CA2352560A1 - Mammalian secretory protein zsig43 - Google Patents

Abstract

Receptors perform many functions that are essential for the metabolism and differentiation of cells. As such, this class of proteins often provides targets for therapeutically useful drugs. The present invention provides a new human membrane-associated polypeptide, designated "Zsig43".

Description

TECHNICAL FIELD
The present invention relates generally to a novel receptor that is t0 expressed on the surface of human cells. In particular, the present invention relates to a novel gene, designated "Zsig43," and to nucleic acid molecules encoding Zsig43.
BACKGROUND OF THE INVENTION
Cellular differentiation of multicellular organisms is controlled by hormones and polypeptide growth factors. These diffusable molecules allow cells to communicate with each other, to act in concert to form tissues and organs, and to repair and regenerate damaged tissue. Examples of hormones and growth factors include the steroid hormones, parathyroid hormone, follicle stimulating hormone, the interferons, 2o the interleukins, platelet derived growth factor, epidermal growth factor, and granulocyte-macrophage colony stimulating factor, among others.
Hormones and growth factors influence cellular metabolism by binding to receptor proteins. Certain receptors are integral membrane proteins that bind with the hormone or growth factor outside the cell, and that are linked to signaling pathways within the cell, such as second messenger systems. Other classes of receptors are soluble intracellular molecules.
Since receptors perform many essential functions, these proteins provide targets for therapeutically useful drugs (see, for example, Gubernator and Bohm (eds.), Structure-Based Ligand Design (John Wiley & Co. 1998), and Leff (ed.), Receptor-3o Based Drug Design (Marcel Dekker, Inc. 1998)). Receptor proteins also provide useful markers for differentiating between various tissues, and between normal and diseased tissues. A continuing need therefore exists for the discovery and characterization of new membrane-associated proteins.

BRIEF SUMMARY OF THE INVENTION
The present invention provides a novel gene, designated "Zsig43." The present invention also provides Zsig43 polypeptides and Zsig43 fusion proteins, nucleic acid molecules encoding such polypeptides and proteins, and methods for using these molecules.
DETAILED DESCRIPTION OF THE INVENTION
io 1. Overview The present invention provides nucleic acid molecules that encode a new human receptor protein, designated "Zsig43." An illustrative nucleotide sequence that encodes Zsig43 is present in SEQ ID NO:1, while the encoded polypeptide has the amino acid sequence of SEQ ID N0:2. Functionally, Zsig43 comprises a secretory signal sequence (amino acid residues 1 to about 25 of SEQ ID N0:2), an extracellular domain (located at about amino acid residues 26 to 315 of SEQ ID N0:2), a transmembrane domain (located at about amino acid residues 316 to 340 of SEQ
ID
N0:2), and an intracellular domain (located at about amino acid residues 341 to 826 of SEQ ID N0:2). In addition, the intracellular domain comprises a putative SH2 binding 2o domain (located at about amino acid residues 381 to 479 of SEQ ID N0:2).
A chromosomal localization study revealed that the Zsig43 gene resides on human chromosome 17 at 17q21.1. This locus is associated with various diseases, as described below.
Northern analyses indicate that the Zsig43 gene is strongly expressed in heart, liver, skeletal muscle, adrenal gland, kidney, and pancreas tissues, and to a lesser extent, in brain, placenta, lung, bone marrow, testis, spleen, thymus, prostate, small intestine, colon, stomach, thyroid, spinal cord, and trachea. In contrast, little or no Zsig43 gene expression was detectable in tissues such as ovary, peripheral blood lymphocytes, and lymph node. Thus, hybridization studies show that Zsig43 sequences 3o can be used to differentiate among various tissues and cell types.
As described below, the present invention provides isolated polypeptides comprising an extracellular domain, wherein the extracellular domain comprises amino acid residues 26 to 315 of the amino acid sequence of SEQ ID N0:2. Such polypeptides may further comprise a transmembrane domain that resides in a carboxyl-terminal position relative to the extracellular domain, wherein the transmembrane domain comprises amino acid residues 316 to 340 of SEQ ID N0:2. These WO 00/31259 PCTNS99/2~040 polypeptides may also comprise an intracellular domain that resides in a carboxyl-terminal position relative to the transmembrane domain, wherein the intracellular domain comprises amino acid residues 341 to 826 of SEQ ID N0:2, and optionally, a signal secretory sequence that resides in an amino-terminal position relative to the extracellular domain, wherein the signal secretory sequence comprises amino acid residues 1 to 25 of the amino acid sequence of SEQ ID N0:2. The present invention also contemplates isolated polypeptides comprising the amino acid sequence of SEQ ID
N0:2, as well as polypeptides having an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to the amino acid sequence of SEQ ID
N0:2, to wherein such isolated polypeptides specifically bind with an antibody that specifically binds with a polypeptide having the amino acid sequence of SEQ ID N0:2. An illustrative polypeptide is a polypeptide that comprises the amino acid sequence of SEQ
ID N0:2.
The present invention further contemplates isolated polypeptides, comprising an amino acid sequence which shares a percent identity with a reference amino acid sequence selected from the group consisting of amino acid residues 26 to 315 of SEQ ID N0:2, amino acid residues 316 to 340 of SEQ ID N0:2, and amino acid residues 341 to 826 of SEQ ID N0:2, wherein the percent identity is selected from the group consisting of at least 70% identity, at least 80% identity, at least 90%
identity, at least 95% identity, or greater than 95% identity, and wherein any difference between the amino acid sequence of the isolated polypeptide and the reference amino acid sequence is due to one or more conservative amino acid substitutions.
The present invention further provides antibodies and antibody fragments that specifically bind with such polypeptides. Exemplary antibodies include polyclonal antibodies, marine monoclonal antibodies, humanized antibodies derived from marine monoclonal antibodies, and human monoclonal antibodies.
Illustrative antibody fragments include F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, and minimal recognition unItS.
The present invention also provides isolated nucleic acid molecules that 3o encode a Zsig43 polypeptide, wherein the nucleic acid molecule is selected from the group consisting of (a) a nucleic acid molecule having the nucleotide sequence of SEQ
ID N0:3, and (b) a nucleic acid molecule that remains hybridized following stringent wash conditions to a nucleic acid molecule having either the nucleotide sequence of SEQ ID NO:1, or the complement of SEQ ID NO:I . Illustrative nucleic acid molecules include those in which any difference between the amino acid sequence encoded by the nucleic acid molecule and the corresponding amino acid sequence of SEQ ID N0:2 is due to a conservative amino acid substitution. The present invention further WO 00/31259 PC'T/US99/27040 contemplates isolated nucleic acid molecules that comprise a nucleotide sequence of nucleotides 93 to 2495 of SEQ ID NO:I .
The present invention also includes vectors and expression vectors comprising such nucleic acid molecules. Such expression vectors may comprise a transcription promoter, and a transcription terminator, wherein the promoter is operably linked with the nucleic acid molecule, and wherein the nucleic acid molecule is operably linked with the transcription terminator. The present invention further includes recombinant host cells comprising these vectors and expression vectors.
Illustrative host cells include bacterial, yeast, fungal, insect, mammalian, and plant cells. Recombinant host cells comprising such expression vectors can be used to produce Zsig43 polypeptides by culturing such recombinant host cells that comprise the expression vector and that produce the Zsig43 protein, and, optionally, isolating the Zsig43 protein from the cultured recombinant host cells.
The present invention also contemplates methods for detecting the ~ 5 presence of Zsig43 RNA in a biological sample, comprising the steps of (a) contacting a Zsig43 nucleic acid probe under hybridizing conditions with either (i) test RNA
molecules isolated from the biological sample, or (ii) nucleic acid molecules synthesized from the isolated RNA molecules, wherein the probe has a nucleotide sequence comprising a portion of the nucleotide sequence of SEQ ID NO:I, or its 2o complement, and (b) detecting the formation of hybrids of the nucleic acid probe and either the test RNA molecules or the synthesized nucleic acid molecules, wherein the presence of the hybrids indicates the presence of Zsig43 RNA in the biological sample.
The biological sample can be obtained, for example, from a human.
The present invention further provides methods for detecting the 25 presence of Zsig43 polypeptide in a biological sample, comprising the steps of: (a) contacting the biological sample with an antibody or an antibody fragment that specifically binds with a polypeptide having the amino acid sequence of SEQ ID
N0:2, wherein the contacting is performed under conditions that allow the binding of the antibody or antibody fragment to the biological sample, and (b) detecting any of the 3o bound antibody or bound antibody fragment. Such an antibody or antibody fragment may further comprise a detectable label selected from the group consisting of radioisotope, fluorescent label, chemiluminescent label, enzyme label, bioluminescent label, and colloidal gold. An illustrative biological sample is a human biological sample.
35 The present invention also provides kits for performing these detection methods. For example, a kit for detection of Zsig43 gene expression may comprise a container that comprises a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of (a) a nucleic acid molecule comprising the nucleotide sequence of nucleotides 93 to 2495 of SEQ ID NO:1, (b) a nucleic acid molecule comprising the complement of the nucleotide sequence of nucleotides 93 to 2495 of SEQ ID NO:1, (c) a nucleic acid molecule that is a fragment of (a) consisting 5 of at least eight nucleotides, and (d) a nucleic acid molecule that is a fragment of (b) consisting of at least eight nucleotides. Such a kit may also comprise a second container that comprises one or more reagents capable of indicating the presence of the nucleic acid molecule. On the other hand, a kit for detection of Zsig43 protein may comprise a container that comprises an antibody, or an antibody fragment, that 1o specifically binds with a polypeptide having the amino acid sequence of SEQ
ID N0:2.
The present invention further contemplates isolated nucleic acid molecules comprising a nucleotide sequence that encodes a Zsig43 secretion signal sequence and a nucleotide sequence that encodes a biologically active polypeptide, wherein the Zsig43 secretion signal sequence comprises an amino acid sequence of residues 1 to 25 of SEQ ID N0:2. Exemplary biologically active polypeptide include Factor VIIa, proinsulin, insulin, follicle stimulating hormone, tissue type plasminogen activator, tumor necrosis factor, interleukin, colony stimulating factor, interferon, erythropoietin, and thrombopoietin. The present invention also provides fusion proteins comprising a Zsig43 secretion signal sequence and a polypeptide, wherein the 2o Zsig43 secretion signal sequence comprises an amino acid sequence of residues 1 to 25 of SEQ ID N0:2.
The present invention further includes isolated nucleic acid molecules that encode an extracellular Zsig43 domain, wherein the extracellular domain has the amino acid sequence of amino acid residues 26-315 of SEQ ID N0:2, and isolated polypeptides having the amino acid sequence of amino acid residues 26-315 of SEQ ID
N0:2. The present invention also contemplates antibodies that specifically bind with such isolated polypeptides, and anti-idiotype antibodies that specifically bind with such antibodies.
A further aspect of the present invention provides fusion proteins 3o comprising amino acid residues 26 to 315 of SEQ ID N0:2. For example a fusion protein can comprise amino acid residues 26 to 315 of SEQ ID N0:2 and an immunoglobulin moiety. An illustrative immunoglobulin moiety is an immunoglobulin heavy chain constant region, such as a human Fc fragment. The present invention also includes isolated nucleic acid molecules that encode such fusion proteins.
The present invention also includes isolated polypeptides that comprise at least 15 contiguous amino acid residues of the amino acid sequence of SEQ
ID N0:2, at least 20 contiguous amino acid residues of the amino acid sequence of SEQ
ID N0:2, at least 30 contiguous amino acid residues of the amino acid sequence of SEQ
ID N0:2, at least 40 contiguous amino acid residues of the amino acid sequence of SEQ
ID N0:2, at least 50 contiguous amino acid residues of the amino acid sequence of SEQ
ID N0:2, or at least 100 contiguous amino acid residues of the amino acid sequence of SEQ ID
s N0:2 These and other aspects of the invention will become evident upon reference to the following detailed description.
t o 2. Definitions In the description that follows, a number of terms are used extensively.
The following definitions are provided to facilitate understanding of the invention.
As used herein, "nucleic acid" or "nucleic acid molecule" refers to t s polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring 20 nucleotides (e.g., a-enantiomeric forms of naturally-occurring nucleotides}, or a combination of both. Modified nucleotides can have alterations in sugar moieties and/or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
25 Moreover, the entire sugar moiety can be replaced with stericaIly and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages.
Analogs 30 of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. The term "nucleic acid molecule" also includes so called "peptide nucleic acids," which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single 3s stranded or double stranded.

The term "complement of a nucleic acid molecule" refers to a nucleic acid molecule having a complementary nucleotide sequence and reverse orientation as compared to a reference nucleotide sequence. For example, the sequence S' ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
The term "contig" denotes a nucleic acid molecule that has a contiguous stretch of identical or complementary sequence to another nucleic acid molecule.
Contiguous sequences are said to "overlap" a given stretch of a nucleic acid molecule either in their entirety or along a partial stretch of the nucleic acid molecule.
The term "degenerate nucleotide sequence" denotes a sequence of nucleotides that includes one or more degenerate codons as compared to a reference nucleic acid molecule that encodes a polypeptide. Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i. e., GAU
and GAC
triplets each encode Asp).
The term "structural gene" refers to a nucleic acid molecule that is ~ 5 transcribed into messenger RNA (mRNA), which is then translated into a sequence of amino acids characteristic of a specific polypeptide.
An "isolated nucleic acid molecule" is a nucleic acid molecule that is not integrated in the genomic DNA of an organism. For example, a nucleic acid molecule that encodes a growth factor that has been separated from the genomic DNA of a cell is an isolated DNA molecule. Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism. A nucleic acid molecule that has been isolated from a particular species is smaller than the complete DNA molecule of a chromosome from that species.
A "nucleic acid molecule construct" is a nucleic acid molecule, either single- or double-stranded, that has been modified through human intervention to contain segments of nucleic acid combined and juxtaposed in an arrangement not existing in nature.
"Linear DNA" denotes non-circular DNA molecules having free 5' and 3' ends. Linear DNA can be prepared from closed circular DNA molecules, such as plasmids, by enzymatic digestion or physical disruption.
"Complementary DNA (cDNA)" is a single-stranded DNA molecule that is formed from an mRNA template by the enzyme reverse transcriptase.
Typically, a primer complementary to portions of mRNA is employed for the initiation of reverse transcription. Those skilled in the art also use the term "cDNA" to refer to a double-stranded DNA molecule consisting of such a single-stranded DNA molecule and its complementary DNA strand. The term "cDNA" also refers to a clone of a cDNA
molecule synthesized from an RNA template.

A "promoter" is a nucleotide sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of a structural gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CART sequences, differentiation-specific elements (DSEs; McGehee et al., Mol. Endocrinol. 7:551 (1993)), cyclic AMP response elements (CREs), serum response elements (SREs; Treisman, Seminars in Cancer Biol.
l: 47 ( 1990)), glucocorticoid response elements {GREs), and binding sites for other 1o transcription factors, such as CRE/ATF (O'Reilly et al., J. Biol. Chem.
267:19938 (1992)), AP2 (Ye et al., J. Biol. Chem. 269:25728 (1994)), SP1, CAMP response element binding protein (CREB; Loeken, Gene Expr. 3:253 (1993)) and octamer factors (see, in general, Watson et al., eds., Molecular Biology of the Gene, 4th ed.
(The Benjamin/Cummings Publishing Company, Inc. 1987), and Lemaigre and Rousseau, Biochem. J. 303:1 (1994)). If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.
A "core promoter" contains essential nucleotide sequences for promoter 2o function, including the TATA box and start of transcription. By this definition, a core promoter may or may not have detectable activity in the absence of specific sequences that may enhance the activity or confer tissue specific activity.
A "regulatory element" is a nucleotide sequence that modulates the activity of a core promoter. For example, a regulatory element may contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are normally associated with genes that are expressed in a "cell-specific,"
"tissue-specific," or "organelle-specific" manner. For example, the Zsig43 regulatory element preferentially induces gene expression in heart, liver, skeletal muscle, and 3o adrenal gland, as opposed to ovary, peripheral blood lymphocytes, and lymph node.
An "enhancer" is a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.
"Heterologous DNA" refers to a DNA molecule, or a population of DNA molecules, that does not exist naturally within a given host cell. DNA
molecules heterologous to a particular host cell may contain DNA derived from the host cell species (i.e., endogenous DNA) so long as that host DNA is combined with non-host DNA (i.e., exogenous DNA). For example, a DNA molecule containing a non-host DNA segment encoding a polypeptide operably linked to a host DNA segment comprising a transcription promoter is considered to be a heterologous DNA
molecule.
Conversely, a heterologous DNA molecule can comprise an endogenous gene operably linked with an exogenous promoter. As another illustration, a DNA molecule comprising a gene derived from a wild-type cell is considered to be heterologous DNA
if that DNA molecule is introduced into a mutant cell that lacks the wild-type gene.
A "polypeptide" is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 1 o amino acid residues are commonly referred to as "peptides."
A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may also comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell.
1 s Proteins are defined herein in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
A peptide or polypeptide encoded by a non-host DNA molecule is a "heterologous" peptide or polypeptide.
2o An "integrated genetic element" is a segment of DNA that has been incorporated into a chromosome of a host cell after that element is introduced into the cell through human manipulation. Within the present invention, integrated genetic elements are most commonly derived from linearized plasmids that are introduced into the cells by electroporation or other techniques. Integrated genetic elements are passed 25 from the original host cell to its progeny.
A "cloning vector" is a nucleic acid molecule, such as a plasmid, cosmid, or bacteriophage, that has the capability of replicating autonomously in a host cell.
Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites that allow insertion of a nucleic acid molecule in a determinable fashion 3o without loss of an essential biological function of the vector, as well as nucleotide sequences encoding a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance or ampicillin resistance.
An "expression vector" is a nucleic acid molecule encoding a gene that is 35 expressed in a host cell. Typically, an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter. and such a gene is said to be "operably linked to"
the promoter.

Similarly, a regulatory element and a core promoter are operably linked if the regulatory element modulates the activity of the core promoter.
A "recombinant host" is a cell that contains a heterologous nucleic acid molecule, such as a cloning vector or expression vector. In the present context, an 5 example of a recombinant host is a cell that produces Zsig43 from an expression vector.
In contrast, Zsig43 can be produced by a cell that is a "natural source" of Zsig43, and that lacks an expression vector.
"Integrative transformants" are recombinant host cells, in which heterologous DNA has become integrated into the genomic DNA of the cells.

10 A "fusion protein" is a hybrid protein expressed by a nucleic acid molecule comprising nucleotide sequences of at least two genes. For example, a fusion protein can comprise at least part of a Zsig43 polypeptide fused with a polypeptide that binds an affinity matrix. Such a fusion protein provides a means to isolate large quantities of Zsig43 using affinity chromatography.
The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule termed a "ligand." This interaction mediates the effect of the ligand on the cell. Receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF
2o receptor, erythropoietin receptor and IL-6 receptor). Membrane-bound receptors are characterized by a multi-domain structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. In certain membrane-bound receptors, the extracellular ligand-binding domain and the intracellular effector domain are located in separate polypeptides that comprise the complete functional receptor.
In general, the binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecules) in the cell, which in turn leads to an alteration in the metabolism of the cell.
Metabolic events that are often linked to receptor-ligand interactions include gene 3o transcription, phosphorylation, dephosphorylation, increases in cyclic AMP
production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids.
The term "secretory signal sequence" denotes a DNA sequence that encodes a peptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.

An "isolated polypeptide" is a polypeptide that is essentially free from contaminating cellular components, such as carbohydrate, lipid, or other proteinaceous impurities associated with the polypeptide in nature. Typically, a preparation of isolated polypeptide contains the polypeptide in a highly purified form, i. e., at least about 80%
pure, at least about 90% pure, at least about 95% pure, greater than 95% pure, or greater than 99% pure. One way to show that a particular protein preparation contains an isolated polypeptide is by the appearance of a single band following sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis of the protein preparation and Coomassie Brilliant Blue staining of the gel. However, the term "isolated"
does not 0 exclude the presence of the same polypeptide in alternative physical forms, such as dimers or alternatively glycosylated or derivatized forms.
The terms "amino-terminal" and "carboxyl-terminal" are used herein to denote positions within polypeptides. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity 1 s or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.
The term "expression" refers to the biosynthesis of a gene product. For 2o example, in the case of a structural gene, expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.
The term "splice variant" is used herein to denote alternative forms of RNA transcribed from a gene. Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly 25 between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a polypeptide encoded by a splice variant of an mRNA transcribed from a gene.
As used herein, the term "immunomodulator" includes cytokines, stem 30 cell growrth factors, lymphotoxins, co-stimulatory molecules, hematopoietic factors, and synthetic analogs of these molecules.
The term "complement/anti-complement pair" denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of a 3s complement/anti-complement pair. Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like. Where subsequent dissociation of the complement/anti-complement pair is desirable, the complement/anti-complement pair preferably has a binding affinity of less than 109 M-~.
An "anti-idiotype antibody" is an antibody that binds with the variable region domain of an immunoglobulin. In the present context, an anti-idiotype antibody binds with the variable region of an anti-Zsig43 antibody, and thus, an anti-idiotype antibody mimics an epitope of Zsig43.
An "antibody fragment" is a portion of an antibody such as F(ab')2, F(ab)Z, Fab', Fab, and the like. Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the intact antibody. For example, an anti-Zsig43 monoclonal antibody fragment binds with an epitope of Zsig43.
The term "antibody fragment" also includes a synthetic or a genetically engineered polypeptide that binds to a specific antigen, such as polypeptides consisting of the light chain variable region, "Fv" fragments consisting of the variable regions of the heavy and light chains, recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker ("scFv proteins"), and minimal recognition units consisting of the amino acid residues that mimic the hypervariable region.
A "chimeric antibody" is a recombinant protein that contains the variable domains and complementary determining regions derived from a rodent antibody, while the remainder of the antibody molecule is derived from a human antibody.
"Humanized antibodies" are recombinant proteins in which marine complementarity determining regions of a monoclonal antibody have been transferred from heavy and light variable chains of the marine immunoglobulin into a human variable domain.
As used herein, a "therapeutic agent" is a molecule or atom which is conjugated to an antibody moiety to produce a conjugate which is useful for therapy.
Examples of therapeutic agents include drugs, toxins, immunomodulators, chelators, boron compounds, photoactive agents or dyes, and radioisotopes.
A "detectable label" is a molecule or atom which can be conjugated to 3o an antibody moiety to produce a molecule useful for diagnosis. Examples of detectable labels include chelators, photoactive agents, radioisotopes, fluorescent agents, paramagnetic ions, or other marker moieties.
The term "affinity tag" is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a poly-histidine tract, protein A (Nilsson et al., EMBO J. 4:1075 (1985); Nilsson et al., Methods Enzymol. 198:3 ( 1991 )), glutathione S transferase (Smith and Johnson, Gene 67:31 (1988)), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad.
Sci. USA
82:7952 (1985)), substance P, FLAG peptide (Hopp et al., Biotechnology 6:1204 (1988)), streptavidin binding peptide, or other antigenic epitope or binding domain.
See, in general, Ford et al., Protein Expression and Purification 2:95 (1991).
DNAs encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ).
A "naked antibody" is an entire antibody, as opposed to an antibody to fragment, which is not conjugated with a therapeutic agent. Naked antibodies include both polyclonal and monoclonal antibodies, as well as certain recombinant antibodies, such as chimeric and humanized antibodies.
As used herein, the term "antibody component" includes both an entire antibody and an antibody fragment.
An "immunoconjugate" is a conjugate of an antibody component with a therapeutic agent or a detectable label.
As used herein, the term "antibody fusion protein" refers to a recombinant molecule that comprises an antibody component and a therapeutic agent.
Examples of therapeutic agents suitable for such fusion proteins include 2o immunomodulators ("antibody-immunomodulator fusion protein") and toxins ("antibody-toxin fusion protein").
A "target polypeptide" or a "target peptide" is an amino acid sequence that comprises at least one epitope, and that is expressed on a target cell, such as a tumor cell, or a cell that carries an infectious agent antigen. T cells recognize peptide epitopes presented by a major histocompatibility complex molecule to a target polypeptide or target peptide and typically lyse the target cell or recruit other immune cells to the site of the target cell, thereby killing the target cell.
An ''antigenic peptide" is a peptide which will bind a major histocompatibility complex molecule to form an MHC-peptide complex which is 3o recognized by a T cell, thereby inducing a cytotoxic lymphocyte response upon presentation to the T cell. Thus, antigenic peptides are capable of binding to an appropriate major histocompatibility complex molecule and inducing a cytotoxic T
cells response, such as cell lysis or specific cytokine release against the target cell which binds or expresses the antigen. The antigenic peptide can be bound in the context of a class I or class II major histocompatibility complex molecule, on an antigen presenting cell or on a target cell.

In eukaryotes, RNA polymerase II catalyzes the transcription of a structural gene to produce mRNA. A nucleic acid molecule can be designed to contain an RNA polymerase II template in which the RNA transcript has a sequence that is complementary to that of a specific mRNA. The RNA transcript is termed an "anti-s sense RNA" and a nucleic acid molecule that encodes the anti-sense RNA is termed an "anti-sense gene." Anti-sense RNA molecules are capable of binding to mRNA
molecules, resulting in an inhibition of mRNA translation.
An "anti-sense oligonucleotide specific for Zsig43" or an "Zsig43 anti sense oligonucleotide" is an oligonucleotide having a sequence (a) capable of forming a t o stable triplex with a portion of the Zsig43 gene, or (b) capable of forming a stable duplex with a portion of an mRNA transcript of the Zsig43 gene.
A "ribozyme" is a nucleic acid molecule that contains a catalytic center.
The term includes RNA enzymes, self splicing RNAs, self cleaving RNAs, and nucleic acid molecules that perform these catalytic functions. A nucleic acid molecule that t 5 encodes a ribozyme is termed a "ribozyme gene."
An "external guide sequence" is a nucleic acid molecule that directs the endogenous ribozyme, RNase P, to a particular species of intracellular mRNA, resulting in the cleavage of the mRNA by RNase P. A nucleic acid molecule that encodes an external guide sequence is termed an "external guide sequence gene."
2o The term "variant Zsig43 gene" refers to nucleic acid molecules that encode a polypeptide having an amino acid sequence that is a modification of SEQ ID
N0:2. Such variants include naturally-occurring polymorphisms of Zsig43 genes, as well as synthetic genes that contain conservative amino acid substitutions of the amino acid sequence of SEQ ID N0:2. Additional variant forms of Zsig43 genes are nucleic 25 acid molecules that contain insertions or deletions of the nucleotide sequences described herein. A variant Zsig43 gene can be identified by determining whether the gene hybridizes with a nucleic acid molecule having the nucleotide sequence of SEQ
ID NO:1, or its complement, under stringent conditions.
Alternatively, variant Zsig43 genes can be identified by sequence 3o comparison. Two amino acid sequences have "100% amino acid sequence identity" if the amino acid residues of the two amino acid sequences are the same when aligned for maximal correspondence. Similarly, two nucleotide sequences have "100%
nucleotide sequence identity" if the nucleotide residues of the two nucleotide sequences are the same when aligned for maximal correspondence. Sequence comparisons can be 35 performed using standard software programs such as those included in the LASERGENE bioinformatics computing suite, which is produced by DNASTAR
(Madison, Wisconsin). Other methods for comparing two nucleotide or amino acid sequences by determining optimal alignment are well-known to those of skill in the art (see, for example, Peruski and Peruski, The Internet and the New Biology:
Tools for Genomic and Molecular Research (ASM Press, Inc. 1997), Wu et al. (eds.), "Information Superhighway and Computer Databases of Nucleic Acids and Proteins,"
5 in Methods in Gene Biotechnology, pages 123-151 (CRC Press, Inc. 1997), and Bishop (ed.), Guide to Human Genome Computing, 2nd Edition (Academic Press, Inc.
1998)).
Particular methods for determining sequence identity are described below.
Regardless of the particular method used to identify a variant Zsig43 gene or variant Zsig43 polypeptide, a variant gene or polypeptide encoded by a variant 1 o gene may be characterized by the ability to bind specifically to an anti-Zsig43 antibody.
The term "allelic variant" is used herein to denote any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or 15 may encode polypeptides having altered amino acid sequence. The term allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
The term "ortholog" denotes a polypeptide or protein obtained from one species that is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an organism. Paralogs are believed to arise through gene duplication. For example, oc-globin, ~i-globin, and myoglobin are paralogs of each other.
The present invention includes functional fragments of Zsig43 genes.
Within the context of this invention, a "functional fragment" of a Zsig43 gene refers to a nucleic acid molecule that encodes a portion of a Zsig43 polypeptide which specifically binds with an anti-Zsig43 antibody. For example, a functional fragment of a Zsig43 gene described herein comprises a portion of the nucleotide sequence of SEQ
ID NO:1, and encodes a polypeptide that specifically binds with an anti-Zsig43 antibody.
3o Due to the imprecision of standard analytical methods, molecular weights and lengths of polymers are understood to be approximate values. When such a value is expressed as "about" X or "approximately" X, the stated value of X
will be understood to be accurate to X10%.

3. Production of a Human Zsig43 Gene Nucleic acid molecules encoding a human Zsig43 gene can be obtained by screening a human cDNA or genomic library using polynucleotide probes based upon the nucleotide sequence of SEQ ID NO:1. These techniques are standard and s well-established.
As an illustration, a nucleic acid molecule that encodes a human Zsig43 gene can be isolated from a human cDNA library. In this case, the first step would be to prepare the cDNA library by isolating RNA from heart, liver, skeletal muscle, adrenal gland, or pituitary tissue, using methods well-known to those of skill in the art. In 1o general, RNA isolation techniques must provide a method for breaking cells, a means of inhibiting RNase-directed degradation of RNA, and a method of separating RNA
from DNA, protein, and polysaccharide contaminants. For example, total RNA can be isolated by freezing tissue in liquid nitrogen, grinding the frozen tissue with a mortar and pestle to Iyse the cells, extracting the ground tissue with a solution of phenol/chloroform to remove 15 proteins, and separating RNA from the remaining impurities by selective precipitation with lithium chloride (see, for example, Ausubel et al. (eds.), Short Protocols in Molecular Biology, 3rd Edition, pages 4-I to 4-6 (John Wiley & Sons 1995) ["Ausubel (1995)"]; Wu et al., Methods in Gene Biotechnology, pages 33-41 (CRC Press, Inc. 1997) ["Wu ( I 997)"]).
2o Alternatively, total RNA can be isolated from tissue, such as heart tissue, by extracting ground tissue with guanidinium isothiocyanate, extracting with organic solvents, and separating RNA from contaminants using differential centrifugation (see, for example, Chirgwin et al., Biochemistry 18:52 (1979); Ausubel (1995) at pages 4-1 to 4-6; Wu (1997) at pages 33-41).
25 In order to construct a cDNA library, poly(A)+ RNA must be isolated from a total RNA preparation. Poly(A)+ RNA can be isolated from total RNA using the standard technique of oligo(dT)-cellulose chromatography (see, for example, Aviv and Leder, Proc. Nat 'l Acad. Sci. USA 69:1408 ( I 972); Ausubel (1995} at pages 4-1 I to 4-12).
3o Double-stranded cDNA molecules are synthesized from poly(A)+ RNA
using techniques well-known to those in the art. (see, for example, Wu (1997) at pages 41-46). Moreover, commercially available kits can be used to synthesize double-stranded cDNA molecules. For example, such kits are available from Life Technologies, Inc. (Gaithersburg, MD), CLONTECH Laboratories, Inc. (Palo Alto, 35 CA), Promega Corporation (Madison, WI) and STRATAGENE (La Jolla, CA).
Various cloning vectors are appropriate for the construction of a cDNA
library. For example, a cDNA library can be prepared in a vector derived from bacteriophage, such as a ~,gt 10 vector. See, for example, Huynh et al., "Constructing and Screening cDNA Libraries in 7~gt10 and ~,gtll," in DNA Cloning: A
Practical Approach Vol. l, Glover (ed.), page 49 (IRL Press, 1985); Wu (1997) at pages 47-52.
Alternatively, double-stranded cDNA molecules can be inserted into a s plasmid vector, such as a PBLUESCRIPT vector (STRATAGENE; La Jolla, CA), a LAMDAGEM-4 (Promega Corp.) or other commercially available vectors. Suitable cloning vectors also can be obtained from the American Type Culture Collection (Manassas, VA).
To amplify the cloned cDNA molecules, the cDNA library is inserted into 0 a prokaryotic host, using standard techniques. For example, a cDNA library can be introduced into competent E. coli DHS cells, which can be obtained, for example, from Life Technologies, Inc. (Gaithersburg, MD).
A human genomic library can be prepared by means well-known in the art (see, for example, Ausubel (1995) at pages 5-1 to 5-6; Wu (1997) at pages 307-327).
15 Genomic DNA can be isolated by lysing tissue with the detergent Sarkosyl, digesting the lysate with proteinase K, clearing insoluble debris from the lysate by centrifugation, precipitating nucleic acid from the lysate using isopropanol, and purifying resuspended DNA on a cesium chloride density gradient.
DNA fragments that are suitable for the production of a genomic library 20 can be obtained by the random shearing of genomic DNA or by the partial digestion of genomic DNA with restriction endonucleases. Genomic DNA fragments can be inserted into a vector, such as a bacteriophage or cosmid vector, in accordance with conventional techniques, such as the use of restriction enzyme digestion to provide appropriate termini, the use of alkaline phosphatase treatment to avoid undesirable joining of DNA
molecules, 25 and ligation with appropriate ligases. Techniques for such manipulation are well-known in the art (see, for example, Ausubel (1995) at pages 5-1 to 5-6; Wu (1997) at pages 307-327).
Nucleic acid molecules that encode a human Zsig43 gene can also be obtained using the polymerase chain reaction (PCR) with oligonucleotide primers 30 having nucleotide sequences that are based upon the nucleotide sequences of the human Zsig43 gene, as described herein. General methods for screening libraries with PCR are provided by, for example, Yu et al., "Use of the Polymerase Chain Reaction to Screen Phage Libraries," in Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and Applications, White (ed.), pages 211-215 (Humana Press, Inc.
1993).
35 Moreover, techniques for using PCR to isolate related genes are described by, for example, Preston. ''Use of Degenerate Oligonucleotide Primers and the Polymerase Chain Reaction to Clone Gene Family Members," in Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications, White (ed.), pages 337 (Humana Press, Inc. 1993).
Alternatively, human genomic libraries can be obtained from commercial sources such as Research Genetics (Huntsville, AL) and the American Type Culture Collection (Manassas, VA}.
A library containing cDNA or genomic clones can be screened with one or more polynucleotide probes based upon SEQ ID NO:1, using standard methods (see, for example, Ausubel (1995) at pages 6-1 to 6-11).
Anti-Zsig43 antibodies, produced as described below, can also be used to to isolate DNA sequences that encode human Zsig43 genes from cDNA
libraries. For example, the antibodies can be used to screen ~,gtll expression libraries, or the antibodies can be used for immunoscreening following hybrid selection and translation (see, for example, Ausubel (1995) at pages 6-12 to 6-16; Margolis et al., "Screening ~, expression libraries with antibody and protein probes," in DNA Cloning 2:
Expression Systems, 2nd Edition, Glover et al. (eds.), pages 1-14 (Oxford University Press 1995)).
As an alternative, a Zsig43 gene can be obtained by synthesizing nucleic acid molecules using mutually priming long oligonucleotides and the nucleotide sequences described herein (see, for example, Ausubel ( 1995) at pages 8-8 to 8-9).
Established techniques using the polymerase chain reaction provide the ability to 2o synthesize DNA molecules at least two kilobases in length (Adang et al., Plant Molec.
Biol. 21:1131 (1993), Bambot et al., PCR Methods and Applications 2:266 (I993), Dillon et al., "Use of the Polymerase Chain Reaction for the Rapid Construction of Synthetic Genes," in Methods in Molecular Biology, Vol. 1 S: PCR Protocols:
Current Methods and Applications, White (ed.), pages 263-268, (Humana Press, Inc.
1993), and Holowachuk et al., PCR Methods Appl. 4:299 (1995)).
The nucleic acid molecules of the present invention can also be synthesized with "gene machines" using protocols such as the phosphoramidite method.
If chemically-synthesized double stranded DNA is required for an application such as the synthesis of a gene or a gene fragment, then each complementary strand is made 3o separately. The production of short genes (60 to 80 base pairs) is technically straightforward and can be accomplished by synthesizing the complementary strands and then annealing them. For the production of longer genes (>300 base pairs), however, special strategies may be required, because the coupling efficiency of each cycle during chemical DNA synthesis is seldom 100%. To overcome this problem, synthetic genes (double-stranded) are assembled in modular form from single-stranded fragments that are from 20 to 100 nucleotides in length. For reviews on polynucleotide synthesis, see, for example, Glick and Pasternak, Molecular Biotechnology, Principles and Applications of Recombinant DNA (ASM Press 1994), Itakura et al., Annu.
Rev.
Biochem. 53:323 (1984), and Climie et al., Proc. Nat'1 Acad. Sci. USA 87:633 (1990).
The sequence of a Zsig43 cDNA or Zsig43 genomic fragment can be determined using standard methods. Zsig43 polynucleotide sequences disclosed herein can also be used as probes or primers to clone S' non-coding regions of a Zsig43 gene.
Promoter elements from a Zsig43 gene can be used to direct the expression of heterologous genes in, for example, adrenal gland or pancreas of transgenic animals or patients undergoing gene therapy. The identification of genomic fragments containing a Zsig43 promoter or regulatory element can be achieved using well-established to techniques, such as deletion analysis (see, generally, Ausubel (1995)).
Cloning of 5' flanking sequences also facilitates production of Zsig43 proteins by "gene activation," as disclosed in U.S. Patent No. 5,641,670.
Briefly, expression of an endogenous Zsig43 gene in a cell is altered by introducing into the Zsig43 locus a DNA construct comprising at least a targeting sequence, a regulatory sequence, an exon, and an unpaired splice donor site. The targeting sequence is a Zsig43 5' non-coding sequence that permits homologous recombination of the construct with the endogenous Zsig43 locus, whereby the sequences within the construct become operably linked with the endogenous Zsig43 coding sequence. In this way, an endogenous Zsig43 promoter can be replaced or supplemented with other regulatory 2o sequences to provide enhanced, tissue-specific, or otherwise regulated expression.
4. Production of Zsig43 Gene Variants The present invention provides a variety of nucleic acid molecules, including DNA and RNA molecules, that encode the Zsig43 polypeptides disclosed herein. Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules. SEQ ID N0:3 is a degenerate nucleotide sequence that encompasses all r.jicleic acid molecules that encode the Zsig43 polypeptides of SEQ ID
N0:2. Those skilled in the art will recognize that the degenerate sequences of SEQ ID
N0:3 also provide ali RNA sequences encoding SEQ ID N0:2 by substituting U for T.
Thus, the present invention contemplates Zsig43 polypeptide-encoding nucleic acid molecules comprising m:v~leotide 18 to nucleotide 2495 of SEQ ID NO:1, and RNA
equivalents.
Table 1 sets north the one-letter codes used within SEQ ID N0:3 to denote degenerate nucleotide positions. "Resolutions" are the nucleotides denoted by a code letter. "Complement" indi~ ates the code for the complementary nucleotide(s).

For example, the code Y denotes either C or T, and its complement R denotes A
or G, A being complementary to T, and G being complementary to C.

Table 1 NucleotideResolutionComplement Resolution A A T T

C C G G

G G C C

T T A A

R A~G Y CST

Y CST R A~G

M ABC K GET

K GET M ABC

S CMG S CMG

W ACT W ACT

H A~C~T D A~G~T

B C'G~T V A~C~G

V A~C~G B C~G~T

D A~G~T H A~C~T

N A~C~G~T N A~C~G~T

The degenerate codons used in SEQ ID N0:3, encompassing all possible codons for a given amino acid, are set forth in Table 2.

Table 2 Amino AcidOne LetterCodons Degenerate Code Codon Cys C TGC TGT TGY

Ser S AGC AGT TCA TCC TCG TCT WSN

Thr T ACA ACC ACG ACT ACN

Pro P CCA CCC CCG CCT CCN

Ala A GCA GCC GCG GCT GCN

Gly G GGA GGC GGG GGT GGN

Asn N AAC AAT AAY

Asp D GAC GAT GAY

Glu E GAA GAG GAR

Gln Q CAA CAG CAR

His H CAC CAT CAY

Arg R AGA AGG CGA CGC CGG CGT MGN

Lys K AAA AAG AAR

Met M ATG ATG

Ile I ATA ATC ATT ATH

Leu L CTA CTC CTG CTT TTA TTG YTN

Val V GTA GTC GTG GTT GTN

Phe F TTC TTT TTY

Tyr Y TAC TAT TAY

Trp W TGG TGG

Ter . TAA TAG TGA TRR

Asn~Asp B RAY

Glu~Gln Z SAR 'I

Any X NNN

One of ordinary skill in the art will appreciate that some ambiguity is introduced in determining a degenerate codon, representative of all possible codons encoding an amino acid. For example, the degenerate codon for serine (WSN) can, in some circumstances, encode arginine (AGR), and the degenerate codon for arginine (MGN) can, in some circumstances, encode serine {AGY). A similar relationship exists between codons encoding phenylalanine and leucine. Thus, some polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequence of SEQ ID N0:2. Variant sequences can be 1o readily tested for functionality as described herein.
Different species can exhibit "preferential codon usage." In general, see, Grantham et al., Nuc. Acids Res. 8:1893 (1980), Haas et al. Curr. Biol. 6:315 (1996), Wain-Hobson et al., Gene 13:355 (1981), Grosjean and Fiers, Gene 18:199 (1982), Holm, Nuc. Acids Res. 14:3075 (1986), Ikemura, J. Mol. Biol. 158:573 (1982), Sharp and Matassi, Curr. Opin. Genet. Dev. 4:851 ( 1994), Kane, Curr. Opin.
Biotechnol.
6:494 (1995), and Makrides, Microbiol. Rev. 60:512 (1996). As used herein, the term "preferential codon usage" or "preferential codons" is a term of art referring to protein translation codons that are most frequently used in cells of a certain species, thus favoring one or a few representatives of the possible codons encoding each amino acid (See Table 2). For example, the amino acid Threonine (Thr) may be encoded by ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly used codon;
in other species, for example, insect cells, yeast, viruses or bacteria, different Thr codons may be preferential. Preferential codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferential codon sequences into recombinant DNA
can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species. Therefore, the degenerate codon sequences disclosed in SEQ ID N0:3 serves as a template for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferential codons can be tested and optimized for expression in various species, and tested for functionality as disclosed herein.
The present invention further provides variant polypeptides and nucleic acid molecules that represent counterparts from other species (orthologs).
These species include, but are not limited to mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species. Of particular interest are Zsig43 polypeptides from other mammalian species, including porcine, marine, ovine, bovine, canine, feline, equine, and other primate polypeptides. Orthologs of human Zsig43 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA obtained from a tissue or cell type that expresses Zsig43 as disclosed herein. Suitable sources of mRNA can be identified by probing northern blots with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line.
A Zsig43-encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences. A cDNA can also be cloned using l0 the polymerase chain reaction with primers designed from the representative human Zsig43 sequences disclosed herein. Within an additional method, the cDNA
library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to Zsig43 polypeptide. Similar techniques can also be applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequence disclosed in SEQ ID NO:1 represents a single allele of human Zsig43, and that allelic variation and alternative splicing are expected to occur. Allelic variants of this sequence can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures. Allelic variants of the nucleotide sequence shown in SEQ
ID
NO:1, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are proteins which are allelic variants of SEQ ID N0:2. cDNA molecules generated from alternatively spliced mRNAs, which retain the properties of the Zsig43 polypeptide are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs. Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.
Within preferred embodiments of the invention, the isolated nucleic acid molecules can hybridize to nucleic acid molecules having the nucleotide sequence of 3o SEQ ID NO:1, or a sequence complementary thereto, under stringent conditions. In general, stringent conditions are selected to be about S°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
A pair of nucleic acid molecules, such as DNA-DNA, RNA-RNA and DNA-RNA, can hybridize if the nucleotide sequences have some degree of complementarity. Hybrids can tolerate mismatched base pairs in the double helix, but the stability of the hybrid is influenced by the degree of mismatch. The Tm of the mismatched hybrid decreases by 1°C for every 1-1.5% base pair mismatch.
Varying the stringency of the hybridization conditions allows control over the degree of mismatch that will be present in the hybrid. The degree of stringency increases as the 5 hybridization temperature increases and the ionic strength of the hybridization buffer decreases. Stringent hybridization conditions encompass temperatures of about 5-25°C
below the Tm of the hybrid and a hybridization buffer having up to 1 M Na+.
Higher degrees of stringency at lower temperatures can be achieved with the addition of formamide which reduces the Tm of the hybrid about 1 °C for each 1 %
formamide in the t o buffer solution. Generally, such stringent conditions include temperatures of 20-70°C
and a hybridization buffer containing up to 6x SSC and 0-50% formamide. A
higher degree of stringency can be achieved at temperatures of from 40-70°C
with a hybridization buffer having up to 4x SSC and from 0-SO% formamide. Highly stringent conditions typically encompass temperatures of 42-70°C with a hybridization 15 buffer having up to lx SSC and 0-50% formamide. Different degrees of stringency can be used during hybridization and washing to achieve maximum specific binding to the target sequence. Typically, the washes following hybridization are performed at increasing degrees of stringency to remove non-hybridized polynucleotide probes from hybridized complexes.

20 The above conditions are meant to serve as a guide and it is well within the abilities of one skilled in the art to adapt these conditions for use with a particular polypeptide hybrid. The Tm for a specific target sequence is the temperature (under defined conditions) at which 50% of the target sequence will hybridize to a perfectly matched probe sequence. Those conditions which influence the Tm include, the size 25 and base pair content of the polynucleotide probe, the ionic strength of the hybridization solution, and the presence of destabilizing agents in the hybridization solution. Numerous equations for calculating T,"-are known in the art, and are specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition {Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current Protocols in Molecular Biology (John Wiley and Sons, Inc. 1987); Berger and Kimmel (eds.), Guide to Molecular Cloning Techniques, (Academic Press, Inc. 1987);
and Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227 (1990)). Sequence analysis software such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0 (Premier Biosoft International; Palo Alto, CA), as well as sites on the Internet, are available tools for analyzing a given sequence and calculating Tm based on user defined criteria.
Such programs can also analyze a given sequence under defined conditions and identify suitable probe sequences. Typically, hybridization of longer polynucleotide sequences, >50 base pairs, is performed at temperatures of about 20-25°C below the calculated T,".
For smaller probes, <50 base pairs, hybridization is typically carried out at the Tm or S-10°C below. This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA hybrids.
The length of the polynucleotide sequence influences the rate and stability of hybrid formation. Smaller probe sequences, <50 base pairs, reach equilibrium with complementary sequences rapidly, but may form less stable hybrids.
Incubation times of anywhere from minutes to hours can be used to achieve hybrid formation. Longer probe sequences come to equilibrium more slowly, but form more stable complexes even at lower temperatures. Incubations are allowed to proceed overnight or longer. Generally, incubations are carried out for a period equal to three times the calculated Cot time. Cot time, the time it takes for the polynucleotide sequences to reassociate, can be calculated for a particular sequence by methods known t s in the art.
The base pair composition of polynucleotide sequence will effect the thermal stability of the hybrid complex, thereby influencing the choice of hybridization temperature and the ionic strength of the hybridization buffer. A-T pairs are less stable than G-C pairs in aqueous solutions containing sodium chloride. Therefore, the higher 2o the G-C content, the more stable the hybrid. Even distribution of G and C
residues within the sequence also contribute positively to hybrid stability. In addition, the base pair composition can be manipulated to alter the T,~ of a given sequence. For example, 5-methyldeoxycytidine can be substituted for deoxycytidine and 5-bromodeoxuridine can be substituted for thymidine to increase the T",, whereas 7-deazz-2'-deoxyguanosine 25 can be substituted for guanosine to reduce dependence on Tm .
The ionic concentration of the hybridization buffer also affects the stability of the hybrid. Hybridization buffers generally contain blocking agents such as Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon sperm DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na' source, such as SSC
30 ( 1 x SSC: 0.1 S M sodium chloride, 15 mM sodium citrate) or SSPE ( 1 x SSPE: 1.8 M
NaCI, 10 mM NaH,P04, 1 mM EDTA, pH 7.7). By decreasing the ionic concentration of the buffer, the stability of the hybrid is increased. Typically, hybridization buffers contain from between 10 mM - 1 M Na+. The addition of destabilizing or denaturing agents such as formamide, tetralkylammonium salts, guanidinium cations or 3s thiocyanate cations to the hybridization solution will alter the T", of a hybrid.
Typically, formamide is used at a concentration of up to 50% to allow incubations to be carried out at more convenient and lower temperatures. Formamide also acts to reduce non-specific background when using RNA probes.
As an illustration, a nucleic acid molecule encoding a variant Zsig43 polypeptide can be hybridized with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1 (or its complement) at 42°C overnight in a solution comprising 50% formamide, SxSSC (IxSSC: 0.15 M sodium chloride and 15 mM
sodium citrate), 50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution (100x Denhardt's solution: 2% (w/v) Ficoll 400, 2% (w/v) polyvinylpyrrolidone, and 2%
(w/v) bovine serum albumin, 10% dextran sulfate, and 20 p.g/ml denatured, sheared t0 salmon sperm DNA. One of skill in the art can devise variations of these hybridization conditions. For example, the hybridization mixture can be incubated at a higher temperature, such as about 65°C, in a solution that does not contain formamide.
Moreover, premixed hybridization solutions are available (e.g., EXPRESSHYB
Hybridization Solution from CLONTECH Laboratories, Inc.), and hybridization can be performed according to the manufacturer's instructions.
Following hybridization, the nucleic acid molecules can be washed to remove non-hybridized nucleic acid molecules under stringent conditions, or under highly stringent conditions. Typical stringent washing conditions include washing in a solution of O.Sx - 2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 55 -65°C. That 2o is, nucleic acid molecules encoding a variant Zsig43 polypeptide hybridize with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1 (or its complement) under stringent washing conditions, in which the wash stringency is equivalent to O.Sx - 2x SSC with 0.1% SDS at 55 - 65°C, including O.Sx SSC with 0.1% SDS at SS°C, or 2xSSC with 0.1% SDS at 65°C. One of skill in the art can readily devise equivalent conditions, for example, by substituting the SSPE
for SSC in the wash solution.
Typical highly stringent washing conditions include washing in a solution of O.lx - 0.2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 50 -65°C. In other words, nucleic acid molecules encoding a variant Zsig43 polypeptide hybridize with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1 (or its complement) under highly stringent washing conditions, in which the wash stringency is equivalent to O.lx - 0.2x SSC with 0.1% SDS at 50 - 65°C, including O.lx SSC with 0.1% SDS at 50°C, or 0.2xSSC with 0.1% SDS at 65°C.
The present invention also provides isolated Zsig43 polypeptides that have a substantially similar sequence identity to the polypeptide of SEQ ID
N0:2, or their orthologs. The term "substantially similar sequence identity" is used herein to denote polypeptides having 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence shown in SEQ ID N0:2.
The present invention also contemplates Zsig43 variant nucleic acid molecules that can be identified using two criteria: a determination of the similarity s between the encoded polypeptide with the amino acid sequence of SEQ ID N0:2, and a hybridization assay, as described above. Such Zsig43 variants include nucleic acid molecules ( 1 ) that hybridize with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1 (or its complement) under stringent washing conditions, in which the wash stringency is equivalent to O.Sx - 2x SSC with 0.1% SDS at 55 -65°C, to and (2) that encode a polypeptide having 70%, 80%, 90%, 95% 96%, 97%, 98%
or 99% sequence identity to the amino acid sequence of SEQ ID N0:2.
Alternatively, Zsig43 variants can be characterized as nucleic acid molecules (1) that hybridize with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1 (or its complement) under highly stringent washing 1s conditions, in which the wash stringency is equivalent to O.lx - 0.2x SSC
with 0.1%
SDS at 50 - 65°C, and (2) that encode a polypeptide having 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of SEQ ID
N0:2.
Percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603 (1986), and Henikoff and 2o Henikoff, Proc. Nat'1 Acad Sci. USA 89:1091 s ( 1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of l, and the "BLOSUM62" scoring matrix of Henikoff and Henikoff (ibid.) as shown in Table 3 (amino acids are indicated by the standard one-letter codes). The percent identity is then calculated as: ([Total number of identical 2s matches]/ [length of the longer sequence plus the number of gaps introduced into the longer sequence in order to align the two sequences])(100).

w rl N M
ri 1 V' rl M N N

I~ ~ rl etr M N

lD dl N N ri M rl I I I
~'. l(1 O N ri r1 r1 '-1 rl M
." x IIW 1 M rl O rl M N N
wQ I 1 I I 1 I 1 ELI a ~ N N O M N .-1 N '-i n-1 dl N M rl O M N rl M rl M

xi 00 M M '-I N rl N n-1 N N N M

CJ l0 N V~ VI N M M N O N N M M

W to N O M M rl N M e-1 O rl M N N

ll1 N N O M N rl O M r-I O 'i N rl N

U 01 M dl M M r-I ri M ri N M ri r1 N N ri 1 I I 1 I I I I 1 1 t I 1 1 I
A l0 M O N rl rl M ep rl M M rl O rl dl M M

7-I ~O r1 M O O O r-I M M O N M N ri O d' N M

l11 O N M ri O N O M N N 'i M N rW -i M N M

A', d' e1 N N O ri ri O N t-I r1 ri '-I N r1 rl O M N O

C x z A v a w ~ x H a x ~ w w cn H 3 o In o Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson and Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and 5 the amino acid sequence of a putative Zsig43 variant. The FASTA algorithm is described by Pearson and Lipman, Proc. Nat'1 Acad. Sci. USA 85:2444 (1988), and by Pearson, Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID
N0:2) and a test sequence that have either the highest density of identities (if the ktup variable is 10 I ) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed"
to include only those residues that contribute to the highest score. If there are several regions with 15 scores greater than the "cutoff' value (calculated by a predetermined formula based upon the length of the sequence and the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch-Sellers 20 algorithm (Needleman and Wunsch, J. Mol. Biol. 48:444 ( 1970); Sellers, SIAM J. Appl.
Math. 26:787 ( 1974)), which allows for amino acid insertions and deletions.
Illustrative parameters for FASTA analysis are: ktup=1, gap opening penalty=10, gap extension penalty=1. and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), 25 as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 ( 1990).
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as described above.
30 The present invention includes nucleic acid molecules that encode a polypeptide having a conservative amino acid change, compared with the amino acid sequence of SEQ ID N0:2. That is, variants can be obtained that contain one or more amino acid substitutions of SEQ ID N0:2, in which an alkyl amino acid is substituted for an alkyl amino acid in a Zsig43 amino acid sequence, an aromatic amino acid is 3s substituted for an aromatic amino acid in a Zsig43 amino acid sequence, a sulfur-containing amino acid is substituted for a sulfur-containing amino acid in a Zsig43 amino acid sequence, a hydroxy-containing amino acid is substituted for a hydroxy-containing amino acid in a Zsig43 amino acid sequence, an acidic amino acid is substituted for an acidic amino acid in a Zsig43 amino acid sequence, a basic amino acid is substituted for a basic amino acid in a Zsig43 amino acid sequence, or a dibasic monocarboxylic amino acid is substituted for a dibasic monocarboxylic amino acid in a Zsig43 amino acid sequence.
Among the common amino acids, for example, a "conservative amino acid substitution" is illustrated by a substitution among amino acids within each of the following groups: (1) glycine, alanine, valine, leucine, and isoleucine, (2) phenylalanine, tyrosine, and tryptophan, (3) serine and threonine, (4) aspartate and to glutamate, (5) glutamine and asparagine, and (6) lysine, arginine and histidine.
The BLOSUM62 table is an amino acid substitution matrix derived from about 2,000 local multiple alignments of protein sequence segments, representing highly conserved regions of more than 500 groups of related proteins (Henikoff and Henikoff, Proc. Nat'1 Acad. Sci. USA 89:10915 (1992)). Accordingly, the substitution frequencies can be used to define conservative amino acid substitutions that may be introduced into the amino acid sequences of the present invention.
Although it is possible to design amino acid substitutions based solely upon chemical properties (as discussed above), the language "conservative amino acid substitution"
preferably refers to a substitution represented by a BLOSUM62 value of greater than -1. For example, 2o an amino acid substitution is conservative if the substitution is characterized by a BLOSUM62 value of 0, 1, 2, or 3. According to this system, preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least I
(e.g., 1, 2 or 3), while more preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 2 (e.g., 2 or 3).
Particular variants of Zsig43 are characterized by having at least 70%, at least 80%, at least 90%, at least 95% or greater than 95% sequence identity to the corresponding amino acid sequence (e.g., SEQ ID N0:2), wherein the variation in amino acid sequence is due to one or more conservative amino acid substitutions.
Conservative amino acid changes in a Zsig43 gene can be introduced by 3o substituting nucleotides for the nucleotides recited in SEQ ID NO:1. Such "conservative amino acid" variants can be obtained, for example, by oligonucleotide directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22; and McPherson (ed.), Directed Mutagenesis: A Practical Approach (IRL Press 1991 )).
The proteins of the present invention can also comprise non-naturally occurring amino acid residues. Non-naturally occurring amino acids include, without limitation. traps-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline, traps-4-hydroxyproline, N methylglycine, allo-threonine, methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins. For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of 1o plasmids containing nonsense mutations is typically carried out in a cell-free system comprising an E. coli S30 extract and commercially available enzymes and other reagents. Proteins are purified by chromatography. See, for example, Robertson et al., J. Am. Chem. Soc. 113:2722 ( 1991 ), Ellman et al., Methods Enzymol. 202:301 ( 1991 ), Chung et al., Science 259:806 (1993), and Chung et al., Proc. Nat'1 Acad. Sci.
USA
t 5 90:10145 ( 1993 ).
In a second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al., J. Biol. Chem. 271:19991 (1996)). Within a third method, E.
coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., 2o phenylalanine) and in the presence of the desired non-naturally occurring amino acids) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-naturally occurring amino acid is incorporated into the protein in place of its natural counterpart. See, Koide et al., Biochem.
33:7470 (1994).
Naturally occurring amino acid residues can be converted to non-naturally occurring 25 species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395 (1993)).
A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural 30 amino acids may be substituted for Zsig43 amino acid residues.
Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081 (1989), Bass et al., Proc. Nat'1 Acad Sci. USA 88:4498 ( 1991 ); Coombs and Corey, "Site-35 Directed Mutagenesis and Protein Engineering," in Proteins: Analysis and Design, Angeletti (ed.), pages 259-311 (Academic Press, Inc. 1998)). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity as disclosed below to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., J. Biol. Chem. 271:4699 (1996).
The location of Zsig43 ligand binding domains can also be determined s by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306 (1992), Smith et al., J. Mol. Biol. 224:899 (1992), and Wlodaver et al., FEBSLett. 309:59 (1992).
to Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53 (1988)) or Bowie and Sauer (Proc. Nat'1 Acad. Sci. USA
86:2152 (1989)). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional 15 polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832 (1991), Ladner et al., U.S. Patent No. 5,223,409, Huse, international publication No. WO 92/06204, and region-directed mutagenesis (Derbyshire et al., Gene 46:145 (1986), and Ner et al., 20 DNA 7:127, (1988)).
Variants of the disclosed Zsig43 nucleotide and polypeptide sequences can also be generated through DNA shuffling as disclosed by Stemmer, Nature 370:389 ( 1994), Stemmer, Proc. Nat 'I Acad. Sci. USA 91:10747 ( 1994), and international publication No. WO 97/20078. Briefly, variant DNAs are generated by in vitro 25 homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. This technique can be modified by using a family of parent DNAs, such as allelic variants or DNAs from different species, to introduce additional variability into the process.
Selection or screening for the desired activity, followed by additional iterations of 30 mutagenesis and assay provides for rapid "evolution" of sequences by selecting for desirable mutations while simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides in host cells. Mutagenized DNA molecules that encode biologically 35 active polypeptides, or polypeptides that bind with anti-Zsig43 antibodies, can be recovered from the host cells and rapidly sequenced using modern equipment.
These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
The present invention also includes "functional fragments" of Zsig43 polypeptides and nucleic acid molecules encoding such functional fragments.
Examples of Zsig43 functional fragments include the signal sequence (e.g., amino acid residues 1-25 of SEQ ID N0:2), the extracellular domain (e.g., amino acid residues 26-315 of SEQ ID N0:2), the transmembrane domain (e.g., amino acid residues 316-of SEQ ID N0:2), the intracellular domain (e.g., amino acid residues 341-826 of SEQ
ID N0:2), an SH2 binding domain (e.g., amino acid residues 381-479 of SEQ ID
N0:2), and combinations thereof. A polypeptide that comprises the Zsig43 extracellular domain, but lacks a transmembrane domain, is considered to be a "soluble Zsig43 receptor." Examples of soluble Zsig43 receptors include an extracellular domain (e.g., amino acid residues 26-315 of SEQ ID N0:2), a signal sequence with an extracellular domain (e.g., amino acid residues 1-315 of SEQ ID N0:2), an extracellular domain with an intracellular domain (e.g., amino acid residues 26-315 and amino acid residues 341 to 826 of SEQ ID N0:2), a signal sequence with an extracellular domain and an intracellular domain (e.g., amino acid residues 1-315 and amino acid residues 341 to 826 of SEQ ID N0:2), and the like.
Routine deletion analyses of nucleic acid molecules can be performed to obtain functional fragments of a nucleic acid molecule that encodes a Zsig43 polypeptide. As an illustration, DNA molecules having the nucleotide sequence of SEQ ID NO:1 can be digested with Ba131 nuclease to obtain a series of nested deletions. One alternative to exonuclease digestion is to use oligonucleotide-directed mutagenesis to introduce deletions or stop codons to specify production of a desired fragment. Alternatively, particular fragments of a Zsig43 gene can be synthesized using the polymerase chain reaction.
As an illustration, studies on the truncation at either or both termini of interferons have been summarized by Horisberger and Di Marco, Pharmac. Ther.
66:507 (1995). Moreover, standard techniques for functional analysis of proteins are 3o described by, for example, Treuter et al., Molec. Gen. Genet. 240:113 (1993), Content et al., "Expression and preliminary deletion analysis of the 42 kDa 2-SA
synthetase induced by human interferon," in Biological Interferon Systems, Proceedings of ISIR-TNO Meeting on Interferon Systems. Cantell (ed.), pages 65-72 (Nijhoff 1987), Herschman, "The EGF Receptor," in Control of Animal Cell Proliferation, Vol.
l, Boynton et al., (eds.) pages 169-199 (Academic Press 1985), Coumailleau et al., J.
Biol. Chena. 270:29270 (1995); Fukunaga et al., J. Biol. Chem. 270:25291 (1995);

Yamaguchi et al., Biochem. Pharmacol. 50:1295 (1995), and Meisel et al., Plant Molec. Biol. 30:1 (1996).
The present invention also contemplates functional fragments of a Zsig43 gene that has amino acid changes, compared with the amino acid sequence of 5 SEQ ID N0:2. A variant Zsig43 gene can be identified on the basis of structure by determining the level of identity with nucleotide and amino acid sequences of SEQ ID
NOs:l and 2, as discussed above. An alternative approach to identifying a variant gene on the basis of structure is to determine whether a nucleic acid molecule encoding a potential variant Zsig43 gene can hybridize to a nucleic acid molecule having the to nucleotide sequence of SEQ ID NO:1, as discussed above.
The present invention also provides polypeptide fragments or peptides comprising an epitope-bearing portion of a Zsig43 polypeptide described herein. Such fragments or peptides may comprise an "immunogenic epitope," which is a part of a protein that elicits an antibody response when the entire protein is used as an 15 immunogen. Immunogenic epitope-bearing peptides can be identified using standard methods (see, for example, Geysen et al., Proc. Nat'1 Acad. Sci. USA 81:3998 (1983)).
In contrast, polypeptide fragments or peptides may comprise an "antigenic epitope," which is a region of a protein molecule to which an antibody can specifically bind. Certain epitopes consist of a linear or contiguous stretch of amino 2o acids, and the antigenicity of such an epitope is not disrupted by denaturing agents. It is known in the art that relatively short synthetic peptides that can mimic epitopes of a protein can be used to stimulate the production of antibodies against the protein (see, for example, Sutcliffe et al., Science 219:660 (1983)). Accordingly, antigenic epitope-bearing peptides and polypeptides of the present invention are useful to raise antibodies 25 that bind with the polypeptides described herein.
Antigenic epitope-bearing peptides and polypeptides preferably contain at least four to ten amino acids, at least ten to fifteen amino acids, or about 1 S to about 30 amino acids of SEQ ID N0:2. Such epitope-bearing peptides and polypeptides can be produced by fragmenting a Zsig43 polypeptide, or by chemical peptide synthesis, as 3o described herein. Moreover, epitopes can be selected by phage display of random peptide libraries (see, for example, Lane and Stephen, Curr. Opin. Immunol.
5:268 (1993), and Cortese et al., Curr. Opin. Biotechnol. 7:616 (1996)). Standard methods for identifying epitopes and producing antibodies from small peptides that comprise an epitope are described, for example, by Mole, "Epitope Mapping," in Methods in 35 Molecular Biology, Vol. 10, Manson (ed.), pages 105-116 (The Humana Press, Inc.
1992), Price, "Production and Characterization of Synthetic Peptide-Derived Antibodies," in Monoclonal Antibodies: Production, Engineering, and Clinical Application, Ritter and Ladyman (eds.), pages 60-84 (Cambridge University Press 1995), and Coligan et al. (eds.), Current Protocols in Immunology, pages 9.3.1 - 9.3.5 and pages 9.4.1 - 9.4.11 (John Wiley & Sons 1997).
For any Zsig43 polypeptide, including variants and fusion proteins, one of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant using the information set forth in Tables 1 and 2 above.
Moreover, those of skill in the art can use standard software to devise Zsig43 variants based upon the nucleotide and amino acid sequences described herein.
Accordingly, the present invention includes a computer-readable medium encoded with a data 1o structure that provides at least one of SEQ ID NO:1, SEQ ID N0:2, and SEQ
ID N0:3.
Suitable forms of computer-readable media include magnetic media and optically-readable media. Examples of magnetic media include a hard or fixed drive, a random access memory (RAM) chip, a floppy disk, digital linear tape (DLT), a disk cache, and a ZIP disk. Optically readable media are exemplified by compact discs (e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable), and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, and DVD+RW).
5. Production of Zsig43 Fusion Proteins Fusion proteins of Zsig43 can be used to express Zsig43 in a recombinant host, and to isolate expressed Zsig43. As described below, particular Zsig43 fusion proteins also have uses in diagnosis and therapy.
One type of fusion protein comprises a peptide that guides a Zsig43 polypeptide from a recombinant host cell. To direct a Zsig43 polypeptide into the secretory pathway of a eukaryotic host cell, a secretory signal sequence (also known as a signal peptide, a leader sequence, prepro sequence or pre sequence) is provided in the Zsig43 expression vector. While the secretory signal sequence may be derived from Zsig43, a suitable signal sequence may also be derived from another secreted protein or synthesized de novo. The secretory signal sequence is operably linked to a Zsig43-encoding sequence such that the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell. Secretory signal sequences are commonly positioned 5' to the nucleotide sequence encoding the polypeptide of interest, although certain secretory signal sequences may be positioned elsewhere in the nucleotide sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5.037,743; Holland et al., U.S.
Patent No.
5,143,830).

Although the secretory signal sequence of Zsig43 or another protein produced by mammalian cells (e.g., tissue-type plasminogen activator signal sequence, as described, for example, in U.S. Patent No. 5,641,655) is useful for expression of Zsig43 in recombinant mammalian hosts, a yeast signal sequence is preferred for expression in yeast cells. Examples of suitable yeast signal sequences are those derived from yeast mating phermone a-factor (encoded by the MFal gene), invertase (encoded by the SUC2 gene), or acid phosphatase (encoded by the PHOS gene}. See, for example, Romanos et al., "Expression of Cloned Genes in Yeast," in DNA Cloning 2: A
Practical Approach, 2"d Edition, Glover and Hames (eds.), pages 123-167 (Oxford University Press 1995}.
In bacterial cells, it is often desirable to express a heterologous protein as a fusion protein to decrease toxicity, increase stability, and to enhance recovery of the expressed protein. For example, Zsig43 can be expressed as a fusion protein comprising a glutathione S-transferase polypeptide. Glutathione S-transferease fusion proteins are typically soluble, and easily purifiable from E. coli lysates on immobilized glutathione columns. In similar approaches, a Zsig43 fusion protein comprising a maltose binding protein polypeptide can be isolated with an amylose resin column, while a fusion protein comprising the C-terminal end of a truncated Protein A
gene can be purified using IgG-Sepharose. Established techniques for expressing a heterologous 2o polypeptide as a fusion protein in a bacterial cell are described, for example, by Williams et al., "Expression of Foreign Proteins in E. coli Using Plasmid Vectors and Purification of Specific Polyclonal Antibodies," in DNA Cloning 2: A Practical Approach, 2"d Edition, Glover and Hames (Eds.), pages 15-58 (Oxford University Press 1995). In addition. commercially available expression systems are available.
For example, the PINPOINT Xa protein purification system (Promega Corporation;
Madison, WI) provides a method for isolating a fusion protein comprising a polypeptide that becomes biotinylated during expression with a resin that comprises avidin.
Peptide tags that are useful for isolating heterologous polypeptides expressed by either prokaryotic or eukaryotic cells include polyHistidine tags (which have an affinity for nickel-chelating resin, c-myc tags, calmodulin binding protein (isolated with calmodulin affinity chromatography), substance P, the RYIRS tag (which binds with anti-RYIRS antibodies), the Glu-Glu tag, and the FLAG tag (which binds with anti-FLAG antibodies). See, for example, Luo et al., Arch. Biochem.
Biophys.
329:215 (1996), Morganti et al., Biotechnol. Appl. Biochem. 23:67 (1996), and Zheng et al., Gene 186:5 (1997). Nucleic acid molecules encoding such peptide tags are available, for example, from Sigma-Aldrich Corporation (St. Louis. MO).

The present invention also contemplates that the use of the secretory signal sequence contained in the Zsig43 polypeptides of the present invention to direct other polypeptides into the secretory pathway. A signal fusion polypeptide can be made wherein a secretory signal sequence derived amino acid residue 1 to about 25 of SEQ ID N0:2 operably linked to another polypeptide using methods known in the art and disclosed herein. The secretory signal sequence contained in the fusion polypeptides of the present invention is preferably fused amino-terminally to an additional peptide to direct the additional peptide into the secretory pathway. Such constructs have numerous applications known in the art. For example, these novel 1o secretory signal sequence fusion constructs can direct the secretion of an active component of a normally non-secreted protein, such as a receptor. Such fusions may be used in a transgenic animal or in a cultured recombinant host to direct peptides through the secretory pathway. With regard to the latter, exemplary polypeptides include pharmaceutically active molecules such as Factor VIIa, proinsulin, insulin, follicle t 5 stimulating hormone, tissue type plasminogen activator, tumor necrosis factor, interleukins (e.g., interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, and IL-15), colony stimulating factors (e.g., granulocyte-colony stimulating factor (G-CSF) and granulocyte macrophage-colony stimulating factor (GM-CSF)), interferons (e.g., interferons-a, -(i, -y, -cu, -8, and -T), the 20 stem cell growth factor designated "S 1 factor," erythropoietin, and thrombopoietin.
The Zsig43 secretory signal sequence contained in the fusion polypeptides of the present invention is preferably fused amino-terminally to an additional peptide to direct the additional peptide into the secretory pathway. Fusion proteins comprising a Zsig43 secretory signal sequence can be constructed using standard techniques.
25 Another form of fusion protein comprises a Zsig43 polypeptide and an immunoglobulin heavy chain constant region, typically an Fc fragment, which contains two constant region domains and a hinge region but lacks the variable region.
Fusions of this type can be used, for example, as an in vitro assay tool. For example, the presence of a Zsig43 ligand in a biological sample can be detected using a Zsig43-30 antibody fusion protein, in which the Zsig43 moiety is used to target the cognate ligand, and a macromolecule. such as Protein A or anti-Fc antibody, is used to detect the bound fusion protein-ligand complex. An illustrative fusion protein comprises the Zsig43 extracelluIar domain (e.g., amino acids 26 to 315 of SEQ ID N0:2) and an Fc moiety.
Fusion proteins can be prepared by methods known to those skilled in 35 the art by preparing each component of the fusion protein and chemically conjugating them. Alternatively, a polynucleotide encoding both components of the fusion protein in the proper reading frame can be generated using known techniques and expressed by the methods described herein. For example, part or all of a domains) conferring a biological function can be exchanged between Zsig43 of the present invention with the functionally equivalent domains) from another transmembrane protein. Such domains include, but are not limited to, the secretory signal sequence, extracellular domain, s transmembrane domain, and intracellular domain. General methods for enzymatic and chemical cleavage of fusion proteins are described, for example, by Ausubel (1995) at pages 16-19 to 16-25.
6. Production of Zsig43 Polypeptides in Cultured Cells 1 o The polypeptides of the present invention, including full-length polypeptides, functional fragments, and fusion proteins, can be produced in recombinant host cells following conventional techniques. To express a Zsig43 gene, a nucleic acid molecule encoding the polypeptide must be operably linked to regulatory sequences that control transcriptional expression in an expression vector and then, introduced into a host 1 s cell. In addition to transcriptional regulatory sequences, such as promoters and enhancers, expression vectors can include translational regulatory sequences and a marker gene which is suitable for selection of cells that carry the expression vector.
Expression vectors that are suitable for production of a foreign protein in eukaryotic cells typically contain ( 1 ) prokaryotic DNA elements coding for a bacterial 2o replication origin and an antibiotic resistance marker to provide for the growth and selection of the expression vector in a bacterial host; (2) eukaryotic DNA
elements that control initiation of transcription, such as a promoter; and (3) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence. As discussed above, expression vectors can also 2s include nucleotide sequences encoding a secretory sequence that directs the heterologous polypeptide into the secretory pathway of a host cell. For example, a Zsig43 expression vector may comprise a Zsig43 gene and a secretory sequence derived from a Zsig43 gene or another secreted gene.
Zsig43 proteins of the present invention may be expressed in 3o mammalian cells. Examples of suitable mammalian host cells include African green monkey kidney cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293-HEK; ATCC CRL 1573}, baby hamster kidney cells (BHK-21, BHK-570; ATCC CRL
8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34), Chinese hamster ovary cells (CHO-K1; ATCC CCL61; CHO DG44 (Chasm et al., Som. Cell.
35 Molec. Genet. 12:555, 1986)), rat pituitary cells (GH1; ATCG CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E; ATCC CRL 1548) SV40-transformed monkey kidney cells (COS-1; ATCC CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
For a mammalian host, the transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, 5 simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression. Suitable transcriptional and translational regulatory sequences also can be obtained from mammalian genes, such as actin, collagen, myosin, and metallothionein genes.
Transcriptional regulatory sequences include a promoter region 1 o sufficient to direct the initiation of RNA synthesis. Suitable eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al., J.
Molec. Appl.
Genet. 1:273 (1982)), the TK promoter of Herpes virus (McKnight, Cell 31:355 (1982)), the SV40 early promoter (Benoist et al., Nature 290:304 (1981)), the Rous sarcoma virus promoter (Gorman et al., Proc. Nat'1 Acad. Sci. USA 79:6777 (1982)), t5 the cytomegalovirus promoter (Foecking et al., Gene 45:101 (1980)), and the mouse mammary tumor virus promoter (see, generally, Etcheverry, "Expression of Engineered Proteins in Mammalian Cell Culture," in Protein Engineering: Principles and Practice, Cleland et al. (eds.), pages 163-181 (John Wiley & Sons, Inc. 1996)).
Alternatively, a prokaryotic promoter, such as the bacteriophage T3 2o RNA polymerase promoter, can be used to control Zsig43 gene expression in mammalian cells if the prokaryotic promoter is regulated by a eukaryotic promoter (Zhou et al., Mol. Cell. Biol. 10:4529 (1990), and Kaufman et al., Nucl. Acids Res.
19:4485 ( 1991 )).
An expression vector can be introduced into host cells using a variety of 25 standard techniques including calcium phosphate transfection, liposome-mediated transfection, microprojectile-mediated delivery, electroporation, and the like. Preferably, the transfected cells are selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome.
Techniques for introducing vectors into eukaryotic cells and techniques for selecting such stable 3o transformants using a dominant selectable marker are described, for example, by Ausubel (1995) and by Murray (ed.), Gene Transfer and Expression Protocols (Humana Press 1991 ).
For example, one suitable selectable marker is a gene that provides resistance to the antibiotic neomycin. In this case, selection is carried out in the 35 presence of a neomycin-type drug, such as G-418 or the like. Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification." Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes. A preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate. Other drug resistance genes (e.g., hygromycin resistance, multi-drug resistance, puromycin acetyltransferase) can also be used. Alternatively, markers that introduce an altered phenotype, such as green fluorescent protein, or cell surface proteins (e.g., CD4, CDB, Glass I MHC, and placental alkaline phosphatase) may be used to sort transfected cells from untransfected cells by such means as FRCS sorting or magnetic bead separation technology.
1 o Zsig43 polypeptides can also be produced by cultured mammalian cells using a viral delivery system. Exemplary viruses for this purpose include adenovirus, herpesvirus, vaccinia virus and adeno-associated virus (AAV). Adenovirus, a double-stranded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for a review, see Becker et al., Meth. Cell Biol.
43:161 (1994), and Douglas and Curiel, Science & Medicine 4:44 (1997)). Advantages of the adenovirus system include the accommodation of relatively large DNA inserts, the ability to grow to high-titer, the ability to infect a broad range of mammalian cell types, and flexibility that allows use with a large number of available vectors containing different promoters.
2o By deleting portions of the adenovirus genome, larger inserts (up to 7 kb) of heterologous DNA can be accommodated. These inserts can be incorporated into the viral DNA by direct ligation or by homologous recombination with a co-transfected plasmid. An option is to delete the essential EI gene from the viral vector, which results in the inability to replicate unless the El gene is provided by the host cell.
Adenovirus vector-infected human 293 cells (ATCC Nos. CRL-1573, 45504, 45505), for example, can be grown as adherent cells or in suspension culture at relatively high cell density to produce significant amounts of protein (see Gamier et al., Cytotechnol.
15:145 (1994)).
Zsig43 genes may also be expressed in other higher eukaryotic cells, 3o such as avian, fungal, insect, yeast, or plant cells. The baculovirus system provides an efficient means to introduce cloned Zsig43 genes into insect cells. Suitable expression vectors are based upon the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), and contain well-known promoters such as Drosophila heat shock protein (hsp) 70 promoter, Autographa californica nuclear polyhedrosis virus immediate-early gene promoter (ie-I ) and the delayed early 39K promoter, baculovirus p10 promoter, and the Drosophila metallothionein promoter. A second method of making recombinant baculovirus utilizes a transposon-based system described by Luckow (Luckow, et al., J.

Virol. 67:4566 (1993)). This system, which utilizes transfer vectors, is sold in the BAC-to-BAC kit (Life Technologies, Rockville, MD). This system utilizes a transfer vector, PFASTBAC (Life Technologies) containing a Tn7 transposon to move the DNA encoding the Zsig43 polypeptide into a baculovirus genome maintained in E.
toll s as a large plasmid called a "bacmid." See, Hill-Perkins and Possee, J. Gen.
Virol.
71:971 (1990), Bonning, et al., J. Gen. Virol. 75:1551 (1994), and Chazenbalk, and Rapoport, J. Biol. Chem. 270:1543 (1995). In addition, transfer vectors can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed Zsig43 polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer et al., l0 Proc. Nat'1 Acad. Sci. 82:7952 (1985)). Using a technique known in the art, a transfer vector containing a Zsig43 gene is transformed into E. toll, and screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus.
The bacmid DNA containing the recombinant baculovirus genome is then isolated using common techniques.
is The illustrative PFASTBAC vector can be modified to a considerable degree. For example, the polyhedrin promoter can be removed and substituted with the baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter) which is expressed earlier in the baculovirus infection, and has been shown to be advantageous for expressing secreted proteins (see, for example, Hill-Perkins and Possee, J. Gen.
20 Virol. 71:971 (1990), Bonning, et al., J. Gen. Virol. 75:1551 (1994), and Chazenbalk and Rapoport, J. Biol. Chem. 270:1543 (1995). In such transfer vector constructs, a short or long version of the basic protein promoter can be used. Moreover, transfer vectors can be constructed which replace the native Zsig43 secretory signal sequences with secretory signal sequences derived from insect proteins. For example, a secretory 2s signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey bee Melittin (Invitrogen Corporation; Carlsbad, CA), or baculovirus gp67 (PharMingen: San Diego, CA) can be used in constructs to replace the native Zsig43 secretory signal sequence.
The recombinant virus or bacmid is used to transfect host cells. Suitable insect host cells include cell lines derived from IPLB-Sf 21, a Spodoptera frugiperda 30 pupal ovarian cell line, such as S~ (ATCC CRL I 711 ), Sfl l AE, and S~21 (Invitrogen Corporation; San Diego, CA), as well as Drosophila Schneider-2 cells, and the HIGH
FIVEO cell line (Invitrogen) derived from Trichoplusia hi (U.S. Patent No.
5,300,435).
Commercially available serum-free media can be used to grow and to maintain the cells. Suitable media are 500 IIT"" (Life Technologies) or ESF 921T""
(Expression 3s Systems) for the Sf~ cells; and Ex-ce11O405T"" (JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life Technologies) for the T. ni cells. When recombinant virus is used, the cells are typically grown up from an inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3.
Established techniques for producing recombinant proteins in baculovirus systems are provided by Bailey et al., "Manipulation of Baculovirus Vectors," in Methods in Molecular Biology, Volume 7: Gene Transfer and Expression Protocols, Murray (ed.), pages 147-168 (The Humana Press, Inc. 1991), by Patel et al., "The baculovirus expression system," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 205-244 (Oxford University Press 1995), by Ausubel (1995) at pages 16-37 to 16-57, by Richardson (ed.), Baculovirus Expression t0 Protocols (The Humana Press, Inc. 1995), and by Lucknow, "Insect Cell Expression Technology," in Protein Engineering: Principles and Practice, Cleland et al.
(eds.), pages 183-218 (John Wiley & Sons, Inc. 1996).
Fungal cells, including yeast cells, can also be used to express the genes described herein. Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica. Suitable promoters for expression in yeast include promoters from GALI (galactose), PGK
(phosphoglycerate kinase), ADH (alcohol dehydrogenase), AOXI (alcohol oxidase), HIS4 (histidinol dehydrogenase), and the like. Many yeast cloning vectors have been designed and are readily available. These vectors include YIp-based vectors, such as 2o YIpS, YRp vectors, such as YRpl7, YEp vectors such as YEpl3 and YCp vectors, such as YCpl9. Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311, Kawasaki et al., U.S. Patent No.
4,931,373, Brake, U.S. Patent No. 4,870,008, Welch et al., U.S. Patent No. 5,037,743, and Murray et al., U.S. Patent No. 4,845,075. Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae is the POTl vector system disclosed by Kawasaki et al.
(U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in 3o glucose-containing media. Additional suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No.
4,599,311, Kingsman et al., U.S. Patent No. 4,615,974, and Bitter, U.S. Patent No.
4,977,092) and alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446, 5,063,154, 5,139,936, and 4,661,454.
Transformation systems for other yeasts, including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactic, Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida maltosa are known in the art. See, for example, Gleeson et al., J.
Gen.
Microbiol. 132:3459 (1986), and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells may be utilized according to the methods of McKnight et al., U.S. Patent No.
4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz, U.S. Patent No. 4,486,533.
For example, the use of Pichia methanolica as host for the production of recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond, U.S. Patent No. 5,736,383, Raymond et al., Yeast 14:11-23 (1998), and in international l0 publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565.
DNA molecules for use in transforming P. methanolica will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P. methanolica, it is preferred that the promoter and terminator in the plasmid be that of a P. methanolica gene, such as a P.
methanolica alcohol utilization gene (AUGI or AUG2). Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of the DNA into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA sequences. A preferred selectable marker for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21 ), and which allows ade2 host cells to grow in the absence of adenine. For large-scale, industrial processes where it is desirable to minimize the use of methanol, it is preferred to use host cells in which both methanol utilization genes (AUGI and AUG2) are deleted. For production of secreted proteins, host cells deficient in vacuolar protease genes (PEP4 and PRBl ) are preferred.
Electroporation is used to facilitate the introduction of a plasmid containing DNA
encoding a polypeptide of interest into P. methanolica cells. P. methanolica cells can be transformed by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
Expression vectors can also be introduced into plant protoplasts, intact plant tissues, or isolated plant cells. Methods for introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA injection, electroporation, and the like. See, for example, Horsch et al., Science 227:1229 (1985), Klein et al., Biotechnology 10:268 (1992), and Miki et al., "Procedures for Introducing Foreign DNA into Plants," in Methods in Plant Molecular Biology and Biotechnology, Glick et al. (eds.), pages 67-88 (CRC Press, 1993).
Alternatively, Zsig43 genes can be expressed in prokaryotic host cells.
Suitable promoters that can be used to express Zsig43 polypeptides in a prokaryotic 5 host are well-known to those of skill in the art and include promoters capable of recognizing the T4, T3, Sp6 and T7 polymerases, the PR and P~ promoters of bacteriophage lambda, the trp, recA, heat shock, IacUVS, tac, Ipp-IacSpr, phoA, and IacZ promoters of E. coli, promoters of B. subtilis, the promoters of the bacteriophages of Bacillus, Streptomyces promoters, the int promoter of bacteriophage lambda, the bla 1 o promoter of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene. Prokaryotic promoters have been reviewed by Glick, J. Ind. Microbiol.
1:277 (1987), Watson et al., Molecular Biology of the Gene, 4th Ed. (Benjamin Cummins 1987), and by Ausubel et al. (1995).
Preferred prokaryotic hosts include E. coli and Bacillus subtilus.
15 Suitable strains of E. coli include BL21(DE3), BL21(DE3)pLysS, BL21(DE3)pLysE, DH1, DH4I, DHS, DHSI, DHSIF', DHSIMCR, DH10B, DH10B/p3, DH11S, C600, HB101, JM101, JM105, JM109, JM110, K38, RRI, Y1088, Y1089, CSH18, ER1451, and ER1647 (see, for example, Brown (ed.), Molecular Biology Labfax (Academic Press 1991)). Suitable strains of Bacillus subtilus include BR151, YB886, MI119, 2o MI 120, and B 170 (see, for example, Hardy, "Bacillus Cloning Methods," in DNA
Cloning: A Practical Approach, Glover (ed.) (IRL Press 1985)).
When expressing a Zsig43 polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, typically as insoluble granules, or may be directed to the periplasmic space by a bacterial secretion sequence. In the former 25 case, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution. In the latter case, the polypeptide can be recovered 3o from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
Methods for expressing proteins in prokaryotic hosts are well-known to 35 those of skill in the art (see, for example. Williams et al., "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies," in DA'A Cloning 2: Expression Systems, 2nd Edition, Glover et al.
(eds.), page 15 (Oxford University Press 1995), Ward et al., "Genetic Manipulation and Expression of Antibodies," in Monoclonal Antibodies: Principles and Applications, page 137 (Wiley-Liss, Inc. 1995), and Georgiou, "Expression of Proteins in Bacteria,"
in Protein Engineering: Principles and Practice, Cleland et al. (eds.), page 101 (John Wiley & Sons, Inc. 1996)).
Standard methods for introducing expression vectors into bacterial, yeast, insect, and plant cells are provided, for example, by Ausubel ( 1995).
General methods for expressing and recovering foreign protein produced by a mammalian cell system are provided by, for example, Etcheverry, "Expression of to Engineered Proteins in Mammalian Cell Culture," in Protein Engineering:
Principles and Practice, Cleland et al. (eds.), pages 163 (Wiley-Liss, Inc. 1996). Standard techniques for recovering protein produced by a bacterial system is provided by, for example, Grisshammer et al., "Purification of over-produced proteins from E. coli cells," in DNA
Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 59-92 (Oxford University Press 1995). Established methods for isolating recombinant proteins from a baculovirus system are described by Richardson (ed.), Baculovirus Expression Protocols (The Humana Press, Inc. 1995).
As an alternative, polypeptides of the present invention can be synthesized by exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. These synthesis methods are well-known to those of skill in the art (see, for example, Merrifield, J. Am. Chem. Soc.
85:2149 (1963), Stewart et al., "Solid Phase Peptide Synthesis" (2nd Edition), (Pierce Chemical Co. 1984). Bayer and Rapp, Chem. Pept. Prot. 3:3 (1986), Atherton et. al., Solid Phase Peptide Synthesis: A Practical Approach (IRL Press 1989), Fields and Colowick, "Solid-Phase Peptide Synthesis," Methods in Enzymology Volume 289 (Academic Press 1997), and Lloyd-Williams et al., Chemical Approaches to the Synthesis of Peptides and Proteins (CRC Press, Inc. 1997)). Variations in total chemical synthesis strategies, such as ''native chemical ligation" and "expressed protein ligation" are also standard (see, for example, Dawson et al., Science 266:776 (1994), Hackeng et al., Proc. Nat'1 Acad. Sci. USA 94:7845 (I997), Dawson, Methods Enrymol. 287: 34 (1997), Muir et al, Proc. Nat'1 Acad. Sci. USA 95:6705 (1998), and Severinav and Muir, J. Biol.
Chem.
273:16205 (1998)).
Peptides and polypeptides of the present invention comprise at least six, preferably at least nine, and more preferably at least 15 contiguous amino acid residues of SEQ ID N0:2. Within certain embodiments of the invention, the polypeptides comprise 20, 30, 40, 50, 100, or more contiguous residues of SEQ ID N0:2.
Nucleic acid molecules encoding such peptides and polypeptides are useful as polymerase chain reaction primers and probes.
The present invention contemplates compositions comprising a peptide or polypeptide described herein. Such compositions can further comprise a carrier.
The carrier can be a conventional organic or inorganic carrier. Examples of carriers include water, buffer solution, alcohol, propylene glycol, macrogol, sesame oil, corn oil, and the like.
7. Isolation of Zsig43 Polypeptides It is preferred to purify the polypeptides of the present invention to at least about 80% purity, more preferably to at least about 90% purity, even more preferably to at least about 95% purity, or even greater than 95% purity with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents. The polypeptides of the present invention may also be purified to a pharmaceutically pure state, which is greater than 99.9%
pure.
Preferably, a purified polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin.
Fractionation and/or conventional purification methods can be used to obtain preparations of Zsig43 purified from natural sources (e.g., heart tissue), and 2o recombinant Zsig43 polypeptides and fusion Zsig43 polypeptides purified from recombinant host cells. In general, ammonium sulfate precipitation and acid or chaotrope extraction may be used for fractionation of samples. Exemplary purification steps may include hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid chromatography. Suitable chromatographic media include derivatized dextrans, agarose, cellulose, polyacrylamide, specialty silicas, and the like.
PEI, DEAE, QAE and Q derivatives are preferred. Exemplary chromatographic media include those media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom 3o CG 71 (Toso Haas) and the like. Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins and the like that are insoluble under the conditions in which they are to be used. These supports may be modified with reactive groups that allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate moieties.

Examples of coupling chemistries include cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, hydrazide activation, and carboxyl and amino derivatives for carbodiimide coupling chemistries.
These and other solid media are well known and widely used in the art, and are available from commercial suppliers. Selection of a particular method for polypeptide isolation and purification is a matter of routine design and is determined in part by the properties of the chosen support. See, for example, Amity Chromatography:
Principles & Methods (Pharmacia LKB Biotechnology 1988), and Doonan, Protein Purifrcation Protocols (The Humana Press I 996).
l0 Additional variations in Zsig43 isolation and purification can be devised by those of skill in the art. For example, anti-Zsig43 antibodies, obtained as described below, can be used to isolate large quantities of protein by immunoaffinity purification.
Moreover, methods for binding receptors, such as Zsig43, to ligands bound to support media are well known in the art.
The polypeptides of the present invention can also be isolated by exploitation of particular properties. For example, immobilized metal ion adsorption (IMAC) chromatography can be used to purify histidine-rich proteins, including those comprising polyhistidine tags. Briefly, a gel is first charged with divalent metal ions to form a chelate (Sulkowski, Trends in Biochem. 3:1 (1985)). Histidine-rich proteins will 2o be adsorbed to this matrix with differing affinities, depending upon the metal ion used, and will be eluted by competitive elution, lowering the pH, or use of strong chelating agents. Other methods of purification include purification of glycosylated proteins by lectin affinity chromatography and ion exchange chromatography (M. Deutscher, (ed.), Meth.Enrymol. 182:529 (1990)). Within additional embodiments of the invention, a fusion of the polypeptide of interest and an affinity tag (e.g., maltose-binding protein, an immunoglobulin domain) may be constructed to facilitate purification.
Zsig43 polypeptides or fragments thereof may also be prepared through chemical synthesis, as described below. Zsig43 polypeptides may be monomers or multimers; glycosylated or non-glycosylated; pegylated or non-pegylated; and may or 3o may not include an initial methionine amino acid residue.
8. Assays for Zsig43 Receptors, and Molecules That Bind With the Zsig43 Receptor As described above, the disclosed polypeptides can be used to construct Zsig43 variants. These polypeptides can be used to identify natural ligands of the Zsig43 receptor, and analogs of the natural ligand (a "Zsig43 Iigand"). One type of Zsig43 ligand analog mimics the natural ligand of Zsig43 by binding with a Zsig43 receptor. Such an analog is considered to be a Zsig43 ligand agonist if the binding of the analog with a Zsig43 receptor produces a response by a cell that expresses the receptor. On the other hand, a Zsig43 ligand analog that binds with a Zsig43 receptor, but does not stimulate a cellular response, may be a Zsig43 ligand antagonist.
Such an antagonist may diminish ligand or agonist activity, for example, by a competitive or non-competitive binding of the antagonist to the Zsig43 receptor.
One approach to producing a Zsig43 ligand analog is to produce an antibody that binds with the extracellular domain of Zsig43. Studies have shown that an antibody that binds with an extracellular domain can act as an agonist or an antagonist of the natural ligand (see, for example, Kita et al., Biochem.
Biophys. Res.
Commun. 226:59 (1996), and Alla et al., J. Biol. Chem. 271:1748 (1996}).
Another approach to obtaining Zsig43 ligand analogs is provided by the use of combinatorial libraries. Methods for constructing and screening phage display libraries, and peptide or peptidomimetic libraries produced by chemical methods are described for example, by Kay et al., Phage Display of Peptides and Proteins (Academic Press 1996), Al-Obeidi et al., Molec. Biotechnol. 9:205 (1998}, Verdine, U.S. Patent No.
5,783,384, Kay, et. al., U.S. Patent No. 5,747,334, and Kauffman et al., U.S. Patent No.
5,723,323.
The Zsig43 ligand, its agonists and antagonists are valuable in both in 2o vivo and in vitro uses. For example, a Zsig43 ligand or an agonist can be used as a component of defined cell culture media, alone or in combination with other bioactive agents, to replace serum that is commonly used in cell culture.
Antagonists are also useful as research reagents for characterizing sites of interaction between a Zsig43 ligand and its receptor. In a therapeutic setting, pharmaceutical compositions comprising Zsig43 ligand antagonists can be used to inhibit Zsig43 ligand activity.
Zsig43 receptor polypeptides can be used to identify and to isolate Zsig43 ligands. Fragments of Zsig43, such as a Zsig43 extracellular domain (e.g., amino acids 26 to 315 of SEQ ID N0:2) and other forms of a soluble receptor, are 3o particularly useful for these methods. For example, proteins and peptides of the present invention can be immobilized on a column and used to bind ligands from a biological sample that is run over the column (Hermanson et al. (eds.}, Immobilized Affinity Ligand Technigzres, pages 195-202 (Academic Press 1992)).
The activity of a Zsig43 polypeptide can be observed by a silicon-based biosensor microphysiometer, which measures the extracellular acidification rate or proton excretion associated with receptor binding and subsequent physiologic cellular responses. An exemplary device is the CYTOSENSOR Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA. A variety of cellular responses, such as cell proliferation, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method (see, for example, McConnell et al., Science 257:1906 (1992), Pitchford et al., Meth.
5 Enrymol. 228:84 (1997), Arimilli et al., J. Immunol. Meth. 212:49 (1998), Van Liefde et al., Eur. J. Pharmacol. 346:87 (1998)). The microphysiometer can be used for assaying eukaryotic, prokaryotic, adherent, or non-adherent cells. By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including agonists, ligands, or to antagonists of the Zsig43 receptor.
Preferably, the microphysiometer is used to measure responses of a Zsig43-expressing eukaryotic cell, compared to a control eukaryotic cell that does not express Zsig43 polypeptide. Suitable cells responsive to Zsig43-modulating stimuli include recombinant host cells comprising a Zsig43 expression vector, and cells that ~5 naturally express Zsig43, such as heart cells. ExtracelIular acidification provides one measure for a Zsig43-modulated cellular response. In addition, this approach can be used to identify ligands, agonists, and antagonists of the Zsig43 receptor.
For example, a compound can be identified as an agonist of the Zsig43 receptor by providing cells that express a Zsig43 polypeptide, culturing a first portion of the cells in the absence of 2o the test compound, culturing a second portion of the cells in the presence of the test compound, and determining whether the second portion exhibits a cellular response, in comparison with the first portion.
Alternatively, a solid phase system can be used to identify a ligand, agonist, or antagonist of the Zsig43 receptor. For example, a Zsig43 polypeptide or 25 Zsig43 fusion protein can be immobilized onto the surface of a receptor chip of a commercially available biosensor instrument (BIACORE, Biacore AB; Uppsala, Sweden). The use of this instrument is disclosed, for example, by Karlsson, Immunol.
Methods 145:229 (1991), and Cunningham and Wells, J. Mol. Biol. 234:554 (1993).
In brief, a Zsig43 polypeptide or fusion protein is covalently attached, 3o using amine or sulfliydryl chemistry, to dextran fibers that are attached to gold film within a flow cell. A test sample is then passed through the cell. If a ligand is present in the sample, it will bind to the immobilized polypeptide or fusion protein, causing a change in the refractive index of the medium, which is detected as a change in surface plasmon resonance of the gold film. This system allows the determination of on-and 35 off rates, from which binding affinity can be calculated, and assessment of stoichiometry of binding. This system can also be used to examine antibody-antigen interactions, and the interactions of other complement/anti-complement pairs.

Zsig43 receptor binding domains can be further characterized by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids of Zsig43 ligand agonists.
See, for example, de Vos et al., Science 255:306 (1992), Smith et al., J. Mol. Biol.
224:899 (1992), and Wlodaver et al., FEBS Lett. 309:59 (1992}.
9. Production of Antibodies to Zsig43 Proteins Antibodies to Zsig43 can be obtained, for example, using as an antigen the product of a Zsig43 expression vector or Zsig43 isolated from a natural source.
Particularly useful anti-Zsig43 antibodies "bind specifically" with Zsig43.
Antibodies are considered to be specifically binding if the antibodies bind to Zsig43 with a threshold level of binding activity. Suitable antibodies include antibodies that bind with Zsig43 in particular domains, such as the Zsig43 secretory signal sequence (amino acid residues 1 to about 25 of SEQ ID N0:2}, the Zsig43 extracellular domain (located at about amino acid residues 26 to 315 of SEQ ID N0:2), the Zsig43 transmembrane domain (located at about amino acid residues 316 to 340 of SEQ ID N0:2), the Zsig43 intracellular domain (located at about amino acid residues 341 to 826 of SEQ
ID N0:2) in general, or the putative SH2 binding domain (located at about amino acid residues 381 to 479 of SEQ ID N0:2) in particular.
Antibodies specifically bind if they bind to a Zsig43 polypeptide, peptide or epitope with a binding affinity (Ka) of 106 M'' or greater, preferably 10' M-~
or greater, more preferably 10g M~~ or greater, and most preferably 109 M-~ or greater.
The binding affinity of an antibody can be readily determined by one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard, Ann. NY Acad. Sci.
51:660 (1949)).
Anti-Zsig43 antibodies can be produced using antigenic Zsig43 epitope-bearing peptides and polypeptides. Antigenic epitope-bearing peptides and polypeptides of the present invention contain a sequence of at least six, preferably between 15 to about 30 amino acids contained within SEQ ID N0:2. However, peptides or polypeptides comprising a larger portion of an amino acid sequence of the invention, containing from 30 to 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention, also are useful for inducing antibodies that bind with Zsig43. It is desirable that the amino acid sequence of the epitope-bearing peptide is selected to provide substantial solubility in aqueous solvents (i.e., the sequence includes relatively hydrophilic residues, while hydrophobic residues are preferably avoided). Moreover, amino acid sequences containing proline residues may be also be desirable for antibody production.
As an illustration, potential antigenic sites in the extracellular domain of Zsig43 were identified using the Jameson-Wolf method, Jameson and Wolf, CABIOS
4:181, (1988), as implemented by the PROTEAN program of LASERGENE
(DNASTAR; Madison, WI). Default parameters were used in this analysis.
The Jameson-Wolf method predicts potential antigenic determinants by combining six major subroutines for protein structural prediction. Briefly, the Hopp-Woods method, Hopp et al., Proc. Nat'1 Acad. Sci. USA 78:3824 (1981), was first used to identify amino acid sequences representing areas of greatest local hydrophilicity (parameter: seven residues averaged). In the second step, Emini's method, Emini et al., J. Virology 55:836 (1985), was used to calculate surface probabilities (parameter:
surface decision threshold (0.6) = 1 ). Third, the Karplus-Schultz method, Karplus and Schultz, Naturwissenschaften 72:212 (1985), was used to predict backbone chain flexibility (parameter: flexibility threshold (0.2) = 1 ). In the fourth and fifth steps of the analysis, secondary structure predictions were applied to the data using the methods of Chou-Fasman, Chou, "Prediction of Protein Structural Classes from Amino Acid Composition," in Prediction of Protein Structure and the Principles of Protein Conformation, Fasman (ed.), pages 549-586 (Plenum Press 1990), and Gamier-Robson, 2o Gamier et al., J. Mol. Biol. 120:97 ( 1978) (Chou-Fasman parameters:
conformation table = 64 proteins; a region threshold = 103; (3 region threshold = 105;
Garnier-Robson parameters: a and p decision constants = 0}. In the sixth subroutine, flexibility parameters and hydropathy/solvent accessibility factors were combined to determine a surface contour value, designated as the "antigenic index." Finally, a peak broadening function was applied to the antigenic index, which broadens major surface peaks by adding 20, 40, 60, or 80% of the respective peak value to account for additional free energy derived from the mobility of surface regions relative to interior regions. This calculation was not applied, however, to any major peak that resides in a helical region, since helical regions tend to be less flexible.
3o The results of this analysis indicated that a peptide consisting of amino acids 26 to 38 of SEQ ID N0:2 ("antigenic peptide 1") would be a suitable antigenic peptide. Suitable antigenic fragments of such a peptide include the following amino acid residues of SEQ ID N0:2: amino acids 26 to 31 ("antigenic peptide 2"), amino acids 27 to 32 ("antigenic peptide 3"), amino acids 28 to 33 ("antigenic peptide 4"), amino acids 29 to 34 ("antigenic peptide 5"), amino acids 30 to 35 ("antigenic peptide 6"), amino acids 31 to 36 ("antigenic peptide 7"), amino acids 32 to 37 ("antigenic peptide 8''), and amino acids 33 to 38 ("antigenic peptide 9"). The analysis also indicated that the following amino acid sequences of SEQ ID N0:2 would provide suitable antigenic peptides: amino acids 74 to 79 ("antigenic peptide 10"), amino acids 145 to 150 ("antigenic peptide 11 "), amino acids 195 to 200 ("antigenic peptide 12"), amino acids 237 to 242 ("antigenic peptide 13"), and amino acids 271 to 276 ("antigenic peptide 14"). The present invention contemplates the use of any one of antigenic peptides 1 to 14 to generate antibodies to Zsig43. The present invention also contemplates polypeptides comprising at least one of antigenic peptides 1 to 14.
Polyclonal antibodies to recombinant Zsig43 protein or to Zsig43 isolated from natural sources can be prepared using methods well-known to those of skill in the art. General methods for producing polyclonal antibodies are described, for example, by Green et al., "Production of Polyclonal Antisera," in Immunochemical Protocols (Manson, ed.), pages 1-5 (Humana Press 1992), and Williams et al., "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), page 1 S (Oxford University Press 1995).
The immunogenicity of a Zsig43 polypeptide can be increased through the use of an adjuvant, such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant. Polypeptides useful for immunization also include fusion polypeptides, such as fusions of Zsig43 or a portion thereof with an immunoglobulin 2o polypeptide or with maltose binding protein. The polypeptide immunogen may be a full-length molecule or a portion thereof. If the polypeptide portion is "hapten-like,"
such portion may be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for immunization.
Although polyclonal antibodies are typically raised in animals such as horse, cow, dog, chicken, rat, mouse, rabbit, goat, guinea pig, or sheep, an anti-Zsig43 antibody of the present invention may also be derived from a subhuman primate antibody. General techniques for raising diagnostically and therapeutically useful antibodies in baboons may be found, for example, in Goldenberg et al., international 3o patent publication No. WO 91/11465, and in Losman et al., Int. J. Cancer 46:310 ( 1990).
Alternatively, monoclonal anti-Zsig43 antibodies can be generated.
Rodent monoclonal antibodies to specific antigens may be obtained by methods known to those skilled in the art (see, for example, Kohler et al., Nature 256:495 (1975), Coligan et al. (eds.), Current Protocols in Immunology, Vol. l, pages 2.5.1-2.6.7 (John Wiley & Sons 1991) ["Coligan"], Picksley et al., "Production of monoclonal antibodies against proteins expressed in E coli," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), page 93 (Oxford University Press 1995)).
Briefly, monoclonal antibodies can be obtained by injecting mice with a composition comprising a Zsig43 gene product, verifying the presence of antibody production by removing a serum sample, removing the spleen to obtain B-lymphocytes, fusing the B-lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones which produce antibodies to the antigen, culturing the clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
1 o In addition, an anti-Zsig43 antibody of the present invention may be derived from a human monoclonal antibody. Human monoclonal antibodies are obtained from transgenic mice that have been engineered to produce specific human antibodies in response to antigenic challenge. In this technique, elements of the human heavy and light chain locus are introduced into strains of mice derived from embryonic stem cell lines that contain targeted disruptions of the endogenous heavy chain and light chain loci. The transgenic mice can synthesize human antibodies specific for human antigens, and the mice can be used to produce human antibody-secreting hybridomas. Methods for obtaining human antibodies from transgenic mice are described, for example, by Green et al., Nature Genet. 7:13 ( 1994), Lonberg et al., Nature 368:856 ( 1994), and Taylor et al., 2o Int. Immun. 6:579 (1994).
Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography (see, for example, Coligan at pages 2.7.1-2.7.12 and 2s pages 2.9.1-2.9.3; Baines et al., "Purification of Immunoglobulin G (IgG},"
in Methods in Molecular Biology, Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to prepare fragments of anti-Zsig43 antibodies. Such antibody fragments can be obtained, for example, by proteolytic hydrolysis of the antibody. Antibody fragments can be obtained by pepsin 30 or papain digestion of whole antibodies by conventional methods. As an illustration, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a SS fragment denoted F(ab')Z. This fragment can be further cleaved using a thiol reducing agent to produce 3.SS Fab' monovalent fragments. Optionally, the cleavage reaction can be performed using a blocking group for the sulfl~ydryl groups 35 that result from cleavage of disulfide linkages. As an alternative, an enzymatic cleavage using pepsin produces two monovalent Fab fragments and an Fc fragment directly. These methods are described, for example, by Goldenberg, U.S. patent No.

4,331,647, Nisonoff et al., Arch Biochem. Biophys. 89:230 (1960), Porter, Biochem. J.
73: I 19 ( 1959), Edelman et al., in Methods in Enzymology Vol. 1, page 422 (Academic Press 1967), and by Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
Other methods of cleaving antibodies, such as separation of heavy 5 chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
For example, Fv fragments comprise an association of VH and VL chains.
This association can be noncovalent, as described by mbar et al., Proc. Nat'1 Acad. Sci.
to USA 69:2659 (1972). Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde {see, for example, Sandhu, Crit. Rev. Biotech. 12:437 (1992)).
The Fv fragments may comprise VH and VL chains which are connected by a peptide linker. These single-chain antigen binding proteins (scFv) are prepared by 15 constructing a structural gene comprising DNA sequences encoding the VH and VL
domains which are connected by an oligonucleotide. The structural gene is inserted into an expression vector which is subsequently introduced into a host cell, such as E.
coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains. Methods for producing scFvs are described, for 20 example, by Whitlow et al., Methods: A Companion to Methods in Enzymology 2:97 (1991) (also see, Bird et al., Science 242:423 (1988), Ladner et al., U.S.
Patent No.
4,946,778. Pack et al., BiolTechnolo~r 11:1271 (1993), and Sandhu, supra).
As an illustration, a scFV can be obtained by exposing lymphocytes to Zsig43 polypeptide in vitro, and selecting antibody display libraries in phage or similar 25 vectors (for instance, through use of immobilized or labeled Zsig43 protein or peptide).
Genes encoding polypeptides having potential Zsig43 polypeptide binding domains can be obtained by screening random peptide libraries displayed on phage (phage display) or on bacteria, such as E. coli. Nucleotide sequences encoding the polypeptides can be obtained in a number of ways, such as through random mutagenesis and random 3o polynucleotide synthesis. These random peptide display libraries can be used to screen for peptides which interact with a known target which can be a protein or polypeptide, such as a ligand or receptor, a biological or synthetic macromolecule, or organic or inorganic substances. Techniques for creating and screening such random peptide display libraries are known in the art (Ladner et al., U.S. Patent No.
5,223,409, Ladner 35 et al., U.S. Patent No. 4,946,778, Ladner et al., U.S. Patent No.
5,403,484, Ladner et al., U.S. Patent No. 5,571,698, and Kay et ul., Phage Display of Peptides and Proteins (Academic Press, Inc. 1996)) and random peptide display libraries and kits for screening such libraries are available commercially, for instance from CLONTECH
Laboratories, Inc. (Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New England Biolabs, Inc. (Beverly, MA), and Pharmacia LKB Biotechnology Inc. (Piscataway, NJ).
Random peptide display libraries can be screened using the Zsig43 sequences disclosed herein to identify proteins which bind to Zsig43.
Another form of an antibody fragment is a peptide coding for a single complementarity-determining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction 1o to synthesize the variable region from RNA of antibody-producing cells (see, for example, Larrick et al., Methods: A Companion to Methods in Enzymology 2:106 (1991), Courtenay-Luck, "Genetic Manipulation of Monoclonal Antibodies," in Monoclonal Antibodies: Production, Engineering and Clinical Application, Ritter et al.
(eds.), page 166 (Cambridge University Press 1995), and Ward et al., "Genetic Manipulation and Expression of Antibodies," in Monoclonal Antibodies:
Principles and Applications, Birch et al., (eds.), page 137 (Whey-Liss, Inc. 1995)).
Alternatively, an anti-Zsig43 antibody may be derived from a "humanized" monoclonal antibody. Humanized monoclonal antibodies are produced by transfernng mouse complementary determining regions from heavy and light 2o variable chains of the mouse immunoglobulin into a human variable domain.
Typical residues of human antibodies are then substituted in the framework regions of the marine counterparts. The use of antibody components derived from humanized monoclonal antibodies obviates potential problems associated with the immunogenicity of marine constant regions. General techniques for cloning marine immunoglobulin variable domains are described, for example, by Orlandi et al., Proc. Nat'1 Acad. Sci.
USA 86:3833 (1989). Techniques for producing humanized monoclonal antibodies are described, for example, by Jones et al., Nature 321:522 (1986), Carter et al., Proc. Nat'I
Acad. Sci. USA 89:4285 (1992), Sandhu, Crit. Rev. Biotech. 12:437 (1992), Singer et al., J. Immun. 150:2844 (1993), Sudhir (ed.), Antibody Engineering Protocols (Humana 3o Press, Inc. 1995), Kelley, "Engineering Therapeutic Antibodies," in Protein Engineering: Principles and Practice, Cleland et al. (eds.), pages 399-434 (John Wiley & Sons, Inc. 1996), and by Queen et al., U.S. Patent No. 5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be prepared by immunizing animals with anti-Zsig43 antibodies or antibody fragments, using standard techniques.
See, for example, Green et al., "Production of Polyclonal Antisera," in Methods In Molecular Biology: Immunochemical Protocols, Manson (ed.), pages 1-12 (Humana Press 1992). Also, see Coligan at pages 2.4.1-2.4.7. Alternatively, monoclonal anti-WO 00/31259 PC'T/US99/27040 idiotype antibodies can be prepared using anti-Zsig43 antibodies or antibody fragments as immunogens with the techniques, described above. As another alternative, humanized anti-idiotype antibodies or subhuman primate anti-idiotype antibodies can be prepared using the above-described techniques. Methods for producing anti-idiotype antibodies are described, for example, by Irie, U.S. Patent No. 5,208,146, Greene, et.
al., U.S. Patent No. 5,637,677, and Varthakavi and Minocha, J. Gen. Virol.
77:1875 ( 1996).
10. Use of Zsig43 Nucleotide Sequences to Detect Zsig43 Gene to Expression and to Analyze Zsig43 Gene Structure Nucleic acid molecules can be used to detect the expression of a Zsig43 gene in a biological sample. Such probe molecules include double-stranded nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO:1, or a fragment thereof, as well as single-stranded nucleic acid molecules having the complement of the nucleotide sequence of SEQ ID NO:1, or a fragment thereof. Probe molecules may be DNA, RNA, oligonucleotides, and the like. Preferred probes bind with regions of a Zsig43 gene that have a low sequence similarity to comparable regions in other proteins.
As an illustration, suitable probes include nucleic acid molecules that 2o bind with a portion of a Zsig43 domain, such as the Zsig43 secretory signal sequence (nucleotide 18 to about 92 of SEQ ID NO:1 ), the extracellular domain (located at about nucleotide 93 to 962 of SEQ ID NO:1 ), the transmembrane domain (located at about nucleotide 963 to 1037 of SEQ ID NO:1), and the intracellular domain (located at about nucleotide 1038 to 2495 of SEQ ID NO:1), including the putative SH2 binding domain (located at about nucleotide 11 S8 to 1454 of SEQ ID NO:1 ). As used herein, the term "portion" refers to at least eight nucleotides to at least 20 or more nucleotides.
In a basic assay, a single-stranded probe molecule is incubated with RNA, isolated from a biological sample, under conditions of temperature and ionic strength that promote base pairing between the probe and target Zsig43 RNA
species.
3o After separating unbound probe from hybridized molecules, the amount of hybrids is detected.
Well-established hybridization methods of RNA detection include northern analysis and dot/slot blot hybridization (see, for example, Ausubel (I995) at pages 4-1 to 4-27, and Wu et al. (eds.), "Analysis of Gene Expression at the RNA
Level," in Methods in Gene Biotechnology, pages 225-239 (CRC Press, Inc.
1997)).
Nucleic acid probes can be detectably labeled with radioisotopes such as 32P
or 'SS.

Alternatively, Zsig43 RNA can be detected with a nonradioactive hybridization method (see, for example, Isaac (ed.), Protocols for Nucleic Acid Analysis by Nonradioactive Probes (Humana Press, Inc. 1993)). Typically, nonradioactive detection is achieved by enzymatic conversion of chromogenic or chemiluminescent substrates.
Illustrative nonradioactive moieties include biotin, fluorescein, and digoxigenin.
Zsig43 oligonucleotide probes are also useful for in vivo diagnosis. As an illustration, '8F-labeled oligonucleotides can be administered to a subject and visualized by positron emission tomography (Tavitian et al., Nature Medicine 4:467 (1998)).
Numerous diagnostic procedures take advantage of the polymerase chain 1 o reaction (PCR) to increase sensitivity of detection methods. Standard techniques for performing PCR are well-known (see, generally, Mathew (ed.), Protocols in Human Molecular Genetics (Humana Press, Inc. I 991 ), White (ed.), PCR Protocols:
Current Methods and Applications (Humana Press, Inc. 1993), Cotter (ed.), Molecular Diagnosis of Cancer (Humana Press, Inc. 1996), Hanausek and Walaszek (eds.), Tumor Marker Protocols (Humana Press, Ine. 1998), Lo (ed.), Clinical Applications of PCR
(Humana Press, Inc. 1998), and Meltzer (ed.), PCR in Bioanalysis (Humana Press, Inc.
1998)). Preferably, PCR primers are designed to amplify a portion of the Zsig43 gene that has a low sequence similarity to a comparable region in other related sequences.
One variation of PCR for diagnostic assays is reverse transcriptase-PCR
(RT-PCR). In the RT-PCR technique, RNA is isolated from a biological sample, reverse transcribed to cDNA, and the cDNA is incubated with Zsig43 primers (see, for example, Wu et al. (eds.), "Rapid Isolation of Specific cDNAs or Genes by PCR," in Methods in Gene Biotechnology, pages I S-28 (CRC Press, Inc. 1997)). PCR is then performed and the products are analyzed using standard techniques.
As an illustration, RNA is isolated from biological sample using, for example, the guanidinium-thiocyanate cell lysis procedure described above.
Alternatively, a solid-phase technique can be used to isolate mRNA from a cell lysate.
A reverse transcription reaction can be primed with the isolated RNA using random oligonucleotides, short homopolymers of dT, or Zsig43 anti-sense oligomers.
Oligo-dT
3o primers offer the advantage that various mRNA nucleotide sequences are amplified that can provide control target sequences. Zsig43 sequences are amplified by the polymerase chain reaction using two flanking oligonucleotide primers that are typically 20 bases in length.
PCR amplification products can be detected using a variety of approaches. For example, PCR products can be fractionated by gel electrophoresis, and visualized by ethidium bromide staining. Alternatively, fractionated PCR
products can be transferred to a membrane, hybridized with a detectably-labeled Zsig43 probe, and examined by autoradiography. Additional alternative approaches include the use of digoxigenin-labeled deoxyribonucleic acid triphosphates to provide chemiluminescence detection, and the C-TRAK colorimetric assay.
Another approach for detection of Zsig43 expression is cycling probe technology (CPT), in which a single-stranded DNA target binds with an excess of DNA-RNA-DNA chimeric probe to form a complex, the RNA portion is cleaved with RNAase H, and the presence of cleaved chimeric probe is detected (see, for example, Beggs et al., J. Clin. Microbiol. 34:2985 (1996), Bekkaoui et al., Biotechniques 20:240 (1996)). Alternative methods for detection of Zsig43 sequences can utilize approaches such as nucleic acid sequence-based amplification (NASBA), cooperative amplification of templates by cross-hybridization (CATCH), and the ligase chain reaction (LCR) (see, for example, Marshall et al., U.S. Patent No. 5,686,272 (1997), Dyer et al., J.
Virol. Methods 60:161 (1996), Ehricht et al., Eur. J. Biochem. 243:358 (1997), and Chadwick et al., J. Yirol. Methods 70:59 ( 1998)). Other standard methods are known to those of skill in the art.
Zsig43 probes and primers can also be used to detect and to localize Zsig43 gene expression in tissue samples. Methods for such in situ hybridization are well-known to those of skill in the art (see, for example, Choo (ed.), In Situ Hybridization Protocols (Humans Press, Inc. 1994), Wu et al. (eds.), "Analysis of Cellular DNA or Abundance of mRNA by Radioactive In Situ Hybridization IRISH),"
in Methods in Gene Biotechnology, pages 259-278 (CRC Press, Inc. 1997), and Wu et al.
(eds.), "Localization of DNA or Abundance of mRNA by Fluorescence In Situ Hybridization IRISH)," in Methods in Gene Biotechnology, pages 279-289 (CRC
Press, Inc. 1997)).
Various additional diagnostic approaches are well-known to those of skill in the art (see, for example, Mathew (ed.), Protocols in Human Molecular Genetics (Humans Press, Inc. 1991), Coleman and Tsongalis, Molecular Diagnostics (Humans Press, Inc. 1996), and Elles, Molecular Diagnosis of Genetic Diseases (Humans Press, Inc., 1996)).
3o Nucleic acid molecules comprising Zsig43 nucleotide sequences can also be used to determine whether a subject's chromosomes contain a mutation in the Zsig43 gene, which resides at chromosome 17q21.1. Detectable chromosomal aberrations at the Zsig43 gene locus include, but are not limited to, aneuploidy, gene copy number changes, insertions, deletions, restriction site changes and rearrangements.
As an illustration, alterations at 17q21.1 are associated with frontotemporal lobe dementia. which is characterized by nonspecific degeneration of neocortex and subcortical nuclei, without the distinct inclusions that characterize other dementias, such as Alzheimer disease or Pick disease (see, for example, Yamaoka et al., Am. J.
Hum. Genet. 59:1306 (1996), Basun et al., Arch. Neurol. 54:539 (1997), Spillantini et al., Proc. Nat'l Acad. Sci. USA 94:4113 (1997), and Lendon et al., Neurology 50:1546 (1998)). Chromosome 17q21 also appears to be the locus of a gene associated with an 5 inherited susceptibility to breast cancer in families with early-onset disease (Hall et al., Science 250:1684 (1990); Muleris et al., Genes Chromosomes Cancer 14:155 (1995)).
Aberrations associated with the Zsig43 locus can be detected using nucleic acid molecules of the present invention by employing molecular genetic techniques, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, amplification-refractory mutation system analysis (ARMS), single-strand conformation polymorphism (SSCP) detection, RNase cleavage methods, denaturing gradient gel electrophoresis, fluorescence-assisted mismatch analysis {FAMA), and other genetic analysis techniques known in the art (see, for example, Mathew (ed.), Protocols in Human ~5 Molecular Genetics (Humana Press, Inc. 1991), Marian, Chest 108:255 (1995), Coleman and Tsongalis, Molecular Diagnostics (Human Press, Inc. 1996), Elles (ed.) Molecular Diagnosis of Genetic Diseases (Humana Press, Inc. 1996), Landegren (ed.), Laboratory Protocols for Mutation Detection {Oxford University Press 1996), Dracopoli et al. (eds.), Current Protocols in Human Genetics (John Wiley &
Sons 20 1998), and Richards and Ward, "Molecular Diagnostic Testing," in Principles of Molecular Medicine, pages 83-88 (Humana Press, Inc. 1998)).
The protein truncation test is also useful for detecting the inactivation of a gene in which translation-terminating mutations produce only portions of the encoded protein (see, for example, Stoppa-Lyonnet et al., Blood 91:3920 (1998)).
According to 25 this approach, RNA is isolated from a biological sample, and used to synthesize cDNA.
PCR is then used to amplify the Zsig43 target sequence and to introduce an RNA
polymerase promoter, a translation initiation sequence, and an in-frame ATG
triplet.
PCR products are transcribed using an RNA polymerase, and the transcripts are translated in vitro with a T7-coupled reticulocyte lysate system. The translation 3o products are then fractionated by SDS-PAGE to determine the lengths of the translation products. The protein truncation test is described, for example, by Dracopoli et al.
(eds.), Current Protocols in Human Genetics, pages 9.11.1 - 9.11.18 (John Wiley &
Sons 1998).
The present invention also contemplates kits for performing a diagnostic 35 assay for Zsig43 gene expression or to analyze the Zsig43 locus of a subject. Such kits comprise nucleic acid probes, such as double-stranded nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO:1, or a fragment thereof, as well as single-stranded nucleic acid molecules having the complement of the nucleotide sequence of SEQ ID NO:1, or a fragment thereof. Probe molecules may be DNA, RNA, oligonucleotides, and the like. Kits may comprise nucleic acid primers for performing PCR.
Preferably, a kit for detecting Zsig43 sequences contains all the necessary elements to perform a nucleic acid diagnostic assay described above.
A kit will comprise at least one container comprising a Zsig43 probe or primer. The kit may also comprise a second container comprising one or more reagents capable of indicating the presence of Zsig43 sequences. Examples of such indicator reagents include detectable labels such as radioactive labels, fluorochromes, chemiluminescent agents, and the like. A kit may also comprise a means for conveying to the user that the Zsig43 probes and primers are used to detect Zsig43 gene expression. For example, written instructions may state that the enclosed nucleic acid molecules can be used to detect either a nucleic acid molecule that encodes Zsig43, or a nucleic acid molecule having a nucleotide sequence that is complementary to a Zsig43-encoding nucleotide sequence, or to analyze chromosomal sequences associated with the Zsig43 locus. The written material can be applied directly to a container, or the written material can be provided in the form of a packaging insert.
? 1. Use of Anfi-Zsig43 Antibodies to Detect Zsig43 The present invention contemplates the use of anti-Zsig43 antibodies to screen biological samples in vitro for the presence of Zsig43. In one type of in vitro assay, anti-Zsig43 antibodies are used in liquid phase. For example, the presence of Zsig43 in a biological sample can be tested by mixing the biological sample with a trace amount of labeled Zsig43 and an anti-Zsig43 antibody under conditions that promote binding between Zsig43 and its antibody. Complexes of Zsig43 and anti-Zsig43 in the sample can be separated from the reaction mixture by contacting the complex with an immobilized protein which binds with the antibody, such as an Fc antibody or Staphylococcus protein A. The concentration of Zsig43 in the biological sample will be inversely proportional to the amount of labeled Zsig43 bound to the antibody and directly related to the amount of free labeled Zsig43.
Alternatively, in vitro assays can be performed in which anti-Zsig43 antibody is bound to a solid-phase carrier. For example, antibody can be attached to a polymer, such as aminodextran, in order to link the antibody to an insoluble support such as a polymer-coated bead, a plate or a tube. Other suitable in vitro assays will be readily apparent to those of skill in the art.

In another approach, anti-Zsig43 antibodies can be used to detect Zsig43 in tissue sections prepared from a biopsy specimen. Such immunochemical detection can be used to determine the relative abundance of Zsig43 and to determine the distribution of Zsig43 in the examined tissue. General immunochemistry techniques are well established (see, for example, Ponder, "Cell Marking Techniques and Their Application," in Mammalian Development. A Practical Approach, Monk (ed.), pages 115-38 (IRL
Press 1987), Coligan at pages 5.8.1-5.8.8, Ausubel (1995) at pages 14.6.1 to 14.6.13 (Wiley Interscience 1990), and Manson (ed.), Methods In Molecular Biology, Vo1.10.~
Immunochemical Protocols (The Humana Press, Ins. 1992)).
1o Immunochemical detection can be performed by contacting a biological sample with an anti-Zsig43 antibody, and then contacting the biological sample with a detestably labeled molecule which binds to the antibody. For example, the detestably labeled molecule can comprise an antibody moiety that binds to anti-Zsig43 antibody.
Alternatively, the anti-Zsig43 antibody can be conjugated with avidin/streptavidin (or biotin) and the detestably labeled molecule can comprise biotin (or avidin/streptavidin).
Numerous variations of this basic technique are well-known to those of skill in the art.
Alternatively, an anti-Zsig43 antibody can be conjugated with a detectable label to form an anti-Zsig43 immunoconjugate. Suitable detectable labels include, for example, a radioisotope, a fluorescent label, a chemiluminescent label, an enzyme label, a bioluminescent label or colloidal gold. Methods of making and detecting such detectably labeled immunoconjugates are well-known to those of ordinary skill in the art, and are described in more detail below.
The detectable label can be a radioisotope that is detected by autoradiography. Isotopes that are particularly useful for the purpose of the present invention are 3H,''-SI, "'I, 355 and'4C.
Anti-Zsig43 immunoconjugates can also be labeled with a fluorescent compound. The presence of a fluorescently-labeled antibody is determined by exposing the immunoconjugate to light of the proper wavelength and detecting the resultant fluorescence. Fluorescent labeling compounds include fluorescein isothiocyanate, rhoda-mine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
Alternatively, anti-Zsig43 immunoconjugates can be detestably labeled by coupling an antibody component to a chemiluminescent compound. The presence of the chemiluminescent-tagged immunoconjugate is determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of chemi luminescent labeling compounds include luminol, isoluminol, an aromatic acridinium ester, an imidazole, an acridinium salt and an oxalate ester.

Similarly, a bioluminescent compound can be used to label anti-Zsig43 immunoconjugates of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Bioluminescent compounds that are useful for labeling include luciferin, luciferase and aequorin.
Alternatively, anti-Zsig43 immunoconjugates can be detectably labeled by linking an anti-Zsig43 antibody component to an enzyme. When the anti-Zsig43-enzyme conjugate is incubated in the presence of the appropriate substrate, the enzyme moiety reacts with the substrate to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or visual means. Examples of enzymes that can be used to detectably label polyspecific immunoconjugates include [3-galac-tosidase, glucose oxidase, peroxidase and alkaline phosphatase.
Those of skill in the art will know of other suitable labels which can be 1 s employed in accordance with the present invention. The binding of marker moieties to anti-Zsig43 antibodies can be accomplished using standard techniques known to the art.
Typical methodology in this regard is described by Kennedy et al., Clin. Chim.
Acta 70:1 (1976), Schurs et al., Clin. Chim. Acta 81:1 (1977), Shih et al., Int'1 J.
Cancer 46:1101 (1990), Stein et al., Cancer Res. 50:1330 (1990), and Coligan, supra.
Moreover, the convenience and versatility of immunochemical detection can be enhanced by using anti-Zsig43 antibodies that have been conjugated with avidin, streptavidin, and biotin (see, for example, Wilchek et al. (eds.), "Avidin-Biotin Technology," Methods In Enrymology, Vol. 184 (Academic Press 1990), and Bayer et al., "Immunochemical Applications of Avidin-Biotin Technology," in Methods In Molecular Biology, i~ol. 10, Manson (ed.), pages 149-162 (The Humana Press, Inc. 1992).
Methods for performing immunoassays are well-established. See, for example, Cook and Self, "Monoclonal Antibodies in Diagnostic Immunoassays," in Monoclonal Antibodies: Production, Engineering, and Clinical Application, Ritter and Ladyman (eds.), pages 180-208, (Cambridge University Press, 1995), Perry, "The Role of Monoclonal Antibodies in the Advancement of Immunoassay Technology," in Monoclonal Antibodies: Principles and Applications, Birch and Lennox (eds.), pages 107-120 (Whey-Liss, Inc. 1995), and Diamandis, Immunoassay (Academic Press, Inc.
1996}.
In a related approach, biotin- or FITC-labeled Zsig43 can be used to identify cells that bind Zsig43. Such can binding can be detected, for example, using flow cytomety .

The present invention also contemplates kits for performing an immunological diagnostic assay for Zsig43 gene expression. Such kits comprise at least one container comprising an anti-Zsig43 antibody, or antibody fragment. A kit may also comprise a second container comprising one or more reagents capable of indicating the presence of Zsig43 antibody or antibody fragments. Examples of such indicator reagents include detectable labels such as a radioactive label, a fluorescent label, a chemiluminescent label, an enzyme label, a bioluminescent label, colloidal gold, and the like. A kit may also comprise a means for conveying to the user that Zsig43 antibodies or antibody fragments are used to detect Zsig43 protein. For example, written instructions may state that the enclosed antibody or antibody fragment can be used to detect Zsig43. The written material can be applied directly to a container, or the written material can be provided in the form of a packaging insert.
In addition to the diagnostic uses described above, nucleic acid molecules and proteins of the present invention can be used as nutritional sources or supplements. Such uses include the use as a protein or amino acid supplement, the use as a carbon source, the use as a nitrogen source, or the use as a carbohydrate source.
For example, the nucleic acid molecules or proteins of the present invention can be added to the feed of an organism, or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions, or capsules.
Exemplary nutritional supplements for human consumption include CytoVol (EAS, Inc.), which contains ribonucleic acid, and Precision Protein (EAS, Inc.), which contains proteins and protein fragments. In the case of cultured cells, including both prokaryotic and eukaryotic cells, the nucleic acid molecules or proteins can be added to the culture medium.
12. Production of Transgenic Mice Transgenic mice can be engineered to over-express the Zsig~t3 gene in all tissues or under the control of a tissue-specific or tissue-preferred regulatory element. These over-producers of Zsig43 can be used to characterize the phenotype 3o that results from over-expression, and the transgenic animals can serve as models for human disease caused by excess Zsig43. Transgenic mice that over-express Zsig43 also provide model bioreactors for production of Zsig43 in the milk or blood of larger animals. Methods for producing transgenic mice are well-known to those of skill in the art (see, for example, Jacob, "Expression and Knockout of Interferons in Transgenic Mice," in Overexpression and Knockout of Cytokines in Transgenic Mice, Jacob (ed.), pages 111-124 (Academic Press, Ltd. 1994), Monastersky and Robl (eds.), Strategies in Transgenic Animal Science (ASM Press 1995), and Abbud and Nilson, "Recombinant Protein Expression in Transgenic Mice," in Gene Expression Systems: Using Nature for the Art of Expression, Fernandez and Hoeffler (eds.), pages 367-397 (Academic Press, Inc. 1999)).
5 For example, a method for producing a transgenic mouse that expresses a Zsig43 gene can begin with adult, fertile males (studs) (B6C3f1, 2-8 months of age (Taconic Farms, Germantown, NY)), vasectomized males (duds) (B6D2f1, 2-8 months, (Taconic Farms)), prepubescent fertile females (donors) (B6C3f1, 4-5 weeks, (Taconic Farms)) and adult fertile females (recipients) (B6D2f1, 2-4 months, (Taconic Farms)).
1o The donors are acclimated for one week and then injected with approximately IU/mouse of Pregnant Mare's Serum gonadotrophin (Sigma Chemical Company; St.
Louis, MO) LP., and 46-47 hours later, 8 IU/mouse of human Chorionic Gonadotropin (hCG (Sigma)) LP. to induce superovulation. Donors are mated with studs subsequent to hormone injections. Ovulation generally occurs within 13 hours of hCG
injection.
15 Copulation is confirmed by the presence of a vaginal plug the morning following mating.
Fertilized eggs are collected under a surgical scope. The oviducts are collected and eggs are released into urinanalysis slides containing hyaluronidase (Sigma). Eggs are washed once in hyaluronidase, and twice in Whitten's W640 medium 20 (described, for example, by Menino and O'Claray, Biol. Reprod 77:159 (1986), and Dienhart and Downs, Zygote 4:129 (1996)) that has been incubated with 5% CO2, 5%
Oz, and 90% NZ at 37°C. The eggs are then stored in a 37°C/S%
COz incubator until microinjection.
Ten to twenty micrograms of plasmid DNA containing a Zsig43 25 encoding sequence is linearized, gel-purified, and resuspended in 10 mM
Tris-HCl (pH
7.4), 0.25 mM EDTA (pH 8.0), at a final concentration of 5-10 nanograms per microliter for microinjection. For example, the Zsig43 encoding sequences can encode a polypeptide comprising amino acid residues 26 to 315 of SEQ ID N0:2.
Plasmid DNA is microinjected into harvested eggs contained in a drop 30 of W640 medium overlaid by warm, COZ-equilibrated mineral oil. The DNA is drawn into an injection needle (pulled from a 0.75mm ID, lmm OD borosilicate glass capillary), and injected into individual eggs. Each egg is penetrated with the injection needle, into one or both of the haploid pronuclei.
Picoliters of DNA are injected into the pronuclei, and the injection 35 needle withdrawn without coming into contact with the nucleoli. The procedure is repeated until all the eggs are injected. Successfully microinjected eggs are transferred into an organ tissue-culture dish with pre-gassed W640 medium for storage overnight in a 37°C/5% CO incubator.
z The following day, two-cell embryos are transferred into pseudopregnant recipients. The recipients are identified by the presence of copulation plugs, after copulating with vasectomized duds. Recipients are anesthetized and shaved on the dorsal left side and transferred to a surgical microscope. A small incision is made in the skin and through the muscle wall in the middle of the abdominal area outlined by the ribcage, the saddle, and the hind leg, midway between knee and spleen.
The reproductive organs are exteriorized onto a small surgical drape. The fat pad is to stretched out over the surgical drape, and a baby serrefine (Roboz, Rockville, MD) is attached to the fat pad and left hanging over the back of the mouse, preventing the organs from sliding back in.
With a fine transfer pipette containing mineral oil followed by alternating W640 and air bubbles, 12-17 healthy two-cell embryos from the previous day's injection are transferred into the recipient. The swollen ampulla is located and holding the oviduct between the ampulla and the bursa, a nick in the oviduct is made with a 28 g needle close to the bursa, making sure not to tear the ampulla or the bursa.
The pipette is transferred into the nick in the oviduct, and the embryos are blown in, allowing the first air bubble to escape the pipette. The fat pad is gently 2o pushed into the peritoneum, and the reproductive organs allowed to slide in. The peritoneal wall is closed with one suture and the skin closed with a wound clip. The mice recuperate on a 37°C slide warmer for a minimum of four hours.
The recipients are returned to cages in pairs. and allowed 19-21 days gestation. After birth, 19-21 days postpartum is allowed before weaning. The 2s weanlings are sexed and placed into separate sex cages, and a 0.5 cm biopsy (used for genotyping) is snipped off the tail with clean scissors.
Genomic DNA is prepared from the tail snips using, for example, a QIAGEN DNEASY kit following the manufacturer's instructions. Genomic DNA is analyzed by PCR using primers designed to amplify a Zsig43 gene or a selectable 3o marker gene that was introduced in the same plasmid. After animals are confirmed to be transgenic, they are back-crossed into an inbred strain by placing a transgenic female with a wild-type male, or a transgenic male with one or two wild-type female(s). As pups are born and weaned, the sexes are separated, and their tails snipped for genotyping.
35 To check for expression of a transgene in a live animal, a partial hepatectomy is performed. A surgical prep is made of the upper abdomen directly below the zyphoid process. Using sterile technique, a small 1.5-2 cm incision is made below the sternum and the left lateral lobe of the liver exteriorized. Using 4-0 silk, a tie is made around the lower lobe securing it outside the body cavity. An atraumatic clamp is used to hold the tie while a second loop of absorbable Dexon (American Cyanamid;
Wayne, N.J.) is placed proximal to the first tie. A distal cut is made from the Dexon tie and approximately 100 mg of the excised liver tissue is placed in a sterile petri dish.
The excised liver section is transferred to a 14 ml polypropylene round bottom tube and snap frozen in liquid nitrogen and then stored on dry ice. The surgical site is closed with suture and wound clips, and the animal's cage placed on a 37°C
heating pad for 24 hours post operatively. The animal is checked daily post operatively and the wound to clips removed 7-10 days after surgery. The expression level of Zsig43 mRNA
is examined for each transgenic mouse using an RNA solution hybridization assay or polymerase chain reaction.
In addition to producing transgenic mice that over-express Zsig43, it is useful to engineer transgenic mice with either abnormally low or no expression of the gene. Such transgenic mice provide useful models for diseases associated with a lack of Zsig43. As discussed above, Zsig43 gene expression can be inhibited using anti-sense genes, ribozyme genes, or external guide sequence genes. To produce transgenic mice that under-express the Zsig43 gene, such inhibitory sequences are targeted to Zsig43 mRNA. Methods for producing transgenic mice that have abnormally low 2o expression of a particular gene are known to those in the art (see, for example, Wu et al., "Gene Underexpression in Cultured Cells and Animals by Antisense DNA and RNA Strategies," in Methods in Gene Biotechnology, pages 205-224 (CRC Press 1997)).
An alternative approach to producing transgenic mice that have little or 2s no Zsig43 gene expression is to generate mice having at least one normal Zsig43 allele replaced by a nonfunctional Zsig43 gene. One method of designing a nonfunctional Zsig43 gene is to insert another gene, such as a selectable marker gene, within a nucleic acid molecule that encodes Zsig43. Standard methods for producing these so-called "knockout mice" are known to those skilled in the art (see, for example, Jacob, 30 "Expression and Knockout of Interferons in Transgenic Mice," in Overexpression and Knockout of Cytokines in Transgenic Mice, Jacob (ed.), pages 111-124 (Academic Press, Ltd. 1994), and Wu et al., "New Strategies for Gene Knockout," in Methods in Gene Biotechnology, pages 339-365 (CRC Press 1997)).
35 The present invention, thus generally described, will be understood more readily by reference to the following example, which is provided by way of illustration and is not intended to be limiting of the present invention.

Construction oja Nucleic Acid Molecule Encoding Zsig43 Pituitary gland RNA was purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA) and reversed transcribed in the following manner. The first strand cDNA reaction contained 10 pI of human pituitary poly (A)+ mRNA (CLONTECH), which had been twice selected with poly d(T), at a concentration of 1.0 mg/ml, and 2 pl of 20 pmole/pl first strand primer ZC6191 (GTCTG GGTTC GCTAC TCGAG
1o GCGGC CGCTA TTTTT TTTTT TTTTT TTT; SEQ ID N0:4) containing a XhoI
restriction site. The mixture was heated at 70°C for 2.0 minutes and cooled by chilling on ice. First strand cDNA synthesis was initiated by the addition of 8 p,l of first strand buffer (Sx SUPERSCRIPT buffer; Life Technologies, Inc.; Gaithersburg, MD), 4 wl of 100 mM dithiothreitol, and 2 pl of a deoxynucleotide triphosphate (dNTP}
solution containing 10 mM each of dTTP, dATP, dGTP and 5-methyl-dCTP (Pharmacia LKB
Biotechnology; Piscataway, NJ) to the RNA-primer mixture. The reaction mixture was incubated at 37°C for 2 minutes, followed by the addition of 10 pl of 200 U/p.l RNase H reverse transcriptase (SUPERSCRIPT II; Life Technologies). The efficiency of the first strand synthesis was analyzed in a parallel reaction by the addition of 10 pCi of 32P-adCTP to a 5 ~1 aliquot from one of the reaction mixtures to label the reaction for analysis. The reactions were incubated at 37°C for 5 minutes, 45°C for 45 minutes, then incubated at 50°C for 10 minutes. Unincorporated 32P-adCTP in the labeled reaction was removed by chromatography on a 400 pore size gel filtration column (CLONTECH). The unincorporated nucleotides and primers in the unlabeled first strand reactions were removed by chromatography on 400 pore size gel filtration column (CLONTECH). The length of labeled first strand cDNA was determined by agarose gel electrophoresis.
The second strand reaction contained 100 pl of the unlabeled first strand cDNA, 30 p.l of Sx polymerase I buffer (125 mM Tris-HCI, pH 7.5, 500 mM KCI, 3o mM MgCl2, SOmM (NH4)2S04)), 2.0 pl of 100 mM dithiothreitol, 3.0 pl of a solution containing 10 mM of each deoxynucleotide triphosphate, 7 ~l of 5 mM ~3-NAD, 2.0 ~.I
of 10 U/ul E coli DNA ligase (NEW ENGLAND BIOLABS; Beverly, MA}, 5 p.l of 10 U/pl E coli DNA polymerase I (NEW ENGLAND BIOLABS), and 1.0 pl of 2 U/p,l RNase H (Life Technologies). A 10 p,l aliquot from one of the second strand synthesis reactions was labeled by the addition of 10 pCi 32P-adCTP to monitor the efficiency of second strand synthesis. The reactions were incubated at 16°C for two hours, followed by the addition of 1 p.l of a 10 mM dNTP solution and 5.0 p.l T4 DNA

polymerase (10 U/~1, Boehringer Mannheim Corporation; Indianapolis, IN) and incubated for an additional 10 minutes at 16°C. Unincorporated 32P-adCTP in the labeled reaction was removed by chromatography through a 400 pore size gel filtration column (CLONTECH) before analysis by agarose gel electrophoresis. The reaction was terminated by the addition of 10.0 ~,1 0.5 M EDTA and extraction with phenol/chloroform and chloroform followed by ethanol precipitation in the presence of 3.0 M sodium acetate and 2 pl of Pellet Paint carrier (Novagen, Inc.; Madison, WI).
The yield of cDNA was estimated to be approximately 2 ~g from starting mRNA
template of 10 ~.g.
to EcoRI adapters were ligated onto the 5' ends of the cDNA described above to enable cloning into an expression vector. A 12.5 ~,l aliquot of cDNA
(about 2.0 pg} and 3 p.l of 69 pmole/pl of EcoRI adapter (Pharmacia LKB
Biotechnology, Inc.) were mixed with 2.5 ~,1 lOx ligase buffer (660 mM Tris-HCl pH 7.5, 100 mM
MgCl2), 2.5 ~,1 of 10 mM ATP, 3.5 p.l 0.1 M DTT and 1 p,l of 15 U/pl T4 DNA
ligase (Promega Corp.; Madison, WI). The reaction was incubated 1 hour at S°C, 2 hours at 7.5°C, 2 hours at 10°C, 2 hours at 12.5°C, and 16 hours at 10°C. The reaction was terminated by the addition of 65 ul H20 and 10 p,l lOx H buffer (Boehringer Mannheim) and incubation at 70°C for 20 minutes.
To facilitate the directional cloning of the cDNA into an expression 2o vector, the cDNA was digested with XhoI, resulting in cDNA molecules having a 5' EcoRI cohesive end and a 3' XhoI cohesive end. The XhoI restriction site at the 3' end of the cDNA had been previously introduced. Restriction enzyme digestion was carried out in a reaction mixture by the addition of 1.0 p.l of 40 U/~1 XhoI
(Boehringer Mannheim) at 37°C for 45 minutes. The reaction was terminated by incubation at 70°C
for 20 minutes and chromatography through a 400 pore size gel filtration column (CLONTECH).
The cDNA was precipitated with ethanol, washed with 70% ethanol, air-dried and resuspended in 13.5 ~.1 water, 2 ~.1 of lOx kinase buffer (660 mM
Tris-HCI, pH 7.5, 100 mM MgCl2), 0.5 ~1 0.1 M DTT, 2 ~l 10 mM ATP, 2 pl T4 polynucleotide kinase (10 U/pl, Life Technologies). Following incubation at 37° C for 30 minutes, the eDNA was precipitated with ethanol in the presence of 2.5 M ammonium acetate, and fractionated on a 0.8% low melt agarose electrophoresis gel. The contaminating adapters and cDNA below 0.6 kb in length were excised from the gel. The electrodes were reversed, and the cDNA was fractionated until concentrated near the lane origin.
The area of the gel containing the concentrated cDNA was excised and placed in a microfuge tube, and the approximate volume of the gel slice was determined. An aliquot of water approximately three times the volume of the gel slice (300 p,l) and 35 p,l of lOx (3-agarose I buffer (NEW ENGLAND BIOLABS) were added to the tube, and the agarose was melted by heating to 65°C for IS minutes. Following equilibration of the sample to 45°C, 3 p,l of 1 U/pl (3-agarose I (NEW ENGLAND BIOLABS) were added, and the mixture was incubated for 60 minutes at 45°C to digest the agarose.
5 After incubation, 40 pl of 3 M sodium acetate were added to the sample, and the mixture was incubated on ice for 1 S minutes. The sample was centrifuged at 14,000 x g for 15 minutes at room temperature to remove undigested agarose. The cDNA was precipitated with ethanol, washed in 70% ethanol, air-dried and resuspended in 20 pl water.
to Following recovery from low-melt agarose gel, the cDNA was cloned into the EcoRI and XhoI sites of pBLUESCRIPT SK+ vector (Life Technologies, Inc.) and electroporated into DH10B cells. Bacterial colonies containing ESTs of known genes were identified and eliminated from sequence analysis by reiterative cycles of probe hybridization to hi-density colony filter arrays (Genome Systems, Inc.;
St. Louis, 15 MO). cDNAs of known genes were pooled in groups of 50 - 100 inserts and were labeled with 3zP using a MEGAPRIME labeling kit (AMERSHAM PHARMACIA
BIOTECH, Inc.; Piscataway, NJ). Colonies that did not hybridize to the probe mixture were selected for sequencing. Sequencing was performed with an ABI 377 sequencer using either the T3 or the reverse primer. The resulting data were analyzed which 20 resulted in the identification of novel nucleotide sequences, including a fragment that had the following sequence: NNNNT NNNTN TCCCC GCGAT GCCGC CGGCG
AGTGG CCCCA NCGTC CTCGC GCGGC TGTTG CCGCT GCTGG GGCTG
CTGCT CGGCA GCGCC TCCCG GGCTC CCGGC AAGTC GCCGC CGGAG
CCCCC CANCC CGCAC GAGAT CCTGA TCAAG GTGCA GGTGT ATGTG
2s AGCGG GGAGC TGGTG CCCCT GGCCC GGGCC TCACT GGATG TGTTT
GGGAA CCGGA CTCTG CTGGC AGCTG GCACC ACANA CTCAT AGGGT
GTGGC CCNCC CTGCC CCTCA GTTAT CGCTT GGGCA C (SEQ ID NO:S), where "N" is any nucleotide. This sequence was used to obtain the complete Zsig43 coding region.

SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> Mammalian Secretory Protein Zsig43 <130> 98-15PC
<160> 5 <170> FastSEQ for Windows Version 3.0 <210>1 <211>3015 <212>DNA

<213>Homo Sapiens <220>
<221> CDS
<222> (18)...(2495) <400> 1 cccggcctag ccccgcg atg ccg ccg gcg agt ggc ccc agc gtc ctc gcg 50 Met Pro Pro Ala Ser Gly Pro Ser Val Leu Ala cgg ctg ttg ccg ctg ctg ggg ctg ctg ctc ggc agc gcc tcc cgg get 98 Arg Leu Leu Pro Leu Leu Gly Leu Leu Leu Gly Ser Ala Ser Arg Ala ccc ggc aag tcg ccg ccg gag ccc ccc agc ccg cag gag atc ctg atc 146 Pro Gly Lys Ser Pro Pro Glu Pro Pro Ser Pro Gln Glu Ile Leu Ile aag gtg cag gtg tat gtg agc ggg gag ctg gtg ccc ctg gcc cgg gcc 194 Lys Val Gln Val Tyr Val Ser Gly Glu Leu Val Pro Leu Ala Arg Ala tca gtg gat gtg ttt ggg aac cgg act ctg ctg gca get ggc acc aca 242 Ser Ual Asp Val Phe Gly Asn Arg Thr Leu Leu Ala Ala Gly Thr Thr gac tca gag ggt gtg gcc acc ctg ccc ctc agt tat cgc ttg ggc acc 290 Asp Ser Glu Gly Val Ala Thr Leu Pro Leu Ser Tyr Arg Leu Gly Thr tgg gtg ctg gtc act get gcc cgc cct ggc ttc ctc acc aac tct gtg 338 Trp Ual Leu Val Thr Ala Ala Arg Pro Gly Phe Leu Thr Asn Ser Val ccc tgg cgt gtt gac aag ctg ccc ttg tat gcg tct gtc agc ctc tac 386 Pro Trp Arg Val Asp Lys Leu Pro Leu Tyr Ala Ser Val Ser Leu Tyr ctg ctc cct gag cgg ccg gcc acg ctc atc ctc tat gag gac ctg gtg 434 Leu Leu Pro Glu Arg Pro Ala Thr Leu Ile Leu Tyr Glu Asp Leu Ual cac att ctc cta ggc tct ccc ggt gcc cgc tcc cag ccc ttg gtg cag 482 His Ile Leu Leu Gly Ser Pro Gly Ala Arg Ser Gln Pro Leu Ual Gln ttc cag cgc cgg get gcc cgc ctg cct gtc agc tcc acc tac agc cag 530 Phe Gln Arg Arg Ala Ala Arg Leu Pro Ual Ser Ser Thr Tyr Ser Gln ctc tgg gcg tca ctt acg cct gcc agc acc cag cag gaa atg cgg get 578 Leu Trp Ala Ser Leu Thr Pro Ala Ser Thr Gln Gln Glu Met Arg Ala ttc cct gcc ttc ctg ggc act gag gcc tcc agc tca ggc aat ggc tcc 626 Phe Pro Ala Phe Leu Gly Thr Glu Ala Ser Ser Ser Gly Asn Gly Ser tgg ctg gag ctg atg ccc ctg act get gtg agc gtg cac ctg ctg aca 674 Trp Leu Glu Leu Met Pro Leu Thr Ala Val Ser Val His Leu Leu Thr ggt aat ggg aca gag gtg ccg ctc tca ggc ccc att cac ctg tcc ctg 722 Gly Asn Gly Thr Glu Val Pro Leu Ser Gly Pro Ile His Leu Ser Leu ccc gtg ccc tcc gag act cgt gcc ctc acc gtg ggc acc agc att cca 770 Pro Val Pro Ser Glu Thr Arg Ala Leu Thr Ual Gly Thr Ser Ile Pro gcc tgg aga ttt gac ccc aag agt ggg ctg tgg gtg cgc aat ggc act 818 Ala Trp Arg Phe Asp Pro Lys Ser Gly Leu Trp Val Arg Asn Gly Thr ggt gta atc cgg aag gaa ggc cgg cag ctc tac tgg acc ttc gtc tcc 866 Gly Val Ile Arg Lys Glu Gly Arg Gln Leu Tyr Trp Thr Phe Val Ser ccc cag ctg ggg tac tgg gtg gcc gcc atg gcc tcc ccc acg get ggg 914 Pro Gln Leu Gly Tyr Trp Val Ala Ala Met Ala Ser Pro Thr Ala Gly ctg gtc acc atc acg tcg ggc atc cag gac atc ggc acc tac cac acc 962 Leu Val Thr Ile Thr Ser Gly Ile Gln Asp Ile Gly Thr Tyr His Thr atc ttc ttg ctc acc atc ctg gca gcc ctg gcc ctg ctg gtg ctt atc 1010 Ile Phe Leu Leu Thr Ile Leu Ala Ala Leu Ala Leu Leu Val Leu Ile ctg ctg tgt ctg ctc atc tac tac tgc cgg agg cgc tgc ctg aag ccg 1058 Leu Leu Cys Leu Leu Ile Tyr Tyr Cys Arg Arg Arg Cys Leu Lys Pro agg caa cag cac cgc aag ctg cag ctc tcg ggg ccc tct gac ggt aac 1106 Arg Gln Gln His Arg Lys Leu Gln Leu Ser Gly Pro Ser Asp Gly Asn aaa cga gac cag gcc acc tcg atg tcc cag ctc cac ctc atc tgt ggg 1154 Lys Arg Asp Gln Ala Thr Ser Met Ser Gln Leu Wis Leu Ile Cys Gly gga ccc ctg gaa ccc gcc ccg tcg ggg gac ccc gag get ccg cct cca 1202 Gly Pro Leu Glu Pro Ala Pro Ser Gly Asp Pro Glu Ala Pro Pro Pro ggc ccc ctc cac tcg gcc ttc tcc agc tcc cgg gac ttg gcc tcc tcc 1250 Gly Pro Leu His Ser Ala Phe Ser Ser Ser Arg Asp Leu Ala Ser Ser cgg gat gac ttc ttc cgc acc aag ccg cgc tct gcc agc cgc ccg gcc 1298 Arg Asp Asp Phe Phe Arg Thr Lys Pro Arg Ser Ala Ser Arg Pro Ala gcc gag cct tcg ggt gcc cgc ggg ggc gag agc gcc ggg ctc aag ggc 1346 Ala Glu Pro Ser Gly Ala Arg Gly Gly Glu Ser Ala Gly Leu Lys Gly get cgc tcg gcc gag ggc ccc ggc ggg ctg gag ccc ggc cta gag gag 1394 Ala Arg Ser Ala Glu G1y Pro Gly Gly Leu Glu Pro Gly Leu Glu Glu cac cgg cgg ggg ccc tcg ggg get gcg gcc ttc ctg cac gag ccg ccc 1442 His Arg Arg Gly Pro Ser Gly Ala Ala Ala Phe Leu His Glu Pro Pro tcg ccg ccg ccg ccc ttc gac cac tac ctg ggc cac aag ggg gcg gcc 1490 Ser Pro Pro Pro Pro Phe Asp His Tyr Leu Gly His Lys Gly Ala Ala gag ggc aag acc ccc gac ttc ctg ctg tcg cag tcg gtg gac cag ctg 1538 Glu Gly Lys Thr Pro Asp Phe Leu Leu Ser Gln Ser Val Asp Gln Leu gcg cgg ccg ccg tcg ctg ggc cag gcg ggg cag ctc atc ttc tgc ggc 1586 Ala Arg Pro Pro Ser Leu Gly Gln Ala Gly Gln Leu Ile Phe Cys Gly tcc atc gac cac ctc aag gac aac gtc tac cgc aac gtc atg ccc acc 1634 Ser Ile Asp His Leu Lys Asp Asn Val Tyr Arg Asn Val Met Pro Thr ctg gtg atc ccc gcg cac tac gtg cgc ctc ggc ggc gag gcg ggc gcc 1682 Leu Ual Ile Pro Ala His Tyr Val Arg Leu Gly Gly Glu Ala Gly Ala gcc ggc gtg ggc gac gag ccg gcc ccg ccg gag ggc acg gca ccc ggc 1730 Ala Gly Val Gly Asp Glu Pro Ala Pro Pro Glu Gly Thr Ala Pro Gly ccg gcg cgc get ttt ccc cag ccc gac ccc cag cgc ccg cag atg ccg 1778 Pro Ala Arg Ala Phe Pro Gln Pro Asp Pro Gln Arg Pro Gln Met Pro ggc cac tcg ggc ccg ggg ggc gag ggc ggc ggg ggc ggc ggc gag ggc 1826 Gly His Ser Gly Pro Gly Gly Glu Gly Gly Gly Gly Gly Gly Glu Gly tgg ggg gcc ggg cgc gcg gcg ccc gtc agt ggc tca gtc acc atc cct 1874 Trp Gly Ala Gly Arg Ala Ala Pro Val Ser Gly Ser Val Thr Ile Pro gtg cta ttc aac gag tcc acc atg gcg cag ctc aac ggg gag ctg cag 1922 Val Leu Phe Asn Glu Ser Thr Met Ala Gln Leu Asn Gly Glu Leu Gln gcc ctg acc gag aag aag ctg ctg gaa ctg ggc gtg aag ccg cac ccg 1970 Ala Leu Thr Glu Lys Lys Leu Leu Glu Leu Gly Val Lys Pro His Pro cgc gcc tgg ttc gtg tcc ctc gac ggg cgc tcc aac tcg caa gtg cgc 2018 Arg Ala Trp Phe Val Ser Leu Asp Gly Arg Ser Asn Ser Gln Val Arg cac tct tac atc gac ctg cag gcg ggc ggc ggg gca cgc agc acc gac 2066 His Ser Tyr Ile Asp Leu Gln Ala Gly Gly Gly Ala Arg Ser Thr Asp gcc agc ctg gac tcg ggc gta gat gtc cac gag gcg cgg ccc gcg cgc 2114 Ala Ser Leu Asp Ser Gly Val Asp Val His Glu Ala Arg Pro Ala Arg cgc cgg ccc gcg agg gag gag cgg gag cgc gcc ccg cct gcc gcg ccg 2162 Arg Arg Pro Ala Arg Glu Glu Arg Glu Arg Ala Pro Pro Ala Ala Pro ccg ccg ccg ccc gcg ccc ccg cgc ctg gcg ctc agc gag gac acg gag 2210 Pro Pro Pro Pro Ala Pro Pro Arg Leu Ala Leu Ser Glu Asp Thr Glu ccc agc agc agc gag agc cgc acg ggc ctc tgc tct ccg gag gac aac 2258 Pro Ser Ser Ser Glu Ser Arg Thr Gly Leu Cys Ser Pro Glu Asp Asn tcg ctg acg ccg ctg ctg gac gag gtg gcg gcg ccc gag ggc cgg gcg 2306 Ser Leu Thr Pro Leu Leu Asp Glu Val Ala Ala Pro Glu Gly Arg Ala gcc acg gta ccc cgg ggg cgg ggc cgc agc cgc ggg gac agc tcc cgc 2354 Ala Thr Val Pro Arg Gly Arg Gly Arg Ser Arg Gly Asp Ser Ser Arg agc agc gcc agc gag ctg cgg cgc gac tcg ctc acc agc ccg gag gac 2402 Ser Ser Ala Ser Glu Leu Arg Arg Asp Ser Leu Thr Ser Pro Glu Asp gag ctg ggg gcg gag gtg ggc gac gag gcg gga gac aag aag agc ccg 2450 Glu Leu Gly Ala Glu Val Gly Asp Glu Ala Gly Asp Lys Lys Ser Pro tgg cag cgg cgg gag gag cgg ccg ctg atg gtg ttc aac gtc aag 2495 Trp Gln Arg Arg Glu Glu Arg Pro Leu Met Val Phe Asn Ual Lys tagcgcccgcgcagggcctggcaccgcccctcccgcgcgggcccgcaccc agggtgcgcg2555 ccccgggggcccgcgggggccctcgcgcgtagctcccagccccaggccgg agaggggccc2615 aggggccttggagctgttccgtggttggtgctgggtcgtgtcttgcaagg gaccctgtgt2675 ctgcctccaagccggggaggagggggggtccagacccccacggggaggtg ccggggagga2735 gggctggggggaagcagtgcctgtgtagacgtggctgtacatagaaagct ctattgtggg2795 aaagcaggaggggtgacccagcctcagctgctagtgtgagggctgggaag ggagggggcg2855 ttctttgtggacccctgggaggggagggggtgctgcttgctgactagccc atctctgggc2915 tacgatgtcacagggctggtggctgggacagctctggggactagggggta atgtgataca2975 gccgatgtgggcagcagcaaatataaaactggtgaggtta 3015 <210>2 <211>826 <212>PRT

<213>Homo sapiens <400> 2 Met Pro Pro Ala Ser Gly Pro Ser Val Leu Ala Arg Leu Leu Pro Leu Leu Gly Leu Leu Leu Gly Ser Ala Ser Arg Ala Pro Gly Lys Ser Pro Pro Glu Pro Pro Ser Pro Gln Glu Ile Leu Ile Lys Val Gln Val Tyr Ual Ser Gly Glu Leu Ual Pro Leu Ala Arg Ala Ser Val Asp Ual Phe Gly Asn Arg Thr Leu Leu Ala Ala Gly Thr Thr Asp Ser Glu Gly Val Ala Thr Leu Pro Leu Ser Tyr Arg Leu Gly Thr Trp Ual Leu Val Thr Ala Ala Arg Pro Gly Phe Leu Thr Asn Ser Val Pro Trp Arg Val Asp Lys Leu Pro Leu Tyr Ala Ser Ual Ser Leu Tyr Leu Leu Pro Glu Arg Pro Ala Thr Leu Ile Leu Tyr Glu Asp Leu Val His Ile Leu Leu Gly Ser Pro Gly Ala Arg Ser Gln Pro Leu Val Gln Phe Gln Arg Arg A1a Ala Arg Leu Pro Val Ser Ser Thr Tyr Ser Gln Leu Trp Ala Ser Leu Thr Pro Ala Ser Thr Gln Gln Glu Met Arg Ala Phe Pro Ala Phe Leu Gly Thr Glu Ala Ser Ser Ser Gly Asn Gly Ser Trp Leu Glu Leu Met Pro Leu Thr Ala Val Ser Val His Leu Leu Thr Gly Asn Gly Thr Glu Ual Pro Leu Ser Gly Pro Ile His Leu Ser Leu Pro Val Pro Ser Glu Thr Arg Ala Leu Thr Ual Gly Thr Ser Ile Pro Ala Trp Arg Phe Asp Pro Lys Ser Gly Leu Trp Val Arg Asn Gly Thr Gly Val Ile Arg Lys Glu Gly Arg Gln Leu Tyr Trp Thr Phe Val Ser Pro Gln Leu Gly Tyr Trp Val Ala Ala Met Ala Ser Pro Thr Ala Gly Leu Val Thr Ile Thr Ser Gly Ile Gln Asp Ile Gly Thr Tyr His Thr Ile Phe Leu Leu Thr Ile Leu Ala Ala Leu Ala Leu Leu Ual Leu Ile Leu Leu Cys Leu Leu Ile Tyr Tyr Cys Arg Arg Arg Cys Leu Lys Pro Arg Gln Gln His Arg Lys Leu Gln Leu Ser Gly Pro Ser Asp Gly Asn Lys Arg Asp Gln Ala Thr Ser Met Ser Gln Leu His Leu Ile Cys Gly Gly Pro Leu Glu Pro Ala Pro Ser Gly Asp Pro Glu Ala Pro Pro Pro Gly Pro Leu His Ser Ala Phe Ser Ser Ser Arg Asp Leu Ala Ser Ser Arg Asp Asp Phe Phe Arg Thr Lys Pro Arg Ser Ala Ser Arg Pro Ala Ala Glu Pro Ser Gly Ala Arg Gly Gly Glu Ser Ala Gly Leu Lys Gly Ala Arg Ser Ala Glu Gly Pro Gly Gly Leu Glu Pro Gly Leu Glu Glu His Arg Arg Gly Pro Ser Gly Ala Ala Ala Phe Leu His Glu Pro Pro Ser Pro Pro Pro Pro Phe Asp His Tyr Leu Gly His Lys Gly Ala Ala Glu Gly Lys Thr Pro Asp Phe Leu Leu Ser Gln Ser Val Asp Gln Leu Ala Arg Pro Pro Ser Leu Gly Gln Ala Gly Gln Leu Ile Phe Cys Gly Ser Ile Asp His Leu Lys Asp Asn Val Tyr Arg Asn Ual Met Pro Thr Leu Val Ile Pro Ala His Tyr Val Arg Leu Gly Gly Glu Ala Gly Ala Ala Gly Val Gly Asp Glu Pro Ala Pro Pro Glu Gly Thr Ala Pro Gly Pro Ala Arg Ala Phe Pro Gln Pro Asp Pro Gln Arg Pro Gln Met Pro Gly His Ser Gly Pro Gly Gly Glu Gly Gly Gly Gly Gly Gly Glu Gly Trp Gly Ala Gly Arg Ala Ala Pro Val Ser Gly Ser Val Thr Ile Pro Ual Leu Phe Asn Glu Ser Thr Met Ala Gln Leu Asn Gly Glu Leu Gln Ala Leu Thr Glu Lys Lys Leu Leu Glu Leu Gly Val Lys Pro His Pro Arg Ala Trp Phe Val Ser Leu Asp Gly Arg Ser Asn Ser Gln Val Arg His Ser Tyr Ile Asp Leu Gln Ala Gly Gly Gly Ala Arg Ser Thr Asp Ala Ser Leu Asp Ser Gly Val Asp Val His Glu Ala Arg Pro Ala Arg Arg Arg Pro Ala Arg Glu Glu Arg Glu Arg Ala Pro Pro Ala Ala Pro Pro Pro Pro Pro Ala Pro Pro Arg Leu Ala Leu Ser Glu Asp Thr Glu Pro Ser Ser Ser Glu Ser Arg Thr Gly Leu Cys Ser Pro Glu Asp Asn Ser Leu Thr Pro Leu Leu Asp Giu Val Ala Ala Pro Glu Gly Arg Ala Ala Thr Val Pro Arg Gly Arg Gly Arg Ser Arg Gly Asp Ser Ser Arg Ser Ser Ala Ser Glu Leu Arg Arg Asp Ser Leu Thr Ser Pro Glu Asp Glu Leu Gly Ala Glu Val Gly Asp Glu Ala Gly Asp Lys Lys Ser Pro Trp Gln Arg Arg Glu Glu Arg Pro Leu Met Val Phe Asn Val Lys <210> 3 <211> 2478 <212> DNA
<213> Artificial Sequence <220>
<223> This is a degenerate sequence that encodes the amino acid sequence of SEQ ID N0:2.

<221> variation <222> (1)...(2478) <223> N is any nucleotide.
<400> 3 atgccnccngcnwsnggnccnwsngtnytngcnmgnytnytnccnytnytnggnytnytn60 ytnggnwsngcnwsnmgngcnccnggnaarwsnccnccngarccnccnwsnccncargar120 athytnathaargtncargtntaygtnwsnggngarytngtnccnytngcnmgngcnwsn180 gtngaygtnttyggnaaymgnacnytnytngcngcnggnacnacngaywsngarggngtn240 gcnacnytnccnytnwsntaymgnytnggnacntgggtnytngtnacngcngcnmgnccn300 ggnttyytnacnaaywsngtnccntggmgngtngayaarytnccnytntaygcnwsngtn360 wsnytntayytnytnccngarmgnccngcnacnytnathytntaygargayytngtncay420 athytnytnggnwsnccnggngcnmgnwsncarccnytngtncarttycarmgnmgngcn480 gcnmgnytnccngtnwsnwsnacntaywsncarytntgggcnwsnytnacnccngcnwsn540 acncarcargaratgmgngcnttyccngcnttyytnggnacngargcnwsnwsnwsnggn600 aayggnwsntggytngarytnatgccnytnacngcngtnwsngtncayytnytnacnggn660 aayggnacngargtnccnytnwsnggnccnathcayytnwsnytnccngtnccnwsngar720 acnmgngcnytnacngtnggnacnwsnathccngcntggmgnttygayccnaarwsnggn780 ytntgggtnmgnaayggnacnggngtnathmgnaargarggnmgncarytntaytggacn840 ttygtnwsnccncarytnggntaytgggtngcngcnatggcnwsnccnacngcnggnytn900 gtnacnathacnwsnggnathcargayathggnacntaycayacnathttyytnytnacn960 athytngcngcnytngcnytnytngtnytnathytnytntgyytnytnathtaytaytgy1020 mgnmgnmgntgyytnaarccnmgncarcarcaymgnaarytncarytnwsnggnccnwsn1080 gayggnaayaarmgngaycargcnacnwsnatgwsncarytncayytnathtgyggnggn1140 ccnytngarccngcnccnwsnggngayccngargcnccnccnccnggnccnytncaywsn1200 gcnttywsnwsnwsnmgngayytngcnwsnwsnmgngaygayttyttymgnacnaarccn1260 mgnwsngcnwsnmgnccngcngcngarccnwsnggngcnmgnggnggngarwsngcnggn1320 ytnaarggngcnmgnwsngcngarggnccnggnggnytngarccnggnytngargarcay1380 mgnmgnggnccnwsnggngcngcngcnttyytncaygarccnccnwsnccnccnccnccn1440 ttygaycaytayytnggncayaarggngcngcngarggnaaracnccngayttyytnytn1500 wsncarwsngtngaycarytngcnmgnccnccnwsnytnggncargcnggncarytnath1560 ttytgyggnwsnathgaycayytnaargayaaygtntaymgnaaygtnatgccnacnytn1620 gtnathccngcncaytaygtnmgnytnggnggngargcnggngcngcnggngtnggngay1680 garccngcnccnccngarggnacngcnccnggnccngcnmgngcnttyccncarccngay1740 ccncarmgnccncaratgccnggncaywsnggnccnggnggngarggnggnggnggnggn1800 ggngarggntggggngcnggnmgngcngcnccngtnwsnggnwsngtnacnathccngtn1860 ytnttyaaygarwsnacnatggcncarytnaayggngarytncargcnytnacngaraar1920 aarytnytngarytnggngtnaarccncayccnmgngcntggttygtnwsnytngayggn1980 mgnwsnaaywsncargtnmgncaywsntayathgayytncargcnggnggnggngcnmgn2040 wsnacngaygcnwsnytngaywsnggngtngaygtncaygargcnmgnccngcnmgnmgn2100 mgnccngcnmgngargarmgngarmgngcnccnccngcngcnccnccnccnccnccngcn2160 ccnccnmgnytngcnytnwsngargayacngarccnwsnwsnwsngarwsnmgnacnggn2220 ytntgywsnccngargayaaywsnytnacnccnytnytngaygargtngcngcnccngar2280 ggnmgngcngcnacngtnccnmgnggnmgnggnmgnwsnmgnggngaywsnwsnmgnwsn2340 wsngcnwsng arytnmgnmg ngaywsnytn acnwsnccng argaygaryt nggngcngar 2400 gtnggngayg argcnggnga yaaraarwsn ccntggcarm gnmgngarga rmgnccnytn 2460 atggtnttya aygtnaar 2478 <210> 4 <211> 48 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 4 gtctgggttc gctactcgag gcggccgcta tttttttttt tttttttt 48 <210> 5 <211> 291 <212> DNA
<213> Artificial Sequence <220>
<223> Expressed sequence tag <221> variation <222> (1)...(1) <223> N is any nucleotide.
<400>

nnnntnnntntccccgcgatgccgccggcgagtggccccancgtcctcgcgcggctgttg 60 ccgctgctggggctgctgctcggcagcgcctcccgggctcccggcaagtcgccgccggag 120 ccccccancccgcacgagatcctgatcaaggtgcaggtgtatgtgagcggggagctggtg 180 cccctggcccgggcctcactggatgtgtttgggaaccggactctgctggcagctggcacc 240 acanactcatagggtgtggcccnccctgcccctcagttatcgcttgggcac 291

Claims (19)

What is claimed is:

1. An isolated mammalian secretory protein Zsig43, comprising an extracellular domain, wherein the extracellular domain comprises amino acid residues 26 to 315 of the amino acid sequence of SEQ ID NO:2.

2. The isolated protean of claim I, wherein the protein further comprises a transmembrane domain that resides in a carboxyl-terminal position relative to the extracellular domain, wherein the trasmembrane domain comprises amino acid residues 316 to 340 of SEQ ID NO:2.

3. The isolated protein of claim 2, wherein the protein further comprises as intracellular domain that resides in a carboxyl-terminal position relative to the transmembrane domain, wherein the intracellular domain comprises amino acid residues 341 to 826 of SEQ ID NO:2.

4, The isolated protein of claim 1, wherein the protein further comprises a signal secretory sequence that resides in an amino-terminal position relative to the extracellular domain, wherein the signal secretory sequence comprises amino acid residues 1 to 25 of the amino acid sequence of SEQ ID NO:2.

5. An isolated polypeptide, comprising an amino acid sequence that is at least 70% identical to the amino acid sequence of SEQ ID NO:2, wherein the isolated polypeptide specifically binds with an antibody that specifically binds with a polypeptide consisting of the amino acid sequence of SEQ ID NO:2.

6. The isolated polypeptide of claim 5, wherein the isolated polypeptide comprises an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO:2.

7. The isolated polypeptide of claim 5, wherein the isolated polypeptide comprises an amino acid sequence that is at least 90°k identical to the amino acid sequence of SEQ ID NO:2.

8. The isolated polypeptide of claim 5, comprising the amino acid sequence of SEQ ID NO:2.

9. An isolated nucleic acid molecule, comprising the nucleotide sequence of SEQ ID NO:3.

10. The isolated nucleic acid molecule of claim 9, comprising the nucleotide sequence of nucleotides 93 to 2495 of SEQ ID NO:1.

11. An isolated nucleic acid molecule, comprising a nucleotide sequence that encodes the amino acid sequence of amino acid residues 26 to 315 of SEQ
ID NO:2.

12. A vector, comprising the isolated nucleic acid molecule of claim 11.

13. An expression vector, comprising the isolated nucleic acid molecule of claim 11, a transcription promoter, and a transcription terminator, wherein the promoter is operably linked with the nucleic acid molecule, and wherein the nucleic acid molecule is operably linked with the transcription terminator.

14. A recombinant host cell comprising the expression vector of claim 13, wherein the host cell is selected from the group consisting of bacterium, yeast cell, fungal cell, insect cell, mammalian cell, and plant cell.

15. A method of using the expression vector of claim 13 to produce a polypeptide that comprises amino acid residues 26 to 315 of SEQ ID NO:2, comprising culturing recombinant host cells that comprise the expression vector and that produce the polypeptide.

16. An antibody or antibody fragment that specifically binds with a lypeptide that comprises the amino acid sequence of amino acid residues 26 to 315 of SEQ
ID NO:2.

17. A method of detecting in a biological sample the presence of RNA that encodes the amino acid sequence of SEQ ID NO:2, comprising:
(a) contacting a nucleic acid probe under hybridizing conditions with either (i) test RNA molecules isolated from the biological sample, or (ii) nucleic acid molecules synthesized from the isolated RNA molecules, wherein the probe has a nucleotide sequence comprising a portion of the nucleotide sequence of SEQ ID NO:1, or its complement, and (b) detecting lane formation of hybrids of the nucleic acid probe and either the test RNA molecules or the synthesized nucleic acid molecules, wherein the presence of the hybrids indicates the presence of RNA that encodes the amino acid sequence of SEQ ID NO:2 in the biological sample.

18. A method of detecting in a biological sample the presence of a polypeptide that comprises the amino acid sequence of amino acid residues 26 to 315 of SEQ
ID NO:2, comprising:
(a) contacting the biological sample with an antibody, or an antibody fragment, of claim 16, wherein the contacting is performed under conditions that allow the binding of the antibody or antibody fragment to the biological sample, and (b) detecting nay of the bound antibody or bound antibody fragment.

19. An antibody or antibody fragment that specifically binds with a polypeptide that comprises amino acid residues 341 to 826 of SEQ ID NO:2