CA2341278A1 - Modified synthetic dna sequences for improved insecticidal control - Google Patents

Abstract

The present invention is related to modified, synthetic DNA sequences allowi ng improved insect control due to their improved mRNA procession, stability and their enhanced translation in higher plants. Said synthetic DNA sequences comprise useful tools for resisitance management, especially for overcoming cross-resistance problems. The improvements are achieved by providing synthetic modifications of the truncated DNA sequence (SEQ ID NO:3:) of the cry9Aa gene, preferably SEQ ID NO:2: coding for a protein characterized by having an amino acid sequence SEQ ID NO:1: or alterations thereof still havi ng substantially the same insecticidal action as the insecticidal protein encod ed by the cry9Aa gene of Bacillus thuringiensis ssp. galleria (Btg). Also disclosed is the use of the modified, synthetic DNA sequences for producing said insecticidal protein and for producing transgenic plants expressing effective amounts of the insecticidal proteins.

Description

Modified Synthetic DNA Sequences for Improved Insecticidal Control The Technical Field of the Invention The present izrventi.on is related to synthetic DNA sequences comprising modifications of t:he truncated gene encoding the N-terminal domain of the Cry9Aa endotoxin of Bacillus thuringiensis ssp. galleria characterized by having the amino acid sequence (SEQ ID NO:1:) or alterations thereof with substantially similar structure and properries. A method for preparing saici modified synt.r:etic DNA-sequence is disclosed in the present invention as well as the use of them. Said modified DNA-;sequences are useful for improved insecticidal control and a~ a tool in resistance management strategies.
The Background of the Invention The use of crystalline end.otoxins (Cry protein? of Bacillus thuringiensis (Bt toxins) for insecticida:L control has been the target for intensive research programs because the endo~-toxins are non-toxic to non-target organisms, including mammals and h~zman bE:ings . The endo-toxins rave a very specif is and selective: effect on insects, especially during their larval stage. In addition too the selectivity and specificity, Bt, toxins are considered to be the most effective bioinsecticides used in agriculture. Generally, the target insects develop resistance: to Bt toxins much s=Lower than to chemical inscacticvdes. For example, Plutella ~cylostella is known to dove-clop resistance to Cryl group of toxins in 30 to 1~J0 generations in laboratory conditions.
The bacteria3 Bt toxins as well as their modes of action have been studied intensively and some of tha_se endotoxins have been used as insecticides by administering culture broth containing t:he bacteria or by administf~ring more or less _ . _ r ~,_____ _...,..._...-:...:.z-,~ ,,.",-,...,-'WO 00/11025 PCTlFI99/OOb98 Bt toxins encoded by the c:r.y genes have also been used to produce transgenic plants. The fir~;t attempts to transform plants using the long, native sequences of the genes failed (Vaeck, M., et al., (1987) Nature 328:33-37?. Hence, different cry genes havf.~ been truncated to contain just the DNA sequence encoding the active toxin protein situated in the protoxin between the trypsi~z cleavage sites. Truncated cry genes have beE:n transformed ~_nto many plant species including tobacco (Burton, K.A., et al., (1987) Plant Physioi. 85:1103-1109;
Vae~ck, M., et al., (1987) Nature 328:33-37Carozzi, N.B., et a1 . , (1992) F~7.ant Mol. Biol. 20:539-548) , tomato (Fischhoff, D.A., et al., (19~~7) Bio/Technology 5:807-813; Delannay, X., et al. , (1989) Bic~/Technolocfy 7 : 1265--1269 and cabbage l;Ba:i, Y.'~'. , et al. , (19~%3) Current Plant ,Scienco and Biotechnology in Agriculture 15: 156-159).
Summarising these data it cyan be stated that in laboratory ex~~eriments the expressi-on of the Bt toxins has been sufficient for controlling insects, but field experiments have nwt been successful. enough (Warren, G.W., et al., (1992), J.
Eton. Entomol. 85 (5) : 1651-1659) to ful-fill the expectations.
The problem in the field experiments is mai-nly the variability in the level of expressed toxins. Tn order to enhance the expression of the toxins, ;strong promoter sequences such as t:he 35S CaMV promoter and untranslated leader-sequences from cauliflower mosaic virus C'aMV and translational fusions with n~>tII, have teen used in tomato (Vaeck, M., et al., (1987) Nature 328: :s3-37) and pot.a~o (Sticl~.len, M.B. , et al. , (1993) In: Yoy, C.B., et al., (ends.) Biotechnology in Agriculture.
Kl.uwer Academic Publisher:, Netherlands, 233-236). With such manipulation.. it rnas been possible to increase the expression of: the toxin genes and to stabilize the protein production to some degree, but not enouga~ to allow stable insect control.
mF~NA instabi:..-ity aIld dlfferences in bacterial and plant colon usage have been suggested to be the main reasons for the lack of Bt toxin cexpression in transgenic plants.

actively on plant. gene expressio=n. As a result codon preference tak>les of plant panes were composed (Murray, E.E. , et al., (1989) Nucl. Acad. F:es. 17:477-497). Collectively, the cod.on usage a:rnalysis of different plant genes showed that there is a sta:-ong avoidance «f XCG codons ~.n dicot plants and XT.~. i.n monocot plants (Grant.ham, R., et al., (1986) In: Oxford Su:rveys in Ev«1. B:iol. 3:48-81) as well as avoidance of some other minor c~~dons It was also shown that putative splicing (Goodball, G .1., and Filipowics, W., (1989) Cell 58:473-483) an~~ polyadenylation (Dean, C., et al., (198t~) Nucl. Acid. Res.
14 (5) :2229-2290; Joshi, C. F~. , (1987) Nucl . Acid Res . 14 (5) 222.9-2240) sites ofd plant ge=nes were characterized by AT-rich regions. Cry c:gene sequences are rich in AT content-_ and are far from the prefa~rred AT/GC rat=io of plant genes. Also a repeated AUL1UA sequence ha;~ been shown to be responsible for mRNA
degradation ir1 eucaryotes (Ohme-Takagi, M., (1993) Proc. Natl.
Acad. Sci. L;SA, 90:11811--11815). Furthermore, a conserved context or motif has been found in thE~ vicinity of the translational start codon A~1C~ in plant genes.
As a conclusi<~n, i.r~ 1986-1.98~~ features reducing the expression J_evel of somE bact=erial genes in plants were elucidated. It was shown that. extra AT content leads to sbontaneous formation of putative sp=lici=ng and polyadenylation sites and occurrence of minor ( for plant: codon p:reference) codons i n the context of t:he gene interfering with its expression. Partial modification of the cryTA.~~ gene at the sites of putatively aberrant mRNA processing was shown to lead to 10-fold :irucreased gene expression (:F~erlak, F.J. , et. a1. , (1991) Proc.
Natl. Acad. Sci. USA 88: 3~s2.4-3328; van der Salm, T. , et al. ;
(u994) Plant A~Iol. Biol. 26: 51.-59) . Report;s on the three first synthesised c=ry genes appeared in the early r_ineties. Perlak, F.J., et al., 1991 (Pros. TJatl. Acad. Sci. USA 88: 3324-3328) reported hyg;erexpression of fully modif ied crylA(b~ and c_rylA (c~ genes t=ransformed in tobacco and tomato plants .
Resynthesised gene sequences produced 100 t-imes more protein . _ . . , . _ _~- _~._ _____ ~_.__, ___ Plant Mol. Bi~~l. 21:1131-1145) and crylA(b) (Fujimoto, H. , et al., (1993) B:~o/Technology .1:1:1151-1153). Adang, M.J., et al., resynthetised the sequence of cryIIIA gene using ligation of oligonucleoti~ies of 13 different fragments (Adang, M.J., et al., (1993) Plant Mol. Biol. 21:1131-1145). The fragments were then ligated into a full gene sequence which was transformed into potato. fuijmoto, H., et al., (1993; resynthetised the crylA(b) gene sequence using high fidelity PCR. Seven synthesised fragments were: ligated into an entire gene sequence whit°h was then transformed in rice plants (Fujimoto, H., et al., '1993) Bio/Technology 11.:115-1155). All of these three articlE.s described the resynthesis of the toxin gene lacking unde~irabl.e processing signal sites and a change in the codon ~:ontext from bacterial to plant preference.
Modification strategies of the DNA sequence of Bt-toxins including monocot and dicot preference were disclosed in US
patent 5, 380, 831 and US pat:e:nt 5, 500, 365.
Resynthesised crylAb (Koziel, M.J., et al., (1993) Bi.o/Technoloc:~y 11: 194-200), cryIIIA (Perlak, F.J., et al., (1.993) Planj: Molecular Biology 22: 31.3-321) and crylAc (Perlak, M.J., et al., (1991) Proc. Natl. Acad. Sci. USA 88:
3324-3328) ~r~rere highly expressed in different plants in laboratory arid field trial;. Interestingly, high expression of the unmodifir>d truncated cryIA(c) gene was achieved using site directed transformation of tobacco chloroplasts (MaeBrige, K.
E~.;., et al., (1995) Bio/Te:chnology 13:362-365. Transportation of the crylA(c) gene product expressed in the nucleus into chloroplasts was shown to enhance the amplification of the protein by ~C! to 20 fold (Wong, E.. Y . , Eat al . , ( 1992 ) Plant Mol. Biol. 20:81--93). Pyramidal expression of two cry genes with different binding receptors was shown to reduce the incidence o~~ resistant insects (van der Salm, T., et al., (1994) Plant. Mol. Biol. 26: 51-59.
As disclosed above point. mutated cryl genes (Lepidopteran arr ; vP l hive heen modif ~.e~3 and especiall~n synthetic crylA ~'c) , prepared and ~.zsed for transforming plant yells. In a recent report (Conner, A.J., et al., Fifth International Symposium on the Molecular Bio:Logy of the Potato, August 2-6, 1998, Bogensee, Germany) it was shown that potatc lines transformed with truncateca crylAc gene had a greater impact on larval growth and survival than a sequence altered by site-directed mut~agenesis c;~f t~.-uncated, native cry9Aa2. Said results confirmed the observation that partial modification does not result in sufficiently high expre:asion level in plants, disclosed also by other research groups.
The main objective of the present invention is to provide plants with an increased tox:icity against target insects, such as lepidopteran larvae ira higher plant: by providing a substantially different in~~ecticidal protein encoded by DNA
sequences, which simultanE:ously convey enhanced expression through improved rnRNA processing and stability as well as enhanced translation, which Together bring about increased t:o7_erance of knighe~: plants against attacks of target insects .
In other word,, the objectives of the present invention are to obtain transgenic plants highly expressing a synthetic DNA
sequence enc~~ding a unique Bt-toxin having a specific insecticidal action, thus providing a means for delaying development of insect tolerance to the toxin and to overcome problems related to cross;-Yesistanc~e phenomena. The latter enables the use of the synthetic DNA sequences of the present invention for implementing 'resistance management strategies.
The Summary of the Invention The objectives of the invention were achieved by providing novel synthetic DNA sequences by modifying part of the gene encoding the N-terminal end of the native Cry9Aa protein, the toxicity of which is base<~ on an insecti~~idal action and/or binding rece~~tor mechanism differing substantially from that of ather CryI: toxins.

WO 00/11025 PCT/F199/0069$

DNA sequence: of the truncated DNA sequence of the cry9Aa gene encoding a prote~_n characterized by an amino acid sequence (;3EQ ID NO: I:) ar alterations thereof, which still have substantiall~r the same structure and insecticidal action as the N-terminal. domain of the CryS~Aa endotaxin of Bacillus t:i"~uringiensis ssJ?. gallEr.ia. The modified synthetic DNA
sequences arm characterized by conveying improved properties, such as enhanced expression through increased mRNA procession and stability as well as translation capacity in transgenic plants, whila the encoded (expressed) delta-endotoxin is still maintaining substantially the same insect.icidal action as the delta-endotoxin encoded by the native cry9Aa gene. Said modified synthetic DNA sequence can be inserted into suitable I~NA constrokcts to enable their transfer into desired procaryotic or eucaryotic hosts.
'The improved mT~.NA processing and stability as we:Ll as translation of the corresponding toxin protein is obtainable by modifyin<~ the radon preference as well as providing other ;r~odificatior~:s in the synthetic DNA sequence of the truncated cry9Aa gene to prefer selected higher plants. For example, the codon bias c:an be changed to Brassica preference, bur also more generally ~~o dicot preference, alteration to monocot preference oeing the least preferred alternative. The start <:odon vicin Lty can also J~~~ changed to be more desirable for higher plants. In the experiments tobacco, turnip rape, cauliflower and potato plants were used, but it is evident that other pl.ant:~ could be=_ transformed as well.
'.Che synthetic DNA sequences of the present invention are capable of expressing in procaryotic or eucaryotic organism an insecticidal protein characterized by having an amino acic ;sequence (yEQ Iv NO:1:) or altexatians thereof capable of demonstrating properties, which axe substantially similar tc 'the properties of the selected domain of the se~lectec insecticida.L pr{stein, vi , a . Cry9Aa to~:in, which does not _ _. _ . _ __ _. _ ~ L _ ._ ...... _ ~ _ ...... ~, .,...., ~ ,. ,..,.. a ., .

other CryI toxins , The modified synthetic DNA .sequences encode substantially the same protein as the DNA sequence of the truncated cry9Aa gene encoding the N-terminal domain of the insecticidal protein of Bacillus thuringiensis ssp. gallewia. The most preferred embodiment of said DNA sequences are synthetic DNA sequences having a substantial similarity, meaning a similarity comprising nct more than 25 % nucleot.-.ide changes compared with SEQ ID N0:2: and capability o.f encoding a protein substantially similar_ with SEQ ID NO:1: c>r a protein having substantially the same properties. The rnociified DNA sequences oq= t: he present invention pre f:erably comprise less than 50 0, more preferak;ly less than :?~> o, most preferably more than 5 0 n,scleotide changes as compared to SEQ ID No:3:. The modified DNA sequence:: of the presents invention preferably comprise up t:~ 20 a or more change:> as compared to SEQ fD N0:2:. The mc:~di.fied syntheti~:~ DNA sequences, should encode a protein substantially different from the known insecticidal proteins, a . g . the cry~Ac and the cr.ylC genes .
The modified synthetic DNA sequence: of the present invention cam be produced by changing the codon bias in the direction of the selected higher plant, prefe~~abl.y to dicot but most preferably to l3rassica preference. Preferably, the putative polyadenyiat_i.on, splicing and mR.NA destabilising signal sequences arcs removed and the vicinity of the start codon is a7_tered to increase the compatibi.l:ity to higher plants. The modified syn*_hetic DNA sequences are characterized by having innproved expwessic>z~L and stability.
The method fox preparing modified :synthetic DNA sequences of the present invention comprise the steps of selecting a synthetic DNA sequence from a gene encoding an insecticidal protein having properties differing substantially from known insecticidal proteins, whi~~h are characterized by conveying r .». , r.t -"-,1.~, ncnor-; a l 1 m nr~~mnt- i nr~r r'3a~7P1 nmmPnt- of Tre synthetic DNA sequences can be inserted into suitable DNA
constructs, vJectors arid p:Lasmids, which in turn can be introduced int:c> desired hosts .
The present invention also discloses the use of the modified synthetic DN/~ sequences with a different specificity and expression lE~vel .and mRNA stability, which confers to the higher plant an improved toxicity to target insects. The modified synthetic DNA sequences of the present invention p~~ovide tran~:genic plants for improved insectic:idal control w~.th increase-~d toxicity to target insects. Said transgenic plants are capable of expressing effective amounts of the desired insec~ticidal prot:e:im and of overcoming the onset of the cross-rf~sistance phenomenon currently observed in connection with the use of other Cryl or Bt toxins.
The transgen..c plants of the present invention were tested with wild :insects and ~he resul.ts were recorded using bioassays described below. Two CryIAc and CryIC resistant lines of dianuond back. mot=h (Plutel.la xyloste.Ila) were used in th.e cross-resistance bioassays. The results obtained, confirmed thc.~ originality of Cry9Aa toxin, which killed the larvae of :;.nsect:s r_esi~~tant to CryIAc and CryIC. Also transgenic plant cell line~~ capable of expressincf Cry9Aa toxin killed the 1<xrvae of resist: ant Plutella xylostella strains .
Ttie Brief Description of the Drawings Fi~~gure 1 depicts the amino acid sequence of insecticidal active N-terminal domain o:E Cry9Aa delta-endotoxin of Bacillus tvhuringiensi:~ ssp. galleri,~.
Figure 2 depicts :synthetic DNA sequence for high expression in higher plant_ s encoding t: he i.nsecticidal, active N-terminal domain of thf~ Cry9Aa delta-~~ndotoxiri of Bacillus thuringi.ensis WO 00/11025 PCT/i<I99/00698 Figure 3 depicts alignment of native (SEQ ID N0:4:), truncated (SE:Q TD N0;3:> and synthesized (SEQ ID N0:2:) cry9Aa gene sequences . The: sites of the start arid the termination codons as well as tl~e restriction sites introduced in truncated or synthetic seguences are marked by shadowed boxes. Changed nucleotides are underlined in the synthetic and truncated sequences. ThE~ fragments witrin the restriction sites were syn-thesized separately. After that they were verified to avoid mistakes and fused together :into a synthetic sequence.
Figure 4 depicts alignment of native, truncated and synthesized Cry9Aa protein .>equences. The changed amino acids are marked b~~~ underlining in the truncated and the synthetic gene protein sequences.
Figure 5 depicts plant transformation constructs containing th.e native truncated sequence of cryQAa gene (A), the synthetic cry.9Aa gene (B) and translational fusion with uidA
gene (C). ThE: abbreviations in the boxes a:re as follows:
RFC, LB -- ri~~ht and left borders c~f T-DNA from Ti plasmid;
pAnos, pAg7: pAocs - polyadenylation signal. sites from different sources; AMV - untranslated leader from CaMV
(cauliflower mosaic virus); 35S:Sp - doub:le 35S promoter from CaMV; nosp -- promoter from nopalin synthetase gene; nptII -neomycin phosphate transferase II gene; hpt - hygromycin phosphate transferase gene uidA (GUS) - fL glucuronidase gene.
The other names shown are restriction enzymes beside the pBIN
and pHTT plant transformation vectors.
Figure 6 depicts bioassays of cauliflower transgenic plants against P. xylostel3a insects.
The cauliflower plants were placed in a cage with P.
~,:ylostella cvultures. The p:Lants were grown in the cage for 10 clays. After that the photographic picture was taken. The two upper plant;, are untransformed conr_rols. Two lower plants are t:ransgenic L ones of caul. i.f lower with low or moderate (A--10 ) - .-- ,._._,..7 ..~ ~T _nl nvr~raa~~np (7f Crv9Aa toxin. The all stages i_ransferred from control plants. The plant of the A-0 line has only very small traces of insect bites. Both control plar~ts were fully damaged by the insect attack and died in the next few days.
Figure 7 depicts molecular analysis of synthetic cry9Aa gene expression in transgenic tobacco.
Figure 7A depicts a Northern blot of total RNA.
Samples containing 3 ug of_ total RNA of tobacco plants were loaded in the gel. Northern blot was performed according to the instruc'.ions of the supplier Boehringer Mannheim. Samples shown are as follows: C' - RNA of non-transformed control plant; and 'T-GS 1 - 9 are lines of_ transgenic tobacco:
Control RNA synthesized from the gene sequence with T3 RNA
polymerase was loaded in the gel in series comprising 0.6 pg -_~ . 6 pg - 5 ~ pg -- 1..5 pg. The T-G8 1, '~ and 4 lines show a :signal ar_ a,.bout 15 pg RNA. It means that the expression is about 5 pg per 1 ~.g of total RNA_ The T-GS 3 and 7 lines show the signal ~~t. about 3 pg, meaning that the expression is about :1 pg per 1 ~.g ofd total Ftt~A. The T-GS 9 line shows the signal at about 1 pg, meaning that the expression is about 0.3 pg per 1 ~.g of total RNA. The average expression of cry9Aa mRNA is 2 pg/~g of total RNA.
Figure 7B depicts Western blot of tobacco plants transformed with synthetic cry9Aa.
Samples containing 1.0 E~.g of fully soluble protein of tobaccc plants transformed with synthetic cry9Aa are loaded in 8 denaturating PAGE, run and blotted in semidry blottinc conditions on nitrocellulose membrane. The membrane way blocked wilyh 1 % BSA. Rabbit antibody serum raised against crystal proteins of B. thuring.i.ensis and conjugated witr acetone prc:~cipit.ated protein powder from tobacco, caulif7_owez and turnip rape was used for incubation. The samples arE
tobacco TG;--2..9 transgenic lines, C - control non-transformer i ~.. n w ~ n ", ... .S ~ r ._ ~ a_ L - .- _ _ _ v - _ _. - _ _ _- _ _ _ - - _ i _ _ _ r, 1~V0 00/11025 PCT/F199/00698 control protein is 30 amino acids longer than the protein expressed in the plants because of t:he additional LacZ leader protein. According to this Western blotting the T-GS-2 line expressed Cryt3Aa protein as soluble protein 0.2 % or 600 ng/g of leaf tissue, the T-GS-4 line expresses 0.15 % of soluble protein or 10:x0 ngjg of lea:E tissue, the T-GS-8 line expresses 0.3 'o of soluble protein or :1440 ngjg of ~~eaf tissue and the T-(3S-7 line empresses 0.2 % of soluble protein or 1020 ng/g of leaf tissue. verage Cry9Aa expression in tobacco plants is 1 f.cg,/g of leaf t=issue or 0.2 0 of soluble protein.
Figure 8 depicts rnoleculaz- analysis of expression of native truncated and GUS fused constructs of cry9Aa gene.
Fi~3ure 8A de~i.cts a Northern blot of tota-~ RNA of transgenic tobaccos tran;3formed with a truncated native sequence.
Samples containing 3 ~g of total RNA of tobacco plants were :l.coaded in thE= gel.. Northez__°n blotting was performed according to the instri.~ctions of the=_ supplier Boehringer Mannheim. The samples are ~~~~ follows : 'f:hc=_ T-GT-3 . . . 11 - Lines of tobacco transformed with truncate:c. native cry9Aa gene; and the positive cont:.rol 0.2 - 5 pg of_ cry9Aa RNA produced on the pI3luescript with T3 RNA po=Lymerase. The signal on the tobacco lanes is seen at. 0.1 to 3 pg. It means that mRNA expression is 0.03 - 1 pg/acg of total RNA and the average expression is about 0.2 pg/~g of total RNA.
Figure 8B de~~icts a Northern blo.'_ of total RNA of transgenic tobaccos tr<~nsfanmed with a truncated native sequence translational.ly fused with uidA (GUS) gene.
The T-G/G-10...21-lines of tobacco transformed with truncated native cry9Aa sequence fused in a translational frame with uidA (GUS) gene. C - RNA c>f: non-transformed tobacco plants.
Pasi_tive controls are 1 - a.0 - 20 pg of cry9Aa RNA produced on tue pBluescr ipt with T3 I~NA polymerase . The signal ors the t ~vh_m~nn l amc~ ~. c Frnm (l ~ ~r~w l ~ r-~n of r~rW711a mT7TTl~ T+- mc»,wo average expre~>si.on is about 0.3 pg/~.g of total RNA.
Figure 8C dep:~.cts a Western blot of tobacco plants transformed with truncatec:~ native (T-GZ'1 as well as with GUS fused (T-G/G) cr~r9Aa gene sc__>quenc:e .
Samples conta.-tning 50 ~.g of total soluble protein from tobacco plants transformed with truncated and GUS fused native cry9Aa gene were loaded in 8 % denaturating PAGE, run and blotted in semidry blotting candition;s on nitz'ocellulose membrane. The membrane was blocked with 1 o BSA. Rabbit antibody serum raised again;~t. crystal proteins c>f_ ~3. thuringiensis and cc»zjugated wi~.=.h acetone precipitated protein powder of tobacco, cauliflower and turnip rape was used for incubation.
Trje samples y,:~sed are as follows: Tobacco T-GT-3..11 lines ti'i~nsformed with the tx-uncated native sequence; T--GS-4 (t.obacco line transformed with the synthetic cry9Aa sequence) - 50 ~.g of total soluble protein containing 75 ng Cry9Aa peptide as positive control; and 'i'-G/G 14a...21. - tobacco lines tram:>formed with truncated native Cry9Aa-GUS
tz-anslational fusion construct. There is no detectable Cry9Aa signal on the lines of tobacco plants transformed with the truncated native or GUS fused cry9Aa gene.
Figure 8D de~pi.cts a Western blot of T-GS-8 and non-trans-formed NTS lines of tobacco mixed in different proportions.
Samples of scl.uble proteins from tobacco were mixed and loaded in. the order shown on the photographic picture. The gel and membrane werf, developed 1n the same Western procedure as the samples of t:ha Figure 8C. The last, track can be used as a negative con~:rol t~or Figure 8C. This Western blot shows that the T-GS-8 sample diluted 50 times still shows a detectable Cry9Aa signa:~.. It means that the native cry9Aa gene construct produces at least 50 timers less of the protein product than the synthetiw sequence.
F9~gure 9 de~:~icts molecular analysis of the synthetic cry9Aa ~,~.."~ ,~~~-.~.-~-,r.r. , ,r, ; r, tr~ncrrcn-i r ~r-~nt~tn r~l l7i t-f1 Figure 9A depicts a Northern blot of total RNA.
Samples containing 3 beg off: total RNA of potato plants were loaded in the ge:l . 'the samples shown are as follows : C
RNA of non-transformed control potato plant; and P-GS 1-8 are :J.ines of transgenic tobacco . The cc>ntrol RNA synthesized from the gene se~3uence with T'7 RNA polymerase was loaded in the c3e1 in series of 0.6 pg - 1.6 pg - !3.0 pg - 15 pg. The P-GS 1, 2 and 4 limes snow a signal at about :LO pg RNA. It means that expression is about 3 pg per 1. beg of total RNA. The P-GS
r;, 7 and 8 Lines show the signal at about 3 pg, meaning that the express.LOn is about _. pg per 1 ~.g of total RNA. The average expxession of cry~Aa mRNA i,s 2 pg;~g of total RNA.
Figure 9B depict a Western blot of potato plants cv. Pito transformed with synthetic. cry9Aa.
Samples containing 40 ~g of total :soluble protein from potato plants trar:sformed with synthetic cry9Aa were loaded in 8 % denaturat:ing PAGE, run and blotted in semidry blotting conditions on nitrocellu:Lose membrane. The membrane was blocked with 1 o BSA. Rabbit antibody serum raised against crystal prc,teins oL B. thuringif=nsis and conjugated with acetone precipitated protein powder from tobacco, cauliflower and turnip :rape was used for incubation. The samples used are t:he potato PG~S-1...8 transgenic lines; C - control non-transgenic tobacco, Cry9Aa 5 and 15 ng - the protein expressed in E. coli from the synthetic sequence of cry9Aa.
'this contrcal protein is 30 amine acids longer than what expressed izi the plants because it contains an additional LacZ
:Leader peptide. Accordiry to this Western the P-GS-1 and 1P-GS-8 linE~s show a C:ry9Aa signal of about 10 ng , which corresponds to an express>ion of 0.03 0 of soluble protein or :300 ng/g leaf tissue. The: P-GS-2 and 5 lines show a lower expression.
:Figure 10 depicts molecular analysis of synthetic cry9Aa expression in transgenic cauliflower cv. Asterix.

'WO 00/11025 PCT/FI99/00698 Samples containing 3 ~g of total RNA from cauliflower plants were loaded :in the gel. The samples shown are as follows:
Nucleic acid tNA) of non-transformed control plant; the A-0 anct A-l0 line;; of-_ transgenic: cauliflower revealed insecticidal properties. Tl~e control RNA ~:ynthesized from the gene sequence with T3 RNA pc>lymerase was 7_oaded in the gel in series of 1.25 pg - 2.5 pg - 5.0 pg. The A-0 line shows a signal at about 2 ~>g RNA, meaniaag that the expression is about 0.7 pg per 1 ~g of total nuclc:e.c acid. A-l0 line has the signal about 0.6 pg, meaning that ~:rre expression is about 0.2 pg per 1 ~g of total RNA .
Figure lOB depicts Western blot of cauliflower cv.Asterix.
Sarnples cont:~ining 50 ~.c~ of tot:a7_ sUluble protein of cauliflower acre used in the Western. The samples are as follows: C is a non-transformed plant control; and A-0 a cauliflower line transformed with. the synthetic cz-y9Aa sequence. 5 and 2C> ng of C:ry9Aa protein expressed in E.coli re~~?resents the positive control. The A-0 lane shows a pc>:~itive Cry9Aa signal at a concentration cf about 5 ng of the to:Kin protein. It rneans that the expression is about 100 ng of Cr,y9Aa protein per 1 g of leaf tissue or 0.01 0 of soluble prwotein.
Figure 11 depicts Northern blot analysis of cry9Aa mRNA
expression ir; turnip rape plants cv. Valtti transformed with the synthetic sequence of c~ry9Aa gene.
Samples containing 3 ~g of: total RNA from turnip rape plants wf~re loaded an the gel. The samples shown are as follows: C -RNA of untransformed control plant; V-GS-12.1 and V-GS-14.3 lines of transgenic turnip rape revealing insecticidal properties. ~~ontrol RNA synthesised from the gene sequence with T3 RNA polymerase was loaded in the gel in series of 1.25 pg - 2.S pg - 5.0 pg. Bath lines show a signal at about 0.6 pg RNA, meaning that expressir~n is about 0.2 pg per 1 ug of total R:N'A .

'WO 00/11025 PCT/F199/00698 Donor organisms, promoters, leader sequences, vectors, bacterial and insects used in the present invention Below is a non-exhaustive list of materials used in the present invf~ntior~. However, the present invention is not rE=_stricted to the use of the listed materials. One skilled in the art can easily think of other suitable readily available sources of material and organisms and carp also apply them in t.lze present invention in order to accompli sh the same re cult .
Cry-gene donor orc.3anisms B,aci3lus thuringiensis ssp. galleries T:he Russian Lnstitute for Genetics of Industrial Microorganisms Moscow, Doi_-oznyi proezd 1.
I?lant promoters u35S promoter of CaMV
(Odell, J.T , et al., Nature v. 313 28 February 1985, p t~10-812; Quzi ~hu, et al., Biotechnology v. 12, 1994, p.
130'7-812) .
~~~eader sequence :HMV leader (Datla, R.S.S., 1993 Plant Sci. 94:139-149).
I=~lant Transf:ormati.on Binary Ti vector F~GPTV vector: s (Becker, et al., 1992, Plant Mol. Biol. 2.0:1195-1197).
yBIN vector (F:i-rsch, D.F,. , et al. , 1995, Plant Mol . Biol. 2'7: 405-409) .
Plant transtormatiQn cointegrative Ti vector ~>HTT
I;Elomaa, P. ,, et. al . , (199.3) Bio/Technol. 11:508-511) E3acterial strains Eagrobacterir m tumefaci.ens strains C58C1 with n~;V'~R~n pGV2260 (Deblaere, et al., 1985 Nucl_ Acids Res.
13:4777-4788), EHA105 (Hood, et al., 1993 Transgenic research 2:208-218) and LBA4404 with pAL4404 helper plasmid (Hoekema, et al., 1983 Nature (London; 303:179-180).
Insect Strains Plz.~tella xylostella wild type collected from the Viikki Experimental Farm. 'rwa Cry.IAc and CryIC resistant P.xylostella strains were received from Professor T. ~;helton at Cornell University, but such strains are avai:l.able and obtainable from other sources as well.
The Detailed Description of the Invention In the present. invention most terms used have the same meaning as they generally have in the fiE:lds of recombinant DNA
te~~hniques, mc:~lecular biolc>gy as wel L as in plant production an~f. entomology related sciences. Some terms are, however, used in a somewhat different way and are explained in more detail below.
They term "modified synthetic DNA sequence" means DNA sequences prepared by :synthetic means, such as nucleotide sequencing and/or by rep~_acing nucl.eot..ides in the truncated DNA sequence (SEQ ID N0:3:~ obtained from the cry9Aa gene by changing the cocoon bias tc prefer the codon usage ef selected higher plant(s), preferably dicots, such as Brassica, or combinations thereof by uc-~.ing compiled tables indicating dicot, monocat and/or selected higher plant, e.g. Brassica preference. The modified DNA sequences of the present invention encode an in:~ecticidal protein characterized by the amino acid sequence (SF~Q ID N0:1 : alsa shown in Figure ~.) or alterations therof .
The most preferred synthetic DNA sequence is SEQ :ID N0:2: also shown in Figure 2 c>r modific~atians thereof.
The term "modifications thereof" means that at least 5 %, prf~ferably more o:~ the nuc~LE:otides c:~f SFC~ Tn Nn~ ~ . ha~rA hAF~n higher plant(s), e.g. Brassica. In other words the modified sequences comprise all synthetic DNA sequences in which at least 10-20, preferably :15, but not all codons have been changed. Furthermore, the germ "modifications thereof" means that the putative polyadenylation, splicing and mRNA
destabilising signal sequences have been removed from the DNA
sequences (S~Q ID N0;3:) t.o provide the modified synthetic DNA
sequence (SEc~ ID N0:2:) shown in Figure 2. It also means that the start cc~don vicinity has been made more compatible with the selected higr~er plant(s). The only prerequisite for the modified syn.theti;= DNA sequences of: the present invention is that they should still encode endo-toxins which have "substantial:ly similar" o:r "essentially identical" properties and/or activ:i.tie;s as trie~ truncated insecticidal protein encoded by t.:~re c:rygAa gene of Bacillus thuringiensis ssp.
galleria (Btg). It is imps>rtant to note that native genes and sate directed mutations of it are not sufficient to provide tlZe highly expressed, modified, synthetic DNA sequences of the present inv~antion.. In order to get synthetic DNA sequences rlaving the caes:ired properties of the pre;~ent invention it is rnecessary to :have a synthetic DNA sequence and to alter it in a skilled fashion based on knowledge and experience as described below.
'ihe term "ex-y9Aa" (in Hdfte and Whiteley (1989) Microbiology Review 52: 242-255) classification cryZG), encompasses the genes cry9A~~1 and cry9Aa~,, because both encode the same toxin region and have the same DNA and amino acid sequence. The "cry9Aa" gene was previously called the crylG gene.
The terms "substantial.ly similar" means "essentially identical" or that the amino acid sequences encoded by the ~7NA sequences of. the pre=gent invent: ion have a structure which is substantially the same as the structure of the N-terminal, trypsin sustaining, part of the lepidopteran active ~~.elta-endotcxin of Bacillus thuringiensis ssp. galleria °T1CWC3PC~ by YhP -!'laY~l~rP r'r~rqlla t nr~rTr_'1 ..or,~, l-...~-.....,... ~t ~:.c_--~7V0 00/11025 PCT/FI99/00698 somewhat from said delta-endotoxin with the prerequisite that the altered or different sequences still have essentially the same insE~cticidal action and properties as the amino acid sequence enc:~oded by the native cry9Aa gene.
Tree selected amino acid sequence (SEQ TD N0:1:) also shown in Figure 1 with trypsin cleavage site, can be altered using minor truncat.i.ons in the N-terminal and/or C-terminal end or minor replacf~ments in the intermediate regions. The size of the C-terminal. or N-terminal. truncations as well as the number of replacements can be different depending upon the domain in which the truncations ors replacements occurs. In active domains of the protein the replacements should be no more than 1C~, preferab=! y no more than 5 and most preferab7_y less than 2 amino acid residues whereas amino acid residues in domains l~:ss relevane~ for the insecticidal action can comprise more replacements. These truncations and replacements can be carried out with per se' known methods. However, it is important than said truncations or replacements should not alter the px:operties, especially the insecticidal action of tree endotoxins as determined by the bioassays disclosed in the present invention. Especially, the minor truncations and/or repla:~cemeras should not make the endotoxin less effective th,~n the native Cry9Aa endotoxin characterized by having SEQ ILK NO:l: or Figure 1.
The term ":implementing resistance management strategies"
includes foi example the following tactics fox deploying ir.~sect resistance ; gene strategies using strongly expressing single genes, multiple genes, e.g. pyramiding and/or chimer.ic genes; gene promoter strnt.egies using constitutive, tissue specific anci/ar inducible promoters, e.g. wounding; gene expression ,~~trategies using high dose, low dose and/or mixtures; but above all field strategies using uniform single gene tactic::a, mixtures of genes,, gene rotation, mosaic planting andjor spatial or temporal refuges.

genes with unique properties are required.
The term "improved mRNA processing" means that the modified synthetic DNA sequences convey successful processing of mRNA
of the foreign gene in a transgenic plant.
Th.e term "improved properties" means above all that the toxin protein is wfficiently unique and expressed in sufficient amounts to enable effective and sustainable insect control and improved resistance management development, but the term also includes other improved t=allot-made properties, such as unproved production in plant. tissues with consequent improved insecticidal action of tlzc? protein in field trials. The improved properties are obtainable by selecting the amino acid sequence enc~~ded by the unique cry9Aa gene and using a truncated synthetic DNA sequence as the basis when preparing modified synthesized DNA sequences and providing said sequences w~.th tailor-made modifications prepared with experienced knowledge. The modified, synthetic DNA sequences inr_lude remov.~.l. of the putative polyadenylation, splicing and mkNA destabilising signal :sequences as well as removal of hairpin loops with per se known methcds.
The "improved properties" also are obtainable by changing the colon preferexice in the direction of a selected higher plant, preferably dicot preference, most preferably Brassica preference or combinations thereof. Monocot.preference is a less preferred choice. Addit:i.onally, "improved properties" are obtainable by making the start colon vicinir_y of the synthetic DNA. sequence mare compatible or desirable to higher plants.
The term "improved expression°' means that the selected plants are capable of expressing ele:Vated amounts of endotoxin which are sufficienU:ly effective to control target insects. 'this means that the toxin is expressed in amounts capable of ki:;.ling larvae when compared to previously used constructions.
Th « ~ .-. ...-,- .. . ._ protein" means that the transformed plant should express the insecticidal protean in at :least such amounts that the plant material cont,~ins enough ez:rdotoxin to kill a substantial part of the target. insects. The expressed effective amount should have a desired insecticidal dietary effect of at least LC~~~p - 60, pz°eferably 80, most preferably 100 ng/ml diet against PlutE~11a xylostella (Diamond back moth) and P.i.er:is brassica (cabbage butterf=l.y) and potato tuber math in laboratory conditions. These numbers are applicable for a time of two days. Generally, it can be said that the longer the ef fective time is the smaller is the amo-,.~nt needed. Due to the diversity in the genomes of wild insects as well as the natural vari~stion in gene expression ir, the plants, the average dietary ef:Eect required should preferably be somewhat higher in fie:.ld trials. Consequently, it is desirable that the amount tcaxin expressed in field experiments should also be somewhat zighe=c than the amount, required in laboratory experiments.
The term "codon preference" or "codon bias" means that the nucleotide ccdons have been selected based on the highest frequency used for a particular amino acid in the coding sequence of the active gene: of the selected species.
The term "removal of putative polyadenylation" means removal of the poly-F, :Like signal :~e:quence ( s? attached to the end of eur_aryotic gkjnes occurrir_g in the cry genes inside the sequence leading to truncat=ion of the coding sequence during mRPJA processing. These sequE:nces are removed in constructing the synthetic cry gene sequence-The term "removal of splicing and mRNA destabilising signal sequences" means treat branch-sequences commonly present in the int:ron sequen~es of eucaryot:ic genes involved in splicing of the gene and destabilizing sequences having repeated ATTTA
motifs are removed by nucleotide replacement in the Synthetic cry sequence.

'WO 00/11025 PCT/F199/00698 The: term "altered start codon vicinity" means that the start coclon vicinit~~r (i.e. sequevnces around the start codon) has been changed to be more compatible with a higher plant.
The term "removal" means that nucleotides are changed ar replaced in tr-.e DNA sequence' so that signal motifs) disappear while: the DN~i sequences encode proteins with substantially similar amino acids as the native Cry9Aa toxin.
They term "an insecticidal protein differing essentially from knov~m insect~.cidal proteins°' mean:> that the amino acid sequence in t:he N-terminal insecticidal part of the Cry9Aa toa~:in should he substantially different, preferably differing more than SO o from that: of tho:>e insecticidal proteins encoded by other commercially available cryl genes. It also means that the selected cry gene should show essentially no cross-resistaz~r_e to inse~~ts resistant to known, more frequently ued insecticidal proteins. In other words it should be aUl.e too overcome the problem connected with cras:~-resistance.
The' term "capable of demonstrating properties, which are substantially different" means that the properties of the se7_ected domain of the selected insecticidal protein shou,~d have a substantially similar effect as the native Cry9Aa toxin, but simultaneously i.t should bind too receptors, which are substanti.al.ly different from those of the other known toxins. For ~axample the toxin selected for the present invention hay. essentially no cross-resistance, which is a typical property ~.~n other insecticidal Cryl proteins. This property is assumed to be an indication of a different receptor bind.vng pattern or mode of action.
The=_ term "capable of demonstrating properties, which are substantially similar to the properties of a selected domain of a selected insecticidal protein" means that the in:~ecticidal proteins encoc3E~d by the modified synthetic DNA

WO 0(1/11025 PCT1FI99/00698 action or effect, which is as good as or better than the insecticidal action or effect of the endotoxin encoded by the native Cry9Aa gene .
The' term "higher plants" means especially flowering plants and includes according to taxonomic classification systems both angiosperms azzd gymnosperms.
The term "DNA constructs" means any DNA constructs, vectors and plasmids comprising thE: modified synthetic DNA sequences of the presFant invention in combination with other DNA
sequences or Fragments, useful for cloning, transforming, expressing, secreting, etc.; and which include for example promoters, er~hancers, signal sequences, terminators, etc., sel.ec_ted from per se known vectors, plasmids or fragments thereof, which are applicable for ~:loniny, transforming of procaryotes or eucaryotes, respectively. The hosts can be selected from bacteria, yeae;t.s, fungi, plant. and animal cells, with special emphasis on plant cells and enhanced expression of said insecticidal proteins in transgenic plant~~.
General Description of the Invention The present invention is related to delta-endotoxins or. Bt toxins produca~d by Bacillus thuringiensis, which are known to have a very high level of toxicity to the host insects. The so called Cry or Bt toxins are: responsible for the insecticidal action of the bade=_rium. T:~ese proteins form crystals in the spore while t-ze bacterium sporulates. It i.s also known that the toxicity varies depending upon the target insect. As described abo~re several types of endotoxins exist and it. is ai;~o known that these endotoxins have different properties and modes of actin.>n. The presen~ inventors selected an endotoxin, which is known to be unique and with properties differing essentially i:rom those of: other more frequently used endotoxins to study whether a modified DNA sequence encoding a substantially different tvt~e of endor_oxin could be used in WO 00l110Z5 PCT/F199/00698 management :.ystems. The present inventors started with the r.~rpothesis that if modified synthetic DNA sequences were provided, they would them incorporated into higher plants, provide imprewed tolerance to target insect attacks including increased specificity, efficacy, toxicity and stability of t=he toxicity txa~ t .
Deployed ress_stance development in insects can be obtained by sound resistance management systems including gene strategies, gene promote=r strategies, and field tactics, such as annual crop rotation with plants <~arrying different Bt-genes, Bt-gene mixtures in composite seeds, mosaic planting and/or spatial or temporal refL:ges. These strategies allow insects susceptible ot:: developin<t resistance to copulate with non--resistant or w~;.ld-types, which increases the incidence of sensitive insects and delays the development of tolerance and resistance in :in;sect popul~~tions. The present inventors realized that in order to provide sustainable resistance management strategies tc> combat cro:~s-resistance phenomena, new DNA sequences and/or genes with unique propertie=s would be needed and advantageous in, order to develop new transgenic plants producing toxins having substantially different and/or unique modes of action.
ThE: complicatE~d mechanisms of action and high receptor binding specificity makes the toxins harmless to all otrier organisms except the insects with the correct receptor molecules in the midgut. Usually the resistance of insects against a delta-endotox~n of Haczllus thuringiensis is assumed to be a result of absence, removal or alteration of the receptor molecule. Fo:r example Cry9Aa, unlike CryIAc and CryIC
(truncated ox- native) is insecticidal against Plutella xylostella and P.ier.is brass.ica as wel=l as against potato tuber mot=h, but nor= very effective against European corn borer (Ost:rinia nublialis) .
In order to provide improved insecticidal resistance and to solve the problem of Bt toxin tolerance develommPnr nr constructed new fully modified synthetic DNA sequences encoding the' protein, which was kraown tc> be as different as possible from those protein in commercial use and against which target. insects have developed tolerance. Due to its unique sequF~nce and high potential for pyramiding Bt toxin genes in plants, the inventors selected for their i.:nvestigations anc3 studies the insecticidal Cry9Aa protein of B,~cillus thu:~~.ingiensis ssp. galleries (Btg) , which has an amino acid percent ident=ity less than 34 o when compared with other conventional Cryl--proteins as determined by a similarity test with a computer program.
In the context of resistance management, the cry9Aa1 gene sEemed a good choice and was selected, because it was known to be a potent toxin, the properties of which differed essentially from the propErties of the most frequently used and commercially available endotox:ins to which the target insects had shown increasing tolerance. As a novel insect toxin, Cry9Aa can be used to slow down the development of tc:~:xin tolerant,e in crops .
The present inventors wanted to study a Cry t-oxin with a specific mech,3nism for acting in the gut of the insect, for example a spe~.cific° andJor selective receptor target in the digestive tracks of the target insects. A5 the CryIG (now Cry9Aa) has a~~ entirely difvferent amino acid sequence in the to~:ic domain than other known Cry proteins of Bacillus thuringiensis, it was considered to be an indication that the gene has its own receptor recognition system. The same could also be concluded from unpublished data according to which this gene has significantly less activity against the European corn borer in comparison to CryAb. This also confirmed the idea that the protein encodE:d by this gene has its own binding receptor and/o:.r mock' of action .
Bacillus thurirxgiensis ssp . galleries lBtg) has several de7 ta-endotoxi°G genes lSheve:LEw, et a1 . , Mol . Biol . lRus) . 28 WO OOI11025 PCTIF199IOOb98 present nomenclature (Smulevich, et al., (1991) FEBS Lett.
293:1-2, 2p-28) and CryIX (Shevelev, et al., FENS Lett. (1993) 336: 79-82and have been cloned in the Institute of Microbial Genetics, l~loscow, Russia. According to the classification by Hofte and Whiteley (1989), Microbiological Review 52: 24- 55, CryIG protean belongs to t:he lepidopteran active CryI group of delta-endotoxins of Bt forming bipyramidal crystals in the bacterial spore. The amino acid sequence of the CryIG
delta-endotoxin protein differs significantly from other Bt toxins. It is only related to the above mentioned protein CryIX. Trypsin resistant; insecticidally active N-terminal part of the: CryIC~ consists of a peptide comprising 632 amino acids.
In the gut of. t:he insects the Bt toxin has been shown to be processed by trypsin to px-avide a N-terminal 630 - 675 amino kids long insecticidally active peptide, the toxicity of which is manifested by its binding to specific receptor molecules irt the insect gut, with consequent formation of ion channels in the epithelium. This action leads to ion efflux and paralysis of the intestinal function, which causes death of the insect. ~tt is generally believed, that the binding x-eceptor situ and target insect specificity are correlated and also determine, which group of insects are sensitive and which are not sensitive. I:t is further believed that the lack of or a chamge in the specific receptor molecule in the gut of the insect leads to tolerance or resistance development to the toxin.
Gleave, A.P., et al. (1998), (Mol. :Breed. 4:459-472) reported that potato lines transformed with the crylAc gene had a greater impac:vt on larval growth and survival than the cry9A2 gene, but tk:ey seemed to have overlooked the potential of Cry9Aa in resistance management strategies. In fact, in the cry9Aa2 gene only 4.2 0 of the nucleotides of the native nucleotide ~~equemce were replaced using site-directed mLZtaqenesis . The t=ransc~P~,; ~ rnhar-rr, nl am ~ r-o,~~,.,,.; .,.-, ....: a mortality w~~s not: high. only in one transgenic line 100 % of the larvae c~ ied ~_n 9 days, whereas 20 - 50 °s of the larvae in the others 1_ines of tobacco were alive_ Unfortunately, the report cont~~ins no data about mRNA and protein expression, which makes the comparison of results difficult. The data shown by Gleave, A.P., et al., (3998) correlate with those of Perlak, F.J.,et al., (2991) (Proc. Natl. Acad. Sci. USA
83:.3324-33281, in which it is concluded that partial.
modification of the cry gene makes transgenic plants inseeticidal, but partial modification noes riot provide a sufficiently high expression of Bt toxin, to provide sustainable mesult.s in field trials.
However, in the present invention it was shown that, larvae of P. xyloste11~:3 (in3ependent of stage of development) died in two days when fed with transgenic cauliflower expressing the synthetic cry9Aa DNA sequence having a 23 % altered sequence.
The data of the bioassays suggests that plants harboring the modified synthetic. DNA sequences c>f the present invention express much more of the in:~ecticidal protein, because potato tuber moth h,~, LC50 - 80 ng per ml of diet in 5 days of feeding and diamond back mo*~h has LC50 - 120 ng per ml of diet in 6 days of ~ eedin<~ .
Accordingly, the present inventors successfully demonstrated that transgenic plants transformed with the modified synthetic DNA sequences of the cry9Aa gene, express more toxin product than plants transformed with the partially modified gene. The elevated expxessicn suffices to enable sustainable field trials .
The same could also be concluded from unpublished data according to which the cry9Aa gene has a target species profile which differs from other cryl genes and has .Less activity against the European corn borer in comparison to CryAb. The results also confirmed the idea that the prat:ein encoded by the cry9Aa has it:s own binding receptor site anc3/~r The modified synr_hetic DNA sequences of the present invention have improved properties especially when expressed in higher plants. The improved properties include enhanced expression through improved mRNA :processing, stability as well as translation, whereas the encoded endotoxin has substantially the same efficacy as the native Cry9Aa endotoxins. The synthetic DNA sequences of the present invention can be used t:o provide improved insecticidal control and are useful tools a.n insect resistance management programs. When incorporated into higher plants, the modified synthetic DNA sequences provide impr~wed tolerance to target insect attacks including increased spc~Cificity, efficacy, toxicity and stability.
The truncated DNA sequence (SEQ ID N0:3:) of the cry9Aa gene was used because attempts to transform plants with the long, native sequences of the genes had previously failed (Vaeck, M., et al. (1987) Nature 328:33-37).The present inventors carried out truncations of the cry9Aa toxin genes at different sites and acc°ardingly they also started with a truncated form o:~ endotoxin encoda_d by the Cry9Aa-gene.
The improveme:.nts were achieved by providing a synthetic DNA
sequence of the truncated IaNA sequence (SE~Q ID NO:3:) of the cry9Aa gene (:~EQ II) N0:4:) encoding a protein characterized by having an amino acid sequence (SEQ zD NO:1:) and Figure 1 ar alterations tnerof still having an :insecticidal action which is substantia 17.y similar to that of the insectic;idal protein Cry9Aa .
Methods for transforming truncated cry genes have been described in several publications and said methods are applicable al4ao to provide the transformants and transgenic plants of the present invention. 'Transformation of tobacco has becan described by Bart on, K,A. , et al. , (1987) Plant Physiol .
85:1103-1109; Vaecl~:, M., et al., (1987) Nature 328:33--37;
Carazzi, N.B., et al., t1992) P ant Mol. ~;c,1 2n.~~q_~na~

5:807-813; Delannay, X., et al., (1989) Bio/Technology ?:
1265-1269 and cabbage by Bai, Y.Y., et al., (1993) In Biotechnology in Agriculture_ Proceedings of the First Asia-Pacif:~.c Conference on Agricultural Biotechnology, Beijing, China, 20-24 August 1992. In Current Plant Science and Biotechnology in Agriculture, 15, 156 - 159).
The present inventors performed modifications of DNA sequence encoding insecti<~idal active N-terminal domain of cry9Aa gene.
In principle: the encoded protein or amino acid sequence should be unchanged or the same as that of the native gene and the alterations in the nucleotides were performed mainly so that c:odon was cHanged to another codon coding the same amino acid.
Expression of the gene was improved on the level of translation (protein synthesis from mRNA molecule). Codon preference was changed to be compatible with higher plants, preferably to dicots and most preferably to Brassa.ca plants.
Mod.ification,~ of the colon preference improved the gene expression iz~ a range of 20 -- 5 times, approximately 10 times.
Further impzovements were carried out mainly on the mRNA
processing lcwel by removal of putative polyadenylation and splicing signal sites (sequences/motifsJcontexts) based on the coding sequer7ce of the native gene. The start colon vicinity was changed to higher plant preference (this can not be species preference) and all ATTTA mRNA destabilising motifs were removed. Rerr:oving of the sites means changing some nu<:leotide (s) in tr:e sequen<:e so that signal motif disappears.
The enhanced ,:~r~y9Aa gene expression obtained by improved mRNA
processing and mRNA stability and translation (colon preference and start colon vicinity) led to higher toxicity of transgenic plants and consequently improved tolerance to insect attacks due to higher level of the toxin. The specificity of the toxin was not changed, because the specificity i;; a ruatural x~ronerr_v ~f r r,P cAo p~wp.a n~~.-the amino acid sequence was change only by truncation to giv the active toxin protean. However, xt is self-evident t~
those skilled in the art. of protein engineering that the amine acids can be replaced or removed to a certain degree without loosing the activity. Thus, amino acid sequences provided b~
recombinanf~ DNA techniques or protein engineering, having substantia:_.ly the same structure and having substantially the same inserticidal effect as the native Cry9Aa toxin are included within the scope: of the present invention.
The transcr.~iption or mRNA synthesis need not be improved in all embodiments of the inventions. Qne preferred embodiment of the invention, comprises removal of the putative transcription end signal-:,. but this is not necessary for enabling the present invnntiar~. The transcription level is regulated with t:he promote>r and other untranslated sequences . Tn one embodiment c~.f the invention only t:he amino acid sequence of the coding region of the gene was me>dified.
:~uitable restriction sites can be :i.ntroduced into the coding region of then DNA sequence, in order to enable the division of the sequenct~ into one or mare conveniently sized DNA
f z-agments . C~~rrespondirg fragments can bo synthesized using fc>r example high fidelity PCR, using two or more, cantradirected primers. The synthetic. fragments can be ligated and the fused corxstruct cloned into a plant transformation vector operating under on.e of the multitude of presently available plarxt e~cpression promoters. The ~~onstructs could be expressed undeer bath constitutive or inducible promoters, e.g.
t:he Nos promoter from Agrobacterium tumefaciens, the 35S
promoter f.rorr3 Caul.ifl_ower Mosaic 'virus small subunit of ribulose-1,S-biphosphate carboxylase (Rubisco) promoter to mention a few examples. Inducible pz.°omoters can be selected from a group c>f la.dht dependent promoters, such as the small suk~~unit of Rubisco promoter for expression in green leaves or otY~c~r selected tissues, or of proms>ters acting in certain tissues, such as the patatin promoter useful for exnrPS:~in" ;

other available choices.
The constructs comprise the synthesised cxy9Aa gene sequenc and are tx-ansfarmed into tobacco, turnip rape, cauliflower an~
potato plants. The level of the gene expression was verifiec by Western ar Northern blot analysis. The insect bioassay:
were carried out and results compared t.o the toxicity of the native truncated cry9Aa1 gene and to the translational fusions of the nat:~..ve truncated sequence and uidA (GUS) gene. Northern blot analy~3es and bioas:~ays against Pieris brassica indicated that the synthetic sequence could produce at least SO times more protein than the native.
Thus, the results obtained proved the validity of the working hypothesis of the inventors, i.e. that the cry9Aa gene would provide improved insecta.c.idal control and provide a useful tool in target insect resistance management strategies. For those skillad in the art it is self-evident based on the disclosure o:E t:~e present invention how to obtain other insecticidal protains far other target insects in other higher plants, in order.- to solve the problem of tolerance and resistance iai target insect; .
The invention is described in more detail below. The examples and experimeents are di~~.~.losed to provide more detailed guidance for those skilled in the art. Even if the examples and experiments were carried out with a modified synthetic DNA
sequence demonstrating the closest preference to Brassica, the examples should not be interpreted as limiting the scope of the protectloll Of higher plants. The examples indicate how t:o proceed to obtain the desired result when combatting tolerance or resistance development in target insects.
Example 1 Origin, structure and function of the native cry9Aa gene.
Bac.il.lus thur~.rlgi.ensis ssp, qalleria (Btq) delta-Pnr~~rr,x;"C

WO OOJ11425 PCTlFI991006!

Microorganisms of Russian Institute for Selection anti Genetic of Industrial Microorganisms (Shevelev, et al., (1994) Mol Biol. (Rus). 28: 3(1), 388-393). Seven Bt toxin-like motif have been found in the genome of the Btg bacterium. Btg form bipyramidal protein crystals during sporulation. The mai:
protein component of the crystal consists of Cry9Aa (CryIG;
toxin.
Cry9Aa toxin belongs to the CryI lepidopteran active class of endotoxins forming bipyramidal protein crystals. The toxin is a 120 kDa protein encoded by a 3,4 kb DNA sequence. Cry9Aa protoxin has t.rypsin cleavage sites producing a 65 kDa N-terminal insec~ticidaliy active toxin-peptide. The trypsin sensitive C-terminal part contains conserved amino acid contexts responsible for crystal formation.
The Cry9Aa toxin is very original compared to the other cryI
toxins in tf~rms c>f its protein structure. It is likely that, it i.s bound by a unique receptor molecule in the insect gut . In bioassays, ~ry9Aa r_oxin showed good insecticidal impact on Plutella xyLoste.Lla, Pieris brass.i.ca and potato tuber moth (Phthorimaea apex'culella). Cry9Aa is not very effective against European corn borear (Dstrinia nubialis).
Example 2 Cross-resistance investigations in bioassays Trypsin processed ar_tive toxin binds t~~ receptor protein m<.~lecule sit~rated in the membrane of the gut cells in the irnsect. Binding t,c:~ the .surface of insect gut the toxin molecules form, ion channel~~ in the cell membrane of the gut .
The ion charnel formatior.~ leads to thE.~ efflux of ions, paralysis of intestinal functions and death of the host insect.
In order to clarify originality of the gene the present inventors pert armed bioassays on Plutel:La xv)n~r-R7 7a ~ -~ nP~

t:o old classification), The mechanisms of the insect resistance are not known, but it is supposed that mutations in the binding receptor are possible. In Table 1 the results of bioassays with crystal Cry9Aa protoxin protein of E. thuringier~sis ssp. gallex~ia are shown.
Suspensions of purified crystals were dissolved in lysis-loading buffer and ran in PAGFa for quantification of the ('ry9Aa protf~in. The protein crystal stock with quantified Cry9Aa protoxin was used far insect tests. The crystal suspension w:~s mixed in 6 rng/ml solution ~~f casein for better adhesion. Ab~~ut 1.00 ~1 of t_he mixture, with a known quantity c~. the protoxin were spread and dried on the surface of cauliflower ~a00 mcr leaf sheet . We ca l.culate that the toxin was 5 times diluted on the fE~ed. Leaves coated with the Cry9Aa protaxin suspension were exchanged with fresh ones every 2 days of feeding. w second instar larvae of P. xylostella were assessed in each point of the experiment. The results of the experiments are shown in Table 1.
In the results of the bioassays, the originality of the Cry9Aa toxin was confirmed. The larvae resistant to CryIAc as well as to CryIC toxins were susceptible to Cry9Aa. CryIC resistant larvae had partial resistance to Cr~r9Aa toxin. But they also died, if t~zey were fed with toxin in concentrations corresponding to concentration expressed i.z transgenic plants carrying the synthetic Bt. toxin gene ~1-2 ~.g/g of leaf tissue).
Example 3 improvements i.n the gene structure. Codon preference tables.
Transformation of plants by native cr,y gene sequences does not provide a sufficient proteir.~ amplification :in plant cells. Two different versions of Cry9Aa gene modifications were prepared.
The sequence (Fa.gure 3) near the tryps:in prc>cessing sites were 1-.-,....-,-,+-r_..7 ~ r, .-wrJcv t~ n~rmrocC i r~, Y~"1G 1'1l ant-c nn~ tr WO 00111025 PCTlFI99/00698 The protein sequence was c:ut at a site 12 amino acids before the N-termimal t:rypsin processing site and at a site 9 amino acids after the C'-terminal processing site.
Truncation was performed using high fidelity PCR. Restriction enzyme site. werE~ introduced before start colon - BamHI and around ATG ~:odon - SphI. '.rhe 5 terminus primer comprises an introduced I~glII restriction site before the stop colon; the stop TAA cc~don and the XmaI site after the stop colon.
Central part. of the cloned PCR product ilimited by BbvI and NcoI restric=tion sites) was exchanged back to the native sequence to exclude possible mismatches during PCR. Terminal parts of the trunr_ated sequence were sequenced to check gene context.
S~mthetic DNF~ sequence of the cry9Aa gene (Figure 2) was compiled on the basis of the active toxin content so, that synthetic gene protein sequence was identical to the native one (Figure ~). Full modification of the gene sequence implied t.h.e followinc changes.
Start ATG colon context was formed as ACCATGG, which contains ACC conserve~~ context befvore start and G base thereafter (Kozak, M., (1987), J. Mol, Biol. 196:947-950. Simultaneously, a Ncol restrietloIl Sl.te was introduced.
The coding sequence of the gene was modified to change colon usage from bacterial to higher plants, preferably divot and mast preferab.Ly Brassica p:Lant preference . Colon exchange was performed manually according to a compiled color. usage table (Table 2). The table consists of columns with codan preferences o:f higher plant:: divots, monocots and Brassica plants. The pa-esent. inventors compiled the colon usage tables for coding sequences of genes of Brass.ica oleracea, B.
campestris and B. ~~apus. Summary colon frequency tables were prepared for Brassica plants. Divot and monocot preference -.., ! "mr,o ...n,.-o mar7~ nn 1-ha hae i ~ of Wta 1 1 ahl P tahl PC FnY

The sequence was checked. for the presence of undesirable sequences: putative signal sites responsible for splicing (Goodball, ~i.J. and Filipowicz, W., (1989) Cell 58: 473-483), polyadenylat.ion (Dean, n'. , et al. , (1386) Nuc. Acid Res.
14(5}: 2229-2240; Joshi, C.P., (1987) Nuc. Acid Res. 15(23):
962'7-9640) and mRNA destabilising sequences (Shaw, G. and Kamen, R. (_L986) Cell, 46: 659-667; Ohme-Takagi, M., et al., (1993) Proc. Natl. Acad. Sci. USA, 90: 1187.7.-1181.5) being listed belr~w. 'Two signal sites for splicing, 6 for polyadenylation and Z4 mRNA destabilising sequences were found and removed from the sequence . Finally the gene sequence was checked for possz.ble folding. 13 putative sites of loop formation were removed from the sequence.
Splicing:
CAN7-gAGTNNA
Polyadenylat~on:
Ap,TAAA, AATAAT and their variations: AACCAA, ATATAA, AATCAA, ATACTA, ATAAAA, ATGAAA, AA~.~C'AT, ATTAAT, ATACAT and AAAATA
(the more conserved of the' A nucleotides are marked by bald font) mRNA destabilising:
ATTTA
'.'o compare the expression of the native and synthetic cry gene:; in crow playas we have made two different versions of the cry9Aa gene. l~,irst, WE: truncated the gene (Figure 3-4) near the tr;rpsin proces~~ing sites to express only the insecticidally active N-terminal part of the toxin in plants (Figu:re 1). We cut the DNA sequence corresponding to the protein sequence site at 12 .:amino acids before the N-terminal trypsin procE>ssincsite a.nd 9 amino acids after the C-terminal pro'essi:ag site (Figure 4).
T'nF~ wnthat-i r~ T7NA ~ec~tiPrirc-~ W f rhP rrV9Aa acPnP Shnwn i n F'irn~ra WO 0011105 PC'f/FI99100698 sa, that the protein product of the synthetic gene would be identical ~o the native protein (Figure 4). Full modification of the genre sequence imp:Lied the changes shown in Table 2, Example 4 Synthesis of the cry9Aa gene sequence.
The modified gene sequence was screened for the presence of desirable ~~estriction sites also with one mismatch in the site. The r.~ene ~~equence was divided in ~ive (350 - 430 bases long) parts delimited by Introduced restriction sites (Figure 3). The sites were designed without. change of the amino acid sequence. 1-'finally, the amino acid sequences of native and synthetic g<~nes were compared in an alignment program to check that the synthetic gene codes the same amino acid context. as the native. Each of the five parts was synthesised by 3 - 4 high fidelity PCR cyc:Les using 6-8 SO-80 by Long oligonucleotides purified in PAGE. The oligonucleotides were ordered from DNAgensy and Operone Technologies USA. Fach PCR product was cut with appropriate restriction enzymes and cloned into a vector_ Sequenced fragments were ligated into t=he entire ~xene sequence, which also was sequenced to avoid mistakes in the DNA sequence. The synthesised sequence was ;situated un<er Lace promoter in BamHI site of pUCl9. The synthesised sequence of c.ry9Aa gene, situated in translation frame, was expressed in ~.c011 Cells. Protein product of the expressed gE:~ne was identified in Western blotting against antibody se:~-um specific to protein crystals of Bacillus thuringi ens.i:; ssp . gal l eri as .
Example 5 Cloning of cry9Aa genes and transformation of plants.
The synthetic sequence of cry9Aa gene was cloned under double 3~~5 promoter of CaMV linked to AMV UTR ((Dad a, R.S.S., et al., (1993) Plant Sci. ~~4:139-149). This construct was transferred i~~t~o p~3PTV-HPT and pGPTV-KAN pBINl9 based vectors WO 00!11025 PC'T/FI99!00698 vectors were transformed in Agrobacterium tumefaciens strains LBA4404, EI-i~~105 and C1C58 (helper pGV3850) . A truncated version was placed under the same double 35S promoter and transformed i.n the same A. tumefaciens strains_ The truncates GUS translation fusion gene was cloned under the same promotez- cointegrative pHTT (Elomaa, P., et al., (1993) Bio/Technol. 11:508511) vector and transformed in C1C58 (pAVS8S0) A. turnefaciens. Vectors and strains mentioned are generally available and known by those skilled in the art and can be replaced by other plasmids, vectors strains with properties compatible for t=ransforming the selected host.
Tcabacco plants were transformed with both native truncated and ~runcated-GUS translations! fusion as well as synthetic sequence of a:he cry9Aa gene. Potato, cau~iflower and turnip -rape plants were transformed with the synthetic sequence only.
Example 6 Gene transfers and expression analysis.
The construct:a used were truncated native cry9Aa1 gene as well as uidA ger:e fusion under 35S:S promoter in a pHTT
cointegrative vector and in a binary pGr'TV (pBINl9 based) vector. Agro~~acterium strains used for transformation were C1C58pGV3850 (as a cointegrative) and LBA4404pLA4404 (as a binary helper- vector). Synthetic cry9Aa1 was cloned in pGPTV-HPT. Tree above ment;i.oned construes were used for transformation: of tobacco, turnip rape, potato and cauliflower plant. Presence of the transgene was verified by Southern analysis and the expression Level of the modified toxin genes could be showy by Western arid Northern analysis.
Example 7 Western blot of synthetic Cry9Aa1 protein product The crv9Aa1 cc~dinct sectuence was placed in t.ranslational frame WO 00/11025 PCf/F199l00698 strain of E. cali. Analysis wa:a performed using rabbit antiserum raised against crystal proteins of Bacillus thuringiensis ssp. galleria and visualized by alkaline phosphatase reaction. Further the expressed protein served as positive control in Western analysis of the transgenic plants (.Figures 7-10) .
Example 8 Transformation of tobacco.
Tobacco NicGtiana tabaccum cultivar Samsung plants were used in genetic transformation. Tobacco Leaf discs were cultivated for. 1 day and inoculated wyith the Agrobacrerium at the second day. The coc;zltivation period was 2 days. After that the leaf discs were washed off the Agrobact:erium and cultivated on selection me:°.diurn. The native truncated, GUS - fused and synthetic secfuences of cry9Aa (Figure 7) were used for tobacco tx:ansformatic>n. About 20 an t:ibiotic resistant regenerates were collected fc:~r analysis of expression. mRNA expression in transformed plants were' studied with Northern blot hybridizatiors. After that the RNA positive plants were studied with Southern and Western analysis. From each the transgene ve~~sionc~ 6 typic~a.l transgenic lines were collected far demonstrating expression.
Regenerants were tested for expression of the mRNA product.
Total RNA (:~ ug) was run in an agarose gel, blotted on a positive chirrged nylon membrane on a vacuum blotter.
Hybridization and luminiscent detecr_ion was performed with a digoxigenin i.rTP labeled RICA probe according to a protocol of Boehringer M<~.nnhei.m. The probe was synthesized with T7 RNA
polymerase based on the full synthetic: or truncated native s.a_quence of cry9Aa cloned in pBluescriptSKII+. The Northern b:Lot developed with lumini:~cent reaction tBoeringer Mannheim) indicated that most of transgenic plants transformed with the synthetic gene expressed mkNA of cry9Aa gene from 0.3 to 5 pg nf~r ~ u,a of total RNA, t:~le average being 2 pg per 1 ~.g of WO 00/11025 PCT/F199/00b98 native gene saquence as well as the GUS fusion express mRNA of cry9Aa gene ~:rom 0.03 to 2 pg per 1 ~g of total RNA, the average being 0,2 ~- 0,3 pg (Figure 8A). The analysis of cry9Aa mRNA expressic5n shows that 'the synthetic sequence expresses on average 7 - to times more m:RNA than the native gene.
The transgenic lines showing mRNA expression were studied as transformation and number o:E the transgene inserts. Samples of tc>t~a:l plant DIVA (5 fig) isolated from green house grown plants were run in ugaro~:,e gel and blotted on a positively charged nylon membrane. ThE~ membrane was hybridized with a digoxigenin dUTP labelled probe. The probe was amplified in PCR on the vector template containing the cry9Aa (synthetic or native) sequence . DNA samp:Les were digested with restrict=ion enzymes, wraith cut cry~Aa gene from the genome or only on one (left or right) side c..:f the. transgene insert. Southern blot analysis gave information that about. half of the transgenic plants contained one: ir_sert_ The inventors could not find any correlation between the number of inserts and mRNA or protein expression.
Expression of the Cry9Aa protein product was analysed with a We:~tern blot. Prat:esins were extracted in a buffer, containing 50 mM Tris (base), NaOH (up to pH 12), 0,4 M urea, 0,1 M
th.~~ourea, Z r:~M Dit:hiotreit.o.l, 0, 5 o Tween 20, 0, 5 % Triton X100 and 4 o tnercaptoethanal (MerEtOH) . Leaf material (lg) was ground in liquid nitrogen and mixed with 2 ml of the buffet.-, then heated t:o 60°C and refrozen in liquid nitrogen. Th-~.s procedure wa, repeated :> times. Debris was removed by centrifugation. The supernatant was precipitated and washed twa times with z~ volumes of acetone -20°C. The dried precipitate w<~s resuspended and dissolved in a loading buffer as 1 ~g of toe precipitate in 40 ~.l buffer and boiled in a water bath fear 10 min. The debris was centrifuged and the supernatant used is the ana~.ysis. The concentration of total protein was measured in a Hradford assay. The samples were loaded in polvacr-ylamide gaI (PAGE). Samples were run in membrane in a semidry blotter. The membrane was hybridized with polyclonal antiserum raised against B. thur.ing,zens.i.s ssp.
galleria protein crystals and purified by conjugation with :1 c>.f acetone precipitated powder of tobacco plant protein and F.col.i (str~~in XL1) protein for 15 minutes at ambient temperature.
As shown on the Figure 7B, the expression of Cry9Aa1 protein e;{pression u;~ing a synthetic transgene construct was from 0.6 to 1.44 ~g per 1 g of leaf tissue, or from 0.15 to 0.3 % of soluble protein, the average being 1 ~g and 0.2 s.
In order to compare protein product expression, the sample T-GS-8 (well expressed Cry9Aa) was mixed with the negative control tobacco protein sample NTS (Nicatiana tabaccum cv.
Samsung) in series comprising the following proportions of (T-GS8/NTS ~f~%~.g of total protein) : 50/0, S/50, 3/50, 1.5/50, 1/50 and 0/5!:). These samples were loaded and run in PAGE. The Western blot of the gel showed that Cry9Aa1 protein signal is wel'~ detecta~~l.e in all dilutions (e~ren i.n 1/50) compared with the NTS cont~ of (Figure 8C) .
Samples of tobacco transgenic lines expressing native truncated anc't GUS fusion mR.NA were loaded in the same Western as 50 ~Cg of total protein . None of the samples showed a clearly dete,a able signal of Cry9Aa protein (Figure 8C). The results indi:~ate that the synthetic sequence of the cry9Aa gene produces at least 5( times more protein product in transgenic tobacco than the native sequences.
Example 9 Potato transformation Potato plant. ev.Pito were transformed with A. tumefaciens LBA4404 harbored pGPTV-HPT plasmid carrying synthetic cry9Aa gene sequencf-~. The transformation was performed according to the protocol ~c~ublz.shed earlier (Kai~;ru. K. , et a1 . 1 ~4~ z~rra 1~0 00/11025 PC'T/FI99/00698 hygromycin resistant lines were analysed for gene expression.
The plants were analysed for expression of mRNA product expression in the same way as tobacco plants. The Northern blot developed with a ,~.uminescent reaction (Boehringer Mannheim) shows that mast of the transgenic potato plants transformed with the synthetic gene express cry9Aa gene mRNA
from 1 to 3 rog per 1 ~g of total RNA, the average being 2 pg,/~,g (Figure 9A) .
The transgenir: inserts in the genome (data not shown) were prc:wed with Southern analysis. Western blot was made according to the method described for tobacco plants. The expression of thf: Cry9Aa protein product in potato was on average 0.3 ~,g per 1 g of leaf material or 0.03 % of soluble protein (Figure 9B) .
Example 10 Cauliflower transformation Cauliflower plants cv. Asterix were transformed with A.
tumefaciens LRA4404 comprising the pGPTV-HPT plasmid carrying thc~ synthetic cry9Aa1 gene sc=_guence (SEQ ID N0:2:). Hypocotyl segments were cultivated i_or 1 day on hormonal medium and co-cultivated with Agrobacter~ium for 2 days. After that the explants were placed on selection medium. Of the plants 5 regenerated ai:ter t=ransformation, 2 showed a positive signal in a Northern blot: performed as describes for tobacco. The cry9Aa mRNA p7~oduct was expressed as 2 pg (line A-0) and 0.5 pg (line A-10) per 1 ~g of total RNA (Figure l0A) .
The Western blot shows expression of the Cry9Aa protein in A-0 at the level of 100 ng protein per 1 g of leaf tissue or 0.01 0 of soluble protein (Figure lOB). In general, protein measurements ref transgenic p:l.ants can result in the detection of low levels of the toxin, because of insolubility of the Cry9Aa toxin when collected in a pH lower than 9Ø

NVO 00!11025 PCT/FI99100b98 had a very high stability of the toxicity in a bioassay of ove:rexpressed target insect attack, where plants were placed in a cage with high density cultures of P. xylostella for 10 days. The re;.xults are presented in Figure 6.
More specific~~lly, bioassays with diamond back moth Plutella xyiostella show a high insecticidal capacity of the A-0 line, which killed the wild larvae in 1 -~2 day: of feeding. This transgenic line also killed CryIAc and CryIC resistant larvae of P_ xylostel.Ia. Line A-10 also had an insecticidal effect.
But. the wild larvae died after 6 - 8 days of feeding arid CryIAc resistant larvae after 8 - 10 days. Transgenic line A-10 did not kill all larvae resistant to CryIC toxin, but they had longer development period and were smaller in size than larvae fed with c:o:ntrol plants (Table 3). This crass-resistance bioassay can serve as a confirmation of the unique properties of Cry9Aa toxin and the possibility to use it in differer.at: resistance management strategies.
Example 11 Turnip rape transformation.
The turnip rape Brassica raga var. oleifera was transformed with A. tumefariens LBA4409: comprising the pGPTV-HPT plasmid carrying the synthetic cryyAa gene sequence according to the protocol tKuvshinov, V., ~~t al., 1999 Plant Cell Reports 18773-777). Two transgenic lines of turnip rape expressed mRNA product at a low level: 0.5 pg per 1 ~g of total RNA
(F~.gure 11) .
While the Southern analysis confirmed transformation, the protein product was undetectable on Western blot partially due tc a high backgraund on the membrane. Nevertheless, two transgenic lines had an insecticidal impact on Plutella xy~:Lostella. T:lm V-~12 . Z and V-14 . 3 lines killed larvae after 3 -- 6 days of feeeding (Table 4) .

VVO 00/11025 PC'T/FI99/00698 10 - 100 times smaller than in tobacco or potato plants and the expression was not steady. Many Brassica transgenic lanes laol~ced expression when the plants matured. This result might be caused by the use of the 35S promoter or AMV leader of Cauliflower Mc:~saic Virus, which is known for its unsteady expression. Especially, it can have aberrations in Brassica plants, which are natural hosts of the vizus. The fact that suppression of the expression happened on the transcriptional lev~;l confirm<~d the thought. that r,: he promoter works but prc>motes only ;~ low level of: mRNA production .
Con~clusa.ons .
The: synthetic sequence of ci:y9Aa with removed transcriptional aberrations express the des:Lr_ed protein product more than SO
times better than t=he native truncated or GUS fused constructions. In cauliflower, an expression of 100 ng of Cry9Aa proteii per 1 g of leaf tissue led to a high insecticidal :.mpact on Plut:ella xy.lostel_la, while tobacco plants expressed the protein in 10 times more according to the Western analy is. Transgenic plant:> expressing sufficient amounts of cry9Aa gene were lethal to CryIAc and CryIC
resistant strains of P, xylostella. This fact confirms the conclusion that Cry9Aa toxin has its own binding receptor mechanism. Th~~ CryIAc and CryIC re:~istant_ insects used in bioassays did not demonstrate cross-resistance to Cry9Aa toxin.
Tables Table 1. The :e~esults of bioassays with crystal Cry9Aa protein fed. to second instar larvae of Plutella xylostella strains, susceptible wa~ld, and resistant to CryIAC and CryIC toxins.
Nu~ruber of ali~re (a) or dead (d) larvae as well as number of pupas (p) are shown for each day of t:he feeding.

Table 1 P . xylostella z)ays of feeding strain 4 6 8 Final resv.lts 8 - 10 ~,g/g of Cry9Aa protein in feed Wild 3 d 2 d ~ 5 d 2 a Cr~.WCAc 2 d ~ d 5 d 3 a Cry:CC 2. d ~ d -.. __~-_.. 5a-.. _ 3 a 3 . 5~ - 4 ~.g/g of Cry9Aa protein i n feed Wild 3 d 2 d 5 d 2 a:~
Cry IAc 5 a i d t 2 d ' S d ': a CryI C ~~ '~ 3 a 1 a-~ 1 d ~ ~ = a __ 1.5 - 2 ug/g c;f Cxy9Aa protein ir_ feed Wild ~~d 3d ~ 5d _i a CryIAc E: a S a ~ 5 d ~ 5 d CryIC f::y a 5 a 1 d 2 d 2 d 5 d 4 a 2 a 0 . T - 1 ~.g/g c~f Cry9Aa prot:G:in in feed Wild ~> a 3 d 2 d ~ ~ d 2 a CY~.IAc ~ a 2 d 1. d ~ 2 d ~ ~ 5 d a 2 ci ~~rIC '~a5a1ci1d1p1d3d i a a. 3 a 2 a Z p 2 p 15 =lg/ml casein in feed Wi~Ld ~a 5a 5a, lp 1p 3p 5p _4 a ~ 3 a CryIAc 5 a ~ 5 a 5 a~ ~ p 1 a 1 p 5 p Z a __-__ ~
Cr~~I C 5 a 5 a ~ 5 a 3 p ~ 2 p 5 p __ ~_-i 2 a 'NVO 00/11025 PC'f/F199/00698 Table 2: Proportion of codons used in coding sequences of mono~cots, dicot:s and Brassica plants.
Aminoacid Codon Monocots Dicots Hrassicas Gly GGC~ 0.25 0.13 0.20 Gly GG/': 0.19 0.38 0.32 Gly GG~' 0.14 0.35 0.32 Gly GG(:' 0 . 42 0 . 14 U . 16 Glu GAC~ 0.76 0.51 0.58 G1a GA~i 0.24 0.49 0.42 Asp GA'" 0.24 0.64 0.62 As ~~ GAc'. 0 . 7 6 0 . 3 0 . 3 8 Val GT~3 0.40 0.27 0.26 Val GTi'~ 0.08 0.13 0.12 Val GT't' 0.16 0.40 0.35 Val GTf~ 0.36 0.20 0.26 Ala GCs 0.28 0.12 0.17 Ala GCA 11.16 0.25 0.26 Ala GC'T 0.19 0.45 0.36 Ala GC~ 0.37 0.19 fl.22 Arg AG~~ 0 . 24 0 . 24 0 . 2 7 Arch AG A 0 . 11 0 . 3 0 . 3 3 Ser AG"T 0.07 0.16 0.17 Sex' AGC 0.23 0.15 0.14 Lys AAG 0.83 0.56 0.55 Ly;a AAA C . 17 0 . 44 0 . 4 5 As.z AAT 0.23 0.46 0.43 Asn AAG 0.77 0.54 0.57 Met, AT'G 1.00 1.00 1.00 I 1 a A'L'A 0 . 12 0 . 2 0 . 2 3 I le: A'L'A' 0 . 24 0 . 43 0 . 3 8 Ile A'.C'C 0.63 0.38 0.39 Thr' AC'G 0.24 0.13 0.19 Thr AC'A 0 . 17 0 . 2 0 . 2 9 mL.._ Tr~rr n ~ s~ n ~5 0.26 idVO 00/11025 PCf/FI99/00698 Aminoacid Codon Monocots Dicots Brassicas Thr ACC' 0.41 0.24 0.26 T rp TGCa 1 . 0 0 1 . 0 0 1 . 0 End TGP,. 0.62 0.48 0.35 Cys TGT 0.24 0.54 0.59 Cys TGC' 0 . 7 6 0 . 4 6 0 . 41 End TAGa 0 . 21 0 . 19 0 . 2 End T.A~~ 0 . 17 0 . 3 3 0 . 3 Tyr TA's' 0.22 0.45 0.43 Tyr TAt:' 0 . 7 8 0 . 5 5 0 . 5 Leu TTC.i 0.14 0.2.3 0.22 Leu TT:x~ 0 _ 04 0 . 12 0 . 0 Prie TT"x 0 . 26 0 . 47 D . 37 Phe TT(; 0.74 0.53 0.63 Ser TCc~ 0.18 0.09 0.13 Ser TCA 0.14 0.19 0.21 Ser TC'r 0.14 0.27 0.21 SPT" TC~~ 0.24 0.19 0.14 Ara CG~~ G . 17 D . 0 B 0 . 10 Arch CGA 0.08 0.10 0.12 Arg CGI' 0.10 0.18 0.14 Arg CC'~C 0.30 0.07 O.OS

Gln CAG 0.44 0.46 0.51 Gln CAA 0.56 0.54 0 49 Hi;.~ CAT 0.34 0.57 0.52 His CAC: 0.66 0.43 0.48 Lean C'I"G 0 . 31 0 . 11 G . 11 Leu C1A 0.08 0.10 0.11 Leu C~"r' 0 . 12 0 . 26 0 . 3 Leu C~'C 0.31 0.18 0.19 Pro C(:~G 0 . 2 9 0 . 15 0 . 15 Pro C('A 0 . 3 7 0 . 3 6 0 . 3 Prc> Cc:"T 0.14 0.36 0.33 .,__ n~,,~ n ~ ~ n 1 'i C . 14 _.

1~V0 00/11025 PCT/F199/00698 Accession numbers of used DNA, sequences in GenBank ???.
Brassica oleracea:
U16751, U18995, M87514, L36926, L36927, M76647, Y00286.
Brassia campestris:
L41355, M64631, D38563, U17098, L21896, L21897, L23554.
Brassi.ca napus:
U04945, U15604, U1.7987, U20179, U21849, U00443, M99415, L2540Ei, L1.530:~, L1.2395, L29214, L:L9879, L08608, L08607, L12393, M97667.
Species and gene number used in the column of dicot cadon pre f. e?-ence .
Arabidopsis thaliana-854 coding sequence (John Morris j ohn . morrisQf rodo . mgh . harvard .. edu ) , Pi sum sa ti va - 3 7 sequences, Petunia sp. -18 genes, Phaseolus vulgaris - 26 genes, So.l.anum tuberosum 21 ge=nes, Glycine rrax - 59, Nicotiana ~abacum - 21, Lycopersicon e;~culentu~t~ - 41 genes (J. Michael Cherry cherryC~~=rodo .. mgh . harvard . edu) Species and geve number used in the column with monocot codon preference.
Hox-deum vulgare - 3 6 genes , lea mays - 71 , Oryza sa ti va - 16 , Tr~t:icum aestivurn - 4~> genes (J. Michael Cherry cherry@frodo . mgh . harvard . edu ) Table 3. Bioassays of tran.sgenic cauliflawer leaves fed to f:ir;st instar larvae of Plutel.Za xylostella strains (su;sceptible wild; and resistant to C'ryIAC and CryIC toxins) .
Numlaer of alive (a) or dead (d) larvae as well as number of pupas (p) are shown for successive days of the feeding.
p.xylostella Days of feeding line -4 6 8 10 14 r final resin A-0 line of ca~xliflower Wild p d 5 d CryIAc : d 3 d. 5 d a CryIC ~ ? d 1 d 1 d 1 d 5 d 3 a Z a 1 a A-10 line of c;~uliflower Wild ~ a 3 d 2 d ~ 5 d 2 a i CryIAc ~ a 5 a 5 a 3 d 2 d 5 d 2 a CryIC ~5 a V 5 a 5 a 5 a 1 p 2 p 3 p a ~ 2 d 2 d Control line of cauliflower cv. Asterix Wild S a S a 1 p 4 p 5 p i4 4 a CryIAc 5 a 5 a 2 p 3 p 5 p 3 ;~
CryIC 5 a 5 a 2 p 2 p 1 p 5 p 3 ~~ 1 a Tax>le 4. Bioassays of transgenic turnip rape leaves fed to second - third instar larvae of Plutella xylostella wild type.
Number alive or died larvae as well as number o.f pupas are shown for successive days of feeding.
Turnip rape Days of feeding line - --2 3 4 S ~ 8 Final results V--12.1 :~ 5 a - 3 d 5 d a ?
d ~

a V~-14.3 1 d 2 d 2 1 d 1 d 5 d a ~

4 a 2 a I 1 a Control 5 a 5 a ~ 2 p :2 Z 5 p a p _b 3 a 1 a SEQUENCE LISTING
(1) GENERAL INFORMATIOhT:
( i ) APPLICANT

(A) NAME: UniCrop Ltd (B) STREET: Helsinki Science Park, Viikinkaari (C) CITY: HELSINKI

(E) CGUNTRY: FINLAND

(F) POSTAL CODE (ZIP): FIN-00710 (ii) TITLE OF INVENTION: MODIFIED SYNTHETIC DNA SQUENCESFOR

IMPROVED INSECTICIDAL CONTROL

(iii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE rFORM:

(A) MEDIUM TYPE: sloppy disk (B) CnMPUTER: IBM PC compatible (C) OI?ERATING SYSTEM: PC-DOS/MS-DOS

(D) SnFTWARE: Patentln Release #1.0, Version (EPO) #1.30 (vi) PRIOR .~~PPLICATION DATA;

(A) APPLICATION N-AMBER: FI 981809 (B) FLLING DATE: 24-AC7G-1998 (2) INFORMATION
FOR
SEQ
ID
NO:
7_:

( i SEQUENCE CHARACTERIS'i':LC:S
) (A) LENGTH: 624 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECLILE TYPE: protein (v) FRAGMENT TYPE: N-terminal (vi ORIGINAL SO'dRCE
) (A) ORGANISM: Bacillus thuringiensis (B) :>TRAIN: galleria.

(C) :aNDIVIDUAL ISOLATE: 11-57 (ri) SEQUE2JCE DESCRIPTION: SF,Q ID N0: 1:

Pro Leu Ala Asp Asn Pro Tyr Ser Ser Ala Leu Asn Leu Ser Asn Cys Gln Asn S_r Ser Ile Leu Asn Trp Ile Asn Iye Ile Giy Ala Asp Ala Lys Glu Ala Val Ser Ile G1y Thr Thr I1Q Val Ser Leu Thr Ile Ala Pro Ser Leu The- Gly Leu Ile Ser Ile Val Tyr Asp Leu Ile Gly Lys Val Leu Gly Gly Ser Ser Gly Gl.n Ser Ile Ser Asp Leu Ser Ile Cys 65 ~ 70 75 BO
Asp Leu Leu Se~_~ Ile Ile Asp Leu Arg Va:L Ser Gln Ser Val Leu Asn Asp Gly Ile A1~~ Asp Phe Asn Gly Ser Val Leu Leu Tyr Arg Asn Tyr 1 0(5 10~ 110 Leu G:lu Ala Leu Asp Ser Trp Asn Lys ASI1 Pro Asn Ser Ala Ser Ala G~.~u Glu Leu Arcs Thr Arg Phe .Arg Ile Ala Asp Sex Glu Phe Asp Arg 130 ~ 135 140 Ile Leu Thr Arg Gly Ser Leu Thr Asn Gly Gly Ser Leu Ala Arg Gln Asn A1a Gln Ilw. Leu Leu Leu Pra Ser Phe Ala Ser Ala Ala Phe phe His Leu Leu Le~.a Leu Arg Asp Ala Thr Arg Tyr Gly Thr Asn Trp Gly 1B(.' 185 190 Leu Tyr Asn Al« Thr Pro Phe i:le Asn Tyr Gln Ser Lys Leu Val Glu Leu Ile Glu Le~.~ Tyr Thr Asp Tyr Cys Val His Trp Tyr Asr. Arg Gly Phe Asn Glu Leu Arg Gln Axg Gly Thr Ser Ala Thr Ala Trp Leu Glu Phe His Arg Tys- Arg Arg G1u Met Thr Leu Met Val Leu Asp Ile Vat A1a Ser Phe Ser Ser Leu Asp Il.e Thr Asn Tyr Pro Ile Glu Thr Asp 26;1 265 270 Phe Gln Leu Ser Arg Val Ile '7.'yr Thr Asp Pro I1e Gly Phe Val His 275 ~'.60 ~ 285 Arg Ser Ser Le~.~ Arg Gly Glu Ser Trp Phe Ser Phe Val Asn Arg Ala Asn Phe Ser Asp Leu Glu Asn Al.a Ile Pro Asn Pro Arg Pro Ser Trp Phe Leu Asn Asr~ Met Ile Ile Ser Thr Gly Ser Leu Thr Leu Pro Val Ile Ser Pro Al.aAsn Ser Gln Phe Ile Thr GluLeu Ile Ser Gly Gln Hia Thr Thr A.l_aThr Gln Thr Ile Leu Gly ArgAsn Ile Phe Arg Val Asp Ser Gln Ala Cys Asn Leu Asn Asp Thr ThrTyr Gly Val Asn Arg Ala Val Phe Tyr His Asp Ala Ser Glu Gly SerGln Arg Ser Val Tyr Glu Gly Tyr I.leArg Thr Thr Gly Ile Asp AsnPro Arg Val Gln Asn 4:?0 425 430 Ile Asn Thr Tyr Leu Pro Gly G~luAsn Ser Aso_Ile Pro Thr Pra Glu 435 4:40 445 Asp Tyr Thr H_LsIle Leu Ser Thr Thr Ile AsnLeu Trr Gly Gly Leu Arg Gln Val ALa Ser Asn Arg Arg Se. Ser LeuVal Met Tyr Gly Trp Ta~~rHis Lys S~:~rLeu Ala Arg J~snAsn Thr I1 As:~P=o Asp Arg Ile a Thr Gln Ile Pro Leu Thr Lys ~Ja~!Asp Thr ArgGly TY~rGly Val Ser Ty.rVal Asn Asp Pro Gly Phe Il Gly Gly AlaLei;Leu Gln Arg Thr a Asp His Gly Se:rLeu Gly Val Leu Arg Val G17Phe Pro Leu lIisLeu X30 53 5~
'_>

Arg Gln Gln 7"yrArg I1e Arg Val Arg T'yrAlaSe,~Thr Thr Asn I
l a 59:5 550 555 560 Arg Leu Ser Val Asn Gly Ser Phe Gly Thr I12Se. Gln Asn Leu Pro ~.e~rThr Met Arg Leu Gly Glu Asp Leu Ara TyrGly Ser Phe Ala ale ~~ 58 5 S90 Arg Glu Phe ~isnThr Ser Il Arg Prc Thr AlaSe=~Pro Asp Gln 31 ~ a A:rgLeu Thr Glu Pro Ser Phe Ile AYg Gl Glu Val Tyr Val Asp -_Le F~ 61~~ 620 ~

WO 00/11025 PCT/F199/OOb98 (2) INrORMATION ~'OR SEQ ID N0: 2:
(i) SEQUENCE CHARACTERISTTCS:
(A? LENGTH: 1953 base gairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: linear (ii) MOLECULE; TYPE: other nucleic acid (A) DESCRIPTION: /desc = "synthetic"
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
NO: 2:

ACCATGGGAAACTGTGGATGTGCTTCTGATGATGTTGCTAAGTACCCATTGGCTAAC'.AAC60 AACA'rCATTGGAGATGCTGCTAAGGAGGCTGTGTCTATTGGAACTACCAT'~GTCTCTCTT180 ATCACTGCTCCATCTC.'TTACTGGATTGATCTC:iIAmTGTGTACGATCTTA'~'TGGAAAGGTT 240 CTTCJ(JAGGTTCTTCTGGACAGTCTATCTCTGATCTTTCTATCTGTGATCTTCTTTCTATC 300 ATTC~i~TCTTAGGG?""'I'C'"CAGTCTGTTTTGAACGATGGAATTGCTGATTTCAACGGTTCT 360 GTTCTTTTGTACAGGAACTACTTGGAGGC''TCTTGATTCTTGGAACAAGAACCCAAACTCT a20 GCTTCTGC'"GAGGAGCTTAGGACTAGGTTCAGGATCGCTGAT'_"CTGAGTTCGATAGGATC 480 TTGACCAG~GATCTCTTACCAACGGAGGATCT:TGGCTAGGCAGAACGCTCAGATCCTT 540 TTG.~_TTCCA'_CTTTTGCATCTGCTGCTTTCTTCCACTTGTTGCTCCTTAGGGATGCTACC 500 AGGT:.4CGG"'ACTAACTGGGGACTTTACAACGC';'ACCCCAT"'TATCAACTACCAAAGCAAG 660 CTGG'TTC:AGCTTATTGAGCTTTACACTGATTACTGTGTTCACTGGTAC_AACAGGGGATTC 720 AACG;~1GCTTAGACAGAGGGGAACCTCTGCTACG3CTTGGCTTGAATTCCACAGATACCGC 780 AGA:.=,~GATGACCTTGATGGTT'CTTGATATTGTTGC'_"TCTTTCTCTTCTCTTGATATCACC 840 AAC:a'ACCCTA'_"TGAGACTGATTTCCAGTTGTCTAGGGTTATCTACACTGATCCTA'='TGGA90C

TTCG'TTCACAGGTCCTCTCTT'AGGGGAGAG"_'C'TGGTTCTCT"'"'CG'I"r.T~ACAGGGCTAAC 960 TTC"'CTGATTTGGAGA.ACGCTATCCC.~1AACCCAAGACCA'."CTTGGTTCC'_"TPAC.~1ACA'"G102C

ATCATCTCTACTGGATCTCTTACCTTGCC_~GTTTCTCCATCTACTGATAGAGCTAGGGTT 1080 TGGTATGGATC'='A~GGA'I'AGGATCTCTCCAGCTAACTCTCA~T'~CATCACTGAGCTTATC 114 C

TCTCAAGCTT GCAACTTGA~1 CGATACTACT TATGGTGTGAACAGGGCTGT TTTCTACCAT1260 GAT.A_~1CCC.AA GGGTT~:AGAA ~'..ATCAACACC GAGAGAACTC CGATATTCCA13 CAGGTTGCTT CTAACAGGAG GTCATCTTTG GTTATGTACGGATGGACTC.~1 CAAGTCTCTT1500 GCTAGGAACA ACACCATC.~IA CCCAGATAGA AT.CACCCAGATCCCATTGAC CAAGGTTGAT1560 CAGAGGACTG ACCAC~aGATC TCTTGGAGTT TTGAGGGTTCAGTTCCCACT TCACTTGAGA1680 CAGCAGTACA GGATCAGGGT TAGGTACGCT TCTACCACTAACATCAGGTT GTCTGTG.AAC1740 GGATCTTTCG GAACTATCTC TCAGAACCTT CC_~1TCTACCATGAGATTGG3 AGAGGATTTG1800 AT'rGAGTTC~. TCCCAGTTAA CCCAGATCTT TA.A 1953 (2'; INFORMATION
FOR SEQ ID
N0: 3:

(i) SEQUENCE
C_~iARACTERISTICS:

(A) LEN~TH : 198 9 base pa:).r s (B) TYPE: nucleic acid (C) STRANDEDNESS; double (Dl TGPOLOG~: linear (:ii) MOLECULE
TYPE: other nucleic acid {A) DESCRIPTION; /desc: _ ted piasrnid S2gmnt"
"trunca {v.) O RIGINAL SOURCE:

(A) ORGANISM: Bacillus t.huringiensis (B) STRAIN: galleria (C) INDIVIDUAL ISOLATE: 11:67 (viii) POSITIGN
IN GENOME:

(A) CHROMOSOME/SEGMENT: truncated-plasmid segmer_t (B) MAP POSITION: DNA r_odingN-terminal part oL
zor cry9 ( xi ) SEQUENCE DESCRIPTION : S7~:C~ ID NO : 3 ;
CGCGGATCCA ACA.ATGGGCA TGCCCAATTG TGGTTGTGCA TCTGATGATG TTGCGAAATA 60 TC~~TTTAGCC AACAATCCAT ATTCATCTGC: TTTAAATTTA AATTCTTGTC AAA.ATAGTAG 120 A.~rCCATAGTC TCTCTTATCACAGCACCTTCTCTTACTGGATTAATTTCAATAGTATATGA 240 CCTT.ATAGGT AAAGTACTAGGAGGTAGTAGTGGACAATCCATATCAGATTTGTCTATATG 300 TGACTTATTA TCTATT'ATTGATTTACGGGTAAGTCAGAGTGTTTTAAATGATGGGATTGC 360 AGAT'TTTAAT GGTTCTGTACTCTTATACAGGAACTATTTAGAGGCTCTGGATAGCTGGAA 420 AGAA'TTTGAT AGAATTTTAACCCGAGGGTCZ'TTAACGA_ATGGTGGCTCGTTAGCTAGACA 540 AAAT'TATCAA TCAAAACTAGTAGAGCTTATTGAACTATATACTGATTATTGCGTACATTG 720 GTAT~rIATCGA GGTTTCAACGAACTAAGACAACGAGGCACTAGTGCTACAGCTTGGTTAGA 780 TACAGATCCA ATTGGTTTTGTACATCGTAG2'AGTCTTAGGGGAG.'AAAGTfiGGTTTAGCTT 960 GTTT"rTAAAT AATATC~ATTATATCTACTGG'I'TCACTTACATTGCCGGTTAGCCCAAGTAC 1080 TGAT,AGAGCG AGGGTATGGTATGGAAGTCGAGATCGA_~TTTCCCCTGCTAATTC_~.CAATT114 TATTACTGAA CTAATC'TCTGGACAACATACGACTGCTACACAAACTATTTTAGGGCGAAA 1200 TATATTTAGA GTAGAZ'TCTCAAGCTTGTAATTT.~1AATGATACCACATATGGAGTGAATAG 1260 GGC('.~GTATTT TATCAfiGATGCGAGTGAAGGTTCTCAAAGATCCGTGTACGAGGGGTATAT 1320 fiCGAACAACT GGGATAGATAACCCTAGAGTTCAAAATATTAACACTTATTTACCTGGAGA 1380 AAATTCAGAT ATCCCAACTCCAGAAGACTATACTCATATATTAAGCACAACAATAA.T~TTT1440 TCTTTAGTAA
TGTATGGTTG

GACACATA_z1A AGTCTGGCTCGTAAGAATACCATTAATCCA 1560 GATAGAATTA
CACAGATACC

GAGGCACAGG GTGAATGATC
CAGGATTTAT

GGACTGACCA TGGTTCGCTT
GGAGTATTGA GGGTCCAATT

AATATCGTAT TAGAGTCCGT
TATGCTTCTA CAACAAATAT

TCGATTGAGT GTGAAT'GGCA 1800 GTTTCGGTAC TATTTCTCAA
AATCTCCCTA GTACAATGAG

ACGGATCTTT TGCTATAAGA
GAGTTTAATA CTTCTATTAG

ACC(:ACTGCA AGTCCC;GACC AAATTCGATT GAG~1.ATAGAA CCATCTTTTA TTAGACA.'4GA 1920 GGTCTATGTA GATAGAAT"TG AGTTCATTCC AGTTAATCCA GATCTATAAC CCGGGCTCGA 1980 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3837 base ~rairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = ~~plasmid DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Bacillus th~,rinazensis (B) SIRAIN: galleria . (C) INDIVIDUAZ, TSOLATE: 11:67 (viii) POSITIGN IN GENOME:
(A) CHROMOS01~/SEGMENT: plasmid DNA
(B) MAP POSITION: full length DNA encoding Cry9Aa toxin (xi) SEQUEN(~E DESCRIPTION: ~EQ .D N0: 4:
CAGAAATCA_~.CTTAC~AGTA CCCCGTTCGACCCGTTTTATAC.T~AAACT'AG60 TTAGGGATTT

TATACTGCGATGGGTAGATATTCGTCTATTTCCTT_AAGTT'TTTAAGATGCAGTATATGTA 120 GATCATATTTT.~.AAATATAGCGTTCATCA~1CTACTATATTATGTAATTGACGGTA.ATCAT 180 AI'TCAAGTGCGTGP.TTTACAAATCAA.AT7.'.'~ATGAA.~1GAACATGCTC.~ATCTGCTCAAATA 240 T(:TGTTTTTTATT'I'ATGAGTAAAAACCGAAG'"TTGTGG_~ACGTAA.ACTGTA.ATAAACGTA 3 C

A'.PGGCG_tIAGATATATAGATGTCAaTATAAAF~GTTA.$CCCAAATAATGTTTTAAAATTTT 360 AAAA_aTAATGTAG(3AGGAAAAATTATGAATCAP_nATA~ACACGGAATTATTGGCG~TTCC 420 AATTGTGGTTGTGt'ATCTGATGATGTTGCGA.zATATCCi"fTAGCCAACA~1TCCATATTCA 480 TCTGCTTTA.~1ATT'rAAATTCTTGTCPD.AATAGTAGTATTCTCAACTGGATTAACATAATA 540 GGCGATGCAGC.~1F::~AGAAGCAGTATCTATTGGGACAACCATAGTCTCTCTTATCACAGCA 600 CCTTCTCTTACTGGATTAATTTCAATAGTAmATG_ACCTTATAGGTA.~.AGTACTAGGAGGT 660 A.GTAGTGGACAATCCATATCAGATTTGT(:TATATGTGAt:TTATTATCTATTATTGATTTA 720 WO 00/11025 PC'f/FI99/OOb98 GAAGAACTCC GTACTCtTTT TAGAATCGCC GACTCAGAAT TTGATAGAAT TTTAACCCGA900 ACTAATTGGG GGCTATAC_~A TGCTACACC'T TTTATAAATT ATCAATC.'AAA 1080 ACTAGTAGAG

CTTATTGA~1C TATATAt~TG_~1 TTATTGCGTA CATTGGTATA ATCGAGGTTT 114 AGACAACGAG GCACTA(3TGC TACAGCTTGG TTAGAATTTC ATAGATATCG 1200 TAGAGAGATG

ACAT1'GATGG TATTAGATAT AGTAGCATCA TTTTCAAGTC TTGATATTAC 1260 TP_~TTACCCA

ATAGAA.~1CAG ATTTTCAGTT GAGTAGGGTC ATTTATAC~G ATCCAATTGG 1320 TTTTGTACAT

CGTAGTAGTC TTAGGG(iAGA AAGTTGGTTT AGCTTTGTTA ATAGAGC"TAz1 1380 TTTCTCAGAT

TTAGZ~.~~.ATG CAATACCTAA TCCTAGACCG TC:TTGGTTTT ':AAATAATAT1440 GATTATATCT

ACTGGTTCAC TTACAT'rGCC GGTTAGCCC~: AGTACTGATA GAGCGAGGGT 1500 ATGGTATGGA

AGTCGAGATC GAATTTCCCC TGCTAATTCA CAA~TTTATTA CTGAACT.iIAT 1560 CTCTGGAC.AA

CATACGACTG CTACACe'~T~..~C TATTTTAGGG CC'~r.AiITATAT TTAGAGTAGA1620 TTCTCAAGCT

TGTA~TTTA~1 ATGATAt~C~C ATATGGAGTG AATAGGGCGG TATTTTA'I'CA 1680 TGATGCGAGT

GAAGGTi'CTC AAAGAT(~CsT GTACGAGGGG 'CATATTCGAA CAACTGGGAT 1740 AGATAACCCT

AGAGTTCAA_~, ATATTAACAC TTATTTACCT GGAG.~1A.AATT CAGATATCCC18 AACTCCAGA.A 0 GACTATACTC ATATAT'PAAG CACA~CAATA AATTTAACAG G.~GGACTTAG 1860 ACAAGTAGCA

TCTAATCGCC GTTCATCTTT AGTAATGTAT GGTTGGACAC .ATAAAAGTCT 1920 GGCTCGTAAC

AATACC.~1TTA ATCCAGATAG AATTACACAG ATACCATTGA CGAAGGTTGA 1980 TACCCGAGGC

ACAGGTGTTT CTTATG'ru~lA TG_~TCCAGGA 'rTTATAGGAG GAGCTCTACT 2040 TCA.~T~GGACT

GACCATGGTT CGCTTGGAGT ATTGAGGGTC CAATTTCCAC TTCACTT?~~G 2100 ACAACAnTAT

CGTATTAGAG TCCGTTATGC TTCTACAACA AATATTCGAT TGAGTGTGA.~ 2150 TGGCAGTTTC

GGTACTATTT CTCAAA.~.TC"' CCCTAGTACA :~TGAGATTAG GAGAGGATTT 2220 AAGATACGGA

TCTTTTGCTA TAAGAGACTT TAATACTTCT ATTAGACCC_T~ CTGCAAGTCC 2280 GGACCAa..ATT

CGATTGACA~1 TAG_~ACCATC TTTTATTAGA CA.~GAGGTCT ATGTAGATAG 2340 AATTGAGTTC

ATTCCAGTTA ATCCGA~rGCG AGAGGCGA.I1.T~ GAGGATCTAG AAGCAGCAAAMann AAAAt~rrt~r~

WO 00/t t025 PCT/F199/00698 AfiGT7.'ATTGGAAGCGGTACGTGCGGCAAAACGACTTAGCCGAG.~ACGCAACTTACTTC.AG2580 GATCCAGATTTTAATACAATC.AATAGTACAGAAGAAAATGGATGGAA~IGCAAGTAACGGC 2640 CGAGAAAATTACCCAAC:ATACATCTATCAAAAAGTAGATGC:ATCGG.AGTTAAAGCCGTAT 2760 ACACGTTATAGACTGGATGGGTTCGTG.iIAGAGTAGTC~AG1~.TTTAGAAATTGATCTCATT 2820 CACCATCATAAAGTCCATCTTGTGAAAA~TGTACC.AGATA1?.TTTAGTATCTGATACTTAC 28$0 CCAGATGATTCTTGTAGTGGAATC:AATCGATGTC_AGGAACAAC~GATGGTAAnTGCGCAA 2940 CTGGA:~ACAGAGCATCATCATCCGATGGATTGCTGTGAAGCAGCTCAAACACATGAGTTT 3000 TCTTCCTATATTGATACAGGGGATTTAn.ATTCGAGTGTAGACCAGGGAATCTGGGCGATC 3060 TTTAAAGTTCGAAC..AACCGATGGTTATGCGAC'3TTAGGAAATCTTG.A.~.'rTGGTAG.AGGTC3120 GGACCGTTATCGGGTGAATCTTTAGAACGTGAAC.AAAGGGATA~TAC~A~ATGGAGTGCA 31$0 GAGC'x'AGGAAG~AAGCG'~GCAGAAACAGATCGCGTGTATCAAGATGCCAAACAATCCATC 3240 AATCA'!'TTATTTGTGGA'rTATC.AAGATC:AAC:~.z':."TAAATCC.AG_AAATAGGGATGGCAGAT 3300 ATTATGGACGCTCAAAA'rCTTGTCGCATCAATTTCAGATGTATATAGCGATGCCGTACTG 3360 C~AAATCCCTGGAATT_~1A{'.TATGAGPTTTACACAGAGCTGTCCAATCGCTTACA.'~CAAGCA3520 TCGTATCTGTATACGTC'('CGAA~TGCGGTGC'''~.~AAATGGGGACTTTAACA~1CGGGCTAGAT 34 AGCTGGAATGCAACAGCGGGTGCATCGGTAC:~~:CAGGATGGCA~iTACGCATTTCTTAGTT 3 54 TTGTAAATAT

GTATTACGTGTAACAGCAGAGAAAGTAGGCGGCGGAG~.CGGATACGTGACTATCCGGGAT 3660 GATGCTC.ATCATACAGAAACGCTTACATTTAATGCATGTGATTATGATAT 3720 AAATGGCACG

TCTA~C~.AAA GACACAACAC
G AAGTGGTAT

AACAGA_AGGT
GCATTTCATA
TAGATAGTAT
TGA~.TTC

Claims (17)

We claim:

1. Modified synthetic DNA sequences with enhanced expression through increased mRNA processing and stability for improved insect control, comprising modified synthetic DNA sequences modified from a truncated cry9Aa gene of Bacillus thuringiensis ssp. galleria, wherein the modified synthetic DNA sequence comprise selected modifications of SEQ ID NO:3:
and encode an insecticidal protein characterized by having the amino acid sequence (SEQ ID NO:1:) or alterations thereof having substantially the same properties as the insecticidally actives N-terminal domain of the selected Cry 9Aa protein and wherein the selected modifications provide an increased compatibility with higher plants.

2. The modified synthetic DNA sequences according to claim 1, wherein the selected modifications comprise selected changes of codon preference.

3. The modified synthetic DNA sequences of claim 1, wherein the selected modifications comprise removal of the putative polyadenylation sequence.

4. The modified synthetic DNA sequences of claim 1, wherein the selected modifications comprise removal of or changes in the splicing and mRNA destabilising signal sequences.

5. The modified synthetic DNA sequences of claim 1, wherein the selected modifications comprise one or more optional changes in the vicinity of the start codon.

6. The modified synthetic DNA sequences according to any of claims 1-5, comprising SEQ ID NO:2: and substantially similar sequences.

7. A DNA construct for cloning and/or transforming procaryotic or eucaryctic organisms, comprising the modified, synthetic DNA sequences according to any of claims 1-6.

8. A procaryotic or eucaryotic host comprising the modified, synthetic DNA sequences according to any of claims 1-5.

9. A method for preparing modified synthetic DNA sequences according to any of claims 1-6, comprising the steps of:
(a) selecting a DNA sequence encoding an insecticidal protein having tree unique properties of the Cry9Aa protein and differing substantially from other CryI proteins;
(b) providing modified synthetic DNA sequences encoding a protein having the insecticidal properties of SEQ ID NO:1 which is encoded by a synthetic truncated DNA sequence (SEQ ID
NO:3:) obtainable from the native cry9Aa gene (SEQ ID NO:4:) by truncation comprising introduction of restriction enzyme sites near the trypsin processing sites and the start codon site;
(c) improving the translation of SEQ ID NO:3: by changing its codon preference in selected direction, in order to obtain modifications of SEQ ID NO:3: still encoding an insecticidal protein comprising the amino acid sequence (SEQ ID NO:1:) or alterations thereof, said alterations still having substantially similar insecticidal action as the insecticidal protein encoded by the native cry9Aa gene of Bacillus thuringiensis ssp. galleries.

10. The method according to claim 9, wherein the selected modifications in the synthetic modified DNA sequences provide increased compatibility with higher plants and comprise the changing of the codon preference of SEQ ID NO:3: in selected direction by methods consisting of removal of putative polyade-nylation, splicing and mRNA destabilising signal sequences and/or changes of the vicinity of the start codon by modification of one or more nucleotides.

11. The method according to claim 10, wherein the modified synthetic DNA sequences comprise SEQ ID NO:2: and substantially similar modifications thereof.

12. A method for providing higher plants for improved insecticidal control comprising the steps of incorporating the modified synthetic DNA sequences according to any of claims 1-6 into a DNA construct in order to functionally incorporate said modified DNA sequences into a plant genome.

13. The use of the modified, synthetic DNA sequence according to any of claims 1-6, for producing the unique insecticidal protein characterized by having the amino acid sequence (SEQ
ID NO:1:) or modifications thereof having substantially the same properties as the N-terminal domain of the insecticidal protein encoded boy the native cry9Aa gene of Bacillus thuring-iensis ssp. galleria.

14. The use of the modified, synthetic DNA sequence according to any of claims 1-6, wherein the improved properties comprise enhanced expression through improved mRNA processing, stability, and/or translation providing improved tolerance against target insects.
.

15. The use of the modified, synthetic DNA sequence according to any of claims 1-6, for producing transgenic plants with improved properties, said transgenic plant being capable of expressing effective amounts of an insecticidal protein being substantially similar with the amino acid sequence SEQ ID
NO:1: and alterations therof having substantially the same properties as the N-terminal domain of the insecticidal protein encoded by the native cry9Aa gene of Bacillus thuringiensis ssp. galleria.

16. The use of the modified, synthetic DNA sequences according to any of claims 1-6 for improving insect resistance in higher plants.

17. The use of the modified, synthetic DNA sequences according to any of claims 2-6 as an implement in resistance management strategies.