CA2364330A1 - Secreted protein zsig49 - Google Patents

Abstract

The present invention relates to polynucleotide and polypeptide molecules fo r zsig49, a novel secreted protein. The polypeptides and polynucleotides encoding them are highly expressed in pancreas tissue and have been mapped t o human chromosome 1q24.1. The present invention provides methods for identifying abnormalities in human chromosome 1q and polymorphisms in an zsig49 gene that resides on chromosome 1q at a locus linked with a heritable form of Type II diabetes.

Description

DESCRIPTION

BACKGROUND OF THE INVENTION
Proteins secreted from cells can act as intercellular signaling molecules which control the ontogeny and maintenance of tissue form and function.
These secreted proteins control, among other things, proliferation, differentiation, migration, and expression of cells of multicellular organisms and act in concert to form cells, tissues and organs, and to repair and regenerate damaged tissue. Examples of secreted proteins include hormones and polypeptide growth factors including steroid hormones (e. g. estrogen, testosterone), parathyroid hormone, follicle stimulating hormone, the interleukins, platelet derived growth factor (PDGF), epidermal growth factor (EGF), granulocyte-macrophage colony stimulating factor (GM-CSF), erythropoietin (EPO) and calcitonin, among others. Hormones and growth factors influence cellular metabolism by binding to receptors.
Receptors may be integral membrane proteins that are linked to signaling pathways within the cell, such as second messenger systems. Other classes of receptors are soluble molecules, such as the transcription factors.
There is a continuing need to discover new proteins, such as the hormones and growth factors described above. The present invention provides such novel secreted proteins, agonists, antagonists and receptors of such proteins, as well as related compositions and methods as well as other uses that should be apparent to those skilled in the art from the teachings herein.

SUMMARY OF THE INVENTION
Within one aspect the invention provides an isolated polypeptide comprising a contiguous sequence of 50 amino acid residues of SEQ ID NO:10. Within one embodiment the contiguous sequence is 100 amino acid residues of SEQ ID N0:10. Within another embodiment the contiguous sequence is 200 amino acid residues of SEQ ID
NO:10. Within another embodiment the polypeptide further comprises an affinity tag or binding domain.
Within another aspect the invention provides an isolated polypeptide comprising a sequence of amino acid residues that is at least 90% identical to the amino acid sequence of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467, wherein the polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID N0:10 specifically binds. Within one embodiment the polypeptide comprises a sequence of amino acid residues that is at least 95% identical to the amino acid sequence of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467, wherein the polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID NO:10 specifically binds. Within another embodiment the amino acid percent identity is determined using a FASTA program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=blosum62, with other parameters set as default. Within yet another embodiment any difference between the amino acid sequence encoded by the polynucleotide molecule and the corresponding amino acid sequence of SEQ ID NO:10 is due to a conservative amino acid substitution.
The invention also provides an isolated polypeptide selected from the group consisting of: a) a polypeptide comprising amino acid residues 34-63 of SEQ ID
N0:2; b) a polypeptide comprising amino acid residues 64-467 of SEQ ID NO:10; c) a polypeptide comprising amino acid residues 58-461 of SEQ ID N0:12; d) a polypeptide of SEQ ID N0:2, from amino acid residue 34 to amino acid residue 77; e) a polypeptide of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467; f)a polypeptide of SEQ ID N0:12, from amino acid residue 28 to amino acid residue 461; g) a polypeptide of SEQ ID N0:2; h) a polypeptide of SEQ ID NO:10; and i) a polypeptide of SEQ
ID N0:12.
The invention further provides an isolated polypeptide comprising the amino acid sequence of SEQ ID
N0:2, from amino acid residue 1 to amino acid residue 33.
Within another aspect the invention provides an isolated polynucleotide encoding a polypeptide comprising a contiguous sequence of 50 amino acid residues of SEQ ID
NO:10. Within one embodiment the contiguous sequence is 100 amino acid residues of SEQ ID NO:10. Within another embodiment the contiguous sequence is 200 amino acid residues of SEQ ID NO:10. Within yet another embodiment the polypeptide further comprises an affinity tag or binding domain.
Within another aspect the invention provides an isolated polynucleotide encoding a polypeptide comprising a sequence of amino acid residues that is at least 90%
identical to the amino acid sequence of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467, wherein the polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID N0:10 specifically binds. Within one embodiment the polypeptide comprises a sequence of amino acid residues that is at least 95 o identical to the amino acid sequence of SEQ ID N0:10, from amino acid residue 34 to amino acid residue 467, wherein the polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID NO:10 specifically binds. Within another embodiment the amino acid percent identity is determined using a FASTA program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=blosum62, with other parameters set as default.
Within yet another embodiment any difference between the amino acid sequence encoded by the polynucleotide molecule and the corresponding amino acid sequence of SEQ ID NO:10 is due to a conservative amino acid substitution.
Within another aspect the invention provides an isolated polynucleotide selected from the group consisting of: a) a polynucleotide encoding a polypeptide comprising amino acid residues 34-63 of SEQ ID N0:2; b) a polynucleotide encoding a polypeptide comprising amino acid residues 64-467 of SEQ ID NO:10; c) a polynucleotide encoding a polypeptide comprising amino acid residues 58-461 of SEQ ID N0:12; d) a polynucleotide encoding a polypeptide of SEQ ID N0:2, from amino acid residue 34 to amino acid residue 77; e) a polynucleotide encoding a polypeptide of SEQ ID N0:10, from amino acid residue 34 to amino acid residue 467; f) a polynucleotide encoding a polypeptide of SEQ ID N0:12, from amino acid residue 28 to amino acid residue 461; g) a polynucleotide encoding a polypeptide of SEQ ID NO: 2; h) a polynucleotide encoding a polypeptide of SEQ ID NO:10; i) a polynucleotide encoding a polypeptide of SEQ ID N0:12; j) a polynucleotide comprising nucleotide 167 to nucleotide 1567 of SEQ ID N0:9; k) a polynucleotide comprising nucleotide 1 to nucleotide 1383 of SEQ ID N0:12; 1) a polynucleotide sequence complementary to a), b), c), d), e), f), g), h), i), j) or k); and m) a degenerate polynucleotide sequence of a), b), c), d), e), f), g), h) or i) .
The invention also provides an isolated polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID N0:2, from amino acid residue 1 to amino acid residue 33.
Within a further aspect the invention provides a variant zsig49 polypeptide, wherein the amino acid sequence of the variant polypeptide shares an identity with the amino acid sequence of SEQ ID NO:10 selected from the group consisting of at least 80o identity, at least 90o identity, at least 95o identity, or greater than 950 _ CA 02364330 2001-10-04 identity, and wherein any difference between the amino acid sequence of the variant polypeptide and the amino acid sequence of SEQ ID NO:10 is due to one or more conservative amino acid substitutions.

5 Within another aspect the invention provides a polynucleotide molecule encoding a fusion protein consisting essentially of a first portion and a second portion joined by a peptide bond, the first portion comprising a polypeptide as described above; and the second portion comprising another polypeptide.
The invention also provides a polynucleotide encoding a fusion protein comprising a secretory signal sequence having the amino acid sequence of amino acid residues 1-33 of SEQ ID NO:10, wherein the secretory signal sequence is operably linked to an additional polypeptide.
Within a further aspect the patent provides an expression vector comprising the following operably linked elements: a transcription promoter; a DNA segment encoding a polypeptide as described above; and a transcription terminator. Within one embodiment the polypeptide further comprises a secretory signal sequence operably linked to the polypeptide. Within a related embodiment the secretory signal sequence comprises amino acid residues 1-33 of SEQ ID N0:2. Within another embodiment the DNA
segment encodes a polypeptide covalently linked amino terminally or carboxy terminally to an affinity tag.
The patent also provides a cultured cell into which has been introduced an expression vector as described above, wherein the cultured cell expresses the polypeptide encoded by the polynucleotide segment.
Also provides is a method of producing a polypeptide comprising: culturing a cell into which has been introduced an expression vector as described above;
whereby the cell expresses the polypeptide encoded by the polynucleotide segment; and recovering the expressed polypeptide. Within one embodiment the expression vector further comprises a secretory signal sequence operably _CA 02364330 2001-10-04 linked to the polypeptide; the cultured cell secretes the polypeptide into a culture medium, and the polypeptide is recovered from the culture medium.
Within another aspect the invention provides an antibody or antibody fragment that specifically binds to a polypeptide as described above. Within one embodiment the antibody is selected from the group consisting of: a) polyclonal antibody; b) murine monoclonal antibody; c) humanized antibody derived from b); and d) human monoclonal antibody. Within a related embodiment the antibody fragment is selected from the group consisting of F(ab'), F(ab), Fab', Fab, Fv, scFv, and minimal recognition unit. Within another embodiment is provided an anti-idiotype antibody that specifically binds to the antibody described above.
Also provides is a polypeptide as described above in combination with a pharmaceutically acceptable vehicle.
Within another aspect the invention provides a method of detecting a chromosome 1 abnormality in a subject comprising: (a) amplifying nucleic acid molecules that encode a polypeptide as described from RNA isolated from a biological sample of the subject, and (b) detecting a mutation in the amplified nucleic acid molecules, wherein the presence of a mutation indicates a chromosome 1 abnormality. Within one embodiment the detecting step is performed by comparing the nucleotide sequence of the amplified nucleic acid molecules to the nucleotide sequence of SEQ ID N0:9, wherein a difference between the nucleotide sequence of the amplified nucleic acid molecules and the corresponding nucleotide sequence of SEQ
ID N0:9 is indicative of chromosome 1 abnormality. Within another embodiment amplification is performed by polymerase chain reaction or reverse transcriptase polymerase chain reaction.
Within another aspect is provided a method of detecting a chromosome 1 abnormality in a subject comprising: (a) amplifying nucleic acid molecules that encode a polypeptide as described above from RNA isolated from a biological sample of the subject, (b) transcribing the amplified nucleic acid molecules to express mRNA, (c) translating the mRNA to produce polypeptides, and (d) detecting a mutation in the polypeptides, wherein the presence of a mutation indicates a chromosome 1 abnormality.
The invention also provides a method for diagnosing a metabolic disease or susceptibility to a metabolic disease in an individual, wherein the disease is related to the expression or activity of a polypeptide as described above in the individual, comprising the step of determining the presence of an alteration in the nucleotide sequence encoding the polypeptide in the genome of the individual, wherein the presence of an alteration in the nucleotide sequence indicates metabolic disease or susceptibility to a metabolic disease.
Within another aspect the invention provides a method for diagnosing a metabolic disease or susceptibility to a metabolic disease in an individual, comprising:(a) amplifying nucleic acid molecules that encode a polypeptide as described above from RNA isolated from a biological sample of the individual, and (b) detecting a mutation in the amplified nucleic acid molecules, wherein the presence of a mutation indicates metabolic disease or susceptibility to a metabolic disease.
Also provided is a method for diagnosing a metabolic disease or susceptibility to a metabolic disease in an individual, comprising:(a) amplifying nucleic acid molecules that encode a polypeptide as described above from RNA isolated from a biological sample of the subject, (b) transcribing the amplified nucleic acid molecules to produce mRNA, (c) translating the mRNA to produce the polypeptides, and (d) detecting a mutation in the polypeptides, wherein the presence of a mutation indicates metabolic disease or susceptibility to a metabolic disease. Within one embodiment the metabolic disease is diabetes. Within a related embodiment the metabolic disease is Type II diabetes, and the individual is a Pima Indian.
The invention further provides a method of detecting the presence of zsig49 polypeptide RNA in a biological sample, comprising the steps of: (a) ontacting a nucleic acid probe under hybridizing conditions with either (i) test RNA molecules isolated from the biological sample, or (ii) nucleic acid molecules synthesized from the isolated RNA molecules, wherein the nucleic acid probe has a nucleotide sequence comprising a portion of the nucleotide sequence of nucleotides 167-1567 of SEQ ID N0:9 or its complement, or the nucleotide sequence of nucleotides 1-1383 of SEQ IN N0:12 or its complement, and (b) detecting the formation of hybrids of the nucleic acid probe and either the test RNA molecules or the synthesized nucleic acid molecules, wherein the presence of the hybrids indicates the presence of zsig49 polypeptide RNA
in the biological sample.
The invention also provides a method of detecting the presence of a polypeptide as described above in a biological sample, comprising the steps of: (a) contacting the biological sample with an antibody or an antibody fragment, that specifically binds with a polypeptide consisting of the amino acid sequence of SEQ
ID NO:10, wherein the contacting is performed under conditions that allow the binding of the antibody or antibody fragment to the biological sample, and (b) detecting any of the bound antibody or bound antibody fragment. Within one embodiment the antibody or the antibody fragment further comprises a detectable label selected from the group consisting of radioisotope, fluorescent label, chemiluminescent label, enzyme label, bioluminescent label, and colloidal gold.

Within another aspect the invention provides a kit for the detection of a gene encoding a polypeptide, comprising: a first container that comprises a polynucleotide molecule as described above; and a second container that comprises one or more reagents capable of indicating the presence of the polynucleotide molecule.
The invention also provides a kit for the detection of a gene encoding a polypeptide, comprising: a first container that comprises an antibody as described above; and a second container that comprises one or more reagents capable of indicating the presence of the antibody.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail, it may be helpful to the understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a peptide segment that can be attached to a polypeptide to provide for purification or detection of the polypeptide or provide sites for attachment of the polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a poly-histidine tract, protein A (Nilsson et al., EMBO J.
4:1075, 1985; Nilsson et al., Methods Enz~mol. 198:3, 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA 82:7952-4, 1985), substance P, FlagTM peptide (Hopp et al., Biotechnoloay 6:1204-10, 1988;
available from Eastman Kodak Co., New Haven, CT), streptavidin binding peptide, or other antigenic epitope or binding domain. See, in general Ford et al., Protein Expression and Purification 2: 95-107, 1991. DNAs encoding affinity tags are available from commercial suppliers (e. g., Pharmacia Biotech, Piscataway, NJ).
The term "allelic variant" denotes any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may 5 encode polypeptides having altered amino acid sequence.
The term allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
The terms "amino-terminal" and "carboxyl terminal" are used herein to denote positions within 10 polypeptides and proteins. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide or protein to denote proximity or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a protein is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete protein.
The term "complements of polynucleotide molecules" denotes polynucleotide molecules having a complementary base sequence and reverse orientation as compared to a reference sequence. For example, the sequence 5' ATGCACGGG 3' is comp7_ementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a polynucleotide that has a contiguous stretch of identical or complementary sequence to another polynucleotide. Contiguous sequences are said to "overlap" a given stretch of polynucleotide sequence either in their entirety or along a partial stretch of the polynucleotide. For example, representative contigs to the polynucleotide sequence 5'-ATGGCTTAGCTT-3' are 5'-TAGCTTgagtct-3' and 3'-gtcgacTACCGA-5'.
The term "corresponding to", when applied to positions of amino acid residues in sequences, means corresponding positions in a plurality of sequences when the sequences are optimally aligned.

The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
The term "expression vector" denotes a DNA
molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription.
Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
The term "isolated", when applied to a polynucleotide molecule, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones.
Isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tijan, Nature 316:774-78, 1985). When applied to a protein, the term "isolated" indicates that the protein is found in a condition other than its native environment, such as apart from blood and animal tissue. In a preferred form, the isolated protein is substantially free of other proteins, particularly other proteins of animal origin. It is preferred to provide the protein in a highly purified form, i.e., greater than 95% pure, more preferably greater than 99o pure.
The term "operably linked", when referring to DNA segments, denotes that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in the promoter and proceeds through the coding segment to the terminator.
The term "ortholog" (or "species homolog") denotes a polypeptide or protein obtained from one species that has homology to an analogous polypeptide or protein from a different species. The ortholog is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
The term "polynucleotide" denotes a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt"), or kilobases ("kb"). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded. When the term is applied to double-stranded molecules it is used to denote overall length and will be understood to be equivalent to the term "base pairs". It will be recognized by those skilled in the art that the two strands of a double-stranded polynucleotide may differ slightly in length and that the ends thereof may be staggered as a result of enzymatic cleavage; thus all nucleotides within a double-stranded polynucleotide molecule may not be paired. Such unpaired ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as "peptides".
"Probes and/or primers" as used herein can be RNA or DNA. DNA can be either cDNA or genomic DNA.
Polynucleotide probes and primers are single or double stranded DNA or RNA, generally synthetic oligonucleotides, but may be generated from cloned cDNA or genomic sequences or its complements. Analytical probes will generally be at least 20 nucleotides in length, although somewhat shorter probes (14-17 nucleotides) can be used. PCR
primers are at least 5 nucleotides in length, preferably or more nt, more preferably 20-30 nt. Short polynucleotides can be used when a small region of the 15 gene is targeted for analysis. For gross analysis of genes, a polynucleotide probe may comprise an entire exon or more. Probes can be labeled to provide a detectable signal, such as with an enzyme, biotin, a radionuclide, fluorophore, chemiluminescer, paramagnetic particle and the like, which are commercially available from many sources (such as Molecular Probes, Inc., Eugene, OR, and Amersham Corp., Arlington Heights, IL), using techniques that are well known in the art.
The term "promoter" denotes a portion of a gene containing DNA sequences that provide for the binding of RNA polymerise and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may also comprise non-peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.

The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-domain structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. Binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecules) in the cell. This interaction in turn leads to an alteration in the metabolism of the cell. Metabolic events that are linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids. In general, receptors can be membrane bound, cytosolic or nuclear; monomeric (e. g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e. g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger peptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.
The term "splice variant" is used herein to denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene.
5 Molecular weights and lengths of polymers determined by imprecise analytical methods (e.g., gel electrophoresis) will be understood to be approximate values. When such a value is expressed as "about" X or "approximately" X, the stated value of X will be 10 understood to be accurate to +10%.
All references cited herein are incorporated by reference in their entirety.
The present invention is based in part upon the discovery of a novel DNA sequence (SEQ ID N0:9) and the 15 corresponding deduced polypeptide sequence (SEQ ID NO:10) for a secreted protein mapping to human chromosome 1. The polypeptide of the present invention has been designated zsig49.
The novel zsig49 polypeptide-encoding polynucleotides of the present invention were initially identified by querying an EST database for secretory signal sequences characterized by an upstream methionine start site, a hydrophobic region of approximately 13 amino acids and a cleavage site (SEQ ID N0:3, wherein cleavage occurs between the alanine and glycine amino acid residues) in an effort to select for secreted proteins.
Polypeptides corresponding to ESTs meeting those search criteria were compared to known sequences to identify secreted proteins having homology to known ligands. One EST sequence was discovered and determined to be novel.
The EST sequence was from an islet cell library. A clone considered likely to contain the entire coding region was used for sequencing and revealed the 3' end of a poly-A+
message. A putative signal sequence is intact with a stop upstream of the predicted start methionine (residue 1 of SEQ ID NOs:2 and 10). The alignment of the murine (SEQ ID
N0:12) and human (SEQ ID NO:1) DNA sequences indicated that the human sequence could be extended further in the 3' direction. A series of 3'RACE PCRs were carried out and extending the human cDNA sequence to 1704 by (SEQ ID
NO : 9 ) . The deduced amino acid sequence is shown in SEQ ID
NO:10. Analysis of the DNA encoding a zsig49 polypeptide (SEQ ID NO:10) revealed an open reading frame encoding 467 amino acid residues comprising a putative signal sequence (residues 1-33 of SEQ ID NO:10) and 434 amino acid residues predicted mature sequence (residues 34 to 467 of SEQ ID N0:10). A dibasic site (lys-lys) is found at residues 62-63 of SEQ ID N0:10. Cysteine residues are found at amino acid residues 42, 44, 81, 90, 95, 100, 130, 165, 207, 240, 262, 390, 393 and 396 of SEQ ID NO:10.
The patent also provides a murine ortholog of human zsig49. Analysis of the polynucleotide sequence (SEQ ID N0:12) encoding the murine ortholog (SEQ ID N0:13) revealed a putative signal sequence (amino acid residues 1-27 of SEQ ID N0:13), and a 434 amino acid residues mature sequence (amino acid residues 28-461 of SEQ ID
N0:13). As in the human, there is a dibasic site (lys-lys) found at residues 56-57 of SEQ ID N0:13 and cysteine residues corresponding to amino acid residues 35, 75, 84, 89, 94, 124, 159, 201, 234, 256, 384, 387 and 390 of SEQ
ID N0:13.
Multimeric complexes can be formed through intermolecular disulfide bonds between zsig49 and a second polypeptide. The dimeric proteins within the present invention are formed by intermolecular disulfide bonds formed between the cysteine residues. These proteins include homodimers and heterodimers. In the latter case, the second polypeptide can be a zsig49 ortholog or homolog or other similar protein. The protein could also be one having a cysteine residue available for disulfide bond formation.
Precursor proteins are cleaved or processed into active form through the action of prohormone convertases (endoproteases). The most prevalent cleavage or processing site is a dibasic amino acid prohormone convertase site.
There are only a few dibasic amino acid combinations, including lys-lys, arg-arg, arg-lys and lys-arg. Non-dibasic cleavage and processing sites have also been observed, for example, Asn-Arg is a non-dibasic site found in gastrin. Zsig49 polypeptides may be processed at the lys-lys di-basic site (amino acid residues 62-62 of SEQ ID
NOs:2 and 10 or amino acid residues 56-57 of SEQ ID N0:13) by prohormone convertases into an active from. Known prohormone convertases include, but are not limited to, prohormone convertase 3 (PC3), prohormone convertase 2 (PC2), furin, or similar convertases of the furin family such as prohormone convertase 4 (PC4) and PACE4.
The present invention therefore provides post translationally modified polypeptides or polypeptide fragments having the amino acid sequence from amino acid residue 34 to amino acid residue 63 of SEQ ID NOs:2 or 110; the amino acid sequence from amino acid residue 64 to amino acid residue 77 of SEQ ID N0:2; the amino acid sequence from amino acid residues 64 to 467 of SEQ ID
NO:10; the amino acid sequence 28 to amino acid residue 57 of SEQ ID N0:13; or the amino acid sequence from amino acid residue 58 to amino acid residue 461 of SEQ ID N0:13.
Examples of post translational modifications include proteolytic cleavage, glycosylation, disulfide bonding and hydroxylation.
Analysis of the tissue distribution of the mRNA
corresponding to the partial zsig 49 DNA sequence of SEQ
ID N0:1, by Northern blot and Dot blot analysis showed strong expression in pancreas, slightly decreased expression in testis, obvious expression in stomach, liver, pituitary, thyroid and salivary gland. A weaker transcript was detected in prostate, spinal cord, adrenal gland, small intestine, trachea, spleen, thymus, peripheral blood leukocytes and lymph node. There are two major transcripts at about 2 kb and 5 kb. While the 2 kb transcript is the major transcript in testis, the 5 kb transcript is the major transcript in the other tissues.
These results suggest that SEQ ID N0:1 may be the result of an incompletely spliced mRNA.
The present invention further provides polynucleotide molecules, including DNA and RNA molecules, encoding zsig49 proteins. The polynucleotides of the present invention include the sense strand; the anti-sense strand; and the DNA as double-stranded, having both the sense and anti-sense strand annealed together by their respective hydrogen bonds. A representative DNA sequence encoding a zsig49 protein is set forth in SEQ ID NO:10.
DNA sequences encoding other zsig49 proteins can be readily generated by those of ordinary skill in the art based on the genetic code. Counterpart RNA sequences can be generated by substitution of U for T.
Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules. SEQ ID N0:4 is a degenerate DNA
sequence that encompasses all DNAs that encode the partial zsig49 polypeptide of SEQ ID N0:2, SEQ ID N0:11 is a degenerate DNA sequence that encompasses all DNAs that encode the zsig49 polypeptide of SEQ ID N0:10, and SEQ ID
N0:14 is a degenerate DNA sequence that encompasses all DNAs that encode the murine ortholog zsig49 sequence of SEQ ID N0:13. Those skilled in the art will recognize that the degenerate sequences of SEQ ID NOs:4, 11 and 14 also provides all RNA sequences encoding SEQ ID NOs:2, 10 and 13 by substituting U for T. Thus, zsig49 polypeptide-encoding polynucleotides comprising nucleotide 1 to nucleotide 231 of SEQ ID N0:4, nucleotide 1 to nucleotide 1401 of SEQ ID N0:11 and nucleotide 1 to nucleotide 1383 of SEQ ID N0:14 and their RNA equivalents are contemplated by the present invention. Table 1 sets forth the one-letter codes used within SEQ ID NOs:4, 11 and 14 to denote degenerate nucleotide positions. "Resolutions" are the nucleotides denoted by a code letter. "Complement"

indicates the code for the complementary nucleotide(s).
For example, the code Y denotes either C or T, and its complement R denotes A or G, A being complementary to T, and G being complementary to C.

Nucleotide Resolution Nucleotide Complement A A T T

C C G G

G G C C

T T A A

R A~G Y CST

Y CST R A~G

M ABC K GET

K GET M ABC

S CMG S CMG

W ACT W ACT

H A~C~T D A~G~T

B C~G~T V A~C~G

V A~C~G B C~G~T

D A~G~T H A~C~T

N A~C~G~T N A~C~G~T

The degenerate codons used in SEQ ID NOs:4, 11 5 and 14, encompassing all possible codons for a given amino acid, are set forth in Table 2.

_ CA 02364330 2001-10-04 One Amino Letter Degenerate Acid Code Colons Colon Cys C TGC TGT TGY

Ser S AGC AGTTCA TCC TCG TCT WSN

Thr T ACA ACCACG ACT ACN

Pro P CCA CCCCCG CCT CCN

Ala A GCA GCCGCG GCT GCN

Gly G GGA GGCGGG GGT GGN

Asn N AAC AAT AAY

Asp D GAC GAT GAY

Glu E GAA GAG GAR

Gln Q CAA CAG CAR

His H CAC CAT CAY

Arg R AGA AGGCGA CGC CGG CGT MGN

Lys K AAA AAG AAR

Met M ATG ATG

Ile I ATA ATCATT ATH

Leu L CTA CTCCTG CTT TTA TTG YTN

Ual U GTA GTCGTG GTT GTN

Phe F TTC TTT TTY

Tyr Y TAC TAT TAY

Trp W TGG TGG

Ter . TAA TAGTGA TRR

Asn~AspB RAY

Glu~GlnZ SAR

Any X NNN

_ CA 02364330 2001-10-04 One of ordinary skill in the art will appreciate that some ambiguity is introduced in determining a degenerate codon, representative of all possible codons encoding each amino acid. For example, the degenerate codon for serine (WSN) can, in some circumstances, encode arginine (AGR), and the degenerate codon for arginine (MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding phenylalanine and leucine. Thus, some polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequences of SEQ ID NOs:2, 10 and 14.
Variant sequences can be readily tested for functionality as described herein.
One of ordinary skill in the art will also appreciate that different species can exhibit "preferential codon usage." In general, see, Grantham, et al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr.
Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene 13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc. Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol.
158:573-97, 1982. As used herein, the term "preferential codon usage" or "preferential codons" is a term of art referring to protein translation codons that are most frequently used in cells of a certain species, thus favoring one or a few representatives of the possible codons encoding each amino acid (See Table 2). For example, the amino acid threonine (Thr) may be encoded by ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly used codon; in other species, for example, insect cells, yeast, viruses or bacteria, different Thr codons may be preferential. Preferential codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferential codon sequences into recombinant DNA can, for example, _CA 02364330 2001-10-04 enhance production of the protein by making protein translation more efficient within a particular cell type or species. Therefore, the degenerate codon sequence disclosed in SEQ ID NOs:4, 11 and 14 serve as a template for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferential codons can be tested and optimized for expression in various species, and tested for functionality as disclosed herein.
Radiation hybrid mapping is a somatic cell genetic technique developed for constructing high-resolution, contiguous maps of mammalian chromosomes (Cox et al., Science 250:245-50, 1990). Partial or full knowledge of a gene's sequence allows the designing of PCR
primers suitable for use with chromosomal radiation hybrid mapping panels. Radiation hybrid mapping panels are commercially available which cover the entire human genome, such as the Stanford G3 RH Panel and the GeneBridge 4 RH Panel (Research Genetics, Inc., Huntsville, AL). These panels enable rapid, PCR based, chromosomal localizations and ordering of genes, sequence-tagged sites (STSs), and other nonpolymorphic- and polymorphic markers within a region of interest. This includes establishing directly proportional physical distances between newly discovered genes of interest and previously mapped markers. The precise knowledge of a gene's position can be useful in a number of ways including: 1) determining if a sequence is part of an existing contig and obtaining additional surrounding genetic sequences in various forms such as YAC-, BAC- or cDNA clones, 2) providing a possible candidate gene for an inheritable disease which shows linkage to the same chromosomal region, and 3) for cross-referencing model organisms such as mouse which may be beneficial in helping to determine what function a particular gene might have.

Radiation hybrid mapping showed that zsig49 maps 9.76 cR 3000 distal of the marker D1S2635 on the GeneBridge 4 RH mapping panel and 62 cR_10,000 distal of the marker SHGC-6236 on the Stanford G3 RH panel. The use of surrounding markers positions zsig49 in the 1q24 chromosomal region. A susceptibility locus for prostate cancer (HPCl) has been localized to chromosome 1q24 and a susceptibility locus for type II diabetes mellitus has also been localized to the q arm of chromosome 1.
Type II diabetes mellitus has a substantial genetic component (Barnett et al., Diabetoloqia 20:87, 1981; Knowler et al., Am. J. Epidemiol. 113:144-56, 1981;
Hanson et al., Am. J. Hum. Genet. 57:160-70, 1995). Genes that predispose to certain forms of diabetes have been identified, including several loci for Type I diabetes and for maturity-onset diabetes of the young (Froguel et al., Nature 356:162, 1992; Davies et al., Nature 371:130, 1994;
Yamagata et al., Nature 384:455, 1996; Stoffers et al., Nat. Genet. 17:138, 1997 and Elbein et al., Diabetes 48:1175-82, 1999). Although specific genetic defects have been identified in rare syndromes of Type II diabetes mellitus, no specific defect has yet been defined as pathogenic in common forms of this disease. Mathematical modeling has suggested that Type II diabetes mellitus is a polygenic disease (DeFronzo, Diabetes Reviews 5:177, 1997;
Lowe, "Diabetes Mellitus," Principles of Molecular Medicine, (Jameson, ed.), pages 433-442 (Humana Press Inc.
1998 ) ) .
A linkage analyses indicates that a diabetes-susceptibility locus resides on chromosome lq (Hanson et al., Am. J. Hum. Genet. 63:1130-8, 1998). On the Stanford G3 RH panel, the zig49 gene was found to map 5 cR 10,000 (1 cR-10,000 - ~25 kb) distal from a potential diabetes-susceptibility loci marker, D1S1677, identified by Hanson et al., ibid. The Hanson study was a genome-wide search for loci linked to diabetes and body-mass index in Pima Indians, a Native American population with a high prevalence of Type II diabetes and obesity (Bennett et al., Lancet 2:125 1971); Knowler et al., Am. J. Clin.
Nutr. 53 (Suppl):15435 1991). Accordingly, nucleotide 5 sequences that encode the zsig49 gene can be used in the diagnosis or prognosis of metabolic disease, such as diabetes. These methods are also suitable for diagnosis or prognosis of diabetes in Pima Indians.
The present invention provides reagents for use 10 in diagnostic applications. For example, the zsig49 gene, a probe comprising zsig49 DNA or RNA, or a subsequence thereof can be used to determine if the zsig49 gene is present on chromosome 1 or if a mutation has occurred.
Detectable chromosomal aberrations at the zsig49 gene 15 locus include, but are not limited to, aneuploidy, gene copy number changes, insertions, deletions, restriction site changes and rearrangements. These aberrations can occur within the coding sequence, within introns, or within flanking sequences, including upstream promoter and 20 regulatory regions, and may be manifested as physical alterations within a coding sequence or changes in gene expression level.
In general, these diagnostic methods comprise the steps of (a) obtaining a genetic sample from a 25 patient; (b) incubating the genetic sample with a polynucleotide probe or primer as disclosed above, under conditions wherein the polynucleotide will hybridize to complementary polynucleotide sequence, to produce a first reaction product; and (iii) comparing the first reaction product to a control reaction product. A difference between the first reaction product and the control reaction product is indicative of a genetic abnormality in the patient. Genetic samples for use within the present invention include genomic DNA, cDNA, and RNA. The polynucleotide probe or primer can be RNA or DNA, and will comprise a portion of SEQ ID NOs:l, 9 or 12, the complements of SEQ ID NOs:l, 9 or 12, or an RNA equivalent thereof. Suitable assay methods in this regard include molecular genetic techniques known to those in the art, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR
techniques, ligation chain reaction (Barany, PCR Methods and Applications 1:5-16, 1991), ribonuclease protection assays, use of single-nucleotide polymorphisms (SNPs) (Zhao et al., Am. J. Hum. Genet. 63:225-40, 1998) and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian, Chest 108:255-65, 1995). Ribonuclease protection assays (see, e.g., Ausubel et al., ibid., ch. 4) comprise the hybridization of an RNA probe to a patient RNA sample, after which the reaction product (RNA-RNA hybrid) is exposed to RNase. Hybridized regions of the RNA are protected from digestion. Within PCR assays, a patient's genetic sample is incubated with a pair of polynucleotide primers, and the region between the primers is amplified and recovered. Changes in size or amount of recovered product are indicative of mutations in the patient.
Another PCR-based technique that can be employed is single strand conformational polymorphism (SSCP) analysis (Hayashi, PCR Methods and Applications 1:34-8, 1991).
Zsig49 is expressed in organs of the endocrine system, pancreas, testis, thymus, adrenal gland, thyroid gland and pituitary gland, suggesting a metabolic-associated activity. Hormones released by endocrine tissues regulate reproduction, growth and development, provide defense against stress, and maintain and regulate a metabolic balance within the body. Zsig49 is also expressed in other tissues, such as stomach and small intestine, which secrete hormones in response to food intake and digestion.
Zsig49 expression is strongest in pancreas.
Acinar cells of the pancreas are involved in production of secretory fluids ducted to the small intestine for use _ CA 02364330 2001-10-04 during digestion. The islets of Langerhans (islets) are the site of synthesis of hormones that affect metabolism and neurological functions. For example, within islets, mature a-cells produce glucagon, mature (3-cells produce insulin, and mature 8-cells produce somatostatin.
Glucagon and insulin coordinate the flow of endogenous glucose, free fatty acids, amino acids, and other substrate molecules to ensure that energy needs are met in the basal state and during exercise. Furthermore, they coordinate the efficient disposition of the nutrient input from meals. Other hormone-like products of islet cells (including amylin, pancreastatin, somatostatin, and pancreatic polypeptide) may play subsidiary roles in the regulation of metabolism.
The ability of zsig49 to modulate mammalian energy balance may be evaluated by monitoring one or more of the following metabolic functions: adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose uptake, protein synthesis, thermogenesis, oxygen utilization or the like. These metabolic functions are monitored by techniques (assays or animal models) known to one of ordinary skill in the art. Such methods of the present invention comprise incubating cells to be studied ~zsig49 polypeptide, monoclonal antibody, agonist or antagonist thereof and observing changes in adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose uptake, or the like. For example, the glucoregulatory effects of insulin are predominantly exerted in the liver, skeletal muscle and adipose tissue. Insulin binds to its cellular receptor in these three tissues and initiates tissue-specific actions that result in, for example, the inhibition of glucose production and the stimulation of glucose utilization. In the liver, insulin stimulates glucose uptake and inhibits gluconeogenesis and glycogenolysis. In skeletal muscle and adipose tissue, insulin acts to stimulate the uptake, storage and utilization of glucose.

Use may also be made of zsig49 polypeptides, agonists and/or antagonists in prevention or treatment of pancreatic conditions characterized by dysfunction associated with pathological regulation of blood glucose levels, insulin resistance or digestive function. As used herein, the terms "treat" and "treatment" will be understood to include the reduction of symptoms as well as effects on the underlying disease process. In particular, diabetes mellitus is a disorder of metabolism caused by a complete or partial lack of insulin. The most prominent forms are Type I or insulin dependent diabetes, and Type II, non-insulin dependent diabetes. Diabetes can also result from secondary causes which disrupt or limit insulin production, such as pancreatectomy or pancreatic insufficiency due to pancreatic disease, hypersecretion of hormones antagonistic to insulin or administration of drugs which interfere with carbohydrate metabolism. Onset may also be due to impaired glucose tolerance. Use of zsig49 polypeptides, agonists and/or antagonists may be made to treat diabetes or alleviate or eliminate associated symptoms related to elevated glucose levels.
Zsig49 polypeptides may find application, for example, in maintaining and/or regulating blood sugar levels. Animal models, such as the NOD mice, a spontaneous model system for insulin-dependent diabetes mellitus (IDDM) and a viral induction transgenic mouse model (Herrath et al., J. Clin Invest. 98:1324, 1996) are available to study induction of non-responsiveness. Administration of zsig49 polypeptides prior to or after onset of disease can be monitored by assay of urine glucose levels.
Stimulation of proliferation or differentiation of pancreatic cells can be measured in vitro by administration of zsig49 polypeptides to cultured pancreatic cells or in vivo by administering molecules of the present invention to the appropriate animal model.
Such reagents would be useful for i~ vitro culturing of islets, and hence their component cells which include a-cell, (3-cells and 8-cells. Cultured islets would provide a source for islet cells for transplantation, an alternative to whole pancreas transplantation. Assays measuring cell proliferation or differentiation are well known in the art. For example, assays measuring proliferation include such assays as chemosensitivity to neutral red dye (Cavanaugh et al., Investigational New Druas 8:347-54, 1990), incorporation of radiolabelled nucleotides (Cook et al., Analytical Biochem. 179:1-7, 1989), incorporation of 5-bromo-2'-deoxyuridine (BrdU) in the DNA of proliferating cells (Porstmann et al., J.
Immunol. Methods 82:169-79, 1985), and use of tetrazolium salts (Mosmann, J. Immunol. Methods 65:55-63, 1983; Alley et al., Cancer Res. 48:589-601, 1988; Marshall et al., Growth Rea. 5:69-84, 1995; and Scudiero et al., Cancer Res. 48:4827-33, 1988). Assays measuring differentiation include, for example, measuring cell-surface markers associated with stage-specific expression of a tissue, enzymatic activity, functional activity or morphological FASEB, 5:281-4, 1991; Francis, changes (Watt, Differentiation 57:63-75, 1994; Raes, Adv. Anim. Cell Biol. Technol. Bioprocesses, 161-71, 1989).
Within the testis, germ cells undergo spermatogenesis and mature into terminally differentiated cells (spermatozoa or sperm). Additionally, Leydig cells within the testis secrete androgens that are involved in development of male sex characteristics and activity.
Factors involved in the regulation of sperm cell maturation and egg-sperm interaction are of therapeutic value for treating conditions associated with fertility and for male contraceptive use. Factors that influence the germ cell maturation process may come directly from the Sertoli cells that are in contact with spermatogenic cells. Others are paracrine or endocrine factors produced outside the seminiferous tubules, such as in the interstitial Leydig cells, and are transported into the sperm cell microenvironment by transport and binding proteins that are expressed by the Sertoli cells within the seminiferous tubules. Factors believed to play an important role in spermatogenic cell maturation process, include testosterone, Leydig factor, IGF-1, inhibin, 5 insulin homologs and activin.
Proliferation or differentiation of testicular cells can be measured in vitro by administering zsig49 polypeptides to cultured testicular cells or in vivo by administering molecules of the present invention to the 10 appropriate animal model. Cultured testicular cells include dolphin DBl.Tes cells (CRL-6258); mouse GC-1 spg cells (CRL-2053); TM3 cells (CRL-1714); TM4 cells (CRL-1715); and pig ST cells (CRL-1746), available from American Type Culture Collection, 12301 Parklawn Drive, 15 Rockville, MD. Assays measuring cell proliferation or differentiation are well known in the art and discussed herein.
In vivo assays for evaluating the effect of zsig49 polypeptides on testes are well known in the art.
20 For example, compounds can be injected intraperitoneally for a specific time duration. After the treatment period, animals are sacrificed and testes removed and weighed.
Testicles are homogenized and sperm head counts are made (Meistrich et al., Ex~. Cell Res. 99:72-8, 1976). Other 25 activities, for example, chemotaxic activity that may be associated with proteins of the present invention can be analyzed. For example, late stage factors in spermatogenesis may be involved in egg-sperm interactions and sperm motility. Activities, such as enhancing 30 viability of cryopreserved sperm, stimulating the acrosome reaction, enhancing sperm motility and enhancing egg-sperm interactions may be associated with the proteins of the present invention. Assays evaluating such activities are known (Rosenberger, J. Androl. 11:89-96, 1990; Fuchs, Zentralbl Gynakol 11:117-120, 1993; Neurwinger et al., Androlo is 22:335-9, 1990; Harris et al., Human Reprod.
3:856-60, 1988; and Jockenhovel, Androloaia 22:171-178, _ CA 02364330 2001-10-04 1990; Lessing et al., Fertil. Steril. 44:406-9 (1985);
Zaneveld, In Male Infertility Chapter 11, Comhaire Ed., Chapman & Hall, London 1996). These activities are expected to result in enhanced fertility and successful reproduction.
The polypeptides of the present invention may exert regulatory effects on male gametes, reproductive development and testicular functions through feedback inhibition of the hypothalamus and anterior pituitary.
Testis proteins, such as activins and inhibins, have been shown to regulate secretion of active molecules including follicle stimulating hormone (FSH) by the pituitary (Ying, Endodcr. Rev. 9:267-93, 1988; Plant et al., Hum. Reprod.
8:41-44,1993). Testosterone reduces the amount of gonadotropin released from the hypothalamus. The polypeptides of the present invention may be evaluated for hormone dependent transcription and expression, using methods known in the art. For example, zsig49 polypeptides can be tested for androgen regulated expression using transgenic mice as described in Allison et al., Mol. Cell. Biol. 9:2254-7, 1989, castration and steroid therapy (Heyns et al., ibid. and Page and Parker, Mol. Cell. Biol. 27:343-55, 1982) and hormone suppression (Pasapera et al., ibid. and Castro et al., ibid.). If desired, zsig49 polypeptide performance in this regard can be compared to other androgen proteins, such as testosterone. Therapeutic use can be made of zsig49 polypeptides, agonists and antagonists by inducing or releasing suppression of the feedback mechanism in treating reproductive dysfunctions.
Zsig49 polypeptide, agonists and/or antagonists of the present invention may have applications in enhancing fertilization during assisted reproduction in humans and in animals. Such assisted reproduction methods are known in the art and include artificial insemination, in vitro fertilization, embryo transfer and gamete intrafallopian transfer. Such methods are useful for assisting patients who may have physiological or metabolic disorders that prevent natural conception. Such methods are also useful in animal breeding programs, such as for livestock, zoological or racehorse breeding, and could be used within methods for the creation of transgenic animals.
Dot blot analysis indicated expression of zsig49 in salivary gland. The salivary glands synthesize and secrete a number of proteins having diverse biological functions. Such proteins facilitate lubrication of the oral cavity (e-a., mucins and proline-rich proteins), re-mineralization (e. a., statherin and ionic proline-rich proteins), digestion (ela., amylase, lipase and proteases), provide anti-microbial (e-a., proline-rich proteins, lysozyme, histatins and lactoperoxidase) and mucosal integrity maintenance (e-a., mucins) capabilities.
In addition, saliva is a rich source of growth factors synthesized by the salivary glands. For example, saliva is known to contain epidermal growth factor (EGF), nerve growth factor (NGF), transforming growth factor-alpha (TGF-a), transforming growth factor-beta (TGF-(3), insulin, insulin-like growth factors I and II (IGF-I and IGF-II) and fibroblast growth factor (FGF). See, for example, Zelles et al., J. Dental. Res. 74: 1826-32, 1995.
Synthesis of growth factors by the salivary gland is believed to be androgen-dependent and to be necessary for the health of the oral cavity and gastrointestinal tract.
In addition to expression is salivary gland, zsig49 is also expressed in stomach and small intestine.
This suggests that zsig49 polypeptides, agonists or antagonists thereof may be therapeutically useful for aiding digestion. To verify the presence of this capability in zsig49 polypeptides, agonists or antagonists of the present invention, such zsig49 polypeptides, agonists or antagonists are evaluated with respect to their ability to break down starch according to procedures known in the art. If desired, zsig49 polypeptide performance in this regard can be compared to digestive enzymes, such as amylase, lipase, proteases and the like.
In addition, zsig49 polypeptides or agonists or antagonists thereof may be evaluated in combination with one or more digestive enzymes to identify synergistic effects.
Also, zsig49 polypeptides, agonists or antagonists thereof may be therapeutically useful for promoting wound healing. To verify the presence of this capability in zsig49 polypeptides, agonists or antagonists of the present invention, such zsig49 polypeptides, agonists or antagonists are evaluated with respect to their ability to facilitate wound healing according to procedures known in the art. If desired, zsig49 polypeptide performance in this regard can be compared to growth factors, such as EGF, NGF, TGF-cc, TGF-~3, insulin, IGF-I, IGF-II, fibroblast growth factor (FGF) and the like. In addition, zsig49 polypeptides or agonists or antagonists thereof may be evaluated in combination with one or more growth factors to identify synergistic effects.
In addition, zsig49 polypeptides, agonists or antagonists thereof may be therapeutically useful for anti-microbial applications. To verify the presence of this capability in zsig49 polypeptides, agonists or antagonists of the present invention, such zsig49 polypeptides, agonists or antagonists are evaluated with respect to their anti-microbial properties according to procedures known in the art. See, for example, Barsum et al., Eur. Respir. J. 8: 709-14, 1995; Sandovsky-Losica et al., J. Med. Vet. Mycol. (England) 28: 279-87, 1990;
Mehentee et al., J. Gen. Microbiol (England) 135 (Pt. 8):
2181-8, 1989; Segal and Savage, J. Med. Vet. Mycol. 24:
477-9, 1986 and the like. If desired, zsig49 polypeptide performance in this regard can be compared to proteins known to be functional in this regard, such as proline-rich proteins, lysozyme, histatins, lactoperoxidase or the like. In addition, zsig49 polypeptides or agonists or antagonists thereof may be evaluated in combination with one or more anti-microbial agents to identify synergistic effects.
Anti-microbial protective agents may be directly . acting or indirectly acting. Such agents operating via membrane association or pore forming mechanisms of action directly attach to the offending microbe. Anti-microbial agents can also act via an enzymatic mechanism, breaking down microbial protective substances or the cell wall/membrane thereof. Anti-microbial agents, capable of inhibiting microorganism proliferation or action or of disrupting microorganism integrity by either mechanism set forth herein, are useful in methods for preventing contamination in cell culture by microbes susceptible to that anti-microbial activity. Such techniques involve culturing cells in the presence of an effective amount of said zsig49 polypeptide or an agonist or antagonist thereof.
Also, zsig49 polypeptides or agonists thereof may be used as cell culture reagents in in vitro studies of exogenous microorganism infection, such as bacterial, viral or fungal infection. Such moieties may also be used in in vivo animal models of infection. Also, the microorganism-adherence properties of zsig49 polypeptides or agonists thereof can be studied under a variety of conditions in binding assays and the like.
Moreover, zsig49 polypeptides, agonists or antagonists thereof may be therapeutically useful for mucosal integrity maintenance. To verify the presence of this capability in zsig49 polypeptides, agonists or antagonists of the present invention, such zsig49 polypeptides, agonists or antagonists are evaluated with respect to their mucosal integrity maintenance according to procedures known in the art. See, for example, Zahm et al., Eur. Respir. J. 8: 381-6, 1995, which describes methods for measuring viscoelastic properties and surface _ CA 02364330 2001-10-04 properties of mucous as well as for evaluating mucous transport by cough and by ciliary activity. If desired, zsig49 polypeptide performance in this regard can be compared to mucins or the like. In addition, zsig49 5 polypeptides or agonists or antagonists thereof may be evaluated in combination with mucins to identify synergistic effects.
In addition, zsig49 polypeptides are expressed in the prostate. The prostate gland is androgen regulated 10 and shares other properties with salivary glands. For example, the salivary glands and prostate gland are classified as slow replicators with respect to their proliferative capacity. See, for example, Zajicek, Med.
Hypotheses 7 10 1241-51, 1981. Such slow replicators 15 exhibit similar onotgenies and proceed during regeneration and neoplasia through similar stages. The prostate gland also appears to produce growth factors, such as EGF and NGF, and other biologically important proteins, such as kallikreins. See, for example, Hiramatsu et al., Biochem.
20 Int. 17 2 311-7, 1988, Harper et al., J. Biol. Chem.
257(14): 8541-8, 1982 and Brady et al., Biochemistry 28 12 5203-10, 1988. Prostate gland function also appears to be androgen-dependent.
The zsig49 gene was localized to human 25 chromosome 1q24 which is also the location of a susceptibility locus for prostate cancer (HPC1). Prostate dysfunction, such as prostate adenocarcinoma or the like, may also be detected using zsig49 polypeptides.
The present invention also provides methods for 30 studying known or identifying new prohormone convertases, or endoproteases, enzymes which process prohormones and protein precursors. Prohormone convertases sometimes exhibit tissue specificity. As a result, zsig49 polypeptides, which are expressed at high levels in 35 pancreatic tissue, are likely tc be processed by prohormone convertases exhibiting pancreas specificity, such as PC2 and PC3. In such methods of the present invention, zsig49 polypeptides or fragments (substrate) may be incubated with known or suspected prohormone convertases (enzyme) to produce a 30 amino acid residue fragment from amino acid residue 34 to amino acid residue 63 (product). The enzyme and substrate are incubated together or co-expressed in a test cell for a time sufficient to achieve cleavage/processing of the zsig49 polypeptide or fragment or fusion thereof. Detection and/or quantification of cleavage products follows, using procedures that are known in the art. For example, enzyme kinetics techniaues, measuring the rate of cleavacre, can be used to study or identify prohormone convertases capable of cleaving zsig49 polypeptides, fragments or fusion proteins of the present invention.
Agonists or antagonists of the zsig49 polypeptides disclosed above are included within the scope of the present invention. Agonists may be identified using a method that comprises providing cells responsive to a zsig49 polypeptide, fragment or fusion; culturing the cells in the presence of a test compound and comparing the cellular response with the cell cultured in the presence of the zsig49 polypeptide, and selecting the test compounds for which the cellular response is of the same type. As described herein, the disclosed polypeptides can be used to construct zsig49 variants and functional fragments of zsig49. Such variants and fragments are considered to be zsig49 agonists. Another type of zsig49 agonist is provided by anti-idiotype antibodies, and fragments thereof, which mimic the RNA-binding domain of zsig49, for example. Zsig49 agonists can also be constructed using combinatorial libraries. Methods for constructing and screening phage display and other combinatorial libraries are provided, for example, by Kay et al., Phage Display of Peptides and Proteins (Academic Press 1996), Verdine, U.S. Patent No. 5,783,384, Kay, et.
al., U.S. Patent No. 5,747,334, and Kauffman et al., U.S.
Patent No. 5,723,323.

_ CA 02364330 2001-10-04 Zsig49 can also be used to identify inhibitors (antagonists) of its activity. One such method comprises providing cells responsive to a zsig49 polypeptide, culturing a first portion of the cells in the presence of zsig49 polypeptide, culturing a second portion of the cells in the presence of the zsig49 polypeptide and a test compound, and detecting a decrease in a cellular response of the second portion of the cells as compared to the first portion of the cells. In addition to those assays disclosed herein, samples can be tested for inhibition of zsig49 activity within a variety of assays designed to measure receptor binding or the stimulation/inhibition of zsig49-dependent cellular responses. For example, zsig49-responsive cell lines can be transfected with a reporter gene construct that is responsive to a zsig49-stimulated cellular pathway. Reporter gene constructs of this type are known in the art, and will generally comprise a zsig49-DNA response element operably linked to a gene encoding an assayable protein, such as luciferase. DNA
response elements can include, but are not limited to, cyclic AMP response elements (CRE), hormone response elements (HRE) insulin response element (IRE) (Nasrin et al., Proc. Natl. Acad. Sci. USA 87:5273-7, 1990) and serum response elements (SRE) (Shaw et al. Cell 56: 563-72, 1989). Cyclic AMP response elements are reviewed in Roestler et al., J. Biol. Chem. 263 (19):9063-6; 1988 and Habener, Molec. Endocrinol. 4 (8):1087-94; 1990. Hormone response elements are reviewed in Beato, Cell 56:335-44;
1989. Candidate compounds, solutions, mixtures or extracts are tested for the ability to inhibit the activity of zsig49 on the target cells as evidenced by a decrease in zsig49 stimulation of reporter gene expression. Assays of this type will detect compounds that directly block zsig49 binding to cell-surface receptors, as well as compounds that block processes in the cellular pathway subsequent to receptor-ligand binding. In the alternative, compounds or other samples can be tested for direct blocking of zsig49 binding to receptor using zsig49-tagged with a detectable label (e. lzSl, biotin, horseradish peroxidase, FITC, and the g., like) . Within assays of this type, the ability of a test sample to inhibit the binding of labeled zsig49 to the receptor is indicative of inhibitory activity, which can be confirmed through secondary assays. Receptors used within binding assays may be cellular receptors or isolated, immobilized receptors.
Useful antagonists of zsig49 polypeptides can also include antibodies directed against a zsig49 polypeptide epitope.
Within preferred embodiments of the invention the isolated polynucleotides will hybridize to similar sized regions of SEQ ID NOs:l, 9 or 12, other polynucleotide probes, primers, fragments and sequences recited herein or sequences complementary thereto.
Polynucleotide hybridization is well known in the art and widely used for many applications, see for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, 1989; Ausubel et al., eds., Current Protocols in Molecular Bioloay, John Wiley and Sons, Inc., NY, 1987; Berger and Kimmel, eds., Guide to Molecular Cloning Techniques, Methods in Enzvmoloay, volume 152, 1987 and Wetmur, Crit. Rev.
Biochem. Mol. Biol. 26:227-59, 1990. Polynucleotide hybridization exploits the ability of single stranded complementary sequences to form a double helix hybrid.
Such hybrids include DNA-DNA, RNA-RNA and DNA-RNA.
Hybridization will occur between sequences which contain some degree of complementarity. Hybrids can tolerate mismatched base pairs in the double helix, but the stability of the hybrid is influenced by the degree of mismatch. The Tm of the mismatched hybrid decreases by loC
for every 1-1.5o base pair mismatch. Varying the stringency of the hybridization conditions allows control over the degree of mismatch that will be present in the hybrid. The degree of stringency increases as the hybridization temperature increases and the ionic strength of the hybridization buffer decreases. Stringent hybridization conditions encompass temperatures of about 5-25oC below the thermal melting point (Tm) of the hybrid and a hybridization buffer having up to 1 M Na+. Higher degrees of stringency at lower temperatures can be achieved with the addition of formamide which reduces the Tm of the hybrid about 1oC for each 1% formamide in the buffer solution. Generally, such stringent conditions encompass temperatures of 20-70oC and a hybridization buffer containing up to 6X SSC and 0-50% formamide. A
higher degree of stringency can be achieved at temperatures of from 40-70°C with a hybridization buffer having up to 4X SSC and from 0-50% formamide. Highly stringent conditions typically encompass temperatures of 42-70°C with a hybridization buffer having up to 1X SSC
and 0-50o formamide. Different degrees of stringency can be used during hybridization and washing to achieve maximum specific binding to the target sequence.
Typically, the washes following hybridization are performed at increasing degrees of stringency to remove non-hybridized polynucleotide probes from hybridized complexes.
The above conditions are meant to serve as a guide and it is well within the abilities of one skilled in the art to adapt these conditions for use with a particular polypeptide hybrid. The Tm for a specific target sequence is the temperature (under defined conditions) at which 50% of the target sequence will hybridize to a perfectly matched probe sequence. Those conditions which influence the Tm include, the size and base pair content of the polynucleotide probe, the ionic strength of the hybridization solution, and the presence of destabilizing agents in the hybridization solution.
Numerous equations for calculating Tm are known in the _ CA 02364330 2001-10-04 art, see for example (Sambrook et al., ibid.; Ausubel et al., ibid.; Berger and Kimmel, ibid. and Wetmur, ibid.) and are specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length.
5 Sequence analysis software such as Oligo 4.0 (publicly available shareware) and Primer Premier (PREMIER Biosoft International, Palo Alto, CA) as well as sites on the Internet, are available tools for analyzing a given sequence and calculating Tm based on user defined criteria.
10 Such programs can also analyze a given sequence under defined conditions and suggest suitable probe sequences.
Typically, hybridization of longer polynucleotide sequences, >50 bp, is done at temperatures of about 20-25oC below the calculated Tm. For smaller probes, <50 bp, 15 hybridization is typically carried out at the Tm or 5-lOoC
below. This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA hybrids.
The length of the polynucleotide sequence influences the rate and stability of hybrid formation.
20 Smaller probe sequences, <50 bp, come to equilibrium with complementary sequences rapidly, but may form less stable hybrids. Incubation times of anywhere from minutes to hours can be used to achieve hybrid formation. Longer probe sequences come to. equilibrium more slowly, but form 25 more stable complexes even at lower temperatures.
Incubations are allowed to proceed overnight or longer.
Generally, incubations are carried out for a period equal to three times the calculated Cot time. Cot time, the time it takes for the polynucleotide sequences to 30 reassociate, can be calculated for a particular sequence by methods known in the art.
The base pair composition of polynucleotide sequence will effect the thermal stability of the hybrid complex, thereby influencing the choice of hybridization 35 temperature and the ionic strength of the hybridization buffer. A-T pairs are less stable than G-C pairs in aqueous solutions containing NaCl. Therefore, the higher _CA 02364330 2001-10-04 the G-C content, the more stable the hybrid. Even distribution of G and C residues within the sequence also contribute positively to hybrid stability. Base pair composition can be manipulated to alter the Tm of a given sequence, for example, 5-methyldeoxycytidine can be substituted for deoxycytidine and 5-bromodeoxuridine can be substituted for thymidine to increase the Tm. 7-deazo-2'-deoxyguanosine can be substituted for guanosine to reduce dependence on Tm.
Ionic concentration of the hybridization buffer also effects the stability of the hybrid. Hybridization buffers generally contain blocking agents such as Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon sperm DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na' source, such as SSC (1X SSC: 0.15 M NaCl, 15 mM sodium citrate) or SSPE (1X SSPE: 1.8 M
NaCl, 10 mM NaH2P04, 1 mM EDTA, pH 7.7). By decreasing the ionic concentration of the buffer, the stability of the hybrid is increased. Typically, hybridization buffers contain from between 10 mM-1 M Na+. Premixed hybridization solutions are also available from commercial sources such as Clontech Laboratories (Palo Alto, CA) and Promega Corporation (Madison, WI) for use according to manufacturer's instruction. Addition of destabilizing or denaturing agents such as formamide, tetralkylammonium salts, guanidinium cations or thiocyanate cations to the hybridization solution will alter the Tm of a hybrid.
Typically, formamide is used at a concentration of up to 50% to allow incubations to be carried out at more convenient and lower temperatures. Formamide also acts to reduce non-specific background when using RNA probes.
As previously noted, the isolated zsig49 polynucleotides of the present invention include DNA and RNA. Methods for isolating DNA and RNA are well known in the art. It is generally preferred to isolate RNA from lymph node, although DNA can also be prepared using RNA
from other tissues or isolated as genomic DNA. Total RNA

_ CA 02364330 2001-10-04 can be prepared using guanidine HCl extraction followed by isolation by centrifugation in a CsCl gradient (Chirgwin et al., Biochemistry 18:52-94, 1979). Poly(A)+ RNA is prepared from total RNA using the method of Aviv and Leder (Proc. Natl. Acad. Sci. USA 69:1408-12, 1972).
Complementary DNA (cDNA) is prepared from poly(A)+ RNA
using known methods. Polynucleotides encoding zsig49 polypeptides are then identified and isolated by, for example, hybridization or PCR.
The polynucleotides of the present invention can also be synthesized using automated equipment. The current method of choice is the phosphoramidite method.
If chemically synthesized double stranded DNA is required for an application such as the synthesis of a gene or a gene fragment, then each complementary strand is made separately. The production of short genes (60 to 80 bp) is technically straightforward and can be accomplished by synthesizing the complementary strands and then annealing them. For the production of longer genes (>300 bp), however, special strategies must be invoked, because the coupling efficiency of each cycle during chemical DNA
synthesis is seldom 1000. To overcome this problem, synthetic genes (double-stranded) are assembled in modular form from single-stranded fragments that are from 20 to 100 nucleotides in length. Gene synthesis methods are well known in the art. See, for example, Glick and Pasternak, Molecular Biotechnology, Principles &
Applications of Recombinant DNA, ASM Press, Washington, D.C., 1994; Itakura et al., Annu. Rev. Biochem. 53: 323-56, 1984; and Climie et al., Proc. Natl. Acad. Sci. USA
87:633-7, 1990.
The present invention further provides counterpart polypeptides and polynucleotides from other species (orthologs). These orthologous polynucleotides can be used, inter alia, to prepare the respective orthologous proteins. These species include, but are not limited to mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species. Of particular interest are zsig49 orthologs from other mammalian species, including murine, porcine, ovine, bovine, canine, feline, equine and other primate proteins.
Orthologs of the human proteins can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses the protein. Suitable sources of mRNA can be identified by probing Northern blots with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line. A zsig49 polypeptide-encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences. A cDNA can also be cloned using the polymerase chain reaction, or PCR
(Mullis, U.S. Patent 4,683,202), using primers designed from the sequences disclosed herein. Within an additional method, the cDNA library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to zsig49.
Similar techniques can also be applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequences disclosed in SEQ ID NOs:l, 9 and 12 and SEQ ID
NOs:2, 10 and 13 represent a single allele of the human zsig49 gene and polypeptide and a single allele of the murine zsig49 gene and polypeptide, and that allelic variation and alternative splicing are expected to occur.
In addition, allelic variants can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures. Allelic variants of the DNA sequences shown in SEQ ID NOs:l, 9 and 12, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are proteins which are allelic variants of SEQ ID NOs:2, 10 and 13.
cDNAs generated from alternatively spliced mRNAs, which retain the properties of the zsig49 polypeptide are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs. Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.
The present invention also provides isolated zsig49 polypeptides that are substantially homologous to the polypeptides of SEQ ID NOs:2, 10 and 13 and their species homologs/orthologs. The term "substantially homologous" is used herein to denote polypeptides having 500, preferably 60%, more preferably at least 800, sequence identity to the sequences shown in SEQ ID NOs:2, 10 and 13 or their orthologs. Such polypeptides will more preferably be at least 90o identical, and most preferably 950 or more identical to SEQ ID NOs:2, 10 and 13 or their orthologs. Percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9, 1992.
Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff (ibid.) as shown in Table 3 (amino acids are indicated by the standard one-letter codes). The percent identity is then calculated as:
Total number of identical matches x 100 [length of the longer sequence plus the number of gaps introduced into the longer sequence in order to align the two sequences]

_CA 02364330 2001-10-04 rl N M

r~ I

[-i tIlN N O
I I

Uj d~ rlM N N
I I

p.l C~rl v--Id' M N
I I I I I

[t., l0 ~ N N H M rl I I I I

LflO N rl rlrl rl~-i I I I I I

,.'l, LIlriM rlO r~M N N
I I I I I I I

r.~ d~N N O M N rlN v-1H

M I I I I I t H '~ N M rlO M N rlM rlM

I I I I I I

,T, 00M M ri N rl N rl N N N M

E'I I I I I I I I I I I

l0 N d' d'N M M N O N N M M
I I I I 1 I I i I I I

W L(1N O M M rl N M t-IO rlM N N
I I I I I I I I I I

Qf LI1N N O M N rl O M rlO rlN rlN
I I I I I I I I i U O1 M ~ M M r-~rlM rlN M rl rlN N rl I I I I I I I I I i I I I I I

l0 M O N rW -IM dif-IM M rlO rld~ M M
I I I 1 I 1 I i I I I I I

"Z, l0H M O O O rlM M O N M N r--IO ~ N M
i I I I I I I I I

(Y, LIlO N M rlO N O M N N rlM N rl rlM N M
I I I I I I I I I I I I I

FC, dirl N N O H rlO N r-IrlH rlN rlr-IO M N O
I I I I I I I I I I I I I I

rx z a v a w ~ x H a x ~ C~.~w cn H 3 In o m o rl c-I N

Sequence identity of polynucleotide molecules is determined by similar methods using a ratio as disclosed above.
Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson and Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant zsig49. The FASTA algorithm is described by Pearson and Lipman, Proc.
Nat. Acad. Sci. USA 85:2444, 1988, and by Pearson, Meth.
Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e. g., SEQ ID NOs:2, 10 or 13) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff" value (calculated by a predetermined formula based upon the length of the sequence and the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman and Wunsch, J. Mol. Biol. 48:444, 1970);
Sellers, SIAM J. Appl. Math. 26:787, 1974), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file (~~SMATRIX") , as explained in Appendix 2 of Pearson, Meth.
Enzymol. 183:63, 1990.
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
The present invention includes nucleic acid molecules that encode a polypeptide having one or more conservative amino acid changes, compared with the amino acid sequences of SEQ ID NOs:2, 10 or 13. The BLOSUM62 table is an amino acid substitution matrix derived from about 2,000 local multiple alignments of protein sequence segments, representing highly conserved regions of more than 500 groups of related proteins (Henikoff and Henikoff, Proc. Nat. Acad. Sci. USA 89:10915, 1992).
Accordingly, the BLOSUM62 substitution frequencies can be used to define conservative amino acid substitutions that may be introduced into the amino acid sequences of the present invention. As used herein, the language "conservative amino acid substitution" refers to a substitution represented by a BLOSUM62 value of greater than -1. For example, an amino acid substitution is conservative if the substitution is characterized by a BLOSUM62 value of 0, 1, 2, or 3. Preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 1 (e. g., l, 2 or 3), while more preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 2 (e.g., 2 or 3 ) .
Substantially homologous proteins and polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes _ CA 02364330 2001-10-04 are preferably of a minor nature, that is conservative amino acid substitutions (see Table 4) and other substitutions that do not significantly affect the folding or activity of the protein or polypeptide; small deletions, typically of one to about 30 amino acids; and small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues or an affinity tag.
Polypeptides comprising affinity tags can further comprise a proteolytic cleavage site between the zsig49 polypeptide and the affinity tag. Preferred such sites include thrombin cleavage sites and factor Xa cleavage sites.

Table 4 Conservative amino acid substitutions Basic: arginine lysine histidine Acidic: glutamic acid aspartic acid Polar: glutamine asparagine Hydrophobic: leucine isoleucine valine Aromatic: phenylalanine tryptophan tyrosine Small: glycine alanine serine threonine methionine The proteins of the present invention can also comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without limitation, trans-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline, trans-4-hydroxyproline, N-methyl-glycine, alto-threonine, methylthreonine, hydroxyethyl-cysteine, hydroxyethylhomocysteine, nitroglutamine, homo-glutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethyl-proline, tert-leucine, norvaline, 2-azaphenyl-alanine, 3-azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenyl-alanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins. For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of plasmids containing nonsense mutations is carried out in a cell-free system comprising an E. coli S30 extract and 5 commercially available enzymes and other reagents.
Proteins are purified by chromatography. See, for example, Robertson et al., J. Am. Chem. Soc. 113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc.
10 Natl. Acad. Sci. USA 90:10145-9, 1993). In a second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al., J. Biol.
Chem. 271:19991-8, 1996). Within a third method, E. coli 15 cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acids) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-20 naturally occurring amino acid is incorporated into the protein in place of its natural counterpart. See, Koide et al., Biochem. 33:7470-6, 1994. Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification.
25 Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993).
A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic 30 code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for zsig49 amino acid residues.
Essential amino acids in the zsig49 polypeptides of the present invention can be identified according to 35 procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (e. g., adhesion-modulation, differentiation-modulation or the like) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., J.
Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992;
Wlodaver et al., FEBS Lett. 309:59-64, 1992.
Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc.
Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).
Variants of the disclosed zsig49 DNA and polypeptide sequences can be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389-91, 1994, Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51, 1994 and WIPO Publication WO 97/20078. Briefly, variant DNAs are generated by in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. This technique can be modified by using a family of parent DNAs, such as allelic variants or DNAs from different species, to introduce additional variability into the process. Selection or screening for the desired activity, followed by additional iterations of mutagenesis and assay provides for rapid "evolution" of sequences by selecting for desirable mutations while simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed above can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides in host cells. Mutagenized DNA molecules that encode active polypeptides (e. g., receptor binding) can be recovered from the host cells and rapidly sequenced using modern equipment. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
Polypeptides of the present invention comprise at least 15 contiguous amino acid residues of SEQ ID
NOs:2, 10 or 13. Within certain embodiments of the invention, the polypeptides comprise 20, 30, 40, 50 or more contiguous residues of SEQ ID NOs:2, 10 or 13, up to the entire predicted mature polypeptides (residues 34-467 of SEQ ID NO:10 or residues 28-461 of SEQ ID N0:13) or residues 34-77 of SEQ ID N0:2, or the primary translation products (residues 1 to 461 of SEQ ID N0:10 or residues 1 to 461 of SEQ ID NO : 13 ) or residues 1-77 of SEQ ID N0: 2 .
As disclosed in more detail below, these polypeptides can further comprise additional, non-zsig49, polypeptide sequence(s). Such fragments or peptides may comprise an "immunogenic epitope," which is a part of a protein that elicits an antibody response when the entire protein is used as an immunogen. Immunogenic epitope-bearing peptides can be identified using standard methods (see, for example, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998, 1983).
In contrast, polypeptide fragments or peptides may comprise an "antigenic epitope," which is a region of a protein molecule to which an antibody can specifically bind. Certain epitopes consist of a linear or contiguous stretch of amino acids, and the antigenicity of such an epitope is not disrupted by denaturing agents. It is known in the art that relatively short synthetic peptides that can mimic epitopes of a protein can be used to stimulate the production of antibodies against the protein (see, for example, Sutcliffe et al., Science 219:660, 1983).
Accordingly, antigenic epitope-bearing peptides and polypeptides of the present invention are useful to raise antibodies that bind with the polypeptides described herein.
Such epitope-bearing peptides and polypeptides can be produced by fragmenting a zsig49 polypeptide, or by chemical peptide synthesis, as described herein.
Moreover, epitopes can be selected by phage display of random peptide libraries (see, for example, Lane and Stephen, Curr. Opin. Immunol. 5:268, 1993), and Cortese et al., Curr. Opin. Biotechnol. 7:616, 1996). Standard methods for identifying epitopes and producing antibodies from small peptides that comprise an epitope are described, for example, by Mole, "Epitope Mapping," in Methods in Molecular Bioloay, Vol. 10, Manson (ed.), pages 105-116 (The Humana Press, Inc. 1992), Price, "Production and Characterization of Synthetic Peptide-Derived Antibodies," in Monoclonal Antibodies: Production, Enaineerina, and Clinical Application, Ritter and Ladyman (eds.), pages 60-84 (Cambridge University Press 1995), and Coligan et al. (eds.), Current Protocols in Immunoloay, pages 9.3.1 - 9.3.5 and pages 9.4.1 - 9.4.11 (John Wiley &
Sons 1997).
Antibodies that recognize short, linear epitopes are particularly useful in analytic and diagnostic applications that employ denatured protein, such as Western blotting (Tobin, Proc. Natl. Acad. Sci. USA
76:4350-6, 1979), or in the analysis of fixed cells or tissue samples. Antibodies to linear epitopes are also useful for detecting fragments of zsig49, such as might occur in body fluids or cell culture media.
For any zsig49 polypeptide, including variants and fusion proteins, one of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant using the information set forth in Tables 1 and 2 above. Moreover, those of skill in the art can use standard software to devise zsig49 variants based upon the nucleotide and amino acid sequences described herein. Accordingly, the present invention includes a computer-readable medium encoded with a data structure that provides at least one of the following sequences: SEQ ID NO:1, SEQ ID N0:2, SEQ ID
N0:4, SEQ ID N0:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
N0:12, SEQ ID N0:13 or SEQ ID N0:14. Suitable forms of computer-readable media include magnetic media and optically-readable media. Examples of magnetic media include a hard or fixed drive, a random access memory (RAM) chip, a floppy disk, digital linear tape (DLT), a disk cache, and a ZIP disk. Optically readable media are exemplified by compact discs (e. g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable), and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, and DVD+RW ) .
Using the methods discussed above, one of ordinary skill in the art can identify and/or prepare a variety of polypeptides that are substantially homologous to residues 34 to 77 of SEQ ID N0:2, residues 34 to 467 of SEQ ID NO:10, residues 28 to 461 of SEQ ID N0:13 or allelic variants thereof and retain the properties of wild-type protein. Such polypeptides may include additional amino acids, such as affinity tags and the like. Such polypeptides may also include additional polypeptide segments as generally disclosed herein.
The polypeptides of the present invention, including full-length proteins, fragments thereof and 5 fusion proteins, can be produced in genetically engineered host cells according to conventional techniques. Suitable host cells are those cell types that can be transformed or transfected with exogenous DNA and grown in culture, and include bacteria, fungal cells, and cultured higher 10 eukaryotic cells. Eukaryotic cells, particularly cultured cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into a variety of host cells are disclosed by Sambrook et al., Molecular Cloning: A
15 Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel et al.
(eds.), Current Protocols in Molecular Bioloay, John Wiley and Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zsig49 20 polypeptide of the present invention is operably linked to other genetic elements required for its expression, generally including a transcription promoter and terminator within an expression vector. The vector will also commonly contain one or more selectable markers and 25 one or more origins of replication, although those skilled in the art will recognize that within certain systems selectable markers may be provided on separate vectors, and replication of the exogenous DNA may be provided by integration into the host cell genome. Selection of 30 promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of ordinary skill in the art. Many such elements are described in the literature and are available through commercial suppliers.
35 To direct a zsig49 polypeptide into the secretory pathway of a host cell, a secretory signal sequence (also known as a leader sequence, prepro sequence _ CA 02364330 2001-10-04 or pre sequence) is provided in the expression vector.
The secretory signal sequence may be that of the zsig49 polypeptide, or may be derived from another secreted protein (e.g., t-PA) or synthesized de novo. The secretory signal sequence is joined to the zsig49 DNA
sequence in the correct reading frame and positioned to direct newly synthesized polypeptide into secretory pathways to host cell. Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the polypeptide of interest, although certain secretory signal sequences may be positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al., U.S. Patent No.
5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Alternatively, the secretory signal sequence contained in the polypeptides of the present invention is used to direct other polypeptides into the secretory pathway. The present invention provides for such fusion polypeptides. A signal fusion polypeptide can be made wherein a secretory signal sequence derived from amino acid residues 1-33 of SEQ ID N0:2 or residues 1-33 of SEQ
ID N0:10 is be operably linked to another polypeptide using methods known in the art and disclosed herein. The secretory signal sequence contained in the fusion polypeptides of the present invention is preferably fused amino-terminally to an additional peptide to direct the additional peptide into the secretory pathway. Such constructs have numerous applications known in the art.
For example, these novel secretory signal sequence fusion constructs can direct the secretion of an active component of a normally non-secreted protein. Such fusions may be used in vivo or in vitro to direct peptides through the secretory pathway.
Cultured mammalian cells are suitable hosts within the present invention. Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics _ CA 02364330 2001-10-04 7:603, 1981: Graham and Van der Eb, Viroloay 52:456, 1973), electroporation (Neumann et al., EMBO J. 1:841-845, 1982), DEAF-dextran mediated transfection (Ausubel et al., eds., Current Protocols in Molecular Bioloay, John Wiley and Sons, Inc., NY, 1987), liposome-mediated transfection (Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80, 1993), and viral vectors (Miller and Rosman, BioTechniques 7:980-90, 1989; Wang and Finer, Nature Med. 2:714-16, 1996). The production of recombinant polypeptides in cultured mammalian cells is disclosed, for example, by Levinson et al., U.S. Patent No. 4,713,339; Hagen et al., U.S. Patent No. 4,784,950;
Palmiter et al., U.S. Patent No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured mammalian cells include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC
No. CRL 1651), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No.
CRL 1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary (e.g. CHO-K1; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland. In general, strong transcription promoters are preferred, such as promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288. Other suitable promoters include those from metallothionein genes (U. S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late promoter.
If the zsig49 polypeptide is expressed in a non-endocrine or non-neuroendocrine cell, the expression host cell generally will not express the prohormone convertases PC2 and PC3, which are believed to be involved in the regulated secretory pathway. Another member of this endoprotease family, furin, is present in most cells and is believed to be involved in the constitutive secretory pathway. Vollenweider et al. (Diabetes 44:1075-80, 1995) have described the role of these prohormone conversion endoproteases in general, and specifically describe studies involving co-transfection of COS cells with proinsulin and one of the endoproteases. Their results showed that PC3 and furin were able to cleave proinsulin at both its junctions; PC2 did not exhibit prohormone cleavage to any significant extent. Without co-transfection of an endoprotease, the prohormone was not converted to any great extent by COS cells. However, the co-transfection system described is still not an exact model of the natural ~3 cell environment, since (3 cells make both PC2 and PC3. Also, a non-endocrine cell does not represent a native environment for PC2 and PC3 expression. In addition, co-transfection may result in general or local overexpression of PC2 and/or PC3, relative to the native (3 cell environment. In a preferred embodiment, the host cells will be co-transfected with a second DNA expression construct comprising the following operably linked elements: a transcription promoter; a DNA
segment encoding an endoprotease; and a transcription terminator, wherein the host cell expresses the DNA
segment encoding the endoprotease.
Drug selection is generally used to select for cultured mammalian cells into which foreign DNA has been inserted. Such cells are commonly referred to as "transfectants". Cells that have been cultured in the presence of the selective agent and are able to pass the gene of interest to their progeny are referred to as "stable transfectants." A preferred selectable marker is a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like. Selection systems may also be used to increase the expression level of the gene of interest, a process referred to as "amplification." Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes. A

preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g., hygromycin resistance, multi-drug resistance, puromycin acetyltransferase) can also be used. Alternative markers that introduce an altered phenotype, such as green fluorescent protein, or cell surface proteins such as CD4, CD8, Class I MHC, placental alkaline phosphatase may be used to sort transfected cells from untransfected cells by such means as FACS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used as hosts, including plant cells, insect cells and avian cells. The use of Agrobacterium rhizogenes as a vector for expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci. (Banaalore) 11:47-58, 1987.
Transformation of insect cells and production of foreign polypeptides therein is disclosed by Guarino et al., U.S.
Patent No. 5,162,222 and V~IIPO publication WO 94/06463.
Insect cells can be infected with recombinant baculovirus, commonly derived from Autographa californica nuclear polyhedrosis virus (AcNPV). However, pFastBaclTM can be modified to a considerable degree. The polyhedrin promoter can be removed and substituted with the baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter) which is expressed earlier in the baculovirus infection, and has been shown to be advantageous for expressing secreted proteins. See, Hill-Perkins and Possee, J. Gen. Virol. 71:971-6, 1990; Bonning et al., J. Gen. Virol. 75:1551-6, 1994; and, Chazenbalk and Rapoport, J. Biol. Chem. 270:1543-9, 1995. In such transfer vector constructs, a short or long version of the basic protein promoter can be used. Moreover, transfer vectors can be constructed which replace the native zsig49 secretory signal sequences with secretory signal sequences derived from insect proteins. For example, a secretory signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to replace the native zsig49 secretory signal sequence. DNA encoding the zsig49 polypeptide is inserted into the baculoviral genome in place of the AcNPV
5 polyhedrin gene coding sequence by one of two methods.
The first is the traditional method of homologous DNA
recombination between wild-type AcNPV and a transfer vector containing the zsig49 flanked by AcNPV sequences.
Suitable insect cells, e.g. 5F9 cells, are infected with 10 wild-type AcNPV and transfected with a transfer vector comprising a zsig49 polynucleotide operably linked to an AcNPV polyhedrin gene promoter, terminator, and flanking sequences. See, King and Possee, The Baculovirus Expression System: A Laboratory Guide, London, Chapman &
15 Hall; O'Reilly et al., Baculovirus Expression Vectors: A
Laboratorv Manual, New York, Oxford University Press., 1994; and, Richardson, Ed., Baculovirus Expression Protocols. Methods in Molecular Bioloay, Totowa, NJ, Humana Press, 1995. Natural recombination within an 20 insect cell will result in a recombinant baculovirus which contains zsig49 driven by the polyhedrin promoter.
Recombinant viral stocks are made by methods commonly used in the art.
The second method of making recombinant 25 baculovirus utilizes a transposon-based system described by Luckow (Luckow et al., J. Virol. 67:4566-79, 1993).
This system is sold in the Bac-to-Bac kit (Life Technologies, Rockville, MD). This system utilizes a transfer vector, pFastBaclT"" (Life Technologies) containing 30 a Tn7 transposon to move the DNA encoding the zsig49 polypeptide into a baculovirus genome maintained in E.
coli as a large plasmid called a "bacmid." The pFastBaclT""
transfer vector utilizes the AcNPV polyhedrin promoter to drive the expression of the gene of interest, in this case 35 zsig49. However, pFastBaclT"" can be modified to a considerable degree. The polyhedrin promoter can be removed and substituted with the baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter) which is expressed earlier in the baculovirus infection, and has been shown to be advantageous for expressing secreted proteins. See, Hill-Perkins and Possee, J. Gen. Virol.
71:971-6, 1990; Bonning et al., J. Gen. Virol. 75:1551-6, 1994; and, Chazenbalk, G.D., and Rapoport, J. Biol. Chem.
270:1543-9, 1995. In such transfer vector constructs, a short or long version of the basic protein promoter can be used. Moreover, transfer vectors can be constructed which replace the native zsig49 secretory signal sequences with secretory signal sequences derived from insect proteins.
For example, a secretory signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to replace the native secretory signal sequence. In addition, transfer vectors can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed zsig49 polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer et al., ibid.). Using a technique known in the art, a transfer vector containing zsig49 is transformed into E. coli, and screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus. The bacmid DNA containing the recombinant baculovirus genome is isolated, using common techniques, and used to transfect Spodoptera frugiperda cells, e.g.
Sf9 cells. Recombinant virus that expresses zsig49 is subsequently produced. Recombinant viral stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line derived from the fall armyworm, Spodoptera frugiperda. See, in general, Glick and Pasternak, Molecular Biotechnoloay: Principles and Applications of Recombinant DNA, ASM Press, Washington, D.C., 1994. Another suitable cell line is the High FiveOT"' cell line (Invitrogen) derived from Trichoplusia ni (U. S.
Patent $#5,300,435). Commercially available serum-free media are used to grow and maintain the cells. Suitable media are Sf900 IIT"" (Life Technologies) or ESF 921T""
(Expression Systems) for the Sf9 cells; and Ex-ce110405T""
(JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life Technologies) for the T. ni cells. The cells are grown up from an inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3. The recombinant virus-infected cells typically produce the recombinant zsig49 polypeptide at 12-72 hours post-infection and secrete it with varying efficiency into the medium. The culture is usually harvested 48 hours post-infection. Centrifugation is used to separate the cells from the medium (supernatant). The supernatant containing the zsig49 polypeptide is filtered through micropore filters, usually 0.45 ~,m pore size. Procedures used are generally described in available laboratory manuals (King and Possee, ibid.; O'Reilly et al., ibid.; Richardson, C.
D., ibid.). Subsequent purification of the zsig49 polypeptide from the supernatant can be achieved using methods described herein.
Fungal cells, including yeast cells, can also be used within the present invention. Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica.
Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides therefrom are disclosed by, for example, Kawasaki, U.S.
Patent No. 4,599,311; Kawasaki et al., U.S. Patent No.
4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075. Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e. g., leucine). A preferred vector system for use in Saccharomyces cerevisiae is the POTI

_ CA 02364330 2001-10-04 vector system disclosed by Kawasaki et al. (U. S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media. Suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No.
4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279.
Aspergillus cells may be utilized according to the methods of McKnight et al., U.S. Patent No. 4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 4,486,533.
For example, the use of Pichia methanolica as host for the production of recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond, U.S. Patent No. 5,736,383, Raymond et al., Yeast 14:11-23, 1998, and in international publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565. DNA molecules for use in transforming P. methanolica will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P. methanolica, it is preferred that the promoter and terminator in the plasmid be that of a P. methanolica gene, such as a P. methanolica alcohol utilization gene (AUG1 or AUG2). Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of the DNA into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21) , which allows ade2 host cells to grow in the absence of adenine. For large-scale, industrial processes where it is desirable to minimize the use of methanol, it is preferred to use host cells in which both methanol utilization genes (AUG1 and AUG2) are deleted. For production of secreted proteins, host cells deficient in vacuolar protease genes (PEP4 and PRB1) are preferred.
Electroporation is used to facilitate the introduction of a plasmid containing DNA encoding a polypeptide of interest into P. methanolica cells. It is preferred to transform P. methanolica cells by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (i) of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the bacteria Escherichia coli, Bacillus and other genera are also useful host cells within the present invention.
Techniques for transforming these hosts and expressing foreign DNA sequences cloned therein are well known in the art (see, e.g., Sambrook et al., ibid.). When expressing a zsig49 polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, typically as insoluble granules, or may be directed to the periplasmic space by a bacterial secretion sequence. In the former case, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution. In the latter case, the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to 5 release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
The adenovirus system can also be used for protein production in vitro. By culturing adenovirus 10 infected non-293 cells under conditions where the cells are not rapidly dividing, the cells can produce proteins for extended periods of time. For instance, BHK cells are grown to confluence in cell factories, then exposed to the adenoviral vector encoding the secreted protein of 15 interest. The cells are then grown under serum-free conditions, which allows infected cells to survive for several weeks without significant cell division.
Alternatively, adenovirus vector infected 293 cells can be grown as adherent cells or in suspension culture at 20 relatively high cell density to produce significant amounts of protein (see Gamier et al., Cytotechnol.
15:145-55, 1994). With either protocol, an expressed, secreted heterologous protein can be repeatedly isolated from the cell culture supernatant. Within the infected 25 293 cell production protocol, non-secreted proteins may also be effectively obtained.
Transformed or transfected host cells are cultured according to conventional procedures in a culture medium containing nutrients and other components required 30 for the growth of the chosen host cells. A variety of suitable media, including defined media and complex media, are known in the art and generally include a carbon source, a nitrogen source, essential amino acids, vitamins and minerals. Media may also contain such components as 35 growth factors or serum, as required. The growth medium will generally select for cells containing the exogenously added DNA by, for example, drug selection or deficiency in _ CA 02364330 2001-10-04 an essential nutrient which is complemented by the selectable marker carried on the expression vector or co-transfected into the host cell. P. methanolica cells are cultured in a medium comprising adequate sources of carbon, nitrogen and trace nutrients at a temperature of about 25°C to 35°C. Liquid cultures are provided with sufficient aeration by conventional means, such as shaking of small flasks or sparging of fermentors. A preferred culture medium for P. methanalica is YEPD (2% D-glucose, 2o BactoTM Peptone (Difco Laboratories, Detroit, MI), 1%
BactoTM yeast extract (Difco Laboratories), 0.004% adenine and 0.006% L-leucine).
An in vivo approach for assaying proteins of the present invention involves viral delivery systems.
Exemplary viruses for this purpose include adenovirus, herpesvirus, vaccinia virus and adeno-associated virus (AAV). Adenovirus, a double-stranded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for a review, see Becker et al., Meth. Cell Biol. 43:161-89, 1994; and Douglas and Curiel, Science & Medicine 4:44-53, 1997).
The adenovirus system offers several advantages:
adenovirus can (i) accommodate relatively large DNA
inserts; (ii) be grown to high-titer; (iii) infect a broad range of mammalian cell types; and (iv) be used with a large number of available vectors containing different promoters. Also, because adenoviruses are stable in the bloodstream, they can be administered by intravenous injection. Some disadvantages (especially for gene therapy) associated with adenovirus gene delivery include:
(i) very low efficiency integration into the host genome;
(ii) existence in primarily episomal form; and (iii) the host immune response to the administered virus, precluding readministration of the adenoviral vector.
By deleting portions of the adenovirus genome, larger inserts (up to 7 kb) of heterologous DNA can be accommodated. These inserts can be incorporated into the _ CA 02364330 2001-10-04 viral DNA by direct ligation or by homologous recombination with a co-transfected plasmid. In an exemplary system, the essential E1 gene has been deleted from the viral vector, and the virus will not replicate unless the E1 gene is provided by the host cell (the human 293 cell line is exemplary). When intravenously administered to intact animals, adenovirus primarily targets the liver. If the adenoviral delivery system has an E1 gene deletion, the virus cannot replicate in the host cells. However, the host's tissue (e. g., liver) will express and process (and, if a secretory signal sequence is present, secrete) the heterologous protein. Secreted proteins will enter the circulation in the highly vascularized liver, and effects on the infected animal can be determined.
The adenovirus system can also be used for protein production in vitro. By culturing adenovirus-infected non-293 cells under conditions where the cells are not rapidly dividing, the cells can produce proteins for extended periods of time. For instance, BHK cells are grown to confluence in cell factories, then exposed to the adenoviral vector encoding the secreted protein of interest. The cells are then grown under serum-free conditions, which allows infected cells to survive for several weeks without significant cell division.
Alternatively, adenovirus vector infected 2935 cells can be grown in suspension culture at relatively high cell density to produce significant amounts of protein (see Gamier et al., Cytotechnol. 15:145-55, 1994). With either protocol, an expressed, secreted heterologous protein can be repeatedly isolated from the cell culture supernatant. Within the infected 2935 cell production protocol, non-secreted proteins may also be effectively obtained.
Zsig49 polypeptides or fragments thereof may also be prepared through chemical synthesis. Zsig49 polypeptides may be monomers or multimers; glycosylated or non-glycosylated; pegylated or non-pegylated; and may or may not include an initial methionine amino acid residue.
The present invention further provides a variety of other polypeptide fusions and related multimeric proteins comprising one or more polypeptide fusions. For example, a zsig49 polypeptide can be prepared as a fusion to a dimerizing protein as disclosed in U.S. Patents Nos.
5,155,027 and 5,567,584. Preferred dimerizing proteins in this regard include immunoglobulin constant region domains. Immunoglobulin-zsig49 polypeptide fusions can be expressed in genetically engineered cells to produce a variety of multimeric zsig49 analogs. Auxiliary domains can be fused to zsig49 polypeptides to target them to specific cells, tissues, or macromolecules. For example, a zsig49 polypeptide or protein could be targeted to a predetermined cell type by fusing a zsig49 polypeptide to a ligand that specifically binds to a receptor on the surface of the target cell. In this way, polypeptides and proteins can be targeted for therapeutic or diagnostic purposes. A zsig49 polypeptide can be fused to two or more moieties, such as an affinity tag for purification and a targeting domain. Polypeptide fusions can also comprise one or more cleavage sites, particularly between domains. See, Tuan et al., Connective Tissue Research 34:1-9, 1996.
Expressed recombinant zsig49 polypeptides (or chimeric zsig49 polypeptides) can be purified using fractionation and/or conventional purification methods and media. Ammonium sulfate precipitation and acid or chaotrope extraction may be used for fractionation of samples. Exemplary purification steps may include hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid chromatography. Suitable anion exchange media include derivatized dextrans, agarose, cellulose, polyacrylamide, specialty silicas, and the like. DEAE Fast-Flow Sepharose (Pharmacia, Piscataway, NJ), PEI, DEAE, QAE and Q derivatives are preferred.

Exemplary chromatographic media include those media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG
71 (Toro Haas) and the like. Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins and the like that are insoluble under the conditions in which they are to be used. These supports may be modified with reactive groups that allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries include cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, hydrazide activation, and carboxyl and amino derivatives for carbodiimide coupling chemistries. These and other solid media are well known and widely used in the art, and are available from commercial suppliers. Methods for binding receptor polypeptides to support media are well known in the art.
Selection of a particular method is a matter of routine design and is determined in part by the properties of the chosen support. See, for example, Affinity Chromatography: Principles & Methods, Pharmacia LKB
Biotechnology, Uppsala, Sweden, 1988.
The zsig49 polypeptides of the present invention can be isolated by exploitation of their structural features. Within one embodiment of the invention are included a fusion of the polypeptide of interest and an affinity tag (e. g., polyhistidine, Glu-Glu, FLAG, maltose-binding protein, an immunoglobulin domain) that may be constructed to facilitate purification. An exemplary purification method of protein constructs having an N-terminal or C-terminal affinity tag produced from mammalian cells, such as BHK cells, involves using an antibody to the affinity tag epitope to purify the protein. SDS-PAGE, Western analysis, amino acid analysis and N-terminal sequencing can be done to the purified protein to confirm its identity.
5 Protein refolding (and optionally reoxidation) procedures may be advantageously used. It is preferred to purify the protein to >80% purity, more preferably to >90%
purity, even more preferably >95%, and particularly preferred is a pharmaceutically pure state, that is 10 greater than 99.90 pure with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents.
Preferably, a purified protein is substantially free of other proteins, particularly other proteins of animal 15 origin.
Proteins/polypeptides which bind zsig49 (such as a zsig49 binding receptor) can also be used for purification of zsig49. The zsig49-binding protein/polypeptide is immobilized on a solid support, 20 such as beads of agarose, cross-linked agarose, glass, cellulosic resins, silica-based resins, polystyrene, cross-linked polyacrylamide, or like materials that are stable under the conditions of use. Methods for linking polypeptides to solid supports are known in the art, and 25 include amine chemistry, cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, and hydrazide activation. The resulting medium will generally be configured in the form of a column, and fluids containing zsig49 polypeptide are 30 passed through the column one or more times to allow zsig49 polypeptide to bind to the ligand-binding or receptor polypeptide. The bound zsig49 polypeptide is then eluted using changes in salt concentration, chaotropic agents (guanidine HCl), or pH to disrupt ligand-receptor 35 binding.
An assay system that uses a ligand-binding receptor (or an antibody, one member of a complement/anti-complement pair) or a binding fragment thereof, and a commercially available biosensor instrument (BIAcoreTM, Pharmacia Biosensor, Piscataway, NJ) may be advantageously employed. Such receptor, antibody, member of a complement/anti-complement pair or fragment is immobilized onto the surface of a receptor chip. Use of this instrument is disclosed by Karlsson, J. Immunol. Methods 145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol.
234:554-63, 1993. A receptor, antibody, member or fragment is covalently attached, using amine or sulfhydryl chemistry, to dextran fibers that are attached to gold film within the flow cell. A test sample is passed through the cell. If a ligand, epitope, or opposite member of the complement/anti-complement pair is present in the sample, it will bind to the immobilized receptor, antibody or member, respectively, causing a change in the refractive index of the medium, which is detected as a change in surface plasmon resonance of the gold film.
This system allows the determination of on- and off-rates, from which binding affinity can be calculated, and assessment of stoichiometry of binding. As used herein, the term complement/anti-complement pair denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions. For instance, biotin and avidin (or streptavidin) are prototypical members of a complement/anti-complement pair. Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like. Where subsequent dissociation of the complement/anti-complement pair is desirable, the complement/anti-complement pair preferably has a binding affinity of <109 M 1.
Zsig49 polypeptide and other ligand homologs can also be used within other assay systems known in the art.
Such systems include Scatchard analysis for determination of binding affinity (see Scatchard, Ann. NY Acad. Sci. 51:

660-72, 1949) and calorimetric assays (Cunningham et al., Science 253:545-48, 1991; Cunningham et al., Science 245:821-25, 1991).
The activity of zsig49 polypeptides can be measured by a silicon-based biosensor microphysiometer which measures the extracellular acidification rate or proton excretion associated with receptor binding and subsequent physiologic cellular responses. An exemplary device is the CytosensorT"" Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA. A variety of cellular responses, such as cell proliferation, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method. See, for example, McConnell et al., Science 257:1906-12, 1992; Pitchford et al., Meth. Enzymol.
228:84-108, 1997; Arimilli et al., J. Immunol. Meth.
212:49-59, 1998; Van Liefde et al., Eur. J. Pharmacol.
346:87-95, 1998. The microphysiometer can be used for assaying adherent or non-adherent eukaryotic or prokaryotic cells. By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including zsig49 polypeptide, its agonists, or antagonists.
Preferably, the microphysiometer is used to measure responses of a zsig49-responsive eukaryotic cell, compared to a control eukaryotic cell that does not respond to zsig49 polypeptide. Zsig49-responsive eukaryotic cells comprise cells into which a receptor for zsig49 has been transfected; or cells naturally responsive to zsig49 such as cells derived from pancreatic tissue.
Differences, measured by a change, for example, an increase or diminution in extracellular acidification, in the response of cells exposed to zsig49 polypeptide, relative to a control, are a direct measurement of zsig49-modulated cellular responses. Moreover, such zsig49-modulated responses can be assayed under a variety of stimuli. Using the microphysiometer, there is provided a method of identifying agonists of zsig49 polypeptide, comprising providing cells responsive to a zsig49 polypeptide, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting a change, for example, an increase or diminution, in a cellular response of the second portion of the cells as compared to the first portion of the cells. The change in cellular response is shown as a measurable change extracellular acidification rate.
Moreover, culturing a third portion of the cells in the presence of zsig49 polypeptide and the absence of a test compound can be used as a positive control for the zsig49-responsive cells, and as a control to compare the agonist activity of a test compound with that of the zsig49 polypeptide. Moreover, using the microphysiometer, there is provided a method of identifying antagonists of zsig49 polypeptide, comprising providing cells responsive to a zsig49 polypeptide, culturing a first portion of the cells in the presence of zsig49 and the absence of a test compound, culturing a second portion of the cells in the presence of zsig49 and the presence of a test compound, and detecting a change, for example, an increase or a diminution in a cellular response of the second portion of the cells as compared to the first portion of the cells.
The change in cellular response is shown as a measurable change extracellular acidification rate. Antagonists and agonists, for zsig49 polypeptide, can be rapidly identified using this method.
Moreover, zsig49 can be used to identify cells, tissues, or cell lines which respond to a zsig49-stimulated pathway. The microphysiometer, described above, can be used to rapidly identify ligand-responsive cells, such as cells responsive to zsig49 of the present invention. Cells can be cultured in the presence or absence of zsig49 polypeptide. Those cells which elicit a _ CA 02364330 2001-10-04 measurable change in extracellular acidification in the presence of zsig49 are responsive to zsig49. Such cell lines, can be used to identify antagonists and agonists of zsig49 polypeptide as described herein.
Nucleic acid molecules disclosed herein can be used to detect the expression of a zsig49 gene in a biological sample. Such probe molecules include double-stranded nucleic acid molecules comprising the nucleotide sequences of SEQ ID NOs:l, 4, 9, 11, 12, 14, or fragments thereof, as well as single-stranded nucleic acid molecules having the complement of the nucleotide sequences of SEQ
ID NOs: 1, 4, 9, 11, 12, 14, or a fragment thereof.
Probe molecules may be DNA, RNA, oligonucleotides, and the like.
In a basic assay, a single-stranded probe molecule is incubated with RNA, isolated from a biological sample, under conditions of temperature and ionic strength that promote base pairing between the probe and target zsig49 RNA species. After separating unbound probe from hybridized molecules, the amount of hybrids is detected.
Well-established hybridization methods of RNA
detection include northern analysis and dot/slot blot hybridization (see, for example, Ausubel ibid. and Wu et al. (eds.), "Analysis of Gene Expression at the RNA
Level," in Methods in Gene Biotechnology, pages 225-239 (CRC Press, Inc. 1997)). Nucleic acid probes can be detectably labeled with radioisotopes such as 32P or 355.
Alternatively, zsig49 RNA can be detected with a nonradioactive hybridization method (see, for example, Isaac (ed.), Protocols for Nucleic Acid Analysis by Nonradioactive Probes, Humana Press, Inc., 1993).
Typically, nonradioactive detection is achieved by enzymatic conversion of chromogenic or chemiluminescent substrates. Illustrative nonradioactive moieties include biotin, fluorescein, and digoxigenin.
Zsig49 oligonucleotide probes are also useful for in vivo diagnosis. As an illustration, l8F-labeled _CA 02364330 2001-10-04 oligonucleotides can be administered to a subject and visualized by positron emission tomography (Tavitian et al., Nature Medicine 4:467, 1998).
Numerous diagnostic procedures take advantage of 5 the polymerase chain reaction (PCR) to increase sensitivity of detection methods. Standard techniques for performing PCR are well-known (see, generally, Mathew (ed.), Protocols in Human Molecular Genetics (Humana Press, Inc. 1991), White (ed.), PCR Protocols: Current 10 Methods and Applications (Humana Press, Inc. 1993), Cotter (ed.), Molecular Diagnosis of Cancer (Humana Press, Inc.
1996), Hanausek and Walaszek (eds.), Tumor Marker Protocols (Humana Press, Inc. 1998), Lo (ed.), Clinical Applications of PCR (Humana Press, Inc. 1998), and Meltzer 15 (ed.), PCR in Bioanalysis (Humana Press, Inc. 1998)).
PCR primers can be designed to amplify a sequence encoding a particular zsig49 domain or motif.
One variation of PCR for diagnostic assays is reverse transcriptase-PCR (RT-PCR). In the RT-PCR
20 technique, RNA is isolated from a biological sample, reverse transcribed to cDNA, and the cDNA is incubated with zsig49 primers (see, for example, Wu et al. (eds.), "Rapid Isolation of Specific cDNAs or Genes by PCR," in Methods in Gene Biotechnoloay, CRC Press, Inc., pages 15-25 28, 1997). PCR is then performed and the products are analyzed using standard techniques.
As an illustration, RNA is isolated from biological sample using, for example, the guanidinium-thiocyanate cell lysis procedure described above.
30 Alternatively, a solid-phase technique can be used to isolate mRNA from a cell lysate. A reverse transcription reaction can be primed with the isolated RNA using random oligonucleotides, short homopolymers of dT, or zsig49 anti-sense oligomers. Oligo-dT primers offer the 35 advantage that various mRNA nucleotide sequences are amplified that can provide control target sequences.

_CA 02364330 2001-10-04 Zrnpl sequences are amplified by the polymerase chain reaction using two flanking oligonucleotide primers that are typically at least 5 bases in length.
PCR amplification products can be detected using a variety of approaches. For example, PCR products can be fractionated by gel electrophoresis, and visualized by ethidium bromide staining. Alternatively, fractionated PCR products can be transferred to a membrane, hybridized with a detestably-labeled zsig49 probe, and examined by autoradiography. Additional alternative approaches include the use of digoxigenin-labeled deoxyribonucleic acid triphosphates to provide chemiluminescence detection, and the C-TRAK colorimetric assay. Another approach is real time quantitative PCR (Perkin-Elmer Cetus, Norwalk, Ct.). A fluorogenic probe, consisting of an oligonucleotide with both a reporter and a quencher dye attached, anneals specifically between the forward and reverse primers. Using the 5' endonuclease activity of Taq DNA polymerase, the reporter dye is separated from the quencher dye and a sequence-specific signal is generated and increases as amplification increases. The fluorescence intensity can be continuously monitored and quantified during the PCR reaction.
Another approach for detection of zsig49 expression is cycling probe technology (CPT), in which a single-stranded DNA target binds with an excess of DNA
RNA-DNA chimeric probe to form a complex, the RNA portion is cleaved with RNase H, and the presence of cleaved chimeric probe is detected (see, for example, Beggs et al., J. Clin. Microbiol. 34:2985, 1996 and Bekkaoui et al., Biotechniaues 20:240, 1996). Alternative methods for detection of zsig49 sequences can utilize approaches such as nucleic acid sequence-based amplification (NASBA), cooperative amplification of templates by cross-hybridization (CATCH), and the ligase chain reaction (LCR) (see, for example, Marshall et al., U.S. Patent No.

_ CA 02364330 2001-10-04 5,686,272 (1997), Dyer et al., J. Virol. Methods 60:161, 1996; Ehricht et al., Eur. J. Biochem. 243:358, 1997 and Chadwick et al., J. Virol. Methods 70:59, 1998). Other standard methods are known to those of skill in the art.
Zsig49 probes and primers can also be used to detect and to localize zsig49 gene expression in tissue samples. Methods for such in situ hybridization are well-known to those of skill in the art (see, for example, Choo (ed.), In Situ Hybridization Protocols, Humana Press, Inc., 1994; Wu et al. (eds.), "Analysis of Cellular DNA or Abundance of mRNA by Radioactive In Situ Hybridization IRISH)," in Methods in Gene Biotechnoloay, CRC Press, Inc., pages 259-278, 1997 and Wu et al. (eds.), "Localization of DNA or Abundance of mRNA by Fluorescence In Situ Hybridization IRISH)," in Methods in Gene Biotechnoloay, CRC Press, Inc., pages 279-289, 1997).
In another embodiment, the present invention provides methods for detecting in a sample from an individual, a chromosome 1 abnormality associated with a disease, comprising the steps of: (a) contacting nucleic acid molecules of the sample with a nucleic acid probe that hybridizes with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1, 9 or 12, their complements or fragments, under stringent conditions, and (b) detecting the presence or absence of hybridization of the probe with nucleic acid molecules in the sample, wherein the absence of hybridization is indicative of a chromosome 1 abnormality, such as an abnormality that causes a defective glucose metabolism.
The present invention also provides methods of detecting in a sample from an individual, an zsig49 gene abnormality associated with a disease, comprising: (a) isolating nucleic acid molecules that encode zsig49 from the sample, and (b) comparing the nucleotide sequence of the isolated zsig49-encoding sequence with the nucleotide sequence of SEQ ID NOs:l, 9 or 12, wherein the difference between the sequence of the isolated zsig49-encoding sequence or a polynucleotide encoding the zsig49 polypeptide generated from the isolated zsig49-encoding sequence and the nucleotide sequences of SEQ ID NOs:l, 9 or 12 is indicative of an zsig49 gene abnormality associated with disease or susceptibility to a disease in an individual, such as a defective glucose metabolism or diabetes.
The present invention also provides methods of detecting in a sample from a individual, an abnormality in expression of the zsig49 gene associated with disease or susceptibility to disease, comprising: (a) obtaining zsig49 RNA from the sample, (b) generating zsig49 cDNA by polymerase chain reaction from the zsig49 RNA, and (c) comparing the nucleotide sequence of the zsig49 cDNA to the nucleotide sequence of SEQ ID NOs :1, 9 or 12 , wherein a difference between the sequence of the zsig49 cDNA and the nucleotide sequence of SEQ ID NOs:l, 9 or 12 is indicative of an abnormality in expression of the zsig49 gene associated with disease or susceptibility to disease.
In further embodiments, the disease is defective glucose metabolism or diabetes.
In other aspects, the present invention provides methods for detecting in a sample from an individual, an zsig49 gene abnormality associated with a disease, comprising: (a) contacting sample nucleic acid molecules with a nucleic acid probe, wherein the probe hybridizes to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs:l, 9 or 12, its complements or fragments, under stringent conditions, and (b) detecting the presence or absence of hybridization is indicative of an zsig49 abnormality. The absence of hybridization of the probe is associated with defective glucose metabolism.
In situ hybridization provides another approach for identifying zsig49 gene abnormalities. According to this approach, an zsig49 probe is labeled with a detectable marker by any method known in the art. For _ CA 02364330 2001-10-04 example, the probe can be directly labeled by random priming, end labeling, PCR, or nick translation. Suitable direct labels include radioactive labels such as 32P, 3H, and 35S and non-radioactive labels such as fluorescent markers (e. g., fluorescein, Texas Red, AMCA blue (7-amino-4-methyl-coumanine-3-acetate), lucifer yellow, rhodamine, etc.), cyanin dyes which are detectable with visible light, enzymes, and the like. Probes labeled with an enzyme can be detected through a colorimetric reaction by providing a substrate for the enzyme. In the presence of various substrates, different colors are produced by the reaction, and these colors can be visualized to separately detect multiple probes if desired. Suitable substrates for alkaline phosphatase include 5-bromo-4-chloro-3-indolylphosphate and nitro blue tetrazolium. One preferred substrate for horseradish peroxidase is diaminobenzoate.
An illustrative method for detecting chromosomal abnormalities with in situ hybridization is described by Wang et al., U.S. patent No. 5,856,089. Following this approach, for example, a method of performing in situ hybridization with an zsig49 probe to detect a chromosome structural abnormality in a cell from a fixed tissue sample obtained from a patient suspected of having a metabolic disease can comprise the steps of: (1) obtaining a fixed tissue sample from the patient, (2) pretreating the fixed tissue sample obtained in step (1) with a bisulfate ion composition, (3) digesting the fixed tissue sample with proteinase, (4) performing in situ hybridization on cells obtained from the digested fixed tissue sample of step (3) with a probe which specifically hybridizes to the zsig49 gene, wherein a signal pattern of hybridized probes is obtained, (5) comparing the signal pattern of the hybridized probe in step (4) to a predetermined signal pattern of the hybridized probe obtained when performing in situ hybridization on cells having a normal critical chromosome region of interest, and (6) detecting a chromosome structural abnormality in the patient's cells, by detecting a difference between the signal pattern obtained in step (4) and the predetermined 5 signal pattern. Examples of zsig49 gene abnormalities include deletions, amplifications, translocations, inversions, and the like.
The present invention also contemplates kits for performing a diagnostic assay for zsig49 gene expression or 10 to detect mutations in the zsig49 gene. Such kits comprise nucleic acid probes, such as double-stranded nucleic acid molecules comprising the nucleotide sequence of SEQ ID
NOs:l, 9 or 12, or a portion thereof, as well as single-stranded nucleic acid molecules having the complement of 15 the nucleotide sequence of SEQ ID NOs:l, 9 or 12, or a portion thereof. Probe molecules may be DNA, RNA, oligonucleotides, and the like. Kits can comprise nucleic acid primers for performing PCR or oligonucleotides for performing the ligase chain reaction.
20 Preferably, such a kit contains all the necessary elements to perform a nucleic acid diagnostic assay described above. A kit will comprise at least one container comprising an zsig49 probe or primer. The kit may also comprise a second container comprising one or 25 more reagents capable of indicating the presence of zsig49 sequences. Examples of such indicator reagents include detectable labels such as radioactive labels, fluorochromes, chemiluminescent agents, and the like. A
kit may also comprise a means for conveying to the user 30 that the zsig49 probes and primers are used to detect zsig49 gene expression. For example, written instructions may state that the enclosed nucleic acid molecules can be used to detect either a nucleic acid molecule that encodes zsig49, or a nucleic acid molecule having a nucleotide 35 sequence that is complementary to an zsig49-encoding nucleotide sequence. The written material can be applied directly to a container, or the written material can be provided in the form of a packaging insert.
Various additional diagnostic approaches are well-known to those of skill in the art (see, for example, Mathew (ed.), Protocols in Human Molecular Genetics Humana Press, Inc., 1991; Coleman and Tsongalis, Molecular Dia~~nostics, Humana Press, Inc., 1996 and Elles, Molecular Diagnosis of Genetic Diseases, Humana Press, Inc., 1996).
The invention also provides anti-zsig49 antibodies. Antibodies to zsig49 can be obtained, for example, using as an antigen the product of a zsig49 expression vector, or zsig49 isolated from a natural source. Particularly useful anti-zsig49 antibodies "bind specifically" with zsig49. Antibodies are considered to be specifically binding if the antibodies bind to a zsig49 polypeptide, peptide or epitope with a binding affinity (Ka) of 106 M 1 or greater, preferably 10~ M 1 or greater, more preferably 108 M 1 or greater, and most preferably 109 M 1 or greater. The binding affinity of an antibody can be readily determined by one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard, Ann.
NY Acad. Sci. 51:660, 1949). Suitable antibodies include antibodies that bind with zsig49 in particular domains.
Anti-zsig49 antibodies can be produced using antigenic zsig49 epitope-bearing peptides and polypeptides. Antigenic epitope-bearing peptides and polypeptides of the present invention contain a sequence of at least nine, preferably between 15 to about 30 amino acids contained within SEQ ID NOs:2, 10 or 13. However, peptides or polypeptides comprising a larger portion of an amino acid sequence of the invention, containing from 30 to 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention, also are useful for inducing antibodies that bind with zsig49. It is desirable that the amino acid sequence of the epitope-bearing peptide is selected to provide substantial solubility in aqueous solvents (i.e., _ CA 02364330 2001-10-04 the sequence includes relatively hydrophilic residues, while hydrophobic residues are preferably avoided).
Moreover, amino acid sequences containing proline residues may be also be desirable for antibody production.
Polyclonal antibodies to recombinant zsig49 protein or to zsig49 isolated from natural sources can be prepared using methods well-known to those of skill in the art. See, for example, Green et al., "Production of Polyclonal Antisera," in Immunochemical Protocols (Manson, ed.), pages 1-5 (Humana Press 1992), and Williams et al., "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), page 15 (Oxford University Press 1995). The immunogenicity of a zsig49 polypeptide can be increased through the use of an adjuvant, such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant. Polypeptides useful for immunization also include fusion polypeptides, such as fusions of zsig49 or a portion thereof with an immunoglobulin polypeptide or with maltose binding protein. The polypeptide immunogen may be a full-length molecule or a portion thereof. If the polypeptide portion is "hapten-like," such portion may be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for immunization.
Although polyclonal antibodies are typically raised in animals such as horses, cows, dogs, chicken, rats, mice, rabbits, guinea pigs, hamsters, goats, or sheep, an anti-zsig49 antibody of the present invention may also be derived from a subhuman primate antibody.
General techniques for raising diagnostically and therapeutically useful antibodies in baboons may be found, for example, in Goldenberg et al., international patent publication No. WO 91/11465, and in Losman et al., Int. J.
Cancer 46:310, 1990. Antibodies can also be raised in _ CA 02364330 2001-10-04 transgenic animals such as transgenic sheep, cows, goats or pigs. Antibodies can also be expressed in yeast and fungi in modified forms as will as in mammalian and insect cells.
Alternatively, monoclonal anti-zsig49 antibodies can be generated. Rodent monoclonal antibodies to specific antigens may be obtained by methods known to those skilled in the art (see, for example, Kohler et al., Nature 256:495, 1975, Coligan et al. (eds.), Current Protocols in Immunoloay, Vol. 1, pages 2.5.1-2.6.7 (John Wiley & Sons 1991), Picksley et al., "Production of monoclonal antibodies against proteins expressed in E.
coli, " in DNA Clonina 2 : E~ression Systems, 2nd Edition, Glover et al. (eds.), page 93 (Oxford University Press 1995) ) .
Briefly, monoclonal antibodies can be obtained by injecting mice with a composition comprising a zsig49 gene product, verifying the presence of antibody production by removing a serum sample, removing the spleen to obtain B-lymphocytes, fusing the B-lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones which produce antibodies to the antigen, culturing the clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
In addition, an anti-zsig49 antibody of the present invention may be derived from a human monoclonal antibody. Human monoclonal antibodies are obtained from transgenic mice that have been engineered to produce specific human antibodies in response to antigenic challenge. In this technique, elements of the human heavy and light chain locus are introduced into strains of mice derived from embryonic stem cell lines that contain targeted disruptions of the endogenous heavy chain and light chain loci. The transgenic mice can synthesize human antibodies specific for human antigens, and the mice can be used to produce human antibody-secreting hybridomas.

Methods for obtaining human antibodies from transgenic mice are described, for example, by Green et al . , Nature Genet .
7:13, 1994, Lonberg et al., Nature 368:856, 1994, and Taylor et al., Int. Immun. 6:579, 1994.
Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography (see, for example, Coligan at pages 2.7.1-2.7.12 and pages 2.9.1-2.9.3; Baines et al., "Purification of Immunoglobulin G (IgG)," in Methods in Molecular Biology, Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to prepare fragments of anti-zsig49 antibodies. Such antibody fragments can be obtained, for example, by proteolytic hydrolysis of the antibody. Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. As an illustration, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab')z. This fragment can be further cleaved using a thiol reducing agent to produce 3.55 Fab' monovalent fragments. Optionally, the cleavage reaction can be performed using a blocking group for the sulfhydryl groups that result from cleavage of disulfide linkages.
As an alternative, an enzymatic cleavage using pepsin produces two monovalent Fab fragments and an Fc fragment directly. These methods are described, for example, by Goldenberg, U.S. patent No. 4,331,647, Nisonoff et al., Arch Biochem. Bio~hys. 89:230, 1960, Porter, Biochem. J.
73:119, 1959, Edelman et al., in Methods in Enzymology Vol. 1, page 422 (Academic Press 1967), and by Coligan, ibid.
Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
For example, Fv fragments comprise an 5 association of Vx and VL chains. This association can be noncovalent, as described by mbar et al., Proc. Nat.
Acad. Sci. USA 69:2659, 1972. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as gluteraldehyde (see, 10 for example, Sandhu, Crit. Rev. Biotech. 12:437, 1992).
The Fv fragments may comprise VH and VL chains which are connected by a peptide linker. These single-chain antigen binding proteins (scFv) are prepared by constructing a structural gene comprising DNA sequences 15 encoding the VH and VL domains which are connected by an oligonucleotide. The structural gene is inserted into an expression vector which is subsequently introduced into a host cell, such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker 20 peptide bridging the two V domains. Methods for producing scFvs are described, for example, by Whitlow et al., Methods: A Companion to Methods in Enzymoloay 2:97, 1991, also see, Bird et al., Science 242:423, 1988, Ladner et al., U.S. Patent No. 4,946,778, Pack et al., 25 Bio/Technoloay 11:1271, 1993, and Sandhu, supra.
As an illustration, a scFV can be obtained by exposing lymphocytes to zsig49 polypeptide in vitro, and selecting antibody display libraries in phage or similar vectors (for instance, through use of immobilized or 30 labeled zsig49 protein or peptide). Genes encoding polypeptides having potential zsig49 polypeptide binding domains can be obtained by screening random peptide libraries displayed on phage (phage display) or on bacteria, such as E. coli. Nucleotide sequences encoding 35 the polypeptides can be obtained in a number of ways, such as through random mutagenesis and random polynucleotide synthesis. These random peptide display libraries can be used to screen for peptides which interact with a known target which can be a protein or polypeptide, such as a ligand or receptor, a biological or synthetic macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide display libraries are known in the art (Ladner et al., U.S. Patent No. 5,223,409, Ladner et al., U.S. Patent No.
4,946,778, Ladner et al., U.S. Patent No. 5,403,484, Ladner et al., U.S. Patent No. 5,571,698, and Kay et al., Phaae Display of Peptides and Proteins (Academic Press, Inc. 1996)) and random peptide display libraries and kits for screening such libraries are available commercially, for instance from Clontech (Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New England Biolabs, Inc. (Beverly, MA), and Pharmacia LKB Biotechnology Inc. (Piscataway, NJ). Random peptide display libraries can be screened using the zsig49 sequences disclosed herein to identify proteins which bind to zsig49.
Another form of an antibody fragment is a peptide coding for a single complementarity-determining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells (see, for example, Larrick et al., Methods: A Companion to Methods in Enzymology 2:106, 1991), Courtenay-Luck, "Genetic Manipulation of Monoclonal Antibodies," in Monoclonal Antibodies: Production, Engineering and Clinical Application, Ritter et al.
(eds.), page 166 (Cambridge University Press 1995), and Ward et al., "Genetic Manipulation and Expression of Antibodies," in Monoclonal Antibodies: Principles and Applications, Birch et al., (eds.), page 137 (Wiley-Liss, Inc. 1995) ) .
Alternatively, an anti-zsig49 antibody may be derived from a "humanized" monoclonal antibody. Humanized monoclonal antibodies are produced by transferring mouse complementary determining regions from heavy and light variable chains of the mouse immunoglobulin into a human variable domain. Typical residues of human antibodies are then substituted in the framework regions of the murine counterparts. The use of antibody components derived from humanized monoclonal antibodies obviates potential problems associated with the immunogenicity of murine constant regions. General techniques for cloning murine immunoglobulin variable domains are described, for example, by Orlandi et al., Proc. Nat. Acad. Sci. USA
86:3833, 1989. Techniques for producing humanized monoclonal antibodies are described, for example, by Jones et al., Nature 321:522, 1986, Carter et al., Proc. Nat.
Acad. Sci. USA 89:4285, 1992, Sandhu, Crit. Rev. Biotech.
12:437, 1992, Singer et al., J. Immun. 150:2844, 1993, Sudhir (ed.), Antibody Enctineerinct Protocols (Humana Press, Inc. 1995), Kelley, "Engineering Therapeutic Antibodies," in Protein En~ineerinct: Principles and Practice, Cleland et al. (eds.), pages 399-434 (John Wiley & Sons, Inc. 1996), and by Queen et al., U.S. Patent No.
5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be prepared by immunizing animals with anti-zsig49 antibodies or antibody fragments, using standard techniques. See, for example, Green et al., "Production of Polyclonal Antisera," in Methods In Molecular Biology: Immunochemical Protocols, Manson (ed.), pages 1-12 (Humana Press 1992).
Also, see Coligan, ibid. at pages 2.4.1-2.4.7.
Alternatively, monoclonal anti-idiotype antibodies can be prepared using anti-zsig49 antibodies or antibody fragments as immunogens with the techniques, described above. As another alternative, humanized anti-idiotype antibodies or subhuman primate anti-idiotype antibodies can be prepared using the above-described techniques.
Methods for producing anti-idiotype antibodies are described, for example, by Irie, U.S. Patent No.

5,208,146, Greene, et. al., U.S. Patent No. 5,637,677, and Varthakavi and Minocha, J. Gen. Virol. 77:1875, 1996.
A variety of assays known to those skilled in the art can be utilized to detect antibodies and binding proteins which specifically bind to zsig49 proteins or peptides. Exemplary assays are described in detail in Antibodies: A Laboratory Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of such assays include: concurrent immunoelectrophoresis, radioimmunoassay, radioimmuno precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western blot assay, inhibition or competition assay, and sandwich assay. In addition, antibodies can be screened for binding to wild-type versus mutant zsig49 protein or peptide.
Antibodies to zsig49 may be used for tagging cells that express zsig49 polypeptide; for isolating zsig49 polypeptide by affinity purification; for diagnostic assays for determining circulating levels of zsig49 polypeptides; for detecting or quantitating soluble zsig49 polypeptide as marker of underlying pathology or disease;
in analytical methods employing FACS; for screening expression libraries; for generating anti-idiotypic antibodies; and as neutralizing antibodies or as antagonists to zsig49-associated activity in vitro and in vivo. Suitable direct tags or labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like; indirect tags or labels may feature use of biotin-avidin or other complement/anti-complement pairs as intermediates. Antibodies herein may also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in vivo diagnostic or therapeutic applications.
The present invention contemplates the use of anti-zsig49 antibodies to screen biological samples in vitro for the presence of zsig49. In one type of in vitro assay, anti-zsig49 antibodies are used in liquid phase.
For example, the presence of zsig49 in a biological sample can be tested by mixing the biological sample with a trace amount of labeled zsig49 and an anti-zsig49 antibody under conditions that promote binding between zsig49 and its antibody. Complexes of zsig49 and anti-zsig49 in the sample can be separated from the reaction mixture by contacting the complex with an immobilized protein which binds with the antibody, such as an Fc antibody or Staphylococcus protein A. The concentration of zsig49 in the biological sample will be inversely proportional to the amount of labeled zsig49 bound to the antibody and directly related to the amount of free labeled zsig49. Although rat or human anti-zsig49 antibodies can be used to detect zsig49, human anti-zsig49 antibodies are preferred for human diagnostic assays.
In vitro assays can also be performed in which anti-zsig49 antibody is bound to a solid-phase carrier.
For example, antibody can be attached to a polymer, such as aminodextran, in order to link the antibody to an insoluble support such as a polymer-coated bead, a plate or a tube.
Other suitable in vi tro assays will be readily apparent to those of skill in the art.
In another approach, anti-zsig49 antibodies can be used to detect zsig49 in tissue sections prepared from a biopsy specimen. Such immunochemical detection can be used to determine the relative abundance of zsig49 and to determine the distribution of zsig49 in the examined tissue. General immunochemistry techniques are well established (see, for example, Ponder, "Cell Marking Techniques and Their Application," in Mammalian Development: A Practical Approach, Monk (ed.), pages 115-38 (IRL Press 1987), Coligan at pages 5.8.1-5.8.8, Ausubel (1995) at pages 14.6.1 to 14.6.13 (Wiley Interscience 1990), and Manson (ed.), Methods In Molecular _ CA 02364330 2001-10-04 Biology, Vol. 10: Immunochemical Protocols (The Humana Press, Ins. 1992)).
Immunochemical detection can be performed by contacting a biological sample with an anti-zsig49 5 antibody, and then contacting the biological sample with a detestably labeled molecule which binds to the antibody.
For example, the detestably labeled molecule can comprise an antibody moiety that binds to anti-zsig49 antibody.
Alternatively, the anti-zsig49 antibody can be conjugated 10 with avidin/streptavidin (or biotin) and the detestably labeled molecule can comprise biotin (or avidin/streptavidin). Numerous variations of this basic technique are well-known to those of skill in the art.
Alternatively, an anti-zsig49 antibody can be 15 conjugated with a detectable label to form an anti-zsig49 immunoconjugate. Suitable detectable labels include, for example, a radioisotope, a fluorescent label, a chemiluminescent label, an enzyme label, a bioluminescent label or colloidal gold. Methods of making and detecting 20 such detestably-labeled immunoconjugates are well-known to those of ordinary skill in the art, and are described in more detail below.
The detectable label can be a radioisotope that is detected by autoradiography. Isotopes that are 25 particularly useful for the purpose of the present invention are 3H, 1251, 1311, 355, 14C, and the like.
Anti-zsig49 immunoconjugates can also be labeled with a fluorescent compound. The presence of a fluorescently-labeled antibody is determined by exposing 30 the immunoconjugate to light of the proper wavelength and detecting the resultant fluorescence. Fluorescent labeling compounds include fluorescein isothiosyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
35 Alternatively, anti-zsig49 immunoconjugates can be detestably labeled by coupling an antibody component to a chemiluminescent compound. The presence of the chemiluminescent-tagged immunoconjugate is determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of chemi-luminescent labeling compounds include luminol, isoluminol, an aromatic acridinium ester, an imidazole, an acridinium salt and an oxalate ester.
Similarly, a bioluminescent compound can be used to label anti-zsig49 immunoconjugates of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Bioluminescent compounds that are useful for labeling include luciferin, luciferase and aequorin.
Alternatively, anti-zsig49 immunoconjugates can be detestably labeled by linking an anti-zsig49 antibody component to an enzyme. When the anti-zsig49-enzyme conjugate is incubated in the presence of the appropriate substrate, the enzyme moiety reacts with the substrate to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or visual means. Examples of enzymes that can be used to detestably label polyspecific immunoconjugates include (3 galactosidase, glucose oxidase, peroxidase and alkaline phosphatase.
Those of skill in the art will know of other suitable labels which can be employed in accordance with the present invention. The binding of marker moieties to anti-ZSIG49 antibodies can be accomplished using standard techniques known to the art. Typical methodology in this regard is described by Kennedy et al., Clin. Chim. Acta 70:1, 1976), Schurs et al., Clin. Chim. Acta 81:1, 1977, Shih et al., Int. J. Cancer 46:1101, 1990, Stein et al., Cancer Res. 50:1330, 1990, and Coligan, su ra.
Moreover, the convenience and versatility of immunochemical detection can be enhanced by using anti-_ CA 02364330 2001-10-04 zsig49 antibodies that have been conjugated with avidin, streptavidin, and biotin (see, for example, Wilchek et al.
(eds.), "Avidin-Biotin Technology," Methods In Enzymoloay, Vol. 184 (Academic Press 1990), and Bayer et al., "Immunochemical Applications of Avidin-Biotin Technology,"
in Methods In Molecular Biology, Vol. 10, Manson (ed.), pages 149-162 (The Humana Press, Inc. 1992).
Methods for performing immunoassays are well established. See, for example, Cook and Self, "Monoclonal Antibodies in Diagnostic Immunoassays," in Monoclonal Antibodies: Production, Enaineerina, and Clinical Application, Ritter and Ladyman (eds.), pages 180-208, (Cambridge University Press, 1995), Perry, "The Role of Monoclonal Antibodies in the Advancement of Immunoassay Technology," in Monoclonal Antibodies: Principles and Applications, Birch and Lennox (eds.), pages 107-120 (Wiley-Liss, Inc. 1995), and Diamandis, Immunoassay (Academic Press, Inc. 1996). Suitable biological samples for detection of zsig49 protein include cells, tissues or bodily fluids, such as urine, saliva or blood.
In a related approach, biotin- or FITC-labeled anti-zsig49 antibodies can be used to identify cells that bind zsig49. Such can binding can be detected, for example, using flow cytometry.
The present invention also contemplates kits for performing an immunological diagnostic assay for zsig49 gene expression. Such kits comprise at least one container comprising an anti-zsig49 antibody, or antibody fragment. A kit may also comprise a second container comprising one or more reagents capable of indicating the presence of zsig49 antibody or antibody fragments.
Examples of such indicator reagents include detectable labels such as a radioactive label, a fluorescent label, a chemiluminescent label, an enzyme label, a bioluminescent label, colloidal gold, and the like. A kit may also comprise a means for conveying to the user that zsig49 antibodies or antibody fragments are used to detect zsig49 _ CA 02364330 2001-10-04 protein. For example, written instructions may state that the enclosed antibody or antibody fragment can be used to detect zsig49. The written material can be applied directly to a container, or the written material can be provided in the form of a packaging insert.
Molecules of the present invention can be used to identify and isolate receptors which bind zsig49. For example, proteins and peptides of the present invention can be immobilized on a column and membrane preparations run over the column (Immobilized Affinity Ligand Techniques, Hermanson et al., eds., Academic Press, San Diego, CA, 1992, pp.195-202). Proteins and peptides can also be radiolabeled (Methods in Enz~mol., vol. 182, "Guide to Protein Purification", Deutscher, ed., Acad.
Press, San Diego, 1990, 721-37) or photoaffinity labeled (Brunner et al., Ann. Rev. Biochem. 62:483-514, 1993 and Fedan et al., Biochem. Pharmacol. 33:1167-80, 1984) and specific cell-surface proteins can be identified.
For pharmaceutical use, pharmaceutically effective amounts of zsig49 therapeutic antibodies, small molecule antagonists or agonists of zsig49 polypeptides, or zsig49 polypeptide fragments can be formulated with pharmaceutically acceptable carriers for parenteral, oral, nasal, rectal, topical, transdermal administration or the like, according to conventional methods. Formulations may further include one or more diluents, fillers, emulsifiers, preservatives, buffers, excipients, and the like, and may be provided in such forms as liquids, powders, emulsions, suppositories, liposomes, transdermal patches and tablets, for example. Slow or extended-release delivery systems, including any of a number of biopolymers (biological-based systems), systems employing liposomes, and polymeric delivery systems, can also be utilized with the compositions described herein to provide a continuous or long-term source of the zsig49 polypeptide, agonist or antagonist. Such slow release systems are applicable to formulations, for example, for oral, topical and parenteral use. The term "pharmaceutically acceptable carrier or vehicle" refers to a carrier medium which does not interfere with the effectiveness of the biological activity of the active ingredients and which is not toxic to the host or patient.
One skilled in the art may formulate the compounds of the present invention in an appropriate manner, and in accordance with accepted practices, such as those disclosed in Remington: The Science and Practice of Pharmacv, Gennaro, ed., Mack Publishing Co., Easton, PA, 19th ed., 1995.
As used herein, a pharmaceutically effective amount of a zsig49 polypeptide, agonist or antagonist, is an amount sufficient to induce a desired biological result. The result can be alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an effective amount of a polypeptide of the present invention is that which provides either subjective relief of symptoms or an objectively identifiable improvement as noted by the clinician or other qualified observer. In particular, such an effective amount if administered to a patient suffering with diabetes, results in a decrease in glucose levels, prevention or significant delay of onset of disease or loss of islet infiltration in NOD mice or other beneficial effect. Doses of zsig49 polypeptide will generally be determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose is within the level of ordinary skill in the art. The proteins may be administered for acute treatment, over one week or less, often over a period of one to three days or may be used in chronic treatment, over several months or years.
Polynucleotides encoding zsig49 polypeptides are useful within gene therapy applications where it is desired to increase or inhibit zsig49 activity. If a mammal has a mutated or absent zsig49 gene, the zsig49 gene can be introduced into the cells of the mammal. In one embodiment, a gene encoding a zsig49 polypeptide is introduced in vivo in a viral vector. Such vectors 5 include an attenuated or defective DNA virus, such as, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses, which entirely or almost entirely lack viral 10 genes, are preferred. A defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Examples of particular vectors include, but 15 are not limited to, a defective herpes simplex virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al., J.
Clin. Invest. 90:626-30, 1992; and a defective adeno-20 associated virus vector (Samulski et al., J. Virol.
61:3096-101, 1987; Samulski et al., J. Virol. 63:3822-8, 1989) .
In another embodiment, a zsig49 gene can be introduced in a retroviral vector, e.g., as described in 25 Anderson et al., U.S. Patent No. 5,399,346; Mann et al.
Cell 33:153, 1983; Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
Markowitz et al., J. Virol. 62:1120, 1988; Temin et al., U.S. Patent No. 5,124,263; International Patent 30 Publication No. WO 95/07358, published March 16, 1995 by Dougherty et al.; and Kuo et al., Blood 82:845, 1993.
Alternatively, the vector can be introduced by lipofection in vivo using liposomes. Synthetic cationic lipids can be used to prepare liposomes for in vivo transfection of a 35 gene encoding a marker (Felgner et al., Proc. Natl. Acad.
Sci. USA 84:7413-7, 1987; Mackey et al., Proc. Natl. Acad.
Sci. USA 85:8027-31, 1988). The use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. More particularly, directing transfection to particular cells represents one area of benefit. For instance, directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids may be chemically coupled to other molecules for the purpose of targeting. Targeted peptides (e. g., hormones or neurotransmitters), proteins such as antibodies, or non-peptide molecules can be coupled to liposomes chemically.
It is possible to remove the target cells from the body; to introduce the vector as a naked DNA plasmid;
and then to re-implant the transformed cells into the body. Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun or use of a DNA vector transporter. See, e.g., Wu et al., J.
Biol. Chem. 267:963-7, 1992; Wu et al., J. Biol. Chem.
263:14621-4, 1988.
Antisense methodology can be used to inhibit zsig49 gene translation, such as to inhibit cell proliferation in vivo. Polynucleotides that are complementary to a segment of a zsig49-encoding polynucleotide (e.g., a polynucleotide as set froth in SEQ
ID NOs:l, 9 or 12) are designed to bind to zsig49-encoding mRNA and to inhibit translation of such mRNA. Such antisense polynucleotides are used to inhibit expression of zsig49 polypeptide-encoding genes in cell culture or in a subject.
Transgenic mice, engineered to express the zsig49 gene, and mice that exhibit a complete absence of zsig49 gene function, referred to as "knockout mice"

(Snouwaert et al., Science 257:1083, 1992), may also be generated (Lowell et al., Nature 366:740-42, 1993). These mice may be employed to study the zsig49 gene and the protein encoded thereby in an in vivo system.
The invention is further illustrated by the following non-limiting examples.

EXAMPLES
Example 1 Identification of zsig~49 cDNA Sequence The novel zsig49 polypeptide-encoding polynucleotides of the present invention were initially identified by querying an EST database for secretory signal sequences characterized by an upstream methionine start site, a hydrophobic region of approximately 13 amino acids and a cleavage site (SEQ ID N0:3, wherein cleavage occurs between the alanine and glycine amino acid residues) in an effort to select for secreted proteins.
Polypeptides corresponding to ESTs meeting those search criteria were compared to known sequences to identify secreted proteins having homology to known ligands. One EST sequence was discovered and determined to be novel.
The EST sequence was from an islet cell library. To identify the corresponding cDNA, a clone considered likely to contain the entire coding sequence was used for sequencing. Using an Invitrogen S.N.A.P.TM Miniprep kit (Invitrogen, Corp., San Diego, CA) according to manufacturer's instructions a 5 ml overnight culture in LB
+ 50 ~g/ml ampicillin was prepared. The template was sequenced on an ABIPRISM TM model 377 DNA sequencer (Perkin-Elmer Cetus, Norwalk, Ct.) using the ABI PRISMTM
Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corp.) according to manufacturer's instructions. Sequencing reactions were carried out in a Hybaid OmniGene Temperature Cycling System (National Labnet Co., Woodbridge, NY). SEQUENCHERTM 3.1 sequence analysis software (Gene Codes Corporation, Ann Arbor, MI) was used for data analysis. The resulting 952 by sequence is disclosed in SEQ ID NO: 1.
Example 2 _ CA 02364330 2001-10-04 Tissue Distribution Northerns were performed using Human Multiple Tissue Blots from Clontech (Palo Alto, CA). An approximately 120 by probe (SEQ ID N0:5) was amplified from the clone described above in Example 1.
Oligonucleotide primers ZC14887 (SEQ ID N0:5) and ZC16136 (SEQ ID N0:6) were used to amplify the probe sequence in a polymerase chain reaction as follows: 1 cycle at 95°C for 1 minute; 35 cycles of 95°C for 30 seconds, 50oC for 30 seconds and 72°C for 30 seconds, followed by a 2 minute extension at 72°C. The resulting DNA fragment was electrophoresed on a to agarose gel (SEA PLAQUE GTG low melt agarose, FMC Corp., Rockland, ME), the fragment was purified using the QIAquickT"' method (Qiagen, Chatsworth, CA). The DNA probe was radioactively labeled with3zP using REDIPRIME~ DNA labeling system (Amersham, Arlington Heights, Illinois) according to the manufacturer's specifications. The probe was purified using a NUCTRAP
push column (Stratagene Cloning Systems, La Jolla, CA).
EXPRESSHYB (Clontech, Palo Alto, CA) solution was used for prehybridization and as a hybridizing solution for the Northern blots. Hybridization took place overnight at 65°C, and the blots were then washed in 2X SSC and 0.1% SDS
at room temperature, followed by two washes in O.1X SSC
and 0.1o SDS at 55°C and exposed to film for 48 hours.
There are two major transcripts at about 2 kb and 5 kb.
While the 2 kb transcript is the major transcript in testis, the 5 kb transcript is the major transcript in the other tissues including pancreas, liver, stomach and thyroid. Signal intensity was highest for testis, with relatively less intense signals in liver, thyroid and stomach, and weak signals in small intestine, spleen, prostate, thymus, spinal cord, trachea and lymph node.
A RNA Master Dot Blot (Clontech) that contained RNAs from various tissues that were normalized to 8 housekeeping genes was also probed with the 120 by probe (SEQ ID N0:5) described above. The blot was prehybridized, hybridized and washed as described above.
After a 48 hour exposure, highest expression was seen in the pancreas, with strong expression in testis and stomach. A lower level of expression was seen in liver, pituitary gland, thyroid gland and salivary gland. A
weaker signal was detected in adrenal gland, small intestine, trachea, spleen, thymus, peripheral leukocyte, lymph node and in fetal tissues.
Example 3 Chromosomal Assignment and Placement of Zsig49 Zsig49 was mapped to chromosome 1 using the both the commercially available GeneBridge 4 Radiation Hybrid Panel and Stanford G3 Radiation Hybrid (RH) panel (Research Genetics, Inc., Huntsville, AL). The GeneBridge 4 Radiation Hybrid Panel contains PCRable DNAs from each of 93 radiation hybrid clones, plus two control DNAs (the HFL donor and the A23 recipient), while the Stanford G3 RH
panel contained PCRable DNAs from each of 83 radiation hybrid clones, plus two control DNAs (the RM donor and the A3 recipient). Publicly available WWW servers (http://carbon.wi.mit.edu:8000/cgi-bin/contig/rhmapper.pl) and (http://shgc-www.stanford.edu/RH/rhserverformnew.html) allowed chromosomal localization in relationship to the respective chromosomal frame work markers.
For the mapping of zsig49 with the GeneBridge 4 RH Panel and Stanford G3 RH panels, 20 ~l reactions were set up in a 96-well microtiter plate (Stratagene, La Jolla, CA) and used in a "RoboCycler Gradient 96" thermal cycler (Stratagene). Each of the 95 PCR reactions consisted of 2 ~,1 10X KlenTaq PCR reaction buffer (Clontech), 1.6 ~.l dNTPs mix (2.5 mM each, PERKIN-ELMER, Foster City, CA), 1 ~C1 sense primer, ZC 16,080 (SEQ ID
N0:7) , 1 ~,l antisense primer, ZC 16, 079 (SEQ ID N0:8) , 2 ~,1 RediLoad (Research Genetics, Inc.), 0.4 ~1 50X
Advantage KlenTaq Polymerase Mix (Clontech), 25 ng of DNA
from an individual hybrid clone or control and ddH20 for a total volume of 20 ~1. The reactions were overlaid with an equal amount of mineral oil and sealed. The PCR cycler conditions were as follows: an initial 1 cycle 5 minute denaturation at 95°C, 35 cycles of a 1 minute denaturation at 95°C, 1 minute annealing at 66°C and 1.5 minute extension at 72°C, followed by a final 1 cycle extension of 7 minutes at 72°C. The reactions were separated by electrophoresis on a 2% agarose gel (Life Technologies, Gaithersburg, MD).
The results of the radiation hybrid mapping showed that zsig49 maps 9.76 cR_3000 distal of the marker D1S2635 on the GeneBridge 4 RH mapping panel and 62 cR 10,000 distal of the marker SHGC-6232 on the Stanford G3 RH panel. Proximal and distal framework markers were D1S2635 and CHLC.GATA70D01, respectively. The use of surrounding markers positions zsig49 in the 1q24.1 region on the integrated LDB chromosome 1 map (The Genetic Location Database, University of Southhampton, WWW server:
http://cedar.genetics. soton.ac.uk/public html/).
In an autosomal genomic scan for loci linked to type II diabetes mellitus and body-mass index in Pima Indians (Hanson et al., Am. J. Hum. Genet. 63:1130-8, 1998) a potential diabetes-susceptibility locus was identified on chromosome lq near the marker D1S1677. We mapped D1S1677 on the Stanford G3 RH panel using similar conditions as described above for zsig49 and found it to map only 5 cR 10,000 (1 cR 10,000 - "'25 kb) proximal to zsig49, making zsig49 a positional gene candidate for type II diabetes mellitus locus.

Example 4 Murine Zsig49 Ortholoa The DNA sequence of human zsig49 (SEQ ID NO: l) described above was used to search for murine orthologs.
A clone considered likely to contain a murine ortholog was sequenced and an alignment with human zsig49 (SEQ ID NO: l) indicated that the murine sequence was missing about 42 by at 5'end. Two 5'RACE primers ZC24781 (SEQ ID N0:23) and ZC24785 (SEQ ID N0:24) were designed according to murine sequence. To a final volume of 25 ~l was added 3 ~.1 of 1/100 diluted marathon stomach or small intestine cDNA as a template, 20 pmoles each of oligonucleotide primers ZC9739 and ZC24785, and 1 U of ExTaq/Taq antibody(1:1).
The 5' RACE reactions were run as follows: 94°C for 2 minutes, followed by 5 cycles (94°C for 20 seconds, 65°C
for 30 seconds, 72°C for 30 seconds) followed by 30 cycles (94°C for 20 seconds, 64°C for 30 seconds; 72°C for 30 seconds) followed by a 2 minute extension at 72°C. A second round, nested PCR was then performed. To a final volume of 25 ~1 was added 1 ~.1 of 1/50 diluted first PCR product as template, 20 pmoles each of oligonucleotide primers ZC9719 (SEQ ID N0:18) and ZC24781 (SEQ ID N0:23) and 1 U
of ExTaq/Taq antibody (1:1). The reactions were run as follows: 94°C for 2 minutes, followed by 5 cycles (94°C for 20 seconds, 65°C for 30 seconds, 72°C for 30 seconds) followed by 35 cycles (94°C for 20 seconds, 64°C for 30 seconds, 72°C and 30 seconds) followed by a 2 minutes extension at 72°C. The second round nested PCR products were purified and sequenced as described above. Comparison of the murine DNA sequence (SEQ ID N0:12) with the human zsig49 DNA sequence (SEQ ID N0:1) indicated that the human sequence differed from the murine sequence by about 17 by from the 5' end encoding the start Met.

Example 5 Extension of Human Zsia49 cDNA Sequence The alignment of the murine and human DNA
sequences indicated that the human sequence could be extended further in the 3' direction. A series of 3'RACE
PCRs were carried out and extending the human cDNA
sequence to 1704 by (SEQ ID N0:9).
3' RACE primers ZC24645 (SEQ ID N0:15) and ZC24646 (SEQ ID N0:16) were designed according to the human zsig49 sequence described by SEQ ID NO:1. To a final volume of 25 ~1 was added 3 ~l of a 1/100 dilution of one of the following marathon cDNAs (human adrenal gland, fetal liver, islet, pancreas, stomach, small intestine and testis) as a template, 20 pmoles each of oligonucleotide primers ZC9739 (SEQ ID N0:17) and ZC24645 (SEQ ID N0:15), and 1 U of ExTaq/Taq antibody(l:l). The reactions were run as follows: 94°C for 2 minutes, followed by 5 cycles (94°C for 20 seconds, 67°C for 1 minute) followed by 35 cycles (94°C for 20 seconds, 64°C for 30 seconds; 72°C for 1 minute) followed by a 5 minutes extension at 72°C. To 25 ~,l of a second round, nested PCR
reaction was added 1 ~l each of a 1/50 diluted first round PCR product as template, 20 pmoles each of oligonucleotide primers ZC9719 (SEQ ID N0:18) and ZC24646 (SEQ ID N0:16) and 1 U of ExTaq/Taq antibody(1:1). The reactions were run as follows: 94°C for 2 minutes, followed by 5 cycles (94°C
for 20 seconds; 69°C for 1 minute) ; followed by 35 cycles (94°C for 20 seconds, 64°C for 30 seconds; 69°C for 1 minute) followed by a 5 minutes extension at 69°C. The second round, nested PCR products were separated on an agarose gel and purified with Qiaquick (Qiagen) gel purification kit. Purified PCR products generated from the small intestine and stomach templates were sequenced as described above. Sequence indicating the PCR product extended and diverged from original zsig49 clone at nucleotide 389 of SEQ ID N0:1 and continued for about 400 by before hitting an intron.
Three additional rounds of 3' RACE were performed as described above using primers ZC24780 (SEQ ID
N0:19), ZC24779 (SEQ ID N0:20), ZC24965 (SEQ ID N0:21), and ZC25142 (SEQ ID N0:22) designed from newly extended sequence. Marathon cDNA from stomach and small intestine was used as a template. Sequencing of the resulting PCR
products was done as described above. The resulting 1,704 by sequence is disclosed in SEQ ID N0:9 which contains a polynucleotide sequence that encodes the polypeptide of SEQ ID N0:2.
From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

SEQUENCE LISTING
<110> ZymoGenetics. Inc.
<120> SECRETED PROTEIN ZSIG49 <130> 98-30PC
<150> 09/176,545 <151> 1998-10-21 <160> 24 <170> FastSEQ for Windows Version 3.0 <210>1 <211>952 <212>DNA

<213>Homo Sapiens <220>
<221> CDS
<222> (158)...(388) <400> 1 ttggggaaag agtcgcctgc ctccggaccg gagtgcagac ctctgaccct ggagtcgctc 60 ggccgctggg aaccgtcccc ttgggtcgtc gcctgggccg cccgtcgttc cccggccccg 120 aggggtccgg ctggccgcgg tgtgggtaga ggtcagc atg agc caa ggg gtc cgc 175 Met Ser Gln Gly Val Arg cgg gca ggc get ggg cag ggg gta gcg gcc gcg gtg cag ctg ctg gtc 223 Arg Ala Gly Ala Gly Gln Gly Val Ala Ala Ala Val Gln Leu Leu Val acc ctg agc ttc ctg cgg agc gtc gtc gag gcg cag gtc act gga gtt 271 Thr Leu Ser Phe Leu Arg Ser Val Val Glu Ala Gln Val Thr Gly Val ctg gat gat tgc ttg tgt gat att gac age atc gat aac ttc aat acc 319 Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Asn Phe Asn Thr tac aaa atc ttc ccc aaa ata aaa aaa ttg caa gag aga gac tat ttt 367 Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe cgt tat tac aag gta agg ttg taatttttta ttctgttgat atcaaaggtt 418 Arg Tyr Tyr Lys Ual Arg Leu tatatgtgacctttatgatccttttgaaagcccatttcagttcctctcagcaccttgtgt 478 atatctttcatcactgaatttattatgtattgcagtggaaacctattgatctttttaaac 538 agtacaaatcttagcccccttcctttgtatggggagttcctcatttttcagttttggttt 598 ttaggcagagactactgtctctatagaagctgaaaatgccacagacttactttgtcagcc 658 tctcttataacatagttctgccatctggacacacctactcagcctttgagttgtgctgat 718 gtcagtgtgctagcattgttagtggaaaggaccacagcagcatctttgttggacctcttt 778 ctgagagggctggcaaaacaggctgaggctccaagtagaccactaccgacagtgatgctc 838 cagaattggttcttaaatctagtaatagtctactctagacctttacaaaataaccggtga 898 tactttaaaggcagcgagtccctgcaacagcaataaacttccttctcctcggga 952 <210>2 <211>77 <212>PRT

<213>Homo sapiens <400> 2 Met Ser Gln Gly Val Arg Arg Ala Gly Ala Gly Gln Gly Val Ala Ala Ala Val Gln Leu Leu Val Thr Leu Ser Phe Leu Arg Ser Val Val Glu Ala Gln Val Thr Gly Val Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Asn Phe Asn Thr Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe Arg Tyr Tyr Lys Val Arg Leu <210> 3 <211> 15 <212> PRT
<213> Artificial Sequence <220>
<223> Cleavage site <400> 3 Leu Leu Thr Leu Ala Leu Leu Gly Gly Pro Thr Trp Ala Gly Lys _. CA 02364330 2001-10-04 <210> 4 <211> 231 <212> DNA
<213> Artificial Sequence <220>
<223> Degenerate nucleotide sequence encoding the zsig49 polypeptide of SEQ ID N0:2.
<221> variation <222> (1)...(231) <223> Each N is independently any nucleotide.
<400> 4 atgwsncarg gngtnmgnmg ngcnggngcn ggncarggng tngcngcngc ngtncarytn 60 ytngtnacny tnwsnttyyt nmgnwsngtn gtngargcnc argtnacngg ngtnytngay 120 gaytgyytnt gygayathga ywsnathgay aayttyaaya cntayaarat httyccnaar 180 athaaraary tncargarmg ngaytaytty mgntaytaya argtnmgnyt n 231 <210> 5 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC14887 <400> 5 tcgatgctgt caatatcaca ca 22 <210> 6 <211> 48 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC16136 <400> 6 tgtgggtata agtcagcatg agccaagggg tccgccgggc aggcgctg 48 <210> 7 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC16080 <400> 7 aggggtgcag gtggtaga 18 <210> 8 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC16079 <400> 8 tcccgaacag ccatcatt 18 <210>9 <211>1704 <212>DNA

<213>Homo sapiens <220>
<221> CDS
<222> (167)...(1567) <400> 9 ggcacgaggt tggggaaaga gtcgcctgcc tccggaccgg agtgcagacc tctgaccctg 60 gagtcgctcg gccgctggga accgtcccct tgggtcgtcg cctgggccgc ccgtcgttcc 120 ccggccccga ggggtccggc tggccgcggt gtgggtagag gtcagc atg agc caa 175 Met Ser Gln ggg gtc cgc cgg gca ggc get ggg cag ggg gta gcg gcc gcg gtg cag 223 Gly Val Arg Arg Ala Gly Ala Gly Gln Gly Val Ala Ala Ala Val Gln ctg ctg gtc acc ctg agc ttc ctg cgg agc gtc gtc gag gcg cag gtc 271 Leu Leu Ual Thr Leu Ser Phe Leu Arg Ser Val Val Glu Ala Gln Val act gga gtt ctg gat gat tgc ttg tgt gat att gac agc atc gat aac 319 _. CA 02364330 2001-10-04 Thr Gly Val Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Asn ttc aat acc tac aaa atc ttc ccc aaa ata aaa aaa ttg caa gag aga 367 Phe Asn Thr Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg gac tat ttt cgt tat tac aag gtt aat ctg aag cga cct tgt cct ttc 415 Asp Tyr Phe Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe tgg gca gaa gat ggc cac tgt tca ata aaa gac tgt cat gtg gag ccc 463 Trp Ala Glu Asp Gly His Cys Ser Ile Lys Asp Cys His Val Glu Pro tgt cca gag agt aaa att ccg gtt gga ata aaa get ggg cat tct aat 511 Cys Pro Glu Ser Lys Ile Pro Val Gly Ile Lys Ala Gly His Ser Asn aag tac ttg aaa atg gca aac aat acc aaa gaa tta gaa gat tgt gag 559 Lys Tyr Leu Lys Met Ala Asn Asn Thr Lys Glu Leu Glu Asp Cys Glu caa get aat aaa ctg gga gca att aac agc aca tta agt aat caa agc 607 Gln Ala Asn Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser Asn Gln Ser aaa gaa get ttc att gac tgg gca aga tat gat gat tca cgg gat cac 655 Lys Glu Ala Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Arg Asp His ttt tgt gaa ctt gat gat gag aga tct cca get get cag tat gta gac 703 Phe Cys Glu Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Val Asp cta ttg ctg aac cca gag cgt tac act ggc tat aaa ggg acc tct gca 751 Leu Leu Leu Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Thr Ser Ala tgg aga gtg tgg aac agc atc tat gaa gag aac tgt ttc aag cct cga 799 Trp Arg Val Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg tct gtt tat cgt cct tta aat cct ctg gcg cct agc cga ggc gaa gat 847 Ser Val Tyr Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp gat gga gaa tca ttc tac aca tgg cta gaa ggt ttg tgt ctg gag aaa 895 Asp Gly Glu Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys aga gtc ttc tat aag ctt ata tcg gga ctt cat get agc atc aat tta 943 Arg Val Phe Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu cat cta tgc gca aat tat ctt ttg gaa gaa acc tgg ggt aag ccc agt 991 His Leu Cys Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser tgg gga cct aat att aaa gaa ttc aaa cac cgc ttt gac cct gtg gaa 1039 Trp Gly Pro Asn Ile Lys Glu Phe Lys His Arg Phe Asp Pro Val Glu acc aag gga gaa ggt cca aga agg ctc aag aat ctt tac ttt tta tac 1087 Thr Lys Gly Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr ttg att gag ctt cga get ttg tca aag gtg get cca tat ttt gag cgc 1135 Leu Ile Glu Leu Arg Ala Leu Ser Lys Val Ala Pro Tyr Phe Glu Arg tca att gtc gat ctt tac act gga aat gca gaa gaa gat get gac aca 1183 Ser Ile Val Asp Leu Tyr Thr Gly Asn Ala Glu Glu Asp Ala Asp Thr aaa act ctt cta ctg aat atc ttt caa gat aca aag tcc ttt ccc atg 1231 Lys Thr Leu Leu Leu Asn Ile Phe Gln Asp Thr Lys Ser Phe Pro Met cac ttt gat gag aaa tcc atg ttt gca ggt gac aaa aaa ggg gcc aag 1279 His Phe Asp Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys tca cta aag gag gaa ttc cga tta cat ttc aag aat atc tcc cgt ata 1327 Ser Leu Lys Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile atg gac tgt gtt gga tgt gac aaa tgc aga tta tgg gga aaa tta cag 1375 Met Asp Cys Ual Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln act cag ggt tta gga act gcc ctg aag ata tta ttc tct gaa aaa gaa 1423 Thr Gln Gly Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu atc caa aag ctt cca gag aat agt cca tct aaa ggc ttc caa ctc acc 1471 Ile Gln Lys Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr cga cag gaa ata gtt get ctt tta aat get ttt gga agg ctt tct aca 1519 Arg Gln Glu Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr agt ata aga gac tta cag aat ttt aaa gtc tta tta caa cac agt agg 1567 Ser Ile Arg Asp Leu Gln Asn Phe Lys Val Leu Leu Gln His Ser Arg taataaaggc ttttatgtgt ctaactagag acataaagtg actgtggaaa gccttttaat 1627 tatggacatt catcagaaag acactaatct gacttcaaga attctgaact attaaataga 1687 aaatttaaat gctcaac 1704 <210>10 <211>467 <212>PRT

<213>Homo sapiens <400> 10 Met Ser Gln Gly Val Arg Arg Ala Gly Ala Gly Gln Gly Val Ala Ala Ala Val Gln Leu Leu Val Thr Leu Ser Phe Leu Arg Ser Ual Val Glu Ala Gln Val Thr Gly Ual Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Asn Phe Asn Thr Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe Trp Ala Glu Asp Gly His Cys Ser Ile Lys Asp Cys His Ual Glu Pro Cys Pro Glu Ser Lys Ile Pro Val Gly Ile Lys Ala Gly His Ser Asn Lys Tyr Leu Lys Met Ala Asn Asn Thr Lys Glu Leu Glu Asp Cys Glu Gln Ala Asn Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser _ CA 02364330 2001-10-04 Asn Gln Ser Lys Glu Ala Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Arg Asp His Phe Cys Glu Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Val Asp Leu Leu Leu Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Thr Ser Ala Trp Arg Val Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg Ser Val Tyr Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp Asp Gly Glu Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys Arg Val Phe Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu His Leu Cys Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser Trp Gly Pro Asn Ile Lys Glu Phe Lys His Arg Phe Asp Pro Val Glu Thr Lys Gly Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr Leu Ile Glu Leu Arg Ala Leu Ser Lys Val Ala Pro Tyr Phe Glu Arg Ser Ile Val Asp Leu Tyr Thr Gly Asn Ala Glu Glu Asp Ala Asp Thr Lys Thr Leu Leu Leu Asn Ile Phe Gln Asp Thr Lys Ser Phe Pro Met His Phe Asp Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys Ser Leu Lys Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile Met Asp Cys Val Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln Thr Gln Gly Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu Ile Gln Lys Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr Arg Gln Glu Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr Ser Ile Arg Asp Leu Gln Asn Phe Lys Val Leu Leu Gln His Ser Arg <210> 11 <211> 1401 <212> DNA
<213> Artificial Sequence <220>
<223> Degenerate polynucleotide encoding the polypeptide of SEQ ID N0:10 <221> variation <222> (1)...(1401) <223> Each N is independently T, A, G, or C.
<400> 11 atgwsncarggngtnmgnmgngcnggngcnggncarggngtngcngcngcngtncarytn60 ytngtnacnytnwsnttyytnmgnwsngtngtngargcncargtnacnggngtnytngay120 gaytgyytntgygayathgaywsnathgayaayttyaayacntayaarathttyccnaar180 athaaraarytncargarmgngaytayttymgntaytayaargtnaayytnaarmgnccn240 tgyccnttytgggcngargayggncaytgywsnathaargaytgycaygtngarccntgy300 ccngarwsnaarathccngtnggnathaargcnggncaywsnaayaartayytnaaratg360 gcnaayaayacnaargarytngargaytgygarcargcnaayaarytnggngcnathaay420 wsnacnytnwsnaaycarwsnaargargcnttyathgaytgggcnmgntaygaygaywsn480 mgngaycayttytgygarytngaygaygarmgnwsnccngcngcncartaygtngayytn540 ytnytnaayccngarmgntayacnggntayaarggnacnwsngcntggmgngtntggaay600 wsnathtaygargaraaytgyttyaarccnmgnwsngtntaymgnccnytnaayccnytn660 gcnccnwsnmgnggngargaygayggngarwsnttytayacntggytngarggnytntgy720 ytngaraarmgngtnttytayaarytnathwsnggnytncaygcnwsnathaayytncay780 ytntgygcnaaytayytnytngargaracntggggnaarccnwsntggggnccnaayath840 aargarttyaarcaymgnttygayccngtngaracnaarggngarggnccnmgnmgnytn900 aaraayytntayttyytntayytnathgarytnmgngcnytnwsnaargtngcnccntay960 ttygarmgnwsnathgtngayytntayacnggnaaygcngargargaygcngayacnaar1020 acnytnytnytnaayathttycargayacnaarwsnttyccnatgcayttygaygaraar1080 wsnatgttygcnggngayaaraarggngcnaarwsnytnaargargarttymgnytncay1140 ttyaaraayathwsnmgnathatggaytgygtnggntgygayaartgymgnytntggggn1200 aarytncaracncarggnytnggnacngcnytnaarathytnttywsngaraargarath1260 caraarytnccngaraaywsnccnwsnaarggnttycarytnacnmgncargarathgtn1320 gcnytnytnaaygcnttyggnmgnytnwsnacnwsnathmgngayytncaraayttyaar1380 gtnytnytncarcaywsnmgn 1401 <210>12 <211>1584 <212>DNA

<213>Mus musculus <220>
<221> CDS
<222> (1)...(1383) <400> 12 cgg gcc gtt act ggg cag ggg gcg gcg gcc gcg gtg caa ctg ctt gtc 48 Arg Ala Ual Thr Gly Gln Gly Ala Ala Ala Ala Val Gln Leu Leu Val acc ctg agc ttc ctc tca agt ctg gtc aag act cag gtg act gga gtt 96 Thr Leu Ser Phe Leu Ser Ser Leu Val Lys Thr Gln Val Thr Gly Val ctg gat gat tgc tta tgt gac att gac agc att gat aaa ttc aac acc 144 Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Lys Phe Asn Thr tac aaa atc ttt ccc aaa ata aag aag tta caa gaa cga gac tat ttt 192 Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe cgt tat tac aag gtt aat ctg aaa cga cca tgt cct ttc tgg gca gaa 240 Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe Trp Ala Glu gat ggc cac tgc tca ata aaa gac tgt cat gtg gag ccc tgt cca gaa 288 Asp Gly His Cys Ser Ile Lys Asp Cys His Val Glu Pro Cys Pro Glu agt aaa att cca gtt gga att aaa gcc ggg cgt tca aat aag tac tcg 336 Ser Lys Ile Pro Val Gly Ile Lys Ala Gly Arg Ser Asn Lys Tyr Ser caa gca gca aac agc acc aaa gaa ctg gat gac tgt gag cag get aac 384 Gln Ala Ala Asn Ser Thr Lys Glu Leu Asp Asp Cys Glu Gln Ala Asn aaa ctg ggc gcc atc aac agc acg cta agt aac gaa agc aaa gaa gcg 432 Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser Asn Glu Ser Lys Glu Ala ttc att gac tgg gcg aga tat gat gat tcg cag gac cac ttt tgt gaa 480 Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Gln Asp His Phe Cys Glu ctt gat gat gag cgg tct cct get gca cag tat gtg gac ctg ctg ctg 528 Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Val Asp Leu Leu Leu aac ccg gaa cgg tac act ggc tac aag ggc tcc tca gca tgg agg gtg 576 Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Ser Ser Ala Trp Arg Val tgg aac agc atc tat gaa gaa aac tgc ttc aag cct cga tct gtt tat 624 Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg Ser Val Tyr cgt cct tta aat cct ttg gcg ccc agc aga ggg gaa gat gat gga gaa 672 Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp Asp Gly Glu tca ttc tat acg tgg cta gaa ggt ttg tgt ctt gag aaa aga gtc ttc 720 Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys Arg Val Phe tat aag ctt ata tca gga ctc cat gcc agc atc aat tta cat ctg tgt 768 Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu His Leu Cys gca aac tac ctt ctg gaa gaa acc tgg ggg aaa cct agt tgg gga cca 816 Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser Trp Gly Pro aac atc aag gag ttt aga cgc cgc ttt gac cct gtg gaa aca aag ggg 864 Asn Ile Lys Glu Phe Arg Arg Arg Phe Asp Pro Val Glu Thr Lys Gly gaa ggt cca agg agg cta aag aac ctg tac ttt tta tac ttg ata gag 912 Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr Leu Ile Glu ctc cgt get ttg tca aag gtg gcc cct tac ttt gag cgc tcg att gtt 960 Leu Arg Ala Leu Ser Lys Ual Ala Pro Tyr Phe Glu Arg Ser Ile Val gat ctc tat act ggc aat gtg gaa gat gat gcc gac acc aag acc ctt 1008 Asp Leu Tyr Thr Gly Asn Val Glu Asp Asp Ala Asp Thr Lys Thr Leu ctg ctc agc atc ttt cag gat aca aag tcc ttt cct atg cac ttc gat 1056 Leu Leu Ser Ile Phe Gln Asp Thr Lys Ser Phe Pro Met His Phe Asp _ CA 02364330 2001-10-04 gag aaa tcc atg ttt gca ggt gac aaa aag ggg gcc aag tca tta aag 1104 Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys Ser Leu Lys gaa gaa ttc cgg tta cat ttc aag aac atc tcc cgg atc atg gac tgt 1152 Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile Met Asp Cys gtt ggg tgc gat aaa tgc aga ctg tgg ggg aaa ctg cag act cag ggt 1200 Val Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln Thr Gln Gly tta gga act gcc ttg aag atc ctc ttc tct gaa aag gaa atc caa aac 1248 Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu Ile Gln Asn ctt ccg gag aac agc cca tcc aaa ggc ttc cag ctc act cgg cag gaa 1296 Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr Arg Gln Glu atc gtt get ctt tta aat get ttt gga aga ctt tct aca agc ata aga 1344 Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr Ser Ile Arg gaa tta cag aac ttt aaa gcg ttg ttg cag cac agg agg taatgaagac 1393 Glu Leu Gln Asn Phe Lys Ala Leu Leu Gln His Arg Arg ttttctatgt cttcatagac atagcagact gtatgaagcc ttttagcctt ggacactggg 1453 caaagagact acatgtctaa gacttcaaga attctgaact ctttaagaga aaattcaaat 1513 gtccacttga atatttatga tctttaatag aataccaatt agagatattt ataaatcctc 1573 gtgccgaatt c <210>13 <211>461 <212>PRT

<213>Mus musculus <400> 13 Arg.Ala Val Thr Gly Gln Gly Ala Ala Ala Ala Ual Gln Leu Leu Val Thr Leu Ser Phe Leu Ser Ser Leu Val Lys Thr Gln Val Thr Gly Val Leu Asp Asp Cys Leu Cys Asp Ile Asp Ser Ile Asp Lys Phe Asn Thr _ CA 02364330 2001-10-04 Tyr Lys Ile Phe Pro Lys Ile Lys Lys Leu Gln Glu Arg Asp Tyr Phe Arg Tyr Tyr Lys Val Asn Leu Lys Arg Pro Cys Pro Phe Trp Ala Glu Asp Gly His Cys Ser Ile Lys Asp Cys His Val Glu Pro Cys Pro Glu Ser Lys Ile Pro Val Gly Ile Lys Ala Gly Arg Ser Asn Lys Tyr Ser Gln Ala Ala Asn Ser Thr Lys Glu Leu Asp Asp Cys Glu Gln Ala Asn Lys Leu Gly Ala Ile Asn Ser Thr Leu Ser Asn Glu Ser Lys Glu Ala Phe Ile Asp Trp Ala Arg Tyr Asp Asp Ser Gln Asp His Phe Cys Glu Leu Asp Asp Glu Arg Ser Pro Ala Ala Gln Tyr Ual Asp Leu Leu Leu Asn Pro Glu Arg Tyr Thr Gly Tyr Lys Gly Ser Ser Ala Trp Arg Val Trp Asn Ser Ile Tyr Glu Glu Asn Cys Phe Lys Pro Arg Ser Val Tyr Arg Pro Leu Asn Pro Leu Ala Pro Ser Arg Gly Glu Asp Asp Gly Glu Ser Phe Tyr Thr Trp Leu Glu Gly Leu Cys Leu Glu Lys Arg Val Phe Tyr Lys Leu Ile Ser Gly Leu His Ala Ser Ile Asn Leu His Leu Cys Ala Asn Tyr Leu Leu Glu Glu Thr Trp Gly Lys Pro Ser Trp Gly Pro Asn Ile Lys Glu Phe Arg Arg Arg Phe Asp Pro Val Glu Thr Lys Gly Glu Gly Pro Arg Arg Leu Lys Asn Leu Tyr Phe Leu Tyr Leu Ile Glu Leu Arg Ala Leu Ser Lys Val Ala Pro Tyr Phe Glu Arg Ser Ile Val Asp Leu Tyr Thr Gly Asn Val Glu Asp Asp Ala Asp Thr Lys Thr Leu Leu Leu Ser Ile Phe Gln Asp Thr Lys Ser Phe Pro Met His Phe Asp Glu Lys Ser Met Phe Ala Gly Asp Lys Lys Gly Ala Lys Ser Leu Lys Glu Glu Phe Arg Leu His Phe Lys Asn Ile Ser Arg Ile Met Asp Cys Val Gly Cys Asp Lys Cys Arg Leu Trp Gly Lys Leu Gln Thr Gln Gly Leu Gly Thr Ala Leu Lys Ile Leu Phe Ser Glu Lys Glu Ile Gln Asn _ CA 02364330 2001-10-04 Leu Pro Glu Asn Ser Pro Ser Lys Gly Phe Gln Leu Thr Arg Gln Glu Ile Val Ala Leu Leu Asn Ala Phe Gly Arg Leu Ser Thr Ser Ile Arg Glu Leu Gln Asn Phe Lys Ala Leu Leu Gln His Arg Arg <210> 14 <211> 1383 <212> DNA
<213> Artificial Sequence <220>
<223> Degenerate polynucleotide encoding the polypeptide of SEQ ID N0:13 <221> variation <222> (1)...(1383) <223> Each N is independently A, T. G, or C.
<400>

mgngcngtnacnggncarggngcngcngcngcngtncarytnytngtnacnytnwsntty60 ytnwsnwsnytngtnaaracncargtnacnggngtnytngaygaytgyytntgygayath120 gaywsnathgayaarttyaayacntayaarathttyccnaarathaaraarytncargar180 mgngaytayttymgntaytayaargtnaayytnaarmgnccntgyccnttytgggcngar240 gayggncaytgywsnathaargaytgycaygtngarccntgyccngarwsnaarathccn300 gtnggnathaargcnggnmgnwsnaayaartaywsncargcngcnaaywsnacnaargar360 ytngaygaytgygarcargcnaayaarytnggngcnathaaywsnacnytnwsnaaygar420 wsnaargargcnttyathgaytgggcnmgntaygaygaywsncargaycayttytgygar480 ytngaygaygarmgnwsnccngcngcncartaygtngayytnytnytnaayccngarmgn540 tayacnggntayaarggnwsnwsngcntggmgngtntggaaywsnathtaygargaraay600 tgyttyaarccnmgnwsngtntaymgnccnytnaayccnytngcnccnwsnmgnggngar660 gaygayggngarwsnttytayacntggytngarggnytntgyytngaraarmgngtntty720 tayaarytnathwsnggnytncaygcnwsnathaayytncayytntgygcnaaytayytn780 ytngargaracntggggnaarccnwsntggggnccnaayathaargarttymgnmgnmgn840 ttygayccngtngaracnaarggngarggnccnmgnmgnytnaaraayytntayttyytn900 tayytnathgarytnmgngcnytnwsnaargtngcnccntayttygarmgnwsnathgtn960 gayytntayacnggnaaygtngargaygaygcngayacnaaracnytnytnytnwsnath1020 ttycargayacnaarwsnttyccnatgcayttygaygaraarwsnatgttygcnggngay1080 aaraarggngcnaarwsnytnaargargarttymgnytncayttyaaraayathwsnmgn1140 athatggaytgygtnggntgygayaartgymgnytntggggnaarytncaracncarggn1200 ytnggnacngcnytnaarathytnttywsngaraargarathcaraayytnccngaraay1260 wsnccnwsnaarggnttycarytnacnmgncargarathgtngcnytnytnaaygcntty1320 ggnmgnytnwsnacnwsnathmgngarytncaraayttyaargcnytnytncarcaymgn1380 _ CA 02364330 2001-10-04 mgn 1383 <210> 15 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24645 <400> 15 tgctggtcac cctgagcttc ctg 23 <210> 16 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24646 <400> 16 tcgaggcgca ggtcactgga gtt 23 <210> 17 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC9739 <400> 17 ccatcctaat acgactcact atagggc 27 <210> 18 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC9719 <400> 18 actcactata gggctcgagc ggc 23 <210> 19 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24780 <400> 19 tagacctatt gctgaaccca gagcg 25 <210> 20 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24779 <400> 20 cactggctat aaagggacct ctgca 25 <210> 21 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24965 <400> 21 gccgaggcga agatgatgga gaatc 25 <210> 22 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC25142 <400> 22 agaatatctc ccgtataatg gactgtgttg g 31 <210> 23 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24781 <400> 23 gaggaagctc agggtgacaa gcagt 25 <210> 24 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide ZC24785 <400> 24 gcaatcatcc agaactccag tcacc 25

Claims (49)

What is claimed is:

1. An isolated polypeptide comprising a contiguous sequence of 50 amino acid residues of SEQ ID NO:10.

2. An isolated polypeptide according to claim 1, wherein said contiguous sequence is 100 amino acid residues of SEQ ID NO:10.

3. An isolated polypeptide according to claim 1, wherein said contiguous sequence is 200 amino acid residues of SEQ ID NO:10.

4. An isolated polypeptide comprising a sequence of amino acid residues that is at least 90% identical to the amino acid sequence of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467, wherein said polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID NO:10 specifically binds.

5. An isolated polypeptide according to claim 4, wherein said polypeptide comprises a sequence of amino acid residues that is at least 95% identical to the amino acid sequence of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467, wherein said polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID NO:10 specifically binds.

6. An isolated polypeptide of claim 4, wherein the amino acid percent identity is determined using a FASTA
program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=blosum62, with other parameters set as default.

7. An isolated polypeptide according to claim 4, wherein any difference between said amino acid sequence encoded by the polynucleotide molecule and said corresponding amino acid sequence of SEQ ID NO:10 is due to a conservative amino acid substitution.

8. An isolated polypeptide according to claim 1, further comprising an affinity tag or binding domain.

9. An isolated polypeptide selected from the group consisting of:
a) a polypeptide comprising amino acid residues 34-63 of SEQ ID NO:2;
b) a polypeptide comprising amino acid residues 64-467 of SEQ ID NO:10;
c) a polypeptide comprising amino acid residues 58-461 of SEQ ID NO:12;
d) a polypeptide of SEQ ID NO:2, from amino acid residue 34 to amino acid residue 77;
e) a polypeptide of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467;
f) a polypeptide of SEQ ID NO:12, from amino acid residue 28 to amino acid residue 461;
g) a polypeptide of SEQ ID NO: 2;
h) a polypeptide of SEQ ID NO:10; and i) a polypeptide of SEQ ID NO:12.

10. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO:2, from amino acid residue 1 to amino acid residue 33.

11. An isolated polynucleotide encoding a polypeptide comprising a contiguous sequence of 50 amino acid residues of SEQ ID NO:10.

12. An isolated polynucleotide according to claim 11, wherein said contiguous sequence is 100 amino acid residues of SEQ ID NO:10.

13. An isolated polynucleotide according to claim 11, wherein said contiguous sequence is 200 amino acid residues of SEQ ID NO:10.

14. An isolated polynucleotide encoding a polypeptide comprising a sequence of amino acid residues that is at least 90% identical to the amino acid sequence of SEQ ID
N0:10, from amino acid residue 34 to amino acid residue 467, wherein said polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID NO:10 specifically binds.

15. An isolated polynucleotide according to claim 14, wherein said polypeptide comprises a sequence of amino acid residues that is at least 95% identical to the amino acid sequence of SEQ ID NO:10, from amino acid residue 34 to amino acid residue 467, wherein said polypeptide specifically binds to an antibody to which a polypeptide of SEQ ID NO:10 specifically binds.

16. An isolated polynucleotide of claim 14, wherein the amino acid percent identity is determined using a FASTA
program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=blosum62, with other parameters set as default.

17. An isolated polynucleotide according to claim 14, wherein any difference between said amino acid sequence encoded by the polynucleotide molecule and said corresponding amino acid sequence of SEQ ID NO:10 is due to a conservative amino acid substitution.

18. An isolated polynucleotide according to claim 11, wherein said polypeptide further comprises an affinity tag or binding domain.

19. An isolated polynucleotide selected from the group consisting of:
a) a polynucleotide encoding a polypeptide comprising amino acid residues 34-63 of SEQ ID NO:2;

b) a polynucleotide encoding a polypeptide comprising amino acid residues 64-467 of SEQ ID NO:10;
c) a polynucleotide encoding a polypeptide comprising amino acid residues 58-461 of SEQ ID NO:12;
d) a polynucleotide encoding a polypeptide of SEQ
ID N0:2, from amino acid residue 34 to amino acid residue 77;
e) a polynucleotide encoding a polypeptide of SEQ
ID NO:10, from amino acid residue 34 to amino acid residue 467;
f) a polynucleotide encoding a polypeptide of SEQ
ID NO:12, from amino acid residue 28 to amino acid residue 461;
g) a polynucleotide encoding a polypeptide of SEQ
ID NO: 2;
h) a polynucleotide encoding a polypeptide of SEQ
ID NO:10;
i) a polynucleotide encoding a polypeptide of SEQ
ID NO:12;
j) a polynucleotide comprising nucleotide 167 to nucleotide 1567 of SEQ ID NO:9;
k) a polynucleotide comprising nucleotide 1 to nucleotide 1383 of SEQ ID NO:12;
l) a polynucleotide sequence complementary to a), b), c), d), e), f), g), h), i), j) or k); and m) a degenerate polynucleotide sequence of a), b), c), d), e), f), g), h) or i).

20. An isolated polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2, from amino acid residue 1 to amino acid residue 33.

21. A variant zsig49 polypeptide, wherein the amino acid sequence of the variant polypeptide shares an identity with the amino acid sequence of SEQ ID NO:10 selected from the group consisting of at least 80% identity, at least 90%
identity, at least 95% identity, or greater than 95% identity, and wherein any difference between the amino acid sequence of the variant polypeptide and the amino acid sequence of SEQ ID
NO:10 is due to one or more conservative amino acid substitutions.

22. A polynucleotide molecule encoding a fusion protein consisting essentially of a first portion and a second portion joined by a peptide bond, said first portion comprising a polypeptide according to claim 1; and said second portion comprising another polypeptide.

23. A polynucleotide encoding a fusion protein comprising a secretory signal sequence having the amino acid sequence of amino acid residues 1-33 of SEQ ID NO:10, wherein said secretory signal sequence is operably linked to an additional polypeptide.

24. An expression vector comprising the following operably linked elements:
a transcription promoter;
a DNA segment encoding a polypeptide according to claim 1; and a transcription terminator.

25. An expression vector according to claim 24 further comprising a secretory signal sequence operably linked to said polypeptide.

26. An expression vector according to claim 25, wherein said secretory signal sequence comprises amino acid residues 1-33 of SEQ ID NO:2.

27. An expression vector according to claim 24, wherein said DNA segment encodes a polypeptide covalently linked amino terminally or carboxy terminally to an affinity tag.

28. A cultured cell into which has been introduced an expression vector according to claim 24, wherein said cultured cell expresses said polypeptide encoded by said polynucleotide segment.

29. A method of producing a polypeptide comprising:
culturing a cell into which has been introduced an expression vector according to claim 24;
whereby said cell expresses said polypeptide encoded by said polynucleotide segment; and recovering said expressed polypeptide.

30. A method of producing a polypeptide according to claim 29, wherein said expression vector further comprises a secretory signal sequence operably linked to said polypeptide;
said cultured cell secretes said polypeptide into a culture medium, and said polypeptide is recovered from said culture medium.

31. An antibody or antibody fragment that specifically binds to a polypeptide according to claim 1.

32. An antibody according to claim 31, wherein said antibody is selected from the group consisting of:
a) polyclonal antibody;
b) murine monoclonal antibody;
c) humanized antibody derived from b); and d) human monoclonal antibody.

33. An antibody fragment according to claim 32, wherein said antibody fragment is selected from the group consisting of F(ab'), F(ab), Fab', Fab, Fv, scFv, and minimal recognition unit.

34. An anti-idiotype antibody that specifically binds to said antibody of claim 31.

35. A polypeptide according to claim 1 in combination with a pharmaceutically acceptable vehicle.

36. A method of detecting a chromosome 1 abnormality in a subject comprising:
(a) amplifying nucleic acid molecules that encode a polypeptide according to claim 1 from RNA isolated from a biological sample of the subject, and (b) detecting a mutation in the amplified nucleic acid molecules, wherein the presence of a mutation indicates a chromosome 1 abnormality.

37. The method of detecting a chromosome 1 abnormality according to claim 36, wherein the detecting step is performed by comparing the nucleotide sequence of the amplified nucleic acid molecules to the nucleotide sequence of SEQ ID NO:9, wherein a difference between the nucleotide sequence of said amplified nucleic acid molecules and the corresponding nucleotide sequence of SEQ ID NO:9 is indicative of chromosome 1 abnormality.

38. The method of detecting a chromosome 1 abnormality according to claim 36, wherein amplification is performed by polymerase chain reaction or reverse transcriptase-polymerase chain reaction.

39. A method of detecting a chromosome 1 abnormality in a subject comprising:
(a) amplifying nucleic acid molecules that encode a polypeptide according to claim 1 from RNA isolated from a biological sample of the subject, (b) transcribing the amplified nucleic acid molecules to express mRNA, (c) translating said mRNA to produce polypeptides, and (d) detecting a mutation in said polypeptides, wherein the presence of a mutation indicates a chromosome 1 abnormality.

40. A method for diagnosing a metabolic disease or susceptibility to a metabolic disease in an individual, wherein the disease is related to the expression or activity of a polypeptide according to claim 1 in said individual, comprising the step of determining the presence of an alteration in the nucleotide sequence encoding said polypeptide in the genome of said individual, wherein the presence of an alteration in said nucleotide sequence indicates metabolic disease or susceptibility to a metabolic disease.

41. A method for diagnosing a metabolic disease or susceptibility to a metabolic disease in an individual, comprising:
(a) amplifying nucleic acid molecules that encode a polypeptide according to claim 1 from RNA isolated from a biological sample of said individual, and (b) detecting a mutation in the amplified nucleic acid molecules, wherein the presence of a mutation indicates metabolic disease or susceptibility to a metabolic disease.

42. A method for diagnosing a metabolic disease or susceptibility to a metabolic disease in an individual, comprising:
(a) amplifying nucleic acid molecules that encode a polypeptide according to claim 1 from RNA isolated from a biological sample of the subject, (b) transcribing the amplified nucleic acid molecules to produce mRNA, (c) translating said mRNA to produce said polypeptides, and (d) detecting a mutation in said polypeptides, wherein the presence of a mutation indicates metabolic disease or susceptibility to a metabolic disease.

43. The method for diagnosing a metabolic disease or susceptibility to a metabolic disease according to claim 42, wherein the metabolic disease is diabetes.

44. The method of claim 43, wherein the metabolic disease is Type II diabetes, and the individual is a Pima Indian.

45. A method of detecting the presence of zsig49 polypeptide RNA in a biological sample, comprising the steps of:
(a) contacting a nucleic acid probe under hybridizing conditions with either (i) test RNA molecules isolated from the biological sample, or (ii) nucleic acid molecules synthesized from the isolated RNA molecules, wherein said nucleic acid probe has a nucleotide sequence comprising a portion of the nucleotide sequence of nucleotides 167-1567 of SEQ ID NO:9 or its complement, or the nucleotide sequence of nucleotides 1-1383 of SEQ IN NO:12 or its complement, and (b) detecting the formation of hybrids of said nucleic acid probe and either said test RNA molecules or said synthesized nucleic acid molecules, wherein the presence of said hybrids indicates the presence of zsig49 polypeptide RNA in the biological sample.

46. A method of detecting the presence of a polypeptide according to claim 1 in a biological sample, comprising the steps of:
(a) contacting said biological sample with an antibody or an antibody fragment, that specifically binds with a polypeptide consisting of the amino acid sequence of SEQ ID
NO:10, wherein the contacting is performed under conditions that allow the binding of said antibody or antibody fragment to said biological sample, and (b) detecting any of said bound antibody or bound antibody fragment.

47. The method of claim 46, wherein said antibody or said antibody fragment further comprises a detectable label selected from the group consisting of radioisotope, fluorescent label, chemiluminescent label, enzyme label, bioluminescent label, and colloidal gold.

48. A kit for the detection of a gene encoding a polypeptide, comprising:
a first container that comprises a polynucleotide molecule according to claim 11; and a second container that comprises one or more reagents capable of indicating the presence of said polynucleotide molecule.

49. A kit for the detection of a gene encoding a polypeptide, comprising:
a first container that comprises an antibody according to claim 31; and a second container that comprises one or more reagents capable of indicating the presence of said antibody.