CA2325051A1 - Reference material for nucleic acid amplification - Google Patents

Abstract

A nucleic acid reference material useful as a control in nucleic acid amplification reactions and the testing of nucleic acid amplification systems.
The reference material comprises at least two reference sequences preferably of different lengths, each reference sequence having a pair of primer binding sites which differ (between reference sequences) by the substitution of one or a few nucleotide bases. This reference material can be used to monitor the specificity of amplification of a target sequence, either by determining the presence or absence of any amplification products at a fixed or final analytical point, or in real time.

Description

REFERENCE MATERIAL FOR NUCLEIC ACID AMPLIFICATION
This invention relates to a nucleic acid reference material useful as a control in nucleic acid amplification reactions and for testing nucleic acid amplification systems. The invention also relates to methods of performing amplification reactions and methods of testing amplification systems using the reference material as a control. The invention further ~o relates to kits containing the reference material.
Background The polymerase chain reaction (PCR) was first described in the mid 1980s (Saiki et a! 1985 and Saiki et al 1988). Since then, it has ~s developed into a highly versatile and widely used detection, identification, manipulation and analysis tool in the field of molecular biology. In brief, two short synthetic oligonucleotides or primers are used to define an intervening DNA sequence which is then amplified in vitro using a thermostable DNA polymerase, DNA precursors, suitable reaction buffer 2o and a thermal cycler. Correct amplification requires a specific interaction of the primers with their target sequence. The specificity of the reaction is generally assessed by gel analysis or by hybridisation which determines whether the size or internal sequence is consistent with correct amplification.
2s However, such quality control procedures do not answer the questions "What if a closely related sequence was in the sample with, for instance, a single base difference at a given position within the priming site? Would it amplify to give a false positive result?" Such questions become more pertinent as unknown samples are analysed. Additionally, ~o as nucleic acid amplification techniques are applied to "environmental" or mixed samples rather than clean and standardised laboratory test samples, a range of inhibitors and contaminants may affect both the ability of the PCR to amplify a target under those conditions and the specificity of interaction of the primer with any correct or incorrect targets leading to false negative or false positive results. Furthermore, differences in samples and s variation in sample preparation can lead to differences in the amplification conditions between individual reaction tubes. Other possible variations can result from errors in pipetting, difference in reaction tube thickness, poor calibration of the thermal cycler with respect to temperature and temperature uniformity, quality of reagents, and other factors again leading ~o to false negative or false positive results.
An internal standard for monitoring PCR analysis for certain food-borne pathogens has been developed (Lambertz et al 1998). The internal standard is a DNA fragment flanked by the same primer recognition sites as the primer sites in the target sequence. It is thus referred to as a ~s "mimic". However, while this mimic can help deal with the problem of false negative PCR results, it is of no use in monitoring the specificity of the PCR. Also, because the mimic competes with the intended target, it by definition decreases the sensitivity of the assay. Elsewhere such mimics have been used for quantification purposes using competitive PCR (Wang 2o et al 1989).
It is an aim of the invention to provide reagents and methods for dealing with the problem of false negative and false positive results in nucleic acid amplification reactions.
It is a further aim of the invention to provide means for 2s assessing specificity in nucleic acid amplification systems.
The Invention In one aspect, the invention provides a nucleic acid reference material comprising:
30 (i) a first reference sequence having a pair of primer binding sites;

(ii) a second reference sequence having a pair of primer binding sites;
wherein the primer binding sites of (ii) are as for (i) except for the substitution of one or a few nucleotide bases.
In a particular, preferred embodiment the primer binding sites of the first and second reference sequences flank a first and second intervening sequence, respectively.
Preferably, the respective intervening sequences of the first and second reference sequences are of different lengths. This means that they can be separately identified on the basis of length, for example using a ~o size separation technique.
The primer binding sites of the first and second reference sequences are preferably identical except for a single base substitution in one of the primer binding sites. Thus, one priming site is conserved between the two reference sequences and the other is variable.
~s The reference material may comprise one or more additional reference sequences, each of which has a pair of primer binding sites flanking an intervening sequence. Each of the second and additional reference sequences has a number of base substitutions in the variable primer binding site relative to the primer binding sites of the first reference 2o sequence, and in each case the number of base substitutions is different.
Each of the reference sequences is distinguishable from the other reference sequences, preferably on the basis of size.
In another aspect the invention provides a kit comprising:
(i) the reference material described herein; and 2s (ii) a pair of oligonucleotide primers complementary to the first reference sequence primer binding sites. Thus, there will be one or more base pair mismatches between the primers and the primer binding sites of the second and any successive reference sequences present in the kit.
In still another aspect the invention provides a method for o amplifying a nucleic acid target sequence which method comprises:

(i) providing a pair of oligonucleotide primers complementary to the target sequence to be amplified;
(ii) providing a reference nucleic acid sequence having a pair of primer binding sites, which primer binding sites are complementary to the s primers in (i) except for one or a few base pair mismatches in at least one of the primer binding sites;
(iii) performing an amplification reaction on a sample containing or suspected of containing the target nucleic acid sequence, using the primers of (i) and in the presence of the reference nucleic acid of (ii); and ~o (iv) monitoring amplification of the target sequence and/or of the reference nucleic acid sequence.
In a preferred embodiment, the primer binding sites of the reference nucleic acid sequence flank an intervening sequence.
Preferably, the amplified target sequence and the reference ~s nucleic sequence are of different lengths. This means that they can be separately identified on the basis of length, for example using a size separation technique.
In a further aspect the invention provides a method for monitoring a PCR system which method comprises performing an 2o amplification reaction on a nucleic acid reference material according to the invention, using the said PCR system and a pair of primers complementary to the primer binding site of the first reference sequence, and determining which of the reference sequences are amplified.
Thus, the invention is useful in, but not limited to, two 2s particular areas of application which are:
1. To ensure the correct performance of a user's amplification systems.
2. To control for amplification specificity (a lack of which can potentially lead to false positive results) and at the same time to control for ~o amplification efficiency (a reduction in which leads to false negative or weak results, for example as a result of inhibition of amplification).

The invention described herein is concerned in particular with a PCR reference material designed to be used in isolation in PCR systems or simultaneously within PCR assays, to control for and allow the measurement of PCR specificity and sensitivity.
s Thus, the reference sequences described herein provide a control which may be employed either as an internal control for a PCR, or as a stand alone control for monitoring a PCR system. Ln the context of an internal control, the reference sequences can take one of two possible forms. Firstly, they may be designed to be integral with an existing PCR for ~o which they are functioning as a control. In this case, they have primer binding sites which are related to the primer binding sites in an existing target sequence to be amplified, such that depending upon the reaction conditions there may be amplification of one or more of the reference sequences in addition to the amplification of the target sequence, if ~s present. Secondly, the reference sequences of an internal control system may be entirely unrelated to the existing target sequence. In this case, separate pairs of primers will be provided for amplification of the target sequence and the reference sequences. It will be evident that in the first example, it is not necessarily essential to include a reference sequence 2o having primer binding sites which are exactly complementary to the primer sequences, but it will be advantageous to include such a reference sequence to provide a direct control for false negatives. On the other hand, in the second case it will be necessary to include a reference which has primer binding sites exactly complementary to the amplifying primers, to 2s provide a reference point for assessing specificity of the reaction.
In a particular embodiment of the invention there is provided a reference material which includes several e.g. three or four different reference sequences. The first and second sequences preferably differ by a single base substitution in one of the primer binding sites and each 3o successive additional reference sequence preferably has an additional base substitution in the same primer binding site. This provides a set of reference sequences in which one primer binding site is conserved and matches the primer, while the other primer binding site is variable with sequences that are matched and progressively mismatched to the other primer. A set of reference sequences of this kind can provide a control for a range of mismatch amplifications, by demonstrating whether defined mismatches are tolerated by the system in use. Conveniently, all of the reference sequences have a different length so that their amplification products can therefore be easily distinguished by using a size determination technique.
o Suitable size determination techniques for analysing the amplified products range from simple agarose or polyacrylamide gel electrophoresis in the presence of a DNA stain such as ethidium bromide to those using more specialised equipment such as capillary electrophoresis and automated fluorescence DNA analysers such as those used in ~s automated DNA sequencing and genotyping as well as a range of hybidisation and mass spectroscopy formats. However, currently preferred are simpler techniques such as separation in a gel using gel electrophoresis, in which the results are easily visualised without the requirement for sophisticated equipment. For the purposes of size 2o separation on a gel, it is convenient to have amplification products which can be separated to form a ladder in the gel which corresponds to a standard marker ladder such as the 50 or 100 base pair ladders which are available commercially. Thus, a desirable difference in length between the reference sequences is 50 or a multiple of 50 nucleotides.
2s Advantageously, the reference sequences are also themselves 50 or a multiple of 50 nucleotides in length. The precise length of the amplification products of the reference sequences will depend upon the actual size of the primers employed.
Sets of reference sequences are envisaged which include so sequences ranging from 50 to 1000 nucleotides in length, more preferably from 100 to 500 nucleotides in length. For example, a set of reference _7_ sequences may include sequences of 100, 150, 200 and 250 nucleotides in length.
The position of a base mismatch between a primer and its primer binding site can have a significant effect both on the stability of s hybridisation of the primer to its binding site and on the likelihood of primer extension and therefore needs to be taken into account when designing the reference sequences. In general, a mismatch in the middle of the primer/primer binding site has the greatest effect on the stability of the interaction, while the primer extension reaction is most prevented by a ~o mismatch at the 3' end of the primer. In the context of the invention, the preferred position for mismatches is between the centre and the 3' end of the primer, most preferably within a few bases e.g. within half a dozen bases of the 3' end of the primer. In a reference material which contains a series of mismatches, the mismatches are preferably adjacent to one ~ s another.
For the mismatches to be in the desired position, the reference sequences have their base substitutions located in the site at which the primer binds, between the centre of that site and the innermost end of that site, and preferably within a few bases of the innermost end of 2o the site. A distinction needs to be made here between possible primer binding sites and actual primer binding sites. This is because it may be desirable to retain flexibility as to the primers which can be used in conjunction with a reference material according to the invention. Thus, while for example 30 by of possible primer binding site may be provided at 2s each end of the reference sequences, it may be desirable to use primers which are shorter than 30 nucleotides, e.g. 15 to 20 nucleotides in length.
The location of the base pair differences between the reference sequences in the reference material can be chosen to enable the user to have a degree of selection relating to the length (and thus annealing temperature) 30 of the primer and also the position of the mismatch of the primer to the primer binding site. For example, rather than being close to the 5' or _8_ innermost end of the available primer binding site, the location of the base pair substitution or substitutions may be closer to the middle of the available primer binding site.
Further factors which need to be taken into account when designing suitable reference sequences are the stability of the primer/primer binding site interaction which can be adjusted for example by altering the GC content or distribution within the primer binding site or the length of the primer/primer binding site, as well as by the use of nucleotide analogues within the primer.
~o In the case of a reference sequence for use as an internal control in a PCR, the hybridisation properties of the reference sequence/reference sequence primers are preferably similar to or compatible with the hybridisation properties of the target sequence/target sequence primers. Where the same pair of primers is amplifying both the ~s target and the reference sequences, this is especially important. The melting temperature (Tm) of a primer can be adjusted if necessary by techniques known in the art, such as by altering its length, or by the use of DNA nucleotide analogues which affect primer Tm. Such nucleotide analogues include for example C5-propyne-dU and 2-amino-purine which 2o can be substituted for dT and dA residues giving bases which form 3 rather than 2 hydrogen bonds and therefore make a higher than normal contribution to Tm (Lebedev et al 1996 and Nguyen et al 1997).
It is also preferable that the reference materials according to the invention which are not related to any existing target sequences are, as 2s far as possible, unrelated to known sequences. This reduces the chances of cross-reactivity with other PCR assays and means that the reference materials are of potentially universal use as internal reference standards.
Two or more reference sequences may be provided according to the invention in a single molecule rather than as separate ao molecules. The provision of the sequences together in this way, for example in a plasmid or other self-replicating vector, has the advantage of _g_ ensuring that equimolar quantities of the reference sequences are added to the reaction. This minimises the potential for preferential target amplification which can result from errors introduced by the pipetting of multiple DNA targets.
s Further adaptations of the single molecule reference material are envisaged, including:
1. The inclusion of unique restriction sites between each of the reference sequences to allow for the removal or insertion of material.
2. The inclusion of an RNA transcription start site to enable the ~o generation of an RNA transcript prior to reverse transcription and amplification. This will allow the specificity of reverse transcription to be assessed in addition to amplification, for example in reverse transcription PCR.
3. The inclusion of additional control sequences, for example a ~s control sequence containing one or more internal restriction sites to give a control for CAPS {cleavage of amplified products) analysis (Meyer et al 1995).
4. The inclusion of variable %GC content or high Tm domains known to be resistant to amplification {McDowell et al 1998). For example, 2o these domains may be incorporated into intervening sequences of the reference sequences to modify the reference material for use with PCR
targets whose amplification is either more favoured or less favoured than normal due to the presence of such domains.
5. The inclusion of priming sites specified by users, to act as a 2s specific matched or mismatched control for a given assay or to serve as a competitive standard for quantification purposes etc.
By including restriction sites as described in 1 above, the insertion of other features such as those described under 2 to 5 either in addition to or in replacement of one or more of the reference sequences, so can be easily carried out by restriction digestion and ligation of new sections into the molecule.

Monitoring amplification of the target sequence and/or of the reference material can be effected in real time by techniques known to those skilled in the art. Alternatively, amplification can be monitored by determining the presence or absence of any amplification product of the target sequence and of the reference material.
Where an amplification reaction is performed using the invention, and the degree of specificity of the reaction is found to be insufficient, the reaction parameters are modified in appropriate fashion and the reaction may be repeated until a desired specificity is obtained.
~o This may involve altering assay reagents and/or their concentration, temperature, timing, or it may involve making a more fundamental change such as replacing a machine or an operator conducting the reaction. The invention may also be used to assess for example the variability in or between thermal cyclers, reagents and assay set-ups, and to evaluate new Is equipment or reagents for use in amplification reactions.
Although the invention is described primarily with reference to PCR, it can also be applied to a range of other amplification techniques which involve specific oligonucleotide hybridisations to target sequences.
Examples include Ligase Chain Reaction (LCR) and the related Gapped 2o Ligase Chain Reaction (G-LCR), Strand Displacement Amplification (SDA), Nucleic Acid Sequence Based Amplification (NASBA - trade mark owned by Organon Teknika) and Self-sustained Sequence Replication (3SR).
In LCR, the counterpart to the pair of primers in PCR is a pair of oligonucleotides which hybridise to a target, adjacent to one another on 2s the target. In the absence of mis-matches at the ends of the oligonucleotides where they meet, the oligonucleotides are ligated by a ligase enzyme and the resulting molecule itself serves as a template for further amplification. G-LCR differs in that there is a short gap of usually 1 to 3 bases which separates the oligonucleotides when they hybridise to the 3o target. The hybridised oligonucleotides are extended by the action of a DNA polymerase such that the extended products are then adjacent and a substrate for the ligase enzyme. The oligonucleotides used in LCR are often referred to as "probes" rather than primers, because they are not involved in primer extension reactions. Nevertheless, the term "primer binding site" as used herein is not intended to exclude LCR type reactions.
A suitable reference material according to the invention for assessing tolerance of mismatches in an LCR system may be a reference material which is itself amplified by LCR, or it may be amplified by conventional PCR.
The utility of LCR for the detection of polymorphisms has ~o been demonstrated for the analysis of various genetic diseases, including cystic fibrosis (Fang et al 1995) and sickle cell anaemia (Barany, 1991 ).
LCR has also been used for the detection of various infectious disease agents, including human immunodeficiency virus (HIV; Laffler et al 1993), Chlamydia (Laffler et al 1993) and multidrug resistant (MDR) ~s Mycobacterium tuberculosis (Winn-Deen et al 1993), and has been exploited for the discrimination of Listeria monocytogenes from other Listeria species (Wiedmann et al 1992). An LCR-based kit (Abbot Lex MTB Assay) for the detection of common mutations in multidrug resistant (MDR) Mycobacterium tuberculosis is currently available from Abbot 2o Laboratories, Chicago, III, USA. These or other LCR systems may benefit from the use of a reference material according to the invention.
SDA is a target amplification method involving two pairs of primers, an internal pair and an external pair, in a primer extension reaction carried out at a fixed temperature (Walker et al 1992; Walker et al 1994).
2s SDA has predominantly been used for the detection of Mycobacterium species. An SDA-based kit for the detection of mycobacterium is available from Becton Dickinson Microbiology Systems (Sparks, Md. USA).
Reference materials according to the invention can be used with SDA.
NASBA and 3SR are transcription-based amplification so methods employing reverse transcriptase and RNA polymerase enzymes.
Both techniques use a pair of oligonucleotide primers to amplify a target sequence of interest, which may be an RNA target or a double-stranded DNA target. NASBA has been successfully applied to the detection of RNA
viruses e.g. HIV-1 (Kievits et al 1991 ) and microorganisms, including Campylobacter (Uyttendaele et al 1994) and others. A NASBA-based s assay for the detection of hepatitis C virus RNA is currently available in kit form, marketed by Organon Teknika (Boxtel, Netherlands). 3SR has also been successfully applied to the detection of RNA viruses, in particular HIV-1 (Bush et al 1992) and human papilloma virus (Brown et al 1990).
3SR has also been developed as an in situ amplification technique, and ~o has been applied for the in situ detection of the measles virus RNA (Hofler et al 1995). Reference materials according to the invention can be used with these methods.
It is envisaged that the present invention will be useful in any of these methods, in particular where detection of target sequences in ~s medical or environmental samples is desired. As already discussed in detail, the reference materials may be used independently to control for errors in a particular system, or they may used as an internal control in an amplification reaction to amplify a particular target sequence. In the latter case, the reference material and the primers which amplify it may be 2o independent of the target sequences and target primers, or the reference material may be designed as a "mimic" of the target sequence such that it undergoes amplification in the presence of the target primers.
The invention will now be further described in the examples which follow, with reference to the accompanying figures.
2s EXAMPLES
Example 1 - Reference Material based on 16S rRNA Seauences In a test system the 16S rRNA genes were targeted since these are commonly used PCR targets within the scientific community.
~o Since these genes are conserved to some degree across all bacteria, there is a chance that unintended but related targets in a sample could amplify depending upon the degree of relatedness between the genes/organisms.
Assumptions can be made using available sequence information as to whether this is likely, based on whether the regions of the gene used as priming sites are known to be highly or less highly conserved between s particular species. However, the majority of environmental species are unculturable and no sequence information is available for these. Because of this, a measure of PCR specificity would be of use in order to ensure confidence in correct amplification.
16S ribosomal RNA gene sequences were amplified from ~o stock Legionella strains using specially designed primers (RDNA3 and RDNA4 as shown in figure 1 a), cloned, and the internal sequence confirmed. Further amplification was then performed from a semi conserved primer binding site differing by 1, 2 or 3 bases (3 bases in from the 3' end) known as RDNA 2, to RDNA4 as indicated in figure 1 b.
~s Subsequent work involved the construction of a size mimic containing the matched RDNA2 and RDNA3 primer sites using a non-specific amplification from calf thymus DNA (Sigma) followed by selection of a suitable clone of approx. 100 by which could be readily coamplified and distinguished from the approx. 150 by products of the previous clones.
2o Duplex amplifications of the approx. 100 by and 150 by targets were performed (results not shown).
This size mimic was later superseded and optimisation problems overcome by generating a new series of 3 constructs each containing a matched and a mismatched primer site. Three new and 2s truncated PCR products were generated from the 150 by RDNA2/RDNA3 Legionella pneumophila serogroup 1 target to give 100 by products with a conserved RDNA3 site and a RDNA2 site which either matched that of the 150 by target or differed by 1 and 2 bases from it in the same way as described above. Thus, three constructs were prepared in which the RDNA2 priming site in the 100 by target:
1. matches the RDNA2 site in the 150 by product;

2. differs by 1 base to the RDNA2 site in the 150 by product;
3. differs by 2 bases to the RDNA2 priming site in the 150 by product.
The RDNA3 priming site was conserved throughout. The 3 s products were flanked by Hindlll sites allowing them to be cloned into the Hindlll site of a clone of the 150 by target fom L, pneumophila SGI as shown in figure 2. It is the performance of this series of 3 constructs which is illustrated in figures 3 and 4. Amplification was performed using both RDNA2 and RDNA3 primers. The 150 by product should normally be ~o produced subject to correct reaction set-up and absence of PCR inhibitors etc. The 100 by target would be expected to be present or absent depending on the degree of mismatch of the primer to the priming site tolerated under the conditions used such as with different annealing temperatures (see figures 3 and 4). The construct in which the RDNA2 ~s priming site is conserved in both the 100 and 150 by target served as a control for uniform amplification. In brief, raising the annealing temperature resulted in a progressive improvement in the specificity or accuracy of primer interaction with the matched and mismatched priming sites and prevented the mismatched or incorrect targets being amplified.
Figure Legends for Example 1 Figure 1 shows sequences of the region of the L. pneumophila serogroup 1 16S ribosomal RNA gene to which the original RDNA3 and RDNA4 PCR primers were targeted. The internal sequence 2s varies according to the Legionella species with the sequences at the RDNA2 site for selected species shown in b; and (b) sequences at the RDNA2 site for different Legionella species. Only differences to the L.
pneumophila SG1 sequence are shown. The four cloned sequences used for the work described are in bold.

Figure 2 shows a diagrammatic representation of the original reference material from which the data contained in figures 3 and 4 was obtained.
Figures 3 and 4 are schematic representations of two s photographs of gels showing the separated amplification products. In figure 3:
lanes 1, 2 = 0 by mismatch (control) lanes 3, 4 = 1 by mismatch lanes 5, 6 = 2 by mismatch ~o In Figure 4:
lanes 1, 4 = 0 by mismatch (control) lanes 2, 5 = 1 by mismatch lanes 3, fi = 2 by mismatch ~s The different annealing temperatures used are indicated.
Under the conditions used mismatches were tolerated as follows:
Figure Annealing Mismatches s Temp. tolerated 3A 40C 1 and 2 3B 50C 1 and 2 3C 60C 1 not 2 4A 55C 1 not 2 4B 60C 1 not 2 4C 65C 1 not 2 4D 70C neither 1 nor Conditions Amplification conditions utilised unless otherwise stated were ~s 50 mM KCI, lOmM Tris-HCI (pH 8.3 at 20°C), 1.5 mM MgCl2, 0.01%
gelatin, 0.2 mM each dNTP and 0.6 Units Taq polymerase. Optimisation of reaction conditions for the reference plasmids described was performed over a range of conditions but 10,000 to 100,000 copies of the reference plasmid were used throughout. For amplification of targets from genomic 2o DNA prior to cloning and manipulation work, approx 1 microgram of DNA
was used. Bacterial strains were obtained from Public Health Laboratory Service National Collection of Type Cultures.
The physical conditions for PCR were:
30 seconds at 94°C; 30 seconds at annealing temperature (variable); 30 2s seconds at 72°C; for 30 rounds of amplification. An additional hold of 30 seconds at 94°C was included prior to cycling and a hold of 3 minutes at 72°C after completion of cycling. Amplifications were performed in a Perkin Elmer 2400 thermal cycler.

Example 2 - Reference Material comprising four reference seQUences of different lengths A second system was designed to contain a number of DNA
targets, amplified in a multiplex reaction, potentially generating up to four different sized PCR products depending upon the degree of mismatch (lack of specificity) tolerated under the conditions used. Under sub-optimal conditions where specificity is increasingly compromised additional products will be generated, with the intensity and number of products giving an indication of the level of specificity achieved as shown in Figure 5. ~
~o Construction of the PCR Reference Material DNA Sequences To establish a consistent set of DNA targets for the system, clones were constructed by amplifying sequence regions of the pGEM luc Basic 2 plasmid (Promega) using primers (construction primers) designed ~s to contain the first 20 nucleotides of the target sequence, adjacent to which are the size and diagnostic primer recognition sites (Table 1 a). The targets were designed to have no significant homology with other known sequences. These PCR fragments were ligated into the pCR II plasmid according to the supplier's instructions (Invitrogen). The ligation mixes 2o were propagated in Escherichia coli DH5-a (Clontech). The resulting clones were screened by PCR using both size and M13 primers to determine the presence and size of the insert (Table 1 b). Standard stocks of each target were prepared using Wizard Maxiprep kits and the concentration of these targets determined by UV-absorption (260nm).
2s Design of size and diagnostic primers The length and %GC content of the size (mismatched) primer and diagnostic (construct specific) primers developed for use with the Reference Material system were designed to be the same (Table 2). This ~o made it more feasible to establish a generic set of conditions that were applicable to the DNA targets of interest. Also, destabilising the size-specific primers, by introducing deliberate mismatches at or close to the 3'-terminal nucleotide decreases specificity and reduces yield thus allowing the degree of assay specificity to be ascertained. When introducing additional mismatches into such a system, the position within the primer s and the G/C content of the 5 or 6 bases preceding the 3'-terminal nucleotide had to be considered. The closer to the 3'-terminus of the primer that an additional primer extension mismatch is incorporated, the greater is the inhibitory effect on primer extension. Therefore, the primers designed to amplify a 100 by DNA target, one of which possessed 3 ~o deliberate mismatches, would theoretically be highly destabilised in the PCR reaction. The complementary primer for the system was also designed to possess a GC content of 50% and to contain no repeat or unusual sequences. An additional T7 promoter sequence was incorporated to facilitate the production of an RNA version of the reference ~s material system. The diagnostic primers were designed to be specific to each individual construct for quality control purposes. (Figure 6). ~

Primer used in the generation of the matched primer and associated priming regions.
(The construction primer is complementary to the luciferase gene target) diagaoatic primer Size primer Construction primer aatttaatacgactcacctat AGGGATTGTCGAAGTCTGAC CACTCGGATATTTGATATGT
Primers used in the generation of the mismatched primer and associated priming regions (The construction primer is complementary to the luciferase gene target) 250 by target diagnostic Drimer Size primer Construction primer gcctgtatcatgctgtctag TCTCTTCTGCGTGAATGCAC CTTTCGAAAGAGGTGCGCCC
200 by target diagnostic primer Size primer 1 Construction primer gtcgtcctaaggagtactgt TCTCTTCTGCGTGAATGCAG TCGTATTTGTCAATCAGAGT
150 by target diagnostic Driraer Size primer 21 Construction primer agaccgaagaaggtcgaagt TCTCTTCTGCGTGAATGCTG TACTAGCAACGCACTTTGAA
100 by target diagnostic prim~r Size primer 321 Construction primer gctagccgatngtcgactta TCTCTTCTGCGTGAATGGTG GCTCTTCTTCAAATCTATAC
Table la. Construction primers used to generate DNA targets. Diagnostic primers are given in bold lower case whilst the size primers are in italic upper case and the construction primers in underlined upper case.
The construction primers amplify regions of the luciferase gene (pGEM luc DNA
vector) between bases 500 to 1000 to generated PCR products ranging from 100 by to 250 by in length.

name Primer sequence 5'-3' Mimic enerated ~ (bp) 1 TCTCTT T GTGAAT GTGGCTC i TCTTC
8? It)t) AAA T CTATACATTA.AGACG.ACTCG~,.=,.-",TCCa,l0U

CATATCAAATATCCGAGTGGTCAGACTTCG

ACAATCCCT

~'821~0 TCTCTTCTGCGTGAATGCTGTACTAGCAAC

GC.ACTTTGAATTTTGAATCCTGAAGGGATCG

TAAAAACAGCTCTTCTTCAAATCTATACATTA I~O

AGACGACTCGAAATCCACATATCAAATATCC

GAGTGGTCAGACTTCGACAATCCCT

1'82 200 TCTCTTCTGCGTGAATGCAGTACTAGCAAC

GC ACTTTGAATTTTGTAATCCTGAAGGGATC

TAAGACGACTCGAAATCCACATATCAAATA

TCCGAGTGGTCAGACTTCGACAATCCCT

AGGTGCGCCCCCAGAAGCA,ATTTCGTGTAA.4 TTAGATAAATCGTATTTGTCAATCAGAGTGC

TTTTGGCGAAGAATGAAA.ATAGGGTTGGTAC 2~0 TAGCAACGCAC'rTI"GAATTTTGTAATCCTGA

AGGGATCGTAAAAACAGCTCTTCTTCA AATC

TATACATTAAGACGACTCGAAATCCACATAT

CAAATATCCGAGTGGTCAGACTTCGACAAT

CCCT

Size primer binding sites arc highlighted in bold.
Table lb. PCR products generated using the reference material DNA targets.
Name Primers (bp) %GC content Y82 SC AGGGATTGTCGAAGTCTGAC 20 $0 1'82 S1M TCTCTTCTGCGTGAATGCA~ 20 SO

Y82 S2M TCTCTTCTGCGTGAATGCT~ 20 50 Y82 S3M TCTCTTCTGCGTGAATG~ 20 50 ~Imm:ucHc~l h;mx an: underlined and highlighted in bold.

Table 2. Size and diagnostic primers designed for the Reference Material system.

Optimisation of the Reference Material system The PCR conditions used in this Example were as described in Example 1.
Several factors are known to affect the specificity of primers used in this type of assay system. These factors, such as magnesium ion concentration, primer concentration and annealing temperature can significantly reduce specificity. Consequently, experiments were conducted to ascertain the effect of these factors on the amplification of the Reference Material DNA targets.
to Magnesium ion concentration All four of the reference material DNA targets were titrated in the presence of MgCl2 ranging from 0.8 mM to 3.2 mM. Magnesium ion concentration had no visible effect on the amplification of the DNA targets ~s in this example, as all target products generated possessed similar band intensities over the range of MgCl2 employed.
Primer concentration The DNA targets were amplified using primer concentrations 2o ranging from 0.5 ~.M to 6.0 ~.M. No significant differences were observed in the intensities of the target product bands generated. The concentration of the primers employed therefore does not appear to have a significant effect on the amplification of the DNA targets in this example.
2s Annealing temperature All of the DNA targets were amplified at a range of annealing temperatures. At an annealing temperature of 50°C all targets were successfully amplified, showing that up to 2 mismatched bases were tolerated under the conditions used, the 200 by and 250 by generating ~o stronger product signals than the other two shorter templates. Stronger signals were generated at an annealing temperature of 55°C for the 150 WO 00!46401 PCT/GB00/00305 bp, 200 by and 250 by templates. The 100 by template generated fainter signals than those of the larger templates at this annealing temperature. At an annealing temperature of 60°C only the 200 by template was successfully amplified in duplicate, the other templates generating fainter, s product bands. The choice of annealing temperature therefore appears to be an important consideration for successful amplification of the reference material DNA targets.
Examale 3 - A Synthetic Multi-purpose Reference Material o A synthetic reference material was constructed containing a series of priming regions, intervening regions and unique restriction sites.
The sequence of this reference material is given in Figure 7. J
The numbers represent the number of bases in the motif.
The 6 base motifs are unique, 6 base recognition sequence, restriction sites of which there are 5 within the sequence R1 EcoRl R2 Kpnl 2o R3 BamHl R4 Pstl R5 Hindlll The 30 and 25 base motifs are conserved sequences within which PCR primers can be selected of which there are 4 forward 2s sequences (F1-4) containing a mismatch region (underlined), and a single conserved reverse sequence.
F1 TGCTATCTCTACTGCGTGAATGCACTCGTC - 100 by F2 TGCTATCTCTACTGCGTGAATGCAGTCGTC - 150 by F3 TGCTATCTCTACTGCGTGAATGCTGTCGTC - 200 by 30 F4 TGCTATCTCTACTGCGTGAATGGTGTCGTC - 250 by The reverse 25 base region is found downstream of each forward region allowing PCR to amplify the intervening sequences (li, 12, 13, 14).
C CTCAGGTCAGACTTCGACAATCCCT
In summary, the reference material was designed to contain a series of targets in which one priming region is conserved (C) and the other contains a small number of base differences (1-3). Unique restriction sites to were placed in the sequence so as to allow the targets to be removed or replaced and to allow the insertion of additional pieces of DNA to spatially separate the targets or to allow other modifications as required.
In the example illustrated below, the following structure was derived from the above synthetic sequence following standard genetic Is manipulation procedures. It is this structure which is referred to here on as the Reference Material or RM
6 30 45 25 6 2.2 kb 30 95 25 6 30 14525 6 EcoRl Fl ll C KpnlStuffersequenceF2 I2 C BamHl F3 13 C HindIll The above structure was cloned in pUCl9 and linearised at 2o the BamH1 restriction site prior to use. This resulted in a linear molecule containing three targets termed F1, F2 and F3 with nominal sizes of 100, 150 and 200 bases respectively in which the three targets were spatially separated by approximately 2.2kb stuffer region and the pUCl9 vector DNA.
2s The sequences of the three targets were:
>ri 5'TGCTATCTCTACTGCGTGAATGCACTCGTCATTCGGAGTATCCCGCGAACCGC
TCTTGGTGAGCGCACCGCAACACTCAGGTCAGACTTCGACAATCCCT 3' 5'TGCTATCTCTACTGCGTGAATGCAGTCGTCCCCTAATTTACGGTAGGAAAGGT
ATCGCGGTCCGCTAGCTCCCAACTGACGCACCATGTACTCCATAGCTATATCGGT
CCCACCTCGCGTCCTATCTCAGGTCAGACTTCGACAATCCCT 3' 5'TGCTATCTCTACTGCGTGAATGCTGTCGTCGCTGTTTTGCAAATAGTTTTGAG
AAATCAGCCGGCCGCGTTCTGCGGGTCGACCGCATACTGGGGCATGTGATTTTCG
ACGTGGGTATGCATACCAAGCCAGTGACCAAGCTCCTTATGTTCATCTGCGGCTT
TCCTTGACCTTTCTCAGGTCAGACTTCGACAATCCCT 3' For the purposes of the following work, a primer was designed to the F3 sequence such that the F2 target contained a single is mismatch in the F2 priming region and the F1 target contained two mismatches in the F1 priming region. Only the F3 (200 bp) target would therefore be expected to amplify under specific amplification conditions with the F2 (150bp) and then the F1 (100bp) being amplified under progressively less specific conditions.
Experimental conditions The reference material was amplified under the following conditions unless otherwise stated.
2s PCR reaction mix dNTPs (1.25mM) 4.Opl 10x PCR Buffer s (100mM Tris-HCL(pH 9.0),lSmM MgC12,500mMKCl) 2.5p.1 C-25 primer (20p,M) 1.Op.l F3-18/F3-20 primer (20p.M) l.Op,l Taq polymerase(5000 u/ml) 0.125u1 Target DNA as required to Sterile distilled water to a final volume of 25p,1 The RM was linearised at the BamH1 restriction site and added to a level of 1.75 x 10 6 copies / 2511 reaction. Amplifications were performed on a Perkin Elmer 2400 thermal cycler using the following Is thermal profile.
94C 4 mins 1 cycle 94C 30 secs 30 cycles Specified30 secs C 1 min 72C 7 min 1 cycle 4C hold The samples were analysed by electrophoresis on a 1.75% agarose gel 20 (containing 0.01 % ethidium bromide) at 175v for 30-,45 minutes. The PCR products were visualised on a UV transilluminator and documented using an Alpha imagerT"" 1220 system.
Results 2s The performance of the reference material was assessed under a number of reaction conditions in order to inform its wider use as a reference standard for specificity and sensitivity purposes.

1. Effect of annealing temp and primer length Two different forward primers of different length (18 and 20 bases) were designed to the forward priming region F3 and designated s F3-18 and F3-20 respectively. The priming regions of the reference material were designed so that primers of different length and position could be selected for use. The use of different primers was expected to have an effect on the performance of the reference material. A single primer was designed to be complementary to a sequence within the ~o conserved priming region and designated C-25.
The sequences of these primers were:
C-25 5' AGGGATTGTCGAAGTCTGACCTGAG 3' (25mer 52$ G/C) F3-ZO 5' TCTACTGCGTGAATGCTGTC 3' (20mer 50 $ G/C) P'3-t8 5' TACTGCGTGAATGCTGTC 3'(l8mer 50$ G/C) The RM was amplified at a range of annealing temperatures 2o using the C-25 primer in combination with both the F3-18 and F3-20 primers.
With the F3-20 primer all three targets (F1, 100 bp; F2, 150 bp; and F3, 200 bp) were amplified at 55°C or below and demonstrated that up to 2 mismatches could be tolerated within this temperature range.
2s Between 56°C and 65°C only the 150 and 200 by products could be seen showing the limitation of mismatch tolerance to a single base. Above 65°C
the amplification was observed to be specific with only the 200bp product seen.
When amplifications were performed using the Primer F3-18, 3o a higher level of specificity was observed and the 100 by target containing two mismatches to the primer was not produced under the conditions used.
Production of the 150 by target containing a single mismatch was restricted to annealing temperatures of 61 °C and below and total specificity observed at 62°C and above.
The results obtained using the F3-18 and F3-20 primers at different annealing temperatures are summarised below.
s 2. Effect of hot start PCR
Hot start PCR is often used as a way of ensuring or increasing amplification specificity. It can be achieved in a number of ways to including the use of the enzyme Taq GoIdT"" which is a thermal stable DNA
polymerase requiring heat activation. To determine the effect of hot start PCR when using a hot start procedure, the Taq polymerase was substituted with Taq GoIdT'". The effect of the Taq GoIdT"" enzyme was to reduce the annealing temperature at which the 150bp non-specific product is was produced from 65°C to 61 °C and the 100 by target from 55°C to 54°C
when using the F3-20 primer and the 150 by product from 61 °C to 56°C
when using the F3-18 primer. The results for both primers are summarised below.

O

,nO

N

O

N

O

,nO

N

N

N

M
N

N

a ~ N N

a~

~

N O N
~O

N
H

G ~ N N

~ N O N

N ~ N

N

h N v O

N ~ 0 ~

N N
~

et O O O

N

N

O O

r1 O

N N

O o_o N

I

w w The reference material clearly demonstrated that the use of a hot start procedure was to improve the specificity of the amplification as would be expected. It is clear that under a given set of reaction conditions where only the 200 by should have been amplified a compromise in specificity, such as the use of Taq rather than Taq GoIdT"', would have been clearly demonstrated by the production of an addition product of 150bp from the RM.
3. Effect of MgCl2 concentration.
The concentration of MgCl2 in a PCR reaction mix is often adjusted when optimising amplification conditions to achieve specificity.
The RM was amplified under a range of MgCl2 concentrations from 1-4 mM
to determine the effect of this parameter on its specificity pertormance.
The temperature at which the non-specific 150 by product was amplified is was up to and including 54, 62, 65, 65°C respectively when using the primer as summarised below. The results are summarised below. A
similar pattern was observed using the F3-20 primer with the non-specific temperature points being higher and the 100 by product additionally amplified (data not shown).

N N N

O O O

N

N

N

,n O O O O O

O O
~

N N N

O O O O O O

N N

N N

N

O h 0 O N ~ O h N N .-, y N

N N ~ N O

N

N

N N O N O N

OD

N N O N O

N

N

O O O O O O O

N N ~ O ~ O

N N

h N N O O

N N

t0 O O

N N O W C

N N

W O $ O O

N

et ~ ~ O

N N N ~ N

M O O O

O ~ N O

N

4. Use of the RM as an internal reference standard.
It was the intention of the RM design that the RM could be used as an internal control in other amplification reactions. In order to prove this to be feasible, the RM was added to a reaction which a product s of 584 by was specifically amplified from the bacterium E. coli. The optimised parameters for this amplification are 3mM MgCl2 and an annealing temperature of 62°C. High molecular weight DNA from E. coli strain W3110 (Sigma D0421 ) was used as a target in combination with the following primers to give a 584 by product.
~o EC 1653 5' CGGTTCCCGAAGGCACATTC 3' EC 1655 5' GAGTAAAGTTAATACCTTTGC 3' The RM was added to the E. coli reaction mix and ~s amplification performed under a range of annealing temperatures and MgCl2 concentrations using either the F3-18 or F3-20 primer set in combination with the E.coli primer set. The results of these experiments are summarised below.

O O O o N N N

p p N O O

0 O ~ o ~
N O ~ ~ O

N 0 N o h O O O

N N ~ O
0~

o N ~

h O O O N O

~ p ~ O ~ O
0 N N ~ ~ ,~ N
~
O

y ,. N o0 00 ~

p N oo ~n vy i M
~'"

N N o O ~O~ ~O'~

~ dNC
O ~

N
N .-~ v1 v~

.

o N O O

~o~ ~o ~o~
son n ~ ~o ~o~

oo ~ ~ V~ ~
..~ n v~ ~n ~n in v~

N O O O O O

C a0 O O O ~ O h O w O

y "" oo oo N ~ ~
h ,n 00 y~

ar N
C N N N p O O

o O O O po N O

~~ ~ OO ~OV
0 ~ 1 h ,n N 0 ~ .-r 0 p ~ ~ ~

O O

~0~ ~O~ 0000 ~~ ~O ~ CO
~

v1~ apy n N ~O
~n p v ~ n n ~ N
~

o N O O O O O O

O ~

O v ~ O ~ O h ~ ~ O ~ O
1 O O ~ ~
O

~

O O O

O v O ~ tt ~ ~ ~ O ~ O
O O ~ N
~1 O

O O O
N O N O N O
O O

o ~ O ~ et O ~' ~
O ~ O O
i ~
p p N o 0 ~
p -v~ v ~ n v~
i O O O O
~
~0 ~p0~0 0 ~0~0 ~ ~O~ ~O~O ~O

' W ~ n v ~

~!' N O N O o ~ N O N O
M O O O O O
O O
O

o o O ~ O t O N N ~ O O m v1 ~ O ~ ~n ~n O ~ O O

~

v 7 ~

~ !1 " '~ N ~
~

N M c The results of the amplifications were as expected clearly demonstrating that the RM could be used in combination with other targets and primer sets. Since it would not normally be possible to check the performance under a range of annealing temperatures and MgCl2 s concentrations in order to identify changes in expected performance, it would be preferred that only the 200 by specific product would be produced under the conditions of the assay and that the non-specific products would be amplified if the performance criteria ensuring specificity were compromised e.g. the annealing temperature achieved was lower than ~o intended as a result of incorrect thermal cycler calibration or poor block temperature uniformity. It is envisaged that the matching of RM
performance to designed amplification criteria would be achieved by further optimisation of parameters and adjusting primer annealing temperatures as required by adjusting the length and/or using DNA analogues which have is different contributions to melting temperatures than the standard DNA
bases. The use of the RM in such a manner would show whether the correct amplification conditions had been met in each individual reaction DISCUSSION
2o It has been demonstrated that the RM can be linearised and amplified under a range of conditions leading to the production of a range of targets according the level of specificity achieved in the amplification.
Specificity has been well documented in the scientific literature to be affected by parameters such as annealing time, annealing temperature, zs MgCl2 concentration and hot start PCR amongst others. The results presented demonstrate that specificity can be assayed by the production of a range of targets with closely related primer sites as found in the Reference Material and that the RM performs in a predictable way in response to variations in parameters well known to affect specificity. The ~o RM may be used in isolation to check for variations in specificity resulting from poor thermal cycler calibration and variations in temperature across the thermal cycler block as well as those introduced by the operator by incorrect or inaccurate additions of reagents. Similar performance of the RM has also been demonstrated in combination with other targets indicating the suitability of the RM for use as an internal positive control in s independent amplifications.
The design of the reference material is such that the amplification of the specific and non-specific targets can be identified by size and by mass using DNA probes and a range of fluorescent reporter molecules which can be monitored in real time.
~o References Barany, F. (1991) Genetic disease detection and DNA
amplification using clone thermostable ligase. Proc. Natl. Acad. Sci. (USA) 88:189-193.
~s Brown, J., Haydock, P. and Radany, E. (1990). Isothermal enzymatic amplification of HPV RNA using the 3SR reaction. J. Cell Biol.
111, 293.
Bush, C. E., Donovan, R. M., Peterson, W. R., Jennings, M.
B., Bolton, V., Sherman, D. G., Vanden, B. K., Beninsig, L. A. and Godscy.
2o J. H. (1992). Detection of human immunodeficiency virus type 1 RNA in plasma samples from high-risk pediatric patients by using the self-sustained sequence replication reaction. J. Clin. Microbiol. 30, 281-286.
Fang. P., Bouma, S., Jou, C., Gordon, J. and Beaudet, A. L.
(1995). Simultaneous analysis of mutant and normal alleles for multiple 2s cystic fibrosis mutations by the ligase chain reaction. Hum. Mutat 6, 144-151.
Hofler, H., Putz, B., Mueller, J. D., Neubert, W., Suffer, G.
and Gais, P. {1995). In situ amplification of measles virus RNA by the self-sustained sequence replication reaction. Lab. Invest. 73, 577-585.

Kievits, T., van Gemen, B., van Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H., Maick, L., Sooknanan, R. and Lens, P. (1991).
NASBAT"" isothermal enzymatic in vitro nucleic acid amplification optimised for the detection of HIV-1 infection. J. Virol. Meths. 35, 273-286.
s Laffler, T. G., Carrino, J. J. and Marshall, R. L. (1993). The ligase chain reaction in DNA-based diagnostics. Ann. Biol. Clin. 50, 821-826.
Lambertz, S.T., Ballagi-Pordany, A. and Lindqvist, R. (1998).
A mimic as internal standard to monitor PCR analysis of food-borne ~o pathogens. Letters in Applied Microbiol. 26: 9-11.
Lebedev, et al., (1996) Genetic Analysis - Biomolecular Engineering 13: 15-21.
McDowell, D.G., Burns, N.A. and Parkes. (1998). Localised sequence regions possessing high melting temperatures prevent the ~s amplification of a DNA mimic in competitive PCR. Nucleic Acids Research 26(14): 3340-3347.
Meyer, R., Hofelein, C., Luthy, J. and Candrian, U. (1995).
Polymerase chain reaction restriction fragment length polymorphism analysis: A simple method for species identification in food. J. AOAC Int.
20 78{6):1542-1551.
Nguyen, H.K., Auffray, P., Asseline, U., Dupret, D. and Thuong, N.T. {1997). Nucleic Acids Research 25: 3059-fi5.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988). Primer-directed 2s enzymatic amplification of DNA with thermostable DNA polymerase.
Science 239: 487-491.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim, N. (1985). Enzymatic amplification of (3-globin genomic sequences and restriction site analysis for diagnosis of sickle cell so anemia. Science 230: 1350-1354.

Uyttendaele, M., Schukkink, R., van Gemen, B. and Debevere, J. (1994). Identification of Campylobacter coli and Campylobacter lari by the nucleic acid amplification system NASBA~. J.
Appl. Bacteriol. 77, 694-701.
s Wang, A.M., Doyle, M.V.L. and Mark, D.F. (1989).
Quantification of mRNA by the polymerase chain reaction. Proc. Natl.
Acad. Sci. USA 86, 9717-9721.
Wiedmann, M., Czajka, J., Barany, F. and Batt, C. A. (1992).
Discrimination of Listeria monocytogenes from other Listeria species by ~o ligase chain reaction. Appl. Environ. Microbiol. 58 (11), 3443-3447.
Winn-Deen, E. S., Batt, C. A. and Wiedmann, M. (1993).
Non-radioactive detection of Mycobacterium tuberculosis LCR products in a microtitre plate format. Mol. CeIL Probes 7, 179-186.
is

Claims (35)

-37-

1. A nucleic acid reference material comprising:
(i) a first reference sequence having a pair of primer binding sites;
(ii) a second reference sequence having a pair of primer binding sites;
wherein the primer binding sites of (ii) are as for (i) except for the substitution of one or a few nucleotide bases.

2. The reference material according to claim 1, wherein the primer binding sites of the first reference sequence flank a first intervening sequence and the primer binding sites of the second reference sequence flank a second intervening sequence.

3. The reference material according to claim 2, wherein the first intervening sequence has a different length to the second intervening sequence.

4. The reference material according to claim 3, wherein the difference in length is detectable by size separation of (i) and (ii).

5. The reference material according to claim 4, wherein the reference sequences are multiples of about 50 nucleotides in length.

6. The reference material according to any one of claims 1 to 5, wherein the primer binding sites of (i) differ from the primer binding sites of (ii) in respect of one base substitution in one of the primer binding sites.

7. The reference material according to claim 6, wherein the base substitution is at or close to an end of the primer binding site adjacent to the intervening sequence.

8. The reference material according to claim 6 or claim 7, further comprising one or more additional reference sequences, each of which has a pair of primer binding sites flanking an intervening sequence, each successive additional reference sequence having an additional base substitution in the primer binding site and all of the intervening sequences of the reference sequences having different lengths.

9. The reference material according to claim 8, wherein the difference in length between each successive reference sequence is about 50 or about a multiple of 50 nucleotides.

10. The reference material according to and one of claims 1 to 9, wherein the primer binding sites are from 15 to 30 nucleotides long.

11. The reference material according to any one of claims 1 to 10, wherein the reference sequences are from 50 to 1000 nucleotides long.

12. The reference material according to claim 11, wherein the references sequences are from 100 to 500 nucleotides long.

13. The reference material according to any one of claims 1 to 12, wherein the reference sequences are present in a single DNA such as a plasmid.

14. The reference material according to claim 12, wherein a unique restriction enzyme site is located between each reference sequence in the DNA.

15. The reference material according to any one of claims 1 to 14, for use in PCR.

16. The reference material according to any one of claims 1 to 15 comprising a set of four or more reference sequences, wherein the four reference sequences are 100, 150, 200, and 250 nucleotides in length respectively and there is a 50 nucleotide increase in length with each additional reference sequence.

17. A kit comprising:
(i) the reference material as claimed in any one of claims 1 to 16; and (ii) a pair of oligonucleotide primers complementary to the first reference sequence primer binding sites.

18. The reference material or kit according to any one of claims 1 to 17, for verifying nucleic acid amplification reactions.

19. A method for amplifying a nucleic acid target sequence which method comprises:
(i) providing a pair of oligonucleotide primers complementary to the target sequence to be amplified;
(ii) providing a reference nucleic acid sequence having a pair of primer binding sites, which primer binding sites are complementary to the primers in (i) except for one or a few base pair mismatches in at least one of the primer binding sites;
(iii) performing an amplification reaction on a sample containing or suspected of containing the target nucleic acid sequence, using the primers of (i) and in the presence of the reference nucleic acid of (ii); and (iv) monitoring amplification of the target sequence and/or of the reference nucleic acid sequence.

20. The method according to claim 19, wherein the primer binding sites of the reference nucleic acid sequence flank an intervening sequence.

21. The method according to claim 20, wherein the amplified target sequence and the reference nucleic acid sequence are of different lengths.

22. The method according to claim 21, wherein (iv) includes the step of size separating the amplification products.

23. The method according to claim 21 or claim 22, wherein the difference in length is about 50 or about a multiple of 50 nucleotides.

24. The method according to any one of claims 19 to 23, wherein there is a single base pair mismatch between one of the primers and its otherwise complementary primer binding sites in the reference nucleic acid sequence.

25. The method according to claim 24, wherein the base pair mismatch is at or close to the 3' end of the primer.

26. The method according to claim 24 or claim 25, wherein one or more additional reference nucleic acid sequences are provided in (ii), each having a pair of primer binding sites flanking an intervening sequence, wherein each successive additional reference sequence has an additional base mismatch with the same primer in the same primer binding site and all of the intervening sequences of the reference sequences are of a different length.

27. The method according to claim 26, wherein the difference in length between each successive reference sequence is about 50 or about a multiple of 50 nucleotides.

28. The method according to any one of claims 19 to 27, wherein the primer binding sites are each from 15 to 30 nucleotides long.

29. The method according to any one of claims 19 to 28, wherein the reference sequences are from 50 to 1000 nucleotides long.

30. The method according to claim 29, wherein the reference sequences are from 100 to 500 nucleotides long.

31. The method according to any one of claims 19 to 30, wherein the reference sequences are provided in a single DNA such as a plasmid.

32. The method according to any one of claims 19 to 31, wherein the amplification reaction is PCR.

33. The method according to any one of claims 19 to 32, wherein step iv) is performed by determining the presence or absence of any amplification products of the target sequence and the reference nucleic acid sequence.

34. The method according to any one of claims 19 to 33, wherein in step iv) amplification is monitored in real time.

35. A method for monitoring a amplification system, which method comprises performing an amplification reaction on a nucleic acid reference material according to any one of claims 7 to 16 using the said amplification system and a pair of primers complementary to the primer binding sites of the first reference sequence, and determining which of the reference sequences are amplified.