CA2377482A1 - Dihydroorotate dehydrogenase sequence of corynebacterium glutamicum and the use thereof in microbial production of pyrimidine and/or compounds used with pyrimidine - Google Patents
Dihydroorotate dehydrogenase sequence of corynebacterium glutamicum and the use thereof in microbial production of pyrimidine and/or compounds used with pyrimidine Download PDFInfo
- Publication number
- CA2377482A1 CA2377482A1 CA002377482A CA2377482A CA2377482A1 CA 2377482 A1 CA2377482 A1 CA 2377482A1 CA 002377482 A CA002377482 A CA 002377482A CA 2377482 A CA2377482 A CA 2377482A CA 2377482 A1 CA2377482 A1 CA 2377482A1
- Authority
- CA
- Canada
- Prior art keywords
- pyrimidine
- corynebacterium glutamicum
- polypeptide
- sequence
- dihydroorotate dehydrogenase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to nucleotide sequences of a gene (pyrD) for biosynthesis of pyrimidine from <i>Corynebacterium glutamicum</i> and to the use thereof in microbial production of pyrimidine.
Description
' CA 02377482 2001-12-21 p DIHYDROOROTATE DEHYDROGENASE SEQUENCE OF CORYNEBACTERIUM
GLUTAMICUM AND THE USE THEREOF IN MICROBIAL PRODUCTION OF
PYRIMIDINE AND/OR COMPOUNDS USED WITH PYRIMIDINE
The present invention is concerned with the process for producing pyrimidines by fermentation with the aid of a genetically manipulated .organism. This inveritibn comprises the sequence of the dihydroorotate dehydrogenase from Corynebacterium glutamicum and the use thereof for the microbial production of pyrimidiizes and/or pyrimidine-related compounds.
The biosynthetic pathway for pyrimidines is essential for all living .organisms (a review article on this by Switzer, R.L. and Quinn, C.L. is to be found in Bacillus subtilis (editors: Sonenshein, A.L., Hoch, J.A. and Losick, R., American Society for Microbiology, Washington, D.C.), 1993, pp. 343-358. The pyrimidine nucleotides are pyrimidine derivatives and, as such, activated precursors of DNA and RNA and for many biosynthetic pathways. In the pyrimidine nucleosides cytidine, uridine, deoxycytidine and deoxythymidine, a pyrimidine base is bonded to a pentose, and the pyrimidine nucleotides~are phosphate esters of the pyrimidine nucleosides. Pyrimidine nucleosides and pyrimidine nucleotides and derivatives thereof are also important starting compounds for synthesizing valuable drugs such as, for example, CDP-choline, orotic acid or UMP (a review article on this by Kuninaka, A. is to be found in Biotechnology, vol. 6 (editors: Rehm, H.-J. and Reed, G.), VCH, Weinheim, Germany, 1996, pp. 561-612).
Many, but not all, microorganisms are able to synthesize their pyrimidine nucleotides both de novo and from pyrimidine bases and pyrimidine nucleosides supplied from outside. Pyrimidine bases and/or pyrimidine nucleosides normally do not occur inside ' CA 02377482 2001-12-21 cells. However, under some conditions of growth they may be formed in excess and are then secreted into the culture medium. For this reason, microorganisms can be employed for the fermentative production of pyrimidine nucleotides and/or related compounds.
The biosynthetic efficiency "of microorganisms for pyrimidine nucleotides can be optimized by genetically manipulating the pyrimidine biosynthetic pathway.
Genetic manipulation means in this connection that the number of gene copies and/or the rate of transcription of the genes for the pyrimidine synthetic pathway is increased. As a consequence of this, the proportion of gene product and the intracellular enzymatic activity increases. An increased enzymatic activity leads to increased conversion of compounds supplied in the nutrient medium into pyrimidine nucleotides and/or related compounds and thus increases the synthetic efficiency. Thus, it has been possible to show that, for example, an increase in the activity of dihydroorotate dehydrogenase, which catalyzes the oxidation of (S)-dihydroorotate to orotate - this is the fourth stage in de novo pyrimidine biosynthesis for pyrimidine nucleotides - increases the efficiency of UMP synthesis ~ in Corynebacterium ainmoniagenes (Nudler, A.A., Garibyan, A.G. and Bourd, G.I. (1991) FEMS Microbiol. Lett. 82:263-266).
The invention is concerned with the novel pyrD gene for the dihydroorotate dehydrogenase of the pyrimidine biosynthetic pathway from Corynebacterium glutamicum and its use for preparing pyrimidine nucleotides and/or pyrimidine-related compounds.
One part of the invention comprises the pyrD gene product. SEQ ID N0. 2 describes a polypeptide sequence.
The pyrD gene encodes a polypeptide of 322 amino acids with ~: molecular weight of 33953. The present invention-' CA 02377482 2001-12-21 ?:
oass~oflooa . - 3 -is, however, also concerned with functional derivatives of ~ this polypeptide which can be obtained by replacing one or more amino acids in SEQ ID N0. 2, preferably up to 25~ of .the amino acids, most suitably up to 15~; by deletion, insertion or substitution or by a combination of deletion, insertion and substitution. The term functional derivative means that the enzymit activity of the derivative is still of the same order of magnitude as that of the polypeptide having the sequence SEQ ID N0. 2.
Another part of the invention comprises the polynucleotide sequences which encode the pol~peptides described above. The polynucleotide'sequences can be generated starting from sequences isolated. from.
Corynebacterium.glutamicum (i.e. SEQ ID N0. 1), in which these sequences are modified by site-directed mutagenesis or, after back-translation of the corres-ponding polypeptide using the genetic code, a total chemical synthesis is carried out.
These polynucleotide sequences can most suitably be employed in the form of gene constructs for the transformation of host organisms, preferably of microorganisms.' These gene constructs consist of at least on.e copy of one of the polynucleotides together with at least one regulatory sequence. Regulatory sequences comprise promoters, terminators, enhancers and ribosome binding sites. w w Preferred host organisms for transformation with these gene constructs are Corynebacterium and Bacillus species, but any eukaryotic microorganisms can also be employed for this purpose, preferably strains of yeast of the genus Ashbya, Candida, Pichia, Saccharomyces and Hansenula.
~rrother part of the invention comprises the process for ' CA 02377482 2001-12-21 ,. ' ooss~oooa4 - 4 -preparing pyrimidines and pyrimidine derivatives by cultivation of a host organism which is transformed in the manner described above, as the subsequent isolation .
of the pyrimidines. A pyrimidine derivative~means a compound having a pyrimidine ring which can be prepared by transforming a host organism with one of the polynucleotides corresponding to the present invention. -.
The processes and procedures for cultivating micro 20 organisms and for isolating pyrimidines from a microbial production are familiar to trained staff.
The following examples describe how the invention arose and its application in the genetic manipulation of microorganisms for increased .efficiency of production of pyrimidine nucleotides and/or related compounds..
Example 1 Construction of a genome library from Corynebacterium glutamicum ATCC 13032 DNA from the genome of Coryn eba c~t eri um g1 a tami cum.
ATCC 13032 can be obtained by standard methods which.
have already been described, for example by .I..Altenbuchner and J. Cullum (1984, Mol. Gen. Genet.
195:134-138). The genome library can be prepared by standard protocols (for example: Sambrook, J. et a1:
(1989) Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press) using any cloning vector, for example pBluescript II KS- (Stratagene.) or ZAP Expresses (Stratagene). It is moreover possible t~o w use any size of fragments, preferably Sau3AI fragments with a length of 2-9 kb, which can be incorporated in..
cloning vectors with digested BamHI.
' CA 02377482 2001-12-21 Example 2 Analysis of the nucleic acid sequence to the .genome library Individual E. co3i clones can be selected from the- ' genome library produced in.example 1. E.'coli cells, are .
cultivated by standard methods in suitable media (e. g.
LB supplemented with 100 mg/1 ampicillin), and the plasmid DNA can then be isolated. If genome fragments from the DNA of Corynebacterium glutamicum .are cloned into pBluescript II KS- (see example 1), the DNA can be sequenced with the aid of the ~oligonucleotides 5'-AATTAACCCTCACTAAAGGG-3' and ~5'-GTAATACGACTCACTATA
. GGGC-3'.
Example 3 Computer analysis of the sequences of isolated nucleic acids The nucleotide sequences can join together for exa~le with the aid of the BLASTX algorithm (Altschul et al.
(1990) J. Mol. Biol. 225:403-410). It is possible in this way to discover novel sequences and elucidate the function of these novel genes.
Example 4 Identification of an E. coli clone which comprises the ..
gene for dihydroorotate dehydrogenase (EC 1.3.3.1) Analysis of the E. coli clones as described in example 2, which was followed by analysis, as described in example 3, of the sequences obtained thereby, revealed a sequence as described by SEQ ID NO. 1. Use of the BLASTX algorithm (see example 3) revealed that this sequence was similar to the dihydroorotate ,' CA 02377482 2001-12-21 Y
dehydrogenase (PyrD; EC 1.3.3.1) from various organisms. The greatest similarity was with the dihydroorotate dehydrogenase from Mycobacterium leprae (SWISSPROT p46727; 67~ agreement at the amino acid level}.
Examples 5.
Use of the gene for the dihydroorotate dehydrog.enase (pyrD) from Corynebacterium glutamicum for .producing pyrimidine and/or pyrimidine-related compounds .
The gene for the dihydraorotate dehydrogenase from Corynebacter,iun~ glutamicum can be introduced with the aid of suitable cloning and/or expression systems into Corynebacterium glutamicum or into any other microorganism. It is possible to produce genetically manipulated microorganisms which differ from the wild .
type in the activity or the number of copies of the genes. These novel, genetically manipulated strains can be employed for producing pyrimidine and/or pyrimidine related compounds.
Sequence list (I) General information (1) Applicant (A) Name: BASF-LYNX Biosci-ence AG
(B) Street: Im Neuenheimer Feld 515 (C) City: Heidelberg (D) Country: Germany (E) Postal code: 69120 (F) Telephone: 06221/4546 (G) Fax: 06221/454770 (2) Title: The sequence of the dihydroorotate dehydrogenase from Corynebacterium glutamicum and the use thereof in the microbial production of pyrimidines and/or pyrimidine-related compounds (3) Number of sequences:
GLUTAMICUM AND THE USE THEREOF IN MICROBIAL PRODUCTION OF
PYRIMIDINE AND/OR COMPOUNDS USED WITH PYRIMIDINE
The present invention is concerned with the process for producing pyrimidines by fermentation with the aid of a genetically manipulated .organism. This inveritibn comprises the sequence of the dihydroorotate dehydrogenase from Corynebacterium glutamicum and the use thereof for the microbial production of pyrimidiizes and/or pyrimidine-related compounds.
The biosynthetic pathway for pyrimidines is essential for all living .organisms (a review article on this by Switzer, R.L. and Quinn, C.L. is to be found in Bacillus subtilis (editors: Sonenshein, A.L., Hoch, J.A. and Losick, R., American Society for Microbiology, Washington, D.C.), 1993, pp. 343-358. The pyrimidine nucleotides are pyrimidine derivatives and, as such, activated precursors of DNA and RNA and for many biosynthetic pathways. In the pyrimidine nucleosides cytidine, uridine, deoxycytidine and deoxythymidine, a pyrimidine base is bonded to a pentose, and the pyrimidine nucleotides~are phosphate esters of the pyrimidine nucleosides. Pyrimidine nucleosides and pyrimidine nucleotides and derivatives thereof are also important starting compounds for synthesizing valuable drugs such as, for example, CDP-choline, orotic acid or UMP (a review article on this by Kuninaka, A. is to be found in Biotechnology, vol. 6 (editors: Rehm, H.-J. and Reed, G.), VCH, Weinheim, Germany, 1996, pp. 561-612).
Many, but not all, microorganisms are able to synthesize their pyrimidine nucleotides both de novo and from pyrimidine bases and pyrimidine nucleosides supplied from outside. Pyrimidine bases and/or pyrimidine nucleosides normally do not occur inside ' CA 02377482 2001-12-21 cells. However, under some conditions of growth they may be formed in excess and are then secreted into the culture medium. For this reason, microorganisms can be employed for the fermentative production of pyrimidine nucleotides and/or related compounds.
The biosynthetic efficiency "of microorganisms for pyrimidine nucleotides can be optimized by genetically manipulating the pyrimidine biosynthetic pathway.
Genetic manipulation means in this connection that the number of gene copies and/or the rate of transcription of the genes for the pyrimidine synthetic pathway is increased. As a consequence of this, the proportion of gene product and the intracellular enzymatic activity increases. An increased enzymatic activity leads to increased conversion of compounds supplied in the nutrient medium into pyrimidine nucleotides and/or related compounds and thus increases the synthetic efficiency. Thus, it has been possible to show that, for example, an increase in the activity of dihydroorotate dehydrogenase, which catalyzes the oxidation of (S)-dihydroorotate to orotate - this is the fourth stage in de novo pyrimidine biosynthesis for pyrimidine nucleotides - increases the efficiency of UMP synthesis ~ in Corynebacterium ainmoniagenes (Nudler, A.A., Garibyan, A.G. and Bourd, G.I. (1991) FEMS Microbiol. Lett. 82:263-266).
The invention is concerned with the novel pyrD gene for the dihydroorotate dehydrogenase of the pyrimidine biosynthetic pathway from Corynebacterium glutamicum and its use for preparing pyrimidine nucleotides and/or pyrimidine-related compounds.
One part of the invention comprises the pyrD gene product. SEQ ID N0. 2 describes a polypeptide sequence.
The pyrD gene encodes a polypeptide of 322 amino acids with ~: molecular weight of 33953. The present invention-' CA 02377482 2001-12-21 ?:
oass~oflooa . - 3 -is, however, also concerned with functional derivatives of ~ this polypeptide which can be obtained by replacing one or more amino acids in SEQ ID N0. 2, preferably up to 25~ of .the amino acids, most suitably up to 15~; by deletion, insertion or substitution or by a combination of deletion, insertion and substitution. The term functional derivative means that the enzymit activity of the derivative is still of the same order of magnitude as that of the polypeptide having the sequence SEQ ID N0. 2.
Another part of the invention comprises the polynucleotide sequences which encode the pol~peptides described above. The polynucleotide'sequences can be generated starting from sequences isolated. from.
Corynebacterium.glutamicum (i.e. SEQ ID N0. 1), in which these sequences are modified by site-directed mutagenesis or, after back-translation of the corres-ponding polypeptide using the genetic code, a total chemical synthesis is carried out.
These polynucleotide sequences can most suitably be employed in the form of gene constructs for the transformation of host organisms, preferably of microorganisms.' These gene constructs consist of at least on.e copy of one of the polynucleotides together with at least one regulatory sequence. Regulatory sequences comprise promoters, terminators, enhancers and ribosome binding sites. w w Preferred host organisms for transformation with these gene constructs are Corynebacterium and Bacillus species, but any eukaryotic microorganisms can also be employed for this purpose, preferably strains of yeast of the genus Ashbya, Candida, Pichia, Saccharomyces and Hansenula.
~rrother part of the invention comprises the process for ' CA 02377482 2001-12-21 ,. ' ooss~oooa4 - 4 -preparing pyrimidines and pyrimidine derivatives by cultivation of a host organism which is transformed in the manner described above, as the subsequent isolation .
of the pyrimidines. A pyrimidine derivative~means a compound having a pyrimidine ring which can be prepared by transforming a host organism with one of the polynucleotides corresponding to the present invention. -.
The processes and procedures for cultivating micro 20 organisms and for isolating pyrimidines from a microbial production are familiar to trained staff.
The following examples describe how the invention arose and its application in the genetic manipulation of microorganisms for increased .efficiency of production of pyrimidine nucleotides and/or related compounds..
Example 1 Construction of a genome library from Corynebacterium glutamicum ATCC 13032 DNA from the genome of Coryn eba c~t eri um g1 a tami cum.
ATCC 13032 can be obtained by standard methods which.
have already been described, for example by .I..Altenbuchner and J. Cullum (1984, Mol. Gen. Genet.
195:134-138). The genome library can be prepared by standard protocols (for example: Sambrook, J. et a1:
(1989) Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press) using any cloning vector, for example pBluescript II KS- (Stratagene.) or ZAP Expresses (Stratagene). It is moreover possible t~o w use any size of fragments, preferably Sau3AI fragments with a length of 2-9 kb, which can be incorporated in..
cloning vectors with digested BamHI.
' CA 02377482 2001-12-21 Example 2 Analysis of the nucleic acid sequence to the .genome library Individual E. co3i clones can be selected from the- ' genome library produced in.example 1. E.'coli cells, are .
cultivated by standard methods in suitable media (e. g.
LB supplemented with 100 mg/1 ampicillin), and the plasmid DNA can then be isolated. If genome fragments from the DNA of Corynebacterium glutamicum .are cloned into pBluescript II KS- (see example 1), the DNA can be sequenced with the aid of the ~oligonucleotides 5'-AATTAACCCTCACTAAAGGG-3' and ~5'-GTAATACGACTCACTATA
. GGGC-3'.
Example 3 Computer analysis of the sequences of isolated nucleic acids The nucleotide sequences can join together for exa~le with the aid of the BLASTX algorithm (Altschul et al.
(1990) J. Mol. Biol. 225:403-410). It is possible in this way to discover novel sequences and elucidate the function of these novel genes.
Example 4 Identification of an E. coli clone which comprises the ..
gene for dihydroorotate dehydrogenase (EC 1.3.3.1) Analysis of the E. coli clones as described in example 2, which was followed by analysis, as described in example 3, of the sequences obtained thereby, revealed a sequence as described by SEQ ID NO. 1. Use of the BLASTX algorithm (see example 3) revealed that this sequence was similar to the dihydroorotate ,' CA 02377482 2001-12-21 Y
dehydrogenase (PyrD; EC 1.3.3.1) from various organisms. The greatest similarity was with the dihydroorotate dehydrogenase from Mycobacterium leprae (SWISSPROT p46727; 67~ agreement at the amino acid level}.
Examples 5.
Use of the gene for the dihydroorotate dehydrog.enase (pyrD) from Corynebacterium glutamicum for .producing pyrimidine and/or pyrimidine-related compounds .
The gene for the dihydraorotate dehydrogenase from Corynebacter,iun~ glutamicum can be introduced with the aid of suitable cloning and/or expression systems into Corynebacterium glutamicum or into any other microorganism. It is possible to produce genetically manipulated microorganisms which differ from the wild .
type in the activity or the number of copies of the genes. These novel, genetically manipulated strains can be employed for producing pyrimidine and/or pyrimidine related compounds.
Sequence list (I) General information (1) Applicant (A) Name: BASF-LYNX Biosci-ence AG
(B) Street: Im Neuenheimer Feld 515 (C) City: Heidelberg (D) Country: Germany (E) Postal code: 69120 (F) Telephone: 06221/4546 (G) Fax: 06221/454770 (2) Title: The sequence of the dihydroorotate dehydrogenase from Corynebacterium glutamicum and the use thereof in the microbial production of pyrimidines and/or pyrimidine-related compounds (3) Number of sequences:
(4) Type of computer-readable form:
. 10 (A) Medium type: diskette (B) Computer: IBM PC compatible ' (C) Operating system: Windows NT
(D) Software: Microsoft~word 97 SR-1 (I) Information on SEQ ID N0. 1:
"(1) Sequence characteristics:
(A) Length: 966 (B) Type: nucleic acid w (C) Strand type: double strand (D) Topology: linear (2) Molecule type: DNA
(3) Hypothetical: no (4) Antisense: no (5) Source:
(A) Organism: Corynebacterium glutamicuirt (6) Description of the sequence: SEQ ID N0. 1:
>.
t 0091/000p4 - g _ ATGGAAAAAATCATCGCAGTGCACGATGATTCCCTCTCCCbGGAAGTCTTCGGCGTCACCTTCCC
RCGACCACTAGGCtTCGCCGCAGGTTTCGACAA.AAACGCATC?ATGGCTGA1~GCCTGGGG'rGCCG
TTGGATTCGGATACGCCGAACTTGGCACCGTCACCGCCTCCCCACAGCCAGGAAACCCCACCCC.G
CGCCTTTTCCGCCTGCCTGCCGACAAAGCTATCTTGAACCGC~!TGGGATT'CAACAACCTGGGTGC
AGCAGAAGTCGCAAAAAACCTGCGCAACCGGAAATCUCCGATGTCATCGGCATCAACATCGGTA
AAACCAAAGTGGTTCCCGCTGAACACGCAGTAGATGACTACCGCCGTTCTGCATCTTg"t'GTTAGGT
GATCTTGCTGATTACCTGGTTGTCAACGT3'TCCTCCCCCAACACTCCGGGTCTCCGCGATCTGCA
GGCTGTGGAATCTTTGCGACCAATCCTCGCCGCAGTGCAGGAATCCACCACCGTCCCAGTCTTGG
TGAAAATCGCACCAGACCTCTCCGACGAAGACATCGACGCCGTAGCTGACCTGGUGTTGAGCTC
AAACTCGCCGGAATCGTAGCCACCAATACCACCATTTCCCGCGAAGGCCTCAACACTCCTTCAGG
TGAAGTCGAAGCCATGGGTGCTGGCGGAATCTCCGGTGCTCCAGTAGUGCCCGATCTTTGGAGG
TACTCPAGCGCCTCTACGCACGGGTAGGCAAAGAGATGGTGTTGATCTCTGTCGGTGGUTCAGC
ACCCCTGAGCAAGCCTGGGAACGCATCACCTCCGGCGCAACCCTTCTt,CAGGGATACACCCCATT
CATCTACGG~GGCCCCGATTGGATCAGAGATATCCACCTTGGTATCGCCAAGUGCTGAiU4GCTC
ACGGTCTGCGCAACATCGCTGACGCTGTGGGCAGCGAATTGGAGTGGAAGAACTAA
(I) Information for SEQ ID NO. 2:
(1) Sequence characteristics:
(A) Length: 322 (B) Type: amino acid (C) Strand type: one chain (D) Topology: linear (2) Molecule tyke: amino acid.
(3) Hypothetical: no (4) Antisense: no (5) Source:
(B) Organism: Corynebacterium glutamicum (6) Description of the sequence: SEQ ID N0. 2:
MEKI IAVf~'JDSLSQE~GVTFPRPLGi.FsA~GFDJ4~TASMADAWGAVGFGYAELGI'VTASPQPGNPTP
RLFFtLFADKAILNRMGi~TNLGAAEVAT~ILRNRKSTDVIGINIGKTKWPAEFiP.VbDYRRSASLLG
DLADYLVViWSSPNTPGLFcDLQAV'SLRPILAAVQESTTVPVLVKIAPDLSDEDIDAVADLAVE:~
KLAG IVATNTTI SREGLNTPSGEVEA_MGAGGI SGAPVAARSLEVLIQiLYARVGI~iVLISVGGIS
TFEQAWERITSGATLLQGYTPFIYGGPD~'I?tDIHLGIAICQLKA~iG..RNIADAVGSELEWK~t
. 10 (A) Medium type: diskette (B) Computer: IBM PC compatible ' (C) Operating system: Windows NT
(D) Software: Microsoft~word 97 SR-1 (I) Information on SEQ ID N0. 1:
"(1) Sequence characteristics:
(A) Length: 966 (B) Type: nucleic acid w (C) Strand type: double strand (D) Topology: linear (2) Molecule type: DNA
(3) Hypothetical: no (4) Antisense: no (5) Source:
(A) Organism: Corynebacterium glutamicuirt (6) Description of the sequence: SEQ ID N0. 1:
>.
t 0091/000p4 - g _ ATGGAAAAAATCATCGCAGTGCACGATGATTCCCTCTCCCbGGAAGTCTTCGGCGTCACCTTCCC
RCGACCACTAGGCtTCGCCGCAGGTTTCGACAA.AAACGCATC?ATGGCTGA1~GCCTGGGG'rGCCG
TTGGATTCGGATACGCCGAACTTGGCACCGTCACCGCCTCCCCACAGCCAGGAAACCCCACCCC.G
CGCCTTTTCCGCCTGCCTGCCGACAAAGCTATCTTGAACCGC~!TGGGATT'CAACAACCTGGGTGC
AGCAGAAGTCGCAAAAAACCTGCGCAACCGGAAATCUCCGATGTCATCGGCATCAACATCGGTA
AAACCAAAGTGGTTCCCGCTGAACACGCAGTAGATGACTACCGCCGTTCTGCATCTTg"t'GTTAGGT
GATCTTGCTGATTACCTGGTTGTCAACGT3'TCCTCCCCCAACACTCCGGGTCTCCGCGATCTGCA
GGCTGTGGAATCTTTGCGACCAATCCTCGCCGCAGTGCAGGAATCCACCACCGTCCCAGTCTTGG
TGAAAATCGCACCAGACCTCTCCGACGAAGACATCGACGCCGTAGCTGACCTGGUGTTGAGCTC
AAACTCGCCGGAATCGTAGCCACCAATACCACCATTTCCCGCGAAGGCCTCAACACTCCTTCAGG
TGAAGTCGAAGCCATGGGTGCTGGCGGAATCTCCGGTGCTCCAGTAGUGCCCGATCTTTGGAGG
TACTCPAGCGCCTCTACGCACGGGTAGGCAAAGAGATGGTGTTGATCTCTGTCGGTGGUTCAGC
ACCCCTGAGCAAGCCTGGGAACGCATCACCTCCGGCGCAACCCTTCTt,CAGGGATACACCCCATT
CATCTACGG~GGCCCCGATTGGATCAGAGATATCCACCTTGGTATCGCCAAGUGCTGAiU4GCTC
ACGGTCTGCGCAACATCGCTGACGCTGTGGGCAGCGAATTGGAGTGGAAGAACTAA
(I) Information for SEQ ID NO. 2:
(1) Sequence characteristics:
(A) Length: 322 (B) Type: amino acid (C) Strand type: one chain (D) Topology: linear (2) Molecule tyke: amino acid.
(3) Hypothetical: no (4) Antisense: no (5) Source:
(B) Organism: Corynebacterium glutamicum (6) Description of the sequence: SEQ ID N0. 2:
MEKI IAVf~'JDSLSQE~GVTFPRPLGi.FsA~GFDJ4~TASMADAWGAVGFGYAELGI'VTASPQPGNPTP
RLFFtLFADKAILNRMGi~TNLGAAEVAT~ILRNRKSTDVIGINIGKTKWPAEFiP.VbDYRRSASLLG
DLADYLVViWSSPNTPGLFcDLQAV'SLRPILAAVQESTTVPVLVKIAPDLSDEDIDAVADLAVE:~
KLAG IVATNTTI SREGLNTPSGEVEA_MGAGGI SGAPVAARSLEVLIQiLYARVGI~iVLISVGGIS
TFEQAWERITSGATLLQGYTPFIYGGPD~'I?tDIHLGIAICQLKA~iG..RNIADAVGSELEWK~t
Claims (5)
1. A polypeptide having dihydroorotate dehydrogenase activity and selected from the following group:
(a) a polypeptide having an amino acid sequence as described in SEQ ID N0. 2, (b) a polypeptide which has been modified by comparison with (a) by deletion, insertion or substitution of one or more amino acids.
(a) a polypeptide having an amino acid sequence as described in SEQ ID N0. 2, (b) a polypeptide which has been modified by comparison with (a) by deletion, insertion or substitution of one or more amino acids.
2. A polynucleotide which encodes a polypeptide corresponding to claim 1.
3. A gene construct which comprises at least one copy of a polynucleotide corresponding to claim 2, together with at least one regulatory sequence.
4. A host organism which is transformed with a gene corresponding to claim 3.
5. A process for producing pyrimidines and pyrimidine derivatives, in which a host organism corres-ponding to claim 4 is cultivated and subsequently the pyrimidine or the pyrimidine derivative is isolated.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE19929364A DE19929364A1 (en) | 1999-06-25 | 1999-06-25 | New Corynebacterium glutamicum dihydroorotate dehydrogenase polypeptide and corresponding DNA useful for creating pyrimidine-producing organisms |
| DE19929364.3 | 1999-06-25 | ||
| PCT/EP2000/005850 WO2001000847A1 (en) | 1999-06-25 | 2000-06-23 | Dihydroorotate dehydrogenase sequence of corynebacterium glutamicum and the use thereof in microbial production of pyrimidine and/or compounds used with pyrimidine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2377482A1 true CA2377482A1 (en) | 2001-01-04 |
Family
ID=7912678
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002377482A Abandoned CA2377482A1 (en) | 1999-06-25 | 2000-06-23 | Dihydroorotate dehydrogenase sequence of corynebacterium glutamicum and the use thereof in microbial production of pyrimidine and/or compounds used with pyrimidine |
Country Status (8)
| Country | Link |
|---|---|
| EP (1) | EP1196602A1 (en) |
| KR (1) | KR20020026470A (en) |
| CN (1) | CN1358229A (en) |
| AU (1) | AU5685400A (en) |
| CA (1) | CA2377482A1 (en) |
| DE (1) | DE19929364A1 (en) |
| WO (1) | WO2001000847A1 (en) |
| ZA (1) | ZA200200581B (en) |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6958228B2 (en) | 2000-08-02 | 2005-10-25 | Degussa Ag | Nucleotide sequence which code for the metH gene |
| US6942996B2 (en) | 2000-08-02 | 2005-09-13 | Degussa Ag | Isolated polynucleotide from Corynebacterium encoding a homocysteine methyltransferase |
| DE10039049A1 (en) | 2000-08-10 | 2002-02-21 | Degussa | Novel polynucleotide from Coryneform bacteria coding for lysR3 gene, useful as a probe for detecting DNA to isolate nucleic acids coding for transcription regulator lysR3 or for producing L-amino acids, e.g., L-lysine and L-valine |
| DE10039043A1 (en) | 2000-08-10 | 2002-02-21 | Degussa | New nucleotide sequences coding for the luxR gene |
| DE10039044A1 (en) | 2000-08-10 | 2002-02-21 | Degussa | Novel polynucleotide from Coryneform bacteria coding for lysR1 gene, useful as hybridization probe for detecting DNA coding for transcription regulator lysR1 |
| AU2001291658A1 (en) | 2000-08-26 | 2002-03-13 | Degussa A.G. | Nucleotide sequences which code for the ccpa2 gene |
| US6812016B2 (en) | 2000-09-02 | 2004-11-02 | Degussa Ag | Nucleotide sequences which code for the metY gene |
| US6815196B2 (en) | 2000-09-02 | 2004-11-09 | Degussa Ag | Nucleotide sequences encoding o-succinylhomoserine sulfhydrylase |
| WO2002020792A1 (en) | 2000-09-09 | 2002-03-14 | Degussa Ag | Efflux protein dep33 of corynebacterium glutamicum |
| US6759224B2 (en) | 2000-09-09 | 2004-07-06 | Degussa Ag | Nucleotide sequences which code for the sahH gene |
| DE10045496A1 (en) | 2000-09-14 | 2002-03-28 | Degussa | New nucleotide sequences coding for the ptsi gene |
| DE10055870A1 (en) | 2000-11-10 | 2002-05-29 | Degussa | New nucleotide sequences coding for the nadC gene |
| DE10055869A1 (en) | 2000-11-10 | 2002-05-29 | Degussa | A polynucleotide encoding the nadA gene useful for the preparation of nicotinic acid or its derivatives, as probes for discovering RNA, cDNA and DNA to isolate polynucleotides or genes which code for quinolinate synthetase A |
| CN102304490B (en) * | 2011-09-05 | 2013-07-10 | 南京工业大学 | Recombinant strain capable of efficiently expressing orotate phosphoribosyltransferase and orotidylic decarboxylase and construction method thereof |
| CN110564660B (en) * | 2019-09-18 | 2023-03-21 | 苏州华赛生物工程技术有限公司 | Recombinant microorganism and method for producing orotic acid |
| CN112391329B (en) * | 2020-11-12 | 2023-07-25 | 江南大学 | Escherichia coli engineering bacteria with improved acid stress resistance and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0710235B2 (en) * | 1987-10-19 | 1995-02-08 | 協和醗酵工業株式会社 | Method for producing orotic acid by fermentation |
| EP0471466A3 (en) * | 1990-08-03 | 1992-07-08 | Eli Lilly And Company | Dna sequences which impart resistance to the fungicide 8-chloro-4-(2-chloro-4-fluorophenoxy)quinoline |
-
1999
- 1999-06-25 DE DE19929364A patent/DE19929364A1/en not_active Withdrawn
-
2000
- 2000-06-23 CN CN00809504A patent/CN1358229A/en active Pending
- 2000-06-23 WO PCT/EP2000/005850 patent/WO2001000847A1/en not_active Application Discontinuation
- 2000-06-23 CA CA002377482A patent/CA2377482A1/en not_active Abandoned
- 2000-06-23 EP EP00942126A patent/EP1196602A1/en not_active Withdrawn
- 2000-06-23 AU AU56854/00A patent/AU5685400A/en not_active Abandoned
- 2000-06-23 KR KR1020017016566A patent/KR20020026470A/en not_active Application Discontinuation
-
2002
- 2002-01-23 ZA ZA200200581A patent/ZA200200581B/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| DE19929364A1 (en) | 2000-12-28 |
| ZA200200581B (en) | 2003-03-26 |
| CN1358229A (en) | 2002-07-10 |
| AU5685400A (en) | 2001-01-31 |
| KR20020026470A (en) | 2002-04-10 |
| EP1196602A1 (en) | 2002-04-17 |
| WO2001000847A1 (en) | 2001-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2377482A1 (en) | Dihydroorotate dehydrogenase sequence of corynebacterium glutamicum and the use thereof in microbial production of pyrimidine and/or compounds used with pyrimidine | |
| JP4163001B2 (en) | Polypeptides derived from RNA polymerase and uses thereof | |
| CN112143764B (en) | Method for preparing intermediate compound of brivaracetam by using biological enzyme catalysis | |
| CN112175916B (en) | L-amino acid ligase mutant, recombinant vector, recombinant bacterium and application thereof | |
| JPH10229885A (en) | New alcohol/aldehyde dehydrogenase | |
| KR20020026469A (en) | Genes from Corynebacterium Glutamicum for the Biosynthesis of Folic Acid and Their Use for the Microbial Production of Folic Acid | |
| JPH09173078A (en) | Production of protein with molecular chaperon | |
| JP2017108740A (en) | Modified meso-diaminopimelic acid dehydrogenase | |
| CN111411128B (en) | Whole cell biocatalysis method for producing alpha, omega-dicarboxylic acid and application thereof | |
| CA2276093A1 (en) | Partial sequences of purine biosynthesis genes from ashbya gossypii and their use in the microbial riboflavin synthesis | |
| US5281531A (en) | Host and vector for producing D-ribose | |
| EP1174499B1 (en) | Novel amidase gene | |
| CN114908129B (en) | Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| JP3531997B2 (en) | Method for producing amide compound using transformant | |
| CN115873881A (en) | Genetically engineered bacterium for producing 1,3-butanediol and application thereof | |
| CN109929853B (en) | Application of thermophilic bacteria source heat shock protein gene | |
| KR20220086044A (en) | Engineering of Escherichia coli for enhanced production of cinnamaldehyde | |
| CA2275443A1 (en) | Monofunctional glycosyltransferase gene of staphylococcus aureus | |
| CN114480345B (en) | MazF mutant, recombinant vector, recombinant engineering bacterium and application thereof | |
| JP2000069971A (en) | New thermostable formate dehydrogenase | |
| JPH05192164A (en) | Recombined dna and its use | |
| WO2000008170A1 (en) | Gene participating in the production of homo-glutamic acid and utilization thereof | |
| JP5596271B2 (en) | Method for producing heterocyclic ring-containing peptide compound and analogue of godosporin | |
| JP2000041683A (en) | Hexulose phosphate synthase and production of hexulose phosphate isomerase | |
| KR100533116B1 (en) | A Heat-resistant dTDP-Glucose Synthase and Its Gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |