CA2331253A1

CA2331253A1 - Immunomodulator polypeptide, zsig57

Info

Publication number: CA2331253A1
Application number: CA002331253A
Authority: CA
Inventors: Paul O. Sheppard
Original assignee: Zymogenetics, Inc.; Paul O. Sheppard
Current assignee: Zymogenetics Inc
Priority date: 1998-06-18
Filing date: 1999-05-20
Publication date: 1999-12-23
Also published as: WO1999066040A1; JP2002518009A; EP1088068A1; AU4197499A; IL140120A0

Abstract

The present invention relates to polynucleotide and polypeptide molecules for zsig57, a novel member of the immunoglobulin superfamily of proteins. The polynucleotides encoding zsig57, are located on chromosome 6, and may, for example, be used to identify a region of the genome associated with human disease states. The present invention also includes methods for producing the protein, uses therefor and antibodies thereto.

Description

Description IMMUNOMODULATOR POLYPEPTIDE, ZSIG57 BACKGROUND OF THE INVENTION
Proliferation and differentiation of cells of multicellular organisms are controlled by hormones and polypeptide growth factors. These secreted molecules allow cells to communicate with each other; act in concert to regulate cell proliferation and organ development; and regulate repair and regeneration of damaged tissue.
Hormones and growth factors influence cellular metabolism by binding to receptors. Receptors may be integral membrane proteins that are linked to signaling pathways within the cell, such as second messenger systems. Other classes of receptors are soluble molecules, such as transcription factors.
The immunoglobulin superfamily is composed of many cell surface and other glycoproteins that share sequence homology with variable (V) and/or constant (C) domains of antibody heavy and light chains. This diverse family of proteins is involved in regulating immune system interactions with other cells through molecules such as major histocampatability complex (MHC) proteins;
lymphocyte adhesion molecules such as ICAM-1; and Fc receptors, T-cell CD8, CD28, and the like (Jackson, D.G., et al., Eur. J. Immunol., 22:1157-1163, 1992). One such interaction involves the mucosal immune system, mediated by the secretory immunoglobulins IgA and IgM. These secreted antibodies are transcytosed from the basolateral side to the apical side (e.g., intestinal lumen) of the mucosal epithelium via the polymeric immunoglobulin

2 receptor (pIgR), a member of the immunoglobulin superfamily (Loman, S., et al., Am. Physiol. Soc. :L951-L958, 1997). When IgA is transcytosed, pIgR is cleaved and the extracellular portion, called the secretory component (SC), of the molecule is released either free or bound to IgA. The SC binds IgA and appears to play an important role in protecting the secreted IgA from degradation. Moreover, aside from a role for SC in the humoral immune response, it appears to have other activities associated with inflammation, cell adhesion, and the like. See, Rindisbacher, L., et al., J. Biol.
Chem., 23:14220-14228, 1995; Nihei, Y., et al., Arch.
Dermatol. Res., 287:546-552; 1995; Brandtzaeg, P. and Krajci, P., "Secretory Component (pIgR)" In: Encyclo edia of Immunology, Ivan M. Roitt and Peter J. Delves (eds.), pp. 1360-1364. Academic Press, London, 1992; Hughes, G.J., et al., FEBS Lett., 410:443-446, 1997; Bakos, M., et al., Molec. Immunol., 31:165-168, 1993). However, the biological role of SC is not fully elucidated.
There is a continuing need to discover new immune modulators, hormones, cytokines, growth factors and the like. The in vivo activities of known immune modulators, and immunoglobulin superfamily members, such as pIgR and SC, illustrate the enormous clinical potential of, and need for, related polypeptides, their agonists, and antagonists.
The present invention provides such polypeptides for these and other uses that should be apparent to those skilled in the art from the teachings herein.
SUMMARY OF THE INVENTION
Within one aspect, the present invention provides an isolated polynucleotide encoding a zsig57 polypeptide comprising a sequence of amino acid residues

3 that is~at least 90$ identical to an amino acid sequence selected from the group consisting of: (a) the amino acid sequence as shown in SEQ ID NO: 2 from residue number 18 (Ile), to residue number 108 (Gly); (b) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro); (c) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln); (d) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met) to amino acid number 199 (Gly), wherein the amino acid percent identity is determined using a FASTA
program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62, with other parameters set as default. Within one embodiment, the isolated polynucleotide disclosed above is selected from the group consisting of: (a) a polynucleotide sequence as shown in SEQ ID N0:1 from nucleotide 115 to nucleotide 387; (b) a polynucleotide sequence as shown in SEQ ID
N0:1 from nucleotide 115 to nucleotide 438; (c) a polynucleotide sequence as shown in SEQ ID N0:1 from nucleotide 115 to nucleotide 531; (d) a polynucleotide sequence as shown in SEQ ID N0:1 from nucleotide 115 to nucleotide 660; and (e) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 64 to nucleotide 660.
Within another embodiment, the isolated polynucleotide disclosed above comprises nucleotide 1 to nucleotide 597 of SEQ ID N0:3. Within another embodiment, the isolated polynucleotide disclosed above consists of a sequence of amino acid residues an amino acid sequence selected from the group consisting of: (a) the amino acid sequence as shown in SEQ ID NO: 2 from residue number 18 (Ile), to residue number 108 (Gly); (b) the amino acid sequence as WO 99/66040 PCT/iJS99/11337

4 shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro); (c) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 {Ile) to amino acid number 156 (Gln); (d) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met) to amino acid number 199 (Gly). Within another embodiment, the isolated polynucleotide disclosed above consists of a sequence of amino acid residues as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 {Gln).
Within a second aspect, the present invention provides an expression vector comprising the following operably linked elements: a transcription promoter; a DNA
segment encoding a zsig57 polypeptide with an amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln); and a transcription terminator. Within one embodiment, the expression vector as disclosed above, further comprises a secretory signal sequence operably linked to the DNA segment.
Within a third aspect, the present invention provides a cultured cell into which has been introduced an expression vector as disclosed above, wherein the cell expresses a polypeptide encoded by the DNA segment.
Within a fourth aspect, the present invention provides a DNA construct encoding a fusion protein, the DNA construct comprising: a first DNA segment encoding a polypeptide that is selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO: 2 from residue number 1 (Met) , to residue number 17 (Gly) ; (b) the amino acid sequence of SEQ ID NO: 2 from residue number 18 {Ile), to residue number 108 (Gly); (c) the amino acid sequence of SEQ ID N0: 2 from residue number 18 (Ile), to residue.number 124 (Pro); (d) the amino acid sequence of SEQ ID NO: 2 from residue number 18 (Ile), to residue number 156 (Gly); (e) the amino acid sequence of SEQ ID
N0: 2 from residue number 186 (Lys), to residue number 199

5 (Gln); (f) the amino acid sequence of SEQ ID N0: 2 from residue number 18 (Ile), to residue number 199 (Gln); and at least one other DNA segment encoding an additional polypeptide, wherein the first and other DNA segments are connected in-frame; and encode the fusion protein.
Within another aspect, the present invention provides a fusion protein produced by a method comprising:
culturing a host cell into which has been introduced a vector comprising the following operably linked elements:
(a) a transcriptional promoter; (b) a DNA construct encoding a fusion protein as disclosed above; and (c) a transcriptional terminator; and recovering the protein encoded by the DNA segment.
Within another aspect, the present invention provides an isolated polypeptide comprising a sequence of amino acid residues that is at least 90o identical to an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence as shown in SEQ ID NO: 2 from residue number 18 (Ile), to residue number 108 (Gly); (b) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro); (c) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln); (d) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met) to amino acid number 199 (Gly), wherein the amino acid percent identity is determined using a FASTA program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62,

6 with other parameters set as default. Within one embodiment the isolated polypeptide disclosed above consists of a sequence of amino acid residues selected from the group consisting of: (a) the amino acid sequence as shown in SEQ ID NO: 2 from residue number 18 (Ile), to residue number 108 (Gly); (b) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro); (c) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln); (d) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met) to amino acid number 199 (Gly). Within another embodiment the isolated polypeptide disclosed above is as shown in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln).
Within another aspect, the present invention provides a method of producing a zsig57 polypeptide comprising: culturing a cell as disclosed above; and isolating the zsig57 polypeptide produced by the cell.
Within another aspect, the present invention provides a method of producing an antibody to zsig57 polypeptide comprising: inoculating an animal with a polypeptide selected from the group consisting of: (a) a polypeptide consisting of 9 to 199 amino acids, wherein the polypeptide is a contiguous sequence of amino acids in SEQ ID N0:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln); (b) a polypeptide according to claim 11;
(c) a polypeptide having an amino acid sequence from residue number 1$6 (Lys), to residue number 199 (Gln) of SEQ ID N0:2; (d) a polypeptide having an amino acid sequence from residue number 18 (Ile), to residue number 108 (Gly) of SEQ ID N0:2; (e) a polypeptide having an

7 amino acid sequence from residue number 96 (Glu) to residue number 101 {Glu) of SEQ ID N0:2; (f) a polypeptide having an amino acid sequence from residue number 129 (Pro) to residue number 129 (Glu) of SEQ ID N0:2; (g) a polypeptide having an amino acid sequence from residue number 125 (Pro) to residue number 130 (Glu) of SEQ ID
N0:2; (h) a polypeptide having an amino acid sequence from residue number 185 (Arg) to residue number 190 (Glu) of SEQ ID N0:2; and (i) a polypeptide having an amino acid sequence from residue number 186 (Lys) to residue number 191 (Ser) of SEQ ID N0:2; and wherein the polypeptide elicits an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
Within another aspect, the present invention provides an antibody produced by the method disclosed above, which binds to a zsig57 polypeptide. Within one embodiment the antibody disclosed above is a monoclonal antibody. Within another aspect, the present invention provides an antibody which specifically binds to a polypeptide disclosed above. Within another embodiment the antibody disclosed above is coupled to a plasmid containing a cDNA encoding a functional polypeptide.
Within another embodiment the antibody disclosed above is coupled to a chemical agent.
These and other aspects of the invention will become evident upon reference to the following detailed description of the invention and attached drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 illustrates an alignment of zsig57 (ZSIG57) (SEQ ID N0:2), human CMRF35 protein (CM35 H) (SEQ
ID N0:29), and human pIgR (PIGR-H) (SEQ ID N0:30).
Figure 2 is a hydrophobicity plot of zsig57 determined from a Hopp/Woods hydrophilicity profile based

8 on a sliding six-residue window, with buried G, S, and T
residues and exposed H, Y, and W residues ignored.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail, it may be helpful to the understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag.
Affinity tags include a poly-histidine tract, protein A
(Nilsson et al., EMBO J. 9:1075, 1985; Nilsson et al., Methods Enzymol. 198:3, 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA
82:7952-4, 1985), substance P, FlagTM peptide (Hopp et al., Biotechnology 6:1204-10, 1988), streptavidin binding peptide, or other antigenic epitope or binding domain.
See, in general, Ford et al., Protein Expression and Purification 2: 95-107, 1991. DNAs encoding affinity tags are available from commercial suppliers (e. g., Pharmacia Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to denote any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequence. The term allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
The terms "amino-terminal" and "carboxyl terminal" are used herein to denote positions within polypeptides. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity or relative position.
For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.
The term "complement/anti-complement pair"
denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions. For instance, biotin and avidin (or streptavidin) are prototypical members of a complement/anti-complement pair.
Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like. Where subsequent dissociation of the complement/anti-complement pair is desirable, the complement/anti-complement pair preferably has a binding affinity of <109 M-1.
The term "complements of a polynucleotide molecule" denotes a polynucleotide molecule having a complementary base sequence and reverse orientation as compared to a reference sequence. For example, the sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a polynucleotide that has a contiguous stretch of identical or complementary sequence to another polynucleotide. Contiguous sequences are said to "overlap" a given stretch of polynucleotide sequence either in their entirety or along a partial stretch of the polynucleotide. For example, representative contigs to the polynucleotide sequence 5'-ATGGAGCTT-3' axe 5'-AGCTTgagt-3' and 3'-tcgacTACC-5'.
5 The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of 10 nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
A "DNA construct" is a single or double stranded, linear or circular DNA molecule that comprises segments of DNA combined and juxtaposed in a manner not found in nature. DNA constructs exist as a result of human manipulation, and include clones and other copies of manipulated molecules.
A "DNA segment" is a portion of a larger DNA
molecule having specified attributes. For example, a DNA
segment encoding a specified polypeptide is a portion of a longer DNA molecule, such as a plasmid or plasmid fragment, that, when read from the 5' to the 3' direction, encodes the sequence of amino acids of the specified polypeptide.
The term "expression vector" is used to denote a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription.
Such additional segments include promoter and terminator sequences, and may also include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, etc. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.

The term "isolated", when applied to a polynucleotide, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones. Isolated DNA
molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is found in a condition other than its native environment, such as apart from blood and animal tissue. In a preferred form, the isolated polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin. It is preferred to provide the polypeptides in a highly purified form, i.e. greater than 95~ pure, more preferably greater than 99~ pure. When used in this context, the term "isolated" does not exclude the presence of the same polypeptide in alternative physical forms, such as dimers or alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained from one species that is the functional WO 99/bb040 PCT/US99/11337 counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an organism. Paralogs are believed to arise through gene duplication. For example, a-globin, (3 globin, and myoglobin are paralogs of each other.
A "polynucleotide" is a single- or double stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt"), or kilobases ("kb"). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded. When the term is applied to double-stranded molecules it is used to denote overall length and will be understood to be equivalent to the term "base pairs". It will be recognized by those skilled in the art that the two strands of a double-stranded polynucleotide may differ slightly in length and that the ends thereof may be staggered as a result of enzymatic cleavage; thus all nucleotides within a double-stranded polynucleotide molecule may not be paired.
A "polypeptide" is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as "peptides".
The term "promoter" is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of WO 99/6b040 PCT/US99/11337 RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may also comprise non peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-peptide structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. Binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecules) in the cell. This interaction in turn leads to an alteration in the metabolism of the cell. Metabolic events that are linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids. In general, receptors can be membrane bound, cytosolic or nuclear; monomeric (e. g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e. g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.
The term "splice variant" is used herein to denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by imprecise analytical methods (e.g., gel electrophoresis) will be understood to be approximate values. When such a value is expressed as "about" X or "approximately" X, the stated value of X will be understood to be accurate to ~10$.
All references cited herein are incorporated by reference in their entirety.
The present invention is based in part upon the discovery of a novel DNA sequence that encodes a polypeptide having homology to human CMRF35 and to the poly-Ig receptor secretory component. Analysis of the tissue distribution of the mRNA corresponding to this novel DNA showed that expression was highest in small intestine, bone marrow and peripheral blood leukocytes (PBLs), followed by apparent but decreased expression levels in liver and kidney. The polypeptide has been 5 designated zsig57.
The novel zsig57 polypeptides of the present invention were initially identified by querying an EST
database for proteins homologous to proteins having a secretory signal sequence. These proteins are 10 characterized by an upstream methionine start site and a hydrophobic region of approximately 13 amino acids, followed by a peptide signal peptidase cleavage site. An EST database was queried for novel DNA sequences whose translations would meet these search criteria. An EST was 15 found and its corresponding cDNA was sequenced. The novel polypeptide encoded by the cDNA, when fully sequenced, showed a Ig-variable domain sequence and homology with the human CMRF35 and the human pIgR secretory component (Jackson, et al., supra; Krajci, P., et al., Hum. Genet.
87:642-698, 1991). The zsig57 nucleotide sequence is believed to encode the entire coding sequence of the predicted protein. Zsig57 may be a new transcytosis receptor, immunomodulator, or the like, and is a novel member of the immunoglobulin superfamily of proteins.
The sequence of the zsig57 polypeptide was obtained from a single clone believed to contain its corresponding polynucleotide sequence. The clone was obtained from a white blood cell (WBC) library. Other libraries that might also be searched for such sequences include small intestine, bone marrow, PBLs, and the like.
The nucleotide sequence of a representative zsig57-encoding DNA is described in SEQ ID N0:1, and its deduced 199 amino acid sequence is described in SEQ ID
N0:2. In its entirety, zsig57 polypeptide (SEQ ID N0:2) represents a full-length polypeptide segment (residue 1 (Met) to residue 199 (Gln) of SEQ ID N0:2). Zsig57 contains a signal sequence, single Ig-variable domain, a transmembrane domain, and a short cytoplasmic tail. These domains positioned throughout zsig57 polypeptide correspond to the homologous regions of CMRF35. These domains and structural features of zsig57 are further described below.
Analysis of the DNA encoding zsig57 polypeptide ZO (SEQ ID NO:l) revealed an open reading frame encoding 199 amino acids (SEQ ID N0:2) comprising a predicted signal peptide of 15 to 17 amino acid residues (residue 1 (Met) to residue 15 (Gly) or 17 (Gly) of SEQ ID N0:2), and a mature polypeptide of 182 to 184 amino acids (residue 18 (Ile) or residue 16 (Gln) to residue 199 (Gln) of SEQ ID
N0:2, depending on where the signal peptide is cleaved).
Zsig57 contains the following 4 regions of conserved amino acids (see Figure):
1) The first region, referred to hereinafter as the "Ig-variable domain" corresponds to amino acid residues 18 (Ile) to amino acid residue 108 (Gly) of SEQ
ID N0:2.
2) The second region, referred to hereinafter as "acidic cleavage site(s)," corresponds to amino acid residues 126 (Glu) to amino acid residue 130 (Glu) of SEQ
ID N0:2, with potential cleavage at residue 126 (Glu); and the di-acid Asp-Glu at residues 157 (Asp) and 158 (Glu) of SEQ ID N0:2, with potential cleavage at residue 157 (Asp).
These acidic cleavage sites suggest that the portion of zsig57 containing the Ig-variable domain is secreted.
3) The third region, referred to hereinafter as the "transmembrane domain" corresponds to amino acid residues 161 (Ile) to amino acid residue 185 (Ala) of SEQ
ID N0:2.

4) The fourth region, referred to hereinafter as the "cytoplasmic stub" corresponds to amino acid residues 186 (Lys) to amino acid residue 199 (Gln) of SEQ
ID N0:2.
In addition, within the Ig-Variable domain, zsig57 contains conserved cysteines located at residues 38, 52, 59 and 104. Disulfide bonds are predicted between cysteine residues 52 and 59 and between residues 38 and 104. These cysteines likely maintain a structurally important fold in the Ig-variable domain, and are conserved throughout the protein family.
The corresponding polynucleotides encoding the zsig57 polypeptide regions, domains, motifs, residues and sequences described above are as shown in SEQ ID NO:1.
The presence of conserved motifs generally correlates with or defines important structural regions in proteins. The regions between such motifs may be more variable, but are often functionally significant because they can relate to or define important structures and activities such as binding domains, biological and enzymatic activity, signal transduction, tissue localization domains and the like.
As described above, the novel zsig57 polypeptide encoded by the polynucleotide described herein contains an Ig-variable domain. The structural topology of Ig variable domains are conserved in the immunoglobulin superfamily of proteins. This domain may be involved in binding another immunoglobulin superfamily protein family member, and confer an essential function in transcytosis in tissues where it is expressed, such as the small intestine; similarly, the Ig-variable domain can also associate or bind with polypeptides or peptides involved in antigen presentation, or confer an immunomodulator activity in PBLs or bone marrow. Additionally, zsig57 polypeptide could be involved in binding other immune effector protein destined for translocation, for instance in bone marrow or small intestine.
The highly conserved amino acids in the Ig variable domain, transmembrane domain, or other regions of zsig57 can be used as a tool to identify new family members. For instance, reverse transcription-polymerase chain reaction (RT-PCR) can be used to amplify sequences encoding the conserved regions from RNA obtained from a variety of tissue sources or cell lines. In particular, highly degenerate primers designed from the zsig57 sequences are useful for this purpose. Designing and using such degenerate primers is readily performed by one of skill in the art.
The present invention also provides polynucleotide molecules, including DNA and RNA molecules, that encode the zsig57 polypeptides disclosed herein.
Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules. SEQ ID N0:3 is a degenerate DNA sequence that encompasses all DNAs that encode the zsig57 polypeptide of SEQ ID N0:2. Those skilled in the art will recognize that the degenerate sequence of SEQ ID N0:3 also provides all RNA sequences encoding SEQ ID N0:2 by substituting U for T. Thus, zsig57 polypeptide-encoding polynucleotides comprising nucleotide 1 to nucleotide 597 of SEQ ID N0:3 and their RNA equivalents are contemplated by the present invention. Table 1 sets forth the one-letter codes used within SEQ ID N0:3 to denote degenerate nucleotide positions. "Resolutions" are the nucleotides denoted by a code letter. "Complement" indicates the code for the complementary nucleotide(s). For example, the code Y

denotes.either C or T, and its complement R denotes A or G, A being complementary to T, and G being complementary to C.

TABLE 1.
Nucleoti Resolutio Compleme Resolutio de n nt n A A T T

C C G G

G G C C

T T A A

R AIG Y CIT

Y CIT R AIG

M ABC K GIT

K GIT M AIC

S CIG S CIG

W AIT W AIT

H AICIT D AIGIT

B CIGIT V AICIG

V A~CIG B CIGIT

D A~GIT H AICIT

N AICIGIT N AICIGIT

The degenerate codons used in SEQ ID N0:3, 5 encompassing all possible codons for a given amino acid, are set forth in Table 2.

TABLE 2.
One Amino Letter Codons Degenerate Acid Code Codon Cys C TGC TGT TGY

Ser S AGC AGT TCA TCC TCG TCT WSN

Thr T ACA ACC ACG ACT ACN

Pro P CCA CCC CCG CCT- CCN

Ala A GCA GCC GCG GCT GCN

Gly G GGA GGC GGG GGT GGN

Asn N AAC AAT ~y Asp D GAC GAT GAY

Glu E GAA GAG GAR

Gln Q CAA CAG CAR

His H CAC CAT CAY

Arg R AGA AGG CGA CGC CGG CGT MGN

Lys K AAA AAG AAR

Met M ATG ATG

Ile I ATA ATC ATT ATH

Leu L CTA CTC CTG CTT TTA TTG YTN

Val V GTA GTC GTG GTT GTN

Phe F TTC TTT TTY

Tyr Y TAC TAT TAY

Trp W TGG TGG

Ter . TAA TAG TGA TRR

Asn ~ B ~y Asp Gly Gln Z SAR

Any X NNN

One of ordinary skill in the art will appreciate that some ambiguity is introduced in determining a degenerate codon, representative of all possible codons encoding each amino acid. For example, the degenerate codon for serine (WSN) can, in some circumstances, encode arginine (AGR), and the degenerate codon for arginine (MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding phenylalanine and leucine. Thus, some polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequence of SEQ ID N0:2. Variant sequences can be readily tested for functionality as described herein.
One of ordinary skill in the art will also appreciate that different species can exhibit "preferential codon usage." In general, see, Grantham, et al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr.
Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene _13:355-69, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc. Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol.
158:573-97, 1982. As used herein, the term "preferential codon usage" or "preferential codons" is a term of art referring to protein translation codons that are most frequently used in cells of a certain species, thus favoring one or a few representatives of the possible codons encoding each amino acid (See Table 2). For example, the amino acid Threonine (Thr) may be encoded by ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly used codon; in other species, for example, insect cells, yeast, viruses or bacteria, different Thr codons may be preferential. Preferential codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferential codon sequences into recombinant DNA can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species. Therefore, the degenerate codon sequence disclosed in SEQ ID N0:3 serves as a template for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferential codons can be tested and optimized for expression in various species, and tested for functionality as disclosed herein.
Within preferred embodiments of the invention the isolated polynucleotides will hybridize to similar sized regions of SEQ ID N0:1, or a sequence complementary thereto, under stringent conditions. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50~ of the target sequence hybridizes to a perfectly matched probe. Numerous equations for calculating Tm are known in the art, and are specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current Protocols in Molecular Biology (John Wiley and Svns, Inc.
1987); Berger and Kimmel (eds.), Guide to Molecular Cloning Techniques, (Academic Press, Inc. 1987); and Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227 (1990)).
Sequence analysis software such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 9.0 (Premier Biosoft International; Palo Alto, CA), as well as sites on the Internet, are available tools for analyzing a given sequence and calculating Tm based on user defined criteria.
Such programs can also analyze a given sequence under defined conditions and identify suitable probe sequences.
Typically, hybridization of longer polynucleotide sequences, >50 base pairs, is performed at temperatures of about 20-25°C below the calculated Tm. For smaller probes, <50 base pairs, hybridization is typically carried out at the Tm or 5-10°C below. This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA hybrids. Higher degrees of stringency at lower temperatures can be achieved with the addition of formamide which reduces the Tm of the hybrid about 1°C for each 1a formamide in the buffer solution. Suitable stringent hybridization conditions are equivalent to about a 5 h to overnight incubation at about 42°C in a solution comprising: about 40-50~ formamide, up to about 6X SSC, about 5X Denhardt's solution, zero up to about 10~ dextran sulfate, and about 10-20 ~g/ml denatured commercially-available carrier DNA.
Generally, such stringent conditions include temperatures of 20-70°C and a hybridization buffer containing up to 6x SSC and 0-50~ formamide; hybridization is then followed by washing filters in up to about 2X SSC. For example, a suitable wash stringency is equivalent to O.1X SSC to 2X
SSC, 0.1~ SDS, at 55°C to 65°C. Different degrees of stringency can be used during hybridization and washing to achieve maximum specific binding to the target sequence.
Typically, the washes following hybridization are performed at increasing degrees of stringency to remove non-hybridized polynucleotide probes from hybridized complexes. Stringent hybridization and wash conditions depend on the length of the probe, reflected in the Tm, hybridization and wash solutions used, and are routinely determined empirically by one of skill in the art.

As previously noted, the isolated polynucleotides of the present invention include DNA and RNA. Methods for preparing DNA and RNA are well known in the art. In general, RNA is isolated from a tissue or 5 cell that produces large amounts of zsig57 RNA. Such tissues and cells are identified by Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and include small intestine, bone marrow, PBLs, and cell lines derived therefrom. Total RNA can be prepared using 10 guanidinium isothiocyanate extraction followed by isolation by centrifugation in a CsCl gradient (Chirgwin et al., Biochemistry 18:52-99, 1979). Poly (A)+ RNA is prepared from total RNA using the method of Aviv and Leder (Proc. Natl. Acad. Sci. USA 69:1408-12, 1972).
15 Complementary DNA (cDNA) is prepared from poly(A)+ RNA
using known methods. In the alternative, genomic DNA can be isolated. Polynucleotides encoding zsig57 polypeptides are then identified and isolated by, for example, hybridization or PCR.
20 A full-length clone encoding zsig57 can be obtained by conventional cloning procedures.
Complementary DNA (cDNA) clones are preferred, although for some applications (e. g., expression in transgenic animals) it may be preferable to use a genomic clone, or 25 to modify a cDNA clone to include at least one genomic intron. Methods for preparing cDNA and genomic clones are well known and within the level of ordinary skill in the art, and include the use of the sequence disclosed herein, or part s thereof, for probing or priming a library.
Expression libraries can be probed with antibodies to zsig57, receptor fragments, or other specific binding partners.
The polynucleotides of the present invention can also be synthesized using DNA synthesis machines.

26 _ . _ _ Currently the method of choice is the phosphoramidite method. If chemically synthesized double stranded DNA is required for an application such as the synthesis of a gene or a gene fragment, then each complementary strand is made separately. The production of short genes (60 to 80 bp) is technically straightforward and can be accomplished by synthesizing the complementary strands and then annealing them. For the production of longer genes (>300 bp), however, special strategies must be invoked, because the coupling efficiency of each cycle during chemical DNA
synthesis is seldom 100. To overcome this problem, synthetic genes (double-stranded) are assembled in modular form from single-stranded fragments that are from 20 to 100 nucleotides in length.
One method for building a synthetic gene requires the initial production of a set of overlapping, complementary oligonucleotides, each of which is between to 60 nucleotides long. The sequences of the strands are planned so that, after annealing, the two end segments 20 of the gene are aligned to give blunt ends. Each internal section of the gene has complementary 3' and 5' terminal extensions that are designed to base pair precisely with an adjacent section. Thus, after the gene is assembled, the only remaining requirement to complete the process is sealing the nicks along the backbones of the two strands with T4 DNA ligase. In addition to the protein coding sequence, synthetic genes can be designed with terminal sequences that facilitate insertion into a restriction endonuclease sites of a cloning vector and other sequences should also be added that contain signals for the proper initiation and termination of transcription and translation.
An alternative way to prepare a full-size gene is to synthesize a specified set of overlapping oligonucleotides (40 to 100 nucleotides). After the 3' and 5' extensions (6 to 10 nucleotides) are annealed, large gaps still remain, but the base-paired regions are both long enough and stable enough to hold the structure together. The duplex is completed and the gaps filled by enzymatic DNA synthesis with E. coli DNA polymerase I.
This enzyme uses the 3'-hydroxyl groups as replication initiation points and the single-stranded regions as templates. After the enzymatic synthesis is completed, the nicks are sealed with T4 DNA ligase. Double-stranded constructs are sequentially linked to one another to form the entire gene sequence and the sequence is verified by DNA sequence analysis. See Glick and Pasternak, Molecular Biotechnology, Principles & Ap lications of Recombinant DNA, (ASM Press, Washington, D.C. 1994); Itakura et al., Annu. Rev. Biochem. 53: 323-56, 1984 and Climie et al., Proc. Natl. Acad. Sci. USA 87:633-7, 1990.
The present invention further provides counterpart polypeptides and polynucleotides from other species (orthologs). These species include, but are not limited to mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species. Of particular interest are zsig57 polypeptides from other mammalian species, including murine, porcine, ovine, bovine, canine, feline, equine, and other primate polypeptides. Orthologs of human zsig57 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses zsig57 as disclosed herein. Suitable sources of mRNA can be identified by probing Northern blots with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line. A

zsig57-encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences. A cDNA can also be cloned using the polymerase chain reaction, or PCR
(Mullis, U.S. Patent No. 4,683,202), using primers designed from the representative human zsig57 polynucleotide sequence disclosed herein. Within an additional method, the cDNA library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to zsig57 polypeptide. Similar techniques can also be applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequence disclosed in SEQ ID N0:1 represents a single allele of human zsig57 and that allelic variation and alternative splicing are expected to occur. Allelic variants of this sequence can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures. Allelic variants of the DNA
sequence shown in SEQ ID NO:1, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are proteins which are allelic variants of SEQ ID N0:2, cDNAs generated from alternatively spliced mRNAs, which retain the properties of the zsig57 polypeptide are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs. Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.
The present invention also provides isolated zsig57 polypeptides that are substantially similar to the WO 99/66040 PCT/US99/1133?

polypept,ides of SEQ ID N0:2 and their orthologs. The term "substantially similar" is used herein to denote polypeptides having 700, preferably 800, more preferably at least 85°s, sequence identity to the sequences shown in SEQ ID N0:2 or their orthologs. Such polypeptides will more preferably be at least 90o identical, and most preferably 950 or more identical to SEQ ID N0:2 or its orthologs.) Percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9, 1992.
Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff (ibid.) as shown in Table 3 (amino acids are indicated by the standard one-letter codes). The percent identity is then calculated as:
Total number of identical matches x 100 [length of the longer sequence plus the number of gaps introduced into the longer sequence in order to align the two sequences]

N M
ri I
H
~1 N N O
I
d' r-I M N N
I I I
r-1 r1 d~ M N
I I I I
~ ~i' N N e-I M rl I 1 I i 'F" L11 O N rl ri r-1 r1 r-i I I I I
'y'' Lfl '-I M rl O r-1 M N N

a d' N N o M N v-I N r-I rl d~ N M ri O M N e-~ M rl M

CO M M rl N rl N r-I N N N M

N d' d' N M M N O N N M M

II1 N O M M r-i N f'~1 rl O r-1 M N N

Lf1 N N O M N ri O M rl O r-I N ~-I N
I 1 I I 1 i I 1 I
U ~ M di M M ~-i rl M ri N M '-1 ri N N r-I
I I I 1 I I I 1 1 I I I 1 i I
La l0 M O N rl '-I M d~ rl M M rl O rl di M M
I I I 1 I a I I 1 1 I 1 1 ~.r l0 r-1 M O O O ri M M O N M N rl O ~i N M

P.' l(1 O N M r-1 O N O M N N '-1 M N rl e-i M N M
1 1 I I a I I I I 1 I I I
~: ~i' v-I N N O ri ,--I O N rl e-1 rl rl N r1 r-1 O M N O

~C x z a a a w ~ x H a x ~ r~i w cn H
M
H
° ~ o ri '"'~ N

Sequence. identity of polynucleotide molecules is determined by similar methods using a ratio as disclosed above.
Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson and Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant zsig57. The FASTA algorithm is described by Pearson and Lipman, Proc.
Nat'1 Acad. Sci. USA 85:2449 (1988), and by Pearson, Meth.
Enzymol. 183:63 (1990).
Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e. g., SEQ ID N0:2) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff" value (calculated by a predetermined formula based upon the length of the sequence and the ktup value}, then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman and Wunsch, J. Mol. Biol. 98:444 (1970); Sellers, SIAM J.

Appl. Math. 26:787 (1974)), which allows for amino acid insertions and deletions. Preferred parameters for FASTA
analysis are: ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62, S with other parameters set as default. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
The BLOSUM62 table (Table 3) is an amino acid substitution matrix derived from about 2,000 local multiple alignments of protein sequence segments, representing highly conserved regions of more than 500 groups of related proteins (Henikoff and Henikoff, Proc.
Nat'1 Acad. Sci. USA 89:10915 (1992)). Accordingly, the BLOSUM62 substitution frequencies can be used to define conservative amino acid substitutions that may be introduced into the amino acid sequences of the present invention. Although it is possible to design amino acid substitutions based solely upon chemical properties (as discussed below), the language "conservative amino acid substitution" preferably refers to a substitution represented by a BLOSUM62 value of greater than -1. For example, an amino acid substitution is conservative if the substitution is characterized by a BLOSUM62 value of 0, 1, 2, or 3. According to this system, preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 1 (e. g., 1, 2 or 3), while more preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 2 (e.g., 2 or 3 ) .
Variant zsig57 polypeptides or substantially homologous zsig57 polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions (see Table 4) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of one to about 30 amino acids; and amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag. The present invention thus includes polypeptides of from about 70 to about 210 amino acid residues that comprise a sequence that is at least 800, preferably at least 90~, and more preferably 95~ or more identical to the corresponding region of SEQ ID N0:2. Polypeptides comprising affinity tags can further comprise a proteolytic cleavage site between the zsig57 polypeptide and the affinity tag.
Preferred such sites include thrombin cleavage sites and factor Xa cleavage sites.
Table 4 Conservative amino acid substitutions Basic: arginine lysine histidine Acidic: glutamic acid aspartic acid Polar: glutamine asparagine Hydrophobic: leucine isoleucine valine Aromatic: phenylalanine tryptophan tyrosine Small: glycine alanine serine threonine methionine The present invention further provides a variety of other polypeptide fusions and related multimeric proteins comprising one or more polypeptide fusions. For example, a zsig57 polypeptide can be prepared as a fusion to a dimerizing protein as disclosed in U. S . Patents Nos .
5,155,027 and 5,567,589. Preferred dimerizing proteins in this regard include immunoglobulin constant region domains. Immunoglobulin-zsig57 polypeptide fusions can be expressed in genetically engineered cells to produce a variety of multimeric zsig57 analogs. Auxiliary domains can be fused to zsig57 polypeptides to target them to specific cells, tissues, or macromolecules (e. g., collagen). For example, a zsig57 polypeptide or protein could be targeted to a predetermined cell type by fusing a zsig57 polypeptide to a ligand that specifically binds to a receptor on the surface of the target cell. In this way, polypeptides and proteins can be targeted for therapeutic or diagnostic purposes. A zsig57 polypeptide can be fused to two or more moieties, such as an affinity tag for purification and a targeting domain. Polypeptide fusions.can also comprise one or more cleavage sites, particularly between domains. See, Tuan et al., Connective Tissue Research 34:1-9, 1996.
The proteins of the present invention can also 5 comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without limitation, traps-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline, traps-4-hydroxyproline, N
methylglycine, allo-threonine, methylthreonine, 10 hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-15 azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins.
For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically 20 aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art .
Transcription and translation of plasmids containing nonsense mutations is carried out in a cell-free system comprising an E, coli S30 extract and commercially 25 available enzymes and other reagents. Proteins are purified by chromatography. See, for example, Robertson et al., J. Am. Chem. Soc. 113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci.
30 USA 90:10195-9, 1993). In a second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al., J. Biol. Chem. 271:19991-8, 1996).
Within a third method, E. coli cells are cultured in the 36 w absence, of a natural amino acid that is to be replaced (e. g., phenylalanine) and in the presence of the desired non-naturally occurring amino acids) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-naturally occurring amino acid is incorporated into the protein in place of its natural counterpart. See, Koide et al., Biochem.
33:7470-6, 1994. Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993) .
A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids can be substituted for zsig57 amino acid residues.
Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989; Bass et al., Proc.
Natl. Acad. Sci. USA 88:4498-502, 1991). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity as disclosed below to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., _J.
Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992;
Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homologies with related proteins such as the human CMRF35.Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc.
Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).
Variants of the disclosed zsig57 DNA and polypeptide sequences can be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389-91, 1994, Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51, 1994 and WIPO Publication WO 97/20078. Briefly, variant DNAs are generated by in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. This technique can be modified by using a family of parent DNAs, such as allelic variants or DNAs from different species, to introduce additional variability into the process. Selection or screening for the desired activity, followed by additional iterations of mutagenesis and assay provides for rapid "evolution" of sequences by selecting for desirable mutations while simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides in host cells. Mutagenized DNA molecules that encode active polypeptides (e. g., IgA binding activity, or cAMP
suppression as described herein) can be recovered from the host cells and rapidly sequenced using modern equipment.
These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
Using the methods discussed herein, one of ordinary skill in the art can identify and/or prepare a variety of polypeptide fragments or variants of SEQ ID
N0:2 or that retain the Ig-variable domain properties, binding, transcytosis, or signal transduction activity of the wild-type zsig57 protein. For example, using the methods described above, one could identify a ligand binding domain on zsig57; heterodimeric and homodimeric binding domains; other functional or structural domains;
or other domains important for protein-protein interactions or signal transduction. Such polypeptides can also include additional polypeptide segments, such as affinity tags, as generally disclosed herein.
For any zsig57 polypeptide, including variants and fusion proteins, one of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant using the information set forth in Tables 1 and 2 above.
The zsig57 polypeptides of the present invention, including full-length polypeptides, biologically active fragments, and fusion polypeptides, can be produced in genetically engineered host cells according to conventional techniques. Suitable host cells are those cell types that can be transformed or transfected with exogenous DNA and grown in culture, including bacteria, fungal cells, and cultured higher eukaryotic cells. Eukaryotic cells, particularly cultured cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into a variety of host cells are disclosed by Sambrook et al., Molecular Cloning: _A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel et al., eds., Current Protocols in Molecular Biolo y, John Wiley and Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zsig57 polypeptide is operably linked to other genetic elements required for its expression, generally including a transcription promoter and terminator, within an expression vector. The vector will also commonly contain one or more selectable markers and one or more origins of replication, although those skilled in the art will recognize that within certain systems selectable markers can be provided on separate vectors, and replication of the exogenous DNA can be provided by integration into the host cell genome. Selection of promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of ordinary skill in the art. Many such elements are described in the literature and are available through commercial suppliers.
To direct a zsig57 polypeptide into the secretory pathway of a host cell, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) is provided in the expression vector.

The secretory signal sequence can be that of zsig57, or can be derived from another secreted protein (e.g., t-PA) or synthesized de novo. The secretory signal sequence is operably linked to the zsig57 DNA sequence, i.e., the two 5 sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell. Secretory signal sequences are commonly positioned 5' to the DNA
sequence encoding the polypeptide of interest, although 10 certain secretory signal sequences may be positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Alternatively, the secretory signal sequence 15 contained in the polypeptides of the present invention is used to direct other polypeptides into the secretory pathway. The present invention provides for such fusion polypeptides. A signal fusion polypeptide can be made wherein a secretory signal sequence that encodes a signal 20 peptide from amino acids 12 (Met) to 15 (Gly) of SEQ ID
N0:2 is operably linked to another DNA segment encoding a polypeptide using methods known in the art and disclosed herein. The secretory signal sequence contained in the fusion polypeptides of the present invention is preferably 25 fused amino-terminally to an additional peptide to direct the additional peptide into the secretory pathway. Such constructs have numerous applications known in the art.
For example,, these novel secretory signal sequence fusion constructs can direct the secretion of an active component 30 of a normally non-secreted protein. Such fusions can be used in vivo or in vitro to direct peptides through the secretory pathway.
Cultured mammalian cells are suitable hosts within the present invention. Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics w 7:603, 1981: Graham and Van der Eb, Virology 52:456, 1973), electroporation (Neumann et al., EMBO J. 1:841-5, 1982), DEAE-dextran mediated transfection (Ausubel et al., ibid.), and liposome-mediated transfection (Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus _15:80, 1993, and viral vectors (Miller and Rosman, BioTechniques 7:980-90, 1989; Wang and Finer, Nature Med. 2:714-6, 1996). The production of recombinant polypeptides in cultured mammalian cells is disclosed, for example, by Levinson et al., U.S. Patent No. 4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S. Patent No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134.
Suitable cultured mammalian cells include the COS-1 (ATCC
No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No.
CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary (e. g. CHO-K1; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Manassas, VA. Other suitable cell lines include but are not limited to intestinal cell lines, osteoblast, osteoclast, hematopoietic cell lines, and leukocyte cell lines. In general, strong transcription promoters are preferred, such as promoters from SV-90 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288. Other suitable promoters include those from metallothionein genes (U. S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late promoter.
Drug selection is generally used to select for cultured mammalian cells into which foreign DNA has been inserted. Such cells are commonly referred to as "transfectants". Cells that have been cultured in the presence of the selective agent and are able to pass the gene of interest to their progeny are referred to as "stable transfectants." A preferred selectable marker is a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like. Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification." Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes. A
preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g. hygromycin resistance, multi-drug resistance, puromycin acetyltransferase) can also be used. Alternative markers that introduce an altered phenotype, such as green fluorescent protein, or cell surface proteins such as CD4, CD8, Class I MHC, placental alkaline phosphatase can be used to sort transfected cells from untransfected cells by such means as FACS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used as hosts, including plant cells, insect cells and avian cells. The use of Agrobacterium rhizogenes as a vector for expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci. (Bangalore) 11:47-58, 1987.
Transformation of insect cells and production of foreign polypeptides therein is disclosed by Guarino et al., U.S.
Patent No. 5,162,222 and WIPO publication WO 94/06463.
Insect cells can be infected with recombinant baculovirus, commonly derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See, King, L.A. and Possee, R.D., The Baculovirus Ex ression System' A Laboratory Guide, London, Chapman & Hall; 0'Reilly, D.R. et al., Baculovirus Expression Vectors: A Laboratory Manual, New York, Oxford University Press., 1994; and, Richardson, C.
D., Ed., Baculovirus Expression Protocols Methods in Molecular Biology, Totowa, NJ, Humana Press, 1995. The second method of making recombinant zsig57 baculovirus utilizes a transposon-based system described by Luckow (Luckow, V.A, et al., J Virol 67:4566-79, 1993). This system, which utilizes transfer vectors, is sold in the Bac-to-BacT"" kit (Life Technologies, Rockville, MD). This system utilizes a transfer vector, pFastBaclT"' (Life Technologies) containing a Tn7 transposon to move the DNA
encoding the zsig57 polypeptide into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid." The pFastBaclT"" transfer vector utilizes the AcNPV polyhedrin promoter to drive the expression of the gene of interest, in this case zsig57. However, pFastBaclT'" can be modified to a considerable degree. The polyhedrin promoter can be removed and substituted with the baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter) which is expressed earlier in the baculovirus infection, and has been shown to be advantageous for expressing secreted proteins. See, Hill-Perkins, M.S. and Possee, R.D., J. Gen. Virol. 71:971-6, 1990; Bonning, B.C. et al., J. Gen. Virol. 75:1551-6, 1994; and, Chazenbalk, G.D., and Rapoport, B., J. Biol.
Chem. 270:1593-9, 1995. In such transfer vector constructs, a short or long version of the basic protein promoter can be used. Moreover, transfer vectors can be constructed which replace the native zsig57 secretory signal sequences with secretory signal sequences derived from insect proteins. For example, a secretory signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to replace the native zsig57 secretory signal sequence.
In addition, transfer vectors can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed zsig57 polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer, T. et al., Proc.
Natl. Acad. Sci. 82:7952-4, 1985). Using a technique known in the art, a transfer vector containing zsig57 is transformed into E. Coli, and screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus. The bacmid DNA containing the recombinant baculovirus genome is isolated, using common techniques, and used to transfect Spodoptera frugiperda cells, e.g.
Sf9 cells. Recombinant virus that expresses zsig57 is subsequently produced. Recombinant viral stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line derived from the fall armyworm, Spodoptera frugiperda. See, in general, Glick and Pasternak, Molecular Biotechnology: Principles an_d Applications of Recombinant DNA, ASM Press, Washington, D.C., 1994. Another suitable cell line is the High FiveOT""
cell line (Invitrogen) derived from Trichoplusia ni (U. S.
Patent No. 5,300,435). Commercially available serum-free media are used to grow and maintain the. cells. Suitable media are Sf900 IIT"" (Life Technologies) or ESF 921T""
(Expression Systems) for the Sf9 cells; and Ex-ce110405T""
(JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life Technologies) for the T, ni cells. The cells are grown up from an inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3.
Procedures used are generally described in available laboratory manuals (King, L. A. and Possee, R.D., ibid.;
5 0'Reilly, D.R. et al., ibid.; Richardson, C. D., ibid.).
Subsequent purification of the zsig57 polypeptide from the supernatant can be achieved using methods described herein.
Fungal cells, including yeast cells, can also be 10 used within the present invention. Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia metnanolica.
Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides 15 therefrom are disclosed by, for example, Kawasaki, U.S.
Patent No. 4,599,311; Kawasaki et al., U.S. Patent No.
4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075. Transformed cells are selected by 20 phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e. g., leucine). A preferred vector system for use in Saccharomyces cerevisiae is the POTI
vector system disclosed by Kawasaki et al. (U. S. Patent 25 No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media. Suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No.
30 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
S 132:3959-65, 1986 and Cregg, U.S. Patent No. 4,882,279.
Aspergillus cells can be utilized according to the methods of McKnight et al., U.S. Patent No. 4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 9,486,533.
The use of Pichia methanolica as host for the production of recombinant proteins is disclosed in WIPO
Publications WO 97/I7450, WO 97/I7451, WO 98/02536, and WO
98/02565. DNA molecules for use in transforming P.
methanolica will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P.
methanolica, it is preferred that the promoter and terminator in the plasmid be that of a P. methanolica gene, such as a P. methanolica alcohol utilization gene (A UG1 or AUG2). Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of the DNA into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21), which allows ade2 host cells to grow in the absence of adenine. For large-scale, industrial processes where it is desirable to minimize the use of methanol, it is preferred to use host cells in which both methanol utilization genes (A UGl and A UG2) are deleted. For production of secreted proteins, host cells deficient in vacuolar protease genes (PEP4 and PRB.t) are preferred.
Electroporation is used to facilitate the introduction of a plasmid containing DNA encoding a polypeptide of interest into P. methanolica cells. It is preferred to transform P. methanolica cells by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, most preferably about 20 milliseconds. P.
methanolica cells are cultured in a medium comprising adequate sources of carbon, nitrogen and trace nutrients at a temperature of about 25°C to 35°C. Liquid cultures are provided with sufficient aeration by conventional means, such as shaking of small flasks or sparging of fermentors. A preferred culture medium for P. methanolica is YEPD (2~ D-glucose, 2~ BactoTM Peptone (Difco Laboratories, Detroit, MI), 1~ BactoTM yeast extract (Difco Laboratories), 0.004$ adenine and 0.006 L-leucine).
Prokaryotic host cells, including strains of the bacteria Escherichia coli, Bacillus and other genera are also useful host cells within the present invention.
Techniques for transforming these hosts and expressing foreign DNA sequences cloned therein are well known in the art (see, e.g., Sambrook et al., ibid.). When expressing a zsig57 polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, typically as insoluble granules, or may be directed to the periplasmic space by a bacterial secretion sequence. In the former case, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution. In the latter case, the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured according to conventional procedures in a culture medium containing nutrients and other components required for the growth of the chosen host cells. A variety of suitable media, including defined media and complex media, are known in the art and generally include a carbon source, a nitrogen source, essential amino acids, vitamins and minerals. Media can also contain such components as growth factors or serum, as required. The growth medium will generally select for cells containing the exogenously added DNA by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker carried on the expression vector or co-transfected into the host cell.
It is preferred to purify the polypeptides of the present invention to X80$ purity, more preferably to ?90$ purity, even more preferably >_95$ purity, and particularly preferred is a pharmaceutically pure state, that is greater than 99.9 pure with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents. Preferably, a purified polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin.

. Expressed recombinant zsig57 polypeptides (or chimeric zsig57 polypeptides) can be purified using fractionation and/or conventional purification methods and media. For example, the particular purification methods described in Rindisbacher, L., et al., su ra., are exemplary, and can be adapted to zsig57 polypeptide by one of ordinary skill in the art using methods described below.
Protein purification methods include, fractionation of samples by ammonium sulfate precipitation and acid or chaotrope extraction. Exemplary purification steps may include hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid chromatography.
Suitable chromatographic media include derivatized dextrans, agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI, DEAF, QAE and Q derivatives are preferred. Exemplary chromatographic media include those media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71 (Toso Haas) and the like.
Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins and the like that are insoluble under the conditions in which they are to be used. These supports may be modified with reactive groups that allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries include cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, hydrazide activation, and carboxyl and amino derivatives for carbodiimide coupling chemistries. These and other solid media are well known and widely used in the art, and are available from commercial suppliers. Methods for binding receptor polypeptides to support media are well 5 known in the art. Selection of a particular method is a matter of routine design and is determined in part by the properties of the chosen support. See, for example, Affinity Chromatography: Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988.
10 The polypeptides of the present invention can be isolated by exploitation of their biochemical, structural, and biological properties. For example, immobilized metal ion adsorption (IMAC) chromatography can be used to purify histidine-rich proteins, including those comprising 15 polyhistidine tags. Briefly, a gel is first charged with divalent metal ions to form a chelate (Sulkowski, Trends in Biochem. 3:1-7, 1985). Histidine-rich proteins will be adsorbed to this matrix with differing affinities, depending upon the metal ion used, and will be eluted by 20 competitive elution, lowering the pH, or use of strong chelating agents. Other methods of purification include purification of glycosylated proteins by lectin affinity chromatography and ion exchange chromatography (Methods in Enzymol., Vol. 182, "Guide to Protein Purification", M.
25 Deutscher, (ed.), Acad. Press, San Diego, 1990, pp.529-39). Within additional embodiments of the invention, a fusion of the polypeptide of interest and an affinity tag (e. g., maltose-binding protein, an immunoglobulin domain) may be constructed to facilitate purification.
Moreover, using methods described in the art, polypeptide fusions, or hybrid zsig57 proteins, are constructed using regions or domains of the inventive zsig57 in combination with those of other related proteins (e. g. human CMRF35 or poly-Ig receptor), or heterologous proteins (Sambrook et al., ibid., Altschul et al., ibid., Picard, Cur. Opin. Biology, 5:511-5, 1994, and references therein). These methods allow the determination of the biological importance of larger domains or regions in a polypeptide of interest. Such hybrids may alter reaction kinetics, binding, constrict or expand the substrate specificity, or alter tissue and cellular localization of a polypeptide, and can be applied to polypeptides of unknown structure.
Fusion proteins can be prepared by methods known to those skilled in the art by preparing each component of the fusion protein and chemically conjugating them.
Alternatively, a polynucleotide encoding different components of the fusion protein in the proper reading frame can be generated using known techniques and expressed by the methods described herein. For example, part or all of a domains) conferring a biological function can be swapped between zsig57 of the present invention with the corresponding domains) from another Ig-variable-domain family member, such as CMRF35. Such domains include, but are not limited to, the secretory signal sequence, conserved motifs, Ig-variable domain, transmembrane domain, acidic cleavage sites, and the cytoplasmic stub. Such fusion proteins would be expected to have a biological functional profile that is the same or similar to polypeptides of the present invention or other members of the protein family, depending on the fusion constructed. Moreover, such fusion proteins can exhibit other properties as disclosed herein.
Zsig57 polypeptides or fragments thereof can also be prepared through chemical synthesis. Zsig57 polypeptides may be monomers or multimers; glycosylated or non-glycosylated; pegylated or non-pegylated; and may or may not include an initial methionine amino acid residue.
Polypeptides of the present invention can also be synthesized by exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. Methods for synthesizing polypeptides are well known in the art. See, for example, Merrifield, J. Am. Chem. Soc. 85:2149, 1963; Kaiser et al., Anal.
Biochem. 34:595, 1970. After the entire synthesis of the desired peptide on a solid support, the peptide-resin is with a reagent which cleaves the polypeptide from the resin and removes most of the side-chain protecting groups . Such methods are well established in the art . The activity of molecules of the present invention can be measured using a variety of assays that measure for example, signal transduction, Ig binding or cAMP
modulation. Such assays are well known in the art. For a general reference, see Nihei, Y., et al., su ra.; and Rindisbacher, L., et al., supra..
The activity of the zsig57 polypeptides of the present invention can be measured by their ability to bind Ig. For example, the IgA binding assay for the secretory component of pIgR is known in the art and can be applied to the polypeptides of the present invention. See, Rindisbacher, L., et al., J. Biol. Chem., 270:14220-14228, 1995.
In addition, zsig57 polypeptides of the present invention can be used to study pancreatic cell proliferation or differentiation. Such methods of the present invention generally comprise incubating a cells, (3 cells, 8 cells, F cells and acinar cells in the presence and absence of zsig57 polypeptide, monoclonal antibody, WO '99/66040 PCT/ITS99/11337 agonist.or antagonist thereof_ and observing changes in islet cell proliferation or differentiation.
A further aspect of the invention provides a method for studying insulin. Such methods of the present invention comprise incubating adipocytes in a culture medium comprising zsig57 polypeptide, monoclonal antibody, agonist or antagonist thereof ~ insulin and observing changes in adipocyte protein secretion or differentiation.
The present invention also provides methods of studying mammalian cellular metabolism. Such methods of the present invention comprise incubating cells to be studied, for example, human vascular endothelial cells, ~
zsig57 polypeptide, monoclonal antibody, agonist or antagonist thereof and observing changes in adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose uptake, or the like.
Also, zsig57 polypeptides, agonists or antagonists thereof can be therapeutically useful for promoting wound healing, for example, in the intestine.
To verify the presence of this capability in zsig57 polypeptides, agonists or antagonists of the present invention, such zsig57 polypeptides, agonists or antagonists are evaluated with respect to their ability to facilitate wound healing according to procedures known in the art. If desired, zsig57 polypeptide performance in this regard can be compared to growth factors, such as EGF, NGF, TGF-a, TGF-~3, insulin, IGF-I, IGF-II, fibroblast growth factor (FGF) and the like. In addition, zsig57 polypeptides or agonists or antagonists thereof can be evaluated in combination with one or more growth factors to identify synergistic effects.
In addition, zsig57 polypeptides, agonists or antagonists thereof can be therapeutically useful for anti-microbial applications. To verify the presence of this capability in zsig57 polypeptides, agonists or antagonists of the present invention, such zsig57 polypeptides, agonists or antagonists are evaluated with respect to their antimicrobial properties according to procedures known in the art. See, for example, Barsum et al., Eur. Respir. J. 8: 709-14, 1995; Sandovsky-Losica et al., J. Med. Vet. Mycol (England) 28: 279-87, 1990;
Mehentee et al., J. Gen. Microbiol (En land) 135: 2181-88, 1989; Segal and Savage, Journal of Medical and Veterinary Mycology 24: 477-479, 1986, and the like. If desired, zsig57 polypeptide performance in this regard can be compared to proteins known to be functional in this regard, such as proline-rich proteins, lysozyrne, histatins, lactoperoxidase or the like. Moreover, zsig57 may bind and protect immune molecules (e. g., IgA) from proteolytic or other microbial attack (Brandtzaeg, P. and Krajci, P., "Secretory Component (pIgR)" In' Encyclo edia of Immunology, Ivan M. Roitt and Peter J. Delves (eds.), pp. 1360-1364. Academic Press, London, 1992). In addition, zsig57 polypeptides or agonists or antagonists thereof can be evaluated in combination with one or more antimicrobial agents to identify synergistic effects.
The activity of molecules of the present invention can be measured using a variety of assays that measure stimulation of gastrointestinal cell contractility, modulation of nutrient uptake and/or secretion of digestive enzymes. Of particular interest are changes in contractility of smooth muscle cells. For example, the contractile response of segments of mammalian duodenum or other gastrointestinal smooth muscles tissue (Depoortere et al., J. Gastrointestinal Motility _1:150-159, 1989). An exemplary in vivo assay uses an ultrasonic micrometer to measure the dimensional changes radially between commissures and longitudinally to the plane of the valve base (Hansen et al., Society of Thoracic Sur eons 60:S384-390, 1995).
Anti-microbial protective agents can be directly acting or indirectly acting. Such agents operating via 5 membrane association or pore forming mechanisms of action directly attach to the offending microbe. Anti-microbial agents can also act via an enzymatic mechanism, breaking down microbial protective substances or the cell wall/membrane thereof. Anti-microbial agents, capable of 10 inhibiting microorganism proliferation or action or of disrupting microorganism integrity by either mechanism set forth above, are useful in methods for preventing contamination in cell culture by microbes susceptible to that anti-microbial activity. Such techniques involve 15 culturing cells in the presence of an effective amount of said zsig57 polypeptide or an agonist or antagonist thereof .
Also, zsig57 polypeptides or agonists thereof can be used as cell culture reagents in in vitro studies 20 of exogenous microorganism infection, such as bacterial, viral or fungal infection. Such moieties can also be used in in vivo animal models of infection. Also, the microorganism-adherence properties of zsig57 polypeptides or agonists thereof can be studied under a variety of 25 conditions in binding assays and the like.
Moreover, zsig57 polypeptides, agonists or antagonists thereof can be therapeutically useful for mucosal integrity maintenance. Tissue expression of zsig57 is high in small intestine, a tissue involved in 30 mucosal secretion. To verify the presence of this capability in zsig57 polypeptides, agonists or antagonists of the present invention, such zsig57 polypeptides, agonists or antagonists are evaluated with respect to their mucosal integrity maintenance according to procedures known in the art. See, for example, Zahm et al., Eur. Respir. J. 8: 381-6, 1995, which describes methods for measuring viscoelastic properties and surface properties of mucous as well as for evaluating mucous transport by cough and by ciliary activity. If desired, zsig57 polypeptide performance in this regard can be compared to mucins or the like. In addition, zsig57 polypeptides or agonists or antagonists thereof can be evaluated in combination with mucins to identify synergistic effects.
Bone cell precursors, such as osteoblasts and osteociasts, are generated from bone marrow. Given the bone marrow localization of the present invention, assays that measure bone formation and/or resorption are important assays to assess zsig57 activity. One example is an assay system that permits rapid identification of substances having selective calcitonin receptor activity on cells expressing the calcitonin receptor. The calcitonin receptor is a member of the G-protein receptor family and transducer signal via activation of adenylate cyclase, leading to elevation of cellular cAMP levels (Lin et al., Science 254:1022-24, 1991). This assay system explaits the receptor's ability to elevate cAMP levels as a way to detect other molecules that are able to stimulate the calcitonin receptor and initiate signal transduction.
Receptor activation can be detected by: (1) measurement of adenylate cyclase activity (Salomon et al., Anal. Biochem. 58:541-48, 1974; Alvarez and Daniels, Anal.
Biochem. 187:98-103, 1990); (2) measurement of change in intracellular CAMP levels using conventional radioimmunoassay methods (Steiner et al., J. Biol. Chem.
247:1106-13, 1972; Harper and Brooker, J. Cyc. Nucl. Res.
1:207-18, 1975); or (3) through use of a CAMP
scintillation proximity assay (SPA) method (Amersham WO 99/66040 PCTlUS99/11337 57 . _.
Corp., .Arlington Heights, IL). While these methods provide sensitivity and accuracy, they involve considerable sample processing prior to assay, are time consuming, involve the use of radioisotopes, and would be cumbersome for large scale screening assays.
An alternative assay system involves selection of polypeptides that are able to induce expression of a cyclic AMP response element (CRE)-luciferase reporter gene, as a consequence of elevated cAMP levels, in cells expressing a calcitonin receptor, but not in cells lacking calcitonin receptor expression, as described in U.S.
patent No. 5,622,839, U.S. Patent No. 5,674,689, and U.S.
patent No. 5,674,981.
Well established animal models are available to test in vivo efficacy of zsig57 polypeptides that interact with the calcitonin receptor. Moreover, these models can be used to test effects of zsig57 on bone other than through the calcitonin receptor. For example, the hypocalcemic rat or mouse model can be used to determine the effect on serum calcium, and the ovariectomized rat or mouse can be used as a model system for osteoporosis.
Bone changes seen in these models and in humans during the early stages of estrogen deficiency are qualitatively similar. Calcitonin has been shown to be an effective agent for the prevention of bone loss in ovariectomized women and rats (Mazzuoli et al., Calcif. Tissue Int.
47:209-14, 1990; Wronski et al., Endocrinology 129:2246-50, 1991). High dose estrogen has been shown to inhibit bone resorption and to stimulate bone formation in an ovariectomized mouse model (Bain et al., J. Bone Miner.
Res. 8:435-42, 1993).
Biologically active zsig57 polypeptides of the present invention that interact with the calcitonin receptor, or exert other effects on bone, are therefore WO 99/66040 PC'T/US99/11337 contemplated to be advantageous for use in therapeutic applications for which calcitonin is useful. Such applications, for example, are in the treatment of osteoporosis, Paget's disease, hyperparathyroidism, osteomalacia, idiopathic hypercalcemia of infancy and other conditions. Additional applications are to inhibit gastric secretion in the treatment of acute pancreatitis and gastrointestinal disorders, and uses as analgesics, in particular for bone pain.
In vivo assays for measuring changes in bone formation rates include performing bone histology (see, Recker, R., eds. Bone Histomorphometry: Techniques and Interpretation. Boca Raton: CRC Press, Inc., 1983) and quantitative computed tomography (QCT; Ferretti,J. Bone 17:3535-3645, 1995; Orphanoludakis et al., Investig.
Radiol. 14:122-130, 1979; and Durand et al., Medical Physics 19:569-573, 1992). An exemplary ex vivo assay for measuring changes in bone formation is a calavarial assay (Gowen et al., J. Immunol. 136:2478-2482, 1986) or resorption calvarial assay (Linkhart, T.A., and Mohan, S., Endocrinology 125:1484-1491, 1989).
In addition, polypeptides of the present invention can be assayed and used for their ability to modify inflammation. Methods to determine proinflammatory and antiinflammatory qualities of zsig57 are known in the art and discussed herein.
Proteins of the present invention are useful for example, in treating gastrointestinal, lymphoid, inflammatory, pancreatic, blood or bone disorders, can be measured in vitro using cultured cells or in vivo by administering molecules of the claimed invention to the appropriate animal model. For instance, host cells expressing a secreted form of zsig57 polypeptide can be embedded in an alginate environment and injected (implanted) into recipient animals. Alginate-poly-L-lysine microencapsulation, permselective membrane encapsulation and diffusion chambers are a means to entrap transfected mammalian cells or primary mammalian cells.
These types of non-immunogenic "encapsulations" permit the diffusion of proteins and other macromolecules secreted or released by the captured cells to the recipient animal.
Most importantly, the capsules mask and shield the foreign, embedded cells from the recipient animal's immune response. Such encapsulations can extend the life of the injected cells from a few hours or days (naked cells) to several weeks (embedded cells). Alginate threads provide a simple and quick means for generating embedded cells.
The materials needed to generate the alginate threads are known in the art. In an exemplary procedure, 3$ alginate is prepared in sterile H20, and sterile filtered. Just prior to preparation of alginate threads, the alginate solution is again filtered. An approximately 50$ cell suspension (containing about 5 x 105 to about 5 x 10~ cells/ml) is mixed with the 3~ alginate solution. One ml of the alginate/cell suspension is extruded into a 100 mM sterile filtered CaCl2 solution over a time period of ~15 min, forming a "thread". The extruded thread is then transferred into a solution of 50 mM CaCl2, and then into a solution of 25 mM CaCl2. The thread is then rinsed with deionized water before coating the thread by incubating in a 0.01 solution of poly-L-lysine. Finally, the thread is rinsed with Lactated Ringer's Solution and drawn from solution into a syringe barrel (without needle). A large bore needle is then attached to the syringe, and the thread is intraperitoneally injected into a recipient in a minimal volume of the Lactated Ringer's Solution.

An alternative in vivo approach for assaying proteins of the present invention involves viral delivery systems. Exemplary viruses for this purpose include adenovirus, herpesvirus, retroviruses, vaccinia virus, and 5 adeno-associated virus (AAV). Adenovirus, a double-stranded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for review, see T.C. Becker et al., Meth. Cell Biol.
43:161-89, 1999; and J.T. Douglas and D.T. Curiel, Science 10 & Medicine 4:44-53, 1997). The adenovirus system offers several advantages: (i) adenovirus can accommodate relatively large DNA inserts; (ii) can be grown to high-titer; (iii) infect a broad range of mammalian cell types;
and (iv) can be used with many different promoters 15 including ubiquitous, tissue specific, and regulatable promoters. Also, because adenoviruses are stable in the bloodstream, they can be administered by intravenous injection.
Using adenovirus vectors where portions of the 20 adenovirus genome are deleted, inserts are incorporated into the viral DNA by direct ligation or by homologous recombination with a co-transfected plasmid. In an exemplary system, the essential El gene has been deleted from the viral vector, and the virus will not replicate 25 unless the E1 gene is provided by the host cell (the human 293 cell line is exemplary). When intravenously administered to intact animals, adenovirus primarily targets the liver. If the adenoviral delivery system has an El gene deletion, the virus cannot replicate in the 30 host cells. However, the host's tissue (e. g., liver) will express and process (and, if a secretory signal sequence is present, secrete) the heterologous protein. Secreted proteins will enter the circulation in the highly WO 99/6b040 vascularized liver, and effects on the infected animal can be determined.
Moreover, adenoviral vectors containing various deletions of viral genes can be used in an attempt to reduce or eliminate immune responses to the vector . Such adenoviruses are E1 deleted, and in addition contain deletions of E2A or E4 (Lusky, M. et al., J. Virol.
72:2022-2032, 1998; Raper, S.E. et al., Human Gene Thera

9:671-679, 1998). In addition, deletion of E2b is reported to reduce immune responses (Amalfitano, A. et al., J. Virol. 72:926-933, 1998). Moreover, by deleting the entire adenovirus genome, very large inserts of heterologous DNA can be accommodated. Generation of so called "gutless" adenoviruses where all viral genes are deleted are particularly advantageous for insertion of large inserts of heterologous DNA. For review, see Yeh, P. and Perricaudet, M., FASEB J. 11:615-623, 1997.
The adenovirus system can also be used for protein production in vitro. By culturing adenovirus infected non-293 cells under conditions where the cells are not rapidly dividing, the cells can produce proteins for extended periods of time. For instance, BHK cells are grown to confluence in cell factories, then exposed to the adenoviral vector encoding the secreted protein of interest. The cells are then grown under serum-free conditions, which allows infected cells to survive for several weeks without significant cell division.
Alternatively, adenovirus vector infected 293 cells can be grown as adherent cells or in suspension culture at relatively high cell density to produce significant amounts of protein (See Gamier et al., Cytotechnol.
15:145-55, 1994). With either protocol, an expressed, secreted heterologous protein can be repeatedly isolated from the cell culture supernatant, lysate, or membrane fractions depending on the disposition of the expressed protein in the cell. Within the infected 293 cell production protocol, non-secreted proteins may also be effectively obtained.
As a ligand, the activity of zsig57 polypeptide can be measured by a silicon-based biosensor microphysiometer which measures the extracellular acidification rate or proton excretion associated with receptor binding and subsequent physiologic cellular responses. An exemplary device is the CytosensorT""
Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA. A variety of cellular responses, such as cell proliferation, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method. See, for example, McConnell, H.M. et al., Science 257:1906-1912, 1992; Pitchford, S. et al., Meth. Enzymol. 228:84-108, 1997; Arimilli, S. et al., J. Immunol. Meth. 212:49-59, 1998; Van Liefde, I. et al., Eur. J. Pharmacol. 346:87-95, 1998. The microphysiometer can be used for assaying adherent or non-adherent eukaryotic or prokaryotic cells.
By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including zsig57 polypeptide, its agonists, or antagonists. Preferably, the microphysiometer is used to measure responses of a zsig57-responsive eukaryotic cell, compared to a control eukaryotic cell that does not respond to zsig57 polypeptide. ZSIG57-responsive eukaryotic cells comprise cells into which a receptor for zsig57 has been transfected creating a cell that is responsive to zsig57;
or cells naturally responsive to zsig57 such as cells derived from small intestine, PBLs, or bone marrow tissue.
Differences, measured by a change, for example, an increase or diminution in extracellular acidification, in the response of cells exposed to zsig57 polypeptide, relative to a control not exposed to zsig57, are a direct measurement of zsig57-modulated cellular responses.
Moreover, such zsig57-modulated responses can be assayed under a variety of stimuli. Using the microphysiometer, there is provided a method of identifying agonists of zsig57 polypeptide, comprising providing cells responsive to a zsig57 polypeptide, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting a change, for example, an increase or diminution, in a cellular response of the second portion of the cells as compared to the first portion of the cells. The change in cellular response is shown as a measurable change extracellular acidification rate.
Moreover, culturing a third portion of the cells in the presence of zsig57 polypeptide and the absence of a test compound can be used as a positive control for the zsig57-responsive cells, and as a control to compare the agonist activity of a test compound with that of the zsig57 polypeptide. Moreover, using the microphysiometer, there is provided a method of identifying antagonists of zsig57 polypeptide, comprising providing cells responsive to a zsig57 polypeptide, culturing a first portion of the cells in the presence of zsig57 and the absence of a test compound, culturing a second portion of the cells in the presence of zsig57 and the presence of a test compound, and detecting a change, for example, an increase or a diminution in a cellular response of the second portion of the cells as compared to the first portion of the cells.
The change in cellular response is shown as a measurable change extracellular acidification rate. Antagonists and agonists, for zsig57 polypeptide, can be rapidly identified using this method.
Moreover, zsig57 can be used to identify cells, tissues, or cell lines which respond to a zsig57 stimulated pathway. The microphysiometer, described above, can be used to rapidly identify ligand-responsive cells, such as cells responsive to zsig57 of the present invention. Cells can be cultured in the presence or absence of zsig57 polypeptide. Those cells which elicit a measurable change in extracellular acidification in the presence of zsig57 are responsive to zsig57. Such cell lines, can be used to identify antagonists and agonists of zsig57 polypeptide as described above.
In view of the tissue distribution observed for zsig57, agonists (including the natural ligand/ substrate/
cofactor/ etc.) and antagonists have enormous potential in both in vitro and in vivo applications. Compounds identified as zsig57 agonists are useful for stimulating cell growth or signal transduction in vitro and in vivo.
For example, zsig57 and zsig57 agonist and antagonist compounds are useful as components of defined cell culture media, and can be used alone or in combination with other cytokines and hormones to replace serum that is commonly used in cell culture. Agonists are thus useful in specifically promoting the growth and/or development of cells in culture. Considering the high expression of zsig57 in PBLs and bone marrow, zsig57 polypeptides and zsig57 agonists are useful as research reagents, for the growth of many cell types, including T-cells, B-cells, and other cells of the lymphoid and myeloid lineages and hematopoetic lineages. As such, zsig57 polypeptide can be provided as a supplement in cell culture medium.
Antagonists are also useful as research reagents for characterizing sites of ligand-receptor interaction.

Inhibitors of zsig57 activity (zsig57 antagonists) include anti-zsig57 antibodies and soluble proteins which bind zsig57 polypeptide, as well as other peptidic and non-peptidic agents (including ribozymes).
5 Zsig57 can be used to identify inhibitors (antagonists) of its activity. Test compounds are added to the assays disclosed herein to identify compounds that inhibit the activity of zsig57. In addition to those assays disclosed herein, samples can be tested for

10 inhibition of zsig57 activity within a variety of assays designed to measure receptor binding or the stimulation/inhibition of zsig57-dependent cellular responses. For example, zsig57-responsive cell lines can be transfected with a reporter gene construct that is 15 responsive to a zsig57-stimulated cellular pathway.
Reporter gene constructs of this type are known in the art, and will generally comprise a zsig57-DNA response element operably linked to a gene encoding an assay detectable protein, such as luciferase. DNA response 20 elements can include, but are not limited to, cyclic AMP
response elements (CRE), hormone response elements (HRE) insulin response element (IRE) (Nasrin et al., Proc. Natl.
Acad. Sci. USA 87:5273-7, 1990) and serum response elements (SRE) (Shaw et al. Cell 56: 563-72, 1989).
25 Cyclic AMP response elements are reviewed in Roestler et al., J. Biol. Chem. 263 (19):9063-6; 1988 and Habener, Molec. Endocrinol. 4 (8):1087-94; 1990. Hormone response elements are reviewed in Beato, Cell _55:335-44; 1989.
Candidate compounds, solutions, mixtures or extracts are 30 tested for the ability to inhibit the activity of zsig57 on the target cells as evidenced by a decrease in zsig57 stimulation of reporter gene expression. Assays of this type will detect compounds that directly block zsig57 binding to cell-surface receptors, as well as compounds that block processes in the cellular pathway subsequent to receptor-ligand binding. In the alternative, compounds or other samples can be tested for direct blocking of zsig57 binding to receptor using zsig57 tagged with a detectable label (e. g., 125I, biotin, horseradish peroxidase, FITC, and the like). Within assays of this type, the ability of a test sample to inhibit the binding of labeled zsig57 to the receptor is indicative of inhibitory activity, which can be confirmed through secondary assays. Receptors used within binding assays may be cellular receptors or isolated, immobilized receptors.
Moreover, zsig57 activity may be exerted when bound to when bound to another polypeptide or protein in a complex. Zsig57 can be used to identify proteins to which it binds as disclosed herein. Moreover, inhibitors (antagonists) of these zsig57 complexes can be identified as described above.
A zsig57 polypeptide can be expressed as a fusion with an immunoglobulin heavy chain constant region, typically an Fc fragment, which contains two constant region domains and lacks the variable region. Methods for preparing such fusions are disclosed in U.S. Patents Nos.
5,155,027 and 5,567,584. Such fusions are typically secreted as multimeric molecules wherein the Fc portions are disulfide bonded to each other and two non-Ig polypeptides are arrayed in closed proximity to each other. Fusions of this type can be used to affinity purify ligand, as an in vitro assay tool, or zsig57 antagonist. For use in assays, the chimeras are bound to a support via the Fc region and used in an ELISA
format.
A zsig57 polypeptide can also be used for purification of ligand or polypeptides to which it binds.
The zsig57 polypeptide is immobilized on a solid support, such as. beads of agarose, cross-linked agarose, glass, cellulosic resins, silica-based resins, polystyrene, cross-linked polyacrylamide, or like materials that are stable under the conditions of use. Methods for linking polypeptides to solid supports are known in the art, and include amine chemistry, cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, and hydrazide activation. The resulting medium will generally be configured in the form of a column, and fluids containing ligand are passed through the column one or more times to allow ligand to bind to the receptor zsig57 polypeptide. The ligand is then eluted using changes in salt concentration, chaotropic agents (guanidine HC1), or pH to disrupt ligand-receptor binding.
An assay system that uses a ligand-binding receptor (or an antibody, one member of a complement/
anti-complement pair) or a binding fragment thereof, and a commercially available biosensor instrument (BIAcore, Pharmacia Biosensor, Piscataway, NJ) can be advantageously employed. Such receptor, antibody, member of a complement/anti-complement pair or fragment is immobilized onto the surface of a receptor chip. Use of this instrument is disclosed by Karlsson, J. Immunol. Methods 145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol.
234:554-63, 1993. A receptor, antibody, member or fragment is covalently attached, using amine or sulfhydryl chemistry, to dextran fibers that are attached to gold film within the flow cell. A test sample is passed through the cell. If a ligand, epitope, or opposite member of the complement/anti-complement pair is present in the sample, it will bind to the immobilized receptor, antibody or member, respectively, causing a change in the refractive index of the medium, which is detected as a change in surface plasmon resonance of the gold film.
This system allows the determination of on- and off-rates, from which binding affinity can be calculated, and assessment of stoichiometry of binding.
Ligand-binding receptor polypeptides can also be used within other assay systems known in the art. Such systems include Scatchard analysis for determination of binding affinity (see Scatchard, Ann. NY Acad. Sci. _51:
660-72, 1949) and calorimetric assays (Cunningham et al., Science 253:545-48, 1991; Cunningham et al., Science 245:821-25, 1991).
Zsig57 polypeptides can also be used to prepare antibodies that bind to zsig57 epitopes, peptides or polypeptides. The zsig57 polypeptide or a fragment thereof serves as an antigen (immunogen) to inoculate an animal and elicit an immune response. One of skill in the art would recognize that antigenic, epitope-bearing polypeptides contain a sequence of at least 6, preferably at least 9, and more preferably at least 15 to about 30 contiguous amino acid residues of a zsig57 polypeptide (e. g., SEQ ID N0:2). Polypeptides comprising a larger portion of a zsig57 polypeptide, i.e., from 30 to 10 residues up to the entire length of the amino acid sequence are included. Antigens or immunogenic epitopes can also include attached tags, adjuvants and carriers, as described herein. Suitable antigens include the zsig57 polypeptide encoded by SEQ ID N0:2 from amino acid number 16 (Gln) to amino acid number 199 (Gln), or a contiguous 9 to 199 AA amino acid fragment thereof. Other suitable antigens include the Ig-variable domain, Ig-variable domain with additional amino acids up to acidic cleavage sites, cytoplasmic stub, and other domains of zsig57, described herein. Preferred peptides to use as antigens are hydrophilic peptides such as those predicted by one of WO 99/66040 PC'f/US99/11337 skill in the art from a hydrophobicity plot (See Figure 2). Zsig57 hydrophilic peptides include peptides comprising amino acid sequences selected from the group consisting of: (1) amino acid number 96 (Glu) to amino acid number 101 (Glu) of SEQ ID N0:2; (2) amino acid number 124 (Pro) to amino acid number 129 (Glu) of SEQ ID
N0:2; (3) amino acid number 125 (Pro) to amino acid number 130 (Glu) of SEQ ID N0:2; (9) amino acid number 185 (Arg) to amino acid number 190 (Glu) of SEQ ID N0:2; and (5) amino acid number 186 (Lys) to amino acid number 191 (Ser) of SEQ ID N0:2. Antibodies from an immune response generated by inoculation of an animal with these antigens can be isolated and purified as described herein. Methods for preparing and isolating polyclonal and monoclonal antibodies are well known in the art. See, for example, Current Protocols in Immunology, Cooligan, et al. (eds.), National Institutes of Health, John Wiley and Sons, Inc., 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, 1989; and Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies-Techniques and Applications, CRC Press, Inc., Boca Raton, FL, 1982 .
As would be evident to one of ordinary skill in the art, polyclonal antibodies can be generated from inoculating a variety of warm-blooded animals such as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats with a zsig57 polypeptide or a fragment thereof .
The immunogenicity of a zsig57 polypeptide can be increased through the use of an adjuvant, such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant. Polypeptides useful for immunization also include fusion polypeptides, such as fusions of zsig57 or a portion thereof with an immunoglobulin polypeptide or with maltose binding protein. The polypeptide immunogen can be a full-length molecule or a portion thereof. If the polypeptide portion is "hapten-like", such portion can be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine 5 serum albumin (BSA) or tetanus toxoid) for immunization.
As used herein, the term "antibodies" includes polyclonal antibodies, affinity-purified polyclonal antibodies, monoclonal antibodies, and antigen-binding fragments, such as F(ab')2 and Fab proteolytic fragments.
10 Genetically engineered intact antibodies or fragments, such as chimeric antibodies, Fv fragments, single chain antibodies and the like, as well as synthetic antigen-binding peptides and polypeptides, are also included.
Non-human antibodies can be humanized by grafting non-15 human CDRs onto human framework and constant regions, or by incorporating the entire non-human variable domains (optionally "cloaking" them with a human-like surface by replacement of exposed residues, wherein the result is a "veneered" antibody). In some instances, humanized 20 antibodies can retain non-human residues within the human variable region framework domains to enhance proper binding characteristics. Through humanizing antibodies, biological half-life can be increased, and the potential for adverse immune reactions upon administration to humans 25 is reduced.
Alternative techniques for generating or selecting antibodies useful herein include in vitro exposure of lymphocytes to zsig57 protein or peptide, and selection of antibody display libraries in phage or 30 similar vectors (for instance, through use of immobilized or labeled zsig57 protein or peptide). Genes encoding polypeptides having potential zsig57 polypeptide binding domains can be obtained by screening random peptide libraries displayed on phage (phage display) or on bacteria., such as E. coli. Nucleotide sequences encoding the polypeptides can be obtained in a number of ways, such as through random mutagenesis and random polynucleotide synthesis. These random peptide display libraries can be used to screen for peptides which interact with a known target which can be a protein or polypeptide, such as a ligand or receptor, a biological or synthetic macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide display libraries are known in the art (Ladner et al., US
Patent N0. 5,223,409; Ladner et al., US Patent N0.
4,946,778; Ladner et al., US Patent NO. 5,903,489 and Ladner et al., US Patent NO. 5,571,698) and random peptide display libraries and kits for screening such libraries are available commercially, for instance from Clontech (Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New England Biolabs, Inc. (Beverly, MA) and Pharmacia LKB
Biotechnology Inc. (Piscataway, NJ). Random peptide display libraries can be screened using the zsig57 sequences disclosed herein to identify proteins which bind to zsig57. These "binding proteins" which interact with zsig57 polypeptides can be used for tagging cells; for isolating homolog polypeptides by affinity purification;
they can be directly or indirectly conjugated to drugs, toxins, radionuclides and the like. These binding proteins can also be used in analytical methods such as for screening expression libraries and neutralizing activity. The binding proteins can also be used for diagnostic assays for determining circulating levels of polypeptides; for detecting or quantitating soluble polypeptides as marker of underlying pathology or disease.
These binding proteins can also act as zsig57 "antagonists" to block zsig57 binding and signal transduction in vitro and in vivo.

Moreover, human antibodies can be produced in transgenic, non-human animals that have been engineered to contain human immunoglobulin genes as disclosed in WIPO
Publication WO 98/24893. It is preferred that the endogenous immunoglobulin genes in these animals be inactivated or eliminated, such as by homologous recombination.
Antibodies are considered to be specifically binding if: 1) they exhibit a threshold level of binding activity, and 2) they do not significantly cross-react with related polypeptide molecules. A threshold level of binding is determined if anti-zsig57 antibodies herein bind to a zsig57 polypeptide, peptide or epitope with an affinity at least 10-fold greater than the binding affinity to control (non-zsig57) polypeptide. It is preferred that the antibodies exhibit a binding affinity (Ka) of 106 M 1 or greater, preferably 107 M 1 or greater, more preferably 108 M 1 or greater, and most preferably 109 M 1 or greater. The binding affinity of an antibody can be readily determined by one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard, G., Ann. NY Acad. Sci. 51: 660-672, 1949).
Whether anti-zsig57 antibodies do not significantly cross-react with related polypeptide molecules is shown, for example, by the antibody detecting zsig57 polypeptide but not known related polypeptides using a standard Western blot analysis (Ausubel et al., ibid.). Examples of known related polypeptides are those disclosed in the prior art, such as known orthologs, and paralogs, and similar known members of a protein family, (e. g. CMRF35 and SC). Screening can also be done using non-human zsig57, and zsig57 mutant polypeptides.
Moreover, antibodies can be "screened against" known related . polypeptides, to isolate a population that specifically binds to the zsig57 polypeptides. For example, antibodies raised to zsig57 are adsorbed to related polypeptides adhered to insoluble matrix;
antibodies specific to zsig57 will flow through the matrix under the proper buffer conditions. Screening allows isolation of polyclonal and monoclonal antibodies non-crossreactive to known closely related polypeptides (Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988; Current Protocols in Immunology, Cooligan, et al. (eds.), National Institutes of Health, John Wiley and Sons, Inc., 1995).
Screening and isolation of specific antibodies is well known in the art. See, Fundamental Immunology, Paul (eds.), Raven Press, 1993; Getzoff et al., Adv. in Immuno.I. 43: 1-98, 1988; Monoclonal Antibodies:
Principles and Practice, Goding, J.W. (eds.), Academic Press Ltd., 1996; Benjamin et al., Ann. Rev. Immunol. 2:
67-101, 1984. Specifically binding anti-zsig57 antibodies can be detected by a number of methods in the art, and disclosed below.
A variety of assays known to those skilled in the art can be utilized to detect antibodies which specifically bind to zsig57 proteins or polypeptides.
Exemplary assays are described in detail in Antibodies: A
Laboratory Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of such assays include: concurrent immunoelectrophoresis, radioimmunoassay, radioimmuno-precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western blot assay, inhibition or competition assay, and sandwich assay. In addition, antibodies can be screened for binding to wild-type versus mutant zsig57 protein or polypeptide.

Antibodies to zsig57 can be used for tagging cells that express zsig57; for isolating zsig57 by affinity purification; for diagnostic assays for determining circulating levels ozsig57 polypeptides; for detecting or quantitating soluble zsig57 polypeptides as marker of underlying pathology or disease. These binding polypeptides can also act as zsig57 "antagonists" to block zsig57 binding and signal transduction in vitro and in vivo. These anti-zsig57 binding polypeptides would be useful for inhibiting zsig57 activity or protein-binding.
Antibodies to zsig57 may be used for tagging cells that express zsig57; for isolating zsig57 by affinity purification; for diagnostic assays for determining circulating levels of zsig57 polypeptides; for detecting or quantitating soluble zsig57 as marker of underlying pathology or disease; in analytical methods employing FACS; for screening expression libraries; for generating anti-idiotypic antibodies; and as neutralizing antibodies or as antagonists to block zsig57 activity in vitro and in vivo. Suitable direct tags or labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like; indirect tags or labels may feature use of biotin-avidin or other complement/anti-complement pairs as intermediates. Antibodies herein can also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in vivo diagnostic or therapeutic applications.
Moreover, antibodies to zsig57 or fragments thereof can be used in vitro to detect denatured zsig57 or fragments thereof in assays, for example, Western Blots or other assays known in the art.
Antibodies, binding proteins or polypeptides herein can also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in vivo diagnostic or therapeutic applications. For instance, polypeptides or antibodies of the present invention can be used to identify or treat 5 tissues or organs that express a corresponding anti-complementary molecule (receptor or antigen, respectively, for instance). More specifically, zsig57 polypeptides or anti-zsig57 antibodies, or bioactive fragments or portions thereof, can be coupled to detectable or cytotoxic 10 molecules and delivered to a mammal having cells, tissues or organs that express the anti-complementary molecule.
Suitable detectable molecules can be directly or indirectly attached to the polypeptide or antibody, and include radionuclides, enzymes, substrates, cofactors, 15 inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like. Suitable cytotoxic molecules can be directly or indirectly attached to the polypeptide or antibody, and include bacterial or plant toxins (for instance, diphtheria toxin, Pseudomonas 20 exotoxin, ricin, abrin and the like), as well as therapeutic radionuclides, such as iodine-131, rhenium-188 or yttrium-90 (either directly attached to the polypeptide or antibody, or indirectly attached through means of a chelating moiety, for instance). Polypeptides or 25 antibodies can also be conjugated to cytotoxic drugs, such as adriamycin. Fox indirect attachment of a detectable or cytotoxic molecule, the detectable or cytotoxic molecule can be conjugated with a member of a complementary/
anticomplementary pair, where the other member is bound to 30 the polypeptide or antibody portion. For these purposes, biotin/streptavidin is an exemplary complementary/
anticomplementary pair.
In another embodiment, polypeptide-toxin fusion proteins or antibody-toxin fusion proteins can be used for targeted cell or tissue inhibition or ablation (for instance, to treat cancer cells or tissues).
Alternatively, if the polypeptide has multiple functional domains (i.e., an activation domain or a ligand binding domain, plus a targeting domain), a fusion protein including only the targeting domain may be suitable for directing a detectable molecule, a cytotoxic molecule or a complementary molecule to a cell or tissue type of interest. In instances where the domain only fusion protein includes a complementary molecule, the anti-complementary molecule can be conjugated to a detectable or cytotoxic molecule. Such domain-complementary molecule fusion proteins thus represent a generic targeting vehicle for cell/tissue-specific delivery of generic anti-complementary-detectable/ cytotoxic molecule conjugates.
In another embodiment, zsig57-cytokine fusion proteins or antibody-cytokine fusion proteins can be used for enhancing in vivo killing of target tissues (for example, intestinal, lymphoid, blood and bone marrow cancers), if the zsig57 polypeptide or anti-zsig57 antibody targets, for example, the hyperproliferative blood or bone marrow cell (See, generally, Hornick et al., Blood 89:4437-47, 1997). They described fusion proteins enable targeting of a cytokine to a desired site of action, thereby providing an elevated local concentration of cytokine. Suitable zsig57 polypeptides or anti-zsig57 antibodies target an undesirable cell or tissue (i.e., a tumor or a leukemia), and the fused cytokine mediated improved target cell lysis by effector cells. Suitable cytokines for this purpose include interleukin 2 and granulocyte-macrophage colony-stimulating factor (GM-CSF), for instance.
In yet another embodiment, if the zsig57 polypeptide or anti-zsig57 antibody targets vascular cells or tissues, such polypeptide or antibody can be conjugated with a radionuclide, and particularly with a beta-emitting radionuclide, to reduce restenosis. Such therapeutic approach poses less danger to clinicians who administer the radioactive therapy. For instance, iridium-192 impregnated ribbons placed into stented vessels of patients until the required radiation dose was delivered showed decreased tissue growth in the vessel and greater luminal diameter than the control group, which received ZO placebo ribbons. Further, revascularisation and stmt thrombosis were significantly lower in the treatment group. Similar results are predicted with targeting of a bioactive conjugate containing a radionuclide, as described herein.
The bioactive polypeptide or antibody conjugates described herein can be delivered intravenously, intraarterially or intraductally, or can be introduced locally at the intended site of action.
Molecules of the present invention can be used to identify and isolate receptors to which zsig57 interacts or binds. For example, proteins and peptides of the present invention can be immobilized on a column and membrane preparations run over the column (Immobilized Affinity Ligand Techniques, Hermanson et al., eds., Academic Press, San Diego, CA, 1992, pp.195-202).
Proteins and peptides can also be radiolabeled (Methods in Enzymol., vol. 182, "Guide to Protein Purification", M.
Deutscher, ed., Acad. Press, San Diego, 1990, 721-37) or photoaffinity labeled (Brunner et al., Ann. Rev. Biochem.
62:483-514, 1993 and Fedan et al., Biochem. Pharmacol.
33:1167-80, 1984) and specific cell-surface proteins can be identified.
The polypeptides, nucleic acid and/or antibodies of the present invention can be used in treatment of disorders associated with the immune system, gastrointestinal system, heart, inflammation, lymph system, bone marrow, blood and bones. The molecules of w the present invention may used to modulate ox to treat or prevent development of pathological conditions in such diverse tissue as small intestine and bone marrow. In particular, certain syndromes or diseases can be amenable to such diagnosis, treatment or prevention.
In addition, polypeptides of the present invention can be used fox their ability to modify inflammation. Methods to assess proinflammatory or antiinflammatory qualities of zsig57 are known in the art.
For example, suppression of cAMP production is an indication of anti-inflammatory effects of the pIgR
secretory component (SC) (Nihei, Y., et al., Arch.
Dermatol. Res., 287:546-552, 1995). Free SC component of the poly-IgR suppressed cAMP and inhibited ICAM and HLA-Dr induced by IFN-y in keratinocytes. Moreover, free SC has been reported to inhibit P1A2 and is believed to act via the arachadonic acid antiinflammatory cascade. Zsig57, likewise can exhibit similar anti-inflammatory effects, and may exert these effects in tissues in which it is expressed. For example, zsig57 is expressed in the small intestine, and can be useful in treatment of inflammatory bowel disease, diverticulitis, inflammation during and after intestinal surgery, and the like. In addition, zsig57, expressed in PBLs and bone marrow, can have other antiinflammatory actions in heart, pelvic inflammatory disease, (PID), psoriasis, arthritis, and other inflammatory diseases.
As such, zsig57 polypeptide, or its antagonists, have potential uses in inflammatory diseases such as asthma and arthritis. For example, if zsig57 is proinflammatory antagonists would be valuable in asthma WO 99/66040 PC'T/US99/11337 therapy. or other anti-inflammatory therapies where migration of lymphocytes is damaging. Alternatively, zsig57 can have an inhibitory or competitive effect on inflammatory agents and may serve directly as an asthma therapeutic or anti-inflammatory. In addition, zsig57 can serve other important roles in lung function, for instance, bronchodilation, tissue elasticity, recruitment of lymphocytes in lung infection and damage. Assays to assess the activity of zsig57 in lung cells are discussed in Laberge, S. et al., Am. J. Respir. Cell Mol. Biol.
17:193-202, 1997 Rumsaeng, V. et al., J. Immunol., 159:2904-2910, 1997; and Schluesener, H.J. et al., J.
Neurosci. Res. 44:606-611, 1996. Methods to determine proinflammatory and antiinflammatory qualities of zsig57 or its antagonists are known in the art. Moreover, other molecular biological, immunological, and biochemical techniques known in the art and disclosed herein can be used to determine zsig57 activity and to isolate agonists and antagonists.
Moreover, based on high expression in PBLs, zsig57 may exhibit antiviral functions by inhibiting viral replication by specific signaling via it's receptors) on a host cell (e. g. T-cell). Zsig57 may exhibit immune cell proliferative activity, as disclosed herein, and may stimulate the immune system to fight viral infections.
Moreover, zsig57 may bind CD4 or another lymphocyte receptor and exhibit antiviral effects, for example, against human immunodeficiency virus (HIV) or human T-cell lymphotropic virus (HTLV). Alternatively, zsig57 polypeptide may compete for a viral receptor or co-receptor to block viral infection. Zsig57 may be given parentally to prevent viral infection or to reduce ongoing viral replication and re-infection (Gayowski, T. et al., Transplantation 64:422-426, 1997). Thus, zsig57 may be used as. an antiviral therapeutic, for example, for viral leukemias (HTLV), AIDS (HIV), or gastrointestinal viral infections caused by, for example, rotavirus, calicivirus (e. g., Norwalk Agent) and certain strains of pathogenic 5 adenovirus.
The molecules of the present invention can be useful for proliferation of cardiac tissue cells, such as cardiac myocytes or myoblasts; skeletal myocytes or myoblasts and smooth muscle cells; chrondrocytes;
10 endothelial cells; adipocytes and osteoblasts in vitro.
For example, molecules of the present invention are useful as components of defined cell culture media, and can be used alone or in combination with other cytokines and hormones to replace serum that is commonly used in cell 15 culture. Molecules of the present invention are particularly useful in specifically promoting the growth and/or development of myocytes in culture, and may also prove useful in the study of cardiac myocyte hyperplasia and regeneration.
20 The polypeptides, nucleic acids and/or antibodies of the present invention can be used in treatment of disorders associated with myocardial infarction, congestive heart failure, hypertrophic cardiomyopathy and dilated cardiomyopathy. Molecules of 25 the present invention may also be useful for limiting infarct size following a heart attack, aiding in recovery after heart transplantation, promoting angiogenesis and wound healing following angioplasty or endarterectomy, to develop coronary collateral circulation, for 30 revascularization in the eye, for complications related to poor circulation such as diabetic foot ulcers, for stroke, following coronary reperfusion using pharmacologic methods, and other indications where angiogenesis is of benefit. Molecules of the present invention may be useful for improving cardiac function, either by inducing cardiac myocyte neogenesis and/or hyperplasia, by inducing coronary collateral development, or by inducing remodeling of necrotic myocardial area. Other therapeutic uses for the present invention include induction of skeletal muscle neogenesis and/or hyperplasia, kidney regeneration and/or for treatment of systemic and pulmonary hypertension.
Zsig57 induced coronary collateral development is measured in rabbits, dogs or pigs using models of chronic coronary occlusion (Landau et al., Amer. Heart J.
29:929-931, 1995; Sellke et al., Surgery 120(2):182-188, 1996; and Lazarous et al., 1996, ibid.) Zsig57 efficacy for treating stroke is tested in vivo in rats, utilizing bilateral carotid artery occlusion and measuring histological changes, as well as maze performance (Gage et al., Neurobiol. Aging 9:695-655, 1988). Zsig57 efficacy in hypertension is tested in vivo utilizing spontaneously hypertensive rats (SHR) for systemic hypertension (Marche et al., Clin. Exp. Pharmacol. Physiol. Suppl. 1:S119-116, 1995).
The zsig57 polypeptide is expressed in the small intestine. Thus, zsig57 polypeptide pharmaceutical compositions of the present invention can also be useful in prevention or treatment of digestive disorders in the GI tract, such as disorders associated with pathological secretory cell expansion or differentiation. Assays and animal models are known in the art for monitoring such expansion or differentiation and for evaluating zsig57 polypeptide, fragment, fusion protein, antibody, agonist or antagonist in the prevention or treatment thereof.
Moreover, trefoil factors in the intestine are known to be involved in mucosal stabilization in the gut and repair processes associated with acute injury, particularly epithelial restitution (Poulsom, R., Bail.

WO 99/66040 PCT/lJS99/11337 Clin. Gastro., 10; 113-134, 1996; Sands, B.E., and Podolsky, D.K., Annu. Rev. Physiol., 58; 253-273, 1996.
Also, trefoil proteins appear to have a role in healing wounds caused by intestinal inflammatory diseases, and resisting microbial invasion via mucosal secretion involvement (Palut, A.G., New Eng. J. Med., 336; 5-6-507, 1997; Playford, R.J., J. Royal Coll. Phys. London, _31; 37-41, 1997) Epidermal growth factor (EGF) receptor ligands may play a role in enhancing trefoil activity in the gut;
however, repair of mucosal injury is not dependent in the main endogenous EGF receptor ligand in the gut, TNF-a, suggesting a role of other undiscovered ligands (Cook, G.A., et al., Am. Physiol. Soc., 61540-61549, 1997). For example, the zsig57 polypeptides can serve as such ligand, regulatory protein or other factor in the trefoil pathway, and hence play an important therapeutic role in diseases and injury associated with the gut and mucosal epithelium.
Also, zsig57 polypeptide is expressed in the bone marrow and PBLs and can exert its effects in the vital organs of the body. Activity of zsig57 expressed in PBLs and bone marrow be independent of gastrointestinal function. Thus, zsig57 polypeptide pharmaceutical compositions of the present invention can be useful in prevention or treatment of pancreatic disorders associated with pathological regulation of the expansion of neuroendocrine and exocrine cells in the pancreas, such as IDDM, pancreatic cancer, pathological regulation of blood glucose levels, insulin resistance or digestive function.
The zsig57 polypeptide of the present invention may act in the neuroendocrine/exocrine cell fate decision pathway and is therefore capable of regulating the expansion of neuroendocrine and exocrine cells in the pancreas. One such regulatory use is that of islet cell regeneration. Also, it has been hypothesized that the autoimmunity that triggers IDDM starts in utero, and zsig57 polypeptide is a developmental gene involved in cell partitioning. Assays and animal models are known in the art for monitoring the exocrine/neuroendocrine cell lineage decision, for observing pancreatic cell balance and for evaluating zsig57 polypeptide, fragment, fusion protein, antibody, agonist or antagonist in the prevention or treatment of the conditions set forth above.
Polynucleotides encoding zsig57 polypeptides are useful within gene therapy applications where it is desired to increase or inhibit zsig57 activity. If a mammal has a mutated or absent zsig57 gene, the zsig57 gene can be introduced into the cells of the mammal. In one embodiment, a gene encoding a zsig57 polypeptide is introduced in vivo in a viral vector. Such vectors include an attenuated or defective DNA virus, such as, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses, which entirely or almost entirely lack viral genes, are preferred. A defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that virus will be produced and the vector transferred to other cells via infection. Examples of particular vectors include, but are not limited to, a defective herpes simplex virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as the,vector described by Stratford-Perricaudet et al., _J.
Clin. Invest. 90:626-30, 1992; and a defective adeno-associated virus vector (Samulski et al., J. Virol.
61:3096-101, 1987; Samulski et al., J. Virol. 63:3822-8, 1989) .

In another embodiment, a zsig57 gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,396; Mann et al.
Cell 33:153, 1983; Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
Markowitz et al., J. Virol. 62:1120, 1988; Temin et al., U.S. Patent No. 5,129,263; International Patent Publication No. WO 95/07358, published March 16, 1995 by Dougherty et al.; and Kuo et al., Blood 82:845, 1993.
Alternatively, the vector can be introduced by lipofection in vivo using liposomes. Synthetic cationic lipids can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Felgner et al., Proc. Natl. Acad.
Sci. USA 89:7413-7, 1987; Mackey et al., Proc. Natl. Acad.
Sci. USA 85:8027-31, 1988). The use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. More particularly, directing transfection to particular cells represents one area of benefit. For instance, directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids can be chemically coupled to other molecules for the purpose of targeting. Targeted peptides (e. g., hormones or neurotransmitters), proteins such as antibodies, or non-peptide molecules can be coupled to liposomes chemically.
It is possible to remove the target cells from the body; to introduce the vector as a naked DNA plasmid;
and then to re-implant the transformed cells into the body. This method is particularly useful for bone marrow and PBLs, in which zsig57 is normally expressed. Naked DNA vectors for gene therapy can be introduced into the desired. host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAF dextran, calcium phosphate precipitation, use of a gene gun or use of a DNA vector 5 transporter. See, e.g., Wu et al., J. Biol. Chem.
267:963-7, 1992; Wu et al., J. Biol. Chem. 263:14621-4, 1988.
Alternatively, zsig57 can be used as a receptor for delivering gene therapy or other therapeutic molecules 10 to target cells and tissues. In acting as a transporter, zsig57 can be used to deliver a polynucleotide encoding a polypeptide, or alternatively, a chemotherapeutic agent, to tissues in which it is expressed, for example bone marrow or PBLs, or intestine. For example, a DNA carrier, 15 consisting of an Fab portion of an anti-zsig57 antibody can be constructed to introduce a plasmid that contains a cDNA encoding a functional polypeptide , e.g., a cDNA
encoding a polypeptide of therapeutic interest. The cDNA
encoding a functional polypeptide would generally be 20 selected to provide, upon expression within the cell, a functional polypeptide where a defective or non-functional polypeptide is present. Such an anti-zsig57 antibody, upon binding to the zsig57 molecule on the cell surface will be endocytosed or otherwise transported into the 25 cell, wherein the functional polypeptide is expressed within the cell. See, e.g., Ferkol, T. et al., Am. Soc.
Clin. Invest. 95:493-502, 1995; Ferkol, T. et al., Gene Therapy 3:669-678, 1996. Moreover, chemical moieties can be cross-linked to anti-zsig57 antibodies for chemical 30 delivery to cells in the same manner and used, for example, to deliver chemotherapeutic agents to tumor cells. Coupling of chemicals to antibodies is well known in the art and described herein. As such, this zsig57 therapy delivery system can be used in vivo or ex v.ivo as described above (See, e.g., Wu et al., su ra). In addition, tissues receptive to delivery of such zsig57-mediated therapy include bone marrow, PBLs, and intestine, and other tissues and cells in which zsig57 is normally expressed, or where zsig57 is introduced by methods known in the art.
Antisense methodology can be used to inhibit zsig57 gene transcription, such as to inhibit cell proliferation in vivo. Polynucleotides that are complementary to a segment of a zsig57-encoding polynucleotide (e.g., a polynucleotide as set froth in SEQ
ID N0:1) are designed to bind to zsig57-encoding mRNA and to inhibit translation of such mRNA. Such antisense polynucleotides are used to inhibit expression of zsig57 polypeptide-encoding genes in cell culture or in a subject.
The present invention also provide s reagents which will find use in diagnostic applications. For example, the zsig57 gene, a probe comprising zsig57 DNA or RNA or a subsequence thereof can be used to determine if the zsig57 gene is present on chromosome 6 or if a mutation has occurred. Zsig57 is located at the 6p21.1-p21.2 region of chromosome 6 (see, Example 3). Detectable chromosomal aberrations at the zsig57 gene locus include, but are not limited to, aneuploidy, gene copy number changes, insertions, deletions, restriction site changes and rearrangements. Such aberrations can be detected using polynucleotides of the present invention by employing molecular genetic techniques, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR
techniques, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian, Chest 108:255-65, 1995).

The precise knowledge of a gene's position can be useful for a number of purposes, including: 1) determining if a sequence is part of an existing contig and obtaining additional surrounding genetic sequences in various forms, such as YACs, BACs or cDNA clones; 2) providing a possible candidate gene for an inheritable disease which shows linkage to the same chromosomal region; and 3) cross-referencing model organisms, such as mouse, which can aid in determining what function a particular gene might have.
The zsig57 gene is located within the major histocompatability (MHC) locus, which encodes proteins involved with antigen presentation to T-cells. Proteins and polypeptides are processed and then complexed with MHC
molecules followed by transport to the cell surface for presentation to T-cells. A number of accessory molecules are encoded in the MHC locus that are essential for antigen processing and presentation. For example, TAP
transporters and tapasin function to transport and assemble peptides plus MHC respectively (Herberg, J.A., et al., Eur. J. Immunol., 28:459-467, 1998). In a similar manner, zsig57 polypeptide may be involved in antigen presentation, as a chaparone, transporter, trafficking element, or other processing and presentation function.
Antigen presentation can be measured in standard assays known in the art: for example, antigen presentation for cytotoxic T-cells, such as the chromium release assay (Hosken, N.A., and Bevan, M.J., J. Exp. Med.
175:719-729, 1992); and proliferation and IL-2 production by T-cells in response to antigen presenting cells (Rudensky, A.Y., et al., Nature 353:660-662, 1991;
Roosnek, E., and Lanzavecchia, J. Exp. Med. 173:487-489, 1991 ) .

Mice engineered to express the zsig57 gene, referred to as "transgenic mice," and mice that exhibit a complete absence of zsig57 gene function, referred to as "knackout mice," may also be generated (Snouwaert et al., Science 257:1083, 1992; Lowell et al., Nature 366:740-42, 1993; Capecchi, M.R., Science 249: 1288-1292, 1989;
Palmiter, R.D. et al. Annu Rev Genet. 20: 465-999, 1986) .
For example, transgenic mice that over-express zsig57, either ubiquitously or under a tissue-specific or tissue-restricted promoter can be used to ask whether over-expression causes a phenotype. For example, over-expression of a wild-type zsig57 polypeptide, polypeptide fragment or a mutant thereof may alter normal cellular processes, resulting in a phenotype that identifies a tissue in which zsig57 expression is functionally relevant and may indicate a therapeutic target fox the zsig57, its agonists or antagonists. For example, a preferred transgenic mause to engineer is one that over-expresses the mature zsig57 polypeptide (approximately amino acids 18 (Ile) or residue 16 (Gln) to residue 199 (Gln) of SEQ
ID N0:2). Moreover, such over-expression may result in a phenotype that shows similarity with human diseases.
Similarly, knockout zsig57 mice can be used to determine where zsig57 is absolutely required in vivo. The phenotype of knockout mice is predictive of the in vivo effects of that a zsig57 antagonist, such as those described herein, may have. The human zsig57 cDNA can be used to isolate murine zsig57 mRNA, cDNA and genomic DNA, which are subsequently used to generate knockout mice.
These mice may be employed to study the zsig57 gene and the protein encoded thereby in an in vivo system, and can be used as in vivo models for corresponding human diseases. Moreover, transgenic mice expression of zsig57 antisense polynucleotides or ribozymes directed against zsig57,, described herein, can be used analogously to transgenic mice described above.
For pharmaceutical use, the proteins of the present invention are formulated for parenteral, particularly intravenous or subcutaneous, delivery according to conventional methods. Intravenous administration will be by bolus injection or infusion over a typical period of one to several hours. In general, pharmaceutical formulations will include a zsig57 protein in combination with a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5$ dextrose in water or the like. Formulations can further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to prevent protein loss on vial surfaces, etc.
Methods of formulation are well known in the art and are disclosed, for example, in Remington: The Science and Practice of Pharmacy, Gennaro, ed., Mack Publishing Co., Easton, PA, 19th ed., 1995. Therapeutic doses will generally be in the range of 0.1 to 100 ~,g/kg of patient weight per day, preferably 0.5-20 mg/kg per day, with the exact dose determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose is within the level of ordinary skill in the art. The invention is further illustrated by the following non-limiting examples.

EXAMPLES
Example 1 - Identification of zsi 57 5 A. Using an EST Sequence to Obtain Full-length zsig57 Scanning of translated pancreas, liver, lung and breast library DNA databases using a signal trap as a query resulted in identification of an expressed sequence tag (EST) sequence found to be homologous to a human 10 secretory signal sequence.
Confirmation of the EST sequence was made by sequence analyses of the cDNA from which the EST
originated. This cDNA was contained in a plasmid, and was sequenced using the following primers: ZC976 (SEQ ID
15 N0:4), ZC16,495 (SEQ ID N0:5), ZC 16,494 (SEQ ID N0:6), and ZC 447 (SEQ ID N0:7). The clone appeared to be full length.
Oligonucleotide primers were designed from the sequence of the identified EST. The primers were used for 20 priming internally within the EST to identify tissues from which a full-length clone could be isolated. To obtain a full-length cDNA, a PCR amplification reaction was performed on Marathon-ready cDNA (Clontech) from a variety of tissues: Brain, Liver, placenta, monocytes, bone 25 marrow and spleen. A PCR reaction was run using oligonucleotides ZC 16,174 (SEQ ID N0:8) and ZC 16,175 (SEQ ID N0:9) as primers. This PCR reaction was run as follows : 1 cycle at 94°'.~ for 1 . 5 minutes; 35 cycles at 94°' for 15 seconds, then 62°:' 20 seconds, then 72= for 30 30 seconds; followed by 72°:: for 10 minutes; then a 4°:: hold.
The resulting DNA products were electrophoresed on a 1.5~ agarose gel, and an expected band at approximately 200 by was seen in reactions using the bone marrow, monocyte and spleen cDNA libraries as a template .

The DNA .band from the bone marrow sample was gel purified using a commercially available kit (QiaexIITM; Qiagen) and sequenced. Sequence analyses of the subclone confirmed that the PCR product included the EST DNA sequence.
Example 2 Tissue Distribution Northern blot analysis was performed using Human Multiple Tissue Blots (MTN I, MTN II, and MTN III) (Clontech). The 200 by PCR product from bone marrow, described in Example 1, was purified using a commercially available kit (QiaexIITM; Qiagen) and then radioactively labeled with 32P-dCTP using Prime-It II, a random prime labeling system (Stratagene Cloning Systems), according to the manufacturer's specifications. The probe was then purified using a Nuc-TrapTM column (Stratagene) according to the manufacturer's instructions. ExpressHybTM
(Clontech) solution was used for prehybridization and as a hybridizing solution for the Northern blots.
Hybridization took place overnight at 65' using 5 x 106 cpm/ml of labeled probe. The blots were then washed in 2X
SSC/lo SDS at 65° , followed by a wash in O.1X SSC/0.1°s SDS
at 55°:. A transcript was detected at approximately 1.4 kb in PBLs and bone marrow. A transcript was detected at approximately 2 kb in small intestine. No signals were apparent in other tissues represented on the blots.
Dot Blots were also performed using Human RNA
Master BlotsTM (Clontech). The methods and conditions for the Dot Blots are the same as for the Multiple Tissue Blots disclosed above. Strong signal intensity was present in small intestine, liver and kidney.

Example 3 PCR-Based Chromosomal Ma ping of the zsiq57 Gene Zsig57 was mapped to chromosome 6 using the commercially available "GeneBridge 4 Radiation Hybrid Panel" (Research Genetics, Inc., Huntsville, AL). The GeneBridge 9 Radiation Hybrid Panel contains DNAs from each of 93 radiation hybrid clones, plus two control DNAs (the HFL donor and the A23 recipient). A publicly available WWW server (http://www-genome.wi.mit.edu/cgi-bin/contig/rhmapper.pl) allows mapping relative to the Whitehead Institute/MIT Center for Genome Research's radiation hybrid map of the human genome (the "WICGR"
radiation hybrid map) which was constructed with the GeneBridge 4 Radiation Hybrid Panel.
For the mapping of zsig57 with the "GeneBridge 4 RH Panel", 20 ul reactions were set up in a 96-well microtiter plate (Stratagene, La Jolla, CA) and used in a "RoboCycler Gradient 96" thermal cycler (Stratagene). Each of the 95 PCR reactions consisted of 2 ul lOX KlenTaq PCR
reaction buffer (Clontech Laboratories, Inc., Palo Alto, CA), 1.6 ul dNTPs mix (2.5 mM each, Perkin-Elmer, Foster City, CA), 1 ul sense primer, ZC16,950, (SEQ ID N0:10), 1 ul antisense primer, ZC 16,951 (SEQ ID N0:11), 2 ul "RediLoad" (Research Genetics, Inc., Huntsville, AL), 0.4 ul 50X Advantage KlenTaq Polymerase Mix (Clontech), 25 ng of DNA from an individual hybrid clone or control and ddH20 for a total volume of 20 ul. The reactions were overlaid with an equal amount of mineral oil and sealed.
The PCR cycler conditions were as follows: an initial 1 cycle 5 minute denaturation at 95°C; 35 cycles of a 1 minute denaturation at 95°C, 1 minute annealing at 60°C, and 1.5 minute extension at 72°C; followed by a final 1 cycle extension of 7 minutes at 72°C. The reactions were WO 99/66040 PCT/US99/1133?

separated by electrophoresis on a 2~ agarose gel (Life Technologies).
The results showed that zsig57 maps 2.12 cR 3000 from the framework marker AFM165YD12 on the chromosome 6 WICGR radiation hybrid map. Proximal and distal framework markers were AFM165YD12 and WI-6092, respectively. The use of surrounding markers positions zsig57 in the 6p21.1-p21.2 region on the integrated LDB chromosome 6 map (The Genetic Location Database, University of Southhampton, WWW
server: http://cedar.genetics.soton.ac.uk/public html/).
Example 4 Creation of baculovirus ex ression vectors zSG57NE and zSG57CE
Two expression vectors were prepared to express zsig57 polypeptides in insect cells: zSG57NE, designed to express a zsig57 polypeptide with a N-terminal Glu-Glu tag (SEQ ID N0:12), and zSG57CE designed to express a zsig57 polypeptide with a C-terminal Glu-Glu tag (SEQ ID N0:13).
Recombinant baculovirus stocks were made for each.
Preparation of the baculovirus transfer vectors for ligation Baculovirus expression vectors derived from the transfer vector, pFastBaclT"" (Life Technologies), were prepared as follows. Approximately l0ug of the vector DNA
was digested with BamHI and XbaI (Boerhinger-Mannheim) for 2 hours according to manufacturer's instructions. The entire digest was then subjected to electrophoresis on a 1.25 SeaPlaque Agarose (in 1XTAE) gel. The linearized vector fragment was excised from the gel and gel purified using a commercially available kit (QiaexIITM; Qiagen).
A. Construction of zSG57NE
A zsig57 DNA fragment having a N-terminal Glu-Glu tag was generated by PCR. A 354 by PCR-generated zsig57 DNA fragment was created using ZC17,115 (SEQ ID
N0:14) and ZC17,228 (SEQ ID N0:15) as PCR primers and the plasmid containing zsig57, described in Example 1, as a template. The 100 ~,1 PCR reaction was run as follows: 94°C
for 2 minutes; then 25 cycles of 95°C for 50 seconds, 50°C
for 1 minute, and 72°C for 2 minutes; then 1 cycle at 72°C
for 10 minutes; followed by a 10°C hold. The PCR product was then run on a 1~ agarose/TAE gel confirming the presence of the expected 354 by PCR product.
Approximately 1/2 of the PCR product was digested for 2 h with BamHI and XbaI (Boerhinger-Mannheim) according to manufacturer's instructions, and the digest run on a to SeaPlaque/lo NuSieve agarose gel. The band was excised, diluted to 0.5e agarose with 2 mM MgCl2, melted at 68°C and ligated into a BamHI/XbaI digested baculovirus expression vector described above.
Approximately 30 nanograms of the restriction digested zsig57NE insert and approximately 141 ng of the BamHI/XbaI digested transfer vector were ligated with T9 DNA ligase (New England Biolabs) according to manufacturer's instructions. The ligation reaction was started at 37°C, and immediately transferred to a bucket containing room temperature water and stored overnight at 4°C. The ligation mix was diluted 3 fold in TE (10 mM
Tris-HC1, pH 7.5 and 1 mM EDTA) and subsequently incubated at 70°C for 5 minutes to inactivate the ligase.
Transformation of ligation into Library Efficiency DHSa competent cells Approximately 1 fmol of the diluted ligation mix was transformed into DHSa Library Efficiency competent cells (Gibco-BRL, Gaithersburg, MD) according to manufacturer's direction by heat shock for 45 seconds in a 42°C water bath. The ligated DNA was diluted in 450 ml SOC

media (2~ Bacto Tryptone, 0.5~ Bacto Yeast Extract, 10 ml 1M NaCl, 1.5 mM KCl, 10 mM MgCl2, 10 mM MgS09 and 20 mM
glucose), and the culture shaken at 250 rpm for 1 h at 37°C. Approximately 100 ml of the culture was plated onto 5 LB plates containing 100 mg/ml ampicillin. The plates were incubated overnight at 37oC. 6 colonies (clones) were picked from these plates and 2 ml cultures (LB + 100 mg/ml ampicillin) grown at 37°C overnight, with shaking at 250 rpm. Plasmid DNA was prepared using the QiaVac 10 Miniprep8 system (Qiagen) according the manufacturer's directions. The clones were screened by restriction digest with DraI (Boerhinger-Mannheim).
DNA sequence analysis was used to verify the zsig57NE sequence of the 6 clones. The sequencing primers 15 were ZC16,084 (SEQ ID N0:16) and ZC7,350 (SEQ ID N0:17), which recognize the vector DNA.
Transformation of mini re DNA into Maximum Efficiency DHlObac cells One microliter of each of the zSG57NE plasmid 20 DNAs, described above, was used to independently transform 20 ml DHlOBac MaxTM Efficiency competent cells (Gibco-BRL) according to manufacturer's instruction, by heat shock at 42°C for 45 seconds. The transformants were then diluted in an appropriate volume (180 ~1) of SOC media, incubated 25 for 4 hours at 37°C on a rotator. Volume was increased to 1 ml with SOC and 50 ~,1 plated on to Luria Agar plates containing 50 mg/ml kanamycin, 7 mg/ml gentamycin, 10 mg/ml tetracycline, 40 mg/ml IPTG and 200 mg/ml Bluo GalT"'.
The cells were incubated for 2 to 3 days at 37°C until blue 30 and white colonies were distinguished. This color selection was used to identify those cells containing virus that had incorporated into the plasmid (referred to as a "bacmid"). Those colonies, which were white in color, were picked for analysis.

. Bacmid DNA was isolated from positive colonies from each plate and screened for the correct insert. 2 white colonies from each plate were picked and grown up in 2m1 cultures of 50$ LB, 50% Terrific Broth (TB), 50 ug/ml kanamycin, 7ug/ml gentamycin, l0ug/mL tetracycline. These incubated overnight at 37°C on a rotator. Plasmid DNA was prepared using the QiaVac Miniprep8 system (Qiagen) as described above. The clones were screened by restriction digest with DraI (Boerhinger-Mannheim), as described above. DNA sequence analysis was used to verify the zsig57NE sequences in the "bacmid" clones. Bacmid DNA
from clone zSG57NE(e), having the correct insert, was used to transfect Spodoptera frugiperda (Sf9) cells as described below.
Transfection of Bacmid DNA into SF9 Insect Cells and Production of Recombinant Virus.
Sf9 cells were seeded into a standard 6-well plate, at a density of 9 x 105 cells per 35 mm well, and allowed to attach for 1 h at 27°C. In separate tubes, 5 ~1 of bacmid DNA was diluted with 100 ~1 Sf-900 II SFM
media (Gibco-BRL); and approximately 6 ~tl of CelIFECTINTM
Reagent (Gibco-BRL) was diluted with 100 ~1 Sf-900 II SMF.
The bacmid DNA and lipid solutions were gently mixed and incubated for approximately 45 min. at room temperature, to form a lipid-DNA complex. 0.8 ml of Sf-900 II SFM was then added to the lipid-DNA complex (transfection mixture). The growth media was aspirated from the cells, and the transfection mixture was then applied to the cells and incubated at room temperature, on a rocker, for 2 h, and then at 27°C for 2 additional hours. The transfection mixture was aspirated off of the cells and fresh SF900II
SMF media was applied. The cultures were incubated for 4 days and the media was then harvested (now containing recombinant zSG57NE(e) virus particles) from the cells and stored at 4°C until ready for primary amplification.
Primary Amplification of Recombinant Baculovirus - Sf9 cells were grown in 50 ml Sf-900 II SFM in a 50 ml shake flask to an approximate density of about 5 x 105 cells/ml. They were then transfected with 0.200 ml of the zSG57NE(e) virus stock from above and incubated at 27oC for about 3 days after which time the virus was harvested. Cells were spun down and the supernatant 0.2 micron filtered. The supernatant was stored at 4°C and the pellet was frozen at -20°C.
The cell pellet was thawed and lysed under hypotonic conditions to determine if there was any protein which was: a) produced but staying in the cell (i.e., detergent extractable) or b) insoluble. The Hypotonic Lysis Procedure is as follows: (1) Thaw cell pellets; (2) Add 2.5m1 hypotonic lysis buffer (HLB) to each pellet and resuspend. HLB contains 20 mM Tris-HC1 (pH 8.3), 1 mM
EDTA, 1 mM DTT, 1 mM PefablocT"' (Boerhinger-Mannheim) , 0.5 ~,M aprotinin (Boerhinger-Mannheim), 4 ~M
leupeptin(Boerhinger-Mannheim), 4 ~tM E-64 (Boerhinger-Mannheim), 1~ NP-40 in H20; (3) Transfer 1 ml of the lysate to an Eppendorf tube and mix on rotator for 20 min. at 4oC
(centrifuge and freeze the remaining 1.5 ml lysate); (4) Centrifuge at 10,000 rpm for 10 min. at 4oC, and transfer the supernatant to a new tube. This new tube contains detergent extractable proteins (detergent extractable fraction); (5) Add 1 ml HLB to the pellet and resuspend.
This tube contains insoluble proteins (insoluble fraction).
A Western blot was performed on the following samples: the zSG57NE(e) culture supernatant, the zSG57NE(e) detergent extractable fraction, the zSG57NE(e) insoluble fraction. The antibody, made in house, used for detection was a mouse anti-Glu-Glu, HRP conjugated antibody (3mg/mL), used at a 1:2000 dilution (l.5ug/mL).
90~ of the zSG57NE protein was in the culture supernatant, with very small amounts in the detergent extractable and insoluble fractions.
Titer the recombinant virus in the culture The culture supernatant was titered to determine the number of plaque forming units/ml (pfu/ml). SF9 cells were plated into standard 6 well plates with 2.4m1/well at a cell density of about 5.2 X 105 cells/ml. The cells were allowed to attach to the well for about 30 minutes. The zSG57NE(e) virus stock was diluted 10-9 and 10-6 in lml total volume in SF900II SMF media. The growth media was removed from the cells and the diluted virus stock was added, and incubated on a rocker at room temperature for 3 hours. Meanwhile, a solution of 1.3% Agarose, 0.9X
SF900II SMF media was prepared and allowed to cool to 35°C. After the 3 hour incubation, the diluted virus stock was aspirated from the cells and 2.5m1 of the 35°C
agarose solution was gently overlaid and allowed to harden. These plates were then incubated for 3 days at 27°C.
After 3 days, viral plaques were identified and counted to determine virus titer. About 1 ml of a viable stain solution (0.85 Agarose, 0.02 Neutral Red, and 99.2 SF900 media at 35°C) was overlaid upon each well and allowed to harden. The virus create plaques of lysed cells which do not take up the neutral red, whereas surrounding uninfected cells do. The plates were incubated at 27°C for 3 hours and the plaques were counted. The zSG57NE virus titer was 1.82 X 108 pfu/ml.
B. Construction of ZSG57CE
A zsig57 DNA fragment having a C-terminal Glu-Glu tag was generated by PCR, as described above, using ZC17,116.(SEQ ID N0:18) and ZC17,479 (SEQ ID N0:19) as PCR
primers and the plasmid containing zsig57, described in Example l, as a template. The 100 ~.1 PCR reaction was run as described above. The PCR product was verified on an agarose gel, digested, and gel isolated, as described above. The DNA band was, diluted to 0.5% agarose with 2 mM MgCl2, melted at 68°C and ligated into a BamHI/XbaI
digested baculovirus expression vector, described above.
Approximately 49 nanograms of the restriction digested zsig57CE insert and approximately 229 ng of the BamHI/XbaI
digested transfer vector were ligated as described above.
DHSa, transformation was performed, as described above. 5 colonies (clones) were picked and plasmid DNA
was prepared as described above The clones were screened as described above. DNA sequence analysis, as described above, was used to verify the zsig57CE sequence of the 5 clones.
DHlObac transformation was performed as described above. Bacmid DNA from clone zSG57CE(c), having the correct insert, was used to transfect Spodoptera frugiperda (Sf9) cells as described above.
Amplification, hypotonic lysis, Western blot and titer of zSG57CE(c) virus stock was performed as described above. A Western blot, using the antibody described above, showed no apparent zSG57CE protein in the cell supernatant, about 10$ of the zSG57CE protein in the detergent extractable fraction, and about 90g of the zSG57CE protein in the insoluble fractions.
The zSG57CE virus titer was 6.6 X 10' pfu/ml.

Example 5 Construction of zsig57 Amino Terminal Glu-Glu Ta gqed and Carboxy Terminal Glu-Glu Ta ed Yeast Expression Vectors Expression of zsig57 in Pichia methanolica utilizes the expression system described in co-assigned WIPO publication WO 97/17450. An expression plasmid containing all or part of a polynucleotide encoding zsig57 was constructed via homologous recombination. An expression vector was built from pCZR204 to express N-terminal (NEE) and C-terminal (CEE) Glu-Glu-tagged zsig57 polypeptides.
The pCZR204 vector contains the AUG1 promoter, followed by the aFpp leader sequence, N-terminal peptide tag (Glu-Glu), followed by a blunt-ended SmaT restriction site, a carboxy-terminal peptide tag (Glu-Glu), a translational stop codon, followed by the AUG1 terminator, the ADE2 selectable marker, and finally the AUG1 3' untranslated region. Also included in this vector are the URA3 and CEN-ARS sequences required for selection and replication in S. cerevisiae, and the AmpR and colEl on sequences required for selection and replication in E.
coli. The zsig57 sequence inserted into these vectors begins at residue 16 (Gln) of the zsig57 amino acid sequence (SEQ ID N0:2).
For each construct a PCR-generated zsig57 fragment containing either NEE or CEE tag was prepared as described below, and were homologously recombined into the yeast expression vectors described above.
AConstruction of the NEE-to ed-Zsi 57 plasmid An NEE-tagged-zsig57 plasmid was made by homologously recombining 100 ng of the SmaI-digested pCZR204 acceptor vector, and 1 ~.g of NEE-zsig57 DNA donor fragment, described below, in S. cerevisiae.

. The NEE-zsig57 donor fragment was synthesized by a PCR reaction. To a final reaction volume of 100 ~1 was added 100 pmol of each primer ZC17, 019 (SEQ ID N0:20) and ZC17,021 (SEQ ID N0:21), approximately 10 pmol template DNA (plasmid from Example 1), and 10 ~,1 of lOX PCR buffer (Boerhinger Mannheim), 1 ~,1 Pwo Polymerase (Boerhinger Mannheim), 10 ~1 of 0.25 mM nucleotide triphosphate mix (Perkin Elmer) and dH20 to 100 ul. The PCR reaction was run as follows: 30 cycles at 94°C for 30 seconds, 50°C for 1 minute, and 72°C for 1 minute; followed by 1 cycle at 72°C for 6 minutes. The resulting 420 by double stranded, NEE-tagged zsig57 fragment is disclosed in SEQ ID N0:22.
B. Construction of the CEE-zsig57 lasmid An CEE-tagged-zsig57 plasmid was made by homologously recombining 100 ng of the SmaI-digested pCZR204 acceptor vector, and 1 ~,g of zsig57-CEE DNA donor fragment, described below, in S. cerevisiae.
The zsig57-CEE donor fragment was made via a PCR
reaction, as described above, using oligonucleotides ZC17,022 (SEQ ID N0:23) and ZC17,020 (SEQ ID N0:24). The resulting 420 by double stranded, zsig57-CEE fragment is disclosed in SEQ ID N0:25.
One hundred microliters of competent yeast cells (S. cerevisiae) was independently combined with 10 ~l of the various DNA mixtures from above and transferred to a 0.2 cm electroporation cuvette. The yeast/DNA mixtures were electropulsed at 0.75 kV (5 kV/cm), o0 ohms, 25 uF.
To each cuvette was added 600 ul of 1.2 M sorbitol and the yeast was plated in two 300 ul aliquots onto two URA D
plates and incubated at 30°C.
After about 48 hours the Ura+ yeast transformants from a single plate were resuspended in 2.5 ml H20 and spun briefly to pellet the yeast cells. The cell pellet was resuspended in 1 ml of lysis buffer (2%
Triton X-100, l~ SDS, 100 mM NaCl, 10 mM Tris, pH 8.0, 1 mM EDTA). Five hundred microliters of the lysis mixture was added to an Eppendorf tube containing 300 ul acid washed glass beads and 200 ul phenol-chloroform, vortexed for 1 minute intervals two or three times, followed by a 5 minute spin in a Eppendorf centrifuge as maximum speed.
Three hundred microliters of the aqueous phase was transferred to a fresh tube and the DNA precipitated with 600 ul ethanol (EtOH), followed by centrifugation for 10 minutes at 4°C. The DNA pellet was resuspended in 100 ul H20.
Transformation of electrocompetent DH10B E. coli cells (Gibco BRL) was done with 0.5-2 ml yeast DNA prep and 40 ~tl of DH10B cells. The cells were electropulsed at 2.0 kV, 25 ~,F and 400 ohms. Following electroporation, 1 ml SOC (2~S BactoT'" Tryptone (Difco, Detroit, MI), 0.5$
yeast extract (Difco), 10 mM NaCl, 2.5 mM KC1, 10 mM MgCl2, 10 mM MgS09, 20 mM glucose) was plated in 250 ul aliquots on four LB AMP plates (LB broth (Lennox), 1.8$ BactoTM Agar (Difco), 100 mg/L Ampicillin).
Individual clones harboring the correct expression construct for both NEE and CEE tagged zsig57 were identified by restriction digest with EcoRI
(Boerhinger-Mannheim) to verify the presence of the zsig57 insert and to confirm that the various DNA sequences had been joined correctly to one another. The DNA from clones with correct inserts were subjected to sequence analysis to verify the sequence of the NEE-zsig57 and zsig57-CEE
constructs. Larger scale plasmid DNA was isolated using the QiagenTM Maxi kit (Qiagen) according to manufacturer's instruction and the DNA was digested with Not I to liberate the Pichia-zsig57 expression cassette from the remaining vector. The Not I-restriction digested DNA

fragment, was then transformed into the Pichia methanolica expression host, PMAD16. This was done by mixing 100 ~l of prepared competent PMAD16 cells with 10 ~g of Not I
restriction digested zsig57 and transferred to a 0.2 cm electroporation cuvette. The yeast/DNA mixture was electropulsed at 0.75 kV, 25 ~F, infinite ohms. To the cuvette was added 1 ml of 1X Yeast Nitrogen Base and 500 ml aliquots were plated onto two ADE DS (0.0560 -Ade -Trp -Thr powder, 0.670 yeast nitrogen base without amino acids, 2% D-glucose, 0.5~ 200X tryptophan, threonine solution, and 18.22% D-sorbitol) plates for selection and incubated at 30°C. The transformed yeast cells were plated on ADE DS plates for selection. Clones were picked and screened via Western blot for high-level zsig57 expression and subjected to fermentation. These isolated clones are considered cloned yeast strains, which express the NEE-and CEE-tagged zsig57 polypeptides disclosed herein. The resulting NEE-tagged-zsig57 strain was designated PMADI6::pSDH125.1.8 and PMADI6::pSDH125.1.13 and the CEE-tagged-zsig57 plasmid containing strain was designated PMADI6::pSDH126.2.19 and PMADI6::pSDH126.2.29.
Example 6 Generation of untag ed zsig57 Recombinant Adenovirus A. Preparation of DNA construct for eneration of Adenovirus The protein coding region of zsig57 was amplified by PCR using primers that added FseI and AscI
restriction sties at the 5' and 3' termini respectively.
PCR primers ZC17529 (SEQ ID N0:26) and ZC17530 (SEQ ID
N0:27) were used with template plasmid containing the full-length zsig57 cDNA (Example 1) in a PCR reaction as follows: one cycle at 95°C for 5 minutes; followed by 15 cycles at 95°C for 1 min., 58°C for 1 min., and 72°C for 1 . 0 min.,; followed by 72°C for 7 min. ; followed by a 9°C
soak. The PCR reaction product was loaded onto a 1.2 (low melt) SeaPlaque GTG (FMC, Rockland, ME) gel in TAE
buffer. The zsig57 PCR product was excised from the gel and purified using the QIAquickT"" PCR Purification Kit gel cleanup kit(Qiagen) as per kit instructions. The PCR
product was then digested with FseI-AscI, phenol/chloroform extracted, EtOH precipitated, and rehydrated in 20m1 TE (Tris/EDTA pH 8). The 600 by zsig57 fragment was then ligated into the FseI-AscI sites of the transgenic vector pMTl2-8 (See, Example 8) and transformed into DH10B competent cells by electroporation. Clones containing zsig57 were identified by plasmid DNA miniprep followed by digestion with FseI-AscI. A positive clone was sent to the sequencing department to insure there are no deletions or other anomalies in the construct. The sequence of zsig57 cDNA was confirmed. Qiagen Maxi Prep protocol (Qiagen) is used to generate DNA to continue our process described below.
The 600 by zsig57 cDNA was released from the TG12-8 vector using FseI and AscI enzymes. The cDNA was isolated on a 1~ low melt SeaPlaque GTGT"" (FMC, Rockland, ME) gel and was then excised from the gel and the gel slice melted at 70°C, extracted twice with an equal volume of Tris buffered phenol, and EtOH precipitated. The DNA
was resuspended in 101 H20.
The zsig57 cDNA was cloned into the FseI-AscI
sites of pAdTrack CMV (He, T-C. et al., PNAS _95:2509-2514, 1998) in which the native polylinker was replaced with FseI, EcoRV, and AscI sites. Ligation was performed using the Fast-LinkT"' DNA ligation and screening kit (Epicentre Technologies, Madison, WI). In order to linearize the plasmid, approximately 5 ~g of the pAdTrack CMV zsig57 plasmid was digested with PmeI. Approximately 1 ~g of the lineariz.ed plasmid was cotransformed with 200ng of supercoiled pAdEasy (He et al., su ra.) into BJ5183 cells.
The co-transformation was done using a Bio-Rad Gene Pulser at 2.5kV, 200 ohms and 25mFa. The entire co-y transformation was plated on 4 LB plates containing 25 ~g/ml kanamycin. The smallest colonies were picked and expanded in LB/kanamycin and recombinant adenovirus DNA
identified by standard DNA miniprep procedures. Digestion of the recombinant adenovirus DNA with FseI-AscI confirmed the presence of zsig57. The recombinant adenovirus miniprep DNA was transformed into DH10B competent cells and DNA prepared using a Qiagen maxi prep kit as per kit instructions.
B. Transfection of 293a Cells with Recombinant DNA
Approximately 5 ~tg of recombinant adenoviral DNA
was digested with Pacl enzyme (New England Biolabs) for 3 hours at 37°C in a reaction volume of 100 ~tl containing 20-30U of PacI. The digested DNA was extracted twice with an equal volume of phenol/chloroform and precipitated with ethanol. The DNA pellet was resuspended in 101 distilled water. A T25 flask of QBI-293A cells (Quantum Biotechnologies, Inc. Montreal, Qc. Canada), inoculated the day before and grown to 60-70% confluence, were transfected with the PacI digested DNA. The PacI-digested DNA was diluted up to a total volume of 50u1 with sterile HBS (150mM NaCl, 20mM HEPES). In a separate tube, 20 ~1 DOTAP (Boehringer Mannheim, lmg/ml) was diluted to a total volume of 100~t1 with HBS. The DNA was added to the DOTAP, mixed gently by pipeting up and down, and left at room temperature for 15 minutes. The media was removed from the 293A cells and washed with 5 ml serum-free MEMalpha (Gibco BRL) containing 1mM Sodium Pyruvate (GibcoBRL), 0.1 mM MEM non-essential amino acids (GibcoBRL) and 25mM HEPES
buffer (GibcoBRL). 5 ml of serum-free MEM was added to the 293A.cells and held at 37°C. The DNA/lipid mixture was added drop-wise to the T25 flask of 293A cells, mixed gently and incubated at 37°C for 4 hours . After 4 h the media containing the DNA/lipid mixture was aspirated off and replaced with 5 ml complete MEM containing 5o fetal bovine serum. The transfected cells were monitored for Green Fluorescent Protein (GFP) expression and formation of foci, i.e., viral plaques.
Seven days after transfection of 293A cells with the recombinant adenoviral DNA, the cells expressed the GFP protein and started to form foci. These foci are viral "plaques" and the crude viral lysate was collected by using a cell scraper to detach all of the 293A cells.
The lysate was transferred to a 50m1 conical tube. To release most of the virus particles from the cells, three freeze/thaw cycles were done in a dry ice/ethanol bath and a 37° waterbath.
C. Amplification of Recombinant Adenovirus (rAdV) The crude lysate was amplified (Primary (1°) amplification) to obtain a working "stock" of zsig57 rAdV
lysate. Ten lOcm plates of nearly confluent (80-900) 293A
cells were set up 20 hours previously, 200m1 of crude rAdV
lysate added to each lOcm plate and monitored for 48 to 72 hours looking for CPE under the white light microscope and expression of GFP under the fluorescent microscope. When all of the 293A cells showed CPE (Cytopathic Effect) this 1° stock lysate was collected and freeze/thaw cycles performed as described under Crude rAdV Lysate.
Secondary (2°) Amplification of zsig57 rAdV was obtained as follows: Twenty l5cm tissue culture dishes of 293A cells were prepared so that the cells were 80-900 confluent. All but 20 mls of SoMEM media was removed and each dish was inoculated with 300-500m1 1° amplified rAdv lysate. After 48 hours the 293A cells were lysed from virus production and this lysate was collected into 250 ml polypropylene centrifuge bottles and the rAdV purified.
D. AdV/cDNA Purification NP-40 detergent was added to a final concentration of 0.5~ to the bottles of crude lysate in order to lyse all cells. Bottles were placed on a rotating platform for 10 min. agitating as fast as possible without the bottles falling over. The debris was pelleted by centrifugation at 20,000 X G for 15 minutes.
The supernatant was transferred to 250 ml polycarbonate centrifuge bottles and 0.5 volumes of 20~PEG8000/2.5M NaCl solution added. The bottles were shaken overnight on ice.
The bottles were centrifuged at 20,000 X G for 15 minutes and supernatant discarded into a bleach solution. The white precipitate in two vertical lines along the wall of the bottle on either side of the spin mark is the precipitated virus/PEG. Using a sterile cell scraper, the precipitate from 2 bottles was resuspended in 2.5 ml PBS.
The virus solution was placed in 2 ml microcentrifuge tubes and centrifuged at 19,000 X G in the microfuge for 10 minutes to remove any additional cell debris. The supernatant from the 2ml microcentrifuge tubes was transferred into a 15m1 polypropylene snapcap tube and adjusted to a density of 1.39g/ml with cesium chloride (CsCl). The volume of the virus solution was estimated and 0.55 g/ml of CsCl added. The CsCl was dissolved and 1 ml of this solution weighed 1.39 g. The solution was transferred polycarbonate thick-walled centrifuge tubes 3.2m1 (Beckman #362305) and spin at 80,OOOrpm (348,000 X
G) for 3-4 hours at 25°C in a Beckman Optima TLX
microultracentrifuge with the TLA-100.4 rotor. The virus formed a white band. Using wide-bore pipette tips, the virus band was collected.

The virus from the gradient has a large amount of CsCl which must be removed before it can be used on cells. Pharmacia PD-10 columns prepacked with Sephadex G-25M (Pharmacia) were used to desalt the virus preparation.
The column was equilibrated with 20 ml of PBS. The virus was loaded and allowed it to run into the column. 5 ml of PBS was added to the column and fractions of 8-10 drops collected. The optical densities of 1:50 dilutions of each fraction was determined at 260 nm on a spectrophotometer. A clear absorbance peak was present between fractions 7-12. These fractions were pooled and the optical density (OD) of a 1:25 dilution determined. A
formula is used to convert OD into virus concentration:
(OD at 260nm) (25) (1.1 x 1012) - virions/ml. The OD of a 1:25 dilution of the zsig57 rAdV was 0.114, giving a virus concentration of 3.1 X 1012 virions/ml.
To store the virus, glycerol was added to the purified virus to a final concentration of 15~, mixed gently but effectively, and stored in aliquots at -80°G.
E. Tissue Culture Infectious Dose at 50o CPE (TCID 50) Viral Titration Assay A protocol developed by Quantum Biotechnologies, Inc. (Montreal, Qc. Canada) was followed to measure recombinant virus infectivity. Briefly, two 96-well tissue culture plates were seeded with 1X10° 293A cells per well in MEM containing 2$ fetal bovine serum for each recombinant virus to be assayed. After 24 hours 20-fold dilutions of each virus from 1X10 2 to 1X10 19 were made in MEM containing 2$ fetal bovine serum. 100,1 of each dilution was placed in each of 20 wells . After 5 days at 37°C, wells were read either positive or negative for Cytopathic Effect (CPE) and a value for "Plaque Forming Units/ml" (PFU) is calculated.

TCIDSO formulation used was as per Quantum Biotechnologies, Inc., above. The titer (T) is determined from a plate where virus used is diluted from 10 2 to 10-14, and read 5 days after the infection. At each dilution a ratio (R) of positive wells for CPE per the total number of wells is determined.
To Calculate titer of the undiluted virus sample: the factor, "F" = 1+d(S-0.5); where "S" is the sum of the ratios (R); and "d" is LoglO of the dilution series, for example, "d" is equal to 1 for a ten-fold dilution series. The titer of the undiluted sample is T =
10 ~1+F~ _ TCIDSO/ml . To convert T~IDso/ml to pfu/ml, 0 . 7 is subtracted from the exponent in the calculation for titer (T) .
The zsig57 adenovirus had a titer of 5.6 X 109 pfu/ml.
Example 7 Purification of zsig57 CEE and NEE from pichia methanolica conditioned medium A. Purification of zsicr57 CEE from baculovirus-infected Sf9 cell media.
Unless otherwise noted, all operations were carried out at 4°C. A mixture of protease inhibitors was added to a 3000 ml sample of conditioned media from pichia cultures (Example 5) to final concentrations of 2.5 mM
ethylenediaminetetraacetic acid (EDTA, Sigma Chemical Co.
St. Louis, MO), 0.001 mM leupeptin (Boehringer-Mannheim, Indianapolis, IN), 0.001 mM pepstatin (Boehringer-Mannheim) and 0.4 mM Pefabloc (Boehringer-Mannheim).
The pH of the media was adjusted to 7.2 with a concentrated solution of NaOH (Sigma Chemical Co., St.
Louis) following the addition of potassium phosphate (Sigma Chemical Co.) to a final concentration of 0.05M.
The sample was centrifuged at 18,000 x g for 30 min at 4°C

in a Beckman JLA-10.5 rotor (Beckman Instruments, Palo Alto, CA) in a Beckman Avanti J25I centrifuge (Beckman Instruments) to remove cell debris. To the supernatant fraction was added a 50.0 ml sample of anti-EE Sepharose, prepared as described below, and the mixture was gently agitated on a Wheaton (Millville, NJ) roller culture apparatus for 18.0 h at 4°C.
The mixture was then poured into a 5.0 x 20.0 cm Econo-Column (Bio-Rad, Laboratories, Hercules, CA) and the gel was washed with 30 column volumes of phosphate buffered saline (PBS). The unretained flow-through fraction was discarded. Once the absorbence of the effluent at 280 nM was less than 0.05, the flow through the column was reduced to zero and the anti-EE Sepharose gel was eluted batchwise with 2.0 column volumes of PBS
containing 0.4 mg/ml of EE peptide (AnaSpec, San Jose, CA). The EE peptide used for bothe CEE and NEE zsig57 constructs has the sequence GluTyrMetProValAsp (SEQ ID
N0:28). After 1.0 h at 4°C, flow was resumed and the eluted protein was collected. This fraction was referred to as the peptide elution fraction. The anti-EE Sepharose gel was then washed with 2.0 column volumes of O.1M
glycine, pH 2.5, and the glycine wash was collected separately. The pH of the glycine-eluted fraction was adjusted to 7.0 by the addition of a small volume of lOX
PBS and stored at 4°C for future analysis if needed.
The peptide elution fraction was concentrated to 5.0 ml using a 3,000 molecular weight cutoff membrane concentrator (Millipore, Bedford, MA) according to the manufacturer's instructions. The pure zsig57 NEE or CEE
protein in the peptide elution fraction was separated from contaminating free peptide by chromatography of the peptide elution fraction on a 1.5 x 50 cm Sephadex G-50 (Pharmacia, Piscataway, NJ) column equilibrated in PBS at a flow rate of 1.0 ml/min using a BioCad Sprint HPLC
(PerSeptive BioSystems, Framingham, MA). Two-ml fractions were collected and the absorbance at 280 nM was monitored.

The first peak of material absorbing at 280 nM and eluting near the void volume of the column was collected. This fraction was pure zsig57 NEE or zsig57 CEE. The pure material was concentrated as described above, analyzed by SDS-PAGE and Western blotting with anti-EE antibodies, and samples were taken for amino acid analysis and N-terminal sequencing. The remainder of the sample was aliquoted, and stored at -80°C according to our standard procedures.
The protein concentration of the purified zsig57 NEE was 0.5 mg/ml and that of zsig57 CEE was 0.46 mg/ml.
On Coomassie Blue-stained SDS-PAGE gels, the zsig57 NEE preparation contained one major band of apparent molecular weight 14,000. The mobility of this band was the same in the presence and absence of reducing agents and was visible on western blots with anti-EE
antibodies. The zsig57 CEE purified protein also showed one major band at 14,000 Da on Coomassie-Blue stained SDS-PAGE gels. Western blotting with anti-EE antibodies showed one major band of cross-reactive material at 14,000 Da. The mobility of the 14,000 Da band on western blots was not changed by the presence or absence of reducing agents.
B. Purification of zsiq57 NEE from baculovirus-infected Sf9 cell media.
Unless otherwise noted, all operations were carried out at 4°C. A mixture of protease inhibitors was added to a 2000 ml sample of conditioned media from baculovirus-infected Sf9 cells (Example 4) to final concentrations of 2.5 mM ethylenediaminetetraacetic acid (EDTA, Sigma Chemical Co. St. Louis, MO), 0.001 mM
leupeptin (Boehringer-Mannheim, Indianapolis, IN), 0.001 mM pepstatin (Boehringer-Mannheim) and 0.4 mM Pefabloc (Boehringer-Mannheim). The sample was centrifuged at 10,000 rpm for 30 min at 4°C in a Beckman JLA-10.5 rotor (Beckman Instruments, Palo Alto, CA) in a Beckman Avanti J25I centrifuge (Beckman Instruments) to remove cell debris. To the supernatant fraction was added a 50.0 ml sample of anti-EE Sepharose (prepared as described below), and the mixture was gently agitated on a Wheaton (Millville, NJ) roller culture apparatus for 18.0 h at 4°C. The mixture was then processed as described above for zsig57 NEE from Pichia methanolica. The pure material was concentrated as described above, analyzed by SDS-PAGE and Western blotting with anti-EE antibodies, and samples were taken for amino acid analysis and N-terminal sequencing.
The remainder of the sample was aliquoted, and stored at -80°C according to our standard procedures. The concentration of the purified zsig57 NEE was 0.3 mg/ml.
Electrophoresis on SDS-PAGE gels in the absence of reducing agents showed two Coomassie Blue stained bands of apparent molecular weights 14,000 and 28,000. Each of these bands showed cross-reactivity on western blots with anti-EE IgG. In the presence of reducing agents, in contrast, only one Coomassie Blue-stained band of 14,000 Da was observed and this band was the only protein that showed cross-reactivity with anti-EE antibodies on Western blots.
C. Preparation of anti-EE IctG Sepharose A 100 ml bed volume of protein G-Sepharose (Pharmacia, Piscataway, NJ) was washed 3 times with 100 ml of PBS containing 0.02% sodium azide using a 500 ml Nalgene 0.45 micron filter unit. The gel was washed with 6.0 volumes of 200 mM triethanolamine, pH 8.2 (TEA, Sigma, St. Louis, MO). and an equal volume of EE antibody solution containing 900 mg of antibody was added. After an overnight incubation at 4°C, unbound antibody was removed by washing the resin with 5 volumes of 200 mM TEA
as described above. The resin was resuspended in 2 volumes of TEA, transferred to a suitable container, and dimethylpimilimidate-2HC1 (Pierce, Rockford, IL), dissolved in TEA, was added to a final concentration of 36 mg/ml of gel. The gel was rocked at room temperature for min and the liquid was removed using the filter unit as described above. Nonspecific sites on the gel were then blocked by incubating for 10 min at room temperature with volumes of 20 mM ethanolamine in 200 mM TEA. The gel was then washed with 5 volumes of PBS containing 0.02%
sodium azide and stored in this solution at 4°C.

Example 8 Construct for generating zsig57 Transgenic Mice Oligonucleotides were designed to generate a PCR
fragment containing a consensus Kozak sequence and the exact zsig57 coding region. These oligonucleotides were designed with an FseI site at the 5' end and an AscI site at the 3' end to facilitate cloning into pMTl2-8, our standard transgenic vector. PMT12-8 contains the mouse MT-1 promoter and a 5' rat insulin II intron upstream of the FseI site.
PCR reactions were carried out with 200 ng zsig57 plasmid template (Example 1) and oligonucleotides ZC17,529 (SEQ ID N0:26) and ZC17,530 (SEQ ID N0:27) as primers. PCR reaction conditions were as follows: 95°C for 5 minutes, wherein Advantage~ cDNA polymerase (Clontech) was added; 15 cycles of 95°C for 60 seconds, 62°C for 60 seconds, and 72°C for 90 seconds; and 72°C for 7 minutes.
PCR products were separated by agarose gel electrophoresis and purified using a QiaQuickT"" (Qiagen) gel extraction kit. The isolated, 599 bp, DNA fragment was digested with FseI and AscI (Boerhinger-Mannheim), ethanol precipitated and ligated into pMTl2-8 that was previously digested with FseI and AscI. The pMTl2-8 plasmid, designed for expression of a gene of interest in transgenic mice, contains an expression cassette flanked by 10 kb of MT-1 5' DNA and 7 kb of MT-1 3' DNA. The expression cassette comprises the MT-1 promoter, the rat insulin II intron, a polylinker for the insertion of the desired clone, and the human growth hormone poly A sequence.

About one microliter of the ligation reaction was electroporated into DH10B ElectroMaxT"" competent cells (GIBCO BRL, Gaithersburg, MD) according to manufacturer's - direction and plated onto LB plates containing 100 ~g/ml ampicillin, and incubated overnight. Colonies were picked and grown in LB media containing 100 ~g/ml ampicillin.
Miniprep DNA was prepared from the picked clones and screened for the zsig57 insert by restriction digestion with EcoRI, and subsequent agarose gel electrophoresis.
Maxipreps of the correct pMT-zsig57 construct were performed. A SalI fragment containing with 5' and 3' flanking sequences, the MT-1 promoter, the rat insulin II
intron, zsig57 cDNA and the human growth hormone poly A
sequence was prepared to be used for microinjection into fertilized murine oocytes.
From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

WO 99/b6040 PCT/US99/1133?

SEQUENCE LISTING
- <110> ZymoGenetics, Inc, 1201 Eastlake Avenue East Seattle. Washington 98102 United States of America <120> IMMUNDMODULATOR POLYPEPTIDE, ZSIG57 <130> 98-23PC
<150> 09/099.600 <151> 1998-06-18 <160> 30 <170> FastSEQ for Windows Version 3.0 <210>1 <211>1218 <212>DNA

<213>Homo Sapiens <220>
<221> CDS
<222> (64)...(660) <400> 1 gaattcggct cgagtgcatc agtgcccagg caagcccagg agttgacatt tctctgccca 60 gcc atg ggc ctc acc ctg ctc ttg ctg ctg ctc ctg gga cta gaa ggt 108 Met Gly Leu Thr Leu Leu Leu Leu Leu Leu Leu Gly Leu Glu Gly cag ggc ata gtt ggc agc ctc cct gag gtg ctg cag gca ccc gtg gga 156 Gln Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly agc tcc att ctg gtg cag tgc cac tac agg ctc cag gat gtc aaa get 204 Ser Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala cag aag gtg tgg tgc cgg ttc ttg ccg gag ggg tgc cag ccc ctg gtg 252 Gln Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val tcc tca get gtg gat cgc aga get cca gcg ggc agg cgt acg ttt ctc 300 Ser Ser Ala Val Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu aca gac ctg ggt ggg ggc ctg ctg cag gtg gaa atg gtt acc ctg cag 348 Thr Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln gaa gag gat get ggc gag tat ggc tgc atg gtg gat ggg gcc agg ggg 396 Glu Glu Asp Ala Gly Glu Tyr Gly Cys Met Val Asp Gly Ala Arg Gly ccc cag att ttg cac aga gtc tct ctg aac ata ctg ccc cca gag gaa 444 Pro Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu Glu gaa gaa gag acc cat aag att ggc agt ctg get gag aac gca ttc tca 492 Glu Glu Glu Thr Nis Lys Ile Gly Ser Leu Ala Glu Asn Ala Phe Ser gac cct gca ggc agt gcc aac cct ttg gaa ccc agc cag gat gag aag 540 Asp Pro Ala Gly Ser Ala Asn Pro Leu Glu Pro Ser Gln Asp Glu Lys agc atc ccc ttg atc tgg ggt get gtg ctc ctg gta ggt ctg ctg gtg 588 Ser Ile Pro Leu Ile Trp Gly Ala Val Leu Leu Val Gly Leu Leu Val gca gcg gtg gtg ctg ttt get gtg atg gcc aag agg aaa caa gaa tcc 636 Ala Ala Val Val Leu Phe Ala Ual Met Ala Lys Arg Lys Gln Glu Ser ctc ctc agt ggt cca cca cgt cag tgactctgga ccggctgctg aattgccttt 690 Leu Leu Ser Gly Pro Pro Arg Gln ggatgtaccacacattaggcttgactcaccaccttcatttgacaataccacctacaccag750 cctacctcttgattccccatcaggaaaaccttcactcccagctccatcctcattgccccc810 tctacctcctaaggtcctggtctgctccaagcctgtgacatatgccacagtaatcttccc870 gggagggaacaagggtggagggacctcgtgtgggccagcccagaatccacctaacaatca930 gactccatccagctaagctgctcatcacactttaaactcatgaggaccatccctaggggt990 tctgtgcatccatccagccagctcatgccctaggatccttaggatatctgagcaaccagg1050 gactttaagatctaatccaatgtcctaactttactagggaaagtgacgctcagacatgac1110 tgagatgtct tggggaagac ctccctgcac ccaactcccc cactggttct tctaccatta 1170 cacactgggc taaataaacc ctaataatga tgtgcaaaaa aaaaaaaa 1218 <210>2 <211>199 <212>PRT

<213>Homo sapiens <400> 2 Met Gly Leu Thr Leu Leu Leu Leu Leu Leu Leu Gly Leu Glu Gly Gln Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly Ser Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala Gln Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val Ser Ser Ala Ual Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu Thr Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln Glu Glu Asp Ala Gly Glu Tyr Gly Cys Met Ual Asp Gly Ala Arg Gly Pro Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu Glu Glu Glu Glu Thr His Lys Ile Gly Ser Leu Ala Glu Asn Ala Phe Ser Asp Pro Ala Gly Ser Ala Asn Pro Leu Glu Pro Ser Gln Asp Glu Lys Ser Ile Pro Leu Ile Trp Gly Ala Val Leu Leu Ual Gly Leu Leu Val Ala Ala Val Ual Leu Phe Ala Val Met Ala Lys Arg Lys Gln Glu Ser Leu Leu Ser Gly Pro Pro Arg Gln <210> 3 <211> 597 <212> DNA
<213> Artificial Sequence <220>
<223> Degenerate polynucleotide sequence for zsig57 <221> misc feature WO 99/66040 PC'f/US99/11337 <222> (I)...(597) <223> n = A,T,C or G
<400>

atgggnytnacnytnytnytnytnytnytnytnggnytngarggncarggnathgtnggn60 wsnytnccngargtnytncargcnccngtnggnwsnwsnathytngtncartgycaytay120 mgnytncargaygtnaargcncaraargtntggtgymgnttyytnccngarggntgycar180 ccnytngtnwsnwsngcngtngaymgnmgngcnccngcnggnmgnmgnacnttyytnacn240 gayytnggnggnggnytnytncargtngaratggtnacnytncargargargaygcnggn300 gartayggntgyatggtngayggngcnmgnggnccncarathytncaymgngtnwsnytn360 aayathytnccnccngargargargargaracncayaarathggnwsnytngcngaraay420 gcnttywsngayccngcnggnwsngcnaayccnytngarccnwsncargaygaraarwsn480 athccnytnathtggggngcngtnytnytngtnggnytnytngtngcngcngtngtnytn540 ttygcngtnatggcnaarmgnaarcargarwsnytnytnwsnggnccnccnmgncar 597 <210> 4 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC976 <400> 4 cgttgtaaaa cgacggcc 18 <210> 5 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16495 <400> 5 caggcgtacg tttctcacag 20 <210> 6 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16494 <400> 6~
ggtttattta gcccagtgtg 20 <210> 7 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC447 <400> 7 taacaatttc acacagg 17 <210> 8 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16174 <400> 8 aagaaccggc accacacctt ct 22 <210> 9 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16175 <400> 9 ggcaagccca ggagttgaca tt 22 <210> 10 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16950 <400> 10 aggcgtacgt ttctcaca lg <210> 11 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16951 <400> 11 ctcgccagca tcctcttc lg <210> 12 <211> 138 <212> PRT
<213> Artificial Sequence <220>
<223> Zsig57 polypeptide with N-terminal Glu-Glu tag <400> 12 Met Thr Ile Leu Cys Trp Leu Ala Leu Leu Ser Thr Leu Thr Ala Val 1_ 5 10 15 Asn Ala Gly Glu Tyr Met Pro Met Glu Gly Ser Gln Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly Ser Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala Gln Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val Ser Ser Ala Val Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu Thr Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln Glu Glu Asp Ala Gly Glu Tyr Gly Cys Met Val Asp Gly Ala Arg Gly Pro Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu <210> 13 <211> 134 <212> PRT
<213> Artificial Sequence <220>
<223> zsig57 polypeptide with C-terminal Glu-Glu tag <400> 13 Met Gly Leu Thr Leu Leu Leu Leu Leu Leu Leu Gly Leu Glu Gly Gln Gly Ile Val Gly Ser Leu Pro Glu Val Leu Gln Ala Pro Val Gly Ser Ser Ile Leu Val Gln Cys His Tyr Arg Leu Gln Asp Val Lys Ala Gln Lys Val Trp Cys Arg Phe Leu Pro Glu Gly Cys Gln Pro Leu Val Ser Ser Ala Val Asp Arg Arg Ala Pro Ala Gly Arg Arg Thr Phe Leu Thr 65 70 75 gp Asp Leu Gly Gly Gly Leu Leu Gln Val Glu Met Val Thr Leu Gln Glu 85 90 g5 Glu Asp Ala Gly Glu Tyr Gly Cys Met Val Asp Gly Ala Arg Gly Pro Gln Ile Leu His Arg Val Ser Leu Asn Ile Leu Pro Pro Glu Gly Leu Glu Tyr Met Pro Met Asp <210> 14 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17115 <400> 14 ttaggatccc agggcatagt tggcagc 27 <210> 15 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17228 <400> 15 taatctagat tactctgggg gcagtatgtt caga 34 <210> 16 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC16084 <400> 16 gtcgaatgca aagcgtaaaa 20 <210> 17 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC7350 <400> 17 cctctacaaa tgtggtatgg c 21 <210> 18 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17116 <400> 18 ttaggatcca tgggcctcac cctgctc 27 <210> 19 <211> 40 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17479 <400> 19 gggtctcttc tagaccctct gggggcagta tgttcagaga 40 WO 99/bb040 PCT/US99/11337 <210> 20 <211> 65 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17019 <400> 20 ctcaaaaatt ataaaaatat ccaaacaggc agccgaattc tactctgggg gcagtatgtt 60 cagag 65 <210> 21 <211> 64 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17021 <400> 21 ttggacaaga gagaagaaga atacatgcca atggaaggtg gtcagggcat agttggcagc 60 ctcc 64 <210> 22 <211> 417 <212> DNA
<213> Artificial Sequence <220>
<223> NEE-tagged zsig57 fragment <400>

ttggacaagagagaagaagaatacatgccaatggaaggtggtcagggcatagttggcagc 60 ctccctgaggtgctgcaggcacccgtgggaagctccattctggtgcagtgccactacagg 120 ctccaggatgtcaaagctcagaaggtgtggtgccggttcttgccggaggggtgccagccc 180 ctggtgtcctcagctgtggatcgcagagctccagcgggcaggcgtacgtttctcacagac 240 ctgggtgggggcctgctgcaggtggaaatggttaccctgcaggaagaggatgctggcgag 300 tatggctgcatggtggatggggccagggggccccagattttgcacagagtctctctgaac 360 atactgcccccagagtagaattcggctgcctgtttggatatttttataatttttgag 417 <210> 23 <2I1> 64 <212> DNA

<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17022 <400> 23 attgctgcta aagaagaagg tgtaagcttg gacaagagag aacagggcat agttggcagc 60 ctcc 64 <210> 24 <211> 65 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17020 <400> 24 atactaggaa ttctactcca taggcatata ctcctcgcct ccctctgggg gcagtatgtt 60 cagag <210> 25 <211> 417 <212> DNA
<213> Artificial Sequence <220>
<223> CEE-tagged zsig57 fragment <400>

attgctgctaaagaagaaggtgtaagcttggacaagagagaacagggcatagttggcagc 60 ctccctgaggtgctgcaggcacccgtgggaagctccattctggtgcagtgccactacagg 120 ctccaggatgtcaaagctcagaaggtgtggtgccggttcttgccggaggggtgccagccc 180 ctggtgtcctcagctgtggatcgcagagctccagcgggcaggcgtacgtttctcacagac 240 ctgggtgggggcctgctgcaggtggaaatggttaccctgcaggaagaggatgctggcgag 300 tatggctgcatggtggatggggccagggggccccagattttgcacagagtctctctgaac 360 atactgcccccagagggaggcgaggagtatatgcctatggagtagaattcctagtat 417 <210> 26 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17529

11 <400> 26 gtatacggcc ggccaccatg ggcctcaccc tg 32 <210> 27 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC17530 <400> 27 cgtatcggcg cgcctcactg acgtggtgga cc 32 <210> 28 <211> 6 <212> PRT
<213> Artificial Sequence <220>
<223> EE peptide <400> 28 Glu Tyr Met Pro Val Asp <210>29 <211>224 <212>PRT

<213>Homo Sapiens <400> 29 Met Thr Ala Arg Ala Trp Ala Ser Trp Arg Ser Ser Ala Leu Leu Leu Leu Leu Val Pro Gly Tyr Phe Pro Leu Ser His Pro Met Thr Val Ala Gly Pro Val Gly Gly Ser Leu Ser Val Gln Cys Arg Tyr Glu Lys Glu His Arg Thr Leu Asn Lys Phe Trp Cys Arg Pro Pro Gln Ile Leu Arg Cys Asp Lys Ile Val Glu Thr Lys Gly Ser Ala Gly Lys Arg Asn Gly Arg Val Ser Ile Arg Asp Ser Pro Ala Asn Leu Ser Phe Thr Val Thr 85 90 g5

12 Leu Glu Asn Leu Thr Glu Glu Asp Ala Giy Thr Tyr Trp Cys Gly Val Asp Thr Pro Trp Leu Arg Asp Phe His Asp Pro Ile Val Glu Val Glu Val Ser Val Phe Pro Ala Gly Thr Thr Thr Ala Ser Ser Pro Gln Ser Ser Met Gly Thr Ser Gly Pro Pro Thr Lys Leu Pro Ual His Thr Trp Pro Ser Ual Thr Arg Lys Asp Ser Pro Glu Pro Ser Pro His Pro Gly Ser Leu Phe Ser Asn Val Arg Phe Leu Leu Leu Val Leu Leu Glu Leu Pro Leu Leu Leu Ser Met Leu Gly Ala Val Leu Trp Val Asn Arg Pro Gln Arg Ser Ser Arg Ser Arg Gln Asn Trp Pro Lys Gly Glu Asn Gln <210> 30 <211> 764 <2I2> PRT
<213> Homo sapiens <400> 30 Met Leu Leu Phe Val Leu Thr Cys Leu Leu Ala Val Phe Pro Ala Ile Ser Thr Lys Ser Pro Ile Phe Gly Pro Glu Glu Val Asn Ser Val Glu Gly Asn Ser Val Ser Ile Thr Cys Tyr Tyr Pro Pro Thr Ser Val Asn Arg His Thr Arg Lys Tyr Trp Cys Arg Gln Gly Ala Arg Gly Gly Cys Ile Thr Leu Ile Ser Ser Glu Gly Tyr Ual Ser Ser Lys Tyr Ala Gly Arg Ala Asn Leu Thr Asn Phe Pro Glu Asn Gly Thr Phe Ual Val Asn Ile Ala Gln Leu Ser Gln Asp Asp Ser Gly Arg Tyr Lys Cys Gly Leu Gly Ile Asn Ser Arg Gly Leu Ser Phe Asp Val Ser Leu Glu Val Ser Gln Gly Pro Gly Leu Leu Asn Asp Thr Lys Val Tyr Thr Ual Asp Leu Gly Arg Thr Val Thr Ile Asn Cys Pro Phe Lys Thr Glu Asn Ala Gln Lys Arg Lys Ser Leu Tyr Lys Gln Ile Gly Leu Tyr Pro Val Leu Ual

13 Ile Asp Ser Ser Gly Tyr Val Asn Pro Asn Tyr Thr Gly Arg Ile Arg Leu Asp Ile Gln Gly Thr Gly Gln Leu Leu Phe Ser Val Val Ile Asn Gln Leu Arg Leu Ser Asp Ala Gly Gln Tyr Leu Cys Gln Ala Gly Asp Asp Ser Asn Ser Asn Lys Lys Asn Ala Asp Leu Gln Val Leu Lys Pro Glu Pro Glu Leu Val Tyr Glu Asp Leu Arg Gly Ser Val Thr Phe His Cys Ala Leu Gly Pro Glu Val Ala Asn Val Ala Lys Phe Leu Cys Arg Gln Ser Ser Gly Glu Asn Cys Asp Val Val Val Asn Thr Leu Gly Lys Arg Ala Pro Ala Phe Glu Gly Arg Ile Leu Leu Asn Pro Gln Asp Lys Asp Gly Ser Phe Ser Val Val Ile Thr Gly Leu Arg Lys Glu Asp Ala Gly Arg Tyr Leu Cys Gly Ala His Ser Asp Gly Gln Leu Gln Glu Gly Ser Pro Ile Gln Ala Trp Gln Leu Phe Val Asn Glu Glu Ser Thr Ile Pro Arg Ser Pro Thr Val Val Lys Gly Val Ala Gly Ser Ser Val Ala Val Leu Cys Pro Tyr Asn Arg Lys Glu Ser Lys Ser Ile Lys Tyr Trp Cys Leu Trp Glu Gly Ala Gln Asn Gly Arg Cys Pro Leu Leu Val Asp Ser Glu Gly Trp Val Lys Ala Gln Tyr Glu Gly Arg Leu Ser Leu Leu Glu Glu Pro Gly Asn Gly Thr Phe Thr Val Ile Leu Asn Gln Leu Thr Ser Arg Asp Ala Gly Phe Tyr Trp Cys Leu Thr Asn Gly Asp Thr Leu Trp Arg Thr Thr Val Glu Ile Lys Ile Ile Glu Gly Glu Pro Asn Leu Lys Val Pro Gly Asn Val Thr Ala Val Leu Gly Glu Thr Leu Lys Val Pro Cys His Phe Pro Cys Lys Phe Ser Ser Tyr Glu Lys Tyr Trp Cys Lys Trp Asn Asn Thr Gly Cys Gln Ala Leu Pro Ser Gln Asp Glu Gly Pro Ser Lys Ala Phe Val Asn Cys Asp Glu Asn Ser Arg Leu Val Ser Leu Thr Leu Asn Leu Val Thr Arg Ala Asp Glu Gly Trp Tyr Trp Cys WO 99!66040 PC'f/US99/11337

14 530 ~ 535 540 Gly Val Lys Gln Gly His Phe Tyr Gly Glu Thr Ala Ala Val Tyr Val Ala Ual Glu Glu Arg Lys Ala Ala Gly Ser Arg Asp Ual Ser Leu Ala Lys Ala Asp Ala Ala Pro Asp Glu Lys Val Leu Asp Ser Gly Phe Arg Glu Ile Glu Asn Lys Ala Ile Gln Asp Pro Arg Leu Phe Ala Glu Glu Lys Ala Val Ala Asp Thr Arg Asp Gln Ala Asp Gly Ser Arg Ala Ser Val Asp Ser Gly Ser Ser Glu Glu Gln Gly Gly Ser Ser Arg Ala Leu Val Ser Thr Leu Val Pro Leu Gly Leu Val Leu Ala Ual Gly Ala Val Ala Val Gly Val Ala Arg Ala Arg His Arg Lys Asn Val Asp Arg Val Ser Ile Arg Ser Tyr Arg Thr Asp Ile Ser Met Ser Asp Phe Glu Asn Ser Arg Glu Phe Gly Ala Asn Asp Asn Met Gly Ala Ser Ser Ile Thr Gln Glu Thr Ser Leu Gly Gly Lys Glu Glu Phe Val Ala Thr Thr Glu Ser Thr Thr Glu Thr Lys Glu Pro Lys Lys Ala Lys Arg Ser Ser Lys Glu Glu Ala Glu Met Ala Tyr Lys Asp Phe Leu Leu Gln Ser Ser Thr Ual Ala Ala Glu Ala Gln Asp Gly Pro Gln Glu Ala

Claims

An isolated polynucleotide encoding a polypeptide comprising a sequence of amino acid residues that is at least 90% identical to an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence as shown in SEQ ID NO:
2 from residue number 18 (Ile), to residue number 108 (Gly);
(b) the amino acid sequence as shown in SEQ TD NO:2 from amino acid number 16 (Ile) to amino acid number 125 (Pro);
(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln);
(d) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (I1e) to amino acid number 199 (Gly) ; and (e) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met) to amino acid number 119 (Gly), wherein the amino acid percent identity is determined using a FASTA program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSDM62, with other parameters set as default.
2. An isolated polynucleotide according to claim 1, wherein the polynucleotide ie selected from the group consisting of:
(a) a polynucleotide sequence as shown in SEQ ID
NO:1 from nucleotide 115 to nucleotide 387;
fib) a polynucleotide sequence as shown in SEQ ID
NO:1 from nucleotide 115 to nucleotide 438;

(c) a polynucleotide sequence as shown in SEQ ID
NO:1 from nucleotide 115 to nucleotide 531;
(d) a polynucleotide sequence as shown, in SEQ ID
No:1 from nucleotide 115 to nucleotide 660; and (e) a polynucleotide sequence as shown in SEQ ID
NO:1 from nucleotide 64 to nucleotide 660.
3. An isolated polynucleotide sequence according to claim 1, wherein the polynucleotide comprises nucleotide 1 to nucleotide 597 of SEQ ID NO:3.
4. An isolated polynucleotide according to claim 1, wherein the polypeptide comprises a sequence of amino acid residues an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence as shown in SEQ ID NO:
2 from residue number 18 (Ile), to residue number 108 (Gly);
(b) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro);
(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln);
(d) the amino acid sequence as shown in SEQ ID NO: 2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met) to amino acid number 199 (Gly).
5. An isolated polynucleotide according to claim wherein the polypeptide consists of a sequence of amino acid residues as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln).
6. An expression vector comprising the following operably linked elements:
a transcription promoter;
a DNA segment encoding a polypeptide with an amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln); and a transcription terminator.
7. An expression vector according to claim 6, further comprising a secretory signal sequence operably linked to the DNA segment.
8. A cultured cell into which has been introduced an expression vector according to claim 6, wherein the cell expresses a polypeptide encoded by the DNA segment.
9. A DNA construct encoding a fusion protein, the DNA construct comprising:
a first DNA segment encoding a polypeptide that is selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO: 2 from residue number 1 (Met), to residue number 17 (Gly);
(b) the amino acid sequence of SEQ ID NO: 2 from residue number 18 (Ile), to residue number 108 (Gly);
(c) the amino acid sequence of SEQ ID NO: 2 from residue number 18 (Ile), to residue number 124 (Pro);
(d) the amino acid sequence of SEQ ID NO: 2 from residue number 18 (Ile), to residue number 156 (Gly);

(e) the amino acid sequence of SEQ ID NO; 2 from residue number 186 (Lys), to residue numbs; 199 (Gln);
(f) the amino acid sequence of SEQ ID NO: 2 from residue number 18 (Ile), to residue number 199 (Gln); and at least one other DNA segment encoding an additional polypeptide, wherein the first and other DNA segments are connected in-frame; and encode the fusion protein.
10. A fusion protein produced by a method comprising:
culturing a host cell into which has been introduced a vector comprising the following operably linked elements:
(a) a transcriptional promoter;
(b) a DNA construct encoding a fusion protein according to claim 9; and (c) a transcriptional terminator; and recovering the protein encoded by the DNA segment.
11. An isolated polypeptide comprising a sequence of amino acid residues that is at least 90% identical to an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence ae shown in SEQ ID NO:
2 from residue number 18 (Ile), to residue number 108 (Gly);
(b) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro);
(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln);

(d) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met) to amino acid number 199 (Gly), wherein the amino acid percent identity is determined using a FASTA program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62, with other parameters set as default.
12. An isolated polypeptide according to claim 11, wherein the polypeptide consists of a sequence of amino acid residues selected from the group consisting of;
(a) the amino acid sequence as shown in SEQ ID NO:
2 from residue number 18 (Ile), to residue number 108 (Gly);
(b) the amino acid sequence ae shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 125 (Pro);
(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 156 (Gln);
(d) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 199 (Gly); and (e) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met) to amino acid number 199 (Gly).
13. Are isolated polypeptide according to claim 12, wherein the sequence of amino acid residues is as shown in SEQ
ID No:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln).
14. A method of producing a polypeptide comprising:
culturing a cell according to claim 8; and isolating the polypeptide produced by the cell.
15. A method of producing an antibody to a polypeptide comprising:
inoculating an animal with a polypeptide selected from the group consisting of:
(a) a polypeptide consisting of 9 to 199 amino acids, wherein the polypeptide is a contiguous sequence of amino acids in SEQ ID NO:2 from amino acid number 18 (Ile) to amino acid number 199 (Gln);
(b) a polypeptide according to claim 11;
(c) a polypeptide having an amino acid sequence from residue number 186 (Lys), to residue number 199 (Gln) of SEQ ID NO:2;
(d) a polypeptide having an amino acid sequence from residue number 18 (Ile), to residue number 108 (Gly) of SEQ ID NO:2;
(e) a polypeptide having an amino acid sequence from residue number 96 (Glu) to residue number 101 (Glu) of SEQ ID
NO:2;
(f) a polypeptide having an amino acid sequence from residue number 124 (Pro) to residue number 229 (Glu) of SEQ ID
NO:2;
(g) a polypeptide having an amino acid sequence from residue number 125 (Pro) to residue number 130 (Glu) of SEQ ID
NO:2;
(h) a polypeptide having an amino acid sequence from residue number 185 (Arg) to residue number 190 (Glu) of SEQ ID
NO:2; and (i) a polypeptide having an amino acid sequence from residue number 186 (Lys) to residue number 191 (Ser) of SEQ ID
NO:2; and wherein the polypeptide elicits an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
16. An antibody produced by the method of claim 15, which binds to a polypeptide of claim 11.
17. The antibody of claim 16, wherein the antibody is a monoclonal antibody.
18. An antibody which specifically binds to a polypeptide of claim 11.
19. An antibody of claim 15, wherein the antibody is coupled to a plasmid containing a cDNA encoding a functional polypeptide.
20. An antibody of claim 15, wherein the antibody is coupled to a chemical agent.