CA2340588A1 - Selective treatment of endothelial somatostatin receptors - Google Patents

Abstract

The invention provides for the use of a SSTR1 or SSTR4 selective agonist to treat human endothelial cells and to formulate a medicament for human use, where the medicament may be for use to treat an endothelial-cell-mediated proliferative disease. The use of SSTR1 or SSTR4 selective agonists for treating endothelial-cell-mediated proliferative diseases may include, for example, treatment of intimal hyperplasia or an angiogenic disease. In various embodiments, the angiogenic disease may for example be macular degeneration, or a solid tumor. The SSTR1 or SSTR4 selective agonists may include the SSTR1 '499 agonist (des-AA1,2,5[DTrp8,IAamp9]SS). In methods of treatment, therapeutically effective amounts of the SSTR1 or SSTR4 selective agonists may be administered to a patient.

Description

~'~TtCA99tQ08~~3= ~~ ~ ~-%~ ~ c 1SA ~ESC26, Q i~ NGVE~B-R 199s o ~ . ~ ~ . ~ 9 SELECTIVE TREATMENT OF ENDOTHI~LIAL SOMATOSTA
RECEPTORS
FIELD OF THE INVENTION
The invention is in the field of therapeutic uses for selective peptide and nonpeptide sornatostatin receptor agonists.
BACKGROUND OF THE INVENTION
Somatastatin {SS) is an endogenous cyclic peptide found in two major native molecular forms of 28 and 14 amino acids {SS28 and SS 14 respectively, SS was initially described as a somadomedin release-inhibiting factor, and is consequently still called SRIF in some of the literature). SS has disparate, but primarily inhibitory, roles in a variety of physiological systems, either acting directly on cellular functions or as an antagonist of stimulatory factors {Coy et al. 1993, J pediatric Endocrinol.
6:205). The multiplicity of effects of SS on physiological processes reflects both its widespread distribution in vivo, ~d the existence of multiple SS receptor subtypes.
The effects of SS are transduced by a family of SS receptors (SSTRs), of which 5 (SSTR1 through SSTRS) have been cloned (Coy et al. 1893, supra) These receptors may be divided into two sub-groups on the basis of their relative sequence similarities and affinity for SS analogues (Hoyer et al., 1'-~9~, Tre»ds Pharmacol Sci 16:86). One sub-group consists of SSTR2, SSTR3 and SSTRS. The second sub-group comprising SSTR1 and SSTR4. The physiology of the first sub-group of receptors has been more thoroughly characterized, due in part to the relative availability of SS
analogues that are selective for these SSTRs, particularly SSTR2. It is however known that all 5 SSTRs share some mechanistic features, for example all 5 have been Shown to be coupled to G-proteins and to regulate intracellular cAMP levels, in part, through activation of G, (Patel et crl. I'~~4, BIOCIIE'111. Bioplys Rc~S.
Com»ru», 198:605).
s0 SS has an extremely short half life i,r i,iv.o~ rendering it unsuitable for most ther:~peutic uses. For therapeutic applications, a variety oi~short peptide analogues of SS have been identified, particularly agonists of the first sub-group of SSTRs {see for example U.S. Patent Nos. 4,485,I01 issued 27 Ivo~-ember 1984; 4,904,642 issued _1_ !4 01-2001 ' , ~~ ~~.. ~ , , , _ ~ , _._ .. ~' E ~~

PGTIGA99It1U8Q(I: . ~ lSA C)ESG2C~ ;~
v."n"h. . .~ ...._,~. ,~~ ~ , "a,~. .~.aF ... ~ , Q 1 NOVf~~~rR 199 ~ I . l ~

February 1990; 5;147,859 issued 15 September 1992; 5,409,894 issued 25 April 1995;
5,597,894 issued 28 January 1997; and, International Patient Publications: WO
97101579 of 16 January 1997 and WO 97/47317 of 18 December 1997; ail of which are hereby incorporated by reference).
Among the most thoroughly characterized of the peptide SSTR agonists are octreotide (Sandoz Ltd., Basel, Switzerland) and angiopc~ptin (sometimes referred to as BIM 23014). Octreotide is recognized as an SSTR2 sf;lective agonist (Yang et al~~
1998, pNAS USA 95:10836). Angiopeptin is recognized as an SSTR2/SSTRS
selective agonist (Alderton et al., 1988, Br: J. Pharrnacol 124(2):323). U.S.
Patent No. 5,750,499 (issued 12 May 1998 to Hoeger et al., incorporated herein by reference) discloses what are claimed therein to be the first SSTR1 selective agonists (also described in Liapakis et al., 1996, The J. of Pharmacology and Experimental Therapeutics 276(3}1089, incorporated herein by referen.ce), one of which is identified as des-AAi.z,s [DTrpB ,IAamp9]SS (Le. des-amino acid ~'z°s[DTryptophan8, N-p-isoproply-4-aminomethyl-L-phenylalanine9~SS, abbreviated herein as the "SSTR1 '499 agonist") A number of nonpeptide somatostatin receptor subtype-selective agonists have been identified using combinatorial chemistry (Rohrer et al. 1998, Science 282:737, incorporated herein by reference). Included amongst the agonists identified by Rhorer et al., supra, are agonists selective for SSTRI and SSTR~4. Rhorer Qt al., supra, also disclose the apparent inhibition constant (K;) for SS14 binding to the SSTR
receptors, as shown in Table l, and disclose methods of calculating that constant for SSTR
selective agonists. Rhorer et al., supra, indicate that the SSTRl and SSTR4 agonists disclosed therein were not physiologically active, in that they did not inhibit the release of growth hormone, glucagon or insulin in a model system. In contrast, a SSTR2 agonist is disclosed as having potent inhibitory ei:fects on secretion of growth hormone, glucagon and insulin.
CA 02340588 2001-02-23 . ' 2 ' t ' i " ' ~ , . . , _ , i:'. ~ <,~~ . ~~' ' f.v. .Sr( 1.. L E 't1f'_ Y Lw ~I4~;~
4' C11-20t~''[v ..~ ~. : .._ -., ~'CT/CA99/OQl~fit3 ~~ ~ !SA aESC2fi ~~ _ 9 ...~~... .n.~E e~.~ ~ NOVEL"BER 1999 I :- I ~ . 9 9 Table 1: SS14 SSTR Specificity (K; in nanomoles)*:
riviu nviuct et a1. i»°~ Jcience °"''~ w'm .
It has been suggested that particular SSTR agonists may be useful in the treatment of a variety of diseases, particularly in light of favourable results of treatment in some animal models. For example, on the basis of the chicken chorioallantoic membrane (CAM) model, it has been suggested that SSTR2 agonists in particular may be effective inhibitors of angiogenesis (Woltering et al.
1997, Investigational New Drugs 15:77, in which SSTR2 binding activity of a number of agonists is correlated with the compounds anti-angiogenic activity). With respect to angiogenesis, SS itself has recently been shown to control growth of a xenografted Kaposi's sarcoma tumor in a nude mouse model, through inhibition of murine angiogenesis (Albini et al. 1999, The FASEB .~ 13(6):647, wherein results are presented indicating that human endothelial cells express SSTR3). There is also abundant evidence that SSTR2 agonists, particularly angiopeptin, are effective in inhibiting intimal hyperplasia after arterial injury in animal models (Lundergan et al.
1989, ~qtherosclerosis 80:49; Foegh et al., 1989, ~qtlaerosclerosis 78:229;
Conte et al.
1989, Transpl Proc 21:3686; Vargas et al. ~ 1989, ~ransp~lant Proc 21:3702;
Hong et al., 1993, Circulation 88:229; Leszczynski et al.~ 1993, ~Zegulatory peptides 43:131;
Mooradian et al. ~ 1995, J. Cardiovasc PJiarm 25:611; Light et al. ~ 1993;
,q,li J Physiol 265:H1265}. It has been suggested that this therapeutic activity in animal models reflects the ability of angiopeptin to inhibit the release of growth factors from injured endothelial cells (Hayry et al., 1996, Metabolism 45(8 Suppl 1):101). In clinical studies, however, the use of angiopeptin to inhibit intima,l hyperplasia causing restenosis in human patients has been inconclusive (Eriksen et ill., 1995, ,,q»7 Hearu J.
130:1; Emanuelsson et al. ~ 1995 Circulation 91:1689; Kent ct al. ~ 1993, Circulation 88:I506). The poor clinical efficacy of angiopeptin in clinical trials for the prophylaxis of restenosis follomng coronary angioplasty, in contrast to encouraging data from animal studies, has been attributed to a low intrinsic activity of angiopeptin at the SSTR2 receptor, combined with lack of agonist activity at the SSTRS
receptor (Alderton ~t crl. 1998, Br. J. Pharnracol 124(2):323). SS~'~R2 agonists have also been Endothelial cells form a single cell layer lining all blood vessels in the human body, surrounded by other cell types such fibroblasts and smooth muscle cells.
Endothelial cells are restricted to blood vessels. Endothelial-cell-mediated proliferative diseases such as angiogenic diseases and intimai hyperplasia continue to pose a significant health problem, caused by imbalances in the physiological system I O that regulates vascular remodelling. For example, ocular neovascularization in diseases such as age-related macular degeneration and diiabetic retinopathy.constitute one of the most common causes of blindness. Intimal hyperplasia causing restenosis or narrowing of the artery has been found to occur in 30-50% of coronary angiopiasties and following approximately 20% of bypass procedures (McBride et al.~
1988, N. Engl. .l. Med. 318:1734; Clowes, 1986, f vasc. Surg. 3:381).
Angiogenesis induced by solid tumor growth may lead not only to enlargement of the primary tumor, but also to metastasis via the new vessels.
SUMMARY OF THE INVENTION
The inventors have made the surprising discovery that SSTR1 and SSTR4 are expressed on human endothlial cells, Ijl vitro and in vivo~ which contrasts with the presence of other SSTRs, particularly SSTR2, on endothelial cells in other animals.
Accordingly, SSTR1 and SSTR4 selective agonists may be used to treat human endothelial-cell-mediated proliferative diseases. In some aspects of the invention, the use of selective agonists targeted to endothelial cells may have the important advantage of minimizing the side effects that would otherwise be associated with stimulating the SSTRs that are present on other cells, particularly SSTR2 on endocrine cells. The invention therefore provides for the use of a SSTRI or selective agonist to formulate a medicament for human use, where the medicament ~0 ~z~ay be for use to treat an endothelial-cell-mediated proliferative disease. The use of SSTRI or SSTR4 selective agonists for treating endothelial-cell-mediated proliferative diseases may include, for example, treatment of intimal hyperplasia or an angiogenic disease. In various embodiments. the aneiogenic disease may for F'rmtea 24=01 2001: ~~.-'.~ ~ r~-,~ ~ r ~ j P ~~ ~ ~ t~ r~ . -... F.:..s.~r,."~

~r l ~~~ ~ !
~~~'~~~~og~oo~o~z ~ ~, N o v E t;~.. ~~Lt~R i~9~ Isa or"~~2st~ , I .~,;~ 9 9 example be age-related macular degeneration, or a solid tumour. The SSTR1 sele ive agonists may be the SSTRl '499 agonist (des-AAI~l~ [D'TrpB ,iAamp9]SS). In methods of treatment, therapeutically effective amounts of the SSTRI or SSTR4 selective agonists may be administered to a patient.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graph showing the anti-angiogenic effects of SS14 in the ECV304IMatrigel model (Hughes, 1996, gxperimental Cell Research 225:171-185), as disclosed in Example 1 herein.
DETAILED DESCRIPTION OF THE INVENTION _ In one aspect, the invention provides therapeutic uses of SSTRI and SSTR4 selective agonists. In some embodiments, the invention involves the use of and SSTR4 selective agonists for the treatment of endothelial-cell-mediated 1 S proliferative diseases. Examples of endothelial-cell-mediated proliferative diseases include intimal hyperplasia and angiogenic diseases (ang;iogenic diseases are characterised by pathological neovascularization as a result of inappropriate or unregulated angiogenesis). Proliferative diseases may be mediated by endothelial cells, for example, where endothelial cells are involved in up-regulating a pathological cellular proliferation, as is thought to occur in intimal hyperplasia {where the proliferating cells may be either endothelial or other cell types), or, as in the case of solid tumour vascularization, where the endothelial cells facilitate pathological cellular proliferation. The categories of endothelial-cell-mediated proliferative diseases will be recognisable by medical practitioners and those skilled in this art, and will change from time-to-time in accordance with progress in medical research.
In various aspects of the invention, angiogenic diseases may include proliferative retinopathies, such as diabetic retinopathy, retinopathy of prematurity, corneal graft rejection, retrolentaI fibroplasia, neovascular glaucoma, rubeosis, retinal s0 neovaseularization due to macular degeneration (including anti-angio;,~enic treatment following photodynamic therapy), hypoxia, angiogenesis in the eye associated v~ith infection or surgical intervention, and other abnormal neovascularization conditions of the eye; angiogenic aspects of skin diseases such as psoriasis; blood vessel diseases CA 02340588 2001-02-23 t''~°' '' k= ~=~ ' .-c, a ~~ ~ Cw,.~ r.' 1 r' ~ , ~ kd ~~ I ~ V ~ ~ w i f ~ t ~ t i sL

w i. , ~' r1 / !1 n ,.. I1 n ~9~' '1'~~"~1~~9~~f?Q$OQ~ ~ NOY~h~~ 1~9 0 LISA DESC26 , ,Fd.. !,f",.". ,~'~.,'ast,t,2re~...ex,..~,3ak."q~r.u<,c"< s.."~, ..
such as hemagiomas, and capillary proliferation within atherosclerotic plaques; Osler-Webber Syndrome; myocardial angiogenesis; plaque neovascularization;
telangiectasia; hemophiliac joints'; angiofibroma; and wound granulation.
Other uses include the treatment of diseases characterized by excessive or abnormal stimulation of endothelial cells, including but not limited to intestinal adhesions, Crohn's disease, atherosclerosis, scleroderma, and hypertrophic scars, i.e. keloids. SSTRI and selective agonists may also be useful in the treatment of diseases that have angiogenesis as a pathologic consequence such as cat scratch disease (Rochele ninalia quintosa) and ulcers (Helicobacter pylori).
An alternative aspect of the invention comprises SSTRl and SSTR4 selective agonist treatments for cancers susceptible to anti-angiogenic treatment, including both primary and metastatic solid tumors, including carcinomas of breast, colon, rectum, lung, oropharynx, hypopharynx, esophagus, stomach, pancreas, liver, gallbladder and bile ducts, small intestine, urinary tract {including kidney, bladder and urothelium), female genital tract, (including cervix, uterus, and ovariea as well as choriocarcinoma and gestational trophoblastic disease), male genital tract (including prostate, seminal vesicles, testes and germ cell tumors); endocrine glands {including the thyroid, adrenal, and pituitary glands), and skin, as well as hemangiomas, melanomas, sarcomas {including those arising from bone and soft tissues as well as Kaposi's sarcoma) and tumors of the brain, nerves, eyes, and meninges (including astrocytomas, gliomas, glioblastomas, retinoblastomas, neuromas, neuroblastomas, Schwannomas, and meningiomas). In some aspects of the invention, SSTR1 and SSTR4 selective agonists may also be useful in treating solid tumors arising from hematopoietic malignancies such as leukemias (i.e. chloromas, plasmacytomas and the plaques and tumors of mycosis fungoides and cutaneous T-cell lymphoma/leukemia) as well as in the treatment of lymphomas (both Hodgkin's and non-Hodgkin's lymphomas). In addition, SSTRI and SS'TR4 selective monists may be useful in the prevention of metastases from the tumors described above either when used alone or in combination with radiotherapy and/or other chemotherapeutic agents.
-G-CA 02340588 2001-02-23 ~-p. ~ r v. ,z c., .,~
[ i ; ~ p e.; . ts. i ~. E ; ~ ~:-~ ic'-" ~ v 22 ;11 199, F''T~C;~99/t~0$00, ~ ~~c 9 tSA ~ESC26.':,-a.~ ~ ~. ~ R
01. NOVEMBER 1999 0 1 . I I =.9 9 .
In several aspects, the present invention relates to somatostatin receptor agonists that are selective for one or more of the somatostatin receptor subtypes. In this context, receptor-ligand binding assays may be carriied out to determine the relative affinity of a compound for one or more of the somatostatin receptors, as for example is described by Rhorer et al. ~ I998, Science 282:737. In some embodiments, a compound will be 'selective' for a receptor if the apparent inhibition constant of the compound with respect to that receptor (K;, calculated as described by Rhorer et al.~
supra) is less than the K; of the compound with respect to another SS
receptor, and in some embodiments at least ten fold less. In some embodiments, the selectivity of the 14 agonists used in the invention may be greater than ten fold, such as 100 fold or 1000 fold. In some embodiments, the present invention encompasses compounds that are selective for more than one SSTR.
In one aspect, the present invention utilises an established model system for studying human angiogenesis. The model system comprises the spontaneously transformed human umbilical vein endothelial cell line, :ECV304, grown on a Matrigel substrate (Hughes, 1996, experimental Cell Research 225:171-I85}.
Matrigel is a solubilized basement membrane extract that promotes the differentiation of endothelial cells into capillary tube-like structures in vitro. It has been shown that cytoskeletal reorganization occurs when human umbilic<ii vein endothelial cells undergo the morphological changes associated with neovascular tube formation on a Matrigel substrate (Grant et al.~ 1991, Ijt Vitro Cell Dev. Biol. 27A(4):327-36.). As disclosed in Example 1 herein, using the i~ vitro ~giogE,nesis model comprising ECV304 cells on a Matrigei substrate, it has been shown. in the context of the present

2~ invention that SS14 inhibits angiogenesis. At sub-micromolar and higher -concentrations, SSI4 was found to significantly inhibit neovascular growth in this model system. These results indicate that SS 14, which is. an agonist of all somatostatin receptor subtypes (see Table 1 ), acts on human endothelial cells as an angiogenesis inhibitor.
The present inventors have further demonstrated that the ECV304 cells onlv express the SSTRI and SSTR4 receptor subtypes, and do not express SSTR2, SSTR3 or SSTRS mRNA in quantities detectable by RT-PCR (see Example 2}. Accordingly, ,~ ~ ~. ~~t! ~~ .' rt s E ~ ., ~ ~ ytm fit.. ''.y ~ f r - w. ~ r~.r .'-' Prmted:24~a1 :20(~~ v ~ . .. ' .. ~ .,' ~ .. ~, ~~. i:. ~;. ~,: ~ t~E i.~ ~ .:
~ , 7 ~ ., X95 PGT~GA~9.(~0~0~~ ~ ~ ~ ,ISA ,DESG2C
' Q~ l NOVEMBER 1999 ~~ I I ~ , 9 9.
the demonstrated anti-angiogenic effects of SS 14 on ECV304 cells must be mediated by SSTRl and/or SSTR4. The present inventors have also demonstrated that an SSTRl selective agonist has similar physiological effects on ECV304 cells as does SS I4, particularly disassembly of actin stress fibres and formation of lameliipodia (see Example 3). This indicates that in alternative embodiments of the invention, SSTR1 and SSTR4 selective agonists will have anti-angi:ogenic effects on human endothelial cells, just as SSI4 has an anti-angiogenic effect in the ECV304/Matrigel model system.
IO Somatostatin analogues have been shown to have: therapeutic effects in a variety of animal models of proliferative disease, including angiogenesis and intimal hyperplasia. SSTR2 agonists in particular have been shown to be successful in ameliorating the pathologies of endothelial-cell-mediated proliferative disease models, such as CAM, arterial balloon injury in several animal species, and murine I S angiogenesis in a cancer model. The present inventors have determined that in contrast to animal models in which endothelial cells express SSTR2 (see Example 4 and Chen e~ al.~ 1997, J of~fivestigative Surgery 10:I7), human endothelial cells and tissues express SSTRI and SSTR4. This indicates that, vrhereas SSTR2 agonists are effective in treating animal models of human endothelial-cell-mediated proliferative 20 pathologies or disease, SSTRl and SSTR4 selective agonists may be used to treat human patients.
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in 25 accordance with the common general knowledge of those skilled in this art.
Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way.
Numeric ranges are inclusive of the numbers defining the range. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase 3U "including, but not limited to'". The following examples are illustrative of various aspects of the invention, and are not limiting of the broad aspects of the invention as disclosed herein.
-g_ °~ f,'.' ~''.. c:.e. ~' ;':v~ ~ ~ .~. ~ y ~r' ' r~._ ,",~~ r : r' - > a y n c°' x4-t3'1 200';1 ~ ~ - f ' ~ ; n~ :. . ,: . ~ _.
. . ~ _ . i ~ ~, ~. . k. .,.k.~ ,. ; ~ t .. . , ~:. -,., 4 '"~ ' n n n ~
~2 'f i ':1999 P~aGT~~A99It1~8~~ ~~v -, r ~ 1SA DESC2fi' :.
r .. .,_ ..: :._~a.c#~",._;~_..' , ~.. x. s. , ._ Q 1. NOV~~'B~.R 1999 0 I . ~ l w 9 9-...:
Example 1: Anti-Angiogenic Effect of SS14 This example shows the anti-angiogenic effect o;f SS 14 on endothelial cell capillary-like tube formation in vitro using an established model of angiogenesis.
The model is based on the propensity of human endothelial cells, particularly S ECV304 cells, to form capillary-like tubes on Matrigel, ;~ basement membrane extract (Hughes, 1996, Experimental Cell Research 225:171 ).
Five mg vials of SS 14 (Biomeasure Incorporated) were reconstituted using 1.0 mL 0.01% BSA/O.O1N acetic acidlPBS to achieve a woiking stock of 3mM. The human endothelial cell line ECV304 (ATCC) was cultured in Medium 199 (M199, Sigma) supplemented with 2 mM L-glutamine (Gibco B:EtL), 1 mM sodiurr~
pyruvate (Gibco BRL), 5 x 10'5 M 2-mercaptoethanol (Sigma), 100 UImL penicillin (Gibco BRL), 100 ug/mL streptomycin (Gibco BRL). 20 mM HEPES (Sigma). and optionally 10% heat-inactivated fetal calf serum (Gibco :BRL) or i % BSA.
Cells 1 S were passed at a rate of 1:5 using 0.05% trypsin/0.005% EDTA (Gibco BRL) upon reaching confluence.
ECV304 cells (3.5 x 104 in 0.5 mL complete M199 medium) were placed onto 24-well plates that were pre-coated with 0.125 mL of Matrigel (Becton-Dickinson).
SS 14 was immediately added to the ECV304 cells and the cells were incubated at

3~°C in a COa humidified chamber. After 24 hours, images of tube-formation were recorded on f lm. Images were converted into a digital format using a Hewlett-Packard ScanJet 4C/T scanner, the summed length of capillary-like tubes was quantified using Optimas 6.1 image analysis software (Optimas Coip.).
Figure 2 illustrates in graphic form the finding that SS14 inhibits neovascular tube formation in a dose-dependent manner. The graph in Figure 2 shows that the inhibition of angiogenesis by SS14 was greater than SO°/<. at all SS14 concentrations ranging from 0.1 pM to 100 pM, as measured by neovasc:ular tube length relative to control samples that were not treated with SS i 4.
Example 2: Characterization of Human Endothelial Cells .. ~w_ F?nntecl24.01 2x011 ~ ~'~~~~ ;'~ ' ' 'x ~~~°=~, ~~ c~~'..-... . ..

~~.1~ ~ ! l.~''3 z"~ ' ~ l ~~ l5 n ll p 99~= PCT~~A9,91608Q ~ 1 N 0 V E h~ ~3 F R 1999 0 LISA D ESC26 ' Il.gg) The endothelial characterization of the ECV304 cells used in the present invention was confirmed by the detection of von Willebrand Factor (vWF) mRNA
by RT-PCR and the detection of vWF by immunocytochemistry (vVhF is a well known functional marker of endothelial cells that is involved In~ vivo in the blood clotting cascade). The ECV304 cells used herein also expressed the endothelial marker endothelial nitric oxide synthase (eNOS).
RT-PCR provided evidence for the presence of ~>STRl and SSTR4 mRNA in ECV304 cells and in a primary endothelial HUVEC cell Line from umbilical veins.
Neither cell lines expressed SSTR2, SSTR3 or SSTRS rnRNA, with the exception that later passages of some HUVEC cultures showed low levels of SSTR2. _ The ECV304 and HUVEC endothelial cell lines v~ere immunostained for SSTRI
and vWF, identifying the location of the SS receptors. Tlue EC304 and HUVEC
cell lines showed SSTRl immunostaining in both the cytopla;~m and on the plasma membrane. Localization of vWF in ECV304 cells and eaniy passages of HUVEC
cells showed that 95-100% of the cells were immunoreactive, however fewer cells were immunostained in the later passage of HUVECs (<60%).
Fn the present Example, ECV304 cells (American Type Culture Collection, Mantissas, VA) were cultured in Medium I99 (Sigma Chemical Co., St. Louis, MO) supplemented with 2mM Glutamine, 24 mM sodium bicarbonate, 10 mM Hepes, penicillin (100 U/ml), streptomycin (0.lmglml), and heat inactivated fetal calf serum (10%). HUVEC and AoSMC cells were obtained from Clonetics Corporation (Walkersville, MD) with the required culture medium. 'The cell lines were grown in 75 cm2 Falcon flasks (Becton Dickinson Labware, Franklin Lakes, NJ.) for collection of RNA or seeded onto APES (Sigma) coated 20mm coverslips in 24 well Costar plates (Corning Inc., Coming, NY) for histological studies. The i'ollowing EC'\'304 cell Line information is provided by the ATCC:
ATCC Number: CRL-1998, originally deposited in May 199?
Organism: Homo sapiens (human) Designations: ECV304 Tissue: normal; umbilical vein; endothelium; endoibclial _ 1 ~~ -CA 02340588 2001-02-23 ~..%.. ~~ ~, , ' . 1. ~ r r ~.. t,r: p "4 ~ ~ ~,~'~
'P~mteci 24 ~f31' 200.x:'' 'lit ~~,~,~:,, P~~-~c~~~~oaas~= P~ I lsa ~ESC2s:.
j-2~, '~'1 1999 ~~,.. M. ,.,.. ..~.~.~ "..
~~._., f _ ..: ,~... w y ~~ NOVEMBER 1989 Morphology: cobblestone Depositors: K. Takahashi VirusSuscept: Semliki Forest virus {SFV) Tumorigenic: yes, in BALB/c nulnu mice Karyotype: modal number = 80 Products: angiotensin converting enzyme (ACE;) FluidRenewal: 2 to 3 times weekly SubCulturing: Remove medium, add fresh 0.25°,~o trypsin, 0.03% EDTA
solution, rinse and remove trypsin. Allow the flask to sit at room temperature (or incubate at 37C) until the cells detach (usually 5 to 10 minutes). Add fresh medium, aspirate and dispense into new flasks. -SplitRatio: A ratio of 1:6 to 1:10 is recommended Growth Properties: monolayer Comments: ECV304 is a spontaneously transformed immortal endothelial cell line established from the vein of an apparently normal human umbilical cord {donor number 304). The cells are characterized by a cobblestone monolayer growth pattern, high proliferation potential without any specific growth :factor requirement, and anchorage dependency with contact inhibition. Endothelium specific Weibel -Palade bodies were identified in electron microscopic studies. Immunocytochemical staining for Iectin Ulex europaeus I (UEA-I) and PHMS (anti-human endothelium as well as glomerular epithelium monoclonal antibody) was positive. The cells are negative for Factor VIII related antigen, for alkaline and acid phosphatases and for epithelial keratins. The cells will form tumors in BALB/c nulnu mice, and will cause neovascularization on rabbit corneas. They are reported to produce pro-urokinase type PA (pro-u-PA) and express small amounts of intercellular adhesion molecule (ICAM-1), lymphocyte function associated antigen-3 (LFA-3). Vascular cell adhesion molecule (VCAM-1) and granular membrane protein-140 (GMP-i40). Interleukin-1 (IL-1 ) and interferon exert suppressive effects on ECV304 cells. These cells also produce IL-6 after stimulation with IL-1. The line was cured of mycoplasma contamination by a 21 day treatment with BM Cycline. Further information may be included in the following references, which are hereby incorporated by reference:
Takahashi et al.~ Ig'~0. In Vitro Cell. Dev. Biol- 26:265; Takahashi and Sawasaki, 1991, In hitro Cell. Dev. Biol- 27A:7G6; Takahasi and Sawasaki, 1992, I» 1-'irro C~II.
CA 02340588 2001-02-23 - ' " ' '- ~ - r ~ - , .
<",;. r a .-n S. A ~ ~ L. ~ y ~ 3 ~4 ~ ~ , . a_ .,ywn L <-: i..:~ _. _ "~';~~;~

~i it ~ f5 /~ n n ~c F~~'flCA99/0a800 ' SSA DESC2fi ~.. ~~,.n,~~.8.~." .~ I NOVEMBER I~g ~ ~ ::..~ I.._ y g Dev. Bioh 28A:380). Propagation of the cell line may bE~ carried out in~ATCC
Medium 199, 90%; heat-inactivated fetal bovine serum, 10%.
In the present Example, total RNA was isolated according to manufacturer's directions from tissue samples and cell lines lysed in Trizol solution (Gibco Life Technologies, Grand Island, N.Y.). Any DNA present w~~s removed by incubation in the first strand buffer (25 mM Tris-HCI pH 8.3, 37.5 mM KCL, 1.5 mM MgCL2 and 10 mM
DTT) containing 1mM dNTPs (Pharmacia), 10 U Rnasin (Pharmacia), and 2U of Dnase (Promega Corporation, Madison, WI) and heated to 37°C for 30 min. The DNase was inactivated by heating to 75°C for 5 min. A sample was removed and used as a PCR
template to verify the absence of genomic DNA. The cDNA was synthesized from purified RNA using Superscript II reverse transcriptase (100 U MMLV; Gibco Life Technologies, Grand Island, N.Y.) according to the manu:facturer's directions with oiigo-dT primer ((Gibco), 10 U Rnasin {Pharmacia), and 1 mM dNTPs (Pharmacia)).
Samples were incubated at 42°C for 1 hour. The enzyme was inactivated by heating the samples to 75°C for 15 min. The cDNA samples were stored at -20°C prior to PCR.
For detection of SSTR subtypes in endothelial cell lines (and human blood vessels), oligonucleotide primers were synthesized on an Applied Biosystems Model 391 DNA synthesizer, as follows:
_ t? _ CA 02340588 2001-02-23 b~ r~ g~ ~"t f ~ ~~+. hr, ~ r n... S.~ ~ . E._~a~;~u . . i . ~ ~ ~ r i~.. , ; ~ 1;
. - " . r ~'k, r . pr. o",eY x ~ L a ' ~
Printed.24=tl1-2.OOt. - . 12' 2~ 11 'I'999yv ~?~~'~GA9'~faQ80a~, ~~ ~ ~tSA ~ESC2fi'' ~f. _ _, ~ ~~_.:,.~.~,,.. ,.t~A,:.~«.-.
p 1l NOVEMBER 1999 0 Z . 1 1. . g g1 TABLE 2: HUMAN SSTR PRIMERS
rimer primer sequence {5'-3') Position PCR Annealing in specificity gene product temperature size SSTR1 GGAGGAGCCGGTTGACTATT 1140-1159375 58~C

SSTR2 AGAGCCGTACTATGACCTGA 184-203 627 59~C

SSTR3 GAGCACCTGCCACATGCAGT 661-681 316 62~C

SSTR4 TCCCTTATCCTCAGCTATGC 948-968 283 60aC

SSTRS TCTTCTCTTGCAGAGCCTGA 11-.30 437 63oC

SSTR-1, -2, -3, -4, and -5 primer pairs were desi~led to hybridize to unique regions of the receptors. The PCR reactions for SSTRs 1-5 were carried out using 2{I of cDNA in 25 (1 total volume of PCT buffer (67 mM Tris pEi 9.01, 1.5 mM MgS04, mM AmS04, and 10 mM (mercaptoethanol) containing I mM MgCl2 (5 rnM MgCl2 for SSTRS), 0.2 mM dNTPs (Pharmacia), 5% DSMO (SSTRS only) and 100 ng of 5' and 3' primer. Taq polymerase (1.25 U, Gibco BRL). The amplification reaction was earned out in a RoboCycIer Gradient 96 (Stratagene, La Jolla, CA) for 35 cycles. Each cycle consisted of denaturation for 45 sec at 94°C, pealing for 45 sec at the relevant temperature (see Table 2), and an extension for 45 sec at '~2°C. A
final extension step at 72°C for ~ min terminated the amplification. The PCR products were separated by electrophoresis through a 1% agarose gel. The DNA was visualized and photographed using the Eagle Eye II Video System (Stratagene). The DANA fra~~cnents obtained using I 5 primers for SSTR 1, 2 and ~ were isolated from the gels and ligated Ento pGEM-T
(Stratagene, La Jolla, CA). DNA sequencing of the sub-clone was perfonmed using the -dideoxynucloetide chain-termination procedure with T7 sequenase (Phannacia Biotech -l3-PCIII~f..C~.j'~4-~ ss ..~"~ 3 ~ . S. ~~, w':sF. ~~-, t''. .~ s ~e T
Pc~r~c~~~~ooaoo ~~ i NovEM~B ' f9 .,Iso ~ESC2s ~.
x.. . ~o. ~ , ~ .~.~ r v.~ . ~ R 999 ~ ~.T.~_ ~ _ ~ ' 9 Inc.). The DNA fragments obtained using primers for SS'TR3, and 4 were eluted from the agarose gel and diagnostic restriction digest analysis performed to confirm that the PCR products were SSTR-3 and -4.
For detection of vWF in endothelial cells, oligonu~;,leotide primers with the sequence: 5'CCCACCCTTTGATGAACACA3' for the forward primer and 5'CCTCACTTGCTGCACTTCCT3' for the reverse primer were used in PCR reactions to detect von Willebrand's factor (vWF) cDNA. The PCR. reaction was performed in PCR buffer (20 mM Tris-HCI (pH8.4), SO mM KCI) cont;~ining 2.0 mM MgCl2, 0.2 mM dNTPs, (Pharmacia), 5% DSMO, and I00 ng of 5' and 3' primer with the addition of Taq polymerise (1.25 U, Gibco BRL). The 35 PCR cycles were performed as described above with an annealing temperature of 60°C. The PCR products were separated and visualized as above. The DNA fragment w;~s isolated from the gel and diagnostic restriction digest analysis was performed to confirm the PCR
product was VWF.
Example 3: Effect of an SSTRl Selective Agonist on lKuman Endothelial Cells It has been demonstrated that SS acting through S;iTRI regulates intracellular pH (Barber et al. ~ I989, J Biol. Chem. 264:21038) and that intracellular pH
in turn regulates actin stress fiber production (Tominaga et al. ~ I998, Mol. Biol.
Cell. 9:2287).
The present Example illustrates the common effects ofSSl4 and an SSTRI
selective agonist on actin bundling in endothelial cells, using fluorescently labelled phalloidin to Iocaiise actin.
To assay the effect of SS 14 on endothelial cells, ECV304 cells were washed to remove growth medium and fresh medium (lacking serum) added (Imllwell). The cells were cooled to 4°C for I 5 minutes to concentrate SSTRs at the plasma membraye prior to the addition of SS14 (IOnM, Peninsula Laboratories; Be:l~llollt, CA) to test wells while control melts received a similar volume of medium only. 'the cells were subsequently incubated at 37°C for 30 min, fixed in 4% PFA for S Illlll and washed in fl3S. The actin cyosl:eleton was visualized by incubating the cells with A.LE~A-4SS conjugated phalloidin ( 1:50, Molecular Probes Inc., Eugene, OR) for :L 5 min at room temperature.
Cells were screened using a Zeiss Axiophot microscope as, previously described. Similar ~ a ~
F?rntect 24 ~t3~1 20.01 ° '~:'. ~ ~ "'~ ~.". i ~.. ~ ~ 'ø f~~. ~ ,~.-,~ 'h '~ . ' r~ ~ 1 1 s < l n 1. . .. ", ~;~3 a ~ ~ ~~ '~ ~ ~ ~ ~ V
2~ ~'11 '199 ' "P~T'~~I193~(?Qg04 ~ ~! ~ V E M B F I SA DESC2fi '~' H E... ~~~~...... R 1999 ~1 =ii.~y~
protocols were used to evaluate the effects SSTRI selective agonists on endothelial cells.
In control ECV304 cells abundant stress fibres strE;tching the entire length of the cell and few lamellipodia were observed. The SS14-treatc;d ECV304 cells showed a loss of long stress fibers and the remaining fibers were short and lacked directional organization. In addition, there was an increase in the number and size of lamellipodia at the plasma membrane. In addition to these morphological changes, SS 14 was shown to inhibit the Na/H exchanger on ECV304 cells, as determin~°d by intracellular pH imaging This indicates that monitoring changes to the actin cytoskeleton or intracellular pH are I O rapid and simple methods to follow activation of SS receptors on endothelial cells. In some embodiments, this assay may be used to screen for SSTR1 or SSTR4 selective agonists.
Treatment of ECV304 or HLJVEC cells with the SSTR1 '499 agonist produced results similar to treatment of the cells with SS I4. The insult of SSTR1 '499 treatment was a decrease in stress fibres and an increase in lamelli;podia formation.
Treatment of ECV304 or HUVEC cells with a SSTR2 selective agonist, DC32-87 (Raynor et al.~
1993, Col. Pharmacol 43(G):838) had no effect on the endothelial cells.
Example 4: SSTIts in Human Endothelial Tissues v. .Animal Tissues In humans, the presence of mRNA for SSTRl, SSTR2 and SSTR4 (but not SSTR3 or SSTRS) was detected by RT-PCR in normal aorta, normal internal mammary artery, normal saphenous vein, and athlerosclerotic popliteal arteries. In all normal endothelial tissues, SSTRl was expressed and was the most abundant of the receptor sub-types. The expression of SSTR2 and SSTF:3 was more variable, with some individuals lacking expression of one of the two sub-types. In normal tissues, the abundance of the mRNA was lower for SSTR2 and SSTR3 compared to SSTRI .

CA 02340588 2001-02-23 . , ~ ' " ' ; '~~ ~~~ ~ s' -. , .-Pririted.~4='0't 2~a'1::

~'~~ ~ ,,gca annann lSi4 DE~C2fi P~~tc~9~~oosoo ~ I NOVEMBER r999 ~ l . I I

Human artery samples (100-400 mg) were collectE;d from bypass procedures, amputations or from human donors for organ transplantation in association with Pacific Organ Retrieval and Transplant Society with ethical permission from the Ethical Committee on Human Experimentation at the University of British Columbia.
Normal veins N=6 (greater saphenous and arm), arteries N=S (aorl:a and internal mammary) and diseased atherosclerotic or aneurysmal arteries N=3 were collected. The normal tissues used to obtain these results were as follows: 2 normal aortic samples, one from a 42-year-old woman and the second from a 19-year-old male; 3 internal mammary arteries and 3 saphenous veins from male patients ranging from 69-74 years of age. In athlerosclerotic popliteal arteries, SSTRl was also the predominant receptor with variable levels of SSTR2 and SSTR4, again there was no cwidence for the pre~,sence of SSTR3 or SSTRS. The 3 popliteal arteries were collected from male patients of 68, 72 and 73 years of age.
The vascular tissues analyzed herein include both endothelial and non-endothelial cells. In particular, non-endothelial smooth muscle cells form a substantial component of the vasculature. In a primary cell preparatiion of aortic smooth muscle cells, mRNAs for SSTR1, SSTR2 and SSTR4 were detected. In these aortic cell cultures, vWF mRNA was also detected, and vWF immunostaining (<10% of cells) was detected, indicating that the cultures included some endothelial cells.
Taken together with the results of the analysis of mRNA expression in human endothelial cells (Example 2), the results reported in this Example suggest that the SSTR2 mRNA detected in human vascular tissues originates with the non-endothelial 2~ cells in the tissues, while the SSTR1 and SSTR4 mRNA originates with the endothelial cells.
-lb-CA 02340588 2001-02-23 .~c ;, ~. p"_ " , ,.~t~~~~~ G4-~~ ~~~~r ' ~. -.- ..r v..; '~L" ~ r ~ le,.t~ r ~ i'' ,~ S ~ i'' .. : f .,~
~.. y ~ ~ r. : ~, ,1.

PGT'lGR~91008a0 ~ ISA DESG2G
~ ~ 'f 99~' ... . ...
. s:3,.~. . s~.. . 1 NOVEMBER 1999 0 ~ . I I . 9 9 ~,=t . a..
' Immunocytochemistry was used to confirm that endothelial cells in situ expressed SSTRl. In normal and diseased blood vessels endothelial cells were immunostained by SSTRl but not SSTR2 antibodies. Von Willebrand's Factor-immunoreactivity {IR) was limited to endothelial cells in normal and diseased vessels.
S For immunocytochemistry, a small portion from each vess~;,l sample was fixed in 4%
paraformaldehyde ((PFA) for lh and i0(m cryostat sections mounted on glass slides and cultured cells fixed for 10 min in PFA were used for immunocytochemistry.
Rabbit antisera to human SSTR-1 (1:100) and SSTR-2 (1:100) (C~URE/Gastroenteric Biology Center Antibody/RIA Core, NIH ,grant DK 41301) and VfTF (Sigma; 1:1000) were incubated on sections or whole cells at 4°C overnight. After washing in PBS to remove excess antibodies the bound antibodies were localized using Cy3 conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, PA.) at 1:1000 for lh at room temperature. Slides were screened using a Zeiss Axiophot microscope equipped with epifluorescence. Representative sections were digitized using a Biorad MRC b00 confocal laser scanning microscope equipped with a krypton argon laser. The resultant image stacks were converted to maximum intensity projections using NIH image (share ware) and the final images produced using Adobe Photoshop.
The results of assays of SSTRs in tissue from animal models may be contrasted with the foregoing results from human tissues {see for a background example: Chen et al. ~ 1997, ,~ Invest. Surg. 10:17). In control samples of rodent iliac arteries no detectable immunoreactivity was observed to antisera specific for SSTR-1, 2 and 3. However, after injury, SSTR-2 immunoreactivity was observed on the surface of the endothelial cells re-populating the injured site. The identity of the SSTR-2 immunoreactive cells and endothelial cells was conf rmed by double staining with a monoclonal antibody to vWF. This immunocytochemical result indicates that SSTR-2 is the active SS receptor in the rat model of arterial injury. This was confirmed with RT-PCR using primers specific for tile 5 known SSTRs. The results demonstrated that normal rat arteries expressed low levels of SSTR2 and SSTR3, but ,U IlOt SSTR1, SSTR4 or SSTRS. A competitive PCR protocol wras used to compare the levels of SSTR2 mRNA in control and injured vessels. The results using this protocol demonstrated a clear increase in expression levels of the SSTR2 receptor 7 days after balloon injury of the rat iliac arteries. Subsequent experiments demonstrated that this CA 02340588 2001-02-23 r'x , t ~ ~'~ ~ '. ,~ ; ~' t ~ ~ ' ~ ' ., .. . ~ . ~x::,~ . ~..... <..~.i n ' :,r i. ~ a ., a a S~ t i ~~t'lCt'~f.'G~ ~~-=4'~,-~0~~ >~E' hence the ability of SSTRl and SSTR4 selective agonists to inhibit intimal hyperplasia in humans.
Exampie 5: Therapeutic Formulatious In one aspect, the invention provides a variety of therapeutic uses for SS
agonists. In various embodiments, SSTR1 and SSTR4 selective agonists may be used therapeutically in formulations or medicaments for the treatment of human I O endothelial-cell-mediated proliferative diseases, such as pathological angiogenesis and intimal hyperplasia, including cancers susceptible to SSTRI and SSTR4 selective agonists {such as susceptible solid tumors). The invention provides corresponding methods of medical treatment, in which a therapeutic do;>e of a SS agonist is administered in a pharmacologically acceptable formulation. Accordingly, the 15 invention also provides therapeutic compositions comprising a SS agonist and a pharmacologically acceptable excipient or carrier. The therapeutic composition may be soluble in an aqueous solution at a physiologically acceptable pH. In one aspect of the invention, SSTRl and/or SSTR4 selective agonists may be administered using a perforated balloon catheter, as disclosed in International Patent Publication VVO
20 93/088f 6 of i 3 May 1993, which is hereby incorporated by reference.
The invention provides pharmaceutical compositiions (medicaments}
containing (comprising) SS agonists. In one embodiment, such compositions include a SS agonist compound in a therapeutically or prophylactically effective amount 25 sufficient to alter, and preferably inhibit, production of gamma interferon, and a pharmaceutically acceptable carrier. In another embodirrient, the composition includes a SS agonist compound in a therapeutically or prophylactically effective amount sufficient to inhibit angiogenesis, and a phannaceuticaliy acceptable cawier.
30 The SSTRl and SSTR4 selective agonists may b~~ used in combioaUon with other compositions and procedures for the treatment of diseases. For example, a tumor may be treated conventionally with photodynamic therapy, surgery, radiation or chemotherapy combined with a SSTRl or SSTR4 selective agonist, and then a SSTRI
- is -t~
f'riritecl 24 'Q1 2.01 ' a°~ g ~ ~ ~°~~~~ ~'~' F'.'~ Ea ~ ~~
~y:~ '~~' . ; , ;e:.a !~~ .,~ ? 1 / f! ~1,. n w ~ ~ ~ gg~ P~~'IC~199100800~1SA DESC2fi ' ~~. _ ._=.,.e. . ~ . _ . .
~t _.. :, , ~ p I NOVEMBE R 1999 ~ I . 1 I . 9 Q
or SSTR4 selective agonist may be subsequently administered to the patient to extend the dormancy of micrometastases and to stabilize and inhibit the growth of any residual primary tumor.
A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as reduction or reversal of angiogenesis in the case of cancers, or reduction or inhibition intimal hyperplasia. A therapeutically effective amount of SS agonist may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the SS agonist to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A_ therapeutically effective amount is also one in which an.y toxic or detrimental effects of the SS agonist are outweighed by the therapeutically lbeneficial effects.
A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as preventing or inhibiting the rate of metastasis of a tumour or the onset of intimal hyperplasia. A prophylactically effective amount can be determined as described above for the therapeutically effective amount. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
In particular embodiments, a preferred range for therapeutically or prophylactically effective amounts of a SSTRI or SSTR:4 selective agonist may be 0.1 nM-O.1M, 0.1 nM-O.OSM, 0.05 nM-15~M or 0.41 nM-IOpM. Alternatively, total daily dose may range from about 0.001 to about lmg/k~; of patients body mass.
Dosage values may vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be 3(> adjusted over tune according to the individual need and the professional judgement of the person administering or supervising the administration of the compositions, and that dosage ranges set forth herein are exemplary only a.nd are not intended to limit the scope or practice of the methods of the invention.
_ lg _ CA 02340588 2001-02-23 Kv- ~. :. ~, ~ g",.". ~ - r. r ;:. ;-~t, t .~~ .
'prEritei~.24-01 ~. ~~ ..' ~~ ~ h ~ ~~ ~.~ ~~-..~' t'm ~~::, ~ ;
~.::

ISA DESC2fi=.::
Q l~ NOVEMBER 1999 0 i;, L 1 -. 9 9 The amount of active SSTR selective agonist in a therapeutic composition may vary according to factors such as the disease state, a;ge, sex, and weight of the individual. Dosage regimens may be adjusted to provide 'the optimum therapeutic S response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment: of sensitivity in individuals.
As used herein "pharmaceutically acceptable carc~ier" or "excipient" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that: are physiologically compatible. In one embodiment, the carrier is suitable for parenteral administration.
Alternatively, the carrier can be suitable for intravenous, intraperitoneal, intramuscular, sublingual or oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion: The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent i:> incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a ,~ ~ ~ ~ ~ °~ ~ ~' ' ~~
'('rrr~t~ct 24=(?'t 2~0'! ' ~, ~ ~ n:
w.

. s v..i t l ~..~a 't '' ' ~.Uv ~~~~~~~s~oog~o- ~ 0 V E ~ B ~ R 1999 0 I , ~s~ Q ~s~ ~s solution, microeinulsion, iiposome, or other ordered structure suitable to high drug concentration. The carrier can be a solvent or dispersion medium containing, for example; water, ethanol, polyol (fox example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like); and suitable mixtures l:hereof. The proper fluidity can be maintained, for example, by the use of a coating stach as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include; isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin. Moreover, the SS agonists can be administered in a time release formulation, for example in a composition which includes a slow release polymer. The active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic copolymers (PLG). Many methods for the preparation of such formulations are patented or generally known to those skilled in the art.
Sterile injectable solutions can be prepared by incorporating the active compound (e.g.SS agonist) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions., the preferred methods of preparation are vacuum drying and freeze-drying which :yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. In accordance with an alternative aspect: Of thL
lIlvl;ntlOll, a SS
agonist may be formulated with one or more additional compounds that enhance the solubility of the SS agonist.

CA 02340588 2001-02-23 _ _ _ ~~1~Y~CItGG~~~4:~ ~G~~:"1'~; ~ ~ ~ , 5; ;~ t, t, ~~ ~ v..fi~ ~ W n ., n n ~~ ~~ ~s~s ~cTic~~stoosoo;- ~s~ ~~sc2s ~. . .z . . . . . ~.. > 3 . . ~... ... y~~ ~ ~ N p V E M B F R 199 0 I . 1 1 .

A further form of administration is to the eye. An SSTRI or SSTR4 selec ~ a agonist may be delivered in a pharmaceutically acceptable ophthalmic vehicle, such that the compound is maintained in contact with the ocular surface for a sufficient time period to allow the compound to penetrate the corneal and internal regions of the eye, as for example the anterior chamber, posterior charr~ber, vitreous body, aqueous humor, vitreous humor, cornea, iris/ciliary, lens, choroidlretina and sclera.
The pharmaceutically-acceptable ophthalmic vehicle may, for example, be an ointment, vegetable oil or an encapsulating material. Alternatively., the compounds of the invention may be injected directly into the vitreous and aqueous humour. In a further alternative, the compounds may be administered systemiically, such as by intravenous infusion or injection, for treatment of the eye. In some embodiments, anti-angiogenic treatment with SSTRl or SSTR4 agonists may be underl:aken following photodynamic therapy (such as is described in U.S. 5,98,349 issued 25 August 1998, incorporated herein by reference).
In accordance with another aspect of the invention, therepeutic compositions of the present invention, comprising SSTRi or SSTR4 selective agonists, may be provided in containers having labels that provide instructions for use of SSTR1 or SSTR4 selective agonists to treat endothelial-cell-mediated proliferative diseases.

~PrErited.24 ~~1 2 ~ ~ ~~ ~..~., , 22°=' v . :. ~ - a-.-~ .

Claims (23)

WHAT IS CLAIMED IS:

1. The use of a SSTR1 selective agonist to formulate a medicament for use to treat intimal hyperplasia in a human patient.

2. The use of a SSTR1 selective agonist to formulate a medicament for use to treat age-related macular degeneration in a human patient.

3. The use of a SSTR4 selective agonist to formulate a medicament for use to treat intimal hyperplasia in a human patient.

4. The use of a SSTR4 selective agonist to formulate: a medicament for use to treat age-related macular degeneration in a human patient.

5. The use of a SSTR1 selective agonist to formulate a medicament for use to inhibit angiogenesis in a human patient.

6. The use of a SSTR4 selective agonist to formulate a medicament for use to inhibit angiogenesis in a human patient.

7. The use of a SSTR1 selective agonist to formulate: a medicament for use to have an anti-angiogenic effect on endothelial cells in a human patient.

8. The use of a SSTR4 selective agonist to formulate; a medicament for use to have an anti-angiogenic effect on endothelial cells in a human patient.

9. The use of a SSTR1 selective agonist to formulate a medicament for anti-angiogenic treatment following photodynamic therapy in a human patient.

10. The use of a SSTR1 selective agonist to formulate a medicament for use to treat a disease selected from the group consisting of proliferative retinopathies, diabetic retinopathy, retinopathy of prematurity, corneal graft rejection, retrolental fibroplasia, neovascular glaucoma, rubeosis, retinal neovascularization due to macular degeneration, hypoxia, angiogenesis in the eye associated with infection or surgical intervention, abnormal neovascularization conditions of the eye, angiogenic aspects of skin diseases, psoriasis, hemagiomas, capillary proliferation within atherosclerotic plaques, Osler-Webber Syndrome, myocardial angiogenesis, atherosclerotic plaque neovascularization, telangiectasia, hemophiliac joints', angiofibroma, wound granulation, intestinal adhesions, Crohn's disease, atherosclerosis, scleroderma, hypertrophic scars, keloids, cat scratch disease and ulcers in a human patient.

11. The use of a SSTR4 selective agonist to formulate a medicament for anti-angiogenic treatment following photodynamic therapy in a human patient.

12. The use of a SSTR4 selective agonist to formulate a medicament for use to treat a disease selected from the group consisting of: angiogenic aspects of skin diseases, psoriasis, hemagiomas, capillary proliferation within atherosclerotic plaques, Osler-Webber Syndrome, myocardial angiogenesis, atherosclerotic plaque neovascularization, telangiectasia, hemophiliac joints', angiofibroma, wound granulation, intestinal adhesions, Crohn's disease, atherosclerosis, scleroderma, hypertrophic scars, keloids, cat scratch disease and ulcers in a human0 patient.

13. The use of a SSTR4 selective agonist to formulate a medicament for use to treat a disease selected from the group consisting of: proliferative retinopathies, diabetic retinopathy, retinopathy of prematurity, corneal graft rejection, retrolental fibroplasia, rubeosis, retinal neovascularization due to macular degeneration, hypoxia, angiogenesis in the eye associated with infection or surgical intervention, abnormal neovascularization conditions of the eye in a human patient.

14. The use of a SSTR4 selective agonist to formulate a medicament for use to treat solid tumours.

15. The use of a SSTR4 selective agonist to formulate a medicament for use to inhibit solid tumour vascularization.

016. The use of a SSTR1 selective agonist to formulate a medicament for use to inhibit solid tumour vascularization.

I7. The use of a SSTR1 selective agonist to formulate a medicament for use to treat an endothelial-cell-mediated proliferative disease in a human patient.

18. The use of a SSTR4 selective agonist to formulate a medicament for use to treat an endothelial-cell-mediated proliferative disease in a human patient.

19. The use of the SSTR1 selective agonist according to any one of claims 1, 2, 5, 7, 9, 10, 16 and 17, wherein the SSTR1 selective agonist is des-AA 1,2, [DTrp8 ,IAamp9]SS.

20. The use of a somatostatin receptor ligand to formulate a medicament for use to treat an endothelial-cell-mediated proliferative disease in a human patient, wherein the somatostatin receptor ligand binds with greater affinity to SSTR1 than to any other somatostatin receptor.

21. The use of a somatostatin receptor ligand to formulate a medicament for use to treat an endothelial-cell-mediated proliferative disease in a human patient, wherein the somatostatin receptor ligand binds with greater affinity to SSTR4 than to any other somatostatin receptor.

22. The use of a somatostatin receptor ligand to formulate a medicament for use to have an anti-angiogenic effect on endothelial cells in a human patient, wherein the somatostatin receptor ligand binds with greater affinity to SSTR4 than to any other somatostatin receptor.

23. The use of a somatostatin receptor ligand to formulate a medicament for use to have an anti-angiogenic effect on endothelial cells in a human patient, wherein the somatostatin receptor ligand binds with greater affinity to SSTR1 than to any other somatostatin receptor.