CA2335272A1 - Mouse growth hormone secretagogue receptor - Google Patents

Abstract

A mouse growth hormone secretagogue receptor has been isolated, cloned and sequenced. This receptor is characteristic of the G-protein family of receptors. Mouse growth hormone secretagogue receptors may be used to screen and identify compounds which bind to the mouse growth hormone secretagogue receptor. Such compounds may be used in the treatment of conditions which occur when there is a shortage of growth hormone, such as observed in growth hormone deficient children, elderly patients with musculoskeletal impairment and those recovering from hip fracture and osteoporosis. Targeted disruption of the mouse GHS-R gene may prove useful in elucidation of the mechanism of action and role of the growth hormone secretagogues in human and animal physiology.

Description

TITLE OF THE INVENTION
MOUSE GROWTH HORMONE SECRETAGOGUE RECEPTOR
FIELD OF THE INVENTION
This invention relates to a newly identified receptor, the mouse gowth hormone secretagogue receptor (mGHS-R), nucleic acids encoding this receptor; and to the use of a mGHS-R to identify growth hormone secretagogues and compounds that modulate mGHS-R function.
BACKGROUND OF THE INVENTION
Growth hormone secretagogues (GHSs) and secretagogue-like compounds, both peptide and non-peptide, bind to and exert their biological effects (i.e., release of growth hormone (GH)) through a G protein-coupled receptor (GPC-R) distinct from the receptors for growth hormone releasing hormone (GHRH) and somatostatin (SST) (Pong et al., 1996Mo1. Endocrin. 10:57-61). The molecular cloning of this growth hormone secretagogue receptor (GHS-R) capitalized on the pivotal observation that GHSs transduce their signal through activation of the phospholipase C pathway (Cheng et al., 1991 Endocrinology 129:3337-3342;
Howard et al., 1996 Science 273:974-977). cDNA and genomic DNA cloning from human, swine, and rat showed that the GHS-R is a protein of 364/366 amino acids containing 7 putative alpha-helical transmembrane (TM) domains, a signature feature of GPC-Rs (Howard et al. 1996; McKee et al., 1997 Mol. Endocrin. 11:415-423). In all species evaluated, the GHS-R is encoded by a single highly-conserved gene containing one intron, placed at the C-terminal end of TM domain 5.
The biology of the growth hormone secretagogues (GHSs) is still in a relatively early stage of development. Research is focused on identification of the GHS natural ligand system and understanding the role of the GHS-R in brain regions (substantia nigra, dentate gyrus, hippocampus) other than those traditionally thought to be involved in GH secretion (Bennett et al. 1997;
Guan et a1.1997).
It would be desirable to know the molecular structure of growth hormone secretagogue receptors in order to analyze this new receptor family and understand its normal physiological role in concert with the actions of GHRH
and somatostatin. This could lead to a better understanding of the in vivo processes which occur upon ligand-receptor binding. Further, it would be desirable to use cloned-growth hormone secretagogue receptors as essential components of an assay system which can identify new growth hormone secretagogues which would confer a significant benefit on children and adults deficient in growth hormone, the frail elderly, those in post-hip fracture rehabilitation and post-operative recovery patients.
DETAILED DESCRIPTION OF THE INVENTION
This invention relates to a novel receptor, mouse growth hormone secretagogue receptor (mGHS-R), which is free from receptor associated proteins.
A further aspect of this invention is mGHS-R which is isolated or purified.
Another aspect of this invention is mGHS-Rs which are encoded by substantially the same nucleic acid sequence, but which have undergone changes in splicing or other RNA processing-derived modifications or mutagenesis induced changes, so that the expressed protein has a homologous, but different amino acid sequence from the native form. These variant forms may have different and/or additional fi~nctions in animal physiology or in vitro in cell based assays.
Growth hormone secretagogue receptors are proteins containing various fiznctional domains, including one or more domains which anchor the receptor in the cell membrane, and at least one ligand binding domain. As with many receptor proteins, it is possible to modify many of the amino acids, particularly those which are not found in the ligand binding domain, and still retain at least a percentage of the biological activity of the original receptor.
Thus, this invention specifically includes modified functionally equivalent mGHS-Rs which have deleted, truncated, or mutated N-terminal portions. This invention also specifically includes modified fianctionally equivalent mGHS-Rs which contain modified and/or deletions in other domains, which are not accompanied by a loss of functional activity.
Additionally, it is possible to modify other functional domains such as those that interact with second messenger effector systems, by altering binding specificity and/or selectivity. Such fi~nctionally equivalent mutant receptors are also within the scope of this invention.
A further aspect of this invention are nucleic acids which encode a mouse growth hormone secretagogue receptor or a fi~nctional equivalent. These nucleic acids may be free from associated nucleic acids, or they may be isolated or purified. For most cloning purposes, cDNA is a preferred nucleic acid, but this invention specifically includes other forms of DNA as well as RNAs which encode a mGHS-R or a fi~nctional equivalent.
Yet another aspect of this invention relates to vectors which comprise nucleic acids encoding mGHS-R or a functional equivalent. These vectors may be comprised of DNA or RNA; for most cloning purposes DNA
vectors are preferred. Typical vectors include plasmids, modified viruses, bacteriophage and cosmids, yeast artificial chromosomes, transposable elements and other forms of episomal or integrated DNA that can encode a mGHS-R. It is well within the skill of the ordinary artisan to determine an appropriate vector for a particular gene transfer or other use.
A further aspect of this invention are host cells which are transformed with a vector comprising a gene which encodes a mouse growth hormone secretagogue receptor or a functional equivalent. The host cell may or may not naturally express a GHS-R on the cell membrane. Preferably, once transformed, the host cells are able to express the mouse growth hormone secretagogue receptor or a functional equivalent on the cell membrane.
Depending on the host cell, it may be desirable to adapt the DNA so that particular codons are used in order to optimize expression. Such adaptations are known in the art, and these nucleic acids are also included within the scope of this invention.
Generally, mammalian cell lines, such as COS, HEK-293, CHO, HeLa, NS/0, CV-1, GC, GH3 or VERO cells are preferred host cells, but other cells and cell lines such as Xenopus oocytes or insect cells, may also be used.
Another aspect of this invention is a process for identifying nucleic acids encoding mouse growth hormone secretagogue related receptors comprising hybridizing a first nucleic acid encoding a mouse growth hormone secretagogue receptor with a second nucleic acid suspected of comprising nucleic acids encoding a growth hormone secretagogue receptor, wherein the hybridizing takes place under relaxed or moderate post hybridizational washing conditions; and identify areas of the second nucleic acid where hybridization occurred.
BRIEF DESCRIPTION OF THE FIGURES
FIGURE 1 is the DNA sequence encoding the mouse GHS-R, 5' and 3' flanking regions and the intron; SEQ ID NO:1.
FIGURE 2 is the DNA sequence encoding the open reading frame (ORF) of the mouse GHS-R; SEQ ID N0:2.

FIGURE 3 is the deduced amino acid sequence of the mouse GHS-R; SEQ ID N0:3.
FIGURE 4 is an amino acid alignment of the mouse GHS-R with other GHS-R's from several species (human - SEQ ID N0:4, rat - SEQ ID NO: 5, and swine - SEQ ID N0:6).
As used throughout the specification and claims, the following definitions shall apply:
Growth Hormone Secretagogue - any compound or agent that directly or indirectly stimulates or increases the release of growth hormone in an animal.
Ligands-- any molecule which binds to the mGHS-R of this invention. These ligands can have either agonist, partial agonist, partial antagonist or antagonist activity.
~ Free from receptor-associated proteins-- the receptor protein is not in a mixture or solution with other membrane receptor proteins.
Free from associated nucleic acids-- the nucleic acid is not covalently linked to DNA which it is naturally covalently linked in the organism's chromosome.
Isolated receptor--the protein is not in a mixture or solution with any other proteins.
Isolated nucleic acid-- the nucleic acid is not in a mixture or solution with any other nucleic acid.
Functional equivalent--a receptor which does not have the exact same amino acid sequence of a naturally occurring mouse growth hormone secretagogue receptor due to alternative splicing, deletions, mutations, or additions, but retains at least 1%, preferably 10%, and more preferably 25% of the biological activity of the naturally occurnng receptor. Such derivatives will have a significant homology with a natural mGHS-R and can be detected by reduced stringency hybridization with a DNA sequence obtained from a mGHS-R. The nucleic acid encoding a functional equivalent has at least about 50% homology at the nucleotide level to a naturally occurring receptor nucleic acid.
Purified receptor-- the receptor is at least about 95% pure.
Purified nucleic acid-- the nucleic acid is at least about 95% pure.

Standard or high stringency post hybridizational washing conditions -- 6 X SSC at 55°C.
Moderate post hybridizational washing conditions --6 X SSC at 45°C.
Relaxed post hybridizational washing conditions -- 6 X SSC at 30°C.
The mouse isoform of the previously identified GHS-R was cloned from two genomic DNA libraries for the generation of a GHS-R knock-out mouse.
This isoform has been shown to be functionally activated by secretagogues such as growth hormone releasing peptide GHRP-6 and MK-0677 through expression studies of the complete and contiguous open reading frame of mGHS-R using the aequorin biolumenescence assay. The proteins of this invention were found to have structural features which are typical of the 7-transmembrane domain (TM)-containing G-protein linked receptor superfamily (GPC-R's or 7-TM receptors), including seven transmembrane regions, three intra- and extracellular loops, and the GPC-R protein signature sequence. Thus, mGHS-R, as an additional member of the growth hormone secretagogue family of receptors, constitutes a new member of the GPC-R family of receptors. Note not all regions are required for functioning, and therefore this invention also comprises functional receptors which lack one or more non-essential domains.
Sequence analysis of the mGHS-R revealed, further, the presence of a non-coding, intronic sequence at nt 790 corresponding to a splice-donor site (G/GT) (Fig. 1). This sequence insertion occurs two amino acids after the completion of the predicted transmembrane domain (TM) 5 (leucine-263), thus dividing the ORF of the mouse GHS-R into an amino-terminal segment (encompassing the extracellular domain, TM-1 through TM-5, and the first two intra-and extra-cellular loops) and a carboxyl-terminal segment containing TM-6, TM-7, the third intra- and extra-cellular loops, and the intracellular domain.
The point of insertion and flanking DNA sequence are highly conserved between human, swine, rat and mouse. Comparison of the complete ORF encoding the murine GHS-R type Ia protein sequence (Fig. 4) to rat, human and swine GHS-R
homologs reveals a high degree of sequence identity (mouse vs. rat, 99.5%;
mouse vs. human 95%; mouse vs. swine 94%).

The mGHS-Rs of this invention also share some sequence homology with previously cloned GPC-receptors including the rat and human neurotensin receptor (approximately 32 % identity) and the rat and human thyrotropin releasing hormone (TRH) receptor (approximately 29 % identity).
The mGHS-R and fragments are immunogenic. Thus, another aspect of this invention is antibodies and antibody fragments which can bind to mGHS-R or a mGHS-R fragment. These antibodies may be monoclonal antibodies and produced using either hybridoma technology or recombinant methods. They may be used as part of assay systems or to deduce the function of a mGHS-R
present on a cell membrane.
A further aspect of this invention are antisense oligonucleotides -nucleotides which can bind to mGHS-R nucleotides and modulate receptor function or expression.
A further aspect of this invention is a method of increasing the amount of mGHS-Rs on a cell membrane comprising, introducing into the cell a nucleic acid encoding a mGHS-R, and allowing expression of the mGHS-R.
A mGHS receptor, preferably immobilized on a solid support, may be used diagnostically for the determination of the concentration of growth hormone secretagogues, or metabolites thereof, in physiological fluids, e.g.
body fluids, including serum, and tissue extracts, as for example in patients who are undergoing therapy with a growth hormone secretagogue.
The administration of a mGHS receptor to a patient may also be employed for purposes of amplifying the net effect of a growth hormone secretagogue by providing increased downstream signaling following administration of the growth hormone secretagogue thereby diminishing the required dosage of growth hormone secretagogue; or diminishing the effect of an overdosage of a growth hormone secretagogue during therapy.
Yet a further aspect of the present invention is a method of identifying ligands comprising contacting the mGHS-R with a compound suspected of being a ligand specific for said receptor and determining whether binding occurs, binding constituting a positive indication of the presence of a ligand.
Ligands detected using assays described herein may be used in the treatment of conditions which occur when there is a shortage of growth hormone, such as observed in growth hormone deficient children, elderly patients with musculoskeletal impairment and those recovering from hip fracture, and osteoporosis.
Targeted disruption of the mouse GHS-R gene may also prove useful in elucidation of the mechanism of action and role of the growth hormone secretagogues in human and animal physiology.
The following, non-limiting Examples are presented to better illustrate the invention.

Isolation of mouse GHS-R
A mouse (strain 129, liver) genomic library constructed in the vector lamda Fix II (Stratagene) was screened under moderate stringency hybridization conditions with a complete ORF probe derived from the swine GHS-R. Nylon filters repesenting 1.2 x 106 PFU were hybridized overnight at 58°C in 6 X SSC
containing 10% dextran sulfate, 2% SDS, 0.5 M NaCI, and 100 p,g/ml salmon sperm DNA with the random prime 32P-labeled swine GHS-R probe. Filters were washed in 4 X SSC, 1% SDS at room temerature for 20 minutes, 4 X SSC, 1% SDS at 55°C for 30 min, 2 X SSC, 1% SDS at 55°C for 30 min, and 2 X SSC, 1% SDS at 62°C for 30 min. Three positive clones were identified, phage DNA was isolated, and partial DNA
sequencing performed to verify that they encoded the murine GHS-R gene. In addition, a mouse genomic library constructed in a BAC vector and gridded in a filter array (Genome Systems, Inc) was screened under moderate stringency hybridization conditions as given above with a complete ORF probe dervived from the human GHS-R. A positive clone was identified from the BAC library.

WO 00/0291$ PCT/US99/15375 Sequencing Of Mouse GHS-R
The BAC clone was sequenced with ABI Prism BigDye terminator cycle sequencing ready reaction mix (P/N 4303149; PE Applied Biosystems, Foster City, CA) using lp,g DNA/reaction, 5% DMSO, 100 ng primer -standard cycle sequencing. Reactions were run on an ABI Prism 377 DNA
Sequencer with XL Upgrade (ABI Prism 377XL).
DNA from the positive lambda clones was prepared from a liquid lysate of the E. coli strain XLBIue MRA minus. For DNA sequencing, 500 ng of DNA was used under the same conditions as given above.

Anal~rsis Of Mouse GHS-R Sequence Sequence analysis revealed the presence of a non-coding, intronic sequence at nt 790 corresponding to a splice-donor site (G/GT) (Fig.
1 ). This sequence insertion occurs two amino acids after the completion of the predicted transmembrane domain (TIV)7 5 (leucine-263), thus dividing the ORF of the mouse GHS-R into an amino-terminal segment (encompassing the extracellular domain, through TM-S, and the first two intra-and extra-cellular loops) and a carboxyl-terminal segment containing TM-6, TM-7, the third intra- and extra-cellular loops, and the intracellular domain. The point of insertion and flanking DNA sequence are highly conserved between human, swine, rat and mouse. Comparison of the complete ORF
encoding the murine GHS-R type Ia protein sequence (Fig. 4) to rat, human and swine GHS-R homologs reveals a high degree of sequence identity (mouse vs. rat, 99.5%;
mouse vs. human 95%; mouse vs. swine 94%).
_g-Construction Of Mouse GHS-R Expression Plasmid For expression studies in mammalian cells, a contiguous ORF
(Figs. 2 and 3) was assembled in the vector pcDNA-3 (Invitrogen) by overlapping PCR to remove the single intron present following nucleotide 790 of the ORF.
To subclone, the Advantage HF PCR kit (K1909-1; Clonetech Laboratories, Inc, Palo Alto, CA) was used under the following conditions: 94°C for i min;, then 25 cycles of the following: 94°C for 15 sec, 55°C for 15 sec, and 68°C
for 3 min. The primers used were: primer 1- 5'GGG CCC GAA TTC GCC GCC ATG TGG AAC GCG ACG CCC
AGC 3' (SEQ 117 N0:7, including EcoR I site, Kozak initation sequence, and translational start Met); primer 2- 5'CAC CAC CAC
AG C AAG CAT CTT CAC TGT CTG3' (SEQ ID N0:8; nucleotides shown in italic type overlap exon 2); primer 3- 5'AAG ATG CTT G CT GTG GTG GTG TTT GCT
TTC ATC3' (SEQ ID N0:9; nucleotides shown in italic type overlap exon 1); and primer 4- 5'AGT TTA GCG GCC GCT CAT GTA TTG ATG CTC GAC TTT GT3' (SEQ ID NO:10, including Not I site and stop codon). "Overlapping" PCR was performed. The first PCR reactions were performed with primers 1 and 2 (exon 1) or 3 and 4 (exon 2). The second PCR reactions were performed with primers 1 and 4 (ORF). The second product was digested with EcoRI and NotI, agarose gel purified, ethanol precipitated, phenol extracted, and Ggated into pcDNA3 with Ready-to-Go T4 Ligase (27-0361-O1; Pharmacia, Piscataway, NJ), and transformed into SCS1 cells (20023 l; Stratagene, La Jolla, CA). DNA was isolated with Wizard Plus miniprep (A1460; Promega, Madison, WI) and 500ng was sequenced as above, but without DMSO.

Functional Activity Of Mouse GHS-R
Measurement of mouse GHS-R expression in the aequorin-expressing stable reporter cell line 293-AEQ17 (Button et al., 1993 Cell Calcium 14:663-671.) was performed using a Luminoskan RT luminometer (Labsystems Inc., Gaithersburg, MD. 293-AEQ17 cells (8 x 105 cells plated 18 hr. before transfection in a T75 flask) were transfected with 22 p,g of pcDNA-3/mouse GHS-R plasmid DNA
and 264 p,g lipofectamine (Life Technologies). Forty hours after transfection, the apo-aequorin in the cells was charged for 1 hour with coelenterazine CP ( 10 NM) under reducing conditions (300 mM reduced glutathione) in ECB buffer (140 mM NaCI, mM KCI, 20 mM HEPES-NaOH, pH=7.4, 5 mM glucose, 1 mM MgCl2, 1 mM
CaCl2, 0.1 mg/ml bovine serum albumin). The cells were harvested, washed once in ECB medium and resuspended to 500,000 cells/ml. One hundred (100) p,l of cell suspension (corresponding to 5x104 cells) was then injected into each well of a 96-well microtiter test plate, and the integrated light emission was recorded over 30 seconds, in 0.5 second units. Twenty (20) p,l of lysis buffer (0.1% final Triton X-100 concentration) was then injected and the integrated light emission recorded over 10 seconds, in 0.5 second units. The "fractional response" values for each well were calculated by taking the ratio of the integrated response to the initial challenge to the total integrated luminescence including the Triton X-100 lysis response. Data were analyzed using GraphPad Prism software V.2.0 (GraphPad Software, San Diego, CA).

SEQUENCE LISTING
<110> Merck & Co., Inc.
<120> MOUSE GROWTH HORMONE SECRETAGOGUE
RECEPTOR
<130> 20218 PCT
<150> 60/092,361 <151> 1998-07-10 <160> 10 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 4009 <212> DNA
<213> Mus musculus <400> 1 agagaggagccctcacacactcgctttgcagcgcctgccttccgcaagagcccacgcact 60 cggacgcttgtggggagcacgacaggcttgctggggcgagatctccagtgccaggcaact 120 gctggtggcgccgccgtttgagtgacaggtaagtgagtgcgtgacagtcgaggctgtatt 180 gggagaccgggactgtgtggggaagatagtgggaagggggaagaaaagagagatgtggga 240 gggaggggagaggaggaacggaaggaaatagggagagacgtgcagtgggtcactctcttc 300 ctttcatcgctaatgttcgcacccccattccaccttctcctaggcttcttctcacttctc 360 tcttccccaagcatccttcctgctgctcgcgcccattcctccccccacgccgccccccgc 420 ccggcccccactcttccgcgcctaggaggacctcctcaggggaccagatttccgcgcggc 480 tgcgaccccaagcctggcaacatgtggaacgcgacgcccagcgaggagccggagcctaac 540 gtcacgctggacctggactgggacgcttctcccggcaacgactcactctctgacgaactg 600 ctgccactgttccccgcgccgctgctggcgggcgtcactgccacctgcgtggcgctcttc 660 gtggtgggcatctcgggcaacctgctcaccatgctggtggtgtcccgcttccgcgagctg 720 cgcaccaccaccaacctctacctatccagcatggccttctccgatctgctcatcttcctg780 tgcatgccgctggacctcgtccgcctctggcagtatcggccctggaacttcggcgacctg840 ctctgcaaactcttccagtttgtcagcgagagctgcacctacgccacggtcctcaccatc900 accgcgctgagcgtcgagcgctacttcgccatctgcttcccgctgcgggccaaggtggtg960 gtcaccaagggccgtgtgaagctggtcatccttgtcatctgggccgtggccttctgcagc1020 gcggggcccatcttcgtgctggtgggcgtggagcacgagaacggcacagatccccgggac1080 accaacgagtgccgcgccaccgagttcgctgtgcgctctgggctgctcaccgtcatggtg1140 tgggtgtccagcgtcttcttctttctaccggtcttctgcctcactgtgctctacagtctc1200 atcgggaggaagctatggcggagacgcggcgatgcagcggtgggcgcctcgctccgggac1260 cagaaccacaaacagacagtgaagatgcttggtgagttctgacaccccggtggcttttct1320 tcccccactgcttgctctttgccagagccctctatttctgtttctggtcgtctccatctc1380 tccctaagtctctcaagtctctgtctgtctctgyctctctsttggttcttggtctcactg1440 ctttckggttttttttcctctgtctgtccctgtatcttctccacgaaaaagcccctcata1500 ttggcaattccctaaatgagtactggtctgggaaatttggtccaagatggaaatacctca1560 ttatggtttattgagtcccctaattgttaayggtkymkcwymtwgwctcacatagaattt1620 gtggttatcmaagtmataatattaaggtaagcaggcaggyawtgggtttagaaatyrctc1680 catggtaartctaaccamaaawttgggtcactctgttaargaygryttatagatgtrttt1740 tgtttgtttkcaatattrggatttrttytctgccctgcmyctkyctcagataattacatc1800 cactcttgtttagtctatggttttgccaggaggggcttcatgctggggtctcctttttct1860 tgtttttgtatttgtctccccagtaatataggccaggatagggtggagaagtcatccttt1920 cctcaaactgtccttcaggaaggtctgggtactgaacggttactgcataaactctgcttc1980 cccaaaggcatgtgcttggtgtggtaaagtcatgaagatggtgctcatgtccaagaggaa2040 cctctgatctcacttttcaagggatttcatgtttgctgacatttaatacttgttagtttt2100 tgcagggggatgatttctcatttgcaattttattattctcaaattctgcatgtcagaatg2160 ttagagattt-ctcagggatgtcaggttctgtttccagatgagtgattgccctgtgtcctc2220 cattggactgtaaactcatatgcaccagacagggtctacattgctgccgtggtgcatagc2280 cttccatgtgtcacttagtcctaaagagaagttactaataacctaatctcactaatctca2340 ctggcatctcaatgccgatcccattgtcatctgaaaatttgaaggggacattaaagtggc2400 acagggaccagaacaatatttttctctcattgctgaattttaaaaacaatctaaaaaatt2460 ggaattcttgaagaaactatcttatatgactaaaatgaagccttgggtgggtgctaatta2520 ttattgtctggcttacctgccccccccactacttatatcttttagagatgacacagactt2580 gctttccctgtggctactaatcccaattgcacattcagtcccttgatagacttactctaa2640 aaatctaagttcagcggtccacgaaacataacaaagcctgtcctaaaacagaaagaaaga2700 aagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaacagaagacaaaca2760 aggtctttccccattccctaacatacaggaatggaaattattaagtctacgtgatagcca2820 atgaatctgtttcttaagtatgcccacaagggtgctgccggagccattgctcagggctgg2880 agtatttactgggcatgcttgaccccagcatggagggtgagaagtgctcctgggaactct2940 gatccactgctgtggtggagagcaaacacctggcctcatttatacttgttgtctgtataa3000 tgcatataaatggaggataatcattaatgaactgtttagttgggtcatcatgccaagtca3060 gtcacaaagccaagtcgttatcacatagaaagactgggaagcccagtggagattgttagc3120 tgttggtctgacagtctcactgtgtgctatctatagtgttagaacggatggaggcagtat3180 ttatgtgaagagcagggtgtcgtgtttcctgtgtcaaagagcaagatgtgatgtttgtca3240 gtgggcatgcccctcatggagaaaagagatccgggacttaaaaatgtgaagtgatttatg3300 ccgtgtcacacccatgctccaccctgatggtctctctttgtgtgccttcagctgtggtgg3360 tgtttgctttcatcctctgctggctgcccttccacgtgggaagatatctgttttccaagt3420 ctttcgagcctggctctctggagatcgcgcagatcagtcagtactgcaacctggtgtcct3480 ttgtcctcttctacctcagcgctgccatcaaccccattctgtacaacatcatgtccaaga3540 agtaccgggtggccgtgttcaaacttctaggatttgaatccttctcccagagaaagcttt3600 ccactctgaaggatgagagttcccgggcctggacaaagtcgagcatcaatacatgacatc3660 gcagcgcatctctccgtcatcgctcattgctccacaccagaagccatagccaagcgggac3720 ttgggaggaggcagaacgtcagtttggggattagagacaaatggatctggaaacaattgg3780 gggtggggagtagagccagatgggcagggtccgtgcagattgatctatttgtgcgcccac3840 cagagcactcatgtgcagcccctgcacacctgtgtctgtgattttgcgaatttgcatttg3900 gagcttctgacagctttgcagctcgaaggagggaggggcgcagagcaggcaacggccgtc3960 cttcttggtgtgtaacactaaactccatttgcttttctcatcataatag 4009 <210>2 <211>1095 <212>DNA

<213>Mus musculus <400> 2 atgtggaacg cgacgcccag cgaggagccg gagcctaacg tcacgctgga cctggactgg 60 gacgcttctc ccggcaacga ctcactctct gacgaactgc tgccactgtt ccccgcgccg 120 ctgctggcgg gcgtcactgc cacctgcgtg gcgctcttcg tggtgggcat ctcgggcaac 180 ctgctcacca tgctggtggt gtcccgcttc cgcgagctgc gcaccaccac caacctctac 240 ctatccagca tggccttctc cgatctgctc atcttcctgt gcatgccgct ggacctcgtc 300 cgcctctggc agtatcggcc ctggaacttc ggcgacctgc tctgcaaact cttccagttt 360 gtcagcgagagctgcacctacgccacggtcctcaccatcaccgcgctgagcgtcgagcgc 420 tacttcgccatctgcttcccgctgcgggccaaggtggtggtcaccaagggccgtgtgaag 480 ctggtcatccttgtcatctgggccgtggccttctgcagcgcggggcccatcttcgtgctg 540 gtgggcgtggagcacgagaacggcacagatccccgggacaccaacgagtgccgcgccacc 600 gagttcgctgtgcgctctgggctgctcaccgtgatggtatgggtgtcgagcgtcttcttc 660 tttctgccggtcttctgcctcactgtgctctacagtctcatcgggaggaagctgtggcgg 720 aggcgcggcgacgcggcggtgggctcctcgctcagggaccagaaccacaaacagacagtg 780 aagatgcttgctgtggtggtgtttgctttcatcctctgctggctgcccttccacgtggga 840 agatatctgttttccaagtctttcgagcctggctctctggagatcgcgcagatcagtcag 900 tactgcaacctggtgtcctttgtcctcttctacctcagcgctgccatcaaccccattctc 960 tacaacatcatgtccaagaagtaccgggtggccgtgttcaaacttctaggatttgaatcc 1020 ttctcccagagaaagctttccactctgaaggatgagagttcccgggcctggacaaagtcg 1080 agcatcaatacatga 1095 <210>3 <211>364 <212>PRT

<213>Mus musculus <400> 3 Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Glu Pro Asn Val Thr Leu Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Ser Asp Glu Leu Leu Pro Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr Ala Thr Cys Val Ala Leu Phe Val Val Gly Ile Ser Gly Asn Leu Leu Thr Met Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr Thr Asn Leu Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met Pro Leu Asp Leu Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly Asp Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val Lys Leu Val Ile Leu Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly Pro Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro Arg Asp Thr Asn Glu Cys Arg Ala Thr Glu Phe Ala Val Arg Ser Gly T~eu Leu Thr Val Met Val Trp Val Ser Ser Val Phe Phe Phe Leu Pro Val Phe Cys Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp Arg Arg Arg Gly Asp Ala Ala Val Gly Ser Ser Leu Arg Asp Gln Asn His Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe Ile Leu Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys Ser Phe Glu Pro Gly Ser Leu Glu Ile Ala Gln Ile Ser Gln Tyr Cys Asn Leu Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro Ile Leu Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Lys Leu Leu Gly Phe G1u Ser Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys Asp Glu Ser Ser Arg Ala Trp Thr Lys Sex Ser Ile Asn Thr <210> 4 <211> 366 <212> PRT
<213> Homo sapiens <400> 4 Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Gly Phe Asn Leu Thr Leu Ala Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Gly Asp Glu Leu Leu Gln Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr Ala Thr Cys Val Ala Leu Phe Val Val Gly Ile Ala Gly Asn Leu Leu Thr Met Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr Thr Asn Leu Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met Pro Leu Asp Leu Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly Asp Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val Lys Leu Val Ile Phe Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly Pro Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro Trp Asp Thr Asn Glu Cys Arg Pro Thr Glu Phe Ala Val Arg Ser Gly Leu Leu Thr Val Met Val Trp Val Ser Ser Ile Phe Phe Phe Leu Pro Val Phe Cys Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp Arg Arg Arg Arg Gly Asp Ala Val Val Gly Ala Ser Leu Arg Asp Gln Asn His Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe Ile Leu Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys Ser Phe Glu Pro Gly Ser Leu Glu Ile Ala Gln Ile Ser Gln Tyr Cys Asn Leu Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro Ile Leu Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Arg Leu Leu Gly Phe Glu Pro Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys Asp Glu Ser Ser Arg Ala Trp Thr Glu Ser Ser Ile Asn Thr <210> 5 <211> 364 <212> PRT
<213> Rattus norvegicus <400> 5 Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Glu Pro Asn Val Thr Leu Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Pro Asp Glu Leu Leu Pro Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr Ala Thr Cys Val Ala Leu Phe Val Val Gly Ile Ser Gly Asn Leu Leu Thr Met _ 'j _ Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr Thr Asn Leu Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met Pro Leu Asp Leu Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly Asp Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val Lys Leu Val Ile Leu Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly Pro Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro Arg Asp Thr Asn Glu Cys Arg Ala Thr Glu Phe Ala Val Arg Ser Gly Leu Leu Thr Val Met Val Trp Val Ser Ser Val Phe Phe Phe Leu Pro Val Phe Cys Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp Arg Arg Arg Gly Asp Ala Ala Val Gly Ala Ser Leu Arg Asp Gln Asn His Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe Ile Leu Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys Ser Phe Glu Pro G1y Ser Leu Glu Ile Ala Gln Ile Ser Gln Tyr Cys Asn Leu Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro Ile Leu Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Lys Leu Leu _g_ Gly Phe Glu Ser Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys Asp Glu Ser Ser Arg Ala Trp Thr Lys Ser Ser Ile Asn Thr <210>6 <211>366 <212>PRT

<213>Sus scrofa <400> 6 Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Gly Pro Asn Leu Thr Leu Pro Asp Leu Gly Trp Asp Ala Pro Pro Glu Asn Asp Ser Leu Val Glu Glu Leu Leu Pro Leu Phe Pro Thr Pro Leu Leu Ala Gly Val Thr Ala Thr Cys Val Ala Leu Phe Val Val Gly Ile Ala Gly Asn Leu Leu Thr Met Leu Val Val Ser Arg Phe Arg Glu Met Arg Thr Thr Thr Asn Leu Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met Pro Leu Asp Leu Phe Arg Leu Trp Gln Tyr Arg Pro Trp Asn Leu Gly Asn Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val Lys Leu Val Ile Leu Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly Pro Ile Phe Val Leu Val Gly Val Glu His Asp Asn Gly Thr Asp Pro Arg Asp Thr Asn GIu Cys Arg Ala Thr Glu Phe Ala Val Arg Ser Gly Leu Leu Thr Val Met Val Trp Val Ser Ser Val Phe Phe Phe Leu Pro Val Phe Cys Leu Thr Val Leu Tyr Sex Leu Ile Gly Arg Lys Leu Trp Arg Arg Lys Arg Gly Glu Ala Ala Val Gly Ser Ser Leu Arg Asp Gln Asn His Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe Ile Leu Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys Ser Leu G1u Pro Gly Ser Val Glu Ile Ala Gln Ile Ser Gln Tyr Cys Asn Leu Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro Ile Leu Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Lys Leu Leu Gly Phe Glu Pro Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys Asp Glu Ser Ser Arg Ala Trp Thr Glu Ser Ser Ile Asn Thr <210>7 <211>39 <212>DNA

<213>PCR primer <400> 7 gggcccgaat tcgccgccat gtggaacgcg acgcccagc 39 <210> 8 <211> 30 <212> DNA
<213> PCR primer <400> 8 caccaccaca gcaagcatct tcactgtctg 30 <210> 9 <211> 33 <212> DNA
<213> PCR primer <400> 9 aagatgcttg ctgtggtggt gtttgctttc atc 33 <210> 10 <211> 38 <212> DNA
<213> PCR primer <400> 10 agtttagcgg ccgctcatgt attgatgctc gactttgt 38

Claims (11)

WHAT IS CLAIMED IS:

1. Mouse growth hormone secretagogue receptor, free from receptor-associated proteins.

2. Isolated mouse growth hormone secretagogue receptor.

3. A receptor according to Claim 1 or 2 which comprises SEQ
ID NO:3.

4. A nucleic acid which encodes mouse growth hormone secretagogue receptor, said nucleic acid being free from associated nucleic acids.

5. A nucleic acid according to Claim 4 which is DNA.

6. A nucleic acid according to Claim 4 which comprises SEQ
ID NO:1.

7. A nucleic acid according to Claim 4 which is RNA.

8. A vector comprising a nucleic acid which encodes a mouse growth hormone secretagogue receptor.

9. A vector according to Claim 8 which is selected from the group consisting of: plasmids, modified viruses, yeast artificial chromosomes, bacteriophages, cosmids and transposable elements.

10. A host cell comprising a vector according to Claim 8.

11. A method of identifying ligands which comprises:
(a) contacting the receptor of claim 3 with compounds suspected of being ligands specific for said receptor; and (b) determining whether binding occurs, binding constituting a positive indication of the presence of a ligand.