CA2344995A1 - Cancer associated antigens and uses therefor - Google Patents

Abstract

Cancer associated antigens have been identified by autologous antibody screening of libraries of nucleic acids expressed in renal cancer cells using antisera from cancer patients. The invention relates to nucleic acids and encoded polypeptides which are cancer associated antigens expressed in patients afflicted with renal cancer. The invention provides, inter alia, isolated nucleic acid molecules, expression vectors containing those molecules and host cells transfected with those molecules. The invention also provides isolated proteins and peptides, antibodies to those proteins and peptides and cytotoxic T lymphocytes which recognize the proteins and peptides. Fragments of the foregoing including functional fragments and variants also are provided. Kits containing the foregoing molecules additionally are provided.
The molecules provided by the invention can be used in the diagnosis, monitoring, research, or treatment of conditions characterized by the expression of one or more cancer associated antigens.

Description

CANCER ASSOCIATED ANTIGENS AND USES THEREFOR
Field of the Invention The invention relates to nucleic acids and encoded polypeptides which are cancer associated antigens expressed in patients afflicted with a variety of cancers.
The invention also relates to agents which bind the nucleic acids or polypeptides. The nucleic acid molecules, polypeptides coded for by such molecules and peptides derived therefrom, as well as related antibodies and cytolytic T lymphocytes, are useful, inter alia, in diagnostic and therapeutic contexts.
Background of the Invention The mechanism by which T cells recognize foreign materials has been implicated in cancer. A number of cytolytic T lymphocyte (CTL) clones directed against autologous melanoma antigens, testicular antigens, and melanocyte differentiation antigens have been described. In many instances, the antigens recognized by these clones have been characterized.
The use of autologous CTLs for identifying tumor antigens requires that the target cells which express the antigens can be cultured in vitro and that stable lines of autologous CTL clones which recognize the antigen-expressing cells can be isolated and propagated.
While this approach has worked well for melanoma antigens, other tumor types, such as epithelial cancers including breast and colon cancer, have proved refractory to the approach.
More recently another approach to the problem has been described by Sahin et al.
(Proc. Natl. Acad. Sci. USA 92:11810-11813, 1995). According to this approach, autologous antisera are used to identify immunogenic protein antigens expressed in cancer cells by screening expression libraries constructed from tumor cell cDNA. Antigen-encoding clones so identified have been found to have elicited an high-titer humoral immune response in the patients from which the antisera were obtained. Such a high-titer IgG response implies helper T cell recognition of the detected antigen. These tumor antigens can then be screened for the presence of MHC/HLA class I and class II motifs and reactivity with CTLs Presently there is a need for additional cancer antigens for development of therapeutics and diagnosis applicable to a greater number of cancer patients having various cancers.

-2-Summary of the Invention Autologous antibody screening has now been applied to renal cancer using antisera from cancer patients. Numerous cancer associated antigens have been identified. The invention provides, inter alia, isolated nucleic acid molecules, expression vectors containing those molecules and host cells transfected with those molecules. The invention also provides isolated proteins and peptides, antibodies to thase proteins and peptides and CTLs which recognize the proteins and peptides. Fragments including functional fragments and variants of the foregoing also are provided. Kits containing the foregoing molecules additionally are provided. The foregoing can be used in the diagnosis, monitoring, research, or treatment of conditions characterized by the expression of one or more cancer associated antigens.
Prior to the present invention, only a handful of cancer associated genes had been identified in the past 20 years. The invention involves the surprising discovery of several genes, some previously known and some previously unknown, which are expressed in individuals who have cancer. These individuals all have serum antibodies against the proteins (or fragments thereof] encoded by these genes. Thus, abnormally expressed genes are recognized by the host's immune system and therefore can form a basis for diagnosis, monitoring and therapy.
The invention involves the use of a single material, a plurality of different materials and even large panels and combinations of materials. For example, a single gene, a single protein encoded by a gene, a single functional fragment thereof, a single antibody thereto, etc.
can be used in methods and products of the invention. Likewise, pairs, groups and even panels of these materials and optionally other cancer associated antigen genes and/or gene products can be used for diagnosis, monitoring and therapy. The pairs, groups or panels can involve 2, 3, 4, 5 or more genes, gene products, fragments thereof or agents that recognize such materials. A plurality of such materials are not only useful in monitoring, typing, characterizing and diagnosing cells abnormally expressing such genes, but a plurality of such materials can be used therapeutically. An example of the use of a plurality of such materials for the prevention, delay of onset, amelioration, etc. of cancer cells, which express or will express such genes prophylactically or acutely. Any and all combinations of the genes, gene products, and materials which recognize the genes and gene products can be tested and identified for use according to the invention. It would be far too lengthy to recite all such combinations; those skilled in the art, particularly in view of the teaching contained herein,

-3 will readily be able to determine which combinations are most appropriate for which circumstances.
As will be clear from the following discussion, the invention has in vivo and ire vitro uses, including for therapeutic, diagnostic, monitoring and research purposes.
One aspect of the invention is the ability to fingerprint a cell expressing a number of the genes identified according to the invention by, for example, quantifying the expression of such gene products.
Such fingerprints will be characteristic, for example, of the stage of the cancer, the type of the cancer, or even the effect in animal models of a therapy on a cancer. Cells also can be screened to determine whether such cells abnormally express the genes identified according to the invention.
The invention, in one aspect, is a method of diagnosing a disorder characterized by expression of a cancer associated antigen precursor coded for by a nucleic acid molecule. The method involves the steps of contacting a biological sample isolated from a subject with an agent that specifically binds to the nucleic acid molecule, an expression product thereof, or a fragment of an expression product thereof complexed with an MHC, preferably an HLA, molecule, wherein the nucleic acid molecule is a NA Group 1 nucleic acid molecule, and determining the interaction between the agent and the nucleic acid molecule, the expression product or fragment of the expression product as a determination of the disorder.
In one embodiment the agent is selected from the group consisting of (a) a nucleic acid molecule comprising NA Group 1 nucleic acid molecules or a fragment thereof, (b) a nucleic acid molecule comprising NA Group 3 nucleic acid molecules or a fragment thereof, (c) a nucleic acid molecule comprising NA Group 5 nucleic acid molecules or a fragment thereof, (d) an antibody that binds to an expression product, or a fragment thereof, of NA
group 1 nucleic acids, (e) an antibody that binds to an expression product, or a fragment thereof, of NA group 3 nucleic acids, (f) an antibody that binds to an expression product, or a fragment thereof, of NA group 5 nucleic acids, (g) and agent that binds to a complex of an MHC, preferably HLA, molecule and a fragment of an expression product of a NA
Group 1 nucleic acid, (h) an agent that binds to a complex of an MHC, preferably HLA, molecule and a fragment of an expression product of a NA group 3 nucleic acid, and (i) an agent that binds to a complex of an MHC, preferably HLA, molecule and a fragment of an expression product of a NA Group 5 nucleic acid.
The disorder may be characterized by expression of a plurality of cancer associated

-4-antigen precursors. Thus the methods of diagnosis may include use of a plurality of agents, each of which is specific for a different human cancer associated antigen precursor (including at least one of the cancer associated antigen precursors disclosed herein), and wherein said plurality of agents is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 such agents.
In each of the above embodiments the agent may be specific for a human cancer associated antigen precursor that is selected from the group consisting of breast, gastric, lung, prostate, renal, colon, thyroid, Hodgkin's disease, and hepatocarcinoma cancer associated antigen precursors.
In another aspect the invention is a method for determining regression, progression or onset of a condition characterized by expression of abnormal levels of a protein encoded by a nucleic acid molecule that is a NA Group 1 molecule. The method involves the steps of monitoring a sample, from a subject who has or is suspected of having the condition, for a parameter selected from the group consisting of (i) the protein, (ii) a peptide derived from the protein, (iii) an antibody which selectively binds the protein or peptide, and (iv) cytolytic T
cells specific for a complex of the peptide derived from the protein and an MHC molecule, as a determination of regression, progression or onset of said condition. In one embodiment the sample is a body fluid, a body effusion or a tissue.
In another embodiment the step of monitoring comprises contacting the sample with a detectable agent selected from the group consisting of (a) an antibody which selectively binds the protein of (i), or the peptide of (ii), (b) a protein or peptide which binds the antibody of (iii), and (c) a cell which presents the complex of the peptide and MHC
molecule of (iv). In a preferred embodiment the antibody, the protein, the peptide or the cell is labeled with a radioactive label or an enzyme. The sample in a preferred embodiment is assayed for the peptide.
According to another embodiment the nucleic acid molecule is one of the following: a NA Group 3 molecule or a NA Group 5 molecule. In yet another embodiment the protein is a plurality of proteins, the parameter is a plurality of parameters, each of the plurality of parameters being specific for a different of the plurality of proteins. In certain embodiments the protein is a plurality of proteins, at least one of which is kinectin, the remainder of which are non-kinectin cancer associated proteins, and wherein the parameter is a plurality of parameters, each of the plurality of parameters being specific for a different of the plurality of

-5-proteins.
The invention in another aspect is a pharmaceutical preparation for a human subject.
The pharmaceutical preparation includes an agent which when administered to the subject enriches selectively the presence of complexes of an HLA molecule and a human cancer associated antigen, and a pharmaceutically acceptable carrier, wherein the human cancer associated antigen is a fragment of a human cancer associated antigen precursor encoded by a nucleic acid molecule which comprises a NA Group 1 molecule. In one embodiment the nucleic acid molecule is a NA Group 3 nucleic acid molecule.
The agent in one embodiment comprises a plurality of agents, each of which enriches selectively in the subject complexes of an HLA molecule and a different human cancer associated antigen. Preferably the plurality is at least two, at least three, at least four or at least 5 different such agents.
In certain embodiments, the agent comprises a plurality of agents, at least one of which is kinectin, the remainder of which are non-kinectin cancer associated proteins, and each of which enriches selectively in the subject complexes of an HLA molecule and a different human cancer associated antigen.
In another embodiment the agent is selected from the group consisting of (1) an isolated polypeptide comprising the human cancer associated antigen, or a functional variant thereof, (2) an isolated nucleic acid operably linked to a promoter for expressing the isolated polypeptide, or functional variant thereof, (3) a host cell expressing the isolated polypeptide, or functional variant thereof, and (4) isolated complexes of the polypeptide, or functional variants thereof, and an HLA molecule.
The agent may be a cell expressing an isolated polypeptide. In one embodiment the agent is a cell expressing an isolated polypeptide comprising the human cancer associated antigen or a functional variant thereof. In another embodiment the agent is a cell expressing an isolated polypeptide comprising the human cancer associated antigen or a functional variant thereof, and wherein the cell expresses an HLA molecule that binds the polypeptide.
The cell can express one or both of the polypeptide and HLA molecule recombinantly. In preferred embodiments the cell is nonproliferative. In other preferred embodiments, the isolated polypeptide is or includes a kinectin polypeptide. In yet another embodiment the agent is at least two, at least three, at least four or at least five different polypeptides, each representing a different human cancer associated antigen or functional variant thereof.

WO 00/20587 PC'T/US99/22873

-6-The agent in one embodiment is a PP Group 2 polypeptide. In other embodiments the agent is a PP Group 3 polypeptide or a PP Group 4 polypeptide.
In an embodiment each of the pharmaceutical preparations described herein also includes an adjuvant.
According to another aspect the invention, a composition is provided which includes an isolated agent that binds selectively a PP Group 1 polypeptide. In separate embodiments the agent binds selectively to a polypeptide selected from the following: a PP
Group 2 polypeptide, a PP Group 3 polypeptide, a PP Group 4 polypeptide, and a PP
Group 5 polypeptide. In other embodiments, the agent is a plurality of different agents that bind selectively at least two, at least three, at least four, or at least five different such polypeptides.
In each of the above described embodiments the agent may be an antibody. In a preferred embodiment, at least one of polypeptides is kinectin or a fragment thereof.
In another aspect the invention is a composition of matter composed of a conjugate of the agent of the above-described compositions of the invention and a therapeutic or diagnostic agent. Preferably the conjugate is of the agent and a therapeutic or diagnostic that is an antineoplastic.
The invention in another aspect is a pharmaceutical composition which includes an isolated nucleic acid molecule selected from the group consisting of: ( 1 ) NA
Group 1 molecules, and (2) NA Group 2 molecules, and a pharmaceutically acceptable carrier. In one embodiment the isolated nucleic acid molecule comprises a NA Group 3 or NA
Group 4 molecule. In another embodiment the isolated nucleic acid molecule comprises at least two isolated nucleic acid molecules coding for two different polypeptides, each polypeptide comprising a different cancer associated antigen. In preferred embodiments, at least one of the polypeptides is a kinectin polypeptide.
Preferably the pharmaceutical composition also includes an expression vector with a promoter operably linked to the isolated nucleic acid molecule. In another embodiment the pharmaceutical composition also includes a host cell recombinantly expressing the isolated nucleic acid molecule.
According to another aspect of the invention a pharmaceutical composition is provided. The pharmaceutical composition includes an isolated polypeptide comprising a PP
Group 1 or a PP Group 2 polypeptide, and a pharmaceutically acceptable carrier. In one embodiment the isolated polypeptide comprises a PP Group 3 or a PP Group 4 polypeptide.

7 PCT/US99/22873 In another embodiment the isolated polypeptide comprises at least two different polypeptides, each comprising a different cancer associated antigen at least one of which is encoded by a NA group 1 molecule as disclosed herein. In separate embodiments the isolated polypeptides are selected from the following: PP Group 3 polypeptides or HLA
binding fragments thereof and PP Group S polypeptides or HLA binding fragments thereof.
In an embodiment each of the pharmaceutical compositions described herein also includes an adjuvant.
Another aspect the invention is an isolated nucleic acid molecule comprising a NA
Group 3 molecule. Another aspect the invention is an isolated nucleic acid molecule comprising a NA Group 4 molecule.
The invention in another aspect is an isolated nucleic acid molecule selected from the group consisting of (a) a fragment of a nucleic acid selected from the group of nucleic acid molecules consisting of SEQ ID Nos numbered below and comprising all nucleic acid sequences among SEQ ID NOs 1-I 1 and 22-46, of sufficient length to represent a sequence unique within the human genome, and identifying a nucleic acid encoding a human cancer associated antigen precursor, (b) complements of (a), provided that the fragment includes a sequence of contiguous nucleotides which is not identical to any sequence selected from the sequence group consisting of (1) sequences having the GenBank accession numbers of Table 1, (2) complements of ( I ), and (3 ) fragments of ( 1 ) and (2).
In one embodiment the sequence of contiguous nucleotides is selected from the group consisting of: (I) at least two contiguous nucleotides nonidentical to the sequences in Table I, (2) at least three contiguous nucleotides nonidentical to the sequences in Table 1, (3) at least four contiguous nucleotides nonidentical to the sequences in 'Table 1, (4) at least five contiguous nucleotides nonidentical to the sequences in Table 1, (5) at least six contiguous nucleotides nonidentical to the sequences in Table I, or (6) at least seven contiguous nucleotides nonidentical to the sequences in Table 1.
In another embodiment the fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, SO nucleotides, 75 nucleotides, 100 nucleotides, 200 nucleotides, nucleotides and every integer length therebetween.
In yet another embodiment the molecule encodes a polypeptide which, or a fragment _g_ of which, binds a human HLA receptor or a human antibody.
Another aspect of the invention is an expression vector comprising an isolated nucleic acid molecule of the invention described above operably linked to a promoter.
According to one aspect the invention is an expression vector comprising a nucleic acid operably linked to a promoter, wherein the nucleic acid is a NA Group 1 or Group 2 molecule. In another aspect the invention is an expression vector comprising a NA Group 1 or Group 2 molecule and a nucleic acid encoding an MHC, preferably HLA, molecule.
In yet another aspect the invention is a host cell transformed or transfected with an expression vector of the invention described above.
In another aspect the invention is a host cell transformed or transfected with an expression vector comprising an isolated nucleic acid molecule of the invention described above operably linked to a promoter, or an expression vector comprising a nucleic acid operably linked to a promoter, wherein the nucleic acid is a NA Group 1 or 2 molecule and further comprising a nucleic acid encoding HL,A.
According to another aspect of the invention an isolated polypeptide encoded by the isolated nucleic acid molecules the invention, described above, is provided. These include PP Group 1-5 polypeptides. The invention also includes a fragment of the polypeptide which is immunogenic. In one embodiment the fragment, or a portion of the fragment, binds HLA or a human antibody. In still another aspect the invention provides as isolated polypeptide comprising a fragment of a kinectin polypeptide which is immunogenic.
The invention includes in another aspect an isolated fragment of a human cancer associated antigen precursor which, or portion of which, binds HLA or a human aaitibody, wherein the precursor is encoded by a nucleic acid molecule that is a NA Group 1 molecule.
In one embodiment the fragment is part of a complex with HLA. In another embodiment the fragment is between 8 and 12 amino acids in length. In another embodiment the invention includes an isolated polypeptide comprising a fragment of the polypeptide of sufficient length to represent a sequence unique within the human genome and identifying a polypeptide that is a human cancer associated antigen precursor.
According to another aspect of the invention a kit far detecting the presence of the expression of a cancer associated antigen precursor is provided. The kit includes a pair of isolated nucleic acid molecules each of which consists essentially of a molecule selected from the group consisting of (a) a 12-32 nucleotide contiguous segment of the nucleotide sequence of any of the NA Group 1 molecules and (b) complements of ("a"), wherein the contiguous segments are nonoverlapping. In one embodiment the pair of isolated nucleic acid molecules is constructed and arranged to selectively amplify an isolated nucleic acid molecule that is a NA Group 3 molecule. Preferably, the pair amplifies a human NA Group 3 molecule.
According to another aspect of the invention a method for treating a subject with a disorder characterized by expression of a human cancer associated antigen precursor is provided. The method includes the step of administering to the subject an amount of an agent, which enriches selectively in the subject the presence of complexes of an HLA
molecule and a human cancer associated antigen, effective to ameliorate the disorder, wherein the human cancer associated antigen is a fragment of a human cancer associated antigen precursor encoded by a nucleic acid molecule selected from the group consisting of (a) a nucleic acid molecule comprising NA group 1 nucleic acid molecules, (b) a nucleic acid molecule comprising NA group 3 nucleic acid molecules, (c) a nucleic acid molecule comprising NA
group 5 nucleic acid molecules.
In one embodiment the disorder is characterized by expression of a plurality of human cancer associated antigen precursors and wherein the agent is a plurality of agents, each of which enriches selectively in the subject the presence of complexes of an HLA
molecule and a different human cancer associated antigen. Preferably the plurality is at least 2, at least 3, at least 4, or at least 5 such agents. In a preferred embodiment, at least one of the human cancer associated antigens is kinectin or a fragment thereof.
In another embodiment the agent is an isolated polypeptide selected from the group consisting of PP Group l, PP Group 2, PP Group 3, PP Group 4, and PP group 5 polypeptides.
In yet another embodiment the disorder is cancer.
According to another aspect the invention is a method for treating a subject having a condition characterized by expression of a cancer associated antigen precursor in cells of the subject. The method includes the steps of (i) removing an immunoreactive cell containing sample from the subject, (ii) contacting the immunoreactive cell containing sample to the host cell under conditions favoring production of cytolytic T cells against a human cancer associated antigen which is a fragment of the precursor, (iii) introducing the cytolytic T cells to the subject in an amount effective to lyse cells which express the human cancer associated antigen, wherein the host cell is transformed or transfected with an expression vector comprising an isolated nucleic acid molecule operably linked to a promoter, the isolated nucleic acid molecule being selected from the group of nucleic acid molecules consisting of NA Group 1, NA Group 2, NA Group 3, NA Group 4, NA Group 5.
In one embodiment the host cell recombinantly expresses an HLA molecule which binds the human cancer associated antigen. In another embodiment the host cell endogenously expresses an HLA molecule which binds the human cancer associated antigen.
The invention includes in another aspect a method for treating a subject having a condition characterized by expression of a cancer associated antigen precursor in cells of the subject. The method includes the steps of (i) identifying a nucleic acid molecule expressed by the cells associated with said condition, wherein said nucleic acid molecule is a NA Group 1 molecule (ii) transfecting a host cell with a nucleic acid selected from the group consisting of (a) the nucleic acid molecule identified, (b) a fragment of the nucleic acid identified which includes a segment coding for a cancer associated antigen, (c) deletions, substitutions or additions to (a) or (b), and (d) degenerates of (a), (b), or (c); (iii) culturing said transfected host cells to express the transfected nucleic acid molecule, and; (iv) introducing an amount of said host cells or an extract thereof to the subject effective to increase an immune response against the cells of the subject associated with the condition. Preferably, the antigen is a human antigen and the subject is a human. In certain preferred embodiments the nucleic acid molecule is a kinectin nucleic acid molecule.
In one embodiment the method also includes the step of (a) identifying an MHC
molecule which presents a portion of an expression product of the nucleic acid molecule, wherein the host cell expresses the same MHC molecule as identified in (a) and wherein the host cell presents an MHC binding portion of the expression product of the nucleic acid molecule.
In another embodiment the method also includes the step of treating the host cells to render them non-proliferative.
In yet another embodiment the immune response comprises a B-cell response or a T
cell response. Preferably the response is a T-cell response which comprises generation of cytolytic T-cells specific for the host cells presenting the portion of the expression product of the nucleic acid molecule or cells of the subject expressing the human cancer associated antigen.
In another embodiment the nucleic acid molecule is a NA Group 3 molecule.
Another aspect of the invention is a method for treating or diagnosing or monitoring a subject having a condition characterized by expression of an abnormal amount of a protein encoded by a nucleic acid molecule that is a NA Group 1 molecule. The method includes the step of administering to the subject an antibody which specifically binds to the protein or a peptide derived therefrom, the antibody being coupled to a therapeutically useful agent, in an amount effective to treat the condition.
In one embodiment the antibody is a monoclonal antibody. Preferably the monoclonal antibody is a chimeric antibody or a humanized antibody.
In another aspect the invention is a method for treating a condition characterized by expression in a subject of abnormal amounts of a protein encoded by a nucleic acid molecule that is a NA Group 1 nucleic acid molecule. The method involves the step of administering to a subject at least one of the pharmaceutical compositions of the invention described above in an amount effective to prevent, delay the onset of, or inhibit the condition in the subject. In one embodiment the condition is cancer. In another embodiment the method includes the step of first identifying that the subject expresses in a tissue abnormal amounts of the protein.
The invention in another aspect is a method for treating a subject having a condition characterized by expression of abnormal amounts of a protein encoded by a nucleic acid molecule that is a NA Group 1 nucleic acid molecule. The method includes the steps of (i}
identifying cells from the subject which express abnormal amounts of the protein; (ii) isolating a sample of the cells; (iii) cultivating the cells, and (iv) introducing the cells to the subject in an amount effective to provoke an immune response against the cells.
In one embodiment the method includes the step of rendering the cells non-proliferative, prior to introducing them to the subject.
In another aspect the invention is a method for treating a pathological cell condition characterized by abnormal expression of a protein encoded by a nucleic acid molecule that is a NA Group 1 nucleic acid molecule. The method includes the step of administering to a subject in need thereof an effective amount of an agent which inhibits the expression or activity of the protein.
In one embodiment the agent is an inhibiting antibody which selectively binds to the protein and wherein the antibody is a monoclonal antibody, a chimeric antibody, a humanized antibody or a fragment thereof. In another embodiment the agent is an antisense nucleic acid molecule which selectively binds to the nucleic acid molecule which encodes the protein. In yet another important embodiment the nucleic acid molecule is a NA Group 3 nucleic acid molecule. In other preferred embodiments, the nucleic acid molecule is a kinectin nucleic acid molecule.
The invention includes in another aspect a composition of matter useful in stimulating an immune response to a plurality of proteins encoded by nucleic acid molecules that are NA
Group 1 molecules. The composition is a plurality of peptides derived from the amino acid sequences of the proteins, wherein the peptides bind to one or more MHC
molecules presented on the surface of the cells which express an abnormal amount of the protein. In preferred embodiments, at least one of the proteins is kinectin.
In one embodiment at least a portion of the plurality of peptides bind to MHC
molecules and elicit a cytolytic response thereto. In another embodiment the composition of matter includes an adjuvant. In another embodiment the adjuvant is a saponin, GM-CSF, or an interleukin. In still another embodiment, the compositions also includes at least one peptide useful in stimulating an immune response to at least one protein which is not encoded by nucleic acid molecules that are NA Group I molecules, wherein the at least one peptide binds to one or more MHC molecules.
According to another aspect the invention is an isolated antibody which selectively binds to a complex of: (i) a peptide derived from a protein encoded by a nucleic acid molecule that is a NA Group 1 molecule and (ii) and an MHC molecule to which binds the peptide to form the complex, wherein the isolated antibody does not bind to (i) or (ii) alone.
In one embodiment the antibody is a monoclonal antibody, a chimeric antibody, a humanized antibody or a fragment thereof.
The invention also involves the use of the genes, gene products, fragments thereof, agents which bind thereto, and so on in the preparation of medicaments. A
particular medicament is for treating cancer and a more particular medicament is for treating breast cancer, lung cancer, renal cancer, colon cancer, prostate cancer or gastric cancer.
Detailed Description of the Invention In the above summary and in the ensuing description, lists of sequences are provided.
The lists are meant to embrace each single sequence separately, two or more sequences together where they form a part of the same gene, any combination of two or more sequences which relate to different genes, including and up to the total number on the list, as if each and every combination were separately and specifically enumerated. Likewise, when mentioning fragment size, it is intended that a range embrace the smallest fragment mentioned to the full-length of the sequence (less one nucleotide or amino acid so that it is a fragment), each and every fragment length intended as if specifically enumerated. Thus, if a fragment could be between 10 and 15 in length, it is explicitly meant to mean 10, 11, 12, 13, 14, or 15 in length.
The summary and the claims mention antigen precursors and antigens. As used in the summary and in the claims, a precursor is substantially the full-length protein encoded by the coding region of the isolated DNA and the antigen is a peptide which complexes with MHC, preferably HLA, and which participates in the immune response as part of that complex. Such antigens are typically 9 amino acids long, although this may vary slightly.
As used herein, a subject is a human, non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent. In all embodiments human cancer antigens and human subjects are preferred.
The present invention in one aspect involves the cloning of cDNAs encoding human cancer associated antigen precursors using autologous antisera of subjects having renal cancer.
The sequences of the clones representing genes identified according to the methods described herein are presented in the attached Sequence Listing. Of the foregoing, it can be seen that some of the clones are considered completely novel as no nucleotide or amino acid homologies to coding regions were found in the databases searched. Other clones are novel but have some homology to sequences deposited in databases (mainly EST
sequences).
Nevertheless, the entire gene sequence was not previously known. In some cases no function was suspected and in other cases, even if a function was suspected, it was not know that the gene was associated with cancer. In all cases, it was not known or suspected that the gene encoded a cancer antigen which reacted with antibody from autologous sera.
Analysis of the clone sequences by comparison to nucleic acid and protein databases determined that still other of the clones surprisingly are closely related to other previously-cloned genes. The sequences of these related genes is also presented in the Sequence Listing.
The nature of the foregoing genes as encoding antigens recognized by the immune systems of cancer patients is, of course, unexpected.
The invention thus involves in one aspect cancer associated antigen polypeptides, genes encoding those polypeptides, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as diagnostics and therapeutics relating thereto.
Homologs and alleles of the cancer associated antigen nucleic acids of the invention can be identified by conventional techniques. Thus, an aspect of the invention is those nucleic acid sequences which code for cancer associated antigen precursors. Because this application contains so many sequences, the following chart is provided to identify the various groups of sequences discussed in the claims and in the summary:
Nucleic Acid Sequences NA Group 1. (a) nucleic acid molecules which hybridize under stringent conditions to a molecule consisting of a nucleic acid sequence selected from the group consisting of nucleic acid sequences among SEQ ID NOs: 1-11 and 22-46 and which code for a cancer associated antigen precursor, (b) deletions, additions and substitutions which code for a respective cancer associated antigen precursor, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c).
NA Group 2. Fragments of NA Group 1, which codes for a polypeptide which, or a portion of which, binds an MHC molecule to form a complex recognized by a an autologous antibody or lymphocyte.
NA Group 3. The subset of NA Group 1 where the nucleotide sequence is selected from the group consisting of:
(a) previously unknown human nucleic acids coding for a human cancer associated antigen precursor (i.e. nucleic acid sequences among SEQ ID NOs: 1-11), (b) deletions, additions and substitutions which code for a respective human cancer associated antigen precursor, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c).

NA Group 4. Fragments of NA Group 3, which code for a polypeptide which, or a portion of which, binds to an MHC molecule to form a complex recognized by an autologous antibody or lymphocyte.
NA Group 5. A subset of NA Group 1, comprising human cancer associated antigens that react with allogeneic cancer antisera.
Polypeptide Sequences PP Group Polypeptides encoded by 1. NA Group 1.

PP Group Polypeptides encoded by 2. NA Group 2 PP Group Polypeptides encoded by 3. NA Group 3.

PP Group Polypeptides encoded by 4. NA Group 4.

PP Group Polypeptides encoded by 5. NA Group S.

The term "stringent conditions" as used herein refers to parameters with which the art is familiar. Nucleic acid hybridization parameters may be found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. More specifically, stringent conditions, as used herein, refers, for example, to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02%
Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.SmM NaHzP04(pH7), 0.5% SDS, 2mM
EDTA). SSC is 0.1 SM sodium chloride/O.15M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid. After hybridization, the membrane upon which the DNA is transferred is washed, for example, in 2 x SSC at room temperature and then at 0.1 - 0.5 x SSC/0.1 x SDS at temperatures up to 68°C.
There are other conditions, reagents, and so forth which can be used, which result in a similar degree of stringency. The skilled artisan will be familiar with such conditions, and thus they are not given here. It will be understood, however, that the skilled artisan will be able to manipulate the conditions in a manner to permit the clear identification of homologs and alleles of cancer associated antigen nucleic acids of the invention (e.g., by using lower stringency conditions). The skilled artisan also is familiar with the methodology for screening cells and libraries for expression of such molecules which then are routinely isolated, followed by isolation of the pertinent nucleic acid molecule and sequencing.
In general homologs and alleles typically will share at least 7S% nucleotide identity and/or at least 90% amino acid identity to the sequences of cancer associated antigen nucleic acid and polypeptides, respectively, in some instances will share at least 90%
nucleotide identity and/or at least 9S% amino acid identity and in still other instances will share at least 9S% nucleotide identity and/or at least 99% amino acid identity. The homology can be calculated using various, publicly available software tools developed by NCBI
(Bethesda, Maryland) that can be obtained through the Internet (ftp:/ncbi.nlm.nih.gov/pub/). Exemplary tools include the BLAST system available at httn://www.ncbi nlm nih <=ov, using default settings. Pairwise and ClustalW alignments (BLOSUM30 matrix setting) as well as Kyte-Doolittle hydropathic analysis can be obtained using the MacVector sequence analysis software (Oxford Molecular Group). Watson-Crick complements of the foregoing nucleic acids also are embraced by the invention.
In screening for cancer associated antigen genes, a Southern blot may be performed using the foregoing conditions, together with a radioactive probe. After washing the membrane to which the DNA is finally transferred, the membrane can be placed against X-ray film to detect the radioactive signal. In screening for the expression of cancer associated antigen nucleic acids, Northern blot hybridizations using the foregoing conditions (see also the Examples) can be performed on samples taken from breast cancer patients or subjects suspected of having a condition characterized by expression of breast cancer associated antigen genes. Amplification protocols such as polymerase chain reaction using primers which hybridize to the sequences presented also can be used for detection of the cancer associated antigen genes or expression thereof.
The renal cancer associated genes correspond to SEQ ID NOs. 1-11 and 22-3S.
Kinectin cancer associated sequences correspond to SEQ ID Nos:36-46. The preferred cancer associated antigens for the methods of diagnosis disclosed herein are those which were found to react with allogeneic cancer antisera (i.e. NA Group S). Encoded polypeptides (e.g., proteins), peptides and antisera thereto are also preferred for diagnosis.
The invention also includes degenerate nucleic acids which include alternative codons to those present in the native materials. For example, serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC. Each of the six codons is equivalent for the _ 17_ purposes of encoding a serine residue. Thus, it will be apparent to one of ordinary skill in the art that any of the serine-encoding nucleotide triplets may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to incorporate a serine residue into an elongating breast cancer associated antigen polypeptide. Similarly, nucleotide sequence triplets which encode other amino acid residues include, but are not limited to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT
(isoleucine codons). Other amino acid residues may be encoded similarly by multiple nucleotide sequences. Thus, the invention embraces degenerate nucleic acids that differ from the biologically isolated nucleic acids in codon sequence due to the degeneracy of the genetic code.
The invention also provides modified nucleic acid molecules which include additions, substitutions and deletions of one or more nucleotides. In preferred embodiments, these modified nucleic acid molecules and/or the polypeptides they encode retain at least one activity or function of the unmodified nucleic acid molecule and/or the polypeptides, such as antigenicity, enzymatic activity, receptor binding, formation of complexes by binding of peptides by MHC class I and class II molecules, etc. In certain embodiments, the modified nucleic acid molecules encode modified polypeptides, preferably polypeptides having conservative amino acid substitutions as are described elsewhere herein. The modified nucleic acid molecules are structurally related to the unmodified nucleic acid molecules and in preferred embodiments are sufficiently structurally related to the unmodified nucleic acid molecules so that the modified and unmodified nucleic acid molecules hybridize under stringent conditions known to one of skill in the art.
For example, modified nucleic acid molecules which encode polypeptides having single amino acid changes can be prepared. Each of these nucleic acid molecules can have one, two or three nucleotide substitutions exclusive of nucleotide changes corresponding to the degeneracy of the genetic code as described herein. Likewise, modified nucleic acid molecules which encode polypeptides having two amino acid changes can be prepared which have, e.g., 2-6 nucleotide changes. Numerous modified nucleic acid molecules like these will be readily envisioned by one of skill in the art, including for example, substitutions of nucleotides in codons encoding amino acids 2 and 3, 2 and 4, 2 and 5, 2 and 6, and so on. In the foregoing example, each combination of two amino acids is included in the set of WO 00/20587 PCT/US99/228~3 modified nucleic acid molecules, as well as all nucleotide substitutions which code for the amino acid substitutions. Additional nucleic acid molecules that encode polypeptides having additional substitutions (i.e., 3 or more), additions or deletions (e.g., by introduction of a stop codon or a splice site(s)) also can be prepared and are embraced by the invention as readily envisioned by one of ordinary skill in the art. Any of the foregoing nucleic acids or polypeptides can be tested by routine experimentation for retention of structural relation or activity to the nucleic acids and/or polypeptides disclosed herein.
The invention also provides isolated unique fragments of cancer associated antigen nucleic acid sequences or complements thereof. A unique fragment is one that is a 'signature' for the larger nucleic acid. It, for example, is long enough to assure that its precise sequence is not found in molecules within the human genome outside of the cancer associated antigen nucleic acids defined above (and human alleles). Those of ordinary skill in the art may apply no more than routine procedures to determine if a fragment is unique within the human genome. Unique fragments, however, exclude fragments completely composed of the nucleotide sequences of any of GenBank accession numbers listed in Table I or other previously published sequences as of the filing date of the priority documents for sequences listed in a respective priority document or the filing date of this application for sequences listed for the first time in this application which overlap the sequences of the invention.
A fragment which is completely composed of the sequence described in the foregoing GenBank deposits is one which does not include any of the nucleotides unique to the sequences of the invention. Thus, a unique fragment must contain a nucleotide sequence other than the exact sequence of those in GenBank or fragments thereof. The difference may be an addition, deletion or substitution with respect to the GenBank sequence or it may be a sequence wholly separate from the GenBank sequence.
Unique fragments can be used as probes in Southern and Northern blot assays to identify such nucleic acids, or can be used in amplification assays such as those employing PCR. As known to those skilled in the art, large probes such as 200, 250, 300 or more nucleotides are preferred for certain uses such as Southern and Northern blots, while smaller fragments will be preferred for uses such as PCR. Unique fragments also can be used to produce fusion proteins for generating antibodies or determining binding of the polypeptide fragments, or for generating immunoassay components. Likewise, unique fragments can be employed to produce nonfused fragments of the cancer associated antigen polypeptides, useful, for example, in the preparation of antibodies, and in immunoassays.
Unique fragments further can be used as antisense molecules to inhibit the expression of cancer associated antigen nucleic acids and polypeptides, particularly for therapeutic purposes as described in greater detail below.
As will be recognized by those skilled in the art, the size of the unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of cancer associated antigen sequences and complements thereof will require longer segments to be unique while others will require only short segments, typically between 12 and 32 nucleotides (e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 or more bases long, up to the entire length of the disclosed sequence. As mentioned above, this disclosure intends to embrace each and every fragment of each sequence, beginning at the first nucleotide, the second nucleotide and so on, up to 8 nucleotides short of the end, and ending anywhere from nucleotide number 8, 9, 10 and so on for each sequence, up to the very last nucleotide (provided the sequence is unique as described above).
Virtually any segment of the polypeptide coding region of novel cancer associated antigen nucleic acids, or complements thereof, that is I 8 or more nucleotides in length will be unique. Those skilled in the art are well versed in methods for selecting such sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from other sequences in the human genome of the fragment to those on known databases typically is all that is necessary, although in vitro confirmatory hybridization and sequencing analysis may be performed.
Especially preferred include nucleic acids encoding a series of epitopes, known as "polytopes". The epitopes can be arranged in sequential or overlapping fashion (see, e.g., Thomson et al., Proc. Natl. Acad. Sci. USA 92:5845-5849, 1995; Gilbert et al., Nature Biotechnol. 15:1280-1284, 1997), with or without the natural flanking sequences, and can be separated by unrelated linker sequences if desired. The polytope is processed to generated individual epitopes which are recognized by the immune system for generation of immune responses.
Thus, for example, peptides derived from a polypeptide having an amino acid sequence encoded by one of the nucleic acid disclosed herein, and which are presented by MHC molecules and recognized by CTL or T helper lymphocytes, can be combined with peptides from one or more other cancer associated antigens (e.g. by preparation of hybrid nucleic acids or polypeptides) to form "polytopes". The two or more peptides (or nucleic acids encoding the peptides) can be selected from those described herein, or they can include one or more peptides of previously known cancer associated antigens. Exemplary cancer associated peptide antigens that can be administered to induce or enhance an immune response are derived from tumor associated genes and encoded proteins including MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-Al 1, MAGE-A12, MACE-13, GAGE-I, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, BAGE-I, RAGE-1, LB33/MUM-1, PRAME, NAG, MAGE-B2, MAGE-B3, MAGE-B4, tyrosinase, brain glycogen phosphorylase, Melan-A, MAGE-C1 MAGE-C2, NY-ESO-1, LAGE-I, SSX-1, SSX-2 (HOM-MEL-40) SSX-4, SSX-5, SCP-1 and CT-7. See, for example, PCT application publication no. W096/10577. Other examples will be known to one of ordinary skill in the art (for example, see Coulie, Stem Cells 13:393-403, 1995), and can be used in the invention in a like manner as those disclosed herein. One of ordinary skill in the art can prepare polypeptides comprising one or more peptides and one or more of the foregoing cancer associated peptides, or nucleic acids encoding such polypeptides, according to standard procedures of molecular biology.
Thus polytopes are groups of two or more potentially immunogenic or immune response stimulating peptides which can be joined together in various arrangements (e.g.
concatenated, overlapping). The polytope (or nucleic acid encoding the polytope) can be administered in a standard immunization protocol, e.g. to animals, to test the effectiveness of the polytope in stimulating, enhancing and/or provoking an immune response.
The peptides can be joined together directly or via the use of flanking sequences to form polytopes, and the use of polytopes as vaccines is well known in the art (see, e.g., Thomson et aL, Proc. Acad. Natl. Acad. Sci USA 92(13):5845-5849, 1995; Gilbert et al., Nature Biotechnol. 15(12):1280-1284, 1997; Thomson et al., J. Immunol.
157(2):822-826, 1996; Tarn et al., J. Exp. Med. 171 ( 1 ):299-306, 1990). For example, Tam showed that polytopes consisting of both MHC class I and class II binding epitopes successfully generated antibody and protective immunity in a mouse model. Tam also demonstrated that polytopes comprising "strings" of epitopes are processed to yield individual epitopes which are presented by MHC molecules and recognized by CTLs. Thus polytopes containing various numbers and combinations of epitopes can be prepared and tested for recognition by CTLs and for efficacy in increasing an immune response.
It is known that tumors express a set of tumor antigens, of which only certain subsets may be expressed in the tumor of any given patient. Polytopes can be prepared which correspond to the different combination of epitopes representing the subset of tumor rejection antigens expressed in a particular patient. Polytopes also can be prepared to reflect a broader spectrum of tumor rejection antigens known to be expressed by a tumor type.
Polytopes can be introduced to a patient in need of such treatment as polypeptide structures, or via the use of nucleic acid delivery systems known in the art (see, e.g., Allsopp et al., Eur. J. Immunol.
26(8):1951-1959, 1996). Adenovirus, pox virus, Ty-virus like particles, adeno-associated virus, plasmids, bacteria, etc. can be used in such delivery. One can test the polytope delivery systems in mouse models to determine efficacy of the delivery system. The systems also can be tested in human clinical trials.
In instances in which a human HLA class I molecule presents tumor rejection antigens derived from cancer associated nucleic acids, the expression vector may also include a nucleic acid sequence coding for the HLA molecule that presents any particular tumor rejection antigen derived from these nucleic acids and polypeptides. Alternatively, the nucleic acid sequence coding for such a HLA molecule can be contained within a separate expression vector. In a situation where the vector contains both coding sequences, the single vector can be used to transfect a cell which does not normally express either one. Where the coding sequences for a cancer associated antigen precursor and the HLA molecule which presents it are contained on separate expression vectors, the expression vectors can be cotransfected. The cancer associated antigen precursor coding sequence may be used alone, when, e.g. the host cell already expresses a HLA molecule which presents a cancer associated antigen derived from precursor molecules. Of course, there is no limit on the particular host cell which can be used. As the vectors which contain the two coding sequences may be used in any antigen-presenting cells if desired, and the gene for cancer associated antigen precursor can be used in host cells which do not express a HLA molecule which presents a cancer associated antigen.
Further, cell-free transcription systems may be used in lieu of cells.
As mentioned above, the invention embraces antisense oligonucleotides that selectively bind to a nucleic acid molecule encoding a cancer associated antigen polypeptide, to reduce the expression of cancer associated antigens. This is desirable in virtually any medical condition wherein a reduction of expression of cancer associated antigens is desirable, e.g., in the treatment of cancer. This is also useful for in vitro or in vivo testing of the effects of a reduction of expression of one or more cancer associated antigens.
As used herein, the term "antisense oligonucleotide" or "antisense" describes an oligonucleotide that is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide, or modified oligodeoxyribonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an mRNA
transcript of that gene and, thereby, inhibits the transcription of that gene and/or the translation of that mRNA. The antisense molecules are designed so as to interfere with transcription or translation of a target gene upon hybridization with the target gene or transcript. Those skilled in the art will recognize that the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence. It is preferred that the antisense oligonucleotide be constructed and arranged so as to bind selectively with the target under physiological conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions. Based upon the sequences of nucleic acids encoding breast cancer associated antigen, or upon allelic or homologous genomic and/or cDNA sequences, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense molecules for use in accordance with the present invention. In order to be sufficiently selective and potent for inhibition, such antisense oligonucleotides should comprise at least 10 and, more preferably, at least 15 consecutive bases which are complementary to the target, although in certain cases modified oligonucleotides as short as 7 bases in length have been used successfully as antisense oligonucleotides (Wagner et al., Nature Biotechnol.
14:840-844, 1996). Most preferably, the antisense oligonucleotides comprise a complementary sequence of 20-30 bases. Although oligonucleotides may be chosen which are antisense to any region of the gene or mRNA transcripts, in preferred embodiments the antisense oligonucleotides correspond to N-terminal or 5' upstream sites such as translation initiation, transcription initiation or promoter sites. In addition, 3'-untranslated regions may be targeted. Targeting to mRNA splicing sites has also been used in the art but may be less preferred if alternative mRNA splicing occurs. In addition, the antisense is targeted, preferably, to sites in which mRNA secondary structure is not expected (see, e.g., Sainio et al., Cell Mol.
Neurobiol.
14(5):439-457, 1994) and at which proteins are not expected to bind. Finally, although the listed sequences are cDNA sequences, one of ordinary skill in the art may easily derive the genomic DNA corresponding to the cDNA of a cancer associated antigen. Thus, the present invention also provides for antisense oligonucleotides which are complementary to the genomic DNA corresponding to nucleic acids encoding cancer associated antigens. Similarly, antisense to allelic or homologous cDNAs and genomic DNAs are enabled without undue experimentation.
In one set of embodiments, the antisense oligonucleotides of the invention may be composed of "natural" deoxyribonucleotides, ribonucleotides, or any combination thereof.
That is, the S' end of one native nucleotide and the 3' end of another native nucleotide may be covalently linked, as in natural systems, via a phosphodiester internucleoside linkage. These oligonucleotides may be prepared by art recognized methods which may be carried out manually or by an automated synthesizer. They also may be produced recombinantly by vectors.
In preferred embodiments, however, the antisense oligonucleotides of the invention also may include "modified" oligonucleotides. That is, the oligonucleotides may be modified in a number of ways which do not prevent them from hybridizing to their target but which enhance their stability or targeting or which otherwise enhance their therapeutic effectiveness.
The term "modified oligonucleotide" as used herein describes an oligonucleotide in which (1) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide) and/or (2) a chemical group not normally associated with nucleic acids has been covalently attached to the oligonucleotide. Preferred synthetic internucleoside linkages are phosphorothioates, alkyiphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters and peptides.
The term "modified oligonucleotide" also encompasses oligonucleotides with a covalently modified base and/or sugar. For example, modified oligonucleotides include oligonucleotides having backbone sugars which are covaiently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified oligonucleotides may include a 2'-O-alkylated ribose group. In addition, modified oligonucleotides may include sugars such as arabinose instead of ribose. The present invention, thus, contemplates pharmaceutical preparations containing modified antisense molecules that are complementary to and hybridizable with, under physiological conditions, nucleic acids encoding breast cancer associated antigen polypeptides, together with pharmaceutically acceptable carriers.
Antisense oligonucleotides may be administered as part of a pharmaceutical composition. Such a pharmaceutical composition may include the antisense oligonucleotides in combination with any standard physiologically and/or pharmaceutically acceptable carriers which are known in the art. The compositions should be sterile and contain a therapeutically effective amount of the antisense oligonucleotides in a unit of weight or volume suitable for administration to a patient. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term "physiologically acceptable" refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. The characteristics of the carrier will depend on the route of administration.
Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art, as further described below.
As used herein, a "vector" may be any of a number of nucleic acids into which a desired sequence may be inserted by restriction and ligation for transport between different genetic environments or for expression in a host cell. Vectors are typically composed of DNA
although RNA vectors are also available. Vectors include, but are not limited to, plasmids, phagemids and virus genomes. A cloning vector is one which is able to replicate autonomously or integrated in the genone in a host cell, and which is further characterized by one or more endonuclease restriction sites at which the vector may be cut in a determinable fashion and into which a desired DNA sequence may be ligated such that the new recombinant vector retains its ability to replicate in the host cell. In the case of plasmids, replication of the desired sequence may occur many times as the plasmid increases in copy number within the host bacterium or just a single time per host before the host reproduces by mitosis. In the case of phage, replication may occur actively during a lytic phase or passively during a lysogenic phase. An expression vector is one into which a desired DNA
sequence may be inserted by restriction and ligation such that it is operably joined to regulatory sequences and may be expressed as an RNA transcript. Vectors may further contain one or more marker sequences suitable for use in the identification of cells which have or have not been transformed or transfected with the vector. Markers include, for example, genes encoding proteins which increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g.,13-galactosidase, luciferase or alkaline phosphatase), and genes which visibly affect the phenotype of transformed or transfected cells, hosts, colonies or plaques (e.g., green fluorescent protein). Preferred vectors are those capable of autonomous replication and expression of the structural gene products present in the DNA
segments to which they are operably joined.
As used herein, a coding sequence and regulatory sequences are said to be "operably"
joined when they are covalently linked in such a way as to place the expression or transcription of the coding sequence under the influence or control of the regulatory sequences. If it is desired that the coding sequences be translated into a functional protein, two DNA sequences are said to be operably joined if induction of a promoter in the S' regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not ( 1 ) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably joined to a coding sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
The precise nature of the regulatory sequences needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5' non-transcribed and 5' non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CART sequence, and the like.
Especially, such 5' non-transcribed regulatory sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined gene.
Regulatory sequences rnay also include enhancer sequences or upstream activator sequences as desired. The vectors of the invention may optionally include S' leader or signal sequences.
The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art.
Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning. A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. Cells are genetically engineered by the introduction into the cells of heterologous DNA (RNA) encoding a breast cancer associated antigen polypeptide or fragment or variant thereof. That heterologous DNA (RNA) is placed under operable control of transcriptional elements to permit the expression of the heterologous DNA
in the host cell.
Preferred systems for mRNA expression in mammalian cells are those such as pRc/CMV (available from Invitrogen, Carlsbad, CA) that contain a selectable marker such as a gene that confers 6418 resistance (which facilitates the selection of stably transfected cell lines) and the human cytomegalovirus (CMV) enhancer-promoter sequences.
Additionally, suitable for expression in primate or canine cell lines is the pCEP4 vector (Invitrogen), which contains an Epstein Barn Virus (EBV) origin of replication, facilitating the maintenance of plasmid as a multicopy extrachromosomal element. Another expression vector is the pEF-BOS plasmid containing the promoter of polypeptide Elongation Factor 1 a, which stimulates efficiently transcription in vitro. The plasmid is described by Mishizuma and Nagata (Nuc.
Acids Res. 18:5322, 1990), and its use in transfection experiments is disclosed by, for example, Demoulin (Mol. Cell. l3iol. 16:4710-4716, 1996). Still another preferred expression vector is an adenovirus, described by Stratford-Perricaudet, which is defective for E 1 and E3 proteins (J. Clin. Invest. 90:626-630, 1992). The use of the adenovirus as an Adeno.PlA
recombinant for the expression of an antigen is disclosed by Warnier et al., in intradermal injection in mice for immunization against P1A (Int. J. Cancer, 67:303-310, 1996).
Additional vectors for delivery of nucleic acid are provided below.
The invention also embraces so-called expression kits, which allow the artisan to prepare a desired expression vector or vectors. Such expression kits include at least separate portions of a vector and one or more of the previously discussed cancer associated antigen nucleic acid molecules. Other components may be added, as desired, as long as the previously mentioned nucleic acid molecules, which are required, are included. The invention also includes kits for amplification of a cancer associated antigen nucleic acid, including at least one pair of amplification primers which hybridize to a cancer associated antigen nucleic acid.
The primers preferably are 12-32 nucleotides in length and are non-overlapping to prevent formation of "primer-dimers". One of the primers will hybridize to one strand of the cancer associated antigen nucleic acid and the second primer will hybridize to the complementary strand of the cancer associated antigen nucleic acid, in an arrangement which permits amplification of the cancer associated antigen nucleic acid. Selection of appropriate primer pairs is standard in the art. For example, the selection can be made with assistance of a computer program designed for such a purpose, optionally followed by testing the primers fox amplification specificity and efficiency.
The invention also permits the construction of cancer associated antigen gene "knock-outs" in cells and in animals, providing materials for studying certain aspects of cancer and immune system responses to cancer.
The invention also provides isolated polypeptides (including whole proteins and partial proteins) encoded by the foregoing cancer associated antigen nucleic acids. Such polypeptides are useful, for example, alone or as fusion proteins to generate antibodies, as components of an immunoassay or diagnostic assay or as therapeutics. Cancer associated antigen polypeptides can be isolated from biological samples including tissue or cell homogenates, and can also be expressed recombinantly in a variety of prokaryotic and eukaryotic expression systems by constructing an expression vector appropriate to the expression system, introducing the expression vector into the expression system, and isolating the recombinantly expressed protein. Short polypeptides, including antigenic peptides (such as are presented by MHC molecules on the surface of a cell for immune recognition) also can be synthesized chemically using well-established methods of peptide synthesis.
A unique fragment of a cancer associated antigen polypeptide, in general, has the features and characteristics of unique fragments as discussed above in connection with nucleic acids. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon factors such as whether the fragment constitutes a portion of a conserved protein domain. Thus, some regions of cancer associated antigens will require longer segments to be unique while others will require only short segments, typically between 5 and 12 amino acids (e.g. S, 6, 7, 8, 9, 10, 11 or 12 or more amino acids including each integer up to the full length).
Unique fragments of a polypeptide preferably are those fragments which retain a distinct functional capability of the polypeptide. Functional capabilities which can be retained in a unique fragment of a polypeptide include interaction with antibodies, interaction with other polypeptides or fragments thereof, selective binding of nucleic acids or proteins, and enzymatic activity. One important activity is the ability to act as a signature for identifying the polypeptide. Another is the ability to complex with HLA and to provoke in a human an immune response. Those skilled in the art are well versed in methods for selecting unique amino acid sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from non-family members. A
comparison of the sequence of the fragment to those on known databases typically is all that is necessary.
The invention embraces variants of the cancer associated antigen polypeptides described above. As used herein, a "variant" of a cancer associated antigen polypeptide is a polypeptide which contains one or more modifications to the primary amino acid sequence of a cancer associated antigen polypeptide. Modifications which create a cancer associated antigen variant can be made to a cancer associated antigen polypeptide 1 ) to reduce or eliminate an activity of a cancer associated antigen polypeptide; 2) to enhance a property of a cancer associated antigen polypeptide, such as protein stability in an expression system or the stability of protein-protein binding; 3) to provide a novel activity or property to a cancer associated antigen polypeptide, such as addition of an antigenic epitope or addition of a detectable moiety; or 4) to provide equivalent or better binding to an HLA
molecule.
Modifications to a cancer associated antigen polypeptide are typically made to the nucleic acid which encodes the cancer associated antigen polypeptide, and can include deletions, point mutations, truncations, amino acid substitutions and additions of amino acids or non-amino acid moieties. Alternatively, modifications can be made directly to the polypeptide, such as by cleavage, addition of a linker molecule, addition of a detectable moiety, such as biotin, addition of a fatty acid, and the like. Modifications also embrace fusion proteins comprising all or part of the cancer associated antigen amino acid sequence. One of skill in the art will be familiar with methods for predicting the effect on protein conformation of a change in protein sequence, and can thus "design" a variant cancer associated antigen polypeptide according to known methods. One example of such a method is described by Dahiyat and Mayo in Science 278:82-87, 1997, whereby proteins can be designed de novo. The method can be applied to a known protein to vary a only a portion of the polypeptide sequence. By applying the computational methods of Dahiyat and Mayo, specific variants of a cancer associated antigen polypeptide can be proposed and tested to determine whether the variant retains a desired conformation.
In general, variants include cancer associated antigen polypeptides which are modified specifically to alter a feature of the polypeptide unrelated to its desired physiological activity.
For example, cysteine residues can be substituted or deleted to prevent unwanted disulfide linkages. Similarly, certain amino acids can be changed to enhance expression of a breast cancer associated antigen polypeptide by eliminating proteolysis by proteases in an expression system (e.g., dibasic amino acid residues in yeast expression systems in which KEX2 protease activity is present).
Mutations of a nucleic acid which encode a cancer associated antigen polypeptide preferably preserve the amino acid reading frame of the coding sequence, and preferably do not create regions in the nucleic acid which are likely to hybridize to form secondary structures, such a hairpins or Loops, which can be deleterious to expression of the variant polypeptide.
Mutations can be made by selecting an amino acid substitution, or by random mutagenesis of a selected site in a nucleic acid which encodes the polypeptide. Variant polypeptides are then expressed and tested for one or more activities to determine which mutation provides a variant polypeptide with the desired properties. Further mutations can be made to variants (or to non-variant cancer associated antigen polypeptides) which are silent as to the amino acid sequence of the polypeptide, but which provide preferred codons for translation in a particular host. The preferred codons for translation of a nucleic acid in, e.g., E coli, are well known to those of ordinary skill in the art. Still other mutations can be made to the noncoding sequences of a cancer associated antigen gene or cDNA clone to enhance expression of the polypeptide. The activity of variants of cancer associated antigen polypeptides can be tested by cloning the gene encoding the variant cancer associated antigen polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the variant cancer associated antigen polypeptide, and testing for a functional capability of the cancer associated antigen polypeptides as disclosed herein.
For example, the variant cancer associated antigen polypeptide can be tested for reaction with autologous or allogeneic sera as disclosed in the Examples. Preparation of other variant polypeptides may favor testing of other activities, as will be known to one of ordinary skill in the art.
The skilled artisan will also realize that conservative amino acid substitutions may be made in cancer associated antigen polypeptides to provide functionally equivalent variants of the foregoing polypeptides, i.e, the variants retain the functional capabilities of the cancer associated antigen polypeptides. As used herein, a "conservative amino acid substitution"
refers to an amino acid substitution which does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made.
Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art such as are found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York.
Exemplary functionally equivalent variants of the cancer associated antigen polypeptides include conservative amino acid substitutions of in the amino acid sequences of proteins disclosed herein. Conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H;
(d) A, G; (e) S, T;
(f) Q, N; and (g) E, D.
For example, upon determining that a peptide derived from a cancer associated antigen polypeptide is presented by an MHC molecule and recognized by CTLs (e.g., as described in the Examples), one can make conservative amino acid substitutions to the amino acid sequence of the peptide, particularly at residues which are thought not to be direct contact points with the MHC molecule. For example, methods for identifying functional variants of HLA class II binding peptides are provided in a published PCT application of Strominger and Wucherpfennig (PCT/US96/03182). Peptides bearing one or more amino acid substitutions also can be tested for concordance with known HLA/MHC motifs prior to synthesis using, e.g, the computer program described by D'Amaro and Drijfhout (D'Amaro et al., Human Immunol. 43:13-18, 1995; Drijfliout et al., Human Immunol. 43:1-12, 1995). The substituted peptides can then be tested for binding to the MHC molecule and recognition by CTLs when bound to MHC. These variants can be tested for improved stability and are useful, inter alia, in vaccine compositions.
Conservative amino-acid substitutions in the amino acid sequence of cancer associated antigen polypeptides to produce functionally equivalent variants of cancer associated antigen polypeptides typically are made by alteration of a nucleic acid encoding a cancer associated antigen polypeptide. Such substitutions can be made by a variety of methods known to one of ordinary skill in the art. For example, amino acid substitutions may be made by PCR-directed mutation, site-directed mutagenesis according to the method of Kunkel (Kunkel, Proc. Nat.
Acad. Sci. U.S.A. 82: 488-492, 1985), or by chemical synthesis of a gene encoding a cancer associated antigen polypeptide. Where amino acid substitutions are made to a small unique fragment of a cancer associated antigen polypeptide, such as an antigenic epitope recognized by autologous or allogeneic sera or cytolytic T lymphocytes, the substitutions can be made by directly synthesizing the peptide. The activity of fianctionally equivalent fragments of cancer associated antigen polypeptides can be tested by cloning the gene encoding the altered cancer associated antigen polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered cancer associated antigen polypeptide, and testing for a functional capability of the cancer associated antigen polypeptides as disclosed herein. Peptides which are chemically synthesized can be tested directly for function, e.g., for binding to antisera recognizing associated antigens.
The invention as described herein has a number of uses, some of which are described elsewhere herein. First, the invention permits isolation of the cancer associated antigen protein molecules. A variety of methodologies well-known to the skilled practitioner can be utilized to obtain isolated cancer associated antigen molecules. The polypeptide may be purified from cells which naturally produce the polypeptide by chromatographic means or immunological recognition. Alternatively, an expression vector may be introduced into cells to cause production of the polypeptide. In another method, mRNA transcripts may be microinjected or otherwise introduced into cells to cause production of the encoded polypeptide. Translation of mRNA in cell-free extracts such as the reticulocyte Iysate system also may be used to produce polypeptide. Those skilled in the art also can readily follow known methods for isolating cancer associated antigen polypeptides. These include, but are not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-exchange chromatography and immune-affinity chromatography.
The isolation and identification of cancer associated antigen genes also makes it possible for the artisan to diagnose a disorder characterized by expression of cancer associated antigens. These methods involve determining expression of one or more cancer associated antigen nucleic acids, and/or encoded cancer associated antigen polypeptides and/or peptides derived therefrom. In the former situation, such determinations can be carried out via any standard nucleic acid determination assay, including the polymerase chain reaction, or assaying with labeled hybridization probes. In the latter situation, such determinations can be carned out by screening patient antisera for recognition of the polypeptide.
The invention also makes it possible isolate proteins which bind to cancer associated antigens as disclosed herein, including antibodies and cellular binding partners of the cancer associated antigens. Additional uses are described further herein.
The invention also provides, in certain embodiments, "dominant negative"
polypeptides derived from cancer associated antigen polypeptides. A dominant negative polypeptide is an inactive variant of a protein, which, by interacting with the cellular machinery, displaces an active protein from its interaction with the cellular machinery or competes with the active protein, thereby reducing the effect of the active protein. For example, a dominant negative receptor which binds a ligand but does not transmit a signal in response to binding of the ligand can reduce the biological effect of expression of the ligand.
Likewise, a dominant negative cataIytically-inactive kinase which interacts normally with target proteins but does not phosphorylate the target proteins can reduce phosphorylation of the target proteins in response to a cellular signal. Similarly, a dominant negative transcription factor which binds to a promoter site in the control region of a gene but does not increase gene transcription can reduce the effect of a normal transcription factor by occupying promoter binding sites without increasing transcription.
The end result of the expression of a dominant negative polypeptide in a cell is a reduction in function of active proteins. One of ordinary skill in the art can assess the potential for a dominant negative variant of a protein, and using standard mutagenesis techniques to create one or more dominant negative variant polypeptides. For example, given the teachings contained herein of renal cancer associated antigens, especially those which are similar to known proteins which have known activities, one of ordinary skill in the art can modify the sequence of the cancer associated antigens by site-specific mutagenesis, scanning mutagenesis, partial gene deletion or truncation, and the like. See, e.g:, U.S. Patent No.
5,580,723 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. The skilled artisan then can test the population of mutagenized polypeptides for diminution in a selected and/or for retention of such an activity. Other similar methods for creating and testing dominant negative variants of a protein will be apparent to one of ordinary skill in the art.
The invention also involves agents such as polypeptides which bind to cancer associated antigen polypeptides. Such binding agents can be used, for example, in screening assays to detect the presence or absence of cancer associated antigen polypeptides and complexes of cancer associated antigen polypeptides and their binding partners and in purification protocols to isolated cancer associated antigen polypeptides and complexes of cancer associated antigen polypeptides and their binding partners. Such agents also can be used to inhibit the native activity of the cancer associated antigen polypeptides, for example, by binding to such palypeptides.
The invention, therefore, embraces peptide binding agents which, for example, can be antibodies ar fragments of antibodies having the ability to selectively bind to cancer associated antigen polypeptides. Antibodies include polyclonal and monoclonal antibodies, prepared according to conventional methodology.
Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunolo~y Wiley &
Sons, Inc., New York; Roitt, I. (1991) Essential Immunoloay, ~th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd.
The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation.
Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991 ). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDR3).
The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity.
It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody.
See, e.g., U.S. patents 4,816,567, 5,225,539, 5,585,089, 5,693,762 and 5,859,205.
Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized marine RSV antibodies in which at least a portion of the marine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as "chimeric" antibodies.
Thus, as will be apparent to one of ordinary skill in the art, the present invention also provides for F(ab')z, Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and/or FR
and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric F(ab')2 fragment antibodies in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and/or CDRI and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; and chimeric Fd fragment antibodies in which the FR and/or CDRI and/or CDR2 regions have been replaced by homologous human or non-human sequences. The present invention also includes so-called single chain antibodies.
Thus, the invention involves polypeptides of numerous size and type that bind specifically to cancer associated antigen polypeptides, and complexes of both cancer associated antigen polypeptides and their binding partners. These polypeptides may be derived also from sources other than antibody technology. For example, such polypeptide binding agents can be provided by degenerate peptide libraries which can be readily prepared in solution, in immobilized form or as phage display libraries. Combinatorial libraries also can be synthesized of peptides containing one or more amino acids. Libraries further can be synthesized of peptoids and non-peptide synthetic moieties.
Phage display can be particularly effective in identifying binding peptides useful according to the invention. Briefly, one prepares a phage library (using e.g.
m13, fd, or lambda phage), displaying inserts from 4 to about 80 amino acid residues using conventional procedures. The inserts may represent, for example, a completely degenerate or biased array.
One then can select phage-bearing inserts which bind to the cancer associated antigen polypeptide. This process can be repeated through several cycles of reselection of phage that bind to the cancer associated antigen polypeptide. Repeated rounds lead to enrichment of phage bearing particular sequences. DNA sequence analysis can be conducted to identify the sequences of the expressed polypeptides. The minimal linear portion of the sequence that binds to the cancer associated antigen polypeptide can be determined. One can repeat the procedure using a biased library containing inserts containing part or all of the minimal linear portion plus one or more additional degenerate residues upstream or downstream thereof.
Yeast two-hybrid screening methods also may be used to identify polypeptides that bind to the cancer associated antigen polypeptides. Thus, the cancer associated antigen polypeptides of the invention, or a fragment thereof, can be used to screen peptide libraries, including phage display libraries, to identify and select peptide binding partners of the cancer associated antigen polypeptides of the invention. Such molecules can be used, as described, for screening assays, for purification protocols, for interfering directly with the functioning of cancer associated antigen and for other purposes that will be apparent to those of ordinary skill in the art.
As detailed herein, the foregoing antibodies and other binding molecules may be used for example to identify tissues expressing protein or to purify protein.
Antibodies also may be coupled to specific diagnostic labeling agents for imaging of cells and tissues that express cancer associated antigens or to therapeutically useful agents according to standard coupling procedures. Diagnostic agents include, but are not limited to, barium sulfate, iocetamic acid.
iopanoic acid, ipodate calcium, diatrizoate sodium, diatrizoate meglumine, metrizamide, tyropanoate sodium and radiodiagnostics including positron emitters such as fluorine-I 8 and carbon-1 l, gamma emitters such as iodine-123, technitium-99m, iodine-131 and indium-111, nuclides for nuclear magnetic resonance such as fluorine and gadolinium. Other diagnostic agents useful in the invention will be apparent to one of ordinary skill in the art. As used herein, "therapeutically useful agents" include any therapeutic molecule which desirably is targeted selectively to a cell expressing one of the cancer antigens disclosed herein, including antineoplastic agents, radioiodinated compounds, toxins, other cytostatic or cytolytic drugs, and so forth. Antineoplastic therapeutics are well known and include:
aminoglutethimide, azathioprine, bleomycin sulfate, busulfan, carmustine, chlorambucil, cisplatin, cyclophosphamide, cyclosporine, cytarabidine, dacarbazine, dactinomycin, daunorubicin, doxorubicin, taxol, etoposide, fluorouracil, interferon-a, lomustine, mercaptopurine, methotrexate, mitotane, procarbazine HCI, thioguanine, vinblastine sulfate and vincristine sulfate. Additional antineoplastic agents include those disclosed in Chapter 52, Antineoplastic Agents (Paul Calabresi and Bruce A. Chabner), and the introduction thereto, 1202-1263, of Goodman and Gilman's "The Pharmacological Basis of Therapeutics", Eighth Edition, 1990, McGraw-Hill, Inc. (Health Professions Division). Toxins can be proteins such as, for example, pokeweed anti-viral protein, cholera toxin, pertussis toxin, ricin, gelonin, abrin, diphtheria exotoxin, or Pseudomonas exotoxin. Toxin moieties can also be high energy-emitting radionuclides such as cobalt-60.
In the foregoing methods, antibodies prepared according to the invention also preferably are specific for the renal cancer associated antigen/MHC complexes described herein.
When "disorder" is used herein, it refers to any pathological condition where the cancer associated antigens are expressed. An example of such a disorder is cancer, breast, colon, gastric, renal, prostate and lung cancers as particular examples.
Samples of tissue and/or cells for use in the various methods described herein can be obtained through standard methods such as tissue biopsy, including punch biopsy and cell scraping, and collection of blood or other bodily fluids by aspiration or other methods.
In certain embodiments of the invention, an immunoreactive cell sample is removed from a subject. By "immunoreactive cell" is meant a cell which can mature into an immune cell (such as a B cell, a helper T cell, or a cytolytic T cell) upon appropriate stimulation. Thus immunoreactive cells include CD34+ hematopoietic stem cells, immature T cells and immature B cells. When it is desired to produce cytolytic T cells which recognize a cancer associated antigen, the immunoreactive cell is contacted with a cell which expresses a cancer associated antigen under conditions favoring production, differentiation andlor selection of cytolytic T cells; the differentiation of the T cell precursor into a cytolytic T cell upon exposure to antigen is similar to clonal selection of the immune system.
Some therapeutic approaches based upon the disclosure are premised on a response by a subject's immune system, leading to lysis of antigen presenting cells, such as breast cancer cells which present one or more cancer associated antigens. One such approach is the administration of autologous CTLs specific to a cancer associated antigen/MHC
complex to a subject with abnormal cells of the phenotype at issue. It is within the ability of one of ordinary skill in the art to develop such CTLs in vitro. An example of a method for T cell differentiation is presented in International Application number PCT/US96/05607. Generally, a sample of cells taken from a subject, such as blood cells, are contacted with a cell presenting the complex and capable of provoking CTLs to proliferate. The target cell can be a transfectant, such as a COS cell. These transfectants present the desired complex of their surface and, when combined with a CTL of interest, stimulate its proliferation. COS cells are widely available, as are other suitable host cells. Specific production of CTL
clones is well known in the art. The clonally expanded autologous CTLs then are administered to the subject.
Another method for selecting antigen-specific CTL clones has recently been described (Altman et al., Science 274:94-96, 1996; Dunbar et al., Curr. Biol. 8:413-416, 1998), in which fluorogenic tetramers of MHC class I molecule/peptide complexes are used to detect specific CTL clones. Briefly, soluble MHC class I molecules are folded in vitro in the presence of (3,-microglobulin and a peptide antigen which binds the class I molecule. After purification, the MHC/peptide complex is purified and labeled with biotin. Tetramers are formed by mixing the biotinylated peptide-MHC complex with labeled avidin (e.g. phycoerythrin) at a molar ratio or 4: I . Tetramers are then contacted with a source of CTLs such as peripheral blood or lymph node. The tetramers bind CTLs which recognize the peptide antigen/MHC
class I
complex. Cells bound by the tetramers can be sorted by fluorescence activated cell sorting to isolate the reactive CTLs. The isolated CTLs then can be expanded in vitro for use as described herein.
To detail a therapeutic methodology, referred to as adoptive transfer (Greenberg, J.
Immunol. 136(5): 1917, 1986; Riddel et al., Science 257: 238, 1992; Lynch et al, Eur. J.
Immunol. 21: 1403-1410,1991; Kast et al., Cell 59: 603-614, 1989), cells presenting the desired complex (e.g., dendritic cells) are combined with CTLs leading to proliferation of the CTLs specific thereto. The proliferated CTLs are then administered to a subject with a cellular abnormality which is characterized by certain of the abnormal cells presenting the particular complex. The CTLs then lyse the abnormal cells, thereby achieving the desired therapeutic goal.
The foregoing therapy assumes that at least some of the subject's abnormal cells present the relevant HLA/cancer associated antigen complex. This can be determined very easily, as the art is very familiar with methods for identifying cells which present a particular HLA molecule, as well as how to identify cells expressing DNA of the pertinent sequences, in this case a cancer associated antigen sequence. Once cells presenting the relevant complex are identified via the foregoing screening methodology, they can be combined with a sample from a patient, where the sample contains CTLs. If the complex presenting cells are lysed by the mixed CTL sample, then it can be assumed that a cancer associated antigen is being presented, and the subject is an appropriate candidate for the therapeutic approaches set forth supra.
Adoptive transfer is not the only form of therapy that is available in accordance with the invention. CTLs can also be provoked in vivo, using a number of approaches. One approach is the use of non-proliferative cells expressing the complex. The cells used in this approach may be those that normally express the complex, such as irradiated tumor cells or cells transfected with one or both of the genes necessary for presentation of the complex (i.e.
the antigenic peptide and the presenting HLA molecule). Chen et al. (Proc.
Natl. Acad. Sci.
USA 88: 110-114,1991) exemplifies this approach, showing the use of transfected cells expressing HPVE7 peptides in a therapeutic regime. Various cell types may be used.
Similarly, vectors carrying one or both of the genes of interest may be used.
Viral or bacterial vectors are especially preferred. For example, nucleic acids which encode a cancer associated antigen polypeptide or peptide may be operably linked to promoter and enhancer sequences which direct expression of the cancer associated antigen polypeptide or peptide in certain tissues or cell types. The nucleic acid may be incorporated into an expression vector.
Expression vectors may be unmodified extrachromosornal nucleic acids, plasmids or viral genomes constructed or modified to enable insertion of exogenous nucleic acids, such as those encoding cancer associated antigen, as described elsewhere herein. Nucleic acids encoding a cancer associated antigen also may be inserted into a retroviral genome, thereby facilitating integration of the nucleic acid into the genome of the target tissue or cell type. In these systems, the gene of interest is carried by a microorganism, e.g., a Vaccinia virus, pox virus, herpes simplex virus, retrovirus or adenovirus, and the materials de facto "infect" host cells.
The cells which result present the complex of interest, and are recognized by autologous CTLs, which then proliferate.
A similar effect can be achieved by combining the cancer associated antigen or a stimulatory fragment thereof with an adjuvant to facilitate incorporation into antigen presenting cells in vivo. The cancer associated antigen polypeptide is processed to yield the peptide partner of the HLA molecule while a cancer associated antigen peptide may be presented without the need for further processing. Generally, subjects can receive an intradermal injection of an effective amount of the cancer associated antigen.
Initial doses can be followed by booster doses, following immunization protocols standard in the art. Preferred cancer associated antigens include those found to react with allogeneic cancer antisera, shown in the examples below.
The invention involves the use of various materials disclosed herein to "immunize"
subjects or as "vaccines". As used herein, "immunization" or "vaccination"
means increasing or activating an immune response against an antigen. It does not require elimination or eradication of a condition but rather contemplates the clinically favorable enhancement of an immune response toward an antigen. Generally accepted animal models can be used for testing of immunization against cancer using a cancer associated antigen nucleic acid. For example, human cancer cells can be introduced into a mouse to create a tumor, and one or more cancer associated antigen nucleic acids can be delivered by the methods described herein. The effect on the cancer cells (e.g., reduction of tumor size) can be assessed as a measure of the effectiveness of the cancer associated antigen nucleic acid immunization. Of course, testing of the foregoing animal model using more conventional methods for immunization include the administration of one or more cancer associated antigen polypeptides or peptides derived therefrom, optionally combined with one or more adjuvants and/or cytokines to boost the immune response. Methods for immunization, including formulation of a vaccine composition and selection of doses, route of administration and the schedule of administration (e.g. primary and one or more booster doses), are well known in the art. The tests also can be performed in humans, where the end point is to test for the presence of enhanced levels of circulating CTLs against cells bearing the antigen, to test for levels of circulating antibodies against the antigen, to test for the presence of cells expressing the antigen and so forth.
As part of the immunization compositions, one or more cancer associated antigens or stimulatory fragments thereof are administered with one or more adjuvants to induce an immune response or to increase an immune response. An adjuvant is a substance incorporated into or administered with antigen which potentiates the immune response.
Adjuvants may enhance the immunological response by providing a reservoir of antigen (extracellularly or within macrophages), activating macrophages and stimulating specific sets of lymphocytes.
Adjuvants of many kinds are well known in the art. Specific examples of adjuvants include monophosphoryl lipid A (MPL, SmithKline Beecham), a congener obtained after purification and acid hydrolysis of Salmonella minnesota Re 595 lipopolysaccharide;
saponins including QS21 (SmithKline Beecham), a pure QA-21 saponin purified from Quillja saponaria extract;
DQS21, described in PCT application W096/33739 (SmithKline Beecham); QS-7, QS-17, QS-18, and QS-L1 (So et al., Mol. Cells 7:178-186, 1997); incomplete Freund's adjuvant;
complete Freund's adjuvant; montanide; and various water-in-oil emulsions prepared from biodegradable oils such as squalene and/or tocopherol. Preferably, the peptides are administered mixed with a combination of DQS21 /MPL. The ratio of DQS21 to MPL
typically will be about 1:10 to 10:1, preferably about 1:5 to 5:1 and more preferably about I :1.
Typically for human administration, DQS21 and MPL will be present in a vaccine formulation in the range of about 1 p,g to about 100 p.g. Other adjuvants are known in the art and can be used in the invention {see, e.g. Goding, Monoclonal Antibodies:
Principles and Practice, 2nd Ed., 1986). Methods for the preparation of mixtures or emulsions of peptide and adjuvant are well known to those of skill in the art of vaccination.
Other agents which stimulate the immune response of the subject can also be administered to the subject. For example, other cytokines are also useful in vaccination protocols as a result of their lymphocyte regulatory properties. Many other cytokines useful for such purposes will be known to one of ordinary skill in the art, including interleukin-12 (IL-12) which has been shown to enhance the protective effects of vaccines (see, e.g., Science 268: 1432-1434, 1995), GM-CSF and IL-18. Thus cytokines can be administered in conjunction with antigens and adjuvants to increase the immune response to the antigens.
There are a number of immune response potentiating compounds that can be used in vaccination protocols. These include costimulatory molecules provided in either protein or nucleic acid form. Such costimulatory molecules include the B7-l and B7-2 (CD80 and CD86 respectively) molecules which are expressed on dendritic cells (DC) and interact with the CD28 molecule expressed on the T cell. This interaction provides costimulation (signal 2) to an antigen/MHC/TCR stimulated (signal 1 ) T cell, increasing T cell proliferation and effector function. B7 also interacts with CTLA4 (CD 152) on T cells and studies involving CTLA4 and B7 ligands indicate that the B7-CTLA4 interaction can enhance antitumor immunity and CTL proliferation (Zheng P., et al. Proc. Natl. Acad. Sci. USA 95 ( 11 ):6284-6289 ( 1998)).
B7 typically is not expressed on tumor cells so they are not efficient antigen presenting cells (APCs) for T cells. Induction of B7 expression would enable the tumor cells to stimulate more efficiently CTL proliferation and effector function. A combination of costimulation has been shown to induce IFN-gamma and a Thl cytokine profile in the T cell population leading to further enhanced T cell activity (Gajewski et al., J.
Immunol, 154:5637-5648 (1995)). Tumor cell transfection with B7 has ben discussed in relation to in vitro CTL
expansion for adoptive transfer immunotherapy by Wang et al., (J. Immunol. , 19:1-8 ( 1986)).
Other delivery mechanisms for the B7 molecule would include nucleic acid (naked DNA) immunization (Kim J., et al. Nat Biotechnol., 15:7:641-646 (1997)) and recombinant viruses such as adeno and pox (Wendtner et al., Gene Ther., 4:7:726-735 (1997)). These systems are all amenable to the construction and use of expression cassettes for the coexpression of B7 with other molecules of choice such as the antigens or fragments) of antigens discussed herein (including polytopes) or cytokines. These delivery systems can be used for induction of the appropriate molecules in vitro and for in vivo vaccination situations.
The use of anti-CD28 antibodies to directly stimulate T cells in vitro and in vivo could also be considered.
Similarly, the inducible co-stimulatory molecule ICOS which induces T cell responses to foreign antigen could be modulated, for example, by use of anti-ICOS
antibodies (Hutloff et al., Nature 397:263-266, 1999).
Lymphocyte function associated antigen-3 (LFA-3) is expressed on APCs and some tumor cells and interacts with CD2 expressed on T cells. This interaction induces T cell IL-2 and IFN-gamma production and can thus complement but not substitute, the costimulatory interaction (Parra et al., J. Immunol., 158:637-642 (1997), Fenton et al., J.
Immunother., 21:2:95-108 (1998)).
Lymphocyte function associated antigen-1 (LFA-1 ) is expressed on leukocytes and interacts with ICAM-1 expressed on APCs and some tumor cells. This interaction induces T
cell IL-2 and IFN-gamma production and can thus complement but not substitute, the B7/CD28 costimulatory interaction (Fenton et al., J. Immunother., 21:2:95-108 (1998)).
LFA-1 is thus a further example of a costimulatory molecule that could be provided in a vaccination protocol in the various ways discussed above for B7.
Complete CTL activation and effector function requires Th cell help through the interaction between the Th cell CD40L (CD40 ligand) molecule and the CD40 molecule expressed by DCs (Ridge et al., Nature, 393:474 (1998), Bennett et al., Nature, 393:478 (1998), Schoenberger et al., Nature, 393:480 (1998)). This mechanism of this costimulatory signal is likely to involve upregulation of B7 and associated IL-6/IL-12 production by the DC
(APC). The CD40-CD40L interaction thus complements the signal 1 (antigen/MHC-TCR) and signal 2 (B7-CD28) interactions.
The use of anti-CD40 antibodies to stimulate DC cells directly, would be expected to enhance a response to tumor antigens which are normally encountered outside of a inflammatory context or are presented by non-professional APCs (tumor cells).
In these situations Th help and B7 costimulation signals are not provided. This mechanism might be used in the context of antigen pulsed DC based therapies or in situations where Th epitopes have not been defined within known TRA precursors.
A cancer associated antigen polypeptide, or a fragment thereof, also can be used to isolate their native binding partners. Isolation of such binding partners may be performed according to well-known methods. For example, isolated cancer associated antigen polypeptides can be attached to a substrate (e.g., chromatographic media, such as polystyrene beads, or a filter), and then a solution suspected of containing the binding partner may be applied to the substrate. If a binding partner which can interact with cancer associated antigen polypeptides is present in the solution, then it will bind to the substrate-bound cancer associated antigen polypeptide. The binding partner then may be isolated.
It will also be recognized that the invention embraces the use of the cancer associated antigen cDNA sequences in expression vectors, as well as to transfect host cells and cell lines, be these prokaryotic (e.g., E coli), or eukaryotic (e.g., dendritic cells, B
cells, CHO cells, COS cells, yeast expression systems and recombinant baculovirus expression in insect cells).
Especially useful are mammalian cells such as human, mouse, hamster, pig, goat, primate, etc.
They may be of a wide variety of tissue types, and include primary cells and cell lines.
Specific examples include keratinocytes, peripheral blood leukocytes, bone marrow stem cells and embryonic stem cells. The expression vectors require that the pertinent sequence, i.e., those nucleic acids described supra, be operably linked to a promoter.
The invention also contemplates delivery of nucleic acids, polypeptides or peptides for vaccination. Delivery of polypeptides and peptides can be accomplished according to standard vaccination protocols which are well known in the art. In another embodiment, the delivery of nucleic acid is accomplished by ex vivo methods, i.e. by removing a cell from a subject, genetically engineering the cell to include a breast cancer associated antigen, and reintroducing the engineered cell into the subject. One example of such a procedure is outlined in U.S. Patent 5,399,346 and in exhibits submitted in the file history of that patent, all of which are publicly available documents. In general, it involves introduction in vitro of a functional copy of a gene into a cells) of a subject, and returning the genetically engineered cells) to the subject. The functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell(s). Numerous transfection and transduction techniques as well as appropriate expression vectors are well known to those of ordinary skill in the art, some of which are described in PCT application W095/00654. In vivo nucleic acid delivery using vectors such as viruses and targeted liposomes also is contemplated according to the invention.
In preferred embodiments, a virus vector for delivering a nucleic acid encoding a cancer associated antigen is selected from the group consisting of adenoviruses, adeno-associated viruses, poxviruses including vaccinia viruses and attenuated poxviruses, Semliki Forest virus, Venezuelan equine encephalitis virus, retroviruses, Sindbis virus, and Ty virus-like particle. Examples of viruses and virus-like particles which have been used to deliver exogenous nucleic acids include: replication-defective adenoviruses (e.g., Xiang et al., Virology 219:220-227, 1996; Eloit et al., J. Virol. 7:5375-5381, 1997;
Chengalvala et al., Vaccine 15:335-339, 1997), a modified retrovirus (Townsend et al., J. Virol.
71:3365-3374, 1997), a nonreplicating retrovirus (Irwin et al., J virol. 68:5036-5044, 1994), a replication defective Semliki Forest virus (Zhao et al., Proc. Natl. Acad Sci. USA 92:3009-3013, 1995), canarypox virus and highly attenuated vaccinia virus derivative (Paoletti, Proc. Natl. Acad.
Sci. USA 93:11349-I 1353, 1996), non-replicative vaccinia virus (Moss, Proc.
Natl. Acad Sci.
USA 93:11341-11348, 1996), replicative vaccinia virus (Moss, Dev. Binl. Stand.
82:55-63.
1994), Venzuelan equine encephalitis virus (Davis et al., J. Virol. 70:3781-3787, 1996), Sindbis virus (Pugachev et al., Virology 212:587-594, 1995), and Ty virus-like particle (Allsopp et al., Eur. J. Immunol 26:1951-1959, 1996). In preferred embodiments, the virus vector is an adenovirus.
Another preferred virus for certain applications is the adeno-associated virus, a double-stranded DNA virus. The adeno-associated virus is capable of infecting a wide range of cell types and species and can be engineered to be replication-deficient. It further has advantages, such as heat and lipid solvent stability, high transduction frequencies in cells of diverse lineages, including hematopoietic cells, and lack of superinfection inhibition thus allowing multiple series of transductions. The adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion.
In general, other preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
Adenoviruses and retroviruses have been approved for human gene therapy trials. In general, the retroviruses axe replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retrovirai expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., "Gene Transfer and Expression, A
Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry, E.J. Ed.
"Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey ( 1991 ).
Preferably the foregoing nucleic acid delivery vectors: ( 1 ) contain exogenous genetic material that can be transcribed and translated in a mammalian cell and that can induce an immune response in a host, and (2) contain on a surface a ligand that selectively binds to a receptor on the surface of a target cell, such as a mammalian cell, and thereby gains entry to the target cell.
Various techniques may be employed for introducing nucleic acids of the invention into cells, depending on whether the nucleic acids are introduced in vitro or in vivo in a host.
Such techniques include transfection of nucleic acid-CaP04 precipitates, transfection of nucleic acids associated with DEAF, transfection or infection with the foregoing viruses including the nucleic acid of interest, liposome mediated transfection, and the like. For certain uses, it is preferred to target the nucleic acid to particular cells.
In such instances, a vehicle used for delivering a nucleic acid of the invention into a cell (e.g., a retrovirus, or other virus; a liposome) can have a targeting molecule attached thereto. For example, a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be bound to or incorporated within the nucleic acid delivery vehicle. Preferred antibodies include antibodies which selectively bind a cancer associated antigen, alone or as a complex with a MHC molecule. Especially preferred are monoclonal antibodies. Where liposomes are employed to deliver the nucleic acids of the invention, proteins which bind to a surface membrane protein associated with endocytosis may be incorporated into the liposome formulation for targeting and/or to facilitate uptake.
Such proteins include capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half life, and the like.
Polymeric delivery systems also have been used successfully to deliver nucleic acids into cells, as is known by those skilled in the art. Such systems even permit oral delivery of nucleic acids.
When administered, the therapeutic compositions of the present invention can be administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents.
The therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, or transdermal.
When antibodies are used therapeutically, a preferred route of administration is by pulmonary aerosol. Techniques for preparing aerosol delivery systems containing antibodies are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the antibodies, such as the paratope binding capacity (see, for example, Sciarra and Cutie, "Aerosols," in Remin ton's Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712; incorporated by reference).
Those of skill in the art can readily determine the various parameters and conditions for producing antibody aerosols without resort to undue experimentation. When using antisense preparations of the invention, slow intravenous administration is preferred.
The compositions of the invention are administered in effective amounts. An "effective amount" is that amount of a cancer associated antigen composition that alone, or together with further doses, produces the desired response, e.g. increases an immune response to the cancer associated antigen. In the case of treating a particular disease or condition characterized by expression of one or more cancer associated antigens, such as renal cancer, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods or can be monitored according to diagnostic methods of the invention discussed herein. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.
Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of cancer associated antigen or nucleic acid encoding cancer associated antigen for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining the immune response following administration of the cancer associated antigen composition via a reporter system by measuring downstream effects such as gene expression, or by measuring the physiological effects of the cancer associated antigen composition, such as regression of a tumor or decrease of disease symptoms. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response.
The doses of cancer associated antigen compositions (e.g., polypeptide, peptide, antibody, cell or nucleic acid) administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment.
In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
In general, for treatments for eliciting or increasing an immune response, doses of cancer associated antigen are formulated and administered in doses between 1 ng and 1 mg, and preferably between 10 ng and 100 p.g, according to any standard procedure in the art.
Where nucleic acids encoding cancer associated antigen of variants thereof are employed, doses of between 1 ng and 0.1 mg generally will be formulated and administered according to standard procedures. Other protocols for the administration of cancer associated antigen compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration (e.g., intra-tumoral) and the like vary from the foregoing. Administration of cancer associated antigen compositions to mammals other than humans, e.g. for testing purposes or veterinary therapeutic purposes, is carried out under substantially the same conditions as described above.
Where cancer associated antigen peptides are used for vaccination, modes of administration which effectively deliver the cancer associated antigen and adjuvant, such that an immune response to the antigen is increased, can be used. For administration of a cancer associated antigen peptide in adjuvant, preferred methods include intradermal, intravenous, intramuscular and subcutaneous administration. Although these are preferred embodiments, the invention is not limited by the particular modes of administration disclosed herein.
Standard references in the art (e.g., Remington's Pharmaceutical Sciences, 18th edition, 1990) provide modes of administration and formulations for delivery of immunogens with adjuvant or in a non-adjuvant carrier.
When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, malefic, acetic, salicylic, citric, formic, malonic, succinic, and the like.

Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
A renal cancer associated antigen composition may be combined, if desired, with a pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
The pharmaceutical compositions may contain suitable buffering agents, including:
acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
The pharmaceutical compositions may canveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy.
All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of breast cancer associated antigen polypeptides or nucleic acids, which is preferably isotonic with the blood of the recipient.
This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc.
administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art. An isolated nucleic acid as used herein is not a naturally occurring chromosome.
As used herein with respect to polypeptides, "isolated'' means separated from its native environment and present in sufficient quantity to permit its identification or use. Isolated, when referring to a protein or polypeptide, means, for example: (i) selectively produced by expression cloning or (ii) purified as by chromatography or electrophoresis.
Isolated proteins or polypeptides may, but need not be, substantially pure. The term "substantially pure" means that the proteins or polypeptides are essentially free of other substances with which they may be found in nature or in vivo systems to an extent practical and appropriate for their intended use. Substantially pure polypeptides may be produced by techniques well known in the art.
Because an isolated protein may be admixed with a pharmaceutically acceptable carrier in a pharmaceutical preparation, the protein may comprise only a small percentage by weight of the preparation. The protein is nonetheless isolated in that it has been separated from the substances with which it may be associated in living systems, i.e. isolated from other proteins.

Examples Example 1: SEREX screenins of renal cancer cell line 1973/10 4 A standard cDNA library was prepared using S p.g of poly A+ RNA derived from the cell line 1973/10.4. A primary (unamplified) cDNA library was immunoscreened (5 x 105 clones per library) by standard SEREX methodology, with absorbed autologous patient serum at 1:200 dilution [Sahin, U. et al., Proc Natl Acad Sci USA 92:11810-3 (1995);
Chen, Y.T. et al. Proc Natl Acad Sci USA. 94:1914-8 (1997)].. Excluding false-positive clones encoding immunoglobulin gene fragments, clones were purified and sequence analyzed.
Comparisons of the sequences showed that these clones represented cDNAs from 22 distinct genes, designated NY-REN-45 through NY-LU-66 (Table A and Sequence Listing (SEQ ID
NOs: l -21)). A homology search through the GenBank/EMBO databases revealed that 14 of the 22 genes corresponded to previously known molecules, and 8 others were unknown genes, with sequence identity limited only to short segments of known genes or to expressed sequence tags (ESTs).
Analysis of isolated clones:
I. NY-REN clones which are known gene products Designation Gene/Sequence IdentityAccession SEQ ID
Number NO

NY-REN-46 lactate dehydrogenaseY00711 22 B

NY-REN-47 EItK tyrosine kinaseD31661 23 NY-REN-48 PINCH protein 009284 24 NY-REN-52 steroid receptor 059302 26 coactivator NY-REN-53 KIAA0336 mltNA tag AB002334 27 NY-REN-54 E6 oncogenic protein-X98033 28 associated protein NY-REN-55 murine NEK1 protein545828 29 kinase homologue - SI -NY-REN-56 6-phospho-fructokinaseD49817 30 NY-REN-59 lactate dehydrogenaseX02152 31 A

NY-REN-61 KIAA0081 mRNA tag D42039 32 NY-REN-63 DDB p127-associatedAF035950 33 protein NY-REN-65 HREV 107 protein X92814 34 NY-REN-66 acidic ribosomal M 17887 35 phosphoprotein 2 II. Novel gene products Clone SEO ID Size Tissue mRNA expressionProtein SEO ID
NO: NO

:

NY-REN-451 4.0kbUbiquitous 12 NY-REN-492 1. Ubiquitous 13 I
kb NY-REN-503 l.8kbUbiquitous 14 NY-REN-574,5 2.9kbUbiquitous 15, 16 NY-REN-586 l.9kbUbiquitous 17 NY-REN-607 4.OkbUbiquitous I g NY-REN-628,9 2.7kbUbiquitous 19, 20 NY-REN-6410,11 3.OkbUbiquitous 21 III. Clones which react with autologous sera only:

NY-REN-SO
IV. Clones which react with sera from normal control donors Frequency of sera reactivity Clone normal cancer patient V. Clones which react with sera from cancer patients only (failed to react with 19 normal patient serum samples). These clones are preferred for therapeutic and diagnostic applications.
Frequency of reactivi~

VI. Additional allogeneic screening of NY-REN renal SEREX clones Renal SEREX clones were tested for reactivity with sera from the normal and various cancer patients listed below.
Sera Clone normal colon renal lung breast Example 2: SEREX screening of tumor cells and testis libraries Standard cDNA libraries were prepared using poly A+ RNA derived from the various cancer sources, as well as testis. The cDNA libraries were immunoscreened by standard SEREX methodology, with absorbed autologous patient serum [Sahin, U. et al., Proc Natl Acad Sci USA 92:11810-3 (1995); Chen, Y.T. et al. Proc Natl Acad Sci USA.
94:1914-8 (1997)]. Excluding false-positive clones encoding immunoglobulin gene fragments, clones were purified and sequence analyzed. Comparisons of the sequences showed that these clones all were substantially identical to the kinectin cDNA (GenBank Accession number L25616).
Table A: Kinectin clones isolated by SEREX
Clone designationSEQID NO Library Patient sera for screen NGO-St-47 36 Gastric tumor autologous TS-64-5' 3 7 Testis seminoma HOM-TSOv3-41 38 Testis seminoma (5') HOM-TSOv3-41 39 Testis seminoma (3') HOM-HD2-2(3') 40 Hodgkin's diseaseautologous HOM-HD2-232(3')41 Hodgkin's diseaseautologous Thy4 (3') 42 Thyroid tumor autologous Thy4 (3') 42 Thyroid tumor autologous ThyS (3') 43 Thyroid tumor autologous Thy8 (3 ) 44 Thyroid tumor autologous ThylO (3') 45 Thyroid tumor autologous NGO-Br-1 46 Breast cancer autologous In addition, a hepatocarcinoma library screened with autologous sera also identified several clones which were sequenced and found to be substantially identical to kinectin.
Allotvpi~(gastric cancer 12/12 gastric cancer patient sera recognized kinectin 0/27 normal individual sera recognized kinectin Therefore it was determined that recognition of kinectin was diagnostic for cancer patients.
Example 3: Preparation of recombinant cancer associated antigens To facilitate screening of patients' sera fox antibodies reactive with cancer associated antigens, for example by ELISA, recombinant proteins are prepared according to standard procedures. In one method, the clones encoding cancer associated antigens are subcloned into a baculovirus expression vector, and the recombinant expression vectors are introduced into appropriate insect cells. Baculovirus/insect cloning systems are preferred because post-translational modifications are carried out in the insect cells. Another preferred eukaryotic system is the Drosophila Expression System from Invitrogen. Clones which express high amounts of the recombinant protein are selected and used to produce the recombinant proteins. The recombinant proteins are tested for antibody recognition using serum from the patient which was used to isolated the particular clone, or in the case of cancer associated antigens recognized by allogeneic sera, by the sera from any of the patients used to isolate the clones or sera which recognize the clones' gene products.
Alternatively, the cancer associated antigen clones are inserted into a prokaryotic expression vector for production of recombinant proteins in bacteria. Other systems, including yeast expression systems and mammalian cell culture systems also can be used.
Example 4: Preparation of antibodies to cancer associated antigens The recombinant cancer associated antigens produced as in Example 4 above are used to generate polyclonal antisera and monoclonal antibodies according to standard procedures.
The antisera and antibodies so produced are tested for correct recognition of the cancer associated antigens by using the antiseralantibodies in assays of cell extracts of patients known to express the particular cancer associated antigen (e.g. an ELISA
assay). These antibodies can be used for experimental purposes (e.g. localization of the cancer associated antigens, immunoprecipitations, Western blots, etc.) as well as diagnostic purposes (e.g., testing extracts of tissue biopsies, testing for the presence of cancer associated antigens).
Example 5: Expression of cancer associated antigens in cancers of similar and different origin.
The expression of one or more of the cancer associated antigens is tested in a range of tumor samples to determine which, if any, other malignancies should be diagnosed and/or treated by the methods described herein. Tumor cell lines and tumor samples are tested for cancer associated antigen expression, preferably by RT-PCR according to standard procedures. Northern blots also are used to test the expression of the cancer associated antigens. Antibody based assays, such as ELISA and western blot, also can be used to determine protein expression. A preferred method of testing expression of cancer associated antigens (in other cancers and in additional same type cancer patients) is allogeneic serotyping using a modified SEREX protocol (as described above).
In all of the foregoing, extracts from the tumors of patients who provided sera for the initial isolation of the cancer associated antigens are used as positive controls. The cells containing recombinant expression vectors described in the Examples above also can be used as positive controls.
The results generated from the foregoing experiments provide panels of multiple cancer associated nucleic acids and/or polypeptides for use in diagnostic (e.g. determining the existence of cancer, determining the prognosis of a patient undergoing therapy, etc.) and therapeutic methods (e.g., vaccine composition, etc.).
Example 6: HLA typing of patients positive for cancer associated antigens To determine which HLA molecules present peptides derived from the cancer associated antigens of the invention, cells of the patients which express the cancer associated antigens are HLA typed. Peripheral blood lymphocytes are taken from the patient and typed for HLA class I or class II, as well as for the particular subtype of class I
or class II. Tumor biopsy samples also can be used for typing. HLA typing can be carried out by any of the standard methods in the art of clinical immunology, such as by recognition by specific monoclonal antibodies, or by HLA allele-specific PCR (e.g. as described in W097/31126).
Example 7: Characterization of cancer associated antigen peptides presented by MHC
class I and class II molecules.
Antigens which provoke an antibody response in a subject may also provoke a cell-mediated immune response. Cells process proteins into peptides for presentation on MHC
class I or class II molecules on the cell surface for immune surveillance.
Peptides presented by certain MHC/HLA molecules generally conform to motifs. These motifs are known in some cases, and can be used to screen the renal cancer associated antigens for the presence of potential class I and/or class II peptides. Summaries of class I and class II
motifs have been published (e.g., Rammensee et al., Immunogenetics 41:178-228, 1995). Based on the results of experiments such as those described above, the HLA types which present the individual breast cancer associated antigens are known. Motifs of peptides presented by these HLA
molecules thus are preferentially searched.
One also can search for class I and class II motifs using computer algorithms.
For example, computer programs for predicting potential CTL epitopes based on known class I
motifs has been described (see, e.g., Parker et al, J. Immunol. 152:163, 1994;
D'Amaro et al., Human Immunol. 43:13-18, 1995; Drijfhout et al., Human Immunol. 43:1-12, 1995).
Computer programs for predicting potential T cell epitopes based on known class II motifs has also been described (see, e.g Sturniolo et al., Nat Biotechnol 17(6):555-61, 1999). HLA
binding predictions can conveniently be made using an algorithm available via the Internet on the National Institutes of Health World Wide Web site at URL
http://bimas.dcrt.nih.~ov . See also the website of: SYFPEITHI: An Internet Database for MHC Ligands and Peptide Motifs (access via http://www.uni-tuebingen.de/uni/kxi/ or httn://134.2.96.221/scripts/hlaserver dll/EpPredict htm. Methods for determining HLA class II peptides and making substitutions thereto are also known (e.g. Strominger and Wucherpfennig (PCT/US96/03182)).

Example 8: Identification of the portion of a cancer associated poIypeptide encoding an antigen To determine if the cancer associated antigens isolated as described above can provoke a cytolytic T lymphocyte response, the following method is performed. CTL
clones are generated by stimulating the peripheral blood lymphocytes (PBLs) of a patient with autologous normal cells transfected with one of the clones encoding a cancer associated antigen polypeptide or with irradiated PBLs loaded with synthetic peptides corresponding to the putative protein and matching the consensus for the appropriate HLA class I molecule (as described above) to localize an antigenic peptide within the cancer associated antigen clone (see, e.g., Knuth et al., Proc. Natl. Acad. Sci. USA 81:3511-3515, 1984; van der Bruggen et al., Eur. J. Immuno1.24:3038-3043, 1994). These CTL clones are screened for specificity against COS cells transfected with the cancer associated antigen clone and autologous HLA
alleles as described by Brichard et al. (Eur. J. Immunol. 26:224-230, 1996).
CTL recognition of a cancer associated antigen is determined by measuring release of TNF from the cytolytic T
lymphocyte or by 5'Cr release assay (Herin et al., Int. J. Cancer 39:390-396, 1987). If a CTL
clone specifically recognizes a transfected COS cell, then shorter fragments of the cancer associated antigen clone transfected in that COS cell are tested to identify the region of the gene that encodes the peptide. Fragments of the cancer associated antigen clone are prepared by exonuclease III digestion or other standard molecular biology methods.
Synthetic peptides are prepared to confirm the exact sequence of the antigen.
Optionally, shorter fragments of cancer associated antigen cDNAs are generated by PCR. Shorter fragments are used to provoke TNF release or 5'Cr release as above.
Synthetic peptides corresponding to portions of the shortest fragment of the cancer associated antigen clone which provokes TNF release are prepared.
Progressively shorter peptides are synthesized to determine the optimal cancer associated antigen tumor rejection antigen peptides for a given HLA molecule.
A similar method is performed to determine if the cancer associated antigen contains one or more HLA class II peptides recognized by T cells. One can search the sequence of the cancer associated antigen polypeptides for HLA class II motifs as described above. In contrast to class I peptides, class II peptides are presented by a limited number of cell types.
Thus for these experiments, dendritic cells or B cell clones which express HLA
class II
molecules preferably are used.

Table 1: Sequence homologies SEQ ID NO.: 1 AB002799, U46118RNU46118U19482AF026216AB002739, AB002730, AB002728, AF058796, AB002777, AF020187, AF009411, AB015609, AF006627, M95076, 043527, AB002741, 025896, AF006628, AF019093, D83352, 010355, M99575, 098288, AF090440, AB007509, 082480, Y15794, AJ005572, AF029349, L10111, S80963, 038894, L41731, AF022733, AJ225108, Y11879, AF001688, 033214, 297178, AF009413, AF019907, AF016371, X71980, AF001522, M77169, AF023132, D83476, AJ009675, 090554, AF069329, AF098691, 234799, AF004947, 060199, AF022732, AF019887, L02937, 055848, AF011331, AF095770, AF043533, X69524, M32882, 008214, 050897, AF017369, 035364, Y14339, AJ005969, 090555, 044430, 079296, AF001501, AJ223316, D78609, LI41060, 259362, AF034387, 062398, AB005545, AB002533, Y13865, AF009959, L02938, 010555, AL010296, AC003091, 037699, S75970, AF071010, 281311, AB003681, X16353, AB002731, X53081, D63950, D10911, D90115, X97065, 282275, AB016891, Y09455, X77990, , W58357, W07820, AA188593, W81096, AA858164, AI018124, AI139112, AA769634, W00937, D80849, AA448160, N98650, T31293, H15307, H51146, N29314, AA770301, AA187822, AA978299, T31823, AA936910, AA993194, N41386, W45601, W81099, C05691, D60153, AA780119, AA929004, 868608, 243271, N37029, AA974718, AA928663, T30120, AA936583, H51109, N20251, W92917, T36035, AA980197, 224908, N79950, AA872019, AA902275, N59810, 813443, AA740162, AA937759, N72168, AA970708, T36257, AA933833, H15700, D51185, AA249138, 837356, W93028, 228641, AA371994, N72757, AA719126, N56164, T31790, D57389, 291959, N58984, AA897848, AA587009, 239343, AA659834, AA505490, 238243, D20349, AA252395, AA025593, H70133, 809101, AA159862, AI032981, 228355, C75020, AI139692, D82421, AI126922, C75170, AI016032, C18798, C75478, AI129339, C75472, AA310765, D63057, C05952, AA357303, C16591, D82132, L48852, D82799, C75176, AI124552, AA669409, 030155, C75118, AA374918, C75108, C05853, 030151, D57346, AI127548, AA918527, AA317816, AA573490, 821.699, AA917928, 836311, AA361522, AA701252, AI085492, H44387, AA156256, AA587935, AA976510, AA515269, W73374, T27986, N34493, AA737770, N32609, N32612, H69920, , AA415293, AA413717, AA117350, AA292502, AA117343, AA545256, AA795651, AA106372, 031322, AA681967, AA221922, AA600546, AA050610, AU018628, C80932, AA920654, AA863834, AI099036, AA183239, AI115182, AA590910, W65628, AA162291, , AA109490, AI052952, AA999324, AI105719, AI026280, AI072678, AA964820, AA754198, AA944557, AI045710, C94989, AA971630, AA933231, AA509077, AA257557, AA509328, AA109365, AA963207, AA435473, AA999306, AA406689, AI105662, AA509174, AI108597, AA109374, AA925182, AA971671, AA088161, AA752$12, AA626989, AA906924, AA840999, AA509033, C94899, AA406875, AA842672, AA123619, AA072471, AA509339, AA933108, AI110259, AA842135, N99262, AA661430, AA842512, AA180648, AI066048, AA559515, AA406761, AA109423, AF074736, AA257676, D87312, AA257488, AA119390, AI087701, W06665, W32852, AA123649, AA842505, AA509330, AA908025, AA257279, AI105717, AA906673, AA627018, AA906850, AA161668, AA114453, AA109372, AA257572, AA803997, AA406943, AA257495, AA842019, AA661368, AI082949, AA892888, W06539, AA118223, AA406986, AA971717, AI096212, AA257707, AA257649, AI053126, AA508950, AA713366, W69049, AA965381, AA208680, AI057997, AA161707, AI058071, AA675858, AA257513, AI083337, AA406908, AI083256, AA659956, AA842532, AA754036, AA753165, W18199, AI109620, AI058022, AI064026, AA471431, AA032116, AA754549, AI108146, C92045, AA843025, AI109103, AA509237, AA161620, AA257665, AA471605, W89932, AA841358, AA843040, AA971695, AA003471, AA840977, AA509267, AA841711, AA471488, AA257699, N98079, AA454318, W04102, AA842874, N99754, AA509307, AA751845, AA661358, AA508954, AA406746, AA842720, W23363, AA508951, AI068913, AA417920, AI108220, AA508996, AA471497, AA892911, AA842501, AA123614, AA509218, AA597812, AA752986, AA752003, AA406839, AA508993, AA161747, AA509008, AA180623, AA508986, AA892627, AA753129, AA509214, AA406733, AI105737, N74818, AA753300, AA430818, AA417415, AA114426, 896936, AA979829, AA246112, AA753138, AI058077, AA842964, AA966639, AA842265, AA509025, AA601853, W15128, AA660039, AA842275, AA454424, AA180651, AA842423, AA257507, AI063375, AA180692, AA051990, W15099, AA180620, W00308, AA406729, AA257712, AA257445, AA433148, C48534, AA495533, C08939, AA906845, AA933362, AA509242, AA892023, W29144, AI087990, AA842237, AA601823, W06538, AI087739, AI087524, AA842164, AA892642, AA471553, .AA842919, AI113700, AA675813, AI083003, AI021727, AI083274, AI083309, W32823, AA253962, AA114520, AA430792, C97230, AA842674, AI053141, D75937, AA893039, W68979, AI105681, W91819, AA756971, AA509104, AAlll828, AI109720, AI110161, AA933311, AA180602, AA842093, 886419, AI058057, AA186285, AA406891, AI105725, AA406888, AA649397, N94700, W51718, AA547916, AA840696, 074116, AA257756, AI082996, W9I818, N74830, AA123585, AA118229, AA459946, AA841367, AA509109, AA892387, AI052833, AA751998, AA123634, AA257327, AA803962, AA842993, AA471448, AA406716, AA891361, AA890661, AA713997, AA906759, AA257695, AA841403, AA751834, AA406997, AI096182, AI105734, W15132, W59918, AA089352, AA180566, AA257927, AA257522, AA906980, AA471469, AA509264, AA509032, AA749469, AA752028, AA754167, AA754696, AAB42335, AA842574, AI065957, AI065970, AI096289, AA109379, AA109472, AA114489, AA161689, AA930830, AA406948, AA433296, AA454371, AA971492, AA471703, AA752086, AA842629, AI096185, 847079, 886415, AA161711, AA161655, AA180599, AA257424, AA257437, AA257749, AA433393, AA471419, AA471602, AA930922, AA661401, AA752034, AA752066, AA842384, AI082936, AI083329, AI105677, 233912, AA109362, AA109417, AA051807, AA430797, AA906799, AA430806, AA495598, AA661116, AI082951, AI105685, AI114069, 897062, W59884, AA109292, AA751829, AA754172, AA842257, AI082934, AI082958, AA180706, AA971516, AA508962, AA751563, AA751816, AA753137, AA753167, AA840972, AA892079, AA874756, AI105522, AI108829, AA180588, AA406676, AA471392, AA509142, AA840909, AA842175, AI066854, 847172, AA161565, AA257643, AA753161, AA471447, AA680450, AA752897, AA753237, AA892230, AA842544, AA161635, AA459928, AA508933, AA509309, C41215, AA842585, D73786, D75990, D75808, AA627099, N74809, AA257682, AA257517, AA257668, AA471970, AA509251, AA509051, AA990913, C39627, C41200, C92101, C96071, C98950, AA840970, AA842156, AA930902, AA842216, AA007706, AA406765, AA180574, AA842310, AI067585, AI077003, AA756933, AA114501, AA406690, AA959490, AA661371, AA056797, AA114372, AA180676, AI082955, AA406735, AA675796, AA752005, W29142, AA109261, AA842401, AA842602, AA246079, AI043420, AA626993, AA123655, AA257716, AA406931, AA791379, AI105668, AA842538, 847669, AA088150, AA109308, AA738555, AA123638, AA180582, AA123597, AA971535, AA180728, AA161741, AA186201, AA430817, AA433170, AA454407, AA471686, AA161596, AA509110, AA675874, AA471540, 226577, AA753093, AI066829, D37716, AA627017, N99292, AA50B936, AA257656, AA406768, AA471587, H39287, AA842931, AA161715, AA509204, AA979935 SEQ ID NO.: 2, AF086243, AE001154, X62889, , W67765, W67769, AA997751, AI141491, W76469, AA906091, AA872676, AA399825, H77545, H91001, W72232, AA948309, AA361403, 857582, AA337188, AA215714, AA481093, T75310, AA976452, AI120744, AA462558, AI158991, AA014020, AA285990, AA051099, AA473453, AA896862, W56907, AA218305, AA020167, W85164, AA017810, W30604, AA541978, W20894, AA023164, AA760925, AA024084, AA840049, , AA231755, T20699, C45833, T24185, C68940, D37618, AA964657, AI011924 SEQ ID NO.: 3, L08501, 297205, 298950, AF010400, AC005162, L08502, D50608, AA707653, AA861639, AA292496, AA702524, AI097367, AI138509, AI147933, AI141836, AI075247, N63868, W88668, AA703196, AA625621, AA292247, AI032898, AA005331, AA699781, AA427941, D31111, D31113, N92013, AA884207, AA094752, 870900, 816693, AA906542, 835112, AA481286, D80100, AA235512, AA960995, AAB67982, D59403, W88874, AA558590, 810098, AA719917, H43573, 849500, AA744780, AA047136, AA789101, AA906332, AA747301, AA830606, AA434559, AA236698, AA328889, N98469, W17299, W96605, AA258082, AI078045, 811930, W74577, AA703312, AI082727, 895189, N76461, AA010500, W63646, W38891, AA490651, AA558805, W87891, AA160849, AA618177, AA776126, AA161281, , AA822308, AA499768, AA028780, AA183100, AA276783, AA120227, AA200285, AA212541, AA116265, AA821616, AA265629, AA108599, W61565, AA030311, W42275, AA419903, AA268027, AA028211, AA518504, AA125399, , C92235, C92002, C29917, AI145662, C65317, AA901847, AI137443, 27.4719, D35515, 890625, H76970, SEQ ID NO.: 4, AL031178, Y11905, AF031904, M34309, M29366, L33953, L33952, L33956, L33954, L33957, 041289, X13369, AL022072, AJ223074, AF078695, AC004683, X17267, AF025526, AF071798, AC005274, AB009537, X68248, AF035537, AF056116, AB009052, AL023286, AF058701, L20725, AF001308, 022438, , AA211485, AA579574, AI078750, AA568661, AA604128, H49462, AA767424, H97012, AA565823, H99963, AA827171, T87152, F22119, AA798975, T31504, 292997, T89930, 802581, H75949, T87057, AA322268, 802700, AA005034, AA576177, AI014302, AA398159, T83607, AA322497, AA211532, AA019517, 827657, AA026869, N67589, T83782, AA129383, 239829, AA814308, AA425569, H67997, AA009420, AA694513, AA007691, T62593, AA333601, H75339, AI057250, T62521, N73865, AA004558, AA004489, AA007690, AA910241, AA456251, AA009568, AA391266, T28757, AA132360, AA781316, AA956942, AA782765, AA662593, AA461351, AA885220, N33840, AA843737, T62232, AA608559, AA64:3270, 844662, AI079863, AI051088, N63305, W249S5, AA085886, W31918, AA097966, AA178965, AA369890, AA515015, N79466, AA768162, AA869694, AA811390, AA839531, AA293263, AA768335, AA799083, T57520, AA292001, AI085512, AA969032, AI027062, AA595663, AA827242, AA799475, , AA472485, AA097011, AA959170, AA647546, AA986669, AI006628, W12604, AI122356, AA571721, AA433697, AA880171, AA015463, AA116290, 087721, AA437983, AA990395, AA265925, W19785, W89262, AA059703, AA413613, AI020231, AA667024, AA907526, AA221491, AA222523, 076436, AA409700, W35766, , AA859485, H33704, T96512, 025899, T41882, 026586, 092302, AA660448, 094493, 025527, D35095, D33727, F14543, D37473, T45969, AA040979, D68274, T38420, AA228607, AA660541, T38283, AA842575, 071889, T38745, D68465, T46732, AA59839.3, 023775, 0:64798, AA042719, F19972, 065873, N97974, AA114425, AA900956 SEQ ID NO.: 5, 029344, S80437, M76767, X62889, M84761, J03514, X62888, X13415, X13135, 005714, AC004013, 058675, 547635, 281533, AC005250, AC003661, AB008567, Y13449, X96401, AF026987, AF026488, , AA781445, AI037943, AI129371, 015883, AI073336, AA909077, AA569092, AI039428, AA568701, AA058907, AA911112, AA234022, N95359, AA565390, AA082927, AA588430, D60358, AA045488, AA089417, N72089, AI143390, 851979, AA081939, AA635907, T47621, AA579930, AA995057, AA827039, AA872990, AAS88319, AA069032, AA062768, AA534011, W96904, H06082, AA938900, AA971262, AA836547, AA251544, AA250742, AA830405, AA906492, AA102653, 8.38286, AA258075, H83302, H38522, 861787, 833742, 824099, AI052406, AA931452, 823634, 839640, AA974568, AI028383, AA312451, AA148800, AI138982, 836172, AA926921, , AA472563, AA919598, AA423256, AA476186, AA091992, W84938, AA797706, AA709956, AA599361, AI006075, AA717202, AA008602, AA033399, AA472306, AI037430, AI152943, AA475582, AA471792, AA530292, AA277496, AA718588, AA823112, AA822771, AA710973, AA981780, AA718846, AA797557, AA510746, AI036049, AA543891, AA606513, AA981758, AA822268, AA913161, AA472201, AA696527, AA213036, AA168259, AA718549, AA458342, AA119918, AA879925, AA050917, AA718814, AA793638, AA177899, AA575627, AA537367, AI121788, AA203946, AA413157, AA517432, AA867736, AI037420, W30436, , 271851, AA957915, AI112847, AA955881, AA963915, AI093663, 095061, AI009894, AA957229, AI044678 SEQ ID NO.: 6, AC002426, AC004674, AC004675, AC004006, L12157, 020839, 046028, 020835, AC004058, X67115, X76266, M25985, 059759, AC005172, 070848, AF042274, X14724, L31840, L41679, , W52480, AA863014, W56770, AA286755, AA164604, W52777, AA814246, AA765427, AA873647, AA360577, AI139274, AA770312, AA732557, AA568651, AA164603, W56729, AA199905, AA865009, 816889, 808110, F07672, AA577790, T11467, AA502989, AA366688, AA480628, AA516318, AA090005, AA081908, F01265, AA780686, , AA466811, AA465808, AA197646, AI157174, AA153086, AA197667, AA066612, AA058086, AA024186, AA110109, AA880419, AA870161, AA153880, AA072995, , AI031052, AI093934, AA849320, D15181, 095093, AI096188, T09655, 062926, AA996934, AA925202, AA817271, AA901051, 803660, AA948980, AA658709, AA899946, AA957150, AA800160, T76196, SEQ ID NO.: 7, X63547, X63596, AF017306, 094839, 020657, AF017305, AJ001589, L21998, D21270, 248245, 063834, 268006, L09573, D63819, AC005266, AF025968, M94131, , AI056961, 015588, AA373847, AA887911, N87070, 839133, AA226825, AA353972, AA325352, 888378, AA990675, AA456219, AA701415, AA046611, AA456224, , AA065652, AA221497, AA710221, AA717401, AA254049, AA041745, AA510261, AA170745, AA656404, AA572506, AA179539, AA217630, , AI134284, 058957, 011202, AA413362, AA728532 SE ID NO.: 8, AB016886, 292811, AL021981, 052078, L46702, 023515, AC005555, 284814, 293016, D21138, X57513, L07194, D83711, M28988, 015974, 052513, AF026939, L19120, J05258, 213985, 270691, 059227, , AA190526, AA769859, AI014655, H88220, AA622877, N32046, H89609, AA682362, AA469420, AA375477, AA284905, AA257109, N80276, H89373, N92393, AA884334, AA778708, AA766209, AA535677, W46414, AA770266, AA983635, AA721113, H88219, 887349, AA628091, , AI116513, AA183589, AI035517, AA209952, AA184622, AI097904, AA016490, AA162370, AA939521, AA162376, AA718152, AA048154, AA253815, AA795350, , AA996981, 044498, 091783, 044695, 044039, 062421, 047063, 045019, D36613, 060872, 050136, 069177, AI055708, D27648, 065648, AI119022, AI064663, AI107213, AA395461, AA800126, AA891987, T01611, 02'7943, AI113482, 083830 SEQ ID NO.: 9, L93510, 071249, L11275, X73541, 228:317, AB008270, X75652, 005987, 085262, 024189, 246676, X70823, AC004981, D11079, X56121, M58053, 033636, 292773, 023168, D31662, , 815557, F01629, N71722, AA252548, AA806751, T59557, AA612671, AA329585, AA295675, AA166990, AA128100, H46363, AA125810, , AA396888, AA408999, AA270873, AA144722, AA863954, W10303, , 038016, N96746, 237622, AA395862, 038756, F15295, N99294, W68877, 094749, 024349, F15569, AA113611, AA689197, N96676, 073598, F15569, L96559, W06235, T09718, H77154, T14151, AI082914, AA650815, AA728021, AA072559, 092112, T96743, 061743, AA550223, 012798, AA275531, AA681003, T75878, AI100097, T75882, AA848187, T44109, AA542686, H21339 SEQ ID NO.: 10, 281595, 041372, 001317, AE000696, AC002057, X66250, L11665, D13438, 029377, 250028, 090953, AA119228, AI025080, 880188, W28745, AA381819, AA381991, 244165, H75915, AI124793, H08139, AA375957, AA381750, AA166751, 842511, T26985, , AA971592, AA661387, AA606231, D35147 SEQ ID NO.: 11, X76998, 297632, AC004232, AC005184, AC002595, AC003991.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
All references disclosed herein are incorporated by reference in their entirety.
We claim:

WO 00/20587 _ PCT/US99/Z2873 SEQUENCE LISTING
<110> Ludwig Institute for Cancer Research <120> Cancer Associated Antigens and Uses Therefor <130> L0961/7050Wo <140> US 09/166,300 <141> 1997-10-05 <190> US 09/166,350 <141> 1997-10-05 <160> 95 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 4422 <212> DNA
<213> Homo Sapiens <400> 1 gattattctggaggaagatgaccttcattttatggttatgtgtgtgtgtctgtgtgtctt60 tggaaaaatatatataattttttcaaataggaagccaacatatcaagtgatgaattaaag120 tatgctgcagaatatatattctaaaactacaaaaaagtcactgaatatcaaaatgataca180 gcttatacatatagttactgtgacaagtgacagactgctagttcagaattcaaaaatcct240 ttcctagtttgtgagataatgggctaaattccttctgcctgccactggggcaaagcaaat300 tgctttagtttttgatgagagttcttagaagtttgttggtattccttcatccacagcatc360 cattgttgaaataaccattttcagttgtgatgccttaactaagaagccaattgttagcct420 gaaatgcaatcttggtagccagtttcaatgaagctagagattagtcagaaaaagttagct980 gttgggctttagaaagggattttgagtcctgncatttctacttgggagcattttggagca590 gattaagctttcagtataaaaacaagtggctacctgatggaaacttttcttacccttata600 gggaaactgagcacaagctgaatgatattgtctgctgcaaaaaaaaacaaacaaaaaaaa660 aacaaaacaaaaaacaaaaaaaaaaaaaaaaaaacctcgtgccgaattcggcacgagggg720 aagccccgtgcaccccccgccctccggccgccgccgccccgctggccctgcagccgtcgc780 cgctgcctcgggctacagccccgggca cggtcccggctggggaaggagggcggcgag890 cgg cgcgtccggagccgccggagatggcgggagggcactgcggcagcttccccgcggcggcgg900 ccggcagcggcgagatcgtccaactgaacgtaggggggaccagatttagtacctcaagac960 aaactcttatgtggattccagattcta tttccagtttgctgagtgggagaatttcaa1020 ttt cacttcgagatgaaactggtgctatatttattgatagagatccagcagcatttgcaccca1080 ttttaaattttcttcggacaaaagaactagacttaaggggagtgagtattaatgttctca1190 ggcatgaagcagaattttacgggatcactccattagtaagaaggcttctcttatgtgaag1200 aattggagcgttcctcttgtggcagtgtcctttttcatggttacttgcccccaccaggta1260 ttcctagtcgtaaaataaacaacacagtcagatctgctgattctaggaatggtctaaatt1320 ctacagaaggtgaagcccggggaaatggtacacagcctgttctctctggaacgggagaag1380 aaactgttaggctaggatttcctgtggatccacgaaaggtgctaatagtagctggccatc1440 acaactggattgtagctgcatatgcccattttgctgngtggtacagaatcaaagaatctt1500 caggatggcagcaagtgtttacgagcccatatttggattggactatcgaacgagtagctt1560 taaatgcaaaggtggttggagggccacatggagacaaagacaaaatggttgctgttgcct1620 cagagagtagcatcatcttgtggagtgttcaggatgggggaagtggaagtgaaattggag1680 tgttcagcctgggtgttcctgtagatgctctcttctttattggtaaccagttggtggcca1740 cgagtcatacagggaaagtgggagtgtggaatgctgtcactcagcactggcaggttcaag1800 atgttgttcctataactagttatgacactgctggatcattccttctgcttggatgtaaca1860 atggatcaatatattacatagatatgcagaagttccccttgcgaatgaaagataatgatc1920 ttcttgtaactgaactgtatcatgatccttcaaatgatgctattactgctctgagtgttt1980 acctcacacccaaaacaagtgtcagtggtaactggatcgagatcgcctatggtacgagct2040 ctggagcagtacgagtgattgtacaacacccagagacagttgggtcaggtcctcagcttt2100 ttcagactttcacagttcaccgaagtcccgtaacaaaaatcatgctatcagagaagcatc2160 ttgtatcagtctgtgcagataataatcatgtccggacgtggacagtaacacgattcngag2220 gaatgatctctactcagccaggttct.actcctttagcgtcattcaagatactatccctgg2280 aggagacagaaagtcatggtagctattcctctggaaatgacataggaccttttggagagc2390 b5 gagacgatcaacaggtgtttatccagaaagttgttcccatcaccaacaaactatttgtaa2400 gactctcatcgactggaaaaagaatatgtgagatccaggctgttgactgtactacaatat2460 cctcatttacagtgagggaatgtgagggatccagtaggatgggctcaagaccaaggcgct2520 acttgttcac aggccatacaaatggcagtattcaaatgtgggatctgaccactgctatgg2580 atatggttaa caaaagtgaagataaggatgtaggtggtccaaccgaagaagagctactca2640 aattactcga tcaatgtgatttgagcacatctcgctgtgctactcctaacatcagtccag2700 caacttccgt agttcagcatagccacttacgagaatcaaattctagccttcagcttcagc2760 accatgatac cacccatgaagcagctacttacggttccatgaggccttacagagaaagtc2820 ctttattagc aagggcaagaaggactgagagctttcacagttatagggacttccagacta2880 ttaatttgaa cagaaatgtagaaagagctgtccctgaaaatggtaacttgggtccaatac2940 aagctgaagt gaaaggggcaacaggggaatgtaatatatctgagagaaagtctcctggag3000 tagaaataaa aagtttgagagaattggatagtggattggaagtgcataaaatagctgaag3060 l0 gtttttcaga atccaagaaaaggtcatcagaagatgaaaatgaaaataaaatagagttta3120 ggaagaaagg aggatttgaagggggaggattccttggaagaaagaaagttccctatctgg3180 catcatcacc aagtacttccgatggaggaactgactcacctggtactgcgtccccatctc3240 ctacaaagac tactccatctcctcggcataaaaaaagtgattcttcaggtcaggagtaca3300 gcttgtgaaa actcaccaaaatgaatagttgtttcggttacatttagatgaaagttaaac3360 tttactgaat ttcagtacattagtttttacactaaaactttacaagataaaattggactt3420 catttagtat ctttttaacagaattacttggaataatgagatacaataatcatatctctt3980 ttgacatttt ggaaatttttttaattttacaagtacatttaacagatcatttataaagca3590 ggagtccatt ttaacacttaccgar_tttttttggtttggaaacatattaccacgtcttaa3600 taggatggtg cccatataggtgagcatccctttagatcatgggaaccagcagactgcatt3660 cctaatcttc attatgcctgagacttgtcttacaatgttacctttaagtgaatcacataa3720 ttgtctttgg aacttggtctcccaacacttattgtgattgcaaagtgtttaccagatatt3780 tgatgaggtg ctatgtttgtgaaaaacatatcatgtaattcaaaaacactattgatattg3890 aataccagat accactatgtagtaagtcttttaggatgattttaatttagtcgtgcgtca3900 ttttctgatt ctcatcattgggagatcttaaatcttagcaagcattagcaatattaaatg3960 ccaaaattcc attgaaactttcaagttggagcaattgtctgtgtttgaaaagatgaaata4020 aaaataataa tcaagggcaaagctttgagtgcccagaagggaaagctgtaccagttgcta4080 acctgtcttg tttcaggagccaccatgtttttttttcagtgttancaacaatcatgataa4140 ttaaattaaa acnctagtttgttcacttgtaggactgcagttctgaattttgggttaaag4200 gttttggctg ctgtaagaatgtgaatttgaatgtattttgaattgtaagagcaaaagaac9260 gtttttgtac aattttttttcatttaattggaatgatcttcaggtttctacaaatagggt4320 aattgtaaat ttaaagcattagcatttattggtgaataatgtatatatccccattccaag4380 aaatataagt gagtgaagttgaaataaaatctttaaaattto 4422 <210> 2 <211> 502 <212> DNA

<213> Homo Sapiens <900> 2 gctagcttcg gcgcggatccctgggcgtccgtacgtcggagtccttcgtcctccagggtc 60 cctgttcttt gcgccagcgggaaccactatctctgcactcctggggttttgttacatggc 120 tgctttcctc aaaatgagtgttagtgtcaatttcttcagacctttcaccaggtttttggt 180 gccatttacc cttcataggaagagaaataacttaacaattttgcagagatacatgtcttc 290 caaaatacca gctgttacttatcctaaaaatgagagtacacgcccttctgaagagctaga 300 gttggataag tggaaaactaccatgaaatctagtgtgcaagaagaatgtgtttcaacaat 360 ctcaagcagt aaggatgaagatcctctagctgccaccagagagttcattgagatgtggag 920 attgcttggc agagaagtaccagaacacatcactgaagaagagctcaaaacccttatgga 980 atgtgtttct aacacagcaaas 502 <210> 3 <211> 1948 <212> DNA

<213> Homo Sapiens <400> 3 ccatgtgagg gaggggcccgctcctgcttggtgacagagtcagcacgcggtggcctgcag 60 ttcctccagc agtgtgaccgggaggatctggtggaattggctctgcctcagctggctcag 120 gttgtgaccg tgtatgagtttcttctgatgaaggttgaaaaagatcatctagcaaagcct 180 tttttcccag ctatatataaggaatttgaagagttgcataaaatggttaagaaaatgtgc 290 caagattacc tcagtagttctggtctgtgttcccaggagaccctggaaataaacaatgat 300 aaggttgctg agtcattaggaatcacagaattcctacggaagaaagaaatacacccagac 360 aaccttggac ccaagcacctcagccgagacatggatggggagcagctagagggagctagc 420 agcgagaaga gggaacgtgaggctgcggaggagggactggcctcagtgaaaaggcccaga 480 agagaagccc tgtccaacgataccactgaatctcttgctgccaacagcagaggccgggag 590 aagcccaggc ccttgcatgctttgcccgctggtttttcccctccagtaaatgtgactgtc 600 tctccccgtt ctgaagaaagccatacaacgacggtttctggtggcaatgggagcgtgttc 660 caggcgggcc cgcagcttcaggcactggctaacttagaagccaggagggggtctataggt 720 WO 00/20587 _ PCT/US99/22873 gctgctctct catcccgggatgtcagtgggctgcctgtttatgctcagtcaggagagcct 780 aggaggctga cccaggcacaggtggcagcgtttcctggagagaatgctttggaacactct 890 tcagaccagg acacctgggacagcctgaggagcccgggtttctgcagccctttgtcatct 900 ggtggtggag cagagtccctgccgcctggggggcctggacatgcagaggcaggacacctc 960 ggcaaggttt gtgacttccacctgaaccaccagcagcccagccccaccagcgtcctgcct 1020 acagaggtgg cagcccctccgcttgagaaaattttgtctgtggatagcgtggcagtggac 1080 tgtgcctaca ggactgtgcccaagccagggcctcagcctggcccacatggatcactattg 1140 actgaagggt gtctcagaagcctttcgggggacttgaaccggttcccctgtgggatggag 1200 gtgcactctg gccagagagaactggagagcgtggttgctgtcggcgaagccatggctttg 1260 aaatttccaa tgggagccatgagttactgtctcagggacagaagcagatttttattcaga 1320 cttccgatgg gcttatcttgtcccctccaggtacaatagtgtctcaggaggaggacattg 1380 tcacagtgac tgatgcagaggggcgtgcctgcggatgggcccgctagaaggagttcctct 1940 agaagctgtg gagtcggtcgtcaccgcgagagccctcacagtgaagtggagtcagatcct 1500 agattcgtct gattttatccagagaaggtctatggcaagcaatgtatatttttctaatgt 1560 gaatattgca cagatgaaccttttatttataaagaataatgtctttctgccctgctgtct 1620 acatttttct atggagcttgtcataataatagcagatattacctgatcaggaatccctgt 1680 ggcgcgtctg acgctcatgagtttttcatgat.ggtgatgagtagcactgcactgtcacct 1790 gatgattggc cctgctccgtttcc~ttctctcctgggagatatgctgcttttccaccaga 1800 cttgctccat actagaagcttcttttgggttcaattaaaaagaaaataagctagtcattc 1860 tgggcagcat tttattgatagaagggggaaaaagtcatttctacttgcatgattttttaa 1920 attaaattaa attaaattaatttaaaaa lgqg <210> 4 <211> 1486 <212> DNA

<213> Homo sapiens <400> 4 ccgcggcggc gtccggggtctccagtagggctgacgctccggtgctcgcacaatcccccg 60 cctcggctgg caacgggcgtccctccactccccgagtccccggcagccgccgccacccca 120 gcgcgccccg atctggccccctgccccgcgaagatggctgccgtacgccgggcccgcagt 1B0 tattgccgct gcctggtgcgcttctccgaccgagaactctgctaagctccgctgcagaga 240 caggcaggag tagacacccggacacccagcacccctcctccggggggcggtgcagagggg 300 gcacggagag cccctcgagcgcagcaggccgccccgccagcatggcagaagctgaggaag 360 attgtcattc tgatactgtcagagcagatgatgatgaagaaaatg<iaagtcctgctgaaa 420 cagatctgca ggcacaactccagatgttccgagctcagtggatgtttgaacttgctccag 480 gtgtaagctc tagcaatttagaaaatcgaccttgcagagcagcaagaggctctctccaga 540 aaacatcggc agataccaaaggaaaacaagaacaggcaaaagaagaaaaggctcgagaac 600 tcttcctaaa agcagtagaagaagaacaaaatggagctctctatgaagccatcaagtttt 660 atcgtagggc tatgcaacttgtacctgatatagagttcaagattacttatacccggtctc 720 cagatggtga tggcgttggaaacagctacattgaagataatgatgatgacagcaaaatgg 780 cagatctctt gtcctacttccagcagcaactcacatttcaggagtctgtgcttaaactgt 840 gtcagcctga gcttgagagcagtcagattcacatatcagtgctgccaatggaggtcctga 900 tgtacatctt ccgatgggtggtgtctagtgacttggacctcagatcattggagcagttgt 960 cgctggtgtg cagaggattctacatctgtgccagagaccctgaaat:atggcgtctggcct 1020 gcttgaaagt ttggggcagaagctgtattaaacttgttccgtacacgtcctggagagaga 1080 tgtttttaga acggcctcgtgttcggtttgatggcgtgtatatcagtaaaaccacatata 1140 ttcgtcaagg ggaacagtctcttgatggtttctatagagcctggcaccaagtggaatatt 1200 acaggtacat aagattctttcctgatggccatgtgatgatgttgacaacccctgaagagc 1260 ctcagtccat tgttccacgtttaagaactagggaataccaggactgatgccaattctact 1320 gggtcactat cgcttggcacaagacacagaccatcagacccaaagt~attttgctgtaata 1380 actaagaaaa aaaggaagaaaaaccacttggactataaatacccgatattttcgtcgggg 1440 tccctgtacc aaagaagccgaatcagaagttttcatgnnggggctn 1986 <210> 5 <211> 774 <212> DNA

<213> Homo sapiens <400> 5 tgcgccaccc caccccaccccacccccgccatgcaacgggattgaagggtcctgccggtg 60 ggaccctgtc cggcccagtgccactgccccccgaggctgctagacgtaggtgttaggcat 120 gtcccaccca cccgccgcctcccacggcacctcggggacaccagagctgccgacttggag 180 actcctggtc tgtgaagagccggtggtgcccgtgcccgcaggaactgggctgggcctcgt 290 gcgcccgtgg ggtctgcgcttggtctttctgtgcttggatttgcatatttattgcattgc 300 tggtagagac ccccaggcctgtccaccctgccaagactcctcaggcagcgtgtgggtccc 360 gcactctgcc cccatttccccgatgtcccctgcgggcgcgggcagccacccaagcctgct 420 ggctgcggccccctctcggccaggcattggctcagcccgctgagtggggggtcgtgggcc480 agtccccgaggagctgggcccctgcacaggcacacagggcccggccacacccagcggccc590 cccgcacagccacccgtggggtgctgcccttatgcccggcgccgggcaccaactccatgt600 ttggtgtttgtctgtgtttgtttttcaagaaatgattcaaattgctgcttggattttgaa660 atttactgtaactgtcagtgtacacgtctggaccccgtttcatttttacaccaatttggt720 aaaaatgctgctctcagcctcccacaattaaaccgcatgtgatctccaaaaaaa 774 <210> 6 <211> 2936 <212> DNA
<213> Homo sapiens <400> 6 cgtaacccttagtcccaatgcctccgtaagcggagttgagtgggtgcctgtggttggagc 60 IS tgtggaggtgtccccggtggcgagcgcggccagaactgcggtcacttaagttttccgtgt 120 gcgggttgcaaggagcgtgcgtgcgtctggtatagggaggacacctctggattgaggatc 180 ttatgacctactttagaggaaggtataatttggcttcctgagattctgccttagcaagaa 290 aggagtgggaaatacccttggaaagaaaactaaaacagtaagaaagccaaaacttatttt 300 tacatggttgtcagcacatttaccgatatggacacttttcccaataattttcctcctggt 360 ggagacagtggattgacaggttctcagtcggagttccagaaaatgttaattgatgaaagg 920 ttacgatgtgagcatcataaagctaattatcagacactgaaggctgaacacacaaggttg 480 cagaatgaacatgtaaagttacaaaatgaactcaagcacctgtttaatgaaaagcaaact 540 cagcaggaaaaacttcagctcctgcttgaagaactaagaggagaattagtagagaaaact 600 aaagatttagaagaaatgaaactgcagatattaactcccaaaaattggaattgctaagag 660 cccaaatacaacaagaattagaaactccaatgagagaacgttttaggaatctagatgaag 720 aggtagaaaagtatagagctgtatataataagcttcgctatgaacatacatttctcaagt 780 cagaatttgaacaccagaaggaagagtatgcacgtattttagatgaaggaaaaataaaat 840 atgaatcagagattgcaagactggaggaagataaagaagaactacgtaaccagctgctta 900 atgttgatctcacaaaagacagcaaacgagtggaacaacttgctcgagaaaaagtctatt 960 tgtgtcaaaaattaaaaggtttagaggctgaagtagcggaattaaaggctgaaaaggaga 1020 attctgaggctcaggtggaaaatgcccaaagaatacaggtgcggcagttggctgagatgc 1080 aggctacagtcagatccctgggggctgaaaaacaatcagctaatttacgggcagaacgct 1190 tggaaaaagagctacaatcaagcagtgaacaaaatacctttttaattaataaattgcata 1200 aagctgaacgagaaataaatacattgtccagtaaagtaaaagaacttaaacattcaaaca 1260 aactggaaataacagacatcaaactggagacagcaagagctaagagtgagctagaaagag 1320 aaaggaataagcttcaaagtgaactggatggattacagtcagacaatgaaattctcaaag 1380 cagctgttgaacatcacaaagtgctcttagtagaaaaggatcgtgaattaatacgtaaag 1990 tacaagctgccaaagaagaaggttatcaaaaacttgtggtattacaagatgaaaagttag 1500 aactcgagaacagattagcagatttggagaaaatgaaagtggaacatgatgtctggaggc 1560 aatctgaaaaggatcagtatgaagagaaattgcgggcttcacagatggcagaagagatca 1620 ccaggaaggagcttcagagtgttaggttaaaacttcagcaacaaattgtgactattgaaa 1680 atgcagagaaggaaaaaaatgaaaattctgacctaaaacagcaaatcagtagtttgcaga 1790 tccaagtgacttcacttgcacagtcagagaatgacttgctgaattcaaaccaaatgctga 1800 aggaaatggtggagagattaaaacaagaatgccgaaattttagaagccaagctgaaaaag 1860 cgcaactagaagctgaaaagacattggaagagaaacagatacagtggttggaagaaaagc 1920 ataagcttcatgaccgtatcacagacagagaagaaaagtacaatcaagctaaggagaaac 1980 tgcagcgagctgcaattgcccagaaaaagagaaaatctcttcatgaaaacaaattgaaaa 2040 gactacaagagaaagtagaagtcttggaggcaaagaaagaagaattggaaacagaaatca 2100 ggtcttaaatagacaaaatgttcctttgaagactatacaaggcttcaaaaaagactaaaa 2160 gatatacagagaagacataatgaatttcgaagtctaattttggttcctaacatgcctcca 2220 acagcatctatcaatcctgttagctttcagtcatcagccatggttccaagcatggaacta 2280 ccatttcctcctcatatgcaggaggaacaacatcaaagggaactctctctacttcgcaaa 2340 agactagaagaactggaaacaacacaaagaaaacaactagaggaacttggatcttccgga 2400 gaatgatgttcttggagaacaggcagatcaaaagaggtgaagttggtgactcagtaaaac 2460 ttgacattttaacctgtggcatttagatactttttactgtttgccaaaacacttgaatgt 2520 gcctcaagaaaaggtacctactacatgctgtattgtatgactgtcaggattttaagatta 2580 tacaagtgaagcattaaaagagaaattctcagagatatttagaatatttgacaatggttt 2640 gagaatgtaaaacaaaaaggaactagttagagtcaagttttaaaatttttactttgttga 2700 atttttttttttggcattttgagtgaaatataactatcattaattctctcttcatctttg 2760 agatgcttggccataacagggtccatacacatcttctggtttactatatacaaaaactgt 2820 agttgaaaaaagatgacaatttaaaagtcagcctaaagaatgtaaaggtatctatataca 2880 aaaggctaccttttctaaaatctgtgtgcacataattaaagagcttaatttttaaa 2936 <210> 7 <211> 1387 <212> DNA
<213> Homo sapiens <900> 7 aaaggctacatcattaacactagaaggaggacgattaaaacgaactccacagctgattca 60 tggaagagactatgaaatggtcccagaacctgtgtggagagcactttatcactggtatgg 120 S agcaaacctggccttacctagaccagttatcaagaacagcaagacagacatcccagagct 180 ggaattatttccccgctatcttctcttcctgagacagcagcctgccactcggacacagca 290 gtctaacatctgggtgaatatgggaaatgtaccttctccgaatgc:acctttaaagcgggt 300 attagcctatacaggctgttttagtcgaatgcagaccatcaaggaaattcacgaatatct 360 atctcaaaggctgcgcattaaagaggaagatatgcgcctgtggctatacaacagtgagaa 420 ctaccttactcttctggatgatgaggatcataaattggaatattt:gaaaatccaggatga 480 acaacacctggtaattgaagttcgcaacaaagatatgagttggccagaggagatgtcttt 540 tatagcaaatagtagtaaaatagatagacacaaggttcccacagaaaagggagccacagg 600 tctaagcaatctgggaaacacatgcttcatgaactcaagcatccagtgtgttagtaacac 660 acagccactgacacagtattttatctcagggagacatctttatgaactcaacaggacaaa 720 tcccattggtatgaaggggcatatggctaaatgctatggtgatttagtgcaggaactttg 780 gagtggaactcagaagaatgttgccccattaaagcttcggtggac:catagcaaaatatgc 890 tcccaggtttaatgggtttcagcaacaggactcccaagaacttctggcttttctcttgga 900 tggtcttcatgaagatcttaatcgagtccatgaaaagccatatgtggaactgaaggacag 960 tgatgggcgaccagactgggaagtagctgcagaggcctgggacaaccatctaagaagaaa 1020 tagatcaattgttgtggatttgttccatgggcagctaagatctcaagtaaaatgcaagac 1080 atgtgggcatataagtgtccgatttgaccctttcaattttttgtctttgccactaccaat 1190 ggacagttatatgcacttagaaataacagtgattaagttagatggtactacccctgtacg 1200 gtatggactaagactgaatatggatgaaaagtacacaggtttaaaaaaacagctgagtga 1260 tctctgtggacttaattcagaacaaatccttctagcagaagtacatggttccaacataaa 1320 2S gaactttcctcaggacaacccaaaaagtaccgaacttctcagtgaagtgggattttttgg 1380 tgtgcca 1387 <210> 8 <211> 799 <212> DNA

<213> Homo Sapiens <400> 8 gcccaacatggctggagcgcggcggaggtgagccggccgcccgcccgcagacgccccagc 60 3S ctactgcgcccgagtcccgcggccccagtggcgcctcagctctgcggtgccgaggcccaa 120 cggctcgatcgctgcccgccgccagcatgttgggcgccccggacgagagctccgtgcggg 180 tggctgtcagaataagaccacagcttgccaaagagaagattgaaggatgccatatttgta 240 catctgtcacaccaggagagcctcaggtcttcctagggaaagataaggcttttacttttg 300 actatgtatttgacattgactcccagcaagagcagatctacattcaatgtatagaaaaac 360 taattgaaggttgctttgaaggatacaatgctacagtttttgcttatggacaaactggag 920 ctggtaaaacatacacaatgggaacaggatttgatgttaacattgttgaggaagaactgg 480 gtattatttctcgagctgttaaacacctttttaagagtattgaagaaaaaaaacacatag 540 caattaaaaatgggcttcctgctccagattttaaagtgaatgcccaattcttagagctct 600 ataatgaagaggtccttgacttatttgataccactcgtgatattgatgcaaaaagtaaaa 660 4S aatcaaatataagaattcatgaagattcaactggagggaatttatactgtgggcgtttcc 720 aacacgtactgtgaatacagaatcnagag 749 <210> 9 <211> 686 <212> DNA

<213> Homo Sapiens <400> 9 tggaaattatagacctagcaaaaaaagatttagagaaggttgnaaagaaaagaaaagagg 60 SS aagnaaaaaagtgtggctggtaaagaggataatacagacactgaccaagagaagaaagaa 120 gaaaagggtgtttcggaaagagaaacccaatgaattagaagtggaagaaagtcaagaagt 180 gagtgatcatgaggatgaagaagaggaggaggaggaggaggaagatgacattgatggggg 240 tgaaagttctgatgaatcagattctgaatcagatgaaaaagccnattatcaagcagactt 300 ggcaaacattacttgtgaaattgcaattaagcaaaagctgattgatgaactagaaaacag 360 ccagaaaagactgcagactctgaaaaagcagtatgaagagaagntaatgatgctgcaaca 420 taaaattcgggatactcagcttgaaagagaccaggtgcttcaaaacttaggctcggtaga 480 atcttactcagaagaaaaagcaaaaaaagttaggtctgaatatgaaaagaaactccaagc 540 catgaacaaagaactgcagagacttcaagcagctcaaaaagaacatgcaaggttgcttaa 600 aaatcagtctcagtatgaaaagcnattgaagaaattgcagcaggatgtgatggaaatgaa 660 6S aaaaacaaaggttcgcctaatgaaaa 686 <210> 10 <211> 833 <212> DNA
<213> Homo sapiens <900> 10 gttcttctgtcgccggcttcagcagcccgcgcccgggcaggaatagaagatgaacaaacc60 cataacaccatcaacatatgtgcgctgcctcaatgttggactaattaggaagctgtcaga120 ttttattgatcctcaagaaggatggaagaagttagctgtagctattaaaaaaccatctgg180 tgatgatagatacaatcagtttcacataaggagatttgaagcattacttcaaactggaaa240 aagtcccacttctgaattactgtttgactggggcaccacaaattgcacagttggtgatct300 tgtggatcttttgatccaaaatgaattttttgctcctgcgagtcttttgctcccagatgc360 tgttcccaaaactgctaatacactaccttctaaagaagctataacagttcagcaaaaaca420 gatgcctttctgtgacaaagacaggacattgatgacacctgtgcagaatcttgaacaaag480 ctatatgccacctgactcctcaagtccagaaaataaaagtttagaagttagtgatacacg590 l5 ttttcacagtttttcattttatgaattgaagaatgtcacaaataactttgatgaacgacc600 catttctgttggtggtaataaaatgggagagggaggatttggagttgtatataaagggct660 acgtaaataacacaactgtggcagtgaaagaa~gcttgcagcaatggttgacattactact720 gaaggaactgaaaccagcagtttgatccaagaaaataaaagtaatgggcaaaagtggtca780 accatggaaaaactttagtaggaacctacttgggttttctcaagtggatggga 833 <210> 11 <211> 799 <212> DNA

<213> Homo sapiens <400> 11 taaaaatatccccttngatgatacctgccaataatgatatgtcccattattagattatgt60 tacatgccaaagtttaaaggaatttgggcagatccagttaaggttccttaaacaacntca120 ctttgagactgttgaaagggcctgacctaatccaagtgaaccccttgcaagaagaattct180 ccttgtaagccttgaagaagtatgtgagagggccacattggctaaaacctaaaggtggcc290 tctaggagatgagacctaccttccagttgtcagcaagcaggaaaaaaaaattgggacctc300 agttgcaaccacaaggaactgaattctgccaaaaatntgagtcagcttagaagagtactc360 caagcttcagatgataaccacagcctgggctgacacctggatttagctttgcatgatcct420 cagtatgagaatctatctgttctgtgctggacttctaatatatagaactgtgagataatg980 ggtcacattggctggatgtggtggctcatacctgtaaatcccagcactttgggaggccga540 ggcaggcagatcacctgaggtcaagagttcaagaccggcctggccaacatggtgaaaccc600 cgtctntactaaaaatacaaaaattagacgagcgtggtggtggacacctgtagtcccagc660 tgcttgggaggctgaggcaggagactagctggaaccagggaggtagaggttgcagtgagc720 tgagatcgtgccactgcactccagcctgggtgacagagtgagactc:catcataaataaat780 aaataaataaatgggtcnc 7gg <210> 12 <211> 812 <212> PRT

<213> Homo sapiens <900> 12 Met Ala GlyGlyHisCys GlySerPhePro AlaAlaAlaAlaGly Ser Gly Glu IleValGlnLeu AsnValGlyGly ThrArgPheSerThr Ser Arg Gln ThrLeuMetTrp IleProAspSer PhePheSerSerLeu Leu Ser Gly ArgIleSerThr LeuArgAspGlu ThrGlyAlaIlePhe Ile Asp Arg AspProAlaAla PheAlaProIle LeuAsnPheLeuArg Thr Lys Glu LeuAspLeuArg GlyValSerIle AsnValLeuArgHis Glu 60 Ala Glu PheTyrGlyIle ThrProLeuVal ArgArgLeuLeuLeu Cys Glu Glu LeuGluArgSer SerCysGlySer ValLeuPheHisGly Tyr Leu Pro ProProGlyIle ProSerArgLys IleAsnAsnThrVal Arg Ser Ala AspSerArgAsn GlyLeuAsnSer ThrGluGlyGluAla Arg Gly GlyThr GlnPro Leu Gly Gly GluThrVal Asn Val Ser Thr Glu Arg GlyPhe ProValAsp LysValLeu I:leValAlaGly Leu Pro Arg His HisAsnTrp IleValAlaAlaTyr AlaHisPhe AlaTyrArgIle Lys GluSerSer GlyTrpGlnGlnVal PheThrSer ProTyrLeuAsp Trp ThrIleGlu ArgValAlaLeuAsn AlaLysVal ValGlyGlyPro His GlyAspLys AspLysMetValAla ValAlaSer GluSerSerIle Ile LeuTrpSer ValGlnAspGlyGly SerGlySer GluIleGlyVal l5 Phe SerLeuGly ValProVal.AspAla LeuPhePhe IleGlyAsnGln Leu ValAlaThr SerHisThrGlyLys ValGlyVal TrpAsnAlaVal Thr GlnHisTrp GlnValGlnAspVal ValProIle ThrSerTyrAsp Thr AlaGlySer PheLeuLeuLeuGly CysAsnAsn GlySerIleTyr Tyr IleAspMet GlnLysPheProLeu RrgMetLys AspAsnAspLeu Leu ValThrGlu LeuTyrHisAspPro SerAsnAsp A.laIleThrAla Leu SerValTyr LeuThrProLysThr SerValSer G.lyAsnTrpIle Glu IleAlaTyr GlyThrSerSerGly AlaValArg ValIleValGln His ProGluThr ValGlySerGlyPro GlnLeuPhe G1nThrPheThr Val HisArgSex ProValThrLysIle MetLeuSer G1uLysHisLeu Val SerValCys AlaAspAsnAsnHis ValArgThr TrpThrValThr Arg PheGlyMet IleSerThrGlnPro GlySerThr ProLeuAlaSer Phe LysIleLeu SerLeuGluGluThr GluSerHis GlySerTyrSer Ser GlyAsnAsp IleGlyProPheGly GluArgAsp AspGlnGlnVal Phe IleGlnLys ValValProIleThr AsnLysLeu PheValArgLeu Ser SerThrGly LysArgIleCysGlu IleGlnAla ValAspCysThr 515 520 52.5 Thr IleSerSer PheThrValArgGlu CysGluGly SerSerArgMet Gly SerArgPro ArgArgTyrLeuPhe ThrGlyHis ThrAsnGlySer Ile GlnMetTrp AspLeuThrThrAla MetAspMet ValAsnLysSer Glu AspLysAsp ValGlyGlyProThr GluGluGlu LeuLeuLysLeu Leu AspGlnCys AspLeuSerThrSer ArgCysAla ThrProAsnIle Ser ProAlaThr SerValValGlnHis SerHisLeu ArgGluSerAsn Ser SerLeuGln LeuGlnHisHisAsp ThrThrHis GluAlaAlaThr Tyr GlySerMet ArgProTyrArgGlu SerProLeu LeuAlaArgAla Arg ArgThrGlu SerPheHisSerTyr ArgAspPhe GlnThrIleAsn Leu AsnArgAsn ValGluArgAlaVal ProGluAsn GlyAsnLeuGly Pro IleGlnAla GluValLysGlyAla ThrGlyGlu CysAsnIleSer

8 Glu Arg Lys Ser Pro Gly Val Glu Ile Lys Ser Leu Arg Glu Leu Asp Ser Gly Leu Glu Val His Lys Ile Ala Glu Gly Phe Ser Glu Ser Lys Lys Arg Sex Ser Glu Asp Glu Asn Glu Asn Lys Ile Glu Phe Arg Lys Lys Gly Gly Phe Glu Gly Gly Gly Phe Leu Gly Arg Lys Lys Val Pro Tyr Leu Ala Ser Ser Pro Ser Thr Ser Asp Gly Gly 7'hr Asp Ser Pro Gly Thr Ala Ser Pro Ser Pro Thr Lys Thr Thr Pro Ser Pro Arg His ?85 790 795 800 Lys Lys Ser Asp Ser Ser Gly Gln Glu Tyr Ser Leu <210> 13 <211> 167 <212> PRT

<213> Homo Sapiens <900> 13 Liu Ala Ala A5gIleProGly ArgProTyrVal GlyValLeuArg Ser Pro Pro Ser LeuPhePheAla ProA1aGlyThr ThrIleSerAla Gly Leu Leu Phe CysTyrMet.Ala AlaPheLeuLys MetSerValSer Gly 35 40 q5 Val Asn Phe ArgProPheThr ArgPheLeuVal ProPheThrLeu Phe His Arg Arg AsnAsnLeuThr IleLeuGlnArg TyrMetSerSer Lys 65 '70 75 80 Lys Ile Ala ValThrTyrPro LysAsnGluSer ThrArgProSer Pro Glu Glu Glu LeuAspLysTrp LysThrThrMet LysSerSerVal Leu Gln Glu Cys ValSerThrIle SerSerSerLys AspGluAspPro Glu Leu Ala Thr ArgGluPheIle GluMetTrpArg LeuLeuGlyArg Ala Glu Val Glu HisIleThrGlu GluGluLeuLys ThrLeuMetGlu Pro Cys Val Asn ThrAlaLys Ser <210> 19 <211> 452 <212> PRT

<213> Homosapiens <900> 14 Pro Cys Glu Gly Gly Ala Arg Ser Cys Leu Val Thr Glu Ser Ala Arg Gly Gly Leu Gln Phe Leu Gln Gln Cys Asp Arg Glu Asp Leu Val Glu Leu Ala Leu Pro Gln Leu Ala Gln Val Val Thr Val Tyr Glu Phe Leu 35 40 q5 Leu Met Lys Val Glu Lys Asp His Leu Ala Lys Pro Phe Phe Pro Ala Ile Tyr Lys Glu Phe Glu Glu Leu His Lys Met Val Lys Lys Met Cys Gln Asp Tyr Leu Ser Ser Ser Gly Leu Cys Ser Gln Glu Thr Leu Glu Ile Asn Asn Asp Lys Val Ala Glu Ser Leu Gly Ile Thr Glu Phe Leu Arg Lys Lys Glu Ile His Pro Asp Asn Leu Gly Pro Lys His Leu Ser

9 Arg AspMetAsp GlyGluGln Leu Ser SerGluLysArg Glu Gly Ala Glu ArgGluAla AlaGluGlu Gly AlaSerVal LysArgProArg Leu Arg GluAlaLeu SerAsnAsp ThrThrGluSerLeu AlaAlaAsnSer Arg GlyArgGlu LysProArg ProLeuHisAlaLeu ProAlaGlyPhe Ser ProProVal AsnValThr ValSerProArgSer GluGluSerHis Thr ThrThrVal SerGlyGly AsnGlySerValPhe GlnAlaGlyPro Gln LeuGlnAla LenAlaAsn LeuGluAlaArgArg GlySerIleGly Ala AlaLeuSer SerArgAsp ValSerGlyLeuPro ValTyrAlaGln Ser GlyGluPro ArgArgLeu ThrGlnAlaGlnVal AlaAlaPhePro Gly GluAsnAla LeuGluHis SerSerAspGlnAsp ThrTrpAspSer Leu ArgSerPro GlyPheCys SerProLeuSexSer GlyGlyGlyAla Glu SerLeuPro ProGlyGly ProGlyHisAlaGlu AlaGlyHisLeu Gly LysValCys AspPheHis LeuAsnHisGlnGln ProSerProThr Ser ValLeuPro ThrGluVal AlaAlaProProLeu GluLysIleLeu Ser ValAspSer ValAlaVal AspCysAlaTyrArg ThrValProLys Pro GlyProGln ProGlyPro HisGlySerLeuLeu ThrGluGiyCys Leu ArgSerLeu SerGlyAsp LeuAsnArgPhePro CysGlyMetGlu Val HisSerGly GlnArgGlu LeuGluSerValVal AlaValGlyGlu Ala MetAlaLeu LysPhePro MetGlyAlaMetSer TyrCysLeuArg Asp ArgSerArg PheLeuPhe ArgLeuProMetGly LeuSerCysPro Leu GlnValGln <210> 15 <211> 321 <212> PRT
<213> Homo sapiens <400> 15 Met Ala GluAla GluGluAspCysHis SerAspThrValArg AlaAsp Asp Asp GluGlu AsnGluSerProAla GluThrAspLeuGln AlaGln Leu Gln MetPhe ArgAlaGlnTrpMet PheGluLeuAlaPro GlyVal Ser Ser SerAsn LeuGluAsnArgPro CysArgAlaAlaArg GlySex Leu Gln LysThr SerAlaAspThrLys GlyLysG1nGluGln AlaLys 60 Glu Glu LysAla ArgGluLeuPheLeu LysAlaValGluGlu GluGln Asn Gly AlaLeu TyrGluAlaIleLys PheTyrArgArgAla MetGln Leu Val ProAsp IleGluPheLysIle ThrTyrThrArgSer ProAsp Gly Asp GlyVal GlyAsnSerTyrIle GluAspAsnAspAsp AspSer Lys Met AlaAspLeu LeuSerTyrPheGln GlnGlnLeu ThrPheGln Glu Ser ValLeuLys LeuCysGlnProGlu LeuGluSer SerGlnIle 5 His Ile SerValLeu ProMetGluValLeu MetTyrIle PheArgTrp Val Val SerSerAsp LeuAspLeuArgSer LeuGluGln LeuSerLeu Val Cys ArgGlyPhe TyrIleCysAlaArg AspProGlu IleTrpArg

10 210 215 220 Leu Ala CysLeuLys ValTrpGlyArgSer CysIleLys LeuValPro Tyr Thr SerTrpArg GluMetPheLeuGlu ArgProArg ValArgPhe Asp Gly ValTyrIle SerLysThrThrTyr IleArgGln GlyGluGln Ser Leu AspGlyPhe TyrArgAlaTrpHis GlnValGlu TyrTyrArg Tyr Ile ArgPhePhe ProAspGlyHisVal MetMetLeu ThrThrPro Glu Glu ProGlnSer IleValProArgLeu ArgThrArg GluTyrGln Asp <210> 16 <211> 172 <212> PRT

<213> Homo s sapien <900> 16 Ala Cys ThrHisPro ProProProThr AlaProArgGly HisGln Pro Ser Cys LeuGlyAsp SerTrpSerVal LysSerArgTrp CysPro Arg Cys Pro GluLeuGly TrpAlaSerCys AlaArgGlyVal CysAla Gln Trp Ser CysAlaTrp IleCysIlePhe IleAlaLeuLeu ValGlu Phe Thr Pro ProValHis ProAlaLysThr ProGlnA.laAla CysGly Arg Ser Arg LeuProPro PheProArgCys ProLeuA:rgAla ArgAla Thr Ala Thr AlaCysTrp LeuArgProPro LeuGlyG:LnAla LeuAla Gln Gln Pro GluTrpGly ValValGlyGln SerProArgSer TrpAla Ala Pro Ala AlaHisArg AlaArgProHis ProAlaAlaPro ArgThr Gln Ala Thr GlyValLeu ProLeuCysPro AlaProGlyThr AsnSer Arg Met Phe ValCysLeu CysLeuPhePhe LysLys Gly <210> 17 <211> 472 <212> PRT
<213> Homo sapiens <400> 17 Met Arg Glu Arg Phe Arg Asn Leu Asp Glu Glu Val Gl.u Lys Tyr Arg Ala Val Tyr Asn Lys Leu Arg Tyr Glu His Thr Phe Leu Lys Ser Glu Phe Glu His Gln Lys Glu Glu Tyr Ala Arg Ile Leu Asp Glu Gly Lys Ile Lys Tyr Glu Ser Glu Ile Ala Arg Leu Glu Glu Asp Lys Glu Glu Leu ArgAsn GlnLeuLeuAsnVal AspLeu Asp Arg Thr Ser Lys Lys Val GluGln LeuAlaArgGluLys ValTyrLeuCysGln LysLeu Lys Gly LeuGlu AlaGluValAlaGlu LeuLysAlaGluLys GluAsn Ser Glu AlaGln ValGluAsnAlaGln ArgIleGlnValArg GlnLeu Ala Glu MetGln AlaThrValArgSer LeuGlyAlaGluI~ysGlnSer Ala Asn LeuArg AlaGluArgLeuGlu LysGluLeuGlnSer SerSer Glu Gln AsnThr PheLeuIleAsnLys LeuHisLysAlaGlu ArgGlu Ile Asn ThrLeu SerSerLysValLys GluLeuLysHisSer AsnLys Leu Glu IleThr AspIleLysLeuGlu ThrAlaArgAlaLys SerGlu Leu Glu ArgGlu ArgAsnLysLeuGln SerGluLeuAspGly LeuGln Sex Asp AsnGlu IleLeuLysAlaAla ValGluHisHisLys ValLeu Leu Val GluLys AspArgGluLeuIle ArgLysValGlnAla AlaLys Glu Glu GlyTyr GlnLysLeuValVal LeuGlnAspGluLys LeuGlu Leu Glu AsnArg LeuAlaAspLeuGlu LysMetLysValGlu HisAsp Val Trp ArgGln SerGluLysAspGln TyrGluGluLysLeu ArgAla Ser Gln MetAla GluGluIleThrArg LysGluLeuGlnSer ValArg Leu Lys LeuGln GlnGlnIleVal.Thr IleGluAsnAlaG1u LysGlu Lys Asn GluAsn SerAspLeuLysGln GlnIleSerSerLeu GlnIle Gln Val ThrSer LeuAlaGlnSerGlu AsnAspLeuLeuAsn SerAsn Gln Met LeuLys GluMetValGluArg LeuLysGlnGluCys ArgAsn Phe Arg SerGln AlaGluLysAlaGln LeuGluAlaGluLys ThrLeu Glu Glu LysGln IleGlnTrpLeuGlu GluLysHisLysLeu HisAsp Arg Ile ThrAsp ArgGluGluLysTyr AsnGlnAlaLysG:LuLysLeu Gln Arg AlaAla IleAlaGlnLysLys ArgLysSerLeuHis GluAsn Lys Leu LysArg LeuGlnGluLysVal GluValLeuGluAla LysLys Glu Glu LeuGlu ThrGluIleArgSer <210> 18 <211> 962 <212> PRT
<213> Homo Sapiens <400> 18 , Lys Ala Thr Ser Leu Thr Leu Glu Gly Gly Arg Leu Lys Arg Thr Pro Gln Leu Ile His Gly Arg Asp Tyr Glu Met Val Pro G1u Pro Val Trp Arg Ala Leu Tyr His Trp Tyr Gly Ala Asn Leu Ala Leu Pro Arg pro Val Ile Lys Asn Ser Lys Thr Asp Ile Pro Glu Leu Glu Leu Phe Pro Arg Tyr Leu Gln Pro Gln Leu Phe Ala Leu Thr Arg Arg Gln Thr Gln Ser Asn IleTrpVal AsnMetGlyAsn ValProSerProAsn AlaPro Leu Lys ArgValLeu AlaTyrThrGly CysPheSerArgMet GlnThr Ile Lys GluIleHis GluTyrLeuSer GlnArgLeuArgIle LysGlu Glu Asp MetArgLeu TrpLeuTyrAsn SerGluAsnTyrLeu ThrLeu Leu Asp AspGluAsp HisLysLeuGlu TyrLeuLysIleGln AspGlu Gln His LeuValIle GluValArgAsn LysAspMetSerTrp ProGlu Glu Met SerPheIle AlaAsnSerSer LysIleAspArgHis LysVal Pro Thr GluLysGly AlaThrGlyLeu SerAsnLeuGlyAsn ThrCys Phe Met AsnSerSex IleGlnCysVal SerAsnThrGlnPro LeuThr Gln Tyr PheIleSer GlyArgHisLeu TyrGluLeuAsnArg ThrAsn Pro Ile GlyMetLys GlyHisMetAla LysCysTyrG.lyAsp LeuVal Gln Glu LeuTrpSer GlyThrGlnLys AsnValAlaProLeu LysLeu Arg Trp ThrIleAla LysTyrAlaPro ArgPheAsnGlyPhe GlnGln Gln Asp SerGlnGlu LeuLeuAlaPhe LeuLeuAspGlyLeu HisGlu Asp Leu AsnArgVal HisGluLysPro TyrValGluLeuLys AspSer Asp Gly ArgProAsp TrpGluValAla AlaGluAlaTrpAsp AsnHis Leu Arg ArgAsnArg SerIleValVal AspLeuPheHisGly GlnLeu Arg Ser GlnValLys CysLysThrCys GlyHisIleSerVal ArgPhe Asp Pro PheAsnPhe LeuSerLeuPro LeuProMetAspSer TyrMet His Leu GluIleThr ValIleLysLeu AspGlyThrThrPro ValArg Tyr Gly LeuArgLeu AsnMetAspGlu LysTyrThrGlyLeu LysLys Gln Leu SerAspLeu CysGlyLeuAsn SerGluGlnIleLeu LeuAla Glu Val HisGlySer AsnIleLysAsn PheProGlnAsp ProLys Asn Ser Thr GluLeuLeu SerGluValGly PhePheGlyValPro <210> 19 <211> 293 <212> PRT
<213> Homo sapiens <400> 19 Pro Thr Trp Leu Glu Arg Gly Gly Gly Glu Pro Ala Ala Arg Pro Gln Thr Pro Gln Pro Thr Ala Pro Glu Ser Arg Gly Pro Ser Gly Ala Ser Ala Leu Arg Cys Arg Gly Pro Thr Ala Arg Ser Leu Pro Ala Ala Ser Met Leu Gly Ala Pro Asp Glu Ser Ser Val Arg Val Ala Val Arg Ile Arg Pro Gln Leu Ala Lys Glu Lys Ile Glu Gly Cys His Ile Cys Thr Ser ValThrPro GlyGluProGln ValPheLeuGly LysAspLysAla Phe ThrPheAsp TyrValPheAsp IleAspSerGln GlnGluGlnIle Tyr IleGlnCys IleGluLysLeu IleGluGlyCys PheGluGlyTyr Asn AlaThrVal PheAlaTyrGly GlnThrGlyAla GlyLysThrTyr l0 Thr MetGlyThr GlyPheAspVal AsnIleValGlu GluGluLeuGly Ile IleSerArg AlaValLysHis LeuPheLysSer :IleGluGluLys Lys HisIleAla IleLysAsnGly LeuProAlaPro AspPheLysVal Asn AlaGlnPhe LeuGluLeuTyr AsnGluGluVal LeuAspLeuPhe Asp ThrThrArg AspIleAspAla LysSerLysLys SerAsnIleArg 20 Ile HisGluAsp SerThrGlyGly AsnLeuTyrCys GlyArgPheGln 225 230 235 2q0 His ValLeu 25 <210> 20 <211> 223 <212> PRT
<213> Homo sapiens 30 <400> 20 Gly AsnTyrArg ProSerLysLys ArgPheArgGlu GlyLysGluLys Lys ArgGlyLys LysValTrpLeu ValLysArgIle IleGlnThrLeu 35 Thr LysArgArg LysLysLysArg ValPheArgLys GluLysProAsn Glu LeuGluVal GluGluSerGln GluValSerAsp HisGluAspGlu Glu GluGluGlu GluGluGluGlu AspAspIleAsp GlyGlyGluSer Ser AspGluSer AspSerGluSer AspGluLysAla TyrGlnAlaAsp Leu AlaAsnIle ThrCysGluIle AlaIleLysGln LysLeuIleAsp 45 Glu LeuGluAsn SerGlnLysArg LeuGlnThrLeu LysLysGlnTyr Glu GluLysMet MetLeuGlnHis LysIleArgAsp ThrGlnLeuGlu Arg AspGlnVal LeuGlnAsnLeu GlySerValGlu SerTyrSerGlu Glu LysAlaLys LysValArgSer GluTyrGluLys LysLeuGlnAla Met AsnLysGlu LeuGlnArgLeu GlnAlaAlaGln LysGluHisAla 55 Arg LeuLeuLys AsnGlnSerGln TyrGluLysLeu LysLysLeuGln Gln AspValMet GluMetLysLys ThrLysValArg LeuMetLys 60 <210> 21 <211> 206 <212> PRT
<213> Homo sapiens 65 <400> 21 Met Asn Lys Pro Ile Thr Pro Ser Thr Tyr Val Arg Cys Leu Asn Val Gly Leu Ile Arg Lys Leu Ser Phe Ile Pro Gln Glu Gly Asp Asp Trp Lys Lys Leu Ala Val Ala Ile Lys Pro Gly Asp Asp Arg Lys Ser Tyr Asn Gln Phe His Ile Arg Arg Glu Ala Leu Gln Thr Gly Phe Leu Lys Ser Pro Thr Ser Glu Leu Leu Asp Trp Thr Thr Asn Cys Phe Gly Thr Val Gly Asp Leu Val Asp Leu Ile Gln Glu Phe Phe Ala Leu Asn Pro Ala Ser Leu Leu Leu Pro Asp Val Pro Thr Ala Asn Thr Ala Lys Leu Pro Ser Lys Glu Ala Ile Thr Gln Gln Gln Met Pro Phe Val Lys Cys Asp Lys Asp Arg Thr Leu Met Pro Val Asn heu Glu Gln Thr Gln Ser Tyr Met Pro Pro Asp Ser Ser Pro Glu Lys Ser Leu Glu Ser Asn Val Ser Asp Thr Arg Phe His Ser Ser Phe Glu Leu Lys Asn Phe Tyr Val Thr Asn Asn Phe Asp Glu Arg Ile Ser Gly Gly Asn Lys Pro Val Met Gly Glu Gly Gly Phe Gly Val Tyr Lys Leu Arg Lys Val Gly <210> 22 <211> 1260 <212> DNA

<213> Homo sapiens <400> 22 cttctccgca cgactgttac agaggtctccagagccttctctctcctgtg caaaatggca60 actcttaagg aaaaactcat tgcaccagttgcggaagaagaggcaacagt tccaaacaat120 aagatcactg tagtgggtgt tggacaagttggtatggcgtgtgctatcag cattctggga180 aagtctctgg ctgatgaact tgctcagatgttttggaagataagct taaaggagaa290 tgtg atgatggatc tgcagcatgg gagcttatttcttcagacacctaaaattgt ggcagataaa300 gattattctg tgaccgccaa ttctaagattgtagtggtaactgcaggagt ccgtcagcaa360 gaaggggaga gtcggctcaa tctggtgcagagaaatgttaatgtcttcaa attcattatt420 cctcagatcg tcaagtacag tcctgattgcatcataattgtggtttccaa cccagtggac480 attcttacgt atgttacctg gaaactaagtggattacccaaacaccgcgt gattggaagt540 ggatgtaatc tggattctgc tagatttcgctaccttatggctgaaaaact tggcattcat600 cccagcagct gccatggatg gattttgggggaacatggcgactcaagtgt ggctgtgtgg660 agtggtgtga atgtggcagg tgtttctctccaggaattgaatccagaaat gggaactgac720 aatgatagtg aaaattggaa ggaagtgcataagatggtggttgaaagtgc ctatgaagtc780 atcaagctaa aaggatatac caactgggctattggattaagtgtggctga tcttattgaa890 tccatgttga aaaatctatc caggattcatcccgtgtcaacaatggtaaa ggggatgtat900 ggcattgaga atgaagtctt cctgagccttccatgtatcctcaatgcccg gggattaacc960 agcgttatca accagaagct aaaggatgatgaggttgctcagctcaagaa aagtgcagat1020 accctgtggg acatccagaa ggacctaaaagacctgtgactagtgagctc taggctgtag1080 aaatttaaaa actacaatgt gattaactcgagcctttagttttcatccat gtacatggat1190 cacagtttgc tttgatcttc ttcaatatgtgaatttgggctcacagaatc aaagcctatg1200 cttggtttaa tgcttgcaat ctgagctcttgaacaaataaaattaactat tgtagtgtga1260 <210> 23 <211> 3151 <212> DNA
<213> Homo spaiens <900> 23 taacacagtt gtgaaaagag atggatgtgg gttccagtcc tagccctgcc tgtgtgcact 60 tatgcagaaa cgctaatgga ctccactaca gcgactgctg agctgggctg gatggtgcat 120 cctccatcag ggtgggaaga ggtgagtggc tacgatgaga acatgaacac gatccgcacg 180 taccaggtgt gcaacgtgtt tgagtcaagc cagaacaact ggctacggac caagtttatc 240 cggcgccgtg gcgcccaccg catccacgtg gagatgaagt tttcggtgcg tgactgcagc 300 agcatcccca gcgtgcctgg ctcctgcaag gagaccttca acctctatta ctatgaggct 360 gactttgact cggccaccaa gaccttcccc aactggatgg agaatccatg ggtgaaggtg 920 gataccattg cagccgacga gagcttctcc caggtggacc tgggtgaccg cgtcatgaaa 980 atcaacaccg aggtgcggag cttcggacct gtgtcccgca gcggcttcta 540 cctggccttc caggactatg gcggctgcat gtccctcatc gccgtgcgtg tcttctaccg 600 caagtgcccc cgcatcatcc agaatggcgc catcttccag gaaaccctgt cgggggctga 660 gagcacatcg t c 720 S ggtggctg cccggggcag ctgcatcgcc aatgcggaag aggtggatgt acccatcaag ctctactgta acggggacgg cgagtggctg gtgcccatcg ggcgctgcat 780 gtgcaaagca ggcttcgagg ccgttgagaa tggcaccgtc tgccgaggtt gtccatctgg 840 gactttcaag gccaaccaag gggatgaggc ctgtacccac tgtcccatca acagccggac 900 cacttctgaa ggggccacca actgtgtctg ccgcaatggc tactacagag cagacctgga 960 ccccctggac atgccctgca caaccatccc ctccgcgccc caggctgtga tttccagtgt 1020 10 caatgagacc tccctcatgc tggagtggac ccctccccgc gactccggag gccgagagga 1080 cctcgtctac aacatcatct gcaagagctg tggctcgggc cggggtgcct gcacccgctg 1190 cggggacaat gtacagtacg caccacgcca gctaggcctg accgagccac gcatttacat 1200 cagtgacctg ctggcccaca cccagtacac cttcgagatc caggctgtga acggcgttac 1260 tgaccagagc cccttctcgc ctcagttcgc ctctgtgaac atcaccacca accaggcagc 1320 IS tccatcggca gtgtccatca tgcatcaggt gagccgcacc gtggacagca ttaccctgtc 1380 gtggtcccag ccagaccagc ccaatggcgt gatcctggac tatgagctgc agtar_tatga 1940 gaagcaggag ctcagtgagt acaacgccac agccataaaa agccccacca acacggtcac 1500 cgtgcagggc ctcaaagccg gcgccatcta tgtcttccag gtgcgggcac gcacc:gtggc 1560 aggctacggg cgctacagcg gcaagatgta cttccagacc atgacagaag ccgat:tacca 1620 gacaagcatc caggagaagt tgccactcat catcggctcc tcggccgctg gcctggtctt 1680 cctcattgct gtggttgtca tcgccatcgt gtgtaacaga cgggggtttg agcgtgctga 1790 ctcggagtac acggacaagc tgcaacacta caccagtggc cacatgaccc caggc:atgaa 1800 gatctacatc gatcctttca cctacgagga ccccaacgag gcagtgcggg agtttgccaa 1860 ggaaattgac atctcctgtg tcaaaattga gcaggtgatc ggagcagggg agttt.ggcga 1920 2S ggtctgcagt ggccacctga agctgccagg caagagagag atctttgtgg ccatcaagac 1980 gctcaagtcg ggctacacgg agaagcagcg ccgggacttc ctgagcgaag cctccatcat 2090 gggccagttc gaccatccca acgtcatcca cctggagggt gtcgtgacca agagcacacc 2100 tgtgatgatc atcaccgagt tcatggagaa tggctccctg gactcctttc tccggcaaaa 2160 cgatgggcag ttcacagtca tccagctggt gggcatgctt cggggcatcg cagctggcat 2220 gaagtacctg gcagacatga actatgttca ccgtgacctg gctgcccgca acatcctcgt 2280 caacagcaac ctggtctgca aggtgtcgga ctttgggctc tcacgctttc tagaggacga 2340 tacctcagac cccacctaca ccagtgccct gggcggaaag atccccatcc gctggacagc 2400 cccggaagcc atccagtacc ggaagttcac ctcggccagt gatgtgtgga gctacggcat 2460 tgtcatgtgg gaggtgatgt cctatgggga gcggccctac tgggacatga ccaaccagga 2520 tgtaatcaat gccattgagc aggactatcg gctgccaccg cccatggact gcccagctgc 2580 cctgcaccaa ctcatgctgg actgttggca gaaggaccgc aaccaccggc ccaagttcgg 2690 ccaaattgtc aacacgctag acaagatgat ccgcaatccc aacagcctca aagccatggc 2700 gcccctctcc tctggcatca acctgccgct gctggaccgc acgatccccg actacaccag 2760 ctttaacacg gtggacgagt ggctgaaggc catcaagatg gggcagtaca aggagagctt 2820 cgccaatgcc ggcttcacct cctttgacgt cgtgtctcag atgatgatgg aggacattct 2880 ccgggttggg gtcactttgg ctggccacca gaaaaaaatc ctgaacagta tccaggtgat 2940 gcgggcgcag atgaaccaga ttcagtctgt ggaggtttga cattcacctg cctcggctca 3000 cctcttcctc caagccccgc cccctctgcc ccacgtgccg gccctcctgg tgctctatcc 3060 actgcagggc cagccactcg ccaggaggcc acgggcacgg gaagaaccaa gcggtg ccag 3120 4S ccacgagacg t caccaagaa aacatgcaac tcaaacgacg g 3151 <210> 29 <211> 1234 <212> DNA

<213> Homo Sapiens <400> 29 tagttcaaga caacagagac aaagctaaga tgaggaagtt ctgtacagtt 60 taggaaatag aggctttcaa agataattcg cagtgatgtg aaactggcct cccaagccct 120 gataacaaca tggccaacgc cctggccagc gccacttgcg agcgctgcaa gggcggcttt 180 gcgcccgctg agaagatcgt gaacagtaat ggggagctgt accatgagca gtgtttcgtg 240 tgcgctcagt gcttccagca gttcccagaa ggactcttct atgagtttga aggaagaaag 300 tactgtgaac atgactttca gatgctcttt gccccttgct gtcatcagtg tggtgaattc 360 atcattggcc gagttatcaa agccatgaat aacagctggc atccggagtg cttccgctgt 420 gacctctgcc aggaagttct ggcagatatc gggtttgtca agaatgctgg gagacacctg 480 tgtcgcccct gtcataatcg tgagaaagcc agaggccttg ggaaatacat ctgccagaaa 590 tgccatgcta tcatcgatga gcagcctctg atattcaaga acgaccccta ccatccagac 600 catttcaact gcgccaactg cgggaaggag ctgactgccg atgcacggga gctgaaaggg 660 gagctatact gcctcccatg ccatgataaa atgggggtcc ccatctgtgg tgcttgccga 720 cggcccatcg 6S aagggcgcgt ggtgaacgct atgggcaagc agtggcatgt ggagcatttt 780 gtttgtgcca agtgtgagaa accctttctt ggacatcgcc attatgagag gaaaggcctg 890 gcatattgtg aaactcacta taaccagcta tttggtgatg tttgcttcca ctgcaatcgt 900 gttatagaag gtgatgtggtctctgctcttaataaggcctggtgcgtgaactgctttgcctgttctacct 960 gcaacactaaattaacactcaagaataagtttgtggagtttgac:atgaagccagtctgta 1020 agaagtgctatgagatttccattggagctgaagaaaagacttaagaaactagctgagacc 1080 ttaggaaggaaataagttcctttattttttcttttctatgcaagataagagattaccaac 1190 attacttgtcttgatctacccatatttaaagctatatctcaaagcagttgagagaagagg 1200 acctatatgaatggttttatgtcatttttttaaa <210> 25 <211> 4539 <212> DNA
<213> Homo Sapiens <400> 25 gtcacgagcg aaagccgcgtcagggggcccggccggggcgggggagcccg60 tcgaagagac gggcttgttggtgccccagcccgcgcggagggcccttcggacccgcgcgccgccgctgcc120 gccgccgccgcctcgcaacaggtccgggcggcctcgctctccgctcccctcccccgcatc180 cgcgaccctccggggcacctcagctcggccggggccgcagtctggccacccgcttccatg290 cggttcgggtccaagatgatgccgatgtttcttaccgtgtatctcagtaacaatgagcag300 cacttcacagaagttccagttactccagaaacaatatgcagagacgtggtggatctgtgc360 aaagaacccggcgagagtgattgccatttggctgaagtgtggtgtggctctgtagagata420 gagtttcatcatgttggccaggatggtctcgatctcctgaccttgtgatccgcctgcctc480 ggcctcccaaagtgctggattacaggtgtgagccaccacgatcagcctctagtgtttaaa590 aaagaacgtccagttgcggataatgagcgaatgtttgatgttcttcaacgatttggaagt600 cagaggaacgaagttcgcttcttccttcgtcatgaacgcccccctggcagggacattgtg660 agtggaccaagatctcaggatccaagtttaaaaagaaatggtgtaaaagttcctggtgaa720 tatcgaagaaaggagaacggtgttaatagtcctaggatggatctgactcttgctgaactt780 caggaaatggcatctcgccagcagcaacagattgaagcccagcaacaattgctggcaact840 aaggaacagcgcttaaagtttttgaaacaacaagatcagcgacaacagcaacaagttgct900 gagcaggagaaacttaaaaggctaaaagaaatagctgagaatcaggaagctaagctaaaa960 aaagtgagagcacttaaaggccacgtggaacagaagagactaagc:aatgggaaacttgtg1020 gaggaaattgaacagatgaataatttgttccagcaaaaacagagggagctcgtcctggct1080 gtgtcaaaagtagaagaactgacc,sggcagctagagatgctcaagaacggcaggatcgac1140 agccaccatgacaatcagtctgcagtggctgagcttgatcgcctctataaggagctgcag1200 ctaagaaacaaattgaatcaagagcagaatgccaagctacaacaacagagggagtgtttg1260 aataagcgtaattcagaagtggcagtcatggataagcgtgttaatgagctgagggaccgg1320 ctgtggaagaagaaggcagctctacagcaaaaagaaaatctaccagtttcatctgatgga1380 aatcttccccagcaagccgcgtcagccccaagccgtgtggctgcagtaggtccctatatc1990 cagtcatctactatgcctcggatgccctcaaggcctgaattgctggtgaagccagccctg1500 ccggatggttccttggtcattcaggcttcagaggggccgatgaaaatacagacactgccc1560 aacatgagatctggggctgcttcacaaactaaaggctctaaaatccatccagttggccct1620 gattggagtccttcaaatgcagatcttttcccaagccaaggctctgcttctgtacctcaa1680 agcactgggaatgctctggatcaagttgatgatggagaggttccgctgagggagaaagag1740 aagaaagtgcgtccgttctcaatgtttgatgcagtagaccagtccaatgccccaccttcc1800 tttggtactctgaggaagaaccagagcagtgaagatatcttgcgggatgctcaggttgca1860 aataaaaatgtggctaaagtaccacctcctgttcctacaaaaccaaaacagattaatttg1920 ccttattttggacaaactaatcagccaccttcagacattaagccagacggaagttctcag1980 cagttgtcaacagttgttccgtccatgggaactaaaccaaaaccagcagggcagcagccg2040 agagtgctgctatctcccagcataccttcggttggccaagaccagaccctttctccaggt2100 tctaagcaagaaagtccacctgctgctgccgtccggccctttactccccagccttccaaa2160 gacaccttacttccacccttcagaaaaccccagaccgtggcagcaagttcaatatattcc2220 atgtatacgcaacagcaggcgccaggaaaaaacttccagcaggctgtgcagagcgcgttg2280 accaagactcataccagagggccacacttttcaagtgtatatggtaagcctgtaattgct2390 gctgcccagaatcaacagcagcacccagagaacatttattccaatagccagggcaagcct2900 ggcagtccagaacctgaaacagagcctgtttcttcagttcaggagaaccatgaaaacgaa2960 agaattcctcggccactcagcccaactaaattactgcctttcttatctaatccttaccga2520 aaccagagtgatgctgacctagaagccttacgaaagaaactgtctaacgcaccaaggcct2580 ctaaagaaacgtagttctattacagagccagagggtcctaatgggccaaatattcagaag2690 cttttatatcagaggaccaccatagcggccatggagaccatctctgtcccatcataccca2700 tccaagtcagcttctgtgactgccagctcagaaagcccagtagaaatccagaatccatat2760 ttacatgtggagcccgaaaaggaggtggtctctctggttcctgaatcattgtccccagag2820 gatgtggggaatgccagtacagagaacagtgacatgccagctccttctccaggccttgat2880 tatgagcctgagggagtcccagacaacagcccaaatctccagaataacccagaagaacca2940 aatccagaggctccacatgtgcttgatgtgtacctggaggagtaccctccatacccaccc3000 ccaccatacccatctggggagcctgaagggcccggagaagactcggtgagcatgcgcccg3060 cctgaaatcaccgggcaggtctctctgcctcctggtaaaaggacaaacttgcgtaaaact3120 ggctcagagcgtatcgctcatggaatgagggtgaaattcaacccccatgctttactgcta3180 gattcgtctttggagggagaatttgaccttgtacagagaattattt=atgaggttgatgac3290 ccaagcctgc ccaatgatgaaggcatcacggctcttcacaatgctgtgtgtgcaggccac3300 acagaaatcg ttaagttcctggtacagtttggtgtaaatgtaaatgctgctgatagtgat3360 ggatggactc cattacattgtgctgcctcatgtaacaacgtccaagtgtgtaagtttttg3420 gtggagtcag gagccgctgtgtttgccatgacctacagtgacatgcagactgctgcagat3480 aagtgcgagg aaatggaggaaggctacactcagtgctcccaatttctttatggagttcag3540 gagaagatgg gcataatgaataaaggagtcatttatgcgctttgggattatgaacctcag3600 aatgatgatg agctgcccatgaaagaaggagactgcatgacaatcatccacagggaagac3660 gaagatgaaa tcgaatggtggtgggcgcgccttaatgataaggagggatatgttccacgt3720 aacttgctgg gactgtacccaagaattaaaccaagacaaaggag<a ctgaaacttc3780 tggc cacacagaat tttagtcaatgaagaattaatctctgttaagaagaagtaatacgattatt3840 tttggcaaaa atttcacaagacttattttaatgacaatgtagcttgaaagcgatgaagaa3900 tgtctctaga agagaatgaaggattgaagaattcaccattagaggacatttagcgtgatg3960 aaataaagca tctacgtcagcaggccatactgtgttggggcaaaggtgtcccgtgtagca4020 ctcagataag tatacagcgacaatcctgttttctacaagaatcctgtctagtaaatagga9080 tcatttattgggcagttgggaaatcagctctctgtcctgttgagtgttttcagcagctgc9190 tcctaaacca gtcctcctgccagaaaggaccagtgccgtcacatcgctgtctctgattgt9200 ccccggcacc agcaggccttggggctcactg~aggctcgaaggcactgcacaccttgtat9260 attgtcagtg aagaacgttagttggttgtcagtgaacaataactttattatatgagtttt9320 tgtagcatct taagaattatacatatgtttgaaatattgaaactaagctacagtaccagt4380 aattagatgt agaatcttgtttgtaggctgaattttaatctgtatttattgtcttttgta4990 tctcagaaat tagaaacttgctacagacttacccgtaatatttgtcaagatcatagctga4500 ctttaaaaac agttgtaataaactttttgatgct 9534 <210> 26 <211> 4660 <212> DNA
<213> Homo Sapiens <400> 26 ggggcttagaaattaacaggttgtttatataattggccttaaatgaggtgagagtgaaga60 gactagagccatctctggaaaacatcattatcccattccccgggaagctaccctctggaa120 ctcaagatttgaccatatctgttttgaggattcattatgaacaaagaagtctcccaggtg180 tgaagtttttcaacatgagtggcctcggggacagttcatccgaccctgctaacccagact240 cacataagaggaaaggatcgccatgtgacacactggcatcaagcacggaaaagaggcgca300 gggagcaagaaaataaatatttagaagaactagctgagttactgtctgccaacattagtg360 acattgacagcttgagtgtaaaaccagacaaatgcaagattttga;sgaaaacagtcgatc420 agatacagctaatgaagagaatggaacaagagaaatcaacaactgatgacgatgtacaga480 aatcagacatctcatcaagtagtcaaggagtgatagaaaaggaatccttgggaccccttc590 ttttggaggctttggatggatttttctttgttgtgaactgtgaagggagaattgtatttg600 tgtcagagaatgtaaccagctacttaggttacaatcaggaggaattaatgaataccagcg660 tctacagcatactgcacgtgggggatcatgcagaatttgtgaagaatctgctaccaaaat720 cactagtaaatggagttcct.tggcctcaagaggcaacacgacgaaatagccataccttta780 actgcaggatgctaattcaccctccagatgagccagggaccgagaaccaagaagcttgcc840 agcgttatgaagtaatgcagtgtttcactgtgtcacagccaaaatcaattcaagaggatg900 gagaagatttccagtcatgtctgatttgtattgcacggcgattac<a cctccagcta960 cgg ttacgggtgtagaatcctttatgaccaagcaagatactacaggtaaaatcatctctattg1020 atactagttccctgagagctgctggcagaactggttgggaagatttagtgaggaagtgca1080 tttatgcttttttccaacctcagggcagagaaccatcttatgccagacagctgttccaag1140 aagtgatgactcgtggcactgcctccagcccctcctatagattcatattgaatgatggga1200 caatgcttagcgcccacaccaagtgtaaactttgctaccctcaaagtccagacatgcaac1260 ctttcatcatgggaattcatatcatcgacagggagcacagtgggctttctcctcaagatg1320 acactaattctggaatgtcaattccccgagtaaatccctcggtcaatcctagtatctctc1380 cagctcatggtgtggctcgttcatccacattgccaccatccaacagcaacatggtatcca1940 ccagaataaaccgccagcagagctcagaccttcatagcagcagtcatagtaattctagca1500 acagccaaggaagtttcggatgctcacccggaagtcagattgtagc:caatgttgccttaa1560 accaaggacaggccagttcacagagcagtaatccctctttaaacct.caataattctccta1620 tggaaggtacaggaatatccctagcacagttcatgtctccaaggagacaggttacttctg1680 gattggcaacaaggcccaggatgccaaacaattcctttcctcctaatatttcgacattaa1740 gctctcccgttggcatgacaagtagtgcctgtaataataataaccgatcttattcaaaca1800 tcccagtaacatctttacagggtatgaatgaaggacccaataactccgttggcttctctg1860 ccagttctccagtcctcaggcagatgagctcacagaattcacctagcagattaaatatac1920 aaccagcaaaagctgagtccaaagataacaaagagattgcctcaattttaaatgaaatga1980 ttcaatctgacaacagctctagtgatggcaaacctctggattcagggcttctgcataaca2090 atgacagactttcagatggagacagtaaatactctcaaaccagtcacaaactagtgcagc2100 ttttgacaacaactgccgaacagcagttacggcatgctgatatagacacaagctgcaaag2160 atgtcctgtcttgcacaggcacttccaactctgcctctgctaactcttcaggaggttctt2220 gtccctcttctcatagctcattgacagaacggcataaaattctacaccggctcttacagg2280 agggtagccc ctcagatatc accactttgt ctgtcgagcc tgataaaaag 2340 gacagtgcat ctacttctgt gtcagtgact ggacaggtac aaggaaactc cagtataaaa 2900 ctagaactgg atgcttcaaa gaaaaaagaa tcaaaagacc atcagctcct acgctatctt 2960 ttagataaag atgagaaaga tttaagatca actccaaacc tgagcctgga tgatgtaaag 2520 gtgaaagtgg aaaagaaaga acagatggat ccatgtaata caaacccaac cccaatgacc 2580 aaacccactc ctgaggaaat aaaactggag gcccagagcc agtttacagc tgaccttgac 2640 cagtttgatc agttactgcc cacgctggag aaggcagcac agttgccagg cttatgtgag 2700 acagacagga tggatggtgc ggtcaccagt gtaaccatca aatcggagat cctgccagct 2760 tcacttcagt ccgccactgc cagacccact tccaggctaa atagattacc tgagctggaa 2820 ttggaagcaa l0 ttgataacca atttggacaa ccaggaacag gcgatcagat tccatggaca 2880 aataatacag tgacagctat aaatcagagt aaatcagaag accagtgtat tagctcacaa 2940 ttagatgagc ttctctgtcc acccacaaca gtagaaggga gaaatgatga gaaggctctt 3000 cttgaacagc tggtatcctt ccttagtggc aaagatgaaa ctgagctagc tgaactagac 3060 agagctctgg gaattgacaa acttgttcag gggggtggat tagatgtatt atcagagaga 3120 tttccaccac IS aacaagcaac gccacctttg atcatggaag aaagacccaa cctttattcc 3180 cagccttact cttctccttc tcctactgcc aatctcccta gccctttcca aggc<itggtc 3240 aggcaaaaac cttcactggg gacgatgcct gttcaagtaa cacctccccg aggt<~ctttt 3300 tcacctggca tgggcatgca gcccaggcaa actctaaaca gacctccggc tgcac:ctaac 3360 cagcttcgac ttcaactaca gcagcgatta cagggacaac agcagttgat acacc:aaaat 3420 cggcaagcta 20 tcttaaacca gtttgcagca actgctcctg ttggcatcaa tatgagatca 3480 ggcatgcaac agcaaattac acctcagcca cccctgaatg ctcaaatgtt ggcac:aacgt 3590 cagcgggaac tgtacagtca acagcaccga cagaggcagc taatacagca gcaaagagcc 3600 atgcttatga ggcagcaaag ctttgggaac aacctccctc cctcatctgg actac:cagtt 3660 caaatgggga acccccgtct tcctcagggt gctccacagc aattccccta tccac:caaac 3720 tatggtacaa 25 atccaggaac cccacctgct tctaccagcc cgttttcaca actagcagca 3780 aatcctgaag catccttggc caaccgcaac agcatggtga gcagaggcat gacaggaaac 3890 ataggaggac agtttggcac tggaatcaat cctcagatgc agcagaatgt cttccagtat 3900 ccaggagcag gaatggttcc ccaaggtgag gccaactttg ctccatctct aagccctggg 3960 agctccatgg tgccgatgcc aatccctcct cctcagagtt ctctgctcca gcaaactcca 4020 cctgcctccg 30 ggtatcagtc accagacatg aaggcctggc agcaaggagc gataggaaac 4080 aacaatgtgt tcagtcaagc tgtccagaac cagcccacgc ctgcacagcc aggagtatac 9190 aacaacatga gcatcaccgt ttccatggca ggtggaaata cgaatgttca gaacatgaac 9200 ccaatgatgg cccagatgca gatgagctct ttgcagatgc caggaatgaa cactgtgtgc 9260 cctgagcaga taaatgatcc cgcactgaga cacacaggcc tctactgcaa ccagctctca 9320 tccactgacc 35 ttctcaaaac agaagcagat ggaacccagg tgcaacaggt tcaggtgttt 4380 gctgacgtcc agtgtacagt gaatctggta ggcggggacc cttacctgaa ccagcctggt 4490 ccactgggaa ctcaaaagcc cacgtcagga ccacagaccc cccaggccca gcagaagagc 4500 ctccttcagc agctactgac tgaataacca ctttr_aaagg aatgtgaaat ttaaataata 4560 gacatacaga gatatacaaa tatattatat atttttctga gatttttgat atctcaatct 9620 gcagccattc 40 ttcaggtcgt agcatttgga gcaaaaaaaa aaaaaaaaaa 9660 <210> 27 <211> 6773 <212> DNA

45 <213> Homo sapiens <400> 27 gcggctggtt cgggccggc ggcgggctgg cggagatgga ggatcttgtt 60 g caagatgggg tggcttcacc gctacccct gggaccggga aatctaagaa ttggagaaag 120 a aaattgaaga 50 actcagatca aacctgtta ctgaaggaac tggtgatatt attaaggcat 180 a taactgaacg tctggatgct ttcttctgg aaaaagcaga gactgagcaa cagtgtcttt 240 c ctctgaaaaa ggaaaatata 300 aaaatgaagc aagaggttga ggattctgta acaaagatgg gagatgcaca taaggagttg 360 gaacaatcac atataaacta tgtgaaagaa attgaaaatt tgaaaaatga gttgatggca 420 gtacgttcca aatacagtga agacaaagct aacttacaaa agcagctgga 55 agaagcaatg 480 aatacgcaat tagaactttc agaacaactt aaatttcaga acaactctga agataatgtt 540 aaaaaactac aagaagagat tgagaaaatt aggccaggct ttgaggagca aattttatat 600 ctgcaaaagc aattagacgc taccactgat gaaaagaagg aaacagttac tcaactccaa 660 aatatcattg aggctaattc tcagcattac caaaaaaata ttaatagttt gcaggaagag 720 cttttacagt tgaaagctat acaccaagaa gaggtgaaag agttgatgtg 60 ccagattgaa 780 gcatcagcta aggaacatga agcagagata aataagttga acgagctaaa agagaactta 840 gtaaaacaat gtgaggcaag tgaaaagaac atccagaaga aatatgaatg tgagttagaa 900 aatttaagga aagccacctc aaatgcaaac caagacaatc agatatgttc tattctcttg 960 caagaaaata catttgtaga acaagtagta aatgaa<~aag tcaaacactt agaagatacc 1020 ttaaaagaac ttgaatctca acacagtatc ttaaaagatg aggtaactta 65 tatgaataat 1080 cttaagttaa aacttgaaat ggatgctcaa catataaagg atgagttttt tcatgaacgg 1140 gaagacttag agtttaaaat taatgaatta ttactagcta aagaagaaca gggctgtgta 1200 attgaaaaat taaaatctga gctagcaggt ttaaataaac agttttgcta tactgtagaacagcataaca 1260 gagaagtaca gagtcttaag gaacaacatc aaaaagaaat atcagaactaaatgagacat 1320 ttttgtcaga ttcagaaaaa gaaaaattaa cattaatgtt tgaaatacagggtcttaagg 1380 aacagtgtga aaacctacag caagaaaagc aagaagcaat tttaaattatgagagtttac ggaaatttta 1990 gagagattat caaacagaac tgggggaatc tgctggaaaaataagtcaag cagcaagcatctgatgttca1500 agttcgaatc aatgaagcaa tgaactgcagcagaagctcagaactgcttttactgaaaaagatgcccttctcgaaactgt1560 gaatcgcctccagggagaaaatgaaaagttactatctcaacaagaattggtaccagaact1620 tgaaaataccataaagaaccttcaagaaaagaatggagtatacttacttagtctcagtca1680 aagagataccatgttaaaagaattagaaggaaagataaattctcttactgaggaaaaaga1740 tgattttataaataaactgaaaaatt.cccatgaagaaatggataatttccataagaaatg1800 tgaaagggaagaaagattgattcttgaacttgggaagaaagtagagcaaacaatccagta1860 caacagtgaactagaacaaaaggtaaatgaattaacaggaggactagaggagactttaaa1920 agaaaaggatcaaaatgaccaaaaactagaaaaacttatggttcaaatgaaagttctctc1980 tgaagacaaagaagtattgtcagctgaagtgaagtctctttatgaggaaaacaataaact2040 cagttcagaaaaaaaacagttgagtagggatttggaggtttttttgtctcaaaaagaaga2100 tgttatccttaaagaacatattactcaattagaaaagaaacttcagttaatggttgaaga2160 gcaagataatttaaataaactgcttgaaaatgagcaagttcagaagttatttgttaaaac2220 tcagttgtatggttttcttaaagaaatgggatcagaagtttcagaagacagtgaagagaa2280 agatgttgttaatgtcctacaggcagtcggtgaatccttggcaaaaataaatgaggaaaa2340 atgcaacctggcttttcagcgtgatgaaaaagtattagagttagaaa agattaagtg2400 aag ccttcaagaagagagtgtagttcagtgtgaagaacttaagtctttattgagagactatga2960 gcaagagaaagttctcttaaggaaagagttagaagaaatacagtcagaaaaagaggccct2520 gcagtctgatcttctagaaatgaagaatgctaatgaaaaaacaaggcttgaaaatcagaa2580 tcttttaattcaagttgaagaagtatctcaaacatgtagcaaaagtgaaatccataatga2690 aaaagaaaaatgttttataaaggaacatgaaaacctaaagccactactagaacaaaaaga2700 attacgagataggagagcagagttgatactattaaaggattccttagcaaaatcaccttc2760 tgtaaaaaatgatcctctgtcttcagtaaaagagttggaagaaaaaatagaaaatctgga2820 aaaagaatgcaaagaaaaggaggagaaaataaataagataaaattagttgccgtaaaggc2880 aaagaaagaactagattccagcagaaaagagacccagactgtgaaggaagaacttgaatc2990 tcttcgatc gaaaaggacca ttccatgagagatctcattcaaggagcaga3000 agttatctgc aagctataag.aatcttttattagaatatgaaaagcagtcagagcaac:tggatgtggaaaa3060 agaacgtgctaataattttgagcatcgtattgaagaccttacaagacaattaagaaattc3120 gactttgcagtgtgaaacaataaattctgataatgaagatctcctggctcgtattgagac3180 attacagtctaatgccaaattattagaagtacagattttagaagtcc:agagagccaaagc3290 aatggtagacaaagaattagaagctgaaaaacttcagaaagaacagaagataaaggaaca3300 tgccactactgtaaatgaacttgaagaacttcaggtacaacttcaaaaggaaaagaaaca3360 gcttcagaaaaccatgcaagaattagagctggttaaaaaggatgccc:aacaaaccacatt3420 gatgaatatggaaatagctgattatgaacgtttgatgaaagaactaaatcaaaagttaac3480 taataaaaacaacaagatagaagatttggagcaagaaataaaaattcaaaaacagaaaca3540 agaaaccctacaagaagaaataacttcattacagtcttcagtacaacaatatgaagaaaa3600 aaacaccaaaatcaagcaattgcttgtgaaaaccaaaaaggaactggcagattcaaagca3660 agcagaaactgatcacttaatacttcaagcatctttaaaaggtgagctggaggcaagcca3720 gcagcaagtagaagtctataaaatacagctggctgaaataacatcagagaagcacaaaat3780 ccacgagcacctgaaaacctctgcggaacagcaccagcgtacgctaagtgcataccagca3840 gagagtgacagcactacaggaagagtgccgtgctgccaaggcagaacaagctactgtaac3900 ctctgaattcgagagctacaaagtccgagttcataatgttctaaaacaacagaaaaataa3960 atctatgtctcaggctgaaactgagggcgctaaacaagaaagggaacatctggaaatgct9020 gattgaccagctaaaaatcaaattacaagatagccaaaataacttacagattaatgtatc4080 tgaacttcaaacattgcagtctgaacatgatacactgctagaaaggcacaacaagatgct4140 gcaggaaactgtgtccaaagaggcggaactccgggaaaaattgtgttcaatacagtcaga4200 gaacatgatgatgaaatctgaacatacacagactgtgagtcagctaacatcccagaacga4260 ggtccttcgaaatagcttccgagatcaagtgcgacatttgcaggaagaacacagaaagac4320 agtggagacattacagcagcagctctccaagatggaagcacagctcttccagcttaagaa4380 tgaaccgaccacaagaagcccagtttcctctcaacaatctttgaagaaccttcgagaaag4440 gagaaacacagacctcccgcttctagacatgcacactgtaacccgggaagagggagaagg4500 catggagacaactgatacggagtctgtgtcttccgccagcacatacacacagtctttaga9560 gcagctgcttaactctcccgaaactaaacttgagcctccattatggcatgctgaatttac4620 caaagaagaattggttcagaagctcagttccaccacaaaaagtgcagatcacttaaacgg4680 cctgcttcgggaaacagaagcaaccaatgcaattcttatggagcaaattaagcttctcaa4740 aagtgaaataagaagattggaaaggaatcaagagcgagagaagtctgcagctaacctgga4800 atacttgaagaacgtcttgctgcagttcattttcttgaaaccaggtagtgaaagagagag4860 acttcttcctgttataaatacgatgttgcagctcagccctgaagaaaagggaaaacttgc4920 tgcggttgctcaaggtgaggaagaaaatgcttcccgttcttctggatgggcatcctatct4980 tcatagttggtctggacttcgataggttgatggaaggaatatttttattaaccaaataga5090 atctatttacaaaaatggttcacgtatattaccacaattcttttgtcaaaaagtgtgtat5100 atatgtttgcatctacatatatttgtacatctatatgacagatgtattttaaaagtttca5160 tcttgaagtaaaagtacaacagcttgaagtgttgatagcaggccacagccctctaactca5220 tgtgatttcccatgcatgctgccagaataaaaccaccaggaatgaattcactccccactt5280 ctctggaacctcaggacccgcccatttctcggcagtactgtgaattttgaagttaaacta5340 aattttggtaccataccaactggaatttaggctttaaaaataatgtttcaaggccaggtg5400 tggtgattcatgcctgaaatcccactactttgggaggctgaggctggagaattgcttgag5960 5 gctagtgagctgtgactcccactgcactccagctcggggaacagagcgagaccttgtctc5520 taaaaataatagtaataaaataaaaataacgttttatgactatttattgcaaggtcagag5580 ttacagattgttataaattgttgagaaatttttgtgattagaatatgaaggaaaaagctt5640 tgttggtaaaagtgacatgttaaggggctatgaagtaaatatgctgcagttaattgtgct5700 aagttaaaatacagtttagttatttgctttaaaataaactcttctttttttctttaaagt5760 f0 atactatctcaaaactcattatgttgtcagagccctagagctggctagtgtaacactgac5820 tatgagtaggtgggcccaccacttgagttgaggtgatttcatggtgtctttccaggctct5880 tgatagggtgtcactgcatgcaagccatgaatctgttttgagaatcctctccattttccc5990 aaataaaaacctatcacaacagtgactatatcactcagcattggat=ctaaatataaaagt6000 ggtgctttcagtgtttttggcagatagtgttccataagctttccat:cagaagggatttta6060 l5 gacaccttagaggtccgtgctacatcgtcacagttcctccgaataaccttaggtggtagt6120 gttacttgcctttgacacctctgcatatgttttaatgactagatccaaactgtgttgttc6180 ttaaatcaaaaattggataatttgtaatatttatgtgttaatcacacagtatgctctctg6240 aagttctcttaagccttcagtttatactcttaatttaattttcttt;ctgagctggagaac6300 tggctttgcactttggttacacagaacattggtttccaattcagtt;taactgaaatttgc6360 20 tgctgatatgttgagtttgttctttaaaaaatagctcatatatctcatctttcctcctgt6420 cttagaagaacagacctaactagtgaatgtattaatgaaaatgcatctatttcagagctg6480 acatgaagagtttagtttttttactttataaactgtgaatatgagtatgccagctgcata6590 cgatgtaactaatcatatttaaatatatttcactttctctttgactttagaccttttgaa6600 gtctgtataaacttgttttgaaatatagtctctgcttacgaatgtcataacaaaataatt6660 ttttgcatgataaaaaattactttgattacaaaaggcgtattctttcatggtttctgcaa6720 tgagaggaagtgtaatgattattttaatatttctattaaatatgtttaactgt 6773 <210> 28 <211> 2619 <212> DNA
<213> Homo Sapiens <400> 28 atggccacag cttgtaaaagatcaggagaacctcagtctgacgacattgaagctagccga 60 atgaagcgag cagctgcaaagcatctaatagaacgctactaccaccagttaactgagggc 120 tgtggaaatg aagcctgcacgaatgagttttgtgcttcctgtccaacttttcttcgtatg 180 gataataatg cagcagctattaaagccctcgagctttataagattaatgcaaaactctgt 240 gatcctcatc cctccaagaaaggagcaagctcagcttaccttgagaactcgaaaggtgcc 300 cccaacaact cctgctctgagataaaaatgaacaagaaaggcgctagaattgattttaaa 360 gatgtgactt acttaacagaagagaaggtatatgaaattcttgaattatgtagagaaaga 920 gaggattatt cccctttaatccgtgttattggaagagttttttctagtgctgaggcattg 980 gtacagagct tccggaaagttaaacaacacaccaaggaagaactgaaatctcttcaagca 590 aaagatgaag acaaagatgaagatgaaaaggaaaaagctgcatgttctgctgctgctatg 600 gaagaagact cagaagcatcttcctcaaggataggtgatagctcacagggagacaacaat 660 ttgcaaaaat taggccctgatgatgtgtctgtggatattgatgccattagaagggtctac 720 accagattgc tctctaatgaaaaaattgaaactgcctttctcaatgcacttgtatatttg 780 tcacctaacg tggaatgtgacttgacgtatcacaatgtatactctcgagatcctaattat 840 ctgaatttgt tcattatcggaatggagaatagaaatctccacagtcctgaatatctggaa 900 atggctttgc cattattttgcaaagcgatgagcaagctaccccttgcagcccaaggaaaa 960 ctgatcagac tgtggtctaaatacaatgcagaccagattcggagaatgatggagacattt 1020 cagcaactta ttacttataaagtcataagcaatgaatttaacagtcgaaatctagtgaat 1080 gatgatgatg ccattgttgctgcttcgaagtgcttgaaaatggtttactatgcaaatgta 1140 gtgggagggg aagtggacacaaatcacaatgaagaagatgatgaagagcccatccctgag 1200 tccagcgagc tgacacttcaggaacttttgggagaagaaagaagaaacaagaaaggtcct 1260 cgagtggacc ccctggaaactgaacttggtgttaaaaccctggattgtcgaaaaccactt 1320 atcccttttg aagagtttattaatgaaccactgaatgaggttctagaaatggataaagat 1380 tatacttttt tcaaagtagaaacagagaacaaattctcttttatgacatgtccctttata 1490 ttgaatgctg tcacaaagaatttgggattatattatgacaatagaattcgcatgtacagt 1500 gaacgaagaa tcactgttctctacagcttagttcaaggacagcagttgaatccatatttg 1560 agactcaaag ttagacgtgaccatatcatagatgatgcacttgtccggctagagatgatc 1620 gctatggaaa atcctgcagacttgaagaagcagttgtatgtggaatttgaaggagaacaa 1680 ggagttgatg agggaggtgtttccaaagaattttttcagctggttgtggaggaaatcttc 1790 aatccagata ttggtatgttcacatacgatgaatctacaaaattgttttggtttaatcca 1800 tcttcttttg aaactgagggtcagtttactctgattggcatagtactgggtctggctatt 1860 tacaataact gtatactggatgtacattttcccatggttgtctac<~ggaagctaatgggg 1920 aaaaaaggaa cttttcgtgacttgggagactctcacccagttctatatcagagtttaaaa1980 gatttattgg agtatgaagggaatgtggaagatgacatgatgatcactttccagatatca2090 cagacagatc tttttggtaacccaatgatgtatgatctaaaggaaaatggtgataaaatt2100 ccaattacaa atgaaaacaggaaggaatttgtcaatctttattctgactacattctcaat2160 aaatcagtag aaaaacagttcaaggcttttcggagaggttttcatatggtgaccaatgaa2220 tctcccttaa agtacttattcagaccagaagaaattgaattgcttatatgtggaagccgg2280 aatctagatt tccaagcactagaagaaactacagaatatgacggtggctataccagggac2340 tctgttctga ttagggagttctgggaaatcgttcattcatttacagatgaacagaaaaga2900 ctcttcttgc agtttacaacgggcacagacagagcacctgtgggaggactaggaaaatta2960 aagatgatta tagccaaaaatggcccagacacagaaaggttacctacatctcatacttgc2520 tttaatgtgc ttttacttccggaatactcaagcaaagaaaaacttaaagagagattgttg2580 aaggccatca cgtatgccaaaggatttggcatgctgtaa 2619 <210> 29 l5 <211> 4263 <212> DNA
<213> Homo sapiens <400> 29 ggccgttccc cagtagctctatggtttcag 60 ctctcctcag ggcggcaacg tgcagcgtcc ttaccttgag tgccctcaccccggaatccatagtcactgtgacgaggcgg120 cctgtgcagt gaggacttgggcgacaggtagcctcccagtcccacacgctgcgggtccgcgcctggccaa180 gccacctcgacctgtgaagttgggggcggtacccagcaactccccctgtgcagccgccgt240 ttccaaggggtcaggaaccgctgtgtttgtttcgtccgcgtagccagggcgggtcgcgga300 gtactgtgcctgacccgacggtggcaagtctgacgcgtcagccagagaccggtgcccggt360 gtaggagtcgcagcctgggctgtgagcggctgctgggtagacagacttgctttctcttac420 agcatgtcatttccaaaatgcatcgtggtgcttctgccttaagtcctataggaagacact480 gccgccactagaccggtgcttatggtcgccactgttattctgactcaggtcccgtgtcat540 tgagcatatgtatgaaaatgccttaggagggaaccatggagaagtatgtgagactgcaga600 agattggagaaggttcatttggaaaagctgttcttgttaaatcgacagaggatggcagac660 attatgtcatcaaggaaattaacatctcaagaatgtctgataaagaaaggcaagaatcaa720 ggagagaagttgctgtattggcaaacatgaagcatccaaatattgtccaatataaagaat780 catttgaagaaaatggctctctctacatagtaatggattactgtgaaggaggtgatttgt840 ttaaacgaataaatgctcagaaaggcgctctgtttcaagaagaccagattttggactggt900 ttgtgcagatatgtttggctctgaagcatgtacatgatagaaaaattcttcaccgagaca960 taaagtcacagaacatatttctaaccaaagatgggacagtgcagca gattttggaa1020 tgga ttgctcgagttcttaatagtactgtagagctggctcgaacttgcataggcactccatact1080 acttgtcacctgaaatctgtgaaaacaagccttataacaataaaagtgacatttgggctt1190 tgggctgtgtcctttatgagttgtgtacacttaaacatgcatttgaagctggaaacatga1200 aaaacctggtactgaagataatctccggatcctttcctccagtgtctccacattactcct1260 atgatctccgcagcttgctgtctcagttatttaaaagaaatcctagggatagaccatcag1320 tcaactccatattggagaaaggttttatagctaaacgaatcgaaaagtttctctcccctc1380 agcttattgcagaagaattttgtctaaaaacactttcaaagtttggaccacagcctctcc1440 caggtaaaagaccagcatcaggacaaggtgtcagttcttttgtccctgctcagaaaatca1500 caaagcctgctgctaaatacggagtgcctttaacatataagaagt.atggagataaaaagt1560 tacttgagaaaaaaccacccccaaaacataaacaggcccatcaaattcccgtgaagaaaa1620 tgaattctggagaagaaaggaagaaaatgtctgaggaagcagcaaaaaaaagaaggttgg1680 aatttattgagaaagaaaagaagcaaaaggatcagattaggttcctgaaggctgagcaga1740 tgaagcggcaagagaagcagcggttggagaggataaatagggccagggaacaaggatgga1800 ggaatgttttaagggctggtggaagcggtgaagtaaaggcttccttttttggcattggag1860 gggctgtctctccatcaccgtgttctcctcgaggccagtatgaacattaccatgccattt1920 ttgaccaaatgcagcggctaagagcagaagataatgaagcaagatggaaggggggaatct1980 atggtcgatggctcccagaaaggcaaaaaggacacttagctgtagagagagccaaccaag2090 tggaagaattcctacagcgtaaacgagaagctatgcagaataaagcccgagccgaaggac2100 acgtggtttatttggcaagactgaggcaaataagactacaaaattttaatgagcgccaac2160 agattaaagccaaacttcgtggtgagaataaagaagctgatggtaccaaaggacaagaag2220 caactgaagagactgacatgaggctcaaaaagatggagtcacttaaggcgcaaacaaatg2280 cacgtgctgctgtactaaaagaacagctggagcgaaaaagaaaggaagcttatgaaagag2390 aaaagaaagtatgggaagaacatttggtggcgagggtaaaaagctcagatgttcctctgc2400 ctttggaacttcttgaaacaggtggttctccatcaaagcagcaggtgaagcctgtcattt2460 ctgtgacttcagctttgaaagaagtgggcctggatggaagtttaactgatacccaggaag2520 aagaaatggaaaagagtaacagtgctatttcaagtaagcgagaaatcctgcgtaggctaa2580 atgaaaatcttaaagctcaagaggatgaaaaggaaaagcagcatcactcaggttcttgtg2640 agaccgttggtcacaaagatgagagagagtatgagacagaaaatgccatttcctctgatc2700 gcaagaagtgggagatgggaggtcagcttgtgattcctctcgatgcagtgacactggata2760 catccttctctgcaaccgaaaaacatactgtgggagaggttattaaattagattctaatg2820 gctctccaagaaaagtctgggggaaaaaccctacagattctgtgctgaagatacttggag2880 zz aagctgaattacagctatagacagaactactagaaaacacatcttttaaaagtgaggttt2990 atgctgaagaggagaactacaaacccttacttactgaagaagagaatctgcagtgcattt3000 caaaagaaataaatccatcagctactgttgattctactgaaacgaaaagtccaaagttta3060 ctgaggtgtctccacaaatgtcagaaggaaatgtggaagaacctgatgatttggaaacag3120 aagttctacaagagccaagtagcacacacacagatgggagtttgccacctgttcttaatg3180 atgtgtggactagagagaaggaagcagctaaggaaactgagttggaagataaggttgctg3240 tgcagcagagtgaagtttgtgaagatagaattccagggaacgtggaccaatcctgtaagg3300 atcagagagatcctgcagtagacgattctccgcagtctggctgtgatgtagagaagtcag3360 tacagccagaatcgattttccagaaagtggttcattctaaggacttgaacttagttcagg3920 cagttcattgctcaccagaagaaccaattccaattcgatctcactctgattctccaccaa3980 aaactaagagcaagaattccttactgattggactttcaactggtctgtttgatgcaaaca3590 atccaaagatgctgaggacctgctcacttccagatctttccaagctgttcagaaccctaa3600 tggacgttcccactgtgggggacgttcatcaagacagtcttgaaatcgatgagctggaag3660 atgaaccaattaaagaagggccttctgattccgaagacactgtatttgaagaaactgaca3720 cagatttacaagagcttcaggcctcaatggagcagctgcttagggagcaaccaggtgacg3780 aatacagtgaggaggaagagtctgttttaaaaagcagcgatgtggagcagacagcaagag3890 ggacagatgccccagacgaggaggacaaccceagcagcgaaagcc:cctgaacgaggaatg3900 gcactcagataatagtgacgctgagaccactagtgaatgtgaatatgacagtgtctttaa3960 ccatttagaggaactaagacttcacttggagcaagaaatgggctttgaaaagttctttga9020 ggtttatgagaaagtaaaggctattcatgaggatgaagatgaaaatattgaaatttgttc4080 aacaatagttgagaatattttgggcaatgagcaccagcatctctatgccaagattctgca4140 tttagtcatggcagatggagcctatcaggaagataatgatgaataatcctcaggacattc4200 tttaatagtcaactgtaagaacacatttgaacttggctcataatacaagcttcctgggaa9260 ata <210> 30 <211> 1756 <212> DNA

<213> Homo Sapiens <400> 30 tcgggcgcagccgcgaagatgccgttggaactgacgcagagccgagtgcagaagatctgg60 gtgcccgtggaccacaggccctcgttgcccagatcctgtgggccaaagctgaccaactcc120 cccaccgtcatcgtcatggtgggcca gcccggggcaagacctacatctccaagaag180 cccc ctgactcgctacctcaactggattggcgtccccacaaaagtgttcaacgtcggggagtat290 cgccgggaggctgtgaagcagtacagctcctacaacttcttccgccccgacaatgaggaa300 gccatgaaagtccggaagcaatgtgccttagctgccttgagagatgtcaaaagctacctg360 gcgaaagaagggggacaaattgcggttttcgatgccaccaatactactagagagaggaga420 cacatgatccttcattttgccaaagaaaatgactttaaagcgtttttcatcgagtcggtg980 tgcgacgaccctacagttgtggcctccaatatcatggaagttaaaatctccagcccggat540 tacaaagactgcaactcggcagaagccatggacgacttcatgaagaggatcagttgctat600 gaagccagctaccagcccctcgaccccgacaaatgcgacagggacttgtcgctgatcaag660 gtgattgacgtgggccggaggttcctggtgaaccgggtgcaggaccacatccagagccgc720 atcgtgtactacctgatgaacatccacgtgcagccgcgtaccatctacctgtgccggcac780 ggcgagaacgagcacaacctccagggccgcatcgggggcgactcaggcctgtccagccgg840 ggcaagaagtttgccagtgctctgagcaagttcgtggaggagcagaacctgaaggacctg900 cgcgtgtggaccagccagctgaagagcaccatccagacggccgaggcgctgcggctgccc960 tacgagcagtggaaggcgctcaatgagatcgacgcgggcgtctgtgaggagctgacctac1020 gaggagatcagggacacctaccctgaggagtatgcgctgcgggagcaggacaagtactat1080 taccgctaccccaccggggagtcctaccaggacctggtccagcgcttggagccagtgatc1140 atggagctggagcggcaggagaatgtgctggtcatctgccaccaggccgtcctgcgctgc1200 ctgcttgcctacttcctggataagagtgcagaggagatgccctacctgaaatgccctctt1260 cacaccgtcctgaaactgacgcctgtcgcttatggctgccgtgtggaatccatctacctg1320 aacgtggagtccgtctgcacacaccgggagaggtcagaggatgcaaagaagggacctaac1380 ccgctcatgagacgcaatagtgtcaccccgctagccagccccgaacccaccaaaaagcct1440 cgcatcaacagctttgaggagcatgtggcctccacctcggccgccctgcccagctgcctg1500 cccccggaggtgcccacgcagctgcctggacaaaacatgaaaggct_cccggagcagcgct1560 gactcctccaggaaacactgaggcagacgtgtcggttccattccatttccatttctgcag1620 cttagcttgtgtcctgccctccgcccgaggcaaaacgtatcctgaggacttcttccggag1680 agggtggggtggagcagcgggggagccttggccgaagagaaccatgcttggcaccgtctg1740 tgtcccctcggccgct 1756 <210> 31 <211> 1661 <212> DNA
<213> Homo Sapiens <400> 31 tgctgcagcc gctgccgccgattccggatctcattgccacgcgcccccgacgaccgcccg60 acgtgcattc ccgattccttttggttccaagtccaatatggcaactctaaaggatcagct120 gatttataat cttctaaaggaagaacagaccccccagaataagattacagttgttggggt180 tggtgctgtt ggcatggcctgtgccatcagtatcttaatgaaggacttggcagatgaact290 tgctcttgtt gatgtcatcgaagacaaattgaagggagagatgatggatctccaacatgg300 cagccttttc cttagaacaccaaagattgtctctggcaaagactataatgtaactgcaaa360 ctccaagctg gtcattatcacggctggggcacgtcagcaagagggagaaagccgtcttaa920 tttggtccag cgtaacgtgaacatatttaaattcatcattcctaatgttgtaaaatacag980 cccgaactgc aagttgcttattgtttcaaatccagtggatatctt:gacctacgtggcttg540 gaagataagt ggttttcccaaaaaccgtgttattggaagtggttgcaatctggattcagc600 ccgattccgt tacctgatgggggaaaggctgggagttcacccattaagctgtcatgggtg660 ggtccttggg gaacatggagattccagtgtgcctgtatggagtggaatgaatgttgctgg720 tgtctctctg aagactctgcacccagatttagggactgataaagataaggaacagtggaa780 IS agaggttcac aagcaggtggttgagagtgcttatgaggtgatcaaactcaaaggctacac840 atcctgggct attggactctctgtagcagatttggcagagagtataatgaagaatcttag900 gcgggtgcac ccagtttccaccatgattaagggtctttacggaataaaggatgatgtctt960 ccttagtgtt ccttgcattttgggacagaatggaatctcagaccttgtgaaggtgactct1020 gacttctgag gaagaggcccgtttgaagaagagtgcagatacactttgggggatccaaaa1080 ggagctgcaa ttttaaagtcttctgatgtcatatcatttcactgtctaggctacaacagg1140 attctaggtg gaggttgtgcatgttgtcctttttatctgatctgtgattaaagcagtaat1200 attttaagat ggactgggaaaaacatcaactcctgaagttagaaataagaatggtttgta1260 aaatccacag ctatatcctgatgctggatggtattaatcttgtgtagtcttcaactggtt1320 agtgtgaaat agttctgccacctctgacgcaccactgccaatgctgtacgtactgcattt1380 gccccttgag ccaggtggatgtttaccgtgtgttatataacttcctggctccttcactga1940 acatgcctag tccaacattttttcccagtgagtcacatcctgggatccagtgtataaatc1500 caatatcatg tcttgtgcataattcttccaaaggatcttattttgtgaactatatcagta1560 gtgtacatta ccatataatgtaaaaagatctacatacaaacaatgcaaccaactatccaa1620 gtgttatacc aactaaaacccccaataaaccttgaacagtg 1661 <210> 32 <211> 4169 <212> DNA

<213> Homo Sapiens <400> 32 ggcggcttcc aggtgggcgcgcaaggccgtggtcctgctttgtgcctctgacctgctgct60 gctgctgcta ctgctaccaccgcctgggtcctgcgcggccgaaggctcgcccgggacgcc120 cgacgagtct accccacctccccggaagaagaagaaggatattcgcgattacaatgatgc180 agacatggcg cgtcttctggagcaatgggagaaagatgatgacattgaagaaggagatct240 tccagagcac aagagaccttcagcacctgtcgacttctcaaagatagacccaagcaagcc300 tgaaagcata ttgaaaatgacgaaaaaagggaagactctcatgatgtttgtcactgtatc360 aggaagccct actgagaaggagacagaggaaattacgagcctctggcagggcagcctttt420 caatgccaac tatgacgtccagaggttcattgtgggatcagaccgtgctatcttcatgct9B0 tcgcgatggg agctacgcctgggagatcaaggactttttggtcggtcaagacaggtgtgc540 tgatgtaact ctggagggccaggtgtaccccggcaaaggaggaggaagcaaagagaaaaa600 taaaacaaag caagacaagggcaaaaaaaagaaggaaggagatctgaaatctcggtcttc660 caaggaagaa aatcgagctgggaataaaagagaagacctgtgatggggcagcagtgacgc720 gctgtggggg gacaggtggacgtggagagctctttgcccagctcctggggtgggagtggt780 ctcaggcaac tgcacaccggatgacattctagtgtcttctagaaagggtctgccacatga890 ccagtttgtg gtcaaagaattactgcttaataggcttcaagtaagaagacagatgttttc900 taattaatac tggacactgacaaattcatgtttactataaaatctccttacatggaaatg960 tgactgtgtt gctttttcccatttacacttggtgagtcatcaactctactgagattccac1020 tcccctccaa gcacctgctgtgattgggtggcctgctctgatcagatagcaaattctgat1080 cagagaagac tttaaaactcttgacttaattgagtaaactcttcatgccatatacatcat1140 tttcattatg ttaaaggtaaaatatgctttgtgaactcagatgtctgtagccaggaagcc1200 agggtgtgta aatccaaaatctatgcaggaaatgcggagaatagaaaatatgtcacttga1260 aatcctaagt agttttgaatttctttgacttgaatcttactcatcagtaagagaactctt1320 ggtgtctgtc aggttttatgtggtctgtaaagttaggggttctgttttgtttccttattt1380 aggaaagagt actgctggtgtcgaggggttatatgttccatttaatgtgacagttttaaa1490 ggatttaagt agggaatcagagtcctttgcagagtgtgacagacgactcaataacctcat1500 ttgtttctaa acatttttctttgataaagtgcctaaatctgtgctttcgtatagagtaac1560 atgatgtgct actgttgatgtctgattttgccgttcatgttagagcctactgtgaataag1620 agttagaaca tttatatacagatgtcatttctaagaactaaaattctttgggaaaaaccc1680 tcaattgtga ttttaataaattaaaagtagcacattacatggttagaaaatgtcagtgtt1790 aaagaatggt acaaagtgaaaagtgtatccctctcttgccgccggtggtagcttgtccca1800 gtggaagctg ctgttaacaatttgtgcccccacatccccctccctgcccatccaccaaaa1860 aaaagtacat ttacttatgtaaatgtactt atgtttgttt tggcctcaca1920 atggtgatgt gcatctgttt ccccttaatttggtagctgc ctcgaaagaa ccacaccctc1980 tcacatttcc tgcattctca gttctttgctttggatggga gcagtccccc caccctccag2040 catttgccct gccatgccct ctccagggtgaggcctgtgt actagggtac taggccctga2100 gatctaccgt aagaggcttt tcttgttcctcctgcatctt cgggagctgt tgtaggcccc2160 gaacctggag gcccttggag aagagaactgtctgacagtg gccacaccct ggtggcataa2220 gggagagagc acgagtccct gaatcatgccgtggctgaac ctgtgggctt tttctgttgt2280 caagccctgt actcagggca gtttgatggggttactgtcc taatggccca gtataaagca2340 tgcatagcca gctgttttga tgagataattgctttaattaagcaaaaggtagcaaagctt tcactccgcc2400 ctgtaccttc tgtttccacttaggagccttcccatgtcagaatgtgcaga tctgtctcat2960 tgtttcctgt gcagtgtgcccccacttcacccagtagtttctgtgtgtct gttatgtact2520 aggtactaca aggtgccaggacggtgtagatacagcctctgctatcgtaa aactcaatga2580 ttcggtgggg gaagacaaatgtcagtaatgtacaaagtaaaatggcagct gttagaagta2690 tgaaaggggc agggtagggggaggtagaatcttccctgaccaggttaaga aaaccagagg2700 ccttctctga gggcaagaggaggagaggagaaatagagtaaggca ggcag aggaaacagt2760 ctgagctaag accctgtggctagaagtggcagagggagaggcagcaggaa ggccagcggg2820 gaggctgggg cccagtgcaggcccaggttggaggagcgtagcacatggag tttggtagga2880 gtttgggacg ccctggtggatcttaattgtgatggggtgggtgtgaaagg cagtccaggt2940 tgcactggtt gcacaggagaagtgatcagaagaggaccccagcaggtgtg agccgtgagc3000 tgggaggtgc ttcagtagtgcaggccatagctgaaggtgtcctacatcag cagggtgatg3060 gtgaggtttg aaccactgtttcactgcatagtccctgctgatggacactt gagtgttcag3120 attttttgct ggtatattcagtgctgcagtggacattttcatacaaaata tttcggtaca3180 cttttgttta tatctgaaaggtaaattcctagcagtagaattatt.agagc aaacggaatt3240 taacattttg gtgtgtattgccaaattgccctcccaagtggtttagtcag cttacccttg3300 ccaacaatag atctatccttgccagccttgggcatcacatttaccagttt aatagattgt3360 aaaaccatat cttaattggctaccctgaagccaccatactggagaggctg cgtacagtgt3920 ttcacgtaga gagagggatacccaggaggcccacctgctccaaccccagc tgcatgagtc3480 ttcccagccc aggcacagacatgtggataagatttaaacatttccagccc cagccttcaa3590 gcaatcctag ttgacactgaggggagccaacataagctgagctgagaaac agtctgccca3600 gtctgcagat tcatgagcaaaagaaatgttgggctgggtacagtggctca cgcctgtaat3660 cccagtactt tgggaggccgaggtgggtggatcagttgaggtcaggagtt tgagaccagc3720 ctggccaaca tggtgaagccctgtctctactaaaaattagccgagtgtgg tggtgcgggc3780 ctgtaatccc agctactcaggtggctgaggcaggagaatggcttgaaccc gggaggcgga3840 ggttgcagtg agccaagatcaggccactgcactccagcctggatgacggg atgagactct3900 gtctcaaaaa aacgaaacaaaaattttttaagagaaatgtcatttgtttt tgtttttgag3960 acagggtctc actctgttgccctcactagagtgcagtagggatcacggct cactgaagtc9020 tctacctacc ggctcaattgatcttcccaccacagcctcccaaatagctg ggagaaatgt9080 cctgttttta atgaatttgtcttcctttttgtcttgtttgttttaatatc tagtgatcta9190 ataaatttgg atgatatcttttgactatc <210> 33 <211> 859 <212> DNA

<213> Homo Sapiens <900> 33 catgccatgc tgggactatg 60 agcttaccaa ctggagataa ccatcgagtc ctatgttcat cgactggttg atagtacagt 120 caagtaaaac atgaatgtga agatggaaaa gggggatact tgccaggaag ttagagtatt 180 agaaaataga catatttact tgccttacag aacaagccag ctggaatctc aagatagttc 290 agcgaatcta ggatagagaa ctgggaaaac ggacacagca gaggaaatta aaagaaacaa 300 acaacatgaa ttgagaagtg gaccaagttt tgataatcta gagcacaaac aagcagtctg 360 taaatgatct tggaaagaaa cctaaaagaa gtgcactcag ctaaacacaa gagctcaaag 420 aagtggccaa aggagcagga actcaccaac aatgaacaag tgtttgcgag aacaagctaa 980 ccaaccaagt aagaggagga cctcctgcag gagggtgctg aaggagacct atcaccgaga 590 gtgaccaaaa tccaggagca agatctgcag gctgcgtgac gtcatgttct atcaaccatc 600 acctggagac tgcctgccga acagcagaag gacccggcag gaaatccagg atggcctcgg 660 agggacagat cctcgagccc caacatcgcc tgcctcttcg gggggcagtg ggccgcagca 720 ggaagttgcc agaggggcaa ctccaggaag gtgaccttca gagcaacaga ctgacactgt 780 catccctgag gagagt:gtgc actgttctcc tgggaccttc agctaaatgt acaagtgagg 840 gagggtgggc acgaaggccg cctaataagt gccttcgtgg ccttagagat 859 ggatgaggc <210> 34 <211> 1070 <212> DNA
<213> Homo Sapiens <400> 39 gcgattgctg gggctgcagcgctgcctccgagaccgagagtgggtggagcgggtcttcct60 ggaagggtgc gataaggccgggcgaggtgcctgggatgcttctccccttccgcgaggaag120 agatctaatt gggtagggcgggtgtagactagcctgccgagccgcccgctggcacctgca180 5 gcctcctggg cgcccgcgggcccggcgagaaagttgttaaagggagcgaggtggttgttc240 ctggggtccg aggcgcgcctctcacgccctgcccaacagaagccgcagtcccgtggggtc300 tggagacgca gtttccttgttaatgacaataaatccctgctccccctgcctcagacatct360 acgcagcgaa atcgagcctggccttgagggtccacaccgcgaggaagatgcgtgcgccca920 ttccagagcc taagcctggagacctgattgagatttttcgccctttctacagacactggg480 10 ccatctatgttggcgatggatatgtggttcatctggcccctccaagtgaggtcgcaggag540 ctggtgcagc cagtgtcatgtccgccctgactgacaaggccatcgtgaagaaggaattgc600 tgtatgatgt ggccgggagtgacaagtaccaggtcaacaacaaacatgatgacaagtact660 cgccgctgcc ctgcacgaaaatcatccagcgggcggaggagctggtggggcaggaggtgc720 tctacaagct gaccagtgagaactgcgagcactttgtgaatgagctgcgctatggagtcg780 15 cccgcagtgaccaggtcagagatgtcatcatcgctgcaagcgttgcaggaatgggcttgg890 cagccatgag ccttattggagtcatgttctcaagaaacaagcgacaaaagcaataactga900 aaaagactgt ctgtcagcgatgactttataca.tcaagggggtcttgttttgctagagagt960 ttggggtttg gtttgtggatttcattgtgatttataataaggcttattttcacagaataa1020 aataaagcaa aacgagggaggattttattgggggagtgcagcccaaaaaa 1070 <210> 35 <211> 460 <212> DNA
<213> Homo sapiens <400> 35 cttttcctcccatgtcgccaccgaggtgccacgcgtgagacttctccgccgcctccgccg60 cagacgccgccgcgatgcgctacgtcgcctcctacctgctggctgccctagggggcaact120 cctcccccagcgccaaggacatcaagaagatcttggacagcgtgggtatcgaggcggacg180 ~

acgaccggctcaacaaggttatcagtgagctgaatggaaaaaacattgaagacgtcattg240 cccagggtattggcaagcttgccagtgtacctgctggtggggctgtagccgtctctgctg300 ccccaggctctgcagcccctgctgctggttctgcccctgctgcagcagaggagaagaaag360 atgagaagaaggaggagtctgaagagtcagatgatgacatgggatt:tggcctttttgatt920 aaattcctgctcccctgcaaataaagcctttttacacatc 960 <210> 36 <211> 9416 <212> DNA

<213> Homo sapiens <400> 36 gccgcacagggttttataggatcacattgacaaaagtaccatggagttttatgagtcagc60 atattttattgttcttattccttcaatagttattacagtaattttcctcttcttctggct120 tttcatgaaagaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagct180 tattcctaccaaaacagataaaaagaaagcagaaaagaaaaagaataaaaagaaagaaat240 ccagaatggaaacctccatgaatccgactctgagagtgtacctcgagactttaaattatc300 agatgctttggcagtagaagatgatcaagttgcacctgttccattgaatgtcgttgaaac360 ttcaagtagtgttagggaaagaaaaaagaaggaaaagaaacaaaagcctgtgcttgaaga920 gcaggtcatcaaagaaagtgacgcatcaaagattcctggcaaaaaagtagaacctgtccc980 agttactaaacagcccacccctccctctgaagcagctgcctcgaagaagaaaccagggca590 gaagaagtctaaaaatggaagcgatgaccaggataaaaaggtggaaactctcatggtacc600 atcaaaaaggcaagaagcattgcccctccaccaagagactaaacaagaaagtggatcagg660 gaagaagaaagcttcatcaaagaaacaaaagacagaaaatgtcttcgtagatgaacccct720 tattcatgcaactacttatattcctttgatggataatgctgactcaagtcctgtggtaga780 SS taagagagaggttattgatttgcttaaacctgaccaagtagaagggatccagaaatctgg840 gactaaaaaactgaagaccgaaactgacaaagaaaatgctgaagtgaagtttaaagattt900 tcttctgtccttgaagactatgatgttttctgaagatgaggctctttgtgttgtagactt960 gctaaaggagaagtctggtgtaatacaagatgctttaaagaagtcaagtaagggagaatt1020 gactacgcttatacatcagcttcaagaaaaggacaagttactcgctgctgtgaaggaaga1080 tgctgctgctacaaaggatcggtgtaagcagttaacccaggaaatgatgacagagaaaga1190 aagaagcaatgtggttataacaaggatgaaagatcgaattggaacattagaaaaggaaca1200 taatgtatttcaaaacaaaatacatgtcagttatcaagagactcaacagatgcagatgaa1260 gtttcagcaagttcgtgagcagatggaggcagagatagctcacttgaagcaggaaaatgg1320 tatactgagagatgcagtcagcaacactacaaatcaactggaaagcaagcagtctgcaga1380 actaaataaactacgccaggattatgctaggttggtgaatgagctgactgagaaaacagg1940 aaagctacagcaagaggaagtccaaaagaagaatgctgagcaagcagctactcagttgaa1500 ggttcaactacaagaagctgagagaaggtgggaagaagttcagagctacatcaggaagag1560 aacagcggaa 1620 catgaggcag cacagcaaga tttacagagt aaatttgtgg ccaaagaaaa tgaagtacag 1680 agtctgcata gtaagcttac agataccttg gtatcaaaac aacagttgga gcaaagacta 1740 atgcagttaa tggaatcaga gcagaaaagg gtgaacaaag aagagtctct acaaatgcag 1800 gttcaggata ttttggagca gaatgaggct ttgaaagctc aaattcagca t g cagatagcag 1860 tccattcc cccagacctc cgcttcagtt ctagcagaag aattacataa agtgattgca gaaaaggataagcagataaa 1920 t acagactgaa gattctttag caagtgaacg gatcgttta acaagtaaag taaggatata atttcttatt 1980 aagaggaact cagaatatga aaaagctgaa gtgcagaaattacaggccctggcaaatgag ctgcacatga 2040 caggctgctg attggagaag atgcaacaaagtgtttatgttaaagatgataaaataagattgctggaaga 2100 gcaactacaa catgaaatttcaaacaaaatggaagaatttaagattctaaatgaccaaaa 2160 caaagcatta aaatcagaagttcagaagctacagactcttgtttctgaacagcctaataa 2220 ggatgttgtg gaacaaatggaaaaatgcattcaagaaaaagatgagaagttaaagactgt 2280 ggaagaatta cttgaaactggacttattcaggtggcaactaaagaagaggagctgaatgc 2390 aataagaaca gaaaattcatctctgacaaaagaagttcaagacttaaaagctaagcaaaa 2400 is tgatcaggtt tcttttgcctctctagttgaagaacttaagaaagtgatccatgagaaaga 2460 tggaaagatc aagtctgtagaagagcttctggaggcagaacttctcaaagttgctaacaa 2520 ggagaaaact gttcaggatttgaaacaggaaataaaggctctaaaagaagaaataggaaa 2580 tgtccagctt gaaaaggctcaacagttatctatcacttccaaagttcaggagcttcagaa 2640 cttattaaaa ggaaaagaggaacagatgaataccatgaaggctgttttggaagagaaaga 2700 gaaagaccta gccaatacagggaagtggttacaggatcttcaagaagaaaatgaatcttt 2760 aaaagcacat gttcaggaagtagcacaacataacttgaaagaggcctcttctgcatcaca 2820 gtttgaagaa cttgagattgtgttgaaagaaaaggaaaatgaattgaagaggttagaagc 2880 catgctaaaa gagagggagagtgatctttctagcaaaacacagct:gttacaggatgtaca 2940 agatgaaaac aaattgtttaagtcccaaattgagcagcttaaacaacaaaactaccaaca 3000 2s ggcatcttct tttccccctcatgaagaattattaaaagtaatttcagaaagagagaaaga 3060 aataagtggt ctctggaatgagttagattctttgaaggatgcagttgaacaccagaggaa 3120 gaaaaacaat gaaaggcagcaacaggtggaagctgttgagttggaggctaaagaagttct 3180 caaaaaatta tttccaaaggtgtctgtcccttctaatttgagttatggtgaatggttgca 3240 tggatttgaa aaaaaggcaaaagaatgtatggctggaacttcagggtcagaggaggttaa 3300 ggttctagag cacaagttgaaagaagctgatgaaatgcacacatt.gttacagctagagtg 3360 tgaaaaatac aaatccgtccttgcagaaacagaaggaattttacagaagctacagagaag 3420 tgttgagcaa gaagaaaataaatggaaagttaaggtcgatgaatc:acacaagactattaa 3480 acagatgcag tcatcatttacatcttcagaacaagagctagagcgattaagaagcgaaaa 3540 taaggatatt gaaaatctgagaagagaacgagaacatttggaaatggaactagaaaaggc 3600 3s agagatggaa cgatctacctatgttacagaagtcagagagttgaaggcacagttaaatga 3660 aacactcaca aaacttagaactgaacaaaatgaaagacagaaggtagctggtgatttgca 3720 taaggctcaa cagtcactggagcttatccagtcaaaaatagtaaaagctgctggagacac 3780 tactgttatt gaaaatagtgatgtttccccagaaacggagtcttctgagaaggagacaat 3840 gtctgtaagt ctaaatcagactgtaacacagttacagcagttgcttcaggcggtaaacca 3900 acagctcaca aaggagaaagagcactaccaggtgttagagtgaagtaattgggaaactgt 3960 tcatttgagg ataaaaaaggcattgtattatattttgccaaattaaagccttatttatgt 4020 tttcaccctt tctactttgtcagaaacactgaacagagttttgtcttttctaatccttgt 4080 tagactactg atttaaagaaggaaaaaaaaaagccaactctgtagacaccttcagagttt 9190 agttttataa taaaaactgtttgaataattagacctttacattcctgaagataaacatgt 9200 4s aatcttttat cttattttgctcaataaaattgttcagaagatcaaagtggtaaagacaat 4260 gtaaaattta acattttaatactgatgttgtacactgttttacttaacattttgggaagt 9320 aactgcctct gacttcaactcaagaaaacacttttttgttgctaat 4380 gtaa tcggtttttg taatggcgtc agcaaataaaaggatgcttattattc 4416 s0 <210> 37 <211> 628 <212> DNA

<213> Homo Sapiens ss <z2o>

<221> unsure <222> 284..284 <223> n = a, c, g or t 60 <220>

<221> unsure <222> 594..594 <223> n = a, c, g or t 6s <220>

<221> unsure <222> 597..597 <223> n = a, c, g or t <220>
<221> unsure <222> 607..607 <223> n = a, c, g or t <400> 37 ggcacgagaa gaagtctaaaaatggaagcgatgaccagggataaaaaggtggaaactctc 60 atggtaccat caaaaaggcaagaagcattgcccctccaccaagagactaaacaagaaagt 120 ggatcaggga agaagaaagcttcatcaaagaaacaaaagacagaaaatgtcttcgtagat 180 gaacccctta ttcatgcaactacttatattcctttgatggataatgctgactcaagtcct 290 gtggtagata agagagaggttatttatttgcttaaacctgaccnagtagaagggatccag 300 aaatctggga ctaaaaaactgaagacccaaactgacaaagaaaatgctgaagtgaagttt 360 aaagattttcttctgtcctttaagactatgatgttttctgaagatgaggctctttgtgtt 920 gtagacttgc taaaggagaagtctcgtgtaatacaagatgctttaaagaagtcaagtaag 480 ggagaattga ctacgcttatacatcagcttcaagaaaaggaccaagttactcgctgctgt 590 gaaggaagat gctgctgctacaaaggatccgtgtaagcagttac<~ccaggaatnatncca 600 aagaaanaca gagcaatttggtatacaa 628 <210> 38 <211> 730 <212> DNA
<213> Homo sapiens <220>

<221> unsure <222> 127..127 <223> n = a, g or c, t <220>

<221> unsure <222> 260..260 <223> n = a, g or c, t <2zo>

<221> unsure <222> 307..307 <223> n = a, g or c, t <220>

<221> unsure <222> 329..329 <223> n = a, g or c, t <220>

<221> unsure <222> 336..336 <223> n = a, g or c, t <220>

<221> unsure <222> 473..473 <223> n = a, g or c, t <220>

<221> unsure <222> 487..487 <223> n = a, g or c, t <220>

<221> unsure <222> 999..994 <223> n = a, g or c, t <220>
<221> unsure <222> 563..563 <223> n = a, c, g or t <220>

<221> unsure <222> 640..690 <223> n = a, c, g or t <220>

<221> unsure <222> 681..681 <223> n = a, c, g or t <220>

IS <221> unsure <222> 689..689 <223> n = a, c, g or t <220>

<221> unsure <222> 708..708 <223> n = a, c, g or t <220>

<221> unsure <222> 714..719 <223> n = a, c, g or t <220>

<221> unsure <222> 728..728 <223> n = a, c, g or t <220>

<221> unsure <222> 730..730 <223> n = a, c, g or t <400> 38 aaagaattcg gcacgagtgaagaccgaaactgacaaagaaaatgctgaagtgaagtttaa 60 agattyyctt ctgtccttgaagactatgatgttttctgaagatgaggctctttgtgttgt 120 agactyncta aaggagaagtctggtgtaatacaagatgctttaaagaagtcaagtaaggg 180 agaattgact acgcttatacatcagcttcaagaaaaggacaagtyactcgctgctgtgaa 290 ggaagatgct gctgcyacanaggatcggtgtaagcagttaacccaggaaatgatgacaga 300 gaaaganaga agcaatgtggttataacanggatganagaycgaatyggaacattagaaaa 360 ggracataat gtatyycaaaacaaaatacatgtcagtyatcaagagacycaacagatgca 420 gatgaagttt cagcaagttcgtgagcagatggaggcagagatagcycacttgnagcagga 480 aaatggnata ctgngagaatgcagtcagcaacactacaaatcaact:ggaaagcaagcagt 540 ctgcagaact aaataaactacgncaggattatgctaggttggtgaatgagcctgactgag 600 aaacaggaaa gctacagcaagaggaagtcaaagaagaatnctgagcaagcagctactcag 660 ttgaaggttc caactacacgnacgcctgngagaaggtgggggaggcgnttcagngcctac 720 atcagggngn <210> 39 <211> 571 <212> DNA

<213> Homo Sapie ns <220>

<221> unsure <222> 37..37 <223> n = a, c, g or t <220>

<221> unsure <222> 42..42 <223> n = a, c, g or t WO 00/20587 29 PC'T/US99/22873 <220>

<221> unsure <222> 64..69 <223> n = a, gor t c, <220>

<221> unsure <222> 67..67 <223> n = a, gor t c, <220>

<221> unsure <222> 73..73 <223> n = a, gor t c, <220>

<221> unsure <222> 86..99 <223> n = a, gor t c, <220>

<221> unsure <222> 106..107 <223> n = a, gor t c, <220>

<221> unsure <222> 117..117 <223> n = a, gor t c, <220>

<221> unsure <222> 139..139 <223> n = a, gor t c, <220>

<221> unsure <222> 153..153 <223> n = a, gor t c, <220>

<221> unsure <222> 243..243 <223> n = a, gor t c, <220>

<221> unsure <222> 257..257 <223> n = a, gor t c, <220>

<221> unsure <222> 264..264 <223> n = a, gor t c, <220>

<221> unsure <222> 319..319 <223> n = a, gor t c, <220>

<221> unsure <222> 337..337 <223> n = a, gor t c, <220>

<221> unsure <222> 341..341 <223> n = a, g or c, t 5 <220>

<221> unsure <222> 353..353 <223> n = a, g or c, t 10 <220>

<221> unsure <222> 362..362 <223> n = a, g or c, t 15 <220>

<221> unsure <222> 373..373 <223> n = a, g or.
c, t 20 <220>

<221> unsure <222> 379..379 <223> n = a, g or c, t 25 <220>

<221> unsure <222> 384..385 <223> n = a, g or c, t 30 <220>

<221> unsure <222> 419,.919 <223> n = a, g or c, t <220>

<221> unsure <222> 421..421 <223> n = a, g or c, t <220>

<221> unsure <222> 427..427 <223> n = a, g or c, t <220>

<221> unsure <222> 933.433 <223> n = a, g or c, t <220>

<221> unsure <222> 440..442 <223> n = a, g or c, t <220>

<221> unsure <222> 449..444 <223> n = a, g or c, t <220>

<221> unsure <222> 448..448 <223> n = a, g or c, t <220>

<221> unsure <222> 450..450 <223> n = a, c, g or t <220>

<221> unsure <222> 455..455 <223> n = a, g or c, t <220>

<221> unsure <222> 986..486 <223> n = a, g or c, t <220>

<221> unsure <222> 488..489 <223> n = a, g or c, t <220>

<221> unsure <222> 493..493 <223> n = a, g or c, t <220>

<221> unsure <222> 496..497 <223> n = a, g or c, t <220>

<221> unsure <222> 500..500 <223> n = a, g or c, t <220>

<221> unsure <222> 504..509 <223> n = a, g or c, t <220>

<221> unsure <222> 506..507 <223> n = a, g or c, t <220>

<221> unsure <222> 515..515 <223> n = a, g or c, t <220>

<221> unsure <222> 520..520 <223> n = a, g or c, t <220>

<221> unsure <222> 523..523 <223> n = a, g or c, t <220>

<221> unsure <222> 525..526 <223> n = a, g or c, t <220>

<221> unsure <222> 538..538 <223> n = a, g or c, t <400> 39 aayacaatgc cttttttatcctcaaatagarcagttncccanttacttcactcttacacc 60 tggnagngct ctntctcctttgtgrnnnnnnnnnnnnnncccccynnccgaatggtnctg 120 taactgtgtt acagtctgntttaggcttacagncattgtctccttctcaggaggctccgt I80 ttctggggga acatcacttttttcaataacagtagtgtctcccgcagcttttactatttt 240 tgnctggata agctccngtgactnttgagccttatgcaaatcacc:agctaccttctgtct 300 ttcattttgt tcagttctnagttttgtgggtgtttcntttnactgtgccytcnactctct 360 gncttctgta acntagggnggtcnntccctctctgccttttctagttccctttcccaang 420 ntctcgntct ccnccccagnnngncaananccgcnatttttcgcttcttaattcggtcta 980 gccccngnnc cgnagnnggnaaangnnggctgcanccggnttnannaggcctgtgtgntt 590 catcggcctt tacctttccctttattttctt 571 <210> 40 <211> 644 IS <212> DNA

<213> Homo Sapiens <220>

<221> unsure <222> 915..915 <223> n = a, c, g or t <220>

<221> unsure <222> 525..526 <223> n = a, c, g or t <400> 40 atattttgga gcagaatgaggctttgaaagctcaaattcagcagttccattcccagatag 60 cagcccagac ctccgcttcagttctagcagaagaattacataaagtgattgcagaaaagg 120 ataagcagat aaaacagactgaagattctttagcaagtgaacgtg;3tcgtttaacaagta 180 aagaagagga acttaaggatatacagaatatgaatttcttattaaaagctgaagtgcaga 240 aattacaggc cctggcaaatgagcaggctgctgctgcacatgaattggagaagatgcaac 300 acagtgttta tgttaaagatgataaaataagattgctggaagagcaactacaacatgaca 360 tttcaaacaa aatggaagaatttaagattctaaatgaccaaaacaaagcattaanatcag 420 aagttcagaa gctacagactcttgtttctgaacagcctaataaggatgttgtggaacaca 480 tggaaaaatg cattcaagaaaagatgagaagttaaagactgtggnngattacttgacact 540 ggacttattc aggtggcaactaaagagaggagctgatgcatagacagacattcatctctg 600 acaaagagtt caagacttacagctagcaaatgatcaggttcttg 644 <210> 41 <211> 566 <212> DNA
<213> Homo sapiens <220>

<221> unsure <222> 47.47 <223> n = a, g c, or t <220>

<221> unsure <222> 59..59 <223> n = a, g c, or t <220>

<221> unsure <222> 91..91 <223> n = a, g c, or t <220>

<221> unsure <222> 104..104 <223> n = a, g c, or t <220>
<221> unsure <222> 941..441 <223> n = a, c, g or t <220>

<221> unsure <222> 498..448 <223> n = a, c, g or t <220>

<221> unsure <222> 457..957 <223> n = a, c, g or t <220>

<221> unsure <222> 525..525 <223> n = a, c, g or t <220>

<221> unsure <222> 539..539 <223> n = a, c, g or t <220>

<221> unsure <222> 564..569 <223> n = a, c, g or t <400> 41 caacacaatc tcaaggtcttcaaactgggatgcagaagag gcctctntca agttatgtng60 tgctacttcc tgaacaagggcttgaaaagantcaatggct tctngaagag cccgtaacca120 cttccccgta ttggctagggctttctctttctcttccaaa acagccttca tgggattcat180 ctgtgcctct tttccttttaataagttcygaagctcctga actttggaag tgatagataa290 cygttgagcc ttttcaagctggacatttcctatttcttct tttagagcct ttatttcccg300 tttcaaatcc cgaacagttttctccttgttagcaacattg agaagtgccg cctccagaag360 ctcttctaca gacttgatctttcacctctctcatggatca ctctcttaag gtcttcaact920 agagaggcaa aagaacccgancatttgntagttttangct cgaacttctt ttgtcagaga480 tgaattttct gttcttattgcattcagctcctcttcttta ggtgncacca gaataaggnc540 agtgtcaaga aattcttccacagnct 566 <210> 42 <211> 878 <212> DNA

<213> Homo sapiens <220>

<221> unsure <222> 595..595 <223> n = a, c, g or t <220>

<221> unsure <222> 756..756 <223> n = a, c, g or t <220>

<221> unsure <222> 766..766 <223> n = a, c, g or t <220>

<221> unsure <222> 815..815 <223> n = a, c, g or t <220>
<221> unsure <222> 818..818 <223> n = a, c, g or t <220>

<221> unsure <222> 827..827 <223> n = a, c, g or t <220>

<221> unsure <222> 831..831 <223> n = a, c, g or t <220>

IS <221> unsure <222> 853..853 <223> n = a, c, g or t <220>

<221> unsure <222> 866..866 <223> n = a, c, g or t <400> 42 accttaacct cctctgacctgaagttccagccatacattcttttgccttt ttttcaatcc60 atgcaaccat tcaccataactcaaattagaagggacagacacctttggaa ataatttttt120 gagaacttct ttagcctccaactcaacagcttccacctgttgctgccttt cattgttttt180 cttcctctgg tgttcaactgcatccttcaaagaatctaactcattccaga gaccacttat240 ttctttctct ctttctgaaattacttttaataattcttcatgagggggaa aagaagatgc300 ctgttggtag ttttgttgtttaagctgctcaatttgggacttaaacaatt tgttttcatc360 ttgtacatcc tgtaacagctgtgttttgctagaaagatcactctccctct cttttagcat420 ggcttctaac ctcttcaattcattt.tccttttctttcaacacaatctcaa gttcttcaaa980 ctgtgatgca gaagaggcctctttcaagttatgttgtgctacttcctgaa catgtgcttt540 taaaagattc attttcttcttgaagatcctgtaaccacttccctgtattg gctangtctt600 tctctttctc ttccaaaacagccttcaaggtattcatctgttcctctttt ccttttaaaa660 agttctgaag ctcctgaactttggaagtgatagataactgttgagccctt tcaagcctgg720 acattcctaa ttcctcctttaaaagccttaattccngtttcaaaanccga aacagttttc780 ccccttgtaa gcaactttgagaaattcggctccanaanccctcctanaga nttgatcttt840 caacctttcc aanggattactttccnaaagttccttaa 878 <210> 43 <211> 620 <212> DNA

<213> Homo Sapiens <220>

<221> unsure <222> 391..391 <223> n = a, c, g or t <220>

<221> unsure <222> 400..400 <223> n = a, c, g or t <220>

<221> unsure <222> 411..911 <223> n = a, c, g or t <220>

<221> unsure <222> 914.. 414 <223> n = a, c, g or t <220>
<221> unsure <222> 418..418 <223> n = a, g c, or t <220>

5 <221> unsure <222> 921..921 <223> n = a, g c, or t <220>

10 <221> unsure <222> 427..928 <223> n = a, g c, or t <220>

15 <221> unsure <222> 935..435 <223> n = a, g c, or t <220>

20 <221> unsure <222> 496..496 <223> n = a, g c, or t <220>

25 <221> unsure <222> 954..455 <223> n = a, g c, or t <220>

30 <221> unsure <222> 463..463 <223> n = a, g c, or t <220>

35 <221> unsure <222> 465..965 <223> n = a, g c, or t <220>

<221> unsure <222> 471..471 <223> n = a, g c, or t <220>

<221> unsure <222> 480..480 <223> n = a, g c, or t <220>

<221> unsure <222> 984..484 <223> n = a, g c, or t <220>

<221> unsure <222> 490..490 <223> n = a, g c, or t <220>

<221> unsure <222> 493..493 <223> n = a, g c, or t <220>

<221> unsure <222> 500..500 <223> n = a, g c, or t <220>

<221> unsure <222> 514..515 <223> n = a, c, g or t <220>

<221> unsure <222> 529..524 <223> n = a, c, g or t <220>

<221> unsure <222> 539..539 <223> n = a, c, g or t <220>

<221> unsure <222> 568..568 <223> n = a, c, g or t <220>

<221> unsure <222> 573..574 <223> n = a, c, g or t <220>

<221> unsure <222> 581..581 <223> n = a, c, g or t <220>

<221> unsure <222> 600..600 <223> n = a, c, g or t <220>

<221> unsure <222> 604..604 <223> n = a, c, g or t <220>

<221> unsure <222> 608..608 <223> n = a, c, g or t <220>

<221> unsure <222> 616..616 <223> n = a, c, g or t <220>

<221> unsure <222> 619..619 <223> n = a, c, g or t <400> 43 accttaacct cctctgaccctgaattccagccatacattc ttttgccttt ttttcaaatc60 catgcaacca ttcaccataactcaaattagaagggacaga cacctttgga aataattttt120 tgagaacttc tttagcctccaactcaacagcttccacctg ttgctgcctt tcattgtttt180 tcttcctctg gtgttcaactgcatccttcaaagaatctaa ctcattccag agaccactta240 tttctttctc tctttctgaaattacttttaataattcttc atgaggggga aaagaagatg300 cctgttggta gttttgttgtttaagctgctcaatttggga cttaaacaat ttgttttcat360 cctgtacatc ctgtaacagctgtgttttgcnaagaaagtn actccccctc nccnttanca420 nggggtnnca acctncttaaatacanttcctttnncttta aananaatct naggttcctn480 caangggtan tgnaaaaaangcccctttcaagtnnggttg tgcnacttcc tgaacatgng540 ctttaagatc attttctctgaagatccngtacnnttcccg nattggtagg cttcccttcn600 ttcnaaanag cttcanggng <210> 94 <211> 623 <212> DNA

<213> Homo sapi ens <220>

<221> unsure <222> 25..25 <223> n = a, c, g ort <220>

<221> unsure <222> 409..909 <223> n = a, c, g ort <220>

<221> unsure <222> 412..412 <223> n = a, c, g ort <220>

<221> unsure <222> 414..414 <223> n = a, c, g ort <220>

<221> unsure <222> 923..423 <223> n = a, c, g ort <220>

<221> unsure <222> 426..426 <223> n = a, c, g ort <220>

<221> unsure <222> 435..435 <223> n = a, c, g ort <220>

<221> unsure <222> 499..444 <223> n = a, c, g ort <220>

<221> unsure <222> 450..450 <223> n = a, c, g ort <220>

<221> unsure <222> 454..454 <223> n = a, c, g ort <220>

<221> unsure <222> 459..459 <223> n = a, c, g ort <220>

<221> unsure <222> 490..490 <223> n = a, c, g ort <220>

<221> unsure <222> 508..508 <223> n = a, c, g or t <220>

<221> unsure <222> 511..511 <223> n = a, c, g or t <220>

<221> unsure <222> 515..515 <223> n = a, c, g or t IS

<220>

<221> unsure <222> 524..524 <223> n = a, c, g or t <220>

<221> unsure <222> 595..595 <223> n = a, c, g or t <220>

<221> unsure <222> 555..555 <223> n = a, c, g or t <220>

<221> unsure <222> 564..564 <223> n = a, c, g or t <220>

<221> unsure <222> 600..600 <223> n = a, c, g or t <220>

<221> unsure <222> 611..611 <223> n = a, c, g or t <400> 44 accttaacct cctctgaccctgaantccagccatacattcttttgcctttttttcaaatc 60 catgcaacca ttcaccataactcaaattagaagggacagacacctttggaaataattttt 120 tgagaacttc tttagcctccaactcaacagcttccacctgttgctgcctttccttggaag 180 tcttgttcac tttgtcctgcagcattttttcagttgatgccaatgcttccattgcttccc 290 agtttttctc ccgaaggtcattgtttttcttcctctggtgttcaactgcatccttcaaag 300 aatctaactc attccagagaccacttatttctttctctctttctgaaattacttttaata 360 attcttcatg agggggaaaagaagatgcctggtgggaatttggtggttnaancnggccaa 420 ttnggnacct aaaanatttggttncaactngtanaccgngtaaaaactgtgttttgctaa 480 aaagataacn ccccctctctttaagcanggnttcnaacctcttnattcatttccttttct 540 tcaanaaatc tcagntctcaaacngggatgcaaaagaggctcttcaagttaggtgggcn 600 a acttccggaa natggcctttaaa 623 <210> 45 <211> 625 <212> DNA
<213> Romo sapiens <220>
<221> unsure <222> 392..392 <223> n = a, c, g or t <220>

<221> unsure <222> 408..408 <223> n = a, g or c, t <220>

<221> unsure <222> 417..417 <223> n = a, g or c, t <220>

<221> unsure <222> 421..421 <223> n = a, g or c, t <220>

<221> unsure <222> 424..425 <223> n = a, g or c, t <220>

<221> unsure <222> 437..437 <223> n = a, g or c, t <220>

<221> unsure <222> 439..439 <223> n = a, g or c, t <220>

<221> unsure <222> 456..456 <223> n = a, g or c, t <220>

<221> unsure <222> 467..467 <223> n = a, g or c, t <220>

<221> unsure <222> 469..469 <223> n = a, g or c, t <220>

<221> unsure <222> 473..473 <223> n = a, g or c, t <220>

<221> unsure <222> 475..975 <223> n = a, g or c, t <220>

<221> unsure <222> 496..496 <223> n = a, g or c, t <220>

<221> unsure <222> 499.,500 <223> n = a, g or c, t <220>

<221> unsure <222> 516..516 <223> n = a, c, g or t <220>

<221> unsure <222> 529..524 <223> n = a, c, g or t <220>

<221> unsure <222> 535..535 <223> n = a, c, g or t IS <220>

<221> unsure <222> 538..538 <223> n = a, c, g or t <220>

<221> unsure <222> 560..560 <223> n = a, c, g or t <220>

<221> unsure <222> 582..582 <223> n = a, c, g or t <220>

<221> unsure <222> 592..592 <223> n = a, c, g or t <220>

<221> unsure <222> 594..594 <223> n = a, c, g or t <220>

<221> unsure <222> 604..604 <223> n = a, c, g or t <900> 45 accttaacct cctctgaccctgaagtccagccatacattcttttgcctttttttcaaatc 60 catgcaacca ttcaccataactcaaattagaagggacagacacctttggaaataattttt 120 tgagaacttc tttagcctccaactcaacagcttccacctgttgctgcctttcattgtttt 180 tcttcctctg gtgttcaactgcatccttcaaagaatctaactcattccagagaccactta 290 tttctttctc tctttctgaaattacttttaataattcttcatgagggggaaaagaagatg 300 cctgttggta gttttgttgtttaagctgctcaatttgggacttaaacaatttgttttcat 360 cttgtacatc ctggtaacagctgtgttttgcntagaaaagattactcnccctctctnttt 420 ncanngggtt caacccntnaaattacatttcccttntcttaaacaanantctnangttct 480 tcaaactgtg atgcanaannggctctttcaagttangttgtgcnacttcctgaanatntg 540 ctttaaagat catttcttcntgaaatccgtaaccacttcccngtatgggcangncttccc 600 ttcncttcaa aaaagcctcaaggta 625 <210> 46 <211> 4416 <212> DNA

<213> Homo sapie ns <900> 46 gccgcacagg gttttataggatcacattgacaaaagtaccatggagttttatgagtcagc 60 atattttatt gttcttattccttcaatagttattacagtaattttcctcttcttctggct 120 tttcatgaaa gaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagct 180 tattcctacc aaaacagataaaaagaaagcagaaaagaaaaagaataaaaagaaagaaat 240 ccagaatggaaacctccatg 300 aatccgactc tgagagtgta cctcgagact ttaaattatc agatgctttggcagtagaag tgcacctgtt 360 atgatcaagt ccattgaatg tcgttgaaac ttcaagtagtgttagggaaa ggaaaagaaa 420 gaaaaaagaa caaaagcctg tgcttgaaga gcaggtcatcaaagaaagtg gattcctggc 480 acgcatcaaa aaaaaagtag aacctgtccc agttactaaacagcccacccctccctctgaagcagctgcc 590 tcgaagaaga aaccagggca gaagaagtctaaaaatggaagcgatgaccacjgataaaaag 600 gtggaaactc tcatggtacc atcaaaaaggcaagaagcattgcccctccaccaagagactaaacaagaaagtggatcagg660 gaagaagaaagcttcatcaaagaaacaaaagacagaaaatgtcttcgtagatgaacccct720 tattcatgcaactacttatattcctttgatggataatgctgactcaagtcctgtggtaga780 taagagagaggttattgatttgcttaaacctgaccaagtagaagggatccagaaatctgg890 gactaaaaaactgaagaccgaaactgacaaagaaaatgctgaagtgaagtttaaagattt900 tcttctgtccttgaagactatgatgttttctgaagatgaggctctttgtgttgtagactt960 gctaaaggagaagtctggtgtaatacaagatgctttaaagaagtcaagtaagggagaatt1020 gactacgcttatacatcagcttcaagaaaaggacaagttactcgctgctgtgaaggaaga1080 tgctgctgctacaaaggatcggtgtaagcagttaacccaggaaatgatgacagagaaaga1190 aagaagcaatgtggttataacaaggatgaaagatcgaattggaacattagaaaaggaaca1200 taatgtatttcaaaacaaaatacatgtcagttatcaagagactcaacagatgcagatgaa1260 gtttcagcaagttcgtgagcagatggaggcagagatagctcacttgaagcaggaaaatgg1320 tatactgagagatgcagtcagcaacactacaaatcaactggaaagcaagcagtctgcaga1380 actaaataaactacgccaggattatgctaggttggtgaatgagctgactgagaaaacagg1440 aaagctacagcaagaggaagtccaaaagaagaatgctgagcaagcagctactcagttgaa1500 ggttcaactacaagaagctgagagaaggtgggaagaagttcagagctacatcaggaagag1560 aacagcggaacatgaggcagcacagcaagatttacagagtaaatttgtggccaaagaaaa1620 tgaagtacagagtctgcatagtaagcttacagataccttggtatcaaaacaacagttgga1680 gcaaagactaatgcagttaatggaatcagagcagaaaagggtgaacaaagaagagtctct1740 acaaatgcaggttcaggatattttggagcagaatgaggctttgaaagctcaaattcagca1800 gttccattcccagatagcagcccagacctccgcttcagttctagcagaagaattacataa1860 agtgattgcagaaaaggataagcagataaaacagactgaagattctttagcaagtgaacg1920 tgatcgtttaacaagtaaagaagaggaacttaaggatatacagaatatgaatttcttatt1980 aaaagctgaagtgcagaaattacaggccctggcaaatgagcaggctgctgctgcacatga2040 attggagaagatgcaacaaagtgtttatgttaaagatgataaaataagattgctggaaga2100 gcaactacaacatgaaatttcaaacaaaatggaagaatttaagattctaaatgaccaaaa2160 caaagcattaaaatcagaagttcagaagctacagactcttgtttctgaacagcctaataa2220 ggatgttgtggaacaaatggaaaaatgcattcaagaaaaagatgagaagttaaagactgt2280 ggaagaattacttgaaactggacttattcaggtggcaactaaagaagaggagctgaatgc2390 aataagaacagaaaattcatctctgacaaaagaagttcaagacttaaaagctaagcaaaa2400 tgatcaggtttcttttgcctctctagttgaagaacttaagaaagtgatccatgagaaaga2460 tggaaagatcaagtctgtagaagagcttctggaggcagaacttctcaaagttgctaacaa2520 ggagaaaactgttcaggatttgaaacaggaaataaaggctctaaaagaagaaataggaaa2580 tgtccagcttgaaaaggctcaacagttatctatcacttccaaagttcaggagcttcagaa2640 cttattaaaaggaaaagaggaacagatgaataccatgaaggctgttttggaagagaaaga2700 gaaagacctagccaatacagggaagtggttacaggatcttcaagaagaaaatgaatcttt2760 aaaagcacatgttcaggaagtagcacaacataacttgaaagaggcctcttctgcatcaca2820 gtttgaagaacttgagattgtgttgaaagaaaaggaaaatgaattgaagaggttagaagc2880 catgctaaaagagagggagagtgatctttctagcaaaacacagctgttacaggatgtaca2940 agatgaaaacaaattgtttaagtcccaaattgagcagcttaaacaacaaaactaccaaca3000 ggcatcttcttttccccctcatgaagaattattaaaagtaatttcagaaagagagaaaga3060 aataagtggtctctggaatgagttagattctttgaaggatgcagttgaacaccagaggaa3120 gaaaaacaatgaaaggcagcaacaggtggaagctgttgagttggaggctaaagaagttct3180 caaaaaattatttccaaaggtgtctgtcccttctaatttgagttatggtgaatggttgca3290 tggatttgaaaaaaaggcaaaagaatgtatggctggaacttcagggtcagaggaggttaa3300 ggttctagagcacaagttgaaagaagctgatgaaatgcacacattgttacagctagagtg3360 tgaaaaatacaaatccgtccttgcagaaacagaaggaattttacagaagctacagagaag3920 tgttgagcaagaagaaaataaatggaaagttaaggtcgatgaatcacacaagactattaa3980 acagatgcag.tcatcatttacatcttcagaacaagagctagagcgattaagaagcgaaaa3540 taaggatattgaaaatctgagaagagaacgagaacatttggaaatggaactagaaaaggc3600 agagatggaacgatctacctatgttacagaagtcagagagttgaaggcacagttaaatga3660 aacactcacaaaacttagaactgaacaaaatgaaagacagaaggtagctggtgatttgca3720 taaggctcaacagtcactggagcttatccagtcaaaaatagtaaaagctgctggagacac3780 tactgttattgaaaatagtgatgtttccccagaaacggagtcttctgagaaggagacaat3840 gtctgtaagtctaaatcagactgtaacacagttacagcagttgcttcaggcggtaaacca3900 acagctcacaaaggagaaagagcactaccaggtgttagagtgaagtaattgggaaactgt3960 tcatttgaggataaaaaaggcattgtattatattttgccaaattaaagccttatttatgt4020 tttcaccctttctactttgtcagaaacactgaacagagttttgtcttttctaatccttgt4080 tagactactgatttaaagaaggaaaaaaaaaagccaactctgtagacaccttcagagttt9140 agttttataataaaaactgtttgaataattagacctttacattcctgaagataaacatgt4200 aatcttttatcttattttgctcaataaaattgttcagaagatcaaagtggtaaagacaat4260 gtaaaattta acattttaat actgatgttg tacactgttt tacttaacat tttgggaagt 4320 aactgcctct gacttcaact caagaaaaca cttttttgtt gctaatgtaa tcggtttttg 4380 taatggcgtc agcaaataaa aggatgctta ttattc 4416

Claims (116)

Claims

1. A method of diagnosing a disorder characterized by expression of a human cancer associated antigen precursor coded for by a nucleic acid molecule, comprising:
contacting a biological sample isolated from a subject with an agent that specifically binds to the nucleic acid molecule, an expression product thereof, or a fragment of an expression product thereof complexed with an HLA molecule, wherein the nucleic acid molecule is a NA Group 1 nucleic acid molecule, and determining the interaction between the agent and the nucleic acid molecule or the expression product as a determination of the disorder.

2. The method of claim 1, wherein the agent is selected from the group consisting of (a) a nucleic acid molecule comprising NA group 1 nucleic acid molecules or a fragment thereof, (b) a nucleic acid molecule comprising NA group 3 nucleic acid molecules or a fragment thereof, (c) a nucleic acid molecule comprising NA group 5 nucleic acid molecules or a fragment thereof, (d) an antibody that binds to an expression product of NA group 1 nucleic acids, (e) an antibody that binds to an expression product of NA group 3 nucleic acids, an antibody that binds to an expression product of NA group 5 nucleic acids, (g) an agent that binds to a complex of an HLA molecule and a fragment of an expression product of a NA group 1 nucleic acid, (h) an agent that binds to a complex of an HLA molecule and a fragment of an expression product of a NA group 3 nucleic acid, and (i) an agent that binds to a complex of an HLA molecule and a fragment of an expression product of a NA group 5 nucleic acid.

3. The method of claim 1, wherein the disorder is characterized by expression of a plurality of human cancer associated antigen precursors and wherein the agent is a plurality of agents, each of which is specific for a different human cancer associated antigen precursor, and wherein said plurality of agents is at least 2, at least 3, at least 4, at least 4, at least 6, at least 7, or at least 8, at least 9 or at least 10 such agents.

4. The method of claims 1-3, wherein the agent is specific for a human cancer associated antigen precursor that is selected from the group consisting of breast, gastric, lung, prostate, renal, colon, thyroid, Hodgkin's disease, and hepatocarcinoma cancer associated antigen precursors.

5. A method for determining regression, progression or onset of a condition characterized by expression of abnormal levels of a protein encoded by a nucleic acid molecule that is a NA
Group 1 molecule, comprising monitoring a sample, from a patient who has or is suspected of having the condition, for a parameter selected from the group consisting of (i) the protein, (ii) a peptide derived from the protein, (iii) an antibody which selectively binds the protein or peptide, and (iv) cytolytic T cells specific for a complex of the peptide derived from the protein and an MHC molecule, as a determination of regression, progression or onset of said condition.

6. The method of claim 5, wherein the sample is a body fluid, a body effusion or a tissue.

7. The method of claim 5, wherein the step of monitoring comprises contacting the sample with a detectable agent selected from the group consisting of (a) an antibody which selectively binds the protein of (i), or the peptide of (ii), (b) a protein or peptide which binds the antibody of (iii), and (c) a cell which presents the complex of the peptide and MHC molecule of (iv).

8. The method of claim 7, wherein the antibody, the protein, the peptide or the cell is labeled with a radioactive label or an enzyme.

9. The method of claim 5, comprising assaying the sample for the peptide.

10. The method of claim 5, wherein the nucleic acid molecule is a NA Group 3 molecule.

11. The method of claim 5, wherein the nucleic acid molecule is a NA Group 5 molecule.

12. The method of claim 5, wherein the protein is a plurality of proteins, the parameter is a plurality of parameters, each of the plurality of parameters being specific for a different of the plurality of proteins, at least one of which is a cancer associated protein encoded by a NA
Group 1 molecule.

13. The method of claim 5, wherein the protein is a plurality of proteins, at least one of which is kinectin, the remainder of which are non-kinectin cancer associated proteins, and wherein the parameter is a plurality of parameters, each of the plurality of parameters being specific for a different of the plurality of proteins.

14. A pharmaceutical preparation for a human subject comprising an agent which when administered to the subject enriches selectively the presence of complexes of an HLA molecule and a human cancer associated antigen, and a pharmaceutically acceptable carrier, wherein the human cancer associated antigen is a fragment of a human cancer associated antigen precursor encoded by a nucleic acid molecule comprises a NA Group 1 molecule.

15. The pharmaceutical preparation of claim 14, wherein the agent comprises a plurality of agents, each of which enriches selectively in the subject complexes of an HLA
molecule and a different human cancer associated antigen, wherein at least one of the human cancer associated antigens is encoded by a NA Group 1 molecule.

16. The pharmaceutical preparation of claim 15, wherein the plurality is at least two, at least three, at least four or at least 5 different such agents.

17. The pharmaceutical preparation of claim 14, wherein the nucleic acid molecule is a NA Group 3 nucleic acid molecule.

18. The pharmaceutical preparation of claim 14, wherein the agent comprises a plurality of agents, at least one of which is kinectin, the remainder of which are non-kinectin cancer associated proteins, and each of which enriches selectively in the subject complexes of an HLA molecule and a different human cancer associated antigen.

19. The pharmaceutical preparation of claim 14, wherein the agent is selected from the group consisting of (1) an isolated polypeptide comprising the human cancer associated antigen, or a functional variant thereof, (2) an isolated nucleic acid operably linked to a promoter for expressing the isolated polypeptide, or functional variant thereof, (3) a host cell expressing the isolated polypeptide, or functional variant thereof, and (4) isolated complexes of the polypeptide, or functional variant thereof. and an HLA
molecule.

20. The pharmaceutical preparation of claims 14-19, further comprising an adjuvant.

21. The pharmaceutical preparation of claim 14, wherein the agent is a cell expressing an isolated polypeptide comprising the human cancer associated antigen or a functional variant thereof, and wherein the cell is nonproliferative.

22. The pharmaceutical preparation of claim 14, wherein the agent is a cell expressing an isolated polypeptide comprising the human cancer associated antigen or a functional variant thereof, and wherein the cell expresses an HLA molecule that binds the polypeptide.

23. The pharmaceutical preparation of claim 21 or 22, wherein the isolated polypeptide comprises a kinectin polypeptide.

24. The pharmaceutical preparation of claim 14, wherein the agent is at least two, at least three, at least four or at least five different polypeptides, each coding for a different human cancer associated antigen or functional variant thereof, wherein at least one of the human cancer associated antigens is encoded by a NA Group 1 molecule.

25. The pharmaceutical preparation of claim 24, wherein the at least one of the human cancer associated antigens is kinectin or a fragment thereof.

26. The pharmaceutical preparation of claim 14, wherein the agent is a PP
Group 2 polypeptide.

27. The pharmaceutical preparation of claim 14, wherein the agent is a PP
Group 3 polypeptide or a PP Group 4 polypeptide.

28. The pharmaceutical preparation of claim 22, wherein the cell expresses one or both of the polypeptide and HLA molecule recombinantly.

29. The pharmaceutical preparation of claim 22, wherein the cell is nonproliferative.

30. A composition comprising an isolated agent that binds selectively a PP Group 1 polypeptide.

31. The composition of matter of claim 30, wherein the agent binds selectively a PP Group 2 polypeptide.

32. The composition of matter of claim 30, wherein the agent binds selectively a PP Group 3 polypeptide.

33. The composition of matter of claim 30, wherein the agent binds selectively a PP Group 4 polypeptide.

34. The composition of matter of claim 30, wherein the agent binds selectively a PP Group polypeptide.

35. The composition of claims 30-34, wherein the agent is a plurality of different agents that bind selectively at least two, at least three, at least four, or at least five different such polypeptides.

36. The composition of claim 35, wherein the at least one of polypeptides is kinectin or a fragment thereof.

37. The composition of claims 30-34, wherein the agent is an antibody.

38. The composition of claim 315 wherein the agent is an antibody.

39. A composition of matter comprising a conjugate of the agent of claims 30-34 and a therapeutic or diagnostic agent.

40. A composition of matter comprising a conjugate of the agent of claim 35 and a therapeutic or diagnostic agent.

41. The composition of matter of claim 39, wherein the conjugate is of the agent and a therapeutic or diagnostic that is a toxin.

42. A pharmaceutical composition comprising an isolated nucleic acid molecule selected from the group consisting of NA Group 1 molecules and NA Group 2 molecules, and a pharmaceutically acceptable carrier.

43. The pharmaceutical composition of claim 42, wherein the isolated nucleic acid molecule comprises a NA Group 3 or NA Group 4 molecule.

44. The pharmaceutical composition of claim 42, wherein the isolated nucleic acid molecule comprises at least two isolated nucleic acid molecules coding for two different polypeptides, each polypeptide comprising a different human cancer associated antigen.

45. The pharmaceutical composition of claim 44, wherein at least one of the polypeptides is a kinectin polypeptide.

46. The pharmaceutical composition of claims 42-45 further comprising an expression vector with a promoter operably linked to the isolated nucleic acid molecule.

47. The pharmaceutical composition of claims 42-45 further comprising a host cell recombinantly expressing the isolated nucleic acid molecule.

4$. A pharmaceutical composition comprising an isolated polypeptide comprising a PP Group 1 or a PP Group 2 polypeptide, and a pharmaceutically acceptable carrier.

49. The pharmaceutical composition of claim 48, wherein the isolated polypeptide comprises a PP Group 3 or a PP Group 4 polypeptide.

50. The pharmaceutical composition of claim 48, wherein the isolated polypeptide comprises at least two different polypeptides, each comprising a different human cancer associated antigen.

51. The pharmaceutical composition of claim 50, wherein at least one human cancer associated antigen is kinectin.

52. The pharmaceutical composition of claim 48, wherein the isolated polypeptides are PP
Group 11 polypeptides or HLA binding fragments thereof.

53. The pharmaceutical composition of claim 48, wherein the isolated polypeptides are PP
Group 12 polypeptides or HLA binding fragments thereof.

54. The pharmaceutical composition of claims 48-53, further comprising an adjuvant.

55. An isolated nucleic acid molecule comprising a NA Group 3 molecule.

56. An isolated nucleic acid molecule comprising a NA Group 4 molecule.

57. An isolated nucleic acid molecule selected from the group consisting of (a) a fragment of a nucleic acid molecule having a nucleotide sequence selected from the group consisting of nucleotide sequences set forth as SEQ ID NOs. 1-11 and 22-46, of sufficient length to represent a sequence unique within the human genome, and identifying a nucleic acid encoding a human cancer associated antigen precursor, (b) complements of (a), provided that the fragment includes a sequence of contiguous nucleotides which is not identical to any sequence selected from the sequence group consisting of (1) sequences having the GenBank accession numbers of Table 1, (2) complements of (1), and (3) fragments of (1) and (2).

58. The isolated nucleic acid molecule of claim 50, wherein the sequence of contiguous nucleotides is selected from the group consisting of:
(1) at least two contiguous nucleotides nonidentical to the sequence group, (2) at least three contiguous nucleotides nonidentical to the sequence group, (3) at least four contiguous nucleotides nonidentical to the sequence group, (4) at least five contiguous nucleotides nonidentical to the sequence group, (5) at least six contiguous nucleotides nonidentical to the sequence group, (6) at least seven contiguous nucleotides nonidentical to the sequence group.

59. The isolated nucleic acid molecule of claim 57, wherein the fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 50 nucleotides, 75 nucleotides, 100 nucleotides, and 200 nucleotides.

60. The isolated nucleic acid molecule of claim 57, wherein the molecule encodes a polypeptide which, or a fragment of which, binds a human HLA receptor or a human antibody.

61. An expression vector comprising an isolated nucleic acid molecule of any of claims 55-60 operably linked to a promoter.

62. An expression vector comprising a nucleic acid operably linked to a promoter, wherein the nucleic acid is a NA Group 2 molecule.

63. An expression vector comprising a NA Group 1 or Group 2 molecule and a nucleic acid encoding an HLA molecule.

64. A host cell transformed or transfected with an expression vector of claim 61.

65. A host cell transformed or transfected with an expression vector of claims 62 or 63.

66. A host cell transformed or transfected with an expression vector of claim 61 and further comprising a nucleic acid encoding HLA.

67. A host cell transformed or transfected with an expression vector of claim 62 and further comprising a nucleic acid encoding HLA.

68. An isolated polypeptide encoded by the isolated nucleic acid molecule of claim 55 or claim 56.

69. A fragment of the polypeptide of claim 68 which is immunogenic.

70. An isolated polypeptide comprising a fragment of a kinectin polypeptide which is immunogenic.

71. The fragment of claims 69 or 70, wherein the fragment, or a portion of the fragment, binds HLA or a human antibody.

72. An isolated fragment of a human cancer associated antigen precursor which, or portion of which, binds HLA or a human antibody, wherein the precursor is encoded by a nucleic acid molecule that is a NA Group 1 molecule.

73. The fragment of claim 72, wherein the fragment is part of a complex with HLA.

74. The fragment of claim 73, wherein the fragment is between 8 and 12 amino acids in length.

75. An isolated polypeptide comprising a fragment of the polypeptide of claim 68 of sufficient length to represent a sequence unique within the human genome and identifying a polypeptide that is a human cancer associated antigen precursor.

76. A kit for detecting the presence of the expression of a human cancer associated antigen precursor comprising a pair of isolated nucleic acid molecules each of which consists essentially of a molecule selected from the group consisting of (a) a 12-32 nucleotide contiguous segment of the nucleotide sequence of any of the NA Group 1 molecules and (b) complements of ("a"), wherein the contiguous segments are nonoverlapping.

77. The kit of claim 76, wherein the pair of isolated nucleic acid molecules is constructed and arranged to selectively amplify an isolated nucleic acid molecule that is a NA Group 3 molecule.

78. A method for treating a subject with a disorder characterized by expression of a human cancer associated antigen precursor, comprising administering to the subject an amount of an agent, which enriches selectively in the subject the presence of complexes of an HLA molecule and a human cancer associated antigen, effective to ameliorate the disorder, wherein the human cancer associated antigen is a fragment of a human cancer associated antigen precursor encoded by a nucleic acid molecule selected from the group consisting of (a) a nucleic acid molecule comprising NA group 1 nucleic acid molecules, (b) a nucleic acid molecule comprising NA group 3 nucleic acid molecules, (c) a nucleic acid molecule comprising NA group 5 nucleic acid molecules.

79. The method of claim 78, wherein the disorder is characterized by expression of a plurality of human cancer associated antigen precursors and wherein the agent is a plurality of agents, each of which enriches selectively in the subject the presence of complexes of an HLA
molecule and a different human cancer associated antigen, wherein at least one of the human cancer associated antigens is encoded by a NA Group 1 molecule.

80. The method of claim 79, wherein at least one of the human cancer associated antigens is kinectin or a fragment thereof.

81. The method of claim 79, wherein the plurality is at least 2, at least 3, at least 4, or at least 5 such agents.

82. The method of claims 78-81, wherein the agent is an isolated polypeptide selected from the group consisting of PP Group 1, PP Group 2, PP Group 3, PP Group 4, and PP
Group 5.

83. The method of claims 78-81, wherein the disorder is cancer.

84. The method of claims 82, wherein the disorder is cancer.

85. A method for treating a subject having a condition characterized by expression of a human cancer associated antigen precursor in cells of the subject, comprising:
(i) removing an immunoreactive cell containing sample from the subject, (ii) contacting the immunoreactive cell containing sample to the host cell under conditions favoring production of cytolytic T cells against a human cancer associated antigen which is a fragment of the precursor, (iii) introducing the cytolytic T cells to the subject in an amount effective to lyse cells which express the human cancer associated antigen, wherein the host cell is transformed or transfected with an expression vector comprising an isolated nucleic acid molecule operably linked to a promoter, the isolated nucleic acid molecule being selected from the group of nucleic acid molecules consisting of NA Group 1, NA Group 2, NA Group 3, NA
Group 4, and NA Group 5.

86. The method of claim 85, wherein the host cell recombinantly expresses an HLA
molecule which binds the human cancer associated antigen.

87. The method of claim 85, wherein the host cell endogenously expresses an HLA
molecule which binds the human cancer associated antigen.

88. A method for treating a subject having a condition characterized by expression of a human cancer associated antigen precursor in cells of the subject, comprising:
(i) identifying a nucleic acid molecule expressed by the cells associated with said condition, wherein said nucleic acid molecule is a NA Group 1 molecule;
(ii) transfecting a host cell with a nucleic acid selected from the group consisting of (a) the nucleic acid molecule identified, (b) a fragment of the nucleic acid identified which includes a segment coding for a human cancer associated antigen, (c) deletions, substitutions or additions to (a) or (b), and (d) degenerates of (a), (b), or (c);
(iii) culturing said transfected host cells to express the transfected nucleic acid molecule, and;
(iv) introducing an amount of said host cells or an extract thereof to the subject effective to increase an immune response against the cells of the subject associated with the condition.

89. The method of claim 88, wherein the nucleic acid molecule is a kinectin nucleic acid molecule.

90. The method of claim 88, further comprising identifying an MHC molecule which presents a portion of an expression product of the nucleic acid molecule, wherein the host cell expresses the same MHC molecule as identified and wherein the host cell presents an MHC
binding portion of the expression product of the nucleic acid molecule.

91. The method of claim 88, wherein the immune response comprises a B-cell response or a T cell response.

92. The method of claim 91, wherein the response is a T-cell response which comprises generation of cytolytic T-cells specific for the host cells presenting the portion of the expression product of the nucleic acid molecule or cells of the subject expressing the human cancer associated antigen.

93. The method of claim 88, wherein the nucleic acid molecule is a NA Group 3 molecule.

94. The method of claims 88 or 90, further comprising treating the host cells to render them non-proliferative.

95. A method for treating or diagnosing or monitoring a subject having a condition characterized by expression of an abnormal amount of a protein encoded by a nucleic acid molecule that is a NA Group 1 molecule, comprising administering to the subject an antibody which specifically binds to the protein or a peptide derived therefrom, the antibody being coupled to a therapeutically useful agent, in an amount effective to treat the condition.

96. The method of claim 95, wherein the antibody is a monoclonal antibody.

97. The method of claim 96, wherein the monoclonal antibody is a chimeric antibody or a humanized antibody.

98. A method for treating a condition characterized by expression in a subject of abnormal amounts of a protein encoded by a nucleic acid molecule that is a NA Group 1 nucleic acid molecule, comprising administering to a subject a pharmaceutical composition of any one of claims and 42-547 in an amount effective to prevent, delay the onset of or inhibit the condition in the subject.

99. The method of claim 98, wherein the condition is cancer.

100. The method of claim 98, further comprising first identifying that the subject expresses in a tissue abnormal amounts of the protein.

101. The method of claim 99, further comprising first identifying that the subject expresses in a tissue abnormal amounts of the protein.

102. A method for treating a subject having a condition characterized by expression of abnormal amounts of a protein encoded by a nucleic acid molecule that is a NA
Group 1 nucleic acid molecule, comprising (i) identifying cells from the subject which express abnormal amounts of the protein;
(ii) isolating a sample of the cells;
(iii) cultivating the cells, and (iv) introducing the cells to the subject in an amount effective to provoke an immune response against the cells.

103. The method of claim 102, further comprising rendering the cells non-proliferative, prior to introducing them to the subject.

104. A method for treating a pathological cell condition characterized by aberrant expression of a protein encoded by a nucleic acid molecule that is a NA Group 1 nucleic acid molecule, comprising administering to a subject in need thereof an effective amount of an agent which inhibits the expression or activity of the protein.

105. The method of claim 104, wherein the agent is an inhibiting antibody which selectively binds to the protein and wherein the antibody is a monoclonal antibody, a chimeric antibody, a humanized antibody or an antibody fragment.

106. The method of claim 104, wherein the agent is an antisense nucleic acid molecule which selectively binds to the nucleic acid molecule which encodes the protein.

107. The method of claim 104, wherein the nucleic acid molecule is a NA Group 3 nucleic acid molecule.

108. The method of claim 104, wherein the nucleic acid molecule is a kinectin nucleic acid molecule.

109. A composition of matter useful in stimulating an immune response to a plurality of a proteins encoded by nucleic acid molecules that are NA Group 1 molecules, comprising a plurality of peptides derived from the amino acid sequences of the proteins, wherein the peptides bind to one or more MHC molecules presented on the surface of the cells which express an abnormal amount of the protein.

110. The composition of matter of claim 109, wherein at least a portion of the plurality of peptides bind to MHC molecules and elicit a cytolytic response thereto.

111. The composition of matter of claim 109, wherein at least one of the proteins is kinectin.

112. The composition of matter of claim 110, further comprising an adjuvant.

113. The composition of matter of claim 112, wherein said adjuvant is a saponin, GM-CSF, or an interleukin.

114. The composition of matter of claim 109, further comprising at least one peptide useful in stimulating an immune response to at least one protein which is not encoded by nucleic acid molecules that are NA Group 1 molecules, wherein the at least one peptide binds to one or more MHC molecules.

115. An isolated antibody which selectively binds to a complex of:
(i) a peptide derived from a protein encoded by a nucleic acid molecule that is a NA Group 1 molecule and (ii) and an MHC molecule to which binds the peptide to form the complex, wherein the isolated antibody does not bind to (i) or (ii) alone.

116. The antibody of claim 115, wherein the antibody is a monoclonal antibody, a chimeric antibody, a humanized antibody, or a fragment thereof.