CA2324261A1 - Method and device for identifying a tag - Google Patents
Method and device for identifying a tag Download PDFInfo
- Publication number
- CA2324261A1 CA2324261A1 CA002324261A CA2324261A CA2324261A1 CA 2324261 A1 CA2324261 A1 CA 2324261A1 CA 002324261 A CA002324261 A CA 002324261A CA 2324261 A CA2324261 A CA 2324261A CA 2324261 A1 CA2324261 A1 CA 2324261A1
- Authority
- CA
- Canada
- Prior art keywords
- nucleotide sequence
- tag
- bound
- nucleotide
- contact
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Radar Systems Or Details Thereof (AREA)
Abstract
The invention relates to a method for identifying a tag. Said tag is provided on a solid (1) and has a first nucleotide sequence (3). The first nucleotide sequence (3) is brought into contact with a detection agent which has a second nucleotide sequence (5) corresponding to the first. The second nucleotide sequence (5) is bound by its first end to a solid phase (D) and has a first flurophore group (6) at its second end.
Description
' Method and device for identifying a tag The invention relates to a method and a device for identifying a tag provided on a solid and having a first nucleotide sequence.
US 4,996,143 discloses a method in which a first and a second primer are bound at a distance of from 2 to 7 nucleotides to the nucleotide sequence to be detected. The first and the second primer are each provided with a fluorophoreic molecule. In the binding state, as a consequence of the Forster effect there is a nonradiative energy transfer from one fluorophoreic molecule to the other. This causes a specific fluorescence.
US 5,607,834 discloses the use of a primer with a hairpin loop for detecting a nucleotide sequence. This entails a fluorophoreic molecule and a quencher being provided oppositely on the loop sections of the hairpin loop. The distance between the fluorophoreic molecule and the quencher make [sic] a nonradiative, fluorescence-quenching energy transfer possible.
However, when the primer hybridizes with a complementary strand, the hairpin loop is opened. The fluorescence-quenching spatial relation between the fluorophoreic molecule and the quencher is altered.
This makes it possible to observe a fluorescence.
DE 195 81 489 T1 describes a method for identifying and detecting components in a multicomponent mixture. This entails use of a marker which has at least two fluorophoreic groups which are bound to a basic framework and are in an energy-transfer relation. The known method is suitable for separation methods such as electrophoresis, chromatography or the like. It is unsuitable for identifying a tag provided on a solid phase.
REPLACEMENT SHEET (RULE 26) The fluorescence energy transfer in hybrids between fluorophore-labeled oligonucleotides is described from Cardullo, R.A. et al.; Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer; Proc. Natl. Acad. Sci. USA 85 (1988) 8790-8794. Use of the fluorescent energy transfer for identifying tags is not mentioned therein.
The known methods are not particularly sensitive. They can be used only in solution. They are unsuitable for simple and rapid identification of nucleotide sequences bound to a solid.
It is an object of the present invention to eliminate the advantages of the prior art. It is particularly intended to indicate a method and a device with which simple and rapid identification of a tag provided on a solid and having a first nucleotide sequence is possible. It is particularly intended that the identification be possible in the dry state, that is to say without preparing a solution.
This object is achieved by the features of Claims 1 and 10. Expedient embodiments are evident from the features of Claims 2 to 9 and 11 to 22.
The invention provides a method for identifying a tag provided on a solid and having a first nucleotide sequence, wherein the first nucleotide sequence is brought into contact with a detection means having a second nucleotide sequence corresponding to the first, wherein the second nucleotide sequence is bound by its first end to a solid phase and has on the second end a first fluorophoreic group. - This makes simple and rapid identification of a nucleotide sequence provided on a solid possible. Preparation of a solution is unnecessary for this.
REPLACEMENT SHEET (RULE 26) According to one embodiment feature, the first and the second nucleotide sequence hybridize on being brought into contact. This may advantageously entail releasing the first nucleotide sequence from an existing hybridization with a third nucleotide sequence. A
fluorescence reaction can be induced on hybridization of the first and second nucleotide sequence. This makes simple identification possible.
According to another embodiment feature, the first nucleotide sequence can, on being brought into contact, be moved by the action of a magnet toward the first detection means. The bringing into contact can also be promoted by applying a gel or a, preferably viscous, liquid to the detection means and/or the tag.
A protective layer covering the first nucleotide sequence is expediently removed before the being brought into contact, in which case the tag is advantageously heated to a temperature of more than 50°C. After the being brought into contact, the tag is expediently cooled to a temperature of less than 50°C.
The invention further provides a device for identifying a tag provided on a solid and having a first nucleotide sequence using a detection means having a second nucleotide sequence corresponding to the first, wherein the second nucleotide sequence is bound by its first end to a solid phase and has on the second end a first fluorophoreic group. Such a device makes simple and rapid identification of a nucleotide sequence provided on a solid possible. Preparation of a solution is unnecessary for this.
It is advantageous for a first end of the first nucleotide sequence to be bound via spacer molecules REPLACEMENT SKEET (RULE 26) covalently to the solid. Such a tag is particularly durable.
A magnetic means is expediently bound to a second end of the first nucleotide sequence. This may be a magnetic plastic, Fe203 particles or the like. The size of the magnetic means is preferably from 20 nm to 200 nm. It is also possible to use plastics which are superparamagnetic from a chain length of 4 monomers onward..Magnetic means produced from such plastics may have a size of a few Angstrom [sic].
According to another embodiment feature, the first end of the second nucleotide sequence is bound via spacer molecules to the solid phase. The detection means may have a third nucleotide sequence which is designed to correspond at least in sections to the second nucleotide sequence. A first end of the third nucleotide sequence can likewise be bound via spacer molecules to the solid phase.
The spacer molecules preferably have a length of from 0.2 to 1 ~. The solid phase of the detection means may be produced from a transparent material, for example plastic, glass or quartz. A further possibility is to provide a layer produced from water-binding substances, for example polyethylene glycol, glycerol or the like, on the surface of the solid phase.
It is expedient to provide a second fluorophoreic group or a quencher on a second end of the third nucleic acid. The second and the third nucleic acid sequences are expediently in the hybridized state for the identification so that an interaction develops between the first fluorophoreic molecule and the quencher. The interaction which develops causes either a quenching of a fluorescence of a first fluorophoreic molecule or else a particularly strong fluorescence reaction as a REPLACE1~NT SHEET (RULE 26) ' consequence of a direct or nonradiative energy transfer from the first to the second fluorophoreic molecule or vice versa. As soon as the spatial relation between the first fluorophoreic molecule and the second fluorophoreic molecule or the quencher is changed it is possible to observe a change in the fluorescence. The change in the fluorescence serves to identify the first nucleotide sequence.
It has proven particularly advantageous for the first, second and the third nucleic acid sequence to be formed from a deoxyribonucleic acid (=DNA) or peptic nucleic acid (=PNA). Other, in particular nuclease-resistant nucleic acid derivatives are likewise conceivable.
The detector means may further have a light source and/or a fluorescence detector. It may further be provided with a unit for generating a heat pulse, preferably an IR laser, NMR, microwave or ultrasonic pulse. It is possible in this way briefly to heat the tag.
Examplary embodiments of the invention are explained in detail by means of the drawing. These show in Fig. 1 a diagrammatic representation of a tag, Fig. 2 a diagrammatic view of part of a detector, Fig. 3 a-c the effect of a magnetic field on a tag shown in Fig. 1, Fig. 4 a diagrammatic view of part of the surface of the detector, Fig. 5 the tag shown in Fig. 1 in contact with the detector shown in Fig. 3, REPLACEMENT SHEET (RULE 2 6 ) Fig. 6 a-c the detection process, Fig. 7 a, b a second tag in the nonhybridized and in the hybridized state, Fig. 8 a, b a third tag in the nonhybridized and in the hybridized state, Fig. 9 ~, b a fourth tag in the nonhybridized and in the hybridized state, Fig. 10 a, b a fifth tag in the nonhybridized and in the hybridized state, Fig. 11 the fluorescence of a detector nucleotide (1) without tag nucleotide and (2) with tag nucleotide, Fig. 12 a a slide coated with tag nucleotide and Fig. 12 b the tag nucleotide shown in Fig. 12 a in the hybridization state with a detector nucleotide.
Fig. 1 shows a first tag in the nonhybridized state. A
spacer molecule 2 is covalently bound to the surface of a solid 1, for example a banknote . The spacer molecule has a length of from 5 to 10,000 nm. The 3' end of a PNA 3 is bound to the free end of the spacer molecule 2. This PNA consists of about 10 to 50 bases. A
magnetizable particle 4 is bound to the 5' end of the PNA 3. This may be a polymer group with a diameter of from 20 to 200 nm.
Fig. 2 shows a diagrammatic view of part of a detector.
A second PNA 5 is bound via the spacer molecule 2 to a solid phase D which is made of plastic. A first REPLACEMENT SHEET (RUDE 26) fluorophoreic group 6 is bound to the 5' end of the second PNA 5. A third PNA 7, which is designed to correspond in sections to the second PNA 5, is bound by its 5' end via another spacer molecule 2 to the solid phase D. A second fluorophoreic molecule or a quencher 8 is bound to the 3' end of the third PNA 7.
The first fluorophoreic molecule 6 may be an acceptor group and the second fluorophoreic molecule may be a donor group. The acceptor group may be a 6-carboxy-tetramethyl-rhodamine and the donor group may be a 6-carboxy-fluorescein. Further suitable donor/acceptor pairs are evident from the table below:
Donor Acceptor Fluorescein Fluorescein Fluorescein Tetramethylrhodamine IAEDANS - (5-((((2-iodo- Fluorescein DABCYL
acyl)amino)ethyl)amino)- (4-dimethylaminoazobenzen-naphathalene-lsulfonic acid 4'-sulfoylochloride) EDANS (5-((2-aminomethyl)- DABCYL (4-dimethylaminoazo-amino)naphthalene-1- benzen-4'-sulfoylochloride) sulfonic acid BODOPY FL BODIPY FL
It is, of course, possible to interchange the first and the second fluorophoreic molecule. According to another embodiment feature, the second fluorophoreic molecule may be replaced by a quencher 8.
Suitable quencher/fluorophore pairs are evident from the following table:
Quencher Fluorophore DABCYL Coumarin DABCYL EDANS
DABCYL Fluorescein REPLACEMENT SFIEET (RULE 26) DABCYL Lucifer yellow DABCYL Bodipy DABCYL Eosin DABCYL Tetramethylrhodamine DABCYL Texas red DABCYL Erythrosin Fig. 3 a to c show the behavior of the tag under the influence of a magnetic field. When an appropriately oriented magnetic field is applied, the magnetic particles 4 are moved away from the surface of the solid 1.
Fig. 4 again shows the surface of the detector shown in Fig. 2. It is evident from this that on the surface of the solid phase D third PNA 7 provided with second fluorophoreic molecules or quenchers 8 are bound in excess via spacer molecules 2 to the surface. This ensures that, in the case where a quencher 8 is used -the fluorescence of the first fluorophoreic molecule 6 is quenched as long as the detector is not in contact with a first PNA 3 designed to correspond to the second PNA 5.
Fig. 5 shows the tag shown in Fig. 1 in contact with the detector shown in Fig. 3. The first PNA 3 hybridizes with the second PNA 5 of the detector. The third PNA 7 is separated from the second PNA 5. There is no longer an interaction between the first fluorophoreic molecule 6 and quencher 8. This elicits a fluorescence reaction. In the case where a second fluorophoreic molecule is used it is possible to observe an altered fluorescence. The binding between second PNA and the third PNA 7 can be loosened by increasing the temperature before bringing the tag into contact with the detector. This is done by briefly heating the tag, for example using an IR laser pulse.
REP?~ACEI~NT SHEET (RULE 2 6 ) Fig. 6 a to c again show diagrammatically the detection process. Firstly, as shown in Fig. 6 a, the detector is brought near the tag. The tag is subsequently heated briefly and a magnetic field is applied. This moves the first PNA 3 toward the solid phase D. The PNA 3 hybridizes with the second PNA 5 which has been released from the third PNA 7 by the heat pulse. The hybridization results in a fluorescence reaction. After detection thereof by a suitable fluorescence detector, the magnetic field is reversed where appropriate and thus the detection process is terminated.
Fig. 7 a and b show a second embodiment of a 20 [sic]
detector. In this case, the second PNA 5 and the third PNA 7 are provided on one and the same nucleotide strand. Hybridization of the second PNA 5 with the third PNA 7 leads to formation of a loop. The first fluorophoric molecule 6 [lacuna] the quencher 8 develop an interaction. In the example shown in Fig. 8 a, the second PNA 5 is provided on one branch and the third PNA 7 is provided on another branch of a branched molecule. Fig. 9 a once again shows the previously described design of the detector in which the second PNA 5 and the third PNA 7 are bound on two separate strands to the solid phase D.
Fig. 7b, 8b and 9b each show the hybridization state.
Fig. l0a shows another examplary embodiment. In this case, the second PNA 5 is directly bound by its 3' end to the solid phase D. The first fluorophoreic molecule 6 is located at the 5' end. The third PNA 7 is bound by its 5' end directly to the solid phase D. In this case, a second fluorophoreic molecule 8 is located at the 3' end of the third PNA 7. In the case of hybridization, the second PNA 5 and the third PNA 7 bind to the first PNA 3 in such a way that a spatial relation between the REPLACEMENT SHEET (RULE 26) first 6 and the second fluorophoreic molecule 8 results. In this examplary embodiment, according to the Forster effect, there is a nonradiative transfer of energy from the second 8 to the first fluorophoreic molecule 6 and thus an enhanced fluorescence reaction.
Example 1:
Design and synthesis of a tag nucleotide and a detector nucleotide An oligonucleotide consisting of 32 nucleotides and having the following sequence is synthesized as tagging means:
5'-CCAAGC CTGGAGGGATGATACTTT GCGCTTGG-3' An oligonucleotide consisting of 32 nucleotides and complementary to the sequence of the tagging means or nucleotide is synthesized as detection means:
3'-X-GGTTCG GACCTCCCTACTATGAAACG CC~hACC-6FAM-5' X = dT(C2-DABCYL) The synthesis mixture comprises 0.2 ~mol. The oligonucleotides are purified by HPLC.
The six terminal nucleotides within an oligonucleotide are complementary to one another. It would therefore be possible for these nucleotides to undergo folding back.
GACCTCCCT
3'-X-GGTTCG
5' -6FA~t-CCAAGC C
GCAAAGTAT
REPLACEI~NT SHEET (RULE 26) In this folding back, the 5'-6FAM group on the detector nucleotide is in the immediate neighborhood of the 3'-DABCYL group. With appropriate excitation of the 6FAM group (absorption maximum 496 nm, emission maximum 516 nm come [sic]), nonradiative energy transfer of the absorbed energy to the DABCYL group can occur. The fluorescence of the 6FAM group is greatly reduced thereby in this state.
When the detector means or nucleotide is brought together with the tag nucleotide there is hybridization of the complementary sequences of the two molecules:
5'-CCA AGC CTG GAG GGA TGA TAC TTT GCG CTT GG-3' 3'-X-GGT TCG GAC CTC CCT ACT ATG AAA CGC GAA CC-6FAM-5' In the hybridized structure, the 5'-6FAM is spatially separate from the 3'-X group of the detector nucleotide. This means that energy transfer between the 6FAM and the DABCYL group is no longer possible. With appropriate excitation of the 6FAM group, accordingly, there is unimpaired fluorescence of the 6FAM group.
To detect a fluorescence energy transfer, detector nucleotide and tag nucleotide are dissolved in 10 mM
tris-C1, 1 mM EDTA, pH 8 (TE) . To 100 ~1 of a 1 ~,tM
solution of the detector nucleotide are added the same volume of a 2 ~tM solution of the tag nucleotide or the same volume of TE. To detect the hybridization, the fluorescence of the solution is determined with excitation at 496 nm and emission at 516 nm. Mixing the nucleotides causes the fluorescence to increase by a factor of about nine (Fig. 11). The increase in the fluorescence shows the augmentation of the intramolecular fluorescence energy transfer of the detector nucleotide because of a hybridization of detector nucleotide and tag nucleotide.
REPLACEMENT SHEET (RULE 2 6 ) Example 2:
Determination of detection sensitivity of hybrids of detector nucleotides and tag nucleotides To determine the detection sensitivity of hybrids of detector nucleotides and tag nucleotides, the fluorescence of a decreasing concentration series of hybrids of tag nucleotide and detector nucleotide is measured. This is done by placing drops, each with a volume .of 1 ~l, of a 1 N.M solution of the tag nucleotide on a slide . The same volume of a decreasing concentration series of the detector nucleotide is added to each drop. The concentrations of detector nucleotide are 1000, 500, 200, 100, 50, 20, 10, 5, 0 nM. To determine the background, the same concentration series of the detector nucleotide are added to 1 ~1 portions of TE. The samples are examined under a fluorescence microscope using a FAM-specific filter block with 500 x magnification.
It was still possible to detect a specific fluorescence owing to the hybridization of detector nucleotide and tag nucleotide after addition of a detector nucleotide solution with a concentration of 5 nM to the tag nucleotide solution. Without tag nucleotide, the fluorescence of the detector nucleotide was visible as far as a concentration of 50 nM.
Example 3:
Hybridization of tag nucleotide and detector nucleotide in the dry state To detect a hybridization of tag nucleotide and detector nucleotide in the dry state, a 1 ~tm solution of the tag nucleotide in TE is prepared. In addition, 4,6-diamidino-2-phenylindoles (DAPI) in a concentration of 2ng/~.l is added to the solution for visualization of the tag nucleotide. DAPI is a dye which binds DNA and REPLACEMENT SHEET (RULE 2 6 fluoresces in the bound state. The fluorescence of DAPI
can be separated by appropriate filters from the fluorescence of the FAM group and be detected.
1 ~l of the tag nucleotide solution is applied with a 2 ~1 pipette in the form of lines to a polished slide.
The liquid is dried at room temperature. Fig. 12 a shows a slide coated in this way. The tag nucleotide is evident in the form of the pale areas. On a second slide, 5 ~1 of a 20 nM solution of the detector nucleotide is applied on an area of about 40 mmz and likewise left to stand at room temperature until dry.
The slides are then laid one on top of another with the sides carrying the tag nucleotides and pressed together with a pressure of about 400 N/cm2 for one minute. The slides are then examined under a fluorescence microscope with 500 x magnification. The applied tag nucleotide can be detected on the basis of the DAPI
stain. The detector nucleotide is undetectable in the nonhybridized state. In the hybridized state, the detector nucleotide can be detected on the basis of the FAM-specific fluorescence. The fluorescence of the detector nucleotide can be observed only in the region of the applied tag nucleotide (Fig. 12 b). The observed fluorescence of the detector nucleotide in the region of the applied tag nucleotide is a demonstration of the hybridization of the tag nucleotide with the detector nucleotide.
REP7~ACEMENT SHEET (RUDE 2 6 ) List of reference numbers 1. Solid 2 Spacer molecule 3 First PNA
4 Magnetic group 5 Second PNA
6 First fluorophoreic molecule 7 Third PNA
8 _Second fluorophoreic molecule or quencher D Solid phase REP?~ACEMENT SHEET (RUDE 2 6
US 4,996,143 discloses a method in which a first and a second primer are bound at a distance of from 2 to 7 nucleotides to the nucleotide sequence to be detected. The first and the second primer are each provided with a fluorophoreic molecule. In the binding state, as a consequence of the Forster effect there is a nonradiative energy transfer from one fluorophoreic molecule to the other. This causes a specific fluorescence.
US 5,607,834 discloses the use of a primer with a hairpin loop for detecting a nucleotide sequence. This entails a fluorophoreic molecule and a quencher being provided oppositely on the loop sections of the hairpin loop. The distance between the fluorophoreic molecule and the quencher make [sic] a nonradiative, fluorescence-quenching energy transfer possible.
However, when the primer hybridizes with a complementary strand, the hairpin loop is opened. The fluorescence-quenching spatial relation between the fluorophoreic molecule and the quencher is altered.
This makes it possible to observe a fluorescence.
DE 195 81 489 T1 describes a method for identifying and detecting components in a multicomponent mixture. This entails use of a marker which has at least two fluorophoreic groups which are bound to a basic framework and are in an energy-transfer relation. The known method is suitable for separation methods such as electrophoresis, chromatography or the like. It is unsuitable for identifying a tag provided on a solid phase.
REPLACEMENT SHEET (RULE 26) The fluorescence energy transfer in hybrids between fluorophore-labeled oligonucleotides is described from Cardullo, R.A. et al.; Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer; Proc. Natl. Acad. Sci. USA 85 (1988) 8790-8794. Use of the fluorescent energy transfer for identifying tags is not mentioned therein.
The known methods are not particularly sensitive. They can be used only in solution. They are unsuitable for simple and rapid identification of nucleotide sequences bound to a solid.
It is an object of the present invention to eliminate the advantages of the prior art. It is particularly intended to indicate a method and a device with which simple and rapid identification of a tag provided on a solid and having a first nucleotide sequence is possible. It is particularly intended that the identification be possible in the dry state, that is to say without preparing a solution.
This object is achieved by the features of Claims 1 and 10. Expedient embodiments are evident from the features of Claims 2 to 9 and 11 to 22.
The invention provides a method for identifying a tag provided on a solid and having a first nucleotide sequence, wherein the first nucleotide sequence is brought into contact with a detection means having a second nucleotide sequence corresponding to the first, wherein the second nucleotide sequence is bound by its first end to a solid phase and has on the second end a first fluorophoreic group. - This makes simple and rapid identification of a nucleotide sequence provided on a solid possible. Preparation of a solution is unnecessary for this.
REPLACEMENT SHEET (RULE 26) According to one embodiment feature, the first and the second nucleotide sequence hybridize on being brought into contact. This may advantageously entail releasing the first nucleotide sequence from an existing hybridization with a third nucleotide sequence. A
fluorescence reaction can be induced on hybridization of the first and second nucleotide sequence. This makes simple identification possible.
According to another embodiment feature, the first nucleotide sequence can, on being brought into contact, be moved by the action of a magnet toward the first detection means. The bringing into contact can also be promoted by applying a gel or a, preferably viscous, liquid to the detection means and/or the tag.
A protective layer covering the first nucleotide sequence is expediently removed before the being brought into contact, in which case the tag is advantageously heated to a temperature of more than 50°C. After the being brought into contact, the tag is expediently cooled to a temperature of less than 50°C.
The invention further provides a device for identifying a tag provided on a solid and having a first nucleotide sequence using a detection means having a second nucleotide sequence corresponding to the first, wherein the second nucleotide sequence is bound by its first end to a solid phase and has on the second end a first fluorophoreic group. Such a device makes simple and rapid identification of a nucleotide sequence provided on a solid possible. Preparation of a solution is unnecessary for this.
It is advantageous for a first end of the first nucleotide sequence to be bound via spacer molecules REPLACEMENT SKEET (RULE 26) covalently to the solid. Such a tag is particularly durable.
A magnetic means is expediently bound to a second end of the first nucleotide sequence. This may be a magnetic plastic, Fe203 particles or the like. The size of the magnetic means is preferably from 20 nm to 200 nm. It is also possible to use plastics which are superparamagnetic from a chain length of 4 monomers onward..Magnetic means produced from such plastics may have a size of a few Angstrom [sic].
According to another embodiment feature, the first end of the second nucleotide sequence is bound via spacer molecules to the solid phase. The detection means may have a third nucleotide sequence which is designed to correspond at least in sections to the second nucleotide sequence. A first end of the third nucleotide sequence can likewise be bound via spacer molecules to the solid phase.
The spacer molecules preferably have a length of from 0.2 to 1 ~. The solid phase of the detection means may be produced from a transparent material, for example plastic, glass or quartz. A further possibility is to provide a layer produced from water-binding substances, for example polyethylene glycol, glycerol or the like, on the surface of the solid phase.
It is expedient to provide a second fluorophoreic group or a quencher on a second end of the third nucleic acid. The second and the third nucleic acid sequences are expediently in the hybridized state for the identification so that an interaction develops between the first fluorophoreic molecule and the quencher. The interaction which develops causes either a quenching of a fluorescence of a first fluorophoreic molecule or else a particularly strong fluorescence reaction as a REPLACE1~NT SHEET (RULE 26) ' consequence of a direct or nonradiative energy transfer from the first to the second fluorophoreic molecule or vice versa. As soon as the spatial relation between the first fluorophoreic molecule and the second fluorophoreic molecule or the quencher is changed it is possible to observe a change in the fluorescence. The change in the fluorescence serves to identify the first nucleotide sequence.
It has proven particularly advantageous for the first, second and the third nucleic acid sequence to be formed from a deoxyribonucleic acid (=DNA) or peptic nucleic acid (=PNA). Other, in particular nuclease-resistant nucleic acid derivatives are likewise conceivable.
The detector means may further have a light source and/or a fluorescence detector. It may further be provided with a unit for generating a heat pulse, preferably an IR laser, NMR, microwave or ultrasonic pulse. It is possible in this way briefly to heat the tag.
Examplary embodiments of the invention are explained in detail by means of the drawing. These show in Fig. 1 a diagrammatic representation of a tag, Fig. 2 a diagrammatic view of part of a detector, Fig. 3 a-c the effect of a magnetic field on a tag shown in Fig. 1, Fig. 4 a diagrammatic view of part of the surface of the detector, Fig. 5 the tag shown in Fig. 1 in contact with the detector shown in Fig. 3, REPLACEMENT SHEET (RULE 2 6 ) Fig. 6 a-c the detection process, Fig. 7 a, b a second tag in the nonhybridized and in the hybridized state, Fig. 8 a, b a third tag in the nonhybridized and in the hybridized state, Fig. 9 ~, b a fourth tag in the nonhybridized and in the hybridized state, Fig. 10 a, b a fifth tag in the nonhybridized and in the hybridized state, Fig. 11 the fluorescence of a detector nucleotide (1) without tag nucleotide and (2) with tag nucleotide, Fig. 12 a a slide coated with tag nucleotide and Fig. 12 b the tag nucleotide shown in Fig. 12 a in the hybridization state with a detector nucleotide.
Fig. 1 shows a first tag in the nonhybridized state. A
spacer molecule 2 is covalently bound to the surface of a solid 1, for example a banknote . The spacer molecule has a length of from 5 to 10,000 nm. The 3' end of a PNA 3 is bound to the free end of the spacer molecule 2. This PNA consists of about 10 to 50 bases. A
magnetizable particle 4 is bound to the 5' end of the PNA 3. This may be a polymer group with a diameter of from 20 to 200 nm.
Fig. 2 shows a diagrammatic view of part of a detector.
A second PNA 5 is bound via the spacer molecule 2 to a solid phase D which is made of plastic. A first REPLACEMENT SHEET (RUDE 26) fluorophoreic group 6 is bound to the 5' end of the second PNA 5. A third PNA 7, which is designed to correspond in sections to the second PNA 5, is bound by its 5' end via another spacer molecule 2 to the solid phase D. A second fluorophoreic molecule or a quencher 8 is bound to the 3' end of the third PNA 7.
The first fluorophoreic molecule 6 may be an acceptor group and the second fluorophoreic molecule may be a donor group. The acceptor group may be a 6-carboxy-tetramethyl-rhodamine and the donor group may be a 6-carboxy-fluorescein. Further suitable donor/acceptor pairs are evident from the table below:
Donor Acceptor Fluorescein Fluorescein Fluorescein Tetramethylrhodamine IAEDANS - (5-((((2-iodo- Fluorescein DABCYL
acyl)amino)ethyl)amino)- (4-dimethylaminoazobenzen-naphathalene-lsulfonic acid 4'-sulfoylochloride) EDANS (5-((2-aminomethyl)- DABCYL (4-dimethylaminoazo-amino)naphthalene-1- benzen-4'-sulfoylochloride) sulfonic acid BODOPY FL BODIPY FL
It is, of course, possible to interchange the first and the second fluorophoreic molecule. According to another embodiment feature, the second fluorophoreic molecule may be replaced by a quencher 8.
Suitable quencher/fluorophore pairs are evident from the following table:
Quencher Fluorophore DABCYL Coumarin DABCYL EDANS
DABCYL Fluorescein REPLACEMENT SFIEET (RULE 26) DABCYL Lucifer yellow DABCYL Bodipy DABCYL Eosin DABCYL Tetramethylrhodamine DABCYL Texas red DABCYL Erythrosin Fig. 3 a to c show the behavior of the tag under the influence of a magnetic field. When an appropriately oriented magnetic field is applied, the magnetic particles 4 are moved away from the surface of the solid 1.
Fig. 4 again shows the surface of the detector shown in Fig. 2. It is evident from this that on the surface of the solid phase D third PNA 7 provided with second fluorophoreic molecules or quenchers 8 are bound in excess via spacer molecules 2 to the surface. This ensures that, in the case where a quencher 8 is used -the fluorescence of the first fluorophoreic molecule 6 is quenched as long as the detector is not in contact with a first PNA 3 designed to correspond to the second PNA 5.
Fig. 5 shows the tag shown in Fig. 1 in contact with the detector shown in Fig. 3. The first PNA 3 hybridizes with the second PNA 5 of the detector. The third PNA 7 is separated from the second PNA 5. There is no longer an interaction between the first fluorophoreic molecule 6 and quencher 8. This elicits a fluorescence reaction. In the case where a second fluorophoreic molecule is used it is possible to observe an altered fluorescence. The binding between second PNA and the third PNA 7 can be loosened by increasing the temperature before bringing the tag into contact with the detector. This is done by briefly heating the tag, for example using an IR laser pulse.
REP?~ACEI~NT SHEET (RULE 2 6 ) Fig. 6 a to c again show diagrammatically the detection process. Firstly, as shown in Fig. 6 a, the detector is brought near the tag. The tag is subsequently heated briefly and a magnetic field is applied. This moves the first PNA 3 toward the solid phase D. The PNA 3 hybridizes with the second PNA 5 which has been released from the third PNA 7 by the heat pulse. The hybridization results in a fluorescence reaction. After detection thereof by a suitable fluorescence detector, the magnetic field is reversed where appropriate and thus the detection process is terminated.
Fig. 7 a and b show a second embodiment of a 20 [sic]
detector. In this case, the second PNA 5 and the third PNA 7 are provided on one and the same nucleotide strand. Hybridization of the second PNA 5 with the third PNA 7 leads to formation of a loop. The first fluorophoric molecule 6 [lacuna] the quencher 8 develop an interaction. In the example shown in Fig. 8 a, the second PNA 5 is provided on one branch and the third PNA 7 is provided on another branch of a branched molecule. Fig. 9 a once again shows the previously described design of the detector in which the second PNA 5 and the third PNA 7 are bound on two separate strands to the solid phase D.
Fig. 7b, 8b and 9b each show the hybridization state.
Fig. l0a shows another examplary embodiment. In this case, the second PNA 5 is directly bound by its 3' end to the solid phase D. The first fluorophoreic molecule 6 is located at the 5' end. The third PNA 7 is bound by its 5' end directly to the solid phase D. In this case, a second fluorophoreic molecule 8 is located at the 3' end of the third PNA 7. In the case of hybridization, the second PNA 5 and the third PNA 7 bind to the first PNA 3 in such a way that a spatial relation between the REPLACEMENT SHEET (RULE 26) first 6 and the second fluorophoreic molecule 8 results. In this examplary embodiment, according to the Forster effect, there is a nonradiative transfer of energy from the second 8 to the first fluorophoreic molecule 6 and thus an enhanced fluorescence reaction.
Example 1:
Design and synthesis of a tag nucleotide and a detector nucleotide An oligonucleotide consisting of 32 nucleotides and having the following sequence is synthesized as tagging means:
5'-CCAAGC CTGGAGGGATGATACTTT GCGCTTGG-3' An oligonucleotide consisting of 32 nucleotides and complementary to the sequence of the tagging means or nucleotide is synthesized as detection means:
3'-X-GGTTCG GACCTCCCTACTATGAAACG CC~hACC-6FAM-5' X = dT(C2-DABCYL) The synthesis mixture comprises 0.2 ~mol. The oligonucleotides are purified by HPLC.
The six terminal nucleotides within an oligonucleotide are complementary to one another. It would therefore be possible for these nucleotides to undergo folding back.
GACCTCCCT
3'-X-GGTTCG
5' -6FA~t-CCAAGC C
GCAAAGTAT
REPLACEI~NT SHEET (RULE 26) In this folding back, the 5'-6FAM group on the detector nucleotide is in the immediate neighborhood of the 3'-DABCYL group. With appropriate excitation of the 6FAM group (absorption maximum 496 nm, emission maximum 516 nm come [sic]), nonradiative energy transfer of the absorbed energy to the DABCYL group can occur. The fluorescence of the 6FAM group is greatly reduced thereby in this state.
When the detector means or nucleotide is brought together with the tag nucleotide there is hybridization of the complementary sequences of the two molecules:
5'-CCA AGC CTG GAG GGA TGA TAC TTT GCG CTT GG-3' 3'-X-GGT TCG GAC CTC CCT ACT ATG AAA CGC GAA CC-6FAM-5' In the hybridized structure, the 5'-6FAM is spatially separate from the 3'-X group of the detector nucleotide. This means that energy transfer between the 6FAM and the DABCYL group is no longer possible. With appropriate excitation of the 6FAM group, accordingly, there is unimpaired fluorescence of the 6FAM group.
To detect a fluorescence energy transfer, detector nucleotide and tag nucleotide are dissolved in 10 mM
tris-C1, 1 mM EDTA, pH 8 (TE) . To 100 ~1 of a 1 ~,tM
solution of the detector nucleotide are added the same volume of a 2 ~tM solution of the tag nucleotide or the same volume of TE. To detect the hybridization, the fluorescence of the solution is determined with excitation at 496 nm and emission at 516 nm. Mixing the nucleotides causes the fluorescence to increase by a factor of about nine (Fig. 11). The increase in the fluorescence shows the augmentation of the intramolecular fluorescence energy transfer of the detector nucleotide because of a hybridization of detector nucleotide and tag nucleotide.
REPLACEMENT SHEET (RULE 2 6 ) Example 2:
Determination of detection sensitivity of hybrids of detector nucleotides and tag nucleotides To determine the detection sensitivity of hybrids of detector nucleotides and tag nucleotides, the fluorescence of a decreasing concentration series of hybrids of tag nucleotide and detector nucleotide is measured. This is done by placing drops, each with a volume .of 1 ~l, of a 1 N.M solution of the tag nucleotide on a slide . The same volume of a decreasing concentration series of the detector nucleotide is added to each drop. The concentrations of detector nucleotide are 1000, 500, 200, 100, 50, 20, 10, 5, 0 nM. To determine the background, the same concentration series of the detector nucleotide are added to 1 ~1 portions of TE. The samples are examined under a fluorescence microscope using a FAM-specific filter block with 500 x magnification.
It was still possible to detect a specific fluorescence owing to the hybridization of detector nucleotide and tag nucleotide after addition of a detector nucleotide solution with a concentration of 5 nM to the tag nucleotide solution. Without tag nucleotide, the fluorescence of the detector nucleotide was visible as far as a concentration of 50 nM.
Example 3:
Hybridization of tag nucleotide and detector nucleotide in the dry state To detect a hybridization of tag nucleotide and detector nucleotide in the dry state, a 1 ~tm solution of the tag nucleotide in TE is prepared. In addition, 4,6-diamidino-2-phenylindoles (DAPI) in a concentration of 2ng/~.l is added to the solution for visualization of the tag nucleotide. DAPI is a dye which binds DNA and REPLACEMENT SHEET (RULE 2 6 fluoresces in the bound state. The fluorescence of DAPI
can be separated by appropriate filters from the fluorescence of the FAM group and be detected.
1 ~l of the tag nucleotide solution is applied with a 2 ~1 pipette in the form of lines to a polished slide.
The liquid is dried at room temperature. Fig. 12 a shows a slide coated in this way. The tag nucleotide is evident in the form of the pale areas. On a second slide, 5 ~1 of a 20 nM solution of the detector nucleotide is applied on an area of about 40 mmz and likewise left to stand at room temperature until dry.
The slides are then laid one on top of another with the sides carrying the tag nucleotides and pressed together with a pressure of about 400 N/cm2 for one minute. The slides are then examined under a fluorescence microscope with 500 x magnification. The applied tag nucleotide can be detected on the basis of the DAPI
stain. The detector nucleotide is undetectable in the nonhybridized state. In the hybridized state, the detector nucleotide can be detected on the basis of the FAM-specific fluorescence. The fluorescence of the detector nucleotide can be observed only in the region of the applied tag nucleotide (Fig. 12 b). The observed fluorescence of the detector nucleotide in the region of the applied tag nucleotide is a demonstration of the hybridization of the tag nucleotide with the detector nucleotide.
REP7~ACEMENT SHEET (RUDE 2 6 ) List of reference numbers 1. Solid 2 Spacer molecule 3 First PNA
4 Magnetic group 5 Second PNA
6 First fluorophoreic molecule 7 Third PNA
8 _Second fluorophoreic molecule or quencher D Solid phase REP?~ACEMENT SHEET (RUDE 2 6
Claims (20)
1. Method for identifying a tag provided on a solid (1), which tag has a first nucleotide sequence (3) bound to the solid, wherein the first nucleotide sequence (3) is brought into contact with a detection means, wherein the detection means has a solid phase (D) to which a second nucleotide sequence (5) corresponding to the first nucleotide sequence (3) is bound by its first end and wherein the second nucleotide sequence (5) has on the second end a first fluorophoric group (6), wherein the first (3) and the second nucleotide sequence (5) hybridize on being brought into contact, and wherein a fluorescence reaction is induced on hybridization of the first (3) and second nucleotide sequence (5).
2. Method according to any of the preceding claims, wherein, before or on being brought into contact, the first nucleotide sequence (3) is released from a hybridization with a third nucleotide sequence (7).
3. Method according to any of the preceding claims, wherein the first nucleotide sequence (5) [sic]
is, on being brought into contact, moved by the action of a magnet toward the detection means.
is, on being brought into contact, moved by the action of a magnet toward the detection means.
4. Method according to any of the preceding claims, wherein a protective layer covering the first nucleotide sequence (3) is removed before the being brought into contact.
5. Method according to any of the preceding claims, wherein the tag is heated to a temperature of more than 50°C before the being brought into contact.
6. Method according to any of the preceding claims, wherein the tag is cooled to a temperature of less than 50°C after the being brought into contact.
7. Method according to any of the preceding claims, wherein the hybridization between the first (3) and the second nucleotide sequence (5) is assisted by the action of light of a predetermined wavelength.
8. Device for identifying a tag provided on a solid (1), which tag has a first nucleotide sequence (3) bound to the solid, using a detection means which has a second nucleotide sequence (5) corresponding to the first nucleotide sequence (3), wherein the second nucleotide sequence (5) is bound by its first end to a solid phase (D) and has on the second end a first fluorophoric group (6), so that the first (3) and the second nucelotide sequence (5) hybridize when the detection means comes into contact with the tag, and a fluorescence reaction can be induced on hybridization of the first (3) and the second nucleotide sequence (5).
9. Device according to Claim 8, wherein a first end of the first nucleotide sequence is bound via spacer molecules (2) covalently to the solid (1).
10. Device according to either of Claims 8 or 9, wherein a magnetic means (4) is bound to a second end of the first nucleotide sequence (3).
11. Device according to any of Claims 8 to 10, wherein the detection means comprises a magnet.
12. Device according to any of Claims 8 to 11, wherein the first end of the second nucleotide sequence (5) is bound via spacer molecules (2) to the solid phase (D).
13. Device according to any of Claims 8 to 12, wherein the detection means has a third nucleotide sequence (7) which is designed to correspond at least in sections to the first (3) or second nucleotide sequence (5).
14. Device according to Claim 13, wherein a first end of the third nucleotide sequence (7) is bound via spacer molecules (2) to the solid phase (D).
15. Device according to either of Claims 13 or 14, wherein a second fluorophoric group or a quencher is provided on a second end of the third nucleotide sequence.
16. Device according to any of Claims 13 to 15, wherein the second and the third nucleotide sequence are in the hybridized state for the identification, so that an interaction can develop between the first fluorophoric molecule and the second fluorophoric molecule or the quencher or can be interrupted.
17. Device according to any of Claims 13 to 16, wherein the first (3), second (5) and third nucleotide sequence (7) is formed from DNA or PNA.
18. Device according to any of Claims 8 to 17, wherein a layer produced from water-binding substances is provided on the surface of the solid phase.
19. Device according to any of Claims 8 to 18, wherein the detector means has a light source and/or a fluorescence detector.
20. Device according to any of Claims 18 to 19, wherein the detector means has a unit for generating a heat pulse, preferably an IR laser, NMR, microwave or ultrasonic pulse.
SEQUENCE PROTOCOLS
<110> november AG Novus Medicatus Bertling Gsellschaft [sic] für Molekulare Medium <120> Method and device for identifying a tag <130> 380293qa5 <140>
<141>
<160> 2 <170> PatentIn Ver. 2.1 <210> 1 <211> 32 <212> DNA
<213> human <400> 1 ccaagcctgg agggatgata ctttgcgctt gg 32 <210> 2 <211> 32 <212> DNA
<213> human <400> 1 ccaagcgcaa agtatcatcc ctccaggctt gg 32
SEQUENCE PROTOCOLS
<110> november AG Novus Medicatus Bertling Gsellschaft [sic] für Molekulare Medium <120> Method and device for identifying a tag <130> 380293qa5 <140>
<141>
<160> 2 <170> PatentIn Ver. 2.1 <210> 1 <211> 32 <212> DNA
<213> human <400> 1 ccaagcctgg agggatgata ctttgcgctt gg 32 <210> 2 <211> 32 <212> DNA
<213> human <400> 1 ccaagcgcaa agtatcatcc ctccaggctt gg 32
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE19811730A DE19811730A1 (en) | 1998-03-18 | 1998-03-18 | Identifying marker that indicates presence of immobilized nucleic acid using fluorophore-labeled detection agent bound to solid phase |
| DE19811730.2 | 1998-03-18 | ||
| PCT/DE1999/000729 WO1999047702A2 (en) | 1998-03-18 | 1999-03-16 | Method and device for identifying a tag |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2324261A1 true CA2324261A1 (en) | 1999-09-23 |
Family
ID=7861306
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002324261A Abandoned CA2324261A1 (en) | 1998-03-18 | 1999-03-16 | Method and device for identifying a tag |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1064409B1 (en) |
| JP (1) | JP2002506656A (en) |
| AT (1) | ATE228173T1 (en) |
| CA (1) | CA2324261A1 (en) |
| DE (2) | DE19811730A1 (en) |
| WO (1) | WO1999047702A2 (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000077248A1 (en) * | 1999-06-15 | 2000-12-21 | november Aktiengesellschaft Gesellschaft für Molekulare Medizin | Device and method for storing information |
| DE10000629C5 (en) * | 2000-01-10 | 2010-06-02 | november Aktiengesellschaft, Gesellschaft für Molekulare Medizin | Method of identifying a label applied to a solid |
| DE10042461C2 (en) | 2000-08-29 | 2002-11-07 | November Ag Molekulare Medizin | Method for counterfeit-proof marking of objects and counterfeit-proof marking |
| DE10105339B4 (en) * | 2001-02-05 | 2004-05-13 | november Aktiengesellschaft Gesellschaft für Molekulare Medizin | Counterfeit-proof marking method, counterfeit-proof marking and kit |
| DE10137484C1 (en) | 2001-08-03 | 2002-10-31 | Siemens Ag | Marking identification method uses detection of fluorescence after bringing detector material into contact with marking material to be identified |
| WO2003016073A1 (en) | 2001-08-16 | 2003-02-27 | november Aktiengesellschaft Gesellschaft für Molekulare Medizin | Forgery-proof marking for objects and method for identifying such a marking |
| DE10155053B4 (en) * | 2001-11-09 | 2005-11-24 | Friz Biochem Gesellschaft Für Bioanalytik Mbh | Reversible binding of a fluorophore to a surface to detect ligate-ligand association events by fluorescence quenching |
| DE102005050094A1 (en) | 2005-10-18 | 2007-04-19 | Identif Gmbh | Colored effect pigment with layer of discrete metal particles, process for its preparation and its use |
| JP7035972B2 (en) * | 2018-11-09 | 2022-03-15 | 横河電機株式会社 | Device for measuring nucleic acid sequences |
| JP2021097648A (en) * | 2019-12-23 | 2021-07-01 | 横河電機株式会社 | Nucleic acid sequence measurement device and nucleic acid sequence measurement method |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4996143A (en) * | 1985-12-23 | 1991-02-26 | Syngene, Inc. | Fluorescent stokes shift probes for polynucleotide hybridization |
| EP0601889A2 (en) * | 1992-12-10 | 1994-06-15 | Maine Medical Center Research Institute | Nucleic acid probes |
| US5925517A (en) * | 1993-11-12 | 1999-07-20 | The Public Health Research Institute Of The City Of New York, Inc. | Detectably labeled dual conformation oligonucleotide probes, assays and kits |
| US5538848A (en) * | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| US5654419A (en) * | 1994-02-01 | 1997-08-05 | The Regents Of The University Of California | Fluorescent labels and their use in separations |
| JP3448090B2 (en) * | 1994-02-16 | 2003-09-16 | 浜松ホトニクス株式会社 | Energy transfer detection method and apparatus |
| ES2354902T3 (en) * | 1996-06-04 | 2011-03-21 | University Of Utah Research Foundation | APPARATUS TO CARRY OUT THE PCR AND MONITORING OF THE REACTION IN REAL TIME DURING TEMPERATURE CYCLES. |
| US5736333A (en) * | 1996-06-04 | 1998-04-07 | The Perkin-Elmer Corporation | Passive internal references for the detection of nucleic acid amplification products |
| JP3016759B2 (en) * | 1997-02-28 | 2000-03-06 | スミスクライン・ビーチャム・コーポレイション | Fluorescent energy transfer by competitive hybridization |
| US5935791A (en) * | 1997-09-23 | 1999-08-10 | Becton, Dickinson And Company | Detection of nucleic acids by fluorescence quenching |
-
1998
- 1998-03-18 DE DE19811730A patent/DE19811730A1/en not_active Ceased
-
1999
- 1999-03-16 JP JP2000536885A patent/JP2002506656A/en not_active Withdrawn
- 1999-03-16 WO PCT/DE1999/000729 patent/WO1999047702A2/en active IP Right Grant
- 1999-03-16 AT AT99920549T patent/ATE228173T1/en not_active IP Right Cessation
- 1999-03-16 EP EP99920549A patent/EP1064409B1/en not_active Expired - Lifetime
- 1999-03-16 CA CA002324261A patent/CA2324261A1/en not_active Abandoned
- 1999-03-16 DE DE59903466T patent/DE59903466D1/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| DE59903466D1 (en) | 2003-01-02 |
| DE19811730A1 (en) | 1999-09-23 |
| EP1064409B1 (en) | 2002-11-20 |
| EP1064409A2 (en) | 2001-01-03 |
| WO1999047702A3 (en) | 1999-11-04 |
| ATE228173T1 (en) | 2002-12-15 |
| WO1999047702A2 (en) | 1999-09-23 |
| JP2002506656A (en) | 2002-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5688648A (en) | Probes labelled with energy transfer coupled dyes | |
| CA2295333C (en) | Assaying nucleotides in solution using a fluorescent intensity quenching effect | |
| JP4740111B2 (en) | Methods and compositions for detecting and analyzing polynucleotide binding protein interactions using light collecting multichromophores | |
| EP0635069B1 (en) | Probe method and composition for detecting different dna sequences | |
| US5470705A (en) | Probe composition containing a binding domain and polymer chain and methods of use | |
| US6046004A (en) | Solution hybridization of nucleic acids with antisense probes having modified backbones | |
| AU717018B2 (en) | Cyanine dyes with high-absorbance cross section as donor chromophores in energy transfer labels | |
| JP2678597B2 (en) | Method for electrophoretically detecting separated oligonucleotides | |
| EA007653B1 (en) | Methods and compositions for detection and analysis of polynucleotides using light harvesting multichromophores | |
| CN1784590B (en) | Optically decodable microcarriers,arrays and methods | |
| JPH11512617A (en) | Method, apparatus and kit for hybridization analysis using peptide nucleic acid probe | |
| CN105555971B (en) | Probe for improving molten chain resolution and multiplicity in nucleic acid determination | |
| WO2005005666A1 (en) | Detection of target molecules through interaction with probes | |
| CA2324261A1 (en) | Method and device for identifying a tag | |
| CN107074904A (en) | Signal bondage is sequenced（SCS）With the nucleotide analog being sequenced for signal bondage | |
| JP3992079B2 (en) | Nucleic acid analysis probe and detection method | |
| Mao et al. | Benzothioxanthene dyes as fluorescent label for DNA hybridization: synthesis and application | |
| US7964355B2 (en) | Assays based on detection of photobleaching reaction products from dye catalytic complex | |
| Shahmuradyan | Towards Fluorescence Resonance Energy Transfer Based Detection of Nucleic Acid Hybridization using Intrinsically Labeled Fluorescent Oligonucleotide Probes as Acceptors and Quantum Dots as Donors | |
| EP4323547A1 (en) | High-resolution whole genome imaging by nucleic acid locus and block coding | |
| Huang | Excimer molecular beacon | |
| Paris | Part I. Circular DNAs as switchable DNA-binding agents. Part II. Highly selective and sensitive oligonucleotide probes | |
| JP2003194824A (en) | Fluorescent material and fluorescent labeling method | |
| Brown | Development of novel fluorescent oligonucleotide probes for use in nucleic acid sequence analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued |