pro Leu Asn Gly Ile Leu Gly Phe Thr His Leu Leu Gin Lys'Ser Glu Leu Thr Pro Arg Gin Phe Asp Tyr Leu Gly Thr Ile Glu Lys Ser Ala Asp Asn Leu Leu Ser Ile Ile Asn Glu Ile Leu Asp Phe Ser Lys Ile Glu Ala Gly Lys Leu Val Leu Asp Asn Ile Pro Phe Asn Leu Arg Asp Leu Leu Gln Asp Thr Leu Thr Ile Leu Ala Pro Ala Ala His Ala Lys Gin Leu Glu Leu Val Ser Leu Val Tyr Arg Asp Thr Pro Leu Ala Leu Ser Gly Asp Pro Leu Arg Leu Arg Gln Ile Leu Thr Asn Leu Val Ser Asn Ala Ile Lys Phe Thr Arg Glu Gly Thr Ile (2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 149 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

Arg Ala Val Arg Glu Ala Arg His Ala Asn Gln Ala Lys Ser Arg Phe Leu Ala Asn Met Ser His Glu Phe Arg Thr Pro Leu Asn Gly Leu Ser Gly Met Thr Glu Val Leu Ala Thr Thr Arg Leu Asp Ala Glu Gln Lys Glu Cys Leu Asn Thr Ile Gln Ala Ser Ala Arg Ser Leu Leu Ser Leu Val Glu Glu Val Leu Asp Ile Ser Ala Ile Glu Ala Gly Lys Ile Arg Ile Asp Arg Arg Asp Phe Ser Leu Arg Glu Met Ile Gly Ser Val Asn Leu Ile Leu Gln Pro Gin Ala Arg Gly Arg Arg Leu Glu Tyr Gly Thr Gln Val Ala Asp Asp Va1 Pro Asp Leu Leu Lys Gly Asp Thr Ala His Leu Arg Gln Val Leu Leu Asn Leu Val Gly Asn Ala Val Lys Phe Thr Glu His Gly His Val (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Leu Lys Val Leu Val Met Asp Glu Asn Gly Val Ser Arg Met Val Thr Lys Gly Leu Leu Val His Leu Gly Cys G1uVa1 Thr Thr Val Ser Ser Asn Giu Glu Cys Leu Arg Val Val Ser His Glu His Lys Val Val Phe Met Asp Val Cys Met Pro Gly Val Glu Asn Tyr Gln Ile Ala Leu Arg Ile His (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

Leu Arg Val Leu Val Val Asp Asp His Lys Pro Asn Leu Met Leu Leu Arg Gin Gln Leu Asp Tyr Leu Gly Gln Arg Val Val Ala Ala Asp Ser Gly Glu Ala Ala Leu Ala Leu Trp His Glu His Ala Phe Asp Val Val Ile Thr Asp Cys Asn Met Pro Gly Ile Asn Gly Tyr Glu Leu Ala Arg Arg Ile Arg (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

Met Met Ile Leu Va1 Vai Asp Asp His Pro Ile Asn Arg Arg Leu Leu Ala Asp Gln Leu Gly Ser Leu Gly 'Iyr Gln Cys Lys Thr Ala Asn Asp Gly Val Asp Ala Leu Asn Val Leu Ser Lys Asn His Ile Asp Ile Val Leu Ser Asp Val Asn Met Pro Asn Met Asp Gly Tyr Arg Leu Thr Gln 50 '55 60 Arg Ile Arg (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

= +- CA 02380955 2002-05-07 =

~ =

Pro Arg Val Leu Cys Val Asp Asp Asn Pro Ala Asn Leu Leu Leu Val Gin Thr Leu Leu Glu Asp Met Gly Ala Glu Val Val Ala Val Glu Gly Gly Tyr Ala Ala Val Asn Ala Val Gln Gln Glu Ala Phe Asp Leu Val Leu Met Asp Val Gln Met Pro Gly Met Asp Gly Arg Gin Ala Thr Glu Ala Ile Arg (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 369 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

TATT'TT'GTCC ACAAATCTGC ATGCTTCCCA TACAGATGGG TCCTCATGCA ATT'lWTGCT 180 (2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 369 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

CAATACATCT CCGATT'TCTT CATTGCGATT GCGTATT'T'i'T CGATTCCTCT TGAGTTGATT 120 = CA 02380955 2002-05-07 (2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 296 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESSz single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

CAGAATATTG CTT7GGA2'GT AGCTCGACAA GAAGCAGAGA TGGCCATCCG TGCACGTAAC 120 (2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 296 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

GATTTCCTAG CGGTTATGAA CCATGAAATG CGAACACCGA TGCATGCGAT TAT'!'GCACTC 180 ' J - CA 02380955 2002-05-07 - ' = , ' `; =

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 123 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Met Glu Ser Cys Asp Cys Ile Glu Ala Leu Leu Pro Thr Gly Asp Leu Leu Val Lys Tyr Gln Tyr Leu Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val His Lys Ser Ala Cys Phe.Pro Tyr Arg Trp Val Leu Met G1n Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Phe Ile Ser Leu Trp Thr Phe Phe Met His Ser Lys Thr Val Ala Va1 Va1 Met Thr Ile Ser Lys Met Leu Thr Ala Ala Val Ser Cys Ile Thr Ala Leu Met Leu Val His Ile I1e Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 123 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

Met Glu Val Cys Asn Cys Ile GluPro Gln Trp Pro Ala Asp Giu Leu Leu Met Lys Tyr Gln Tyr,Ile Ser Asp Phe Phe Ile Ala Ile Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr Arg Trp Va1 Leu Va1 Gln Phe Gly Ala Phe Ile Val Leu , `~ ; : t =

Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Thr Thr His Ser Arg Thr,Val Ala Leu Val Met Thr Thr Ala Lys Val Leu Thr Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys (2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

(2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

Leu Arg Val Lys Val Lys Asp Ser Gly Ala Gly Ile Asn Pro Gin Asp Ile Pro Lys Ile Phe Thr Lys Phe Ala Gln Thr Gln Ser Leu Ala Thr Arg Ser Ser Gly Gly Ser Gly Leu Gly Leu Ala Ile Ser Lys Arg Phe Va1 Asn Leu Met Glu Gly Asn Ile (2) INFORMATIaN FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:56 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

Ile Glu Va1 Gln Ile Arg Asp Thr Gly Ile Gly Ile Pro Glu Arg Asp Gin Ser Arg Leu Phe Gln Ala Phe Arg Gin Ala Asp Ala Ser Ile Ser Arg Arg His Gly Gly Thr Gly Leu Gly Leu Val Ile Thr G1n Lys Leu Val Asn Glu Met Gly Gly Asp Ile (2) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

Leu Arg Ile Ser Val Gin Asp Thr Gly Ile Gly Leu Ser Ser Gln Asp Val Arg Ala Leu Phe Gln Ala Phe Ser Gln Ala Asp Asn Ser Leu Ser Arg Gln Pro Gly Gly Thr G1y Leu Gly Leu Val I1e Ser LysArg Leu Ile Giu G1n Met Gly Gly Glu Ile (2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

Leu Arg Phe Asp Val G1u Asp Thr Gly Ile Gly Val Pro Met Asp Met Arg Pro Arg Leu Phe G1u Ala Phe Glu Gln Ala Asp Val Gly Leu Ser Arg Arg Tyr Glu Gly Thr Gly Leu Gly Thr Thr Ile Ala Lys Gly Leu Val Glu Ala Met Gly Gly Ser Ile (2) INFORMATION FOR SEQ ID NO:31:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTIONt SEQ ID NO:31:

Pro Leu Leu Val Ala Leu Ser Gly Asn Thr Asp Lys Ser Thr Lys Glu Lys Cys Met Ser Phe Gly Leu Asp Gly Val Leu Leu Lys Pro Val Ser Leu Asp Asn Ile Arg Asp Val Leu Ser Asp Leu Leu (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

Cys Ile Leu Phe Gly Phe Thr Ala Ser Ala Gln Met Asp Glu Ala His Ala Cys Arg Ala Ala Gly Met Asp Asp Cys Leu Phe Lys Pro Ile Gly Val Asp Ala Leu Arg GIn Arg Leu Asn Glu Ala Ala (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:

Leu Pro Val I1e Gly Va1 Thr Ala Asn Ala Leu Ala Glu Glu Lys Gln Arg Cys Leu Glu Ser Gly Met Asp Ser Cys Leu Ser Lys Pro Val Thr Leu Asp Val Ile Lys Gln Ser Leu Thr Leu Tyr Ala = . CA 02380955 2002-05-07 (2) INFORMATION FOR SEQ ID NO:34:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

Leu Pro Ile Val Ala Leu Thr Ala His Ala Met Ala Asn Glu Lys Arg Ser Leu Leu Gin Ser Gly Met Asp Asp Tyr Leu Thr Lys Pro Ile Ser Glu Arg Gln Leu Ala Gln Val Val Leu Lys Trp Thr (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2405 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 288..2196 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:

Met Glu Ser Cys Asp Cys Ile Glu Ala Leu Leu Pro Thr Gly Asp Leu Leu Val Lys Tyr Gin Tyr Leu Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val His Lys Ser Ala Cys Phe Pro Tyr ~ ; = l; ~

Arg Trp Val Leu Met G1n Phe G1y Ala Phe Ile Val Leu Cys Gly Ala Thr His Phe Ile Ser Leu Trp Thr Phe Phe Met His Ser Lys Thr Val Ala Val Val Met Thr Ile Ser Lys Met Leu Thr Ala Ala Val Ser Cys Ile Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Thr Arg Ala Glu Glu Leu Asp Lys Glu Met Gly Leu Ile Ile Arg Gln GluG1u Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Asp Leu Ala Glu Cys Ala Leu Trp Met Pro Cys Gin Gly Gly Leu Thr Leu G1n Leu Ser His Asn Leu Asn Asn Leu I1e Pro Leu Gly Ser Thr Val Pro Ile Asn Leu Pro Ile Ile Asn Giu Ile Phe Ser Ser Pro Glu Ala Ile Gln Ile Pro His Thr Asn Pro Leu Ala Arg Met Arg Asn Thr Va1 Gly Arg Tyr Ile Pro Pro Glu Val Vai Ala Val Arg Val Pro Leu Leu His Leu Ser Asn PheThr Asn Asp Trp Ala Glu Leu Ser Thr Arg Ser Tyr Ala Val Met Val Leu Val Leu Pro Met Asn Gly Leu Arg Lys Trp Arg Glu His Glu Leu Glu Leu Val Gln Val Va1 Ala Asp Gln Vai Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Asp Ser Met Arg Ala His Asp Gln Leu Met Glu G1n Asn Ile Ala Leu Asp Val Ala Arg Gln Glu Ala Glu Met Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Val Ile Ala Leu CysSer Leu Leu Leu Glu Thr Asp Leu Thr Pro Glu Gln Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ile Leu Glu LeuG1u Asn Gly Thr Phe Asn Leu His G1y Ile Leu Arg Glu Ala Val Asn Leu Ile Lys Pro Ile Ala Ser Leu Lys Lys Leu Ser I1e Thr Leu Ala Leu Ala Leu Asp Leu Pro Ile Leu Ala Val Gly Asp Ala Lys Arg Leu Ile Gin Thr Leu Leu Asn Val Val GGA AA`I' GCT GTG AAG TTC ACT AAA GAA GGA CAT ATT TCA ATT GAG GCT 17 3 6 Gly Asn Ala Val Lys Phe Thr LysGlu Gly His Ile Ser Ile Glu Ala 470 475 480.

Ser Val Ala Lys Pro Glu Tyr Ala Arg Asp Cys His Pro Pro G1u Met Phe Pro Met Pro Ser Asp Gly Gin Phe Tyr Leu Arg Val Gin Va1 Arg Asp Thr Gly Cys Gly Ile Ser Pro Gln Asp Ile Pro Leu Val Phe Thr Lys Phe Ala Glu Ser Arg Pro Thr Ser Asn Arg Ser Thr Gly Gly Glu G1y,Leu Gly Leu Ala Ile Trp Arg Arg Phe Ile G1n Leu Met Lys Gly Asn Ile Trp Ile Clu Ser Glu Gly Pro Gly Lys Gly Thr Thr Va1 Thr Phe Val Val Lys Leu Gly Ile Cys His His Pro Asn Ala Leu Pro Leu Leu Pro Met Pro Pro ArgGly Arg Leu Asn Lys Gly Ser Asp Asp Leu Phe Arg Tyr Arg Gin Phe Arg Gly Asp Asp Gly Gly Met Ser Val Asn Ala Gln Arg Tyr Gin Arg Ser Met *

GACAAAGAAC ATTAAATCAT GACTAGTGAA TTT'GAGATTT CTTCACTGTT CTGTACACTC 2276 (2) INFORMATION FOR SEQ ID NO:36:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 636 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

Met Glu Ser Cys Asp Cys Ile Glu Ala Leu Leu Pro Thr Gly Asp Leu Leu Val Lys Tyr Gin Tyr Leu Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val His Lys Ser Ala Cys Phe Pro Tyr Arg Trp Val Leu Met Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Phe Ile Ser Leu Trp Thr Phe Phe Met His Ser Lys,Thr Val Ala Val Val Met Thr Ile Ser Lys Met Leu Thr Ala Ala Va1 Ser Cys Ile Thr Ala Leu Met Leu Val His Ile Ile Pro-Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Thr Arg Ala Glu Glu - = k _ . . :, ` 3 ~ ~

Leu Asp Lys Glu Met Gly Leu Ile Ile Arg G1n Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Asp Leu Ala Glu Cys Ala Leu Trp Met Pro Cys Gln Gly Gly Leu Thr Leu Gln Leu Ser His Asn Leu Asn Asn Leu Ile Pro Leu Gly Ser Thr Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Ile Phe Ser Ser Pro Glu Ala Ile G1n Ile Pro His Thr Asn Pro Leu Ala Arg Met Arg Asn Thr Val Gly Arg Tyr Ile Pro Pro Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Thr Asn Asp Trp Ala Glu Leu Ser Thr Arg Ser Tyr Ala Val Met Val Leu Val Leu Pro Met Asn Gly Leu Arg Lys Trp Arg Glu His Glu Leu Glu Leu Val G1n Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Asp Ser Met Arg Ala His Asp G1n Leu Met Glu Gin Asn Ile Ala Leu Asp Val Ala Arg Gin Glu Ala Glu Met Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His GluMet Arg Thr Pro Met His Ala Val Ile Ala Leu Cys Ser Leu Leu Leu Glu Thr Asp Leu Thr Pro Glu Gin Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ile Leu Glu Leu Glu Asn Gly Thr Phe Asn Leu His Gly Ile Leu Arg Glu Ala Val Asn Leu Ile Lys Pro Ile Ala Ser Leu Lys Lys Leu Ser Ile Thr Leu Ala Leu Ala Leu Asp Leu Pro Ile Leu Ala Vai Gly Asp Ala Lys Arg Leu Ile Gln Thr Leu Leu ~ q. . . . . . .

Asn Val Val Gly Asn Ala Val Lys Phe Thr Lys Glu Gly His Ile Ser Ile Glu Ala Ser Val Ala Lys Pro Glu Tyr Ala Arg Asp Cys His Pro Pro Glu Met Phe Pro Met Pro Ser Asp Gly Gin Phe Tyr Leu Arg Val Gln Val Arg Asp Thr Gly Cys Gly I1e Ser Pro Gin Asp Ile Pro Leu Val Phe Thr Lys Phe Ala Glu Ser Arg Pro Thr Ser Asn Arg Ser Thr Gly Gly Glu Gly Leu Gly Leu Ala I1e Trp Arg Arg Phe Ile Gin Leu Met Lys Gly Asn Ile Trp Ile Glu Ser Glu Gly Pro Gly Lys Gly Thr Thr Val Thr Phe Val Val Lys Leu Gly Ile Cys His His Pro Asn Ala Leu Pro Leu Leu Pro Met Pro Pro Arg Gly Arg Leu Asn Lys Gly Ser Asp Asp Leu Phe Arg Tyr Arg Gln Phe Arg Gly Asp Asp Gly Gly Met Ser Val Asn Ala Gln Arg Tyr Gln Arg Ser Met *

(2) INFORMATION FOR SEQ ID NO:37:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4566 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: join(763..1671, 3062..3433, 3572..3838, 3969 ..4096, 4234..4402) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:

TTA'PGTATTC TTGACTAGAG GAGTTTAATA AAAAGAAAAT AGAAAGGAAC AAAGAAACGT 360 ACATACATAA AGTGCATAAC ATAAAGATGA AATTCACAAT 'I'PGCTGGATC 'I"I'T"TC',GZGCA 540 AGGGAACTAT TTTTTACACT ATAAGTTAGC TGTTAATTTC AATA'I'TC'+GCT CTTCTACACC 600 TTAAATATAT TCAGGTTGTT TAACTCTTGT ACAGCTTGTT ATTCTTCTGA GGTCTATi'TC 720 Val Glu Ser Cys Asn Cys Ile Ile Asp Pro Gln Leu Pro Ala Asp Asp Leu Leu Met Lys Tyr Gin Tyr Ile Ser Asp Phe Phe Ile Ala Leu Ala Tyr Phe Ser Ile Pro Val Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val Phe Pro Tyr ArgTrp Val Leu Val Gin Phe Gly Ala Phe 11e Val Leu Cys Gly Ala ACC CAT CTT ATC AAC TTA TGG ACA Ti'T AAT ATG CAT ACA AGG AAT GTG 1014 Thr His Leu I1e Asn Leu Trp Thr Phe Asn Met His Thr Arg Asn Val GCA'ATA GTA ATG ACT ACT GCA AAG GCC TTG ACT GCA CTG GTG TCA TGT 1062 Ala Ile Val Met Thr Thr Ala Lys Ala Leu Thr Ala Leu Val Ser Cys Ile Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Lys Lys Ala Ala Gln Leu Asp Arg Glu Met Gly Ile Ile Arg Thr G1n Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu AAG ACT ACA CTT GTT GAG CTA GGA AGA ACA TTG GCA TTG GAA GAG TGT 1302.
Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Giu Leu Gln Leu Ser Tyr Thr Leu Arg His G1n Asn Pro Val Gly Leu Thr Val Pro Ile Gln Leu Pro Val Ile Asn Gln Val Phe Gly Thr Asn His Val Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Ala Gly Lys Tyr Met Pro GOT GAG GTG GTT GCT GTC AGG GTT CCA CTT CTG CAT CTG TCG AAC '1"1T 1542 Gly Glu Val Val Ala Va1 Arg Val Pro Leu Leu His Leu Ser Asn Phe CAG ATT AAT GAT TGG CCT GAA C'!T TCA ACA AAG CGC TAT GCT TTA ATG 1590 Gin Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gin Trp His Val His Glu CTG GAG CTT GTT GAA GTG GTA GCT GAT CAG GTT TGATZTM'GT TATTGAAAAT 1691 Leu Glu Leu Val Glu Val Val Ala Asp Gln Val TCCTTAATAT AATGTTAAAA TTTCTCTTI'T ATATATTTTT GGGTTGAACA CAACCACGTT 1751 AAGCTGAACT ATATGACTTT TTGCATACTT CGTCTGCTGA TTGCTTT'I'TG GTGATGGAAT 1991 AGAACTCTTG ACGTGTATGT AGTTrTCTTA GTACTTTTAT CATATGAAGT GAAAATAACG 2231 TCTTCAACGG AAGCCATTTA TTT'rIRTI'AC ATATCTGGCA TCTTACTTCT CCATCAAAGA 2351 CTTTAGAGAA CTTTAACTTT TTCATTC'IGT CTCTCGTAGT GTACTGTTCT CTGATGTATG 2411 TAATTAGCTC ACTGGCAAGT AGCACACCTA GTCTT'I'GTTT GACTTGTTTA AAAATCATGA 2471 GTAATCCTCA T'T'1'GTCCAGA CAGGCGACCA GCTATTATGC TTTCATTATG GGAAAAATTG 2771 TGGTCGGTGT CTGGTTGCAA CTAGTZ'TrAG ATGTTTATAT GTCTTATTTG ATTTAATAAG 3011 Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu G1n Asn Val Ala Leu Asp Leu Ala Arg Arg Glu Ala Glu Met Ala Val Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Ile Asp Leu Thr Pro Glu Gln Arg Leu Met Val Glu Thr Zle Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu G1n Leu Asp Ile Gly Thr Phe Asn Leu His Ala Leu Phe Arg Glu Val TT"II"TTACTT GCAAATTCTA GATTACCTGT CAGAAAAAAA GTGTCATTAC AGATATTT'I'G 3 513 Val His Ser Leu Ile Lys Pro Ile Ala Ser Val Lys Lys Ser Val Ala G1n Leu Ser Leu Ser Ser Asp Leu Pro Glu Tyr Val Ile Gly Asp Glu Lys Arg Leu Met Gln Ile Leu Leu Asn Val Val Gly Asn Ala Val Lys Phe Ser Lys Giu Gly Asn Val Ser Ile Ser Ala Phe Val Ala Lys Ser .~ ' e* *

Asp Ser Leu Arg Asp Pro Arg Ala Pro Glu Phe Phe AIa Val Pro Ser GAA AAT CAC TTC TAT ZTA CGG GTG CAG GTATATI'ZTI' ACAAGCTTGA 3858 Glu Asn His Phe Tyr Leu Arg Val Gln TATACTATCT TCGTAGGTTA AGGATAG'PCA CAAATATGAT AT'MTAGACT TATAACTGTC 3918 Ile Lys Asp Thr Gly Ile Gly Ile Thr Pro Gln Asp Ile Pro Asn Leu Phe Ser Lys Phe Thr Gln Ser Gin Ala Leu Ala Thr Thr Asn Ser Gly Gly Thr Gly Leu Gly Leu Ala Ile Cys Lys Arg GTGTTCTTTT TCCGACTCTG ATTTTCATTC TACGTGAACT TGGTAACTGC T'!'CATATTCA 4176 Phe Val Asn Leu Met Glu Gly His Ile Trp Ile Glu Ser Glu Gly Leu Gly Lys Gly Ser Thr Ala Ile Phe Ile Ile Lys Leu Gly Leu Pro Gly Arg Ala Asn Glu Ser Lys Leu Pro Phe Val Thr Lys Leu Pro Ala Asn His Thr Gin Met Ser Phe Lys Asp (2)INFORMATION FOR SEQ ID NO:38:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 615 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:

Val Glu Ser Cys Asn Cys Ile Ile Asp Pro Gln Leu Pro Ala Asp Asp Leu Leu Met Lys Tyr Gin Tyr Ile Ser Asp Phe Phe Ile Ala Leu Ala Tyr Phe Ser Ile Pro Val G1u Leu Ile Tyr Phe Val Lys Lys Ser Ala 35. 40 45 Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Asn Met His Thr Arg Asn Val Ala Ile Val Met Thr Thr Ala Lys Ala Leu Thr Ala Leu Val Ser Cys Ile Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Lys Lys Ala Ala Gln Leu Asp Arg Glu Met Gly Ile Ile Arg Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Leu Glu Leu Gln Leu Ser Tyr Thr Leu Arg His Gln Asn Pro Val Gly Leu Thr Val Pro Ile Gln Leu Pro Val Ile Asn Gln Vai Phe Gly Thr Asn His Val.
210 215 . 220 Val Lys Ile Ser Pro Asn Ser Pro Val Ala Arg Leu Arg Pro Ala Gly Lys Tyr Met Pro G1y Glu Va1 Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Val Val 290 295 = 300 Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg Asp Leu Leu Met Glu Gln Asn Val Ala Leu Asp Leu Ala Arg Arg = - CA 02380955 2002-05-07 =~ . . ~. . . . . i . ~
_ ~=

Glu Ala Glu Met Ala Val Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His G1u Met Arg Thr Pro Met His Ala Ile Ile Ala Leu Ser Ser Leu Leu Gln Glu Ile Asp Leu Thr Pro Glu Gin Arg Leu Met Val Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Asp Ile Gly Thr Phe Asn Leu His Ala Leu Phe Arg Glu Val Val His Ser Leu Ile Lys Pro Ile Ala Ser Val Lys Lys Ser Val Ala Gln Leu Ser Leu Ser Ser Asp Leu Pro Glu Tyr Val Ile Gly Asp Glu Lys Arg Leu Met Gin Ile Leu Leu Asn Val Val Gly Asn Ala Val Lys Phe Ser Lys Glu Gly Asn Val Ser Ile Ser Ala Phe Val Ala Lys Ser Asp Ser Leu Arg Asp Pro Arg Ala Pro Glu Phe Phe Ala Val Pro Ser Glu Asn His Phe Tyr Leu Arg Va1 G1n Ile Lys Asp Thr Gly Ile Gly Ile Thr Pro Gln Asp Ile Pro Asn Leu Phe Ser Lys Phe Thr G1n Ser Gln Ala Leu Ala Thr Thr Asn Ser Gly Gly Thr Gly Leu Gly Leu Ala Ile Cys Lys Arg Phe Val Asn Leu Met Glu Gly His Ile Trp Ile Glu Ser Glu Gly Leu Gly Lys Gly Ser Thr Ala Ile Phe Ile Ile Lys Leu Gly Leu Pro Gly Arg Aia Asn Glu Ser Lys Leu Pro Phe Val Thr Lys Leu Pro Ala Asn His Thr Gln Met Ser Phe Lys Asp (2)INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHc 737 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear CA 02380955 2002-05-07 =

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 33..719 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:

Ile Met Asp Cys Asn Cys Phe Asp Pro Leu Leu Pro Ala Asp Glu Leu Leu Met Lys Tyr Gin Tyr Ile Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile Pro Ile Glu Leu ValPhe Phe Val Gin Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu GTG CAG TTT GGT GCT TTC ATA GTT CTT TGT GGA.GCA ACA CAC CTT ATC 245 Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Ser Thr Pro His Thr Arg Thr Val Ala Met Val Met Thr Thr Ala Lys Phe Ser Thr Ala Ala Val Ser Cys Ala Thr Ala Val ATG CTT GTC GCA ATT ATT CCG GAT TTA T'TA AGT GTC AAA ACT AGG GAG 389 Met Leu Val Ala Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu-Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr G1n Glu G1u Thr Gly Arg Tyr Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu G1y Arg Ala Leu G1n Leu G1u Glu Cys Ala Leu Trp Met Pro Thr Arg Thr.GlyVal Olu Leu G1n Leu Ser Tyr Thr Leu His His Gin Asn Pro Val Gly Phe Thr Val Pro Ile Gin Leu Pro Val Ile Asn - i Gln Val Phe Ser Ala Asn Cys Ala Val Lys Ile Ser Pro (2) INFORMATION FOR SEQ ID NO:40:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 228 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:

Ile Met Asp Cys Asn Cys Phe Asp Pro Leu Leu Pro Ala Asp Glu Leu Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile Pro Ile Giu Leu Val Phe Phe Val Gln Lys Ser Ala Val Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Ser Thr Pro His Thr Arg Thr Va1 Ala Met Val Met Thr Thr Ala Lys Phe Ser Thr Ala Ala Val Ser Cys Ala Thr Ala Val Met Leu Val Ala Ile Ile Pro Asp Leu Leu Ser Va1 Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Glu Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg Tyr Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Ala Leu Gin Leu Glu Glu Cys Ala Leu Trp Met Pro Thr Arg Thr Gly Val Glu Leu Gln Leu Ser Tyr Thr Leu His His Gin Asn Pro Val Gly Phe Thr Val Pro Ile Gln Leu Pro Val Ile Asn Gin Val Phe Ser Ala Asn Cys Ala Val Lys Ile Ser Pro =- , (2) INFORMATION FOR SEQ ID NO:41:

( i ) SEQUENCE CIiAR.ACTERISTICS :
(A) LENGTH: 6202 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
( A ) NAME/ICEY : CDS
(B) LOCATION: jain(3522..5288, 5372..5926) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:

AGGCCCAATA TCATTTGGAG GTT!"i'GATTT"I' TGGGTTCGTA AATTTCAAGA GCCAGATTAT 360 AAATTAAAGA TTTTAATTGG GTGTAGTAGG CTGATTT'I'TT TATAAGAATC TTGTCTATAG 480 TGGTCAGAAC TATAAGGTAT GTTGT'TGTTC GCCTTGTTGC TAATGAAGAT TATAACATTC 600 TGTTGTTGCA TZTTTTTITT TTTTT'T"!`GTG TTAAATATAT ATATIT'M'T'I' TGCATATTTA 660 GATTCTTATC AAGTTT'I`GGA AAAT'ITTAAT GGAGATTCCT TGGTTGGGAA GAAGTATGAA 1020 TTCAAGAACC CATGTTCATG ACACATTTTG TTCATGTGTT GTTTAGATTG TCAGAGAT"TT 1320 ~

AATGTCTCTT GAGACTTTGT ACTCATTCTA TAGATAAAGA T=ATTTAT TACAAAAACA 1800 GATAGTACTA TCAATAAATA AAATAAATAT GTACAAAGGC TTTAAACAAT GATGTTTTI'C 2100 TTAAGGCGTT ATACATATCT TCTTTT'IGTA AATATTTGAC TAATTAAAAT ATCTAATTAG 2400 CCTTTACTTA CACCCTATAC ATACACTTCT CTTTZTATCC.TCCATCGGCG GCTTATGGCG 3060 GTTTTCCGGC ACTAATCATC TCCGGCATAT ATAAATAAAC GTACTTCACG TT'i"TTTTATA 3120 TAACTTCAAA GTAGTTTCAG ATTTGTCTCT ATCTCTTCAC TTTTAAGTCT TCTGGTTT'I'G 3180 TCATCACCAG CTTT"PTTTGT TCTCTCTCTG TCTCTGTCTC TGTCTTTCTC TTTGTGTATT 3240 TTTATTCTCG TCATCGTTGT TCTTCTATGA GAGGAAGATC GGAATGTCGA AGAGAATTAG 33.00 ` ;.. ; ,.t =

TTCATT'I"I'GA TCCAAACTCA TCTCTTTCAG GTATTCCAAA TTTGTCTTTC TCTGTTCTTT 3420 CTACTATTAC CCAAATTAAA GTTT'IATTT TTATTTCTCA CTCTGT'TTCT TGTTTPTCTA 3480 Met Val Lys Glu Ile Ala Ser Trp Leu Leu Ile Leu Ser Met Val Val Phe Val Ser Pro Val Leu Ala Ile Asn Gly Gly Gly Tyr Pro Arg Cys Asn Cys Glu Asp Glu Gly Asn Ser Phe Trp Ser Thr Glu Asn Ile Leu Glu Thr Gin Arg Val Ser Asp Phe Leu Ile Ala Va1 Ala Tyr Phe Ser Ile Pro Ile Glu Leu Leu Tyr Phe Val Ser Cys Ser Asn Val Pro Phe Lys Trp Val Leu Phe Glu Phe Ile Ala Phe Ile Val Leu Cys Gly Met Thr His Leu Leu His Gly Trp Thr Tyr Ser Ala His Pro Phe Arg Leu Met Met Ala Phe Thr Val Phe Lys Met Leu Thr Ala Leu Val Ser Cys Ala Thr Ala Ile Thr Leu Ile Thr Leu Ile Pro Leu Leu Leu Lys Val Lys Val Arg Glu Phe Met Leu Lys Lys Lys Ala His Olu Leu Gly Arg Glu Val Gly Leu Ile Leu Ile Lys Lys Glu Thr Gly Phe His Val Arg Met Leu Thr Gln GluIle Arg Lys Ser Leu Asp Arg His Thr Ile Leu Tyr Thr Thr Leu Va1 Glu Leu Ser Lys Thr Leu Gly Leu Gln Asn Cys Ala Val Trp Met , . ~ , ., `+ =

Pro Asn Asp Gly Gly Thr G1u Met Asp Leu Thr His Glu Leu Arg Gly Arg Gly Gly Tyr Gly Gly Cys Ser Val Ser Met Glu Asp Leu Asp Val Val Arg Ile Arg Glu Ser Asp Glu Val Asn Val Leu Ser Val Asp Ser 245 250 255. 260 Ser Ile Ala Arg Ala Ser Gly Gly Gly Gly Asp Val Ser Glu Ile Gly Ala Val Ala Ala Ile Arg Met Pro Met Leu Arg Val Ser Asp Phe Asn Gly Glu Leu Ser Tyr Ala Ile Leu Val Cys Val Leu Pro Gly Gly Thr CGT CGG GAT TGG ACT TAT CAG GAG ATT GAG ATT GTI'AAA.GTT GTG GCG 4493 Arg Arg Asp Trp Thr Tyr G1n Glu Ile Glu Ile Val Lys Val Val Ala Asp G1n Val Thr Val Ala Leu Asp His Ala Ala Val Leu Glu Glu Ser Gin Leu Met Arg Glu Lys Leu Ala Glu Gln Asn Arg Ala Leu Gln Met Ala Lys Arg Asp Ala Leu Arg Ala Ser G1n Ala Arg Asn Ala Phe Gln 360 . . 365 370 Lys Thr Met Ser Glu Gly Met Arg Arg Pro Met His Ser Ile Leu Gly CTT TTG TCG ATG ATT CAG GAC GAG AAG TTG AGT GAC GAG CAG AAA ATG . 4733 Leu Leu Ser Met Ile G1n Asp Glu Lys Leu Ser Asp Glu Gln Lys Met ATT GTT GAT ACG ATG GTT AAA ACA GGG AAT GT3''ATG TCG AAT TTG GTG 4781 IleVa1 Asp Thr Met Val Lys Thr Gly Asn Val Met Ser Asn Leu Val G1y Asp Ser Met Asp Val Pro Asp Gly Arg Phe Gly Thr Glu Met Lys Pro Phe Ser LeuHis Arg Thr Ile His Glu Ala Ala Cys Met Ala Arg Cys Leu Cys Leu Cys Asn Gly Ile Arg Phe Leu Val Asp Ala Glu Lys, = ~ h ; .
. <

Ser Leu Pro Asp Asn Val Val Gly Asp Glu Arg Arg Val Phe G1n Val Ile Leu His Met Val Gly Ser Leu Va1 Lys Pro Arg Lys Arg Ghn Glu Gly Ser Ser Leu Met Phe Lys Val Leu Lys Glu Arg Gly Ser Leu Asp Arg Ser Asp His Arg Trp Ala Ala Trp Arg Ser Pro Ala Ser Ser Ala Asp Gly Asp Va1 Tyr Ile Arg Phe Glu Met Asn Val Glu Asn Asp Asp Ser Ser Ser Gin Ser Phe Ala Ser Val Ser Ser Arg Asp Gln Glu Val Gly Asp Val Arg Phe Ser Gly Gly Tyr Gly Leu Gly G1n Asp Leu Ser 565_ 570 575 580 Phe Gly Val Cys Lys Lys Val Val Gln CTT'TCTAAAG TTCCTGTCAT TAGTCTGAGT TTCTGTTTAG GAGTTCTTTG ATAATGTGTG 5368 Leu Ile His Giy Asn Ile Ser Vai Vai Pro Gly Ser Asp Gly Ser CCG GAG ACC ATG TCG TTG CTC CTT CGG T'i'T CGA CGT AGA CCC TCC ATA 5464 Pro Clu Thr Met Ser Leu Leu Leu Arg Phe Arg Arg Arg Pro Ser Ile Ser Val His Giy Ser Ser Glu Ser Pro Ala Pro Asp His His Ala His Pro His Ser Asn Ser Leu Leu Arg Gly Leu Gin Val Leu Leu Val Asp Thr Asn Asp Ser Asn Arg Ala Val Thr Arg Lys Leu Leu Glu Lys Leu Gly Cys Asp VA1 Thr Ala Val Ser Ser Gly Phe Asp Cys Leu Thr Ala ATT GCT CCC GGC TCG TCC TCG CCT TCT ACT TCG TTT CAA GTG GTG'GTG 5704 Ile Ala Pro Gly Ser Ser Ser Pro Ser Thr Ser Phe Gin Val Val Val Leu Asp Leu Gln Met Ala Glu Met Asp Gly Tyr Glu Val Ala Met Arg Ile Arg Ser Arg Ser Trp Pro Leu Ile Val Ala Thr Thr Val Ser Leu Asp G1u Glu Met Trp Asp Lys Cys Ala Gin Ile Gly Ile Asn Gly Val Val Arg Lys Pro Val Val Leu Arg Ala Met Glu Ser Glu Leu Arg Arg GTA T'!'G TTG CAA GCT GAC CAA CTT CTC TAAGTTGTTA TCTCAACTTC 5943 Val Leu Leu Gln Ala Asp Gln Leu Leu GTTCTTTTTC TCATTTTGAA CCCCACGAAA TTGCATI'GAA TCTTAGTATT TCGTAGGGTC 6123 AAGAAGGAGT CAGTTTCGTA GT1wIT'I"3`GTT TTCTTTATGT TACGAACTTA CGAAACTGAA 6183 (2) INFORMATION FOR SEQ ID NO:42:

{i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 773 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:

Met Val Lys Glu Ile Ala Ser Trp Leu Leu Ile Leu Ser Met Val Val Phe Val Ser Pro Val Leu Ala Ile Asn Gly Gly Gly Tyr Pro Arg Cys Asn Cys Glu Asp Glu Gly Asn Ser Phe Trp Ser Thr Glu Asn Ile Leu Glu Thr Gln Arg Val Ser Asp Phe Leu Ile Ala Val Ala Tyr Phe Ser Ile Pro Ile Glu Leu Leu Tyr Phe Val Ser Cys Ser Asn Val Pro Phe Lys Trp Val Leu Phe Glu Phe Ile Ala Phe Ile Val Leu Cys Gly Met Thr His Leu Leu His Gly Trp Thr Tyr Ser Ala His Pro Phe Arg Leu Met Met Ala Phe Thr Val Phe Lys Met Leu Thr Ala Leu Val Ser Cys Ala Thr Ala Ile Thr Leu Ile Thr Leu Ile Pro Leu Leu Leu Lys Val Lys Val Arg Glu Phe Met Leu Lys Lys Lys Ala His Glu Leu G1y Arg Glu Val Gly Leu Ile Leu Ile Lys Lys Glu Thr Gly Phe His Val Arg Met Leu Thr Gln Giu Ile Arg Lys Ser Leu Asp Arg His Thr Ile Leu Tyr Thr Thr Leu Val Glu Leu Ser Lys Thr Leu Gly Leu Gin Asn Cys Ala Val Trp Met Pro Asn Asp Gly Gly Thr Glu Met Asp LeuThr His Glu Leu Arg Gly Arg Gly Gly Tyr Gly Gly Cys Ser Val Ser Met Glu Asp Leu Asp Val Val Arg Ile Arg Glu Ser Asp Glu Val Asn Val Leu Ser Val Asp Ser Ser Ile Ala Arg Ala Ser Gly Gly Gly Gly Asp Val Ser Glu Ile Gly Ala Val Ala Ala Ile Arg Met Pro Met Leu Arg Val Ser Asp Phe Asn Gly Glu Leu Ser Tyr Ala Ile Leu Val Cys Val Leu Pro Gly Gly Thr Arg Arg Asp Trp Thr Tyr Gln Glu Ile Glu Ile Val Lys Val Val Ala Asp Gin Val Thr Val Ala Leu Asp His Ala Ala Val Leu Giu Glu Ser Gln Leu Met Arg Glu Lys Leu Ala Glu Gin Asn Arg Ala Leu Gln Met Ala Lys Arg Asp Ala Leu Arg Ala Ser Gln Ala Arg Asn Ala Phe Gin Lys Thr Met Ser Glu Gly Met Arg Arg Pro Met His Ser Ile Leu Gly Leu Leu Ser Met Ile Gin Asp Glu Lys Leu Ser Asp Glu Gln Lys Met Ile Val Asp Thr Met Val Lys Thr Gly Asn Val Met Ser Asn Leu Val G1y Asp Ser Met Asp Val Pro Asp Gly Arg Phe Gly Thr Glu Met Lys Pro Phe Ser Leu His Arg Thr Ile His Glu Ala Ala Cys Met Ala Arg Cys Leu Cys Leu Cys Asn Gly Ile Arg Phe Leu Val Asp Ala Glu Lys Ser Leu Pro Asp Asn Val Val Gly Asp GluArg Arg Val Phe Gin Val Ile Leu His Met Val Gly Ser Leu Val Lys Pro Arg Lys Arg Gin Glu Gly Ser Ser Leu Met Phe Lys Val Leu Lys Glu Arg Gly Ser Leu Asp Arg Ser Asp His Arg Trp Ala Ala Trp Arg'Ser Pro Ala Ser Ser Ala Asp Gly Asp Val Tyr Ile Arg Phe Glu MetAsn Val Glu Asn Asp Asp Ser Ser Ser Gln Ser Phe Ala Ser Val Ser Ser Arg Asp Gln Glu Val Gly Asp Val Arg Phe Ser Gly G1y'Tyr GlyLeu Gly Gln Asp Leu Ser Phe Gly Val Cys Lys Lys Vai Val Gln Leu Ile His Gly Asn Ile Ser Vai Val Pro Gly Ser Asp Gly Ser Pro G1u Thr Met Ser Leu Leu Leu Arg Phe Arg Arg Arg Pro Ser Ile Ser Va1 His Gly Ser Ser Glu Ser Pro Ala Pro Asp His His Ala His Pro His Ser Asn Ser Leu Leu Arg Gly Leu Gln Val Leu Leu Val Asp Thr Asn Asp Ser Asn Arg Ala Val Thr Arg Lys Leu Leu Glu Lys Leu Gly Cys Asp Val Thr Ala Val Ser Ser Gly Phe Asp Cys Leu Thr Ala Ile Ala Pro Gly Ser Ser Ser Pro Ser Thr Ser Phe Gln Val Val Val Leu Asp Leu Gin Met Ala Glu Met Asp Gly Tyr Glu Val Ala Met Arg Ile Arg Ser Arg Ser Trp Pro Leu Ile Val Ala Thr Thr Val Ser Leu Asp:Glu Glu Met Trp Asp Lys Cys Ala-Gin Ile Gly Ile Asn Gly Val Val Arg Lys Pro Val Val Leu Arg Ala Met Glu Ser Glu Leu Arg Arg Val Leu Leu Gln Ala Asp Gin Leu Leu (2) INFORMATION FOR SEQ ID NO:43:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2404 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..2322 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:

Met Val Lys Glu Ile Ala Ser Trp Leu Leu Ile Leu Ser Met Val Val T'IT GTT TCT CCG GTT TTA GCT ATA AAC GGC GGT GGT TAT CCA CGA TGT 96 Phe Val Ser Pro Val Leu Ala Ile Asn Gly Gly Gly Tyr Pro Arg Cys Asn Cys Glu Asp Clu G1y Asn Ser Phe Trp Ser Thr Giu Asn Ile Leu Glu Thr Gln Arg Val Ser Asp Phe Leu Ile Ala Val Ala TyrPhe Ser Ile Pro Ile Glu Leu Leu Tyr Phe Val Ser Cys Ser Asn Val Pro Phe Lys Trp Val Leu Phe Glu Phe Ile Ala Phe Ile Val Leu Cys Gly Met Thr His Leu Leu His Gly Trp- ThrTyr Ser Ala His Pro Phe Arg Leu Met Met Ala Phe Thr Va1 Phe Lys Met Leu Thr Ala Leu Val Ser Cys Ala Thr Ala Ile Thr Leu Ile Thr Leu Ile Pro Leu Leu Leu Lys Val Lys Val Arg Glu Phe Met Leu Lys Lys Lys Ala His Glu Leu Gly Arg Glu Val Gly Leu Ile Leu Ile Lys Lys Glu Thr Gly Phe His Val Arg Met Leu Thr G1n Glu Ile Arg Lys Ser Leu Asp Arg His Thr Ile Leu , ~ * t =

Tyr Thr Thr Leu Val Glu Leu Ser Lys Thr Leu Gly Leu Gin Asn Cys Ala Val Trp Met Pro Asn Asp Gly Gly Thr Glu Met Asp Leu Thr His GAG ZTG AGA GGG AGA GGT GGT TAT GGT GGT 'i"GT TCT GTT TCT ATG GAG 720 Glu Leu Arg Gly Arg Gly Gly Tyr Gly Gly Cys Ser Val Ser Met Glu GAT T'PC' GAT GTT GTT AGO ATT AGG GAG AGT GAT GAA GTG AAT GTG TTG 768 Asp Leu Asp Val Val Arg Ile Arg Glu Ser Asp Glu Val Asn Val Leu Ser Val Asp Ser Ser Ile Ala Arg Ala Ser Gly Gly Gly Gly Asp Val Ser Glu Ile Gly Ala Val Ala Ala Ile Arg Met Pro Met Leu Arg Val Ser Asp Phe Asn Gly Glu Leu Ser Tyr Ala Ile Leu Val Cys Val Leu Pro Gly Gly Thr Arg Arg Asp Trp Thr Tyr Gln Glu Ile Glu Ile Val Lys Val Val Ala Asp Gln Val Thr Val Ala Leu Asp His Ala Ala Val CT'T GAA GAG TCT CAG CTT ATG AGG GAG AAG CTG GCG GAA CAG AAC AGG 1056 Leu Glu Glu Ser Gln Leu Met Arg Glu Lys Leu Ala Glu Gln Asn Arg GCG TTG CAG ATG GCG AAG AGA GAC GCG TI'G AGA GCG AGC CAA GCG AGG 1104 Ala Leu Gln Met Ala Lys Arg Asp Ala Leu Arg Ala Ser Gin Ala Arg Asn Ala Phe Gln Lys Thr Met Ser Glu Gly Met Arg Arg Pro Met His Ser Ile Leu Gly Leu Leu Ser Met Ile Gin Asp Glu Lys Leu Ser Asp Glu G1n Lys Met Ile Val Asp Thr Met Val Lys Thr Gly Asn Val Met TCG AAT TTG G'I'G GGG GAC TCT ATG GAT GTG CCT GAC GGT AGA TTT GGT 1296 Ser Asn Leu Val Gly Asp Ser Met Asp Val Pro Asp Gly Arg Phe Gly Thr Glu Met Lys Pro Phe Ser LeuHis Arg Thr Ile His Glu Ala Ala ~ s ~ =
<. ¾

Cys Met Ala Arg Cys Leu Cys Leu Cys Asn Gly Ile Arg Phe Leu Val Asp Ala Glu Lys Ser Leu Pro Asp Asn Val Val G1y Asp Glu Arg Arg Val Phe G1n Va1 Ile Leu His Met Val Gly Ser Leu Va1 Lys Pro Arg Lys Arg Gln Glu Gly Ser Ser Leu Met Phe Lys Va1 Leu Lys Glu Arg Gly Ser Leu Asp Arg Ser Asp His Arg Trp Ala Ala Trp Arg Ser Pro Ala Ser Ser Ala Asp Gly Asp Va1 Tyr Ile Arg Phe Glu Met Asn Val Glu Asn Asp Asp Ser Ser Ser G1n Ser Phe Ala Ser Val Ser Ser Arg Asp Gln Glu Val Gly Asp Val Arg Phe Ser G1y Gly Tyr Gly Leu Gly CAA GAT CTA AGC TIT GGT GTT TGT AAG AAA GTG GTG CAG T'I'G AT'r CAT 1776 Gin Asp Leu Ser Phe G1y Va1Cys Lys Lys Val Val Gln Leu Ile His Gly Asn Ile Ser Val Val Pro Gly Ser Asp Gly Ser Pro Glu Thr Met Ser Leu Leu Leu Arg Phe Arg Arg Arg Pro Ser Ile Ser Val His Gly Ser Ser Glu Ser Pro Ala Pro Asp His His Ala His Pro His Ser Asn Ser Leu Leu Arg Gly Leu G1n Va1 Leu Leu Va1 Asp Thr Asn Asp Ser Asn Arg Ala Val Thr Arg Lys Leu Leu Glu Lys Leu Gly Cys Asp Val Thr Ala Val Ser Ser Gly Phe Asp Cys Leu Thr Ala Ile Ala Pro Gly Ser Ser Ser Pro Ser Thr Ser Phe Gln Val Val Val Leu Asp Leu Gin ' .~

Met Ala Glu Met Asp Gly Tyr Glu Vai Ala Met Arg Ile Arg Ser Arg Ser Trp Pro Leu Ile Vai Ala Thr Thr Val Ser Leu Asp Glu Glu Met Trp Asp Lys Cys Ala G1n Ile Gly Ile Asn Gly Val Val Arg Lys Pro Val Val Leu Arg Ala Met Glu Ser Glu Leu Arg Arg Val Leu Leu Gln Ala Asp Gln Leu Leu (2) INFORMATION FOR SEQ ID N0:44:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 773 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:

Met Val Lys Glu Ile Ala Ser Trp Leu Leu Ile Leu Ser Met Val Val Phe Val Ser Pro Val Leu Ala Ile Asn Gly Gly Gly Tyr Pro Arg Cys Asn Cys Glu Asp Glu Gly Asn Ser Phe Trp Ser Thr Glu Asn Ile Leu Glu Thr Gin Arg Val Ser Asp Phe Leu Ile Ala Val Ala Tyr Phe Ser Ile Pro Ile Glu Leu Leu Tyr Phe Val Ser Cys Ser Asn Val Pro Phe Lys Trp Val Leu Phe Glu Phe Ile Ala Phe Ile Val Leu Cys Gly Met Thr His Leu Leu His Gly Trp Thr Tyr Ser Ala His Pro Phe Arg Leu Met Met Ala Phe Thr Val Phe Lys Met Leu Thr Ala Leu Val Ser Cys Ala Thr Ala Ile Thr Leu Ile Thr Leu Ile Pro Leu Leu Leu Lys Val Lys Val Arg Glu Phe Met Leu Lys Lys Lys Ala His Glu Leu Gly Arg " z CA 02380955 2002-05-07 +~ j = =

Glu Val Gly Leu Ile Leu Ile Lys Lys Glu Thr Gly Phe HisVal Arg Met Leu Thr Gln Glu Ile Arg Lys Ser Leu Asp Arg His Thr'Ile Leu Tyr Thr Thr Leu Val Giu Leu Ser Lys Thr Leu Gly Leu G1n Asn Cys Ala Val Trp Met Pro Asn Asp G1y Gly Thr Glu Met Asp Leu Thr His Giu Leu Arg Gly Arg .Gly Gly Tyr Gly Gly Cys Ser Val Ser Met Glu Asp Leu Asp Val Val Arg Ile Arg Glu Ser Asp Glu Val Asn Val Leu Ser Val Asp Ser Ser Ile Ala Arg Ala Ser Gly Gly Gly Gly Asp Val Ser Giu Ile Gly Ala Val Ala Ala Ile Arg Met Pro Met Leu Arg Val Ser Asp Phe Asn Gly Glu Leu Ser Tyr Ala Ile Leu Val Cys Val Leu Pro Gly G1y Thr Arg Arg Asp Trp Thr Tyr Gin Glu Ile G1u Ile Val Lys Vai Val Ala Asp G1n Va1 Thr Val Ala Leu Asp His Ala Ala Val Leu Glu Glu Ser Gln Leu Met Arg Glu Lys Leu Ala Glu Gln Asn Arg Ala Leu Gin Met Ala Lys Arg Asp Ala Leu Arg Ala Ser Gln Ala Arg Asn Ala Phe Gln Lys Thr Met Ser Glu Gly Met Arg Arg Pro Met His Ser Ile Leu Gly Leu Leu Ser Met Ile Gln Asp Glu Lys Leu Ser Asp Glu Gln Lys Met Ile Val Asp Thr Met Val Lys Thr Gly Asn Val Met Ser Asn Leu Val Gly Asp Ser Met Asp Val Pro Asp Gly Arg Phe Gly Thr Glu Met Lys Pro Phe Ser Leu His Arg Thr Ile His Glu Ala Ala Cys Met Ala Arg Cys Leu Cys Leu Cys Asn Gly Ile Arg Phe Leu Val Asp Ala Glu Lys Ser Leu Pro Asp Asn Val Val Gly Asp Glu Arg Arg Val Phe G1n Val Ile Leu His Met Va1 Gly Ser Leu Val Lys Pro Arg Lys Arg Gln Glu Gly Ser Ser Leu Met Phe Lys Val Leu Lys Glu Arg Gly Ser Leu Asp Arg Ser Asp His Arg Trp Ala Ala Trp Arg Ser Pro Ala Ser Ser Ala Asp Gly Asp Val Tyr Ile Arg Phe Glu Met Asn Val Glu Asn Asp Asp Ser Ser Ser Gln Ser Phe Ala Ser Val Ser Ser Arg Asp Gin Glu Val Gly Asp Val Arg Phe Ser Gly Gly Tyr Gly Leu Gly Gln Asp Leu Ser Phe Gly Val Cys Lys Lys Val Val Gln Leu Ile His Gly Asn Ile Ser Val Val Pro Gly Ser Asp Gly Ser Pro Glu Thr Met Ser Leu Leu Leu Arg Phe Arg Arg Arg Pro Ser Ile-Ser Val His Gly Ser Ser Glu Ser Pro Ala Pro Asp His His Ala His Pro His Ser Asn Ser Leu Leu Arg Gly Leu Gln Val Leu Leu Val Asp Thr Asn Asp Ser Asn Arg Ala Val Thr Arg Lys Leu Leu Glu Lys Leu Gly Cys Asp Val Thr Ala Val Ser Ser Gly Phe Asp Cys Leu Thr Ala Ile Ala Pro Gly Ser Ser Ser Pro Ser Thr Ser Phe Gln Val Val Val Leu Asp Leu Gln Met Ala Glu Met Asp Gly Tyr Glu Val Ala Met Arg Ile Arg Ser Arg Ser Trp Pro Leu Ile Val Ala Thr Thr Val Ser Leu Asp Glu Glu Met Trp Asp Lys Cys Ala Gln Ile Gly Ile Asn Gly Val Val Arg Lys Pro Val Val Leu Arg Ala Met Glu Ser G1u Leu Arg Arg Val Leu Leu Gln Ala Asp Gln Leu Leu (2) INFORMATION FOR SEQ ID NO:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3009 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: join(564..1469, 1565..1933, 2014..2280, 2359 ..2486, 2577..2748) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:

ATGTAACAAG TAGGCCTATA ACACGTGAAC TTCCCTCT'IT GCAAAAAAAA AATCATCAAA 120 AACZTTTACC TCTCATTGGT TTC7'1'CTITA TCACACTGTT ACGCTTGGAT TCTCATTTCT 180 Met Glu Ser Cys Asp Cys Phe G1u Thr His Val Asn Gln Asp Asp Leu Leu Val Lys Tyr Gln Tyr Ile Ser Asp Ala Leu Ile Ala Leu Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Gin Lys Ser Ala Phe Phe Pro Tyr Lys Trp Val Leu Met Gln Phe Gly Ala Phe Ile I1e Leu Cys Gly Ala Thr His Phe Ile Asn Leu Trp Met Phe Phe Met His Ser Lys Ala Val Ala Ile Val Met Thr Ile Ala Lys Val Ser Cys Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Va1 Lys Asn Arg G1u Leu Phe Leu Lys Lys Lys Ala Asp Glu Leu Asp Arg Glu Met Gly Leu Ile Leu . = ~ t, ,i.

Thr GTn Glu Glu Thr Gly Arg His Va1 Arg Met Leu Thr His Gly Ile Arg Arg Thr Leu Asp Arg His Thr Ile Leu Arg Thr Thr Leu Val Glu Leu Gly Lys Thr Leu Cys Leu Glu Glu Cys Ala Leu Trp Met Pro Ser CAA AGT GGT TTA TAT TTG CAG CTT TCT CAT ACT T'!'G AGT CAT AAA ATA 1166 G1n Ser Gly Leu Tyr Leu Gln Leu Ser His Thr Leu Ser His Lys Ile Gln Val Gly Ser Ser Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Leu Phe Asn Ser Ala Gln Ala Met His Ile Pro His Ser Cys Pro Leu Ala Lys Ile Gly Pro Pro Val Gly Arg Tyr Ser Pro Pro Giu Val Val Ser Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Gly Ser Asp Trp Ser Asp Leu Ser Gly Lys Gly Tyr Ala Ile Met Val Leu Ile Leu Pro Thr Asp Gly Ala Arg Lys Trp Arg Asp His Glu Leu Glu Leu Val Glu Asn Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met His Ala Arg Asp Gin Leu Met Glu Gin Asn Phe Ala Leu Asp Lys Ala Arg Gln Glu Ala G1u Met Ala Va1 His Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ser Leu Ser Ser - g-, CA 02380955 2002-05-07 Leu Leu Leu Glu Thr Glu Leu Ser Pro Glu G1n Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Val Ala Thr Leu Ile Ser Asp Val CTG GAT CTT TCG AGA T'TG GAA GAT GGG AGC TTA CTC TTG GAA AAT GAA 1903 Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Leu Leu Glu Asn Glu Pro Phe Ser Leu Gln Ala Ile Phe Glu Glu AACCACTGAA GTCCATTATA TATGTCTTAC ATGAATAACA'I'GGGCGCTTT GAATCTGCAG 2013 Val Ile Ser Leu Ile Lys Pro Ile Ala Ser Val Lys Lys Leu Ser Thr Asn Leu Ile Leu Ser Ala Asp Leu Pro Thr Tyr Ala Ile Gly Asp Glu Lys Arg Leu Met Gln Thr Ile Leu Asn Ile Met Gly Asn Ala Val Lys Phe Thr Lys Glu Gly Tyr Ile Ser Ile Ile Ala Ser Ile Met Lys Pro Glu Ser Leu G1n Glu Leu Pro Ser Pro Glu Phe Phe Pro Val Leu Ser Asp Ser His Phe Tyr Leu Cys Val Gln Val Lys Asp Thr Gly Cys Gly Ile His Thr Gln Asp Ile Pro Leu Leu Phe Thr Lys Phe Va1 Gln Pro Arg Thr Gly Thr G1n Arg Asn His Ser 535 540 5:45 Gly Gly Gly Leu Gly Leu Ala Leu Cys Lys Arg TGATGGATGT CTCTGGTTAG G T'!T GTC GGG CTA ATG GGA GGA TAC ATG TGG 2607 Phe Val Gdy Leu Met Gly Gly Tyr Met Trp Ile Glu Ser Glu Gly Leu Glu Lys Gly Cys Thr Ala Ser Phe Ile Ile Arg Leu Gly Iie Cys Asn Gly Pro Ser Ser Ser Ser Gly Ser Met Ala Leu His Leu Ala Ala Lys Ser GlnThr Arg Pro Trp Asn Trp AAATACATGA CCGGACGGTG TGATCTAACT TATTGGATTT TGTTC'~GATGT AATATGTAAA 2875 T!'ACTTTAGA GAATATGTTT TGGAATTCAC TACTAAATAA ACGATATAAA TCTTCACGAA 2995 AAGAGCAACA TT'IT 3009 (2) INFORMATION FOR SEQ ID NO:46:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 613 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:

Met Giu Ser Cys Asp Cys Phe Glu Thr His Val Asn G1n Asp Asp Leu Leu Val Lys Tyr Gln Tyr Ile Ser Asp Ala Leu Ile Ala Leu Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Gin Lys Ser Ala Phe Phe Pro Tyr Lys Trp Val Leu Met Gin Phe Gly Ala Phe Ile Ile Leu Cys Gly Ala Thr His Phe Ile Asn Leu Trp Met Phe Phe Met His Ser Lys Ala Val Ala Iie Val Met Thr Ile Ala Lys Val Ser Cys Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Asn Arg Glu Leu Phe Leu Lys Lys Lys Ala Asp Glu Leu Asp Arg Glu Met Gly Leu Ile Leu Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Gly Ile Arg Arg Thr Leu'Asp Arg His 4 s Thr Ile Leu Arg Thr Thr Leu Val Glu Leu Gly Lys Thr Leu Cys Leu Glu Glu Cys Ala Leu Trp Met Pro Ser Gin Ser Gly Leu Tyr Leu Gln Leu Ser His Thr Leu Ser His Lys Ile Gin Val Gly Ser Ser Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Leu Phe Asn Ser Ala Gln Ala Met His Ile Pro His Ser Cys Pro Leu Ala Lys I1e Gly Pro Pro Val Gly Arg Tyr Ser Pro Pro Glu Val Val Ser Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Gly Ser Asp Trp Ser Asp Leu Ser Gly Lys Gly Tyr Ala Ile Met Val Leu Ile Leu Pro Thr Asp Gly Ala Arg Lys Trp Arg Asp His Glu Leu Glu Leu Val Glu Asn Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met His Ala Arg Asp Gln Leu Met Glu Gin Asn Phe Ala Leu Asp Lys Ala Arg Gln Glu Ala Glu Met Ala Val His Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ser Leu Ser Ser Leu Leu Leu Glu Thr Glu Leu Ser Pro Glu G1n Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Val Ala Thr Leu Ile Ser Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Leu Leu Glu Asn Glu Pro Phe Ser Leu Gln Ala Ile Phe Glu Glu Val Ile Ser Leu Ile Lys Pro Ile Ala Ser Val Lys Lys Leu Ser Thr Asn Leu Ile Leu Ser Ala Asp Leu Pro Thr Tyr Ala Tle Gly Asp Glu Lys Arg Leu Met Gln Thr Ile Leu Asn Ile Met Gly Asn Ala Val Lys Phe Thr Lys Glu Gly Tyr Ile Ser Ile Ile Ala Ser Ile Met Lys Pro Glu Ser Leu G1n Giu Leu Pro Ser Pro Glu Phe Phe Pro Val Leu Ser Asp Ser His Phe Tyr Leu Cys Val Gln Val Lys Asp Thr Gly Cys Gly Ile His Thr Gln Asp Ile Pro Leu Leu Phe Thr Lys Phe Val Gln Pro Arg Thr Gly Thr Gln Arg Asn His Ser Gly Gly Gly Leu Gly Leu Ala Leu Cys Lys Arg Phe Val Gly Leu Met Gly Gly Tyr Met Trp Ile Glu Ser Glu Gly Leu Glu Lys Gly Cys Thr Ala Ser Phe Ile Ile Arg Leu Gly Ile Cys Asn Gly Pro Ser Ser Ser Ser Gly Ser Met Ala Leu HisLeu Ala Ala Lys Ser Gln Thr Arg Pro Trp Asn Trp (2) INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2314 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 224..2065 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:

TTCZ"TTTTIT CATCATTACC CAAAGCTATG AGGCTCACAC CACCAATACG TCCGCCGTCA 180 TGAATCCTTC TCT'I'CCAGGT CAACACAAGT CAGAGCTCCA AAA ATG GAG TCA TGC 235 Met Glu Ser Cys Asp Cys Phe Glu Thr His Val Asn G1n Asp Asp Leu Leu Val Lys Tyr Gin Tyr Ile Ser Asp Ala Leu Ile Ala Leu Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Gln Lys Ser Ala Phe Phe Pro Tyr Lys .. 1 Trp Va1 Leu Met Gin Phe Gly Ala Phe Ile Ile Leu Cys Gly Ala Thr His Phe Ile Asn Leu Trp Met Phe Phe Met His Ser Lys Ala Val Ala Ile Val Met Thr Ile Ala Lys Val Ser Cys Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His IleIle Pro Asp Leu Leu Ser Val Lys 105 . 110 115 Asn Arg Glu Leu Phe Leu Lys Lys Lys Ala Asp Glu Leu Asp Arg Glu Met Gly Leu Ile Leu Thr Gln Glu Glu Thr Gly Arg His Vai Arg Met Leu Thr His Gly Ile Arg Arg Thr Leu Asp Arg His Thr Ile Leu Arg Thr Thr Leu Val Glu Leu Gly Lys Thr Leu Cys Leu Glu Glu Cys Ala Leu Trp Met Pro Ser Gin Ser Gly Leu Tyr Leu Gin Leu Ser His Thr 185 190 . 195 Leu Ser His Lys Ile Gln Val Gly Ser Ser Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Leu Phe Asn Ser Ala Gin Ala.Met His Ile Pro His 215 . 220 225 Ser Cys Pro Leu Ala Lys Ile Gly Pro Pro Val Gly Arg Tyr Ser Pro Pro Glu Val Val Ser Val Arg Va1.Pro Leu Leu His Leu Ser Asn Phe Gln Gly SerAsp Trp Ser Asp Leu Ser Gly Lys Gly Tyr Ala Ile Met GTC CTG ATT CTC CCA ACC GAT GGT GCA AGA AAA TGG AGA.GAC CAT GAG 1099 Val Leu Ile Leu Pro Thr Asp Gly Ala Arg Lys Trp Arg Asp His Glu Leu Glu Leu Vai Glu Asn Val Ala Asp Gin Val Ala Val Ala Leu Ser ' -,- CA 02380955 2002-05-07 .= ;~ i His Ala Ala Ile Leu Glu Glu Ser Met His Ala Arg Asp Gin Leu Met Glu Gln Asn Phe Ala Leu Asp Lys Ala Arg Gln Glu Ala Glu Met Ala Val His Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg ACA CCG ATG CAT GCC ATC ATC TCT CTr TCT TCT CTT CTC CZT GAG ACT 1339 Thr Pro Met His Ala Ile:Ile Ser Leu Ser Ser Leu Leu Leu Glu Thr Glu Leu Ser Pro Glu Gin Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Val Ala Thr Leu Ile Ser Asp Val Leu Asp Leu 5er Arg Leu Glu Asp Gly Ser Leu Leu Leu Glu Asn Glu Pro Phe Ser Leu G1n Ala Ile Phe Glu Glu Val Ile Ser Leu Ile Lys Pro Ile Ala Ser Val Lys Lys Leu Ser Thr Asn Leu Ile Leu Ser Ala Asp Leu Pro Thr Tyr Ala Ile Gly Asp Glu Lys Arg Leu Met Gln Thr Ile Leu Asn Ile Met Gly Asn Ala Val Lys Phe Thr Lys Glu Gly Tyr Ile Ser Ile Ile Ala Ser Ile Met Lys Pro Glu Ser Leu Gin Glu Leu Pro Ser Pro Glu Phe Phe Pro Val Leu Ser Asp Ser His Phe Tyr Leu Cys Val Gln Val Lys GAC ACA GGG TGT GGA ATT CAC ACA CAA GAC AT'I' CCT TTG CTC TTT ACC 1819 Asp Thr Gly Cys Gly IleHis Thr Gin Asp Ile Pro Leu Leu Phe Thr 520 525 530 ' Lys Phe Val Gln Pro Arg Thr Gly Thr Gin Arg Asn His Ser Gly Gly Gly Leu Gly Leu Ala Leu Cys Lys Arg Phe Val G1y Leu Met Gly Gly ~ ~.. ,. ~ .

Tyr Met Trp Ile Glu Ser Glu Gly Leu Glu Lys Gly Cys Thr Ala Ser Phe Ile Ile Arg Leu Gly Ile Cys Asn Gly Pro Ser Ser Ser Ser Gly Ser Met Ala Leu His Leu Ala Ala Lys Ser Gin Thr Arg Pro Trp Asn TGG TGATACTTAC GTTGGAAAGA CTTGTATTGA GGTGAGACTT TT'PAACTACA 2112 Trp CAGCAGCAAG AGAAAGAAGA AAATACATGA CCGGACGGTG TGATCTAACT TATTGGATZ'T 2172 (2) INFORMATION FOR SEQ ID NO:48:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 613 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:

Met Glu Ser Cys Asp Cys Phe Glu Thr HisVal Asn Gln Asp Asp Leu Leu Val Lys Tyr Gln Tyr Iie Ser Asp Ala Leu Ile Ala Leu Ala Tyr Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Gln Lys Ser Ala Phe Phe Pro.Tyr Lys Trp Val Leu Met Gln Phe Gly Ala Phe Ile Ile Leu Cys Gly Ala Thr His Phe Ile Asn Leu Trp Met Phe Phe Met His Ser Lys Ala Val Ala Ile Vai Met Thr Ile Ala Lys Val Ser Cys Ala Val Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Asn Arg Glu Leu Phe Leu Lys Lys Lys Ala Asp Glu Leu Asp Arg Glu Met Gly Leu Ile Leu Thr Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Gly Ile Arg Arg Thr Leu Asp Arg His Thr Ile Leu Arg Thr Thr Leu Val Glu Leu Gly Lys Thr Leu Cys Leu Glu Glu Cys Ala Leu Trp Met Pro Ser Gin Ser Gly Leu Tyr Leu Gin Leu Ser His Thr Leu Ser His Lys Ile Gln Val Gly Ser Ser Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Leu Phe Asn Ser Ala Gin Ala Met His Ile Pro His Ser Cys Pro Leu Ala Lys Ile Gly Pro Pro Val Gly Arg Tyr Ser Pro Pro Glu Val Val Ser Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Gln Gly Ser Asp Trp Ser Asp Leu Ser Gly Lys Gly Tyr Ala Ile Met Val Leu Ile Leu Pro Thr Asp Gly Ala Arg Lys Trp .Arg Asp His Glu Leu Clu Leu Val Glu Asn Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met His Ala Arg Asp Gin Leu Met Glu Gln Asn Phe Ala Leu Asp Lys Ala Arg Gln Glu Ala Glu Met Ala Val His Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Ile Ile Ser Leu Ser Ser Leu Leu Leu Glu Thr Glu Leu Ser Pro Glu Gln Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn LeuVal Ala Thr Leu Ile Ser Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Leu Leu Glu Asn Glu Pro Phe Ser Leu Gin Ala Ile Phe Glu Glu Val Ile Ser Leu Ile Lys Pro Ile Ala Ser Val Lys Lys Leu Ser Thr Asn Leu Ile Leu Ser Ala Asp Leu Pro Thr Tyr Ala Ile GIy Asp Glu Lys Arg Leu Met Gln Thr Ile Leu Asn Ile Met Gly Asn Ala Va1 Lys Phe Thr Lys Glu Gly Tyr Ile Ser Ile Ile Ala Ser Ile Met Lys Pro Glu Ser Leu Gln G1u Leu Pro Ser Pro G1u Phe Phe Pro Val Leu Ser Asp Ser His Phe Tyr Leu Cys Val Gln Val Lys Asp Thr Gly Cys Gly Ile His Thr Gin Asp Ile Pro Leu Leu Phe Thr Lys Phe Val Gin Pro Arg Thr Gly Thr Gln Arg Asn His Ser Gly Gly Gly Leu Gly Leu Ala Leu Cys Lys Arg Phe Val Gly Leu Met Gly Gly Tyr Met Trp Ile Glu Ser Glu Gly Leu Glu Lys Gly Cys Thr Ala Ser Phe Ile Ile Arg Leu Gly Ile Cys Asn Gly Pro Ser Ser Ser Ser Gly Ser Met Ala Leu His Leu Ala Ala Lys Ser Gln Thr Arg Pro Trp Asn Trp (2) INFORMATION FOR SEQ ID N0:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2405 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAMEIKEY: CDS
(B) LOCA`I`I ON : 2 8 8.. 219 6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:

TTT'IITZ"I'TT GTCAAAAGCT CGATGTAAAA ATCCGATGGC CACAAGCAAA ACGACAGGZT 60 TCGCATTCTC CGGCGTCGTT TTTCACATCG AAATAGTCGT GTAAAAAAAT GAAAAP,ATTG 180 CTCGAAAGTT ACTAAAAATT TTI'GATTCTT TGGGACGAAA CGAGATA ATG GAA TCC 296 Met Glu Ser Cys Asp Cys Ile Glu Ala Leu Leu Pro Thr Gly Asp Leu Leu Va1 Lys 10 . 15 TAC CAA TAC CTC TCA GAT TTC TTC ATT GCT GTA GCC TAC TT"F TCC ATT 392 Tyr Gin Tyr Leu Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile = CA 02380955 2002-05-07 - = i,_ i j . .
= ~ ~ ` ~

\=

Leu Leu Glu Leu Ile Tyr Phe Val His Lys Ser Ala Cys Phe Pro Tyr Arg Trp Val Leu Met Gin Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Phe Ile Ser Leu Trp Thr Phe Phe Met His Ser Lys Thr Val Ala Val Val Met Thr Ile Ser Lys Met Leu Thr Ala Ala Val ser Cys Ile Thr Ala Leu. Met Leu Val His Iie Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Thr Arg Ala Glu Glu Leu Asp Lys Glu Met G1y Leu Ile Ile Arg Gln Glu Glu Thr Gly Arg His Val Arg ATG CTG ACT CAT GAG ATA AGA AGC ACA CTC GAC AGA CAC ACA ATC T'FG 776 Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val G1u Leu Gly Arg Thr Leu Asp Leu Ala Glu Cys Ala Leu Trp Met Pro Cys G1n Gly Gly Leu Thr Leu Gln Leu Ser His Asn Leu Asn Asn Leu Ile Pro Leu Gly Ser Thr Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Ile Phe Ser Ser Pro Glu Ala Ile Gln Ile Pro His Thr Asn Pro Leu Ala Arg Met Arg Asn Thr Va1 Gly Arg Tyr Ile Pro Pro Glu Val Val Ala Val Arg Vai Pro Leu Leu His Leu Ser Asn Phe Thr Asn Asp Trp Ala Glu Leu Ser Thr Arg Ser Tyr Ala Val Met Val Leu Val Leu Pro Met Asn Giy Leu Arg Lys Trp Arg Glu His Glu 280 285 = 290 Leu Glu Leu Val Gln Val Va1 Ala Asp Gln Val Ala Val AlaLeu Ser His Ala Ala Ile Leu Glu Asp Ser Met Arg Ala His Asp Gin Leu Met 310 .315 320 GAA CAG AAT ATT GCT T'PG GAT GTA GCT CGA CAA GAA GCA GAG ATG GCC 13 04 Glu Gin Asn Ile Ala Leu Asp Val Ala Arg Gln Glu Ala Glu Met Ala ATC CGT GCA CGT AAC GAC TTC' CTT GCT GTG ATG AAC CAT GAA AZG AGA 1352 Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg ACG CCC ATG CAT GCA GTT ATT`GCT CTG TGC TCT CTG CTT TTA GAA ACA 1400 Thr Pro Met His Ala Val Ile Ala Leu Cys Ser Leu Leu Leu Glu Thr Asp Leu Thr Pro Glu Gin Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu Asp Leu Ser Arg CTT GAA GAT GGT ATT CTT GAA. CTA GAA AAC GGA ACA TTC AAT CT'T CAT 1544 Leu Glu Asp Gly I1e Leu Glu Leu Glu Asn Gly Thr Phe Asn Leu His GGC ATC TTA AGA GAG GCC GTTAAT TTG ATA AAG CCA ATT GCA TCT T'I'G 1592 Gly Ile Leu Arg Glu Ala Val Asn Leu Ile Lys Pro Ile Ala Ser Leu Lys Lys Leu Ser Ile Thr Leu Ala Leu Ala Leu Asp Leu Pro Ile Leu Ala Val Gly Asp Ala Lys Arg Leu Iie Gln Thr Leu Leu Asn Val Val Gly Asn Ala Val Lys Phe ThrLys Glu Gly His Ile Ser Ile Glu Ala Ser Val Ala Lys Pro Glu Zyr Ala Arg Asp Cys His Pro Pro Glu Met Phe Pro Met Pro Ser AspGly G1n Phe Tyr Leu Arg Val G1n Va1 Arg Asp Thr Gly Cys Gly Ile Ser Pro Gin Asp Ile Pro Leu Val Phe Thr Lys Phe Ala Glu Ser Arg Pro Thr Ser Asn Arg Ser Thr Gly Gly Glu ~

Gly Leu Gly Leu Ala Ile Trp Arg Arg Phe Ile Gln Leu Met Lys Gly Asn Ile Trp Ile Glu Ser Glu Gly Pro Gly Lys Gly Thr Thr Val Thr Phe Val Val Lys Leu Gly Ile Cys His His Pro Asn Ala Leu Pro Leu Leu Pro Met Pro Pro Arg G1y,Arg Leu Asn Lys Gly Ser Asp Asp Leu Phe Arg Tyr Arg Gin Phe Arg Gly Asp Asp Gly Gly Met Ser Val Asn Ala Gln Arg Tyr Gln Arg Ser Met *

GTATCT'i'GAA AATGTAACTA TCGAATTTAT ACATCGAGCT TTTGACAAAA AAAAAAAAAA 2396 (2) INFORMATION FOR SEQ ID NO:50:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 636 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:

Met Glu Ser Cys As.p Cys Ile Glu Ala Leu Leu Pro Thr Gly Asp Leu Leu Va1 Lys Tyr Gin Tyr Leu Ser Asp Phe Phe Ile Ala Val Ala Tyr Phe Ser Ile Leu Leu Glu Leu Ile Tyr Phe Val His Lys Ser Ala Cys Phe Pro Tyr Arg Trp Val Leu Met Gin Phe Gly Ala Phe Ile Val Leu Cys Gly Ala Thr His Phe Ile Ser Leu Trp Thr Phe Phe Met His Ser Lys Thr Val Ala Val Val Met Thr Ile Ser Lys Met Leu Thr Ala Ala Val Ser Cys Ile Thr Ala Leu Met Leu Val His Ile Ile Pro Asp Leu Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Thr Arg Ala GIu Glu Leu Asp Lys Glu Met Gly Leu Ile Ile Arg Gln Glu Glu Thr Gly Arg His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His Thr Ile Leu Lys Thr Thr Leu Val G1u Leu Gly Arg Thr Leu Asp Leu Ala Glu Cys Ala Leu Trp Met Pro Cys Gin Gly G1y Leu Thr Leu Gln Leu Ser His Asn Leu Asn Asn Leu Ile Pro Leu Gly Ser Thr Val Pro Ile Asn Leu Pro Ile Ile Asn Glu Ile Phe Ser Ser Pro Glu Ala Ile Gln Ile Pro His Thr Asn Pro Leu Ala Arg Met Arg Asn Thr Val Gly Arg Tyr Ile Pro Pro Glu Val Val Ala Val Arg Val Pro Leu Leu His Leu Ser Asn Phe Thr Asn AspTrp Ala Glu Leu Ser Thr Arg Ser Tyr Ala Val Met Val Leu Val Leu Pro Met Asn Gly Leu Arg Lys Trp Arg Glu His Glu Leu Glu Leu Va3 Gln Val Val Ala Asp Gln Val Ala Val Ala Leu Ser His Ala Ala IleLeu Glu Asp Ser Met Arg Ala His Asp Gln Leu Met G1u Gin Asn Ile Ala Leu Asp Val Ala Arg Gln Glu Ala Glu Met Ala Ile Arg Ala Arg Asn Asp Phe Leu Ala Val Met Asn His Glu Met Arg Thr Pro Met His Ala Val Ile Ala Leu Cys Ser Leu Leu Leu Glu Thr Asp Leu Thr Pro Glu Gin Arg Val Met Ile Glu Thr Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu Asp Leu Ser Arg Leu Glu Asp Gly Ile Leu Glu Leu Glu Asn Gly Thr Phe Asn Leu His Gly Ile Leu Arg Glu Ala Val Asn Leu Ile Lys Pro Ile Ala Ser Leu Lys Lys Leu Ser Ile Thr Leu Ala Leu Ala Leu Asp Leu Pro Ile Leu Ala Va1 Gly Asp Ala Lys Arg Leu Ile G1n Thr Leu Leu Asn Val Val Gly Asn Ala Val Lys Phe Thr Lys Glu Gly His Ile Ser Ile Glu Ala Ser Val Ala Lys Pro Glu Tyr Ala Arg Asp Cys His Pro Pro Glu Met Phe Pro Met Pro`Ser Asp Gly Gln Phe Zyr Leu Arg Val Gin Va1 Arg Asp Thr Gly Cys Gly Ile Ser Pro Gin Asp Ile Pro Leu Val Phe Thr Lys Phe Ala GluSer Arg Pro Thr Ser Asn Arg Ser Thr Gly Gly Glu Gly Leu Gly Leu Ala Ile Trp Arg Arg Phe Ile Gln Leu Met Lys Gly Asn Ile Trp Ile Glu Ser Glu Gly Pro Gly Lys G1y Thr Thr Val Thr Phe Val Val Lys Leu Gly Ile Cys His His Pro Asn Ala Leu Pro Leu Leu Pro Met Pro Pro Arg Gly Arg Leu Asn Lys Gly Ser Asp Asp Leu Phe Arg Tyr Arg G1n Phe Arg Gly Asp Asp Gly Gly Met Ser Val Asn Ala Gln Arg Tyr Gin Arg Ser Met *

Claims (13)

1. A plant cell transformed with a modified ethylene response (ETR) nucleic acid and having a phenotype characterized by a decrease in the response to ethylene as compared to a corresponding wild-type plant cell, wherein said modified ETR nucleic acid comprises a precursor ETR nucleic acid that encodes a precursor ETR
protein, wherein said precursor ETR nucleic acid has been substituted at one or more nucleotides which results in the substitution of one or more selected amino acid residues in said precursor ETR protein with a different amino acid, said selected amino acid residue being equivalent to an amino acid residue selected from the group consisting of Ala-31, Ile-62, Cys-65 and Ala-102 in the ETR protein from Abrabidopsis thaliana as set forth in SEQ ID NO: 3.

2. A plant cell according to claim 1 wherein a tissue-specific promoter is operably linked to said modified ETR nucleic acid.

3. A plant cell according to claim 2 wherein said promoter is a fruit-specific promoter.

4. A plant cell according to claim 3 wherein said decrease in the response to ethylene is characterized by a decrease in fruit ripening of a plant comprising said plant cell.

5. The plant cell according to claim 4 wherein said plant cell is a fruit cell.

6. The plant cell according to claim 5 wherein said fruit is tomato.

7. A plant cell comprising a recombinant nucleic acid, said recombinant nucleic acid comprising a promoter operably linked to a modified plant ethylene response (ETR) nucleic acid, wherein said modified ETR nucleic acid contains the substitution of one or more nucleotides of a precursor ETR nucleic acid which results in the substitution of one or more selected amino acid residues in a precursor ETR protein with a different amino acid, said selected amino acid residue being equivalent to an amino acid residue selected from the group consisting of Ala-31, Ile-62, Cys-65 and Ala-102 in the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3 and wherein said promoter is heterologous to said precursor ETR nucleic acid and capable of causing expression of said modified ETR
nucleic acid in said plant cell.

8. A plant cell comprising a recombinant nucleic acid, said recombinant nucleic acid comprising a promoter operably linked to a modified plant ethylene response (ETR) nucleic acid, wherein said modified plant ETR nucleic acid comprises a precursor ETR nucleic acid which has been modified to encode a modified ETR protein comprising the substitution, insertion or deletion of an amino acid residue in the N-terminal 316 amino acids of a precursor ETR protein encoded by said precursor ETR nucleic acid, wherein said precursor ETR protein has at least 75% identity to the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3, and at least 75% identity to the N-terminal 316 amino acid of said ETR protein sequence of Arabidopsis thaliana, wherein the expression of said ETR protein encoded by said ETR nucleic acid in said plant cell results in an increased or decreased response to ethylene by said plant cell.

9. The plant cell according to claim 8, wherein said modified ETR protein comprises the substitution of a selected amino acid residue in said precursor ETR protein with a different amino acid and wherein said selected amino acid residue in said precursor ETR protein is equivalent to an amino acid residue selected from the group consisting of Ala-31, Pro-36, Ile-62, Cys-65 and Ala-102 in the ETR protein sequence of Arabidopsis thaliana as set forth in SEQ ID NO: 3.

10. The plant cell according to claim 8, wherein said promoter is heterologous to said modified ETR nucleic acid and causes expression of said modified ETR nucleic acid in a plant cell, wherein the expression of an ETR protein encoded by said ETR nucleic acid in a plant cell results in an increased or decreased response to ethylene by said cell.

11. The plant cell according to claim 10, wherein said promoter is a tissue-specific or temporal-specific promoter.

12. The plant cell according to claim 10, wherein said promoter is inducible.

13. A plant cell comprising a recombinant nucleic acid comprising a promoter operably linked to an ETR nucleic acid that encodes an ethylene response (ETR) protein, wherein said ETR nucleic acid hybridizes with a probe having a nucleic acid sequence complementary to the sequence represented in SEQ ID NO: 2 at hybridization conditions of 50°C in 5xSSPE and washing conditions of 50°C in 0.2xSSPE, wherein the expression of an ETR protein encoded by said recombinant nucleic acid in a plant cell results in an increased or decreased response to ethylene by said cell.