CA2337492A1

CA2337492A1 - Delta-related polypeptides

Info

Publication number: CA2337492A1
Application number: CA002337492A
Authority: CA
Inventors: John R. Shutter; Kevin L. Stark
Original assignee: Individual
Current assignee: Amgen Inc
Priority date: 1998-07-27
Filing date: 1999-07-12
Publication date: 2000-02-10
Also published as: JP2002523018A; WO2000006726A3; EP1100899A2; WO2000006726A2; AU4870599A

Abstract

Nucleic acid sequences are disclosed which encode polypeptide members of the Delta family of mammalian membrane surface-bound ligands; such sequences can be used, among other things, for chromosome mapping and analysis and to produce the polypeptides in abundance by recombinant expression of the corresponding DNA molecules.

Description

DELTA-RELATED POL~YPEPTIDES
FIELD OF THE INVENTTON
5 This invention relates to novel mammalian polypeptide members of the cell development cycle protein family known as "Delta", to the corresponding nucleic acids, and to methods of: making and using the nucleic acid molecules and polypeptides.
BACKGROUND OF THE TNVENTION
The Notch gene family encodes transmembrane receptors that control cell fate: decisions; see review 15 in Fleming et al., Trends in Cell Biology, Volume 7, pages 437-441 (1997). Currently, there are at least four known members of this family in the human, which are designated as Notchl, Notch2, Notch3 and Notch4;
for reference, see Ellisen et al., Cell, Volume 66, 20 pages 649-661 (1991); Katsanis ea al., Genomics, Volume 35, pages 101-108 (1996); Joutel et al., The Lancet, Volume 350, pages 1511-1515 (1997); and Uyttendaele et al., Development, Volume 122, pages 2252-2259 (1996), respectively. Many of the known. actions of Notch 25 signaling have been documented during the development of lower organisms, such as worms and flies, but increasing attention is now being devoted to the role that these receptors may play during mammalian embryogenesis; Lewis, Current Opinion in Neurobiology, 30 Volume 6, pages 3-10 (1996). However, relatively little is known about the function of these receptors in the biology of the adult mammal at present.

The activation of the Notch receptors can be accomplished by ligands belonging to the Delta and Jagged gene families. These genie products also contain transmembrane domains, and the interaction of the 5 ligand with the receptor most likely occurs via cell to cell contact. Perhaps the most well-documented case of Delta-Notch signaling occurs in the production of neural precursor cells in Drosop~hila. Since the absence of Delta-Notch signaling results in an 10 excessive production of neuronal cells, this signaling pathway is thought to inhibit th.e differentiation of precursors in a process known as lateral specification;
see Lewis, above. This process allows a defined population of cells to adopt one particular cell fate, 15 while allowing adjacent cells to avoid that commitment.
There have been two Delta ligands reported for the mouse, namely, Delta-like 1 (also referred to as "Dlll~~) and Delta-like 3 (also referred to as "D113~~).
20 These genes are primarily expressed in the neuroectoderm and the presomitic mesoderm, and are thought to function in the formation of the nervous and musculoskeletal systems; see Dumwoodie et al., Development, Volume 124, pages 3065-3076 (1997).
SUMMARY OF THE IPTVENTION
This invention is based on the discovery and isolation of novel nucleic acids encoding polypeptides 30 from mouse and human species which can be considered members of the Delta family of ligands.
Previously, vertebrate Notch ligands have been divided into two classes: Delta .and Serrate; see Nye and Kopan, Current Biology, Volwme 5, Number 9, pages 966-969 (1995). The polypeptide members of both families contain a signal sequence, an amino-terminal Delta-Serrate-Lag (DSL) domain, a series of EGF-like repeats, and a single transmemb:rane (hydrophobic) domain. The Serrate family members also contain a cysteine-rich region in the extracellular portion and inserts that interrupt some of the EGF-like repeats.
Characteristic of the Delta cla:as, full length polypeptides in accordance with the present invention contain a signal sequence, a DSI:. domain, EGF-like repeats, and a transmembrane dornain, but do not contain inserts 'that interrupt some of t:he EGF-like repeats or an extracellular cysteine-rich z°egion. Moreover, the amino acid sequence of the present murine polypeptide is approximately fifty percent identical to that of murine D111 and, like D111, contains eight EGF-like repeats. Consequently, the pol~~eptides of this invention can be considered memx>ers of the Delta family.
The highly specific expres.>ion pattern of the newly discovered murine gene within vascular endothelium, coupled with the known actions of other members of the Delta family, indicate a role fox the present polypeptides in the control of endothelial cell biology.
Studies relating to Notch-Deita signaling in non-human species indicate that such receptor-ligand interactions are central to vertebrate neurogenesis and influence the development of precursor cells for the retina and central nervous system; Nye et al., Current Biology, and Lewes, Current Opinion in Neurobiology, above. Other studies suggest treat Notch signaling is also involved in the regulation of fibroblast growth factor-induced angiogenesis; zimrin et al., Journal of Biological Chemistry, Volume 271., Number 51, pages 32499-32502 (1996). Moreover, cerebral autosomal dominant ateriopathy with subcortical infarcts and leucoencephalopathy (CADASIL), <~n autosomal dominant disorder that causes ischaemic :>trokes in adults, has 5 recently been traced to a mutational defect in the Notch3 gene. Joutel et al., Lancet, above.
Based on such information, the current understanding of Notch behavior has lead to the belief 10 that Notch controls the ability of precursor cells to progress to the next differentiated state, most likely through interaction with ligands~ such as Delta, among others. Thus, Delta polypeptidea are thought to play a key role in cell development.. Ntoreover, the 15 possibility that malfunctions in. Notch-Delta signaling and the Delta genes may result in one or more diseases or disorders suggests fertile ground for further research and study.
20 In view of the foregoing, the full length DNA
sequences given herein, or subsequences thereof, may be used for chromosome identification and gene mapping (.not unlike an EST), which is a utility of the present invention. In such applications, a key objective would 25 be to determine whether the gene falls within a known area of a chromosome linked to a genetic disease or disorder, and whether the gene itself is responsible for the abnormality. Such studies can be carried out with the murine as well as human sequences. For 30 instance, information regarding the murine gene and its biology may be useful for understanding the human gene if abnormalities associated with the gene in mice have counterparts in humans.
35 Other potential uses for the molecules of this invention are delineated further below, including use of the polypeptides to identify a corresponding receptor or receptors (possibly in the Notch family).
Still other uses of the nucleic acid and polypeptide molecules of this invention will become clearer over time, based on further elucidation of the biological activity of the polypeptides of this invention, particularly in light of the prE~sent description.
This invention also includE~s biologically active fragments and analogs of the aforementioned polypeptides, DNA molecules enccEding such fragments and analogs, as well as derivatives of such polypeptides as further described below.
Additionally, this invention includes vectors for the recombinant expression of th,e above mentioned nucleic acid molecules in heterologous host cells, as well as host cells which have been modified (e.g., by transfection or transformation) to contain such expression vectors.
In addition, this invention comprises methods for the recombinant production of the polypeptides, fragments and analogs mentioned .above, including the steps of expressing the polypeptide, fragment or analog encoded by a DNA molecule in a host cell and collecting the resulting expression product.
As a still further aspect of the invention, the 3Q present polypeptides can be used in methods and Systems for the identification of receptors which bind to and/or are activated by the polypeptides. Such receptors may be found, for instance, on the surface of adjacent cells that come into contact or proximity with the present polypeptides, which are membrane bound in their naturally occurring state.

- 6 _ Z3RIEF DESCRIPTION OF' THE FIGURES
FIGURE 2 (A-B). This figure depicts the DNA
sequence encoding a marine polypeptide of .this invention. The portion encoding the transmembrane region of the marine polypeptidES is underlined.
FIGURE 2. This figure depicts the amino acid sequence for the marine polypept:ide encoded by the DNA
molecule of Figure 1A-2B, inclue3ing a putative signal peptide region (amino acids 1--22, 1-23, 1-24, 1-25, 1-26, or 1-27), a putative extracellular domain (amino acids 23-532, 24-532, 25-532, 2E~-532, 27-532, or 28-532), a transmembrane region (amino acids 533-553), and an intracellular/cytoplasmic portion (amino acids 554-686). The transmembrane region is underlined.
FIGURE 3 (A-B). This figure depicts the DNA
sequence encoding a human polype;ptide of this invention The portion encoding the transme:mbrane region of the polypeptide is underlined.
FTGURE 4. This figure depicts the amino acid sequence for the human polypeptide encoded by the DNA
molecule of Figure 3A-3B, including a putative signal peptide region (amino acids 1123; 1-24; 1-25; or 1-26, 1-27, or 1-28), a putative extracellular domain (amino acids 24-531, 25-531, 26-531, 27-531, 28-531, or 29-531), a transmembrane region (am,ino acids 532-552), and intracellular/cytoplasmic portion (amino acids 553 685). The transmembrane region is underlined.
FIGURE 5 (A-P). This figure depicts the expression pattern of messenger RNA (mRNA) for the marine polypeptide in various adult mouse tissues, as analyzed by in situ hybridization using a '3P-labeled riboprobe.
FIGURE 6 (A-P). This figure depicts the 5 expression pattern of mRNA for the murine polypeptide in various adult mouse tissues, as analyzed by in situ hybridization using a 33P-labeled riboprobe.
FIGURE 7 (A-D). This figure depicts the 10 expression pattern of mRNA for i~he murine polypeptide in mouse embryos at ten and one--half days {Figs. A and B) and eleven and one-half days (Figs. C and D) after fertilization, as analyzed by in situ hybridization using a 33P-labeled riboprobe.
DETAILED DESCRIPTION OF THE INVENTION
As indicated, a novel member of the human Delta family, and its murine counterpart, are provided by this invention. This discovery resulted from the identification of polymerase chain reaction (PCR) fragments isolated from a murine: white adipose tissue cDNA library. As illustrated by the working examples 25 given further below, the PCR fragments enabled the identification of the full length nucleic acid sequence encoding the murine polypeptide of this invention (SEQ
ID N0: 1) and its predicted amino acid sequence (SEQ ID
N0: 2). Probes prepared from th.e murine sequence were 30 then used to screen a human brain cDNA library, leading to the isolation and identification of a full length nucleic acid sequence (SEQ ID NO: 3) encoding a counterpart human polypeptide (SEQ ID NO: 4).
35 Using hydrophobicity analysis; the leader ("signal") sequence for the murine polypeptide is likely to comprise amino acids 1-22, 1-23, 1-24, 1-25, 1-26, 1-27, or 1-27. The first amino acid of the "mature" polypeptide is likely to be 23 (Q), 24 (R), 25 (A), 26 (A), 27 (G), or 28 (S). The beginning of the 5 transmembrane domain appears to be located at position 533 (V). The end of the transme:mbrane domain appears to be located at position 553 (V). At a minimum, what is needed for biological activity is the extracellular domain of the mature polypeptid~e, specifically, amino 10 acids 23 (Q), 24 (R), 25 (A), 26 (A), 27 (G), or 28 (S) through amino acid 532 (A). Thus, murine polypeptides in accordance with this invention will include any of those having the following amino acids:
15 (a) 1-686 (SEQ I7~N0: 2) , (b) 23-532 (SEQ I)7NO: 5), (c) 24-532 (SEQ I7DN0: 6), (d) 25-532 (SEQ Io No: 7), (e) 26-532 (SEQ I7DNO: 8) , 20 (f) 27-532 (SEQ I NO: 9), (g) 28-532 (SEQ IlDN0: 10) (h) 23-553 (SEQ I7DN0: 11) , (i) 24-553 (SEQ IlDNO: 12) , ( j ) 25-553 (SEQ I1DNO: 13 ) , 25 (k) 26-553 (SEQ I~7NO: 14) , (1) 27-553 (SEQ I)7NO: 15), (m) 28-553 (SEQ I7DNO: 16), (n) 23-686 (SEQ I1DNO: 17) , (o) 24-686 (SEQ I7DN0: 18) , 30 (p) 25-686 (SEQ I7DN0: 19) , (q) 26-686 (SEQ I~3N0: 20), (r) 27-686 (SEQ I7DN0: 21), and (s) 28-686 (SEQ I~~N0: 22) 35 with or without an amino(N)-terminal methionyl residue (-1) .

_ 9 _ The leader ("signal") sequence for the human polypeptide y to comprise is likel amino acids 1-23, 24, 1-25, 1-26, or 1-28. ~rhe first amino acid 1-27 of the "mature" polypep tide is ik~sly to be 24 (A), 25 l (A) , 26 (G) 27 (S) or 28 , , (G) , or 29 (V) .
The beginning of the transmembrane domain appears to be located at 532 (V) ThES end of the position .

transmembrane domain appears to be located at position 552 (V). At a minimum, is needed is the extra-what cellular doma in of e" polypeptide, the "matur specifically, amino (A), 25 (A), 26 (G), 27 acids (S), or 28 ), or (G 29 (V) through amino acid (A).

Therefore, polypeptidEa the human of this invention include those having the followi.ng'amino acids:

(a) 1-685 (SEQ ID N0: 4), (b) 24-531 (SEQ ID NO: 23), (c) 25-531 (SEQ ID N0: 24), (d) 26-531 (SEQ TD NO: 25), (e) 27-531 (SEQ ID~ N0: 26), (f) 28-531 (SEQ ID~ N0: 27) , (g) 29-531 (SEQ ID N0: 28), (h) 24-552 (sEQ ID No: 29), (i) 25-552 (SEQ ID N0: 30), (j) 26-552 (SEQ ID NO: 31), (k) 27-552 (SEQ ID N0: 32), (1) 28-552 (SEQ ID NO: 33), (m) 29-552 (SEQ ID N0: 34), (n) 24-685 (SEQ ID N0: 35), (o) 25-685 (SEQ ID N0: 36), (p) 26-685 (SEQ ID NO: 37), (q) 27-685 (SEQ ID N0: 38), (r) 28-685 (SEQ ID NO: 39), and (s) 29-685 (SEQ ID No: 40) with or without an N-terminal methionyl residue (-1).
Tissue distribution analysis in mice (Example 5, below) demonstrates that the presence of nucleic acids 5 encoding the polypeptide is fairly ubiquitous, with gene expression being highest in the lung, followed by heart, kidney, skeletal muscle and brain, and to a lesser extent, the spleen and testis.
10 The present invention provides purified and isolated'polypeptide products having part or x.11 of the primary structural conformation (i.e., continuous sequence o_f amina acid residues) and one or more of the biological properties (e. g., immunological properties 15 and biological activity) and physical properties (e. g., molecular weight) of the naturally-occurring (human and murine) polypeptides of this invention, including allelic variants thereof. The term "purified and isolated" herein means substantially free of unwanted 20 substances so that the present p~olypeptides are useful for an intended purpose. For example, one may have a recombinant polypeptide substantially free of other human (or murine) proteins or pathological agents.
These polypeptides are also characterized by being a 25 product of mammalian cells, or the product of chemical synthetic procedures or of prokaryotic or eukaryotic host expression (e. g., by bacterial, yeast, higher plant, insect and mammalian cells in culture) of exogenous DNA sequences obtained by genomic or cDNA
30 cloning or by gene synthesis. T:he products of expression in typical yeast (e. g., Saccharomyces cerevisiae), insect, or prokaryote (e. g., E. coli) host cells are free of association with any mammalian proteins. The products of expression in vertebrate 35 (e.g., non-human mammalian such .as COS or CHO, and avian) cells are free of association with any human (or murine) proteins. Depending upon the host employed, and other factors, polypeptides in accordance with this invention may be glycosylated with mammalian or other eukaryotic carbohydrates or may be non-glycosylated.
One may modify the nucleic acid so that glycosylation sites are included in the resulitant polypeptide. One may choose to partially or fully deglycosylate a glycosylated polypeptide. The polypeptides may also include an initial methionine amino acid residue (at position -1 with respect to the first amino acid residue of the mature polypeptide).
In addition to naturally-occurring allelic forms of the polypeptide, the present invention also embraces other products such as polypepti.de analogs. For instance, modifications of cDNA and genomic genes may be readily accomplished by well-known site-directed mutagenesis techniques and employed to generate analogs which differ in the primary conformations herein specified in terms of the identity or location of one or more residues (e.g., substitutions, terminal and intermediate additions and deletions). Such products would share at least, one of the biological properties of the naturally occurring polypeptide but may differ in others. As examples, projected products of the invention include those which are foreshortened by e.g., deletions (i.e., fragments or subsequences); or those which are more stable to hydrolysis (and, therefore, may have more pronoun~~ed or longer lasting effects than naturally-occurring); or which have been altered to delete one or more potential sites for glycosylation (which may result :in higher activities for yeast-produced products); or which have one or more cysteine residues deleted or rep:Laced by, e.g.; alanine or serine residues and are poteni~ially more easily isolated in active form from microbial systems; or which have one or more tyrosine residues replaced by phenylalanine; or have an altered lysine composition (such as those prepared for purposes of derivatization). Included are those polypeptides with amino acid substitutions which <~re conservative according to acidity, charge, hydrophobicity, polarity, size, or any other characteristic known to those skilled in the art. One may make changes in selected amino acids so long as such changes preserve the overall folding or activity of t:he protein, as discussed in greater detail fort;her below. Small amino terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facili-tates purification, such as a poly-histidine tract, an antigenic epitope or a binding domain, may also be present. See, in general, Ford et al., Protein Expression and Purification Volume 2, pages 95-107 (1991).
One may also prepare soluble forms of the polypeptides of (a) above, human or marine, by elimination of the transmembrane and intracellular regions; see (b), above, in this regard.
Of particular interest herein is the human polypeptide (SEQ ID N0: 4) and its fragments, analogs and derivatives, as well as DNA molecules encoding such polypeptides. However, as will be seen, the marine counterpart (SEQ ID N0: 2) may a:Lso be useful for the same or similar purposes.
Polvzaeptide Analoc~s_ In addition to the polypeptides of the particular sequences delineated above, and fragments thereof, also intended as part of this invention are analogs of such polypeptides which are biologically equivalent or share one or more biological properties. By "biologically equivalent" is meant having the same properties of the 5 polypeptides described herein. Preferably, such analogs will cross-react with antibodies raised against the polypeptide of SEQ ID NO: 4.(or of SEQ ID NO: 2).
The term "analog" as appliE~d to the polypeptides of this invention is specifically intended to mean molecules representing one or more amino acid substitutions, deletions and/or additions derived from the linear array of amino acids of the full length polypeptide SEQ ID N0: 4 (or of SEQ ID NO: 2), and 15 which are also substantially biologically equivalent or share one or more biological properties.
Especially preferred polypeptide analogs in accordance with this invention a:re those which possess 20 a degree of homology (i.e., iden.tity of amino acid residues) with the polypeptide of SEQ ID N0: 4 (or of SEQ ID NO: 2) or in excess of eighty percent ($0~), and most preferably, in excess of ninety percent (90$) or ninety-five (95~).
Percent sequence identity can be determined by standard methods that are commonly used to compare the similarity the amino acids of two polypeptides in order to generate an optimal alignment of two respective 30 sequences. By way of illustration, using a computer algorithm such as BLAST, BLAST2, or FASTA, the two polypeptides for which the percent identity is to be determined are aligned for optimal matching of their respective amino acids (the "matched span", which can 35 include the full length of one o:r both sequences, or along a pre-determined portion o:f one or both WO 001Ob726 PCTNS99/15710 _ 14 _ sequences). Each computer algorithm provides a "default" opening penalty and a "default" gap penalty, and a scoring matrix such as PAIK 250 (for FASTA) or BLSUM 62 (for BLAST algorithms). A preferred algorithm for the purposes of this invention is BLAST2.
A standard scoring matrix c:an be used in conjunction with the computer algorithm; see Dayhoff et al. in Atlas of Protein Sequence and Structure, Volume 10, 5, Supplement 3 (1978). The percent identity can then be determined using an algorithm such as contained in FASTA, as follows:
Total number of identical matches X 100 [Length of the longer sequence within the matched span] +
[Number of gaps introduced into the longer sequence in order to align the two sequences]
Analog polypeptides in accordance with this invention that are at least eighty percent identical to "wild types sequence of Figure 4 (or of Figure 2) will typically have one or more amino acid substitutions, deletions and/or insertions, compared with the wild type. Usually, the substitutions will be conservative so as to have little or no effect on the overall net charge, polarity or hydrophobiciity of the polypeptide.
Examples of conservative substitutions are set forth below.

Tabl E~",1_ Conservative Amino Acid Substitutions Bas is : arg.inine lys :ine hisitidine Acidic: glui~amic acid aspartic acid Polar : glut:amine asparagine Hydrophobic : leuc:ine iso7.eucine val .i.ne Aromatic: phenylalanine try~rtophan tyrosine Small: glycine alan.ine serine threonine meth.i onine When making substitutions (or omissions) of particular amino acid residues within the naturally occurring (i.e., "native") amino acid sequence of the wild type, relatively conservative substitutions are preferred so as not to adversely affect desired biological properties to any substantial degree. Thus, for example, residues or regions which are known or suspected to be involved in rece7ptor specificity or heparin binding should generally be avoided if alterations in these sites will detract from these properties.

_ - ~6 -zn general, polypeptide fragments and analogs in accordance with this inventionwill be useful for the same purposes for which the pol:ypeptide.of SEQ ID N0: 4 (or SEQ ID N0: 2) is useful.
Nucleic Acids According to another aspeci: of the present 10 invention, the DNA sequences described herein which encode 'the polypeptides are useful in generating new and useful DNA vectors, transfox-med and transfected prokaryotic and eukaryotic host cells (including bacterial cells, yeast cells, insect cells, and 15 mammalian cells grown in culture), and methods for cultured growth of such host cells capable of expression of the polypeptides a.nd related products.
In addition to (a) the DNA molecules of Figure lA-20 1B (SEQ TD N0: 1) and Figure 3A-3B (SEQ ID N0: 3), also intended as part of this invention are (b) naturally occurring allelic variants thereof which encode the same polypeptides, (c) DNA molecules which selectively hybridize to any such DNA sequences, and (d) DNA
25 molecules which, but for the degeneracy of the genetic code, would hybridize to any DNA of (a), (b) and (c).
Complementary sequences of the foregoing DNA
molecules, or subsequences thereof, may be used to 30 screen cDNA or genomic libraries to isolate the nucleic acid molecules of SEQ ID N0: 1 and SEQ ID N0: 3 and naturally occurring allelic variants thereof for use in recombinant expression (or for modification as described below). Alternatively, nucleic acid 35 molecules encoding the same polypeptides can be made prepared by chemical synthesis uaing methods well known ' WO 00/06726 PCT/US99/15710 to the skilled artisan, such as those described by Engels et al. in Angew. Chem. Intl. Ed., Volume 2$, pages 716-734 (1989). Such methods include, inter alia, the phosphotriester, phosphoramidite and H-phosphonate methods for nucleic acid synthesis. A
preferred method involves polymer supported synthesis using standard phosporamidite chemistry. Usually, DNA
molecules encoding the polypepti.des of this invention will be several hundred nucleotides in length. Nucleic acid molecules larger than about: one hundred nucleotides can be synthesized ass several fragments in accordance with these methods, a.nd the fragments can them be ligated together to form a full-length molecule encoding the entire polypeptide.
Optionally, the portion of DNA encoding the amino (N) terminus of the polypeptide will contain an "ATGn codon, which encodes a methionine residue.
Variant nucleic acid molecules having sequences which differ from the naturally occurring ones and encode polypeptide analogs in accordance with this invention may be produced using ;site specific mutagenesis, PCR amplification, or other appropriate - 25 methods known to those skilled in the art; see, for instance, Sambrook et al., Molecular Cloning: A
Laboratory Manual, Cold Spring H<~rbor Laboratory Press, Cold Spring Harbor, New York (19139). Such variants would also include those contain_Lng nucleotide substitutions accounting for codon preference in the host cell being employed for expression.
The present invention also Embraces nucleic acid molecules that may encode additional amino acid residues flanking the 5' or 3' portions of the region encoding the "mature" polypeptidE: (that is, the WO OO/OG726 PCT/US99/1S?10 ~g _ processed expression product harvested from the host), such as sequences encoding alternative pre/pro regions (that is, sequences responsible for secretion of the polypeptide through cell membranes) in place of the 5 "native" pre/pro regions. The additional sequences may also constitute noncoding sequences, including regulatory sequences such as promoters of transcription or translation, depending on the host cell. The nucleic acid molecules may even include various 10 internal non-coding sequences (i.ntrons) known to occur within genes.
The nucleic acid molecules of this invention (whether genes or cDNAs) can be inserted into a 15 suitable expression or amplification vector using standard ligation techniques. The vector is selected to be functional in the particular host employed (i.e., the vector is compatible with th.e host cell machinery, such that amplification and/or expression of the 20 nucleic acid encoding the polypeptide can occur). The polypeptide, fragment or analog may be amplified or expressed in prokaryotic, yeast, insect (baculovirus systems) and/or eukaryotic host cells, or in transgenic non-human animal species as the :host. Selection of the 25 host cell will depend at least i:n part on whether the polypeptide expression product is to be glycosylated and/or phosphorylated. If glyco~sylation and/or phosphorylation is desired, then yeast, insect or mammalian host cells are preferred for use, in that 30 yeast cells will glycosylate the polypeptide, and insect and mammalian cells can g:Iycosylate and/or phosphorylate the polypeptide in a manner similar to "native" glycosylation and/or phosphorylation.
35 The vectors used in any of i~he host cells to express the polypeptide may also contain a 5' flanking WO 00/06726 _ 19 _ PCT/US99/15710 sequence (also referred to as a "promoter") and other expression regulatory elements operatively linked to the nucleic acid molecule (DNA) to be expressed, as well as enhancer(s), an origin cof replication element, a transcriptional termination element, a complete intron sequence containing a donor and acceptor splice site, a signal peptide sequence, a ribosome binding site element, a polylinker region for inserting the nucleic acid encoding the polypE:ptide to be expressed, and a selectable marker element, as discussed in greater detail further below.
5 ' ~'~nking Sequence The 5' flanking sequence may be the native 5' flanking sequence, or it may be homologous (i.e., from the same species and/or strain as the host), heterologous (i.e., from a species other than the host cell species or strain), hybrid (i.e., a combination of 5' flanking sequences from more than one source), or synthetic. The source of the 5' flanking sequence may be any unicellular prokaryotic o:r eukaryotic organism, any vertebrate or invertebrate organism; or any plant, provided that the 5' flanking sequence is functional in, and can be activated by, the host cell machinery.
The 5' flanking sequences uaeful in the vectors of this invention may be obtained b~~r any of several methods well known in the art. ri'ypically, 5' flanking sequences useful herein other than the flanking sequence will have been previous:Ly identified by mapping and/or by restriction endonuclease digestion and can thus be isolated from then proper tissue source using the appropriata restriction endonucleases. In some cases, the full nucleotide sequence of the 5' flanking sequence may be known. In such a case, the 5' flanking sequence may be synthesized using the methods described above.
Where all or only a portion of the 5' flanking sequence is known, it may be obtained using PCR and/or by screening a genomic library with suitable oligonucleotide and/or 5' flanking sequence fragments from the same or another species. Where the 5' flanking sequence is not known, a fragment of DNA
containing a 5' flanking sequence may be isolated from a larger piece of DNA that may c:ontain, for example, a coding sequence or even another gene or genes.
isolation may be accomplished by restriction endonuclease digestion using one: or more carefully selected enzymes to isolate the proper DNA fragment.
After digestion, the desired fragment may be isolated by agarose gel purification, or by other methods known to the skilled artisan. Selection of suitable enzymes to accomplish this purpose will be readily apparent to one skilled in the art.
Origin of Replication Element The origin of replication element is typically a part of prokaryotic expression vectors purchased commercially, and aids in the amplification of the vector in a host cell. Amplification of the vector to a certain copy number can, in some cases, be important for optimal expression of the polypeptide. If the vector of choice does not contain an origin of replication site, one may be chemically synthesized based on a known sequence and then ligated into the vector.

Transcription Termination Element The transcription termination element is typically located 3 ' to the end of the po:Lypeptide coding 5 sequence and serves to terminatE~ transcription of the polypeptide. Usually, the tran:~cription termination element in prokaryotic cells is a G-C rich fragment followed by a poly-T sequence. While the element is easily-cloned from a library or even purchased 10 commercially as part of a vector, it can also be readily synthesized using methods for nucleic acid synthesis such as those referred to above.
delectable Marker Element A selectable marker gene element encodes a protein necessary for the survival and growth of a host cell grown in a selective culture medium. Typical selection marker genes encode proteins that (a) confer resistance 20 to antibiotics or other toxins, for example, ampicillin, tetracycline or kanamycin for prokaryotic host cells, (b) complement auxotrophic deficiencies of the cell, or (c) supply critical nutrients not available from complex media. Preferred selectable 25 markers are the kanamycin.resistance gene; the ampicillin resistance gene, and the tetracycline resistance gene.
Ribosome Bin.diny Element The ribosome binding element, commonly called the Shine-Dalgarno sequence (for prokaryotes) or the Kozak sequence (for eukaxyotes), is necessary for the initiation of translation for mR~t~A. The.element is 35 typically located 3' to the prom~ater and 5' to the coding sequence of the polypeptide to be synthesized.

The Shine-Dalgarno sequence is 'varied but is typically a polypurine (i.e., having a high A-G content). Many Shine-Dalgarno sequences have been identified, each of which can be readily synthesized using methods referred to above and used in a prokaryotic vector.
Sianal Pentid~ Seauence 10 In those cases where it is desirable for the polypeptide to be secreted from the host cell, a signal sequence may be used to direct t:he polypeptide out of the host cell, and the carboxy(C:)-terminal part of the polypeptide may be deleted in order to prevent membrane anchoring. Typically, the signal sequence is positioned in the coding region of the nucleic acid sequence, or directly at the 5' end of the coding region. Many signal sequences have been identified, and any that are functional in the selected host cell may be used.
Transcription Promote Transcription of the gene may be enhanced by the presence of one or more introns in the vector. This is particularly true where the polypeptide is produced in eukaryotic host cells, especially mammalian host cells.
The introns used may be naturally occurring within the gene, especially where the genevused is a full length 30 genomic sequence or a fragment thereof. Where the intron is not naturally occurring within the gene (as is the case for most cDNAs), the intron(s) may be obtained from another source. The position of the intron with respect to the 5' flanking sequence and the 35 encoding nucleic acid sequence i;s generally important, as the intron must be transcribed to be effective. As such, where the nucleic acid is a cDNA molecule, the preferred position for the intron is 3' to the transcription start site, and 5' to the polyA
transcription termination sequence. Preferably, the 5 intron will be located on one side or the other (i.e., 5' or 3') of the cDNA such that it does not interrupt this coding sequence. Any intron from any source, including any viral, prokaryotic and eukaryotic (plant or animal) organisms, may be usE~d, provided that it is 10 compatible with the host cell into which it is inserted.
Where one or more of the e7_ements set forth above are not already present in the vector to be used, they 15 may be individually obtained and ligated into the vector . Methods used for obtaining each of the elements are well known to the ~~killed artisan and are comparable to the methods set forth above (i.e., synthesis of the DNA, library screening, and the like).
Vector and Host Cell Preferred vectors for practicing this invention are those which are compatible with bacterial, insect, 25 and mammalian host cells. Such vectors include, by way of illustration, pCRII, pCR3, and pcDNA3 (Invitrogen Company, San Diego, California), pBSII (Stratagene Company, La JoTla, California), pETl5b (Novagen, Madison, Wisconsin), pGEX (Pharmacia Biotech, 30 Piscataway, New Jersey), and pEGFP-N2 (Clontech, Palo Alto, California).
After the vector has been constructed and a nucleic acid molecule encoding full length or truncated 35 polypeptide, or an analog thereof, has been inserted into the proper site of the vector, the completed vector may be inserted into a s~.zitable host cell for amplification or polypeptide ex~,~ression.
Host cells may be prokaryoi~ic host cells (such as E. coli) or eukaryotic host cells (such as yeast, insect or vertebrate cells). The host cell, when cultured under suitable nutrient: conditions, will synthesize the polypeptide, which can subsequently be collected by isolation from the culture medium (if the host cell secretes it inta the medium} or directly from the host cell (if not secreted). For polypeptide situated in the host cell cytoplasm and/or nucleus, the host cells are typically first a~isrupted mechanically or with detergent to release the: intracellular contents into a buffered solution. The p~olypeptide can then be collected from this solution. After collection, the polypeptide can be purified using methods such as molecular sieve chromatography, affinity chromatography, and the like.
Selection of the host cell for polypeptide production will depend in part o;n whether the polypeptide is to be glycosylate~d or phosphorylated (in which case eukaryotic host cells are preferred), and the manner in which the host cell is able to "fold" the protein into its native tertiary structure (e. g., proper orientation of disulfide lbridges, etc.) such that biologically active protein is prepared by the cell. Even where the host cell does not synthesize the polypeptide in the proper conformation, the polypeptide may be "folded" after synthesis ~,zsing appropriate chemical conditions such as discussed below.
Suitable cells or cell linea may be mammalian cells, such as Chinese hamster ovary cells (CHO) or 3T3 cells. The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production and purification are known in the art. Other suitable mammalian cell lines, are the monkey COS-1 and COS-7 cell lines, and the CV-1 cell line. Further exemplary mammalian host cells include primate cell lines and :rodent cell lines, including transformed cell linea. Normal diploid cells, cell strains derived from in vitro culture, of primary tissue, as well as prim<~ry explants, are also suitable. Candidate cells may be genotypically deficient:in the selection gene, or may contain a dominantly acting selection genE~. Other suitable mammalian cell lines include, but are not limited to, mouse neuroblastoma N2A cells, HeLa, mouse L-929 cells, 3T3 lines derived from Swiss, Balb-c or NIH mice, BHK
or HaK hamster cell lines.
Similarly useful as host cells are bacterial cells. For example, the various strains of E. coli (e.g., HB101, DHSa, DH10, and MC1061) are well-known as host cells in the field of biotechnology. Various strains of B. subtilis, Pseudomo~nas spp., other Bacillus spp., Streptomyces spp., and the like may also be employed in this method.
Many strains of yeast cells known to those skilled in the art are also available as host cells for use with the present invention.
Insertion of the vector into the selected host cell (also referred to as "transformation" or "transfection") may be accomplished using known materials or methods such as calcium chloride, electroporation, microinjection, lipofection or the DEAF-dextran method.

Host Cell Culturing Host cells containing the vector may be cultured using standard media well known to the skilled artisan.
5 The media will usually contain <~11 of the nutrients necessary for the growth and survival of the transformed cells. Suitable media for culturing E.
coli cells are, for example, Lug.°ia Broth (LB) and/. or Terrific Broth (TB). Suitable nnedia for culturing 10 eukaryotic cells are RPMI 1640, MEM, DMEM, all of which may be supplemented with serum and/or growth factors as required by the particular cell line being cultured. A
suitable medium for the culturing of insect cells is Grace's medium supplemented witty yeastolate, 15 lactalbumin hydrolysate and/or fetal calf serum, as necessary.
Typically, an antibiotic or other compound useful for selective growth of the transformed cells is added 20 as a supplement to the growth medium. The compound to be used will be dictated by the selectable marker element present on the plasmid with which the host cell has been transformed or transfected. For example, where the selectable marker element is kanamycin 25 resistance, the compound added to the culture medium will be kanamycin.
The amount of polypeptide produced in the host cell can be evaluated using standard methods known in 30 the art. Such methods include, without limitation, Western blot analysis, SDS-polya~crylamide gel electrophoresis, non-denaturing gel electrophoresis, HPLC separation, immunoprecipitation, and/or activity assays such as DNA binding gel sl'Zift assays.

Recovery of Expression Pro ,~nrr Purification of polypeptidEas according to this invention from solution can be accomplished using a variety of techniques. If the polypeptide has been synthesized such that it contains a tag, it may essentially be purified in a onE~-step process by passing the solution through an affinity column where the column matrix has a high affinity for the tag or for the polypeptide directly (i.e., a monoclonal antibody specifically recognizing the polypeptide).
For example, polyhistidine binds With great affinity and specificity to nickel, thus an affinity column of nickel (such as the Qiagen~ nickel columns) can be used for purification. See; for example, Current Protocols in Molecular Biology, Volume 1, Edited by Ausubel et al., John Wiley and Sons, Inc. (1995).
Where the polypeptide is prepared without a tag attached, and no antibodies are .available, other well known procedures for purificatio:a can be used. Such procedures include, without limitation, ion exchange chromatography, molecular sieve chromatography, HPLC, native gel electrophoresis in combination with gel elution, and preparative isoelecitric focusing.
If the polypeptide has been formed with inclusion bodies in the periplasm, the inc:Lusion bodies can often bind to the inner and/or outer cESllular membranes and thus will be found primarily in the pellet material after centrifugation: The pellets material can then be treated with a chaotropic agent such as guanidine or urea to release, break apart, and solubilize the inclusion bodies. The polypeptide in its now soluble form can then be analyzed using c~el.electrophoresis, immunoprecipitation or the like. If it is desired to isolate the, isolation may be accomplished using standard methods such as those described by Marston et al. in Meth. Enz., Volume 182, ;pages 264-275 (1990).
In those situations where :it is preferable to partially or completely isolate the polypeptide, purification can be accomplished using standard methods well known to the skilled artis<~n. Such methods include, without limitation, separation by electrophoresis followed by elecaroelution, various types of chromatography (immunoaffinity, molecular 'sieve, and/or ion exchange), and/or high pressure liquid chromatography. In some cases, it may be preferable to use more than one of these methods for complete purification.
Gene Theragv The human DNA molecules provided herein (or corresponding RNAs) may also be used for gene therapy, depending on the biological activity and desired effect. Currently, vectors suitable for gene therapy (such as retroviral or adenoviral vectors modified for gene therapy purposes and of purity and pharmaceutical acceptability) may be administered for delivery into the lung, for example. Such vectors may incorporate nucleic acid encoding the present polypeptides for expression in a desired location. Gene therapy may involve more than one gene for a desired protein or different desired proteins.
Alternatively, one may use no vector so as to facilitate relatively stable presence in the host. For example, homologous recombination of a DNA as provided herein or of a suitable transcription or translation control region may facilitate integration into or expression. from a host genome. (This may be performed .for production purposes as well, for example, United States Patent No. 5,272;071, issued December 21, 1993, and PCT application W0 91/09955, published July 11, 1991):' The nucleic acid may be placed within a pharmaceutically acceptable carrier to facilitate cellular uptake, such as a lipid solution carrier (e. g., a charged lipid), a lipoaome, or polypeptide carrier (e. g., polylysine).
Thus, the present invention provides for a population of cells expressing t:he polypeptides of this invention. Such cells may be suitable for transplantation or implantation into an individual for therapeutic purposes. For examx>le, one may prepare a population of cells to overexpre~ss the polypeptide.
One may then implant such cells into an individual.
Such cells may be, for example, liver cells, bone marrow cells, or cells derived from umbilical cord.
Alternatively, one may wish to u.se overexpressing circulating cells such as blood progenitor cells, T
cells or other blood cells. Human cells may be used.
Cells may be in the form of tissue. Such cells may be cultured prior to transplantation or implantation. In situ expression may be accomplished by, for example, by altering the regulatory mechanism for expression of the polypeptide, such as by using homologous recombination techniques as referred to above. Thus, provided is a population of host cells modified so that expression of endogenous polypeptide DNA is enhanced.
The cells to be transferred to the recipient may be cultured using one or more factors affecting the growth or proliferation of such cells, if appropriate.
Hematopoietic factors may be used in culturing hematopoietic cells. Such factors include G-CSF, EPO, _ 30 _ MGDF, SCF, Flt-3 ligand, interleukins (e.g., IL-1 to IL-13), GM-CSF, LIF, and analogy and derivatives thereof as available to one skilled in the art.
5 There may be a co-gene therapy involving the transplantation of cells expressing more than one desired protein.
For gene therapy dosages, c>ne will generally use between one copy and several thousand copies of the present nucleic acid per cell, depending on the vector, the expression system, the age, weight and condition of the recipient, and other factors which will be apparent to those skilled in the art. Th.e cellular delivery of 15 the polypeptide(s) may be designed to last for a selected period of time, such as a period of days, weeks, months or years. At the end of the effective time period, the recipient of the transformed cells may receive another "dose" (e.g., transplantation of 20 cells). Cells may be selected for their lifespan, their time period of expression of the desired polypeptide, or their ability to be reisolated from an individual (i.e., for blood cells, leukaphoresis may be used to retrieve transformed cells using markers 25 present on the cell surface). Vectors may be similiarly designed using, for example, viruses which have a known period of expression of DNAs contained therein.
The desired cells or vectors may be stored using 30 techniques, such as freezing, available to those in the art.
Thus, the present invention also contemplates a method for administering the polypeptide to an 35 individual, wherein the source o:E the polypeptide is selected from (i) a population o:E cells expressing the WO 00/06726 - 3 ~ - PCT/US99/15710 polypeptide and (ii) a population of vectors expressing the polypeptide. Such vectors :may be virus vectors capable of infecting human cells. The cells may be selected from among tissue or iindividual cells. The individual cells may be selected from among adipocytes, fibroblasts, bone marrow cells, peripheral blood progenitor cells, red blood cel:Ls, and white blood cells, including T cells and nerve cells.
Polypeptide Derivatives One may modify the polypept:ides of this invention (including fragments and analog:), prepared as described above, to create a fur>ion molecule with another peptide sequence. For example, if one desired to "tag" the polypeptide with an immunogenic peptide, one could construct a DNA which would result in such fusion product. The tag may be at the N-terminus or the C-terminus. An example is a. "FLAG-tag" version of the polypeptide. This type of "taggingn is useful to bind the polypeptide using reagents, such as antibodies, which are selective for the tag. Such binding may be for detection of the location or amount of polypeptide, or for polypeptide capturing processes where, for example, an affinity column is used to bind the tag, arid thus the desired polypeptide. Other types of detectable labels, such as radioisotopes, light-emitting (e. g., fluorescent or phosporescent compounds), enzymatically cleavable, detectable antibody (or modification thereof), or other substances may be used for such labeling of the present polypeptides.
For human therapeutic purposes, it may also be advantageous to derivatize the polypeptides described above by the attachment of one o:r more other chemical WO 00/0672b PCTIUS99115710 moieties to the polypeptide moiety. Such chemical moieties may be selected from among various water soluble polymers. The polymer should be water soluble so that the polypeptide to which it is attached is miscible in an aqueous environment, such as a physiological environment. The water soluble polymer may be selected from the group consisting of, for example, polyethylene glycol, copolymers of ethylene glycol/propylene glycol, carbox~znethylcellulose, 1Q dextran, polyvinyl alcohol, polyvinyl pyrolidone, poly-1,3-dioxolane, poly-1,3,6-t:rioxane, ethylene/maleic anhydride copolymer, polyaminoacids teither homopolymers or random o~r non-random copolymers (see further below regarding fusion molecules), and dextran or poly(n-vinyl pyrolidone)polyethylene glycol, propylene glycol homopolymers, polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols, polystyrenemaleate and polyvinyl alcohol.
Polyethylene glycol propionaldenhyde may have advantages in manufacturing due to its stability in water.
Fusion polypeptides in accordance with this invention may be prepared by attaching polyamino acids to the polypeptide. For example, the polyamino acid may be a carrier protein which serves to increase the circulation half life of the pol:ypeptide. The polyamino acid should be one which does not create a neutralizing antigenic response, or other adverse response, if the derivative is intended for in vivo therapeutic use. The polyamino acid may be selected from the group consisting of ser~.un album (such as human serum albumin), an antibody or portion thereof (such as an antibody constant region, sometimes called "Fc") or other polyamino acids. The locai~ion of attachment of the polyamino acid may be at the N-terminus of the polypeptide moiety, or other pT_ace, and also may be connected by a chemical "linker" moiety to the polypeptide.
The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 2 kilodaltons (kDa) and about 100 kDa (the term "about"
indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the Effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and othE:r known effects of the polyethylene glycol on a therapE?utic protein).
The number of polymer molecules so attached may vary, and one skilled in the art will be able to ascertain the effect on function.. One may mono-derivatize, or may provide for a di-, tri-, tetra- or some combination of derivatization, with the same or different chemical moieties (e.g., polymers; such as different weights of polyethylene glycols). The proportion of polymer molecules to polypeptide molecules will vary; as will their concentrations in the reaction mixture. In general, the optimum ratio (in terms of efficiency of reaction in that there is no excess unreacted polypeptide or polymer) will be determined by factors such as the desired degree of derivatization (e.g., mono, di-, tri-, etc.), the molecular weight of the polymer ;elected, whether the polymer is branched or unbranched, and the reaction conditions.

WO 00!06726 - 3 4 - PCT/US99/15710 The chemical moieties shou:Ld be attached to the polypeptide with consideration of effects on functional or antigenic domains of the polypeptide. There are a number of attachment methods available to those skilled in the art. See, for example, E~? 0 401 384 (coupling PEG to G-CSF), and Malik et al., Experimental Hematology, Volume 20, pages 1028-1035 (1992) (reporting the pegylation of GM-~CSF using tresyl chloride). By way of illustration, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule (or other chemical moiety) may be bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residue. Those having a free carboxyl group may include aspartic acid residues, glutamic acid residues, and the ~C-terminal amino acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethyJ.ene glycol molecules) (or other chemical moiety). Preferred for therapeutic manufacturing purposes is attachment at an amino group, such as at the N-terminus or to a lysine group. Attachment at residues important for receptor binding should be avoided if receptor binding is desired.
One may specifically desire N-terminally chemically modified derivatives: Using polyethylene glycol as an illustration, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to polypeptide molecules in the reaction mixture, the typE: of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylat:ed.polypeptide. The - 3~~ -method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated ;polypeptide molecules.
Selective N-terminal chemical modification may be accomplished by reductive alkyl~ation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particu:Lar protein. See PCT
application WO 96/11953, published April 25, 1996.
Under the appropriate reaction conditions, substantially selective derivatization of the polypeptide at the N-terminus with a carbonyl group containing polymer is achieved. For example, one may selectively N-terminally pegylat:e the polypeptide by performing the reaction at a~pH which allows one to take advantage of the pKa differences between the ~-amino group of the lysine residues and that of the a-amino group of the N-terminal residue of the polypeptide. By such selective derivatization, attachment of a polymer to a polypeptide is controlled:
the conjugation with the polymer takes place predominantly at the N-terminus of the polypeptide and no significant modification of other reactive groups, such as lysine side chain amino groups, occurs. Using reductive alkylation, the polymer may be of the type described above, and should have a single reactive aldehyde for coupling to the pohypeptide. Polyethylene glycol propionaldehyde, containing a single reactive aldehyde, may be used.
In general, an N-terminally chemically modified derivative will be preferred over other forms of chemical modification for ease in production of a therapeutic. N-terminal chemica:L modification ensures WO 00/06726 PCTlUS99/15710 a homogenous product as charactE~rization of the product is simplified relative to di-, t:ri- or other multi-derivatized products. The use of the above reductive alkylation process for preparation of an N-terminally chemically modified product is preferred for ease in commercial manufacturing.
Chemically modified derivatives in accordance with this invention may be further formulated for intra-arterial, intraperitoneal, intra.muscular, subcutaneous, intravenous, oral, nasal, pulmonary, topical or other routes of-administration, again depending on the biological activity of the polypeptide and the desired therapeutic effect. Chemical modification of biologically active proteins has been found to provide additional advantages under certain circumstances, such as increasing the stability and circulation time of the therapeutic protein and decreasing the immunogenicity.
See; for example, United States Patent No. 4,179,337, issued December 18, 1979 (Davis ~et.al.), and Abuchowski et al., "Enzymes as Drugs", Edited by Holcerberg and Roberts, pages 367-383 (1981). :?~ review describing protein modification and fusion proteins is Francis, Focus on Growth Factors, Volume :3, pages 4-10, published by Mediscript, Mountview Court, Friern Barnet Lane, London, England (1992). Preferably, for therapeutic use of the end-product preparation, the chemical moiety for derivatization will be pharmaceutically acceptable.
Therapeutic Compositions Another aspect of the present invention involves the use of the polypeptide of SES2 ID N0: 4 and analogs and derivatives thereof in pharmaceutical compositions and in methods for the manufacture of medicaments for use in humans. Such compositions may be for administration by injection, or for oral, pulmonary, nasal, transdermal or other.foro:ns of administration.
In general, encompassed vuithin 'the invention are pharmaceutical compositions comprising effective amounts of polypeptide or deriv<~tive products of the invention together with pharmacesutically acceptable diluents, preservatives, solubi7Lizers, emulsifiers, adjuvants and/or carriers. By "effective amounts is meant an amount sufficient to px,oduce a measurable biological effect. Such composa.tions include diluents of various buffer content (e. g., Tris-HC1, acetate, phosphate), pH and ionic strength; additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e. g., ascorbic acid, sodium metabisulfite), preservatives (e. g., Thimersol, benzyl alcohol) and bulking substances (e. g., lactose, mannitol); incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycoli.c acid, etc., or into liposomes. See, for example, PCT application WO
96/29989, Collins et al., published October 3, 1996.
Hyaluronic acid may also be used, arid this may have the effect of promoting sustained du:ration in the circulation. Such composi ions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, for example, l~emington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co., Easton, Pennsylvania, pages 1435-1712 (1990). The compositions may be prepared in liquid form, or as a dried powder, such as lyophilized form. Implantable sustained release formulations as°e also contemplated, as are transdermal formulations.

' i ~' Also contemplated are oral dosage forms of the above derivatized polypeptides. Proteins may be chemically modified so that oral delivery of the derivative is efficacious. Generally, the chemical modification contemplated for the present purposes is the attachment of at least one moiety to the polypeptide molecule itself, whE~re this moiety permits (ar) inhibition of proteolysis and (b) uptake into the blood stream from the stomach or intestine. Also desired is the increase in overall stability of the protein and increase in circulation time in. the body.
See PCT application WO-95/21629 (Habberfield, "Oral Delivery of Chemically Modified Proteins"), published August 17, 1995, and United States Patent No.
5,574,018, issued November 12, 1996 (Habberfield et al., "Conjugates of Vitamin B12 and Proteins"), issued November 12, 1996.
Also contemplated herein is pulmonary delivery of such polypept:ides and derivatives. The polypeptide or polypeptide analog or derivative is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream. For illustration, see PCT application W0 94/20069, Niven et al., "Pulmonary Administration of Granulocyte Colony Stimulating Factor", published September 15, 1994.
Nasal delivery of the polypeptide (or analog or derivative) may also be possible. Nasal delivery allows the passage of the polype7~tide (or derivative) to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung.
Formulations for nasal delivery :include those with - 39 _ absorption enhancing agents, such as dextran or cyclodextran. Delivery via transport across other mucous membranes isalso contemplated.
If desired, the polypeptidE~s of this invention may also be administered systemical:Ly in a sustained release formulation or preparat~Lon. Suitable examples of sustained release preparations include semipermeable polymer matrices in the form of shaped articles, for example, films or microcapsuies. Sustained release matrices include polyesters, hyctrogels, polylactides (United States Patent No. 3,773,919, issued November 20, 1973), copolymers of L-glutamic acid and gamma ethyl-L-glutamine (Sidman et al, Biopolymers, Volume 25 22, pages 547-556, 1983), poly (2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater. Res., Volume 15, pages l67--277, 1981, and Langer, Chem.
Tech., Volume 12, pages 98-105, 1982), ethylene vinyl acetate (Langer et-al., above), or poly-D(-)-3-hydroxybutyric acid. Sustained-release compositions also may include liposomes, which can be prepared. by any of several methods known in the art; see, for example, Epstein et al., Proceedings of the, National Academy of Sciences USA, Volume 82, pages 3688-3692 (1985), and Hwang et al., Proceedings of the National Academy of Sciences USA, Volume '77, pages 4030-4034 (1980).
Typically, the polypeptide will be in highly purified form, and the compositican will normally be presterilized for use, such as by filtration through sterile filtration membranes.
The amount of polypeptide that will be effective in vivo will depend on the naturE~ of the application.
One skilled in the art will be able to ascertain effective dosages by administration and observing the desired therapeutic effect. Particular effective does within this range will depend on the particular disorder or condition being tre<~ted, as well as the age and general health of the recipient, and can be determined by standard clinical procedures. Where possible, it will be desirable t:o determine the dose-response curve of the pharmaceutical composition first in vitro, as in bioassay system:, and then in useful animal model systems in vivo prior to testing in humans. The skilled practitioner, considering the therapeutic context, type of disorder under treatment, and other applicable factors, will be able to ascertain proper dosing without undue effort. Typically, a practitioner will administer the polypeptide composition until a dosage is reached that achieves the desired effect. The composition may be administered as a single dose, or as two or more doses (which may or may not contain the same amount of polypeptide) over time, or on a continuous basis.
Diagnostic Materials and Methods Nucleic acid products of the invention may be labeled with detectable markers (such as radiolabels and non-isotopic labels such as biotin) and employed in hybridization processes to locatEs the gene position and/or the position of any related gene family in a chromosomal map. They may also be used for identifying gene disorders at the DNA level and used as gene markers for identifying neighboring genes and their disorders. Such nucleic acid sequences may be used for detection or measurement of mRNA level from a biological sample. Contemplated herein are kits containing such labeled material:>.

The polypeptides and/or nucleic acids provided herein may be embodied as part of a kit or article of manufacture. An example is an article of manufacture comprising a packaging material and one or more preparations of the presently provided compositions.
Such packaging material will comprise a label indicating that the polypeptide or nucleic acid preparation i.s useful for detecting and/or quantifying the amount of polypeptide-in a biological sample, or defects iri a biological sample. As such, the kit may optionally include materials to carry out such testing, such as reagents useful for performing DNA or RNA
hybridization analysis, or PCR analysis on blood, urine, or tissue samples.
A further aspect of the invention is binding molecules, such as polyclonal antibodies, or preferably, monoclonal antibodies selectively binding the polypeptides of this invention. The hybridoma technique described originally by Kohler and Milstein in the European Journal of Immunology, Volume 6, pages 511-519 (1976, has been widely applied to produce hybrid cell lines that secrete high levels of monoclonal antibodies against many specific antigens.
Recombinant antibodies may also be prepared; see Huse et al., Science, Volume 246, at page 1275 (1989). Such recombinant antibodies may be further modified, such as by modification of complementarit~y determining regions to increase or alter affinity, or "humanizing" such antibodies, and incorporated into a,kit for diagnostic purposes. A diagnostic kit may be employed to determine the location and/or amount of the polypeptide of this invention in an individual. Diagnostic kits may also be used to determine if an individual has receptors which the polypeptide, or those which, to - 42 _ varying degrees, have reduced binding capacity or ability. Such antibodies may be prepared using immunogenic portions of the pol~,rpeptide. Such selective binding molecules may themselves be alternatives to the polypeptide,, and may be formulated for pharmaceutical use.
Such polypeptides and/or nLrcleic acids may be used for tissue distribution assays (for example, as 20 provided in the working example below) or for other assays to determine the expression pattern of the polypeptide.
The biological function of the polypeptide(s) of this invention can be studied in. vivo by disrupting expression of the corresponding gene in non-human animals such as mice, such that the level of expression of this gene is significantly decreased or completely abolished (so-called "knock out" animals). Such animals may be prepared with the use of techniques and methods described in United States Patent No.
5,557;032, issued September 17, 1996, for example.
Additionally, or alternatively,umice can be prepared in which the gene for the polypepti~de is overexpressed ("transgenic" animals) in order to evaluate the effects of the overexpression. Suitable methods for the preparation of such transgenic animals are described in United States Patent No. 5,489,743, issued February 6, 1996, and in PCT application WO 94/28122, published December 8, 1994. Useful transgenic animals will be those which display a detectable phenotype associated with expression of the polypeptide:
Another potential use of the present polypeptides is in assays and methods for the identification of a receptor or receptors which bind to, and are activated 4~, _ by, the polypeptides. This can. be accomplished, for instance, by contacting a recombinant host cell (bacterial; yeast, etc.) expressing the polypeptide of this invention ("ligand") on the surface with a receptor to be identified under conditions which permit binding or receptor activation, and detecting the occurrence of any such binding ~or activation. Such "ligand-receptor" interactions can take place cell to cell, since the membrane-bound polypeptide of this invention is believed to interact through contact with the receptor on an adjacent cell. Thus, the assay can involve recombinant expression of the "ligand" and the "receptor" on the surface of separate host cells, which are then brought into proximity or direct contact to determine whether ligand-receptor binding or receptor activation occurs. The binding or activation event would then be detected by standard means, such as by measurement of the change in an analytically detectable label which has been attached to either-the ligand or receptor, or by measurement of a.utophosphorylation of the receptor (if the latter is capable of phosphorylation upon activation).
Alternatively, the assay can be carried out using a "soluble" version of the polypeptide of the invention, consisting of the extracellular domain (with or without the signal peptide region) which has been recombinantly expressed and harvested from the halt.
The soluble polypeptide can be employed alone, or in derivatized form, e.g., an "Fc fusion" product such as described above (and exemplified below). The soluble polypeptide or derivative is then brought into proximity or contact with a subsi~rate to which the receptor to be identified has beESn bound, and the binding or activation event is dEaected in the same manner as described above. The procedure can also be WO 00!06726 PCT/US99/15710 conducted in reverse, i.e., with the receptor to be identified being bound to a suitable substrate and the unbound soluble polypeptide or derivative being contacted therewith, etc.
The purified polypeptide ojthis invention will also be useful for structural studies as a means for the rational design of novel drugs affecting the in vivo function and activity of the polypeptide. For instance, the recombinant protein may be used to derive the structure of the protein through X-ray cxystallography, NMR or modeling from published structures of related prciteins. Knowledge of the structure will foster an understanding of how the polypeptide binds, and can lead to the design or discovery of compounds which can either block or mimic the activity of the polypeptide, depending on what is desired.
Describtion of Specific Embodiments The invention is described in further detail with regard to the following workingexamples, which are included for purposes of illustration only and are not intended to be limiting..
Example 1 Construction of cDNA Library Normal white adipose tissue was collected from CD-2 mice, and total mRNA was isolai~ed using an RNeasy Maxi~ kit (Qiagen, Santa Clara, California) in accordance with the manufacturer°s instructions. The proportion of RNA containing a polyA sequence was _ 45 -subsequently isolated (Oligotex kit, Qiagen, Santa Clara, California) as per instructions except for the omission of the DNase step.
A cDNA library was constructed with this mRNA
using the Super Script~ Plasmid System (Gibco BRL, Gaithersburg, Maryland). The ma.rlufacturer~s protocol was followed except that a custom random oligonucleotide primer containing a Notl restriction site was substituted for the first strand synthesis step and a PCR Clean up kit (Qiagen, Santa Clara, California).was used to purify t:he products of the second strand synthesis and Salt adapter ligation steps. The cDNA was size-fractionated using agarose gel electrophoresis (Maniatis, Molecular Cloning, CSH
Press, 1991), and the 200-800 base pair products were excised. These fragments were then ligated into shuttle vector pYYA-41L which had been previously digested with the enzymes Xhol and Notl. Vector pYYA-4lL was deposited with the American Type Culture Collection, Manassas; Virginia, on February 13, 1998, under accession number 209636.
Vector pYYA-41L contains the; ampicillin resistance gene and the Trpl gene for selection in E. co.Ii and S.
cerevisiae, respectively. In addition, the vector contains a yeast promoter upstream from the yeast amylase gene in which the signal ;peptide sequence has been deleted. The vector is constructed such that insertion of a functional signal sequence into the Xhol-Notl restriction sites results in secretion of the amylase gene product outside the ;yeast cell wall. The ligated vector was amplified by transformation into WO 00/06726 PCT/US99%15710 - 4Ei -E. coli (DHlOb, Gibco BRL, Gait.hersburg, Maryland), and than isolated using a Qiagen plasmid purification kit (Qiagen, Santa Clara, California).
The resulting DNA was used to transform YPH499 yeast using lithium acetate; for reference, see Gietz et al., Nucleic Acids Research, Volume 20, page 1425 (1992). The transformed yeast cells were then plated onto agar containing starch azure (Sigma, St. Louis, Missouri) and lacking tryptophan. Following incubation at 30°C, yeast colonies surrouncLed by a clearing of the azure plate (indicating secretion of the amylase gene) were picked. Individual yeast colonies were isolated by re-streaking on plates and grown in liquid culture, and the vector DNA was then isolated using a Qiagen plasmid purification kit (Qiagen, S~.nta Clara, California). The DNA sequences of the vector inserts were determined by PCR amplification (Perkin Elmer, Sunnyvale, California) using vector specific primers, purification of the amplified DNA (Qiagen, Santa Clara, California), and automated DNA sequencing (Perkin Elmer/Applied Biosystems, Foster City, California).
The resulting DNA sequences and predicted protein sequences were searched against~,availabla public databases containing nucleotide and protein sequences.
One sequence (SEQ ID N0: 41), composed of 402 base pairs, showed significant homology to previously isolated members of the Delta gene family.

W0 00/0672b PCT/US99/15710 Example 2_ Clonincx of the Murine Gent Murine adipose cDNAs longer than eight hundred base pairs were ligated to adapitor primers using a Marathon~ cDNA amplification kit. (Clontech, Palo Alto, California) and the manufacturer's protocol. The final cDNA products were purified fronn unligated adaptor primers (PCR Clean-up kit, Qiage~n, Chatsworth, California) and then used as templates for subsequent rapid amplification of cDNA ends; (RACE) reactions using polymerase chain reaction (PCR).
For the 3' RACE reaction, P~CR was performed on the cDNA templates using Advantage~ PCR kit components (Clontech, Palo Alto, California) and the following primers:
TGCTGTGGGTAAGATTTGGCGAACA (SEQ ID NO: 42) and CCATCCTAATACGACTCACTATAGGGC (SEQ ID NO: 43).
Following denaturation (94°c~ for one minute), the amplification procedure was conducted as follows: five cycles at 94°C for five seconds and at 72°C for four minutes; five cycles at 94°C for five seconds and at 70°C for four minutes; and twenty five cycles at 94°C
for five seconds and at 68°C for four minutes. All reactions were performed on a Pei-kin Elmer 2400 PCR
machine (Sunnyvale, California) The reaction mixture was ele:ctrophoresed on a 1~k agarose gel, and a single band migrating at approximately 3 kilobases was excised and purified through a Genelute~ column (Supelco, Bellefonte, - 4~~ -Pennsylvania), then ligated into a pCR-Blunt plasmid (Invitrogen, Carlsbad, Californ.ia). Bacterial host cells were then transformed with this plasmid and grown overnight. The plasmid DNA was isolated from the bacteria host cells using the Qiagen miniprep protocol and digested with EcoRI and Notl to confirm the presence and size of the inserts. A clone containing an insert of approximately 3 kilobases (SEQ ID NO: 44) was sequenced and found to contain a novel cDNA
encoding murine polypeptide. This DNA sequence was used td design primers for a 5' RACE reaction.
For the 5' RACE reaction, 7?CR was performed on the cDNA templates using Advantage~ PCR kit components (Clontech, Palo Alto, California) together with the following primers:
GGTGAGTCCGCACAGGTCAAGGTAC (SEQ ID NO: 45) and CCATCCTAATACGACTCACTATAGGGC (SF'sQ ID N0: 43).
Following an initial denaturation step (94°C for one minute), amplification was carried out as follows:
five cycles at 94°C for five seconds and at 72°C for four minutes; five cycles at 94°C for five seconds and at 70°C for four minutes; and tvi~enty-five cycles at 94°C for five seconds and at 68°C for four minutes.
The reaction mixture was electrophoresed on a 1~
agarose gel, and a single band migrating at approximately 1.5 kilobases was excised, purified as above, and reamplified using the Advantage° PCR kit components with the following oligonucleotides:
GACAGGGGTTGCTGGCACACTTGTT (SEQ ID N0: 46) and CCATCCTAATACGACTCACTATAGGGC (SE~Q ID NO: 43).

- 4 ~i -Following denaturation (99:°C for one.minute), the template was amplified over thirty-five cycles at: 94°C
for ten seconds and at 72°C foxes two and one-half minutes.
The reaction mixture was electrophoresed on a l~
agarose gel, and a single band :migrating at approximately 1.7 kilobases was excised and purified through a Genelute~ column and then iigated into the pCR2.1 plasmid (Invitrogen, Car:lsbad, California).
Bacterial host cells were trans:Eormed with this plasmid and grown overnight. The plasmid DNA was isolated from the bacteria host cells using the Qiagen miniprep protocol, then digested with EcoRI to confirm the presence and size of the insert:;. Three clones, containing an insert of approximately 1.5 kilobases, were sequenced and shown to contain additional 5' murine cDNA sequence composed of: 982 base pairs (SEQ ID
NO: 47).
The sequence of this 5' RAC'.E clone (SEQ ID NO: 47) was merged with the sequence of the 3' RACE clone (SEQ
ID N0: 44) to give the full length murine cDNA open reading frame sequence (Figure 1A-1B, and SEQ ID
NO: 1).
To generate a full length murine cDNA clone of SEQ
ID N0: 1 (above), PCR was performed on the murine white adipose template from the RACE reactions using the Advantage~ PCR kit components and the following oligonucleotides:
AGCCACCATGACGCCTGCGTCCCG (SEQ ID N0: 48) and TCTATTATACCTCTGTGGCAATCAC (SEQ IJD N0: 49).

Following denaturation {94:°C for one minute), the template was amplified with ten. cycles of heating at 94°C for ten seconds, 55°C for ten seconds, and 72°C
for two and one-half minutes; followed by twenty five cycles of heating at 94°C for ten seconds, 62°C for ten seconds and 72°C for two and one-half minutes.
The reaction mixture was e.lectrophoresed on a 1~
agarose gel and a single band migrating at approximately 2.2 kilobases was excised and purified through a Genelute~ column and ligated into a pCR2.1 plasmid {Invitrogen, Carlsbad, California). Bacterial host cells were transformed with this plasmi.d and grown overnight. The plasmid DNA was then isolated from the bacteria host cells using the Qi.agen miniprep protocol and digested with EcoRI to confirm the presence and size of the inserts. Three clor.~es, containing an insert of approximately 2.2 kilobases, were sequenced and one clone was shown to contain the complete marine cDNA {SEQ ID N0: 1, Figure lA-1E'.). This cDNA molecule encodes a marine polypepti:de (herein termed '~D114 ~~ ) having the predicted amino acid sequence of Figure 2 (SEQ TD NO: 2).
Example 3 Identification of the Human Gene The marine DNA sequence (SEQ ID N0: 1) was searched against the GenBank database (Wisconsin Package Version 9.1, Genetics Computer Group, Madison, Wisconsin), and a 409-base pair ;sequence (SEQ ID
N0: 50) from a human brain cDNA :Library was found that had 81.37 sequence identity to i~he marine polypeptide.

- 51. -The following oligonucleotides were designed from areas of high homology between SEQ ID NO: 50 and SEQ ID
N0: 1:
AAGAAGGAGCTGGAAGTGGACTGTG (SEQ ID N0: 51) and ATCAAACACACAGACTGGTACATGG (SEQ ID NO: 52).
These oligonucleotides were used to amplify a Marathon human brain cDNA library (Clontech, Palo Alto, 10 California) using the Advantages PCR kit components (Clontech, Palo Alto, California). Following. an initial denaturation step (94°C for one minute), amplification was carried out a:~,follows: ~ive cycles at 94°C for five seconds and 72°C for two and one-half 15 minutes; five cycles at 94°C for five seconds and 70°C
for two and one-half minutes; ar.~d twenty-five cycles at 94°C for five seconds and 68°C for two and one-half minutes.
20 The reaction mixture was electrophoresed on a 1~
agarose gel and a single band migrating at approximately 245 base pairs was excised, purified through a Genelute~ column, and .reamplified under the same reaction conditions.
The resulting 245-base pair product was purified with a PCR Clean-up kit (Qiagen, Chatsworth, California) and labeled with a-32:P-dCTP (RediVue, Amersham, Arlington Heights, Tll:inois), using a RediPrime~ random primed reaction. kit (Amersham.
Arlington Heights, Illinois). Unincorporated radioactivity was excluded by si:ae exclusion chromatography (SPrime-3Prime, Boulder; Colorado). A
human fat cell 5' Stretch Plus cDNA lambda gtl0 library (Clontech, Palo Alto, California) was then screened for the human gene with this a-'2P-dCTP Tabeled cDNA probe.
Seventy-two filters were hybridized with the labeled cDNA probe in 200 milliliters of RapidHyb~ buffer (Amersham, Arlington Heights, I:llznois) for approximately sixteen hours at X55°C. The filters were then washed twice in 2X SSC (0.:3 M sodium chloride/0.3 M sodium citrate) with 0.2~ SDS at room temperature for thirty minutes, followed by two washes in 0.2X SSC with 0.2~ SDS at 65°C for thirty minutes. The filters were placed in autoradiography cassettes and exposed to Hyperfilm (Amersharn, Arlington Heights, Illinois) at -80°C overnight. The film was cleveloped, and one clone was identified which hybridized to the probe.
This phage clone was plaque purified using standard methods, isolated using the Wizard Lambda Prep DNA Purification System (Promega, Madison, Wisconsin), and sequenced. The sequence (SEQ ID NO: 53) showed that this clone contained approximately 215 base pairs of 5' untranslated region and 19:80 base pairs of the coding region for the human polypeptide. The clone also lacked the last 85 base pairs of the coding region.
To amplify the remaining 3' end of the human gene, the oligonucleotide primers shown below were designed from the clone of SEQ ID NO: 5f downstream of the termination codon and from the sequence for the above mentioned human phage clone (SEQ ID N0: 53).
ACCTGATTCCTGCCGCCCAGCT (SEQ ID I~fOc 54) arid GATGTCCCAGGTAGGCTCCTGC (SEQ ID 1~f0: 55).
These oligonucleotides were used to amplify a Marathon human lung cDNA library (Clontech, Palo Alto, _ WO 00/06726 PCT/US99/15710 _ 5~; _ California) using the pfu polymerase (Stratagene, La Jolla, California). Following denaturation at 94°C for one minute, amplification was carried out over thirty cycles at 94°C for fifteen seconds, 68°C for fifteen seconds, and 74°C for one minute.
The reaction mixture was electrophoresed on a 1~
agarose gel and a single band migrating at approximately 300 base pairs was excised and purified w10 through a Genelute~ column and ligated into the pCR-Blunt plasmid (Invitrogen, Carlabad, California).
Bacterial host cells vuere then i~ransformed with this plasmid and grown overnight. The plasmid DNA was isolated from the bacterial host: cells using the Qiagen miniprep protocol and digested vuith EcoRI and SpeI to confirm the presence and size of. the inserts. Three clones containing an insert of approximately 300 base pairs were sequenced and comparE:d to SEQ ID N0: 50 and SEQ TD NO: 53. One clone was cr~osen, and three-fold coverage sequencing of this clor.~e revealed that it had the sequence of SEQ ID N0: 56.
This sequence (SEQ ID N0: 56) and the sequence of SEQ ID N0: 53 were merged using Sequencer software (Gene Codes, Ann Arbor, Michigan.) into the full length human open reading frame sequence (Figure 3A-3B, SEQ ID
NO: 3). This DNA sequence encodes a human polypeptide having the predicted amino acid sequence of Figure 4 (SEQ ID NO: 4).

_ 59:
Example 4 Expression of the Murine Gene To assess the gene expression pattern of the murine polypeptide, RT-PCR was ;performed on ten nanograms of mRNA from various :murine tissues using the GeneAmp EZ rTt.h RNA PCR Kit (Pe:rkin-Elmer, Norwalk, Connecticut) and the following oligonucleotide primers:
AACCTGGACGGCAGATG (SEQ ID NO: 57) and AGATTTGGCGAACAGACGA (SEQ TD N0: 58).
Following first strand cDNA synthesis at 60°C for thirty minutes and denaturation at 94°C for two minutes, amplification was carr~_ed out using thirty cycles at 94°C for fifteen seconds, followed by 66~C
fox one minute. Reactions were performed with a Perkin Elmer 2400 PCR machine. The reaction mixtures were then purified with a PCR Clean-up Kit (Qiagen, Chatsworth, California), an aliquot of each was run on a 1~ agarose gel; and an expected 275-base pair fragment was observed in most tissues. The highest level of expression was seen in the lung, followed by white arid brown adipose tissue. Other tissues expressing the murine polypeptid.e at lower levels of expression were the adrenal gland, spleen, brain, eye, kidney, and the liver. Skin and skeletal muscle were negative at this level of examination.
These same oligonucleotide ;primers were used to amplify a region from the clone of SEQ ID NO: 41 using a PCR Core Kit (Boehringer Mannheim, Indianapolis, Indiana) as a probe. Following .an initial denaturation step (94°C for one minute), the .amplification procedure WO OO/Ob726 PCT/US99115710 _ 5G; _ consisted of thirty cycles at 94°C for fifteen seconds followed by 66°C for one minute. An aliquot of the reaction mixture was electrophoresed on a 1~ agarose gel and a single band migrating at approximately 275 base pairs was observed. The remainder of the reaction mixture was purified with a PCR Clean-up kit (Qiagen, Chatsworth, California) and labeled with a-32P-dCTP
(RediVue~, Amersham, Arlington Heights, Illinois) using a RediPrame~ random primed reaction kit (Amersham, Arlington Heights, Illinois) . l:Inincorporated radioactivity was excluded by s:Lze exclusion chromatography (SPrime-3Prime, Boulder, Colorado).
This marine probe was used to screen Northern blots containing two micrograms per lane of poiyAf RNA
from various marine tissues (Clontech, Palo Alto, California) in ten milliliters of RapidHyb buffer (Amersham, Arlington Heights, Illinois. Screening was carried out for approximately one hour at a temperature of 65°C. The filters were then 'washed twice in 2X SSC
with 0.2~ SDS at room temperature for thirty minutes, followed by two washes in 0.2X SSC with 0.2$ SDS at 65°C for thirty minutes. Blots were then exposed to -- --Phosphor Cassettes (Molecular Dynamics, Sunnyvale, California) overnight and developed with a Molecular Dynamics Storm $20 system.
Northern blot analysis showed the level of marine gene expression was highest in t:he lung, followed by heart, kidney; skeletal muscle and brain. Transcripts were barely detectable in spleen and testis tissues, and hybridization to GAPDH showed little RNA in these lanes.
Exampla 5 - 5fi -_In Situ Hybridization of the Marine Gene A panel of normal embryonic (E10.5 through E18.5) and adult mouse tissues were fixed in ~~
paraformaldehyde, then embedded. in paraffin and sectioned at five micrometers. Prior to in situ hybridization, tissues were permeabilized with 0.2M
HCL, followed by digestion with Proteinase K and acetylation with triethanolamin~e and acetic anhydride.
Sections were hybridized'overnight at 55°C with a 2058-base pair 33p-labeled riboprobe corresponding to nucleotides 1 to 2058 of the mouse sequence, then subjected to a high stringency wash in O.1X SSC at 55°C. Slides were dipped in a x:odak NTB2 emulsion (Eastman Kodak, Rochester, New Stork), exposed at 4°C
for two to three weeks, developed, and then counterstained with hernatoxylin~'eosin. Sections were examined with standard (brightfi.eld) and darkfield illumination to allow simultaneous evaluation of tissue morphology and hybridization signal. Hematoxylin/eosin differentially stained nuclei anal cytoplasm and allowed, under brightfield illumination, visualization of cellular morphology and identification of cell types expressing the gene of interest. Emulsion autoradiography allowed microscopic evaluation of the hybridization signal (from the hybridized radiolabeled probe) under darkfield illumination, in which developed silver grains appeared as bright dots on a dark background.
The tissues examined in this manner included:
GI (esophagus, stomach, duodenum, jejunum, ileum, proximal and distal colon), brain (one sagittal, two coronal sections), liver, lung, heart, spleen, thymus, lymph nodes, kidney, adrenal, bladder, pancreas, salivary gland, male and female reproductive organs (ovary, oviduct and uterus in the female; testis, epidydimis, prostate, seminal vesicle and vas deferens in the male), BAT and WAT (subcutaneous, peri-renal, peri-ovarian or epdidymal), bone (femur), skin, breast, and skeletal muscle.
The results for tissues from an adult mouse are shown in Figures 5 and 6. The results from mouse embryos are shown in Figure 7. Brightfield illumination is shown on the top panel and darkfield illumination is shown on the botaom panel of each paired set of photographs. Figss. 5A and 5B: lung.
Figs. 5C and 5D: liver. Figs. 5E and 5F: brain. Figs.
5G and 5H: choroid plexus. Figs;. 5I and 5J: kidney.
Figs. 5K and 5L: adrenal gland. Figs. 5M and 5N:
spleen. Figs. 50 and 5P: thymus gland. Figs. 6A and 6B: white adipose tissue. Figs. 6C and 6D: brown adipose tissue. Figs. 6E and 6F': skeletal muscle.
Figs. 6G and 6H: skin. Figs. 6I and 6J: duodenum.
Figs. 6K and 6L: pancreas. Figs. 6M and 6N: ovary.
Figs. 60 and 6P: testis. Figs. 7A and 7B: E10.5 mouse embryo. Figs. 7C and 7D: E11.5 :mouse embryo. ('tE10.5"
and "E11.5" indicate day of embryo development; "H" and "L" indicate heart and lung, res;pectively).
As shown in these photographs, the probe produced a clear signal, with little or n~~ background signal, in tissue sections from both embryo and adult mice. At all of the embryonic stages examined and in all of the adult tissues, signal was restricted to cells with an endothelial-type morphology in b:Lood vessels or capillaries. Signal in the heart: was confined to the microvasculature (see Figure 7).

WO OOI06726 PCTlUS99/15710 Exam~l a C
Preparation of Fc Fus,~on Deriva iv An "Fc" fusion derivative caf the polypeptide of this invention (using the murinEa species as an example) and a polyamino acid can be prepared as follows:.
Most of the extracellular region of marine Delta4 (nucleotides 1-1587 of SEQ ID N0: 1 and Figure 1A-1B) is amplified with the following oligos to add a Spe I
site on the 5' end and a Not I kite at the 3' end.
GAACTAGTCCACCATGACGCCTGCGTC'CCG (SEQ ID N0: 59) TCGCGGCCGCGGGGAAGCTGGGTGGC1~,A (SEQ ID NO: 60) Following an initial denaturation step of 94°C for one minute, amplification is carried out over thirty cycles at 94°C for fifteen seconds, 58°C for fifteen seconds, and 74°C for one minute. The reaction mixture is electrophoresed on a 2~ agarose gel, and a single band migrating at approximately 1600 :base pairs is excised and purified through a Genelute~ column. This fragment is digested with Spe I and.Not I, purified with a PCR
Clean-up kit (Qiagen, C'hatsworth, California), and ligated into a plasmid containin~~ the Fc region of human IgG also digested with Spe 2 and Not I. The Not I;site introduces three alanine residues in place of ~~wVA" in positions 530, 531 and 532 of the normal amino acid sequence of the extracellul<~r region of the marine polypeptide, which allows for an in frame ligation between the marine polypeptide sE:quence and the Fc sequence. Bacterial host cells are then transformed with this plasmid and grown overnight. The plasmid DNA

is isolated from the bacteria host cells using the Qiagen miniprep protocol, and then digested with Spe I
and Not I to confirm the presence and size of the inserts. One clone containing an insert of 5 approximately 1.6 kilobases is sequenced and shown to encode:~amino acid residues 1-529 of the extracellular region of murine polypeptide in frame with the human IgG Fc region (SEQ ID N0: 61 anc~ SEQ ID NO: 62 for DNA
and amino acid sequences, respectively, with Fc portion beginning at position 533 of thEs amino acid sequence).
Biology As mentioned, Delta-Notch signaling is known to 15 regulate cell development, and more specifically, the differentiation of endothelial cells into more specialized cells. The studies shown in Examples 4 and 5, in particular, reveal that th.e polypeptide is strongly expressed in the vascular endothelium in both 20 the embryonic and adult stages, consequently it is not limited to organism development alone but has a role in adult organism biology as well. In the particular case of angiogenesis, Delta-Notch signaling would be expected to influence the development of endothelium 25 into blood vessels. Because the development of blood vessels are critical fox the support of tumor growth, the linking of the polypeptide to angiogenesis could provide a "target" for use in programs for the identification and/or development of a suitable agonist 30 (stimulator) or antagonist (inhi:bitor) of its effect.
Specific examples of other endothelial cell biology that may be influenced include endothelial cell proliferation, migration, chemot~axis, changes vascular 35 permeability (possibly associated with inflammation), stimulation of endothelial cell production of other factors (for example, metallopx~oteinases, growth factors, and angiogenesis inhibitors), and apoptosis.
The invention described abc>ve is now defined in 5 the appended claims.

SEQUENCE LISTING
<110> Amgen Inc.
<120> DELTA RELATED POLYPEPTIDE
<130> A531 <140> Not Assigned Yet <141> 1998-07-24 <160> 62 <170> PatentIn Ver. 2.0 <210> 1 <211> 2058' <212> DNA
<213> Murine <400> 1 atgacgcctg cgtcccggag cgcctgtcgc tgggcgct.ac tgctgctggc ggtactgtgg 60 ccgcagcagc gcgctgcggg ctccggcatc ttccagct~gc ggctgcagga gttcgtcaac 120 cagcgcggta tgctggccaa tgggcagtcc tgcgaaccgg gctgccggac tttcttccgc 180 atttgcctta agcacttcca ggcaaccttc tccgaggg~ac cctgcacctt tggcaatgtc 240 tccacgccgg tattgggcac caactccttc gtcgtcaggg acaagaatag cggcagtggt 300 cgcaaccctc tgcagttgcc cttcaatttc acctggcagg gaaccttctc actcaacatc 360 caagcttggc acacaccggg agacgacctg cggccagaga cttcgccagg aaactctctc 420 atcagccaaa tcatcatcca aggctctctt gctgtggg~ta agatttggcg aacagacgag 480 caaaatgaca ccctcaccag actgagctac tcttaccggg tcatctgcag tgacaactac 540 tatggagaga gctgttctcg cctatgcaag aagcgcgatg accacttcgg acattatgag 600 tgccagccag atggcagcct gtcctgcctg ccgggctgga ctgggaagta ctgtgaccag 660 cctatatgtc tttctggctg tcatgagcag aatggttact gcagcaagcc agatgagtgc 720 atctgccgtc caggttggca gggtcgcctg tgcaatgaat gtatccccca caatggctgt 780 cgtcatggca cctgcagcat cccctggcag tgtgcctgcg atgagggatg gggaggtctg 840 ttttgtgacc aagatctcaa ctactgtact caccactctc cgtgcaagaa tggatcaacg 900 tgttccaaca gtgggccaaa gggttatacc tgcacctgi:.c tcccaggcta cactggtgag 960 cactgtgagc tgggactcag caagtgtgcc agcaacccct gtcgaaatgg tggcagctgt 1020 aaggaccagg agaatagcta ccactgcctg tgtcccccag gctactatgg ccagcactgt 1080 gagcatagta ccttgacctg tgcggactca ccctgcttc~a atgggggctc ttgccgggag 1140 cgcaaccagg ggtccagtta tgcctgcgaa tgccccccc:a actttaccgg ctctaactgt 1200 gagaagaaag tagacaggtg taccagcaac ccgtgtgcc:a atggaggcca gtgcctgaac 1260 agaggtccaa gccgaacctg.ccgctgccgg cctggattc:a caggcaccca ctgtgaactg 1320 cacatcagcg attgtgcccg aagtccctgt gcccacggc~g gcactt:gcca cgatctggag 1380 aatgggcctg tgtgcacctg ccccgctggc ttctctggc:a ggcgctgcga ggtgcggata 1440 acccacgatg cctgtgcctc cggaccctgc ttcaatggqg ccacctgcta cactggcctc 1500 tccccaaaca acttcgtctg caactgtcct tatggcttt;g tgggcagccg ctgcgagttt 1560 cccgtgggct tgccacccag cttcccctgg gtagctgtca cgctgggcgt ggggctagtg 1620 gtactgctgg tgctgctggt catggtggta gtggctgtc~c ggcagctgcg gcttcggagg 1680 cccgatgacg agagcaggga agccatgaac aatctgtcag acttccagaa ggacaaccta 1740 atccctgccg cccagctcaa aaacacaaac cagaagaac_~g agctggaagt ggactgtggt 1800 ctggacaagt ccaattgtgg caaactgcag aaccacacat tggactacaa tctagccccg 1860 ggactcctag gacggggcag catgcctggg aagtatcct;c acagtgacaa gagcttagga 1920 gagaaggtgc cacttcggtt acacagtgag aagccagacft gtcgaatatc agccatttgc 1980 tctcccaggg actctatgta ccaatcagtg tgtttgatat cagaagagag gaacgagtgt 2040 gtgattgcca cagaggta 2058 <210> 2 <211> 686 <212> PRT
<213> Murine z <400> 2 Met Thr Pro Ala Ser Arg Ser Ala Cys Arg Trp Ala Leu Leu Leu Leu Ala Val Leu Trp Pro Gln Gln Arg Ala Ala G.ly Ser Gly Ile Phe G1n Leu Arg Leu Gln Glu Phe Val Asn Gln Arg G:Ly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg I1e Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cars Thr Phe Gly Asn Val 65 70 '75 80 Ser-Thr Pro Val Leu Gly Thr Asn Ser Phe Val Va1 Arg Asp Lys Asn Ser Gly Ser Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro G1y Thr Phe Ser Leu Asn Ile Gln Ala Tx~p His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ss~r Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu A1a Val Gly Lys Il.e Trp Arg fihr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Seer Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr G1y Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe G1y His Tyr G1u Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser IIe Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Se:r Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Se:r Asn Pro Cys Arg Asn Gly Gly.Ser Cys Lys Asp Gln Glu Asn Ser Tyrr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gin His Cys Glu His Ser Thr Leu Thr Cys AIa Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys G1u Leu His Ile Seer Asp Cys Ala Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Le~u Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser GIy Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro VaI Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Val Val Val Ala Val Arg Gl:n Leu Arg Leu Arg Arg Pro Asp Asp Glu Ser Arg.Glu A1a Met Asn Assn Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro Ala Ala Gln Leu Ly,s Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys Gly Leu Asp Lya Ser Asn Cys Gly Lys Leu Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Leu Leu Gly Arg Gly Ser Met Pro Gly Lys Tyr Pro His Ser_ Asp Lys Ser Leu Gly 625 630 63!i 640 Glu Lys Val Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu 660 66s 670 WO 00/06?26 PCT/lJS99/15710 Ile Sex Glu Glu Arg Asn Glu Cys Val Ile A.la Thr Glu Val <210> 3 <211> 2055 <212> DNA
<213> Human <400> 3 atggcggcag cgtcccggag cgcctctggc tgggcgctac tgctgctggt ggcactttgg 60 cagcagcgcg cggccggctc cggcgtcttc cagctgcagc tgcaggagtt catcaacgag 120 cgcggcgtac tggccagtgg gcggccttgc gagcccggct gccgga.cttt cttccgcgtc 180 tgccttaagc acttccaggc ggtcgtctcg cccggaccct gcaccttcgg gaccgtctcc 240 acgccggtat tgggcaccaa ctccttcgct gtccgggacg acagtagcgg cggggggcgc 300 aaccctctcc aactgccctt caatttcacc tggccgggta ccttctcgct catcatcgaa 360 gcttggcacg cgccaggaga cgacctgcgg ccagaggcct tgccaccaga tgcactcatc 420 agcaagatcg ccatccaggg ctccctagct gtgggtca<xa actggttatt ggatgagcaa 480 accagcaccc tcacaaggct gcgctactct taccgggtc:a tctgcagtga caactactat 540 ggagacaact gctcccgcct gtgcaagaag cgcaatgacc acttcggcca ctatgtgtgc 600 cagccagatg gcaacttgtc ctgcctgccc ggttggaci~g gggaatattg ccaacagcct 660 atctgtcttt cgggctgtca tgaacagaat ggctactgca gcaagccagc agagtgcctc 720 tgccgcccag gctggcaggg ccggctgtgt aacgaatgca tcccccacaa tggctgtcgc 780 cacggcacct gcagcactcc ctggcaatgt acttgtgat:g agggctgggg aggcctgttt 840 tgtgaccaag atctcaacta ctgcacccac cactccccat gcaagaatgg ggcaacgtgc 900 tccaacagtg ggcagcgaag ctacacctgc acctgtcg<;c caggctacac tggtgtggac 960 tgtgagctgg agctcagcga gtgtgacagc aacccctgt:c gcaatggagg cagctgtaag 1020 gaccaggagg atggctacca ctgcctgtgt cctccgggc;t actatggcct gcattgtgaa 1080 cacagcacct tgagctgcgc cgactccccc tgcttcaat:g ggggctcctg ccgggagcgc 1140 aaccaggggg ccaactatgc ttgtgaatgt ccccccaac;t tcaccggctc caactgcgag 1200 aagaaagtgg acaggtgcac cagcaacccc tgtgccaac;g ggggacagtg cctgaaccga 1260 ggtccaagcc gcatgtgccg ctgccgtcct ggattcacc~g gcacctactg tgaactccac 1320 gtcagcgact gtgcccgtaa cccttgcgcc cacggtggc;a cttgccatga cctggagaat 1380 gggctcatgt gcacctgccc tgccggcttc tctggccgac gctgtgaggt gcggacatcc 1440 atcgatgcct gtgcctcgag tccctgcttc aacagggcc:a cctgctacac cgacctctcc 1500 acagacacct ttgtgtgcaa ctgcccttat ggctttgtc~g gcagccgctg cgagttcccc 2560 gtgggcttgc cgcccagctt cccctgggtg gccgtctcc~c tgggtgtggg gctggcagtg 1620 ctgctggtac tgctgggcat ggtggcagtg gctgtgcggc agctgcggct tcgacggccg 1680 gacgacggca gcagggaagc catgaacaac ttgtcggaca tccagaagga caacctgatt 1740 cctgccgccc agcttaaaaa cacaaaccag aagaaggagfc tggaagtgga ctgtggcctg 1800 gacaagtcca actgtggcaa acagcaaaac cacacattg~g actataatct ggccccaggg 1860 cccctggggc gggggaccat gccaggaaag tttccccac:a gtgacaagag cttaggagag 1920 aaggcgccac tgcggttaca cagtgaaaag ccagagtgt.c ggatatcagc gatatgctcc 1980 cccagggact ccatgtacca gtctgtgtgt ttgatatca.g aggagaggaa tgaatgtgtc 2040 attgccacgg aggta 2055 <210> 4 <211> 685 <212> PRT
<213> Human <400> 4 Met Ala Ala Ala Ser Arg Ser Ala Ser G1y Trp Ala Leu Leu Leu Leu Val Ala Leu Trp Gln Gln Arg Ala Ala Gly Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro GIy Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu GIy Thr Asn Ser Phe Ala V'al Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu I1e Iie Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile A1a Ile Gln Gly Ser Leu Ala Val Gly Gln Asn T:rp Leu Leu Asp GIu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser T!~rr Arg Val Ile Cys Sex Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro A;~p Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gl.n Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro AIa G1u Cys Leu 225 230 23.5 240 Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Assn Glu Cys IIe Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp GIn Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Assn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys GIu His Ser Th:r Leu Sex Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu 385 390 :395 400 Lys Lys Val Asp Arg Cys Thr Ser Asn Pro C:ys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys F~rg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser A,sp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala G1y Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Aia Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Assn Cys Pro Tyr Gly Phe 500 5'05 510 Val Gly Ser Arg Cys Glu-Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu A:La Val Leu Leu Val Leu Leu Gly Met Val Ala Val Ala Val Arg Gln Le~u Arg Leu Arg Arg Pro 545 550 5°_iS 560 Asp Asp Gly Ser Arg Glu Ala Met Asn Asn Le:u Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro Ala Ala Gln Leu Lys Aeon Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys Gly Leu Asp Lys Se:r Asn Cys Gly Lys Gln Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Pro Leu Gly Arg Gly Thr Met Pro Gly Lys Phe Pro His Ser Asp Lys Ser Leu Gly Glu Lys Ala Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala Ile Cys Sex Pro Arg Asp Ser Met Tyr Gl.n Ser Val Cys Leu Ile Ser Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 5 <2I1> 510 <212> PRT
<213> Murine 7.
<400> 5 Gln Arg Ala Ala Gly Ser Gly Ile Phe Gln Leu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro GIy Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys H:is Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Ser GIy Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp P.ro Gly fihr Phe Ser Leu Asn I1e Gln Ala Trp His Thr Pro Gly Asp A;sp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile I:Le Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly GIu Ser Cys Ser Arg Leu Cys Lys Lys Arg A::p Asp His Phe Gly His Tyr Glu Cys Gln Pro Asp G1y Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Lle Cys Leu Seer GIy Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys I1e Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser I1e Pro'Trp Gln Cys Ala Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu Hiss Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro Gly fiyr Tyr G1y Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly S;er Ser Tyr Ala Cys Glu Cys Pro.Pro Asn Phe Thr Gly Sex Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His Ile Sex Asp Cys Ala Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Giy Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Tlzr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro 465 470 4'75 480 Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys G1u Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 6 <211> 509 <212> PRT
<213> Murine <400> 6 Arg Ala Ala Gly Ser Gly ile Phe Gln Leu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys fihr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gi;y Ser Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gl;y Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro G1y Asp Asp Leu Arg Pro Glu Thr Ser WO 00!06726 PCT/US99/15710 Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile 7:1e Gln G1y Ser Leu Ala Val G1y Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser F,sp Asn Tyr Tyr Gly Glu 145 150 1.55 160 Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp A,sp His Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro G1y Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Ile Pro Trp Gln Cys Ala Cys A,sp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly P:ro Lys Gly Tyr Thr Cys fihr Cys Leu Pro Gly Tyr Thr Gly Glu His CRTs Glu Leu Gly Leu Ser 290 295 ~ 300 Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln 305 310 3:L5 320 Glu Asn Ser Tyr His Cys Leu Cys Pro Pro G7Ly -Tyr Tyr Gly Gln His Cys Glu His Ser fihr Leu Thr Cys Ala Asp Se:r Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys A1a His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys fih.r Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser G1y Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn 465 470 9:75 480 Asn-Phe Val Cys Asn Cys Pro Tyr Gly Phe V'al Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro T~rp Val Ala <210> 7 <211> 508 <212> PRT
<213> Murine <400> 7 Ala Ala Gly Ser Gly Ile Phe Gln Leu Arg L~eu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe G:l.n Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Vai Ser Thr P~.~o Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Se:r Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gl.y Asn Ser Leu Ile Ser Gln Ile Ile Tle Gl.n Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn As;p Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gl;y Cys Arg His Gly Thr WO 00/06726 PCT/US99/15'710 Cys Ser Ile Pro Trp Gln Cys Ala Cys Asp (ilu Gly Trp Gly GIy Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr Fiis His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro i~ys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly GIy Ser Cys Lys Asp Gln Glu Asn Sex Tyr His Cys Leu Cys Pro Pro Gly T'yr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lays Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr G:Ly Thr His Cys Glu Leu His Ile Sex Asp Cys Ala Arg Ser Pro Cys A:La His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr G7.y Leu Ser Pro Asn Asn 465 470 4 i'5 480 Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gl.y Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Va.l Ala <210> 8 <211> 507 <212> PRT
<213> Murine <400> 8 Ala Gly Ser Gly Ile Phe Gln Leu Arg Leu Gln Glu Phe Val Asn Gln iII

WO OOf~6726 PCT/US99f15710 Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu G1y Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Ser Glly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Txp Pro Gly Thr Phe Ser Leu Asn Ile G1n Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp T:hr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn T;Yr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Plze Giy His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro G:Ly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser G1y Cys H:Ls Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys IIe Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Ile Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His Ha.s Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gl.y Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Le~u Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser WO 0010672b PCT/US99/15710 Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu P,sn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser P.ro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly 435 440 445 ' Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro ' 450 455 460 Cys Phe Asn Gly AIa Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val A:La <210> 9 <211> 506 <212> PRT
<213> Murine <400> 9 Gly Ser Giy Ile Phe Gln Leu Arg Leu Gln G:Lu Phe Val Asn G1n Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Iie Cys Leu Lys His Phe Gln AIa Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Ser G1y Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro G1y Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr 2~rr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe .Gly His Tyr Glu Cys Gin Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys.Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys A:rg His Gly.Thr Cys Ser 225 230 2:35 240 Ile Pro Trp Gln Cys Ala Cys Asp Glu Gly T:rp Gly Gly Leu Phe Cys Asp G1n Asp Leu Asn Tyr Cys Thr His His S<sr Pro Cys Lys Asn Gly Ser Thr Cys Sex Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu G=Ly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro G1y Tyr Tyr G7.y Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn GIy Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val As;p Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr G2y Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Va1 Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 10 <211> 505 <212> PRT
<213> Murine <400> 10 Ser Gly Ile Phe Gln Leu Arg Leu Gln Glu F~he Val Asn Gln Arg Gly Met Leu AIa Asn Gly G1n Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr F~he Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu G'~ly Thr Asn Ser Phe Val Val Arg Asp Lys Asn $er Gly Ser Gly Arg A.sn Pro Leu Gln Leu Pro 6s 7a 75 so Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp T:hr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly T:rp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg H:is Gly Thr Cys Ser Ile 225 230 2:35 240 Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp G:Ly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser P:ro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr 7"hr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr 305 310 ?'.15 320 His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe P;sn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp A,rg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg G'~ly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His IIe Ser Asp Cys Ala Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pra Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 11 <211> 531 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal seqilence and intracellular domain) <400> 11 Gln Arg Ala Ala Gly Ser Gly Ile Phe Gln L~eu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly G.ln Ser Cys Glu Pro Gly l7 Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val S~er Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn S~er Gly Ser Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp &~ro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp A,sp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp GIu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln G1y Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Ile Pro Trp Gln Cys Ala C;ys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp 305 310 3:15 320 Gln Glu Asn Ser Tyr His Cys Leu Cys Pro P:ro G1y Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala A;sp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly S~er Ser Tyr A1a Cys Glu WO 00/06726 PCTlUS99115710 Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His IIe Ser Asp Cys Ala Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn G1y Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile TY~r His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro 465 470 4 i'S 480 Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Le~u Leu Val Met Val Val Val Ala Val <210> 12 <211> 530 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal sequence and intracellular domain) <400> 12 Arg Ala Ala Gly Ser Gly Ile Phe G1n Leu Arg Leu Gln Glu Phe Va1 Asn Gln Arg Gly Met Leu Ala Asn GIy Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser 35 40 . 45 Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser G1y Ser Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro G1y Thr Phe Ser Leu Asn Tle Gln Ala Trp His Thr Pro Gly Asp Asp Le~u Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu IIe Ser Gln Ile Ile Il.e Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln As,n Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser As.p Asn Tyr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Le~u Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Ile Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gin Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser GIy Pro Lys Gly Tyr Thr Cys -Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys G1u Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Th.r Gly Thr His Cys Glu Leu His Ile Ser Asp,Cys Ala Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile fihr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys fiyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Tr;p Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Val Val Val Ala Val <210> 13 <211> 529 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal sequence and intracellular domain}
<400> 13 Ala Ala Gly Ser Gly Iie Phe Gln Leu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cy~s Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gl:n Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Va1 Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Se:r Gly Arg Asn Pro Leu 65 70 7.5 80 Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Th:r Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile I1e Gln Gly Ser Leu Ala Va1 Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Assn Tyr fiyr Gly Glu Ser WO 00/46726 2' PCT/US99115710 Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp Hi.s Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn GLy Cys Arg His Gly Thr Cys Ser Tle Pro Trp Gln Cys Ala Cys Asp Gl.u Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr Hi.s His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Giy Glu His Cys Gl.u Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Seer Cys Lys Asp Gln Glu 305 310 31.5 320 Asn Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr G1y Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gl.y Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys Al.a His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser G1y Arg Arg Cys Glu Val Arg Ile Thr His Asop Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly A1a Thr Cys Tyr Thr GLy Leu Ser Pro Asn Asn 465 470 4 i'5 480 Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gl.y Ser Arg Cys Glu Phe WO 00/06726 PCTIUS99/15'110 Pro Val Gly Leu Pro Pro Ser Phe Pro Trp V<~1 Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu V<~l Met Val Val Val Ala Val <210> 14 <211> 528 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal! sequence and intracellular domain) <400> 14 Ala Gly Ser Gly Ile Phe Gln Leu Arg Leu GJ.n Glu Phe VaJ. Asn Gln Arg Giy Met Leu Ala Asn Gly Gln Ser Cys GJ.u Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln AJ.a Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Ser GJ.y Arg Asn Pro Leu Gln 65 70 i'S 80 Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Px-o GJ.u Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gl.y Ser Leu A1a Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys 145 150 15.5 160 Ser Arg Leu Cys Lys Lys Arg Asp Asp His Pre Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gl.y Trp Thr Gly Lys Tyr 180 i85 190 Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys Hi.s G1u Gln Asn Gly Tyr Cys Ser Lys Pro Asp G1u Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg.

Leu Cys Asn G1u Cys I1e Pro His Asn Gly Cys Arg His GIy Thr Cys 225 230 23.5 240 Ser Ile Pro Trp Gln Cys Ala Cys Asp Glu Gl.y Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His Hi.s Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Sex Gly Pro Lys Gl.y Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Le:u Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn 305 310 315, 320 Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala-Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Sex Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg 385. 390 395 400 Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys A1a Arg Ser Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp A1a Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val G1y Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Val Val Va1 Ala Val WO 00106726 PCTlUS99/15710 <210> 15 <211> 527 <212> PRT
<223> Murine <220>
<223> Murine protein sequence (less signal sequence and intracellular domain) <400> 15 Gly Ser Gly Ile Phe Gln Leu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe A:rg Ile Cys Leu Lys His Phe Gln Ala Th,r Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Giy Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Ser Gly Arg Asn Pro Leu G1n Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Tle I1e Ile G1n Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr G1u Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp .Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys I1e Pro His Asn Gly Cys Arg His Gly Thr Cys Sex Ile Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys ASn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu 275 280 285 .

Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gl.y Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln GIu Asn Ser 305 310 39.5 320 Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gl.y GIn His Cys Gl.u His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln G1y Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr~Gly Ser Asn Cys Glu Lys Lys Val Asop Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys.Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr H3.s Cys G1u Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys AIa His Gl.y Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys fihr Cys Pro Al.a Gly Phe Ser Gly Arg Arg Cys Glu VaI Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn GIy Ala Thr Cys Tyr Thr Gly Leu Se:r Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val A1a Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met V~~l Val Val Ala Val <210> 16 <211> 526 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal. sequence and intracellular domain) <400> 16 Ser Gly Ile Phe Gln Leu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala ~.sn G1y Gln Ser Cys Glu Pro Gl.y Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gl.y Thr Asn Ser Phe Val Val Arg Asp Lys Asn. Ser Gly Ser Gly Arg Assn Pro Leu G1n Leu Pro Phe Asn Phe Thr Trp Pro G1y Thr Phe Ser Leu Asn Ile Gln Ala Trp ~iis Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Le~u Ala Val Gly Lys Ile 115 120 _ 125 .
Trp Arg Thr Asp G1u Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val IIe Cys Ser Asp Asn Tyr Tyr Gl.y Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly Hi.s Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gl.n Asn Gly.Tyr Cys Ser 19.5 200 205 Lys Pro Asp G1u Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Tle Pro His Asn Gly Cys Arg Hi.s Gly Thr Cys Ser Ile 225 230 23.5 240 Pro Trp G1n Cys Ala Cys Asp Glu Gly Trp Gl.y Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Sex Thr Cys Ser Asn Ser GIy Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys A:~p Gln Glu Asn Ser Tyr 305 310 31.5 320 His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly;Gl.n His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly GIy Ser Cys Arg Glu Arg Asn G1n Gly Ser Ser Tyr Ala Cys Gl.u Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gl.y Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys Ala His Gly Gl.y Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gl.y Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Al.a Ser Gly Pro Cys Phe Asn Gly Ala Thr CyS Tyr Thr G1y Leu Ser Pro Asn Asn Phe Val Cys 465 470 4 i'S 480 Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Val Va~1 Val Ala Val <210> 17 <211> 664 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal. sequence) <400> 17 Gln Arg Ala Ala Gly Ser Gly Tle Phe G1n Le:u Arg Leu Gln Glu Phe Va1 Asn Gln Arg Gly Met Leu Ala Asn Gly Gl.n Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys Hi,s Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Se:r Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Seer Gly Ser Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Ae;p Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln I1e Il.e Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu G:Ln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val I1e Cys Sear Asp Asn Tyr Tyr GIy 145 150 1!i5 160 Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg A:ap Asp His Phe Gly His Tyr Glu Cys Gln Pro Asp G1y Ser Leu Ser Cys Leu Pro G1y Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Sesr Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro Hpa Asn Gly Cys Arg His 225 230 2~5 240 Gly Thr Cys Ser Ile Pro Trp Gln Cys Ala Cys Asp G1u Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gl.y Pro Lys Gl.y Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu Hi.s Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gl.y Gly Ser Cys Lys Asp 305 310 31.5 320 Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala As;p Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg :Glu Arg Asn Gln Gly Seer Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Gl,u Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gl.n Cys Leu Asn Arg Gly.

Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Ph:e Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser.Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Th.r His Asp Ala Cys Ala WO 00106726 PCT/US991i5710 Ser G1y Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr G1y Leu Ser Pro 465 470 4 i'S 480 Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Pre Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Le~u Leu Val Met Val Val Val Ala Val Arg G1n Leu Arg Leu Arg Arg Pro Asp Asp Glu Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro 545 550 55.5 560 Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Le:u Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Leu Leu GIy Arg Gly Ser Met Pro Gly Lys Tyr Pro His Ser Asp Lys Ser Leu Gly Gl.u Lys Val Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Se:r Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Il.e Ser Glu Glu Arg Asn Glu Cys Val I1e Ala Thr Glu Val <210> 28 <211> 663 <212> PRT
<213> Murine <220>
<223> Murine protein sequence iless signal. sequence) <400> 18 Arg Ala Ala Gly Ser Gly Tle Phe Gln Leu Arg Leu G1n Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Se:r Cys G1u Pro G1y Cys 20' 25 30 Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser G7.y Ser Gly Arg Asn Pro 65 70 ~'S 80 3a Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro G:Ly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp L<~u Arg Pro Glu Thr Ser 1oa 10~ m o Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Aap Asn Tyr Tyr Gly Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp A:>p His Phe Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro GIy Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn i95 200 205 G1y Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Assn Gly Cys Arg His Gly Thr Cys Ser Lle Pro Trp Gln Cys Ala Cys As;p Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys TY;~r His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu WO 00106726 PCTlUS99/15710 Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cars Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Al:a Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn 465 470 4',~5 480 Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys G1u Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Val Val Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Glu Ser Arg Glu 530 535 ' 540 Ala Met Asn Asn Leu Ser Asp Phe Gln Lys A:~p Asn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Gl.u Leu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Leu Gl.n Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Leu Leu Gly Arg Gl.y Ser Met Pro Gly Lys Tyr Pro His Ser Asp Lys Ser Leu Gly Glu Lys Va1 Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Al.a Ile Cys Sex Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile Seer Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 19 <211> 662 <212> PRT
<213> Marine <220>
<223> Marine protein sequence (less signal. sequence) <400> 19 Ala Ala Gly Ser Gly IIe Phe Gln Leu Arg Le~u Gln Glu Phe Val Asn Gln Arg G1y Met Leu Ala Asn Gly Gln Ser Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Giy Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser Gly Seer Gly Arg Asn Pro Leu 65 70 '~5 80 Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Sex Pro Gly Asn Ser Leu T1e Ser Gln Ile I1e Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser 145 150 i55 160 Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Giy His Tyr Glu Cys Gln Pro Asp GIy Ser Leu Ser Cys Leu Pro G1y Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr 225 230 2a5 240 Cys Ser Ile Pro Trp Gln Cys Ala Cys Asp G:Lu GIy Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr H:LS His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Ly_s Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr G1y Glu His Cys G:Lu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly G1y Ser Cys Lys Asp Gln Glu 305 310 3:L5 320 Asn Ser Tyr His Cys Leu Cys Pro Pro Gly T~,rr Tyr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser P:ro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro WO 00/0672b PCT/US99115710 Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr 370 375 y 380 Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Lc~u Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr G:ly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys A:La His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr G'_Ly Leu Ser Pro Asn Asn 465 470 4'75 480 Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Sex Leu Gly Val Gly Leu Va1 Val Leu Leu Val Leu Leu Val Met Val Val Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Glu Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp A:an Leu Ile Pro Ala Ala 545 550 5Ei5 560 Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Le:u Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Leu G1n A:an His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Leu Leu Gly Arg Gly Se:r Met Pro GIy Lys Tyr Pro His Ser Asp Lys Ser Leu Gly Glu Lys Val Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala I7le Cys Ser Pro Arg Asp 625 630 6:95 640 Ser Met Tyr Gln Ser Val Cys Leu Ile Ser G7lu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val WO OO/Ob72b PCT/US99/15710 <210> 20 <211> 661 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signa:L sequence) <400> 20 Ala Gly Sex Gly Ile Phe Gln Leu Arg Leu G:Ln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys G:Lu Pro Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln A:La Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro Val Leu Gly Thr Asn-Ser Phe Val Val Arg Asp Lys Asn Ser Gly Ser G:Ly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln g5 90 95 Ala fire His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln G:Ly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp GIu Gln Asn Asp TJ:lr Leu Thr Arg Leu Ser Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys 145 150 1!i5 160 Ser Arg Leu Cys Lys Lys Arg Asp Asp His PJze Gly His Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro G:Ly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys H:is Glu Gln Asn Gly Tyr 195 200 205.
Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg P:ro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys 225 230 2:35 240 Ser Ile Pro Trp Gln Cys Ala Cys Asp Glu G:Ly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His H:is Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr GIy Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser C~,~s Lys Asp Gln Glu Asn 305 310 3:L5 320 Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr 'htr Gly Gln His Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro C~_ls Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr A:La Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys AIa Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro G1y Phe Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys Ala His G1y Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Va1 Arg Ile Thr His Asp A_La Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Le~u Ser Pro Asn Asn Phe 465 470 4'75 480 Val Cys Asn Cys Pro Tyr Gly Phe VaI Gly Seer Arg Cys Glu Phe Pro Val GIy Leu Pro Pro Ser Phe Pro Trp Val A:La Val Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Mea Val Val VaI Ala Val 515 520 .._ 525 Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp G=Lu Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Ls:u Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu G_Lu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Leu Gln Asn H7LS Thr Leu Asp Tyr Asn Leu Ala Pro Gly Leu Leu Gly Arg Gly Ser Meet Pro Gly Lys Tyr Pro His Ser Asp Lys Ser Leu Gly Glu Lys Val P~.~o Leu Arg Leu His Ser Glu Lys Piro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile Ser Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210a 21 <211> 660 <212> PRT
<213> Murine <220>
<223> Marine protein sequence (less signa:L sequence) <400> 21 Gly Ser Gly Ile Phe Gln Leu Arg Leu G1n Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Paso Gly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe G1y Asn Val Ser Thr Pro Val Le:u Gly Thr Asn Ser Phe Val Val-Arg Asp Lys Asn Ser Gly Ser Gly Ax-g Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Gl.u Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Tle Ile T1e Gln Gly Se:r Leu A1a Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Le;ii Thr Arg Leu Ser Tyr Ser Tyr Arg Val Tle Cys Ser Asp Asn Tyr Tyr Gly Glu Ser Cys Ser 145 150 15.5 160 Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr Glu Cys GIn Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Sex Ile Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp Giy Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys A1a Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys L;ys Asp Gln Glu Asn Ser Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Gln His-Cys Glu His Ser Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly G1y Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr H~.s Cys Glu Leu His Ile 405 410 47.5 Ser Asp Cys Ala Arg Ser Pro Cys Ala His G7.y Gly Thr Cys His Asp Leu GIu Asn Gly Pro Val Cys Thr Cys Pro Al.a G1y Phe Ser G1y Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr GIy Leu Seer Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Va.l Ser Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Va.I Val Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Glu Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Leu Gln Asn His T'hr Leu Asp Tyr Asn Leu Aia Pro Gly Leu Leu Gly Arg Gly Ser Met Pro Gly Lys Tyr Pro His Ser Asp Lys Ser Leu Gly Glu Lys Val Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala Tle Cys Ser Pro Arg Asp Ser Met Tyr GIn Ser Val Cys Leu Ile Ser Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 22 <211> 659 <212> PRT
<213> Murine <220>
<223> Murine protein sequence (less signal sequence?
<400> 22 Ser Gly Ile Phe Gln Leu Arg Leu Gln Glu Plze Val Asn G1n Arg Gly Met Leu Ala Asn Gly Gln Ser Cys Glu Pro G:Ly Cys Arg Thr Phe Phe Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro Cys Thr Phe Gly Asn Val Ser Thr Pro VaI Leu G:ly Thr Asn Ser Phe Val Val Arg Asp Lys Asn Ser G1y Ser Gly Arg Aan Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Le:u Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Fro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile Gln Gly Ser Leu Ala Val Gly Lys Ile Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr Ser 13 0 13 5 1.40 Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gl.y Glu Ser Cys Ser Arg Leu Cys Lys Lys Arg Asp Asp His Phe Gly Hi.s Tyr Glu Cys Gln Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp TYir Gly Lys Tyr Cys Asp Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Asp Glu Cys Ile Cys Arg Pro Gly T'rp Gln Gly Arg Leu Cys Asn Glu Cys Tle Pro His Asn Gly Cys Arg His Gly Thr Cys Ser I1e Pro Trp Gln Cys Ala Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu Pro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser Tyr 305 310 3:15 320 His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly G:ln His Cys Glu His Ser 325 330. 335 Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Aan Gly Gly Ser Cys Arg Glu Arg Asn Gln G1y Ser Ser Tyr Ala Cys G:Lu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys AIa Asn Gly Gly GIn Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His Ile Ser Asp Cys Ala Arg Ser Pro Cys Ala His GIy Gly Thr Cys His Asp Leu Glu Asn Gly Pro Val Cys Thr Cys Pro A1a G7Ly Phe Ser Gly Arg Arg Cys Glu Val Arg Ile Thr His Asp Ala Cys A7La Ser Gly Pro Cys Phe Asn Gly Ala Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Se:r Leu Gly Val Gly Leu Val Val Leu Leu Val Leu Leu Val Met Val Val Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Glu Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile faro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys. Glu Leu Glu Val A.sp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Leu C<ln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Leu Leu Giy Arg Gly Ser Met Pro Gly Lys Tyr Pro His Ser Asp Lys Ser Leu Gly Glu Lys Val Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile Ser Glu Glu Arg Asn G1u Cys Val Ile Ala Thr G1u Val <210> 23 <211> 508 <212> PRT
<213> Human <400> 23 Ala Ala Gly Ser Gly Val Phe GIri Leu Gln Le:u Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe G7.n Ala Val Val Ser Pro GIy Pro Cys Thr Phe Gly Thr Va1 Ser Thr Px-o Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gl.y Gly Arg Asn Pro Leu Glri Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Aia Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Seer Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr GIy Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu 1?ro Gly Trp Thr Gly Glu Tyr Cys Gln.Gln Pro Ile Cys Leu Ser Gly C:ys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly 210 215 220 .
Arg Leu Cys Asn GIu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr 225 230 2'.35 240 Cys Ser Thr Pro Trp Gln Cys Thr Cys. Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr H:is His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln A.rg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser P:ro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn fiyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr --Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Lf~u Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro G1y Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys A=La His Gly Gly fihr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile A:~p Ala Cys A1a Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr A:~p Leu Ser Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gl.y Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 24 <211> 507 <212> PRT
<213> Human <400> 24 Ala Gly Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu l 5 10 15 Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gljr Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pra Gly Thr P:he Ser Leu Ile Ile G1u Ala Trp His Ala Pro Gly Asp Asp Leu Arg P:ro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln G:Ly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Tlzr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys 145 150 1'.~5 160 Ser Arg Leu Cys Lys Lys Arg Asn Asp His Plze Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro G:Ly Trp Thr Gly Glu Tyr 1$0 1$5 190 Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys H:is Glu Gln Asn Gly Tyr 195 2bb 205 Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys 22S 230 2:55 240 Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu GLy Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Seer Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser C;ys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys .Pro Pro Gly Tyr T.yr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cars Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr A:La Cys Glu Cys Pro Pro 355 3b0 365 Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly.Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Al.a Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Le;u Sex Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Se;r Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 25 <211> 506 <212> PRT
<213> Human <400> 25 Gly Ser G1y Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Va1 Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser fihr Pro Val Leu G1y Thr Asn Ser Phe 50 55 b0 WO 00/06?26 PCTIUS99/15?10 Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe S~er Lau Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro G.lu Ala Leu Pro Pro Asp Ala Leu I1e Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val GIy Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Lc~u Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln GIn Pro Ile Cys Leu Ser Gly Cys His Gl.u Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gl.y Trp G1n Gly Arg Leu Cys Asn Glu Cys IIe Pro His Asn.Gly Cys Arg His Gly Thr Cys Ser 225 230 23.5 240 Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Seer Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr G1y Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr A1a Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg MeL

Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val 465 470 4'75 480 Cys Asn Cys Pro Tyr Gly Phe Va1 Gly Ser P.rg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 26 <211> 505 <212> PRT
<213> Human <400> 26 Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Al~a Leu Pro Pro Asp Ala Leu Ile.Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Th:r Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln WO 00/0672b PCT/US99/15710 Gln Pro Ile Cys Leu Ser Gly Cys His Glu G:ln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Z'rp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg H:is Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp G!ly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asia Gly Ala Thr,Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr.Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly L~eu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Assn Gly Gly Ser Cys Arg Glu Arg Asn GIn Gly Ala Asn Tyr Ala Cys G:Lu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp A:rg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg G:Ly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cy_s Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala_His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala G7Ly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr_Ser Ile Asp Ala Cys A7_a Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala WO 00/06726 PCTNS99l15710 <210> 27 <211> 504 <212> PRT
<213> Hurnan <400> 27 Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala~Val Arg Asp Asp Ser Sex Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu A:La Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val I1e Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu 145 150 1!i5 160 Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro G1y Trp Thr G7Ly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln A:>n GIy Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gl.n Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gl.y Thr Cys Ser Thr Pro 225 230 23.5 240 Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gl.y Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Seer Glu Cys Asp Ser Asn WO 00l0672G PCT/US99/15710 Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Giy Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg 385 390 ~ 395 400 Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly T:hr Cys His Asp Leu Glu Asn G1y Leu Met Cys Thr Cys Pro Ala Gly Plhe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Iie Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Asn 465 470 4'75 480 Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys G:Lu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala <210> 28 <211> 503 <212> PRT
<213> Human <400> 28 Val Phe Gln Leu Gln Leu G1n G1u Phe Ile A:~n Glu Arg Gly Va1 Leu Ala Ser G1y Arg Pro Cys Glu Pro Gly Cys Ax-g Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro GIy Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly G1y Gly Arg Asn Pro LE~u Gln Leu Pro Phe Asn 65 70 ~'5 80 Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile I7.e Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp A1a Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr V.al Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly G:lu Tyr Cys Gln Gln Pro I1e Cys Leu Ser Gly Cys His Glu Gln Asn G:Ly Tyr Cys Ser Lys Pro Ala G1u Cys Leu Cys Arg Pro Gly Trp Gln G:Ly Arg Leu Cys Asn Glu Cys IIe Pro Hi.s Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp 225 230 235 240 ' Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys LSrs Asn G1y Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr 275 280 . 285 Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Gl.u Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Gl.u Asp Gly Tyr His Cys 305 310 31.5 320 - Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys G1u His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gl.y Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Th.r Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn WO 0010672b PCT/US99I15710 Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu 435 440 . 445 Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp T:hr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu P:he Pro Val Gly Leu Pra Pro Ser Phe Pro Trp Val Ala <210> 29 <212> 529 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence and intracellular domain) <400> 29 Ala Ala Gly Ser G1y Val Phe Gln Leu Gln Le:u G1n Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys G1u Pro Gly Cys Arg Thr Phe Phe Arg Va1 Cys Leu Lys His Phe Gl.n Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gl.y Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Giy Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu WO 00/06726 ~ PCT/US99/15710 Tyr Cys Gln Gln Pro Ile Cys Leu Ser G1y C'ys His Glu GIn Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys A.rg Pro Gly Trp Gln Gly 210 215. 220 Arg Leu Cys Asn Glu Cys Ile Pro His Asn G1y Cys Arg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly VaI Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly S~er Cys Lys Asp Gln G1u Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Sex Cys Ala Asp Ser P:ro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys G1u Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr 370 375 y 380 Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Le~u Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr G7Ly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys A7.a His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile A:op Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr 465 470 4 i'5 480 Phe Val Cys Asn Cys Pro Tyr Gly Phe Va1 Gl.y Sex Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Va~l Ala Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu Gl.y Met Val Ala Val Ala Val <210> 30 <211> 528 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal, sequence and intracellular domain) <400> 30 Ala Gly Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Va1 Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr P:he Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg P:ro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln G1y Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Tlhr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Plze Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro G:Ly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys H_'LS Glu Gln Asn Gly Tyr Cys Ser Lys Pro Aia Glu Cys Leu Cys Arg Pro Gly Trp Gln G1y Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys 225 230 2.:5 240 Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His H9_s Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser G1y Gln Arg ~>er Tyr Thr Cys fihr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly G1y Ser C'ys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro C'ys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr A.la Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys V'al ASp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe 465 470 4'75 480 Val Cys A.sn Cys Pro Tyr Gly Phe Val Gly S~er Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val A:la Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu Gly Met Val Ala Val Ala Val <210> 31 <211> 527 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence and intracellular domain) <400> 31 G1y Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Faro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala V'al Va1 Ser Pro G1y Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly A.rg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly G1n Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe G1y His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro G1y T:rp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His G:Lu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro G:Ly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys A:rg His Gly Thr Cys Ser 225 230 2:35 240 Thr Pro Trp Gln Cys Thr Cys Asp Glu G1y T:rp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His S<~r Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu G:Lu Leu Ser Glu Cys Asp Ser A.sn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Giu Asp Gly 305 33.0 3:L5 320 Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr G:Ly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly AIa Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr T;yr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn G1y Leu Met Cys Thr Cys Pro A.la Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys AIa Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val 465 470 4'75 480 Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val 485 490 495 .
Gly Leu Pro Pro Ser Phe Pro Trp Val Aia Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu G1y Met Val Ala Val Ala Val <210> 32 <211> 526 <212> PRT
<213> Human <220> ' <223> Human protein sequence iless signal sequence and intracellular domain) <400> 32 Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser GIy Arg Pro Cys Glu Pro G7.y Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe G1y Thr Val Ser Thr Pro Val Leu Gl.y Thr Asn Ser Phe Ala SO 55 60' Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Axon Pro Leu Gln Leu Pro 65 70 i'5 80 Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Le:u I1e Ile Glu Ala Trp His A1a Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile G1n Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu TYir Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gl.y Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe GIy Hi.s Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly G1u Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gl.n Asn Giy Tyr Cys Ser.

Lys Pro Ala Glu Cys Leu Gys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg Hi.s Gly Thr Cys Ser Thr Pro Trp Gin Cys Thr Cys Asp Glu Gly Trp Gl.y Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Le:u Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Le:u His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe As.n Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Va1 Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gl.y Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr G1y Thr Tyr Cys Glu Leu His Val Ser Asp Cys A1a Arg Asn Pro Cys Ala His Gly G:Ly Thr Cys His Asp Leu G1u Asn Gly Leu Met Cys Thr Cys Pro Ala G:Ly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys A:La Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val.Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Giy Leu PrO Pro Ser Phe Pro Trp Val Ala Val Se:r Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu Gly Met Val AT.a Val Ala Val <210> 33 <211> 525 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence and intracellular domain) <400> 33 Gly Va1 Phe Gln Leu Gln Leu Gln Glu Phe I7.e Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Va1 Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val.Leu GIy TY~r Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe 65 70 i'5 80 Asn Phe Thr Trp Pro Gly Thr Phe,Ser Leu Tl.e Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Le:u Pro Pro Asp Ala Leu Ile Ser Lys Ile AIa Ile Gln Gly Ser Leu Al.a Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly A:op Asn Cys Ser Arg Leu 145 150 lci5 160 5~
Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln A.sn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro G1y Tyr Thr Gly Val Asp Gys Glu Leu G1u Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn.Gly Gly Ser Cys Lys Asp Gln Glu Asp GIy Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly.Ala Asn Tyr Ala Cys Glu C:ys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg C;ys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp VaI Ala Val Ser Leu Gly Val GIy Leu Ala Val Leu Leu Val Leu Leu GIy Met Val Ala Val Ala Val <210> 34 <211> 524 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence and intracellular domain) <400> 34 Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro GIy Pro Cys Thr Phe Gly fihr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn s5 70 75 so Phe fihr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro GIu Ala Leu Pro Pro Asp Ala Leu Ile 100 105 11.0 Ser Lys Ile Ala IIe Gln Gly Ser Leu Ala V~al Gly Gln Asn Trp Leu i15 120 125 Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr V~al Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro IIe Cys Leu Sex Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly fi:hr Cys Ser Thr Pro firp sa Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly.Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg G1u Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val.Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Sex Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp T:hr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu P:he Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu Gly Met Vai Ala Val Ala Val <210> 35 <211> 682 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence) <400> 35 Ala A1a Gly Ser Gly VaT Phe Gln Leu Gln Leu Gln Glu Phe IIe Asn Glu Arg Gly Vai Leu Ala Ser Gly Arg Pro Cys Glu Pro G1y Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe fihr Trp Pro Gly T;hr Phe Ser Leu Ile Ile Glu Aia Trp His Ala Pro Gly Asp Asp Leu A:rg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile G:Ln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn 145 150 1!55 160 Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp H:Ls Phe Gly His Tyr Val Cys Gln Pro Asp Giy Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Giu 180. 185 190 Tyr Cys Gln Gin Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr 225 230 2:35 240 Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp G".Lu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Giy Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Giy Val Asp Cys GLu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Se:r Cys Lys Asp Gln Glu 305 310 3~'~5 320 Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser ~?ro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn 9:~yr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser 385 390 3.95 400 Arg Met Cys Arg Cys Arg Pro Gly Phe Thr C:ly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr C:ys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg fihr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr F~sp Leu Ser Thr Asp Thr 465 470 9:75 480 Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro VaI Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu Gly Met Val Ala Val Ala Va1 Arg Gln Leu Arg Leu Arg Arg Pro Asp F~sp Gly Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp P~sn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu L~eu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Gln Gln P~sn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Pro Leu Gly Arg Gly Thr Met Pro Gly Lys Phe Pro His Ser Asp Lys Ser Leu Gly Glu Lys F~la Pro Leu Arg Leu His Sex Glu Lys Pro Glu Cys Arg Ile Ser Ala I:le Cys Ser Pro Arg Asp 625 630 E~35 640 Ser Met Tyr Gln Ser Val Cys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val C:ys Leu Ile Ser Glu Glu WO 00/06726 PCTlUS99/15710 s3 Arg Asn Glu Cys Val I1e Ala Thr Glu Val <210> 36 <211> 681 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence) <400> 36 Ala Gly Ser Gly Val Phe G1n Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser GIy Arg Pro Cys Glu Pro G1y Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln A.la Val Val Ser Pro G1«

Pro Cys Thr Phe Gly Thr Val Ser Thr Pro V'al Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly G1y Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro G1y Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Sex Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr G1y Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp 305 3i0 315 320 Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr G1y Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gin Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro 355 360 ' 365 Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Sex Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Va1 A.la Va1 Ser Leu Gly Val Gly Leu Ala Val Leu Leu VaI Leu Leu Gly M:et VaI Ala Val Ala Va1 Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Gly Ser Arg Glu Ala Met Asn Asn -Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Gln Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Pro Leu Gly Arg Gly Thr M:et Pro Gly Lys Phe Pro His Ser Asp Lys Ser Leu Gly Glu Lys Ala Fro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr G1n Ser Val Cys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile Ser G1u Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 37 <211> 680 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence <400> 37 Gly Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Giy Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe GIy Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Sex Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr firp Pro Gly Thr Phe Ser Leu Ile Ile G1u Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Sex Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys WO 00/06726 ~ PCT/US99115710 Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys I1e Pro His Asn Gly Cys F,rg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His ~~er Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Sex Z'yr Thr Cys Thr Cys Arg Pra Gly Tyr Thr Gly Val Asp Cys Glu Leu C?lu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys L,ys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys F~he Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala C'ys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val P,sp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn P,rg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Z'yr Cys G1u Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Grly Gly Thr Cys His Asp Leu Glu Asn-Gly Leu Met Cys Thr Cys Pro P,la Gly Phe Ser G1y Arg Arg Cys Glu Val Arg Thr Ser I1e Asp Ala C:ys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val 465 470 9:75 480 Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser p~rg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu G1y Val Gly Leu Ala Val Leu Leu Val Leu Leu Gly Met Val Ala Val AIa Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Gly Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe GIn Lys Asp Asn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Gln Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Pro Leu Gly Arg Gly Thr Met Pro G1y Lys Phe Pro His Ser Asp Lys Ser Leu Gly Glu Lys Ala Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser Ala I1e Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Pro Glu Cys Arg Ile Ser Ala T1e Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Va1 Cys Leu Ile Ser Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 38 <211> 679 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence) <400> 38 Ser Gly Val Phe Gln Leu Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Va1 Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp ASp Leu Arg Pro Glu A.la Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Z'hr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg 145 150 1.55 160 Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg H:is Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser F'ro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly G1n Arg Ser Tyr Thr Cys Thr Cys Arg Pro 275. 280 285 Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Lieu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys A,sp Gln GIu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly L~eu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe A,sn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly A1a Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Va1 Asp A.rg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr C'ys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys A,la Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys 465 470 9:75 480 WO OOlOb72b PCT/US991157I0 Asn Cys Pro Tyx Gly Phe Val Giy Ser Arg Cys G1u Phe Pro Val Giy Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu Leu Giy Met Val Ala Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Gly Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Leu I1e Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu VaI Asp Cys G1y Leu Asp Lys Ser Asn Cys Gly Lys Gln Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Pro Leu Gly Arg Gly Thr Met Pro Gly Lys Phe Pro His Ser Asp Lys Ser Leu Gly G1u Lys Ala Pro Leu A:rg Leu His Ser Glu Lys 610 615 b20 Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser P:ro Arg Asp Ser Met Tyr 625 630 6:35 640 Gln Ser Val Cys Pro Glu Cys Arg Ile Ser A:la Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Tle S~er Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 39 <211> 678 <212> PRT
<213> Human <220>
<223> Human protein sequence (less signal sequence) <400> 39 Gly Val Phe Gln Leu Gln Leu Gln Glu Phe I:le Asn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val. Cys Leu Lys His Phe G1n Ala Val Val S~~r Pro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Tlhr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn P:ro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro G1u Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr G1y Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly G1y Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly f'he Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr A.sp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro VaI Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser L~eu Gly Val Gly Leu Ala 500 505 510 , Val Leu Leu Val Leu Leu Gly Met Val Ala V'al Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Gly Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro A.la Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp C'ys Gly Leu Asp Lys Ser Asn Cys Gly Lys Gln Gln Asn His Thr Leu A.sp Tyr Asn Leu Ala Pro.

Gly Pro Leu Gly Arg Gly Thr Met Pro Gly L~ys Phe Pro His Ser Asp Lys Ser Leu Gly Glu Lys Ala Pro Leu Arg L~eu His Ser G1u Lys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Axg Asp Ser Met Tyr G1n Ser Val Cys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile Ser Glu Glu Axg Asn Glu Cys Val Ile Aia Thr Glu Vai <210> 40 <211> 677 <212> PRT
<213> Human <220>
<223> Human, protein sequence (less signal sequence) <400> 40 Val Phe Gln Leu Gln Leu Gln Glu Phe Ile P,sn Glu Arg Gly Val Leu Ala Ser Gly Arg Pro Cys GIu Pro Gly Cys i~rg Thr Phe Phe Arg Val Cys Leu Lys His Phe Gln Ala Val Val Ser I?ro Gly Pro Cys Thr Phe Gly Thr Val Ser Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser Gly Gly Gly Arg Asn Pro I~eu Gln Leu Pro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Ile 7Cle Glu Ala Trp His Ala Pro Gly Asp Asp Leu Arg Pro Glu Ala Leu I?ro Pro Asp A1a Leu Ile Ser Lys Ile Ala Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln Thr Ser Thr Leu Thr Arg I~eu Arg Tyr Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln C~ly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly G1y Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser G:lu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln C:lu Asp Gly Tyr His Cys 305 310 3.15 320 Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His C;ys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Crly Ser Cys Arg Glu Arg WO 00106'726 PCTIUS99/15710 Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Fro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu 435 ~ 440 445 Val Arg Thr Ser Ile Asp A1a Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Sex Arg Cys G1u Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Trp Val Ala Val Ser Leu Gly Val Gly Leu A1a Val Leu Leu Val Leu Leu Gly Met Val Ala Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro Asp Asp Gly Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys Asp Asn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys Glu Leu Glu Val Asp Cys GIy Leu Asp Lys Ser Asn Cys Gly Lys Gln Gln Asn His Thr Leu Asp 'I'yr Asn Leu Ala Pro Gly Pro Leu Gly Arg Gly Thr Met Pro Gly Lys P:he Pro His Ser Asp Lys , Ser Leu Gly Glu Lys Ala Pro Leu Arg Leu His Sex Glu Lys Pro Glu Cys Arg Ile Ser Ala I1e Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Pro Glu Cys Arg Ile Ser Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile Ser Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val <210> 41 <211> 402 <212> DNA
<213> Murine <400> '41 caccgggaga cgacctgcgg ccagagantt cgccaggaaa ctctctcatc agccaaatca 60 tcatacaagg ctctcttgct gtgggtaaga tttggcgaac agacgagcaa aatgacaccc 120 tcaccagact gagctactct taccgggtca tctgcagtga caactactat ggagagagct 180 gttctcgcct atgcaagaag cgcgatgacc acttcggaca ttatgagtgc cagccagatg 240 gcagcctgtc ctgcctgccg ggctggactg ggaagtactg tgaccagcct atatgtcttt 300 ctggctgtca tgagcagaat ggttactgca gcaagccaga tgagtgcatc tgccgtccag 360 gttggcaggg tcgcctgtgc aatgaatgta tccccccatg at 402 <210> 42 <211> 25 <212> DNA
<213> Murine <400> 42 tgctgtgggt aagatttggc gaaca 25 <210> 43 <211> 27 <212> DNA
<213> Murine <400> 43 ccatcctaat acgactcact atagggc 27 <210> 44 <211> 2718 <212> DNA
<213> Murine <400> 44 tgctgtgggt aagatttggc gaacagacga gcaaaatgac accctcacca gactgagcta 60 ctcttaccgg gtcatctgca gtgacaacta ctatggagag agctgttctc gcctatgcaa 120 gaagcgcgat gaccacttcg gacattatga gtgccagcca gatggcagcc tgtcctgcct 180 gccgggctgg actgggaagt actgtgacca gcctatatgt ctttctggct gtcatgagca 240 gaatggttac tgcagcaagc cagatgagtg catctgccgt ccaggttggc agggtcgcct 300 gtgcaatgaa tgtatccccc acaatggctg tcgtcatggc acctgcagca tcccctggca 360 gtgtgcctgc gatgagggat ggggaggtct gttttgtgac caagatctca actactgtac 420 tcaccactct ccgtgcaaga atggatcaac gtgttccaac agtgggccaa agggttatac 480 ctgcacccgt ctcccaggct acactggtga gcactgtgag ctgggactca acaagtgtgc 540 cagcaacccc tgtcgaaatg gtggcagctg taaggaccag gagaatagct accactgcct 600 gtgtccccca ggctactatg gccagcactg tgagcatagt accttgacct gtgcggactc 660 accctgcttc tatgggggct cttgccggga gcgcaaccag gggtccagtt atgcctgcga 720 atgccccccc aactttaccg gctctaactg tgagaagaaa gtagacaggt gtaccagcaa 780 cccgtgtgcc aatggaggcc agtgcctgaa cagaggtcca agccgaacct gccgctgccg 840 gcctggattc acaggcaccc actgtgaact gcacatcagc gattgtgccc gaagtccctg 900 tgcccacggg ggcacttgcc acgatctgga gaatgggcct gtgtgcacct gccccgctgg 960 cttctctggc aggcgctgcg aggtgcggat aacccacgat gcctgtgcct ccggaccctg 1020 cttcaatggg gccacctgct acactggcct ctccccaaac aacttcgtct gcaactgtcc 1080 ttatggcttt gtgggcagcc gctgcgagtt tcccgtgggc ttgccaccca gcttcccctg 1140 ggtagctgtc tcgctgggcg tggggctagt ggtactgctg gtgctgctgg tcatggtggt 1200 agtggctgtg cggcagctgc ggcttcggag gcccgatgac aagagcaggg aagccatgaa 1260 caatctgtca gacttccaga aggacaacct aatccctgcc gcccagctca aaaacacaaa 1320 ccagaagaag gagctggaag tggactgtgg tctggacaag tccaattgtg gcaaactgca 1380 gaaccacaca ttggactaca atctagcccc gggactccta ggacggggca gcatgcctgg 1440 ~5 gaagtatcct cacagtgaca agagcttagg agagaagc~tg ccacttcggt tacacagtga 1500 gaagccagag tgtcgaatat cagccatttg ctctcccagg gactctatgt accaatcagt 1560 gtgtttgata tcagaagaga ggaacgagtg tgtgattc~cc acagaggtat aaggcaggag 1620 cctactcaga cacccagctc cggcccagca gctgggcc;tt ccttctgcat tgtttacatt 1680 gcatcctgta tgggacatct ttagtatgca cagtgctc~ct ctgcggagga ggagggaatg 1740 gcatgaactg aacagactgt gaacccgcca agagttgc;ac cggctctgca cacctccagg 1800 agtctgcctg gcttcagatg ggcagccccg ccaagggaac agagttgagg agttagagga 1860 gcatcagttg agctgatatc taaggtgcct ctcgaactag gacttgctct gccaacagtg 1920 gtcatcatgg agctcttgac tgttctccag agagtggc;ag tggccctagt gggtcttggc 1980 gctgctgtag ctcctgtggg catctgtatt tccaaagt:gc ctttgcccag actccatcct 2040 cacagctggg cccaaatgag aaagcagaga ggaggctt:gc aaaggatagg cctcccgcag 2100 gcagaacagc cttggagttt ggcattaagc aggagctzct ctgcaggtga ggaaagcccg 2160 aggaggggac acgtgtgact cctgcctcca accccagc;ag gtggggtgcc acctgcagcc 2220 tctaggcaag agttggtcct tcccctggtc ctggtgcc;tc tgggctcatg tgaacagatg 2280 ggcttagggc acgccccttt tgccagccag gggtacac~gc ctcactgggg agctcagggc 2340 cttcatgcta aactcccaat aagggagatg gggggaac;gg ggctgtggcc taggcccttc 2400 cctccctcac acccattttt gggcccttga gcctgggc;tc caccagtgcc cactgttgcc 2460 ccgagaccaa ccttgaagcc gattttcaaa aatcaataat atgaggtttt gttttgtagt 2520 ttattttgga atctagtatt ttgataattt aagaatcaga agcactggcc tttctacatt 2580 ttataaaatt attttgtata taatgtgtat ttataatatg aaacagatgt gtacataaaa 2640 aaaaaaaaaa aaaaaaaaaa aaaaaagcga cctgcccc~gg cggccgctcg agccctatag 2700 tgagtcgtat taggatgg 2718 <210> 45 <211> 25 <212> DNA
<213> Murine <400> 45 ggtgagtccg cacaggtcaa ggtac 25 <210> 46 <211> 25 <212> DNA
<213> Murine <400> 46 gacaggggtt gctggcacac ttgtt 25 <210> 47 <212> 982 <212> DNA
<213> Murine <400> 47 ctcgcaggct aggaacccga ggccaagagc tgcagccaaa gtcacttggg tgcagtgtac 60 tccctcacta gcccgctcga gaccctagga tttgctccag gacacgtact tagagcagcc 120 accgcccagt cgccctcacc tggattacct accgaggcat cgagcagcgg agtttttgag 180 aaggcgacaa gggagcagcg tcccgagggg aatcagcttt tcaggaactc ggctggcaga 240 cgggacttgc gggagagcga catccctaac aagcagai~tc ggagtcccgg agtggagagg 300 acaccccaag ggatgacgcc tgcgtcccgg agcgcctc~tc gctgggcgct actgctgctg 360 gcggtactgt ggccgcagca gcgcgctgcg ggctccggca tcttccagct gcggctgcag 420 gagttcgtca accagcgcgg tatgctggcc aatgggcagt cctgcgaacc gggctgccgg 480 actttcttcc gcatttgcct taagcacttc caggcaacact tctccgaggg accctgcacc 540 tttggcaatg tctccacgcc ggtattgggc accaactcct tcgtcgtcag ggacaagaat 600 agcggcagtg gtcgcaaccc tctgcagttg cccttcaatt tcacctggcc gggaaccttc 660 tcactcaaca tccaagcttg gcacacaccg ggagacgacc tgcggccaga gacttcgcca 720 ggaaactctc tcatcagcca aatcatcatc caaggctctc ttgctgtggg taagatttgg 780 cgaacagacg agcaaaatga caccctcacc agactgagct actcttaccg ggtcatctgc 840 agtgacaact actatggaga gagctgttct cgcctatgca agaagcgcga tgaccacttc 900 ggacattatg agtgccagcc agatggcagc ctgtcctgcc tgccgggctg gactgggaag 960 tactgtgacc agcctatatg tc 982 <210> 48 <211> 24 <212> DNA
<223> Murine <400> 48 agccaccatg acgcctgcgt cccg 24 <210> 49 <211> 25 <212> DNA
<223> Murine <400> 49 tctattatac ctctgtggca atcac ~ 25 <210> 50 <211> 409 <212> DNA
<213> Human <400> 50 cagatcagaa aagtaaagac cagttaagag gttggtgacc agataaggac aacctgattc 60 ctgccgccca gcttaaaaac acaaaccaga agaaggagct ggaagtggac tgtggcctgg 120 acaagtccaa ctgtggcaaa cagcaaaacc acacattgga ctataatctg gccccagggc 180 ccctggggcg ggggaccatg ccaggaaagt ttccccacag tgacaagagc ttaggagaga 240 aggcgccact gcggttacac agtgaaaagc cagagtntcg gatatcagcg atatgctccc 300 ccagggactc catgtaccag tctgtgtgtt tgatatcaga ggagaggaat gaatgtttca 360 ttnccacgga ggtataaggc aggagcctac ctgggacatc cctgctcag 409 <210> 51 <211> 25 <212> DNA
<213> Human <400> 51 aagaaggagc tggaagtgga ctgtg 25 <2I0> 52 <211> 25 <212> DNA
<213> Human <400> 52 atcaaacaca cagactggta catgg 25 <210> 53 <211> 2184 <212> DNA
<213> Human <400> 53 gcgtcctcgg cgcggtcgcc gcccagccgt agtcacctgg attacctaca gcggcagctg 60 cagcggagcc agcgagaagg ccaaagggga gcagcgtc:cc gagaggagcg cctcttttca 120 gggaccccgc _cggctggcgg acgcgcggga aagcggcc~tc gcgaacagag ccagattgag 180 WO 00!06726 PCT/US99/15710 ggcccgcggg tggagagagc gacgcccgag gggatggc:gg cagcgtcccg gagcgcctct 240 ggctgggcgc tactgctgct ggtggcactt tggcagca~gc gcgcggccgg ctccggcgtc 300 ttccagctgc agctgcagga gttcatcaac gagcgcggcg tactggccag tgggcggcct 360 tgcgagcccg gctgccggac tttcttccgc gtctgcctaa agcacttcca ggcggtcgtc 420 tcgcccggac cctgcacctt cgggaccgtc tccacgcc:gg tattgggcac caactccttc 480 gctgtccggg acgacagtag cggcgggggg cgcaacccac tccaactgcc cttcaatttc 540 acctggccgg gtaccttctc gctcatcatc gaagcttggc acgcgccagg agacgacctg 600 cggccagagg ccttgccacc agatgcactc atcagcaaga tcgccatcca gggctcccta 660 gctgtgggtc agaactggtt attggatgag caaaccac_~ca ccctcacaag gctgcgctac 720 tcttaccggg tcatctgcag tgacaactac tatggagaca actgctcccg cctgtgcaag 780 aagcgcaatg accacttcgg ccactatgtg tgccagcc:ag atggcaactt gtcctgcctg 840 cccggttgga ctggggaata ttgccaacag cctatctc~tc tttcgggctg tcatgaacag 900 aatggctact gcagcaagcc agcagagtgc ctctgccgcc caggctggca gggccggctg 960 tgtaacgaat gcatccccca caatggctgt cgccacggca cctgcagcac tccctggcaa 1020 tgtacttgtg atgagggctg gggaggcctg ttttgtga~cc aagatctcaa ctactgcacc 1080 caccactccc catgcaagaa tggggcaacg tgctccaaca gtgggcagcg aagctacacc 1140 tgcacctgtc gcccaggcta cactggtgtg gactgtgagc tggagctcag cgagtgtgac 1200 agcaacccct gtcgcaatgg aggcagctgt aaggaccagg aggatggcta ccactgcctg 1260 tgtcctccgg gctactatgg cctgcattgt gaacacac~ca ccttgagctg cgccgactcc 1320 ccctgcttca atgggggctc ctgccgggag cgcaaccagg gggccaacta tgcttgtgaa 1380 tgtcccccca acttcaccgg ctccaactgc gagaagaaag tggacaggtg caccagcaac 1440 ccctgtgcca acgggggaca gtgcctgaac cgaggtcc:aa gccgcatgtg ccgctgccgt 1500 cctggattca cgggcaccta ctgtgaactc cacgtcagcg actgtgcccg taacccttgc 1560 gcccacggtg gcacttgcca tgacctggag aatgggct:ca tgtgcacctg ccctgccggc 1620 ttctctggcc gacgctgtga ggtgcggaca tccatcgatg cctgtgcctc gagtccctgc 1680 ttcaacaggg ccacctgcta caccgacctc tccacagaca cctttgtgtg caactgccct 1740 tatggctttg tgggcagccg ctgcgagttc cccgtggc~ct tgccgcccag cttcccctgg 1800 gtggccgtct cgctgggtgt ggggctggca gtgctgct:gg tactgctggg catggtggca 1860 gtggctgtgc ggcagctgcg gcttcgacgg ccggacgacg gcagcaggga agccatgaac 1920 aacttgtcgg acttccagaa ggacaacctg attcctgc;cg cccagcttaa aaacacaaac 1980 cagaagaagg agctggaagt ggactgtggc ctggacaagt ccaactgtgg caaacagcaa 2040 aaccacacat tggactataa tctggcccca gggcccct:gg ggcgggggac catgccagga 2100 aagtttcccc acagtgacaa gagcttagga gagaaggc;gc cactgcggtt acacagtgaa 2160 aagccagagt gtcggatatc agcg 2184 <210> 54 <211> 22 <212> DNA
<213> human <400> 54 acctgattcc tgccgcccag ct 22 <210> 55 <211> 22 <212> DNA
<213> Human <400> 55 gatgtcccag gtaggctcct gc 22 <210> 56 <211> 349 <212> DNA
<213> Human <400> 56 acctgattcc tgccgcccag cttaaaaaca caaacca<~aa gaaggagctg gaagtggact 60 gtggcctgga caagtccaac tgtggcaaac agcaaaacca cacattggac tataatctgg 120 ccccagggcc cctggggcgg gggaccatgc caggaaa<~tt tccccacagt gacaagagct 180 taggagagaa. .ggcgccactg cggttacaca gtgaaaa<~cc agagtgtcgg atatcagcga 240 WO 00106726 PCTlUS99/15710 tatgctcccc cagggactcc atgtaccagt ctgtgtgtat gatatcagag300 gagaggaatg aatgtgtcat tgccacggag gtataaggca ggagcctacc tgggacatc349 <210> 57 <211> 17 <212> DNA

<213> Murine <400> 57 aacctggacg gcagatg 17 <210> 58 <211> 19 <212> DNA

<213> Murine <400> 5$

agatttggcg aacagacga 19 <210> 59 <211> 30 <212> DNA

<213> Murine <400> 59 gaactagtcc accatgacgc ctgcgtcccg 30 <210> 60 <211> 28 <212> DNA

<213> Murine <400> 60 tcgcggccgc ggggaagctg ggtggcaa 28 <210> 61 <211> 2292 <212> DNA
<213> hybrid <220>
<223> Hybrid of mouse and human <400> 61 atgacgcctg cgtcccggag cgcctgtcgc tgggcgct:ac tgctgctggc ggtactgtgg 60 ccgcagcagc gcgctgcggg ctccggcatc ttccagct:gc ggctgcagga gttcgtcaac i20 cagcgcggta tgctggccaa tgggcagtcc tgcgaacc:gg gctgccggac tttcttccgc 180 atttgcctta agcacttcca ggcaaccttc tccgaggc~ac cctgcacctt tggcaatgtc 240 tccacgccgg tattgggcac caactccttc gtcgtcac~gg acaagaatag cggcagtggt 300 cgcaaccctc tgcagttgcc cttcaatttc acctggcc:gg gaaccttctc actcaacatc 360 caagcttggc acacaccggg agacgacctg cggccagaga cttcgccagg aaactctctc 420 atcagccaaa _tcatcatcca aggctctctt gctgtggc~ta agatttggcg aacagacgag 480 caaaatgaca ccctcaccag actgagctac tcttaccc~gg tcatctgcag tgacaactac 540 tatggagaga gctgttctcg cctatgcaag aagcgcgatg accacttcgg acattatgag 600 tgccagccag atggcagcct gtcctgcctg ccgggctgga ctgggaagta ctgtgaccag 660 cctatatgtc tttctggctg tcatgagcag aatggttact gcagcaagcc agatgagtgc 720 atctgccgtc caggttggca gggtcgcctg tgcaatgaat.gtatccccca caatggctgt 780 cgtcatggca cctgcagcat cccctggcag tgtgcctc~cg atgagggatg gggaggtctg 840 ttttgtgacc aagatctcaa ctactgtact caccact<a c cgtgcaagaa tggatcaacg 900 WO 00106726 1'CTNS99/15710 tgttccaaca gtgggccaaa gggttatacc tgcacctgtc tcccaggcta cactggtgag 960 cactgtgagc tgggactcag caagtgtgcc agcaacccct gtcgaaatgg tggcagctgt 1020 aaggaccagg agaatagcta ccactgcctg tgtcccccag gctactatgg ccagcactgt 1080 gagcatagta ccttgacctg tgcggactca ccctgcttca atgggggctc ttgccgggag 1140 cgcaaccagg ggtccagtta tgcctgcgaa tgccccccca actttaccgg ctctaactgt 1200 gagaagaaag tagacaggtg taccagcaac ccgtgtgcca atggaggcca gtgcctgaac 1260 agaggtccaa gccgaacctg ccgctgccgg cctggattca caggcaccca ctgtgaactg 1320 cacatcagcg attgtgcccg aagtccctgt gcccacgggg gcacttgcca cgatctggag 1380 aatgggcctg tgtgcacctg ccccgctggc ttctctggca ggcgctgcga ggtgcggata 1440 acccacgatg cctgtgcctc cggaccctgc ttcaatgggg ccacctgcta cactggcctc 1500 tccccaaaca acttcgtctg caactgtcct tatggctttg tgggcagccg ctgcgagttt 1560 cccgtgggct tgccacccag cttccccgcg gccgctgagc ccaaatcttg tgacaaaact 1620 cacacatgcc caccgtgccc agcacctgaa ctcctggggg gaccgtcagt cttcctcttc 1680 cccccaaaac ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg 1740 gtggacgtga gccacaaaaa ccctgaggtc aacttcaact ggtacgtgga cggcgtggag 1800 gtgcataatg ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc 1860 agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc 1920 tccaacaaag ccctcccagc ccccatcgag aaaaccatct ccaaagccaa agggcagccc 1980 cgagaaccac aggtgtacac cctgccccca tcccgggatg agctgaccaa gaaccaggtc 2040 agcctgacct gcctggtcaa aggcttctat cccagcgaca tcgccgtgga gtgggagagc 2100 aatgggcagc cggagaacaa ctacaagacc acgcctcccg tgctggactc cgacggctcc 2160 ttcttcctct acagcaagct caccgtggac aagagcaggt ggcagcaggg gaacgtcttc 2220 tcatgctccg tgatgcatga ggctctgcac aaccactaca cgcagaagag cctctccctg 2280 tctccgggta as 2292 <210> 62 <211> 764 <212> PRT
<213> hybrid <220>
<223> Hybrid of mouse and human <400> 62 Met Thr Pro Ala Ser Arg Ser Ala Cys Arg Z'rp Ala Leu Leu Leu Leu Ala Val Leu Trp Pro Gln Gln Arg Ala Ala Gly Ser Gly Ile Phe Gin Leu Arg Leu Gln Glu Phe Val Asn Gln Arg Gly Met Leu Ala Asn Gly Gln Ser Cys G1u Pro Gly Cys Arg Thr Phe F~he Arg Ile Cys Leu Lys His Phe Gln Ala Thr Phe Ser Glu Gly Pro C'ys Thr Phe Gly Asn Val Ser Thr Pro Val Leu G1y Thr Asn Ser Phe ~i'al Val Arg Asp Lys Asn Ser Gly Ser Gly Arg Asn Pro Leu G1n Leu Faro Phe Asn Phe Thr Trp Pro Gly Thr Phe Ser Leu Asn Ile Gln Ala Trp His Thr Pro Gly Asp Asp Leu Arg Pro Glu Thr Ser Pro Gly Asn Ser Leu Ile Ser Gln Ile Ile Ile G1n Gly Sex Leu Ala Val Gly Lys I:le Trp Arg Thr Asp Glu Gln Asn Asp Thr Leu Thr Arg Leu Ser Tyr S~er Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly G1u Ser Cys Ser P.rg Leu Cys Lys Lys Arg Asp Asp His Phe Gly His Tyr Glu Cys G1n Pro Asp Gly Ser Leu Ser Cys Leu Pro Gly Trp Thr Gly Lys Tyr Cys'A,sp GIn Pro Ile Cys Leu Ser GIy Cys His Glu G1n Asn Gly Tyr Cys S~er Lys Pro Asp Glu Cys 225 230 2;35 240 Ile C.ys Arg Pro Gly Trp Gln Gly Arg Leu C'.ys Asn Glu Cys Ile Pro 245 250 ' 255 His Asn Gly Cys Arg His Gly Thr Cys Ser I:le Pro Trp G1n C:ys Ala Cys Asp Glu GIy Trp Gly Gly Leu Phe Cys P.sp G1n Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ser Thr Cys Ser Asn Ser Gly Pro Lys Gly Tyr Thr Cys Thr Cys Leu E>ro Gly Tyr Thr Gly Glu His Cys Glu Leu Gly Leu Ser Lys Cys Ala Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asn Ser '1:'yr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly GIn His Cys Glu His :ier Thr Leu Thr Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ser Ser Tyr Ala Cys Glu Cys Pro Pro Asn 1?he Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys Thr Ser Asn 1?ro Cys Ala Asn Gly Gly G7:n Cys Leu Asn Arg Gly Pro Ser Arg Thr Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr His Cys Glu Leu His IIe Ser Asp Cys Ala Arg Ser Pro Cys AIa His Gly Gly Thr Cys His Asp )Leu Glu Asn Gly Pro Val Cys Thr Cys Pro Ala Gly Phe Ser Gly Arg ;Arg Cys Glu VaI Arg Ile Thr His Asp Ala Cys Ala Ser Gly Pro Cys Phe Asn Gly A1a Thr Cys Tyr Thr Gly Leu Ser Pro Asn Asn Phe Va1 Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro Ala Ala Ala Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro ' 530 535 540 Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Fro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Seer Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Lys P,sn Pro Glu Val Asn Phe Asn Trp Tyr Val Asp Gly Val Glu Val His F,sn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Grlu Tyr Lys Cys Lys Val 625 630 Ei35 640 Ser Asn Lys Ala Leu Pro Ala Pro Lle Giu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile A1a Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser 705 710 '7-15 720 Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu A1a Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

Claims

CLAIM
WHAT IS CLAIMED IS:

1. A purified mammalian polypeptide comprising an amino acid sequence selected from the group consisting of:
a) the polypeptide of SEQ ID NO: 2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO: 7, SEQ ID NO:8, SEQ

ID NO: 9, SEQ ID NO 10, SEQ ID NO: 11, SEQ

ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ

ID NO: 15, SEQ NO: 16, SEQ ID NO: 17 SEQ

ID NO: 18, SEQ NO: 19, SEQ ID NO: 20, SEQ

ID NO: 21,or SEQ ID NO: 22;

(b) the polypeptide of SEQ ID NO:4, SEQ ID NO:

23, SEQ ID NO: 24, SEQ ID NO:25, SEQ ID NO:

26, SEQ ID NO: 27, SEQ ID NO:28, SEQ ID NO:

29, SEQ ID NO: 30, SEQ ID NO:31, SEQ ID NO:

32, SEQ ID NO: 33, SEQ ID NO:34, SEQ ID NO:

35, SEQ ID NO: 36, SEQ ID NO:37, SEQ ID NO:

38, SEQ ID NO: 39, or SEQ ID NO: 40;

(c) a polypeptide fragment of any of the foregoing, (d) a polypeptide analog of any of the foregoing having at least eighty percent amino acid sequence identity therewith, (e) any of the foregoing also having an N-terminal methionyl residue.

2. The polypeptide according to claim 1 which is a human polypeptide comprising the amino acid sequence of SEQ ID NO: 26, with or without an N-terminal methionine residue.

3. A polypeptide analog according to claim 1 which is ninety percent or more identical in amino acid sequence with any of (a), (b), (c), (d) or (e).

4. A polypeptide according to claims 1, 2, or 3 which has been produced by recombinant expression.

5. A biologically active derivative of a polypeptide according to claim 1.

6. The polypeptide derivative of claim 5, in.
which the polypeptide is attached to a synthetic water soluble polymer, a detectable label molecule, or a polyamino acid.

7. The polypeptide derivative of claim 6 in which the synthetic water soluble polymer is polyethylene glycol or dextran.

8. The polypeptide derivative of claim 6 which is an Fc fusion product.

9. An isolated DNA molecule encoding a polypeptide according to claim 1 which is selected from the group consisting of:
(a) the DNA molecule of SEQ ID NO: 1 or SEQ ID
NO: 3, (b) an allelic variant of the DNA molecule of (a) which encodes the same polypeptide, (c) a DNA molecule which selectively hybridizes to the DNA molecule of (a) or (b), and (d) a DNA molecule which, but for the degeneracy of the genetic code, would hybridize to a DNA
molecule of (a), (b) or (c).

10. A biologically functional viral or plasmid vector containing a DNA molecule according to claim 9.

11. A prokaryotic or eukaryotic host cell containing the vector of claim 10.

12. A host cell modified so that the expression of an endogenous polypeptide having the sequence of SEQ
ID NO: 2 or SEQ ID NO: 4 or a fragment or naturally occurring mutation thereof is enhanced.

13. A host cell according to claim 12 which is an isolated human host cell.

14. A process for producing a polypeptide according to claim 1, which comprises culturing, under suitable nutrient conditions, a host cell containing a DNA molecule encoding the polypeptide such that expression of the polypeptide occurs, obtaining the polypeptide so produced, and optionally preparing a composition containing the polypeptide.

15. An antibody for the polypeptide of claim 1.

16. The antibody of claim 15 which is monoclonal.

17. A method for identifying a receptor which binds to the polypeptide of claim. 1, comprising the polypeptide with a receptor to be identified under conditions to permit binding, and detecting the presence of any binding.

18. A transgenic non-human mammal capable of expressing in any cell thereof the DNA of SEQ ID NO: 3.