CA2324228A1 - Genes coding for flavone synthases - Google Patents

Abstract

DNA obtained, for example, from perilla, encoding an enzyme that can convert flavanones directly to flavones, and its uses; the DNA and amino acid sequences for the enzyme encoded thereby are listed as SEQ.ID. No. 1 & 2. Introduction of the gene into plants can, for example, alter the flower colors of the plants.

Description

DESCRIPTION
GENES CODING FOR FLAVONE SYNTHASES
Technical Field The present invention relates to the control and utilization of biosynthesis of flavones, which have effects on flower color, protection from ultraviolet ray, symbiosis with microorganisms, etc. in plants, by a genetic engineering technique. More specifically, it relates to genes encoding proteins with activity of synthesizing flavones from flavanones, and to their utilization.
Background Art The abundance of different flower colors is one of the pleasant aspects of life that enriches human minds and hearts. It is expected to increase food production to meet future population increase by the means of accelerating the growth of plants through symbiosis with microorganisms, or by increasing the number of nitrogen-fixing leguminous bacteria, thus improving the plant productivity as a result of increasing the content of nitrogen in the soil. Elimination or reduction of the use of agricultural chemicals is also desirable to achieve more environmentally friendly agriculture, and this requires improvement of the soil by the above-mentioned biological means, as well as higher resistance of plants against microbial infection. Another desired goal is to obtain plants with high protective functions against ultraviolet rays as a means of protecting the plants from the destruction of the ozone layer.
"Flavonoid" is a general term for a group of compounds with a C6-C3-C6 carbon skeleton, and they are widely distributed throughout plant cells. Flavonoids are known to have such functions as attracting insects and other pollinators, protecting plant from ultraviolet rays, and participating in interaction with soil microorganisms (BioEssays, 16 (1994), Koes at al., p.123;

Trends in Plant Science, 1 (1997), Shirley, B.W., p.377).
Of flavonoids, flavone plays an important role in interaction of plants with microorganisms, especially in legumes, where they participate in the initial steps of the symbiosis with leguminous bacteria (Plant Cell, 7 (1995), Dixon and Paiva, p.1085; Annu. Rev. Phytopathol., 33 (1995), Spaink, p.345). Flavones in petals play a role in recognition by insects and act as copigments which form complexes with anthocyanins. (Gendai Kagaku, (May, 1998), Honda and Saito, p.25; Prog. Chem. Org.
Natl. Prod., 52 (1987), Goto, T., p.114). It is known that when flavone forms a complex with anthocyanin, the absorption maximum of the anthocyanin shifts toward the longer wavelength, i.e. toward blue.
The biosynthesis pathways for flavonoids have been widely studied (Plant Cell, 7 (1995), Holton and Cornish, p.1071), and the genes for all of the enzymes involved in the biosynthesis of anthocyanidin 3-glucoside and flavonol, for example, have been isolated. However, the genes involved in the biosynthesis of flavones have not yet been isolated. The enzymes that synthesize flavones include those belonging to the dioxygenase family (flavone synthase I) that depends on 2-oxoglutaric acid and monooxygenase enzymes belonging to the cytochrome P450 family (flavone synthase II). These groups of enzymes are completely different enzymes with no structural homology.
It has been reported that in parsley, 2-oxoglutaric acid-dependent dioxygenase catalyzes a reaction which produces apigenin, a flavone, from naringenin, a flavanone (Z. Naturforsch., 36c (1981), Britsch et al., p.742; Arch. Biochem. Biophys., 282 (1990), Britsch, p.152). The other type, flavone synthase II, is known to exist in snapdragon (Z. Naturforsch., 36c (1981), Stotz and Forkmann, p.737) and soybean (Z. Naturforsch., 42c (1987), Kochs and Grisebach, p.343; Planta, 171 (1987), Kochs et al., p.519). A correlation has been recently reported between a gene locus and flavone synthase II
activity in the petals of gerbera (Phytochemistry, 49 (1998), Martens and Forkmann, p.1953). However, there are no reports that the genes for these flavone synthases I and II were isolated or that flavone synthase II was highly purified.
The properties of a cytochrome P450 protein, which had licodione-synthesizing activity that was induced when cultured cells of licorice (Glycyrrhiza echinata) were treated with an elicitor, were investigated. The protein is believed to catalyze the hydroxylation of 2-position of liquiritigenin which is a 5-deoxyflavanone, followed by non-enzymatic hemiacetal ring opening to produce licodione (Plant Physiol., 105 (1994), Otani et al., p.1427). For cloning of licodione synthase, a cDNA
library was prepared from elicitor-treated Glycyrrhiza cultured cells, and 8 gene fragments encoding cytochrome P450 were cloned (Plant Science, 126 (1997), Akashi et al., p.39).
From these fragments there were obtained two different full-length cDNA sequences, each encoding a cytochrome P450, which had been unknown until that time.
Specifically, they were CYPGe-3 (cytochrome P450 No.CYP81E1) and CYPGe-5 (cytochrome P450 No.CYP93B1, hereinafter indicated as CYP93B1) (Plant Physiol., 115 (1997), Akashi et al., p.1288). By further expressing the CYP93B1 cDNA in a system using cultured insect cells, the protein derived from the gene was shown to catalyze the reaction synthesizing licodione from liquiritigenin, a flavanone, and 2-hydroxynaringenin from naringenin, also a flavanone.
2-Hydroxynaringenin was converted to apigenin, a flavone, by acid treatment with 10~ hydrochloric acid (room temperature, 2 hours). Also, eriodictyol was converted to luteolin, a flavone, by reacting eriodictyol with microsomes of CYP93B1-expressing yeast followed by acid treatment. It was therefore demonstrated that the cytochrome P450 gene encodes the function of flavanone 2-hydroxylase activity (FEBS Lett., 431 (1998), Akashi et al., p.287). Here, production of apigenin from naringenin required.CYP93B1 as well as another unknown enzyme, so that it was concluded that a total of two enzymes were necessary.
However, no genes have yet been identified for enzymes with activity of synthesizing flavones (such as apigenin) directly from flavanones (such as naringenin) without acid treatment. Thus, despite the fact that flavones have numerous functions in plants, no techniques have yet been reported for controlling their biosynthesis in plants, and improving the biofunctions in which flavones are involved, such as flower color. The discovery of an enzyme which by itself can accomplish synthesis of flavones from flavanones and acquisition of its gene, and introduction of such a gene into plants, would be more practical and industrially applicable than the introduction into a plant of genes for two enzymes involved in the synthesis of flavones from flavanones.
Disclosure of the Invention It is an aim of the present invention to provide flavone synthase genes, preferably flavone synthase II
genes, and more preferably genes for flavone synthases with activity of synthesizing flavones directly from flavanones. The obtained flavone synthase genes may be introduced into plants and over-expressed to alter flower colors.
Moreover, in the petals of flowers that naturally contain large amounts of flavones, it is expected that controlling expression of the flavone synthase genes by an antisense method or a cosuppression method can also alter flower colors. Also, expression of the flavone synthase genes in the appropriate organs, in light of the antibacterial activity of flavones and their interaction with soil microorganisms, will result in an increase in the antibacterial properties of plants and improvement in the nitrogen fixing ability of legumes due to promoted symbiosis with rhizosphere microorganisms, as well as a protective effect against ultraviolet rays and light.
The present invention therefore provides genes encoding proteins that can synthesize flavones directly from flavanones. The genes are, specifically, genes encoding flavone synthase II that can synthesize flavones from flavanones by a single-enzyme reaction (hereinafter referred to as "flavone synthase II").
More specifically, the present invention provides genes encoding P450 proteins having the amino acid sequences listed as SEQ.ID. No. 2 of the Sequence Listing and possessing activity of synthesizing flavones from flavanones, or genes encoding proteins having amino acid sequences modified by additions or deletions of one or more amino acids and/or a substitution with different amino acids in said amino acid sequence, and possessing activity of synthesizing flavones from flavanones.
The invention further provides a gene encoding proteins having amino acid sequences with at least 55$
identity with the amino acid sequences listed as SEQ.ID.
No. 2 of the Sequence Listing and possessing activity of synthesizing flavones from flavanones.
The invention still further provides genes encoding proteins possessing activity of synthesizing flavones from flavanones, and hybridizing with all or a part of the nucleotide sequences listed as SEQ.ID. No. 1 of the Sequence List under the conditions of 5 x SSC, 50°C.
The invention still further provides a vector, particularly an expression vector, containing any one of the aforementioned genes.
The invention still further provides a host transformed with the aforementioned vector.
The invention still further provides a protein encoded by any of the aforementioned genes.
The invention still further provides a process for producing the aforementioned protein which is characterized by culturing or growing the aforementioned host, and collecting the protein with flavone-synthesizing activity from the host.
The invention still further provides a plant into which any one of the aforementioned genes has been introduced, or progenies of the plant or a tissue thereof, such as cut flowers, which exhibit the same properties.
The invention still further provides a method of altering amounts and compositions of flavonoid using the aforementioned genes; a method of altering amounts of flavones using the aforementioned genes; a method of altering flower colors using the aforementioned genes; a method of bluing the color of flowers using the aforementioned genes; a method of reddening the color of flowers using the aforementioned genes; a method of modifying the photosensitivity of plants using the aforementioned genes; and a method of controlling the interaction between plants and microbes using the aforementioned genes.
Embodiments for Carrying out the Invention Flavanone 2-hydroxylase encoded by the Glycyrrhiza CYP93B1 gene produces 2-hydroxyflavanones from flavanones as the substrates, and the products are converted to flavones by acid treatment. The present inventors viewed that it would be possible to obtain a gene encoding a flavone synthase II, which was an object of the invention, by using the Glycyrrhiza-derived cDNA, CYP93B1 for screening of a cDNA library of, for example, a flower containing a large amount of flavones, to thus obtain cDNA encoding proteins with activity of synthesizing flavones directly from flavanones as substrates.
According to the invention, a cDNA library of perilla which contains a large amount of flavones is screened using the Glycyrrhiza-derived cDNA, CYP93B1 as a probe, to obtain cDNA encoding a novel cytochrome P450 (see Example 1).

The perilla-derived cDNA was expressed in yeast and reacted with naringenin, a flavanone, as a substrate which resulted in production not of 2-hydroxynaringenin but rather of the flavone apigenin, without acid treatment (see Example 2). In other words, this enzyme directly produced flavones from flavanones without acid treatment, and its gene was confirmed to be a flavone synthase II which had never been cloned.
The genes of the present invention may be, for example, one encoding the amino acid sequence listed as SEQ.ID. No. 2 of the Sequence Listing. However, it is known that proteins whose amino acid sequences are modified by additions or deletions of multiple amino acids and/or substitutions with different amino acids can maintain the same enzyme activity as the original protein. Consequently, proteins having the amino acid sequence listed as SEQ.ID. No. 2 of the Sequence Listing wherein the amino acid sequence is modified by additions or deletions of one or more amino acids and/or substitutions with different amino acids, and gene s encoding those proteins, are also encompassed by the present invention so long as they maintain the activity of producing flavones directly from flavanones.
The present invention also relates to genes that have the nucleotide sequence listed as SEQ.ID. No. 1 and nucleotide sequence encoding the amino acid sequences listed therein, or that hybridize with portions of the nucleotide sequence under conditions of 5 x SSC, 50°C, for example, providing they encode proteins possessing activity of producing flavones from flavanones. The suitable hybridization temperature will differ depending on nucleotide sequences and the length of nucleotide sequences, and for example, when the probe used is a DNA
fragment comprising 18 bases coding for 6 amino acids, the temperature is preferably not higher than 50°C.
A gene selected by such hybridization may be a naturally derived one, such as a plant-derived gene, for _ g _ example, a gene derived from snapdragon, torenia or perilla; it may also be a gene from another plant, such as gentian, verbena, chrysanthemum, iris, or the like. A
gene selected by hybridization may be cDNA or genomic DNA.
The invention also relates to genes encoding proteins that have amino acid sequences with identity of at least 55~, preferably at least 70~, such as 80~ or greater and even 90~ or greater, with the amino acid sequence listed as SEQ.ID. No. 2 of the Sequence Listing, and that possess activity of synthesizing flavones from flavanones.
A gene with the natural nucleotide sequence can be obtained by screening of a cDNA library, for example, as demonstrated in detail in the examples. DNA encoding enzymes with modified amino acid sequences can be synthesized using common site-directed mutagenesis or a PCR method, using DNA with a natural nucleotide sequence as a starting material. For example, a DNA fragment into which a modification is to be introduced may be obtained by restriction enzyme treatments of natural cDNA or genomic DNA and then used as a template for site-directed mutagenesis or PCR using a primer having the desired mutation introduced therein, to obtain a DNA fragment having the desired modification introduced therein.
Mutation-introduced DNA fragments may then be linked to a DNA fragment encoding another portion of a target enzyme.
Alternatively, in order to obtain DNA encoding an enzyme consisting of a shortened amino acid sequence, for example, DNA encoding an amino acid sequence which is longer than the aimed amino acid sequence, such as the full length amino acid sequence, may be cut with desired restriction endonucleases, and if the DNA fragment obtained thereby does not encode the entire target amino acid sequence, it may be linked with synthesized DNA
comprising the rest of the sequence.
Thus obtained genes may be expressed in an _ 9 _ expression system using E. coli or yeast and its enzyme activity measured to confirm that the obtained gene encodes flavone synthase. By expressing the gene, it is also possible to obtain the flavone synthase protein as the gene product. Alternatively, it is also possible to obtain a flavone synthase protein even using antibodies for a full or a partial amino acid sequence listed as SEQ.ID. No. 2, and such antibodies may be used for cloning of a flavone synthase gene in another organism.

Consequently, the invention also relates to recombinant vectors, and especially expression vectors, containing the aforementioned genes, and to hosts transformed by these vectors. The hosts used may be prokaryotic or eukaryotic organisms. Examples of prokaryotic organisms that may commonly be used as hosts include bacteria belonging to the genus Escherichia, such as Escherichia coli, and microorganisms belonging to the genus Bacillus, such as Bacillus subtilis.

Examples of eukaryotic hosts that may be used include lower eukaryotic organisms, for example, eukaryotic microorganisms, for example, Eumycota such as yeast and filamentous fungi. As yeast there may be mentioned microorganisms belonging to the genus Saccharomyces, such as Saccharomyces cerevisiae, and as filamentous fungi there may be mentioned microorganisms belonging to the genus Aspergillus, such as Aspergillus oryzae and Aspergillus niger and microorganisms belonging to the genus Penicillium. Animal cells and plant cells may also be used, the animal cells being cell lines from mice, hamsters, monkeys or humans. Insect cells, such as silkworm cells, or the adult silkworms themselves, may also be used.

The expression vectors of the invention will include expression regulating regions such as a promoter and a terminator, a replication origin, etc., depending on the type of hosts into which they are to be introduced.

Examples of promoters for bacterial expression vectors which may be used include conventional promoters such as trc promoter, tac promoter, lac promoter, etc., examples of yeast promoters that may be used include glyceraldehyde-3-phosphate dehydrogenase promoter, PH05 promoter, etc., and examples of filamentous fungi promoters that may be used include amylase promoter, trpC, etc. Examples of animal cell host promoters that may be used include viral promoters such as SV40 early promoter, SV40 late promoter, etc.

The expression vector may be prepared according to a conventional method using restriction endonucleases, ligases and the like. The transformation of a host with an expression vector may also be carried out according to conventional methods.

The hosts transformed by the expression vector may be cultured, cultivated or raised, and the target protein may be recovered and purified from the cultured product, etc. according to conventional methods such as filtration, centrifugal separation, cell crushing, gel filtration chromatography, ion-exchange chromatography and the like.

The present specification throughout discusses flavone synthase II derived from perilla that is capable of synthesizing flavones directly from flavanones, and it r 25 is also known that the cytochrome P450 genes constitute a superfamily (DNA and Cell Biology, 12 (1993), Nelson et al., p.l) and that cytochrome P450 proteins within the same family have 40~ or greater identity in their amino acid sequences while cytochrome P450 proteins within a subfamily have 55~ or greater identity in their amino acid sequences, and their genes hybridize to each other (Pharmacogenetics, 6 (1996), Nelson et al., p.l).

For example, a gene for flavonoid 3',5'-hydroxylase, which was a type of cytochrome P450 and participated in the pathway of flavonoid synthesis, was first isolated from petunia (Nature, 366 (1993), Holton et al., p.276), and the petunia flavonoid 3',5'-hydroxylase gene was used as a probe to easily isolate a flavonoid 3',5'-hydroxylase gene from gentian (Plant Cell Physiol., 37 (1996), Tanaka et al., p.711), prairie-gentian, bellflower (W093/18155 (1993), Kikuchi et al.), lavender, torenia and verbena (Shokubutsu no Kagaku Chosetsu, 33 (1998), Tanaka et al., p.55).
Thus, a part or all of the flavone synthase II gene of the invention derived from perilla, which is capable of synthesizing flavones directly from flavanones, can be used as a probe, in order to obtain flavone synthase II
genes capable of synthesizing flavones directly from flavanones, from different species of plants.
Furthermore, by purifying the perilla-derived flavone synthase II enzymes described in this specification which can synthesize flavones directly from flavanones, and obtaining antibodies against the enzymes by conventional methods, it is possible to obtain different flavone synthase II proteins that react with the antibodies, and obtain genes coding for those proteins.
Consequently, the present invention is not limited merely to perilla-derived genes for flavone synthases II
capable of synthesizing flavones directly from flavanones, but further relates to flavone synthases II
derived from numerous other plants, which are capable of synthesizing flavones directly from flavanones. The sources for such flavone synthase II genes may be, in addition to perilla described here, also gentian, verbena, chrysanthemum, iris, commelina, centaurea, salvia, nemophila and the like, although the scope of the invention is not limited to these plants.
The invention still further relates to plants whose colors are modified by introducing a gene or genes for flavone synthases II that can synthesize flavones directly from flavanones, and to progenies of the plants or their tissues, which may also be in the form of cut flowers. By using the flavone synthases II or their genes which have been cloned according to the invention, it is possible to produce flavones in plant species or varieties that otherwise produce little or absolutely no flavones. By expressing the flavone synthase II gene or the genes in flower petals, it is possible to increase the amount of flavones in the flower petals, thus allowing the colors of the flowers to be modified toward the blue, for example.

Conversely, by repressing synthesis of flavones in flower petals, it is possible to madify the colors of the flowers toward the red, for example. However, flavones have myriad effects on flower colors, and the changes in flower colors are therefore not limited to those mentioned here. With the current level of technology, it is possible to introduce a gene into a plant and express the gene in a constitutive or tissue-specific manner, while it is also possible to repress the expression of a target gene by an antisense method or a cosuppression method.

As examples of transformable plants there may be mentioned rose, chrysanthemum, carnation, snapdragon, cyclamen, orchid, prairie-gentian, freesia, gerbera, gladiolus, baby's breath, kalanchoe, lily, pelargonium, geranium, petunia, torenia, tulip, rice, barley, wheat, rapeseed, potato, tomato, poplar, banana, eucalyptus, r 25 sweet potato, soybean, alfalfa, lupin, corn, etc., but there is no limitation to these.

Because flavones have various physiological _ activities as explained above, they can impart new physiological activity or economic value to plants. For example, by expressing the gene to produce flavones in roots, it is possible to promote growth of microorganisms that are beneficial for the plant, and thus promote growth of the plant. It is also possible to synthesize flavones that exhibit physiological activity in humans, animals or insects.

Examples The invention will now be explained in further detail by way of the following examples. Unless otherwise specified, the molecular biological methods were carried out according to Molecular Cloning (Sambrook et al., 1989).
Example 1. Cloning of perilla flavone synthase II
gene RNA was extracted from leaves of red perilla (Perilla frutescens), and polyA+ RNA was obtained by an Oligotex. This polyA+ RNA was used as a template to prepare a cDNA library using a ~.gt 10 (Stratagene) as the vector according to the method of Gong et al. (Plant Mol.
Biol., 35 (1997), Gong et al., p. 915). The cDNA library was screened using the full length CYP93B1 cDNA as the probe. The screening and detection of positive clones were carried out using a DIG-DNA-labeling and detection kit (Boehringer) based on the method recommended by the same company, under a low stringent condition.
Specifically, a hybridization buffer (5 x SSC, 30~
formamide, 50 mM sodium phosphate buffer (pH 7.0), l~
SDS, 2~ blocking reagent (Boehringer), 0.1~
lauroylsarcosine, 80 ug/ml salmon sperm DNA) was used for prehybridization at 42°C for 2 hours, after which the DIG-labeled probe was added and the mixture was kept overnight. The membrane was rinsed in 5 x SSC washing solution containing 1~ SDS at 65°C for 1.5 hours. One positive clone was obtained, and it was designated as a phase clone #3. Upon determining the nucleotide sequence at the 5' end of #3 cDNA it was expected that #3 cDNA
encodes a sequence with high identity with the flavanone 2-hydroxylase encoded by licorice CYP93B1, and it was assumed that it encoded a P450 with a function similar to that of flavanone 2-hydroxylase.
The protein encoded by #3 cDNA obtained here exhibited 52~ identity on the amino acid level with flavanone 2-hydroxylase encoded by CYP93B1. The nucleotide sequence of perilla clone #3 cDNA is listed as SEQ.ID. No. l, and the amino acid sequence deduced therefrom is listed as SEQ.ID. No.2.
Example 2. Expression of perilla flavone synthase II
gene in yeast The following experiment was conducted in order to detect the enzyme activity of the protein encoded by the perilla cDNA #3 obtained in Example 1.
The phage clone #3 obtained in Example 1 was used as a template for PCR using Lambda Arm primer (Stratagene).
The PCR conditions were 98°C for one minute, 20 cycles of (98°C for 15 seconds, 55°C for 10 seconds, 74°C for 30 seconds), followed by 74°C for 10 minutes. The amplified DNA fragment was subcloned at the EcoRV site of pBluescript KS(-). A clone with the initiation codon of the perilla #3 cDNA on the SalI side of pBluescript KS (-) was selected, and was designated as pFS3. The nucleotide sequence of the pFS3 cDNA was determined and the PCR was conducted to confirm the absence of errors.
An approximately 1.8 kb DNA fragment obtained by digesting pFS3 with SalI and XbaI was ligated with pYES2 predigested with XhoI and XbaI to produce a plasmid designated as pYFS3. The resultant plasmid was then introduced into BJ2168 yeast (Nihon Gene). The enzyme activity was measured by the method described by Akashi et al. (FEBS Lett., 431 (1998), Akashi et al., p.287).
The transformed yeast cells were cultured in 20 ml of selective medium (6.7 mg/ml amino acid-free yeast nitrogen base (Difco), 20 mg/ml glucose, 30 ~rg/ml leucine, 20 ug/ml tryptophan and 5 mg/ml casamino acid), at 30°C for 24 hours.
After harvesting the yeast cells with centrifugation, the harvested yeast cells were cultured at 30°C for 48 hours in an expressing medium (10 mg/ml yeast extract, 10 mg/ml peptone, 2 ug/ml hemin, 20 mg/ml galactose). After collecting the yeast cells, they were washed by suspending in water and collecting them. Glass beads were used for 10 minutes of disrupting the cells, after which the cells were centrifuged at 8000 x g for 10 minutes. The supernatant was further centrifuged at 15,000 x g for 10 minutes to obtain a crude enzyme fraction.
A mixture of 15 ug of (R,S)-naringenin (dissolved in 30 ul of 2-methoxyethanol), 1 ml of crude enzyme solution and 1 mM NADPH (total reaction mixture volume: 1.05 ml) was reacted at 30°C for 2 hours. After terminating the reaction by addition of 30 ul of acetic acid, 1 ml of ethyl acetate was added and mixed therewith. After centrifugation, the ethyl acetate layer was dried with an evaporator. The residue was dissolved in 100 ul of methanol and analyzed by HPLC. The analysis was carried out according to the method described by Akashi et al.
(FEES Lett., 431 (1998), Akashi et al., p. 287). The acid treatment involved dissolution of the evaporator-dried sample in 150 ul of ethanol containing 10~
hydrochloric acid, and stirring for 30 minutes. This was diluted with 1.3 ml of water, 800 ul of ethyl acetate was further added and mixed therewith, and after centrifugation, the ethyl acetate layer was recovered.
This was then dried, dissolved in 200 ul of methanol, and analyzed by HPLC.
The yeast expressing pYFS3 yielded apigPnin from naringenin without acid treatment of the reaction mixture. This demonstrated that perilla pFS3 cDNA _ encodes a protein with flavone synthase II activity.
Industrial Agplicabilitv It is possible to alter flower colors by linking cDNA of the invention to an appropriate plant expression vector and introducing it into plants to express or inhibit expression of flavone synthases. Furthermore, by expressing the flavone synthase genes not only in petals but also in entire plants or their appropriate organs, it is possible to increase the resistance agasint microorganisms of plants or to improve the nitrogen fixing ability of legumes by promoting association with rhizosphere microorganisms, as well as to improve the protective effects of plants against ultraviolet rays and light.
a f/6 SEQUENCE LISTING
<110> SUNTORY LIMITED
<120> Gene coding for flavone synthesizing enzyme <130>
<160> 2 <210> 1 <211> 1770 <212> DNA
<213> Perilla frutescens <220>
<223> Nucleotide sequence encoding a protein having an activity to directly convert flavanone to flavone <400> 1 tgtcgacgga gcaagtggaa 53 atg gca ctg tac gcc gcc ctc ttc ctc ctg tcc Met Ala Leu Tyr Ala Ala Leu Phe Leu Leu Ser gccgcc gtggtccgc tccgttctg gatcgaaaa cgcgggcgg ccgccc 101 AlaAla ValValArg SerValLeu AspArgLys ArgGlyArg ProPro taccct cccgggccg ttccctctt cccatcatc ggccactta cacctc 149 TyrPro ProGlyPro PheProLeu ProIleIle GlyHisLeu HisLeu ctcggg ccgagactc caccaaacc ttccacgat ctgtcccaa cggtac 197 LeuGly ProArgLeu HisGlnThr PheHisAsp LeuSerGln ArgTyr gggccc ttaatgcag ctccgcctc gggtccatc cgctgcgtc attget 245 GlyPro LeuMetGln LeuArgLeu GlySerIle ArgCysVal IleAla 2~6 gcc tcg ccggag ctcgccaag gaatgcctcaag acacac gagctcgtc 293 Ala Ser ProGlu LeuAlaLys GluCysLeuLys ThrHis GluLeuVal ttc tcc tcccgc aaacactcc accgccattgat atcgtc acctacgat 341 Phe Ser SerArg LysHisSer ThrAlaIleAsp IleVal ThrTyrAsp tca tcc ttcget ttctctccc tacgggccttac tggaaa ttcatcaag 389 Ser Ser PheAla PheSerPro TyrGlyProTyr TrpLys PheIleLys aaa tta tgcacc tacgagctg ctcggggcccga aatctc gcccacttt 437 Lys Leu CysThr TyrGluLeu LeuGlyAlaArg AsnLeu AlaHisPhe cag ccc atcagg actctcgaa gtcaagtctttc ctccaa attcttatg 485 Gln Pro IleArg ThrLeuGlu ValLysSerPhe LeuGln IleLeuMet cgc aag ggtgaa tcgggggag agcttcaacgtg actgag gagctcgtg 533 Arg Lys GlyGlu SerGlyGlu SerPheAsnVal ThrGlu GluLeuVal aag ctg acgagc aacgtcata tcgcatatgatg ctgagc atacggtgt 581 Lys Leu ThrSer AsnValIle SerHisMetMet LeuSer IleArgCys 175 leo 185 tca gag acggag tcggaggcg gaggcggcgagg acggtg attcgggag 629 Ser Glu ThrGlu SerGluAla GluAlaAlaArg ThrVal IleArgGlu gtc acg cagata tttggggag ttcgacgtctcc gacatc atatggctt 677 Val Thr GlnIle PheGlyGlu PheAspValSer AspIle IleTrpLeu tgt aag aacttc gatttccaa ggtataaggaag cggtcc gaggatatc 725 Cys Lys AsnPhe AspPheGln GlyIleArgLys ArgSer GluAspIle cag agg aga tat gat get ctg ctg gag aag atc atc acc gac aga gag 773 Gln Arg Arg Tyr Asp Ala Leu Leu Glu Lys Ile Ile Thr Asp Arg Glu aag cag agg cgg acc cac ggc ggc ggt ggc ggc ggc ggg gaa gcc aag 821 Lys Gln Arg Arg Thr His Gly Gly Gly Gly Gly Gly Gly Glu Ala Lys gat ttt cttgacatg ttcctcgac ataatg gagagcggg aaagccgaa 869 Asp Phe LeuAspMet PheLeuAsp IleMet GluSerGly LysAlaGlu gtt aaa ttcacgagg gagcatctc aaaget ttgattctg gatttcttc 917 Val Lys PheThrArg GluHisLeu LysAla LeuIleLeu AspPhePhe acc gcc ggcaccgac acgacggcg atcgtg tgtgaatgg gcgatagca 965 Thr Ala GlyThrAsp ThrThrAla IleVal CysGluTrp A1aIleAla gaa gtg atcaacaat ccaaatgtg ttgaag aaagetcaa gaagagatt 1013 Glu Val IleAsnAsn ProAsnVal LeuLys LysAlaGln GluGluIle gcc aac atcgtcgga ttcgacaga attctg caagaatcc gacgcccca 1061 Ala Asn IleValGly PheAspArg IleLeu GlnGluSer AspAlaPro aat ctg ccctacctt caagccctc atcaaa gaaacattc cggctccac 1109 Asn Leu ProTyrLeu GlnAlaLeu IleLys GluThrPhe ArgLeuHis cct cca atcccaatg ctggcgagg aaatcg atctccgac tgcgtcatc 1157 Pro Pro IleProMet LeuAlaArg LysSer IleSerAsp CysValIle gac ggc tacatgatt ccggccaac acgctg ctcttcgtc aacctctgg 1205 Asp Gly TyrMetIle ProAlaAsn ThrLeu LeuPheVal AsnLeuTrp tcc atg gggcggaac cctaaaatc tgggac tacccgacg gcgttccag 1253 Ser Met GlyArgAsn ProLysIle TrpAsp TyrProThr AlaPheGln ccg gag aggtttctg gagaaggaa aaggcc gccatcgat gttaaaggg 1301 Pro Glu ArgPheLeu GluLysGlu LysAla AlaIleAsp ValLysGly cag cat ttt gag ctg cta ccg ttc gga acg ggc agg aga ggc tgc cca 1349 Gln His Phe Glu Leu Leu Pro Phe Gly Thr Gly Arg Arg Gly Cys Pro ggg atg ctt tta gcc att cag gag gtg gtc atc ata att ggg acg atg 1397 Gly Met Leu Leu Ala Ile Gln Glu Val Val Ile Ile Ile Gly Thr Met ~ /6 att caa tgc ttc gat tgg ccc gac tcc ggc cat gtt gat 1445 aag ctg ggc Ile Gln Cys Phe Asp Trp Pro Asp Ser Gly His Val Asp Lys Leu Gly atg gca gaa cgg cca ggg gca ccg gag acc gat ttg ttt 1493 ctc acg cga Met Ala Glu Arg Pro Gly Ala Pro Glu Thr Asp Leu Phe Leu Thr Arg tgc cgt gtg gtg ccg cga ccg ttg gtt tcc acc cag 1538 gtt gat gtt Cys Arg Val Val Pro Arg Pro Leu Val Ser Thr Gln Val Asp Val tgatcacccc ctttaaattt attaatgatatatttttattttgagaaaaa ataaaaatgc1598 taattgtttt gtttcatgat gtaattgttaattagtttctattgtgcgct gtcgcgtgtc1658 gcgtggctta agataagatt gtatcattggtacctaggatgtattttcat tttcaataaa1718 ttattttgtg ctgtgtatat taaaaaaaaaaaagaaaaaaaaaaaaaaaa as 1770 <210> 2 <211> SOIL
<212> PRT
<213> Perilla frutescens <220>
<223> Amino acid sequence of a protein having an activity to directly convert flavanone to flavone <400> 2 Met Ala Leu Tyr Ala Ala Leu Phe Leu Leu Ser Ala Ala Val Val Arg ,,: Ser Val Leu Asp Arg Lys Arg Gly Arg Pro Pro Tyr Pro Pro Gly Pro Phe Pro Leu Pro Ile Ile Gly His Leu His Leu Leu Gly Pro Arg Leu His G1n Thr Phe His Asp Leu Ser Gln Arg Tyr Gly Pro Leu Met Gln Leu Arg Leu Gly Ser Ile Arg Cys Val Ile Ala Ala Ser Pro Glu Leu Ala Lys Glu Cys Leu Lys Thr His Glu Leu Val Phe Ser Ser Arg Lys His Ser Thr Ala Ile Asp Ile Val Thr Tyr Asp Ser Ser Phe Ala Phe Ser Pro Tyr Gly Pro Tyr Trp Lys Phe Ile Lys Lys Leu Cys Thr Tyr Glu Leu Leu Gly Ala Arg Asn Leu Ala His Phe Gln Pro Ile Arg Thr Leu Glu Val Lys Ser Phe Leu Gln Ile Leu Met Arg Lys Gly Glu Ser Gly Glu Ser Phe Asn Val Thr Glu Glu Leu Val Lys Leu Thr Ser Asn Val Ile Ser His Met Met Leu Ser Ile Arg Cys Ser Glu Thr Glu Ser Glu Ala Glu Ala Ala Arg Thr Val Ile Arg Glu Val Thr Gln Ile Phe Gly Glu Phe Asp Val Ser Asp Ile Ile Trp Leu Cys Lys Asn Phe Asp Phe Gln Gly Ile Arg Lys Arg Ser Glu Asp Ile Gln Arg Arg Tyr Asp Ala Leu Leu Glu Lys Ile Ile Thr Asp Arg Glu Lys Gln Arg Arg Thr His Gly Gly Gly Gly Gly Gly Gly Glu Ala Lys Asp Phe Leu Asp Met Phe Leu Asp Ile Met Glu Ser Gly Lys Ala Glu Val Lys Phe Thr Arg Glu His Leu Lys Ala Leu Ile Leu Asp Phe Phe Thr Ala Gly Thr Asp Thr Thr Ala Ile Val Cys Glu Trp Ala Ile Ala Glu Val Ile Asn Asn Pro Asn Val Leu Lys Lys Ala Gln Glu Glu Ile Ala Asn Ile Val Gly Phe Asp Arg Ile Leu Gln Glu Ser Asp Ala Pro Asn Leu Pro Tyr Leu Gln Ala Leu Ile Lys Glu Thr Phe Arg Leu His Pro Pro Ile Pro Met Leu Ala Arg Lys Ser Ile Ser Asp Cys Val Ile Asp Gly Tyr Met Ile Pro Ala Asn Thr Leu Leu Phe Val Asn Leu Trp Ser Met Gly Arg Asn Pro Lys Ile Trp Asp Tyr Pro Thr Ala Phe Gln Pro Glu Arg Phe Leu Glu Lys Glu Lys Ala Ala Ile Asp Val Lys Gly Gln His Phe Glu Leu Leu Pro Phe Gly Thr Gly Arg Arg Gly Cys Pro Gly Met Leu Leu Ala Ile Gln Glu Val Val Ile Ile Ile Gly Thr Met Ile Gln Cys Phe Asp Trp Lys Leu Pro Asp Gly Ser Gly His Val Asp Met Ala Glu Arg Pro Gly Leu Thr Ala Pro Arg Glu Thr Asp Leu Phe Cys Arg Val Val Pro Arg Val Asp Pro Leu Val Val Ser Thr Gln

Claims (16)

1. A gene which encodes a protein having the amino acid sequence listed as SEQ.ID. No. 2 of the Sequence Listing and showing activity of synthesizing flavones from flavanones, or a gene encoding a protein having one of these amino acid sequences wherein the amino acid sequence has been modified by additions or deletions of one or more amino acids and/or one or more substitution with different amino acids, and possessing activity of synthesizing flavones from flavanones.

2. A gene according to claim 1, which has at least 55% identity with the amino acid sequence listed as SEQ.ID. No. 2 of the Sequence Listing and possesses activity of synthesizing flavones from flavanones.

3. A gene according to claim 1 or 2, which hybridizes with all or a part of the nucleotide sequences listed as SEQ.ID. No. 1 of the Sequence Listing under conditions of 5 x SSC, 50°C, and which encodes a protein possessing activity of synthesizing flavones from flavanones.

4. A vector comprising a gene according to any one of claims 1 to 3.

5. A host transformed with a vector according to claim 4.

6. A protein encoded by a gene according to any one of claims 1 to 3.

7. A method of producing a protein with flavone-synthesizing activity, which is characterized by culturing or growing a host according to claim 5 and recovering said protein from said host.

8. A plant into which a gene according to any one of claims 1 to 3 has been introduced, or progenies of said plant or a tissue thereof, which exhibits the same properties.

9. A cut flower from a plant or a progeny thereof having the same properties, according to claim 8.

10. A method of altering a composition flavonoids and/or its amount using a gene according to any one of claims 1 to 3.

11. A method of altering the amount of a flavone using a gene according to any one of claims 1 to 3.

12. A method of altering the color of a flower using a gene according to any one of claims 1 to 3.

13. A method of bluing the color of a flower using a gene according to any one of claims 1 to 3.

14. A method of reddening the color of a flower using a gene according to any one of claims 1 to 3.

15. A method of altering the photosensitivity of a plant using a gene according to any one of claims 1 to 3.

16. A method of controlling the interaction between a plant and microorganisms using a gene according to any one of claims 1 to 3.