CA2346968A1 - Plasmodium falciparum antigens and their vaccinal and diagnostic applications - Google Patents

Description

ANTIG ~ NES OF PLASMODIUM FALCIPARUM AND THEIR
VACCINE AND DIAGNOSTIC APPLICATIONS
BACKGROUND OF THE INVENTION
a) Field of the invention The present invention relates to novel antigens of Plasmodium falciparum and their vaccine and diagnostic applications.
More in particular, the present invention relates to polynucleotide molecules and immunogenic polypeptides, compositions comprising them, and methods of diagnosis and vaccination of malaria.
b) Brief description of the prior art Malaria is a disease caused by infection of parasites protozoa belonging to the apicomplexes of the Plasmodium species and transmitted by females of Anopheles mosquitoes. Despite the fact that WHO has classified, since 1998, malaria among the three infectious diseases interest major for global public health at the same level as tuberculosis and the AIDS, there is not yet an effective vaccine against this disease.
Previous studies have led to the discovery of polypeptides antigenics of the pre-erythrocytic stage of the disease, including SALSA polypeptides (for Sporozoite Liver Stage Antigen) described in EP A
0407230, LSA 1 (for Liver Stage Antigen) described in WO 92/13884 and LSA-3 described in FR 2,735,478.
The present invention relates to new mo ~ ecu ~ es polynucleotides and polypeptides specific for the pre-erythrocyte and their uses as an active ingredient in malaria vaccine or in methods of diagnosing the disease.
SUMMARY OF THE INVENTION
The Applicant has identified a series of 120 DNA fragments genomics coding for proteins expressed in the preerythrocytic stages, that is to say at the sporozoite stage and / or at the hepatic stage. The caracterisation

2 initial of this series of clones led to the identification of the LSA-1 antigen, then SALSA, then STARP, then LSA-3. More recent work on 10 fragments of the same bank of clones coding for pre-allowed to provide details concerning 8 of them, 3 himself have been shown to be genes already known to be expressed at the stage erythrocyte and the other 5 as new genes not described to date, and whose expression at the pre-erythrocytic stages has been confirmed.
In addition, the work carried out using the cells of volunteers protected by irradiated sporozoites, those of chimpanzees protected by the same method and those of chimpanzees like Aotus trivirgatus, protected by immunization with LSA-3 antigen led to characterize responses cells with a high rate of secretion of interferon-y, generally associated with a low production of antibodies, as being associated with the state of protection, and vice versa.
Among the new pre-erythrocyte genes studied, two of them, called DG747 and DG772 have several remarkable properties: they generate cellular responses to high Interferon- ~ y levels, detected by ELISPOT in volunteers protected by irradiated sporozoites, who are also found for several regions of the LSA-3 antigen but which are absent for 4 regions of the LSA-1 antigen, two from SALSA, two from STARP
and two from "CircumSporozoïte protein". These same two clones are positive also in the same tests in chimpanzees protected by irradiated sporozoites. The differential response profile between chimpanzees protected and those of chimpanzees having received sporozoites irradiated with too much strong dose, and unprotected, is identical to that recorded with the LSA-3 molecule which is capable of inducing protection. This response profile corresponds, according to work carried out in rodents, with the capacity to induce recruitment cell specific at the intrahepatic level. The complete sequence of the two genes has been identified. Corresponding proteins have antigenicity high in individuals exposed to the parasite in endemic areas (reaction in 80%
adults in endemic areas). Their location on the surface of the sporozoite and their production during the intrahepatic maturation of the parasite was

3 confirmed by various biological methods. Their immunogenicity in animals as recombinant proteins, or as plasmids (genetic immunization) has been demonstrated. These characteristics make them important candidates who request to be the subject of further studies, in particular immunization and challenge in the higher primate for get new vaccine formulations, alone or in combination with the LSA-3 antigen.
BR ~ VE DESCRIPTION OF THE DRAWINGS
Figures 1 A, 1 B, 1 C and 1 D show the sequence list nucleotides (SEQ ID NOs: 1 and 2) and amino acids (SEQ ID NOs: 3 and 4) DG747 and DG772.
Figure 1E shows typical degenerate repeating sequences of the DG747 clone.
Figure 2A shows the sequence of the gene encoding DG747.
Figure 2B shows the sequence of the gene encoding DG772.
Figure 3.1 is a schematic representation of proteins corresponding to DG747 and DG772.
Figure 3.2 shows IFATs of the sporozoite and blood stages of P. falciparum and sporozoites of P. yoeüi with anti-DG747 antibodies or anti-DG772.
Figure 3.3 shows Western blots of P. falciparum, P. yoelü and P. berghei using anti-Hiss-747 (a) and anti-Hiss-772 (b) antibodies.
Figure 3.4 shows photographs of PCR results DNA from 12 different strains with specific primers for DG747 (a) and DG772 (b).
Figure 3.5 illustrates with graphs the prevalence of responses humoral against His6-747 (a) and Hiss-772 (b) in two age groups and in two different endemic areas.
Figure 3.6 graphically illustrates the cellular responses against Hiss-747 and His6-772 in humans and immune chimpanzees with irradiated sporozoites.

4 Figure 3.7 illustrates with graphs the distribution of isotypes of IgG in humoral responses against His6-747 and Hiss-772 of individuals differentially exposed to malaria.
Figure 3.8 illustrates with graphs the humoral responses of mice immunized with four recombinant protein formulations.
DETAILED DESCRIPTION OF THE INVENTION
The originality of the present invention relates to the demonstration of new stage-specific polynucleotide and polypeptide molecules malaria pre-erythrocyte and their uses as a principle active of anti-malaria vaccine or in methods of diagnosing the disease.
More particularly, the invention relates to polynucleotides having a nucleotide sequence of at least 10 consecutive nucleotides and having at least 60%, preferably 80% and more preferably at least 95% identity with the SEQ. ID NO: 1 or NO 2. Other molecules according to the invention contain at least at least 20 consecutive nucleotides or at least 50. Other molecules according to the invention hybridizes under conditions of strong stringency with nucleotide sequences above, and more particularly with the SEQs. ID
NOs: 1 and / or NO 2. As a non-limiting example of strong conditions stringencies we find the following method:
a) pre-hybridization and hybridization at 68 ° C. in a solution containing:

SSPE (1X SSPE = 0.18 M NaCl, 10 mM NaH2PO4); 5X solution Denhardt; 0.05% (w / v) sodium dodecyl sulfate (SDS); and 100 pg / ml salmon sperm DNA;
b) two washes at room temperature for 10 min in the presence of 2X SSPE and 0.1% SDS;
c) washing at 60 ° C for 15 min in the presence of 1X SSPE and 0.1%
SDS; and d) washing at 60 ° C for 15 min in the presence of 0.1X SSPE and 0.1%
SDS.
The invention also relates to the polypeptides (and fragments thereof) which derive from the above-mentioned nucleotide sequences and preferably polypeptides having at least 10 consecutive amino acids and at least 80% and more preferably at least 95% homology with one of the sequences chosen from the group consisting of SEQ ID NOs: 3 to 7, and SEQ ID NO:
8. Other molecules according to the invention contain at least 20 amino acids

5 consecutive or at least 50.
It is well known in the field how to determine the percentage of identity between different sequences. For example, a method analysis for alignment of nucleotide and peptide sequences according to the invention is advantageously the GAP GCGT "" program (Genetic Computer Group) from UNIXT programming manual "~ (Wisconsin Sequence Analysis PackageT""), Needleman and Wunsch algorithm. The parameters used are default settings or the following settings: for a comparison of nucleotide sequences: "gap penalty" = 50; "gap extension penalty": 3; and for a comparison of amino acid sequences: "gap penalty" = 5; "gap penalty extension ": 0.30.
The peptides according to the present invention can be prepared by any appropriate process. They can in particular be obtained by chemical synthesis but it is also possible to obtain them biologically using in particular different vectors in appropriate cell cultures such as than this will be described below.
The molecules of the invention can be used as such or be modified (chemical conjugates, fusion protein) if necessary. Through example, modifications (chemical or nucleotide or peptides) allowing nucleotides / peptides to cross certain barriers to show better solubilization, to facilitate their incorporation in particular dosage forms such as for example liposomes or microparticles. It should also be noted in this connection that the peptides according to the present invention can be in the form deglycosylated, or glycosylated, if necessary. A person versed in the field of the invention will be able to obtain different polynucleotides / polypeptides and it will also be able to determine which of the

6 polynucleotides / polypeptides obtained, those which have a biological activity adequate.
Thus, the subject of the invention is also a process for the preparation of a peptide of the invention, by transformation of a cellular host using a vector of expression (plasmid, cosmid, virus, etc.) comprising the DNA sequences coding for the peptides of the invention, followed by culturing the host cell thus transformed, and the recovery of the peptide in the medium of culture.
The invention therefore also relates to any vector (of cloning and / or expression) and any cellular host (prokaryotic or eukaryotic) transformed by a such a vector, and comprising the regulatory elements allowing expression of the nucleotide sequence coding for a peptide according to the invention.
More particularly, the invention relates to recombinant E. Coli cells containing an insert corresponding to the polynucleotides defined by! es SEQ ID
NOs: 1 and 2. More preferably the E. Coli cells are those which have been deposited at the CNCM on May 23, 2001 under accession numbers I-2671 and I-2672. Briefly, these cells were obtained by transformation of a plasmid containing either an insert corresponding to the defined polynucleotides through SEQ ID NO: 1, i.e. an insert corresponding to the polynucleotides defined by the SEQ ID N0: 2. in E. Coü DhSa. Each of the plasmids was obtained from a phage ~, recombinant gt11 containing the insert. A PCR to summer performed with flanking primers at the insert and this amplified insert was digested with EcoR1 and subcloned into the vector pTreHis6 (Invitrogen) in EcoR1 sites.
The use of vectors for the expression of proteins and peptides in the cells of a host, especially humans, is known and will not be described more in detail. It may be advantageous to use vectors incorporating of the sequences capable of increasing the immunogenicity of polynucleotides / polypeptides of the present invention, such as sequences CPG, the GMCSF (Granulocyte Macrophage Colony Stimulating Factor) gene or cytokine genes. The specific constructions depend obviously the host, the epitope and the vector selected.

7 The peptides of the present invention and the polynucleotides encoding them can also be used to prepare polyclonal antibodies or monoclonal able to attach (preferably specifically) to at least one peptide / polynucleotide object of the invention. The present invention therefore aims also such purified antibodies which can be obtained by techniques very well known, for example the technique described by Kolher and Milstein (Continuous cultures of fused cells secreting antibody of predefined specificity, Nature (1975), 262: 495-497) In a preferred embodiment of the invention, at least one portion immunogenic peptides / polynucleotides according to the invention is conjugated to a support on which it is absorbed or fixed covalently or not covalent at its C and / or N-terminal end. The support can be constituted of carrier molecules (natural or synthetic), physiologically acceptable and non-toxic. These carrier molecules can allow in particular to increase the immunogenicity of the peptides of the invention by through complementary reactive groups respectively carried by the carrier molecule and the peptide. As an example of molecules carriers, natural proteins such as tetanus toxoid will be mentioned, ovalbumin, serum albumin, hemocyamines, PPD (purified protein derivative) of tuberculin, etc. As supports macromolecular synthetic, for example polylysines or poly (DL-alanine) -poly (L-lysine). As hydrocarbon or lipid supports, we will mention saturated or unsaturated fatty acids. Support can also take the form of liposomes, particles and microparticles, vesicles, of microspheres of latex beads, polyphosphoglycans (PGLA), or polystyrene.
The invention also relates to vaccine / therapeutic compositions.
(drug) comprising peptides / polynucleotides, conjugates and / or polyclonal or monoclonal antibodies as described above, and a acceptable pharmaceutical vehicle. The invention also relates to immunogenic compositions capable of inducing protection by infection test by Plasmodiums, both in vivo and in vitro and, so preferred, protection by a challenge infection with Plasmodium falciparum.

Preferably, the compositions according to the invention allow the production of interferon-y by leukocytes from subjects immunized with sporozoites irradiated and / or obtaining an IgG humoral response such as IgG1, IgG2, IgG3 andlou IgG4.
These compositions can be advantageous in order to be administered in vivo for the treatment or prevention of malaria in human. Of course, the use of compositions based on antibodies need generally that these are compatible with the administration to be human. It can in particular be antibodies humanized by techniques known or directly expressed in situ from the DNA sequence as for example the technique described in Ren EC, Cellular and Molecular approaches to developping human monoclonal antibodies as drugs (1991), Ann.
Acad. Med. Singapore, 20: 66-70.
The compositions according to the present invention can be presented under any solid or liquid form customary for administration pharmaceutical, i.e. for example forms of liquid administration, in gel, or any other support allowing, for example, controlled release.
Among the compositions which can be used, mention may in particular be made of the compositions injectable more particularly intended for injections into the bloodstream in human.
The compositions of the invention may also include components increasing or likely to increase the immunogenicity of peptides, including other immunogenic peptides, adjuvants of immunity specific or not such as alum, QS21, Freund's adjuvant, adjuvant SBA2, montanide, polysaccharides or equivalent compounds.
The present invention further relates to compositions intended to be administered in order to express in situ the peptides described above. Through example, by injecting "naked DNA" encoding the immunogenic peptides of the invention, this injection leads, in a certain number of cases, to expression of the encoded peptide and to an immune response against said peptide. We will be able to also use naked DNA systems but with their own system of expression or expression vectors as described above. The expression vectors are likely, in some cases, to improve the activity expressed peptides. Vaccination systems using DNA sequences are known and are already widely described in the literature.
Examples of vaccination using DNA sequences are described in international application WO 95/111307 and in the publication of Bot et al. (DNA immunization of newborn mice with a plasmid expressing nucleoprotein of Influenza virus (1996), Viral Immunol., 9: 207-210) The invention also relates to methods of in vitro diagnosis of malaria in an individual likely to be infected with Plasmodium falciparum.
According to one embodiment of the invention, the method comprises the following steps:
a) contacting, under conditions allowing a reaction immunological, tissue or biological fluid taken from a individual likely to be infected with Plasmodium falciparum with a antibody as previously described to allow formation immune complexes; and b) in vitro detection of the immune complexes formed.
According to one embodiment of the invention, the diagnostic method includes the following steps:
a) contacting, under conditions allowing a reaction immunological, tissue or biological fluid taken from a individual likely to be infected with Plasmodium falciparum with polynucleotide / polypeptide molecules as described previously to allow the formation of immune complexes involving at least one of said molecules and antibodies possibly present in said tissue or said biological fluid; and b) in vitro detection of any immune complexes that may have formed.
The invention also relates to kits (kits) for the diagnosis of malaria in an individual. According to one embodiment of the invention, the kit includes the following:

a) at least one of the elements chosen from the group consisting of:
polynucleotide molecules; the polypeptide molecules and the conjugates as previously described;
b) reagents for the constitution of the medium suitable for a reaction of 5 bond between a test sample and at least one of the molecules defined in a); and c) reagents for the detection of antigen-antibody complexes produced by said binding reaction, these reagents also being able to wear a marker or be likely to be recognized in turn by 10 a labeled reagent.
According to another embodiment of the invention, the kit comprises the following items:
- antibodies as described above;
- reagents for the constitution of the medium favorable to a reaction of binding between a test sample and at least one of said antibodies; and - reagents for the detection of antigen-antibody complexes produced by said binding reaction, these reagents also being able to wear a marker or be likely to be recognized in turn by a labeled reagent Although through the specification of the present invention, the term "peptide" and "polypeptide", it is understood that the invention is not limited not to compounds formed by the union of a limited number of amino acids. Indeed, the flexibility of recombinant technologies enables proteins to be produced comprising a plurality of identical or different epitopes and susceptible to improve the immunogenic activity of the final product. So this invention also covers immunogenic polymers comprising between two and ten peptides chosen from the polypeptides defined above. Likewise, the present invention includes oligonucleotides having a sequence nucleotide coding for oligonucleotides incorporating one or more polynucleotides such as defined above.
The examples below will highlight other features and advantages of the present invention.

a CA 02346968 2001-05-23 EXAMPLES
The following examples serve to illustrate the extent of use of the present invention and not to limit its scope. Modifications and variations can be carried out without escaping the spirit and scope of the invention. Although other methods or products can be used equivalent to those found below to test or carry out the The present invention describes the preferred equipment and methods.
1) INTRODUCTION
1.1 History of malaria Malaria is a disease caused by infection of parasites protozoa belonging to the apicomplexes of the Plasmodium species and transmitted by females of Anopheles mosquitoes. The sustained efforts and the eradication program started in the 1950s, funded by WHO
allowed to limit the areas where the disease spread and to decrease the number of infected people. Since then, the decline in effectiveness of the means of control against the parasite has caused an increase in malaria cases compared to it there at 20 years. Today malaria remains concentrated in the sub-belt tropical where between 300 and 500 million clinical cases are recorded annually, of which at least 3 million die mainly due to infection with P. falciparum. Following the appearance and extension of a overall resistance to only effective drugs, and because the regions affected are in extension, WHO has classified, since 1998, malaria among the three infectious diseases of major interest to global public health at same rank as tuberculosis and AIDS.
Description of malaria infection, the clinical signs of which are very characteristics, can be found in writings of civilizations the more ancient, such as the Nei Ching, a large medical directory for the emperor Chinese Huang Ti (2700 BC), Mesopotamian tablets (2000 BC) C.), Egyptian papyri (1500 BC) and Vedic writings (1500-800 BC.
BC). Part of Hippocrates'"book of epidemics" (460-370 BC) at was devoted to the detailed description of tertiary or quaternary fevers or a relationship between splenomegalies and the proximity of swampy areas. Besides, the term malaria designates a fever of the swampy areas (L. palude = swamp), which is also reflected in the term malaria (I. mall'aria) probably introduced by Sansovino in 1560 for describe the "bad air" from the swamps. The drainage of these areas has been one of the only means of malaria control known before the discovery of the infectious agent. Despite knowledge of clinical signs, the parasite causing the disease was not discovered until the end of the 19th century.
In 1880 Charles Louis Alphonse Laveran observed the exaggeration of altered microgamets and red blood cells from (Laveran, 1880), and it has associated these forms with the disease. His findings were controversial and born were accepted by others, in particular by the important school Italian, that 5 years later. The mode of transmission of the disease remains unknown 12 years. Patrick Manson in 1877 demonstrated that the filariasis nematode (Elephantiasis) was transmitted by a mosquito. He was convinced that the malaria followed a similar course. He advised Ronald Ross to begin research on this and the latter described in 1897, for the first time, oocysts in mosquitoes that have been fed on infected humans.
Then, using Bird Piasmodium, he was able to describe the entire cycle of parasite in the mosquito. This cycle was confirmed in 1898 for the species plasmodiales of the man by the Italian researchers carried out by Battista Grassi.
It has long been believed that after inoculation by the mosquito, the sporozoite directly invaded the red blood cell of the host mammal, thereby initiating the asexual and gendered blood cycle. An exo-erythrocytic cycle was described as early as 1908 in parasites of birds by H. de Beaupaire Aragao who demonstrated the development of atypical forms, in endothelial cells and macrophages, capable of releasing forms invading red blood cells and to transform into typical pigmented forms of the parasite. However we have vintage that the tissue cycle was a special form of these species Plasmodium.
It is only because of observations made during infections malarial induced and closely monitored in individuals (such as malariotherapy of the 1920s-50s) that the presence of an additional tissue stage was postulated then actively sought. Pre-erythrocytic forms of primates and humans parasites were only discovered in 1948 when HE Shortt and PCC Garnham described hepatic forms resulting sporozoite inoculations of P. cynomolgi (close to P. vivax) in monkey rhesus (Shortt and Garnham, 1948). In 1951 the same stages were described for P. falciparum (Shortt et al., 1951) in a remarkable experiment where a liver biopsy was taken from a volunteer previously inoculated with of the million sporozoites. However, the upsurges due to P. vivax or P.
oval were not explained, and it was hypothesized that an exo-"secondary" erythrocyte. It was not until much later that phenomenon was demonstrated experimentally. So a "dormant" stage of the hepatic form, the hypnozoite, was described in 1980 (Krotoski et al., 1980) for P.
cynomolgi, the primate equivalent of P. vivax. This form is responsible relapses after a long period of absence of parasite in the blood / parasite exposure, which are characteristic of P. vivax and Ovale.
Recently, an additional stage, the merophore, a form originating from blood forms, has been observed in the spleen and lymph nodes of mouse infected with murine Plasmodium (P, yoelü, P. chabaudi and P.
Vincke ~) (Landau et al., 1999). This stage of the cycle still remains to be described in the human plasmodial species.
The parasite cycle, as it is designed today is depicted in Figure 1 (The parts in brackets are shapes described for other Plasmodium species, but not for P. falciparum).
1.2 Means of combating the spread of malaria: the need for vaccine development The two discoveries of the causative agent of the disease and the vector of the illnesses made it possible from the beginning of the 20th century to develop defenses rational against malaria by attacking the parasite in the vertebrate host through drugs or targeting the vector mosquito either with larvicides, is with insecticides, either through the use of mosquito nets. The success of elimination of the disease in temperate zones after WWII
led to the establishment of an eradication program for malaria which peaked in the 1960s when DDT was the main tool mosquito and chloroquine was the main drug against parasite. The size of the target endemic areas has thus been reduced (quasi eradication in temperate zones) and the number of people affected by the disease initially decreased. However the successes in the zones were short lived. The number of patients has not stopped grow on the one hand because of population growth, on the other hand due to the emergence of resistance to insecticides and available drugs.
The emergence of these resistances necessitated turning to other means of struggle. The existence of natural immunity induced by exposure to the parasites and the observation that the passive transfer of immunoglobulins from immune people decrease parasitaemia as well as effective immunization and sterilizing by sporozoites attenuated by irradiation have rendered reasonable the argument of a malaria vaccine, the development of which constitutes then a global public health priority.
1.3 In search of life-saving immunity Natural immunity against malaria is characterized by very slow development and the fact that it does not result in protection sterilizing. In hyperendemic areas, the acquisition of immunity natural against erythrocyte stages manifests in children first by a tolerance to the parasite (anti-toxic immunity) then with age by a decrease in parasitic load in the blood (anti-parasitic immunity).
These observations, made during epidemiological studies were confirmed by experimental infections. Applied malaria therapy people with neurosyphilis (Boyd and Coggeshall, 1938; Ciuca and al., 1943; James, 1936), made it possible to define parameters which intervene in the acquisition of immunity in tightly controlled experiments.
He has thus been shown that the acquired immunity was on the one hand dependent on species and strain and on the other hand differed depending on the stage of the cycle parasitic infective. So far, the precise mechanisms of anti-malarial remain to be elucidated.
Because clinical signs and transmission are only due at the blood stages and that these are the most accessible as well in vitro 5 that in vivo, most vaccine studies have concerned these stages. A
thirty antigens expressed in erythrocyte parasites have been identified, particularly by monoclonal antibodies and considered in so as vaccine candidates. However, trials of induction of protective immunity through the rare antigens tested in humans have remained unsuccessful until 10 present.
The first immunization with the pre-erythrocytic stages has been attempted unsuccessfully by the Sergent brothers in Algeria (Sergent and Sergent, 1910). The ability to protect in a sterilizing manner (absence of any parasitaemia blood) was only obtained by immunization with attenuated sporozoites 15 by irradiation. This approach was initiated by studies in birds with some sporozoites irradiated with UV rays (Mulligan et al., 1941), and has been reprise years later with rodent parasites using sporozoites irradiated with x-rays and later y-rays, the dose of which may be more easily controlled (Nussenzweig et al., 1967; Richards, 1966);
immunity 20 can be maintained by a recall of non-attenuated sporozoites (Orjih and al.
1982). In humans, such protection has also been obtained (Clyde, 1975;
McCarthy and Clyde, 1977), however it is only induced after a very large number of inoculations by irradiated sporozoites so that such procedure vaccine cannot be applied on a large scale.
For a long time, it was believed that protection was correlated with a phenomenon observed when the sporozoites are incubated with immune serum, CS (Circum sporozoite) precipitation (Vanderberg et al., 1969). Protein recognized by this serum, the protein CS, was therefore considered responsible for this immunity. Since then it has been the source of multiple studies in many experimental models. Gold so far none of these studies has been able to reproduce as strong an immunity as that induced by irradiated sporozoites.

A critical evaluation of previous experimental results has led to postulate that it was the hepatic stage and not the sporozoite which was at the origin of sterilizing immunity (Druilhe and Marchand, 1989). The main clue was the fact that protection could only be induced by the inoculation of sporozoites viable, intravenously, able to invade and enter a hepatocyte develop, and that liver forms from irradiated sporozoites persisted (Ramsey et al., 1982). In addition, elimination of stages liver causes susceptibility to sporozoite infections in previously protected animals (Londono et al., 1991; Scheller and Azad, 1995).
The hepatic stage has unique characteristics. The hepatocyte is a metabolically active nucleated cell and expresses molecules of major histocompatibility complex. Hepatic schizogony leads to formation of between 10,000 and 30,000 merozoites while 4 to 32 merozoites are released by a blood schizont. Merozoites from these two stages have morphological differences, but it is not known if there are any differences functional or molecular, because only blood merozoites could be extensively studied.
Because in the liver only a few hepatocytes are infected and that in in vitro, cultivation techniques remain delicate and difficult, this has constituted a major obstacle to the development of knowledge on the hepatic stage and looking for antigens expressed at this point.
1.4 Screening of specific stage antigens The first strategy for establishing stage specific expression is generation of complementary DNA libraries from messenger RNAs different stages. This has been accomplished several times in the blood stages (Chakrabarti et al., 1994; Watanabe et al., 2001) and more recently once at sporozoite stage (Fidock et al., 2000). However, this approach is not possible for the hepatic stage of human parasites. Another way is generation of specific antibodies in animal models. This is easy at the erythrocytic stages but for the hepatic stage, several attempts have failed because injections of P. falciparum liver stages did not induce than very few antibodies in mice. A final approach is screening immunological based on the use of antibodies from naturally occurring individuals immune. This approach made it possible to highlight for the first time that antigens other than CS were present on the surface of the sporozoite (Galey et al., 1990).
1.5 Strategy developed in the antigen identification laboratory expressed at the pre-erythrocytic stages In order to get around the difficulty of screening at the pre-erythrocytic stages, a screening strategy for potentially P. falciparum antigens expressed in the sporozoite and hepatic stages has been developed (Marchand and Druilhe, 1990).
The principle was to look for individuals in whom the answer predominant immune was against the preerythrocytic stages. We have thus obtained sera from individuals (PM sera) living in endemic areas for over 20 years and having never had clinical access as they were in permanently on prophylactic treatment with chloroquine (schizonticide effective against blood stages, but has no effect on stages liver).
The corresponding sera recognized only very weakly blood stages in Western Blot and IFI (titer less than 1/200), while than the titers against the sporozoite and hepatic stages of the parasite were understood between 1/3200 and 1/6400 in IFI and they labeled several polypeptides on protein extracts of P. falciparum sporozoites; so it was about serums containing antibodies specific for the antigens expressed at the pre-erythrocyte.
These sera were used to screen a genomic library of P.
falciparum (built by Odile Mercereau Puijalon). Genomic DNA from parasitic clone T9-96 was methylated and digested with Dnase 1, and the fragments ranging in size from 200 to 2,500 base pairs have been introduced into the site EcoR1 of phage ~, gt11 (Guérin-Marchand et al., 1987).

Among the 7 million DNA fragments generated, 2000 clones producing a recombinant antigen recognized by hyper immune sera (SHI) immune individuals living in endemic areas were then screened with PM sera. 120 clones were thus selected and the stage expression of corresponding antigens was determined by IFI tests, with immunopurified human antibodies on each recombinant protein, on sporozoites, hepatic stages and blood stages of P. falciparum, P.
yoelü and sometimes with P. berghei and P. vivax.
The first antigen to be studied and against which humoral responses were highest in several sera from individuals living in a zoned endemic was (e Liver Stage Antigen 1, LSA-1 (Guérin-Marchand et al., 1987). II
remains the only antigen characterized to be expressed only at the stage hepatic.
Following LSA-1, 3 STARP, SALSA and LSA-3 antigens were selected from various criteria and characterized at the molecular level (Bottius et al., 1996; Daubersies et al., 2000; Fidock et al., 1994a), and immunologically by L. Benmohammed, K. Brahimi, JP Sauzet and B.
Perlaza. (BenMohamed et al., 1997; Perlaza et al., 1998; Sauzet et al., 2001 ).
These antigens are expressed both on the surface of the sporozoite and at the stage hepatic.
LSA3 is the only antigen recognized differently by sera volunteers or chimpanzees protected by immunization with irradiated sporozoites. He is the only one to have induced protection sterilizing and long-lived in chimpanzees (Daubersies et al., 2000), and will soon be tested in phase I and II clinical trials.
2) MATERIAL AND METHODS
2.1. Molecular biology techniques 2.1.1. Bacterial strains DHSa: supE44 DIacU169 (~ 80 IacZOM15) hsdR17 recA1 gyrA96 thi- 1 relA1.

2.1.2. Pest strains:
NF54 from an isolate from a European patient infected in Africa (ATCC
MRA151) (Walliker et al., 1987).
3D7, the reference strain used in the genome project, is a clone from of the strain (ATCC MRA151) (Walliker et al., 1987).
T9.96, a strain from a Thai patient ATCC: MRA153, (Thaithong et al., 1984) For the polymorphism tests, separate strains were employed: B1 (Brazil); F32, D7, D28, D50 from Tanzania; D28 from Senegal, D41 from India, D51 from Myanmar, L1 from Liberia, H1 from Honduras, Mad20 from Papua New Guinea, and PA from Palo Alto, from South West America.
(Stricker et al., 2000).
The sporozoites are from the NF54 strain and obtained by passage in Anopheles Gambiae REF
2.1.3. PCR from extracts of folds or DNA from folds The Expand High Fidelity KitT "" (Mannheim Boehringer, Germany) has been used as directed by the supplier with 2 mM MgCIZ, 3.5 units of Taq polymerase, 0.2 mM deoxyribonucleotides (dNTP), 50 nM primers 21 D
in 5 '(CCTGGAGCCCGTCAGTATCGGCGG) and 26D in 3' (GGTAGCGACCGGCGCTCAGCTGG) and 2 p1 of purified DNA or extract of folding. The reaction involved an initial denaturation of 2 minutes at 94 ° C, followed by 35 consecutive cycles of 15 seconds denaturation at 94 ° C, 30 seconds of hybridization at 50 ° C, and 2 minutes of elongation at 68 ° C. The circuit cyclic was followed by incubation at 68 ° C for 5 minutes.
2.1.3.1 Subcloning in the vectors histidine, pNAK and Topo Depending on the quality of the folding amplification product, three procedures have have been employed:
PCR products with a very small smear or yield and being smaller size almost impossible to detect by digesting folding DNA
corresponding, were cloned via a vector allowing a direct cloning of the PCR product without successive digestion of a restriction using the TopoTA CloningT "" kit (Invitrogen, The Netherlands).
The Topo cloning was also done for the fragments we wanted only determine the sequence.
5 PCR products smaller than 1 Kbp have been digested, precipitated with ethanol, and resuspended in half of the initial volume of H2O, then digested per 10 U of the restriction enzyme EcoR1, for 1 hour at 37 ° C., drawn on a 2% agarose gel, gel purified by the gel extraction kit procedure of Qiagen, giving a volume of 50 NI.
10 Large, scanty PCR products (greater than 1000 bp) were isolated from purified phage DNA by digestion with EcoR1, then by extraction of the insert from the agarose gel.
2.1.3.2 Study of the aolvmorphism of the Gene in parasitic strains 15 different.
The following primers were used to identify polymorphisms in size of specific regions corresponding to the antigens studied.
747-1: AAAAGTGATGATAGAAATGCTTGTG (5 ' 747-2: TTTTGTTGATCTTACTTATTTCACC (3 ') 20 772-1: CGGAATCAGGTTTAAATCCAAC (5 ') 772-2: AGATCGTTTTTCATCAGGGGG (3 ') The cyclic reaction was carried out with a program comprising a initial stage of denaturation at 94 ° C for 15 seconds, followed by 39 cycles including denaturation at 94 ° C for 2 minutes, one hybridization at 52 ° C for 1 minute and elongation at 72 ° C for 2 minutes. A
5 minute step at 72 ° C completed the reaction.
The PCRs were carried out on an Appligene Crocodile III. The products were then analyzed on agarose gel.

2. 9.4. DNA purification 2.1.4.1 For analyzes of recombinants PCR positive colonies were inoculated into 3 ml of medium containing the antibiotic corresponding to the vector used (100 pg / ml ampicillin for Topo and Histidine, 20 pg / ml kanamycin for the vector Vical) and 2 ml inoculum were used in the preparation of plasmid DNA with the QiagenT "" Miniprep Kit. The DNA obtained was successively digested with the restriction enzymes used in cloning and subjected to electrophoresis on agarose gel, in order to detect the insertion of the fragment.
2.1.4.2 For the isolation of fragments:
100 ml of Luria Broth medium supplemented with an appropriate antibiotic have.
were inoculated with 1 colony of bacteria comprising the recombinant, and incubated at 37 ° C overnight in a thermostatic bath with vigorous stirring. The next day the bacterial culture was harvested and the purified plasma DNA
as described (Qiagen maxiprepT "~, Qiagen, Germany).
2.1.4.3 For the immunization of naked DNA constructs In order to eliminate endotoxins, which are present in bacteria and which may cause non-specific responses during immunizations of mice, the DNA of the constructs was purified from 2 l of culture of bacteria recombinant, by Qiagen EndoFree Plasmid GigaT "" kit (Qiagen, Germany).
2.1.4.4 For the purification of DNA from recombinant phaaes The phages were re-amplified on LB agarose dishes, in depositing 5 p1 on Topagar taken with 200 p1 of Y1090 inoculum, and leaving at 37 ° C overnight.
Then more was produced in liquid culture.
First, a patch pricked on the dish was incubated with 200 μl of inoculum of Y1090, left at 37 ° C with stirring for 15 minutes. Then, 5 ml of antibiotic-free medium supplemented with 10 mM MgS04 was added, and the culture left in agitation for 4 hours, until the appearance of lysis.
50 p1 of Chloroform was added, and the whole centrifuged at 7000 g for 10 minutes.
After centrifugation, the supernatant released from cell debris was recovered.
This stock was used in the production of 500 ml of phage in culture liquid the equivalent of 7.5 $ 10 pfu (plate forming units) has been added to 500 NI
of cells of a culture inoculated on the night of Y1090, and 500 p1 of 10 mM
MgCl2 / CaCl2. Everything was incubated at 37 ° C for 15 minutes, and added to 500 ml.
middle LB without antibiotic. The lysis of bacteria observed by the appearance of filaments in the culture was followed until total lysis (4-5h). Then the culture was centrifuged at 6000 g for 15 minutes at 4 ° C, the supernatant recovered, and stored at 4 ° C overnight.
The next day, DNA purification was undertaken with the Lambda Maxi Kit (Qiagen, Germany) with adjustments at the start of the protocol to because of the larger volume of starting supernatant. The final pellet was resuspended in 500 µl TE buffer.
2.1.4.5 from parasites 100 p1 of red blood cell culture pellet at 10% parasitaemia, was resuspended in 100 μl of PBS, pH 7.2 and purified by Qiaamp DNA Mini KitT "' (Qiagen, Germany). From 100 p1 pellet of a parasitized culture to 10 %
we got about 5pg of DNA.
2. 7.5. Purification of total parasitic RNA
We used two methods depending on the amount of RNA wanted.
For large quantities, the method described by (Kyes et al., 2000) has summer employed, while to obtain preparations of larger quantities restricted, we used the RNeasy kitT "" (Qiagen, Germany.) 2. 7. 6. RT PCR.
RT-PCR was carried out with the RT-PCR kit from Qiagen (Germany).
Primers specific for each gene and located, if possible, such way that we can distinguish between products from DNA amplification genomics and RNA (around the introns) were used. A first reaction Reverse Transcription was performed at 50 ° C for 30 minutes, then one PCR reaction was carried out, under the same conditions as that described for parasite DNA PCR with selected primers, sometimes followed a second reaction (nested PCR) with primers located in the sequence of the first amplified PCR product. However, the temperature of hybridization varies according to the primers used (between 50 and 60 °
VS).
2.7.7. Purification of histidine recombinants 2 I of Luria Broth medium added with ampicillin at 100 ng / ml was inoculated with 50 ml of bacteria culture containing the recombinant plasmid.
The growth of bacteria was followed by measurement of turbidity bacterial to 600 nm and at the desired optical density (between 0.5 and 1) a concentration IPTG
varying between 0.5 and 1 mM depending on the recombinant was added to the culture, and the induction lasted between 2 h and 4 h.
Then the cells were harvested and the pellet of bacteria resuspended in 20 mM NaPO 4 buffer, pH 7.4, and 8 M urea (TU) (25 ml / liter of bacterial culture). Then, the cell suspension was subjected to sonications of 10 shocks of 1 minute each, and the supernatant containing the recombinant protein was recovered by centrifugation at 10,000 g for 10 minutes, and filtered at 0.22 pm. Then, a purification step by affinity on a Nickel column was carried out. A 1 ml column (HiTrapT "", Pharmacy, Sweden) was washed as directed by the supplier and 1 ml of NiCl2 was applied, followed by further washes. Then the column was washed with 5 ml of TU, and the supernatant applied to the column. Then a wash of 10 ml of TU was carried out, and the recombinant eluted by an increasing gradient in imidazole, competitor of histidine. Depending on the purified recombinant, different concentrations were used, and the results obtained are summarized in the table below. Then the protein pool was dialysis against an L-histidine buffer pH 6, and chromatographed on a column anion exchanger (HiTrap QT "", Pharmacy, Sweden) to eliminate some Lipo Poly Saccharides (LPS) or endoxins which induce non-responsive specific (Morrison and Ryan, 1987).

Histidine recombinant purification table DO Location RecombinantInduction 'after protein, ImidazoleNaCI

induction Weight (mM) 3 (mM) 4 molculaire2 DO
IPTG
Tem s 747 0.5 0.5 4h 2.7 Mem, 18 50 360 772 0.5 0.5 4h 2.2 SN, 35 36 120 1: OD measured at 600 nm, IPTG concentration (mM); and the time induction before harvest.
2: After sonication, and centrifugation of a suspension of bacteria does not containing no urea (8M) in the buffer, the supernatant and the pellet containing the debris of bacterial membranes were tested in Western blot to detect where the recombinant protein was. In urea all proteins were soluble, and the procedures for purification therefore have applied in the presence of 8 M urea.
3: The concentration of imidazole at which the protein has eluted on the HiTrap-NiT column "' 4: The concentration of NaCl at which the protein has been eluted on the column from HiTrap-QT ""
2.2. Immunological techniques 2.2. 7. ELISAs (Enzyme Linked ImmunoSorbant Assay) Optimal conditions were determined with 100 µl of solution antigen with a concentration of 10, 5 or 1 pg / ml coated on the plates in 50 mM Carbonate pH 9.6 or 1X PBS pH 7.4 by incubating the plates on the overnight at 4 ° C. Saturation was carried out, either in PBS supplemented by 3% of skim milk, or 1% BSA (calf serum albumin) at room temperature ambient or at 37 ° C for 2 hours. The dilution of sera of 100 or times was carried out either with 1.5% PBS / milk or with 1% PBS / BSA, and the incubation was carried out at room temperature or at 37 ° C. for 1 h.
Incubation with secondary antibodies coupled to HRPO
(turnip peroxidase) diluted 1/2000 in the dilution buffer for sera a was done at room temperature, and the disclosures were made at the help of TMB (peroxidase substrate and peroxidase solution B) buffers (Laboratories Kirkegaard and Perry, USA) mixed volume to volume immediately before use of which 100 p1 were distributed in each well. The reactions colored in blue were stopped by adding the same volume of a 1 M solution acid phosphoric. Reactions are read at 450 nm in a Multiscan reader AscentT "" (Labsystems).

The results of the mice are expressed in Ratio (arbitrary unit relative to response rates in naïve witnesses) and in experiments where isotype levels were studied, compared to the ratio of total IgG
determined in the same experience.

2.2.2. Immunopurification of specific antibodies For immunopurification of specific antibodies against recombinants Hiss, a method described by (Brahimi et al., 1993) was used. 100 pl / well of antigen solution in PBS, pH 7.2, at a concentration of 5 pg / ml have 10 were adsorbed on Nunc MaxisorpT "" plates (Nunc, Denmark), and the plates incubated at + 4 ° C overnight. Then, hyperimmune sera were incubated at a 1/50 dilution for 1 hour at room temperature, the plates washed and the elution of the antibodies carried out by adding glycine pH 2.5 to 0.2 M, incubation for 3 minutes and recovery followed by neutralization of the pH with 15 Tris, 1 M, pH 11. Immunopurification from fusion recombinants ~ i-galactosidase was performed on nitrocellulose filters, as described (Beall and Mitchell, 1986).
2.2.3. SDS-PAGE and Western Biot 20 Depending on the samples to be tested, percentage gels acrylamide (BioRadTM 29.1: 1 ratio) variables (5, 7.5, 10 or 12%) were used. After migration in Tris / glycine buffer (pH 8.5) with the minigel kit (Biorad, USA) the gels have either been colored by Coomassie blue or submitted at transfer to nitrocellulose filters (0.45 pm), in the Trans- cell blot 25 (BioRad.) After transfer, the proteins were visualized by staining with 0.2% Ponceau red in acetic acid solution (5%), then filter at saturated with TBS / 5% skim milk for 30 minutes. Human antibodies immunopurified without dilution, and sera diluted 1/100 or 1/200 in TBS / 5% milk / TweenT "" 0.05% were incubated for 1 to 2 hours at ambient temperature. Then the filter was washed 3 times 10 minutes in 0.05% TBS / Tween, and incubated with phosphatase-coupled antisera alkaline diluted 1/5000, for 30 minutes. After washing in the same buffer, the colored reactions were produced by the addition of NBT (330 pg / ml) and BCIP
(165 Ng / ml) (Promega, Germany) diluted in Tris pH 9 buffer.
2.2.4. IFI (Indirect immunofluorescence) All incubations at 37 ° C were carried out in a chamber humid to avoid drying of the tissues or cells to be studied. The tampons were filtered by a 0.22 µm filter to avoid contamination by other microorganisms and background noise.
2.2.4.1 Sporozoite stage After dissection of the salivary glands of mosquitoes infected with the parasite, the sporozoites were fixed with 0.01% glutaraldehyde in PBS
and washed thoroughly in PBS.
In order to study the marking only on the surface of sporozoites, (Galey et al., 1990) developed a technique allowing “wet” fixation with a suspension of sporozoites attached to the polylysine. Titration slides (PolyLabo, France) were coated with 1 p1 of a 50 mg / ml solution of polylysine, then left to dry overnight at 37 ° C. 1 p1 of a suspension of sporozoites (20 / p1) was deposited on each well, and incubated in a bedroom humid at 4 ° C overnight. Detection of an intra-parasitic presence was made by fixation of sporozoites in acetone.
2.2.4.2 Hepatic stage The sections fixed to the Carnoy and paraffined were prepared by 3 baths of Xylene of 10 min each, 3 baths of absolute alcohol of 5 min each, 2 baths distilled water for 5 minutes each, and dried in the open air. Then the cuts have was rehydrated for 10 min in filtered PBS pH 7.4. The cuts to freezing were set 10 minutes in acetone.

2.2.4.3 Blood stage.
The blood smears were fixed for 10 minutes with acetone, and boxes for each sample to be tested has been delimited by drawing edges with a Pentel-red marker on the smear.
The rest of the technique was identical for the three stages: After fixation, the antibodies to be tested (diluted in PBS) were deposited on each well, cut or box, and the slide incubated at 37 ° C in a humid chamber during 1 hour. The slides were washed 3 times 10 minutes in 1 × PBS, then incubated with anti-human or mouse anti-IgG (depending on the antibodies specific used), coupled to fluorescein (Alexis) diluted 1/200 in PBS and blue Evans 1/50000, incubated for 30 minutes at 37 ° C in a humid chamber, washed three once in PBS 1X, and covered with a coverslip after a drop of buffer glycerine (PBS 30% glycerol) has been deposited. Reading the slide was performed under UV microscope (Olympus, BH2)) 2.2.5. Mouse immunizations 2.2.5.1 By histidine recombinants Protocols a, b and c were mainly applied to obtain specific sera, while protocols b, c and d were used in order to to perform challenge infections with P. yoelü.
a) IFA / Alum adjuvant 6 week old female BALB / c mice received 1 first injection intraperitoneal 500 NI, with 1 mixture of 20 pg of antigen (Hiss-249, Hiss 680, His6-747. Hiss-772), 2 mg / ml Alum (AI (OH) 3, and incomplete Adjuvant of Freund (AIF), volume in volume, supplemented with 0.9% NaCI.
The next 2 injections, each 15 days apart, were performed with the same amount of antigen in the same volume, but without AIF, and with methiolate, a preservative, at 0.05%.
The mice were removed (500 NI) before immunization 2 weeks, 1 months and 6 weeks after the first immunization, on EDTA and plasma recovered and stored at -20 ° C.

b) CFA
6-week-old female BALB / c mice received 3 sub-injections cutaneous every 15 days at the base of the tail of a mixture consisting of p1 of complete Freund's adjuvant and 10 Ng of antigen (Hiss-114 or His6-662) in 100 µl of PBS. 1 week after the third injection, the sera of mice were removed and the responses tested in ELISAs against the recombinant and in IFI on sporozoites. 18 days after the last injection, the mice sustained challenge infection with P, yoelü sporozoites.
c) SBAS2 (Smith and Klein Beecham adjuvant) 7-week-old female C3H mice received three sub-injections skin at the base of the tail of 100 u) of a mixture consisting of 57 NI
adjuvant mixed with 43 µl of antigen (Hiss-249, His6-747 or Hiss-772) corresponding to 10 pg, the injections being spaced 3 weeks each. 10 days after the last immunization, the mice were removed and serums correspondents collected.
d) Microparticles Antigen solutions (Hiss-249, His6-747 or Hiss-772) were adsorbed on polystyrene microparticles 0.5 µm in diameter (Polysciences Inc, USA) by incubation at 37 ° C with shaking for 4 hours in glycine solution, pH 8Ø Adsorption of the antigen has been verified by the ability of the microbeads to agglutinate with a serum specific for antigen absorbed. 7-week-old female C3H mice received three sub-injections skin at the base of the 100 p1 tail of a mixture of microbeads coated with the antigen corresponding to 10 pg, the injections being spaced weeks each. 10 days after the last immunization, the mice were collected and the corresponding sera collected.

2.2.5.2 By DNA recombinants BALBIc and C3H mice of 6 weeks were injected 3 times at 8 weeks apart intramuscularly with 100 NI antigen (PNAK114, pNAK249, pNAK438, pNAK571, pNAK747, pNAK772) in PBS pH 7.4, then a 4th time 12 weeks after the 5th injection. Blood samples were performed 1 week after the 5th and 4th immunization on EDTA, and sera collected after incubation of the sample overnight at 4 ° C.
The spleens of 3 Igroupe mice were removed after the 4th immunization, and stimulation of the cellular responses studied. After a 5th boost, 8 weeks after the 4th injection, the mice underwent infection test by P. yoelü sporozoites.
2.2. 6. Infection of tests by sporozoites and by blood stage Sporozoites from Anopheles stephensü mosquitoes infected with clone 1.1 of P. yoelü yoelü were obtained by a method (Ozaki et al., 1984) which consists of isolating the mosquito's rib cage and obtaining through centrifugation through glass wool of the sporozoites, which have been washed by successive resuspensions in PBS after centrifugation.
The mice were infected with P. yoelü sporozoites retroactively orbital with 150 to 200 sporozoites (200 p1 / injection), and parasitaemia followed by smears from day 3 following infection until the 12th day post-infection, both on immunized animals and on naive mice infected with the same batch of sporozoites.
Blood stages taken from other mice infected with P. yoelü
were washed in PBS, and the equivalent of 5 x 104 parasites were injected intraperitoneally.
2.2.7. Study of cellular responses.
In order to study both the induction of T-cell proliferation specific as well as the secretion of cytokines capable of stimulating the reply immune we studied the stimulation of mouse splenocytes by antigens and the secretion of IFN-γ by these cells.

2.2.7.1 T cell proliferation Spleens were removed from mice, splenocyte suspensions were washed twice in RPMI 1640 (Gibco, France) and the cells 5 resuspended at a final concentration of 5 x 106 cells / rnl in RPMI
supplemented with 100 U / ml penicillin, 2 mM L-glutamine, 10 mM Hepes, 50 pM
~ 3-mercaptoethanol, 1.5% fetal calf serum (SVF) and 0.5% serum normal mouse. 100 μl / well of each suspension was distributed in 96-well round bottom plates (Costar, USA) and recombinant proteins to 10 test were added at a concentration of 50 mg / ml. These tests were performed in triplicate. After 48 h of incubation, (37 ° C with 5% of C02), 50p1 / well culture supernatant was removed and stored at -70 ° C before the determination IFN-y titles. 50 NI / well of supernatant was taken for assay of cytokines. In order to detect DNA replication due to stimulation of division, 15 50 µl of a tritiated thymidine solution (3H) (Amersham Life Science, England) to 1 pCi / well was added during the last 12 hours of incubation. The cell were harvested in an automatic cell harvester (Skatron Inc, Sterling, VA, USA), and incorporation of Thymidine 3H quantified by scintillation. The results are expressed in Stimulation Index (1.S.) and proliferation has summer 20 considered positive, when S.1. is above 2.
2.2.7.2 Detection of secretion of interferon ~ r (IFN-y) IFN-γ titers in culture supernatants were determined by a double capture ELISA method. Maxisorp plates (Nunc, Denmark) 25 with flat bottom were coated with an anti-IFN-γ rat monoclonal antibody of primary mouse (R4-6A2) (Pharmingen, San Diego, CA) diluted in a buffer of 0.1 M carbonate, pH 9.6, and left overnight at 4 ° C. Between each stage of the procedure, the plates were washed several times with PBS buffer supplemented with 0.05% Tween T "" (PBS-T). Then the plates were 30 saturated with 3% calf serum albumin (BSA, Sigma Chemicals, St Louis, USA) in PBS-T. Undiluted supernatants have been added to wells and plates incubated overnight at 4 ° C, followed by 1 hour incubation at room temperature with an anti-mouse IFN-y rat monoclonal antibody secondary biotinylated (XMG1.2, Pharmingen, San Diego, CA) diluted in PBS-T. The labeling steps with antibodies coupled to peroxidase are identical to those used in the ELISA technique. (A.2.1) 2.2.7.3 Detection of IFN-v secretory cells by Elispot The number of IFN- ~ y secreting cells was determined in unstimulated splenocytes 40 hours after freshly isolated and incubated with antigens. Microtiter plates (Multiscreen-HAT "", sterile plate, Millipore) were coated with 50 μl of a solution containing pg / ml of anti-IFN-γ antibody (18181 D, Becton Dickinson Co). After one overnight incubation at 4 ° C, the wells were washed and saturated with a solution of 5% of SVF. 5 x 105 cell / well cell suspensions were incubated with the antigen at 50 pg / ml in a total volume of 200 p1 for 40 h, at 37 ° C in a humidified atmosphere of 5% COZ. The plaques have then washed 3 times with PBS-T and 3 times with PBS alone and the well were then coated with 50N1 of IFN-γ anti-mouse antibody solution biotinylated (Becton Dickinson Co, USA) diluted 1/200 and incubated overnight at 4 ° C.
The plates were then washed in the same way as before, before a addition of 50 p1 per well of alkaline phosphatase coupled to streptavidin (Boehringer-Mannheim, Germany) at a dilution of 1/2000 in PBS. After 1 h of incubation, and washing of the plates, spots were detected by development of a colored reaction with BCIP / NBT reagents at 50 Ng / ml at where individual cells secreted IFN-γ. The results are expressed as the number of spot forming cells compared to 5 x 106 splenocytes.
2.2.8. Serums and cells 2.2.8.1 Individuals naturally exposed to the parasite.
10 sera from adults living in a strong endemic area (Ivory Coast) and naturally protected have been used in studies of ELISA and immunopurifications of antibodies specific to antigens studied.
Sera from individuals of two age ranges from 0 -9 years or above 12 years old, Ndiop and Dielmo Villages have been selected (Rogier and Trape, 1995; Trape et al., 1994). Ndiop is located in an area endemic which has about 20 infectious bites / year, and Dielmo, in a area with 150 infectious bites / year. Each serum in one of two regions corresponds in age and sex to a serum from the other region.
2.2.8.2 Animals or humans immunized with irradiated sporozoites.
Two chimpanzees were immunized with either sporozoites irradiated with 18 kRad, i.e. 30 kRad by 4 injections of 5 x 106 sporozoites each by way intravéneuse. The first 3 immunizations were performed with 1 month interval, while the 4th "e was performed 4 months after the 3rd"'e. Their serum and peripheral blood cells have been studied in response tests and humoral responses after 3 immunizations. The two animals were infected with the intravenous injection of 4 x 104 sporozoites (low dose) each of P. falciparum and only the chimpanzee immunized with the sporozoites irradiated at 18 kRad was protected (did not develop parasitaemia blood) Two human volunteers immunized by the same means, received a recall with a new batch of irradiated sporozoites, and blood cells have been studied in Elispot tests. In addition, the serum of 4 human volunteers immunized with irradiated sporozoites has also been at available to the Applicant.
2.2.8.3 Individuals exposed differently to the parasite We had at our disposal sera from 8 exposed individuals naturally to the parasite but under permanent chloroquine treatment, this who eliminates blood stages to a very early form and sera of 5 individuals accidentally infected with transfusion of P. infected blood falciparum.

3) RESULTS
3.0: Example 1 Identification of two new antigens DG47 and DG772 from P. falciparum recognized by volunteers immunized with irradiated sporozoites The clones DG 747 and DG772 were selected not only because initial criteria set (detection on sporozoites and stage hepatic, as well as recognition by hyperimmune sera), but because several additional features interested us: the DG747 did not have no cross-reactivity with other PM library proteins, and DG772 had only one cross-reactivity, with LSA1, the only antigen identified as expressed only in the hepatic stage of P. falciparum. In addition, antibodies specific for the two proteins labeled P. sporozoites yoeüi.
Initial sequencing revealed that these two clones contained inserts belonging to hitherto unknown genes, but whose sequence was available on the P. falciparum genome databases. We are therefore devoted to the work of molecular characterization expression stage, gene conservation, as well as characterization work immunological (antigenicity, immunogenicity) of these new antigens. The results showed that a) these two antigens induce an immune response in individuals or animals only exposed in the pre-red blood cells both artificially (by immunization) and naturally (in the field), b) that they are recognized by sera from individuals naturally exposed to the entire parasite cycle, both in areas of low and of strong endemic. In addition, we assessed their potential in mice immunogenic and protective through immunization and P. challenge infection yoelü.
3.1. Sequence analysis DG747 codes for a polypeptide of 59 amino acids including 40 acids amines (aa) C-terminals are part of a repeating structure of 5 x 8 aa rich arginine and lysine. This sequence is identical to aa 81-140 of the gene PfB0155c (1524 bp, 508 aa) located on chromosome 2 (Figure 3.1a). This gene who code for a putative protein (Gardner et al., 1999), does not contain introns nor signal peptide predicted, nor of regions homologous to other proteins than either from Plasmodium or other organisms. The corresponding protein has a theoretical molecular mass of 59 kDa, and a neutral isoelectric point (7.5), but some regions have very variable p1, for example the region found in DG747 has a positive charge at neutral pH.
DG772 contains an insert of 333 bp, which are translated into 111 aa contents in an open reading frame. This polypeptide corresponds to the region of aa 1146-1256 of a protein of 1493 amino acids encoded by a gene located on the chromosome 1 (Figure 3.1b). The theoretical mass of the protein is 173 kDa and the isoelectric point is 5.05. Most of the protein acids polar amines and does not contain hydrophobic sites, except in the part NOT-terminal, where there could be a GPI anchor site. The gene does not contain of repetitions and the translated nucleotide sequence has strong homology with proteins of the “EBP” family (Adams et al., 1992), that is to say with of the 5'cys and 3'cys regions which are characteristic of this family.
3.2. Stage expression and gene conservation In order to more precisely assess the stage expression of the two proteins, we used IFI and Western blot techniques on stadiums different from P. falciparum and on the murine parasites P. yoelü and P.
berghei.
The surface of P. falciparum sporozoites was marked by antibodies (human or mouse) specific to DG747 and DG772, but the erythrocytic stages were marked differently for the two antibody groups. Anti-His6-747 (anti-747) antibodies barely mark the young stages, but strongly mature schizont stages, with markings located around the knob structures (Figure 3.2 image A), while the antibody anti-Hiss-772 (anti-772) mark the parasite in a more homogeneous way at along the erythrocytic stage. In the murine species P. yoelü and P, berghei, the surface of sporozoites has been strongly marked by specific antibodies of the two antigens.

In order to define the sizes of the proteins detected, we also performed a Western Blot of protein extracts from P. blood parasites falciparum with the same antibodies (Figure 3.3 a and b).
Anti-747 antibodies label a polypeptide of around 70 kDa as well in 5 the extracts of rings than those of schizonts, while no band has summer detected in unparasitized erythrocytes. The polypeptide detected by anti-772 antibody is larger, with a molecular mass of 150 kDa, and is detected both in rings and in schizonts. Marking protein extracts from P. yoelü detected a 70 kDa polypeptide for Anti-747 in sporozoites and blood stages and a polypeptide of 60 kDa for anti-772, only detected in the sporozoites of P. yoelü.
In addition, to confirm the presence of proteins and their consistency expression on the surface of sporozoites from several parasites different, we have examined by IFI batches of sporozoites from 15 different Thai isolates of P. falciparum. Anti-772 serum has marked all the sporozoites, while only 7 in 10 of the isolates tested were marked by anti-747. Likewise, PCR amplifications with primers specific for the two gene fragments (shown in Figures 3.1 a and 3.1 b) were carried out with DNA from blood stages of 12 strains 20 different from P. falciparum (Figure 3.4). The corresponding PCR products at DG772 were amplified from the 12 samples and their size was similar, whereas the specific primers for DG747 could not amplify a fragment only from 9 of 12 DNA. It should be noted that all the lines of parasites used in this work (T9-96, NF54 and 3D7) contain the genes 25 correspondents. These results indicate a variation in expression or the presence of DG747 in parasitic strains, because in total, only 15 of 22 parasites appeared to contain or have the DG747 gene showed positive reactivity in IFI. One of the primers used for the detection of the gene encoding DG747 is located in the 3 'part of the repeats contained 30 in DG747, while the other is located further downstream which could explain the absence of PCR amplification, if there was a variation in the number of these repetitions. However, the results remain to be confirmed, from preference on DNA from parasites isolated in the field, because all parasites tested in PCR were cultivated in the more or less long term in vitro, which can train chromosomal deletions. The deletion phenomenon has moreover also observed in populations of parasites in vivo (Corcoran and Kemp, 1986).
3.3. Recognition by the human immune system in areas endemic In addition to studying the constancy of expression of the antigen, we have studied the prevalence of humoral responses from individuals living in areas high (Dielmo) or low (Ndiop) endemic, and in two age groups different in these two areas (Figures 3.5a and 3.5b) The same prevalence is observed (40%) against 747 in the low-lying area endemic, except that the number of individuals who respond strongly (the intensity of response compared to controls) increases with age. In the strong zone endemic, the number of responders versus 747 increases with age, as does the intensity of the response, and the prevalence in adults, that we can consider to have acquired immunity, is 85%. In addition, these responses appear to be correlated with sporozoite exposure because the rate of antibodies is higher in individuals of a given age group in a stronger transmission area. However, in the same area, the response did not not changed significantly during weaker seasons transmission (dry season) (results not shown), which could correspond to the response against blood stages and / or indicate that the immune response anti-747 is long lasting. The response induced by DG747 increases in prevalence and intensity as a function of exposure and duration exhibition to the parasite (age).
The anti-772 response increases like anti-747 with age, but with a much smaller increase, compared to the rate of transmission observed between Ndiop and Dielmo and in relation to age. The rate of anti-772 responses measured in% of prevalence and in intensity is higher for individuals younger than those with anti-747 responses, but less strong (75 %) than anti-747 (85%) to Dielmo in immune individuals.
3.4. Comparison of responses induced by different stages of parasite We had the privilege of being in possession of cells from individuals immunized with irradiated sporozoites, and sera from people differently exposed to parasitic infection.
3.4.1. Cellular responses All these studies were carried out in close collaboration with Jean-Pierre Sauzet in the laboratory. Given the limited material we had, we restricted the analyzes in order to detect what we had previously defined as one of the important criteria (role in protection) for the evaluation of a vaccine potential at the pre-erythrocytic stage. We have studied the secretion of IFN-y from cells from 2 individuals immunized with of the irradiated sporozoites of P. falciparum, as we observed during analysis other antigens, and in particular LSA3, a vaccine candidate studied in our laboratory (Daubersies et al., 2000), that the rate of secretion of this cytokine appears to be correlated with protection. In these two volunteers, the number of cells secreting IFN-y against DG747 and DG772 is as high as for recombinants from LSA3 (729 and PC), (Figure 3.6a). In addition, we have examined whether the cellular immune responses measured by the proliferation of T cells and IFN- ~ y secretion differed between two chimpanzees immunized with irradiated sporozoites of P. falciparum, but one was not protected, (figure 3.6b and figure 4.3).
The immune system cells of the animal immunized with viable irradiated sporozoites (18 kRad) and subsequently protected, recognized the antigens DG747 and DG772, as did the animal's cells immune with irradiated non-viable sporozoites (30 kRad), and not protected during a challenge infection.

Lymphocyte proliferation is at the limit of the threshold value, while that the secretion rates of IFN-y are high, as well for the amount of cytokine detected only for the number of secretory cells (detected by ELISPOT). This also applies to animals that are effectively immunized and those not being protected. However, it appears that response rates are higher for animals immunized with irradiated sporozoites by 30 kRad. The responses induced by 747 are stronger than those induced by 772, and both stronger than those induced by LSA3.
Cells taken from immunized animals by the irradiated sporozoites were damaged during the transport from the primatology center in Africa, so we don't have not was able to study the presence of an induced “boost” against these antigens.
3.4.2. Study of humoral responses We were not in possession of the cells of all human groups differently exposed to parasitic infection but we were able study in detail the humoral response (IgG isotypes) of volunteers immunized with irradiated sporozoites (ISS, only exposed to the pre-erythrocytic stages), naturally immune individuals living in highly endemic areas (exposed to all stages of the parasite), and of an individual who has been accidentally infected by malaria by blood transfusion, (only exposed at stages ) (Figures 3.7a and 3.7b).
For the two antigens, the greatest difference is observed for the cytophilic isotype IgG1, the level of which is much higher in serum immune individuals (SHl) only in the serum from the patient infected with transfusion or ISS volunteers. The responses of these last two groups are quite similar and do not show any imbalance between antibody cytophiles (IgG1 and IgG3) and non-cytophiles (IgG2 and IgG4). We have in outraged noticed that the serum from an individual exposed at length to the parasite, but under permanent prophylaxis (PM), has the same profile in isotypes as ISS.

3.5. immunogenicity in mice Mice of two different strains were immunized with the recombinants in the form of proteins, with different adjuvants or in form of "naked" DNA constructs, without adjuvant.
A preliminary study with a naked DNA construct not comprising signal sequence allowing the export of the synthesized protein has been performed. The immunized mice did not generate any humoral response, except either for these two antigens or for others studied simultaneously.
However, we detected specific cellular responses to 747 and Anti-772. Both the T cell proliferation and the rate of secretion of IFN-γ were tested for two strains of mice, C3H and BALB / c. The response profiles are presented in tables 3.1 a and 3.1 b where can note that for the cellular responses of mice immunized with pNAK747, there are both stimulation of proliferation and secretion of IFN-γ, while for pNAK772, T cell proliferations were very little stimulation compared to stimulation of secretion of IFN-y which is considerable. Among all immunized mice, the highest level of IFN-y secretions are observed when the stimulation level of proliferation is the lowest.
Vaccinations with other formulations (recombinant protein and Naked DNA with a signal sequence) all induced a humoral response in mice (Figure 3.8). All sera from these immunized mice recognize the native protein in IF / tests and the labeling corresponds with that observed for immunopurified human antibodies.
Anti-747 responses show a similar profile for all mice immunized and all formulations used, with an isotypic response to preponderance of IgG2b. Anti-772 responses are also similar between mice and vaccine formulations, but with a clear predominance of IgG1. The profile isotypic therefore depends on the immunogen more than the mode of presentation used. However, endpoint titles are much higher when one immunizes with recombinant proteins (1 / 200,000) against DNA

(1/2000), and the titers of the sera of mice immunized with His6-772 are more higher than those of Hiss-747.
Since we had observed a cross reactivity with the stadium sporozoite of P. yoelü, we tested the protective potential of these antigens 5 by infection with sporozoites of this species of immunized mice with recombinant proteins. Parasitaemia was followed by observation of blood forms on smears from day 3 of infection and during consecutive days. We did not observe any protection whatever the mouse strain used because parasitaemia was detected on the same day as 10 that of unimmunized mice, and the curve was similar to that of mouse controls (results not shown).
3.6 Additional data 3.6.1 DG772 15 By RT-PCR on total RNA from sporozoites and blood parasites, the inventors were able to determine the splicing sites of the messenger RNA
corresponding to the coding gene. The primer sequence was extracted from Plasmodium falciparum genome data.
Amplification products are identical in size in stadiums 20 sporozoites and blood stages, and differ in product size obtained by amplification of genomic DNA and by sequencing the splice sites have been shown to be identical (see the introns shown in the figure).
The gene encoding DG772 belongs to a family of proteins identified by a shared motif. All proteins of the EBP family 25 (Erythrocyte Binding Proteins) share conserved residue patterns cysteine with a similar arrangement for all proteins. However, the degree of identity does not exceed 31% (max. 57% homology), even in most preserved regions.
30 3.6.2 Immunogenicity tests envisaged in humans.
From our results obtained in mice, we can confirm that the DG747 and DG772 antigens used both in the form of DNA and as a recombinant protein are immunogenic. In addition, because the recombinant proteins are recognized by immune individuals and protected against infection by Plasmodiurn falciparum sporozoites would indicate a role for these antigens in preerythrocytic immunity. A
test in primates, and in particular chimpanzees will allow us preliminary results which will allow us to choose the formulation optimal for clinical trials in humans.
In phase I trials, to study the immunogenicity and safety of product, we are considering three formulations all prepared in GMP conditions: 1) the antigen in the form of a recombinant protein purified to from the bacteria Lactococcuc lactis (use permitted in humans) adjuvanted with SBAS2 adjuvant (GSK); 2) the construction of DNA in the vector VicaIT "" (Avantis Pasteur); and 3) synthetic lipopeptides injected without no adjuvant (see LSA3). These formulations will be distributed by injection subcutaneous (at the level of the deltoid). By preliminary tests, we know that the Hiss-747 and His6-772 antigens induce cellular responses and of the humoral responses in individuals who have been exposed only to pre-erythrocytic stages. We will then study the answers cell and humoral responses of individuals immunized with the selected formulations in comparing them with those seen in individuals immunized with sporozoites attenuated by radiation and protected against infection test with non-attenuated sporozoites. Based on these responses, an infection test with Plasmodium falciparum sporozoites will be considered.
3.6.3 Homology with other nucleotide sequences.
Southern blot hybridization under standard stringent conditions (0.1 X SSC, 80 ° C) would not give rise to any other hybridization except with the gene corresponding.
3.6.4 Search for homology by bioinformatical means Research was carried out with BLAST software (tblastx and blastn) on all the available Plasmodium genome databases falciparum as well as the databases of other organisms. The settings used are the default parameters found on the sites http://vvww.ncbi.nlm.nih.gov/BLAST/
3.7 Discussion This work, which is part of the study of antigens expressed at the pre-red blood cells allowed us a first characterization and evaluation of the vaccine potential of two new P. falciparum antigens. These two antigens have different characteristics at the molecular level. On the one go, the protein of which DG747 is a member contains repeats, while the molecule containing DG772 has no direct repeat. The Pfb0155c gene coding for DG747 is small (1524 bp) and contains a repetitive region at which belongs to DG747. We could not detect the presence of the gene by PCR
in all strains, nor observed reactivity with all strains of sporozoites studied. The absence observed may be due to a real deletion of the gene or to experimental procedures. Indeed, one of the primers used for detection of the coding part for DG747 overlaps the part repetitive, which can cause difficulty in amplifying a gene containing a repetition larger, or to detect a gene containing fewer repeats. Moreover, this is also the case for detection in indirect immunofluorescence where a number possible repetition variations may change the affinity of the antibodies specific, if the target epitope straddles this region. Expression detected through IFI appears to be present throughout the asexual parasitic cycle in the host vertebrate (we did not analyze the sexual stages). Despite the presence of repetitions in DG747, we did not detect cross-reactivity with other antigens of P, falciparum. The entire gene sequence has not homology with other plasmodial proteins so far identified, and we we do not yet have indications on a possible biological function.
DG772 does not contain repeats and its presence seems to be constant, whether detected by PCR or IFI. At the biological level, the uncomfortable coding for DG772 turns out to be interesting. We found by homology of sequence that this 5300 bp open reading frame gene is part of the family of Erythrocyte Binding Protein (Adams et al., 1992), but that the DG772 sequence does not belong to the conserved regions of this family, it only shares a small portion of sequences with the N-terminus of the 3'cys region. Besides, it has no cross reactivities nor homology of sequence with DG249, another clone belonging to one of the consensus parts of the gene encoding EBA-175. DG772 may be part of a region which gives a peculiarity to each molecule of this family. The presence of two molecules of the EBP family (EBA-175 and 772) on sporozoites could imply that there are several molecules in this family which would intervene from alternative way in the invasion process as described in the stages blood.
Knowledge of prevalence is useful when evaluating a vaccine candidate, and the prevalence obtained for DG747 and DG772, 85% and 75% are important. This study showed the significant antigenicity of a small part of the two molecules, and suggested that there would be an interest in studying more detail of other epitopes of the same molecule. The humoral response detected against DG747 and DG772 in permanently exposed individuals indicates that there is a preponderance in IgG1 response (cytophilic type) developed during a sustained exposure which is not found in the case of malaria Transfusion. However, the humoral response profiles obtained for of them groups exposed to the pre-erythrocytic stages with more or less long duration (PM and ISS) are similar, and the IgG1 level is low, indicating that this isotype translates the repeated exposure of the antigen to the blood stages.
The study cellular responses in these same areas will need to be performed in order having a more precise notion of the immune responses induced by these antigens.
At the pre-erythrocytic stages, we observed an induction of cellular response by these antigens both in chimpanzees and in humans. We observed IFN-γ secretion, described as a factor involved in the protection against pre-erythrocytic stages. The difference response observed in chimpanzees as a function of radiation dose could mean that antigens are recognized as well on sporozoites than in the hepatic stages. Indeed, sporozoites irradiated at 30 kRad are unable to enter the hepatocyte, and the responses detected are therefore only due to this exposure, while the sporozoites irradiated at 18 kRad develop in the hepatocyte, and the detected responses are therefore due to this Stadium. It would be interesting to study more closely the responses induced in these two animals (MHC1 restriction), and the induction of response “boost” during of several successive immunizations. This work has also shown that in these two fragments of antigens, there are both T epitopes and epitopes B.
The immunogenicity induced by the two antigens in mice is different with a predominance of IgG1 for DG772, which is not observed for DG747. However, we did not observe any difference in the responses based on formulations, which is interesting because the presentation molecules is not identical for each formulation. The answers cellular only obtained for the formulation which did not induce detectable humoral responses shows that there have been both blooms of lymphocytes, as secretions of IFN-γ depending on the mice. The IFN-y secretions tend to be higher when levels of proliferation are low, but this remains to be studied more precisely with a higher number of mice. The lack of protection of immune mice does not does not exclude protection in humans or by infection with P.
falciparum because the target epitopes are not necessarily the same. To to study a role in the P. falciparuml vertebrate host interaction, we have to layout an in vitro model with human hepatocytes and sporozoites of falciparum which will allow the study of invasion inhibition, and the studies in vivo will be possible in an AotusIP monkey model. falciparum which is found in Colombia. Currently we are doing the work necessary to complete the analyzes started on these antigens for what is immunogenicity.

Table D1: Summary of malaria preerythrocytic antigens now known *.
Antigne References 'Location Stadiums' Structures Intron expression 'Reps S
H
SSA
SSS

CS (Nardin et al., 1982) + j - - CHR3 + +

LSA1 (Gurin-Marchand et al., + J, m - - CHR4 - +
1987) TRAP (Robson et al., 1988) + j, mm - CHR13 - +

PfHsp70 (Renia et al., 1990) + j, mj, m - CHR13 +

STARP (Fidock et al. 1994) + j, m - - CHR12 + +

EXP-1 (Koenen et al., 1984), - mj, m Nt CHR12 - +
lSanchez et al., 1994) Pfs16 (Bruce et al., 1990) + nt - +? - -SALSA (Bottius et al., 1996) + j, m - - CHR2 + -LSA3 fDaubersies et al., + J, m - - CHR2 + +
2000) PfEMP3 (Pasloske et al., 1993), + j, mj, m - CHR2 + +
(Grner et al., 2001) GLURP (Borre et al., 1991 + mj, m Nt CHR10 - +
) EBA-175 (Camus and Hadley, 1985) + j, mj, m - CHR4.13 +

DG? 47., ~: ~: - ~ ,. 'j, mj, m.: - CHR ~, ~ +
'+ _' _ '~.
, aG772 + j, '..j, CHR1 +
:: rn m, * The antigens in gray are the antigens characterized in this application.
5 NT: Not tested 1: The presence at the pre-erythrocytic stages of other antigens (MSP-1) has also been suggested, but the preliminary results remain to be confirmed. The references underlined indicate the year of discovery of the pre-erythrocytic expression.
2. S: sporozoite; H: Young and mature liver stage; SSA: Blood Stage asexual young and mature;
10 SSS: Sexual blood stage. 3. ST: sub-telomeric. Bold type indicate shape from the stage where the marking is most intense.
3. Most of the chromosomal locations were made by research of homology on data base Table 3.1a: Stimulation of cell proliferation and secretion of IFN-γ by Hiss-747 after 3 immunizations with pNAK747.
Interfron proliferation Gamma lymphocyte strain IU / ml stimulation index Hiss-747 GEX- Hiss-747 NN GEX- NN

C3H 8.63.0 3.21.1 7.00.4 4.010.9 C3H 23.65.9 8.82.9 7.00.7 4.00.2 C3H 3.00.9 1.10.1 16.011.9 1.02.1 Positive 2/3 - 1/3 BALB / c 2.70.2 1.30.2 40.05.0 24.03.0 BALB / c 23.64.3 3.00.3 15.04.4 8.01.8 BALB / c 33.77.2 5.90.3 16.011.5 10.04.2 Positive 213 - 3l3 -pGEX-NN: P. falciparum antigen not cross-reactive with Hiss-747.
Positive results are in bold.
Table 3.1b: Stimulation of cell proliferation and secretion of IFNJy by Hiss-772 after 3 immunizations with pNAK772.
Interfron proliferation mouse gamma lymphocyte strain IUlml Stimulation Index Hiss-772 GEX- Hiss-772 NN GEX- NN

C3H 0.90.1 0.70.1 23.912.0 10.712.9 C3H 0.90.2 0.60.1 1.72.0 3.32.1 C3H 0.80.2 0.90.2 6.60.1 5.82.6 Positive 013 - 113 -BALB / c 3.50.3 - - - 2.70.4 24.02.2 1 ~ .83.0 _ -BALB / c 1.90.3 1.20.4 31.37.1 5.60.9 BALBIc 3.20.9 1.50.2 25.012.1 6.91.5 Positive 1I3 ~ - ~ 313 -pGEX-NN: P. falciparum antigen not cross-reactive with Hiss-772.
Positive results are in bold Table 4.1: Cellular responses of mice after 5 immunizations with pNAK438 *.
mouse Prolifration (1.S.) IFN-y antibody scan C3H 2.30.3 2.22.0 -C3H 1.81.1 15.64.0 -C3H 3.21.3 0.50.2 -Positive 2/3 113 BALB / c 4.3 1.6 26.2 6.3 -BALB / c 5.30.6 29.38.5 -BALB / c 15.32.2 12.78.7 -Positive 3I3 313 * The response rates are represented in relation to the responses obtained by a threshold value.
The threshold value is calculated by averaging the responses of animals not immune and that of animals immunized against a non-relevant antigen, such as OspC, a protein Borrelia burgdorferi.
Table 4.2: Expression detection by IFI with human antibodies immunopurified or specific mouse sera anti-Hiss-680 a-Hiss-680 Parasites * mice or humans Sporozotes P. falciparum ++

Sporozotes P. yoel clone ++
1.1 Hpatic stage P. falciparum ++

T23 ++ / +++ blood stage (75%) rings / schizonts ++ / +++ (75%) NF54 blood stage rings / schizonts * The sporozoites of Plasmodium falciparum come from the strain NF54.
T23: strain of Thai origin; NF54 strain of African origin.

Table 5.1: Cross-reactivities detected in Western blots between Strong reaction Average reaction E: immunopurified antibodies (eluted) on the recombinant proteins corresponding.
P: recombinant protein.
Table 5.2: Cross-reactivities at the nucleotide level between the clones from the Pfl1-1 family *
PM PCR571 clones 1 control probe 43 +++ ++

88 ++ 0 322 +++++ +++++

525 ++++ +++++

563 ++++ ++++

571 +++++ +++++

676f +++++ ++++

729E +++ +++++

263 ++++ NT

381 ++ NT
._ -453 +++ I NT
l * The signal strength is symbolized by crosses.
NT: not tested.
family members Pf11-1 Table 5.3: Sequence homologies of the clones studied by BLAST
Size Rptitions Homology Degree of homology amino acids with 571 lone (bp) Nuclotides Nuclotides Proteins Proteins DG43 900 PIVeELLEE Pf11-1 Part 1: 94%, 80%, 80%
100% (= 88) DG88 900 PIVeELLEE Pf11-1 Part 1: 94%, Same as DG43 100% (= 43) DG263-7253 No P, falciparum Chr 12 -95%, 60%

DG263-8176 No P. f. CHR12 95%, 45% -human chr22 58%

DG322-1500, - - -DG322-22000 PeeVLEEvI Pf11-1 86%, 65% 79% -DG381 400 PEkIvEEVI plastid tRNA 100%, CHR2-71%

DG453 300 PIVEEvVEE Pf11-1 Part 2 88%, 83% 93%, 72%

DG525 450 PeIeEVEvI GLURP R2 98%, 100% -DG563 438 PIVEEvvEE Pf11-1 Part 4: 86%, 75%, 56%, Part 1 68%

DG571 550 PEEiIEEiv Pf11-1 Part 5 87%, 100%, 100%
55%

DG676f 2000 PvVEEvLEE Pf11.1 Part 488%, Part74%, 44%
5 75%

DG729E 1.7 - ma13P5 100% -1: Estimated size in relation to the PCR products obtained, or the precise size when the whole clone has been sequenced.
CHR: Chromosome; part: part Table 5.4: Reactivity in IFIs tested with antibodies specific for Hiss-571 and Vi571 Parasites a-Hiss-571, aVi571 mice or humans Sporozotes P. falciparum NF54 ++

Sporozotes P. yoel clone 1.1 ++

Hpatic stage P. falciparum ++

Blood stage T23 rings / schizonts ++ / +++ (75%) NF54 blood stage rings / schizonts ++ / +++ (75%) Table 5.5: Cellular responses of mice immunized with pNAK571 Interfron proliferation mouse gamma lymphocyte strain IU / ml stimulation index 571 pGEX NNpGEX 571 pGEX
NNpGEX

C3H dead 0.9 0.1 0.7 0.05 31.0 2.5 21.2110.6 C3H 0.90.2 0.70.1 30.22.6 10.502.03 C3H 0.80.2 0.90.2 16.80.1 6.652.8 Positive 013 - 213 -BALB / c 3.50.3 2.70.13 23.1 0.9 10.362.2 BALB / c 1.90.3 1.20.1 15.92.1 8.633.9 BALB / c (dead) 3.20.9 1.50.1 5.31.3 1.060.5 Positive 213 - 313 -NNpGEX: recombinant GST fusion of LSA3 not relevant.
Although the present invention has been described in relation to the embodiments concrete and privileged, it will appear obvious to people paid in the art or science involved that it is possible to introduce some number of variations and modifications without departing from the scope of the invention described in this document.

Claims (41)

1. Purified polynucleotide characterized in that it comprises a sequence nucleotide having at least 60%, preferably at least 80% and more preferably at least 95% identity with SEQ ID NO: 1 (DG747) or the SEQ ID NO: 2 (DG772). 2. Purified polynucleotide characterized in that it comprises at least 10 consecutive nucleotides identical to SEQ ID NO: 1 or SEQ ID NO: 2. 3. Purified polynucleotide characterized in that it hybridizes in terms high stringencies with a polynucleotide according to claim 1 or the claim 2. 4. Purified polypeptide characterized in that it is coded by a polynucleotide according to any one of claims 1 to 3. 5. Purified polypeptide characterized in that it has at least 60%, preferably at least 80% and more preferably at least 95% homology with SEQ ID NO: 3 (DG747) or SEQ ID NO: 4 (DG772). 6. Purified polypeptide characterized in that it comprises at least 5 acids consecutive amines identical to one of the sequences chosen from the group consisting of SEQ ID NOs: 3 to 7, and SEQ ID NO: 8. 7. Purified polypeptide characterized in that it has at least 40%
identity with a polypeptide according to any one of claims 4 to 6. 8. Recombinant or chimeric polypeptide characterized in that it comprises at least one polypeptide according to any one of claims 4 to 7. 9. Antigen characterized in that it consists of a polynucleotide according to one any one of claims 1 to 3, or a polypeptide according to one any of claims 4 to 8. 10. Antigenic conjugate consisting of polynucleotides according to any one of claims 1 to 3, and / or of polypeptides according to any one of claims 4 to 8; and a support on which said polynucleotides /
polypeptides are adsorbed. 11. Conjugate according to claim 10 characterized in that the support is consisting of microspheres, microparticles of latex beads, polyphosphoglycans (PGLA) or polystyrene. 12. Use of a conjugate according to claims 10 or 11, for immunization of individuals infected or likely to be infected with malaria. 13. Recognized purified monoclonal or polyclonal antibodies specifically at least one of the polynucleotides, polypeptides and / or conjugates defined in claims 1 to 11. 14. Antibody according to claim 13, characterized in that they are humanized. 15. Cloning or expression vector comprising a sequence Polynucleotide according to any one of claims 1 to 3. 16. A vector according to claim 15, wherein said sequence is incorporated into one of the sites which is not essential for the replication of said vector. 17. A vector according to claim 15 or 16, characterized in that said vector is chosen from plasmids, cosmids or phages. 18. Host cell comprising a vector according to any one of claims 15 to 18. 19. Recombinant E. Coli cell chosen from the cells deposited at the CNCM on May 23, 2001 under accession numbers I-2671 and I-2672. 20. Immunogenic composition comprising:
- at least one of the following: polynucleotides according to one any of claims 1 to 3, polypeptides according to one any of claims 4 to 8, conjugates according to claim 10 or 11; and - at least one acceptable pharmaceutical vehicle. 21. Immunogenic composition according to claim 20, characterized in that that it additionally contains at least one compound chosen from the group consisting through alum, QS21, montanide, SBAS2 adjuvant and incomplete adjuvant Freund. 22. Immunogenic composition according to claim 20 or 21, characterized in the polypeptide molecule is adsorbed on microparticles. 23. Immunogenic composition according to any one of claims 20 to 22, wherein said polynucleotide molecule is in the form of DNA. 24. Immunogenic composition according to any one of claims 20 to 23 characterized in that it further comprises at least one epitope chosen from the group consisting of: proteins CS, MSP-1, MSP-3, LSA-1, TRAP, STARP, SALSA, SALSA I, SALSA II and LSA-3. 25. Immunogenic composition according to any one of claims 20 to 24 characterized in that it makes it possible to obtain a cellular response and / or humoral in vivo and / or in vitro. 26. Immunogenic composition according to claims 24 or 25, characterized in that it allows the production of interferon-.gamma. by leukocytes from topics immune to irradiated sporozoites. 27. Immunogenic composition according to any one of claims 24 to 26, characterized in that it makes it possible to obtain an IgG humoral response. 28. Immunogenic composition according to claim 27, characterized in that that it allows the obtaining of an humoral response of the IgG1, IgG2, IgG3 and / or IgG4. 29. Immunogenic composition according to any one of claims 20 to 28, characterized in that it is capable of inducing, in vivo and in vitro, a protection by challenge infection with Plasmodium falciparum. 30. Anti-malaria vaccine comprising:
- at least one of the following: polynucleotides according to one any of claims 1 to 3, polypeptides according to one any of claims 4 to 8, conjugates according to the claim 10 or 11; and - at least one acceptable pharmaceutical vehicle. 31. Vaccine according to claim 30, characterized in that it further comprises at least one epitope chosen from the group consisting of: proteins CS, MSP-1, MSP-3, LSA-1, TRAP, STARP, SALSA, SALSA I, SALSA II and LSA-3. 32. Pharmaceutical composition comprising, as active substance, one or more several polyclonal or monoclonal antibodies according to claim 13 or in combination with an acceptable pharmaceutical vehicle. 33. Pharmaceutical composition according to claim 32, characterized in that that it further comprises at least one compound chosen from the group consisting alum, QS21, montanide, SBAS2 adjuvant and incomplete adjuvant Freund. 34. Use of at least one of the following: polynucleotides according to any one of claims 1 to 3, polypeptides according to any one claims 4 to 8, conjugated according to claim 10 or 11; antibody according to claim 13 or 14; for the manufacture of a medicinal product intended at treatment of malaria. 35. Method for in vitro diagnosis of malaria in a susceptible individual to be infected with Plasmodium falciparum including the following steps a) contacting, under conditions allowing a reaction immunological, tissue and / or biological fluid taken from a individual likely to be infected with Plasmodium falciparum with a antibody according to claim 13 or 14 in order to allow the formation immune complexes; and b) in vitro detection of immune complexes formed A 36. Method for in vitro diagnosis of malaria in a susceptible individual to be infected with Plasmodium falciparum including the following steps a) contacting, under conditions allowing a reaction immunological, tissue and / or biological fluid taken from a individual likely to be infected with Plasmodium falciparum at least one of the following: polynucleotides according to any one claims 1 to 3; polypeptides according to any one of claims 4 to 8, conjugates according to claim 10 or 11;
in order to allow the formation of immune complexes involving at at least one of said conjugates and possibly antibodies present in said tissue or said biological fluid; and b) in vitro detection of any immune complexes that may have formed. 37. Method according to claim 35, characterized in that in step a), the tissue and / or biological fluid is further contacted with at least one epitope chosen from the group consisting of: the proteins CS, MSP-1, MSP-3, LSA-1, TRAP, STARP, SALSA, SALSA I, SALSA II or LSA-3. 38. Kit for the in vitro diagnosis of malaria comprising the elements following:

a) at least one of the elements chosen from the group consisting of:
polynucleotides according to any one of claims 1 to 3; the polypeptides according to any one of claims 4 to 8, the conjugates according to claim 10 or 11;

b) reagents for the constitution of the medium suitable for a reaction of bond between a sample to be tested and at least one of the molecules defined in a); and c) reagents for the detection of antigen-antibody complexes produced by said binding reaction, these reagents can also carry a marker or be capable of being recognized in turn by a reagent Mark. 39. Kit for the in vitro diagnosis of malaria comprising the elements following:
- antibodies according to claim 13 or 14;
- reagents for the constitution of the medium favorable to a reaction of binding between a test sample and at least one of said antibodies; and - reagents for the detection of antigen-antibody complexes produced by said binding reaction, these reagents also being able to wear a marker or be likely to be recognized in turn by a labeled reagent. 40. The kit for the in vitro diagnosis of malaria according to claim 38, characterized in that it further comprises at least one peptide molecule chosen from the group consisting of: proteins CS, MSP-1, MSP-3, LSA-1, TRAP, STARP, SALSA, SALSA I, SALSA II and LSA-3. 41. Kit for the in vitro diagnosis of malaria according to any one of the Claims 38 to 40, characterized in that it also comprises the adjuvant SBAS2.