CA2322731A1 - Lectomedin materials and methods - Google Patents

Abstract

Disclosed are novel seven transmembrane receptor polypeptides having characteristic extracellular structure including lectin-binding, olfactomedinlike and mucin-like domains.

Description

LECTOMEDIN MATERIALS AND METHODS
s G-protein coupled receptors (GPCRs) are proteins that interact with G-proteins to transmit an intracellular signal. Upon liga.nd binding, GPCRs trigger the hydrolysis of GTP to GDP by G-protein subunits; GTP hydrolysis is accompanied by a switch from activity to inactivity. It is estimated that there are roughly 1,000 GPCRs [Clapham, Nature 379:297-299 (1996)] and all characterized to date include a seven transmembrane domain that anchors the receptor to the cell. GPCRs include receptors for opiates, adrenaline, histamine, polypeptide hormones, and photons, among other ligands. These receptors are coupled to a wide variety of cellular second messenger 1 s pathways including, for example, pathways that alter intracellular calcium concentrations and cAMP levels.
Among the various GPCRs identified, CD97 appears to be representative of a sub-family of proteins which effect cellular adhesion [McKnight, et al., Immunol Today 17:283-287(1996)]. CD97 and related receptors are unique in that their structure includes a transmembrane domain that directly links a cytoplasmic domain that participates in GTP hydrolysis with extracellular protein binding domains that specifically participate in cell-cell adhesion. The extracellular, amino terminal region of CD97 includes numerous cell-cell adhesive motifs, including multiple epidermal growth factor-like (EGF-like) repeats and an integrin binding site [Hamann J, et al., Immunol lss:1942-19s0 (1996);
2s Gray, etal., J. Immuno1157a438-s447 (1996)]. Proteins that contain EGF-like repeats have been shown to be involved in cell adhesion events [Campbell, et al., Curr. Opin.
Struct. Biol. 3:38s-392 (1993); Rao,et al., Ce1182:131-141 (199s)], and consistent with this observation, heterologous expression of CD97 in COS cells elicits homotypic cell aggregation that can be blocked in the presence of anti-CD97 monoclonal antibodies [Hamann, etal., J. Exp. Med 184:118s-1189 (1996)]. CD97 and related proteins have been referred to as the EGF-7TM subfamily of seven transmembrane receptors [McKNight and Gordon, Immunol. Today 17:283-2887 (1996)]. Ligands identified for CD97 include members of the integrin family of cell surface adhesion receptors. Various _ integrins recognize and interact with their cognate ligands through a trimeric amino acid sequence of arginine-glycine-aspartic acid (denoted RGD in the single letter amino acid code) [D'Souza, etal., TrendsBiochem. Sci., 16:246-250 (1991)] and this sequence has been identified in the extracellular region of CD97, between the EGF-like repeats and the transmembrane domain.
CD97 has been shown to undergo post-translational proteolytic processing which results in an extracellular (and potentially soluble) alpha subunit and a smaller, integral membrane beta subunit [Gray, et al., J. Immunol. 157:5438-5447 (1996)]. The two subunits are associated in a non-covalent manner and the alpha subunit is held at the cell surface through its interaction with the beta subunit. The role of proteolysis is unclear, but it may be a mechanism for receptor down-regulation which is common among proteins, such as selectins and intercellular adhesion molecules (ICAMs), that participate in cell adhesion.
Other members of the CD97 sub-family of GPCRs have been identified by amino acid sequence and structural homology and include human EMR1, HE6, BAI1, the calcium-independent receptor of latrotoxin (CIRL), latrophiIin, and proteins encoded by the Caenorhabditis elegans open reading frames designated 80457.1 and 80286.2 [Baud V, et al., Genomics 26:334-344 (1995); McKnight, et al., J. Biol. Chem.
271:486-489 (1996); Krasnoperov, etal., Neuron 18:925-937 (1997); Lelianova, et al., J.
Biol. Chem.
272:21504-21508 (1997); Davletov, et al., J. Biol. Chem. 271:23239-23245 (1996);
Nishimori, et al., Oncogene 15:2145-2150 (1997)]. EMRl, and its murine homolog F4/80, are macrophage-specific in expression and structurally related to CD97 in that they contain multiple extracellular EGF-like repeats, a rod-like stalk region, and the characteristic transmembrane domain of GPCRs [Baud V, et al., Genomics 26:334-(1995); McKnight, et al., J. Biol. Chem. 271:486-489 (1996)]. No ligands have been identified for EMR-1 and it is uncertain if the protein undergoes post-translational proteolytic processing.
CIRL [Krasnoperov, et al., Neuron 18:925-937 ( 1997); Lelianova, et al., J. Biol. Chem. 272:21504-21508 (1997); Davletov, et al., J. Biol. Chem.
271:23239-23245 (1996)] is believed to be expressed specifically in the central nervous system at WO 99/45111 PC'T/US99/04676 neuronal presynaptic terminals and, like CD97, undergoes proteolytic cleavage resulting _ in an extracellular alpha subunit in non-covalent association with an integral membrane seven-transmembrane beta subunit. Cleavage of latrophilin is believed to occur at a Ser His-Leu/Thr-Asn-Phe site that is conserved in CD97 [Krasnoperov, et al., Neuron 18:925-937 (1997)]. CIRL has been shown to bind latrotoxin, a component of black widow spider venom, in the 0.5 to 1.0 nM range, and binding of the ligand to CIRL
expressed in bovine chromaffin cells has been shown to result in exocytosis, a hallmark of toxin binding [Krasnoperov, et al., Neuron 18:925-937 (1997)]. Alpha latrotoxin binding has also been demonstrated at neuromuscular motor endplates, and this interaction elicits explosive secretory granule release of acetylcholine from presynaptic granules, resulting in muscle paralysis characteristic of the spider's bite [Petrenko, et al., F.E.B.S.
Lens 325:81-85 (1993)]. It is unclear, however, if the peripheral toxin effects result from binding to CIRL or some other related protein.
Thus there exists a need in the art to identify and characterize other 1 S members of the CD97-like family of GPCRs, in particular human receptors which participate in cellular adhesion and those that participate in cytoplasmic metabolic pathways modulated by extracellular signals. Identification of CD97-like receptors can permit identification and diagnosis of disease states which arise from aberrant signaling by the receptor, as well as disease states that arise from aberrant expression of the receptor itself.
The present invention provides purified and isolated human seven transmembrane receptor lectomedin polypeptides or fragments thereof, said polypeptides comprising extracellular lectin-binding, olfactomedin-like, and mucin-like domains.
Mature lectomedin polypeptides are also provided wherein signal or leader sequences are cleaved. Preferred polypeptides of the invention comprise the amino acid sequence set out in SEQ m NO: 2 or a fragment thereof, the amino acid sequence set out in SEQ m NO: 4 or fragment thereof, the amino acid sequence set out in SEQ ID NO: 6 or fragment thereof, and the amino acid sequence set out in SEQ 117 NO: 58 or fragment thereof.

The invention also provides polynucleotides encoding polypeptides of the - invention. Preferred polynucleotides comprising the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 57. The invention also provide polynucleotides encoding a human lectomedin polypeptide selected from the group consisting of the polynucleotide set out in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID
NO:

5, or SEQ ID NO: 57; b) a DNA which hybridizes under moderately stringent conditions to the non-coding strand of the polynucleotide of (a); and c) a DNA which would hybridize to the non-coding strand of the polynucleotide of (a) but for the redundancy of the genetic code. Preferred polynucleotides of the invention are DNA
molecules. Preferred DNA molecules are cDNA molecules and genomic DNA molecules. The invention also provides DNA which is a wholly or partially chemically synthesized. Anti-sense polynucleotide which specifically hybridizes with a polynucleotide of the invention are also comprehended.
The invention also proved expression construct comprising the a polynucleotide of the invention, as well as host cells transformed or transfected with a polynucleotide or expression construct of the invention.
The invention also provides polynucleotide of the invention operably linked to a heterologous promoter, and host cells polynucleotides operably linked to a heterologous promoter.
In another aspect, the invention provides methods for producing a human lectomedin polypeptide comprising the steps of a) growing the host cell of the invention under conditions appropriate for expression of the lectomedin polypeptide and b) isolating the lectomedin polypeptide from the host cell or the medium of its growth.
The invention also proved antibodies specifically immunoreactive with a polypeptide of the invention. Preferably, antibodies of the invention are monoclonal antibodies. The invention also provides cells, e.g. hybridomas, that produce antibodies of the invention. Anti-idiotype antibodies specifically immunoreactive with an antibody of the invention are also comprehended.
The invention also provides methods to identify a specific binding partner compound of a lectomedin polypeptide comprising the steps of a) contacting the lectomedin polypeptide with a compound under conditions which permit binding between _$_ the compound and the lectomedin polypeptide; b) detecting binding of the compound to - the lectomedin polypeptide; and c) identifying the compound as a specific binding partner of the lectomedin polypeptide. Methods of the invention embrace specific binding partner that modulate activity of the lectomedin polypeptide. In one aspect, the compound $ inhibits activity of the lectomedin polypeptide, and in another aspect, the compound enhances activity of the lectomedin polypeptide.
The invention also provides methods to identify a specific binding partner compound of a lectomedin polynucleotide comprising the steps of a) contacting the lectomedin polynucleotide with a compound under conditions which permit binding between the compound and the lectomedin polynucleotide; b) detecting binding of the compound to the lectomedin polynucleotide; and c) identifying the compound as a specific binding partner of the lectomedin polynucleotide. Methods of the invention embrace specific binding partner that modulates expression of a lectomedin polypeptide encoded by the lectomedin polynucleotide. In one aspect, the compound inhibits 1$ expression of the lectomedin polypeptide, and in another aspect, the compound enhances expression of the lectomedin polypeptide. The invention also provides compounds identified by a method of the invention.
In another aspect, the invention comprehends composition comprising the compound identified by a method of the invention. and a pharmaceutically acceptable carrier. The invention also provides use of a compound identified by a method of the invention for the preparation of a medicament to treat lectomedin related pathologies.
The invention also provides for use of a lectomedin polypeptide in the preparation of a medicament for the treatment of a lectomedin related disorder.

The present invention provides purified and isolated polypeptides and underlying polynucleotides for a novel family of transmembrane proteins designated lectomedins. The invention includes both naturally occurring and non-naturally occurring lectomedin polynucleotides and polypeptide products thereof. Naturally occurring lectomedin products include distinct gene and polypeptide species within the lectomedin family, including, for example, allelic variants, which are expressed within cells of the same animal, as well as corresponding species homologs expressed in cells of other - animals. The invention further provides splice variants encoded by the same polynucleotide but which arise from distinct mRNA transcripts. Non-naturally occurnng lectomedin products include variants of the naturally occurring products such as analogs, fragments, fusion (or chimeric) proteins, and lectomedin products having covalent modifications. The lectomedin family of proteins is distinguished from previously known seven transmembrane families of proteins in that the lectomedin proteins include at least one extracellular lectin binding-like domain and at least one extracellular olfactomedin domain. Unlike many other seven transmembrane proteins, the structure of proteins in the lectomedin family of proteins does not include EGF-like binding domains which effect cell/cell interactions. In a preferred embodiment, the invention provides polynucleotides comprising the sequences set forth in SEQ ID NOs: 1, 3, 5 and 57. The invention also embraces polynucleotides encoding the amino acid sequences set out in SEQ ID
NOs: 2, 4, 6, and 58. Presently preferred polypeptides of the invention comprises the amino acid sequences set out in SEQ ID NOs: 2, 4, 6, and 58.
The invention also provides expression constructs (or vectors) comprising polynucleotides of the invention, as well as host cells transformed, transfected, or electroporated to include a polynucleotide or expression construct of the invention.
Methods to produce a polypeptide of the invention are also comprehended. The invention fiarther provides antibodies, preferably monoclonal antibodies, specifically immunoreactive with a polypeptide of the invention, as well as cell lines, e.g., hybridomas, that secrete the antibodies.
The present invention provides novel purified and isolated human polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, including splice variants thereof) encoding the human lectomedins. DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. Genomic DNA
of the invention comprises the protein coding region for a polypeptide of the invention and includes allelic variants of the preferred polynucleotides of the invention.
Genomic DNA
ofthe invention is distinguishable from genomic DNAs encoding polypeptides other than lectomedin in that it includes the lectomedin coding region found in lectomedin cDNA of WO 99/45111 PCT/US99/04b76 _7_ the invention. Genomic DNA of the invention can be transcribed into RNA, and the - resulting RNA transcript may undergo one or more splicing events wherein one or more introns (i.e., non-coding regions) of the transcript are removed, or "spliced out." RNA
transcripts that can be spliced by alternative mechanisms, and therefore be subjected to removal of different non-coding RNA sequences but still encode a lectomedin polypeptide, are referred to in the art as splice variants, which are embraced by the invention. Splice variants comprehended by the invention, therefore, are encoded by the same DNA
sequences but arise from distinct mRNA transcripts. Allelic variants are known in the art to be modified forms of a wild type (predominant) gene sequence, the modification resulting from recombination during chromosomal segregation or exposure to conditions which give rise to genetic mutation. Allelic variants, like wild type genes, are inherently naturally occurring sequences (as opposed to non-naturally occurring variants which arise from in vitro manipulation).
The invention also comprehends cDNA that is obtained through reverse 1 S transcription of an RNA polynucleotide encoding lectomedin, followed by second strand synthesis of a complementary strand to provide a double stranded DNA.
"Chemically synthesized" as used herein and understood in the art, refers to polynucleotides produced by purely chemical, as opposed to enzymatic, methods.
"Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means.
Preferred DNA sequences encoding human lectomedin polypeptides are set out in SEQ m NOs: 1, 3, 5, and 57. The worker of skill in the art will readily appreciate that preferred DNAs of the invention comprise double stranded molecules, for example, the molecule having the sequence set forth in either SEQ 1D NOs: 1, 3, 5, or 57, along with the complementary molecule (the "non-coding strand" or "complement") having a sequence deducible from the sequence of SEQ m NO: 1 according to Watson-Crick base pairing rules for DNA. Also preferred are polynucleotides encoding the lectomedin polypeptides of SEQ >D NOs: 2, 4, 6, and 58.
The invention further embraces species, preferably mammalian, homologs of the human lectomedin DNA. Species homologs, in general, share at least 3 5%, at least -g-40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%
homology with human DNA of the invention. Percent sequence "homology" with respect to polynucleotides of the invention is defined herein as the percentage of nucleotide bases in the candidate sequence that are identical to nucleotides in the lectomedin coding sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
The polynucleotide sequence information provided by the invention makes possible large scale expression of the encoded polypeptide by techniques well known and routinely practiced in the art. Polynucleotides also permit identification and isolation of polynucleotides encoding related lectomedin polypeptides by well known techniques including Southern and/or Northern hybridization, and polymerise chain reaction (PCR), ligase chain reaction, as well as other amplification techniques. Examples of related polynucleotides include human and non-human genomic sequences, including allelic variants, as well as polynucleotides encoding polypeptides homologous to lectomedins and structurally related polypeptides sharing one or more biological, immunological, and/or physical properties of lectomedin.
The disclosure of full length polynucleotides encoding lectomedin polypeptides makes readily available to the worker of ordinary skill in the art every possible fragment of the full length polynucleotides. The invention therefore provides fragments of lectomedin coding polynucleotides. Such fragments comprise at least 10 to 20, and preferably at least 15, consecutive nucleotides of the polynucleotide.
The invention comprehends, however, fragments of various lengths. Preferably, fragment polynucleotides of the invention comprise sequences unique to the lectomedin coding polynucleotide sequence, and therefore hybridize under highly stringent or moderately stringent conditions only (i.e., "specifically") to polynucleotides encoding lectomedin, or lectomedin fi~agments thereof containing the unique sequence. Polynucleotide fragments of genomic sequences of the invention comprise not only sequences unique to the coding region, but also include fragments of the full length sequence derived from introns, regulatory regions, and/or other non-translated sequences. Sequences unique to polynucleotides of the invention are recognizable through sequence comparison to other known polynucleotides, and can be identified though use of alignment programs routinely - utilized in the art, e.g., those made available in public sequence databases.
The invention also provides fragment polynucleotides that are conserved in one or more polynucleotides encoding members of the lectomedin family of polypeptides. Such fragments include sequences characteristic of the family of lectomedin polynucleotides, and are also referred to as "signature sequences." The conserved signature sequences are readily discernable following simple sequence comparison of polynucleotides encoding members of the lectomedin family. Fragments of the invention can be labeled in a manner that permits their detection, including radioactive and non-radioactive labeling.
Fragment polynucleotides are particularly usefi~l as probes for detection of fizll length or other fragment lectomedin coding polynucleotides. One or more fragment polynucleotides can be included in kits that are used to detect the presence of a polynucleotide encoding lectomedin, or used to detect variations in a polynucleotide sequence encoding lectomedin.
The invention also embraces DNA sequences encoding lectomedin species which hybridize under moderately or highly stringent conditions to the non-coding strand, or complement, of the polynucleotide in SEQ ID NOs: 1, 3, 5, or 57. DNA
sequences encoding lectomedin polypeptides which would hybridize thereto but for the redundancy of the genetic code are further comprehended by the invention. Exemplary highly stringent conditions are include hybridization at 45°C in SX SSPE and 45% formamide, and a final wash at 65 °C in 0.1X SSC. Exemplary moderately stringent condition include a final wash at 55°C in 1X SSC. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausubel, et al. (Eds.), Protocols in Molecular BioloQV, John Wiley & Sons (1994), pp. 6Ø3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage ofguanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), _M_ol_ecular Cloning:
A Laboratolv Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51.

Autonomously replicating recombinant expression constructs such as - plasmid and viral DNA vectors incorporating lectomedin coding sequences are also provided. Expression constructs wherein lectomedin-encoding poIynucleotides are operably linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. Expression control DNA sequences include promoters, enhancers, and operator, and are generally selected based on the expression systems in which the expression construct is to be utilized. Preferred promoter and enhancer sequences are generally selected for the ability to increase gene expression, while operator sequences are generally selected for the ability to regulate gene expression.
Expression constructs of the invention may also include sequences encoding one or more selectable markers that permit identification of host cells bearing the construct.
Expression constructs may also include sequences that facilitate, and preferably promote, homologous recombination in a host cell. Preferred constructs of the invention also include sequences necessary for replication in a host cell. Expression constructs are preferably utilized for production of an encoded lectomedin protein, but may also be utilized to amplify the construct itself.
According to another aspect of the invention, host cells are provided, including prokaryotic and eukaryotic cells, comprising a polynucleotide of the invention in a manner which permits expression of the encoded lectomedin polypeptide.
Polynucleotides of the invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector.
Methods for introducing DNA into the host cell well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, and protoplasts. Expression systems of the invention include bacterial, yeast, fungal, plant, insect, invertebrate, and mammalian cells systems. Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with lectomedin. Host cells of the invention are also useful in methods for large scale production of lectomedin polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by purification methods known in the art, e.g., conventional chromatographic methods including immunoaffinity chromatography, receptor affinity chromatography, hydrophobic - interaction chromatography, lectin affinity chromatography, size exclusion filtration, canon or anion exchange chromatography, high pressure liquid chromatography (HPLC), reverse phase HPLC and the like. Still other methods of purification include those wherein the desired protein is expressed and purified as a fusion protein having a specific tag, label, or chelating moiety that is recognized by a specific binding partner or agent.
The purified protein can be cleaved to yield the desired protein, or be left as an intact fusion protein. Cleavage of the fusion component may produce a form of the desired protein having additional amino acid residues as a result of the cleavage process.
Knowledge of lectomedin coding DNA sequences allows for modification of cells to permit, or increase, expression of endogenous lectomedin. Cells can be modified (e.g., by homologous recombination) to provide increased lectomedin expression by replacing, in whole or in part, the naturally occurring lectomedin promoter with all or part of a heterologous promoter so that the cells express lectomedin at higher levels. The heterologous promoter is inserted in such a manner that it is operably linked to lectomedin- encoding sequences. See, for example, PCT International Publication No.
WO 94/12650, PCT International Publication No. WO 92/20808, and PCT
International Publication No. WO 91/09955. It is also contemplated that, in addition to heterologous promoter DNA, amplifiable marker DNA (e.g., ada, dhfr, and the multifunctional CAD
gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase) and/or intron DNA may be inserted along with the heterologous promoter DNA. If linked to the lectomedin coding sequence, amplification of the marker DNA by standard selection methods results in co-amplification of the lectomedin coding sequences in the cells.
The DNA sequence information provided by the present invention also makes possible the development through, e.g. homologous recombination or "knock-out"
strategies [Capecchi, Science 244:1288-1292 (1989)], of animals that fail to express functional lectomedin or that express a variant of lectomedin. Such animals are useful as models for studying the in vivo activities of lectomedin and modulators of lectomedin.
The invention also provides purified and isolated mammalian lectomedin polypeptides encoded by a polynucleotide of the invention. Presently preferred are lectomedin polypeptides comprising the amino acid sequence set out in SEQ m NO: 2, - 4, 6, or 58. The invention also embraces lectomedin polypeptides encoded by a DNA
selected from the group consisting of : a) the DNA sequence set out in SEQ ID
NO:1, 3, 5 or 57; b) a DNA molecule which hybridizes under high stringent conditions to the noncoding strand of the protein coding portion of (a); and c) a DNA molecule that would hybridize to the DNA of (a) but for the degeneracy of the genetic code.
The invention also embraces variant (or analog) lectomedin polypeptides.
In one example, insertion variants are provided wherein one or more amino acid residues supplement a lectomedin amino acid sequence. Insertions may be located at either or both termini of the protein, or may be positioned within internal regions of the lectomedin amino acid sequence. Insertional variants with additional residues at either or both termini can include for example, fusion proteins and proteins including amino acid tags or labels.
In another aspect, the invention provides deletion variants wherein one or more amino acid residues in a lectomedin polypeptide are removed. Deletions can be effected at one or both termini of the lectomedin polypeptide, or with removal of one or more residues within the lectomedin amino acid sequence. Deletion variants, therefore, include all fragments of a lectomedin polypeptide.
In still another aspect, the invention provides substitution variants of lectomedin polypeptides. Substitution variants include those polypeptides wherein one or more amino acid residues of a lectomedin polypeptide are removed and replaced with alternative residues. In one aspect, the substitutions are conservative in nature, however, the invention embraces substitutions that are also non-conservative.
Conservative substitutions for this purpose may be defined as set out in Tables A, B, or C
below.
The invention also provides derivatives of lectomedin polypeptides.
Derivatives include lectomedin polypeptides bearing modifications other than insertion, deletion, or substitution of amino acid residues. Preferably, the modifications are covalent in nature, and include, for example, chemical bonding with polymers, lipids, non-naturally occurring amino acids, other organic, and inorganic moieties. Derivatives of the invention may be prepared to increase circulating half life of a lectomedin polypeptide, or may be designed to improve targeting capacity for the polypeptide to desired cells, tissues, or organs.

The invention also embraces polypeptides have at least 99%,at least 95%, - at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55% or at least SO% identity and/or homology to the preferred polypeptide of the invention. Percent amino acid sequence "identity" with respect to the preferred polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the lectomedin sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent sequence "homology" with respect to the preferred polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the lectomedin sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity.
1 S In one aspect, percent homology is calculated as the percentage of amino acid residues in the smaller of two sequences which align with identical amino acid residue in the sequence being compared, when four gaps in a length of 100 amino acids may be introduced to maximize alignment [Dayhoff, in Altas of Protein Sequence and Stricture, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C.
(1972), incorporated herein by reference].
Polypeptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. Glycosylated and non-glycosylated form of lectomedin polypeptides are embraced.
Insertion variants include lectomedin polypeptides wherein one or more amino acid residues are added to a lectomedin acid sequence, or fragment thereof.
Variant products of the invention also include mature lectomedin products, i.e., lectomedin products wherein leader or signal sequences are removed, with additional amino terminal residues. The additional amino terminal residues may be derived from - another protein, or may include one or more residues that are not identifiable as being derived from a specific proteins. Lectomedin products with an additional methionine residue at position -1 (Met'1-lectomedin) are contemplated, as are lectomedin products S with additional methionine and lysine residues at positions -2 and -1 (Met'2-Lys'-lectomedin). Variants of lectomedin with multiple, additional Met, Met-Lys, Lys residues are particularly useful for enhanced recombinant protein production in bacterial host cell.
The invention also embraces lectomedin variants having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as part of glutathione-S-transferase (GST) fusion product provides the desired polypeptide having an additional glycine residue at position -I after cleavage of the GST
component from the desired polypeptide. Variants which result from expression in other vector systems are also contemplated.
Insertional variants also include fusion proteins wherein the amino and/or carboxy termini of the lectomedin polypeptide is fiased to another polypeptide. Examples of such fusion proteins are immunogenic polypeptides, proteins with long circulating half life, such as immunoglobulin constant regions, marker proteins (e.g., fluorescent) and proteins or polypeptide that facilitate purification of the desired lectomedin polypeptide, e.g. FLAG~ tags or polyhistidine sequences.
Deletion variants include lectomedin polypeptides wherein one or more amino acid residues are deleted from the lectomedin amino acid sequence.
Deletion variants of the invention embrace polypeptide fragments of the sequence set out in SEQ
ID NO: 2, 4, 6, or 58 wherein the fragments maintain biological or immunological properties of a lectomedin polypeptide. Fragments comprising at least 5, 10, 15, 20, 25, 30, 35, or 40 consecutive amino acids of SEQ ID NO: 2, 4, 6, or 58 are comprehended by the invention. Preferred polypeptide fragments display antigenic properties unique to or specific for the lectomedin family of polypeptides. Fragments of the invention having the desired biological and immunological properties can be prepared by any of the methods well known and routinely practiced in the art.

WO 99/45111 PC'f/US99/04676 Substitution variants of the invention include lectomedin polypeptides, or - fragments thereof; wherein one or more amino acid residues in the lectomedin amino acid sequence are deleted and replaced with another amino acid residue. Variant polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are set out in Table A (from WO 97/09433, page 10, published March 13, 1997 (PCT/GB96/02197, filed 9/6/96), immediately below.
Table A
Conservative Substitutions I
SIDE CAIN CgA_RA_CTERT~T1(' Abp ACID
Aliphatic Non-polar G A P
ILV
Polar - uncharged C S T M
NQ
Polar - charged D E
KR
Aromatic H F W Y
Other N Q D E
Alternatively, conservative amino acids can be grouped as described in Lehninger, Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY (1975), pp.71-77]
as set out in Table B, immediately below.

Table B
- Conservative Substitutions II
SIDE CHAIN
~AR,ACTERISTIC AMINO ACID
Non-polar (hydrophobic) A. Aliphatic: A L I V
P

B. Aromatic: F W

C. Sulfur-containing: M

D. Borderline: G

Uncharged-polar A. Hydroxyl: S T Y

B. Amides: N Q

C. Sulfliydryl: C

D. Borderline: G

Positively Charged (Basic): K R H

Negatively Charged (Acidic): DE

As still an another alternative, exemplary conservative substitutions are set out in Table C, below.
The invention further embraces lectomedin products, or fragments thereof, covalently modified or derivatized, e.g., to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.
Particularly preferred are lectomedin products covalently modified with polyethylene glycol (PEG) subunits. Water soluble polymers may be bonded at specific positions, for example at the amino terminus of the lectomedin products, or randomly attached to one or more side chains of the polypeptide. Additional derivatives include lectomedin species immobilized on a solid support, pin microparticle, or chromatographic resin, as well as lectomedin polypeptides modified to include one or more non-protein labels, tags, or chelating agents.

Table C
- Conservative Substitutions III
O~'Einal Residue E:emnlarv Substitution S Ala (A) Val, Leu, Ile Arg (R) Lys, Gln, Asn Asn (I~ Gln, His, Lys, Arg Asp (D) Glu Cys (C) Ser Gln (Q) Asn Glu (E) Asp His (I~ Asn, Gln, Lys, Arg Ile (I) Leu, Val, Met, Ala, Phe, Leu (L) Ile, Val, Met, Ala, Phe Lys (K) Arg, Gln, Asn Met (NI) Leu, Phe, Ile Phe (F~ Leu, Val, Ile, Ala Pro (P) Gly Ser (S) Thr Thr (T') Ser Trn (~ 'fir Tyr (Y) Trp, Phe, Thr, Ser Val (V) Ile, Leu, Met, Phe, Ala Also comprehended by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bifunctional/bispecific antibodies, humanized antibodies, human antibodies, and CDR-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide of the invention) and other binding proteins specific for lectomedin products or fragments thereof. Preferred antibodies of the invention are human antibodies which are produced and identified according to methods described in W093/11236, published June 20, 1993, which is incorporated herein by reference in its entirety. Antibody fragments, including Fab, Fab', F(ab')2, and F~, are also provided by - the invention. The term "specific for" indicates that the variable regions of the antibodies of the invention recognize and bind lectomedin polypeptides exclusively (i.e., able to distinguish single lectomedin polypeptides from the family of lectomedin polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region of the molecule.
Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds), _A_n_tibodies: A 1_.aboratorv Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor , NY (1988), Chapter 6. Antibodies that recognize and bind fragments of the lectomedin polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, lectomedin polypeptides.
As with antibodies that are specific for full length lectomedin polypeptides, antibodies of the invention that recognize lectomedin fragments are those which can distinguish single and distinct lectomedin polypeptides from the family of lectomedin polypeptides despite inherent sequence identity, homology, or similarity found in the family of proteins.
Antibodies of the invention can be produced using any method well known and routinely practiced in the art.
Non-human antibodies may be humanized by any methods known in the art. In one method, the non-human complementarity determining regions (CDRs) are inserted into a human antibody or consensus antibody framework sequence.
Further changes can then be introduced into the antibody framework to modulate affinity or immunogenicity.
Antibodies of the invention are useful for, for example, therapeutic purposes (by modulating activity of lectomedin), diagnostic purposes to detect or quantitate lectomedin, as well as purification of lectomedin. Antibodies are particularly useful for detecting and/or quantitating lectomedin expression in cells, tissues, organs and lysates and extracts thereof, as well as fluids, including serum, plasma, cerebrospinal fluind, urine, sputum, peritoneal fluid, pleural fluid, or pulmonary lavage.
Kits comprising an antibody of the invention for any of the purposes described herein are also - comprehended. In general, a kit of the invention also includes a control antigen for which the antibody is immunospecific.
Specific binding proteins can be identified or developed using isolated or recombinant lectomedin products, lectomedin variants, or cells expressing such products.
Binding proteins are useful for purifying lectomedin products and detection or quantification of lectomedin products in fluid and tissue samples using known immunological procedures. Binding proteins are also manifestly usefi~l in modulating (i.e., blocking, inhibiting or stimulating) biological activities of lectomedin, especially those activities involved in signal transduetion.
The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of lectomedins. DNA and amino acid sequence information for lectomedin also permits identification of binding partner compounds with which a lectomedin polypeptide or polynucleotide will interact. Agents that modulate (i.e., increase, decrease, or block) lectomedin activity or expression may be identified by incubating a putative modulator with a lectomedin polypeptide or polynucleotide and detennining the effect of the putative modulator on lectomedin activity or expression. The selectivity of a compound that modulates the activity of the lectomedin can be evaluated by comparing its binding activity to one particular lectomedin to its activity to other lectomedin polypeptides.
Cell based methods, such as di-hybrid assays to identify DNAs encoding binding compounds and split hybrid assays to identify inhibitors of lectomedin polypeptide interaction with a known binding polypeptide, as well as in vitro methods, including assays wherein a lectomedin polypeptide, lectomedin polynucleotide, or a binding partner are immobilized, and solution assays are contemplated by the invention.
Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to a lectomedin polypeptide or a lectomedin-encoding nucleic acid, oligonucleotides which specifically bind to a lectomedin polypeptide or a lectomedin gene sequence, and other non-peptide compounds (e.g., isolated or synthetic organic and inorganic molecules) which specifically react with a lectomedin polypeptide or its underlying nucleic acid. Mutant lectomedin polypeptides WO 99/45111. PCT/US99/04676 which affect the enzymatic activity or cellular localization of the wild-type lectomedin polypeptides are also contemplated by the invention. Presently preferred targets for the development of selective modulators include, for example: (1) regions of the lectomedin polypeptide which contact other proteins, (2) regions that localize the lectomedin S polypeptide within a cell, (3) regions of the lectomedin polypeptide which bind substrate, (4) allosteric regulatory binding sites) of the lectomedin polypeptide, (5) sites) of the lectomedin polypeptide wherein covalent modification regulates biological activity and (6) regions of the lectomedin polypeptide which are involved in multimerization of lectomedin subunits. Still other selective modulators include those that recognize specific lectomedin encoding and regulatory polynucleotide sequences. Modulators of lectomedin activity may be therapeutically useful in treatment of a wide range of diseases and physiological conditions in which lectomedin activity is known or suspected to be involved.
Lectomedin polypeptides of the invention are amenable to numerous cell based high throughput screening (HTS) assays known in the art, including melanophore assay to investigate receptor-ligand interaction, yeast based assay systems, and mammalian cell expression systems. For a review, see Jayawickreme and Kost, Curr. Opin.
Biotechnol. 8:629-634 (1997). Automated and miniaturized HTS assays are also comprehended as described, for example, in Houston and Banks, Curr. Opin.
Biotechnod.
8:734-740 (1997) There are a number of different libraries used for the identification of small molecule modulators, including, (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random or designed peptides, oligonucleotides or organic molecules.
Chemical libraries consist of structural analogs of known compounds or compounds that are identified as "hits" or °leads" via natural product screening.
Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil; plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) variants thereof.
For a review, see Science 282:63-68 (1998). Combinatorial libraries are composed of large numbers of peptides, oligonucleotides or organic compounds as a mixture. They are - relatively easy to prepare by traditional automated synthesis methods, PCR, cloning or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein, S peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:701-707 (1997).
Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" (or "lead") to optimize the capacity of the "hit" to modulate activity.
The scientific value of the information contributed through the disclosures of DNA and amino acid sequences of the present invention is manifest. As one series of examples, knowledge of the sequence of a cDNA for lectomedin makes possible through use of Southern hybridization or polymerase chain reaction (PCR) the identification of genomic DNA sequences encoding lectomedin and lectomedin expression control regulatory sequences such as promoters, operators, enhancers, repressors, and the like.
DNA/DNA hybridization procedures carried out with DNA sequences of the invention under moderately to highly stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of lectomedin; allelic variants are known in the art to include structurally related proteins sharing one or more of the biochemical and/or immunological properties specific to lectomedin. Similarly, non-human species genes . encoding proteins homologous to human lectomedin can also be identified by Southern and/or PCR analysis; species homologs of the invention are particularly useful in animal models for the study of lectomedin-related disorders. As an alternative, complementation studies can be useful for identifying other human lectomedin products as well as non-human proteins, and DNAs encoding the proteins, sharing one or more biological properties of lectomedin.
Polynucleotides of the invention are also useful in hybridization assays to detect the capacity of cells to express lectomedin. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alterations) in a lectomedin locus that underlies a disease state or states.

Also made available by the invention are anti-sense polynucleotides which _ recognize and hybridize to polynucleotides encoding lectomedin. Full length and fragment anti-sense polynucleotides are provided. The worker of ordinary skill will appreciate that fragment antisense molecules of the invention include (i) those which specifically S recognize and hybridize to lectomedin RNA (as determined by sequence comparison of DNA encoding lectomedin to DNA encoding other known molecules) as well as (ii) those which recognize and hybridize to RNA encoding variants of the lectomedin family of proteins. Antisense polynucleotides that hybridize to RNA encoding other members of the lectomedin family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules.
Anti-sense polynucleotides are particularly relevant to regulating expression of lectomedin by those cells expressing lectomedin mRNA.
Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides) capable of specifically binding to lectomedin expression control sequences or lectomedin RNA are introduced into cells (e. g. , by a vital vector or colloidal dispersion system such as a liposome). The antisense nucleic acid binds to the lectomedin target nucleotide sequence in the cell and prevents transcription or translation of the target sequence. Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' end.
The invention further contemplates methods to modulate lectomedin expression through use of ribozymes. For a review, see Gibson and Shillitoe, Mol.
Biotech. 7:125-137 (1997). Ribozyme technology can be utilized to inhibit translation of lectomedin mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a target mRNA and (ii) cleavage of the hybridized mRNA
through nuclease activity inherent to the complementary strand. Ribozymes can identified by empirical methods but more preferably are specifically designed based on accessible sites on the target mRNA (Bramlage, et al., Trends in Biotech 16:434-438 (1998).
Delivery of ribozymes to target cells can be accomplished using either exogenous or endogenous delivery techniques well known and routinely practiced in the art.
Exogenous delivery methods can include use of targeting liposomes or direct local injection.
_ Endogenous methods include use of viral vectors and non-viral plasmids.
Ribozymes can specifically modulate expression of lectomedin when designed to be complementary to regions unique to a polynucleotide encoding lectomedin.
S "Specifically modulate" therefore is intended to mean that ribozymes of the invention recognizes only a polynucleotide encoding lectomedin. Similarly, ribozymes can be designed to modulate expression of all or some of the lectomedin family of proteins.
Ribozymes of this type are designed to recognize polynucleotide sequences conserved in all or some of the polynucleotides which encode the family of proteins.
The invention further embraces methods to modulate transcription of lectomedin through use of oligonucleotide-directed triplet helix formation.
For a review, see Lavrovsky, et al., Biochem. Mol. Med. 62:11-22 (1997). Triplet helix formation is accomplished using sequence specific oligonucleotides which hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. Hybridization of a sequence specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases.
Preferred target sequences for hybridization include promoter and enhancer regions to permit transcriptional regulation of lectomedin expression.
Oligonucleotides which are capable of triplet helix formation are also usefixl for site-specific covalent modification of target DNA sequences.
Oligonucleotides useful for covalent modification are coupled to various DNA damaging agents as described in Lavrovsky, et al. [supra).
Mutations in a lectomedin gene that results in loss of normal function of the lectomedin gene product may underlie lectomedin-related human disease states. The invention comprehends gene therapy to restore lectomedin activity would thus be indicated in treating those disease states (for example, various forms of cancer described herein). Delivery of a functional lectomedin gene to appropriate cells is effected ex vivo, in situ, or in vivo by use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus), or ex vivo by use of physical DNA transfer methods (e.g. , liposomes or chemical treatments).
See, for example, Anderson, Nature, supplement to vol. 392, no. 6679, pp.25 (1998). For additional reviews of gene therapy technology see Friedmann, Science, 244:

1281 (1989); Verma, Sciensific American: 68-84 (1990); and Miller, Nature, 357: 455-460 (1992). Alternatively, it is contemplated that iri other human disease states, preventing the expression of or inhibiting the activity of lectomedin will be useful in treating the disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of lectomedin.
The invention further embraces pharmaceutical compositions comprising a lectomedin polypeptide of the invention, generally in combination with a pharmaceutically acceptable carrier. The pharmaceutical compositions optionally may include pharmaceutically acceptable (i. e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma.
The pharmaceutical compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, sachet, cachet, gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets.
The pharmaceutical compositions may be introduced into the subject to be treated by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, intrathecal, intraocular, retrobulbar, intrapulmonary (e.g., aerosolized drug solutions) or subcutaneous injection (including depot administration for long term release) ; by oral, sublingual, nasal, anal, vaginal, or transdermal delivery; or by surgical implantation, e.g., embedded under the splenic capsule, brain, or in the cornea. The treatment may consist of a single dose or a plurality of doses over a period of time.
When given parenterally, lectomedin product compositions are generally injected. in doses ranging from 1 ~cg/kg to 100 mg/kg per day, preferably at doses ranging from 0.1 mg/kg to 50 mg/kg per day, and more preferably at doses ranging - from 1 to 20 mg/kg/day. The Iectomedin product composition may be administered by an initial bolus followed by a continuous infusion to maintain therapeutic circulating levels of dn~g product. Those of ordinary skill in the art will readily optimize effective dosages and administration regimens as determined by good medical practice and the clinical condition of the individual patient. The frequency of dosing will depend on the pharmacokinetic parameters of the agents and the route of administration. The optimal pharmaceutical formulation will be determined by one skilled in the art depending upon the route of administration and desired dosage. See for example, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA
18042) pages 1435-1712, the disclosure of which is hereby incorporated by reference.
Such formulations may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the administered agents. Depending on the route of administration, a suitable dose may be calculated according to body weight, body surface area or organ size. Further refinement of the calculations necessary to determine the appropriate dosage for treatment involving each of the above mentioned formulations is routinely made by those of ordinary skill in the art without undue experimentation, especially in light of the dosage information and assays disclosed herein, as well as the pharmacokinetic data observed in the human clinical trials discussed above. Appropriate dosages may be ascertained through use of established assays for determining blood levels dosages in conjunction with appropriate dose-response data. The final dosage regimen will be determined by the attending physician;
considering various factors which modify the action of drugs, e.g. the drug's specific activity, the severity of the damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. As studies are conducted, further information will emerge regarding the appropriate dosage levels and duration of treatment for various diseases and conditions.
It will be appreciated that the pharmaceutical compositions and treatment methods of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be treated may be a mammal, preferably human, or other animals. For veterinary purposes, subjects include, for example, farm animals including - cows, sheep, pigs, horses, and goats, companion animals such as dogs and cats; exotic and/or zoo animals; laboratory animals including mice, rats, rabbits, guinea pigs, and hamsters; and poultry such as chickens, turkeys, ducks and geese.
The present invention is illustrated by the following examples. Example 1 describes identif ration and characterization of cDNA encoding lectomedin polypeptides.
Example 2 relates to expression of recombinant lectomedin. Example 3 described characterization of recombinant lectomedin. Ligand affinity chromatography with immobilized lectomedin is described in Example 4. Example 5 describes Northern analysis of lectomedin expression. Example 5 provides an assessment of tissue distribution of lectomedin in mammalian cell types, while Example 6 describes results from in situ hybridization. The chromosome localization of lectomedin is disclosed in Example 7.
Example 8 provides production of polyclonal and monoclonal antibodies specific for lectomedin. Example 9 addresses lectomedin expression.
Example 1 Isolation and Characterization of Human Lectomedin Identification of ><.ertomedin-la In an attempt to identify genes encoding novel seven transmembrane receptor proteins related to CD97, a TBLASTN search of the National Center for Biotechnology Information (NCBI, Bethesda, MD) Expressed Sequence Tag (EST) database was carried out with an amino acid query sequence for,full length CD97 (SEQ
ID NO: 12). This database contains DNA sequences representing one or both ends of cDNAs collected from a variety of tissue sources. The TBLASTN program was used to determine homology between the protein sequence of CD97 and the six different amino acid sequences encoded by each EST. In the search, ESTs are translated in six reading frames and the amino acid sequences generated are compared to the query CD97 amino acid sequence. Sequences identified as homologous at the amino acid level were examined and any ESTs positively identified as corresponding to a known protein were discarded.

Among the CD97-related sequences identified as corresponding to known proteins were ESTs representing CD97, human EMRl, and murine F4/80. In addition, several ESTs showed statistically significant values for relatedness in the transmembrane region of CD97, but they were not CD97, EMR1, or F4/80. One of the identified ESTs, designated GenBank~ Accession No: T47902 (SEQ B77 NO: 13), was chosen to attempt identification of a full length cDNA. The basis for choosing T47902 was disclosure in GenBank~ that the EST was derived from a human fetal spleen library.
A library probe was first generated by PCR based on the Genbank sequence of T47902. Primers used to amplify a T47902 sequence are set out in SEQ m NOs: 14 and 15 below.
5' TGGAGTTTCAGCTGCTATTG SEQ ID NO: 14 5' TGCCCATCCACAATAGTCTC SEQ 117 NO: 15 Mixed human adult spleen cDNA was prepared by standard methods and ligated into vector pcDNAl.amp (Invitrogen) [Van der Vieren, M. et al.
Immunity 3:683-690 (1995)]. The resulting plasmid mixture was transformed into E. coli and the bacteria were plated onto LB bacterial plates containing carbenicillin (100 ug/ml).
Surviving colonies were collected by scraping and plasmid DNA was prepared by the alkaline lysis method. The cDNA mixture was used as a template for PCR in a reaction mixture including 350 ng cDNA, 100 ng each primer (SEQ ID NO. 14 and NO. 15), 200 ~tM
each deoxynucleotide triphosphate (adenosine, thymidine, cytidine and guanosine), 10 mM
Tris-HCI, pH 8.3 (at 25°C), 50 mM KCI, 1.5 mM MgCl2, and 5 units Taq polymerase (Perkin Elmer Corp., Foster City, CA). PCR was carried out with an initial denaturation step of seven minutes at 95 °C followed by 30 cycles of denaturation for one minute at 95 ° C, hybridization for one minute at 55 ° C, and extension two minutes at 74 ° C. After PCR, 10 pl of the reaction was separated on a 1.5% agarose gel and an amplification product of 306 by was detected following ethidium bromide staining. The 306 by product was eluted from the gel using GeneClean~ (BIO101 Inc., Vista CA) according to the manufacturer's suggested protocol and ligated into vector pCR2.1~ (TA Cloning kit, Invitrogen, Carlsbad, CA). The resulting plasmid preparation was transformed into E. coli and the cells plated as described above. Several colonies were selected for DNA
minipreps and the cDNA inserts were sequenced.
The 306 by insert was excised from the pCR2.1 ~ TA Cloning vector by digestion with EcoRI. Following digestion, DNA fragments were fractionated on an agarose gel. A band of approximately 306 by was eluted from the gel and labeled by random priming according to standard procedures. The labeled probe was used to screen the human spleen adult cDNA pcDNAl library (described above) immobilized on nylon membranes following colony lifts from cells spread on LB/carbenicillin plates.
Two cDNA clones, designated 3.3 and 15.3.1, were obtained and purified.
Clone 3.3 included an insert of approximately 4200 by and clone 15.3.1 contained an insert of approximately 2?SO bp. Both clones were sequenced by standard automated methods. The nucleotide sequence for clone 3.3 is set out in SEQ ID NO: 9 and the predicted amino acid encoded is set out in SEQ ID NO: 10. The nucleotide sequence for clone 15.3.1 is set out in SEQ ID NO: 16. It was initially presumed that the two clones represented a single cDNA sequence and, relying predominantly on the larger 3.3 insert, a contiguous cDNA was predicted. Neither insert, however, encoded a complete open reading frame, as evidenced by the fact that an in frame ATG translation start site preceded by a Kozak translation initiator sequence and an in-frame stop codon were not found.
In an attempt to isolate the 5' end of the complete cDNA, RACE PCR was carried out using a human spleen cDNA library (MarathonTM cDNA, Clontech, La Jolla.
CA). Nested primers (SEQ ID NOs: 1? and 18} utilized in the PCR were designed based on the library vector and clone 3.3 sequences.
S' GTGATCCAGCTACAGTTGTGCTCAT SEQ ID NO: 17 5' CTAATGCTTCACAGAATCTCTCTGGC SEQ ID NO: 18 Five microliters of cDNA prepared from human spleen RNA or peripheral blood leukocyte RNA was added to separate reactions with 100 ng downstream nested gene specific primer, adapter primer AP1 (MarathonTM cDNA kit; Clontech Inc., Palo Alto CA), NM each deoxynucleotide triphosphate (adenosine, thymidine, cytidine, and guanosine), WO 99/45111 PC"f/US99/04676 mM Tris-HCI, pH 8.3 (at 25°C), 50 mM KCI, 1.5 mM MgCl2, S units Taq polymerase. PCR was carried out with an initial denaturation step for two minutes at 94 ° C, followed by (i) five cycles of 0.05 minutes at 94 ° C
and seven minutes at 74 ° C, (ii) five cycles of 0.05 minutes at 94 ° C and seven minutes at 72 °
C, and (iii) 25 cycles of 0.05 5 minutes at 94 ° C and seven minutes at 70 ° C. Following amplification, the reaction mixture was diluted 1:50, and Spl was used in a second amplification reaction including 100 ng upstream internal gene specific primer and adapter primer AP2 (MarathonTM
cDNA kit, Clontech) with the same cycling conditions as in the first amplification.
Amplification products from the second reaction were separated on a 0.9%
agarose gel 10 and a band of approximately 2 kb in the gel was eluted for subcloning into vector pCR2.1~ as above. The isolated fi-agment was designated RACE3.3. The nucleotide and predicted amino acid sequences for the fragment are set out in SEQ n7 NOs: 7 and 8, respectively.
When the RACE3.3 sequence was correlated with the sequence for the spleen clone 3.3 to account for overlap, an open reading frame (SEQ m NO: 33) was deduced encoding a polypeptide of 1114 amino acids (SEQ ID NO: 34) and a predicted molecular weight of approximately 125 kD. Even thought the EST used to screen the spleen library was selected based on sequence similarity to CD97, the polypeptide encoded by the overlapping clones was presumed to represent a unique family of human proteins, related to, but distinct from, any previously identified in GenBank~. The putative extracellular domain in the predicted amino acid sequence did not include EGF
domains characteristic of the CD97-like protein family and the amino acid sequence of the transmembrane domain in the predicted protein was only about 45-60% identical to the transmembrane domains of CD97. In addition, the predicted amino acid sequence deduced from the combined RACE3.3 and clone 3.3 open reading frame included potential lectin-binding, olfactomedin-like, and mucin-like extracellular domains not found in CD97. Based on the presence of the extracellular lectin binding-like and olfactomedin-like domains, the polypeptide encoded by the RACE3.3 and clone 3.3 sequences was designated lectomedin-la.
A later BLAST search of the GenBank~ database using the lectomedin-1 a sequence indicated that lectomedin-la was related to the rat receptor for a-latrotoxin designated latrophilin [Lenianova, et al., J. Biol. Chem. 272:21504-21508 (1997)], and the calcium-independent receptor of a-latrotoxin (CIRL) [Krasnoperov, supra].
Both human lectomedin-la and rat latrophilin have extracellular lectin binding-like and olfactomedin-like domains, in addition to a seven transmembrane region and a cytoplasmic S domain also found in CD97. Lectomedin-1 a also includes a sequence at amino acid residues 809 to 814 (in SEQ 11? NO: 2) which is similar to a proposed cleavage site conserved in both CD97 and latrophilin. It is possible that these three proteins are processed by an endoprotease (or related proteases) with similar primary sequence specificity. In view of these similarities, lectomedin-la may be related to a human homolog of the rat latrophilin and may participate in stimulation/secretion coupling in presynaptic termini and/or secretory granule release. Expression of lectomedin in cell and tissue types outside the central nervous system (discussed below), however, indicates that lectomedin is functionally distinct from latrophilin.
The overall amino acid sequence of lectomedin-la was found to be 1 S approximately 80% identical to that of latrophilin, but the amino acid sequence of the latrophilin cytoplasmic domain was unrelated to the predicted cytoplasmic domain of lectomedin-1 a. In addition, the location of the initiating methionine in latrophilin differed from thax in the predicted open reading frame of lectomedin-1 a. After further analysis of the lectomedin-1 a polynucleotide sequence, however, a methionine codon in a different reading frame was identified upstream from the originally predicted open reading frame.
The location of the upstream methionine codon (with respect to the transmembrane region) more closely corresponded to the position of the latrophilin initiating methionine and the first few amino acids in reading frame with the upstream methionine codon also corresponded to the sequence in latrophilin.
In view of the potential similarity to latrophilin, the polynucleotide sequence encoding the 1114 amino acid lectomedin-1 a open reading frame was again compared to the raw data obtained during automated sequencing of the RACE3.3 cDNA.
Further inspection showed that a guanosine nucleotide at position 454 had been entered in SEQ ID NO: 33, but was not present in the raw sequence data. The corrected nucleotide sequence for RACE3.3 (i.e., having the extraneous guanosine nucleotide .deleted} together with the sequence of clone 3.3 (SEQ ID NO: 9) showed an open reading WO 99/45111 PCT/US99/046'76 frame encoding 1177 amino acids. The corrected open reading frame began with the - newly identified initiating methionine and included the previously identified lectin binding-like, olfactomedin-like, mucin-like, transmembrane and cytoplasmic domains of lectomedin-la (SEQ m NO: 1).
Based on sequence homology with known proteins, domains in various regions of the lectomedin-1 a protein were identified. An extracellular region of approximately 831 amino acids showed homology to a previously reported D-galactoside binding lectin binding-like domain [Ozeki, et al., Biochemistry 30:2391-2394 (1991)]
(lectomedin-la amino acids 36 to 131 of SEQ ID NO: 2) and an olfactomedin-like domain [Yokoe and Anholt, Proc. Natl. Acac~ Sci. (USA) 90:4655-4659 (1993)]
(lectomedin-la amino acids 135 to 327 of SEQ ID NO: 2). Three extracellular and three intracellular domains were separated by seven transmembrane domains (amino acids 832 to 1075 of SEQ ID NO: 2) characteristic of G-protein coupled receptors (GPCR) [Kobilka, etal., Science 238:650-656 (1987)]. A cytoplasmic region of 102 amino acids was adjacent the transmembrane region. Based on the observation that lectomedin-la contained a region from amino acids 354 to 563 (SEQ m NO: 2) with many serine and threonine residues (which may be O-glycosylated), as well as many proline residues (which break up alpha helices resulting in an extended structure with many beta turns), a mucin-like domain was identified.
The sequence for lectomedin-l a was based on the sequences determined for clone 3.3 and the fragment RACE3.3. A second lectomedin cDNA could also be deduced based on the sequence of the second spleen clone 15.3.1. In comparing the sequences for clones 3.3 and 15.3.1, it was first noted that the clones were substantially identical throughout both 5' regions, except that an adenosine required at position 1620 of clone 3.3 (SEQ ID NO: 7) was apparently not present in clone 15.3 .1. As a result, the reading fi~ame of clone 15.3.1 was shifted in comparison to the reading frame of clone 3 .3, and thus, clone 15.3.1 did not encode a protein having the characteristic seven transmembrane domain found in lectomedin-la. When the variant adenosine was inserted into the sequence for clone 15.3.1, the predicted protein sequence was consistent with the lectomedin-la amino acid sequence up to the first amino acid residue in the cytoplasmic - domain. This sequence suggested an alternative splice site in the cytoplasmic region of clone 15.3.1 that produced a shorter cDNA comprising a cytoplasmic domain of approximately forty-eight amino acids (as compared to 107 amino acids in the cytoplasmic S domain of the lectomedin-1 a cDNA derived solely from clone 3.3 sequences).
The lectomedin-1 a cDNA deduced from clone 3.3 also terminated at an alternative poly(A+) site 210 nucleotides upstream from the corresponding poly(A+) site identified in clone 15.3. I . The differences suggested that clone 15.3.1 represents a second member of the lectomedin family, which was designated lectomedin-1(3. A deduced polynucleotide sequence for lectomedin-1 (i was therefore generated using the overlapping sequence from clone 3.3 (which extended the 5' region of clone 15.3.1) and the RACE3.3 sequence (to provide an appropriate 5' end); the complete predicted cDNA and deduced amino acid sequences for lectomedin-1(3 are set out in SEQ B7 NOs: 3 and 4, respectively.
Characterization of the predicted amino acid sequence for lectomedin-1 ~3 I S provides various domains similar (in both sequence and position) to those identified for lectomedin-1 a. An extracellular region of approximately 831 amino acids is predicted, including a D-galactoside-binding lectin-like domain (amino acids 36 to 131 of NO: 4), an olfactomedin-like domain (amino acids 135 to 327 of SEQ 1D NO: 4), and a mucin-like domain (amino acids 354 to 563 of SEQ m NO: 4). A seven transmembrane domain (amino acids 832 to 1075 of SEQ m NO: 4) was located adjacent the extracellular domain, and a cytoplasmic region of 48 amino acids (residues 1076 to 1123 of SEQ 117 NO: 4) was located adjacent the transmembrane region.
The originally identified EST designated T49702 (SEQ m NO: 13) was described in GenBank~ to represent the 5' end of a cDNA clone designated 71509 (SEQ
B7 NO: 21), and when GenBank~ was further searched for a DNA sequence representing the 3 ' end of clone 71509, a second EST designated T47903 (SEQ 1D NO: 30) was identified. Clone 71509 (SEQ m NO: 21) was purchased, sequenced, and compared to the corresponding regions in lectomedin-1 a and lectomedin-1 ~3. The sequence of clone 7I 509 was identical to portions of the lectomedin-1 a and 1 ~ sequences, but, like the alternative splicing apparent from comparing lectomedin-1 a and lectomedin-1 (3, yet another alternative splicing event was found based on the sequence of clone 71509.

WO 99/45111 PC"f/US99/04676 Specifically, the sequence of clone 71509 was found to lack a 106 by sequence found in _ clone 3.3. Clone 15.3.1 also lacked the same 106 by and an additional 97 by of 5' upstream DNA. Clone 15.3.1 therefore lacked 203 by of sequence found in the lectomedin-la clone. The 106 by deletion resulted in a frame shift in the region encoding the cytoplasmic domain, providing a third lectomedin protein. This third alternative lectomedin polynucleotide and predicted amino acid sequence (SEQ ID NO: 5 and 6, respectively) was designated lectomedin-ly.
As with the other lectomedin polypeptides, lectomedin-1 y is predicted to include (i) an extracellular region of approximately 831 amino acids with a D-galactoside binding lectin-Like domain (amino acids 36 to 131 of SEQ n7 NO: 6), an olfactomedin-like domain (amino acids 135 to 327 of SEQ ID NO: 6) and a mucin-like domain (amino acids 354 to 563 of SEQ ID NO: 6), (ii) a seven transmembrane region (amino acids 832 to 1075 of SEQ ID NO: 6), and (iii) a cytoplasmic region of 328 amino acids (amino acids 1076 to 1403 of SEQ ID NO: 6).
The sequences at which the three clones diverged showed hallmarks of the canonical 3' exon sequence with the presence of an AG dinucleotide. However, these regions dii~ered from the accepted intron junction sequences which have been found to include highly conserved GT dinucleotides [GENES IV, B. Lewin, Cell Press, Cambridge MA (1992), p. 597]. The identification of these sequences indicated that the clones were derived from alternatively spliced RNAs rather than from incomplete RNA
splicing wherein the canonical exon/intron junction sequence (AG/GT) would be expected.
Lectomedin 1 a and rat latrophilin (SEQ ID NO: 19) were used as query sequences in a subsequent BLAST search in an attempt to identify any additional ESTs with sequence homology. Two human ESTs designated AA683020 (SEQ ll7 NO: 22) and M79057 (SEQ ID NO: 23) were identified as being closely related to both lectomedin-la and rat latrophilin. The sequence for EST AA683020 corresponds to the region from nucleotide 3275 to 3643 in the lectomedin-la sequence (SEQ ID NO:
22) and the sequence for EST M79057 corresponds to nucleotides 2561 to 2842 in lectomedin-1 a.

The BLAST search results indicated that both ESTs were more closely - related to the sequence encoding rat latrophilin than to the nucleotide sequence encoding lectomedin-1 a, further distinguishing lectomedin-1 a from the rat protein and suggesting that the human ESTs may be more closely related to a putative human homolog of rat latrophilin. In view of the apparent relatedness between the human EST
sequences and human lectomedin-la, however, the AA683020 and M79057 ESTs were determined to represent unique lectomedin-2 and lectomedin-3 species.
In an effort to isolate cDNAs encoding full length lectomedin-2 and lectomedin-3 proteins, primers were designed based on the EST sequences for both lectomedin-2 and lectomedin-3 to amplify probes for library screening. Primers for amplifying a lectomedin-2 sequence were NHlect2.5 (SEQ ID NO: 35) and NHleet2.3 (SEQ ID NO: 36), and primers for the lectomedin-3 sequence were Nhlct.5 (SEQ
ID NO:
37) and NHlct.3 (SEQ ID NO: 38).
NHlect2.5 GGGCCTCACCTGGGCTTTCGGCCTCCTC SEQ ID NO:

NHlect2.3 GGACTGGTGCCCCCACGCGTGTCAGCAC SEQ D7 NO:

Nhlct.5 CCAACAAGACCCATACCAGCTGTG SEQ 117 NO:

Nhlct.3 CTGAGTCTTGTCGATCCCGACC SEQ ID NO:

PCR was carried out using a Clontech human brain Marathon-ReadyTM
cDNA library as template. Reaction conditions included an initial incubation at 94 ° C for five minutes, followed by 25 cycles at 94°C for 30 seconds, 55°C
for 30 seconds, and 72°C for 30 seconds, followed by a final extension step of 72°C
for 7 minutes and cooling to 4°C in a Perkin-Elmer GeneAmp PCR System 9700. The resulting PCR
products were gel purified using low melting point agarose (Gibco/BRL) and a QIAGEN~
gel extraction kit according to the manufacturer's suggested protocol. The purified amplification products were separately cloned into vector pCRII~ with a TA
Cloning kit (Invitrogen), and sequencing was carried out to identify errors associated with PCR.
Probes for cDNA library screening were prepared by purifying EcoRI
fragments from the pCRII~ clones. The lectomedin-2 digestion products provided two fragments, 274 and 158 bp, and the 274 by fragment was purified. The lectomedin-3 digestion resulted in a 297 by EcoRI fragment.
A human fetal brain cDNA library in the LAMBDA ZAP~ II vector was purchased from Stratagene (La Jolla, CA). Approximately 50,000 pfu were plated on twenty 150 mm LBM agar plates with LE392 E. coli. Plates were inverted and incubated at 3 7 ° C overnight. The next day, the plates were chilled at 4 ° C for two hours before preparing filter replicas. Amersham Hybond~N+ nylon transfer membrane filters, with a diameter of 132 mm and a removal rating of 0.45 Vim, were used to prepare two replicas of each plate. Filters were soaked in denaturing solution for two minutes, soaked in neutralizing solution for two minutes, and UV crosslinked in a Stratagene~ W
Stratalinker 2400. Filters were prehybridized overnight at 65°C with 20 filters in 80 ml of prehybridization solution.
Hybridization probes were prepared by labeling the EcoRI fragments with 32P-dCTP and 3zP-dTTP (800 Ci/mmol each, NEN Life Sciences Products) using a random priming kit (Boehringer Mannheim GmbH, Germany). The labeled probes were added to 20 ml hybridization solution per 20 filters and hybridization was carried out at 65 ° C overnight. The filters were washed the next day and air dried before autoradiography at -70°C for one to three days. Once films were developed, positive plaques were picked and removed to 500 pl of phage diluent buffer including one drop of chloroform. Dilutions of the positive plaques were prepared and plated on 100 mm LBM agar plates.
The plates were screened a second time as described above using 82 mm Amersham Hybond~N+ filters, except that only one set of replica filters was prepared.
Positive plaques from the second screening were screened for a third time to ensure that only positive plaques were picked for the phage rescue.
Positive plaques were prepared using an Exassist~/SOLR phage rescue system (Stratagene, La Jolla, CA) according to the manufacturer's suggested protocol.
The rescue procedure produced E. coli colonies containing the DNA of interest cloned into a pBluescript~ SK vector with flanking EcoRI restriction sites. Plasmid DNA was purified using the Wizard~ Plus Ntiniprep Kit (Promega, Madison, WI) and digested with EcoRI to determine relative size.

The resulting purified clones were analyzed by DNA sequencing at both - the 5' and 3' ends. Of the positive clones identified by the probe derived from EST
M79057, several of the longest isolates were chosen for complete DNA sequence analysis.
Two clones (designated 2.1 and 2.4) were found to comprise overlapping DNA
sequences totaling 5611 by including a complete open reading fame encoding 1470 amino acids.
Of the clones identified with the AA683020 probe, all comprised sequences identical to clones derived from EST M79057. These results indicated that the AA683020 and M79057 ESTs represented non-overlapping regions from a single mRNA species.
The two clones therefore were derived from the same lectomedin-2 gene. The polynucleotide encoding lectomedin-2 is set out in SEQ B7 NO: 57, and its amino acid sequence is set out in SEQ D7 NO: 58.
The organization of various domains in the predicted polypeptide sequence of lectomedin-2 was related to that in lectomedin-1. The approximately 851 amino acid extracellular domain of lectomedin-2 included a region with homology to the D-galactoside binding lectin-like domain (amino acids 36 to 131 of SEQ ID NO.:
57), an olfactomedin-like domain (amino acids 135 to 325 of SEQ m NO: 57), three extracellular and three intracellular domains separated by seven transmembrane domains (approximately amino acids 852 to 1095 of SEQ ID NO: 57) and a cytoplasmic region (approximately amino acids 1096 to 1470 of SEQ ID NO: 57). The cytoplasmic region of lectomedin-2 was most similar in length and sequence identity to lectomedin-ly.
Comparison of the overall polypeptide sequences of lectomedin-ly and lectomedin-2 showed 62.5% amino acid identity. Comparison of the overall polypeptide sequences of lectomedin-2 and CIRL showed 97.6% amino acid identity. These comparisons indicated that lectomedin-2 is more closely related by sequence to CIRL than lectomedin-.ly.
A strategy was designed to assemble the overlapping clones 2-1 and 2-4 in the mammalian expression vector pcDNA3 to produce full length lectomedin-2 open reading frame. Two primers (SEQ ID NOs: 61 and 62) were used to amplify a region of cDNA clone 2-1.
JD#1 ATATAAGCTTGCTGCCACCATGGCCCGC SEQ ID NO: 61 Lecto-3#31 ATGACCCACAGCCCGTTCTC SEQ IS NO: 62 Primer JD#1 (SEQ 117 NO: 61) incorporated a HindIII site to facilitate cloning. The _ resulting 843 by amplified product was digested with HindIII and BamHI and a 53 5 by DNA fragment was isolated. The 535 by fragment from clone 2-lwas ligated with a 1912 by BamHIlSaII fragment from clone 2-1, a 2904 by SaIIlEcoRV DNA fragment from clone 2-4, and pcDNA3 (Invitrogen) previously digested with HindIII and EcoRV.
Identification of Additional ,pctnmPdin sine A BLAST search of the GenBank EST database with lectomedin-la or lectomedin-2 as query sequences identified EST sequences identical to lectomedin-1, EST
sequences identical to lectomedin-2 and ESTs that were significantly related to but distinct from both known lectomedins. See Table 1. One of these unique lectomedin ESTs (GenBank Ace# 850822) was derived from clone #37438. Clone #37438 was purchased and its DNA sequence completely determined. The polynucleotide sequence for clone #37438 is set out in SEQ ID NO: 59, and the encoded amino acid sequence is set out in SEQ m NO: 60. The 3' sequence of clone #37438 is comprised of an untranslated region preceded by a predicted coding sequence for a protein with significant amino acid homology to the cytoplasmic domains of lectomedin-1 y and lectomedin-2. The 5' end of the sequence of clone #37438 was unrelated to the lectomedins, but was identical to the nucleotide sequence for a tRNA synthetase. This clone may represent a partially spliced ZO mRNA or it might be a cloning artifact.
The cDNA clone #37438 was used to generate a labeled probe to screen approximately one million clones from a human fetal brain cDNA library by techniques standard in the art. Hybridization was carried out at 43 °C in the presence of 45%
formamide and filters were washed in O.IX SSC at 68°C for 90 minutes.
Positive clones identified were isolated to homogeneity and partial sequence analysis was carried out with eleven of the clones. The DNA sequence of one clone (#11) was determined to have 3' sequences identical to clone #37438 and 5'sequences within the upstream coding sequences similar to, but distinct from, lectomedin-1 and lectomedin-2.

WO 99/45111 PC1'/US99/04676 - Table 1 Additi onal L.pctomedin Species Lectomedin-4 T10363 (SEQ ID NO:
39), 819057 (SEQ ID NO:
40), Lectomedin-5 850822 (SEQ ID NO:
41) Lectomedin-6 W03697 (SEQ 1D NO:
42) Lectomedin-7 H18951 (SEQ 11? NO:
43) Lectomedin-8 AA769730 (SEQ ID NO:
44) Lectomedin-9 C 17798 (SEQ ID NO:
45) Lectomedin-10 244961 (SEQ ID NO:
46) Lectomedin-11 AA369669 (SEQ ID NO:
47) Lectomedin-12 AB011122 (SEQ LD NO:
48) Example 2 Recombinant Expression of Lectomedin Lectomedin-la A. Expression vectors encoding lectomedin isoforms were constructed by combining DNA fragments from clone 3.3 and RACE3.3 described above.
In one approach, both clone 3.3 and RACE3.3 polynucleotides are first modified in the overlapping regions by insertion of a silent mutation to introduce a SacI
restriction site. PCR is employed using primers (SEQ ID NOs: 25 and 26) to amplify a 5' sequence from the RACE3.3 cDNA template that changes G to C at position 1455 to create the desired restriction site. In amplification of the RACE3.3 fragment, the 5' primer (SEQ LD NO: 26) is designed based on sequences at the ATG start codon;
the primer introduces a BamHI restriction site to facilitate cloning and a Kozak consensus start sequence.
S'-TCTTCAGCTGAGCTCTTCAAAACC SEQ LD NO: 24 5'-GGTTTTGAAGAGCTCAGCTGAAGA SEQ ID NO: 25 5'-CAGCAGGGATCCACCATGGTGTCTT-CTGGTTGCAGAATGCGAAGTCTGTGG SEQ ID NO: 26 5'-GACGATGACGCGGCCGCCTATTAAAGAC-TTGTAACCAGCTGCATTTGTCCTTCTC SEQ ID NO: 27 In amplification of the clone 3.3 DNA with primers set out in SEQ ID NOs: 24 and 27, the 3' primer is based on sequences at the stop site of translation and is designed to introduce a NotI restriction site.
The resulting amplification products, a RACE3.3 fragment with a 5' BamHI site and a 3' SacI site, and a clone 3.3 DNA with a 5'SacI site and a 3' NotI site, are digested with appropriate enzymes, ligated together, and cloned into the mammalian expression vector pcDNA+3, (Invitrogen, Carlsbad, CA) previously digested with BamHI
and NotI.
B. As an alternative approach, a lectomedin-la-encoding DNA is generated using PCR with the 5' primer used to amplify RACE3.3 described above and the 3' primer used to amplify the clone 3.3 DNA also described above.
In the PCR, both RACE3.3 and clone 3.3 DNA are combined with the two primers. After an initial denaturing step, the RACE3.3 and clone 3.3 DNA will anneal across the overlapping regions and the double stranded region will serve as primers in the first extension that produces a complete double stranded lectomedin-la DNA.
Subsequent amplifications will result from extension from the 5' and 3' primers. The amplification product is then purified, digested with BamHI and NotI, and inserted into the pcDNA vector previously digested with the same enzymes.
C. In another approach, an expression vector encoding lectomedin-la was constructed in a two step procedure. First, PCR was carried out using a XbaI
fragments of clone 3.3 and primers 3.3.24 (SEQ ID NO: 52) and Lecto 3' express (SEQ ID
NO:
27) along with Taq polymerise.
CCTACCACAGCTGTGACAATAACTTCTTCAGCTGAGC SEQ ID NO: 52 A second PCR was carried out using an EcoRI fragment of RACE 3 .3 as template DNA
and primers Lecto 5' express (SEQ ll~ NO: 26) and Lecto6 (SEQ 117 NO: 25) with Vent~
polymerise (New England Biolabs, Beverly, MA). The two amplification products were purified, denatured, and annealed. Because the two fragments overlap in a region of approximately 100 nucleotides, annealing results in a partially double stranded molecule spanning the entire lectomedin-1 a coding region. Extension with Taq polymerise first produces a double stranded lectomedin-1 a coding region. The double stranded molecule was then amplified using primers in SEQ ID NOs: 26 and 27. The SEQ ID NO: 26 primer was designed to introduce a BamHI restriction site, followed by a Kozak consensus start site. The resulting amplification product was digested with NotI and BamHI, and the lectomedin-la fragment was gel purified. The fragment was ligated into pcDNA3 (Invitrogen, Carlsbad, CA) previously digested with BamHI and NotI. Sequence analysis of the resulting plasmid, designated pcDNA3 Lectomedin-la#Z, indicated that several errors were introduced in the amplification process. The correct lectomedin-la coding sequence was constructed from regions of pcDNA3 Lectomedin-1a#2 without errors Iigated to fragments of RACE3.3 and clone 3.3 as follows.
A 166 by HindllIlBglll fi-agment from pcDNA3 Lectomedin-1 a#2, a 628 by BgIIIlBstXI fragment from RACE3.3, and a 775 by BstXIlApaI fragment from pcDNA3 Lectomedin-1 a#2 were ligated in the presence of pBluescript~ KS+
(pBSKS) (Stratagene) previously digested with Bsf~ and ApaI. The resulting plasnud was designated pB SKSlectoHindIII/ApaI# 14.
In a another reaction, a 306 by ApallEcoRI fragment from clone 3.3 and a 2486 by EcoRIlEcoRI fragment from clone 3.3 were ligated in the presence of pBSKS
previously digested with ApaI and EcoRI. The resulting plasmid was designated pBSKSlectolalphaEcoRI/ApaI#6.
Plasmids pNEF6 and pDEF2 encode promoter regions and a 5' intron from the gene encoding Chinese hamster ovary elongation factor 1, in addition to neomycin (G418) resistance for selection. Construction of pNEF6 and pDEF2 was carried out as follows.
Plasmid pEFI/3~T was generated by ligation of an 11 kb NotIlXbaI
fragment from pSK/EF1.12 (WO 98/49289, published November 5, 1998, incorporated herein by reference), having the XbaI site blunt ended with Klenow polymerase, with a _ 2.22 NotIlSmaI fragment from pDC31 (WO 98/49289).
Plasmid pNEF3 was generated by ligation of a 4.19 kb SaIIINs~'I fragment (the NStT site blunt ended with Klenow polymerase) from pSKEFl .7 (WO
98/49289) with a 7.96 kb SaIIlPmeI fragment from pNEF 1 (WO 98/49289).
Plasmid pNEFS was constructed with a 9.2 kb AscIlNotI fragment from pNEF3 and an 11 kb AscllNotI fragment from pEXl/X1V.
Plasmid pNEF6 was constructed by ligation of a 19.7 kb XbaIlAsp718 fragment fom pNEFS with a 0.844 kb XballAsp718 fragment from pRc/CMv (Invitrogen).
A 736 by NotIlHindIII fragment (including the intron sequence) was isolated from pDEF2 and combined with a 1571 HindIIIlApaI fragment (including the Kozak sequence, translation start site, and coding region for amino acids 1 to 515) from pBSKSIectoHindllI/ApaI#14, a 3714 by ApaIlXbaI fragment (encoding amino acids to I 177 of lectomedin-1 a and including a stop codon and untranslated sequences) from pB SKSlecto 1 alphaEcoRI/Apa#6, and pNEF6 previously digested with XbaI and NotI.
The resulting plasmid was designated pNEF6LectomedinlA#3.1.
Lectomedin-~ and Lectomedin-ly Clone 15.3.1 and clone 71509 were separately amplified with primers lecto3.3.10 and 3.3.19.
TCAGACACTCATACTGCTGTG SEQ ID NO: 49 CACAGTCCACAACTTGCAC SEQ ID NO: 50 The resulting amplification products were digested with StuI and NcoI, and a 113 by fragment from 15.3.1 (lectomedin-1~3) and a 210 by fragment from 71509 (lectomedin-ly) were purified. Each fragment was separately ligated into pBSKSlectolalphaEcoR1/ApaI#6 previously digested with StuI and NcoI. The resulting plasmids were designated pBSKSlectolbetaEcoRI/ApaI#7 and pBSKSlectolgammaEcoRI/ApaI#6.

To create a lectomedin-1 ~i expression plasmid, the reaction described above for construction of the lectomedin-1 a expression plasmid was repeated except that a 2586 by Apa1/XbaI fragment from pBSKSlectolbetaEcoRI/ApaI#7 was substituted for the 3714 by ApaIlXbaI from pBSKSIectolalphaEcoRI/ApaI#6 to provide plasmid pNEF6LectomedinlB#4.2.
To create a lectomedin-ly expression plasmid, the same lectomedin-la reaction above was carned out except that a 2683 by ApaIlXbaI fragment from pBSKSlectolgammaEcoRI/ApaI#6 was substituted for the 3714 by ApaIlXbaI from pBSKSlectolalphaEcoRI/ApaI#6 to provide plasmid pNEF6LectomedinlG.
An expression construct was also prepared in parental vector pDC37 encoding a soluble, truncated form of lectomedin-1 as a fusion protein with human immunoglobulin G1 hinge and constant heavy chain regions 2 and 3 [hinge CH2-CH3]
sequence [Sadhu, et al., Cell Adhesion and Commun. 2:429-440 (1994)]. Plasmid pDC37, encoding human VCAM-1 with human IgGl hinge-CH2 coding sequences, is a derivative of pDC31 generated by digestion with San, filled in with Klenow polymerase, and blunt end ligated to eliminate the SaII site.
Plasmid pDC37/VCAMI.IgI.Zc was digested with HindIII and Salt and a fragment lacking the VACM-1 coding region was isolated. The isolated HindIIilSall fragment was ligated with a 1571 by HirrdIIIlApaI fragment from pcDNA3Lectomedin-1 a#2 and an amplification product from clone 3.3 prepared using primers lecto Sal Ig (SEQ 117 NO: 51) and 3.3.24 (SEQ ID NO: 52).
lecto Sal Ig SEQ ID NO: 51 GACGCTGGTCGACTAGGTGGCTGCATGCACACGTTGTTCG
3.3.24 SEQ ID NO: 52 CCTACCACAGCTGTGACAATAACTTCTTCAGCTGAGC
Primer lecto Sal Ig generated a unique SaII site in the amplification product (after codon 811 of lectomedin-1) to permit in-frame ligation to IgGI coding sequences. The resulting plasmid was designated pDC37Lecto.Ig#7.

A ?36 by NotIlHindIli fragment from pDEF2 was ligated with a 1571 by HindIllllApaIII fragment (encoding the Kozak sequence, start site, and amino acids 1 to 515 from lectomedin-1 a) from pcDNA3 Lectomedin-la#2, a 1788 by ApallXbaI
fragment (encoding amino acids 516 to 811 from lectomedin-1 fused to IgG sequences) from pDC37Lecto.Ig#7, and pDEFl4 previously digested with NotI and XbaI. The resulting plasmid was designated pDEF l4Lecto.Ig#2.
Plasmid pDEFI4Lecto.Ig#2 was transfected into DHFR' DG44 CHO cells and stably transfected cells were selected.
Example 3 Characterization of Recombinant Lectomedin Characterization of the protein expression level in recombinant cells is carried out using polyclonal antisera (produced as described in Example 8), and functional analysis, with respect to latrotoxin binding (discussed below) and/or release of secretory granule contents, is performed as previously described.
In initial characterization, Chinese hamster ovary (CHO) cells were transfected by standard methods (i.e., calcium phosphate or cationic lipids) with lectomedin-la expression construct. After 48 hours incubation, the cells were lysed in PBS containing 1% Triton~ X-100 and protease inhibitors, and proteins in the detergent soluble fraction were separated by SDS-PAGE. After transfer to nitrocellulose membrane, the blot was incubated with rabbit antiserum immunospecific for lectomedin-1 a (generated against amino acids 432-852 as immunogen). Immunoreactivity was detected using a goat anti-rabbit IgG (conjugated with horseradish peroxidase) followed by chemiluminescence detection and exposure to X-ray film (using a Renaissance~
detection kit, NEN Life Sciences, Boston, MA)..
For functional characterization, secretory cells of the endocrine system are employed which readily accept DNA constructs by transfection. Cell lines useful in functional characterization include, for example, mouse anterior pituitary corticotroph continuous cells (AtT20; ATCC CCL 89), rat pancreatic islet insulinoma continuous cells (RinMSF), or human pituitary somatotroph continuous cells (GH3; ATCC CCL
82.1).
After an appropriate amount of time to allow protein synthesis, incubation of the transfected cells with alpha-latrotoxin, or another ligand, is followed by detection of stimulated secretion of proteins using enzyme-linked immunosorbant assay or radioimmunoassay (RIA). For example, increased secretion from the exemplified cells lines is accomplished through detection of adrenocorticotrophic hormone (ACTH) release from AtT20 cells, insulin release from RinMSF cells, or growth hormone release from GH3 cells.
In addition, since lectomedin-1 is a G-protein coupled receptor, ligand binding would be expected to trigger intracellular second messenger effector pathway activity changes such as, for example, increased production of cyclic AMP
{CAMP) or changes in intracellular calcium concentration. Changes of these types are measured by standard techniques, for example, RIA detection of cAMP or fluorescence detection of calcium binding indicators (i.e., Fura 2).
An exemplary alpha-latrotoxin binding assay has been previously described [Meldolesi, J. Neurochem. 38:1559-1569 (1982), Petrenko, et al., EMBO J, 9:2023-2027 (1990)]. Cells are transfected with either vector DNA alone (control cells) or a lectomedin 1-encoding expression plasmid (assay cells). Both assay and control cells are homogenized in buffer (120 mMNaCI, 4.7 mM KCI, 1.2 mM each MgS04, KZHPO4, and CaCl2, 20 mM Na2HP04-HCI, pH 7.4, and 10 mM glucose) and protein concentrations are determined by standard methods. Known amounts of protein from control or transfected assay cell membranes are spotted on nitrocellulose paper and placed in separate wells of a 24 well dish. The paper is rinsed once with buffer containing 100 mM
KCI, 2 mM CaClv and 20 mM Tris, pH 7.7, and incubated for one hour in the same buffer supplemented to 1.5% (w/v) with bovine serum albumin (BSA) (blocking buffer).
Solutions ofblocking buffer containing from 0.1 to 1.2 nM of l2sl-labeled alpha-latrotoxin, labeled to a specific activity of 1500 to 2000 Ci/mmol, without or with a large excess (100 nM) of unlabeled toxin are incubated for thirty minutes with the immobilized protein. The paper is rinsed three times with 1 ml of blocking buffer over a 20 minute time period and counts per minute remaining are determined with a gamma counter. Nonspecific binding is determined to be the value of radioactive counts remaining after incubation of labeled toxin in the presence of a large excess of unlabeled toxin. Specific counts are converted to nanomoles of toxin bound per milligram of protein spotted and the data is plotted as nanomoles bound toxin versus nanomoles free toxin. The data are converted to bound - toxin divided by free toxin versus bound toxin to derive a Scatchard plot for number of binding sites (a linear plot being the expected result for a single toxin binding site on the receptor).
In additional characterizations, the lectomedin fusion protein Lecto-lIg (Example 2) was purified using protein A Sepharose~ (Amersham Pharmacia Biotech, Piscataway, N~ affinity chromatography and conditioned growth media derived from one of two clones designated G10 and E10. Media was loaded onto the column which was then washed extensively with 50 mM Tris, pH 7.5, 50 mM NaCI. Protein was eluted in buffer containing 50 mM citric acid, pH 4.0, and 50 mM citric acid, pH 3Ø
The majority of the protein eluted in the pH 3.0 buffer. Protein fractions were pooled, neutralized with I M Tris, pH 8.0, and dialyzed against PBS. Purified protein was filtered, aliquoted, flash frozen and stored at -70 ° C.
Amino terminal sequencing indicated that the mature amino terminus of the protein was identified as a phenylalanine residue at position 26. This observation indicated that the recombinant protein was recognized and cleaved by a signal peptidase in the CHO cells and that the amino terminus was not blocked.
Size exclusion chromatography suggested a protein with a molecular weight of approximately 650 kDal as compared to the molecular weight determined on SDS PAGE of approximately I70 kDal. The gel filtration result suggested that four monomers combined to produce the 650 kDal protein.
Treatment of the protein with N-glycosidase F, O-glycosidase, and/or neurominidase (Boehringer Mannheim) in 10 mM Na2HP04 (pH 6.8), 5 mM EDTA, 0.25% Triton~ X-100, 0.5% SDS, and 0.5% (3-mercaptoethanol (BME), at 37°C, resulted in reduction of protein molecular weight. After treatment with N-glycosidase F
alone, monomeric protein molecular weight was approximately 130 kDal. After treatment with N-glycosidase F, O-glycosidase, and neuraminidase, monomeric protein molecular weight was approximately 125 kDal. These observations suggest that the observed SDS
PAGE molecular weight may be attributable to approximately 40 kDal N-linked carbohydrate and approximately 5 kDal O-linked carbohydrate.

Example 4 Ligand Affinity Chromatography In an attempt to isolate a ligand for lectomedin-1, an affinity column was generated with immobilized lectomedin-1. In short, 10 mg of purified sLecto-lIg was coupled to CNBr-activated Sepharose~ 4B resin (AmershamPharmacia) according to the manufacturer's suggested protocol. Greater than 96% of the lectomedin protein was coupled to the resin.
A detergent extract was prepared from human spleen (3.48 g wet weight}.
Tissue was homogenized in 15 ml buffer containing 1% Triton~X-100, 25 mM Tris, pH
8, 150 mM NaCI, 5 mM iodoaceta.mide, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 pg/ml pepstatin and aprotinin using a Waning blender.
Homogenization was carried out at low speed. The resulting homogenate was cooled on ice for one hour and centrifuged at 100,000 x g for 60 min. The supernatant (approximately 120 mg total protein) was mixed with the sLecto-lIg-coupled resin with rotation overnight at 4 ° C. The resin was drained and washed extensively with 10 mM
Tris (pH 8), 150 mM NaCI, and 10 mM Tris (pH 8), 1 M NaCI. Protein was eluted with five bed volumes of 100 mM D-lactose, 10 mM Tris, pH 8.0, 150 mM NaCI. Five equal fractions were collected. The resin was further eluted with four bed volumes of 100 mM
glycine, pH 2.0, and four equal fractions were collected and neutralized with 1 M Tris, pH
8Ø The resin was then neutralized in 10 mM Tris, pH 8.0/1 SO mM NaCI.
Fractions from the resin were analyzed by SDS-PAGE and bands of approximately 95, 71, 55 and kDal were detected.
Fractions with the highest protein yields were spin concentrated (Ultrafree~ 10, Millipore, New Bedford, MA) and proteins were separated with 12%
SDS-PAGE. Coomassie staining revealed four prominent bands in the lactose eluate of approximately 30-32, 55, 70, and 80-95 kDal. Bands were excised from the gel, rinsed twice in 50:50 acetonitrile:water, and stored at -70°C until sequence analyses were performed. Sequence results indicated that the 30-32 kDal protein was Mac-2 (also called galectin-3, GenBank~ Accession No: 8106937}, the 55 kDal protein was fibrinogen y A
chain (GenBank~ Accession No: 871827) and the 80-95 kDal protein was immunoglobulin mu chain constant region.

Mac-2 (galectin-3) is synthesized by numerous immune cell populations _ and epithelia, and is a major non-integrin laminin binding protein [Perillo, et al., J. Mol.
Meal 76:402-412 (1998)]. Recent observations indicated that Mao-2 was expressed in vessels in early atherosclerotic lesions in association with infiltrating monocytes.
Expression was not detected in normal vessels. Expression was also detected in aortic smooth muscle cells in culture, as well as in animals following a hypercholesterolemic feeding regimen and post balloon angioplasty [Aran, et al., FEBS Letts.430:307-(1998), Nachtigal, etal., Am.J.Pathol. 152:1199-1208 (1998)]. Mac-2 stimulates normal fibroblast proliferation, nears! cell adhesion, and neurite outgrowth [Inohjara, et la., Exp.
Cell. Res. 245:294-302 (1998); Pesheva, etal., J. Neurosci. Res 54:639-654 (1998)].
The binding results from lectomedin affinity chromatography, in view of the art, suggest that secretion of Mac-2 by infiltrating macrophages during atherogenesis and binding to lectomedin-1 expressed on smooth muscle cells of vascular tunics media may be required for smooth muscle proliferation in atherosclerosis. [Ross, Nature 362:801-809 (1993)].
Previous work has indicated that circulating components of the thrombolytic pathway, including firinogen, are associated with chronic vascular disease (i.e. , hypertension, atherosclerosis). Studied showed that circulating fibrinogen levels may be elevated in hypertensive patient populations. These observations suggest a role for lectomedin in various vascular disease states.
Example 5 Northern Analysis In an attempt to assess human lectomedin-1 a expression, Northern blot analysis was performed using a commercial mufti-tissue blot (Clontech, Palo Alto, CA) with RNA derived from various human tissue sources. The probe used was a 531 by BstXI fi-agment derived from the extracellular region of clone 3.3 (bases 1860 to 2350 in SEQ m NO: 7). Hybridization was carried out in Express-Hyb~' Solution (Clontech) at 68°C for two hours; the final wash was carned out at 68°C in O.1X SSC for one hour.
Results indicated expression of two predominant transcripts of 6.6 and 7 kb. The highest levels of expression were detected in spleen, prostate, and lung. Lower signals were in duodenum, placenta, thymus, testis, colonic mucosa, heart, and liver.
_ Lowest levels were found in skeletal muscle, kidney, pancreas, and brain. No signal was observed in ovary and peripheral blood leukocytes.
Ezample 6 In situ Hybridization In order to verify results from Northern analysis, in situ hybridization was carned out using various human tissue sections.
Probes for in situ hybridization analysis were prepared as follows. Clone 3.3 was engineered by PCR to include a SacI site near the 5' end of the cDNA
by changing a G nucleotide to C at position 1459 of the composite sequence. A 626 by SacIlEcoRI fragment was prepared and subcloned into pBSSK (Stratagene, La Jolla, CA).
The resulting plasmid was linearized with either EcoRI or SacI. The ends of the SacI
linearized DNA were made blunt by standard procedures using T4 DNA polymerise.
Linear DNAs were used to generate 35S-labeled sense or antisense strand probes for in situ hybridization with tissue sections from spleen, lung, prostate, heart, thymus, duodenum.
The results obtained from hybridization experiments were inconclusive due to high background with sense strand control probe.
In another approach to localizing the lectomedin-1 mRNA, two other fragments of the lectomedin-1 cDNA were subcloned into the pBluescript~
vector. A
1238 by BamHIlSacI fragment of lectomedin-la (SEQ ID NO: 1) was subcloned. A
representative clone including this fragment was designated as probe BS. A
2855 by BamHIlXbaI fragment of lectomedin-la (SEQ ID NO: 1) was subcloned and a representative clone was isolated and designated as probe BX. 35S-labeled sense and antisense probes from both BS and BX were prepared by methods standard in the art and hybridized with tissue sections from human brain occipital cortex, cerebellum and thalamus; interventricular septum, sino-atrial node and atrium of the heart;
small intestine, spleen, lung, prostate, adrenal gland and pancreas.
Specific signals were observed with the antisense BS probe in cardiac myocytes (heart), endocrine secretory cells ofthe adrenal cortex, occipital cortex neurons and cerebellar purkinje neurons, granule layer neurons and some molecular layer neurons.

The antisense BX probe produced similar patterns except for the presence of specific _ signals in a subset of secretory cells of the prostate.
Example 7 Human Lectomedin Chromosomal Localization The contiguous lectomedin-1 a cDNA deduced from combining clone 3.3 and RACE3.3 sequences was used as a query to search the NCBI Sequence-Tagged Sites {STS) database in an attempt to map the chromosomal location of a gene encoding lectomedin-1 a.
Two STSs were identified, designate SHGC-36772 and WI-11936, which were mapped to chromosome 1 by radiation hybrid mapping techniques. The STS WI-11936 mapping has been further refined to chromosome locus 1p31.
In an effort to identify the chromosomal localization of the gene for lectomedin-2, the full length nucleotide sequence was used to query the GenBank~ high throughput genomic sequences nucleotide database using the BLAST algorithm.
Results indicated that a portion of chromosome 17 had identity with a portion of the lectomedin-2 DNA sequence. Query of the human Genemap '98 at NCBI for the localization of this region of chromosome 17, showed that the lectomedin-2 gene mapped to chromosome 17p 11.1-q 12.
To identify the chromosomal localization of the gene for lectomedin-3, an accession number query (using EST 850822) of the Unigene database at the National Center for Biotechnology Information (NCBI) was carried out. The results identified a cluster ofESTs, including 850822 that mapped to human chromosome 4. Refinement of the localization was carried by searching the human GeneMap '98 out at NCBI, which showed that EST the cluster containing 880522 was assigned to 4q12-13.3.

- Example 8 Preparation of Antibodies to Lectomedin Generation of Polyclonal Anti-sera With Eatracell~lar he .tomedin-i Fragments An E. toll expression vector was constructed encoding the extracellular region oflectomedin-la (residues 432 to 852 of SEQ D7 NO: 1) as a fission protein with a biotinylated tag at the amino terminus. The plasmid, designed "Biolecto 1 st ECD" was constructed as follows.
PCR primers "lecto-I" and "lecto-2" (SEQ B3 NOs: 31 and 32, respectively) were used to amplify a 1283 by fragment of clone 3.3 (nucleotides 1508-2772 in SEQ ID NO: 9 which encodes the amino acid sequence from residue 432 to residue 852 of SEQ ID NO: 10). This region of the lectomedin-1 polypeptide is approximately 69% identical with latrophilin.
primer lecto-1 SEQ ID NO: 31 5'-TAC CACAACTGTAGCTGG
primer lecto-2 SEQ ID NO: 32 5'-TACAAGATCTAGCAGATAGCCAGGCAAACAAGGG
Primer lecto-1 introduced an NcoI restriction site (underlined above) in the amplification product and primer lecto-2 introduced a BglII restriction site (underlined above) and a translational termination site. The amplified fragment was subcloned into plasmid arabio lb previously digested with NcoI and Bglll to form plasmid Bio 1 ecto 1 stECD. The plasmid arabiolb contains the Salmonella typhimurium arabinose promoter and araC
gene, as well as the biotin transferase gene [Kashishian, et al., J. Bio.
Chem. 273:27412-27419 (1998)]. The expression product of the final construct provides a fusion protein of approximately 55 lcDa with the biotin tag at the N-terminus, and the lectomedin-1 amino acids 432 to 852 at the C-terminus.
The plasmid BiolectolstECD was transformed into E. toll using standard procedures and single colonies were isolated and gown for plasmid preparation.
A

culture including the desired plasmid was grown at 30°C in LB/caxbenicillin supplemented with biotin (4 uM} and induced in the presence of arabinose (0.5%) for 16 hours.
Bacteria were collected by centrifugation and lysed with hen egg lysozyme (10 ~.g/ml) in TEN buffer (50 mM Tris-HCI, pH 7.5 at 25 °C, 0.5 mM EDTA, 0.3 M NaCI) on ice for 15 minutes. After incubation on ice, NP-40 detergent was added to 0.2% final concentration and the resulting mixture sonicated briefly on ice. Insoluble material was removed by centrifugation at 15,000 x g for ten minutes, after which the pellet washed five times with the additional of TEN buffer followed by sonication and centrifugation.
The final pellet was solubilized in 2X sample loading buffer for preparative SDS-PAGE
separation.
A major band of 55 kDa was detected after treating the gel for 30 minutes in 0.4 M KCI. The 55 kDa band was excised from the gel and the fusion protein eluted in dialysis tubing using 0.5% SDS-PAGE running buffer. The collected protein was concentrated, spin-dialyzed (30,000 MW cutoff Ultrafree~ Centrifugal Filter Device;
Millipore Corp. Bedford, MA), and stored.
The purified protein was used to immunize two rabbits to generate antisera according to well known procedures. Briefly, two New Zealand white rabbits (designated #7234 and #7278) were prebled to obtain preimmune serum and then immunized with 250 pg ofpurified BiolectolstECD fusion protein emulsified with complete Freund's adjuvant.
The rabbits were boosted repeatedly with 250 pg of purified fusion protein in incomplete Fruend's adjuvant. The first three boosts were given at one month intervals, the third and fourth boosts following a three month interval, and the fourth and fifth boost following an additional one month interval. Blood was drawn by ear vein puncture two weeks after the second, third, fourth, and fifth boosts to determine antibody titers.
Immunoprecipitation was carned out with the resulting polyclonal sera using extracts from tissues/cell lines, including brain cortex, lung, spleen, liver, skeletal muscle, hippocampus, and prostate carcinoma cell line PC-3 (ATCC, CRL 1435).
Protein species having molecular weights of 200, 180, 170, and 70 kDa were detected which may have represented fiill length proteins, proteolytic fragments, or isoforms of lectomedin including the a, Vii, and y proteins .

Serum obtained from rabbit #7234 after the fifth boost was subjected to antigen-specific affinity chromatography by methods standard in the art.
Briefly, 10 ml of 0.45 or 0.8 microfiltered serum (100 x g supernatant) adjusted to 10 mM
Tris, pH 7.5, was incubated with sLecto-lIg agarose beads for 16 hours at 4°C with rotation. The beads were drained and washed with 20 bed volumes of 0.5 M NaC 1, 10 mM Tris, pH

7.5, until absorbance OD2go reached 0.03. Bound antibody was eluted with five bed volumes of 100 mM glycine, pH 2.5. The eluates were collected as 0. S ml fractions and neutralized with 1 M Tris, pH 8. The sLecto-lIg agarose beads were neutralized with 50 mM Tris, pH 7.5/150 mM NaC 1 and stored at 4 ° C in the same buffer supplemented with 0.1% timerool. Fractions were analyzed by SDS-PAGE for the presence of immunoglobulin heavy and light chains. The peak fractions were pooled, the buffer was exchanged with PBS, and the volume reduced by 90%. The final product was mixed with an equal volume of sterile glycerol, aliquoted, flash frozen, and stored at -70 ° C. until use.
Generation of Polyclonal Antisera With S~rnthetic i.ectomedin-1 C'~r~ohlacmic PP
Peptides specific to the carboxy terminal cytoplasmic regions of a, [3, and y isoforms of lectomedin-1 were synthesized as immunogens for producing polyclonal antisera in New Zealand White rabbits. The peptides were designed from the DNA
sequence in the cytoplasmic region of lectomedin 1 a (SEQ ID NO: 53), lectomedin 1 (3 (SEQ ID ON: 54}, and lectomedin l~y (SEQ D7 NO: 55).
Cys-Leu-Gln-Asp-Leu-Tyr-His-Leu-Glu-Leu-Leu-Leu-Gly-Gln-Ile-Ala SEQ m NO: 53 Cys-Thr-Arg-Thr-Ser-Ala-Arg-Tyr-Ser-Ser-Gyl-Thr-GIn-Asp-lle-His SEQ ID NO: 54 Cys-Glu-Gly-Asp-Val-Arg-Glu-Gly-Gln-Met-Gln-Leu-Val-Thr-Ser-Leu SEQ ID NO: 55 Peptides comprising the carboxy terminal regions of the related lectomedin-2 (SEQ ID
NO: 63) and lectomedin-3 (SEQ ID NO: 64) proteins were also synthesized.
Cys-Pro-Gly-Pro-Asp-Gly-Asp-Gly-Gln-Met-Gln-Leu-Val-Thr-Ser-Leu SEQ ID NO: 63 Cys-Pro-Glu-Gly-Ser-Ser-Lys-Gly-Pro-Ala-His-Leu-Val-Thr-Ser-Leu SEQ ID NO: 64 The synthesized peptides were individually conjugated to Keyhole Limpet Hemocyanin (KLH) (Imject, Pierce) according to the manufacturer's suggested protocol.
Rabbits were prebled, and 100 llg of conjugated peptide in complete Freund's adjuvant was injected per rabbit, two rabbits per isoform. At three week intervals, the rabbits were boosted with the same dose of antigen in incomplete Freud's adjuvant. Animals were bled 10 days after the third injection and serum titer determined by ELISA.
Briefly, Immulon~ 4 (Dynax Technologies, Chantilly, VA) plates were coated with unconjugated peptide at 2 pg/ml. Plates were blocked with 0.5%
fish skin gelatin and washed. Serial dilutions of the pre-immune serum and test bleeds from each rabbit were incubated on the peptide-coated plates. After washing, goat anti-rabbit-horseradish peroxidase (HRP) conjugated secondary antibody was added. The plates were washed and signal detected by tetramethyl benzidine (TMB) (Sigma) reagent.
Serum from rabbits #6484 and #6453 immunized with the lectomedin-1 (3 peptide showed reactivity three-fold greater than pre-immune serum at a 3000-fold dilution. Serum from rabbits #6868 and #6307 immunized with lectomedin-l~y showed three-fold greater reactivity over pre-immune serum at a 3000-fold dilution.
Serum from rabbits #7347 and #6490 immunized with lectomedin-la, showed three-fold greater reactivity at a 200-fold dilution.
In view ofthese results, a second lectomedin-la peptide (SEQ ID NO: 56) was synthesized and the immunization protocol described above was repeated with two additional rabbits. Serum from these rabbits is assayed for specific reactivity as described above.

Cys-S er-Arg-Ile-Arg-Arg-Met-Trp-Asn-Asp-Thr-Val-Arg-Lys-Gln-Ser SEQ ID NO: 56 Monoclonal Antibody Production In an attempt to produce monoclonal antibodies immunospecific for lectomedin polypeptides, the following procedure was carried out.
Five 6 to 12 week old BALB/c mice were prebled on day 0 and immunized by subcutaneous injection with 20 pg of the lectomedin-1 a, lectomedin-1 ~3, or lectomedin-ly peptides (SEQ ID NOs: 53, 54, and 55) described above (60 pg total) in complete Freund's adjuvant. On Days 21, 41, and 62, each mouse was boosted with 10 pg of each peptide (30 ug total) in incomplete Freund's adjuvant. Test bleeds were drawn on day 72 and reactivity determined by ELISA against individual peptides as described in generation of polyclonal antisera, with the exception that specific mouse antibody was detected with a goat anti-mouse-HItP.
1 S Immune serum from all five mice showed reactivity to lectomedin-1 ~i and lectomedin-ly peptides greater than pre-immune serum at a 12800-fold dilution.
Serum from all of the mice showed modest reactivity to lectomedin-1 a peptide.
Additional peptides comprising the carboxyl termini of lectomedin-2 and lectomedin-3 (SEQ ID NOs: 58 and ) were synthesized to screen for cross reactive antibodies recognizing similar epitopes found in termini of lectomedin-1 y, lectomedin-2 and lectomedin-3.
In an another approach to generate an immune response to lectomedin-1 a, five additional mice were immunized with the second lectomedin-1 a peptide (SEQ ID
NO: 56) described above. Immune serum from each of the mice is tested for lectomedin-1 a reactivity by ELISA (described above) prior to fusion and hybridoma cloning.
The spleen of the immunized animal is removed aseptically and a single-cell suspension is formed by grinding the spleen between the frosted ends of two glass microscope slides submerged in serum free RPMI 1640 (Gibco, Canada) supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 pg/ml streptomycin. The cell suspension is filtered with a sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 x g for five minutes and resuspending the pellet in 20 ml serum free RPMI.
Thymocytes taken from naive Balb/c mice are prepared in the same manner.
Approximately 2 x 10g spleen cells are combined with 4 x 10' NS-1 cells (kept in log phase in RPMI with 11% fetal bovine serum [FBS] for three days prior to fusion). The cells are collectedy centrifugation and the supernatant is aspirated. The cell pellet is dislodged and 2 ml of 37°C PEG 1500 (50% in 75 mM HEPES, pH

8.0) (Boehringer Mannheim) is added while stirring over the course of one minute, followed by the addition of 14 ml of serum free RPMI over seven minutes. Additional RPMI can be added and the cells are centrifuged at 200 x g for 10 minutes. After discarding the supernatant, the pellet is resuspended in 200 ml RPMI containing 15% FBS, 100 mM
sodium hypoxarnhine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim), and 1.5 x 106 thymocytes/ml. The suspension is dispensed into ten 96-well flat bottom tissue culture plates (Corning, United Kingdom) at 200 IcUwell. Cells are fed on days 2, 4, and 6 days post-fusion by aspirating 100 pl from each well and adding 100 pl/well plating medium containing 10 U/ml IL-6 and lacking thymocytes.
When cell growth reaches 60-80% confluence (day 8 to 10), culture supernatants are taken from each well and screened for reactivity to lectomedin by ELISA.
ELISAs are performed as follows. Immulon~ 4 plates (Dynatech, Cambridge, Massachusetts) are coated at 4°C with 50 pl/well with 100 ng/well of immunogen in 50 mM carbonate buffer, pH 9.6. Plates are washed with PBS with 0.05%, Tween~ 20 (PBST) and blocked 30 minutes at 37°C with 0.5% fish skin gelatin.
Plates are washed as described above and 50 pl culture supernatant is added. After incubation at 37°C for minutes, plates were washed as above, then 50 pl of horseradish peroxidase conjugated 25 goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, Pennsylvania) [diluted 1:10,000 in PBST] is added. Plates are incubated at 37°C for 30 minutes, washed with PBST and 100 pl of substrate, consisting of 1 mg/ml TMB (Sigma) and 0.15 mUml 30%
H202 in 100 mM citrate, pH 4.5, is added. The color reaction is stopped with the addition of 50 pl of 15% HZSO4. Absorbance at 450 nm is read on a plate reader (Dynatech).

Example 9 Immunocytochemistry for Expression of Lectomedin Polyclonal antisera generated in rabbit #7234 (and affinity purified) as described above was used to determine lectomedin expression patterns in human and rat tissues. Human tissues were obtained from the National Disease Research Interchange (NDRI, Philadelphia, PA), including human brain (cortex and cerebellum), heart (septum and atrium), prostate, lung, liver, spleen, small intestines, adrenal gland, and artery (renal, pulmonary and subclavian). Aorta was obtained from the Pathological determinants of ~therosclerosis in youth (PDA~ Study, Louisiana State University Medical Center. Rat tissue was prepared using procedures well known and routinely practiced in the art.
Frozen tissues were embedded in OCT (Tissue-Tek), sectioned at 6 micron thickness, mounted onto Superfrost~ Plus (VWR Scientific) slides, and stored at -20°C
until the assay was performed. Paraffin-embedded, formalin-fixed tissues were stored at room temperature until the assay was performed. Prior to assay, frozen tissue was fixed in acetone for two minutes at 4°C, except for brain tissue which was fixed in ether for five minutes at room temperature. Formalin-fixed tissue was deparaffulized with two three-minute washes in each of xylene, 100% ethanol, 95% ethanol, and 70% ethanol.
Endogenous peroxidase activity was quenched by incubating the fixed cryosections in buffer containing 0.1% sodium azide and 0.33% hydrogen peroxide in phosphate buffered saline (PBS) during a 15 minute incubation. All incubations were carried out at room temperature unless otherwise indicated. Slides were rinsed in TBST (20 mM
Trizma~
base [Sigma], I50 mM NaCI, 0.05% Tween~, pH 7.2) and blocked in a solution containing 30 % normal human serum albumin (Boston Biomedica), S% normal goat serum (Harlan), and 2% bovine serum albumin (Sigma) in TBST for 30 minutes.
Nonspecific binding was blocked using sequential 15 minute incubations with avidin and biotin blocking solution (SP-2001, Vector Labs, Burlingame CA). Slides were rinsed in TSBT after each incubation. Primary antibody at concentrations ranging from 1 gg/ml to S pg/ml was applied to each section for one hour, after which sides were washed in TSBT three times. Biotinylated goat anti-rabbit antibody conjugated to peroxidase (Vector Labs) was diluted 1:200 in blocking solution and applied to the slides for 30 minutes. Slides were washed for five minutes and incubated for 30 minutes with ABC
Elite reagent (avidin-biotin-peroxidase kit PK-6100, Vector Labs). Slides were washed twice for five minutes per wash in TSBT. Substrate solution (DAB substrate kit for peroxidase, Vector Labs) was applied to the slides and the desired color intensity was allowed to develop over approximately five minutes. The reaction was stopped with deionized water, and the slides were counterstained with Gill's hematoxylin (Sigma) solution, rinsed in water, dehydrated in ethanol, and mounted with Cytoseal mounting medium (Stephens Scientific) for light microscopic evaluation.
In human brain cortex, labeling with 7234 sera was detected in a subset of neurons (inciuding large and small pyrimidal neurons), granule cells, and smooth muscle cells of the vasculature. Human cerebellum staining with 7234 sera was localized to purkinje neurons and neurons of the granular cell layer. Human heart (septal and atrial sections) showed cardiomyocyte immunoreactivity, most prominently at cardial myocyte cell junctions transverse to the plane of the contractile apparatus called intercalated dicks.
In double label experiments using a commercially available connexin antibody (Zymed, San Francisco, CA), which stains connexin found at the intercalated disks, the previous results were confyrmed as results indicated that connexin antibody and 7234 antisera staining co-localized on the intercalated disks.
Sections of human prostate showed weak stromal cell labeling and cytoplasmic skeletal muscle staining. Lung staining was found in cartilage and some bronchial smooth muscle cells, with certain cells staining more strongly than others. The medulla of the adrenal gland showed strong positive staining.
Human liver, spleen, and small intestines exhibited a non-specific pattern of immunoreactivity. Human aorta showed inununoreactivity with 7234 sera in the vessel wall that was primarily located in the tunica intima (lumenal muscle layer) and tunics media (intermediate muscle layer). Thoracic aorta, pulmonary artery, and renal antery each showed similar staining patterns. When compared with staining with an antibody to smooth muscle a-actin (an accepted marker for smooth muscle cells), lectomedin-immunoreactivity was found primarily in the same cells (i.e., smooth muscle cells).
Staining in rat tissues with 7234 sera demonstrated similar patterns as observed in human tissues. In brain, some neuronal populations and the smooth muscle ofthe vasculature were stained. In the heart, disks, cardiomyocytes, and vascular smooth muscle all showed immunoreactivity.

_ While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the appended claims should be placed on the invention.

SEQUENCE LISTING
<110> Hayflick, Joel <120> Lectomedin Materials and Methods <130> 27866/35307 <190>
<141>
<150> 60/076,782 <151> 1998-03-04 <160> 64 <170> PatentIn Ver. 2.0 <210> 1 <211> 5597 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (217)..(3747) <400> 1 cggcgaacag acgttctttc tcctccatgc agttacacaa aaggagggct acggaaacta 60 aaagtttcgg ggcctctggc tcggtgtgtg gagaaaagag aaaacctgga gacgggatat 120 gaagatcaat gatgcagact gatggtcttg atgaagctgg gcatttataa ctagattcat 180 taaggaatac aaagaaaata cttaaaggga tcaata atg gtg tct tct ggt tgc 234 Met Val Ser Ser Gly Cys aga atg cga agt ctg tgg ttt atc att gta atc agc ttc tta cca aat 282 Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn aca gaa ggt ttc agc aga gca get tta cca ttt ggg ctg gtg agg cga 330 Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg gaa tta tcc tgt gaa ggt tat tct ata gat ctg cga tgc ccg ggc agt 378 Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser gat gtc atc atg att gag agc get aac tat ggt cgg acg gat gac aag 426 Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys att tgt gat get gac cca ttt cag atg gag aat aca gac tgc tac ctc 479 Ile Cys Asp Ala Asp Pro Phe Gln Met Glu Asn Thr Asp Cys Tyr Leu ccc gat gcc ttc aaa att atg act caa agg tgc aac aat cga aca cag 522 Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln tgt ata gtagttactggg tcagatgtg tttcctgat ccatgtcct gga 570 Cys Ile ValValThrGly SerAspVal PheProAsp ProCysPro Gly aca tac aaataccttgaa gtccaatat gaatgtgtc ccttacatt ttt 618 - Thr Tyr LysTyrLeuGlu ValGlnTyr GluCysVal ProTyrIle Phe gtg tgt cctgggaccttg aaagcaatt gtggactca ccatgtata tat 666 Val Cys ProGlyThrLeu LysAlaIle ValAspSer ProCysIle Tyr gaa get gaacaaaaggcg ggtgettgg tgcaaggac cctcttcag get 714 Glu Ala GluGlnLysAla GlyAlaTrp CysLysAsp ProLeuGln Ala gca gat aaaatttatttc atgccctgg actccctat cgtaccgat act 762 Ala Asp LysIleTyrPhe MetProTrp ThrProTyr ArgThrAsp Thr tta ata gaatatgettct ttagaagat ttccaaaat agtcgccaa aca 810 Leu Ile GluTyrAlaSer LeuGluAsp PheGlnAsn SerArgGln Thr aca aca tataaacttcca aatcgagta gatggtact ggatttgtg gtg 858 Thr Thr TyrLysLeuPro AsnArgVaI AspGlyThr GlyPheVal Val tat gat ggtgetgtcttc tttaacaaa gaaagaacg aggaatatt gtg 906 Tyr Asp GlyAlaValPhe PheAsnLys GluArgThr ArgAsnIle Val aaa ttt gacttgaggact agaattaag agtggcgag gccataatt aac 954 Lys Phe AspLeuArgThr ArgIleLys SerGlyGlu AlaIleIle Asn tat gcc aactaccatgat acctcacca tacagatgg ggaggaaag act 1002 Tyr Ala AsnTyrHisAsp ThrSerPro TyrArgTrp GlyGlyLys Thr gat atc gacctagcagtt gatgaaaat ggtttatgg gtcatttac gcc 1050 Asp Ile AspLeuAlaVal AspGluAsn GlyLeuTrp ValIleTyr Ala act gaa cagaacaatgga atgatagtt attagccag ctgaatcca tac 1098 Thr Glu GlnAsnAsnGly MetIleVal IleSerGln LeuAsnPro Tyr act ctt cgatttgaagca acgtgggag actgtatac gacaaacgt gcc 1146 Thr Leu ArgPheGluAla ThrTrpGlu ThrValTyr AspLysArg Ala gca tca aatgettttatg atatgcgga gtcctctat gtggttagg tca 1194 Ala Ser AsnAlaPheMet IleCysGly ValLeuTyr ValValArg Ser gtt tat caagacaatgaa agtgaaaca ggcaagaac tcaattgat tac 1242 Val Tyr GlnAspAsnGlu SerGluThr GlyLysAsn SerIleAsp Tyr att tat aatacccgatta aaccgagga gaatatgta gacgttccc ttc 1290 Ile Tyr AsnThrArgLeu AsnArgGly GluTyrVal AspValPro Phe cccaaccag tatcagtat attgetgca gtggattac aatccaaga gat 1338 ProAsnGln TyrGlnTyr IleAlaAla ValAspTyr AsnProArg Asp aaccaactt tacgtgtgg aacaataac ttcatttta cgatattct ctg 1386 AsnGlnLeu TyrValTrp AsnAsnAsn PheIleLeu ArgTyrSer Leu gagtttggt ccacctgat cctgcccaa gtgcctacc acagetgtg aca 1434 GluPheGly ProProAsp ProAlaGln ValProThr ThrAlaVal Thr ataacttct tcagetgag ctgttcaaa accataata tcaaccaca agc 1482 IleThrSer SerAlaGlu LeuPheLys ThrIleIle SerThrThr Ser actacttca cagaaaggc cccatgagc acaactgta getggatca cag 1530 ThrThrSer GlnLysGly ProMetSer ThrThrVal AlaGlySer Gln gaaggaagc aaagggaca aaaccacct ccagcagtt tctacaacc aaa 1578 GluGlySer LysGlyThr LysProPro ProAlaVal SerThrThr Lys attccacct ataacaaat atttttccc ctgccagag agattctgt gaa 1626 IleProPro IleThrAsn IlePhePro LeuProGlu ArgPheCys Glu gcattagac tccaagggg ataaagtgg cctcagaca caaagggga atg 1674 AlaLeuAsp SerLysGly IleLysTrp ProGlnThr GlnArgGly Met atggttgaa cgaccatgc cctaaggga acaagagga actgcctca tat 1722 MetValGlu ArgProCys ProLysGly ThrArgGly ThrAlaSer Tyr ctctgcatg atttccact ggaacatgg aaccctaag ggccccgat ctt 1770 LeuCysMet IleSerThr GlyThrTrp AsnProLys GlyProAsp Leu agcaactgt acctcacac tgggtgaat cagctgget cagaagatc aga 1818 SerAsnCys ThrSerHis TrpValAsn GlnLeuAla GlnLysIle Arg agcggagaa aatgetget agtcttgcc aatgaactg getaaacat acc 1866 SerGlyGlu AsnAlaAla SerLeuAla AsnGluLeu AlaLysHis Thr aaagggcca gtgtttget ggggatgta agttcttca gtgagattg atg 1914 LysGlyPro ValPheAla GlyAspVal SerSerSer ValArgLeu Met gagcagttg gtggacatc cttgatgca cagctgcag gaactgaaa cct 1962 GluGlnLeu ValAspIle LeuAspAla GlnLeuGln GluLeuLys Pro agtgaaaaa gattcaget ggacggagt tataacaag gcaattgtt gac 2010 SerGluLys AspSerAla GlyArgSer TyrAsnLys AlaIleVal Asp aca gtggacaac cttctgaga cctgaaget ttggaatca tggaaacat 2058 Thr ValAspAsn LeuLeuArg ProGluAla LeuGluSer TrpLysHis atg aattcttct gaacaagca catactgca acaatgtta ctcgataca 2106 - Met AsnSerSer GluGlnAla HisThrAla ThrMetLeu LeuAspThr ttg gaagaagga gettttgtc ctagetgac aatctttta gaaccaaca 2154 Leu GluGluGly AlaPheVal LeuAlaAsp AsnLeuLeu GluProThr agg gtctcaatg cccacagaa aatattgtc ctggaagtt gccgtactc 2202 Arg ValSerMet ProThrGlu AsnIleVal LeuGluVal AlaValLeu agt acagaagga cagatccaa gactttaaa tttcctctg ggcatcaaa 2250 Ser ThrGluGly GlnIleGln AspPheLys PheProLeu GlyIleLys gga gcaggcagc tcaatccaa ctgtccgca aataccgtc aaacagaac 2298 Gly AlaGlySer SerIleGln LeuSerAla AsnThrVal LysGlnAsn agc aggaatggg cttgcaaag ttggtgttc atcatttac cggagcctg 2346 Ser ArgAsnGly LeuAlaLys LeuValPhe IleIleTyr ArgSerLeu gga cagttcctt agtacagaa aatgcaacc attaaactg ggtgetgat 2394 Gly GlnPheLeu SerThrGlu AsnAlaThr IleLysLeu GlyAlaAsp ttt attggtcgt aatagcacc attgcagtg aactctcac gtcatttca 2442 Phe IleGlyArg AsnSerThr IleAlaVal AsnSerHis ValIleSer gtt tcaatcaat aaagagtcc agccgagta tacctgact gatcctgtg 2490 Val SerIleAsn LysGluSer SerArgVal TyrLeuThr AspProVal ctt tttaccctg ccacacatt gatcctgac aattatttc aatgcaaac 2538 Leu PheThrLeu ProHisIle AspProAsp AsnTyrPhe AsnAlaAsn tgc tccttctgg aactactca gagagaact atgatggga tattggtct 2586 Cys SerPheTrp AsnTyrSer GluArgThr MetMetGly TyrTrpSer acc cagggctgc aagctggtt gacactaat aaaactcga acaacgtgt 2634 Thr GlnGlyCys LysLeuVal AspThrAsn LysThrArg ThrThrCys gca tgcagccac ctaaccaat tttgcaatt ctcatggcc cacagggaa 2682 Ala CysSerHis LeuThrAsn PheAlaIle LeuMetAla HisArgGlu att gcatataaa gatggcgtt catgaatta cttcttaca gtcatcacc 2730 Ile AlaTyrLys AspGlyVal HisGluLeu LeuLeuThr ValIleThr tgg gtgggaatt gtcatttcc cttgtttgc ctggetatc tgcatcttc 2778 Trp ValGlyIle ValIleSer LeuValCys LeuAlaIle CysIlePhe accttc tgctttttc cgtggccta cagagtgac cgaaatact attcac 2826 ThrPhe CysPhePhe ArgGlyLeu GlnSerAsp ArgAsnThr IleHis aagaac ctttgtatc aaccttttc attgetgaa tttattttc ctaata 2874 LysAsn LeuCysIle AsnLeuPhe IleAlaGlu PheIlePhe LeuIle ggcatt gataagaca aaatatgcg attgcatgc ccaatattt gcagga 2922 GlyIle AspLysThr LysTyrAla IleAlaCys ProIlePhe AlaGly cttcta cactttttc tttttggca gettttget tggatgtgc ctagaa 2970 LeuLeu HisPhePhe PheLeuAla AlaPheAla TrpMetCys LeuGlu ggtgtg cagctctaccta atgttagtt gaagttttt gaaagt gaatat 3018 GlyVal GlnLeuTyrLeu MetLeuVal GluValPhe GluSer GluTyr tcaagg aaaaaatattac tatgttget ggttacttg tttcct gccaca 3066 SerArg LysLysTyrTyr TyrValAla GlyTyrLeu PhePro AlaThr gtggtt ggagtttcaget getattgac tataagagc tatgga acagaa 3114 ValVal GlyValSerAla AlaIleAsp TyrLysSer TyrGly ThrGlu aaaget tgctggcttcat gttgataac tactttata tggagc ttcatt 3162 LysAla CysTrpLeuHis ValAspAsn TyrPheIle TrpSer PheIle ggacct gttaccttcatt attctgcta aatattatc ttcttg gtgatc 3210 GlyPro ValThrPheIle IleLeuLeu AsnIleIle PheLeu ValIle acattg tgcaaaatggtg aagcattca aacactttg aaacca gattct 3258 ThrLeu CysLysMetVal LysHisSer AsnThrLeu LysPro AspSer agcagg ttggaaaacatt aagtcttgg gtgcttggc getttc getctt 3306 SerArg LeuGluAsnIle LysSerTrp ValLeuGly AlaPhe AlaLeu ctgtgt cttcttggcctc acctggtcc tttgggttg cttttt attaat 3354 LeuCys LeuLeuGlyLeu ThrTrpSer PheGlyLeu LeuPhe IleAsn gaggag actattgtgatg gcatatctc ttcactata tttaat getttc 3402 GluGlu ThrIleValMet AlaTyrLeu PheThrIle PheAsn AlaPhe caggga gtgttcattttc atctttcac tgtgetctc caaaag aaagta 3450 GlnGly ValPheIlePhe IlePheHis CysAlaLeu GlnLys LysVal cgaaaa gaatatggcaag tgcttcaga cactcatac tgctgt ggaggc 3998 ArgLys GluTyrGlyLys CysPheArg HisSerTyr CysCys GlyGly ctc cca act gag agt ccc cac agt tca gtg aag gca tca acc acc aga 3546 Leu Pro Thr Glu Ser Pro His Ser Ser Val Lys Ala Ser Thr Thr Arg acc agt get cgc tat tcc tct ggc aca cag agt cgt ata aga aga atg 3594 Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg Ile Arg Arg Met tgg aat gat act gtg aga aaa caa tca gaa tct tct ttt atc tca ggt 3642 Trp Asn Asp Thr Val Arg Lys Gln Ser Glu Ser Ser Phe Ile Ser Gly gac atc aat agc act tca aca ctt aat caa gga ctg aca tca cat ggt 3690 Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly Leu Thr Ser His Gly ctg aga gcc cat ctt caa gat tta tat cat tta gag cta ctc tta ggc 3738 Leu Arg Ala His Leu Gln Asp Leu Tyr His Leu Glu Leu Leu Leu Gly cag ata gcc tgagcagaca gacatgatgt gagttgtcca aagacattca 3787 Gln Ile Ala ctgaacaatg ccagggatac aagtgccatg gatactctac cgctaaatgg taattttaac 3847 aacagctact cgctgcacaa gggtgactat aatgacagcg tgcaagttgt ggactgtgga 3907 ctaagtctga atgatactgc ttttgagaaa atgatcattt cagaattagt gcacaacaac 3967 ttacggggca gcagcaagac tcacaacctc gagctcacgc taccagtcaa acctgtgatt 4027 ggaggtagca gcagtgaaga tgatgctatt gtggcagatg cttcatcttt aatgcacagc 4087 gacaacccag ggctggagct ccatcacaaa gaactcgagg caccacttat tcctcagcgg 4147 actcactccc ttctgtacca accccagaag aaagtgaagt ccgagggaac tgacagctat 4207 gtctcccaac tgacagcaga ggctgaagat cacctacagt cccccaacag agactctctt 4267 tatacaagca tgcccaatct tagagactct ccctatccgg agagcagccc tgacatggaa 4327 gaagacctct ctccctccag gaggagtgag aatgaggaca tttactataa aagcatgcca 4387 aatcttggag ctggccatca gcttcagatg tgctaccaga tcagcagggg caatagtgat 4447 ggttatataa tccccattaa caaagaaggg tgtattccag aaggagatgt tagagaagga 4507 caaatgcagc tggttacaag tctttaatca tacagctaag gaattccaag ggccacatgc 4567 gagtattaat aaataaagac accattggcc tgacgcagct ccctcaaact ctgcttgaag 4627 agatgactct tgacctgtgg ttctctggtg taaaaaagat gactgaacct tgcagttctg 4687 tgaattttta taaaacatac aaaaactttg tatatacaca gagtatacta aagtgaatta 4747 tttgttacaa agaaaagaga tgccagccag gtattttaag attctgctgc tgtttagaga 4807 aattgtgaaa caagcaaaac aaaactttcc agccatttta ctgcagcagt ctgtgaacta 4867 aatttgtaaa tatggctgca ccatttttgt aggcctgcat tgtattatat acaagacgta 4927 ggctttaaaa tcctgtggga caaatttact gtaccttact attcctgaca agacttggaa 4987 aagcaggaga gatattctgc atcagtttgc agttcactgc aaatctttta cattaaggca 5047 aagattgaaa acatgcttaa ccactagcaa tcaagccaca ggccttattt catatgtttc 5107 ctcaactgta caatgaacta ttctcatgaa aaatggctaa agaaattata ttttgttcta 5167 ttgctagggt aaaataaata catttgtgtc caactgaaat ataattgtca ttaaaataat 5227 tttaaagagt gaagaaaata ttgtgaaaag ctcttggttg cacatgttat gaaatgtttt 5287 ttcttacact ttgtcatggt aagttctact cattttcact tcttttccac tgtatacagt 5347 gttctgcttt gacaaagtta gtctttatta cttacattta aatttcttat tgccaaaaga 5407 acgtgtttta tggggagaaa caaactcttt gaagccagtt atgtcatgcc ttgcacaaaa 5467 gtgatgaaat ctagaaaaga ttgtgtgtca cccctgttta ttcttgaaca gagggcaaag 5527 agggcactgg gcacttctca caaactttct agtgaacaaa aggtgcctat tcttttttaa 5587 aaaaaaaaaa 5597 <210> 2 <211> 1177 <212> PRT
<213> Homo.sapiens <400> 2 Met Val Ser Ser Gly Cys Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys Ile Cys Asp Ala Asp Pro Phe Gln Met Glu Asn Thr Asp Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser Pro Cys Ile Tyr Glu Ala Glu Gln Lys Ala Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Ala Asp Lys Ile Tyr Phe Met Pro Trp Thr Pro Tyr Arg Thr Asp Thr Leu Ile Glu Tyr Ala Ser Leu Glu Asp Phe - Gln Asn Ser Arg Gln Thr Thr Thr Tyr Lys Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Phe Asn Lys Glu Arg Thr Arg Asn Ile Val Lys Phe Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Ala Ile Ile Asn Tyr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr Asp Lys Arg Ala Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Val Arg Ser Val Tyr Gln Asp Asn Glu Ser Glu Thr Gly Lys Asn Ser Ile Asp Tyr Ile Tyr Asn Thr Arg Leu Asn Arg Gly Glu Tyr Val Asp Val Pro Phe Pro Asn Gln Tyr Gln Tyr Ile Ala Ala Val Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Asn Phe Ile Leu Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ala Gln Val Pro Thr Thr Ala Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile Ser Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val Ala Gly Ser Gln Glu Gly Ser Lys Gly Thr Lys Pro Pro Pro Ala Val Ser Thr Thr Lys Ile Pro Pro Ile Thr Asn Ile Phe Pro Leu Pro Glu Arg Phe Cys Glu Ala Leu Asp Ser Lys Gly Ile Lys Trp Pro Gln_Thr Gln Arg Gly Met Met Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Thr Ala Ser Tyr Leu Cys Met Ile Ser Thr Gly Thr Trp Asn Pro Lys Gly Pro Asp Leu Ser Asn Cys Thr Ser His Trp Val Asn Gln Leu Ala Gln Lys Ile Arg Ser Gly Glu Asn Ala Ala Ser Leu Ala Asn Glu Leu Ala Lys His Thr Lys Gly Pro Val Phe Ala Gly Asp Val Ser Ser Ser Val Arg Leu Met Glu Gln Leu Val Asp Ile Leu Asp Ala Gln Leu Gln Glu Leu Lys Pro Ser Glu Lys Asp Ser Ala Gly Arg Ser Tyr Asn Lys Ala Ile Val Asp Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys His Met Asn Ser Ser Glu Gln Ala His Thr Ala Thr Met Leu Leu Asp Thr Leu Glu Glu Gly Ala Phe Val Leu Ala Asp Asn Leu Leu Glu Pro Thr Arg Val Ser Met Pro Thr Glu Asn Ile Val Leu Glu Val Ala Val Leu Ser Thr Glu Gly Gln Ile Gln Asp Phe Lys Phe Pro Leu Gly Ile Lys Gly Ala Gly Ser Ser Ile Gln Leu Ser Ala Asn Thr Va1 Lys Gln Asn Ser Arg Asn Gly Leu Ala Lys Leu Val Phe Ile Ile Tyr Arg Ser Leu Gly Gln Phe Leu Ser Thr Glu Asn Ala Thr Ile Lys Leu Gly Ala Asp Phe Ile Gly Arg Asn Ser Thr Ile Ala Val Asn Ser His Val Ile Ser Val Ser Ile Asn Lys Glu Ser Ser Arg Val Tyr Leu Thr Asp Pro Val Leu Phe Thr Leu Pro His Ile Asp Pro Asp Asn Tyr Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Thr Met Met Gly Tyr Trp Ser Thr Gln Gly Cys Lys Leu Val Asp Thr Asn Lys Thr Arg Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Ile Leu Met Ala His Arg Glu Ile Ala Tyr Lys Asp Gly Val His Glu Leu Leu Leu Thr Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala Ile Cys Ile Phe Thr Phe Cys Phe Phe Arg Gly Leu Gln Ser Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Ile Ala Glu Phe Ile Phe Leu Ile Gly Ile Asp Lys Thr Lys Tyr Ala Ile Ala Cys Pro Ile Phe Ala Gly Leu Leu His Phe Phe Phe Leu Ala Ala Phe Ala Trp Met Cys Leu Glu Gly Val Gln Leu Tyr Leu Met Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Lys Lys Tyr Tyr Tyr Val Ala Gly Tyr Leu Phe Pro Ala Thr Val Val Gly Val Ser Ala Ala Ile Asp Tyr Lys Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu His Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Thr Phe Ile Ile Leu Leu Asn Ile Ile Phe Leu Val Ile Thr Leu Cys Lys Met Val Lys His Ser Asn Thr Leu Lys Pro Asp Ser Ser Arg Leu Glu Asn Ile Lys Ser Trp Val Leu Gly Ala Phe Ala Leu Leu Cys Leu Leu Gly Leu Thr Trp Ser Phe Gly Leu Leu Phe Ile Asn Glu Glu Thr Ile Val Met Ala Tyr Leu Phe Thr Ile Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Ile Phe His Cys Ala Leu Gln Lys Lys Val Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr Cys Cys Gly Gly Leu Pro Thr Glu Ser Pro His Ser Ser Val Lys Ala Ser Thr Thr Arg Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Ser Glu Ser Ser Phe Ile Ser Gly Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly Leu Thr Ser His Gly Leu Arg Ala His Leu Gln Asp Leu Tyr His Leu Glu Leu Leu Leu Gly Gln Ile Ala <210> 3 <211> 5617 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (217)..(3585) <400> 3 cggcgaacag acgttctttc tcctccatgc agttacacaa aaggagggct acggaaacta 60 aaagtttcgg ggcctctggc tcggtgtgtg gagaaaagag aaaacctgga gacgggatat 120 gaagatcaat gatgcagact gatggtcttg atgaagctgg gcatttataa ctagattcat 180 taaggaatac aaagaaaata cttaaaggga tcaata atg gtg tct tct ggt tgc 234 Met Val Ser Ser Gly Cys aga atg cga agt ctg tgg ttt atc att gta atc agc ttc tta cca aat 282 Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn aca gaa ggt ttc agc aga gca get tta cca ttt ggg ctg gtg agg cga 330 Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg gaa tta tcc tgt gaa ggt tat tct ata gat ctg cga tgc ccg ggc agt 378 Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser gat gtc atc atg att gag agc get aac tat ggt cgg acg gat gac aag 426 Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys att tgt gat get gac cca ttt cag atg gag aat aca gac tgc tac ctc 474 Ile Cys Asp Ala Asp Pro Phe Gln Met Glu Asn Thr Asp Cys Tyr Leu ccc gat gcc ttc aaa att atg act caa agg tgc aac aat cga aca cag 522 Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln tgt ata gta gtt act ggg tca gat gtg ttt cct gat cca tgt cct gga 570 Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp Pro Cys Pro Gly aca tac aaa tac ctt gaa gtc caa tat gaa tgt gtc cct tac att ttt 618 Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val Pro Tyr Ile Phe gtg tgt cct ggg acc ttg aaa gca att gtg gac tca cca tgt ata tat 666 Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser Pro Cys Ile Tyr gaa get gaa caa aag gcg ggt get tgg tgc aag gac cct ctt cag get 714 Glu Ala Glu Gln Lys Ala Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala WO 99/45111 PC'f/US99/04676 gcagataaa atttatttc atgccctgg actccctat cgtaccgat act 762 AlaAspLys IleTyrPhe MetProTrp ThrProTyr ArgThrAsp Thr ttaatagaa tatgettct ttagaagat ttccaaaat agtcgccaa aca 810 LeuIleGlu TyrAlaSer LeuGluAsp PheGlnAsn SerArgGln Thr acaacatat aaacttcca aatcgagta gatggtact ggatttgtg gtg 858 ThrThrTyr LysLeuPro AsnArgVal AspGlyThr GlyPheVal Val tatgatggt getgtcttc tttaacaaa gaaagaacg aggaatatt gtg 906 TyrAspGly AlaValPhe PheAsnLys GluArgThr ArgAsnIle Val aaatttgac ttgaggact agaattaag agtggcgag gccataatt aac 954 LysPheAsp LeuArgThr ArgIIeLys SerGlyGlu AlaIleIle Asn tatgccaac taccatgat acctcacca tacagatgg ggaggaaag act 1002 TyrAlaAsn TyrHisAsp ThrSerPro TyrArgTrp GlyGlyLys Thr gatatcgac ctagcagtt gatgaaaat ggtttatgg gtcatttac gcc 1050 AspIleAsp LeuAlaVal AspGluAsn GlyLeuTrp ValIleTyr Ala actgaacag aacaatgga atgatagtt attagccag ctgaatcca tac 1098 ThrGluGln AsnAsnGly MetIleVal IleSerGln LeuAsnPro Tyr actcttcga tttgaagca acgtgggag actgtatac gacaaacgt gcc 1146 ThrLeuArg PheGluAla ThrTrpGlu ThrValTyr AspLysArg Ala gcatcaaat gettttatg atatgcgga gtcctctat gtggttagg tca 1199 AlaSerAsn AlaPheMet IleCysGly ValLeuTyr ValValArg Ser gtttatcaa gacaatgaa agtgaaaca ggcaagaac tcaattgat tac 1242 ValTyrGln AspAsnGlu SerGluThr GlyLysAsn SerIleAsp Tyr atttataat acccgatta aaccgagga gaatatgta gacgttccc ttc 1290 IleTyrAsn ThrArgLeu AsnArgGly GluTyrVal AspValPro Phe cccaaccag tatcagtat attgetgca gtggattac aatccaaga gat 1338 ProAsnGln TyrGlnTyr IleAlaAla ValAspTyr AsnProArg Asp aaccaactt tacgtgtgg aacaataac ttcatttta cgatattct ctg 1386 AsnGlnLeu TyrValTrp AsnAsnAsn PheIleLeu ArgTyrSer Leu gagtttggt ccacctgat cctgcccaa gtgcctacc acagetgtg aca 1434 GluPheGly ProProAsp ProAlaGln ValProThr ThrAlaVal Thr ata acttcttca getgagctg ttcaaaacc ataatatca accacaagc 1482 Ile ThrSerSer AlaGluLeu PheLysThr IleIleSer ThrThrSer act acttcacag aaaggcccc atgagcaca actgtaget ggatcacag 1530 Thr ThrSerGln LysGlyPro MetSerThr ThrValAla GlySerGln gaa ggaagcaaa gggacaaaa ccacctcca gcagtttct acaaccaaa 1578 Glu GlySerLys GlyThrLys ProProPro AlaValSer ThrThrLys att ccacctata acaaatatt tttcccctg ccagagaga ttctgtgaa 1626 Ile ProProIle ThrAsnIle PheProLeu ProGluArg PheCysGlu gca ttagactcc aaggggata aagtggcct cagacacaa aggggaatg 1674 Ala LeuAspSer LysGlyIle LysTrpPro GlnThrGln ArgGlyMet atg gttgaacga ccatgccct aagggaaca agaggaact gcctcatat 1722 Met ValGluArg ProCysPro LysGlyThr ArgGlyThr AlaSerTyr ctc tgcatgatt tccactgga acatggaac cctaagggc cccgatctt 1770 Leu CysMetIle SerThrGly ThrTrpAsn ProLysGly ProAspLeu 505 510 51.5 agc aactgtacc tcacactgg gtgaatcag ctggetcag aagatcaga 1818 Ser AsnCysThr SerHisTrp ValAsnGln LeuAlaGln LysIleArg agc ggagaaaat getgetagt cttgccaat gaactgget aaacatacc 1866 Ser GlyGluAsn AlaAlaSer LeuAlaAsn GluLeuAla LysHisThr aaa gggccagtg tttgetggg gatgtaagt tcttcagtg agattgatg 1914 Lys GlyProVal PheAlaGly AspValSer SerSerVal ArgLeuMet gag cagttggtg gacatcctt gatgcacag ctgcaggaa ctgaaacct 1962 Glu GlnLeuVal AspIleLeu AspAlaGln LeuGlnGlu LeuLysPro agt gaaaaagat tcagetgga cggagttat aacaaggca attgttgac 2010 Ser GluLysAsp SerAlaGly ArgSerTyr AsnLysAla IleValAsp aca gtggacaac cttctgaga cctgaaget ttggaatca tggaaacat 2058 Thr ValAspAsn LeuLeuArg ProGluAla LeuGluSer TrpLysHis atg aattcttct gaacaagca catactgca acaatgtta ctcgataca 2106 Met AsnSerSer GluGlnAla HisThrAla ThrMetLeu LeuAspThr ttg gaagaagga gettttgtc ctagetgac aatctttta gaaccaaca 2154 Leu GluGluGly AlaPheVaI LeuAlaAsp AsnLeuLeu GluProThr agg gtctcaatg cccacagaa aatattgtc ctggaagtt gccgtactc 2202 Arg ValSerMet ProThrGlu AsnIleVal LeuGluVal AlaValLeu agtacagaa ggacagatccaa gacttt aaatttcct ctgggcatc aaa 2250 SerThrGlu GlyGlnIleGln AspPhe LysPhePro LeuGlyIle Lys ggagcaggc agctcaatccaa ctgtcc gcaaatacc gtcaaacag aac 2298 GlyAlaGly SerSerIleGln LeuSer AlaAsnThr ValLysGln Asn agcaggaat gggcttgcaaag ttggtg ttcatcatt taccggagc ctg 2346 SerArgAsn GlyLeuAlaLys LeuVal PheIleIle TyrArgSer Leu ggacagttc cttagtacagaa aatgca accattaaa ctgggtget gat 2394 GlyGlnPhe LeuSerThrGlu AsnAla ThrIleLys LeuGlyAla Asp tttattggt cgtaatagcacc attgca gtgaactct cacgtcatt tca 2442 PheIleGly ArgAsnSerThr IleAla ValAsnSer HisValIle Ser 730 735 ?40 gtttcaatc aagaaagagtcc agccga gtatacctg actgatcct gtg 2490 ValSerIle LysLysGluSer SerArg ValTyrLeu ThrAspPro Val ctttttacc ctgccacacatt gatcct gacaattat ttcaatgca aac 2538 LeuPheThr LeuProHisIle AspPro AspAsnTyr PheAsnAla Asn tgctccttc tggaactactca gagaga actatgatg ggatattgg tct 2586 CysSerPhe TrpAsnTyrSer GluArg ThrMetMet GlyTyrTrp Ser acccagggc tgcaagctggtt gacact aataaaact cgaacaacg tgt 2634 ThrGlnGly CysLysLeuVal AspThr AsnLysThr ArgThrThr Cys gcatgcagc cacctaaccaat tttgca attctcatg gcccacagg gaa 2682 AlaCysSer HisLeuThrAsn PheAla IleLeuMet AlaHisArg Glu attgcatat aaagatggcgtt catgaa ttacttctt acagtcatc acc 2730 IleAlaTyr LysAspGlyVal HisGlu LeuLeuLeu ThrValIle Thr tgggtggga attgtcatttcc cttgtt tgcctgget atctgcatc ttc 2778 TrpValGly IleValIleSer LeuVal CysLeuAla IleCysIle Phe accttctgc tttttccgtggc ctacag agtgaccga aatactatt cac 2826 ThrPheCys PhePheArgGly LeuGln SerAspArg AsnThrIle His aagaacctt tgtatcaacctt ttcatt getgaattt attttccta ata 2874 LysAsnLeu CysIleAsnLeu PheIle AlaGluPhe IlePheLeu Ile ggcattgat aagacaaaatat gcgatt gcatgccca atatttgca gga 2922 GlyIleAsp LysThrLysTyr AlaIle AlaCysPro IlePheAla Gly ctt cta cactttttc tttttg gcagetttt gettggatgtgc ctagaa 2970 Leu Leu HisPhePhe PheLeu AlaAlaPhe AlaTrpMetCys LeuGlu ggt gtg cagctctac ctaatg ttagttgaa gtttttgaaagt gaatat 3018 Gly Val GlnLeuTyr LeuMet LeuValGlu ValPheGluSer GluTyr tca agg aaaaaatat tactat gttgetggt tacttgtttcct gccaca 3066 Ser Arg LysLysTyr TyrTyr ValAlaGly TyrLeuPhePro AlaThr gtg gtt ggagtttca getget attgactat aagagctatgga acagaa 3114 Val Val GlyValSer AlaAla IleAspTyr LysSerTyrGly ThrGlu aaa get tgctggctt catgtt gataactac tttatatggagc ttcatt 3162 Lys Ala CysTrpLeu HisVal AspAsnTyr PheIleTrpSer PheIle gga cct gttaccttc attatt ctgctaaat attatcttcttg gtgatc 3210 Gly Pro ValThrPhe IleIle LeuLeuAsn IleIlePheLeu ValIle aca ttg tgcaaaatg gtgaag cattcaaac actttgaaacca gattct 3258 Thr Leu CysLysMet ValLys HisSerAsn ThrLeuLysPro AspSer agc agg ttggaaaac attaag tcttgggtg cttggcgetttc getctt 3306 Ser Arg LeuGluAsn IleLys SerTrpVal LeuGlyAlaPhe AlaLeu ctg tgt cttcttggc ctcacc tggtccttt gggttgcttttt attaat 3354 Leu Cys LeuLeuGly LeuThr TrpSerPhe GlyLeuLeuPhe IleAsn gag gag actattgtg atggca tatctcttc actatatttaat getttc 3402 Glu Glu ThrIleVal MetAla TyrLeuPhe ThrIlePheAsn AlaPhe cag gga gtgttcatt ttcatc tttcactgt getctccaaaag aaagta 3450 Gln Gly ValPheIle PheIle PheHisCys AlaLeuGlnLys LysVal cga aaa gaatatggc aagtgc ttcagacac tcatactgctgt ggaggc 3498 Arg Lys GluTyrGly LysCys PheArgHis SerTyrCysCys GlyGly ctc cca actgagagt ccccac agttcagtg aaggcatcaacc accaga 3546 Leu Pro ThrGluSer ProHis SerSerVal LysAlaSerThr ThrArg acc agt getcgctat tcctct ggcacacag gacattcactgaacaatgc 3595 Thr Ser AlaArgTyr SerSer GlyThrGln AspIleHis cagggataca agtgccatgg atactctacc gctaaatggt aattttaaca acagctactc 3655 gctgcacaag ggtgactata atgacagcgt gcaagttgtg gactgtggac taagtctgaa 3?15 tgatactgct tttgagaaaa tgatcatttc agaattagtg cacaacaact tacggggcag 3775 cagcaagact cacaacctcg agctcacgct accagtcaaa cctgtgattg gaggtagcag 3835 cagtgaagat gatgctattg tggcagatgc ttcatcttta atgcacagcg acaacccagg 3895 gctggagctc catcacaaag aactcgaggc accacttatt cctcagcgga ctcactccct 3955 tctgtaccaa ccccagaaga aagtgaagtc cgagggaact gacagctatg tctcccaact 4015 gacagcagag gctgaagatc acctacagtc ccccaacaga gactctcttt atacaagcat 9075 gcccaatctt agagactctc cctatccgga gagcagccct gacatggaag aagacctctc 4135 tccctccagg aggagtgaga atgaggacat ttactataaa agcatgccaa atcttggagc 9195 tggccatcag cttcagatgt gctaccagat cagcaggggc aatagtgatg gttatataat 4255 ccccattaac aaagaagggt gtattccaga aggagatgtt agagaaggac aaatgcagct 4315 ggttacaagt ctttaatcat acagctaagg aattccaagg gccacatgcg agtattaata 4375 aataaagaca ccattggcct gacgcagctc cctcaaactc tgcttgaaga gatgactctt 4435 gacctgtggt tctctggtgt aaaaaagatg actgaacctt gcagttctgt gaatttttat 4495 aaaacataca aaaactttgt atatacacag agtatactaa agtgaattat ttgttacaaa 4555 gaaaagagat gccagccagg tattttaaga ttctgctgct gtttagagaa attgtgaaac 4615 aagcaaaaca aaactttcca gccattttac tgcagcagtc tgtgaactaa atttgtaaat 4675 atggctgcac catttttgta ggcctgcatt gtattatata caagacgtag gctttaaaat 4735 cctgtgggac aaatttactg taccttacta ttcctgacaa gacttggaaa agcaggagag 4795 atattctgca tcagtttgca gttcactgca aatcttttac attaaggcaa agattgaaaa 4855 catgcttaac cactagcaat caagccacag gccttatttc atatgtttcc tcaactgtac 4915 aatgaactat tctcatgaaa aatggctaaa gaaattatat tttgttctat tgctagggta 4975 aaataaatac atttgtgtcc aactgaaata taattgtcat taaaataatt ttaaagagtg 5035 aagaaaatat tgtgaaaagc tcttggttgc acatgttatg aaatgttttt tcttacactt 5095 tgtcatggta agttctactc attttcactt cttttccact gtatacagtg ttctgctttg 5155 acaaagttag tctttattac ttacatttaa atttcttatt gccaaaagaa cgtgttttat 5215 ggggagaaac aaactctttg aagccagtta tgtcatgcct tgcacaaaag tgatgaaatc 5275 tagaaaagat tgtgtgtcac ccctgtttat tcttgaacag agggcaaaga gggcactggg 5335 cacttctcac aaactttcta gtgaacaaaa ggtgcctatt cttttttaaa aaaataaaat 5395 aaaacataaa tattactctt ccatattcct tctgcctata tttagtaatt aatttatttt 5955 atgataaagt tctaatgaaa tgtaaattgt ttcagcaaaa ttctgctttt ttttcatccc 5515 tttgtgtaaa cctgttaata atgagcccat cactaatatc cagtgtaaag tttaacacgg 5575 tttgacagta aataaatgtg aattttttca aaaaaaaaaa as 5617 <210> 9 <211> 1123 <212> PRT
<213> Homo Sapiens <400> 4 Met Val Ser Ser Gly Cys Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Azg Cys Pro Gly Ser Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys Ile Cys Asp Ala Asp Pro Phe Gln Met Glu Asn Thr Asp Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser Pro Cys Ile Tyr Glu Ala Glu Gln Lys Ala Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Ala Asp Lys Ile Tyr Phe Met Pro Trp Thr Pro Tyr Arg Thr Asp Thr Leu Ile Glu Tyr Ala Ser Leu Glu Asp Phe Gln Asn Ser Arg Gln Thr Thr Thr Tyr Lys Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Phe Asn Lys Glu Arg Thr Arg Asn Ile Val Lys Phe Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Ala Ile Ile Asn Tyr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr Asp Lys Arg Ala Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Val Arg Ser Val Tyr Gln Asp Asn Glu Ser Glu Thr Gly Lys Asn Ser Ile Asp Tyr Ile Tyr Asn Thr Arg Leu Asn Arg Gly Glu Tyr Val Asp Val Pro Phe Pro Asn Gln Tyr Gln Tyr Ile Ala Ala Val Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Asn Phe Ile Leu Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ala Gln Val Pro Thr Thr Ala Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile 5er Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val Ala Gly Ser Gln Glu Gly Ser Lys Gly Thr Lys Pro Pro Pro Ala Val Ser Thr Thr Lys Ile Pro Pro Ile Thr Asn Ile Phe Pro Leu Pro Glu Arg Phe Cys Glu Ala Leu Asp Ser Lys Gly Ile Lys Trp Pro Gln Thr Gln Arg Gly Met Met Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Thr Ala Ser Tyr Leu Cys Met Ile Ser Thr Gly Thr Trp Asn Pro Lys Gly Pro Asp Leu Ser Asn Cys Thr Ser His Trp Val Asn Gln Leu Ala Gln Lys Ile Arg Ser Gly Glu Asn Ala Ala Ser Leu Ala Asn Glu Leu Ala Lys His Thr Lys Gly Pro Val Phe Ala Gly Asp Val Ser Ser Ser Val Arg Leu Met Glu Gln Leu Val Asp Ile Leu Asp Ala Gln Leu Gln Glu Leu Lys Pro Ser Glu Lys Asp Ser Ala Gly Arg Ser Tyr Asn Lys Ala Ile Val Asp Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys His Met Asn Ser Ser Glu Gln Ala His Thr Ala Thr Met Leu Leu Asp Thr Leu Glu Glu Gly Ala Phe Val Leu Ala Asp Asn Leu Leu Glu Pro Thr Arg Val Ser Met Pro Thr Glu Asn Ile Val Leu Glu Val Ala Val Leu Ser Thr Glu Gly Gln Ile Gln Asp Phe Lys Phe Pro Leu Gly Ile Lys Gly Ala Gly Ser Ser Ile Gln Leu Ser Ala Asn Thr Val Lys Gln Asn Ser Arg Asn Gly Leu Ala Lys Leu Val Phe Ile Ile Tyr Arg Ser Leu Gly Gln Phe Leu Ser Thr Glu Asn Ala Thr Ile Lys Leu Gly Ala Asp Phe Ile Gly Arg Asn Ser Thr Ile Ala Val Asn Ser His Val Ile Ser Val Ser Ile Lys Lys Glu Ser Ser Arg Val Tyr Leu Thr Asp Pro Val Leu Phe Thr Leu Pro His Ile Asp Pro Asp Asn Tyr Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Thr Met Met Gly Tyr Trp Ser Thr Gln Gly Cys Lys Leu Val Asp Thr Asn Lys Thr Arg Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Ile Leu Met Ala His Arg Glu Ile Ala Tyr Lys Asp Gly Val His Glu Leu Leu Leu Thr Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala Ile Cys Ile Phe Thr Phe Cys Phe Phe Arg Gly Leu Gln Ser Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Ile Ala 865 870 , 875 880 Glu Phe Ile Phe Leu Ile Gly Ile Asp Lys Thr Lys Tyr Ala Ile Ala Cys Pro Ile Phe Ala Gly Leu Leu His Phe Phe Phe Leu Ala Ala Phe Ala Trp Met Cys Leu Glu Gly Val Gln Leu Tyr Leu Met Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Lys Lys Tyr Tyr Tyr Val Ala Gly Tyr Leu Phe Pro Ala Thr Val Val Gly Val Ser Ala Ala Ile Asp Tyr Lys Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu His Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Thr Phe Ile Ile Leu Leu Asn Ile Ile Phe Leu Val Ile Thr Leu Cys Lys Met Val Lys His Ser Asn Thr Leu Lys Pro Asp Ser Ser Arg Leu Glu Asn Ile Lys Ser Trp Val Leu Gly Ala Phe Ala Leu Leu Cys Leu Leu Gly Leu Thr Trp Ser Phe Gly Leu Leu Phe Ile Asn Glu Glu Thr Ile Val Met Ala Tyr Leu Phe Thr Ile Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Ile Phe His Cys Ala Leu Gln Lys Lys Val Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr Cys Cys Gly Gly Leu Pro Thr Glu Ser Pro His Ser Ser Val Lys Ala Ser Thr Thr Arg Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Asp Ile His <210> 5 <211> 5491 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (217)..(4425) <400> 5 cggcgaacag acgttctttc tcctccatgc agttacacaa aaggagggct acggaaacta 60 aaagtttcgg ggcctctggc tcggtgtgtg gagaaaagag aaaacctgga gacgggatat 120 gaagatcaat gatgcagact gatggtcttg atgaagctgg gcatttataa ctagattcat 180 taaggaatac aaagaaaata cttaaaggga tcaata atg gtg tct tct ggt tgc 234 Met Val Ser Ser Gly Cys aga atg cga agt ctg tgg ttt atc att gta atc agc ttc tta cca aat 282 Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn aca gaa ggt ttc agc aga gca get tta cca ttt ggg ctg gtg agg cga 330 Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg gaa tta tcc tgt gaa ggt tat tct ata gat ctg cga tgc ccg ggc agt 378 Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser gat gtcatc atgattgag agcgetaac tatggtcgg acggatgac aag 426 Asp ValIle MetIleGlu SerAlaAsn TyrGlyArg ThrAspAsp Lys att tgtgat getgaccca tttcagatg gagaataca gactgctac ctc 974 Ile CysAsp AlaAspPro PheGlnMet GluAsnThr AspCysTyr Leu ccc gatgcc ttcaaaatt atgactcaa aggtgcaac aatcgaaca cag 522 Pro AspAla PheLysIle MetThrGln ArgCysAsn AsnArgThr Gln tgt atagta gttactggg tcagatgtg tttcctgat ccatgtcct gga 570 Cys IleVal ValThrGly SerAspVal PheProAsp ProCysPro Gly aca tacaaa taccttgaa gtccaatat gaatgtgtc ccttacatt ttt 618 Thr TyrLys TyrLeuGlu ValGlnTyr GluCysVal ProTyrIle Phe gtg tgtcct gggaccttg aaagcaatt gtggactca ccatgtata tat 666 Val CysPro GlyThrLeu LysAlaIle ValAspSer ProCysIle Tyr gaa getgaa caaaaggcg ggtgettgg tgcaaggac cctcttcag get 714 Glu AlaGlu GlnLysAla GlyAlaTrp CysLysAsp ProLeuGln Ala gca gataaa atttatttc atgccctgg actccctat cgtaccgat act 762 Ala AspLys IleTyrPhe MetProTrp ThrProTyr ArgThrAsp Thr tta atagaa tatgettct ttagaagat ttccaaaat agtcgccaa aca 810 Leu IleGlu TyrAlaSer LeuGluAsp PheGlnAsn SerArgGln Thr aca acatat aaacttcca aatcgagta gatggtact ggatttgtg gtg 858 Thr ThrTyr LysLeuPro AsnArgVal AspGlyThr GlyPheVal Val tat gatggt getgtcttc tttaacaaa gaaagaacg aggaatatt gtg 906 Tyr AspGly AlaValPhe PheAsnLys GluArgThr ArgAsnIle Val aaa tttgac ttgaggact agaattaag agtggcgag gccataatt aac 954 Lys PheAsp LeuArgThr ArgIleLys SerGlyGlu AlaIleIle Asn tat gccaac taccatgat acctcacca tacagatgg ggaggaaag act 1002 Tyr AlaAsn TyrHisAsp ThrSerPro TyrArgTrp GlyGlyLys Thr gat atcgac ctagcagtt gatgaaaat ggtttatgg gtcatttac gcc 1050 Asp IleAsp LeuAlaVal AspGluAsn GlyLeuTrp ValIleTyr Ala act gaacag aacaatgga atgatagtt attagccag ctgaatcca tac 1098 Thr GluGln AsnAsnGly MetIleVal IleSerGln LeuAsnPro Tyr act cttcga tttgaagca acgtgggag actgtatac gacaaacgt gcc 1146 Thr LeuArg PheGluA2a ThrTrpGlu ThrValTyr AspLysArg Ala gcatcaaat gettttatg atatgcgga gtcctctat gtggttagg tca 1194 AlaSerAsn AlaPheMet IleCysGly ValLeuTyr ValValArg Ser gtttatcaa gacaatgaa agtgaaaca ggcaagaac tcaattgat tac 1242 ValTyrGln AspAsnGlu SerGluThr GlyLysAsn SerIleAsp Tyr atttataat acccgatta aaccgagga gaatatgta gacgttccc ttc 1290 IleTyrAsn ThrArgLeu AsnArgGly GluTyrVal AspValPro Phe cccaaccag tatcagtat attgetgca gtggattac aatccaaga gat 1338 ProAsnGln TyrGlnTyr IleAlaAla ValAspTyr AsnProArg Asp aaccaactt tacgtgtgg aacaataac ttcatttta cgatattct ctg 1386 AsnGlnLeu TyrValTrp AsnAsnAsn PheIleLeu ArgTyrSer Leu gagtttggt ccacctgat cctgcccaa gtgcctacc acagetgtg aca 1434 GluPheGly ProProAsp ProAlaGln ValProThr ThrAlaVal Thr ataacttct tcagetgag ctgttcaaa accataata tcaaccaca agc 1482 IleThrSer SerAlaGlu LeuPheLys ThrIleIle SerThrThr Ser actacttca cagaaaggc cccatgagc acaactgta getggatca cag 1530 ThrThrSer GlnLysGly ProMetSer ThrThrVal AlaGlySer Gln gaaggaagc aaagggaca aaaccacct ccagcagtt tctacaacc aaa 1578 GluGlySer LysGlyThr LysProPro ProAlaVal SerThrThr Lys attccacct ataacaaat atttttccc ctgccagag agattctgt gaa 1626 IleProPro IleThrAsn IlePhePro LeuProGlu ArgPheCys Glu gcattagac tccaagggg ataaagtgg cctcagaca caaagggga atg 1674 AlaLeuAsp SerLysGly IleLysTrp ProGlnThr GlnArgGly Met atggttgaa cgaccatgc cctaaggga acaagagga actgcctca tat 1722 MetValGlu ArgProCys ProLysGly ThrArgGly ThrAlaSer Tyr ctctgcatg atttccact ggaacatgg aaccctaag ggccccgat ctt 1770 LeuCysMet IleSerThr GlyThrTrp AsnProLys GlyProAsp Leu agcaactgt acctcacac tgggtgaat cagctgget cagaagatc aga 1818 SerAsnCys ThrSerHis TrpValAsn GlnLeuAla GlnLysIle Arg agcggagaa aatgetget agtcttgcc aatgaactg getaaacat acc 1866 SerGlyGlu AsnAlaAla SerLeuAla AsnGluLeu AlaLysHis Thr aaa gggcca gtgtttget ggggatgtaagt tcttcagtg agattg atg 1919 Lys GlyPro ValPheAla GlyAspValSer SerSerVal ArgLeu Met gag cagttg gtggacatc cttgatgcacag ctgcaggaa ctgaaa cct 1962 Glu GlnLeu ValAspIle LeuAspAlaGln LeuGlnGlu LeuLys Pro agt gaaaaa gattcaget ggacggagttat aacaaggca attgtt gac 2010 Ser GluLys AspSerAla GlyArgSerTyr AsnLysAla IleVal Asp aca gtggac aaccttctg agacctgaaget ttggaatca tggaaa cat 2058 Thr ValAsp AsnLeuLeu ArgProGluAla LeuGluSer TrpLys His atg aattct tctgaacaa gcacatactgca acaatgtta ctcgat aca 2106 Met AsnSer SerGluGln AlaHisThrAla ThrMetLeu LeuAsp Thr ttg gaagaa ggagetttt gtcctagetgac aatctttta gaacca aca 2154 Leu GluGlu GlyAlaPhe ValLeuAlaAsp AsnLeuLeu GluPro Thr agg gtctca atgcccaca gaaaatattgtc ctggaagtt gccgta ctc 2202 Arg ValSer MetProThr GluAsnIleVal LeuGluVal AlaVal Leu agt acagaa ggacagatc caagactttaaa tttcctctg ggcatc aaa 2250 Ser ThrGlu GlyGlnIle GlnAspPheLys PheProLeu GlyIle Lys gga gcaggc agctcaatc caactgtccgca aataccgtc aaacag aac 2298 Gly AlaGly SerSerIle GlnLeuSerAla AsnThrVal LysGln Asn agc aggaat gggcttgca aagttggtgttc atcatttac cggagc ctg 2346 Ser ArgAsn GlyLeuAla LysLeuValPhe IleIleTyr ArgSer Leu gga cagttc cttagtaca gaaaatgcaacc attaaactg ggtget gat 2394 Gly GlnPhe LeuSerThr GluAsnAlaThr IleLysLeu GlyAla Asp ttt attggt cgtaatagc accattgcagtg aactctcac gtcatt tca 2442 Phe IleGly ArgAsnSer ThrIleAlaVal AsnSerHis ValIle Ser gtt tcaatc aataaagag tccagccgagta tacctgact gatcct gtg 2490 Val SerIle AsnLysGlu SerSerArgVal TyrLeuThr AspPro Val ctt tttacc ctgccacac attgatcctgac aattatttc aatgca aac 2538 Leu PheThr LeuProHis IleAspProAsp AsnTyrPhe AsnAla Asn tgc tccttc tggaactac tcagagagaact atgatggga tattgg tct 2586 Cys SerPhe TrpAsnTyr SerGluArgThr MetMetGly TyrTrp Ser acc cagggc tgcaagctg gttgacactaat aaaactcga acaacg tgt 2634 Thr GlnGly CysLysLeu ValAspThrAsn LysThrArg ThrThr Cys gcatgcagc cacctaaccaat tttgca attctcatg gcccacagg gaa 2682 AlaCysSer HisLeuThrAsn PheAla IleLeuMet AlaHisArg Glu attgcatat aaagatggcgtt catgaa ttacttctt acagtcatc acc 2730 IleAlaTyr LysAspGlyVal HisGlu LeuLeuLeu ThrValIle Thr tgggtggga attgtcatttcc cttgtt tgcctgget atctgcatc ttc 2778 TrpValGly IleValIleSer LeuVal CysLeuAla IleCysIle Phe accttctgc tttttccgtggc ctacag agtgaccga aatactatt cac 2826 ThrPheCys PhePheArgGly LeuGln SerAspArg AsnThrIle His aagaacctt tgtatcaacctt ttcatt getgaattt attttccta ata 2874 LysAsnLeu CysIleAsnLeu PheIle AlaGluPhe IlePheLeu Ile ggcattgat aagacaaaatat gcgatt gcatgccca atatttgca gga 2922 GlyIleAsp LysThrLysTyr AlaIle AlaCysPro IlePheAla Gly cttctacac tttttctttttg gcaget tttgettgg atgtgccta gaa 2970 LeuLeuHis PhePhePheLeu AlaAla PheAlaTrp MetCysLeu Glu ggtgtgcag ctctacctaatg ttagtt gaagttttt gaaagtgaa tat 3018 GlyValGln LeuTyrLeuMet LeuVal GluValPhe GluSerGlu Tyr tcaaggaaa aaatattactat gttget ggttacttg tttcctgcc aca 3066 SerArgLys LysTyrTyrTyr ValAla GlyTyrLeu PheProAla Thr gtggttgga gtttcagetget attgac tataagagc tatggaaca gaa 3114 ValValGly ValSerAlaAla IleAsp TyrLysSer TyrGlyThr Glu aaagettgc tggcttcatgtt gataac tactttata tggagcttc att 3162 LysAlaCys TrpLeuHisVal AspAsn TyrPheIle TrpSerPhe Ile ggacctgtt accttcattatt ctgcta aatattatc ttcttggtg atc 3210 GlyProVal ThrPheIleIle LeuLeu AsnIleIle PheLeuVal Ile acattgtgc aaaatggtgaag cattca aacactttg aaaccagat tct 3258 ThrLeuCys LysMetValLys HisSer AsnThrLeu LysProAsp Ser agcaggttg gaaaacattaag tcttgg gtgcttggc getttcget ctt 3306 SerArgLeu GluAsnIleLys SerTrp ValLeuGly AlaPheAla Leu ctgtgtctt cttggcctcacc tggtcc tttgggttg ctttttatt aat 3354 LeuCysLeu LeuGlyLeuThr TrpSer PheGlyLeu LeuPheIle Asn gag gag attgtg atggca ctc ttcact ata aat ttc 3402 act tat ttt get Glu Glu IleVal MetAla Leu PheThr Ile Asn Phe Thr Tyr Phe Ala cag gga ttcatt ttcatc_tttcac tgtget ctc aag gta 3450 gtg caa aaa Gln Gly PheIle PheIle His CysAla Leu Lys Val Val Phe Gln Lys cga aaa gaa tat ggc aag tgc ttc aga cac tca tac tgc tgt gga ggc 3498 Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr Cys Cys Gly Gly ctc cca act gag agt ccc cac agt tca gtg aag gca tca acc acc aga 3546 Leu Pro Thr Glu Ser Pro His Ser Ser Val Lys Ala Ser Thr Thr Arg acc agt get cgc tat tcc tct ggc aca cag agt cgt ata aga aga atg 3594 Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg Ile Arg Arg Met tgg aat gat act gtg aga aaa caa tca gaa tct tct ttt atc tca ggt 3642 Trp Asn Asp Thr Val Arg Lys Gln Ser Glu Ser Ser Phe Ile Ser Gly gac atc aat agc act tca aca ctt aat caa gga cat tca ctg aac aat 3690 Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly His Ser Leu Asn Asn gcc agg gat aca agt gcc atg gat act cta ccg cta aat ggt aat ttt 3738 Ala Arg Asp Thr Ser Ala Met Asp Thr Leu Pro Leu Asn Gly Asn Phe aac aac agc tac tcg ctg cac aag ggt gac tat aat gac agc gtg caa 3786 Asn Asn Ser Tyr Ser Leu His Lys Gly Asp Tyr Asn Asp Ser Val Gln gtt gtg gac tgt gga cta agt ctg aat gat act get ttt gag aaa atg 3834 Val Val Asp Cys Gly Leu Ser Leu Asn Asp Thr Ala Phe Glu Lys Met atc att tca gaa tta gtg cac aac aac tta cgg ggc agc agc aag act 3882 Ile Ile Ser Glu Leu Val His Asn Asn Leu Arg Gly Ser Ser Lys Thr cac aac ctc gag ctc acg cta cca gtc aaa cct gtg att gga ggt agc 3930 His Asn Leu Glu Leu Thr Leu Pro Val Lys Pro Val Ile Gly Gly Ser agc agt gaa gat gat get att gtg gca gat get tca tct tta atg cac 3978 Ser Ser Glu Asp Asp Ala Ile Val Ala Asp Ala Ser Ser Leu Met His agc gac aac cca ggg ctg gag ctc cat cac aaa gaa ctc gag gca cca 4026 Ser Asp Asn Pro Gly Leu Glu Leu His His Lys Glu Leu Glu Ala Pro ctt att cct cag cgg act cac tcc ctt ctg tac caa ccc cag aag aaa 4074 Leu Ile Pro Gln Arg Thr His Ser Leu Leu Tyr Gln Pro Gln Lys Lys gtg aag tcc gag gga act gac agc tat gtc tcc caa ctg aca gca gag 9122 Val Lys Ser Glu Gly Thr Asp Ser Tyr Val Ser Gln Leu Thr Ala Glu get gaa gat cac cta cag tcc ccc aac aga gac tct ctt tat aca agc 4170 Ala Glu Asp His Leu Gln Ser Pro Asn Arg Asp Ser Leu Tyr Thr Ser atg ccc aat ctt aga gac tct ccc tat.ccg gag agc agc cct gac atg 4218 Met Pro Asn Leu Arg Asp Ser Pro Tyr Pro Glu Ser Ser Pro Asp Met gaa gaa gac ctc tct ccc tcc agg agg agt gag aat gag gac att tac 4266 Glu Glu Asp Leu Ser Pro Ser Arg Arg Ser Glu Asn Glu Asp Ile Tyr tat aaa agc atg cca aat ctt gga get ggc cat cag ctt cag atg tgc 4314 Tyr Lys Ser Met Pro Asn Leu Gly Ala Gly His Gln Leu Gln Met Cys tac cag atc agc agg ggc aat agt gat ggt tat ata atc ccc att aac 4362 Tyr Gln Ile Ser Arg Gly Asn Ser Asp Gly Tyr Ile Ile Pro Ile Asn aaa gaa ggg tgt att cca gaa gga gat gtt aga gaa gga caa atg cag 4910 Lys Glu Gly Cys Ile Pro Glu Gly Asp Val Arg Glu Gly Gln Met Gln ctg gtt aca agt ctt taatcataca gctaaggaat tccaagggcc acatgcgagt 4465 Leu Val Thr Ser Leu attaataaat aaagacacca ttggcctgac gcagctccct caaactctgc ttgaagagat 4525 gactcttgac ctgtggttct ctggtgtaaa aaagatgact gaaccttgca gttctgtgaa 4585 tttttataaa acatacaaaa actttgtata tacacagagt atactaaagt gaattatttg 4645 ttacaaagaa aagagatgcc agccaggtat tttaagattc tgctgctgtt tagagaaatt 4705 gtgaaacaag caaaacaaaa ctttccagcc attttactgc agcagtctgt gaactaaatt 4765 tgtaaatatg gctgcaccat ttttgtaggc ctgcattgta ttatatacaa gacgtaggct 4825 ttaaaatcct gtgggacaaa tttactgtac cttactattc ctgacaagac ttggaaaagc 9885 aggagagata ttctgcatca gtttgcagtt cactgcaaat cttttacatt aaggcaaaga 4945 ttgaaaacat gcttaaccac tagcaatcaa gccacaggcc ttatttcata tgtttcctca 5005 actgtacaat gaactattct catgaaaaat ggctaaagaa attatatttt gttctattgc 5065 tagggtaaaa taaatacatt tgtgtccaac tgaaatataa ttgtcattaa aataatttta 5125 aagagtgaag aaaatattgt gaaaagctct tggttgcaca tgttatgaaa tgttttttct 5185 tacactttgt catggtaagt tctactcatt ttcacttctt ttccactgta tacagtgttc 5245 tgctttgaca aagttagtct ttattactta catttaaatt tcttattgcc aaaagaacgt 5305 gttttatggg gagaaacaaa ctctttgaag ccagttatgt catgccttgc acaaaagtga 5365 tgaaatctag aaaagattgt gtgtcacccc tgtttattct tgaacagagg gcaaagaggg 5425 cactgggcac ttctcacaaa ctttctagtg aacaaaaggt gcctattctt ttttaaaaaa 5485 aaaaaa 5491 <210> 6 <211> 1403 <212> PRT
<213> Homo Sapiens <400> 6 Met Val Ser Ser Gly Cys Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys Ile Cys Asp Ala Asp Pro Phe Gln Met Glu Asn Thr Asp Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser Pro Cys Ile Tyr Glu Ala Glu Gln Lys Ala Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Ala Asp Lys Ile Tyr Phe Met Pro Trp Thr Pro Tyr Arg Thr Asp Thr Leu Ile Glu Tyr Ala Ser Leu Glu Asp Phe Gln Asn Ser Arg Gln Thr Thr Thr Tyr Lys Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Phe Asn Lys Glu Arg Thr Arg Asn Ile Val Lys Phe Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Ala Ile Ile Asn Tyr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr Asp Lys Arg Ala Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Val Arg Ser Val Tyr Gln Asp Asn Glu Ser Glu Thr Gly Lys Asn Ser Ile Asp Tyr Ile Tyr Asn Thr Arg Leu Asn Arg Gly Glu Tyr Val Asp Val Pro Phe Pro Asn Gln Tyr Gln Tyr Ile Ala Ala Val 355 360 ' 365 Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Asn Phe Ile Leu Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ala Gln Val Pro Thr Thr Ala Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile Ser Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val Ala Gly Ser Gln Glu Gly Ser Lys Gly Thr Lys Pro Pro Pro Ala Val Ser Thr Thr Lys Ile Pro Pro Ile Thr Asn Ile Phe Pro Leu Pro Glu Arg Phe Cys Glu Ala Leu Asp Ser Lys Gly Ile Lys Trp Pro Gln Thr Gln Arg Gly Met Met Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Thr Ala Ser Tyr Leu Cys Met Ile Ser Thr Gly Thr Trp Asn Pro Lys Gly Pro Asp Leu Ser Asn Cys Thr Ser His Trp Val Asn Gln Leu Ala Gln Lys Ile Arg Ser Gly Glu Asn Ala Ala Ser Leu Ala Asn Glu Leu Ala Lys His Thr Lys Gly Pro Val Phe Ala Gly Asp Val Ser Ser Ser Val Arg Leu Met Glu Gln Leu Val Asp Ile Leu Asp Ala Gln Leu Gln Glu Leu Lys Pro Ser Glu Lys Asp Ser Ala Gly Arg Ser Tyr Asn Lys Ala Ile Val Asp Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys His Met Asn Ser Ser Glu Gln Ala His Thr Ala Thr Met Leu Leu Asp Thr Leu Glu Glu Gly Ala Phe Val Leu Ala Asp Asn Leu Leu Glu Pro Thr Arg Val Ser Met Pro Thr Glu Asn Ile Val Leu Glu Val Ala Val Leu Ser Thr Glu Gly Gln Ile Gln Asp Phe Lys Phe Pro Leu Gly Ile Lys Gly Ala Gly Ser Ser Ile Gln Leu Ser Ala Asn Thr Val Lys Gln Asn Ser Arg Asn Gly Leu Ala Lys Leu Val Phe Ile Ile Tyr Arg Ser Leu Gly Gln Phe Leu Ser Thr Glu Asn Ala Thr Ile Lys Leu Gly Ala Asp Phe Ile Gly Arg Asn Ser Thr Ile Ala Val Asn Ser His Val Ile Ser Val Ser Ile Asn Lys Glu Ser Ser Arg Val Tyr Leu Thr Asp Pro Val Leu Phe Thr Leu Pro His Ile Asp Pro Asp Asn Tyr Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Thr Met Met Gly Tyr Trp Ser Thr Gln Gly Cys Lys Leu Val Asp Thr Asn Lys Thr Arg Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Ile Leu Met Ala His Arg Glu Ile Ala Tyr Lys Asp Gly Val His Glu Leu Leu Leu Thr Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala Ile Cys Ile Phe Thr Phe Cys Phe Phe Arg Gly Leu Gln Ser Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Ile Ala Glu Phe Ile Phe Leu Ile Gly Ile Asp Lys Thr Lys Tyr Ala Ile Ala Cys Pro Ile Phe Ala Gly Leu Leu His Phe Phe Phe Leu Ala Ala Phe Ala Trp Met Cys Leu Glu Gly Val Gln Leu Tyr Leu Met Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Lys Lys Tyr Tyr Tyr Val Ala Gly Tyr Leu Phe Pro Ala Thr Val Val Gly Val Ser Ala Ala Ile Asp Tyr Lys Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu His Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Thr Phe Ile Ile Leu Leu Asn Ile Ile Phe Leu Val Ile Thr Leu Cys Lys Met Val Lys His Ser Asn 995 1b00 1005 Thr Leu Lys Pro Asp Ser Ser Arg Leu Glu Asn Ile Lys Ser Trp Val Leu Gly Ala Phe Ala Leu Leu Cys Leu Leu Gly Leu Thr Trp Ser Phe Gly Leu Leu Phe Ile Asn Glu Glu Thr Ile Val Met Ala Tyr Leu Phe Thr Ile Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Ile Phe His Cys Ala Leu Gln Lys Lys Val Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr Cys Cys Gly Gly Leu Pro Thr Glu Ser Pro His Ser Ser Val Lys Ala Ser Thr Thr Arg Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Ser Glu Ser Ser Phe Ile Ser Gly Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly His Ser Leu Asn Asn Ala Arg Asp Thr Ser Ala Met Asp Thr Leu Pro Leu Asn Gly Asn Phe Asn Asn Ser Tyr Ser Leu His Lys Gly Asp Tyr Asn Asp Ser Val Gln Val Val Asp Cys Gly Leu Ser Leu Asn Asp Thr Ala Phe Glu Lys Met Ile Ile Ser Glu Leu Val His Asn Asn Leu Arg Gly Ser Ser Lys Thr His Asn Leu Glu Leu Thr Leu Pro Val Lys Pro Val Ile Gly Gly Ser Ser Ser Glu Asp Asp Ala Ile Val Ala Asp Ala Ser Ser Leu Met His Ser Asp Asn Pro Gly Leu Glu Leu His His Lys Glu Leu Glu Ala Pro Leu Ile Pro Gln Arg Thr His Ser Leu Leu Tyr Gln Pro Gln Lys Lys Val Lys Ser Glu Gly Thr Asp Ser Tyr Val Ser Gln Leu Thr Ala Glu Ala Glu Asp His Leu Gln Ser Pro Asn Arg Asp Ser Leu Tyr Thr Ser Met Pro Asn Leu Arg Asp Ser Pro Tyr Pro Glu Ser Ser Pro Asp Met Glu Glu Asp Leu Ser Pro Ser Arg Arg Ser Glu Asn Glu Asp Ile Tyr Tyr Lys Ser Met Pro Asn Leu Gly Ala Gly His Gln Leu Gln Met Cys Tyr Gln Ile Ser Arg Gly Asn Ser Asp Gly Tyr Ile Ile Pro Ile Asn Lys Glu Gly Cys Ile Pro Glu Gly Asp Val Arg Glu Gly Gln Met Gln Leu Val Thr Ser Leu <210> 7 <211> 1527 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (217)..(1527) <400> 7 cggcgaacag acgttctttc tcctccatgc agttacacaa aaggagggct acggaaacta 60 aaagtttcgg ggcctctggc tcggtgtgtg gagaaaagag aaaacctgga gacgggatat 120 gaagatcaat gatgcagact gatggtcttg atgaagctgg gcatttataa ctagattcat 180 taaggaatac aaagaaaata cttaaaggga tcaata atg gtg tct tct ggt tgc 234 Met Val Ser Ser Gly Cys aga atg cga agt ctg tgg ttt atc att gta atc agc tte tta cca aat 282 Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn aca gaa ggt ttc agc aga gca get tta cca ttt ggg ctg gtg agg cga 330 Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg gaa tta tcc tgt gaa ggt tat tct ata gat ctg cga tgc ccg ggc agt 378 Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser gat gtc atc atg att gag agc get aac tat ggt cgg acg gat gac aag 426 Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys att tgt gat get gac cca ttt cag atg gag aat aca gac tgc tac ctc 479 Ile CysAsp AlaAspProPhe GlnMetGlu AsnThr CysTyr Leu Asp ccc gatgcc ttcaaaattatg actcaaagg tgcaac aatcgaaca cag 522 Pro AspAla PheLysIleMet ThrGlnArg CysAsn AsnArgThr Gin tgt atagta gttactgggtca gatgtgttt cctgat ccatgtcct gga 570 Cys IleVal ValThrGlySer AspValPhe ProAsp ProCysPro Gly aca tacaaa taccttgaagtc caatatgaa tgtgtc ccttacatt ttt 618 Thr TyrLys TyrLeuGluVal GlnTyrGlu CysVal ProTyrIle Phe gtg tgtcct gggaccttgaaa gcaattgtg gactca ccatgtata tat 666 Val CysPro GlyThrLeuLys AlaIleVal AspSer ProCysIle Tyr gaa getgaa caaaaggcgggt gettggtgc aaggac cctcttcag get 714 Glu AlaGlu GlnLysAlaGly AlaTrpCys LysAsp ProLeuGln Ala gca gataaa atttatttcatg ccctggact ccctat cgtaccgat act 762 Ala AspLys IleTyrPheMet ProTrpThr ProTyr ArgThrAsp Thr tta atagaa tatgettcttta gaagatttc caaaat agtcgccaa aca 810 Leu IleGlu TyrAlaSerLeu GluAspPhe GlnAsn SerArgGln Thr aca acatat aaacttccaaat cgagtagat ggtact ggatttgtg gtg 858 Thr ThrTyr LysLeuProAsn ArgValAsp GlyThr GlyPheVal Val tat gatggt getgtcttcttt aacaaagaa agaacg aggaatatt gtg 906 Tyr AspGly AlaValPhePhe AsnLysGlu ArgThr ArgAsnIle Val aaa tttgac ttgaggactaga attaagagt ggcgag gccataatt aac 954 Lys PheAsp LeuArgThrArg IleLysSer GlyGlu AlaIleIle Asn tat gccaac taccatgatacc tcaccatac agatgg ggaggaaag act 1002 Tyr AlaAsn TyrHisAspThr SerProTyr ArgTrp GlyGlyLys Thr gat atc gac cta gca gtt gat gaa aat ggt tta tgg gtc att tac gcc 1050 Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala act gaa cag aac aat gga atg ata gtt att agc cag ctg aat cca tac 1098 Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln Leu Asn Pro Tyr act ctt cga ttt gaa gca acg tgg gag act gta tac gac aaa cgt gcc 1146 Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr Asp Lys Arg Ala gca tca aat get ttt atg ata tgc gga gtc ctc tat gtg gtt agg tca 1194 Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Val Arg Ser gtt tatcaa gacaatgaa agtgaaaca ggcaagaac tcaattgat tac 1242 Val TyrGln AspAsnGlu SerGluThr GlyLysAsn SerIleAsp Tyr att tataat acccgatta aaccgagga gaatatgta gacgttccc ttc 1290 Ile TyrAsn ThrArgLeu AsnArgGly GluTyrVal AspValPro Phe ccc aaccag tatcagtat attgetgca gtggattac aatccaaga gat 1338 Pro AsnGln TyrGlnTyr IleAlaAla ValAspTyr AsnProArg Asp aac caactt tacgtgtgg aacaataac ttcatttta cgatattct ctg 1386 Asn GlnLeu TyrValTrp AsnAsnAsn PheIleLeu ArgTyrSer Leu gag tttggt ccacctgat cctgcccaa gtgcctacc acagetgtg aca 1434 Glu PheGly ProProAsp ProAlaGln ValProThr ThrAlaVal Thr ata acttct tcagetgag ctgttcaaa accataata tcaaccaca agc 1482 Ile ThrSer SerAlaGlu LeuPheLys ThrIleIle SerThrThr Ser act acttca cagaaaggc cccatgagc acaactgta getggatca 1527 Thr ThrSer GlnLysGly ProMetSer ThrThrVal AlaGlySer <210> 8 <211> 437 <212> PRT
<213> Homo sapiens <400> 8 Met Val Ser Ser Gly Cys Arg Met Arg Ser Leu Trp Phe Ile Ile Val Ile Ser Phe Leu Pro Asn Thr Glu Gly Phe Ser Arg Ala Ala Leu Pro Phe Gly Leu Val Arg Arg Glu Leu Ser Cys Glu Gly Tyr Ser Ile Asp Leu Arg Cys Pro Gly Ser Asp Val Ile Met Ile Glu Ser Ala Asn Tyr Gly Arg Thr Asp Asp Lys Ile Cys Asp Ala Asp Pro Phe Gln Met Glu 65 70 75 g0 Asn Thr Asp Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser Pro Cys Ile Tyr Glu Ala Glu Gln Lys Ala Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Ala Asp Lys Ile Tyr Phe Met Pro Trp Thr Pro Tyr Arg Thr Asp Thr Leu Ile Glu Tyr Ala Ser Leu Glu Asp Phe Gln Asn Ser Arg Gln Thr Thr Thr Tyr Lys Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Phe Asn Lys Glu Arg Thr Arg Asn Ile Val Lys Phe Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Ala Ile Ile Asn Tyr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr Asp Lys Arg Ala Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Val Arg Ser Val Tyr Gln Asp Asn Glu Ser Glu Thr Gly Lys Asn Ser Ile Asp Tyr Ile Tyr Asn Thr Arg Leu Asn Arg Gly Glu Tyr Val Asp Val Pro Phe Pro Asn Gln Tyr Gln Tyr Ile Ala Ala Val Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Asn Phe Ile Leu Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ala Gln Val Pro Thr Thr Ala Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile Ser Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val Ala Gly Ser <210> 9 <211> 4190 <212> DNA
<213> Homo Sapiens <220>

<221>
CDS

<222> (2340) (1)..

<400>

gcc caagtg cctaccaca getgtgaca ataacttct tcagetgag ctg 48 Ala GlnVal ProThrThr AlaValThr IleThrSer SerAlaGlu Leu ttc aaaacc ataatatca accacaagc actacttca cagaaaggc ccc 96 Phe LysThr IleIleSer ThrThrSer ThrThrSer GlnLysGly Pro atg agcaca actgtaget ggatcacag gaaggaagc aaagggaca aaa 149 Met SerThr ThrValAla GlySerGln GluGlySer LysGlyThr Lys cca cctcca gcagtttct acaaccaaa attccacct ataacaaat att 192 Pro ProPro AlaValSer ThrThrLys IleProPro IleThrAsn Ile ttt cccctg ccagagaga ttctgtgaa gcattagac tccaagggg ata 240 Phe ProLeu ProGluArg PheCysGlu AlaLeuAsp SerLysGly Ile aag tggcct cagacacaa aggggaatg atggttgaa cgaccatgc cct 288 Lys TrpPro GlnThrGln ArgGlyMet MetValGlu ArgProCys Pro aag ggaaca agaggaact gcctcatat ctctgcatg atttccact gga 336 Lys GlyThr ArgGlyThr AlaSerTyr LeuCysMet IleSerThr Gly aca tggaac cctaagggc cccgatctt agcaactgt acctcacac tgg 384 Thr TrpAsn ProLysGly ProAspLeu SerAsnCys ThrSerHis Trp gtg aatcag ctggetcag aagatcaga agcggagaa aatgetget agt 932 Val AsnGln LeuAlaGln LysIleArg SerGlyGlu AsnAlaAla Ser ctt gccaat gaactgget aaacatacc aaagggcca gtgtttget ggg 480 Leu AlaAsn GluLeuAla LysHisThr LysGlyPro ValPheAla Gly gat gtaagt tcttcagtg agattgatg gagcagttg gtggacatc ctt 528 Asp ValSer SerSerVal ArgLeuMet GluGlnLeu ValAspIle Leu gat gcacag ctgcaggaa ctgaaacct agtgaaaaa gattcaget gga 576 Asp AlaGln LeuGlnGlu LeuLysPro SerGluLys AspSerAla Gly cgg agttat aacaaggca attgttgac acagtggac aaccttctg aga 624 Arg SerTyr AsnLysAla IleValAsp ThrValAsp AsnLeuLeu Arg cct gaaget ttggaatca tggaaacat atgaattct tctgaacaa gca 672 Pro GluAla LeuGluSer TrpLysHis MetAsnSer SerGluGln Ala cat actgca acaatgtta ctcgataca ttggaagaa ggagetttt gtc 720 His Thr Thr MetLeuLeu AspThrLeu GluGluGly PheVal Ala Ala cta getgacaat cttttagaa ccaacaagg gtctcaatg cccacagaa 768 Leu AlaAspAsn LeuLeuGlu ProThrArg ValSerMet ProThrGlu aat attgtcctg gaagttgcc gtactcagt acagaagga cagatccaa 816 Asn IleValLeu GluValAla ValLeuSer ThrGluGly GlnIleGln gac tttaaattt cctctgggc atcaaagga gcaggcagc tcaatccaa 864 Asp PheLysPhe ProLeuGly IleLysGly AlaGlySer SerIleGln ctg tccgcaaat accgtcaaa cagaacagc aggaatggg cttgcaaag 912 Leu SerAlaAsn ThrValLys GlnAsnSer ArgAsnGly LeuAlaLys ttg gtgttcatc atttaccgg agcctggga cagttcctt agtacagaa 960 Leu ValPheIle IleTyrArg SerLeuGly GlnPheLeu SerThrGlu aat gcaaccatt aaactgggt getgatttt attggtcgt aatagcacc 1008 Asn AlaThrIle LysLeuGly AlaAspPhe IleGlyArg AsnSerThr att gcagtgaac tctcacgtc atttcagtt tcaatcaat aaagagtcc 1056 Ile AlaValAsn SerHisVal IIeSerVal SerIleAsn LysGluSer agc cgagtatac ctgactgat cctgtgctt tttaccctg ccacacatt 1104 Ser ArgValTyr LeuThrAsp ProValLeu PheThrLeu ProHisIle gat cctgacaat tatttcaat gcaaactgc tccttctgg aactactca 1152 Asp ProAspAsn TyrPheAsn AlaAsnCys SerPheTrp AsnTyrSer gag agaactatg atgggatat tggtctacc cagggctgc aagctggtt 1200 Glu ArgThrMet MetGlyTyr TrpSerThr GlnGlyCys LysLeuVal gac actaataaa actcgaaca acgtgtgca tgcagccac ctaaccaat 1248 Asp ThrAsnLys ThrArgThr ThrCysAla CysSerHis LeuThrAsn ttt gcaattctc atggcccac agggaaatt gcatataaa gatggcgtt 1296 Phe AlaIleLeu MetAlaHis ArgGluIle AlaTyrLys AspGlyVal cat gaattactt cttacagtc atcacctgg gtgggaatt gtcatttcc 1344 His GluLeuLeu LeuThrVal IleThrTrp ValGlyIle ValIleSer ctt gtttgcctg getatctgc atcttcacc ttctgcttt ttccgtggc 1392 Leu ValCysLeu AlaIleCys IlePheThr PheCysPhe PheArgGly cta cagagtgac cgaaatact attcacaag aacctttgt atcaacctt 1490 Leu GlnSerAsp ArgAsnThr IleHisLys AsnLeuCys IleAsnLeu WO 99/45111 PC'T/US99/04676 ttc att getgaattt attttccta ataggcatt gataagacaaaa tat 1488 Phe Ile AlaGluPhe IlePheLeu IleGlyIle AspLysThrLys Tyr gcg att gcatgccca atatttgca ggacttcta cactttttcttt ttg 1536 Ala Ile AlaCysPro IlePheAla GlyLeuLeu HisPhePhePhe Leu gca get tttgettgg atgtgccta gaaggtgtg cagctctaccta atg 1589 Ala Ala PheAlaTrp MetCysLeu GluGlyVal GlnLeuTyrLeu Met tta gtt gaagttttt gaaagtgaa tattcaagg aaaaaatattac tat 1632 Leu Val GluValPhe GluSerGlu TyrSerArg LysLysTyrTyr Tyr gtt get ggttacttg tttcctgcc acagtggtt ggagtttcaget get 1680 Val Ala GlyTyrLeu PheProAla ThrValVal GlyValSerAla Ala att gac tataagagc tatggaaca gaaaaaget tgctggcttcat gtt 1728 Ile Asp TyrLysSer TyrGlyThr GluLysAla CysTrpLeuHis Val gat aac tactttata tggagcttc attggacct gttaccttcatt att 1776 Asp Asn TyrPheIle TrpSerPhe IleGlyPro ValThrPheIle Ile ctg cta aatattatc ttcttggtg atcacattg tgcaaaatggtg aag 1824 Leu Leu AsnIleIle PheLeuVal IleThrLeu CysLysMetVal Lys cat tca aacactttg aaaccagat tctagcagg ttggaaaacatt aag 1872 His Ser AsnThrLeu LysProAsp SerSerArg LeuGluAsnIle Lys tct tgg gtgcttggc getttcget cttctgtgt cttcttggcctc acc 1920 Ser Trp ValLeuGly AlaPheAla LeuLeuCys LeuLeuGlyLeu Thr tgg tcc tttgggttg ctttttatt aatgaggag actattgtgatg gca 1968 Trp Ser PheGlyLeu LeuPheIle AsnGluGlu ThrIleValMet Ala tat ctc ttcactata tttaatget ttccaggga gtgttcattttc atc 2016 Tyr Leu PheThrIle PheAsnAla PheGlnGly ValPheIlePhe Ile ttt cac tgtgetctc caaaagaaa gtacgaaaa gaatatggcaag tgc 2064 Phe His CysAlaLeu GlnLysLys ValArgLys GluTyrGlyLys Cys ttc aga cactcatac tgctgtgga ggcctccca actgagagtccc cac 2112 Phe Arg HisSerTyr CysCysGly GlyLeuPro ThrGluSerPro His agt tca gtgaaggca tcaaccacc agaaccagt getcgctattcc tct 2160 Ser Ser ValLysAla SerThrThr ArgThrSer AlaArgTyrSer Ser ggc aca cagagtcgt ataagaaga atgtggaat gatactgtgaga aaa 2208 Gly Thr GlnSerArg IleArgArg MetTrpAsn AspThrValArg Lys caa tca gaa tct tct ttt atc tca ggt gac atc aat agc act tca aca 2256 Gln Ser Glu Ser Ser Phe Ile Ser Gly Asp Ile Asn Ser Thr Ser Thr ctt aat caa gga ctg aca tca cat ggt ctg aga gcc cat ctt caa gat 2304 Leu Asn Gln Gly Leu Thr Ser His Gly Leu Arg Ala His Leu Gln Asp tta tat cat tta gag cta ctc tta ggc cag ata gcc tgagcagaca 2350 Leu Tyr His Leu Glu Leu Leu Leu Gly Gln Ile Ala gacatgatgt gagttgtcca aagacattca ctgaacaatg ccagggatac aagtgccatg 2410 gatactctac cgctaaatgg taattttaac aacagctact cgctgcacaa gggtgactat 2470 aatgacagcg tgcaagttgt ggactgtgga ctaagtctga atgatactgc ttttgagaaa 2530 atgatcattt cagaattagt gcacaacaac ttacggggca gcagcaagac tcacaacctc 2590 gagctcacgc taccagtcaa acctgtgatt ggaggtagca gcagtgaaga tgatgctatt 2650 gtggcagatg cttcatcttt aatgcacagc gacaacccag ggctggagct ccatcacaaa 2710 gaactcgagg caccacttat tcctcagcgg actcactccc ttctgtacca accccagaag 2770 aaagtgaagt ccgagggaac tgacagctat gtctcccaac tgacagcaga ggctgaagat 2830 cacctacagt cccccaacag agactctctt tatacaagca tgcccaatct tagagactct 2890 ccctatccgg agagcagccc tgacatggaa gaagacctct ctccctccag gaggagtgag 2950 aatgaggaca tttactataa aagcatgcca aatcttggag ctggccatca gcttcagatg 3010 tgctaccaga tcagcagggg caatagtgat ggttatataa tccccattaa caaagaaggg 3070 tgtattccag aaggagatgt tagagaagga caaatgcagc tggttacaag tctttaatca 3130 tacagctaag gaattccaag ggccacatgc gagtattaat aaataaagac accattggcc 3190 tgacgcagct ccctcaaact ctgcttgaag agatgactct tgacctgtgg ttctctggtg 3250 taaaaaagat gactgaacct tgcagttctg tgaattttta taaaacatac aaaaactttg 3310 tatatacaca gagtatacta aagtgaatta tttgttacaa agaaaagaga tgccagccag 3370 gtattttaag attctgctgc tgtttagaga aattgtgaaa caagcaaaac aaaactttcc 3930 agccatttta ctgcagcagt ctgtgaacta aatttgtaaa tatggctgca ccatttttgt 3490 aggcctgcat tgtattatat acaagacgta ggctttaaaa tcctgtggga caaatttact 3550 gtaccttact attcctgaca agacttggaa aagcaggaga gatattctgc atcagtttgc 3610 agttcactgc aaatctttta cattaaggca aagattgaaa acatgcttaa ccactagcaa 3670 tcaagccaca ggccttattt catatgtttc ctcaactgta caatgaacta ttctcatgaa 3730 aaatggctaa agaaattata ttttgttcta ttgctagggt aaaataaata catttgtgtc 3790 caactgaaat ataattgtca ttaaaataat tttaaagagt gaagaaaata ttgtgaaaag 3850 ctcttggttg cacatgttat gaaatgtttt ttcttacact ttgtcatggt aagttctact 3910 cattttcact tcttttccac tgtatacagt gttctgcttt gacaaagtta gtctttatta 3970 cttacattta aatttcttat tgccaaaaga acgtgtttta tggggagaaa caaactcttt 4030 gaagccagtt atgtcatgcc ttgcacaaaa gtgatgaaat ctagaaaaga ttgtgtgtca 4090 cccctgttta ttcttgaaca gagggcaaag agggcactgg gcacttctca caaactttct 4150 agtgaacaaa aggtgcctat tcttttttaa aaaaaaaaaa 4190 <210> 10 <211> ?80 <212> PRT
<213> Homo Sapiens <400> 10 Ala Gln Val Pro Thr Thr Ala Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile Ser Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val Ala Gly Ser Gln Glu Gly Ser Lys Gly Thr Lys Pro Pro Pro Ala Val Ser Thr Thr Lys Ile Pro Pro Ile Thr Asn Ile Phe Pro Leu Pro Glu Arg Phe Cys Glu Ala Leu Asp Ser Lys Gly Ile Lys Trp Pro Gln Thr Gln Arg Gly Met Met Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Thr Ala Ser Tyr Leu Cys Met Ile Ser Thr Gly Thr Trp Asn Pro Lys Gly Pro Asp Leu Ser Asn Cys Thr Ser His Trp Val Asn Gln Leu Ala Gln Lys Ile Arg Ser Gly Glu Asn Ala Ala Ser Leu Ala Asn Glu Leu Ala Lys His Thr Lys Gly Pro Val Phe Ala Gly Asp Val Ser Ser Ser Val Arg Leu Met Glu Gln Leu Val Asp Ile Leu Asp Ala Gln Leu Gln Glu Leu Lys Pro Ser Glu Lys Asp Ser Ala Gly Arg Ser Tyr Asn Lys Ala Ile Val Asp Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys His Met Asn Ser Ser Glu Gln Ala His Thr Ala Thr Met Leu Leu Asp Thr Leu Glu Glu Gly Ala Phe Val Leu Ala Asp Asn Leu Leu Glu Pro Thr Arg Val Ser Met Pro Thr Glu Asn Ile Val Leu Glu Val Ala Val Leu Ser Thr Glu Gly Gln Ile Gln Asp Phe Lys Phe Pro Leu Gly Ile Lys Gly Ala Gly Ser Ser Ile Gln Leu Ser Ala Asn Thr Val Lys Gln Asn Ser Arg Asn Gly Leu Ala Lys Leu Val Phe Ile Ile Tyr Arg Ser Leu Gly Gln Phe Leu Ser Thr Glu Asn Ala Thr Ile Lys Leu Gly Ala Asp Phe Ile Gly Arg Asn Ser Thr Ile Ala Val Asn Ser His Val Ile Ser Val Ser Ile Asn Lys Glu Ser Ser Arg Val Tyr Leu Thr Asp Pro Val Leu Phe Thr Leu Pro His Ile Asp Pro Asp Asn Tyr Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Thr Met Met Gly Tyr Trp Ser Thr Gln Gly Cys Lys Leu Val Asp Thr Asn Lys Thr Arg Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Ile Leu Met Ala His Arg Glu Ile Ala Tyr Lys Asp Gly Val His Glu Leu Leu Leu Thr Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu AIa Ile Cys Ile Phe Thr Phe Cys Phe Phe Arg Gly Leu Gln Ser Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Ile Ala Glu Phe Ile Phe Leu Ile Gly Ile Asp Lys Thr Lys Tyr Ala Ile Ala Cys Pro Ile Phe Ala Gly Leu Leu His Phe Phe Phe Leu Ala Ala Phe Ala Trp Met Cys Leu Glu Gly Val Gln Leu Tyr Leu Met Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Lys Lys Tyr Tyr Tyr Val Ala Gly Tyr Leu Phe Pro Ala Thr Val Val Gly Val Ser Ala Ala Ile Asp Tyr Lys Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu His Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Thr Phe Ile Ile Leu Leu Asn Ile Ile Phe Leu Val Ile Thr Leu Cys Lys Met Val Lys His Ser Asn Thr Leu Lys Pro Asp Ser Ser Arg Leu Glu Asn Ile Lys Ser Trp Val Leu Gly Ala Phe Ala Leu Leu Cys Leu Leu Gly Leu Thr Trp Ser Phe Gly Leu Leu Phe Ile Asn Glu Glu Thr Ile Val Met Ala Tyr Leu Phe Thr Ile Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Ile Phe His Cys Ala Leu Gln Lys Lys Val Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr Cys Cys Gly Gly Leu Pro Thr Glu Ser Pro His Ser Ser Val Lys Ala Ser Thr Thr Arg Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys 725 730 ?35 Gln Ser Glu Ser Ser Phe Ile Ser Gly Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly Leu Thr Ser His Gly Leu Arg Ala His Leu Gln Asp Leu Tyr His Leu Glu Leu Leu Leu Gly Gln Ile Ala <210> 11 <211> 3156 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (49)..(2553) <400> 11 ctgtcccact cactctttcc cctgccgctc ctgccggcag ctccaacc atg gga ggc 57 Met Gly Gly cgc gtc ttt ctc gca ttc tgt gtc tgg ctg act ctg ccg gga get gaa 105 Arg Val Phe Leu Ala Phe Cys Val Trp Leu Thr Leu Pro Gly Ala Glu acc cag gac tcc agg ggc tgt gcc cgg tgg tgc cct cag aac tcc tcg 153 Thr GlnAsp Ser Gly CysAlaArg TrpCysPro GlnAsnSer Ser Arg tgt gtcaat gccaccgcc tgtcgctgc aatccaggg ttcagctct ttt 201 Cys ValAsn AlaThrAla CysArgCys AsnProGly PheSerSer Phe tct gagatc atcaccacc ccgacggag acttgtgac gacatcaac gag 249 Ser GluIle IleThrThr ProThrGlu ThrCysAsp AspIleAsn Glu tgt gcaaca ccgtcgaaa gtgtcatgc ggaaaattc tcggactgc tgg 297 Cys AlaThr ProSerLys ValSerCys GlyLysPhe SerAspCys Trp 70 75 80 ' aac acagag gggagctac gactgcgtg tgcagcccg ggatatgag cct 345 Asn ThrGlu GlySerTyr AspCysVal CysSerPro GlyTyrGlu Pro gtt tctggg acaaaaaca ttcaagaat gagagcgag aacacctgt caa 393 Val SerGly ThrLysThr PheLysAsn GluSerGlu AsnThrCys Gln gat gtggac gaatgtcag cagaaccca aggctctgt aaaagctac ggc 441 Asp ValAsp GluCysGln GlnAsnPro ArgLeuCys LysSerTyr Gly acc tgcgtc aacaccctt ggcagctat acctgccag tgcctgcct ggc 989 Thr CysVal AsnThrLeu GlySerTyr ThrCysGln CysLeuPro Gly ttc aagttc atacctgag gatccgaag gtctgcaca gatgtgaat gaa 537 Phe LysPhe IleProGlu AspProLys ValCysThr AspValAsn Glu tgc acctcc ggacaaaat ccgtgccac agctccacc cactgcctc aac 585 Cys ThrSer GlyGlnAsn ProCysHis SerSerThr HisCysLeu Asn aac gtgggc agctatcag tgtcgctgc cgaccgggc tggcaaccg att 633 Asn ValGly SerTyrGln CysArgCys ArgProGly TrpGlnPro Ile ccg gggtcc cccaatggc ccaaacaat accgtctgt gaagatgtg gac 681 Pro GlySer ProAsnGly ProAsnAsn ThrValCys GluAspVal Asp gag tgcagc tccgggcag catcagtgt gacagctcc accgtctgc ttc 729 Glu CysSer SerGlyGln HisGlnCys AspSerSer ThrValCys Phe aac accgtg ggttcatac agctgccgc tgccgccca ggctggaag ccc 777 Asn ThrVal GlySerTyr SerCysArg CysArgPro GlyTrpLys Pro aga cacgga atcccgaat aaccaaaag gacactgtc tgtgaagat atg 825 Arg HisGly IleProAsn AsnGlnLys AspThrVal CysGluAsp Met act ttctcc acctggacc ccgccccct ggagtccac agccagacg ctt 873 Thr PheSer ThrTrpThr ProProPro GlyValHis SerGlnThr Leu tcc cga ttc ttc gac aaa gtc cag gac ctg ggc aga gac tcc aag aca 921 Ser Arg Phe Phe Asp Lys Val Gln Asp Leu Gly Arg Asp Ser Lys Thr agc tca gcc gag gtc acc atc cag aat gtc atc aaa ttg gtg gat gaa 969 Ser Ser Ala Glu Val Thr Ile Gln Asn Val Ile Lys Leu Val Asp Glu ctg atg gaa get cct gga gac gta gag gcc ctg gcg cca cct gtc cgg 1017 Leu Met Glu Ala Pro Gly Asp Val Glu Ala Leu Ala Pro Pro Val Arg cac ctc ata gcc acc cag ctg ctc tca aac ctt gaa gat atc atg agg 1065 His Leu Ile Ala Thr Gln Leu Leu Ser Asn Leu Glu Asp Ile Met Arg atc ctg gcc aag agc ctg cct aaa ggc ccc ttc acc tac att tcc cct 1113 Ile Leu Ala Lys Ser Leu Pro Lys Gly Pro Phe Thr Tyr Ile Ser Pro tcg aac aca gag ctg acc ctg atg atc cag gag cgg ggg gac aag aac 1161 Ser Asn Thr Glu Leu Thr Leu Met Ile Gln Glu Arg Gly Asp Lys Asn gtc act atg ggt cag agc agc gca cgc atg aag ctg aat tgg get gtg 1209 Val Thr Met Gly Gln Ser Ser Ala Arg Met Lys Leu Asn Trp Ala Val gca get gga gcc gag gat cca ggc ccc gcc gtg gcg ggc atc ctc tcc 1257 Ala Ala Gly Ala Glu Asp Pro Gly Pro Ala Val Ala Gly Ile Leu Ser atc cag aac atg acg aca ttg ctg gcc aat gcc tcc ttg aac ctg cat 1305 Ile Gln Asn Met Thr Thr Leu Leu Ala Asn Ala Ser Leu Asn Leu His tcc aag aag caa gcc gaa ctg gag gag ata tat gaa agc agc atc cgt 1353 Ser Lys Lys Gln Ala Glu Leu Glu Glu Ile Tyr Glu Ser Ser Ile Arg ggt gtc caa ctc aga cgc ctc tct gcc gtc aac tcc atc ttt ctg agc 1401 Gly Val Gln Leu Arg Arg Leu 5er Ala Val Asn Ser Ile Phe Leu Ser cac aac aac acc aag gaa ctc aac tcc ccc atc ctt ttc gcc ttc tcc 1449 His Asn Asn Thr Lys Glu Leu Asn Ser Pro Ile Leu Phe Ala Phe Ser cac ctt gag tcc tcc gat ggg gag gcg gga aga gac cct cct gcc aag 1497 His Leu Glu Ser Ser Asp Gly Glu Ala Gly Arg Asp Pro Pro Ala Lys gac gtg atg cct ggg cca cgg cag gag ctg ctc tgt gcc ttc tgg aag 1545 Asp Val Met Pro Gly Pro Arg Gln Glu Leu Leu Cys Ala Phe Trp Lys agt gac agc gac agg gga ggg cac tgg gcc acc gag ggc tgc cag gtg 1593 Ser Asp Ser Asp Arg Gly Gly His Trp Ala Thr Glu Gly Cys Gln Val ctg ggc agc aag aac ggc agc acc acc tgc caa tgc agc cac ctg agc 1641 Leu Gly Ser Lys Asn Gly Ser Thr Thr Cys Gln Cys Ser His Leu Ser agctttgcgatc cttatgget cattat gacgtggaggac tggaagctg 1689 SerPheAlaIle LeuMetAla HisTyr AspValGluAsp TrpLysLeu accctgatcacc agggtggga ctggcg ctgtcactcttc tgcctgctg 1737 ThrLeuIleThr ArgValGly LeuAla LeuSerLeuPhe CysLeuLeu ctgtgcatcctc actttcctg ctggtg cggcccatccag ggctcgcgc 1785 LeuCysIleLeu ThrPheLeu LeuVal ArgProIleGln GlySerArg accaccatacac ctgcacctc tgcatc tgcctcttcgtg ggctccacc 1833 ThrThrIleHis LeuHisLeu CysIle CysLeuPheVal GlySerThr atcttcctggcc ggcatcgag aacgaa ggcggccaggtg gggctgcgc 1881 IlePheLeuAla GlyIleGlu AsnGlu GlyGlyGlnVal GlyLeuArg tgccgcctggtg gccgggctg ctgcac tactgtttcctg gccgccttc 1929 CysArgLeuVal AlaGlyLeu LeuHis TyrCysPheLeu AlaAlaPhe tgctggatgagc ctcgaaggc ctggag ctctactttctt gtggtgcgc 1977 CysTrpMetSer LeuGluGly LeuGlu LeuTyrPheLeu ValValArg gtgttccaaggc cagggcctg agtacg cgctggctctgc ctgatcggc 2025 ValPheGlnGly GlnGlyLeu SerThr ArgTrpLeuCys LeuIleGly tatggcgtgccc ctgctcatc gtgggc gtctcggetgcc atctacagc 2073 TyrGlyValPro LeuLeuIle ValGly ValSerAlaAla IleTyrSer aagggctacggc cgccccaga tactgc tggttggacttt gagcagggc 2121 LysGlyTyrGly ArgProArg TyrCys TrpLeuAspPhe GluGlnGly ttcctctggagc ttcttggga cctgtg accttcatcatt ttgtgcaat 2169 PheLeuTrpSer PheLeuGly ProVal ThrPheIleIle LeuCysAsn getgtcattttc gtgactacc gtctgg aagctcactcag aagttttct 2217 AlaValIlePhe ValThrThr ValTrp LysLeuThrGln LysPheSer gaaatcaatcca gacatgaag aaatta aagaaggcgagg gcgctgacc 2265 GluIleAsnPro AspMetLys LysLeu LysLysAlaArg AlaLeuThr atcacggccatc gcgcagctc ttcctg ttgggctgcacc tgggtcttt 2313 IleThrAlaIle AlaGlnLeu PheLeu LeuGlyCysThr TrpValPhe ggcctgttcatc ttcgacgat cggagc ttggtgctgacc tatgtgttt 2361 GlyLeuPheIle PheAspAsp ArgSer LeuValLeuThr TyrValPhe acc atc ctc aac tgc ctg cag ggc gcc ttc ctc tac ctg ctg cac tgc 2409 Thr Ile Leu Asn Cys Leu Gln Gly Ala Phe Leu Tyr Leu Leu His Cys ctg ctc aac aag aag gtt cgg gaa gaa tac cgg aag tgg gcc tgc cta 2457 Leu Leu Asn Lys Lys Val Arg Glu Glu Tyr Arg Lys Trp Ala Cys Leu gtt get ggg ggg agc aag tac tca gaa ttc acc tcc acc acg tct ggc 2505 Val Ala Gly Gly Ser Lys Tyr Ser Glu Phe Thr Ser Thr Thr Ser Gly act ggc cac aat cag acc cgg gcc ctc agg gca tca gag tcc ggc ata 2553 Thr Gly His Asn Gln Thr Arg Ala Leu Arg Ala Ser Glu Ser Gly Ile tgaaggcgca tggttctgga cggcccagca gctcctgtgg ccacagcagc tttgtacacg 2613 aagaccatcc atcctccctt cgtccaccac tctactccct ccaccctccc tccctgatcc 2673 cgtgtgccac caggagggag tggcagctat agtctggcac caaagtccag gacacccagt 2733 ggggtggagt cggagccact ggtcctgctg ctggctgcct ctctgctcca ccttgtgacc 2793 cagggtgggg acaggggctg gcccagggct gcaatgcagc atgttgccct ggcacctgtg 2853 gccagtactc gggacagact aagggcgctt gtcccatcct ggacttttcc tctcatgtct 2913 ttgctgcaga actgaagaga ctaggcgctg gggctcagct tccctcttaa gctaagactg 2973 atgtcagagg ccccatggcg aggccccttg gggccactgc ctgaggctca cggtacagag 3033 gcctgccctg cctggccggg caggaggttc tcactgttgt gaaggttgta gacgttgtgt 3093 aatgtgtttt tatctgttaa aatttttcag tgttgacact taaaattaaa cacatgcata 3153 cag 3156 <210> 12 <211> 835 <212> PRT
<213> Homo sapiens <400> 12 Met Gly Gly Arg Val Phe Leu Ala Phe Cys Val Trp Leu Thr Leu Pro Gly Ala Glu Thr Gln Asp Ser Arg Gly Cys Ala Arg Trp Cys Pro Gln Asn Ser Ser Cys Val Asn Ala Thr Ala Cys Arg Cys Asn Pro Gly Phe Ser Ser Phe Ser Glu Ile Ile Thr Thr Pro Thr Glu Thr Cys Asp Asp Ile Asn Glu Cys Ala Thr Pro Ser Lys Val Ser Cys Gly Lys Phe Ser 65 70 75 8p Asp Cys Trp Asn Thr Glu Gly Ser Tyr Asp Cys Val Cys Ser Pro Gly Tyr Glu Pro Val Ser Gly Thr Lys Thr Phe Lys Asn Glu Ser Glu Asn Thr Cys Gln Asp Val Asp Glu Cys Gln Gln Asn Pro Arg Leu Cys Lys Ser Tyr Gly Thr Cys Val Asn Thr Leu Gly Ser Tyr Thr Cys Gln Cys Leu Pro Gly Phe Lys Phe Ile Pro Glu Asp Pro Lys Val Cys Thr Asp Val Asn Glu Cys Thr Ser Gly Gln Asn Pro Cys His Ser Ser Thr His Cys Leu Asn Asn Val Gly Ser Tyr Gln Cys Arg Cys Arg Pro Gly Trp Gln Pro Ile Pro Gly Ser Pro Asn Gly Pro Asn Asn Thr Val Cys Glu Asp Val Asp Glu Cys Ser Ser Gly Gln His Gln Cys Asp Ser Ser Thr Val Cys Phe Asn Thr Val Gly Ser Tyr Ser Cys Arg Cys Arg Pro Gly Trp Lys Pro Arg His Gly Ile Pro Asn Asn Gln Lys Asp Thr Val Cys Glu Asp Met Thr Phe Ser Thr Trp Thr Pro Pro Pro Gly Val His Ser Gln Thr Leu Ser Arg Phe Phe Asp Lys Val Gln Asp Leu Gly Arg Asp Ser Lys Thr Ser Ser Ala Glu Val Thr Ile Gln Asn Val Ile Lys Leu Val Asp Glu Leu Met Glu Ala Pro Gly Asp Val Glu Ala Leu Ala Pro Pro Val Arg His Leu Ile Ala Thr Gln Leu Leu Ser Asn Leu Glu Asp Ile Met Arg Ile Leu Ala Lys Ser Leu Pro Lys Gly Pro Phe Thr Tyr Ile Ser Pro Ser Rsn Thr Glu Leu Thr Leu Met Ile Gln Glu Arg Gly Asp Lys Asn Val Thr Met Gly Gln Ser Ser Ala Arg Met Lys Leu Asn Trp Ala Val Ala Ala Gly Ala Glu Asp Pro Gly Pro Ala Val Ala Gly Ile Leu Ser Ile Gln Asn Met Thr Thr Leu Leu Ala Asn Ala Ser Leu Asn Leu His Ser Lys Lys Gln Ala Glu Leu Glu Glu Ile Tyr Glu Ser Ser Ile Arg Gly Val Gln Leu Arg Arg Leu Ser Ala Val Asn Ser Ile Phe Leu Ser His Asn Asn Thr Lys Glu Leu Asn Ser Pro Ile Leu Phe Ala Phe Ser His Leu Glu Ser Ser Asp Gly Glu Ala Gly Arg Asp Pro Pro Ala Lys Asp Val Met Pro Gly Pro Arg Gln Glu Leu Leu Cys Ala Phe Trp Lys Ser Asp Ser Asp Arg Gly Gly His Trp Ala Thr Glu Gly Cys Gln Val Leu Gly Ser Lys Asn Gly Ser Thr Thr Cys Gln Cys Ser His Leu Ser Ser Phe Ala Ile Leu Met Ala His Tyr Asp Val Glu Asp Trp Lys Leu Thr Leu Ile Thr Arg Val Gly Leu Ala Leu Ser Leu Phe Cys Leu Leu Leu Cys Ile Leu Thr Phe Leu Leu Val Arg Pro Ile Gln Gly Ser Arg Thr Thr Ile His Leu His Leu Cys Ile Cys Leu Phe Val Gly Ser Thr Ile Phe Leu Ala Gly Ile Glu Asn Glu Gly Gly Gln Val Gly Leu Arg Cys Arg Leu Val Ala Gly Leu Leu His Tyr Cys Phe Leu Ala Ala Phe Cys Trp Met Ser Leu Glu Gly Leu Glu Leu Tyr Phe Leu Val Val Arg Val Phe Gln Gly Gln Gly Leu Ser Thr Arg Trp Leu Cys Leu Ile Gly Tyr Gly Val Pro Leu Leu Ile Val Gly Val Ser Ala Ala Ile Tyr Ser Lys Gly Tyr Gly Arg Pro Arg Tyr Cys Trp Leu Asp Phe Glu Gln Gly Phe Leu Trp Ser Phe Leu Gly Pro Val Thr Phe Ile Ile Leu Cys Asn Ala Val Ile Phe Val Thr Thr Val Trp Lys Leu Thr Gln Lys Phe Ser Glu Ile Asn Pro Asp Met Lys Lys Leu Lys Lys Ala Arg Ala Leu Thr Ile Thr Ala Ile Ala Gln Leu Phe Leu Leu Gly Cys Thr Trp Val Phe Gly Leu Phe Ile Phe Asp Asp Arg Ser Leu Val Leu Thr Tyr Val Phe Thr Ile Leu Asn Cys Leu Gln Gly Ala Phe Leu Tyr Leu Leu His Cys Leu Leu Asn Lys Lys Val Arg Glu Glu Tyr Arg Lys Trp Ala Cys Leu VaI Ala Gly Gly Ser Lys Tyr Ser Glu Phe Thr Ser Thr Thr Ser Gly Thr Gly His Asn Gln Thr Arg Ala Leu Arg Ala Ser Glu Ser Gly Ile <210> 13 <211> 867 <212> DNA
<213> Homo sapiens <400> 13 tttagaacct gaggccttct gtatcacgcg tgtggagttt cagctgctat tgactataag 60 agctatggaa cagaaaaagc ttgctggctt catgttgata actactttat atggagcttc 120 attggacctg ttaccttcat tattctgcta aatattatct tcttggtgat cacattgtgc 180 aaaatggtga agcattcaaa cactttgaaa ccagattcta gcaggttgga aaacattaag 240 tcttggggtg cttggcgctt tcgctcttct gtgtcttctt ggcctcacct gggtcctttg 300 gggttgcttt ttattaatga gggagactat tgtggatggg catatctctt tcacttatat 360 ttaattgctt tccgggggag tgttccattt tccatctttc cactgtgctc tccaaaagga 420 agtaatgatc tatatcatat atcttgatct cagcttcaaa attgctactt agctaggtat 480 atatatagta gaagatttat agtaatcaac tatctcttct ctcctagtaa gtactaatcg 540 aattcggcac gagaatcctc gagttttttt tttttttttt tttatttagt tccataaatt 600 aatattctat ttactctatc attaatacaa tgaaagttat aattaaaata taatagttat 660 cggcactaaa ttctattgca ggatattcat tgcaggccta tgcaggataa tagcacctat 720 gccgcctatg caaggcaagg atgtcctcaa tgaaggagac acgctcctga actcaagggc 780 aatgaaggca cgctcgcgca cgctcaggat aactcaggga tagatcaatt aagggtaaat 840 cggtaaatca ggctccaaaa gggaaaa 867 <210> 14 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 19 tggagtttca gctgctattg 20 <210> 15 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 15 tgcccatcca caatagtctc 20 <210> 16 <211> 3165 <212> DNA
<213> Homo sapiens <400> 16 aagaaagagt ccagccgagt atacctgact gatcctgtgc tttttaccct gccacacatt 60 gatcctgaca attatttcaa tgcaaactgc tccttctgga actactcaga gagaactatg 120 atgggatatt ggtctaccca gggctgcaag ctggttgaca ctaataaaac tcgaacaacg 180 tgtgcatgca gccacctaac caattttgca attctcatgg cccacaggga aattgcatat 240 aaagatggcg ttcatgaatt acttcttaca gtcatcacct gggtgggaat tgtcatttcc 300 cttgtttgcc tggctatctg catcttcacc ttctgctttt tccgtggcct acagagtgac 360 cgaaatacta ttcacaagaa cctttgtatc aaccttttca ttgctgaatt tattttccta 420 ataggcattg ataagacaaa atatgcgatt gcatgcccaa tatttgcagg acttctacac 480 tttttctttt tggcagcttt tgcttggatg tgcctagaag gtgtgcagct ctacctaatg 540 ttagttgaag tttttgaaag tgaatattca aggaaaaata ttactatgtt gctggttact 600 tgtttcctgc cacagtggtt ggagtttcag ctgctattga ctataagagc tatggaacag 660 aaaaagcttg ctggcttcat gttgataact actttatatg gagcttcatt ggacctgtta 720 ccttcattat tctgctaaat attatcttct tggtgatcac attgtgcaaa atggtgaagc 780 attcaaacac tttgaaacca gattctagca ggttggaaaa cattaagtct tgggtgcttg 840 gcgctttcgc tcttctgtgt cttcttggcc tcacctggtc ctttgggttg ctttttatta 900 atgaggagac tattgtgatg gcatatctct tcactatatt taatgctttc cagggagtgt 960 tcattttcat ctttcactgt gctctccaaa agaaagtacg aaaagaatat ggcaagtgct 1020 tcagacactc atactgctgt ggaggcctcc caactgagag tccccacagt tcagtgaagg 1080 catcaaccac cagaaccagt gctcgctatt cctctggcac acaggacatt cactgaacaa 1140 tgccagggat acaagtgcca tggatactct accgctaaat ggtaatttta acaacagcta 1200 ctcgctgcac aagggtgact ataatgacag cgtgcaagtt gtggactgtg gactaagtct 1260 gaatgatact gcttttgaga aaatgatcat ttcagaatta gtgcacaaca acttacgggg 1320 cagcagcaag actcacaacc tcgagctcac gctaccagtc aaacctgtga ttggaggtag 1380 cagcagtgaa gatgatgcta ttgtggcaga tgcttcatct ttaatgcaca gcgacaaccc 1440 agggctggag ctccatcaca aagaactcga ggcaccactt attcctcagc ggactcactc 1500 ccttctgtac caaccccaga agaaagtgaa gtccgaggga actgacagct atgtctccca 1560 actgacagca gaggctgaag atcacctaca gtcccccaac agagactctc tttatacaag 1620 catgcccaat cttagagact ctccctatcc ggagagcagc cctgacatgg aagaagacct 1680 ctctccctcc aggaggagtg agaatgagga catttactat aaaagcatgc caaatcttgg 1740 agctggccat cagcttcaga tgtgctacca gatcagcagg ggcaatagtg atggttatat 1800 aatccccatt aacaaagaag ggtgtattcc agaaggagat gttagagaag gacaaatgca 1860 gctggttaca agtctttaat catacagcta aggaattcca agggccacat gcgagtatta 1920 ataaataaag acaccattgg cctgacgcag ctccctcaaa ctctgcttga agagatgact 1980 cttgacctgt ggttctctgg tgtaaaaaag atgactgaac cttgcagttc tgtgaatttt 2040 tataaaacat acaaaaactt tgtatataca cagagtatac taaagtgaat tatttgttac 2100 aaagaaaaga gatgccagcc aggtatttta agattctgct gctgtttaga gaaattgtga 2160 aacaagcaaa acaaaacttt ccagccattt tactgcagca gtctgtgaac taaatttgta 2220 aatatggctg caccattttt gtaggcctgc attgtattat atacaagacg taggctttaa 2280 aatcctgtgg gacaaattta ctgtacctta ctattcctga caagacttgg aaaagcagga 2340 gagatattct gcatcagttt gcagttcact gcaaatcttt tacattaagg caaagattga 2400 aaacatgctt aaccactagc aatcaagcca caggccttat ttcatatgtt tcctcaactg 2960 tacaatgaac tattctcatg aaaaatggct aaagaaatta tattttgttc tattgctagg 2520 gtaaaataaa tacatttgtg tccaactgaa atataattgt cattaaaata attttaaaga 2580 gtgaagaaaa tattgtgaaa agctcttggt tgcacatgtt atgaaatgtt ttttcttaca 2640 ctttgtcatg gtaagttcta ctcattttca cttcttttcc actgtataca gtgttctgct 2700 ttgacaaagt tagtctttat tacttacatt taaatttctt attgccaaaa gaacgtgttt 2760 tatggggaga aacaaactct ttgaagccag ttatgtcatg ccttgcacaa aagtgatgaa 2820 atctagaaaa gattgtgtgt cacccctgtt tattcttgaa cagagggcaa agagggcact 2880 gggcacttct cacaaacttt ctagtgaaca aaaggtgcct attctttttt aaaaaaataa 2940 aataaaacat aaatattact cttccatatt ccttctgcct atatttagta attaatttat 3000 tttatgataa agttctaatg aaatgtaaat tgtttcagca aaattctgct tttttttcat 3060 ccctttgtgt aaacctgtta ataatgagcc catcactaat atccagtgta aagtttaaca 3120 cggtttgaca gtaaataaat gtgaattttt tcaaaaaaaa aaaaa 3165 <210> 17 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 17 gtgatccagc tacagttgtg ctcat 25 <210> 18 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <900> 18 ctaatgcttc acagaatctc tctggc 26 <210> 19 <211> 5693 <212> DNA
<213> Rattus rattus <220>
<221> CDS
<222> (425)..(4822) <400> 19 gagctctgac gccgcccccg cccctccgcc tccacgcctc gctccccggg aggggcgcag 60 acccgcgcgc ccggggccgg ggccgcctcc ggagcgccgc gatccgcctt ttctttcctt 120 ttttttccct tcccttcttc ccttttaaat tttggttggt ggcggcagtg ctgggccgga 180 ggaaagaagg gacacggagt cctccctcgc tcagccaccc cctccccgct tccccctggg 240 ccgggctccg ggagatgtgc cgggcggggg gcccggcttc gcggagccgc gggaggagcg 300 cgcacggccg accccgaagc gccgctggac aggctggtgg gccaggcctt ggtaccctgg 360 tgatgcgggg caaggccccc cccacagtcc gctgagatca ccgtgcccgc ccctggcctt 420 cgcc atg gcc cgc ttg get gca gca ctc tgg agt ctc tgt gtg acg act 469 Met Ala Arg Leu Ala Ala Ala Leu Trp Ser Leu Cys Val Thr Thr gtc ctc gtc acc tct get acc caa ggc ctg agc cgg get gga ctc cca 517 Val Leu Val Thr Ser Ala Thr Gln Gly Leu Ser Arg Ala Gly Leu Pro ttt gga ttg atg cgc cgg gag cta gca tgc gaa ggc tac ccc att gag 565 Phe Gly Leu Met Arg Arg Glu Leu Ala Cys Glu Gly Tyr Pro Ile Glu ctg cgg tgc ccg ggc agt gac gtc atc atg gtg gag aat gca aac tat 613 Leu Arg Cys Pro Gly Ser Asp Val Ile Met Val Glu Asn Ala Asn Tyr ggg cgc aca gat gac aag atc tgc gat gcc gac cct ttt cag atg gag 661 Gly Arg Thr Asp Asp Lys Ile Cys Asp Ala Asp Pro Phe Gln Met Glu aac gtg cag tgc tac ctg cct gac gcc ttc aaa atc atg tca cag aga 709 Asn Val Gln Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Ser Gln Arg tgt aat aac cga acc cag tgt gtg gtg gtg gcc ggc tct gac gcc ttt 757 Cys Asn Asn Arg Thr Gln Cys Val Val Val Ala Gly Ser Asp Ala Phe 100 105 lI0 cct gac ccc tgt cct gga acc tac aag tac ctg gag gtg cag tac gac 805 Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Asp tgt gtc cct tac atc ttc gtg tgc cca ggg aca ctg cag aag gtg ctg 853 Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Gln Lys Val Leu gag ccc acc tcc aca cat gaa tcg gag cac cag tct ggc gca tgg tgc 901 Glu Pro Thr Ser Thr His Glu Ser Glu His Gln Ser Gly Ala Trp Cys aag gac cca ctg cag gca ggt gac cgt atc tac gtt atg ccc tgg atc 949 Lys Asp Pro Leu Gln Ala Gly Asp Arg Ile Tyr Val Met Pro Trp Ile ccc tac cgc acg gac aca ctg acc gag tat get tcc tgg gag gac tat 997 Pro Tyr Arg Thr Asp Thr Leu Thr Glu Tyr Ala Ser Trp Glu Asp Tyr gtg get gca cgc cac acc acc acg tac aga ctg ccc aac cgt gta gat 1045 Val Ala Ala Arg His Thr Thr Thr Tyr Arg Leu Pro Asn Arg Val Asp ggc act ggc ttt gtg gta tat gat ggt gcc gtc ttc tat aac aag gaa 1093 Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Tyr Asn Lys Glu cgt act cgc aac att gtc aaa tat gac ctg cgg acc cgc atc aag agc 1141 Arg Thr Arg Asn Ile Val Lys Tyr Asp Leu Arg Thr Arg Ile Lys Ser gga gaa aca gtc ata aac aca gcc aac tac cac gac acc tca cct tat 1189 Gly Glu Thr Val Ile Asn Thr Ala Asn Tyr His Asp Thr Ser Pro Tyr cgc tgg gga ggc aaa acc gac att gac ctg gca gtg gat gag aac ggg 1237 Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly ctg tgg gtc atc tat gcc acc gag ggg aac aac ggg cgt ctg gtg gtg 1285 Leu Trp Val Ile Tyr Ala Thr Glu Gly Asn Asn Gly Arg Leu Val Val agc cag ctc aac ccc tac aca ctg cgt ttc gag ggc acc tgg gaa aca 1333 Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Gly Thr Trp Glu Thr ggc tat gac aag cgc tca gcc tcc aat gcc ttc atg gtg tgt ggt gtc 1381 Gly Tyr Asp Lys Arg Ser Ala Ser Asn Ala Phe Met Val Cys Gly Val ctc tat gtg ctg cgc tct gtt tat gtg gat gac gac agt gag gca gca 1429 Leu Tyr Val Leu Arg Ser Val Tyr Val Asp Asp Asp Ser Glu Ala Ala ggc aac cgc gtg gac tat gcc ttt aac acc aat gca aac cga gag gag 1477 Gly Asn Arg Val Asp Tyr Ala Phe Asn Thr Asn Ala Asn Arg Glu Glu ccc gtc agt ctc gcc ttc ccc aac ccc tac cag ttt gta tct tct gtt 1525 Pro Val Ser Leu Ala Phe Pro Asn Pro Tyr Gln Phe Val Ser Ser Val gac tac aat ccc cgg gac aac cag ctg tat gtg tgg aac aac tat ttc 1573 Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Tyr Phe gtg gtg cgc tac agc ctg gag ttt gga ccc cca gat ccc agt get ggc 1621 Val Val Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ser Ala Gly cca gcc act tcc cca cct ctc agt acc acc acc aca get cgg cct acg 1669 Pro Ala Thr Ser Pro Pro Leu Ser Thr Thr Thr Thr Ala Arg Pro Thr ccc ctc acc agc aca gcc tca cct gca gcc acc act cca ctc cgc cgg 1717 Pro Leu Thr Ser Thr Ala Ser Pro Ala Ala Thr Thr Pro Leu Arg Arg gcg ccc ctc acc acg cac cca gta ggt gcc atc aac cag ctg gga cct 1765 Ala Pro Leu Thr Thr His Pro Val Gly Ala Ile Asn Gln Leu Gly Pro gac ctg cct cca gcc aca gcc cca gca ccc agt acc cgg cgg cct cca 1813 Asp Leu Pro Pro Ala Thr Ala Pro Ala Pro Ser Thr Arg Arg Pro Pro gcc ccc aat ctg cat gtg tcc cct gag ctc ttc tgt gaa ccc cga gag 1861 Ala Pro Asn Leu His Val Ser Pro Glu Leu Phe Cys Glu Pro Arg Glu gtc cgg cgg gtc cag tgg cca get acc cag cag ggt atg ctg gta gag 1909 Val Arg Arg Val Gln Trp Pro Ala Thr Gln Gln Gly Met Leu Val Glu aga cct tgc ccc aag gga act cga gga att gcc tcg ttc cag tgc ctc 1957 Arg Pro Cys Pro Lys Gly Thr Arg Gly Ile Ala Ser Phe Gln Cys Leu cca get ctg ggg ctc tgg aat cct cgg ggc cct gac ctc agc aac tgc 2005 Pro Ala Leu Gly Leu Trp Asn Pro Arg Gly Pro Asp Leu Ser Asn Cys act tcc ccc tgg gtc aac caa gtc gcc cag aag atc aag agt gga gag 2053 Thr Ser Pro Trp Val Asn Gln Val Ala Gln Lys Ile Lys Ser Gly Glu aat gca gcc aac att get agt gag ctg gcc cgc cac acg cgg ggc tcc 2101 Asn Ala Ala Asn Ile Ala Ser Glu Leu Ala Arg His Thr Arg~Gly Ser atc tat get ggg gac gtg tcc tca tcg gtg aag ctg atg gag caa ctg 2149 - Ile Tyr Ala Gly Asp Val Ser Ser Ser Val Lys Leu Met Glu Gln Leu cta gat atc ctg gat gcc cag ctc cag gcc cta cgg ccc att gaa cga 2197 Leu Asp Ile Leu Asp Ala Gln Leu Gln Ala Leu Arg Pro Ile Glu Arg gag tca get ggc aag aac tac aat aag atg cac aag cga gag aga acc 2245 Glu Ser Ala Gly Lys Asn Tyr Asn Lys Met His Lys Arg Glu Arg Thr tgc aag gac tat atc aag get gtg gtg gag aca gtg gac aac ctg ctt 2293 Cys Lys Asp Tyr Ile Lys Ala Val Val Glu Thr Val Asp Asn Leu Leu cgg cca gag gca ctt gag tca tgg aaa gac atg aat gcc acc gaa cag 2341 Arg Pro Glu Ala Leu Glu Ser Trp Lys Asp Met Asn Ala Thr Glu Gln gtc cat acg gcc acc atg ctc cta gat gtc tta gag gag ggt gcc ttc 2389 Val His Thr Ala Thr Met Leu Leu Asp Val Leu Glu Glu Gly Ala Phe ctg ctg gcc gac aat gtc aga gaa cct get cgc ttc ttg get gcc aag 2437 Leu Leu Ala Asp Asn Val Arg Glu Pro Ala Arg Phe Leu Ala Ala Lys cag aat gtg gtc ctg gag gtc act gtc ctg agc aca gag ggt caa gtg 2485 Gln Asn Val Val Leu Glu Val Thr Val Leu Ser Thr Glu Gly Gln Val cag gag ttg gtg ttc ccc cag gag tat gcc agt gag agc tcc att cag 2533 Gln Glu Leu Val Phe Pro Gln Glu Tyr Ala Ser Glu Ser Ser Ile Gln ctg tcc gcc aac acc atc aag cag aac agc cgc aat ggt gtg gtg aag 2581 Leu Ser Ala Asn Thr Ile Lys Gln Asn Ser Arg Asn Gly Val Val Lys gtt gtc ttc att ctc tac aac aac ctg ggc ctc ttc ttg tcc acg gag 2629 Val Val Phe Ile Leu Tyr Asn Asn Leu Gly Leu Phe Leu Ser Thr Glu aat gcc aca gtg aag ctg gca ggt gag gca ggg acc ggt ggc cct gga 2677 Asn Ala Thr Val Lys Leu Ala Gly Glu Ala Gly Thr Gly Gly Pro Gly ggt gcc tcc ctg gtg gtt aac tca cag gtc atc gca gca tcc atc aat 2725 Gly Ala Ser Leu Val Val Asn Ser Gln Val Ile Ala Ala Ser Ile Asn aag gag tcc agc cgt gtc ttc ctc atg gac cct gtc atc ttt act gtg 2773 Lys Glu Ser Ser Arg Val Phe Leu Met Asp Pro Val Ile Phe Thr Val gcc cac ttg gag gcc aag aac cac ttc aat gca aac tgc tcc ttc tgg 2821 Ala His Leu Glu Ala Lys Asn His Phe Asn Ala Asn Cys Ser Phe Trp aactactcagag cgctccatg ctgggctac tggtcaacc cagggctgc 2869 AsnTyrSerGlu ArgSerMet LeuGlyTyr TrpSerThr GlnGlyCys cgactggtggag tccaataag acccatacc acatgtgcc tgcagccac 2917 ArgLeuValGlu SerAsnLys ThrHisThr ThrCysAla CysSerHis ctcaccaacttc gcagtgctc atggetcac cgagagatc taccaaggc 2965 LeuThrAsnPhe AlaValLeu MetAlaHis ArgGluIle TyrGlnGly cgtattaatgag ctgttgctg tcagtcatc acctgggtt ggcattgtc 3013 ArgIleAsnGlu LeuLeuLeu 5erValIle ThrTrpVal GlyIleVal atctccctggtc tgtctgget atctgcatc tccaccttc tgcttcctg 3061 IleSerLeuVal CysLeuAla IleCysIle SerThrPhe CysPheLeu cggggcctgcag accgaccgc aacaccatc cacaagaac ctgtgcatc 3109 ArgGlyLeuGln ThrAspArg AsnThrIle HisLysAsn LeuCysIle 880 885 890 g95 aacctcttcctt gcagagctg ctcttcctg gttggaata gacaaaact 3157 AsnLeuPheLeu AlaGluLeu LeuPheLeu ValGlyIle AspLysThr cagtatgaggtc gcctgccct atctttgcg ggcctgctg cactacttc 3205 GlnTyrGluVal AlaCysPro IlePheAla GlyLeuLeu HisTyrPhe ttcctggccgcc ttctcctgg ctgtgccta gagggcgtg cacctctac 3253 PheLeuAlaAla PheSerTrp LeuCysLeu GluGlyVal HisLeuTyr ctcctgctggtc gaggtgttc gagagcgaa tattcacgc accaagtac 3301 LeuLeuLeuVal GluValPhe GluSerGlu TyrSerArg ThrLysTyr tattacctgggc ggctactgc ttcccagcc ctggtggta ggcatcgca 3349 TyrTyrLeuGly GlyTyrCys PheProAla LeuValVal GlyIleAla gccgccattgac taccgaagc tacggcact gagaaggcc tgctggctg 3397 AlaAlaIleAsp TyrArgSer TyrGlyThr GluLysAla CysTrpLeu agggtggataac tatttcatc tggagcttc attgggccc gtctccttt 3445 ArgValAspAsn TyrPheIle TrpSerPhe IleGlyPro ValSerPhe gttattgtggtg aacctggtg ttcctcatg gtgaccctg cacaagatg 3493 ValIleValVal AsnLeuVal PheLeuMet ValThrLeu HisLysMet atccgaagctca tccgtgctc aagcctgac tccagccgc cttgacaac 3541 IleArgSerSer SerValLeu LysProAsp SerSerArg LeuAspAsn atc aag tcc tgg gcg ctg ggt gcc att gca ctg ctc ttc ctg ctg ggc 3589 Ile Lys Ser Trp Ala Leu Gly Ala Ile Ala Leu Leu Phe Leu Leu Gly ctc acc tgg get ttc ggc ctc ctc ttc atc aac aag gag tca gta gta 3637 Leu Thr Trp Ala Phe Gly Leu Leu Phe Ile Asn Lys Glu Ser Val Val atg get tac ctc ttc aca acc ttc aac gcc ttc cag ggg gtc ttc atc 3685 Met Ala Tyr Leu Phe Thr Thr Phe Asn Ala Phe Gln Gly Val Phe Ile ttt gtc ttt cac tgc gcc tta cag aaa aag gtg cac aag gag tac agc 3733 Phe Val Phe His Cys Ala Leu Gln Lys Lys Val His Lys Glu Tyr Ser aag tgc ctg cgt cac tcc tac tgc tgc att cgc tcc cca cct ggg ggg 3781 Lys Cys Leu Arg His Ser Tyr Cys Cys Ile Arg Ser Pro Pro Gly Gly get cac ggc tcc ctt aag acc tca gcc atg cga agt aac acc cgc tac 3829 Ala His Gly Ser Leu Lys Thr Ser Ala Met Arg Ser Asn Thr Arg Tyr tac aca ggg acc cag agc cga atc cgg agg atg tgg aat gac acc gtg 3877 Tyr Thr Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val agg aag cag aca gag tcg tcc ttt atg gca ggg gac atc aac agc acc 3925 Arg Lys Gln Thr Glu Ser Ser Phe Met Ala Gly Asp Ile Asn Ser Thr ccc acc ctg aac cga ggt acc atg ggg aac cac cta ctg acc aac cct 3973 Pro Thr Leu Asn Arg Gly Thr Met Gly Asn His Leu Leu Thr Asn Pro gtg cta cag ccc cgt ggg ggc act agc cca tac aat aca ctc att gca 4021 Val Leu Gln Pro Arg Gly Gly Thr Ser Pro Tyr Asn Thr Leu Ile Ala gag tct gtg ggc ttc aat ccc tcc tcg ccc cca gtc ttc aac tcc cca 4069 Glu Ser Val Gly Phe Asn Pro Ser Ser Pro Pro Val Phe Asn Ser Pro gga agc tac agg gaa cct aag cac ccc ttg ggc ggc cgg gaa gcc tgt 4117 Gly Ser Tyr Arg Glu Pro Lys His Pro Leu Gly Gly Arg Glu Ala Cys ggc atg gac aca ctg ccc ctt aat ggc aac ttc aac aac agc tac tcc 4165 Gly Met Asp Thr Leu Pro Leu Asn Gly Asn Phe Asn Asn Ser Tyr Ser ttg cga agt ggt gat ttc cct ccg ggg gat ggg ggt cct gag cca ccc 4213 Leu Arg Ser Gly Asp Phe Pro Pro Gly Asp Gly Gly Pro Glu Pro Pro cga ggc cga aac cta gcg gat get gcg gcc ttt gag aag atg atc atc 4261 Arg Gly Arg Asn Leu Ala Asp Ala Ala Ala Phe Glu Lys Met Ile Ile tca gag ctg gtg cac aac aac ctt cgg ggg gcc agt ggg ggc gcc aaa 4309 Ser Glu Leu Val His Asn Asn Leu Arg Gly Ala Ser Gly Gly Ala Lys ggtcctcca ccagagcct cctgtgcca cccgtg ccagga agt gag 4357 gtc GlyProPro ProGluPro ProValPro ProVal ProGly Ser Glu Val gacgagget ggtgggcct gggggtget gaccgg getgag gaa ctt 4405 att AspGluAla GlyGlyPro GlyGlyAla AspArg AlaGlu Glu Leu Ile ctctacaag gccctggag gagccactg ctgctg ccccgg cag tcg 4453 gcc LeuTyrLys AlaLeuGlu GluProLeu LeuLeu ProArg Gln Ser Ala gtgctgtac cagagtgat ctggatgag tcggag agctgt gca gag 4501 acg ValLeuTyr GlnSerAsp LeuAspGlu SerGlu SerCys Ala Glu Thr gat ggg gcc acc agc cgg ccc ctc tcc tcc cct ccc ggc cgg gac tcc 4549 Asp Gly Ala Thr Ser Arg Pro Leu Ser Ser Pro Pro Gly Arg Asp Ser ctc tat gcc agc ggg gcc aac ctg cgg gac tcg ccc tcc tac ccg gac 4597 Leu Tyr Ala Ser Gly Ala Asn Leu Arg Asp Ser Pro Ser Tyr Pro Asp agc agc ccc gaa ggg cct aat gag gcc ctg ccc cct ccc cca cct get 4645 Ser Ser Pro Glu Gly Pro Asn Glu Ala Leu Pro Pro Pro Pro Pro Ala ccc cct ggg ccc cca gaa atc tac tac acc tct cgc ccg ccg gcc ctg 4693 Pro Pro Gly Pro Pro Glu Ile Tyr Tyr Thr Ser Arg Pro Pro Ala Leu gtg get cgg aat ccc cta cag ggc tac tac cag gtg cgg cgg ccc agc 4741 Val Ala Arg Asn Pro Leu Gln Gly Tyr Tyr Gln Val Arg Arg Pro Ser cat gag ggc tac ctg gca gcc ccc agc ctt gag ggg cca ggg ccc gat 4789 His Glu Gly Tyr Leu Ala Ala Pro Ser Leu Glu Gly Pro Gly Pro Asp ggg gat ggg caa atg cag ttg gtc act agt ctc tgaggggcct catggaccag 4842 Gly Asp Gly Gln Met Gln Leu Val Thr Ser Leu aggcctggcc agggagggaa tccaggaggg gctctggtgg gagcagagac tgatggaggc 4902 agtggctggt gggccactct ctccaggtgc ccctctgcct gtgggcccca cagtcccctt 4962 ggggactatg acctgggccc caggtgccag ggttagtaga cagggtttcc accagccaca 5022 agccccagct tctttagggg agtgcattga ggagaagccc ccagggccct aggagtgagg 5082 gagaagctgg taggtgtgac caacgtccaa agctccctcc ctttggaggg agaaagcaag 5142 ggataaggct tccctaggtg tacaggggtg gccacttttg aggtggccga agccttgcag 5202 gatacaccct atctgctgct catcttcttc gtccaccaga aaggagcagt gggacagatg 5262 gacaggtcct tccatgctac agttccttgc ttcttggaga ctgggcctaa catcctgaga 5322 gagcccaggc ccaggggatg gatggggttg tgagggctgg tggttaatgg tggaactttc 5382 tctgaagctc ctttctccct tgctattggt ccctatctcc cgagcaagcc taccctaaac 5442 ccccagagtg cacccaatga ccccctccct tggggtgact cctgatgaag cacaactccc 5502 cgcagggccc caacccactg cagtggccat atttgggcag ttcccagtcc tgtgggctgg 5562 gctatctggg gagcagatgt ggggtctggg gctccctgag gagtgggtcc tgggtttgga 5622 tctttcccta gggggtcctc ttacccttct cttcctcccc tattgctgta aatatttcaa 5682 caaaatggaa a 5693 <210> 20 <211> 1466 <212> PRT

<213> Rattus rattus <400> 20 Met Ala erg Leu Ala LeuTrp5er Leu ValThrThr Val Ala Ala Cys Leu Val Thr Ser Gln GlyLeuSer Arg GlyLeuPro Phe Ala Thr Ala Gly Leu Met Arg Leu AlaCysGlu Gly ProIleGlu Leu Arg Glu Tyr Arg Cys Pro Gly Val IleMetVal Glu AlaAsnTyr Gly Ser Asp Asn Arg Thr Asp Asp Cys AspAlaAsp Pro GlnMetGlu Asn Lys Ile Phe Val Gln Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Ser Gln Arg Cys Asn Asn Arg Thr Gln Cys Val Val Val Ala Gly Ser Asp Ala Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Asp Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Gln Lys Val Leu Glu Pro Thr Ser Thr His Glu Ser Glu His Gln Ser Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Gly Asp Arg Ile Tyr Val Met Pro Trp Ile Pro Tyr Arg Thr Asp Thr Leu Thr Glu Tyr Ala Ser Trp Glu Asp Tyr Val Ala Ala Arg His Thr Thr Thr Tyr Arg Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Tyr Asn Lys GIu Arg Thr Arg Rsn Ile Val Lys Tyr Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Thr Val Ile Asn Thr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gly Asn Asn Gly Arg Leu Val Val Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Gly Thr Trp Glu Thr Gly Tyr Asp Lys Arg Ser Ala Ser Asn Ala Phe Met Val Cys Gly Val Leu Tyr Val Leu Arg Ser Val Tyr Val Asp Asp Asp Ser Glu Ala Ala Gly Asn Arg Val Asp Tyr Ala Phe Asn Thr Asn Ala Asn Arg Glu Glu Pro Val Ser Leu Ala Phe Pro Asn Pro Tyr Gln Phe Val Ser Ser Val Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Tyr Phe Val Val Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ser Ala Gly Pro Ala Thr Ser Pro Pro Leu Ser Thr Thr Thr Thr Ala Arg Pro Thr Pro Leu Thr Ser Thr Ala Ser Pro Ala Ala Thr Thr Pro Leu Arg Arg Ala Pro Leu Thr Thr His Pro Val Gly Ala Ile Asn Gln Leu Gly Pro Asp Leu Pro Pro Ala Thr Ala Pro Ala Pro Ser Thr Rrg Arg Pro Pro Ala Pro Asn Leu His Val Ser Pro Glu Leu Phe Cys Glu Pro Arg Glu Val Arg Arg Val Gln Trp Pro Ala Thr Gln Gln Gly Met Leu Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Ile Ala Ser Phe Gln Cys Leu Pro Ala Leu Gly Leu Trp Asn Pro Arg Gly Pro Asp Leu Ser Asn Cys Thr Ser Pro Trp Val Asn Gln Val Ala Gln Lys Ile Lys Ser Gly Glu Asn Ala Ala Asn Ile Ala Ser Glu Leu Ala Arg His Thr Arg Gly Ser Ile Tyr Ala Gly Asp Val Ser Ser Ser Val Lys Leu Met Glu Gln Leu Leu Asp Ile Leu Asp Ala Gln Leu Gln Ala Leu Arg Pro Ile Glu Arg Glu Ser Ala Gly Lys Asn Tyr Asn Lys Met His Lys Arg Glu Arg Thr Cys Lys Asp Tyr Ile Lys Ala Val Val Glu Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys Asp Met Asn Ala Thr Glu Gln Val His Thr Ala Thr Met Leu Leu Asp Val Leu Glu Glu Gly Ala Phe Leu Leu Ala Asp Asn Val Arg Glu Pro Ala Arg Phe Leu Ala Ala Lys Gln Asn Val Val Leu Glu Val Thr Val Leu Ser Thr Glu Gly Gln Val Gln Glu Leu Val Phe Pro Gln Glu Tyr Ala Ser Glu Ser Ser Ile Gln Leu Ser Ala Asn Thr Ile Lys Gln Asn Ser Arg Asn Gly Val Val Lys Val Val Phe Ile Leu Tyr Asn Asn Leu Gly Leu Phe Leu Ser Thr Glu Asn Ala Thr Val Lys Leu Ala Gly Glu Ala Gly Thr Gly Gly Pro Gly Gly Ala Ser Leu Val Val Asn Ser Gln Val Ile Ala Ala Ser Ile Asn Lys Glu Ser Ser Arg Val Phe Leu Met Asp Pro Val Ile Phe Thr Val Ala His Leu Glu Ala Lys Asn His Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Ser Met Leu Gly Tyr Trp Ser Thr Gln Gly Cys Arg Leu Val Glu Ser Asn Lys Thr His Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Val Leu Met Ala His Arg Glu Ile Tyr Gln Gly Arg Ile Asn Glu Leu Leu Leu Ser Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala Ile Cys Ile Ser Thr Phe Cys Phe Leu Arg Gly Leu Gln Thr Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Leu Ala Glu Leu Leu Phe Leu Val Gly Ile Asp Lys Thr Gln Tyr Glu Val Ala Cys Pro Ile Phe Ala Gly Leu Leu His Tyr Phe Phe Leu Ala Ala Phe Ser Trp Leu Cys Leu Glu G1y Val His Leu Tyr Leu Leu Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Thr Lys Tyr Tyr Tyr Leu Gly Gly Tyr Cys Phe Pro Ala Leu Val Val Gly Ile Ala Ala Ala Ile Asp Tyr Arg Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu Arg Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Ser Phe Val Ile Val Val Asn Leu Val Phe Leu Met Val Thr Leu His Lys Met Ile Arg Ser Ser Ser Val Leu Lys Pro Asp Ser Ser Arg Leu Asp Asn Ile Lys Ser Trp Ala Leu Gly Ala Ile Ala Leu Leu Phe Leu Leu Gly Leu Thr Trp Ala Phe Gly Leu Leu Phe Ile Asn Lys Glu Ser Val Val Met Ala Tyr Leu Phe Thr Thr Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Val Phe His Cys Ala Leu Gln Lys Lys Val His Lys Glu Tyr Ser Lys Cys Leu Arg His Ser Tyr Cys Cys Ile Arg Ser Pro Pro Gly Gly Ala His Gly Ser Leu Lys Thr Ser Ala Met Arg Ser Asn Thr Arg Tyr Tyr Thr Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Thr Glu Ser Ser Phe Met Ala Gly Asp Ile Asn Ser Thr Pro Thr Leu Asn Arg Gly Thr Met Gly Asn His Leu Leu Thr Asn Pro Val Leu Gln Pro Arg Gly Gly Thr Ser Pro Tyr Asn Thr Leu Ile Ala Glu Ser Val Gly Phe Asn Pro Ser Ser Pro Pro Val Phe Asn Ser Pro Gly Ser Tyr Arg Glu Pro Lys His Pro Leu Gly Gly Arg Glu Ala Cys Gly Met Asp Thr Leu Pro Leu Asn Gly Asn Phe Asn Asn Ser Tyr Ser Leu Arg Ser Gly Asp Phe Pro Pro Gly Asp Gly Gly Pro Glu Pro Pro Arg Gly Arg Asn Leu Ala Asp Ala Ala Ala Phe Glu Lys Met Ile Ile Ser Glu Leu Val His Asn Asn Leu Arg Gly Ala Ser Gly Gly Ala Lys Gly Pro Pro Pro Glu Pro Pro Val Pro Pro Val Pro Gly Val Ser Glu Asp Glu Ala Gly Gly Pro Gly Gly Ala Asp Arg Ala Glu Ile Glu Leu Leu Tyr Lys Ala Leu Glu Glu Pro Leu Leu Leu Pro Arg Ala Gln Ser Val Leu Tyr Gln Ser Asp Leu Asp Glu Ser Glu Ser Cys Thr Ala Glu Asp Gly Ala Thr Ser Arg Pro Leu Ser Ser Pro Pro Gly Arg Asp Ser Leu Tyr Ala Ser Gly Ala Asn Leu Arg Asp Ser Pro Ser Tyr Pro Asp Ser Ser Pro Glu Gly Pro Asn Glu Ala Leu Pro Pro Pro Pro Pro Ala Pro Pro Gly Pro Pro Glu Ile Tyr Tyr Thr Ser Arg Pro Pro Ala Leu Val Ala Arg Asn Pro Leu Gln Gly Tyr Tyr Gln Val Arg Arg Pro Ser His Glu Gly Tyr Leu Ala Ala Pro Ser Leu Glu Gly Pro Gly Pro Asp Gly Asp Gly Gln Met Gln Leu Val Thr Ser Leu <210> 21 <211> 829 <212> DNA
<213> Homo Sapiens <400> 21 agtggttgga gtttcagctg ctattgacta taagagctat ggaacagaaa aagcttgctg 60 gcttcatgtt gataactact ttatatggag cttcattgga cctgttacct tcattattct I20 gctaaatatt atcttcttgg tgatcacatt gtgcaaaatg gtgaagcatt caaacacttt 180 gaaaccagat tctagcaggt tggaaaacat taagtcttgg gtgcttggcg ctttcgctct 240 tctgtgtctt cttggcctca cctggtcctt tgggttgctt tttattaatg aggagactat 300 tgtgatggca tatctcttca ctatatttaa tgctttccag ggagtgttca ttttcatctt 360 tcactgtgct ctccaaaaga aagtacgaaa agaatatggc aagtgcttca gacactcata 420 ctgctgtgga ggcctcccaa ctgagagtcc ccacagttca gtgaaggcat caaccaccag 480 aaccagtgct cgctattcct ctggcacaca gagtcgtata agaagaatgt ggaatgatac 540 tgtgagaaaa caatcagaat cttcttttat ctcaggtgac atcaatagca cttcaacact 600 taatcaagga cattcactga acaatgccag ggatacaagt gccatggata ctctaccgct 660 aaatggtaat tttaacaaca gctactcgct gcacaagggt gactataatg acagcgtgca 720 agttgtggac tgtggactaa gtctgaatga tactgctttt gagaaaatga tcatttcaga 780 attagtgcac aacaacttac ggggcagcag caagactcac aacctcgag 82g <210> 22 <211> 429 <212> DNA
<213> Homo Sapiens <400> 22 ggggactggt gcccccacgc gtgtcagcac ggggttggtc agcaggtggt tccccatggt 60 acctcggttc agggtggggg tgctgttgat gtcacccgcc atgaaggagg actccgtctg 120 tttcctcaca gtgtcattcc acatcctccg aattcggctc tgggtccctg tgtagtagcg 180 ggtgttgctt cgcatggctg aggtcttgag ggatccgtga gtgcccccgg gtgggatgcg 240 gatgcagcag taggagtgac gcaggcactt gctgtactcc ttgtgcacct tcttctgtaa 300 ggcgcagtga aagacgaaga tgaagacccc ctggaaggcg ttgaaggtgg tgaagagata 360 ggccatgacc accgactcct tgttgatgaa gaggaggccg aaagcccagg tgaggcccag 420 caggaacag <210> 23 <211> 280 <212> DNA
<213> Homo Sapiens <400> 23 ctgagtcttg tcgatcccga ccaggaagag cagctcagcc aggaagaggt tgatgcacag 60 gttcttgtgg atggtgttgc ggtcggtctg cagcccccgc agaagcagaa ggtggagatg 120 cagatggcca agcagaccag ggagatcaca atgcccaccc aggtgatgac cgacagcagc 180 agctcgttga tgcggccctg gtagatctca cggtgagcca tgagcacagc gaagttggtg 240 aggtggctgc aggcacacgt ggtatgggtc ttgttggact 280 <210> 24 <211> 24 <212> DNA

<213> Artificial Sequence <220> .
<223> Description of Artificial Sequence: primer <400> 24 tcttcagctg agctcttcaa aacc 24 <210> 25 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 25 ggttttgaag agctcagctg aaga 24 <210> 26 <211> 51 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 26 cagcagggat ccaccatggt gtcttctggt tgcagaatgc gaagtctgtg g 51 <210> 27 <211> 55 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 27 gacgatgacg cggccgccta ttaaagactt gtaaccagct gcatttgtcc ttctc 55 <210> 28 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 28 tacaaccatg ggcacaactg tagctgg 27 <210> 29 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 29 tacaagatct agcagatagc caggcaaaca aggg 34 <210> 30 <211> 439 <212> DNA
<213> Homo Sapiens <400> 30 aaaagcagta tcattcagac ttagtccaca gtccacaact tgcacgctgt cattatagtc 60 acccttgtgc agcgagtagt gtntgttaaa attaccattt agcggtagag tatccatggc 120 acttgtatcc ctgggcattg ttcagtgaat gtccttgatt aagtgttgaa gtgctattga 180 tgtcacctga gataaaagaa gattctgatt gttttctcac agtatcattc cacattcttc 240 ttatacggac tctgtgtgcc agagggaata gcgagcactg ggttctgggt gggttgatgc 300 cttcactgaa ctgtgggggg actctcaggt tggggagggc ctncacaggc agtatggagg 360 tgtcttgaag gcactttgcc ataattcttt ttcgtacctt tccttttggg agagcacagt 420 gaaagntgga aaattgacc 439 <210> 31 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 31 tacaaccatg ggcacaactg tagctgg 27 <210> 32 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 32 tacaagatct agcagatagc caggcaaaca aggg 34 <210> 33 <211> 5598 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (407)..(3748) <400> 33 cggcgaacag acgttctttc tcctccatgc agttacacaa aaggagggct acggaaacta 60 aaagtttcgg ggcctctggc tcggtgtgtg gagaaaagag aaaacctgga gacgggatat 120 gaagatcaat gatgcagact gatggtcttg atgaagctgg gcatttataa ctagattcat 180 taaggaatac aaagaaaata cttaaaggga tcaataatgg tgtcttctgg ttgcagaatg 240 cgaagtctgt ggtttatcat tgtaatcagc ttcttaccaa atacagaagg tttcagcaga 300 gcagctttac catttgggct ggtgaggcga gaattatcct gtgaaggtta ttctatagat 360 ctgcgatgcc cgggcagtga tgtcatcatg attgagagcg ctaact atg gtc gga 415 Met Val Gly cgg atg aca aga ttt gtg atg ctg acc cat ttc aga tgg gag aat aca 463 Arg Met Thr Arg Phe Val Met Leu Thr His Phe Arg Trp Glu Asn Thr gac tgc tac ctc ccc gat gcc ttc aaa att atg act caa agg tgc aac 511 Asp Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn aat cga aca cag tgt ata gta gtt act ggg tca gat gtg ttt cct gat 559 Asn Arg Thr Gln Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp cca tgt cct gga aca tac aaa tac ctt gaa gtc caa tat gaa tgt gtc 607 Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val cct tac att ttt gtg tgt cct ggg acc ttg aaa gca att gtg gac tca 655 Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser cca tgt ata tat gaa get gaa caa aag gcg ggt get tgg tgc aag gac 703 Pro Cys Ile Tyr Glu Ala Glu Gln Lys Ala Gly Ala Trp Cys Lys Asp cct ctt cag get gca gat aaa att tat ttc atg ccc tgg act ccc tat 751 Pro Leu Gln Ala Ala Asp Lys Ile Tyr Phe Met Pro Trp Thr Pro Tyr cgt acc gat act tta ata gaa tat get tct tta gaa gat ttc caa aat 799 Arg Thr Asp Thr Leu Ile Glu Tyr Ala Ser Leu Glu Asp Phe Gln Asn agt cgc caa aca aca aca tat aaa ctt cca aat cga gta gat ggt act 847 Ser Arg Gln Thr Thr Thr Tyr Lys Leu Pro Asn Arg Val Asp Gly Thr gga ttt gtg gtg tat gat ggt get gtc ttc ttt aac aaa gaa aga acg 895 Gly Phe Val Val Tyr Asp Gly Ala Val Phe Phe Asn Lys Glu Arg Thr agg aat att gtg aaa ttt gac ttg agg act aga att aag agt ggc gag 943 Arg Asn Ile Val Lys Phe Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu gcc ata att aac tat gcc aac tac cat gat acc tca cca tac aga tgg 991 Ala Ile Ile Asn Tyr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp gga gga aag act gat atc gac cta gca gtt gat gaa aat ggt tta tgg 1039 Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp gtc att tac gcc act gaa cag aac aat gga atg ata gtt att agc cag 1087 Val Ile Tyr Ala Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln ctg aat cca tac act ctt cga ttt gaa gca acg tgg gag act gta tac 1135 Leu Asn Pro Tyr Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr gac aaa cgt gcc gca tca aat get ttt atg ata tgc gga gtc ctc tat 1183 Asp Lys Arg Ala Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr gtg gtt agg tca gtt tat caa gac aat gaa agt gaa aca ggc aag aac 1231 Val Val Arg Ser Val Tyr Gln Asp Asn Glu Ser Glu Thr Gly Lys Asn tca att gat tac att tat aat acc cga tta aac cga gga gaa tat gta 1279 Ser Ile Asp Tyr Ile Tyr Asn Thr Arg Leu Asn Arg Gly Glu Tyr Val gac gtt ccc ttc ccc aac cag tat cag tat att get gca gtg gat tac 1327 Asp Val Pro Phe Pro Asn Gln Tyr Gln Tyr Ile Ala Ala Val Asp Tyr aat cca aga gat aac caa ctt tac gtg tgg aac aat aac ttc att tta 1375 Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Asn Phe Ile Leu cga tat tct ctg gag ttt ggt cca cct gat cct gcc caa gtg cct acc 1423 Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ala Gln Val Pro Thr aca get gtg aca ata act tct tca get gag ctg ttc aaa acc ata ata 1471 Thr Ala Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile tca acc aca agc act act tca cag aaa ggc ccc atg agc aca act gta 1519 Ser Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val get gga tca cag gaa gga agc aaa ggg aca aaa cca cct cca gca gtt 1567 Ala Gly Ser Gln Glu Gly Ser Lys Gly Thr Lys Pro Pro Pro Ala Val tct aca acc aaa att cca cct ata aca aat att ttt ccc ctg cca gag 1615 Ser Thr Thr Lys Ile Pro Pro Ile Thr Asn Ile Phe Pro Leu Pro Glu aga ttc tgt gaa gca tta gac tcc aag ggg ata aag tgg cct cag aca 1663 Arg Phe Cys Glu Ala Leu Asp Ser Lys Gly Ile Lys Trp Pro Gln Thr caa agg gga atg atg gtt gaa cga cca tgc cct aag gga aca aga gga 1711 Gln Arg Gly Met Met Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly act gcc tcatat ctc atgatt tccactgga acatggaac cctaag 1759 tgc Thr Ala SerTyr Leu MetIle SerThrGly ThrTrpAsn ProLys Cys ggc ccc gatctt agc tgtacc tcacactgg gtgaatcag ctgget 1807 aac Gly Pro AspLeu Ser CysThr SerHisTrp ValAsnGln LeuAla Asn cag aag atc aga agc gga gaa aat get get agt ctt gcc aat gaa ctg 1855 Gln Lys Ile Arg Ser Gly Glu Asn Ala Ala Ser Leu Ala Asn Glu Leu get aaa cat acc aaa ggg cca gtg ttt get ggg gat gta agt tct tca 1903 Ala Lys His Thr Lys Gly Pro Val Phe Ala Gly Asp Val Ser Ser Ser gtg aga ttg atg gag cag ttg gtg gac atc ctt gat gca cag ctg cag 1951 Val Arg Leu Met Glu Gln Leu Val Asp Ile Leu Asp Ala Gln Leu Gln gaa ctg aaa cct agt gaa aaa gat tca get gga cgg agt tat aac aag 1999 Glu Leu Lys Pro Ser Glu Lys Asp Ser Ala Gly Arg Ser Tyr Asn Lys gca att gtt gac aca gtg gac aac ctt ctg aga cct gaa get ttg gaa 2047 Ala Ile Val Asp Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu tca tgg aaa cat atg aat tct tct gaa caa gca cat act gca aca atg 2095 Ser Trp Lys His Met Asn Ser Ser Glu Gln Ala His Thr Ala Thr Met tta ctc gat aca ttg gaa gaa gga get ttt gtc cta get gac aat ctt 2143 Leu Leu Asp Thr Leu Glu Glu Gly Ala Phe Val Leu Ala Asp Asn Leu tta gaa cca aca agg gtc tca atg ccc aca gaa aat att gtc ctg gaa 2191 Leu Glu Pro Thr Arg Val Ser Met Pro Thr Glu Asn Ile Val Leu Glu gtt gcc gta ctc agt aca gaa gga cag atc caa gac ttt aaa ttt cct 2239 Val Ala Val Leu Ser Thr Glu Gly Gln Ile Gln Asp Phe Lys Phe Pro ctg ggc atc aaa gga gca ggc agc tca atc caa ctg tcc gca aat acc 2287 Leu Gly Ile Lys Gly Ala Gly Ser Ser Ile Gln Leu Ser Ala Asn Thr gtc aaa cag aac agc agg aat ggg ctt gca aag ttg gtg ttc atc att 2335 Val Lys Gln Asn Ser Arg Asn Gly Leu Ala Lys Leu Val Phe Ile Ile tac cgg agc ctg gga cag ttc ctt agt aca gaa aat gca acc att aaa 2383 Tyr Arg Ser Leu Gly Gln Phe Leu Ser Thr Glu Asn Ala Thr Ile Lys ctg ggt get gat ttt att ggt cgt aat agc acc att gca gtg aac tct 2431 Leu Gly Ala Asp Phe Ile Gly Arg Asn Ser Thr Ile Ala Val Asn Ser cac gtc att tca gtt tca atc aat aaa gag tcc agc cga gta tac ctg 2479 His Val Ile Ser Val Ser Ile Asn Lys Glu Ser Ser Arg Val Tyr Leu act gat cct gtg ctt ttt acc ctg cca cac att gat cct gac aat tat 2527 Thr Asp Pro Val Leu Phe Thr Leu Pro His Ile Asp Pro Rsp Asn Tyr ttc aat gca aac tgc tcc ttc tgg aac tac tca gag aga act atg atg 2575 Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Thr Met Met gga tat tgg tct acc cag ggc tgc aag ctg gtt gac act aat aaa act 2623 Gly Tyr Trp Ser Thr Gln Gly Cys Lys Leu Val Asp Thr Asn Lys Thr cga aca acg tgt gca tgc agc cac cta acc aat ttt gca att ctc atg 2671 Arg Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Ile Leu Met gcc cac agg gaa att gca tat aaa gat ggc gtt cat gaa tta ctt ctt 2719 Ala His Arg Glu Ile Ala Tyr Lys Asp Gly Val His Glu Leu Leu Leu aca gtc atc acc tgg gtg gga att gtc att tcc ctt gtt tgc ctg get 2767 Thr Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala atc tgc atc ttc acc ttc tgc ttt ttc cgt ggc cta cag agt gac cga 2815 Ile Cys Ile Phe Thr Phe Cys Phe Phe Arg Gly Leu Gln Ser Asp Arg aat act att cac aag aac ctt tgt atc aac ctt ttc att get gaa ttt 2863 Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Ile Ala Glu Phe att ttc cta ata ggc att gat aag aca aaa tat gcg att gca tgc cca 2911 Ile Phe Leu Ile Gly Ile Asp Lys Thr Lys Tyr Ala Ile Ala Cys Pro ata ttt gca gga ctt cta cac ttt ttc ttt ttg gca get ttt get tgg 2959 Ile Phe Ala Gly Leu Leu His Phe Phe Phe Leu Ala Ala Phe Ala Trp atg tgc cta gaa ggt gtg cag ctc tac cta atg tta gtt gaa gtt ttt 3007 Met Cys Leu Glu Gly Val Gln Leu Tyr Leu Met Leu Val Glu Val Phe gaa agt gaa tat tca agg aaa aaa tat tac tat gtt get ggt tac ttg 3055 Glu Ser Glu Tyr Ser Arg Lys Lys Tyr Tyr Tyr Val Ala Gly Tyr Leu ttt cct gcc aca gtg gtt gga gtt tca get get att gac tat aag agc 3103 Phe Pro Ala Thr Val Val Gly Val Ser Ala Ala Ile Asp Tyr Lys Ser tat gga aca gaa aaa get tgc tgg ctt cat gtt gat aac tac ttt ata 3151 Tyr Gly Thr Glu Lys Ala Cys Trp Leu His Val Asp Asn Tyr Phe Ile tgg agc ttc att gga cct gtt acc ttc att att ctg cta aat att atc 3199 Trp Ser Phe Ile Gly Pro Val Thr Phe Ile Ile Leu Leu Rsn Ile Ile ttc ttg gtg atc aca ttg tgc aaa atg gtg aag cat tca aac act ttg 3247 Phe Leu Val Ile Thr Leu Cys Lys Met Val Lys His Ser Asn Thr Leu aaa cca gat tct agc agg ttg gaa aac att aag tct tgg gtg ctt ggc 3295 Lys Pro Asp Ser Ser Arg Leu Glu Asn Ile Lys Ser Trp Val Leu Gly get ttc get ctt ctg tgt ctt ctt ggc ctc acc tgg tcc ttt ggg ttg 3343 Ala Phe Ala Leu Leu Cys Leu Leu Gly Leu Thr Trp Ser Phe Gly Leu ctt ttt att aat gag gag act att gtg atg gca tat ctc ttc act ata 3391 Leu Phe Ile Asn Glu Glu Thr Ile Val Met Ala Tyr Leu Phe Thr Ile ttt aat get ttc cag gga gtg ttc att ttc atc ttt cac tgt get ctc 3439 Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Ile Phe His Cys Ala Leu caa aag aaa gta cga aaa gaa tat ggc aag tgc ttc aga cac tca tac 3487 Gln Lys Lys Val Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr tgc tgt gga ggc ctc cca act gag agt ccc cac agt tca gtg aag gca 3535 Cys Cys Gly Gly Leu Pro Thr GIu Ser Pro His Ser Ser Val Lys Ala tca acc acc aga acc agt get cgc tat tcc tct ggc aca cag agt cgt 3583 Ser Thr Thr Arg Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg ata aga aga atg tgg aat gat act gtg aga aaa caa tca gaa tct tct 3631 Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Ser Glu Ser Ser ttt atc tca ggt gac atc aat agc act tca aca ctt aat caa gga ctg 3679 Phe Ile Ser Gly Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly Leu aca tca cat ggt ctg aga gcc cat ctt caa gat tta tat cat tta gag 3727 Thr Ser His Gly Leu Arg Ala His Leu Gln Asp Leu Tyr His Leu Glu cta ctc tta ggc cag ata gcc tgagcagaca gacatgatgt gagttgtcca 3778 Leu Leu Leu Gly Gln Ile Ala aagacattca ctgaacaatg ccagggatac aagtgccatg gatactctac cgctaaatgg 3838 taattttaac aacagctact cgctgcacaa gggtgactat aatgacagcg tgcaagttgt 3898 ggactgtgga ctaagtctga atgatactgc ttttgagaaa atgatcattt cagaattagt 3958 gcacaacaac ttacggggca gcagcaagac tcacaacctc gagctcacgc taccagtcaa 4018 acctgtgatt ggaggtagca gcagtgaaga tgatgctatt gtggcagatg cttcatcttt 4078 aatgcacagc gacaacccag ggctggagct ccatcacaaa gaactcgagg caccacttat 4138 tcctcagcgg actcactccc ttctgtacca accccagaag aaagtgaagt ccgagggaac 4198 tgacagctat gtctcccaac tgacagcaga ggctgaagat cacctacagt cccccaacag 4258 agactctctt tatacaagca tgcccaatct tagagactct ccctatccgg agagcagccc 4318 tgacatggaa gaagacctct ctccctccag gaggagtgag aatgaggaca tttactataa 4378 aagcatgcca aatcttggag ctggccatca gcttcagatg tgctaccaga tcagcagggg 4438 caatagtgat ggttatataa tccccattaa caaagaaggg tgtattccag aaggagatgt 4498 tagagaagga caaatgcagc tggttacaag tctttaatca tacagctaag gaattccaag 4558 ggccacatgc gagtattaat aaataaagac accattggcc tgacgcagct ccctcaaact 4618 ctgcttgaag agatgactct tgacctgtgg ttctctggtg taaaaaagat gactgaacct 4678 tgcagttctg tgaattttta taaaacatac aaaaactttg tatatacaca gagtatacta 4738 aagtgaatta tttgttacaa agaaaagaga tgccagccag gtattttaag attctgctgc 4798 tgtttagaga aattgtgaaa caagcaaaac aaaactttcc agccatttta ctgcagcagt 4858 ctgtgaacta aatttgtaaa tatggctgca ccatttttgt aggcctgcat tgtattatat 4918 acaagacgta ggctttaaaa tcctgtggga caaatttact gtaccttact attcctgaca 4978 agacttggaa aagcaggaga gatattctgc atcagtttgc agttcactgc aaatctttta 5038 cattaaggca aagattgaaa acatgcttaa ccactagcaa tcaagccaca ggccttattt 5098 catatgtttc ctcaactgta caatgaacta ttctcatgaa aaatggctaa agaaattata 5158 ttttgttcta ttgctagggt aaaataaata catttgtgtc caactgaaat ataattgtca 5218 ttaaaataat tttaaagagt gaagaaaata ttgtgaaaag ctcttggttg cacatgttat 5278 gaaatgtttt ttcttacact ttgtcatggt aagttctact cattttcact tcttttccac 5338 tgtatacagt gttctgcttt gacaaagtta gtctttatta cttacattta aatttcttat 5398 tgccaaaaga acgtgtttta tggggagaaa caaactcttt gaagccagtt atgtcatgcc 5458 ttgcacaaaa gtgatgaaat ctagaaaaga ttgtgtgtca cccctgttta ttcttgaaca 5518 gagggcaaag agggcactgg gcacttctca caaactttct agtgaacaaa aggtgcctat 5578 tcttttttaa aaaaaaaaaa 5598 <210> 34 <211> 1114 <212> PRT
<213> Homo sapiens <400> 34 Met Val Gly Arg Met Thr Arg Phe Val Met Leu Thr His Phe Arg Trp Glu Asn Thr Asp Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Thr Gln Arg Cys Asn Asn Arg Thr Gln Cys Ile Val Val Thr Gly Ser Asp Val Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Glu Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Lys Ala Ile Val Asp Ser Pro Cys Ile Tyr Glu Ala Glu Gln Lys A1a Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Ala Asp Lys Ile Tyr Phe Met Pro Trp Thr Pro Tyr Arg Thr Asp Thr Leu Ile Glu Tyr Ala Ser Leu Glu Asp Phe Gln Asn Ser Arg Gln Thr Thr Thr Tyr Lys Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Phe Phe Asn Lys Glu Arg Thr Arg Asn Ile Val Lys Phe Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Ala Ile Ile Asn Tyr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gln Asn Asn Gly Met Ile Val Ile Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Ala Thr Trp Glu Thr Val Tyr Asp Lys Arg Ala Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Val Arg Ser Val Tyr Gln Asp Asn Glu Ser Glu Thr Gly Lys Asn Ser Ile Asp Tyr Ile Tyr Asn Thr Arg Leu Asn Arg Gly Glu Tyr Val Asp Val Pro Phe Pro Asn Gln Tyr Gln Tyr Ile Ala Ala Val Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Asn Phe Ile Leu Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ala Gln Val Pro Thr Thr Aia Val Thr Ile Thr Ser Ser Ala Glu Leu Phe Lys Thr Ile Ile Ser Thr Thr Ser Thr Thr Ser Gln Lys Gly Pro Met Ser Thr Thr Val Ala Gly Ser Gln Glu Gly Ser Lys Gly Thr Lys Pro Pro Pro Ala Val Ser Thr Thr Lys Ile Pro Pro Ile Thr Asn Ile Phe Pro Leu Pro Glu Arg Phe Cys Glu Ala Leu Asp Ser Lys Gly Ile Lys Trp Pro Gln Thr Gln Arg Gly Met Met Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Thr Ala Ser Tyr Leu Cys Met Ile Ser Thr Gly Thr Trp Asn Pro Lys Gly Pro Asp Leu Ser Asn Cys Thr Ser His Trp Val Asn Gln Leu Ala Gln Lys Ile Arg Sex Gly Glu Asn Ala Ala Ser Leu Ala Asn Glu Leu Ala Lys His Thr Lys Gly Pro Val Phe Ala Gly Asp Val Ser Ser Ser Val Arg Leu Met Glu Gln Leu Val Asp Ile Leu Asp Ala Gln Leu Gln Glu Leu Lys Pro Ser Glu Lys Asp Ser Ala Gly Arg Ser Tyr Asn Lys Ala Ile Val Asp Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys His Met Asn Ser Ser Glu Gln Ala His Thr Ala Thr Met Leu Leu Asp Thr Leu Glu Glu Gly Ala Phe Val Leu Ala 565 570 5'75 Asp Asn Leu Leu Glu Pro Thr Arg Val Ser Met Pro Thr Glu Asn Ile Val Leu Glu Val Ala Val Leu Ser Thr Glu Gly Gln Ile Gln Asp Phe Lys Phe Pro Leu Gly Ile Lys Gly Ala Gly Ser Ser Ile Gln Leu Ser Ala Asn Thr Val Lys Gln Asn Ser Arg Asn Gly Leu Ala Lys Leu Val Phe Ile Ile Tyr Arg Ser Leu Gly Gln Phe Leu Ser Thr Glu Asn Ala Thr Ile Lys Leu Gly Ala Asp Phe Ile Gly Arg Asn Ser Thr Ile Ala Val Asn Ser His Val Ile Ser Val Ser Ile Asn Lys Glu Ser Ser Arg Val Tyr Leu Thr Asp Pro Val Leu Phe Thr Leu Pro His Ile Asp Pro Asp Asn Tyr Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Thr Met Met Gly Tyr Trp Ser Thr Gln Gly Cys Lys Leu Val Asp Thr Asn Lys Thr Arg Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Ile Leu Met Ala His Arg Glu Ile Ala Tyr Lys Asp Gly Val His Glu Leu Leu Leu Thr Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala Ile Cys Ile Phe Thr Phe Cys Phe Phe Arg Gly Leu Gln Ser Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Ile Ala Glu Phe Ile Phe Leu Ile Gly Ile Asp Lys Thr Lys Tyr Ala Ile Ala Cys Pro Ile Phe Ala Gly Leu Leu His Phe Phe Phe Leu Ala Ala Phe Ala Trp Met Cys Leu Glu Gly Val Gln Leu Tyr Leu Met Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Lys Lys Tyr Tyr Tyr Val Ala Gly Tyr Leu Phe Pro Ala Thr Val Val Gly Val Ser Ala Ala Ile Asp 885 890 8g5 Tyr Lys Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu His Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Thr Phe Ile Ile Leu Leu Asn Ile Ile Phe Leu Val Ile Thr Leu Cys Lys Met Val Lys His Ser Asn Thr Leu Lys Pro Asp Ser Ser Arg Leu Glu Asn Ile Lys Ser Trp Val Leu Gly Ala Phe Ala Leu Lieu Cys Leu Leu Gly Leu Thr Trp Ser Phe Gly Leu Leu Phe Ile Asn Glu Glu Thr Ile Val Met Ala Tyr Leu Phe Thr Ile Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Ile Phe His Cys Ala Leu Gln Lys Lys Val Arg Lys Glu Tyr Gly Lys Cys Phe Arg His Ser Tyr Cys Cys Gly Gly Leu Pro Thr Glu Ser Pro His Ser Sex Val Lys Ala Ser Thr Thr Arg Thr Ser Ala Arg Tyr Ser Ser Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Ser Glu Ser Ser Phe Ile Ser Gly Asp Ile Asn Ser Thr Ser Thr Leu Asn Gln Gly Leu Thr Ser His Gly Leu Arg Ala His Leu Gln Asp Leu Tyr His Leu Glu Leu Leu Leu Gly Gln Ile Ala <210> 35 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 35 gggcctcacc tgggctttcg gcctcctc 2g <210> 36 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 36 ggactggtgc ccccacgcgt gtcagcac 28 <210> 37 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 37 ccaacaagac ccataccagc tgtg 24 <210> 38 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 38 ctgagtcttg tcgatcccga cc 22 7$

<210> 39 <211> 349 <212> DNA
<213> Homo Sapiens <400> 39 aagcttggca cgagggtcta tgtgcatttt ggaattactc acctgatacc atgaatggca 60 gctggtcttc agagggctgt gagctgacat actcaaatga gacccacacc tcatgccgct 120 gtaatcacct gacacatttt gcaattttga tgtcctctgg tccttccatt ggtattaaag 180 attataatat tcttacaagg gatcactcaa ctaggaataa ttatttcact gatttgtctt 240 gccatatgca tttttacctt ctggttcttc agtgaaattc aaagcaccag gacaacaatt 300 cacaaaaatc tttgctggta gcctatttct tgctgaactt ggtttttct 349 <210> 40 <211> 359 <212> DNA
<213> Homo Sapiens <400> 40 cagggaatgt ttatatttat tttccattgt gtcctacaga agaaggtacg aaaagagtat 60 gggaaatgcc tgcgaacaca ttgctgtagt ggcaaaagta cagagagttc cattggttca 120 gggaaaacat ctggttctcg aactcctgga cgctactcca caggctcaca gagcganatt 180 ccgtagaatg tggaatgaca cggttcgaaa gcagtcagag tcttccttta ttactggaga 240 cataaacagt tcagcgtcac tcaacagaga ggggcttctg aacaatgcca ggggatacaa 300 gtgtcatgga tactctacca ctgaatgggt aaccatgggc aatagttaca gcattgcca 359 <2I0> 41 <211> 480 <212> DNA
<213> Homo Sapiens <400> 41 tttttttttc tactacatta acaggactca aattctggag gaacagaaag cagactatat 60 gtgcaatgct agtatctgta cattacatag aaattgctca acttcttttt ctgccattag 120 ttttatcatc agttaataca gcaaatcata aaatatgcat ttagcatata attctagaat 180 tcccctccat ttcattatta attttgttgt tttattttgt tttccacagc tattccagct 240 gtgggtgaaa ttcaggttgt gagtgaccaa aaaccctatg tgatacagtt ttgctttgct 300 cttatgtttg tttgtgcagg cactccaatc taggatgcag cattgttact aatttcagac 360 aattgttctg ggccttttna aaaggcgggt ccntgttaat tttaggtaac acggcatcgg 920 ggtggtttaa agcntacaca acctattnca caggggccca tggggggcct ttttcttcaa 480 <210> 42 <211> 466 <212> DNA
<213> Homo Sapiens <400> 42 ngcgaaacga annngtnctt ctagnaactt caggcttgca acaacacang ggggtgggac 60 agcagtgggt gctatgttga agaaggtgat ggggacaatg tcacctgtat ctgtgaccac 120 ctaacatcat tctccatcct catgtcccct gactccccag atcctagttc tctcctggga 180 atactcctgg atattatttc ttatgttggg gtgggctttt ccatcttgag cttggcagcc 240 tgtctagttg tggaagctgt ggtgtggaaa tcggtgacca agaatcggac ttcttatatg 300 cgccacacct gcatagtgaa tatcgctgcc tcccttctgg tccgccaaca cctggttcat 360 tgtnggtcgc tggccatcca ggacaatccg ctacatactc tgcaagacag cctgtgtggc 420 tgccaccttc ttcaatccac ttcttctanc tcagcgtctt cttctn 466 <210> 43 <211> 403 <212> DNA
<213> Homo Sapiens <400> 43 tttttttttc ctgggaatat atttttttaa ttggttgatt tgcttcgttc aaagcgctta 60 gaatggaaga tttagtttga ggaggggcag gtttgggggt aggctcagcg ggcatagtgg 120 ccacaagaag atgcccatct cacacctgga gacgtccatg agcacctcga agctggccgt 180 ntggctgcac tggcgtacga catgggtccg gttcctggac aggagcttga agccccgggc 240 aggaccaccc tcccgtccca ctgacactgc gtagagaagg gagaagaggc aggggtgaga 300 cggttccctc cgcccatgtc tnttgggggc antctttncc cgggccctgg ggacttccca 360 ggccattcct gggccaaaac caaacagcag gtattagttg agt 403 <210> 44 <211> 358 <212> DNA
<213> Homo Sapiens <900> 44 ttttgagagg tttggctttt tttaatctgc ttccaaaaca aagcctcgat gatcaggcat 60 aaaatgagac ttccaatgga gatacccagt cccacatagg tgatccattt tacaacgggg 120 aagattgtag aggggacaaa aggtgacatc aatatggaga aggaggtcaa gtgagtacat 180 tggcacgtca cgatgtcttg agtttcattc actaggtggc agcctgcatc gttccactgc 240 aaatgactga aatcccaaaa cacacaatga ggctggctca ggtttgactc tatcttggaa 300 aaaaatagga aaacttcatt tatggaatag ttttgaataa ccgtggatat cacaggtc 358 <210> 45 <211> 556 <212> DNA
<213> Homo sapiens - <400> 45 gctggctgcc gagccagtgc catcttcctg cacttctccc tgctcacctg cctttcctgg 60 atgggcctcg aggggtacaa cctctaccga ctcgtggtgg aggtctttgg cacctatgtc 120 cctggctacc tactcaagct gagcgccatg ggctggggct tccccatctt tctggtgacg 180 ctggtggccc tggtggatgt ggacaactat ggccccatca tcttggctgt gcataggact 240 ccagagggcg tcatctaccc ttccatgtgc tggatccggg actccctggt cagctacatc 300 accaacctgg gcctcttcag cctggtgttt ctgttcaaca tggccatgct agccaccatg 360 gtggtgcaga tcctgcggct gcgcccccac acccaaaagt ggtcacatgt gctgacactg 420 ctgggcctca gcctggtcct tggcctgccc tgggccttga ccttcttctc ctttgcttct 480 ggcaccttcc agcttgtcgt cctctacctt ttcagcatca tcacctcctt ccaaggcttc 540 ctcatcttca tctggt 556 <210> 46 <211> 324 <212> DNA
<213> Homo Sapiens <400> 96 gatccccatt gcgccantgn ggactactcc agagcagatg ccagctcagg agtctgggnc 60 actgaaaatt gccagaccct ggagacccag gcagctcaca cccgctgcca gtgccagcac 120 ctgtccacct ttgctgtact agcccagccg cccaaggacc tgaccctgga gctggcgggc 180 tccccctcgg tccccctggt gatcggctgt gcagtgtcgt gcatggcgct gctcaccctg 240 ctcgccatct atgccgcctt ttggaggttc ataaaatctg aacgctccat catcttgctg 300 aacttntgcc tgtccatctt ggca 324 <210> 47 <211> 391 <212> DNA
<213> Homo Sapiens <400> 47 ttaaagcata actgtatttt tnnttttagg gccttattga tgttttgccg ttccaatgta 60 tgcatttttt nactcaataa acttgtctta attttaaata tggggcttcc ttggacctgt 120 ctgcgccatc ttctctgtga atttagttct ctttctggtg actctctgga ttttnaaaaa 180 cagactctcc tccctcaata gtgaagtgtc caccctccgg aacacaaggt ccgggagcaa 240 tatgggaaat ggtccaaagg gatcaggaaa ttgaaaactg agtctgagat gcacacactc 300 tccagcagtg ctaaggctga caactccaaa cccagcacgg gtaactagaa aaatcttctg 360 aataagatct tcccctttgc ccgtgggaaa t 391 <210> 4B
<211> 5749 <212> DNA
<223> Homo Sapiens <400> 48 ggaaagcgga aagaggaaaa agcataagct tgagccttcc gatccgacca cgaatactcc 60 tgtaataaac ccaccgcccc aacaaatctg ccatagcagc cgccgccgcc gccggtcact 120 tctcgtctca gcgctttctt tgcttcttgg tttgttgggg gtagctttta tgaaacaaat 180 ctttgctatt aagccactta cattttgggg ggttccttag agtctccctt gggggggctt 240 ctccctccct ttagcccccc tcggtttgga ggttggattc agttggatac ggcgcaaggt 300 tctgggctcc tgctggcttt tttttcctct ctctcatcga cccccctttg gttcccaccc 360 cccacctttt gcttttcgta tgtatgcatt tttaaaaata aatcctgatt ttggaagctg 420 agccggggaa aatgggcaac ggtgattggg accgaagggg agtctctccg tcactgttgc 480 tgggacgcgt gcctgtgctg gtgtcttaga gcaagagcct ccctgagctt tcggagtgga 540 agaacagtgg aagagactgc agcctaaaga cttttaaaat taacttggca tcacttttat 600 cagctcaaag gctaaacaaa caaacaaaag cagtgtcatt tattctaaga aataacttct 660 taaaggttaa agctgaaaaa tattcaagtt atttttggat aacaacttac agaggccaaa 720 tgacatagga tgaaggctgt tcgtaacctg ctgatttata tattttccac ctatctcctg 780 gttatgtttg gatttaatgc tgcccaagac ttctggtgtt caactttggt gaagggagtc 840 atttatggat cgtattctgt aagtgaaatg tttcctaaaa actttacaaa ctgcacttgg 900 acgctggaaa atccagatcc aaccaaatat agcatttacc tgaaattttc caaaaaggac 960 cttagctgct ctaacttttc actcctggct tatcagtttg atcatttttc ccatgaaaaa 1020 ataaaggatc ttttaagaaa gaatcattct ataatgcaac tctgcaattc caagaatgct 1080 ttcgtttttc tacagtatga taaaaatttt attcaaatac gtcgagtatt tccaactaat 1140 ttcccaggat tacagaaaaa aggggaagaa gatcagaaat ctttttttga gtttttggta 1200 ttgaacaagg tcagcccaag ccagtttggt tgccatgtat tatgtacttg gttggagagc 1260 tgcttaaaat cagaaaatgg gagaacagaa tcatgtggga tcatgtatac aaaatgcacc 1320 tgccctcagc atttgggaga gtgggggatc gacgaccagt cgctgatttt gttaaataac 1380 gtggtgttac ccctgaatga gcagacagag ggctgcctga cccaggagct gcaaaccacc 1440 caagtctgca atcttaccag ggaggccaag cgaccaccca aagaagaatt tggaatgatg 1500 ggagatcata caattaaaag tcagcgacct cgatctgttc atgaaaaaag ggtccctcag 1560 gaacaagctg atgctgctaa atttatggca caaactggtg aatctggtgt ggaagagtgg 1620 tcccagtgga gcacatgttc ggttacttgt ggtcaagggt cgcaggtgcg aaccagaact 1680 tgtgtatcac cttacgggac acactgcagc ggcccattaa gagaatcaag ggtttgcaat 1740 aacactgccc tctgtccagt acacggagta tgggaggaat ggtcaccatg gagtttatgt 1800 tcatttacat gtggtcgagg ccaaagaaca agaacaaggt catgcacacc tcctcagtat 1860 ggaggaaggc cgtgtgaagg acctgaaaca catcataagc cttgtaatat tgctctttgc 1920 ccagttgatg gacagtggca agagtggagt tcgtggagcc agtgctcagt aacgtgctcg 1980 aatgggactc agcagagaag ccggcagtgc actgcagctg cccatggagg ctccgaatgc 2040 agagggccat gggcagaaag cagagagtgc tataaccctg aatgtacagc caatggtcaa 2100 tggaatcagt ggggtcattg gagtggttgt tccaagtcct gtgatggcgg ctgggaaagg 2160 cgaataagga cctgtcaggg tgcagtgata acagggcagc aatgtgaagg aacgggcgaa 2220 gaagtgagaa gatgcagtga gcagcgatgc cctgcacctt atgaaatatg ccctgaggat 2280 tatctgatgt cgatggtgtg gaaaagaact ccagcaggcg acttggcatt caatcaatgt 2340 cccctgaatg ccacaggcac cactagcaga cgctgctctc tcagtcttca tggagtggcc 2400 ttctgggaac agccgagctt tgcaagatgc atatcaaatg agtacagaca cttgcagcat 2460 tcaattaaag agcaccttgc taaggggcag cgaatgctgg caggtgatgg aatgtcccag 2520 gtgaccaaga cactgttgga tttaactcag agaaaaaatt tctatgcagg cgatcttctg 2580 atgtctgtgg agatcctgag aaatgtgaca gacacattta aaagggcaag ttacatccct 2640 gcatctgatg gtgtccagat ttatccaggg tcaatagagt taatgcaggt gattgaagat 2700 tttatacaca ttgttggaat ggggatgatg gactttcaga attcatactt aatgactgga 2760 aatgtagtgg ctagtattca gaagcttcct gcagcctctg ttctaacaga catcaacttt 2820 ccaatgaaag gacggaaggg aatggttgac tgggcaagaa actcagaaga tagggtagta 2880 attccaaaaa gcattttcac tccggtgtca tcaaaagaat tagatgaatc atctgtattt 2940 gttcttggcg cagtcctata caaaaactta gatctaattt tgcccacttt gagaaattat 3000 actgtcatta attccaaaat catcgtggtc acaataaggc ctgaacccaa aacaaccgat 3060 tcgtttctgg agatagaact agctcatttg gctaatggta ctttgaatcc ctattgtgta 3120 ttgtgggatg actccaaaac gaacgagtct ttgggaacgt ggtccaccca gggatgtaaa 3180 actgtgctta ccgatgcatc ccatacgaaa tgcttatgtg atcgtctctc taccttcgcc 3240 attttggctc agcaacctag agaaataatc atggaatcct ctggcacacc ttcagttacc 3300 ctaatagtag gcagtggtct ttcttgcttg gccttgatta ccctagcagt tgtctatgca 3360 gcattatgga ggtacatacg ctctgagaga tccataatac taattaactt ctgcctgtct 3420 atcatctcat ccaatatcct catactggtt ggacagactc agacacataa taagagtatc 3480 tgcacaacca ccactgcatt tttgcacttt ttcttcctgg cttcattctg ttgggttttg 3540 actgaggcgt ggcaatcata tatggctgta actggaaaaa ttaggacacg gcttataaga 3600 aaacgctttt tgtgccttgg atggggtaag catattgata taccgtttca tgctcttctc 3660 aaaatgacgt tgaacacaca ttagaaagca gtcatgagtg attagacaca ggctactttg 3720 tgtctaattt aatctatgga agtgaaaata catgagctgg tcagttttga acattcattg 3780 gtcatttgga actttaaaag gaagtaagta ttgaatgctc atttagctag tcagttaaca 3840 ttcaacagtg tctagatagt atgaaatgag accccgagat gcctacacac agaaaaacag 3900 tgctctctgt taatattttc tgaaagtgca aaatacctta aaattttcaa ggcctaatgt 3960 gtgatggttc actaggcatg tactcccacc aagaaaactt agaagatttc atttcaagaa 4020 atctcaaagc aattaaagaa taaaagcgat tcatttcata gggagaacac catctagaga 4080 attaatgaaa cctcacagct tgttgacctg gtcctcaaaa gcagaaacag aattgctgac 4140 agactgagaa ctaattcttt acttgtgttt attaagaagt ttctctcaaa ttgcctcatg 4200 acatggacat ctcaaagatc tatattatag ggccaattct aatgatagcc tagttaattt 4260 aagaagctac ttttagaaaa agcccaaata tacaataata tctactgtat tagaagactg 4320 gcatatggga tgctaggagg aacctgggaa attacaaata agtgtgctta taacaattcc 4380 agaattattt aggctggaaa aatatgatca agaacacgta aatattattc attaggtttc 9440 agcaaggtct attatgtcta gctaataaat taggacttta tccacagaca aatggaaaag 4500 caattaataa gaagttgaag agtaggccag acatggtggc tcacgcctgt aatcctagca 4560 ctttgggaaa ccaaggcggg tggactacct gagcgtgggt ggactacctg agcgcgggtg 4620 gactacctga gcacgggagt tcgagattag cctgagcaat atggcaaaac cccatctcta 4680 ccaaaaatgc aaaaaattag ccgggagtga tggcacatac ctgtagtccc agctactcgg 4740 gaggctaagg tgggaggatt gcatgagcct gggaagtgga ggttgcagtg agccaagatc 4800 acaccacgac actccaactt gtgtcacaga gtaagaccct atctcacacc aacacaaaag 4860 ttgaagactt tgttctactt agaatttcat caaatttttg tctaaatttc ctgacaaagg 4920 ccttctaaag ttgagatagt atttaaatca agggacactt ttgccatgaa ttagtaccat 9980 tctaagaaat acagaataca ggtaaaagaa cacatttttt gatgaagaac aaaacatggt 5040 gattttcaag attagtgact accttgttta aaattattac taaagatttt gaggagaggg 5100 ttcacagaca gtctccgtat ttacagctaa tattaaacta ctctaggtag caaaaacctg 5160 aactgatggt gctaaagtat cagaaagttt atgggttggc agaatagtgg tgtgtgtgtt 5220 tcattatgaa caagtacaat aaaatgaatc tagaaaaaat ttaatctaaa ttgtatgaaa 5280 taaatactat taattcttca gttataaccc atgaggaatt tttttttcct aatgaacttg 5340 gtccagtcaa tcaaaaaaaa tcaacaaatg acatgtgtgg aggaagagga gaaggaggga 5400 caagaagagg agaaacagaa ggaggaaagg gaagaggagg aaagggagga taaggatgag 5960 gaggggacta tatatttata attttatata catatatgta tagtcaccag tgtttgttta 5520 acactatggt gtgtccttct gagatgtttt ccatagttct tgtcattaaa tctcatgaag 5580 gaatgtgatg ccactagaga aggctcacag aagagaatag caggaggtat gtgaaatgat 5640 agtaagaaag aagacagaca gaggacatac aataaaatga ttagatgacg gatttttcaa 5700 ccggaaaagg caaacatgat cttcctgaaa agaaggcata accaaaact 5749 <210> 99 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 49 tcagacactc atactgctgt g 21 <210> 50 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 50 cacagtccac aacttgcac 1g <210> 51 <211> 40 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 51 gacgctggtc gactaggtgg ctgcatgcac acgttgttcg 40 <210> 52 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 52 cctaccacag ctgtgacaat aacttcttca gctgagc 37 <210> 53 <211> 16 <212> PRT
<213> Homo Sapiens <400> 53 Cys Leu Gln Asp Leu Tyr His Leu Glu Leu Leu Leu Gly Gln Ile Ala <210> 54 <211> 15 <212> PRT
<213> Homo Sapiens <400> 54 Cys Thr Arg Thr Ser Ala Arg Tyr Ser Ser Thr Gln Asp Ile His <210> 55 <211> 16 <212> PRT
<213> Homo Sapiens <400> 55 Cys Glu Gly Asp Val Arg Glu Gly Gln Met Gln Leu Val Thr Ser Leu <210> 56 <211> 16 <212> PRT
<213> Homo Sapiens <400> 56 Cys Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Ser <210> 57 <211> 5610 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (281)..(4687) <400> 57 ctaatttttg gtcggcggcg gtgctgggcc aggggaagga agggacacgg aggccgccct 60 cgtcccgcca cctcctaccc gcttcccccc agccccggct ccgggagatg tgccgggcgg 120 ggggcccggg ttcgccgagc cgcaggagag acacgctggg ccgaccccag agaggcgctg 180 gacaggctgg tggtccaggc cgtggtgcct gccaggtgat gtggggcaaa gccccccgca 240 caggccactg agagctccgg acacgcaccc ggctgccacc atg gcc cgc cta gcc 295 Met Ala Arg Leu Ala gca gtg ctctggaatctg tgtgtcacc gccgtcctg gtcacc tcggcc 343 Ala Val LeuTrpAsnLeu CysValThr AlaValLeu ValThr SerAla acc caa ggcctgagccgg gccgggctc ccgttcggg ctgatg cgccgg 391 Thr Gln GlyLeuSerArg AlaGlyLeu ProPheGly LeuMet ArgArg gag ctg gcgtgtgaaggc taccccatc gagctgcgg tgcccc ggcagc 439 Glu Leu AlaCysGluGly TyrProIle GluLeuArg CysPro GlySer gac gtc atcatggtggag aatgccaac tacgggcgc acggac gacaag 487 Asp Val IleMetValGlu AsnAlaAsn TyrGlyArg ThrAsp AspLys att tgc gatgetgaccct ttccagatg gagaatgtg cagtgc tacctg 535 Ile Cys AspAlaAspPro PheGlnMet GluAsnVal GlnCys TyrLeu ccg gac gccttcaagatc atgtcacag aggtgtaac aaccgc acccag 583 Pro Asp AlaPheLysIle MetSerGln ArgCysAsn AsnArg ThrGln tgc gtg gtggtcgccggc tcggatgcc tttcctgac ccctgt cctggg 631 Cys Val ValValAlaGly SerAspAla PheProAsp ProCys ProGly acc tac aagtacctggag gtgcagtac gactgtgtc ccctac atcttc 679 Thr Tyr LysTyrLeuGlu ValGlnTyr AspCysVal ProTyr IlePhe gtg tgc ccagggaccctg cagaaggtg ctggagccc acctcg acacac 727 Val Cys ProGlyThrLeu GlnLysVal LeuGluPro ThrSer ThrHis gag tca gagcaccagtct ggcgcatgg tgcaaggac ccgctg caggcg 775 Glu Ser GluHisGlnSer GlyAlaTrp CysLysAsp ProLeu GlnAla ggt gac cgcatctacgtg atgccctgg atcccctac cgcacg gacaca 823 Gly Asp ArgIleTyrVal MetProTrp IleProTyr ArgThr AspThr ctg act gagtatgcctcg tgggaggac tacgtggcc gcccgc cacacc 871 Leu Thr GluTyrAlaSer TrpGluAsp TyrValAla AlaArg HisThr acc acc taccgcctgccc aaccgcgtg gatggcaca ggcttt gtggtc 919 Thr Thr TyrArgLeuPro AsnArgVal AspGlyThr GlyPhe ValVal tac gat ggtgccgtcttg tacaacaag gagcgcacg cgcaac atcgtc 967 Tyr Asp GlyAlaValLeu TyrAsnLys GluArgThr ArgAsn IleVal aag tat gacctacggacg cgcatcaag agcggggag acggtc atcaat 1015 Lys Tyr AspLeuArgThr ArgIleLys SerGlyGlu ThrVal IleAsn acc gcc aactaccat gacacctcg ccctaccgc tggggcgga aagacc 1063 Thr Ala AsnTyrHis AspThrSer ProTyrArg TrpGlyGly LysThr gac att gacctggcg gtggacgag aacgggctg tgggtcatc tacgcc 1111 Asp Ile AspLeuAla ValAspGlu AsnGlyLeu TrpValIle TyrAla act gag ggcaacaac gggcggctg gtggtgagc cagctgaac ccctac 1159 Thr Glu GlyAsnAsn GlyArgLeu ValValSer GlnLeuAsn ProTyr aca ctg cgctttgag ggcacgtgg gagacgggt tacgacaag cgctcg 1207 Thr Leu ArgPheGlu GlyThrTrp GluThrGly TyrAspLys ArgSer gca tcc aacgccttc atggtgtgt ggggtcctg tacgtcctg cgttcc 1255 Ala Ser AsnAlaPhe MetValCys GlyValLeu TyrValLeu ArgSer gtg tac gtggatgat gacagcgag gcggetggc aaccgcgtg gactat 1303 Val Tyr ValAspAsp AspSerGlu AlaAlaGly AsnArgVal AspTyr gcc ttc aacaccaat gccaaccgc gaggagcct gtcagcctc accttc 1351 Ala Phe AsnThrAsn AlaAsnArg GluGluPro ValSerLeu ThrPhe ccc aac ccctaccag ttcatctcc tccgttgac tacaaccct cgcgac 1399 Pro Asn ProTyrGln PheIleSer SerValAsp TyrAsnPro ArgAsp aac cag ctgtacgtc tggaacaac tatttcgtg gtgcgctac agcctg 1447 Asn Gln LeuTyrVal TrpAsnAsn TyrPheVal ValArgTyr SerLeu gag ttc gggccgccc gaccccagt getggccca gccacttcc ccaccc 1495 Glu Phe GlyProPro AspProSer AlaGlyPro AlaThrSer ProPro ctc agc acgaccacc acagccagg cccacgccc ctcaccagc acagcc 1543 Leu Ser ThrThrThr ThrAlaArg ProThrPro LeuThrSer ThrAla tcg ccc gcagccacc accccgctc cgccgggca cccctcacc acgcac 1592 Ser Pro AlaAlaThr ThrProLeu ArgArgAla ProLeuThr ThrHis cca gtg ggtgccatc aaccagctg ggacctgat ctgcctcca gccaca 1639 Pro Val GlyAlaIle AsnGlnLeu GlyProAsp LeuProPro AlaThr gcc cca gtccccagc acccggcgg cccccagcc ccgaatcta cacgtg 1687 Ala Pro ValProSer ThrArgArg ProProAla ProAsnLeu HisVal tcc cct gagctcttc tgcgagccc cgagaggta cggcgggtc cagtgg 1735 Ser Pro GluLeuPhe CysGluPro ArgGluVal ArgArgVal GlnTrp ccg gcc acccagcag ggcatgctg gtggagagg ccctgcccc aagggg 1783 Pro Ala ThrGlnGln GlyMetLeu ValGluArg ProCysPro LysGly actcgaggaatt gcctccttc cagtgtcta ccagccttg gggctctgg 1831 ThrArgGlyIle AlaSerPhe GlnCysLeu ProAlaLeu GlyLeuTrp aacccccggggc cctgacctc agcaactgc acctccccc tgggtcaac 1879 AsnProArgGly ProAspLeu SerAsnCys ThrSerPro TrpValAsn caggtggcccag aagatcaag agtggggag aacgcggcc aacatcgcc 1927 GlnValAlaGln LysIleLys SerGlyGlu AsnAlaAla AsnIleAla agcgagctggcc cgacacacc cggggctcc atctacgcg ggggacgtc 1975 SerGluLeuAla ArgHisThr ArgGlySer IleTyrAla GlyAspVal tcctcctctgtg aagctgatg gagcagctg ctggacatc ctggatgcc 2023 SerSerSerVal LysLeuMet GluGlnLeu LeuAspIle LeuAspAla cagctgcaggcc ctgcggccc atcgagcgc gagtcagcc ggcaagaac 2071 GlnLeuGlnAla LeuArgPro IleGluArg GluSerAla GlyLysAsn tacaacaagatg cacaagcga gagagaact tgtaaggat tatatcaag 2119 TyrAsnLysMet HisLysArg GluArgThr CysLysAsp TyrIleLys gccgtggtggag acagtggac aatctgctc cggccagaa getctggag 2167 AlaValValGlu ThrValAsp AsnLeuLeu ArgProGlu AlaLeuGlu tcctggaaggac atgaatgcc acggagcag gtgcacacg gccaccatg 2215 SerTrpLysAsp MetAsnAla ThrGluGln ValHisThr AlaThrMet ctcctcgacgtc ctggaggag ggcgccttc ctgctggcc gacaatgtc 2263 LeuLeuAspVal LeuGluGlu GlyAlaPhe LeuLeuAla AspAsnVal agggagcctgcc cgcttcctg getgccaag gagaacgtg gtcctggag 2311 ArgGluProAla ArgPheLeu AlaAlaLys GluAsnVal ValLeuGlu gtcacagtcctg aacacagag ggccaggtg caggagctg gtgttcccc 2359 ValThrValLeu AsnThrGlu GlyGlnVal GlnGluLeu ValPhePro caggaggagtac ccgagaaag aactccatc cagctgtct gccaaaacc 2407 GlnGluGluTyr ProArgLys AsnSerIle GlnLeuSer AlaLysThr atcaagcagaac agccgcaat ggggtggtc aaagttgtc ttcatcctc 2455 IleLysGlnAsn SerArgAsn GlyValVal LysValVal PheIleLeu tacaacaacctg ggcctcttc ctgtccacg gagaatgcc acagtgaag 2503 TyrAsnAsnLeu GlyLeuPhe LeuSerThr GluAsnAla ThrValLys ctg gccggc gaagcaggcccg ggtggccct gggggcgcc tctcta gtg 2551 Leu AlaGly GluAlaGlyPro GlyGlyPro GlyGlyA1a SerLeu Val gtg aactca caggtcatcgca gcatccatc aacaaggag tccagc cgc 2599 Val AsnSer GlnValIleAla AIaSerIle AsnLysGlu SerSer Arg gtc ttcctc atggaccctgtc atcttcacc gtggcccac ctggag gac 2647 Val PheLeu MetAspProVal IlePheThr ValAlaHis LeuGlu Asp aag aaccac ttcaatgetaac tgctccttc tggaactac tcggag cgt 2695 Lys AsnHis PheAsnAlaAsn CysSerPhe TrpAsnTyr SerGlu Arg tcc atgctg ggctactggtcg acccaaggc tgccgcctg gtggag tcc 2743 Ser MetLeu GlyTyrTrpSer ThrGlnGly CysArgLeu ValGlu Ser aac aagacc cataccacgtgt gcctgcagc cacctcacc aacttc get 2791 Asn LysThr HisThrThrCys AlaCysSer HisLeuThr AsnPhe Ala gtg ctcatg getcaccgtgag atctaccag ggccgcatc aacgag ctg 2839 Val LeuMet AlaHisArgGlu IleTyrGln GlyArgIle AsnGlu Leu ctg ctgtcg gtcatcacctgg gtgggcatt gtgatctcc ctggtc tgc 2887 Leu LeuSer ValIleThrTrp ValGlyIle ValIleSer LeuVal Cys ttg gccatc tgcatctccacc ttctgcttc ctgcggggg ctgcag acc 2935 Leu AlaIle CysIleSerThr PheCysPhe LeuArgGly LeuGln Thr gac cgcaac accatccacaag aacctgtgc atcaacctc ttcctg get 2983 Asp ArgAsn ThrIleHisLys AsnLeuCys IleAsnLeu PheLeu Ala gag ctgctc ttcctggtcggg atcgacaag actcagtat gagatt gcc 3031 Glu LeuLeu PheLeuValGly IleAspLys ThrGlnTyr GluIle Ala tgc cccatc ttcgccggcctg ctgcactat ttcttcctg getgcc ttc 3079 Cys ProIle PheAlaGlyLeu LeuHisTyr PhePheLeu AlaAla Phe tcc tggctg tgcctggagggc gtgcacctc tacctgcta ctagtg gag 3127 Ser TrpLeu CysLeuGluGly ValHisLeu TyrLeuLeu LeuVal Glu gtg tttgag agcgagtattcc cgcaccaag tactactac ctgggt ggc 3175 Val PheGlu SerGluTyrSer ArgThrLys TyrTyrTyr LeuGly Gly tac tgcttc ccggccctggtg gtgggcatc gcggetgcc attgac tac 3223 Tyr CysPhe ProAlaLeuVal ValGlyIle AlaAlaAla IleAsp Tyr cgc agctac ggcaccgagaag gcctgctgg ctccgagtg gacaat tac 3271 Arg SerTyr GlyThrGluLys AlaCysTrp LeuArgVal AspAsn Tyr ttcatc tggagtttc atcgggcca gtctccttc gttatcgtg gtcaac 3319 PheIle TrpSerPhe IleGlyPro ValSerPhe ValIleVal ValAsn ctggtg ttcctcatg gtgaccctg cacaagatg atccgaagc tcatct 3367 LeuVal PheLeuMet ValThrLeu HisLysMet IleArgSer SerSer gtgctc aagcccgac tccagccgc ctggacaac attaaatcc tgggcg 3415 ValLeu LysProAsp SerSerArg LeuAspAsn IleLysSer TrpAla ctgggg gccatcgcg ctgctgttc ctgctgggc ctcacctgg getttc 3463 LeuGly AlaIleAla LeuLeuPhe LeuLeuGly LeuThrTrp AlaPhe ggcctc ctcttcatc aacaaggag tcggtggtc atggcctat ctcttc 3511 GlyLeu LeuPheIle AsnLysGlu SerValVal MetAlaTyr LeuPhe accacc ttcaacgcc ttccagggg gtcttcatc ttcgtcttt cactgc 3559 ThrThr PheAsnAla PheGlnGly ValPheIle PheValPhe HisCys gcctta cagaagaag gtgcacaag gagtacagc aagtgcctg cgtcac 3607 AlaLeu GlnLysLys ValHisLys GluTyrSer LysCysLeu ArgHis tcctac tgctgcatc cgctcccca cccgggggc actcacgga tccctc 3655 SerTyr CysCysIle ArgSerPro ProGlyGly ThrHisGly SerLeu aagacc tcagccatg cgaagcaac acccgctac tacacaggg acccag 3703 LysThr SerAlaMet ArgSerAsn ThrArgTyr TyrThrGly ThrGln agccga attcggagg atgtggaat gacactgtg aggaaacag acggag 3751 SerArg IleArgArg MetTrpAsn AspThrVal ArgLysGln ThrGlu tcctcc ttcatggcg ggtgacatc aacagcacc cccaccctg aaccga 3799 SerSer PheMetAla GlyAspIle AsnSerThr ProThrLeu AsnArg ggtacc atggggaac cacctgctg accaacccc gtgctgcag ccccgt 3847 GlyThr MetGlyAsn HisLeuLeu ThrAsnPro ValLeuGln ProArg gggggc accagtccc tacaacacc ctcatcgcc gagtcagtg ggcttc 3895 GlyGly ThrSerPro TyrAsnThr LeuIleAla GluSerVal GlyPhe aatccc tcctcgccc cctgtcttc aactcccca 'gggagctac cgggaa 3943 AsnPro SerSerPro ProValPhe AsnSerPro GlySerTyr ArgGlu cccaag caccccttg ggaggccgg gaagcctgt ggcatggac accctg 3991 ProLys HisProLeu GlyGlyArg GluAlaCys GlyMetAsp ThrLeu ccc ctg aac ggc ttc aat agttac tcc cga agt ggg gat 4039 aac aac ttg Pro Leu Asn Gly Phe Asn SerTyr Ser Arg Ser Gly Asp Asn Asn Leu ttc cct ccc ggg ggg ggc gagccg ccc ggc cgg aac cta 4087 gat cct cga Phe Pro Pro Gly Gly Gly GluPro Pro Gly Arg Asn Leu Asp Pro Arg gcc gat gcg gcg gcc ttt gag aag atg atc atc tca gag ctg gtg cac 4135 Ala Asp Ala Ala Ala Phe Glu Lys Met Ile Ile Ser Glu Leu Val His aac aac ctg cgg ggg agc agc agc gcg gcc aag ggc cct cca ccg cct 4183 Asn Asn Leu Arg Gly Ser Ser Ser Ala Ala Lys Gly Pro Pro Pro Pro gag ccc cct gtg cca cct gtg cca ggg ggc ggg ggc gag gaa gag gcg 4231 Glu Pro Pro Val Pro Pro Val Pro Gly Gly Gly Gly Glu Glu Glu Ala ggc ggg ccc ggg ggt get gac cgg gcc gag att gaa ctt ctc tat aag 9279 Gly Gly Pro Gly Gly Ala Asp Arg Ala Glu Ile Glu Leu Leu Tyr Lys gcc ctg gag gag cct ctg ctg ctg ccc cgg gcc cag tcg gtg ctg tac 4327 Ala Leu Glu Glu Pro Leu Leu Leu Pro Arg Ala Gln Ser Val Leu Tyr cag agc gat ctg gac gag tcg gag agc tgc acg gcc gag gac ggc gcc 4375 Gln Ser Asp Leu Asp Glu Ser Glu Ser Cys Thr Ala Glu Asp Gly Ala acc agc cgg ccc ctc tcc tcc cct cct ggc cgg gac tcc ctc tat gcc 4423 Thr Ser Arg Pro Leu Ser Ser Pro Pro Gly Arg Asp Ser Leu Tyr Ala agc ggg gcc aac ctg cgg gac tca ccc tcc tac ccg gac agc agc cct 4471 Ser Gly Ala Asn Leu Arg Asp Ser Pro Ser Tyr Pro Asp Ser Ser Pro gag ggg ccc agt gag gcc ctg ccc cca ccc cct ccc gca ccc ccc ggc 4519 Glu Gly Pro Ser Glu Ala Leu Pro Pro Pro Pro Pro Ala Pro Pro Gly ccc ccc gaa atc tac tac acc tcg cgc ccg cca gcc ctg gtg gcc cgg 4567 Pro Pro Glu Ile Tyr Tyr Thr Ser Arg Pro Pro Ala Leu Val Ala Arg aat ccc ctg cag ggc tac tac cag gtg cgg cgt cct agc cac gag ggc 4615 Asn Pro Leu Gln Gly Tyr Tyr Gln Val Arg Arg Pro Ser His Glu Gly tac ctg gca gcc cca ggc ctt gag ggg cca ggg ccc gat ggg gac ggg 4663 Tyr Leu Ala Ala Pro Gly Leu Glu Gly Pro Gly Pro Asp Gly Asp Gly cag atg cag ctg gtc acc agt ctc tgagggcacc tcatggacca ggggctggtg 4717 Gln Met Gln Leu Val Thr Ser Leu gcccaggcca gggagggaac cctgggcagg gctctggtgg gagagggaga cagatggagg 4777 cagtggctgg tgggccactc tctccaggtg cccctcagcc atgggcccta cagtcccctc 4837 aggggactct aacctggggg cctgaggtgc cagggttcac agacagggtt tcccaccagc 4897 cacacgcacc agctctattt gggggaagtg tagtgaggag gagcccagag gaccccaggg 4957 gagtgaggag ggagaacttg gaagggtgca gcccacttcc agactctccc ctctcccacc 5017 cttctaccct gtgaagggaa atgagggctt tagtttcctg ggcagggagg ggcagcttct 5077 gaggttgcca aaggccccca ctggatggaa cctgttagct gctcctctcc gcagccagaa 5137 atgctgccgg ctgcacccag agggagcagt gaggcaggac agatggacag gttcctcctg 5197 cgctgtaatt ccctgctccc tggagactgg gaaaaggccg cagggcaggg ggactgggcg 5257 gtggtggctg gtggtttaaa ggttgaactt tctctgaagc tcctttcccc ttgctcttgg 5317 tccctgcccc gcaagcaaac ctgccccctc tgcctcccag tgcacccaat gaccccctcc 5377 cttggggcga ctcctgatga agcacaactc cccgcagggc ccccagccca caggggtggc 5437 catatttggg cagttcccag tcctgtgggc tcggctatct ggggagcaga ttttgggtct 5497 ggatctccct ggggagtggg tcctgggctt ggatctttcc ctagggggcc ctcttactcc 5557 ttcctctctc ctcctccttc cccattgctg taaatatttc aacgaaatgg aaa 5610 <210> 58 <211> 1469 <212> PRT
<213> Homo Sapiens <400> 58 Met Ala Arg Leu Ala Ala Val Leu Trp Asn Leu Cys Val Thr Ala Val Leu Val Thr Ser Ala Thr Gln Gly Leu Ser Arg Ala Gly Leu Pro Phe Gly Leu Met Arg Arg Glu Leu Ala Cys Glu Gly Tyr Pro Ile GIu Leu Arg Cys Pro Gly Ser Asp Val Ile Met Val Glu Asn Ala Asn Tyr Gly Arg Thr Asp Asp Lys Ile Cys Asp Ala Asp Pro Phe Gln Met Glu Asn Val Gln Cys Tyr Leu Pro Asp Ala Phe Lys Ile Met Ser Gln Arg Cys Asn Asn Arg Thr Gln Cys Val Val Val Ala Gly Ser Asp Ala Phe Pro Asp Pro Cys Pro Gly Thr Tyr Lys Tyr Leu Glu Val Gln Tyr Asp Cys Val Pro Tyr Ile Phe Val Cys Pro Gly Thr Leu Gln Lys Val Leu GIu Pro Thr Ser Thr His Glu Ser Glu His Gln Ser Gly Ala Trp Cys Lys Asp Pro Leu Gln Ala Gly Asp Arg Ile Tyr Val Met Pro Trp Ile Pro Tyr Arg Thr Asp Thr Leu Thr Glu Tyr Ala Ser Trp Glu Asp Tyr Val Ala Ala Arg His Thr Thr Thr Tyr Arg Leu Pro Asn Arg Val Asp Gly Thr Gly Phe Val Val Tyr Asp Gly Ala Val Leu Tyr Asn Lys Glu Arg Thr Arg Asn Ile Val Lys Tyr Asp Leu Arg Thr Arg Ile Lys Ser Gly Glu Thr Val Ile Asn Thr Ala Asn Tyr His Asp Thr Ser Pro Tyr Arg Trp Gly Gly Lys Thr Asp Ile Asp Leu Ala Val Asp Glu Asn Gly Leu Trp Val Ile Tyr Ala Thr Glu Gly Asn Asn Gly Arg Leu Val Val Ser Gln Leu Asn Pro Tyr Thr Leu Arg Phe Glu Gly Thr Trp Glu Thr Gly Tyr Asp Lys Arg Ser Ala Ser Asn Ala Phe Met Val Cys Gly Val Leu Tyr Val Leu Arg Set Val Tyr Val Asp Asp Asp Ser Glu Ala Ala Gly Asn Arg Val Asp Tyr Ala Phe Asn Thr Asn Ala Asn Arg Glu Glu Pro Val Ser Leu Thr Phe Pro Asn Pro Tyr Gln Phe Ile Ser Ser Val Asp Tyr Asn Pro Arg Asp Asn Gln Leu Tyr Val Trp Asn Asn Tyr Phe Val Val Arg Tyr Ser Leu Glu Phe Gly Pro Pro Asp Pro Ser Ala Gly Pro Ala Thr Ser Pro Pro Leu Ser Thr Thr Thr Thr Ala Arg Pro Thr Pro Leu Thr Ser Thr Ala Ser Pro Ala Ala Thr Thr Pro Leu Arg Arg Ala Pro Leu Thr Thr His Pro Val Gly Ala Ile Asn Gln Leu Gly Pro Asp Leu Pro Pro Ala Thr Ala Pro Val Pro Ser Thr Arg Arg Pro Pro Ala Pro Asn Leu His Val Ser Pro Glu Leu Phe Cys Glu Pro Arg Glu Val 465 470 475 4g0 WO 99/45111 PC1'/US99/04676 Arg Arg Val Gln Trp Pro Ala Thr Gln Gln Gly Met Leu Val Glu Arg Pro Cys Pro Lys Gly Thr Arg Gly Ile Ala Ser Phe Gln Cys Leu Pro Ala Leu Gly Leu Trp Asn Pro Arg Gly Pro Asp Leu Ser Asn Cys Thr Ser Pro Trp Val Asn Gln Val Ala Gln Lys Ile Lys Ser Gly Glu Asn Ala Ala Asn Ile Ala Ser Glu Leu Ala Arg His Thr Arg Gly Ser Ile Tyr Ala Gly Asp Val Ser Ser Ser Val Lys Leu Met Glu Gin Leu Leu Asp Ile Leu Asp Ala Gln Leu Gln Ala Leu Arg Pro Ile Glu Arg Glu Ser Ala Gly Lys Asn Tyr Asn Lys Met His Lys Arg Glu Arg Thr Cys Lys Asp Tyr Ile Lys Ala Val Val Glu Thr Val Asp Asn Leu Leu Arg Pro Glu Ala Leu Glu Ser Trp Lys Asp Met Asn Ala Thr Glu Gln Val His Thr Ala Thr Met Leu Leu Asp Val Leu Glu Glu Gly Ala Phe Leu Leu Ala Asp Asn Val Arg Glu Pro Ala Arg Phe Leu Ala Ala Lys Glu Asn Val Val Leu Glu Val Thr Val Leu Asn Thr Glu Gly Gln Val Gln Glu Leu Val Phe Pro Gln Glu Glu Tyr Pro Arg Lys Asn Ser Ile Gln Leu Ser Ala Lys Thr Ile Lys Gln Asn Ser Arg Asn Gly Val Val Lys Val Val Phe Ile Leu Tyr Asn Asn Leu Gly Leu Phe Leu Ser Thr Glu Asn Ala Thr Val Lys Leu Ala Gly Glu Ala Gly Pro Gly Gly Pro Gly Gly Ala Ser Leu Val Val Asn Ser Gln Val Ile Ala Ala Ser Ile Asn Lys Glu Ser Ser Arg Val Phe Leu Met Asp Pro Val Ile Phe Thr Val Ala His Leu Glu Asp Lys Asn His Phe Asn Ala Asn Cys Ser Phe Trp Asn Tyr Ser Glu Arg Ser Met Leu Gly Tyr Trp Ser Thr Gln Gly Cys Arg Leu Val Glu Ser Asn Lys Thr His Thr Thr Cys Ala Cys Ser His Leu Thr Asn Phe Ala Val Leu Met Ala His Arg Glu Ile Tyr Gln Gly Arg Ile Asn Glu Leu Leu Leu Ser Val Ile Thr Trp Val Gly Ile Val Ile Ser Leu Val Cys Leu Ala Ile Cys Ile Ser Thr Phe Cys Phe Leu Arg Gly Leu Gln Thr Asp Arg Asn Thr Ile His Lys Asn Leu Cys Ile Asn Leu Phe Leu Ala Glu Leu Leu Phe Leu Val Gly Ile Asp Lys Thr Gln Tyr Glu Ile Ala Cys Pro Ile Phe Ala Gly Leu Leu His Tyr Phe Phe Leu Ala Ala Phe Ser Trp Leu Cys Leu Glu Gly Val His Leu Tyr Leu Leu Leu Val Glu Val Phe Glu Ser Glu Tyr Ser Arg Thr Lys Tyr Tyr Tyr Leu Gly Gly Tyr Cys Phe Pro Ala Leu Val Val Gly Ile Ala A1a Ala Ile Asp Tyr Arg Ser Tyr Gly Thr Glu Lys Ala Cys Trp Leu Arg Val Asp Asn Tyr Phe Ile Trp Ser Phe Ile Gly Pro Val Ser Phe Val Ile Val Val Asn Leu Val Phe Leu Met Val Thr Leu His Lys Met Ile Arg Ser Ser Ser Val Leu Lys Pro Asp Ser Ser Arg Leu Asp Asn Ile Lys Ser Trp Ala Leu Gly Ala Ile Ala Leu Leu Phe Leu Leu Gly Leu Thr Trp Ala Phe Gly Leu Leu Phe Ile Asn Lys Glu Ser Val Val Met Ala Tyr Leu Phe Thr Thr Phe Asn Ala Phe Gln Gly Val Phe Ile Phe Val Phe His Cys Ala Leu Gln Lys Lys Val His Lys Glu Tyr Ser Lys Cys Leu Arg His Ser Tyr Cys Cys Ile Arg Ser Pro Pro Gly Gly Thr His Gly Ser Leu Lys Thr Ser Ala Met Arg Ser Asn Thr Arg Tyr Tyr Thr Gly Thr Gln Ser Arg Ile Arg Arg Met Trp Asn Asp Thr Val Arg Lys Gln Thr Glu Ser Ser Phe Met Ala Gly Asp Ile Asn Ser Thr Pro Thr Leu Asn Arg Gly Thr Met Gly Asn His Leu Leu Thr Asn Pro Val Leu Gln Pro Arg Gly Gly Thr Ser Pro Tyr Asn Thr Leu Ile Ala 185 ~ 1190 1195 1200 Glu Ser Val Gly Phe Asn Pro Ser Ser Pro Pro Val Phe Asn Ser Pro Gly Ser Tyr Arg Glu Pro Lys His Pro Leu Gly Gly Arg Glu Ala Cys Gly Met Asp Thr Leu Pro Leu Asn Gly Asn Phe Asn Asn Ser Tyr Ser Leu Arg Ser Gly Asp Phe Pro Pro Gly Asp Gly Gly Pro Glu Pro Pro Arg Gly Arg Asn Leu Ala Asp Ala Ala Ala Phe Glu Lys Met Ile Ile Ser Glu Leu Val His Asn Asn Leu Arg Gly Ser Ser Ser Ala Ala Lys Gly Pro Pro Pro Pro Glu Pro Pro Val Pro Pro Val Pro Gly Gly Gly Gly Glu Glu Glu Ala Gly Gly Pro Gly Gly Ala Asp Arg Ala Glu Ile Glu Leu Leu Tyr Lys Ala Leu Glu Glu Pro Leu Leu Leu Pro Arg Ala Gln Ser Val Leu Tyr Gln Ser Asp Leu Asp Glu Ser Glu Ser Cys Thr Ala Glu Asp Gly Ala Thr Ser Arg Pro Leu Ser Ser Pro Pro Gly Arg Asp Ser Leu Tyr Ala Ser Gly Ala Asn Leu Arg Asp Ser Pro Ser Tyr Pro Asp Ser Ser Pro Glu Gly Pro Ser Glu Ala Leu Pro Pro Pro Pro Pro Ala Pro Pro Gly Pro Pro Glu Ile Tyr Tyr Thr Ser Arg Pro Pro Ala Leu Val Ala Arg Asn Pro Leu Gln Gly Tyr Tyr Gln Val Arg Arg Pro Ser His Glu Gly Tyr Leu Ala Ala Pro Gly Leu Glu Gly Pro Gly Pro Asp Gly Asp Gly Gln Met Gln Leu Val Thr Ser Leu <210> 59 <21 1>

<212>
DNA

<213>
Homo Sapiens <22 0>

<22 1>
CDS

<222>
(1)..(798) <400>

gag gggctt ctgaacaatgcc agggat acaagtgtc atggatact cta 48 Glu GlyLeu LeuAsnAsnAla ArgAsp ThrSerVal MetAspThr Leu cca ctgaat ggtaaccatggc aatagt tacagcatt gccagcggc gaa 96 Pro LeuAsn GlyAsnHisGly AsnSer TyrSerIle AlaSerGly Glu tac ctgagc aactgtgtgcaa atcata gaccgtggc tataaccat aac 144 Tyr LeuSer AsnCysValGln IleIle AspArgGly TyrAsnHis Asn gag accgcc ctagagaaaaag attctg aaggaactc acttccaac tat 192 Glu ThrAla LeuGluLysLys IleLeu LysGluLeu ThrSerAsn Tyr atc ccttct tacctgaacaac catgag cgctccagt gaacagaac agg 240 Ile ProSer TyrLeuAsnAsn HisGlu ArgSerSer GluGlnAsn Arg aat ctgatg aacaagctggtg aataac cttggcagt ggaagggaa gat 28B

Asn LeuMet AsnLysLeuVal AsnAsn LeuGlySer GlyArgGlu Asp gat gccatt gtcctggatgat gccacc tcgtttaac cacgaggag agt 336 Asp AlaIle ValLeuAspAsp AlaThr SerPheAsn HisGluGlu Ser ttg ggcctg gaactcattcat gaggaa tctgatget cctttgctg ccc 384 Leu GlyLeu GluLeuIleHis GluGlu SerAspAla ProLeuLeu Pro cca agagta tactccaccgag aaccac cagccacac cattatacc aga 432 Pro ArgVal TyrSerThrGlu AsnHis GlnProHis HisTyrThr Arg agg cggatc ccccaagaccac agtgag agctttttc cctttgcta acc 480 Arg ArgIle ProGlnAspHis SerGlu SerPhePhe ProLeuLeu Thr aac gagcag acagaagatctc cagtca ccccataga gactctctc tat 528 Asn GluGln ThrGluAspLeu GlnSer ProHisArg AspSerLeu Tyr acc agcatg ccgacactgget ggtgtg gccgccaca gagagtgtt acc 576 Thr SerMet ProThrLeuAla GlyVal AlaAlaThr GluSerVal Thr acc agcacc cagaccgaaccc ccaccg gccaaatgt ggtgatgcc gaa 624 Thr SerThr GlnThrGluPro ProPro AlaLysCys GlyAspAla Glu gat gtttac tacaaaagcatg ccaaac ctaggctcc agaaaccac gtc 672 Asp Val Tyr Tyr Lys Ser Met Pro Asn Leu Gly Ser Arg Asn His Val cat cag ctg cat act tac tac cag cta ggt cgc ggc agc agt gat gga 720 His Gln Leu His Thr Tyr Tyr Gln Leu Gly Arg Gly Ser Ser Asp Gly ttt ata gtt cct cca aac aaa gat ggg acc cct ccc gag gga agt tca 768 Phe Ile Val Pro Pro Asn Lys Asp Gly Thr Pro Pro Glu Gly Ser Ser aaa gga ccg get cat ttg gtc act agt cta tagaagatga cacagaaatt 818 Lys Gly Pro Ala His Leu Val Thr Ser Leu ggaaccaaca aaactgctaa caccttgttg actgttctga gttgatataa gcagtggtaa 878 taatgtgtgt actcctaaat ctttatgctg tcctctaaag acaaacacaa actctcagac 938 tttttttttt ttaatgggat ttttaggtca gcccagggga gaaagataac tgctaaaatt 998 cccctgtacc ccatcctttc ttgtcctttc cccttcagat ggagacttca ttatgttaat 1058 gaacaagata tgaagaaaat ggcactcatt gtggccttgt tgaattatgt tgtgtatgtt 1118 ttaacatctc tgatgctgtg ttactaaaat tacaaggacc tgctttttaa aaggccagaa 1178 caattgtctg aaattagtaa caatgctgca tctagattgg agtgctgcac aaacaaacat 1238 aagagcaaag caaaactgta tcacataggg tttttggtca ctcacaacct gaattcacca 1298 cagctggaat agctgtggaa aacaaaataa aacaacaaaa ttaataatga aatggagggg 1358 aattctagaa ttatatgcta aatgcatatt ttatgatttg ctgtattaac tgatgataaa 1418 actaatggca gaaaaagaag ttgagcaatt tctatgtaat gtacagatac tagcattgca 1478 catatagtct gctttctgtt cctccagaat ttgagtcctg ttaatgtagt agaaaaaaaa 1538 aaaaaaaaaa 1548 <210> 60 <211> 266 <212> PRT
<213> Homo sapiens <400> 60 Glu Gly Leu Leu Asn Asn Ala Arg Asp Thr Ser Val Met Asp Thr Leu Pro Leu Asn Gly Asn His Gly Asn Ser Tyr Ser Ile Ala Ser Gly Glu Tyr Leu Ser Asn Cys Val Gln Ile Ile Asp Arg Gly Tyr Asn His Asn Glu Thr Ala Leu Glu Lys Lys Ile Leu Lys Glu Leu Thr Ser Asn Tyr Ile Pro Ser Tyr Leu Asn Asn His Glu Arg Ser Ser Glu Gln Asn Arg Asn Leu Met Asn Lys Leu Val Asn Asn Leu Gly Ser Gly Arg Glu Asp Asp Ala Ile Val Leu Asp Asp Ala Thr Ser Phe Asn His Glu Glu Ser Leu Gly Leu Glu Leu Ile His Glu Glu Ser Asp Ala Pro Leu Leu Pro Pro Arg Val Tyr Ser Thr Glu Asn His Gln Pro His His Tyr Thr Arg Arg Arg Ile Pro Gln Asp His Ser Glu Ser Phe Phe Pro Leu Leu Thr Asn Glu Gln Thr Glu Asp Leu Gln Ser Pro His Arg Asp Ser Leu Tyr Thr Ser Met Pro Thr Leu Ala Gly Val Ala Ala Thr Glu Ser Val Thr Thr Ser Thr Gln Thr Glu Pro Pro Pro Ala Lys Cys Gly Asp Ala Glu Asp Val Tyr Tyr Lys Ser Met Pro Asn Leu Gly Ser Arg Asn His Val His Gln Leu His Thr Tyr Tyr Gln Leu Gly Arg Gly Ser Ser Asp Gly Phe Ile Val Pro Pro Asn Lys Asp Gly Thr Pro Pro Glu Gly Ser Ser Lys Gly Pro Ala His Leu Val Thr Ser Leu <210> 61 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 61 atataagctt gctgccacca tggcccgc 2g <210> 62 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer <400> 62 atgacccaca gcccgttctc 20 <210> 63 <211> 16 <212> PRT
<213> Homo Sapiens <400> 63 Cys Pro Gly Pro Asp Gly Asp Gly Gln Met Gln Leu Val Thr Ser Leu <210> 64 <211> 16 <212> PRT
<213> Homo Sapiens <400> 64 Cys Pro Glu Gly Ser Ser Lys Gly Pro Ala His Leu Val Thr Ser Leu Arg Arg Il

Claims (35)

What is claimed is:

1. A purified and isolated human seven transmembrane receptor lectomedin polypeptide or a fragment thereof, said polypeptide comprising extracellular lectin-binding, olfactomedin-like, and mucin-like domains.

2. The polypeptide according to claim 1 which is a mature lectomedin polypeptide.

3. The polypeptide according to claim 1 comprising the amino acid sequence set out in SEQ ID NO: 2 or a fragment thereof.

4. The polypeptide according to claim 1 comprising the amino acid sequence set out in SEQ ID NO: 4 or fragment thereof.

5. The polypeptide according to claim 1 comprising the amino acid sequence set out in SEQ ID NO: 6 or fragment thereof.

6. The polynucleotide according to claim 1 comprising the amino acid sequence set out in SEQ ID NO: 58 or fragment thereof.

7. A polynucleotide encoding the polypeptide according to any one of claims 1 through 6.

8. The polynucleotide according to claim 7 comprising the sequence set forth in SEQ ID NO: 1.

9. The polynucleotide according to claim 7 comprising the sequence set forth in SEQ ID NO: 3.

10. The polynucleotide according to claim 7 comprising the sequence set forth in SEQ ID NO: 5 .

11. The polynucleotide according to claim 7 comprising the sequence set forth in SEQ ID NO: 57.

12. A polynucleotide encoding a human lectomedin polypeptide selected from the group consisting of:
a) the polynucleotide according to claim 8 through 11;
b) a DNA which hybridizes under moderately stringent conditions to the non-coding strand of the polynucleotide of (a); and c) a DNA which would hybridize to the non-coding strand of the polynucleotide of (a) but for the redundancy of the genetic code.

13. The polynucleotide of claim 12 which is a DNA molecule.

14. The DNA of claim 13 which is a cDNA molecule.

15. The DNA of claim 13 which is a wholly or partially chemically synthesized DNA molecule.

16. An anti-sense polynucleotide which specifically hybridizes with the polynucleotide of claim 13.

17. A expression construct comprising the polynucleotide according to claim 12.

18. A host cell transformed or transfected with the polynucleotide according to claim 17.

19. The polynucleotide according to claim 12 operably linked to a heterologous promoter.

20. A host cell comprising the polynucleotide according to claim 19.

21. A method for producing a human lectomedin polypeptide comprising the steps of:
a) growing the host cell according to claim 18 or 20 under conditions appropriate for expression of the lectomedin polypeptide and b) isolating the lectomedin polypeptide from the host cell or the medium of its growth.

22. An antibody specifically immunoreactive with the polypeptide according to any one of claims 1 through 6.

23. The antibody according to claim 22 which is a monoclonal antibody.

24. A hybridoma which produces the antibody according to claim 23.

25. An anti-idiotype antibody specifically immunoreactive with the antibody according to claim 23.

26. A method to identify a specific binding partner compound of the lectomedin polypeptide according to any one of claims 1 through 6 comprising the steps of:
a) contacting the lectomedin polypeptide with a compound under conditions which permit binding between the compound and the lectomedin polypeptide;

b) detecting binding of the compound to the lectomedin polypeptide; and c) identifying the compound as a specific binding partner of the lectomedin polypeptide.

27. The method according to claim 26 wherein the specific binding partner modulates activity of the lectomedin polypeptide.

28. The method according to claim 27 wherein the compound inhibits activity of the lectomedin polypeptide.

29. The method according to claim 27 wherein the compound enhances activity of the lectomedin polypeptide.

30. A method to identify a specific binding partner compound of the lectomedin polynucleotide according to claim 12 comprising the steps of:
a) contacting the lectomedin polynucleotide with a compound under conditions which permit binding between the compound and the lectomedin polynucleotide;
b) detecting binding of the compound to the lectomedin polynucleotide; and c) identifying the compound as a specific binding partner of the lectomedin polynucleotide.

31. The method according to claim 30 wherein the specific binding partner modulates expression of a lectomedin polypeptide encoded by the lectomedin polynucleotide.

32. The method according to claim 31 wherein the compound inhibits expression of the lectomedin polypeptide.

33. The method according to claim 31 wherein the compound enhances expression of the lectomedin polypeptide.

34. A compound identified by the method according to claim 26 or 30.

35. A composition comprising the compound according to claim 34 and a pharmaceutically acceptable carrier.