CA2324514A1 - Methods for producing libraries of expressible gene sequences - Google Patents

Abstract

The present invention comprises a method for producing libraries of expressible gene sequences. The method of the invention allows for the simultaneous manipulation of multiple gene sequences and thus allows libraries to be created in an efficient and high throughput manner. The expression vectors containing verified gene sequences can be used to transfect cells for the production of recombinant proteins. The invention further comprises libraries of expressible gene sequences produced using the method of the invention and expression vectors used in the construction of said libraries.

Description

The invention disclosed herein relates to the fields of genomics and molecular biology. More specifically the invention relates to new high through-put methods of making libraries of expressed gene sequences and the libraries made using said methods.
Recent breakthroughs in nucleic acid sequencing technology have made possible the sequencing of entire genomes from a variety of organisms, including humans. The potential benefits of a complete genome sequence are many, ranging from applications in medicine to a greater understanding of evolutionary processes.
These benefits cannot be fully realized, however, without an understanding of how and where these newly sequenced genes function.
Traditionally, functional understanding started with recognizing an activity, isolating a protein associated with that activity, then identifying and isolating the gene, or genes, encoding that protein. Each gene of interest was identified, isolated and expressed separately, a relatively time consuming process.
Recently, breakthroughs in high through-put DNA sequencing technology have allowed massive amounts of gene sequence information to become available to the public. Yet methods of expressing these sequences to produce the proteins encoded by them for study have still required that each sequence be manipulated one at a time. Accordingly, a need exists for the development of methods for the rapid, simultaneous expression of large numbers of gene sequences. The invention described herein addresses this and related needs as will become apparent upon inspection of the specification and the appended claims.

Brief R~sc~'ntion of the Invention The present invention comprises a method for producing libraries of expressible gene sequences. The method of the invention allows for the simultaneous manipulation of multiple gene sequences and thus allows libraries to be created in an efficient and high through-put manner. The expression vectors containing verified gene sequences can be used to transfect cells for the production of recombinant proteins. The invention method utilizes known techniques in such a way as to create an efficient high through-put means of producing libraries of expressible gene sequences.
The invention further comprises libraries of expressible gene sequences produced using the method of the invention and expression vectors used in the construction of such libraries.
Figure 1 shows a schematic representation of the vaccinia topoisomerase type I cloning method used in the practice of the invention.
The present invention comprises a method for producing libraries of expressible gene sequences. The invention method comprises the following steps:
amplifying a plurality of gene sequences, purifying the amplified gene sequences, inserting each of the purified gene sequences into an expression vector, and verifying the size and orientation of the inserted gene sequence.
In the first step, the gene sequences that are to be expressed are amplified.
By "amplification" it is meant that the copy number of the gene sequences) is increased.
One commonly used method of amplification is the polymerase chain reaction (PCR).
In brief, starter DNA is heat-denatured into single strands. Two synthetic oligonucleotides, one complementary to sequence at the 3' end of the sense strand of DNA segment of interest and the other complementary to the sequence at the 3' end of the anti-sense strand of a DNA segment of interest, are added in great excess to the DNA sequence to be amplified and the temperature is lowered to 50 - 60°
C. The specific oligonucleotides hybridize with the complementary sequences in the DNA
and then serve as primers of DNA chain synthesis, which requires the addition of a supply of deoxynucleotides and a temperature-resistant DNA polymerase, such as Taq polymerase, which can extend the primers at temperatures up to 72° C.
When synthesis is complete, the whole mixture is heated further (up to 95°
C) to melt the newly formed DNA duplexes. When the temperature is lowered again, another round of synthesis takes place, since an excess of primer is still present. Repeated cycles of synthesis and melting quickly amplify the sequence of interest. A more detailed description of PCR can be found in Erlich, Ed, PCR Technology: Principles and Applications for DNA Amplification, W.H. Freeman and Co., 1992 and Erlich, et al, Eds., Polymerase Chain Reaction, Cold Spring Harbor Laboratory, 1989, both of which are incorporated by reference herein.
Starter DNA can come from a variety of sources. It can be total genomic DNA from an organism, for example, or can be cDNA that has been synthesized from cellular mRNA using reverse transcriptase. Sources of suitable RNA include normal and diseased tissues, cellular extracts, and the like.
In practicing the method of the invention, the desired gene sequences can come from any source. The examples presented below show the amplification of all open reading frames (ORFs) from a single organism, Saccharomyces cerevisiae, for example. By "open reading frame" it is meant a segment of DNA that exists between a start codon and a stop codon and is likely to represent a gene. The examples presented below further show the amplification of a group of human genes thought to be important in the development of cancer.
Public databases exist that contain the entire or partial genome of a particular organism, for example yeast (Saccharomyces cerevisiae), prokaryotes (Bacillus subtilis, E. coli, Borrelia burgdorferi, Helicobacter pylori, Mycoplasma genitalium, and the like), fish (Fugu rubripes), mammals (human, mouse), plants (rice, cotton) WO 99/S17b6 PCTNS99/07270 and the like. Well known databases include GenBank, Unigene, EMBL, IMAGE and TIGR, for example. Public databases such as these can be used a source of gene sequences for use in the method of the invention.
The primers employed in the amplification step are specific for each desired gene sequence and include a variety of unique features. For example, the 5' "sense"
primer starts with the sequence S'-CACC~... (the start codon is underlined).
The CACC sequence is added as a Kozak consensus that aids in translational efficiency.
When the gene sequence being amplified represents a full-length gene, the 3' "antisense" codon is preferably designed to make the amplification product end at the 3rd position of the last codon of the gene being amplified, plus a single adenine residue. This facilitates the fusion of the coding region in-frame with a heterologous peptide sequence such as an epitope tag, an affinity purification tag, and the like (see below). The gene sequence need not encode a full-length sequence, however, as the invention methods are equally suitable for any gene sequence, including Expressed Sequence Tags (ESTs). The primers can be synthesized and dried in multiwell formats, such as 96-well microtiter plates to facilitate identification and fiuther processing.
The amplified gene products are next isolated from the other components of the amplification reaction mixture. This purification can be accomplished using a variety of methodologies such as column chromatography, gel electrophoresis, and the like. A preferred method of purification utilizes low-melt agarose gel electrophoresis.
The reaction mixture is separated and visualized by suitable means, e.g. by ethidium bromide staining. DNA bands that represent correctly sized amplification products are cut away from the rest of the gel and placed into appropriate corresponding wells of a 96-well microtiter plate. These plugs are subsequently melted and the DNA
contained therein utilized as cloning inserts. The use of gel electrophoresis has the advantage that the practitioner can purify the desired amplified gene sequence while additionally verifying that the sequence is of the correct size, i.e., represents the entire desired gene sequence.

The purified, amplified gene sequences are next inserted into an expression vector. A variety of expression vectors are suitable for use in the method of the invention, both for prokaryotic expression and eukaryotic expression. In general, the expression vector will have one or more of the following features: a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an affinity purification tag sequence, an inducible element sequence, an epitope-tag sequence, and the like.
Promoter-enhancer sequences are DNA sequences to which RNA polymerase binds and initiates transcription. The promoter determines the polarity of the transcript by specifying which strand will be transcribed. Bacterial prnmoters consist of consensus sequences, -35 and -10 nucleotides relative to the transcriptional start, which are bound by a specific sigma factor and RNA polymerase. Eukaryotic promoters are more complex. Most promoters utilized in expression vectors are transcribed by RNA polymerase II. General transcription factors (GTFs) first bind 1 S specific sequences near the start and then recruit the binding of RNA
polymerase II.
In addition to these minimal promoter elements, small sequence elements are recognized specifically by modular DNA-binding/trans-activating proteins (e.g.
AP-1, SP-1) which regulate the activity of a given promoter. Viral promoters serve the same function as bacterial or eukaryotic promoters and either provide a specific RNA
polymerase in traps (bacteriophage T7) or recruit cellular factors and RNA
polymerase (SV40, RSV, CMV). Viral promoters are preferred as they are generally particularly strong promoters.
Promoters may be, furthermore, either constitutive or, more preferably, regulatable (i.e., inducible or derepressible). Inducible elements are DNA
sequence elements which act in conjunction with promoters and bind either repressors (e.g.
lac0/LAC Iq repressor system in E. coli) or inducers (e.g. gall/GAL4 inducer system in yeast). In either case, transcription is virtually "shut off' until the promoter is derepressed or induced, at which point transcription is "turned-on".

Examples of constitutive promoters include the int promoter of bacteriophage ~,, the bla promoter of the ø-lactamase gene sequence of pBR322, the CAT
promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like.
Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage (PL and P~, the trp, reca, lacZ, LacI, Ara.C and gal promoters of E. coli, the a.-amylase (Ulmanen et al., J. Bacteriol. x:176-182, 1985) and the sigma-28-specific promoters of B. subtilis (Gilman et al., Gene sequence 32:11-20(1984)), the promoters of the bacteriophages of Bacillus (Gryczan, In:
The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982)), Streptomyces promoters (Ward et al., Mol. Gen. Genet. x:468-478, 1986), and the like.
Exemplary prokaryotic promoters are reviewed by Glick {J. Ind. Microbiol.
x:277-282, 1987); Cenatiempo (Biochimie x$:505-516, 1986); and Gottesman (Ann. Rev.
Genet.1$:415-442, 1984).
Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al., J. Mol. Appl. Gen.1:273-288, 1982); the TK promoter of Herpes virus (McKnight, Cell x:355-365, 1982); the SV40 early promoter (Benoist et al., Nature (London) ~QQ:304-310, 1981); the yeast gal l gene sequence promoter (Johnston et al., Proc. Natl. Acad Sci. (USAI
22:6971-6975, 1982); Silver et al., Proc. Natl. Acad. Sci. (LISA) $1:5951-5955, 1984), the CMV promoter, the EF-1 promoter, Ecdysone-responsive promoter(s), and the like.
Selection marker sequences are valuable elements in expression vectors as they provide a means to select for growth only those cells which contain a vector.
Such markers are of two types: drug resistance and auxotrophic. A drug resistance marker enables cells to detoxify an exogenously added drug that would otherwise kill the cell. Auxotrophic markers allow cells to synthesize an essential component (usually an amino acid) while grown in media which lacks that essential component.
Common selectable marker gene sequences include those for resistance to antibiotics such as ampicillin, tetracycline, kanamycin, streptomycin, bleomycin, hygromycin, neomycin, ZeocinTM, and the like. Selectable auxotrophic gene sequences include, for example, hisD, which allows growth in histidine free media in the presence of histidinol.
A preferred selectable marker sequence for use in yeast expression systems is URA3. Laboratory yeast strains carrying mutations in the gene which encodes orotidine-5'-phosphate decarboxylase, an enzyme essential for uracil biosynthesis, are unable to grow in the absence of exogenous uracil. A copy of the wild-type gene (ura4+ in S. pombe and URA3 in S. cerevisiae) will complement this defect in trans.
A further element useful in an expression vector is an origin of replication sequence. Replication origins are unique DNA segments that contain multiple short repeated sequences that are recognized by multimeric origin-binding proteins and which play a key role in assembling DNA replication enzymes at the origin site.
Suitable origins of replication for use in expression vectors employed herein include E coli oriC, 2p, and ARS (both useful in yeast systems), sfl, SV40 (useful in I S mammalian systems), and the like.
Additional elements that can be included in expression vectors employed in the invention method are sequences encoding affinity purification tags or epitope tags.
Affinity purification tags are generally peptide sequences that can interact with a binding partner immobilized on a solid support. Synthetic DNA sequences encoding multiple consecutive single amino acids, such as histidine, when fused to the expressed protein, may be used for one-step purification of the recombinant protein by high affinity binding to a resin column, such as nickel sepharose. An endopeptidase recognition sequence is often engineered between the polyamino acid tag and the protein of interest to allow subsequent removal of the leader peptide by digestion with a specific protease. Sequences encoding peptides such as the chitin binding domain (which binds to chitin), glutathione-S-transferase (which binds to glutathione), biotin (which binds to avidin or strepavidin), and the like can also be used for facilitating purification of the protein of interest. The affinity purification tag can be separated from the protein of interest by methods well known in the art, including the use of inteins (protein self splicing elements, Chong, et al, Gene .122:271-281, 1997).
Epitope tags are short peptide sequences that are recognized by epitope specific antibodies. A fusion protein comprising a recombinant protein and an epitope tag can be simply and easily purified using an antibody bound to a chromatography resin. The presence of the epitope tag furthermore allows the recombinant protein to be detected in subsequent assays, such as Western blots, without having to produce an antibody specific for the recombinant protein itself. Examples of commonly used epitope tags include V5, glutathione-S-transferase (GST), hemaglutinin (HA), the peptide Phe-His-His-Thr-Thr, chitin binding domain, and the like.
A further useful element in an expression vector is a multiple cloning site or polylinker. Synthetic DNA encoding a series of restriction endonuclease recognition sites is inserted into a plasmid vector downstream of the promoter element.
These sites are engineered for convenient cloning of DNA into the vector at a specific 1 S position.
The foregoing elements can be combined to produce expression vectors useful in the practice of the present invention. Suitable prokaryotic vectors include plasmids such as those capable of replication in E. coli (for example, pBR322, ColEl, pSC101, PACYC 184, itVX, pRSET, pBAD (Invitrogen, Carlsbad, CA) and the like). Such plasmids are disclosed by Sambrook (cf. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989)). Bacillus plasmids include pC194, pC221, pT127, and the like, and are disclosed by Gryczan (In: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329). Suitable Streptomyces plasmids include p1J101 (Kendall et al., J. Bacteriol. xø2:4177-4183,1987), and streptomyces bacteriophages such as ~C31 (Chater et al., In: Sixth International Symposium on Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986), pp. 45-54).

Pseudomonas plasmids are reviewed by John et al. (Rev. Infect. Dis. $:693-704, 1986), and Izaki (Jpn. J. Bacteriol. 3:729-742, 1978).
Suitable eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-micron circle, pcDNA3.1, pCDNA3.l/GS, pYES2/GS, pMT, p IND, pIND(Spl), pVgRXR (Invitrogen), and the like, or their derivatives. Such plasmids are well known in the art (Botstein et al., Miami Wntr. Symp. ,x:265-274, 1982);
Broach, In:
"The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470, 1981;
Broach, Cell x$:203-204, 1982; Dilon et al., J Clin. Hematol. Oncol. I,Q:39-48, 1980;
Maniatis, In: Cell Biology: A Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic Press, NY, pp. 563-608, 1980).
Construction of chimaeric DNA molecules in vitro relies traditionally on two enzymatic steps catalyzed by separate protein components. PCR amplification or site-specific restriction endonucleases are used to generate linear DNAs with defined termini that can then be joined covalently at their ends via the action of DNA
ligase.
DNA ligase has limitations, however, in that it is relatively slow acting and temperature sensitive.
Thus, when inserting the purified, amplified gene sequence into the expression vector the use of an enzyme that can both cleave and religate DNA in a site specific manner is preferred. Any site-specific enzyme of this type is suitable, for example, a type I topoisomerase or a site-specific recombinase. Examples of suitable site-specific recombinases include lambda integrase, FLP recombinase, P1-Cre protein, Kw recombinase, and the like (Pan, et al, J. Biol. Chem. ?x$:3683-3689, 1993;
Nunes-Duby, et al, EMBO J.1~:4421-4430, 1994; Hallet and Sherratt, FEMS
Microbio. Revs ?,1:157-178, 1997; Ringrose, et al, Eur J. Biochem X4$:903-912, 1997).
A particularly suitable enzyme for use in the invention method is a type I
topoisomerase, particularly vaccinia DNA topoisomerase. Vaccinia DNA

topoisomerase binds to duplex DNA and cleaves the phosphodiester backbone of one strand. The enzyme exhibits a high level of sequence specificity, akin to that of a restriction endonuclease. Cleavage occurs at a consensus pentapyrimidine element 5'-(C/T)CCTT in the scissile strand. In the cleavage reaction, bond energy is conserved via the formation of a covalent adduct between the 3' phosphate of the incised strand and a tyrosyl residue of the protein. Vaccinia topoisomerase can religate the covalently held strand across the same bond originally cleaved (as occurs during DNA relaxation) or it can religate to a heterologous acceptor DNA and thereby create a recombinant molecule.
10 When the substrate is configured such that the scissile bond is situated near (within 10 basepairs ofj the 3' end of a DNA duplex, cleavage is accompanied by the spontaneous dissociation of the downstream portion of the cleaved strand. The resulting topoisomerase-DNA complex, containing a 5' single-stranded tail, can religate to an acceptor DNA if the acceptor molecule has a 5' OH tail complementary 1 S to that of the activated donor complex.
In accordance with the present invention, this reaction has been optimized for joining PCR-amplified DNA fragments into plasmid vectors (See Figure 1). PCR
fragments are naturally good surrogate substrates for the topoisomerase I
religation step because they generally have 5' hydroxyl residues from the primers used for the amplification reaction. The 5' hydroxyl is the substrate for the religation reactions.
The use of vaccinia topoisomerase type I for cloning is described in detail in copending US patent application serial number 08/358,344, filed 12/19/94, incorporated by reference herein in its entirety.
The gene sequence being inserted into the expression vector can insert in either the sense or antisense direction. Therefore, the invention method provides for verification of both the size and orientation of the insert to insure that the gene sequence will express the desired protein. Preferably, the insert plus vector is utilized in a standard bacterial transformation reaction and the contents of the transformation plated onto selective growth media. Bacterial transformation and growth selection procedures are well known in the art and described in detail in, for example, Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed. 1995.
Individual bacterial colonies are picked and grown in individual wells of a multiwell microtiter plate containing selective growth media. An aliquot of these cells is used directly in a diagnostic PCR reaction. Primers for this reaction are designed such that only plasmids with correctly oriented inserts give amplification product. The amplified DNA is separated and visualized by SDS-PAGE gel electrophoresis using standard protocols (see Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed. 1995).
Performing the PCR reaction directly from the cultured cell lysates, rather than first preparing DNA from the bacteria, is a particular advantage of the invention method as it significantly reduces both the time needed to generate the required data and the cost of doing so.
1 S Once plasmids containing the gene sequence insert in the correct orientation have been identified, plasmid DNA is prepared for use in the transformation of host cells for expression. Methods of preparing plasmid DNA and transformation of cells are well known to those skilled in the art. Such methods are described, for example, in Ausubel, et al, supra.
Prokaryotic hosts are, generally, very efficient and convenient for the production of recombinant proteins and are, therefore, one type of preferred expression system. Prokaryotes most frequently are represented by various strains of E. coli. However, other organisms may also be used, including other bacterial strains.
Recognized prokaryotic hosts include bacteria such as E. coli and those from genera such as Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. However, under such conditions, the polypeptide will not be glycosylated. The prokaryotic host selected for use herein must be compatible with the replicon and control sequences in the expression plasmid.

Suitable hosts may often include eukaryotic cells. Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, and mammalian cells either in vivo, or in tissue culture. Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO, 3T3 or CHOKI, HEK 293 cells or cells of lymphoid origin (such as 32D cells) and their derivatives. Preferred mammalian host cells include nonadherent cells such as CHO, 32D, and the like. Preferred yeast host cells include S. pombe, Pichia pastoris, S. cerevisiae (such as INVScl), and the like.
In addition, plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, nopaline synthase promoter and polyadenylation signal sequences, and the like.
Another preferred host is an insect cell, for example the Drosophila larvae.
Using insect cells as hosts, the Drosophila alcohol dehydrogenase or MT promoter can be used. Rubin, Science ~,Q:1453-1459, 1988). Alternatively, baculovirus vectors can be engineered to express large amounts of peptide encoded by a desire gene sequence in insects cells (Jasny, Science 2$:1653, 1987); Miller et al., In: Genetic Engineering (1986), Setlow, J.K., et al., eds., Plenum, Vol. 8, pp. 277-297).
In a further embodiment of the invention, there are provided libraries of expressible gene sequences produced by the methods of the invention. As shown in more detail in the Examples presented below, such libraries comprise gene sequences from a variety of sources such as yeast, mammals (including humans), and the like.
The present invention also features the purified, isolated or enriched versions of the expressed gene products produced by the methods described above.
Kits comprising one or more containers or vials containing components for using the libraries of the present invention are also within the scope of the invention.
Kits can comprise any one or more of the following elements: one or more expressible gene sequences, cells which are or can be transfected with said gene sequences, and antibodies recognizing the expressed gene product or an epitope tag associated therewith. Cells suitable for inclusion in such a kit include bacterial cells, yeast cells (such as INVScl), insect cells or mammalian cells {such as CHO).

WO 99/51766 PC'T/US99/07270 In one embodiment, such a kit can comprises a detergent solution, preferably the Trax~ lysing reagent (6% NP-40 and 9% Triton X-100 in 1X PBS). Also included in the kit can be one or more binding partners, e.g., an antibody or antibodies, preferably a pair of antibodies to the same expressed gene product, which preferably do not compete for the same binding site on the expressed gene product.
In another embodiment, a kit can comprise more than one pair of such antibodies or other binding partners, each pair directed against a different target molecule, thus allowing the detection or measurement of a plurality of such target molecules in a sample. In a specific embodiment, one binding partner of the kit may be pre-adsorbed to a solid phase matrix, or alternatively, the binding partner and matrix are supplied separately and the attachment is performed as part of the assay procedure. The kit preferably contains the other necessary washing reagents well-known in the art. For EIA, the kit contains the chromogenic substrate as well as a reagent for stopping the enzymatic reaction when color development has occurred.
The substrate included in the kit is one appropriate for the enzyme conjugated to one of the antibody preparations. These are well-known in the art, and some are exemplified below. The kit can optionally also comprise a target molecule standard;
i.e., an amount of purified target molecule that is the target molecule being detected or measured.
In a specific embodiment, a kit of the invention comprises in one or more containers: (1 ) a solid phase Garner, such as a microtiter plate coated with a first binding partner; (2) a detectably labeled second binding partner which binds to the same expressed gene product as the first binding partner; (3) a standard sample of the expressed gene product recognized by the first and second binding partners;
(4) concentrated detergent solution; and (S) optionally, diluent.
The invention will now be described in greater detail by reference to the following non-limiting examples.

WO 99/517b6 PCT/US99/07270 The following example illustrates the creation of a library of expressible yeast gene sequences.
Amplification -6,032 yeast ORFs and a corresponding gene-specific primer of the 3' end of each were obtained from Research Genetics (Huntsville, AL) in a 96-well microtiter plate format at a concentration of 0.3 ng/p,l. Each gene specific primer was designed to exclude the gene's stop codon. Since the templates each contain a common sequence immediately 5' of the start ATG (5'-GCAGTCCTGGAATTCCAGCTGACCACC) (SEQ ID NO:1 ), it was possible to amplify each template with a common 5' primer.
5 p,l of ORF template was added to a fresh 96-well microtiter plate (polycarbonate Thermowell Thinwall, Model M. Cat # 6511 ) using a 12 channel pipetter. 6 pl of specific 3' primer solution (2 p.M) was added and the total volume per well brought to 30 p.l with PCR cocktail, immediately after which the plate was placed on ice. (PCR cocktail for 120 reactions - 720 pl SX Buffer J, 48 p,l dNTPs (SOmM stock), 12 ~,1 common 5' primer (1 p,g/pl stock), 48 pl Taq DNA
polymerise (Boeringer-Mannheim or Promega, 5 units/pl), 1.92 p,l Pfu DNA polymerise (Stratgene, cat. # 600153-81, 2.5 units/pl) and 1464 p,l distilled water. SX
Buffer J:
300 mM Tris (pH 9.5), 75 mM ammonium sulfate, 10 mM MgCl2). The rubber Hybaid Micromat lid was washed by soaking in 0.1 M HCI, the rinsed for 2 minutes with distilled water and dried completely before applying to the 96-well plate.
The PCR reaction was performed using a Hybaid, Ltd. (Middlesex, LTK) thermo-cycler according to the manufacturer's instructions. The conditions used were as follows: pre-melt step: 94° C x 4 min; melt step: 94° C x 30 sec, anneal step: 58°
C x 45 sec, extend step: 72° C x 3 min - repeated for 25 cycles; final extension: 72°
C x 4 min; final block temperature set to room temp (approx. 22° C).
The plates were stored at 4° C.

Purification -The plates were spun briefly at 1000 rpm, then 10 pl of 6X gel loading dye was added to each well (6X gel Loading dye: 6 mM Tris (pH 8), 6 mM EDTA, 0.03%
Bromphenol Blue, 30% glycerol). The entire contents of each well were Loaded onto 5 a 1 % low melt agarose (Invitrogen # 46-O 150) gel (plus ethidium bromide at 20 pl of a 10 mg/ml solution added to 400 mls of agarose) in 1X TAE (SOX TAE = 2428 Tris base, 57.1 ml glacial acetic acid, 100 ml 0.5 M EDTA, pH 8.0 per liter (water)) and run at I 10 - 120 volts for 1.25 to 1.5 hours. A IJV light box was used to visualize the amplification products and ensure that only correct-sized PCR products are used in the 10 insertion step.
Insertion into expression vectors) -The portion of each lane containing the amplified gene sequence was cut from the gel and transferred to a well in a 96-well microtiter plate, melted on a heat block (75° C), and a portion of the melt mufti-channel pipetted into a 96-well microtiter 15 plate (7 ~,i/well) containing one of two expression vectors: TOPO-adapted pcDNA3.1 /GS or pYES2/GS (Invitrogen, Carlsbad, CA) previously digested with HindIII. The plate was covered with parafilm and incubated at 37° C for 7 minutes.
Top 10 Chemically Competent Cells (Invitrogen) were added to each well (45 g,l/well, O.D.=4.7), whereupon the plate was re-covered and incubated on ice for S
minutes.
The cells were then heat shocked on a 42° C block for 1 minute and returned to ice for 1 minute. An aliquot of SOC medium was added to each well (150 ~tl, 20g tryptone, Sg yeast extract, O.Sg NaCI, 250 mM KCI, 20 ml 1M glucose/Liter), and the plate was incubated at 37° C for 90 to 120 minutes.
The contents of each well were plated onto a LB(1 Og tryptone, Sg yeast extract, l Og NaCI per liter)/L .5% agar petrie plate containing the appropriate selection marker (ampicillin (50 pg/ml) for pYES2/GS and ZeocinT"' (25 pg/ml) for pcDNA3.1/GS). The petrie plates were grown overnight at 37° C.
Verification of size and orientation -WO 99/51766 PCTlUS99/07270 Contamination is a potentially serious problem in this step. Care should be taken to guard against contaminating the process through airborne contamination, unsterile reagents or equipment, or well-to-well contamination.
Eight colonies were picked from each petrie plate and placed in eight individual wells of a 96-well microtiter plate. Each well contained 100 pl of plus 100 ltg/ml ampicillin or 50 p,g/ml ZeocinTM as appropriate for the expression vector used. The plates were incubated overnight at 37° C.
The plates were spun briefly at 1000 rpm. The cells were stirred by pipetting up and down in a pipetter, then 2 pl from each well was transferred to a corresponding well in a PCR reaction plate containing 28 pl/well PCR cocktail (PCR cocktail for 840 reactions - 5040 p,l SX Buffer J, 336 ~tl dNTPs (SOmM stock), 84 p.l common 5' primer (1 p,g/~tl stock, Dalton Chemical Lab. Inc, Ont. CAN), 84 p,l 3' H6stopprevu primer (1 pg/pl, Dalton Chemical Lab. Inc, Ont. CAN), 336 pl Taq DNA
polymerase (Boeringer-Mannheim or Promega, 5 units/~1), and 17.64 mls distilled water.
H6stopprevu primer has the sequence 5' AAA CTC AAT GGT GAT GGT GAT GAT
GACC - 3') (SEQ ID N0:2).
The PCR reaction was run essentially as described above with the following cycle: pre-melt step: 94° C x 10 min; melt step: 94° C x 1 min, anneal step: 67° C x 1 min, extend step: 72° C x 3 min - 35 cycles; final extension:
72° C x 4 min; final block temp set to room temp (approximately 22° C). The plates were spun briefly at 100 rpm and 6 pl of 6X gel loading dye added to each well. Samples were run on a 1 % agarose gel which was subsequently stained with ethidium bromide. Only plasmids with correctly oriented inserts give an amplification product in this step.
The location of the positive clones was entered into a database and a spreadsheet of positive clones generated. The spreadsheet was downloaded onto a Qiagen BioRobot 9600TM to direct the re-racking of the positive cultures into deep-well culture blocks. Essentially, a single positive culture for each clone was grown and used to prepare plasmid DNA according to the Quia-Prep Turbo protocol.
CHO cells were transfected with the prepared plasmid DNA using the Pfx-6 PerFect Lipid system (Invitrogen, Cat #T930-16). Yeast cells (INVScl) were transfected using the S.C. EasyComp Transformation kit (Invitrogen, Cat #K5050-0 i ). Expression was verified by Western blot using anti-VS antibody to detect the epitope tag. A total of 558 clones expressing a correct protein were obtained after a single pass.
The following example illustrates the construction of a library of expressible human gene sequences using the method of the invention. Primers were constructed based on sequences of human genes available from GenBank.
Fetal human heart tissue was obtained from the International Institute for the Advancement of Medicine (IIAM). Poly A+ mRNA was isolated using the 1 S FastTrackTM 2.0 Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The mRNA was converted to first-strand cDNA using a cDNA Cycle~
Kit (Invitrogen) using the oligo dT primer provided and the protocols suggested. A
single cDNA synthesis reaction was split into 12 separate wells of a 96-well PCR
amplification plate, and PCR amplifications were performed using specific primer sets, essentially as described above, with the exception that the ratio of Taq to Pfu was 50:1 in the initial amplification (final conc. 2 U Taq:0.04 U Pfu/well).
Primers were synthesized using a Primerstation 960 (Intelligent Automation Systems, Inc.) used according to the manufacturer's instructions and were designed from sequences downloaded from Unigene and sent directly to the synthesizer.
Approximately 15 nMoles of each primer, having an average length of 25 basepairs, was synthesized in a 96-well format. After synthesis, the primers were cleaved from the supports, deprotected and dried in the same 96-well format (see manufacturer's instructions).

The amplified gene sequences were purified and inserted into the pcDNA3.l/GS expression vector essentially as described above. The expression vectors containing sequences verified to be in the correct orientation were transfected into CHO cells in 96-well deep-well blocks using the Pfx-6 PerFect Lipid system (Invitrogen, Cat #T930-16). Cell lysates were made 48 hours after transfection, and the lysates were separated by SDS-PAGE and analyzed by Western blot according to standard protocols using an anti-VS epitope tag Mab/horseradish peroxidase conjugate. Table 1 lists the human proteins successfully expressed using this methodology. A total of 66 clones expressing a correct protein, out of 118, were obtained after a single pass.
Table 1 - Human ORFs Plate NumberAccession Description PredictedActual Number Size Size M235 C7 H-A06977 albumin 67.1 67.OkDa E1 H-AB002391 Human mRNA for ICIAA039368 . 6g gene, complete cds H3 H-AB006969 Homo Sapiens hGAA 68.42 70 1 mRNA, complete cds E2 H-AB007875 Homo Sapiens KIAA041551.48 51 mRNA, complete cds D 1 H-AB007887 Homo Sapiens KIAA042766.55 70 mRNA, complete cds M421 D6 H-AB010710 Homo Sapiens mRNA 30.14 45.OkDa for lectin-- like oxidized LDL
receptor, complete cds G3 H-AD001528 Homo Sapiens spenmidine40.37 40 aminopropyltransferase mRNA, complete cds BS H-AE000659 Homo Sapiens T-cell 12.39 16 receptor alpha delta locus from bases 250472 to 501670 (section 2 of 5) of the C

E2 H-AF004022 Homo Sapiens protein 38.28 44 kinase mRNA, complete cds M428 C1 H-AF004231 Homo sapiens 65.78 70.OkDa monocyte/macrophage Ig-related receptor MIR-10 (MIR
cl-10) mRNA, complete cds AS H-AF004327 Homo Sapiens angiopoietin-254.67 60 mRNA, complete cds C1 H-AF006501 Homo Sapiens chromosome14.08 24 cosmid clone c1155, RNA

polymerase II subunit 14.4 kDa (POLRF) gene, complete cds H4 H-AF008936 Homo sapiens syntaxin-16B35.75 47 m RNA, complete c ds HS H-AF009243 _ 22.33 36 _ Homo Sapiens proline-rich Gla protein 2 (PRGP2) mRNA, complete cds M462 D6 H-AF013249 Homo Sapiens leukocyte-31.68 40.OkDa associated Ig-like receptor-1 (LAIR-1) mRNA, complete cds A 1 H-AF013512 untitled 53.02 53 A3 H-AF013970 Homo Sapiens MTGB-like66.55 70 protein (MTGRI) mRNA, complete cds M467 A7 H-AF014807 Homo sapiens 23.54 29.OkDa phosphatidylinositol synthase (PIS) mRNA, complete cds D2 H-AF015257 Homo sapiens flow-induced41.36 40 endothelial G protein-coupled receptor (FEG-1) mRNA, complete cds M422 B5 H-AF017307 Homo sapiens Ets-related40.92 49.OkDa transcription factor (ERT) mRNA, complete cds A6 H-AF017656 Homo Sapiens G protein38.94 48 beta 5 subunit mRNA, complete cds EI H-AF017995 Homo sapiens 3-phosphoinositide61.27 52 dependent protein kinase-1 (PDK1) mRNA, complete cds G 1 H-AF019612 Homo sapiens S2P 57.2 57 mRNA, complete cds D3 H-AF020591 Homo sapiens zinc 78.76 74 forger protein mRNA, complete cds A7 H-AF022385 Homo Sapiens apoptosis-related23.43 33 protein TFAR15 (TFAR15) mRNA, complete cds H6 H-AF024714 Homo sapiens interferon-37.84 48 inducible protein (AIM2) mRNA, complete cds B1 H-AF025527 Homo Sapiens leucocyte48.4 47 immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds M424 B4 H-AF025532 Homo Sapiens leucocyte49.39 59.OkDa immunoglobulin-like receptor-5 (LIR-5) mRNA, complete cds H5 H-AF026071 Homo Sapiens soluble30.58 50 death receptor 3 beta (DR3) mRNA, complete cds -M428 A1 H-AF026273 Homo sapiens interleukin-165.01 68.OkDa receptor-associated kinase-2 mRNA, complete cds B6 N-AF026293 Homo Sapiens chaperonin58.96 58 containing t-complex polypeptide 1, beta subunit (Cctb) mRNA, complete cds B5 H-AF026548 Homo sapiens branched45.43 50 chain alpha-ketoacid dehydrogenase kinase precursor, mRNA, nuclear gene encoding mitochondrial protein, complete cds B2 H-AF027204 Homo Sapiens putative21.78 27 tetraspan transmembrane protein (TM4SF5) mRNA, complete cds M426 D3 H-AF028008 Homo Sapiens SP1-like56.43 64.OkDa zinc forger transcription factor SLP

mltNA, complete cds B 1 H-AF029232 Homo Sapiens calpamodulin70.62 70 (CalpM) mRNA, complete cds M422 A7 H-AF029761 Homo sapiens decoy 42.57 50.OkDa receptor 2 mltNA, complete cds M477 F3 H-AF029893 Homo Sapiens i-beta-1,3-N-45.76 50.OkDa acetylglucosaminyltransferase mRNA, complete cds C5 H-AF032437 Homo sapiens mitogen 51.92 SO
activated protein kinase activated protein kinase gene, complete cds M416 F3 H-AF035824 Homo sapiens vesicle 25.63 36.OkDa soluble NSF attachment protein receptor (VTI1) mRNA, complete cds F3 H-AF037335 Homo Sapiens carbonic39.05 39 anhydrase precursor (CA 12) mIZNA, complete cds G I H-AF039019 Homo sapiens zinc 87.45 87 forger DNA

binding protein 89 kDa (ZBP-89) mIZNA, complete cds G 1 H-AF039136 Homo sapiens Fas binding81.51 98 protein (hDaxx) m)ZIVA, complete cds A7 H-AF0407U5 Homo sapiens putative31.57 41 tumor suppressor protein unspliced form (Fus-2) m)ZNA, complete cds M469 F1 H-AF040958 Homo sapiens lysosomal45.76 46.OkDa neuraminidase precursor, mltNA, complete cds G2 _ Homo sapiens Shab-related54.12 64 delayed-rectifier K+ channel alpha subunit (Kv9.3) mIZNA, complete cds E2 H-AJ001340 Homo Sapiens mRNA 52.36 60 for U3 snoRNP associated 55 kDa protein G 1 H-D00096 Transtyretin (prealbumin)16.28 20 C4 H-D00408 Cytochrome P450 IIIA755.44 64 (P450-HFLa) M302 E7 H-D00682 cofilin 18.37 30 M383 G2 H-D00726 ferrochelatase 46.64 50.OkDa M383 C3 H-D00760 proteasome, subunit 25.85 34.OkDa M305 B4 H-D00761 proteasome, subunit 26.62 33 M266 F7 H-D00763 proteasome, subunit 28.82 33 E2 H-D00860 Phosphoribosyl pyrophosphate35.09 47 synthetase subunit I

2 i 5- H-D 10522 human mRNA for 80K-L 3 S 36.59 I 3 protein M423 FS H-D 11086 Interleukin 2 receptor40.7 45.OkDa gamma chain M248 D2 H-D11094 positive modulator 47.74 40.0kDa of HIV tat-mediated transactivation G3 H-D11428 Peripheral myelin 17.71 17 protein 22 M424 D3 H-D13168 Human gene for endothelin-B48.73 48.OkDa receptor (hET-BR) M271 B8 H-D13315 glyoxalase I, 20.35 34.OkDa LACTOYLGLUTATHIONE

LYASE. CATALYZES THE

CONVERSION OF

HEMIMERCAPTAL, FORMED

FROM METHYLGLYOXAL

AND GLUTATHIONE, TO
S-LACTOYLGLUTATHIONE.

M306 F1 H-D13627 hypothetical protein 60.39 90 (GB:D13627) M248 D1 H-D13630 hypothetical protein 46.2 49 (GB:D13630) , Human mRNA for KIAA0005 gene, complete - cds M270 DS H-D13634 hypothetical protein 34.65 42.OkDa (GB:D 13634) M250 D2 H-D13642 hypothetical protein 44 48.OkDa (GB:D13642),Human mRNA for KIAA0017 gene, complete cds M250 E6 H-D13748 translation initiation44.77 49.OkDa factor 4A

M305 C3 H-D13892 carboxyl methyltransferase,25.19 34 aspartate D1 H-D13900 enoyl-Coenzyme A hydratase,32.01 58 short chain, mitochondria) E1 H-D14446 Human HFREP-1 mRNA 34.43 40 for unknown protein, complete cds 167-14 H-D14497 H.sapiens (Ewing's 51.44 64 sarcoma cell line) mRNA encoding open reading frame M266 D2 H-D14520 basic transcription 24.2 33.OkDa element-binding protein 2 M318 D2 H-D14658 hypothetical protein 13.64 17 (GB:D14658) D2 H-D14661 Human mRNA for KIAA010516.72 28 gene, complete cds M236 E2 H-D14662 HYPOTHETICAL 29.5 24.75 36.OkDa KD

INTERGENIC REGION

[Saccharomyces cerevisiaej M271 G6 H-D14695 hypothetical protein 43.12 SO.OkDa ( GB:D14695), Human mRNA for KIAA0025 gene, complete cds.

M311 A3 H-D14696 hypothetical protein 25.74 30.OkDa ( GB: D 14696) H3 H-D14697 Farnesyl diphosphate 46.2 SS
synthase (farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase) M271 E7 H-D1470S catenin, alpha 2(E). 99.77 110 Catenin (cadherin-associated protein), alpha 1 (102kD). ASSOCIATES

WITH THE CYTOPLASMIC

DOMAIN OF A VARIETY
OF

CADHERINS.

M236 A6 H-D14811 hypothetical protein 30.25 42 (GB:D 14811 ) M2S0 A3 H-D14812 hypothetical protein (GH:D14812), Human mRNA for KIAA0026 gene, complete cds AS H-D14874 Human mRNA for 20.46 33 adrenomedullin, complete cds F3 H-D14887 Human mRNA for TFIIA-42,41.47 SO

complete cds M250 H6 H-D 16234 phospholipase C, alphaSS.66 S6.OkDa , PROBABLE PROTEIN

DISULFIDE ISOMERASE
ER-60 PRECURSOR [Homo Sapiens]

M30S B1 H-D16480 enoyl-CoA hydratase/3-84.04 g4 hydroxyacyl-CoA dehydrogenase trifunctional protein, alpha-subunit, mitochobdrial M271 G2 H-D16481 3-ketoacyl-CoA thiolase, beta subunit, mitochodrial, Hydroxyacyl-Coenzyme A

dehydrogenase/3-ketoacyl-Coenzyme Athiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit H1 H-D16626 Histidine ammonia-lyase72.38 64 A2 H-D17532 Human mRNA for RCK, 52.03 53 complete cds M266 F4 H-D17SS4 DNA-binding protein 31.79 38 TAX

M248 A3 H-D2123S xeroderma pigmentosum40.04 SS
group C

repair complementing protein M235 E1 H-D21261 SM22-ALPHA HOMOLOG, 22 31 hypothetical protein (GB:D21261 ) M311 E 1 H-D21262 hypothetical protein 77.950 63 (GB:D21262) M466 B4 H-D218S3 Human mRNA for KIAA011145.32 49.OkDa gene, complete cds M311 H3 H-D23660 ribosomal protein 47.08 47 M419 E 1 H-D26309 human mRNA for LIMK 71.240 75.OkDa (LIM

kinase) M271 B9 H-D26362 hypothetical protein79.97 70 (GB:D26362), Human mItNA for KIAA0043 gene, complete cds M361 H2 H-D26598 proteasome, subunit 22.66 33.OkDa HsClO-II

M302 G4 H-D26599 proteasome, subunit 22.22 34 HsC7-I

G1 H-D26600 Human mRNA for proteasome29.15 36 subunit HsN3, complete cds G9 H-D28540 hypothetical protein,44.77 60 homolog M266 AS H-D29011 proteasome, subunit 22.99 23 X

M236 F3 H-D29012 Proteasome (prosome,26.4 32.OkDa macropain) delta subunit, beta type, 6 C1 H-D30037 Human mItNA for 29.92 38 phosphatidylinositol transfer protein (PI-TPbeta), complete cds M250 H4 H-D30655 translation initiation44.88 45.OkDa factor 4AII, and ribosomal binding protein 167-26 H-D30742 human mltNA for cahnodulin-52.10 55 dependent protein kinase IV

M236 A4 H-D31767 hypothetical protein18.59 30 (GB:D31767), Human mItNA for KIAA0058 gene, complete cds E1 H-D31883 Human mltNA for KIAA005950.93 64 gene, complete cds G2 H-D32129 MHC class I protein 40.26 50 HLA-A

M422 A6 H-D37965 Human mltNA for PDGF41.36 45.OkDa receptor beta-like tumor suppressor (PRLTS), complete cds M305 H4 H-D38047 26S proteasome regulatory28.340 34.OkDa subunit P31 M423 B2 H-D38081 Thromboxane A2 receptor37.84 45.OkDa M317 D3 H-D38305 ErbB-2 transducer 38.06 49 M270 A8 H-D38583 calgizzarin, Human 11.66 12 mRNA for calgizzarin, complete cds M270 A6 H-D42038 hypothetical protein15.29 27 (GB:D42038), Human mItNA for KIAA0087 gene, complete cds M318 F3 H-D42085 hypothetical protein90.2 100 (GB:D42085) M311 C2 H-D43642 YL-1 protein homolog40.15 36 E I H-D45213 Human mItNA for zinc12.87 20 forger protein, complete cds M236 B2 H-D45248 proteasome activator26.4 38 hPA28, subunit beta , may be cell adhesion protein H3 H-D45887 Human mRNA for calmodulin,16.5 20 complete cds 166-3 H-D45906 human mltNA for LIMK-270 70.25 A7 H-D49357 Human mRNA for S- 43.56 51 adenosylmethionine synthetase, complete cds CS H-D49489 Human mltNA for protein48.51 54 disulfide isomerase-related protein P5, complete cds WO 99/517b6 PCT/US99/07270 M482 E2 H-D49958 Human fetus brain 30.69 32.OkDa mRNA for membrane glycoprotein M6, complete cds M305 GS H-D50063 proteasome, subunit 35.75 39 p40 M250 B6 H-D50310 cyclin I, Human mltNA41.58 47 for cyclin I, complete cds E3 H-D50419 Homo Sapiens mRNA 78.32 64 for OTK 18, complete cds M298 B1 H-D50495 transcription elongation33 33.OkDa factor h-SII-Tl (GB:D50495) M302 A3 H-D50840 ceramide glucosyltransferase43.45 44 167-40 H-D50863 human mRNA for TESK1 68.9 70 166-28 H-D50927 human myeloblast mRNA60.46 64 for KIAA0137 gene D 1 H-D63521 Homo sapiens mRNA 16.72 16 for LECT2 precursor, complete cds M302 AS H-D78134 glycine-rich binding 19.03 30.OkDa protein CIRP

M313 ES H-D78275 proteasome subunit 42.9 48.OkDa p42 B3 H-D79205 Human mRNA for ribosomal5.72 10 protein L39, complete cds A4 H-D79206 Human gene for ryudocan21.89 33 ~ core protein, exonl-5, complete cds A 1 H-D80008 Human mRNA for KIAAO 21.67 32 gene, complete cds M298 H4 H-D83004 ubiquitin-conjugating16.83 32.OkDa enryme E2 similar to Drosophila bendless gene product C3 H-D83702 Human brain mRNA for 64.57 64 photolyase homolog, complete cds M306 A1 H-D83735 neutral calponin 34.1 34 OkDa H2 H-D86322 Homo Sapiens mRNA 67.21 .
for 64 cahnegin, complete cds B 1 H-D86979 Human mRNA for KIAA022682.72 82 gene, complete cds 169-16 H-D87116 duai specificity mitogen-activated38.24 42 protein kinase kinase 166-27 H-D87119 human cancellous bone37.80 40 osteoblast mRNA for GS3955 E2 H-D88308 Homo sapiens mRNA 68.31 64 for very-long-chain acyl-CoA
synthetase, complete cds 166-26 H-D89077 human mRNA for Src-like30.43 38 adapter protein M440 H2 H-D89479 Homo Sapiens mRNA 32.67 38.OkDa for ST1B2, complete cds H1 H-D90086 Human pyruvate dehydrogenase39.6 35 (EC 1.2.4.1) beta subunit gene, exons I-10 M362 FI H-D90209 DNA-binding protein 38.72 48.OkDa M316 B2 H-J00068 actin, alpha 1, skeletal41.58 50 muscle M250 B2 H-J00194 major histocompatibility28.05 36.OkDa complex, MHC class II, DR alpha G2 H-100212 Interferon, alpha 20.9 30 ~ ~ 21 G1 H-100287 Human pepsinogen gene42.79 48 M298 C2 H-102611 apolipoprotein D 20.9 3l.OkDa M266 C4 H-102683 ADP/ATP carrier protein32.89 36 M383 H2 H-102685 plasminogen activator45.76 SO.OkDa inhibitor, placenta 167-3 H-102853 "casein kinase II, 43.08 50 alpha chain"

E3 H-102854 Human 20-kDa myosin 19.03 31 light chain (MLC-2) mRNA, complete cds M248 F3 H-102874 fatty-acid-binding 14.63 17 protein 4, adipocyte, LIPID TRANSPORT

PROTEIN IN ADIPOCYTES

M235 DS H-102939 antigen 4F2, heavy 58.3 58 chain C3 H-102943 Corticosteroid binding44.66 50 globulin M248 F2 H-102966 adenine nucleotide 32.78 33 translocator 1 (skeletal muscle) [ANTI), CATALYZES THE EXCHANGE

OF ADP AND ATP ACROSS

THE MITOCHONDRIAL

INNER MEMBRANE.

EI H-102982 Glycophorin B 10.12 20 167-91 H-103075 "protein kinase c 58.04 98 substrate, 80 kD

protein heavy chain"

M266 A3 H-103191 profilin 1 15.51 l7.OkDa M248 H4 H-103231 glucose-6-phosphate 56.76 51 dehydrogenase [G6PDj M266 F2 H-103459 LEUKOTRIENE A-4 67.32 64 HYDROLASE [Homo sapiens]

A2 H-103460 Prolactin-induced 16.17 26 protein M271 ES H-103799 laminin receptor 1, 32.56 Laminin receptor (2H5 epitope).

RIBOSOMAL PROTEIN
SA

[Homo sapiensj.

M440 A4 H-103890 Human pulmonary surfactant21.78 30.OkDa protein C (SP-C) and pulmonary surfactant protein C 1 (SP-C 1 ) genes, complete cds M271 D8 H-103934 NAD(P)H menadione 30.25 38 oxidoreductase 1, dioxin-inducible. INVOLVED
IN

DETOXICATION PATHWAYS.

M271 A8 H-104031 trifunctional enzyme 102.96 117.OkDa (GB:J04031). C-1-TETRAHYDROFOLATE

SYNTHASE, CYTOPLASMIC

[Homo sapiensj M305 F6 H-104046 calmodulin 3 [CALM3j 16.5 20 M305 G7 H-104071 cytotoxic T-lymphocyte-27.28 38 associated serine esterase 1 (cathepsin G-like 1, granzyme B) [CTLA 1 M311 D2 H-104183 lysosomal-associated 44.99 47 membrane protein 2 WO 99/51766 PC'T/US99/07270 M300 F4 H-104205 Sjogren syndrome antigen44.99 S 1.OkDa B

M416 G8 H-104430 Acid phosphatase 5, 35.64 45.OkDa tartrate resistant BI H-104501 Glycogen synthase 81.18 81 1 (muscle) M313 BS H-104543 synexin 51.37 51 B1 H-104605 Peptidase D 54.34 55 M250 C6 H-104615 small nuclear ribonucleoprotein26.51 34.OkDa SM-D, ROLE IN THE
PRE-mRNA SPLICING OR IN

SNRNPSTRUCTURE.

M248 E2 H-104964 steroid sulfatase 64.24 60.OkDa (microsomal) [STS]

M250 A7 H-105249 replication protein 29.81 36.OkDa A, 32 kDa subunit , REQUIRED
FOR SV

IN

VITRO, RP-A IS SINGLE-STRANDED DNA-BINDING

PROTEIN.

F1 H-105272 IMP (inosine monophosphate)56.65 51 dehydrogenase 1 169-15 H-105401 "creatine kinase, 50 46.16 sarcoraeric mitochondria) precursor"

M266 E4 H-105448 RNA polymerase II, 30.36 35 subunit B33 OkDa M305 C2 H-K00558 tubulin, alpha kI 49.72 .
[TUBA*] 52 OkDa M416 H7 H-K01571 Human T-cell receptor34.43 .
active 36.OkDa beta-chain, mRNA from cell line MOLT-3, complete cds M311 E4 H-K01763 haptoglobin 38.28 47 OkDa GS H-K02100 Human ornithine 39.05 .

transcarbamylase (OTC) mRNA, complete coding sequence M302 DS H-K02574 purine nucleoside 31.9 36 phosphorylase OkDa 169-39 H-K02581 "thymidine kinase, 34 .
cytosolic" 25 M248 E4 H-K03020 phenylalanine hydroxylase49.83 .
[PAH] 50 M556 B3 H-K03191 Cytochrome P450, subfamily56.43 53.OkDa I

(aromatic compound-inducible), potypeptide 1 N2 H-L00190 Antithrombin III 51.15 55 169-62 H-L01087 "protein kinase c, 80 77 theta type" 7 M3 I 8 C2 H-LO I 124 ribosomal protein 16.72 , M313 F1 H-L02321 glutathione S-transferase24.09 28 MS

M305 ES H-L02426 protease 26S, regulatory48.51 53 subunit 4 M302 D4 H-L02547 cleavage stimulation 47.52 SO.OkDa factor, 50 kDa subunit M266 H7 H-L02648 transcobalamin II 47.08 48.OkDa E2 H-L02932 Human peroxisome proliferator51.59 59 activated receptor mRNA, complete cds M270 A1 H-L03380 gonadotropin-releasing36.19 36 hormone receptor [GRHR], THIS

RECEPTOR MEDIATES
ITS

ACTION BY ASSOCIATION

WITH G PROTEINS

M270 H 1 H-L03411 RD protein [RDBP], 41.91 59.OkDa Radin blood group D3 H-L03426 Human XE7 mRNA, complete42.46 45 alternate coding regions B1 H-L03785 Myosin, lightpolypeptide19.14 32 5, regulatory A7 H-L04483 ribosomal protein 9.24 34 M416 B2 H-L05147 Human dual specificity20.46 30.OkDa phosphatase tyrosine/serine mRNA, complete cds 215-38 H-L05624 dual specificity mitogen-activated50 43.30 protein kinase kinase M271 D4 H-L06132 anion channel, voltage-gated,31.24 37 isoform I. FORMS A
CHANNEL

THROUGH THE CELL

MEMBRANE, THAT ALLOWS

DIFFUSION FROM SMALL

HYDROPHYLIC MOLECULES.

169-27 H-L06139 tyrosine-protein kinase125 123.7 receptor TIE-2 precursor H1 N-L06147 Human (clone SY11) 68.31 68 golgin-95 mRNA, complete cds M250 A 1 H-L06419 procollagen-lysine, 80.08 80.OkDa 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) [PLOD]

M236 F6 H-L06498 ribosomal protein 13.2 23.OkDa M318 D1 H-L06499 ribosomal protein 10.23 27 L37a M270 D1 H-L07414 CD40 antigen ligand 28.82 36 [CD40LG], NVOLVED IN

IMMUNOGLOBULIN CLASS

SWITCHING.

M298 A6 H-L07548 aminoacylase 1 44.99 52.OkDa M424 C3 H-L07592 Human peroxisome proliferator48.62 48.OkDa activated receptor mRNA, complete cds M298 G6 H-L07633 proteasome (prosome, 27.5 33.OkDa macropain) activator subunit 1 (PA28 alpha) [PSME 1 ]

M318 B 1 H-L08096 CD70 antigen (CD27 21.34 28 ligand) [CD70]

D2 H-L08187 cytokine receptor 25.3 42 M313 F4 H-L08850 amyloid, non-A beta 15.51 3l.OkDa component, Alzheimer's disease M426 E1 H-L08895 MADS box transcription52.14 60.OkDa enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) M266 A8 H-L09235 ATPase, vacuolar 67.98 64.OkDa M266 D 1 H-L09604 differentiation-dependent16.83 17.OkDa intestinal membrane A4 protein (Homo sapiens) M317 CI H-L10338 sodium channel, voltage-gated,24.09 24 type I, beta polypeptide [SCN1B]

M317 E1 H-L10717 tyrosine-protein kinase68.270 68.OkDa ITK/TSK

M300 BS H-L10820 formyl peptide receptor38.61 3?
1 [FPRI]

M312 A4 H-L10838 pre-mRNA splicing 18.15 3l.OkDa factor SRp20 M300 AS H-L10918 chemokine (C-C) receptor39.16 30 [CMKBRI]

M311 F2 H-L11245 complement component 27.83 30 4-binding protein, beta M266 B7 H-L11353 neurofibromatosis 65.56 63.OkDa 2 (bilateral acoustic neuroma) [NF2) M311 B3 H-L11667 cyclophilin 40 40.81 SO.OkDa 215-49 H-L11695 serine/threonine-protein64 55.40 kinase receptor R4 precursor M466 C2 H-L 11931 Human cytosolic serine53.24 56.OkDa hydroxymethyltransferase (SHMT) mRNA, complete cds M271 B7 H-L12168 ADENYLYL CYCLASE- 52.36 60.OkDa ASSOCIATED PROTEIN

[Homo Sapiens) M416 D4 H-L12964 Interleukin-activated28.16 38.OkDa receptor, homolog of mouse Ly63 B3 H-L13203 Human HNF-3/fork-head38.72 49 homolog-3 HFH-3 mRNA, complete cds D2 H-L13744 Human AF-9 mRNA, complete62.59 63 cds 167-8 H-L13943 glycerol kinase 60 57 M311 G3 H-L13974 leucinezipperprotein 41.14 .

(GB:L13974) M271 HS H-L13977 LYSOSOMAL PRO-X 54.67 57 CARBOXYPEPT)DASE

PRECURSOR [Homo sapiens).

M270 G2 H-L 14283 protein kinase C, 65.23 98 zeta [PRKCZ), SERINE- AND THREONINE-SPECIFIC ENZYME.

M235 A3 H-L14286 antioxidant protein, 21.89 32 thiol-specific OkDa M426 H3 H-L14778 Protein phosphatase 57.42 .
3 (formerly 60.OkDa 2B), catalytic subunit, alpha isoform (calcineurin A

alpha){alternative products}

B4 H-L 15702 complement factor 84.15 100 B

M426 A4 H-L 16794 Human transcription 57.42 60.OkDa factor (MEF2) mRNA, complete cds 215-25 H-L 16862 g protein-coupled 70 63.4 receptor kinase 167-74 H-L16991 thymidylate kinase 36 23.39 169-3 H-L18964 "protein kinase c, 80 64 iota type" 64 M305 E2 H-L18972 hypothetical protein 75.24 .
(GB:L18972) 7g M426 D4 H-L19067 Human NF-kappa-B transcription59.18 63.OkDa factor p65 subunit mRNA, complete cds 215-26 H-L19268 Homo Sapiens myotonic70 68.71 dystrophy associated protein kinase mRNA

WO 99/517b6 PCT/tTS99/07270 M271 El H-L19297 carbonic anhydrase 33.66 42 V [CAS], Mitochondrial carbonic anhydrase. REVERSIBLE

HYDRATATION OF CARBON

DIOX)DE.

M298 G4 H-L19437 transaldolase 37.18 39 OkDa M423 C4 H-L 19593 Interleukin 8 receptor,39.71 .
beta 41 OkDa G1 H-L19686 Homo sapiens macrophage12.76 .

migration inhibitory factor (MIF) gene, complete cds G2 H-L19739 metallopanstimulin 9.35 32 M302 E3 H-L19871 activating transcription20.02 36 factor 3 OkDa 167-86 H-L20422 14-3-3 protein eta 34 .

M440 B2 H-L20492 Human gamma-glutamyl 24.86 .
35.OkDa transpeptidase mRNA, complete cds M315 B H-L20688 GDP-dissociation inhibitor22.22 32 protein rhoA

M271 H3 H-L20941 ferritin, heavy polypeptide.20.24 32 FERRITIN IS AN

INTRACELLULAR

MOLECULE THAT STORES

IRON IN A SOLUBLE, NONTOXIC, READILY

AVAILABLE FORM.

M235 B7 H-L21893 Na+/taurocholate cotransporter, STRICTLY DEPENDENT
ON

THE

F 1 H-L21934 Sterol O-acyltransferase60.61 60 {acyl-Coenzyme A: cholesterol acyltransferase) C2 H-L22075 Human guanine nucleotide41.58 50 regulatory protein (G13) mRNA, complete cds 169-18 H-L22206 vasopressin v2 receptor60 58.00 M421 AIO H-L22214 Human adenosine A1 35.97 38.OkDa receptor (ADORA 1 ) mRNA exons 1-6, complete cds M424 Fl H-L23959 Homo Sapiens E2F-related45.21 53.OkDa transcription factor (DP-1) mRNA, complete cds C2 H-L24498 Human gadd45 gene, 18.26 28 complete cds M302 E2 H-L25080 proto-oncogene rhoA, 21.34 31 multidrug resistance protein M270 B8 H-L25081 guanine nucleotide-binding21.34 30 and transforming protein rhoC, Aplysia ras-related homolog 9 M236 E3 H-L25085 Sec61 complex, beta 10.67 19 subunit, PROTEIN TRANSLOCATION

IN THE ENDOPLASMIC

RETICULUM

167-85 H-L25610 cyclin-dependentkinaseinhibitor32 18.11 B2 H-L2561 cyclin-dependent kings18.1 40 '~mhib'rtor __ M297 H2 H-L26232 cathepsin A/phos transfer54.34 64.OkDa protein 167-4 H-L26318 stress-activated protein52 42.31 kinase JNK I

M428 Fl H-L27586 Human TR4 orphan receptor67.76 67.OkDa mRNA, complete cds M302 ES H-L27711 protein phosphatase 23.43 28 KAPI

M250 A6 H-L28010 Homo Sapiens HnRNP
F protein mRNA, complete cds, F1 H-L28821 Alpha mannosidase 87.67 87 II isozyme 167-89 H-L28824 tyrosine-protein kinase70 69.92 SYK

M298 E6 H-L28997 ADP-ribosylation factor-like20.02 33.OkDa gene D4 H-L29219 Homo sapiens clkl 53.35 60 mRNA, complete cds 169-63 H-L29222 Homo Sapiens clkl 25 15 mRNA 0 3 M429 B3 H-L29277 Signal transducer 84.81 .
and activator of 88.OkDa transcription 3 (acute-phase response factor) C 1 H-L29433 Human factor X (blood53.79 64 coagulation factor) gene G3 H-L31860 Glycophorin A 16.61 26 D1 H-L31881 Nuclear factor I/X 48.62 4g (CCAAT-binding transcription factor) 169-13 H-L31951 human protein kinase 55 46.71 (.1NK2) mRNA

A 1 H-L32179 Arylacetamide deacetylase44 50 (esterase) B2 H-L33404 Human stratum corneum27.94 36 chymotryptic enzyme mRNA, complete cds M312 D3 H-L33799 procollagen C-proteinase49.5 S I .OkDa enhancer 169-77 H-L33801 human protein kinase 55 46.27 mRNA

M305 D6 H-L34041 L-glycerol-3-phosphate:NAD+38.5 42.OkDa oxidoreductase B4 H-L34355 Homo sapiens (clone 42.68 47 p4) 50 kD

dystrophin-associated glycoprotein mRNA, complete cds M297 B3 H-L35013 spliceosomal protein 46.75 52.OkDa 167-32 H-L35253 human CSaids binding 52 39.67 protein (CSBP1) mRNA

M266 D6 H-L35545 C/activated protein 26.29 38.OkDa C receptor, endothelial M300 F1 H-L35594 autotaxin 100.76 9l.OkDa M318 E2 H-L36720 bystin 33.77 29 M305 H2 H-L37127 RNA polymerise II 12.98 16 M300 D1 H-L38490 ADP-ribosylation factor22.22 32 (GB:L38490) M318 E1 H-L38941 rib 12.98 18 oso mal protein L34 C2 H-L38969 _ 105.27 110 _ _ Homo sapiens ~spondin (THBS3) gene, complete cds M476 F4 H-L39060 Homo Sapiens transcription49.61 S3.OkDa factor SL 1 mRNA, complete cds M300 E4 H-L40399 hypothetical protein29.26 36 (GB:L40399) E3 H-L40802 Homo Sapiens 17-beta-42.68 60 hydroxysteroid dehydrogenase ( 17-HSD) gene M478 F1 H-L40904 H. Sapiens peroxisome52.69 60.OkDa proliferator activated receptor gamma, complete cds M306 C2 H-L41268 natural killer associated37.62 40 transcript 2 ~~*]

M306 E2 H-L4I270 natural killer associated50.16 6S.OkDa transcript 4 [NK.AT4*]

M306 F2 H-L41347 natural killer associated33.55 40 transcript S [NKATS*]

M468 C3 H-L413S 1 Homo Sapiens prostasin37.84 4S.OkDa mRNA, complete cds 169-S3 H-L41816 Homo Sapiens cam 48 40.77 kinase I

mRNA

167-2S H-L41939 tyrosine-protein 108 108.6 kinase receptor EPH-3 precursor C3 H-L42374 Homo sapiens protein54.78 64 phosphatase 2A BS6-beta (PP2A) mRNA, complete cds M306 B 1 H-L42S31 glutathione syntltetaseS2.2S S4 OkDa M302 F6 H-L42856 RNA polymerase II 13.09 .
transcription 20.OkDa factor SIII, p 18 subunit M313 C7 H-L76200 guanylate kinase 21.78 32 (GUK 1 ) OkDa M428 E1 H-L76702 Homo Sapiens protein66.33 .
68.OkDa phosphatase 2A B56-delta (PP2A) mRNA, complete cds M478 A 1 H-L76703 Homo Sapiens proteinS 1.48 60.OkDa phosphatase 2A BS6-epsilon {PP2A) mRNA, complete cds 166-S2 H-L77213 H.sapiens phosphomevalonate34 21.19 kinase mRNA

169-64 H-L77964 H.sapiens ERIC3 mRNA100 79 M360 C3 H-MIOOSO fatty-acid-binding 14.08 .
protein 2, 20.OkDa intestinal DS H-MI0050 fatty-acid-binding 14.08 36 protein 2, intestinal M421 E7 H-M10058 Asialoglycoprotein 32.12 48 receptor 1 OkDa M429 D3 H-M10901 Glucocorticoid receptor85.58 .
BS.OkDa M312 G1 H-MI 1025 asialoglycoprotein 34.32 34 receptor 2 OkDa 167-44 H-M11026 interferon alpha-4 33 .
precursor 20 F2 H-MI 1321 Human group-specificS2.2S .
component S6 vitamin D-binding protein mRNA, complete cds M236 BS H-M I 1354 histone H3.2, CENTRAL15.07 24 ROLE

IN NUCLEOSOME

FORMATION.

M236 G2 H-M11433 retinol-binding protein14.96 28 I, cellular transport protein M270 G7 H-MI 1560 aldolase A , FRUCTOSE-40.15 40 BISPHOSPHATE ALDOLASE
A

[Homo sapiens]

H3 H-M 11717 Human heat shock protein70.51 60 (hsp 70) gene, complete cds E1 H-M12523 Human serum albumin 67.1 70 (ALB) gene, complete cds B5 H-M12963 Alcohol dehydrogenase41.36 48 1 (class I), alpha polypeptide D6 H-M13228 51.15 50 D4 H-M13981 Inhibin, alpha 40.37 50 M236 G4 H-M13982 interleukin 4 [IL4] 16.94 30 precursor, B-cell activator M271 B6 H-M14043 lipocortin II, Annexin37.4 45.OkDa II

(lipocortin II). CALCIUM-REGULATED MEMBRANE_ BINDING PROTEIN

M271 F4 H-M14218 argininosuccinate 51.04 56 lyase M297 A3 H-M14221 cathepsin B 37.4 32 OkDa M305 B2 H-M14328 enolase, alpha 47.85 .

167-54 H-M 14333 human c-syn protooncogene60 59 167-51 H-M14505 H.sapiens mRNA (open 36 .
reading 33.40 frame; patient SK29(AV)) 215-74 H-M 14676 human src-like kinase60 59.14 (slk) mRNA

167-55 H-M 14780 "creative kinase, 52 41 m chain" 98 M416 F8 H-IvI15059 Fc fragment of IgE, 35.42 .
low affinity 45.OkDa II, receptor for (CD23A) M271 F 1 H-M 15182 glucuronidase, beta 71.72 72 [GUSB], PLAYS AN IMPORTANT
ROLE

IN THE DEGRADATION
OF

DERMATAN AND KERATAN

SULFATES.

215-37 H-M15465 human pyruvate kinase64 59.80 type L

mRNA

M298 A4 H-M 15796 cyclin 28.82 43 OkDa C3 H-M15800 Mal, T-cell differentiation16 .
protein .94 17 M440 EI H-M15841 Human U2 small nuclear_ 34.OkDa RNA- 24.86 associated B" antigen mRNA, complete cds M248 C3 H-M15887 endozepine 9.68 lS
OkDa M463 A2 H-M15990 human c-yes-1 mRNA 59.800 .

OkDa M418 E2 H-M16038 tyrosine-protein kinase56.390 .

OkDa M266 D3 H-M 16342 HETEROGENEOUS NUCLEAR32.01 .

RIBONUCLEOPROTEINS

C1/C2 [Homo Sapiens];
small nuclear ribonucleoprotein, polypeptide C

167-20 H-M16591 tyrosine-protein kinase60 55 C7 H-M16591 tyrosine-protein kinase55.620 .

M305 E7 H-M16660 heat shock 90kD protein79.75 80 1, beta [HSPCB) 167-65 H-M16750 PIM-1 proto-oncogene38 34.50 ~

serine/threonine-protein kinase M311 A 1 H-M 16827 acyl-Coenzyme A dehydrogenase,46.42 SO.OkDa C-4 to C-12 straight-chain D3 H-M16961 Alpha-2-HS-glycoprotein40.48 50 alpha and beta chain D3 H-M16974 Complement component64.35 55 8, alpha polypeptide [Homo Sapiens) M305 E4 H-M17885 ribosomal phosphoprotein34.98 37.OkDa P0, acidic M339 E2 H-M17887 ribosomal phosphoprotein12.76 l9.OkDa M248 DS H-M18731 galactose-1-phosphate41.91 42 uridylyltransferase [GALT]

F2 H-M19309 Troponin Tl, skeletal,30.69 40 slow M385 E2 H-M19713 tropomyosin, alpha, 31.35 4l.OkDa muscle 167-79 H-M19722 proto-oncogene tyrosine-protein64 58.26 kinase FGR

M248 H1 H-M20560 Annexin III (lipocortin35.64 37 III), INHIBITOR OF

M235 H1 H-M20681 GLUCOSE TRANSPORTER 54.67 50 TYPE 3, BRAIN

167-29 H-M21616 beta platelet-derived121 121.7 growth factor receptor precursor M305 A3 H-M21812 myosin light chain 18.81 30 167-30 H-M22146 "405 ribosomal protein34 26.91 S4, x isofonn"

M302 D6 H-M22430 phospholipase A2 15.95 3l.OkDa RASF-A

E2 H-M22491 Bone morphogenetic 52.03 55 protein 3 (osteogenic) M340 A2 H-M22538 NADH-ubiquinone reductase,27.5 33 kDa subunit, mitochondria) B2 H-M22632 Glutamic-oxaloacetic47.41 47 transaminase 2, mitochondria) (aspartate aminotransferase 2) B4 H-M22960 Protective protein 52.91 60 for beta-galactosidase (galactosialidosis) M250 C4 H-M22995 ras-related protein RAP1A, member of RAS oncogene family B3 H-M23254 Calpain, large polypeptide77.1 77 M266 B4 H-M23613 Nucleophosmin (nucleolar32.45 42 phosphoprotein B23, numatrin), BELIEVED TO BIND
SINGLE-STRANDED NUCLEIC
ACIDS

M469 D2 H-M23668 Homo Sapiens adrenodoxin20.35 25 gene OkDa M478 H3 H-M24439 Human liver/bone/kidney-type57.75 .
64.OkDa alkaline phosphatase (ALPL) gene FS H-M24470 Glucose-6-phosphate 38.06 44 dehydrogenase M270 ES H-M24898 thyroid hormone triiodothyronine67.65 85 receptor c-erbA, ear-1, Thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homology D3 H-M24902 Acid phosphatase, 42.57 S4 prostateprostate D6 H-M2S809 ATPase, H+ transport56.32 57 iysosomal (vacuolar proton pump), beta polypeptide, S6/58kD, isofonm 167-77 H-M262S2 "pyruvate kinase, 60 58 M2 isozyme" 48 M271 F8 H-M26326 keratin 18 47.41 .

0kDa B 1 H-M26901 Human renin gene 44.44 .
SO

M271 G4 H-M27396 asparagine synthetase61.82 62 M338 B3 H-M27S42 globulin, sex hormone-binding39.200 40 MS 12 B6 H-M27602 Protease, serine, 27.28 36 2 (trypsin 2) OkDa M270 B6 H-M27691 DNA-binding protein 36.08 .
CREB, SO

CAMP-responsive C 1 H-M27878 Zinc forger protein 8129 81 84 (HPF2) M270 F6 H-M28209 guanine nucleotide-binding22.66 30.OkDa protein rabl MS 12 HS H-M28210 RAB3A, member RAS 24.31 36.OkDa oncogene family B3 H-M28214 Homo sapiens GTP-binding24.2 34 protein (RAB3B) mRNA, complete cds M300 CS H-M28249 integrin, alpha 2 130.02 130.OkDa (CD49B, alpha 2 subunit of VLA-2 receptor) [ITGA2]

M248 B6 H-M28372 zinc forger protein 19.58 28.OkDa 9 (a cellular retroviral nucleic acid binding protein) [ZNF9]

M248 CS H-M28983 interleukin 1, alpha29.92 42 [IL 1 A]

M298 Cl H-M29S36 translation initiation36.74 SO.OkDa factor 2, beta subunit M42S AS H-M29696 Interleukin 7 receptor50.6 63 OkDa E1 H-M29960 Human steroid receptor66.44 .
(Tlt2-11) 6S

mltNA, complete cds M361 D3 H-M29971 6-O-methylguanine-DNA22.88 33.OkDa methyltransferase [MGMT]

167-67 H-M30448 "casein kinase II, 34 23 beta chain" 72 M2S0 E2 H-M31211 MYOSIN LIGHT CHAIN 22.99 .
1, 30.OkDa SLOW-TWITCH MUSCLE
A

ISOFOItM jHomo sapiens]

M311 C4 H-M314S2 proline-rich protein65.78 68 M312 H3 H-M31469 ras-like protein 23.87 32 TC4 OkDa 167-41 H-M31606 "phosphorylase B SO .
kinase gamma 44,7 catalytic chain, testis isoform"

B4 H-M31642 Hypoxanthine 24.09 36 phosphoribosyltransferase ( Lesch-Nyhan syndrome) M416 D8 H-M31932 Fc fragment of IgG, 34.98 4S.OkDa low affinity I Ia, receptor for (CD32) M305 A8 H-M32011 neutrophil cytosolic57.97 58 factor 2 (65kD, chronic granulomatous disease, autosomal 2) [NCF2]

B2 H-M32315 Human tumor necrosis50.82 60 factor receptor mRNA, complete cds M266 C2 H-M33374 cell adhesion protein14.96 lB
SQM1 OkDa M431 F1 H-M33375 dihydrodiol dehydrogenase33.99 .

OkDa G6 H-M33680 Human 26-kDa cell 26.07 .
surface 24 protein TAPA-1 mRNA, complete cds F1 H-M33772 Human fast skeletal 17.71 29 muscle troponin C gene 167-15 H-M34065 m-phase induc 55 52 er phosphatase 3 10 F4 H-M34079 _ 44.55 .
Human immunodeficiency 52 vuus tat transactivator binding protein-1 (tbp-I) mRNA, complete cds 169-86 H-M34181 "CAMP-dependent protein50 38.68 kinase, beta-catalytic subunit"

D1 H-M34379 Elastatse 2, neutrophil29.48 35 M314 E1 H-M34671 CD59 glycoprotein 14.150 20 precursor M266 C3 H-M35252 CO-029 (GB:M35252) 26.18 30 M315 A4 H-IvI36035 benzodiazapine receptor18.7 19 (peripheral) [BZRP]

M300 C 1 H-M36340 ADP-ribosylation 20.02 30 factor 1 M312 C3 H-M36341 ADP-ribosylation 19.91 29 factor 2 D6 H-M36634 Vasoactive intestinal18.81 28 peptide 169-26 H-M36881 proto-oncogene tyrosine-protein60 56.06 kinase LCK

167-76 H-M36981 nucleoside diphosphate26 16 kinase B 79 M298 D6 H-M37400 aspartate aminotransferase,45.54 .
SO.OkDa cytosolic 167-88 H-M37712 galactosyltransferase55 48.36 associated protein kinase P58/GTA

M424 F4 H-M38258 Retinoic acid receptor,50.05 58 gamma 1 OkDa M266 H3 H-M38690 CD9 antigen, INVOLVED25.19 .
IN 26.OkDa PLATELET ACTIVATION
AND

AGGREGATION.

M270 AS H-M55265 casein kinase II, 43.12 50 alpha catalytic subunit 169-74 H-M55284 human protein kinase80 75.09 C-L

(PRKCL) mRNA

M512 B3 H-M55514 Potassium voltage-gated71.94 IOO.OkDa channel, shaker-related subfamily, member M271 FS H-M57567 ADP-ribosylation 19.91 32.OkDa factor S [ARS].

INVOLVED IN PROTEIN

TRAFFICKING AND ACTS
AS

AN ALLOSTERIC ACTIVATOR

OF CHOLERA TOXIN.

M250 DI H-M57627 i nterleukin 10 [IL10],19.69 27 SUPPRESSOR FACTOR
FOR

( BY SIMILARITY).

IvI302 D3 H-M57730 EPH-related receptor22.620 ~ 36.OkDa tyrosine kinase ligand 1 precursor M248 BS H-M58458 ribosomal protein 29.04 36.OkDa S4, X-linked [RPS4X]

M248 AS H-M58459 ribosomal protein 29.04 36 S4, Y-linked [ltPS4Y]

M248 GS H-M58525 CATECHOL O- 29.92 36 METHYLTRANSFERASE, MEMBRANE-BOUND FORM

[Homo Sapiens], COMT

M482 B2 H-M59916 Sphingomyelin phosphodiesterase69.3 69.OkDa I, acid lysosomal (acid sphingomyelinase) M390 C1 H-M60091 galactose-1-phosphate41.8 SO.OkDa uridylyltransferase M316 B1 H-M60314 bone morphogenetic 50.05 55 protein 5 [BMPS]

B4 H-M60459 Erythropoietin receptor55.99 60 C7 H-M60483 Human protein phosphatase34.1 56 catalytic subunit-alpha gene, complete cds M462 D7 H-M60484 Human protein phosphatase34.1 44.OkDa catalytic subunit-beta gene, complete cds A 12 H-M60527 deoxycytidine kinase28.b70 50 167-5 H-M60724 human p70 ribosomal 66 57.82 S6 kinase alpha-I mRNA

167-17 H-M60725 human p70 ribosomal 62 55.29 S6 kinase alpha-II mRNA

M271 A4 H-M61199 cleavage signal 1, 27.5 36.OkDa ESTs, Highly similar to CLEAVAGE
SIGNAL-1 PROTEIN [Homo sapiens]

B1 H-M61733 Homo Sapiens erythroid70.62 71 membrane protein 4.1 mRNA, complete cds M298 A1 H-M61764 tubulin, gamma 49.72 SS.OkDa M422 E2 H-M62505 Complement component38.61 38.OkDa receptor 1 (CSa ligand) M313 GS H-M62810 transcription factor27.17 35.OkDa 1, mitochondrial C9 H-M62839 apolipoprotein H 38.06 60 GS H-M63154 Gastric intrinsic 45.98 52 factor (vitamin B

synthesis) 167-6 H-M63167 RAC-alpha serine/threonine64 52.87 kinase B 1 H-M63573 Pepddylprolyl isomerase23.87 33 B

(cyclophilin B) M302 H2 H-M63603 phospholamban 5.83 6 M306 D1 H-M63838 interferon, gamma-inducible80.3 108 protein 16 M423 H3 H-M63959 Low density lipoprotein-related39.38 48.OkDa protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein G3 H-M64099 Human gamma-glutmyl 64.57 S2 transpeptidase-related protein (GGT-Rel) mRNA, complete cds M47S B8 H-M64673 Human heat shock factor58.3 6S.OkDa (TCFS) mRNA, complete cds M266 DS H-M64716 ribosomal protein 13.86 l7.OkDa M248 C6 H-M647S2 glutamate receptor, 99.88 100 ionotropic, AMPA 1 [GRIAlJ

M312 G3 H-M6492S pahnitoylated membraneS L37 S 1.OkDa protein, erythrocyte, SS kDa M302 C7 H-M6S292 complement factor 36.41 SO
H-related protein (GB:M6S292) D3 H-M68S 16 Human protein C inhibitor44.77 S4 gene, complete cds 167-27 H-M68S20 cell division protein38 32.85 kinase 2 M236 DS H-M68867 Cellular retinoic 15.29 l9.OkDa acid-binding protein 2, MAY REGULATE

THE ACCESS OF RETINOIC

ACID TO THE NUCLEAR

RETINOIC ACID RECEPTORS.

M441 E1 H-M69226 monoamine oxidase 58.08 64.OkDa A [MAOA]

M298 DS H-M72393 calcium-dependent 82.5 117.OkDa phospholipid-binding protein [PLA2"']

M422 DS H-M73238 Ciliary neurotrophic 41.03 SI.OkDa factor receptor C1 H-M732SS Human vascular cell 81.4 81 adhesion molecule-1 (VCAM1) gene, complete CDS

M422 G6 H-M73481 Human gastrin releasing42.35 4S.OkDa peptide receptor (GRPR) mRNA, complete cds M23S G6 H-M73499 carboxylesterase, 62.48 90.OkDa INVOLVED IN

THE DETOXIFICATION
OF

XENOBIOTICS AND THE

ACTIVATION OF ESTER
AND

AMIDE PRODRUGS.

M302 D1 H-M73S47 polyposis locus DP1 20.46 28 M300 H4 H-M73969 interleukin 8 receptor,39.71 36 beta [IL8RB]

G 1 H-M74491 ADP-ribosylation factor20.02 31 B4 H-M74816 49.5 SO

B2 H-M7S 110 H,K-ATPase, beta subunit32.12 37 M416 B8 H-M76766 General transcription34.87 44.OkDa factor IIB

167-18 H-M77198 RAC-beta serine/threonine64 57.27 kinase 167-87 H-M77348 PMEL 17 protein precursor74 73.SS

C4 H-M77698 YY1 transcription 4S.6S 48 factor M248 G6 H-M80261 apurinic/apyrimidinic35.09 37.OkDa (abasic) endonuclease [APE], REPAIRS

OXIDATIVE DNA DAMAGES

IN VITRO

169-SO H-M803S9 putative serine%threonine-protein80 78.50 kinase P78 M330 H1 H-M80461 immunoglobulin-associated25.370 27.OkDa beta (B29) [IGBJ

169-I H-M8061_3 ring3 protein 100 83.01 "

M298 A2 H-M80783 B12 protein 34.87 43.OkDa 217-1 H-M81457 calpactin I light 10 10.74 chain M422 C6 H-M81589 Homo Sapiens serotonin41.58 4l.OkDa ID

receptor (5-HT 1 D' ) mRNA, complete cds M424 A1 H-M81590 Homo sapiens serotonin43.01 48.OkDa ID

receptor (5-HT1D~) mRNA, complete cds M250 Hl H-M81592 gamma-glutamyl carboxylase83.49 85 [GGCX], CONVERTS

GLUTAMATE RESIDUES
TO

GAMMA-CARBOXYGLUTAMATE

M250 F2 H-M81601 TRANSCRIPTION 33.22 36.OkDa ELONGATION FACTOR
S-II

[Homo sapiens]

C2 H-M81650 Human semenogelin 50.93 52 I (SEMGI) gene, complete cds M266 A4 H-M81757 ribosomal protein 16.06 18 169-61 H-M81933 m-phase inducer phosphatase57 57.60 M302 HI H-M82809 annexin IV 35.42 38.OkDa M300 C4 H-M83653 cytoplasmic phosphotyrosyl17.49 28.OkDa protein phosphatase, type 1 169-14 H-M83941 tyrosne-protein kinase108 108.2 receptor ETK I precursor F1 H-M84443 Galactokinase 2 50.49 52 M305 H6 H-M84747 interleukin 9 receptor57.53 58 [IL9R]

167-53 H-M86400 14-3-3 protein zeta/delta33 27.02 M271 C8 H-M86521 transketolase 68.64 68.OkDa 169-51 H-M86699 human kinase (TTK) 92 92.58 mRNA

M316 F2 H-M86752 transformation-sensitive59.84 60.OkDa protein M270 C8 H-M86921 membrane glycoprotein24.97 34 mb-1, Immunoglobulin-associated alpha, ASSOCIATED
TO

SURFACE IGM-RECEPTOR;

MAY BE INVOLVED IN

SIGNAL TRANSDUCTION

A5 H-M87507 Homo sapien interleukin-144.55 50 beta convertase (ILIBCE) mRNA, complete cds M305 B7 H-M88011 glucokinase [GCK] 51.26 60 M305 H1 H-M88279 immunophilin FKBP52 50.6 64.OkDa M420 F1 H-M88468 mevalonate kinase 43.600 47.OkDa M305 A7 H-M89913 dUTP pyrophosphatase15.62 19 (dUTPase) [DUT*]

M316 E2 H-M90657 tumor-associated 22.33 28 antigen L6 167-31 H-M90813 human D-type cyclin 36 31.86 (CCND2) mRNA

A 1 H-M91036 H.sapiens G-gamma 16.28 18 globin and A-gamma globin genes, complete cds's G2 H-M91463 Human glucose transporter55.66 52 (GLUT4) gene, complete cds A1 H-M91670 Human ubiquitin carrier24.86 36 protein (E2-EPF) mRNA, complete cds E4 H-M92444 Homo Sapiens 35.09 45 apurinic/apyrimidinic endonuclease (HAPl) gene, complete cds M305 C4 H-M94556 single-stranded DNA-binding16.39 20 protein, mitochondrial G 12 H-M94856 fatty-acid-binding 14.96 36 protein homolog M453 C3 H-M95623 Homo Sapiens 39.82 SO.OIcDa hydroxymethylbilane synthase gene, complete cds M302 F2 H-M95787 smooth muscle protein22.22 33.OkDa AI H-M95809 Human basic transcription60.39 64 factor 621cD subunit (BTF2), complete cds M271 E8 H-M96982 small nuclear ribonucleoprotein26.51 39.OIcDa U2 auxiliary factor, 35 kDa , KD SUBUNIT. NECESSARY

FOR THE SPLICING OF
PRE-mRNA.

M416 B3 H-M96995 Growth factor receptor-bound23.98 32.O1cDa protein 2 G2 H-M96995 Growth factor receptor-bound23.98 49 protein 2 H4 H-M97016 Bone morphogenetic 44.33 61 protein 8 (osteogenic protein 2) M271 DI H-M97190 Sp2 transcription 54.56 60 factor [SP2], BINDS TO GC BOX

PROMOTERS ELEMENTS
AND

SELECTIVELY ACTIVATES

mRNA SYNTHESIS FROM

GENES THAT CONTAIN

FUNCTIONAL RECOGNITION

SITES.

M271 C1 H-M97191 Sp3 transcription 71.94 72 factor [SP3], BINDS TO GT AND GC
BOXES

PROMOTERS ELEMENTS.

PROBABLE

TRANSCTRIPTIONAL

ACTIVATOR.

M305 C7 H-M97388 transcription repressor19.47 30 (interacting with the TATA-binding protein) [DRI *]

217-13 H-M97675 human transmembrane 100 103.1 receptor (rorl) mRNA

B3 H-M97856 Nuclear autoantigenic86.68 87 sperm protein (histone-binding) M429 G2 H-M97935 Homo Sapiens transcription82.61 89.O1cDa factor ISGF-3 mRNA, complete cds D1 H-M99487 Human prostate-specific82.61 92 membrane antigen (PSM) mRNA, complete cds M363 A1 H-P0002 riboflavin synthase 17.27 beta chain (ribE) M363 B 1 H-P0004 carbonic anhydrase 24.42 (icfA) M363 C1 H-P0005 orotidine 5'-phosphate25.08 decarboxylase (pyrF) M363 D1 H-P0006 pantoate-beta-alanine30.47 ligase (PAC) M379 A1 H-P0010-2 chaperone and heat 60.17 shock protein (groEL) M363 E1 H-P0011 co-chaperone (groES) 13.09 M363 F1 H-P0012 DNA primase (dnaG) 61.6 M363 GI H-P0013 hypothetical protein 38.61 M363 H1 H-P0014 hypothetical protein 30.36 M363 A2 H-P0015 hypothetical protein 10.34 M363 B2 H-P0016 hypothetical protein 9.68 M363 C2 H-P0017 virB4 homolog (virB4)86.68 M363 D2 H-P0018 hypothetical protein 51.7 M363 E2 H-P0021 hypothetical protein 21.01 M363 F2 H-P0022 conserved hypothetical57.42 integral membrane protein M363 G2 H-P0026 citrate synthase (gltA)46.97 M363 H2 H-P0027 isocitrate dehydrogenase46.86 (icd) M363 A3 H-P0028 conserved hypothetical19.58 secreted protein M363 B3 H-P0030 hypothetical protein 65.34 M363 C3 H-P0031 hypothetical protein 15.18 M363 D3 H-P0034 aspartate 1-decarboxylase12.98 (panD) M363 E3 H-P0035 conserved hypothetical10.78 protein M363 F3 H-P0037 NADH-ubiquinone 38.72 oxidoreductase subunit M363 G3 H-P0044 GDP-D-mannose dehydratase42.02 (rfbD) M363 H3 H-P0047 hydrogenase expression/formation36.63 protein (hypE) M363 A4 H-P0048 transcriptional regulator84.7 (hypF) M363 B4 H-P0052 hypothetical protein 36.41 M363 C4 H-P0055 proline permease (putP)54.67 M363 D4 H-P0056 delta-1-pyrroline-5-carboxylate130.46 dehydrogenase M363 E4 H-P0057 hypothetical protein 7,7 M363 F4 H-P0063 hypothetical protein 54.67 M363 G4 H-P0064 hypothetical protein 15.4 M363 H4 H-P0066 conserved hypothetical91.52 ATP-binding protein M363 AS H-P0067 urease accessory protein29.26 (ureH) M363 BS H-P0068 urease accessory protein22 (ureG) M363 CS H-P0075 urease protein (ureC)49.06 M363 DS H-P0077 peptide chain release38.83 factor RF-1 (PEA) M363 ES H-P0082 methyl-accepting chemotaxis74.14 transducer (tlpC) M363 FS H-P0086 conserved hypothetical49.61 protein M363 G5 H-P0087 hypothetical protein 50.38 M363 HS H-P0088 RNA polymerise sigma-7073.92 factor (rpoD) M363 A6 H-P0089 pfs protein (pfs) 25.52 M363 B6 H-P0090 malonyl coenzyme A-acyl34.1 carrier protein transacylase (fibD) M363 C6 H-P0093 hypothetical protein 12.21 M363 D6 H-P0096 phosphoglycerate dehydrogenase34.65 M304 A1 H-P0099 methyl-accepting chemotaxis74.36 protein (tlpA) M304 B1 H-PO100 conserved hypothetical40.59 protein M304 C 1 H-P0101 hypothetical protein 27.94 M304 D1 H-P0104 2',3'-cyclic-nucleotide64.02 2'-phosphodiesterase (cpdB) M304 E 1 H-P0105 conserved hypothetical17.16 protein M304 F1 H-P0106 cystathionine gamma-synthase41.91 (metB) M304 GI H-P0107 cysteine synthetase 33.77 (cysK) M304 H1 H-P0108 hypothetical protein 20.57 M304 A2 H-P0109 chaperone and heat 68.31 shock protein 70 (dnaK) M304 B2 H-P0110 co-chaperone and heat20.9 shock protein (grpE) M304 C2 H-PO111 hypothetical protein 30.47 M304 D2 H-P0113 hypothetical protein 10.89 M304 E2 H-P0114 hypothetical protein 69.19 M304 F2 H-PO115 flagellin B (flag) 56.65 M304 G2 H-P0116 DNA topoisomerase 81.07 I (topA) M304 H2 H-P0117 conserved hypothetical33.99 protein M304 A3 H-P0118 hypothetical protein 43.56 M304 B3 H-P0119 hypothetical protein 50.82 M304 C3 H-P0120 hypothetical protein 43.89 M304 D3 H-P0121 phosphoenolpyruvate 89.43 synthase (PPS) M304 E3 H-P0122 hypothetical protein 4.84 M304 F3 H-P0123 threonyl-tRNA synthetase67.43 (thrS) M304 G3 H-P0124 translation initiation22.44 factor IF-3 (intC) M304 H3 H-P0125 ribosomal protein 7.15 L35 (rp135) M304 A4 H-P0126 ribosomal protein 12.87 L20 (rp120) M304 B4 H-P0127 outer membrane protein31.57 (omp4) M304 C4 H-P0128 hypothetical protein 4.62 M304 D4 H-P0129 hypothetical protein 15.62 M304 E4 H-P0130 hypothetical protein 31.57 M304 F4 H-P0131 hypothetical protein 3.74 M304 G4 H-P0132 L-serine deaminase 50.16 (sdaA) M304 H4 H-P0133 serine transporter 45.54 (sdaC) M304 AS H-P0134 3-deoxy-D-arabino-heptulosonate49.5 7-phosphate synthase (dhs 1 ) M304 BS H-P0135 hypothetical protein 4.95 M304 CS H-P0136 bacterioferritin comigratory16.83 protein (bcp) M304 DS H-)?0137 hypothetical protein 23.32 M304 ES H-P0138 conserved hypothetical53.02 iron-sulfur protein M304 FS H-P0139 conserved hypothetical26.73 secreted protein M304 GS H-P0140 L-lactate permease 60.5 (IctP) M304 HS H-P0141 L-lactate permease 60.72 (IctP) M304 A6 H-P0142 A1G-specific adenine 36.19 glycosylase (mutt) M304 B6 H-P0144 cytochrome c oxidase,53.79 heme b and copper-binding subunit, membrane-bound (fixN) M304 C6 H-P0145 cytochrome c oxidase,25.63 monoheme subunit, membrane-bound (fix0) M304 D6 H-P0146 cbb3-type cytochrome 8.14 c oxidase subunit Q (CcoQ) M304 E6 H-P0147 cytochrome c oxidase,31.57 diheme subunit, membrane-bound (fucP) M304 F6 H-P0148 hypothetical protein 7.59 M304 G6 H-PO150 hypothetical protein 21.67 M304 H6 H-P0152 hypothetical protein 31.68 M304 A7 H-P0153 recombinase (recA) 38.28 M304 B7 H-P0154 enolase (eno) 46.97 M304 C7 H-PO155 hypothetical protein 10.12 M304 D7 H-P0157 shikimic acid kinase 17.93 I {aroK) M304 E7 H-P0158 hypothetical protein 35.09 M304 F7 H-P0159 lipopolysaccharide 41.03 1,2-glucosyltransferase (rfa~

M304 G7 H-P0161 hypothetical protein 4.07 M304 H7 H-P0162 conserved hypothetical26.51 protein M304 A8 H-P0163 delta-aminolevulinic 35.64 acid dehydratase (hemB) M304 B8 H-P0164 signal-transducing 28.05 protein, histidine kinase M304 C8 H-P0165 hypothetical protein 19.14 M304 D8 H-P0166 response regulator 24.86 (ompR) M304 E8 H-P0167 hypothetical protein 17.38 M304 F8 H-P0168 hypothetical protein 9.68 M304 G8 H-P0170 hypothetical protein 27.94 M304 H8 H-P0171 peptide chain release40.04 factor RF-2 (P~) M304 A9 H-P0172 molybdopterin biosynthesis43.12 protein (moeA) M304 B9 H-P0173 tlagellar biosynthetic28.16 protein (fliR) M304 C9 H-P0174 hypothetical protein 28.49 M304 D9 H-P0175 cell binding factor 33 M304 E9 H-P0176 fructose-bisphosphate33.88 aldolase {tsr) M304 F9 H-P0177 translation elongation20.68 factor EF-P
(efp) M304 G9 H-P0178 spore coat polysaccharide37.51 biosynthesis protein E

M304 H9 H-P0179 ABC transporter, ATP-binding23.54 protein M304 A10 H-P0180 apolipoprotein N-acyltransferase46.86 (cute) M304 B10 H-P0182 lysyl-tRNA synthetase55.22 (lysS) M304 C10 H-P0183 serine hydroxymethyltransferase45.87 (glyA) M304 D10 H-P0184 hypothetical protein 19.91 M304 E10 H-P0185 hypothetical protein 29.48 M304 F10 H-P0186 hypothetical protein 44.55 M304 G10 H-P0187 hypothetical protein 10.56 M304 H10 H-P0188 hypothetical protein 3.74 M304 A11 H-P0189 conserved hypothetical19.58 integral membrane protein M304 BI1 H-P0190 conserved hypothetical55.33 secreted protein M304 C11 H-P0191 fumarate reductase, 27.06 iron-sulfur subunit (frdB) M304 Dl H-P0192 fumarate reductase, 78.65 l flavoprotein subunit (frdA) M304 E11 H-P0193 fumarate reductase, 28.16 cytochrome b subunit (frdC) M304 Fl H-P0194 triosephosphate isomerase25.85 l (tpi) M304 G11 H-P0195 enoyl-(acyl-Garner-protein)30.36 reductase (NADH) (fabl) M365 A1 H-P0197 S-adenosyhnethionine 42.46 synthetase 2 (metX) M365 B1 H-P0203 hypothetical protein 10.12 M365 C1 H-P0209 hypothetical protein 49.61 M365 D1 H-P02I3 glucose inhibited 68.42 division protein (gig) M381 E1 H-P0218 hypothetical protein 20.24 M365 E1 H-P0221 nifU-like protein 35.97 M365 F1 H-P0227 outer membrane protein76.12 (omp5) M365 G1 H-P0228 conserved hypothetical43.01 integral membrane protein M365 H1 H-P0230 CTP:CMP-3-deoxy-D-manno-26.84 octulosonate-cytidylyl-transferase (kdsB) M365 A2 H-P0233 conserved hypothetical43.01 protein M365 B2 H-P0235 conserved hypothetical39.16 secreted protein M365 C2 H-P0236 hypothetical protein 13.64 M365 D2 H-P0238 prolyl-tltNA synthetase63.58 (pros) M381 E2 H-P0243 neutrophil activating15.95 protein (napA) (bacteriofen itin) M365 E2 H-P0244 signal-transducing 42.02 protein, histidine kinase (atoS) M365 F2 H-P0246 flagellar basal-body 37.73 P-ring protein (flgI) M365 G2 H-P0247 ATP-dependent RNA ~ 54.23 helicase, DEAD-box family (deaD) M365 H2 H-P0248 conserved hypothetical39.93 protein M379 B1 H-P0249-2 hypothetical protein 19.8 M379 C1 H-P0250-2 oligopeptide ABC transporter,56.87 ATP-binding protein (oppD) M381 A3 H-P0251 oligopeptide ABC transporter,37.29 permease protein (oppC) M379 E1 H-P0252-2 outer membrane protein53.68 (omp7) M365 A3 H-P0254 outer membrane protein47.52 (omp8) M365 B3 H-P0255 adenylosuccinate synthetase45.32 (purA) M365 C3 H-P0257 conserved hypothetical24.2 secreted protein M365 D3 H-P0259 exonuclease VII, large46.31 subunit (xseA) M381 D3 H-P0260 adenine specific DNA 42.35 methyltransferase (mod) M365 E3 H-P0263 adenine specific DNA 27.83 methyltransferase (hpaim) M365 F3 H-P0264 ATP-dependent protease94.27 binding subunit (clpB) M365 G3 H-P0266 dihydroorotase (pyrC)41.69 M365 H3 H-P0267 chlorohydrolase 45.1 M365 A4 H-P0271 hypothetical protein 36.08 M365 B4 H-P0275 ATP-dependent nuclease47.41 (addB) M381 G3 H-P0276 hypothetical protein 20.46 M365 C4 H-P0278 guanosine pentaphosphate53.35 phosphohydrolase (gppA) M365 D4 H-P0279 lipopolysaccharide 37.51 heptosyltransferase-1 (rfaC) M365 E4 H-P0280 heat shock protein 36.19 B (ibpB) M365 F4 H-P0282 hypothetical protein 52.91 M365 G4 H-P0283 3-dehydroquinate synthase37.84 (aroB) M365 H4 H-P0284 conserved hypothetical57.64 integral membrane protein M365 AS H-P0285 conserved hypothetical46.09 protein M381 A4 H-P0287 hypothetical protein 19.03 M381 C4 H-P0288 hypothetical protein 17.38 M366 A1 H-P0389 superoxide dismutase 23.54 (soda) M366 B1 H-P0390 adhesin-thiol peroxidase18.37 (tagD) M366 C1 H-P0391 purine-binding chemotaxis18.26 protein (cheVl~

M366 D1 H-P0392 histidine kinase (cheA)88.44 M366 E1 H-P0393 chemotaxis protein 34.32 (cheV) M366 F1 H-P0394 hypothetical protein 27.83 M366 G1 H-P0395 conserved hypothetical24.53 protein M366 H 1 H-P0396 conserved hypothetical67.87 protein M366 A2 H-P0397 phosphoglycerate dehydrogenase57.75 (serA) M366 B2 H-P0398 hypothetical protein 20.13 M366 C2 H-P0399 ribosomal protein 61.27 S 1 (rps 1 ) M366 D2 H-P0403 phenylalanyl-tRNA 36.19 synthetase, alpha subunit (pheS) _ M366 E2 H-P0404 protein kinase C inhibitor11.55 (SP:P16436) M366 F2 H-P0405 nifS-like protein 48.51 M366 G2 H-P0406 hypothetical protein 21.67 M366 H2 H-P0407 biotin sulfoxide reductase87.67 (bisC) M381 DI H-P0409 GMP synthase (guaA) 55.99 M381 F1 H-P0410 putative neuraminyllactose-27.5 binding hemagglutinin homolog (hp~) M366 A3 H-P0411 hypothetical protein 11.66 M366 B3 H-P0412 hypothetical protein 3.63 M366 C3 H-P0413 transposase-like protein,29.59 M366 D3 H-P0414 IS200 insertion sequence15.29 from M366 E3 H-P0415 conserved hypothetical68.64 integral membrane protein M366 F3 H-P0416 cyclopropane fatty 42.9 acid synthase (cfa) M366 G3 H-P0417 methionyl-tRNA synthetase71.61 (metS) M366 H3 H-P0418 hypothetical protein 36.96 M366 A4 H-P0419 conserved hypothetical28.82 protein M366 B4 H-P0420 hypothetical protein 15.73 M366 C4 H-P0421 type 1 capsular polysaccharide42.9 biosynthesis protein J (capJ) M366 D4 H-P0422 arginine decarboxylase67.76 (speA) M366 E4 H-P0424 hypothetical protein 68.2 M366 F4 H-P0425 hypothetical protein 45.98 M366 G4 H-P0427 hypothetical protein 12.32 M366 H4 H-P0433 hypothetical protein 16.28 M366 AS H-P0436 hypothetical protein 13.42 M366 BS H-P0437 IS605 transposase 15.73 (tnpA) M366 CS H-P0438 IS605 transposase 47.08 (tnpB) M366 DS H-P0442 hypothetical protein 9.79 M366 ES H-P0445 hypothetical protein 6.82 M366 FS H-P0452 hypothetical protein 57.09 M366 GS H-P0455 hypothetical protein 11.44 M366 HS H-P0457 hypothetical protein 9.68 M366 A6 H-P0463 type I restriction 53.68 enzyme M
protein (hsdM) M366 B6 H-P0464 type I restriction 116.16 enzyme R
protein (hsdR) M366 C6 H-P0465 conserved hypothetical69.52 protein M366 D6 H-P0466 conserved hypothetical28.16 protein M366 E6 H-P0467 conserved hypothetical12.76 integral membrane protein M366 F6 H-P0468 conserved hypothetical54.56 protein M366 G6 H-P0469 conserved hypothetical17.93 protein M366 H6 H-P0471 glutathione-regulated45.87 potassium-efflux system protein (kefB) M366 A7 H-P0472 outer membrane protein20.57 (ompl l) M366 B7 H-P0473 molybdenum ABC transporter,27.17 periplasmic molybdate-binding protein (modA) M366 C7 H-P0474 molybdenum ABC transporter,24.75 permease protein (modB) M366 D7 H-P0475 molybdenum ABC transporter,29.26 ATP-binding protein (modD) M366 E7 H-P0476 glutamyl-tRNA synthetase51.04 {gltX) M366 F7 H-P0477 outer membrane protein40.48 (ompl2) M366 G7 H-P0478 adenine specific DNA 60.06 methyltransferase (VSPIM) M366 H7 H-P0479 hypothetical protein 31.13 M366 A8 H-P0481 adenine specific DNA 23.32 methyltransferase (MFOKI) M366 B8 H-P0482 hypothetical protein 18.81 M366 C8 H-P0483 cytosine specific 36.3 DNA
methyltransferase (H-PHIMC) M367 A1 H-P0486 hypothetical protein 58.19 M367 B1 H-P0487 hypothetical protein 52.91 M367 C1 H-P0489 hypothetical protein 32.56 M367 DI H-P0490 putative potassium 41.69 channel protein, putative M367 El H-P0491 ribosomal protein 6.93 L28 {rpL28) M367 F1 H-P0492 hypothetical protein 30.69 M367 G1 H-P0494 UDP-N-acetylmuramoylalanine-46.53 D-glutamate ligase (murD) M367 H1 H-P0495 hypothetical protein 9.57 M367 A2 H-P0496 conserved hypothetical14.74 protein M367 B2 H-P0498 sodium- and chloride-dependent48.73 transporter M367 C2 H-P0499 phospholipase A1 precursor39.16 (DR-phospholipase A) M367 D2 H-PO500 DNA polymerase III 41.25 beta-subunit (dnaN) M367 E2 H-PO501 DNA gyrase, sub B 85.14 {gyrB) M367 F2 H-P0503 hypothetical protein 27.17 M367 G2 H-P0504 hypothetical protein 5.5 M367 H2 H-PO505 hypothetical protein 17.05 M367 A3 H-P0507 conserved hypothetical23.43 protein M367 B3 H-P0509 glycolate oxidase 50.6 subunit (glcD) M367 C3 H-POS 10 dihydrodipicolinate 28.05 reductase {APB) M367 D3 H-P0512 glutamine synthetase 53.02 (glnA) M367 E3 H-P0514 ribosomal protein 16.61 L9 (rpl9) M367 F3 H-PO515 heat shock protein 19.91 (hslV) M367 G3 H-P0516 heat shock protein 48.84 (hslU) ORF1 M367 H3 H-P0517 GTP-binding protein 33.33 (era) M367 A4 H-P0519 conserved hypothetical30.47 protein M367 B4 H-P0520 cag pathogenicity 12.76 island protein (cagl) M367 C4 H-P0522 cag pathogenicity 53.02 island protein (cag3) M367 D4 H-P0523 cag pathogenicity 18.7 island protein (~B4) M36 7 viral l homolog 36.41 M367 F4 H-P0526 cag pathogenicity 22 island protein (cag6) M367 G4 H-P0528 cag pathogenicity 57.53 island protein (cag8) M379 H1 H-P0531-2 cag pathogenicity 24.09 island protein (cagll) M367 H4 H-P0532 cag pathogenicity 30.91 island protein (cagl2) M367 A5 H-P0534 cag pathogenicity 21.67 island protein (cagl3) M367 B5 H-P0541 cag pathogenicity 40.81 island protein - (cag20) M367 C5 H-P0542 cag pathogenicity 15.73 island protein (cag21) M367 D5 H-P0545 cag pathogenicity 22.88 island protein (cag24) M367 E5 H-P0549 glutamate racemase 28.16 (glr) M367 F5 H-P0550 transcription termination48.29 factor )tho (rho) M367 G5 H-P0551 ribosomal protein 7.48 L31 (rp131) M367 H5 H-P0552 conserved hypothetical31.68 protein M36? A6 H-P0553 conserved hypothetical25.08 protein M367 B6 H-P0554 hypothetical protein 35.42 M367 C6 H-P0555 hypothetical protein 30.14 M367 D6 H-P0556 hypothetical protein 16.06 M367 E6 H-P0557 acetyl-coenzyme A 34.43 carboxylase (accA) M367 F6 H-P0558 beta ketoacyl-acyl 45.43 carrier protein synthase II (fabF) M367 G6 H-P0561 3-ketoacyl-acyl carrier27.28 protein reductase (fabG) M367 H6 H-P0562 ribosomal protein 7.81 S21 (rps21) M367 A7 H-P0563 hypothetical protein 45.87 M367 B7 H-P0566 diaminopimelate epimerase30.14 (~PF) M367 C7 H-P0568 hypothetical protein 28.16 M367 D7 H-P0570 aminopeptidase a/i 54.67 (pepA) M367 E7 H-P0571 conserved hypothetical21.23 integral membrane protein M379 A2 H-P0572-2 adenine 19.8 phosphoribosyltransferase (apt) M379 B2 H-P0573-2 hypothetical protein 12.21 M379 C2 H-P0574-2 galactosidase acetyltransferase16.72 (lacA) M379 D2 H-P0575-2 conserved hypothetical25.63 membrane protein M379 E2 H-P0576-2 signal peptidase I 32.01 (IepB) M367 F7 H-P0577 methylene-tetrahydrofolate32.23 dehydrogenase(folD) M367 G7 H-P0579 hypothetical protein 20.35 M367 H7 H-P0580 hypothetical protein 41.03 M367 A8 H-P0581 dihydroorotase (pyrC)37.4 M367 B8 H-P0582 hypothetical protein 35.75 M367 C8 H-P0583 hypothetical protein 32.34 M368 A1 H-P0584 flagellar switch protein13.64 (fliN) M368 B H-P0585 endonuclease III (nth)24.09 M368 C1 H-P0587 aminodeoxychorismate 36.3 lyase (pabC) M368 D1 H-P0591 ferredoxin oxidoreductase,20.57 gamma subunit M368 E1 H-P0593 adenine specific DNA 65.89 methyltransferase (mod) M368 F1 H-P0594 hypothetical protein 6.05 M368 GI H-P0596 hypothetical protein 21.23 M368 H1 H-P0597 penicillin-binding 72.6 protein lA
(PBP-1 A) M368 A2 H-P0599 hemolysin secretion 47.74 protein precursor(hylB) M368 B2 H-P0601 flagellin A (flaA) 56.21 M368 C2 H-P0602 endonuclease III 24.09 M368 D2 H-P0603 hypothetical protein 20.9 M379 F2 H-P0608-2 hypotheticai protein 17.71 M368 E2 H-P0614 hypothetical protein 12.32 M368 F2 H-P0616 chemotaxis protein 34.54 (cheV) M368 G2 H-P0617 aspartyl-tltNA synthetase63.58 (asps) M368 H2 H-P0621 DNA mismatch repair 83.93 protein (MutS) M368 A3 H-P0622 hypothetical protein 13.31 M368 B3 H-P0623 UDP-N-acetylmuramate-alanine49.5 ligase (murC) M368 C3 H-P0625 protein E (gcpE) 39.6 M368 D3 H-P0626 tetrahydrodipicolinate44.22 N-succinyltransferase (dapD) M368 E3 H-P0627 hypothetical protein 12.21 M368 F3 H-P0629 hypothetical protein 75.02 M368 G3 H-P0630 modulator of drug 21.45 activity (mda66) M368 H3 H-P0631 quinone-reactive Ni/Fe42.35 hydrogenase, small subunit (hY~) M368 A4 H-P0632 quinone-reactive Ni/Fe63.69 hydrogenase, large subunit (hydB) M368 B4 H-P0633 quinone-reactive Ni/Fe24.75 hydrogenase, cytochrome b subunit (hydC) M368 C4 H-P0634 quinone-reactive Ni/Fe19.69 hydrogenase (hydD) M368 D4 H-P0635 hypothetical protein 56.43 M368 E4 H-P0636 hypothetical protein 10.23 M368 F4 H-P0637 hypothetical protein 16.61 M368 G4 H-P0638 outer membrane protein33.66 (ompl3) M368 H4 H-P0643 glutamyl-tltNA synthetase48.4 (gltX) M368 AS H-P0644 conserved hypothetical10.78 integral membrane protein M368 BS H-P0645 soluble lytic murein 61.71 transglycosylase (slt) M368 CS H-P0646 UDP-glucose pyrophosphorylase30.14 (galU) M368 D5 H-P0647 hypothetical protein 14.96 M368 ES H-P0648 UDl'-N-acetylglucosamine46.53 enolpyruvyl transferase (murZ) M368 FS H-P0649 aspartate ammonia-lyase51.59 (aspA) M368 GS H-P0650 hypothetical protein 21.67 M379 A3 H-P0651-2 fucosyltransferase 52.47 M381 E3 H-P0652 phosphoserine phosphatase22.88 (sera) M368 HS H-P0653 nonheme iron-containing18.48 ferritin (Pfi') M379 G2 H-P0654-2 conserved hypothetical39.71 protein M379 H2 H-P0655-2 protective surface 100.87 antigen D15 M368 A6 H-P0656 conserved hypothetical42.24 protein M368 B6 H-P0657 processing protease 47.63 (ymxG) M368 C6 H-P0658 PET112-like protein 52.36 M368 D6 H-P0659 hypothetical protein 45.65 M368 E6 H-P0660 hypothetical protein 37.29 M368 F6 H-P0661 ribonuclease H (rnhA)15.84 M368 G6 H-P0662 ribonuclease III (rnc)26.51 M368 H6 H-P0663 chorismate synthase 40.26 (aroC) M368 A7 H-P0665 oxygen-independent 50.38 coproporphyrinogen III oxidase (hemN) M368 B7 H-P0667 hypothetical protein 9.46 M368 C7 H-P0668 hypothetical protein 66.88 M368 D7 H-P0671 outer membrane protein29.81 (ompl4) M368 E7 H-P0672 solute-binding signature43.01 and mitochondrial signature protein (~pB) M379 B3 H-P0673-2 hypothetical protein 46.97 M381 H3 H-P0674 hypothetical protein 25.19 M368 F? H-P0676 methylated-DNA--protein-18.59 cysteine methyltransferase (datl) M368 G7 H-P0677 conserved hypothetical28.16 integral membrane protein M368 H7 H-P0679 lipopolysaccharide 31.9 biosynthesis protein (wbpB) M369 A1 H-P0681 hypothetical protein 18.59 M369 BI H-P0682 hypothetical protein 13.97 M369 Cl H-P0683 UDP-N-acetylglucosamine47.74 pyrophosphorylase (ghnU) M369 D1 H-P0685 flagellar biosynthetic19.03 protein (flip) M369 E1 H-P0687 iron(II) transport 70.73 protein (feoB) M369 F1 H-P0688 hypothetical protein 18.37 M369 G H-P0690 acetyl coenzyme A 43.12 1 acetyltransferase (thiolase) (fadA) M381 A1 H-P0691 3-oxoadipate coA-transferase25.63 _subunit A (yxjD) M381 B1 H-P0692 3-oxoadipate coA-transferase22.88 subunit B (yxjE) M369 Hl H-P0694 hypothetical protein28.38 M369 A2 H-P0695 hydantoin utilization78.54 protein A
(hyuA) M369 B2 H-P0697 hypothetical protein18.59 M369 C2 H-P0699 hypothetical protein37.73 M369 D2 H-P0700 diacylglycerol kinase14.19 (dgkA) M369 E2 H-P0701 DNA gyrase, sub A 91.08 (gyrA) M369 F2 H-P0703 response regulator 42.02 M369 G2 H-P0707 conserved hypothetical33.99 protein M369 H2 H-P0711 hypothetical protein44.77 M369 A3 H-P0715 ABC transporter, 26.51 ATP-binding protein M369 B3 H-P0716 conserved hypothetical14.74 protein M369 C3 H-P0718 conserved hypothetical23.21 integral membrane protein M369 D3 H-P0719 hypothetical protein12.1 M369 E3 H-P0723 L-asparaginase II 36.41 (ansB) M369 F3 H-P0724 anaerobic C4-dicarboxylate48.84 transport protein (dcuA) M369 G3 H-P0727 transcriptional regulator,36.19 putative M369 H3 H-P0728 conserved hypothetical37.07 protein M369 A4 H-P0730 hypothetical protein11.22 M369 B4 H-P0732 hypothetical protein13.09 M369 C4 H-P0734 conserved hypothetical48.4 protein M369 D4 H-P0735 xanthine guanine 16.94 phosphoribosyl transferase (gpt) M369 E4 H-P0737 conserved hypothetical17.49 integral membrane protein M381 H2 H-P0738 D-alanine:D-alanine 38.28 ligase A
(ddlA) M369 F4 H-P0739 2-hydroxy-6-oxohepta-2,4-26.62 dienoate hydrolase M369 G4 H-P0741 conserved hypothetical17.82 protein M369 H4 H-P0745 conserved hypothetical36.08 protein M369 AS H-P0747 conserved hypothetical43.34 protein M369 BS H-P0748 cell division protein24.64 (ftsE) M369 CS H-P0749 cell division membrane29.59 protein (ftsX) M369 DS H-P0750 hypothetical protein44.11 M369 ES H-P0752 flagellar hook-associated74.25 protein 2 (flip) M381 F3 H-P0755 molybdopterin biosynthesis23.21 protein (moeB) M379 C3 H-P0757-2 beta-alanine synthetase32.23 homolog M369 FS H-P0758 conserved hypothetical48.18 integral membrane protein M369 GS H-P0759 conserved hypothetical45.98 integral membrane protein M369 HS H-P0761 hypothetical protein22.11 M369 A6 H-P0762 hypothetical protein20.46 M369 H6 H-P0767 hypothetical protein2.75 M369 C6 H-P0768 molybdenum cofactor 35.42 biosynthesis protein A (moaA) M369 D6 H-P0769 molybdopterin-guanine22.22 dinucleotide biosynthesis protein A (mobA) M369 E6 H-P0771 hypothetical protein27.06 M369 F6 H-P0772 N-acetylmuramoyl-L-alanine48.51 amidase (amiA) M369 G6 H-P0773 hypothetical protein40.04 M369 H6 H-P0777 uridine 5'-monophosphaie26.51 (UMP) kinase (pyres) M370 A1 H-P0782 hypothetical protein50.16 M370 B1 H-P0783 hypothetical protein18.26 M370 C1 H-P0792 sigma-54 interacting55.77 protein M370 D1 H-P0793 polypeptide deformylase19.25 (def) M370 E1 H-P0794 ATP-dependent clp 21.67 protease proteolytic component (clpP) M370 F1 H-P0796 outer membrane protein30.69 (ompl8) M379 G3 H-P0797-2 flagellar sheath 28.71 adhesin hpaA

M379 H3 H-P0798-2 molybdenum cofactor 17.49 biosynthesis protein C (moaC) M370 G H-P0799 molybdopterin biosynthesis19.47 1 protein (mog) M370 H1 H-P0800 molybdopterin converting16.06 factor, subunit 2 (moaE) M379 A4 H-P0801-2 molybdopterin converting8.25 factor, subunit 1 (moaD) M379 B4 H-P0802-2 GTP cyclohydrolase 21.23 II (ribA) M379 D3 H-P0803-2 hypothetical protein30.8 M379 E3 H-P0804-2 GTP cyclohydrolase 37.95 II/3,4-dihydroxy-2-butanone phosphate synthase (ribA, ribB) M379 F3 H-P0805-2 lipooligosaccharide 31.35 SG8 epitope biosynthesis-associated protein (lex2B) M370 A2 H-P0806 hypothetical protein22.77 M379 C4 H-P0807-2 iron(III) dicitrate 86.68 transport protein (fecA) M370 B2 H-P0808 bolo-acp synthase 13.2 (acpS) M370 C2 H-P0809 hypothetical protein20.24 M370 D2 H-PO810 conserved hypothetical22.11 protein M370 E2 H-P0811 hypothetical protein11.99 M370 F2 H-P0812 hypothetical protein37.07 M370 G2 H-P0813 conserved hypothetical22.66 protein M370 H2 H-P0814 thiamin biosynthesis28.16 protein (thiF) M370 A3 H-P0815 flagellar motor rotation28.38 protein (motA) M370 B3 H-P0831 conserved hypothetical21.67 ATP
binding protein M379 D4 H-P0832-2 spermidine synthase 28.93 (speE) M379 E4 H-P0833-2 hypothetical protein 32.23 M37U C3 H-P0834 GTP-binding protein 50.49 homologue (yphC) M370 D3 H-P0835 histone-like DNA-binding10.45 protein ~ ~uP) M370 E3 H-P0836 hypothetical protein 13.2 M370 F3 H-P0837 hypothetical protein 11.33 M370 G3 H-P0838 hypothetical protein 22.66 M370 H3 H-P0839 outer membrane protein64.68 Pl (ompPl) M370 A4 H-P0840 flaAl protein 36.74 M370 B4 H-P0841 pantothenate metabolism46.86 flavoprotein (dfp) M370 C4 H-P0843 thiamin phosphate 24.2 pyrophosphorylase/hyroxyethylthi azole kinase (thiB) M370 D4 H-P0845 thiamin phosphate 30.14 pyrophosphorylase/hyroxyethylthi azole kinase (thiM) M370 E4 H-P0850 type I restriction 58.08 enzyme M
protein (hsdM) M370 F4 H-P0851 conserved hypothetical25.08 integral membrane protein M370 G4 H-P0854 GMP reductase (guaC) 36.08 M370 H4 H-P0858 ADP-heptose synthase 50.82 (rfaE) M370 AS H-P0859 ADP-L-glycero-D-mannoheptose-36.41 6-epimerase (rfaD) M370 BS H-P0861 hypothetical protein 27.17 M370 CS H-P0862 hypothetical protein 24.64 M379 F4 H-P0863-2 hypothetical protein 59.73 M370 DS H-P0865 deoxyuridine 5'-triphosphate16.06 nucleotidohydrolase (dut) M370 ES H-P0866 transcription elongation18.15 factor GreA (greA) M379 G4 H-P0867-2 lipid A disaccharide 39.71 synthetase (1P~) M379 H4 H-P0870-2 flagellar hook (flgE)79.09 M370 FS H-P0871 CDP-diglyceride hydrolase26.95 (cdh) M370 GS H-P0872 alkylphosphonate uptake12.I
protein (P~) M370 HS H-P0873 hypothetical protein 7.92 M371 A1 H-P0879 hypothetical protein 22.33 M371 B1 H-P0883 Holliday junction 20.24 DNA helicase (ruvA) M371 Cl H-P0885 virulence factor mviN50.82 protein (mviN) M371 D H-P0886 cysteinyl-tItNA synthetase5126 1 (cysS) M371 E1 H-P0889 iron(III) dicitrate 35.97 ABC
transporter, permease protein (fecD) M371 F1 H-P0890 conserved hypothetical28.27 protein M371 G H-P0891 conserved hypothetical19.25 I protein M371 H1 H-P0892 conserved hypothetical10.01 protein M371 A2 H-P0894 conserved hypothetical9.79 protein M371 B2 H-P0895 hypothetical protein13.86 M371 C2 H-P0896 outer membrane protein77.99 (omp 19) M371 D2 H-P0897 hypothetical protein22.99 M371 E2 H-P0898 hydrogenase expression/formation40.81 protein (hypD) M371 F2 H-P0899 hydrogenase expression/formation8.58 protein (hypC) M371 G2 H-P0900 hydrogenase expression/fonnation26.73 protein (hypB) M371 H2 H-P0905 phosphotransacetylase24.64 (pta) M371 A3 H-P0906 hypothetical protein58.08 M371 B3 H-P0907 _ 33.22 hook assembly protein, flagella (B!~) M371 C3 H-P0909 hypothetical protein22.22 M371 D3 H-P0912 outer membrane protein56.76 (omp20) M371 E3 H-P0913 outer membrane protein58.3 (omp21) M371 F3 H-P0914 hypothetical protein56.65 M371 G3 H-P0915 iron-regulated outer61.93 membrane protein (frpB) M371 H3 H-P0916 iron-regulated outer27.5 membrane protein (frpB) M380 A1 H-P0917-2 hypothetical protein2.64 M371 A4 H-P0918 hypotheticai protein15.84 M371 B4 H-P0920 conserved hypothetical25.41 integral membrane protein M371 C4 H-P0921 glyceraldehyde-3=phosphate36.63 dehydrogenase(gap) M371 D4 H-P0923 outer membrane protein40.7 (omp22) M371 E4 H-P0925 recombinational DNA 21.34 repair protein (recR) M371 F4 H-P0927 heat shock protein 35.97 (htpX) M371 G4 H-P0928 GTP cyclohydrolase 19.91 I (folE) M371 H4 H-P0929 geranyltranstransferase33.44 (ispA) M371 A5 H-P0930 stationary-phase 29.48 survival protein (surf) M371 BS H-P0931 hypothetical protein16.17 M371 CS H-P0932 hypothetical protein11.1 l M371 DS H-P0933 hypothetical protein22.11 M371 ES H-P0934 conserved hypothetical27.72 protein M371 F5 H-P0935 hypothetical protein17.82 M371 GS H-P0936 proline/betaine transporter42.9 (prop) M371 HS H-P0938 hypothetical protein12.76 M371 A6 H-P0939 amino acid ABC transporter,26.18 permease protein (yckJ) M371 B6 H-P0940 amino acid ABC transporter,28.27 periplasmic binding protein (Yc~) M371 C6 H-P0941 alanine racemase, 41.58 biosynthetic (alr) M371 D6 H-P0942 D-alanine glycine 49.61 permease {dagA) M371 E6 H-P0943 D-amino acid dehydrogenase45.21 {dadA) M371 F6 H-P0944 translation initiation13.86 inhibitor, putative M371 G6 H-P0946 conserved hypothetical54.67 integral membrane protein M371 H6 H-P0947 hypothetical protein13.31 M371 A7 H-P0949 conserved hypothetical16.61 secreted protein M371 B7 H-P0950 acetyl-CoA carboxylase31.9 beta subunit (accD) M371 C7 H-P0951 hypothetical protein22.66 M371 D7 H-P0952 conserved hypothetical24.09 integral membrane protein M371 E7 H-P0953 hypothetical protein20.79 M371 F7 H-P0955 prolipoprotein diacylglyceryl31.35 transferase (lgt) M371 G7 H-P0956 conserved hypothetical26.73 protein M371 H7 H-P0957 3-deoxy-d-manno-octulosonic-43.34 acid transferase (kdtA) M371 A8 H-P0958 hypothetical protein28.05 M371 B8 H-P0960 glycyl-tIZIVA synthetase,33.44 alpha subunit (glyQ) M371 C8 H-P0961 glycerol-3-phosphate34.43 dehydrogenase (NAD(P)+) M380 B H-P0965-2 hypothetical protein48.84 M371 D8 H-P0966 conserved hypothetical60.5 protein M380 F1 H-P0968-2 hypothetical protein2.42 M371 E8 H-P0969 cation efflux system112.31 protein (czcA) M371 F8 H-P0970 nickel-cobalt-cadmium39.6 resistance protein {nccB) M371 G8 H-P0971 hypothetical protein45.54 M371 H8 H-P0972 glycyl-tlZlVA synthetase,77.22 beta subunit (glyS) M371 A9 H-P0973 hypothetical protein38.94 M380 C1 H-P0974-2 phosphoglycerate 54.12 mutase (pgm) M380 D1 H-P0975-2 conserved hypothetical10.34 protein M380 EI H-P0976-2 adenosyhnethionine-8-amino-7-48.07 oxononanoate aminotransferase (bioA) M380 H1 H-P0994-2 hypothetical protein29.48 M380 G1 H-P1000-2 PARA protein 24.09 M380 A2 H-P1001-2 hypothetical protein10.45 M380 B2 H-P1002-2 hypothetical protein43.45 M380 C2 H-P1003-2 hypothetical protein40.81 M380 D2 H-P1004-2 hypothetical protein30.14 M380 E2 H-P1005-2 hypothetical protein11.55 M380 F2 H-P1006-2 conjugal transfer 19.58 protein (traG) M380 G2 H-P1017-2 amino acid permease 57.2 (rocE) M380 H2 H-P1042-2 hypothetical protein38.39 M380 A3 H-P1056-2 hypothetical protein31.35 M380 B3 H-P1075-2 conserved hypothetical48.29 secreted protein M373 A H-P 1076 hypothetical protein18.92 M373 B1 H-P1077 nickel transport 36.52 protein (nixA) M373 C H-P 1080 conserved hypothetical20.9 1 integral membrane protein M373 D1 H-P1081 hypothetical protein22.88 M373 E1 H-P1082 multidrug resistance60.72 protein (msbA) M373 F1 H-P1083 hypothetical protein52.8 M373 GI H-P1084 aspartate transcarbamoylase33.88 (P3'rB) M373 H1 H-P1085 hypothetical protein18.92 M373 A2 H-P1086 hemolysin (tly) 25.96 M373 B2 H-P1087 riboflavin biosynthesis30.91 regulatory protein (ribC) M373 C2 H-P1088 transketolase A (tktA)70.62 M373 D2 H-P1091 alpha-ketoglutarate 46.97 permease (kgtP) M373 E2 H-P1092 flagellar basal-body29.7 rod protein {flgG) M373 F2 H-P1096 IS605 transposase 15.73 (tnpA) M373 G2 H-P1098 conserved hypothetical32.01 secreted protein M373 H2 H-P1101 glucose-6-phosphate 46.86 dehydrogenase(g6pD) M373 A3 H-P1102 glucose-6-phosphate 25.08 dehydrogenase{devB) M373 B3 H-P1103 glucokinase (glk) 37.07 M373 C3 H-P1108 pyruvate ferredoxin 20.57 oxidoreductase, gamma subunit M373 D3 H-P1109 pyruvate ferredoxin 14.41 oxidoreductase, delta subunit M373 E3 H-P1110 pyruvate ferredoxin 44,88 oxidoreductase, alpha subunit M373 F3 H-P1111 pyruvate ferredoxin 34.65 oxidoreductase, beta subunit M373 G3 H-P1112 adenylosuccinate 48.51 lyase (purB) M380 C3 H-P1113-2 outer membrane protein30.58 (omp24) M373 H3 H-P 1117 conserved hypothetical28.27 secreted protein M373 A4 H-P1120 hypothetical protein15.95 M373 B4 H-P1121 cytosine specific 34.43 DNA
methyltransferase (BSP6IM) M380 D3 H-P1122-2 hypothetical protein8,47 M373 C4 H-P1123 peptidyl-prolyl cis-traps20.46 isomerase, FKBP-type rotamase (slyD) M373 D4 H-P1124 hypothetical protein36.52 M373 E4 H-P1125 peptidoglycan associated19.8 lipoprotein precursor (ompl8) M373 F4 H-P1126 colicin tolerance-like45.98 protein (tolB) M373 G4 H-P1128 hypothetical protein 9.35 M373 H4 H-P1129 biopolymer transport 14.74 protein (exbD) M373 AS H-P1131 ATP synthase F1, subunit13.?5 epsilon (atpC) M373 BS H-P1134 ATP synthase F1, subunit55.44 alpha (atpA) M373 CS H-P1135 ATP synthase F1, subunit19.91 delta (atpH) M373 DS H-P1137 ATP synthase F0, subunit15.95 b' (atpF') M373 ES H-P1138 plasmid replication-partition32.01 related protein M373 FS H-P1139 SpoOJ regulator (soj)29.15 M373 GS H-P1140 biotin operon repressor/biotin23.43 acetyl coenzyme A
carboxylase synthetase (birA) M373 HS H-P1141 methionyl-tltNA 33.44 fonmyltransferase (fret) M373 A6 H-P1144 hypothetical protein 9.46 M373 B6 H-Pl i45 hypothetical protein 11.44 M373 C6 H-P1147 ribosomal protein 13.09 L19 (rp119) M373 D6 H-P1148 tRNA (guanine-Nlr 25.3 methyltransferase (trmD) M373 E6 H-P1149 conserved hypothetical20.35 protein M380 F3 H-P1150-2 hypothetical protein 12.76 M373 F6 H-PI 152 signal recognition 49.39 particle protein M380 G3 H-P1153-2 valyl-tItNA synthetase96.25 (valS) M380 E3 H-P115?-2 outer membrane protein135.41 (omp26) M373 G6 H-P1158 pyrroline-5-carboxylate28.38 reductase (Pry) M373 H6 H-P1159 cell filamentation 19.58 protein (fic) M373 A7 H-P1160 conserved hypothetical15.51 protein M380 A4 H-P1163-2 hypothetical protein 7.04 M373 B7 H-P1165 tetracycline resistance42.57 protein tetA(P), putative M373 C7 H-P1168 carbon starvation 75.68 protein (cstA) M373 D7 H-P1169 glutamine ABC transporter,23.98 permease protein (glnP) M380 H3 H-P1169-2 glutamine ABC transporter,23.98 permease protein (glnP) M374 A1 H-P1170 glutamine ABC transporter,24.64 permease protein (ghiP) M374 B1 H-P1171 glutamine ABC transporter,27.39 ATP-binding protein (glnQ) M374 CI H-P1 I72 glutamine ABC transporter,30.58 periplasmic glutamine-binding protein (glnH) M374 D1 H-P1173 hypothetical protein 20.24 M374 E1 H-P1174 glucose%galactose 44.88 transporter (glue) M374 F1 H-P1175 conserved hypothetical47.96 integral membrane protein M374 G1 H-PI 177 outer membrane protein70.62 (omp27) M374 H1 H-P1178 purine-nucleoside 25.74 phosphorylase (deoD) M374 A2 H-P1179 phosphopentomutase 45.54 (deoB) M374 B2 H-Pl 180 pyrimidine nucleoside46.09 transport protein (nupC) M374 C2 H-P1183 NA+/H+ antiporter 42.24 (napA) M374 D2 H-P1184 conserved hypothetical50.6 integral membrane protein M374 E2 H-P1185 conserved hypothetical43.12 integral membrane protein M374 F2 H-P1186 carbonic anhydrase 22.33 M374 G2 H-P1187 hypothetical protein 42.46 M374 H2 H-P1188 hypothetical protein 29.7 M374 A3 H-P1189 aspartate-semialdehyde38.17 dehydrogenase (asd) M374 B3 H-PI 191 ADP-heptose-lps 38.5 heptosyltransferase II (rfaF) M374 C3 H-P1196 ribosomal protein 17.16 S7 (rps7) M374 D3 H-P1200 ribosomal protein 18.15 L10 (rp110) M374 E3 H-P 1201 ribosomal protein 25.85 L 1 (rpl l ) M374 F3 H-P1202 ribosomal protein 15.62 LI1 (rpll I) M374 G3 H-P1203 transcription termination19.47 factor NusG (nusG) M380 B4 H-P1205-2 translation elongation44 factor EF-Tu (tufB) M374 H3 H-P1206 multidrug resistance 63.69 protein (hetA) M374 A4 H-PI207 hypothetical protein 24.53 M374 B4 H-P1210 serine acetyltransferase18.92 (cysE) M380 F4 H-P1213-2 polynucieotide phosphorylase75.79 - (pnP) M380 G4 H-P1214-2 conserved hypothetical26.51 protein M380 C4 H-P1215-2 hypothetical protein 8.91 M380 D4 H-P1216-2 conserved hypothetical72.71 secreted protein M380 E4 H-P1217-2 hypothetical protein 17.6 M374 C4 H-P1220 ABC transporter, ATP-binding25.19 protein (yhcG) M374 D4 H-P1221 conserved hypothetical25.85 protein M374 E4 H-P1222 D-lactate dehydrogenase104.39 (dld) M374 F4 H-P1224 uroporphyrinogen III 24.97 cosynthase (hemp) M374 G4 H-P1225 conserved hypothetical14.41 integral membrane protein M374 H4 H-P1226 oxygen-independent 38.83 coproporphyrinogen III oxidase (hemN) M380 H4 H-P1227-2 cytochrome c553 10.67 M380 AS H-P1228-2 invasion protein (invA)17.16 M380 BS H-P1229-2 aspartokinase (lysC) 44.66 M374 AS H-P1230 hypo_thet_ical protein19.91 M374 BS H-P1231 DNA polymerise III 24.09 delta prime subunit (holB) M374 CS H-P1232 dihydropteroate synthase41.91 (folP) M380 DS H-P1233-2 hypothetical protein 16.94 M374 DS H-P1234 conserved hypothetical32.89 integral membrane protein M374 E5 H-P1235 conserved hypothetical45.76 integral membrane protein M374 FS H-P1236 hypothetical protein 20.24 M3?4 GS H-P1237 carbamoyl-phosphate 41.36 synthetase (pyrAa) M374 HS H-P1240 conserved hypothetical21.01 protein M380 CS H-P1241-2 alanyl-tltNA synthetase93.28 (alas) M374 A6 H-P1242 conserved hypothetical8.47 protein M380 HS H-P1243-2 outer membrane protein80.74 (omp28) M374 B6 H-P1244 ribosomal protein 9.46 S18 (rpsl8) M374 C6 H-P1245 single-strand DNA-binding19.8 protein (ssb) M374 D6 H-P1246 ribosomal protein 15.73 S6 (rps6) M380 A6 H-PI247-2 hypothetical protein 37.51 M374 E6 H-P1248 virulence associated 70.95 protein homolog (vacB) M380 B6 H-P1249-2 shikimate 5-dehydrogenase29.04 (aroE) M380 ES H-P1251-2 oligopeptide ABC transporter,38.39 permease protein (oppB) M380 FS H-P1252-2 oligopeptide ABC transporter,65.45 periplasmic oligopeptide-binding protein (oppA) M380 GS H-P1253-2 tryptophanyl-tltNA 37.4 synthetase (trpS) M374 F6 H-P1254 biotin synthesis protein26.51 (bioC) M374 G6 H-P1255 protein translocation2222 protein, low temperature (sect) M374 H6 H-P1256 ribosome releasing 20.46 factor (frr) M374 A7 H-P1257 orotate phosphoribosyltransferase22.22 (pyrE) M374 B7 H-P1258 conserved hypothetical17.05 mitochondria) protein M374 C7 H-P1260 NADH-ubiquinone 14.74 oxidoreductase, NQ07 subunit (NQO7) M374 D7 H-P1262 NADH-ubiquinone 29.37 oxidoreductase, NQOS
subunit (NQOS) M374 E7 H-P1263 NADH-ubiquinone 45.1 oxidoreductase, NQ04 subunit (NQ04) M380 C6 H-P1264-2 hypothetical protein 8.47 M374 F7 H-P1265 hypothetical protein 36.19 M375 A1 H-P1268 NADH-ubiquinone 24.31 oxidoreductase, NQ09 subunit (NQ09) M375 B1 H-P1275 phosphomannomutase 50.6 (algC) M375 C1 H-P1277 tryptophan synthase,28.93 alpha subunit (trpA) M375 D1 H-P1278 tryptophan synthase,43.34 beta subunit (trpB) M375 E1 H-P1279 anthranilate isomerase49.83 (trpC) M375 F1 H-P1282 anthranilate synthase55.11 component I
(trpE) M375 G1 H-P1285 conserved hypothetical25.41 secreted protein M375 H1 H-P1286 conserved hypothetical20.13 secreted protein M375 A2 H-P1287 transcriptional regulator23.98 (tenA) M375 B2 H-P1288 hypothetical protein14.63 M375 C2 H-P1289 hypothetical protein17.82 M375 D2 H-P1290 nicotinamide mononucleotide24.31 transporter {pnuC) M375 E2 H-P1291 conserved hypothetical22.55 protein M375 F2 H-P1292 ribosomal protein 12.87 L17 (rp117) M375 G2 H-P1293 DNA-directed RNA 37.95 polymerise, alpha subunit (rpoA) M375 H2 H-P1294 ribosomal protein 22.99 S4 (rps4) M375 A3 H-P1295 ribosomal protein 14.52 S11 (rpsl l) M375 B3 H-P1296 ribosomal protein 13.31 S13 (rpsl3) M380 D6 H-P1298-2 translation initiation8.03 factor EF-1 (infA) M375 C3 H-P1299 methionine amino 27.94 peptidase (map) M375 D3 H-P1302 ribosomal protein 16.94 SS {rps5) M375 E3 H-P1303 ribosomal protein 13.2 L18 (rp118) M375 F3 H-P1305 ribosomal protein 14.52 S8 (rps8) M375 G3 H-P1307 ribosomal protein 20.02 LS (rpl5) M375 H3 H-P1308 ribosomal protein 8.14 L24 (rp124) M375 A4 H-P1309 ribosomal protein 13.53 L14 (rp114) M375 B4 H-P1310 ribosomal protein 9.57 S17 (rpsl7) M375 C4 H-P1312 ribosomal protein 15.62 L16 (rp116) M375 D4 H-P1314 ribosomal protein 13.53 L22 (rp122) M375 E4 H-P1315 ribosomal protein 10.34 S19 (rpsl9) M375 F4 H-P1318 ribosomal protein 23.76 L4 (rpl4) M375 G4 H-P1319 ribosomal protein 21.12 L3 (rpl3) M375 H4 H-P1320 ribosomal protein 11.55 S10 (rpsl0) M375 AS H-P1321 conserved hypothetical41.58 ATP-binding protein M375 BS H-P1322 hypothetical protein22.22 M375 CS H-P1323 ribonuclease HII 23.1 (rnhB) M375 DS H-P1324 hypothetical protein9.24 M375 ES H-P1326 hypothetical protein13.86 M375 FS H-P1327 hypothetical protein45.43 M375 GS H-P1328 cation efflux system37.29 protein (czcA) M375 HS H-P1330 ~ conserved hypothetical12.76 ~ integral membrane protein M375 A6 H-P1331 conserved hypothetical25.19 integral membrane protein M375 B6 H-P1332 co-chaperone and heat40.7 shock protein (dnal7 M375 C6 H-P1333 hypothetical protein 42.13 M375 D6 H-PI335 conserved hypothetical39.71 protein M375 E6 H-P1336 hypothetical protein 27.94 M375 F6 H-P1337 conserved hypothetical19.25 protein M375 G6 H-P1338 conserved hypothetical16.39 protein M375 H6 H-P1340 biopolymer transport 14.3 protein (exbD) M375 A7 H-P1341 siderophore-mediated 31.46 iron transport protein (tong) M375 B7 H-P1342 outer membrane protein76.12 (omp29) M375 C7 H-P1343 conserved hypothetical26.73 integral membrane protein M375 D7 H-P1344 magnesium and cobalt 35.09 transport protein (corA) M375 E7 H-P1345 phosphoglycerate kinase44.33 M375 F7 H-P1346 glyceraldehyde-3-phosphate36.41 dehydrogenase(gap) M375 G7 H-P1347 uracil-DNA glycosylase25.74 (ung) M375 H7 H-P1349 hypothetical protein 42.68 M375 A8 H-P1350 protease 50.6 M375 B8 H-P1355 nicotinate-nucleotide30.14 pyrophosphorylase (nadC) M375 C8 H-P1356 quinolinate synthetase37.07 A (nadA) M375 D8 H-P1357 phosphatidylserine 29.48 decarboxylase proenzyme (psd) M375 E8 H-P1358 hypothetical protein 18.59 M375 F8 H-P1360 4-hydroxybenzoate 32.45 octaprenyltransferase (ubiA) M375 G8 H-P1361 competence locus E 45.98 (comE3) M375 H8 H-P1362 replicative DNA helicase53.79 (dnaB) M375 A9 H-P1363 conserved hypothetical51.37 integral membrane protein M376 A1 H-P1364 signal-transducing 43.78 protein, histidine kinase M376 B1 H-P1365 response regulator 23.54 M376 C1 H-P1371 type III restriction 106.59 enzyme R
protein M376 D1 H-P1372 rod shape-determining27.39 protein (mreC) M376 E1 H-P1373 rod shape-determining38.28 protein (mreB) M376 Fl H-P1374 ATP-dependent protease49.17 ATPase subunit (clpX) M376 G1 H-PI375 UDP-N-acetylglucosamine29.81 acyltransferase (IpxA) M376 H1 H-P1376 (3R)-hydroxymyristoyl-(acyl17.6 carrier protein) dehydratase (fabZ) ~ M376 A2 H-P1377 ~ hypothetical protein 16.17 ~

M376 B2 H-P1378 competence lipoprotein24.31 (comL) M376 C2 H-P1379 ATP-dependent protease91.96 (lon) M376 D2 H-PI380 prephenate dehydrogenase29.26 (tyrA) M381 C1 H-P1381 hypothetical protein g.5g M376 E2 H-P1382 hypothetical protein 14.41 M376 F2 H-P1383 restriction modification17.71 system S
subunit M376 G2 H-P1384 hypothetical protein 7.59 M376 H2 H-P1385 fructose-1,6-bisphosphatase32.01 M376 A3 H-P1386 D-ribulose-5-phosphate23.98 epimerase (rpe) M376 B3 H-P1388 hypothetical protein 16.5 M376 C3 H-P1389 hypothetical protein 6,71 M376 D3 H-P1390 hypothetical protein 18.37 M376 E3 H-P1391 hypothetical protein 10.89 M376 F3 H-PI392 fbronectin/fibrinogen-binding47.96 protein M376 G3 H-P1393 DNA repair protein 57.75 (recN) M376 H3 H-P1394 conserved hypothetical31.35 protein M376 A4 H-P1395 outer membrane protein26.73 (omp30) M376 B4 H-P1396 hypothetical protein 31.79 M376 C4 H-P1398 alanine dehydrogenase41.91 (ald) M376 D4 H-P1399 arginase (rocF) 35.53 M376 E4 H-P1400 iron(III) dicitrate 92.73 transport protein (fecA) M376 F4 H-P1401 conserved hypothetical25.96 protein M381 A2 H-P1402 type I restriction 109.34 enzyme R
protein (hsdR) M381 B2 H-P1403 type I restriction 89.98 enzyme M
protein (hsdM) M376 G4 H-P1405 hypothetical protein 3.85 M376 H4 H-P1406 biotin synthetase 31.13 (bioB) M376 AS H-P1407 conserved hypothetical32.23 integral membrane protein M381 C2 H-P1408 hypothetical protein 12.32 M381 D2 H-P1409 hypothetical protein 63.69 M376 BS H-P1410 hypothetical protein 43.45 M376 CS H-P1411 hypothetical protein 68.2 M376 DS H-P1412 hypothetical protein 33.99 M376 ES H-P1413 conserved hypothetical16.39 protein M376 FS H-P1414 conserved hypothetical12.54 protein M376 GS H-P1415 tRNA delta(2)- 29.37 isopentenylpyrophosphate transferase (miaA) M376 HS H-P1418 UDP-N- 28.6 acetylenolpyruvoylglucosamine reductase (murB) M376 A6 H-P1419 flagellar biosynthetic9.79 protein (fliQ) M376 86 H-P1420 flagellar export protein47.85 ATP
synthase (fliI) M376 C6 H-P1421 conjugative transfer 33.55 regulon protein (trbB) M376 D6 H-P1423 conserved hypothetical9.35 protein M376 E6 H-P1424 hypothetical protein 22.77 ~

M376 F6 H-P1425 hypothetical protein 8.36 M376 G6 H-P1427 histidine-rich, metal6.71 binding polypeptide (hpn) M376 H6 H-P1428 conserved hypothetical39.38 protein M376 A7 H-P1429 polysialic acid capsule36.3 expression protein (lcpsF) M376 B7 H-PI430 conserved hypothetical?5.9 ATP-binding protein M376 C7 H-P1431 16S rRNA (adenosine-N6,N6-)-29.92 dimethyltransferase (ksgA) M376 D7 H-P1432 histidine and glutamine-rich8.03 protein M376 E7 H-P1433 hypothetical protein 94.27 M376 F7 H-P1434 formyltetrahydrofolate32.34 hydrolase (purU) M376 G7 H-P1435 protease IV (PspA) 32.23 M376 H7 H-P1436 hypothetical protein 9.13 M376 A8 H-P1438 conserved hypothetical37.29 lipoprotein M376 B8 H-P1439 hypothetical protein 9.02 M376 C8 H-P1440 hypothetical protein 28.6 M376 D8 H-P1441 peptidyl-prolyl cis-trans18.04 isomerase B, cyclosporin-type rotamase (ppi) M376 E8 H-P1442 carbon storage regulator8.47 (csrA) M376 F8 H-P1443 conserved hypothetical29.59 protein M376 G8 H-P1444 small protein (smpB) 16.83 M376 H8 H-P1445 biopolymer transport 16.61 protein (exbB) M376 A9 H-P1446 biopolymer transport 14.74 protein (exbD) M376 B9 H-P1447 ribosomal protein 4.95 L34 (rp134) M376 C9 H-P1448 ribonuclease P, protein17.82 component (mpA) M376 D9 H-P1449 conserved hypothetical12.98 protein M376 E9 H-P1450 60 kDa inner-membrane60.28 protein M376 F9 H-P1451 hypothetical protein 29.15 M376 G9 H-P1452 thiophene and furan 50.82 oxidizer (tdhF) M376 H9 H-P1453 conserved hypothetical82.17 protein M376 A10 H-P1454 hypothetical protein 33.44 M376 BIO H-P1455 hypothetical protein 14.41 M376 C10 H-P1456 membrane-associated 19.36 lipoprotein (1pp20) M376 D10 H-P1457 hypothetical protein 23.21 M376 E10 H-P1458 thioredoxin 11.55 M376 F10 H-P1461 cytochrome c551 peroxidase38.61 M377 AI H-P1462 secreted protein involved19.03 in flagellar motility M377 B1 H-P1463 hypothetical protein 24.86 M377 CI H-P1464 conserved hypothetical29.92 secreted protein M377 D1 H-P1465 ABC transporter, ATP-binding28.82 protein (HI1087) M377 E1 H-P1466 conserved hypothetical41:58 integral membrane protein M377 F1 H-P1467 hypothetical protein 25.52 M377 G1 H-P1468 branched-chain-amino-acid37.51 aminotransferase (ilvE) M377 H1 H-P1469 outer membrane protein27.39 (omp31) M377 A2 H-P1473 hypothetical protein 21.12 M377 B2 H-P1474 thymidylate kinase 21.12 (tmk) M377 C2 H-P1475 lipopolysaccharide 17.38 core biosynthesis protein (kdtB) M377 D2 H-P1476 phenylacrylic acid 20.68 decarboxylase M377 E2 H-P1479 hypothetical protein 92.95 M377 F2 H-P1480 seryl-tRNA synthetase45.76 (serS) M377 G2 H-P1481 hypothetical protein 29.26 M377 H2 H-P 1482 hypothetical protein 9.57 M377 A3 H-P1483 gerC2 protein (gerC2)27.17 M377 83 H-P1484 conserved hypothetical16.39 integral membrane protein M377 C3 H-P1485 proline dipeptidase 21.01 (pepQ) M377 D3 H-P1486 conserved hypothetical41.47 integral membrane protein M377 E3 H-P1487 conserved hypothetical40.26 integral membrane protein M377 F3 H-P1488 conserved hypothetical36.3 secreted protein M377 G3 H-P1489 lipase-like protein 56.21 M381 G1 H-P1490 hemolysin 49.5 M377 H3 H-P1491 phosphate permease 58.74 M377 A4 H-P1492 conserved hypothetical9.9 nifU-like protein M377 B4 H-P1493 hypothetical protein 22.44 M377 C4 H-P1494 UDP-MurNac-tripeptide49.28 synthetase (murE) M377 D4 H-P1495 transaldolase (tal) 34.87 M377 E4 H-P1496 general stress protein19.69 (ctc) M377 F4 H-P1497 peptidyl-tRNA hydrolase20.57 (pth) M377 G4 H-P1499 hypothetical protein 30.03 M377 H4 H=P1501 outer membrane protein42.79 (omp32) M377 AS H-P1502 hypothetical protein 16.06 M377 BS H-P1503 cation-transporting 86.79 ATPase, P-type (copA) M377 CS H-P1504 conserved hypothetical26.29 protein M377 DS H-P1505 riboflavin biosynthesis37.95 protein (ribG) M377 ES H-P1506 glutamate pennease 44.99 (gltS) M377 FS H-P1507 conserved hypothetical42.46 ATP-binding protein M381 F2 H-P1508 ferrodoxin-like protein50.49 M377 G5 H-P1509 conserved hypothetical28.93 integral membrane protein M377 H5 H-P1510 conserved hypothetical12.98 protein M377 A6 H-P1511 hypothetical protein11.99 M377 B6 H-P1512 iron-regulated outer96.58 membrane protein (fipB) M377 C6 H-P1513 selenocystein synthase42.57 (selA) M377 D6 H-P1514 transcription termination43.56 factor NusA (nusA) M377 E6 H-P1518 hypothetical protein10.56 M381 B3 H-P1521 type III restriction106.48 enzyme R
protein {res) M381 C3 H-P1523 DNA recombinase (recta)68.64 M377 F6 H-P1524 hypothetical protein12.76 M377 G6 H-P1525 hypothetical protein23.32 M377 H6 H-P1526 exodeoxyribonuclease27.61 (IexA) M377 A7 H-P1527 hypothetical protein52.8 M377 B7 H-P1530 purine nucleoside 19.91 phosphorylase (Pub) M377 C7 H-P1531 hypothetical proteing,g M377 D7 H-P1532 glucosamine fructose-6-phosphate65.78 aminotransferase (isomerizing) (g~S) M377 E7 H-PI533 conserved hypothetical25.52 protein M377 F7 H-P1534 IS605 transposase 47.08 {tnpB) M377 G7 H-P1535 IS605 transposase 15.73 (tnpA) M377 H7 H-P1541 transcription-repair110 coupling factor (trcF) M377 A8 H-P1548 conserved hypothetical12.43 integral membrane protein M377 B8 H-P1551 conserved hypothetical14.08 secreted protein M377 C8 H-P 1552 Na+/H+ antiporter 48.29 (nhaA) M381 B4 H-P1554 ribosomal protein 29.15 S2 (rps2) M381 D4 H-P1555 translation elongation39.16 factor EF-Ts (tsf) M377 D8 H-P1556 cell division protein67.76 (ftsI) M381 E4 H-P1557 flagellar basal-body12.1 protein (fliE) M381 F4 H-P1558 flagellar basal-body17.82 rod protein (flgC) (proximal rod protein) M381 G4 H-P1559 flagellar basal-body15.51 rod protein (flgB) (proximal rod protein) M378 A1 H-P1560 cell division protein42.79 (fts~

M378 BI H-P1561 iron(III) ABC transporter,36.96 periplasmic iron-binding protein (ceuE) M378 C1 H-P1562 iron(III) ABC transporter,36.74 periplasmic iron-binding protein (ceuE) M378 D1 H-P1563 alkyl hydroperoxide 21.89 reductase (tsaA) ~ M378 H-P1564 ~ outer membrane protein29.92 El ~

M378 F1 H-P1565 penicillin-binding 64.79 protein 2 _" (pbp2) M378 G 1 H-P 1566 hypothetical protein 16.28 M378 H1 _ conserved hypothetical22.99 binding protein M378 A2 H-P1568 hypothetical protein 20.24 M378 B2 H-P1569 hypothetical protein 21.78 M378 C2 H-P1570 conserved hypothetical18.15 protein M378 D2 H-P1571 rare lipoprotein A 34.76 (rlpA) M378 E2 H-P1572 regulatory protein 41.03 DniR

M378 F2 H-P1573 conserved hypothetical28.05 protein M378 G2 H-P1576 ABC transporter, ATP-binding36.08 protein (abc) M378 H2 H-P1577 ABC transporter, permease23.76 protein (yaeE) M378 A3 H-P1580 hypothetical protein 24.31 M378 B3 H-P1581 methicillin resistance37.07 protein (llm) M378 C3 H-P1582 pyridoxal phosphate 28.93 biosynthetic protein J (pdxJ) M378 D3 H-P1583 pyridoxal phosphate 33.88 biosynthetic protein A (pdxA) M378 E3 H-P1584 sialoglycoprotease 37.51 (gcp) M378 F3 H-P1585 flagellar basal-body 28.93 rod protein (flgG) M378 G3 H-P1587 conserved hypothetical17.16 protein M378 H3 H-P1588 conserved hypothetical27.94 protein M3 81 H H-P 1590 hypothetical protein 4.4 M318 G2 H-538729 sutoimmune antigen 67.1 67 Ku; p70 subunit H 1 H-S39329 Kallikrein 1 24.64 30 (renal/pancreas/salivary) {alternative products}
-M270 G4 H-S43855 Recoverin, photoreceptor22.11 32.OkDa protein M300 C2 H-S56151 milk fat globule protein24.09 30 HMFG

M318 C1 H-S57153 retinoblastoma-binding101.31 101 protein 1, isofonm I [RBBP1]

M271 B2 H-S57162 retinoblastoma-binding93.72 110 protein 1, isoform III [RBBPI], INTERACTS WITH THE
VIRAL

PROTEIN-BINDING DOMAIN

OF THE RETINOBLASTOMA

PROTEIN.

M3I7 H3 H-S62027 transducin, gamma 8.25 11 subunit M270 G6 H-S66793 arrestin, X-arrestin=S-antigen42.79 SO.OkDa homolog (human, retina, mRNA, 1314 nt], MAY PLAY
A ROLE

IN AN AS YET UNDEFINED

RETINA-SPECIFIC SIGNAL

TRANSDUCTION.

M419 C2 H-567859 "transcription initiation48.360 64.OkDa factor IIe, alpha subunit"

M302 D7 H-S69022 myosin, light polypeptide18.26 31 2, ventricular H5 H-569272 cytoplasmic antiproteinase=3841.47 50 kda intracellular serine proteinase inhibitor [human, placenta, mRNA, 1465 nt]

D 1 H-S72043 GIF=growth inhibitory7.59 19 factor [human, brain, Genomic, 2015 nt]

M266 B3 H-S74221 cytokine IK factor 17.93 36.OkDa D 1 H-574445 cellular retinoic 15.18 23 acid-binding protein [human, skin, mRNA, 735 nt]

E3 H-S74728 antiquitin=26g turgor56.32 53 protein homolog [human, kidney, mltNA, 1809 nt]

D4 H-S75174 E2F transcription 45.87 58 factor 4, p I 07/p 130-binding 166-61 H-S76474 "trkB {alternately 55 52.54 spliced}

[human, brain, mRNA]"

169-40 H-S76617 "B lk=protein tyrosine60 55.62 kinase [human, B lymphocytes, mRNA, 2608 nt]"

M250 D3 H-S79522 ubiquitin carboxyl-terminal17.27 l7.OkDa extension protein, Ubiquitin A-52 residue ribosomal protein fusion product 1 M236 B4 H-S80562 calponin, acidic 36.3 49 G 1 H-S82470 BB 1=malignant cell 37.73 34 expression-enhanced gene/tumor progression-enhanced gene [human, UM-UC-9 bladder carcinoma cell line, mltNA, 1897 nt]

M313 E1 H-S85655 prohibitin [PHB] 30.03 40.OkDa M465 A6 H-S87759 protein phosphatase 42.13 52.OkDa 2C alpha [human, teratocarcinoma, mltNA, 2346 nt]

M472 B1 H-000803 tyrosine-protein kinase55.620 64.OkDa FItK

B2 H-002390 Human adenylyl cyclase-52.58 55 associated protein homolog CAP2 (CAP2) mltNA, complete cds 167-2 H-002680 human protein tyrosine36 38.57 kinase mltNA

G2 H-U0305b Human tumor suppressor47.96 47 (LUCA-I ) mIZIVA, complete cds M512 E3 H-003100 Human alpha2(E~catenin102.52 102.OkDa mltNA, complete cds M306 G3 H-003187 72.93 95.OkDa H3 H-003398 Human receptor 4-1BB 28.05 51 ligand mRNA, complete cds D3 H-003486 Human connexin40 gene,39.49 40 complete cds M300 C3 H-003643 leukophysin 25.96 34 FS H-003749 Human chromogranin 50.38 50 A (CHGA) gene, promoter and M314 C3 H-003886 GS2 (GB:U03886) 27.94 32.OkDa M306 E3 H-004343 CD86 antigen (CD28 35.64 47 antigen ligand 2, B7-2 antigen) [CD86]

167-61 H-005012 TrkC 92 90.82 M302 GS H-005340 cell division cycle 55 55 protein p55 A4 H-005659 Hydroxysteroid (17-beta)34.21 36 dehydrogenase 3 F1 H-005861 Human hepatic dihydrodiol35.64 40 dehydrogenase gene M302 B2 H-006452 antigen MART-I, melanoma13.09 20.OkDa 169-52 H-006454 human AMP-activated 70 60.79 protein kinase (hAMPK) mRNA

M315 A3 H-006643 lectin, epidermal 15.07 18 H1 H-006715 Cytochrome B561 27.06 25 M476 ES H-007132 Human steroid hormone50.82 SS.OkDa receptor Ner-I mRNA, complete cds M236 D3 H-007151 guanine nucleotide-binding20.13 34 protein ADP-ribosylation factor like gene 3 M317 G3 H-007559 homeotic protein 38.17 38 Islet-1 M266 H1 H-007681 Human NAD(H)-specific40.37 40 isocitrate dehydrogenase alpha subunit precursor mRNA, complete cds E3 H-007919 Aldehyde dehydrogenase56.43 53 M298 A3 H-008021 nicotinamide N-methyltransferase29.15 36.OkDa M297 B1 H-008024 alcohol/hydroxysteroid31.46 SO.OkDa sulfotransferase A2 H-008336 Human basic helix-loop-helix21.89 42 transcription factor mRNA, complete cds E2 H-009303 Human T cell leukemia38.17 40 (EPLG2) mRNA, complete cds M250 HS H-009559 RCHI, RAG (recombination58.3 58.OkDa activating gene) cohort 1 167-50 H-009564 human serine kinase 72 72.12 mRNA

166-74 H-009578 human MAPKAP kinase 50 42.09 (3pK) mRNA

M302 C4 H-009813 ATP synthase, subunit15.73 30 9, mitochondrial A1 H-009850 Zinc forger protein 68.97 68 143 (clone P~-I) M423 EI H-009937 Human urokinase-type36.96 49.OkDa plasminogen receptor M450 H4 H-010117 Human endothelial-monocyte34.43 38.OkDa activating polypeptide II mRNA, complete cds M314 G H-U 10248 ribosomal protein 17.6 27 M298 H H-U 10323 nuclear factor 45 44.77 45 I

E1 H-010492 Human Moxl protein 28.05 37 (MOX1) mRNA, complete cds F3 H-010686 Human MAGE-11 antigen35.2 35 (MAGEl l) gene, complete cds 167-38 H-011050 human NIMA-like protein55 49.02 kinase 1 (NLK1) mRNA

M266 B2 H-011292 Human Ki nuclear autoantigen29.48 32 mRNA, complete cds, may play a rol in cell adhesion 167-62 H-011791 human cyclin H m RNA 40 35.60 M423 DS H-U 12255 immunoglobulin gamma 40.26 48.OkDa heavy chain Fc receptor RI, high affinity M302 F7 H-U 12404 Csa-19 23.98 32 M236 A2 H-012465 ribosomal protein 13.64 24 169-4 H-012535 human epidermal growth100 90.49 factor receptor kinase substrate (Eps8) mRNA

F3 H-012597 Human tumor necrosis 55.22 64 factor type 2 receptor associated protein (TRAP3) mRNA, complete cds M314 D 1 H-012979 transcriptional coactivator14.08 23 M476 G4 H-013044 GA-binding protein 50.05 53.OkDa transcription factor, alpha subunit (60kD) M302 F3 H-013665 cathepsin O (GB:U13665)36.3 SO.OkDa M311 G4 H-U 13831 cellular retinol binding14.85 20.OkDa protein II

A2 H-013991 Human TATA-binding 24.09 34 protein associated factor 30 kDa subunit (tafII30) mRNA, complete cds M416 A4 H-U 14187 Human receptor tyrosine26.29 29.OkDa kinase ligand LERK-3 (EPLG3) mRNA, complete cds M250 A2 H-U 14188 eph-related receptor 22.22 27 tyrosine kinase ligand 4 [EPLG4]

M302 D2 H-014193 human TFIIA gamma 12.060 28.OkDa subunit mRNA

M416 G1 H-014603 Human protein-tyrosine18.48 30.OkDa phosphatase (HU-PP-1) mRNA, partial sequence E2 H-014747 Visinin-like 1 21.12 25 M266 D4 H-014966 ribosomal protein 32.78 38 LS

M314 E2 H-014967 ribosomal protein 17.71 29 M266 FS H-014968 ribosomal protein 16.39 l9.OkDa L27a M248 E3 H-014969 ribosomal protein 15.18 27 M266 El H-014971 ribosomal protein 21.45 30 M250 C2 H-015009 small nuclear ribonucleoprotein,13.97 l7.OkDa Sm D3 M311 D4 H-016660 enoyl-Coenzyme A hydratase-like36.19 38 protein, peroxisomal M302 H4 H-017074 cyclin-dependent kinase18.59 29 inhibitor p 18 M306 A2 H-017195 A-kinase anchor protein72.05 100 [AKAP I 00* ]

Dl H-017280 Steroidogenic acute 31.46 35 regulatory protein M316 F1 H-018291 cell division cycle 68.2 7l.OkDa protein 16 CS H-U18420 Human ras-related 23.87 33 small GTP

binding protein RabS
(rab5) mRNA, complete cds M311 A2 H-U 18423 spinal muscular atrophy32.45 41 gene M248 D4 H-U18914 hypothetical protein,20.35 32 (Human 19.8 kDa protein mRNA, complete cds) M302 BS H-U19718 microfibril-associated20.24 34.OkDa glycoprotein 2 M305 E3 H-U20240 CCAAT/enhancer-binding16.61 29 protein gamma M302 A8 H-U20352 malate dehydrogenase 36.85 40 M416 F4 H-U20391 Human folate receptor28.38 34.OkDa (FOLRI) gene, complete cds M311 D1 H-U20536 apoptotic cysteine 32.34 38.OkDa protease Mch2 M431 G2 H-U20659 RNA polymerise II, 19.03 3l.OkDa subunit B7 M499 C1 H-U20938 Human lymphocyte 112.86 100.0kDa dihydropyrimidine dehydrogenase mRNA, complete cds M305 F2 H-U20972 14-3-3 protein, epsilon28.16 36 M271 D3 H-U21049 _ 12.65 16 hypothetical protein (GB:U2I049), ESTs, Highly similar to DD96 [H.sapiens].

M421 GS H-U21858 Human transcriptional29.15 38.OkDa activation factor TAFII32 mRNA, complete cds M424 H3 H-U22662 Human nuclear orphan 49.28 49.OkDa receptor LXR-alpha mRNA, complete cds M271 D2 H-U24074 killer cell inhibitory37.62 43 receptor [KIR], Homo Sapiens natural killer-associated transcript 3 (NKAT3), complete cds.

RECEPTOR ON NATURAL

KILLER (NK) CELLS
FOR

HLA-C ALLELES.

169-29 H-U24I53 human p21-activated 60 57.82 protein kinase(Pak2) gene M385 H2 H-U24166 EB1 29.59 36.OkDa G1 H-U24169 Human 1TV-1 (JTV-1) 34.43 40 mRNA, complete cds E1 H-U24576 Human breast tumor 18.26 27 autoantigen mRNA, complete sequence G4 H-U24577 Human LDL-phospholipase48.62 52 mRNA, complete cds H1 H-U25789 Human ribosomal protein17.71 32 mRNA, complete cds M416 DI H-U25849 Human red cell-type 17.49 28.OkDa low molecular weight acid phosphatase (ACP 1 ) gene, 5' flanking region and M300 A3 H-U26312 heterochromatin protein19.14 30 H-PIHs-gamma M416 D3 H-026403 Human receptor tyrosine25.19 30.OkDa kinase ligand LERK-7 precursor (EPLG7) mltNA, complete cds M317 E2 H-027143 human protein kinase 13.900 l7.OkDa C inhibitor-I cDNA

ES H-028249 Human l lkd protein 12.32 12 mltNA, complete cds F4 H-028386 Human nuclear localization58.3 54 sequence receptor hSRPlalpha mItNA, complete cds M423 E3 H-028694 Chemokine (C-C) receptor39.16 39.OkDa M266 G6 H-028963 Gps2 36.08 36 M306 D3 H-030610 CD94 antigen (NK/T-cell19.8 27 C-type lectin receptor) [CD94]

B1 H-031116 Human beta-sarcogiycan35.09 33 A3b mltNA, complete cds M297 C2 H-031278 mitotic feedback control22.66 3l.OkDa protein Madp2 homolog M302 G2 H-031384 guanine nucleotide-binding8.14 10 protein, gamma 11 subunit F4 H-031986 Human cartilage-specific35.97 47 homeodomain protein Cart-1 mIZNA, complete cds M390 F3 H-032114 caveoiin 2 17.93 lB.OkDa E4 H-032324 Human interleukin-11 46.53 54 receptor alpha chain mItNA, complete cds F1 H-032576 Apolipoprotein C-IV 14.08 16 M298 C4 H-032907 p37NB protein 34.54 39 M300 D3 H-032944 dynein, light chain 9.9 15 1, cytoplasmic M297 D1 H-032989 tryptophan 2,3-dioxygenase44.77 SO.OkDa 166-51 H-033052 "protein kinase PltK2110 108.3 [human, DX3 B-cell myeloma cell line, mRNA]"

166-64 H-033054 "human G protein-coupled52 63.65 receptor kinase GRK4 mRNA, alpha splice variant"

166-88 H-033055 "human G protein-coupled60 60.1 receptor kinase GltK4 mltNA, beta splice variant"

166-76 H-033056 "human G protein-coupled58 58.59 receptor kinase GltK4 mIZNA, gamma splice variant"

A2 H-034584 17.71 31 169-87 H-034820 human MAP kinase mRNA55 46.49 215-2 H-034822 human JNICI alpha2 55 47.04 protein kinase (JNK1A2) mIZNA

169-37 H-035002 human JNK2 betal protein50 42.09 kinase (JNK2B 1 ) mltNA

169-25 H-035003 human JNK2 beta2 protein55 46.71 kinase (JNK2B2) mltNA

167-16 H-035004 human JNKl betal protein52 42.31 kinase (JNK 1 B 1 ) mRNA

M300 B2 H-035048 TSC-22 protein 15.95 27 M423 ES H-U35398 Human G protein-coupled40.26 48.OkDa _ receptor mRNA, complete cds A3 H-U35735 Human RACH1 (RACH1) 42.9 78 mRNA, complete cds M250 ES H-U36764 Eukaryotic translation35.86 36.OkDa initiation factor 3 (eIF-3) p36 subunit, transforming gowth factor-beta receptor II interacting protein 1 M270 E4 H-U37283 microfibril-associated19.14 32 glycoprotein-2 (GB:U37283) M426 F3 H-U37352 Protein phosphatase 56.65 SS.OkDa 2A, regulatory subunit B' alpha-1 EI H-U37529 Human substance P 14.3 22 beta-PPT-A

mRNA, complete cds M305 HS H-U37547 apoptosis inhibitor 68.09 64 M424 DS H-U38480 Human retinoid X receptor-51.04 61.OkDa gamma mRNA, complete cds M270 F4 H-U38810 Human mab-21 cell fate-determining protein homolog (CAGRI) mRNA, M467 F6 H-U38904 Human zinc finger 40.48 47.OkDa protein C2H2-25 mRNA, complete cds E2 H-U39318 Human E2 ubiquitin 16.28 22 conjugating enzyme UbcHSC (UBCHSC) mRNA, complete cds 166-75 H-U39657 human MAP kinase kinase40 36.81 (MKK6) mRNA

M298 E4 H-U39945 human adenylate kinase26.3633 38.OkDa 2 (adk2) mRNA

166-38 H-U40282 human integrin-linked55 49.68 kinase (ILK) mRNA

169-65 H-U40343 human CDK inhibitor 18 18. 33 pl9INK4d mRNA

E2 H-U40705 Homo sapiens telomeric48.4 52 repeat binding factor (TRF1) mRNA, complete cds 166-50 H-U40989 human tat interactive60 53.09 protein mRNA

M266 H6 H-U41767 metargidin precursor 89.65 90 M270 F3 H-U41804 Human putative Tl/ST225.08 35.OkDa receptor binding protein precursor mRNA, complete cds DS H-U42360 Human N33 gene 38.28 38 A1 H-U43368 Vascular endothelial 22.88 33 gowth factor B

M421 G7 H-U43901 Human 37 kD laminin 32.56 58.OkDa receptor precursor/p40 ribosome associated protein gene, complete cds M392 C2 H-U43923 transcription factor 12.98 l6.OkDa E2 H-U46024 Myotubular myopathy 66.44 58 M330 A1 H-U46838 pI05MCM 90.42 97 M476 E2 H-U47677 Human transcription 48.18 53.OkDa factor E2F1 (E2F 1 ) gene, promoter and M421 H1 H-U48707 Human protein phosphatase-118.92 36.OkDa inhibitor mltNA, complete cds _ M302 B7 H-U49070 peptidyl-prolyl isomerase18.04 28.OkDa PINI

C1 H-U49188 Human placenta (Diff33)54.45 70 mltNA, complete cds M485 H2 H-U49837 Human LIM protein 21.45 34.OkDa MLP mIZNA, complete cds D2 H-U49897 Homo sapiens phenylalanine49.83 64 hydroxylase (PAH) mltNA, complete cds B2 H-U49957 Human LIM protein 67.43 67 (LPP) mltNA, partial cds 166-16 H-U50196 human adenosine kinase50 38.02 mltNA

A4 H-U50939 Human amyloid precursor58.85 60 protein-binding protein 1 mltNA, complete cds G3 H-U51224 Human U2AFBPL gene, 52.8 55 complete cds M486 E3 H-U51333 Hexokinase 3 (white 101.64 100.OkDa cell) M305 D1 H-U51478 AT'Pase, Na+/K+transporting,30.8 36 beta 3 subunit M416 H3 H-U52112 Homo Sapiens Xq28 25.96 36.OkDa genomic DNA in the region of the L 1 CAM

locus containing the genes for neural cell adhesion molecule LI

(L1CAM), arginine-vasopressin receptor (A VPlt2), C 1 p 115 (C 1 ), ARDI N-acetyltransferase related protein (TE2), renin-binding protein (RbP), host cell factor 1 (HCF1}, and interleukin-1 receptor-associated kinase (IRAK) genes, complete cds, and Xq281u2 gene M463 E1 H-U53442 human p38Beta MAP 40.99 49.OkDa kinase mltNA

G3 H-U53446 Human mitogen-responsive84.81 98 phosphoprotein DOC-2 mRNA, complete cds M463 C1 H-U54617 human pyruvate dehydrogenase45.28 52.OkDa kinase isofonn 4 mltNA

169-38 H-U54645 methylmalonyl-coA 38 25.59 mutase precursor M300 H3 H-U56255 t-complex sterility 12.54 16 protein homolog CW-1 C4 H-U56417 Human lysophosphatidic31.24 46 acid acyltransferase-alpha mltNA, complete cds M305 A2 H-U56637 actin-capping protein31.5? 31 alpha subunit isoform 1 M235 E6 H-056814 Human DNasel-Like 33.66 40.OkDa III protein (DNAS1L3) mRNA, complete eds, involved in apoptosis Binds specifically to G-ACTIN
AND

BLOCKS ACTIN

POLYMERIZATION.

DS H-057059 31.02 36 -B3 H-057093 Human small GTP-binding24.09 34 protein rab27b mRNA, complete cds D3 H-057099 Human APEG-1 mRNA, 12.54 20 complete cds F1 H-058331 Sarcoglycan, delta 28.27 24 (35kD

dystrophin-associated glycoprotein) M512 F4 H-058334 Human Bcl2, p53 binding110.66 108.OkDa protein Bbp/53BP2 (BBP/53BP2) mRNA, complete cds B3 H-058516 Human breast epithelial42.68 50 antigen BA46 mRNA, complete cds M250 E4 H-058522 Human huntingtin interacting22.11 30 protein (HIP2) mRNA, complete cds M419 G2 H-060207 human stress responsive53.640 63.OkDa serine/threonine protein kinase Krs-2 mRNA

M298 B2 H-060276 arsA homolog (hASNA-I)36.63 47.OkDa B2 H-060521 Human protease proMch645.87 52 (Mch6) mRNA, complete cds F3 H-061166 Human SH3 domain-containing57.31 57 protein SH3P17 mRNA, complete cds M250 BS H-061232 cofactor E (tubulin-folding protein), REQUIRED
FOR

VIABILITY IN THE ABSENCE

OF THE KINESIN-RELATED

CINB

AS H-062392 Homo Sapiens zinc 43.45 52 finger protein mRNA, complete cds G1 H-062801 Human protease M mRNA,26.95 33 complete cds M266 B 1 H-062962 Int-6 , Human Int-6 49.06 52.OkDa mRNA, complete cds M300 G1 H-063295 seven in absentia 31.13 36 homolog M306 H3 H-064198 94.93 98 H3 H-064863 Human hl'D-1 (hPD-1) 31.79 37 mRNA, complete cds B3 H-065581 Human ribosomal protein44.88 52 L3-like mRNA, complete cds M341 D1 H-065918 DAZ homologue [DAZLAJ32.56 36.OkDa M302 E1 H-065928 Jun activation domain36.85 48.OkDa binding protein M512 D3 H-066347 Homo sapiens cAMP 46.97 60.OkDa phosphodiesterase (PDE4C) mRNA, 4C-426 isoform, complete cds M306 F3 H-066867 ubiquitin-conjugating17.49 28 enzyme E2I

[UBE2I]

M416 E2 H-068111 Human protein phosphatase22.66 37.OkDa inhibitor 2 (PPPllt2) gene F2 H-068382 Mannosidase, alpha 35.64 36 B, lysosomal G2 H-069141 Glutaryl-Coenzyme 48.29 56 A

dehydrogenase B2 H-070660 Human copper transport7.59 16 protein HAH1 (HAH1) mRNA, complete cds M297 B2 H-071374 peroxisomal membrane 40.15 40.OkDa protein (Pexl3p) M306 A3 H-075272 progastricsin [PGC] 42.79 49.OkDa A2 H-075285 Homo sapiens apoptosis15.73 25 inhibitor survivin gene, complete cds B2 H-077456 Human nucleosome assembly41.36 50 protein 2 mltNA, complete cds C2 H-078294 Homo Sapiens 15S-lipoxygenase74.47 74 mRNA, complete cds F6 H-078302 Human 2,4-dienoyl-CoA36.96 40 reductase gene M478 G3 H-078798 Human TNF receptor 57.53 65.OkDa associated factor 6 (TRAF6) mltNA, complete cds G3 H-080982 Human myeloid-specific27.5 51 C/EBP-epsilon transcription factor (CEBPE) gene, complete cds M468 B7 H-082256 Homo Sapiens arginase39.05 45.OkDa type II

mItNA, complete cds M465 B2 H-082812 Human scavenger receptor38.28 48.OkDa cysteine rich Sp alpha mIZNA, complete cds M484 D7 H-083410 Human CUL-2 (cul-2) 82.06 85.OkDa mIZNA, complete cds M467 E6 H-083460 Human high-affinity 21.01 32.OkDa copper uptake protein (hCTRl) mltNA, complete cds D2 H-084763 Homo Sapiens UCP3 34.43 42 mRNA, complete cds B2 H-086070 Homo sapiens 28.93 36 phosphomannomutase mIZNA, complete cds C2 H-090441 Human prolyl 4-hydroxylase58.96 64 alpha (II) subunit mRNA, complete cds B2 H-090543 Human butyrophilin 58.08 54 (BTF1) mRNA, complete cds H2 H-090545 Human sodium phosphate44.22 36 transporter (NPT4) mRNA, complete cds G2 H-090552 Human butyrophilin 56.54 48 (BTFS) mRNA, complete cds C3 H-091521 Peroxisomal biogenesis39.6 48 factor 12 H1 H-091641 Numan alpha2,8-sialyltransferase41.47 45 mRNA, complete cds CI H-093869 Human RNA polymerase 34.98 36 III

subunit (RPC39) mRNA, complete cds F2 H-094346 Human calpain-like 70.4 65 protease (tetra-3) mRNA, complete cds C2 H-094855 Human translation 39.38 36 initiation factor 3 47 kDa subunit mRNA, complete cds M271 F7 H-095089 Epidermal growth factor44.66 47 receptor.

M424 AS H-095847 Human GDNF receptor 50.71 52.OkDa alpha mRNA, complete cds D2 H-096094 Human sarcolipin (SLN)3.52 10 mRNA, complete cds B3 H-096769 Homo Sapiens chondroadherin39.6 43 gene, S'flanking region and M298 G2 H-V00566 prolactin 25.08 35 M298 H2 H-V00571 corticotropin-releasing21.67 49 factor 217-61 H-V00572 phosphoglycerate kinase50 45.94 M314 B3 H-V00597 parathyroid hormone 12.76 14 M305 B8 H-X00129 retinol-binding protein22 51 4, interstitial [RBP4]

F2 H-X00351 Human mRNA for beta-actin41.36 41 A4 H-X00570 apolipoprotein C-I 9.24 35 M362 E1 H-X01057 interleukin 2 receptor,30.03 40.OkDa alpha [IL2RA]

A4 H-X01677P Human liver mRNA for 10.45 10 glyceraldehyde-3-phosphate dehydrogenase (G3PD, EC

1.2.1.12) M271 D6 H-X02152 lactate dehydrogenase36.63 45.0kDa A [LDHA], L-LACTATE

DEHYDROGENASE M CHAIN

A 1 H-X02158 Human gene for erythropoietin21.34 32 H4 H-X02415 Human gene for fibrinogen48.18 50 gamma chain AS H-X02750 Protein C (inactivator50.82 53 of coagulation factors Va and VIIIa) M302 B3 H-X02751 proto-oncogene N-ras 20.9 25.OkDa D3 H-X02812 Human mRNA for transforming43.12 50 growth factor-beta (TGF-beta) M302 C H-X03124 tissue inhibitor of 22.88 36.OkDa metalloproteinase M362 B1 H-X03342 ribosomal protein 14.96 24.OkDa M235 A2 H-X03484 human mRNA for raf 71.350 73.OkDa oncogene M318 A3 H-X03557 interferon-induced 52.69 SO.OkDa protein 56 A3 H-X03747 ATPase, Na+/K+ transporting,33.44 45 beta 1 polypeptide M30S D2 H-X04297 ATPase, Na+/K+ transporting,112.64 99 alpha subunit M30S AS H-X04327 2,3-bisphosphoglycerate28.6 36 mutase M271 GS H-X04S88 tropomyosin TM30nm, 26.29 40.OkDa cytoskeletal M30S C8 H-X04741 ubiquitin related 23.43 28.OkDa protein M236 AS H-XOS231 matrix metalloproteinaseS 1.7 S3.OkDa (interstitial collagenase) (MMPI), CLEAVES COLLAGENS

166-S3 H-XOS246 "phosphoglycerate SO 45.94 kinase, testis specific"

M236 AI H-XOS908 annexin I, REGULATES 38.17 40 ACTIVITY, Binds CALCIUM

IONS

M2S0 A4 H-X06234 SI00 calcium-binding 10.34 lO.OkDa protein A8 (calgranulin A) M266 B6 H-X06323 ribosomal protein 38.39 39 L3, isoform 1 M313 A7 H-X06617 ribosomal protein 17.49 27 M416 E4 H-X06948 High affinity IgE 28.38 36.OkDa receptor alpha-subunit (FcERI) M421 H7 H-X07203 Human mRNA for CD20 32.78 40.OkDa receptor (S7) 217-2 H-X07743 pleckstrin 38 38.57 217-73 H-X07767 "CAMP-dependent protein4S 38.68 kinase, alpha-catalytic subunit"

M30S B3 H-X07898 troponin C, skeletal,17.71 2S
fast M306 E 1 H-X07979 integrin, beta 1 87.89 110 A11 H-X08004 ras-related protein 20.24 38 raplB

M23S A7 H-X12387 Cytochrome P4S0IIIA3 SS.44 60.OkDa (nifedipine oxidase chain 3) M31 S F H-X 12496 glycophorin C 14. I 24 M316 D3 H-X 12S 17 small nuclear ribonucleoprotein17.6 30.OkDa U1, C

M236 ES H-X12S34 guanine nucleotide-binding20.24 34.OkDa protein rapt, ras-oncogene related M266 E3 H-X12S97 High-mobility group 23.76 37 (nonhistone chromosomal) protein 1, placenta 217-14 H-X126S6 human mRNA for protein40 34.06 phosphatase 2A (beta type) H4 H-X12662 H.sapiens arginase 3S.S3 SO
gene exon 1 and flanking regions (EC 3.5.3.1) (and joined CDS) C1 H-X129S3 RAB2, member RAS oncogene23.43 29 family FS H-X139S6 Human 12S RNA induced9.13 19 by poly(rI), poly(rC) and Newcastle disease virus M297 A1 H-X1S005 laminin receptor 1 33.11 48.OkDa M31S E3 H-X1S088 guanine nucleotide 38.61 4S
binding protein (G protein), alpha transducing (transducin) activity polypeptide 1 [GNATIj G2 H-X 15183 Human mRNA for 90-kDa80.63 80 heat-shock protein M385 CI H-X15422 mannose-binding lectin,27.39 27.OkDa soluble (opsonic defect) [MBL]

M271 D7 H-X15606 INTERCELLULAR ADHESION30.36 37.OkDa [Homo sapiens].

M298 CS H-X15653 uracil-DNA glycosylase33.55 37 M302 B4 H-X15822 cytochrome-c oxidase,9.24 20 VIIa subunit, liver M305 A6 H-X15940 ribosomal protein 13.86 18 M236 GS H-X 15949 interferon regulatory38.5 54.OkDa factor 2 , BINDS AND REPRESSES

REGULATORY REGION
OF

INDUCIBLE MHC CLASS
I

GENES.

M236 C2 H-X16064 translationally-controlled19.03 35 tumor protein M512 BS H-X 16323 Hepatocyte growth 80.19 100.OkDa factor (hepapoietin A) M3 I 5 H-X 16461 cell division cycle 32.78 40 C3 2, G 1 to S and G2 to M [CDC2]

M297 G2 H-X 16832 cathepsin H 36.96 45.OkDa M271 B H-X I 6983 integrin, alpha 4 114.29 114 1 (CD49D, alpha 4 subunit of VLA-4 receptor) [ITGA4], IMPORTANT
FOR

CELL-CELL ADHESION

FUNCTION.

M270 A7 H-X17025 plasminogen activator-inducible25.19 34 c54, Human homolog of yeast IPP

isomerase M302 C3 H-X17042 proteoglycan 1, secretory17.49 26 granule B 1 H-X 17206 ribosomal protein 24.42 45 B4 H-X17254 Transcription factor 45.54 53 Eryfl M311 H2 H-X17610 beta-1-glycoprotein, 46.97 48.OkDa pregnancy-specific (GB:X 17610) M315 D1 H-X17644 G1 to S phase transition55 55 protein (GSTI) M340 G1 H-X51415 lipase, hormone-sensitive84.59 98.OkDa [LIPE]

M464 A7 H-X51688 Cyclin A 47.63 47.OkDa M313 G H-X51745 major histocompatibility40.26 50 1 complex, class I, A

M297 A2 H-X51804 putative receptor 21.23 30 protein PMI

D4 H-X51952 Human UCP gene for 33.88 37 uncoupling protein exons 1 and M300 B1 H-X52011 muscle determining 26.73 39 factor M419 G1 H-X52479 "protein kinase c, 82.28 85.OkDa alpha type"

A2 H-X52486 Uracil-DNA giycosylase35.97 36 E3 H-X52520 Tyrosine aminotransferase50.05 58 B1 H-X52638 6-phosphofructo-2- 51.92 47 kinase/fructose-2,6-bisphosphatase M509 C4 H-X52730 Human gene for 31.13 35.OkDa phenylethanolamine N-methylase (PNMT) (EC 2.1.1.28) M235 CS H-X52839 ribosomal protein 15.51 18 M426 C2 H-X52943 Human mRNA for ATF-a53.24 64.OkDa transcription factor M266 GS H-X53777 ribosomal protein 20.35 31 B4 H-X53961 Lactotransferrin 78.32 78 M462 C6 H-X54150 Fc fragment of IgA, 31.68 37.OkDa receptor for M302 A6 H-X54304 myosin, light polypeptide18.92 32.OkDa 2, regulatory M311 G2 H-X54802 cytochrome-c oxidase,18.7 23.OkDa IV subunit M270 H3 H-X54871 guanine nucleotide-binding23.76 33.OkDa , protein RabSB,ras-oncogene related [RABSB], PROTEIN

TRANSPORT. PROBABLY

INVOLVED IN VESICULAR

TRAFFIC (BYSIMILARITY).

M313 B6 H-X54936 placenta growth factor16.5 22.OkDa [PLGF*]

M496 B2 H-X55079 Human lysosomal alpha-104.83 98.OkDa glucosidase gene exon 1 Dl H-X55330 Aspartylglucosaminidase38.17 36 EI H-X55448 H.sapiens G6PD gene 25.41 30 for glucose-6-phosphate dehydrogenase M421 G6 H-X56253 Human MPR46 gene 30.58 52.OkDa for 46kd mannose 6-phosphate receptor 169-89 H-X56468 14-3-3 protein tau 34 27.02 M300 B4 H-X56549 fatty-acid-binding 14.74 17 protein, muscle M298 D2 H-X56740 guanine nucleotide-binding23.87 31.OkDa protein rab 11 [RAB
11 *]

M266 ES H-X56932 highly basic protein,22.44 30.OkDa 23 kDa M318 G1 H-X57025 insulin-like growth 16.94 18 factor I

M305 FS H-X57348 protein kinase C 27.39 35.OkDa inhibitor M236 D6 H-X57351 interferon-induced 14.63 24 protein 1-8D

H3 H-X57352 interferon-induced 14.74 38 protein I-8U

M305 B6 H-X58079 S-100 protein, alpha10.45 11 chain E6 H-X59131 H.sapiens D13S106 34.76 50 mRNA for a highly charged amino acid sequene M248 HS H-X59268 transcription factor34.87 49 IIB [TCF2B*]

E2 H-X59357 Epstein-Barr virus 14.19 36 small RNA-associated protein M236 D4 H-X59417 macropain, iota subunit27.17 36 , THE

INTERACTION OF CALPONIN

WITH ACTIN INHIBITS

ACTOMYOSIN MG-ATPASE

ACTIVITY

M271 H4 H-X59618 ribonucleotide redactase,42.9 46 small subunit WO 99/51766 PC'T/US99/07270 M250 G3 H-X59710 CART-box DNA-binding 22.66 34 protein, subunit B, CCAAT-BINDING

TRANSCRIPTION FACTOR

SUBUNIT A [Homo Sapiens]

M423 E2 H-X59711 Nuclear transcription38.28 48.OkDa factor Y, alpha M271 C7 H-X59798 Cyclin D1 (PRADI; 32.56 40.OkDa parathyroid adenomatosis I). ESSENTIAL

FOR THE CONTROL OF
THE

CELL CYCLE AT THE

(START) TRANSITION.

M270 HS H-X59834 calmodulin 41.14 53.OkDa M416 DS H-X59871 Transcription factor 29.59 36.OkDa 7 (T-cell specific) M485 D6 H-X60036 Phosphate carrier, 39.82 37.OkDa mitochondria) M250 D4 H-X60489 translation elongation24.86 33.OkDa factor 1, beta FS H-X60592 Human CDw40 mRNA for 30.58 46 nerve growth factor receptor-related B-iymphocyte activation molecule M312 F3 H-X61587 ras-related rhoG 21.12 2l.OkDa F9 H-X61622 cyclin-dependent kinase32.89 56 [CDK2]

M313 E3 H-X61970 macropain, zeta subunit26.62 35.OkDa M428 D1 H-X62055 tyrosine phosphatase,65.?8 66.OkDa non-receptor type 6 M248 C4 H-X62534 high mobility group 23. I 37 protein 2, BINDS PREFERENTIALLY

SINGLE-STRANDED DNA

AND UNWINDS DOUBLE

STRANDED DNA.

M305 F3 H-X62753 folate-binding protein28.38 36 M476 G2 H-X63468 H.sapiens mRNA for 48.4 53.OkDa transcription factor TFIIE alpha G6 H-Xb3469 General transcription32.12 56 factor TFIIE

beta subunit, 34 kD

G4 H-X63522 Haapiens mRNA DAUDI6 58.74 54 for retinoic acid X receptor b M316 G2 H-X63526 translation elongation48.18 52.OkDa factor I, gamma M305 CS H-X63527 ribosomal protein 21.67 33 E2 H-X63629 Cadherin 3 (P-cadherin)91.3 110 D4 H-X64037-2 General transcription56.98 64 factor IIF, polypeptide I (74kD
subunit) M302 C6 H-X64559 tetranectin 22.33 32.OkDa M271 H 1 H-X64728 choroideremia-like 72.27 98 [CHML], H.sapiens CHML mRNA

M270 E1 H-X64810 proprotein convertase82.94 90 subtilisin/kexin type 1 [PCSK 1 J, INVOLVED IN PROCESSING

OF HORMONE AND OTHER

PROTEIN PRECURSORS

M31 I F4 H-X64877 complement factor 29.81 36.OkDa H-related protein M388 Dl H-X65293 protein kinase C, 81.18 96.OkDa epsilon [PRKCE]

BS H-X65873 kinesin, heavy polypeptide106.04 34 F4 H-X66079 Spi-B transcription 28.93 54 factor (Spi-I/PU.I related) F3 H-X66114 2-oxoglutarate carrier0 37 protein [OGMT*]

M305 C6 H-X66141 myosin, light polypeptide18.37 31 2, regulatory, ventricular M419 H1 H-X66357 cell division protein33.620 44.OkDa kinase 3 166-13 H-X66358 serine/threonine-protein45 39.45 kinase KKIALRE

166-25 H-X66360 serine/threonine-protein60 57.60 kinase M419 A2 H-X66363 serine/threonine-protein54.600 64.OkDa kinase 166-37 H-X66364 H.sapiens mRNA PSSALRE38 32.19 for serine/threonine protein kinase M419 B2 H-X66365 cell division protein35.900 46.OkDa kinase 6 H3 H-X66839 H.sapiens MaTu MN 50.6 54 mRNA for p54/58N protein M266 G3 H-X67325 interferon, alpha-inducible13.53 13 gene p27 M462 H7 H-X67594 Melanocortin I receptor34.98 44.OkDa (alpha melanocyte stimulating hormone receptor) M236 CS H-X67951 Proliferation-associated22 34 gene A

(natural killer-enhancing factor A), PAGA

H3 H-X68486 Adenosine receptor 45.43 45 M429 E3 H-X68561 Sp4 transcription 86.35 86.OkDa factor M430 F2 H-X69151 ATP synthase, H+ transporting,42.13 58.OkDa subunit C, vacuolar M236 C3 H-X69392 ribosomal protein 16.06 29 B3 H-X69532 H.sapiens gene for 100.32 98 inter-alpha-trypsin inhibitor heavy chain Hl, exons I-3 M236 FS H-X69654 ribosomal protein 12.76 18 M421 C8 H-X70218 Protein phosphatase 33.88 4 (formerly X), catalytic subunit M266 HS H-X70848 protein phosphatase 36.41 37 1, alpha catalytic subunit E1 H-X70940 Eukaryotic translation51.04 60 elongation factor 1 alpha 2 M270 F1 H-X72215 [PITT], POU domain, 32.12 40.OkDa class 1, transcription factor 1 (Pit 1, growth hormone factor 1 ) M271 A7 H-X72760 Laminin, beta 2 (laminin67.87 75.OkDa S), S-ADHESIVE PROTEIN

CONCENTRATED IN THE

SYNAPTIC CLEFT OF
THE

NEUROMUSCULAR

JUNCTION.

$1 M235 B H-X72841 Human retinoblastoma-binding46.86 52.OkDa protein (RbAp46) mRNA, complete cds, IEF

(GB:X72841) 217-25 H-X73428 DNA-binding protein 20 17.08 inhibitor -M305 BS H-X73459 signal recognition 15.07 20 particle, subunit 14 M250 D6 H-X73460 ribosomal protein 44.44 SO.OkDa L3, isoform 2, COMPONENT OF THE LARGE

SUBUNIT OF CYTOPLASMIC

RIBOSOMES

M462 D8 H-X74008 Protein phosphatase 35.64 46.OkDa 1, catalytic subunit, gamma isofonm M266 G2 H-X74104 Signal sequence receptor,20.24 27 beta;

translocon-associated protein, beta subunit M266 E7 H-X74262 retinoblastoma binding46.86 SO.OkDa protein RbAp48 H1 H-X74330 DNA primase polypeptide46.31 51 I

(49kD) M313 F3 H-X74570 gal beta (1-3/1-4) 36.3 46.OkDa GIcNAc alpha-2,3 sialyltransferase (GB:X74570) M429 H3 H-X74764 Iiaapiens mRNA for 94.120 98.OkDa receptor protein tyrosine kinase M271 E6 H-X75042 V-rel avian reticuloendotheliosis68.2 88 viral oncogene homolog M305 G2 H-X75252 phosphatidylethanolamine-20.68 30 binding protein M302 Gi H-X75593 guanine nucleotide-binding22.44 32.OkDa protein rabl3 166-49 H-X75958 H.sapiens trkB mRNA 55 52.54 for protein-tyrosine kinase C4 H-X76013 Haapiens QRSHs mRNA 85.36 85 for glutaminyl-tRNA synthetase A2 H-X76029 H.sapiens mRNA for 19.25 20 neuromedin U

M305 DS H-X76228 ATP synthase, H+ transporting,24.97 36 subunit E, vacuolar M298 F6 H-X76648 glutaredoxin 11.77 ll.OkDa M311 A4 H-X76717 metallothionein 11 6.82 14 C4 H-X77533 H.sapiens mRNA for 56.43 61 activin type IIreceptor H2 H-X77548 H. sapiens cDNA for 67.65 67 RFG

169-41 H-X77743 Haapiens CDK activating45 38.1 kinase 3 mRNA

A4 H-X77909 H.sapiens IKBL mRNA 42.02 52 M305 C1 H-X78136 heterogeneous nuclear40.26 40.OkDa ribonucleoprotein M306 G2 H-X78416 casein, alpha [CSN 20.46 33 1 ]

M271 C2 H-X78678 ketohexokinase (fructokinase)32.89 39 [KHK], H.sapiens KHK
mRNA

for ketohexokinase, clone pHKHK3a M305 D4 H-X79193 cyclin-dependent kinase38.17 35 (homolog of Xenopus MO15 cdk-activating kinase) [CDK7]

M431 F2 H-X79389 glutathione S-transferase26.51 34.OkDa Tl M298 C6 H-X79537 glycogenin 30.8 34.OkDa M440 C1 H-X79865 H.sapiens Mrpl7 mRNA 21.89 3l.OkDa M298 FS H-X80229 protein kinase PKN 52.8 64.OkDa 167-39 H-X80230 H.sapiens mRNA (clone42 40.99 C-2k) mRNA for serine/threonine protein kinase 217-49 H-X80343 H.sapiens p35 mRNA 40 33.84 for regulatory subunit of cdk5 kinase M270 D7 H-X80695 cytochrome oxidase-assembly47.96 50 protein, OXA1, H.sapiens OXA 1 Hs mRNA

M266 BS H-X80909 nascent polypeptide-associate23.76 37.OkDa complex, alpha M416 D9 H-X80910 Protein phosphatase 36.08 45.OkDa 1, catalytic subunit, beta isofonm E2 H-X81198 Archain 52.03 63 169-6 H-X81817 H.sapiens BAP31 mRNA 32 27.1 E4 H-X82018 H.sapiens mRNA for 46.75 57 ZID protein M313 D7 H-X82456 MLN50 28.82 33 A2 H-X82629 H.sapiens mRNA for 33.44 42 Mox-2 M236 D1 H-X83006 lipocalin, neutrophil21.89 34.OkDa gelatinase associated 166-40 H-X83107 H.sapiens Bmx mRNA ~ 75 74.32 for cytoplasmic tyrosine kinase E3 H-X83425 H.sapiens LU gene 69.19 59 for Lutheran blood group glycoprotein C6 H-X83703 H.sapiens mRNA for 35.2 54 cytokine inducible nuclear protein M416 H2 H-X83928 H.sapiens mRNA for 23.32 33.OkDa transcription factor TFIID subunit 166-17 H-X85106 H.sapiens mRNA for 90 80.70 ribosomal S6 kinase 166-39 H-X85337 H.sapiens mRNA for 110 109.0 myosin light chain kinase D2 H-X85750 H.sapiens mRNA for 26.29 30 transcript associated with monocyte to macrophage differentiation M266 E6 H-X87176 17-beta-hydroxysteroid81.07 65 dehydrogenase,type M297 F2 H-X87689 CLCP 23.21 33.OkDa M300 A2 H-X87843 cyclin H assembly 34.1 47 factor M271 E3 H-X89750 homeotic protein, 30.03 32.OkDa TGIF, H.sapiens mRNA for TGIF

protein M235 GI H-X90529 guanine nucleotide-binding34.54 40 protein ragA [RAGA) M302 E6 H-X90583 translocon-associated19.14 28.OkDa protein, delta M306 G1 H-X90872 gp2512 23.65 33 M416 D2 H-X91504 Transcription factor 22.22 32.OkDa (a.k.a. ARP1) M250 B3 H-X92098 transmembrane protein22.22 30 rnp24 M271 G7 H-X92106 bleomycin hydrolase. 50.16 SS.OkDa PROTECTING NORMAL
AND

MALIGNANT CELLS FROM

BLM TOXICITY.

F3 H-X92715 Zinc finger protein 63.03 47 74 (Cos52) M270 H6 H-X92720 H.sapiens mRNA for 70.51 71 phosphoenolpyruvate carboxykinase HS H-X92762 H.sapiens mRNA for 32.23 37 tafazans protein M298 D3 H-X93036 MAT-8 9.68 l6.OkDa M476 AS H-X93595 H.sapiens mRNA for 50.16 56.OkDa NK receptor (clone 17. I C) M417 D2 H-X93920 protein tyrosine phosphatase41.980 48.OkDa foreskin AS H-X95592 H.sapiens mRNA for 15.62 28 CID protein M298 B4 H-X95648 translation initiation33.66 34.OkDa factor 2B, alpha subunit F3 H-X95735 H.sapiens mRNA for 63.03 72 zyxin 2 M386 B1 H-X96752 L-3-hydroxyacyl-CoA 34.65 45.OkDa dehydrogenase, SCHAD
gene M422 B6 H-X97229 H.sapiens mRNA for 41.58 48.OkDa NK

receptor, clone library 15.212 B3 H-X98173 H.sapiens mRNA for 51.15 51 MACH-alpha-2 protein 166-14 H-X99325 H.sapiens mRNA for 55 46.9 Ste20-like 3 kinase C4 H-X99459 H.sapiens mRNA for 21.34 30 sigma 3B

protein M424 C4 H-Y00291 Human hap mRNA encoding49.39 59.OkDa a DNA-binding hormone receptor M386 H1 H-Y00345 polyadenylate-binding69.74 70.OkDa protein M469 A2 H-Y00630 Plasminogen activator45.76 46.OkDa inhibitor, type II (arginine-serpin) M305 E1 H-Y00711 lactate dehydrogenase36.85 38.OkDa B

H2 H-Y00764 ubiquinol/cytochrome 10.12 33 c reductase hinge protein FS H-Y07848 Haapiens EWS, gar22, 36.3 50 rrp22 and bam22 genes M305 G6 H-211559 iron-responsive element97.9 98 binding protein 1 [IREB I
]

M250 F3 H-211566 Pr22 protein , STATHMIN16.5 22.OkDa [Homo sapiens], SERVES
AS

RELAY (VIA

PHOSPHORYLATION) FOR

DIVERSE SECOND

MESSENGER PATHWAYS

169-73 H-211695 H.sapiens 40 kDa protein50 38.35 kinase related to rat ERK2 M475 C8 H-211737 Flavin-containing 61.49 70.OkDa monooxygenase 4 Ci H-211898 Octamer binding protein39.71 50 M266 H4 H-212830 SSR, alpha subunit 31.57 42.OkDa A3 H-214000 Ring finger protein 41.58 50 M300 E1 H-214978 actin-related protein41.47 49 G 1 H-Z 19002 H.sapiens of PLZF 74.14 84 gene encoding kruppel-like zinc forger protein H 1 H-221966 POU homeobox protein 33.22 43 M248 G3 H-223139 CLASS II 29.04 34 HISTOCOMPATIBILITY

ANTIGEN, M BETA CHAIN

PRECURSOR [Homo sapiens]

D3 H-226876 ribosomal protein 7.81 35 F2 H-228339 H.sapiens mRNA for 35.97 43 delta 4-3-oxosteroid 5 beta-reductase M298 B3 H-228407 ribosomal protein 28.38 39.OkDa M313 C3 H-229330 ubiquitin-conjugating20.24 34 enzyme UbcH2, 23 kDa M271 F3 H-229677 guanine nucleotide-binding20.35 28.OkDa protein, ras-related M465 C2 H-230425 H.sapiens mRNA for 38.39 34.OkDa orphan nuclear hormone receptor M302 FS H-231357 cysteine dioxygenase 22.11 3l.OkDa M340 C1 H-231695 inositol polyphosphate40.04 49.OkDa phosphatase, 43 kDa E3 H-232564-2 H.sapiens FRGAMMA 26.84 36 mRNA

(819bp) for folate receptor M236 H1 H-235227 small G protein, TTF,21.12 30.OkDa RAS-RELATED PROTEIN RAC

A10 H-235491 H.sapiens mRNA for 30.25 60 novel glucocorticoid receptor-associated protein M440 GS H-237986 H.sapiens mRNA for 25.41 28.OkDa phenylalkylamine binding protein M297 E2 H-247087 cyclin A/cyclin-dependent18.04 30.OkDa kinase 2-associated p19 F1 H-248051 H.sapiens gene for 27.28 31 myelin oligodendrocyte glycoprotein (MOG) A2 H-248475 Glucokinase regulator68.86 70 M302 E4 H-248570 sperm zona pellucida-binding16.72 24 protein M266 A2 H-268907 Human clone ID 19322543.34 45.OkDa NAD

(H~specific isocitrate dehydrogenase gamma subunit mRNA, alternatively spliced, partial cds G1 H-283850 Human DNA sequence 45.76 60 from PAC

82J I 1 and cosmid U 134E6 on chromosome Xq22. Contains NIK

like and Thyroxin-binding globulin precursor (T4-binding globulin, TBG) genes, ESTs and STSs H4 H-297171 Homo sapiens GLCIA 55.55 55 (trabecular meshwork induced glucocortcoid response) gene, exon I, joined CDS

M421 DS H-297632 Human DNA sequence 28.49 38.OkDa from PAC

196E23 on chromosome Xq26.1-27.2. Contains the (HIV-1 transcriptional elongation factor TAT cofactor TAT-SFI) gene, the BRS3 (Bombesin Receptor subtype-3 (Uterine Bombesin Receptor, BRS-3) gene, an unknown gene coding for two isoforms, a predicted CpG

island, ESTs and STSs The following example illustrates the construction of the expression vectors 5 used in the Examples above. Similar modifications can be made in other vectors for use in creating libraries of expressible gene sequences.
The vector pcDNA3.1/VS-His was obtained from Invitrogen (cat #V810-20) and modified slightly so that it carried an gene sequence for ZeocinTM
resistance and lacked the multiple cloning site. A 100~.g aliquot was suspended in 200 ~tl medical 10 irrigation (MI) water. A Sp,l aliquot was saved for gel analysis. The remainder was transferred to a 1.7 ml Eppendorf tube. The vector was digested with HindIII
(400 U) using Promega Buffer E (final volume = 400 ~l). The reaction ran 3 hours at 37° C.
An aliquot was checked for completeness of digestion by running on an 0.8%
agarose gel in 1 X TAE, and visualizing with ethidium bromide.
15 The digested vector was treated with 200 p,l phenol/chloroform (pH7.5) according to standard procedures, and the DNA precipitated from the aqueous phase using 1/10 volume 3M NaOAc and 2 volumes 100% EtOH at room temperature, followed by washing with 80% EtOH. The pellet was resuspended in 100 ul MI
water.

WO 99/51766 PC1'/US99/07270 Two oligonucleotides were added to the resuspended DNA (Topo -H (40 pg) 5'-(P)AGCTCGCCCTTATTCCGATAGTG (SEQ ID N0:3), Topo-4 (12 g.g) 5'-(P)AGGGCG (SEQ ID N0:4)), plus I7 ~,1 l OX Promega T4 Ligase buffer. The tube was placed on ice and the volume increased to 170 Itl with MI water. The oligos were S ligated to the vector using 20U Promega T4 DNA ligase, incubated at I2° C
overnight.
The vector was treated with 100 ~1 phenoUchloroform and the aqueous phase precipitated as described above. The pelleted DNA was resuspended in 150 p.l of sterile water the redigested with HindIII (17 ~,1 Promega Buffer E, 200 U
HindIII - 37°
C, 1 hour). The redigested DNA was re-extracted with phenol/chloroform and precipitated with 1/10 volume 3M NaOAc and 7/10 volume isopropanol, then washed with 80% EtOH.
The pelleted DNA was resuspended in 82 ~.1 TE buffer ( 10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0). A 2 ~,1 aliquot was used to check the foregoing procedure using agarose gel electrophoresis as described above. The remaining 80 ~l was transferred to a Falcon tube and mixed with 16 ~g Topo-5 oligonucleotide (S'-(P)CAACACTATCGGAATA (SEQ ID NO:S). To this mixture was added 190 ~,1 NEB Restriction Buffer # 1 (room temperature). The total reaction mixture was adjusted to 1.9 mls with MI wafer. Vaccinia Topoisomerase I enzyme was added (80 fig) and the reaction tube placed in a 37° C water bath for 15 minutes.
After 15 minutes, 200 ~,1 of room temperature Topo-lOX stop buffer was added (100 mM Tris 7.4, 110 mM EDTA, bromophenol blue). The entire volume was loaded onto an agarose gel ( 1.2 gr agarose/ 130 mls 1 X TAE) and run at 70 volts until the bromophenol blue dye had run down about I /2 in (volume in the loading well was kept constant by the addition of 1 X TE). The voltage was reversed for 90 seconds.
The contents of the loading well were transferred to a 15 ml Falcon tube and placed on ice. 2 mls of cold Topo-2X Wash Buffer (60 mM Tris 7.4, 1 mM EDTA, 4 mM
dithiothreitol (DTT), 200 ltg/ml bovine serum albumin (BSA)) was added and the volume then adjusted to 4 mls with cold Topo-1X Enzyme Dilution Buffer (50%
glycerol, 50 mM Tris 7.4, 1 mM EDTA, 2 mM DTT, 0.1 % Triton X-100, 100 pg/ml BSA) plus 4 mls Topo-Glycerol mix (90% glycerol, 10% 50 mM TE pH 7.4, 0.1%
Triton X-100) and stored until needed.
A similar procedure was used to make Topo-adapted pYES2 (Invitrogen cat #
V 825-20).
While the foregoing has been presented with reference to particular embodiments of the invention, it will be appreciated by those skilled in the art that changes in these embodiments may be made without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims.

Claims (38)

That which is claimed is:

1. A method for producing a library of expressible coding regions comprising the steps of:
(a) amplifying a plurality of coding regions using at least one coding region specific primer, (b) inserting each coding region into an expression vector, and (c) verifying the size and orientation of the inserted coding region.

2. The method according to claim 1 further comprising transforming cells with the vector containing the verified coding region.

3. The method according to claim 1 further comprising purifying the amplified coding region prior to insertion into an expression vector.

4. The method according to claim 1 wherein the coding regions encode full-length proteins.

5. The method according to claim 4 wherein the 5' primer used for amplification starts with the nucleotides CACCATG and the 3' primer causes the amplification product to end at the third position of the codon immediately preceding the stop codon of the coding region being amplified plus a single adenine residue.

6. The method according to claim 3 wherein the purification is performed using agarose gel electrophoresis.

7. The method according to claim 6 wherein the agarose is low melt agarose.

8. The method according to claim 1 wherein insertion of the amplified coding region into an expression vector is performed using an enzyme that both cleaves and ligates DNA.

9. The method according to claim 3 wherein the purification is performed using low melt agarose gel electrophoresis and insertion of the amplified coding region into an expression vector is performed using an enzyme that both cleaves and ligates DNA.

10. The method according to claim 8 wherein said enzyme is a type I
topoisomerase or a site-specific recombinase.

11. The method according to claim 10 wherein said enzyme is vaccinia DNA
topoisomerase, lambda integrase, FLP recombinase or P1-Cre protein.

12. A method according to claim 11 wherein said enzyme is vaccinia DNA
topoisomerase.

13. The method of claim 1 wherein the expression vector is a eukaryotic expression vector.

14. The method of claim 13 wherein said eukaryotic expression vector is pYES2/GS or pcDNA3.1/GS.

15. The method of claim 1 wherein the expression vector is a prokaryotic expression vector.

16. The method of claim 15 wherein said prokaryotic expression vector is pBAD.

17. The method according to claim 1 wherein the expression vector comprises one or more elements selected from: a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an affinity purification tag sequence, an inducible element sequence and an epitope-tag sequence.

18. The method of claim 1 wherein size and orientation of the insert is verified using a polymerase chain reaction protocol.

19. The method of claim 18 wherein said verification is performed using whole cell lysates.

20. The method of claim 1 wherein the coding regions to be amplified are open reading frame sequences in prokaryotic DNA or eukaryotic DNA.

21. The method according to claim 20 wherein the eukaryotic DNA is obtained from yeast or mammalian cells.

22. The method according to claim 1 wherein the coding regions being amplified encode members of a family of proteins.

23. The method according to claim 22 wherein the proteins are human proteins.

24. The method according to claim 23 wherein the family of proteins are kinases, phosphatases, transcription factors, oncogenes, or tumor suppressors.

25. The method according to claim 1 wherein steps (a) and (b) are performed in a multiwell microtiter plate.

26. The method according to claim 1 wherein coding regions of the correct size and in the correct orientation are roboticly selected for transformation into cells for expression.

27. The method according to claim 2 comprising the additional step of verifying that the transformed cells express the coding region.

28. The method according to claim 2 wherein the transformed cells are eukaryotic cells or prokaryotic cells.

29. A method according to claim 28 wherein the eukaryotic cells are CHO
cells or S. cerevisiea cells.

30. An expression library of coding regions produced according to the method of claim 1.

31. The library according to claim 30 wherein the coding regions encode yeast proteins.

32. The library according to claim 31 wherein the coding regions encode mammalian proteins.

33. The library according to claim 32 wherein the mammalian proteins are human proteins.

34. The library according to claim 33 wherein the human proteins are kinases, phosphatases, transcription factors, oncogenes, or tumor suppressors.

35. An expression library obtainable from the method of claim 1.

36. An expression vector pYES2/GS.

37. An expression vector pCDNA3.1/GS.

38. A method for producing a library of expressible coding regions comprising the steps of:
(a) amplifying a plurality of coding regions using PCR, wherein the 5' primer comprises the sequence CACCATG and the 3' primer causes the amplification product to end just prior to any stop codon, (b) purifying the amplified coding regions using low melt agarose electrophoresis, (c) inserting each of the purified coding regions into an expression vector using vaccinia DNA topoisomerase, wherein said expression vector comprises a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an affinity purification sequence, and an epitope-tag sequence, (d) transforming bacterial cells with the insert containing expression vector, (e) growing the transformed cells and verifying the size and orientation of the inserted coding region, (f) selecting expression vectors containing inserted coding regions in the correct orientation for expression of the gene product, and (g) transforming cells for expression with said expression vectors.