CA2331876A1

CA2331876A1 - Water-soluble ligand-binding proteins and analogs of ligand-gated channels, crystals thereof and their use for screening ligands of ligand-gated ion channels

Info

Publication number: CA2331876A1
Application number: CA002331876A
Authority: CA
Inventors: August Benjamin Smit; Titia Karen Sixma
Original assignee: Individual
Current assignee: Stichting voor de Technische Wetenschappen STW
Priority date: 2000-02-10
Filing date: 2001-02-12
Publication date: 2001-08-10
Also published as: IL151156A0; EP1252311A2; JP2003521932A; WO2001058951A2; WO2001058951A3; AU3737201A

Abstract

Provided are water-soluble ligand-binding proteins derived from molluscs and analogs of ligand-gated ion channels, crystals thereof and their use for screening ligands of ligand-gated ion channels. In particular, water-soluble ligand-binding proteins are provided that are capable of forming multimers and are amenable to crystallization. The crystal structure of one these proteins, an acetylcholine binding protein (AChBP) is provided, which can be used to generate 3D models of the extracellular ligand-binding domain of ligand-gated ion channels and thus for screening of drugs that act on these ion channels. Furthermore, chimeric proteins are provided that are capable of binding a ligand of a ligand-gated receptor, and comprising at least the amino acids of the AChBP determining solubility of the AChBP, in the same positions as in the AChBP, and furthermore comprising amino acids determining binding to said ligand.

Description

NWO-TECHNOLOGIESTICHTING STW
OUR REF.: F 1105 CA
WATER-SOLUBLE LIGAND-BINDING PROTEINS AND ANALOGS OF LIGAND-GATED ION CHANNELS, CRYSTALS THEREOF AND THEIR USE FOR
SCREENING LIGANDS OF LIGAND-GATED ION CHANNELS
SUMMARY OF THE INVENTION
Novel water-soluble ligand-binding proteins have been identified and isolated, which have a ligand-binding profile substantially similar to that of ligand-gated ion channels.
DNA molecules encoding such proteins have been cloned and characterized. The biological and structural properties of these proteins are disclosed, as is the amino acid and nucleotide sequence. The recombinant DNA molecules, and portions thereof, are useful for isolating homologues of the DNA molecules, identifying and isolating genomic equivalents of the DNA molecules, and identifying, detecting or isolating mutant forms of the DNA molecules. Using a recombinant expression system functional DNA molecules encoding the water-soluble ligand-binding proteins as well as chimeras have been functionally produced. Furthermore, the water-soluble ligand-binding proteins could be crystallized revealing the three dimensional (3D) structure and enabling the modeling of the 3D structure of the,ligand-binding domain of ligand-gated ion channels. The invention is further in the field of the development of new drugs that are capable of selectively intervening in neuronal signaling pathways. The invention is more in particular concerned with providing new analogues of the channel-coupled receptors, crystal structures thereof and to their use in screening ligands for these receptors.
Several documents are cited throughout the text of this specification either by name or are referred to by numerals within parenthesis. Full bibliographic citations may be found at the end of the specification immediately preceding the claims. Each of the documents cited herein (including any manufacturer's specifications, instructions, etc.) are hereby incorporated herein by reference; however, there is no admission that any document cited is indeed prior art as to the present invention.

_7 BACKGROUND OF THE INVENTION
The communication in the central nervous system (CNS) occurs through a complex interaction of electrical and chemical signals. Molecules bearing chemical information are called neurotransmitters. The chemical information is converted in electric currents on the post-synaptic membrane, which is specialised in recognising and binding neurotransmitters by means of protein receptors. The specific binding of a ligand to one type of such receptors, the ionotropic receptors, induces a fast opening of the ion channel coupled to the receptor. An important group of ionotropic receptors is the superfamily of the channel-coupled receptors, also referred to as ligand-gated receptors, including the 7-amino-butyric acid (GABAA) receptor, the glycine receptor, the serotonin-3 (5-HT3) receptor and both neuronal and muscle-type nicotinic acetylcholine receptors (nAChR). These receptors share certain structural features such as (1 ) a 15-residue cysteine loop between amino acids 128 and 142 corresponding to the Torpedo AChR a unit, (2) four trans-membrane domains, (3) similar subunit arrangements, and (4) homologies in amino acid sequence.
Activation of these receptors causes a change in electrical current and hyperpolarisation of the cell membrane and consequently an inhibition of the electrical activity of the cell. The GABAA receptor and the glycine receptor are coupled to a chloride-selective channel, and thus the inhibition of the electrical activity leads to inhibition of the cell response.
On the other hand, activation of the 5-HT3 receptor and the nAChRs provokes an excitatory response on the cell because they are connected to a cation-selective channel (Na+, K+, Ca2+). The AChRs are the best studied of the ligand-gated receptors; for a review, see Arias, Brain Research Reviews, 25 (1997)133-191 and Arias, Neurochem. Int. 36 (2000), 595-645). Mutations in these ligand-gated ion-channels (LGICs) lead to diseases such as congenital myasthenia gravis, epilepsy, startle syndrome and alcohol sensitivity (Vafa and Schofield, Int. Rev.
Neurobiol. 42, 285-332; 1998). NAChRs mediate nicotine addiction in chronic tobacco users.
Since nicotine binding to these receptors also has a positive effect on Alzheimer's disease, Parkinson's disease and schizophrenia these receptors present an important drug target (Peterson and Nordberg, A. Neuronal nicotinic receptors in the human brain.
Prog. Neurobiol. 61, 75-111; 2000).
The development of new active compounds that can selectively or - as the case may be - a-selectively bind to the channel-coupled receptors, is of utmost importance for the understanding of the processes occurring in the nervous system and for the treatment of disturbances of neural conditions. The development of such active compounds requires the availability of a reliable model system for the corresponding receptors. The primary structural features (amino acid sequences) of the various receptors have been largely elucidated by now. Certain subunits of the AChRs have been found to be determinant in the pharmacological specificity or affinity of the receptor for its ligand (Corringer et al., J. Neuroscience 18 (1998), 648-657).
However, the study of the ligand binding properties of the receptor proteins is hampered by the fact that the spatial structure of the proteins - which is decisive in the binding of ligands - is still unknown. This is partly because crystallisation of the receptor proteins has been unsuccessful up to now.
The above-defined technical problem is solved by the present invention by providing the embodiments characterized in the claims.
Accordingly, in one aspect the present invention relates to a water-soluble protein derived from a mollusc being capable of binding a ligand of a ligand-gated receptor.
It has been found according to the invention that acetylcholine-binding proteins (AChBP) of certain molluscs show a surprising structural similarity with the channel-coupled receptors on the one hand and have interesting physical properties, such as water-solubility, on the other hand. The molluscan AChBPs are capable of forming multimers, especially pentamers, and of binding specific toxins such as a-bungarotoxin. These multimers may be homogeneous (identical units) or heterogeneous (different units). These properties make them eminently suitable as model systems for studying the binding of candidate ligands to the channel-coupled receptors. It has been possible to produce these molluscan AChBPs in recombinant systems, thus allowing convenient and large-scale production thereof.
Moreover, it is feasible to construct hybrid proteins sharing the physical properties of the mollusc AChBP with the pharmacological properties of the (human) channel-coupled receptors, thus providing new dedicated tools for screening ligands for these receptors.
The AChBP is a naturally occurring analogue of the extracellular domains of the a-subunits of the neuronal nicotinic acetylcholine receptors (nAChRs). In contrast to the nAChRs, it lacks domains to form a transmembrane ion channel, but alike the nAChRs it assembles into a homo-pentamer (Figure 6). Moreover, AChBP has ligand-binding characteristics that are typical for a nicotinic receptor. The dimensional structure of AChBP was solved by X-ray crystallography at 2.7A
resolution (current Rfa~t~r = 27.9 %, R,ree = 30.0 %). In crystals, as in solution, AChBP
forms a stable homo-pentamer with dimensions comparable to those of the ligand-binding domain of the nAChR, as determined in EM studies by Unwin, Struct.
Struct.
Biol 121 (1998), 181-190. The high-resolution crystal structure of AChBP, along with biochemical and pharmacological data, supports the extrapolation of AChBP as a good mimic of ligand-binding domains of ligand-gated ion channels including nAChR, 5-HT3R, GABAA,~R and GIyR.
Four AChBPs according to the present invention are exemplified herein, isolated and cloned from the CNS of Lymnaea stagnalis (L-AChBP_T1 and L-AChBP_T2) and Bulinus truncatus (B-AChBP T1 and B-AChBP_T2). L-AChBP T1 and 2 are 229 amino acid proteins with a signal sequence of 19 amino acids (224 and 21 amino acids, respectively, for B-AChBP T1 and 2; see also Figure 1 ) and have sequence homology with the extracellular domains of the subunits of ligand-gated ion channels (Figure 3), in particular with those of the nAChRs (Figure 4 and 5). The mass of the purified AChBP from Lymnaea has been determined by mass-spectrometry. The glycosylated form has a mass of about 24720 Da and the de-glycosylated form of about 23832 Da. In SDS-PAGE the glycosylated AChBP migrates between the 14 and 26 kDA marker proteins. Hydrophopicity plots of the AChBPs are shown in Figure 2, which reveal those regions of the ligand-binding proteins that are particularly hydrophilic and thus may be replaced at least in part or essential amino acids thereof in the ligand-binding domain of the ligand-gated ion channel.
Sequence conservation is particularly high in the so-called loop areas (reviewed by Arias, Neurochem. Int. 36 (2000), 595-645), which contain the residues involved in ligand-binding. The cysteine residues characteristic for the Cys-loop family of ligand gated receptors are conserved in AChBP. Also the double cysteine typically found in the alpha subunits of the nAChR is present. AChBP protein sequence ends at the position where in the nAChRs the first predicted transmembrane domain would start.
The ligand-binding characteristics of AChPBs are described in Example 4 and summerized in Table 2.
The terms "channel coupled receptors", "ligand-gated receptor", "ligand-gated ion channel" are used interchangeable herein. However, in context with the natural occurring, in particular human molecules the term "ligand-gated ion channel"
is preferably used. The water-soluble ligand-binding protein of the invention can also be characterized as a ligand-binding protein having at least 10%, more preferably at least 12°i~, still more preferably at least 15% and most preferably at least 20% amino acid sequence identity to a vertebrate ligand-gated ion channel but missing any traps-membrane domain. A ligand-gated receptor of the present invention is characterized by having substantially the same ligand-binding characteristics of a vertebrate, preferably mammalian, most preferably human ligand-gated ion channel but comprising at least one alteration in the original amino acid sequence, said alteration resulting in the presence of an amino acid determining or contributing to the water-solubility of the water-soluble ligand-protein found in molluscs, in particular snails such as those described in more detail below.
The terms "ligand-binding protein", "ligand-binding domain" and "ligand-binding receptor" are meant to at least include the portion of a water-soluble ligand-binding protein or corresponding modified ligand-gated ion channel required for binding a ligand. Minimally the ligand-binding domain consists of a peptide containing that domain. However the use of this term is meant to include a ligand- binding domain or protein that is comprised by a larger portion of, for example, ligand-gated ion channel, such as a fully reconstituted nicotinic acetylcholine receptor.
As shown in Figure 3 the nicotinic acetylcholine receptor (nAChR) belongs to a well-understood member of the ligand-gated ion channels superfamily. The members of this signaling protein group, including 5-HT3, glycine, GABAA, and GABA~
receptors, are thought to share common secondary, tertiary, and quaternary structures on the basis of a high degree of sequence similarity. Therefore, it is expected that the novel findings in respect to the exemplified AChBP equally apply to the other members of the mentioned ligand-gated ion channels superfamily. Thus, either water-soluble protein being capable of binding a ligand of any of those ligand-gated ion channels may be found in molluscs or the present 5-HT3, GABAA, and glycine receptors can be modified such as to substantially retain their binding affinity.
Accordingly, the ligand of the water-soluble ligand-binding protein is preferably acetylcholine, gamma-amino-butyric acid (GABA), glycine, nicotine or serotonin.
Isolation of such water-soluble ligand-binding proteins can be done as described in Example 1 for the AChBP of the present invention. Instead of a-bungarotoxin other known ligands or can be used for affinity purification. Most preferably, water-soluble ligand-binding protein of the invention is a acetylcholine-binding protein (AChBP).
Preferably, the ligand-binding protein displays substantially the binding characteristics shown in Table 2.
The acetylcholine-binding proteins to be used according to the invention are originally derived from aquatic molluscan species, especially species from the class of the snails (Gastropoda), in particular from the order of the lunged snails (Pulmonata).
The order of the Pulmonata is divided into the suborders of the Basommatophora (mostly aquatic snails), Systellommatophora and Stylommatophora (mostly land snails). The Basommatophora include the families of the Acroloxidae (e.g.
genus Acroloxus), Lymnaeidae (e.g. genera Galba, Stagnicola, Radix and Lymnaea), Physidae (e.g. genera Physa and Aplexa) and Planorbidae (e.g. genera Planorbis, Anises, Ancylus, Gyraulus, Biomphalaria and Bulinus). Examples of suitable species are Lymnaea stagnalis (pond snail) and Bulinus truncates. The isolation of the AChBPs from these snails, cloning of the cDNA encoding these AChBPs and their characterization including the full amino acid sequences is described in the examples. The cDNA and amino acid sequences of the AChBPs of Lymnaea stagnalis are depicted in SEQ ID Nos. 1 and 2 (L-AChBP T1 ) and SEQ ID Nos. 3 and 4 (L-AChBP_T2). Those of Bulinus truncates are depicted in SEO ID Nos. 5 and 6 (B-AChBP_T1) and SEQ ID Nos. 7 and 8 (B-AChBP_T2). Features of these proteins are further described in the examples and the accompanying figures.
While a water-soluble ligand-binding protein derived form a Pulmonata species, preferably from a Basommatophora species is preferred, it will be appreciated that the present invention generally relates to any water-soluble protein being capable of binding a ligand of a ligand-gated receptor comprising an amino acid sequence selected from the group consisting of:
(a) an amino acid sequence as depicted in any one of SEQ ID Nos. 2, 4, 6 or 8 or a functional equivalent thereof, or a fragment of at least 5 continuous amino acids thereof;
(b) an amino acid sequence having at least 30% amino acid identity to the amino acid sequence of any one of SEQ ID Nos. 2, 4, 6 or 8; and (c) an amino acid sequence resulting in a protein which is detectable by a monoclonal or polyclonal antibody which recognises, preferably with a binding affinity of at least 10-'M, a protein comprising an amino acid sequence of (a) or (b).
Identity or similarity, as known in the art, are relationships between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Both identity and similarity can be readily calculated (Computational Molecular Biology, Lesk, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin and Griffin, eds., Hurnana Press, New Jersey, 1994;
SequencE~ Analysis in Molecular Biology, von Heinje, Academic Press, 1987; and SequencE~ Analysis Primer, Gribskov and Devereux, eds., M Stockton Press, New York, 1991 ). While there exist a number of methods to measure identity and similarity between two polynucleotide or two polypeptide sequences, both terms are well known to skilled artisans (von Heinje, supra; Gribskov and Devereux, supra;
and Carillo and Lipman SIAM J. Applied Math. 48 (1988), 1073). Methods commonly employed to determine identity or similarity between sequences include, but are not limited to those disclosed in Carillo and Lipman; see supra. Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux et al., Nucleic Acids Research 12 (1984), 387), BLASTP, BLASTN, psi BLAST and FASTA (Atschul et al., J. Molec. Biol. 215 (1990), 403).
In another embodiment, the present invention relates to a water-soluble protein being capable of binding a ligand of a ligand-gated receptor comprising (a) at least the amino acids of the water-soluble protein described above determining solubility of said protein, in the same or corresponding positions as in said protein; and (b) at least 4 amino acids determining binding to said ligand.
Protein expression studies have shown that wild-type AChBP of the mollusc Lymnaea stagnalis can be produced in Pichia pastoris yeast. The yeast cells express AChBP in a homopentameric form and secrete the protein complex into the medium.
The IargE~ amounts of AChBP per volume of medium produced (up to 2 mg per liter medium) and the large volumes of yeast that can be cultured allow a large-scale production of AChBP. Besides the wild-type AChBP, various AChBP mutants have been produced in Pichia pastoris. These include mutants containing the following single point mutations (the numbers refer to the amino acid position in the AChBP
sequence of Lymnaea stagnalis depicted in SEQ ID No. 2 counted from the first amino acid of the signal peptide; the letter before the number indicates the original amino acid and the letter after the number indicates the mutant amino acid) N85D, H164Y, D194N, Y204P, Y211 P and D213N.
Thus the invention pertains to water-soluble proteins derived from molluscan, preferably acetylcholine binding proteins (AChBP's), which are capable of forming multimers, and are capable of binding a ligand of a ligand-gated receptor.
These proteins comprise, on the one hand, at least of the amino acids of the AChBP
determining solubility of the AChBP in the same positions as in the AChBP, and, on _g the other hand, amino acids determining binding to the ligand of the ligand-gated receptor. The degree of identity with the molluscan AChBP sequence can be defined by amino acid identity, of at least 15%, preferably 20%, more preferably 30%, still more preferably 40%, preferably at least 50 or even at least 60%, preferably more than 70%, more preferably more than 80% and most preferably at least 90%
identity, or more, .as determined, e.g., using the art-known BLAST algorithm. The amino acids determining binding to the ligand should comprise at least 4 amino acids, preferably at least 5 or even at least 8 amino acids, including a series of at least 3 or 4 amino acids, corresponding to the receptor sequence and preferably differing from the corresponding AChBP amino acids. Preferred embodiments of these proteins are further defined below. Usually, the water-soluble ligand-binding protein or domain as part of a for example chimeric ligand-gated ion channel will comprise 200-240 amino acids. The ligand is preferably acetylcholine, nicotine, lophotoxin, d-tubocurarine, carbamylcholine, galanthamine or epibatidine.
Said ligand-gated receptor can be derived from an arthropod (preferably insect), a plant (preferably a higher plant, most preferably a seed plant) or a chordate (preferably a mammalian, most preferably human), preferably said ligand-gated receptor is a nicotinic acetylcholine receptor.
Usually, the said amino acids in the water-soluble ligand-binding proteins of the invention, which determine solubility are in the same positions as in the AChBP
having the amino acid sequence as depicted in any one of SEQ ID Nos. 2, 4, 6 or 8.
The solubility determining regions are based on solvent accessibility in structure. The respective amino acid residues can be chosen for example according to Figure 10 or 11 in which the solvent accessible regions are indicated. Preferably, the water-soluble ligand-binding protein of the invention comprises an amino acid sequence having at least 40% amino acid identity to the amino acid sequence of the mature AChBP comprising the amino acid sequence of any one of SEQ ID Nos. 2, 4, 6 or 8, in which the ligand binding amino acids have been replaced with the corresponding amino acids of a ligand-gated receptor.
In one embodiment of the protein of the invention said solubility-determining amino acids (a) comprise hydrophilic amino acids (Asp, Glu, Arg, Lys) from the sequences 20-44, 7',3-81, 86-92, 112-120, 135-152, 166-189, 196-20, 209-213, and/or 219-of SEQ ID No. 2.
The amino acid sequences of L-AChBP T1 (SEQ ID No. 2) and T2 {SEQ ID No. 4) are almost similar. For the sake of clarity, reference is always made to L-AChBP T1 (SEQ ID No. 2). However, all references to amino acid residues within are valid for both T1 and T2, with the noticeable exceptions of Arg(167) becoming Gly(167) and and Thr(203) becoming Ile(203). Furthermore, regarding the amino acid residues (domains) from L-AChBP T1 and the corresponding residues from B-AChBP the following list provide those amino acid positions in which L-AChBP and B-AChBP
differ. All amino acid residue numbers below correspond to their position within the amino acid sequence of the immature protein (numbering starting at methionine (1 ).
One could also start numbering at the start of the amino acid sequence of the mature sequence (L(1 )DRAD for L-AChBP and Q(1 )IRW for B-AChBP). When using this second method (1st amino acid of the mature seq. = position 1) simply subtract from the L.-AChBP position numbers and 21 from the B-AChBP position numbers, for example Asp(36) becomes Asp(17) for L-AChBP) and Asp(15) for B-AChBP. For the further embodiments the positions are given for L-AChBP T1 (SEQ ID No. 2) followed by an indication of the corresponding amino acid positions in the amino acid sequence of L-AChBP T2 (SEO ID No. 4) and B-AChBP T1 (SEO ID No. 6) & B-AChBP _ _T2 (SEQ ID No. 8) in the form of (L-AChBP_T1 &T2 : B-AChBP_T1 &T2).
In a preferred embodiment said solubility determining amino acids (a) comprise amino acids Asp(36), Asp(68), Glu(115), Arg(137), Asp(143), Asp(148), Glu(150), Arg(167), Arg(189), Glu(215) of SEO ID No.2, wherein Asp may be exchanged for Glu and vice versa and Lys may be exchanged for Arg and vice versa (L-AChBP ~'1 &T2 : B-AChBP T1 &T2; Asp(36) : Asp(36); Asp(68): Asp(68); Glu(115):
Glu(116); Arg(137): Arg(138); Asp(143): Asp(144); Asp(148): Asp(149);
Glu(150):
Glu(151 ); Arg(167): Gly(167), in L-AChBP T2 : Lys(168); Arg(189): Lys(190);
Glu(215): Glu(216).
In a still more preferred embodiment the water-soluble ligand-binding protein comprises the amino acids Cys(142), Thr(149), Ala(153), Thr(154), Cys(155), Arg(156), _Ile(157) and/or Lys(158) of SEQ ID No. 2. (L-AChBP T1 &T2 : B-AChBP T1 &T2; Cys(142): Cys(143); Thr(149): Thr(150); Ala(153): Ala(154);
Thr(154): Thr(155); Cys(155): Cys(156); Arg(156): Arg(157); Ile(157):
Ile(158);
Lys(158): Lys(159). In a further embodiment the water-soluble ligand-binding protein comprises either in addition or alternatively the amino acids (b) Pro(39), Trp(77), Trp(101 _), Pro(103), Asp(194), and/or Ser(161 ) of SEQ ID No. 2 (L-AChBP_T1 &T2 B-AChBF T1 &T2; Pro(39): Pro(39); Trp(77): Trp(77); Trp(101 ): Trp(102);
Pro(103):
Pro(104); Ser(161 ): Ser(162); Asp(194): Ser(195).
In a still further embodiment the water-soluble ligand-binding protein comprises either -1~
in addition or alternatively to the above described embodiments amino acid sequences 165-169 and/or 200-203 of SEQ ID No. 2 have been exchanged with the corresponding sequence of the ligand-gated receptor (L-AChBP T1 &T2 : B-AChBP T1 &T2; His(165)-Iso(169): Asp(166)-Phe(170) (B-AChBP_T1 ) : Asp(166j-Leu(170) (B-AChBP T2); Asn(200)-Thr(203); Iso(203) for L-AChBP_T2: Asn(201)-Lys(204).
The amino acids determining binding to the ligand of the nicotinic acetylcholine receptor include three stretches on the nAChR alpha subunits. These stretches contain amino acids that are conserved throughout the various nAChR alpha subunits and that are essential for ligand binding. These stretches (corresponding to the Torpedo alpha subunit) are (numbering of nAChR a7 as depicted in SEO ID
No.
9): Trp (108) - Tyr (115), Trp (108) and Tyr (115) being essential; Trp (171) -Tyr (173), thE: amino acids Trp (171 ) and Tyr (173) being essential; Tyr (210) -Tyr (217), the amino acids Tyr (210), Cys (212), Cys (213) and Tyr (217) being essential.
In the chimeric proteins according to the invention, at least the essential amino acids of at least one of these stretches haven been substituted for the corresponding amino acids. Preferably, the entire stretches have been substituted.
In a particularly preferred embodiment of the invention, the water-soluble ligand-binding protein is capable of binding a ligand of an acetylcholine receptor, wherein in said protein at least one of the amino acid sequences Trp(101 ) - Tyr(T108), Trp(162) - His(164) and Tyr(204) - Tyr(211 ) of SEO ID No. 2 has been exchanged with the corresponding sequence of the acetylcholine receptor (L-AChBP T1 &T2 : B-AChBP_T1 &T2; Trp(101 )-Tyr(108): Trp(102)-Tyr(109); Trp(162)-His(164):
Trp(163)-His(165), (B-AChBP_T1 ) : Trp(163)-Phe(165) (B-AChBP_T2); Tyr(204)-Tyr(211 ):
Tyr(205)-~Tyr(212).
On the basis of homology to the AChBPs, it is possible to change amino acid residues in the original amino acid sequence of the ligand-gated ion channel, which are not critical to ligand-binding or essential for the tertiary and quaternary structure of the receptor but could be substituted to amino acid residues which according to the AChBP in particular the crystal structure contributes to their water-solubility. As a result thE: ligand-gated ion channel or its ligand-binding domain or the respective monomers and pentamers are for example expected to be more easily expressible in recombinant expression system and more importantly amenable to crystallization, allowing the construction of three-dimensional models of their ligand binding domains.

Thus, in another embodiment the present invention relates to a method for the production of a water-soluble ligand-gated receptor or a corresponding ligand-binding domain or for improving the water solubility and accessibility to crystallization of such a receptor or domain, said method comprising altering the amino acid sequence of the extracellular domain of a ligand-gated receptor by way of substituting, adding, deleting or modifying at least one amino acid at a position corresponding to an amino acid determining or contributing to the water-solubility of the above-described water-soluble ligand-binding protein of the present invention The method of the invention can be pf:rformed using conventional techniques known in the art, for example, by using amino acid deletion(s), insertion(s), substitution(s), addition(s), and/or recombination(s) and/or any other modifications) known in the art either alone or in combination. Methods for introducing such modifications in the DNA sequence underlying the amino acid sequence of the ligand-binding domain a ligand-gated ion channel are well known to the person skilled in the art; see, e.g., Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y.
The resulting ligand-gated receptor or ligand-binding domain retains comparable in vitro and preferably also in vivo ligand-binding activity to that of the ligand-gated ion channel, and more importantly, allow complete crystallization of the protein such that they may be characterized by X-ray crystallography. The X-ray crystallographic data can be used for example for identification and construction of possible therapeutic compounds in the treatment of various disease conditions.
As has been discussed herein before, the ligand-gated ion channel superfamily including nACh, 5-HT3, glycine, GABAA, and GABA~ receptors as well as invertebrate glutamate ion-channels and MOD-1 serotonin channel contain extracellular ligand binding domains that are homologous to the AChBP. Many of these receptors are promising drug targets. Therefore, the ligand-gated receptor to be modified is preferably one of those of the mentioned superfamily, most preferably it is nAChR.
Information on the nucleotide and amino acid sequences, structural elements, functional assays of the nAch, 5-HT3, glycine, GABAA, and GABA~ receptors can be found in 'the prior art. For example, the nicotinic receptors at the amino acid level are described in Corringer et al., Annu. Rev. Pharmacol. Toxicol. 40 (2000), 431-458.
Means for retrieving nucleotide and amino acid sequences, perfiorming sequence alignments in order to identify the most likely critical amino acid residues are described below and in the examples; for further general information see the review on periplasmic binding protein (PBP), an ancient protein module present in multiple drug receptors by Felder et al., PharmSci. 1 (2) (1999).

In a preferred embodiment of the method of the present invention, said at least one amino acid is altered to the corresponding amino acid of the amino acid sequence depicted in any one of SEQ ID Nos. 2, 4, 6 or 8, or to a an equivalent amino acid, preferably in which said solubility-determining amino acids comprise solvent accessible regions in the crystal structure according to Figure 10 or 11.
Preferred amino acid sequence positions and amino acid substitutions are described above for the AChBP and can be applied generally in the method of the present invention.
It is expected that the insertion of the loop Cys123-Cys136 of the mature AChBP
SEQ ID No. 2 into the equivalent region (Cys127-Cys141) in the mature nicotinic a7 homopentamer ligand binding domain creates an easily expressed form of this protein. likewise, this loop or an equivalent loop from other water-soluble ligand proteins of the present invention can be inserted into the equivalent region of other homopentameric ligand binding domains of ligand gated ion channels such as the glycine receptor and the 5-HT3 receptor to create an easily expressed form of those proteins.
Thus, in one embodiment, the present invention relates to any one of the above described methods, wherein loop Cys123-Cys136 of SEQ ID No. 2 is inserted into the corresponding region of the ligand binding domain of the ligand-gated receptor.
The above described water-soluble ligand-gated receptor or a corresponding ligand-binding domain are usually prepared by site-directed mutagenesis of the underlying encoding polynucleotide. Once the corresponding polynucleotide has been generated it can be used to express the altered ligand-gated receptor or a corresponding ligand-binding domain. Thus, the method of the present invention commoniy comprises (a) culturing a host cell transfected with and capable of expressing a polynucleotide comprising a nucleotide sequence encoding the altered amino acid sequence; and optionally (b) recovering said water-soluble ligand-gated receptor or corresponding lic~and-binding domain from the culture.
Methods for the expression and purification of the water-soluble ligand-gated receptor or corresponding ligand-binding domain of the present invention are described further below. Preferably, the expression system described in Examples 4 and 5, or' corresponding expression systems are used.

The present invention also relates to the a water-soluble ligand-gated receptor and ligand-binding domain obtainable by the above described methods of the invention.
Preferably, said water-soluble ligand-gated receptor exhibits a 10-fold, more preferably 100-fold, still more preferably 1000-fold and most preferably 10000-fold higher solubility in water than the corresponding wild type, preferably human ligand-gated receptor. However, improvements in water solubility of about 2 to 5 fold is also already advantageous. The average hydrophobicity may be in the range of -100 to -400. Accordingly, the present invention provides methods for the prediction and creation of mutants and chimeras of ligand binding domains of homopentameric acetylcholine receptor subtypes and of other homopentameric ion channels with increased solubility.
In one embodiment the water-soluble ligand-binding protein of the invention further comprises a spacer sequence allowing coupling with a carrier body. The spacer sequence may be an amino acid sequence encodable by a polynucleotide or other molecule such as polymethylene anchor groups commonly used in chip technology.
The chimeric protein of the invention may further comprise a spacer sequence, which allows coupling of the protein to a carrier body. Such spacer sequence may be e.g.
an oligo-histidine stretch attached to the C-terminus of the protein. Such an oligo-histidine stretch is capable of binding to Talon~ metal affinity beads or similar carriers. Such binding stretches have no detectable influence on the pharmacological properties of the proteins. The chimeric proteins according to the invention can be used for screening of specific binding of potential drugs, in particular screening for modulators of ion-channel opening. Conventional in vitro screening techniques, such as phage display technology, can be used for this purpose. High-throughput assays, possibly in combination with combinatorial chemistry can also be used.
Specific binding of test compounds to the (immobilised) chimeric proteins of the invention can be performed e.g. by competition binding assays using alpha bungarotoxin as a competitor. The invention also concerns test kits containing the proteins described above, together with further means for carrying out a screening test, such as carriers, labels, diluents, other chemicals etc.
In additian, the present invention relates to fusion proteins comprising the water-soluble ligand-binding protein of the invention or a binding fragment thereof and a fragment of a ligand-gated receptor. The term "fusion protein" as used herein refers to protein constructs that are the result of combining multiple protein domains or linker regions for the purpose of gaining the combined functions of the domains or -1~
linker regions. This is may be accomplished by molecular cloning of the nucleotide sequences encoding such domains to produce a new polynucleotide sequence that encodes the desired fusion protein. Alternatively, creation of a fusion protein may be accomplished by chemically joining two proteins. A fusion protein of the present invention preferably comprises at least the ligand-binding domain of the AChBP
or of a ligand-gated ion channel, which has been modified in accordance with the above described methods.
Nicotinic acetylcholine receptors are comprised of five subunits, selected from a related family of subunit proteins. The neuronal subunits fall into two main types depending on the presence or absence of a pair of vicinal cysteines close to the binding site for acetylcholine. Thus all a-subunits contain paired cysteine residues thought to play a role in binding of nicotinic agonists (Aplin and Wonnacott, 48 (1994), 473-477);, whereas the ~-subunits do not. There are ten known alpha subunits, a1 to a10, and at least four beta subunits, a1 to ~4. Receptors comprise at least one alpha subunit which in some cell types combine with a beta subunit and in some cases a gamma, delta and epsilon subunit. For example, the AChR at the neuromuscular junction is believed to have an (a1)2~1y8 stoichiometry. Within the group of a-subunits there is marked diversity in the manner in which a complete functional nAChR is, formed. The majority of the a subunits only form functional receptors when combinecl as a heteropentamer with a-subunits in the CNS (McGehee and Role, Annual Review of Physiology 57 (1995), 521-546). However, a7, a8 and a9 nAChR
subunits and the related 5-HT3A subunit are capable of forming functional homopentameric receptors. In this respect it is interesting that the phylogenetic relationship between nAChR subunits suggest that a7, a8, a9 and the related 5-subunit are more related to each other than to the subunits which only form heteropentameric receptors. Sequence homologies indicate that the a7, a8 and a9 subunits form a distinct subgroup of the alpha subunits.
As is evident form the foregoing, the above described water-soluble ligand-binding protein or receptor or ligand-binding domain thereof can be used for forming complexes of homo- or heteromultimers, such as a dimer, pentamer or decamer consisting of at least one monomer of the mentioned proteins of the present invention. Preferably, these multimers constitute a function ligand-gated receptor.
Preferably, said ligand-gated receptor is related to the nAchR.
The present invention also relates to the production of synthetic heteropentamers resembling heteropentameric gated ion-channels by mutation of AChBP, using -1$
knowledge of the crystal structure about the primary and secondary contact regions;
see infra. Preferably, said synthetic heteropentamers resembles a heteropentameric nicotinic acetylcholine receptor. Accordingly, the present invention more generally relates to a ligand-gated ion channel comprising any one of the above described water-soluble ligand-binding proteins or receptors of the invention as a monomer, homo- or heterodimer or -pentamer. This method therefore allows the prediction and creation of mutants and chimeras of nicotinic acetylcholine receptors and other ligand-gated ion channels that are insensitive or more sensitive to toxin binding, e.g.
bungarotoxin, lophotoxin, conotoxin, and other toxins that inhibit ligand-gated ion channels. Preferably, said ligand-gated ion channel is less or more sensitive to binding of toxins such as bungarotoxin, lophotoxin or conotoxin compared to the wild type ligand-gated ion channel.
Further information and examples how to create chimeric ligand-binding proteins in accordance with the present invention is given in Example 10.
The nucleotide and amino acid sequences of the acetylcholine, 5-HT3, glycine, GABAA, and GABA~ receptors can be easily retrieved from public database, for example from the Internet using http://www.ncbi.nlm.nih.gov/Entrez. The citations also include a reference to the corresponding publication also reporting on the functional expression of the respective receptor.
The use of recombinant acetylcholine-gated ion channels and functionally assays in the discovery of putative novel ligands has been described in Cosford, Pharm.
Acta Helv. (2000), 74(2-3), 125-130. Furthermore, the cell-free expression and functional reconstitution of homo-oligomeric a7 nicotinic acetylcholine receptors into planar lipid bilayers has been reported by Lyford and Rosenberg, J. Biol. Chem. (1999), 274(36), 25675-25681. The use of functional assays of cloned and native muscarinic acetylcholine receptors for determining the selectivity profile of toxins has been described by Olianas et al. (J. Pharmacol. Exp. Ther. 288 (1999), 164-170). A
system for the evaluation of pharmacological differences and similarities between 5-receptors stably transfected cells is provided by for example Bruss et al., Naunyn-Schmiedebergs Archives of Pharmacology 360 (1999), 225-33. The primary structure and functional expression of the 5-HT3 receptor is described in Maricq et al., Science 254 (1991 ), 432-437. Likewise, the stable expression of human glycine a1 and a2 receptor monomers in mouse L(tk-) cells and their use for the study of the physiology and pharmacology of functional glycine receptors is described in Wick et al., J.
Neurosci. Methods 87 (1999), 97-103. An example for the measurement of the pharmacology of recombinant GABAA receptor subtypes is described in Simpson et al., J. Neurosci. Methods 99 (2000), 91-100. Further examples for assay systems are given below.
The described methods as well as others known to the person skilled in the art can be used for example to (1 ) express and characterise the water-soluble ligand-binding proteins and ligand-gated ion channels of the present invention; and (2) use stably transfected cells expressing the above described ligand-gated ion channels for the identification of novel ligands.
The pre~;ent invention also relates to polynucleotides encoding the water-soluble ligand-binding proteins and ligand-gated ion channels of the present invention, and multimer s thereof, preferably dimers or pentamers. Such polynucleotide may be a DNA such as a cDNA, or an RNA such as mRNA or any other form of nucleic acid including synthetic or modified derivatives and may encode the polypeptide in a continuous sequence or in a number of sequences interrupted by intervening sequences. In which ever form it is present, the polynucleotide is an isolated polynucleotide in that it is removed from its naturally-occurring state. This aspect of the invention is based on the cloning of the cDNA for ligand-binding proteins.
In a preferred embodiment, the polynucleotide comprises the nucleotide sequence of any one of SEQ ID Nos. 1, 3, 5 or 7, optionally including one or more mutations or deletions which do not substantially affect the activity of the polypeptide encoded thereby. Such mutations include those arising from the degeneracy of the genetic code, as well as those giving rise to any of the amino acid mutations or deletions discussed above. The polynucleotides of the invention preferably comprise (a) a nucleotide sequence having at least 15 continuous nucleotides of the nucleotide sequence depicted in any one of SEQ ID Nos. 1, 3, 5 or 7 or a degenerated nucleotide sequence thereof; or (b) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (a) under stringent hybridisation conditions.
Typically, selective hybridization will occur when there is at least about 55%
sequence identity -- preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90% -- over a stretch of at least about 14 nucleotides; see, e.g., Kanehisa, Nucleic Acids Res. 12 (1984), 203-213, herein incorporated by reference. Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, solvents, the base composition of the -1~
hybridizing species, length of the complementary regions, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art.
"Stringent hybridization conditions" and "stringent wash conditions" in the context of nucleic acid hybridization experiments depend upon a number of different physical parameters. The most important parameters include temperature of hybridization, base composition of the nucleic acids, salt concentration and length of the nucleic acid. One having ordinary skill in the art knows how to vary these parameters to achieve a particular stringency of hybridization. In general, "stringent hybridization"
is performed at about 25°C below the thermal melting point (T m) for the specific DNA hybrid under a particular set of conditions.
"Stringent washing" is performed at temperatures about 5°C lower than the Tm for the specific DNA hybrid under a particular set of conditions. The Tm is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe; see Sambrook et al., page 9.51, hereby incorporated by reference. The Tm for a particular DNA-DNA hybrid can be estimated by the formula:
Tm = 81.5°C + 16.6 (IoglO[Na+ ]) + 0.41 (fraction G + C) - 0.63 (%
formamide) -(600/1) where I is the length of the hybrid in base pairs.
The Tm 'for a particular RNA-RNA hybrid can be estimated by the formula:
Tm = 79.8°C + 18.5 (IoglO[Na+ ]) + 0.58 (fraction G + C) + 11.8 (fraction G + C)2 -0.35 (% formamide) - (820/1).
The Tm 'for a particular RNA-DNA hybrid can be estimated by the formula:
Tm = 79.8°C + 18.5(IoglO[Na+ ]) + 0.58 (fraction G + C) + 11.8 (fraction G + C)2 -0.50 (% formamide) - (820/1).
In general, the Tm decreases by 1-1.5°C for each 1% of mismatch between two nucleic acid sequences. Thus, one having ordinary skill in the art can alter hybridization and/or washing conditions to obtain sequences that have higher or lower degrees of sequence identity to the target nucleic acid. For instance, to obtain hybridizing nucleic acids that contain up to 10% mismatch from the target nucleic acid sequence, 10-15°C would be subtracted from the calculated Tm of a perfectly matched hybrid, and then the hybridization and washing temperatures adjusted accordingly. Probe sequences may also hybridize specifically to duplex DNA
under certain conditions to form triplex or other higher order DNA complexes. The preparation of such probes and suitable hybridization conditions are well known in the art. An example of stringent hybridization conditions for hybridization of complementary nucleic acid sequences having more than 100 complementary residues on a filter in a Southern or Northern blot or for screening a library is 50%

formamide/6X SSC at 42°C for at least ten hours. Another example of stringent hybridization conditions is 6X SSC at 68°C for at least ten hours. An example of low stringency hybridization conditions for hybridization of complementary nucleic acid sequences having more than 100 complementary residues on a filter in a Southern or northern blot or for screening a library is 6X SSC at 42°C for at least ten hours.
Hybridization conditions to identify nucleic acid sequences that are similar but not identical can be identified by experimentally changing the hybridization temperature from 68°C to 42°C while keeping the salt concentration constant (6X SSC), or keeping the hybridization temperature and salt concentration constant (e.g.
42°C and 6X SSC) and varying the formamide concentration from 50% to 0%. Hybridization buffers may also include blocking agents to lower background. These agents are well-known in the art; see Sambrook et al., pages 8.46 and 9.46-9.58, herein incorporated by reference. Wash conditions also can be altered to change stringency conditions. An example of stringent wash conditions is a 0.2x SSC wash at 65°C for 15 minutes (see Sambrook et al., for SSC buffer). Often the high stringency wash is preceded by a low stringency wash to remove excess probe. An exemplary medium stringency wash for duplex DNA of more than 100 base pairs is 1 x SSC at 45°C for 15 minutes. An exemplary low stringency wash for such a duplex is 4x SSC at 40°C
for 15 minutes. In general, signal-to-noise ratio of 2x or higher than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
By the provision of the nucleotide sequences of SEO ID Nos. 1, 3, 5 and 7 as well as those encoding the amino acid sequences depicted in SEQ ID Nos. 2, 4, 6 and 8 it is possible to isolate identical or similar nucleic acid molecules which encode water-soluble iigand-binding proteins from other species or organisms, in particular orthologous water-soluble ligand-binding protein encoding genes from mammals.
The term "orthologous" as used herein means homologous sequences in different species 'that arose from a common ancestor gene during speciation. Orthologous genes may or may not be responsible for a similar function; see, e.g., the glossary of the "Trends Guide to Bioinformatics", Trends Supplement 1998, Elsevier Science.
In a further aspect, the present invention provides a recombinant polynucleotide comprising a vector incorporating the polynucleotide of the present invention.
Many suitable vectors are known to those skilled in molecular biology, the choice of which would depend on the function desired and include plasmids, cosmids, viruses, bacteriophages and other vectors used conventionally in genetic engineering.
Methods which are well known to those skilled in the art can be used to construct various plasmids and vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y, and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989), (1994). Alternatively, the polynucleotides and vectors of the invention can be reconstituted into liposomes for delivery to target cells. As discussed in further details below, a cloning vector was used to isolate individual sequences of DNA. Relevant sequences can be transferred into expression vectors where expression of a particular polypeptide is required.
Typical cloning vectors include pBscpt sk, pGEM, pUC9, pBR322 and pGBT9.
Typical expression vectors include pTRE, pCAL-n-EK, pESP-1, pOPI3CAT, pET, pGEX, pMALC, pPIC9, pBac.
Hence, in a preferred embodiment of the present invention the above-described polyncucleotides either alone or present in a vector are linked to control sequences which allow the expression of the polynucleotide in prokaryotic and/or eukaryotic cells.
The terra "control sequence" refers to regulatory DNA sequences which are necessary to effect the expression of coding sequences to which they are ligated.
The nature of such control sequences differs depending upon the host organism.
In prokaryotes, control sequences generally include promotor, ribosomal binding site, and terminators. In eukaryotes generally control sequences include promotors, terminators and, in some instances, enhancers, transactivators or transcription factors. The term "control sequence" is intended to include, at a minimum, all components the presence of which are necessary for expression, and may also include additional advantageous components.
The term "operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. A
control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. In case the control sequence is a promotor, it is obvious for a skilled person that double-stranded nucleic acid is preferably used.
Thus, the vector of the invention is preferably an expression vector. An "expression vector" is a construct that can be used to transform a selected host cell and provides for expression of a coding sequence in the selected host. Expression vectors can for instance be cloning vectors, binary vectors or integrating vectors. Expression comprises transcription of the nucleic acid molecule preferably into a translatable mRNA. Regulatory elements ensuring expression in prokaryotic and/or eukaryotic cells are well known to those skilled in the art. In the case of eukaryotic cells they comprise normally promotors ensuring initiation of transcription and optionally poly-A
signals ensuring termination of transcription and stabilization of the transcript.
Possible regulatory elements permitting expression in prokaryotic host cells comprise, e.g., the PL, lac, trp, T7 or tac promotor in E. coli, and examples of regulatory elements permitting expression in eukaryotic host cells are the AOX1 or GAL1 promotor in yeast or the CMV-, SV40-, RSV-promotor (Rous sarcoma virus), CMV-enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells. In this context, suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDMB, pRc/CMV, pcDNAI, pcDNA3 (In-vitrogene), pSPORT1 (GIBCO BRL). An alternative expression system which could be used to express the protein is an insect system. In one such system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. The coding sequence of a nucleic acid molecule of the invention may be cloned into a nonessential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promotor. Successful insertion of said coding sequence will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein coat. The recombinant viruses are then used to infect S.
frugiperda cells or Trichoplusia larvae in which the protein of the invention is expressed (Smith, J. Virol. 46 (1983), 584; Engelhard, Proc. Nat. Acad. Sci.

(1994), 3224-3227).
In plants, promotors commonly used are the polyubiquitin promotor, and the actin promotor for ubiquitous expression. The termination signals usually employed are from the Nopaline Synthase promotor or from the CAMV 35S promotor. A plant translational enhancer often used is the TMV omega sequences, the inclusion of an intron (Intron-1 from the Shrunken gene of maize, for example) has been shown to increase expression levels by up to 100-fold. (Malt, Transgenic Research 6 (1997), 143-156; Ni, Plant Journal 7 (1995), 661-678). Additional regulatory elements may include transcriptional as well as translational enhancers. Advantageously, the above-described vectors of the invention comprises a selectable and/or scorable marker. ;selectable marker genes useful for the selection of transformed cells and, e.g., plant tissue and plants are well known to those skilled in the art and comprise, for example, antimetabolite resistance as the basis of selection for dhfr, which confers resistance to methotrexate (Reiss, Plant Physiol. (Life Sci. Adv.) 13 (1994), 143-149); npt, which confers resistance to the aminoglycosides neomycin, kanamycin and paromycin (Herrera-Estrella, EMBO J. 2 (1983), 987-995) and hygro, which confers resistance to hygromycin (Marsh, Gene 32 (1984), 481-485).
Useful scorable markers are also known to those skilled in the art and are commercially available. Advantageously, said marker is a gene encoding luciferase (Giacomin, PI. Sci. 116 (1996), 59-72; Scikantha, J. Bact. 178 (1996), 121 ), green fluorescent protein (Gerdes, FEBS Lett. 389 (1996), 44-47) or f3-glucuronidase (Jefferson, EMBO J. 6 (1987), 3901-3907). This embodiment is particularly useful for simple and rapid screening of cells, tissues and organisms containing a vector of the invention.
The proteins can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, size exclusion chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") or FPLC is employed for purification.
The present invention furthermore relates to host cells produced by introducing a nucleic acid molecule into the host cell which upon its presence in the cell mediates the expression of a gene encoding water-soluble ligand-binding proteins or comprising a polynucleotide or a vector as described above or a polynucleotide according to the invention wherein the polynucleotides and/or nucleic acid molecule is foreign to the host cell. By "foreign" it is meant that the polynucleotide or nucleic acid molecule is either heterologous with respect to the host cell, this means derived from a cell or organism with a different genomic background, or is homologous with respect to the host cell but located in a different genomic environment than the naturally occurring counterpart of said nucleic acid molecule. This means that, if the nucleic acid molecule is homologous with respect to the host cell, it is not located in its natural location in the genome of said host cell, in particular it is surrounded by different genes. In this case the polynucleotide may be either under the control of its own promotor or under the control of a heterologous promotor. The vector or nucleic acid molecule according to the invention which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained in some form extrachromosomally. In this respect, it is also to be understood that the nucleic acid molecule of the invention can be used to restore or create a mutant gene via homologous recombination.

The host cell can be any prokaryotic or eukaryotic cell, such as bacterial, insect, fungal, plant or animal cells.
The terms "prokaryotic" is meant to include all bacteria which can be transformed or transfected with a DNA or RNA molecules for the expression of a protein of the invention. Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. The term "eukaryotic" is meant to include yeast, higher plant, insect and preferably mammalian cells. Depending upon the host employed in a recombinant production procedure, the protein encoded by the polynucleotide of the present invention may be glycosylated or may be non-glycosylated. The water-soluble ligand-binding protein of the invention may or may not also include an initial methionine amino acid residue. A polynucleotide of the invention can be used to transform or transfect the host using any of the techniques commonly known to those of ordinary skill in the art. Furthermore, methods for preparing fused, operably linked genes and expressing them in, e.g., mammalian cells and bacteria are well-known in the art (Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).
Thus they present invention provides a cell capable of expressing a polypeptide as discussed herein. The cell comprises a recombinant host cell usually incorporating the polynucleotide. Preferably, the host cell incorporates the polynucleotide as the recombinant polynucleotide. Any suitable host cell may be chosen, again depending on the intended purpose. Suitable host cells include XLI-BLUE, B21 (DE3)pLysS, HB101, SOLR and SP-Q01 (Saccharomyces pombe).
Using an appropriate combination of host cell, vector and polynucleotide, an expression system can be provided so as to obtain a polypeptide useful in the present invention. This may comprise a fusion polypeptide encoded by the recombinant polynucleotide, a part of which is encoded by the vector.
Typically, the vector will have a promotor region, which is usually inducible, leading to 5' coding region a ssociated with the promotor. By appropriate manipulation, the polynucleotide encoding the polypeptide can be attached to the 5' coding region in frame. In this way, expression of the nucleotide sequence downstream of the promotor region gives rise to the fusion polypeptide which includes the polypeptide of the present invention.
The present invention also relates to an antigen comprising an epitope of at least 5 continuous amino acids of the amino acid sequence depicted in any one of SEQ
ID
Nos. 2, 4, 6 or 8 and/or said epitope is detectable by a monoclonal or polyclonal antibody which recognises, preferably with a binding affinity of at least 10-'M, a protein of the invention as described above. In the present invention, "epitopes"
refers to fragments of the AChBP of the invention having antigenic or immunogenic activity in an animal. A preferred embodiment of the present invention relates to antigens comprising an epitope, as well as the polynucleotide encoding this fragment. A region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." In contrast, an "immunogenic epitope" is defined as a part of a protein that elicits an antibody response; see, for instance, Geysen, Proc.
Natl. Acad.
Sci. USA 81 (1983); 3998-4002. Fragments which function as epitopes may be produced by any conventional means; see, e.g., Houghten, Proc. Natl. Acad.
Sci.
USA 82 (1985), 5131-5135 further described in U.S. Patent No. 4,631,211. In the present invention, antigenic epitopes preferably contain a sequence of at least five, six, seven, more preferably at least nine, and most preferably between about 15 to about 30 amino acids. Antigenic epitopes are useful to raise antibodies, including monoclonal antibodies, that specifically bind the epitope; see, for instance, Wilson, Cell 37 (1984), 767-778; Sutcliffe, Science 219 (1983), 660-666). Similarly, immunogenic epitopes can be used to induce antibodies according to methods well known in the art; see, for instance, Sutcliffe, supra; Wilson, supra; Chow, Proc. Natl.
Acad. Sci. USA 82 (1985), 910-914; and Bittle, J. Gen. Virol. 66 (1985); 2347-2354.
A preferred immunogenic epitope includes the soluble protein. The immunogenic epitopes may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier. However, immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting.) The present invention also relates to antibodies specifically recognizing the water-soluble ligand-binding protein and ligand-gated ion channels of the present invention, in particular recognizing the above described antigen or epitope. As used herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab) is meant to include intact molecule, as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) which are capable of specifically binding to protein. Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding than an intact antibody;
see, e.g., Wahl, J. Nucl. Med. 24 (1983), 316-325. Thus, these fragments are preferred" as well as the products of a FAB or other immunoglobulin expression library. Moreover, antibodies of the present invention include chimeric, single chain, and humanized antibodies; see also infra. Said antibody can be a monoclonal antibody, a polyclonal antibody, a single chain antibody, human or humanized antibody, primatized, chimerized or fragment thereof that specifically binds said peptide or polypeptide also including bispecific antibody, synthetic antibody, antibody fragment, such as Fab, Fv or scFv fragments etc., or a chemically modified derivative of any of these. The general methodology for producing antibodies is well-known and has been described in, for example, Kohler and Milstein, Nature 256 (1975), 494 and reviewed in J.G.R. Hurrel, ed., "Monoclonal Hybridoma Antibodies: Techniques and Applications", CRC Press Inc., Boco Raron, FL (1982), as well as that taught by L. T.
Mimms et al., Virology 176 (1990), 604-619. Furthermore, antibodies or fragments thereof to the aforementioned peptides can be obtained by using methods which are described, e.g., in Harlow and Lane "Antibodies, A Laboratory Manual", CSH
Press, Cold Spring Harbor, 1988. For the production of antibodies in experimental animals, various hosts including goats, rabbits, rats, mice, and others, may be immunized by injection with polypeptides of the present invention or any fragment or oligopeptide or derivative thereof which has immunogenic properties. Techniques for producing and processing polyclonal antibodies are known in the art and are described in, among others, Mayer and Walker, eds., "Immunochemical Methods in Cell and Molecular Biology", Academic Press, London (1987). Polyclonal antibodies also may be obtained from an animal, preferably a mammal, previously infected with the virus of the invention. Methods for purifying antibodies are known in the art and comprise, for example, immunoaffinity chromatography. Depending on the host species, various adjuvants or immunological carriers may be used to increase immunological responses. Such adjuvants include, but are not limited to, Freund's, complete or incomplei:e adjuvants, mineral gels such as aluminium hydroxide, and surface active substancEa such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions and dinitrophenol. An example of a carrier, to which, for instance, a peptide of the invention may be coupled, is keyhole limpet hemocyanin (KLH). When derivatives of said antibodies are obtained by the phage display technique, surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies which bind to an epitope of the peptide or polypeptide of the invention (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J.
Immunol. Methods 183 (1995), 7-13). In many cases, the binding phenomena of antibodies to antigens is equivalent to other ligand/anti-ligand binding.

-2$
In another embodiment the present invention relates to an oligonucleotide probe comprising a nucleotide sequence having at least 15 continuous nucleotides of a polynucleotide of the invention and/or encoding the above described antigen.
Such oligonucleotides will usually specifically hybridize to a polynucleotide encoding a water-soluble ligand-binding protein of the invention. Specific hybridization occurs preferably under stringent conditions and implies no or very little cross-hybridization with nucleotide sequences encoding no or substantially different proteins.
Such nucleic acid molecules may be used as probes and/or for the control of gene expression. Nucleic acid probe technology is well known to those skilled in the art who will readily appreciate that such probes may vary in length. Preferred are nucleic acid probes of 17 to 35 nucleotides in length. Of course, it may also be appropriate to use nucleic acids of up to 100 and more nucleotides in length. The nucleic acid probes of the invention are useful for various applications. On the one hand, they may be used as PCR primers for amplification of polynucleotides according to the invention. Another application is the use as a hybridization probe to identify polynucleotides hybridizing to the polynucleotides of the invention by homology screenincf of genomic DNA libraries. Nucleic acid molecules according to this preferred embodiment of the invention which are complementary to a polynucleotide as described above may also be used for repression of expression of a gene comprising such a polynucleotide, for example due to an antisense or triple helix effect or for the construction of appropriate ribozymes (see, e.g., EP-B1 0 291 533, EP-A1 0 321 201, EP-A2 0 360 257) which specifically cleave the (pre)-mRNA of a gene cornprising a polynucleotide of the invention. Selection of appropriate target sites and corresponding ribozymes can be done as described for example in Steinecke, Ribozymes, Methods in Cell Biology 50, Galbraith et al. eds Academic Press, Inc. (1995), 449-460. Standard methods relating to antisense technology have also been described (Melani, Cancer Res. 51 (1991 ), 2897-2901 ). Said nucleic acid molecules may be chemically synthesized or transcribed by an appropriate vector containing a chimeric gene which allows for the transcription of said nucleic acid molecule in the cell. Such nucleic acid molecules may further contain ribozyme sequences as described above.
In this respect, it is also to be understood that the polynucleotide of the invention can be used for "gene targeting" and/or "gene replacement", for restoring a mutant gene or for creating a mutant gene via homologous recombination; see for example Mouellic, Proc. Natl. Acad. Sci. USA, 87 (1990), 4712-4716; Joyner, Gene Targeting, A Practical Approach, Oxford University Press.

Furthermore, the person skilled in the art is well aware that it is also possible to label such a nucleic acid probe with an appropriate marker for specific applications, such as for the detection of the presence of a polynucleotide of the invention in a sample derived from an organism, in particular mammals, preferably human. A number of companies such as Pharmacia Biotech (Piscataway NJ), Promega (Madison WI), and US Biochemical Corp (Cleveland OH) supply commercial kits and protocols for these procedures. Suitable reporter molecules or labels include those radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents teaching the use of such labels include US Patents US-A-3,817,837; US-A-3,850,752; US-A-3,939,35(); US-A-3,996,345; US-A-4,227,437; US-A-4,275,149 and US-A-4,366,241.
Also, recombinant immunoglobulins may be produced as shown in US-A-4,816,567 incorporated herein by reference.
Furthermore, the so-called "peptide nucleic acid" (PNA) technique can be used for the detection or inhibition of the expression of a polynucleotide of the invention. For example, the binding of PNAs to complementary as well as various single stranded RNA and DNA nucleic acid molecules can be systematically investigated using thermal denaturation and BIAcore surface-interaction techniques (Jensen, Biochemistry 36 (1997), 5072-5077).
The present invention also relates to a method for the production of a transgenic non-human animal, preferably transgenic mouse, comprising introduction of a polynucleotide or vector of the invention into a germ cell, an embryonic cell, stem cell or an egg or a cell derived therefrom. The non-human animal can be used in accordance with a screening method of the invention described herein.
Production of transgenic embryos and screening of those can be performed, e.g., as described by A. L. Joyner Ed., Gene Targeting, A Practical Approach (1993), Oxford University Press. The DNA of the embryonal membranes of embryos can be analyzed using, e.g., Southern blots with an appropriate probe; see supra. The invention also relates to transgenic non-human animals such as transgenic mouse, rats, hamsters, dogs, monkeys, rabbits, pigs, C. elegans and fish such as Torpedo fish comprising a polynucleotide or vector of the invention or obtained by the method described above, preferably wherein said polynucleotide or vector is stably integrated into the genome of said non-human animal, preferably such that the presence of said polynucleotide or vector leads to the expression of the water-soluble protein of the present invention.

The present invention further relates to composition comprising any one of the above described water-soluble ligand-binding proteins, multimers such as dimers or pentamers thereof, ligand-gated ion channels, polynucleotides, vectors, host cells, antigens, antibodies, or oligonucleotide probes of the invention; and optionally suitable means for detection or performing a ligand-receptor binding assay. In this context, the present invention also relates to a method for identifying an agonist/activator or antagonist/inhibitor of a ligand-gated receptor comprising the steps of:
(a) contacting the water-soluble ligand-binding protein of the present invention, multimers such as dimers or pentamers thereof, or the ligand-gated ion channel of the invention or a cell expressing said protein in the presence of components capable of providing a detectable signal in response to ligand binding with a compound to be screened under conditions that permit binding of said compound to the ligand-binding protein; and (b) detecting the presence or absence of a signal generated from the binding activity of the ligand-binding protein, wherein the presence/increase and absence/decrease of the signal is indicative for an agonist/activator and antagonist/inhibitor, respectively, of a ligand-gated receptor.
Since ligand-gated receptors are modulated allosterically by natural polyamines, such as spermine, and by polyamine derivatives, such as polyamine amides (e.g.
philanthotoxin-343) and polymethylene tetraamines (e.g. methoctramine) (Usherwood, Farmaco. 55 (2000), 202-205) compounds comprising or based on such entities may be used as starting material for screening. An antagonist or agonist that "modulates the activity" of a polypeptide and causes an altered signal, for example response in the cell refers to a compound that alters the activity of the protein so that it behaves differently in the presence of the compound than in the absence of the compound. Typically, the effect of an antagonist is observed as a blocking of agonist-induced receptor activation. Antagonists include competitive as well as non-competitive antagonists. A competitive antagonist (or competitive blocker) interacts with or near the site specific for agonist binding. A non-competitive antagonist or blocker inactivates the function of the receptor by interacting with a site other than the agonist interaction site. As understood by those of skill in the art, bioassay methods for identifying compounds that modulate the activity of receptors such as proteins of the invention generally require comparison to a control.
One type of "control" is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control"
cell or culture is not exposed to the compound. For example, in methods that use voltage clamp electrophysiological procedures, the same cell can be tested in the presence or absence of compound, by merely changing the external solution bathing the cell.
Accordingly, the response of the transfected cell to the "control" cell or culture to the same compound under the same reaction conditions. However, "control data" can also be used from the literature.
As described in Example 6 the 3-dimensional structure of AChBP could be solved by X-ray crystallography at 2.7A resolution (current Rfactor = 27.9 %, Rfree =
30.0 %).
In crystals, as in solution, AChBP forms a stable homo-pentamer with dimensions comparable to those of the ligand-binding domain of ligand-gated ion channels, in particular comparable to the nAChR, as determined in EM studies by Unwin and coworkers; see supra. The structural analysis revealed that in the AChBP
homopentamer the monomers have immunoglobulin-like topology. At each of five subunit interfaces a ligand-binding site is located, with all residues consistent with biochemical data. In this site a buffer molecule (HERPES) stacks with cation-n interactions on a tryptophan, resembling acetylcholine binding. The AChBP
structure is relevant for the development of drugs against, e.g., Alzheimer's disease and nicotine addiction. The high-resolution crystal structure of AChBP, along with biochemical and pharmacological data, supports the teaching of the present invention that the water-soluble ligand-binding proteins of the invention such as AChBP are good mimics of ligand-binding domains of ligand-gated ion channels.
Thus, the present invention relates to a crystal of a water-soluble ligand-binding protein of the invention, preferably in a multimeric form such as dimer, pentamer or decamer. In one embodiment said crystal comprises a protein-ligand complex.
Methods how to employ and analyze such crystals are known to the person skilled in the art; see for example US-A-5,872,011 which describes the crystal structure of a protein-ligand complex containing an N-terminal truncated eIF4E and uses thereof.
The crystal structure of the ligand-gated receptor ligand-binding region in a complex with a ligand, preferably being an antagonist or agonist will reveal the determinants of receptor-antagonist/agonist interactions and how ligand-binding specificity and affinity are altered by remote residues and the redox state of the conserved disulphide bond. The structure may also indicate mechanisms for allosteric effector action and for ligand-induced channel gating. How the information on the crystal structure of a ligand-binding region in a complex with a ligand can be used for the development of agonists and antagonists has been described for the structure of a glutamate-receptor ligand-binding core in complex with kainate (Armstrong et al., Nature 395 (1998), 913-917).
The crystal of the invention, in particular when comprising nAChR related proteins can be a complex of the protein with a ligand comprising an N-alkylated hydroxyalkyl and/or a quaternary ammonium ion. However, other ligands my be used as well.
PreferrE~d ligands comprise 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), B-bippinatin, lophotoxin, d-tubocurarine, nicotine, acetylcholine, conotoxin, carbamylcholine, galanthamine, epibatidine or alpha-bungarotoxin or derivatives thereof.
Different aspects of X-ray crystallography are such as data collection, structure solution, determining the molecular structure from X-ray diffraction, refinement, etc.
are described in the prior art, see, e.g., Powell, Annu. Rep. Prog. Chem., Sect. C:
Phys. Chem. 96 (2000), 139-175 and Methods in Enzyrnology, 276-277, edited by Carter .and Sweet, Academic Press, 1997. Current methods and optimization algorithms for the refinement of X-ray crystal structures are described by Van Der Maelen Uria, Crystallogr. Rev. 7 (1999), 125-180.
The crystal of the invention effectively diffracts X-rays for the determination of the atomic coordinates of the protein or protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms. In a preferred embodiment the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 3.0 Angstroms. In a more preferred embodiment the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 2.0 Angstroms. In one embodiment the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of about 2.7 Angstroms.
Preferably, the crystal of the invention is formed by a protein that has an amino acid sequence of amino acids 20 to 223 of SEQ ID No. 2, or an amino acid sequence that differs from amino acid 20 to 223 of SEQ ID No. 2 by only having conservative substitutions. As is described in the examples, the crystals of the AChBP
comprise decameric forms of the protein. In order to ease the use of the AChBP protein for analysis and crystallography it is envisaged to create a mutation in residue Asp2 and Asp5 of the mature AChBP SEQ ID No. 2 or 4 to remove the calcium binding site, and prevent creation of a decamer. This deletion can be done for example by oligonuc;leotide-directed mutagenesis. Alternatively crystals could be grown in a low calcium concentration or in the absence of calcium.
The crystal of the present invention preferably has (1 ) a space group of P2,2,21 and a unit cell of dimensions of a=120.6A, b=137.OA and c=161.SA; (2) a space group of P422,2 and a unit cell of dimensions of a=b=141.6 and c=120.8 or (3) a space group of P2, and a unit cell of dimensions of a=121.1 A, b=162.1 A, c=139.4A, f3=90.1 °.
The crystal of the present invention is preferably from a protein that has secondary structural elements that include .alpha.-helix and antiparallel .beta.-sheets as shown in and described for Figures 7, 10, 11 and/or 12. Most preferably, the crystal of the invention has a three-dimensional structure as defined by atomic coordinates shown in Table 1. Those of skill in the art understand that a set of structure coordinates determined by X-ray crystallography is not without standard error. For the purpose of this invention, any set of structure coordinates for AChBP or AChBP mutants that have a root mean square deviation of protein backbone atoms (N, C.alpha., C
and O) of less than 0.75 Angstrom when superimposed - using backbone atoms - on the structure coordinates listed in Table 1 shall be considered identical.
In a most preferred embodiment of the present invention, the crystal has a binding cavity as shown in Figures 6, 8, 9 and/or 13.
In accordance with the findings of the present irivention, it is proposed to use the water-soluble ligand-binding proteins of molluscs as the blueprint for the receptor binding site of the ligand-gated ion channel superfamily including nACh, 5-HT3, glycine, (aABAA, and GABA~, most preferably for the nAChR. The availability of X-ray structures, and the cloned sequences provide a unique opportunity to understand these receptors at the molecular level, possibly unravel the dynamic changes occurring upon ligand binding, and predict their tertiary and quaternary structure with a higher degree of confidence than possible for other protein modules. This should pave the way for designing ligands selective for any of the multiple subtypes in any of these receptor families. The AChBP-like structures can be used for computerized docking to homology models which leads to the a priori discovery of novel ligands before lak>oratory experiments begin to optimize the drug candidates.
Thus, the present invention also relates to a method of using the crystal of the invention in a drug screening assays, such as comprising:
(a) selecting a potential ligand by performing structure assisted drug design with the three-dimensional structure determined for the crystal, -~1 wherein said selecting is performed in conjunction with computer modeling; optionally (b) contacting the potential ligand with the ligand binding domain of the ligand-gated receptor in an in vitro or in vivo assay; and (c) detecting the binding of the potential ligand for the ligand binding domain.
The use of macromolecular crystallography as a tool for investigating drug and receptor interactions, in particular structure-based drug design is reviewed in Oakley and Wilce, Clin. Exp. Pharmacol. Physiol. 27 (2000), 145-151. The desired drug could be an inhibitor or an agonist that mimics endogenous transmitters or ligands.
Once the 3-D structure of the relevant target is known, computational processes can be used to search databases of compounds to identify ones that may interact strongly with the target. Lead compounds can be improved using the 3-D
structure of the complex of the lead compound and its biological target. The activity of the selected compound can then be tested in a functional assay such as one of those described herein.
Preferably, the potential drug is selected on the basis of its having a greater affinity for the ligand binding domain of the ligand-gated receptor than that of a standard ligand for the ligand binding domain of the ligand-gated receptor. However, the affinity of the selected compound may also be less than that of a standard ligand.
Such compounds are useful for example as a lead for the development of further analogues which in turn may have enhanced binding affinity or otherwise beneficial therapeutic properties. On the other hand, the selected compound may bind to a site of the liqand-gated receptor other than known ligands. In a preferred embodiment, the ligand-gated receptor is a nicotinic acetylcholine receptor.
In a further embodiment, the method of the present invention further comprises:
(d) forming a supplemental crystal of a protein-ligand complex by co crystallization or soaking the crystal of the water-soluble ligand-binding protein with a potential drug, wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms, more preferably greater than 3;
(e) determining the three-dimensional structure of the supplemental crystal;

(f) selecting a candidate drug by performing a structure assisted drug design with the three-dimensional structure determined for the supplemental crystal, wherein said selecting is performed in conjunction with computer modeling; optionally (g) contacting the candidate drug with a cell that expresses the ligand-gated receptor; and (h) detecting a cell response; wherein a candidate drug is identified as a drug when the cell response is altered compared to a cell that has not been contacted with the candidate compound.
The above described methods can further comprise an initial step that precedes step {a) wherein said initial step consists of determining the three-dimensional structure of a crystal comprising a protein-ligand complex formed between the water-soluble ligand-binding protein, and the ligand of the ligand-gated receptor, wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protf~in-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms. Preferably, the resolution of crystal diffraction in the above described methods is at least 3.0, most preferably at least about 2.7 Angstroms.
In a still further embodiment, the present invention relates to a method of growing a crystal of a protein-ligand complex comprising:
(a) contacting the water-soluble ligand-binding protein described above with a ligand of a ligand-gated receptor, wherein the water-soluble ligand-binding protein forms a protein-ligand complex with the ligand; and (b) growing the crystal of the protein-ligand complex; wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms, more preferably at least 3.0, most preferably at least about 2.7 Angstroms.
The crystals of the present invention can also be used in X-ray crystallography-driven screening technique that combines the steps of lead identification, structural assessment, and optimization such as described for example in Nienaber et al., Nature Biotechnol. 18 (2000), 1105 - 1108. This crystallographic screening method (named ~rystaLEAD) has been used to sample large compound libraries and detecting ligands by monitoring changes in the electron density map of the crystal relative to the unbound form. The electron density map yields a high-resolution picture of the ligand-protein complex that provides key information to a structure-directed drug discovery process. The bound ligand is directly visualized in the electron density map. Ligands that bind away from the targeted site may be eliminated.
The above described methods can be coupled with state-of-the-art laboratory data collection facilities including CCD detectors and data acquisition robotics.
Further embodiments that may be used in accordance with the ligand-binding proteins and receptor of the present invention are described in the prior art, for example ligand screening and design by X-ray crystallography is disclosed in W099/45379 and W099/45389; WO00/14105 describes assaying a candidate compound for its ability to interact with a modified receptor tyrosine kinase including obtaining and applying crystallography coordinates to a computer algorithm for generating a model which is applied in an iterative process to various molecular structures in order to identify agonist and antagonists of the receptor. All these methods may be equally applied to the proteins and crystals of the present invention.
In one preferred embodiment, the present invention relates to a drug screening assay comprising soaking a crystal of the invention in a solution of compounds to be screened and detecting the binding of the compound to the ligand-binding protein. A
possible procedure is also described in Example 9. Besides the detection methods of ligand-binding mentioned above, in the cited documents and in the examples, the detection can also be based on measuring the release of the ligand in the preformed crystal of a protein-ligand complex. As described herein before, said ligand preferably comprises an alkylated nitrogen and/or quaternary ammonium ion or may be one of those described above.
The structural information on the crystals of the present invention can also be used for increasing or decreasing the affinity of a drug to a ligand-gated receptor. Such a method can comprise performing structure assisted drug design with the three-dimensional structure determined for the crystal, wherein said drug design is performed in conjunction with computer modeling; and modifying said drug to alter or eliminate a portion thereof suspected of interacting with a binding site of the binding cavity or with a non-specific binding site of the protein in the crystal. This method can, of course, be combined with one or more steps of any of the above described screening methods or other screening methods well known in the art. Methods for clinical compound discovery comprises for example ultrahigh-throughput screening (Sundberg, Curr. Opin. Biotechnol. 11 (2000), 47-53) for lead identification, and structure-based drug design (Verlinde and Hol, Structure 2 (1994), 577-587) and combinatorial chemistry (Salemme et al., Structure 15 (1997), 319-324) for lead optimization. Further information that could be taken into account for drug selection and design so far available for the localization of agonist and competitive antagonist binding sites on nicotinic acetylcholine receptors have recently been reviewed (Arias, Neurochem. Int. 36 (2000), 595-6450; Corringer et al., 1999). Once a drug has been selected, the method can have the additional step of repeating the method used to perform rational drug design using the modified drug and to assess whether said modified drug displays better affinity according to for example interaction/energy analysis.
A related method of the present invention for drug design comprises the step of using the structural coordinates of the water-soluble ligand-binding protein crystal comprising the coordinates of Table 1, to computationally evaluate a chemical entity for associating with the ligand-binding site or a non-specific binding site of a ligand-binding protein. This approach, made possible and enabled by this invention, is to screen computationally small molecule data bases for chemical entities or compounds that can bind in whole, or in part, to the AChBP. In this screening, the quality of fit of such entities or compounds to the binding site may be judged either by shape complementarity or by estimated interaction energy. Meng, et al., J.
Coma.
Chem. 13 (1992), 505-524. In addition, in accordance with this invention, AChBP
mutants or chimerics may be crystallized in co-complex with known ligand-gated ion channel inhibitors. The crystal structures of a series of such complexes may then be solved by molecular replacement (for review see for example Brunger er al.
Prog.
Biophys. Mol. Biol. 72 (1999), 135-155; and references cited therein) and compared with that of wild-type AChBP. Potential sites for modification within the various binding sites of the ligand-binding domain may thus be identified. This information provides an additional tool for determining the most efficient binding interactions, for example, increased hydrophobic interactions, between AChPB and a chemical entity or compound.
The design of compounds that bind to or inhibit ligand-gated ion channels according to this invention generally involves consideration of two factors.
First, the compound must be capable of physically and structurally associating with the ligand-binding domain. Non-covalent molecular interactions important in the association of the ligand-binding domain with its ligand include hydrogen bonding, van der Waals and hydrophobic interactions.
Second, the compound must be able to assume a conformation that allows it to associate with the ligand-binding domain. Although certain portions of the compound -~J' will not directly participate in this association, those portions may still influence the overall conformation of the molecule. This, in turn, may have a significant impact on potency. Such conformational requirements include the overall three-dimensional structure and orientation of the chemical entity or compound in relation to all or a portion of the binding site or the spacing between functional groups of a compound comprising several chemical entities that directly interact with the AChBP.
If the theoretical structure of the given compound suggests insufficient interaction and association between it and AChBP, synthesis and testing of the compound is obviated. However, if computer modelling indicates a strong interaction, the molecule may then be synthesized and tested for its ability to bind to AChPB or a ligand-gated ion charnel and functionally tested according to the methods mentioned above.
In this manner, synthesis of inoperative compounds may be avoided. Once suitable chemical entities or fragments have been selected, they can be assembled into a single compound or inhibitor. Assembly may be proceed by visual inspection of the relationship of the fragments to each other on the three-dimensional image displayed on a computer screen in relation to the structure coordinates of AChBP. This would be followed by manual model building using software such as Quanta or Sybyl.
Useful programs to aid one of skill in the art in connecting the individual chemical entities or fragments include CAVEAT (Bartlett, et al, "CAVEAT: A Program to Facilitate the Structure-Derived Design of Biologically Active Molecules". In Molecular Recognition in Chemical and Biological Problems", Special Pub., Royal Chem.
Soc.
78 (1989), 182-196); 3D Database systems such as MACCS-3D (Martin, J. Med.
Chem. 35 (1992), 2145-2154) and HOOK (Molecular Simulations, Burlington, Mass.).
Instead of proceeding to build an AChBP ligand in a step-wise fashion one fragment or chemical entity at a time as described above, AChBP binding compounds may be designed as a whole or "de novo" using either an empty active site or optionally including some portions) of a known ligand(s). These methods include LUDI
(Bohm, J. ComFi. Aid. Molec. Design 6 (1992), 61-78); LEGEND (Nishibata and Itai, Tetrahedron 47 (1991 ), 8985); and LeapFrog (Tripos Associates, St. Louis, Mo.).
Other molecular modelling techniques may also be employed in accordance with this invention.; see, e.g., Cohen, J. Med. Chem. 33 (1990), 883-894 and Navia and Murcko, Current Opinions in Structural Biology 2 (1992), 202-210.
Such computer modeling is preferably performed with a Docking program (Dunbrack et al., Protein Sci. 6 (1997), 1661-1681 and Folding Des. 2 (1997), R27-R42).
Methods for the identification of drugs or corresponding lead compounds in computational prescreen using X-ray crystal structures are described in the prior art (Verlinde and Hol, Structure 2 (1994), 577-587; Kuntz, Science 257 (1992), 1082; Shuker et al., Science 274 (1996), 1531-1534; Fejzo et al., Chem. Biol.

(1999), 755-769; WO 98/58961 ). The structural information can be consulted to efficiently optimize leads. Computational programs have been written to identify compounds ranging from very small molecules or functional groups (GRID:
Goodford, J. Med. Chem. 28 (1985), 849-857; MCSS: Caflish et al., J. Med.
Chem.
36 (1993), 2142-2167) to potential lead scaffolds (DOCK: Kuntz et al., Accounts Chem. Res. 27 (1994), 117-123) using solved X-ray crystal structures. Another method computationally prescreens compound libraries and experimentally tests the individual "hits" by X-ray crystallography (Verlinde et al., J. Comput. Aided Mol. Des.
6 (1992), 131-147) in order to decrease the size of the screening library. In addition, an experimental approach has been developed to find organic solvents that bind to active sites that may be recombined into a lead macromolecule (Allen et al., J. Phys.
Chem. 100 (1996), 2605-2611 ).
Once a compound has been designed or selected by the above methods, the efficiency with which that compound may bind to the AChBP or a corresponding ligand-binding domain may be tested and optimized by computational evaluation.
For example, a compound that has been designed or selected to function as an inhibitor must preferably demonstrate a relatively small difference in energy between its bound and free states (i.e., a small deformation energy of binding). Thus, the most efficient inhibitors should preferably be designed with a deformation energy of binding of not greater than about 10 kcal/mole, preferably, not greater than 7 kcal/mole. Inhibitors may interact with the ligand-binding domain in more than one conformation that is similar in overall binding energy. In those cases, the deformation energy of binding is taken to be the difference between the energy of the free compound and the average energy of the conformations observed when the inhibitor binds to the AChBP.
A compound designed or selected as binding to AChBP may be further computationally optimized so that in its bound state it would preferably lack repulsive electrostatic interaction with the target ligand-binding domain. Such non-complementary (e.g., electrostatic) interactions include repulsive charge-charge, dipole-dipole and charge-dipole interactions. Specifically, the sum of all electrostatic interactions between the ligand and the AChBP when the ligand is bound to AChBP, preferably make a neutral or favorable contribution to the enthalpy of binding.
Specific computer software is available in the art to evaluate compound deformation energy and electrostatic interaction. Examples of programs designed for such uses include Gaussian 92, revision C (Frisch, Gaussian, Inc., Pittsburgh, Pa.);
AMBER, version 4.0 (Kollman, University of California at San Francisco);
QUANTA/CHARMM
(Molecular Simulations, Inc., Burlington, Mass.); and Insight II/Discover (Biosysm Technologies Inc., San Diego, Calif.). These programs may be implemented, for instance, using a Silicon Graphics workstation, IRIS 4D/35, IBM RISC/6000 workstation model 550 or better a Unix workstation (SGI, Alpha, Sun, etc.) or any Linux PC. Other hardware systems and software packages will be known to those skilled in the art.
Once an AChBP-binding compound has been optimally selected or designed, as described above, substitutions may then be made in some of its atoms or side groups in order to improve or modify its binding properties. Generally, initial substitutions are conservative, i.e., the replacement group will have approximately the same size, shape, hydrophobicity and charge as the original group. It should, of course, be understood that components known in the art to alter conformation should be avoided. Such substituted chemical compounds may then be analyzed for efficiency of fit to AChBP by the same computer methods described in detail, above.
As mentioned before, the above described methods of the present invention can also be used as an initial drug screening assay followed by a classical drug screening assay using the biochemical assays known in the art.
Methods for the preparation of compounds, chemical derivatives and analogues are well known to those skilled in the art and are described in, for example, Beilstein, Handbook of Organic Chemistry, Springer edition New York Inc., 175 Fifth Avenue, New York, N.Y.
In one embodiment of the method of the present invention the identified drug prevents or promotes correct assembly of a ligand-gated ion channel. Thus, the selected drug may far example either interfere with the contact regions of the monomers of the ligand-gated ion channel or may act as a scaffold for the assembly.
In the latter case, the drug may be based for example on an antibody which binds to the contact regions of two or more monomers when assembled and thus facilitates the assembly process. Preferred contact regions with respect to the AChBP and the related nicotinic acetylcholine receptor are given below. In a still further embodiment of the above described methods, the drug can be selected such as to bind to a non-specific binding site of a ligand-gated ion channel. The non-specific binding site can for example include those contact regions that are highly conserved between the monomers of the ligand-gated ion channels.

Once a drug has been selected in accordance with any one of the above described methods of the present invention, the drug or a pro-drug thereof can be synthesized in a therapeutically effective amount. As used herein, the term "therapeutically effective amount" means the total amount of the drug or pro-drug that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of a condition related to an ligand-gated ion channel, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. In addition or alternatively, in particular with respect to pre-clinical testing of the drug the term "therapeutically effective amount" includes the total amount of the drug or pro-drug that is sufficient to elicit a physiological response upon its binding to its target ligand-gated ion channel in an non-human animal test.
The present invention also relates to a drug produced by any one of the above described methods of the present invention, or a pro-drug thereof. Preferably, the drug or pro-drug thereof is present either alone or in a composition in a therapeutically effective amount.
The drug obtained by a method of the present invention may be characterized by its interaction with the binding sites in the binding cavity defined by the coordinates of crystal structure of the protein-ligand complex; for examples of such characterization see, e.g., US-A-5,798,247. Preferably, the drug, for example a potential inhibitor will form non-covalent bonds with one or more amino acids in the active site based upon the crystal structure. On the other hand, the drug may bind to a contact region of the individual monomers of the pentameric ligand-gated receptor. For example, multimer contact regions in Lymnaea stagnalis AChBP (SEQ ID No. 2) have been identified.
Consecutive regions have at least every second residue involved in contacts with the other monomer. Contacts have been defined as 2 atoms within 4.2 angstrom distance in 2.7 Angstrom structure. The primary contact regions in mature AChBP
(residues from A contacting B) are 15-21, 44-47, 85-87, 91-94, 122-124,143-146, 149, 185-187 and the complementary contact regions (from B contacting A, (identical to residues on A contacting E) are 3-4, 7-8, 11, 37-39, 53, 75-77, 96-104, 114-118, 163-170; see also Figure 14.
Thus, in one preferred embodiment the drug of the present invention interacts with a ligand-gated receptor comprising a pentamer with monomers A to E, wherein the drug binds to one or more primary contact regions of a monomer (residues from A
contacting B) defined by amino acid residues 15 to 21, 44 to 47, 85 to 87, 91 to 94, 122 to 124, 143 to 146, 149, 185 to 187 of SEQ ID No. 2 and/or to one or more of the complementary contact regions of the other monomer (from B contacting A, (identical to residues on A contacting E) defined by amino acid residues 3 to 4, 7 to 8, 11, 37 to 39, 53, 75 to 77, 96 to 104, 114 to 118 and 163-170 of SEO ID No. 2; or to one of the contact regions identified in Figure 14; or to the corresponding contact regions of the monomers of a ligand-gated ion channel. Preferably, the ligand-gated ion channel is the nicotinic acetylcholine receptor and the order of the monomers is aya8(3.
Any available method may be used to construct such model from the crystallographic and/or amino acid sequence data disclosed herein or obtained from independent analysis of crystalline AChBP proteins or other water-soluble ligand-binding proteins of the present invention. Such a model can be constructed from available analytical data points using known software packages such as HKL, MOSFILM, XDS, CCP4, SHARP, PHASES, HEAVY, XPLOR, TNT, NMRCOMPASS, NMRPIPE, DIANA, NMRDRAW, FELIX, VNMR, MADIGRAS, QUANTA, BUSTER, SOLVE, O, FRODO, RASMOL_, CNS , REFMAC, ARP/WARP, XTALVIEW and CHAIN. The model constructed from these data can then be visualized using available systems, including, for example, Silicon Graphics, Evans and Sutherland, SUN, Hewlett Packard, Apple Macintosh, DEC, IBM, and Compaq. The present invention also provides for devices such as a computer system which comprises the model of the invention and hardware used for construction, processing and/or visualization of the model of the invention. Further embodiments provide a computer system comprising computer' hardware and the model of the present invention. The study of the interaction of the candidate species with the model can be performed using available software platforms, including QUANTA, RASMOL, O, CHAIN, FRODO, INSIGHT, DOCK, MCSS/HOOK, CHARMM, LEAPFROG, CAVEAT (UC Berkley), CAVEAT
(MSI), MODELLER, CATALYST, XTALVIEW and ISIS. Computer readable media such as floppy discs, CD ROMs, tapes, and any other storage or processing means comprising crystallographic and/or nucleotide/amino acid sequence data disclosed herein or obtained from independent analysis of crystalline AChBP proteins or other water-soluble ligand-binding proteins of the present invention are subject of the present invention as well. Any one of the mentioned means and devices can advantageously be used for modeling an antagonist/inhibitor or agonist/activator of a ligand-gated receptor.
Furthermore, the present invention relates to the construction of theoretical three dimensional (3D) models of ligand-binding domains of ligand-gated ion channels by computer-assisted molecular modeling using the X-ray coordinates of the water soluble ligand-binding proteins of the invention. These 3D models can correspond either to the entire ligand-binding domain 0220 to 240 extracellular amino acids) or may be limited to the ligand-binding site.
The concept of using 3D structures of the mollusc ligand-binding proteins for molecular modeling and tool for structure prediction of for example mammalian, in particular human ligand-gated ion channels gains support from the observation that the ligand-binding domain of vertebrate glutamate receptor channels and bacterial periplasmic substrate-binding proteins (PBPs) share similar 3D structures despite the very low sequence similarity between ionotropic glutamate receptor subunits and the PBPs th<~t were used as templates (12%); for review see Paas et al. TIPS 21 (2000), 87- 92 and refernces cited therein Thus, on the basis of a computer-assisted molecular modeling, optionally supplemented by for example functional studies of site-specific mutants, the crystal structure of the ligand-binding domain of ligand-gated ion channels and theoretical 3D models of these domains can be predicted. In turn, these models can be used for structure assisted drug design. The predicted models may be further refined, for example by monitoring the effects of mutations of amino acid residues that are probably located in the ligand-binding site on (1 ) agonist-elicited channel activation and desensitization, (2) inhibition of channel activity by various competitive receptor antagonists; or (3) the binding of various ligands. Experimental setups for analyzing such effects are known to the person skilled in the art, see also the documents cited for functional assay systems of ligand-gated ion channels.
Thus, the embodiments of the present invention enable various possibilities for identification and modeling new ligands of ligand-gated ion channels as well as modifying the ion channels themselves. Accordingly, the present invention relates to the use of the above described polynucleotides, proteins, dimers and pentamers, ligand-gated ion channels, vectors, host cells, antigens, antibodies, oligonucleotide probes, crystals, their structural coordinates and methods for screening or profiling putative ligands of ligand-gated receptors.
Methods for the lead generation in drug discovery using proteins and detection methods such as mass spectrometry (Cheng et al. J. Am. Chem. Soc. 117 (1995), 8859-88Ei0) and some nuclear magnetic resonance (NMR) methods (Fejzo et al., Chem. Biol. 6 (1999), 755-769; Lin et al., J. Org. Chem. 62 (1997), 8930-8931 ).
The newly identified drug obtained by a method of the present invention, i.e.
an antagonist/inhibitor or agonist/activator can be used for the preparation of a pharmaceutical composition for the treatment of a ligand-gated ion channel mediated or related disorder. Such disorders are well know to the person skilled in the art. For example, possible applications of agonist and antagonists to nAChRs are based on their participation in complex functions such as attention, memory, and cognition, and their involvement in the pathogenesis of certain neuropsychiatric disorders (Alzheimer's and Parkinson's diseases, Tourette's syndrome, schizophrenia, depression, etc). For the majority of these disorders, the use of nAChRs' agonists may represent either a prophylactic (esp. for Alzheimer's and Parkinson's diseases) or a syrnptomatic treatment; for review see for example Mihailescu and Drucker-Colin, Arch. Med. Res. 31 (2000), 131-144.
The medicinal chemistry and molecular biology of GABA-activated ligand-gated ion channels also in terms of agonist and antagonist structural profiles is described in Chebib et al., J. Med. Chem. 43 (2000), 1427-1447.
Glycine receptors and disorders of glycinergic neurotransmission are extensively reviewed in Rajendra et al., Pharmacol. Ther. 73 (1997), 121-146 and Barry et al., Clin. Exp~. Pharmacol. Physiol. 26 (1999), 935-936.
The central role of 5-HT3 receptor in CNS disorders and 5-HT3 receptor antagonists are described in Bloom and Morales, Neurochemical Research 23 (1998), 653-659 and Higgins and Kilpatrick, Expert Opin. Invest. Drugs 8 (1999), 2183-2188.
In one Embodiment, the antagonist/inhibitor is or is derived from a protein, an antigen, antibody or from a toxin of the ligand-gated ion channel. Likewise, the agonist/activator can be derived from a protein, an antigen, antibody or from a toxin of the ligand-gated ion channel. Possible starting points comprise for example peptide toxins, e.g., conotoxin (IMI) and alpha bungarotoxin, lophotoxins (Bippinatins), tubocurarine, decamethonium, alpha-cobratoxin, epibatidine, acetylcholine, choline, nicotine, carbachol, serotonin or GABA. The structure of these molecules together with that of the crystal of the target ligand-binding domain can be used to model the compound and elucidate side chains, functional groups etc.
which may be added, deleted or modified in order to improve for example affinity and/or specificty of the drug or for example make a drug which acts on a different target non-reactive with a certain ligand-gated ion channel.
In a preferred embodiment for the uses according to the present invention, the ligand-gated ion channel is the nicotinic acetylcholine receptor and said mediated or related disorder is Tourette's syndrome, Alzheimer's disease, addiction to nicotine or schizophrenia.
As mentioned herein before, this is the first time it could be shown that water-soluble ligand-binding proteins exists in molluscs, which closely resemble the ligand-binding domain of ligand-gated ion channel of higher mammals. It is expected that similar ligand-binding proteins exist in other molluscan species or even in the lineage the Mollusca, Protostomia, Coelomata, Bilateria, Eumetazoa, Metazoa, Fungi/Metazoa group. Accordingly, the present invention also relates to the use of a ligand of a ligand-gated ion channel for identifying and isolating a water-soluble ligand-binding protein from such species, preferably from a mollusc. Preferably, the ligand used for the isolation of the protein is a-bungarotoxin. The water-soluble ligand binding proteins obtainable from these organisms as well as derivatives that can be made in accordance with the teaching present herein are also subject of the present invention.
Furthermore, for the first time the crystal structure of a nicotinic binding site has been revealed. This crystal structure shows that the molluscan AChBP is a homolog of the LGIC superfamily ligand binding domains. It reveals the Ig-topology, the location of the binding site at the subunit interface, the position of the MIR and the extensive data on the nicotinic ligand binding residues. Importantly, it gives important new information about the exact fold and the arrangement of the nicotinic ligand-binding site in three dimensions. It shows the presence of a second pocket that has been noticed by EM analysis. Furthermore, it clarifies the arrangement of subunits by showing the relative positioning of the principal and complementary part of the ligand-binding site. It provides an explanation of the role of the LGIC
superfamily conserved residues in stabilizing the monomer structure by the formation of hydrophobic cores and packing of secondary structure elements and it makes clear how the pentamers are built up, and how weakly the pentamer interfaces are conserved between LGICs.
This structure can be used for the numerous drug-design studies that are targeting the LGIC; superfamily. The general structural knowledge on its folding will be applicable to the GABA, serotonin (5HT3) and glycine receptor fields. It will help to understand their ligand-binding characteristics and could thus have impact on development of e.g. anti-emetics aimed at the 5HT3 receptor or the mood-defining drugs that target the GABA receptors. However, the availability of a three-dimensional description of the nicotinic ligand-binding site will be especially relevant for the design of new drugs against Alzheimers' disease, epilepsy and the addiction to smoking which have the neuronal nicotinic receptors as their targets.
Many embodiments and the examples feature the acetylcholine-binding protein (AChBP) of the invention and the embodiments generally described herein are preferably related to the nicotinic acetylcholine receptor (nAChR), more preferably to the alpha subunit, and most preferably to the alpha 7 subunit. However, it should be understood that all embodiments equally apply to the other water-soluble ligand-binding proteins and generally to the ligand-gated ion channels mentioned herein.
For example, the crystal structure of the AChBP can be used to model new ligands for the acetylcholine receptor, preferably such with inhibiting or stimulating action on the acetylcholine receptor. Likewise, it is possible to identify and model new ligands for other ligand-gated ion channels (including glycine, GABA and serotonin receptor) with inhibiting action. Such ligands may for example prevent correct assembly of ligand gated ion channels. Preferably such ligands prevent correct assembly of specific sub types of ligand gated ion channels. On the other hand, ligands can be identified and modeled that promote correct assembly of ligand gated ion channels, preferably of specific sub types of ligand gated ion channels. As mentioned before, the methods of the present invention also allow modeling inhibitors for the non-specific binding site of ligand gated ion channels.
In addition, it is possible to predict and create mutants and chimeras of AChBP with modified assembly behaviour, modified ligand binding behavior such as with increased resemblance of the binding site to the acetylcholine receptor subtype on the primary binding site and generally with increased resemblance to particular ligand-gated ion channels in activity and conformational changes. In view of the closest relationship between AChBP and the acetylcholine receptor it is particular preferred to create mutants and chimeras with increased resemblance of the binding site to the acetylcholine receptor subtype on the secondary binding site.
However, the prediction and creation of mutants and chimeras with increased resemblance of the binding site to other ligand gated ion channels subtype on the primary binding site or on the secondary binding site are envisaged as well.
These and other embodiments are disclosed and encompassed by the description and Examples of the present invention. Further literature concerning any one of the antibodies, methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries and databases, using for example electronic devices. For example the public database "Medline" may be utilized which is available on the Internet, for example under http://www.ncbi.nlm.nih.gov/PubMed/medline.html. Further databases and addresses, such as http://www.ncbi.nlm.nih.gov/, http://www.infobiogen.fr/, http://www.fmi.ch/biology/research tools.html, http://www.tigr.org/, are known to the person skilled in the art and can also be obtained using, e.g., http://www.lycos.com.

An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness is given in Berks, TIBTECH 12 (1994), 352-364.
This disclosure may best be understood in conjunction with the accompanying drawings, incorporated herein by references. Furthermore, a better understanding of the present invention and of its many advantages will be had from the following examples, given by way of illustration and which are not intended as limiting.
Unless stated otherwise in the examples, all recombinant DNA techniques are performed according to protocols as described in Sambrook et al. (1989), Molecular Cloning " A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY or in Volumes 1 and 2 of Ausubel et al. (1994), Current Protocols in Molecular Biology, Current Protocols. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfase (1993) by R.D.D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK).
Brief descriation of the drawingis Figure 1: Clustal X (1.8) multiple sequence alignment of AChBP amino acid sequences. The AChBP alignment was made using "ClustalX_1.8"
(Thompson et al., Nucleic Acids Research 24 (1997), 4876-4882. The subsequent alignment was further processed using "Genedoc" version 2.5.000 (Nicholas et al. (1997) Genedoc a tool for editing and annotating multiple sequence alignments). Identical amino acids are indicated with "*", equivalent amino acid with ":", and similar amino acids with ".". Glycosylation sites are Asn 66 for L-AChBP and Asn 21 and 26 for B-AChBP in the amino acid sequence of the respective mature AChBP SEQ ID No. 2 and 4, and 6 and 8, respectively.
Figure 2: Hydrophobicity plots of the mature AChBP amino acid sequences. The B&L-AChBP hydrophobicity plots were made using "Protein sequence analyses" according to the method described in Kyte and Doolite (J.
Mol. Biol. 157 (1982), 105-132). 2A: L-AChBP T1 (SEQ ID No. 2), 2B:
L-AChBP_T2 (SEQ ID No. 4), 2C: B-AChBP_T1 (SEQ ID No. 6), 2D:
B-AChBP T2 (SEQ ID No. 8).

Figure 3: Clustal X (1.8) multiple sequence alignment of AChBP amino acid sequences with the amino acid sequences of the ligand-binding domains of the ligand-gated receptors nAChR-a7, GABAAR-a1, 5-HT3R and GIyR-a1. Sequence alignment and processing was performed as described for Figure 1. The accession numbers of the amino acid sequences used for the alignment are as follows: Human alphal: Human alpha7: Y08420; Human 5HT3: CAA06442; Human GIyR alphal: S12382; Human GABA~bI: NP 000797. A similar sequence alignment can be performed with the corresponding rat sequences (ratnAChRa7_Q05941, rat5HT3R_P35563, ratGABARbI_P15431, ratGIyRa1_p24524) which will give substantially similar if not identical results.
Figure 4: Clustal X (1.8) multiple sequence alignment of AChBP amino acid sequences with the amino acid sequences of nAChRs. Sequence alignment and processing was performed as described for Figure 1.
The accession numbers of the amino acid sequences used for the alignment are as follows: Human alphal : ACHUA1; Human alpha2:
AAG23253; Human alpha3: A53956; Human alpha4: P43681; Human alphas: P30532; Human alpha6: Q15825; Human alpha7: Y08420;
Human alpha9: CAB65091. A similar sequence alignment can be performed with the corresponding rat sequences (ratnAChRa7_Q05941, rnAChRa9_P43144, rnAChR2_P1238, rnAChRa3_P04757, rnAChRa4_P09483) which will give substantially similar if not identical results.
Figure 5: Clustal X (1.8) multiple sequence alignment of AChBP amino acid sequences with the amino acid sequences of nAChRs alpha 1 and 7.
Sequence alignment and processing was performed as described for Figure 1. The accession numbers of the amino acid sequences used for the alignment are as follows: Human alphal: ACHUA1; Human alpha7: Y08420. A similar sequence alignment can be performed with the corresponding rat sequence ratnAChRa7_Q05941 which will give substantially similar if not identical results.
Figure 8: The pentameric structure of AChBP. a In this schematic representation each monomer has a different grey level. Subunits are labeled anti-clockwise, with A-B, B-C, C-D, D-E and E-A forming the plus and minus interface side, with the principal and complementary ligand-binding sites respectively (ball-and-stick representation). b Viewing the AChBP pentamer perpendicular to the five-fold axis. The equatorially located ligand-binding site (ball-and-stick representation) is highlighted only in the A (light) and B (dark) interface.
Figure 7: The AChBP monomer. Ribbon representation of the AChBP monomer.
The secondary structure starting from the N-terminus (top) towards the C-terminus (bottom). The monomer is viewed towards the center of the pentamer. In the nAChR, the top would correspond to the N-terminus of the ligand binding domain, pointing towards the synaptic cleft, while the C-terminus would be entering the membrane at the bottom, continuing into the transmembrane domain. The AChBP
monomer is built up mainly of f3-strands, except for an N-terminal (-helix. It contains 14 f3-strands that are organized in the two antiparallel f3-sheets, with an immunoglobulin topology. However, in contrast to the classical immunoglobulin fold, the AChBP f3-sheets are rotated against each other, forming a small pocket, as visible in Figure 6.
Figure 8.: The ligand-binding site at dimer interface. Ribbon representation of two neighboring AChBP monomers. Monomer A is shown in grey and monomer B in dark grey. The ligand-binding site is located at the interface between two monomers. As predicted for the nAChRs, the acetylcholine binding site in AChBP occurs at the interface between two neighboring subunits. Similar to the model proposed for the nAChRs, the ligand-binding site is asymmetric, formed mainly by aromatic residues. Residues from mature AChBP monomer A
(TyrA89, TrpA143, TyrA185, CysA187, CysA188 and TyrA192) form the principal component, while residue TrpB53 from monomer B

creates the complementary part of the ligand-binding site. There are five identical ligand-binding sites in the AChBP pentamer, similar to the homomeric a7 neuronal receptor.
Figure 9: The ligand binding site. Stereo figure showing the ligand binding site in AChBP, at the interface of two monomers. Residues from mature AChBP monomer A (TyrA89, TrpA143, TyrA185, CysA187, CysA188 and TyrA192) form the principal component, while residue TrpB53 from monomer B creates the complementary part of the ligand-binding site with with additional residues ArgB104, LeuB112 and MetB114.
There are five identical ligand-binding sites in the AChBP pentamer, similar to the homomeric a7 neuronal receptor.
Figure '10: Multiple sequence alignment of AChBP amino acid sequences with indication of secondary structure and solvent accessibility derived from the crystal structure. Alignment of the four molluscan AChBP
sequences, with secondary structure and solvent accessibility of the Lymnea stagnalis AChBP-1 indicated from the crystal structure. The Figure was prepared with ESPript (Gouet et al., Bioinformatics. 15 (1999), 305-308), using DSSP (Kabsch and Sander, Biopolymers. 22 (1983), 2577-2637). Under the alignment the solvent accessibility is indicated, white most buried, dark blue most exposed, according to ESPript defaults (blue A> 0.4, cyan 0.1 <A<0.4, white A<0.1 ).
Figure 11: Sequence alignment of AChBP with LGICs. The alignment shows only the N-terminal domain of the LGIC subunits and is based on a multi-sequence alignment of 92 full-length LGIC sequences. Abbreviations used, H and Tca, stand for human and Torpedo californica. Secondary structure elements (a:a-helix, ~3: ~-strand, ~: 3,o-helix) are indicated above the sequence, in accordance with Fig 12a. AChBP shares 23%
sequence identity with the ligand-binding domain of human a,. The LGIC conserved residues (bold, grey background) are displayed.
Beginning and end of the Cys-loop are indicated by a "*". Nicotinic receptor ligand-binding residues on the principal and complementary side are indicated.

Figure 12: Overview of the AChBP monomer structure. a Stereo representation of the AChBP monomer as viewed from outside the pentameric ring.
Disulfide bridges are indicated in ball-and-stick representation. In a complete ion-channel the N-terminus would be pointing towards the synaptic cleft, while the C-terminus would enter the membrane at the bottom, continuing into the first transmembrane domain, b Topology diagram of the AChBP monomer. For comparison with Ig-folds the strands have been labeled a-g, showing the additional strand (b') and hairpin (f'-f"). In this structure, strands have been labeled ~i1-a10 with loops (or turns) L1-L10 preceding each strand with the same number.
The R5 strand is broken (~5-a5') with internal loop L5', a6 also has a small break, but is shown continuously; (see Fig. 11 ). The precise beginnings and ends of strands may change slightly with increasing resolution, but the topology seen here will be highly conserved across the entire family of LGICs.
Figure 13: The ligand-binding site. a Stereo representation of the ligand-binding site in ball-and-stick representation, showing the contribution of the principal A (TyrA89/a,Tyr93), B (TrpA143/a,Trp149) and C
(TyrA185/cx~Tyr190, CysA187/cx~Cys192, CysA188/a,Cys193, TyrA192 /alTyr198) and the complementary D (TrpB53/yTrp55, GInB55/yGlu57) E (ArgB104/~lLeu109, VaIB106/yTyr111, LeuB112/yTyr117, MetB114 /yLeu119) and F (TyrB164) 'loops'. b Stereo view of the electron density map displaying a HEPES buffer molecule in the ligand-binding site. This experimental density (contoured at 1 a) is derived from cross-crystal averaging. c Location of the principal ligand-binding residues on the monomer. d Location of the complementary ligand-binding residues on the monomer. (orientation as in Figure 6b) Figure 14: Dimer interface a Stereo figure of the dimer interface.
Representation of the interface residues (ball-and-stick) on a schematic secondary structure figure. The figure shows the plus face of subunit A and the minus minus face of subunit B b Dimer interface interactions. Note that due to the low conservation of these interfaces (Fig. 11 ) the actual interactions will not be conserved in any LGIC interface, but that in all receptors the topological regions are likely to form the interface.

-a~
Figure 15: Conservation in the LGIC superfamily. Conserved residues are indicated on the top, middle and bottom respectively on the monomer as viewed from the central pore. The hydrophilic conserved residues are indicated in dark. Conserved residues are indicated as viewed from the central pore. Hydrophobic Cluster I: residues 6, 10, 63, 65, 71, 81, 105, 111; Cluster II: residues 20, 27, 29, 31, 58, 82, 84, 86, 140, 150, 152, 195; Cluster III: residues 33, 35, 38, 41, 48, 52, 125, 138, 171, 173, 199, 201. The hydrophilic conserved residues: Asp60, Asp85, Asn90, GIy109, Cys123, Cys136, Lys203. Conserved residues in the ligand binding site: 106, 145, 192. These three and Lys203 are the only conserved residues without structural role in the monomer.
Note how very few conserved residues are at the surface. Within the LGIC family the Cys-loop residues are also highly conserved; see bottom, left.

EXAM PLES
EXAMPLE 1: Isolation of Lymnaea AChBP from the CNS, determination of mass and N-terminal protein sequence Isolation: 80 CNS of Lymnaea were homogenized in lysis buffer (PBS [16 mM
Na2HPG4, 4 mM NaH2P04, pH 7.4; 150 mM NaCI] 0.5% Nonidet P-40; 0.1 % triton, 0.2% tween-20) containing 1 ug/ml aprotinin, 10 ug/ml benzamidine, 0.5 ug/ml leupeptin, 24 ug/ml pefabloc. The CNS lysate was cleared by triplicate centrifugation at 12,000x g for 5 min. Streptavidin-coated magnetic beads (Dynal, Oslo), 5 mg, were saturated with a-bungarotoxin conjugated to Biotin (4 ug) (Molecular Probes, Oxford, tJK). These beads were washed in PBS to remove excess a-bungarotoxin, then added to the cleared CNS lysate, and incubated for 1 h. After this, beads were washed 3 times in PBS to remove unbound protein. A control reaction without a-bungarotoxin was performed. Proteins bound to a-bungarotoxin were allowed to elute off in 10 ul of PBS containing 10-4 M nicotine for 1 h.
Mass determination: The eluent was separated on a microcolumn LC system was similar to that described previously (Hsieh et al.; Anal. Chem. 70; 1998; 1847-1852).
A commercial syringe pump (Perkin-Elmer /ABI, model 140B) was used to deliver a flow rate of 20 ~I /min to the column. After loading of sample to the column the flow rate was dropped to 10 ~I /min. The eluent was then switched from 0.2% acetic acid to 0.2% acetic acid/ 60% acetonitril in 1 min. Electrospray mass spectra in MS
mode were acquired on a Micromass Q-TOF quadropole time-of-flight mass spectrometer equipped with a Z-spray atmospheric pressure ionization source.
Protein secfuence analysis: For sequence analysis a-bungarotoxin binding protein was extracted using the same procedure, now followed by SDS-PAGE and Western Blotting on PDVF membrane. Sequence analysis was performed with Edman degradation of the 24 kDa blotted protein (apparent MW) using a protein sequencer (ABI, Perkin Elmer).
EXAMPLE 2: Cloning the Lymnaea AChBP cDNA sequence: PCR and screening of a cDNA library PCR clonina: A degenerate oligonucleotide was synthesized based on the amino acid sequence LDRADILYNI (SEQ ID No. 10), residues 1-10, of AChBP, (5' CGGATCCGA(TC)(AC)GIGC(GATC)GA(TC)AT(ATC)(TC)T(GATC)TA(TC)AA(TC)A
T-3'; SE(~ ID No. 11), containing a BamHl restriction site, and used in combination with a primer on the IZAPII lambda vector. PCR was performed on a IZAP II cDNA

library of the Lymnaea CNS, in a 100 pl reaction volume with 1.0 unit of Super Taq DNA polymerase (Boehringer Mannheim, Germany) in a DNA thermal cycler (Perkin-Elmer Cetus, CT) using 45 cycles of (94 °C, 20 sec; 53 °C, 30 sec; and 72 °C, 1 min.
Amplified cDNA was digested with BamHl and EcoRl, separated on agarose gel, and a product of 900 by was cloned and sequenced.
Library screening: Approximately 20,000 clones of the amplified lambda ZAP II
CNS
cDNA library were plated at a density of 105 pfu/400 cm2 and absorbed to charged Nylon membranes (Boehringer Mannheim, Germany). The AChBP PCR product was used as a random primed probe, labeled with [alfa32P]dATP (specific activity >109 cpm/mg). Membranes were hybridized in 6x SSC (1 x SSC: 0.15 M NaCI and 0.015 M
Na-citrate), 0.2% SDS, 5x Denhardts and 10 ug/ml herring sperm DNA at 65 °C for 18 h. The filters were washed in 0.2x SSC, 0.2% SDS, at 65 °C for 30 min, and autoradiographed. Four individual cDNA clones were in vivo excised, and sequenced using dideoxy chain termination in both orientations. Two types of sequence were obtained, named L-AChBP_T1 and L-AChBP T2. The signal sequences were determined with "SMART", Simple Modular Architectur Research Tool (V3.1 ); see Schultz et al., Proc. natl. Acad. Sci. USA 95 (1998), 5857-5864 and Nucleic Acids Res. 28 (2000), 231-234. In case of L-AChBP_T1 (SEQ ID No. 2) the prediction could experimentally be confirmed.
EXAMPEE 3: Lymnaea AChBP-related sequences: cloning of the Bulinus truncatus cDNAs Total RNA was isolated from Bulinus brain ganglia (CNS), and reverse transcribed into hexanucleotide primed cDNA. Two degenerate oligonucleotides, directed to the Lymnaea AChBP_T1 sequence, forward primer: 5' GCGAATTCGAYACIGARWSIGGNGCNACNTG-3' (SEQ ID No. 12), reverse primer:

5'-GCGAAGCTTCRTCYTCRTAIGCYTCNGCRCARC-3' (SEQ ID No. 13), were used to amplify AChBP-related sequences. PCR was performed on one animal equivalent of CNS cDNA using 150 pmole of each primer under standard conditions for 45 cycles (94'C, 20 sec; 54' C, 30 sec; 72 'C, 1 min). Amplified cDNA was EcoRl/Hindlll digested, cloned into EcoRl/Hindlll digested pBluescript, and sequenced. The ORFs of the obtained sequences showed a Bulinus AChBP, sequence-related to Lymnaea AChBP, named B-AChBP T1. This partial cDNA was used to screen a Bulinus brain cDNA library using the same hybridization protocol as described for the cloning of the Lymnaea cDNAs, and yielded two cDNA clones, encoding B-AChBP_T1 and B-AChBP_T2. Sequencing of the cDNAs was performed in both orientations.

EXAMPLE 4: The production of L-AChBP-T1 and -T2 and B-AChBP-T1 and -T2 in the yeast Pichia pastoris and functional characterization Production of recombinant AChBP:
In order to produce L-AChBP_T1 and T2 and B-AChBP_T1 and T2 as recombinant proteins in the Pichia pastoris expression system (Pichia Expression Kit version 3.0, Invitrogen), the DNA sequence encoding the mature form of these proteins (see sequence files) was cloned into the pPIC9 expression vector (Invitrogen). The mature sequences of L-AChBP_T1, T2 and B-AChBP_T1 and T2 were PCR amplified (using Pfu-taq DNA polymerase (Stratagene) in order to avoid introduction of errors into the sequence due to PCR) and restriction sites were added to the primers to allow rapid pPIC9 compatible cloning. The amplified sequence of mature AChBP L-AChBP_T1 was EcoRl inserted into pPIC9, whereas L-AChBP T2 and B-AChBP T1 and T2 were Xhol/EcoRl inserted into pPIC9 (the alpha-mating factor cleavage site was fully reconstructed after Xhol digestion).
Constructs with and without an additional C-terminal His-tag (SRGHHHHHH (SEQ
ID
No. 14) in the case of L-AChBP_T1, EFKDDDDKHHHHHH (SEQ ID No. 15) otherwise) were generated for each of the AChBP (sub)types. The AChBP/pPIC9 constructs were amplified in E. coli DHSaF and isolated and purified using the plasmid Maxi Kit (Qiagen). Due to the engineered cleavage site at the N-terminus of the amino acid sequence four additional amino acids (EAEA, SEQ ID No. 16) will precede the N-terminus of the original mature protein. Prior to transfection into Pichia pastoris the constructs were linearised (for protocol see supplier's manual;
Pichia Expression Kit version 3.0, Invitrogen) and subsequently purified by phenol/chloroform extraction, and ethanol precipitation. Approximately 5 ~g of each of the linearised constructs was transformed into freshly prepared electro-competent Pichia pastoris cells and plated onto MD plates (for protocol see supplier's manual;
Pichia Expression Kit version 3.0, Invitrogen corporation). Electrocompetent Pichia pastoris cells were squired according to the protocol provided by Invitrogen.
Plates were incubated at 30°C until the appearance of Pichia colonies, which were subsequently analysed for the presence of the correct insert by PCR
amplification (for protocol see supplier's manual; Pichia Expression Kit version 3.0, Invitrogen).
Colonies containing an homologous recombination with the Pichia genome, carrying the AChBP sequence, were grown in 25 ml of BMGY for 1-2 days (30°C;
rotation at 250rpm), after which the cells were centrifuged (10 min., 1500g) and the cell pellet was resuspended into 10 ml of BMMY. Growth (30°C, 250rpm) was continued for an additional 4 days (day 3-6), during which the expression of AChBP was induced by the addition of 100% methanol (1 % of total culture volume) once every 24 hours. At day seven the culture was centrifuged (15 min.; 2000g; 4°C) and the medium was collected. The AChBP expression level of the various cultures was determined by the analyses of a fraction of the collected medium with SDS-polyacrylamide gel electrophoresis (see suppliers manual; Pichia Expression Kit version 3.0, Invitrogen).
The cultures that yielded the highest level of AChBP expression were selected and stored as glycerol stocks.
Recombinant AChBP that contained a C-terminal His-tag was isolated and purified from the Picha pastoris medium using Talon metal affinity resin (according to protocol as described within the user manual; Clontech laboratories Inc.). The protein concentration was subsequently analysed using SDS-polyacrylamide gel electrophoresis and reference marker proteins. Polyclonal antibodies have been raised succesfully to the recombinant L-AChBP T1 and B-AChBP_T1 proteins in Balb-C mice. Immune-sera were obtained without crosslinking of the proteins.
Binding characteristics of AChBP:
First the binding curve of a-Bungarotoxin to His-tagged AChBP was determined, and an affinity of 3.5 nM was calculated. Using a-Bungarotoxin in a competitive binding assay ligands of several types of ligand-gated ion channels were then tested on His tagged AChBP, i.e., ACh, serotonin, GABA, glycine, and glutamate. Both ACh and serotonin did compete with a-Bungarotoxin binding at 4.2 mM and 269 mM, IC50s respectively. GABA, Glycine and glutamate did not compete for binding with a-Bungarotoxin. Thus, as predicted by the primary sequence and by subunit structure also the ligand-binding characteristics of AChBP resembled that of a nAChR.
In a second series of competitive binding assays the ligand binding characteristics of AChBP were studied in more detail, now using various agonists and antagonists of the AChRs. Nicotine a classical agonist of the nAChRs, is a high affinity ligand of His-tagged AChBP (IC50 98 nM). Epibatidine, a high affinity agonist of the nAChRs, also binds with high affinity to His-tagged AChBP (IC50 1.4 nM), which is even higher than the 58 pM affinity of epibatidine reported for the nAChR (Radio, Mol.
Pharmacol.
45 (1994), 563-569). Other cholinergic agonists bind with a lower affinity e.g., decamethonium, carbachol, and choline respectively with IC50s of 4.1 pM, 43 pM.
and 190 NM. Summary of affinities indicated in Table 2.

Table 2 IC50 (pM) IC50 (pM) nHill nHill serotonin 269 t 67 0.65 a-cobratoxin16.2 0.1 4.08 0.03 0.30 choline 190 t 32 0.91 atropine 5.25 t 1.91 t 0.20 0.49 0.23 carbachol 43 2.7 0.67 t decamethonium4.1 t 0.3 1.13 t 0.05 0.09 acetylcholine4.2 t 1.1 0.72 t physostigmine1.25 0.040.66 0.09 0.07 nicotine 0.098 t 0.0250.78 t d-tubocurarine0.093 t 0.83 0.05 0.003 0.04 epibatidine0.0014 0.00010.66 t gallamine 0.039 t 0.71 t 0.04 0.007 0.14 a-bungarotoxin0.0026 0.80 t 0.0006 0.18 Competition-binding of typical antagonists of the nAChRs, e.g., tubocurarine and a-Bungarotoxin, have a high affinity for His-tagged AChBP, respectively IC50s of nM and 2.6 nM. The cholinergic antagonist succinylcholine has a very low affinity for His-tagged AChBP (IC50 7.9 mM). Interestingly, also muscarinic receptor antagonists bind to His-tagged AChBP with relatively high affinity, e.g., the muscarinic allosteric modulator gallamine (IC50 39 nM), and the muscarinic antagonist atropine (IC50 5.3 mM). Physotigmine which is a known blocker of acetylcholinesterase and is also an antagonist of the nAChR, binds to His-tagged AChBP with an IC50 of 1.3 mM.
Finally, Bipinnatin-B was tested, a synthetic form of the coral lophotoxin on AChBP
(Groebe and Abramson, J. Biol. Chem. 270 (1995), 281-286). Bipinnatin-B is a general blocker of nAChRs and is known to covalently bind to Tyr-190 of the a subunits (Abramson, J. Biol. Chem. 263 (1988), 18568-18573). His-tagged AChBP
was incubated with the toxin, and the mass of the protein increased with 430.1 Da, corresponding well to the calculated mass of Bipinnatin-B of 431 Da, indicating that the toxin also binds to Tyr-184 in His-tagged AChBP.
EXAMPLE 5: Expression and purification of recombinant AChBP for crystallization The AChBP_T1 protein from Lymnea stagnalis (AChBP) was overexpressed in Pichia pastoris GS115 strain using the AOX1 gene expression system from Invitrogen. Media and methods used for AChBP expression are also described in Invitrogen manual Pichia Expression Kit. For long term storage the transformants were grown overnight in YPD medium at 30°C.

YPD or Yeast Extract Peptone Dextrose medium 1 % yeast extract (Difco) 2% peptone (Difco) 2% dextrose (glucose) (Merck) The cells were harvested and suspended in YPD medium containing 15% glycerol at final OD500 of -50. The cells were frozen in a dry ice/ethanol bath and stored in the freezer (Revco) at -80°C. Normally, the expression of AChBP started with plating the cells from the glycerol stock on MD plate.
MD or Minimal Dextrose Medium 1.34% YNB (yeast nitrogen base w/o amino-acids) (Difco) 4x10-5 °~~ d-biotin (Sigma) 1 % dextrose For plates add 15g of agar (Difco) The plate was stored in the incubator (Heraeus) for 3-4 days at 30°C. A
single colony was picked from the plate and inoculated in 150 ml baffled flask (Nalgene) containing ml of BMGY medium.
BMGY or Buffered Glycerol-complex Medium 1 % yeast extract 2% peptone 20 100 mM potassium phosphate (pH 6.0) (Merck) 1.34% YNB
4x10-5 °/~ d-biotin 1 % glycerol (Merck) The culture was placed into the shaker (New Brunswick) and left to grow overnight 25 rotating at 250 rpm at 30°C. The following day 12.5 ml of the culture was inoculated into 225 ml of BMGY medium in a 1000 ml baffled flask. In order to increase the yield of expressed AChBP a larger number of flasks were used, usually 16. The flasks were placed in the shaker and start-cultures were rotated at 250 rpm at 30°C. After two days the start-cultures were centrifuged for 15 min at 2500 rpm (Sorvall RC3B+, rotor H-6000A) at room temperature. In order to increase the cell mass for bigger protein production, cell pellets of two start-culture flasks were pooled together and resuspended in 200 ml of BMMY medium containing 1 % (w/v) casamino acids.
BMMY of Buffered Methanol-complex Medium + 1 % casamino acids 1 % yeast extract 2% peptone 100 mM potassium phosphate (pH 6.0) 1.34% YNB

4x10-5 % d-biotin 0.5% methanol (Merck) 1 % casamino acids (Difco) The cultures were put back into the shaker (250 rpm, 30°C) and induced for the following 4 days. The concentration of methanol in the medium was kept constant by adding 1 % (v/v) methanol to the cultures every 24 hours. After 4 days 100 ml of culture was harvested and the original volume of 200 ml was readjusted by adding fresh BMMY medium with 1 % casamino acids. The remaining cultures were induced for another 4 days. The harvested cultures were centrifuged for 15 min at 4000 rpm (Sorvall RC3B+, rotor H-6000A) and the cell pellet was discarded. The supernatant was first filtered through a 0.22 pm filter (Millipore) to remove any remaining cells and it was concentrated using a Minitan system (Waters/Millipore) with 30kDa cutoff filter (Waters/Millipore). Both the filtration and concentration and were performed at 4°C.
Finally, centrifugation at 16000 rpm was done (Sorvall RCSC, rotor SS-34) in order to remove any debris left after the first two steps. The final volume of concentrated sample was ~80 ml and it was dialyzed overnight against 2 x 5 I (20 mM Tris [pH
8.0], 15t) mM NaCI and 0.02% NaN3) using l5kDa cutoff dialysis membrane (SpectralPor) at 4°C. The dialyzed protein solution (--100 ml) was loaded onto an anion-exchange column (POROS 50 HO, Pharmacia, column volume 8 ml). After the initial wash step of ~15 column volumes using loading buffer, a salt gradient of 30 column volumes was run from 150 mM to 1000 mM NaCI. Both solutions contained also 20 mM Tris (pH 8.0) and 0.02% NaN3. The peak of interest eluted at 300 mM
NaCI (conductivity range 16-24 mS/cm). The presence of AChBP was checked by Bio-Rad Protein Assay (Bio-Rad) and SDS-PAGE and the fractions of interested were pooled and concentrated using a Centriprep with a 30kDa cutoff membrane (Amicon). The concentrated sample (volume of 5 ml) was loaded onto a gel filtration column (Superdex 200 HR 16/60, Pharmacia, column volume 120 ml) using 20mM
Tris (pH 8.0), 150 mM NaCI and 0.02% NaN3. The protein eluted starting from 60 to 71 ml with peak at ~66 ml. The final purification step of the protein was done on an anion-exchange column (MonoQ HR10/10, Pharmacia, column volume 6 ml). The protein was loaded onto the column in the same buffer as eluted from the gel filtration column. The salt gradient used for the column was the identical to the one used for the POROS 50 HQ column. The fractions in the conductivity range 25-27.5 mS/cm were pooled together and dialyzed against buffer containing 50 mM HEPES (pH
7.0) and 0.02% NaN3. The protein was concentrated up to ~20 mg/ml using a Centricon with a 30kDa cutoff membrane (Amicon). The total yield was about 2 mg purified protein per liter of expressed medium. The concentrated protein was stored at 4°C
and used for crystallization experiments and biochemical characterization. N-terminal sequencing revealed the presence of EAEAYVEF residues that are part of the pIC9-encoded signal sequence, before residue 2. The experimental mass was determined to be 26544 Da (MALDI), which is ~2kDa more than calculated mass based on amino-acid sequence (24649 Da). The difference is assigned to glycosylation of AChBP at position Asn66 in the mature sequence, confirmed by deglycosylation experiments with N-glycosidase F (Boehringer).
The purification of the first harvest was done separately from the full harvest. They were pooled together prior to the last purification step (anion-exchange chromatography step on MonoO column). All above mentioned chromatography columns were mounted on an FPLC system (Pharmacia) controlled by the UNICORN
system (Pharmacia). All solutions used in the FPLC system were prepared with MilliO UF+ water, filtered through 0.22 Nm filter (Millipore) and degassed.
EXAMPLE 6: Crystallization of the AChBP
All the crystallization experiments were done by vapor diffusion technique in a hanging drop mode using 12 well tray (Nelipak) and siliconized cover slides (Hampton Research). Trays were placed in a sandwich box (Semadeni) and stored at 19°C temperature conditioned room. The initial crystallization attempts were performed using Hampton Crystal Screen I and II (Hampton Research). Drops contained 2 NI of protein (10 mg/ml in 50 mM HEPES [pH 7.0] and 0.02% NaN3) and 2 NI of reservoir solution. From the first screen it became clear that AChBP
makes crystalline precipitate in the presence of CaCl2 salt. A more detailed screen was made which produced crystals suitable for X-ray analysis. The AChBP crystals appeared in the following conditions: 9-11 % (w/v) PEG 4000 (Hampton Research), 100 mM HEPES (pH 7.0), 50-200 mM CaCl2 x 6H20 and 0.02% NaN3 or or PEG
MME 550 10-18% in the same conditions, with 0.3 mM ZnAcetate as additive.
Depending on the batch of the protein used and the CaCl2 concentration three different crystal forms were found: orthorhombic, tetragonal and monoclinic.
Both orthorhombic and monoclinic crystal forms are frequently twinned. Orthorhombic rod-like crystals appeared immediately upon setting up the crystallization experiments (in between first few hours) under high [CaCl2]. The size of the crystals varied from 0.05x0.05x0.15 to 0.25x0.25x1.0 mm. The crystals diffract X-ray up to 3 A
resolution and show high degree of mosaicity (--05-1.2°). They have the symmetry of space group P212,2, with cell constants of a= 120.62, b=137.011, c=161.54A with 2 pentamer molecules per asymmetric unit. Tetragonal crystals, squared in shape, grew at lower CaCl2 concentration, reaching 0.2x0.3x0.35 mm in size. The maximal resolution obtained was 2.7 ~ with a lower mosaicity (0.5°). They belong to space group P422,2 space group with cell dimensions of a=b=141.66A, c=120.83A with one pentamer molecule per asymmetric unit. The exact crystallization condition for the tetragonal crystal which was used for refinement of the crystal structure:
11.5% (w/v) PEG 4000, 100 mM HEPES (pH 7.0), 150 mM CaCl2 and 0.02% NaN3. The third crystal form, monoclinic P2,, is very similar in morphology to the orthorhombic crystals with cell dimensions of a=121.1,x, b=162.1, c=139.4A, a=90.13°, containing 4 pentamers per asymmetric unit. This crystals were gave lower resolution data (~
3.3~ resolution). All three crystal forms were used in the structure determination of AChBP.
The resolution limit of diffraction depended very much on the size of the crystals. And the largest crystals diffracted weakly to ~4~ resolution when exposed to a conventional rotating anode X-ray source. Therefore, the use of synchrotron radiation was critical for the structure determination. The crystals had to be cryo-protected in order to slow down the damage caused by high intensity synchrotron radiation.
The cryo-protection of the AChBP crystal was done in multiple steps. The first steps included the stabilization of crystal by adding the 2 NI of mother liquor (equilibrated reservoir solution) to the drop with the crystal. After 5 minutes 3 NI of stabilizing solution was added to the drop. Normally, the stabilizing solution contained slightly higher concentrations (1-5%) of the components of the original crystallization buffer.
As protectant glycerol (Merck) was added, increasing the concentration stepwise from 0% to 30% (v/v). For example, the starting solution contained 15% PEG
4000, 100 mM HEPES (pH 7.0), 150 mM CaCl2 and 0.02% NaN3 and the final solution contained 30% (v/v) glycerol in addition to the components just mentioned. The AChBP crystals do not tolerate drastic increase in the glycerol concentrations therefore a gentle but more time consuming approach has to be adopted. The solution around the crystal has to be stepwise exchanged (usually 5% increase of glycerol concentrations) allowing crystals to equilibrate for at least 5 minutes in each glycerol concentration. Once the crystals were equilibrated in stabilizing solution with 30% glycerol they were flash-cooled in liquid nitrogen or in the cryo-stream.
In all three space groups AChBP forms a decamer structure with perfect 52 symmetry, where two pentamers contact each other through a calcium-binding site, at the 'top' of the a1 helix. This binding site (Asp2 and Asp5 from two monomers) is not conserved in the LGIC family. In the tetragonal space group the 2-fold of the decamer coincides with a crystallographic two-fold, which leads to pseudocentrosymmetric behavior of the phases at low resolution. In solution the AChBP protein acts as pentamer.
Those of skill in the art will appreciate that the aforesaid crystallization conditions can be varied. Such variations may be used alone or in combination, and include final protein (optionally in complex with a ligand) concentrations between 1 mg/ml and 30 mg/ml; all combinations of AChPB/ligand to precipitant ratios; use of citrate concentrations between 0 mM and 200 mM; DTT concentrations between 0 mM and mM; and any concentration of beta-mercaptoethanol; pH ranges between 5.5 and 10 9.5; PEG concentrations between 5% and 25% (w/v); PEG weights between 2000 and 8000; HEPES concentrations between 5 and 500 mM; use of TRIS or other solutions instead of HEPES, and any concentration or type of detergent; any other type of precipitating agent; any other buffer; any temperature between -50 °-C and 30 °-C; and crystallization of AChBP or complexes thereof by batch, liquid bridge, or dialysis method using these conditions or variations thereof.
EXAMPLE 7: Structure determination The crystal structure was determined using the multiwave anomalous dispersion (MAD) technique on a Pb derivative, but non-crystallographic symmetry (NCS) averaging was necessary to obtain interpretable electron density. Collection of native data and heavy-atom derivatives were carried out at the synchrotron beam-lines in Grenoble (ESRF/BM14 and ID14) and Hamburg (DESY/BW7A, BW7B and X11 ). The AChBP orthorhombic crystal was soaked in stabilizing solution containing 5 mM
trimethylleadacetate (MePb) for 5 days. Data sets were collected at four different wavelengths (0.9492A, 0.8610A, 0.9507 and 0.9499A) and data were integrated and reduced using DENZO/SCALEPACK (Otwinowski and Minor (1997) Processing of X-ray diffraction data collected in oscillation mode. In Methods in Enzymology, Volume 276: Macromolecular Crystallography, part A. C.W. Carter and R.M.
Sweet, eds. (New York: Academic Press), pp. 307-326). The program SOLVE (Terwilliger (1997) SOLVE: An automated structure solution for MAD and MIR. Edition 1.16) found 5 Pb sites which were situated on the interface between two pentamers.
The Pb parameters were refined and phases calculated with SHARP (La Fortelle et al.
(1997) Advances in MIR and MAD phasing: Maximum-likelihood refinement in a graphical environment, with SHARP. Proceedings of the CCP4 study weekend).
Mean figure of merit (FOM) value for 4 wavelengths was 0.45. Search and optimizatian of 5-fold NCS operators were done using programs NCS6D and IMP
(Kleywegt and Jones (1999) Software for handling macromolecular envelopes.
Acta Crystallo., D55, 941-944). 10-fold averaging using refined NCS operators in conjunction with density modification by DM (Cowtan (1994) DM: An automated procedure for phase improvement by density modification. In Joint CCP4 and ESF-EACBM Newsletter on Protein Crystallography 31, 34-38) yielded an interpretable electron density map. However, some parts of the pentamers were still not clearly defined. Therefore, a second MAD experiment was performed on the monoclinic crystals soaked in 10 mM MePb for 5 days. Data were collected for only two wavelengths, at the Pb peak (0.947910 and remote (0.9498A) wavelength. The processing of the two collected data sets was done with MOSFLM (Leslie (1992) Recent changes to the MOSFLM package for processing film and image plate data.
In Joint CCP4 and ESF-EACBM Newsletter on Protein Crystallography, Number 26) and data were scaled with SCALA (CCP4. The CCP4 suite: programs for protein crystallography. Acta Crystallog. D50, 760-763). 10 Pb sites were identified with Solve. The Pb parameters were refined and phases calculated with SHARP in single anomalous dispersion (SAD) mode using data collected at the Pb absorption peak The NCS operators needed for 20-fold averaging were found by NCS6D and improved with IMP. 20-fold averaging and density modification by program DM
further improved electron density. The initial model tracing and sequence assignment were done based on the 20-fold averaged electron density with program O (Jones et al., 1991 ). However, parts of the molecules were not clearly defined. The electron density was further improved doing multi-crystal averaging with DMMULTI
(Cowtan, 1994) using amplitudes of tetragonal, orthorhombic and native data sets and experimental phases of the orthorhombic and monoclinic MAD experiments.
Initially missing parts became clearly defined and a complete model could be built. The initial atomic model was refined with the program CNS (Brunger et al. (1998) Acta Crystallogr. D 54, 905-921 ) against a maximum-likelihood target without experimental phases contribution using tetragonal native data which extend to 2.7A
resolution.
Refinement included five-fold NCS restraints, an overall anisotropic B factor and bulk solvent correction. The five-fold NCS restraints were released for the parts of the pentamer that clearly do not follow the five-fold symmetry. The current model contains one pentamer of AChBP consisting of 1035 residues, 14 well-ordered solvent molecules, 5 Ca2+ ions, 5 CI- ions and 5 Hepes molecules, well-ordered solvent molecules and 5 HEPES molecules. The following residues are not well defined in the electron density: -8-0 (part of a-mating S. cerevisiae signal sequence not native to AChBP EAEAYVEF; SEQ ID No. 21 ), 125-135, 155-165, 186-191 and 206-210.

Electron density is detectable in the ligand-binding site of AChBP. It is presumed that a HEPES molecule could account for this extra electron density based on its chemical properties. HEPES or N-2-Hydroxyethylpiperazine-N'-2-ethanesulfonic acid contains a quaternary ammonium ion similar to ligand such as acetylcholine (ACh) and d-tubocurarine. It has been proposed that the binding of ACh would be mediated by cation-~ interaction involving N+ and ~-systems of aromatic residues present in the binding site of nicotinic acetylcholine receptor. Without intending to be bound by theory it is suggested in accordance with the observation of the present invention that the observed HEPES molecule mimics ligand binding analogous to the binding of natural ligands like ACh in the ligand-binding site.
EXAMPLE 8: More detailed description of the structure determined in Example 7 As described in the previous example, the crystal structure of AChBP was solved using weak Pb MAD data in two crystal forms. The electron density map was improved substantially by cross-crystal averaging of three crystal forms with 20, 10 and 5 copies of the monomer in the asymmetric unit respectively (Table 3).
Table 1: Data collection statistics Data set 7~,.,peak ~,~ remote ~,~ infl. ~,, peak 7~_? infl. Native Space group P2,212, P2, P422,2 Resol. (~) 3.3/3.4-3.3 3.0/3.1-3.0 2.7/2.8-2.7 7~ (A) 0.9492 0.8610 0.9507 0.9479 0.9498 0.943 Compl. (%) 99.7/99.7 99.6/99.6 99.7/99.7 99.9/99.9 99.5/99.5 97.8/96.5 Mosaicity (°) 0.62 0.43 0.78 Redundancy 3.7/3.8 3.8/3.9 3.7/3.8 3.5/2.2 3.2/2.0 6.5 Rmer9e (%,) 7.7/46.8 7.8/45.2 8.3/55.0 5.9/26.1 6.0/32.9 5.9/67.4 Ilal 8.7/1.6 8.4/1.7 8.3/1.4 7.7/2.7 6.8/1.5 27.4/2.3 Phasing ISO/ANO ISO/ANO ISO/ANO ISO/ANO ISO/ANO
R~~ns (%) 0.74/0.89 n.a./0.92 0.54/0.94 n.a./0.74 0.66/0.77 Phasing power 0.57/1.2 n.a./1.06 2.3/0.91 n.a./1.1 0.37/1.22 FOM (overall) 0.45 0.28 The structure was refined at 2.7 A in space group P422,2, with one AChBP
pentamer in the asymmetric unit. Thus, native data (X11 ) were collected and the Pb-1 data sets (BW7A) at the EMBUDESY synchrotron in Hamburg and the Pb-2 data sets (BM14) at the ESRF, Grenoble (Table 3). Data were processed with DENZO/SCALEPACK
(Otwinowski & Minor, Methods Enzymol. 276, 307-326 1997) (native) or MOSFLM
(Leslie, Acta Crystallogr. D. Biol. Crystallogr. 55, 1696-1702, 1999)/SCALA
(CCP4) (Pb-1, Pb-2). The Pb sites, located at the interface of two pentamers, were found for both MAD sets by SOLVE (Terwilliger, Acta Crystallogr. 55, 849-861, 1999) and heavy atom parameters were optimized with SHARP (La Fortelle et al., Methods Enzymol. 276, 472-494, 1997). NCS operators were found and refined with NCS6D
and IMP (Kleywegt and Jones, SERC Daresbury Laboratory, Warrington, pp. 59-66, 1994). DM-multi (Cowtan, Joint CCP4 and ESF-EACBM Newsletter on Protein Crystallography, 31, 34-38, 1994) multi-crystal averaging used amplitudes of monoclinic, orthorhombic and native (tetragonal) data sets and experimental phases of the orthorhombic and monoclinic MAD experiments. The model was built in O
(Jones et al., Acta Crystallogr. A47, 110-119, 1991 ) and refined with the program CNS (Brunger et al., Acta Crystallogr. D54, 905-921, 1998), against the tetragonal data to 2.7 A resolution. Refinement included partial 5-fold NCS restraints, an overall anisotropic B factor and bulk solvent correction. The unusual double cysteine Cys187-Cys188 formed a clear disulfide bridge. Because of the limited resolution it was refined with standard parameters. The final model contains 1025 residues of AChBP pentamer, 5 HEPES molecules, 10 Ca2+ ions and 15 water molecules. The entire AChBP pentamer is well ordered, except for the N-terminal 7 residues (part of the signal sequence) and the last five C-terminal residues. In addition, the HEPES, the loop region 155-160 and the sugar residues attached to residue Asn66 are not well resolved in the electron density. R.m.s deviations from ideal geometry for bond distances and angles are 0.01 A and 1.6°, respectively. The sequence alignment was calculated by CLUSTALX (Thompson et al., Nucleic. Acids. Res. 25, 4876-4882, 1997) and the corresponding figure with Espript (Gouet et al., Bioinformatics.
15, 305-308, 1999). Figures 2-5 were done using programs MOLSCRIPT (Kraulis, P.J., J. Appl. Cryst. 24, 946-950, 1991 ), BOBSCRIPT (Esnouf, Acta Crystallogr. D55, 940, 1999) and RASTER3D (Merritt and Bacon, Methods Enzymol. 277, 505-524, 1997). Refinement took place with partial five-fold NCS restraints, resulting in an R-faCtOr of 26.4% (Rfree = 30%).
The AChBP pentamer:
The AChBP homopentamer, when viewed along the five-fold axis, resembles a windmill toy, with petal-like monomers (Fig. 6a). When viewed perpendicular to the five-fold axis it has a disc-like appearance (Fig. 6b). The overall proportions of the pentamer are -80x80x62 A, and the diameter of the central hole is --18 A.
These dimensions are in good agreement with the Torpedo nAChR N-terminal domain EM
data (Miyazawa et al., J. Mol. Biol. 288, 765-786, 1999). The only subunit contacts in the AChBP pentamer are dimer interfaces, of which each monomer has two, one called the plus side and one called the minus side. We refer to the A (plus)-B
(minus) interface" as example for the five equivalent interfaces AB, BC, CD, DE and EA
(Fig 6).
The AChBP monomer:
Each AChBP monomer is a single domain protein, asymmetric in shape, with a size of -50x21 x27 A (Fig. 12a). It consists of an N-terminal a-helix, two short 3,o helices and a core of 10 ~-strands forming a R-sandwich. The order of a-strands conforms to a modified immunoglobulin (Ig) topology (Fig. 12b) with an extra a-hairpin (f'-f") and an extra strand (b') (Bork et al., J. Mol. Biol. 242, 309-320, 1994). These additional strands introduce two so-called "Greek key" folding motifs. The Ig-based structure prediction (Le Novere et al., 1999; Corringer et al., Biophys. J. 76, 2329-2345, 1999) agrees well with the AChBP structure, although location of the binding site was missed due to the presence of extra a-strands (Fig. 12b). Compared to the classical Ig-fold, the AChBP (3-strands are considerably twisted, with the a-sheets rotated against each other, resulting in two separate hydrophobic cores. Thus the three-dimensional fold does not resemble other Ig-like proteins and comparison to the protein database (Holm and Sander, Nucleic. Acids. Res. 25, 231-234, 1997) did not result in a significant match to any known structure.

Positioning of functional regions:
Couple of regions that are important to receptor function can be localized in the AChBP structure. In muscle type nAChRs the main immunogenic region (MIR), comprising residues a167-a,76, acts as an epitope in the autoimmune disease myasthenia gravis (Tzartos et al., Mol. Neurobiol. 5, 1-29, 1991 ). Although the MIR-related region in AChBP (residues 65-72) shows no sequence homology to the a,-subunit, its location in loop L3 at the top of the pentamer in a highly accessible position agrees well with the expected accessibility for this region. It also fits with EM
studies that located the MIR at the distal end of the receptor relative to the membrane (Beroukhim and Unwin, Neuron 15, 323-331, 1995).
On each AChBP monomer, a large cavity that is accessible from the central pore of the pentameric ring can be seen. The cavity is framed at the entrance by (3-strands (~i3, a4, ~5 and (35') (Fig 12a) and is uncharged, mainly hydrophobic, in character.
This region probably corresponds to the tunnel framed by twisted R-strands that was observed in the a1-subunit of Torpedo receptor at 4.6 A resolution (Miyazawa et al., J. Mol. Biol. 288, 765-786, 1999). However, this cavity is not in contact with another large pocket observed at each interface between subunits. These latter pockets are lined by residues shown to be involved in ligand binding in nAChR (Arias, Neurochem. Int. 36, 595-645, 2000; Corringer et al., Annu. Rev. Pharmacol.
Toxicol.
40, 431-458, 2000). They are buried from the solvent, and located close to the outside of the pentameric ring. When viewed perpendicular to the five-fold axis they are roughly equatorially positioned, -30 A away from the C-termini (Fig. 6b), conforming to the expected location of the Torpedo receptor ligand-binding site, as determined by labeling (Fernando Valenzuela et al., Biophys. J. 66, 674-682, 1994) and EM studies (Unwin, J. Mol. Biol. 229, 1101-1124, 1993).
The liaand-binding site:
Each ligand-binding site is found in a cleft formed by a series of loops from the principal face of one subunit and a series of a-strands from the complementary face of an adjacent subunit. It is a large cavity buried by a series of loops from the principal side and by a a-strands from the complementary side (Fig. 13). The principal side on the plus side of the AB interface consists of residues coming from 'loop A' (TyrA89), 'loop B' (TrpA143, A145) and 'loop C' (TyrA185, the double cysteine A187-A188, and TyrA192) (Fig 13c). The complementary part of this binding site is contributed by monomer B and made of 'loop D' (TrpB53, GInB55), 'loop E' (ArgB104, VaIB106, LeuB112 and MetB114) and 'loop F' (TyrB164) (Fig 13d). In this pocket four of the aromatic residues form the bottom half of the cavity (TyrA89, TyrA185, TyrB164 and TrpB53). The pocket walls are formed by the TyrA192, TrpA143, main chain of A145 Met B114, the side-chain of GInB55 and the double cysteine (CysA187-CysA188). The hydrophobic parts of ArgB104, VaIB106 and LeuB112 form the top of the pocket (Fig 13a).
All residues in the pocket had been successfully identified by photoaffinity labeling and mutagenesis studies (Arias, Neurochem. Int. 36, 595-645, 2000; Corringer et al., Annu. Rev. Pharmacol. Toxicol. 40, 2000). Although the side chain of HisA145 is pointing away from the cavity, its main chain is involved. One residue identified by labeling studies, TrpA82 (a,Trp86) (Galzi et al., J. Biol. Chem. 265, 10430-10437, 1990; Dennis et al., Biochemistry 27, 2346-2357, 1988) is involved in hydrophobic core formation and located far from the pocket, thus not participating in ligand binding. Otherwise, the AChBP ligand-binding site confirms the available biochemical and mutational data on nAChR completely.
The structure, however, shows for the first time how these residues are positioned with respect to each other and therefore provide a valuable tool for drug design as described in the above description of the present invention.
All observed residues are conserved between known nicotinic ligand-binding subunits except the 'loop F' TyrB164 residue. The 'loop F' region has an unusual conformation, but since it is relatively weakly resolved, its precise analysis is difficult.
The 'loop F' region is stabilized in the structure by a calcium binding site formed by AspB161, AspB175 and the main chain of 8176. This Ca2+ ion is structurally important for TyrB164 orientation and could therefore be important for proper ligand binding. 'The present findings are supported by labeling studies on muscle/Torpedo subunits showing that residues homologous to AspB161, yAsp174/8Asp180 play a role in ligand binding (Czajkowski et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6285-6289, 1993; Czajkowski and Karlin, J. Biol. Chem. 270, 3160-3164, 1995; Martin et al., J.
Biol. Chem. 271, 13497-13503, 1996). Additionally, calcium binding sites that enhance the response to agonist binding have been identified in the homologous region (residue range 161-172) of neuronal a, receptor (Galzi et al., EMBO J.
15, 5824-5832, 1996). The 'loop F' region has low sequence conservation in the nicotinic family (Fig. 11 ) and in other superfamily members it may well have a different conformation, even to the extent of forming a (3-strand that connects the two sheets into a ~i-barrel. Such changes could well lead to variations in affinity, e.g.
by changing the size of the ligand-binding site or its access route.
The most likely access routes to the ligand binding sites are from above or below the double-cysteine-containing 'loop C' (Fig. 13a). This region buries the pocket from the solvent and therefore prevents access from the outside. Access from the central pore has been suggested in the literature (Miyazawa, J. Mol. Biol. 288, 765-786, 1999), but this would require major structural rearrangements at the interface, which makes it less likely.
Ligand binding Surprisingly, features of bulky electron density were found that stacked onto Trp143 in each ligand-binding site in the experimental cross-crystal averaged electron density (Fig 13b). Upon consideration we have assigned this to a HEPES (N-2-Hydroxyethylpiperazine-N'-2-ethanesulfonic acid) buffer molecule, that contains a positively charged quaternary ammonium group and therefore has some similarity to known nicotinic receptor ligands. Its EC50 is 100 mM, indicating that its binding under crystallization conditions (100-150 mM) is possible. Although HEPES
molecule does not make any specific contacts with the protein, it stacks with its quaternary ammonium onto Trp143, making cation-~ interactions as expected for nicotinic agonists (Dougherty, Science 271, 163-168, 1996) (Fig. 13b). However, due to limited resolution of the present data and probable low occupancy, the precise orientation of the HEPES molecule should be taken with some degree of reservation.
It has been suggested (Changeux and Edelstein, Neuron 21, 959-980, 1998) that the ligand-binding site of nAChRs could be similar to that of acetylcholinesterase (AChE).
Although the size of the binding site is roughly similar in AChBP and AChE, the observed arrangement of aromatic residues is quite different. However, the stacking of the quaternary ammonium of HEPES, as far as it has been refined in the current AChBP structure, is similar to that of the quaternary ammonium of the decamezonium in AChE on the Trp84 residue (Harel et al., Proc. Natl. Acad.
Sci.
U.S.A. 90, 9031-9035, 1993).
Subunit arran a From the location of the ligand-binding site conclusions can be drawn about the relative arrangement of subunits in the Torpedo and muscle receptors. It has been suggested that the a,y and a,8 interfaces occur in a clockwise a,~ya,8a~
arrangement when looking towards the membrane (Machold et al., Eur. J. Biochem. 234, 427-430, 1995). Such a clockwise arrangement disagrees with the structure determined in accordance with the present invention, because the relative arrangement of the principal binding site and its complementary partner is anticlockwise when looking towards the 'bottom' (membrane) side of the pentamer (Fig. 6).
Pentamer interface:
The subunit interface consists on the plus side entirely of loop regions (L1, L2, L4, L5, L7, L8 and L10), whereas the minus side mostly presents secondary structure elements to the interface (a1, (i1, ~2, ~3, a5, ~6 and L9) (Fig. 14). Several residues are important for both ligand-binding and pentamer formation. The interface buries a considerably surface area (2700 A2), with a mainly uncharged character including only a single bifurcated salt bridge (GIuA149-ArgB3 and ArgB104). Most intriguing about the interface residues is the lack of conservation of these particular residues in the entire superfamily, not only with AChBP, but also amongst each other (Fig.
11 ).
These changes involve major changes in character, including changes from hydrophobic to charged. Even when a residue is conserved in any particular subunit, its expected counterpart is missing (either in the same subunit, as in the a, homopentamers, or in contacts such as muscle a18 or a1'y or neuronal a4(32) with the sole exception of the ligand-binding site. The high level of structural conservation however, determines involvement of the same topological regions in these contacts in all family members (Fig 14b). This indicates that shape complementarity must play a major role in determining the conservation of the pentamer structure. It also indicates that different combinations of subunits will have different interfaces, creating variations in the precise allosteric contacts and movements in the various subclasses of these ion channels.
Li aq nd-gated ion channels:
The lack of conservation of the interface residues seems a general feature in the superfamily of LGICs, as the residues that form the interface are among the least conserved regions of the domains (Fig. 11 ). Apparently pentamer formation does not impose very stringent evolutionary requirements in this case. However, there is clear sequence conservation within the superfamily (Fig. 11 ) and it is interesting to analyze this in the light of the structure.

In the AChBP monomer structure the conserved hydrophobic residues can be grouped into three clusters (Fig. 15). In AChBP, as in other proteins with Ig-like fold, the packing of the a-sheets is promoted mainly by hydrophobic and to a lesser extent by electrostatic interactions. The first cluster is involved in packing of the N-terminal helix a1 against the main framework of the monomer and it involves residues 6, 10, 63, 65, 71, 81, 105 and 111. The second cluster, comprising residues 20, 27, 29, 31, 58, 82, 84, 86, 140, 150, 152 and 195, is situated in the upper half of the (i-core region. The third cluster, including residues 33, 35, 38, 41, 48, 52, 125, 138, 171, 173, 199 and 201, is located at the lower end of the structure (Fig 15). The only non-hydrophobic residues that are highly conserved in the superfamily are Asp60, Asp85, Asn90 and GIy109. Asp60 and GIy109 are involved stabilizing the turns of a Greek key motif connecting strands a3, R5, R6 and ~2, where Asp60 stabilizes the N-terminus of a small 3,o helix and GIy109 enables tight turn formation.
Conserved residues Asp85 and Asn90 are involved in packing of the a-sheets. Asp85 forms hydrogen bonds to the highly conserved Ser142 and Thr144 and residue Asn90 brings together the main-chain oxygens of Ser122 and Arg137, enabling disulfide bond formation of the nearby absolutely conserved disulfide bond (123-136).
This disulphide bond is topologically equivalent to so-called 'tyrosine cornerstone' (Hemmingsen et al., Protein Sci. 3, 1927-1937, 1994), which links the two ~-sheets together in Ig-like proteins. This explains why in the Torpedo receptor the Cys128-Cys142 bond is important for both preservation of subunit conformational stability (Mishina et al., Nature 313, 364-369, 1985) and complete nAChR assembly (Green &
Wanamaker, J. Neurosci. 18, 5555-5564, 1998). Since the observed overall structural conservation is high, it is clear that all LGIC N-terminal domains will have the same three-dimensional structure.
In contrast to the above residues, the Cys-loop is a highly conserved hydrophobic region in the LGIC family but presents a totally different character in AChBP
(Fig. 11 ).
In AChBP, this loop is hydrophilic and is found at the bottom (membrane) side of the protein, at the dimer interface. This location and its hydrophobicity in the LGIC family implies that this loop could interact with the membrane or with the transmembrane region of the receptors, functions that are absent in AChBP.
Since all ligand gated ion channels have intrinsically the same function, opening of a membrane pore, it is likely that the conserved regions of the protein determine this function. That also indicates that it is unlikely that the interface of the pentamer has a major role in opening the channel. It is possible that the conserved Cys-loop is directly involved in transmitting this kind of information to the membrane part of the LGICs. Another option is that large structural changes in the ~-sheet regions play a role in opening the channel. Indeed, the movement observed at 9 ~ for Torpedo nAChR upon agonist binding (Unwin, Nature 373, 37-43, 1995), fits well with such a suggestion. In accordance with the present invention a twisted ~-sandwich would be observed, with two distinct hydrophobic cores and it is entirely possible that these cores move with respect to each other upon ligand binding. The effect of such movements will then be modulated by the varying subunit interfaces in the different subtypes of the receptor, allowing intricate specificity in the neuronal signal transmission.
EXAMPLE 9: Ligand-binding crystallization studies AChBP was cocrystallized in complex with a-bungarotoxin (aBTX, Sigma). Prior to the crystallization experiments the stability of the complex has been investigated.
Using gel-filtration chromatography (Superdex 200 HR 10/30, Pharmacia, column volume 24 ml) it has been found that it is possible to purify stable complex between AChBP and aBTX. The gel-filtration run was performed using 20 mM Tris (pH
8.0), 150 mM NaCI and 0.02% NaN3. The stability of the complex was also confirmed with native PAGE. The crystallization experiments were done based on the same set of conditions found to work for AChBP alone; see Example 6. A small screen was set up with different precipitant concentrations and various AChBP:a BTX
concentrations. Tiny crystals appeared in the conditions containing 10-12% PEG
4000, 100 mM HEPES (pH 7.0), 20-80 mM CaCl2 and 0.02% NaN3. The best looking crystals grew under above mentioned conditions when AChBP: (BTX were mixed in 1:10 molar ratio. In order to check if complex indeed crystallized, crystals were thoroughly washed, dissolved in denaturing buffer and checked on SDS-PAGE that clearly showed that they contained both proteins.
In addition, a number of small ligands were bound to AChBP in soaking experiments.
These include: B-bippinatin (a synthetic analog of lophotoxin), acetylcholine (ACh, Sigma), d-tubocurarine chloride (Sigma), carbamylcholine chloride (CCh, Sigma), galanthamine hydrobromide (Sigma), epibatidine (Sigma) and nicotine (Sigma).
The soaking solutions were made of stabilizing solutions (see Example 6) and together with dissolved ligands (ligands were normally dissolved in 20 mM HEPES [pH

7.0]).
The ligand concentrations used were dependent on its binding constants, as determined by ligand-binding studies. The soaking times were different depending on the ligand used. After the soaking step the crystals were flash-cooled in liquid nitrogen.

EXAMPLE 10: Generating human alpha? nAChR 1 AChBP chimeras The chimeric proteins of nAChR subunits and AChBP can be used as tools in the development of novel, nAChR subtype specific ligands. As a first step in developing these tools chimeric proteins have been designed and constructed in which parts) of the human alpha? nAChR were grafted into AChBP. Previous studies on the molecular determinants of ligand-binding by the alpha? nAChR have identified three amino acid domains that compose the primary part of the ligand-binding site, further referred to as "loops A, B, and C". Within each of the three loops amino acid residues are present that are thought to directly interact with the ligand. Based on sequence conservation of the nAChR and AChBP the three possible ligand-binding loops of AChBP have been pin-pointed in accordance with the present invention as follows:
loop A, Trp-101 -> Tyr-108; loop B, Trp-162 -> His-164; loop C, Tyr-204 -> Tyr-211.
The chimeric proteins that were constructed replace either one (A, B or C) or multiple (A&B, A&C, B&C and A&B&C) of the ligand-binding loops of AChBP with the corresponding human alpha? nAChR sequence.
The loop-A domain of AChBP was replaced by the corresponding domain of the human alpha? nAChR using a two-step polymerase chain reaction (PCR). In the first step two separate PCR amplifications (35 cycles: 94 °C;30 sec., 58 °C; 30 sec and 72 °-C; 60 sec.) yielded two halves of the chimera construct. AChBP
cDNA (wild type) was used as template, and outer primers located either just before the start codon (gcgctcgagaaaagagaggctgaagctttggaccgggcagacatctt; SEQ ID No. 17) or just before the stop codon (cgcgaattcaagaatttcggagcgtccctt; SEQ ID No. 18) were each used in combination with two internal primers gtggaaaccagacattctcctctacaacgccatctcgaaacc (SEQ ID No. 19) and gaggagaatgtctggtttccacaaagagcttattggcac (SEQ ID No. 20), respectively. The internal primers contained a 5'-tag-sequence that encoded for the introduced alpha? nAChR domain. As such the two generated chimeric PCR
products share a common tag containing a part of the alpha? nAChR subunit. In the second step, the two PCR products from the first round were pooled and, in the absence of primers, went through 5 rounds of PCR amplification (94 °-C;
30 sec., 54 °-C; 3 mm. and 72 °C; 90 sec.). This allowed the two halves of the chimera to anneal to each other at the common alpha? nAChR tag. The subsequent addition of the two outer primers and another 35 cycles of 25 PCR amplification (94 °-C; 30 sec., 58 °-C;
30 sec. and 72 °-C; 90 sec.) yielded the final chimera construct. All PCR
amplifications were hot-started and performed using PFU DNA-polymerase (Invitrogen). The loop-A AChBP/alpha7 chimera was cloned, using Xhol/EcoRl restriction sites in the outer primers, into the His-tag containing yeast expression -~ 1 vector pPIC9 (Invitrogen). Validation of the construct was achieved by DNA
sequencing. Expression of the chimera construct was achieved according to the Pichia pastoris protein expression protocol of Invitrogen.
As described in the examples and the description, the present invention provides water-soluble ligand-binding proteins derived from molluscs and analogs of ligand-gated ion channels, crystals thereof and their use for screening ligands of ligand-gated ion channels. In particular, ligand-binding proteins have been identified that are capable of forming multimers and are amenable to crystallization. The crystall structure of one these proteins, an acetylcholine binding protein (AChBP) is provided, which can be used to generate 3D models of the extracellular ligand-binding domain of ligand-gated ion channels and thus for screening of drugs that act on these ion channels. Furthermore, chimeric proteins are provided that are capable of binding a ligand of a ligand-gated receptor, and comprising at least the amino acids of the AChBP determining solubility of the AChBP, in the same positions as in the AChBP, and furthermore comprising amino acids determining binding to said ligand.
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.
The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background of the Invention, Description, and Examples is hereby incorporated herein by reference. Moreover, the sequence listing is herein incorporated by reference.

Table 1 REMARK Written by O
version 7Ø1 CRYST1 141.660 141.660 120.870 90.0090.00 90.00 ORIGX1 1.0000()0 0.000000 0.000000 0.00000 ORIGX2 0.000000 1.000000 0.000000 0.00000 ORIGX3 0.000000 0.000000 1.000000 0.00000 SCALE1 0.007059 0.000000 0.000000 0.00000 SCALE2 0.000000 0.007059 0.000000 0.00000 1~ SCALE3 0.000000 0.000000 0.008273 0.00000 ATOM 1 CB PHEA 1 65.468 25.1271.161 1.0073.24 ATOM 2 CG PHEA 1 64.224 24.8030.370 1.0076.49 ATOM 3 CD1 PHEA 1 63.433 25.819-0.178 1.0077.52 ATOM 4 CD2 PHEA 1 63.798 23.4710.244 1.0078.15 15 ATOM 5 CE1 PHEA 1 62.224 25.522-0.840 1.0079.11 ATOM 6 CE2 PHEA 1 62.590 23.148-0.412 1.0079.82 ATOM 7 CZ PI-iEA 1 61.79"7 24.179-0.958 1.0079.89 ATOM 8 C PHEA 1 66.638 27.1461.923 1.0069.89 ATOM 9 0 PHEA 1 67.034 26.5192.903 1.0070.26 ATOM 10 N PHEA 1 67.407 25.990-0.118 1.0071.31 ATOM 11 CA PHEA 1 66.21.4 26.3750.689 1.0070.93 ATOM 12 N ASPA 2 66.562 28.4781.909 1.0068.78 ATOM 13 CA ASPA 2 66.958 29.2333.105 1.0068.57 ATOM 14 CB ASPA 2 67.577 30.6152.739 1.0069.98 25 ATOM 15 CG ASPA 2 66.63!a 31.5231.914 1.0073.55 ATOM 16 OD1 ASPA 2 67.059 32.0680.844 1.0073.75 ATOM 17 OD2 ASPA 2 65.485 31.7142.349 1.0075.27 ATOM 18 C ASPA 2 65.794 29.3744.102 1.0067.66 ATOM 19 0 ASPA 2 64.622 29.2733.719 1.0068.25 ATOM 20 N ARGA 3 66.126 29.5605.386 1.0065.60 ATOM 21 CA ARGA 3 65.131 29.7036.453 1.0060.77 ATOM 22 CB ARGA 3 65.765 30.2227.737 1.0060.30 ATOM 23 CG ARGA 3 66.393 29.1748.604 1.0059.51 ATOM 24 CD ARGA 3 66.375 29.62910.048 1.0061.41 35 ATOM 25 NE ARGA 3 66.440 28.47110.927 1.0061.03 ATOM 26 CZ ARGA 3 67.550 27.78711.159 1.0062.03 ATOM 27 NH1 ARGA 3 68.692 28.16910.586 1.0060.01 ATOM 28 NH2 ARGA 3 67.509 26.69411.918 1.0062.76 ATOM 29 C ARGA 3 64.034 30.6596.055 1.0059.92 ATOM 30 0 ARGA 3 62.883 30.4876.454 1.0059.64 ATOM 31 N ALAA 4 64.395 31.6855.291 1.0057.25 ATOM 32 CA ALAA 4 63.404 32.6414.836 1.0055.16 ATOM 33 CB ALAA 4 64.065 33.7824.088 1.0053.78 ATOM 34 C ALAA 4 62.421 31.9173.927 1.0054.69 4'rJATOM 35 0 ALAA 4 61.213 32.0624.074 1.0055.60 ATOM 36 N ASPA 5 62.942 31.1272.995 1.0054.79 ATOM 37 CA ASPA 5 62.097 30.3922.060 1.0055.84 ATOM 38 CB ASPA 5 62.937 29.5801.058 1.0056.83 ATOM 39 CG ASPA 5 63.918 30.4370.278 1.0059.97 ATOM 40 OD1 ASPA 5 63.519 31.519-0.213 1.0061.60 ATOM 41 OD2 ASPA 5 65.095 30.0250.148 1.0062.19 ATOM 42 C ASPA 5 61.176 29.4432.815 1.0055.90 ATOM 43 0 ASPA 5 60.01:L 29.2682.445 1.0053.57 ATOM 44 N ILEA 6 61.695 28.8323.877 1.0055.26 55 ATOM 45 CA ILEA 6 60.890 27.8894.650 1.0055.12 ATOM 46 CB ILEA 6 61.743 27.1075.657 1.0055.82 ATOM 47 CG2 ILEA 6 60.878 26.0566.354 1.0053.18 ATOM 48 CGl ILEA 6 62.924 26.4554.933 1.0056.24 ATOM 49 CD1 ILEA 6 63.802 25.5685.816 1.0059.65 ATOM 50 C ILEA 6 59.742 28.5615.396 1.0054.71 ATOM 51 0 ILEA 6 58.589 28.159 5.256 1.00 55.75 ATOM 52 N LEUA 7 60.058 29.583 6.182 1.00 52.58 ATOM 53 CA LEUA 7 59.041 30.299 6.929 1.00 51.88 ATOM 54 CB LEUA 7 59.697 31.387 7.784 1.00 51.65 ATOM 55 CG LEUA 7 60.589 30.828 8.895 1.00 51.59 ATOM 56 CD1 LEUA 7 61.484 31.902 9.480 1.00 51.45 ATOM 57 CD2 LEUA 7 59.700 30.225 9.953 1.00 51.32 ATOM 58 C LEUA 7 58.048 30.915 5.961 1.00 51.46 ATOM 59 0 LEUA 7 56.846 30.921 6.204 1.00 51.87 1~ ATOM 60 N TYRA 8 58.561 31.417 4.848 1.00 51.83 ATOM 61 CA TYRA 8 57.727 32.041 3.832 1.00 53.61 ATOM 62 CB TYRA 8 58.601 32.520 2.672 1.00 55.43 ATOM 63 CG T'IRA 8 57.806 33.119 1.543 1.00 57.65 ATOM 64 CD1 TYRA 8 57.217 34.379 1.668 1.00 58.24 15 ATOM 65 CE1 TYRA 8 56.439 34.914 0.644 1.00 58.94 ATOM 66 CD2 T'CRA 8 57.601 32.407 0.366 1.00 58.93 ATOM 67 CE2 T'CRA 8 56.825 32.930 -0.6651.00 60.13 ATOM 68 CZ T'IRA 8 56.244 34.183 -0.5181.00 60.03 ATOM 69 OH TYRA 8 55.453 34.699 -1.5271.00 63.97 ATOM 70 C TYRA 8 56.636 31.114 3.296 1.00 52.67 ATOM 71 0 TYRA 8 55.483 31.511 3.143 1.00 52.13 ATOM 72 N ASNA 9 57.009 29.880 2.997 1.00 53.39 ATOM 73 CA ASNA 9 56.051 28.918 2.488 1.00 53.87 ATOM 74 CB ASNA 9 56.750 27.613 2.096 1.00 58.21 25 ATOM 75 CG ASNA 9 57.646 27.772 0.860 1.00 62.45 ATOM 76 OD1 A;3NA 9 57.647 28.824 0.209 1.00 64.72 ATOM 77 ND2 A3NA 9 58.405 26.724 0.530 1.00 62.99 ATOM 78 C ASNA 9 54.987 28.638 3.526 1.00 53.31 ATOM 79 0 ASNA 9 53.794 28.725 3.239 1.00 52.02 ATOM 80 N ILEA 10 55.420 28.300 4.736 1.00 53.77 ATOM 81 CA ILEA 10 54.489 28.018 5.829 1.00 55.18 ATOM 82 CB ILEA 10 55.229 27.788 7.150 1.00 53.51 ATOM 83 CG2 II~EA 10 54.220 27.639 8.272 1.00 53.99 ATOM 84 CG1 ILEA 10 56.109 26.541 7.044 1.00 50.48 35 ATOM 85 CD1 ILEA 10 57.043 26.346 8.202 1.00 47.68 ATOM 86 C ILEA 10 53.523 29.183 6.032 1.00 57.42 ATOM 87 0 II~EA 10 52.319 28.997 6.221 1.00 57.74 ATOM 88 N ARGA 11 54.070 30.390 5.997 1.00 58.29 ATOM 89 CA ARGA 11 53.283 31.600 6.156 1.00 60.48 ATOM 90 CB ARGA 11 54.199 32.810 6.042 1.00 64.72 ATOM 91 CG ARGA 11 53.513 34.134 6.270 1.00 70.99 ATOM 92 CD ARGA 11 53.241 34.337 7.757 1.00 79.75 ATOM 93 NE ARGA 11 53.059 35.751 8.105 1.00 86.33 ATOM 94 CZ ARGA 11 53.848 36.733 7.665 1.00 89.85 45 ATOM 95 NH1 ARGA 11 54.871 36.451 6.845 1.00 92.68 ATOM 96 NH2 ARGA 11 53.636 37.992 8.056 1.00 90.02 ATOM 97 C ARGA 11 52.204 31.701 5.082 1.00 59.54 ATOM 98 0 ARGA 11 51.038 31.954 5.363 1.00 59.64 ATOM 99 N GLNA 12 52.614 31.489 3.841 1.00 59.22 ATOM 100 CA GLNA 12 51.718 31.595 2.705 1.00 58.15 ATOM 101 CB GLNA 12 52.542 31.776 1.441 1.00 59.05 ATOM 102 CG GLNA 12 52.118 32.961 0.629 1.00 60.64 ATOM 103 CD GLNA 12 52.674 34.226 1.192 1.00 61.53 ATOM 104 OE1 GLNA 12 53.879 34.345 1.360 1.00 65.50 55 ATOM 105 NE2 GLNA 12 51.811 35.182 1.489 1.00 62.18 ATOM 106 C GLNA 12 50.732 30.460 2.472 1.00 57.30 ATOM 107 0 GLNA 12 49.714 30.651 1.814 1.00 57.03 ATOM 108 N T13RA 13 51.029 29.280 2.987 1.00 56.84 ATOM 109 CA THRA 13 50.142 28.147 2.773 1.00 57.26 ATOM 110 CB THRA 13 50.922 26.964 2.186 1.00 57.29 ATOM 111 OG1 THRA 13 52.000 26.616 3.071 1.00 55.40 ATOM 112 CG2 THR A 13 51.477 27.326 0.813 1.00 58.15 ATOM 113 C THR A 13 49.411 27.650 4.013 1.00 58.45 ATOM 114 0 THR A 13 48.423 26.932 3.905 1.00 58.36 ATOM 115 N SER A 14 49.892. 28.034 5.187 1.00 60.01 ATOM 116 CA SER A 14 49.290 27.584 6.424 1.00 60.03 ATOM 117 CB SER A 14 50.198 27.930 7.601 1.00 61.46 ATOM 118 OG SER A 14 49.813 27.207 8.758 1.00 65.18 ATOM 119 C SER A 14 47.899 28.147 6.664 1.00 59.50 ATOM 120 0 SER A 14 47.560 29.240 6.189 1.00 58.72 1~ ATOM 121 N ARG A 15 47.7_02 27.377 7.407 1.00 58.04 ATOM 122 CA ARG A 15 45.74() 27.753 7.755 1.00 55.62 ATOM 123 CB ARG A 15 44.744 26.996 6.877 1.00 56.74 ATOM 124 CG ARG A 15 44.925 27.253 5.385 1.00 59.62 ATOM 125 CD ARG A 15 43.688 26.851 4.614 1.00 61.99 ATOM 126 NE ARG A 15 42.519 27.540 5.151 1.00 64.02 ATOM 127 CZ ARG A 15 41.261 27.216 4.870 1.00 65.48 ATOM 128 NH1 ARG A 15 41.007 26.201 4.050 1.00 67.33 ATOM 129 NH2 ARG A 15 40.256 27.908 5.408 1.00 64.23 ATOM 130 C ARG A 15 45.51.6 27.420 9.219 1.00 52.12 ATOM 131 0 ARG A 15 45.135 26.310 9.562 1.00 53.25 ATOM 132 N PRO A 16 45.751 28.392 10.1041.00 50.04 ATOM 133 CD PRO A 16 46.198 29.750 9.773 1.00 48.52 ATOM 134 CA PRO A 16 45.597 28.249 11.5511.00 49.56 ATOM 135 CB PRO A 16 45.959 29.634 12.0731.00 49.66 25 ATOM 136 CG PRO A 16 46.870 30.165 11.0411.00 49.57 ATOM 137 C PRO A 16 44.215 27.816 12.0161.00 50.11 ATOM 138 0 PRO A 16 44.060 27.322 13.1311.00 51.27 ATOM 139 N ASP A 17 43.208 28.013 11.1761.00 50.70 ATOM 140 CA ASP A 17 41.856 27.640 1.1.5481.00 50.64 ATOM 141 CB ASP A 17 40.850 28.609 10.9311.00 54.16 ATOM 142 CG ASP A 17 40.873 29.974 1.1.5921.00 59.76 ATOM 143 OD1 ASP A 17 41.245 30.060 1.2.7911.00 60.67 ATOM 144 OD2 AS A 17 40.500 30.965 1Ø9201.00 62.99 ATOM 145 C ASP A 17 41.482 26.218 11.1571.00 50.71 35 ATOM 146 0 ASP A 17 40.353 25.783 11.3901.00 48.36 ATOM 147 N VAL A 18 42.42.9 25.484 10.5831.00 51.85 ATOM 148 CA VAL A 18 42.143 24.128 10.1481.00 52.53 ATOM 149 CB VAL A 18 42.262 24.011 8.622 1.00 53.05 ATOM 150 CG1 VAL A 18 41.834 22.618 8.169 1.00 51.38 ATOM 151 CG2 VAL A 18 41.396 25.077 7.963 1.00 51.76 ATOM 152 C VAL A 18 42.993 23.050 10.7791.00 52.56 ATOM 153 0 VAL A 18 44.199 23.006 10.5881.00 52.64 ATOM 154 N ILE A 19 42.327 22.172 11.5191.00 53.41 ATOM 155 CA ILE A 19 42.954 21.042 12.2021.00 52.70 45 ATOM 156 CB ILE A 19 41.871 20.319 13.0721.00 52.71 ATOM 157 CG2 ILE A 19 40.819 19.671 12.1901.00 52.40 ATOM 158 CG1 ILE A 19 42.504 19.290 13.9921.00 53.50 ATOM 159 CD1 ILE A 19 41.546 18.811 15.0561.00 50.39 ATOM 160 C ILE A 19 43.596 20.097 11.1641.00 52.96 ATOM 161 0 ILE A 19 42.957 19.687 10.1931.00 51.39 ATOM 162 N PRO A 20 44.878 19.757 11.3551.00 53.70 ATOM 163 CD PRO A 20 45.711 20.210 12.4721.00 54.14 ATOM 164 CA PRO A 20 45.644 18.876 10.4611.00 56.34 ATOM 165 CB PRO A 20 47.078 18.996 10.9811.00 56.60 55 ATOM 166 CG PRO A 20 47.060 20.235 11.8401.00 58.05 ATOM 167 C PRO A 20 45.177 17.432 10.4741.00 58.61 ATOM 168 0 PRO A 20 45.974 16.523 10.6821.00 59.22 ATOM 169 N THR A 21 43.886 17.231 10.2461.00 62.30 ATOM 170 CA THR A 21 43.283 15.900 10.2361.00 66.91 ATOM 171 CB THR A 21 41.765 16.020 10.4951.00 65.83 ATOM 172 OG1 THR A 21 41.516 15.813 11.8831.00 67.19 ATOM 173 CG2 THRA 21 40.975 15.0109.687 1.00 68.42 ATOM 174 C THRA 21 43.522 15.0608.967 1.00 70.65 ATOM 175 0 THRA 21 43.365 15.5387.832 1.00 70.53 ATOM 176 N GLNA 22 43.899 13.8029.179 1.00 74.54 ATOM 177 CA GLNA 22 44.152 12.8448.096 1.00 78.38 ATOM 178 CB GLNA 22 45.513 12.1808.296 1.00 79.92 ATOM 179 CG GLNA 22 46.668 13.1748.402 1.00 83.40 ATOM 180 CD GLNA 22 47.836 12.6409.244 1.00 84.08 ATOM 181 OE1 GLNA 22 47.709 12.45110.467 1.00 82.79 1~ ATOM 182 NE2 GL~NA 22 48.976 12.3978.592 1.00 83.48 ATOM 183 C GLNA 22 43.055 11.7798.158 1.00 80.25 ATOM 184 0 GLNA 22 43.050 10.9299.058 1.00 80.25 ATOM 185 N ARGA 23 42.133 11.8257.199 1.00 82.59 ATOM 186 CA ARGA 23 40.999 10.8967.162 1.00 84.29 15 ATOM 187 CB ARGA 23 41.478 9.447 7.095 1.00 85.05 ATOM 188 CG ARGA 23 41.983 9.032 5.717 1.00 87.64 ATOM 189 CD ARGA 23 43.517 8.991 5.617 1.00 90.14 ATOM 190 NE ARGA 23 43.958 8.775 4.231 1.00 92.92 ATOM 191 CZ ARGA 23 43.557 7.768 3.447 1.00 94.10 ATOM 192 NH1 ARGA 23 42.700 6.854 3.901 1.00 94.07 ATOM 193 NH2 ARGA 23 44.000 7.687 2.195 1.00 93.77 ATOM 194 C ARGA 23 40.130 11.0998.399 1.00 85.22 ATOM 195 0 ARGA 23 39.979 12.2378.881 1.00 84.91 ATOM 196 N ASPA 24 39.549 10.0118.908 1.00 86.21 25 ATOM 197 CA ASPA 24 38.705 10.10510.105 1.00 86.07 ATOM 198 CB ASPA 24 37.689 8.952 10.194 1.00 89.13 ATOM 199 CG ASPA 24 37.418 8.289 8.847 1.00 91.57 ATOM 200 OD1 ASPA 24 36.945 8.994 7.900 1.00 92.21 ATOM 201 OD2 A:~PA 24 37.680 7.058 8.756 1.00 91.67 ATOM 202 C ASPA 24 39.631 10.02111.305 1.00 84.31 ATOM 203 0 ASPA 24 39.173 9.975 12.458 1.00 84.64 ATOM 204 N ARGA 25 40.935 9.981 11.029 1.00 81.75 ATOM 205 CA ARGA 25 41.936 9.898 12.091 1.00 79.08 ATOM 206 CB ARGA 25 43.309 9.539 11.527 1.00 81.87 35 ATOM 207 CG ARGA 25 43.471 8.100 11.087 1.00 86.55 ATOM 208 CD ARGA 25 44.960 7.785 10.851 1.00 90.81 ATOM 209 NE ARGA 25 45.187 6.380 10.489 1.00 95.61 ATOM 210 CZ ARGA 25 46.388 5.815 10.345 1.00 96.85 ATOM 211 NH1 ARGA 25 47.495 6.537 10.530 1.00 97.46 ATOM 212 NH2 ARGA 25 46.48'7 4.522 10.023 1.00 97.32 ATOM 213 C ARGA 25 42.059 11.20112.870 1.00 75.12 ATOM 214 0 ARGA 25 42.158 12.28312.281 1.00 75.55 ATOM 215 N PROA 26 42.034 11.11214.212 1.00 70.63 ATOM 216 CD PROA 26 41.636 9.933 14.999 1.00 69.09 45 ATOM 217 CA PROA 26 42.152 12.28115.083 1.00 67.24 ATOM 218 CB PROA 26 41.802 11.72316.460 1.00 67.68 ATOM 219 CG PROA 26 40.930 10.56516.158 1.00 68.06 ATOM 220 C PROA 26 43.593 12.76215.053 1.00 64.53 ATOM 221 0 PROA 26 44.491 12.00014.694 1.00 63.60 ATOM 222 N VALA 27 43.816 14.02015.420 1.00 61.16 ATOM 223 CA VALA 27 45.168 14.54415.476 1.00 57.20 ATOM 224 CB VALA 27 45.19'7 16.07915.374 1.00 56.96 ATOM 225 CG1 VALA 27 46.535 16.61515.872 1.00 54.60 ATOM 226 CG2 VALA 27 44.986 16.49613.930 1.00 55.09 55 ATOM 227 C VALA 27 45.685 14.11416.835 1.00 55.33 ATOM 228 0 VALA 27 45.026 14.32817.849 1.00 53.70 ATOM 229 N ALAA 28 46.852 13.48416.858 1.00 54.55 ATOM 230 CA ALAA 28 47.405 13.02318.118 1.00 53.25 ATOM 231 CB ALAA 28 48.250 11.78517.907 1.00 52.00 ATOM 232 C AI~AA 28 48.230 14.11718.761 1.00 52.77 ATOM 233 0 ALAA 28 49.324 14.45118.294 1.00 52.53 ATOM 234 N VAL 29 47.683 14.672 19.837 1.00 7 A 51.33 ATOM 2.35 CA VAL 29 48.332 15.730 20.590 1.00 6 A 49.28 ATOM 236 CB VAL 29 47.367 16.921 20.845 1.00 6 A 47.59 ATOM 237 CG1VAL 29 48.056 17.985 21.676 1.00 6 A 44.30 'rJ ATOM 238 CG2VAL 29 46.891 17.497 19.527 1.00 6 A 44.21 ATOM 2.39 C VAL 29 48.782 15.171 21.930 1.00 49.546 A

ATOM 2,40 0 VAL 29 48.014 14.524 22.635 1.00 49.148 A

ATOM 241 N SER 30 50.043 15.402 22.261 1.00 49.547 A

ATOM 242 CA SER 30 50.574 14.946 23.523 1.00 52.386 A

1~ ATOM ;?43 CB SER 30 51.869 14.163 23.309 1.00 51.506 A

ATOM :?44 OG SER 30 52.846 14.945 22.645 1.00 56.108 A

ATOM 245 C SER 30 50.819 16.187 24.362 1.00 54.256 A

ATOM 246 0 SER 30 51.360 17.174 23.880 1.00 56.418 A

ATOM :~47 N VAL 31 50.396 16.134 25.618 1.00 56.867 A

15 ATOM :~48 CA VAI~ 31 50.543 17.258 26.531 1.00 58.426 A

ATOM :z49 CB VAI~ 31 49.170 17.768 27.012 1.00 58.486 A

ATOM 250 CG1VAL 31 49.338 19.086 27.744 1.00 59.956 A

ATOM 251 CG2VAL 31 48.219 17.910 25.835 1.00 56.736 A

ATOM 252 C VAL 31 51.328 16.803 27.747 1.00 59.566 A

ATOM 253 0 VAL 31 51.073 15.729 28.281 1.00 60.858 A

ATOM 254 N SER 32 52.271 17.631 28.185 1.00 61.067 A

ATOM 255 CA SER 32 53.105 17.312 29.338 1.00 60.166 A

ATOM 256 CB SER 32 54.388 16.619 28.868 1.00 59.886 A

ATOM 257 OG SER 32 55.294 16.430 29.937 1.00 60.418 A

25 ATOM 258 C SER 32 53.465 18.568 30.116 1.00 60.196 A

ATOM 259 O SER 32 54.206 19.416 29.621 1.00 61.878 A

ATOM 260 N LEU 33 52.946 18.689 31.333 1.00 58.897 A

ATOM 261 CA LEU 33 53.256 19.847 32.170 1.00 57.236 A

ATOM 262 CB LEU 33 52.112 20.142 33.142 1.00 55.206 A

ATOM 263 CG LEU 33 50.740 20.363 32.511 1.00 54.666 A

ATOM 264 CD1LEU 33 49.762 20.880 33.543 1.00 51.016 A

ATOM 265 CD2LEU 33 50.880 21.342 31.373 1.00 55.396 A

ATOM 266 C LEU 33 54.518 19.601 32.979 1.00 56.766 A

ATOM 267 0 LEU 33 54.697 18.526 33.533 1.00 58.148 A

35 ATOM 268 N LYS 34 55.394 20.597 33.028 1.00 57.177 A

ATOM 269 CA LYS 34 56.633 20.512 33.800 1.00 57.466 A

ATOM 270 CB LYS 34 57.865 20.690 32.910 1.00 60.896 A

ATOM 271 CG LYS 34 57.940 19.723 31.738 1.00 68.806 A

ATOM 272 CD LYS 34 58.048 18.249 32.186 1.00 73.306 A

ATOM 273 CE LYS 34 58.077. 17.290 30.961 1.00 74.906 A

ATOM 274 NZ LYS 34 58.210 15.842 31.340 1.00 75.557 A

ATOM 275 C LA'S 34 56.522 21.691 34.741 1.00 54.816 A

ATOM 276 0 LYS 34 56.567 22.834 34.308 1.00 55.338 A

ATOM 277 N PHE 35 56.358 21.422 36.026 1.00 52.887 A

45 ATOM 278 CA PHE 35 56.215 22.507 36.976 1.00 50.006 A

ATOM 279 CB PHE 35 55.586 21.993 38.260 1.00 45.716 A

ATOM 280 CG PI-iE 35 54.186 21.542 38.072 1.00 45.076 A

ATOM 281 CD1PHE 35 53.91'? 20.256 37.634 1.00 45.466 A

ATOM 282 CD2 35 53.133 22.429 38.252 1.00 47.466 PHE
A

'rJ0ATOM 283 CE1 35 52.612 19.848 37.372 1.00 45.036 PHE
A

ATOM 284 CE2 35 51.819 22.036 37.990 1.00 49.486 PHE
A

ATOM 285 CZ PHE 35 51.560 20.735 37.547 1.00 48.146 A

ATOM 286 C PHE 35 57.494 23.268 37.247 1.00 49.056 A

ATOM 287 0 PHE 35 58.549 22.687 37.480 1.00 48.498 A

55 ATOM 288 N ILE 36 57.374 24.588 37.191 1.00 46.867 A

ATOM 289 CA ILE 36 58.492 25.482 37.393 1.00 45.556 A

ATOM 290 CB ILE 36 58.538 26.551 36.284 1.00 43.926 A

ATOM 291 CG2 36 59.771 27.411 36.433 1.00 39.036 ILE
A

ATOM 292 CG1 36 58.526 25.876 34.917 1.00 44.176 ILE
A

ATOM 293 CD1 36 59.671 24.916 34.699 1.00 46.336 ILE
A

ATOM 294 C ILE 36 58.392 26.181 38.739 1.00 46.386 A

ATOM 295 0 II~EA 36 59.405 26.58039.318 1.00 45.40 ATOM 296 N ASNA 37 57.176 26.34039.244 1.00 46.13 ATOM 297 CA ASNA 37 57.023 27.00840.526 1.00 46.27 ATOM 298 CB ASNA 37 57.491 28.46240.400 1.00 46.32 ATOM 299 CG ASNA 37 58.009 29.03041.707 1.00 48.59 ATOM 300 OD1 A~~NA 37 57.408 28.84442.759 1.00 49.38 ATOM 301 ND2 ASNA 37 59.124 29.74341.639 1.00 46.71 ATOM 302 C ASNA 37 55.595 26.97541.046 1.00 46.17 ATOM 303 0 ASNA 37 54.644 26.79940.281 1.00 44.02 1~ ATOM 304 N ILEA 38 55.465 27.11742.362 1.00 46.64 ATOM 305 CA ILEA 38 54.173 27.15843.033 1.00 48.46 ATOM 306 CB ILEA 38 53.988 25.95143.923 1.00 47.34 ATOM 307 CG2 ILEA 38 52.680 26.06644.671 1.00 49.13 ATOM 308 CG1 ILEA 38 53.983 24.69743.050 1.00 48.40 ATOM 309 CD1 ILEA 38 54.079 23.40243.791 1.00 47.55 ATOM 310 C ILEA 38 54.245 28.43343.847 1.00 50.74 ATOM 311 0 ILEA 38 54.979 28.50544.817 1.00 53.13 ATOM 312 N LEUA 39 53.485 29.43843.433 1.00 53.46 ATOM 313 CA LEUA 39 53.52'7 30.75744.045 1.00 55.16 ATOM 314 CB LEUA 39 53.350 31.80642.952 1.00 54.91 ATOM 315 CG LEUA 39 54.33() 31.59141.800 1.00 57.26 ATOM 316 CD1 LEUA 39 54.108 32.64740.728 1.00 54.71 ATOM 317 CD2 LEUA 39 55."75'731.62342.341 1.00 54.68 ATOM 318 C LEUA 39 52.613 31.09845.203 1.00 56.69 25 ATOM 319 0 LEUA 39 53.043 31.75046.157 1.00 59.24 ATOM 320 N GLUA 40 51.352 30.71545.123 1.00 56.60 ATOM 321 CA GLUA 40 50.451 31.01946.216 1.00 58.75 ATOM 322 CB GLUA 40 49.617 32.25145.920 1.00 59.61 ATOM 323 CG GLUA 40 50.426 33.52045.821 1.00 65.69 ATOM 324 CD GI~UA 40 49.547 34.75245.683 1.00 69.26 ATOM 325 OE1 GLUA 40 48.747 34.81244.715 1.00 72.53 ATOM 326 OE2 GLUA 40 49.655 35.65946.543 1.00 69.31 ATOM 327 C GLUA 40 49.534 29.86346.448 1.00 60.49 ATOM 328 0 GLUA 40 49.006 29.27545.509 1.00 62.83 35 ATOM 329 N VALA 41 49.348 29.52547.710 1.00 60.13 ATOM 330 CA VALA 41 48.474 28.43148.049 1.00 60.14 ATOM 331 CB VALA 41 49.292 27.23048.576 1.00 59.98 ATOM 332 CG1 VALA 41 48.376 26.18549.146 1.00 59.73 ATOM 333 CG2 VALA 41 50.118 26.63247.444 1.00 59.26 ATOM 334 C VALA 41 47.510 28.93449.109 1.00 60.58 ATOM 335 0 VALA 41 47.864 29.79349.934 1.00 61.24 ATOM 336 N ASNA 42 46.283 28.42849.059 1.00 59.54 ATOM 337 CA ASNA 42 45.26'7 28.80650.024 1.00 60.72 ATOM 338 CB ASNA 42 44.346 29.89549.463 1.00 59.36 45 ATOM 339 CG ASNA 42 43.473 30.53050.533 1.00 59.07 ATOM 340 OD1 ASNA 42 42.811 29.83551.303 1.00 60.43 ATOM 341 ND2 ASNA 42 43.46? 31.85650.582 1.00 57.17 ATOM 342 C ASNA 42 44.474 27.53550.286 1.00 62.57 ATOM 343 0 ASNA 42 43.654 27.10749.460 1.00 62.42 ATOM 344 N GLUA 43 44.731 26.92151.435 1.00 63.02 ATOM 345 CA GLUA 43 44.045 25.69551.792 1.00 62.62 ATOM 346 CB GLUA 43 44.772 25.00452.942 1.00 65.20 ATOM 347 CG GLUA 43 44.206 23.64253.253 1.00 67.62 ATOM 348 CD GI~UA 43 45.088 22.82754.174 1.00 69.40 55 ATOM 349 OE1 GLUA 43 44.628 21.73954.581 1.00 71.48 ATOM 350 OE2 GLUA 43 46.2.28 23.25654.479 1.00 67.83 ATOM 351 C GI~UA 43 42.595 25.95952.169 1.00 61.53 ATOM 352 0 GLUA 43 41.755 25.05852.086 1.00 59.68 ATOM 353 N ILEA 44 42.309 27.19752.575 1.00 60.06 ATOM 354 CA ILEA 44 40.957 27.58052.951 1.00 60.59 ATOM 355 CB II~EA 44 40.923 28.95353.632 1.00 60.98 ATOM 356 CG2 ILEA 44 39.469 29.34353.943 1.00 61.06 ATOM 357 CG1 ILEA 44 41.749 28.92154.918 1.00 61.51 ATOM 358 CD1 IL~EA 44 41.119 28.11756.022 1.00 61.37 ATOM 359 C ILEA 44 40.069 27.66051.718 1.00 61.06 'rJATOM 360 0 ILEA 44 38.942 27.14851.708 1.00 61.53 ATOM 361 N THRA 45 40.581 28.30250.674 1.00 60.25 ATOM 362 CA THRA 45 39.826 28.46449.426 1.00 58.34 ATOM 363 CB THRA 45 40.086 29.84448.805 1.00 58.12 ATOM 364 OG1 THRA 45 41.492. 29.99248.535 1.00 58.85 1~ ATOM 365 CG2 THRA 45 39.632 30.93449.762 1.00 56.98 ATOM 366 C TI-tRA 45 40.139 27.40748.374 1.00 56.43 ATOM 367 0 THRA 45 39.465 27.32847.349 1.00 54.64 ATOM 368 N ASNA 46 41.169 26.60748.620 1.00 55.73 ATOM 369 CA ASNA 46 41.534 25.56347.677 1.00 56.27 ATOM 370 CB ASNA 46 40.39() 24.55747.560 1.00 55.82 ATOM 371 CG A:>NA 46 40.61<? 23.32748.412 1.00 56.92 ATOM 372 OD1 ASNA 46 39.671 22.62148.746 1.00 55.85 ATOM 373 ND2 ASNA 46 41.866 23.05848.754 1.00 54.55 ATOM 374 C ASNA 46 41.869 26.12746.299 1.00 56.62 20 ATOM 375 0 ASNA 46 41.350 25.65945.283 1.00 58.80 ATOM 376 N GLUA 47 42.744 27.13046.275 1.00 54.91 ATOM 377 CA GLUA 47 43.156 27.76645.044 1.00 52.39 ATOM 378 CB GLUA 47 42.606 29.18344.999 1.00 50.63 ATOM 379 CG GLUA 47 41.107 29.24744.938 1.00 48.77 25 ATOM 380 CD GLUA 47 40.601 30.67544.951 1.00 53.28 ATOM 381 OE1 GLUA 47 41.37() 31.57744.568 1.00 51.68 ATOM 382 OE2 GI~UA 47 39.429 30.90245.333 1.00 58.43 ATOM 383 C GLUA 47 44.671 27.77644.979 1.00 52.87 ATOM 384 0 GLUA 47 45.347 28.00945.981 1.00 53.20 ATOM 385 N VALA 48 45.208 27.51343.797 1.00 53.53 ATOM 386 CA VALA 48 46.656 27.48143.619 1.00 53.36 ATOM 387 CB VALA 48 47.14'7 26.04343.318 1.00 53.31 ATOM 388 CG1 VALA 48 48.646 26.02943.122 1.00 55.73 ATOM 389 CG2 VALA 48 46.781 25.13044.456 1.00 52.72 35 ATOM 390 C VALA 48 47.108 28.39042.484 1.00 52.90 ATOM 391 0 VALA 48 46.441 28.50441.454 1.00 54.54 ATOM 392 N ASPA 49 48.24'? 29.04642.691 1.00 52.21 ATOM 393 CA ASPA 49 48.818 29.92841.692 1.00 51.57 ATOM 394 CB ASPA 49 49.084 31.29142.304 1.00 52.64 ATOM 395 CG ASPA 49 49.264 32.35241.268 1.00 53.86 ATOM 396 OD1 ASPA 49 49.900 32.05140.246 1.00 54.56 ATOM 397 OD2 ASPA 49 48.779 33.48241.474 1.00 57.00 ATOM 398 C ASPA 49 50.121 29.24141.313 1.00 50.45 ATOM 399 0 ASPA 49 51.074 29.25442.075 1.00 52.15 45 ATOM 400 N VALA 50 50.155 28.63640.135 1.00 49.83 ATOM 401 CA VALA 50 51.329 27.89339.711 1.00 49.77 ATOM 402 CB VALA 50 50.992 26.37239.723 1.00 51.61 ATOM 403 CG1 VALA 50 50.095 26.01538.531 1.00 51.90 ATOM 404 CG2 VALA 50 52.265 25.53939.721 1.00 53.03 ATOM 405 C VALA 50 51.890 28.29038.335 1.00 49.01 ATOM 406 0 VALA 50 51.193 28.87837.508 1.00 50.33 ATOM 407 N VALA 51 53.163 27.97438.117 1.00 46.39 ATOM 408 CA VALA 51 53.863 28.24536.861 1.00 45.41 ATOM 409 CB VALA 51 55.111 29.13437.083 1.00 43.93 55 ATOM 410 CG1 VALA 51 55.943 29.18235.807 1.00 42.09 ATOM 411 CG2 VALA 51 54.696 30.53637.497 1.00 41.05 ATOM 412 C VALA 51 54.336 26.89936.291 1.00 46.83 ATOM 413 0 VALA 51 54.879 26.06337.016 1.00 47.95 ATOM 414 N PHEA 52 54.147 26.68434.996 1.00 45.38 ATOM 415 CA PHEA 52 54.560 25.42334.402 1.00 44.58 ATOM 416 CB PHEA 52 53.485 24.37334.662 1.00 44.09 ATOM 417 CG PHE A 52 52.15.5 24.718 34.0681.00 43.27 ATOM 418 CD1 PHE A 52 51.857 24.393 32.7581.00 42.79 ATOM 419 CD2 PHE A 52 51.211 25.411 34.8051.00 45.35 ATOM 420 CE1 PHE A 52 50.643 24.755 32.1941.00 41.86 'rJATOM 421 CE2 PHE A 52 49.991 25.776 34.2401.00 45.03 ATOM 422 CZ PHE A 52 49.712 25.445 32.9331.00 41.04 ATOM 423 C PHE A 52 54.789 25.547 32.9061.00 45.52 ATOM 424 0 PHE A 52 54.403 26.536 32.2881.00 46.49 ATOM 425 N TRP A 53 55.431 24.541 32.3281.00 45.07 1~ ATOM 426 CA TRP A 53 55.662 24.527 30.8981.00 46.61 ATOM 427 CB TRP A 53 57.043 24.000 30.5731.00 48.36 ATOM 428 CG TRP A 53 58.137 24.899 30.9831.00 50.29 ATOM 429 CD2 TRP A 53 59.531 24.604 30.9421.00 50.34 ATOM 430 CE2 TRP A 53 60.213 25.755 31.3861.00 51.89 15 ATOM 431 CE3 TRP A 53 60.274 23.473 30.5701.00 52.05 ATOM 432 CD1 TRP A 53 58.024 26.175 31.4361.00 50.84 ATOM 433 NE1 TRP A 53 59.267 26.700 31.6821.00 52.12 ATOM 434 CZ2 TRP A 53 61.605 25.817 31.4701.00 53.79 ATOM 435 CZ3 TRP A 53 61.660 23.527 30.6491.00 53.82 ATOM 436 CH2 TRP A 53 62.314 24.697 31.0991.00 55.14 ATOM 437 C TRP A 53 54.644 23.599 30.2851.00 47.55 ATOM 438 0 TRP A 53 54.645 22.410 30.5641.00 49.29 ATOM 439 N GLN A 54 53.765 24.139 29.4571.00 47.91 ATOM 440 CA GLN A 54 52.765 23.312 28.8251.00 48.38 25 ATOM 441 CB GLN A 54 51.517 24.132 28.5291.00 47.98 ATOM 442 CG GLN A 54 50.322 23.309 28.0951.00 50.36 ATOM 443 CD GLN A 54 49.001 24.016 28.3751.00 54.00 ATOM 444 OE1 GLN A 54 48.697 24.360 29.5151.00 53.48 ATOM 445 NE2 GLN A 54 48.209 24.231 27.3351.00 57.12 30 ATOM 446 C GLN A 54 53.378 22.755 27.5551.00 49.13 ATOM 447 0 GLN A 54 53.095 23.203 26.4531.00 50.86 ATOM 448 N GLN A 55 54.251 21.779 ?.7.7381.00 50.50 ATOM 449 CA GLN A 55 54.937 21.122 2.6.6411.00 52.90 ATOM 450 CB GLN A 55 55.995 20.200 27.2341.00 58.12 35 ATOM 451 CG GLN A 55 56.699 19.288 26.2631.00 66.05 ATOM 452 CD GLN A 55 57.909 18.634 26.9071.00 71.07 ATOM 453 OEl GLN A 55 57.890 18.307 28.1071.00 73.93 ATOM 454 NE2 GLN A 55 58.969 18.442 26.1231.00 72.99 ATOM 455 C G~N A 55 53.939 20.353 25.7741.00 51.30 ATOM 456 0 GIN A 55 53.451 19.293 26.1511.00 50.67 ATOM 457 N THR A 56 53.648 20.907 24.6041.00 49.14 ATOM 458 CA THR A 56 52.690 20.325 23.6841.00 46.69 ATOM 459 CB THR A 56 51.597 21.347 23.3421.00 45.67 ATOM 460 OG1 THR A 56 51.138 21.969 24.5411.00 45.84 45 ATOM 461 CG2 THR A 56 50.426 20.673 22.6661.00 45.93 ATOM 462 C THR A 56 53.344 19.878 22.3891.00 46.05 ATOM 463 O THR A 56 54.286 20.503 21.9171.00 46.13 ATOM 464 N THR A 57 52.836 18.796 21.8121.00 44.22 ATOM 465 CA THR A 57 53.384 18.286 20.5691.00 44.65 'Jr~ATOM 466 CB THR A 57 54.511 17.270 20.8231.00 44.59 ATOM 467 OG1 THR A 57 55.593 17.914 21.4991.00 42.38 ATOM 468 CG2 THR A 57 55.036 16.733 19.5121.00 49.11 ATOM 469 C THR A 57 52.316 17.627 19.7211.00 43.97 ATOM 470 0 THR A 57 51.377 17.039 20.2391.00 44.62 55 ATOM 471 N TRP A 58 52.452 17.753 18.4101.00 42.72 ATOM 472 CA TRP A 58 51.502 17.153 17.4891.00 44.75 ATOM 473 CB TRP A 58 50.139 17.883 17.5291.00 42.24 ATOM 474 CG TRP A 58 50.130 19.267 16.9671.00 40.43 ATOM 475 CD2 TRP A 58 50.427 20.473 17.6681.00 39.55 ATOM 476 CE2 TRP A 58 50.354 21.521 16.7351.00 41.08 ATOM 477 CE3 TRP A 58 50.755 20.770 18.9951.00 36.98 ATOM 478 CD1 TRPA 58 49.887 19.62415.677 1.00 39.98 ATOM 479 NE1 TRPA 58 50.019 20.97115.527 1.00 41.55 ATOM 480 CZ2 TRPA 58 50.599 22.85017.084 1.00 40.32 ATOM 481 CZ3 TRPA 58 50.997 22.08119.341 1.00 37.03 'rJATOM 482 CH2 TRPA 58 50.919 23.10918.389 1.00 38.53 ATOM 483 C TRPA 58 52.112 17.18416.098 1.00 47.09 ATOM 484 0 TRPA 58 53.226 17.67515.915 1.00 47.06 ATOM 485 N SERA 59 51.390 16.67015.115 1.00 48.64 ATOM 486 CA SERA 59 51.933 16.63113.782 1.00 50.92 1~ ATOM 487 CB SERA 59 52.245 15.18713.435 1.00 53.25 ATOM 488 OG SERA 59 53.191 15.10912.389 1.00 62.80 ATOM 489 C SERA 59 51.020 17.22912.735 1.00 52.80 ATOM 490 0 SERA 59 49.828 16.94212.696 1.00 53.05 ATOM 491 N ASPA 60 51.602. 18.06511.881 1.00 55.45 15 ATOM 492 CA ASPA 60 50.881 18.72110.792 1.00 57.44 ATOM 493 CB ASPA 60 50.747. 20.22111.071 1.00 57.33 ATOM 494 CG ASPA 60 49.856 20.93610.058 1.00 57.43 ATOM 495 OD1 ASPA 60 49.776 20.4868.896 1.00 57.47 ATOM 496 OD2 ASPA 60 49.256 21.96710.424 1.00 56.76 20 ATOM 497 C ASPA 60 51.726 18.5109.541 1.00 59.20 ATOM 498 0 ASPA 60 52.679 19.2459.304 1.00 58.82 ATOM 499 N ARGA 61 51.372 17.5038.748 1.00 61.30 ATOM 500 CA ARGA 61 52.115 17.1817.533 1.00 63.09 ATOM 501 CB ARGA 61 51.643 15.8456.958 1.00 67.23 25 ATOM 502 CG ARGA 61 52.191 14.5947.653 1.00 72.92 ATOM 503 CD AF~GA 61 51.883 13.3556.786 1.00 81.01 ATOM 504 NE ARGA 61 52.44".~ 12.0917.291 1.00 85.79 ATOM 505 CZ ARGA 61 52.320 10.9176.660 1.00 87.50 ATOM 506 NH1 ARGA 61 51.665 10.8435.501 1.00 88.31 ATOM 507 NH2 ARGA 61 52.852 9.815 7.179 1.00 87.74 ATOM 508 C ARGA 61 52.073 18.2386.430 1.00 61.94 ATOM 509 0 AF;GA 61 52.92'7 18.2255.550 1.00 61.39 ATOM 510 N TFIRA 62 51.095 19.1416.461 1.00 60.78 ATOM 511 CA THRA 62 51.017 20.1755.434 1.00 59.76 35 ATOM 512 CB THRA 62 49.666 20.9525.483 1.00 60.01 ATOM 513 OG1 THRA 62 49.582 21.7206.689 1.00 62.71 ATOM 514 CG2 TFFRA 62 48.500 20.0005.442 1.00 59.86 ATOM 515 C THRA 62 52.17'? 21.1715.616 1.00 58.73 ATOM 516 0 THRA 62 52.40() 22.0444.774 1.00 59.33 ATOM 517 N LEUA 63 52.898 21.0316.720 1.00 56.50 ATOM 518 CA LEUA 63 54.029 21.9037.020 1.00 55.97 ATOM 519 CB LEUA 63 54.088 22.2058.521 1.00 53.19 ATOM 520 CG LEUA 63 52.866 22.8379.174 1.00 52.76 ATOM 521 CD1 LF~UA 63 53.074 22.90910.672 1.00 51.73 45 ATOM 522 CD2 LEUA 63 52.629 24.2178.589 1.00 53.34 ATOM 523 C LEUA 63 55.351 21.2646.603 1.00 55.80 ATOM 524 0 LEUA 63 56.366 21.9476.509 1.00 54.36 ATOM 525 N AI~AA 64 55.332 19.9526.368 1.00 56.30 ATOM 526 CA ALAA 64 56.532 19.2075.987 1.00 56.99 ATOM 527 CB ALAA 64 56.194 17.7445.810 1.00 54.20 ATOM 528 C AI~AA 64 57.176 19.7454.715 1.00 59.20 ATOM 529 0 ALAA 64 56.48'7 20.2243.816 1.00 60.08 ATOM 530 N TRPA 65 58.502 19.6464.651 1.00 60.65 ATOM 531 CA TRPA 65 59.295 20.1043.506 1.00 62.47 55 ATOM 532 CB TRPA 65 59.623 21.5883.667 1.00 59.37 ATOM 533 CG TRPA 65 60.773 21.8704.613 1.00 56.94 ATOM 534 CD2 TRPA 65 60.685 22.1676.020 1.00 56.89 ATOM 535 CE2 TRPA 65 62.001 22.4246.475 1.00 55.08 ATOM 536 CE3 TRPA 65 59.622 22.2456.938 1.00 54.01 ATOM 537 CD1 TRPA 65 62.097 21.9474.292 1.00 55.45 ATOM 538 NE1 TRPA 65 62.838 22.2825.400 1.00 53.98 gl ATOM 539 CZ2 TRPA 65 62.286 22.757 7.808 1.00 52.03 ATOM 540 CZ3 TRPA 65 59.910 22.577 8.266 1.00 53.82 ATOM 541 CH2 TRPA 65 61.232 22.829 8.684 1.00 51.71 ATOM 542 C TRPA 65 60.603 19.297 3.445 1.00 65.72 ATOM 543 0 TRPA 65 61.091. 18.825 4.479 1.00 66.89 ATOM 544 N ASNA 66 61.181. 19.138 2.255 1.00 68.69 ATOM 545 CA ASNA 66 62.431 18.371 2.149 1.00 71.84 ATOM 546 CB ASNA 66 62.735 17.983 0.689 1.00 73.23 ATOM 547 CG ASNA 66 63.968 17.084 0.568 1.00 76.18 ATOM 548 OD1 ASNA 66 64.473 16.822 -0.5411.00 76.68 ATOM 549 ND2 ASNA 66 64.463 16.606 1.715 1.00 76.39 ATOM 550 C ASNA 66 63.581 19.199 2.723 1.00 71.96 ATOM 551 0 ASNA 66 63.902 20.279 2.217 1.00 72.02 ATOM 552 N SERA 67 64.197 18.690 3.784 1.00 72.09 ATOM 553 CA SERA 67 65.29?. 19.403 4.435 1.00 72.65 ATOM 554 CB SERA 67 65.063 19.425 5.943 1.00 72.61 ATOM 555 OG SERA 67 64.969 18.105 6.449 1.00 70.09 ATOM 556 C SE;RA 67 66.655 18.794 4.177 1.00 73.27 ATOM 557 0 SERA 67 67.576 19.031 4.961 1.00 72.43 ATOM 558 N SERA 68 66.799 18.026 3.097 1.00 74.60 ATOM 559 CA SERA 68 68.082 17.370 2.825 1.00 76.38 ATOM 560 CB SERA 68 68.006 16.490 1.564 1.00 75.57 ATOM 561 OG SERA 68 67.870 17.265 0.386 1.00 75.20 ATOM 562 C SERA 68 69.222 18.380 2.707 1.00 77.15 ATOM 563 0 SERA 68 70.288 18.201 3.300 1.00 77.04 ATOM 564 N HISA 69 68.992 19.451 1.962 1.00 78.21 ATOM 565 CA HISA 69 70.015 20.479 1.804 1.00 79.62 ATOM 566 CB HISA 69 70.445 20.578 0.341 1.00 84.04 ATOM 567 CG HISA 69 71.00'7 19.302 -0.1961.00 88.01 ATOM 568 CD2 HISA 69 72.208 19.022 -0.7591.00 89.20 ATOM 569 ND1 HISA 69 70.332 18.100 -0.1101.00 89.31 ATOM 570 CE1 HISA 69 71.096 17.133 -0.5891.00 90.18 ATOM 571 NE2 H'~SA 69 72.240 17.666 -0.9881.00 90.99 ATOM 572 C HISA 69 69.441 21.799 2.279 1.00 77.78 ATOM 573 0 HISA 69 69.47:3 22.803 1.561 1.00 77.92 ATOM 574 N SERA 70 68.896 21.766 3.496 1.00 75.27 ATOM 575 CA SERA 70 68.300 22.931 4.141 1.00 72.21 ATOM 576 CB SERA 70 67.01:3 23.316 3.421 1.00 72.74 ATOM 577 OG SERA 70 66.368 22.158 2.919 1.00 74.05 ATOM 578 C SERA 70 68.03:L 22.563 5.595 1.00 69.35 ATOM 579 0 SERA 70 68.138 21.384 5.962 1.00 70.38 ATOM 580 N PROA 71 67.710 23.563 6.450 1.00 66.44 ATOM 581 CD PROA 71 67.81.9 24.998 6.134 1.00 64.03 ATOM 582 CA PROA 71 67.422 23.385 7.883 1.00 64.80 ATOM 583 CB PROA 71 67.106 24.805 8.334 1.00 63.49 ATOM 584 CG PROA 71 68.031 25.608 7.498 1.00 61.83 ATOM 585 C PROA 71 66.295 22.395 8.223 1.00 63.99 ATOM 586 0 PROA 71 65.314 22.289 7.496 1.00 63.63 ATOM 587 N ASPA 72 66.434 21.679 9.333 1.00 63.39 ATOM 588 CA ASPA 72 65.424 20.701 9.734 1.00 63.43 ATOM 589 CB ASPA 72 66.056 19.634 10.6171.00 65.69 ATOM 590 CG ASPA 72 67.229 18.974 9.959 1.00 70.53 ATOM 591 OD1 ASPA 72 66.985 18.216 8.988 1.00 73.68 ATOM 592 OD2 A:3PA 72 68.389 19.218 1Ø3901.00 71.00 ATOM 593 C AS A 72 64.307 21.356 10.5201.00 62.20 ATOM 594 0 ASPA 72 63.164 20.878 10.5201.00 61.88 ATOM 595 N GLNA 73 64.653 22.457 11.1751.00 59.83 ATOM 596 CA GLNA 73 63.738 23.186 12.0411.00 59.45 ATOM 597 CB GLNA 73 64.083 22.901 13.4891.00 60.33 ATOM 598 CG GLNA 73 63.720 21.569 14.0351.00 63.59 ATOM 599 CD GLNA 73 64.224 21.462 15.4591.00 68.15 -g2 ATOM 600 OE1 GLNA 73 65.425 21.59515.699 1.00 70.618 ATOM 601 NE2 GLNA 73 63.316 21.24916.416 1.00 69.737 ATOM 602 C GLNA 73 63.779 24.70311.886 1.00 57.046 ATOM 603 0 GLNA 73 64.798 25.28011.490 1.00 58.198 'rJATOM 604 N VALA 74 62.670 25.33612.243 1.00 52.687 ATOM 605 CA VALA 74 62.557 26.78212.211 1.00 50.246 ATOM 606 CB VALA 74 62.036 27.27910.859 1.00 48.706 ATOM 607 CG1 VALA 74 63.066 27.0349.794 1.00 49.746 ATOM 608 CG2 VALA 74 60.738 26.58410.515 1.00 47.986 1~ ATOM 609 C VALA 74 61.580 27.20113.310 1.00 49.746 ATOM 610 0 VALA 74 60.756 26.40113.754 1.00 48.968 ATOM 611 N SERA 75 61.691 28.44213.769 1.00 47.627 ATOM 612 CA SERA 75 60.792 28.95414.787 1.00 44.066 ATOM 613 CB SERA 75 61.525 29.90215.728 1.00 44.676 15 ATOM 614 OG SERA 75 62.241 29.18816.710 1.00 46.378 ATOM 615 C SERA 75 59.668 29.68814.084 1.00 43.076 ATOM 616 0 SERA 75 59.894 30.65713.358 1.00 42.118 ATOM 617 N VALA 76 58.451 29.21414.307 1.00 42.717 ATOM 618 CA VALA 76 57.272 29.79213.687 1.00 43.336 2~ ATOM 619 CB VALA 76 56.482 28.71112.936 1.00 44.346 ATOM 620 CG1 VALA 76 55.247 29.31512.298 1.00 44.976 ATOM 621 CG2 VALA 76 57.359 28.05811.894 1.00 43.126 ATOM 622 C VALA 76 56.335 30.43614.704 1.00 44.166 ATOM 623 0 VALA 76 56.093 29.88215.773 1.00 45.898 25 ATOM 624 N PROA 77 55.798 31.62414.388 1.00 43.197 ATOM 625 CD PROA 77 56.162 32.55613.311 1.00 41.246 ATOM 626 CA PR.OA 77 54.884 32.26615.334 1.00 41.496 ATOM 627 CB PROA 77 54.619 33.61514.691 1.00 41.136 ATOM 628 CG PR.OA 77 55.886 33.88413.950 1.00 41.896 ATOM 629 C PR.OA 77 53.617 31.43915.453 1.00 40.826 ATOM 630 0 PROA 77 53.112 30.91914.471 1.00 39.558 ATOM 631 N IL~EA 78 53.116 31.31816.671 1.00 42.427 ATOM 632 CA IL,EA 78 51.908 30.55616.959 1.00 42.146 ATOM 633 CB ILEA 78 51.526 30.75118.441 1.00 42.096 35 ATOM 634 CG2 ILEA 78 50.105 30.35718.712 1.00 43.536 ATOM 635 CG1 II~EA 78 52.464 29.92119.285 1.00 43.226 ATOM 636 CDl ILEA 78 52.585 28.51318.784 1.00 43.926 ATOM 637 C II~EA 78 50.749 30.94216.057 1.00 43.586 ATOM 638 0 II~EA 78 49.98'.> 30.09615.624 1.00 45.648 ATOM 639 N SERA 79 50.642 32.22915.768 1.00 43.797 ATOM 640 CA SERA 79 49.588 32.76714.918 1.00 44.386 ATOM 641 CB SERA 79 49.666 34.29214.934 1.00 44.816 ATOM 642 OG SERA 79 50.972 34.73214.584 1.00 45.888 ATOM 643 C SERA 79 49.590 32.29513.465 1.00 43.506 45 ATOM 644 0 SERA 79 48.60'7 32.49812.758 1.00 42.808 ATOM 645 N SERA 80 50.685 31.68313.016 1.00 42.627 ATOM 646 CA SERA 80 50.774 31.21611.639 1.00 42.846 ATOM 647 CB SERA 80 52.137 31.55511.043 1.00 44.686 ATOM 648 OG SERA 80 52.308 32.95610.932 1.00 51.598 ATOM 649 C SERA 80 50.534 29.72611.502 1.00 44.696 ATOM 650 0 SERA 80 50.596 29.18410.402 1.00 43.978 ATOM 651 N LEUA 81 50.248 29.06812.620 1.00 45.137 ATOM 652 CA LEUA 81 50.003 27.63112.631 1.00 41.196 ATOM 653 CB LEUA 81 51.061 26.92613.467 1.00 39.926 55 ATOM 654 CG LEUA 81 52.534 27.16713.185 1.00 41.526 ATOM 655 CD1 LEUA 81 53.356 26.67714.355 1.00 39.706 ATOM 656 CD2 LEUA 81 52.922 26.46411.918 1.00 42.526 ATOM 657 C LEUA 81 48.672 27.34013.272 1.00 39.476 ATOM 658 0 LEUA 81 48.089 28.19713.921 1.00 40.218 ATOM 659 N TRPA 82 48.191 26.12213.081 1.00 38.467 ATOM 660 CA TRPA 82 46.965 25.69413.720 1.00 37.326 ATOM 661 CB TRP 82 46.346 24.49413.006 1.00 36.836 A

ATOM 662 CG TRP 82 45.274 23.81813.829 1.00 40.606 A

ATOM Ei63 CD2 TRF? 82 45.459 22.74114.757 1.00 39.636 A

ATOM 664 CE2 TRP 82 44.213 22.49915.369 1.00 38.336 A

ATOM ti65 CE3 TRP 82 46.560 21.96115.132 1.00 40.546 A

ATOM 666 CD1 TRP 82 43.948 24.17013.914 1.00 39.436 A

ATOM 667 NE1 TRP 82 43.311 23.38314.839 1.00 39.007 A

ATOM 668 CZ2 TRP 82 44.040 21.51116.332 1.00 38.946 A

ATOM 669 CZ3 TRP 82 46.388 20.98216.088 1.00 39.996 A

1~ ATOM 670 CH2 TRP 82 45.135 20.76416.678 1.00 39.886 A

ATOM 671 C TRP 82 47.485 25.24115.064 1.00 36.996 A

ATOM 672 0 TRP 82 48.559 24.66115.142 1.00 38.938 A

ATOM 673 N VAL 83 46.744 25.50316.123 1.00 37.437 A

ATOM 674 CA VAL 83 47.179 25.08617.437 1.00 37.486 A

15 ATOM 675 CB VAL 83 47.729 26.30018.209 1.00 37.406 A

ATOM 676 CG1 VAL 83 47.901 25.98419.655 1.00 43.516 A

ATOM 677 CG2 VAL 83 49.054 26.68817.644 1.00 37.346 A

ATOM 678 C VAL 83 46.011 24.43718.175 1.00 39.746 A

ATOM 679 0 VAL 83 44.858 24.82317.997 1.00 42.508 A

ATOM 680 N PRO 84 46.290 23.40818.982 1.00 39.547 A

ATOM 681 CD PRO 84 47.594 22.74519.134 1.00 41.226 A

ATOM 682 CA PRO 84 45.263 22.70119.752 1.00 38.546 A

ATOM 683 CB PRO 84 46.079 21.69020.558 1.00 39.946 A

ATOM 684 CG PRO 84 47.202 21.38119.663 1.00 41.426 A

25 ATOM 685 C PRO 84 44.509 23.66320.658 1.00 36.096 A

ATOM 686 0 PRO 84 45.121 24.46921.342 1.00 35.578 A

ATOM 687 N ASP 85 43.186 23.57620.668 1.00 32.887 A

ATOM 688 CA ASP 85 42.397 24.45821.505 1.00 34.366 A

ATOM 689 CB ASP 85 41.014 24.66820.898 1.00 35.146 A

ATOM 690 CG ASP 85 40.268 23.38120.696 1.00 37.786 A

ATOM 691 ODl ASP 85 40.897 22.38820.290 1.00 40.248 A

ATOM 692 OD2 ASP 85 39.050 23.36720.927 1.00 37.658 A

ATOM 693 C ASP 85 42.277 23.90622.910 1.00 35.336 A

ATOM 694 O A5P 85 41.180 23.72623.420 1.00 38.828 A

ATOM 695 N LEU 86 43.418 23.64423.528 1.00 32.247 A

ATOM 696 CA LE:U 86 43.459 23.10624.869 1.00 35.186 A

ATOM 697 CB LEU 86 44.878 22.67025.208 1.00 34.636 A

ATOM 698 CG LEU 86 45.435 21.58524.311 1.00 35.366 A

ATOM 699 CD1 LEU 86 46.842 21.24124.749 1.00 34.846 A

ATOM 700 CD2 LEU 86 44.530 20.37624.386 1.00 35.686 A

ATOM 701 C LEU 86 42.973 24.08625.925 1.00 36.016 A

ATOM 702 0 LEU 86 43.141 25.28325.800 1.00 37.758 A

ATOM 703 N ALA 87 42.378 23.55626.979 1.00 38.037 A

ATOM 704 CA ALA 87 41.870 24.36928.060 1.00 38.296 A

45 ATOM 705 CB ALA 87 40.428 24.67427.811 1.00 36.176 A

ATOM 706 C ALA 87 42.022 23.60529.371 1.00 41.086 A

ATOM 707 0 ALA 87 41.798 22.39929.407 1.00 43.908 A

ATOM 708 N AI~A 88 42.431 24.29030.436 1.00 39.687 A

ATOM 709 CA ALA 88 42.558 23.63931.726 1.00 38.376 A

ATOM 710 CB ALA 88 43.586 24.33732.571 1.00 34.886 A

ATOM 711 C ALA 88 41.180 23.72932.376 1.00 40.656 A

ATOM 712 0 ALA 88 40.778 24.78032.847 1.00 40.298 A

ATOM 713 N TYR 89 40.460 22.61332.371 1.00 42.497 A

ATOM 714 CA TYR 89 39.116 22.50232.934 1.00 44.246 A

55 ATOM 715 CB TYR 89 38.727 21.02333.052 1.00 46.706 A

ATOM 716 CG TYR 89 38.641 20.28631.725 1.00 51.626 A

ATOM 717 CD1 89 38.462 18.90231.684 1.00 54.356 TYR
A

ATOM 718 CE1 89 38.353 18.22230.466 1.00 56.336 TYR
A

ATOM 719 CD2 89 38.711 20.96830.511 1.00 51.866 TYR
A

ATOM 720 CE2 89 38.604 20.29729.302 1.00 53.716 TYR
A

ATOM 721 CZ TYR 89 38.424 18.92729.286 1.00 6 A 55.54 ATOM 722 OH TYRA 89 38.296 18.25728.093 1.00 59.35 ATOM 723 C TYRA 89 38.888 23.18534.280 1.00 43.81 ATOM 724 0 TYRA 89 37.808 23.73534.518 1.00 41.70 ATOM 725 N ASNA 90 39.880 23.14935.167 1.00 43.90 ATOM 726 CA ASNA 90 39.709 23.78136.473 1.00 43.12 ATOM 727 CB ASNA 90 39.976 22.77037.598 1.00 40.92 ATOM 728 CG ASNA 90 41.340 22.15637.517 1.00 42.04 ATOM 729 OD1 ASNA 90 41.770 21.72136.456 1.00 43.62 ATOM 730 ND2 ASNA 90 42.033 22.10238.646 1.00 43.25 1~ ATOM 731 C ASNA 90 40.550 25.04236.655 1.00 44.35 ATOM 732 0 ASNA 90 40.881 25.43437.769 1.00 46.42 ATOM 733 N ALAA 91 40.902 25.67335.543 1.00 45.44 ATOM 734 CA ALAA 91 41.660 26.91235.591 1.00 45.36 ATOM 735 CB ALAA 91 42.130 27.30834.206 1.00 44.43 ATOM 736 C ALAA 91 40.680 27.94036.136 1.00 45.00 ATOM 737 0 ALAA 91 39.522 28.00035.729 1.00 43.71 ATOM 738 N IL~EA 92 41.164 28.75037.064 1.00 46.47 ATOM 739 CA ILEA 92 40.359 29.75337.734 1.00 46.18 ATOM 740 CB IL~EA 92 40.674 29.67339.232 1.00 47.56 ATOM 741 CG2 ILEA 92 41.595 30.79739.634 1.00 50.92 ATOM 742 CG1 ILEA 92 39.409 29.71340.055 1.00 50.52 ATOM 743 CD1 IL~EA 92 39.711 29.79541.547 1.00 51.82 ATOM 744 C ILEA 92 40.659 31.15737.177 1.00 45.80 ATOM 745 0 ILEA 92 39.996 32.13437.518 1.00 45.79 25 ATOM 746 N SERA 93 41.666 31.23736.317 1.00 44.40 ATOM 747 CA SERA 93 42.076 32.48335.687 1.00 41.89 ATOM 748 CB SERA 93 43.248 33.08036.445 1.00 40.83 ATOM 749 OG SE;RA 93 44.400 32.27536.274 1.00 37.97 ATOM 750 C SERA 93 42.541 32.11234.295 1.00 42.18 ATOM 751 O SE;RA 93 42.762 30.94234.023 1.00 41.06 ATOM 752 N LYSA 94 42.693 33.08133.401 1.00 43.27 ATOM 753 CA LYSA 94 43.178 32.71232.077 1.00 45.47 ATOM 754 CB LYSA 94 42.703 33.68030.988 1.00 44.26 ATOM 755 CG LYSA 94 42.747 35.14231.314 1.00 44.49 35 ATOM 756 CD LYSA 94 41.907 35.91830.309 1.00 46.66 ATOM 757 CE LYSA 94 42.209 35.47028.885 1.00 47.75 ATOM 758 NZ LYSA 94 41.443 36.23727.873 1.00 49.19 ATOM 759 C LYSA 94 44.688 32.59232.089 1.00 43.67 ATOM 760 0 LA'SA 94 45.359 33.10232.980 1.00 44.46 4~ ATOM 761 N PROA 95 45.243 31.88931.105 1.00 43.23 ATOM 762 CD PROA 95 44.559 31.19930.004 1.00 41.03 ATOM 763 CA PROA 95 46.692 31.69531.024 1.00 42.80 ATOM 764 CB PROA 95 46.858 30.71929.862 1.00 43.77 ATOM 765 CG PROA 95 45.515 30.07829.725 1.00 43.00 45 ATOM 766 C PROA 95 47.480 32.96230.783 1.00 41.84 ATOM 767 0 PROA 95 47.178 33.72929.861 1.00 41.82 ATOM 768 N GLUA 96 48.483 33.18331.627 1.00 40.74 ATOM 769 CA GLUA 96 49.350 34.32231.472 1.00 39.25 ATOM 770 CB GLUA 96 49.704 34.96032.817 1.00 41.50 ATOM 771 CG GLUA 96 50.548 36.23532.682 1.00 46.46 ATOM 772 CD GLUA 96 50.864 36.91034.014 1.00 51.10 ATOM 773 OE1 GLUA 96 50.172 36.59135.002 1.00 55.39 ATOM 774 OE2 GLUA 96 51.784 37.77234.079 1.00 51.01 ATOM 775 C GLUA 96 50.583 33.71330.851 1.00 38.30 55 ATOM 776 0 GLUA 96 51.424 33.16931.548 1.00 37.33 ATOM 777 N VALA 97 50.662 33.77029.528 1.00 36.80 ATOM 778 CA VALA 97 51.813 33.23128.821 1.00 37.13 ATOM 779 CB VALA 97 51.514 33.09227.313 1.00 35.99 ATOM 780 CG1 VALA 97 52.704 32.48026.600 1.00 34.96 60 ATOM 781 CG2 VALA 97 50.287 32.22227.122 1.00 30.36 ATOM 782 C VALA 97 53.002 34.16029.061 1.00 37.37 ATOM 783 0 VAL A 97 52.998 35.329 28.6701.00 35.14 ATOM 784 N LEU A 98 54.022 33.619 29.7151.00 37.54 ATOM 785 CA LEU A 98 55.203 34.389 30.0701.00 39.37 ATOM 786 CB LEU A 98 55.773 33.851 31.3741.00 38.96 ATOM 787 CG LEU A 98 54.848 33.662 32.5681.00 39.17 ATOM 788 CD1LEU A 98 55.522 32.772 33.5761.00 37.89 ATOM 789 CD2LEU A 98 54.501 34.997 33.1691.00 38.95 ATOM 790 C LEU A 98 56.317 34.387 29.0331.00 41.78 ATOM 791 0 LEU A 98 57.310 35.114 29.1771.00 42.77 1~ ATOM 792 N THR A 99 56.162 33.579 27.9921.00 39.65 ATOM 793 CA THR A 99 57.199 33.471 26.9811.00 37.85 ATOM 794 CB THR A 99 57.793 32.063 27.0041.00 39.36 ATOM 795 OG1THR A 99 56.745 31.102 26.8221.00 40.29 ATOM 796 CG2TI3RA 99 58.490 31.812 28.3251.00 36.68 15 ATOM 797 C THR A 99 56.762 33.784 2.5.5591.00 37.27 ATOM 798 0 THR A 99 55.571 33.809 25.2601.00 37.48 ATOM 799 N PRO A 100 57.733 34.050 24.6661.00 35.48 ATOM 800 CD PRO A 100 59.169 34.217 24.9381.00 34.88 ATOM 801 CA PRO A 100 57.450 34.356 23.2681.00 34.86 ATOM 802 CB PRO A 100 58.825 34.308 22.6311.00 32.91 ATOM 803 CG PRO A 100 59.660 34.899 23.6741.00 33.33 ATOM 804 C PRO A 100 56.535 33.287 22.7351.00 34.32 ATOM 805 0 PRO A 100 56.748 32.110 22.9901.00 37.05 ATOM 806 N GLN A 101 55.508 33.684 22.0051.00 35.52 25 ATOM 807 CA GLN A 101 54.591 32.698 21.4831.00 38.08 ATOM 808 CB GLN A 101 53.181 33.271 21.4521.00 39.02 ATOM 809 CG GLN A 101 52.557 33.223 22.8361.00 42.77 ATOM 810 CD GLN A 101 51.356 34.102 22.9651.00 46.68 ATOM 811 OE1GLN A 101 50.383 33.943 22.2391.00 51.63 ATOM 812 NE2GLN A 101 51.408 35.045 23.9001.00 48.84 ATOM 813 C GLN A 101 55.006 32.145 20.1441.00 37.60 ATOM 814 0 GLN A 101 54.331 32.329 19.1361.00 36.16 ATOM 815 N LEU A 102 56.138 31.445 20.1771.00 38.73 ATOM 816 CA LEU A 102 56.742 30.812 19.0161.00 38.35 ATOM 817 CB LEU A 102 58.180 31.289 18.8331.00 36.63 ATOM 818 CG LEU A 102 58.411 32.792 18.7091.00 37.99 ATOM 819 CD1LEU A 102 59.890 33.054 18.5501.00 39.54 ATOM 820 CD2LEU A 102 57.650 33.343 17.5381.00 35.40 ATOM 821 C LEU A 102 56.763 29.311 19.2001.00 39.23 ATOM 822 0 LEU A 102 56.933 28.809 20.3021.00 40.34 ATOM 823 N ALA A 103 56.574 28.595 18.1041.00 40.83 ATOM 824 CA ALA A 103 56.603 27.142 18.1251.00 41.49 ATOM 825 CB ALA A 103 55.334 26.569 17.4971.00 41.49 ATOM 826 C ALA A 103 57.830 26.697 17.3371.00 42.17 45 ATOM 827 0 ALA A 103 58.472 27.484 L6.6451.00 43.45 ATOM 828 N ARG A 104 58.163 25.427 17.4531.00 43.77 ATOM 829 CA ARG A 104 59.309 24.893 16.7501.00 44.63 ATOM 830 CB ARG A 104 60.242 24.228 17.7451.00 43.89 ATOM 831 CG ARG A 104 61.621 23.992 17.2141.00 45.78 ATOM 832 CD ARG A 104 62.362 25.277 16.9501.00 43.65 ATOM 833 NE ARG A 104 63.675 24.958 16.4091.00 44.01 ATOM 834 CZ ARG A 104 64.618 25.848 16.1241.00 46.53 ATOM 835 NH1ARG A 104 64.411 27.147 16.3271.00 47.99 ATOM 836 NH2ARG A 104 65.775 25.432 15.6321.00 47.13 55 ATOM 837 C ARG A 104 58.770 23.878 15.7541.00 46.81 ATOM 838 0 ARG A 104 58.042 22.961 16.1241.00 49.12 ATOM 839 N VAL A 105 59.097 24.049 14.4821.00 47.69 ATOM 840 CA VAL A 105 58.601 23.125 13.4691.00 47.16 ATOM 841 CB VAL A 105 57.791 23.857 12.3821.00 44.84 ATOM 842 CG1VAL A 105 57.198 22.861 11.4211.00 41.16 ATOM 843 CG2VAL A 105 56.702 24.684 13.0181.00 45.42 ATOM 844 C VALA 59.731 22.35512.799 1.00 49.71 6 ATOM 845 O VALA 105 60.688 22.94612.283 1.00 48.12 8 ATOM 846 N VALA 106 59.597 21.03012.821 1.00 50.55 7 ATOM 847 CA VA:LA 106 60.571 20.12312.232 1.00 51.43 6 'rJATOM 848 CB VALA 106 60.648 18.81613.037 1.00 52.44 6 ATOM 849 CG1 VALA 106 61.828 17.98712.571 1.00 50.24 6 ATOM 850 CG2 VALA 106 60.762 19.12814.521 1.00 52.53 6 ATOM 851 C VALA 106 60.142 19.80910.805 1.00 52.38 6 ATOM 852 0 VALA 106 58.961 19.64410.536 1.00 52.65 8 1~ ATOM 853 N SERA 107 61.101 19.7189.895 1.00 52.34 7 ATOM 854 CA SERA 107 60.803 19.4478.492 1.00 54.32 6 ATOM 855 CB SERA 107 62.111 19.1857.735 1.00 55.62 6 ATOM 856 OG SERA 107 62.965 18.3168.462 1.00 60.14 8 ATOM 857 C SERA 107 59.795 18.3288.186 1.00 53.69 6 15 ATOM 858 0 SERA 107 59.191 18.3047.111 1.00 51.90 8 ATOM 859 N ASPA 108 59.598 17.4129.122 1.00 54.61 7 ATOM 860 CA ASPA 108 58.667 16.3188.890 1.00 57.15 6 ATOM 861 CB ASPA 108 59.164 15.0469.580 1.00 58.72 6 ATOM 862 CG ASPA 108 59.114 15.13411.097 1.00 61.68 6 ATOM 863 OD1 ASPA 108 59.391 16.22111.642 1.00 64.28 8 ATOM 864 OD2 ASPA 108 58.816 14.10511.747 1.00 62.23 8 ATOM 865 C ASPA 108 57.235 16.6159.320 1.00 58.57 6 ATOM 866 0 ASPA 108 56.379 15.7259.301 1.00 58.30 8 ATOM 867 N GLYA 109 56.979 17.8659.703 1.00 59.14 7 25 ATOM 868 CA GLYA 109 55.649 18.27110.116 1.00 58.25 6 ATOM 869 C GI~YA 109 55.397 18.16611.602 1.00 58.69 6 ATOM 870 0 GI~YA 109 54.273 18.37412.054 1.00 59.98 8 ATOM 871 N GLUA 110 56.423 17.82112.369 1.00 58.71 7 ATOM 872 CA GLUA 110 56.255 17.71313.813 1.00 58.33 6 ATOM 873 CB GLUA 110 57.380 16.87114.425 1.00 61.59 6 ATOM 874 CG GLUA 110 57.062 16.24215.797 1.00 66.10 6 ATOM 875 CD GLUA 110 55.913 15.21815.728 1.00 70.89 6 ATOM 876 OE1 GLUA 110 55.634 14.71014.600 1.00 70.53 8 ATOM 877 OE2 GLUA 110 55.303 14.91616.800 1.00 70.77 8 35 ATOM 878 C GLUA 110 56.293 19.13614.369 1.00 56.59 6 ATOM 879 0 GLUA 110 57.114 19.95513.941 1.00 54.81 8 ATOM 880 N VALA 111 55.392 19.42515.307 1.00 54.27 7 ATOM 881 CA VALA 111 55.310 20.74515.912 1.00 52.01 6 ATOM 882 CB VALA 111 53.949 21.41215.616 1.00 50.79 6 ATOM 883 CG1 VALA 111 53.902 22.79516.242 1.00 47.90 6 ATOM 884 CG2 VALA 111 53.718 21.48914.115 1.00 50.80 6 ATOM 885 C VALA 111 55.465 20.66617.418 1.00 51.33 6 ATOM 886 0 VALA 111 54.833 19.83018.057 1.00 50.54 8 ATOM 887 N LEUA 112 56.300 21.53917.979 1.00 49.64 7 45 ATOM 888 CA LEUA 112 56.501 21.56919.418 1.00 50.36 6 ATOM 889 CB L~UA 112 57.9"_1 21.10719.791 1.00 54.86 6 ATOM 890 CG LEUA 112 58.651 20.02018.989 1.00 59.01 6 ATOM 891 CD1 LEUA 112 57.699 18.865".8.6311.00 60.90 6 ATOM 892 CD2 LEUA 112 59.248 20.632".7.7271.00 57.28 6 50 ATOM 893 C LEUA 112 56.297 22.98019.946 1.00 49.94 6 ATOM 894 0 LEUA 112 57.004 23.89319.553 1.00 49.38 8 ATOM 895 N TYRA 113 55.323 23.15120.833 1.00 49.46 7 ATOM 896 CA TYRA 113 55.036 24.44621.437 1.00 47.23 6 ATOM 897 CB TYRA 113 53.643 24.93921.021 1.00 45.72 6 5'rJATOM 898 CG TYRA 113 53.222 26.27921.621 1.00 46.02 6 ATOM 899 CD1 A 113 54.092 27.36421.654 1.00 42.86 6 TYR

ATOM 900 CE1 TYRA 113 53.691 28.58822.179 1.00 43.03 6 ATOM 901 CD2 A 113 51.936 26.46222.131 1.00 45.25 6 TYR

ATOM 902 CE2 A 113 51.533 27.68222.653 1.00 41.00 6 TYR

ATOM 903 CZ TYRA 113 52.410 28.74022.677 1.00 42.42 6 ATOM 904 OH TYR 113 52.008 29.95223.211 1.00 42.79 8 A

ATOM 905 C TYR A113 55.097 24.250 22.9361.00 47.386 ATOM 906 0 TYR A113 54.304 23.508 23.5061.00 47.088 ATOM 907 N MET A114 56.047 24.916 23.5771.00 48.387 ATOM 908 CA MET A114 56.205 24.788 25.0151.00 48.396 ATOM 909 CB MET A114 57.485 24.020 25.3041.00 52.096 ATOM 910 CG MET A114 57.675 23.679 26.7391.00 59.106 ATOM 911 SD MET A114 59.383 23.282 26.9251.00 67.2016 ATOM 912 CE MET A114 59.324 21.518 26.4161.00 67.266 ATOM 913 C MET A114 56.245 26.148 25.7011.00 46.126 1~ ATOM 914 0 ME;TA114 57.308 26.660 26.0271.00 46.768 ATOM 915 N PRO A115 55.076 26.754 25.9221.00 44.807 ATOM 916 CD PRO A115 53.740 26.329 25.4631.00 44.546 ATOM 917 CA PRO A115 55.005 28.059 26.5751.00 44.086 ATOM 918 CB PRO A115 53.675 28.598 26.0751.00 45.016 15 ATOM 919 CG PRO A115 52.831 27.366 26.0771.00 43.446 ATOM 920 C PRO A115 55.030 27.935 28.1021.00 43.246 ATOM 921 0 PRO A115 54.552. 26.947 28.6641.00 40.798 ATOM 922 N SER A116 55.599 28.929 28.7711.00 42.367 ATOM 923 CA SER A116 55.62'7 28.911 30.2271.00 42.646 ATOM 924 CB SER A116 56.851 29.624 30.7641.00 40.996 ATOM 925 OG SI;RA116 56.852 29.573 32.1691.00 41.568 ATOM 926 C SER A116 54.382 29.658 30.6531.00 42.716 ATOM 927 0 SER A116 54.184 30.809 30.2661.00 44.528 ATOM 928 N ILE A117 53.545 29.006 31.4461.00 41.187 25 ATOM 929 CA ILE A117 52.303 29.616 31.8791.00 40.126 ATOM 930 CB ILE A117 51.104 28.814 31.3251.00 37.676 ATOM 931 CG2 ILE A117 49.805 29.400 31.8191.00 38.256 ATOM 932 CGl ILE A117 51.134 28.825 29.7981.00 36.766 ATOM 933 CD1 ILE A117 50.212 27.822 29.1691.00 33.486 ATOM 934 C ILE A117 52.114 29.768 33.3881.00 41.316 ATOM 935 0 ILE A117 52.444 28.876 34.1681.00 43.788 ATOM 936 N ARG A118 51.607 30.925 33.7951.00 41.357 ATOM 937 CA ARG A118 51.283 31.153 35.1941.00 41.266 ATOM 938 CB ARG A118 51.789 32.496 35.7091.00 38.566 35 ATOM 939 CG ARG A118 51.290 32.758 37.1131.00 37.296 ATOM 940 CD ARG A118 52.006 33.883 37.8171.00 38.246 ATOM 941 NE ARG A118 51.453 34.066 39.1501.00 41.497 ATOM 942 CZ ARG A118 52.006 34.794 40.1071.00 43.106 ATOM 943 NH1 ARG A118 53.148 35.423 39.8921.00 46.987 ATOM 944 NH2 ARG A118 51.417 34.890 41.2821.00 43.217 ATOM 945 C ARG A118 49.765 31.156 35.1791.00 41.216 ATOM 946 0 ARG A118 49.144 31.842 34.3741.00 41.578 ATOM 947 N GLN A119 49.152 30.394 36.0631.00 41.947 ATOM 948 CA GLN A119 47.702 30.329 36.0561.00 43.446 45 ATOM 949 CB G:LNA119 47.292 29.433 34.8951.00 41.216 ATOM 950 CG GLN A119 45.825 29.257 34.6721.00 43.476 ATOM 951 CD GLN A119 45.552 28.554 33.3641.00 41.256 ATOM 952 OE1 GLN A119 46.333 27.721 32.9311.00 42.288 ATOM 953 NE2 GGN A119 44.439 28.877 32.7361.00 42.817 ATOM 954 C GLN A119 47.183 29.801 37.3851.00 44.096 ATOM 955 O GLN A119 47.866 29.041 38.0621.00 43.598 ATOM 956 N ARG A120 45.990 30.228 37.7781.00 46.267 ATOM 957 CA ARG A120 45.433 29.762 39.0361.00 48.606 ATOM 958 CB ARG A120 44.780 30.900 39.7971.00 51.276 55 ATOM 959 CG ARG A120 45.705 32.036 40.0961.00 60.626 ATOM 960 CD ARG A120 45.261 32.728 41.3621.00 67.206 ATOM 961 NE ARG A120 45.730 32.045 42.5751.00 69.707 ATOM 962 CZ ARG A120 44.989 31.859 43.6681.00 69.766 ATOM 963 NH1 ARG A120 43.728 32.279 43.7091.00 68.367 ATOM 964 NH2 ARG A120 45.533 31.307 44.7481.00 70.337 ATOM 965 C ARG A120 44.414 28.669 38.8041.00 48.026 -8g ATOM ~~66 0 ARG 43.706 28.66937.788 1.00 8 A 46.40 ATOM 967 N PHE 44.341 27.73939.753 1.00 7 A 46.74 ATOM 968 CA PHE 43.406 26.62839.648 1.00 48.156 A

ATOM 969 CB PHE 44.129 25.33039.301 1.00 45.726 A

ATOM 970 CG PHE 44.973 25.41538.074 1.00 44.956 A

ATOM 971 CD1 PHE 46.240 25.99338.122 1.00 43.546 A

ATOM !372 CD2 PHE 121 44.495 24.94436.866 1.00 41.666 A

ATOM !a73 CE1 PHIL 121 47.011 26.09936.986 1.00 42.056 A

ATOM !a74 CE2 PHE 121 45.257 25.04735.733 1.00 41.566 A

1~ ATOM '375 CZ PHE 121 46.521 25.62835.790 1.00 42.246 A

ATOM :a76 C PHE 121 42.622 26.37640.908 1.00 49.436 A

ATOM 977 0 PHE 121 42.996 26.81042.001 1.00 49.478 A

ATOM 978 N SER 122 41.524 25.65340.727 1.00 51.177 A

ATOM 979 CA SER 122 40.657 25.25041.823 1.00 52.066 A

ATOM 980 CB SER 122 39.193 25.50141.477 1.00 52.696 A

ATOM 981 OG SER 122 38.354 25.04642.520 1.00 51.128 A

ATOM 982 C SER 122 40.896 23.75441.978 1.00 52.706 A

ATOM 983 O SER 122 40.529 22.96641.103 1.00 51.138 A

ATOM 984 N CYS 123 41.543 23.36943.070 1.00 52.977 A

ATOM 985 CA CYS 123 41.820 21.96743.312 1.00 56.036 A

ATOM 986 C CYS 123 42.017 21.69344.803 1.00 59.486 A

ATOM 987 0 CYS 123 41.882 22.60245.634 1.00 60.138 A

ATOM 988 CB CYS 123 43.052 21.55542.534 1.00 53.786 A

ATOM 989 SG CYS 123 44.483 22.55842.968 1.00 56.8916 A

25 ATOM 990 N ASP 124 42.342 20.44345.143 1.00 61.917 A

ATOM 991 CA ASP 124 42.525 20.08446.542 1.00 63.816 A

ATOM 992 CB ASP 124 42.391 18.57146.749 1.00 65.056 A

ATOM 993 CG ASP 124 41.828 18.22648.128 1.00 66.746 A

ATOM 994 OD1 ASP 124 42.113 18.97349.103 1.00 65.038 A

ATOM 995 OD2 ASP 124 41.101 17.20948.234 1.00 67.398 A

ATOM 996 C ASP 124 43.857 20.54347.110 1.00 63.726 A

ATOM 997 0 ASP 124 44.910 20.03646.745 1.00 64.118 A

ATOM 998 N VAL 125 43.794 21.49548.031 1.00 64.497 A

ATOM 999 CA VAL 125 44.981 22.04248.681 1.00 63.286 A

35 ATOM J-000CB VAL 125 44.861 23.57848.804 1.00 62.296 A

ATOM J_001CG1 VAL 125 46.058 24.13549.539 1.00 61.766 A

ATOM J_002CG2 VAL 125 44.735 24.19447.429 1.00 61.516 A

ATOM J_003C VAL 125 45.190 21.44950.078 1.00 63.426 A

ATOM =_0040 VAL 125 46.283 21.53450.632 1.00 63.088 A

ATOM ._005N SER 126 44.142 20.84850.641 1.00 64.347 A

ATOM 1006 CA SER 126 44.218 20.25251.981 1.00 64.436 A

ATOM 1007 CB SER 126 42.924 19.50352.302 1.00 63.156 A

ATOM :1008OG SER 126 42.723 18.46551.371 1.00 58.958 A

ATOM :1009C SER 126 45.414 19.30652.128 1.00 64.406 A

45 ATOM 1010 0 SER 126 45.636 18.42051.299 1.00 62.898 A

ATOM 1011 N GLY 127 46.188 19.51053.186 1.00 65.007 A

ATOM 1012 CA GLY 127 47.343 18.67653.416 1.00 67.556 A

ATOM 1013 C GI~Y 127 48.647 19.29352.939 1.00 71.256 A

ATOM 1014 0 GLY 127 49.725 18.71753.130 1.00 72.658 A

ATOM 1015 N VAL 128 48.572 20.46352.317 1.00 72.587 A

ATOM 1016 CA VAL 128 49.77.9 21.10951.830 1.00 73.826 A

ATOM 1017 CB VAL 128 49.505 22.48251.162 1.00 73.076 A

ATOM 1018 CG1 VAL 128 48.855 22.27249.837 1.00 75.576 A

ATOM 1019 CG2 128 48.625 23.35952.065 1.00 72.326 VAL
A

55 ATOM 1020 C VAL 128 50.792 21.37652.912 1.00 75.606 A

ATOM 1021 0 VAL 128 51.984 21.10252.727 1.00 76.008 A

ATOM 1022 N ASP 129 50.324 21.90754.041 1.00 77.557 A

ATOM 1023 CA ASP 129 51.241 22.28755.107 1.00 79.656 A

ATOM 1024 CB ASP 129 50.507 23.01556.235 1.00 79.086 A

ATOM 1025 CG ASP 129 51.427 23.95457.017 1.00 80.066 A

ATOM 1026 ODl 129 51.000 25.09757.338 1.00 80.128 ASP
A

ATOM 7.027OD2 ASPA 129 52.578 23.546 57.3111.00 80.59 ATOM 7.028C ASPA 129 52.085 21.164 55.6761.00 80.77 ATOM 7.0290 ASPA 129 53.089 21.441 56.3551.00 80.25 ATOM 7_030N THRA 130 51.724 19.907 55.3891.00 80.58 'rJATOM 7_031CA THRA 130 52.541 18.824 55.9251.00 81.44 ATOM 7_032CB THRA 130 52.508 18.858 57.4651.00 83.89 ATOM 1033 OG1 THRA 130 51.433 19.722 57.8801.00 85.49 ATOM 7_034CG2 THRA 130 53.88'.?19.331 58.0471.00 83.12 ATOM __035C THRA 130 52.309 17.374 55.5291.00 80.12 1~ ATOM 1036 0 TFiRA 130 51.199 16.974 55.1481.00 78.43 ATOM 037 N GLUA 131 53.404 16.611 55.6541.00 79.90 ATOM '1038CA GLUA 131 53.459 15.165 55.4321.00 80.19 ATOM ''039CB GLUA 131 52.364 14.489 56.2721.00 82.93 ATOM :1040CG GLUA 131 52.693 14.372 57.7601.00 86.59 15 ATOM :1041CD GI~UA 131 51.440 14.289 58.6321.00 88.67 ATOM 1042 OE1 GLUA 131 50.524 13.470 58.3111.00 89.43 ATOM 1043 OE2 GLUA 131 51.380 15.050 59.6381.00 88.79 ATOM 1044 C GLUA 131 53.378 14.637 54.0121.00 79.05 ATOM 1045 0 GLUA 131 54.33'7 14.716 53.2311.00 77.86 ATOM :1046N SERA 132 52.227 14.033 53.7271.00 77.68 ATOM 1047 CA SERA 132 51.915 13.474 52.4261.00 76.46 ATOM 1048 CB SERA 132 50.796 12.429 52.5761.00 76.05 ATOM :1049OG SERA 132 49.642 12.990 53.1761.00 74.46 ATOM 1050 C SERA 132 51.462 14.653 51.5331.00 75.70 25 ATOM :10510 SERA 132 51.123 14.479 50.3551.00 75.58 ATOM :1052N GI~YA 133 51.468 15.848 52.1271.00 73.94 ATOM :1053CA GLYA 133 51.094 17.056 51.4211.00 71.52 ATOM :1054C GLYA 133 49.754 16.971 50.7351.00 70.11 ATOM :1055O GLYA 133 48.927 16.115 51.0601.00 69.95 ATOM :1056N ALAA 134 49.540 17.864 49.7741.00 68.35 ATOM :1057CA ALAA 134 48.290 17.895 49.0331.00 65.73 ATOM :1058CB ALAA 134 47.748 19.321 48.9821.00 65.87 ATOM :1059C AI~AA 134 48.476 17.359 47.6211.00 63.96 ATOM :10600 ALAA 134 49.600 17.219 47.1241.00 61.93 35 ATOM :1061N THRA 135 47.353 17.048 46.9851.00 63.38 ATOM :1062CA TIIRA 135 47.359 16.549 45.6211.00 62.44 ATOM :1063CB THRA 135 47.003 15.066 45.5621.00 62.52 ATOM :1064OG1 THRA 135 47.951 14.323 46.3451.00 62.25 ATOM :1065CG2 THRA 135 47.040 14.574 44.1221.00 61.31 ATOM :1066C THRA 135 46.350 17.355 44.8201.00 61.68 ATOM :10670 THRA 135 45.120 17.188 44.9441.00 60.36 ATOM :1068N CYSA 136 46.900 18.259 44.0171.00 59.30 ATOM :1069CA CYSA 136 46.115 19.129 43.1781.00 56.11 ATOM :1070C CYSA 136 46.111 18.538 41.7781.00 55.58 45 ATOM :10710 CYSA 136 47.168 18.370 41.1631.00 53.10 ATOM :1072CB CYSA 136 46.739 20.518 43.1811.00 55.44 ATOM :1073SG CYSA 136 46.010 21.663 41.9781.00 54.51 ATOM :1074N ARGA 137 44.917 18.191 41.2981.00 55.48 ATOM :1075CA ARGA 137 44.764 17.611 39.9681.00 56.07 ATOM :1076CB ARGA 137 43.786 16.431 39.9901.00 58.27 ATOM :1077CG ARGA 137 44.213 15.318 40.9151.00 62.94 ATOM :1078CD ARGA 137 43.017 14.517 41.3$41.00 67.01 ATOM :1079NE ARGA 137 43.308 13.821 42.6411.00 72.70 ATOM :1080CZ ARGA 137 44.131 12.772 42.7621.00 74.69 55 ATOM :1081NH1 ARGA 137 44.765 12.270 41.6961.00 74.12 ATOM :1082NH2 ARGA 137 44.326 12.226 43.9581.00 74.27 ATOM :1083C ARGA 137 44.265 18.670 39.0101.00 53.72 ATOM :10840 ARGA 137 43.325 19.396 39.3011.00 51.52 ATOM :1085N ILEA 138 44.917 18.738 37.8601.00 52.05 ATOM :1086CA ILEA 138 44.582 19.696 36.8251.00 50.25 ATOM :1087CB ILEA 138 45.778 20.624 36.5571.00 49.78 ATOM 1088 CG2 II~EA 138 45.449 21.566 35.4211.00 48.31 ATOM 1089 CG1 ILEA 138 46.150 21.389 37.8371.00 48.07 ATOM 1090 CD1 ILEA 138 47.444 22.144 37.7501.00 41.58 ATOM 1091 C II~EA 138 44.270 18.925 35.5551.00 49.76 'rJATOM 1092 0 ILEA 138 45.119 18.190 35.0581.00 50.40 ATOM 1093 N LYSA 139 43.059 19.081 35.0321.00 49.44 ATOM 1094 CA LYSA 139 42.672 18.374 33.8091.00 51.81 ATOM 1095 CB LYSA 139 41.285 17.713 33.9691.00 52.86 ATOM 1096 CG LYSA 139 41.176 16.772 35.1641.00 56.41 1~ ATOM 1097 CD LYSA 139 39.919 15.940 35.1371.00 57.01 ATOM 1098 CE LYSA 139 39.978 14.888 34.0471.00 60.31 ATOM :1099NZ LYSA 139 38.728 14.066 33.9651.00 59.02 ATOM 1100 C LYSA 139 42.628 19.317 32.6151.00 51.20 ATOM 1101 0 LVSA 139 41.964 20.340 32.6731.00 51.87 15 ATOM 1102 N II~EA 140 43.325 18.979 31.5351.00 49.23 ATOM :1103CA ILEA 140 43.295 19.826 30.3541.00 49.38 ATOM 1104 CB ILEA 140 44.578 20.710 30.2781.00 50.36 ATOM 1105 CG2 ILEA 140 44.889 21.277 31.6531.00 51.45 ATOM :1106CG1 ILEA 140 45.794 19.900 29.8681.00 50.82 ATOM 1107 CD1 II~EA 140 47.103 20.630 30.1481.00 51.49 ATOM :1108C II~EA 140 43.088 19.025 29.0661.00 47.91 ATOM :11090 ILEA 140 43.721 18.006 28.8591.00 46.67 ATOM :L110N GLYA 141 42.168 19.485 28.2201.00 48.53 ATOM :1111CA GLYA 141 41.885 18.811 26.9591.00 47.60 25 ATOM :1112C GLYA 141 41.255 19.765 25.9581.00 48.49 ATOM 1113 0 GLYA 141 40.938 20.900 26.3171.00 49.03 ATOM :1114N SERA 142 41.070 19.329 24.7121.00 46.01 ATOM :1115CA SERA 142 40.466 20.195 23.6991.00 43.95 ATOM 1116 CB SERA 142 40.306 19.466 22.3701.00 44.36 ATOM _1117OG SERA 142 39.494 20.214 21.4771.00 39.73 ATOM _1118C SERA 142 39.10'7 20.686 24.1441.00 45.09 ATOM :11190 SERA 142 38.319 19.934 24.7141.00 47.13 ATOM 1120 N TRPA 143 38.822 21.947 23.8621.00 43.97 ATOM :1121CA TRPA 143 37.564 22.537 24.2561.00 41.28 35 ATOM 1122 CB TRPA 143 37.754 24.033 24.4731.00 42.28 ATOM :1123CG TRPA 143 36.577 24.697 25.1261.00 42.52 ATOM :1124CD2 TRPA 143 36.215 24.610 26.5051.00 39.43 ATOM 1125 CE2 TRPA 143 35.025 25.359 26.6761.00 39.15 ATOM :1126CE3 TRPA 143 36.778 23.969 27.6131.00 37.16 ATOM _1127CD1 TRPA 143 35.618 25.480 24.5261.00 41.93 ATOM 1128 NE1 TRPA 143 34.681 25.880 25.4561.00 40.50 ATOM :1129CZ2 TRPA 143 34.393 25.480 27.9111.00 39.06 ATOM :1130CZ3 TRPA 143 36.150 24.090 28.8371.00 39.37 ATOM 1131 CH2 TRPA 143 34.968 24.840 28.9781.00 39.40 45 ATOM 1132 C TRPA 143 36.450 22.307 23.2581.00 41.37 ATOM 1133 0 TRPA 143 35.28'7 22.239 23.6321.00 42.45 ATOM :1134N THRA 144 36.790 22.179 21.9831.00 41.97 ATOM 1135 CA TIIRA 144 35.76() 21.992 20.9791.00 41.13 ATOM :1136CB THRA 144 35.703 23.191 20.0511.00 39.00 ATOM 1137 OG1 THRA 144 36.994 23.416 19.4901.00 39.19 ATOM :1138CG2 THRA 144 35.288 24.420 20.8181.00 37.78 ATOM 1139 C THRA 144 35.879 20.738 20.1481.00 42.54 ATOM 1140 0 THRA 144 34.941 20.385 19.4431.00 45.82 ATOM 1141 N HiSA 145 37.012 20.054 20.2331.00 43.18 55 ATOM :1142CA H=SA 145 37.187 18.837 19.4591.00 46.20 ATOM 1143 CB HISA 145 38.517 18.875 18.7071.00 46.05 ATOM :1144CG H.ISA 145 38.588 19.933 17.6461.00 46.56 ATOM 1145 CD2 HISA 145 37.994 20.022 16.4321.00 45.44 ATOM 1146 ND1 HISA 145 39.366 21.061 17.7721.00 44.61 ATOM 1147 CE1 HiSA 145 39.250 21.797 16.6821.00 43.87 ATOM 1148 NE2 HISA 145 38.423 21.189 15.8531.00 41.35 ATOM 1149 C HISA 145 37.105 17.57020.303 1.00 47.36 ATOM 1150 0 HISA 145 37.811 17.42221.298 1.00 47.71 ATOM 1151 N HISA 146 36.230 16.65619.898 1.00 48.75 ATOM 1152 CA HISA 146 36.067 15.40020.609 1.00 50.47 'rJATOM 1153 CB HISA 146 34.658 14.84620.365 1.00 49.28 ATOM 1154 CG HISA 146 34.314 14.69418.919 1.00 50.42 ATOM 1155 CD2 HISA 146 34.954 14.05717.910 1.00 50.68 ATOM 1156 ND1 HISA 146 33.183 15.24818.362 1.00 51.90 ATOM 1157 CE1 HISA 146 33.138 14.96217.073 1.00 49.57 ATOM 1158 NE2 HISA 146 34.202 14.23916.774 1.00 51.03 ATOM 1159 C HISA 146 37.137 14.39620.167 1.00 49.74 ATOM 1160 0 HISA 146 37.927 14.67319.268 1.00 49.87 ATOM 1161 N SERA 147 37.145 13.23420.809 1.00 50.23 ATOM 1162 CA SERA 147 38.101 12.15820.543 1.00 50.98 15 ATOM 1163 CB SERA 147 37.722 10.93421.372 1.00 50.73 ATOM 1.164OG SERA 147 36.346 10.64221.240 1.00 51.84 ATOM 1.165C SERA 147 38.314 11.73019.096 1.00 51.53 ATOM 1.1660 SERA 147 39.374 11.22818.754 1.00 50.53 ATOM 1.167N AR.GA 148 37.319 11.92518.245 1.00 53.75 ATOM 1.168CA ARGA 148 37.444 11.52816.850 1.00 56.68 ATOM 1.169CB ARGA 148 36.052 11.40816.221 1.00 60.77 ATOM 1.170CG AR.GA 148 35.100 10.48716.985 1.00 70.28 ATOM 1.171CD ARGA 148 33.673 10.51616.423 1.00 76.18 ATOM 1.172NE ARGA 148 32.702 9.919 17.351 1.00 83.11 25 ATOM 1.173CZ ARGA 148 32.685 8.632 17.719 1.00 85.65 ATOM 1.174NH1 ARGA 148 33.595 7.781 17.243 1.00 86.70 ATOM 1.175NH2 ARGA 148 31.746 8.187 18.549 1.00 85.60 ATOM 1_176C ARGA 148 38.295 12.50216.025 1.00 56.73 ATOM 1_1770 ARGA 148 38.774 12.15714.938 1.00 56.48 ATOM 1_178N GLUA 149 38.477 13.71416.553 1.00 55.77 ATOM 1.179CA GLUA 149 39.233 14.76715.884 1.00 51.96 ATOM 1_180CB GLUA 149 38.384 16.03715.821 1.00 52.02 ATOM 1_181CG GLUA 149 36.918 15.74815.527 1.00 51.38 ATOM 1_182CD GLUA 149 36.065 16.98915.423 1.00 49.98 35 ATOM 1_183OE1 GLUA 149 36.220 17.87916.273 1.00 50.58 ATOM 1184 OE2 GLUA 149 35.226 17.07014.506 1.00 46.84 ATOM ~~_185C GLUA 149 40.53"~ 15.03016.627 1.00 50.15 ATOM '_1860 GLUA 149 41.584 15.16716.013 1.00 49.33 ATOM :'_187N II~EA 150 40.45<1 15.10017.950 1.00 47.25 ATOM 1188 CA II~EA 150 41.643 15.30918.748 1.00 48.44 ATOM :1189CB II~EA 150 41.712 16.74019.374 1.00 48.83 ATOM :1190CG2 II~EA 150 42.759 16.79320.481 1.00 44.42 ATOM :1191CG1 ILEA 150 42.104 17.76918.315 1.00 49.22 ATOM :1192CD1 ILEA 150 42.185 19.17518.839 1.00 45.68 ATOM :1193C ILEA 150 41.707 14.31019.881 1.00 50.37 ATOM :11940 ILEA 150 40.712 14.03120.536 1.00 50.37 ATOM :1195N SERA 151 42.902 13.78120.104 1.00 52.48 ATOM :1196CA SERA 151 43.156 12.84121.178 1.00 54.49 ATOM :1197CB SERA 151 43.437 11.45220.611 1.00 54.22 ATOM :1198OG SERA 151 44.619 11.45719.844 1.00 54.28 ATOM 1199 C SERA 151 44.385 13.38121.899 1.00 55.57 ATOM 1200 0 SERA 151 45.347 13.79821.257 1.00 56.29 ATOM 1201 N VALA 152 44.337 13.40023.227 1.00 57.03 ATOM 1202 CA VALA 152 45.447 13.89724.033 1.00 59.85 55 ATOM 1203 CB VALA 152 44.979 14.92225.100 1.00 59.80 ATOM 1204 CG1 VALA 152 44.170 16.02124.447 1.00 60.14 ATOM 1205 CG2 VALA 152 44.163 14.22526.175 1.00 61.09 ATOM 1206 C VALA 152 46.084 12.72224.747 1.00 61.00 ATOM 1207 O VALA 152 45.393 11.78525.132 1.00 59.83 ATOM 1208 N ASPA 153 47.398 12.78024.932 1.00 63.57 ATOM 1209 CA ASPA 153 48.114 11.69025.582 1.00 66.72 ATOM 1.210CB ASPA 153 48.620 10.72424.505 1.00 66.16 ATOM 1.211CG ASPA 153 47.505 10.24523.573 1.00 67.72 ATOM 1.212OD1 ASPA 153 46.769 9.317 23.972 1.00 68.96 ATOM 1.213OD2 ASPA 153 47.354 10.80122.451 1.00 67.60 'rJATOM 1.214C ASPA 153 49.293 12.19826.422 1.00 68.93 ATOM 1.2150 ASPA 153 49.951 13.17526.058 1.00 69.39 ATOM 1.216N PROA 154 49.553 11.56427.577 1.00 70.74 ATOM 1.217CD PROA 154 48.601 10.75928.357 1.00 71.40 ATOM 1.218CA PROA 154 50.675 11.99528.421 1.00 73.42 1~ ATOM 1.219CB PROA 154 50.421 11.26629.735 1.00 72.22 ATOM 7.220CG PROA 154 48.930 11.18229.776 1.00 72.97 ATOM 1.221C PROA 154 51.999 11.58027.773 1.00 75.99 ATOM 7_2220 PROA 154 51.997 10.95126.716 1.00 75.49 ATOM 1223 N THRA 155 53.121 11.91628.406 1.00 79.97 15 ATOM 1_224CA THRA 155 54.433 11.58027.851 1.00 84.54 ATOM 7_225CB THRA 155 55.002 12.79727.084 1.00 84.38 ATOM 7_226OG1 TI-IRA 155 55.314 13.84428.015 1.00 85.24 ATOM 1227 CG2 THRA 155 53.979 13.32626.085 1.00 83.86 ATOM 7_228C TI-IRA 155 55.504 11.10128.868 1.00 88.31 ATOM 7_2290 TIIRA 155 55.179 10.48029.905 1.00 89.23 ATOM 7_230N THRA 156 56.774 11.40228.539 1.00 91.22 ATOM 7_231CA THRA 156 57.970 11.05729.337 1.00 93.64 ATOM 7_232CB THRA 156 59.146 12.04129.041 1.00 93.80 ATOM 1233 OG1 THRA 156 59.430 12.04827.631 1.00 93.55 25 ATOM 7_234CG2 TIiRA 156 60.414 11.62429.839 1.00 93.12 ATOM 1235 C THRA 156 57.778 11.03130.862 1.00 95.49 ATOM 7_2360 TI-IRA 156 57.812 12.08031.532 1.00 95.50 ATOM 7_237N GLUA 157 57.614 9.827 31.406 1.00 97.12 ATOM 1238 CA GLUA 157 57.411 9.649 32.841 1.00 98.24 ATOM 1239 CB GI~UA 157 56.619 8.370 33.095 1.00100.23 ATOM 7_240CG GLUA 157 55.476 8.150 32.109 1.00103.23 ATOM 1241 CD GI~UA 157 54.728 6.842 32.372 1.00104.38 ATOM :_242OE1 GLUA 157 55.391 5.769 32.462 1.00103.49 ATOM 1243 OE2 GLUA 157 53.475 6.896 32.482 1.00105.11 35 ATOM 7_244C GLUA 157 58.731 9.570 33.591 1.00 98.22 ATOM 1245 0 GLUA 157 58.742 9.488 34.825 1.00 98.77 ATOM 'w246N ASNA 158 59.840 9.582 32.854 1.00 97.95 ATOM '-247CA ASNA 158 61.154 9.505 33.494 1.00 98.34 ATOM 1248 CB ASNA 158 62.244 9.212 32.455 1.00100.52 40 ATOM 1249 CG ASNA 158 61.953 7.969 31.634 1.00102.32 ATOM .'_250OD1 ASNA 158 61.787 6.872 32.184 1.00104.16 ATOM _'_251ND2 ASNA 158 61.898 8.131 30.305 1.00102.61 ATOM 1252 C A:~NA 158 61.471 10.83234.196 1.00 97.02 ATOM 1253 0 ASNA 158 61.170 11.01935.392 1.00 96.34 45 ATOM 1254 N SERA 159 62.093 11.72933.423 1.00 94.95 ATOM 1255 CA SERA 159 62.49?. 13.06933.857 1.00 91.51 ATOM 1256 CB SERA 159 61.878 14.09132.890 1.00 91.99 ATOM 1257 OG SERA 159 60.550 13.70832.529 1.00 90.83 ATOM 1258 C SI;RA 159 62.116 13.41235.301 1.00 88.77 ATOM 1259 0 SERA 159 60.939 13.38035.666 1.00 88.38 ATOM 1260 N ASPA 160 63.120 13.72836.120 1.00 85.60 ATOM 1261 CA ASPA 160 62.867 14.09337.517 1.00 81.69 ATOM 1262 CB A:>PA 160 64.107 14.71638.164 1.00 81.79 ATOM 1263 CG ASPA 160 63.827 15.21739.578 1.00 82.16 55 ATOM 1264 OD1 ASPA 160 64.609 16.05740.075 1.00 82.93 ATOM 1265 OD2 ASPA 160 62.824 14.76640.194 1.00 81.33 ATOM 1266 C ASPA 160 61.748 15.12537.556 1.00 78.87 ATOM 1267 O ASPA 160 61.906 16.21536.997 1.00 77.29 ATOM 1268 N ASPA 161 60.643 14.78338.223 1.00 75.12 ATOM 1269 CA ASPA 161 59.493 15.67738.324 1.00 71.64 ATOM 1270 CB ASPA 161 58.433 15.11139.273 1.00 71.12 ATOM 7.271CG ASPA 161 57.719 13.895 38.6981.00 71.43 ATOM 7.272OD1 ASPA 161 57.509 13.854 37.4631.00 70.50 ATOM 7_273OD2 ASPA 161 57.353 12.983 39.4801.00 71.76 ATOM 7_274C ASPA 161 59.814 17.097 38.7561.00 69.97 ATOM 1275 0 ASPA 161 59.009 18.001 38.5451.00 69.41 ATOM ._276N S)=~RA 162 60.974 17.321 39.3581.00 68.43 ATOM 1277 CA SERA 162 61.282 18.682 39.7741.00 68.46 ATOM 1278 CB SI;RA 162 61.190 18.809 41.3081.00 68.76 ATOM 1279 OG SERA 162 62.209 18.069 41.9621.00 68.11 1~ ATOM 1280 C SERA 162 62.636 19.163 39.2891.00 67.78 ATOM 1281 0 SERA 162 63.264 20.014 39.9171.00 67.84 ATOM 1282 N GLUA 163 63.087 18.640 38.1561.00 67.60 ATOM :1283CA GLUA 163 64.382 19.052 37.6491.00 68.35 ATOM 1284 CB GLUA 163 64.884 18.051 36.6091.00 70.48 15 ATOM 1285 CG GLUA 163 64.380 18.242 35.1931.00 73.24 ATOM 1286 CD GLUA 163 65.111 17.328 34.2041.00 75.50 ATOM :1287OE1 GLUA 163 64.835 16.097 34.2111.00 76.99 ATOM 1288 OE2 GLUA 163 65.970 17.842 33.4381.00 73.24 ATOM :1289C GLUA 163 64.342 20.475 37.0831.00 68.50 ATOM :12900 GLUA 163 65.385 21.062 36.7741.00 69.25 ATOM :1291N TYRA 164 63.140 21.031 36.9581.00 67.44 ATOM :1292CA TYRA 164 62.968 22.396 36.4661.00 65.48 ATOM :1293CB TYRA 164 62.085 22.422 35.2211.00 66.46 ATOM :1294CG TYRA 164 62.709 21.754 34.0291.00 67.56 ATOM :1295CD1 TYRA 164 62.082 20.664 33.4151.00 68.14 ATOM :1296CE1 TYRA 164 62.664 20.011 32.3281.00 67.68 ATOM :1297CD2 TYRA 164 63.942 22.185 33.5271.00 66.99 ATOM :1298CE2 TYRA 164 64.539 21.538 32.4351.00 69.28 ATOM :1299CZ TYRA 164 63.892 20.449 31.8371.00 68.44 ATOM :1300OH T'IRA 164 64.456 19.823 30.7371.00 69.00 ATOM :1301C TYRA 164 62.313 23.259 37.5341.00 64.21 ATOM 1302 0 TYRA 164 62.181 24.474 37.3681.00 62.71 ATOM 1303 N PHEA 165 61.899 22.626 38.6271.00 62.72 ATOM 1304 CA PHEA 165 61.241 23.343 39.7051.00 60.48 35 ATOM 1305 CB PHEA 165 60.738 22.364 40.7581.00 57.99 ATOM :1306CG PHEA 165 59.676 22.936 41.6411.00 57.14 ATOM 1307 CD1 PI-IEA 165 58.424 23.252 41.1151.00 55.84 ATOM 1308 CD2 PHEA 165 59.933 23.194 42.9851.00 55.03 ATOM :1309CE1 PHEA 165 57.439 23.818 41.9021.00 54.80 ATOM 1310 CE2 PHEA 165 58.961 23.762 43.7871.00 57.75 ATOM :1311CZ PHEA 165 57.699 24.079 43.2421.00 57.78 ATOM 1312 C PHEA 165 62.159 24.369 40.3541.00 60.44 ATOM 1313 0 PHEA 165 63.348 24.121 40.5471.00 60.73 ATOM 1314 N SERA 166 61.611 25.534 40.6761.00 60.95 45 ATOM 1315 CA SERA 166 62.418 26.567 41.3121.00 61.11 ATOM 1316 CB SERA 166 61.638 27.874 41.4571.00 59.76 ATOM 1317 OG SERA 166 62.476 28.875 42.0151.00 59.79 ATOM 1318 C SERA 166 62.809 26.068 42.6941.00 61.38 ATOM 1319 0 SERA 166 62.009 25.442 43.3931.00 61.62 ATOM 1320 N GLNA 167 64.038 26.359 43.0891.00 61.82 ATOM 1321 CA GLNA 167 64.525 25.931 44.3931.00 62.17 ATOM 1322 CB GINA 167 66.052 25.797 44.3511.00 63.58 ATOM 1323 CG GINA 167 66.745 27.065 43.8611.00 66.42 ATOM 1324 CD GLNA 167 68.204 26.85'y43.5141.00 69.06 55 ATOM 1325 OE1 GLNA 167 69.008 26.488 44.3761.00 70.77 ATOM 1326 NE2 GLNA 167 68.556 27.081 42.2411.00 69.23 ATOM 1327 C GLNA 167 64.119 26.927 45.4761.00 61.22 ATOM 1328 0 GLNA 167 64.112 26.585 46.6591.00 61.10 ATOM 1329 N TYRA 168 63.762 28.147 45.07 1.00 58.44 ATOM 1330 CA TYRA 168 63.392 29.162 46.0461.00 56.45 ATOM 1331 CB TYRA 168 63.881 30.522 45.5641.00 55.36 ATOM 1332 CG TYR A168 65.335 30.469 45.1581.00 57.58 ATOM 1333 CD1 TYR A168 65.699 30.352 43.8181.00 57.60 ATOM "w334CE1 TYR A168 67.031 30.233 43.4391.00 57.86 ATOM 1335 CD2 TYR A168 66.349 30.467 46.1151.00 57.43 'rJATOM 1336 CE2 TYR A168 67.683 30.347 45.7491.00 58.19 ATOM :1337CZ TYR A168 68.017 30.228 44.4101.00 59.25 ATOM 1338 OH TYR A168 69.337 30.086 44.0421.00 60.91 ATOM 1339 C TYR A168 61.912 29.199 46.3831.00 56.00 ATOM :13400 TYR A168 61.457 30.053 47.1421.00 56.39 ATOM :1341N SER A169 61.162 28.257 45.8321.00 55.67 ATOM :1342CA SER A169 59.732 28.179 46.0961.00 56.31 ATOM :1343CB SIR A169 59.082 27.123 45.1971.00 57.76 ATOM :1344OG SER A169 57.699 26.971 45.5011.00 55.64 ATOM :1345C SER A169 59.478 27.804 47.5441.00 57.69 15 ATOM 1346 0 SER A169 60.246 27.066 48.1521.00 58.82 ATOM 1347 N ARG A170 58.385 28.302 48.0961.00 58.68 ATOM 1348 CA ARG A170 58.043 27.993 49.4721.00 58.62 ATOM 1349 CB ARG A170 56.90'7 28.901 49.9561.00 60.14 ATOM 1350 CG ARG A170 57.37:1 30.123 50.7271.00 60.43 ATOM 1351 CD ARG A170 56.401 31.291 50.5891.00 64.30 ATOM 1352 NE ARG A170 55.020 30.998 50.9891.00 66.31 ATOM 1353 CZ ARG A170 53.967 31.107 50.1741.00 66.81 ATOM 1354 NH1 ARG A170 54.129 31.489 48.9151.00 63.97 ATOM 1355 NH2 ARG A170 52.750 30.850 50.6191.00 67.23 25 ATOM 1356 C ARG A170 57.604 26.544 49.5541.00 58.75 ATOM 1357 0 ARG A170 57.516 25.975 50.6421.00 60.59 ATOM 1358 N PHE A171 57.339 25.933 48.4051.00 57.02 ATOM 1359 CA PHE A171 56.882 24.552 48.4041.00 56.54 ATOM 1360 CB PHE A171 55.499 24.479 47.7651.00 55.41 ATOM 1361 CG PHE A171 54.552 25.522 48.2811.00 55.91 ATOM 1362 CD1 PHE A171 54.685 26.856 47.8931.00 57.70 ATOM 1363 CD2 PHE A171 53.560 25.190 49.2031.00 56.28 ATOM 1364 CE1 PHE A171 53.845 27.847 48.4191.00 58.19 ATOM 1365 CE2 PHE A171 52.718 26.170 49.7321.00 55.91 35 ATOM 1366 CZ PI-IEA171 52.864 27.505 49.3371.00 57.16 ATOM 1367 C PHE A171 57.844 23.612 47.6951.00 56.77 ATOM 1368 O PHE A171 58.841 24.045 47.1131.00 56.03 ATOM 1369 N GLU A172 57.552 22.319 47.7651.00 56.23 ATOM 1370 CA GLU A172 58.389 21.325 47.1201.00 58.00 4~ ATOM 1371 CB GLU A172 59.371 20.707 48.1191.00 60.23 ATOM 1372 CG GLU A172 58.734 19.970 49.3031.00 64.00 ATOM 1373 CD GLU A172 59.769 19.445 50.3131.00 66.01 ATOM 1374 OE1 GLU A172 60.869 19.042 49.8681.00 69.59 ATOM 1375 OE2 GLU A172 59.487 19.421 51.5411.00 65.33 45 ATOM 1376 C GLU A172 57.497 20.259 46.5181.00 59.67 ATOM 1377 0 GLU A172 56.356 20.064 46.9551.00 60.12 ATOM 1378 N ILE A173 58.006 19.579 45.4961.00 60.16 ATOM 1379 CA ILE A173 57.224 18.545 44.8271.00 60.67 ATOM 1380 CB ILE A173 57.413 18.587 43.2911.00 61.87 ATOM 1381 CG2 ILE A173 56.659 17.422 42.6441.00 62.56 ATOM 1382 CG1 ILE A173 56.920 19.919 42.7271.00 61.03 ATOM 1383 CD1 ILE A173 57.165 20.062 41.2441.00 59.49 ATOM 1384 C ILE A173 57.579 17.150 45.2961.00 59.83 ATOM 1385 0 ILE A173 58.751 16.770 45.3601.00 57.21 55 ATOM 1386 N LEU A174 56.554 16.381 45.6161.00 61.63 ATOM 1387 CA LEU A174 56.786 15.022 46.0561.00 64.20 ATOM 1388 CB LEU A174 55.687 14.592 47.0241.00 63.47 ATOM 1389 CG LEU A174 55.461 15.601 48.1491.00 65.34 ATOM 1390 CD1 LEU A174 54.285 15.144 49.0241.00 66.19 ATOM 1391 CD2 LEU A174 56.747 15.770 48.9621.00 64.00 ATOM 1392 C LEU A174 56.783 14.147 44.8061.00 65.92 ATOM 1.3930 LEUA 174 57.757 13.44044.522 1.0065.29 ATOM 1.394N ASPA 175 55.702 14.23344.036 1.0067.33 ATOM 1.395CA ASPA 175 55.583 13.43642.827 1.0068.45 ATOM 1.396CB ASPA 175 55.227 11.99343.223 1.0068.56 ATOM 1397 CG ASPA 175 55.161 11.03842.032 1.0068.23 ATOM 1.398OD1 ASPA 175 56.141 10.96441.244 1.0067.58 ATOM 1399 OD2 ASPA 175 54.121 10.34741.905 1.0067.56 ATOM 1.400C ASPA 175 54.542. 14.02341.872 1.0069.02 ATOM 1.4010 ASPA 175 53.617 14.73542.286 1.0069.85 1~ ATOM 1.402N VALA 176 54.714 13.72740.587 1.0068.72 ATOM 1.403CA VALA 176 53.809 14.19839.552 1.0067.76 ATOM 1_404CB VALA 176 54.461 15.32438.694 1.0067.60 ATOM 1.405CG1 VALA 176 53.533 15.72137.542 1.0066.09 ATOM 1.406CG2 VALA 176 54.771 16.53239.564 1.0065.31 15 ATOM 1.407C VALA 176 53.495 13.02538.645 1.0067.31 ATOM 1.408O VALA 176 54.399 12.30838.230 1.0066.10 ATOM 1.409N THRA 177 52.213 12.83338.348 1.0068.30 ATOM 1.410CA THRA 177 51.781 11.76337.463 1.0069.37 ATOM 1.411CB THRA 177 51.2.41 10.56538.259 1.0069.49 ATOM 1.412OG1 THRA 177 50.218 11.00739.160 1.0069.60 ATOM 1.413CG2 THRA 177 52.366 9.905 39.045 1.0069.19 ATOM 1.414C THRA 177 50.696 12.27636.528 1.0070.72 ATOM 1.4150 THRA 177 49.879 13.11936.917 1.0072.04 ATOM 1.416N GLNA 178 50.692. 11.77135.297 1.0071.85 25 ATOM 1.417CA GLNA 178 49.706 12.19134.302 1.0073.03 ATOM 1.418CB GLNA 178 50.392. 12.91633.144 1.0075.20 ATOM 1.419CG GLNA 178 51.681 13.64033.533 1.0078.41 ATOM 1.420CD GL~NA 178 52.059 14.73332,539 1.0079.92 ATOM 1.421OEl GL~NA 178 52.078 14.50931.315 1.0081.52 ATOM 1.422NE2 GLNA 178 52.370 15.92433.061 1.0078.36 ATOM 1.423C GLNA 178 49.014 10.96433.764 1.0072.67 ATOM 1.4240 GLNA 178 49.679 10.04333.293 1.0073.74 ATOM 1.425N LYSA 179 47.686 10.94733.827 1.0072.17 ATOM 1.426CA LYSA 179 46.916 9.807 33.337 1.0071.53 35 ATOM 1.427CB LYSA 179 46.327 9.038 34.519 1.0074.09 ATOM 1.428CG LYSA 179 47.352 8.781 35.644 1.0079.46 ATOM 1.429CD LYSA 179 46.703 8.189 36.905 1.0081.06 ATOM 1.430CE LYSA 179 47.635 8.300 38.119 1.0080.77 ATOM 1.431NZ LYSA 179 47.968 9.715 38.443 1.0080.83 ATOM 1432 C LYSA 179 45.795 10.31632.470 1.0070.00 ATOM 1.4330 LYSA 179 44.878 10.93932.980 1.0073.37 ATOM 1.434N LYSA 180 45.845 10.06031.170 1.0067.55 ATOM 1.435CA LYSA 180 44.780 10.53830.294 1.0067.72 ATOM 1.436CB LYSA 180 45.171 10.32728.829 1.0066.54 45 ATOM 1.437CG LYSA 180 45.120 8.909 28.344 1.0063.87 ATOM 1.438CD LYSA 180 43.751 8.573 27.796 1.0064.72 ATOM 1439 CE LYSA 180 43.404 9.412 26.552 1.0065.43 ATOM 1440 NZ LYSA 180 44.217 9.057 25.339 1.0065.01 ATOM 1441 C LYSA 180 43.445 9.854 30.586 1.0067.22 ATOM 1442 0 LYSA 180 43.373 9.021 31.471 1.0068.12 ATOM 1443 N ASNA 181 42.388 10.23129.871 1.0067.59 ATOM 1444 CA ASNA 181 41.083 9.600 30.053 1.0068.03 ATOM 1445 CB ASNA 181 40.710 9.514 31.545 1.0069.44 ATOM 1446 CG ASNA 181 40.940 10.80332.291 1.0068.81 55 ATOM 1447 OD1 ASNA 181 40.552 11.87231.834 1.0071.29 ATOM 1448 ND2 ASNA 181 41.556 10.70633.463 1.0067.88 ATOM 1449 C ASNA 181 39.917 10.19429.272 1.0067.66 ATOM 1450 0 ASNA 181 39.576 11.35029.437 1.0068.16 ATOM 1451 N SERA 182 39.302 9.377 28.420 1.0068.81 ATOM 1452 CA SERA 182 38.160 9.802 27.615 1.0068.00 ATOM 1453 CB SERA 182 37.861 8.745 26.553 1.0067.42 ATOM 1454 OG SERA 182 36.905 9.223 25.6261.00 70.87 ATOM 1455 C SERA 182 36.953 9.974 28.5411.00 67.36 ATOM 1456 0 SERA 182 36.915 9.385 29.6171.00 67.61 ATOM :1457N VALA 183 35.973 10.771 28.1261.00 65.82 'rJATOM :1458CA VALA 183 34.790 11.017 28.9501.00 64.66 ATOM :1459CB VALA 183 35.151 11.912 30.1631.00 63.68 ATOM :1460CG1 VALA 183 36.153 12.956 29.7481.00 65.08 ATOM :1461CG2 VALA 183 33.90:1 12.581 30.7181.00 61.80 ATOM :1462C VALA 183 33.632 11.666 28.2041.00 64.12 1~ ATOM :14630 VALA 183 33.828 12.597 27.4401.00 64.83 ATOM :1464N THRA 184 32.422 11.170 28.4321.00 65.00 ATOM :1465CA THRA 184 31.240 11.737 27.7931.00 67.07 ATOM :1466CB THRA 184 30.303 10.641 27.2581.00 64.63 ATOM 1467 OG1 THRA 184 30.97'7 9.911 26.2241.00 61.46 15 ATOM 1468 CG2 THRA 184 29.030 11.260 26.6851.00 67.30 ATOM :1469C THRA 184 30.490 12.596 28.8081.00 69.96 ATOM 1470 0 THRA 184 30.41_:312.238 29.9931.00 71.87 ATOM :1471N TYRA 185 29.961 13.735 28.3621.00 71.00 ATOM 1472 CA T'CRA 185 29.230 14.618 29.2611.00 72.17 ATOM 1473 CB T'CRA 185 29.849 16.015 29.2741.00 72.39 ATOM 1474 CG TYRA 185 31.335 16.005 29.5251.00 72.53 ATOM 1475 CD1 TYRA 185 32.226 15.598 28.5311.00 71.50 ATOM 1476 CE1 TYRA 185 33.601 15.535 28.7751.00 70.43 ATOM 1477 CD2 TYRA 185 31.854 16.358 30.7761.00 73.42 25 ATOM 1478 CE2 TYRA 185 33.236 16.300 31.0311.00 71.16 ATOM 1479 CZ TYRA 185 34.097 15.885 30.0221.00 70.35 ATOM 1480 OH TYRA 185 35.448 15.811 30.2541.00 68.69 ATOM :1481C T'IRA 185 27.804 14.705 28.7801.00 73.84 ATOM 1482 0 TYRA 185 27.551 14.756 27.5761.00 73.39 ATOM 1483 N SERA 186 26.873 14.714 29.7271.00 76.31 ATOM 1484 CA SERA 186 25.455 14.794 29.4031.00 78.23 ATOM 1485 CB SERA 186 24.645 14.953 30.6931.00 78.92 ATOM 1486 OG SERA 186 25.215 15.952 31.5271.00 77.75 ATOM 1487 C SERA 186 25.19'7 15.967 28.4531.00 78.29 35 ATOM :14880 SERA 186 24.348 15.879 27.5531.00 79.09 ATOM :1489N C'CSA 187 25.949 17.047 28.6531.00 77.81 ATOM 1490 CA CYSA 187 25.830 18.254 27.8391.00 78.71 ATOM 1491 C C'.CSA 187 26.144 17.978 26.4071.00 78.06 ATOM 1492 0 C'CSA 187 25.514 18.482 25.4881.00 78.32 ATOM 1493 CB CYSA 187 26.858 19.320 28.2521.00 79.52 ATOM 1494 SG C'.CSA 187 28.656 18.934 27.9461.00 82.56 ATOM 1495 N C'ISA 188 27.147 17.144 26.2441.00 78.96 ATOM 1496 CA C'tSA 188 27.706 16.918 24.9471.00 78.72 ATOM 1497 C C'CSA 188 27.817 15.468 24.4541.00 78.19 45 ATOM 1498 0 C'CSA 188 28.454 14.618 25.0961.00 78.27 ATOM 1499 CB CYSA 188 29.070 17.610 25.0061.00 79.96 ATOM 1500 SG CYSA 188 29.118 19.206 25.9501.00 80.88 ATOM 1501 N PROA 189 27.211 15.186 23.2811.00 77.44 ATOM 1502 CD PROA 189 26.571 16.283 22.5261.00 77.01 ATOM 1503 CA PROA 189 27.125 13.918 22.5321.00 76.01 ATOM :1504CB PROA 189 26.756 14.378 21.1291.00 76.94 ATOM :1505CG PROA 189 25.858 15.558 21.4081.00 77.54 ATOM :1506C PROA 189 28.355 12.991 22.5121.00 75.22 ATOM :15070 PROA 189 28.300 11.883 23.0561.00 76.90 55 ATOM :1508N GLUA 190 29.44'7 13.423 21.8741.00 72.83 ATOM 1509 CA GLUA 190 30.662 12.603 21.7681.00 69.68 ATOM :1510CB GI~UA 190 31.535 13.102 20.6291.00 72.91 ATOM :1511CG GI~UA 190 30.777 13.743 19.4861.00 75.89 ATOM :1512CD GLUA 190 30.236 12.730 18.5051.00 77.90 60 ATOM :1513OE1 GLUA 190 30.974 11.765 18.1701.00 78.51 ATOM :1514OE2 GLUA 190 29.080 12.909 18.0581.00 79.55 ATOM 1515 C GLU A190 31.492 12.631 23.0391.00 66.30 ATOM 1516 0 GLU A190 31.113 13.278 24.0091.00 65.23 ATOM 1517 N ALA A191 32.633 11.941 23.0201.00 63.17 ATOM 1518 CA ALA A191 33.524 11.891 24.1821.00 61.94 ATOM 1519 CB AI~AA191 34.102 10.493 24.3411.00 60.63 ATOM 1520 C ALA A191 34.666 12.904 24.0551.00 61.30 ATOM 1521 0 ALA A191 35.148 13.165 22.9501.00 62.21 ATOM :1522N TYR A192 35.105 13.468 25.1791.00 58.30 ATOM 1523 CA TYR A192 36.188 14.438 25.1591.00 56.19 1~ ATOM :1524CB TYR A192 35.695 15.807 25.6331.00 55.84 ATOM :1525CG TYR A192 34.779 16.487 24.6491.00 56.15 ATOM :1526CD1 TYR A192 33.409 16.226 24.6421.00 56.04 ATOM :1527CE1 TYR A192 32.571 16.794 23.6831.00 57.88 ATOM :1528CD2 TYR A192 35.291 17.341 23.6751.00 56.39 ATOM :1529CE2 T'~RA192 34.467 17.915 22.7151.00 57.19 ATOM :1530CZ T'.tRA192 33.108 17.637 22.7221.00 58.29 ATOM 1531 OH TYR A192 32.295 18.200 21.7691.00 58.06 ATOM 1532 C T'CRA192 37.389 14.013 25.9841.00 56.62 ATOM 1533 0 T'tRA192 37.375 14.090 27.2171.00 57.67 ATOM 1534 N GLU A193 38.436 13.571 25.2911.00 57.15 ATOM 1535 CA GLU A193 39.676 13.124 25.9351.00 58.07 ATOM 1536 CB GI~UA193 40.651 12.523 24.9011.00 56.63 ATOM 1537 CG GLU A193 40.14.3 11.269 24.2091.00 55.92 ATOM 1538 CD GLU A193 41.171 10.636 23.3071.00 56.05 25 ATOM 1539 OE1 GLU A193 42.339 10.509 23.7431.00 56.33 ATOM 1540 OE2 GLU A193 40.808 10.250 22.1711.00 57.19 ATOM 1541 C GLU A193 40.363 14.278 26.6551.00 58,09 ATOM 1542 0 GLU A193 40.221 15.440 26.2611.00 59.15 ATOM 1543 N ASP A194 41.098 13.948 27.7121.00 57.73 ATOM 1544 CA ASP A194 41.816 14.941 28.4861.00 56.31 ATOM 1545 CB ASP A194 40.856 15.738 29.3861.00 57.85 ATOM 1546 CG ASP A194 40.339 14.930 30.5781.00 59.72 ATOM 1547 OD1 ASP A194 39.120 14.610 30.5921.00 55.87 ATOM 1548 OD2 ASP A194 41.154 14.628 31.4941.00 58.60 35 ATOM 1549 C ASP A194 42.881 14.276 29.3331.00 55.87 ATOM 1550 0 ASP A194 42.746 13.121 29.7141.00 56.72 ATOM 1551 N VAL A195 43.948 15.014 29.6111.00 55.00 ATOM 1552 CA VAL A195 45.039 14.520 30.4311.00 55.58 ATOM 1553 CB VAL A195 46.397 14.961 29.8761.00 54.15 ATOM 1554 CG1 VAL A195 47.508 14.610 30.8601.00 52.00 ATOM 1555 CG2 VAL A195 46.643 14.292 28.5441.00 53.83 ATOM 1556 C VAL A195 44.900 15.082 31.8321.00 57.46 ATOM 1557 0 VAL A195 44.809 16.294 32.0111.00 57.93 ATOM 1558 N GLU A196 44.886 14.206 32.8281.00 58.46 45 ATOM 1559 CA GLU A196 44.767 14.654 34.2041.00 58.24 ATOM 1560 CB GLU A196 43.805 13.758 34.9661.00 59.77 ATOM 1561 CG GLU A196 43.556 14.199 36.3851.00 63.27 ATOM 1562 CD GLU A196 42.624 13.256 37.1141.00 64.52 ATOM 1563 OEl GLU A196 41.485 13.063 36.6461.00 63.73 ATOM 1564 OE2 GLU A196 43.035 12.705 38.1551.00 68.58 ATOM 1565 C GLU A196 46.142 14.590 34.8281.00 57.57 ATOM 1566 0 GLU A196 46.775 13.538 34.8411.00 59.03 ATOM 1567 N VAL A197 46.618 15.723 35.3221.00 55.78 ATOM 1568 CA VAL A197 47.929 15.766 35.9431.00 55.65 55 ATOM 1569 CB VAL A197 48.781 16.937 35.3861.00 55.24 ATOM 1570 CG1 V.ALA197 50.142 16.962 36.0501.00 51.21 ATOM 1571 CG2 VAL A197 48.929 16.800 33.8771.00 53.65 ATOM 1572 C VAL A197 47.716 15.955 37.4311.00 57.58 ATOM 1573 O VAL A197 46.963 16.843 37.8501.00 57.66 ATOM 1574 N SER A198 48.355 15.102 38.2311.00 58.29 ATOM 1575 CA SER A198 48.229 15.194 39.6771.00 57.91 ATOM 1576 CB SERA 198 47.951 13.822 40.2751.00 56.54 ATOM 1577 OG SERA 198 46.654 13.401 39.9081.00 61.46 ATOM 1578 C SERA 198 49.501 15.765 40.2571.00 58.27 ATOM 1579 0 SERA 198 50.585 15.202 40.0891.00 58.63 ATOM 7_580N LEUA 199 49.366 16.901 40.9291.00 58.53 ATOM 581 CA LEUA 199 50.521 17.538 41.5311.00 60.77 ATOM 1582 CB LEUA 199 50.519 19.046 41.2741.00 60.73 ATOM 1583 CG LEUA 199 51.591 19.833 42.0321.00 59.19 ATOM 1584 CD1 LEUA 199 52.982 19.400 41.5991.00 57.61 1~ ATOM 1585 CD2 LEUA 199 51.390 21.311 41.7761.00 60.66 ATOM 1586 C LEUA 199 50.524 17.293 43.0221.00 61.78 ATOM 1587 0 LEUA 199 49.739 17.895 43.7651.00 62.31 ATOM :1588N ASNA 200 51.397 16.389 43.4571.00 61.40 ATOM 1589 CA ASNA 200 51.519 16.092 44.8661.00 58.00 ATOM :1590CB ASNA 200 51.763 14.607 45.0881.00 60.46 ATOM :1591CG ASNA 200 51.926 14.267 46.5531.00 61.99 ATOM :1592OD1 ASNA 200 51.158 14.735 47.3911.00 63.14 ATOM :1593ND2 ASNA 200 52.928 13.447 46.8711.00 63.54 ATOM :1594C ASNA 200 52.708 16.906 45.3451.00 56.52 ATOM :15950 ASNA 200 53.859 16.664 44.9571.00 55.31 ATOM :1596N PHEA 201 52.406 17.901 46.1661.00 55.49 ATOM :1597CA PHEA 201 53.416 18.790 46.7071.00 54.84 ATOM 1598 CB PHEA 201 53.450 20.082 45.9081.00 50.77 ATOM 1599 CG PHEA 201 52.237 20.940 46.1121.00 47.21 25 ATOM 1600 CD1 PHEA 201 52.337 22.161 46.7651.00 46.20 ATOM 1601 CD2 PHEA 201 50.985 20.513 45.6781.00 46.31 ATOM 1602 CE1 PHEA 201 51.205 22.942 46.9841.00 45.24 ATOM 1603 CE2 PHEA 201 49.849 21.291 45.8961.00 43.16 ATOM 1604 CZ PHEA 201 49.962 22.504 46.5491.00 42.59 ATOM 1605 C PHEA 201 53.035 19.112 48.1421.00 56.47 ATOM 1606 0 PHEA 201 51.956 18.748 48.6101.00 54.75 ATOM 1607 N ARGA 202 53.927 19.811 48.8291.00 58.72 ATOM 1608 CA ARGA 202 53.693 20.207 50.2071.00 61.75 ATOM 1609 CB ARGA 202 54.052 19.063 51.1361.00 63.76 35 ATOM 1610 CG ARGA 202 55.544 18.822 51.1301.00 65.86 ATOM 1611 CD ARGA 202 55.938 17.640 51.9621.00 68.52 ATOM 1612 NE ARGA 202 57.383 17.466 51.9161.00 69.87 ATOM 1613 CZ ARGA 202 58.01.3 16.409 52.4051.00 70.56 ATOM 1614 NH1 ARGA 202 57.308 15.433 52.9771.00 71.39 ATOM 1615 NH2 ARGA 202 59.340 16.332 52.3151.00 70.56 ATOM 1616 C ARGA 202 54.579 21.406 50.5561.00 62.74 ATOM 1617 0 ARGA 202 55.588 21.675 49.8901.00 62.41 ATOM 1618 N LYSA 203 54.200 22.121 51.6061.00 63.53 ATOM 1619 CA LYSA 203 54.983 23.256 52.0441.00 64.89 45 ATOM 1620 CB LYSA 203 54.271 23.993 53.1691.00 65.59 ATOM 1621 CG LYSA 203 55.067 25.149 53.7401.00 66.14 ATOM 1622 CD LYSA 203 54.348 25.777 54.9111.00 65.85 ATOM 1623 CE L'A'SA 203 55.145 26.939 55.4731.00 67.46 ATOM 1624 NZ LYSA 203 55.259 28.073 54.5001.00 68.09 ATOM 1625 C L'~SA 203 56.264 22.665 52.5631.00 65.93 ATOM 1626 0 LYSA 203 56.250 21.585 53.1571.00 66.11 ATOM 1627 N LYSA 204 57.372 23.351 52.3131.00 69.05 ATOM 1628 CA L'i'SA 204 58.659 22.863 52.7671.00 71.58 ATOM 1629 CB LYSA 204 59.758 23.834 52.3581.00 69.66 55 ATOM 1630 CG L'YSA 204 59.862 23.906 50.8391.00 69.91 ATOM 1631 CD LYSA 204 61.113 24.609 50.3361.00 71.48 ATOM 1632 CE LYSA 204 61.195 24.491 48.8091.00 73.18 ATOM 1633 NZ LYSA 204 62.324 25.234 48.1891.00 72.99 ATOM 1634 C L'YSA 204 58.544 22.745 54.2641.00 74.56 ATOM 1635 0 LYSA 204 57.769 23.493 54.8731.00 77.21 ATOM 1636 N GLYA 205 59.262 21.782 54.8501.00 75.75 ATOM 1637 CA GLY A205 59.215 21.592 56.2961.00 75.55 ATOM 1638 C GLY A205 60.125 22.564 57.0291.00 76.09 ATOM 1639 OT1 GLY A205 60.824 23.350 56.3481.00 77.07 ATOM 1640 OT2 GLY A205 60.151 22.545 58.2781.00 75.36 'rJATOM 1641 CB PI-iEB1 33.107 19.922 1.832 1.00 57.02 ATOM 1642 CG PI-IEB1 32.174 20.672 0.888 1.00 58.55 ATOM 1643 CD1 PHE B1 32.670 21.495 -0.1201.00 59.39 ATOM 1644 CD2 PHE B1 30.784 20.612 1.079 1.00 58.84 ATOM 1645 CE1 PHE B1 31.795 22.248 -0.9191.00 59.92 1~ ATOM 1646 CE2 PHE B1 29.905 21.357 0.292 1.00 56.97 ATOM :1647CZ PHE B1 30.410 22.176 -0.7071.00 58.52 ATOM :1648C PHE B1 35.200 18.747 2.262 1.00 56.22 ATOM :16490 PHE B1 34.732 18.314 3.311 1.00 58.27 ATOM :1650N PHE B1 33.748 17.916 0.462 1.00 54.28 15 ATOM :1651CA PHE B1 34.250 19.143 1.152 1.00 55.90 ATOM :1652N ASP B2 36.512 18.877 2.083 1.00 55.99 ATOM 1653 CA ASP B2 37.383 18.526 3.204 1.00 56.44 ATOM :1654CB ASP B2 38.876 18.485 2.792 1.00 59.88 ATOM 1655 CG ASP B2 39.364 19.782 2.139 1.00 65.04 20 ATOM 1656 OD1 ASP B2 40.076 19.729 1.091 1.00 67.12 ATOM 1657 OD2 ASP B2 39.042 20.860 2.684 1.00 68.18 ATOM 1658 C ASP B2 37.096 19.582 4.280 1.00 55.70 ATOM 1659 0 ASP B2 36.331 20.507 4.047 1.00 54.61 ATOM :1660N ARG B3 37.682 19.443 5.458 1.00 55.52 25 ATOM 1661 CA ARG B3 37.441 20.380 6.556 1.00 53.72 ATOM 1662 CB ARG B3 38.114 19.838 7.806 1.00 56.23 ATOM 1663 CG ARG B3 37.541 20.323 9.094 1.00 55.76 ATOM 1664 CD ARG B3 37.772 19.269 10.1391.00 55.83 ATOM 1665 NE ARG B3 36.531 18.930 10.8181.00 56.35 ATOM 1666 CZ ARG B3 36.23.3 17.708 11.2201.00 56.91 ATOM 1667 NH1 ARG B3 37.095 16.729 1Ø9941.00 56.22 ATOM 1668 NH2 ARG B3 35.090 17.468 11.8491.00 57.84 ATOM 1669 C ARG B3 37.909 21.822 6.295 1.00 53.67 ATOM 1670 0 ARG B3 37.395 22.772 6.888 1.00 53.80 35 ATOM 1671 N ALA B4 38.896 21.969 5.420 1.00 52.29 ATOM 1672 CA ALA B4 39.443 23.255 5.025 1.00 50.06 ATOM 1673 CB ALA B4 40.743 23.036 4.275 1.00 48.42 ATOM 1674 C ALA B4 38.442 23.978 4.131 1.00 49.06 ATOM 1675 0 ALA B4 38.225 25.179 4.270 1.00 47.12 40 ATOM 1676 N ASP B5 37.837 23.233 3.211 1.00 49.07 ATOM 1677 CA ASP B5 36.869 23.801 2.288 1.00 51.75 ATOM 1678 CB ASP B5 36.345 22.748 1.299 1.00 55.02 ATOM 1679 CG ASP B5 37.454 22.084 0.491 1.00 60.18 ATOM 1680 OD1 ASP B5 38.347 22.794 -0.0391.00 63.04 45 ATOM 1681 OD2 ASP B5 37.430 20.839 0.374 1.00 61.10 ATOM 1682 C ASP B5 35.699 24.381 3.051 1.00 51.17 ATOM 1683 0 ASP B5 35.179 25.428 2.670 1.00 51.32 ATOM 1684 N ILE B6 35.292 23.713 4.130 1.00 49.73 ATOM 1685 CA ILE B6 34.164 24.178 4.926 1.00 50.09 ATOM 1686 CB ILE B6 33.723 23.128 5.950 1.00 51.11 ATOM 1687 CG2 ILE B6 32.472 23.610 6.678 1.00 48.60 ATOM 1688 CG1 ILE B6 33.434 21.809 5.232 1.00 53.13 ATOM 1689 CD1 ILE B6 32.881 20.712 6.121 1.00 55.06 ATOM 1690 C ILE B6 34.448 25.480 5.653 1.00 49.98 55 ATOM 1691 0 ILE B6 33.700 26.450 5.518 1.00 51.60 ATOM 1692 N LEU B7 35.524 25.504 6.426 1.00 49.48 ATOM 1693 CA LEU B7 35.908 26.705 7.160 1.00 48.15 ATOM 1694 CB LEU B7 37.157 26.424 7.995 1.00 45.60 ATOM 1695 CG LEU B7 36.916 25.427 9.126 1.00 45.98 ATOM 1696 CD1 LEU B7 38.221 24.935 9.696 1.00 46.59 ATOM 1697 CD2 LEU B7 36.081 26.086 10.1911.00 44.50 -1~~
ATOM :1698C LEU B 7 36.167 27.850 6.195 1.00 47.43 ATOM :16990 LEU B 7 35.797 28.986 6.447 1.00 46.94 ATOM 1700 N T'IRB 8 36.799 27.529 5.080 1.00 49.45 ATOM 1701 CA TYR B 8 37.105 28.507 4.051 1.00 52.16 ATOM 1702 CB T'fRB 8 37.800 27.821 2.877 1.00 54.75 ATOM 1703 CG TYR B 8 38.090 28.758 1.737 1.00 56.10 ATOM 1704 CD1 TYR B 8 39.088 29.720 1.839 1.00 56.48 ATOM 1705 CE1 T'LRB 8 39.344 30.605 0.794 1.00 57.35 ATOM 1706 CD2 TYR B 8 37.348 28.701 0.564 1.00 57.26 1~ ATOM 1707 CE2 TYR B 8 37.592 29.581 -0.4841.00 57.99 ATOM 1708 CZ TYR B 8 38.590 30.528 -0.3641.00 57.33 ATOM 1709 OH TYR B 8 38.819 31.385 -1.4081.00 58.94 ATOM 1710 C T'IRB 8 35.858 29.234 3.537 1.00 52.55 ATOM 1711 0 T'IRB 8 35.867 30.460 3.387 1.00 52.22 15 ATOM 1712 N ASN B 9 34.796 28.482 3.249 1.00 52.51 ATOM 1713 CA ASN B 9 33.566 29.086 2.752 1.00 54.09 ATOM 1714 CB A;3NB 9 32.539 28.021 2.376 1.00 56.72 ATOM 1715 CG ASN B 9 32.963 27.203 1.163 1.00 60.46 ATOM 1716 ODl ASN B 9 33.966 27.509 0.512 1.00 61.72 ATOM 1717 ND2 ASN B 9 32.198 26.159 0.852 1.00 61.67 ATOM 1718 C ASN B 9 32.980 30.007 3.794 1.00 54.24 ATOM 1719 O ASN B 9 32.680 31.160 3.506 1.00 54.66 ATOM 1720 N ILE B 10 32.829 29.503 5.013 1.00 54.21 ATOM 1721 CA ILE B 10 32.282 30.310 6.104 1.00 53.77 25 ATOM 1722 CB ILE B 10 32.303 29.543 7.429 1.00 52.00 ATOM 1723 CG2 ILE B 10 31.860 30.451 8.552 1.00 50.79 ATOM 1724 CG1 ILE B 10 31.389 28.323 7.339 1.00 50.43 ATOM 1725 CD1 ILE B 10 31.531 27.371 8.498 1.00 47.56 ATOM 1726 C ILE B 10 33.085 31.592 6.284 1.00 55.12 ATOM 1727 0 ILE B 10 32.531 32.663 6.458 1.00 56.17 ATOM 1728 N ARG B 11 34.400 31.464 6.243 1.00 56.91 ATOM 1729 CA ARG B 11 35.297 32.595 6.386 1.00 58.48 ATOM 1730 CB ARG B 11 36.739 32.110 6.243 1.00 63.85 ATOM 1731 CG ARG B 11 37.799 33.170 6.434 1.00 68.86 35 ATOM 1732 CD ARG B 11 37.917 33.493 7.917 1.00 77.74 ATOM 1733 NE ARG B 11 39.211 34.078 8.264 1.00 85.52 ATOM 1734 CZ ARG B 11 40.384 33.635 7.807 1.00 88.55 ATOM 1735 NH1 ARG B 11 40.424 32.589 6.970 1.00 90.95 ATOM 1736 NH2 ARG B 11 41.518 34.239 8.178 1.00 87.63 ATOM 1737 C ARG B 11 35.030 33.639 5.306 1.00 58.49 ATOM 1738 0 ARG B 11 34.905 34.825 5.584 1.00 57.34 ATOM 1739 N GLN B 12 34.933 33.175 4.066 1.00 58.50 ATOM 1740 CA GLN B 12 34.748 34.055 2.927 1.00 57.77 ATOM 1741 CB GLN B 12 35.147 33.329 1.653 1.00 58.35 45 ATOM 1742 CG GLN B 12 36.124 34.100 0.814 1.00 62.22 ATOM 1743 CD GLN B 12 37.514 33.973 1.351 1.00 64.08 ATOM 1744 OE1 GLN B 12 38.011 32.862 1.501 1.00 68.35 ATOM 1745 NE2 GLN B 12 38.156 35.098 1.653 1.00 63.78 ATOM 1746 C GLN B 12 33.366 34.633 2.720 1.00 57.86 ATOM 1747 0 GIN B 12 33.219 35.657 2.059 1.00 59.62 ATOM 1748 N THR B 13 32.345 33.994 3.266 1.00 57.21 ATOM 1749 CA THR B 13 30.987 34.479 3.054 1.00 56.88 ATOM 1750 CB THR B 13 30.101 33.373 2.468 1.00 54.90 ATOM 1751 OG1 THR B 13 30.100 32.247 3.350 1.00 55.07 55 ATOM 1752 CG2 TIjRB 13 30.612 32.946 1.104 1.00 56.83 ATOM 1753 C THR B 13 30.295 35.009 4.298 1.00 58.52 ATOM 1754 0 Tl3RB 13 29.275 35.698 4.206 1.00 57.64 ATOM 1755 N SER B 14 30.848 34.691 5.462 1.00 60.24 ATOM 1756 CA SER B 14 30.247 35.117 6.715 1.00 60.31 ATOM 1757 CB SER B 14 30.884 34.369 7.878 1.00 60.50 ATOM 1758 OG SER B 14 30.086 34.485 9.034 1.00 63.18 I~L
ATOM ".759C SERB 14 30.343 36.619 6.949 1.00 59.80 ATOM 1760 0 SERB 14 31.247 37.293 6.443 1.00 60.23 ATOM 1761 N ARGB 15 29.382 37.134 7.710 1.00 58.15 ATOM 1762 CA ARGB 15 29.322 38.549 8.040 1.00 55.80 ATOM :1763CB ARGB 15 28.271 39.239 7.183 1.00 56.87 ATOM 1764 CG ARGB 15 28.540 39.145 5.684 1.00 60.72 ATOM :1765CD ARGB 15 27.721 40.179 4.945 1.00 63.19 ATOM :1766NE ARGB 15 28.008 41.515 5.475 1.00 67.21 ATOM :1767CZ ARGB 15 27.30'7 42.616 5.196 1.00 67.82 1~ ATOM :1768NH1 ARGB 15 26.259 42.549 4.384 1.00 69.12 ATOM :1769NH2 ARGB 15 27.660 43.789 5.722 1.00 66.84 ATOM :1770C ARGB 15 28.962 38.655 9.511 1.00 54.09 ATOM :17710 ARGB 15 27.'795 38.651 9.880 1.00 55.59 ATOM :1772N PROB 16 29.979 38.747 10.3771.00 51.42 15 ATOM :1773CD PROB 16 31.405 38.751 10.0151.00 48.17 ATOM :1774CA PROB 16 29.81'7 38.846 11.8281.00 48.94 ATOM :1775CB PROB 16 31.256 38.950 12.3281.00 48.44 ATOM :1776CG PROB 16 32.038 38.262 11.2841.00 48.62 ATOM :1777C PROB 16 28.974 40.014 12.3001.00 48.35 ATOM :17780 PROB 16 28.475 40.006 13.4201.00 49.87 ATOM 1779 N ASPB 17 28.82.5 41.026 11.4561.00 49.55 ATOM 1780 CA ASPB 17 28.048 42.201 11.8301.00 51.87 ATOM 1781 CB ASPB 17 28.638 43.469 1.1.2041.00 55.73 ATOM 1782 CG ASPB 17 29.956 43.896 11.8561.00 59.93 25 ATOM 1783 OD1 ASPB 17 30.158 43.598 13.0621.00 60.57 ATOM 1784 OD2 ASPB 17 30.781 44.548 11.1631.00 61.01 ATOM 1785 C ASPB 17 26.581 42.120 1.1.4581.00 51.65 ATOM 1786 O ASPB 17 25.837 43.066 11.6841.00 51.12 ATOM 1787 N VALB 18 26.156 40.990 10.9061.00 53.24 ATOM 1788 CA VALB 18 24.772 40.848 10.4951.00 53.38 ATOM 1789 CB VALB 18 24.679 40.682 8.978 1.00 52.53 ATOM 1790 CG1 VALB 18 23.238 40.628 8.551 1.00 53.33 ATOM 1791 CG2 VALB 18 25.38.5 41.833 8.299 1.00 52.08 ATOM 1792 C VALB 18 24.026 39.701 11.1571.00 54.80 35 ATOM 1793 O VALB 18 24.359 38.527 10.9801.00 57.05 ATOM 1794 N ILEB 19 22.999 40.062 11.9131.00 55.38 ATOM 1795 CA ILEB 19 22.150 39.105 12.6151.00 54.84 ATOM 1796 CB ILEB 19 21.128 39.899 13.4931.00 53.97 ATOM 1797 CG2 ILEB 19 20.17'7 40.699 12.6121.00 52.99 ATOM 1798 CG1 ILEB 19 20.354 38.963 14.4141.00 54.58 ATOM 1799 CD1 ILEB 19 19.598 39.696 15.4901.00 51.38 ATOM 1800 C ILEB 19 21.450 38.192 11.5861.00 55.77 ATOM 1801 0 ILEB 19 20.879 38.678 10.6051.00 56.23 ATOM 1802 N PROB 20 21.508 36.857 11.7871.00 57.54 45 ATOM 1803 CD PROB 20 22.223 36.204 12.8881.00 57.31 ATOM 1804 CA PROB 20 20.900 35.841 10.9001.00 59.26 ATOM 1805 CB PROB 20 21.478 34.521 11.4171.00 57.46 ATOM 1806 CG PROB 20 22.657 34.935 12.2351.00 58.77 ATOM 1807 C PROB 20 19.366 35.836 10.9401.00 62.02 ATOM 1808 0 PROB 20 18.732 34.806 11.1851.00 61.74 ATOM 1809 N THRB 21 18.781 36.997 10.6791.00 65.81 ATOM 1810 CA THRB 21 17.337 37.160 10.7051.00 69.72 ATOM 1811 CB THRB 21 16.974 38.658 10.9711.00 67.96 ATOM 1812 OG1 THRB 21 16.710 38.837 12.3671.00 69.51 55 ATOM 1813 CG2 THRB 21 15.765 39.087 10.1781.00 68.09 ATOM 1814 C THRB 21 16.606 36.658 9.455 1.00 73.11 ATOM 1815 0 THRB 21 17.000 36.942 8.315 1.00 71.83 ATOM 1816 N GLNB 22 15.532 35.907 9.694 1.00 77.49 ATOM 1817 CA GLNB 22 14.684 35.370 8.629 1.00 80.52 ATOM 1818 CB GLNB 22 14.492 33.871 8.842 1.00 81.72 ATOM 1819 CG GLNB 22 15.793 33.097 8.917 1.00 83.16 -10~
ATOM 1820 CD GLNB 22 15.654 31.8329.753 1.00 85.69 ATOM 1821 OE1 GLNB 22 15.421 31.90110.976 1.00 86.08 ATOM 1822 NE2 GLNB 22 15.787 30.6659.103 1.00 85.85 ATOM 1823 C GLNB 22 13.326 36.0918.717 1.00 81.72 ATOM 1824 0 GLNB 22 12.526 35.8379.632 1.00 80.46 ATOM 1825 N ARGB 23 13.075 36.9907.765 1.00 84.00 ATOM 1826 CA ARGB 23 11.829 37.7697.744 1.00 86.23 ATOM 1827 CB ARGB 23 10.599 36.8407.695 1.00 87.50 ATOM 1828 CG AR.GB 23 10.348 36.2156.314 1.00 89.89 1~ ATOM 1.829CD ARGB 23 10.796 34.7346.215 1.00 90.83 ATOM 1830 NE AR.GB 23 10.694 34.2424.833 1.00 93.76 ATOM 1.831CZ ARGB 23 9.590 34.3024.068 1.00 95.64 ATOM 1832 NH1 AR.GB 23 8.452 34.8324.534 1.00 96.17 ATOM 1.833NH2 ARGB 23 9.627 33.8552.811 1.00 95.03 15 ATOM 1834 C AR.GB 23 11.754 38.6578.987 1.00 86.03 ATOM 1.8350 AR.GB 23 12.776 39.1379.476 1.00 85.87 ATOM 1.836N ASPB 24 10.548 38.8799.497 1.00 86.08 ATOM 1.837CA ASPB 24 10.393 39.70310.693 1.00 85.72 ATOM 1.838CB ASPB 24 8.975 40.30110.799 1.00 89.17 ATOM 1.839CG ASPB 24 8.226 40.3399.453 1.00 90.77 ATOM 1.840OD1 ASPB 24 8.743 40.9658.486 1.00 92.05 ATOM 1.841OD2 ASPB 24 7.113 39.7469.376 1.00 89.95 ATOM 1.842C ASPB 24 10.622 38.79811.891 1.00 83.93 ATOM 1.8430 ASPB 24 10.445 39.21813.045 1.00 83.66 25 ATOM 1.844N ARGB 25 10.994 37.54911.613 1.00 81.18 ATOM 1.845CA ARGB 25 11.237 36.58412.677 1.00 78.99 ATOM 1.846CB AR.GB 25 11.318 35.15912.128 1.00 82.30 ATOM 1.847CG ARGB 25 10.001 34.54111.696 1.00 87.15 ATOM 1848 CD ARGB 25 10.171 33.02411.485 1.00 91.09 ATOM 1.849NE ARGB 25 8.908 32.37111.140 1.00 95.87 ATOM 1.850CZ AR.GB 25 8.747 31.05311.005 1.00 98.43 ATOM 1.851NH1 AR.GB 25 9.785 30.23511.186 1.00 97.96 ATOM 1.852NH2 ARGB 25 7.538 30.54910.709 1.00 99.56 ATOM 1.853C ARGB 25 12.527 36.87613.426 1.00 75.18 35 ATOM 1.8540 ARGB 25 13.573 37.10512.813 1.00 75.11 ATOM 1.855N PROB 26 12.463 36.87914.767 1.00 71.32 ATOM 1.856CD PROB 26 11.233 36.88515.569 1.00 69.54 ATOM 1.857CA PROB 26 13.629 37.13415.617 1.00 68.20 ATOM 1.858CB PROs 26 13.020 37.29817.007 1.00 68.04 4~ ATOM 1.859CG PROB 26 11.627 37.76316.720 1.00 68.94 ATOM 1.860C PROB 26 14.543 35.91715.572 1.00 65.66 ATOM 1.8610 PROB 26 14.114 34.83215.183 1.00 65.23 ATOM 1.862N VALB 27 15.801 36.09315.956 1.00 62.13 ATOM 1.863CA VALB 27 16.716 34.96915.990 1.00 58.35 45 ATOM 1.864CB VF,LB 27 18.185 35.41615.851 1.00 57.74 ATOM 1.865CG1 VALB 27 19.127 34.30816.328 1.00 54.93 ATOM 1866 CG2 VALB 27 18.479 35.73714.393 1.00 54.94 ATOM 1867 C VALB 27 16.491 34.34817.349 1.00 56.29 ATOM 1.8680 VF,LB 27 16.517 35.04318.360 1.00 56.31 ATOM 1.869N ALAB 28 16.243 33.04517.379 1.00 54.44 ATOM 1.870CA ALAB 28 16.008 32.38418.645 1.00 52.98 ATOM 1.871CB ALAB 28 15.095 31.20918.461 1.00 52.15 ATOM 1.872C ALAB 28 17.318 31.93819.262 1.00 52.73 ATOM 1.8730 ALAB 28 17.959 31.00418.782 1.00 51.86 55 ATOM 1.874N VALB 29 17.696 32.63220.334 1.00 51.10 ATOM 1.875CA VALB 29 18.911 32.35321.080 1.00 49.08 ATOM 1.876CB VALB 29 19.741 33.64221.324 1.00 49.72 ATOM 1.877CG1 VALB 29 20.986 33.32322.140 1.00 46.43 ATOM 1.878CG2 VALB 29 20.117 34.27219.996 1.00 49.12 ATOM 1.879C VALB 29 18.553 31.76222.428 1.00 48.65 ATOM 1.880O VALB 29 17.731 32.30123.161 1.00 48.71 -10~
ATOM 1881 N SERB 30 19.169 30.63822.746 1.00 50.09 ATOM 1882 CA SERB 30 18.925 29.99724.018 1.00 53.68 ATOM 1883 CB SERB 30 18.587 28.52123.817 1..0053.36 ATOM 1884 OG SERB 30 19.653 27.84523.180 1.00 57.88 ATOM 1885 C SERB 30 20.201 30.15024.823 1.00 56.00 ATOM 1886 O SERB 30 21.297 29.93324.306 1.00 57.56 ATOM 1887 N VALB 31 20.049 30.54226.084 1.00 57.69 ATOM 1888 CA VALB 31 21.175 30.75226.980 1.00 57.19 ATOM 1889 CB VALB 31 21.227 32.19827.460 1.00 57.32 1~ ATOM 1890 CG1 VALB 31 22.536 32.44928.185 1.00 58.47 ATOM 1891 CG2 VALB 31 21.044 33.14726.288 1.00 56.64 ATOM 1892 C VALB 31 21.016 29.87828.204 1.00 57.98 ATOM 1893 0 VALB 31 19.938 29.81528.787 1.00 59.53 ATOM 1894 N SERB 32 22.101. 29.23228.611 1.00 58.26 15 ATOM 1895 CA SERB 32 22.069 28.35629.765 1.00 58.30 ATOM 1896 CB SERB 32 21.806 26.91429.298 1.00 60.26 ATOM 1897 OG SERB 32 21.881. 25.97530.361 1.00 61.39 ATOM 1898 C SERB 32 23.374 28.41430.530 1.00 58.22 ATOM 1899 0 SERB 32 24.402 27.98330.024 1.00 62.28 ATOM 1900 N LEUB 33 23.340 28.93731.753 1.00 56.90 ATOM 1901 CA LEUB 33 24.548 29.00232.572 1.00 56.09 ATOM 1902 CB LEUB 33 24.489 30.18333.541 1.00 54.84 ATOM 1903 CG LEUB 33 24.257 31.55532.914 1.00 55.33 ATOM 1904 CD1 LEUB 33 24.483 32.64733.962 1.00 53.97 25 ATOM 1905 CD2 LEUB 33 25.201 31.73131.737 1.00 56.27 ATOM 1.906C LEUB 33 24.725 27.72833.379 1.00 55.50 ATOM 1.9070 LEUB 33 23.770 27.22033.950 1.00 56.54 ATOM 1.908N LYSB 34 25.948 27.21533.413 1.00 55.65 ATOM 1.909CA LYSB 34 26.270 26.01834.183 1.00 56.27 ATOM 1.910CB LYSB 34 26.815 24.90533.279 1.00 60.64 ATOM 1911 CG LYSB 34 25.908 24.52832.102 1.00 66.07 ATOM 1.912CD LYSB 34 24.552 23.96532.566 1.00 72.18 ATOM 1.913CE LYSB 34 23.611 23.67031.373 1.00 74.46 ATOM 1.914NZ LYSB 34 22.303 23.06831.799 1.00 74.04 35 ATOM 1.915C LYSB 34 27.365 26.49335.108 1.00 54.54 ATOM 1.9160 LYSB 34 28.463 26.81134.655 1.00 55.93 ATOM 1917 N PHEB 35 27.079 26.56436.401 1.00 52.21 ATOM 1.918CA PHEB 35 28.086 27.04537.336 1.00 49.54 ATOM 1.919CB PHEB 35 27.422 27.49138.633 1.00 46.23 ATOM 1.920CG PHEB 35 26.545 28.68238.450 1.00 47.55 ATOM 1.921CD1 PHEB 35 25.230 28.53638.035 1.00 48.89 ATOM 1.922CD2 PHEB 35 27.056 29.96838.603 1.00 48.56 ATOM 1.923CE1 PHEB 35 24.434 29.65337.771 1.00 47.34 ATOM 1.924CE2 PHEB 35 26.269 31.08738.343 1.00 45.87 45 ATOM 1.925CZ PHEB 35 24.958 30.92737.926 1.00 47.81 ATOM 1.926C PHEB 35 29.224 26.07237.595 1.00 49.37 ATOM 1.9270 PHEB 35 29.020 24.88037.833 1.00 48.82 ATOM 1.928N ILEB 36 30.434 26.60937.530 1.00 47.17 ATOM 1.929CA ILEB 36 31.634 25.82037.706 1.00 45.02 ATOM 1.930CB ILEB 36 32.641 26.10636.574 1.00 42.09 ATOM 1.931CG2 ILEB 36 33.858 25.23036.717 1.00 38.48 ATOM 1.932CG1 ILEB 36 31.966 25.89735.224 1.00 41.05 ATOM 1.933CD1 ILEB 36 31.393 24.52035.028 1.00 41.45 ATOM 1.934C ILEB 36 32.284 26.14139.029 1.00 45.51 rJ'rJATOM 1.9350 ILEB 36 32.977 25.30439.603 1.00 45.83 ATOM 1.936N ASNB 37 32.068 27.35139.522 1.00 45.06 ATOM 1937 CA ASNB 37 32.678 27.71940.792 1.00 45.81 ATOM 1.938CB ASNB 37 34.200 27.71240.652 1.00 43.65 ATOM 1939 CG ASNB 37 34.900 27.38441.950 1.00 47.86 ATOM 1.940OD1 ASNB 37 34.518 27.86443.025 1.00 49.43 ATOM 1.941ND2 ASNB 37 35.942 26.57241.862 1.00 46.99 -1()~
ATOM 1942 C ASNB 37 32.222 29.07741.322 1.00 45.58 ATOM 7_943O ASNB 37 31.767 29.93140.566 1.00 44.62 ATOM 7_944N ILEB 38 32.335 29.24842.635 1.00 45.83 ATOM 7_945CA ILEB 38 31.973 30.48943.301 1.00 47.98 'rJATOM 7_946CB ILEB 38 30.781 30.28744.214 1.00 46.41 ATOM 7_947CG2 ILEB 38 30.510 31.55044.976 1.00 46.45 ATOM 1948 CG1 ILEB 38 29.567 29.90543.356 1.00 47.23 ATOM 1949 CD1 ILEB 38 28.365 29.40644.105 1.00 48.96 ATOM 7_950C ILEB 38 33.221 30.80544.086 1.00 50.65 ATOM 7_9510 ILEB 38 33.546 30.10945.040 1.00 52.37 ATOM 7_952N LEUB 39 33.926 31.85543.668 1.00 52.96 ATOM 7_953CA LEUB 39 35.207 32.21444.264 1.00 53.68 ATOM 7_954CB LEUB 39 36.137 32.69843.157 1.00 53.70 ATOM 1955 CG LEUB 39 36.204 31.70642.000 1.00 53.99 ATOM 1956 CD1 LEUB 39 37.099 32.25740.904 1.00 53.07 ATOM 1957 CD2 LEUB 39 36.718 30.36442.510 1.00 51.88 ATOM ._958C LEUB 39 35.27?. 33.18845.418 1.00 54.85 ATOM "-959O LEUB 39 36.061 32.99446.342 1.00 55.07 ATOM 1960 N GI~UB 40 34.489 34.25545.359 1.00 55.18 ATOM 1961 CA GLUB 40 34.509 35.22046.446 1.00 58.32 ATOM 1962 CB GLUB 40 35.423 36.40046.144 1.00 59.68 ATOM 1963 CG GLUB 40 36.879 36.04146.018 1.00 65.11 ATOM _'964CD GLUB 40 37.749 37.27145.846 1.00 69.72 ATOM :_965OE1 GLUB 40 37.534 38.03444.867 1.00 72.04 ATOM :'_966OE2 GLUB 40 38.648 37.47746.693 1.00 70.63 ATOM w'967C GLUB 40 33.128 35.73846.685 1.00 59.54 ATOM 1968 O GLUB 40 32.393 36.05745.747 1.00 59.65 ATOM 1969 N VALB 41 32.772 35.81647.956 1.00 60.26 ATOM 1970 CA VALB 41 31.468 36.30448.323 1.00 58.68 ATOM :'_971CB VALB 41 30.599 35.15948.862 1.00 59.00 ATOM "972 CG1 VALB 41 29.318 35.71149.450 1.00 61.18 ATOM 1973 CG2 VALB 41 30.279 34.18647.740 1.00 59.58 ATOM "'..974C VALB 41 31.666 37.36849.379 1.00 58.15 ATOM 1975 0 VALB 41 32.594 37.29050.187 1.00 56.97 35 ATOM 1976 N ASNB 42 30.811 38.38349.337 1.00 58.17 ATOM 1977 CA ASNB 42 30.863 39.46650.302 1.00 58.74 ATOM 1978 CB ASNB 42 31.609 40.67349.730 1.00 58.84 ATOM 1979 CG ASNB 42 31.962 41.70250.795 1.00 58.68 ATOM 1980 OD1 ASNB 42 31.122 42.10051.593 1.00 58.91 ATOM 1981 ND2 ASNB 42 33.215 42.13850.806 1.00 58.72 ATOM 1982 C ASNB 42 29.412. 39.82350.577 1.00 60.60 ATOM 1983 0 ASNB 42 28.738 40.45749.747 1.00 60.01 ATOM 1984 N GLUB 43 28.926 39.40151.742 1.00 61.86 ATOM 1985 CA GLUB 43 27.543 39.66952.111 1.00 62.81 45 ATOM 1986 CB GLUB 43 27.117 38.76053.267 1.00 64.87 ATOM 1987 CG GLUB 43 25.640 38.87153.591 1.00 67.01 ATOM 1988 CD GLUB 43 25.152 37.77954.525 1.00 69.52 ATOM 1989 OE1 GLUB 43 23.973 37.84254.945 1.00 68.10 ATOM .L990OE2 GLUB 43 25.944 36.85454.831 1.00 70.46 'rJ~ATOM "991 C GI~UB 43 27.332 41.13252.476 1.00 60.60 ATOM :_9920 GLUB 43 26.223 41.64952.387 1.00 59.23 ATOM '1993N ILEB 44 28.408 41.79252.882 1.00 60.18 ATOM 1994 CA ILEB 44 28.356 43.19953.254 1.00 61.54 ATOM "995 CB ILEB 44 29.674 43.66953.910 1.00 62.98 55 ATOM __996CG2 ILEB 44 29.601 45.17254.183 1.00 61.14 ATOM .997 CG1 ILEB 44 29.950 42.87755.194 1.00 63.64 ATOM 998 CD1 ILEB 44 29.004 43.20556.335 1.00 65.05 ATOM 1999 C ILEB 44 28.141 44.06952.016 1.00 62.14 ATOM 2000 0 ILEB 44 27.318 44.99252.024 1.00 62.54 ATOM 2001 N THRB 45 28.894 43.77350.959 1.00 60.63 ATOM 2002 CA THRB 45 28.806 44.52749.721 1.00 59.11 ATOM 2003 CB THR B 45 30.190 44.696 49.0901.00 58.49 ATOM 2004 OG1 THR B 45 30.749 43.403 48.8151.00 60.11 ATOM 2005 CG2 THR B 45 31.106 45.444 50.0361.00 56.17 ATOM 2006 C THR B 45 27.879 43.894 48.6881.00 58.30 ATOM 2007 0 THR B 45 27.555 44.521 47.6751.00 58.45 ATOM 2008 N ASN B 46 27.450 42.660 48.9331.00 56.14 ATOM 2009 CA ASN B 46 26.560 42.001 47.9861.00 55.54 ATOM 2010 CB ASN B 46 25.242 42.770 47.8941.00 54.26 ATOM 2011 CG ASN B 46 24.161 42.171 48.7671.00 56.06 ATOM 2012 OD1 ASN B 46 23.195 42.835 49.1031.00 55.63 ATOM 2013 ND2 ASN B 46 24.314 40.898 49.1231.00 56.99 ATOM 2014 C ASN B 46 27.190 41.867 46.5911.00 54.59 ATOM 2015 0 ASN B 46 26.589 42.228 45.5741.00 52.67 ATOM 2016 N GLU B 47 28.408 41.337 46.5651.00 53.06 15 ATOM 2017 CA GLU B 47 29.141 41.131 45.3301.00 51.52 ATOM 2018 CB GLU B 47 30.320 42.090 45.2671.00 49.41 ATOM 2019 CG GLU B 47 29.902 43.534 45.2111.00 51.44 ATOM 2020 CD GLU B 47 31.084 44.472 45.2321.00 53.91 ATOM 2021 OE1 GLU B 47 32.183 44.015 44.8621.00 51.27 ATOM 2022 OE2 GLU B 47 30.911 45.662 45.6041.00 58.92 ATOM 2023 C GLU B 47 29.627 39.697 45.2621.00 50.23 ATOM 2024 0 GLU B 47 30.100 39.150 46.2451.00 50.97 ATOM 2025 N VAL B 48 29.509 39.090 44.0911.00 50.68 ATOM 2026 CA VAL B 48 29.928 37.706 43.9091.00 50.46 25 ATOM 2027 CB VAL B 48 28.712 36.793 43.6331.00 49.57 ATOM 2028 CG1 VAL B 48 29.162 35.370 43.4401.00 53.01 ATOM 2029 CG2 VAL B 48 27.749 36.861 44.7811.00 50.46 ATOM 2030 C VAL B 48 30.910 37.554 42.7571.00 49.70 ATOM 2031 0 VAL B 48 30.785 38.204 41.7271.00 50.33 ATOM 2032 N ASP B 49 31.891 36.688 42.9501.00 48.84 ATOM 2033 CA ASP B 49 32.888 36.414 41.9351.00 49.56 ATOM 2034 CB ASP B 49 34.283 36.610 42.5141.00 51.66 ATOM 2035 CG ASP B 49 35.320 36.772 41.4561.00 50.41 ATOM 2036 OD1 A:3PB 49 35.214 36.073 40.4431.00 52.66 ATOM 2037 OD2 ASP B 49 36.240 37.586 41.6391.00 51.65 ATOM 2038 C A:3PB 49 32.648 34.949 41.5901.00 49.62 ATOM 2039 0 ASP B 49 32.973 34.052 42.3641.00 49.38 ATOM 2040 N VAL B 50 32.078 34.720 40.4161.00 49.68 ATOM 2041 CA Vi~LB 50 31.721 33.381 39.9821.00 48.91 ATOM 2042 CB VAL B 50 30.168 33.242 40.0001.00 50.39 ATOM 2043 CG1 VAL B 50 29.565 33.968 38.8071.00 47.68 ATOM 2044 CG2 VAL B 50 29.767 31.781 40.0061.00 52.12 ATOM 2045 C VAL B 50 32.241 32.978 38.5981.00 47.99 ATOM 2046 0 VAL B 50 32.533 33.824 37.7581.00 48.54 45 ATOM 2047 N VAL B 51 32.349 31.669 38.3831.00 45.73 ATOM 2048 CA VAL B 51 32.802 31.091 37.1161.00 44.16 ATOM 2049 CB VAL B 51 34.037 30.178 37.3131.00 43.78 ATOM 2050 CG1 VAL B 51 34.324 29.416 36.0311.00 40.41 ATOM 2051 CG2 VAL B 51 35.245 31.005 37.7281.00 40.89 ATOM 2052 C VAL B 51 31.673 30.227 36.5691.00 45.01 ATOM 2053 0 VAL B 51 31.075 29.458 37.3181.00 48.28 ATOM 2054 N PHE B 52 31.382 30.328 35.2751.00 42.51 ATOM 2055 CA PHE B 52 30.307 29.535 34.7081.00 41.24 ATOM 2056 CB PHE B 52 28.981 30.224 34.9931.00 41.72 ATOM :2057CG PHE B 52 28.876 31.595 34.3941.00 42.31 ATOM :2058CD1 PFiEB 52 28.448 31.767 33.0881.00 42.63 ATOM 2059 CD2 PHE B 52 29.248 32.711 35.1231.00 43.12 ATOM 2060 CE1 PHE B 52 28.394 33.025 32.5211.00 43.87 ATOM 2061 CE2 PHE B 52 29.197 33.976 34.5621.00 43.32 ATOM 2062 CZ PHE B 52 28.770 34.132 33.2611.00 43.87 ATOM 2063 C PHE B 52 30.463 29.345 33.2171.00 43.44 ATOM 2064 0 PHEB 52 31.264 30.008 32.585 1.0046.26 ATOM 2065 N TRPB 53 29.692 28.428 32.655 1.0044.90 ATOM 2066 CA TRPB 53 29.725 28.188 31.223 1.0047.46 ATOM 2067 CB TRPB 53 29.655 26.698 30.907 1.0047.31 ATOM 2068 CG TRPB 53 30.869 25.949 31.278 1.0049.36 ATOM 2069 CD2 TRPB 53 31.029 24.535 31.246 1.0050.82 ATOM 2070 CE2 TRPB 53 32.342 24.253 31.686 1.0049.80 ATOM 2071 CE3 TRPB 53 30.189 23.473 30.887 1.0051.30 ATOM 2072 CDl TRPB 53 32.057 26.463 31.719 1.0050.05 1~ ATOM 2073 NE1 TRPB 53 32.947 25.448 31.968 1.0050.43 ATOM 2074 CZ2 TRPB 53 32.835 22.955 31.779 1.0050.23 ATOM 2075 CZ3 TRPB 53 30.676 22.182 30.977 1.0049.78 ATOM 2076 CH2 TRPB 53 31.990 21.932 31.421 1.0050.88 ATOM 2077 C TRPB 53 28.51.6 28.860 30.619 1.0048.93 15 ATOM 2078 0 TRPB 53 27.388 28.490 30.912 1.0048.69 ATOM 2079 N GLNB 54 28.746 29.846 29.770 1.0050.46 ATOM 2080 CA GLNB 54 27.643 30.543 29.155 1.0051.66 ATOM 2081 CB GLNB 54 28.036 31.984 28.844 1.0051.35 ATOM 2082 CG GLNB 54 26.871 32.851 28.407 1.0053.49 ATOM 2083 CD GLNB 54 27.117 34.326 28.693 1.0057.50 ATOM 2084 OE1 GLNB 54 27.399 34.711 29.837 1.0057.95 ATOM 2085 NE2 GLNB 54 27.016 35.161 27.659 1.0058.04 ATOM 2086 C GLNB 54 27.273 29.790 27.898 1.0052.38 ATOM 2087 0 GLNB 54 27.564 30.209 26.786 1.0054.42 25 ATOM 2088 N GLNB 55 26.638 28.650 28.101 1.0052.78 ATOM 2089 CA GLNB 55 26.203 27.793 27.017 1.0053.84 ATOM 2090 CB GLNB 55 25.672 26.501 27.623 1.0058.14 ATOM 2091 CG GLNB 55 24.985 25.549 26.663 1.0066.74 ATOM 2092 CD GLNB 55 24.756 24.190 27.315 1.0070.87 ATOM 2093 OE1 GLNB 55 24.456 24.108 28.528 1.0073.46 ATOM 2094 NE2 GLNB 55 24.897 23.117 26.527 1.0069.32 ATOM 2095 C GLNB 55 25.145 28.495 26.168 1.0051.37 ATOM 2096 0 GLNB 55 23.993 28.631 26.563 1.0052.24 ATOM 2097 N THRB 56 25.558 28.935 24.989 1.0048.92 35 ATOM 2098 CA THRB 56 24.690 29.660 24.083 1.0047.03 ATOM 2099 CB THRB 56 25.307 31.018 23.741 1.0047.18 ATOM 2100 OG1 THRB 56 25.758 31.647 24.946 1.0046.91 ATOM 2101 CG2 THRB 56 24.291 31.909 23.056 1.0045.50 ATOM 2102 C THRB 56 24.466 28.896 22.787 1.0046.66 ATOM 2103 0 THRB 56 25.351 28.202 22.306 1.0046.60 ATOM 2104 N z'HRB 57 23.273 29.034 22.220 1.0045.86 ATOM 2105 CA THRB 57 22.942 28.350 20.984 1.0044.53 ATOM 2106 CB THRB 57 22.320 26.958 21.247 1.0044.84 ATOM 2107 OG1 THRB 57 23.271 26.115 21.910 1.0041.11 45 ATOM 2108 CG2 THRB 57 21.942 26.306 19.936 1.0046.63 ATOM 2109 C THRB 57 21.967 29.152 20.162 1.0043.27 ATOM 2110 0 THRB 57 21.106 29.825 20.700 1.0044.01 ATOM 2111 N TRPB 58 22.122 29.086 18.849 1.0041.40 ATOM 2112 CA TRPB 58 21.235 29.792 17.945 1.0042.18 ATOM 2113 CB TRPB 58 21.500 31.302 17.968 1.0040.63 ATOM 2114 CG TRPB 58 22.800 31.729 17.377 1.0040.64 ATOM 2115 CD2 TRPB 58 24.048 31.827 18.054 1.0037.47 ATOM 2116 CE2 TRPB 58 24.998 32.252 17.113 1.0037.44 ATOM 2117 CE3 TRPB 58 24.456 31.594 19.371 1.0037.69 55 ATOM 2118 CDl TRPB 58 23.036 32.088 16.087 1.0039.23 ATOM 2119 NE1 TRPB 58 24.354 32.404 15.917 1.0036.19 ATOM 2120 CZ2 TRPB 58 26.336 32.452 17.444 1.0040.36 ATOM 2121 CZ3 TRPB 58 25.778 31.789 19.701 1.0038.85 ATOM 2122 CH2 TRPB 58 26.708 32.215 18.742 1.0040.16 ATOM 2123 C TRPB 58 21.430 29.217 16.561 1.0043.00 ATOM 2124 O TRPB 58 22.226 28.320 16.383 1.0044.24 -l~~
ATOM 2125 N SERB 59 20.711 29.72915.579 1.00 47.57 ATOM 2126 CA SERB 59 20.814. 29.18114.246 1.00 50.36 ATOM 2127 CB SERB 59 19.517 28.41013.937 1.00 52.43 ATOM 2128 OG SERB 59 19.677 27.45512.901 1.00 58.14 'rJATOM 2129 C SE:RB 59 21.073 30.25013.191 1.00 51.80 ATOM 2130 0 SERB 59 20.440 31.30713.184 1.00 48.66 ATOM 2131 N ASPB 60 22.018 29.95412.303 1.00 53.93 ATOM !132 CA ASPB 60 22.393 30.84411.206 1.00 56.01 ATOM 2133 CB ASPB 60 23.766 31.46211.474 1.00 57.13 1~ ATOM 2134 CG ASPB 60 24.163 32.50310.437 1.00 58.21 ATOM 2135 OD1 ASPB 60 23.714 32.4139.275 1.00 56.08 ATOM 2.136OD2 ASPB 60 24.952. 33.40710.786 1.00 59.82 ATOM 2137 C ASPB 60 22.453 29.9769.953 1.00 57.25 ATOM 2.1380 ASPB 60 23.458 29.3159.683 1.00 57.02 ATOM 2139 N ARGB 61 21.370 29.9799.192 1.00 59.51 ATOM 2140 CA ARGB 61 21.281 29.1717.981 1.00 62.14 ATOM 2141 CB ARGB 61 19.852 29.2027.418 1.00 65.88 ATOM 2142 CG ARGB 61 18.842 28.2888.125 1.00 71.80 ATOM 2143 CD ARGB 61 17.562 28.1897.282 1.00 79.30 ATOM 2144 NE ARGB 61 16.561 27.2457.806 1.00 85.93 ATOM 2145 CZ ARGB 61 15.393 26.9677.210 1.00 88.02 ATOM <?146NH1 ARGB 61 15.059 27.5536.059 1.00 89.55 ATOM 2.147NH2 ARGB 61 14.550 26.1017.762 1.00 88.72 ATOM 2148 C AF;GB 61 22.256 29.5376.868 1.00 61.20 25 ATOM 2149 0 ARGB 61 22.488 28.7255.972 1.00 61.95 ATOM 2150 N TFiRB 62 22.819 30.7426.898 1.00 59.72 ATOM 2151 CA THRB 62 23.755 31.1335.846 1.00 59.39 ATOM 2152 CB THRB 62 24.072 32.6535.878 1.00 61.53 ATOM '<?153OG1 TFIRB 62 24.790 32.9817.077 1.00 62.67 ATOM 2154 CG2 TFIRB 62 22.783 33.4615.826 1.00 61.46 ATOM 2155 C THRB 62 25.055 30.3555.992 1.00 58.40 ATOM 2156 0 TFIRB 62 25.923 30.4105.129 1.00 58.95 ATOM 2157 N LEUB 63 25.176 29.6267.095 1.00 57.74 ATOM 2158 CA LEUB 63 26.365 28.8317.381 1.00 55.00 35 ATOM 2159 CB LEUB 63 26.677 28.8718.880 1.00 53.55 ATOM 2160 CG LEUB 63 26.908 30.2309.531 1.00 52.72 ATOM <'?161CD1 LEUB 63 27.061 30.07011.038 1.00 53.77 ATOM 2162 CD2 LEUB 63 28.14' 30.8668.929 1.00 52.77 ATOM 2163 C LEUB 63 26.163 27.3776.971 1.00 54.84 ATOM 2164 0 LEUB 63 27.125 26.6246.858 1.00 55.28 ATOM <?165N ALAB 64 24.911 26.9866.767 1.00 53.09 ATOM 2166 CA ALAB 64 24.579 25.6216.403 1.00 54.25 ATOM 2167 CB ALAB 64 23.078 25.4746.274 1.00 54.84 ATOM 2168 C ALAB 64 25.235 25.1735.116 1.00 54.35 45 ATOM <?1690 ALAB 64 25.441 25.9734.208 1.00 56.81 ATOM 2170 N TRPB 65 25.543 23.8845.040 1.00 50.85 ATOM 2171 CA TRPB 65 26.148 23.3053.851 1.00 50.36 ATOM 2172 CB TRPB 65 27.674 23.4493.895 1.00 47.85 ATOM 2173 CG TRPB 65 28.356 22.4964.836 1.00 44.59 ATOM 2174 CD2 TRPB 65 28.626 22.7046.229 1.00 42.42 ATOM :?175CE2 TRPB 65 29.244 21.5356.711 1.00 41.31 ATOM <?176CE3 TRPB 65 28.406 23.7667.115 1.00 39.86 ATOM :?177CD1 TRPB 65 28.809 21.2474.544 1.00 43.65 ATOM 2178 NE1 TRPB 65 29.344 20.6645.662 1.00 42.95 ~J'rJATOM <?179CZ2 TRPB 65 29.645 21.3938.041 1.00 41.27 ATOM :?180CZ3 TRPB 65 28.807 23.6248.439 1.00 39.24 ATOM 2181 CH2 TRPB 65 29.419 22.4458.886 1.00 40.26 ATOM 2182 C TRPB 65 25.751 21.8353.839 1.00 51.92 ATOM :?1830 TRPB 65 25.269 21.3124.846 1.00 51.65 ATOM 2184 N ASNB 66 25.933 21.1732.703 1.00 54.28 ATOM 2185 CA ASNB 66 25.579 19.7602.599 1.00 56.88 -1~g ATOM 2186 CB ASNB 66 25.361 19.349 1.139 1.00 59.16 ATOM 2187 CG ASNB 66 25.067 17.869 1.006 1.00 62.92 ATOM 2188 OD1 ASNB 66 25.084 17.308 -0.0901.00 64.20 ATOM 2189 ND2 ASNB 66 24.792 17.223 2.138 1.00 63.82 ATOM 2190 C ASNB 66 26.684 18.903 3.197 1.00 56.22 ATOM 2191 0 ASNB 66 27.826 18.942 2.747 1.00 54.74 ATOM 2192 N SERB 67 26.336 18.112 4.200 1.00 57.45 ATOM 2193 CA SERB 67 27.323 17.276 4.866 1.00 60.21 ATOM 2194 CB SERB 67 27.251 17.503 6.376 1.00 60.70 ATOM 2195 OG SERB 67 25.956 17.197 6.844 1.00 59.26 ATOM 2196 C SERB 67 27.139 15.796 4.554 1.00 60.90 ATOM 2197 0 SERB 67 27.705 14.926 5.221 1.00 59.74 ATOM 2198 N SERB 68 26.350 15.519 3.528 1.00 62.89 ATOM 2199 CA SERB 68 26.094 14.148 3.129 1.00 64.44 ATOM 2200 CB SERB 68 25.141 14.127 1.933 1.00 64.07 ATOM 2201 OG SERB 68 25.569 15.023 0.923 1.00 65.05 ATOM 2202 C SERB 68 27.399 13.437 2.790 1.00 65.22 ATOM 2203 0 SERB 68 27.491 12.215 2.898 1.00 65.18 ATOM 2204 N HISB 69 28.414 14.203 2.401 1.00 66.21 ATOM 2205 CA HISB 69 29.702 13.617 2.054 1.00 66.70 ATOM 2206 CB HISB 69 29.832 13.502 0.539 1.00 69.64 ATOM 2207 CG HISB 69 29.047 12.363 -0.0251.00 74.89 ATOM 2208 CD2 HISB 69 29.433 11.123 -0.4171.00 76.05 ATOM 2209 ND1 HISB 69 27.673 12.393 -0.1431.00 76.35 25 ATOM 2210 CE1 HISB 69 27.245 11.221 -0.5831.00 76.49 ATOM :211 NE2 HISB 69 28.293 10.433 -0.7571.00 76.65 ATOM 2212 C HI:SB 69 30.895 14.352 2.633 1.00 65.56 ATOM 2.2130 HI:SB 69 31.919 14.538 1.971 1.00 63.93 ATOM 2214 N SERB 70 30.746 14.737 3.897 1.00 65.07 ATOM 2215 CA SERB 70 31.772 15.463 4.632 1.00 63.00 ATOM 2216 CB SERB 70 31.954 16.854 4.004 1.00 61.97 ATOM a?217OG SERB 70 30.716 17.393 3.551 1.00 59.22 ATOM 2218 C SERB 70 31.353 15.576 6.105 1.00 62.92 ATOM 2219 0 SERB 70 30.288 15.077 6.507 1.00 62.73 35 ATOM 2220 N PROB 71 32.204 16.199 6.937 1.00 62.42 ATOM '<?221CD PROB 71 33.624 16.490 6.672 1.00 61.13 ATOM 2222 CA PROB 71 31.901 16.371 8.361 1.00 61.29 ATOM :?223CB PROB 71 33.124 17.103 8.879 1.00 61.30 ATOM :?224CG PROB 71 34.214 16.490 8.063 1.00 60.40 ATOM :?225C PROB 71 30.619 17.159 8.575 1.00 61.12 ATOM :?2260 PROB 71 30.22' 17.964 7.733 1.00 60.52 ATOM 2227 N ASPB 72 29.973 16.916 9.708 1.00 62.69 ATOM 2228 CA ASPB 72 28.714 17.587 10.0461.00 62.55 ATOM 2229 CB ASPB 72 27.839 16.649 10.8831.00 64.34 45 ATOM 2230 CG ASPB 72 27.143 15.613 10.0401.00 67.53 ATOM :?231OD1 ASPB 72 25.937 15.794 9.767 1.00 67.60 ATOM :?232OD2 ASPB 72 27.808 14.627 9.631 1.00 70.97 ATOM :?233C ASPB 72 28.962 18.858 10.8271.00 60.43 ATOM :?234O ASPB 72 28.13'7 19.780 10.8151.00 58.20 ATOM 2235 N GLNB 73 30.123 18.883 11.4831.00 58.87 ATOM 2236 CA GLNB 73 30.549 19.981 12.3391.00 58.03 ATOM 2237 CB GLNB 73 30.400 19.583 13.7881.00 60.56 ATOM 2238 CG GLNB 73 29.025 19.532 14.3461.00 62.56 ATOM 2239 CD GLNB 73 29.096 19.033 15.7631.00 64.10 55 ATOM 2240 OE1 GLNB 73 29.599 17.945 16.0031.00 67.42 ATOM 2241 NE2 GLNB 73 28.628 19.830 16.7111.00 65.84 ATOM 2242 C GLNB 73 31.998 20.392 12.1651.00 55.43 ATOM 2243 0 GLNB 73 32.845 19.591 11.7541.00 56.41 ATOM 2244 N VALB 74 32.275 21.642 12.5221.00 50.91 ATOM 2245 CA VALB 74 33.62:1 22.197 12.4641.00 48.23 ATOM 2246 CB VALB 74 33.925 22.849 11.1071.00 46.99 ATOM 2247 CG1 74 34.009 21.782 10.026 1.00 6 'JAL 48.63 B

ATOM 2248 CG2 74 32.864 23.871 10.777 1.0045.41 6 VAL
B

ATOM 2249 C VAL 74 33.734 23.259 13.532 1.0046.89 6 B

ATOM 2250 0 VAL 74 32.731 23.812 13.964 1.0046 8 ATOM 2251 N SER 75 34.951 23.524 13.980 1.00. 7 B 44.18 ATOM 2252 CA SER 75 35.177 24.551 14.982 1.0041.30 6 B

ATOM 2253 CB SER 75 36.314 24.145 15.920 1.0039.05 6 B

ATOM 2254 OG SER 75 35.850 23.290 16.932 1.0030.94 8 B

ATOM 2255 C SER 75 35.513 25.856 14.264 1.0040 6 ATOM 2256 0 SER 75 36.478 25.936 13.516 1.00. 8 B 39.74 ATOM 2257 N VAL 76 34.701. 26.875 14.497 1.0039.53 7 B

ATOM 2258 CA VAL 76 34.885 28.167 13.861 1.0040.26 6 B

ATOM 2259 CB VAL 76 33.607 28.580 13.124 1.0042.73 6 B

ATOM 2260 CG1VAL 76 33.788 29.928 12.483 1.0043 6 15 ATOM 2261 CG2VAL 76 33.244 27.539 12.090 1.00. 6 B 40.50 ATOM 2262 C VAL 76 35.218 29.256 14.861 1.0040.57 6 B

ATOM 2263 0 VAL 76 34.626 29.322 15.926 1.0041.80 8 B

ATOM 2264 N PRO 77 36.188 30.120 14.541 1.0040.43 7 B

ATOM 2265 CD PRO 77 37.176 30.053 13.460 1.0039 6 ATOM 2266 CA PRO 77 36.527 31.189 15.479 1.00. 6 B 39.73 ATOM 2267 CB PRO 77 37.77_7 31.853 14.816 1.0040.77 6 B

ATOM 2268 CG PRO 77 38.342 30.728 14.078 1.0040.80 6 B

ATOM 2269 C FRO 77 35.346 32.141 15.622 1.0038.02 6 B

ATOM 2270 0 FRO 77 34.663 32.438 14.658 1 39 8 25 ATOM 2271 N ILE 78 35.105 32.600 16.835 . . 7 B 1.0037.63 ATOM 2272 CA ILE 78 34.018 33.515 17.129 1.0039.61 6 B

ATOM 2273 CB ILE 78 34.107 33.946 18.602 1.0041.86 6 B

ATOM 2274 CG2ILE 78 33.311 35.183 18.861 1.0040.86 6 B

ATOM 2275 CG1ILE 78 33.622 32.799 19.469 1.0045 6 ATOM 2276 CD1ILE 78 32.313 32.232 18.983 1.00. 6 B 46.64 ATOM 2277 C ILE 78 34.000 34.741 16.231 1.0041.00 6 B

ATOM 2278 0 ILE 78 32.947 35.225 15.846 1.0041.00 8 B

ATOM 2279 N SER 79 35.185 35.227 15.898 1.0043.87 7 B

ATOM 2280 CA SER 79 35.368 36.399 15.047 1.0044 6 35 ATOM 2281 CB SER 79 36.842 36.792 15.061 1.00. 6 B 46.91 ATOM 2282 OG SER 79 37.657 35.687 14.696 1.0049.85 8 B

ATOM 2283 C SER 79 34.914 36.244 13.593 1.0043.47 6 B

ATOM 2284 0 SER 79 34.805 37.228 12.876 1.0043.49 8 B

ATOM 2285 N SER 80 34.656 35.016 13.160 1 43 7 ATOM 2286 CA SER 80 34.227 34.769 11.793 . . 6 B 1.0044.14 ATOM 2287 CB SER 80 34.955 33.552 11.221 1.0044.85 6 B

ATOM 2288 OG SER 80 36.354 33.781 11.115 1.0052.06 8 B

ATOM 2289 C SER 80 32.731 34.545 11.690 1.0044.49 6 B

ATOM 2290 0 SER 80 32.213 34.308 10.609 1 44 8 45 ATOM 2291 N LEU 81 32.039 34.625 12.820 . . 7 B 1.0045.89 ATOM 2292 CA LEU 81 30.589 34.418 12.858 1.0045.78 6 B

ATOM 2293 CB LEU 81 30.250 33.187 1.3.7001.0042.48 6 B

ATOM 2294 CG LEU 81 30.945 31.867 13.420 1.0042.60 6 B

ATOM 2295 CD1LEU 81 30.769 30.949 14.584 1.0041 6 ATOM :?296 CD2LEU 81 30.379 31.266 12.165 1.00. 6 B 45.70 ATOM 2297 C LEU 81 29.909 35.611 13.513 1.0045.11 6 B

ATOM :?298 O LEU 81 30.562 36.439 14.154 1.0046.02 8 B

ATOM ;?299 N TRP 82 28.596 35.696 13.344 1.0042.92 7 B

ATOM '300 CA TRP 82 27.829 36.737 13.984 1.0040 6 55 ATOM 2301 CB TRP 82 26.493 36.962 13.290 1.00. 6 B 42.22 ATOM 2302 CG TRP 82 25.535 37.766 14.126 1.0043.85 6 B

ATOM '<?303CD2TRP 82 24.580 37.257 15.072 1.0044.14 6 B

ATOM 2304 CE2TRP 82 23.972 38.369 15.687 1.0042.05 6 B

ATOM 2.305 CE3TRP 82 24.185 35.964 15.461 1 42 6 60 ATOM 2306 CD1TRP 82 25.459 39.118 14.204 . . 6 B 1.0042.92 ATOM 2307 NE1TRP 82 24.527 39.490 15.138 1.0041.43 7 B

-II~

ATOM 2308 C22 82 22.991 38.23816.671 1.00 42.94 6 TRP
B

ATOM 2309 C23 82 23.211 35.83216.442 1.00 41.79 6 TRP
B

ATOM 2310 CH2 82 22.625 36.96517.036 1.00 42.57 6 TRP
B

ATOM 2311 C TRP 82 27.579 36.10015.323 1.00 39 6 ATOM 2312 0 TRP 82 27.379 34.90415.410 1.00 . 8 B 41.05 ATOM 2313 N VAL 83 27.594 36.89216.373 1.00 41.18 7 B

ATOM 2314 CA VAL 83 27.363 36.35917.699 1.00 40.57 6 B

ATOM 2315 CB VAL 83 28.714 36.21018.444 1.00 41.00 6 B

ATOM 2316 CG1 VAL 83 28.494 35.95619.903 1.00 45 6 1~ ATOM 2317 CG2 VAL 83 29.491 35.06617.856 1.00 . 6 B 40.97 ATOM 2318 C V.AL 83 26.399 37.27518.460 1.00 40.40 6 B

ATOM 2319 0 V.AL 83 26.424 38.48718.301 1.00 42.78 8 B

ATOM 2320 N PRO 84 25.510 36.69319.271 1.00 40.62 7 B

ATOM 2321 CD PRO 84 25.296 35.25019.465 1.00 43 6 15 ATOM 2322 CA PRO 84 24.540 37.46020.052 1.00 . 6 B 39.62 ATOM 2323 CB P:RO 84 23.839 36.384?Ø8801.00 39.00 6 B

ATOM 2324 CG PRO 84 23.899 35.21220.013 1.00 43.18 6 B

ATOM 2325 C PRO 84 25.246 38.47420.937 1.00 37.37 6 B

ATOM 2326 0 PRO 84 26.215 38.14021.603 1.00 34 8 ATOM 2327 N ASP 85 24.753 39.70620.950 1.00 . 7 B 36.29 ATOM 2328 CA ASP 85 25.341 40.73621.777 1.00 37.57 6 B

ATOM 2329 CB ASP 85 25.112 42.10721.152 1.00 38.52 6 B

ATOM 2330 CG ASP 85 23.661 42.41820.952 1.00 40.81 6 B

ATOM 2331 OD1 ASP 85 22.925 41.50120.578 1.00 41 8 25 ATOM 2332 OD2 ASP 85 23.254 43.57921.148 1.00 . 8 B 41.12 ATOM :?333C ASP 85 24.776 40.68723.193 1.00 39.08 6 B

ATOM 2334 0 ASP 85 24.2.61 41.66823.714 1.00 36.01 8 B

ATOM 2335 N LEU 86 24.902 39.52223.811 1.00 38.19 7 B

ATOM 2336 CA LEU 86 24.42:1 39.30625.161 1.00 39 6 ATOM '?.337CB LEU 86 24.459 37.81925.502 1.00 . 6 B 37.18 ATOM :?338CG LEU 86 23.585 36.93924.621 1.00 38.33 6 B

ATOM '<?339CD1 LEU 86 23.700 35.49325.065 1.00 33.72 6 B

ATOM 2340 CD2 LEU 86 22.159 37.43324.693 1.00 35.49 6 B

ATOM '1.341C LEU 86 25.223 40.06126.201 1.00 40 6 35 ATOM 2342 O LEU 86 26.432 40.25126.065 1.00 . 8 B 42.26 ATOM 2343 N ALA 87 24.541 40.46727.260 1.00 40.28 7 B

ATOM 2:344CA ALA 87 25.180 41.19328.339 1.00 40.51 6 B

ATOM 2345 CB ALA 87 25.048 42.69828.091 1.00 40.62 6 B

ATOM 2346 C ALA 87 24.521 40.82629.660 1.00 40 6 ATOM 2.3470 ALA 87 23.306 40.70229.729 1.00 . 8 B 40.56 ATOM 2348 N ALA 88 25.316 40.63430.703 1.00 39.13 7 B

ATOM 2:349CA ALA 88 24.756 40.34032.014 1.00 38.99 6 B

ATOM 2350 CB ALA 88 25.749 39.57732.850 1.00 37.09 6 B

ATOM 2351 C ALA 88 24.433 41.68632.665 1.00 40 6 45 ATOM 2352 0 ALA 88 25.319 42.39233.134 1.00 . 8 B 38.34 ATOM 2353 N TYR 89 23.153 42.03332.667 1.00 42.45 7 B

ATOM 2354 CA TYR 89 22.654 43.28533.232 1.00 44.08 6 B

ATOM 2355 CB TYR 89 21.133 43.20933.363 1.00 46.62 6 B

ATOM 2356 CG TYR 89 20.395 43.05532.056 1 51 6 ATOM 2357 CD1 TYR 89 19.022 42.81632.036 . . 6 B 1.00 54.25 ATOM 2358 CE1 TYR 89 18.322 42.71130.826 1.00 55.90 6 B

ATOM 2359 CD2 TYR 89 21.054 43.17930.835 1.00 52.13 6 B

ATOM 2360 CE2 TYR 89 20.366 43.07829.626 1.00 54.28 6 B

ATOM 2361 CZ TYR 89 19.001 42.84729.629 1 55 6 55 ATOM 2362 OH TYR 89 18.313 42.78728.440 . . 8 B 1.00 59.26 ATOM 2363 C TYR 89 23.243 43.72534.579 1.00 43.48 6 B

ATOM 2364 0 TYR 89 23.409 44.91734.820 1.00 42.18 8 B

ATOM 2365 N ASN 90 23.540 42.78435.466 1.00 42.08 7 B

ATOM 2366 CA ASN 90 24.102 43.15536.755 1.00 40 6 ATOM 2367 CB ASN 90 23.262 42.58137.904 1.00 . 6 B 39.29 ATOM 2368 CG ASN 90 23.084 41.08237.824 1.00 40.77 6 B

ATOM 2369 OD1ASN B 90 22.778 40.536 36.7741.00 40.90 8 ATOM 2370 ND2ASN B 90 23.257 40.412 38.9481.00 42.41 7 ATOM 2371 C ASN B 90 25.554 42.768 36.9211.00 41.50 6 ATOM 2372 0 ASN B 90 26.031 42.618 38.0421.00 42.85 8 ATOM 2373 N ALA B 91 26.250 42.605 35.7981.00 43.60 7 ATOM 2374 CA ALA B 91 27.669 42.266 35.8111.00 43.31 6 ATOM 2375 CB ALA B 91 28.156 41.933 34.4151.00 42.36 6 ATOM 2376 C ALA B 91 28.359 43.513 36.3361.00 44.47 6 ATOM 2377 0 ALA B 91 28.048 44.637 35.9341.00 43.75 8 1~ ATOM 2378 N ILE B 92 29.295 43.299 37.2441.00 44.99 7 ATOM 2379 CA ILE B 92 30.009 44.379 37.8951.00 45.69 6 ATOM 2380 CB ILE B 92 30.052 44.061 39.4181.00 46.91 6 ATOM 2381 CG2ILE B 92 31.419 43.514 39.8311.00 49.50 6 ATOM 2382 CG1ILE B 92 29.726 45.288 40.2321.00 48.64 6 15 ATOM 2383 CD1ILE B 92 29.920 45.030 41.7181.00 53.73 6 ATOM 2384 C ILE B 92 31.428 44.532 37.3021.00 45.86 6 ATOM 2385 0 ILE B 92 32.156 45.487 37.6111.00 45.24 8 ATOM 2386 N SER B 93 31.804 43.581 36.4531.00 41.25 7 ATOM 2387 CA SER B 93 33.104 43.578 35.8131.00 38.58 6 ATOM 2388 CB SER B 93 34.056 42.662 36.5681.00 35.19 6 ATOM 2389 OG SER B 93 33.682 41.315 36.3881.00 35.43 8 ATOM 2390 C SER B 93 32.852 43.015 34.4311.00 40.88 6 ATOM 2391 O SER B 93 31.776 42.493 34.1741.00 39.63 8 ATOM 2392 N LYS B 94 33.815 43.131 33.5241.00 43.16 7 25 ATOM 2393 CA LYS B 94 33.598 42.557 32.2121.00 43.98 6 ATOM 2394 CB LYS B 94 34.355 43.325 31.1271.00 46.29 6 ATOM 2395 CG LYS B 94 35.769 43.727 31.4341.00 50.31 6 ATOM 2396 CD LYS B 94 36.225 44.764 30.4011.00 52.39 6 ATOM 2397 CE LYS B 94 35.853 44.341 28.9781.00 52.02 6 ATOM 2398 NZ LYS B 94 36.333 45.308 27.9651.00 54.82 7 ATOM 2399 C LYS B 94 33.963 41.075 32.2301.00 43.71 6 ATOM 2400 O LYS B 94 34.673 40.602 33.1141.00 44.78 8 ATOM 2401 N PRO B 95 33.443 40.310 31.2671.00 44.16 7 ATOM 2402 CD PRO B 95 32.562 40.750 30.1711.00 42.37 6 35 ATOM 2403 CA PRO B 95 33.704 38.873 31.1841.00 39.82 6 ATOM 2404 CB PRO B 95 32.836 38.422 30.0161.00 40.83 6 ATOM 2405 CG PRO B 95 31.813 39.505 29.8811.00 42.58 6 ATOM 2406 C PRO B 95 35.141 38.524 30.9411.00 39.41 6 ATOM 2407 0 PRO B 95 35.772 39.048 30.0321.00 40.47 8 ATOM 2408 N GLU B 96 35.663 37.637 31.7651.00 39.61 7 ATOM 2409 CA GLU B 96 37.020 37.175 31.5821.00 39.82 6 ATOM 2410 CB GLU B 96 37.765 37.046 32.9151.00 41.36 6 ATOM 2411 CG GI~UB 96 39.238 36.644 32.7631.00 50.17 6 ATOM 2412 CD GLU B 96 39.989 36.540 34.0941.00 55.05 6 45 ATOM 2413 OE1GLU B 96 39.506 37.129 35.0841.00 57.32 8 ATOM 2414 OE2GI~UB 96 41.067 35.888 34.1531.00 56.17 8 ATOM 2415 C GLU B 96 36.802 35.804 30.9661.00 39.55 6 ATOM 2416 0 GLU B 96 36.537 34.840 31.6761.00 38.71 8 ATOM 2417 N VAL B 97 36.864 35.736 29.6381.00 36.87 7 ATOM 2418 CA VAL B 97 36.690 34.475 28.9381.00 35.52 6 ATOM 2419 CB VAL B 97 36.457 34.702 27.4481.00 35.28 6 ATOM 2420 CG1VAL B 97 36.249 33.378 26,7521.00 33.50 6 ATOM 2421 CG2VAL B 97 35.249 35.586 27.2551.00 31.71 6 ATOM 2422 C VAL B 97 37.935 33.640 29.1571.00 35.07 6 55 ATOM '?423 0 VAL B 97 39.025 34.005 28.7411.00 37.13 8 ATOM '424 N LEU B 98 37.759 32.511 29.8231.00 35.85 7 ATOM :?425 CA LEU B 98 38.866 31.631 30.1671.00 36.60 6 ATOM 2426 CB LEU B 98 38.554 30.913 31.4821.00 37.34 6 ATOM 2427 CG LEU B 98 38.127 31.727 32.7011.00 39.09 6 ATOM 2428 CD1LEU B 98 37.534 30.812 33.7391.00 37.97 6 ATOM 2429 CD2LEU B 98 39.306 32.469 33.2591.00 41.28 6 ATOM 2430 C LEU B98 39.198 30.581 29.1281.00 36.56 ATOM 2431 0 LEU B98 40.195 29.889 29.2511.00 37.06 ATOM 2432 N THR B99 38.371 30.467 28.1031.00 36.66 ATOM 2433 CA THR B99 38.578 29.438 27.1001.00 37.03 ATOM 2434 CB THR B99 37.405 28.414 27.1421.00 40.73 ATOM 2435 OG1THR B99 36.152 29.097 26.9721.00 42.70 ATOM 2436 CG2THR B99 37.400 27.676 28.4661.00 37.60 ATOM 2437 C THR B99 38.725 29.932 25.6801.00 34.89 ATOM 2438 0 THR B99 38.401 31.073 25.3781.00 35.25 1~ ATOM 2439 N PRO B100 39.231 29.066 24.7861.00 35.40 ATOM 2440 CD PRO B100 39.818 27.745 25.0561.00 33.38 ATOM 2441 CA PRO B100 39.413 29.420 23.3801.00 35.17 ATOM 2442 CB PRO B100 39.783 28.095 22.7451.00 33.58 ATOM 2443 CG PRO B100 40.603 27.476 23.7891.00 34.20 15 ATOM 2444 C PRO B100 38.107 29.961 22.8521.00 37.17 ATOM 2445 0 PRO B100 37.052 29.396 23.1031.00 38.59 ATOM 2446 N GLN B101 38.168 31.066 22.1301.00 39.08 ATOM 2447 CA GLN B101 36.949 31.636 21.6211.00 40.23 ATOM 2448 CB GLN B101 37.071 33.155 21.5761.00 39.84 ATOM 2449 CG GLN B101 36.866 33.742 22.9601.00 45.68 ATOM 2450 CD GLN B101 37.334 35.158 23.0751.00 47.02 ATOM 2451 OE1GLN B101 36.871 36.035 22.3501.00 50.05 ATOM 2452 NE2GLN B101 38.260 35.398 23.9971.00 45.46 ATOM 2453 C GLN B101 36.536 31.057 20.2951.00 39.08 25 ATOM 2454 0 GLN B101 36.496 31.747 19.2821.00 37.88 ATOM 2455 N LEU B102 36.212 29.768 20.3421.00 40.24 ATOM 2456 CA LEU B102 35.770 28.997 19.1831.00 39.64 ATOM 2457 CB LEU B102 36.652 27.759 18.9821.00 37.23 ATOM 2458 CG LEU B102 38.155 27.988 18.8421.00 37.24 ATOM 2459 CD1LEU B102 38.852 26.666 18.6591.00 33.59 ATOM 2460 CD2LEU B102 38.429 28.893 17.6651.00 36.66 ATOM 2461 C LEU B102 34.349 28.528 19.3941.00 39.73 ATOM 2462 0 LEU B102 33.948 28.210 20.5021.00 38.45 ATOM 2463 N ALA B103 33.586 28.492 18.3171.00 41.12 35 ATOM 2464 CA ALA B103 32.218 28.017 18.3751.00 40.48 ATOM 2465 CB ALA B103 31.271 29.034 17.7601.00 39.15 ATOM 2466 C ALA B103 32.163 26.711 17.5991.00 40.28 ATOM 2467 0 ALA B103 33.109 26.337 16.9171.00 38.52 ATOM 2468 N ARG B104 31.045 26.014 17.7151.00 42.85 ATOM 2469 CA ARG B104 30.876 24.755 17.0191.00 44.21 ATOM 2470 CB ARG B104 30.557 23.659 18.0271.00 43.23 ATOM 2471 CG ARG B104 30.760 22.273 17.4961.00 45.99 ATOM 2472 CD ARG B104 32.214 21.957 17.2171.00 44.48 ATOM 2473 NE ARG B104 32.306 20.612 16.6521.00 45.67 45 ATOM 2474 CZ ARG B104 33.434 19.985 16.3411.00 42.29 ATOM 2475 NH1ARG B104 34.593 20.576 16.5341.00 40.18 ATOM 2476 NH2ARG B104 33.397 18.755 15.8471.00 43.70 ATOM 2477 C ARG B104 29.736 24.954 16.0401.00 44.71 ATOM 2478 O ARG B104 28.655 25.377 16.4251.00 43.84 ATOM 2479 N VAL B105 29.990 24.686 14.7671.00 45.98 ATOM 2480 CA VAL B105 28.955 24.862 13.7611.00 46.86 ATOM 2481 CB VAL B105 29.404 25.834 12.6631.00 43.67 ATOM 2482 CG1VAL B105 28.257 26.111 11.7151.00 42.93 ATOM 2483 CG2VAL B105 29.885 27.116 13.2811.00 41.79 55 ATOM 2484 C VAL B105 28.546 23.546 13.1121.00 50.58 ATOM 2485 0 VAL B105 29.393 22.808 12.5891.00 51.09 ATOM 2486 N VAL B106 27.243 23.266 13.1581.00 51.24 ATOM 2487 CA VAL B106 26.677 22.056 12.5771.00 52.00 ATOM 2488 CB VAL B106 25.464 21.592 13.3871.00 52.31 ATOM 2489 CG1VAL B106 25.038 20.207 12.9311.00 52.15 ATOM 2490 CG2VAL B106 25.798 21.607 14.8651.00 50.55 ATOM 2491 C VALB 106 26.243 22.36911.147 1.00 52.00 ATOM 2492 0 VALB 106 25.782 23.47410.870 1.00 52.80 ATOM :?493N SERB 107 26.388 21.40110.248 1.00 51.28 ATOM 2494 CA SERB 107 26.038 21.5928.845 1.00 52.41 ATOM 2495 CB SERB 107 26.175 20.2728.097 1.00 54.05 ATOM 2496 OG SERB 107 25.609 19.2168.855 1.00 58.60 ATOM 2497 C SERB 107 24.676 22.1988.544 1.00 52.33 ATOM 2498 0 SERB 107 24.469 22.7287.460 1.00 52.31 ATOM 2499 N ASPB 108 23.753 22.1329.494 1.00 54.48 ATOM 2500 CA ASPB 108 22.417 22.6879.285 1.00 57.36 ATOM 2501 CB ASPB 108 21.376 21.83010.007 1.00 59.13 ATOM 2502 CG ASPB 108 21.474 21.93311.512 1.00 61.77 ATOM '?503OD1 ASPB 108 22.604 21.99312.034 1.00 63.26 ATOM 2504 OD2 ASPB 108 20.419 21.94112.180 1.00 63.13 15 ATOM 2505 C ASPB 108 22.266 24.1529.715 1.00 58.76 ATOM 2506 O ASPB 108 21.16:3 24.6969.711 1.00 60.28 ATOM :?507N GI~YB 109 23.376 24.78410.087 1.00 59.97 ATOM 2508 CA GI~YB 109 23.346 26.17510.489 1.00 58.62 ATOM 2509 C GI~YB 109 23.213 26.39411.983 1.00 59.08 ATOM 2510 0 GLYB 109 23.123 27.53412.437 1.00 58.71 ATOM 2511 N GI~UB 110 23.18'7 25.31712.758 1.00 58.29 ATOM :?512CA GI~UB 110 23.062 25.45114.202 1.00 57.49 ATOM 2513 CB GI~UB 110 22.619 24.12514.827 1.00 60.94 ATOM 2514 CG GLUB 110 21.94'7 24.23416.208 1.00 64.96 25 ATOM :?515CD GLUB 110 20.623 25.00716.159 1.00 69.09 ATOM '?516OE1 GLUB 110 20.054 25.12115.044 1.00 70.48 ATOM :?517OE2 GLUB 110 20.146 25.49317.223 1.00 67.90 ATOM ''<?518C GLUB 110 24.43?. 25.83814.723 1.00 56.48 ATOM :?5190 GLUB 110 25.44'7 25.29114.282 1.00 58.51 ATOM :?520N VALB 111 24.461 26.78015.656 1.00 52.94 ATOM <?521CA VALB 111 25.706 27.25416.237 1.00 49.98 ATOM :?522CB VALB 111 25.933 28.74315.914 1.00 50.06 ATOM :?523CG1 VALB 111 27.259 29.19916.502 1.00 48.91 ATOM :?524CG2 VALB 111 25.894 28.97314.406 1.00 49.75 35 ATOM ?525 C VALB 111 25.702. 27.09517.749 1.00 49.14 ATOM 2526 0 VALB 111 24.730 27.43118.413 1.00 47.85 ATOM :?527N LEUB 112 26.795 26.58118.292 1.00 49.78 ATOM '<?528CA LEUB 112 26.907 26.40419.733 1.00 50.84 ATOM '<?529CB LEUB 112 26.903 24.91420.107 1.00 54.21 ATOM '<?530CG LEUB 112 26.075 23.86819.337 1.00 56.22 ATOM 2531 CD1 LEUB 112 24.673 24.39319.025 1.00 58.51 ATOM a?532CD2 LEUB 112 26.802 23.50418.065 1.00 54.95 ATOM 2533 C LEUB 112 28.202 27.03820.242 1.00 50.58 ATOM 2534 0 LEUB 112 29.300 26.65119.829 1.00 51.33 ATOM 2535 N TYRB 113 28.073 28.01321.134 1.00 47.63 ATOM <'?536CA TYRB 113 29.227 28.68121.709 1.00 46.01 ATOM 2537 CB TYRB 113 29.266 30.15421.279 1.00 45.50 ATOM 2538 CG TYRB 113 30.415 30.97021.868 1.00 45.48 ATOM 2539 CD1 TYRB 113 31.715 30.46821.902 1.00 43.49 ATOM 2540 CE1 TYRB 113 32.766 31.22522.412 1.00 42.81 ATOM '<?541CD2 TYRB 113 30.200 32.26222.367 1.00 44.88 ATOM 2.542CE2 T~'RB 113 31.246 33.02222.876 1.00 42.75 ATOM 2543 CZ TYRB 113 32.528 32.49922.897 1.00 45.11 ATOM 2544 OH TYRB 113 33.579 33.24823.397 1.00 46.12 55 ATOM 2545 C TYRB 113 29.081 28.56123.208 1.00 45.62 ATOM 2546 0 TYRB 113 28.130 29.06423.783 1.00 48.17 ATOM 2547 N ME:TB 114 30.025 27.88723.842 1.00 45.82 ATOM 2548 CA METB 114 29.966 27.69125.280 1.00 47.40 ATOM 2549 CB METB 114 29.652. 26.23725.578 1.00 51.46 ATOM 2550 CG METB 114 29.408 25.95827.030 1.00 56.47 ATOM 2551 SD METB 114 29.463 24.20427.290 1.00 61.08 ATOM 2552 CE MET B114 27.833 23.732 26.7361.00 59.81 ATOM 2553 C MET B114 31.281 28.060 25.9441.00 47.40 ATOM 2554 0 MET B114 32.093 27.187 26.2681.00 46.46 ATOM 2555 N PRO B115 31.511 29.364 26.1581.00 46.76 ATOM 2556 CD PRO B115 30.680 30.502 25.7121.00 45.52 ATOM 2557 CA PRO B115 32.744 29.832 26.7861.00 44.75 ATOM 2558 CB PRO B115 32.834 31.259 26.2851.00 47.19 ATOM 2559 CG PRO B115 31.382 31.687 26.3161.00 45.23 ATOM 2560 C PRO B115 32.653 29.776 28.3031.00 45.76 ATOM 2561 0 PRO B115 31.567 29.933 28.8651.00 46.79 ATOM 2562 N SER B116 33.783 29.545 28.9651.00 44.58 ATOM 2563 CA SER B116 33.797 29.527 30.4161.00 42.97 ATOM 2564 CB SER B116 34.867 28.605 30.9351.00 42.63 ATOM 2565 OG SER B116 34.810 28.586 32.3421.00 46.80 15 ATOM 2566 C SER B116 34.124 30.939 30.8321.00 43.61 ATOM 2567 0 SER B116 35.144 31.473 30.4311.00 45.91 ATOM 2568 N ILE B117 33.2?0 31.547 31.6431.00 42.76 ATOM 2569 CA ILE B117 33.483 32.923 32.0521.00 40.88 ATOM 2570 CB ILE B117 32.340 33.816 31.5151.00 39.30 20 ATOM 2571 CG2 ILE B117 32.512 35.249 31.9951.00 40.17 ATOM 2572 CG1 ILE B117 32.317 33.760 29.9921.00 37.44 ATOM 2573 CD1 ILE B117 31.069 34.332 29.3941.00 36.96 ATOM 2574 C ILE B117 33.592 33.158 33.5451.00 42.01 ATOM 2575 0 ILE B117 32.840 32.585 34.3291.00 44.14 25 ATOM 2576 N ARG B118 34.554 33.986 33.9391.00 42.44 ATOM 2577 CA ARG B118 34.683 34.363 35.3391.00 42.12 ATOM 2578 CB ARG B118 36.120 34.283 35.8351.00 39.55 ATOM 2579 CG ARG B118 36.241 34.873 37.2261.00 40.13 ATOM 2580 CD ARG B118 37.520 34.517 37.9331.00 40.72 ATOM 2581 NE ARG B118 37.546 35.120 39.2591.00 43.73 ATOM 2582 CZ ARG B118 38.424 34.821 40.2041.00 43.99 ATOM 2583 NH1 ARG B118 39.356 33.915 39.9731.00 45.99 ATOM 2584 NH2 ARG B118 38.367 35.427 41.3761.00 44.09 ATOM 2585 C ARG B118 34.215 35.819 35.3321.00 42.68 35 ATOM 2586 0 ARG B118 34.657 36.604 34.5031.00 43.76 ATOM 2587 N GLN B119 33.324 36.190 36.2391.00 41.50 ATOM 2588 CA GLN B119 32.815 37.553 36.2291.00 40.73 ATOM 2589 CB GLN B119 31.817 37.664 35.0801.00 37.47 ATOM 2590 CG GLN B119 31.199 39.002 34.8501.00 37.63 4~ ATOM 2591 CD GLN B119 30.414 39.031 33.5531.00 38.05 ATOM 2592 OEl GLN B119 29.835 38.028 33.1371.00 40.82 ATOM 2593 NE2 GLN B119 30.380 40.181 32.9141.00 38.24 ATOM 2594 C GLN B119 32.171 37.897 37.5611.00 41.65 ATOM 2595 0 GLN B119 31.660 37.028 38.2451.00 43.20 45 ATOM 2596 N ARG B120 32.208 39.163 37.9451.00 43.19 ATOM 2597 CA ARG B120 31.606 39.561 39.2091.00 46.59 ATOM 2598 CB ARG B120 32.500 40.540 39.9551.00 48.44 ATOM 2599 CG ARG B120 33.874 40.005 40.2321.00 57.79 ATOM 2600 CD ARG B120 34.423 40.632 41.4931.00 64.95 ATOM 2601 NE ARG B120 33.964 39.971 42.7271.00 67.80 ATOM 2602 CZ ARG B120 33.571 40.624 43.8181.00 68.76 ATOM 2603 NH1 ARG B120 33.565 41.958 43.8271.00 66.34 ATOM 2604 NH2 ARG B120 33.219 39.944 44.9131.00 69.34 ATOM 2605 C ARG B120 30.241 40.184 38.9991.00 45.42 55 ATOM 2606 0 ARG B120 29.991 40.825 37.9791.00 43.82 ATOM 2607 N PHE B121 29.361 39.983 39.9721.00 45.27 ATOM 2608 CA PHE B121 28.012 40.515 39.8821.00 46.73 ATOM 2609 CB PHE B121 26.998 39.411 39.5581.00 44.66 ATOM 2610 CG PHE B121 27.320 38.639 38.3241.00 41.56 ATOM 2611 CD1 PHE B121 28.265 37.621 38.3551.00 38.98 ATOM 2612 CD2 PHE B121 26.698 38.942 37.1231.00 40.65 ATOM 2613 CE1PHE B121 28.585 36.920 37.2121.00 38.44 6 ATOM 2614 CE2PHE B121 27.013 38.245 35.9771.00 38.36 6 ATOM 2615 CZ PHE B121 27.959 37.232 36.0201.00 37.80 6 ATOM 2616 C PHE B121 27.549 41.193 41.1421.00 47.76 6 ATOM 2617 0 PHE B121 28.094 40.972 42.2241.00 45.87 8 ATOM 2618 N SER B122 26.521 42.021 40.9661.00 49.39 7 ATOM 2619 CA SER B122 25.881 42.735 42.0541.00 51.30 6 ATOM 2620 CB SER B122 25.677 44.200 41.6801.00 50.63 6 ATOM 2621 OG SER B122 25.026 44.887 42.7261.00 52.75 8 1~ ATOM 2622 C SER B122 24.530 42.041 42.2351.00 52.14 6 ATOM 2623 0 SER B122 23.659 42.135 41.3771.00 51.12 8 ATOM 2624 N CYS B123 24.371 41.323 43.3401.00 53.84 7 ATOM 2625 CA CYS B123 23.133 40.605 43.6031.00 56.99 6 ATOM 2626 C CYS B123 22.973 40.343 45.1111.00 58.94 6 15 ATOM 2627 0 CYS B123 23.837 40.727 45.9111.00 58.00 8 ATOM 2628 CB CYS B123 23.135 39.282 42.8301.00 55.83 6 ATOM 2629 SG CYS B123 24.561 38.231 43.2501.00 57.55 16 ATOM 2630 N ASP B124 21.874 39.687 45.4911.00 59.24 7 ATOM 2631 CA ASP B124 21.619 39.412 46.8931.00 59.17 6 ATOM 2632 CB ASP B124 20.148 39.085 47.1141.00 61.47 6 ATOM 2633 CG ASP B124 19.670 39.487 48.5051.00 62.03 6 ATOM 2634 OD1ASP B124 20.462 39.403 49.4701.00 60.72 8 ATOM 2635 OD2ASP B124 18.493 39.886 48.6281.00 63.80 8 ATOM 2636 C ASP B124 22.470 38.274 47.4341.00 59.25 6 25 ATOM 2637 0 ASP B124 22.309 37.122 47.0361.00 58.84 8 ATOM 2638 N VAL B125 23.365 38.612 48.3561.00 59.36 7 ATOM 2639 CA VAL B125 24.260 37.647 48.9791.00 59.62 6 ATOM 2640 CB VAL B125 25.683 38.230 49.0801.00 57.35 6 ATOM 2641 CG1VAL B125 26.599 37.280 49.7981.00 54.50 6 ATOM 2642 CG2VAL B125 26.212 38.519 47.7021.00 58.35 6 ATOM 2643 C VAL B125 23.766 37.277 50.3781.00 62.42 6 ATOM 2644 0 VAL B125 24.161 36.254 50.9381.00 64.51 8 ATOM 2645 N SER B126 22.892 38.105 50.9391.00 63.61 7 ATOM 2646 CA SER B126 22.375 37.857 52.2831.00 64.32 6 35 ATOM 2647 CB SER B126 21.260 38.857 52.6131.00 63.21 6 ATOM 2648 OG SER B126 20.175 38.715 51.7151.00 59.22 8 ATOM 2649 C SER B126 21.858 36.429 52.4441.00 64.47 6 ATOM 2650 0 S:ERB126 21.082 35.940 51.6261.00 63.31 8 ATOM 2651 N GLY B127 22.3"~3 35.764 53.4961.00 65.55 7 ATOM 2652 CA GLY B127 21.872 34.409 53.7481.00 68.84 6 ATOM 2653 C GLY B127 22.847 33.351 53.2821.00 70.32 6 ATOM 2654 0 GLY B127 22.634 32.161 53.5001.00 71.17 8 ATOM 2655 N VAL B128 23.923 33.776 52.6381.00 71.67 7 ATOM 2656 CA VAL B128 24.910 32.826 52.1481.00 72.95 6 45 ATOM 2657 CB VAL B128 26.107 33.522 51.4671.00 71.97 6 ATOM 2658 CG1VAL B128 25.686 34.081 50.1491.00 73.72 6 ATOM 2659 CG2VAL B128 26.654 34.614 52.3591.00 69.90 6 ATOM 2660 C VAL B128 25.504 31.942 53.2121.00 73.83 6 ATOM 2661 0 VAL B128 25.628 30.743 53.0161.00 73.27 8 ATOM 2662 N ASP B129 25.884 32.542 54.3321.00 75.83 7 ATOM 2663 CA ASP B129 26.532 31.789 55.3841.00 78.34 6 ATOM 2664 CB ASP B129 27.008 32.715 56.5041.00 79.36 6 ATOM 2665 CG ASP B129 28.209 32.141 57.2571.00 81.22 6 ATOM 2666 OD1ASP B129 29.166 32.909 57.5231.00 81.78 8 55 ATOM '?667 OD2ASP B129 28.202 30.922 57.5761.00 81.70 8 ATOM 2668 C ASP B129 25.720 30.648 55.9721.00 80.31 6 ATOM 2669 0 ASP B129 26.293 29.783 56.6601.00 81.06 8 ATOM 2670 N THR B130 24.412 30.603 55.7061.00 80.80 7 ATOM :?671 CA THR B130 23.640 29.501 56.2591.00 81.78 6 ATOM ?.672 CB THR B130 23.681 29.563 57.7991.00 85.11 6 ATOM :?673 OG1THR B130 24.158 30.862 58.1951.00 84.93 8 ATOM 2674 CG2 THR B130 24.582 28.416 58.3881.00 85.83 ATOM 2675 C THR B130 22.182 29.286 55.8811.00 80.84 ATOM 2676 0 THR B130 21.460 30.224 55.5061.00 78.93 ATOM 2677 N GLU B131 21.784 28.014 56.0281.00 80.92 ATOM 2678 CA GLU B131 20.416 27.510 55.8321.00 80.70 ATOM 2679 CB GLU B131 19.435 28.339 56.6891.00 83.05 ATOM 2680 CG GLU B131 19.467 28.017 58.1871.00 84.49 ATOM 2681 CD GLU B131 19.024 29.189 59.0511.00 85.34 ATOM 2682 OE1 GLU B131 17.948 29.773 58.7621.00 86.44 1~ ATOM 2683 OE2 GLU B131 19.757 29.521 60.0191.00 85.14 ATOM 2684 C GLU B131 19.864 27.420 54.4261.00 79.07 ATOM 2685 0 GLU B131 20.207 26.520 53.6431.00 76.96 ATOM 2686 N SER B132 18.941 28.338 54.1561.00 78.17 ATOM 2687 CA SER B132 18.298 28.449 52.8581.00 77.92 ATOM 2688 CB SER B132 16.953 29.195 53.0011.00 77.07 ATOM 2689 OG SER B132 17.130 30.486 53.5751.00 77.45 ATOM 2690 C SER B132 19.277 29.220 51.9451.00 76.88 ATOM 2691 0 SER B132 19.000 29.463 50.7591.00 77.41 ATOM 2692 N GLY B133 20.424 29.588 52.5201.00 74.38 ATOM 2693 CA GLY B133 21.442 30.308 51.7821.00 72.04 ATOM 2694 C GLY B133 20.943 31.569 51.1051.00 71.42 ATOM 2695 0 GLY B133 19.888 32.104 51.4501.00 71.39 ATOM 2696 N ALA B134 21.708 32.044 50.1251.00 69.68 ATOM 2697 CA ALA B134 21.345 33.251 49.3901.00 66.69 25 ATOM 2698 CB ALA B134 22.534 34.194 49.3151.00 66.34 ATOM 2699 C ALA B134 20.874 32.908 47.9931.00 64.53 ATOM ;2700O ALA B134 21.095 31.802 47.5041.00 64.56 ATOM 2701 N THR B135 20.207 33.865 47.3691.00 62.63 ATOM 2702 CA THR B135 19.719 33.696 46.0171.00 62.23 ATOM 2703 CB THR B135 18.205 33.577 45.9801.00 62.17 ATOM 2704 OG1 THR B135 17.812 32.456 46.7751.00 64.85 ATOM 2705 CG2 THR B135 17.72:1 33.370 44.5431.00 62.33 ATOM 2706 C THR B135 20.15.9 34.900 45.1941.00 62.39 ATOM 2707 0 THR B135 19.618 36.009 45.3081.00 62.56 35 ATOM 2708 N CYS B136 21.174 34.661 44.3791.00 61.14 ATOM :?709CA CYS B136 21.754 35.668 43.5261.00 58.61 ATOM 2710 C C'ISB136 21.159 35.497 42.1341.00 56.85 ATOM 2711 0 C'.1SB136 21.308 34.452 41.5031.00 55.78 ATOM :?712CB C'ISB136 23.276 35.474 43.5271.00 58.82 ATOM 2713 SG C'ISB136 24.201 36.455 42.3151.00 60.36 ATOM :?714N ARG B137 20.453 36.519 41.6701.00 55.98 ATOM 2715 CA ARG B137 19.845 36.457 40.3531.00 56.14 ATOM :?716CB ARG B137 18.421 37.009 40.3831.00 57.73 ATOM 2717 CG ARG B137 17.502 36.250 41.3031.00 62.21 45 ATOM :?718CD ARG B137 16.367 37.136 41.7921.00 68.77 ATOM :?719NE ARG B137 15.827 36.666 43.0711.00 74.27 ATOM 2720 CZ ARG B137 15.070 35.575 43.2241.00 76.32 ATOM 2721 NH1 ARG B137 14.739 34.822 42.1741.00 77.05 ATOM 2722 NH2 ARG B137 14.65:? 35.221 44.4341.00 75.79 ATOM 2723 C ARG B137 20.672 37.253 39.3661.00 55.38 ATOM '<?7240 ARG B137 21.052 38.389 39.6371.00 57.67 ATOM 2725 N ILE B138 20.933 36.646 38.2151.00 52.27 ATOM 2726 CA ILE B138 21.716 37.255 37.1631.00 48.96 ATOM 2727 CB ILE B138 22.977 36.411 36.8901.00 45.32 55 ATOM 2728 CG2 ILE B138 23.751 37.007 35.7491.00 42.82 ATOM 2729 CG1 ILE B138 23.822 36.309 38.1601.00 42.90 ATOM 2730 CD1 ILE B138 24.931 35.313 38.0671.00 40.32 ATOM 2731 C ILE B138 20.863 37.313 35.9001.00 48.66 ATOM ;732 0 ILE B138 20.420 36.286 35.4061.00 49.73 ATOM 2733 N LYS B139 20.628 38.506 35.3751.00 48.12 ATOM 2.734CA LA'SB139 19.822. 38.642 34.1651.00 51.18 ATOM 2735 CB LYS B139 18.775 39.759 34.3261.00 52.93 6 ATOM 2736 CG LYS B139 17.908 39.625 35.5531.00 56.09 6 ATOM 2737 CD LYS B139 16.721 40.567 35.5231.00 58.54 6 ATOM 2738 CE LYS B139 15.716 40.155 34.4611.00 59.19 6 ATOM 2739 NZ LYS B139 14.539 41.062 34.4351.00 59.74 7 ATOM 2740 C LYS B139 20.686 38.966 32.9571.00 50.79 6 ATOM 2741 0 LYS B139 21.461 39.919 32.9981.00 53.10 8 ATOM 2742 N ILE B140 20.561 38.192 31.8831.00 47.96 7 ATOM 2743 CA ILE B140 21.348 38.480 30.6961.00 49.36 6 1~ ATOM 2744 CB ILE B140 22.590 37.531 30.6071.00 49.96 6 ATOM 2745 CG2 ILE B140 23.254 37.411 31.9731.00 52.22 6 ATOM 2746 CG1 ILE B140 22.192 36.126 30.2171.00 50.93 6 ATOM 2747 CD1 ILE B140 23.312 35.115 30.4831.00 54.24 6 ATOM 2748 C ILE B140 20.520 38.444 29.4101.00 48.36 6 15 ATOM 2749 0 ILE B140 19.727 37.545 29.2111.00 49.73 8 ATOM 2750 N GLY B141 20.685 39.448 28.5571.00 46.46 7 ATOM 2751 CA GLY B141 19.941 39.500 27.3131.00 47.33 6 ATOM 2752 C GLY B141 20.631 40.387 26.2931.00 46.71 6 ATOM 2753 0 GLY B141 21.623 41.025 26.6251.00 47.72 8 ATOM 2754 N SER B142 20.131 40.425 25.0581.00 45.43 7 ATOM 2755 CA SER B142 20.739 41.267 24.0261.00 44.63 6 ATOM 2756 CB SER B142 19.990 41.165 22.7061.00 42.45 6 ATOM 2757 OG SER B142 20.431 42.168 21.8141.00 40.68 8 ATOM 2758 C SER B142 20.774 42.728 24.4571.00 46.01 6 25 ATOM 2759 0 SER B142 19.812 43.256 25.0311.00 46.34 8 ATOM 2760 N TRP B143 21.888 43.384 24.1621.00 46.69 7 ATOM 2761 CA TRP B143 22.069 44.761 24.5491.00 45.07 6 ATOM 2762 CB TRP B143 23.553 45.044 24.7581.00 44.45 6 ATOM 2763 CG TRP B143 23.816 46.368 25.3881.00 43.71 6 30 ATOM 2764 CD2 TRP B143 23.642 46.697 26.7621.00 40.44 6 ATOM 2765 CE2 TRP B143 23.999 48.055 26.9201.00 40.05 6 ATOM '2766CE3 TRP B143 23.22:L 45.975 27.8801.00 38.96 6 ATOM :?767CD1 TRP B143 24.262 47.517 24.7731.00 43.74 6 ATOM 2768 NE1 TRP B143 24.373 48.534 25.6911.00 40.21 7 35 ATOM 2769 CZ2 TRP B143 23.947 48.694 28.1491.00 38.81 6 ATOM 2770 CZ3 TRP B143 23.171 46.612 29.0971.00 35.11 6 ATOM 2771 CH2 TRP B143 23.531 47.956 29.2241.00 37.51 6 ATOM 2772 C TRP B143 21.499 45.730 23.5451.00 46.35 6 ATOM 2773 0 TRP B143 21.06'? 46.813 23.9091.00 48.58 8 ATOM ;?774N THR B144 21.477 45.358 22.2771.00 45.22 7 ATOM :?775CA THR B144 20.963 46.287 21.2901.00 45.21 6 ATOM :?776CB THR B144 22.072 46.696 20.3281.00 44.02 6 ATOM 2777 OG1 THR B144 22.669 45.524 19.7631.00 44.19 8 ATOM '<?778CG2 THR B144 23.129 47.487 21.0691.00 42.50 6 45 ATOM 2779 C THR B144 19.778 45.793 20.4851.00 48.06 6 ATOM <'?7800 THR B144 19.136 46.576 19.7831.00 50.29 8 ATOM '1.781N HIS B145 19.474 44.504 20.5841.00 47.78 7 ATOM 2782 CA HIS B145 18.364 43.970 19.8201.00 48.99 6 ATOM 2783 CB HI:SB145 18.800 42.716 19.0551.00 47.81 6 ATOM 2784 CG HIS B145 19.805 42.974 17.9741.00 46.09 6 ATOM 2785 CD2 HI:SB145 19.677 43.532 16.7481.00 44.37 6 ATOM 2786 ND1 HIS B145 21.125 42.602 18.0861.00 45.57 7 ATOM 2787 CE1 HIS B145 21.766 42.915 16.9751.00 44.33 6 ATOM 2788 NE2 HIS B145 20.909 43.481 16.1461.00 41.88 7 55 ATOM 2789 C HIS B145 17.149 43.656 20.6821.00 50.77 6 ATOM 2,7900 HIS B145 17.235 42.933 21.6681.00 52.14 8 ATOM 2791 N HIS B146 16.010 44.213 20.3021.00 52.05 7 ATOM 2792 CA HIS B146 14.774 43.974 21.0271.00 54.32 6 ATOM 2793 CB HIS B146 13.797 45.130 20.8001.00 52.48 6 ATOM 2794 CG HIS B146 13.526 45.413 19.3601.00 52.25 6 ATOM 2795 CD2 HIS B146 13.106 44.605 18.3571.00 53.49 6 ATOM 2796 ND1 HISB 146 13.726 46.65318.795 1.00 53.68 ATOM 2797 CE1 HISB 146 13.448 46.59717.504 1.00 55.84 ATOM 2798 NE2 HI:SB 146 13.070 45.36417.212 1.00 55.30 ATOM ?.799C HISB 146 14.149 42.64720.576 1.00 57.05 ATOM 2800 0 HISB 146 14.640 41.98419.644 1.00 58.04 ATOM 2801 N SERB 147 13.057 42.28021.243 1.00 58.47 ATOM '<?802CA SERB 147 12.328 41.03720.997 1.00 58.52 ATOM 2803 CB SERB 147 11.071 41.02121.861 1.00 58.93 ATOM '<?804OG SERB 147 10.386 42.25221.740 1.00 63.53 1~ ATOM 2805 C SERB 147 11.955 40.70819.557 1.00 57.13 ATOM 2806 0 SERB 147 11.776 39.54519.215 1.00 56.86 ATOM 2807 N ARGB 148 11.841 41.71618.709 1.00 56.50 ATOM 2808 CA ARGB 148 11.473 41.46217.323 1.00 58.81 ATOM 2809 CB ARGB 148 10.905 42.73416.691 1.00 62.56 15 ATOM '<?810CG ARGB 148 9.781 43.38017.493 1.00 70.38 ATOM '<?811CD ARGB 148 9.337 44.73116.897 1.00 76.49 ATOM 2812 NE ARGB 148 8.480 45.48717.819 1.00 82.57 ATOM '<?813CZ ARGB 148 7.263 45.10418.222 1.00 84.74 ATOM 2814 NH1 ARGB 148 6.728 43.96517.791 1.00 85.52 ATOM 2815 NH2 ARGB 148 6.573 45.86419.064 1.00 85.55 ATOM 2816 C ARGB 148 12.655 40.96316.490 1.00 57.83 ATOM ~?8170 ARGB 148 12.474 40.42315.395 1.00 58.23 ATOM 2818 N GLUB 149 13.864 41.14717.011 1.00 56.99 ATOM 2819 CA GLUB 149 15.072 40.74316.306 1.00 53.60 ATOM 2820 CB GI~UB 149 16.015 41.93316.216 1.00 52.91 ATOM 2821 CG GLUB 149 15.280 43.24315.955 1.00 51.82 ATOM 2822 CD GI~UB 149 16.208 44.43715.841 1.00 54.76 ATOM 2823 OE1 GLUB 149 17.132 44.56216.672 1.00 55.52 ATOM 2824 OE2 GLUB 149 16.010 45.26114.929 1.00 52.75 30 ATOM 2825 C GLUB 149 15.729 39.58417.036 1.00 52.38 ATOM 2826 0 GL~UB 149 16.150 38.60616.421 1.00 51.81 ATOM 2827 N ILEB 150 15.811 39.69318.355 1.00 51.32 ATOM 2.828CA ILEB 150 16.382. 38.61919.154 1.00 51.11 ATOM 2.829CB II,EB 150 17.770 38.98919.757 1.00 48.77 35 ATOM 2.830CG2 ILEB 150 18.155 37.99520.843 1.00 43.40 ATOM 2831 CG1 ILEB 150 18.842. 38.96718.672 1.00 47.30 ATOM 1.832CD1 ILEB 150 20.219 39.31519.168 1.00 45.12 ATOM 2.833C ILEB 150 15.453 38.25420.297 1.00 53.02 ATOM 2834 0 II~EB 150 14.842. 39.11620.932 1.00 52.00 ATOM 2835 N SERB 151 15.350 36.95520.539 1.00 55.16 ATOM 2836 CA SERB 151 14.542 36.43621.628 1.00 56.52 ATOM 2837 CB SE;RB 151 13.280 35.73321.089 1.00 57.06 ATOM 2838 OG SERB 151 13.594 34.58520.323 1.00 54.91 ATOM 2839 C SE;RB 151 15.452 35.44722.337 1.00 56.69 ATOM 2840 0 SERB 151 16.144 34.67621.685 1.00 57.55 ATOM 2841 N VALB 152 15.480 35.50423.661 1.00 58.35 ATOM 2842 CA VALB 152 16.306 34.60024.456 1.00 60.89 ATOM 2843 CB VALB 152 17.135 35.36225.502 1.00 60.77 ATOM 2844 CG1 VALB 152 17.890 36.48924.844 1.00 59.09 ATOM 2845 CG2 VALB 152 16.220 35.90326.586 1.00 62.75 ATOM 2846 C VALB 152 15.389 33.63225.194 1.00 62.80 ATOM 2847 0 VALB 152 14.287 34.01225.597 1.00 63.08 ATOM 2848 N ASPB 153 15.845 32.39525.387 1.00 64.20 ATOM 2849 CA ASPB 153 15.028 31.39026.061 1.00 66.36 55 ATOM 2850 CB ASPB 153 14.232 30.61125.016 1.00 67.03 ATOM 2851 CG ASPB 153 13.427 31.51824.095 1.00 68.33 ATOM 2852 OD1 ASPB 153 12.327 31.94924.504 1.00 65.39 ATOM 2853 OD2 ASPB 153 13.905 31.81022.969 1.00 70.09 ATOM 2854 C ASPB 153 15.877 30.41626.872 1.00 68.77 ATOM 2855 0 ASPB 153 16.974 30.04926.453 1.00 69.28 ATOM 2856 N PR.OB 154 15.404 30.01728.067 1.00 70.46 ATOM 2857 CD PRO B154 14.409 30.740 28.8761.00 69.92 ATOM 2858 CA PRO B154 16.15'7 29.070 28.8981.00 72.29 ATOM :?859CB PRO B154 15.410 29.108 30.2251.00 70.76 ATOM '.?860CG PRO B154 14.902 30.494 30.2811.00 69.28 ATOM '861 C PRO B154 16.151 27.668 28.2501.00 75.71 ATOM 2862 0 PRO B154 15.548 27.467 27.1871.00 75.41 ATOM 2863 N THR B155 16.807 26.700 28.8881.00 79.33 ATOM '?864CA THR B155 16.88'7 25.350 28.3321.00 83.13 ATOM 2865 CB THR B155 18.208 25.187 27.5421.00 82.37 1~ ATOM 2866 OG1 THR B155 19.316 25.233 28.4531.00 83.94 ATOM 2867 CG2 THR B155 18.378 26.311 26.5451.00 81.49 ATOM 2868 C THR B155 16.785 24.189 29.3481.00 86.65 ATOM 2869 0 THR B155 16.122 24.298 30.3851.00 87.45 ATOM :?870N THR B156 17.452 23.078 29.0131.00 90.57 ATOM 2871 CA THR B156 17.504 21.839 29.8131.00 93.48 ATOM 2872 CB THR B156 18.799 21.025 29.4911.00 93.70 ATOM 2873 OG1 THR B156 18.861 20.761 28.0771.00 92.52 ATOM :2874CG2 TrigB156 18.825 19.694 30.3011.00 93.12 ATOM '875 C THR B156 17.448 22.012 31.3371.00 95.82 ATOM 2876 0 THR B156 18.471 22.286 31.9901.00 95.51 ATOM 2877 N GI~UB157 16.257 21.809 31.8971.00 98.15 ATOM 2878 CA Gr~UB157 16.047 21.946 33.3371.00100.26 ATOM 2879 CB GLU B157 14.583 22.308 33.6061.00102.01 ATOM 2880 CG GLU B157 14.023 23.363 32.6431.00104.88 25 ATOM 2881 CD GLU B157 12.539 23.649 32.9021.00106.35 ATOM 2882 OE1 GI~UB157 11.745 22.665 32.9651.00106.79 ATOM 2883 OE2 Gr~UB157 12.178 24.850 33.0301.00105.97 ATOM 2884 C GLU B157 16.397 20.662 34.1021.00100.31 ATOM 2885 0 GLU B157 16.352 20.631 35.3481.00100.47 ATOM 2886 N ASN B158 16.726 19.601 33.3641.00 99.66 ATOM 2887 CA ASN B158 17.065 18.329 34.0031.00 99.04 ATOM 2888 CB ASN B158 17.084 17.198 32.9691.00100.65 ATOM 2889 CG ASN B158 15.793 17.113 32.1701.00101.63 ATOM :2890OD1 ASN B158 14.701 16.919 32.7331.00101.77 35 ATOM 2891 ND2 ASN B158 15.909 17.254 30.8471.00102.28 ATOM 2892 C ASN B158 18.439 18.424 34.6721.00 97.31 ATOM 2893 0 ASN B158 18.546 18.748 35.8721.00 97.45 ATOM 2894 N SER B159 19.473 18.120 33.8811.00 94.36 ATOM 2895 CA SER B159 20.879 18.156 34.3001.00 90.64 ATOM 2896 CB SER B159 21.645 19.051 33.3251.00 91.05 ATOM 2897 OG SER B159 20.831 20.167 32.9481.00 91.42 ATOM 2898 C SER B159 21.129 18.622 35.7421.00 87.58 ATOM 2899 0 SER B159 20.770 19.741 36.1141.00 87.04 ATOM 2900 N ASP B160 21.744 17.767 36.5531.00 84.29 45 ATOM 2901 CA ASP B160 22.035 18.137 37.9381.00 80.73 ATOM 2902 CB ASP B160 23.003 17.149 38.5821.00 79.96 ATOM 2903 CG ASP B160 23.404 17.566 39.9911.00 79.90 ATOM 2904 OD1 ASP B160 24.459 17.087 40.4711.00 79.39 ATOM 2905 OD2 ASP B160 22.659 18.362 40.6171.00 79.13 'rJ0ATOM 2906 C ASP B160 22.687 19.514 37.9561.00 79.03 ATOM 2907 O ASP B160 23.782 19.687 37.3941.00 78.08 ATOM 2908 N ASP B161 22.022 20.473 38.6121.00 76.06 ATOM 2909 CA ASP B161 22.506 21.851 38.7061.00 71.50 ATOM 2910 CB ASP B161 21.655 22.683 39.6751.00 70.10 55 ATOM 2911 CG ASP B161 20.275 22.977 39.1301.00 69.41 ATOM 2912 OD1 ASP B161 20.140 23.189 37.9051.00 68.26 ATOM 2913 OD2 ASP B161 19.319 23.007 39.9291.00 71.44 ATOM 2914 C ASP B161 23.957 21.979 39.1101.00 69.84 ATOM 2915 O ASP B161 24.569 23.008 38.8431.00 71.09 ATOM 2916 N SER B162 24.527 20.960 39.7401.00 67.23 ATOM 2917 CA SER B162 25.928 21.078 40.1361.00 67.27 -I2~
ATOM 2918 CB SER B162 26.051 21.210 41.6611.00 67.18 ATOM 2919 OG SER B162 25.648 20.020 42.3151.00 66.16 ATOM 2920 C SER B162 26.787 19.922 39.6531.00 66.71 ATOM 2921 0 SER B162 27.786 19.576 40.2891.00 64.25 ATOM 2922 N GLU B163 26.410 19.330 38.5231.00 67.10 ATOM 2923 CA GLU B163 27.192 18.220 38.0051.00 68.36 ATOM 2924 CB GLU B163 26.378 17.421 36.9701.00 70.98 ATOM 2925 CG GLU B163 26.411 17.926 35.5451.00 72.60 ATOM 2926 CD GLU B163 25.726 16.946 34.5941.00 74.62 1~ ATOM 2927 OE1 GLU B163 24.477 16.828 34.6491.00 76.45 ATOM 2928 OE2 GLU B163 26.428 16.285 33.7981.00 74.37 ATOM 2929 C GLU B163 28.530 18.688 37.4101.00 67.51 ATOM 2930 0 GLU B163 29.379 17.868 37.0701.00 67.13 ATOM 2931 N TYR B164 28.709 20.008 37.2941.00 66.57 15 ATOM 2932 CA TYR B164 29.943 20.583 36.7711.00 64.39 ATOM 2933 CB TYR B164 29.671 21.419 35.5261.00 64.28 ATOM 2934 CG TYR B164 29.192 20.602 34.3541.00 66.44 ATOM 2935 CD1 TYR B164 27.948 20.860 33.7661.00 66.70 ATOM 2936 CE1 TYR B164 27.490 20.105 32.6901.00 66.59 ATOM 2937 CD2 TYR B164 29.973 19.556 33.8321.00 65.02 ATOM 2938 CE2 TYR B164 29.524 18.790 32.7561.00 65.71 ATOM 2939 CZ TYR B164 28.277 19.075 32.1841.00 66.77 ATOM 2940 OH TYR B164 27.819 18.369 31.0841.00 67.83 ATOM 2941 C TYR B164 30.584 21.463 37.8261.00 63.28 25 ATOM 2942 0 T'i'RB164 31.717 21.936 37.6621.00 61.67 ATOM 2943 N PHE B165 29.859 21.673 38.9181.00 61.88 ATOM 2944 CA PHE B165 30.357 22.517 39.9901.00 60.70 ATOM 2945 CB PI-IEB165 29.288 22.704 41.0671.00 58.78 ATOM 2946 CG PHE B165 29.523 23.905 41.9411.00 57.08 ATOM 2947 CD1 PHE B165 29.420 25.184 41.4131.00 56.05 ATOM 2948 CD2 PHE B165 29.888 23.757 43.2721.00 54.09 ATOM 2949 CEi PHE B165 29.680 26.296 42.2001.00 55.95 ATOM 2950 CE2 PHE B165 30.149 24.858 44.0631.00 55.48 ATOM :2951CZ PHE B165 30.048 26.131 43.5301.00 56.15 35 ATOM 2952 C PHE B165 31.626 21.960 40.6141.00 59.91 ATOM ?953 0 PHE B165 31.757 20.760 40.8081.00 60.17 ATOM 2954 N SER B166 32.572 22.839 40.9191.00 60.28 ATOM 2955 CA SIR B166 33.807 22.390 41.5321.00 60.24 ATOM :2956CB SER B166 34.810 23.534 41.6471.00 59.33 ATOM :2957OG SER B166 36.012 23.081 42.2391.00 59.12 ATOM 2958 C SER B166 33.468 21.877 42.9161.00 60.82 ATOM 2959 0 SER B166 32.614 22.434 43.6111.00 60.12 ATOM 2960 N GLN B167 34.148 20.815 43.3191.00 61.73 ATOM 2961 CA GLN B167 33.907 20.228 44.6231.00 62.29 45 ATOM 2962 CB GIN B167 34.228 18.737 44.5761.00 63.96 ATOM 2963 CG GIN B167 35.620 18.442 44.0681.00 66.77 ATOM 2964 CD GLN B167 35.82'7 16.969 43.7361.00 68.16 ATOM :?965OE1 GLN B167 35.710 16.103 44.6051.00 66.24 ATOM :?966NE2 GLN B167 36.136 16.682 42.4651.00 68.10 ATOM :?967C GLN B167 34.74() 20.912 45.6891.00 60.72 ATOM '.?9680 GLN B167 34.433 20.814 46.8801.00 62.24 ATOM '.?969N TYR B168 35.778 21.626 45.2691.00 57.81 ATOM '.?970CA TYR B168 36.637 22.291 46.2351.00 56.47 ATOM :?971CB TYR B168 38.078 22.236 45.7411.00 55.55 55 ATOM :?972CG TYR B168 38.457 20.836 45.3301.00 55.77 ATOM 2973 CD1 TYR B168 38.420 20.447 43.9881.00 53.38 ATOM 2974 CE1 TYR B168 38.698 19.139 43.6171.00 53.39 ATOM 2975 CD2 TYR B168 38.785 19.872 46.2861.00 55.32 ATOM 2976 CE2 TYR B168 39.060 18.561 45.9221.00 54.41 ATOM 2977 CZ TYR B168 39.013 18.207 44.5911.00 54.89 ATOM <'?978OH TYR B168 39.270 16.919 44.2271.00 56.81 ATOM 2979 C TYRB 168 36.222 23.71246.586 1.00 55.31 ATOM 2980 0 TYRB 168 36.891 24.39547.356 1.00 54.88 ATOM 2981 N SERB 169 35.097 24.14046.033 1.00 55.16 ATOM 2982 CA SERB 169 34.570 25.46946.299 1.00 57.04 ATOM 2983 CB SERB 169 33.363 25.75545.412 1.00 55.22 ATOM 2984 OG SERB 169 32.775 26.99145.769 1.00 55.21 ATOM 2985 C SERB 169 34.14'7 25.61747.754 1.00 60.21 ATOM :?9860 SERB 169 33.664 24.67148.380 1.00 62.02 ATOM 2987 N ARGB 170 34.321 26.81548.298 1.00 61.79 1~ ATOM 2988 CA ARGB 170 33.938 27.05949.678 1.00 60.59 ATOM 2989 CB ARGB 170 34.467 28.41750.150 1.00 61.26 ATOM <?990CG ARGB 170 35.781 28.34250.904 1.00 61.61 ATOM '1.991CD ARGB 170 36.588 29.62850.764 1.00 66.75 ATOM '<?992NE ARGB 170 35.866 30.84651.158 1.00 69.32 15 ATOM <?993CZ ARGB 170 35.634 31.87750.342 1.00 68.59 ATOM <?994NH1 ARGB 170 36.053 31.84049.079 1.00 65.59 ATOM 2995 NH2 ARGB 170 35.017 32.95950.803 1.00 69.04 ATOM 2996 C ARGB 170 32.431 27.04149.785 1.00 58.91 ATOM 2997 0 ARGB 170 31.892 26.98150.883 1.00 61.10 ATOM 2998 N PHEB 171 31.748 27.07748.650 1.00 56.02 ATOM 2999 CA PHEB 171 30.294 27.09348.674 1.00 56.85 ATOM 3000 CB PHEB 171 29.782 28.38448.033 1.00 56.79 ATOM ;1001CG PLiEB 171 30.498 29.60848.529 1.00 59.30 ATOM ;1002CD1 PLiEB 171 31.806 29.88948.110 1.00 59.59 25 ATOM ;1003CD2 PHEB 171 29.900 30.44749.462 1.00 58.28 ATOM ;1004CE1 PHEB 171 32.497 30.98348.616 1.00 58.87 ATOM 3005 CE2 PI-tEB 171 30.586 31.54649.978 1.00 57.19 ATOM 3006 CZ PHEB 171 31.883 31.81749.556 1.00 58.74 ATOM 3007 C PHEB 171 29.694 25.89247.987 1.00 57.50 ATOM 3008 0 PHEB 171 30.412 25.06347.439 1.00 57.83 ATOM 3009 N GLUB 172 28.372 25.79348.036 1.00 58.25 ATOM 3010 CA GLUB 172 27.671 24.68147.416 1.00 58.95 ATOM 3011 CB GLUB 172 27.418 23.55548.436 1.00 61.94 ATOM 3012 CG GLUB 172 26.521 23.92149.634 1.00 65.83 35 ATOM .9013CD GLUB 172 26.352 22.76950.637 1.00 67.36 ATOM 3014 OE1 GLUB 172 26.275 21.59350.192 1.00 67.12 ATOM .9015OE2 GLUB 172 26.280 23.04351.868 1.00 67.97 ATOM ;016 C GLUB 172 26.369 25.19746.844 1.00 59.12 ATOM 3017 O GLUB 172 25.837 26.21747.302 1.00 58.48 ATOM 3018 N ILEB 173 25.865 24.50245.831 1.00 59.47 ATOM 3019 CA ILEB 173 24.630 24.91145.180 1.00 60.85 ATOM ..020CB ILEB 173 24.715 24.72943.653 1.00 62.04 ATOM 3021 CG2 ILEB 173 23.369 25.07742.998 1.00 60.25 ATOM ~'~022CG1 ILEB 173 25.832 25.60343.087 1.00 62.02 45 ATOM 3023 CD1 ILEB 173 26.018 25.41341.600 1.00 63.88 ATOM 3024 C ILEB 173 23.415 24.14845.667 1.00 61.72 ATOM 3025 0 IL~EB 173 23.415 22.91945.733 1.00 61.55 ATOM 3026 N LEUB 174 22.369 24.88345.999 1.00 62.91 ATOM 3027 CA LEUB 174 21.158 24.25346.460 1.00 63.63 ATOM 3028 CB LEUB 174 20.438 25.16647.443 1.00 63.66 ATOM 3029 CG LEUB 174 21.339 25.69848.556 1.00 64.21 ATOM 3030 CD1 LEUB 174 20.543 26.67849.428 1.00 63.13 ATOM 3031 CD2 LEUB 174 21.914 24.53249.369 1.00 61.09 ATOM 3032 C LEUB 174 20.307 24.01045.232 1.00 64.20 55 ATOM 3033 0 LEUB 174 19.891 22.88544.962 1.00 65.99 ATOM 3034 N ASPB 175 20.068 25.05844.459 1.00 64.89 ATOM 3035 CA ASPB 175 19.250 24.89543.268 1.00 66.77 ATOM 3036 CB ASPB 175 17.769: 24.78543.691 1.00 68.40 ATOM 3037 CG ASPB 175 16.806 24.56642.508 1.00 70.08 ATOM 3038 OD1 ASPB 175 17.038 23.63141.695 1.00 71.56 ATOM 3039 OD2 ASPB 175 15.809 25.32242.404 1.00 67.36 ATOM 3040 C ASPB 175 19.480 26.06742.298 1.00 67.13 ATOM 3041 0 ASPB 175 19.910 27.16042.703 1.00 67.04 ATOM :3042N VALB 176 19.214 25.81841.018 1.00 66.07 ATOM 3043 CA VALB 176 19.364 26.81939.981 1.00 65.28 ATOM 3044 CB VALB 176 20.616 26.54739.112 1.00 64.59 ATOM 3045 CG1 VALB 176 20.681 27.52937.943 1.00 62.08 ATOM 3046 CG2 VALB 176 21.866 26.64539.964 1.00 64.50 ATOM 3047 C VALB 176 18.139 26.76039.088 1.00 66.92 ATOM 3048 0 VALB 176 17.723 25.68238.657 1.00 68.14 1~ ATOM 3049 N THRB 177 17.555 27.92038.816 1.00 68.01 ATOM 3050 CA THRB 177 16.393 27.98837.939 1.00 70.52 ATOM 3051 CB THRB 177 15.08'7 28.13938.744 1.00 69.59 ATOM 3052 OG1 THRB 177 15.203 29.25339.638 1.00 70.12 ATOM 3053 CG2 TF3RB 177 14.821 26.88539.544 1.00 68.35 15 ATOM 3054 C THRB 177 16.537 29.17336.984 1.00 72.66 ATOM 3055 0 THRB 177 17.095 30.22037.356 1.00 74.08 ATOM 3056 N GLNB 178 16.049 29.00235.757 1.00 73.01 ATOM 3057 CA GLNB 178 16.121 30.05734.756 1.00 74.26 ATOM 3058 CB GLNB 178 17.006 29.61933.594 1.00 76.29 ATOM 3059 CG GLNB 178 18.090 28.62833.984 1.00 79.92 ATOM 3060 CD GLNB 178 19.227 28.57532.959 1.00 83.13 ATOM 3061 OE1 GLNB 178 18.993 28.49531.731 1.00 83.91 ATOM 3062 NE2 GLNB 178 20.469 28.61633.458 1.00 82.82 ATOM 3063 C GLNB 178 14.725 30.35434.232 1.00 73.95 25 ATOM 3064 O GINB 178 14.041 29.45433.752 1.00 75.30 ATOM 3065 N LYSB 179 14.306 31.61134.310 1.00 73.25 ATOM 3066 CA LYSB 179 12.978 31.99533.837 1.00 72.86 ATOM 3067 CB LYSB 179 12.076 32.30735.030 1.00 75.19 ATOM 3068 CG LYSB 179 12.196 31.28236.160 1.00 78.55 ATOM 3069 CD LYSB 179 11.456 31.73537.428 1.00 80.12 ATOM 3070 CE LYSB 179 11.845 30.87438.631 1.00 80.51 ATOM 3071 NZ LYSB 179 13.32() 30.98738.927 1.00 81.19 ATOM 3072 C LYSB 179 13.101 33.23232.961 1.00 70.68 ATOM 3073 0 L1'SB 179 13.411 34.31133.455 1.00 70.88 35 ATOM 3074 N LYSB 180 12.852 33.09031.665 1.00 68.28 ATOM 3075 CA LYSB 180 12.970 34.24230.776 1.00 68.69 ATOM 3076 CB LYSB 180 12.873 33.79229.305 1.00 66.36 ATOM 3077 CG LYSB 180 11.517 33.38328.831 1.00 61.57 ATOM 3078 CD LYSB 180 10.763 34.57828.296 1.00 62.84 ATOM :3079CE LYSB 180 11.419 35.16827.058 1.00 63.27 ATOM 3080 NZ LYSB 180 11.317 34.29525.857 1.00 64.69 ATOM 3081 C LYSB 180 11.914 35.29731.096 1.00 69.36 ATOM 3082 0 LYSB 180 11."~3'_ 35.11232.019 1.00 70.64 ATOM 3083 N ASNB 181 11.922 36.41630.366 1.00 69.86 45 ATOM 3084 CA ASNB 181 10.927 37.47330.560 1.00 70.42 ATOM 3085 CB ASNB 181 10.755 37.81632.052 1.00 71.53 ATOM 3086 CG A:iNB 181 12.058 38.02132.760 1.00 71.03 ATOM 3087 OD1 A:iNB 181 12.935 38.73132.267 1.00 71.52 ATOM 3088 ND2 ASNB 181 12.195 37.41233.940 1.00 71.36 ATOM 3089 C A:iNB 181 11.125 38.76829.779 1.00 70.25 ATOM 3090 0 ASNB 181 12.104 39.47829.975 1.00 70.25 ATOM 3091 N SERB 182 10.162 39.07828.911 1.00 70.77 ATOM 3092 CA SERB 182 10.203 40.29728.105 1.00 70.64 ATOM 3093 CB SERB 182 9.107 40.26227.045 1.00 70.47 55 ATOM 3094 OG SERB 182 9.267 41.32726.122 1.00 71.28 ATOM 3095 C SERB 182 9.997 41.50029.024 1.00 70.77 ATOM 3096 0 SERB 182 9.429 41.35930.095 1.00 72.80 ATOM '_3097N VALB 183 10.442 42.68028.600 1.00 71.20 ATOM 3098 CA VALB 183 10.334 43.88729.425 1.00 70.43 ATOM 3099 CB VALB 183 11.337 43.82630.630 1.00 68.47 ATOM 3100 CG1 VALB 183 12.636 43.17830.202 1.00 68.72 ATOM 3101 CG2 VAL B183 11.625 45.230 31.1481.00 67.786 ATOM 3102 C VAL B183 10.590 45.189 28.6591.00 70.596 ATOM 3103 0 VAL B183 11.522 45.282 27.8531.00 71.258 ATOM 3104 N THR B184 9.761 46.195 28.9111.00 70.217 ATOM 3105 CA THR B184 9.949 47.480 28.2501.00 71.596 ATOM 3106 CB THR B184 8.610 48.062 27.7111.00 70.786 ATOM 3107 OG1 THR B184 8.065 47.183 26.7211.00 69.378 ATOM 3108 CG2 THR B184 8.836 49.431 27.0741.00 69.816 ATOM 3109 C THR B184 10.558 48.447 29.2711.00 73.136 1~ ATOM 3110 0 THR B184 10.240 48.384 30.4671.00 73.238 ATOM 3111 N TYR B185 11.449 49.319 28.8061.00 74.377 ATOM 3112 CA TYR B185 12.085 50.287 29.6891.00 76.176 ATOM 3113 CB TYR B185 13.614 50.134 29.6631.00 77.196 ATOM 3114 CG T'YRB185 14.076 48.723 29.9121.00 78.366 15 ATOM 3115 CD1 TYR B185 13.942 47.745 28.9281.00 78.946 ATOM 3116 CE1 TYR B185 14.298 46.417 29.1781.00 80.416 ATOM 3117 CD2 TYR B185 14.584 48.344 31.1541.00 79.096 ATOM 3118 CE2 TYR B185 14.944 47.013 31.4131.00 79.416 ATOM 3119 CZ T'~RB185 14.796 46.054 30.4241.00 79.276 ATOM 3120 OH TYR B185 15.119 44.731 30.6771.00 79.158 ATOM 3121 C TYR B185 11.713 51.670 29.2091.00 76.816 ATOM 3122 0 T'~RB185 11.669 51.927 28.0031.00 76.758 ATOM 3123 N SER B186 11.445 52.563 30.1521.00 78.687 ATOM 3124 CA SER B186 11.078 53.941 29.8101.00 80.006 25 ATOM 3125 CB SER B186 11.002 54.795 31.0891.00 80.196 ATOM 3126 OG SER B186 12.160 54.610 31.9021.00 79.868 ATOM 3127 C SER B186 12.100 54.539 28.8321.00 80.216 ATOM 3128 0 SER B186 11.745 55.296 27.9231.00 79.158 ATOM 3129 N CYS B187 13.364 54.171 29.0251.00 80.457 30 ATOM :3130CA CYS B187 14.459 54.653 28.1891.00 80.856 ATOM 3131 C C'ISB187 14.259 54.260 26.7721.00 81.016 ATOM :31320 CYS B187 14.510 55.018 25.8381.00 80.348 ATOM 3133 CB CYS B187 15.78'7 53.993 28.5741.00 81.536 ATOM 3134 SG CYS B187 15.913 52.165 28.2681.00 84.2516 35 ATOM 3135 N CYS B188 13.79:L 53.035 26.6371.00 82.807 ATOM 3136 CA CYS B188 13.712 52.411 25.3391.00 83.266 ATOM 3137 C CYS B188 12.352 51.851 24.8491.00 82.466 ATOM 3138 0 CYS B188 11.733 50.977 25.4911.00 82.708 ATOM 3139 CB CYS B188 14.811 51.336 25.3651.00 82.416 ATOM 3140 SG CYS B188 16.353 51.824 26.2821.00 83.4916 ATOM 3141 N PRO B189 11.891 52.346 23.6791.00 81.487 ATOM 3142 CD PRO B189 12.734 53.291 22.9101.00 81.136 ATOM 3143 CA PRO B189 10.652 52.037 22.9381.00 79.976 ATOM 3144 CB PRO B189 10.97'7 52.510 21.5171.00 80.126 ATOM 3145 CG PRO B189 11.825 53.725 21.7661.00 80.416 ATOM 3146 C PRO B189 10.133 50.585 22.9411.00 78.776 ATOM 3147 0 PRO B189 9.063 50.303 23.4901.00 78.668 ATOM 3148 N GLU B190 10.878 49.671 22.3131.00 77.687 ATOM 3149 CA GLU B190 10.473 48.254 22.2191.00 73.966 ATOM 3150 CB GLU B190 11.214 47.570 21.0751.00 75.246 ATOM 3151 CG GLU B190 11.578 48.475 19.9081.00 77.676 ATOM ;1152CD GLU B190 10.414 48.680 18.9501.00 79.116 ATOM 3153 OEl GL~UB190 9.731 47.672 18.6171.00 77.058 ATOM 3154 OE2 GLU B190 10.200 49.845 18.5261.00 79.848 55 ATOM 3155 C GLU B190 10.779 47.482 23.4941.00 71.496 ATOM 3156 0 GLU B190 11.317 48.038 24.4601.00 71.148 ATOM ;157 N ALA B191 10.455 46.191 23.4831.00 68.337 ATOM 3158 CA ALA B191 10.708 45.331 24.6381.00 66.036 ATOM 3159 CB ALA B191 9.554 44.340 24.8011.00 65.956 6d ATOM 3160 C ALA B191 12.035 44.570 24.4891.00 64.666 ATOM 3161 0 ALA B191 12.439 44.225 23.3741.00 63.368 ATOM 3162 N TYR B192 12.704 44.306 25.6081.00 62.75 ATOM 3163 CA TYR B192 13.969 43.574 25.5721.00 61.63 ATOM 3164 CB TYR B192 15.134 44.468 26.0101.00 59.80 ATOM 3165 CG TYR B192 15.465 45.538 25.0101.00 59.56 ATOM :3166CD1 TYR B192 14.786 46.754 25.0051.00 59.46 ATOM 3167 CE1 T'.CRB192 15.055 47.728 24.0361.00 60.27 ATOM :3168CD2 TYR B192 16.426 45.315 24.0271.00 60.64 ATOM :3169CE2 TYR B192 16.705 46.274 23.0571.00 60.97 ATOM 3170 CZ TYR B192 16.017 47.480 23.0641.00 61.60 1~ ATOM :3171OH T'tRB192 16.290 48.431 22.1011.00 60.81 ATOM :3172C TYR B192 13.948 42.302 26.4261.00 62.58 ATOM 3173 0 T'CRB192 14.047 42.349 27.6681.00 62.03 ATOM 3174 N GLU B193 13.834 41.166 25.7381.00 62.66 ATOM :3175CA GLU B193 13.794 39.852 26.3841.00 62.77 15 ATOM :3176CB GLU B193 13.521 38.742 25.3521.00 61.29 ATOM :3177CG GLU B193 12.153 38.831 24.6811.00 61.98 ATOM 3178 CD GLU B193 11.858 37.636 23.7751.00 62.41 ATOM 3179 OE1 GI~UB193 12.059 36.486 24.2281.00 62.14 ATOM 3180 OE2 GLU B193 11.411 37.838 22.6211.00 62.38 ATOM :3181C GLU B193 15.105 39.552 27.0911.00 61.37 ATOM :31820 GLU B193 16.166 40.019 26.6661.00 63.09 ATOM 3183 N ASP B194 15.026 38.772 28.1651.00 58.46 ATOM :3184CA ASP B194 16.207 38.395 28.9141.00 57.68 ATOM :3185CB ASP B194 16.699 39.560 29.7941.00 58.80 25 ATOM 3186 CG ASP B194 15.806 39.809 31.0061.00 61.20 ATOM 3187 OD1 ASP B194 15.115 40.864 31.0301.00 63.41 ATOM 3188 OD2 ASP B194 15.804 38.955 31.9301.00 59.40 ATOM 3189 C ASP B194 15.914 37.177 29.7721.00 56.01 ATOM :31900 ASP B194 14.789 36.956 30.1711.00 55.53 ATOM :3191N VAL B195 16.943 36.385 30.0361.00 55.28 ATOM :3192CA VaL B195 16.819 35.199 30.8601.00 54.79 ATOM :3193CB VAL B195 17.662 34.053 30.3001.00 53.86 ATOM :3194CG1 VAL B195 17.695 32.895 31.2851.00 51.98 ATOM :3195CG2 VaL B195 17.112 33.631 28.9681.00 53.24 35 ATOM 3196 C VAL B195 17.334 35.522 32.2481.00 56.42 ATOM 3197 0 VAL B195 18.45:L 36.003 32.4071.00 58.47 ATOM :3198N GLU B196 16.525 35.261 33.2611.00 58.06 ATOM 3199 CA GLU B196 16.942 35.526 34.6241.00 58.06 ATOM :3200CB GLU B196 15.808 36.168 35.3931.00 59.44 ATOM :3201CG GLU B196 16.168 36.535 36.8111.00 64.02 ATOM :3202CD GLU B196 14.983 37.131 37.5611.00 65.27 ATOM 3203 OE1 GLU B196 14.414 38.137 37.0811.00 65.41 ATOM 3204 OE2 GLU B196 14.625 36.591 38.6311.00 68.06 ATOM 3205 C GLU B196 17.310 34.199 35.2521.00 57.73 ATOM 3206 0 GLU B196 16.495 33.285 35.2911.00 60.64 ATOM 3207 N VAL B197 18.543 34.084 35.7221.00 56.14 ATOM 3208 CA VAL B197 18.999 32.854 36.3381.00 54.69 ATOM :3209CB VAL B197 20.358 32.405 35.7571.00 52.53 ATOM 3210 CG1 VAL B197 20.807 31.107 36.4041.00 50.11 ATOM 3211 CG2 VAL B197 20.241 32.229 34.2641.00 51.73 ATOM 3212 C VAL B197 19.154 33.106 37.8191.00 56.80 ATOM 3213 0 VAL B197 19.817 34.057 38.2261.00 57.91 ATOM 3214 N SER B198 18.539 32.258 38.6311.00 58.59 ATOM :3215CA SER B198 18.626 32.421 40.0711.00 58.65 55 ATOM 3216 CB SER B198 17.235 32.308 40.7031.00 59.34 ATOM 3217 OG SER B198 16.426 33.407 40.3201.00 59.29 ATOM :3218C SER B198 19.556 31.385 40.6511.00 57.58 ATOM 3219 0 SER B198 19.340 30.188 40.5051.00 58.41 ATOM 3220 N LEU B199 20.599 31.857 41.3101.00 57.49 ATOM :3221CA LEU B199 21.569 30.963 41.9041.00 58.89 ATOM 3222 CB LEU B199 23.000 31.437 41.6221.00 58.76 12$
ATOM 3223 CG LEUB 199 24.108 30.67042.358 1.00 59.80 ATOM 3224 CD1 LEUB 199 24.135 29.20941.927 1.00 60.58 ATOM 3225 CD2 LEUB 199 25.446 31.30442.063 1.00 60.42 ATOM 3226 C LEUB 199 21.369 30.88543.395 1.00 60.51 ATOM 3227 0 LEUB 199 21.759 31.78844.136 1.00 61.67 ATOM 3228 N ASNB 200 20.754 29.80143.838 1.00 60.15 ATOM 3229 CA ASNB 200 20.539 29.60745.252 1.00 57.57 ATOM 3230 CB ASNB 200 19.188 28.91945.499 1.00 60.95 ATOM 3231 CG ASNB 200 18.936 28.64246.968 1.00 62.80 1~ ATOM 3232 OD1 ASNB 200 19.167 29.50447.820 1.00 65.10 ATOM 3233 ND2 ASNB 200 18.465 27.44347.275 1.00 59.90 ATOM 3234 C ASNB 200 21.691 28.73645.712 1.00 55.80 ATOM 3235 0 ASNB 200 21.793 27.56945.325 1.00 56.54 ATOM 3236 N PHEB 201 22.561 29.31646.527 1.00 53.98 15 ATOM 3237 CA PHEB 201 23.725 28.61547.042 1.00 53.98 ATOM 3238 CB PHEB 201 24.960 28.97546.226 1.00 53.35 ATOM 3239 CG PHEB 201 25.418 30.40446.418 1.00 51.26 ATOM 3240 CD1 PHEB 201 26.633 30.69047.050 1.00 50.15 ATOM 3241 CD2 PHEB 201 24.615 31.47246.000 1.00 50.67 ATOM 3242 CE1 PHEB 201 27.038 32.01547.264 1.00 45.58 ATOM 3243 CE2 PHEB 201 25.016 32.79946.213 1.00 47.69 ATOM :3244CZ PHEB 201 26.227 33.06246.845 1.00 46.26 ATOM :3245C PHEB 201 23.943 29.08048.456 1.00 55.95 ATOM :32460 PHEB 201 23.275 30.01748.912 1.00 56.39 25 ATOM 3247 N ARGB 202 24.896 28.44349.132 1.00 56.81 ATOM :3248CA ARGB 202 25.223 28.79350.506 1.00 60.77 ATOM 3249 CB ARGB 202 24.255 28.10451.460 1.00 64.25 ATOM 3250 CG ARGB 202 24.491 26.62551.497 1.00 66.78 ATOM 3251 CD ARGB 202 23.494 25.89352.344 1.00 70.08 ATOM :3252NE ARGB 202 23.768 24.45452.333 1.00 72.69 ATOM 3253 CZ ARGB 202 22.945 23.52852.825 1.00 73.67 ATOM :3254NH1 ARGB 202 21.781 23.88453.375 1.00 74.01 ATOM 3255 NH2 ARGB 202 23.281 22.24552.760 1.00 73.29 ATOM 3256 C ARGB 202 26.635 28.32850.843 1.00 61.67 35 ATOM 3257 0 ARGB 202 27.181 27.45050.183 1.00 62.10 ATOM :3258N LYSB 203 27.225 28.91851.875 1.00 62.58 ATOM 3259 CA LYSB 203 28.549 28.50552.298 1.00 62.87 ATOM 3260 CB LYSB 203 29.06'7 29.41753.399 1.00 62.83 ATOM 3261 CG LYSB 203 30.400 28.99553.967 1.00 62.29 ATOM 3262 CD LYSB 203 30.765 29.87155.141 1.00 65.39 ATOM 3263 CE LYSB 203 32.135 29.51955.689 1.00 67.38 ATOM 3264 NZ LYSB 203 33.232 29.77254.695 1.00 70.43 ATOM 3265 C LYSB 203 28.387 27.10152.854 1.00 64.30 ATOM 3266 0 LYSB 203 27.318 26.73653.371 1.00 65.43 45 ATOM 3267 N LYSB 204 29.446 26.31252.745 1.00 66.12 ATOM 3268 CA LYSB 204 29.417 24.95553.246 1.00 67.10 ATOM 3269 CB LYSB 204 30.701 24.22352.860 1.00 63.37 ATOM 3270 CG LYSB 204 30.745 23.85351.379 1.00 60.21 ATOM 3271 CD LYSB 204 31.940 22.96651.055 1.00 58.61 50 ATOM 3272 CE LYSB 204 31.955 22.55349.582 1.00 57.79 ATOM 3273 NZ LYSB 204 33.202 21.80849.238 1.00 53.82 ATOM 3274 C LYSB 204 29.293 25.08154.745 1.00 70.90 ATOM 3275 0 LYSB 204 29.893 25.98955.339 1.00 72.60 ATOM 3276 N GLYB 205 28.489 24.19255.342 1.00 74.01 55 ATOM 3277 CA GLYB 205 28.260 24.19756.783 1.00 74.37 ATOM 3278 C GLYB 205 29.305 23.43057.576 1.00 75.59 ATOM 3279 OT1 GLYB 205 30.276 22.93256.958 1.00 75.56 ATOM 3280 OT2 GLYB 205 29.163 23.33158.822 1.00 76.47 ATOM 3281 CB PHEC 1 16.639 48.1832.177 1.00 71.30 ATOM 3282 CG PHEC 1 17.365 49.1621.297 1.00 73.66 ATOM 3283 CD1 PHEC 1 18.546 48.8050.647 1.00 74.99 ATOM 3284 CD2 PHEC 1 16.889 50.4711.160 1.00 75.46 ATOM 3285 CE1 PHEC 1 19.257 49.743-0.138 1.00 77.68 ATOM 3286 CE2 PHEC 1 17.590 51.4210.380 1.00 76.94 ATOM 3287 CZ PHEC 1 18.779 51.054-0.271 1.00 77.37 rJ ATOM 3288 C PHEC 1 16.469 45.8412.896 1.00 69.30 ATOM 3289 O PHEC 1 15.487 45.9763.637 1.00 68.12 ATOM 3290 N PHEC 1 15.624 46.5150.608 1.00 67.59 ATOM 3291 CA PHEC 1 16.651 46.7331.669 1.00 69.36 ATOM 3292 N ASPC 2 17.421 44.9403.123 1.00 69.61 1~ ATOM 3293 CA ASPC 2 17.373 44.0714.298 1.00 68.32 ATOM 3294 CB ASPC 2 17.364 42.5923.882 1.00 69.98 ATOM 3295 CG ASPC 2 18.729 42.0923.426 1.00 71.56 ATOM :3296OD1 ASPC 2 19.586 41.8674.316 1.00 71.73 ATOM :3297OD2 ASPC 2 18.936 41.9262.187 1.00 72.36 1'rJATOM 3298 C ASPC 2 18.615 44.3995.116 1.00 66.00 ATOM 3299 0 ASPC 2 19.617 44.8654.562 1.00 67.56 ATOM :3300N ARGC 3 18.550 44.1656.423 1.00 62.29 ATOM 3301 CA ARGC 3 19.663 44.4557.320 1.00 59.37 ATOM :3302CB ARGC 3 19.515 43.6618.604 1.00 56.89 ATOM 3303 CG ARGC 3 18.280 44.0179.387 1.00 55.35 ATOM :3304CD ARGC 3 18.177 43.17210.640 1.00 57.70 ATOM 3305 NE ARGC 3 16.947 43.43711.378 1.00 60.36 ATOM 3306 CZ ARGC 3 16.714 44.54012.084 1.00 62.92 ATOM 3307 NH1 ARGC 3 17.623 45.50312.166 1.00 62.53 25 ATOM 3308 NH2 ARGC 3 15.554 44.68912.700 1.00 64.87 ATOM 3309 C ARGC 3 21.060 44.2366.749 1.00 59.30 ATOM 3310 0 ARGC 3 21.970 45.0087.051 1.00 61.36 ATOM 3311 N ALAC 4 21.257 43.2155.920 1.00 57.54 ATOM 3312 CA ALAC 4 22.595 43.0235.379 1.00 55.37 3flATOM 3313 CB ALAC 4 22.686 41.7274.610 1.00 53.55 ATOM 3314 C ALAC 4 22.947 44.1864.478 1.00 54.97 ATOM 3315 O ALAC 4 24.020 44.7644.603 1.00 55.12 ATOM 3316 N ASPC 5 22.034 44.5343.575 1.00 56.24 ATOM 3317 CA ASPC 5 22.265 45.6322.646 1.00 56.25 35 ATOM 3318 CB ASPC 5 21.081 45.7951.680 1.00 58.72 ATOM 3319 CG ASPC 5 20.773 44.5290.906 1.00 62.35 ATOM 3320 OD1 ASPC 5 21.715 43.9000.364 1.00 63.21 ATOM 3321 OD2 ASPC 5 19.574 44.1710.834 1.00 65.38 ATOM .3322C ASPC 5 22.47'_ 46.9353.406 1.00 55.27 ATOM 3323 O A:>PC 5 23.294 47.7643.020 1.00 54.31 ATOM 3324 N ILEC 6 21.732 47.1104.495 1.00 53.55 ATOM 3325 CA II~EC 6 21.840 48.3395.270 1.00 54.16 ATOM 3326 CB ILEC 6 20.713 48.4566.311 1.00 54.45 ATOM 3327 CG2 ILEC 6 20.811 49.7937.021 1.00 52.65 45 ATOM 3328 CG1 ILEC 6 19.352. 48.3445.612 1.00 56.53 ATOM 3329 CD1 ILEC 6 18.146 48.5306.524 1.00 56.74 ATOM 3330 C ILEC 6 23.178 48.4755.972 1.00 52.95 ATOM 3331 0 ILEC 6 23.872 49.4875.818 1.00 53.74 ATOM .'.332N LEUC 7 23.543 47.4556.741 1.00 51.30 ATOM 3333 CA LE;UC 7 24.814 47.4627.460 1.00 49.62 ATOM 3334 CB LEUC 7 24.931. 46.1948.293 1.00 47.45 ATOM 3335 CG LEUC 7 23.912 46.1369.429 1.00 47.62 ATOM 3336 CD1 LEUC 7 23.819 44.74310.014 1.00 48.73 ATOM 3337 CD2 LEUC 7 24.321 47.12210.486 1.00 47.41 55 ATOM 3338 C LEUC 7 25.970 47.5596.465 1.00 49.71 ATOM 3339 O LEUC 7 26.951 48.2696.677 1.00 47.57 ATOM 3340 N TYRC 8 25.827 46.8455.361 1.00 52.00 ATOM 3341 CA TYRC 8 26.830 46.8384.318 1.00 53.34 ATOM 3342 CB TYRC 8 26.367 45.9613.167 1.00 53.82 ATOM 3343 CG TYRC 8 27.335 45.9692.020 1.00 57.66 ATOM 3344 CD1 TYRC 8 28.552 45.2892.106 1.00 58.72 ATOM 3345 CE1 TYRC 8 29.467 45.315 1.045 1.00 60.33 ATOM 3346 CD2 TYRC 8 27.051 46.679 0.851 1.00 58.73 ATOM 3347 CE2 TYRC 8 27.957 46.714 -0.2111.00 60.05 ATOM 3348 CZ TYRC 8 29.162 46.027 -0.1071.00 60.68 ATOM 3349 OH TYRC 8 30.045 46.045 -1.1631.00 62.86 ATOM 3350 C T'i'RC 8 27.134 48.235 3.790 1.00 54.25 ATOM 3351 0 TYRC 8 28.298 48.589 3.614 1.00 55.00 ATOM 3352 N ASNC 9 26.092 49.015 3.516 1.00 53.76 ATOM 3353 CA ASNC 9 26.283 50.369 3.013 1.00 55.35 1~ ATOM 3354 CB ASNC 9 24.941 51.005 2.660 1.00 59.27 ATOM 3355 CG ASNC 9 24.299 50.372 1.433 1.00 61.31 ATOM 3356 OD1 ASNC 9 24.907 49.531 0.758 1.00 61.18 ATOM 3357 ND2 ASNC 9 23.068 50.778 1.136 1.00 62.69 ATOM 3358 C A:3NC 9 27.003 51.233 4.034 1.00 54.14 1'JrATOM 3359 0 ASNC 9 28.001 51.877 3.722 1.00 54.09 ATOM 3360 N ILEC 10 26.494 51.240 5.258 1.00 54.05 ATOM 3361 CA ILEC 10 27.107 52.014 6.330 1.00 54.35 ATOM :3362CB ILEC 10 26.399 51.757 7.668 1.00 53.88 ATOM :3363CG2 ILEC 10 27.141 52.453 8.784 1.00 52.27 ATOM 3364 CG1 II~EC 10 24.956 52.257 7.595 1.00 53.43 ATOM 3365 CD1 ILEC 10 24.114 51.860 8.769 1.00 51.08 ATOM 3366 C ILEC 10 28.580 51.635 6.479 1.00 55.70 ATOM :33670 ILEC 10 29.452 52.497 6.609 1.00 56.88 ATOM :3368N ARGC 11 28.844 50.337 6.456 1.00 56.11 25 ATOM :3369CA ARGC 11 30.194 49.827 6.579 1.00 57.74 ATOM :3370CB ARGC 11 30.161 48.307 6.466 1.00 61.80 ATOM 3371 CG ARGC 11 31.495 47.629 6.644 1.00 67.28 ATOM 3372 CD ARGC 11 31.879 47.631 8.102 1.00 75.61 ATOM 3373 NE ARGC 11 32.848 46.586 8.419 1.00 82.91 ATOM 3374 CZ ARGC 11 32.779 45.333 7.957 1.00 86.49 ATOM 3375 NH1 ARGC 11 31.785 44.963 7.140 1.00 87.62 ATOM 3376 NH2 ARGC 11 33.689 44.436 8.331 1.00 87.96 ATOM 3377 C ARGC 11 31.099 50.388 5.490 1.00 57.06 ATOM '_33780 ARGC 11 32.198 50.865 5.758 1.00 57.56 35 ATOM 3379 N GLNC 12 30.617 50.333 4.255 1.00 57.22 ATOM 3380 CA GLNC 12 31.377 50.781 3.093 1.00 56.59 ATOM 3381 CB GLNC 12 30.783 50.169 1.829 1.00 56.62 ATOM 3382 CG GINC 12 31.795 49.448 0.976 1.00 58.01 ATOM _i383CD GI,NC 12 32.113 48.101 1.532 1.00 58.10 ATOM ;1384OE1 GLNC 12 31.215 47.289 1.704 1.00 59.91 ATOM 3385 NE2 GLNC 12 33.384 47.846 1.824 1.00 57.19 ATOM 3386 C GLNC 12 31.505 52.278 2.872 1.00 56.02 ATOM 3387 0 GLNC 12 32.424 52.728 2.208 1.00 54.27 ATOM 3388 N THRC 13 30.589 53.054 3.423 1.00 58.04 45 ATOM 3389 CA THRC 13 30.631 54.492 3.213 1.00 59.72 ATOM .4390CB THRC 13 29.302 54.985 2.653 1.00 58.83 ATOM 3391 OG1 THRC 13 28.253 54.622 3.559 1.00 55.46 ATOM 3392 CG2 THRC 13 29.043 54.374 1.277 1.00 59.29 ATOM 3393 C THRC 13 30.944 55.316 4.459 1.00 61.81 ATOM 3394 0 THRC 13 31.317 56.492 4.364 1.00 62.06 ATOM 1395 N SERC 14 30.794 54.705 5.627 1.00 62.55 ATOM 3396 CA SERC 14 31.053 55.421 6.865 1.00 62.19 ATOM 3397 CB SERC 14 30.549 54.612 8.056 1.00 62.76 ATOM 3398 OG SERC 14 30.476 55.435 9.209 1.00 64.16 55 ATOM 3399 C SERC 14 32.521 55.779 7.074 1.00 61.03 ATOM 3.4000 SERC 14 33.422 55.098 6.577 1.00 61.70 ATOM 3401 N ARGC 15 32.735 56.863 7.816 1.00 58.93 ATOM 3402 CA ARGC 15 34.064 57.367 8.127 1.00 57.11 ATOM 3403 CB ARGC 15 34.383 58.576 7.247 1.00 57.80 ATOM 3404 CG ARGC 15 34.388 58.261 5.748 1.00 59.34 ATOM 3405 CD ARGC 15 35.114 59.331 4.968 1.00 61.90 ATOM 3406 NE ARG C 15 36.475 59.479 5.475 1.00 64.09 7 ATOM 3407 CZ ARG C 15 37.287 60.488 5.180 1.00 63.60 6 ATOM 3408 NH1 ARG C 15 36.873 61.450 4.375 1.00 62.16 7 ATOM 3409 NH2 ARG C 15 38.516 60.526 5.688 1.00 66.26 7 ATOM 3410 C ARG C 15 34.081 57.753 9.598 1.00 54.80 6 ATOM 3411 0 ARG C 15 33.736 58.874 9.969 1.00 54.31 8 ATOM 3412 N PRO C 16 34.483 56.811 10.4601.00 53.16 7 ATOM 3413 CD PRO C 16 34.921 55.451 10.1061.00 49.32 6 ATOM 3414 CA PRO C 16 34.547 57.012 11.9111.00 51.93 6 1~ ATOM 3415 CB PRO C 16 35.072 55.668 12.4291.00 49.26 6 ATOM 3416 CG PRO C 16 34.647 54.702 11.3871.00 48.93 6 ATOM 3417 C PRO C 16 35.420 58.172 _2.3561.00 51.62 6 ATOM 3418 0 PRO C 16 35.266 58.663 ~3.4681.00 52.27 8 ATOM 3419 N ASP C 17 36.337 58.608 11.5011.00 51.78 7 15 ATOM 3420 CA ASP C 17 37.219 59.706 11.8631.00 54.16 6 ATOM 3421 CB ASP C 17 38.597 59.526 11.2091.00 59.36 6 ATOM 3422 CG ASP C 17 39.421 58.411 11.8591.00 64.02 6 ATOM 3423 OD1 ASP C 17 39.200 58.134 13.0671.00 64.61 8 ATOM 3424 OD2 ASP C 17 40.299 57.824 11.1701.00 64.76 8 ATOM 3425 C ASP C 17 36.680 61.080 11.4991.00 53.77 6 ATOM 3426 0 ASP C 17 37.350 62.088 11.7361.00 54.82 8 ATOM 3427 N VAL C 18 35.473 61.129 1Ø9441.00 53.02 7 ATOM 3428 CA VAL C 18 34.902 62.398 10.5281.00 53.40 6 ATOM 3429 CB VAL C 18 34.699 62.421 9.003 1.00 53.89 6 25 ATOM 3430 CG1 VAL C 18 34.194 63.785 8.563 1.00 53.62 6 ATOM 3431 CG2 VAL C 18 36.013 62.087 8.308 1.00 52.31 6 ATOM 3432 C VAL C 18 33.589 62.771 11.2011.00 54.75 6 ATOM :34330 VAL C 18 32.573 62.097 11.0461.00 54.30 8 ATOM 3434 N ILE C 19 33.634 63.870 11.9441.00 56.30 7 ATOM 3435 CA ILE C 19 32.480 64.401 12.6621.00 55.34 6 ATOM :3436CB ILE C 19 32.934 65.631 13.5191.00 54.46 6 ATOM 3437 CG2 ILE C 19 33.362 66.777 12.6181.00 53.28 6 ATOM 3438 CG1 ILE C 19 31.82'7 66.078 14.4671.00 53.52 6 ATOM 3439 CD1 ILE C 19 32.318 67.022 15.5251.00 50.20 6 35 ATOM 3440 C ILE C 19 31.392 64.784 11.6441.00 56.25 6 ATOM 3441 0 ILE C 19 31.675 65.474 10.6531.00 56.64 8 ATOM 3442 N PRO C 20 30.142 64.318 11.8611.00 55.95 7 ATOM 3443 CD PRO C 20 29.'756 63.451 12.9781.00 55.72 6 ATOM 3444 CA PRO C 20 28.980 64.574 10.9961.00 57.07 6 ATOM 3445 CB PRO C 20 27.912 63.627 11.5401.00 55.92 6 ATOM 3446 CG PRO C 20 28.673 62.639 12.3491.00 57.30 6 ATOM 3447 C PRO C 20 28.50() 66.023 11.0351.00 59.85 6 ATOM 3448 0 PRO C 20 27.326 66.290 11.2701.00 58.63 8 ATOM 3449 N THR C 21 29.416 66.947 10.7821.00 64.15 7 45 ATOM 3450 CA THR C 21 29.123 68.370 10.7971.00 68.52 6 ATOM 3451 CB THR C 21 30.421. 69.169 11.0461.00 68.47 6 ATOM 3452 OG1 THR C 21 30.496 69.477 12.4401.00 70.47 8 ATOM 3453 CG2 THR C 21 30.470 70.455 10.2161.00 69.90 6 ATOM ..454C THR C 21 28.424 68.913 9.555 1.00 72.31 6 ATOM 3455 0 THR C 21 28.826 68.631 8.412 1.00 71.25 8 ATOM 3456 N GLN C 22 27.384 69.709 9.805 1.00 76.61 7 ATOM 3457 CA GLN C 22 26.599 70.346 8.747 1.00 80.67 6 ATOM 3458 CB GLN C 22 25.112 70.087 8.972 1.00 81.49 6 ATOM 3459 CG GLN C 22 24.749 68.606 9.029 1.00 82.93 6 55 ATOM 3460 CD GLN C 22 23.534 68.351 9.900 i.00 83.25 6 ATOM 3461 OE1 GLN C 22 23.566 68.595 11.1201.00 84.14 8 ATOM 3462 NE2 GLN C 22 22.452 67.867 9.285 1.00 83.14 7 ATOM 3463 C GLN C 22 26.865 71.846 8.814 1.00 83.04 6 ATOM 3464 O GLN C 22 26.382 72.523 9.730 1.00 83.36 8 ATOM 3465 N ARG C 23 27.635 72.357 7.849 1.00 85.46 7 ATOM 3466 CA ARG C 23 27.985 73.783 7.802 1.00 86.39 6 ATOM 3467 CB ARGC 23 26.722 74.654 7.771 1.00 87.20 ATOM :3468CG ARGC 23 26.050 74.710 6.393 1.00 89.96 ATOM 3469 CD ARGC 23 24.797 73.834 6.297 1.00 90.96 ATOM 3470 NE ARGC 23 24.282 73.771 4.920 1.00 93.30 ATOM :3471CZ ARGC 23 23.996 74.830 4.145 1.00 94.77 ATOM 3472 NH1 ARGC 23 24.167 76.083 4.591 1.00 94.25 ATOM 3473 NH2 ARGC 23 23.537 74.640 2.905 1.00 94.32 ATOM 3474 C ARGC 23 28.828 74.134 9.013 1.00 85.61 ATOM 3475 0 ARGC 23 29.599 73.302 9.495 1.00 85.98 ATOM 3476 N ASPC 24 28.700 75.358 9.503 1.00 85.83 ATOM 3477 CA ASPC 24 29.462 75.755 10.6851.00 86.66 ATOM :3478CB ASPC 24 29.625 77.283 10.7851.00 90.61 ATOM 3479 CG ASPC 24 29.385 78.002 9.458 1.00 92.74 ATOM 3480 OD1 ASPC 24 30.108 77.704 8.471 1.00 93.41 15 ATOM :3481OD2 ASPC 24 28.468 78.868 9.418 1.00 93.68 ATOM :3482C ASPC 24 28.679 75.280 11.9071.00 85.20 ATOM 3483 0 ASPC 24 29.053 75.591 13.0521.00 85.29 ATOM 3484 N ARGC 25 27.587 74.553 11.6601.00 82.29 ATOM 3485 CA ARGC 25 26.761 74.039 12.7421.00 79.75 ATOM :3486CB ARGC 25 25.422 73.522 12.2101.00 82.55 ATOM 3487 CG ARGC 25 24.428 74.588 11.7811.00 86.91 ATOM :3488CD ARGC 25 23.026 73.964 11.5941.00 91.01 ATOM :3489NE ARGC 25 22.00'7 74.963 11.2521.00 94.97 ATOM :3490CZ ARGC 25 20.702 74.705 11.1461.00 96.54 25 ATOM :3491NH1 ARGC 25 20.253 73.471 11.3561.00 97.65 ATOM :3492NH2 ARGC 25 19.844 75.679 10.8371.00 96.40 ATOM :3493C ARGC 25 27.456 72.906 13.4901.00 76.53 ATOM :34940 ARGC 25 28.004 71.987 12.8761.00 78.25 ATOM :3495N PROC 26 27.449 72.963 14.8291.00 72.39 ATOM 3496 CD PROC 26 27.074 74.126 15.6471.00 71.70 ATOM 3497 CA PROC 26 28.073 71.935 15.6601.00 68.13 ATOM 3498 CB PROC 26 28.087 72.574 17.0501.00 69.12 ATOM 3499 CG PROC 26 28.066 74.039 16.7701.00 69.98 ATOM 3500 C PROC 26 27.183 70.706 15.6391.00 64.71 35 ATOM 3501 O PROC 26 26.010 70.795 15.2751.00 63.13 ATOM :3502N VALC 27 27.735 69.560 16.0191.00 61.55 ATOM 3503 CA VALC 27 26.937 68.349 16.0811.00 57.92 ATOM :3504CB VALC 27 27.805 67.073 15.9481.00 56.85 ATOM :3505CG1 VALC 27 27.038 65.860 16.4391.00 54.71 ATOM :3506CG2 VALC 27 28.19'7 66.872 14.5021.00 54.24 ATOM 3507 C VALC 27 26.301 68.400 17.4521.00 56.84 ATOM 3508 0 VALC 27 26.987 68.621 18.4501.00 57.02 ATOM :3509N ALAC 28 24.989 68.228 17.5061.00 56.11 ATOM 3510 CA ALAC 28 24.302 68.262 18.7831.00 54.82 45 ATOM 3511 CB ALAC 28 22.896 68.775 18.6001.00 55.72 ATOM 3512 C ALAC 28 24.282 66.879 19.4241.00 54.45 ATOM 3513 0 ALAC 28 23.579 65.972 18.9641.00 54.53 ATOM 3514 N VALC 29 25.067 66.742 20.4881.00 53.25 ATOM 3515 CA VALC 29 25.191 65.503 21.2351.00 51.65 5flATOM 3516 CB VALC 29 26.676 65.113 21.4501.00 50.25 ATOM 3517 CG1 VALC 29 26.770 63.846 22.2971.00 47.03 ATOM 3518 CG2 VALC 29 27.358 64.921 20.1081.00 50.21 ATOM 3519 C VALC 29 24.549 65.670 22.5951.00 52.02 ATOM 3520 0 VALC 29 24.833 66.615 23.3201.00 51.40 55 ATOM 3521 N SERC 30 23.669 64.745 22.9321.00 53.81 ATOM 3522 CA SERC 30 23.012 64.785 24.2141.00 55.39 ATOM 3523 CB SERC 30 21.495 64.666 24.0341.00 54.53 ATOM 3524 OG SERC 30 21.159 63.462 23.3731.00 56.88 ATOM 3525 C SERC 30 23.566 63.614 25.0131.00 55.69 ATOM 3526 0 SERC 30 23.688 62.504 24.5031.00 56.19 ATOM 3527 N VALC 31 23.916 63.888 26.2611.00 56.76 ATOM 3528 CA VAL C 31 24.466 62.893 27.1741.00 57.06 ATOM 3529 CB VAL C 31 25.871 63.301 27.6401.00 57.34 ATOM 3530 CG1VAL C 31 26.543 62.141 28.3541.00 57.65 ATOM 3531 CG2VAL C 31 26.674 63.784 26.4671.00 58.89 ATOM 3532 C VAL C 31 23.585 62.791 28.4151.00 57.25 ATOM 3533 0 VAL C 31 23.152 63.806 28.9791.00 57.25 ATOM 3534 N SER C 32 23.339 61.569 28.8551.00 56.49 ATOM 3535 CA SER C 32 22.505 61.356 30.0241.00 57.63 ATOM 3536 CB SER C 32 21.045 61.182 29.5891.00 59.80 1~ ATOM 3537 OG SER C 32 20.220 60.763 30.6671.00 63.17 ATOM 3538 C SER C 32 22.958 60.123 30.7811.00 57.81 ATOM 3539 0 SER C 32 22.860 58.998 30.2711.00 60.21 ATOM 3540 N LEU C 33 23.448 60.317 31.9971.00 56.08 ATOM 3541 CA LEU C 33 23.895 59.182 32.8011.00 55.73 15 ATOM 3542 CB LEU C 33 25.021 59.581 33.7521.00 53.14 ATOM 3543 CG LEU C 33 26.240 60.219 33.1051.00 52.98 ATOM 3544 CD1LEU C 33 27.353 60.346 34.1271.00 51.17 ATOM 3545 CD2LEU C 33 26.680 59.374 31.9331.00 53.34 ATOM 3546 C LEU C 33 22.752 58.629 33.6241.00 56.29 ATOM 3547 0 LEU C 33 21.976 59.392 34.1931.00 57.63 ATOM 3548 N LYS C 34 22.642 57.303 33.6641.00 54.96 ATOM 3549 CA LYS C 34 21.616 56.643 34.4471.00 55.26 ATOM 3550 CB LYS C 34 20.710 55.790 33.5631.00 58.99 ATOM 3551 CG LYS C 34 20.053 56.544 32.4141.00 63.56 25 ATOM 3552 CD LYS C 34 19.098 57.649 32.8971.00 68.99 ATOM 3553 CE LYS C 34 18.499 58.434 31.7051.00 71.13 ATOM 3554 NZ LYS C 34 17.528 59.497 32.1201.00 71.58 ATOM 3555 C LYS C 34 22.410 55.756 35.3691.00 53.96 ATOM 3556 0 LYS C 34 23.034 54.806 34.9221.00 54.63 ATOM 3557 N PHE C 35 22.410 56.064 36.6571.00 53.24 ATOM 3558 CA PHE C 35 23.190 55.260 37.5791.00 51.26 ATOM 3559 CB PHE C 35 23.427 56.032 38.8641.00 49.55 ATOM 3560 CG PHE C 35 24.291 57.226 38.6621.00 48.89 ATOM 3561 CD1PHE C 35 23.745 58.428 38.2391.00 48.34 35 ATOM 3562 CD2PHE C 35 25.669 57.133 38.8141.00 50.53 ATOM 3563 CE1PHE C 35 24.553 59.526 37.9671.00 47.39 ATOM 3564 CE2PHE C 35 26.488 58.228 38.5421.00 50.75 ATOM 3565 CZ PHE C 35 25.925 59.424 38.1181.00 49.19 ATOM 3566 C PHE C 35 22.608 53.899 37.8491.00 50.23 ATOM 3567 O PHE C 35 21.418 53.754 38.0781.00 50.29 ATOM 3568 N ILE C 36 23.478 52.901 37.7951.00 49.55 ATOM 3569 CA ILE C 36 23.095 51.519 37.9971.00 47.28 ATOM 3570 CB ILE C 36 23.658 50.632 36.8831.00 46.86 ATOM :3571 CG2ILE C 36 23.173 49.223 37.0551.00 44.45 45 ATOM :3572 CG1ILE C 36 23.252 51.192 35.5211.00 46.79 ATOM :3573 CD1ILE C 36 21.754 51.310 35.3281.00 48.67 ATOM 3574 C ILE C 36 23.619 50.999 39.3081.00 46.88 ATOM 3575 0 ILE C 36 23.052 50.074 39.8661.00 48.98 ATOM 3576 N ASN C 37 24.711 51.578 39.7991.00 45.50 50 ATOM 3577 CA ASN C 37 25.271 51.124 41.0611.00 44.80 ATOM 3578 CB ASN C 37 25.738 49.678 40.9191.00 44.35 ATOM 3579 CG ASN C 37 25.685 48.919 42.2261.00 47.95 ATOM 3580 OD1ASN C 37 26.077 49.424 43.2851.00 47.36 ATOM 3581 ND2ASN C 37 25.209 47.688 42.1571.00 50.05 ATOM 3582 C ASN C 37 26.430 51.985 41.5731.00 44.84 ATOM 3583 0 ASN C 37 27.089 52.678 40.8101.00 42.36 ATOM 3584 N ILE C 38 26.654 51.939 42.8821.00 45.30 AfiOM 3585 CA ILE C 38 27.735 52.671 43.5181.00 46.27 ATOM 3586 CB ILE C 38 27.186 53.759 44.4341.00 44.46 ATOM 3587 CG2ILE C 38 28.319 54.433 45.1781.00 42.73 ATOM 3588 CG1ILE C 38 26.418 54.770 43.5841.00 42.70 ATOM 3589 CD1 ILEC 38 25.630 55.75844.343 1.0040.81 6 ATOM 3590 C ILEC 38 28.432 51.58544.306 1.0049.67 6 ATOM 3591 0 ILEC 38 27.890 51.08345.281 1.0053.17 8 ATOM 3592 N LEUC 39 29.636 51.22843.872 1.0051.33 7 rJ ATOM 3593 CA LEUC 39 30.378 50.12544.468 1.0053.07 6 ATOM 3594 CB LEUC 39 31.113 49.38443.353 1.0053.88 6 ATOM 3595 CG LEUC 39 30.167 49.00042.215 1.0055.35 6 ATOM :3596CD1 LEUC 39 30.932 48.30841.115 1.0054.78 6 ATOM :3597CD2 LEUC 39 29.053 48.09742.760 1.0054.41 6 1~ ATOM :3598C LEUC 39 31.334 50.36745.619 1.0053.89 6 ATOM 3599 0 LEUC 39 31.386 49.56746.558 1.0053.73 8 ATOM 3600 N GLUC 40 32.124 51.42645.536 1.0054.34 7 ATOM 3601 CA GI~UC 40 33.058 51.71446.602 1.0056.97 6 ATOM :3602CB GI~UC 40 34.446 51.21146.271 1.0059.79 6 15 ATOM 3603 CG GLUC 40 34.555 49.71146.147 1.0067.48 6 ATOM 3604 CD GLUC 40 35.996 49.26645.979 1.0070.43 6 ATOM 3605 OE1 GLUC 40 36.647 49.71944.998 1.0071.96 8 ATOM 3606 OE2 GLUC 40 36.471 48.47646.832 1.0071.19 8 ATOM 3607 C GLUC 40 33.125 53.19246.823 1.0057.35 6 ATOM 3608 0 GLUC 40 33.163 53.97545.886 1.0058.85 8 ATOM 3609 N VALC 41 33.132 53.57248.084 1.0057.50 7 ATOM 3610 CA VALC 41 33.20?. 54.96448.440 1.0056.50 6 ATOM 3611 CB VALC 41 31.845 55.44749.000 1.0057.37 6 ATOM 3612 CG1 VALC 41 31.972 56.83249.567 1.0056.32 6 25 ATOM .9613CG2 VALC 41 30.797 55.43747.894 1.0057.94 6 ATOM 3614 C VALC 41 34.289 55.09849.486 1.0055.27 6 ATOM 3615 0 VALC 41 34.502 54.20050.300 1.0054.09 8 ATOM 3616 N ASNC 42 34.994 56.21649.433 1.0055.74 7 ATOM 3617 CA ASNC 42 36.053 56.50450.379 1.0056.05 6 ATOM 3618 CB ASNC 42 37.418 56.16949.787 1.0053.93 6 ATOM 3619 CG ASNC 42 38.509 56.15550.833 1.0053.86 6 ATOM 3620 OD1 ASNC 42 38.622 57.07551.634 1.0054.42 8 ATOM 3621 ND2 ASNC 42 39.325 55.11050.828 1.0054.04 7 ATOM 3622 C ASNC 42 35.947 57.99450.635 1.0058.42 6 35 ATOM 3623 0 ASNC 42 36.322 58.80649.786 1.0058.83 8 ATOM 3624 N GLUC 43 35.408 58.34851.801 1.0060.55 7 ATOM 3625 CA GLUC 43 35.242 59.74452.163 1.0061.17 6 ATOM 3626 CB GLUC 43 34.269 59.87453.327 1.0063.37 6 ATOM 3627 CG GLUC 43 33.932 61.31853.646 1.0067 6 ATOM 3628 CD GLUC 43 32.773 61.46354.616 1.00. 6 68.69 ATOM 3629 OE1 GLUC 43 32.494 62.6135.019 1.0069.27 8 ATOM 3630 OE2 GLUC 43 32.142 60.44454.964 1.0068.84 8 ATOM 3631 C GLUC 43 36.571 60.39152.524 1.0060.37 6 ATOM 3632 0 GLUC 43 36.706 61.61152.459 1.0059.71 8 45 ATOM 3633 N ILEC 44 37.544 59.56752.903 1.0059.67 7 ATOM 3634 CA ILEC 44 38.874 60.05153.254 1.0060.12 6 ATOM 3635 CB ILEC 44 39.727 58.94453.908 1.0060.72 6 ATOM 3636 CG2 ILEC 44 41.124 59.46954.194 1.0061.61 6 ATOM 3637 CG1 ILEC 44 39.081 58.47055.206 1.0062.18 6 ATOM 3638 CD1 ILEC 44 39.142 59.47956.325 1.0063.46 6 ATOM 3639 C ILEC 44 39.617 60.51451.998 1.0059.74 6 ATOM 3640 0 ILEC 44 40.255 61.56951.988 1.0060.88 8 ATOM 3641 N THRC 45 39.540 59.71050.944 1.0057.16 7 ATOM 3642 CA THRC 45 40.221 60.02249.698 1.0054 6 55 ATOM 3643 CB THRC 45 40.819 58.74349.056 1.00. 6 52.62 ATOM 3644 OG1 THRC 45 39.776 57.81048.773 1.0052.62 8 ATOM 3645 CG2 THRC 45 41.812 58.10649.985 1.0052.65 6 ATOM 3646 C THRC 45 39.325 60.70648.675 1.0051.85 6 ATOM 3647 O THRC 45 39.801 61.19647.664 1.0051 8 ATOM 3648 N ASNC 46 38.029 60.73648.933 1.00. 7 51.51 ATOM 3649 CA ASNC 46 37.106 61.36748.002 1.0052.39 6 ATOM 3650 CB ASNC 46 37.420 62.856 47.890 1.00 54.026 ATOM 3651 CG ASNC 46 36.525 63.703 48.766 1.00 56.296 ATOM 3652 OD1 ASNC 46 36.87'7 64.821 49.132 1.00 59.358 ATOM 3653 ND2 ASNC 46 35.357 63.182 49.093 1.00 53.307 ATOM 3654 C ASNC 46 37.143 60.711 46.618 1.00 52.566 ATOM 3655 0 ASNC 46 37.269 61.376 45.587 1.00 51.608 ATOM 3656 N GLUC 47 37.013 59.392 46.610 1.00 51.637 ATOM 3657 CA GLUC 47 37.023 58.633 45.376 1.00 50.566 ATOM 3658 CB GLUC 47 38.307 57.805 45.300 1.00 49.506 ATOM 3659 CG GLUC 47 39.566 58.650 45.210 1.00 49.796 ATOM 3660 CD GLUC 47 40.823 57.810 45.227 1.00 51.386 ATOM 3661 OE1 GLUC 47 40.742 56.621 44.860 1.00 52.938 ATOM 3662 OE2 GLUC 47 41.892 58.339 45.595 1.00 51.308 ATOM 3663 C GLUC 47 35.793 57.734 45.314 1.00 48.786 ATOM 3664 0 GL~UC 47 35.403 57.133 46.300 1.00 48.468 ATOM 3665 N VALC 48 35.178 57.654 44.147 1.00 47.957 ATOM 3666 CA VALC 48 33.998 56.834 43.993 1.00 49.716 ATOM 3667 CB VALC 48 32.768 57.701 43.736 1.00 50.436 ATOM 3668 CG1 VALC 48 31.549 56.834 43.578 1.00 53.946 ATOM 3669 CG2 VALC 48 32.567 58.645 44.869 1.00 52.356 ATOM 3670 C VALC 48 34.130 55.838 42.850 1.00 49.776 ATOM 3671 0 VALC 48 34.686 56.146 41.802 1.00 49.938 ATOM 3672 N ASPC 49 33.615 54.636 43.068 1.00 49.867 ATOM 3673 CA ASPC 49 33.646 53.595 42.061 1.00 49.596 ATOM 3674 CB ASPC 49 34.261 52.331 42.644 1.00 51.716 ATOM 3675 CG ASPC 49 34.714 51.366 41.580 1.00 51.646 ATOM 3676 OD1 ASPC 49 33.992 51.233 40.581 1.00 50.258 ATOM 3677 OD2 ASPC 49 35.777 50.736 41.748 1.00 51.898 ATOM 3678 C ASPC 49 32.181 53.382 41.728 1.00 49.006 ATOM 3679 0 ASPC 49 31.437 52.818 42.524 1.00 51.148 ATOM 3680 N VALC 50 31.770 53.840 40.551 1.00 48.307 ATOM 3681 CA VALC 50 30.374 53.757 40.147 1.00 48.896 ATOM 3682 CB VALC 50 29.755 55.185 40.167 1.00 51.496 ATOM 3683 CG1 VALC 50 30.212 55.964 38.944 1.00 50.496 ATOM 3684 CG2 VALC 50 28.248 55.120 40.223 1.00 53.326 ATOM 3685 C VALC 50 30.130 53.122 38.771 1.00 47.566 ATOM 3686 O VALC 50 31.012 53.080 37.928 1.00 49.118 ATOM 3687 N VALC 51 28.917 52.621 38.574 1.00 44.817 ATOM 3688 CA VALC 51 28.484 52.003 37.324 1.00 43.096 ATOM 3689 CB VALC 51 28.003 50.542 37.539 1.00 41.286 ATOM 3690 CG1 VALC 51 27.355 50.017 36.267 1.00 37.456 ATOM 3691 CG2 VALC 51 29.157 49.659 37.953 1.00 36.776 ATOM 3692 C VA:LC 51 27.300 52.817 36.781 1.00 44.986 ATOM 3693 0 VALC 51 26.385 53.163 37.522 1.00 46 8 ATOM 3694 N PHEC 52 27.299 53.113 35.490 1.00 . 7 44.48 ATOM 3695 CA PHEC 52 26.206 53.883 34.937 1.00 45.006 ATOM 3696 CB PHEC 52 26.469 55.352 35.210 1.00 44.946 ATOM 3697 CG PHEC 52 27.729 55.857 34.587 1.00 44.746 ATOM 3698 CD1 PHEC 52 27.735 56.327 33.278 1.00 44.146 ATOM 3699 CD2 PHEC 52 28.921 55.841 35.299 1.00 44.436 ATOM 3700 CE1 PHEC 52 28.908 56.771 32.690 1.00 45.236 ATOM 3701 CE2 PHEC 52 30.102 56.284 34.722 1.00 41.526 ATOM 3'702CZ PHEC 52 30.098 56.751 33.415 1.00 42.146 ATOM 3'703C PHEC 52 26.048 53.663 33.443 1.00 47.736 ATOM 3'704O PHEC 52 26.932 53.102 32.798 1.00 49.848 ATOM 3705 N TRPC 53 24.918 54.099 32.895 1.00 46.737 ATOM 3706 CA TRPC 53 24.684 53.985 31.471 1.00 47.026 ATOM 3'707CB TRPC 53 23.251 53.595 31.175 1.00 46.366 ATOM 3'708CG TRPC 53 22.915 52.221 31.552 1.00 48 6 ATOM 3'709CD2 TRPC 53 21.615 51.636 31.534 1.00 . 6 50.65 ATOM 3'710CE2 TRPC 53 21.748 50.311 32.002 1.00 49.666 ATOM 3711 CE3 TRP 53 20.342 52.10631.170 1.00 51.64 6 C

ATOM 3712 CD1 TRP 53 23.765 51.25932.008 1.00 48.94 6 C

ATOM 3713 NE1 TRP 53 23.073 50.10732.284 1.00 48.58 7 C

ATOM 3714 CZ2 TRP 53 20.659 49.44832.120 1.00 50 6 'rJATOM 3715 CZ3 TRP 53 19.258 51.25031.286 1.00 . 6 C 51.60 ATOM 3716 CH2 TRP 53 19.424 49.93531.759 1.00 52.14 6 C

ATOM 3717 C TRP 53 24.940 55.33930.862 1.00 48.39 6 C

ATOM 3718 0 TRP 53 24.234 56.29031.156 1.00 50.70 8 C

ATOM 3719 N GLN 54 25.946 55.42930.010 1.00 49 7 1~ ATOM 3720 CA GLN 54 26.265 56.69129.378 1.00 . 6 C 50.29 ATOM 3721 CB GLN 54 27.759 56.74929.053 1.00 50.27 6 C

ATOM 3722 CG GLN 54 28.231 58.11128.587 1.00 54.00 6 C

ATOM 3723 CD GLN 54 29.710 58.34428.853 1.00 55.07 6 C

ATOM 3724 OE1 GLN 54 30.172 58.24129.988 1.00 53 8 15 ATOM 3725 NE2 GLN 54 30.458 58.66727.805 1.00 . 7 C 57.05 ATOM 3726 C GLN 54 25.415 56.79728.125 1.00 50.70 6 C

ATOM 3727 0 GLN 54 25.886 56.61727.004 1.00 52.15 8 C

ATOM 3728 N GLN 55 24.138 57.06928.345 1.00 51.37 7 C

ATOM 3729 CA GLN 55 23.169 57.20527.272 1.00 54 6 ATOM 3730 CB GLN 55 21.786 57.32627.897 1.00 . 6 C 57.18 ATOM 3731 CG GLN 55 20.667 57.64826.948 1.00 64.94 6 C

ATOM 3732 CD GLN 55 19.3'3 57.47227.617 1.00 70.65 6 C

ATOM 3733 OE1 GLN 55 19.154 57.76028.817 1.00 73.87 8 C

ATOM 3734 NE2 GLN 55 18.32.5 56.99726.849 1.00 72 7 25 ATOM 3735 C GLN 55 23.509 58.41926.396 1.00 . 6 C 53.13 ATOM 3736 O GIN 55 23.296 59.56926.779 1.00 54.85 8 C

ATOM :3737N THR 56 24.044 58.14825.211 1.00 50.27 7 C

ATOM 3738 CA THR 56 24.455 59.19324.290 1.00 48.20 6 C

ATOM :3739CB THR 56 25.916 59.01923.905 1.00 47 6 30 ATOM 3740 OG1 THR 56 26.69:3 58.79525.085 1.00 . 8 C 51.04 ATOM 3741 CG2 THR 56 26.431 60.24323.219 1.00 46.01 6 C

ATOM 3742 C THR 56 23.633 59.16223.023 1.00 49.71 6 C

ATOM 3743 0 THR 56 23.216 58.09522.568 1.00 49.78 8 C

ATOM 3744 N TfIR 57 23.393 60.34022.454 1.00 49 7 35 ATOM 3745 CA TfIR 57 22.619 60.43621.221 1.00 . 6 C 49.62 ATOM 3746 CB THR 57 21.122 60.59221.501 1.00 49.45 6 C

ATOM 3747 OG1 THR 57 20.640 59.44022.206 1.00 49.55 8 C

ATOM 3748 CG2 THR 57 20.368 60.72220.191 1.00 51.01 6 C

ATOM 3749 C THR 57 23.057 61.60820.368 1.00 48 6 ATOM 3750 0 THR 57 23.423 62.64920.888 1.00 . 8 C 51.05 ATOM '.751N TRP 58 23.033 61.42819.056 1.00 45.80 7 C

ATOM 3752 CA TRP 58 23.415 62.48718.145 1.00 45.33 6 C

ATOM 3753 CB TRP 58 24.934 62.70218.146 1.00 44.23 6 C

ATOM 3754 CG TRP 58 25.733 61.58417.556 1.00 45 6 45 ATOM 3755 CD2 TRP 58 26.221 60.42818.241 1.00 . 6 C 43.51 ATOM 3756 CE2 TR.P 58 26.896 59.64217.296 1.00 41.95 6 C

ATOM 3757 CE3 TRP 58 26.150 59.98319.566 1.00 44.75 6 C

ATOM 3758 CD1 TRP 58 26.120 61.45316.264 1.00 41.99 6 C

ATOM 3759 NE1 TRP 58 26.818 60.29216.097 1 43 7 ATOM 3760 CZ2 TRP 58 27.498 58.43617.625 . . 6 C 1.00 42.44 ATOM 3761 CZ3 TRP 58 26.748 58.77819.894 1.00 45.66 6 C

ATOM 3762 CH2 TRP 58 27.414 58.02018.926 1.00 44.08 6 C

ATOM 3763 C TRP 58 22.915 62.10716.772 1.00 46.80 6 C

ATOM 3764 0 TRP 58 22.315 61.05416.603 1.00 45 8 55 ATOM 3765 N SER 59 23.157 62.95915.788 1.00 . 7 C 50.21 ATOM 3766 CA SER 59 22.663 62.68414.452 1.00 53.47 6 C

ATOM 3767 CB SER 59 21.536 63.65714.128 1.00 54.42 6 C

ATOM 3768 OG SER 59 20.707 63.14613.104 1.00 59.88 8 C

ATOM 3769 C SER 59 23.733 62.75213.376 1.00 54 6 ATOM 3770 O SER 59 24.541 63.68213.343 1.00 . 8 C 54.12 ATOM 3771 N 60 23.727 61.74512.503 1.00 57.21 7 ASP
C

ATOM 3772 CA ASP C 60 24.677 61.646 11.3961.00 59.27 6 ATOM 3773 CB ASP C 60 25.680 60.517 11.6501.00 59.62 6 ATOM 3774 CG ASP C 60 26.786 60.472 10.6151.00 61.35 6 ATOM 3775 OD1 ASP C 60 26.553 60.894 9.462 1.00 60.03 8 ATOM 3776 OD2 ASP C 60 27.890 59.996 10.9571.00 62.69 8 ATOM 3777 C ASP C 60 23.842 61.317 10.1721.00 61.10 6 ATOM 3778 0 ASP C 60 23.493 60.163 9.940 1.00 61.72 8 ATOM 3779 N ARG C 61 23.509 62.338 9.396 1.00 63.66 7 ATOM 3780 CA ARG C 61 22.689 62.153 8.201 1.00 65.73 6 1~ ATOM 3781 CB ARG C 61 22.276 63.516 7.628 1.00 68.89 6 ATOM 3782 CG ARG C 61 21.106 64.221 8.348 1.00 74.08 6 ATOM 3783 CD ARG C 61 20.624 65.417 7.517 1.00 79.55 6 ATOM 3784 NE ARG C 61 19.438 66.085 8.059 1.00 84.63 7 ATOM 3785 CZ ARG C 61 18.810 67.101 7.457 1.00 87.07 6 15 ATOM 3786 NH1 ARG C 61 19.257 67.572 6.291 1.00 88.09 7 ATOM 3787 NH2 ARG C 61 17.721 67.636 8.005 1.00 87.40 7 ATOM 3788 C ARG C 61 23.322 61.310 7.083 1.00 64.92 6 ATOM 3789 0 ARG C 61 22.604 60.783 6.225 1.00 65.71 8 ATOM 3790 N THR C 62 24.648 61.176 7.078 1.00 62.18 7 ATOM 3791 CA THR C 62 25.301 60.393 6.038 1.00 60.64 6 ATOM 3792 CB THR C 62 26.840 60.568 6.056 1.00 61.65 6 ATOM 3793 OG1 THR C 62 27.389 59.999 7.256 1.00 63.35 8 ATOM 3794 CG2 THR C 62 27.207 62.045 5.983 1.00 61.52 6 ATOM 3795 C THR C 62 24.970 58.917 6.211 1.00 60.11 6 25 ATOM :37960 THR C 62 25.303 58.095 5.354 1.00 61.77 8 ATOM 3797 N LEU C 63 24.313 58.592 7.321 1.00 58.17 7 ATOM 3798 CA LEU C 63 23.919 57.219 7.621 1.00 57.53 6 ATOM 3799 CB LEU C 63 24.079 56.929 9.111 1.00 54.69 6 ATOM :3800CG LEU C 63 25.442 57.142 9.750 1.00 55.50 6 ATOM 3801 CDl LEU C 63 25.32'7 56.938 11.2631.00 54.27 6 ATOM 3802 CD2 LEU C 63 26.449 56.178 9.139 1.00 55.93 6 ATOM 3803 C LEU C 63 22.455 56.977 7.242 1.00 58.42 6 ATOM 3804 0 LEU C 63 22.010 55.830 7.147 1.00 58.94 8 ATOM 3805 N ALA C 64 21.707 58.055 7.037 1.00 58.80 7 35 ATOM 3806 CA ALA C 64 20.291 57.928 6.703 1.00 61.86 6 ATOM 3807 CB ALA C 64 19.666 59.310 6.522 1.00 61.89 6 ATOM 3808 C ALA C 64 20.081 57.087 5.450 1.00 63.09 6 ATOM 3809 0 ALA C 64 20.840 57.179 4.481 1.00 63.27 8 ATOM 3810 N TRP C 65 19.055 56.249 5.485 1.00 65.02 7 40 ATOM 3811 CA TRP C 65 18.749 55.381 4.355 1.00 66.31 6 ATOM 3812 CB TRP C 65 19.329 53.989 4.600 1.00 64.14 6 ATOM 3813 CG TRP C 65 18.597 53.208 5.687 1.00 62.22 6 ATOM 3814 CD2 TRP C 65 18.962 53.110 7.074 1.00 57.97 6 ATOM 3815 CE2 TRP C 65 18.025 52.247 7.694 1.00 56.42 6 45 ATOM 3816 CE3 TRP C 65 19.985 53.666 7.848 1.00 55.52 6 ATOM 3817 CDl TRP C 65 17.475 52.430 5.533 1.00 60.23 6 ATOM 3818 NE1 TRP C 65 17.131 51.849 6.734 1.00 57.79 7 ATOM 3819 C22 TRP C 65 18.088 51.926 9.049 1.00 55.30 6 ATOM 3820 CZ3 TRP C 65 20.047 53.350 9.195 1.00 56.61 6 ATOM 3821 CH2 TRP C 65 19.102 52.484 9.784 1.00 56.47 6 ATOM 3822 C TRP C 65 17.238 55.287 4.252 1.00 68.58 6 ATOM 3823 0 TRP C 65 16.540 55.365 5.268 1.00 67.72 8 ATOM 3824 N ASN C 66 16.728 55.113 3.037 1.00 72.17 7 ATOM 3825 CA ASN C 66 15.283 55.011 2.882 1.00 75.21 6 55 ATOM 3826 CB ASN C 66 14.863 55.013 1.408 1.00 77.34 6 ATOM 3827 CG ASN C 66 13.355 55.190 1.244 1.00 79.16 6 ATOM 3828 OD1 ASN C 66 12.845 55.261 0.119 1.00 80.81 8 ATOM 3829 ND2 ASN C 66 12.633 55.267 2.374 1.00 77.07 7 ATOM 3830 C ASN C 66 14.802 53.730 3.532 1.00 74.77 6 ATOM 3831 0 ASN C 66 15.431 52.675 3.383 1.00 75.31 8 ATOM 3832 N SER C 67 13.685 53.816 4.244 1.00 73.52 7 ATOM 3833 CA SERC 67 13.166 52.647 4.920 1.0073.52 6 ATOM 3834 CB SERC 67 13.451 52.759 6.411 1.0072.63 6 ATOM 3835 OG SERC 67 12.985 53.994 6.914 1.0070.04 8 ATOM 3836 C SERC 67 11.684 52.469 4.702 1.0075.29 6 ATOM ;18370 SERC 67 11.010 51.788 5.493 1.0075.31 8 ATOM 3838 N SERC 68 11.165 53.077 3.639 1.0077.57 7 ATOM 3839 CA SERC 68 9.739 52.957 3.356 1.0078.39 6 ATOM 3840 CB SERC 68 9.327 53.874 2.187 1.0077.79 6 ATOM 3841 OG SE:RC 68 10.010 53.570 0.983 1.0077.16 8 1~ ATOM 3842 C SERC 68 9.398 51.498 3.051 1.0078.91 6 ATOM 3843 0 SERC 68 8.242 51.165 2.802 1.0078.88 8 ATOM 3844 N HISC 69 10.415 50.634 3.090 1.0080.17 7 ATOM 3845 CA HISC 69 10.252. 49.197 2.824 1.0081.55 6 ATOM 3846 CB HISC 69 10.307 48.935 1.319 1.0084.67 6 15 ATOM 3847 CG HISC 69 9.327 49.755 0.542 1.0088.75 6 ATOM 3848 CD2 HISC 69 8.119 49.436 0.014 1.0089.38 6 ATOM 3849 ND1 HISC 69 9.479 51.115 0.359 1.0089.98 7 ATOM 3850 CEl HISC 69 8.405 51.600 -0.239 1.0091.29 6 ATOM 3851 NE2 HISC 69 7.564 50.602 -0.458 1.0091.72 7 ATOM 3852 C HISC 69 11.363 48.406 3.514 1.0080.62 6 ATOM 3853 0 HISC 69 11.740 47.318 3.072 1.0079.15 8 ATOM 3854 N SERC 70 11.867 48.961 4.614 1.0079.62 7 ATOM 3855 CA SERC 70 12.950 48.341 5.355 1.0077.30 6 ATOM 3856 CB SERC 70 14.262 48.818 4.739 1.0077.47 6 25 ATOM 3857 OG SERC 70 14.107 48.991 3.336 1.0074.00 8 ATOM 3858 C SERC 70 12.880 48.746 6.836 1.0076.56 6 ATOM 3859 0 SERC 70 12.168 49.686 7.193 1.0077.11 8 ATOM 3860 N PROC 71 13.587 48.014 7.726 1.0076.29 7 ATOM 3861 CD PROC 71 14.305 46.733 7.544 1.0075.52 6 ATOM 3862 CA PROC 71 13.538 48.401 9.143 1.0074.74 6 ATOM 3863 CB PROC 71 14.366 47.322 9.843 1.0075.26 6 ATOM 3864 CG PROC 71 14.241 46.124 8.936 1.0075.64 6 ATOM 3865 C PROC 71 14.202 49.771 9.235 1.0073.61 6 ATOM 3866 0 PROC 71 15.042 50.125 8.401 1.0072.22 8 35 ATOM 3867 N ASPC 72 13.828 50.537 10.247 1.0072.60 7 ATOM 3868 CA ASPC 72 14.377 51.869 10.414 1.0070.96 6 ATOM 3869 CB ASPC 72 13.277 52.795 10.899 1.0075.25 6 ATOM 3870 CG ASPC 72 11.919 52.353 10.415 1.0078.33 6 ATOM 3871 OD1 ASPC 72 11.633 52.512 9.199 1.0079.88 8 ATOM 3872 OD2 ASPC 72 11.150 51.821 11.256 1.0079.56 8 ATOM 3873 C ASPC 72 15.519 51.835 11.411 1.0068.36 6 ATOM 3874 0 ASPC 72 16.046 52.887 11.799 1.0066.88 8 ATOM 3875 N GLNC 73 15.883 50.625 11.838 1.0063.81 7 ATOM 3876 CA GLNC 73 17.001 50.485 12.756 1.0061.20 6 45 ATOM 3877 CB GLNC 73 16.537 50.494 14.191 1.0061.12 6 ATOM 3878 CG GLNC 73 16.121 51.802 14.749 1.0062.71 6 ATOM 3879 CD GLNC 73 15.665 51.603 16.163 1.0064.60 6 ATOM 3880 OE1 GLNC 73 14.784 50.779 16.421 1.0067.49 8 ATOM 3881 NE2 GLNC 73 16.267 52.329 17.099 1.0066.00 7 ATOM 3882 C GLNC 73 17.842 49.232 12.583 1.0059.70 6 ATOM 3883 0 GLNC 73 17.350 48.167 12.213 1.0061.26 8 ATOM 3884 N VALC 74 19.122 49.369 12.893 1.0056.05 7 ATOM 3885 CA VALC 74 20.050 48.260 12.825 1.0052.11 6 ATOM 3886 CB VALC 74 20.736 48.177 11.454 1.0052.42 6 55 ATOM 3887 CG1 VALC 74 19.732 47.788 10.397 1.0051.61 6 ATOM 3888 CG2 VALC 74 21.376 49.507 11.112 1.0052.96 6 ATOM 3889 C VALC 74 21.095 48.498 13.891 1.0050.29 6 ATOM 3890 0 VALC 74 21.277 49.626 14.332 1.0049.79 8 ATOM 3891 N SERC 75 ?.1.754 47.431 14.323 1.0048.56 7 ATOM 3892 CA SERC 75 22.809 47.533 15.318 1.0045.56 6 ATOM 3893 CB SERC 75 22.784 46.337 16.257 1.0043.40 6 ATOM 3894 OG SERC 75 21.818 46.52117.269 1.0043.99 8 ATOM 3895 C SERC 75 24.146 47.61114.595 1.0044.84 6 ATOM 3896 0 SERC 75 24.519 46.70313.858 1.0047.60 8 ATOM 3897 N VALC 76 24.858 48.71214.811 1.0043.51 7 ATOM 3898 CA VALC 76 26.140 48.94114.165 1.0042.84 6 ATOM 3899 CB VALC 76 26.122 50.27313.412 1.0041.76 6 ATOM 3900 CG1 VALC 76 27.441 50.50412.741 1.0042.71 6 ATOM 3901 CG2 VALC 76 25.003 50.27912.403 1.0040.70 6 ATOM 3902 C VALC 76 27.294 48.96115.153 1.0042.64 6 1~ ATOM 3903 0 VALC 76 27.194 49.54216.227 1.0045.77 8 ATOM 3904 N PROC 77 28.409 48.31314.812 1.0041.78 7 ATOM 3905 CD PROC 77 28.644 47.34513.737 1.0041.15 6 ATOM 3906 CA PROC 77 29.532 48.32615.748 1.0041.64 6 ATOM 3907 CB PROC 77 30.527 47.37015.108 1.0040.47 6 ATOM 3908 CG PROC 77 29.654 46.43214.379 1.0042.43 6 ATOM 3909 C PROC 77 30.074 49.74615.860 1.0041.29 6 ATOM 3910 0 PROC 77 30.123 50.48914.881 1.0038.61 8 ATOM 3911 N ILEC 78 30.469 50.11117.070 1.0041.82 7 ATOM 3912 CA ILEC 78 31.000 51.43317.359 1.0041.93 6 ATOM 3913 CB ILEC 78 31.439 51.48918.837 1.0042.16 6 ATOM 3914 CG2 ILEC 78 32.37() 52.63419.107 1.0042.14 6 ATOM 3915 CG1 ILEC 78 30.193 51.60119.696 1.0044.77 6 ATOM 3916 CD1 ILEC 78 29.251 52.67619.216 1.0044.16 6 ATOM 3917 C IL~EC 78 32.149 51.81316.450 1.0042.57 6 25 ATOM 3918 0 ILEC 78 32.287 52.96316.063 1.0045.18 8 ATOM 3919 N SERC 79 32.963 50.82916.100 1.0043.18 7 ATOM 3920 CA SERC 79 34.120 51.03015.241 1.0043.52 6 ATOM 3921 CB SERC 79 34.969 49.76815.242 1.0043.74 6 ATOM 3922 OG SERC 79 34.189 48.63714.910 1.0043.50 8 ATOM 3923 C SERC 79 33.810 51.41513.804 1.0043.41 6 ATOM 3924 0 SERC 79 34.698 51.83813.082 1.0044.10 8 ATOM 3925 N SERC 80 32.562 51.26413.380 1.0043.62 7 ATOM 3926 CA SERC 80 32.180 51.60412.012 1.0044.83 6 ATOM 3927 CB SERC 80 31.260 50.53411.441 1.0044.21 6 35 ATOM 3928 OG SERC 80 31.915 49.28411.380 1.0052.55 8 ATOM 3929 C SERC 80 31.482 52.95611.908 1.0046.57 6 ATOM 3930 0 SERC 80 31.050 53.35510.829 1.0046.16 8 ATOM 3931 N LEUC 81 31.366 53.64913.035 1.0046.49 7 ATOM 3932 CA LEUC 81 30.720 54.95213.080 1.0045.86 6 ATOM 3933 CB LEUC 81 29.467 54.89113.935 1.0045.00 6 ATOM 3934 CG LEUC 81 28.421 53.82713.653 1.0046.58 6 ATOM 3935 CD1 LEUC 81 27.488 53.70114.839 1.0045.04 6 ATOM 3936 CD2 LEUC 81 27.667 54.19812.405 1.0047.69 6 ATOM 3937 C LEUC 81 31.645 55.97313.718 1.0046.18 6 45 ATOM 3938 0 LEUC 81 32.636 55.61314.355 1.0050.36 8 ATOM 3939 N TRPC 82 31.323 57.24913.536 1.0043.58 7 ATOM 3940 CA TRPC 82 32.086 58.30314.161 1.0039.79 6 ATOM 3941 CB TRPC 82 31.860 59.63913.463 1.0041.96 6 ATOM 3942 CG TRPC 82 32.342 60.81714.278 1.0044.12 6 ATOM 3943 CD2 TRPC 82 31.577 61.56915.230 1.0044.19 6 ATOM 3944 CE2 TRPC 82 32.453 62.50415.823 1.0043.39 6 ATOM 3945 CE3 TRPC 82 30.234 61.54015.645 1.0044.58 6 ATOM 3946 CD1 TRPC 82 33.611 61.31814.327 1.0043.74 6 ATOM 3947 NE1 TRPC 82 33.686 62.32715.252 1.0044.54 7 ATOM 3948 CZ2 TRPC 82 32.033 63.40516.809 1.0042.68 6 ATOM 3949 Cz3 TRPC 82 29.818 62.43016.623 1.0043.22 6 ATOM 3950 CH2 TRPC 82 30.717 63.35217.195 1.0043.77 6 ATOM 3951 C TRPC 82 31.426 58.34815.514 1.0040.00 6 ATOM 3952 0 TRPC 82 30.219 58.17415.619 1.0039.36 8 ATOM 3953 N VALC 83 32.201 58.57416.557 1.0040.23 7 ATOM 3954 CA VALC 83 31.626 58.64917.887 1.0039.34 6 ATOM 3955 CB VAL C 83 31.891 57.325 18.6571.00 6 38.82 ATOM 3956 CG1 C 83 31.587 57.479 20.1091.00 6 VAL 39.50 ATOM 3957 CG2 C 83 31.021 56.219 18.0871.00 38.81 6 VAL

ATOM 3958 C VAL C 83 32.205 59.860 18.6241.00 40 6 ATOM 3959 0 VAL C 83 33.365 60.222 18.4281.00 . 8 41.45 ATOM 3960 N PRO C 84 31.386 60.528 19.4511.00 38.82 7 ATOM 3961 CD PRO C 84 29.948 60.288 19.6441.00 40.83 6 ATOM 3962 CA PRO C 84 31.812 61.698 20.2201.00 36.19 6 ATOM 3963 CB PRO C 84 30.580 62.022 21.0581.00 37 6 1~ ATOM 3964 CG PRO C 84 29.479 61.609 20.2011.00 . 6 39.39 ATOM 3965 C PRO C 84 32.999 61.358 21.0981.00 34.25 6 ATOM 3966 0 PRO C 84 32.987 60.351 21.7881.00 35.16 8 ATOM 3967 N ASP C 85 34.016 62.206 21.0931.00 33.39 7 ATOM 3968 CA ASP C 85 35.192 61.949 21.9091.00 34 6 15 ATOM 3969 CB ASP C 85 36.423 62.588 21.2701.00 . 6 35.95 ATOM 3970 CG ASP C 85 36.260 64.056 21.0461.00 35.70 6 ATOM 3971 OD1ASP C 85 35.159 64.468 20.6621.00 34.85 8 ATOM 3972 OD2ASP C 85 37.234 64.798 21.2381.00 38.52 8 ATOM 3973 C ASP C 85 35.005 62.452 23.3261.00 36 6 ATOM 3974 0 ASP C 85 35.806 63.229 23.8411.00 . 8 39.41 ATOM 3975 N LEU C 86 33.941 61.978 23.9621.00 36.11 7 ATOM 3976 CA LEU C 86 33.609 62.385 25.3151.00 36.00 6 ATOM 3977 CB LEU C 86 32.208 61.904 25.6781.00 35.07 6 ATOM 3978 CG LEU C 86 31.089 62.464 24.8061.00 36 6 25 ATOM 3979 CD1LEU C 86 29.752 61.912 25.2401.00 . 6 31.87 ATOM 3980 CD2LEU C 86 31.112 63.974 24.9101.00 35.41 6 ATOM 3981 C LEU C 86 34.585 61.870 26.3371.00 36.89 6 ATOM 3982 0 LEU C 86 35.147 60.795 26.1891.00 38.19 8 ATOM 3983 N ALA C 87 34.773 62.648 27.3911.00 38 7 ATOM 3984 CA ALA C 87 35.672 62.268 28.4611.00 . 6 38.06 ATOM 3985 CB ALA C 87 37.045 62.838 28.2001.00 35.59 6 ATOM 3986 C ALA C 87 35.119 62.799 29.7721.00 38.10 6 ATOM 3987 0 ALA C 87 34.586 63.891 29.8151.00 37.91 8 ATOM 3988 N ALA C 88 35.217 62.013 30.8331.00 39 7 35 ATOM 3989 CA ALA C 88 34.756 62.448 32.1471.00 . 6 40.05 ATOM 3990 CB ALA C 88 34.356 61.250 33.0051.00 40.30 6 ATOM 3991 C ALA C 88 35.939 63.169 32.7711.00 41.63 6 ATOM 3992 0 ALA C 88 36.912 62.545 33.1951.00 41.71 8 ATOM 3993 N TYR C 89 35.852 64.492 32.7991.00 42 7 ATOM 3994 CA T'TRC 89 36.904 65.350 33.3301.00 . 6 41.60 ATOM 3995 CB TYR C 89 36.368 66.775 33.4591.00 43.41 6 ATOM 3996 CG T'~RC 89 35.976 67.422 32.1491.00 48.68 6 ATOM 3997 CD1TYR C 89 35.321 68.653 32.1291.00 51.90 6 ATOM 3998 CE1T'~RC 89 34.99:1 69.284 30.9201.00 53 6 45 ATOM :3999 CD2TYR C 89 36.290 66.830 30.9291.00 . 6 48.32 ATOM 4000 CE2TYR C 89 35.966 67.449 29.7261.00 52.45 6 ATOM 4001 CZ TYR C 89 35.318 68.678 29.7301.00 53.45 6 ATOM 4002 OH TYR C 89 35.017 69.305 28.5451.00 56.75 8 ATOM 4003 C TYR C 89 37.527 64.914 34.6571.00 40 6 ATOM 4004 0 TS'RC 89 38.727 65.075 34.8631.00 . 8 39.21 ATOM 4005 N ASN C 90 36.725 64.364 35.5621.00 39.53 7 ATOM 4006 CA ASN C 90 37.265 63.952 36.8481.00 39.15 6 ATOM 4007 CB ASN C 90 36.476 64.603 37.9891.00 38.99 6 ATOM 4008 CG ASN C 90 34.995 64.290 37.9441.00 38 6 ATOM 4009 OD1ASN C 90 34.355 64.378 36.9021.00 . 8 37.33 ATOM 4010 ND2ASN C 90 34.443 63.939 39.0901.00 39.59 7 ATOM 4011 C ASN C 90 37.343 62.448 37.0331.00 41.22 6 ATOM 4.012 0 ASN 90 37.354 61.946 38.1531.00 42.78 8 C

ATOM 4013 N ALA 91 37.400 61.733 35.9151.00 42 7 ATOM 4014 CA ALA 91 37.528 60.292 35.9281.00 . 6 C 40.71 ATOM 9015 CB ALA 91 37.346 59.733 34.5211.00 41.88 6 C

ATOM 4016 C ALA 91 38.939 60.03336.435 1.00 39.966 C

ATOM 4017 0 ALA 91 39.898 60.66436.007 1.00 35.608 C

ATOM 4018 N ILEC 92 39.040 59.09337.356 1.00 41.497 ATOM 4019 CA ILEC 92 40.292 58.73137.993 1.00 43.206 rJ ATOM 4020 CB ILEC 92 40.020 58.59439.511 1.00 47.776 ATOM 4021 CG2 ILEC 92 39.923 57.13039.921 1.00 48.366 ATOM 4022 CG1 ILEC 92 41.093 59.29340.316 1.00 50.986 ATOM 4023 CD1 II~EC 92 40.903 59.03641.812 1.00 55.366 ATOM 4024 C ILEC 92 40.861 57.41637.403 1.00 41.816 1~ ATOM 4025 0 ILEC 92 41.973 56.99237.720 1.00 40.198 ATOM 4026 N SERC 93 40.080 56.78136.541 1.00 39.247 ATOM 4027 CA SERC 93 40.470 55.53435.913 1.00 39.096 ATOM 4028 CB SERC 93 39.892 54.35636.685 1.00 39.196 ATOM 4029 OG SERC 93 38.479 54.31036.541 1.00 39.348 1'rJATOM 4030 C SERC 93 39.839 55.57934.546 1.00 37.696 ATOM 4031 0 SERC 93 38.987 56.40434.311 1.00 39.278 ATOM 4032 N LYSC 94 40.251 54.71733.632 1.00 37.587 ATOM 4033 CA LYSC 94 39.612 54.73732.330 1.00 40.656 ATOM 4034 CB LS'SC 94 40.560 54.25631.228 1.00 41 6 ATOM 4035 CG LYSC 94 41.383 53.02431.520 1.00 . 6 46.32 ATOM 4036 CD LYSC 94 42.502 52.90230.485 1.00 48.626 ATOM 4037 CE LYSC 94 41.962 53.09129.069 1.00 47.906 ATOM 4E038NZ LA'SC 94 42.999 52.92928.024 1.00 48.057 ATOM 4039 C LYSC 94 38.321 53.92632.359 1.00 40 6 25 ATOM 4040 0 LYSC 94 38.102 53.09433.234 1.00 . 8 42.52 ATOM 4041 N PROC 95 37.434 54.17831.404 1.00 41.557 ATOM 4042 CD PROC 95 37.555 55.15030.312 1.00 42.126 ATOM 4043 CA PROC 95 36.153 53.47931.335 1.00 41.346 ATOM 4044 CB PROC 95 35.439 54.16630.177 1.00 41 6 30 ATOM 4045 CG PR.OC 95 36.125 55.47630.058 1.00 . 6 42.87 ATOM 9046 C PROC 95 36.256 52.00031.102 1.00 40.866 ATOM 4047 0 PR0C 95 36.941 51.56330.189 1.00 41.658 ATOM 4048 N GLUC 96 35.581 51.22831.940 1.00 40.557 ATOM 4049 CA GLUC 96 35.560 49.79131.766 1.00 41 6 35 ATOM 4050 CB GLUC 96 35.684 49.05033.104 1.00 . 6 43.71 ATOM 4051 CG GLUC 96 35.762 47.52132.954 1.00 49.856 ATOM 4052 CD GLUC 96 35.912 46.76834.286 1.00 54.356 ATOM 4053 OE1 GLUC 96 36.282 47.40435.302 1.00 58.628 ATOM 4054 OE2 GLUC 96 35.682 45.53434.316 1.00 52 8 ATOM 4055 C GLUC 96 34.190 49.55331.168 1.00 . 6 39.91 ATOM 4056 0 GLUC 96 33.200 49.47831.894 1.00 40.628 ATOM 4057 N VALC 97 34.133 49.48329.841 1.00 35.737 ATOM 4058 CA VALC 97 32.876 49.24929.153 1.00 34.276 ATOM 4059 CB VALC 97 33.006 49.54127.660 1.00 31 6 45 ATOM 4060 CG1 VALC 97 31.686 49.33326.968 1.00 . 6 34.09 ATOM 4061 CG2 VALC 97 33.437 50.96327.470 1.00 30.226 ATOM 4062 C VALC 97 32.481 47.80129.382 1.00 34.556 ATOM 4063 O VALC 97 33.167 46.89128.949 1.00 35.638 ATOM 4064 N LEUC 98 31.362 47.60730.072 1.00 35 7 ATOM 4065 CA LEUC 98 30.868 46.28630.433 1.00 . 6 34.12 ATOM 4066 CB LEUC 98 30.098 46.37731.752 1.00 33.636 ATOM 4067 CG LEUC 98 30.741 47.04932.961 1.00 35.446 ATOM 4068 CD1 LE1JC 98 29.694 47.35233.989 1.00 37.776 ATOM 4069 CD2 LEUC 98 31.806 46.16633.538 1.00 34 6 55 ATOM 4070 C LEUC 98 29.965 45.64129.404 1.00 . 6 36.94 ATOM 4071 0 LEt1C 98 29.640 44.46429.524 1.00 39.498 ATOM 4072 N THRC 99 29.567 46.39828.389 1.00 36.947 ATOM 4073 CA THRC 99 28.642 45.88127.393 1.00 36.726 ATOM 4074 CB THRC 99 27.317 46.67427.450 1.00 36 6 ATOM 4075 OG1 THRC 99 27.574 48.07627.259 1.00 . 8 40.25 ATOM 4076 CG2 THRC 99 26.648 46.47428.792 1.00 34.146 ATOM 4077 C THRC 99 29.154 45.895 25.9651.00 37.65 6 ATOM 4078 0 THRC 99 30.147 46.549 25.6641.00 37.93 8 ATOM 4079 N PROC 100 28.497 45.134 25.0731.00 37.89 7 ATOM 4080 CD PROC 100 27.443 44.145 25.3641.00 40.71 6 ATOM 4081 CA PROC 100 28.874 45.065 23.6671.00 37.03 6 ATOM 4082 CB PROC 100 27.716 44.298 23.0461.00 37.46 6 ATOM 4083 CG PROC 100 27.402 43.316 24.0941.00 38.27 6 ATOM 4084 C PROC 100 28.963 46.476 23.1391.00 38.41 6 ATOM 4085 0 PROC 100 28.082 47.297 23.3901.00 39.24 8 ATOM 4086 N GLNC 101 30.026 46.772 22.4121.00 38.06 7 ATOM 4087 CA GLNC 101 30.169 48.113 21.8931.00 39.24 6 ATOM 4088 CB GLNC 101 31.639 48.479 21.8271.00 38.35 6 ATOM 4089 CG GLNC 101 32.140 48.846 23.1951.00 43.58 6 ATOM 4090 CD GLNC 101 33.633 48.822 23.2911.00 47.06 6 15 ATOM 4091 OE1 GLNC 101 34.315 49.497 22.5331.00 51.61 8 ATOM 4092 NE2 GLNC 101 34.160 48.041 24.2271.00 48.13 7 ATOM 4093 C GLNC 101 29.471 48.333 20.5711.00 38.37 6 ATOM 4094 0 GLNC 101 30.095 48.620 19.5541.00 36.55 8 ATOM 4095 N LEUC 102 28.148 48.198 20.6271.00 40.04 7 20 ATOM 4096 CA LEUC 102 27.263 48.373 19.4781.00 40.82 6 ATOM 4097 CB LEUC 102 26.375 47.143 19.2891.00 38.65 6 ATOM 4098 CG LEUC 102 27.061 45.791 19.1631.00 40.16 6 ATOM 4099 CD1 LEUC 102 26.015 44.708 18.9941.00 37.69 6 ATOM 4100 CD2 LEUC 102 27.991 45.815 17.9811.00 39.89 6 25 ATOM 4101 C LEUC 102 26.362 49.583 19.6851.00 40.48 6 ATOM 4102 0 LEUC 102 25.940 49.880 20.8001.00 39.50 8 ATOM 4103 N AI~AC 103 26.072 50.280 18.6031.00 40.58 7 ATOM 4104 CA ALAC 103 25.203 51.434 18.6741.00 42.17 6 ATOM 4105 CB ALAC 103 25.879 52.646 18.0541.00 43.90 6 ATOM 4106 C ALAC 103 23.950 51.087 17.9041.00 43.55 6 ATOM 4107 0 ALAC 103 23.905 50.092 17.1891.00 44.89 8 ATOM 4108 N ARGC 104 22.930 51.916 18.0481.00 45.38 7 ATOM 4109 CA ARGC 104 21.674 51.689 17.3591.00 46.54 6 ATOM 4110 CB ARGC 104 20.549 51.665 18.3811.00 46.10 6 35 ATOM 4111 CG ARGC 104 19.292 51.040 17.8791.00 47.91 6 ATOM 4112 CD ARGC 104 19.457 49.560 17.5591.00 45.29 6 ATOM ~L113NE ARGC 104 18.188 49.059 17.0351.00 46.68 7 ATOM 4114 CZ ARGC 104 17.927 47.792 16.7611.00 46.66 6 ATOM 46115NH1 ARGC 104 18.850 46.866 16.9541.00 47.05 7 ATOM 4116 NH2 ARGC 104 16.733 47.452 16.3081.00 48.97 7 ATOM 4117 C ARGC 104 21.491 52.830 16.3671.00 46.82 6 ATOM 4118 0 ARGC 104 21.550 53.999 16.7381.00 49.29 8 ATOM 4119 N VALC 105 21.296 52.501 15.0981.00 47.65 7 ATOM 4120 CA VALC 105 21.138 53.543 14.0921.00 47.99 6 45 ATOM 4121 CB VP.LC 105 22.200 53.426 12.9801.00 46.29 6 ATOM 4122 CG1 VALC 105 22.080 54.588 12.0211.00 44.96 6 ATOM 4123 CG2 VALC 105 23.583 53.386 13.5801.00 42.95 6 ATOM 4124 C VF.LC 105 19.769 53.519 13.4441.00 50.20 6 ATOM 9:1250 VALC 105 19.340 52.497 12.9041.00 50.01 8 ATOM 4126 N VPZC 106 19.097 54.666 13.5061.00 51.90 7 ATOM 9127 CA VALC 106 17.767 54.836 12.9331.00 53.33 6 ATOM 4128 CB VALC 106 16.947 55.840 13.7581.00 51.93 6 ATOM 4129 CG1 VALC 106 15.503 55.825 13.3061.00 49.94 6 ATOM 4130 CG2 VALC 106 17.060 55.504 15.2221.00 50.56 6 ATOM 4131 C VALC 106 17.899 55.347 11.4971.00 53.76 6 ATOM 4132 0 VALC 106 18.782 56.151 11.2031.00 52.33 8 ATOM 4133 N SERC 107 17.016 54.889 10.6151.00 54.08 7 ATOM 4134 CA SERC 107 17.066 55.275 9.208 1.00 56.13 6 ATOM 4135 CB SERC 107 15.835 54.734 8.487 1.00 56.67 6 60 ATOM 4136 OG SERC 107 14.672 54.943 9.268 1.00 59.41 8 ATOM 4137 C SERC 107 17.228 56.762 8.895 1.00 56.30 6 ATOM 4138 0 SERC 107 17.678 57.1297.797 1.00 55.138 ATOM 4139 N ASPC 108 16.879 57.6199.849 1.00 56.727 ATOM 4140 CA ASPC 108 16.999 59.0649.632 1.00 58.466 ATOM 4141 CB ASPC 108 15.875 59.80710.353 1.00 59.646 ATOM 4142 CG ASPC 108 15.998 59.73511.856 1.00 60.596 ATOM 4143 OD1 ASPC 108 16.432 58.69312.378 1.00 61.808 ATOM 4144 OD2 ASPC 108 15.643 60.72412.520 1.00 63.048 ATOM 4145 C ASPC 108 18.345 59.64810.054 1.00 58.386 ATOM 4146 0 ASPC 108 18.513 60.85910.068 1.00 58.338 1~ ATOM 4147 N GI~YC 109 19.299 58.78510.396 1.00 59.417 ATOM 4148 CA GLYC 109 20.618 59.24610.786 1.00 58.666 ATOM 4149 C GLYC 109 20.802 59.46712.271 1.00 59.586 ATOM 4150 0 GLYC 109 21.868 59.92612.695 1.00 59.078 ATOM 4151 N GLUC 110 19.775 59.16513.064 1.00 59.047 15 ATOM 4152 CA GLUC 110 19.871 59.32514.508 1.00 59.386 ATOM 4153 CB GLUC 110 18.481 59.32715.141 1.00 62.396 ATOM 4154 CG GLUC 110 18.386 60.02016.513 1.00 66.236 ATOM 4155 CD GLUC 110 18.717 61.52016.441 1.00 70.426 ATOM 4156 OE1 GLUC 110 18.640 62.10715.333 1.00 69.278 ATOM 4157 OE2 GLUC 110 19.047 62.11717.493 1.00 72.258 ATOM 4158 C GLUC 110 20.677 58.14115.038 1.00 59.616 ATOM 4159 0 GLUC 110 20.467 56.99514.623 1.00 60.958 ATOM 4160 N VALC 111 21.600 58.41915.953 1.00 57.637 ATOM 4161 CA VALC 111 22.444 57.37916.535 1.00 55.436 25 ATOM 4162 CB VALC 111 23.926 57.62016.200 1.00 55.716 ATOM 4163 CG1 vALC 111 24.783 56.51116.788 1.00 53.146 ATOM 4164 CG2 VALC 111 24.105 57.70614.686 1.00 56.046 ATOM 4165 C VP,LC 111 22.308 57.33718.048 1.00 54.636 ATOM 4166 0 VALC 111 22.328 58.37318.706 1.00 53.678 ATOM 9:167N LEUC 112 22.171 56.13718.596 1.00 53.097 ATOM 9:168CA LEUC 112 22.050 55.99220.034 1.00 53.626 ATOM 9169 CB LEUC 112 20.638 55.54820.420 1.00 56.646 ATOM 4170 CG LEUC 112 19.380 56.01119.657 1.00 60.856 ATOM 4171 CD1 LEUC 112 19.439 57.49019.341 1.00 62.416 35 ATOM 4172 CD2 LEUC 112 19.244 55.20718.374 1.00 62.326 ATOM 4173 C LEUC 112 23.053 54.96320.542 1.00 53.286 ATOM 4174 0 LEUC 112 23.024 53.80720.134 1.00 54.918 ATOM 4175 N TYRC 113 23.943 55.3892.1.4291.00 50.877 ATOM 4176 CA TYRC 113 24.947 54.50222.003 1.00 47 6 ATOM 4177 CB TYRC 113 26.362 54.92421.560 1.00 . 6 44.85 ATOM 4178 CG TYRC 113 27.500 54.09922.134 1.00 40.846 ATOM 4179 CD1 TYRC 113 27.428 52.71622.181 1.00 39.926 ATOM 4180 CE1 TYRC 113 28.481 51.95622.679 1.00 39.266 ATOM 4181 CD2 TYRC 113 28.663 54.71022.602 1.00 41.116 45 ATOM 4182 CE2 TYRC 113 29.720 53.96223.100 1.00 40.686 ATOM 4183 CZ TYRC 113 29.625 52.58323.138 1.00 41.466 ATOM 4184 OH TYRC 113 30.667 51.83123.649 1.00 40.708 ATOM 4185 C TYRC 113 24.805 54.61123.508 1.00 48.036 ATOM 4186 O TYRC 113 25.002 55.67324.089 1.00 47.838 ATOM 4187 N METC 114 24.457 53.50824.146 1.00 48.887 ATOM 4188 CA METC 114 24.283 53.51925.583 1.00 49.266 ATOM 4189 CB METC 114 22.809 53.37525.910 1.00 53.646 ATOM 4190 CG METC 114 22.494 53.55827.370 1.00 58.336 ATOM 4191 SD METC 114 20.864 52.92727.696 1.00 67.3416 55 ATOM 4192 CE METC 114 19.859 54.33027.098 1.00 65.996 ATOM 4193 C METC 114 25.055 52.39326.244 1.00 47.946 ATOM 4194 O ME'PC 114 24.485 51.36026.579 1.00 48.328 ATOM 4195 N PROC 115 26.364 52.57626.440 1.00 47.407 ATOM 4196 CD PROC 115 27.181 53.71125.976 1.00 49.356 ATOM 4.197CA PROC 115 27.207 51.55627.066 1.00 48.056 ATOM 4:198CB PROC 115 28.591 51.90326.545 1.00 48.906 ATOM 4199 CG PROC 115 28.548 53.39826.559 1.00 48.59 ATOM 4200 C PROC 115 27.153 51.63628.585 1.00 48.68 ATOM 4201 0 PROC 115 26.976 52.72029.142 1.00 48.78 ATOM 4202 N SERC 116 27.291 50.49329.249 1.00 47.05 ATOM 4203 CA SERC 116 27.292 50.48130.699 1.00 45.85 ATOM 4204 CB SERC 116 26.746 49.17831.248 1.00 45.70 ATOM 4205 OG SERC 116 26.731 49.22832.667 1.00 46.59 ATOM 4206 C SERC 116 28.743 50.60731.097 1.00 47.30 ATOM 4207 0 SERC 116 29.568 49.79430.695 1.00 48.38 ATOM 4208 N ILEC 117 29.058 51.62231.892 1.00 45.86 ATOM 4209 CA ILEC 117 30.437 51.84932.293 1.00 41.61 ATOM ,4210CB ILEC 117 30.926 53.21031.749 1.00 39.60 ATOM 4211 CG2 ILEC 117 32.325 53.49932.230 1.00 38.47 ATOM 4212 CG1 ILEC 117 30.876 53.20830.225 1.00 38.60 ATOM 4213 CD1 ILEC 117 31.025 54.56329.619 1.00 34.54 ATOM 4214 C ILEC 117 30.708 51.83033.796 1.00 42.04 ATOM 4215 0 ILEC 117 29.948 52.39034.587 1.00 42.87 ATOM 4216 N ARGC 118 31.78'7 51.15834.182 1.00 40.79 ATOM 4217 CA ARGC 118 32.210 51.16235.568 1.00 40.35 ATOM 4218 CB ARGC 118 32.607 49.78236.060 1.00 37.23 ATOM 4219 CG ARGC 118 33.172 49.86637.455 1.00 36.55 ATOM 4220 CD ARGC 118 33.27'7 48.53838.156 1.00 39.03 ATOM 4221 NE ARGC 118 33.874 48.69339.483 1.00 39.42 ATOM 4222 CZ ARGC 118 33.882 47.75640.424 1.00 39.50 25 ATOM 4223 NH1 ARGC 118 33.326 46.57440.208 1.00 40.01 ATOM 4224 NH2 ARGC 118 34.434 48.01241.594 1.00 40.75 ATOM 4225 C ARGC 118 33.440 52.06535.545 1.00 41.99 ATOM 4226 0 ARGC 118 34.322 51.88134.722 1.00 43.88 ATOM 4227 N GLNC 119 33.514 53.04036.436 1.00 42.79 ATOM 4228 CA GINC 119 34.649 53.94736.408 1.00 43.05 ATOM 4229 CB GLNC 119 34.439 54.91435.252 1.00 41.88 ATOM 4230 CG GLNC 119 35.502 55.93935.034 1.00 41.06 ATOM 4231 CD GLNC 119 35.281 56.66833.732 1.00 41.03 ATOM 4232 OE1 GLNC 119 34.148 56.89933.331 1.00 40.46 35 ATOM 4233 NE2 GLNC 119 36.363 57.03933.066 1.00 43.78 ATOM 4234 C GLNC 119 34.786 54.68537.728 1.00 43.66 ATOM 4235 0 GLNC 119 33.803 54.93738.397 1.00 45.00 ATOM 4236 N ARGC 120 36.008 55.01838.113 1.00 44.71 ATOM 4237 CA ARGC 120 36.210 55.72239.369 1.00 48.39 ATOM 4238 CB ARGC 120 37.414 55.16940.107 1.00 51.11 ATOM 4239 CG ARGC 120 37.325 53.69640.397 1.00 56.82 ATOM 4240 CD ARGC 120 38.116 53.38641.641 1.00 64.45 ATOM 4241 NE AR.GC 120 37.375 53.65042.886 1.00 68.42 ATOM 4242 CZ AR.GC 120 37.903 54.23143.969 1.00 68.95 45 ATOM 4243 NH1 ARGC 120 39.169 54.63143.967 1.00 66.80 ATOM 4.244NH2 ARGC 120 37.177 54.37345.076 1.00 69.05 ATOM 4245 C ARGC 120 36.388 57.21539.168 1.00 48.49 ATOM 4246 0 ARGC 120 36.937 57.66038.161 1.00 48.13 ATOM 4247 N PHEC 121 35.916 57.99240.133 1.00 47.70 ATOM 9248 CA PHEC 121 36.013 59.43740.035 1.00 47.31 ATOM 4249 CB PHEC 121 34.649 60.04539.719 1.00 43.68 ATOM 4250 CG PHEC 121 34.022 59.48938.504 1.00 43.63 ATOM 4251 CD1 PHEC 121 33.365 58.27538.549 1.00 42.29 ATOM 4252 CD2 PHEC 121 34.104 60.16537.301 1.00 44.87 55 ATOM 4253 CE1 PHEC 121 32.793 57.74137.410 1.00 44.63 ATOM 4254 CE2 PHEC 121 33.539 59.64336.160 1.00 45.50 ATOM 4255 CZ PHEC 121 32.878 58.42536.213 1.00 45.14 ATOM 4256 C PHEC 121 36.535 60.09841.280 1.00 46.67 ATOM 4257 0 PHEC 121 36.528 59.52542.359 1.00 47.10 ATOM 4258 N SERC 122 36.984 61.32841.098 1.00 47.71 ATOM 4259 CA SERC 122 37.469 62.15042.187 1.00 49.70 ATOM 4260 CB SERC 122 38.799 62.80841.809 1.00 51.31 ATOM 4261 OG SERC 122 39.240 63.68842.829 1.00 51.16 ATOM 4262 C SERC 122 36.387 63.21342.365 1.00 50.12 ATOM 4263 0 SERC 122 36.169 64.05041.489 1.00 49.00 ATOM 4264 N CYSC 123 35.687 63.15643.488 1.00 50.55 ATOM 4265 CA CYSC 123 34.636 64.11243.754 1.00 52.50 ATOM 4266 C CYSC 123 34.356 64.19845.246 1.00 54.52 ATOM 4267 0 CYSC 123 34.998 63.51446.043 1.00 54.24 ATOM 4268 CB CYSC 123 33.37'7 63.70942.993 1.00 53.16 ATOM 4269 SG CYSC 123 32.811 62.03143.374 1.00 51.95 ATOM 4270 N ASPC 124 33.389 65.03745.622 1.00 56.86 ATOM 4271 CA ASPC 124 33.047 65.21547.034 1.00 58.55 ATOM 4272 CB ASPC 124 32.265 66.51447.252 1.00 58.22 ATOM 4273 CG ASPC 124 32.506 67.10548.634 1.00 58.91 ATOM 4274 OD1 ASPC 124 32.703 66.33849.589 1.00 58.22 ATOM 4275 OD2 ASPC 124 32.500 68.34148.777 1.00 62.67 ATOM 4276 C ASPC 124 32.246 64.05547.601 1.00 58.49 ATOM 4277 O ASPC 124 31.098 63.83747.229 1.00 58.26 ATOM 4278 N VALC 125 32.868 63.32048.513 1.00 59.01 ATOM 4279 CA VALC 125 32.23'? 62.17549.152 1.00 60.88 ATOM 4280 CB VALC 125 33.224 60.98349.243 1.00 59.28 ATOM 4281 CG1 VALC 125 32.601 59.83849.983 1.00 56.75 ATOM 4282 CG2 VALC 125 33.639 60.55247.856 1.00 58.31 ATOM 4283 C VALC 125 31.740 62.53050.565 1.00 63.26 25 ATOM 4284 0 VALC 125 30.892 61.83351.143 1.00 63.90 ATOM 4285 N SERC 126 32.267 63.61651.122 1.00 63.98 ATOM 4286 CA SERC 126 31.878 64.02652.464 1.00 64.49 ATOM 4287 CB SERC 126 32.464 65.40052.793 1.00 63.93 ATOM X6288OG SERC 126 31.972 66.38151.898 1.00 61.34 ATOM 4289 C SERC 126 30.364 64.06152.614 1.00 64.90 ATOM X62900 SERC 126 29.654 64.60351.766 1.00 64.08 ATOM 4291 N GLYC 127 29.871 63.45853.689 1.00 66.05 ATOM 4292 CA GI~YC 127 28.442 63.45853.929 1.00 68.25 ATOM 4293 C GLYC 127 27.742 62.20153.467 1.00 69.88 35 ATOM 4294 0 GLYC 127 26.546 62.04053.679 1.00 70.57 ATOM 4295 N VALC 128 28.480 61.29752.839 1.00 71.23 ATOM 4296 CA VALC 128 27.871 60.06552.366 1.00 72.78 ATOM 4297 CB VALC 128 28.890 59.12451.690 1.00 72.13 ATOM 4298 CG1 VALC 128 29.282 59.67050.361 1.00 75.47 ATOM 4299 CG2 VALC 128 30.104 58.94052.585 1.00 70.24 ATOM 4300 C VALC 128 27.223 59.24253.466 1.00 74.00 ATOM 4301 0 VALC 128 26.090 58.77053.316 1.00 73.73 ATOM 4302 N ASPC 129 27.946 59.06354.567 1.00 75.39 ATOM 4303 CA ASPC 129 27.440 58.22255.628 1.00 77.33 45 ATOM 4304 CB ASPC 129 28.490 58.04056.721 1.00 77.51 ATOM 4305 CG ASPC 129 28.304 56.72957.486 1.00 78.34 ATOM 4306 OD1 ASPC 129 29.328 56.05157.770 _.00 78.50 ATOM 4307 OD2 ASPC 129 27.132 56.37757.803 1.00 77.23 ATOM 4308 C ASPC 129 26.114 58.63456.235 1.00 78.98 ATOM 4309 0 ASPC 129 25.497 57.83256.948 1.00 79.11 ATOM 4310 N THRC 130 25.645 59.85155.948 1.00 79.48 ATOM 4311 CA THRC 130 24.365 60.25056.521 1.00 80.50 ATOM 4312 CB THRC 130 24.447 60.22958.077 1.00 83.19 ATOM 4313 OG1 THRC 130 25.829 60.14058.472 1.00 82.84 55 ATOM 4314 CG2 THRC 130 23.618 59.03558.670 1.00 83.96 ATOM 4315 C THRC 130 23.705 61.56656.146 1.00 79.50 ATOM 4316 0 THRC 130 24.362 62.53655.760 1.00 78.71 ATOM 4317 N GLUC 131 22.382 61.55356.307 1.00 79.39 ATOM 4318 CA GLUC 131 21.486 62.70056.114 1.00 79.61 ATOM 9319 CB GLUC 131 21.981 63.89356.961 1.00 82.70 ATOM 4320 CG GLUC 131 21.680 63.77258.471 1.00 85.13 ATOM 4321 CD GLU C131 22.642 64.580 59.3351.00 86.47 ATOM 4322 OE1GLU C131 22.862 65.788 59.0241.00 87.43 ATOM 4323 OE2GLU C131 23.168 63.998 60.3201.00 85.12 ATOM 4324 C GLU C131 21.207 63.185 54.7151.00 77.86 ATOM 4325 0 GLU C131 20.460 62.560 53.9551.00 76.34 ATOM 4326 N SER C132 21.771 64.355 54.4281.00 76.46 ATOM 4327 CA SER C132 21.652 64.995 53.1361.00 75.54 ATOM 4328 CB SER C132 21.941 66.495 53.2901.00 76.21 ATOM 4329 OG SER C132 23.233 66.719 53.8411.00 78.77 1~ ATOM 4330 C SER C132 22.673 64.318 52.2051.00 74.37 ATOM 4331 0 SER C132 22.799 64.675 51.0261.00 74.56 ATOM 4332 N GLY C133 23.392 63.338 52.7641.00 72.74 ATOM 4333 CA GLY C133 24.389 62.591 52.0191.00 70.01 ATOM 4334 C GLY C133 25.435 63.449 51.3371.00 68.98 ATOM 4335 0 GLY C133 25.636 64.615 51.6861.00 69.00 ATOM 4336 N ALA C134 26.107 62.859 50.3551.00 66.70 ATOM 4337 CA ALA C134 27.131 63.563 49.6091.00 64.10 ATOM 4338 CB ALA C134 28.394 62.723 49.5311.00 63.57 ATOM 4339 C ALA C134 26.641 63.899 48.2121.00 62.41 ATOM 4340 0 ALA C134 25.640 63.360 47.7371.00 60.16 ATOM 4341 N THR C135 27.347 64.826 47.5731.00 62.33 ATOM 4342 CA THR C135 27.023 65.237 46.2111.00 62.11 ATOM 4343 CB THR C135 26.431 66.642 46.1661.00 61.79 ATOM 4344 OG1THR C135 25.253 66.675 46.9801.00 65.07 25 ATOM 4345 CG2THR C135 26.057 67.007 44.7461.00 60.95 ATOM 4346 C THR C135 28.292 65.181 45.3751.00 60.85 ATOM 4347 O THR C135 29.181 66.040 45.4731.00 61.27 ATOM 4348 N CYS C136 28.368 64.128 44.5741.00 58.77 ATOM 4349 CA CYS C136 29.499 63.891 43.7121.00 56.58 ATOM 4350 C CYS C136 29.140 64.393 42.3251.00 56.26 ATOM 4351 0 CYS C136 28.197 63.907 41.7101.00 56.21 ATOM 4352 CB CYS C136 29.794 62.396 43.6981.00 54.70 ATOM 4353 SG CYS C136 31.010 61.882 42.4541.00 52.66 ATOM 4354 N ARG C137 29.874 65.386 41.8431.00 55.40 35 ATOM 4355 CA ARG C137 29.605 65.938 40.5201.00 55.61 ATOM 4356 CB ARG C137 29.698 67.466 40.5371.00 56.53 ATOM 4357 CG ARG C137 28.713 68.135 41.4621.00 61.72 ATOM 4358 CD ARG C137 29.231 69.491 41.9471.00 65.19 ATOM 4359 NE ARG C137 28.632 69.871 43.2361.00 69.78 ATOM 4360 CZ ARG C137 27.352 70.221 43.4121.00 71.88 ATOM 4361 NHlARG C137 26.504 70.256 42.3841.00 74.24 ATOM 4362 NH2ARG C137 26.908 70.522 44.6261.00 70.49 ATOM 4363 C ARG C137 30.604 65.392 39.5221.00 55.23 ATOM 4364 0 ARG C137 31.807 65.381 39.7731.00 57.26 45 ATOM 4365 N ILE C138 30.095 64.948 38.3851.00 52.01 ATOM 4366 CA ILE C138 30.922 64.398 37.3331.00 50.01 ATOM 4367 CB ILE C138 30.529 62.928 37.0611.00 49.70 ATOM 4368 CG2ILE C138 31.361 62.360 35.9331.00 47.04 ATOM 4369 CG1I:GEC138 30.703 62.090 38.3271.00 48.47 ATOM 4370 CD1ILE C138 30.080 60.706 38.2251.00 46.09 ATOM 4371 C ILE C138 30.693 65.222 36.0701.00 48.82 ATOM 4372 0 ILE C138 29.571 65.322 35.5971.00 46.40 ATOM 4373 N LYS C139 31.752 65.814 35.5291.00 49.18 ATOM 4374 CA LYS C139 31.634 66.614 34.3091.00 52.75 55 ATOM 4375 CB LYS C139 32.364 67.950 34.4641.00 54.78 ATOM 4376 CG LYS C139 31.952 68.737 35.6971.00 59.35 ATOM 4377 CD LYS C139 32.477 70.168 35.6691.00 60.96 ATOM 4378 CE LYS C139 31.780 71.019 34.5941.00 62.06 ATOM 4379 NZ LYS C139 32.316 72.419 34.5591.00 59.27 ATOM 4380 C LYS C139 32.218 65.886 33.1061.00 52.07 ATOM 4381 0 LYS C139 33.364 65.446 33.1431.00 52.64 ATOM 4382 N ILEC 140 31.441 65.76132.036 1.00 51.29 ATOM 4383 CA ILEC 140 31.938 65.09130.842 1.00 50.15 ATOM 4384 CB ILEC 140 31.404 63.61330.769 1.00 51.22 ATOM 4385 CG2 ILEC 140 31.536 62.95532.134 1.00 52.05 'rJ'ATOM 4386 CG1 ILEC 140 29.930 63.55530.393 1.00 49.11 ATOM 4387 CD1 ILEC 140 29.307 62.18730.676 1.00 49.89 ATOM 4388 C ILEC 140 31.624 65.86129.560 1.00 47.99 ATOM 4389 0 ILEC 140 30.515 66.32329.365 1.00 50.04 ATOM 4390 N GLYC 141 32.620 66.02528.701 1.00 46.57 ATOM 4391 CA GI~YC 141 32.414 66.73227.447 1.00 46.87 ATOM 4392 C GLYC 141 33.453 66.32326.416 1.00 46.66 ATOM 4393 O GLYC 141 34.359 65.56526.739 1.00 46.42 ATOM 4394 N SERC 142 33.329 66.80425.180 1.00 45.19 ATOM 4395 CA SERC 142 34.303 66.47424.140 1.00 41.98 ATOM 4396 CB SERC 142 33.974 67.16522.828 1.00 40.96 ATOM 4397 OG SERC 142 35.062 67.05721.943 1.00 34.78 ATOM 4398 C SERC 142 35.698 66.88524.551 1.00 43.33 ATOM 4399 0 SERC 142 35.915 67.95625.115 1.00 45.01 ATOM 4400 N TRPC 143 36.655 66.02824.256 1.00 43.12 ATOM 4401 CA TRPC 143 38.025 66.30024.622 1.00 42.98 ATOM 4402 CB TRPC 143 38.768 64.98224.819 1.00 41.57 ATOM 4403 CG TRPC 143 40.125 65.14125.446 1.00 39.54 ATOM 4404 CD2 TRPC 143 40.394 65.42026.820 1.00 36.50 ATOM 4405 CE2 TRPC 143 41.795 65.48126.967 1.00 35.30 ATOM 4406 CE3 TRPC 143 39.584 65.62527.943 1.00 36.55 ATOM 4407 CD1 TRPC 143 41.345 65.04824.829 1.00 38.96 ATOM 4408 NE1 TRPC 143 42.353 65.25125.738 1.00 35.00 ATOM 4409 CZ2 TRPC 143 42.400 65.73628.192 1.00 34.47 ATOM 4410 CZ3 TRPC 143 40.185 65.87829.153 1.00 35.28 ATOM 4411 CH2 TRPC 143 41.580 65.93129.271 1.00 35.16 ATOM 4412 C TRPC 143 38.767 67.15923.605 1.00 43.69 ATOM 4413 0 TRPC 143 39.657 67.91523.962 1.00 46.65 ATOM 4414 N THRC 144 38.402 67.06522.338 1.00 42.21 ATOM 4415 CA THRC 144 39.107 67.83421.333 1.00 40.90 ATOM 4416 CB THRC 144 39.839 66.90120.372 1.00 40.06 ATOM 4417 OG1 THRC 144 38.907 65.97619.798 1.00 40.17 ATOM 4418 CG2 THRC 144 40.916 66.14421.106 1.00 38.34 ATOM 4419 C THRC 144 38.25'1. 68.79520.520 1.00 43.03 ATOM 4420 0 THRC 144 38.786 69.63119.795 1.00 43.02 ATOM 4421 N H7:SC 145 36.934 68.68720.635 1.00 42.41 ATOM 4422 CA HISC 145 36.065 69.57119.885 1.00 45.42 ATOM 4423 CB H7:SC 145 34.994 68.77219.144 1.00 48.25 ATOM 4424 CG HI:SC 145 35.533 67.87318.071 1.00 49.32 ATOM 4425 CD2 HISC 145 36.052 68.15416.853 1.00 47.20 ATOM 4426 ND1 HISC 145 35.572 66.50018.197 1.00 47.13 ATOM 4427 CE1 HISC 145 36.091 65.97617.103 1.00 47.99 ATOM 4428 NE2 HISC 145 36.391 66.95816.272 1.00 48.34 ATOM 4429 C HISC 145 35.394 70.62720.754 1.00 48.71 ATOM 4430 0 HISC 145 34.738 70.32521.746 1.00 47.60 ATOM 4431 N HISC 146 35.562 71.88320.363 1.00 52.53 ATOM 4432 CA HISC 146 34.972 72.99321.094 1.00 53.12 ATOM 4433 CB HISC 146 35.777 74.26120.840 1.00 50.98 ATOM 4434 CG HISC 146 35.931 74.58619.390 1.00 48.89 ATOM 4435 CD2 HISC 146 35.013 74.75518.409 1.00 47.83 ATOM 4436 ND1 HI:SC 146 37.167. 74.77618.801 1.00 48.82 ATOM 4437 CEl HISC 146 36.993 75.04917.519 1.00 48.32 ATOM 4438 NE2 HI:SC 146 35.699 75.04317.257 1.00 46.12 ATOM 4439 C HISC 146 33.524 73.18820.664 1.00 54.19 ATOM 4440 O HISC 146 33.047 72.53119.736 1.00 54.21 ATOM 4441 N SERC 147 32.847 74.11221.341 1.00 56.30 ATOM 4442 CA SERC 147 31.437 74.41821.115 1.00 57.23 ATOM 4443 CB SERC 147 31.055 75.61021.978 1.00 57.36 ATOM 4444 OG SERC 147 32.017 76.63521.828 1.00 59.18 ATOM 4445 C SERC 147 30.972 74.66019.682 1.00 57.72 ATOM 4446 0 SERC 147 29.790 74.48419.375 1.00 57.25 ATOM 4447 N ARGC 148 31.885 75.06518.809 1.00 58.23 ATOM 4448 CA ARGC 148 31.517 75.33617.424 1.00 60.12 ATOM 4449 CB ARGC 148 32.555 76.26416.777 1.00 63.75 ATOM 4450 CG ARGC 148 32.799 77.56717.549 1.00 70.83 ATOM 4451 CD ARGC 148 33.950 78.39316.946 1.00 77.31 1~ ATOM 4452 NE ARGC 148 34.422 79.45317.852 1.00 84.18 ATOM 4453 CZ ARGC 148 33.696 80.50618.245 1.00 86.23 ATOM 4454 NH1 ARGC 148 32.447 80.66117.818 1.00 87.64 ATOM 4455 NH2 ARGC 148 34.213 81.40819.072 1.00 86.26 ATOM 4456 C ARGC 148 31.390 74.05116.601 1.00 59.83 15 ATOM 4457 0 ARGC 148 30.786 74.05315.519 1.00 60.30 ATOM 4458 N GI~UC 149 31.954 72.95917.121 1.00 57.69 ATOM 4459 CA GLUC 149 31.937 71.67716.425 1.00 54.67 ATOM 4460 CB GLUC 149 33.364 71.13216.321 1.00 52.47 ATOM 4461 CG GLUC 149 34.395 72.22816.050 1.00 52.11 ATOM 4462 CD GLUC 149 35.824 71.71815.896 1.00 50.20 ATOM 4463 OE1 GLUC 149 36.246 70.85216.678 1.00 49.43 ATOM 4464 OE2 GLUC 149 36.537 72.20315.004 1.00 47.62 ATOM 4465 C GLUC 149 31.043 70.69817.162 1.00 53.64 ATOM 4466 0 GLUC 149 30.252 69.98516.552 1.00 53.16 25 ATOM 4467 N ILEC 150 31.172 70.66718.479 1.00 52.16 ATOM 4468 CA ILEC 150 30.353 69.79519.289 1.00 51.98 ATOM 4469 CB ILEC 150 31.157 68.61219.883 1.00 53.49 ATOM 4470 CG2 ILEC 150 30.361 67.95421.019 1.00 52.00 ATOM X6471CG1 ILEC 150 31.450 67.57118.800 1.00 53.48 ATOM 4472 CD1 ILEC 150 32.235 66.38319.299 1.00 50.44 ATOM 4473 C ILEC 150 29.750 70.56520.446 1.00 53.26 ATOM 4474 0 ILEC 150 30.410 71.38921.095 1.00 51.01 ATOM 4475 N SERC 151 28.479 70.28020.694 1.00 54.99 ATOM 4476 CA SERC 151 27.749 70.88721.797 1.00 56.94 35 ATOM 4477 CB SERC 151 26.693 71.87321.280 1.00 54.85 ATOM 4478 OG SERC 151 25.665 71.22120.557 1.00 55.92 ATOM 4479 C SERC 151 27.084 69.71722.516 1.00 59.00 ATOM 4480 O SE:RC 151 26.536 68.82021.871 1.00 60.03 ATOM 4481 N VALC 152 27.172, 69.70523.844 1.00 60.32 ATOM 4482 CA VALC 152 26.569 68.65124.655 1.00 61.16 ATOM 4483 CB VALC 152 27.564 68.09625.694 1.00 60.14 ATOM 4484 CG1 VALC 152 28.858 67.72325.009 1.00 61.98 ATOM 4485 CG2 VALC 152 27.817 69.11026.775 _.00 61.23 ATOM 4486 C VALC 152 25.373 69.23725.391 1.00 62.82 45 ATOM 4487 0 VALC 152 25.379 70.40925.758 1.00 63.73 ATOM 4488 N ASPC 153 24.349 68.42525.614 1.00 65.81 ATOM 4489 CA ASPC 153 23.147 68.88726.293 1.00 67.23 ATOM 4490 CB ASPC 153 22.150 69.37725.249 1.00 69.19 ATOM 4491 CG ASPC 153 22.748 70.42524.320 1.00 72.38 ATOM 4492 OD1 ASPC 153 22.786 71.61424.718 1.00 72.90 ATOM 4493 OD2 ASPC 153 23.193 70.06023.201 1.00 75.01 ATOM 4494 C ASPC 153 22.505 67.77627.120 _.00 69.10 ATOM 4495 0 ASPC 153 22.504 66.61226.717 1.00 68.47 ATOM 4496 N PROC 154 21.970 68.11528.304 1.00 70.49 55 ATOM 4497 _CD PR0C 154 22.282 69.30929.094 1.00 69.97 ATOM 4498 CA PR0C 154 21.325 67.09829.147 1.00 73.18 ATOM 4499 CB PR0C 154 21.148 67.81430.477 1.00 70.84 ATOM 4500 CG PR0C 154 22.300 68.74530.493 1.00 71.35 ATOM 4501 C PROC 154 19.985 66.66928.522 1.00 77.25 ATOM 4502 O PROC 154 19.591 67.18327.462 1.00 77.76 ATOM 4503 N THRC 155 19.279 65.74429.175 1.00 80.57 ATOM 4504 CA THR C155 18.010 65.25328.633 1.00 83.84 6 ATOM 4505 CB THR C155 18.244 63.93227.837 1.00 83.53 6 ATOM 4506 OG1 THR C155 18.609 62.88228.744 1.00 83.26 8 ATOM 4507 CG2 THR C155 19.361 64.10526.823 1.00 83.08 6 'rJATOM 4508 C THR C155 16.897 65.00129.678 1.00 87.74 6 ATOM 4509 0 THR C155 16.826 65.67730.715 1.00 87.94 8 ATOM 4510 N THR C156 16.042 64.01229.370 1.00 91.72 7 ATOM 4511 CA THR C156 14.882 63.57730.180 1.00 93.73 6 ATOM 4512 CB THR C156 14.501 62.09229.877 1.00 93.94 6 ATOM 4513 OG1 THR C156 14.249 61.93328.470 1.00 93.93 8 ATOM 4514 CG2 THR C156 13.253 61.68130.696 1.00 93.29 6 ATOM 4515 C THR C156 15.042 63.69531.693 1.00 95.32 6 ATOM 4516 0 THR C156 15.626 62.81732.347 1.00 95.61 8 ATOM 4517 N GLU C157 14.490 64.76732.246 1.00 97.07 7 15 ATOM 4518 CA GLU C157 14.578 65.01133.679 1.00 98.94 6 ATOM 4519 CB GLU C157 14.487 66.51433.942 1.00 100.276 ATOM 4520 CG GLU C157 15.282 67.35932.950 1.00 102.556 ATOM 4521 CD GLU C157 15.113 68.85233.214 1.00104.54 6 ATOM 4522 OE1 GLU C157 13.943 69.32233.312 1.00105.88 8 ATOM 4523 OE2 GLU C157 16.150 69.55533.327 1.00104.90 8 ATOM 4524 C GLU C157 13.475 64.29034.465 1.00 99.30 6 ATOM 4525 O GLU C157 13.452 64.33735.706 1.00 99.77 8 ATOM 4526 N ASN C158 12.557 63.63933.751 1.00 99.15 7 ATOM 4527 CA ASN C158 11.457 62.91934.404 1.00 98.32 6 25 ATOM 4528 CB ASN C158 10.382 62.54133.374 1.00100.43 6 ATOM 4529 CG ASN C158 9.902 63.73632.555 1.00101.38 6 ATOM 4530 OD1 ASN C158 9.423 64.73833.112 1.00101.96 8 ATOM 4531 ND2 ASN C158 10.026 63.63631.224 1.00101.40 7 ATOM 4532 C ASN C158 11.991 61.63835.064 1.00 96.64 6 ATOM 4533 O ASN C158 12.380 61.64336.239 1.00 96.33 8 ATOM 4534 N SER C159 11.992 60.55834.283 1.00 93.61 7 ATOM 4535 CA SER C159 12.466 59.23734.690 1.00 90.35 6 ATOM 4536 CB SER C159 13.541 58.78833.690 1.00 90.84 6 ATOM 4537 OG SER C159 14.367 59.89833.320 1.00 90.44 8 35 ATOM 4538 C SER C159 13.005 59.16736.123 1.00 88.15 6 ATOM 4539 0 SER C159 13.942 59.89436.481 1.00 88.99 8 ATOM 4540 N ASP C160 12.414 58.30236.945 1.00 84.53 7 ATOM ~L541CA ASP C160 12.863 58.15238.330 1.00 80.47 6 ATOM 4542 CB ASP C160 12.232 56.92138.985 1.00 80.26 6 ATOM 4543 CG ASP C160 12.760 56.68340.398 1.00 82.12 6 ATOM 4544 ODl ASP C160 12.658 55.53640.890 1.00 82.78 8 ATOM 4545 OD2 ASP C160 13.277 57.64441.023 1.00 82.17 8 ATOM 4546 C ASP C160 14.380 57.97838.340 1.00 77.39 6 ATOM 4547 0 ASP C160 14.892 57.00937.768 1.00 75.75 8 45 ATOM 4548 N ASP C161 15.080 58.91038.992 1.00 73.66 7 ATOM 4549 CA ASP C161 16.529 58.86439.072 1.00 71.77 6 ATOM 4550 CB ASP C161 17.060 59.93440.028 1.00 71.93 6 ATOM 4551 CG ASP C161 16.943 61.33039.461 1.00 72.28 6 ATOM 4552 OD1 ASP C161 17.115 61.48638.230 1.00 71.71 8 ATOM 4553 OD2 ASP C161 16.695 62.27040.246 1.00 74.13 8 ATOM 4554 C ASP C161 17.118 57.51539.479 1.00 70.97 6 ATOM 9:5550 ASP C161 18.296 57.25139.222 1.00 73.00 8 ATOM 4556 N SER C162 16.335 56.64940.105 1.00 68.54 7 ATOM 4557 CA SER C162 16.899 55.36640.496 1.00 66.65 6 55 ATOM 4558 CB SER C162 17.085 55.30842.020 1.00 66.09 6 ATOM 4559 OG SER C162 15.845 55.35242.698 1.00 66.84 8 ATOM 4560 C SER C162 16.064 54.19440.019 1.00 65.29 6 ATOM 4561 0 SER C162 16.042 53.14740.646 1.00 65.08 8 ATOM 4562 N GLU C163 15.393 54.35738.892 1.00 64.69 7 ATOM 4563 CA GLU C163 14.571 53.27038.398 1.00 66.58 6 ATOM 4564 CB GLU C163 13.543 53.78437.372 1.00 68.86 6 ATOM 4565 CG GLUC 163 14.029 53.94235.951 1.00 70.35 ATOM 4566 CD GLUC 163 12.886 54.26135.000 1.00 73.03 ATOM 4567 OE1 GLUC 163 12.345 55.39035.065 1.00 75.39 ATOM 4568 OE2 GLUC 163 12.517 53.37834.193 1.00 72.63 ATOM 4569 C GLUC 163 15.416 52.14537.808 1.00 65.46 ATOM 4570 O GLUC 163 14.902 51.07137.481 1.00 64.98 ATOM 4571 N TYRC 164 16.718 52.39237.675 1.00 65.54 ATOM 4572 CA TYRC 164 17.647 51.38937.143 1.00 63.20 ATOM 4573 CB TYRC 164 18.353 51.89435.884 1.00 63.41 ATOM 4574 CG TYRC 164 17.433 52.10134.716 1.00 65.49 ATOM 4575 CD1 TYRC 164 17.299 53.35534.119 1.00 66.61 ATOM 4576 CE1 TYRC 164 16.429 53.55533.046 1.00 68.54 ATOM 4577 CD2 TYRC 164 16.676 51.046x4.216 1.00 68.25 ATOM 4578 CE2 TYRC 164 15.797 51.23033.144 1.00 70.31 ATOM 4579 CZ TYRC 164 15.680 52.48432.562 1.00 70.26 ATOM 4580 OH TYRC 164 14.832 52.65531.482 1.00 74.21 ATOM 4581 C TYRC 164 18.690 51.06638.184 1.00 61.13 ATOM 4582 0 TYRC 164 19.480 50.14738.003 1.00 60.53 ATOM 4583 N PHEC 165 18.68'7 51.82439.279 1.00 59.92 ATOM 4584 CA PHEC 165 19.65'7 51.62240.347 1.00 58.58 ATOM 4585 CB PHEC 165 19.497 52.69041.425 1.00 56.39 ATOM 4586 CG PHEC 165 20.717 52.85642.288 1.00 55.60 ATOM 4587 CDl PHEC 165 21.904 53.33641.742 1.00 53.27 ATOM 4588 CD2 PHEC 165 20.692 52.49743.629 1.00 54.20 ATOM 4589 CE1 PHEC 165 23.049 53.45142.513 1.00 53.30 ATOM 4590 CE2 PHEC 165 21.835 52.60744.414 1.00 54.70 ATOM 4591 CZ PHEC 165 23.018 53.08543.854 1.00 54.90 ATOM 4592 C PHEC 165 19.528 50.25040.974 1.00 58.64 ATOM 4593 0 PHEC 165 18.422 49.74941.153 1.00 60.35 ATOM 4594 N SERC 166 20.655 49.63141.298 1.00 58.50 ATOM 4595 CA SERC 166 20.614 48.30941.900 1.00 58.50 ATOM 4596 CB SERC 166 22.013 47.70341.996 1.00 58.83 ATOM 4597 OG SERC 166 21.957 46.39142.542 1.00 61.34 ATOM 4598 C SERC 166 20.050 48.47343.286 1.00 58.49 ATOM 4599 0 SERC 166 20.346 49.45443.964 1.00 58.40 ATOM 4600 N GLNC 167 19.249 47.50343.706 1.00 57.37 ATOM 4601 CA GLNC 167 18.631 47.54545.020 1.00 57.17 ATOM 4602 CB GLNC 167 17.317 46.76644.994 1.00 59.70 ATOM 4603 CG GLNC 167 17.467 45.35144.490 1.00 62.90 ATOM 4604 CD GLNC 167 16.136 44.69644.164 1.00 67.19 ATOM 4605 OE1 GLNC 167 15.284 44.51945.048 1.00 68.37 ATOM 4606 NE2 GLNC 167 15.940 44.33442.884 1.00 66.77 ATOM 4607 C GLNC 167 19.548 46.97546.085 1.00 55.30 ATOM 4608 0 GLNC 167 19.373 47.23547.271 1.00 53.36 ATOM X6609N TYRC 168 20.541 46.21145.659 1.00 55.00 ATOM 4610 CA TYRC 168 21.455 45.60146.609 1.00 55.48 ATOM 4611 CB TYRC 168 21.845 44.21446.114 1.00 55.25 ATOM 4612 CG TYRC 168 20.630 43.41345.714 1.00 56.93 ATOM 4613 CD1 TYRC 168 20.242 43.31544.378 1.00 56.29 ATOM 4614 CE1 TYRC 168 19.087 42.64044.016 1.00 56.50 ATOM 4615 CD2 TYRC 168 19.825 42.80946.680 1.00 57.12 ATOM 4616 CE2 TYRC 168 18.664 42.13346.332 1.00 56.97 ATOM 4617 CZ T~'RC 168 18.300 42.05444.997 1.00 58.82 ATOM 4618 OH TYRC 168 17.133 41.40844.640 1.00 61.29 ATOM 4619 C TYRC 168 22.692 46.43146.919 1.00 55.31 ATOM 4620 0 TYRC 168 23.582 45.98747.637 1.00 53.34 ATOM 4621 N SERC 169 22.733 47.64646.384 1.00 56.64 ATOM 4622 CA SERC 169 23.851 48.55346.620 1.00 58.01 ATOM 4623 CB SERC 169 23.731 49.78645.720 1.00 58.39 ATOM 4624 OG SERC 169 24.745 50.72746.017 1.00 57.32 ATOM 4625 C SERC 169 23.860 49.00148.076 1.00 60.12 ATOM 4626 0 SER C 169 22.803 49.148 48.699 1.00 60.78 8 ATOM 4627 N ARG C 170 25.052 49.215 48.621 1.00 59.44 7 ATOM 4628 CA ARG C 170 25.174 49.662 49.998 1.00 58.39 6 ATOM 4629 CB ARG C 170 26.636 49.602 50.438 1.00 59.12 6 ATOM 4630 CG ARG C 170 26.999 48.350 51.195 1.00 61.61 6 ATOM 4631 CD ARG C 170 28.466 47.972 51.024 1.00 64.86 6 ATOM 4632 NE ARG C 170 29.418 49.012 51.424 1.00 66.40 7 ATOM 4633 CZ ARG C 170 30.317 49.556 50.597 1.00 68.28 6 ATOM 4634 NH1 ARG C 170 30.384 49.165 49.326 1.00 66.23 7 ATOM 4635 NH2 ARG C 170 31.166 50.480 51.039 1.00 68.62 7 ATOM 4636 C ARG C 170 24.668 51.102 50.109 1.00 59.25 6 ATOM 4637 0 ARG C 170 24.416 51.609 51.215 1.00 59.99 8 ATOM 4638 N PHE C 171 24.498 51.759 48.968 1.00 57.06 7 ATOM 4639 CA PHE C 171 24.063 53.146 48.982 1.00 56.45 6 15 ATOM 4640 CB PHE C 171 25.131 54.016 48.324 1.00 55.23 6 ATOM 4641 CG PHE C 171 26.521 53.719 48.814 1.00 54.51 6 ATOM 4642 CD1 PHE C 171 27.189 52.568 48.400 1.00 55.98 6 ATOM 4643 CD2 PHE C 171 27.145 54.559 49.724 1.00 53.29 6 ATOM 4644 CE1 PHE C 171 28.463 52.257 48.890 1.00 55.09 6 ATOM 4645 CE2 PHE C 171 28.412 54.258 50.218 1.00 54.24 6 ATOM 4646 Cz PHE C 171 29.074 53.102 49.799 1.00 54.89 6 ATOM 4647 C PHE C 171 22.732 53.346 48.311 1.00 55.77 6 ATOM 4648 0 PH13 C 171 22.164 52.406 47.761 1.00 55.57 8 ATOM 4649 N GLU C 172 22.228 54.569 48.376 1.00 55.26 7 25 ATOM 4650 CA GL~J C 172 20.947 54.877 47.760 1.00 58.65 6 ATOM 4651 CB GLU C 172 19.806 54.769 48.789 1.00 60.96 6 ATOM 4652 CG GLU C 172 19.891 55.739 49.981 1.00 64.19 6 ATOM 4653 CD GLU C 172 18.753 55.551 50.992 1.00 64.82 6 ATOM 4654 OE1 GLU C 172 17.626 55.236 50.557 1.00 65.38 8 ATOM 4655 OE2 GLU C 172 18.976 55.734 52.216 1.00 64.87 8 ATOM 4656 C GLU C 172 21.014 56.279 47.162 1.00 59.71 6 ATOM 4657 0 GLU C 172 21.815 57.116 47.600 1.00 60.04 8 ATOM 4658 N ILE C 173 20.186 56.530 46.154 1.00 58.96 7 ATOM 4659 CA ILE C 173 20.182 57.827 45.494 1.00 59.79 6 35 ATOM 4660 CB ILE C 173 20.016 57.687 43.970 1.00 60.17 6 ATOM 4661 CG2 ILE C 173 19.918 59.071 43.334 1.00 57.73 6 ATOM 4662 CG1 ILE C 173 21.191 56.896 43.384 1.00 59.23 6 ATOM 4.663 CD1 ILE C 173 21.053 56.663 41.902 1.00 58.26 6 ATOM 4664 C ILE C 173 19.088 58.756 45.977 1.00 59.99 6 ATOM 4665 0 ILE C 173 17.912 58.391 46.021 1.00 57.81 8 ATOM 4666 N LEU C 174 19.480 59.972 46.321 1.00 60.93 7 ATOM 4667 CA LEU C 174 18.510 60.943 46.782 1.00 62.65 6 ATOM 4668 CB LEU C 174 19.164 61.916 47.756 1.00 62.58 6 ATOM 4669 CG LEU C 174 19.967 61.213 48.856 1.00 63.64 6 45 ATOM 4670 CD1 LEU C 174 20.647 62.264 49.723 1.00 63.25 6 ATOM 4671 CD2 LEU C 174 19.054 60.303 49.684 1.00 61.62 6 ATOM 4672 C LEU C 174 17.985 61.680 45.564 1.00 64.25 6 ATOM 4673 0 LEU C 174 16.781 61.734 45.329 1.00 65.71 8 ATOM 4674 N ASP C 175 18.893 62.223 44.768 1.00 65.23 7 ATOM 4675 CA ASP C 175 18.485 62.951 43.576 1.00 66.02 6 ATOM 4676 CB ASP C 175 17.949 64.334 43.991 1.00 67.24 6 ATOM 4677 CG ASP C 175 17.419 65.160 42.812 1.00 68.54 6 ATOM 4678 OD1 ASP C 175 16.598 64.650 42.011 1.00 69.53 8 ATOM 4679 OD2 ASP C 175 17.812 66.338 42.695 1.00 66.59 8 55 ATOM 4680 C ASP C 175 19.651 63.084 42.593 1.00 66.29 6 ATOM 4681 O ASP C 175 20.829 63.031 42.980 1.00 66.20 8 ATOM 4682 N VAL C 176 19.312 63.237 41.318 1.00 66.07 7 ATOM 4683 CA VAL C 176 20.308 63.391 40.267 1.00 65.83 6 ATOM 4684 CB VAL C 176 20.426 62.109 39.401 1.00 66.59 6 ATOM 4685 CG1 VAL C 176 21.382 62.345 38.232 1.00 64.35 6 ATOM 4686 CG2 VAL C 176 20.900 60.943 40.254 1.00 63.70 6 ATOM 4687 C VALC 176 19.869 64.53239.368 1.00 67.12 6 ATOM 4688 0 VALC 176 18.715 64.58938.956 1.00 67.64 8 ATOM 4689 N THRC 177 20.786 65.44739.075 1.00 68.63 7 ATOM 4690 CA THRC 177 20.482 66.57338.200 1.00 69.48 6 ATOM 4691 CB THRC 177 20.215 67.86139.004 1.00 69.26 6 ATOM 4692 OG1 THRC 177 21.310 68.10939.894 1.00 68.92 8 ATOM 4693 CG2 THRC 177 18.932 67.71839.804 1.00 68.40 6 ATOM 4694 C THRC 177 21.640 66.81337.245 1.00 70.44 6 ATOM 4695 O THRC 177 22.802 66.64137.614 1.00 69.76 8 1~ ATOM 4696 N GLNC 178 21.312 67.20736.018 1.00 71.94 7 ATOM 4697 CA GLNC 178 22.320 67.47034.998 1.00 73.43 6 ATOM 4698 CB GLNC 178 22.150 66.50033.831 1.00 76.20 6 ATOM 4699 CG GLNC 178 21.560 65.14834.220 1.00 80.00 6 ATOM 4700 CD GLNC 178 21.896 64.04633.196 1.00 83.21 6 ATOM 9:701OE1 GLNC 178 21.745 64.23731.973 1.00 84.40 8 ATOM 4702 NE2 GLNC 178 22.346 62.88933.694 1.00 82.90 7 ATOM 4703 C GLNC 178 22.149 68.88434.482 1.00 72.16 6 ATOM 4704 0 GLNC 178 21.070 69.24434.044 1.00 72.49 8 ATOM 4705 N LYSC 179 23.214 69.67534.522 1.00 71.74 7 ATOM 4706 CA LYSC 179 23.166 71.05434.048 1.00 71.38 6 ATOM 4707 CB LYSC 179 23.205 72.02235.233 1.00 73.17 6 ATOM 4708 CG LYSC 179 22.291 71.61036.380 1.00 78.41 6 ATOM 4709 CD LA'SC 179 22.499 72.45937.644 1.00 79.07 6 ATOM 4710 CE LYSC 179 21.814 71.82138.864 1.00 80.35 6 25 ATOM 4711 NZ LYSC 179 22.363 70.45239.163 1.00 81.10 7 ATOM 4712 C LYSC 179 24.384 71.30133.176 1.00 70.13 6 ATOM 4713 0 LYSC 179 25.504 71.35333.681 1.00 70.65 8 ATOM 4714 N LYSC 180 24.180 71.46631.876 1.00 68.21 7 ATOM 4715 CA LYSC 180 25.306 71.71930.978 1.00 67.25 6 ATOM 4716 CB LYSC 180 24.833 71.66729.519 1.00 67.12 6 ATOM 4717 CG LYSC 180 24.008 72.84629.053 1.00 63.90 6 ATOM 4718 CD LYSC 180 24.908 73.92028.488 1.00 63.70 6 ATOM 4719 CE LYSC 180 25.64.'> 73.45227.223 1.00 63.89 6 ATOM 4720 NZ LYSC 180 24.768 73.29526.013 1.00 62.80 7 35 ATOM 4721 C LvSC 180 25.971 73.07531.266 1.00 67.33 6 ATOM 4722 0 LYSC 180 25.552 73.80332.160 1.00 66.68 8 ATOM 4723 N ASNC 181 27.027 73.39930.528 1.00 67.89 7 ATOM 4724 CA ASNC 181 27.698 74.67430.702 1.00 67.78 6 ATOM 4725 CB ASNC 181 27.967 74.94832.191 1.00 69.90 6 ATOM 4726 CG ASNC 181 28.580 73.77032.916 1.00 70.82 6 ATOM 4727 OD1 ASNC 181 29.508 73.13732.422 1.00 73.77 8 ATOM 4728 ND2 A:3NC 181 28.071 73.48134.109 1.00 70.00 7 ATOM 4729 C ASNC 181 28.977 74.88429.901 1.00 67.29 6 ATOM 4730 0 ASNC 181 29.937 74.15330.049 1.00 68.57 8 45 ATOM 4731 N SERC 182 28.978 75.91129.058 1.00 67.43 7 ATOM 4732 CA SERC 182 30.134 76.24828.233 1.00 66.28 6 ATOM 4733 CB SERC 182 29.726 77.29027.186 1.00 65.32 6 ATOM 4734 OG S~RC 182 30.731 77.47726.214 1.00 68.09 8 ATOM 4735 C SERC 182 31.230 76.79829.141 1.00 65.83 6 ATOM 4736 0 SLRC 182 30.941 77.27230.231 1.00 66.92 8 ATOM 4737 N V.ALC 183 32.483 76.73128.698 1.00 65.76 7 ATOM 4738 CA VALC 183 33.613 77.21129.498 1.00 65.65 6 ATOM 4739 CB VALC 183 33.872 76.26430.696 1.00 63.98 6 ATOM 4740 CG1 VALC 183 33.648 74.84330.277 1.00 64.03 6 55 ATOM 4741 CG2 VALC 183 35.292 76.44231.209 1.00 61.75 6 ATOM 4742 C VALC 183 34.925 77.37528.728 1.00 65.88 6 ATOM 4743 0 V_~LC 183 35.305 76.51527.944 1.00 65.40 8 ATOM 4744 N THRC 184 35.616 78.48528.957 1.00 66.99 7 ATOM 4745 CA THRC 184 36.892 78.72228.293 1.00 68.57 6 ATOM 4746 CB THRC 184 36.995 80.16827.732 1.00 67.80 6 ATOM 4747 OG1 THRC 184 35.981 80.36926.737 1.00 66.40 8 ATOM 4748 CG2 THRC 184 38.370 80.40627.094 1.00 66.48 ATOM 4749 C THRC 184 38.032 78.47029.292 1.00 70.57 ATOM 4750 O THRC 184 37.920 78.80230.482 1.00 70.99 ATOM 4751 N TYRC 185 39.118 77.86928.815 1.00 70.74 ATOM 4752 CA TYRC 185 40.236 77.57229.683 1.00 71.98 ATOM 4753 CB TYRC 185 40.555 76.06729.658 1.00 72.58 ATOM 4754 CG TYRC 185 39.351 75.19529.937 1.00 72.59 ATOM 4755 CD1 TYRC 185 38.363 75.01128.970 1.00 73.55 ATOM 4756 CE1 TYRC 185 37.224 74.25829.236 1.00 72.54 ATOM 9:757CD2 TYRC 185 39.164 74.59731.185 1.00 72.27 ATOM 9:758CE2 TYRC 185 38.017 73.83931.461 1.00 71.72 ATOM 4759 CZ TYRC 185 37.057 73.67830.480 1.00 71.73 ATOM 4760 OH TYRC 185 35.920 72.95130.732 1.00 71.36 ATOM 4761 C TYRC 185 41.426 78.35529.191 1.00 73.72 15 ATOM 4762 O TYRC 185 41.625 78.49227.983 1.00 74.41 ATOM 4763 N SE;RC 186 42.220 78.86930.125 1.00 75.63 ATOM 4764 CA SERC 186 43.405 79.65329.772 1.00 77.64 ATOM 4765 CB SE:RC 186 44.183 80.01531.043 1.00 77.47 ATOM 4766 OG SE:RC 186 44.398 78.87031.858 1.00 78.93 20 ATOM 4767 C SE:RC 186 44.300 78.87528.793 1.00 77.75 ATOM 4768 0 SE;RC 186 44.926 79.45727.893 1.00 76.44 ATOM 4769 N CYSC 187 44.332 77.55628.977 1.00 78.65 ATOM 4770 CA CYSC 187 45.116 76.64828.135 1.00 79.38 ATOM 4771 C CYSC 187 44.658 76.70326.715 1.00 79.55 25 ATOM 467720 CYSC 187 45.443 76.68725.771 1.00 79.09 ATOM 4773 CB CYSC 187 44.899 75.17828.529 1.00 79.04 ATOM 4774 SG CYSC 187 43.205 74.46228.241 1.00 80.14 ATOM 4775 N CYSC 188 43.345 76.77426.589 1.00 80.45 ATOM 4776 CA CYSC 188 42.727 76.64225.305 1.00 79.63 ATOM 4777 C CYSC 188 41.779 77.75524.835 1.00 79.24 ATOM 4778 0 CYSC 188 40.785 78.06525.504 1.00 81.46 ATOM 4779 CB CYSC 188 42.037 75.26925.365 1.00 79.66 ATOM 4780 SG CYSC 188 42.984 73.94026.264 1.00 75.61 ATOM 4781 N PROC 189 42.070 78.34623.656 1.00 77.55 35 ATOM 4782 CD PROC 189 43.22:? 77.84922.879 1.00 76.91 ATOM 4783 CA PROC 189 41.378 79.43122.922 1.00 75.67 ATOM 4784 CB PROC 189 41.921 79.28321.502 1.00 75.82 ATOM 4785 CG PROC 189 43.328 78.85821.747 1.00 77.27 ATOM 4786 C PROC 189 39.835 79.46822.927 1.00 73.97 40 ATOM 4787 0 PROC 189 39.233 80.40323.459 1.00 73.90 ATOM 4788 N GLUC 190 39.201 78.46522.317 1.00 71.85 ATOM 4789 CA GLUC 190 37.734 78.40422.246 1.00 68.61 ATOM 4790 CB GLUC 190 37.305 77.49721.099 1.00 70.45 ATOM 4791 CG GLUC 190 38.27'7 77.43419.945 1.00 72.05 ATOM 4792 CD GLUC 190 38.082 78.55418.969 1.00 73.59 ATOM 4793 OE1 GLUC 190 36.908 78.87618.657 1.00 73.46 ATOM 4794 OE2 GLUC 190 39.106 79.10018.504 1.00 77.52 ATOM 4795 C GLUC 190 37.084 77.88923.528 1.00 64.48 ATOM 4796 O GLUC 190 37.762 77.59624.501 1.00 64.47 ATOM 4797 N ALAC 191 35.764 77.76523.514 1.00 60.72 ATOM 4798 CA ALAC 191 35.035 77.28124.679 1.00 60.54 ATOM 4799 CB ALAC 191 33.755 78.0752,4.8541.00 59.52 ATOM 4800 C ALAC 191 34.702 75.79624.554 1.00 60.66 ATOM 4801 0 ALAC 191 34.423 75.30623.458 1.00 60.77 55 ATOM 4802 N TYRC 192 34.717 75.08025.675 1.00 58.74 ATOM 4803 CA TYRC 192 34.409 73.65325.659 1.00 57.24 ATOM 4804 CB TYRC 192 35.621 72.82626.109 1.00 55.18 ATOM 4805 CG TYRC 192 36.737 72.82525.097 1.00 55.96 ATOM 4806 CD1 TYRC 192 37.694 73.84225.075 1.00 56.31 ATOM 4807 CE1 TYRC 192 38.680 73.88724.092 1.00 56.74 ATOM 4808 CD2 TYRC 192 36.800 71.84424.109 1.00 56.77 -is1 ATOM 4809 CE2 TYRC 192 37.785 71.87423.121 1.00 57.49 ATOM 4810 CZ TYRC 192 38.720 72.89823.119 1.00 58.13 ATOM 4811 OH TYRC 192 39.689 72.91822.148 1.00 58.55 ATOM 4812 C TYRC 192 33.204 73.29526.508 1.00 57.26 'rJATOM 4813 0 TYRC 192 33.292 73.24127.736 1.00 57.40 ATOM 4814 N GLUC 193 32.084 73.04225.836 1.00 57.28 ATOM 4815 CA GLUC 193 30.839 72.67826.506 1.00 58.77 ATOM 4:816CB GLUC 193 29.681 72.59725.495 1.00 59.02 ATOM 9:817CG GLUC 193 29.342 73.91224.823 1.00 61.64 1~ ATOM 9:818CD GLUC 193 28.118 73.82723.945 1.00 63.79 ATOM 4819 OE1 GLUC 193 27.107 73.24224.411 1.00 66.05 ATOM 9:820OE2 GLUC 193 28.171 74.35522.805 1.00 63.82 ATOM 4821 C GLUC 193 30.968 71.33627.224 1.00 58.56 ATOM 4822 0 GLUC 193 31.749 70.47126.811 1.00 58.35 15 ATOM 9:823N ASPC 194 30.197 71.17128.296 1.00 57.04 ATOM 4824 CA ASPC 194 30.215 69.94029.059 1.00 57.30 ATOM 4825 CB ASPC 194 31.473 69.84929.932 1.00 58.11 ATOM 4826 CG ASPC 194 31.430 70.77731.141 1.00 58.91 ATOM 4827 OD1 ASPC 194 32.220 71.74231.172 1.00 57.40 ATOM 4828 OD2 ASPC 194 30.614 70.53832.060 1.00 58.46 ATOM 4829 C ASPC 194 28.982 69.84829.933 1.00 56.78 ATOM 4830 0 ASPC 194 28.411. 70.86430.320 1.00 56.90 ATOM 4831 N VALC 195 28.567 68.61930.223 1.00 55.47 ATOM 4832 CA VALC 195 27.404 68.37331.061 1.00 55.52 25 ATOM 4833 CB VALC 195 26.538 67.23630.504 1.00 54.50 ATOM 4834 CG1 VALC 195 25.469 66.84131.511 1.00 52.44 ATOM 4835 CG2 VALC 195 25.914 67.67129.199 1.00 55.96 ATOM 4836 C VALC 195 27.874 67.97332.444 1.00 56.12 ATOM 4837 0 VALC 195 28.661 67.04632.602 1.00 56.74 ATOM 4838 N GLUC 196 27.388 68.67533.451 1.00 56.91 ATOM 4839 CA GL~UC 196 27.777 68.37034.816 1.00 57.46 ATOM X840 CB GLUC 196 28.051 69.65435.581 1.00 58.09 ATOM 4841 CG GL~UC 196 28.548 69.44536.972 1.00 59.59 ATOM 4842 CD GLUC 196 28.730 70.75837.700 1.00 62.33 35 ATOM 4843 OE1 GLUC 196 29.523 71.59437.229 1.00 62.53 ATOM 4844 OE2 GL~UC 196 28.074 70.95838.746 1.00 65.85 ATOM 4845 C GLUC 196 26.636 67.62735.453 1.00 57.05 ATOM 4846 0 GLUC 196 25.517 68.12035.487 1.00 59.06 ATOM 4847 N VALC 197 26.914 66.42735.938 1.00 56.46 ATOM 4848 CA VALC 197 25.889 65.61236.566 1.00 55.58 ATOM 4849 CB VALC 197 25.867 64.17935.984 1.00 53.38 ATOM 4850 CG1 VALC 197 24.777 63.36036.649 1.00 50.20 ATOM 4851 CG2 VALC 197 25.629 64.23934.486 1.00 51.56 ATOM 4852 C VALC 197 26.199 65.54638.041 1.00 56.50 45 ATOM 4853 0 VALC 197 27.320 65.20738.430 1.00 58.31 ATOM 4854 N SE;RC 198 25.214 65.88538.866 1.00 57.35 ATOM 4855 CA SERC 198 25.407 65.85740.309 1.00 57.08 ATOM 4856 CB SERC 198 24.867 67.13740.943 1.00 56.30 ATOM 4857 OG SE;RC 198 25.661 68.24640.565 1.00 55.97 ATOM 4858 C SE:RC 198 24.717 64.64340.886 1.00 57.36 ATOM 4859 0 SERC 198 23.513 64.46040.731 1.00 58.49 ATOM 4860 N LEUC 199 25.494 63.79141.531 1.00 57.83 ATOM 4861 CA LE;UC 199 24.938 62.59442.120 1.00 57.20 ATOM 4862 CB LEUC 199 25.824 61.38341.834 1.00 56.00 55 ATOM 4863 CG LEUC 199 25.457 60.11042.606 1.00 56.43 ATOM 4864 CDl LE:UC 199 24.073 59.62742.211 1.00 53.65 ATOM 4865 CD2 LEUC 199 26.487 59.05042.325 1.00 55.64 ATOM 4866 C LEUC 199 24.818 62.78243.613 1.00 58.48 ATOM 4867 0 LEUC 199 25.819 62.73744.337 1.00 59.73 ATOM 4868 N ASNC 200 23.593 63.01244.070 1.00 58.64 ATOM 4869 CA ASNC 200 23.355 63.16845.489 1.00 58.44 ATOM 4870 CB ASNC 200 22.285 64.232 45.754 1.0060.17 ATOM 4871 CG ASNC 200 21.985 64.387 47.239 1.0062.50 ATOM 4872 OD1 ASNC 200 22.905 64.419 48.070 1.0064.15 ATOM 4873 ND2 ASNC 200 20.700 64.480 47.583 1.0061.21 ATOM 4874 C ASNC 200 22.898 61.801 45.988 1.0055.97 ATOM 4875 0 ASNC 200 21.821 61.316 45.627 1.0054.75 ATOM 4876 N PHEC 201 23.739 61.181 46.802 1.0053.51 ATOM 4877 CA PHEC 201 23.454 59.867 47.330 1.0053.54 ATOM 4878 CB PHEC 201 24.169 58.807 46.503 1.0050.74 1~ ATOM 4879 CG PHEC 201 25.663 58.820 46.677 1.0048.36 ATOM 4880 CD1 PHEC 201 26.312 57.763 47.309 1.0045.72 ATOM 4881 CD2 PHEC 201 26.413 59.912 46.252 1.0046.85 ATOM 4882 CE1 PHEC 201 27.689 57.794 47.521 1.0043.95 ATOM 4883 CE2 PHEC 201 27.782 59.955 46.457 1.0045.93 ATOM 4884 CZ PHEC 201 28.425 58.889 47.096 1.0044.09 ATOM 4885 C PHEC 201 23.979 59.812 48.749 1.0055.36 ATOM 4886 O PHEC 201 24.640 60.739 49.210 1.0053.66 ATOM 4887 N ARGC 202 23.698 58.702 49.425 1.0057.35 ATOM 4888 CA ARGC 202 24.140 58.511 50.792 1.0059.95 ATOM 4889 CB ARGC 202 23.192 59.224 51.744 1.0062.36 ATOM 4890 CG ARGC 202 21.844 58.529 51.789 1.0064.26 ATOM 4891 CD ARGC 202 20.831 59.278 52.610 1.0067.26 ATOM 4892 NE ARGC 202 19.555 58.567 52.620 1.0070.54 ATOM 4893 CZ ARGC 202 18.430 59.062 53.129 1.0069.46 ATOM 4894 NH1 ARGC 202 18.420 60.270 53.670 1.0069.25 ATOM 4895 NH2 ARGC 202 17.315 58.349 53.095 ~.0069.56 ATOM 4896 C ARGC 202 24.116 57.023 51.119 1.0060.80 ATOM 4897 0 ARGC 202 23.439 56.231 50.445 1.0060.45 ATOM 4898 N LYSC 203 24.860 56.651 52.158 1.0061.42 ATOM 4899 CA LYSC 203 24.886 55.270 52.603 1.0060.82 ATOM 4900 CB LYSC 203 25.931 55.088 53.703 1.0059.66 ATOM 4901 CG LYSC 203 25.988 53.688 54.258 1.0061.19 ATOM 4902 CD LYSC 203 26.955 53.617 55.404 1.0063.27 ATOM 9903 CE LYSC 203 27.036 52.209 55.947 1.0066.98 35 ATOM 4904 NZ LYSC 203 27.621 51.250 54.945 1.0068.80 ATOM 4905 C LYSC 203 23.477 55.037 53.157 1.0060.81 ATOM 4906 0 LYSC 203 22.878 55.942 53.735 1.0060.52 ATOM 4907 N LYSC 204 22.913 53.858 52.944 1.0060.36 ATOM 4908 CA LYSC 204 21.584 53.606 53.466 1.0060.22 ATOM 4909 CB LYSC 204 21.017 52.329 52.837 1.0058.64 ATOM 4910 CG LYSC 204 20.591 52.487 51.381 1.0055.82 ATOM 4911 CD LYSC 204 20.445 51.140 50.692 1.0051.95 ATOM 4912 CE LYSC 204 19.975 51.298 49.253 1.0052.70 ATOM 4913 NZ LYSC 204 19.967 50.027 48.458 1.0051.76 45 ATOM 4914 C LYSC 204 21.742 53.460 54.977 1.0062.01 ATOM 4915 0 LYSC 204 22.711 52.854 55.440 ~.0063.36 ATOM 4916 N GLYC 205 20.811 54.022 55.747 1.0062.55 ATOM 4917 CA GL~YC 205 20.898 53.921 57.202 _.0062.30 ATOM 4918 C GLYC 205 19.797 53.078 57.844 i.0061.75 ATOM 4919 OT1 GLYC 205 18.911 52.614 57.093 1.0060.18 ATOM 4920 OT2 GLYC 205 19.811. 52.879 59.092 1.0060.86 ATOM 4921 CB PHED 1 39.182 71.754 1.648 1.0071.47 ATOM 4922 CG PHED 1 40.239 71.385 0.623 1.0073.60 ATOM 4923 CD1 PHED 1 40.1.22 70.241 -0.169 1.0075.22 ATOM 4924 CD2 PHED 1 41.397 72.176 0.493 1.0073.83 ATOM 4925 CE1 PHED 1 41.141 69.886 -1.081 1.0075.00 ATOM 4926 CE2 PHED 1 42.418 71.835 -0.410 1.0073.07 ATOM 4927 CZ PHED 1 42.289 70.688 -1.199 1.0074.63 ATOM 4928 C PHED 1 37.071 70.999 2.658 1.0068.35 ATOM 4929 0 PHED 1 37.607 71.392 3.688 1.0069.33 ATOM 4930 N PHED 1 37.010 72.284 0.515 1.0069.08 ATOM 4931 CA PHE D 1 37.756 71.268 1.321 1.00 69.54 ATOM 4932 N ASP D 2 35.915 70.338 2.678 1.00 67.84 ATOM 4933 CA ASP D 2 35.253 70.061 3.967 1.00 66.03 ATOM 4934 CB ASP D 2 33.949 69.266 3.772 1.00 66.47 ATOM 4935 CG ASP D 2 34.138 68.032 2.928 1.00 68.89 ATOM 4936 OD1 ASP D 2 35.029 67.218 3.287 1.00 68.16 ATOM 4937 OD2 ASP D 2 33.396 67.886 1.912 1.00 70.47 ATOM 4938 C ASP D 2 36.181 69.310 4.933 1.00 64.63 ATOM 4939 0 ASP D 2 37.378 69.165 4.672 1.00 64.43 ATOM 4940 N ARG D 3 35.639 68.837 6.049 1.00 62.26 ATOM 4941 CA ARG D 3 36.461 68.128 7.029 1.00 60.44 ATOM 4942 CB ARG D 3 35.748 68.078 8.388 1.00 60.90 ATOM 4943 CG ARG D 3 36.068 69.254 9.302 1.00 60.80 ATOM 4944 CD ARG D 3 35.185 69.243 10.5321.00 65.18 ATOM 4945 NE ARG D 3 35.849 69.838 11.6961.00 66.90 ATOM 4946 CZ ARG D 3 36.028 71.141 11.8881.00 66.63 ATOM 4947 NH1 ARG D 3 35.591 72.031 11.0021.00 68.16 ATOM 4948 NH2 ARG D 3 36.664 71.553 12.9641.00 66.33 ATOM 4949 C ARG D 3 36.831 66.719 6.580 1.00 59.10 ATOM 4950 0 ARG D 3 37.938 66.252 6.845 1.00 57.28 ATOM 4951 N ALA D 4 35.909 66.050 5.891 1.00 56.67 ATOM 4952 CA ALA D 4 36.153 64.699 5.414 1.00 53.48 ATOM 4953 CB ALA D 4 34.938 64.175 4.706 1.00 52.26 ATOM 4954 C ALA D 4 37.347 64.696 4.479 1.00 53.39 ATOM 4955 0 ALA D 4 38.225 63.851 4.600 1.00 52.40 ATOM 4956 N ASP D 5 37.381 65.650 3.550 1.00 54.53 ATOM 4957 CA ASP D 5 38.489 65.756 2.602 1.00 55.71 ATOM 4958 CB ASP D 5 38.266 66.914 1.627 1.00 58.22 ATOM 4959 CG ASP D 5 36.938 66.810 0.881 1.00 61.46 ATOM 4960 OD1 ASP D 5 36.605 65.709 0.386 1.00 64.32 ATOM 4961 OD2 ASP D 5 36.227 67.832 0.773 1.00 63.22 ATOM 4962 C ASP D 5 39.816 65.970 3.326 1.00 54.28 ATOM 4963 O ASP D 5 40.844 65.440 2.914 1.00 52.86 ATOM 4964 N ILE D 6 39.787 66.735 4.410 1.00 52.53 ATOM 4965 CA ILE D 6 41.007 67.003 5.154 1.00 53.69 ATOM 4966 CB ILE D 6 40.813 68.128 6.191 1.00 55.79 ATOM 4967 CG2 ILE D 6 42.152 68.435 6.877 1.00 54.61 ATOM 4968 CG1 ILE D 6 40.266 69.385 5.499 1.00 55.83 ATOM 4969 CD1 ILE D 6 40.121 70.597 6.400 1.00 55.01 ATOM 4970 C ILE D 6 41.545 65.775 5.870 1.00 52.43 ATOM 4971 0 ILE D 6 42.711 65.420 5.709 1.00 52.78 ATOM 4972 N LEU D 7 40.701 65.134 6.666 1.00 51.01 ATOM 4973 CA LEU D 7 41.111 63.949 7.401 1.00 50.01 ATOM 4974 CB LEU D 7 39.962 63.459 8.276 1.00 47.85 ATOM 4975 CG LEU D 7 39.608 64.420 9.408 1.00 46.02 ATOM 4976 CD1 LEU D 7 38.267 64.084 10.0101.00 48.59 ATOM 4977 CD2 LEU D 7 40.687 64.356 10.4401.00 45.91 ATOM 4978 C LEU D 7 41.526 62.871 6.415 1.00 51.80 ATOM 4979 0 LEU D 7 42.507 62.154 &.631 1.00 52.35 ATOM 4980 N TYR D 8 40.788 62.781 5.315 1.00 52.55 ATOM 4981 CA TYR D 8 41.060 61.788 4.288 1.00 53.16 ATOM 4982 CB TYR D 8 40.047 61.936 3.159 1.00 54.45 ATOM 4983 CG TYR D 8 40.294 61.006 2.006 1.00 57.19 ATOM 4984 CD1 TYR D 8 40.030 59.646 2.120 1.00 57.12 ATOM 4985 CE1 TYR D 8 40.308 58.772 1.069 1.00 60.62 ATOM 4986 CD2 TYR D 8 40.841 61.481 0.810 1.00 58.57 ATOM 4987 CE2 TYR D 8 41.130 60.617 -0.2471.00 60.35 ATOM 4988 CZ TYR D 8 40.863 59.264 -0.1121.00 61.47 ATOM 4989 OH TYR D 8 41.162 58.403 -1.1491.00 62.53 ATOM 4990 C TYR D 8 42.483 61.905 3.735 1.00 53.38 ATOM 4991 0 TYR D 8 43.190 60.907 3.591 1.00 53.74 ATOM 4992 N ASND 9 42.900 63.1213.416 1.0053.53 ATOM 4993 CA ASND 9 44.238 63.3292.890 1.0055.79 ATOM 4994 CB ASND 9 44.451 64.8002.509 1.0059.06 ATOM 4995 CG ASND 9 43.588 65.2321.317 1.0063.96 ATOM 4996 OD1 ASND 9 42.912 64.4060.688 1.0067.47 ATOM 4997 ND2 ASND 9 43.612 66.5271.000 1.0065.39 ATOM 4998 C ASND 9 45.283 62.9013.907 1.0055.13 ATOM 4999 0 ASND 9 46.175 62.1173.593 1.0054.15 ATOM 5000 N ILED 10 45.167 63.4165.129 1.0055.13 1~ ATOM 5001 CA ILED 10 46.099 63.0776.195 1.0054.61 ATOM 5002 CB ILED 10 45.660 63.6937.534 1.0054.44 ATOM 5003 CG2 ILED 10 46.585 63.2188.651 1.0053.71 ATOM 5004 CG1 ILED 10 45.683 65.2227.435 1.0052.93 ATOM 5005 CD1 ILED 10 45.083 65.9168.605 1.0047.92 ATOM 5006 C ILED 10 46.177 61.5666.365 1.0056.15 ATOM 5007 0 ILED 10 47.258 60.9926.496 1.0057.11 ATOM 5008 N ARGD 11 45.018 60.9276.363 1.0056.48 ATOM 5009 CA ARGD 11 44.938 59.4946.512 1.0058.41 ATOM 5010 CB ARGD 11 43.478 59.0706.428 1.0063.58 ATOM 5011 CG ARGD 11 43.229 57.5856.631 1.0070.33 ATOM 5012 CD ARGD 11 43.398 57.2198.100 1.0079.03 ATOM 5013 NE ARGD 11 42.703 55.9808.448 1.0085.37 ATOM 5014 CZ ARGD 11 41.466 55.6858.037 1.0088.61 ATOM 5015 NH1 ARGD 11 40.795 56.5487.249 1.0089.11 25 ATOM 5016 NH2 ARGD 11 40.890 54.5458.434 1.0087.93 ATOM 5017 C ARGD 11 45.721 58.7785.425 1.0058.93 ATOM 5018 0 ARGD 11 46.497 57.8625.698 1.0058.85 ATOM 5019 N GLND 12 45.507 59.2114.186 1.0059.05 ATOM 5020 CA GLND 12 46.131 58.5963.024 1.0057.95 ATOM 5021 CB GLND 12 45.345 58.9581.780 1.0057.48 ATOM 5022 CG GLND 12 44.961 57.7670.955 1.0061.67 ATOM 5023 CD GLND 12 43.773 57.0691.525 1.0061.71 ATOM 5024 OE1 GLND 12 42.729 57.6851.698 1.0064.71 ATOM 5025 NE2 GLND 12 43.912 55.7841.831 1.0059.81 35 ATOM 5026 C GLND 12 47.589 58.9262.769 1.0057.99 ATOM 5027 O GL~ND 12 48.280 58.1692.097 1.0058.62 ATOM 5028 N THRD 13 48.070 60.0463.291 1.0057.97 ATOM 5029 CA THRD 13 49.452 60.4333.042 1.0058.22 ATOM 5030 CB THRD 13 49.520 61.8552.464 1.0056.90 ATOM 5031 OG1 THRD 13 48.907 62.7743.377 1.0053.15 ATOM 5032 CG2 THRD 13 48.808 61.9231.110 1.0056.04 ATOM 5033 C THRD 13 50.361. 60.3944.255 1.0060.59 ATOM 5034 0 THRD 13 51.589 60.4164.120 1.0061.33 ATOM 5035 N SERD 14 49.762 60.3355.440 1.0061.87 45 ATOM 5036 CA SERD 14 50.542 60.3326.669 1.0061.93 ATOM 5037 CB SERD 14 49.634 60.6137.863 1.0061.53 ATOM 5038 OG SERD 14 50.417 60.9628.988 1.0062.76 ATOM 5039 C SERD 14 51.323 59.0356.903 1.0061.38 ATOM 5040 0 SERD 14 50.922. 57.9506.467 1.0062.07 ATOM '_i041N ARGD 15 52.444 59.1757.596 1.0059.21 ATOM 'i042CA ARGD 15 53.317 58.0617.911 1.0058.97 ATOM 5043 CB ARGD 15 54.553 58.0877.011 1.0059.72 ATOM 5044 CG ARGD 15 54.219 57.9785.528 1.0062.38 ATOM 5045 CD ARGD 15 55.455 57.6084.738 1.0063.96 55 ATOM 5046 NE ARGD 15 56.013 56.3645.254 1.0066.53 ATOM _'i047CZ ARGD 15 57.207 55.8734.929 1.0066.36 ATOM 5048 NH1 ARGD 15 57.985 56.5284.080 1.0065.36 ATOM 5049 NH2 ARGD 15 57.623 54.7215.457 1.0067.99 ATOM 5050 C ARGD 15 53.724 58.1829.376 1.0057.69 60 ATOM 5051 0 ARGD 15 54.705 58.8599.715 1.0057.96 ATOM 5052 N PROD 16 52.967 57.51710.265 1.0055.24 ATOM 5053 CD PROD 16 51.785 56.700 9.935 1.0051.06 ATOM 5054 CA PROD 16 53.200 57.524 11.709 1.0051.86 ATOM 5055 CB PROD 16 52.104 56.602 12.236 1.0049.85 ATOM 5056 CG PROD 16 51.031 56.720 11.226 1.0051.02 ATOM 5057 C PROD 16 54.580 57.066 12.130 1.0049.97 ATOM 5058 0 PROD 16 55.034 57.387 13.220 1.0048.83 ATOM 5059 N ASPD 17 55.247 56.313 11.270 1.0050.05 ATOM 5060 CA ASPD 17 56.568 55.809 11.612 1.0053.82 ATOM 5061 CB ASPD 17 56.796 54.419 10.981 1.0057.43 1~ ATOM 5062 CG ASPD 17 55.979 53.320 11.666 1.0063.55 ATOM 5063 OD1 ASPD 17 55.728 53.431 12.892 1.0063.43 ATOM 5064 OD2 ASPD 17 55.598 52.330 10.985 1.0066.47 ATOM 5065 C ASPD 17 57.710 56.733 11.218 1.0052.72 ATOM 5066 0 ASPD 17 58.875 56.406 11.440 1.0054.00 15 ATOM 5067 N VALD 18 57.384 57.888 10.653 1.0050.54 ATOM 5068 CA VALD 18 58.418 58.808 10.209 1.0051.72 ATOM 5069 CB VALD 18 58.353 58.992 8.680 1.0052.70 ATOM 5070 CG1 VALD 18 59.487 59.869 8.209 1.0052.67 ATOM 5071 CG2 VALD 18 58.426 57.642 7.998 1.0053.16 ATOM 5072 C VALD 18 58.402 60.181 10.865 1.0051.90 ATOM 5073 0 VALD 18 57.463 60.955 10.716 1.0050.79 ATOM 5074 N ILED 19 59.475 60.473 11.586 1.0052.81 ATOM 5075 CA ILED 19 59.646 61.748 12.280 1.0054.09 ATOM 5076 CB ILED 19 60.960 61.699 13.116 1.0053.08 25 ATOM 5077 CG2 ILED 19 62.168 61.565 12.194 1.0053.31 ATOM 5078 CG1 ILED 19 61.074 62.919 14.027 1.0052.13 ATOM 5079 CD1 ILED 19 62.157 62.753 15.086 1.0049.47 ATOM 5080 C ILED 19 59.675 62.907 11.255 1.0056.58 ATOM 5081 0 ILED 19 60.436 62.877 10.274 1.0057.79 ATOM 5082 N PROD 20 58.833 63.936 11.464 1.0056.89 ATOM 5083 CD PROD 20 57.915 64.059 12.603 1.0056.43 ATOM 5084 CA PROD 20 58.725 65.113 10.587 1.0058.17 ATOM 5085 CB PROD 20 57.505 65.856 11.148 1.0057.33 ATOM 5086 CG PROD 20 56.812 64.848 12.009 1.0056.81 35 ATOM 5087 C PROD 20 59.985 66.004 10.585 1.0060.38 ATOM 5088 0 PROD 20 59.920 67.215 10.802 1.0057.93 ATOM 5089 N THRD 21 61.128 65.391 10.329 1.0064.41 ATOM 5090 CA THRD 21 62.392 66.106 10.320 1.0068.99 ATOM 5091 CB THRD 21 63.546 65.121 10.552 1.0068.83 ATOM 5092 OG1 THRD 21 63.899 65.152 11.939 1.0069.74 ATOM 5093 CG2 THRD 21 64.760 65.457 9.688 1.0069.49 ATOM 5094 C THRD 21 62.671 66.926 9.067 1.0073.81 ATOM 5095 0 THRD 21 62.480 66.457 7.936 1.0075.27 ATOM 5096 N GLND 22 63.130 68.157 9.285 1.0077.41 ATOM 5097 CA GLND 22 63.481 69.076 8.203 1.0081.17 ATOM 5098 CB GLND 22 62.791 70.416 8.428 1.0082.19 ATOM 5099 CG GLND 22 61.281 70.306 8.543 1.0084.72 ATOM 5100 CD GLND 22 60.689 71.416 9.409 1.0086.15 ATOM 5101 OE1 GLND 22 60.939 71.471 10.623 1.0085.03 ATOM 5102 NE2 GLND 22 59.901 72.309 8.789 1.0086.55 ATOM 5103 C GLND 22 65.001 69.262 8.233 1.0083.27 ATOM 5104 O GLND 22 65.538 69.912 9.147 1.0083.34 ATOM 5105 N ARGD 23 65.691 68.686 7.243 1.0085.66 ATOM 5106 CA ARGD 23 67.159 68.767 7.170 1.0087.34 55 ATOM 5107 CB ARGD 23 67.625 70.231 7.105 1.0088.19 ATOM 5108 CG ARGD 23 67.453 70.875 5.742 _.0089.83 ATOM 5109 CD ARGD 23 66.246 71.822 5.674 1.0092.72 ATOM 5110 NE ARGD 23 65.994 72.293 4.298 1.0095.59 ATOM 5111 CZ ARGD 23 66.904 72.868 3.497 1.0095.46 ATOM 5112 NH1 ARGD 23 68.158 73.068 3.914 1.0093.60 ATOM 5113 NH2 ARGD 23 66.555 73.226 2.257 1.0094.84 ATOM 5114 C ARGD 23 67.768 68.079 8.399 1.0087.43 ATOM 5115 0 ARGD 23 67.201 67.105 8.907 1.0088.35 ATOM 5116 N ASPD 24 68.912 68.570 8.875 1.0087.68 ATOM 5117 CA ASPD 24 69.538 67.975 10.055 1.0086.96 'rJATOM 5118 CB ASPD 24 71.041 68.283 10.123 1.0091.11 ATOM 5119 CG ASPD 24 71.627 68.719 8.780 1.0094.40 ATOM 5120 OD1 ASPD 24 71.599 67.908 7.806 1.0095.87 ATOM 5121 OD2 ASPD 24 72.121 69.881 8.712 1.0095.25 ATOM 5122 C ASPD 24 68.864 68.594 11.274 1.0085.02 1~ ATOM 5123 0 ASPD 24 69.279 68.347 12.414 1.0083.40 ATOM 5124 N ARGD 25 67.836 69.409 11.026 1.0082.95 ATOM 5125 CA ARGD 25 67.112 70.062 12.111 1.0081.58 ATOM 5126 CB ARGD 25 66.218 71.189 11.585 1.0083.67 ATOM 5127 CG ARGD 25 66.951 72.455 11.150 1.0088.52 ATOM 5128 CD ARGD 25 65.941 73.597 10.942 1.0092.65 ATOM 5129 NE ARGD 25 66.579 74.866 10.584 1.0096.29 ATOM 5130 CZ ARGD 25 65.928 76.024 10.463 1.0098.03 ATOM 5131 NH1 ARGD 25 64.608 76.073 10.673 1.0098.35 ATOM 5132 NH2 ARGD 25 66.597 77.136 10.142 1.0098.69 ATOM 5133 C ARGD 25 66.241 69.091 12.901 1.0078.66 ATOM 5134 O ARGD 25 65.480 68.303 12.325 1.0079.51 ATOM 5135 N PROD 26 66.353 69.127 14.237 1.0074.94 ATOM 5136 CD PROD 26 67.383 69.831 15.020 1.0073.76 ATOM 5137 CA PROD 26 65.562 68.252 15.101 1.0071.13 25 ATOM 5138 CB PROD 26 66.202 68.450 16.483 1.0071.49 ATOM 5139 CG PROD 26 67.608 68.884 16.165 1.0072.18 ATOM 5140 C PROD 26 64.115 68.738 15.095 1.0067.33 ATOM 5141 O PROD 26 63.834 69.874 14.713 1.0065.48 ATOM 5142 N VALD 27 63.198 67.870 15.510 1.0063.87 ATOM 5143 CA VALD 27 61.806 68.258 15.596 1.0058.65 ATOM 5144 CB VALD 27 60.849 67.036 15.494 1.0057.16 ATOM 5145 CG1 VALD 27 59.462 67.401 15.998 1.0054.11 ATOM 5146 CG2 VALD 27 60.755 66.579 14.052 1.0056.19 ATOM 5147 C VALD 27 61.705 68.896 16.968 1.0056.92 35 ATOM 5148 0 VALD 27 62.164 68.337 17.961 1.0055.97 ATOM 5149 N ALAD 28 61.136 70.088 1'7.0191.0056.42 ATOM 5150 CA ALAD 28 60.999 70.767 18.287 1.0055.56 ATOM 5151 CB ALAD 28 61.057 72.269 18.095 1.0055.33 ATOM 5152 C ALAD 28 59.688 70.371 18.923 1.0054.28 ATOM 5153 0 ALAD 28 58.617 70.741 18.440 1.0054.43 ATOM 5154 N VALD 29 59.800 69.603 20.006 1.0052.62 ATOM 5155 CA VALD 29 58.657 69.127 20.775 1.0050.60 ATOM 5156 CB VALD 29 58.715 67.599 21.016 1.0048.93 ATOM 5157 CG1 VALD 29 57.543 67.162 21.871 1.0046.20 45 ATOM 5158 CG2 VALD 29 58.718 66.868 19.692 1.0047.60 ATOM 5159 C VALD 29 58.652 69.805 22.131 1.0050.77 ATOM 5160 0 VALD 29 59.657 69.806 22.852 1.0051.59 ATOM 5161 N SERD 30 57.517 70.395 22.471 1.0050.31 ATOM 5162 CA SERD 30 57.373 71.049 23.754 1.0052.56 'rJ~ATOM 5163 CB SERD 30 56.794 72.449 23.575 1.0053.44 ATOM 5164 OG SERD 30 55.514 72.393 22.966 1.0056.80 ATOM 5165 C SERD 30 56.442 70.188 24.598 1.0053.29 ATOM 5166 0 SERD 30 55.397 69.746 24.126 1.0055.20 ATOM 5167 N VALD 31 56.845 69.947 25.841 1.0054.04 55 ATOM 5168 CA VALD 31 56.089 69.130 26.780 1.0056.25 ATOM 5169 CB VALD 31 56.911 67.898 27.241 1.0058.16 ATOM 5170 CG1 VALD 31 56.015 66.914 27.986 1.0056.17 ATOM 5171 CG2 VALD 31 57.573 67.234 26.043 1.0058.28 ATOM 5172 C VALD 31 55.753 69.947 28.015 1.0057.41 ATOM 5173 0 VALD 31 56.607 70.632 28.570 1.0058.01 ATOM 5174 N SERD 32 54.508 69.850 28.458 1.0059.19 ATOM 5175 CA SERD 32 54.062 70.59429.628 1.0059.47 ATOM 5176 CB SERD 32 53.467 71.93429.175 1.0060.04 ATOM 5177 OG SERD 32 52.892 72.64130.256 1.0062.30 ATOM 5178 C SERD 32 53.023 69.79930.433 1.0058.78 ATOM 5179 0 SERD 32 51.906 69.57229.966 1.0059.54 ATOM 5180 N LEUD 33 53.390 69.37931.638 1.0056.81 ATOM 5181 CA LEUD 33 52.468 68.62932.472 1.0056.85 ATOM 5182 CB LEUD 33 53.217 67.70233.426 1.0054.23 ATOM 5183 CG LEUD 33 54.192 66.72632.775 1.0055.08 1~ ATOM 5184 CD1 LEUD 33 54.665 65.70933.818 1.0053.15 ATOM 5185 CD2 LEUD 33 53.513 66.03431.614 1.0054.80 ATOM 5186 C LEUD 33 51.623 69.57233.291 1.0056.91 ATOM 5187 0 LEUD 33 52.136 70.54233.829 1.0059.29 ATOM 5188 N LYSD 34 50.327 69.29433.366 1.0056.10 15 ATOM 5189 CA LYSD 34 49.422 70.08934.171 1.0055.13 ATOM 5190 CB LYSD 34 48.311 70.69433.320 1.0058.38 ATOM 5191 CG LYSD 34 48.802 71.51932.146 1.0065.52 ATOM 5192 CD LYSD 34 49.581 72.76432.581 1.0069.06 ATOM 5193 CE LYSD 34 50.100 73.55931.364 1.0072.37 ATOM 5194 NZ LYSD 34 50.855 74.80131.747 1.0072.05 ATOM 5195 C LYSD 34 48.838 69.06535.118 1.0053.80 ATOM 5196 0 LYSD 34 48.123 68.16734.685 1.0055.04 ATOM 5197 N PHED 35 49.144 69.17336.405 1.0051.60 ATOM 5198 CA PHED 35 48.616 68.20037.346 1.0049.19 25 ATOM 5199 CB PHED 35 49.441 68.19938.616 1.0046.49 ATOM 5200 CG PHED 35 50.838 67.73338.393 1.0048.31 ATOM 5201 CD1 PHED 35 51.823 68.61737.964 1.0046.94 ATOM 5202 CD2 PHED 35 51.159 66.38738.530 1.0049.16 ATOM 5203 CE1 PHED 35 53.109 68.17037.668 1.0048.04 ATOM 5204 CE2 PHED 35 52.449 65.92538.235 1.0050.28 ATOM 5205 CZ PHED 35 53.424 66.81837.802 1.0048.13 ATOM 5206 C PHED 35 47.136 68.35237.642 1.0049.07 ATOM 5207 0 PHED 35 46.626 69.44937.869 1.0049.57 ATOM 5208 N ILED 36 46.451 67.21737.600 1.0047.68 35 ATOM 5209 CA ILED 36 45.030 67.15637.827 1.0044.72 ATOM 5210 CB ILED 36 44.352 66.33436.731 1.0043.48 ATOM 5211 CG2 ILED 36 42.850 66.36936.914 1.0041.45 ATOM 5212 CG1 ILED 36 44.752 66.87735.360 1.0043.86 ATOM 5213 CD1 ILED 36 44.398 68.32435.152 1.0046.64 4~ ATOM 5214 C ILED 36 44.719 66.52539.164 1.0044.81 ATOM 5215 O ILED 36 43.677 66.79839.743 1.0046.51 ATOM 5216 N ASND 37 45.612 65.67839.661 1.0042.08 ATOM 5217 CA ASND 37 45.363 65.03040.939 1.0042.31 ATOM 5218 CB ASND 37 44.117 64.14040.834 1.0041.66 45 ATOM 5219 CG ASND 37 43.392 63.99042.159 1.0043.88 ATOM 5220 OD1 ASND 37 44.015 63.78543.200 1.0043.62 ATOM 5221 ND2 ASND 37 42.068 64.08542.124 1.0038.41 ATOM 5222 C ASND 37 46.539 64.18641.426 1.0043.81 ATOM 5223 0 ASND 37 47.380 63.75240.640 1.0040.93 ATOM 5224 N ILED 38 46.588 63.97742.740 1.0043.93 ATOM 5225 CA ILED 38 47.612 63.16343.372 1.0044.58 ATOM 5226 CB ILED 38 48.496 64.01344.246 1.0042.93 ATOM 5227 CG2 ILED 38 49.473 63.14044.989 1.0039.88 ATOM 5228 CG1 ILED 38 49.220 65.02843.359 1.0043.19 55 ATOM 5229 CD1 ILED 38 49.944 66.11044.084 1.0044.94 ATOM 5230 C ILED 38 46.795 62.18344.190 1.0047.97 ATOM 5231 O ILED 38 46.169 62.56545.162 1.0050.60 ATOM 5232 N LEUD 39 46.802 60.91643.777 1.0050.68 ATOM 5233 CA LEUD 39 45.979 59.87444.388 1.0051.24 ATOM 5234 CB LEUD 39 45.489 58.94443.287 1.0051.95 ATOM 5235 CG LEUD 39 44.834 59.72342.141 1.0054.64 1$g ATOM 5236 CD1 LEUD 39 44.356 58.77741.068 1.00 53.53 ATOM 5237 CD2 LEUD 39 43.666 60.54242.696 1.00 53.70 ATOM 5238 C LEUD 39 46.520 59.04145.529 1.00 53.82 ATOM 5239 0 LEUD 39 45.793 58.75046.479 1.00 54.77 ATOM 5240 N GLUD 40 47.771 58.62045.437 1.00 54.21 ATOM 5241 CA GLUD 40 48.349 57.82546.507 1.00 56.24 ATOM 5242 CB GLUD 40 48.278 56.33946.204 i.00 58.19 ATOM 5243 CG GLUD 40 46.873 55.80146.103 1.00 65.00 ATOM 5244 CD GLUD 40 46.844 54.29145.938 1.00 68.23 1~ ATOM 5245 OEl GLUD 40 47.443 53.79144.955 1.00 70.63 ATOM 5246 OE2 GLUD 40 46.226 53.61146.789 1.00 68.96 ATOM 5247 C GLUD 40 49.785 58.19846.702 1.00 56.38 ATOM 5248 0 GLUD 40 50.541 58.35545.746 1.00 59.25 ATOM 5249 N VALD 41 50.162 58.34347.955 1.00 55.49 ATOM 5250 CA VALD 41 51.517 58.69548.273 1.00 54.71 ATOM 5251 CB VALD 41 51.590 60.14548.811 1.00 55.08 ATOM 5252 CG1 VALD 41 52.954 60.43149.361 1.00 55.65 ATOM 5253 CG2 VP.LD 41 51.273 61.12547.696 1.00 55.07 ATOM 5254 C VALD 41 52.003 57.71349.309 1.00 54.17 ATOM 5255 0 VALD 41 51.232 57.23950.136 1.00 53.51 ATOM 5256 N ASND 42 53.280 57.38149.233 1.00 54.90 ATOM 5257 CA ASND 42 53.880 56.47350.182 1.00 56.47 ATOM _'i258CB ASND 42 53.944 55.05649.612 1.00 55.97 ATOM 5259 CG ASND 42 54.306 54.02550.661 1.00 56.38 ATOM '_i260OD1 ASND 42 55.272 54.19151.408 1.00 55.15 ATOM ~i261ND2 ASND 42 53.536 52.94750.717 1.00 56.12 ATOM _'i262C ASND 42 55.278 57.02250.420 1.00 58.56 ATOM 5263 0 ASND 42 56.154 56.91249.567 1.00 58.83 ATOM '_i264N GLUD 43 55.474 57.63951.579 1.00 59.69 ATOM 5265 CA GI~UD 43 56.77'_ 58.20851.905 1.00 60.97 ATOM 'i266CB GLUD 43 56.640 59.19253.065 1.00 63.50 ATOM 'i267CG GLUD 43 57.921 59.95953.341 1.00 67.19 ATOM _'i268CD GLUD 43 57.725 61.12154.303 1.00 68.84 ATOM 5269 OE1 GLUD 43 58.743 61.73454.682 1.00 70.83 ATOM 5270 OE2 GLUD 43 56.568 61.42754.670 1.00 67.80 ATOM 5271 C GLUD 43 57.792 57.13452.246 1.00 59.80 ATOM '>2720 GLUD 43 58.993 57.35652.138 1.00 59.85 ATOM 5273 N ILED 44 57.301 55.96952.653 1.00 59.27 ATOM 5274 CA ILED 44 58.164 54.85853.006 1.00 59.05 ATOM 5275 CB II~ED 44 57.373 53.72353.681 1.00 59.62 ATOM 5276 CG2 II~ED 44 58.300 52.52753.945 1.00 59.50 ATOM 5277 CG1 II~ED 44 56.75' 54.21754.982 1.00 58.87 ATOM 5278 CD1 ILED 44 57.768 54.48456.073 1.00 60.45 ATOM 5279 C ILED 44 58.801 54.28651.751 1.00 59.04 ATOM 5280 0 ILED 44 60.001 54.02951.723 1.00 60.06 ATOM '5281N THRD 45 57.986 54.08050.719 1.00 57.12 ATOM 5282 CA THRD 45 58.46:1 53.51349.464 1.00 54.05 ATOM 5283 CB THRD 45 57.410 52.57648.857 1.00 52.43 ATOM 5284 OG1 THRD 45 56.204 53.30448.628 1.00 49.39 5~ ATOM 5285 CG2 THRD 45 57.128 51.42649.788 1.00 49.70 ATOM 5286 C THRD 45 58.833 54.55148.417 1.00 53.32 ATOM 5287 O THRD 45 59.427 54.21547.397 1.00 56.15 ATOM 5288 N ASND 46 58.493 55.80948.666 1.00 51.82 ATOM 5289 CA ASND 46 58.796 56.87447.723 1.00 51.33 ATOM 5290 CB ASND 46 60.305 57.02247.567 1.00 51.66 ATOM 5291 CG ASND 46 60.874 58.11748.434 1.00 52.73 ATOM 5292 OD1 ASND 46 62.057 58.10548.765 1.00 52.55 ATOM 5293 ND2 ASND 46 60.041 59.07848.793 1.00 50.90 ATOM 5294 C ASND 46 58.156 56.61846.360 1.00 50.97 ATOM 5295 0 ASND 46 58.820 56.66845.325 1.00 53.17 ATOM 5296 N GLUD 47 56.858 56.34846.371 1.00 48.99 ATOM 5297 CA GLUD 47 56.118 56.09145.155 1.00 48.91 ATOM 5298 CB GLUD 47 55.717 54.62745.105 1.00 46.66 ATOM 5299 CG GLUD 47 56.888 53.67845.006 1.00 47.02 ATOM 5300 CD GLUD 47 56.458 52.22745.018 1.00 49.64 'rJATOM 5301 OE1 GLUD 47 55.302 51.95644.644 1.00 48.30 ATOM 5302 OE2 GLUD 47 57.276 51.35745.391 1.00 51.88 ATOM 5303 C GLUD 47 54.888 56.99245.111 1.00 50.12 ATOM 5304 0 GLUD 47 54.222 57.20246.125 1.00 50.30 ATOM 5305 N VALD 48 54.591 57.53143.936 1.00 50.20 ATOM 5306 CA VALD 48 53.455 58.42343.793 1.00 52.05 ATOM 5307 CB VALD 48 53.925 59.86143.502 1.00 53.36 ATOM 5308 CG1 VALD 48 52.727 60.77843.352 1.00 56.39 ATOM 5309 CG2 VALD 48 54.801. 60.35244.620 1.00 54.18 ATOM 5310 C VALD 48 52.522 57.99542.673 1.00 51.50 15 ATOM 5311 0 VALD 48 52.962 57.55241.617 1.00 53.49 ATOM 5312 N ASPD 49 51.231 58.13742.910 1.00 49.46 ATOM 5313 CA ASPD 49 50.241. 57.77741.920 1.00 49.81 ATOM 5314 CB ASPD 49 49.241 56.81342.535 1.00 52.06 ATOM 5315 CG ASPD 49 48.447 56.08641.508 1.00 53.16 ATOM 5316 OD1 ASPD 49 48.086 56.71940.499 1.00 53.36 ATOM 5.317OD2 ASPD 49 48.176 54.88741.717 1.00 57.15 ATOM 5318 C ASPD 49 49.583 59.10541.580 1.00 49.01 ATOM 5319 0 ASPD 49 48.818 59.64642.373 1.00 48.57 ATOM 5320 N VALD 50 49.882 59.62440.394 1.00 48.09 25 ATOM 5.321CA VALD 50 49.380 60.92839.986 1.00 47.49 ATOM 5322 CB VALD 50 50.561 61.94639.980 1.00 49.68 ATOM 5323 CG1 VALD 50 51.428 61.73238.761 1.00 49.68 ATOM 5324 CG2 VALD 50 50.048 63.35640.017 1.00 54.48 ATOM 5325 C VALD 50 48.671 60.96638.630 1.00 44.84 ATOM 5.3260 VALD 50 48.885 60.10737.791 1.00 46.99 ATOM 5327 N VALD 51 47.816 61.97138.443 1.00 41.91 ATOM 5328 CA VALD 51 47.067 62.18637.204 1.00 40.48 ATOM 5329 CB VALD 51 45.560 62.22537.460 1.00 37.45 ATOM 5330 CG1 VALD 51 44.837 62.69736.213 1.00 39.17 35 ATOM 5331 CG2 VALD 51 45.070 60.86037.859 1.00 36.64 ATOM 5332 C VALD 51 47.479 63.53836.628 1.00 42.16 ATOM 5333 0 VALD 51 47.560 64.50837.359 1.00 46.47 ATOM 5334 N PHED 52 47.726 63.61735.328 1.00 40.72 ATOM 5335 CA PHED 52 48.144 64.87734.738 1.00 42.11 ATOM 5336 CB PHED 52 49.635 65.07234.984 1.00 41.64 ATOM 5337 CG PHED 52 50.491. 64.00734.362 1.00 42.87 ATOM 5338 CD1 PHED 52 50.887 64.09933.038 1.00 44.21 ATOM 5339 CD2 PHED 52 50.868 62.89135.088 1.00 42.70 ATOM 5340 CE1 PHED 52 51.642. 63.10032.447 1.00 42.06 45 ATOM 5341 CE2 PHED 52 51.624 61.88634.506 1.00 42.93 ATOM '1342CZ PHED 52 52.010 61.99033.185 1.00 41.42 ATOM ~i343C PHED 52 47.870 64.94033.241 1.00 44.00 ATOM _'13440 PHED 52 47.606 63.93132.610 1.00 46.55 ATOM '_1345N TR.PD 53 47.934 66.13332.673 1.00 43.89 ATOM 5346 CA TRPD 53 47.726 66.29431.253 1.00 44.08 ATOM 5347 CB TR.PD 53 46.919 67.53830.948 1.00 45.09 ATOM '_134$CG TRPD 53 45.537 67.47431.396 1.00 46.86 ATOM 5349 CD2 TRPD 53 44.596 68.54231.383 1.00 49.97 ATOM 5350 CE2 TRPD 53 43.372. 68.02431.855 1.00 50.77 55 ATOM '_1351CE3 TR.PD 53 44.666 69.89131.017 1.00 52.22 ATOM 5352 CD1 TR.PD 53 44.877 66.38331.863 1.00 47.58 ATOM 5353 NE1 TR.PD 53 43.571 66.70032.141 1.00 48.69 ATOM 5354 CZ2 TRPD 53 42.222 68.80831.973 1.00 52.23 ATOM 5355 C23 TRPD 53 43.521 70.67231.135 1.00 54.33 ATOM 5356 CH2 TR.PD 53 42.313 70.12631.610 1.00 53.10 ATOM 5357 C TRPD 53 49.085 66.45230.640 1.00 46.17 ATOM 5358 0 TRP D 53 49.803 67.384 30.9601.00 46.13 ATOM 5359 N GLN D 54 49.444 65.532 29.7601.00 49.02 ATOM 5360 CA GLN D 54 50.741 65.592 29.1121.00 48.49 ATOM 5361 CB GLN D 54 51.248 64.184 28.8091.00 48.38 ATOM 5362 CG GLN D 54 52.677 64.135 28.3171.00 50.78 ATOM 5363 CD GLN D 54 53.339 62.792 28.5831.00 52.08 ATOM 5364 OE1 GLN D 54 53.409 62.336 29.7211.00 52.24 ATOM 5365 NE2 GLN D 54 53.832 62.158 27.5321.00 53.79 ATOM 5366 C GLN D 54 50.560 66.408 27.8491.00 49.01 1~ ATOM 5367 0 GLN D 54 50.504 65.892 26.7351.00 48.80 ATOM 5368 N GLN D 55 50.441 67.708 28.0581.00 51.39 ATOM 5369 CA GLN D 55 50.256 68.665 26.9851.00 53.26 ATOM 5370 CB GLN D 55 49.964 70.022 27.6091.00 56.68 ATOM 5371 CG GLN D 55 49.913 71.176 26.6521.00 66.24 15 ATOM 5372 CD GLN D 55 49.355 72.406 27.3261.00 70.72 ATOM 5373 OE1 GLN D 55 49.611 72.637 28.5251.00 72.96 ATOM 5374 NE2 GLN D 55 48.584 73.210 26.5731.00 70.76 ATOM 5375 C GLN D 55 51.494 68.697 26.0921.00 51.66 ATOM 5376 0 GIN D 55 52.533 69.249 26.4571.00 52.73 ATOM 5377 N THR D 56 51.373 68.091 24.9201.00 48.75 ATOM 5378 CA THR D 56 52.485 68.005 23.9881.00 48.81 ATOM 5379 CB THR D 56 52.769 66.534 23.6171.00 48.35 ATOM 5380 OG1 THR D 56 52.793 65.733 24.8011.00 50.12 ATOM 5381 CG2 THR D 56 54.101 66.408 22.9251.00 47.54 25 ATOM 5382 C THR D 56 52.198 68.771 22.7091.00 48.92 ATOM 5383 O THR D 56 51.051 68.862 22.2751.00 50.82 ATOM 5384 N THR D 57 53.243 69.320 22.1011.00 48.36 ATOM 5385 CA THR D 57 53.080 70.069 20.8601.00 47.70 ATOM 5386 CB THR D 57 52.766 71.563 21.1261.00 47.89 ATOM 5387 OG1 THR D 57 51.521 71.679 21.8341.00 48.44 ATOM 5388 CG2 THR D 57 52.642 72.317 19.8261.00 47.29 ATOM .'5389C THR D 57 54.322 69.988 19.9951.00 47.52 ATOM 5390 0 THR D 57 55.446 69.954 20.4961.00 48.40 ATOM '5391N TRP D 58 54.113 69.928 18.6861.00 46.65 35 ATOM 5392 CA TRP D 58 55.221 69.883 17.7491.00 45.92 ATOM 5393 CB TRP D 58 55.890 68.501 17.7501.00 46.07 ATOM 5394 CG TRP D 58 55.055 67.379 17.1921.00 46.21 ATOM 5395 CD2 TRP D 58 54.099 66.585 17.9041.00 45.21 ATOM 5396 CE2 TRP D 58 53.51'7 65.702 16.9761.00 45.14 ATOM 5397 CE3 TRP D 58 53.675 66.537 19.2401.00 44.92 ATOM 5398 CD1 TRP D 58 55.018 66.952 15.9021.00 44.73 ATOM 5399 NE1 TRP D 58 54.097 65.945 15.7611.00 46.01 ATOM 5400 CZ2 TRP D 58 52.533 64.783 17.3361.00 46.24 ATOM 5401 C23 TRP D 58 52.696 65.618 19.5961.00 45.62 45 ATOM 5402 CH2 TRP D 58 52.138 64.755 18.6461.00 45.70 ATOM 5403 C TRP D 58 54.679 70.236 16.3861.00 47.55 ATOM 5404 0 TRP D 58 53.494 70.509 16.2371.00 46.55 ATOM 5405 N SER D 59 55.537 70.226 15.3811.00 51.25 ATOM !5406CA SER D 59 55.097 70.602 14.0511.00 54.98 ATOM '.5407CB SER D 59 55.688 71.974 13.7051.00 56.59 ATOM 5408 OG SER D 59 54.969 72.6,0 12.6591.00 61.93 ATOM 5409 C SER D 59 55.457 69.592 12.9671.00 55.53 ATOM 5410 0 SER D 59 56.587 69.119 12.8891.00 54.93 ATOM 5411 N ASP D 60 54.479 69.279 12.1261.00 57.49 55 ATOM 5412 CA ASP D 60 54.66() 68.338 11.0281.00 59.17 ATOM 5413 CB ASP D 60 53.898 67.046 11.3161.00 61.53 ATOM 5414 CG ASP D 60 54.141 65.967 10.2751.00 63.57 ATOM 5415 OD1 ASP D 60 54.465 66.300 9.120 1.00 64.52 ATOM 5416 OD2 ASP D 60 53.988 64.773 10.6111.00 64.89 ATOM 5417 C ASP D 60 54.067 69.020 9.811 1.00 60.52 ATOM 5418 0 ASP D 60 52.847 69.016 9.615 1.00 59.95 ATOM 5419 N ARGD 61 54.937 69.6098.995 1.00 62.50 ATOM 5420 CA ARGD 61 54.503 70.3347.800 1.00 64.61 ATOM 5421 CB ARGD 61 55.672 71.1377.205 1.00 67.57 ATOM 5422 CG ARGD 61 56.000 72.4687.909 1.00 73.40 'rJATOM 5423 CD ARGD 61 56.968 73.2837.037 1.00 81.08 ATOM 5424 NE ARGD 61 57.268 74.6357.537 1.00 86.56 ATOM 5425 CZ AR.GD 61 58.057 75.5226.910 1.00 87.41 ATOM 5426 NH1 ARGD 61 58.642 75.2105.749 1.00 87.01 ATOM 5427 NH2 ARGD 61 58.246 76.7317.433 1.00 87.16 1~ ATOM 5428 C ARGD 61 53.867 69.4766.703 1.00 64.15 ATOM 5429 0 ARGD 61 53.145 69.9985.844 1.00 63.51 ATOM 5430 N THRD 62 54.121. 68.1706.722 1.00 62.13 ATOM 5431 CA THRD 62 53.542 67.3035.704 1.00 61.28 ATOM 5432 CB THRD 62 54.171. 65.8865.716 1.00 62.74 ATOM 5433 OG1 THRD 62 53.809 65.2016.924 1.00 65.20 ATOM 5434 CG2 THRD 62 55.692. 65.9745.624 1.00 63.05 ATOM 51435C THRD 62 52.030 67.1845.911 1.00 60.41 ATOM 514360 THRD 62 51.313 66.6195.073 1.00 60.16 ATOM 5437 N LEUD 63 51.551 67.7317.025 1.00 59.01 ATOM 5438 CA LEUD 63 50.124 67.7057.356 1.00 57.25 ATOM 51439CB LEUD 63 49.932. 67.4838.860 1.00 55.13 ATOM 5440 CG LEUD 63 50.567 66.2429.489 1.00 54.37 ATOM 51441CD1 L&.UD 63 50.396 66.27710.997 1.00 51.58 ATOM 5442 CD2 LEUD 63 49.917 65.0028.903 1.00 55.32 25 ATOM 5443 C LEUD 63 49.446 69.0176.973 1.00 56.83 ATOM '14440 LEUD 63 48.228 69.0916.904 1.00 55.62 ATOM 5445 N ALAD 64 50.241 70.0526.730 1.00 56.52 ATOM Fi446CA ALAD 64 49.702 71.3626.388 1.00 56.94 ATOM 5447 CB ALAD 64 50.843 72.3516.196 1.00 56.75 ATOM 5448 C AI~AD 64 48.825 71.3365.147 1.00 57.08 ATOM 5449 0 ALAD 64 49.091. 70.5714.222 1.00 59.16 ATOM '_1450N TRPD 65 47.785 72.1745.138 1.00 56.39 ATOM '_1451CA TRPD 65 46.853 72.2864.008 1.00 57.81 ATOM 5452 CB TRPD 65 45.718 71.2794.183 1.00 52.06 35 ATOM '_1453CG TF:PD 65 44.662 71.7085.139 1.00 49.69 ATOM 5454 CD2 TRPD 65 44.574 71.3836.532 1.00 48.62 ATOM ~i455CE2 TRPD 65 43.386 71.9747.027 1.00 50.58 ATOM 5456 CE3 TRPD 65 45.379 70.6497.409 1.00 45.78 ATOM '_1457CD1 TRPD 65 43.563 72.4664.855 1.00 51.37 ATOM _'1458NEl TRPD 65 42.787 72.6315.985 1.00 51.62 ATOM 5459 CZ2 TRPD 65 42.987 71.8498.358 1.00 48.81 ATOM 5460 CZ3 TRPD 65 44.983 70.5258.731 1.00 45.33 ATOM ~i461CH2 TRPD 65 43.797 71.1229.193 1.00 48.88 ATOM _'1462C TRPD 65 46.2.81 73.7233.873 1.00 60.73 45 ATOM _'14630 TRPD 65 46.309 74.4934.839 1.00 61.78 ATOM _'1464N ASND 66 45.757 74.0812.692 1.00 63.62 ATOM _'1465CA ASND 66 45.198 75.4232.474 1.00 66.29 ATOM _'1466CB ASND 66 44.996 75.7020.975 1.00 67.13 ATOM _'1467CG ASND 66 44.462 77.1290.700 1.00 70.42 ATOM _'1468OD1 ASND 66 44.317 77.560-0.465 1.00 68.84 ATOM 5469 ND2 ASND 66 44.167 77.8661.780 1.00 71.49 ATOM 5470 C ASND 66 43.886 75.6763.221 1.00 67.74 ATOM 5471 0 ASND 66 42.823 75.2082.820 1.00 67.77 ATOM 5472 N SERD 67 43.982 76.4664.289 1.00 70.41 55 ATOM _'1473CA SE:RD 67 42.852 76.8105.156 1.00 72.51 ATOM 5474 CB SE:RD 67 43.363 77.0286.586 1.00 71.50 ATOM 5475 OG SERD 67 42.519 77.9117.324 1.00 70.60 ATOM 5476 C SE:RD 67 42.021 78.0254.763 1.00 74.90 ATOM 5477 0 SERD 67 41.148 78.4345.530 1.00 75.98 ATOM 5478 N SERD 68 42.272 78.6033.589 1.00 77.57 ATOM 5479 CA SERD 68 41.538 79.8053.157 1.00 79.08 ATOM 5480 CB SER D 68 41.991 80.243 1.761 1.00 78.86 ATOM 5481 OG SER D 68 41.612 79.297 0.776 1.00 79.93 ATOM 5482 C SER D 68 40.012 79.707 3.157 1.00 80.32 ATOM 5483 O SER D 68 39.328 80.655 3.552 1.00 81.34 ATOM 5484 N HIS D 69 39.471 78.578 2.711 1.00 80.85 ATOM 5485 CA HIS D 69 38.027 78.421 2.663 1.00 81.81 ATOM 5486 CB HIS D 69 37.562 78.625 1.239 1.00 84.77 ATOM 5487 CG HIS D 69 37.857 79.994 0.729 1.00 88.72 ATOM 5488 CD2 HIS D 69 38.776 80.436 -0.1661.00 89.11 1~ ATOM 5489 ND1 HIS D 69 37.226 81.117 1.227 1.00 88.96 ATOM 5490 CE1 HIS D 69 37.748 82.193 0.660 1.00 90.17 ATOM 5491 NE2 HIS D 69 38.691 81.809 -0.1881.00 89.66 ATOM 5492 C HIS D 69 37.607 77.066 3.176 1.00 81.57 ATOM 5493 0 HIS D 69 36.624 76.459 2.713 1.00 80.65 ATOM 5494 N SER D 70 38.362 76.606 4.162 1.00 80.66 ATOM 5495 CA SER D 70 38.110 75.319 4.770 1.00 79.33 ATOM 5496 CB SER D 70 38.813 74.240 3.941 1.00 79.59 ATOM 5497 OG SER D 70 40.110 74.675 3.550 1.00 79.40 ATOM 5498 C SER D 70 38.624 75.348 6.211 1.00 77.66 ATOM 5499 0 SER D 70 39.520 76.135 6.545 1.00 76.61 ATOM 5500 N PRO D 71 38.037 74.514 7.088 1.00 76.20 ATOM 5501 CD PRO D 71 36.862 73.660 6.801 1.00 76.18 ATOM 5502 CA PRO D 71 38.420 74.425 8.502 1.00 74.80 ATOM 5503 CB PRO D 71 37.788 73.101 8.935 1.00 75.09 25 ATOM 5504 CG PRO D 71 36.454 73.145 8.196 1.00 75.33 ATOM 5505 C PRO D 71 39.933 74.465 8.704 1.00 73.25 ATOM 5506 0 PRO D 71 40.685 73.855 7.939 1.00 73.92 ATOM 5507 N ASP D 72 40.369 75.180 9.738 1.00 71.15 ATOM 5508 CA ASP D 72 41.794 75.329 10.0331.00 69.88 ATOM 5509 CB ASP D 72 42.077 76.680 10.7211.00 74.59 ATOM 5510 CG ASP D 72 40.874 77.647 10.6911.00 79.11 ATOM 5511 OD1 ASP D 72 41.131 7$.882 10.7371.00 79.05 ATOM 5512 OD2 ASP D 72 39.692 77.190 10.6351.00 80.55 ATOM 5513 C ASP D 72 42.330 74.212 10.9231.00 67.26 35 ATOM 5514 0 ASP D 72 43.540 73.973 10.9751.00 66.51 ATOM 5515 N GLN D 73 41.421 73.556 11.6371.00 63.43 ATOM 5516 CA GLN D 73 41.75'0 72.462 12.5391.00 60.99 ATOM 5517 CB GLN D 73 41.653 72.909 13.9811.00 63.13 ATOM 5518 CG GLN D 73 42.774 73.723 14.5331.00 65.58 ATOM 5519 CD GLN D 73 42.460 74.099 15.9571.00 67.92 ATOM 5520 OE1 GLN D 73 41.413 74.692 16.2161.00 70.47 ATOM 5521 NE2 GLN D 73 43.338 73.737 16.8951.00 69.20 ATOM 5522 C G:~ND 73 40.810 71.287 12.3971.00 58.94 ATOM 5523 0 GLN D 73 39.639 71.445 12.0291.00 59.19 45 ATOM 5524 N VAL D 74 41.317 70.108 12.7371.00 56.36 ATOM 5525 CA VAL D 74 40.531 68.883 12.6981.00 52.71 ATOM 5526 CB VAL D 74 40.635 68.177 11.3291.00 51.38 ATOM 5527 CG1 VAL D 74 39.944 68.998 10.2601.00 48.73 ATOM 5528 CG2 VAL D 74 42..087 67.951 10.9731.00 48.36 ATOM 5529 C VAL D 74 41.089 67.959 13.7601.00 50.70 ATOM 5530 0 VAL D 74 42.240 68.108 14.1731.00 49.32 ATOM 5531 N SER D 75 40.264 67.023 14.2151.00 48.60 ATOM 5532 CA SER D 75 40.696 66.051 15.2061.00 46.92 ATOM 5533 CB SER D 75 39.55.5 65.729 16.1661.00 48.45 55 ATOM 5534 OG SER D 75 39.444 66.718 17.1681.00 48.28 ATOM 5535 C SER D 75 41.159 64.789 14.4871.00 44.70 ATOM 5536 0 SER D 75 40.397 64.143 13.7811.00 43.70 ATOM 5537 N VAL D 76 42.424 64.449 14.6751.00 44.00 ATOM 5538 CA VAL D 76 43.024 63.281 14.0391.00 43.43 ATOM 5539 CB VAL D 76 44.283 63.687 13.2641.00 44.79 ATOM 5540 CG1 VAL D 76 44.891 62.486 12.6041.00 43.63 ATOM 5541 CG2 VALD 76 43.943 64.74612.241 1.0042.10 ATOM 5542 C VA:LD 76 43.419 62.19315.034 1.0043.50 ATOM 5543 0 VALD 76 44.004 62.47216.078 1.0045.44 ATOM 5544 N PROD 77 43.102 60.92914.721 1.0042.76 ATOM 5545 CD PROD 77 42.235 60.40213.656 1.0041.52 ATOM 5546 CA PROD 77 43.472 59.86515.650 1.0041.41 ATOM 5547 CB PROD 77 42.856 58.62815.009 1.0042.36 ATOM 5548 CG PROD 77 41.674 59.16814.296 1.0040.67 ATOM 5549 C PROD 77 44.985 59.77415.749 1.0040.15 1~ ATOM 5550 0 PROD 77 45.687 59.92214.762 1.0039.02 ATOM 5551 N ILED 78 45.474 59.53716.954 1.0041.66 ATOM 5552 CA ILED 78 46.899 59.42117.217 1.0042.23 ATOM 5553 CB ILED 78 47.113 59.01918.687 1.0043.04 ATOM 5554 CG2 ILED 78 48.495 58.51818.924 1.0045.01 15 ATOM 5555 CG1 ILED 78 46.872 60.23619.555 1.0047.88 ATOM 5556 CD1 ILED 78 47.618 61.46119.057 1.0048.43 ATOM 5557 C ILED 78 47.591 58.43216.299 1.0042.53 ATOM 5558 0 ILED 78 48.717 58.64315.880 1.0044.25 ATOM 5559 N SERD 79 46.891 57.35815.979 1.0043.93 ATOM 5560 CA SERD 79 47.410 56.30215.127 1.0043.22 ATOM 5561 CB SERD 79 46.457 55.11015.185 1.0042.69 ATOM 5562 OG SERD 79 45.130 55.52314.910 1.0043.59 ATOM 5563 C SERD 79 47.661 56.69213.668 1.0042.26 ATOM 5564 0 SERD 79 48.319 55.95312.937 1.0041.56 ATOM 5565 N SERD 80 47.138 57.83513.243 1.0039.86 ATOM 5566 CA SERD 80 47.326 58.28211.871 1.0040.25 ATOM 5567 CB SERD 80 46.026 58.84011.307 1.0040.77 ATOM 5568 OG SERD 80 45.025 57.84511.259 1.0048.70 ATOM 5569 C SERD 80 48.413 59.34211.742 1.0041.01 ATOM 5570 0 SERD 80 48.658 59.84210.655 1.0041.05 ATOM 5571 N LEUD 81 49.067 59.67112.847 1.0039.67 ATOM 5572 CA LEUD 81 50.112 60.67812.844 1.0039.96 ATOM 5573 CB LEUD 81 49.703 61.88613.684 1.0040.31 ATOM 5574 CG LEUD 81 48.371 62.57113.448 1.0042.96 35 ATOM 5575 CD1 LEUD 81 48.019 63.42914.638 1.0041.75 ATOM 5576 CD2 LEUD 81 48.454 63.38212.191 1.0044.21 ATOM 5577 C LEUD 81 51.357 60.10913.472 1.0038.80 ATOM 5578 0 LEUD 81 51.303 59.07714.119 1.0039.28 ATOM 5579 N TRPD 82 52.478 60.79513.276 1.0037.55 ATOM 5580 CA TRPD 82 53.726 60.39813.891 1.0036.02 ATOM 5581 CB TRPD 82 54.927 60.98113.158 1.0039.06 ATOM 5582 CG TR.PD 82 56.206 60.89113.958 1.0040.02 ATOM 5583 CD2 TRPD 82 56.715 61.86414.887 1.0039.10 ATOM 5584 CE2 TR.PD 82 57.878 61.31815.463 1.0038.66 45 ATOM 5585 CE3 TRPD 82 56.294 63.14015.292 1.0038.90 ATOM '_.586CD1 TRPD 82 57.060 59.84014.007 1.0040.23 ATOM 5587 NE1 TRPD 82 58.065 60.08214.908 1.0040.21 ATOM 5588 CZ2 TRPD 82 58.630 61.99716.422 1.0036.80 ATOM 5589 CZ3 TF.PD 82 57.038 63.81216.247 1.0040.18 ATOM 5590 CH2 TRPD 82 58.195 63.23816.801 1.0038.54 ATOM ~i591C TRPD 82 53.606 61.06815.236 1.0035.47 ATOM 5592 0 TRPD 82 53.085 62.17215.339 1.0036.72 ATOM ~i593N VALD 83 54.078 60.40816.272 1.0034.62 ATOM ~i594CA VALD 83 53.996 60.98917.592 1.0036.17 55 ATOM 5595 CB VALD 83 52.827 60.34118.381 1.0035.89 ATOM 5596 CG1 VALD 83 52.906 60.67619.835 1.0038.30 ATOM 5597 CG2 VALD 83 51.507 60.84017.832 1.0035.92 ATOM '_i598C VALD 83 55.335 60.81018.312 1.0037.27 ATOM 5599 0 VALD 83 56.035 59.82118.113 1.0036.95 ATOM 5600 N PROD 84 55.727 61.79619.125 1.0035.49 ATOM 5601 CD PROD 84 55.073 63.09519.324 1.0037.20 16~
ATOM 5602 CA PROD 84 56.979 61.74019.873 1.00 36.59 ATOM 5603 CB PROD 84 56.933 63.02420.694 1.00 37.18 ATOM 5604 CG PROD 84 56.196 63.93019.835 1.00 36.05 ATOM 5605 C PROD 84 57.034 60.50220.759 1.00 35.92 ATOM 5606 0 PROD 84 56.070 60.19721.449 1.00 34.78 ATOM 5607 N ASPD 85 58.167. 59.79820.749 1.00 33.98 ATOM 5608 CA ASPD 85 58.283 58.60921.565 1.00 34.25 ATOM 5609 CB ASPD 85 59.244 57.62220.925 1.00 35.35 ATOM 5610 CG ASPD 85 60.60() 58.20120.700 1.00 38.15 ATOM 'i611OD1 ASPD 85 60.645 59.37920.327 1.00 40.37 ATOM '_i612OD2 ASPD 85 61.612. 57.48620.870 1.00 36.29 ATOM 5613 C ASPD 85 58.740 58.96222.964 1.00 37.26 ATOM 5614 0 ASPD 85 59.737 58.44923.453 1.00 38.45 ATOM 5615 N LEUD 86 57.981 59.84023.609 1.00 35.72 ATOM Gi616CA LEUD 86 58.290 60.29424.956 1.00 37.34 ATOM 5617 CB LEUD 86 57.397 61.47125.325 1.00 35.58 ATOM 5618 CG LEUD 86 57.576 62.69024.434 1.00 36.77 ATOM '_i619CD1 LEUD 86 56.652 63.79924.877 1.00 32.58 ATOM 5620 CD2 LEUD 86 59.026 63.12724.496 1.00 36.92 ATOM 5621 C LEUD 86 58.112 59.20525.989 1.00 38.80 ATOM '_i6220 LEUD 86 57.250 58.33725.853 1.00 43.05 ATOM '_i623N ALAD 87 58.925 59.26327.033 1.00 38.29 ATOM 5624 CA ALAD 87 58.852 58.29128.103 1.00 38.34 ATOM 'i625CB ALAD 87 59.808 57.17427.827 1.00 37.03 25 ATOM 'i626C ALAD 87 59.202 58.96629.414 1.00 39.60 ATOM 'i6270 ALAD 87 60.087 59.79329.436 1.00 43.32 ATOM 5628 N ALAD 88 58.495 58.64430.492 1.00 39.86 ATOM 5629 CA ALAD 88 58.804 59.23431.786 1.00 39.70 ATOM 5630 CB AI~AD 88 57.572 59.29432.654 1.00 38.81 ATOM 5631 C ALAD 88 59.861 58.34732.418 1.00 41.02 ATOM 5632 0 ALAD 88 59.575 57.25932.894 1.00 42.74 ATOM 5633 N T1'RD 89 61.095 58.82632.400 1.00 42.88 ATOM 5634 CA TYRD 89 62.241 58.10132.931 1.00 44.50 ATOM 5635 CB TYRD 89 63.443 59.05033.031 1.00 46.85 35 ATOM 5636 CG TYRD 89 63.940 59.58331.709 1.00 50.97 ATOM 5637 CD1 TYRD 89 64.91() 60.57131.663 1.00 55.21 ATOM 5638 CE1 TYRD 89 65.384 61.06330.441 1.00 57.34 ATOM 5639 CD2 TYRD 89 63.452 59.09030.502 1.00 52.68 ATOM 5640 CE2 TYRD 89 63.916 59.56929.288 1.00 55.92 ATOM 5641 CZ TYRD 89 64.881 60.55729.260 1.00 57.40 ATOM 5642 OH TYRD 89 65.341 61.04128.048 1.00 61.62 ATOM 5643 C TYRD 89 62.044 57.40334.274 1.00 43.55 ATOM 5644 0 TYRD 89 62.618 56.34034.503 1.00 43.31 ATOM 5645 N ASND 90 61.261 57.99235.171 1.00 40.99 45 ATOM 5646 CA ASND 90 61.059 57.36836.470 1.00 40.89 ATOM 5647 CB ASND 90 61.459 58.32337.605 1.00 38.07 ATOM 5648 CG ASND 90 60.717 59.63937.561 1.00 38.20 ATOM 5649 OD1 ASND 90 60.602 60.27036.515 1.00 43.00 ATOM 5650 ND2 ASND 90 60.229 60.07138.707 1.00 36.31 ATOM 5651 C ASND 90 59.646 56.85136.669 1.00 41.76 ATOM 5652 0 ASND 90 59.170 56.70637.795 1.00 42.39 ATOM 5653 N ALAD 91 58.974 56.56835.562 1.00 42.04 ATOM 5654 CA ALAD 91 57.631 56.02335.630 1.00 42.57 ATOM 5655 CB ALAD 91 56.985 56.01034.260 1.00 42.26 55 ATOM 5656 C ALAD 91 57.820 54.60336.150 1.00 42.84 ATOM 5657 O ALAD 91 58.716 53.88235.717 1.00 41.70 ATOM 5658 N ILED 92 56.963 54.22237.084 1.00 44.08 ATOM 5659 CA ILED 92 57.012 52.93037.733 1.00 44.15 ATOM 5660 CB ILED 92 56.838 53.16639.239 1.00 48.04 ATOM 5661 CG2 ILED 92 55.423 52.86039.672 1.00 49.55 ATOM 5662 CG1 ILED 92 57.827 52.33740.032 1.00 51.37 ATOM 5663 CD1 ILE D 92 57.559 52.447 41.5441.00 57.95 ATOM 5664 C ILE D 92 55.921 51.998 37.1801.00 43.63 ATOM 5665 0 ILE D 92 55.867 50.816 37.5021.00 43.77 ATOM 5666 N SER D 93 55.051 52.546 36.3431.00 41.02 ATOM 5667 CA SER D 93 53.968 51.788 35.7331.00 39.43 ATOM 5668 CB SER D 93 52.673 51.994 36.4981.00 40.39 ATOM 5669 OG SER D 93 52.200 53.324 36.3201.00 40.98 ATOM 5670 C SER D 93 53.802 52.387 34.3661.00 39.82 ATOM 5671 0 SER D 93 54.349 53.452 34.1031.00 38.78 1~ ATOM 5672 N LYS D 94 53.063 51.727 33.4841.00 40.02 ATOM 5673 CA L'~SD 94 52.883 52.322 32.1731.00 42.68 ATOM 5674 CB LYS D 94 52.695 51.260 31.0811.00 42.12 ATOM 5675 CG LYS D 94 51.789 50.113 31.4051.00 45.31 ATOM 5676 CD LYS D 94 51.980 48.999 30.3781.00 48.12 15 ATOM 5677 CE LYS D 94 51.973 49.545 28.9571.00 49.66 ATOM 5678 NZ LYS D 94 52.092 48.466 27.9381.00 53.06 ATOM 5679 C LYS D 94 51.738 53.319 32.2051.00 42.30 ATOM 5680 0 LYS D 94 50.899 53.299 33.1041.00 42.15 ATOM 5681 N PRO D 95 51.707 54.230 31.2341.00 41.20 20 ATOM 5682 CD PRO D 95 52.637 54.379 30.1081.00 37.85 ATOM 5683 CA PRO D 95 50.655 55.243 31.1781.00 40.86 ATOM 5684 CB PRO D 95 51.064 56.117 29.9901.00 41.55 ATOM 5685 CG PRO D 95 52.512 55.834 29.8211.00 42.69 ATOM 5686 C PRO D 95 49.263 54.691 30.9811.00 39.96 25 ATOM 5687 0 PRO D 95 49.030 53.893 30.0801.00 39.70 ATOM 5688 N GLU D 96 48.344 55.113 31.8351.00 40.14 ATOM 5689 CA GLU D 96 46.961 54.718 31.6891.00 38.41 ATOM 5690 CB GLU D 96 46.321 54.399 33.0411.00 40.63 ATOM 5691 CG GLU D 96 44.880 53.856 32.9231.00 48.74 ATOM 5692 CD GLU D 96 44.232 53.503 34.2731.00 51.27 ATOM 5693 OE1 GLU D 96 44.983 53.350 35.2611.00 50.19 ATOM 5694 OE2 GLU D 96 42.979 53.360 34.3451.00 50.07 ATOM 5695 C GLU D 96 46.324 55.963 31.0841.00 37.34 ATOM 5696 0 GLU D 96 45.998 56.900 31.7991.00 36.63 35 ATOM 5697 N VAL D 97 46.199 55.988 29.7601.00 34.71 ATOM 5698 CA VAL D 97 45.599 57.120 29.0791.00 32.69 ATOM 5699 CB VAL D 97 45.881 57.066 27.5821.00 30.58 ATOM 5700 CG1 VAL D 97 45.289 58.260 26.8961.00 30.36 ATOM 5701 CG2 VAL D 97 47.361 57.037 27.3541.00 28.89 ATOM 5702 C VAL D 97 44.104 57.067 29.3451.00 34.47 ATOM 5703 0 VAL D 97 43.431 56.124 28.9621.00 35.88 ATOM 5704 N LEU D 98 43.597 58.091 30.0191.00 35.68 ATOM 5705 CA LEU D 98 42.190 58.174 30.4011.00 36.36 ATOM 5706 CB LEU D 98 42.071 58.943 31.7131.00 35.92 45 ATOM 5707 CG LEU D 98 42.941 58.547 32.8941.00 36.85 ATOM 5708 CD1 LEU D 98 42.906 59.639 33.9141.00 35.58 ATOM 5709 CD2 LEU D 98 42.456 57.261 33.4871.00 39.84 ATOM 5710 C LEU D 98 41.276 58.845 29.3861.00 38.24 ATOM 5711 O LEU D 98 40.055 58.850 29.5491.00 37.04 ATOM 5712 N THR D 99 41.862 59.409 28.3381.00 37.00 ATOM 5713 CA THR D 99 41.082 60.130 27.3441.00 36.28 ATOM 5714 CB THR D 99 41.449 61.644 27.3781.00 36.19 ATOM 5715 OG1 THR D 99 42.863 61.803 27.1771.00 38.29 ATOM 5716 CG2 THR D 99 41.075 62.248 28.7061.00 31.31 55 ATOM 5717 C THR D 99 41.224 59.629 2.5.9101.00 35.89 ATOM 5718 0 THR D 99 42.148 58.883 25.5881.00 35.45 ATOM 5719 N PRO D 100 40.281 60.026 25.0341.00 34.88 ATOM 5720 CD PRO D 100 39.043 60.761 25.3371.00 35.25 ATOM 5721 CA PRO D 100 40.303 59.630 23.6311.00 33.36 ATOM 5722 CB PRO D 100 39.217 60.492 23.0241.00 32.41 ATOM 5723 CG PRO D 100 38.223 60.527 24.0931.00 33.73 ATOM 5724 C PROD 100 41.666 59.955 23.0771.00 35.04 ATOM 5725 0 PROD 100 42.188 61.028 23.3101.00 36.02 ATOM 5726 N GLND 101 42.256 59.026 22.3501.00 38.56 ATOM 5727 CA GLND 101 43.574 59.280 21.8171.00 39.66 'rJATOM 'i728CB GLND 101 44.356 57.980 21.7491.00 38.98 ATOM 'i729CG GLND 101 44.890 57.613 23.1091.00 41.80 ATOM 5730 CD GLND 101 45.318 56.175 23.2011.00 46.38 ATOM 5731 OE1 GLND 101 46.158 55.714 22.4391.00 50.42 ATOM 5732 NE2 GLND 101 44.735 55.447 24.1431.00 49.13 1~ ATOM 'i733C GLND 101 43.543 59.994 20.4861.00 39.27 ATOM 5734 0 GLND 101 43.965 59.463 19.4631.00 38.19 ATOM 5735 N LEUD 102 43.037 61.224 20.5401.00 40.46 ATOM '.1736CA LEUD 102 42.910 62.103 19.3811.00 40.51 ATOM '.1737CB LEUD 102 41.467 62.590 19.2311.00 37.39 15 ATOM 5738 CG LEUD 102 40.382 61.515 19.1211.00 38.97 ATOM '.1739CD1 LEUD 102 39.030 62.182 18.9881.00 36.48 ATOM 5740 CD2 LEUD 102 40.657 60.628 17.9251.00 36.34 ATOM 5741 C LEUD 102 43.804 63.308 19.5541.00 41.42 ATOM 5742 0 LEUD 102 43.990 63.794 20.6651.00 43.09 ATOM 5743 N ALAD 103 44.375 63.777 18.4551.00 40.44 ATOM 5744 CA ALAD 103 45.221 64.953 18.4891.00 40.53 ATOM 5745 CB ALAD 103 46.549 64.673 17.8471.00 43.43 ATOM 5746 C ALAD 103 44.501) 66.050 17.7311.00 41.82 ATOM 5747 0 ALAD 103 43.503 65.803 17.0581.00 41.33 25 ATOM 5748 N ARGD 104 44.998 67.271 17.8491.00 42.58 ATOM 5749 CA ARGD 104 44.369 68.381 17.1651.00 43.20 ATOM 5750 CB ARGD 104 43.995 69.450 18.1831.00 43.57 ATOM 5751 CG ARGD 104 43.032 70.480 17.6781.00 40.98 ATOM 5752 CD ARGD 104 41.674 69.900 17.4251.00 39.96 ATOM 5753 NE ARGD 104 40.803 70.951 16.9091.00 41.32 ATOM 5754 CZ ARGD 104 39.517 70.802 16.6351.00 39.52 ATOM 5755 NH1 ARGD 104 38.927 69.633 16.8241.00 40.96 ATOM 5756 NH2 ARGD 104 38.826 71.832 16.1751.00 38.44 ATOM 5757 C ARGD 104 45.380 68.896 16.1621.00 43.89 35 ATOM 5758 0 ARGD 104 46.508 69.192 16.5261.00 44.97 ATOM 5759 N VALD 105 44.989 68.966 14.8941.00 44.88 ATOM 5760 CA VALD 105 45.910 69.427 13.8631.00 46.87 ATOM 5761 CB VALD 105 46.094 68.380 12.7511.00 44.91 ATOM 5762 CG1 VALD 105 47.165 68.838 11.7871.00 42.60 ATOM 5763 CG2 VaLD 105 46.469 67.050 13.3461.00 43.58 ATOM 5764 C VaLD 105 45.467 70.729 13.2231.00 48.29 ATOM 5765 0 VaLD 105 44.335 70.845 12.7311.00 47.85 ATOM 5766 N VALD 106 46.375 71.702 13.2381.00 48.47 ATOM 5767 CA VaLD 106 46.129 73.018 12.6631.00 50.73 45 ATOM 5768 CB VaLD 106 46.855 74.106 13.4721.00 50.55 ATOM 5769 CG1 VALD 106 46.392 75.477 13.0261.00 51.23 ATOM 5770 CG2 VALD 106 46.601 73.903 14.9511.00 48.01 ATOM 5771 C VALD 106 46.636 73.025 11.2161.00 51.91 ATOM 5772 0 VALD 106 47.664 72.420 10.9181.00 52.36 ATOM 5773 N SERD 107 45.920 73.712 10.3291.00 52.06 ATOM 5774 CA SERD 107 46.281 73.761 8.915 1.00 51.56 ATOM 5775 CB SERD 107 45.391 74.756 8.185 1.00 52.91 ATOM 5776 OG SERD 107 45.259 75.941 8.943 1.00 59.44 ATOM 5777 C SERD 107 47.726 74.058 8.591 1.00 50.83 55 ATOM 5778 0 SERD 107 48.188 73.739 7.511 1.00 50.82 ATOM 5779 N A:3PD 108 48.451 74.657 9.519 1.00 53.72 ATOM 5780 CA ASPD 108 49.853 74.978 9.262 1.00 57.12 ATOM 5781 CB ASPD 108 50.239 76.289 9.965 1.00 58.24 ATOM 5782 CG ASPD 108 50.271 76.163 11.4751.00 61.04 ATOM 5783 OD1 ASPD 108 49.396 75.459 12.0421.00 63.89 ATOM 5784 OD2 ASPD 108 51.162 76.782 12.0951.00 60.97 ATOM 5785 C ASP 50.827 73.870 9.665 1.0058.88 6 D

ATOM 5786 0 ASP 108 52.043 74.071 9.635 1.0061.62 8 D

ATOM 5787 N GLY 109 50.293 72.711 10.051 1.0058.94 7 D

ATOM 5788 CA GLY 109 51.134 71.589 10.437 1.0058.18 6 D

ATOM 5789 C GLY 109 51.424 71.483 11.918 1.0057.62 6 D

ATOM 5790 O GLY 109 52.186 70.612 12.343 1.0056.21 8 D

ATOM 5791 N GLU 110 50.831 72.370 12.707 1.0058.61 7 D

ATOM 5792 CA GLU 110 51.042 72.345 14.152 1.0059.21 6 D

ATOM 5'793CB GLt1 110 50.664 73.700 14.776 1.0062.41 6 D

1~ ATOM 5794 CG GLU 110 51.327 74.002 16.134 1.0066.58 6 D

ATOM 5'795CD GLU 110 52.852 74.104 16.041 1.0069.79 6 D

ATOM 5'796OE1GLiJ 110 53.375 74.340 14.921 1.0070.58 8 D

ATOM 5797 OE2GLtJ 110 53.527 73.963 17.089 1.0070.10 8 D

ATOM 5'798C GLU 110 50.158 71.232 14.712 1.0056.76 6 D

15 ATOM 5799 0 GLZJ 110 49.001 71.079 14.320 1.0054.86 8 D

ATOM 5800 N VAL 111 50.723 70.451 15.625 1.0055.23 7 D

ATOM 5801 CA VAL 111 50.013 69.333 16.236 1.0053.43 6 D

ATOM 5802 CB VAL 111 50.704 67.976 15.889 1.0053.47 6 D

ATOM 5803 CG1VA~ 111 49.934 66.821 16.500 1.0051.83 6 D

ATOM 5804 CG2VAL 111 50.798 67.803 14.382 1.0052.57 6 D

ATOM 5805 C VAL 111 49.962 69.470 17.754 1.0053.05 6 D

ATOM 5806 O VAL 111 50.972 69.747 18.400 1.0052.81 8 D

ATOM 5807 N LEU 112 48.783 69.269 18.323 1.0051.91 7 D

ATOM 5808 CA LEU 112 48.631 69.354 19.766 1.0051.71 6 D

25 ATOM 5809 CB LEU 112 47.776 70.566 20.155 1.0055.12 6 D

ATOM 5810 CG LEU 112 47.832 71.901 19.392 1.0055.82 6 D

ATOM 5811 CD1LEU 112 49.269 72.287 19.035 1.0056.65 6 D

ATOM 5812 CD2LEU 112 46.985 71.777 18.155 1.0055.54 6 D

ATOM 5813 C LEU 112 47.959 68.089 20.292 1.0051.46 6 D

30 ATOM 5814 0 LEU 112 46.833 67.769 19.900 1.0051.33 8 D

ATOM 5815 N TYR 113 48.659 67.365 21.162 1.0048.43 7 D

ATOM 5816 CA TYR 113 48.128 66.149 21.762 1.0045.71 6 D

ATOM 5817 CB TYR 113 48.941 64.928 21.318 1.0043.52 6 D

ATOM 5818 CG TYR 113 48.490 63.601 21.918 1.0041.37 6 D

35 ATOM 5819 CD1TYR 113 47.142 63.255 21.975 1.0039.60 6 D

ATOM 5820 CE1TYR 113 46.735 62.028 22.492 1.0038.43 6 D

ATOM 5821 CD2TYR 113 49.423 62.679 22.397 1.0040.11 6 D

ATOM 5822 CE2TYR 113 49.028 61.458 22.911 1.0039.17 6 D

ATOM '_i823CZ TYR 113 47.682 61.134 22.958 1.0040.31 6 D

ATOM 5824 OH TYR 113 47.283 59.921 23.470 1.0040.08 8 D

ATOM _'i825C TYR 113 48.218 66.325 23.262 1.0045.22 6 D

ATOM 5826 0 TYR 113 49.302. 66.442 23.812 1.0044.34 8 D

ATOM 5827 N MET 114 47.073 66.352 23.924 1.0047.16 7 D

ATOM 5828 CA MET 114 47.044 66.541 25.368 1.0048.56 6 D

45 ATOM '.1829CB MET 114 46.457 67.906 25.681 1.0053.17 6 D

ATOM 5830 CG MET 114 46.536 68.281 27.130 1.0058.47 6 D

ATOM 5831 SD MET 114 45.470 69.687 27.429 1.0064.86 16 D

ATOM 5832 CE MET 114 46.527 70.991 26.840 1.0063.87 6 D

ATOM 5833 C MET 114 46.214 65.472 26.062 1.0047.72 6 D

ATOM 5834 0 MET 114 45.060 65.705 26.424 1.0047.31 8 D

ATOM 5835 N PRO 115 46.790 64.279 26.251 1.0045.85 7 D

ATOM 5836 CD PRO 115 48.108 63.831 25.761 1.0045.44 6 D

ATOM 5837 CA PRO 115 46.080 63.184 26.903 1.0044.65 6 D

ATOM 5838 CB PRO 115 46.818 61.967 26.385 1.0046.29 6 D

55 ATOM 5839 CG PRO 115 48.231 62.454 26.372 1.0045.12 6 D

ATOM 5840 C PRO 46.159 63.283 28.416 1.00 6 D 44.40 ATOM 5841 0 PRO 47.145 63.787 28.954 1.00 8 D 43.35 ATOM 5842 N SER 45.124 62.811 29.102 1.00 7 D 42.71 ATOM 5843 CA SER 45.142 62.828 30.551 1.00 6 D 40.50 ATOM 5844 CB SER 43.752 62.976 31.110 1.00 6 D 37.94 ATOM 5845 OG SER 43.829 63.015 32.516 1.00 8 D 44.37 ATOM 5846 C SERD 116 45.712 61.48430.957 1.00 42.16 ATOM 5847 0 SERD 116 45.190 60.44830.569 1.00 45.67 ATOM 5848 N ILED 117 46.781 61.49331.739 1.00 39.79 ATOM 5849 CA ILED 117 47.409 60.25232.135 1.00 38.51 'rJATOM 5850 CB IL,ED 117 48.842 60.17931.565 1.00 38.14 ATOM 5851 CG2 ILED 117 49.545 58.93232.041 1.00 38.72 ATOM 5852 CG1 IL,ED 117 48.802 60.18830.045 1.00 37.23 ATOM 5853 CD1 ILED 117 50.137 60.45429.422 1.00 31.06 ATOM _'i854C ILED 117 47.506 60.00033.635 1.00 40.56 1~ ATOM 5855 0 ILED 117 47.838 60.89434.407 1.00 41.12 ATOM '_i856N ARGD 118 47.196 58.77334.042 1.00 40.57 ATOM 5857 CA ARGD 118 47.356 58.38635.429 1.00 39.48 ATOM 5858 CB ARGD 118 46.151 57.62335.966 1.00 37.31 ATOM '_i859CG ARGD 118 46.420 57.11937.377 1.00 36.74 15 ATOM 5860 CD ARGD 118 45.196 56.63838.101 1.00 36.75 ATOM _'i861NE ARGD 118 45.554 56.13139.414 1.00 36.89 ATOM 5862 CZ ARGD 118 44.687 55.83840.367 1.00 36.15 ATOM 5863 NH1 AKGD 118 43.396 56.00140.163 1.00 38.10 ATOM 5864 NH2 AF;GD 118 45.118 55.38141.523 1.00 35.81 ATOM 5865 C ARGD 118 48.581 57.46935.376 1.00 39.50 ATOM 5866 0 ARGD 118 48.661 56.57934.541 1.00 39.41 ATOM '_i867N GLND 119 49.541 57.67836.260 1.00 39.25 ATOM 'i868CA GLND 119 50.739 56.86536.222 1.00 40.77 ATOM 5869 CB GLND 119 51.588 57.35735.059 1.00 39.61 25 ATOM 5870 CG GLND 119 52.879 56.63834.807 1.00 39.00 ATOM 5871 CD GLND 119 53.483 57.03733.476 1.00 37.41 ATOM 5872 OE1 GLND 119 53.349 58.16933.043 1.00 42.14 ATOM 5873 NE2 GLND 119 54.154 56.11232.831 1.00 38.80 ATOM 5874 C GLND 119 51.491 56.96137.534 1.00 42.32 ATOM 5875 O GLND 119 51.421 57.96538.213 1.00 43.53 ATOM 5876 N ARGD 120 52.197 55.90837.906 1.00 43.85 ATOM 5877 CA ARGD 120 52.950 55.94439.149 1.00 47.43 ATOM '>878CB ARGD 120 52.819 54.63239.900 1.00 50.39 ATOM 5879 CG ARGD 120 51.389 54.27840.235 1.00 58.64 35 ATOM 5880 CD ARGD 120 51.352 53.44141.493 1.00 64.21 ATOM 5881 NE ARGD 120 51.38'7 54.24442.725 1.00 67.25 ATOM 5882 CZ ARGD 120 52.129 53.94243.790 1.00 65.70 ATOM 5883 NH1 ARGD 120 52.911 52.87043.763 1.00 64.48 ATOM 5884 NH2 ARGD 120 52.049 54.67844.895 1.00 62.69 ATOM '.885C ARGD 120 54.41:L 56.23138.913 1.00 46.83 ATOM 5886 0 ARGD 120 54.969 55.84837.885 1.00 46.53 ATOM '.887N PHED 121 55.032 56.91239.869 1.00 45.77 ATOM 5888 CA PHED 121 56.443 57.24939.743 1.00 45.26 ATOM 5889 CB PHED 121 56.627 58.73739.416 1.00 42.47 45 ATOM 5890 CG PHED 121 55.893 59.18638.199 1.00 41.19 ATOM 5891 CD1 PHED 121 54.546 59.48338.266 1.00 39.80 ATOM 5892 CD2 PHED 121 56.544 59.28436.979 1.00 39.10 ATOM 5893 CE1 PHED 121 53.855 59.87237.141 1.00 39.49 ATOM 5894 CE2 PHED 121 55.862 59.67035.858 1.00 37.48 'rJ0ATOM 5895 CZ PHED 121 54.512 59.96535.937 1.00 38.89 ATOM 5896 C PHED 121 57.256 56.94740.980 1.00 46.08 ATOM 5897 0 PHED 121 56.729 56.78342.077 1.00 43.10 ATOM 5898 N SERD 122 58.560 56.88140.769 1.00 48.75 ATOM 5899 CA SERD 122 59.520 56.67241.837 1.00 51.22 55 ATOM 5900 CB SERD 122 60.535 55.60441.442 1.00 51.58 ATOM 5901 OG SERD 122 61.510 55.45542.453 1.00 51.33 ATOM 5902 C SERD 122 60.224 58.02742.004 1.00 51.78 ATOM 5903 0 SERD 122 60.968 58.46041.123 1.00 50.44 ATOM 5904 N CYSD 123 59.965 58.69943.120 1.00 52.36 ATOM 5905 CA CYSD 123 60.564 59.99943.370 1.00 55.03 ATOM 5906 C CYSD 123 60.584 60.31444.860 1.00 57.50 ATOM 5907 0 CYS 123 60.131 59.51345.676 1.00 58.478 D

ATOM 5908 CB CYS 123 59.784 61.08342.631 1.00 54.896 D

ATOM 5909 SG CYS 123 58.043 61.14743.136 1.00 52.8816 D

ATOM 5910 N ASP D124 61.104 61.48745.218 1.00 58.857 ATOM 5911 CA ASP D124 61.196 61.86546.619 1.00 59.596 ATOM 5912 CB ASP D124 62.205 62.99446.816 1.00 60.386 ATOM 5913 CG ASP D124 62.876 62.93748.182 1.00 61.576 ATOM 5914 OD1 ASP D124 62.207 62.51949.151 1.00 60.878 ATOM 5915 OD2 ASP D124 64.067 63.30648.289 1.00 61.868 1~ ATOM 5916 C ASP D124 59.864 62.29447.198 1.00 59.726 ATOM 5917 0 ASP D124 59.310 63.32946.822 1.00 59.128 ATOM 5918 N VAL D125 59.366 61.49248.131 1.00 60.027 ATOM 5919 CA VAL D125 58.096 61.75848.795 1.00 61.006 ATOM 5820 CB VAL D125 57.274 60.46948.906 1.00 57.986 15 ATOM 5921 CG1 VAL D125 56.007 60.72149.664 1.00 56.316 ATOM 5922 CG2 VAL D125 56.973 59.94647.526 1.00 58.886 ATOM 5923 C VF.LD125 58.305 62.34650.199 1.00 63.486 ATOM 5924 0 VAL D125 57.391 62.95650.781 1.00 64.818 ATOM 5925 N SER D126 59.511 62.17750.738 1.00 64.057 ATOM 5926 CA SER D126 59.824 62.68452.072 1.00 64.036 ATOM Fi927CB SER D126 61.317 62.51752.362 1.00 63.156 ATOM 5928 OG SER D126 62.088 63.27751.455 1.00 61.248 ATOM 5929 C SER D126 59.426 64.14652.233 1.00 63.556 ATOM 5930 0 SER D126 59.745 64.98951.396 1.00 62.308 25 ATOM 5931 N GLY D127 58.716 64.43453.315 1.00 64.297 ATOM 'i932CA GLY D127 58.285 65.79453.564 1.00 67.206 ATOM '.1933C GLY D127 56.868 66.08553.115 1.00 68.646 ATOM 5934 O GLY D127 56.368 67.19053.321 1.00 69.558 ATOM 5935 N VAL D128 56.207 65.10352.510 1.00 70.107 ATOM 5936 CA VAL D128 54.845 65.32352.038 1.00 71.316 ATOM 5937 CB VAL D128 54.252 64.07751.378 1.00 69.986 ATOM 5938 CG1 VAL D128 54.87:3 63.85950.035 1.00 72.536 ATOM 5939 CG2 VAL D128 54.476 62.87752.271 1.00 70.166 ATOM 5940 C VAL D128 53.883 65.70753.136 1.00 71.706 35 ATOM 5941 0 VAL D128 53.089 66.63452.978 1.00 69.478 ATOM 5942 N ASP D129 53.960 64.99354.251 1.00 73.537 ATOM 5943 CA ASP D129 53.022 65.23355.320 1.00 77.216 ATOM 5944 CB ASP D129 53.1'71 64.19756.428 1.00 78.326 ATOM 5945 CG ASP D129 51.860 63.98557.204 1.00 80.246 4~ ATOM 5946 ODl ASP D129 51.521 62.80557.509 1.00 81.788 ATOM 5947 OD2 ASP D129 51.172 64.99657.504 1.00 78.078 ATOM 5948 C ASP D129 53.027 66.61855.915 1.00 79.336 ATOM 5949 0 ASP D129 52.082 66.96356.644 1.00 80.548 ATOM 5950 N THR D130 54.041 67.43355.604 1.00 80.137 ATOM 5951 CA THR D130 54.048 68.77956.171 1.00 80.396 ATOM 5952 CB THR D130 54.064 68.70257.716 1.00 83.746 ATOM 5953 OGl THR D130 54.418 67.35958.114 1.00 84.658 ATOM 5954 CG2 THR D130 52.670 69.13658.320 1.00 81.786 ATOM 5955 C THR D130 55.110 69.79455.795 1.OD 78.836 ATOM 5956 0 THR D130 56.241 69.44055.449 1.00 77.718 ATOM 5957 N GLU D131 54.701 71.06555.921 1.00 78.937 ATOM 5958 CA GLU D131 55.520 72.27255.705 1.00 78.306 ATOM 5959 CB GLU D131 56.825 72.16556.518 1.00 81.286 ATOM 5960 CG GLU D131 56.641 72.41058.024 1.00 83.846 55 ATOM 5961 CD GLU D131 57.696 71.71558.856 1.00 84.296 ATOM 5962 OE1 GLU D131 58.893 71.82158.485 1.00 85.148 ATOM 5963 OE2 GLU D131 57.321 71.06859.870 1.00 82.708 ATOM 5964 C GLU D131 55.869 72.67254.295 1.00 75.986 ATOM 5965 0 GLU D131 55.047 73.20553.552 1.00 74.518 ATOM 5966 N SER D132 57.136 72.45253.973 1.00 75.067 ATOM 5967 CA SER D132 57.689 72.73352.665 1.00 74.596 -17~
ATOM 5968 CB SERD 132 59.215 72.88252.788 1.00 75.96 ATOM 5969 OG SERD 132 59.812 71.73353.401 1.00 76.36 ATOM 5970 C SERD 132 57.316 71.55151.753 1.00 72.89 ATOM 5971 0 SERD 132 57.636 71.53050.563 1.00 73.06 'rJATOM 5972 N GLYD 133 56.630 70.57552.337 1.00 70.56 ATOM 5973 CA GLYD 133 56.203 69.40651.599 1.00 67.95 ATOM 5974 C GLYD 133 57.326 68.64750.917 1.00 66.74 ATOM 5975 0 GLYD 133 58.504 68.78451.257 1.00 65.57 ATOM 5976 N ALAD 134 56.950 67.83049.942 1.00 65.62 1~ ATOM 5977 CA ALAD 134 57.922 67.05249.194 1.00 63.00 ATOM 5978 CB ALAD 134 57.506 65.58649.145 1.00 62.05 ATOM 5979 C ALAD 134 58.060 67.59747.785 1.00 60.69 ATOM 5980 0 ALAD 134 57.215 68.35747.298 1.00 57.71 ATOM 5981 N THRD 135 59.149 67.20647.139 1.00 60.08 15 ATOM 5982 CA THRD 135 59.417 67.61945.777 1.00 59.14 ATOM 5983 CB THRD 135 60.585 68.59045.703 1.00 59.67 ATOM 5984 OG1 TI-IRD 135 60.291 69.73546.516 1.00 62.19 ATOM 5985 CG2 THRD 135 60.811 69.03144.263 1.00 57.77 ATOM 5986 C THRD 135 59.726 66.38744.963 1.00 57.95 ATOM _'19870 TIiRD 135 60.801 65.80445.065 1.00 56.51 ATOM _'1988N CH.'SD 136 58.740 65.99544.170 1.00 56.67 ATOM 5989 CA CYSD 136 58.825 64.83643.314 1.00 55.02 ATOM 5990 C CYSD 136 59.172 65.31041.906 1.00 55.53 ATOM 5991 0 CYSD 136 58.413 66.06041.282 1.00 53.64 25 ATOM 5992 CB CYSD 136 57.475 64.11543.347 1.00 55.35 ATOM 5993 SG CYSD 136 57.280 62.75642.175 1.00 52.04 ATOM '-1994N ARGD 137 60.331 64.88941.414 1.00 55.15 ATOM '.1995CA ARGD 137 60.752 65.29140.084 1.00 56.13 ATOM 5996 CB ARGD 137 62.233 65.66440.080 1.00 59.85 ATOM '1997CG ARGD 137 62.587 66.81840.993 1.00 64.22 ATOM 5998 CD ARGD 137 64.042 66.71841.445 1.00 67.87 ATOM '1999NE ARGD 137 64.261 67.42542.706 1.00 72.81 ATOM 6000 CZ ARGD 137 64.221 68.75342.848 1.00 76.15 ATOM 6001 NHl ARGD 137 63.975 69.54541.798 1.00 76.59 35 ATOM 6002 NH2 ARGD 137 64.408 69.29544.051 1.00 75.96 ATOM 6003 C ARGD 137 60.511 64.15639.112 1.00 54.79 ATOM 6004 0 ARGD 137 60.844 63.01139.394 1.00 55.64 ATOM 6005 N ILED 138 59.935 64.49837.966 1.00 52.46 ATOM 6006 CA ILED 138 59.618 63.55136.923 1.00 49.86 4~ ATOM E>007CB ILED 138 58.092 63.51636.686 1.00 47.60 ATOM Ei008CG2 ILED 138 57.769 62.56235.565 1.00 46.55 ATOM 6009 CG1 ILED 138 57.368 63.12037.975 1.00 44.38 ATOM (1010CD1 ILED 138 55.873 63.27437.903 1.00 39.29 ATOM 6011 C II~ED 138 60.30'7 64.00435.645 1.00 50.53 45 ATOM 6012 0 II~ED 138 60.056 65.10335.163 1.00 47.86 ATOM 6013 N LYSD 139 61.171 63.15835.093 1.00 52.17 ATOM t~014CA LYSD 139 61.881 63.49733.857 1.00 53.46 ATOM 6015 CB L'ISD 139 63.381 63.19533.988 1.00 54.96 ATOM 6016 CG LYSD 139 64.040 63.83835.187 1.00 59.06 ATOM 6017 CD LYSD 139 65.558 63.76135.119 1.00 60.55 ATOM 6018 CE LYSD 139 66.116 64.68534.044 1.00 62.84 ATOM 15019NZ LYSD 139 67.604 64.58433.930 1.00 64.96 ATOM 6020 C L'ISD 139 61.335 62.71532.667 1.00 52.45 ATOM 6021 0 LYSD 139 61.269 61.49332.708 1.00 52.48 55 ATOM 6022 N ILED 140 60.953 63.41131.604 1.00 51.17 ATOM 6023 CA ILED 140 60.453 62.72330.426 1.00 51.40 ATOM 6024 CB ILED 140 58.886 62.78130.369 1.00 52.71 ATOM 6025 CG2 ILED 140 58.303 62.47831.748 1.00 53.74 ATOM 6026 CGl ILED 140 58.387 64.17130.003 1.00 52.18 ATOM 6027 CD1 ILED 140 56.892 64.35430.322 1.00 51.22 ATOM 6028 C ILED 140 61.078 63.25129.123 1.00 50.75 ATOM 6029 0 ILED 140 61.189 64.451 28.918 1.0050.51 ATOM 6030 N GLYD 141 61.511 62.340 28.258 1.0048.91 ATOM 6031 CA GLYD 141 62.112 62.735 26.997 1.0048.03 ATOM 6032 C GLYD 141 62.036 61.611 25.983 1.0047.81 ATOM 6033 0 GLYD 141 61.636 60.511 26.340 1.0050.42 ATOM 6034 N SE:RD 142 62.405 61.865 24.729 1.0045.08 ATOM 6035 CA SERD 142 62.364 60.824 23.713 1.0042.21 ATOM 6036 CB SERD 142 62.872 61.334 22.376 1.0043.40 ATOM 6037 OG SERD 142 63.079 60.255 21.482 1.0043.21 1~ ATOM 6038 C SERD 142 63.194 59.630 24.126 1.0044.37 ATOM 6039 0 SERD 142 64.284 59.758 24.688 1.0045.99 ATOM 6040 N TRPD 143 62.673 58.452 23.825 1.0046.12 ATOM 6041 CA TRPD 143 63.338 57.222 24.196 1.0045.24 ATOM 6042 CB TRPD 143 62.300 56.121 24.425 1.0042.93 15 ATOM 6043 CG TRPD 143 62.872 54.893 25.051 1.0039.90 ATOM 6044 CD2 TRPD 143 63.244 54.737 26.418 1.0037.42 ATOM 6045 CE2 TRPD 143 63.740 53.425 26.567 1.0037.64 ATOM 6046 CE3 TRPD 143 63.204 55.581 27.536 1.0035.75 ATOM 6047 CD1 TRPD 143 63.154 53.702 24.436 1.0040.17 ATOM 6048 NE1 TRPD 143 63.676 52.817 25.341 1.0038.55 ATOM 6049 CZ2 TRPD 143 64.187 52.935 27.788 1.0038.02 ATOM 6050 CZ3 TRPD 143 63.647 55.100 28.741 1.0036.62 ATOM 6051 CH2 TRPD 143 64.133 53.784 28.863 1.0039.07 ATOM 6052 C TRPD 143 64.348 56.758 23.170 1.0046.24 25 ATOM 6053 0 TRPD 143 65.328 56.109 23.509 1.0048.11 ATOM 6054 N THRD 144 64.124 57.080 21.910 1.0045.62 ATOM 6055 CA THRD 144 65.047 56.616 20.894 1.0044.68 ATOM 6056 CB THRD 144 64.336 55.633 19.955 1.0044.87 ATOM 6057 OG1 THRD 144 63.155 56.242 19.421 1.0041.93 ATOM 6058 CG2 THRD 144 63.931 54.394 20.720 1.0044.03 ATOM 6059 C THRD 144 65.703 57.710 20.075 1.0046.21 ATOM 6060 0 THRD 144 66.662 57.452 19.366 1.0047.29 ATOM 6061 N HISD 145 65.198 58.931 20.173 1.0047.13 ATOM 6062 CA HISD 145 65.772 60.021 19.403 1.0050.18 35 ATOM 6063 CB HISD 145 64.672 60.793 18.679 1.0050.55 ATOM 6064 CG HISD 145 63.961 59.997 17.630 1.0052.45 ATOM 6065 CD2 HISD 145 64.369 59.558 16.416 1.0051.92 ATOM 6066 ND1 HISD 145 62.652 59.589 17.765 1.0050.59 ATOM 6067 CEl HISD 145 62.282 58.936 16.679 1.0051.27 ATOM 6068 NE2 HISD 145 63.305 58.902 15.844 1.0052.81 ATOM 6069 C HISD 145 66.611 60.990 20.241 1.0052.96 ATOM 6070 0 HISD 145 66.147 61.554 21.236 1.0051.74 ATOM 6071 N HISD 146 67.856 61.179 19.828 1.0053.81 ATOM 6072 CA HISD 146 68.748 62.081 20.532 1.0055.05 45 ATOM 6073 CB HISD 146 70.205 61.691 20.267 1.0053.71 ATOM 6074 CG HISD 146 70.555 61.617 18.816 1.0052.77 ATOM 6075 CD2 HISD 146 70.425 62.526 17.821 1.0053.89 ATOM 6076 ND1 HISD 146 71.083 60.487 18.236 x.0049.45 ATOM 6077 CE1 HISD 146 71.261 60.700 16.945 1.0049.76 ATOM 6078 NE2 HISD 146 70.869 61.929 16.667 1.0051.93 ATOM 6079 C HISD 146 68.489 63.521 20.094 1.0056.51 ATOM 6080 0 HISD 146 67.682 63.770 19.185 1.0058.53 ATOM 6081 N SERD 147 69.190 64.455 20.738 1.0057.97 ATOM 6082 CA SERD 147 69.054 65.902 20.497 1.0058.69 55 ATOM 6083 CB SERD 147 70.097 66.646 21.332 1.0058.36 ATOM 6084 OG SERD 147 71.365 66.032 21.179 1.0058.90 ATOM E~085C SERD 147 69.114 66.404 19.049 1.0057.67 ATOM 6086 0 SERD 147 68.570 67.470 18.727 1.0055.79 ATOM 6087 N ARGD 148 69:768 65.647 18.180 1.0057.54 ATOM 6088 CA ARGD 148 69.878 66.061 16.790 1.0059.37 ATOM 6089 CB AR.GD 148 71.054 65.340 16.126 1.0064.67 ATOM 6090 CG ARGD 148 72.382 65.49816.869 1.00 73.01 ATOM 6091 CD ARGD 148 73.494 64.62116.270 1.00 79.78 ATOM 6092 NE ARGD 148 74.652 64.49517.172 1.00 86.45 ATOM 6093 CZ ARGD 148 75.435 65.50817.558 1.00 88.85 'rJATOM 6094 NH1 ARGD 148 75.200 66.74917.126 1.00 90.23 ATOM 6095 NH2 ARGD 148 76.462 65.28418.381 1.00 89.74 ATOM 6096 C ARGD 148 68.603 65.79016.001 1.00 58.14 ATOM 6097 0 ARGD 148 68.406 66.35114.921 1.00 57.28 ATOM 6098 N GLUD 149 67.737 64.93216.546 1.00 58.44 1~ ATOM 6099 CA GLUD 149 66.488 64.55515.881 1.00 54.51 ATOM 6100 CB GLUD 149 66.394 63.03015.787 1.00 54.24 ATOM 6101 CG GLUD 149 67.744 62.38415.474 1.00 56.46 ATOM 6102 CD GLUD 149 67.687 60.88615.343 1.00 57.56 ATOM 6103 OE1 GLUD 149 67.015 60.22616.171 1.00 60.61 15 ATOM 6104 OE2 GLUD 149 68.336 60.36514.415 1.00 56.79 ATOM 6105 C GLUD 149 65.315 65.12316.638 1.00 51.56 ATOM 6106 0 GLUD 149 64.396 65.66716.050 1.00 48.50 ATOM 6107 N ILED 150 65.355 65.00217.954 1.00 51.48 ATOM 6108 CA ILED 150 64.284 65.53318.783 1.00 53.11 ATOM 6109 CB ILED 150 63.382 64.42419.410 1.00 55.50 ATOM 6110 CG2 ILED 150 62.530 65.01320.542 1.00 52.41 ATOM 6111 CG1 ILED 150 62.440 63.83018.352 1.00 55.09 ATOM 6112 CD1 ILED 150 61.549 62.72818.884 1.00 53.30 ATOM 6113 C ILED 150 64.841 66.33919.925 1.00 54.06 25 ATOM 6114 0 ILED 150 65.809 65.94420.573 1.00 49.46 ATOM 6115 N SERD 151 64.199 67.47420.162 1.00 55.80 ATOM 6116 CA SERD 151 64.570 68.36521.245 1.00 57.52 ATOM 6117 CB SERD 151 65.190 69.66020.688 1.00 59.00 ATOM 6118 OG SERD 151 64.256 70.40419.906 1.00 62.67 30 ATOM 6119 C SERD 151 63.269 68.66321.989 1.00 57.81 ATOM 6120 0 SERD 151 62.241 68.93221.373 1.00 55.28 ATOM 6121 N VALD 152 63.315 68.59223.312 1.00 59.48 ATOM 6122 CA VALD 152 62.142 68.85124.132 1.00 62.33 ATOM 6123 CB VALD 152 61.940 67.74225.188 1.00 63.11 35 ATOM 6124 CG1 VALD 152 61.945 66.37324.511 1.00 63.08 ATOM 6125 CG2 VALD 152 63.038 67.82126.259 1.00 61.64 ATOM 6126 C VALD 152 62.350 70.16724.854 1.00 63.67 ATOM 6127 0 VALD 152 63.478 70.49625.231 1.00 63.11 ATOM 6128 N ASPD 153 61.266 70.90925.070 1.00 65.73 ATOM 6129 CA ASPD 153 61.365 72.20625.740 1.00 68.62 ATOM 6130 CB ASPD 153 61.524 73.29624.680 1.00 70.73 ATOM 6131 CG ASPD 153 62.698 73.02323.733 1.00 74.59 ATOM 6132 OD1 ASPD 153 63.854 73.33224.118 i.00 73.93 ATOM 6133 OD2 ASPD 153 62.473 72.48322.612 1.00 76.61 45 ATOM 6134 C ASPD 153 60.144 72.51326.601 1.00 69.92 ATOM 6135 0 ASPD 153 59.022 72.17626.227 1.00 71.07 ATOM 6136 N PROD 154 60.345 73.13927.778 1.00 71.13 ATOM 6137 CD PR.OD 154 61.609 73.20728.536 1.00 70.02 ATOM 6138 CA PROD 154 59.199 73.47128.645 1.00 72.68 ATOM 6139 CB PROD 154 59.863 73.88229.955 1.00 71.74 ATOM 6140 CG PR.OD 154 61.135 73.06229.962 1.00 70.60 ATOM 6141 C PR.OD 154 58.374 74.60928.030 1.00 75.79 ATOM 6142 0 PR.OD 154 58.732 75.14026.983 1.00 76.11 ATOM 6143 N THRD 155 57.286 75.00128.686 1.00 80.37 55 ATOM 6144 CA THRD 155 56.419 76.06028.148 1.00 84.32 ATOM 6145 CB THRD 155 55.208 75.43627.393 1.00 84.09 ATOM 6146 OG1 THRD 155 54.342 74.78528.337 1.00 83.35 ATOM 6147 CG2 THRD 155 55.685 74.41226.360 1.00 83.23 ATOM 6148 C THRD 155 55.861 77.06829.184 1.00 88.09 ATOM 6149 O THRD 155 56.510 77.36630.211 1.00 88.59 ATOM 6150 N THRD 156 54.654 77.57828.886 1.00 91.07 ATOM 6151 CA THRD 156 53.911 78.55929.705 1.00 93.25 ATOM 6152 CB THRD 156 52.372 78.48329.424 1.00 94.48 ATOM 6153 OG1 THRD 156 52.115 78.68628.019 1.00 94.94 ATOM 6154 CG2 THRD 156 51.619 79.54630.255 1.00 93.74 ATOM 6155 C THRD 156 54.104 78.44531.220 1.00 94.44 ATOM 6156 0 THRD 156 53.471 77.61531.898 1.00 93.56 ATOM 6157 N GLUD 157 54.955 79.31431.750 1.00 96.79 ATOM 6158 CA GLUD 157 55.252 79.32033.183 1.00 99.37 ATOM 6159 CB GLUD 157 56.670 79.86533.416 1.00100.34 1~ ATOM 6160 CG GLUD 157 57.701 79.33332.426 1.00102.84 ATOM 6161 CD GLUD 157 59.086 79.95532.629 1.00104.89 ATOM 6162 OE1 GLUD 157 59.1.79 81.21332.700 1.00104.68 ATOM 6163 OE2 GLUD 157 60.085 79.18932.707 1.00105.54 ATOM 6164 C GL~UD 157 54.237 80.16533.967 1.00 99.49 15 ATOM Ei1650 GLUD 157 54.273 80.21635.210 1.00100.21 ATOM 6166 N ASND 158 53.336 80.82833.248 1.00 98.56 ATOM Ei167CA ASND 158 52.340 81.65733.911 1.00 98.16 ATOM 6168 CB ASND 158 51.632 82.55032.894 1.00100.26 ATOM Ei169CG ASND 158 52.610 83.37832.064 1.00102.10 ATOM 6170 OD1 ASND 158 53.425 84.15332.607 1.00101.77 ATOM Ei171ND2 ASND 158 52.533 83.22130.735 1.00102.21 ATOM Ei172C ASND 158 51.313 80.78634.613 1.00 96.52 ATOM 6173 0 ASND 158 51.475 80.45235.797 1.00 96.76 ATOM Ei174N SERD 159 50.257 80.44733.864 1.00 94.02 25 ATOM Ei175CA SERD 159 49.142. 79.59934.313 1.00 90.18 ATOM 6176 CB SERD 159 48.996 78.42233.331 1.00 90.25 ATOM Ei177OG SERD 159 50.277 77.93232.940 1.00 90.19 ATOM 6178 C SERD 159 49.254 79.07135.751 1.00 87.40 ATOM 6179 0 SERD 159 50.208 78.37236.094 1.00 87.99 ATOM 6180 N ASPD 160 48.282 79.40836.594 1.00 83.57 ATOM Ei181CA ASPD 160 48.300 78.94737.984 1.00 79.69 ATOM Ei182CB ASPD 160 46.950 79.18938.660 1.00 79.26 ATOM 6183 CG ASPD 160 46.902 78.63240.079 1.00 79.02 ATOM 6184 OD1 ASPD 160 45.785 78.38540.596 1.00 78.94 35 ATOM 6185 OD2 ASPD 160 47.987 78.44640.679 1.00 77.43 ATOM 6186 C ASPD 160 48.579 77.45337.995 1.00 77.55 ATOM 6187 0 ASPD 160 47.797 76.67037.429 1.00 77.70 ATOM Ei188N ASPD 161 49.676 77.06238.646 1.00 74.02 ATOM Ei189CA ASPD 161 50.070 75.65738.719 1.00 69.51 ATOM Ei190CB ASPD 161 51.277 75.46639.642 1.00 68.24 ATOM 6191 CG ASPD 161 52.556 76.00439.050 1.00 67.15 ATOM 6192 OD1 ASPD 161 52.734 75.88637.827 1.00 67.47 ATOM 6193 OD2 ASPD 161 53.397 76.53639.803 1.00 70.25 ATOM 6194 C ASPD 161 48.972 74.69739.147 1.00 67.31 45 ATOM 6195 0 ASPD 161 49.071 73.49738.890 1.00 68.61 ATOM ti196N SERD 162 47.924 75.19139.788 1.00 64.39 ATOM 6197 CA SERD 162 46.871 74.28040.210 1.00 63.54 ATOM 6198 CB SERD 162 46.897 74.09741.736 1.00 63.26 ATOM 6199 OG SERD 162 46.555 75.28642.417 1.00 65.64 ATOM 6200 C SERD 162 45.494 74.72239.761 1.00 62.73 ATOM 6201 0 SERD 162 44.490 74.43940.425 1.00 60.67 ATOM 6202 N GLUD 163 45.435 75.40038.620 1.00 63.28 ATOM 6203 CA GLUD 163 44.149 75.86138.139 1.00 66.60 ATOM 6204 CB GLUD 163 44.325 76.98437.105 1.00 69.72 55 ATOM 6205 CG GLUD 163 44.576 76.54635.681 1.00 72.12 ATOM 6206 CD GLUD 163 44.506 77.72034.698 1.00 74.42 ATOM 6207 OE1 GLUD 163 45.442 78.55734.703 1.00 75.59 ATOM 6208 OE2 GLUD 163 43.510 77.80833.932 1.00 73.89 ATOM 6209 C GLUD 163 43.310 74.71237.572 1.00 65.25 ATOM 6210 0 GLUD 163 42.126 74.88537.264 1.00 65.73 ATOM 6211 N TYRD 164 43.926 73.53937.448 1.00 64.10 ATOM 6212 CA TYRD 164 43.236 72.35336.946 1.0061.14 ATOM 6213 CB TYRD 164 43.901 71.82835.675 1.0062.34 ATOM 6214 CG TYRD 164 43.794 72.75634.501 1.0062.07 ATOM 6215 CD1 TYRD 164 44.937 73.26433.887 1.0062.29 ATOM 6216 CE1 TYRD 164 44.846 74.15232.813 1.0064.14 ATOM 6217 CD2 TYRD 164 42.547 73.15134.016 1.0063.36 ATOM 6218 CE2 TYRD 164 42.438 74.03832.940 1.0065.18 ATOM 6219 CZ TYRD 164 43.594 74.53632.337 1.0065.18 ATOM 6220 OH TYRD 164 43.495 75.38031.240 1.0065.32 1~ ATOM 6221 C TYRD 164 43.257 71.26338.000 1.0059.77 ATOM 6222 0 TYRD 164 42.602 70.2313'7.8531.0059.16 ATOM 6223 N PHED 165 44.008 71.49739.068 1.0057.70 ATOM 6224 CA PHED 165 44.113 70.51840.143 1.0056.00 ATOM 6225 CB PHED 165 45.105 70.98841.202 1.0053.27 15 ATOM 6226 CG PHED 165 45.635 69.88542.053 1.0051.93 ATOM 6227 CD1 PHED 165 46.436 68.89141.502 1.0050.62 ATOM 6228 CD2 PHED 165 45.326 69.82043.398 1.0052.41 ATOM 6229 CE1 PHED 165 46.922 67.84542.283 1.0049.13 ATOM 6230 CE2 PHED 165 45.807 68.77744.188 1.0052.20 ATOM 6231 CZ PHED 165 46.608 67.78843.624 1.0051.98 ATOM 6232 C PHED 165 42.773 70.24140.801 1.0055.90 ATOM 6233 0 PHED 165 41.970 71.14941.005 1.0056.82 ATOM 6234 N SERD 166 42.524 68.98041.126 1.0055.56 ATOM 6235 CA SERD 166 41.273 68.62741.771 1.0055.90 25 ATOM 6236 CB SERD 166 41.115 67.11741.887 1.0055.69 ATOM 6237 OG SERD 166 39.855 66.79942.457 1.0055.69 ATOM 6238 C SERD 166 41.280 69.22943.158 1.0056.73 ATOM 6239 0 SERD 166 42.315 69.22943.839 1.0056.74 ATOM 6240 N GLND 167 40.121 69.72943.578 1.0057.58 30 ATOM 6241 CA GLND 167 39.999 70.35344.892 1.0057.81 ATOM 6242 CB GLND 167 38.867 71.38344.885 1.0059.24 ATOM 6243 CG GLND 167 37.541 70.79444.439 1.0063.59 ATOM 6244 CD GLND 167 36.485 71.85444.107 1.0065.57 ATOM 6245 OE1 GLND 167 36.054 72.60744.979 1.0065.98 35 ATOM 6246 NE2 GLND 167 36.067 71.90942.831 1.0065.54 ATOM 6247 C GLND 167 39.752 69.32845.977 1.0056.65 ATOM 6248 O GLND 167 39.990 69.59847.151 1.0056.95 ATOM 6249 N TYRD 168 39.293 68.14545.586 1.0056.16 ATOM 6250 CA TYRD 168 39.014 67.09146.556 1.0053.65 ATOM 6251 CB TYRD 168 37.798 66.29746.096 1.0054.14 ATOM 6252 CG TYRD 168 36.675 67.2174.707 1.0053.82 ATOM 6253 CD1 TYRD 168 36.446 67.54544.371 1.0053.19 ATOM 6254 CE1 TYRD 168 35.445 68.45444.020 1.0054.20 ATOM 6255 CD2 TYRD 168 35.880 67.81646.681 1.0052.39 45 ATOM 6256 CE2 TYRD 168 34.881 68.72246.342 1.0052.03 ATOM 6257 CZ TYRD 168 34.670 69.03545.016 1.0053.04 ATOM 6258 OH TYRD 168 33.683 69.91744.689 1.0053.97 ATOM 6259 C TYRD 168 40.181 66.16246.851 1.0052.39 ATOM 6260 0 TYRD 168 40.025 65.18547.575 1.0053.02 5flATOM 6261 N SERD 169 41.347 66.47946.299 1.0051.48 ATOM 6262 CA SERD 169 42.543 65.68646.513 1.0051.84 ATOM 6263 CB SERD 169 43.664 66.15145.584 1.0052.14 ATOM 6264 OG SERD 169 44.878 65.48345.881 1.0050.95 ATOM 6265 C SERD 169 43.001 65.82847.953 1.0053.72 55 ATOM 6266 0 SERD 169 42.832 66.88048.570 1.0051.67 ATOM 6267 N ARGD 170 43.583 64.76148.487 1.0054.84 ATOM 6268 CA ARGD 170 44.079 64.77849.850 1.0054.97 ATOM 6269 CB ARGD 170 44.460 63.36650.297 1.0054.29 ATOM 6270 CG ARGD 170 43.369 62.64751.081 1.0057.60 ATOM 6271 CD ARGD 170 43.436 61.12450.955 1.0058.91 ATOM 6272 NE ARGD 170 44.726 60.54351.323 1.0061.45 ATOM 6273 CZ ARG D 170 45.504 59.853 50.4831.00 64.08 ATOM 6274 NH1ARG D 170 45.140 59.656 49.2201.00 60.98 ATOM 6275 NH2ARG D 170 46.649 59.334 50.9061.00 64.65 ATOM 6276 C ARG D 170 45.293 65.683 49.9281.00 56.57 ATOM 6277 0 ARG D 170 45.719 66.078 51.0221.00 59.46 ATOM 6278 N PHE D 171 45.842 66.033 48.7701.00 55.26 ATOM 6279 CA PHE D 171 47.034 66.864 48.7391.00 54.09 ATOM 6280 CB PHE D 171 48.1'72 66.094 48.0701.00 53.61 ATOM 6281 CG PHE D 171 48.319 64.688 48.5851.00 54.38 ATOM 6'82 CD1PHE D 171 47.427 63.698 48.1911.00 55.63 ATOM 6283 CD2PHE D 171 49.315 64.364 49.4981.00 54.14 ATOM 6284 CE1PHE D 171 47.521 62.415 48.6941.00 54.27 ATOM 6285 CE2PHE D 171 49.414 63.078 50.0081.00 54.92 ATOM 6286 CZ PHE D 171 48.516 62.103 49.6051.00 54.58 15 ATOM 6287 C PHE D 171 46.821 68.195 48.0491.00 53.25 ATOM 6288 0 PHE D 171 45.759 68.457 47.5001.00 52.23 ATOM 6'89 N GLU D 172 47.836 69.045 48.1001.00 52.75 ATOM 6290 CA GLtJD 172 47.741 70.347 47.4791.00 55.31 ATOM 6291 CB GL1JD 172 47.327 71.413 48.5051.00 58.80 ATOM 6292 CG GLU D 172 48.293 71.616 49.6861.00 62.32 ATOM 6293 CD GLTJD 172 47.773 72.633 50.6931.00 64.33 ATOM 6294 OE1GLU D 172 47.132 73.617 50.2511.00 64.06 ATOM 6295 OE2GLU D 172 48.012 72.456 51.9151.00 65.29 ATOM 6296 C GLU D 172 49.083 70.671 46.8611.00 56.32 25 ATOM 6297 0 GLU D 172 50.115 70.122 47.2651.00 54.59 ATOM 6298 N ILE D 173 49.063 71.550 45.8641.00 56.82 ATOM 6299 CA ILE D 173 50.286 71.928 45.1711.00 57.96 ATOM 6300 CB ILE D 173 50.062 72.033 43.6441.00 57.06 ATOM 6301 CG2ILE D 173 51.332 72.535 42.9591.00 56.84 ATOM 6302 CG1ILE D 173 49.663 70.675 43.0801.00 55.34 ATOM 6303 CDlILE D 173 49.371 70.720 41.6221.00 53.59 ATOM 6304 C ILE D 173 50.848 73.250 45.6531.00 59.20 ATOM 6305 0 ILE D 173 50.132 74.249 45.7561.00 58.03 ATOM 6306 N LEU D 174 52.140 73.251 45.9491.00 60.22 35 ATOM 6307 CA LEU D 174 52.784 74.473 46.3941.00 61.88 ATOM 6308 CB LEU D 174 53.929 74.136 47.3401.00 61.02 ATOM 6309 CG LEU D 174 53.512 73.196 48.4691.00 61.46 ATOM 6310 CD1LEU D 174 54.722 72.881 49.3301.00 62.06 ATOM 6311 CD2LEU D 174 52.395 73.823 49.2841.00 59.37 ATOM 6312 C LEU D 174 53.302 75.193 45.1511.00 63.17 ATOM 6313 0 LEU D 174 52.979 76.357 44.8991.00 63.68 ATOM 6314 N ASP D 175 54.080 74.479 44.3491.00 64.58 ATOM 6315 CA ASP D 175 54.627 75.067 43.1451.00 65.97 ATOM 6316 CB ASP D 175 55.789 75.993 43.5381.00 67.34 45 ATOM 6317 CG ASP D 175 56.390 76.748 42.3541.00 69.43 ATOM 6318 OD1ASP D 175 55.636 77.413 41.5841.00 69.68 ATOM 6319 OD2ASP D 175 57.635 76.685 42.2141.00 69.28 ATOM 6320 C ASP D 175 55.085 73.984 42.1641.00 66.38 ATOM 6321 0 ASP D 175 55.380 72.846 42.5611.00 66.58 ATOM 6322 N VAL D 176 55.118 74.342 40.8811.00 65.75 ATOM E~323 CA VAL D 176 55.536 73.436 39.8311.00 65.19 ATOM 6324 CB VAL D 176 54.330 72.945 38.9921.00 64.89 ATOM 6325 CGlVP.LD 176 54.818 72.085 37.8111.00 64.67 ATOM 6326 CG2VAL D 176 53.382 72.145 39.8651.00 65.95 55 ATOM E>327 C VAL D 176 56.477 74.190 38.9191.00 66.36 ATOM 6328 0 VAL D 176 56.178 75.314 38.5131.00 66.32 ATOM 6329 N THR D 177 57.614 73.576 38.6021.00 68.04 ATOM 6330 CA THR D 177 58.598 74.184 37.7081.00 69.05 ATOM 6331 CB THR D 177 59.763 74.819 38.4961.00 67.62 ATOM 6332 OG1THR D 177 60.349 73.843 39.3701.00 63.42 ATOM 6333 CG2THR D 177 59.258 76.013 39.3051.00 66.11 ATOM 6334 C THRD 177 59.165 73.144 36.739 1.0071.66 ATOM 6335 0 THRD 177 59.373 71.973 37.111 1.0073.56 ATOM 6336 N GLND 178 59.417 73.568 35.501 1.0071.95 ATOM 6337 CA GLND 178 59.941 72.667 34.488 1.0072.06 ATOM 6338 CB GLND 178 58.932 72.511 33.347 1.0074.14 ATOM 6339 CG GLND 178 57.466 72.700 33.754 1.0076.97 ATOM 6340 CD GLND 178 56.497 72.041 32.772 1.0078.22 ATOM 6341 OE1 GLND 178 56.603 72.230 31.551 1.0079.44 ATOM 6342 NE2 GLND 178 55.544 71.266 33.302 1.0076.76 1~ ATOM 6343 C GLND 178 61.219 73.240 33.936 1.0071.25 ATOM 6344 0 GLND 178 61.226 74.368 33.462 1.0071.24 ATOM 6345 N LYSD 179 62.291 72.461 33.979 1.0071.70 ATOM 6346 CA LYSD 179 63.593 72.904 33.474 1.0071.59 ATOM 6347 CB LYSD 179 64.553 73.170 34.642 1.0073.63 15 ATOM 6348 CG LYSD 179 63.906 73.953 35.800 1.0077.80 ATOM 6349 CD LYSD 179 64.795 74.018 37.040 1.0078.53 ATOM 6350 CE LYSD 179 64.016 74.470 38.273 1.0079.16 ATOM 6351 NZ LYSD 179 62.899 73.537 38.610 1.0077.90 ATOM 6352 C LYSD 179 64.173 71.807 32.601 1.0070.50 ATOM 6353 0 LYSD 179 64.549 70.754 33.112 1.0069.32 ATOM 6354 N LYSD 180 64.252 72.044 31.294 1.0069.56 ATOM 6355 CA LY5D 180 64.803 71.039 30.382 1.0069.55 ATOM 6356 CB LYSD 180 64.581 71.464 28.924 1.0069.05 ATOM 6357 CG LYSD 180 65.462 72.584 28.419 1.0068.35 25 ATOM 6358 CD LYSD 180 66.773 72.041 27.860 1.0066.86 ATOM 6359 CE LYSD 180 66.550 71.200 26.619 1.0063.97 ATOM 6360 NZ LYSD 180 66.096 72.020 25.476 1.0064.54 ATOM 6361 C LYSD 180 66.293 70.795 30.642 1.0068.87 ATOM 6362 0 LYSD 180 66.869 71.406 31.536 1.0069.83 ATOM 6363 N ASND 181 66.905 69.879 29.897 1.0068.37 ATOM 6364 CA ASND 181 68.326 69.615 30.060 1.0070.05 ATOM 6365 CB ASND 181 68.711 69.461 31.540 1.0070.86 ATOM 6366 CG ASND 181 67.808 68.533 32.291 1.0071.68 ATOM 6367 OD1 ASND 181 67.498 67.446 31.823 1.0074.38 35 ATOM 6368 ND2 ASND 181 67.395 68.945 33.487 1.0072.61 ATOM 6369 C ASND 181 68.905 68.449 29.281 1.0070.12 ATOM 6370 0 ASND 181 68.535 67.303 29.491 1.0068.91 ATOM 6371 N SERD 182 69.844 68.760 28.385 1.0071.81 ATOM 6372 CA SERD 182 70.519 67.744 27.577 1.0071.83 ATOM 6373 CB SERD 182 71.361 68.418 26.495 1.0070.60 ATOM 6374 OG SERD 182 71.817 67.463 25.557 1.0071.86 ATOM 6375 C SERD 182 71.405 66.866 28.482 1.0071.03 ATOM 6376 0 SERD 182 71.794 67.281 29.572 1.0072.13 ATOM 6377 N VALD 183 71.715 65.653 28.037 1.0070.45 45 ATOM 6378 CA VALD 183 72.528 64.736 28.842 1.0069.61 ATOM 6379 CB VALD 183 71.728 64.221 30.066 1.0069.93 ATOM 6380 CG1 VALD 183 70.268 63.988 29.671 1.0071.71 ATOM 6381 CG2 VALD 183 72.331 62.909 30.584 1.0068.31 ATOM 6382 C VALD 183 73.046 63.521 28.069 1.0069.82 ATOM 6383 0 VALD 183 72.317 62.887 27.305 1.0069.28 ATOM 6384 N THRD 184 74.314 63.194 28.272 1.0071.03 ATOM 6385 CA THRD 184 74.898 62.041 27.596 1.0072.40 ATOM 6386 CB THRD 184 76.314 62.360 27.027 1.0071.67 ATOM 6387 OG1 THRD 184 76.207 63.364 26.010 1.0069.65 55 ATOM 6388 CG2 THRD 184 76.944 61.110 26.404 1.0071.24 ATOM 6389 C THRD 184 74.997 60.901 28.602 1.0073.76 ATOM 6390 0 THRD 184 75.273 61.132 29.786 1.0074.26 ATOM 6391 N TYRD 185 74.749 59.679 28.139 1.0074.82 ATOM 6392 CA TYRD 185 74.818 58.515 29.024 1.0076.20 ATOM 6393 CB TYRD 185 73.477 57.755 29.046 1.0077.17 ATOM 6394 CG TYRD 185 72.286 58.637 29.324 1.0077.03 ATOM 6395 CD1 TYRD 185 71.822 59.52728.362 1.0077.16 ATOM 6396 CE1 TYRD 185 70.781 60.41628.640 1.0078.65 ATOM 6397 CD2 TYRD 185 71.676 58.64330.578 1.0078.44 ATOM 6398 CE2 TYRD 185 70.629 59.53230.873 1.0078.76 ATOM 6399 CZ TYRD 185 70.190 60.41729.897 1.0078.44 ATOM 6400 OH TYRD 185 69.173 61.31130.160 1.0078.64 ATOM 6401 C TYRD 185 75.909 57.59528.525 1.0076.37 ATOM 6402 0 TYRD 185 76.062 57.40327.320 1.0075.86 ATOM 6403 N SERD 186 76.669 57.03129.454 1.0078.41 1~ ATOM 6404 CA SERD 186 77.762 56.12729.097 1.0080.47 ATOM 6405 CB SERD 186 78.353 55.49430.361 1.0080.37 ATOM 6406 OG SERD 186 77.324 55.00031.202 1.0080.82 ATOM 6407 C SERD 186 77.259 55.04228.139 1.0081.49 ATOM 6408 0 SERD 186 77.977 54.63727.205 1.0080.86 ATOM 6409 N CYSD 187 76.018 54.60128.370 1.0082.03 ATOM 6410 CA CYSD 187 75.366 53.57327.553 1.0082.11 ATOM 6411 C CYSD 187 75.259 54.00526.123 1.0082.74 ATOM 6412 0 CYSD 187 75.445 53.22625.179 1.0081.67 ATOM 6413 CB CYSD 187 73.908 53.36027.980 1.0082.28 ATOM 6414 SG CYSD 187 72.725 54.77827.707 1.0081.64 ATOM 6415 N CYSD 188 74.954 55.28725.990 1.0083.43 ATOM 6416 CA CYSD 188 74.614 55.82724.701 1.0083.03 ATOM 6417 C CYSD 188 75.379 57.07024.204 1.0081.94 ATOM 6418 0 CYSD 188 75.401 58.12724.860 1.0081.77 25 ATOM 6419 CB CYSD 188 73.091 56.05924.777 1.0083.56 ATOM 6420 SG CYSD 188 72.115 54.78325.740 1.0085.15 ATOM 6421 N PROD 189 76.000 56.94523.013 1.0080.60 ATOM 6422 CD PROD 189 75.862 55.67622.263 1.0080.05 ATOM 6423 CA PROD 189 76.809 57.92122.254 1.0078.99 30 ATOM 6424 CB PROD 189 76.804 57.34120.836 1.0079.15 ATOM 6425 CG PR0D 189 76.835 55.85221.097 1.0080.06 ATOM 6426 C PR0D 189 76.386 59.40822.258 1.0076.71 ATOM 6427 O PROD 189 77.106 60.26522.777 1.0076.06 ATOM 6428 N GLUD 190 75.237 59.71321.663 1.0073.54 35 ATOM 6429 CA GLUD 190 74.762 61.10121.583 1.0070.67 ATOM 6430 CB GLUD 190 73.735 61.23320.462 1.0072.95 ATOM 6431 CG GLUD 190 73.941 60.27219.292 1.0076.22 ATOM 6432 CD GLUD 190 74.959 60.77818.284 1.0077.17 ATOM 6433 OE1 GLUD 190 74.920 61.98717.949 1.0075.78 ATOM 6434 OE2 GLUD 190 75.786 59.96117.819 1.0078.06 ATOM 6435 C GLUD 190 74.113 61.57622.874 1.0067.13 ATOM E436 0 GLUD 190 74.060 60.84223.861 1.0066.77 ATOM 6437 N ALAD 191 73.595 62.79722.852 1.0063.73 ATOM 6438 CA ALAD 191 72.924 63.36224.027 1.0063.96 45 ATOM 6.439CB ALAD 191 73.293 64.83324.188 1.0060.91 ATOM 6440 C ALAD 191 71.398 63.22623.935 1.0063.09 ATOM 6441 0 ALAD 191 70.824 63.32422.848 1.0063.27 ATOM 6442 N TYRD 192 70.737 63.01525.073 1.0061.86 ATOM 6443 CA TYRD 192 69.284 62.88325.077 1.0060.02 ATOM 6444 CB TYRD 192 68.874 61.48325.544 1.0058.87 ATOM 6445 CG TYRD 192 69.185 60.40824.531 1.0059.77 ATOM 6446 CD1 TYRD 192 70.447 59.80424.491 1.0059.82 ATOM 6447 CE1 TYRD 192 70.762 58.84923.514 1.0059.91 ATOM 6448 CD2 TYRD 192 68.234 60.03023.568 1.0059.23 55 ATOM 6449 CE2 TYRD 192 68.534 59.08422.592 1.0060.37 ATOM 6450 CZ TYRD 192 69.803 58.49622.566 1.0061.99 ATOM 6451 OH TYRD 192 70.120 57.58221.581 1.0061.54 ATOM 6452 C TYRD 192 68.590 63.93825.922 1.0059.37 ATOM 6453 0 TYRD 192 68.594 63.87427.150 1.0061.63 ATOM 6454 N GLUD 193 67.986 64.90925.248 1.0059.03 ATOM 6455 CA GLUD 193 67.280 65.99225.915 1.0060.46 ATOM 6456 CB GLU D193 66.832 67.054 24.8981.00 61.02 ATOM 6457 CG GLU D193 67.985 67.781 24.1961.00 65.53 ATOM 6458 CD GLU D193 67.522 68.937 23.2921.00 66.58 ATOM 6459 OE1 GLU D193 66.6?8 69.760 23.7391.00 66.15 'rJATOM 6460 OE2 GLU D193 68.017 69.023 22.1381.00 66.88 ATOM 6461 C GLU D193 66.066 65.455 26.6581.00 61.32 ATOM 6462 0 GI~UD193 65.498 64.428 26.2781.00 61.10 ATOM 6463 N ASP D194 65.682 66.157 27.7241.00 62.11 ATOM 6464 CA ASP D194 64.533 65.788 28.5371.00 60.32 ATOM 6465 CB ASP D194 64.855 64.571 29.4161.00 60.68 ATOM 6466 CG ASP D194 65.759 64.907 30.5891.00 61.25 ATOM 6467 OD1 ASP D194 66.929 64.453 30.5911.00 62.58 ATOM 6468 OD2 ASP D194 65.297 65.619 31.5091.00 61.10 ATOM 15469C ASP D194 64.086 66.951 29.4171.00 59.85 1cJATOM 6470 0 ASP D194 64.890 67.793 29.8161.00 60.03 ATOM 6471 N VAL D195 62.792 66.993 29.7041.00 57.38 ATOM 6472 CA VAL D195 62.225 68.024 30.5381.00 55.36 ATOM 6473 CB VAL D195 60.864 68.480 30.0011.00 52.24 ATOM 6474 CG1 VAL D195 60.179 69.394 31.0011.00 51.69 ATOM 6475 CG2 VAL D195 61.058 69.189 28.6931.00 52.14 ATOM 6476 C VAL D195 62.044 67.460 31.9351.00 56.36 ATOM 6477 0 VAL D195 61.452 66.412 32.1141.00 57.76 ATOM 6478 N GI~UD196 62.571 68.151 32.9301.00 58.67 ATOM 6479 CA GLU D196 62.425 67.712 34.3031.00 58.26 ATOM 6480 CB GLU D196 63.754 67.833 35.0351.00 58.61 ATOM 6481 CG GLU D196 63.725 67.326 36.4601.00 61.95 ATOM 6482 CD GI~UD196 65.062 67.533 37.1721.00 63.50 ATOM 6483 OEl GLU D196 66.083 67.014 36.6791.00 62.21 ATOM 6484 OE2 GI~UD196 65.099 68.218 38.2221.00 65.74 ATOM 6485 C GI~UD196 61.370 68.598 34.9591.00 58.08 ATOM 6486 0 GLU D196 61.500 69.822 34.9971.00 59.87 ATOM 6487 N VAL D197 60.305 67.979 35.4521.00 57.22 ATOM 6488 CA VAL D197 59.242 68.721 36.1041.00 54.36 ATOM 6489 CB VAL D197 57.863 68.304 35.5671.00 52.68 ATOM 6490 CGl VAL D197 56.772 69.095 36.2551.00 49.60 ATOM 6491 CG2 VAL D197 57.809 68.517 34.0681.00 50.84 ATOM 6492 C VAL D197 59.317 68.420 37.5871.00 55.10 ATOM 6493 0 VAL D197 59.36'7 67.264 37.9951.00 55.27 ATOM 6494 N SER D198 59.351 69.467 38.3991.00 56.68 ATOM 6495 CA SER D198 59.41:3 69.284 39.8391.00 56.39 ATOM 6496 CB SER D198 60.487 70.188 40.4481.00 55.89 ATOM 6497 OG SER D198 61.789 69.767 40.0661.00 57.83 ATOM 6498 C SER D198 58.058 69.593 40.4481.00 56.61 ATOM 6499 0 SER D198 57.536 70.698 40.3171.00 56.25 ATOM 6500 N LEU D199 57.481 68.597 41.1011.00 56.92 ATOM 6501 CA LEU D199 56.189 68.770 41.7281.00 56.84 ATOM 6502 CB LEU D199 55.303 67.561 41.4681.00 57.08 ATOM 6503 CG LEU D199 53.981 67.553 42.2431.00 57.99 ATOM 6504 CD1 LEU D199 53.094 68.726 41.8341.00 57.12 rJ0ATOM 6505 CD2 LEU D199 53.272 66.246 41.9711.00 58.22 ATOM 6506 C LEU D199 56.354 68.953 43.2201.00 57.85 ATOM 6507 O LEU D199 56.625 67.998 43.9501.00 58.46 ATOM 6508 N ASN D200 56.207 70.192 43.6711.00 58.52 ATOM 6509 CA ASN D200 56.315 70.486 45.0841.00 57.07 ATOM 6510 CB ASN D200 57.017 71.827 45.3111.00 59.47 ATOM 6511 CG ASN D200 57.126 72.184 46.7811.00 61.26 ATOM 6512 OD1 ASN D200 57.508 71.359 47.6131.00 60.78 ATOM 6513 IVD2ASN D200 56.792 73.423 47.1081.00 63.13 ATOM 6514 C ASN D200 54.886 70.533 45.5931.00 55.28 ATOM 6515 0 ASN D200 54.108 71.422 45.2421.00 53.93 ATOM 6516 N PHE D201 54.549 69.554 46.4191.00 53.26 ATOM 6517 CA PHE D201 53.218 69.444 46.973 1.0051.91 ATOM 6518 CB PHE D201 52.408 68.434 46.168 1.0049.89 ATOM 6519 CG PHE D201 52.870 67.013 46.348 1.0046.59 ATOM 6520 CD1PHE D201 52.068 66.086 47.003 1.0045.61 ATOM 6521 CD2PHE D201 54.133 66.613 45.903 1.0046.86 ATOM 6522 CE1PHE D201 52.519 64.779 47.218 1.0045.68 ATOM 6523 CE2PHE D201 54.597 65.312 46.112 1.0044.48 ATOM 6524 CZ PHE D201 53.788 64.394 46.772 1.0044.43 ATOM 6525 C PHE D201 53.360 68.940 48.386 1.0053.35 ATOM 6526 0 PHE D201 54.456 68.570 48.818 1.0052.18 ATOM 6527 N ARG D202 52.238 68.902 49.093 1.0055.22 ATOM 6528 CA ARG D202 52.211 68.426 50.470 1.0057.74 ATOM 6529 CB ARG D202 52.632 69.546 51.412 1.0058.53 ATOM 6530 CG ARG D202 51.564 70.612 51.484 1.0062.76 ATOM 6531 CD ARG D202 51.956 71.797 52.313 1.0064.76 ATOM 6532 NE ARG D202 50.901 72.806 52.296 1.0064.52 ATOM 6533 CZ ARG D202 51.046 74.035 52.779 1.0065.00 ATOM 6534 NH1ARG D202 52.206 74.409 53.323 1.0065.86 ATOM 6535 NH2ARG D202 50.045 74.896 52.708 1.0062.46 ATOM 6536 C ARG D202 50.788 67.997 50.835 1.0057.64 ATOM 6537 0 ARG D202 49.822 68.392 50.186 1.0055.63 ATOM 6538 N LYS D203 50.668 67.189 51.878 1.0058.55 ATOM 6539 CA LYS D203 49.359 66.759 52.332 1.0059.55 ATOM 6540 CB LYS D203 49.505 65.708 53.428 1.0060.97 25 ATOM 6541 CG LYS D203 48.195 65.258 54.031 1.0062.61 ATOM 6542 CD LYS D203 48.445 64.319 55.194 1.0066.11 ATOM 6543 CE LYS D203 47.142 63.813 55.784 1.0068.33 ATOM 6544 NZ LYS D203 46.380 62.985 54.804 1.0069.98 ATOM 6545 C LYS D203 48.702 68.008 52.914 1.0060.27 ATOM 6546 0 LYS D203 49.402 68.886 53.428 1.0060.55 ATOM 6547 N LYS D204 47.374 68.105 52.832 1.0059.32 ATOM 6548 CA LYS D204 46.680 69.260 53.395 1.0060.40 ATOM 6549 CB LYS D204 45.221 69.284 52.947 1.0059.66 ATOM 6550 CG LYS D204 45.054 69.738 51.495 1.0056.15 35 ATOM 6551 CD LYS D204 43.652 69.489 50.974 1.0052.10 ATOM 6552 CE LYS D204 43.593 69.775 49.488 1.0052.88 ATOM 6553 NZ LYS D204 42.334 69.320 48.856 1.0054.65 ATOM 6554 C LYS D204 46.7'76 69.201 54.919 1.0062.27 ATOM 6555 0 LYS D204 47.031 68.129 55.479 1.0063.85 ATOM 6556 N GLY D205 46.590 70.344 55.587 1.0061.70 ATOM 6557 CA GLY D205 46.701 70.390 57.043 1.0061.46 ATOM 6558 C GLY D205 45.432 70.704 57.821 1.0060.96 ATOM 6559 OT1GLY D205 44.364 70.809 57.191 1.0061.45 ATOM 6560 OT2GLY D205 45.495 70.835 59.067 1.0060.53 45 ATOM 6561 CB PHE E1 68.481 57.493 1.362 1.0063.85 ATOM 6562 CG PHE E1 68.496 56.384 0.357 1.0065.93 ATOM 6563 CD1PHE E1 67.431 56.207 -0.526 1.0067.13 ATOM 6564 CD2PHE E1 69.549 55.462 0.345 1.0067.48 ATOM 6565 CE1PHE E1 67.410 55.116 -1.409 1.0068.65 ATOM 6566 CE2PHE E1 69.548 54.364 -0.528 1.0067.48 ATOM 6567 CZ PHE E1 68.481 54.185 -1.406 1.0069.10 ATOM 6568 C PHE E1 67.191 59.419 2.218 1.0061.93 ATOM 6569 0 PHE E1 67.898 59.384 3.225 1.0062.32 ATOM 6570 N PHE E1 68.457 59.591 0.037 1.0062.93 55 ATOM 6571 CA PHE E1 67.655 58.712 0.943 1.0062.89 ATOM 6572 N ASP E2 66.011 60.038 2.205 1.0061.01 ATOM 6573 CA ASP E2 65.524 60.730 3.406 1.0060.82 ATOM 6574 CB ASP E2 64.448 61.754 3.027 1.0059.66 ATOM 6575 CG ASP E2 63.263 61.126 2.346 1.0061.52 ATOM 6576 OD1ASP E2 62.587 60.347 3.035 1.0062.72 ATOM 6577 OD2ASP E2 63.006 61.396 1.142 1.0050.96 -1 g~
ATOM 6578 C ASP E 2 65.012 59.731 4.459 1.00 60.89 ATOM 6579 0 ASP E 2 64.990 58.525 4.216 1.00 62.95 ATOM 6580 N ARG E 3 64.624 60.214 5.635 1.00 60.20 ATOM 6581 CA ARG E 3 64.161 59.321 6.697 1.00 57.08 ATOM 6582 CB ARG E 3 63.746 60.128 7.933 1.00 56.21 ATOM 6583 CG ARG E 3 64.906 60.475 8.878 1.00 56.67 ATOM 6584 CD ARG E 3 65.314 59.266 9.702 1.00 57.53 ATOM 6585 NE ARG E 3 66.519 59.426 10.5241.00 58.61 ATOM 6586 CZ ARG E 3 66.825 60.497 11.2581.00 60.79 1~ ATOM 6587 NH1 ARG E 3 66.024 61.559 11.2941.00 61.35 ATOM 6588 NH2 ARG E 3 67.943 60.499 11.9751.00 58.97 ATOM 6589 C ARG E 3 63.008 58.447 6.244 1.00 56.93 ATOM 6590 0 ARG E 3 62.949 57.256 6.567 1.00 58.08 ATOM 6591 N ALA E 4 62.102 59.033 5.473 1.00 54.21 15 ATOM 6592 CA ALA E 4 60.937 58.311 4.993 1.00 52.85 ATOM 6593 CB ALA E 4 60.002 59.262 4.270 1.00 50.53 ATOM 6594 C ALA E 4 61.342 57.168 4.075 1.00 53.00 ATOM 6595 0 ALA E 4 60.858 56.056 4.225 1.00 53.30 ATOM 6596 N ASP E 5 62.235 57.443 3.132 1.00 54.00 ATOM 6597 CA ASP E 5 62.692 56.433 2.190 1.00 54.02 ATOM 6598 CB ASP E 5 63.702 57.021 1.197 1.00 56.37 ATOM 6599 CG ASP E 5 63.153 58.223 0.435 1.00 60.25 ATOM 6600 OD1 ASP E 5 62.018 58.154 -0.0721.00 61.70 ATOM 6601 OD2 ASP E 5 63.864 59.247 0.327 1.00 64.63 25 ATOM 6602 C ASP E 5 63.341 55.278 2.924 1.00 54.45 ATOM 6603 0 ASP E 5 63.192 54.127 2.532 1.00 54.26 ATOM 6604 N II~EE 6 64.060 55.582 3.997 1.00 54.54 ATOM 5605 CA ILE E 6 64.734 54.535 4.755 1.00 55.28 ATOM 6606 CB II~EE 6 65.72'7 55.121 5.781 1.00 56.90 ATOM 6607 CG2 ILE E 6 66.476 53.991 6.489 1.00 56.40 ATOM 6608 CG1 ILE E 6 66.728 56.031 5.068 1.00 58.74 ATOM 6609 CD1 ILE E 6 67.833 56.589 5.976 1.00 60.73 ATOM 6610 C II~EE 6 63.765 53.617 5.482 1.00 53.47 ATOM 6611 0 ILE E 6 63.830 52.401 5.322 1.00 53.23 35 ATOM 6612 N LEU E 7 62.883 54.199 6.290 1.00 53.23 ATOM 6613 CA LEU E 7 61.897 53.423 7.033 1.00 52.57 ATOM 6614 CB LEU E 7 61.060 54.354 7.899 1.00 52.03 ATOM 6615 CG LEU E 7 61.862 55.020 9.017 1.00 52.39 ATOM 6616 CD1 LEU E 7 61.074 56.183 9.607 1.00 53.72 ATOM 6617 CD2 LEU E 7 62.185 53.989 10.0701.00 47.50 ATOM 6618 C LEU E 7 61.003 52.660 6.065 1.00 52.40 ATOM 6619 0 LEU E 7 60.665 51.503 6.302 1.00 53.43 ATOM 6620 N Tt!RE 8 60.644 53.311 4.967 1.00 51.20 ATOM 6621 CA TYR E 8 59.810 52.707 3.951 1.00 52.74 45 ATOM 6622 CB TYR E 8 59.622 53.686 2.804 1.00 54.75 ATOM 6623 CG TYR E 8 58.825 53.102 1.660 1.00 60.00 ATOM 6624 CD1 TYR E 8 57.448 52.902 1.773 1.00 59.81 ATOM 6625 CE1 T~rRE 8 56.723 52.341 0.734 1.00 59.72 ATOM 6626 CD2 TYR E 8 59.453 52.717 0.465 1.00 61.59 ATOM 6627 CE2 TYR E 8 58.727 52.148 -0.5801.00 59.67 ATOM 6628 CZ TYR E 8 57.36'7 51.967 -0.4331.00 59.94 ATOM 6629 OH TYR E 8 56.646 51.411 -1.4571.00 63.44 ATOM 6630 C TYR E 8 60.399 51.405 3.404 1.00 54.02 ATOM 6631 0 TYR E 8 59.692 50.414 3.259 1.00 54.84 55 ATOM 6632 N ASN E 9 61.688 51.411 3.082 1.00 53.58 ATOM 6633 CA ASN E 9 62.338 50.224 2.559 1.00 52.96 ATOM 6634 CB ASN E 9 63.790 50.524 2.182 1.00 58.69 ATOM 6635 CG ASN E 9 63.907 51.445 0.966 1.00 62.10 ATOM 6636 OD1 ASN E 9 62.908 51.771 0.321 1.00 64.59 ATOM 6637 ND2 ASN E 9 65.137 51.861 0.645 1.00 63.43 ATOM 6638 C ASN E 9 62.297 49.112 3.584 1.00 52.17 Igl ATOM 6639 0 ASN E 9 61.870 48.003 3.287 1.00 51.04 ATOM 6640 N ILE E 10 62.746 49.410 4.794 1.00 53.05 ATOM 6641 CA ILE E 10 62.752 48.424 5.866 1.00 53.91 ATOM 6642 CB ILE E 10 63.189 49.053 7.195 1.00 53.67 ATOM 6643 CG2 ILE E 10 63.060 48.027 8.316 1.00 51.86 ATOM 6644 CGl ILE E 10 64.627 49.564 7.077 1.00 51.89 ATOM 6645 CD1 ILE E 10 65.085 50.379 8.251 1.00 50.06 ATOM 6646 C ILE E 10 61.358 47.835 6.054 1.00 55.10 ATOM 6647 0 ILE E 10 61.186 46.631 6.216 1.00 55.00 1~ ATOM 6648 N ARG E 11 60.364 48.708 6.032 1.00 56.28 ATOM 6649 CA ARG E 11 58.975 48.308 6.199 1.00 57.92 ATOM 6650 CB ARG E 11 58.084 49.543 6.106 1.00 61.96 ATOM 6651 CG ARG E 11 56.628 49.280 6.323 1.00 69.38 ATOM 6652 CD ARG E 11 56.359 49.040 7.797 1.00 79.46 15 ATOM 6653 NE ARG E 11 54.957 49.274 8.149 1.00 85.84 ATOM 6654 CZ ARG E 11 54.244 50.315 7.713 1.00 89.11 ATOM 6655 NH1 ARG E 11 54.801 51.215 6.892 1.00 90.35 ATOM 6656 NH2 ARG E 11 52.980 50.475 8.117 1.00 90.14 ATOM 6657 C ARG E 11 58.559 47.314 5.126 1.00 56.77 ATOM 6658 O ARG E 11 57.986 46.264 5.415 1.00 55.32 ATOM 6659 N GLN E 12 58.866 47.663 3.881 1.00 56.51 ATOM 6660 CA GLN E 12 58.511 46.850 2.730 1.00 54.24 ATOM 6661 CB GLN E 12 58.583 47.698 1.485 1.00 53.75 ATOM 6662 CG GLN E 12 57.341 47.645 0.673 1.00 58.35 25 ATOM 6663 CD GLN E 12 56.287 48.540 1.223 1.00 59.21 ATOM 6664 OE1 GLN E 12 56.517 49.726 1.375 1.00 63.59 ATOM 6665 NE2 GLN E 12 55.121 47.990 1.528 1.00 59.83 ATOM 6666 C GLN E 12 59.312 45.581 2.484 1.00 53.65 ATOM 6667 0 GLN E 12 58.820 44.677 1.825 1.00 52.67 ATOM 6668 N THR E 13 60.536 45.507 2.995 1.00 54.14 ATOM 6669 CA THR E 13 61.369 44.331 2.771 1.00 55.96 ATOM 6670 CB THR E 13 62.714 44.726 2.181 1.00 55.93 ATOM 6671 OG1 THR E 13 63.380 45.612 3.090 1.00 55.29 ATOM 6672 CG2 THR E 13 62.526 45.400 0.822 1.00 55.33 35 ATOM 6673 C THR E 13 61.656 43.486 4.005 1.00 58.24 ATOM 6674 0 THR E 13 62.096 42.343 3.892 1.00 58.85 ATOM 6675 N SER E 14 61.414 44.042 5.182 1.00 60.49 ATOM 6676 CA SER E 14 61.681 43.317 6.408 1.00 61.17 ATOM 6677 CB SER E 14 61.629 44.265 7.599 1.00 62.69 ATOM 6678 OG SER E 14 62.247 43.658 8.723 1.00 66.18 ATOM 6679 C SER E 14 60.727 42.151 6.644 1.00 60.36 ATOM 6680 0 SER E 14 59.579 42.153 6.184 1.00 59.94 ATOM 6681 N ARG E 15 61.233 41.156 7.369 1.00 58.70 ATOM 6682 CA ARG E 15 60.487 39.949 7.703 1.00 58.01 45 ATOM 6683 CB ARG E 15 60.926 38.792 6.805 1.00 57.94 ATOM 6684 CG ARG E 15 60.686 39.058 5.325 1.00 59.93 ATOM 6685 CD ARG E 15 60.746 37.761 4.547 1.00 63.77 ATOM 6686 NE ARG E 15 59.755 36.818 5.060 1.00 66.81 ATOM 6687 CZ ARG E 15 59.714 35.516 4.772 1.00 66.79 ATOM 6688 NH1 ARG E 15 60.622 34.982 3.964 1.00 64.79 ATOM 6689 NH2 ARG E 15 58.748 34.752 5.287 1.00 67.36 ATOM 6690 C ARG E 15 60.743 39.621 9.170 1.00 55.75 ATOM 6691 0 ARG E 15 61.705 38.928 9.513 1.00 55.70 $

ATOM 6692 N PRO E 16 59.869 40.121 10.0571.00 54.09 55 ATOM 6693 CD PRO E 16 58.682 40.932 9.727 1.00 50.97 ATOM 6694 CA PRO E 16 59.961 39.919 11.5031.00 51.94 ATOM 6695 CB PRO E 16 58.731 40.650 12.0311.00 50.89 ATOM 6696 CG PRO E 16 58.463 41.680 10.9971.00 51.98 ATOM 6697 C PRO E 16 59.986 38.473 11.9451.00 50.22 ATOM 6698 0 PRO E 16 60.418 38.176 13.0461.00 49.19 ATOM 6699 N ASP E 17 59.512 37.579 11.0951.00 50.78 ATOM 6700 CA ASPE 17 59.477 36.171 11.4461.00 53.11 ATOM 6701 CB ASPE 17 58.244 35.492 10.8321.00 58.78 ATOM 6702 CG ASPE 17 56.931 35.917 11.5131.00 64.95 ATOM 6703 OD1 ASPE 17 56.959 36.261 12.7321.00 65.29 ATOM 6704 OD2 ASPE 17 55.865 35.887 10.8311.00 66.80 ATOM 6705 C ASPE 17 60.716 35.401 11.0391.00 52.04 ATOM 6706 0 ASPE 17 60.787 34.194 11.2421.00 53.16 ATOM 6707 N VALE 18 61.701 36.090 10.4811.00 52.13 ATOM 6708 CA VALE 18 62.906 35.410 10.0341.00 51.75 1~ ATOM 6709 CB VALE 18 63.050 35.519 8.509 1.00 53.20 ATOM 6710 CG1 VALE 18 64.265 34.728 8.037 1.00 54.22 ATOM 6711 CG2 VALE 18 61.797 35.010 7.843 1.00 52.93 ATOM 6712 C VALE 18 64.193 35.897 10.6751.00 50.84 ATOM 6713 0 VALE 18 64.595 37.039 10.5131.00 50.74 15 ATOM 6714 N ILEE 19 64.841 34.990 11.3871.00 51.04 ATOM 6715 CA ILEE 19 66.092 35.270 12.0771.00 53.80 ATOM 6716 CB ILEE 19 66.478 34.027 12.9401.00 52.99 ATOM 6717 CG2 ILEE 19 66.'791 32.842 12.0401.00 52.72 ATOM 6718 CG1 ILEE 19 67.644 34.346 13.8701.00 52.81 ATOM 6719 CD1 ILEE 19 67.867 33.290 14.9231.00 49.41 ATOM 6720 C ILEE 19 67.184 35.628 11.0531.00 55.50 ATOM 6721 0 ILEE 19 67.399 34.903 10.0871.00 54.87 ATOM 6722 N PROE 20 67.879 36.765 11.2501.00 57.80 ATOM 6723 CD PROE 20 67.710 37.684 12.3851.00 58.20 25 ATOM 6724 CA PROE 20 68.948 37.253 10.3591.00 60.68 ATOM 6725 CB PROE 20 69.252 38.664 10.8971.00 58.99 ATOM 6726 CG PROE 20 68.056 39.007 11.7441.00 60.19 ATOM 6727 C PROE 20 70.201 36.370 10.3601.00 62.73 ATOM 6728 0 PROE 20 71.317 36.854 10.5681.00 61.22 ATOM 5729 N THRE 21 70.008 35.080 10.1171.00 65.32 ATOM 6730 CA THRE 21 71.107 34.128 10.1061.00 69.19 ATOM 6731 CB THRE 21 70.573 32.698 10.3641.00 68.56 ATOM 5732 OG1 THRE 21 70.744 32.370 11.7511.00 66.59 ATOM 6733 CG2 THRE 21 71.300 31.677 9.502 1.00 68.21 35 ATOM 6734 C THRE 21 71.964 34.121 8.840 1.00 72.78 ATOM 6735 0 TI3RE 21 71.450 34.096 7.716 1.00 72.75 ATOM 6736 N GLNE 22 73.282 34.128 9.051 1.00 77.19 ATOM 6737 CA GLNE 22 74.279 34.102 7.971 1.00 80.45 ATOM 6738 CB GLNE 22 75.303 35.209 8.192 1.00 81.20 ATOM 6739 CG GLNE 22 74.691 36.597 8.264 1.00 83.07 ATOM 6740 CD GLNE 22 75.515 37.542 9.131 1.00 85.11 ATOM 6741 OE1 GLNE 22 75.640 37.329 10.3551.00 85.67 ATOM 6742 NE2 GLNE 22 76.087 38.587 8.510 1.00 84.48 ATOM 6743 C GLNE 22 74.980 32.739 8.023 1.00 81.85 45 ATOM 6744 0 GLNE 22 75.783 32.480 8.929 1.00 81.74 ATOM 6745 N ARGE 23 74.676 31.880 7.050 1.00 84.04 ATOM 6746 CA ARGE 23 75.235 30.521 7.001 1.00 84.92 ATOM 6747 CB ARGE 23 76.767 30.550 6.931 1.00 84.82 ATOM 6748 CG ARGE 23 77.314 30.929 5.558 1.00 87.29 ATOM 6749 CD ARGE 23 77.788 32.397 5.462 1.00 90.43 ATOM 6750 NE ARGE 23 78.140 32.777 4.081 1.00 92.74 ATOM 6751 CZ ARGE 23 78.982 32.103 3.287 1.00 93.28 ATOM 6752 NHl ARGE 23 79.592 30.993 3.712 1.00 92.22 ATOM 6753 NH2 ARGE 23 79.204 32.535 2.047 1.00 92.78 55 ATOM 6754 C ARGE 23 74.790 29.736 8.237 1.00 85.32 ATOM 6755 0 ARGE 23 73.673 29.929 8.747 1.00 85.55 ATOM 6756 N ASPE 24 75.648 28.842 8.718 1.00 85.95 ATOM 6757 CA ASPE 24 75.304 28.062 9.907 1.00 86.37 ATOM 6758 CB ASPE 24 76.103 26.752 9.985 1.00 90.45 ATOM 6759 CG ASPE 24 76.671 26.317 8.636 1.00 93.77 ATOM 6760 ODl ASPE 24 75.856 26.082 7.698 1.00 95.19 ATOM 6761 OD2 ASPE 24 77.930 26.2128.533 1.00 94.96 ATOM 6762 C ASPE 24 75.657 28.91711.116 1.00 84.76 ATOM 6763 0 ASPE 24 75.551 28.46612.259 1.00 84.92 ATOM 6764 N ARGE 25 76.097 30.14610.857 1.00 82.51 ATOM 6765 CA ARGE 25 76.465 31.06311.930 1.00 80.45 ATOM 6766 CB ARGE 25 77.208 32.28911.382 1.00 83.04 ATOM 6767 CG ARGE 25 78.635 32.03210.918 1.00 87.73 ATOM 6768 CD ARGE 25 79.370 33.35810.688 1.00 91.97 ATOM 6769 NE ARGE 25 80.781 33.17110.340 1.00 95.94 1~ ATOM 6770 CZ ARGE 25 81.667 34.16410.199 1.00 97.73 ATOM 6771 NH1 ARGE 25 81.285 35.4351Ø3791.00 98.12 ATOM 6772 NH2 ARGE 25 82.938 33.8929.880 1.00 97.12 ATOM 6773 C ARGE 25 75.256 31.55712.708 1.00 76.54 ATOM 6774 0 ARGE 25 74.265 31.99912.122 1.00 76.16 15 ATOM 6775 N PROE 26 75.322 31.48314.045 1.00 73.86 ATOM 6776 CD PROE 26 76.34.3 30.77814.834 1.00 73.05 ATOM 6777 CA PROE 26 74.23:1 31.9361.4.9161.00 70.73 ATOM 6778 CB PROE 26 74.647 31.42516.295 1.00 70.99 ATOM 6779 CG PROE 26 75.529 30.25715.984 1.00 72.42 ATOM 6780 C PROE 26 74.199 33.46614.891 1.00 67.63 ATOM 6781 0 PROE 26 75.173 34.11014.493 1.00 66.91 ATOM 6782 N VALE 27 73.076 34.04615.288 1.00 63.36 ATOM 6783 CA VALE 27 72.980 35.48715.346 1.00 57.94 ATOM 6784 CB VALE 27 71.537 35.94915.266 1.00 55.79 25 ATOM 6785 CGl VALE 27 71.403 37.36615.780 1.00 54.61 ATOM 6786 CG2 VALE 27 71.082 35.87013.839 1.00 57.04 ATOM 6787 C VALE 27 73.554 35.82116.706 1.00 57.83 ATOM 6788 0 VALE 27 73.180 35.20717.711 1.00 58.05 ATOM 6789 N ALAE 28 74.490 36.76016.744 1.00 55.79 30 ATOM 6790 CA ALAE 28 75.087 37.13018.014 1.00 55.59 ATOM 6791 CB ALAE 28 76.508 37.58817.810 1.00 54.25 ATOM 6792 C ALAE 28 74.270 38.22418.677 1.00 54.76 ATOM Ei7930 ALAE 28 74.244 39.37018.216 1.00 54.28 ATOM 6794 N VALE 29 73.596 37.85019.759 1.00 53.10 35 ATOM 6795 CA VALE 29 72.769 38.78320.514 1.00 53.62 ATOM 6796 CB VALE 29 71.338 38.22220.767 1.00 52.63 ATOM 6797 CG1 VALE 29 70.531 39.21021.591 1.00 47.51 ATOM 6798 CG2 VALE 29 70.641 37.94019.446 1.00 52.51 ATOM 6799 C VALE 29 73.412 39.05121.865 1.00 53.21 ATOM 6800 O VALE 29 73.76() 38.11922.599 1.00 53.58 ATOM 6801 N SERE 30 73.583 40.32522.184 1.00 51.51 ATOM 6802 CA SERE 30 74.154 40.68123.459 1.00 54.05 ATOM 6803 CB SERE 30 75.288 41.69023.276 1.00 52.43 ATOM Ei804OG SERE 30 74.821 42.85422.632 1.00 55.74 45 ATOM 6805 C SERE 30 73.024 41.27724.301 1.00 56.57 ATOM 6806 0 SERE 30 72.236 42.11023.825 1.00 54.93 ATOM 6807 N VALE 31 72.946 40.82425.550 1.00 58.33 ATOM fi808CA VALE 31 71.934 41.28026.493 1.00 60.16 ATOM 6809 CB VALE 31 71.058 40.11826.966 1.00 59.85 ATOM 6810 CGl VALE 31 69.842 40.66227.700 1.00 60.72 ATOM 6811 CG2 VALE 31 70.653 39.26425.783 1.00 60.11 ATOM 6812 C VALE 31 72.599 41.89127.724 1.00 61.00 ATOM 6813 0 VALE 31 73.542 41.32728.279 1.00 62.05 ATOM fi814N SERE 32 72.092 43.03728.160 1.00 61.21 55 ATOM 6815 CA SERE 32 72.648 43.71729.318 1.00 60.47 ATOM 6816 CB SERE 32 73.688 44.74328.851 1.00 61.09 ATOM 6817 OG SERE 32 74.162. 45.55329.919 1.00 63.13 ATOM 6818 C SERE 32 71.552 44.42230.111 1.00 60.62 ATOM 6819 0 SERE 32 70.941 45.37529.621 1.00 62.55 ATOM 6820 N LEUE 33 71.300 43.96231.332 1.00 58.26 ATOM 6821 CA LEUE 33 70.282 44.59132.165 1.00 56.62 ATOM 6822 CB LEUE 33 69.658 43.57833.122 1.00 54.43 ATOM 6823 CG LEUE 33 69.031 42.34432.487 1.00 55.79 ATOM 6824 CD1 LEUE 33 68.247 41.56133.532 1.00 53.82 ATOM 6825 CD2 LEUE 33 68.132 42.78131.348 1.00 56.32 ATOM 6826 C LEUE 33 70.880 45.71732.985 1.00 56.68 ATOM 6827 0 LEUE 33 71.954 45.57233.556 1.00 58.07 ATOM 6828 N LYSE 34 7,0.186 46.84333.029 1.00 55.71 ATOM 6829 CA LYSE 34 70.616 47.97833.822 1.00 54.48 ATOM 6830 CB LYSE 34 70.799 49.20732.948 1.00 57.11 1~ ATOM 6831 CG LYSE 34 71.726 48.98531.774 1.00 66.06 ATOM 6832 CD LYSE 34 73.179 48.67932.205 1.00 71.51 ATOM 6833 CE LYSE 34 74.103 48.40930.973 1.00 73.37 ATOM Ei834NZ LYSE 34 75.541 48.13531.351 1.00 72.80 ATOM 6835 C LYSE 34 69.459 48.20134.776 1.00 53.15 15 ATOM 6836 0 LYSE 34 68.373 48.59034.356 1.00 52.81 ATOM 6837 N PHEE 35 69.668 47.94736.059 1.00 51.67 ATOM 6838 CA PHEE 35 68.584 48.12037.011 1.00 49.05 ATOM 6839 CB PHEE 35 68.890 47.36438.292 1.00 46.62 ATOM 6840 CG PHEE 35 68.921 45.88338.095 1.00 47.20 ATOM 6841 CD1 PHEE 35 70.071 45.25437.651 1.00 46.38 ATOM 6842 CD2 PHEE 35 67.'766 45.12538.253 1.00 49.08 ATOM Ei843CE1 PHEE 35 70.074 43.89737.363 1.00 47.59 ATOM 6844 CE2 PHEE 35 67.755 43.76037.964 1.00 48.98 ATOM 6845 CZ PHEE 35 68.913 43.14537.517 1.00 48.13 25 ATOM 6846 C PHEE 35 68.225 49.56037.285 1.00 48.83 ATOM 6847 0 PHEE 35 69.086 50.40137.492 1.00 50.99 ATOM 6848 N II~EE 36 66.927 49.83137.259 1.00 47.58 ATOM 6849 CA ILEE 36 66.403 51.16637.465 1.00 44.93 ATOM 6850 CB ILEE 36 65.398 51.53236.370 1.00 44.37 ATOM 6851 CG2 ILEE 36 64.92'7 52.95636.547 1.00 39.93 ATOM 6852 CG1 ILEE 36 66.034 51.32834.994 1.00 45.24 ATOM 6853 CD1 II~EE 36 67.290 52.11434.776 1.00 46.74 ATOM 6854 C ILEE 36 65.698 51.26638.792 1.00 46.03 ATOM 6855 0 ILEE 36 65.588 52.35039.347 1.00 46.58 35 ATOM 6856 N ASNE 37 65.201 50.14239.299 1.00 45.38 ATOM 6857 CA ASNE 37 64.510 50.16340.580 1.00 44.10 ATOM Ei858CB ASNE 37 63.256 51.02240.471 1.00 42.99 ATOM 6859 CG ASNE 37 62.870 51.66041.784 1.00 46.14 ATOM 6860 OD1 ASNE 37 62.892 51.01842.832 1.00 45.55 4~ ATOM 6861 ND2 A:~NE 37 62.497 52.93141.731 1.00 45.29 ATOM Ei862C ASNE 37 64.125 48.77741.087 1.00 45.25 ATOM Ei8630 ASNE 37 64.009 47.82540.317 1.00 42.90 ATOM Ei864N ILEE 38 63.951 48.68042.401 1.00 46.26 ATOM 6865 CA ILEE 38 63.537 47.45343.057 1.00 47.22 45 ATOM Ei866CB ILEE 38 64.646 46.91343.940 1.00 46.57 ATOM 6867 CG2 IL,EE 38 64.152 45.69244.685 1.00 46.43 ATOM 6868 CG1 IL~EE 38 65.848 46.56143.058 1.00 47.22 ATOM 6869 CD1 ILEE 38 67.109 46.20743.784 1.00 46.51 ATOM 6870 C ILEE 38 62.346 47.90243.879 1.00 48.14 ATOM 6871 0 ILEE 38 62.504 48.61944.855 1.00 49.04 ATOM 6872 N LEUE 39 61.157 47.47643.466 1.00 49.65 ATOM 6873 CA LEUE 39 59.908 47.89744.092 1.00 51.44 ATOM 6874 CB LEUE 39 58.856 48.05243.004 1.00 53.02 ATOM 6875 CG LEUE 39 59.359 48.91641.847 1.00 54.99 55 ATOM 6876 CD1 LEUE 39 58.314 49.01940.767 1.00 54.07 ATOM 6877 CD2 LEUE 39 59.717 50.28942.377 1.00 53.65 ATOM 6878 C LEUE 39 59.312 47.10445.241 1.00 52.90 ATOM 6879 0 LEUE 39 58.795 47.69046.184 1.00 53.53 ATOM 6880 N GLUE 40 59.332 45.78145.163 1.00 54.20 ATOM 6881 CA GLUE 40 58.781 44.98846.249 1.00 56.14 ATOM 6882 CB GLUE 40 57.357 44.54945.960 1.00 58.59 ATOM 6883 CG GLUE 40 56.377 45.67845.865 1.00 64.95 ATOM 6884 CD GLUE 40 54.960 45.17845.718 1.00 68.54 ATOM 6885 OE1 GLUE 40 54.697 44.40544.757 1.00 70.88 ATOM 6886 OE2 GLUE 40 54.119 45.56146.564 1.00 69.89 ATOM 6887 C GLUE 40 59.620 43.77346.449 1.00 55.88 ATOM 6888 0 GLUE 40 60.029 43.13445.498 1.00 58.42 ATOM 6889 N VALE 41 59.876 43.45447.700 1.00 55.75 ATOM 6890 CA VALE 41 60.675 42.30048.021 1.00 55.46 ATOM 6891 CB VALE 41 62.06'7 42.73248.550 1.00 56.94 ATOM 6892 CG1 VALE 41 62.802 41.54749.107 1.00 58.11 ATOM 6893 CG2 VALE 41 62.878 43.36147.433 1.00 55.88 ATOM 6894 C VALE 41 59.925 41.52049.078 1.00 55.20 ATOM 6895 0 VALE 41 59.230 42.09449.908 1.00 55.44 ATOM 6896 N ASNE 42 60.042 40.20449.025 1.00 55.58 15 ATOM Ei897CA ASNE 42 59.381 39.35049.995 1.00 56.97 ATOM 6898 CB ASNE 42 58.077 38.79449.430 1.00 55.95 ATOM Ei899CG ASNE 42 57.220 38.13550.490 1.00 55.31 ATOM 6900 OD1 ASNE 42 57.696 37.30651.267 1.00 56.29 ATOM 6901 ND2 ASNE 42 55.948 38.49950.526 1.00 53.42 ATOM 6902 C ASNE 42 60.360 38.22250.241 1.00 59.68 ATOM 6903 0 ASNE 42 60.527 37.33749.393 1.00 60.84 ATOM 6904 N GI~UE 43 61.014 38.25551.398 1.00 61.29 ATOM 6905 CA GLUE 43 62.005 37.24251.717 1.00 62.43 ATOM 6906 CB GLUE 43 62.898 37.72152.857 1.00 65.13 25 ATOM Ei907CG GLUE 43 64.066 36.78753.120 1.00 70.44 ATOM Ei908CD GLUE 43 65.091 37.35854.094 1.00 73.76 ATOM 6909 OE1 GLUE 43 66.010 36.60154.486 1.00 74.81 ATOM 6910 OE2 GLUE 43 64.982. 38.55754.460 1.00 74.43 ATOM 6911 C GLUE 43 61.355 35.92052.070 1.00 61.19 ATOM 6912 0 GLUE 43 61.977 34.86151.958 1.00 58.53 ATOM 6913 N ILEE 44 60.094 35.99452.484 1.00 61.32 ATOM 6914 CA ILEE 44 59.330 34.80952.852 1.00 61.37 ATOM 6915 CB ILEE 44 57.999 35.17853.536 1.00 62.70 ATOM Ei916CG2 ILEE 44 57.197 33.89753.812 1.00 63.01 35 ATOM 6917 CG1 ILEE 44 58.258 35.94654.836 1.00 62.78 ATOM 6918 CD1 ILEE 44 58.852 35.08855.947 1.00 63.28 ATOM 6919 C ILEE 44 58.983 34.00051.608 1.00 60.40 ATOM 6920 0 ILEE 44 59.114 32.77451.592 1.00 61.80 ATOM Ei921N THRE 45 58.532 34.69250.569 1.00 58.56 ATOM Ei922CA THRE 45 58.149 34.03349.326 1.00 57.28 ATOM Ei923CB THRE 45 56.906 34.69648.710 1.00 56.47 ATOM 6924 OG1 THRE 45 57.189 36.07448.443 1.00 55.94 ATOM 6925 CG2 THRE 45 55.724 34.58849.658 1.00 52.56 ATOM 6926 C THRE 45 59.245 34.02948.275 1.00 55.65 45 ATOM 6927 0 THRE 45 59.120 33.35747.262 1.00 55.71 ATOM 6928 N ASNE 46 60.313 34.78248.514 1.00 55.17 ATOM Ei929CA ASNE 46 61.420 34.85047.564 1.00 54.46 ATOM Ei930CB ASNE 46 62.057 33.47247.435 1.00 54.61 ATOM 6931 CG ASNE 46 63.288 33.32248.290 1.00 56.45 ATOM 6932 OD1 ASNE 46 63.674 32.21348.638 1.00 57.64 ATOM 6933 ND2 ASNE 46 63.922 34.43648.621 1.00 53.06 ATOM 6934 C ASNE 46 60.972 35.36246.187 1.00 54.17 ATOM 6935 0 ASNE 46 61.259 34.76445.149 1.00 54.29 ATOM 6936 N GL~UE 47 60.267 36.48246.191 1.00 52.96 55 ATOM 6937 CA GL~UE 47 59.769 37.07444.970 1.00 51.83 ATOM 6938 CB GLUE 47 58.247 36.95644.926 1.00 50.20 ATOM 6939 CG GL~UE 47 57.750 35.53044.856 1.00 50.29 ATOM 6940 CD GLUE 47 56.236 35.43844.877 1.00 52.98 ATOM 6941 OE1 GLUE 47 55.589 36.44244.516 1.00 50.88 ATOM 6942 OE2 GLUE 47 55.692 34.35845.237 1.00 56.10 ATOM 6943 C GLUE 47 60.186 38.53444.919 1.00 51.43 ATOM 6944 0 GLU E 47 60.134 39.243 45.9191.00 51.14 ATOM 6945 N VAL E 48 60.597 38.980 43.7421.00 51.27 ATOM 6946 CA VAL E 48 61.037 40.352 43.5741.00 51.20 ATOM 6947 CB VAL E 48 62.554 40.402 43.2761.00 52.39 ATOM 6948 CG1 VAL E 48 63.000 41.822 43.0811.00 54.32 ATOM 6949 CG2 VAL E 48 63.319 39.778 44.4111.00 53.03 ATOM 6950 C VAL E 48 60.290 41.062 42.4521.00 49.53 ATOM 6951 0 VAL E 48 59.974 40.474 41.4251.00 47.97 ATOM 6952 N ASP E 49 60.005 42.334 42.6691.00 47.94 ATOM 6953 CA ASP E 49 59.335 43.146 41.6801.00 48.29 ATOM 6954 CB ASP E 49 58.107 43.795 42.2901.00 49.64 ATOM 6955 CG ASP E 49 57.146 44.300 41.2491.00 50.04 ATOM 6956 OD1 ASP E 49 57.596 44.853 40.2281.00 47.78 ATOM 6957 OD2 ASP E 49 55.931 44.151 41.4591.00 53.33 ATOM 6958 C ASP E 49 60.373 44.200 41.3301.00 48.39 ATOM 6959 0 ASP E 49 60.644 45.101 42.1181.00 48.55 ATOM 6960 N VAL E 50 60.950 44.085 40.1401.00 48.88 ATOM 6961 CA VAL E 50 62.011 44.988 39.7181.00 48.55 ATOM 6962 CB VAL E 50 63.353 44.220 39.7071.00 50.40 ATOM 6963 CG1 VAL E 50 63.428 43.303 38.4921.00 49.66 ATOM 6964 CG2 VAL E 50 64.511 45.188 39.7211.00 55.70 ATOM 6965 C VAL E 50 61.801 45.642 38.3541.00 47.28 ATOM 6966 0 VAL E 50 61.057 45.134 37.5231.00 48.34 ATOM 6967 N VAL E 51 62.467 46.777 38.1441.00 45.37 ATOM 6968 CA VAL E 51 62.407 47.540 36.8961.00 43.25 ATOM 6969 CB VAL E 51 61.930 48.993 37.1311.00 41.43 ATOM 6970 CG1 VAL E 51 62.118 49.820 35.8651.00 39.28 ATOM 6971 CG2 VAL E 51 60.478 49.000 37.5461.00 39.33 ATOM 6972 C VAL E 51 63.821 47.597 36.3331.00 44.33 ATOM 6973 0 VAL E 51 64.764 47.841 37.0781.00 46.78 ATOM 6974 N PHE E 52 63.978 47.383 35.0291.00 43.60 ATOM 6975 CA PHE E 52 65.304 47.416 34.4301.00 41.93 ATOM 6976 CB PHE E 52 65.997 46.085 34.6781.00 41.48 ATOM 6977 CG PHE E 52 65.275 44.917 34.0701.00 42.18 ATOM 6978 CD1 PHE E 52 65.486 44.566 32.7451.00 41.86 ATOM 6979 CD2 PHE E 52 64.347 44.200 34.8091.00 43.51 ATOM 6980 CE1 PHE E 52 64.784 43.527 32.1671.00 42.36 ATOM 6981 CE2 PHE E 52 63.638 43.153 34.2361.00 45.87 ATOM 6982 CZ PHE E 52 63.859 42.818 32.9111.00 43.76 ATOM 6983 C PHE E 52 65.239 47.675 32.9331.00 44.18 ATOM 6984 0 PHE E 52 64.183 47.574 32.3141.00 43.22 ATOM 6985 N TRP E 53 66.384 48.014 32.3541.00 46.10 ATOM 5986 CA TRP E 53 66.466 48.252 30.9271.00 47.08 ATOM 6987 CB TRP E 53 67.367 49.431 30.6141.00 46.54 ATOM 6988 CG TRP E 53 66.822 50.726 31.0151.00 49.25 ATOM 6989 CD2 TRP E 53 67.510 51.972 30.9911.00 51.55 ATOM 6990 CE2 TRP E 53 66.616 52.951 31.4711.00 52.89 ATOM 6991 CE3 TRP E 53 68.804 52.358 30.6141.00 53.33 ATOM 6992 CD1 TRP E 53 65.577 50.980 31.4861.00 50.42 ATOM 6993 NE1 TRP E 53 65.440 52.318 31.7651.00 52.93 ATOM 6994 CZ2 TRP E 53 66.969 54.299 31.5891.00 54.65 ATOM 6995 CZ3 TRP E 53 69.162 53.706 30.7301.00 55.02 ATOM 6996 CH2 TRP E 53 68.245 54.658 31.2151.00 56.13 ATOM 6997 C TRP E 53 67.070 47.018 30.3161.00 48.44 ATOM 6998 0 TRP E 53 68.201 46.680 30.6161.00 50.00 ATOM 6999 N GLN E 54 66.313 46.342 29.4651.00 49.02 ATOM 7000 CA GLN E 54 66.805 45.143 28.8181.00 49.56 ATOM 7001 CB GLN E 54 65.648 44.193 28.5171.00 50.24 ATOM '7002CG GLN E 54 66.076 42.837 28.0171.00 52.86 ATOM 7003 CD GLN E 54 65.043 41.768 28.3131.00 57.64 ATOM 7004 OE1 GLN E 54 64.668 41.564 29.4651.00 59.29 I8~
ATOM '7005NE2 GLNE 54 64.576 41.07827.275 1.00 58.15 ATOM 7006 c GLNE 54 67.500 45.58327.547 1.00 50.68 ATOM 7007 0 GLNE 54 66.972 45.45826.446 1.00 50.31 ATOM 7008 N GLNE 55 68.692 46.13227.735 1.00 53.08 ATOM '7009CA GLNE 55 69.534 46.62026.647 1.00 55.55 ATOM '7010CB GLNE 55 70.723 47.34227.257 1.00 57.75 ATOM '7011CG GLNE 55 71.798 47.75926.296 1.00 65.99 ATOM 7012 CD GLNE 55 72.759 48.74526.952 1.00 70.80 ATOM '7013OE1 GLNE 55 73.057 48.63728.158 1.00 74.02 1~ ATOM 7014 NE2 GLNE 55 73.245 49.71026.175 1.00 70.33 ATOM 7015 C GLNE 55 69.978 45.44625.768 1.00 54.06 ATOM 7016 0 GLNE 55 70.834 44.64826.147 1.00 55.16 ATOM '7017N THRE 56 69.370 45.35024.592 1.00 51.47 ATOM '7018CA THRE 56 69.638 44.26623.664 1.00 49.57 15 ATOM '7019CB THRE 56 68.340 43.52723.323 1.00 48.99 ATOM '7020OG1 THRE 56 67.621 43.25924.530 1.00 51.03 ATOM '7021CG2 THRE 56 68.638 42.22822.613 1.00 48.81 ATOM '7022C THRE 56 70.245 44.78022.374 1.00 48.56 ATOM '70230 THRE 56 69.919 45.87021.916 1.00 47.42 ATOM '7024N THRE 57 71.131 43.98421.789 1.00 48.33 ATOM 7025 CA THRE 57 71.778 44.37020.545 1.00 48.63 ATOM '7026CB THRE 57 73.079 45.15320.803 1.00 48.38 ATOM 7027 OG1 THRE 57 72.786 46.36921.504 1.00 49.73 ATOM '7028CG2 THRE 57 73.737 45.49819.488 1.00 53.54 25 ATOM '7029C THRE 57 72.115 43.16219.688 1.00 47.10 ATOM '70300 THRE 57 72.462 42.09420.196 1.00 47.16 ATOM 7031 N TRPE 58 71.996 43.33718.382 1.00 44.64 ATOM 7032 CA TRPE 58 72.302 42.27217.443 1.00 45.43 ATOM 7033 CB TRPE 58 71.217 41.18517.463 1.00 44.32 ATOM '7034CG TRPE 58 69.901 41.59016.907 1.00 41.75 ATOM 7035 CD2 TRPE 58 68.834 42.22517.617 1.00 41.25 ATOM '7036CE2 TRPE 58 67.800 42.45816.689 1.00 43.06 ATOM 7037 CE3 TRPE 58 68.653 42.62218.948 1.00 42.08 ATOM '7038CD1 TRPE 58 69.485 41.46315.622 1.00 39.77 35 ATOM 7039 NE1 TRPE 58 68.229 41.98215.477 1.00 43.20 ATOM 7040 CZ2 TRPE 58 66.598 43.07217.043 1.00 42.98 ATOM '7041CZ3 TRPE 58 67.462 43.23219.301 1.00 45.88 ATOM '7042CH2 TRPE 58 66.447 43.45118.347 1.00 46.11 ATOM '7043C TRPE 58 72.450 42.87216.060 1.00 46.92 ATOM 7044 0 TRPE 58 72.312 44.07915.874 1.00 46.99 ATOM '7045N SERE 59 72.737 42.03915.076 1.00 49.39 ATOM 7046 CA SERE 59 72.933 42.57113.738 1.00 52.86 ATOM '7047CB SERE 59 74.423 42.47713.382 1.00 55.16 ATOM 7048 OG SERE 59 74.777 43.36812.335 1.00 59.85 45 ATOM 7049 C SERE 59 72.093 41.87312.673 1.00 53.08 ATOM 7050 0 SERE 59 72.023 40.64012.621 1.00 50.22 ATOM 7051 N ASPE 60 71.461 42.68511.833 1.00 55.39 ATOM 7052 CA ASPE 60 70.616 42.20610.743 1.00 58.98 ATOM 7053 CB ASPE 60 69.144 42.50211.027 1.00 59.87 ATOM ',054CG ASPE 60 68.214 41.87110.006 1.00 61.83 ATOM 7055 OD1 ASPE 60 68.625 41.7018.835 1.00 62.51 ATOM 7056 OD2 ASPE 60 67.060 41.55610.374 1.00 62.82 ATOM 7057 C ASPE 60 71.041 42.9759.508 1.00 61.07 ATOM 7058 0 ASPE 60 70.599 44.1069.293 1.00 60.13 55 ATOM 7059 N ARGE 61 71.896 42.3518.701 1.00 63.73 ATOM 7060 CA ARGE 61 72.428 42.9897.501 1.00 66.18 ATOM 7061 CB ARGE 61 73.580 42.1556.908 1.00 70.24 ATOM 7062 CG ARGE 61 74.957 42.3087.596 1.00 74.18 ATOM 7063 CD ARGE 61 76.042. 41.6796.722 1.00 80.58 ATOM 7064 NE ARGE 61 77.411. 41.8557.223 1.00 86.19 ATOM 7065 CZ ARGE 61 78.505 41.3976.598 1.00 88.23 Igg ATOM 7066 NH1 ARG E 61 78.383 40.734 5.447 1.00 88.94 ATOM 7067 NH2 ARG E 61 79.724 41.603 7.111 1.00 88.58 ATOM '7068C ARG E 61 71.404 43.289 6.414 1.00 65.48 ATOM '70690 ARG E 61 71.655 44.145 5.561 1.00 65.84 ATOM '7070N THR E 62 70.25.5 42.610 6.439 1.00 64.00 ATOM 7071 CA THR E 62 69.232 42.842 5.410 1.00 61.93 ATOM '7072CB THR E 62 68.113 41.764 5.439 1.00 62.28 ATOM 7073 OG1 THR E 62 67.367 41.879 6.652 1.00 65.24 ATOM 7074 CG2 THR E 62 68.707 40.361 5.372 1.00 61.73 1~ ATOM '7075C THR E 62 68.602 44.218 5.595 1.00 59.03 ATOM '70760 THR E 62 67.827 44.676 4.761 1.00 57.27 ATOM '7077N LEU E 63 68.962 44.868 6.697 1.00 57.62 ATOM '7078CA LEU E 63 68.461 46.200 7.029 1.00 57.37 ATOM 7079 CB LEU E 63 68.214 46.316 8.543 1.00 55.66 15 ATOM '7080CG LIEUE 63 67.253 45.322 9.196 1.00 55.07 ATOM '7081CD1 LEU E 63 67.231 45.508 10.6921.00 52.03 ATOM '7082CD2 LEU E 63 65.875 45.519 8.612 1.00 55.09 ATOM 7083 C LEU E 63 69.47.1 47.277 6.625 1.00 57.97 ATOM 7084 0 LEU E 63 69.135 48.460 6.549 1.00 56.59 ATOM 7085 N ALA E 64 70.715 46.862 6.389 1.00 58.86 ATOM 7086 CA ALA E 64 71.770 47.798 6.018 1.00 60.30 ATOM 7087 CB ALA E 64 73.077 47.055 5.844 1.00 58.52 ATOM '7088C ALA E 64 71.440 48.571 4.745 1.00 61.25 ATOM '70890 ALA E 64 70.814 48.041 3.830 1.00 59.01 25 ATOM '7090N TRP E 65 71.845 49.832 4.702 1.00 63.42 ATOM '7091CA TRP E 65 71.619 50.631 3.514 1.00 67.05 ATOM '7092CB TRP E 65 70.406 51.537 3.704 1.00 66.45 ATOM '7093CG TRP E 65 70.513 52.506 4.835 1.00 66.84 ATOM '7094CD2 TRP E 65 70.173 52.266 6.209 1.00 67.35 ATOM '7095CE2 TRP E 65 70.352 53.488 6.904 1.00 67.71 ATOM 7096 CE3 TRP E 65 69.730 51.141 6.920 1.00 65.56 ATOM '7097CD1 TRP E 65 70.882 53.816 4.756 1.00 66.32 ATOM '7098NEl TRP E 65 70.785 54.415 5.993 1.00 67.91 ATOM 7099 CZ2 TRP E 65 70.101 53.615 8.270 1.00 65.59 35 ATOM '7100CZ3 TRP E 65 69.483 51.267 8.272 1.00 64.14 ATOM '7101CH2 TRP E 65 69.668 52.497 8.935 1.00 65.02 ATOM 7102 C TRP E 65 72.874 51.449 3.253 1.00 69.81 ATOM '71030 TRP E 65 73.908 51.237 3.902 1.00 70.35 ATOM 7104 N ASN E 66 72.801 52.370 2.297 1.00 71.64 40 ATOM '7105CA ASN E 66 73.956 53.203 1.999 1.00 72.49 ATOM 7106 CB ASN E 66 74.174 53.318 0.486 1.00 73.41 ATOM 7107 CG ASN E 66 75.497 53.990 0.131 1.00 75.13 ATOM '7108OD1 ASN E 66 75.513 55.081 -0.4561.00 76.49 ATOM 7109 ND2 ASN E 66 76.614 53.347 0.487 1.00 73.59 45 ATOM '7110C ASN E 66 73.707 54.561 2.602 1.00 72.73 ATOM 7111 0 ASN E 66 72.930 55.361 2.068 1.00 72.23 ATOM 7112 N SER E 67 74.367 54.810 3.726 1.00 74.00 ATOM '7113CA SER E 67 74.231 56.076 4.441 1.00 76.61 ATOM 7114 CB SER E 67 74.159 55.805 5.942 1.00 76.40 ATOM '7115OG SER E 67 75.161 54.878 6.307 1.00 75.84 ATOM 7116 C SER E 67 75.378 57.041 4.150 1.00 78.08 ATOM '71170 SER E 67 75.512 58.093 4.807 1.00 77.79 ATOM 7118 N SER E 68 76.199 56.678 3.162 1.00 79.24 ATOM '7119CA SER E 68 77.353 57.486 2.769 1.00 79.93 55 ATOM '7120CB SER E 68 78.217 56.734 1.730 1.00 80.16 ATOM '7121OG SER E 68 77.535 56.523 0.495 1.00 81.02 ATOM 7122 C SER E 68 76.896 58.835 2.219 1.00 79.10 ATOM 7123 0 SER E 68 77.586 59.471 1.411 1.00 79.89 ATOM 7124 N HIS E 69 75.722 59.261 2.664 1.00 77.21 60 ATOM '7125CA HIS E 69 75.176 60.529 2.247 1.00 76.33 ATOM '7126CB HIS E 69 75.229 60.665 0.732 1.00 76.74 ATOM 7127 CG HISE 69 75.366 62.0830.283 1.00 77.46 ATOM 7128 CD2 HISE 69 74.568 62.857-0.491 1.00 76.01 ATOM 7129 ND1 HISE 69 76.390 62.8980.720 1.00 75.50 ATOM 7130 CE1 HISE 69 76.212 64.1140.239 1.00 74.91 'rJATOM 7131 NE2 HISE 69 75.115 64.117-0.497 1.00 77.04 ATOM 7132 C HISE 69 73.748 60.6412.716 1.00 75.96 ATOM 7133 0 HISE 69 72.954 61.4082.170 1.00 75.96 ATOM 7134 N SERE 70 73.431 59.8803.754 1.00 75.27 ATOM 7135 CA SERE 70 72.086 59.8674.308 1.00 72.77 1~ ATOM 7136 CB SERE 70 71.307 58.7583.639 1.00 71.14 ATOM ?137 OG SERE 70 72.085 57.5783.703 1.00 68.45 ATOM 7138 C SERE 70 72.177 59.5855.806 1.00 72.84 ATOM 7139 0 SE:RE 70 73.254 59.2126.304 1.00 73.59 ATOM 7140 N PROE 71 71.065 59.7896.550 1.00 71.65 15 ATOM 7141 CD PROE 71 69.793 60.4346.160 1.00 70.63 ATOM 7142 CA PROE 71 71.091 59.5217.989 1.00 69.54 ATOM 7143 CB PROE 71 69.627 59.6498.376 1.00 69.50 ATOM 7144 CG PROE 71 69.172 60.7837.505 1.00 69.75 ATOM 7145 C PROE 71 71.611 58.1048.128 1.00 67.45 ATOM 7146 0 PROE 71 71.371 57.2887.249 1.00 67.47 ATOM 7147 N ASPE 72 72.332 57.8139.202 1.00 65.90 ATOM 7148 CA ASPE 72 72.888 56.4809.401 1.00 65.38 ATOM 7149 CB ASPE 72 74.336 56.5959.864 1.00 66.99 ATOM ;150 CG ASPE 72 74.623 57.93310.513 1.00 69.68 25 ATOM 7151 OD1 ASPE 72 75.809 58.34910.511 1.00 72.85 ATOM ?152 OD2 ASPE 72 73.659 58.56411.022 1.00 69.14 ATOM 7153 C ASPE 72 72.078 55.65610.387 1.00 64.69 ATOM ;'1540 ASPE 72 72.273 54.43810.492 1.00 62.72 ATOM 7155 N GLNE 73 71.194 56.33411.122 1.00 63.38 ATOM 7156 CA GLNE 73 70.291 55.69212.073 1.00 62.59 ATOM 7157 CB GLNE 73 70.703 55.96813.502 1.00 63.56 ATOM 7158 CG GLNE 73 71.812 55.14714.064 1.00 66.36 ATOM 7159 CD GLNE 73 72.073 55.60115.478 1.00 69.74 ATOM 7160 OE1 GLNE 73 72.311 56.79415.711 1.00 71.52 35 ATOM 7161 NE2 GLNE 73 72.005 54.67616.437 1.00 70.16 ATOM 7162 C GLNE 73 68.850 56.18911.932 1.00 60.94 ATOM 7163 O GLNE 73 68.599 57.33611.548 1.00 60.74 ATOM 7164 N VALE 74 67.910 55.31812.281 1.00 57.54 ATOM 7165 CA VALE 74 66.495 55.65212.254 1.00 54.00 4~ ATOM ?166 CB VALE 74 65.857 55.29610.901 1.00 52.88 ATOM ?167 CG1 VALE 74 66.391 56.2019.814 1.00 52.07 ATOM 7168 CG2 VALE 74 66.151 53.84610.564 1.00 53.11 ATOM ?169 C VALE 74 65.816 54.84413.349 1.00 51.46 ATOM ?170 0 VALE 74 66.355 53.83813.804 1.00 51.44 45 ATOM ?171 N SERE 75 64.649 55.29913.789 1.00 48.05 ATOM 7172 CA SERE 75 63.893 54.59214.812 1.00 45.32 ATOM ?173 CB SERE 75 63.222 55.58315.761 1.00 44.86 ATOM ?174 OG SERE 75 64.122 56.02216.763 1.00 42.99 ATOM ?175 C SERE 75 62.846 53.72714.123 1.00 45.51 ATOM 7176 0 SERE 75 61.959 54.22813.431 1.00 45.94 ATOM 7177 N VALE 76 62.953 52.42014.325 1.00 44.89 ATOM ',178CA VALE 76 62.052 51.46313.706 1.00 43.76 ATOM ?179 CB VALE 76 62.857 50.40012.943 1.00 44.31 ATOM ?180 CG1 VALE 76 61.930 49.41112.296 1.00 45.29 55 ATOM ?181 CG2 VALE 76 63.734 51.06011.907 1.00 45.23 ATOM ?182 C VALE 76 61.169 50.75114.718 1.00 43.81 ATOM 7183 0 VALE 76 61.641 50.33115.772 1.00 46.08 ATOM 7184 N PROE 77 59.868 50.61214.418 1.00 41.91 ATOM 7185 CD PROE 77 59.085 51.23813.344 1.00 41.05 ATOM 7186 CA PROE 77 58.98? 49.92315.360 1.00 39.46 ATOM ?187 CB PROE 77 57.619 50.07614.719 1.00 39.68 ATOM 7188 CG PRO E 77 57.736 51.362 13.9811.00 41.25 ATOM 7189 C PRO E 77 59.407 48.464 15.4561.00 39.33 ATOM 7190 0 PRO E 77 59.766 47.848 14.4571.00 39.91 ATOM '7191N ILE E 78 59.368 47.929 16.6651.00 39.53 ATOM '7192CA ILE E 78 59.729 46.550 16.9381.00 39.36 ATOM 7193 CB II~EE 78 59.440 46.235 18.4081.00 41.90 ATOM 7194 CG2 ILE E 78 59.421 44.753 18.6671.00 44.69 ATOM 7195 CG1 ILE E 78 60.512 46.887 19.2591.00 45.61 ATOM 7196 CD1 ILE E 78 61.904 46.569 18.7831.00 45.82 ATOM 7197 C ILE E 78 59.002 45.562 16.0481.00 39.58 ATOM 7198 0 ILE E 78 59.556 44.550 15.6451.00 39.79 ATOM 7199 N SER E 79 57.755 45.870 15.7291.00 41.50 ATOM '7200CA SER E 79 56.932 45.011 14.8911.00 41.99 ATOM 7201 CB SER E 79 55.497 45.502 14.9311.00 40.86 ATOM 7202 OG SER E 79 55.441 46.876 14.6331.00 44.60 ATOM 7203 C SER E 79 57.370 44.887 13.4411.00 43.24 ATOM '72040 SER E 79 56.883 44.020 12.7301.00 43.62 ATOM '7205N SER E 80 58.278 45.750 12.9961.00 44.61 ATOM '7206CA SER E 80 58.751 45.713 11.6191.00 44.15 ATOM '7207CB SER E 80 58.841 47.133 11.0621.00 43.26 ATOM '7208OG SER E 80 57.568 47.744 11.0171.00 47.92 ATOM '7209C SER E 80 60.110 45.033 11.4821.00 45.19 ATOM 7210 0 SER E 80 60.661 44.963 10.3871.00 46.20 ATOM 7211 N LEU E 81 60.645 44.533 12.5891.00 42.25 ATOM 7212 CA LEU E 81 61.949 43.891 12.5771.00 42.76 ATOM 7213 CB LEU E 81 62.950 44.702 13.4001.00 41.44 ATOM 7214 CG LEU E 81 63.144 46.190 13.1501.00 39.51 ATOM '7215CDl LEU E 81 63.861 46.826 14.3141.00 38.48 ATOM 7216 CD2 LEU E 81 63.908 46.367 11.8911.00 43.00 ATOM 7217 C LEU E 81 61.846 42.530 13.2161.00 42.93 ATOM 7218 0 LEU E 81 60.845 42.221 13.8651.00 47.16 ATOM 7219 N TRP E 82 62.880 41.715 13.0281.00 39.63 ATOM 7220 CA TRP E 82 62.925 40.412 13.6571.00 38.60 ATOM '7221CB TRP E 82 63.872 39.465 12.9411.00 37.23 ATOM 7222 CG TRP E 82 64.186 38.241 13.7531.00 39.34 ATOM 7223 CD2 TRP E 82 65.272 38.087 14.6781.00 41.49 ATOM '7224CE2 TRP E 82 65.142 36.811 15.2661.00 40.40 ATOM '7225CE3 TRP E 82 66.344 38.909 15.0711.00 41.39 ATOM 7226 CD1 TRP E 82 63.469 37.086 13.8141.00 37.83 ATOM 7227 NE1 TRP E 82 64.032 36.222 14.7191.00 40.75 ATOM 7228 CZ2 TRP E 82 66.044 36.335 16.2281.00 39.91 ATOM '7229CZ3 TRP E 82 67.23'7 38.436 16.0251.00 38.98 ATOM '7230CH2 TRP E 82 67.080 37.161 16.5911.00 40.84 ATOM '7231C TRP E 82 63.513 40.766 14.9991.00 38.10 ATOM 7232 0 TRP E 82 64.356 41.636 15.0861.00 39.18 ATOM 7233 N VAL E 83 63.068 40.104 16.0491.00 39.36 ATOM 7234 CA VAL E 83 63.578 40.395 17.3671.00 38.27 ATOM '7235CB VAL E 83 62.562 41.277 18.1411.00 39.12 ATOM '7236CG1 VAL E 83 62.919 41.352 19.5961.00 43.60 ATOM '7237CG2 VAL E 83 62.557 42.678 17.5651.00 38.09 ATOM '7238C VAL E 83 63.853 39.081 18.0891.00 37.11 ATOM 7239 0 VAL E 83 63.154 38.098 17.8961.00 39.80 ATOM 7240 N PRO E 84 64.909 39.039 18.8991.00 35.89 ATOM '7241CD PRO E 84 65.921 40.088 19.0751.00 38.94 ATOM '7242CA PRO E 84 65.276 37.842 19.6511.00 35.46 ATOM 7243 CB PRO E 84 66.485 38.306 20.4561.00 36.52 ATOM '7244CG PRO E 84 67.087 39.306 19.6001.00 37.91 ATOM '7245C PRO E 84 64.134 37.398 20.5551.00 36.04 ATOM '72460 PRO E 84 63.541 38.220 21.2461.00 34.75 ATOM '7247N ASP E 85 63.839 36.103 20.5651.00 33.87 ATOM '7248CA ASP E 85 62.771 35.595 21.4001.00 35.26 1~1 ATOM 7249 CB ASPE 85 62.150 34.350 20.779 1.0037.18 ATOM 7250 CG ASPE 85 63.150 33.259 20.556 1.0040.21 ATOM 7251 OD1 ASPE 85 64.268 33.583 20.129 1.0041.52 ATOM 7252 OD2 ASPE 85 62.828 32.079 20.789 1.0038.39 ATOM 7253 C ASPE 85 63.277 35.290 22.794 1.0036.88 ATOM 7254 0 ASPE 85 63.139 34.174 23.287 1.0037.96 ATOM 7255 N LEUE 86 63.848 36.307 23.427 1.0034.95 ATOM 7256 CA LEUE 86 64.387 36.185 24.769 1.0036.75 ATOM 7257 CB LEUE 86 65.211 37.414 25.116 1.0036.06 1~ ATOM 7258 CG LEUE 86 66.410 37.646 24.221 1.0034.31 ATOM 7259 CD1 LEUE 86 67.131 38.893 24.653 1.0032.72 ATOM 7260 CD2 LEUE 86 67.300 36.446 24.287 1.0035.49 ATOM 7261 C LEUE 86 63.317 36.021 25.816 1.0037.61 ATOM 7262 0 LEUE 86 62.226 36.557 25.694 1.0041.91 15 ATOM 7263 N ALAE 87 63.652 35.293 26.865 1.0038.39 ATOM 7264 CA ALAE 87 62.727 35.060 27.949 1.0039.76 ATOM 7265 CB ALAE 87 61.950 33.766 27.692 1.0037.37 ATOM 7266 C ALAE 87 63.510 34.959 29.255 1.0041.61 ATOM 7267 0 ALAE 87 64.583 34.372 29.288 1.0042.91 ATOM 7268 N ALAE 88 62.989 35.550 30.323 1.0041.72 ATOM 7269 CA ALAE 88 63.639 35.460 31.624 1.0040.16 ATOM 7270 CB ALAE 88 63.259 36.638 32.480 1.0038.02 ATOM 7271 C ALAE 88 63.154 34.168 32.261 1.0041.60 ATOM 7272 0 ALAE 88 62.028 34.089 32.740 1.0043.75 25 ATOM 7273 N TYRE 89 64.008 33.152 32.245 1.0043.12 ATOM 7274 CA TYRE 89 63.691 31.832 32.793 1.0044.73 ATOM 7275 CB TYRE 89 64.970 31.010 32.900 1.0047.55 ATOM 7276 CG TYRE 89 65.633 30.711 31.573 1.0053.63 ATOM 7277 CD1 TYRE 89 66.903 30.120 31.521 1.0054.69 30 ATOM 7278 CE1 TYRE 89 67.519 29.831 30.311 1.0056.44 ATOM 7279 CD2 TYRE 89 64.995 31.006 30.368 1.0056.01 ATOM 7280 CE2 TYRE 89 65.599 30.720 29.147 1.0058.87 ATOM 7281 CZ TYRE 89 66.860 30.131 29.125 1.0058.82 ATOM 7282 OH TYRE 89 67.437 29.821 27.908 1.0064.15 35 ATOM 7283 C TYRE 89 62.959 31.792 34.138 1.0044.61 ATOM 7284 0 TYRE 89 62.113 30.920 34.362 1.0043.17 ATOM 7285 N ASNE 90 63.275 32.723 35.036 1.0043.58 ATOM 7286 CA ASNE 90 62.621 32.729 36.338 1.0043.92 ATOM 7287 CB ASNE 90 63.658 32.682 37.469 1.0041.30 40 ATOM 7288 CG ASNE 90 64.654 33.809 37.401 1.0040.93 ATOM 7289 OD1 ASNE 90 65.197 34.116 36.341 1.0040.18 ATOM 7290 ND2 ASNE 90 64.914 34.425 38.542 1.0042.13 ATOM 7291 C ASNE 90 61.668 33.894 36.538 1.0045.22 ATOM 7292 0 ASNE 90 61.397 34.296 37.668 1.0045.17 45 ATOM 7293 N ALAE 91 61.170 34.437 35.432 1.0046.14 ATOM 7294 CA ALAE 91 60.207 35.526 35.482 1.0044.27 ATOM 7295 CB ALAE 91 59.974 36.095 34.110 1.0043.16 ATOM 7296 C ALAE 91 58.937 34.881 36.006 1.0045.11 ATOM 7297 0 ALAE 91 58.543 33.800 35.577 1.0043.27 ATOM 7298 N ILEE 92 58.306 35.569 36.940 1.0046.13 ATOM 7299 CA ILEE 92 57.111 35.100 37.611 1.0045.40 ATOM 7300 CB ILEE 92 57.301 35.365 39.123 1.0049.00 ATOM 7301 CG2 ILEE 92 56.517 36.598 39.568 1.0053.30 ATOM 7302 CG1 ILEE 92 56.883 34.165 39.929 1.0050.53 55 ATOM 7303 CD1 ILEE 92 56.902 34.482 41.419 1.0057.12 ATOM 7304 C ILEE 92 55.863 35.805 37.060 1.0043.27 ATOM 7305 0 ILEE 92 54.745 35.458 37.395 1.0040.97 ATOM 7306 N SERE 93 56.078 36.806 36.216 1.0042.51 ATOM 7307 CA SERE 93 55.001 37.573 35.599 1.0041.03 ATOM 7308 CB SERE 93 54.765 38.864 36.362 1.0040.45 ATOM 7309 OG SERE 93 55.849 39.756 36.170 1.0040.42 ATOM 7310 C SERE 93 55.497 37.92534.214 1.00 41.98 ATOM 7311 0 SERE 93 56.686 37.78133.932 1.00 43.61 ATOM 7312 N LYSE 94 54.617 38.38033.333 1.00 41.47 ATOM 7313 CA LYSE 94 55.109 38.73832.018 1.00 44.98 ATOM 7314 CB LYSE 94 54.037 38.56130.942 1.00 44.95 ATOM 7315 CG LYSE 94 52.663 39.07131.264 1.00 48.24 ATOM 7316 CD LYSE 94 51.659 38.49930.255 1.00 50.47 ATOM 7317 CE LYSE 94 52.173 38.62828.822 1.00 53.56 ATOM 7318 NZ LYSE 94 51.218 38.12527.795 1.00 54.79 ATOM 7319 C LYSE 94 55.675 40.15132.031 1.00 45.16 ATOM 7320 0 LYSE 94 55.386 40.93932.933 1.00 46.22 ATOM 7321 N PROE 95 56.514 40.48131.038 1.00 43.95 ATOM 7322 CD PROE 95 56.973 39.63329.926 1.00 42.19 ATOM 7323 CA PROE 95 57.131 41.80230.957 1.00 43.02 ATOM 7324 CB PROE 95 58.076 41.67129.768 1.00 42.81 ATOM 7325 CG PROE 95 58.306 40.21629.636 1.00 42.27 ATOM 7326 C PROE 95 56.162 42.93930.761 1.00 42.70 ATOM 7327 0 PROE 95 55.320 42.89929.870 1.00 46.65 ATOM 7328 N GLUE 96 56.269 43.95231.601 1.00 40.32 ATOM 7329 CA GLUE 96 55.424 45.11531.446 1.00 41.45 ATOM 7330 CB GLUE 96 54.910 45.63532.797 1.00 42.90 ATOM 7331 CG GLUE 96 53.911 46.79732.674 1.00 47.98 ATOM 7332 CD GLUE 96 53.396 47.30834.024 1.00 50.94 ATOM 7333 OE1 GLUE 96 53.482 46.53935.005 1.00 53.57 25 ATOM 7334 OE2 GLUE 96 52.894 48.46234.102 1.00 47.79 ATOM 7335 C GLUE 96 56.372 46.12330.830 1.00 40.44 ATOM 7336 0 GLUE 96 57.143 46.76231.538 1.00 42.91 ATOM 7337 N VALE 97 56.348 46.22729.506 1.00 36.63 ATOM 7338 CA VALE 97 57.200 47.16528.800 1.00 34.15 ATOM 7339 CB VALE 97 57.230 46.85027.311 1.00 31.33 ATOM 7340 CG1 VALE 97 58.136 47.81426.596 1.00 31.45 ATOM 7341 CG2 VALE 97 57.708 45.44427.113 1.00 28.98 ATOM 7342 C VALE 97 56.665 48.57629.041 1.00 35.79 ATOM 7343 0 VALE 97 55.558 48.93228.636 1.00 35.88 35 ATOM 7344 N LEUE 98 57.474 49.37829.714 1.00 35.63 ATOM 7345 CA LEUE 98 57.091 50.72530.086 1.00 36.41 ATOM 7346 CB LEUE 98 57.787 51.09831.395 1.00 34.14 ATOM 7347 CG LEUE 98 57.676 50.17632.598 1.00 33.56 ATOM 7348 CD1 LEUE 98 58.694 50.57033.602 1.00 31.56 ATOM 7349 CD2 LEUE 98 56.306 50.24833.190 1.00 33.37 ATOM 7350 C LEUE 98 57.400 51.79329.058 1.00 36.97 ATOM 7351 0 LEUE 98 56.969 52.93629.203 1.00 38.13 ATOM 7352 N THRE 99 58.133 51.42628.018 1.00 35.68 ATOM 7353 CA THRE 99 58.533 52.39127.011 1.00 34.41 45 ATOM 7354 CB THRE 99 60.067 52.54727.032 1.00 35.73 ATOM 7355 OG1 THRE 99 60.683 51.26526.850 1.00 39.59 ATOM 7356 CG2 THRE 99 60.517 53.12228.355 1.00 34.05 ATOM 7357 C THRE 99 58.098 52.08425.589 1.00 33.50 ATOM 7358 0 THRE 99 57.696 50.96925.283 1.00 33.37 ATOM 7359 N PROE 100 58.155 53.09324.701 1.00 34.01 ATOM 7360 CD PR.OE 100 58.424 54.51424.975 1.00 36.06 ATOM 7361 CA PR.OE 100 57.777 52.91923.302 1.00 33.45 ATOM 7362 CB PR.OE 100 58.227 54.22322.669 1.00 31.60 ATOM 7363 CG PR.OE 100 57.906 55.19023.725 1.00 32.57 55 ATOM 7364 C PR.OE 100 58.529 51.71922.769 1.00 35.44 ATOM 7365 0 PROE 100 59.713 51.54623.041 1.00 35.44 ATOM 7366 N GLNE 101 57.844 50.86822.029 1.00 37.12 ATOM 7367 CA GLNE 101 58.514 49.70121.516 1.00 38.35 ATOM 7368 CB GLNE 101 57.551 48.53221.476 1.00 39.07 ATOM 7369 CG GLNE 101 57.398 47.92122.845 1.00 43.00 ATOM 7370 CD GLNE 101 56.194 47.03722.948 1.00 48.55 ATOM 7371 OE1GLN E101 56.055 46.068 22.194 1.0050.74 8 ATOM 7372 NE2GLN E101 55.298 47.359 23.885 1.0048.45 7 ATOM 7373 C GLN E101 59.146 49.950 20.181 1.0037.98 6 ATOM '7374 0 GLN E101 58.749 49.374 19.177 1.0036.86 8 ATOM 7375 N LEU E102 60.153 50.825 20.213 1.0039.66 7 ATOM '7376 CA LEU E102 60.935 51.230 19.046 1.0038.89 6 ATOM '7377 CB LEU E102 60.911 52.749 18.880 1.0036.07 6 ATOM 7378 CG LEU E102 59.545 53.416 18.766 1.0036.30 6 ATOM 7379 CD1LEU E102 59.712 54.906 18.615 1.0037.57 6 ATOM 7380 CD2LEU E102 58.809 52.853 17.571 1.0037.42 6 ATOM '7381 C LEU E102 62.374 50.791 19.207 1.0037.90 6 ATOM '7382 0 LEU E102 62.909 50.784 20.312 1.0040.06 8 ATOM 7383 N ALA E103 62.995 50.408 18.102 1.0037.36 7 ATOM 7384 CA ALA E103 64.395 50.007 18.127 1.0038.78 6 ATOM 7385 CB ALA E103 64.577 48.634 17.504 1.0037.72 6 ATOM 7386 C ALA E103 65.193 51.039 17.351 1.0038.02 6 ATOM 7387 0 ALA E103 64.645 51.890 16.666 1.0038.29 8 ATOM 7388 N ARG E104 66.500 50.969 17.469 1.0040.78 7 ATOM 7389 CA ARG E104 67.344 51.911 16.770 1.0044.75 6 ATOM 7390 CB ARG E104 68.258 52.612 "7.771 1.0044.40 6 ATOM 7391 CG ARG E104 68.873 53.873 17.251 1.0045.66 6 ATOM 7392 CD ARG E104 67.868 54.956 16.983 1.0043.79 6 ATOM 7393 NE ARG E104 68.570 56.118 16.456 1.0046.54 7 ATOM 7394 CZ ARG E104 68.008 57.289 16.175 1.0046.54 6 25 ATOM 7395 NH1ARG E104 66.711 57.493 16.365 1.0047.66 7 ATOM 7396 NH2ARG E104 68.760 58.266 15.698 1.0049.69 7 ATOM 7397 C ARG E104 68.142 51.099 15.763 1.0046.58 6 ATOM 7398 0 ARG E104 68.775 50.105 16.119 1.0047.46 8 ATOM 7399 N VAL E105 68.081 51.492 14.497 1.0048.34 7 3o ATOM 7400 CA VAL E105 68.808 50.761 13.475 1.0049.67 6 ATOM 7401 CB VAL E105 67.869 50.244 12.388 1.0049.06 6 ATOM 7402 CG1VAL E105 68.643 49.361 11.431 1.0049.26 6 ATOM 7403 CG2VAL E105 66.731 49.478 13.010 1.0049.99 6 ATOM 7404 C VAL E105 69.883 51.601 12.805 1.0051.57 6 35 ATOM 7405 0 VAL E105 69.606 52.684 12.272 1.0049.78 8 ATOM 7406 N VAL E106 71.109 51.077 12.834 1.0053.67 7 ATOM 7407 CA VAL E106 72.265 51.738 12.232 1.0055.11 6 ATOM 7408 CB VAL E106 73.537 51.409 13.009 1.0054.77 6 ATOM 7409 CG1VAL E106 74.666 52.300 12.539 1.0055.46 6 ATOM 7410 CG2VAL E106 73.283 51.577 14.507 1.0057.64 6 ATOM 7411 C VAL E106 72.428 51.253 10.795 1.0055.88 6 ATOM 7412 0 VAL E106 72.213 50.075 10.508 1.0057.82 8 ATOM 7413 N SER E107 72.812 52.153 9.897 1.0055.80 7 ATOM 7414 CA SER E107 72.972 51.812 8.486 1.0055.14 6 45 ATOM 7415 CB SER E107 73.610 52.984 7.740 1.0055.20 6 ATOM 7416 OG SER E107 74.708 53.503 8.470 1.0058.75 8 ATOM 7417 C SER E107 73.738 50.530 8.175 1.0054.04 6 ATOM 7418 0 SER E107 73.578 49.966 7.096 1.0052.93 8 ATOM 7419 N ASP E108 74.558 50.062 9.105 1.0053.77 7 ATOM 7420 CA ASP E108 75.324 48.847 8.862 1.0056.74 6 ATOM 7421 CB ASP E108 76.691 48.938 9.548 1.0058.54 6 ATOM 7422 CG ASP E108 76.597 48.911 11.055 1.0061.09 6 ATOM 7423 OD1ASP E108 75.653 49.522 11.599 1.0063.34 8 ATOM 7424 OD2ASP E"~08 77.479 48.296 11.694 1.0061.64 8 55 ATOM 7425 C ASP E108 74.612 47.563 9.288 1.0058.86 6 ATOM 7426 0 ASP E108 75.213 46.484 9.278 1.0058.05 8 ATOM 7427 N GLY E109 73.337 47.686 9.662 1.0060.25 7 ATOM 7428 CA GLY E109 72.559 46.528 10.072 1.0060.49 6 ATOM 7429 C GLY E109 72.581 46.229 11.563 1.0061.38 6 ATOM 7430 0 GLY E109 72.031 45.211 12.011 1.0060.99 8 ATOM 7431 N GLU E110 73.215 47.100 12.342 1.0061.69 7 ATOM 7432 CA GLU E110 73.283 46.899 13.7871.00 61.54 ATOM 7433 CB GLU E110 74.432 47.720 14.3911.00 64.16 ATOM 7434 CG GLU E110 74.946 47.231 15.7551.00 67.88 ATOM 7435 CD GLU E110 75.559 45.828 15.6841.00 72.22 ATOM 7436 OE1GLU E110 75.936 45.401 14.5541.00 72.61 ATOM 7437 OE2GLU E110 75.676 45.165 16.7581.00 70.57 ATOM 7438 C GLU E110 71.948 47.368 14.3471.00 60.20 ATOM 7439 O GLU E110 71.421 48.418 13.9491.00 59.08 ATOM 7440 N VAL E111 71.403 46.581 15.2661.00 57.63 1~ ATOM 7441 CA VAL E111 70.116 46.893 15.8851.00 54.53 ATOM 7442 CB VAL E111 69.065 45.797 15.5571.00 53.43 ATOM 7443 CG1VAL E111 67.728 46.159 16.1781.00 53.30 ATOM 7444 CG2VAL E111 68.932 45.631 14.0531.00 52.07 ATOM 7445 C VAL E111 70.231 47.017 17.4061.00 52.96 1~ ATOM 7446 0 VAL E111 70.846 46.170 18.0661.00 52.11 ATOM 7447 N LEU E112 69.641 48.070 17.9611.00 50.09 ATOM 7448 CA LEU E112 69.687 48.261 19.3991.00 50.92 ATOM 7449 CB LEU E112 70.546 49.468 19.7701.00 55.28 ATOM 7450 CG LEU E112 71.820 49.846 18.9921.00 58.58 20 ATOM 7451 CD1LEU E112 72.649 48.603 18.6291.00 59.41 ATOM 7452 CD2LEU E112 71.428 50.603 17.7421.00 58.46 ATOM 7453 C LEU E112 68.286 48.485 19.9301.00 50.61 ATOM 7454 0 LEU E112 67.628 49.437 19.5351.00 50.59 ATOM 7455 N TYR E113 67.835 47.597 20.8161.00 49.12 25 ATOM 7456 CA TYR E113 66.514 47.690 21.4201.00 46.39 ATOM 7457 CB TYR E113 65.635 46.500 21.0031.00 45.58 ATOM 7458 CG TYR E113 64.235 46.491 21.6101.00 44.58 ATOM 7459 CD1TYR E113 63.453 47.650 21.6551.00 45.06 ATOM 7460 CE1TYR E113 62.162 47.632 22.1771.00 44.35 ATOM 7461 CD2TYR E113 63.684 45.318 22.1051.00 43.68 ATOM 7462 CE2TYR E113 62.395 45.287 22.6291.00 45.23 ATOM 7463 CZ TYR E113 61.633 46.444 22.6631.00 46.53 ATOM 7464 OH TYR E113 60.346 46.399 2.3.1831.00 46.01 ATOM 7465 C TYR E113 66.721 47.679 22.9151.00 46.41 35 ATOM 7466 0 TYR E113 67.194 46.697 23.4631.00 46.43 ATOM 7467 N MJT E114 66.363 48.774 23.5721.00 46.91 ATOM 7468 CA MET E114 66.539 48.880 25.0111.00 48.35 ATOM 7469 CB MET E114 67.635 49.889 25.3151.00 51.44 ATOM 7470 CG MET E114 68.053 49.906 26.7371.00 56.27 ATOM 7471 SD MET E114 68.981 51.368 27.0171.00 65.32 ATOM 7472 CE MST E114 70.586 50.862 26.4251.00 63.97 ATOM 7473 C MET E114 65.255 49.320 25.6971.00 48.66 ATOM 7474 0 MET E114 65.095 50.494 26.0361.00 50.19 ATOM 7475 N PRO E115 64.325 48.383 25.9201.00 48.19 45 ATOM 7476 CD PRO E115 64.341 46.978 25.4671.00 47.93 ATOM 7477 CA PRO E115 63.056 48.702 26.5721.00 46.04 ATOM 7478 CB PRO E115 62.150 47.590 26.0771.00 46.59 ATOM 7479 CG PRO E115 63.080 46.411 26.0831.00 45.01 ATOM 7480 C PRO E115 63.184 48.685 28.0801.00 44.33 ATOM 7481 0 PRO E115 63.997 47.940 28.6191.00 44.22 ATOM 7482 N SER E116 62.397 49.510 28.7611.00 41.95 ATOM 7483 CA SER E116 62.428 49.514 30.2171.00 42.78 ATOM 7484 CB SER E116 62.113 50.884 30.7731.00 41.77 ATOM 7485 OG SER E116 62.191 50.841 32.1811.00 44.88 55 ATOM 7486 C SER E116 61.344 48.533 30.6431.00 43.69 ATOM 7487 0 SER E116 60.196 48.672 30.2461.00 46.37 ATOM 7488 N ILE E117 61.704 47.544 31.4491.00 42.70 ATOM 7489 CA ILE E117 60.'75.146.534 31.8511.00 40.36 ATOM 7490 CB ILE E117 61.182 45.152 31.3041.00 39.17 60 ATOM 7491 CG2ILE E117 60.25.1 44.080 31.7921.00 39.63 ATOM 7492 CGlILE E117 61.207 45.173 29.7871.00 38.62 ATOM 7493 CD1 ILE E117 61.883 43.98529.185 1.00 35.746 ATOM 7494 C ILE E117 60.561 46.38733.349 1.00 43.146 ATOM 7495 0 ILE E117 61.525 46.40034.116 1.00 44.328 ATOM 7496 N ARG E118 59.305 46.26633.768 1.00 43.037 ATOM 7497 CA ARG E118 59.014 46.00935.170 1.00 42.466 ATOM 7498 CB ARG E118 57.907 46.89735.710 1.00 40.986 ATOM 7499 CG ARG E118 57.537 46.48437.113 1.00 39.326 ATOM 7500 CD ARG E118 56.671 47.48237.827 1.00 40.326 ATOM 7501 NE ARG E118 56.321 46.98539.155 1.00 40.467 1~ ATOM 7502 CZ ARG E118 55.762 47.71740.108 1.00 38.256 ATOM 7503 NH1 ARG E118 55.485 48.99139.899 1.00 41.077 ATOM 7504 NH2 ARG E118 55.486 47.17541.273 1.00 37.407 ATOM 7505 C ARG E118 58.552 44.55735.140 1.00 41.736 ATOM 7506 0 ARG E118 57.738 44.18534.309 1.00 41.598 15 ATOM 7507 N GLN E119 59.071 43.73136.036 1.00 42.607 ATOM 7508 CA GLN E119 58.718 42.32136.016 1.00 43.626 ATOM '7509CB GLN E119 59.460 41.67134.842 1.00 41.246 ATOM '7510CG GLN E119 59.220 40.21134.624 1.00 40.906 ATOM '7511CD GLN E119 59.795 39.74933.304 1.00 40.756 ATOM '7512OE1 GLN E119 60.829 40.22732.879 1.00 41.448 ATOM '7513NE2 GLN E119 59.126 38.80732.654 1.00 44.307 ATOM 7514 C GLN E119 59.085 41.65837.337 1.00 44.856 ATOM 7515 0 GIN E119 60.030 42.05938.006 1.00 44.938 ATOM 7516 N ARG E120 58.326 40.64937.724 1.00 46.597 25 ATOM '7517CA ARG E120 58.612 39.95838.969 1.00 49.636 ATOM '7518CB ARG E120 57.327 39.65739.722 1.00 52.246 ATOM '7519CG ARG E120 56.514 40.87940.037 1.00 59.376 ATOM 7520 CD ARG E120 55.730 40.64141.301 1.00 65.416 ATOM '7521NE ARG E120 56.517 40.89642.518 1.00 68.767 ATOM 7522 CZ ARG E120 56.46'7 40.12543.606 1.00 69.556 ATOM 7523 NH1 ARG E120 55.687 39.04543.617 1.00 67.607 ATOM '7524NH2 ARG E120 57.150 40.45944.702 1.00 69.987 ATOM '7525C ARG E120 59.365 38.66238.724 1.00 48.956 ATOM 7526 0 ARG E120 59.187 38.01337.692 1.00 47.748 35 ATOM '7527N PHE E121 60.210 38.29539.683 1.00 47.827 ATOM 7528 CA PHE E121 60.996 37.08539.563 1.00 46.246 ATOM ?529 CB PHE E121 62.453 37.40839.224 1.00 42.796 ATOM ?530 CG PHE E121 62.620 38.23838.001 1.00 43.166 ATOM ?531 CD1 P~iEE121 62.431 39.60538.052 1.00 42.556 ATOM 7532 CD2 PHE E121 62.945 37.65136.793 1.00 41.676 ATOM 7533 CE1 PHE E121 62.559 40.37236.924 1.00 44.296 ATOM 7534 CE2 PHE E121 63.074 38.40635.667 1.00 39.856 ATOM 7535 CZ PHE E121 62.887. 39.77035.725 1.00 43.746 ATOM 7536 C PHE E121 60.991 36.24340.812 1.00 46.966 45 ATOM 7537 0 PHE E121 60.663 36.70841.902 1.00 44.858 ATOM 7538 N SER E122 61.381 34.98740.619 1.00 50.047 ATOM 7539 CA SER E122 61.509 34.01941.691 1.00 50.976 ATOM 7540 CB SER E122 60.846 32.70141.302 1.00 50.696 ATOM 7541 OG SER E122 60.993 31.75342.338 1.00 54.838 ATOM 7542 C SER E122 63.007 33.81741.838 1.00 51.596 ATOM 7543 0 SER E122 63.648 33.27440.947 1.00 51.838 ATOM 7544 N CYS E123 63.566 34.28242.946 1.00 53.047 ATOM 7545 CA CYS E123 65.000 34.15543.186 1.00 55.646 ATOM 7546 C CYS E123 65.301 34.24744.680 1.00 58.476 ATOM 7547 O CYS E123 64.390 34.40145.501 1.00 58.898 ATOM 7548 CB CYS E123 65.757 35.24942.425 1.00 53.826 ATOM 7549 SG CYS E123 65.215 36.92742.881 1.00 56.4116 ATOM 7550 N ASP E124 66.581 34.15145.033 1.00 61.787 ATOM 7551 CA ASP E124 66.991 34.21546.437 1.00 63.066 60 ATOM 7552 CB ASP E124 68.406 33.65046.620 1.00 63.796 ATOM 7553 CG ASP E124 68.605 33.02447.992 1.00 64.876 ATOM 7554 OD1 ASPE 124 67.970 33.50248.967 1.0063.75 ATOM 7555 OD2 ASPE 124 69.396 32.05848.094 1.0065.17 ATOM 7556 C ASPE 124 66.953 35.63647.007 1.0063.18 ATOM 7557 0 ASPE 124 67.748 36.49546.630 1.0063.39 ATOM 7558 N VALE 125 66.031 35.85747.936 1.0063.67 ATOM 7559 CA VALE 125 65.869 37.15248.586 1.0063.68 ATOM 7560 CB VALE 125 64.370 37.50648.710 1.0061.88 ATOM 7561 CG1 VALE 125 64.195 38.79449.466 1.0058.52 ATOM 7562 CG2 VALE 125 63.751 37.60847.331 1.0059.91 ATOM 7563 C VALE 125 66.501 37.15749.987 1.0064.88 ATOM 7564 0 VALE 125 66.768 38.21450.551 1.0066.59 ATOM 7565 N SERE 126 66.745 35.97550.544 1.0064.96 ATOM 7566 CA SERE 126 67.335 35.87051.874 1.0064.47 ATOM 7567 CB SERE 126 67.672 34.41052.185 1.0062.82 ATOM 7568 OG SERE 126 68.617 33.90151.267 1.0061.35 ATOM 7569 C SERE 126 68.588 36.72952.013 1.0065.71 ATOM 7570 0 SERE 126 69.494 36.69051.165 1.0065.59 ATOM 7571 N GLYE 127 68.632 37.51953.082 1.0066.30 ATOM 7572 CA GLYE 127 69.788 38.36953.309 1.0067.81 ATOM 7573 C GLYE 127 69.595 39.80052.848 1.0069.06 ATOM 7574 0 GLYE 127 70.471 40.63353.037 1.0069.45 ATOM 7575 N VALE 128 68.449 40.09352.253 1.0070.68 ATOM 7576 CA VALE 128 68.179 41.43851.771 1.0072.21 ATOM 7577 CB VALE 128 66.784 41.57551.127 1.0070.88 ATOM 7578 CG1 VALE 128 66.771 40.88249.794 1.0074.99 ATOM 7579 CG2 VALE 128 65.722 40.99352.039 1.0069.09 ATOM 7580 C VALE 128 68.233 42.48052.855 1.0073.85 ATOM 7581 0 VALE 128 68.855 43.52552.678 1.0074.59 ATOM 7582 N ASPE 129 67.579 42.19753.977 1.0075.59 ATOM 7583 CA ASPE 129 67.506 43.17055.046 1.0077.34 ATOM 7584 CB ASPE 129 66.583 42.69156.164 1.0078.29 ATOM 7585 CG ASPE 129 65.952 43.86456.939 1.0080.26 ATOM 7586 OD1 ASPE 129 64.733 43.80557.257 1.0082.07 ATOM 7587 OD2 ASPE 129 66.674 44.84857.231 1.0078.55 ATOM 7588 C ASPE 129 68.825 43.62555.628 1.0078.37 ATOM 7589 0 ASPE 129 68.852 44.62456.362 1.0078.49 ATOM 7590 N THRE 130 69.925 42.94255.302 1.0079.16 ATOM 7591 CA THRE 130 71.201 43.39155.847 1.0080.17 ATOM 7592 CB THRE 130 71.162 43.35157.393 1.0083.36 ATOM 7593 OG1 THRE 130 70.028 42.56457.803 1.0084.91 ATOM 7594 CG2 THRE 130 71.096 44.81057.995 1.0082.87 ATOM 7595 C THRE 130 72.505 42.73155.445 1.0078.82 ATOM 7596 0 THRE 130 72.549 41.55355.068 1.0078.45 ATOM 7597 N GLUE 131 73.564 43.53755.572 1.0078.85 ATOM 7598 CA GLUE 131 74.961 43.15355.353 1.0078.23 ATOM 7599 CB GLUE 131 75.292 41.90056.187 1.0080.76 ATOM 7600 CG GLUE 131 75.507 42.17657.686 1.0082.62 ATOM 7601 CD GLUE 131 75.241 40.95558.543 1.0083.46 ATOM 7602 OEl GLUE 131 75.740 39.85458.186 1.0083.49 ATOM 7603 OE2 GLUE 131 74.534 41.10759.565 1.0083.07 ATOM 7604 C GLUE 131 75.434 42.93153.943 1.0077.11 ATOM 7605 0 GLUE 131 75.646 43.88453.173 1.0075.95 ATOM 7606 N SERE 132 75.658 41.65253.650 1.0076.20 ATOM 7607 CA SERE 132 76.107 41.20052.352 1.0075.57 ATOM 7608 CB SERE 132 76.773 39.83152.501 1.0075.40 ATOM 7609 OG SERE 132 75.896 38.91153.122 1.0073.45 ATOM 7610 C SERE 132 74.858 41.11551.462 1.0074.79 ATOM 7611 0 SERE 132 74.926 40.72250.288 1.0076.37 ATOM 7612 N GLYE 133 73.719 41.48452.048 1.0072.67 ATOM 7613 CA GLYE 133 72.459 41.48251.330 1.0069.80 ATOM 7614 C GLYE 133 72.127 40.17950.631 1.0067.70 ATOM 7615 0 GLY E133 72.686 39.128 50.9341.00 67.31 ATOM 7616 N ALA E134 71.205 40.256 49.6811.00 66.03 ATOM 7617 CA ALA E134 70.799 39.081 48.9311.00 64.43 ATOM 7618 CB ALA E134 69.275 38.990 48.8791.00 64.83 ATOM 7619 C ALA E134 71.363 39.108 47.5121.00 63.34 ATOM 7620 0 ALA E134 71.825 40.148 47.0141.00 61.70 ATOM 7621 N THR E135 71.339 37.944 46.8751.00 61.78 ATOM '7622CA TrigE135 71.813 37.817 45.5151.00 61.48 ATOM '7623CB THR E135 73.108 37.043 45.4461.00 62.04 1~ ATOM 7624 OG1 THR E135 74.093 37.715 46.2371.00 63.94 ATOM 7625 CG2 THR E135 73.590 36.970 44.0121.00 63.05 ATOM 7626 C THR E135 70.741 37.102 44.7181.00 61.03 ATOM 7627 0 THR E135 70.522 35.886 44.8391.00 59.53 ATOM '7628N CYS E136 70.049 37.901 43.9191.00 59.40 15 ATOM '7629CA CYS E136 68.975 37.422 43.0831.00 57.62 ATOM '7630C CYS E136 69.530 37.254 41.6691.00 56.65 ATOM '7631O CYS E136 69.990 38.220 41.0541.00 54.61 ATOM '7632CB CYS E136 67.843 38.442 43.1291.00 55.65 ATOM 7633 SG CYS E136 66.510 38.178 41.9461.00 55.99 ATOM '7634N ARG E137 69.517 36.016 41.1801.00 56.36 ATOM '7635CA ARG E137 70.025 35.717 39.8531.00 57.23 ATOM '7636CB ARG E137 70.861 34.437 39.8711.00 58.80 ATOM '7637CG ARG E137 72.068 34.513 40.7741.00 62.70 ATOM '7638CD ARG E137 72.482 33.125 41.2411.00 66.89 25 ATOM 7639 NE ARG E137 73.230 33.182 42.5001.00 70.82 ATOM '7640CZ ARG E137 74.469 33.659 42.6331.00 71.90 ATOM 7641 NH1 ARG E137 75.134 34.130 41.5781.00 70.38 ATOM 7642 NH2 ARG E137 75.042 33.674 43.8321.00 71.22 ATOM '7643C ARG E137 68.863 35.545 38.8941.00 56.91 ATOM 7644 0 ARG E137 67.909 34.822 39.1771.00 56.92 ATOM '7645N ILE E138 68.970 36.215 37.7541.00 54.63 ATOM '7646CA ILE E138 67.966 36.175 36.7161.00 51.98 ATOM '7647CB II~EE138 67.432 37.587 36.4681.00 51.76 ATOM '7648CG2 ILE E138 66.432 37.573 35.3331.00 49.89 35 ATOM 7649 CG1 ILE E138 66.81'7 38.137 37.7571.00 50.16 ATOM '7650CD1 ILE E138 66.476 39.606 37.6811.00 47.06 ATOM 7651 C ILE E138 68.611 35.655 35.4341.00 52.26 ATOM 7652 0 ILE E138 69.557 36.261 34.9331.00 52.12 ATOM '7653N LYS E139 68.105 34.542 34.9011.00 52.70 ATOM '7654CA LYS E139 68.656 33.961 33.6671.00 53.32 ATOM 7655 CB LYS E139 68.877 32.455 33.8221.00 53.63 ATOM '7656CG L'tSE139 69.732 32.075 35.0131.00 57.59 ATOM '7657CD LYS E139 70.150 30.612 34.9671.00 59.76 ATOM '7658CE LYS E139 71.183 30.363 33.8691.00 62.51 45 ATOM 7659 NZ L'tSE139 71.624 28.928 33.7871.00 63.48 ATOM '7660C LYS E139 67.738 34.187 32.4801.00 52.42 ATOM 7661 0 L'ISE139 66.572 33.826 32.5271.00 52.75 ATOM 7662 N ILE E140 68.264 34.770 31.4101.00 52.23 ATOM '7663CA ILE E140 67.449 35.013 30.2291.00 51.67 ATOM 7664 CB ILE E140 66.995 36.513 30.1651.00 50.77 ATOM 7665 CG2 ILE E140 66.543 36.974 31.5461.00 51.60 ATOM 7666 CG1 ILE E140 68.136 37.434 29.7661.00 52.08 ATOM 7667 CD1 ILE E140 '07.815 38.915 30.0601.00 55.62 ATOM '7668C ILE E140 68.145 34.594 28.9351.00 51.13 55 ATOM '76690 ILE E140 69.295 34.917 28.7101.00 49.59 ATOM '7670N GLY E141 67.434 33.840 28.1021.00 52.11 ATOM '7671CA GLY E141 67.985 33.382 26.8331.00 51.58 ATOM 7672 C GLY E141 66.884 33.089 25.8261.00 51.56 ATOM 7673 0 GLY E141 65.709 33.125 26.1861.00 52.84 ATOM 7674 N SER E142 67.245 32.807 24.5731.00 49.52 ATOM 7675 CA SER E142 66.241 32.514 23.5531.00 46.89 19g ATOM 7676 CB SER E142 66.883 32.177 22.2141.00 44.37 ATOM 7677 OG SER E142 65.913 31.657 21.3291.00 40.29 ATOM 7678 C SER E142 65.386 31.346 23.9971.00 47.72 ATOM 7679 0 SER E142 65.880 30.376 24.5841.00 48.09 ATOM 7680 N TRP E143 64.097 31.439 23.7011.00 47.51 ATOM 7681 CA TRP E143 63.165 30.406 24.1011.00 46.17 ATOM 7682 CB TRP E143 61.780 31.025 24.3271.00 45.01 ATOM 7683 CG TRP E143 60.808 30.096 24.9681.00 42.92 ATOM '7684CD2 TRP E143 60.799 29.697 26.3371.00 41.62 1~ ATOM '7685CE2 TRP E143 59.72:L 28.803 26.5051.00 39.45 ATOM '7686CE3 TRP E143 61.601 30.008 27.4421.00 42.26 ATOM 7687 CD1 TRP E143 59.764 29.448 24.3711.00 41.66 ATOM 7688 NE1 TRP E143 59.106 28.669 25.2881.00 41.08 ATOM 7689 C22 TRP E143 59.423 28.216 27.7361.00 39.02 ATOM 7690 CZ3 TRP E143 61.305 29.426 28.6621.00 40.87 ATOM '7691CH2 TRP E143 60.223 28.540 28.7991.00 41.01 ATOM '7692C TRP E143 63.067 29.281 23.0971.00 46.14 ATOM '76930 TRP E143 62.816 28.147 23.4671.00 47.72 ATOM '7694N THR E144 63.277 29.579 21.8211.00 46.28 ATOM '7695CA THR E144 63.141 28.539 20.8081.00 44.88 ATOM 7696 CB THR E144 61.961 28.863 19.8591.00 42.99 ATOM 7697 OG1 THR E144 62.131 30.174 19.3081.00 42.03 ATOM 7698 CG2 THR E144 60.655 28.824 20.6091.00 40.32 ATOM 7699 C THR E144 64.378 28.276 19.9691.00 46.55 25 ATOM 7700 O THR E144 64.434 27.294 19.2431.00 46.91 ATOM 7701 N HIS E145 65.367 29.151 20.0601.00 48.37 ATOM 7702 CA HIS E145 66.576 28.973 19.2751.00 50.06 ATOM 7703 CB HIS E145 66.937 30.265 18.5411.00 49.35 ATOM 7704 CG HIS E145 65.947 30.669 17.4921.00 49.26 ATOM 7705 CD2 HIS E145 65.676 30.143 16.2751.00 49.17 ATOM 7706 ND1 HIS E145 65.112 31.756 17.6341.00 47.03 ATOM 7707 CE1 HIS E145 64.371 31.883 16.5481.00 48.38 ATOM 7708 NE2 HIS E145 64.694 30.917 15.7081.00 50.40 ATOM 7709 C HIS E145 67.754 28.529 20.1251.00 51.77 35 ATOM 7710 O HIS E145 68.096 29.153 21.1291.00 50.03 ATOM 7711 N HIS E146 68.371 27.427 19.7101.00 55.46 ATOM 7712 CA HIS E146 69.530 26.886 20.4181.00 57.69 ATOM 7713 CB HIS E146 69.654 25.377 20.1621.00 56.07 ATOM 7714 CG HIS E146 69.679 25.019 18.7151.00 56.24 ATOM 7715 CD2 HIS E146 70.477 25.442 17.7071.00 55.97 ATOM 7716 ND1 HIS E146 68.798 24.121 18.1571.00 58.10 ATOM 7717 CE1 HIS E146 69.053 24.005 16.8631.00 58.23 ATOM 7718 NE2 HIS E146 70.068 24.797 16.5661.00 57.28 ATOM 7719 C HIS E146 70.801 27.612 19.9711.00 58.37 45 ATOM 7720 0 HIS E146 70.775 28.455 19.0641.00 59.37 ATOM 7721 N SER E147 71.908 27.269 20.6181.00 60.00 ATOM 7722 CA SER E147 73.218 27.872 20.3561.00 60.54 ATOM 7723 CB SER E147 74.268 27.134 21.1851.00 60.36 ATOM 7724 OG SER E147 74.082 25.728 21.0711.00 61.90 ATOM 7725 C SER E147 73.690 27.960 18.8971.00 60.61 ATOM 7726 0 SER E147 74.491 28.837 18.5531.00 60.32 ATOM 7727 N ARG E148 73.197 27.072 18.0411.00 59.60 ATOM 7728 CA ARG E148 73.611 27.083 16.6461.00 60.89 ATOM 7729 CB ARG E148 73.307 25.722 15.9961.00 66.00 55 ATOM 7730 CG ARG E148 73.902 24.527 16.7561.00 74.00 ATOM 7731 CD ARG E148 73.462 23.177 16.1691.00 79.80 ATOM 7732 NE ARG E148 73.749 22.052 17.0771.00 85.45 ATOM 7733 CZ ARG E148 74.973 21.680 17.475~.00 86.76 ATOM 7734 NH1 ARG E148 76.045 22.338 17.0461.00 87.13 ATOM 7735 NH2 ARG E148 75.130 20.650 18.3061.00 86.87 ATOM 7736 C ARG E148 72.942 28.189 15.8471.00 59.62 ATOM 7737 0 ARG E148 73.418 28.564 14.7661.00 58.11 ATOM 7738 N GLU E149 71.836 28.707 16.3841.00 58.68 ATOM '7739CA GLU E149 71.067 29.756 15.7161.00 56.72 ATOM 7740 CB GLU E149 69.598 29.337 15.6301.00 55.99 ATOM 7741 CG GLU E149 69.435 27.854 15.3351.00 57.25 ATOM '7742CD GLU E149 67.992 27.402 15.2391.00 57.65 ATOM '7743OE1 GLU E149 67.166 27.825 16.0751.00 58.97 ATOM 7744 OE2 GLU E149 67.684 26.606 14.3321.00 56.32 ATOM '7745C GLU E149 71.214 31.073 16.4631.00 55.95 ATOM '77460 GLU E149 71.423 32.122 15.8521.00 54.41 ATOM 7747 N ILE E150 71.109 31.012 17.7871.00 55.27 ATOM '7748CA ILE E150 71.265 32.202 18.6001.00 54.72 ATOM 7749 CB ILE E150 69.922 32.686 19.2271.00 54.60 ATOM '7750CG2 ILE E150 70.190 33.711 20.3391.00 51.29 ATOM '7751CG1 ILE E150 69.051 33.354 18.1671.00 53.90 ATOM 7752 CD1 ILE E150 67.738 33.855 18.7091.00 52.06 ATOM 7753 C II~EE150 72.238 31.954 19.7281.00 55.47 ATOM '77540 ILE E150 72.226 30.898 20.3611.00 54.39 ATOM 7755 N SER E151 73.083 32.948 19.9621.00 56.26 ATOM 7756 CA SER E151 74.055 32.898 21.0351.00 59.09 ATOM 7757 CB SER E151 75.478 32.752 20.4711.00 59.25 ATOM 7758 OG SER E151 75.826 33.853 19.6531.00 59.55 ATOM '7759C SER E151 73.904 34.226 21.7701.00 59.98 ATOM '77600 SER E151 73.793 35.283 21.1391.00 59.94 25 ATOM 7761 N VAL E152 73.878 34.172 23.0961.00 60.88 ATOM 7762 CA VAL E152 73.739 35.380 23.9001.00 62.73 ATOM 7763 CB VAL E152 72.628 35.233 24.9561.00 61.31 ATOM '7764CG1 VAL E152 71.339 34.777 24.2941.00 58.78 ATOM '7765CG2 VAL E152 73.067 34.241 26.0341.00 62.59 ATOM 7766 C VAL E152 75.054 35.633 24.6121.00 64.27 ATOM '77670 VAL E152 75.743 34.687 24.9941.00 63.76 ATOM 7768 N ASP E153 75.393 36.904 24.8051.00 66.67 ATOM '7769CA ASP E153 76.650 37.261.25.4561.00 70.32 ATOM 7770 CB ASP E153 77.713 37.471 24.3811.00 70.77 35 ATOM 7771 CG ASP E153 77.832 36.272 23.4331.00 74.19 ATOM 7772 OD1 ASP E153 78.483 35.261 23.8031.00 75.87 ATOM '7773OD2 ASP E153 77.265 36.331 22.3191.00 73.45 ATOM 7774 C ASP E153 76.531 38.533 26.3041.00 72.18 ATOM 7775 0 ASP E153 75.835 39.481 25.9221.00 72.90 ATOM 7776 N PRO E154 77.187 38.561 27.4781.00 73.33 ATOM 7777 CD PRO E154 77.671 37.398 28.2431.00 72.54 ATOM 7778 CA PRO E154 77.123 39.755 28.3321.00 75.06 ATOM 7779 CB PRO E154 77.749 39.279 29.6421.00 74.00 ATOM '7780CG PRO E154 77.389 37.823 29.6761.00 74.05 45 ATOM 7781 C PRO E154 77.911 40.901 27.6881.00 77.63 ATOM '77820 PRO E154 78.502 40.717 26.6201.00 78.05 ATOM '7783N THR E155 77.940 42.066 28.3381.00 81.26 ATOM 7784 CA THR E155 78.638 43.230 27.7811.00 85.03 ATOM '7785CB THR E155 77.623 44.147 27.0201.00 83.83 ATOM '7786OG1 THR E155 76.717 44.749 27.9561.00 81.33 ATOM 7787 CG2 THR E155 76.815 43.341 26.0201.00 83.47 ATOM 7788 C THR E155 79.417 44.101 28.8031.00 88.40 ATOM 7789 0 THR E155 79.900 43.592 29.8251.00 88.82 ATOM 7790 N THR E156 79.527 45.405 28.4871.00 91.48 55 ATOM 7791 CA THR E156 80.206 46.443 29.2881.00 93.55 ATOM 7792 CB THR E156 79.615 47.854 29.0021.00 93.31 ATOM '7793OG1 THR E156 79.697 48.136 27.5961.00 92.71 ATOM 7794 CG2 THR E156 80.376 48.925 29.8131.00 92.25 ATOM 7795 C THR E156 80.165 46.249 30.8031.00 95.69 ATOM 7796 0 THR E156 79.173 46.584 31.4761.00 95.92 ATOM 7797 N GLU E157 81.264 45.733 31.3401.00 97.89 ATOM 7798 CA GLU E157 81.365 45.481 32.7761.00100.21 ATOM 7799 CB GLU E157 82.361 44.343 33.0181.00101.17 ATOM 7800 CG GLU E157 82.198 43.190 32.0461.00103.80 ATOM 7801 CD GLU E157 83.222 42.107 32.2961.00105.78 ATOM 7802 OE1 GLU E157 84.423 42.466 32.3751.00105.64 ATOM 7803 OE2 GLU E157 82.828 40.907 32.4101.00107.35 ATOM 7804 C GLU E157 81.817 46.729 33.5501.00100.48 ATOM 7805 0 GLU E157 81.869 46.719 34.7981.00100.82 ATOM 7806 N ASN E158 82.151 47.793 32.8181.00 99.54 ATOM 7807 CA ASN E158 82.620 49.011 33.4611.00 98.41 ATOM 7808 CB ASN E158 83.235 49.953 32.4261.00100.23 ATOM 7809 CG ASN E158 84.338 49.283 31.6041.00101.57 ATOM 7810 OD1 ASN E158 85.334 48.768 32.1521.00100.21 ATOM 7811 ND2 ASN E158 84.165 49.286 30.2741.00102.69 ATOM 7812 C ASN E158 81.456 49.701 34.1561.00 96.86 ATOM 7813 0 ASN E158 81.185 49.443 35.3411.00 96.41 ATOM 7814 N SER E159 80.791 50.578 33.3951.00 94.72 ATOM 7815 CA SER E159 79.624 51.349 33.8341.00 91.39 ATOM 7816 CB SER E159 78.465 51.087 32.8581.00 91.87 ATOM 7817 OG SER E159 78.391 49.705 32.4991.00 92.44 ATOM 7818 C SER E159 79.169 51.080 35.2691.00 88.56 ATOM 7819 0 SER E159 78.823 49.947 35.6141.00 89.22 ATOM 7820 N ASP E160 79.171 52.119 36.1021.00 85.19 ATOM 7821 CA ASP E160 78.744 51.966 37.4951.00 81.21 ATOM 7822 CB ASP E160 78.527 53.327 38.1571.00 80.51 ATOM 7823 CG ASP E160 78.005 53.194 39.5741.00 79.98 ATOM 7824 ODl ASP E160 77.424 54.174 40.0791.00 80.37 ATOM 7825 OD2 ASP E160 78.184 52.104 40.1781.00 78.39 ATOM 7826 C ASP E160 77.426 51.202 37.5251.00 78.59 ATOM 7827 0 ASP E160 76.427 51.669 36.9591.00 77.98 ATOM 7828 N ASP E161 77.427 50.043 38.1851.00 75.05 ATOM 7829 CA ASP E161 76.233 49.203 38.2831.00 71.67 ATOM 7830 CB ASP E161 76.473 48.017 39.2261.00 70.39 ATOM 7831 CG ASP E161 77.428 46.994 38.6411.00 70.69 ATOM 7832 OD1 ASP E161 77.389 46.782 37.4161.00 70.97 ATOM 7833 OD2 ASP E161 78.211 46.386 39.4001.00 71.91 ATOM '7834C ASP E161 74.968 49.931 38.7321.00 70.49 ATOM '78350 ASP E161 73.864 49.439 38.5141.00 71.58 ATOM '7836N SER E162 75.099 51.093 39.3561.00 68.11 ATOM 7837 CA SER E162 73.903 51.792 39.7851.00 66.58 ATOM 7838 CB SER E162 73.771 51.731 41.3081.00 66.49 ATOM 7839 OG SER E162 74.786 52.478 41.9381.00 64.63 ATOM 7840 C SER E162 73.856 53.237 39.3191.00 65.96 ATOM 7841 0 SER E162 73.250 54.088 39.9721.00 64.77 45 ATOM 7842 N GLU E163 74.475 53.514 38.1781.00 65.61 ATOM '7843CA GLU E163 74.474 54.872 37.6761.00 67.53 ATOM '7844CB GI~UE163 75.582 55.051 36.6311.00 70.35 ATOM 7845 CG GLU E163 75.237 54.661 35.2131.00 72.94 ATOM 7846 CD GLU E163 76.338 55.083 34.2251.00 76.12 ATOM 7847 OE1 GLU E163 77.424 54.448 34.2411.00 77.12 ATOM 7848 OE2 GLU E163 76.118 56.054 33.4451.00 76.02 ATOM '7849C GLU E163 73.108 55.271 37.1131.00 66.26 ATOM 7850 0 GLU E163 72.873 56.442 36.8001.00 64.91 ATOM 7851 N TYR E164 72.211 54.292 36.9901.00 66.34 ATOM 7852 CA TYR E164 70.848 54.539 36.4961.00 65.02 ATOM '7853CB TYR E164 70.555 53.716 35.2351.00 64.40 ATOM 7854 CG TYR E164 71.386 54.109 34.0511.00 64.81 ATOM '7855CD1 TYR E164 72.237 53.191 33.4371.00 64.72 ATOM 7856 CE1 TYR E164 73.040 53.559 32.3511.00 65.69 ATOM 7857 CD2 TYR E164 71.350 55.413 33.5591.00 67.21 ATOM 7858 CE2 TYR E164 72.154 55.805 32.4711.00 67.79 ATOM 7859 CZ TYR E164 72.994 54.867 31.8671.00 67.33 ATOM 7860 OH TYR E164 73.744 55.230 30.7651.00 67.72 ATOM 7861 C TYR E164 69.831 54.174 37.5741.00 63.42 ATOM 7862 0 TYR E164 68.642 54.458 37.4421.00 62.96 ATOM 7863 N PI-IEE165 70.309 53.552 38.6461.00 60.43 ATOM 7864 CA PHE E165 69.428 53.139 39.7171.00 59.92 ATOM 7865 CB PHE E165 70.208 52.378 40.7761.00 58.36 ATOM 7866 CG PHE E165 69.347 51.515 41.6451.00 58.01 ATOM 7867 CD1 PHE E165 68.674 50.427 41.1101.00 55.31 1~ ATOM 7868 CD2 PHE E165 69.189 51.802 42.9941.00 58.36 ATOM 7869 CE1 PHE E165 67.858 49.642 41.9041.00 56.74 ATOM 7870 CE2 PHE E165 68.368 51.016 43.8041.00 57.34 ATOM 7871 CZ PHE E165 67.703 49.939 43.2601.00 57.55 ATOM 7872 C PHE E165 68.732 54.324 40.3561.00 60.15 15 ATOM 7873 0 PHE E165 69.321 55.390 40.5041.00 62.59 ATOM 7874 N SER E166 67.466 54.148 40.7181.00 59.42 ATOM 7875 CA SER E166 66.724 55.222 41.3571.00 57.86 ATOM 7876 CB SER E166 65.241 54.869 41.5031.00 56.65 ATOM 7877 OG SER E166 64.513 55.951 42.0641.00 53.76 ATOM 7878 C SER E166 67.325 55.425 42.7331.00 56.88 ATOM 7879 0 SER E166 67.712 54.472 43.4071.00 55.76 ATOM 7880 N GLN E167 67.406 56.677 43.1421.00 56.96 ATOM 7881 CA GLN E167 67.955 57.010 44.4431.00 58.28 ATOM 7882 CB GLN E167 68.547 58.423 44.4011.00 60.41 25 ATOM 7883 CG GLN E167 67.549 59.465 43.9411.00 64.41 ATOM 7884 CD GLN E167 68.198 60.780 43.5991.00 66.50 ATOM 7885 OE1 GLN E167 68.795 61.433 44.4581.00 67.54 ATOM 7886 NE2 GLN E167 68.089 61.184 42.3301.00 68.48 ATOM 7887 C GLN E167 66.880 56.924 45.5321.00 57.21 ATOM 7888 0 GLN E167 67.196 56.835 46.7201.00 56.91 ATOM 7889 N TYR E168 65.613 56.932 45.1331.00 54.47 ATOM '7890CA T'TRE168 64.550 56.877 46.1111.00 53.18 ATOM '7891CB T'zRE168 63.399 57.760 45.6491.00 53.95 ATOM 7892 CG T'TRE168 63.88.1 59.125 45.2491.00 53.27 35 ATOM '7893CD1 TYR E168 64.102 59.439 43.9131.00 54.37 ATOM '7894CE1 TYR E168 64.625 60.672 43.5411.00 56.01 ATOM 7895 CD2 T'IRE168 64.190 60.077 46.2081.00 52.09 ATOM 7896 CE2 TYR E168 64.711 61.304 45.8561.00 55.52 ATOM '7897CZ TYR E168 64.929 61.599 44.5221.00 57.20 ATOM 7898 OH T'fRE168 65.458 62.815 44.1771.00 59.36 ATOM '7899C TYR E168 64.072 55.470 46.4311.00 52.65 ATOM 7900 0 T'IRE168 63.131 55.282 47.1891.00 53.48 ATOM 7901 N SER E169 64.735 54.479 45.8611.00 51.93 ATOM 7902 CA SER E169 64.387 53.093 46.1171.00 53.34 45 ATOM '7903CB SER E169 65.191 52.167 45.2011.00 53.89 ATOM 7904 OG SER E169 64.945 50.807 45.5141.00 50.40 ATOM 7905 C SER E169 64.686 52.726 47.5671.00 54.98 ATOM '79060 SER E169 65.636 53.225 48.1621.00 54.67 ATOM '7907N ARG E170 63.875 51.844 48.1311.00 56.35 ATOM 7908 CA ARG E170 64.075 51.404 49.5001.00 56.22 ATOM '7909CB ARG E170 62.869 50.568 49.9631.00 57.55 ATOM 7910 CG ARG E170 61.832 51.361 50.7241.00 59.10 ATOM 7911 CD ARG E170 60.436 50.785 50.5871.00 63.93 ATOM 7912 NE ARG E170 60.309 49.382 50.9921.00 67.80 55 ATOM '7913CZ ARG E170 59.897 48.405 50.1811.00 68.39 ATOM '7914NH1 ARG E170 59.577 48.664 48.9161.00 66.05 ATOM 7915 NH2 ARG E170 59.784 47.163 50.6371.00 71.45 ATOM 7916 C ARG E170 65.342 50.563 49.5771.00 56.43 ATOM '79170 ARG E170 65.878 50.334 50.6661.00 57.41 ATOM 7918 N PHE E171 65.833 50.115 48.4231.00 54.16 ATOM 7919 CA PHE E171 67.011 49.265 48.4031.00 53.05 ATOM 7920 CB PHE E171 66.665 47.926 47.7471.00 51.94 ATOM 7921 CG PHE E171 65.392 47.326 48.2591.00 52.21 ATOM 7922 CD1 PHE E171 64.157 47.848 47.8761.00 54.72 ATOM 7923 CD2 PHE E171 65.416 46.288 49.1801.00 52.12 ATOM 7924 CE1 PHE E171 62.963 47.346 48.4121.00 54.00 ATOM 7925 CE2 PHE E171 64.233 45.781 49.7191.00 52.15 ATOM 7926 CZ PHE E171 63.008 46.313 49.3341.00 53.26 ATOM 7927 C PHE E171 68.181 49.909 47.6981.00 54.03 ATOM 7928 0 PHE E171 68.056 50.993 47.1371.00 55.23 1~ ATOM 7929 N GLU E172 69.328 49.245 47.7491.00 55.00 ATOM 7930 CA GLU E172 70.520 49.755 47.1061.00 56.51 ATOM 7931 CB GLU E172 71.385 50.513 48.1201.00 58.70 ATOM 7932 CG GLU E172 71.906 49.691 49.2991.00 63.76 ATOM 7933 CD GLU E172 72.716 50.527 50.3001.00 66.16 ATOM 7934 OE1 GLU E172 73.450 51.439 49.8611.00 67.90 ATOM 7935 OE2 GLU E172 72.635 50.266 51.5261.00 67.48 ATOM 7936 C GLU E172 71.288 48.596 46.4901.00 57.61 ATOM 7937 0 GLU E172 71.161 47.451 46.9171.00 57.07 ATOM 7938 N ILE E173 72.077 48.891 45.4701.00 58.83 ATOM 7939 CA ILE E173 72.844 47.850 44.8021.00 60.44 ATOM 7940 CB ILE E173 72.863 48.063 43.2741.00 60.05 ATOM '7941CG2 ILE E173 73.751 47.016 42.6171.00 60.65 ATOM 7942 CG1 ILE E173 71.439 47.999 42.7221.00 60.27 ATOM 7943 CD1 ILE E173 71.357 48.283 41.2451.00 60.88 25 ATOM 7944 C ILE E173 74.289 47.760 45.2751.00 60.89 ATOM '79450 ILE E173 75.011 48.752 45.3421.00 60.64 ATOM 7946 N LEU E174 74.715 46.555 45.5951.00 62.24 ATOM '7947CA LEU E174 76.079 46.360 46.0191.00 63.64 ATOM 7948 CB LEU E174 76.152 45.176 46.9681.00 62.78 ATOM 7949 CG LEU E174 75.126 45.262 48.0861.00 63.68 ATOM 7950 CD1 LEU E174 75.212 44.013 48.9521.00 63.39 ATOM '7951CD2 LEU E174 75.367 46.538 48.8961.00 62.58 ATOM 7952 C LEU E174 76.908 46.093 44.7601.00 65.84 ATOM 7953 0 LEU E174 77.891 46.787 44.4801.00 67.17 ATOM 7954 N ASP E175 76.494 45.102 43.9791.00 67.20 ATOM 7955 CA ASP E175 77.227 44.772 42.7631.00 67.40 ATOM 7956 CB ASP E175 78.496 43.999 43.1481.00 68.39 ATOM 7957 CG ASP E175 79.385 43.673 41.9611.00 67.83 ATOM 7958 OD1 ASP E175 79.754 44.600 41.1921.00 66.66 ATOM '7959OD2 ASP E175 79.727 42.477 41.8211.00 67.72 ATOM '7960C ASP E175 76.358 43.960 41.8031.00 67.16 ATOM 7961 0 ASP E175 75.405 43.291 42.2161.00 66.38 ATOM 7962 N VAL E176 76.692 44.044 40.5201.00 66.77 ATOM '7963CA VAL E176 75.974 43.329 39.4771.00 67.34 45 ATOM 7964 CB VAL E176 75.077 44.283 38.6431.00 67.70 ATOM 7965 CG1 VAL E176 74.430 43.524 37.4791.00 66.11 ATOM '7966CG2 VAL E176 74.009 44.902 39.5371.00 66.22 ATOM 7967 C VAL E176 76.979 42.692 38.5411.00 66.94 ATOM 7968 0 VAL E176 77.894 43.354 38.0781.00 65.94 ATOM 7969 N THR E177 76.796 41.407 38.2651.00 68.37 ATOM 7970 CA THR E177 77.682 40.671 37.3621.00 70.46 ATOM 7971 CB THR E177 78.677 39.794 38.1421.00 69.65 ATOM '7972OG1 THR E177 77.962 38.938 39.0411.00 68.82 ATOM 7973 CG2 THR E177 79.630 40.667 38.9381.00 70.26 ATOM 7974 C THR E177 76.870 39.778 36.4201.00 72.02 ATOM 7975 0 THR E177 75.849 39.202 36.8131.00 72.47 ATOM 7976 N GLN E178 77.327 39.669 35.1751.00 73.21 ATOM 7977 CA GLN E178 76.642 38.861 34.1731.00 74.06 ATOM 7978 CB GLN E178 76.151 39.744 33.0351.00 75.43 60 ATOM 7979 CG GLN E178 75.865 41.187 33.4421.00 77.78 ATOM 7980 CD GLN E178 74.935 41.901 32.4641.00 79.93 ATOM 7981 OE1 GLNE 178 75.139 41.862 31.236 1.0082.06 ATOM 7982 NE2 GLNE 178 73.909 42.565 33.002 1.0078.21 ATOM 7983 C GLNE 178 77.608 37.840 33.610 1.0074.50 ATOM 7984 0 GLNE 178 78.661 38.205 33.086 1.0074.89 'rJATOM 7985 N LYSE 179 77.248 36.563 33.703 1.0075.28 ATOM 7986 CA LYSE 179 78.107 35.482 33.209 1.0075.34 ATOM 7987 CB LYSE 179 78.666 34.692 34.391 1.0077.30 ATOM 7988 CG LYSE 179 79.186 35.600 35.515 1.0081.23 ATOM 7989 CD LYSE 179 79.593 34.805 36.763 1.0083.79 1~ ATOM 7990 CE LYSE 179 79.779 35.727 37.981 1.0082.73 ATOM 7991 NZ LYSE 179 78.496 36.431 38.332 1.0082.45 ATOM 7992 C LYSE 179 77.274 34.554 32.353 1.0074.24 ATOM 7993 0 LYSE 179 76.409 33.850 32.882 1.0074.20 ATOM 7994 N LYSE 180 77.528 34.533 31.045 1.0072.18 15 ATOM 7995 CA LYSE 180 76.747 33.674 30.155 1.0070.93 ATOM 7996 CB LYSE 180 77.062 34.017 28.694 1.0071.21 ATOM 7997 CG LYSE 180 78.412 33.558 28.187 1.0067.95 ATOM 7998 CD LYSE 180 78.327 32.136 27.630 1.0067.85 ATOM 7999 CE LYSE 180 77.429 32.041 26.394 1.0066.39 2flATOM 8000 NZ LYSE 180 78.005 32.722 25.197 1.0067.24 ATOM 8001 C LYSE 180 77.014 32.199 30.429 1.0069.92 ATOM 8002 0 LYSE 180 77.803 31.876 31.303 1.0070.33 ATOM 8003 N ASNE 181 76.335 31.310 29.711 1.0069.75 ATOM 8004 CA ASNE 181 76.570 29.881 29.878 1.0070.27 25 ATOM 8005 CB ASNE 181 76.563 29.495 31.362 1.0069.84 ATOM 8006 CG ASNE 181 75.395 30.060 32.112 1.0070.39 ATOM 8007 OD1 ASNE 181 74.255 30.006 31.648 1.0075.03 ATOM 8008 ND2 ASNE 181 75.659 30.587 33.299 1.0070.26 ATOM 8009 C ASNE 181 75.658 28.932 29.097 1.0071.10 ATOM 8010 0 ASNE 181 74.438 28.918 29.276 1.0072.53 ATOM 8011 N SERE 182 76.266 28.121 28.236 1.0071.98 ATOM 8012 CA SERE 182 75.518 27.161 27.427 1.0073.38 ATOM 8013 CB SERE 182 76.437 26.566 26.343 1.0074.44 ATOM 8014 OG SERE 182 75.712 25.791 25.388 1.0077.56 35 ATOM 8015 C SERE 182 74.984 26.054 28.345 ~.0073.19 ATOM 8016 O SERE 182 75.527 25.836 29.428 1.0073.57 ATOM 8017 N VALE 183 73.936 25.350 27.914 1.0072.44 ATOM 8018 CA VALE 183 73.341 24.295 28.738 1.0071.01 ATOM 8019 CB VALE 183 72.582 24.906 29.956 1.0069.59 ATOM 8020 CG1 VALE 183 71.892 26.184 29.555 1.0067.54 ATOM 8021 CG2 VALE 183 71.534 23.922 30.470 1.0069.87 ATOM 8022 C VALE 183 72.366 23.391 27.986 1.0071.36 ATOM 8023 0 VALE 183 71.508 23.867 27.234 1.0071.74 ATOM 8024 N THRE 184 72.490 22.087 28.202 1.0071.66 45 ATOM 8025 CA THRE 184 71.586 21.134 27.551 1.0073.71 ATOM 8026 CB THRE 184 72.339 19.902 26.988 1.0072.73 ATOM 8027 OGl THRE 184 73.243 20.327 25.957 1.0072.08 ATOM 8028 CG2 THRE 184 71.353 18.897 26.392 1.0071.99 ATOM 8029 C THRE 184 70.547 20.656 28.565 1.0075.19 ATOM 8030 0 THRE 184 70.862 20.458 29.740 1.0075.50 ATOM 8031 N TYRE 185 69.307 20.495 28.110 1.0076.63 ATOM 8032 CA TYRE 185 68.234 20.054 28.992 1.0077.67 ATOM 8033 CB TYRE 185 67.084 21.074 29.004 1.0078.57 ATOM 8034 CG TYRE 185 67.547 22.482 29.285 1.0078.26 55 ATOM 8035 CD1 TYRE 185 68.203 23.218 28.304 1.0077.24 ATOM 8036 CE1 TYRE 185 68.666 24.506 28.559 1.0079.16 ATOM 8037 CD2 TYRE 185 67.361 23.065 30.544 1.0079.06 ATOM 8038 CE2 TYRE 185 67.822 24.359 30.817 1.0079.31 ATOM 8039 CZ TYRE 185 68.472 25.075 29.819 1.0079.42 ATOM 8040 OH TYRE 185 68.919 26.357 30.067 1.0080.13 ATOM 8041 C TYRE 185 67.725 18.723 28.516 1.0077.68 ATOM 8042 0 TYRE 185 67.578 18.50927.314 1.00 76.95 ATOM 8043 N SERE 186 67.460 17.83129.463 1.00 79.15 ATOM 8044 CA SERE 186 66.968 16.49729.134 1.00 80.95 ATOM 8045 CB SERE 186 66.593 15.75530.423 1.00 81.59 'rJATOM 8046 OG SERE 186 65.784 16.58031.254 1.00 83.29 ATOM 8047 C SERE 186 65.770 16.59428.192 1.00 81.27 ATOM 8048 0 SERE 186 65.612 15.76427.291 1.00 81.31 ATOM 8049 N CYSE 187 64.948 17.62428.402 1.00 82.15 ATOM 8050 CA CYSE 187 63.753 17.87627.583 1.00 83.38 1~ ATOM 8051 C CYSE 187 64.119 18.10426.143 1.00 83.62 ATOM 8052 0 CYSE 187 63.463 17.63125.206 1.00 82.88 ATOM 8053 CB CYSE 187 63.043 19.17927.993 1.00 83.49 ATOM 8054 SG CYSE 187 63.980 20.75727.703 1.00 86.50 ATOM 8055 N CYSE 188 65.204 18.84125.993 1.00 84.35 ATOM 8056 CA CYSE 188 65.589 19.31824.701 1.00 84.60 ATOM 8057 C CYSE 188 67.013 18.99124.213 1.00 84.20 ATOM 8058 O CYSE 188 68.012 19.33424.874 1.00 84.71 ATOM 8059 CB CYSE 188 65.319 20.83324.759 1.00 85.11 ATOM 8060 SG CYSE 188 63.808 21.34925.731 1.00 88.15 ATOM 8061 N PROE 189 67.108 18.34023.025 1.00 83.48 ATOM 8062 CD PROE 189 65.864 18.06422.267 1.00 82.84 ATOM 8063 CA PROE 189 68.292 17.87822.267 1.00 81.51 ATOM 8064 CB PROE 189 67.738 17.66620.853 1.00 82.30 ATOM 8065 CG PROE 189 66.345 17.17321.119 1.00 82.79 25 ATOM 8066 C PROE 189 69.547 18.78222.249 1.00 79.46 ATOM 8067 0 PROE 189 70.592 18.39822.785 1.00 79.36 ATOM 8068 N GLUE 190 69.450 19.96121.629 1.00 76.55 ATOM 8069 CA GLUE 190 70.592 20.87821.529 1.00 74.34 ATOM 8070 CB GLUE 190 70.358 21.88120.401 1.00 76.82 ATOM 8071 CG GLUE 190 69.520 21.35219.239 1.00 80.12 ATOM 8072 CD GLUE 190 70.336 20.53318.231 1.00 81.75 ATOM 8073 OE1 GLUE 190 71.471 20.96517.884 1.00 81.85 ATOM 8074 OE2 GLUE 190 69.836 19.47217.775 1.00 80.52 ATOM 8075 C GLUE 190 70.822 21.66322.815 1.00 71.33 35 ATOM 8076 0 GLUE 190 70.095 21.48923.791 1.00 71.05 ATOM 8077 N ALAE 191 71.826 22.54322.798 1.00 68.78 ATOM 8078 CA ALAE 191 72.142 23.39023.957 1.00 67.15 ATOM 8079 CB ALAE 191 73.651 23.53624.108 1.00 65.15 ATOM 8080 C ALAE 191 71.502 24.78723.836 1.00 65.83 ATOM 8081 O ALAE 191 71.379 25.34022.730 1.00 64.00 ATOM 8082 N TYRE 192 71.097 25.35524.971 1.00 64.83 ATOM 8083 CA TYRE 192 70.487 26.67824.964 1.00 65.12 ATOM 8084 CB TYRE 192 69.025 26.61325.450 1.00 63.81 ATOM 8085 CG TYRE 192 68.096 25.95324.462 1.00 63.14 45 ATOM 8086 CD1 TYRE 192 67.939 24.56424.442 1.00 64.40 ATOM 8087 CE1 TYRE 192 67.146 23.93423.468 1.00 64.53 ATOM 8088 CD2 TYRE 192 67.435 26.70523.493 1.00 62.60 ATOM 8089 CE2 TYRE 192 66.642 26.09422.521 1.00 64.04 ATOM 8090 CZ TYRE 192 66.505 24.71022.512 1.00 64.71 ATOM 8091 OH TYRE 192 65.744 24.10121.538 1.00 66.46 ATOM 8092 C TYRE 192 71.262 27.69425.795 1.00 65.22 ATOM 8093 0 TYRE 192 71.181 27.69927.026 1.00 67.13 ATOM 8094 N GLUE 193 72.010 28.55725.112 1.00 65.61 ATOM 8095 CA GLUE 193 72.792 29.60625.773 1.00 64.70 55 ATOM 8096 CB GLUE 193 73.643 30.37224.749 1.00 66.19 ATOM 8097 CG GLUE 193 74.722 29.52224.074 1.00 69.50 ATOM 8098 CD GLUE 193 75.625 30.34523.144 1.00 72.29 ATOM 8099 OE1 GLUE 193 76.083 31.43523.584 1.00 71.70 ATOM 8100 OE2 GLUE 193 75.881 29.89821.985 1.00 73.48 ATOM 8101 C GLUE 193 71.890 30.60026.498 1.00 63.08 ATOM 8102 O GLUE 193 70.747 30.82826.095 1.00 64.03 ATOM 8103 N ASPE 194 72.418 31.18727.566 1.00 62.00 ATOM 8104 CA ASPE 194 71.683 32.16828.340 1.00 60.31 ATOM 8105 CB ASPE 194 70.644 31.48029.235 1.00 62.01 ATOM 8106 CG ASPE 194 71.268 30.74930.413 1.00 64.58 ATOM 8107 OD1 ASPE 194 71.200 29.50430.448 1.00 66.44 ATOM 8108 OD2 ASPE 194 71.824 31.41531.314 1.00 64.95 ATOM 8109 C ASPE 194 72.637 32.98929.193 1.00 59.18 ATOM 8110 0 ASPE 194 73.715 32.51529.570 1.00 59.24 ATOM 8111 N VALE 195 72.238 34.22329.484 1.00 56.73 1~ ATOM 8112 CA VALE 195 73.029 35.12130.311 1.00 55.51 ATOM 8113 CB VALE 195 73.019 36.55529.763 1.00 53.92 ATOM 8114 CG1 VALE 195 73.686 37.49830.752 1.00 53.41 ATOM 8115 CG2 VALE 195 73.738 36.59528.431 1.00 55.34 ATOM 8116 C VALE 195 72.453 35.14531.715 1.00 56.03 15 ATOM 8117 0 VALE 195 71.270 35.40031.907 1.00 56.70 ATOM 8118 N GLUE 196 73.292 34.86832.702 1.00 57.06 ATOM 8119 CA GLUE 196 72.834 34.87034.077 1.00 57.01 ATOM 8120 CB GLUE 196 73.402 33.67334.821 1.00 57.41 ATOM 8121 CG GLUE 196 72.908 33.55536.238 1.00 61.42 ATOM 8122 CD GLUE 196 73.533 32.38336.968 1.00 62.69 ATOM 8123 OE1 GLUE 196 73.377 31.23536.493 1.00 64.88 ATOM 8124 OE2 GLUE 196 74.184 32.60438.013 1.00 64.76 ATOM 8125 C GLUE 196 73.315 36.16034.715 1.00 57.51 ATOM 8126 0 GLUE 196 74.518 36.42734.755 1.00 60.16 25 ATOM 8127 N VALE 197 72.375 36.96935.192 1.00 55.54 ATOM 8128 CA VALE 197 72.712 38.22635.829 1.00 54.09 ATOM 8129 CB VALE 197 71.853 39.38035.278 1.00 50.90 ATOM 8130 CG1 VALE 197 72.241 40.68535.932 1.00 47.64 ATOM 8131 CG2 VALE 197 72.030 39.47133.782 1.00 49.59 ATOM 8132 C VALE 197 72.473 38.06737.325 1.00 56.97 ATOM 8133 O VALE 197 71.414 37.61437.748 1.00 58.03 ATOM 8134 N SERE 198 73.476 38.40938.125 1.00 58.05 ATOM 8135 CA SERE 198 73.338 38.30039.562 1.00 58.55 ATOM 8136 CB SERE 198 74.550 37.58440.174 1.00 58.65 35 ATOM 8137 OG SERE 198 74.556 36.20939.811 1.00 60.87 ATOM 8138 C SERE 198 73.182 39.68540.155 1.00 58.53 ATOM 8139 0 SERE 198 74.049 40.54940.004 1.00 59.57 ATOM 8140 N LEUE 199 72.060 39.89540.823 1.00 58.51 ATOM 8141 CA LEUE 199 71.803 41.17641.434 1.00 59.74 ATOM 8142 CB LEUE 199 70.361 41.61241.186 1.00 59.28 ATOM 8143 CG LEUE 199 69.921 42.86141.953 1.00 58.45 ATOM 8144 CDl LEUE 199 70.758 44.05941.543 1.00 57.64 ATOM 8145 CD2 LEUE 199 68.466 43.12741.669 1.00 57.53 ATOM 8146 C LEUE 199 72.039 41.08442.917 1.00 61.63 45 ATOM 8147 0 LEUE 199 71.226 40.50043.640 1.00 64.16 ATOM 8148 N ASNE 200 73.163 41.63743.366 1.00 61.69 ATOM 8149 CA ASNE 200 73.486 41.65844.780 1.00 58.91 ATOM 8150 CB ASNE 200 74.981 41.47744.994 1.00 61.22 ATOM 8151 CG ASNE 200 75.355 41.52246.454 1.00 63.36 ATOM 8152 OD1 ASNE 200 74.686 40.91647.295 1.00 64.82 ATOM 8153 ND2 ASNE 200 76.426 42.23546.770 1.00 64.37 ATOM 8154 C ASNE 200 73.048 43.02645.280 1.00 56.95 ATOM 8155 0 ASNE 200 73.610 44.05644.905 1.00 58.64 ATOM 8156 N PHEE 201 72.018 43.03046.109 1.00 54.18 55 ATOM 8157 CA PHEE 201 71.474 44.26046.650 1.00 52.16 ATOM 8158 CB PHEE 201 70.257 44.68845.844 1.00 50.83 ATOM 8159 CG PHEE 201 69.065 43.78046.028 1.00 47.47 ATOM 8160 CD1 PHEE 201 67.923 44.23346.681 1.00 47.04 ATOM 8161 CD2 PHEE 201 69.107 42.45845.601 1.00 44.93 ATOM 8162 CE1 PHEE 201 66.843 43.38246.911 1.00 45.49 ATOM 8163 CE2 PHEE 201 68.043 41.60845.829 1.00 43.88 ATOM 8164 CZ PHEE 201 66.905 42.07246.488 1.00 43.86 ATOM 8165 C PHEE 201 71.029 43.97748.066 1.00 53.50 ATOM 8166 0 PHEE 201 71.001 42.82348.504 1.00 53.30 ATOM 8167 N ARGE 202 70.650 45.03248.770 1.00 55.04 ATOM 8168 CA ARGE 202 70.195 44.91550.146 1.00 57.24 ATOM 8169 CB ARGE 202 71.399 44.89851.084 1.00 59.58 ATOM 8170 CG ARGE 202 72.078 46.25451.130 1.00 64.26 ATOM 8171 CD ARGE 202 73.337 46.27851.951 1.00 65.59 ATOM 8172 NE ARGE 202 73.935 47.60651.908 1.00 67.13 1~ ATOM 8173 CZ ARGE 202 75.140 47.89152.386 1.00 68.53 ATOM 8174 NH1 ARGE 202 75.870 46.93052.942 1.00 69.03 ATOM 8175 NH2 ARGE 202 75.612 49.12952.303 1.00 68.11 ATOM 8176 C AKGE 202 69.321 46.12150.499 1.00 57.27 ATOM 8177 0 ARGE 202 69.370 47.16749.839 1.00 56.88 15 ATOM 8178 N LYSE 203 68.528 45.97451.551 1.00 56.76 ATOM 8179 CA LYSE 203 67.689 47.06352.011 1.00 57.10 ATOM 8180 CB LYSE 203 66.755 46.58353.109 1.00 58.42 ATOM 8181 CG LYSE 203 65.904 47.68253.702 1.00 60.29 ATOM 8182 CD LYSE 203 65.112 47.15754.883 1.00 64.62 ATOM 8183 CE LYSE 203 64.222 48.24155.471 1.00 67.46 ATOM 8184 NZ LYSE 203 63.171 48.69654.504 1.00 70.79 ATOM 8185 C LYSE 203 68.623 48.10152.603 1.00 56.53 ATOM 8186 0 LYSE 203 69.715 47.76953.060 1.00 58.18 ATOM 8187 N LYSE 204 68.190 49.35252.629 1.00 53.82 25 ATOM 8188 CA LYSE 204 69.021 50.39253.207 1.00 52.45 ATOM 8189 CB LYSE 204 68.545 51.76652.731 1.00 50.86 ATOM 8190 CG LYSE 204 68.852 52.11051.279 1.00 44.94 ATOM 8191 CD LYSE 204 68.253 53.46250.970 1.00 45.54 ATOM 8192 CE LYSE 204 68.744 54.05049.669 1.00 46.91 ATOM 8193 NZ LYSE 204 68.388 53.26848.463 1.00 48.94 ATOM 8194 C LYSE 204 68.991 50.31754.747 1.00 54.01 ATOM 8195 0 LYSE 204 68.119 49.66855.329 1.00 54.82 ATOM 8196 N GLYE 205 69.958 50.96955.394 1.00 53.51 ATOM 8197 CA GLYE 205 70.025 50.98756.848 1.00 52.96 35 ATOM 8198 C GLYE 205 69.747 52.40057.344 1.00 54.24 ATOM 8199 OT1 GLYE 205 69.326 53.22456.507 1.00 53.02 ATOM 8200 OT2 GLYE 205 69.937 52.69758.551 1.00 54.73 ATOM 8201 OH2 WATW 1 42.707 26.84416.535 1.00 50.04 ATOM 8202 OH2 WATW 2 46.115 22.9228.819 1.00 33.72 ATOM 8203 OH2 WATW 3 49.921 22.96213.240 1.00 27.71 ATOM 8204 OH2 WATW 4 48.219 24.5269.434 1.00 48.75 ATOM 8205 OH2 WATW 5 27.826 41.69017.095 1.00 41.54 ATOM 8206 OH2 WATW 6 24.872 36.5898.613 1.00 51.20 ATOM 8207 OH2 WATW 7 36.046 60.03417.934 1.00 33.21 45 ATOM 8208 OH2 WATW 8 35.043 57.81116.418 1.00 28.29 ATOM 8209 OH2 WATW 9 55.882 56.45516.997 1.00 31.72 ATOM 8210 OH2 WATW 10 55.717 62.2929.132 1.00 41.99 ATOM 8211 OH2 WATW 11 54.077 57.63815.628 1.00 35.89 ATOM 8212 OH2 WATW 12 60.807 36.70017.893 1.00 31.22 ATOM 8213 OH2 WATW 13 66.541 42.74813.082 1.00 52.94 ATOM 8214 OH2 WATW 14 64.752 41.3279.587 1.00 53.75 ATOM 8215 CA+2CA2I 1 56.450 11.09737.999 1.00 76.79 ATOM 8216 CL-1CL1I 2 37.092 21.68412.754 1.00 43.91 ATOM 8217 CA+2CA2I 3 17.667 23.11038.506 1.00 80.38 55 ATOM 8218 CL-1CL1I 4 20.502 44.77413.190 1.00 62.37 ATOM 8219 CA+2CA2I 5 16.762 64.15438.299 1.00 85.82 ATOM 8220 CL-1CL1I 6 37.412 67.36313.067 1.00 45.17 ATOM 8221 CA+2CA2I 7 55.038 76.85837.301 1.00 71.00 ATOM 8222 CL-1CL1I 8 64.026 57.74612.334 1.00 69.47 ATOM 8223 CA+2CA2I 9 79.499 45.06737.836 1.00 85.28 ATOM 8224 CL-1CLlI 10 64.286 29.84412.440 1.00 48.05 ATOM 8225 C1 HEPL 1 31.694 22.16923.679 1.00109.78 ATOM 8226 C2 HEPL 1 32.042 22.82225.000 1.00106.01 ATOM 8227 C3 HEPL 1 33.258 20.66725.468 1.00 99.68 ATOM 8228 C4 HEPL 1 34.107 19.90126.462 1.00 97.90 ATOM 8229 C5 HEPL 1 33.049 21.22028.203 1.00 99.77 ATOM 8230 C6 HEPL 1 32.154 21.95327.266 1.00101.85 ATOM 8231 C7 HEPL 1 34.051 19.06728.833 1.00 98.50 ATOM 8232 C8 HEPL 1 35.030 19.80229.773 1.00 97.76 ATOM 8233 04 HEPL 1 34.441 19.86031.064 1.00 96.20 ATOM 8234 N1 HEPL 1 32.880 22.04325.968 1.00103.11 ATOM 8235 S1 HEPL 1 31.207 23.33622.418 1.00113.66 ATOM 8236 01 HEPL 1 31.826 22.87821.182 1.00113.59 ATOM 8237 02 HEPL 1 31.477 24.68522.941 1.00111.64 ATOM 8238 03 HEPL 1 29.701 23.32222.307 1.00111.51 15 ATOM 8239 N2 HEPL 1 33.333 19.83927.737 1.00 98.16 ATOM 8240 C1 HEPL 2 19.833 49.70824.248 1.00108.88 ATOM 8241 C2 HEPL 2 20.653 49.68425.518 1.00104.63 ATOM 8242 C3 HEPL 2 19.090 47.81426.172 1.00100.27 ATOM 8243 C4 HEPL 2 18.728 46.78827.241 1.00 98.30 ATOM 8244 C5 HEPL 2 19.702 48.32628.859 1.00100.12 ATOM 8245 C6 HEPL 2 20.022 49.38027.845 1.00101.78 ATOM 8246 C7 HEPL 2 18.080 46.64629.663 1.00 97.02 ATOM 8247 C8 HEPL 2 19.186 46.06530.550 1.00 96.36 ATOM 8248 04 HEPL 2 19.161 46.71431.805 1.00 95.77 25 ATOM 8249 N1 HEPL 2 20.281 48.67626.560 1.00102.78 ATOM 8250 S1 HEPL 2 20.640 50.53022.892 1.00112.59 ATOM 8251 01 HEPL 2 20.348 49.76521.697 1.00113.24 ATOM 8252 02 HEPL 2 22.024 50.79123.309 1.00111.25 ATOM 8253 03 HEPL 2 20.059 51.92422.770 1.00111.32 ATOM 8254 N2 HEPL 2 18.478 47.54428.507 1.00 98.39 ATOM 8255 C1 HEPL 3 42.028 70.36923.900 1.00109.55 ATOM 8256 C2 HEPL 3 42.091 69.31225.003 1.00104.54 ATOM 8257 C3 HEPL 3 40.178 70.59425.988 1.00 97.17 ATOM 8258 C4 HEPL 3 39.192 70.68827.124 1.00 96.78 35 ATOM 8259 C5 HEPL 3 40.844 69.54028.502 1.00 98.62 ATOM 8260 C6 HEPL 3 41.854 69.47627.408 1.00100.28 ATOM 8261 C7 HEPL 3 39.103 70.89129.639 1.00 97.37 ATOM 8262 C8 HEPL 3 38.600 69.61630.336 1.00 97.34 ATOM 8263 04 HEPL 3 39.310 69.46631.552 1.00 95.42 ATOM 8264 N1 HEPL 3 41.104 69.41826.123 1.00100.25 ATOM 8265 Sl HEPL 3 42.851 69.89722.390 1.00113.40 ATOM 8266 O1 HEPL 3 41.999 70.35221.301 1.00112.83 ATOM 8267 02 HEPL 3 43.216 68.46422.535 1.00111.97 ATOM 8268 03 HEPL 3 44.208 70.58022.342 1.00111.22 45 ATOM 8269 N2 HEPL 3 39.982 70.75628.394 1.00 97.91 ATOM 8270 C1 HEPL 4 67.843 54.52923.109 1.00109.23 ATOM 8271 C2 HEPL 4 67.696 54.05324.549 1.00105.70 ATOM 8272 C3 HEPL 4 67.448 56.48825.071 1.00101.29 ATOM 8273 C4 HEPL 4 67.199 57.52626.150 1.00 99.73 ATOM 8274 C5 HEPL 4 68.223 55.96027.701 1.00100.32 ATOM 8275 C6 HEPL 4 68.526 54.94826.646 1.00101.68 ATOM 8276 C7 HEPL 4 68.126 58.36228.296 1.00 99.92 ATOM 8277 C8 HEPL 4 67.284 58.00729.528 1.00100.01 ATOM 8278 04 HEPL 4 68.179 57.75130.594 1.00100.41 55 ATOM 8279 N1 HEPL 4 67.472 55.08225.609 1.00103.08 ATOM 8280 S1 HEPL 4 67.556 53.25221.895 1.00112.53 ATOM 8281 01 HEPL 4 66.829 53.86020.813 1.00112.71 ATOM 8282 02 HEPL 4 67.011 52.08022.599 1.00111.24 ATOM 8283 03 HEPL 4 68.908 52.76521.423 1.00111.51 ATOM 8284 N2 HEPL 4 68.258 57.35427.169 1.00 99.66 ATOM 8285 C1 HEPL 5 62.836 24.32723.511 1.00108.64 ATOM 8286 C2 HEP L 5 62.164 25.268 24.495 1.00104.37 ATOM 8287 C3 HEP L 5 64.426 25.352 25.555 1.00 99.26 ATOM 8288 C4 HEP L 5 65.270 25.934 26.676 1.00 98.50 ATOM 8289 C5 HEP L 5 63.215 26.126 27.960 1.00 99.10 ATOM 8290 C6 HEP L 5 62.366 25.505 26.903 7_.00100.20 ATOM 8291 C7 HEP L 5 65.381 26.089 29.165 1.00 98.56 ATOM 8292 C8 HEP L 5 65.085 27.500 29.708 1.00 98.97 ATOM 8293 04 HEP L 5 64.379 27.406 30.942 1.00 98.36 ATOM 8294 N1 HEP L 5 63.001 25.830 25.594 1.00101.58 ATOM 8295 S1 HEP L 5 61.935 24.146 21.985 1.00112.71 ATOM 8296 01 HEP L 5 62.912 24.120 20.912 1.00112.36 ATOM 8297 02 HEP L 5 60.852 25.151 22.006 1.00111.63 ATOM 8298 03 HEP L 5 61.166 22.846 22.024 1.00111.95 ATOM 8299 N2 HEP L 5 64.610 25.582 27.957 1.00 98.40 ~'rJEND

Atom Type Residue # X Y Z OCC B
Table 1: Structural coordinates of AChBP
"Atom type" refers to the element whoose coordinate are measured. The first letter in the column defines the element.
"Residue" refers to the amino acid in the AChBP protein sequence, using the standard three letter abbreviations known in the art.
"#" refers to the residue number.
"X, Y, Z" crystallographically define the atomic position, in three-dimensional space, of the element measured.
"OCC" is the occupancy volume.
"B" is a thermal factor that measures movement of the atom around its atomic center.

(1 /20) SEQUENCE LISTING
<110> Technologiestichting STW
<120> Water-soluble ligand-binding proteins and analogs of ligand-gated ion channels, crystals thereof and their use for screening ligands of ligand-gated ion channels <130> F 1105 CA
<140>
<141>
<160> 20 <170> PatentIn Ver. 2.1 <210> 1 <211> 690 <212> DNA
<213> Lymnaea stagnalis <220>
<221> CDS
<222> (1)..(687) <220>
<221> mat_peptide <222> (58)..(687) <400> 1 atg cgt cga aac att ttc tgc ctt get tgt ctc tgg atc gtg caa gcg 48 Met Arg Arg Asn Ile Phe Cys Leu Ala Cys Leu Trp Ile Val Gln Ala tgt cta agc ttg gac cgg gca gac atc ttg tac aac ata cgt cag aca 96 Cys Leu Ser Leu Asp Arg Ala Asp Ile Leu Tyr Asn Ile Arg Gln Thr (2/20) tcg aga ccg gat gtg att ccc aca cag cga gat cgc cca gtg gcg gtg 144 Ser Arg Pro Asp Val Ile Pro Thr Gln Arg Asp Arg Pro Val Ala Val tcc gtc tct ttg aag ttc atc aac atc ttg gaa gtg aat gaa ata acc 192 Ser Val Ser Leu Lys Phe Ile Asn Ile Leu Glu Val Asn Glu Ile Thr aat gaa gtg gac gtg gtc ttt tgg cag cag acg aca tgg tcg gac agg 240 Asn Glu Val Asp Val Val Phe Trp Gln Gln Thr Thr Trp Ser Asp Arg acc ctc gcc tgg aac agt tct cac tca cca gat cag gtt tcc gtg cca 288 Thr Leu Ala Trp Asn Ser Ser His Ser Pro Asp Gln Val Ser Val Pro ata agc tct ttg tgg gtg cct gac ctc get gca tac aac gcc atc tcg 336 Ile Ser Ser Leu Trp Val Pro Asp Leu Ala Ala Tyr Asn Ala Ile Ser aaa cct gaa gtc ctt aca ccg caa ctg gcc agg gtc gta tcc gat ggt 384 Lys Pro Glu Val Leu Thr Pro G1n Leu Ala Arg Val Val Ser Asp Gly gaa gtg ctg tac atg ccg agt atc cgc cag cgg ttc tcc tgc gat gta 432 Glu Val Leu Tyr Met Pro Ser Ile Arg Gln Arg Phe Ser Cys Asp Val tcg ggt gtc gat acg gag tcc ggt get aca tgt cgg atc aaa att ggt 480 Ser Gly Val Asp Thr Glu Ser Gly Ala Thr Cys Arg Ile Lys Ile Gly tcc tgg acc cac cac agt aga gag att tct gta gat ccc acg aca gaa 528 Ser Trp Thr His His Ser Arg Glu Ile Ser Val Asp Pro Thr Thr Glu aat agt gat gat tct gaa tac ttc tcc caa tac tct cgc ttt gaa atc 576 Asn Ser Asp Asp Ser Glu Tyr Phe Ser Gln Tyr Ser Arg Phe Glu Ile (3/20) ttg gac gtc aca cag aag aag aac tcg gtt acc tac tct tgc tgt ccg 624 Leu Asp Val Thr Gln Lys Lys Asn Ser Val Thr Tyr Ser Cys Cys Pro gag gca tac gag gac gtt gaa gtg agt ctc aat ttc cgg aag aag gga 672 Glu Ala Tyr Glu Asp Val Glu Val Ser Leu Asn Phe Arg Lys Lys Gly cgc tcc gaa att ctt tag 690 Arg Ser Glu Ile Leu <210> 2 <211> 229 <212> PRT
<213> Lymnaea stagnalis <400> 2 Met Arg Arg Asn Ile Phe Cys Leu Ala Cys Leu Trp Ile Val Gln Ala Cys Leu Ser Leu Asp Arg Ala Asp Ile Leu Tyr Asn Ile Arg Gln Thr Ser Arg Pro Asp Val Ile Pro Thr Gln Arg Asp Arg Pro Val Ala Val Ser Val Ser Leu Lys Phe Ile Asn Ile Leu Glu Val Asn Glu Ile Thr Asn Glu Val Asp Val Val Phe Trp Gln Gln Thr Thr Trp Ser Asp Arg Thr Leu Ala Trp Asn Ser Ser His Ser Pro Asp Gln Val Ser Val Pro Ile Ser Ser Leu Trp Val Pro Asp Leu Ala Ala Tyr Asn Ala Ile Ser (4/20) Lys Pro Glu Val Leu Thr Pro Gln Leu Ala Arg Val Val Ser Asp Gly Glu Val Leu Tyr Met Pro Ser Ile Arg Gln Arg Phe Ser Cys Asp Val Ser Gly Val Asp Thr Glu Ser Gly Ala Thr Cys Arg Ile Lys Ile Gly Ser Trp Thr His His Ser Arg Glu Ile Ser Val Asp Pro Thr Thr Glu Asn Ser Asp Asp Ser Glu Tyr Phe Ser Gln Tyr Ser Arg Phe Glu Ile Leu Asp Val Thr Gln Lys Lys Asn Ser Val Thr Tyr Ser Cys Cys Pro Glu Ala Tyr Glu Asp Val Glu Val Ser Leu Asn Phe Arg Lys Lys Gly Arg Ser Glu Ile Leu <210> 3 <211> 690 <212> DNA
<213> Lymnaea stagnalis <220>
<221> CDS
<222> (1)..(687) <220>
<221> mat~eptide <222> (58)..(687) <400> 3 (5/20) atg cgt cga aac att ttc tgc ctt get tgt ctc tgg atc gtg caa ggg 48 Met Arg Arg Asn Ile Phe Cys Leu Ala Cys Leu Trp Ile Val Gln Gly tgt cta agc ttg gac cgg gca gac atc ttg tac aac ata cgt cag aca 96 Cys Leu Ser Leu Asp Arg Ala Asp Ile Leu Tyr Asn Ile Arg Gln Thr tcg aga ccg gat gtg att ccc aca cag cga gat cgc cca gtg gcg gtg 144 Ser Arg Pro Asp Val Ile Pro Thr Gln Arg Asp Arg Pro Val Ala Val tcc gtc tct ttg aag ttc atc aac atc ttg gaa gtg aat gaa ata acc 192 Ser Val Ser Leu Lys Phe Ile Asn Ile Leu Glu Val Asn Glu Ile Thr aat gaa gtg gac gtg gtc ttt tgg cag cag acg aca tgg tcg gac agg 240 Asn Glu Val Asp Val Val Phe Trp Gln Gln Thr Thr Trp Ser Asp Arg acc ctc gcc tgg aac agt tct cac tca cca gat cag gtt tcc gtg cca 288 Thr Leu Ala Trp Asn Ser Ser His Ser Pro Asp Gln Val Ser Val Pro ata agc tct ttg tgg gtg cct gac ctc get gca tac aac gcc atc tcg 336 Ile Ser Ser Leu Trp Val Pro Asp Leu Ala Ala Tyr Asn Ala Ile Ser aaa cct gaa gtc ctt aca ccg caa ctg gcc agg gtc gta tcc gat ggt 384 Lys Pro Glu Val Leu Thr Pro Gln Leu Ala Arg Val Val Ser Asp Gly gaa gtg ctg tac atg ccg agt atc cgc cag cgg ttc tcc tgc gat gta 432 Glu Val Leu Tyr Met Pro Ser Ile Arg Gln Arg Phe Ser Cys Asp Val tcg ggt gtc gat acg gag tcc ggt get acg tgt cgg atc aaa att ggt 480 Ser Gly Val Asp Thr Glu Ser Gly Ala Thr Cys Arg Ile Lys Ile Gly (6/20) tcc tgg acc cac cac agt gga gag att tct gta gat ccc acg aca gaa 528 Ser Trp Thr His His Ser Gly Glu Ile Ser Val Asp Pro Thr Thr Glu aat agt gat gat tct gaa tac ttc tcc caa tac tct cgc ttt gaa atc 576 Asn Ser Asp Asp Ser Glu Tyr Phe Ser Gln Tyr Ser Arg Phe Glu Ile ttg gac gtc aca cag aag aag aac tcg gtt atc tac tct tgc tgt ccg 624 Leu Asp Val Thr Gln Lys Lys Asn Ser Val Ile Tyr Ser Cys Cys Pro gag gca tac gag gac gtt gaa gtg agt ctc aat ttc cgg aag aag gga 672 Glu Ala Tyr Glu Asp Val Glu Val Ser Leu Asn Phe Arg Lys Lys Gly cgc tcc gaa att ctt tag 690 Arg Ser Glu Ile Leu <210> 4 <211> 229 <212> PRT
<213> Lymnaea stagnalis <400> 4 Met Arg Arg Asn Ile Phe Cys Leu Ala Cys Leu Trp Ile Val Gln Gly Cys Leu Ser Leu Asp Arg Ala Asp Ile Leu Tyr Asn Ile Arg Gln Thr Ser Arg Pro Asp Val Ile Pro Thr Gln Arg Asp Arg Pro Val Ala Val Ser Val Ser Leu Lys Phe Ile Asn Ile Leu Glu Val Asn Glu Ile Thr Asn Glu Val Asp Val Val Phe Trp Gln Gln Thr Thr Trp Ser Asp Arg (7/20) Thr Leu Ala Trp Asn Ser Ser His Ser Pro Asp Gln Val Ser Val Pro Ile Ser Ser Leu Trp Val Pro Asp Leu Ala Ala Tyr Asn Ala Ile Ser Lys Pro Glu Val Leu Thr Pro Gln Leu Ala Arg Val Val Ser Asp Gly Glu Val Leu Tyr Met Pro Ser Ile Arg Gln Arg Phe Ser Cys Asp Val Ser Gly Val Asp Thr Glu Ser Gly Ala Thr Cys Arg Ile Lys Ile Gly Ser Trp Thr His His Ser Gly Glu Ile Ser Val Asp Pro Thr Thr Glu Asn Ser Asp Asp Ser Glu Tyr Phe Ser Gln Tyr Ser Arg Phe Glu Ile Leu Asp Val Thr Gln Lys Lys Asn Ser Val Ile Tyr Ser Cys Cys Pro Glu Ala Tyr Glu Asp Val Glu Val Ser Leu Asn Phe Arg Lys Lys Gly Arg Ser Glu Ile Leu <210>5 <211>675 <212>DNA

<213>Bulinus truncatus <220>

(8/20) <221> CDS
<222> (1)..(672) <220>
<221> mat~eptide <222> (64)..(672) <400> 5 atg get gaa cta cga agg atc att ctt ctg cta tgt act att gcc ttt 48 Met Ala Glu Leu Arg Arg Ile Ile Leu Leu Leu Cys Thr Ile Ala Phe cat gtt tcc cat gga caa ata aga tgg acg ctg ctg aat cag atc acc 96 His Val Ser His Gly Gln Ile Arg Trp Thr Leu Leu Asn Gln Ile Thr ggt gaa tct gac gtc att ccg ctg tct aac aac acg ccc ctg aat gtg 144 Gly Glu Ser Asp Val Ile Pro Leu Ser Asn Asn Thr Pro Leu Asn Val tcg ctg aat ttt aag ctg atg aat atc gta gag gcg gac aca gaa aaa 192 Ser Leu Asn Phe Lys Leu Met Asn Ile Val Glu Ala Asp Thr Glu Lys gat caa gtg gag gtc gtg ctg tgg aca cag get agc tgg aaa gtg ccg 240 Asp Gln Val Glu Val Val Leu Trp Thr Gln Ala Ser Trp Lys Val Pro tat tac agc tca ctg ctg tcc tct agc agt tta gac cag gtg agc tta 288 Tyr Tyr Ser Ser Leu Leu Ser Ser Ser Ser Leu Asp Gln Val Ser Leu cca gtc agc aaa atg tgg acc cca gac ctt tct ttc tac aac gcc atc 336 Pro Val Ser Lys Met Trp Thr Pro Asp Leu Ser Phe Tyr Asn Ala Ile get gca ccc gag ttg ctc tcc gca gac cgc gtg gtg gtc tct aag gac 384 Ala Ala Pro Glu Leu Leu Ser Ala Asp Arg Val Val Val Ser Lys Asp (9/20) ggg agc gtc att tac gtc ccc agc cag agg gtc cgt ttc acc tgc gac 432 Gly Ser Val Ile Tyr Val Pro Ser Gln Arg Val Arg Phe Thr Cys Asp ctt att aat gtc gac acg gag ccg gga gcc acc tgt cgc atc aaa gtc 480 Leu Ile Asn Val Asp Thr Glu Pro Gly Ala Thr Cys Arg Ile Lys Val gga tcc tgg acc cac gac aac aaa cag ttc gcc ctg atc acc ggg gag 528 Gly Ser Trp Thr His Asp Asn Lys Gln Phe Ala Leu Ile Thr Gly Glu gag ggg gtg gtg aat att gca gag tac ttc gac agc cca aag ttt gac 576 Glu Gly Val Val Asn Ile Ala Glu Tyr Phe Asp Ser Pro Lys Phe Asp ctt ttg agt gcc aca cag agt ctg aat cgc aag aag tac agc tgt tgc 624 Leu Leu Ser Ala Thr Gln Ser Leu Asn Arg Lys Lys Tyr Ser Cys Cys gag aat atg tat gat gac att gaa att acc ttt gca ttc aga aag aag 672 Glu Asn Met Tyr Asp Asp Ile Glu Ile Thr Phe Ala Phe Arg Lys Lys taa 675 <210>6 <211>224 <212>PRT

<213>Bulinus truncatus <400> 6 Met Ala Glu Leu Arg Arg Ile Ile Leu Leu Leu Cys Thr Ile Ala Phe His Val Ser His Gly Gln Ile Arg Trp Thr Leu Leu Asn Gln Ile Thr Gly Glu Ser Asp Val Ile Pro Leu Ser Asn Asn Thr Pro Leu Asn Val ( 10/20) Ser Leu Asn Phe Lys Leu Met Asn Ile Val Glu Ala Asp Thr Glu Lys Asp Gln Val Glu Val Val Leu Trp Thr Gln Ala Ser Trp Lys Val Pro Tyr Tyr Ser Ser Leu Leu Ser Ser Ser Ser Leu Asp Gln Val Ser Leu Pro Val Ser Lys Met Trp Thr Pro Asp Leu Ser Phe Tyr Asn Ala Ile Ala Ala Pro Glu Leu Leu Ser Ala Asp Arg Val Val Val Ser Lys Asp Gly Ser Val Ile Tyr Val Pro Ser Gln Arg Val Arg Phe Thr Cys Asp Leu Ile Asn Val Asp Thr Glu Pro Gly Ala Thr Cys Arg Ile Lys Val Gly Ser Trp Thr His Asp Asn Lys Gln Phe Ala Leu Ile Thr Gly Glu Glu Gly Val Val Asn Ile Ala Glu Tyr Phe Asp Ser Pro Lys Phe Asp Leu Leu Ser Ala Thr Gln Ser Leu Asn Arg Lys Lys Tyr Ser Cys Cys Glu Asn Met Tyr Asp Asp Ile Glu Ile Thr Phe Ala Phe Arg Lys Lys <210> 7 <211> 675 <212> DNA

( 11 /20) <213> Bulinus truncatus <220>
<221> CDS
<222> (1)..(672) <220>
<221> mat_peptide <222> (64)..(672) <400> 7 atg get gaa cta cga ggg atc att ctt ctg cta tgt act att gcc ttt 48 Met Ala Glu Leu Arg Gly Ile Ile Leu Leu Leu Cys Thr Ile Ala Phe cat gtt tcc cat gga caa ata aga tgg acg ctg ctg aat cag atc acc 96 His Val Ser His Gly Gln Ile Arg Trp Thr Leu Leu Asn Gln Ile Thr ggt gaa tct gac gtc att ccg ctg tct aac aac acg cca ctg aat gtg 144 Gly Glu Ser Asp Val Ile Pro Leu Ser Asn Asn Thr Pro Leu Asn Val tcg ctg aat ttt aag ctg atg aat atc tta gag gcg gac aca gag aaa 192 Ser Leu Asn Phe Lys Leu Met Asn Ile Leu Glu Ala Asp Thr Glu Lys gat caa gtg gag gtc gtg ctg tgg aca cag get agc tgg aaa gtg ccg 240 Asp Gln Val Glu Val Val Leu Trp Thr Gln Ala Ser Trp Lys Val Pro tat tac agc tca ctg ctg tcc tct agc agt tta gac cag gtg agc tta 288 Tyr Tyr Ser Ser Leu Leu Ser Ser Ser Ser Leu Asp Gln Val Ser Leu cca gcc agc aaa atg tgg acc cca gac ctt tct ttc tat aac gcc atc 336 Pro Ala Ser Lys Met Trp Thr Pro Asp Leu Ser Phe Tyr Asn Ala Ile get gca ccc gag ttg ctc tcc aca gac cgc gtg gtg gtc tct aag gac 384 ( 12/20) Ala Ala Pro Glu Leu Leu Ser Thr Asp Arg Val Val Val Ser Lys Asp ggg agc gtc att tac gtg ccc agc cag agg gtc cgt ttc acc tgc gac 432 Gly Ser Val Ile Tyr Val Pro Ser Gln Arg Val Arg Phe Thr Cys Asp ctt att aat gtg gac acg gag ccg gga gcc acc tgt cgc atc aaa gtc 480 Leu Ile Asn Val Asp Thr Glu Pro Gly Ala Thr Cys Arg Ile Lys Val gga tcc tgg acc ttc gac aac aaa cag ctc gcc ctg atc acc ggg gag 528 Gly Ser Trp Thr Phe Asp Asn Lys Gln Leu Ala Leu Ile Thr Gly Glu gag ggg gtg gtg aat att gca gag tac ttc gac agc cca aag tac gac 576 Glu Gly Val Val Asn Ile Ala Glu Tyr Phe Asp Ser Pro Lys Tyr Asp ctt ttg agt gcc aca cag agt ctg aat cgc aag aag tac aga tgt tgc 624 Leu Leu Ser Ala Thr Gln Ser Leu Asn Arg Lys Lys Tyr Arg Cys Cys gag aat atg tat gaa gac att gaa att acc ttt gca ttc aga aag aag 672 Glu Asn Met Tyr Glu Asp Ile Glu Ile Thr Phe Ala Phe Arg Lys Lys taa 675 <210> 8 <211> 224 <212> PRT
<213> Bulinus truncatus <400> 8 Met Ala Glu Leu Arg Gly Ile Ile Leu Leu Leu Cys Thr Ile Ala Phe His Val Ser His Gly Gln Ile Arg Trp Thr Leu Leu Asn Gln Ile Thr ( 13/20) Gly Glu Ser Asp Val Ile Pro Leu Ser Asn Asn Thr Pro Leu Asn Val Ser Leu Asn Phe Lys Leu Met Asn Ile Leu Glu Ala Asp Thr Glu Lys Asp Gln Val Glu Val Val Leu Trp Thr Gln Ala Ser Trp Lys Val Pro Tyr Tyr Ser Ser Leu Leu Ser Ser Ser Ser Leu Asp Gln Val Ser Leu Pro Ala Ser Lys Met Trp Thr Pro Asp Leu Ser Phe Tyr Asn Ala Ile Ala Ala Pro Glu Leu Leu Ser Thr Asp Arg Val Val Val Ser Lys Asp Gly Ser Val Ile Tyr Val Pro Ser Gln Arg Val Arg Phe Thr Cys Asp Leu Ile Asn Val Asp Thr Glu Pro Gly Ala Thr Cys Arg Ile Lys Val Gly Ser Trp Thr Phe Asp Asn Lys Gln Leu Ala Leu Ile Thr Gly Glu Glu Gly Val Val Asn Ile Ala Glu Tyr Phe Asp Ser Pro Lys Tyr Asp Leu Leu Ser Ala Thr Gln Ser Leu Asn Arg Lys Lys Tyr Arg Cys Cys Glu Asn Met Tyr Glu Asp Ile Glu Ile Thr Phe Ala Phe Arg Lys Lys ( 14/20) <210> 9 <211> 502 <212> PRT
<213> Homo sapiens <220>
<221> DOMAIN
<222> (1)..(235) <400> 9 Met Arg Cys Ser Pro Gly Gly Val Trp Leu Ala Leu Ala Ala Ser Leu Leu His Val Ser Leu Gln Gly Glu Phe Gln Arg Lys Leu Tyr Lys Glu Leu Val Lys Asn Tyr Asn Pro Leu Glu Arg Pro Val Ala Asn Asp Ser Gln Pro Leu Thr Val Tyr Phe Ser Leu Ser Leu Leu Gln Ile Met Asp Val Asp Glu Lys Asn Gln Val Leu Thr Thr Asn Ile Trp Leu Gln Met Ser Trp Thr Asp His Tyr Leu Gln Trp Asn Val Ser Glu Tyr Pro Gly Val Lys Thr Val Arg Phe Pro Asp Gly Gln Ile Trp Lys Pro Asp Ile Leu Leu Tyr Asn Ser Ala Asp Glu Arg Phe Asp Ala Thr Phe His Thr Asn Val Leu Val Asn Ser Ser Gly His Cys Gln Tyr Leu Pro Pro Gly Ile Phe Lys Ser Ser Cys Tyr Ile Asp Val Arg Trp Phe Pro Phe Asp ( 15/20) Val Gln His Cys Lys Leu Lys Phe Gly Ser Trp Ser Tyr Gly Gly Trp Ser Leu Asp Leu Gln Met Gln Glu Ala Asp I1e Ser Gly Tyr Ile Pro Asn Gly Glu Trp Asp Leu Val Gly Ile Pro Gly Lys Arg Ser Glu Arg Phe Tyr Glu Cys Cys Lys Glu Pro Tyr Pro Asp Val Thr Phe Thr Val Thr Met Arg Arg Arg Thr Leu Tyr Tyr Gly Leu Asn Leu Leu Ile Pro Cys Val Leu Ile Ser Ala Leu Ala Leu Leu Val Phe Leu Leu Pro Ala Asp Ser Gly Glu Lys Ile Ser Leu Gly Ile Thr Val Leu Leu Ser Leu Thr Val Phe Met Leu Leu Val Ala Glu Ile Met Pro Ala Thr Ser Asp Ser Val Pro Leu Ile Ala Gln Tyr Phe Ala Ser Thr Met Ile Ile Val Gly Leu Ser Val Val Val Thr Val Ile Val Leu Gln Tyr His His His Asp Pro Asp Gly Gly Lys Met Pro Lys Trp Thr Arg Val Ile Leu Leu Asn Trp Cys Ala Trp Phe Leu Arg Met Lys Arg Pro Gly Glu Asp Lys Val Arg Pro Ala Cys Gln His Lys Gln Arg Arg Cys Ser Leu Ala 5er Val Glu Met Ser Ala Val Ala Pro Pro Pro Ala Ser Asn Gly Asn Leu ( 16/20) Leu Tyr Ile Gly Phe Arg Gly Leu Asp Gly Val His Cys Val Pro Thr Pro Asp Ser Gly Val Val Cys Gly Arg Met Ala Cys Ser Pro Thr His Asp Glu His Leu Leu His Gly Gly Gln Pro Pro Glu Gly Asp Pro Asp Leu Ala Lys Ile Leu Glu Glu Val Arg Tyr Ile Ala Asn Arg Phe Arg Cys Gln Asp Glu Ser Glu Ala Val Cys Ser Glu Trp Lys Phe Ala Ala Cys Val Val Asp Arg Leu Cys Leu Met Ala Phe Ser Val Phe Thr Ile Ile Cys Thr Ile Gly Ile Leu Met Ser Ala Pro Asn Phe Val Glu Ala Val Ser Lys Asp Phe Ala <210> 10 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: N-terminus of mature LAChBPI
<400> 10 Leu Asp Arg Ala Asp Ile Leu Tyr Asn Ile ( 17/20) <210> 11 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:
Oligonucleotides encoding N-terminal peptide of LAChBPl <220>
<221> modified base <222> (13) <223> i <400> 11 cggatccgay mgagcngaya thytntayaa ya 32 <210> 12 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primerl useful for cloning cDNA encoding LAChBP (optionally with Primer2) <220>
<221> modified base <222> (14) <223> i <220>
<221> modified base <222> (20) <223> i ( 18/20) <400> 12 gcgaattcga yacagarwsa ggngcnacnt g 31 <210> 13 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer2 useful for cloning cDNA encoding LAChBP
(optionally with Primerl) <220>
<221> modified base <222> (20) <223> i <400> 13 gcgaagcttc rtcytcrtaa gcytcngcrc arc 33 <210> 14 <211> 9 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: His-tag <400> 14 Ser Arg Gly His His His His His His <210> 15 <211> 14 <212> PRT
<213> Artificial Sequence ( 19/20) <220>
<223> Description of Artificial Sequence: His-tag <400> 15 Glu Phe Lys Asp Asp Asp Asp Lys His His His His His His <210> 16 <211> 4 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Additonal amino acids at the N-terminus of mature LAChBP due to alpha-mating factor cleavage site <400> 16 Glu Ala Glu Ala <210> 17 <211> 47 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer useful for generating LAChBP/alpha7 nAChR chimera <400> 17 gcgctcgaga aaagagaggc tgaagctttg gaccgggcag acatctt 47 <210> 18 <211> 30 <212> DNA

(20/20) <213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer useful for generating LAChBP/alpha7 nACHR chimera <400> 18 cgcgaattca agaatttcgg agcgtccctt 30 <210> 19 <211> 42 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer useful for generating LAChBP/alpha7 nACHR chimera <400> 19 gtggaaacca gacattctcc tctacaacgc catctcgaaa cc 42 <210> 20 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer useful for generating LAChBP/alpha7 nACHR chimera <400> 20 gaggagaatg tctggtttcc acaaagagct tattggcac 39

Claims

1. A water-soluble protein derived from a mollusc being capable of binding a ligand of a ligand-gated receptor.

2. The protein of claim 1, wherein the ligand is acetylcholine, gamma-amino-butyric acid (GABA), glycine or serotonin.

3. The protein of claim 2, wherein said protein is a acetylcholine-binding protein (AChBP).

4. The protein of any one of claim 1 to 3 which is capable of forming multimers.

5. The protein of any one of claims 1 to 4 which is derived form a Pulmonata species, preferably from a Basommatophora species.

6. The protein of any one of claims 1 to 5 comprising an amino acid sequence selected from the group consisting of:
(a) an amino acid sequence as depicted in any one of SEQ ID Nos. 2, 4, 6 or 8 or a functional equivalent thereof, or a fragment of at least 5 continuous amino acids thereof;
(b) an amino acid sequence having at least 30% amino acid identity to the amino acid sequence of any one of SEQ ID Nos. 2, 4, 6 or 8.

7. A water-soluble ligand binding protein capable of binding a ligand of a ligand-gated receptor and comprising at least 5 continuous amino acids of the aminoacid sequence depicted in any one of SEQ ID Nos. 2, 4, 6 or 8 and/or said protein is detectable by a monoclonal or polyclonal antibody which recognises, preferably with a binding affinity of at least 10-7M, a protein of any one of claims 1 to 6.

8. A water-soluble protein being capable of binding a ligand of a ligand-gated receptor comprising (a) at least the amino acids of the water-soluble protein of any one of claims 1 to 6 determining solubility of said protein, in the same or corresponding positions as in said protein; and (b) at least 4 amino acids determining binding to said ligand.

9. The protein of claim 7 or 8 which is capable of forming multimers.

10. The protein of any one of claims 7 to 9 comprising 200-240 amino acids.

11. The protein of any one of claims 7 to 10, wherein the ligand is acetylcholine, nicotine, lophotoxin, d-tubocurarine, carbamylcholine, galanthamine or epibatidine.

12. The protein of any one of claims 1 to 11 , wherein said ligand-gated receptor is derived from an arthropod (preferably insect), a plant (preferably a higher plant, most preferably a seed plant) or a chordate (preferably a mammalian, most preferably human).

13. The protein of any one of claims 7 to 12, wherein said ligand-gated receptor is a nicotinic acetylcholine receptor.

14. The protein of any one of claims 7 to 13, wherein said amino acids determining solubility are in the same positions as in the AChBP having the amino acid sequence as depicted in any one of SEQ ID Nos. 2, 4, 6 or 8;
preferably in which said solubility-determining amino acids comprise solvent accessible regions in the crystal structure according to Figure 10.

15. The protein of any one of claims 7 to 14 comprising an amino acid sequence having at least 40% amino acid identity to the amino acid sequence 20-223 of any one of SEQ ID Nos. 2, 4, 6 or 8, in which the ligand binding amino acids have been replaced with the corresponding amino acids of a ligand-gated receptor.

16. The protein of any one of claims 7 to 15, in which said solubility-determining amino acids (a) comprise hydrophilic amino acids (Asp, Glu, Arg, Lys) from the sequences 20-44, 73-81, 86-92, 112-120, 135-152, 166-189, 196-20, 209-213, and/or 219-227 of SEQ ID No. 2.

17. The protein of claim 16, in which said solubility determining amino acids (a) comprise amino acids Asp(36), Asp(68), Glu(115), Arg(137), Asp(143), Asp(148), Glu(150), Arg(167), Arg(189), Glu(215) of SEQ ID No.2, wherein Asp may be exchanged for Glu and vice versa and Lys may be exchanged for Arg and vice versa.

18. The protein of any one of claims 7 to 17 which further comprises the amino acids Cys(142), Thr(149), Ala(153), Thr(154), Cys(155), Arg(156), Ile(157) and/or Lys(158) of SEQ ID NO. 2.

19. The protein of any one of claims 7 to 17 which comprises the amino acids (b) Pro(39), Trp(77), Trp(101), Pro(103), Asp(194), and/or Ser(161) of SEQ ID
No. 2.

20. The protein of any one of claims 7 to 19 in which the amino acid sequences 165-169 and/or 200-203 of SEQ ID No. 2 have been exchanged with the corresponding sequence of the ligand-gated receptor.

21. The protein of any one of claims 7 to 20 which is capable of binding a ligand of an acetylcholine receptor, in which at least one of the amino acid sequences Trp(101) - Tyr(T08), Trp(162) - His(164) and Tyr(204) - Tyr(211) of SEQ ID No. 2 have been exchanged with the corresponding sequence of the acetylcholine receptor.

22. A method for the production of a water-soluble ligand-gated receptor or a corresponding ligand-binding domain or for improving the water solubility and accessibility to crystallization of such a receptor or domain, said method comprising altering the amino acid sequence of the extracellular domain of a ligand-gated receptor by way of substituting, adding, deleting or modifying at least one amino acid at a position corresponding to an amino acid determining or contributing to the water-solubility of the protein of any one of claims 1 to 21.

23. The method of claim 22, wherein the ligand-gated receptor is defined as in any one of claims 1 to 21.

24. The method of claim 22 or 23, wherein at least one amino acid is altered to the corresponding amino acid of the amino acid sequence depicted in any one of SEQ ID Nos. 2, 4, 6 or 8, or to a an equivalent amino acid, preferably in which said solubility-determining amino acids comprise solvent accessible regions in the crystal structure according to Figure 10.

25. The method of any one of claims 22 to 24, wherein loop cyst123-cyst136 of SEQ ID No. 2 is inserted into the corresponding region of the ligand binding domain of the ligand-gated receptor.

26. The method of any one of claims 22 to 25 further comprising (a) culturing a host cell transfected with and capable of expressing a polynucleotide comprising a nucleotide sequence encoding the altered amino acid sequence; and optionally (b) recovering said water-soluble ligand-gated receptor or corresponding ligand-binding domain from the culture.

27. A water-soluble ligand-gated receptor or ligand-binding domain obtainable by the method of any one of claims 22 to 26.

28. The protein of any one of claims 1 to 21 or 27 further comprising a spacer sequence allowing coupling with a carrier body.

29. A fusion protein comprising the water-soluble ligand-binding protein of any one of claims 1 to 21, 27 or 28, or a binding fragment thereof and a fragment of a ligand-gated receptor

30. A dimer or pentamer consisting of at least one monomer comprising a protein of any one of claims 1 to 21 or 27 to 29.

31. A ligand-gated ion channel comprising a protein of any one of claims 1 to or 27 to 29 or the dimer or pentamer of claim 30.

32. One or more polynucleotides encoding the protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31.

33. The polynucleotide(s) of claim 32 which comprise(s) (a) a nucleotide sequence having at least 15 continuous nucleotides of the nucleotide sequence depicted in any one of SEQ ID Nos. 1, 3, 5 or 7 or a degenerated sequence thereof; or (b) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (a) under stringent hybridisation conditions.

34. The polynucleotide(s) of claim 32 or 33 which is(are) operatively linked to heterologous expression control sequences allowing expression inprokaryotic or eukaryotic cells.

35. One or more vector(s) containing the polynucleotide(s) of any one of claims 32 to 34.

36. A host cell genetically engineered with the polynucleotide(s) of any one claims 32 to 34 or with the vector(s) of claim 35.

37. An antigen comprising an epitope of at least 5 continuous amino acids of the amino acid sequence depicted in any one of SEQ ID Nos. 2, 4, 6 or 8 and/or said epitope is detectable by a monoclonal or polyclonal antibody which recognises, preferably with a binding affinity of at least 10-7M, a protein of any one of claims 1 to 6.

38. An antibody specifically recognizing the protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30, the ligand-gated ion channel of claim 31 or the antigen of claim 37.

39. An oligonucleotide probe comprising a nucleotide sequence having at least continuous nucleotides of a polynucleotide of any one claims 32 to 34 or encoding the antigen of claim 37.

40. A composition comprising the protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30, the ligand-gated ion channel of claim 31, the polynucleotide(s) of any one claims 32 to 34, the vector(s) of claim 35, the host cell of claim 36, the antigen of claim 37, the antibody of claim 38, or an oligonucleotide probe of claim 39; and optionally suitable means for detection or performing a ligand-receptor binding assay.

41. A method for identifying an agonist/activator or antagonist/inhibitor of a ligand gated receptor comprising the steps of:
(a) contacting the water-soluble ligand-binding protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30, the ligand-gated ion channel of claim 31 or a cell expressing said protein in the presence of components capable of providing a detectable signal in response to ligand binding with a compound to be screened under conditions that permit binding of said compound to the ligand-binding protein; and (b) detecting the presence or absence of a signal generated from the binding activity of the ligand-binding protein, wherein the presence/increase and absence/decrease of the signal is indicative for an agonist/activator and antagonist/inhibitor, respectively, of a ligand-gated receptor.

42. A crystal of a protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31.

43. A crystal of a protein-ligand complex comprising a protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31; and a ligand.

44. The crystal of claim 43, wherein the ligand comprises an N-alkylated hydroxyalkyl and/or a quaternary ammonium ion.

45. The crystal of claim 43, wherein the ligand comprises 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), B-bippinatin, lophotoxin, d-tubocurarine, carbamylcholine, galanthamine, epibatidine or alpha-bungarotoxin.

46. The crystal of any one of claims 42 to 45, wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein or protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms.

47. The crystal of any one claims 42 to 46, wherein the protein has an amino acid sequence of amino acids 20 to 223 of SEQ ID No. 2, or an amino acid sequence that differs from amino acid 20 to 223 of SEQ ID No. 2 by only having conservative substitutions.

48. The crystal of claim 47, wherein the ligand is HEPES.

49. The crystal of claim 46 having (1) a space group of P212121 and a unit cell of dimensions of a=120..ANG., b=137ØANG. and c=161.5.ANG. (2) a space group of P42212 and a unit cell of dimensions of a=b=141.6.ANG. and c=120.8.ANG.
or (3) a space group of P21 and a unit cell of dimensions of a=121.1.ANG. b=162.1.ANG., c=139.4.ANG., .delta.=90.1 °.

50. The crystal of any one of claims 42 to 49, wherein the protein has secondary structural elements that include .alpha.-helix and antiparallel .beta.-sheets as shown in Figure 7, 10, 11 and/or 12.

51. The crystal of any one claims 42 to 50 having a three-dimensional structure as defined by atomic coordinates shown in Table 1.

52. The crystal of any one of claims 42 to 51 having a binding cavity as shown in Figure 6, 8, 9 and/or 13.

53. A method of using the crystal of any one of claims 42 to 52 in a drug screening assay comprising:
(a) selecting a potential ligand by performing structure assisted drug design with the three-dimensional structure determined for the crystal, wherein said selecting is performed in conjunction with computer modeling; optionally (b) contacting the potential ligand with the ligand binding domain of the ligand-gated receptor in an in vitro or in vivo assay; and (c) detecting the binding of the potential ligand for the ligand binding domain.

54. The method of claim 53, wherein the ligand-gated receptor is a nicotinic acetylcholine receptor.

55. The method of claim 53 or 54 further comprising:

(d) forming a supplemental crystal of a protein-ligand complex by co-crystallization or soaking the crystal of the water-soluble ligand-binding protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31, with a potential drug, wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms, more preferably greater than 3;

(e) determining the three-dimensional structure of the supplemental crystal;
(f) selecting a candidate drug by performing a structure assisted drug design with the three-dimensional structure determined for the supplemental crystal, wherein said selecting is performed in conjunction with computer modeling; optionally (g) contacting the candidate drug with a cell that expresses the ligand-gated receptor; and (h) detecting a cell response; wherein a candidate drug is identified as a drug when the cell response is altered compared to a cell that has not been contacted with the candidate compound.

56. The method of any one of claims 53 to 55 further comprising an initial step that precedes step (a) wherein said initial step consists of determining the three-dimensional structure of a crystal comprising a protein-ligand complex formed between the water-soluble ligand-binding protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31, and the ligand of the ligand-gated receptor, wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms.

57. A method of growing a crystal of a protein-ligand complex comprising:
(a) contacting the water-soluble ligand-binding protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31 with a ligand of a ligand-gated receptor, wherein the water-soluble ligand-binding protein forms a protein-ligand complex with the ligand; and (b) growing the crystal of the protein-ligand complex; wherein the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of greater than 5.0, preferably greater than 4.0 Angstroms.

58. A drug screening assay comprising soaking the crystal of any one of claims 42 to 52 in a solution of compounds to be screened and detecting the binding of the compound to the ligand-binding protein.

59. The method of claim 57 or 58, wherein said ligand comprises an alkylated nitrogen and/or quaternary ammonium ion.

60. A method of increasing or decreasing the affinity of a drug to a ligand-gated receptor, comprising (a) performing structure assisted drug design with the three-dimensional structure determined for the crystal of any one of claims 42 to 52, wherein said drug design is performed in conjunction with computer modeling; and (b) modifying said drug to alter or eliminate a portion thereof suspected of interacting with a binding site of the binding cavity or with a non-specific binding site of the protein in the crystal.

61. The method of claim 60, wherein step (a) further comprises the steps of a method of any one of claims 53 to 59.

62. The method of claim 60 or 61, further comprising after step (b), the additional step of:
(c) repeating the method used to perform structure assisted drug design according to step (a) using the modified drug according to step (b).

63. A method of drug design comprising the step of using the structural coordinates of a water-soluble ligand-binding protein crystal comprising the coordinates of Table 1, to computationally evaluate a chemical entity for associating with the ligand-binding site or a non-specific binding site of a ligand-binding protein.

64. The method of any one of claims 53 to 63, wherein the identified drug prevents or promotes correct assembly of a ligand-gated ion channel.

65. The method of any one of claims 53 to 63, wherein the identified drug binds to a non-specific binding site of a ligand-gated ion channel.

66. The method of any one of claims 53 to 65 further comprising synthesizing the drug in a therapeutically effective amount.

67. A drug produced by the method of claim 66 or a pro-drug thereof.

68. The drug of claim 67 which interacts with a ligand-gated receptor comprising a pentamer of claim 30 with monomers A to E, wherein the drug binds to one or more primary contact regions of a monomer (residues from A contacting B) defined by amino acid residues 15 to 21, 44 to 47, 85 to 87, 91 to 94, 122 to 124, 143 to 146, 149, 185 to 187 of the mature protein of SEQ ID No. 2 and/or to one or more of the complementary contact regions of the other monomer (from B contacting A, (identical to residues on A contacting E) defined by amino acid residues 3 to 4, 7 to 8, 11, 37 to 39, 53, 75 to 77, 96 to 104, 114 to 11.beta. and 163-170 of the mature protein of SEQ ID No. 2; or to the contact regions as identified in Figure 14; or to the corresponding contact regions of the monomers of a ligand-gated ion channel.

69. The drug of claim 68, wherein the ligand-gated ion channel is the nicotinic acetylcholine receptor and the order of the monomers is .alpha..gamma..alpha..beta..delta..

70. A computer readable medium comprising a nucleotide sequence of the polynucleotide(s) of any one of claims 32 to 34, an amino acid sequence of a protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30 or the ligand-gated ion channel of claim 31, or the structural coordinates of a crystal of any one of claims 40 to 50.

71. A device comprising the computer readable medium of claim 70.

72. Use of the computer readable medium of claim 70 or the device of claim 71 for modeling an antagonist/inhibitor or agonist/activator of a ligand-gated receptor.

73. Use of the crystal of any one of claims 42 to 52 or its structural coordinates as a template for modeling the 3D structure of a ligand-gated ion channel.

74. Use of the polynucleotide(s) of any one of claims 32 to 34, the protein of any one of claims 1 to 21 or 27 to 29, the dimer or pentamer of claim 30, the ligand-gated ion channel of claim 31, the vectors) of claim 35, the host cell of claim 36, the antigen of claim 37, the antibody of claim 38, an oligonucleotide probe of claim 39, the crystal of any one of claims 42 to 52 or a method of any one of claims 53 to 66 for screening or profiling putative ligands of ligand-gated receptors.

75. Use of an antagonist/inhibitor or agonist/activator identified according to a method of any one of claims 53 to 66 for the preparation of a pharmaceutical composition for the treatment of a ligand-gated ion channel mediated or related disorder.

76. The use of claim 75, wherein the antagonist/inhibitor is or is derived from the protein of any one of claims 1 to 21 or 27 to 29, an antigen of claim 37, an antibody of claim 38 or from a toxin of the ligand-gated ion channel.

77. The use of claim 75, wherein the agonist/activator is or is derived from a the protein of any one of claims 1 to 21 or 27 to 29, an antigen of claim 37, an antibody of claim 38 or from epibatidine, acetylcholine, choline, nicotine, carbachol, serotonin or GABA.

78. The use of any one claims 75 to 77, wherein the ligand-gated ion channel is the nicotinic acetylcholine receptor and said mediated or related disorder is Tourette's syndrome, Alzheimer's disease, addiction to nicotine or schizophrenia.

79. Use of ligand of a ligand-gated receptor for identifying and isolating a water-soluble ligand-binding protein from a mollusc.

80. The use of claim 79, wherein said ligand is .alpha.-bungarotoxin.