CA2372690A1 - Manufacture of autogenous replacement body parts - Google Patents

Abstract

Disclosed are matrix materials, methods, and devices for manufacture in vivo of autogenous replacement body parts comprising plural distinct tissues. In one embodiment, the replacement body part is a skeletal joint and the new plural distinct tissues include bone and articular cartilage.

Description

F>dd of the Irnetniat ?his invention relates to materials and methods t~ the rep>ir:nd regcrterxion of plural distinct tissues at a singk detect site in a marnmaL More particularly, the invention is conxrned with materials and methods for the manufacture in vivo of awogenotts rtpisoemem body parts, including tnammatiart skeletal joints. comprising plural different tissues.
such as Ligament, articular eanilage and bone tissues.
Skektal joitus provide a movable union of two ar more bones. Syrtovial jt>itxs ate highly evolved anitxtlating joittu Utat pemtit free movemau. B~ttse mammalian lower limbs area caxemed with locomotion and upper Limbs piovidc vctsaulity of movement, rn~t of the joints in ttte extremities are of d~tc synovial type. There are various types of synovial jcdrs<s. Their classification is based upon the types of active motion that thery pemtit (uatiaxial: biaxial. and polyaxial). They are differentiated funlter according to their principal morphological features (hinge. pivot, cond~~loid). In eottcrast to fibrous and c~nilsginous joints where the ands of the bones are found in tatuiratity w ith irxervctung tissue. the ends of the horses in at syttovial joint are in contact, but separate. Because the bones arc trot bound iruemally, the integritl~ of a synovial joint results from its ligaments and capsule (which bind the anitatlation cxtemallp) tuxl to some extent from the surrounding muscles. In syravial joints. the crnuiguous brety surfaces are covered with articular or, hyaline cartilage, and the joint cavity' Is surrottrrded by' a fibrous capsuk which segregates the joint from the surrounding vascularized environment. The inner surface of the txpsule is lined by a syovial layer or "ma»bruK" containing yells involved in secreting ttu viscous lubricating slrnovial fluid. Gray, atomy of the Human Bodo. pp. 312:
333-336 (13th ed.: C.C. Clemente. ed.. (1985)).

D 95/335E12 PCTIt1S95b6724 In certain synovial joints, the joint or svnovial cavity may be divided by a meniscus of fibrocartilage. Symovial joints involving two bones and containing a single joint cavity are referred to as simple joints. Joints that contain a meniscus forming two joint cavities are called composite joints. Ttte term compound joint is used for those articulations in which more than a single pair of articulating surfaces are present.
Joint replacanent. particularly articulating joiru replacemeiu, is a cottunmtly performed procedure in orthopedic surgery. However, tl>e ideal material for r~eplacemen.t joints remains elusive. Typically, joiru recottsautxion requires repair of the bony defect, the azticular cartilage and, in addition, one or more of the joining ligametus. To date, there are no satisfactory clinical means for readily repairing both articular cartilage and bony defects within a joint which reliablyr results in viable, fully-functional weight-bearing joints. Prosthetic joints which replace all the endogenous joint tissues circumvent some of these problems. However, prosthetic joints have numerous. well documented limitations. particularly in younger and highly grave patients. In addition. in some circumstances prosthetic joint replacement is not possible and repair options are limited to osteochondroallograft materials.
The.articular, or hyaline cartilage, found at the end of articulating bones is a specialized.
hiscoiogically distinct tissue and is responsible for the distribution of load res:istartce to compressive forces, and the smooth gliding that is part of joint function. Aiticular cartilal;e has little or no self regenerative properties. Thus, if the articular cartilage is tom or wom down in thickness or is otherwise damaged as a function of time, disease or trauma. its ability to protect the underlying bone surface is compromised.
Other types of cartilage in skeletal joints include fibtocartilage and elastic cartilage.
Secondary cartilagir~us joints are fomted by discs of fibrocarWage which din vertebrae in tlic vertebral column. In fibrocartilage, the mucopoly-sacc)>aride network is interlaced with pmmittent ?5 collagen burulles and the chot~tocytes are moro widely scattered than in by al.itu cartilage. Elastic cartilage contains collagen fibers which arc histologically similar to elastin fibers. As with other connective tissues the formation of cartilaginous tissue is a complex biologic,rl process. involving the interaction of cells and collagen fibers in a unique bior,~mical milieu.
Cartilage tissue, including anicular cartilage. unlike other connective tissues. lacks blood vessels, nerves, lymphatics and basement membrane. Cartilage is composed of chondrocytes which WO 95133502 PCTNS95I067=' synthesiu an abundant extracellular milieu composed of water, collaaens.
~oteoglycans and noncollagenous proteins and lipids. Collagen serves to vap proteoglycans and to provide tensile strength to the tissue. Type II collagen is the predominant collagen in cartilage tissue. The proteogIycaris are composed of a variable number of glycosaminoglycan chains, keratin sulphate.
5 chondroitin sulphate and/or dermatan sulphate, and N-linked anal O-linked oligosaccharides covalently bound to a protein core. The sulfated glycosaminoglycans are negatively charged resulting in an osmotic swelling pressure that draws in water.
In contrast. certain collager>_s such as the fibrodc cartilaginous tissues which occur in scar tissue for example. are keloid and typical of scar-type tissue, i.e:..
composed of capillaries and I O abundant. irregular, disorganiud bundles of Type I and Type II collagen.
Histologically. articular or hyaline cartilage can be distinguished from otter forms of cartilage, both by its morphology and by its biochemistry. Morphologically, articular cartilage is characterized by superficial VE1SIIS mid versus deep "zones" wtuch show a characteristic gradation of features from the surface of the tissue to the base of the tissue adjacent to the bone. In the 15 superficial zone, for example, chondrocytts are flattered and lie parallel to the surface embedded in an extracellular network that coraains tangentially arranged coTtagen and few proteoglycans. In the mid zone, chorrdrocytes are spherical and surrounded by an ex~~acellular network rich in proteoglycans and obliquely organized collagen fibers. In the deep zoru, close to the bot~, the collage fibers are vertically oriented. The keratin sulphate rich proteoglycar>s irrcrease in 20 concentration with inereasin~ distance from tl>e cartilage surface. For a detailed description of articular cartilage micro-structure. see, for example, (Aydelotte and Kuettner. ( 1988), Conn. Tiss.
$gt. x$:205: Zanetti et al.. (1985). ~1~,i9~.1Q~.:53: and Poole et al., (1984). J.J. Anat. ~:13.
Biochemically, articular collagen can be identified by the presence of Type II
and Type IX
collagen, as well as by the presence of well-characterized ptnte~glycans, and by the absence of 25 Type X collagen. which is associated with endochondral bone formation.
In normal ariicular cartilage, a balance exists between synthesis and destruction of the above-described extracellular network. However. in tissue subjected to repeated trauma. for example due to friction between misaligned bones in contact with one another.
or in joint diseases characterized by net loss of articular canila~e, e.g., osteoanhtitis. an imbalance occurs between 30 synthesis and degradation.

~ttntr~ sir (~ ~s) 'O 95!33502 PCTNS95J06724 Two types of defects are recognized in atvcular surfaces, i.c., full-thickness defects and superficial defecu. These defects differ not only in the extent of physical damage to the cartilage, but also in the nature of the repair response each type of lesion can elicit.
Full-thic~ess defects of an articulating surface include damage to the hyaline cartilage.
the calcified cartilage layer and- the subchondral bone tissue with iu blood vessels and bone marrow. Full-thickness facts can cause severe pain since the botx plate c:ontairis sensory nerve endings. Such defecu generally arise from severe trauma and~or during the late stages of degenerative joint disease, such as osteoarthritis. Full-thickness defects may, on occasion, lead to bleeding and the induction of a repair reaction from tlx subchondral bone. In such instances.
t>owever, the repair tissue formed is a vascularized fibrous type of cartilage with insufficient biomechanical properties, and does not persist on a long-term basis.
In contrast, superficial defecu in the articular cartilage tissue are reatrictcd to the cartilage tissue itself. Such defects are notorious because they do not heal and show no propensity for repair reactions. Superficial defects may appear as fissures. divots. or clefts in the surface of the cartilage, or they may have a "crab-meat" appearance in the affected tissue.
They contain no bleeding vessels (blood spots) such as are seen in full-thickness defects.
Su;perficia~l defects may have no known cause, however. they are often the result of mechanical derattgements which lead to a wearing down of the cartilaginous tissue. Such mechanical derangements may be caused by trauma to the joint, e.g., a displacement of tom meniscus tissue into the joint. meniscectomy, a taxation of the joint by a tom ligament. malalignment of joints, or bone fracture, or by hereditary diseases. Superficial ~fecu are also characteristic of early stages of degetit:rative joint diseases.
such as osteoarthritis. Since the canilage tissue is not innervated or vascula.rized. superficial defects do not heal and often degenerate into full-thickness defects.
Replacement with prosthetic joints is currently the preferreef option for serious degeneration of joint function involving loss of articular cartilage. It is anticipated that a means for functional reconstruction of joint complexes. including regeneration and repair of articular cartilage, will have a profound effect on alloplastic joint replacement surgery and the management of degenerative joint disease.
Like articular cartilage, joint ligaments which serve to connect interacting bones in the joint, have little or no self regenerative properties. Ligaments typically are composed of WO 95133502 PCTIUS9~06724 substantially parallel bundles of white fibrous tissue. They are pliant and flexible to allow substantially complete freedom of movement, but are inextensile to prevent ovcr-extetuion of the inuracting bones in the joint. Like cartilage, ligament tissue is substantially devoid of blood vessels and has little or no self regenerative properties. SurgiG~l repair of tom or damaged 5 ligament tissue to date is limiud to use of autogenous grafts or synthetic materials that are surgically attached to the articular extremities of the bones. Allogenic ligaments typically fail mechanically, presumably due to the treatments required to trrnier these materials biocomgatihle.
Similarly, tendons are mpe-like structures which connect muscle fibers to bone or cartilage and which are formed from substantially parallel fibroids of white connective tissue. 1h~ synovial 10 capsule is composed of a thin layer of ligamentous tissue which encloses the dint and allows the joint to be bathed in the lubricating synovial fluid. The interior of the joint capsule is lined with a thin membrane of connective tissue having branched connective-tissue corpuscles defining the synovial membrar~, and which is primarily responsible for secreting synovial fluid into the cavity.
The integrity of this membrane therefore. is important to mainuuning a source for the lubricating 15 synovial fluid. Repair of these tissues in orthopedic contexts typically is limited to resuturing of existing tissue.
Bone tissue differs significantly from the other tissues described hereinabove, including cartilage tissue. Specifically, bone tissue is vascularized tissue composed both of cells and a biphasic medium which is composed of a mineralized, inorganic: component (primarily 20 hydroxyapatite crystals) and an organic component comprised primarily of Tvpe I collagen.
Glycosaminoglycans constitute less than 29c of this organic comporxnt and less than 19c of the biphasic medium itself or of bone tissue ~ ~. Moreover, relative to cartilage tissue, the collagen present in bone tissue exists in a highly-organized parallel attartgement.
Bony defects. whether from degenerative, traumatic or cancerous etiologies, pose a 25 formidable challenge to the reconsttuctive surgeon. Panicularl3~ difficult is reconstruction or repair of skeletal pans that comprise part of a mufti-tissue complex, such as occurs in mammalian joints.
Mammalian bone tissue is known to contain one or mots proteinaceous materials pttsumably active during growth and natural bone healing which can induce a developmental cascade of cellular events resulting in endochondral bone formation. The developmental cascade 30 involved in endochondral bone differentiation consists of chemotaxis of mesenchymal cells.

SuBSlt~ttE s~~r (~utF ~s) WO 95133502 ~CTIUS95b67?a proliferation of progenitor cells into chondrocy~tes and osteoblasts, differentiation of cartilage.
vascular invasion. bone formation, remodeling, and finally marrow differeruiation.
Tcue osteogenic factors capable of inducing the above-described cascade of events that result in et>dochottdtal bone formation have now been identified, isolated, and cloned. These protons. which occur in nature as disulfide-bonded diuretic proteins. are referred to in the art as "osteogenic" proteins, "osteoinductive" proteins, and "bone morphogenetic"
;prottins. Whether naturally-occurring or synthetically prepared, these osteogetuc proteins, when implanted in a mammal typically in association with a substrate that allows the aaachnaent, proliferation and differentiation of migratory progenitor cells, arc capable of inducing rectuitmenc of accessible progenitor cells arid stimulating their proliferation. inducing differentiation into chondrocytes and osteoblasts, and further inducing differentiation of intermediate cartilage, vascuIarization, bone formation. remo~ling, and finally marrow differentiation. Those proteins are:
referred to as members of the Vgr-1/OPl protein subfamily of the TGF~ super gene family of structurally related proteitu. Members include the proteins described in the art as OPI
(ftMP-7). OP2 (BMP-8). BMP2. BMP3. BMP4, BMPS. BMP6. 60A. DPP, Vgr-1 and Vgl. Sec., e.g., U.S.
5.011.691;
U.S. 5.266.683. Ozkaynak et al. (1990) E:~IBO ~. Q: 2085-2093. Wharton et al.
(1991) PNAS
$$:9214-9218), (Ozkayttak ( 1992) ~. Bj~l-Chem_ x:25220-25227 and U.S,.
5.266,683); (Colesu et al. (1991) PN_AS $7:9843-9847): (Lyons et al. (1989 ) P_NAS $x:4554-45~~8).
These disclosures describe the amino acid and DNA sequences, as well as the chemical and physical characteristics of these proteins. See also (Womey et al. (1988) ~ience 242;1528-1534); Blv>p 9 (W093/00~32, published January 7. 1993): DPP (Padgett et al. (1987) Nature x:81-84: and Vg-1 (Weeks (1987) ~ x:861-867).
It is an object of the ittstartt invention to provide a bioresorbable matrix arid device.
suitable for regenerating body pacts which comprise two ar more functionally-and swctutally-associated yet distinct replacement tissues in a mammal. Another object is to provide compositions and methods for the repair or complete reconstruction of a mechanically and functionally viable skeletal joint in a mammal. particularly an articulating or syttovial joint, as well as other body parts comprising bone and hyaline cartilage, without relying on prosthetic devices.
Another object is to provide materials and methods for the repair of tissue defects in an articulating mammaDan joint. so as to form a mechanically and functionally viable joint comprising bone and arcicular cartilage, ligament, tendon. syovial membtartc and svriovial capsule tissue. Another ,. ._ . ,, . 6 _ ~,i :_- ~' : . - . _ _ S~iiiiE SNEET (Iilif 26) PCTNS951a6~~
WO 95!33502 object of the invention is to provide means for reuorin_ fiutctioval ran-mineralized tissue in a skeletal joint including the avascular tissue therein.
In accordencx with the resent invention, methods and ~devioes are provided for the 5 manufacture of a live autogenous replacement part comprising plural distinct tissues. In one aspect the replacement body part includes part or all of a mammalian skeletal joint, including an articulating or synovial joint. As described herein below, the methods and compositions of the invention are sufficient to restore mechanical and functional viable of the tissues associated with a skeletal joint, including bone (and boot marrow). articular cartilage.
ligament. tendon. synovial 10 capsule and synovial membrane tissues. Thus the invention provides methods and compositions for replacement of one or more of the plural distinct tissues that de:Fme a mammalian skeletal joint.
The invention provides, in one aspect therefore, a novel matrix for forming a mechanically and structurally functional, mammalian, replacement body part comprising plural distinct tissues.
The matrix comprises intact residues specific for or characteristic of. and/or derived from at least 15 two distinct tissues of the replacement body part. As will be appreciated from the d~iption provided herein below, the matrix can include residues specific for four or more distinct tissues.
The matrix is biocompatible and bioresorbable. Specifically, it is sufficiently free of pathogens and antigenic stimuli that can result in graft rejection. Preferably the matrix is derived from an allogertic or xeno~enic body part. Preferably, it is derived from a mammalian donor, such as a _ 20 cadaver. The body part may be rendered inert or "devitalized" by dehydration. such as by ethanol extraction and lyophilization, so that no residual cellular metabolism remains, but the function of endogenous growth factors and the like can be restored upon in situ reconstitution by endogenous body fluids. 'The treated body part which now is substantially depleted in antigenic and pathosenic components and now is biocompatible, maintains the residues .~pecific for the plural distinct tissues 25 constituting the body part sought to be replaced. These residuta include those of plural distinct tissues with dimensions and swetural relationships to each other which mimic those of the body part to be replaced.
The thus treated matrix having utility in the methods artd devices of the invention lacks significant mechanical lore=rity as compared with native tissue and, on its own. is not sufficient to 30 induce regeneration of a replacement body part or tissue when implanted.
However, by su~tr~s~r(~u~2s) , . a 9s~33soz ~crms~~2a impregnating or otherwise infusing the interstices of the matrix with osteogenic protein so that the protein is disposed on or adsorbed to, the surfaces of the matrix, the device of the instant invention is formed and is sufficient to induce formation of new tissue in vivo such that regeneration of a mechanically and functionally viable replacement body part occurs in situ.
In one preferred embodiment. the device comprises part or all of a skeletal joint excised from a mammalian donor allogertic or xenogenic to the donee. Treated as described herein the device comprising the allogenic or xenogenic skeletal pint ( 1 ) is biocompatible, namely, it is non-pathogenic and sufficiently non-antigenic to prevent graft rejection jp vivo.
and (2) is sufficient to induce formation of a functionally viable autogenous repiacanent joint ja v'vy, including i0 generating functional bone, articular cartilage. ligament and capsule tissue in correct relation to one another such that a structurally and mechanically functional replacement joirn: results.
In another embodiment. the invention provides a vice which serves as a template for forming in vivo pan or all of a skeletal synovial joint comprising plural distinct tissues and which , in response to morphogenic signals. induces new tissue formation. including new artieular cartilage tissue from rapotxling cells pment in the synovial environment. The newly :formed tissues assume the shape and function of the original tissue in the skeletal joint.
In another aspect. the invention provides methods for replacing a deft:ctive body pan comprising the steps of: excising the defective body pan and implanting the device of tlx instant invention. In one embodiment, the method also comprises the additional step of providing a supply of meserrchymal cells to the implanted device, as by threading or otherwise providing a muscle flap prefused with a blood supply into a hollow portion of the device. 1n another embodiment, the device is implanted at a locus in the body of the individual distinct from the defect site but which allows generation of the replacement body part. The autogenous body part ttws formed then can be implanted at the defect site.
As will be appreciated from the description prvvidcd t~rein, in another aspect. the invention provides devices and methods for the functional and mechanical restoration of one or more individual tissues in a mammalian skeletal joint, including the non-mir~raliz~ and avascular tissue therein. Thus, in one embodiment, the invention pcflvides methods and devices competent for restoring, without limitation. functional articular cartilage, ligament.
synovial membrane and synovial capsule tissue. The methods and devices described herein can be used for example, to _g_ Nme~r~~r c~ntt! llsi~ ~'~~

PC?NS95~06714 correct superficai articular cartilage defects in a john, to replace: tom or emtrpromised ligamenu and/or tendons, and to repair defecu in synovial capsule or meaabrane tissue.
The devices for repairing individual skeletal joint tissue compare osteogenic protein ctisposed on a matrix containing residues specific for. or derived from skeletal joint tissue of the 5 type to be restored, including. without limitation. cartilage, ligatnent.
ten~n. synovial capsule, or synovial mtmbrane tissue. 'Ihe device cart take the form of a solid, or it can have the physical properties of a paste or gel. 1?referably, the matrix is derived from alloget>ic or xenogenic tissue, and is treated as described herein to form a biocompatible devit;alized matrix.
In another embodiment the matrix can be formulated ~ novo froth synthetic and/or 10 naturally-derived components. The matrix includes both (a) residues specific for, or characteristic of, the given tissue and , (b) materials sufficient to create a temporar<~
scaffold for infiltrating cells and defining a three dimensional structure which mimics the dimensions of the desired replacement tissue.Useful such materials are described herein below. Suitable tissue-specific residues cart be obtained from devitalized allogenic or xcnogenic tissue and combined with the structural materials 15 as described herein to create the synthetic matrix. In another embodiment.
the matrix comprises devitalized non-mineralized tissue. In some circumstances, as i;n the formation of articular cartilage on subchondral bone. a non-mineralized matrix material defining a thte~-dimensional structure which allows the attachment of infiltrating cells, can be sufficient, in combination with osteogenic protein, to induce new tissue formation.
20 While. as described above, in a preferred embodiment du invention contemplates a device suitable as a template for forming in vivo a replacement skeletal joint, as will be appreciated by the practioner in the art, the invention contemplates. and the disclosure enables, a device suitable as a template for forming in vivo functional replacement body parts other than skeletal joints and which comprise plural distinct tissues.
25 When used in accordance with the methods of the instant invention, the vices of the invention and/or the tissues which result from their a~lication, essentially satisfy the following criteria of a preferred gt~afting material:
1. They result in formation of mechanically and fiusctionally viable tissues normally present at the site. These tissues are of an appropriate size and have correct structural a~nurE sit (~ ~) 95l33S02 I~C'~YUS'1510672~
relationships so as to result in a functional bady pan. In particular, the mufti-tissue replacement pan, whether produced in situ at the site of intended use or remotely, becomes incorporated.
integrating with adjacent tissues, essentially maintaining its shape, and avoiding abnormal resorption, regardless of the conditions present at the recipient site.
Weiland et al. (1983) ~, Otihon. ,4_:87 (1983).
2. The devices are capable of being precisely contoured and sha)xd to exactly match any defect, whichever complex skeletal or organ shape it is meant to replace.
3. The devices virtually have unlimited supply and are relatively easy to obtain 4. 'Ihe devices have minimal donor site morbidity.
Furthermore. the instant invention provides practitioners with mateda:s and methods for skeletal joint repair including the repair of the bone and articular cartilage pre;cent therein, and which solve problems that occur using the methods and devices of the art. For example, the instant invention can induce formation of hyaline cartilage rather than fibrorartilage at a defect site. Using ttte materials and methods disclosed herein, functional hyaline canilage forms on the articulating surface of bone at a defect site and does not degenerate over time to fibre-cartilage.
By contrast, prior art methods of repairing cartilage defects generally ultimately result in development of fibrous cartilage at the defect site. Unlike hyaline cartilage, fibrocartiIage lacks the physiological ability to restore articulating joints to their full capacity.
Thus. when the instant materials are used in accordance with the instant methods, the practitioner carp substantially functionally restore a cartilage defect in an articulating joint, particularly a su;pe~cial articular cartilage defect and substantially avoid the undesirable formation of fibrocartilage typical of prior an methods, or degeneration into a "full-thickness defect". 'Ihe invention also provides means for repairing individual tissue of a joint not readily reparable individually using prior art methods, and which, in some cases, previotuly warrutted replacement of the entire joint with a prosthetic device.
35 The invention further allows use of allogenic replacement materials for repaiz;~ng the avascular tissue in a skeletal joint. and which result in the formation of mechanically and functionally viable replacement tissues at a joint locus.

In as aspect of die ptasetu inventi~, there is provided a device for implantation in a rrntturwl which serves as a template to form in vivo a 5mctional replacsnoent akeidal joins comprising Plural distinct tisat>a, wherein at least ane of said phual distinct tissue is a mo-minoralixed tissae, the device cmaprising:
(a) a biocompatrble, biodegradable matrix, defacing a single st~uctu<e allowing fne a<taduneat of ia5ldnuiag calls and comprising residues having specifxity for, or derived from plural distinct tissues of a skeletal joie, at least one of said tissues being a non-mineralized tissue; and having dimmtsitoas and sbape which miadc that of the skeletal joint to be replaced; and disposed oa the aa$ce of said matrix, (b) an ostcog~ic protein in as amount sufficient to induce formation of new said phual diati>xt ti:uues having dimensions rmd ahtpe which mimic the skeletal joie to be rqdaoed, at least one of said new tisanes being a noa-mineralized tissue, thereby to permit regeneration of a fiuactional skeletal joint.
In a faartbmr aspect of the iavaatioa, there is provided a device tkx implaaWios is a mammal forming tn viva articular cart7age replacement tisstx in a akelotsl joint" the device compris~g:
exogenous osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix said rrotrix couaprisiag Plural ~srimx tisates derived from a joint including:rticuhrr eartilaF;a, said tissues defining a unitary structure which allows the attac6meat of infiltrating cxus thereby to permit regeasration of said acticular cartilage in said skeletal joint In yet a her sapact of the present invention, there is provided a devbx for implantatix~ in a matamal for forming in visa repLcaneat non-tninaaliud tissue in a skeletal joint, the device cotr~rising:
exogerunrs osbrogenic protein diseased oa the surface of a b~aaapah'bla, biore:;mbabk matrix, said matrix compciaing phusl distinct tissues derived from a joint including at leant one noaanineraliud tissue cotn:porxling in ldad to said tisane to be replaced, said matrix ~fming a unitar,;~ shucture which allows the attachaaeat of ir~r~ing cells >haeby to permit regeneration of nonmineraliaal tiasna in a sbelatil joint.
In yet a tltemer aspect of the pteaeat invantioo, there is provided. a use of a device is the formatiaa of an tutologous ~ akehxal joint comprising Plural diatiact tisates w>~ia at least one of aid plural distinct tiasuea is a twn-mia~eralized tisatre, bY implanting said devico at s locus is a taammal, thereby to induce formation of a fitactional skeletal joint, acid device coaoprisiag exogenous osteogenic disposed on the anface of a biareaorbabk, biocoaopatibk rrmtrix, said avahix de5niag a siogk stnreture allowing the attachment of infiltrating cells sad coaqciaiag rasiduea having spoci5city for, or derivod from said phual distinct tissues of a skeletal joint, at least one of said ti,sue being a noa-minerslized tissue, sad having dimetaions and shape which mimic that of the skeletal joint to be repisced, at least on for said new tissues being s non-mineniized tissue.
- 1 Oa -In yet a further aspect of the present invention, there is provided a use of a device for repaiciog in vlvo articular cartiLge on the surface of a bone by providing to said bone surfaG~~ at a locus is a martanal said device, wheteia said device cod an exogenous asteogenic proteia dis~posad on tire a~ubCe of a biocompaabk, bioraorbable matrix, said matrix comprisitlg residues specific far, or derived from cartilage, and defining a structtac which allows the attachment of iafiltrrting cells.
1n yet a further aspect of the present io4 '~ k pmvidetl a use of a dt=vice far restoring a non-miwetslized tissue in a skeletal joist is a ~maml by providing to said skeh;tal joie said device whtreia said device canp~ea an exogw~ osteogetuc protein disposed on the surface of a bk, b~eaorbable matrix, said matrix comprising residues specific for, or derived fn~m tissue cornsponding in kind to said non-mineralized tissue to be cepLced, and defining a strt>chtre which allows the attachment of infiltrating cells.
In yet a furtlxr aspect of the present iaventio4 there is provided a matrix for forn~g a stable, t'bndional, repleameM skeletal jokt thu cottgtriaas articulsr csatihtge and bona tissues at a sloektal joint defect site is a msimml, said matrix oosnptising: (ij a bio~patibk biorbk support material accised from a maamoslisn doaor skeletal joint wherein said malarial include:
bone and associated artieular silage tissues capable of ess~lly mair~ising their shape and irss'ttaLtionshipa of tissues when used as a replacem~t joim and wherein said bone std associated artiarlar cerdlage tissues have dimwtsiooa sad 24 structural relationships to each other which soatomically to those of the skeletal joint to be raplaoed; and (its stttutantklly press exogettotta oa~gcnie protein ort the surface of said mabrpt in an amount fat to isaittce formation of new bane and asso~ated actiatlar cartilage tissues thereby pettnittieg the regeneration of a functional raplacemt~ skeletal joint at the defect site.
In yet a furt6a aspect of the prey imerdion, there is pcorided s device for forming a:bble, timcdonat, vitalized artiatlatiag skelenl joint at a joint defect site in a mamtael,, wherein acid device cott~prites: (a) a biocompatible biorcsorbable rt~trix euised from a ntauunsliar~ d~tor articuktiog skeletal joie wherein raid maoritc comprises: (i) an articu~g rvrface; and (iij plural disti>sct tiastxs including at keel one non-mineralizes tissues, wha~eIn said tissues are capable of essent;ally tneintaining their shape and relationships when used as a repLcemettt joint and haves diraensiona and aductural relstionthips to each other which oorrespoad:natomiailly to the articulatiag sbeldal joist to be repkad; and (b) subabntislly plus exogenous ostaogatic protein disposed on or within said matrix in as amount sufficient to induce the formation of s now vitalized articulating sur4ce and tuw vitalized phtral disthd~t tissues thereby permitting the regetuxatiat of a stable, functional, vitalized attia~rtg skeletal jokt at sand defect site.
- I t7b -In yet a fiutlrer aspect of the lueseat inve~ntlo0. ~ is provided a d~a for fig plural distinct non-mineralized tissues in a stable, fuar~ional vitalized articulating skeletal joint irr vivo, whaeia said device comprises: (a) a biocompattbk bioresorbabk matrix excised from a rnammaliaa doctor srticdating skektal joint wluxein said matrix con~xises: (i) an articulating surface; and (ii) Plural distinct non-mineralized tissues capable of essentially maintaining their shape and relationships when used as a rep~oent joint and having dimensions and atnxlural relationships to each otbax which corrospoad anatomically to the articulating skeletal joint to be replaced; and (b) substantially pure exogenous osteogenic protein disposed on or within said matrix in $n amount sn~cieat to in~lues the formation of a new articulating surface and new plural distinct non-rrzyneralized tiss~xs thereby lxrntatting the regeneration of a stable, functional, vitalized articulating slcektal joint at said defect site.
- l Oc -Brief Descritxion of the Drawinss While the specification concludes with claims particularly pointing out and specifically claiming ~ subject maser which is regarded a cot~sdtuting the invention. it is believed that the invention will be better understood from the following dietailed description of prefcrnd embodiments taken in conjunction with the accompany7ng drawi,n~ts in which:
Fig. 1 is a fragmentary front elevational view of a mammalian knee joint with sufficient tissue removed to show the ardcular cartiiagt on the condyks ox the femur, ttx ligaments, synovial membrane, joint capsule, and further showing a damaged area in the articular cartilage requiring repair, FIGS. 2A through 2D are schematic representations of the elements used to Generate a viable, functional glenohumoral hemi joint in orte embodiment of the invention. Fig. 2A ~picts a lyophilized allograft: Fig. 2B. depicts osteogenic protein for application to the lyophilized allograft of Fig. 2A: Fig. 2C depicts a muscle flap of cutaneous maximus muscle to be threaded inside the shaft of the lyophilized allograft; and, Fig. 2D depicts a viable. fiutetional hemi joint resulting from the combination of elements in Figs. 2A. 2B and 2C. Fig. 2D represents one embodiment of the device of the inscattt invention:
FIGS. 3A through 3D are schematic representations of the four allografts tested in the hemi-joint of Example 2 (5 week): and FIGS. 4A through 4D are schematic representations of the four allografts tested in the hemi-joint of Example 3 (6 month).
In accordance with the presern invention, novel materials and methods arc provided for the repair and regeneration of plural distinct tissues. including manufacture of a live autogertotts replacement part comprising plural distinct tissues. in one embaiiment the replacement body part is a skeletal joint, particularly an articulating joint, and includes, without limitation. residues specific for, or derived from, bone. cartilage, ligament, tendon, syoviaI
capsule and syrtovial membrane tissue.

D 95133501 PCTII1S951067Z~1 Mote particularly, in one aspect, the invention provides a device comprising an osteogenic protein disposed on the surfaces of a matrix or substrate for forming a functional, mammalian replacement body part comprising plural distinct tissues. As used herein. the:
term "matrix" is understood to define a stntcture having interstices for the attachment, proliferation and differextiiation of infiltrating cells. It comprises residues specific for the tisstae to be teptaced and/or derived from the same tissue type, and has a shape and dimension when implanted which subAazuially mimics that of the replacemau tissue desired.
As used haeirt, the teen "rtsidue" is intexrcled to mean a cmrssituent of a given tissue.
which has speaficity for, or is characteristic of, the given tissue, and which is derivable from the non-viably constituents of the given tissue. A matrix comprising these residue(s), when combined with osteogenic protein, and implanted in a mammal in an environment which mimics the tissue's local environment under physiological conditions. and is sufficient for formation of specific.
mechanically and functionally viable replacement tissue.
The term "plural distinct tissue" is intended to mean physiologically distinguishable tissues. such as biochemically or ultrastrucrurally distinguishable tissues which reside at an anatomically similar locus. In an articulating replacement joint device for example, the matrix can comprise residues specific for, or derived from, bone. cartilage, ligament, tendon and synovial membrane tissue. Thus. a signif cant aspect of the matrix of the invention is a single swccure comprising residues of plural, distinct tissues. and which, when combined wi:fi an osteogenic protein as defined herein, is suitable for inducing repair or regeneration of a body part that is mechanically and functionally viable over time ja v'~q.
As used lxrcin, the terms "bone" and "articular cartilage" an: intended to mean the following: Bone refers to a calcified (mineralized) cau~ecdve tissue primarily comprising a composite of deposited calcium and phosphate in the form of hydroxyapatite, collagen (predominantly Type I collagen) and bone ells, such as osceoblascs, osteocy~tes and osteoclasts, as well as to the bone marrow tissue which forms in the interior of true endochondral bone. Cartilase refers to a type of connective; tissue that contains chondtncyces embedded in an extracellular network comprising fibrils of collagen (predominantly Type Il collagen along:
with other minor types, e.g. Types IX and XI), various protcoglycans (e.g., chondroitin sulfate., keracart sulfate, and detmatan sulfate proteoglycans), other proteins, and water. Atticular cartila;~e refers to hyaline or articular cartilage, an avascular, non-mineralized tissue which covers the articulaang surfaces of ~~orr~nn~c t~s1' ~ ~'ll~l the portions of bogs in joints and allows movement in joints without direct bone-to-bone contact, and thereby prevents wearing down and damage to opposing bane surfaces. Most normal healthy articular cartilage is refetied to as "hyaline." i.e., having a char.~actetistic frosted glass appearance.
Under physiological conditions, articular cartilage tissue rests on the ur~erlying, mineralized bone surface. the subchondral bone, which contains highly vascularized ossicles.
These highly vasculariud ossicles can provide diffusible nutrients to the overlying cartilage, but not mesenchymal stem cells.
"Ligament" is intended to mean both the rope-like swcturGS of white fibrous connective tissue which attach anterior extremities of intracting bones, as ~~ell as the tissue defusing a synovial 10. capsule. "Synovial membtarse" is intended to define the connet:tive tissue membrat>e lining the interior of the synovial cavity and which is involved in svnovial fluid secretion. "Tendon' is intended to define the connective tissue structure which joins muscle to bone.
Replacement Bodv Pans As disclosed Iserein, the instant invention provide metts~ads and compositions for replacing 15 and repairing a defective body part. The method comprises the steps of surgically excising the defective body part, implanting a device comprising a matrix of the type described above at the site of excision, and, as necessary, surgically repairing tissues adjacent the site of excision as described herein below. For example, for synovial joint replacement. it i:; desirable to repair the joint capsule, including the synovial membrane and ligaments. so as to surgically approximate the joint 20 structure as it occurs physiological conditions, thereby recreating the avascular environment which is the synovial cavity and which is bathed in synovial fluid. It ~slso is preferable to suture or otherwise mechanically temporarily connect the implanted device to surrounding tissue.
In one embodiment the device is conswcted to replace pan or all of a mammalian skeletal joint structure and includes a matrix having residues for plssral, distinct tissues, including two or 25 more of bone, cartilage, ligament, tendon, synovial capsule andlor synovial membrane tissue.
In another embodiment the device is constructed to replace an individual tissue of a mammalian skeletal joint. including an individual avascular and/or non-mineralized tissue. As demonsarated herein, the device is competent to induce functional replacement tissue formation.
including arcicular cartilage, from responding cells present in th.e local environment. including a strE sir (au~ 2s) synovial environment, and without requiring calluLr in6hsation of rnesenchymaJ
cell: from a vasculaccizzed muscle clap. The aaatrix of this embodiment coca residues specifrc for, or characteristic o~ andlor dacived from, tisane of the same typo as the individual tissue to be rid. 1n ether eaobodiment, the matrix comprises deviblized son-mineralized tissue. In a preferred aa>bodimea, the repiacaaeat tissae S can include articulu cariilaga, Ugame~, bone, teadoai or aynovisl capsule tissoc.
In a partial or complete joint replacenaern, ~ is but not toquire~9 to iacltde in the practice of the axihod the additiomil step of threading ~ mu8ek t>sp into a hollow portion of the implanted device.
Far example, using the method desen'bed in Rluwri, U.S. 5,067,963, a muscle tlsp; which can itself be procreated with oateogenic protein, can be surgically inaroduced into a cavity in d~a implanted r~trix, such as the murow cavity of devitslized bone, to provide a blood supply to expedite nsorphogcaesis of vascularized tiastte and to provide a rally supply of maa~ymal stem oelis.
The matrix of iaatsat iavea~on has utt7ity as an implantabk device when osteogemc protein is I S disposed ~ the snriaca of the maaix, pis an aaaaot t to iadace fomntion of each of the replao~ent tissues. This ptrmita reg~atkn of the body part within the msmnnsl, including plural tissues of appropriate size, interrela:iQaship, and function. Osteogemc proteins contemplaoed to be useful in the instant iave~on are de:cri6cd below sad have been e~-described io, fix example, U.S. Pat. Nos.
4,968,590, S,Z58,499 and 5,266.683. The oateogenic protein can be, for example:, any of the hewn bone motphogenetic proteins andlor aNivaleats thereof d~nbed herein md/or in the art sad includes naturally sou~rced maucial, recombinant mataiV, wd any m~ial othawim produced whkh is capable of inducing tissue morphogenesis.
The a>ethOds end msteriah of the iiaveMion are dally useful for the repair and/or partial or complete replacement of mammalian body joints, including, witho~
limitation, articulating joints, particularly joints aaclosed by a ligafieptoua capsule sad bathed in synovial fluid.
In some synovial jainta, the movement is urdaxisl, i.e., all movements tales plea around one axis:
Among these arc the ginglymau or hinge joint in which the axis of movement is Pt:TIUS9510672.~i WO 95!33502 transverse to the axes of the bones, and the trocttoid or pivot joint in which the axis is longitudinal.
In the case of biaxial synovial joints. movements are around two .axes at a right angle or any other angle to each other. These include the condyloid, the ellipsoid, an:d the saddle joints. Them is a third type of synovial joint, the spheroidal or ball-and-socket joint, in which the movements are 5 polyaxial. i.e.. movemec>ts are permitted in an infinite number of ~uces.
Finally, there are the plane or gliding-type synovial joints.
In hinge joints. the articular surfaces are molded to each other in such a manner as to permit motion in only one plane around tl~ transverse axis. Flexion at the elbow joint is an example: other examples include the interphalangeal joints of boat the fingers and toes. In pivot 10 joints, movement in a pivot joint also occurs around a single axis, however, it is the longitudinal axis. There are several pivot joints in the human body, such as th~~ proximal radioulnar articulation. In condylar joints include, movement occurs principally in one plane. The tibiofemoral articulation of the knee joint is an example. In ellipsoid joint include, movement is around two principal axes which are at right angles to each other. Examples of these joints include 15 the radiocarpal and metacarpophalangeal joints. In a saddie joint, the articular end of the proximal bone is concave in one axis and convex in a perpendicular axis. These surfaces fit reciprocally into convex and concave surfaces of the distal bone. The best example: of a saddle joint is the carpometacarpal joint of the thumb. A ball-and-socket joint is one: in which the distal bone is capable of motion around art indefuute number of axes with one common center.
Examples of this 20 form of articulation are found in the hip and shoulder joints. A pl;me or gliding-type joint allows ~a slight slipping or sliding of one bone over the other. Unlike the above-described joints. the amount of motion between the surfaces is limited by the ligaments or osseous processes that surround the articulation. This is the form present in the joints between the articular processes of certain vertebrae, the carpal joints. and the intetmetatarsal joints.
25 Although it is contemplated that the present invention is usable to repair defects including bone and articular cartilage elsewhere in a mammalian body. aspects of the invention are here illustrated in connection with the articulatins surfaces on the femur in a knee joint 10 illustrated in FIG. 1.
FIG. 1 illustrates a knee joint 10 between the bottom of a femur 11 and the top of a tibia 30 12. For clarity of illustration, only portions 13 and l4 of the medial and lateral collateral ligaments which movably tie the femur 11 to the underlying tibia :l2 and fibuh 15, are shown in S~lttUtE ~'ET (RUiF ~6?

V )SI33502 PC7."IU89.~671a FIG. 1. Similarly, the joint capsule is represented by the exterior dark lining 25, and the synovial membrane, which lines the synovial cavity and secretes the lubricating synovial fluid, is repeesertted by the interior dark lining 26. Normally interposed between the o~asing surfaces of the femur 11 and tibia 12 are lateral and medial meniscus cattilages 1G and 17 and anterior and S posterior cnrciate ligaments (not shown). The convexly curved condyles 20 and 21 at the lower end of the femur l l are normally supported by the meniscus cartilages 16 and 17, respectively, on the upper end of the tibia 12. Normally, the lower end of the femur 1 I, including the condyles 20 and 21, are covered by a layer 22 of hyaline cartilage material, referred to as the articular cartilage 22. Tlx articular cartilage 22 forms a generally resilient padding which is fixed on the surface of the Iower end of the femur 1 I to protect the latter from wear and mechanical shw:k. Moreover, the articular cartilage 22, when lubricated by the synovial fluid in the knee joint 10, provides a surface which. is readily slidable on the underlying surfaces of the meniscus cartiIages 16 and 17 (or on tt>c upper surface of the tibia IZ should one or both of the meniscus cartilas_e 16 and 17 be paNy or totally absent) during articulation of the knee joint 10.
A portion of the articular cartilage may become damaged by injury or 'disease, or become excessively wom. FIG. I illustrates an example of a damaged area 23.
As will be appreciated by the skilled artisan, provided the matrix has a tutee dimensional swcture sufficient to act as a scaffold for infiltrating cells, and includes the residues specific for.
or characteristic of, andlor which are derived from, the same tissue type as the tissue to be repaired, the precise nature of the substrate g~ used for the matrices disclosed herein is not determinative of a matrix's ultimate ability to repair and regenerate replacement tissue. In the instant invention. the substrate serves as a scaffold upon which certain cellular events. mediated by an osteogenic protein, necxssarily will occur. The specific responses to the osteogenic protein ultimately are dictated by the endogenous microenvironmcnt at the im~ant site and the developmental potential of the responding cells. As also will be appreciated by tlx skilled artisan, the precise choice of substrare utilized for the matrices disclosed herein will depend. in part. upon the type of defect to be repaired. anatomical considerations such as the extern of vaseulaeixacion ar the defect site. and the like.

1~~~#~ T ~~

WO 95!33502 The matrix of the invention may be otxairied as follows. A replacement tissue or body part to be used as a replacement body part and which comprises at least two distinct tissues in association to form the body part. is provided, as from a cadaver, or from a bone bank and treated.
as by ethanol meaunent and dehydrated by lyophilization, so th;u the remaining material is non-5 pathogenic and sufficient non-antigenic to prevent graft rejection. As described above, the thus seated material having utility in the vices of the invention further comprises the residues of ttx extracted tissue or tissues from which it is derived. A replacement body part matrix thus treated further is dimensioned such that the residues have a structural m"lationship to each otl>cr which mimic that of the body part to be rrplaced.
10 Natural-sourced Matrices Suitable allogenic or xenogeriic matrices can be created as ascribed herein below, using methods well known in the art. Preferably, the replacement body part or tissue is obtained fresh.
from a cadaver or from a tissue bank which freezes its tissues upon harvest.
In all cases and as will be appreciated by the practitioner in the field. it is preferable to freeze any tissue upon harvest.
15 unless the tissue is to be put to immediate use. Prior to use, the tissue is treated with a suitable agent to extract the cellular non-structural components of the tissue so as to devitalize the tissue.
The agent also should be capable of extracting any growth inhi>r~iting components associated with the tissue, as well as to extract or otherwise destroy any pathogens. The resulting material is an acellular matrix defining interstices that can be infiltrated by cells, and is substantially depleted in 20 non-structurally-associated components.
In a currently preferred procedure, the tissue is devitalized following a methodology such as that used in the art for fixing tissue. The tissue is exposed to a non-polar solvent, such as 10090 (200 proof) ethanol. for a time sufficient to substantially replace~ the water content of the tissue with ethanol and to destroy the cellular structure of the tissue. 'Typically, the tissue is exposed to 25 200 proof ethanol for several days, at a temperature in the rang: of about 4° - 40°C, taking care to replace the solution with fresh ethanol every 6-12 hours. until such time as the liquid content of the tissue comprises 70-90% ethanol. Typically. treatment for 3-4 days is appropriate. The volume of liquid added should be more than enough to submerse the tissue. The treated tissue then is lyophlized. The resulting, dry matrix is substantially depleted in non-structural components but 30 retains both intracellular and extracellular matrix components d~:rived from the tissue.
. 17 _ s~rurE s~ (~ ~s) l soz ncrrt~s~s~osn~
Numerous other methods are described in the art for extrauing tissues..
including mineralized tissue such as bone. and for rendering these tissues biocompatible for allogertic or xenogenic implants. See, for example, Sampath et al. (1983) PNAS $():6591-6595. US 5.011.691, and U.S. Patent Nos. 4.975.526 and 5.171.574. These publications describe extraction with 4M
guanidine-HCI. SOmM Tris-HQ, pH 7.0 for 16 hours at 4°C, and various deglycosylating and collagen fibril modifying agents, including hydrogen fluoride, trifluorocetic acid, dicttloromethane.
acxtoniaile, isopropanol, heated, acidic aqtuous solutions, and various combinaoions of these reagents. The disclosures of the patents is incorporated herein by reference.
pas described therein and below, where the matrix is treated with a fibril-modifying agent. the treated matrix can be , washed to remove any extracted components. following a form of the procedw a set forth below:
Suspend matrix preparation in TBS (Tris-buffered saline) Ig;200 ml and stir at 4°C for 2 hrs: or in 6 M urea. 50 mM Tris-HCI. 500 mM Na~~l, pH 7.0 (UTBS) or water and stir at room temperature (R'I~ for 30 minutes (setfficient time to rieutraiize the pH);
1 S 2 Centrifuge and repeat wash Step: and 3. Centrifuge; discard supernatant: water wash residue; and then lyopht~ize.
Treated ailogenic or xcnogenic matrices are envisioned to have particular utility for creating devices for forming replacement body parts comprising plural distinco tissues. as well as for creating devices for replacing individual joint tissues, such as ligament and articular cartilage tissue. For example, a replacement ligament device can be formulated from are allogenic ligament matrix and osteogeruc protein, and implanted at a skeletal joint locus followin;t standard sursical procedures for autogenous ligament replacement. Similarly, an allogenic atrieular cartilage device can. be formed from devitalized cartilage tissue, or other inert, non-mineralized matrix material and osteogenic protein. and the device laid on the subchondral bone surface as a sr~eeG Alternatively, a formulated device can be pulverized or otherwise mechanically abraded to produce particles which can be formulated into a paste or gel as described herein for application to the bone surface.

~Il~'f:~l~! ~!'t'~ /l~ti C AL1 )~'~$9~7Z~

~,yplhetic Matrices As an alternative to a natural-sourced matrix, or as a supplement to be used in combination with a natural-sourced matrix. a suitable matrix also can be formulated , using (1) residues derived from artdlor characteristic of. or specific for, the sumo tissue type as the tissue to be repaired, and (2) one or more materialswhich serve to create a three-dimensional scaffolding strtrcntrc that can be formed or molded to take on the dimensions of the replacement tissue desired.
In some cit~ctttnstances, as in the formatimt of articular cartilage on a subchondral bone surface.
osteogenic protein in combination with a matrix defining a three-dimensiartal scaffolding suueture sufficient to allow the attachment of infiltrating cells and eomFbsed of a ran-mineralized material cart be sufficitru. Any one or combination of materials can be used to advantage, including, without limitation, collagen; homopolymers or copolymers of QIycolic acid, lactic acid, and butyric acid, indudins derivatives thereof: and ceramic, such as hydroxyapatite, tricalciunt phosphate and other calcium phosphates and combinations thereof.
The tissue-specific component of a synthetic matrix re~ily can be o)xained by devitalizing an allogenic or xenogtnic tissue as described above and then pulerizing or otherwise mechanically breaking down the insoluble matrix remaining. This particulate material tl~n can be combined with one or more swcttrral materials. including those described herein.
Alternatively, tissue-specific components can be fuNxr purified from the treated matrix using standard extraction procedures well characterized in the art and, using standard ar,~alysis procedures, the extracted material at each purification step can be tested for its tissue-sF~ecificin capability. See, for example. Sampath ct al. ( 1987) PNAS ?$:7599-7603 and US 4.968.590 for exemplary tissue extraction protocols.
A synthetic matrix may be desired where, for example, replacement articular cartilage is desired in an existing joint to, for example. correct a tear or limited superficial defect in the tissue.
or to increase the height of the anicular cattila~e surface now worn due to age, disease or uatuna.
Such "resurfacing" of the articular cartilage layer can be achieved using the methods and compositions of the invention by, in one embodiment. ut:atin~ a sheet of allogerric or xenogesic articular cartilage tissue as described herein. coatis= the resulting matrix with osteogesic protein.
rolling up the formulated device so that it can be introduced to the joint using standard orthoscopic surgical techniques ar>d, or>ce provided to the site, tmroliing the device as a lay er onto the articular bone surface. In another embodiment, the device is formulated as a paste or injectable gel-like ~fiY~sEt (i~lf 2B) 0 9sr~~soi lPCrnJS9sro6na substance that can be injected onto the arcicular bone surface in the joint also using standard orthoscopic surgical techniques, In this embodiment, the fotmuiation may comprise a pulverized or otherwise mechanically degraded device comprising both matrix and oste~oger~ic protein and, in addition, one or more cmrtponents which serve to bind the particles ituo a paste-like or gel-like substance. Binding materials well characterized in the art include, for example.
carboxymethylcellulose, glycerol, polyethylene-glycol and the like, Akemauvely, the device can comlxise osteogenic protein dispersed in a synthetic matrix which provides the desired physical propetTies. As an example, a synthetic matrix having tissue specificity for cajtilage and bone is described in WO91/18558. published December 21.1991 and hettin below.
:Briefly, the matrix comprises a porous crosslinked structural polymer of biocompatible, biodegradable collagen and appropriate, tissue-specific glycosaminoglycans as tissue-specific cell attachment factors.
Collagen derived from a number of sources can be used, including insoluble collagen. acid-soluble collagen, collagen soluble in neutral or basic aqueous solutions. as well as those collagens which are commercially available.
Glycosaminoglycans (GAGs) or mucopolysact:harides are ttoxosamin~s-containing polysaccharides of animal origin that have a tissue specific distribution, and therefore may be used to l~lp determine the tissue specificity of the morpttogen-stimulated differentincirtg cells. Reaction with the GAGS also provides collagen with another valuablt property, i.e..
in2,bility to provoke an immune reaction (foreign body reaction) from an animal host.
Chemically, GAGS are made up of residues of hexoamines glycosidically bound and alternating in a more-or-less regular manner with either hexouronic acid or hexose moieties (see, e.g.. Dodgson et al. in ~,~j~h_y~drate ~tabolism and its Disorders (Dickens et al., eds.) Vol. 1.
Academic Press (1968)). Useful GAGs include hyalurot>ic acid, heparin, heparin sulfate.
chondroitin 6-sulfate, chondroitin 4-sulfate. dermatan sulfate, and keratin sulfate. Other GAGs also can be used for forming the matrix described herein, and those skilled in the art will eittkr know or be able to ascertain other suitable GAGs using no more than routine ~:xpetimentation. For a more detailed description of mucopolysaccharides, see Aspinall. ~~, Pergamon Press. Oxford (1970).
Collagen can be reacted with a GAG in aqueous acidic solutions, preferably in diluted acetic acid solutions. By adding the GAG dropwise into the aqueous collagen.
dispersion.
coprecipitates of tangled collagen fibrils coated with GAG resuhs. This tangled mass of fibers lyil~~'13~ I~RIT laia C X111 then can ba izod to faro a homogenous of fine I~as and then filtered sad a~ied.
l~ohaM'lity of the ceu-0AG produce can ba raised to the daairod d~egroe by y crosa-linking these materials, which also server to raise the resistance to resorption of tlxsa materials. In general, any covaknt cross-Iiniring m~Od auitabk for cross~1cotlagea also is suitabk for cross-lialong these composiee ial~ although craas-linkkg by a dehyd~ba~ml process is p<e~rred.
'Ibe devices of tire invention can be formnlatal using nay of the mathodt~
descx8xd in tie art for fommdtsting devices. See, f~ example, U.S. Patriot h'o. 5,266.683. Ba~iefly, protein ty~cally is dissolved in a suitable solvent sari combined wilt the rmh~ix. The caanponcnrs are allowed to associate. Typically, rise o~nbined material then is lyophitia~, with the result that 9se nee protein is disposed cm, ~ sdaorbed to the surfaces of the >mt~t.. Useful salub~aing solvents include, without liraihtion, sa ethsnoltri8ttoroaatic acid solution, a.g. 47.5'6 EtON/0.01'/oTFA; aid acatonitdkIfFA
solution, athsno> or atbanol in water, and phyaiologially bafflxod salase solutions. For~slations in as acidic buffer can facil irate adsorption of OP 1 onto the matrix surface. For the rep~Iaceme~tt body part devices of the iavantion, the a~rra~y preferred formulation pmtxol is iacubatio:n of mt>tix sad osteoganic protein in as a~anouTFA sohstion (e.g., 30-40%BtOH/0.01%TFA) for 24 hours, followed by lyophili~tioa. This procedure is aufficiont to adsorb err precipitate 70-90%
of the protein onto the matrix 'I1e quantity of osbeogenic protein used will dep~d on the aiza of replacsemeat devioc to be used end on the specific activity of rise o.~teog~ pm~teia. Typically, O.Smg-100/10 g of r~ix, dry weig)st, can be used to advantage.
1n addition to aaoeo~C pcotaim, vuiovs 8ruwth fa~«s. . ~Y~.
compositions, antibiotics, or other bioactive agents also can be adso:bed one, or impragpated within, a :ubslrate and rekaasd ova time whoa implanted and ~a rostra abwly is ab:orbtsd. Tlsas vatiotn known growth factors such as EGF, PDGF, IGF, FGF, TGF-a and TGF-b ctut be l 95!33502 Pl.'?1US95/06724 released ja vivo. The matrix can also be used to release chtrnotherageutic a2etu:~, insulin.
etuymes. enzyme inhibitors or chemotactic-chemoattractattt factors.
As defined herein. the osteogenic proteins useful in the composition and methods of the invention include the family of dimeric proteins having en~chondral bone activity wt~n implanted in a mammal in association with a matrix and which comprise a subclass of the "super family" of "TGF~i-like" proteins. The natural-sourced osteogenic protein in its mature, nati~~e form is a glycosylated dimer typically having an a~arent molecular weight of about 30-36 kDa as determined by SDS-PAGE. When reduced. the 30 kDa protein gives rise to two ;~lycosylated peptide subunits having apparent molecular weights of about 16 kDa and 18 kDa.
In the reduced state, the protein has no detectable osteogenic activity. The unglycosylated protein, which also has osteogenic activity, has an apparent molecular weight of about 27 kDa. When reduced. the 27 kDa protein gives rise to two unglycosylated polypelxides having molecular weights of about 14 kDa to 16 kDa capable of inducing endochondral bone formation in a mammal. Useful sequences include those rnmprising the C-terminal 102 amino acid sequences of DPP (from Drosophila). Vgl (from Xenopus). Vgr-1 (from mouse). the OPl and OP2 proteins, proteins (sec U.S.
Pat. No. 5.011.691 and Oppermann et al.. as well as the proteins referred to as BMP2, BMP3. BMP~~
(sce W088/00205. U. S. Patent No. 5.013.649 and W091/18098). BMPS and BMP6 (see W090/11366. PCT/US90ro1630 and BMP8 and 9.
The members of this family of proteins share a conserved six or seven cy,~teine skeleton in the C-terminal region. See. for example. 335-431 of Seq. ID No. l and whose sequence defines the six cystcine skeleton residues referred to herein as "OPS". or residues 330-431 of Seq. ID No. 1.
comprising 102 amino acids and whose sequence defines the seven cysteine skeleton.
This family of proteins includes loner forms of a given protein, as well a;s phylogenetic, e.~., species and allelic variants and biosynthetic mutants. including addition and deletion mutarus and v ariants, such as those which may alter the conserved C-terminal cysteir>c skeleton, provided that the alteration still allows the protein to form a dimeric species having a confatmation capable of inducing bone formation in a mammal when implanted in the mammal in association with a matrix. In addition. the osteogenic proteins useful in devices of this invention may include forms having varying glycosylation patterns and varying N-termini, may be naturally occurring or ~'ll~l~tlll'~ ~ll~! t~Q = ~1 WO 951335Q2 PCTlUS95106724 biosyntlxtically derived. and may be produced by expression of recombinant DNA
in procaryotic or eucaryotic host cells. The proteins are active as a single species (e.g., as homodimers), or combined as a mixed species. including heterodimers.
In one embodiment, the osteogenic protein contemplated herein comprises OP1 or an OP1-5 related sequence. Useful OPI sequences are recited in US Pat Nos. 5.011,691:
5,018.753 and 5.266.683: in Ozkaynak et al. (1990) EMBO JJ Q:2085-2093: and Sampath et al.
(1993) PNAS ~:
6004-6008. OP-1 related sequences include xenagenic homologs, e.g.; 60A, from Drosophila.
Wharton et al. (1991) PNAS $$:9214-9218: and proteins sharing greater than 609o identity with OPI in the C-terminal seven cysteine domain, preferably at least 65~7o identity. Exampl-s of OP-1 10 related sequences include BMPS. BMP6 (and its species homotog Vgr-1. Lyons et al. (1989) PNAS $ø:4554-4558). Celeste, et al. (1990) PNAS 87:9843-9.347 and PCT
international application W093I00432: OP-2 (Ozkayrtah et al. (1992) J.Bio:l. Chem. X7,:13198-13205) As will be appreciated by those having ordinary skill in the an. chimeri.c constructs readily can be created using standard molecular biology and mutagenesis techniques combining v arious portions of 15 different morphogenic protein sequences to create a novel sequence, and these forms of the protein also are contemplated herein.
In another preferned aspect. the invention contemplates osteogenic prouit>.s comprising species of polypeptide chains having the generic amino acid sequence herein referred to as "OPX"
which accommodates the homologies between the various identified species of the osteogenic OP1 20 and OP2 proteins. and which is described by the amino acid sequence presented below and in Sequence ID No. 3.
Cys Xaa Xaa His Glu Leu Tyr Va1 Ser Phe Xaa Asp Leu Gly Trp Xaa Asp Trp Xaa lle Ala Pro Xaa Gly Tyr Xaa Ala Tyr Tyr i:ys -23_ sir (surf ~s) VU 95!33502 PGT/US95~06714 Glu Gly Glu Cys Xaa Phe Pro Leu Xaa Ser Xaa Met Asn Ala Thr Asn His Ala Be Xaa Gln Xaa Leu Val His Xaa Xaa Xaa Pro Xaa Xaa VaI Pro Lys Xaa Cys Cys Ala Pro Thr Xaa Leu Xaa Ala Xaa Ser Val Leu Tyr Xaa Asp Xaa Ser Xaa Asn Val lle Leu Xaa Lys Xaa Arg Asn Met Val Val Xaa Ala Cys Gly Cys His, and wherein Xaa at res. 2 = (Lys or Arg): Xaa at res. 3 = (Lys or Arg): Xaa at res. 1 I = (Arg or Gln): Xaa at res. 15 = (Gln or Lcu): Xaa at res. 19 = (Ile or Val); Xaa at re,~. 23 = (Glu or Gln):
Xaa at res. 26 = (Ala or Ser); Xaa at ties. 35 = (Ala or Ser): Xaa at rrs. 39 := (Asn or Asp): Xaa at res. 41 = (Tyr or Cys); Xaa at res. 50 = (Val or Leu): Xaa at res. 52 = (Ser or Thr); Xaa at res. 56 = (Phe or Leu): Xaa at res. 57 = (Ile or Met): Xaa at res. 58 = (Asn or Lys);
Xaa at res. 60 = (Glu.
Asp or Asn); Xaa at mss. 61 = (Thr. Ala or Val); Xaa at res. 65 = (Pro or Ala): Xaa at res. 7 i =
(Gln or Lys): Xaa at res. 73 = (Asn or Ser); Xaa at res. 75 = (Ile or Thr);
x:aa at res. 80 = (Phe or Tyr); Xsa at res. 82=(Asp or Ser); xas at ces. 84~Sar or Asa); Xaa at tea.
891;Lys or Arg); xaa at res.
9l~Tyr or His); and Xaa at res. 97m(Arg or Lys).
In still another lxefcrrcd aspect; one or both of the polypepada emin aulnmits of the oso~geaerically active diver is oocoded by axkic acids which hybridize to DNA
a RNA sees a~odi~ the active region of OPl ueWa stringent hybcidiut~a oonditioos. As used 6ere~, stringent hybridization conditians are daf~aed as hybridization in 4056 formamide, 5 X
SS1PE, 5 X Daphardt's Solntioo, and 0.196 SDS at 37°C overnight, and washing in 0.1 X SSP$
0.156 SDS at 50°G
Given the foregoing amino acid and DNA:oqireax boa, the level of s1a71 in the art, and the disclosures of nuaneravs publiations on ost~geaic proteins, iachrding U.S.
Patent 5,011,691 and Pcr tine us s9ro1469, publi~aa as wo s9ro97ss, p~l~had o«obcr 19,1989, various DNAs can be coostnu~ed which encode at bast the active domain of an osteogenic protein useful in the devices of this invention, and various aaabgs thereof (including spxies arid allelic variants and those containing geaehcally engineered mutations), as wen ss finion proteins, truncated forms of the mature proteins, deletion and addition muWtts, and siavlat conshncis which can be usedl is the devices and of the invention. Moreover, DNA hybriddebon probes can be constNCtod from fr~n~ of any of these proE~s, a deigned ø~ 88x8 from the generic saqu~ca. Theca lnobes than can ba used to aereen ditTereat genomic arwl cDNA Irbrariea to idoatify additioosl osteogenic proteins useful in tba pmathctic devices of this invention.
The DNAs can be produced by these skilled is the art using wall known DNA
maaipuhuion tadauqua involving genomic ~d eDNA isolali~, coastt~don of DNA from syrrmesized oligonucleotidea, and caseetoe mutagsnesis ta~aiqu~. 15-100ma~
oligaaoacloatides may be synthesized ~
a DNA ayar, and purified by polyacrybunide gal elochup~r~is (PAGE is Tris-Bortto-~TA
buflcr. The DNA then may be ete~toel~ed from the gel. OverLpping oligoatara may be phosphorylated by T4 polynucleotide >onase and llgated into large blocks which may also be p~uified by PAGE.
The DNA from appropriately identifxd clones then can be isolated, snbcloned (preferably into an exp~ioa vector), and set~Ced. Fbcaking aeof inttreat then can be transfceted into an appropuiate host call for protein axpraid further characterization. The host may be a procaryotic or eurcaryotic cell since the formar's inability to glyrosyLte protein will not deswy the protein's morphoZenic activity. Uxfu1 host cells include )~ )~j.
~;~y~"y~, the inxetfiacutovinu cell system, myetama cells. CIi4 cells and various otter mammalian cells 7tte veeeors additionally may erteode various xquertces to promote coma expressicxr of the recotnbittant protein, inclufiing trarucriptbn promoter and urntination xquencts, ettttartcer seqttec>oes. preferred ribosome binding site se~xtfces, preferred mRNA lsader sees, preferred siguat seqtttxtxs for protein seaetiotu and the liYe.
The DNA she encoding the Zone of iruerest also may be m>nipulaoed to remove potauially inlbbitit~ xquertces or to minimize unwanted secot>dsty stnicntre formation. The rcooaabinant osteoZeNc proteLt also may be expressed as a firsiat protein.
After being translated.
the protein may be purified from Ure calls tlumxlves or recovered from the culture medium. AJ!
biologically xrive protein fomu comprise dimrric species joined b} disulfide hoods or othetyvise assoaated. produced by fdding and oxidizing one or mote of the various re~mbinant polyptptide chains within an ~prop<iate eucaryotic cell or jet y[lEU a8er expression of indiv idual subunits. A
decaikd description of osteoZenic protons exposed from rtcotnbinaut DNA in ~;~j and itt numerous different mammaUa<t cells is dsdosed in U.S. Prtent Na 5 46.963.
Altetrt~vely, osteogadc pdypepdde cdains can be syred chemically using conventional pqttide synthesis techrodues well known to thox having ordinary t~ili in the art, For example, the proteins may be synthesized ituaa or in pits on a solid peptide syruhesizer.
ruing s<aridard operating procedures. Coenpided chains then arc deproteaed and puified by IiPLC (high prcssurc liquid chromatography). If tell protein is syrultesixed in parts, the parts may be peptide bonded using standaro methodologies to form the intact Iuntein. In Fcncnat, the manner in which the osuogenic protdtu are made can be comentiottal and does not form a part of this inveruioa Eaistttl~itts~i~t 'the means for making and using the mairioes and dtvioes of the inventioa, as well as whet material aspens coxerrtirtg the nature acrd utility of telex carrtpositiorts.
induding taw to make and now to use the subject matter claimed. will be iStrttter understood crate the roUowing. whkh consticutts the best mode curcetxly contemplated for practicing the irneruion.
It wlfl be PCT/t1S95J~0671"
wo soz appreciated that rlx invention is not limited to such exemplary work or to the specific details set forth in these examples.
In the exemplification. a hemi-joint teconstmction of an articulating synovial joint is resected into an existing joint locus. As will be appreciated by those having ordinary skill in the 5 art, the msthods and compositions of the invention equally can be applied to the formation of replacement body parts other than skeletal joints, as well as to skeletal joints other than articttlatiug or synovial joints. Moreover, if desired, a replacement autogeraous joint can be constructed in the recipieru first by placing the device of the invetuiort at another convenient locus distal to the defect site, for a time sufficient to induce formation of the replacement body part.
and the autogenous 10 body part thus formed then sutured into the joint locus for use.
~~ 1? a 1. Recon.~yajc~n of a Mammalian Hemi-Joint New Zealand white rabbits were used as the expetimen.tal moil. Standard orthopedic surgical equipment and pnxedures were used.
As depicted in Fig. 2A, joint defects were created in a recipient by surgically resetting the 15 entire gleno-Numeral hemiarticular complex with the proximal two-thirds of the humerus.
Allografts for implantation were prepared from hemi-joints exci~.sed from a donor animal with the articular surface of the glenohumoral joint. All allografts were extracted in ethanol and lyophilized using standard procedures, and as described herein above, to destray the pathogeniciry and antigenieiry of the material. Specifically, intact joint complexes were excised, demarraowed and 20 ethanol treated by exposure to 200m1-SOOm1 of 200 proof ethanol for 72 hours at 40 C. Fresh ethanol was provided every 6-8 hours. Following ethanol treatment, the matrix was lyophilized and rehydrated in ethanol/TFA, with or without osteogenic protein. The treated hemi joints comprised devitalized bone. articular canilage, ligament, tendon;, synovialcapsule and svnovial membr~rte tissue.
25 As illustrated in Fig. 2B, all lyophilised, osteocenic protein-treated atlografrs were coated with OP-1 as described in U.S. 5.011,691. Specifically, mature, dimeric recombinant OP-1 (fiOP 1 ) was solubilized in an acetonitrile trifluoro-acetic acid sr~lution.
combined with the lyophilized allograft, and implanted. IS-20 mg proteinl8-10 g matrix, dry weight. was used. The distal bone portions of all allografts were secured in place with a four hole titanium miniplate. A
. 27 -1~ES~E!(~E~6) tttetiarlous surgical ra:oaswcdort of dte joint c~sute was pcrfomtcd by s~urfr~g the ly~t~d apwle ends m the endogenous capsule using st~td:urgical "~e~l established in the art using standard sucgieal ptroctdtrrts well es<abllshed in the art. 'this recrtued ate intact capsule std synoviai lining, thereby restodtsg dtt synovial mltieu of the grafted amcular surface. Maion S was permitted almost ituatediately after surgery, again to restore nomul joint coctditiorts.
Ia slowe an~rls, loa) muack flaps (cWanooea maximus aaasck; Fig. 2Cj wAere mcap~ated into tba region of the defect by thrmuscle iuoo the maww cavity of the allograft ss depicted in Fig. 2D using the med>od of ICl>omi as desctlbed is U.S. 5,067,9b3.
Briefly, vatxularized and oanveaieut mascle flea were dta:~d using sdmdsrd prcwell lotown ao the p~ri:~a in reconaatrctive stugery, ao as to msiatttiH a psrfusing blood mpply, sad threaded inside the boon marrow cavities of the at~raRs.
Pne>hninmy evaluations of the reconstrtcmd ttemi joints were obtaiasd by setisl waidy radiographs tuirtg X-ray, artdMr taagnetic resonance imaging (hHit).
Hisa>lOgial aAd medial 1 S oonf rmatory evaluaaotJS vreee caduaed upon sacrifice at 5 vvodcs and 6 moddu a;her surgery.
Mechanical evahtariatu imroived stanmrd tmngt of motion (ROME axastue:metys obtalr>ed serially ut~l saaifkt. His<ological evaluations involved staining sagital sections through the harvested allograftt using standard techniques.
Briefly, idendficuian of atticutar eartilagt cart be aocomplislted using uhrsatutrctural and/or biochemical parameters. For exampk, attiatlar cartilage tonnes a continuous layer of cartllage tissue possessing idendtiable zones. The superficial carte is characterized by droncJrocyta having a naaerted mmpltolvgy aatd an exaaallular network which dots na stain. or stains poorly. wide toluldine blot. indicaoctg the rduive absence of ptoteoglycans.
Chondrocy<es ire the tnid and deep tans have a spheeical appea~toe and the m~rix cxmains aburtdartt sulphated ptaeoglycat~s, as evidenced by staining whb toiuidine blue. Gvllagea fibers are pn~ert diffusely tttroughou< ttte matrix. The dtondrocytes possess ~tudatu rttugk tadoplssmic reticvlum arid are surrounded by exwceUutar network. 7tte pericWtr3ar network numerous thin non-banded collagen fiber:. The collagen to the iA<etteriwrial rtetwodc is less campacoed and embeddod in elaaort aartslu<xnt amorphous material, similar to articular . 28 -cartilage. Collagen Burs in the interutritorial report of the necwoak: exhibit the perio~c betiding characteristic of collagen fibers in the interterritorial zone of caailage tissue.
Biochemially. the pe~oe of Type II artd Type 1X n is the cartilage tissue is itrd'tct~ve of the di~ett~Oed phatocype of cttondrveytes. The pe~xtoa of Type II and/aa Type s lx collagen can be detennirted by simtdard gel elearophorais. western blot artslysis arty imatuutohitno-cbemit~l s~inittg using. ftx example. s~ttatett~ily avaulabae aat~ody. Other biotahemial muixr: ittchrde hemtdoxylin, eosin. CoWner's Ttac>uotne ford S~bzt~n-O.
Arti~ular cartilage rtgaxratiott was evaiu~ed ltiaologically in the exatnplGt de~ibed herein using giycosalninoglycsn-spedtlc stains and t~ti~,t well-',kztown in the tint. For the 10 initial histologic evaluuion. Ux defter sites were bisected Iestgtttwisr:
through the center of ttte defect. The resulting halves and surrounding tissue wets embedded in parafM
and seaiotnd across the axtcer of the defect. One hsif of each defect wu utilized for hiuologica! staining with toluidine blue and/or tumaeoxlin arid eosin. Goldrter's Ttichrane and Safrattirt-0. Ttte other half was used is preparin& seasons for immurtostaining. Hiuologial ewrluations involved assessment I S of: glycosamimglytxn conurtt in the repair autilage: cartilage and clmttdroey~e morpdtoaogy: and.
integrity arid marpttofogy a the defect interface. The morphology of the repair cartilage wu exhibited for the type of cartilage fomted: atticulsr vs. fibtntic by evaluating glyatsamirtoglyam content. degree of cartilage depositi~, and the like.
FI~sbgical evaluations ttahtg al~d~d medtodologiea wel) charaeterizod in the art also fit? allows assetsirtoeu of new bone and bone marrow f~matioo. See, f~
ettamph:, U.S. Pat. No.
5,266,683. Similarly. and synovial capsule iaegrity an 6e monitasrrd by 1~IRI.
as well as by histology upon sacrifice dive Weeha Duration (Shaft Tern) For the S week tnudy. font grasps wilt 10 rabbits per group were implattted with 25 lyophilized allogtahs. See Ftgs. 3A. 3B. 3C, and 3D. In Group I, tx»llyopdilized altograR 30 free of osteogenic protein. was itapiarued (Fig. 3A). In Group 2. expaimattal lyophilized atlogtaft 31 was impregnated with OF-1 prior to ituuphtttta<ion (Fig. 3B). In Group 3.
conovl lyophilised aDogeaft 30 free of osteogerie pttxein, was impluaed, with muscle flap 32 >?n~aded into marrow cavity 33 Wig. 3G'. In Group 4. expetimetttal lyophilized aHografi: 31 was imprcgttated with OP-1 . O 95133502 PCTNS9.51~06'1'l~
prior to implantation. and muscle flap 32 was threaded within the marrow cavi.ry 33 (Fig. 3D).
As stated above, graft healing was followed r>on-invasively with serial X-rays and standard MRI (magnetic resonance imaging). By X-ray assessment. allografcs treated vrith osteongic protein had a noticeably thickened cortex by I week post-operative, as compan:d with control allografts (Groups 1, 3) which evidenced only a thin egg-stall-Like cortex. By four weeks the majority control allografts had fractured.and were unstable. In contrast, OP-1 treated allogrefts (Groups 2. 4) sacemained stable.
NlItI also was used as a non-invasive means for following reformation of articular cartilage in the ailografts. A dark signal produced by MRI represents absent or nonviable cartilage, while a bright signal indicates live, viable cartilage. Control allografu produced oNy a dark signal. when tested at 1. 3 and 5 weeks post-operative. These MRI
findings were confirmed by histological analysis performed at 5 weeks post-operative. Sagital sectionin:o through control allografu showed a degenerated articular surface with no live cells.
By contrast. the MRI findings of the articuIar caps from OP-I~treaced allografts showed a bright signal by week 3 post-operative, indicating regeneration of viable articutar cartilage.
Histological analysis of the OP-I-treated allografcs at week 5 revealed a layer of newly generated articular cartilage on top of the allograft matrix. The allografts of Group 4 showed somewhat thicker cartilage layers than those of Group 2, sus~estinp that the addition of tee muscle flap may further enhance the rate of joint regeneration.
Additionally, joints regenerated with the OP-I-treated allograhs regained near normal range of motion by the time they wen harvested at 5 weeks post-reconstructiorr. The near normal range of motion also is indicative of the presence of lubricating synovial fluid. By contrast. the harvested control allografts wen stiff and contracted at harvest. Thus, hemi-joint n:plxement devices of the invention succeeded in fomting mechanically acrd functionally viable replacanent joints. with an intact capsule. and synovium. and functioning ligament, bone mrd articular cartilage tissue. In the absence of osteogenic protein. the allo~rafu, whip not rejected by the dormr. are insu~cient on their own to generate a functional. weight bearing joint.

ei~fi~#i~'t lu~.T Btu r ~

WO 95!33502 PCT/US95/06724 Example 33 Six Months Duration - (Lop Term) For the 6 month study, the variable of shaving off the old cartilaginous cap in the lyophilized allografts was introduced. Briefly, this was accomplished by mechanically sharing the articular cartilage cap of the joint surface.
The following groups were used with 4 rabbits per group: in Group 5, lyophilized allograft 34 with shaved aracular surface. and muscle flap 32 were implanu;d (see Fig.
4A); in Groap 6.
control lyophilized allograft 30 with non-shaved articular surface. .and muscle flap 32 were implanted (see Fig. 4B): in Group 7, lyophilized allograft 35 with shaved articular surface and OP-1, and muscle flap 36 treated with OP-1 were implanted (see Fig. ~4C): and, in Group 8, lyophilized allograft 37 with a non-shaved articular surface and OP-1, and muscle flap 36 treated wits OP-1 were implanted (see Fig. 4D). Grafts in Groups 5-8 were harvested at 6 months after surgery.
Based upon pre-harvest imaging studies, the results collected by 3 months post-operative are consistent with the above-described resulu collected at 5 week:.. Intact allografts treated with OP-I (Group 8) regenerated a live cartilaginous articular surface by 3 weeks when evaluated using N1RI. This articular cap is still present and even better developed at 3 months. Without OP-1 treatment of the allograft. (Group 6) there was negligible cartilage regeneration relative to the OP-1 treated groups.
Similarly. Group 8 rabbits (allograft + OP1, non-shaved) t~egained near normal range of motion (greater than 809c) in the reconstructed joint. Group 7 rabhits (allo~raft + OP1, shaved) achieved only 509 range of motion, and Groups 5 and 6 (no OP1) achieved less than 309e.
As determined by histology, the devices of the invention were competent to induce and maintain both bone and articular cartilage formation in the appropriate context to one another in a long term scudy(greater than 6 months). Specifically, the rabbits o:f Group 8, demonswated articular cartilage formation on the surface of bone, as evidenced maorphologically by the presence of resting. central and deeper zone chondrocytes. By contrast. in groups treated only with muscle flap. (Group 5 and 6) muscle was replaced with scar tissue. In the. groups treated with shaved botx marrices, no significant cartilage regeneration was identified.
demonstrating the requirement for cartilage-specific residues in articular cartilage formation in a non-vascularized mileiu.
_31_ a 95r33soi PcTnrsnros~za 1n both the short term and long term study, mechanically and functionally viable synovial joints resulted from the reconstructed hemijoints treated with ostcogenic protei», as evidenced by morphology and biochemistry. In addition. new tissue formed including articular cartilage, corrcspoc>ding in shape, kind arid suuctural relationship to the residues in the devitalized tissue which formed the matrix of the device. Collectively, these examples demonstrtte that a device comprising osteogenic prorein and an off the-shelf. non-viable lyophilized.
devitalized matrix can be transfotmcd into aviable. mechanically artd swcturally functional replacement body part structure comprising plural di~irtct newly formed tissues which assume the shhpe and function of the oagittal tissue. TIx device can restott normal function to a destroyed body part. including a destroyed skeletal joint, restoring mechanically and functionally viable plural distinct tissues, including bone and bone marrow, articular cartilage, ligament, ttndon, svnovial capsule and synovial membrane tissue. h4oreover. these tissues are restored under substantially physiological conditionsincluding. for example, from respotxling cells present in a synovial environment. and without exposure to avascularized muscle flap.
A device comprising osteogettic protein-treated matrices, including lyophilized allografts or xenografts as disclosed herein can lead to the formation of a new, mechanically, scrtrcturally and functionally viable replacement tissue, and to replacement body parts comprising plural distinct tissues, populated by the host cells, and without any of the limitations of prosthetic materials.
Those skilled in the art will know. or be able to ascertain using no most than routine .
experimentation, many equivalents to the specific embodimenu of the invention described herein.
These and all other equivalents are intended to be encompassed by the following claims.

l~l~ M~ft'!' It~~i~ C ~L1 W4 95133502 PCTN8951067?rt S SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:

(A) NAME: CREATIVE BIOMOLCULES, INC

(B) STREET: 45 SOUTH STREET

(C) CITY: HOPKINTON

(D) STATE: MA

1S (E) COUNTRY: USA

(F) POSTAL CODE (ZIP): 01748 (G) TELEPHONE: (508)-435-9001 (H) TELEFAX: (508)-435-0992 (I) TELEx:

ZO

(ii) TITLE OF INVENTION: MANUFACTURE OF J~.UTOGENOUS
REPLAC~NT

(iii) NUMBER OF SEQUENCES: 3 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: PATENT ADMINISTRATOP., TEST1~.
HURWITZ &

THIBEAULT

(B) STREET: 53 STATE STREET

30 (C) CITY: BOSTON

(D) STATE: MA

(E) COUNTRY: USA

(F) ZIP: 02109 3S (v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release X1.0, Version (t1.25 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: US

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(H) FILING DATE:
SO (viii) ATTORNEY/AGEh": INFORMATION:
(A) NAME: KELLEY. ROBIN D.
(H) REGISTRATION NUMBER: 34,637 (C) REFER.ENCE/DOCKET NUMBER: CRP107.PC
SS (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 617/248-7000 (B) TELEFAX: 617/248-7100 E)0 (2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1822 base gairs (B) TYPE: nucleic acid 6S !C) sTRAND~DNESS: single (D) TOPOLOGY: '-inear (ii) MOLECULE TYPE: cDNA

XO 95133502 PCTfUS95l06724 ( i i i ) HYPOTH...~'T'ICAL : NO
(iv) ANTI-S~ISE: NO
lO (vi) ORIGINAL SOURCE:
(A) ORGANISM: HOMO SAPIENS
(F) TISSUE TYPE: HIPPOCAMPUS
(ix) FEATURE:
IS (A) NAME/KEY: CDS
(B) LOCATION: 49..1341 (C) IDENTIFICATION METHOD: experimental (D) OTHER INFORMATION: /function 'OSTEOGENJ:C PROTEIN' !product= 'OPl' 20 /evidence= EXPERIMENTAL
/standard_name= 'OP1' (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GGTGCGGGCC CGGAGCCCGG i~GS.CCGGGTn GCGCGTAGAG CCG"CGCG ATG CAC GTG 57 riet His Val CGC TCA CTG CGA GCT GCG GCG CCG CAC AGC TTC GTG GCG C".'C TGG GCA 105 Arg Ser Leu Arg Ala Ala Ala Pro His Ser Phe Val Ala LE:u Trp Ala 3S CCC CTG TTC CTG CTG CGC TCC GCC CTG GCC GaC TTC AGC C7G GAC AAC 153 Pro Leu Phe Leu Leu Arg Ser Ala Leu Ala Asp Phe Ser Leu Asp Asn 20 25 30 3s Glu Val His Ser Ser Phe Ile His Arg Arg Leu Arg Ser Gln Glu Arg 40 45 s0 CGG GAG ATG CAG CGC GAG ATC CTC TCC ATT TTG GGC TTG CG:C CAC CGC 249 Arg Glu Met Gln Arg Glu Ile Leu Ser Ile Leu Gly Leu Pro His Arg 4S s5 60 E~S
SO
CCG CGC CCG CAC CTC CAG GGC AAG CAC AAC TCG GCA CCC A7"G TTC ATG 297 Pro Arg Pro His Leu Gln Gly Lys His Asn Ser Ala Pro Msa Phe Met CTG GAC CTG TAC AAC GCC ATG GCG GTG GAG GAG GGC GGC GC'd'a CCC G~vC 345 Leu Asp Leu Tyr Asn Ala Met Ala Val Glu Glu Gly Gly Gl.y Pro Gly SS GGC CAG GGC TTC TCC TAC CCC TAC AAG GCC GTC TTC AGT AG:C CAG GGC 393 Gly Gln Gly Phe Ser Tyr Pro Tyr Lys Ala Val Phe Ser Tl~:r Gln Gly 100 lOS 110 115 CCC CCT CTG GCC AGC CTG CnA GAT AGC CAT TTC CTC ACC GAC GCC GAC 441 60 Pro Pro Leu Ala Ser Leu Gln Asp Ser His Phe Leu Thr As;p Ala Asp 120 12s 130 ATG GTC ATG AGC TTC GTC AnC CTC GTG GAA CAT GAC AAG Gf~A TTC TTC 489 Met Val Met Ser Phe Val Asn Leu Val Glu His Asp Lys Gl.u Phe Phe 6S 13s lao 14,s CAC CCA CGC T~,C CAC C?.T CG, G~G TTC CG.G TTT GAT CTT TC:C AAG ATC 537 His Pro Arg Tyr His His Arg Glu Phe Arg Phe Asp Leu Ss:r Lys Ile ~~t ~ue~ non r wav WO 95!'33502 PCTNS95I06724 CCA GAA GGG GAA GCT GTC ACG GCA GCC GRA TTC G:~G 585 ATC TAC AAG GAC

Pro Glu Gly Glu Ala Val Thr Ala Ala Glu Phe Arg Ile Tyr Lys Asp I65 170 1'75 l0 TAC ATC CGG GAA CGC TTC GrIC AAT GAG ACG TTC t~.~G 633 ATC AGC GTT TAT

Tyr Ile Arg Glu Arg Phe Asp Asn Glu Thr Phe Arg Ile Ser Val Tyr IS CAG G2G CTC CAG GAG CAC TTG GGC AGG GAA TCG G,AT 68I
CTC TTC CTG CTC .

Gln Val Leu Gln Glu His Leu Gly Arg Glu Ser Asp Leu Phe L~u Leu GAC AGC CGT ACC CTC TGG GCC TCG GAG GAG GGC 'h:,G 729 CTG GTG TTT GAC

Z0 Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu Val Phe Asp ATC ACA GCC ACC AGC AAC CAC TGG GTG GTC AAT C~G CGG 777 CAC AAC CT'G

Ile Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg His Asn Leu GGC CT'G CF~G CTC TCG GTG GAG ACG CTG GAT GGG CAG 825 AGC ATC AAC CCC

Gly Leu Gln Leu Ser Val Glu Thr Leu Asp Gly Gln Ser ile Asn Pro AAG CAG CCC

Lys Leu Ala Gly Leu Ile Gly Arg His Gly Pro Gln Asn Lys Gln Pro 3S TTC ATG GTG GCT TTC TTC AAG GCC ACG Gist GTC CnC 921 TTC CGC AGC ATC

Phe Met Val Ala Phe Phe Lys Ala Thr G1u Val His Phe Arg Sez Ile AAG ACG CCC

40 Arg Ser Thr Gly Ser Lys Gln Arg Ser Gln Asn Arg Ser Lys Thr Pro AAG AAC CAG GAA GCC CTG CGG ATG GCC AAC GTG GCn GAG 1017 AAC AGC AGC

Lys Asn Gln Glu Ala Leu Arg Met Ala Asn Val A.la Glu Asn Ser Ser A.GC GAC CAG AGG CAG GCC TGT AAG AAG CAC GAG G'TG 1065 TAT GTC AGC TTC

Ser Asp Gin Arg Gln Ala Cys Lys Lys His Glu heu Tyr Val Ser Phe sa GGC TAC GCC

Arg Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Fro Glu Gly Tyr Ala 340 345 350, 355 SS GCC TAC TAC TGT GAG GGG GAG TGT GCC TTC CCT C.'TG 1161 AAC TCC TAC ATG

Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pro Leu Asn Ser Tyr Met AAC GCC ACC AAC CAC GCC ~.TC GTG CAG ACG CTG C:TC 1209 C:.C TTC ATC AAC

60 Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His Phe Ile Asn CCG GAA ACG GTG CCC AAG CCC TGC TGT GCG CCC l;CG 12'7 CAG CTC AAT GCC

Pro Glu Thr Val Pro Lys Pro Cys Cys Ala Pro '.Chr Gln Leu Asn Ala ATC TCC GTC CTC TAC TTC GnT GAC AGC TCC h.=~C f~TC 1305 ATC CTG AAG F~F~A

Ile Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn ~lal Ile Leu Lys Lys S~tUtESEET(1~~

y0 95133502 1'CT/US95I0671~i 405 410 41s TAC AGA AisC ATG GTG GTC TGT GGC CnC iAGCTCCTCC 1351 CGG G~.C TGC

Tyr Arg Asn Met Val Val Cys Gly His Arg Ala Cys GAGAATTCAG ACCC'ITTGGG TCTGGATCCTCCATTGCTCG CCThGGCCAG1411 GCCAAGTTTT

IS TGTGAGAGTA TTAGGAAACA TGAGCAGC=.TATGGCTTTTGATCAGTTT"IT CAGTGGCAGC1531 ATCCAATCAA CAAGATCCTA CAAGCTGTv~CAGGCAAAACCTe'.GCACGAAA AAAAAACAAC1591 GCATAAAGAA AAAZGGCCGG GCCAGGTCi~TTGGCTGGGnAGTCTCAGCCA T:,CACGGACT1651 CGTTTCCnGA GGTAATTATG nGCGCCTACCAGCCAGGCCi~CCCnGCCGTG GaAGGAAGGG1711 GGCGTGGCnA GGGG'IrsGGCn TGTGCG:wGGnFsAATTGAC C'CGGAAGTTC1771 CATTGGTGTC

2S CTGTAATAAA TGTC.;~CP.J,TA ATGAAAi,ni,i,Ae~;niau4AAA A 1822 nnnCGnATGi, (2)INFORMATION FORSEQID N0:2:

(1)SEQUENCE CHARACTERISTICS:

(A) LENGTii : 1 amino 43 acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE: rotein MOLECULE p (xi) SEQUENCE DESCRIPTION: NO:
SEQ Z:
ID

MetHisValArg SerLeuArgAla AlaProHisSerPhe 'JalAla Ala LeuTrpAlaPro LeuPheLeuLeu SerAlaLeuAlaAsp PheSer Arg LeuAspAsnGlu ValHisSerSer IleHisArgArgLeu .ArgSer Phe GlnGluArgArg GluMetGlnAr= IleLeuSe.IleLeu GlyLeu Glu ProHisArgPro ArgProHisLeu GlyLysHisAsnSer ,AlaPro Gln SS MetPheMetLeu AspLeuTyrAsn MetAlaValGluGlu GlyGly Ala GlyProGlyGly GlnGlyPheSer ProTyrLysAlaVal PheSer Tyr ThrGlnGlyPro ProLeuAlaSer GlnAspSerHisPhe ;LeuThr Leu AspAlaAspMet ValMetSerPhe AsnLeuValGluHis .AspLys Val 13o I3s I4o GluPhePheHis ProArgTarHis ArgGluPheArgPhe .AspLeu His nlt~li~'!' l~c'~' IRi~ C ~1 WO 95I335t12 PCTNS951n67Z4 Ser Lys Ile Pro Glu Gly Glu Ala Val Thr Ala Ala Glu Phe Arg Ile Tyr Lys Asp Tyz Ile Arg Glu Arg Phe Asp Asn Glu Thr Phe Arg Ile Ser Val Tyr Gln Val Leu Gln Glu His Leu Gly Arg Glu Ser Asp Leu 15 Phe Leu Leu Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu Val Phe Asp Ile Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg His Asn Leu Gly Leu Gln Leu Ser Val Glu Thr Leu Asp Gly Gln Ser Ile Asn Pro Lys Leu Ala Gly Leu Ile Gly Arg Hi.. Gly Pro Gln Asn 25 260 265 2?0 Lys Gln Pro Phe Met Val Ala Phe Phe Lys ::la Thr Glu Val His Phe 30 Arg Ser Ile Arg Ser Thr Gly Ser Lys Gln Arg Sex- Gln Asn Arg Ser 290 295 30(>
Lys Thr Pro Lys Asn Gln Glu Ala Leu Arg Met Alai Asn Val Ala Glu Asn Ser Ser Ser Asp Gln Arg Gln Ala Cys Lys Lys His Glu Leu Tyr Val Sex Phe Arg Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pro Leu Asn 45 Ser Tyr Met Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His Phe Ile Asn Pro Glu Thr Val Pro Lys Pro Cys Cy:; Ala Pro Thr Gln 385 390 3~5 400 Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys His (2) INFORMATION FOR SEQ ID N0:3:
60 (i) SEQUENCE CHARACTERISTICS:
(A) LEITH: 102 amino acids (H) TYPE: amino acid (D) TOPOLOGY: linear 65 (ii) MOLECULE TYPE: protein (ix) FEATURE:

~, ~ 95f33502 PtT/US951867Z4 J (~.) NAME/KEY: Protein (H) LOCATION: 1..102 (D) OTHER INFORMATION: /label= OPX
/note= ~WH~REIN EACH XAA IS INDEPENDENTLY SELECTED

IO AS DEFINED IN THE SPECIFICF~TION' (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
15 Cys Xaa Xaa His Glu Leu Tyr VaI Xaa Phe Xaa Asp Leu G:(y Trp Xaa Asp Trp Xaa Ile AIa Pro Xaa Gly Tyr Xaa Ala Tyr Tyr Cvs Glu Gly 20 25 3n) Glu Cys Xaa Phe Pro Leu Xaa Ser Xaa Met Asn Ala Thr A:~n His Ala 25 lle SOa Gln Xaa Leu Val Sss Xaa Xaa Xaa Pro 68 Xaa Val Pro Lys Xaa Cys Cys Ala Pro Thr Xaa Leu Xaa .~.la Xaa Ser Val Leu Tyr Xaa 30 Asp Xaa Ser Xaa Asn Val Xaa Leu Xaa Lys Xaa Arg Asn stet Val Val Xaa Ala Cys Gly Cys His M~ ~ ~ ~

Claims

1. A device for implantation in a mammal which serves as a template to form in vivo a functional replacement skeletal joint comprising plural distinct tissues, wherein at least one of said plural distinct tissues is a non-mineralized tissue, the device comprising:
a) a biocompatible, biodegradable matrix defining a single structure allowing the attachment of infiltrating cells and comprising residues having specificity for, or derived from, plural distinct tissues of a skeletal joint, at least one of said tissues being a non-mineralized tissue;
and having dimensions and shape which mimic that of the skeletal joint to be replaced; and disposed on the surface of said matrix, b) an osteogenic protein in an amount sufficient to induce formation of new said plural distinct tissues having dimensions and shape which mimic the skeletal joint to be replaced, at least one of said new tissues being a non-mineralized tissue, thereby to permit regeneration of a functional skeletal joint.
3. The device of claim 1 wherein said matrix comprises devitalized tissue from a mammalian donor.
4. The device of claim 1 wherein said matrix comprises residues of articular cartilage and of bone.
6. The device of claim 1 wherein the matrix comprises dehydrated mammalian tissue.
7. The device of claim 1 wherein said replacement non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, tendon, synovial capsule and synovial membrane tissue.
8. The device of claim 1 wherein said skeletal joint defines a synovial or articulating joint.

9. The device of claim 1 wherein said device defines a devitalized intact skeletal joint structure.
10. A device for implantation in a mammal forming in vivo articular cartilage replacement tissue in a skeletal joint, the device comprising:
osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix said matrix defining a structure which allows the attachment of infiltrating cells and which comprises residues specific for, or derived from, articular cartilage tissue.
11. A device for implantation in a mammal for forming in vivo replacement non-mineralized tissue in a skeletal joint, the device comprising:
osteogenic protein disposed on the surface of a bioeompatible, bioresorbable matrix, said matrix defining a structure which allows the attachment of infiltrating cells and which comprises residues specific for, or derived from, non-mineralized skeletal joint tissue corresponding in kind to said tissue to be replaced.
12. The device of claim 11 wherein said non-mineralized tissue is an avascular tissue.
13. The device of claim 10 wherein said non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, synovial membrane and synovial capsule tissue.
14. The device of claim 10 or 11 wherein said matrix comprises devitalized allogenic or xenogenic tissue.
15. The device of claim 10 or 11 wherein said matrix comprises a material selected from the group consisting of: collagen, polymers comprising monomers of lactic acid, glycolic acid, butyric acid and combinations thereof, hydroxyapatite, tricalcium phosphate, and mixtures thereof.

16. The device of claim 10 or 11 further comprising a material suitable for binding particulate matter to form a moldable solid.
17. The device of claim 1, 10 or 11 wherein said osteogenic protein comprises homodimers or heterodimers of OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX, or functional equivalents thereof.
18. A method for inducing in a mammal the formation of an autologous replacement skeletal joint comprising plural distinct tissues wherein at least one of said plural distinct tissues is a non-mineralized tissue, said method comprising the steps of:
a) providing a device comprising osteogenic protein disposed on the surface of a bioresorbable, biocompatible matrix, said matrix defining a single structure allowing the attachment of infiltrating cells and comprising residues having specificity for, or derived from said plural distinct tissues of a skeletal joint, at least one of said tissues being a non-mineralized tissue, and having dimensions and shape which mimic that of the skeletal joint to be replaced. at least one of said new tissues being a non-mineralized tissue; and b) implanting said device at a locus in a mammal, thereby to induce formation of a functional skeletal joint.
19. The method of claim 18 wherein said locus in said mammal defines an endogenous body part to be replaced.
20. The method of claim 18 wherein said matrix further comprises residues which are dimensioned to correspond in shape and structural relation to said plural distinct tissues to be replaced.
21. The method of claim 18 wherein the plural distinct tissues comprise bone and cartilage.

22. The method of claim 18 wherein said matrix comprises devitalized allogenic or xenogenic tissue.

23. The method of claim 18 wherein one of said plural distinct tissues is an avascular tissue.

24. A method for repairing in vivo articular cartilage on the surface of a bone, the method comprising the step of:
providing to said bone surface at a locus in a mammal a device comprising an osteogenic protein disposed on the surface of a biocompatible, bioresorbable; matrix, said matrix comprising residues specific for, or derived from, cartilage, and defining a structure which allows the attachment of infiltrating cells.

25. The method of claim 24 wherein said locus occurs in a synovial cavity.

26. A method for restoring in a mammal a non-mineralized tissue in a skeletal joint, the method comprising the step of:
providing to said skeletal joint in a mammal a device comprising an osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix said matrix comprising residues specific for, or derived from, tissue corresponding in kind to said non-mineralized tissue to be replaced, and defining a structure which allows the attachment of infiltrating cells.

27. The method of claim 26 wherein said non-mineralized tissue to be restored comprises avascular tissue.

28. The method of claim 26 wherein said non-mineralized tissue to be restored is selected from the group consisting of articular cartilage, tendon, ligament, synovial capsule and synovial membrane tissue.

29. The method of claim 24 or 26 wherein said matrix is derived from allogenic or xenogenic articular cartilage.

30. The method of claim 24 or 26 wherein said device comprises a moldable solid.

31. The method of claim 24 or 26 wherein said device comprises a flexible sheet.

32. The method of claim 24 or 26 wherein said device comprises collagen, polymers comprising lactic acid, butyric glycolic acid or mixtures thereof;
hydroxyapatite and combinations thereof.

33. The method of claim 18, 24 or 26 wherein said osteogenic protein comprises homodimers or heterodimers of OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, EMP6, OPX, or functional equivalents thereof.