CA2379608A1 - Cancer treatments and diagnostics utilizing rad51 related molecules and methods - Google Patents

Abstract

Described herein are methods of treating, diagnosing and prognosing cancer, sensitizing a patient for treatment for cancer, providing predictive outcome s for treatments for cancer and methods of inducing apoptosis. Compositions, agents and kits are also provided.

Description

CANCER TREATMENTS AND DIAGNOSTICS

FIELD OF THE INVENTION
The invention relates to compositions and methods for diagnosing, prognosing and treating cancer which generally utilize Rad51 inhibitors and Rad51 expression detectors.
BACKGROUND OF THE INVENTION
Breast cancer is the most frequent malignancy, affecting women in Western industrialized countries.
Germline mutations in the coding sequences of the tumor suppressor genes BRCA1 and BRCA2 are responsible for more than 65% of familial forms of breast cancer whereas mutations in these genes are rare in sporadic cases (Feunteun, J., Mol. Med. Today 4:263-270 (1998).
However, BRCA1 function is also lost in sporadic breast cancer due to down-regulation of BRCA1 protein levels in tumor cells (Yoshikawa, K., et al., clin. Canc. Res. 5:1249-1261 (1999); Wilson, C.A., et al., Nat. Genet.
21:236-240 (1999); Dobrovic, A. and Simpfendorfer, D., Canc. Res. 57:3347-3350 (1997; Mancini, D.N., et al., Oncogene 16:1161-1169 (1998)). BRCA1 is directly involved in pathways that respond to DNA damage (Zhang, H., et al., Cell 92:433-436 (1998)). The polypeptide is part of a multi protein complex, which also contains Rad51 (Scully, R., et al., Cell 88:265-275 (1997)), a key enzyme of homologous recombination and the repair of DNA double strand breaks (Feunteun, J., Mol. Med.
Today 4:263-270 (1998); Baumann, P. and West, S.C., Trends Biochem. Sci.
23:247-251 (1998)).
Regarding treating cancer, the capability of tumor cells to become resistant towards chemo- and/or radiotherapy is regarded as one of the major problems that hinder the efficiency of most established therapeutic regimes to treat advanced stages of solid tumors. These critical aspects of the malignant phenotype of cancer cells are mimicked more reliably by three-dimensional (3D) cell systems than by classical monolayer cell cultures (for review, see Mueller-Klieser, W., Am. J.
Physiol. 273:C1109-1123 (1997); Kunz-Schughart, L.A., et al., Int. J. Exp. Path. 79:1-23 (1998)). 3-D
growth enhances the metastatic potential of different human tumor cell lines (Raz, A and Ben-e'ev, A., Science 221:1307-1310 (1983)) and augments the level of radio- and chemoresistance compared to the same cells grown as monolayers (Mueller-Klieser, W., Am. J. Physiol. 273:C1109-1123 (1997)). Permanent genetic alterations alone cannot be responsible for the increase in chemoresistance in 3D-culture compared to monolayers, since this phenotype is lost after only a few cell doublings as monolayers (Luo, C., et al., Exp. Cell Res. 243:282-289 (1998)). Recently, up-regulations of P-glycoprotein in tumor cells grown as spheroids, has been described (Wartenberg, M., et al., Int. J. Cancer 75:855-863 (1998)). However, it appears that classical resistance genes are not alone responsible for the development of chemoresistance in 3D cultures (Desoize, B., et al., AnticancerRes. 18:4147-4158 (1998)).
Regarding DNA repair mechanisms, homologous recombination is one of the mechanisms involved in the repair of DNA double strand breaks. One of the key-factors catalyzing these processes is the product of the rad51 gene. Induced disruption of the rad51 gene in chicken cells leads to cell death accompanied by the accumulation of DNA double-strand breaks (Sonoda, E., et al., EMBO J., 17:598-608 (1998)). Elevated expression of Rad51 enhances radioresistance of human tumor cells (Yanagisawa, T., et al., Oral Oncol. 334:524-528 (1998); Vispe, S., et al., Nucl. Acids Res. 26:2859-2864 (1998)). Treatment of monolayer cultures of tumor cells with Rad51 specific anti-sense oligonucleotides renders them radiosensitive (Ohnishi, t., et al., Biochem.
Biophys. Res. Commun.
245:319-324 (1998)).
Homologous recombination of DNA is one of the driving forces of genetic variety and evolution, but on the other hand, the same mechanism guarantees maintenance of genomic stability by participation in the repair of DNA double strand breaks. The product of the recA gene is known as one of the key factors, catalyzing homologous recombination processes in prokaryotes like Escherichia coli. In eukaryotes, members of the Rad51 family of proteins share remarkable structural and functional homology with E. coli RecA. In bacteria and yeast, RecA/Rad51 deficiency leads to a drop in recombination rate and high sensitivity to y-irradiation without affecting overall cell survival. By contrast, mouse embryos lacking functional Rad51 die early in development just prior to gastrulation and efforts to establish Rad51 deficient mammalian cell lines have failed (Lim, D.S. & Hasty, P., Mol Cell Biol 16:7133-43 (1996); Tsuzuki, T., et al., Proc Natl Acad Sci USA
93:6236-40 (1996)).

Conditionally Rad51 deficient chicken cells accumulate double strand breaks prior to cell death (Sonoda, E., et al., Embo J 17:598-608 (1998)). These results indicate that, in contrast to bacteria and yeast, Rad51 is essential for cell survival in vertebrates and might be involved in maintaining cellular homeostasis.
Rad51 physically interacts with several tumor suppressors like the BRCA-1 (Scully, R., et al., Cell 88:265-75 (1997b)) and BRCA-2 (Sharan, S.K., et al., Nature 386:804-10 (1997)), polypeptides defective in hereditary forms of breast and ovarian cancer. Mouse embryos lacking functional BRCA1 or BRCA2 display a similar phenotype as Rad51 deficient mouse embryos (Hakem, R., et al., Cell 85:1009-23 (1996); Suzuki, A., et al., Genes Dev 11:1242-52 (1997); Chen, J.J., et al., Mol Cel12:317-28 (1998); Chen, J.J., et al., Cancer Res 59:1752s-1756s (1999b)). Moreover, it has been observed that BRCA1 and BRCA2 nullizygous embryos show activation of the cell cycle inhibitor p21 Wa"
(Hakem, R., et al., Cell 85:1009-23 (1996); Suzuki, A., et al., Genes Dev 11:1242-52 (1997)).
Classically, the tumor suppressor p53 is the most prominent regulator of p21'"a" expression. p53 maintains genomic stability by controlling for DNA integrity and, as appropriate, responds with halting the cell cycle or by inducing cell death by apoptosis (for review see, (Janus, F., et al., Cell Mol Life Sci 55:12-27 (1999)). p53 also forms protein complexes with Rad51 and suppresses biochemical activities of the bacterial homologue RecA in vitro (Sturzbecher, H.W., et al., Embo J 15:1992-2002 (1996). Cells lacking functional p53 develop genomic instability and exhibit elevated rates of homologous recombination (Bertrand, P., et al., Oncogene 14:1117-22 (1997);
Mekeel, K.L., et al., Oncogene 14:1847-57 (1997)), suggesting a control function of p53 for processes of homologous recombination.
Described herein are methods and compositions which address the diagnosis, prognosis, predictive outcome of therapies and treatment of cancer and which utilize compositions and pathways related to Rad51.
SUMMARY OF THE INVENTION
In accordance with the objects outlined above, the present invention provides a number of methods of diagnosis and prognosis, predictive outcome methods and methods of treating cancer. Methods of inhibiting and inducing apoptosis are also provided.

In one aspect of the invention, a method of diagnosing an individual for cancer is provided. In one embodiment, the method comprises determining the level of Rad51 expression in a sample from an individual; and comparing said level to a control level wherein a change from said control indicates cancer. The sample is preferably a tissue sample or cells which have been cultured in spheroids.
Various cancers can be diagnosed by said method, including but not limited to breast cancer, brain cancer, pancreatic cancer, prostate cancer, colon cancer, lymphoma, and skin cancer.
Rad51 expression can be determined by the level of Rad51 protein or nucleic acid, protein being preferred. In one embodiment, the level is determined through the use of polyclonal antibodies.
Preferably, the level is determined through the use of monoclonal antibodies.
In one embodiment, said antibodies are raised against eukaryotic Rad51, preferably, mammalian Rad51. Alternatively, the Rad51 expression is determined by the level of Rad51 nucleic acid.
In another aspect of the invention, a method of prognosing an individual for cancer is provided. In one embodiment the method comprises determining the level of Rad51 expression in a sample from an individual; and comparing said level to a control which indicates the severity of cancer so as to provide a prognosis. Generally, the higher level of Rad51 expression in said individual the less time the patient has to live without treatment.
Also provided herein is a method for identifying a cancer cell in a primary tissue sample. In one embodiment, the method comprises determining the level of Rad51 in a primary tissue sample of interest; and comparing said level of Rad51 to a non-cancer tissue sample, wherein a difference in said level indicates a cancer cell is in the tissue sample of interest.
In yet another aspect of the invention, a kit for detecting a normal or abnormal level of Rad51 expression in a tissue sample is provided. The kit comprises a binding agent for detecting Rad51, a detectable label; and a control which indicates a normal level of Rad51 expression or Rad51 expression at various severities of cancer.
Also provided herein is a method for treating an individual with cancer, comprising inhibiting Rad51 activity in said individual. Preferably, a Rad51 inhibitor is administered to said individual in an amount effective to inhibit cancer in said individual.
In one embodiment, Rad51 or a Rad51 inhibitor is administered to a cell which comprises dysfunctional p53. As shown herein, there is not a requirement that p53 be present for the methods provided herein. Therefore, in one embodiment, p53 is excluded from administration in conjuction with a Rad51 inhibitor.
Also provided herein is a method for inducing sensitivity to radiation and DNA
damaging chemotherapeutics in an individual with cancer comprising administering inhibiting Rad51 activity in said individual. In one embodiment, a composition comprising a Rad51 inhibitor is administered to said individual in an amount effective to induce said sensitivity.
In yet another aspect of the invention, a method of inducing apoptosis in a cell is provided which comprises administering a Rad51 inhibitor to said cell. In one embodiment, the cell is a cancer cell.
Also provided herein is a method of determining a predictive outcome of a treatment for cancer.
Predictive outcome as used herein is a term which indicates whether or not a treatment will be effective for a certain condition. In one embodiment, the method comprises determining the level of Rad51 expression in a tissue sample of a patient and correlating said level with a control which indicates the resistance a patient will have to chemotherapy or radiation treatments. The greater the level of Rad51, generally the greater resistance the patient will have.
Moreover, also provided herein is a method of inhibiting apoptosis in a cell comprising inducing overexpression of Rad51 in a cell. Overexpression means more expression than would be found in a normal unaffected cell. Inducing overexpression can be by a variety of ways including administering Rad51 protein, Rad51 nucleic acid or by indirectly stimulating Rad51 expression. Preferably, inducing is by administration of a Rad51 nucleic acid. In one embodiment, a nuclear localization signal is joined to said nucleic acid.
Also provided herein is a method of enhancing survival of a cell comprising inducing overexpression of Rad51 in a cell.
Furthermore, a method of screening for agents which modulate Rad51 expression is provided. In one embodiment, the method comprises culturing cells in spheroids and adding a candidate agent to said spheroids and determining Rad51 expression levels before and after adding said candidate agent, wherein a change indicates said candidate agent modulates Rad51 expression.
Preferably, the agent inhibits expression. The spheroids can also be used to determine effective treatments. Moreover, the spheroids can be used to identify agents which modulate Rad51 activity.

BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1F show comparison by Rad51 and p53 expression levels in monolayer cell culture by immunohistochemistry (Figuers 1A-1D) and Western-Blotting (Figures 1E-1F).
More particularly, in Figures 1A-1 D, immunocytochemistry of Rad51 (Figure 1 B and 1 D) and p53 (Figures 1A and 1 C) in pancreatic cancer cell lines are shown. Immunostaining of cell lines 818-4 (Figures 1A-1 B) and BXPC-3 (Figures 1 C-1 D), respectively, was performed using monoclonal antibody 1 G8 for Rad51 and monoclonal antibody PAb1801 for p53. Before staining, cells were fixed in 3,7%
neutral buffered formalin and permeabilized with 0,2% riton X-100. Rad 51 and p53 proteins were visualized using diaminobenzidine tetrahydrochloride as substrate for peroxidase;
counterstaining with hemalum.
Magnification: 1000-fold. In Figures 1 E-1 F, expression of full-length Rad51 (Figure 1 F) and p53 (Figure 1 E) proteins in pancreatic tumor cell lines are shown. Western blot analysis of Rad51 and p53 proteins in 50 Ng of total protein extracts from 818-4 and BXPC-3 pancreatic cell lines using monoclonals 1G8 for Rad51 and DO-1 for p53 detection. Exposure time to detect Rad51 protein was about 20 minutes as compared to 45 seconds for p53.
Figures 2A-2H show accumulation of Rad51 protein in human pancreatic cancer cell lines grown as spheroids. More particularly, Figures 2A-2F show PancTU-I and 818-4 cells which were grown as spheroids and analyzed by immunohistochemistry. Spheroids were harvested, formalin fixed and paraffin embedded. Rad51 was detected using monoclonal antibody 1 G8 and visualized using diaminobenzidine tetrahydrochloride as substrate for peroxidase;
counterstaining with hemalum. The order of magnification as indicated. Figures 2G-2H show Western blot analysis of Rad51 protein in 50 ~g of total lysates from PancTU-I (Figure 2G) and 818-4 (Figure 2H) pancreatic cell lines grown as monolayer (lane a) or as spheroid (lane b) using monoclonals 1 G8 for Rad51 detection.
Figure 3A-3H shows comparison of Rad51 expression in pancreatic cancer cells, grown either as monolayer, as tumor in SCID mice after orthotopic transplantation or in different tumor specimens of pancreatic adenocarcinoma. Rad51 expression was determined by immunohistochemistry in: A-B) Panc-TUI monolayer cells, C-E) Panc-TUI cells growing as tumors in SCID mice after orthotopic transplantation or F-H) in different specimens of human pancreatic adenocarcinoma. Specimens were harvested, formalin fixed and paraffin embedded. Rad51 was detected using monoclonal antibody 1 G8 and visualized using diaminobenzidine tetrahydrochloride as substrate for peroxidase;
counterstaining with hemalum. Order of magnification as indicated.

Figure 4 shows specificity of Rad51 immunohistochemistry determined by peptide competition. More particularly, Figure 4 shows a competition experiment using a peptide corresponding to the 1G8 epitope. Rad51 was stained with the monoclonal antibody 1 G8, in absence (Figure 4A) and presence (Figure 4B) of competing peptide 10-ADTSVEEESFCPQP-25. Rad51 was visualized using diaminobenzidine tetrahydrochloride as substrate for peroxidase. Magnification 200-fold.
Figure 5 shows mutation analysis-of the Rad51 coding sequence using the non-isotopic RNASE
cleavage assay (NIRCA). Negative control: NIRC-assay performed on hybridized sense and anti-sense wild-type Rad51 mRNA; positive control: RNASE cleavage using wild-type sense and an in vitro generated point mutant (anti-sense) of Rad51; Capan-1, HPAF: NIR-assay performed on Rad51 mRNA isolated from the pancreatic tumor cell lines Capan-1 and HPAF, respectively, hybridized to genuine wild-type Rad51 mRNA; a) control without RNASE digestion; b) c) d) RNASE 1, 2, 3 digestion with the enzymes provided by the supplier; wt: wild-type Rad51 mRNA;
mt: mutant Rad51 mRNA; S: sense mRNA; AS: anti-sense mRNA. RNA fragments were analyzed on 2%
agarose gels and stained with ethidium bromide. Shown is an inverted print of the gel using the Fluor-S imaging system.
Figure 6 shows biological consequences of Rad51 over-expression. In particular, Figure 6A shows that p53 levels are unaffected by over-expression of Rad51. UiRad51 and UiLacZ
cells were plated and allowed to sit for 24h. At that time, induction of ectopic protein production was induced with 1 NM
muristerone A, non-induced cells received 1%o ethanol, the solvent used for muristerone A. UV
irradiation was carried out after additional 24h and cells were harvested 24h thereafter. Equal numbers of cells were subjected to Western blotting for p53 protein detection.
Figure 6B shows over-expression of Rad51 confers resistance to DNA double strand breaks.
UiRad51 cells were plated at identical cell numbers and allowed to adhere for 24h. Induction of ectopic protein production was induced with 1 NM muristerone A, non-induced cells received 1%o ethanol.
24h after induction, cells were treated with calicheamicin y1 at the concentrations indicated for 16h, washed three times in complete medium and allowed to recover for 72h. Subsequently, cells were stained with crystal violet.
Cell survival was quantified using a GS700 densitometer (Biorad, Munich).
Figure 7 shows a map of the 5'-region of the human rad51 gene. Regulatory region: fine hatched, exons: black, introns: coarsed; nucleotides 700 to 1560 are shown; putative factor binding sites are boxed.

Figures 8A-L show expression of RadG1, p53, Ki67-antigen and BRCA1 in relation to tumor grading.
A collection of specimens from invasive ductal carcinoma of different histological grading (G1, G2, G3) were stained with monoclonal antibodies 1G8 (anti Rad51), Do-1 (anti p53), MIB-1 (anti Ki67-antigen), and AB-1 (anti BRCA1). Counterstaining with Hemalum.
Figure 9 shows a graph showing the correlations between Rad51, p53, Ki67-antigen and BRCA1 expression and established tumor parameters. r5: Spearman s rank correlation coefficient; */**/***:
p<0.05/0.01/0.001; T: tumor size; N: nodal status; G: histological grading;
ES: estrogen receptor status; PS: progesterone receptor status; PCI: positive stained cell index;
IRS: immunoreactive score (Remmele and Stegner, 1987); SII: staining intensity index.
Figures 10A-10D show representative staining patterns of BRCA1. Various specimens of invasive ductal breast cancer were stained for BRCA1 expression using monoclonal antibody AB-1. (0): no BRCA1 specific staining (blue nuclei due to Mayer's Hemalum counter-staining);
(1): more than 10%
of tumor cells show weak BRCA1 staining (grey color); (2): clear BRCA1 staining with more than 10%
of brown tumor cell nuclei; (3): intense brown staining of more than 10% of tumor cell nuclei.
Figures 11A-11C show ectopic expression of Rad51 causes cell cycle arrest in UiRad51 cells. More particularly, Figure 11A shows UiRad51 cells inducibly over-express ectopic Rad51 protein. Cells were grown in the presence or absence of muristerone A as indicated by .+' and .=, respectively.
Lysates from equal cell numbers were applied to each lane and analyzed by Western blotting for Rad5 1 protein using monoclonal antibody 1G8. Figure 11B shows UiLacZ and UiRad51 cells arrest in G, and G2/M in response to UV irradiation. Cells were UV irradiated, harvested 54h later and analyzed by flow cytometry. Figure 11C shows Rad51 over-expression induces cell cycle arrest. Cells were cultivated in the presence or absence of muristerone A for the time indicated and subjected to cell cycle analysis by flow cytometry.
Figures 12A-12C shows ectopic expression of Rad51 transcriptionally induces expression of p21""~f' protein without p53 activation. More particularly, Figure 12A shows Rad51 triggers p21Waf-I protein expression. UiRad51 cells were plated and allowed to sit for 24h. At that time, cells shown in lanes 1 and 2 received 1 %o ethanol, the solvent used for muristerone A, while those represented in lanes 3 and 4 were supplemented with muristerone A. UV irradiation was carried out after additional 24h (lanes 2 and 4) and cells were harvested 24h thereafter. Equal numbers of cells were subjected to Western blotting for p21'"af' protein detection by using monoclonal antibody 6B6 (Pharmingen).
Figure 12B shows Rad51 induces transcriptional activation of the vvaf 1 promoter. Equal numbers of _g_ non-induced UiLacZ and UiRad51 cells were transfected with reporter plasmid WWP-Luc ((e1 Deiry, W.S., et al., Cell 75:817-25 (1993)). Cells were induced with ponasterone A
for 48h where indicated.
Cell lysates were normalized to protein content and assayed for luciferase activity. Error bars represent standard deviation of triplicates. Figure 12C shows Rad51 does not trigger activation of p53 as transcription factor. UiRad51 blue cells were seeded, allowed to sit for 24h and subsequently treated with 1 NM muristerone A for 40h. UV irradiation was carried out 16h before harvesting. ~3-galactosidase activity assays were carried out in duplicate.
Figures 13A-13C show Rad51 induced cell cycle arrest is lost after prolonged Rad51 over i expression. In particular, Figure 13A shows Rad51 arrested UiRad51 cells re-enter the cell cycle despite over-expression of Rad51. Cells were induced with muristerone A for the time indicated and the distribution of cell cycle phases determined by flow cytometry. G,: dark gray, S: black, Gz/M: light gray. Figure 13B shows p21'"a" protein level decreases while cells re-enter proliferation. Equal cell numbers derived from (Figure 13A) were analyzed for p21"'a" expression by Western Blot using monoclonal antibody 6B6 (Pharmingen). Figure 13C shows Rad51 does not induce transcriptional activation of the waf 1 promoter after adaptation. Equal numbers of non-induced and adapted UiRad51 cells were transfected with reporter plasmid WWP-Luc (e1 Dei~y, w ~ et al., Cel175:817-25 (1993)). Cells were induced with ponasterone A for 48h where indicated. Cell lysates were normalized to protein content and assayed for luciferase activity. "Non-induced" and "induced" refer to ponasterone A treatment for 48h after transfection. "Nonadapted": cells were treated with ponasterone A only after transfection with WWP-Luc (see Figure 12C);
"adapted": cells were induced with muristerone A for more than 28d prior to transfection; "continuous treatment": uninterrupted treatment of adapted cells until transfection of WWP-Luc; "discontinuous treatment": muristerone A
treatment ended 48h prior to transfection of adapted cells. Error bars represent standard deviation of triplicates.
Figures 14A-14B show adaptation to Rad51 over-expression does not affect UV
triggered cell cycle arrest pathways. Particularly, Figure 14A shows re-induction of Rad51 in adapted cells does not lead to cell cycle arrest. Ponasterone A was removed from long-term induced (>28d) UiRad51 cells for 14d (Panel 1 ) or for 11 d followed by re-induction for 72h (Panel 2) and cells analyzed by flow cytometry.
Panels 3 and 4: Cells were treated as in panels 1 and 2, respectively, but in addition cells were UV-irradiated 24h prior to harvest. Figure 14B shows that p53 accumulates after UV-irradiation of adapted cells. Cells were treated as in (A). An aliquot each was lysed for Western blot analysis.
Lysates from equal cell numbers were applied to each lane and analyzed for p53 protein by using a polyclonal sheep anti p53 serum. Lane numbers correspond to panel numbers in Figure 14A.
_g_ DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to a series of discoveries relating to the pivotal role that Rad51 plays in a number of cellular functions, including those involved in disease states.
In particular, described herein are compositions and methods for inhibiting Rad51 and methods of treatment for disease states associated with Rad51 activity as further defined below using Rad51 inhibitors. Also provided are methods regarding the regulation of apoptosis. Furthermore, methods of diagnosis and prognosis of Rad51 related disorders as well as predictive outcomes of treatments are provided. Other compositions and methods related to Rad51 are also described.
In one embodiment, a method is provided which comprises first determining the level of Rad51 expression in a first tissue type of a first individual, i.e. the sample tissue for which a diagnosis or prognosis is required. In some embodiments, the testing may be done on one or more cells cultured as spheroids or a primary tissue sample. The first individual, or patient, is suspected of being at risk for the disease state, and is generally a human subject, although as will be appreciated by those in the art, the patient may be animal as well, for example in the development or evaluation of animal models of human disease. Thus other animals, including mammals such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, etc., and primates (including monkeys, chimpanzees, orangutans and gorillas) are included within the definition of patient.
As will be appreciated by those in the art, the tissue type tested will depend on the disease state under consideration. Thus for example, potentially cancerous tissue may be tested, including breast tissue, skin cells, pancreas, prostate, colon, solid tumors, brain tissue, etc. In a preferred embodiment, the disease state under consideration is cancer and the tissue sample is a potentially cancerous tissue type. Of particular interest is breast, skin, brain, colon, pancreas, prostate, and other solid tumor cancers.
Rad51 expression as used herein means any form of expression, at the protein or nucleic acid level.
Preferably, expression level is determined at the protein level and the nucleic acid level is excluded from the determination.

WO 01/11369 PCT/iJS00/22077 Once the determination of the Rad51 expression level is determined, it can be compared to a control to determine the diagnosis or prognosis. The control may be another control experiment on an unaffected sample such as from another individual or another tissue of the same individual, or it may be a chart, graph or diagram which indicates the "normal" range of levels of Rad51 in an individual similar to the one being tested. In one case, the severity may be determined by having one or more controls and determining how different the test results are from the control.
The greater the level of Rad51 in the test results over the control indicates a greater severity of cancer. Alternatively, a number of controls may be provided such that the results can be matched with a control which shows a predetermined severity of cancer. By determining the severity, a prognosis can also be provided.
A change, preferably an increase, is generally from at least about 5% to about 500% or more, more preferably 20% to 100%, and sometimes more than a 200% increase, sometimes more than a 300%
increase, sometimes more than a 400% increase, sometimes more than a 500%
increase, and sometimes more than a 750% increase, Generally, to see this effect, at least about 100 cells should be evaluated, with at least about 500 cells being preferred, and at least about 1000 being particularly preferred.
The level of Rad51 expression can be determined in a variety of ways. In a preferred embodiment, a labeled binding agent that binds to Rad51 is used. By "labeled" herein is meant that a compound has at least one element, isotope or chemical compound attached to enable the detection of the compound. In general, labels fall into three classes: a) isotopic labels, which may be radioactive or heavy isotopes; b) immune labels, which may be antibodies or antigens; and c) colored or fluorescent dyes. The labels may be incorporated into the compound at any position.
Preferred labels are fluorescent or radioactive labels. The binding agent can either be labeled directly, or indirectly, through the use of a labeled secondary agent which will bind to the first binding agent. The spheroids or tissue sample are prepared as is known for cellular or in situ staining, using techniques well known in the art, as outlined in the Examples.
In a preferred embodiment, the binding agent used to detect Rad51 protein is an antibody. The antibodies may be either polyclonal or monoclonal, with monoclonal antibodies being preferred. In general, it is preferred, but not required, that antibodies to the particular Rad51 under evaluation be used; that is, antibodies directed against human Rad51 are used in the evaluation of human patients.
However, as the homology between different mammalian Rad51 molecules is quite high (73% identity as between human and chicken, for example), it is possible to use antibodies against Rad51 from one type of animal to evaluate a different animal (mouse antibodies to evaluate human tissue, etc.). Thus, in a preferred embodiment, antibodies raised against eukaryotic Rad51 are used, with antibodies raised against mammalian Rad51 being especially preferred. Thus, antibodies raised against yeast, human, rodent, primate, and avian Rad51 proteins are particularly preferred.
In addition, as will be appreciated by those in the art, the protein used to generate the antibodies need not be the full-length protein; fragments and derivatives may be used, as long as there is sufficient immunoreactivity against the sample Rad51 to allow detection. Alternatively, other binding agents which will bind to Rad51 at sufficient affinity to allow visualization can be used. In an alternative embodiment, expression levels are determined by determining mRNA levels of Rad51.
In another aspect of the invention, methods of inhibiting Rad51 expression and/or activity are provided.
In one aspect of the invention, a method for inhibiting at least one Rad51 biological or biochemical activity is provided. The method comprises administering a Rad51 inhibitor to a composition comprising Rad51. The composition can be an in vitro solution comprising Rad51 and Rad51 binders such as DNA and ATP under conditions which allow Rad51 activity. In one embodiment, the composition is a cell. In a preferred embodiment, the Rad51 inhibitor is a small molecule.
Rad51 biological or biochemical activity as used herein can be selected from the group consisting of DNA dependent ATPase activity, formation of Rad51 foci, nucleic acid strand exchange, DNA binding, nucleoprotein filament formation, DNA pairing and DNA repair. DNA repair and recombination are generally considered biological activities. DNA repair can be double stranded break repair, single stranded annealing or post replication recombinational repair.
As further described below, in another aspect of the invention, a Rad51 inhibitor inhibits cell proliferation. In a further aspect also described below, a Rad51 inhibitor results in the cells containing it to be more sensitive to radiation and/or chemotherapeutic agents. In yet another aspect, a Rad51 inhibitor induces apoptosis as further described below.
In one aspect, a Rad51 inhibitor or an agent or composition having Rad51 inhibitory activity is defined herein as an agent or composition inhibiting expression or translation of a Rad51 nucleic acid or the biological activity of a Rad51 peptide by at least 30%, more preferably 40%, more preferably 50%, more preferably 70%, more preferably 90%, and most preferably by at least 95%.
In one embodiment herein, a Rad51 inhibitor inhibits expression or translation of a Rad51 nucleic acid or the activity of a Rad51 protein by 100%. In one aspect, inhibition is defined as any detectable decrease in Rad51 activity compared to a control not comprising the Rad51 inhibitor.

In one embodiment, Rad51 inhibitors can include inhibitors of Rad51 homologues such as RecA
and/or inhibitors that sensitize cells to radiation and also affect aspects of recombination in vivo, which were not previously known to inhibit Rad51. Thus, in one embodiment, Rad51 as used herein refers to Rad51 and its homologues, preferably human homologues. In one embodiment, Rad51 excludes non-human homologues. Rad51 homologues include RecA and Rad51 homologues in yeast and in mammals. Genes homologous to E. coli RecA and yeast Rad51 have been isolated from all groups of eukaryotes, including mammals. Morita, et al., PNAS USA 90:6577-6580 (1993);
Shinohara, et al., Nature Genet. 4:239-243 (1993); Heyer, Experentia, 50:223-233 (1994);
Maeshima, et al., Gene 160:195-200 (1995). Human Rad51 homologues include Rad51 B, Rad51 C, Rad51 D, XRCC2 and XRCC3. Albala, et al., Genomics 46:476-479 (1997); Dosanjh, et al., Nucleic Acids Res 26:1179(1998); Pittman, et al., Genomics 49:103-11 (1998); Cartwright, et al., Nucleic Acids Res 26:3084-3089 (1998); Liu, et al., Mol Cell 1:783-793 (1998). In preferred embodiments, Rad51 inhibitors provided herein were not previously known to inhibit RecA or other Rad51 homologues and were not known to induce sensitizing of cells to radiation. In one embodiment, Rad51 as used herein excludes homologues thereof.
The Rad51 inhibitor can inhibit Rad51 directly or indirectly, preferably directly by interacting with at least a portion of the Rad51 nucleic acid or protein. Additionally, the inhibitors herein can be utilized individually or in combination with each other.
In a preferred embodiment, the small molecule is preferably 4 kilodaltons (kd) or less. In another embodiment, the small molecule is less than 3 kd, 2kd or 1 kd. In another embodiment the small molecule is less than 800 daltons (D), 500 D, 300 D, 200 D or 100 D.
In one embodiment, the Rad51 inhibitor is an inorganic or organic molecule. In a preferred embodiment, the Rad51 inhibitor is a small organic molecule, comprising functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically will include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The Rad51 inhibitor may comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more chemical functional groups. As further discussed below, Rad51 inhibitors can comprise nucleotides, nucleosides, and nucleotide and nucleoside analogues. Nucleotides as used herein refer to XYP, wherein X can be U, T, G, C or A
(base being uracil, thymine, guanine, cytosine or adenine, respectively), and Y can be M, D or T
(mono, di or tri, respectively). In another embodiment, nucleotides can include xathanine, hypoxathanine, isocytosine, isoguanine, etc. Analogues as used herein includes derivatives of and chemically modified nucleotides and nucleosides. In one embodiment, methyl methanesulfonate is excluded.
In one aspect of the invention, the Rad51 inhibitor is a nucleotide diphosphate. In a preferred embodiment, the Rad51 inhibitor is selected from the group consisting of ADP, GDP, CDP, UDP and TDP. In preferred embodiments, ADP is excluded.
In another aspect of the invention, the Rad51 inhibitor is a nucleotide analogue. In a preferred embodiment, the Rad51 inhibitor is a nucleotide diphosphate complexed with aluminum fluoride. In one embodiment, the Rad51 inhibitor is selected from the group consisting of ADP.AIF4, GDP.AIF4, CDP.AIF4, UDP.AIF4 and TDP.AIF4 In yet a further aspect of the invention, the Rad51 inhibitor is a non-hydrolyzable nucleotide. In a preferred embodiment, the Rad51 inhibitor is selected from the group consisting of ATPyS, GTPyS, UTPyS, CTPyS, TTPyS, ADPYS, GDPyS, UDPyS, CDPyS, TDPyS, AMPyS, GMPyS, UMPyS, CMPyS, TMPyS, ATP-PNP, GTP-PNP, UTP-PNP, CTP-PNP, TTP-PNP, ADP-PNP, GDP-PNP, UDP-PNP, CDP-PNP, TDP-PNP, AMP-PNP, GMP-PNP, UMP-PNP, CMP-PNP, and TMP-PNP In preferred embodiments, ADPyS is excluded.
Also another embodiment, the Rad51 inhibitor is a DNA minor groove binding drug. In a preferred embodiment, the Rad51 inhibitor is selected from the group consisting of distamycin, netropsin, bis-benzimidazole and actinomycin.
In yet another embodiment, the Rad51 inhibitor is a peptide. By "peptide"
herein is meant at least two covalently attached amino acids, which includes proteins, polypeptides, oligopeptides and peptides.
The protein may be made up of naturally occurring amino acids and peptide bonds, or synthetic peptidomimetic structures. Thus "amino acid", or "peptide residue", as used herein means both naturally occurring and synthetic amino acids. For example, homo-phenylalanine, citrulline and noreleucine are considered amino acids for the purposes of the invention.
"Amino acid" also includes imino acid residues such as proline and hydroxyproline. The side chains may be in either the (R) or the (S) configuration. In the preferred embodiment, the amino acids are in the (S) or L-configuration.
If non-naturally occurring side chains are used, non-amino acid substituents may be used, for example to prevent or retard in vivo degradations.

The peptides can be naturally occurring or fragments of naturally occuring proteins. Thus, for example, cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts, may be used. Thus, procaryotic and eukaryotic proteins can be Rad51 inhibitors. Rad51 inhibitors may also be peptides from bacterial, fungal, viral, and mammalian sources, with the latter being preferred, and human proteins being especially preferred.
In a preferred embodiment, the Rad51 inhibitors are peptides of from about 5 to about 30 amino acids, with from about 5 to about 20 amino acids being preferred, and from about 7 to about 15 being particularly preferred. The peptides may be digests of naturally occuring proteins as is outlined above, random peptides, or "biased" random peptides. By "randomized" or grammatical equivalents herein is meant that each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. Since generally these random peptides (or nucleic acids, discussed below) are chemically synthesized, they may incorporate any nucleotide or amino acid at any position. The synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence.
Preferred peptides include p53 and Rad51 antibodies and include but are not limited to amino acids 94-160 and 264-315 of p53 and fragments of Rad51 antibodies.
In a preferred embodiment, the Rad51 inhibitors are nucleic acids. By "nucleic acid" or "oligonucleotide" or grammatical equivalents herein means at least two nucleotides covalently linked together. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al., Tetrahedron 49(10):1925 (1993)) and references therein; Letsinger, J. Org. Chem. 35:3800 (1970);
Sprinzl et al., Eur. J.
Biochem. 81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487 (1986);
Sawai et al, Chem. Lett.
805 (1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels et al., Chemica Scripts 26:141 91986)), phosphorothioate (Mag et al., Nucleic Acids Res. 19:1437 (1991); and U.S. Patent No. 5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc. 111:2321 (1989)), O-methylphophoroamidite linkages (see Eckstein, oligonucleotides and Analogues:
A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J.
Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem. Int. Ed. Engl. 31:1008 (1992); Nielsen, Nature 365:566 (1993); Carlsson et al., Nature 380:207 (1996)), all of which are incorporated by reference).
Other analog nucleic acids include those with positive backbones (Denpcy et al., Proc. Natl. Acad. Sci.
USA 92:6097 (1995); non-ionic backbones (U.S. Patent Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 (1991); Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et al., Nucleoside &
Nucleotide 13:1597 (1994);
Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett.
37:743 (1996)) and non-ribose backbones, including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al., Chem.
Soc. Rev. pp169-176 (1995)). Several nucleic acid analogs are described in Rawls, C & E News p. 35 (June 2, 1997). All of these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to increase the stability and half-life of such molecules in physiological environments. In addition, mixtures of naturally occurring nucleic acids and analogs including PNA can be made. Alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occuring nucleic acids and analogs may be made. The nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo-and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc.
In one aspect it is understood that Rad51 inhibitors may bind to Rad51, but exclude agents which generally activate Rad51 such as DNA on which Rad51 normally binds to in the process of recombinational activity, DNA repair, -etc.
As generally for proteins, nucleic acid Rad51 inhibitors may be naturally occurring nucleic acids, random nucleic acids, or "biased" random nucleic acids. For example, digests of procaryotic or eucaryotic genomes may be used as is outlined above for proteins.
Rad51 inhibitors are obtained from a wide variety of sources, as will be appreciated by those in the art, including libraries of synthetic or natural compounds. Any number of techniques are available for the random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means. Known pharmacological agents may be subjected to directed or random chemical modifications to produce structural analogs.
In a preferred embodiment, the methods include both in vitro and in vivo applications, preferably in vivo. Accordingly, in a preferred embodiment, the methods comprise the steps of administering a Rad51 inhibitor to a sample comprising Rad51 under physiological conditions, preferably to a cell.
The cell that the Rad51 inhibitor is administered to may be a variety of cells. Preferably the cell is mammalian, and preferably human. The cell may be any cell in a site in need of Rad51 inhibition such as diseased cells including cancerous cells and cells infected with viruses such as HIV as further discussed below.
Administration may occur in a number of ways. The addition of the Rad51 inhibitor to a cell will be done as is known in the art for other inhibitors, and may include the use of nuclear localization signal (NLS). NLSs are generally short, positively charged (basic) domains that serve to direct the entire protein in which they occur to the cell's nucleus. Numerous NLS amino acid sequences have been reported including single basic NLS's such as that of the SV40 (monkey virus) large T Antigen (Pro Lys Lys Lys Arg Lys Val), Kalderon (1984), et al., Cell 39:499-509; the human retinoic acid receptor-f3 nuclear localization signal (ARRRRP); NFtcB p50 (EEVQRKRQKL; Ghosh et al., Cell 62:1019 (1990);
NFKB p65 (EEKRKRTYE; Nolan et al., Cell 64:961 (1991 )); and others (see for example Boulikas, J.
Cell. Biochem. 55(1):32-58 (1994)), hereby incorporated by reference) and double basic NLS's exemplified by that of the Xenopus (African clawed toad) protein, nucleoplasmin (Ala Val Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Leu Asp), Dingwall, et al., Cell 30:449-458, 1982 and Dingwall, et al., J. Cell Biol., 107:641-849; 1988). Numerous localization studies have demonstrated that NLSs incorporated in synthetic peptides or grafted onto reporter proteins or other molecules not normally targeted to the cell nucleus cause these molecules to be concentrated in the nucleus. See, for example, Dingwall, and Laskey, Ann, Rev. Cell Biol. 2:367-390, 1986; Bonnerot, et al., Proc. Natl. Acad. Sci. USA 84:6795-6799, 1987; Galileo, et al., Proc.
Nat!. Acad. Sci. USA 87:458-462, 1990.
There are a variety of techniques available for introducing a Rad51 inhibitor into cells. The techniques vary depending upon whether the inhibitor is transferred into cultured cells in vitro, or in vivo in the cells of the intended host. Techniques suitable for the transfer of inhibitors into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc. The currently preferred in vivo transfer techniques include transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends in Biotechnology 11:205-210 (1993)). Special or other liposomes, modified electroporation, chemical treatment or Piezo injection techniques are particularly preferred.
The inhibitory agents may be administered in a variety of ways, orally, systemically, topically, parenterally e.g., subcutaneously, intraperitoneally, intravascularly, etc. In one embodiment, the inhibitors are applied to the site of a tumor (or a removed tumor) intra-operatively during surgery.
Depending upon the manner of introduction, the compounds may be formulated in a variety of ways.
The concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt.%. Generally, a therapeutic amount for the need is used, for example, to achieve inhibition of cellular proliferation, radiation or chemotherapeutic sensitization or inducing apoptosis.
The Rad51 inhibitory molecules can be combined in admixture with a pharmaceutically or physiologically acceptable carrier vehicle. Therapeutic formulations are prepared for storage by mixing the active ingredient having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980)), in the form of lyophilized formulations or aqueous solutions.
Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, Pluronics or PEG.
The pharmaceutical compositions can be prepared in various forms, such as granules, aerosols, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like. Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds. Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.

WO 01/11369 PCT/iJS00/22077 In some situations it is desirable to provide the inhibitor with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc. Where liposomes are employed, proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting andlor to facilitate uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life.
The technique of receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol.
Chem. 262:4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA
87:3410-3414 (1990).
Dosages and desired drug concentrations of pharmaceutical compositions of the present invention may vary depending on the particular use envisioned. The determination of the appropriate dosage or route of administration is well within the skill of an ordinary physician.
Animal experiments provide reliable guidance for the determination of effective doses for human therapy.
Interspecies scaling of effective doses can be performed following the principles laid down by Mordenti, J. and Chappell, W.
"The use of interspecies scaling in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al., Eds., Pergamon Press, New York pp. 42-96 (1989).
In a preferred embodiment, the methods comprise identifying the inhibitory effect of the Rad51 inhibitor. For example, determining the effect on double strand break repair, homologous recombination, sensitivity to ionizing radiation, class switch recombination, cellular inhibition, induction of apoptosis, etc. Assays are detailed in Park, J. Biol. Chem. 270(26):15467 (1995) and Li et al., PNAS USA 93:10222 (1996), Shinohara et al., supra, (1992), all of which are hereby incorporated by reference. Further assays are discussed below in the examples.
In an embodiment provided herein, the invention provides methods of treating disease states requiring inhibition of cellular proliferation. In a preferred embodiment, the disease state requires inhibition of at least one of Rad51 expression, translation or the biological activity of Rad51 as described herein. As will be appreciated by those in the art, a disease state means either that an individual has the disease, or is at risk to develop the disease.
Disease states which can be treated by the methods and compositions provided herein include, but are not limited to hyperproliferative disorders. More particular, the methods can be used to treat, but are not limited to treating, cancer (further discussed below), premature aging, autoimmune disease, arthritis, graft rejection, inflammatory bowel disease, proliferation induced after medical procedures, including, but not limited to, surgery, angioplasty, and the like. Thus, in one embodiment, the invention herein includes application to cells or individuals afflicted or impending affliction with any one of these disorders.
The compositions and methods provided herein are particularly deemed useful for the treatment of cancer including solid tumors such as skin, breast, brain, cervical carcinomas, pancreas, testicular carcinomas, etc. More particularly, cancers that may be treated by the compositions and methods of the invention include, but are not limited to: Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma; liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lun4:
bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma, Wilm's tumor [nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastom, angiosarcoma, hepatocellular adenoma, hemangioma; Bone:
osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors;
Nervous system:
skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma);
Gynecological: uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma], granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma [embryonal rhabdomyosarcoma], fallopian tubes (carcinoma); Hematologic: blood (myeloid leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis; and Adrenal 4lands: neuroblastoma. Thus, the term "cancerous cell" as provided herein, includes a cell afflicted by any one of the above identified conditions.
The individual, or patient, is generally a human subject, although as will be appreciated by those in the art, the patient may be animal as well. Thus other animals, including mammals such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, etc., and primates (including monkeys, chimpanzees, orangutans and gorillas) are included within the definition of patient. In a preferred embodiment, the individual requires inhibition of cell proliferation. More preferably, the individual has cancer or a hyperproliferative cell condition.
IS
The compositions provided herein may be administered in a physiologically acceptable carrier to a host, as previously described. Preferred methods of administration include systemic or direct administration to a tumor cavity or cerebrospinal fluid (CSF).
In one aspect, the Rad51 inhibitors herein induce sensitivity to alkylating agents, DNA cross-linkers, intra and inter strand, cisplatin and related compounds and radiation. Induced sensitivity (also called sensitization or hypersensitivity) is measured by the cells tolerance to radiation or alkylating agents.
For example, sensitivity, which is measured, i.e., by toxicity, occurs if it is increased by at least 20%, more preferably at least 40%, more preferably at least 60%, more preferably at least 80%, and most preferably by 100% to 200% or more.
In an embodiment herein, the methods comprising administering the Rad51 inhibitors provided herein further comprise administering an alkylating agent or radiation. For the purposes of the present application the term ionizing radiation shall mean all forms of radiation, including but not limited to alpha, beta and gamma radiation and ultra violet light, which are capable of directly or indirectly damaging the genetic material of a cell or virus. The term irradiation shall mean the exposure of a sample of interest to ionizing radiation, and term radiosensitive shall refer to cells or individuals which display unusual adverse consequences after receiving moderate, or medically acceptable (i.e., nonlethal diagnostic or therapeutic doses), exposure to ionizing irradiation.
Alkylating agents include BCNU and CCNU. Additionally, radiation sensitizers (e.g., xanthine and xanthine derivatives including caffeine) can be applied with, before or after the Rad51 inhibitors.
In one embodiment herein, the Rad51 inhibitors provided herein are administered to prolong the survival time of an individual suffering from a disease state requiring the inhibition of the proliferation of cells. In a preferred embodiment, the individual is further administered radiation or an alkylating agent.
In yet another aspect of the invention, a fragment of Rad51 is provided wherein said fragment consists essentially of a binding site for a small molecule, wherein said small molecule regulates the biological or biochemical activity of Rad51. Preferably, the regulation is inhibitory. In one embodiment, the binding site is the binding site for p53.
Generally, the binding site is identified by combining the inhibitor with fragments of Rad51. In one embodiment, the fragments are from between amino acids 125 and 220. In one embodiment, Rad51 125-220 is fragmented to fragments of 5-25 amino acids and then tested separately or in random recombinations to determine the binding site by standard binding techniques.
The following examples serve to more fully describe the manner of using the above-described invention, as well as to set forth the best modes contemplated for carrying out various aspects of the invention. It is understood that these examples in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes. All references cited herein are incorporated by reference.
EXAMPLES
EXAMPLE 1: RAD51 IS OVEREXPRESSED IN HUMAN PANCREATIC ADENOCARCINOMA.
Herein we analyze expression levels of human Rad51 protein in tumor cells cultured as spheroids compared to monolayers. In fact, 3D-growth of human pancreatic cancer cell lines is accompanied by nuclear cultures of the same cell lines. Similar accumulation of Rad51 is induced after orthotopic transplantation of human pancreatic cancer cells into SCID mice. The clinical significance of these observations with respect to the malignant phenotype of pancreatic cancer is underlined by our finding that wild-type Rad51 also accumulates to high levels in human pancreatic cancer in situ. Functional analysis revealed that the 5'-regulatory region of the rad59 gene is comprised of TATA-less, GC-rich elements known from housekeeping genes and that Rad51 over-expression enhances survival of cells after induction of DNA double strand breaks.
Materials and Methods Cell culture Human pancreatic cancer cell lines 818-4, Colo-357, SW-850, QUIP-1, BXPC-3, Capan-1, HPAF, PancTU-II, PT 45-P1, Panc 89 (Kalthoff, H., et al., Oncogene 8:289-298 (1993)) as well as UiRad51 and UiLacZ cells were maintained in a humidified incubator at 37°C in an atmosphere of 5% carbon dioxide, 95% air in DMEM supplemented with 10% fetal calf serum (PAA, Colbe, Germany).
Hybridoma cell line 1G8 was grown as described previously (Buchhop, S., et al., Hybridoma 15:205-210 (1996). Production of antibody was performed using a miniPERM Bioreactor (Heraeus, Osterode, Germany) according to the recommendations of the supplier. The ecdysone analogues muristerone A
and ponasterone A, respectively (Invitrogen), were dissolved at ImM in absolute ethanol and used at a final concentration of 1 NM to induce expression of ectopic Rad51 (UiRad51) or (3-galactosidase (UiLacZ). Non-induced controls were supplemented with the same amount of ethanol. For UV
treatment, media were removed and cells irradiated for 1 second on a TFL-20M
transilluminator (Biometra, Gottingen, Germany) equipped with 312nm bulbs. According to biological calibration, this corresponds to approximately 270J/m2. Cells were then grown in fresh medium, as were non-irradiated controls. Calicheamicin y, (Wyeth-Ayers" research, Pearl River, NY, USA) was dissolved in absolute ethanol at 100 NM and stored at -80°C. For determination of chemosensitivity, cells were treated with increasing concentrations of calicheamicin y1 for 16h, allowed to recover for 72h at 37°C
under standard conditions and stained with crystal violet.
Antibodies Hybridoma cell line 1G8 was isolated as described previously (Buchhop, S., et al., Hybridoma 15:205-210 (1996)). Monoclonal antibody 1G8 specifically recognizes Rad51 protein.
Prof. J. Gerdes, Forschungszentrum Borstel, Germany kindly provided the monoclonal antibody MIB-1 directed against the proliferation marker protein KI-67. Monoclonal anti p53 antibodies PAb1801 and DO-1 were supplied by Dianova, Hamburg, Germany. Roche Biochemicals, Mannheim, Germany, supplied the polyclonal sheep anti p53 serum. HRP-conjugated goat anti-mouse IgG (Amersham Buchler KG, Braunschweig, Germany) and HRP-conjugated donkey anti-sheep IgG (Sigma-Aldrich Chemie, Steinheim, Germany) were used as second antibody.

Immunohistochemistry For immunohistochemical staining, tissue from 41 surgical resection specimens (38 Whipple specimens and 3 left pancreatectomies) from patients with ductal adenocarcinoma of the pancreas were classified according to the criteria of the WHO (Kloppel, G., et al., Histological typing of tumours of the exocrine pancreas. Second edition. WHO International histological classification of tumours, Springer Verlag, Berlin ( 1996)). The mean age of the patients was 59.7 years (45-75). The tumor stages were pT2 (n=6), pT3 (n=29) and pT4 (n=6). Histologically, 6 cases were grade 1, 24 grade 2 and 11 grade 3. Specimens were fixed in neutral buffered formalin (4%) and subsequently embedded in paraffin. Consecutive 5pm thick sections were placed on slide glasses, dewaxed in xylene, passed through alcohol and washed in phosphate buffered saline (PBS). As antigen retrieval treatment the sections were immersed in citrate buffer (100 mM Na-citrate, pH 7.2) and boiled for 3 minutes under pressure in a pressure cooker. Following this treatment, endogenous peroxidase activity was blocked by incubation in 0.3% hydrogen peroxide in PBS for 10 min. Sections were incubated with the different antibodies for Ih at room temperature in a wet chamber. After washing in PBS, a biotinylated anti mouse antibody (Vector Laboratories Inc., Burlingame, USA) was added for 30 min at room temperature. After washing in PBS, sections were incubated with ABC complexes (Vector Laboratories Inc.) and subsequently stained using DAB (Diaminobenzidine tetrahydrochloride, Vector Laboratories Inc.) as substrate for peroxidase. Counter-staining was performed using Mayers hemalum (Merck, Darmstadt, Germany).
Western blot analysis Cultured cells were washed with ice-cold PBS. Subsequently, cellular proteins were extracted in SDS
lysis buffer (25mM Tris-HCI (pH 6.5), 1 % SDS, 5% ~3-mercaptoethanol, 0.1 %
Bromophenol blue, 5%
glycerol). Following sonification and boiling, equal amounts of total protein (determined by BCA
protein assay, Pierce, Rockford, USA) were loaded onto an 11.5% SDS-polyacrylamide gel. After transfer to PVDF membrane (Biorad, Munich, Germany), relevant proteins were detected using the antibodies described above. The Super Signal Substrate system (Pierce, Rockford, USA) was used for chemiluminescence detection.
NIRC-assay Non-isotopic RNASE cleavage assay was performed following the manufacturer's guidelines provided with the Mismatch Detection Kit II (Ambion, Texas, USA). Briefly, total cell RNA was prepared from cultured cells using the RNeasy kit supplied by Quiagen (Hilden, Germany).
Reverse Transcription and PCR was performed in a one-tube reaction (Life Technologies, Karlsruhe, Germany), using the "outer primer pairs" for the PCR reaction described below. Subsequently, an aliquot of this reaction was subjected to a nested PCR using the primers listed, which include the SP6 or T7 promoter sequence. PCR products were transcribed in vitro with T7 or SP6 RNA polymerase to produce sense and antisense RNA probes, respectively. Sense RNA products were hybridized with antisense from wild-type control and vice versa. The hybridized samples were treated in three different reactions with the RNases provided with the kit. The cleaved products were analyzed on ethidium bromide-stained agarose gels (2%) using the Fluor-S imaging system (Biorad, Munich, Germany).
For Rad51 mutation analysis, the following primers were used for the amplification of nucleotides 1 to 1020 of the Rad51 coding region:
outer 5'-primer: ATGGCAATGCAGATGCAGCTTGAAGC, 3'-primer: TCAAGTCTTTGGCATCTCCCACTCC;
for nested PCR: 5'-primer:
GATAATACGACTCACTATAGGGAAGAAGAAAGCTTTG. 3'-primer:
TCATTTAGGTGACACTATAGGAAGACAGGGAGAGTC.
To amplify the region from -232 to 1289 the following primers were used:
outer 5'-primer: CCGCGCGCAGCGGCCAGAGACCG, 3'-primer: GTCAAAGATACTTCATACCCCTCC;
for nested PCR of nucleotides -190 to 703:
5'-primer: GATAATACGACTCACTATAGGGCGCTTCCCGAGGC:
3'-primer: TCATTTAGGTGACACTATAGGACCCGAGTAGTCTGTTC;

for nested PCR of 346 to 1123:
5'-primer: GATAATACGACTCACTATAGGGAATTGAGACTGGAT
3'-primer: TCATTTAGGTGACACTATAGGAATAAACATTTTAGATC.
Rad5 sequences are underlined.
Isolation and characterization of a genomic rad51 clone A human genomic PAC library (RPC11,3-5 Human PAC Library No.: 704, Pieter de Jong, Rosewell Park Cancer Institute) was kindly provided by Resource Center/Primary Database of the German Human Genome Project, Berlin, Germany. This library was screened with a random labeled PCR fragment amplified from human genomic DNA by using the rad51 specific primers 5'-ATGGCAATGCAGATGCAGCTTGAAGC-3' and 5'-TGGCTTCACTAATTCCCTTA-3'. PAC clone RPCIP704124767 was identified to contain rad51 sequences. The isolated clone was fragmented with restriction enzymes Pstl, Hindlll and EcoRI/EcoRV and subcloned into the pBluescript SK vector (Stratagene, Amsterdam, Netherlands).
Clones positive for the target gene fragments were lifted using a Hybond-C
Nitro-cellulose membrane (Amersham Pharmacia Biotech, Freiburg, Germany) and identified by means of hybridization with oligonucleotides spanning the human rad51 cDNA sequence (DDBI accession no.
D14134;
Yoshimura, Y., et al., Nucl. Acids. Res. 21:1665 (1993)). DNA from positive subclones was extracted using the Qiagen DNA purification Kit (Qiagen, Hilden, Germany) and sequenced on a MWG
automated sequencer (LI-COR LI-4200 system, MWG AG Biotech, Munich ,Germany).
The putative promoter and potential transcription factor binding sites upstream of exon 1 were analyzed using the program Promoter Scan II (Prestridge, 1995). Determination of intron-exon junctions was performed by Splice Site Prediction by Neural Network (NNSPLICE0.9; Reese, M.G., et al., J. Comp. Biol. 4:311-323 (1997)).
Results:
Accumulation of Rad51 protein in human pancreatic cancer cell lines cultured as spheroids During cell cycle progression only minor variations in Rad51 protein level occur (Yamamoto, A., et al., Mol. Gene. Genet. 251:1-12 (1996); Chen, F., et al., Mutat. Res. 384:205-211 (1997)). Immortalization of human fibroblasts is accompanied by a three- to four-fold increase in Rad51 mRNA expression levels (Xia, S.J., et al., Mol. Cell Biol. 17:7151-7158 (1997)). There is, however, no description of the Rad51 protein levels in different human tumor cell lines derived from a single tumor entity. Therefore, we first compared the amount of Rad51 protein in a panel of well-characterized human pancreatic cancer cell lines (818-4, Colo-357, SW-850, QCP-1, BXPC-3, Capan-1, HPAF, Panc-TU-I, Panc TU-II, PT 45-P1, Panc 89; (Kalthoff, H., et al., Oncogene 8:289-298 (1993)) by immunocytochemistry and Western blotting. Figure 1 shows representative examples of staining intensity and subcellular localization of Rad51 protein and by way of comparison of p53 in 818-4 and BXPC3 cells. Both cell lines exhibited weak nuclear staining for Rad51 polypeptide similar to the signal intensity for p53 in 818-4 cells. By contrast, a very strong signal for over-expressed mutant p53 was found in BXPC-3 cells. Examination at low order magnification revealed only minor variat+ons in staining intensities for both polypeptides between individual cells of a given cell line. To established that the differences in staining intensity reflect quantitative differences in Rad51 and p53 content, protein levels were determined by Western blotting (Figure 1 B). In these experiments, 50 Ng of total protein extract was loaded in each lane. The amount of mutant p53 in BXPC-3 of total protein extract was loaded in each lane. The amount of mutant p53 in BXPC-3 cells is increased at least by a factor of 10 compared to p53 in 818-4. No such difference between the two cell lines was observed for Rad5l. Staining intensities observed by immunocytochemistry correlate with the amount of Rad51 and p53 protein in the cells. In addition, we did not find gross variations for Rad51 between all cell lines tested (data not shown). These results demonstrate that pancreatic cancer cell lines display a very low level of Rad51 protein, hardly detectable by immunocytochemical methods and comparable to the amount of wild-type p53 in these cells.
In order to test, whether 3D growth might affect expression of Rad51, 818-4 and PancTU1 cells were grown as spheroids. Figure 2A demonstrates that Rad51 accumulates to much higher levels in a sub-population of tumor cell nuclei compared to monolayer cultures. The proportion of cells over-expressing Rad51 varies between cell lines with about 5-10 percent of cells for PancTU-I and more than 30 percent for 818-4. There is no apparent correlation between Rad51 over-expression and the genetic status of p53 in the respective cell lines (data not shown). Western blot analysis of Rad51 in PancTU-I and 818-4 cells grown as monolayers or as spheroids confirmed the immunocytochemical data (Figure 2B). In contrast to Rad51, expression of p53 was not affected by cell culture conditions (data not shown). Quantification of the Western blot reveals about a five-fold difference for Rad51 between monolayer and spheroid. Given that Rad51 is over-expressed only in 20 percent of 818-4 cells, this argues that the level of Rad51 in over-expressing spheroid cells is increased 25-fold compared to monolayers.
Accumulation of Rad51 in PancTU-I cells after orthotopic transplantation into SCID mice To further elucidate the biological significance of these findings and to test, whether the observed accumulation of Rad51 in spheroids might also occur under in vivo conditions, Rad51 expression was analyzed in an orthotopic xeno-transplantation model. 106 PancTU-I cells were inoculated into the pancreas in SCID mice. Mice were sacrificed on day 21 after inoculation.
PancTU-I tumors were fixed, paraffin embedded, and prepared for immunohistochemistry. To rule out that paraffin embedding would affect the outcome of the experiment, PancTU-I cells grown as monolayer were harvested by centrifugation after scraping and processed under identical technical conditions concerning fixation, paraffin embedding, and histochemical analysis. High-level Rad51 protein expression was detected only in PancTU-I tumors (Figure 3, panel B) but not in cells grown as monolayer (Figure 3, panel A). These data show that high-level expression of Rad51 represent a unique feature of tumor cells grown as 3-dimensional network in vitro as well as in vivo.

Over-expression of wild-type Rad51 protein in specimens of human pancreatic adenocharcinoma To further substantiate these findings, Rad51 expression was investigated in paraffin embedded specimens of human pancreatic adenocarcinoma. As shown in Figure 3, panel C, Rad51 protein accumulates to high levels in tumor cell nuclei. Rad51 over-expression is restricted to tumor cells and not found in nuclei of surrounding tissue. Under identical staining conditions, nuclear antigens like Ki-67 and p53 were also easily detectable in the tumor cell population. There was apparent correlation between Rad51 and p53 expression in tumor specimens (data not shown). Intense staining was highly specific for Rad51 protein, since pre-incubation of the anti Rad51 monoclonal 1 G8 with a peptide corresponding to the epitope recognized by the antibody (Buchhop, S., et al., Hybridoma.
15:205-210 (1996)) completely blocked the staining reaction (Figure 4). The percentage of Rad51 positive tumor cells ranged from 5% to nearly 50% between different specimens.
Tumor specimens were scored positive when more than 5% of tumor cell nuclei were stained as intense as in spheroids 1 S or xeno-transplants. According to thee criteria, 27 (66%) out of 41 pancreatic adenocarcinoma specimens expressed Rad51 protein at high-levels.
Over-expression of Rad51 protein is not a consequence of mutations in the Rad51 coding sequence The panel of 13 pancreatic cancer cell lines used in this study and 12 tumor specimens were tested for mutations in the Rad51 coding sequence. The highly sensitive and specific non-isotopic RNase cleavage assay (NIRCA) was used for mutation screening. NIRCA detects single mismatches in double stranded RNA molecules derived after cross hybridization between wild-type and mutant mRNAs by RNASE cleavage. mRNAs are generated by in vitro transcription of cNDAs amplified by RT-PCR. Using the commercially available assay system for the screening of mutations in the p53 coding sequence, the test reliably detected known single point mutations (Kalthoff, H., et al., Oncogene 8:289-298 (1993)) in the human pancreatic cancer cell lines used in this study. To verify the functionality of the assay for Rad51 mutation detection, mRNA
corresponding to a Rad51 point mutant created by in vitro mutagenesis was hybridized with wild-type Rad51 transcripts. The results of these experiments are shown in Figure 5. No degradation occurs after RNASE
digestion of hybridized sense and anti-sense wild-type Rad51 mRNA (negative control). Cross hybridization befinreen wild-type and mutant Rad51 mRNA on the other hand results in distinctive and specific cleavage patterns after RNASE digestion (positive control). These controls indicate that the assay can be applied for specific detection of mutations in the Rad51 coding sequence.
Thirteen different pancreatic cancer cell lines and 12 tumor specimens of pancreatic adenocarcinoma were screened for Rad51 mutations using NIRCA, but not mutations were found. Based on these data, we argue that over-expressed Rad51 protein in spheroids of human pancreatic tumor cells lines and tumor specimens represents wild-type Rad51 protein.
Over-expression of Rad51 confers resistance to DNA double strand breaks In order to create a model system in which the biological consequences of modulating the Rad51 content in cells can be easily monitored, the human osteosarcoma cell line U-ZOS was used as parental cell line to establish clone UiRad51 which inducibly expresses Rad51.
As a control, the inducibly E. coli ~i-galactosidase producing clone UiLacZ was developed.
Treating these cells with muristerone A or ponasterone A, analogues of the insect steroid hormone ecdysone, induces expression of the respective ectopic proteins (Miska, et al., submitted for publication). All cell clones express wild-type p53, which accumulates and becomes activated to induce cell cycle arrest in response to DNA damage. This system was used to elucidate the link between Rad51 over-expression and the cellular response to DNA double strand breaks. To test whether over-expression of Rad51 can affect p53 levels, these were compared in non-induced versus induced UiRad51 and UiLacZ cells. Western blot analysis shows that induction of Rad51 or [3-galactosidase, respectively, does not have an effect on the level of p53 (Figure 6A). Both UiRad51 and UiLacZ arrest their cell cycle in response to UV-irradiation without any evidence of cell death (data not shown).
Over-expression of Rad51 does not interfere with p53 accumulation in response to DNA damage by UV--irradiation (Figure 6A). Without being bound by theory, it is believed that Rad51 over-expression does not confer resistance to UV-irradiation because UV-induced DNA damage is predominantly corrected via excision repair, it is not surprising that (data not shown). By contrast, homologous recombination is one of the mechanisms involved the repair of DNA double strand breaks (DSBs). In order to test whether high-level expression of Rad51 might be advantageous for cell survival, we used calicheamicin y1, which induces DSBs without any mediators. UiRad51 cells were treated for 16h with various concentrations of the drug followed by fixation of the cells after 72h of recovery. The differences in cell numbers of non-induced versus induced controls not treated with calicheamicin y1 (Figure 6B) can be attributed to the fact, that over-expression of Rad51 induces a transient cell cycle arrest in G, and Gz/M (Miska, et al., submitted for publication). Massive cell death occurs in response to increasing concentrations of calicheamicin y1 (Figure 6B). However, over-expression of Rad51 significantly potentiated the rate of survival compared to cells expressing basal levels.
The promoter region of human rad51 shows characteristics of a housekeeping gene Recent evidence suggests that expression of Rad5 1 is regulated at the transcriptional level (Xia, et al., Mol. Cell Biol., 17:7151-7158 (1997); Ohnishi, et al., Biochem. Biophys.
Res. Commun. 245:319-324 (1998)). This prompted us to study the 5 -regulatory region of the human rad51 gene. An 8.1kb DNA fragment of the 5'-region of this gene was sequenced (GenBank accession number: AF203691 ).
The 5'-UTR involves the first exon and a 3.3kb nucleotide sequence encompasses the first intron.
The translation start codon is located immediately at the beginning of the second exon. The predicted regulatory region has been pointed 5.4kb upstream of ATG. Nucleotide sequence analysis of this region revealed consensus sequences known to be involved in RNA polymerase II
mediated transcription. Binding motives for AP-2, Spl, Ets-1 as well as c-Myc were identified. No TATA-like or initiator element sequences were found (Figure 7). These data suggest that human rad51 gene belongs to the TATA-less GC-rich housekeeping gene family.
Pancreatic adenocarcinoma is regarded a paradigm for a chemo- and radioresistant tumor entity. In our survey, we found only weak expression of Rad51 in all pancreatic cancer cell lines tested, when they were grown as monolayers. These data confirm previous reports on Rad51 expression in monolayer cell systems (Yamamoto et al., Oral. Oncol. 34:524-528 (1996); Chen et al., Mutat. Res.
384:205-211b (1997); Xia et al., Mol. CeII8iol. 17:7151-7158 (1997)).
Different results emerge when tumor cells were grown as spheroids or as xeno-transplants in SCID mice. Under these conditions, Rad51 protein accumulates to high levels in the nuclei of a sub-population of cells. Moreover, tumor cells in specimens of human pancreatic adenocarcinoma also showed Rad51 over-expression. Since we did not detect any mutations in the coding sequence, we assert that the over-expressed protein represents wild-type Rad51. In summary, our data present Rad51 a DNA repair associated gene which is over-expressed in human cancer. Furthermore, 3D systems like spheroids or xeno-transplants reliably reflect the expression status of Rad51 in human pancreatic cancer.
Western blot analysis of spheroids confirms an about flue-fold increase compared to monolayer culture cell lines. Taking into account that only about 20% of the cells over-express Rad51, the level in this sub-population should be elevated by a factor of at least 25.
While cancer cells predominantly express high levels of mutant rather than wild-type p53, over-expression of Rad51 protein is not associated with alterations in the coding region. Up-regulation of rad51 expression has been reported on the transcriptional level during immortalization of primary human fibroblasts (Xia et al., Mol. Cell Biol. 17:7151-7158 (1997). From our analysis of the 5 -regulatory region, the rad51 gene appears to contain a TATA-less, GC-rich promoter known from housekeeping genes. Nutritional deficits like shortage of oxygen, common to inner cell layers of spheroid cultures are not believed to trigger Rad51 over-expression (data not shown).
EXAMPLE 2: BREAST CANCER IS ACCOMPANIED BY OVER-EXPRESSION OF RAD51 Here we describe over-expression of wild-type Rad51 protein in tumor specimens of invasive ductal mammary carcinoma. Statistical analysis of more than one hundred tumor specimens revealed that Rad51 over-expression significantly correlates with tumor grading. These data qualify Rad51 overexpression as a marker for diagnosis and prognosis of invasive ductal mammary carcinoma. In addition to down-regulation of BRCA1 protein in dedifferentiated tumors, over-expression of Rad51 is shown to contribute to the pathogenesis of sporadic breast cancers.
Patients, Materials and Methods:
Patients The study was performed using paraffin-embedded tumor specimens from 107 female patients (mean age: 58 years) with sporadic invasive ductal breast carcinoma. Tumor size was 26mm on average.
36 cases were assigned to category T1, 44 cases to T2, six cases to T3 and 19 cases to T4 of the TNM classification. In 48 patients, no axillary lymph node metastases were detectable, whereas 49 cases were found nodal-positive. T classification of two patients and the nodal status of ten patients were unknown. All tumor specimens were reviewed by one pathologist (S.K.) according to the grading criteria of Elston and Ellis (Elston, C.W. and Ellis, LO., Histopathology 19:403-410 (1991)). 28 carcinomas were graded as G1, 49 as G2 and 30 as G3. For assessment of the hormonal receptor status, serial sections of each paraffin-embedded tumor sample were immunostained using monoclonal antibodies directed against estrogen receptor (clone 1 D5) and progesterone receptor (clone 1A6; DAKO, Hamburg, Germany). An immunoreactive score ranging from 0 to 12 was calculated according to Remmele and Stegner (Remmele, W. and Stegner, H.E., Pathologe 8:138-140 (1987)).
Antibodies The mouse monoclonal antibody 1G8 specifically recognizing Rad51 protein in paraffin embedded tissues was isolated as described previously (Buchhop, S., et al., Hybridoma 15:205-210 (1996);
Maacke et al., submitted for publication)). Monoclonal antibody MIB-1 directed against the proliferation marker Ki67-antigen was kindly provided by Prof. J. Gerdes (Forschungszentrum Borstel, Germany). Monoclonal anti p53 antibody DO-1 was supplied by Dianova (Hamburg, Germany), and monoclonal antibody AB-1 (MS110 (Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)) directed against BRCA1 was purchased from Calbiochem (Schwalbach, Germany).
Immunohistochemistry Tissue sections were fixed routinely in neutral buffered formalin (4%) and subsequently embedded in paraffin. Consecutive 4 Nm thick sections were dewaxed in xylene, passed through alcohol and washed in phosphate buffered saline (PBS). In order to improve antigen retrieval, sections were immersed in citrate buffer (100 mM Na-citrate, pH 6.0) and boiled for 3 minutes in a pressure cooker.
Endogenous peroxidase activity was blocked by incubation in 3,5% hydrogen peroxide in PBS for 5min. After permeabilizing the cells with Triton-X 100 for 5min, specimens were blocked in horse serum and subsequently with avidin and biotin (Vector Laboratories Inc., Burlingame, USA). Sections were incubated with the different antibodies for Ih at room temperature in a wet chamber. After washing in PBS, a biotinylated anti-mouse antibody (Vektor Laboratories Inc., Burlingame, USA) was added for 30 min at room temperature. Sections were then incubated with ABC complexes (Vector Laboratories Inc., Burlingame, USA) and stained using DAB
(Diaminobenzidine tetrahydrochlorid, Vector Laboratories Inc., Burlingame, USA) as peroxidase substrate. Specimens were counter-stained using Mayers hemalum (Merck, Darmstadt, Germany).
For BRCA1 this staining protocol was modified according to Wilson et al.
(Wilson, C.A., et al., Nat.
Genet. 21:236-240 (1999)). The antigen retrieval solution used for this modified procedure was purchased from DAKO, (Hamburg, Germany). Antibody incubation was performed overnight at 4°C.
Image Analysis Stained specimens were analyzed using an Olympus BX40 microscope (Olympus Optical CO. GmbH, Hamburg, Germany). Images were digitized using AnalysisPro 2.10.200 software (SIS Software GmbH, Munster, Germany). For Rad51, p53, and Ki67-antigen, the positive stained cell index (PCI;
10) was quantified using PiClick Image analysis (S. Opitz, unpublished). 1000 representative tumor cells per slide were analyzed and the PCI was assessed by two observers independently.
For BRCA1 evacuation a scoring system based on the criteria established by Wilson et al. (Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)) was used. First the area of most intense staining was determined at low order magnification. Subsequently, BRCA1 staining intensity was classified using the following criteria: (0): no BRCA1 specific staining (blue nuclei due to Mayer's Hemalum counter-staining); (1 ): more than 10% of tumor cells show weak BRCA1 staining (grey color); (2):
clear BRCA1 staining with more than 10% of brown tumor cell nuclei; (3):
intense brown staining of more than 10% of tumor cell nuclei.
Statistical Analysis SPSS Version 8 software was used for statistical analysis. The association between Rad51 and biologic or pathologic parameters was assessed by Spearman's rank correlation coefficient (r3). To search for significance different groups were compared globally by H-test according to Kruskal and Wallis. Significance in each group of pairs was confirmed using Mann and Whitney's Utest with Bonferroni's correction.
NIRC-assay Non-isotopic RNase cleavage assay was performed following the manufacturer's guidelines provided with the Mismatch detection Kit II (Ambion, Texas, USA). Briefly: total cell RNA was prepared using the RNeasy kit supplied by Quiagen (Hilden, Germany). Reverse Transcription and PCR was performed in a one-tube reaction (GibcoBRL, Karlsruhe, Germany), using the "outer primer pairs"
described below for PCR. An aliquot of this reaction was subjected to nested PCR using primers, which include SP6 or T7 promoter sequences. PCR products were transcribed in vitro with T7 or SP6 RNA polymerase to produce sense and antisense RNA probes, respectively. Sense RNA products were hybridized with antisense from wild-type control and vice versa. The hybridized samples were treated in three different reactions with the RNases provided with the kit.
The cleaved products were analyzed on ethidium bromide-stained agarose gels (2%) using the Fluor-S
imaging system (Biorad, Munchen, Germany). For Rad51 mutation analysis, the following primers were used for amplification of the Rad51 coding region 4 (Rad51 sequences are underlined):
outer primers:
5'-primer: ATGGCAATGCAGATGCAGCTTGAAGC.
3'-primer : TCAAGTCTTTGGCATCTCCCACTCC;
5'-primer: CCGCGCGCAGCGGCCAGAGACCG, 3'-primer: GTCAAAGATACTTCATACCCCTCC~
for nested PCR:
5'-primer: GATAATACGACTCACTATAGGGAAGAAGAAAGCTTTG.
3'-primer: TCATTTAGGTGACACTATAGGAAGACAGGGAGAGTC.

5'-primer: GATAATACGACTCACTATAGGGCGCTTCCCGAGGC;
3'-primer: TCATTTAGGTGACACTATAGGACCCGAGTAGTCTGTTC;
5~-ptinter: ~ GATAATACGACTCACTATAGGGAATTGAGACTGGAT
3'-primer: TCATTTAGGTGACACTATAGGAATAAACATTTTAGATC..
F~esuits:
In a CNA repair pathway, recombinational processes may act to maintain genetic stab7ity, but if deregulated or Increased, genomic instabUlty and malignant transformation can result. In order to test, i0 whether RadS1 protein expression is altered in malignandes of epithelial origin. specimens of invasive ducts! mammary carcinoma were analyzed by immunohistochemistry. The results indicate that Rad51 fs~ over-expressed in Tumor cell nuclei (Figure 8) compared to normal breast tissue derived from reduc;ion;mamniaplasty (n=8) and tissue from fibrocystic mastopathy (n=i 0) (not shown). Tumor cells cars be cfassitied as either positive (dark brown staining) or negative for Rad51 (Figure 8). This 15- psfEern allows the classification of Rad51 expression by pos'dive cell index (PCI (10)). In a small panel of'spscimens~of invasive ductal breast carcinomas analyzed first, the PCI for Rad51 ranged from 0%
up tD 6S%.
To assess correlations with established tumor parameters, the Rad51 PCI was detenntned in a panel 20. of 1p7 specimens of ductal invasive breast cancers. Table 1 below gives a summary of the statistical arislysis of Rad51 PCI compared to a spectrum of established tumor parameters, corresponding rank correlation coe~cients are shown in Figure 9. The notable correlation was found between Rad61 ov~r-expression and tumor grading with a coefficient of ,=0.535 (rank correlation according to Spearman) that reached sta4stical significance (p<0.001 ). In addition, RadS1 PCI was tnversaty ZS correlated with the estrogen receptor status of the tumors (rB=-0.352;
p<0.001). Rad51 over-expression was also compared with expression of iwo established marker proteins, the tumor suppressor p53 and the proliferation protein K187-antigen. There was no significant direct correlation between Rad54 and p53 PCI, but a highly significant correlation between Rad51 and Ki67-antigen expression (r,--0.563; p<0.001 ). Figure 8 shows representative examples of Rad51, p53 and 3D ICS7-antigen staining patterns in relation to tumor grading.
The alteration of Rad51 expression in breast cancer described above does not result from mutations in'the,Rad51 coding sequence. A panes of 14 r~presentative breast cancer samples was analy~od using the highly sensitive and specific mutation detection non-isotopic RNASE
cleavage assay 35 {NIRCA) as described in Material and Methods. No Rad51 mutations were found (data not shown), In RECTIFIED SHEET (.~'s(li_E c~~~
ISA / EP

summary, recombination factor Rad51 over-expression in invasive ductal breast cancer classified as PCI correlates with clinical tumor parameters like tumor grading and hormonal receptor status. Since Rad51 in the tumors represents the wild-type form of the protein, over-expression is the result of epigenetic changes in tumor cells.
Recently, epigenetic phenomena have been described as being responsible for the down-regulation of BRCA1 expression in sporadic breast cancers (Yoshikawa, K., et al., clin.
Canc. Res. 5:1249-1261 (1999); Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999); Dobrovic, A. and Simpfendorfer, D., Canc.
Res. 57:3347-3350 (1997); Mancini, D.N., et al., Oncogene 16:1161-1169 (1998)). Therefore BRCA1 expression was determined in our collective of breast cancer specimens using AB-1 (Calbiochem, Schwalbach, Germany), a monoclonal anti BRCA1 antibody providing optimal results in paraffin embedded tissue (Wilson, C.A., et al., Nat. Genet. 21:236-140 (1999)). In agreement with Wilson and co-workers we found BRCA1 staining restricted exclusively to cell nuclei.
Occasional additional cytoplasmic staining was registered in only two out of 98 specimens analyzed.
In contrast to Rad51, differences in BRCA1 staining intensities were subtle ranging from weak brown to dark-brown.
Consequently, a scoring system based on the criteria established by Wilson, C.A., et al., Nat. Genet.
21:236-240 (1999) was used to evaluate BRCA1. Figure 10 shows staining patterns representative of this scoring system for BRCA1. Figure 8 gives examples of BRCA1 expression in relation to tumor grading. Statistical analysis of 108 tumor specimens confirms the inverse correlation between BRCA1 expression and tumor grading (Figure 9) first described by Wilson and co-workers (Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)). Although there is not necessarily a correlation between Rad51 over-expression and loss of BRCA1 (Figure 9), the data establishes the correlation between both parameters and tumor grading.
Table 1 Statistical analysis of Rad51 in invasive ductal breast carcinoma n: number of cases; n~: number of cases in a particular class; PCI: positive stained cell index; IRS:
immunoreactive score (Remmele and Stegner, 1987); SII: staining intensity index; nn: test not necessary; ns: not significant; */**I***: p<0.05/0.01/0.001 (if necessary, Bonferroni-correction was applied); H-test: according to Kruskal and Wallis; U-test: according to Mann and Whitney.
Table 1 parameter n class n~ Rad51 H- U-test (PCI; tes median t tumor size 105 1 36 10,35 ** 1:2*, 1:3ns, 1:4ns (T) 2 44 20,5 2:3nx, 2:4ns, 3:4ns 3 6 24,9 4 19 16,4 nodal status97 0 48 18,35 ns nn (N) 1 42 14,75 2 7 22,5 grading (G) 107 1 28 5,4 ***1:2**, 1:3**, 2:3**

2 49 16,4 3 30 25,3 Ki67 (PCI) 104 PCI<25,7 51 10,1 nn ***

PCI>35,4 53 20,5 p53 (PCI) 101 PCI<35,4 51 16,5 nn ns PCI>35,4 50 16,45 BRCA1 (S11) 98 0 15 17,6 0 0:1 ns, 0:2ns, 0:3ns, 1 44 17,2 1:2nd, 1:3ns, 2:3ns 2 27 10,1 3 12 23,75 estrogen 105 IRS<6 54 20,55 nn **

receptor IRS>6 51 12 status progesterone105 IRS<6 57 19,6 nn ns receptor IRS>6 48 13,4 status The development of cancer is accompanied by the accumulation of mutations in proto-oncogenes and tumor suppressor genes. In addition, cancer related genes may also be dysregulated by epigenetic mechanisms as demonstrated recently for the BRCA1 tumor suppressor gene in sporadic breast cancer (Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)). The biological function of BRCA1 is not understood in detail, but it appears to be involved in DNA double strand break (DSB) repair (Feunteun, J., Mol. Med. Today4:263-270 (1998)) via a pathway, which relies on homologous recombination (Hendrickson, E.A., Am. J. Hum. Genet. 61:795-800 (1997)). BRCA1 protein is found in complex with Rad51, the key enzyme of homologous recombination (Scully, R., et al., Cell 88:265-275 (1997)).
This study demonstrates the statistically significant positive correlation between over-expression of wild-type Rad51 protein in tumor cells and tumor grading of invasive ductal breast cancer. In confirmation of previous reports, BRCA1 expression showed an inverse correlation with tumor grading (Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)). Although there does not appear to be a direct correlation between Rad51 PCI and BRCA1 score, the result that over-expression of Rad51 increases during dedifferentiation whereas BRCA1 expression decreases, indicates that both incidents confer advantages during tumor progression.
Loss of BRCA1 during murine embryogenesis results in accumulation of DNA
damage that triggers activation of p53 dependent pathways leading to cell cycle arrest or apoptosis. Cell survival is increased in mouse embryos, nullizygous for BRCA1 and p53 (Hakem, R., et al., Cell 85:1009-1023 (1996); Hakem, R., et al., Nat. Genet. 16:298-302 (1997); Xu, X., et al., Nat.
Genet. 22:37-43 (1999)).
We assert that accumulating DNA damage in BRCAI defective breast cancer cells triggers apoptosis pathways unless permissive events like inactivation of p53 function occur to prevent elimination of damaged cells (Crook, T., et al., Lancet 350:638-639 (1997)). Loss of p53 function accelerates breast cancer development in BRCA1 hemizygous transgenic mice (Xu, X., et al., Nat.
Genet. 22:37-43 (1999)). In this model system, we assert that inactivation of BRCA1 leads to an increase of mutation rates of all genes, including tumor suppressor genes and oncogenes. Wild-type p53 acts against the establishment of this phenotype by inducing either cell cycle arrest via p21 or apoptotic cell death (Xu, X., et al., Nat. Genet. 22:37-43 (1999); Sourvinos, G. and Spandidos, D.A., Biochem. Blophys. Res.
Commun., 245:75-80 (1998)). We assert that overexpression of Rad51 is also a permissive event for tumor progression since it will help to keep the DNA damage, which accumulates upon down-regulation of BRCA1 at a tolerable level for cell survival, thus inhibition thereof will lead to apoptosis. Thus, epigenetic dysregulation of protein expression manifested as down-regulation and/or over-expression of wild-type Rad51 contribute to the development of sporadic breast cancer.
EXAMPLE 3: RAD51 TRIGGERS A P53 INDEPENDENT CELL CYCLE CONTROL PATHWAY
Materials and Methods Cell Culture Cell lines UiRad51, over-expressing Rad51 protein and UiLacZ, producing (3-galactosidase were prepared. In brief, Rad51 cDNA (Stiirzbecher, H.W., et al., Embo J 15:1992-2002 (1996)) was inserted into plasmid pIND and co-transfected with a modified pVgRxR
(Invitrogen, de Schelp, the Netherlands, S.M, and H.-W.S., in preparation) into U-2 OS cells (Ponten, J. &
Saksela, E., Int J
Cancer2:434-47 (1967)) by the CaPO, precipitation method (Graham, F.L. & Eb, A.J.v.d., Virology 52:456-67 (1973)). Clones resistant to 6418 (500 Nglml, Life Technologies, Egenstein, Germany) and Zeocin (250 Ng/ml, Invitrogen) were picked by cloning ring, expanded and tested for Rad51 overexpression by immunohistochemistry. To exclude potential heterogeneity in the cell population, the original UiRad51 culture was subcloned. Growth retardation in response to Rad51 induction was retained in seven of 12 subclones. Further studies were performed with subclone 2 of UiRad51. Cell line UiRad51-blue was established from UiRad51 (subclone 2) by stable transfection with an E. coli (3-galactosidase reporter for p53 transcriptional activation (pRGCOFosLacZ
(Frebourg, T., et al., Cancer Res 52:6976-8 (1992)) and a plasmid conferring hygromycin resistance (pDSP
Hygro; (Pfarr, D.S., et al., Dna 4:461-7 (1985)). UiRad51-blue cells were selected with 80 Ng/ml hygromycin B (Roche Molecular Biochemicals, Mannheim, Germany) and maintained in 40 Ng/ml. All cells were grown in Dulbecco's Modified Eagle medium (DMEM, Life Technologies, Egenstein, Germany), supplemented with 10% fetal calf serum. The ecdysone analogues, muristerone A and ponasterone A, respectively (Invitrogen), were dissolved at ImM in absolute ethanol and used at a final concentration of 1 NM to induce expression of ectopic Rad51 or (3-galactosidase. Non-induced controls were supplemented with the same amount of ethanol. For UV treatment, media were removed and cells irradiated for 1 second on a TFL-20M transilluminator (Biometra, Gottingen, Germany) equipped with 312nm bulbs.
According to biological calibration using UiRad51-blue cells, this corresponds to approximately 270J/m2. Cells were then grown in fresh medium, as were non-irradiated controls. Calicheamicin y, (Wyeth-Ayerst research, Pearl River, NY, USA) was dissolved in absolute ethanol at 100 NM and stored at -80°C. Etoposide in solution (Vepesid J) was purchased by Bristol GmbH, Munchen, Germany.
Cell Cycle Analysis Cells were trypsinised at the time indicated, collected by centrifugation, washed and resuspended in PBS. An aliquot of 200 NI of cell suspension was transferred to 1 ml of ice cold 70% ethanol and stored at 4°C until use. Fixed cells were collected by centrifugation, washed in PBS and digested with 400 Ng/ml DNase-free RNase for Ih at room temperature with agitation.
Propidium iodide was added to a final concentration of 15 Ng/ml. 30.000 events were analyzed on a FACscan using the "cell fit"
cell cycle analysis software (version 2.0; Becton Dickinson, Heidelberg, Germany).
Western Blotting Equal cell numbers were pelleted and lysed in 2x SDS sample buffer (5% SDS;
125mM Tris/CI, pH
6,8; 10% glycerol; 0,02 % bromophenol blue and 12,5% freshly added (3-mercaptoethanol), boiled for minutes and nucleic acids were removed by digestion with 260 U Benzonase for 30min at 37°C
(Merck, Darmstadt, Germany). Transfer was essentially carried out as described (Towbin, H., et al., 10 Proc Natl Acad Sci USA 76:4350-4 (1979)). Rad51 was detected with monoclonal antibody 1G8 (Buchhop et al., 1996), p21 Waf' with monoclonal antibody 6B6 (Pharmingen, Hamburg, Germany) and p53 with a polyclonal sheep antiserum. Peroxidase coupled secondary antibodies were supplied by Amersham (Braunschweig, Germany). Signals were generated with chemiluminescent substrate Super Signal Ultra (Pierce, Rockford, IL, USA).
~3-Galactosidase Assay Cells were trypsinised, washed once with PBS, resuspended in 100 NI assay buffer (60mM Naz HP04;
40mM NaHzP04; 10mM KCI; ImM MgSO 4) and lysed by three freeze-thaw cycles (-70°C/+37°C). The total protein content was measured by the bichinonic acid (BCA) method according to the protocol of the supplier (Pierce) and the protein concentration equalized by addition of assay buffer. Aliquots were diluted in assay buffer containing 50mM (3-mercaptoethanol, adjusted to contain 6.7 mg/ml ortho-nitrophenyl-(3-D-galactopyranoside (ONPG; Sigma, Deisenhofen, Germany) and incubated at 37°C for 1 hour. Adding Na2C03 to a final concentration of 143mM
stopped the reaction and OD
readings were taken at 420nm.
Luciferase Assays Cells were trypsinised, washed in PBS and lysed in cell lysis buffer (Promega, Mannheim, Germany).
Cell lyeates were assayed for protein content using the BCA assay kit (Pierce) and diluted with lysis buffer to contain identical protein levels. Luciferase activity was measured in triplicate using the Steady-GIoT"" as say kit (Promega) in a Microlumate LB 96P luminom eter ( K G
& G B erthold , Freiburg, Germany) according to the suppliers recommendations.
Results Growth retardation and cell cycle arrest in response to high-level expression of Rad51 The human osteosarcoma cell line U-2 OS was used as parental cell line to create clone UiRad51 which inducibly expresses Rad51. As a control, the inducibly E. coli ~i-galactosidase producing clone UiLacZ was established. Treating the cells with muristerone A or ponasterone A, analogues of the insect steroid hormone ecdysone, induces expression of the respective ectopic proteins. From experiments obtained in rats pharmacological effects of these metamorphosing insect hormones can be excluded (Masuoka, M., et al., Jap. J. Pharmac. 20:142-156 (1970)). Figure 11A shows the induction of ectopic Rad51 protein by muristerone A treatment. Equal cell numbers were applied to each lane in this analysis and in all other relevant experiments in need of quantitative evaluation. Due to the short exposure time in the experiment shown, only ectopic protein is visible. In order to test, whether high-level expression of Rad51 would affect cell proliferation, growth curves were recorded.
Proliferation of U-2 OS parental cells was not affected by muristerone A
treatment confirming that steroid treatment alone does not affect cell proliferation of this cell line, while growth of UiLacZ controls was slightly retarded, presumably due to the high synthesis rate of ectopically expressed protein. By contrast, induction of Rad51 expression triggered serious growth retardation of UiRad51, while non-treated UiRad51 cells proliferated exponentially with a doubling time of approximately 24h. There was no evidence of cell death in response to Rad51 over-expression as determined by Annexin V
FLUOS (Roche Biochemicals, Mannheim, Germany) and propidium iodide staining (data not shown).
It is well established that the parental cell line U2-OS expresses wild-type p53 at levels comparable to normal diploid fibroblasts (Diller, L., et al., Mol Cell Biol 10:5772-81 (1990)). In response to DNA
damage or upon ectopic expression of the inhibitor of cyclin dependent kineses, p21 Waf', U2-OS cells arrest in G, and GZ/M (van Oijen et al., 1998). To assess whether the newly established cell clones UiLacZ and UiRad51 still respond to genotoxic stress with cell cycle arrest, cells were treated either with etoposide (not shown) or were W irradiated. Cell cycle analyses 56 hours after treatment reveal that both cell clones halt the cell cycle in G, and GZ/M (Figure 11 B).
Treatment with the DNA double strand break (DSB) inducing agent calicheamicin y, leads to cell cycle arrest exclusively in GZ/M
while the cells arrest exclusively in G, after serum deprivation (data not shown). These control experiments indicate that cell cycle control mechanisms appear to be intact in all cell clones used in this study. Within 26 hours of Rad51 over-expression the number of UiRad51 cells in S-Phase dropped from 53,8% to 18,3%, reaching its minimum of only 13% at 56 hours (Figure 11C). In non-induced controls 55,1 %, 51,7% and 40,5% of cells were found in S-phase at the respective timepoints (data not shown). During 26h of Rad51 induction, the fraction of Gz/M cells increased from 16,4% to 46,0%, compared to 16,9% and 13,9% in non-induced controls. By contrast, the fraction of cells in G, raised only slightly in induced cells (29,8%, 35,1% and 46,7%, at Oh, 26h and 56h) compared to non-induced controls (27,4%, 34,3% and 36,4%). For non-induced UiRad51 and for UiLacZ cells the increase in GI cells is dependent on cell density upon prolonged cultivation. However, this does not apply to induced UiRad51 cells, since they no longer proliferate. We therefore conclude that expressing high levels of Rad51 induces an arrest of cell proliferation in the G, and G2/M phases.
When UiRad51 cells were induced for 24h and were subsequently cultured for additional 50h in absence of muristerone A, cell cycle arrest was still maintained, although the Rad51 levels return to normal within 16h after cessation of treatment (data not shown). These findings indicate that once cell cycle arrest has been implemented, high levels of Rad51 are dispensable to prevent cell proliferation for at least additional 50h.
Rad51 induces p21"'a" in a p53 independent manner by activating the waf 1 promoter The inhibitor of cyclin dependent kineses, p21'"a", mediates cell cycle arrest (e1 Deiry, W.S., et al., Cell 75:817-25 (1993)). Over-expression of p21'"a" is sufficient to trigger both, G, and Gz/M arrest, in U2-OS cells, the line used to establish UiRad51 and UiLacZ (van Oijen, M., et al., Am J. Clin Pathol 110:24-31 (1998)). In order to test whether p21'"a" is involved in Rad51 dependent cell cycle arrest, p21'"a" protein content was determined by Western blot analysis. Under normal conditions, UiRad51 cells contain low levels of p21'"a" (Figure 12A, lane 1) which increase upon UV irradiation (Figure 12A, lane 2). Accumulation of p21'"a" protein to even higher levels was found in response to expression of ectopic Rad51 for 48h (Figure 12A, lane 3). There was no further increase in p21'"a" protein content, when both ectopic Rad51 expression and additional UV irradiation were applied (Figure 12A, lane 4).
In UiLacZ control cells there was no influence of muristerone A treatment on p21'"a" expression level, while UV irradiation resulted in p21'"a" induction (data not shown). Therefore over-expression of Rad51 is sufficient to induce cell cycle arrest which correlates with an induction of p21~"af'.
Since the waf 1 gene is activated on the transcriptional level (e1 Deiry, W.S., et al., Cell 75:817-25 (1995)) we analyzed the waf 1 promoter for responsiveness to ectopically expressed Rad51 using reporter plasmid WWP-Luc (e1 Deiry, W.S., et al., Cel175:817-25 (1993)). This construct carries the firefly luciferase gene under control of the distal 2.4kb part of the waf 7 promoter. Consistent with the protein data, there was an increase in luciferase activity upon ponasterone A
treatment in UiRad51, but not in UiLacZ cells (Figure 12B). Additional controls include transfection of both cell lines with pGL3 (Promega, Mannheim, Germany) the vector used to construct WWP-Luc providing the promoterless luciferase gene (data not shown). A control for transfection efficiency was not necessary since cells were transfected as one batch. Half were induced with ponasterone A, the other was mock-induced with ethanol. Furthermore, as shown below, in adapted UiRad51 cells WWP-Luc is not responsive to Rad51 over-expression (Figure 13C). These data show that high level expression of Rad51 specifically activates the waf 1 promoter and that the element responsive to Rad51 is located within the 2.4kb region used in the reporter construct.
One of the major regulators that trigger activation of the waf 1 promoter is p53 and p53 dependent cell cycle arrest is at least partially mediated by p21'"a" (e1 Deiry, W.S., et al., Ce1175:817-25 (1993)). In order to explore whether Rad51 requires the transactivator activity of p53 to induce p21'"af', cell line UiRad51-blue was established from UiRad51 by stable integration of the highly p53 specific reporter pRGC~fos-LacZ (Frebourg, T., et al., Cancer Res 52:6976-8 (1992)). Thus, substrate cleavage by /3-galactosidase can be used as direct measure of p53 transactivator activity in this cell clone.
Muristerone A dependent Rad51 over-expression in UiRad51-blue was verified by Western blot analysis as was Rad51 dependent cell cycle arrest (data not shown). As expected, UV irradiated UiRad51-blue cells exhibit elevated levels of (3-galactosidase activity compared to non-irradiated controls, indicating that under these conditions p53 becomes competent to work as transactivator (Figure 12C). On the other hand, induction of Rad51 expression with muristerone A did not lead to an increase of (3-galactosidase activity beyond basal levels. These results argue that Rad51 triggers stimulation of p21'"af' expression independent of p53 transactivator activity.
Cells adapt to high levels of Rad51 After 56h of ectopic Rad51 expression, only 13% of cells are found in S-phase.
When UiRad51 cells were cultured on in presence of muristerone A, the fraction of cells in S-phase increased again to 15%
at 78h and to 21% at 152h (Figure 13A). Long-term cultivation (28d) of induced UiRad51 led to a complete release from cell cycle arrest although Rad51 was permanently produced at high levels.
Under such conditions as many as 40% of S-phase cells were detected by flow cytometry compared to 38% in untreated cultures. Cells adapt to high levels of Rad51 with time and re-enter proliferation.
Release from cell cycle arrest was paralleled by a decline of p21'"af' protein levels (Figure 13B). An increase in p21'"a" levels was already visible after 24h (data not shown) while its maximal amount was found at 56h and 78h of induction and thereafter decreased to very low basal levels. Thus, Rad51 causes a transient cell cycle arrest via reversible and p53 independent induction of p21'~~f'.
To learn more about the underlying mechanism of adaptation, viraf 1 promoter activity was analyzed after transient transfection of reporter construct WWP-Luc and assayed 48h thereafter. In adapted UiRad51, i.e., cells that had been induced for 28 days. The level of Luciferase activity in adapted cells does not exceed the level detectable in control cells (compare Figure 12B).
Removal of the drug from adapted cells 48h prior to assaying did not cause a change of Luciferase activity above basal level (Figure 13C, column 3). Here the question arises whether the expression of p21 Way' can be re-stimulated in adapted cells after a period of recovery from Rad51 over-expression. Time-course experiments confirmed that the ectopically expressed Rad51 protein is completely degraded 16h after removal of muristerone A (data not shown). Consequently, adapted cells were allowed to recover for 48h in absence of the drug, transfected with WWP-Luc, and Rad51 expression was re-induced for another 48h (Figure 13C, column 6). As control, cells were left non-induced after transfection (Figure 13C, column 5). The data shows the failure of re-activation of the waf 1 promoter in response to a second round of Rad51 over-expression. Assuming, that expression of p21'"a"
was responsible for Rad51 triggered cell cycle arrest, one might expect that reinduction of Rad51 in adapted cells should not affect cell proliferation. To test this hypothesis, adapted cells were cultured in absence of muristerone for 2 (data not shown) or 11 days, re-induced for 72h and analyzed by flow cytometry (Figure 14A, panel 2). As control, adapted cells were left non-induced for 14 days prior to cell cycle analysis (Figure 14A, panel 1 ). Cell cycle distribution, of re-induced and control cells is indistinguishable. Consequently, 11 days without high levels of Rad51 are not sufficient to re-establish Rad51 triggered cell cycle arrest. The loss of waf 1 promoter activation and subsequent cell cycle arrest after adaptation to high level expression of Rad51 prompted us to sort out whether other p21'"8"
mediated cell proliferation control pathways might also be affected. Cells were treated as in Figure 14A panels 1 and 2 but in addition UV irradiated 24 hours before harvest. Flow cytometric analysis revealed that adapted cells do arrest in G, and GZ/M in response to UV-irradiation as do non-adapted cells (Figure 14A, panels 3, 4).
As shown above, Rad51 induces a transient cell cycle arrest in non-adapted cells independent of p53.
In non-adapted, non-induced UiRad51 cells the p53 dependent and p21'"a"
mediated cell cycle arrest in response to UV-irradiation is intact: p53 accumulates (not shown), is activated as transcription factor (Figure 12C), p21 Wa" accumulates (Figure 12A) and cells arrest in G, and GZ/M (Figure 11 B).
To test whether p53 accumulation in response to UV-irradiation is affected by adaptation to Rad51, an aliquot of the cells shown in Figure 14A were used for the determination of p53 levels (Figure 14B, lane numbers refer to panel numbers of Figure 14A). Western blot analysis demonstrates that the ability of p53 to accumulate in response to UV-irradiation is still intact.
Consequently, the p53 dependent pathway is not affected by adaptation to high level expression of Rad51. Moreover, serum dependence is conserved since after serum withdrawal adapted UiRad51 cells accumulate in G, as do non-adapted, non-induced UiRad51 and UiLacZ (data not shown). Therefore only the Rad51 triggered cell cycle regulation pathway appears to be affected by adaptation to Rad51 overexpression.

Claims (32)

We claim:

1. A method of diagnosing an individual for cancer comprising a) determining the level of Rad51 expression in a sample from an individual;
and b) comparing said level to a control level wherein a change from said control indicates cancer.

2. A method according to claim 1 wherein the cancer is selected from the group consisting of breast cancer, brain cancer, pancreatic cancer, prostate cancer, colon cancer, lymphoma, and skin cancer.

3. A method according to claim 1 wherein the level of Rad51 expression is determined by the level of Rad51 protein.

4. A method according to claim 1 wherein said level is determined through the use of polyclonal antibodies.

5. A method according to claim 1 wherein said level is determined through the use of monoclonal antibodies.

6. A method according to claim 4 or 5 wherein said antibodies are raised against eukaryotic Rad51.

7. A method according to claim 6 wherein said eukaryotic Rad51 is mammalian Rad51.

8. A method according to claim 1 wherein the level of Rad51 expression is determined by the level of Rad51 nucleic acid.

9. A method of prognosing an individual for cancer comprising a) determining the level of Rad51 expression in a sample from an individual;
and b) comparing said level to a control which indicates the severity of cancer so as to provide a prognosis.

10. A method according to claim 9 wherein the cancer is selected from the group consisting of breast cancer, brain cancer, pancreatic cancer, prostate cancer, colon cancer, lymphoma, and skin cancer.

11. A method according to claim 9 wherein the level of Rad51 expression is determined by the level of Rad51 protein.

12. A method according to claim 9 wherein said level is determined through the use of polyclonal antibodies.

13. A method according to claim 9 wherein said level is determined through the use of monoclonal antibodies.

14. A method according to claim 12 or 13 wherein said antibodies are raised against eukaryotic Rad51.

15. A method according to claim 14 wherein said eukaryotic Rad51 is mammalian Rad51.

16. A method according to claim 9 wherein the level of Rad51 expression is determined by the level of Rad51 nucleic acid.

17. A method for identifying a cancer cell in a primary tissue sample, comprising a) determining the level of Rad51 in a primary tissue sample of interest; and b) comparing said level of Rad51 to a non-cancer tissue sample;
wherein a difference in said level indicates a cancer cell is in the tissue sample of interest.

18. A kit for detecting a normal or abnormal level of Rad51 expression in a cell or tissue comprising:
a) binding agent for Rad51, b) a detectable label; and c) a control which indicates a normal level of Rad51 expression or Rad51 expression at various severities of cancer.

19. A method for treating an individual with cancer, comprising administering a Rad51 inhibitor to said individual in an amount effective to inhibit cancer in said individual.

20. The method of claim 19 wherein said Rad51 inhibitor is selected from the group consisting of small molecules and peptides.

21. A method for inducing sensitivity to radiation and DNA damaging chemotherapeutics in an individual with cancer comprising administering to said individual a composition comprising a Rad51 inhibitor in an amount effective to induce said sensitivity.

22. The method of claim 21 wherein said Rad51 inhibitor is selected from the group consisting of small molecules and peptides.

23. A method of inducing apoptosis in a cell comprising administering a Rad51 inhibitor to said cell.

24. The method of claim 23 wherein said cell is a cancer cell.

25. The method of claim 23 wherein said Rad51 inhibitor is selected from the group consisting of small molecules and peptides.

26. A method of determining a predictive outcome of a treatment for cancer comprising determining the level of Rad51 expression in a tissue sample of a patient and correlating said level with a control which indicates the resistance a patient will have to chemotherapy or radiation treatments.

27. A method of inhibiting apoptosis in a cell comprising inducing overexpression of Rad51 in a cell.

28. The method of claim 27 wherein inducing is by administration of a Rad51 nucleic acid.

29. A method of enhancing survival of a cell comprising inducing overexpression of Rad51 in a cell.

30. The method of claim 29 wherein inducing is by administration of a Rad51 nucleic acid.

31. A method of screening for agents which modulate Rad51 expression comprising culturing cells in spheroids and adding a candidate agent to said spheroids and determining Rad51 expression levels before and after adding said candidate agent, wherein a change indicates said candidate agent modulates Rad51 expression.

32. The method of claim 31 wherein said expression is inhibited.