CA2304169A1 - Laminins and uses thereof - Google Patents

Abstract

The invention is drawn to a purified laminin 12 polypeptide that includes the .alpha.2 subunit, the .beta.1 subunit and the .gamma.3 subunit. The invention is also drawn to isolated laminin .beta.4 subunit and to isolated laminin .gamma.3 subunit. The invention is also drawn to polynucleotides encoding purified laminin 12 polypeptide as well as to polynucleotides encoding laminin .beta.4 subunit and laminin .gamma.3 subunit.

Description

LANJZNINS AND USES THEREOF
BACKGROUND OF THE INVENTION
The invention relates to the laminin 12, laminin subunit y3, and laminin subunit (31, and methods of making and using these molecules.
SUMMARY OF THE INVENTION
The present invention is based, in part, on the discovery of a novel member of the laminin family, laminin 12. Accordingly, the present invention features a purified or isolated preparation or a recombinant preparation of laminin 12 which includes an a2 subunit, a ail subunit and a y3 subunit.
In a preferred embodiment, the a2 subunit has at least 60% to about 70%, more preferably at least about 80%, even more preferably at least about 90% to about 95%, and most preferably at least about 99% sequence identity with human a2 subunit, e.g., the human a2 subunit of SEQ ID N0:7. The a2 subunit can be identical to a human a2 sequence, e.g., that of SEQ ID N0:7. In another embodiment, the a2 subunit is encoded by a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule of the nucleic acid sequence shown in SEQ ID N0:8. In addition, the a2 subunit can have substantially the same electrophoretic mobility as human a2 subunit, e.g., it appears as a 205 kDa electrophoretic band on reducing gels. Yet another preferred embodiment of the invention features an a2 subunit which is reactive with an a2-specific antibody, e.g., an antibody which binds to the epitope recognized by mAb SH2. a2 specific antibodies can be made by methods known in the art.
Another preferred embodiment of the invention features a (31 subunit having at least 60% to about 70%, more preferably at least about 80%, even more preferably at least about 90% to about 95%, and most preferably at least about 99% sequence identity with human (31 subunit, e.g., the human ail subunit of SEQ 1D N0:9. Preferably, the X31 subunit has the identical amino acid sequence of human ~i 1 subunit, e.g., that of SEQ ID
N0:9. In another embodiment, the ail subunit is encoded by a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule of the nucleic acid sequence shown in SEQ ID
NO:10. In addition, the (31 subunit can have substantially the same electrophoretic mobility as human (31 subunit, e.g., it appears as a 185 kDa electrophoretic band on reducing gels. Yet another preferred embodiment of the invention features an [31 subunit which is reactive with an (31-specific antibody, e.g., an antibody which binds to the epitope recognized by mAb 545.
ail-specific antibodies can be made by methods known in the art.
In yet another preferred embodiment, the Y3 subunit of laminin 12 has at least 60% to about 70%, more preferably at least about 80%, even more preferably at least about 90% to about 95%, and most preferably at least about 99% sequence identity with human y3 subunit, e.g., the y3 subunit of SEQ ID N0:3. The y3 subunit can be identical to a naturally occuring human y3 subunit, e.g., that of SEQ ID N0:3. In another embodiment, the y3 subunit is encoded by a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule of the nucleic acid sequence shown in SEQ ID N0:4. In addition, the y3 subunit can have substantially the same electrophoretic mobility as human y3 subunit, e.g., it appears as a 170 kDa electrophoretic band on reducing gels. Yet another preferred embodiment of the invention features an y3 subunit which is reactive with an y3-specific antibody. y3-specific antibodies can be made by methods known in the art and taught herein.
In a preferred embodiment, the laminin 12 is a trimer which can be found in, or can be isolated from human placental chorionic villi. In another embodiment, the laminin 12 is expressed by a recombinant cell, e.g., a bacterial cell, a cultured cell (e.g., a cultured eukaryotic cell) or a cell of a non-human transgenic animal. Cultured cells can include CHO
cells or SF8 cells. Expression of laminin 12 in a transgenic animal can be general or can be under the control of a tissue specific promoter. Preferably, one or more sequences which encode subunits of the laminin 12 trimer are expressed in a preferred cell-type by a tissue specific promoter, e.g., a milk specific promoter.
The present invention is also based, in part, on the discovery of a novel laminin subunit, y3. Accordingly, the invention features a recombinant or substantially pure or isolated preparation of a y3 polypeptide.
In a preferred embodiment, the y3 polypeptide has the following biological acitivities:
1) it promotes adhesion between tissue elements; 2) provides a site for insertion of nerves into the basement membrane. Im other preferred embodiments: the y3 polypeptide includes an amino acid sequence with at least 60%, 80%, 90%, 95%, 98%, or 99% sequence identity to an amino acid sequence from SEQ ID N0:3; the y3 polypeptide includes an amino acid sequence essentially the same as the amino acid sequence in SEQ ID N0:3; the y3 polypeptide is at least 5, 10, 20, 50, 100, or 150 amino acids in length; the y3 polypeptide includes at least 5, preferably at least 10, more preferably at least 20, most preferably at least 50, 100, or 150 contiguous amino acids from SEQ ID N0:3; the y3 polypeptide is either, an agonist or an antagonist, of a biological activity of a naturally occurring y3 subunit; the y3 polypeptide is a vertebrate, e.g., a mammalian, e.g. a primate, e.g., a human, y3 polypeptide.
In a preferred embodiment, the invention includes a y3 polypeptide encoded by a DNA insert of a plasmid deposited with ATCC as Accession No: 209357. In another embodiment, the y3 polypeptide is a polypeptide encoded by nucleotide sequences of the overlapping DNA inserts of more than one, preferably all seven of the plasmids deposited with ATCC as Accession No:209357.
In preferred embodiments: the y3 polypeptide is encoded by the nucleic acid in SEQ
ID N0:4, or by a nucleic acid having at least about 85%, more preferably at least about 90%
to about 95%, and most preferably at least about 99% sequence identity with the nucleic acid from SEQ ID NO: 4.

In preferred embodiments, the y3 polypeptide includes a nidogen-binding domain.
Generally, the nidogen-binding domain is at least 5 residues in length and preferably, has about 70, 80, 90, or 95% sequence identity with the nidogen-binding domain of the protein shown in SEQ ID NO: 3 (amino acid residues 750-755). In another embodiment, the y3 polypeptide includes at least 5, preferably 6 to 7, and most preferably 8 of the cysteins found Z O in native y3 protein. In yet another embodiment of the invention features a y3 polypeptide that does not include or has an inactivated nidogen-binding domain which serves as an antagonist to y3 biological activities. Furthermore, a y3 polypeptide which has antagonist activity can have inactivated or excluded regions which comprise at least one cystein found in native y3 protein.
In a preferred embodiment, the y3 polypeptide differs in amino acid sequence at up to 1, 2, 3, 5, or 10 residues, from a sequence in SEQ ID NO: 3. In other preferred embodiments, the y3 polypeptide differs in amino acid sequence at up to 1, 2, 3, 5, or 10 %
of the residues from a sequence in SEQ ID NO: 3. Preferably, the differences are such that:
the y3 polypeptide exhibits a y3 biological activity, e.g., the y3 polypeptide retains a biological activity of a naturally occurring y3 subunit.
In preferred embodiments the y3 polypeptide includes a y3 subunit sequence described herein as well as other N-terminal andlor C-terminal amino acid sequence.
In preferred embodiments, the y3 polypeptide includes all or a fragment of an amino acid sequence from SEQ ID NO: 3, fused, in reading frame, to additional amino acid residues, preferably to residues encoded by genomic DNA 5' to the genomic DNA which encodes a sequence from SEQ ID NO: 3.
In yet other preferred embodiments, the y3 polypeptide is a recombinant fusion protein having a first y3 portion and a second polypeptide portion, e.g., a second polypeptide portion having an amino acid sequence unrelated to y3. The second polypeptide portion can be, e.g., any of glutathione-S-transferase, a DNA binding domain, or a polymerase activating domain. In preferred embodiment the fusion protein can be used in a two-hybrid assay.
In a preferred embodiment the y3 polypeptide includes amino acid residues 750-of SEQ ID N0:3. In another embodiment, the y3 polypeptide encodes domains IV-VI of the y3 subunit.
In preferred embodiments the y3 polypeptide has antagonistic activity, and is capable of inhibiting adhesion between connective tissues.
In a preferred embodiment, the y3 polypeptide is a fragment of a naturally occurring y 3 which inhibits connective tissue adhesion.
Polypeptides of the invention include those which arise as a result of the existence of multiple genes, alternative transcription events, alternative RNA splicing events, and alternative translational and postranslational events. The y3 polypeptide can be expressed in systems, e.g., cultured cells, which result in substantially the same postranslational modifications present when expressed y3 is expressed in a native cell, or in systems which result in the omission of postranslational modifications present when expressed in a native cell. ~ _ The invention includes an immunogen which includes a y3 polypeptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for the y3 polypeptide, e.g., a humoral response, an antibody response, or a cellular response. In preferred embodiments, the immunogen comprising an antigenic determinant, e.g., a unique determinant, from a protein represented by SEQ ID NO: 3.
The present invention also includes an antibody preparation specifically reactive with an epitope-of the y3 immunogen or generally of a y3 polypeptide, preferably an epitope which consists all or in part of residues from the the amino acid sequence of SEQ ID
N0:3, or an epitope, which when bound to an antibody, results in the modulation of a biological activity.
In preferred embodiments the y3-like polypeptide, as expressed in the cells in which it is normally expressed or in other eukaryotic cells, has a molecular weight of 170 kDa as determined by SDS-PAGE.
In another embodiment, the y3 polypeptide comprises amino acid residues 100-of SEQ ID NO: 3.
In a preferred embodiment, the y3 polypeptide has one or more of the following characteristics:
(i) it has the ability to promote adhesion between connective tissues;
(ii) it has a molecular weight, amino acid composition or other physical characteristic of y3 subunit of SEQ ID N0:3;
(iii) it has an overall sequence similarity of at least 50%, preferably at least 60%, more preferably at least 70, 80, 90, or 95%, with a y3 polypeptide of SEQ
ID N0:3;
(iv) it can be isolated from human placenta chorionic villi;
(v) it has a nidogen-binding domain which is preferably about 70%, 80%, 90% or 95% with amino acid residues 750-755 of SEQ ID N0:3;
(vi) it can colocalize with protein ubiquitin carboxy terminal hydroxylase I;
(vii) it has at least 5, preferably 6 or 7, and most preferably 8 of the cysteins found amino acid sequence of native y3.
Also included in the invention is a composition which includes a y3 polypeptide (or a nucleic acid which encodes it) and one or more additional components, e.g., a carrier, diluent, or solvent. The additional component can be one which renders the composition useful for in vitro and in vivo pharmaceutical or veterinary use.
In another aspect, the invention provides an isolated or substantially pure nucleic acid having or comprising a nucleotide sequence which encodes a y3 polypeptide, e.g., a y3 polypeptide described herein.
A preferred embodiment of the invention features a nucleic acid molecule having a nucleotide sequence at least about 85% sequence identity to a nucleotide sequence of SEQ iD
N0:4. In other preferred embodiments, the y3 polypeptide is encoded by a nucleic acid S
S molecule having a nucleotide sequence with at least about 90% to about 9S%, and more preferably about 98% to about 99% sequence identity to the nucleotide sequence from SEQ
ID N0:4. In another preferred embodiment, the y3 polypeptide is encoded by the nulceic acid molecule of SEQ ID N0:4.
In prefered embodiments, the isolated nucleic acid molecule includes the nucleotide sequence of at least one and preferably all of the DNA inserts of the plasmids deposited with ATCC as Accession No: 209357.
In preferred embodiments, the subject y3 nucleic acid will include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter or transcriptional enhancer sequence, operably linked to the y3 gene sequence (also referred to as LAMG3), e.g., to 1 S render the y3 gene sequence suitable for use as an expression vector.
In yet a further preferred embodiment, the nucleic acid which encodes a y3 polypeptide of the invention, hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides of SEQ ID N0:4. More preferably, the nucleic acid probe corresponds to at least 20 consecutive nucleotides from SEQ
ID NO: 4.
The invention also provides a probe or primer which includes or comprises a substantially purified oligonucleotide. The oligonucleotide includes a region of nucleotide sequence which hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or antisense sequence from SEQ ID NO: 4, or naturally occurring mutants thereof. In preferred embodiments, the probe or primer further includes a label group attached thereto.
2S The label group can be, e.g., a radioisotope, a fluorescent compound, an enzyme, and/or an enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than 20, 30, S0, 100, or 150 nucleotides in length.
The invention involves nucleic acids, e.g., RNA or DNA, encoding a y3 polypeptide of the invention. This includes double stranded nucleic acids as well as coding and antisense single strands.
In another aspect, the invention features a cell or purified preparation of cells which include a y3 subunit transgene, or which otherwise misexpress a y3 gene. The cell preparation can consist of human or non human cells, e.g., rodent cells, e.g., mouse or rat cells, rabbit cells, or pig cells. In preferred embodiments, the cell or cells include a y3 3S transgene, e.g., a heterologous form of a r3 gene, e.g., a gene derived from humans (in the case of a non-human cell). The y3 transgene can be misexpressed, e.g., overexpressed or underexpressed. In other preferred embodiments, the cell or cells include a gene which misexpress an endogenous y3 gene, e.g., a gene the expression of which is disrupted, e.g., a knockout. Such cells can serve as a model for studying disorders which are related to mutated or mis-expressed y3 alleles or for use in drug screening.
In another aspect, the invention features a transgenic y3 animal, e.g., a rodent, e.g., a mouse or a rat, a rabbit, a pig, a goat, or a cow. In preferred embodiments, the transgenic animal includes (and preferably express) a heterologous form of a y3 gene, e.g., a gene derived from humans. In a further embodiment, the y3 transgene includes a tissue specific promoter, e.g., a milk-specific promoter. In other preferred embodiments, the animal has an endogenous y3 gene which is misexpressed, e.g., a knockout. Such a transgenic animal can serve as a model for studying disorders which are related to mutated or mis-expressed y3 alleles or for use in drug screening.
The invention is also based, in part, on the discovery of a novel laminin subunit, (34.
Accordingly, the invention features a recombinant or substantially pure preparation of a (34 polypeptide.
In preferred embodiment, the X34 polypeptide has the following biological activities: 1 ) it promotes adhesion between tissue elements; 2) it aids in wound healing. In other preferred embodiments: the (34 polypeptide includes an amino acid sequence with at least 65%, 80%, 90%, 95%, 98%, or 99% sequence identity to an amino acid sequence from SEQ ID
NO:1;
the (34 polypeptide includes an amino acid sequence essentially the same as an amino acid sequence in SEQ ID NO: 1; the (34 polypeptide is at least 5, 10, 20, 50, 100, or 150 amino acids in length; the (34 polypeptide includes at least 5, preferably at least 10, more preferably at least 20, most preferably at least 50, 100, or 150 contiguous amino acids from SEQ ID
NO:1; the (34 polypeptide is either, an agonist or an antagonist, of a biological activity of a naturally occurnng ~i4 subunit; the ~i4 polypeptide is a vertebrate, e.g., a mammalian, e.g. a primate, e.g., a human, ~i4 polypeptide.
In preferred embodiments: the ~i4 polypeptide is encoded by the nucleic acid in SEQ
ID N0:2, or by a nucleic acid having at least about 65% to about 70%, more preferably at least 80%, even more preferably at least about 90% to about 95%, and most preferably about 99% sequence identity with the nucleic acid from SEQ ID NO: 2.
In preferred embodiments, the (34 polypeptide includes domains VI and V found in native [34 subunits. Amino acid residues from about 221-262 and 263-535 of SEQ
m NO: 1 are exemplary of domains VI and V, respectively, of (34. Generally, domain VI
is at least 33 residues in length and has preferably at least about 60%, more preferably about 70% to about 80%, and most preferably about 90% to about 95% sequence identity with the amino acid residues 221-262 of the (34 protein shown in SEQ ID NO: 1. Domain V is at least 272 residues in length and has preferably at least about 60%, more preferably about 70% to about 80%, and most preferably about 90% to about 95% sequence identity with the amino acid residues 263-535 of the (34 protein shown in SEQ ID NO: 1. In another embodiment, the (34 polypeptide has at least 5, preferably 6 or 7, and most preferably 8 cysteins as found in native (34. In yet another embodiment, a (34 polypeptide which has antagonist activity has inactivated or excluded regions which comprise at least one of the cysteins found in native [34 protein.
In a preferred embodiment, the ~i4 polypeptide differs in amino acid sequence at up to 1, 2, 3, 5, or 10 residues, from a sequence in SEQ ID NO: 1. In other preferred embodiments, the (34 polypeptide differs in amino acid sequence at up to 1, 2, 3, 5, or 10 % of the residues from a sequence in SEQ ID NO: 1. Preferably, the differences are such that:
the (34 polypeptide exhibits a (34 biological activity, e.g., the (34 polypeptide retains a biological activity of a naturally occurring ~i4 subunit.
In preferred embodiments the (34 polypeptide includes a X34 sequence described herein as well as other N-terminal and/or C-terminal amino acid sequence.
In preferred embodiments, the (34 polypeptide includes all or a fragment of an amino acid sequence from SEQ ID NO:1, fused, in reading frame, to additional amino acid residues, preferably to residues encoded by genomic DNA 5' to the genomic DNA which encodes a sequence from SEQ ID NO:1.
In yet other preferred embodiments, the X34 polypeptide is a recombinant fusion protein having a first (34 portion and a second polypeptide portion, e.g., a second polypeptide portion having an amino acid sequence unrelated to (34. The second polypeptide portion can be, e.g., any of glutathione-S-transferase, a DNA binding domain, or a polymerase activating domain. In preferred embodiment the fusion protein can be used in a two-hybrid assay.
In preferred embodiments the ~i4 polypeptide has antagonistic activity, and is capable of inhibiting the adhesion of connective tissues.
Preferably, the [34 polypeptide is a fragment of a naturally occurnng (34 which inhibits connective tissue adhesion.
Polypeptides of the invention include those which arise as a result of the existence of multiple genes, alternative transcription events, alternative RNA splicing events, and alternative translational and postranslational events. In one aspect of the invention, the ~i4 polypeptide is a splice variant of the [34 subunit. In another preferred embodiment, the (34 splice variant is encoded by a nucleic acid molecule identical to the nucleotide sequence of SEQ ID N0:6. The polypeptide can be expressed in systems, e.g., cultured cells, which result in substantially the same postranslational modifications present when expressed (34 is expressed in a native cell, or in systems which result in the omission of postranslational modifications present when expressed in a native cell.
The invention includes an immunogen which includes a ~i4 polypeptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for the (34 polypeptide, e.g., a humoral response, an antibody response, or a cellular response. In preferred embodiments, the immunogen comprising an antigenic determinant, e.g., a unique determinant, from a protein represented by SEQ ID NO: 1.
The present invention also includes an antibody preparation specifically reactive with an epitope of the (34 immunogen or generally of a (34 polypeptide, preferably an epitope which consists all or in part of residues from the amino acid sequence of SEQ
ID NO:1, or an epitope, which when bound to an antibody, results in the modulation of a biological activity.
In preferred embodiments the (34-like polypeptide, as expressed in the cells in which it is normally expressed or in other eukaryotic cells, has an estimated molecular weight of 200 kDa as determined by SDS-PAGE.

In a preferred embodiment, the (34 polypeptide has one or more of the following characteristics:
(i) it has the ability to promote adhesion between connective tissues;
(ii) it has a molecular weight, amino acid composition or other physical characteristic of [34 subunit of SEQ m NO:1;
(iii) it has an overall sequence similarity of at least 50%, preferably at least 65%, more preferably at least 70, 80, 90, or 95%, with a [34 polypeptide of SEQ >D NO:1;
(iv) it can be isolated from human placenta chorionic villi;
(v) it can associate with a3 or y2 subunits;
(vi) it has coiled coils in domains I and II.
(vii) it has at least 5, preferably 6 or 7, and most preferably 8 of the cysteins found in native (34 sequence.
Also included in the invention is a composition which includes a (34 polypeptide (or a nucleic acid which encodes it) and one or more additional components, e.g., a carrier, diluent, or solvent. The additional component can be one which renders the composition for in vitro and in vivo pharmaceutical or veterinary use. Such uses can include aiding in wound healing or promotion of the adhesion of dermal and epidermal cells.
In another aspect, the invention provides an isolated or substantially pure nucleic acid having or comprising a nucleotide sequence which encodes a ~i4 polypeptide, e.g., a (34 polypeptide described herein.
A preferred embodiment of the invention features a nucleic acid molecule having a nucleotide sequence at least about 65% sequence identity to a nucleotide sequence of SEQ ID
N0:2. In other preferred embodiments, the ~i4 polypeptide is encoded by a nucleic acid molecule having a nucleotide sequence with at least 70%, preferably 80%, more preferably about 90% to about 95%, and even more preferably about 99% sequence identity to the nucleotide sequence from SEQ m N0:2. In another preferred embodiment, the (i4 polypeptide is encoded by the nulceic acid molecule of SEQ ID N0:2.
In preferred embodiments, the subject ~i4 nucleic acid will include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter or transcriptional enhancer sequence, operably linked to the [34 gene sequence (also referred to as LAMB4), e.g., to render the ~i4 gene sequence suitable for use as an expression vector.
In yet a further preferred embodiment, the nucleic acid which encodes a (34 polypeptide of the invention, hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides from SEQ ID N0:2, more preferably to at least 20 consecutive nucleotides from SEQ ID N0:2.
In a preferred embodiment, the nucleic acid differs by at least one nucleotide from a nucleotide sequence of SEQ m N0:2, nucleotides 4686-5870.
The invention also provides a probe or primer which includes or comprises a substantially purified oligonucleotide. The oligonucleotide includes a region of nucleotide sequence which hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or antisense sequence from SEQ ID NO: 2, or naturally occurring mutants thereof. In preferred embodiments, the probe or primer further includes a label group attached thereto.
The label group can be, e.g., a radioisotope, a fluorescent compound, an enzyme, and/or an enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than 20, 30, 50, 100, or 150 nucleotides in length.
The invention involves nucleic acids, e.g., RNA or DNA, encoding a (34 polypeptide of the invention. This includes double stranded nucleic acids as well as coding and antisense single strands.
In another aspect, the invention features a cell or purified preparation of cells which include a p4 transgene, or which otherwise misexpress a ~4 gene. The cell preparation can consist of human or non human cells, e.g., rodent cells, e.g., mouse or rat cells, rabbit cells, or pig cells. In preferred embodiments, the cell or cells include a (34 transgene, e.g., a heterologous form of a (34 gene, e.g., a gene derived from humans (in the case of a non-human cell). The X34 transgene can be rnisexpressed, e.g., overexpressed or underexpressed.
In other preferred embodiments, the cell or cells include a gene which misexpress an endogenous (34 gene, e.g., a gene the expression of which is disrupted, e.g., a knockout. Such cells can serve as a model for studying disorders which are related to mutated or mis-expressed ~i4 alleles or for use in drug screening.
In another aspect, the invention features a transgenic [34 animal, e.g., a rodent, e.g., a mouse or a rat, a rabbit, a pig, a goat, or a cow. In preferred embodiments, the transgenic animal includes (and preferably express) a heterologous form of a (34 gene, e.g., a gene derived from humans. In a fiutller embodiment, the (34 transgene includes a tissue specific promoter, e.g., a milk-specific promoter. In other preferred embodiments, the animal has an endogenous (34 gene which is misexpressed, e.g., a knockout. Such a transgenic animal can serve as a model for studying disorders which are related to mutated or mis-expressed (34 alleles or for use in drug screening.
In another aspect, the invention features, a method of promoting adhesion of a first tissue element to a second tissue element. The method includes contacting one or both of the first tissue element and the second tissue element with an amount of a laminin molecule described herein, e.g., Iaminin 12, or'y3 (or a Iaminin trimer which inlcudes y3), sufficient to promote adhesion. The method can be performed in vivo, or in vitro. In in vivo methods the laminin is administered to the subject. The administration can be directed to the site where adhesion is desired, e.g., by topical appication or by injection, or administered in a systemic fashion.
A tissue element can be a cell or a multi-cellular on acellular structure.
Examples of tissue elements include, skin cells, e.g., epidermal or dermal cells, neuronal cells, e.g., nerve cells, retinal cells, central or pereipheral nervous system components, basement membrane or components of the basement membrane, or any cell or structure which in normal, non-5 traumatized, or non-diseased tissue is adjascent or adhered to a specific tissue element recited herein.
In preferred embodiments the molecule is exogenous (e.g., administered to a subject) or is recombinant.
In preferred embodiments the method is an vivo method. In vivo methods can be 10 autologous, allogeneic, or xenogeneic. In autologous methods, adhesion between two tissue elements from the subject is promoted. In allogeneic methods, adhesion between a recipient tissue element and a donor tissue element from an allogeneic donor is promoted. In xenogeneic methods, adhesion between a recipient tissue element and a donor tissue element from a xenogeneic donor is promoted. Thus, one element can be a donor tissue element which is implanted into a recipient subject.
In preferred embodiments the first tissue is healthy tissue, e.g., skin tissue, and the second tissue is wounded, e.g., burned, diseased, traumatized, cut, and the tissue, or is a wound bed. For example, the first tissue is skin tissue, from the subject or from a donor, and the second tissue is wounded, e.g., burned or abraided tissue.
In preferred embodiments the first tissue and second tissue element are normally adhered but have become detached from one another due to trauma, burn or other physical injury, disease, or age.
In preferred embodiments: the first tissue element is a dermal cell and the second tissue element is an epidermal cell; the first tissue element is a nerve cell or nerve and the second tissue element is a cell or structure which in normal, non-traumatized, or non-diseased tissue is adjascent or adhered to the nerve cell or nerve; the first tissue element is a retinal cell or retina tissue and the second tissue element is a cell or structure which in normal, non-traumatized, or nvn-diseased tissue is adjascent or adhered to the a retinal cell or retina tissue, the first tissue is a nerve and the second tissue is basement membrane.
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting wound healing in a subject. The method includes administering an amount of a laminin molecule described herein, e.g., laminin 12, y3 (or a laminin trimer which inlcudes y3), sufficient to promote healing to the wound. The administration can be directed to the site where healing is desired, e.g., by topical appication or by injection, or administered in a systemic fashion.
The wound can be in any tissue, but preferably ina tissue in which the laminin normally occurs. Examples skin, central or peripheral nervous tissue, tissues ofthe eye, e.g., the retinal, the basement membrane, or any tissue which in normal, non-traumatized, or non-diseased tissue is adjascent or adhered thereto.
In preferred embodiments the molecule is exogenous (e.g., administered to a subject) or is recombinant.
In preferred embodiments the wound tissue is burned, diseased, traumatized, cut, the subject of immune attack, e.g, autoimmune attack, or abraided.

The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting nerve growth or regeneration in a subject. The method includes administering an amount of a laminin molecule described herein, e.g., laminin 12, or y3 (or a laminin trimer which inlcudes y3), sufficient to promote nerve growth or regeneration. The administration can be directed to the site where nerve growth or regeneration is desired, e.g., by topical appication or by injection, or administered in a systemic fashion.
In preferred embodiments the molecule is exogenous (e.g., administered to a subject) or is recombinant.
In preferred embodiments the nerve growth or regeneration is promoted at a wound site.
The administration of laminin can be repeated.
In another aspect, the invention provides, a method of determining if a subject is at risk for a disorder related to a lesion in or the misexpression of a gene which encodes a laminin described herein, e.g., y3 or laminin 12.
Such disorders include, e.g., a disorder associated with the misexpression of a laminin, e.g., laminin 12, or misexpression of the y3 subunit; a disorder of the central or peripheral nervous system;
a disorder associated with a genetic lesion at chromosome 9, region q31-34;
Fukuyama-type muscular dystrophy; muscle-eye-brain disease; Walker-Warburg Syndrome (hydrocephalus, ageria, and retinal displasia); a retinal disorder, e.g, retinitis pigmentosa-deafness syndrome {which may be a subtype of Walker-Warburg Syndrome); a disorder associated with abnormal levels, e.g., abnormally low levels, of adhesion between tissues; a disorder associated with the basement membrane; a skin disorder, e.g., an epidermal or dermal, disorder; a disorder associated with the testis, spleen, placenta, thymus, ovary, small intestine, lung, or liver.
The method includes one or more of the following:
detecting, in a tissue of the subject, the presence or absence of a mutation which affects the expression of the y3 gene, or other gene which encodes a subunit of laminin 12, e.g., detecting the presence or absence of a mutation in a region which controls the expression of the gene, e.g., a mutation in the S' control region;
detecting, in a tissue of the subject, the presence or absence of a mutation which alters the structure of the y3 gene, or other gene which encodes a subunit of laminin 12;
detecting, in a tissue of the subject, the misexpression of they3 gene, or other gene which encodes a subunit of laminin 12 at the mRNA level, e.g., detecting a non-wild type level of a y3, or an other laminin 12 subunit mRNA ;
detecting, in a tissue of the subject, the misexpression of the y3 gene, or other gene which encodes a subunit of laminin 12, at the protein level, e.g., detecting a non-wild type level of a y3, or an other laminin 12 subunit polypeptide.
In preferred embodiments the method includes: ascertaining the existence of at least one of: a deletion of one or more nucleotides from the y3 gene, or other gene which encodes a subunit of laminin 12; an insertion of one or more nucleotides into the gene, a point mutation, e.g., a substitution of one or more nucleotides of the gene, a gross chromosomal -rearrangement of the gene, e.g., a translocation, inversion, or deletion.
For example, detecting the genetic lesion can include: (i) providing a probe/primer including an oligonucleotide containing a region of nucleotide sequence which hybridizes to a sense or antisense sequence from SEQ ID N4:4, or naturally occurring mutants thereof or 5' or 3' flanking sequences naturally associated with the LAMG3 gene; (ii) exposing the probe/primer to nucleic acid of the tissue; and detecting, by hybridization, e.g., in situ hybridization, of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion.
I S In preferred embodiments detecting the misexpression includes ascertaining the existence of at least one of an alteration in the level of a messenger RNA
transcript of the y3 gene, or other gene which encodes a subunit of laminin I2; the presence of a non-wild type splicing pattern of a messenger RNA transcript of the y3 gene, or other gene which encodes a subunit of laminin 12; or a non-wild type level of Y3, or other subunit of laminin 12.
Methods of the invention can be used prenatally or to determine if a subject's offspring will be at risk for a disorder.
In preferred embodiments the method includes determining the structure of a y3 gene, or other gene which encodes a subunit of laminin 12, an abnormal structure being indicative of risk for the disorder.
In preferred embodiments the method includes contacting a sample form the subject with an antibody to the laminin protein or a nucleic acid which hybridizes specifically with the y3 gene, or other gene which encodes a subunit of laminin 12.
In another aspect, the invention features, a method of promoting adhesion of a first tissue element to a second tissue element. The method includes contacting one or both of the first tissue element and the second tissue element with an amount of a laminin molecule described herein, e.g., (34, sufficient to promote adhesion. The method can be performed in vivo, or in vitro. In in vivo methods the laminin is administered to the subject. The administration can be directed to the site where adhesion is desired, e.g., by topical application or by injection, or administered in a systemic fashion.
A tissue element can be a cell or a multi-cellular on acellular structure.
Examples of tissue elements include, skin cells, e.g., epidermal or dermal cells, neuronal cells, e.g., nerve cells, retinal cells, central or pereipheral nervous system components, basement membrane or components of the basement membrane, or any cell or structure which in normal, non-traumatized, or non-diseased tissue is adjascent or adhered to a specific tissue element recited herein.
In preferred embodiments the molecule is exogenous (e.g., administered to a subject) or is recombinant.

In preferred embodiments the method is an vivo method. In vivo methods can be autologous, allogeneic, or xenogeneic. In autologous methods, adhesion between two tissue elements from the subject is promoted. In allogeneic methods, adhesion between a recipient tissue element and a donor tissue element from an allogeneic donor is promoted. In xenogeneic methods, adhesion between a recipient tissue element and a donor tissue element from a xenogeneic donor is promoted. Thus, one element can be a donor tissue element which is implanted into a recipient subject.
In preferred embodiments the first tissue is healthy tissue, e.g., skin tissue, and the second tissue is wounded, e.g., burned, diseased, traumatized, cut, and the tissue, or is a wound bed. For example, the first tissue is skin tissue, from the subject or from a donor, and the second tissue is wounded, e.g., burned or abraided tissue.
In preferred embodiments: the first tissue element is a dermal cell and the second tissue element is an epidermal cell; the first tissue element is a nerve cell or nerve and the second tissue element is a cell or structure which in normal, non-traumatized, or non-diseased tissue is adjascent or adhered to the nerve cell or nerve; the first tissue is a nerve and the second tissue is basement membrane.
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting wound healing in a subject. The method includes administering an amount of a laminin molecule described herein, e.g., ~i4, sufficient to promote healing to the wound. The administration can be directed to the site where healing is desired, e.g., by topical appication or by injection, or administered in a systemic fashion.
The wound can be in any tissue, but preferably in a tissue in which the laminin normally occurs in fetal or adult life. Examples examples include skin the basement membrane.
In preferred embodiments the molecule is exogenous (e.g., administered to a subject) or is recombinant.
In preferred embodiments the wound tissue is burned, diseased, traumatized, cut, the subject of immune attack, e.g, autoimmune attack, or abraded.
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting tissue growth, development, or regeneration in a subject. The method includes administering an amount of a laminin molecule described herein, e.g., (34, sufficient to promote tissue growth, development, or regeneration in a subject. The administration can be directed to the site where nerve growth or regeneration is desired, e.g., by topical appication or by injection, or administered in a systemic fashion.
In preferred embodiments the molecule is exogenous (e.g., administered to a subject) or is recombinant.

In preferred embodiments the nerve growth or regeneration is promoted at a wound site.
The administration of laminin can be repeated.
In another aspect, the invention provides, a method of determining if a subject is at risk for a disorder related to a lesion in or the misexpression of a laminin molecule described herein, e.g., (34.
Such disorders include, e.g., a disorder associated with the misexpression of a laminin, e.g., ~i 4; a disorder associated with a genetic lesion at chromosome region 7q22-q31.2; a developmetnal disorder; a disorder associated with abnormal levels, e.g., abnormally low levels, of adhesion between tissues; a disorder associated with the basement membrane; a skin disorder, e.g., an epidermal or dermal, disorder.
The method includes one or more of the following:
detecting, in a tissue of the subject, the presence or absence of a mutation which affects the expression of the ~i4 gene, e.g, detecting the presence or absence of a mutation in a region which controls the expression of the gene, e.g., a mutation in the 5' control region;
detecting, in a tissue of the subject, the presence or absence of a mutation which alters the structure of the ~i4 gene;
detecting, in a tissue of the subject, the misexpression of the (34 gene, e.g., detecting a non-wild type level of a (34 mRNA ;
detecting, in a tissue of the subject, the misexpression of the (34, at the protein level, e.g., detecting a non-wild type level of a (34 polypeptide.
In preferred embodiments the method includes: ascertaining the existence of at least one of a deletion of one or more nucleotides from the (34; an insertion of one or more nucleotides into the gene, a point mutation, e.g., a substitution of one or more nucleotides of the (34 gene, a gross chromosomal rearrangement of the (34 gene, e.g., a translocation, inversion, or deletion.
For example, detecting the genetic lesion can include: (i) providing a probe/primer including an oligonucleotide containing a region of nucleotide sequence which hybridizes to a sense or antisense sequence from SEQ ID N0:2, or naturally occurring mutants thereof or 5' or 3' flanking sequences naturally associated with the LAMB4 gene; (ii) exposing the probelprimer to nucleic acid of the tissue; and detecting, by hybridization, e.g., in situ hybridization, of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion.
In preferred embodiments: detecting the misexpression includes ascertaining the existence of at least one of an alteration in the level of a messenger RNA
transcript of the (3 4; the presence of a non-wild type splicing pattern of a messenger RNA
transcript of the (34;
or a non-wild type level of (34.
Methods of the invention can be used prenatally or to determine if a subject's offspring will be at risk for a disorder.

5 In preferred embodiments the method includes determining the structure of the a ~i4, an abnormal structure being indicative of risk for the disorder.
In preferred embodiments the method includes contacting a sample form the subject with an antibody to the (34 protein or a nucleic acid which hybridizes specifically with the ~i4.
In another aspect, the invention features, a method of evaluating a compound for the 10 ability to interact with, e.g., bind, a subject laminin polypeptide, e.g., laminin 12, y3, a laminin trimer which inlcudes ~3, ~i4, or a laminin trimer which includes (34.
The method includes: contacting the compound with the subject laminin polypeptide; and evaluating ability of the compound to interact with, e.g., to bind or form a complex with the subject laminin polypeptide. This method can be performed in vitro, e.g., in a cell free system, or in 15 vivo, e.g., in a two-hybrid interaction trap assay. This method can be used to identify naturally occurring molecules which interact with subject laminin polypeptide.
It can also be used to find natural or synthetic inhibitors of subject laminin polypeptide.
In another aspect, the invention features, a method of evaluating a compound, e.g., a polypeptide, e.g., a naturally occurring ligand of or a naturally occuring substrate to which binds a subject laminin polypeptide, e.g., of laminin 12, y3, a laminin trimer which inlcudes y 3, (34, or a laminin trimer which includes (34, for the ability to bind a subject laminin polypeptide. The method includes: contacting the compound with the subject laminin polypeptide; and evaluating the ability of the compound to interact with, e.g., to bind or form a complex with the subject laminin polypeptide, e.g., the ability of the compound to inhibit a subject laminin polypeptide/ligand interaction. This method can be performed in vitro, e.g., in a cell free system, or in vivo, e.g., in a two-hybrid interaction trap assay. This method can be used to identify compounds, e.g., fragments or analogs of a subject laminin polypeptide, which are agonists or antagonists of a subject laminin polypeptide.
In another aspect, the invention features, a method of evaluating a first compound, e.g., a subject laminin polypeptide, e.g., laminin 12, y3, a laminin trimer which inlcudes Y3, (3 4, or a laminin trimer which includes (34, for the ability to bind a second compound, e.g., a second polypeptide, e.g., a naturally occurring ligand of or substrate to which binds a subject laminin polypeptide. The method includes: contacting the first compound with the second compound; and evaluating the ability of the first compound to form a complex with the second compound. This method can be performed in vitro, e.g., in a cell free system, or in vivo, e.g., in a two-hybrid interaction trap assay. This method can be used to identify compounds, e.g., fragments or analogs of a subject laminin polypeptide, which are agonists or antagonists of a subject laminin polypeptide.
In yet another aspect, the invention features a method for evaluating a compound, e.g., for the ability to modulate an interaction, e.g., the ability to inhibit an interaction of a subject laminin polypeptide, e.g., of laminin 12, y3, a laminin trimer which inlcudes y3, (34, or a laminin trimer which includes [34, with a second polypeptide, e.g., a polypeptide, e.g., a natural ligand of the of or a substrate wo which binds a subject laminin polypeptide, or a fragment thereof. The method includes the steps of (i) combining the second polypeptide (or preferably a purified preparation thereof), a subject laminin polypeptide, (or preferably a purified preparation thereof), and a compound, e.g., under conditions wherein in the absence of the compound, the second polypeptide, and the subject laminin polypeptide, are able to interact, e.g., to bind or form a complex; and (ii) detecting the interaction, e.g., detecting the formation (or dissolution) of a complex which includes the second polypeptide, and the subject laminin polypeptide. A change, e.g., a decrease or increase, in the formation of the complex in the presence of a compound (relative to what is seen in the absence of the compound)-is indicative of a modulation, e.g., an inhibition or promotion, of the interaction between the second polypeptide, and the subject laminin polypeptide. In preferred embodiments: the second polypeptide, and the subject laminin polypeptide, are combined in a cell-free system and contacted with the compound; the cell-free system is selected from a group consisting of a cell lysate and a reconstituted protein mixture; the subject laminin polypeptide, and the second polypeptide are simultaneously expressed in a cell, and the cell is contacted with the compound, e.g. in an interaction trap assay (e.g., a two-hybrid assay).
In yet another aspect, the invention features a two-phase method (e.g., a method having an in vitro, e.g., in a cell free system, and an in vivo phase) for evaluating a compound, e.g., for the ability to modulate, e.g., to inhibit or promote, an interaction of a subject laminin polypeptide subject laminin polypeptide, e.g., of laminin 12, y3, a laminin trimer which inlcudes y3, (34, or a laminin trimer which includes [34, with a second compound, e.g., a second polypeptide, e.g., a naturally occurring ligand of or a substrate to which binds a subject laminin polypeptide, or a fragment thereof. The method includes steps (i) and (ii) of the method described immediately above performed in vitro, and further includes: (iii) determining if the compound modulates the interaction in vitro, e.g., in a cell free system, and if so; (iv) administering the compound to a cell or animal;
and (v) evaluating the in vivo effect of the compound on an interaction, e.g., inhibition, of a subject laminin polypeptide, with a second polypeptide.
In another aspect, the invention features, a method of evaluating a compound for the ability to bind a nucleic acid encoding a subject laminin polypeptide, e.g., a laminin 12, y3, a laminin trimer which inlcudes y3, (34, or a laminin trimer which includes (34 polypeptide regulatory sequence. The method includes: contacting the compound with the nucleic acid;
and evaluating ability of the compound to form a complex with the nucleic acid.
In another aspect, the invention features a method of making a y3 or [34 polypeptide, e.g., a peptide having a non-wild type activity, e.g., an antagonist, agonist, or super agonist of a naturally occurring y3 or ~i4 polypeptide, e.g., a naturally occurring Y3 or X34 polypeptide.
The method includes: altering the sequence of a y3 or ~i4 polypeptide, e.g., altering the sequence , e.g., by substitution or deletion of one or more residues of a non-conserved region, a domain or residue disclosed herein, and testing the altered polypeptide for the desired activity.

In another aspect, the invention features a method of making a fragment or analog of a y3 or (34 polypeptide having a biological activity of a naturally occurring y3 or [34 polypeptide. The method includes: altering the sequence, e.g., by substitution or deletion of one or more residues, of a y3 or (34 polypeptide, e.g., altering the sequence of a non-conserved region, or a domain or residue described herein, and testing the altered polypeptide for the desired activity.
In another aspect, the invention features, a human cell, e.g., a hematopoietic stem cell, transformed with nucleic acid which encodes a subject laminin polypeptide, e.g., a laminin 12, y3, a laminin trimer which inlcudes y3, (34, or a laminin trimer which includes ~i4.
In another aspect, the invention includes: a y3, ~i4 nucleic acid, e.g., a y3, /34 nucleic acid inserted into a vector; a cell transformed with a y3, ~i4 nucleic acid; a y3, (34 made by culturing a cell transformed with a y3, (34 nucleic acid; and a method of making a y3, [34 polypeptide including culturing a a cell transformed with a y3, (34 nucleic acid.
The inventors have shown that y3 forms laminin 12'in association with a2 and ail.
However, we are unsure of the chain associations of y3 within other tissues.
It is very likely that y3 can also associate with y3, a3, a4, and a5; with (32, ~i3, [34 and (35. Therefore, our results predict 25 new laminins: laminins 12-37. y3 and [i4 polypetides of the invention can be expressed with, assembled with, or administered with other laminin subunits in any of the methods described herein. E.g., y3 can be assembled with an a and a (3 subunit to form a laminin trimer. [34 can be assembled with an a and a (3 subunit to form a laminin trimer.
In any treatment or therapeutic application which administers y3, a (32 subunit can also be administered.
A "heterologous promoter", as used herein is a promoter which is not naturally associated with a gene or a purified nucleic acid.
A "purified"or "substantially pure" or isolated "preparation" of a polypeptide, as used herein, means a polypeptide that has been separated from other proteins, lipids, and nucleic acids with which it naturally occurs. Preferably, the polypeptide is also separated from substances, e.g., antibodies or gel matrix, e.g., polyacrylamide, which are used to purify it.
Preferably, the polypeptide constitutes at least 10, 20, 50 70, 80 or 95% dry weight of the purified preparation. Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 ~,g of the polypeptide; at least 1, 10, or 100 mg of the polypeptide.
A "purified preparation of cells", as used herein, refers to, in the case of plant or animal cells, an in vitro preparation of cells and not an entire intact plant or animal. In the case of cultured cells or microbial cells, it consists of a preparation of at least 10% and more preferably 50% of the subject cells.
A "treatment", as used herein, includes any therapeutic treatment, e.g., the administration of a therapeutic agent or substance, e.g., a drug.

An "isolated" or " pure nucleic acid", e.g., a substantially pure DNA, is a nucleic acid which is one or both of not immediately contiguous with either one or both of the sequences, e.g., coding sequences, with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA which is incorporated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences. Substantially pure DNA can also includes a recombinant DNA which is part of a hybrid gene encoding sequence.
"Sequence identity or homology", as used herein, refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous or sequence identical at that position. The percent of homology or sequence identity between two sequences is a function of the number of matching or homologous identical positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10, of the positions in two sequences are the same then the two sequences are 60% homologous or have 60% sequence identity.
By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology or sequence identity. Generally, a comparison is made when two sequences are aligned to give maximum homology.
The tenors "peptides", "proteins", and "polypeptides" are used interchangeably herein.
As used herein, the term "transgene" means a nucleic acid sequence {encoding, e.g., one or more subject laminin polypeptides), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of the selected nucleic acid, all operably linked to the selected nucleic acid, and may include an enhancer sequence.
As used herein, the term "transgenic cell" refers to a cell containing a transgene.
As used herein, a "transgenic animal" is any animal in which one or more, and preferably essentially all, of the cells of the animal includes a transgene.
The transgene can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. ~ -As used herein, the term "tissue-specific promoter" means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA
sequence in specific cells of a tissue, such as mammary tissue. The term also covers so-called "leaky"
promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.
"Unrelated to a y3 or (34 amino acid or nucleic acid sequence" means having less than 30% sequence identity, less than 20% sequence identity, or, preferably, less than 10%
homology with a naturally occuring y3 or (34 sequence disclosed herein.
A polypeptide has y3 biological activity if it has one or more of the properties of y3 disclosed herein. A polypeptide has biological activity if it is an antagonist, agonist, or super-agonist of a polypeptide having one of the properties of y3 disclosed herein.
A polypeptide has (34 biological activity if it has one or more of the properties of [34 disclosed herein. A polypeptide has biological activity if it is an antagonist, agonist, or super-agonist of a polypeptide having one of the properties of ~i4 disclosed herein.
"Misexpression", as used herein, refers to a non-wild type pattern of gene expression, at the RNA or protein level. It includes: expression at non-wild type levels, i.e., over or under expression; a pattern of expression that differs from wild type in terms of the time or stage at which the gene is expressed, e.g., increased or decreased expression (as compared with wild type) at a predetermined developmental period or stage; a pattern of expression that differs from wild type in terms of decreased expression (as compared with wild type) in a predetermined cell type or tissue type; a pattern of expression that differs from wild type in terms of the splicing size, amino acid sequence, post-transitional modification, or biological activity of the expressed polypeptide; a pattern of expression that differs from wild type in terms of the effect of an environmental stimulus or extracellular stimulus on expression of the gene, e.g., a pattern of increased or decreased expression (as compared with wild type) in the presence of an increase or decrease in the strength of the stimulus.
Subject, as used herein, can refer to a mammal, e.g., a human, or to an experimental or animal or disease model. The subject can also be a non-human animal, e.g., a horse, cow, goat, or other domestic animal.
As described herein, one aspect of the invention features a substantially pure (or recombinant) nucleic acid which includes a nucleotide sequence encoding a Y3 or ~i4 polypeptide and/or equivalents of such nucleic acids. The term nucleic acid as used herein can include fragments and equivalents. The term equivalent refers to nucleotide sequences encoding functionally equivalent polypeptides. Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as 5 allelic variants, and include sequences that differ from the nucleotide sequences disclosed herein by degeneracy of the genetic code.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art.
10 Such techniques are described in the literature. See, for example, Molecular Cloning A
Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985);
Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195;
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984);
Transcription And 15 Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I.
Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B.
Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology {Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H.
Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymolo~r, Vols. 154 20 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
DETAILED DESCRIPTION
The drawings are briefly described.
Figure 1 depicts the cDNA sequence for human a2 subunit.
Figure 2 depicts the predicted amino acid sequence for human a2 subunit.
Figure 3 depicts the cDNA sequence for human ø4 subunit.
Figure 4 depicts the predicted amino acid sequence for human ø4 subunit.
Figure 5 depicts an alignment of the amino acid sequence of human ø4 of SEQ ID
NO: 1 and ø4 splice varient of SEQ ID N0:5 and laminin ø1, ø2, and ø3 subunits.
Figure 6 provides a comparision of the similarities of laminin ø4 domains with the domains of other known laminin ø subunits.

WO 99/19348 PC'T/US98/21391 Lanvnin 12 was isolated from human placental chorionic villi. Briefly, human chorionic placental villi were frozen in liquid nitrogen, ground in a Waring blender and washed in 1 M NaCI. The final tissue pellet (200g, wet weight) was suspended in 1 L of extraction buffer (50 mM Tris-HCl 50 mM, pH=7.8; NaCI O.SM, EDTA IOmM, 625 mg/1 of N-ethylmaleimide, 150 mg/1 of phenyhnethylsulphonyl fluoride. The suspension was incubated at 4°C with stirring for 48 h. Unless otherwise noted, all subsequent steps were performed at 4oC. The soluble fraction was collected following centrifugation (30000 x g, 60 min) and precipitated by 300g11 of Ammonium Sulfate. The precipitated proteins were collected by centrifugation (30000 x g, 60 min) and redissolved into chromatography buffer (2M Urea, 25 mM NaCI, 5 mM EDTA, and 50 mM Tris-HCI, pH=7.8). The sample was then dialyzed against the same buffer. Following dialysis, 0.5 volumes of buffer equilibrated DEAE-cellulose (DE-52, Whatman) was added and the mixture shaken overnight.
Material not bound to DEAF-cellulose was collected by filtration on a Buchner fimnel (Whatman filter 4) and precipitated by addition of 300g/1 of ammonium sulfate. The proteins were collected by centrifugation (30000 x g, 60 min), redissolved in the Concanavalin-A
buffer (0.5 M
NaCI, 5 mM CaCl2, 5 mM MgCl2, and Tris-HCl 50 mM, pH=7.8) and dialyzed against the same buffer overnight. The fraction was applied to a 2.5 x 5 cm Concanavalin-A
sepharose column (Pharmacia), and unbound material was removed by extensive washing.
Bound proteins were first eluted with 10 mM a-D- Mannopyrannoside (Sigma, St. Louis, MO) and secondly with 1 M a-D-Glucopyrannoside (Sigma, St. Louis, MO). A third elution with 1M
a-D-Manno-pyrannoside (Sigma, St. Louis, MO) allowed the recovery of the proteins of interest. Each fraction was independently concentrated to 10 ml on a AmiconT""
concentrator (30 kDa membrane) and applied to a 2.5 x 100 cm Sephacryl S-500 column in a 0.5 M NaCI, 50 mM Tris-HCI, pH=7.8 buffer. The fractions of interest were pooled, dialyzed against Mono-Q buffer (0.1 M NaCI, 25 mM Tris-HCI, pH=7.8) and applied to the 1 x 5 cm Mono-Q
column (Pharmacia). Elution was achieved with a 60 ml 0.1-0.5 M NaCI gradient.
The final fraction of interest resulting from the above protocol contains multiple laminins. The laminin 12 was resolved from this mixture by SDS-PAGE (3-5%
polyacrylamide) under non-reducing conditions. Six band were resolved. Only the bands at approximately 560 kDa and at the top of the gel were shown to be reactive with polyclonal anti-laminin antiserum (Sigma, St. Louis, MO).
Laminin 12 was excised, equilibrated and reduced in 10°b 2-me SDS-PAGE
sample buffer, and resolved by 5 % SDS-PAGE. Three bands were resolved, which were approximately 205 kDa, 185 kDa, and 170 kDa. The band at 185 kDa reacted with monoclonal antibody 545, specific to the laminin ~i 1 subunit. Each of the three bands were digested with trypsin and the peptides were resolved by HPLC. The selected resolves were subject to peptide sequencing.
Protein sequencing was done according to Aebersold et al. (1987). The complex laminin 5-laminin 7 was run on a polyacrylamide gel in the presence of 2-mercaptoethanol and blotted onto a nitrocellulose membrane (Biorad). The 190 kDa band of ~i2 and the 165 kDa a3 band were separately excised and digested by protease trypsin. The digested product was separated by HPLC and one fragment was sequenced on an Applied Biosystems sequenator (Applied Biosystems, Foster City, CA). The 205 kDa chain contained a sequence identical to human laminin a2, and was thus identified as human laminin a2 subunit. The 185 kDa produced two peptides identical to human (31, and was thus identified as human laminin ~i 1 subunit. The band at 170 kDa contained three sequences not contained in any known laminin chain. A N-terminal sequence of the 170 kDa chain was also determined. In addition, the N-terminal sequence was not identical to any known laminin sequence.
The cDNA sequences of human yl and r2 were used to probe the National Center for Biomedical Information (NCBI) dBestTM data base by BLAST search and a clone was isolated that was homologous, but not identical to yl and y2. This clone was extended by PCR at the 5' end using Marathon cDNA from human placenta from Clonetech (Palo Alto, CA). The resulting sequence was determined to be 100% identical to all three of the 170 kDa band peptide sequences.
Comparison of the nucleotide sequence of the isolated y3 subunit to yl, demonstrated about 80 % sequence identity.
The human cDNA encoding y3, which is approximately 4710 nucleotides in length, encodes a protein having an estimated molecular weight of approximately 146 kDa (including post-translational modifications) and which is approximately 1570 amino acid residues in length. The human y3 protein contains a nidogen-binding domain, which can be found, for example, from about amino acids 750-755 of SEQ ID N0:3. The y3 amino acid sequence and the nucleotide sequence encoding human laminin y3 is shown in SEQ ID N0:3 and SEQ ID
N0:4, respectively.
By Northern analysis the size of the y3 mRNA is approximately 5 kb, which is consistent with other laminin y subunits. The y3 mRNA transcript is expressed in human tissues including spleen, testis, brain, placenta, lung, and possibly liver.
Chromosomal mapping using the y3 cDNA sequence indicates that the human y3 gene is located on WO 99/19348 PCT/US98lZ1391 chromosome 9q31-34. The location of y3 on chromosome 9 was confirmed by FISH
analysis using a 1.3 kb y3 cDNA probe within the predicted domains I and II, which are~the regions of the least sequence identity among y subunits. Four human genes associated with Walker-Walburg syndrome, Fukuyama muscular dystrophy, retinitis pigmentosa-deafness syndrome and Eye, Muscle, Brain disease have also been mapped to chromosome 9q31-34.
Production of a y3 specific antibody and tissue lo~~alization of ~
The 170 kDa (y3) chain was excised from the reducing SDS-PAGE gel described above and inj ected into a rabbit for antibody production. The resulting serum (rabbit 16) was evaluated by Western analysis and shown to react with the 170 kDa y3 chain, and showed minor crossreactivity with other laminin chains.
Using immunofluorescence, this antiserum shows localization of y3 to the following tissue areas: 1) sites of insertions of nerves into the dermal-epidermal junction basement membrane of human skin; 2) the inner nuclear layers, outer nuclear layers, and outer limiting membranes of human, mouse and rat neural retina; 3) the Purkinje cells, and molecular layers, and (perhaps) the glial cells of the mouse and rat cerebellum; 4) the neuromuscular junctions of skeletal muscle; and, S) the taste buds of the cow tongue.
The y3 was also shown to colocalize with protein ubiquitin carboxy terminal hydrolase I using antibody pGp 9.5. The y3 subunit also appears to colocalize with the a2 subunit in the same tissue sections.
Isolation and Sequencing of cDNA encodLng Q4 The initial 350 by fragment of human laminin (34 cDNA was amplified by touchdown RT-PCR from cultured human keratinocyte total RNA using nested primers made from the published chicken laminin (3 x 503 by cDNA sequence (as described in Ybot-Gonzalez et al. (1995)). Subsequent cDNA clones were isolated by nested PCR
directly from a human placenta cDNA library packaged in lambda-gtl 1 (Clontech, Palo Alto, CA) or by nested PCR directly from human placenta Marathon-Ready cDNA (Clontech, Palo Alto, CA).
The 5' end of the cDNA was cloned using the 5'-RACE technique from human placenta total RNA. The Expanded Long Template PCR System (Boehringer Mannheim Biochemicals, Indianapolis, Il~ was used for all PCR reactions. The PCR products were ligated into the pCR2.1 vector (Invitrogen, San Diego, CA) and recombinant plasmids purified for sequencing using the QIAprepT"" kit (Qiagen). The DNA sequence was determined using either the Sequenase version 2.0 DNA Sequencing Kit (Amersham) and 35S-dATP or the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit (Amersham) and 33p_ ddNTPs. At least two independent cDNA subclones were sequenced to rule out Taq polymerase-generated nucleotide substitutions. In some cases, PCR product bands were sequenced directly by cycle sequencing after excision from a TAE-EtBr agarose gel and purification using QIAquick Gel Extraction kit (Qiagen).

WO 99/19348 PCT/US98l21391 The human cDNA encoding a long form (34, which is approximately 5.87 kb, encodes a protein having an estimated molecular weight of approximately 200 kDa and which is approximately 1761 amino acid residues in length. The human (34 protein retains the highest amino acid sequence identity with domains VI and V, which can be found, for example, from about amino acids 221-262 and about 263-535 of SEQ ID NO:1. In addition, a short form, splice variant of (34, which is approximately 3.84 kb and an estimated molecular weight of 120 kDa, was also isolated. The splice variant has 132 nucleotide sequence identical to the long form of [34, with the sequence diverging at nucleotide 3375 and spliced into a unique 3' I 5 untranslated region. The short form cDNA encodes a truncated (34 subunit which contains only the short arm of the (34 subunit and is missing the domains necessary for heterodimerization. The (34 amino acid sequence and the nucleotide sequence encoding human laminin (34 is shown in SEQ ID NO:1 and SEQ ID N0:2, respectively.
Northern analysis was performed using total RNA prepared from JAR cell, cultured human keratinocytes and human placenta using either Trizol (Gibco BRL, Bethesda, MD) or RNeasyT"" (Qiagen) which was denatured, separated on a formaldehyde agarose gel and blotted onto nitrocellulose according to standard protocols (Sambrook, et al., 1989). In addition, A human multiple tissue northern blot (Clontech, Palo Alto, CA) and Human Northern Terntory normal tissue blots and custom fetal skin northern blot (Invitrogen, San Diego, CA) were used. Hybridization and washing were performed using NorthernMAXT""
buffer system (Ambion) by manufacturer's recommended protocols. 32P-dCTP-labelled probes were generated from gel-purified restriction fragments using RediprimeT"' random primer labeling kit (Amersham). 32P-UTP-labelled antisense RNA probes were generated using the RNA transcription kit (Stratagene, La Jolla, CA) from cDNAs subcloned into Bluescript II KS+ (Stratagene, La Jolla, CA).
Northern blotting showed that human laminin ~i4 is expressed in JAR cells, derived from undeveloped chronic villi and in placenta. By RT-PCR, it is also expressed in cultured keratinocytes. Using a northern blot of human fetal skin developmental progression, (34 subunit (long form) demonstrates strong expression at week twelve of fetal development and persists until birth, but expression is barely detectable in adult skin. The ~i4 splice variant, however, is expressed in various tissues including adult heart, brain, lung, liver, skeletal muscle, kidney, spleen, stomach, esophagus, intestine, colon, uterus, bladder, adipose tissue and pancreas. Chromosomal mapping with a (34 cDNA probe indicates that the human (34 subunit is located at locus 7q22-q31.2. The gene encoding (31 is located near, but not on, this position of chromosome 7. Statistical analysis of the mapping data using markers for ~i 1 and (34 suggest that the gene encoding ~i 1 is linked to both ends of the gene encoding ~i4. In addition, neonatal cutis laxa with manifold phenotype has been mapped near, but not in the same position, as the gene encoding (34.

In situ hybridization to wounded human skin grafted into nude mice suggests that laminin ~3 x is expressed in the dermis underneath the migrating epidermal tongues during wound closure.
A GenBankTM search using the human nucleotide sequence encoding [34 as shown in SEQ ID N0:3 revealed an EST, which corresponds to nucleotides 4686-5870 of the human 10 nucleotide sequence encoding (34 depicted in SEQ ID N0:3. Alignment of cDNA
encoding ~i4 with the genes encoding human laminin X31 and laminin (32 shows 61 % and 59% sequence identity, respectively, as shown in Figure 5.
Production of a (~4 specific antibodjr and ti ue local'~a ion of j~
15 Antibodies were raised in rabbits against a 26 kDa bacterial fusion protein which corresponds to the 175 amino acid residues of domain VI (e.g., from about amino acid residues 221-262) of SEQ ID NO:1. Briefly the fusion protein was made by PCR
amplification of nucleotides 302-785 of the cDNA encoding ~i4 using adapter primers and cloned in-frame into the NdeI and SacII sites of pET-15b (Novagen). The fusion protein 20 construct was confirmed by restriction mapping and DNA sequencing.
Expression of the fusion protein was induced and separated from E. coli proteins using reducing SDS-PAGE.
Bands corresponding to the fusion protein were excised from the gel, equilibrated and homogenized using Freud's adjuvant. The same fusion protein was also western blotted on nitrocellulose, dissolved in DMSO and used to immunize mice for monoclonal antibody 25 production.
The polyclonal antisera raised in mice against the fusion protein reacted well with (34, as well as, (31 and (32 polypeptides.
The (34 subunit contains six domains, and a interruption and a signal peptide.
The signal peptide and domain VI can be found, for example, at about amino acid residues 1-262 of SEQ ID NO:1. Domain V can be found, for example, at about amino acid residues 263-535 of SEQ ID NO:1. Domains IV and III can be found, for example, at about amino acid residues 536-767 and 768-1178 of SEQ ID NO:1, respectively. Domain I can be found, for example, at about amino acid residues 1409-1761 of SEQ ID NO:I.
The (34 suburut (long form) is most similar in size and domain structure to laminin (31 with an amino acid sequence identity of 42.5%. (34 retains the highest levels of amino acid identity with the other laminin ~3 subunits in domains VI and V, and the lowest levels in domains I and II, as shown in Figure 6. Using the MulticoilT"" program, it was determined that only domains I and II of (34 have a high probability of forming coiled coil structures.
Domains I and II of ~i4 look most similar to human (33. Both [34 and (i3 are epithelial and the coiled coil structures in domains I and II dictate the a and y subunits with which the ~i subunits are associated. Thus, it is likely that /34 associates with a3 and y2, as does the laminin (33 subunit.
The cDNA encoding the splice variant of ~i4 contains only the short arm of the (34 subunit, and is missing the EGF repeat of domain III, as shown in Figure 5.
Thus, the (34 polypeptide encoded by the [34 c DNA splice variant is missing the coiled coil structures in domains I and II, rendering the short subunit unable to associate into a laminin heterotrimer.
PCR amplification of human genomic DNA suggest that the exon which encodes the alternative short form 3' untranslated region is located downstream from the carboxyl-most common exon, exon 23, and is splices out of the (34 subunit, long form, by exon skipping.
Analogs o~r3 and ~
Analogs can differ from naturally occurring y3 or [34 in amino acid sequence or in ways that do not involve sequence, or both. Non-sequence modifications include in vivo or in vitro chemical derivatization of y3 or ~i4. Non-sequence modifications include changes in acetylation, methylation, phosphorylation, carboxylation, or glycosylation.
Preferred analogs include y3 or (34 (or biologically active fiagments thereof) whose sequences differ from the wild-type sequence by one or more conservative amino acid substitutions or by one or more non-conservative amino acid substitutions, deletions, or insertions which do not abolish the Y3 or (34 biological activity.
Conservative substitutions typically include the substitution of one amino acid for another with similar characteristics, e.g., substitutions within the following groups: valine, glycine; glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine;
serine, threonine;
lysine, arginine; and phenylalanine, tyrosine. Other conservative substitutions can be taken from the table below.

CONSERVATIVE AMINO ACID REPLACEMENTS
For Amino Acid Code Replace with any of Alanine A D-Ala, Gly, beta-Ala, L-Cys, D-Cys Arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, Met, Ile, D-Met, D-Ile, Orn, D-Orn Asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln Aspartic Acid D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr Glutamine Q D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp Glutamic Acid E D-GIu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln Glycine G Ala, D-Ala, Pro, D-Pro, (3-Ala, Acp ~i Isoleucine I D-Ile, VaI, D-Val, Leu, D-Leu, Met, D-Met I Leucine L D-Leu, Val, D-Val, Leu, D-Leu, Met, D-Met Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-Ile, Orn, D-Orn Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu, Val, D-Val Phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D-Trp, Trans-3,4, or 5-phenylproline, cis-3,4, or 5-phenylproline Proline P D-Pro, L-I-thioazolidine-4-carboxylic acid, D-or L-1-oxazolidine-4-carboxylic acid Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, Met(O), D-Met(O), L-Cys, D-Cys Threonine . T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, Met(O), D-Met(O), Val, D-Val Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met Other analogs within the invention are those with modifications which increase peptide stability; such analogs may contain, for example, one or more non-peptide bonds (which replace the peptide bonds) in the peptide sequence. Also included are:
analogs that include residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., [i or y amino acids; and cyclic analogs.
Geny Theranv zs The gene constructs of the invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic form of a Y3 ar (3 4 polypeptide. The invention features expression vectors for in vivo transfection and expression of a y3 or ~i4 polypeptide in particular cell types so as to reconstitute the function of, or alternatively, antagonize the function of y3 or (i4 polypeptide in a cell in which that polypeptide is misexpressed. Expression constructs of y3 or (34 polypeptides, may be administered in any biologically effective carrier, e.g. any formulation or composition capable of effectively delivering the Y3 or ~i4 gene to cells in vivo.
Approaches include insertion of the subject gene in viral vectors including recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus-l, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered with the help of, for example, cationic liposomes (lipofectin) or derivatized (e.g. antibody conjugated), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaP04 precipitation carried out in vivo.
A preferred approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g. a cDNA, encoding a y3 or (34 polypeptide. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid.
Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans.
These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. The development of specialized cell lines (termed "packaging cells") which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A.D.
( 1990) Blood 76:271 ). A replication defective retrovirus can be packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques.
Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Cu_r_rent Protocols in Molecul r ioloev, Ausubel, F.M. et aI. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE
and pEM
which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include yrCrip, y~Cre, yr2 and yr Am. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad Sci. USA
85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. ( 1991 ) Proc. Natl.
Acad Sci. USA
88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381;
Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl.
Acad. Sci. USA
89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al.
(1992) Proc.
Natl. Acad Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S.
Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCT Application WO 89/07136;
PCT
Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO
92/07573).
Another viral gene delivery system useful in the present invention utilizes adenovirus-derived vectors. The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al. (1988) BioTechnigues 6:616;
Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 d1324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are known to those skilled in the art.
Recombinant adenoviruses can be advantageous in certain circumstances in that they are not capable of infecting nondividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al. (1992) cited supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267).
Yet another viral vector system useful for delivery of the subject gene is the adeno-associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al.
Curr. Topics in Micro. and Immunol. (1992) 158:97-129). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (see for example Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356;
Samulski et al. (1989) J. Virol. 63:3822-3828; and McLaughlin et al. (1989) J. Virol. 62:1963-1973).
Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce DNA into cells.
A variety of nucleic acids have been introduced into different cell types using AAV vectors 5 (see for example Hermonat et al. ( 1984) Proc. Natl. Acad Sci. USA 81:6466-6470; Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al. (1988) Mol.
Endocrinol. 2~32-39; Tratschin et al. (1984) J. Yirol. 51:611-619; and Flotte et al. (1993) J.
Biol. Chem.
268:3781-3790).
In addition to viral transfer methods, such as those illustrated above, non-viral 10 methods can also be employed to cause expression of a y3 or (34 polypeptide in the tissue of an animal. Most nonviral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules.
In preferred embodiments, non-viral gene delivery systems of the present invention rely on endocytic pathways for the uptake of the subject y3 or ~i4 gene by the targeted cell.
Exemplary gene 15 delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
In a representative embodiment, a gene encoding a y3 or (34 polypeptide can be entrapped in liposomes bearing positive charges on their surface (e.g., lipofectins) and (optionally) which are tagged with antibodies against cell surface antigens of the target tissue 20 (Mizuno et al. (1992) No Shinkei Geka 20:547-551; PCT publication W091/06309;
Japanese patent application 1047381; and European patent publication EP-A-43075).
In clinical settings, the gene delivery systems for the therapeutic y3 or ~i4 gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art.
For instance, a pharmaceutical preparation of the gene delivery system can be introduced 25 systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof. In other embodiments, initial delivery of the recombinant gene is more limited with introduction into 30 the animal being quite localized. For example, the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by Stereotactic injection (e.g. Chen et al. (1994) PNAS
91: 3054-3057).
The pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery system can be produced in tact from recombinant cells, e.g.
retroviral vectors, the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
Transgenic nimal_s The invention includes transgenic animals which include cells (of that animal) which contain a y3 or (34 transgene and which preferably (though optionally) express (or misexpress) an endogenous or exogenous y3 or ~i4 gene in one or more cells in the animal.

The y3 or (34 transgene can encode the wild-type form of the protein, or can encode homologs thereof, including both agonists and antagonists, as well as antisense constructs: In preferred embodiments, the expression of the transgene is restricted to specific subsets of cells, or tissues utilizing, for example, cis-acting sequences that control expression in the desired pattern. Tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the transgene in certain spatial patterns, e.g., to restrict production to the milk or other secreted product of the animal.
Fragments of a protein can be produced in several ways, e.g., recombinantly, by proteolytic digestion, or by chemical synthesis. Internal or terminal fragments of a polypeptide can be generated by removing one or more nucleotides from one end (for a terminal fragment) or both ends (for an internal fragment) of a nucleic acid which encodes the polypeptide. Expression of the mutagenized DNA produces polypeptide fragments.
Digestion with "end-nibbling" endonucleases can thus generate DNA's which encode an array of fragments. DNA's which encode fragments of a protein can also be generated by random shearing, restriction digestion or a combination of the above-discussed methods.
Fragments can also be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f Moc or t-Boc chemistry. For example, peptides of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or divided into overlapping fragments of a desired length.
Amino acid sequence variants of a protein can be prepared by random mutagenesis of DNA which encodes a protein or a particular domain or region of a protein.
Useful methods include PCR mutagenesis and saturation mutagenesis. A library of random amino acid sequence variants can also be generated by the synthesis of a set of degenerate oligonucleotide sequences. (Methods for screening proteins in a library of variants are elsewhere herein.) PCR Mutagenesis In PCR mutagenesis, reduced Taq polymerise fidelity is used to introduce random mutations into a cloned fragment of DNA (Leung et al., 1989, Technique 1:11-15). This is a very powerful and relatively rapid method of introducing random mutations. The DNA
region to be mutagenized is amplified using the polymerise chain reaction (PCR) under conditions that reduce the fidelity of DNA synthesis by Taq DNA polymerise, e.g., by using a dGTP/dATP ratio of five and adding Mn2+ to the PCR reaction. The pool of amplified DNA fragments are inserted into appropriate cloning vectors to provide random mutant libraries.
Saturation Mutagenesis Saturation mutagenesis allows for the rapid introduction of a large number of single base substitutions into cloned DNA fragments (Mayers et al., 1985, Science 229:242). This technique includes generation of mutations, e.g., by chemical treatment or irradiation of single-stranded DNA in vitro, and synthesis of a complimentary DNA strand. The mutation frequency can be modulated by modulating the severity of the treatment, and essentially all possible base substitutions can be obtained. Because this procedure does not involve a genetic selection for mutant fragments both neutral substitutions, as well as those that alter function, are obtained. The distribution of point mutations is not biased toward conserved sequence elements.
Degenerate Oligonucleotides A library of homologs can also be generated from a set of degenerate oligonucleotide sequences. Chemical synthesis of a degenerate sequences can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector.
The synthesis of degenerate oligonucleotides is known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp273-289; Itakura et al.
(1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477. Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott et al. (1990) Science 249:386-390;
Roberts et al.
(1992) PNAS 89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et al. (1990) PNAS 87: 6378-6382; as well as U.S. Patents Nos. 5,223,409, 5,198,346, and 5,096,815).
Non-random or directed, mutagenesis techniques can be used to provide specific sequences or mutations in specific regions. These techniques can be used to create variants which include, e.g., deletions, insertions, or substitutions, of residues of the known amino acid sequence of a protein. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conserved amino acids and then with more radical choices depending upon results achieved, (2) deleting the target residue, or (3) inserting residues of the same or a different class adjacent to the located site, or combinations of options 1-3.
Alanine Scanning Mutagenesis S Alanine scanning mutagenesis is a useful method for identification of certain residues or regions of the desired protein that are preferred locations or domains for mutagenesis,-Cunningham and Wells (Science 244:1081-1085, 1989}. In alanine scanning, a residue or group of target residues are identified (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) and replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine). Replacement of an amino acid can affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell. Those domains demonstrating functional sensitivity to the substitutions are then refined by introducing further or other variants at or for the sites of substitution. Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to optimize the performance of a mutation at a given site, alanine scanning or random mutagenesis may be conducted at the target codon or region and the expressed desired protein subunit variants are screened for the optimal combination of desired activity.
Oligonucleotide-Mediated Mutagenesis Oligonucleotide-mediated mutagenesis is a useful method for preparing substitution, deletion, and insertion variants of DNA, see, e.g., Adehnan et al., (DNA
2:183, 1983).
Briefly, the desired DNA is altered by hybridizing an oligonucleotide encoding a mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native DNA sequence of the desired protein. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the desired protein DNA. Generally, oligonucleotides of at least 25 nucleotides in length are used. An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side of the nucleotides) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule. The oligonucleotides are readily synthesized using techniques known in the art such as that described by Crea et al. (Proc. Natl.
Acad. Sci. USA, 75: 5765[1978]).
Cassette Mutagenesis Another method for preparing variants, cassette mutagenesis, is based on the technique described by Wells et al. (Gene, 34:315[1985]). The starting material is a plasmid (or other vector) which includes the protein subunit DNA to be mutated. The codon(s) in the protein subunit DNA to be mutated are identified. There must be a unique restriction endonuclease site on each side of the identified mutation site(s). If no such restriction sites exist, they may be generated using the above-described oligonucleotide-mediated mutagenesis method to introduce them at appropriate locations in the desired protein subunit DNA. After the restriction sites have been introduced into the plasmid, the plasmid is cut at these sites to linearize it. A double-stranded oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutations) is synthesized using standard procedures. The two strands are synthesized separately and then hybridized together using standard techniques. This double-stranded oligonucleotide is referred to as the cassette.
This cassette is designed to have 3' and 5' ends that are comparable with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid. This plasmid now contains the mutated desired protein subunit DNA sequence.
Combinatorial Mutagenesis Combinatorial mutagenesis can also be used to generate mutants. E.g., the amino acid sequences for a group of homologs or other related proteins are aligned, preferably to promote the highest homology possible. All of the amino acids which appear at a given position of the aligned sequences can be selected to create a degenerate set of combinatorial sequences. The variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library. For example, a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential sequences are expressible as individual peptides, or alternatively, as a set of larger fusion proteins containing the set of degenerate sequences.
Primalv High-Through-Put Me hod for greening Libraries of Peg it de Fra n . or Various techniques are known in the art for screening generated mutant gene products.
Techniques for screening large gene libraries often include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the genes under conditions in which detection of a desired activity, e.g., in this case, binding to other laminin subunits, assembly into a trimeric laminin molecules, binding to natural ligands or substrates, facilitates relatively easy isolation of the vector encoding the gene whose product was detected. Each of the techniques described below is amenable to high through-put analysis for screening large numbers of sequences created, e.g., by random mutagenesis techniques.
Two Hybrid Systems Two hybrid assays such as the system described above (as with the other screening methods described herein), can be used to identify fragments or analogs. These may include agonists, superagonists, and antagonists. (The subject protein and a protein it interacts with are used as the bait protein and fish proteins.) .
Display Libraries 5 In one approach to screening assays, the candidate peptides are displayed on the surface of a cell or viral particle, and the ability of particular cells or viral particles to bind an appropriate receptor protein via the displayed product is detected in a "panning assay". For example, the gene library can be cloned into the gene for a surface membrane protein of a bacterial cell, and the resulting fusion protein detected by panning (Ladner et al., WO
10 88/06630; Fuchs et al. (1991) BiolTechnology 9:1370-1371; and Goward et al.
(1992) TIBS
18:136-140). In a similar fashion, a detectably labeled ligand can be used to score for potentially functional peptide homologs. Fluorescently labeled ligands, e.g., receptors, can be used to detect homolog which retain ligand-binding activity. The use of fluorescently labeled ligands, allows cells to be visually inspected and separated under a fluorescence microscope, 15 or, where the morphology of the cell permits, to be separated by a fluorescence-activated cell sorter.
A gene library can be expressed as a fusion protein on the surface of a viral particle.
For instance, in the filamentous phage system, foreign peptide sequences can be expressed on the surface of infectious phage, thereby conferring two significant benefits.
First, since these 20 phage can be applied to affinity matrices at concentrations well over 1013 phage per milliliter, a large number of phage can be screened at one time. Second, since each infectious phage displays a gene product on its surface, if a particular phage is recovered from an affinity matrix in low yield, the phage can be amplified by another round of infection.
The group of almost identical E. coli filamentous phages M13, fd., and fl are most often used in phage 25 display libraries. Either of the phage gIII or gVIII coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle. Foreign epitopes can be expressed at the NH2-terminal end of pIII and phage bearing such epitopes recovered from a large excess of phage lacking this epitope (Ladner et al. PCT
publication WO 90/02909; Garrard et al., PCT publication WO 92/09690; Marks et al. (1992) J. Biol.
30 Chem. 267:16007-16010; Griffiths et al. (1993} EMBO J 12:725-734; Clackson et al. (1991) Nature 352:624-628; and Barbas et al. (1992) PNAS 89:4457-4461).
A common approach uses the maltose receptor of E. coli (the outer membrane protein, Lama) as a peptide fusion partner (Charbit et al. (1986) EMBO 5, 3029-3037).
Oligonucleotides have been inserted into plasmids encoding the Lama gene to produce 35 peptides fused into one of the extracellular loops of the protein. These peptides are available for binding to ligands, e.g., to antibodies, and can elicit an immune response when the cells are administered to animals. Other cell surface proteins, e.g., OmpA (Schorr et al. (1991) Vaccines 91, pp. 387-392), PhoE (Agterberg, et al. {1990) Gene 88, 37-45}, and PAL (Fuchs et al. (1991) BiolTech 9, 1369-1372), as well as large bacterial surface structures have served as vehicles for peptide display. Peptides can be fused to pilin, a protein which polymerizes to form the pilus-a conduit for interbacterial exchange of genetic information (Thiry et al.
(1989) Appl. Environ. Microbiol. 55, 984-993). Because of its role in interacting with other cells, the pilus provides a useful support for the presentation of peptides to the extracellular environment. Another large surface structure used for peptide display is the bacterial motive organ, the flagellum. Fusion of peptides to the subunit protein flagellin offers a dense array of may peptides copies on the host cells (Kuwajima et al. (1988) BiolTech. 6, 1080-1083).
Surface proteins of other bacterial species have also served as peptide fusion partners.
Examples include the Staphylococcus protein A and the outer membrane protease IgA of Neisseria (Hansson et al. (1992) J. Bacteriol. 174, 4239-4245 and Klauser et al. (1990) EMBO J. 9, 1991-1999}.
In the filamentous phage systems and the Lama system described above, the physical link between the peptide and its encoding DNA occurs by the containment of the DNA within a particle (cell or phage) that carries the peptide on its surface. Capturing the peptide captures the particle and the DNA within. An alternative scheme uses the DNA-binding protein LacI
to form a link between peptide and DNA (Cull et al. (1992) PNAS USA 89:1865-1869). This system uses a plasmid containing the LacI gene with an oligonucleotide cloning site at its 3'-end. Under the controlled induction by arabinose, a LacI-peptide fusion protein is produced.
This fusion retains the natural ability of LacI to bind to a short DNA
sequence known as LacO operator (LacO). By installing two copies of LacO on the expression plasmid, the LacI-peptide fusion binds tightly to the plasmid that encoded it. Because the plasmids in each cell contain only a single oligonucleotide sequence and each cell expresses only a single peptide sequence, the peptides become specifically and stably associated with the DNA
sequence that directed its synthesis. The cells of the library are gently lysed and the peptide-DNA complexes are exposed to a matrix of immobilized receptor to recover the complexes containing active peptides. The associated plasmid DNA is then reintroduced into cells for amplification and DNA sequencing to determine the identity of the peptide ligands. As a demonstration of the practical utility of the method, a large random library of dodecapeptides was made and selected on a monoclonal antibody raised against the opioid peptide dynorphin B. A cohort of peptides was recovered, all related by a consensus sequence corresponding to a six-residue portion of dynorphin B. (Cull et al. (1992) Proc. Natl. Aced.
Sci. U.S.A. 89-1869) This scheme, sometimes referred to as peptides-on-plasmids, differs in two important ways from the phage display methods. First, the peptides are attached to the C-terminus of the fusion protein, resulting in the display of the library members as peptides having free carboxy termini. Both of the filamentous phage coat proteins, pIII and pVIII, are anchored to the phage through their C-termini, and the guest peptides are placed into the outward-extending N-terminal domains. In some designs, the phage-displayed peptides are presented right at the amino terminus of the fusion protein. (Cwirla, et al. (1990) Proc. Natl. Aced. Sci.
U.S A. 87, 6378-6382) A second difference is the set of biological biases affecting the population of peptides actually present in the libraries. The LacI fusion molecules are confined to the cytoplasm of the host cells. The phage coat fusions are exposed briefly to the cytoplasm during translation but are rapidly secreted through the inner membrane into the periplasmic compartment, remaining anchored in the membrane by their C-terminal hydrophobic domains, with the N-termini, containing the peptides, protruding into the periplasm while awaiting assembly into phage particles. The peptides in the LacI and phage libraries may differ significantly as a result of their exposure to different proteoLytic activities.
The phage coat proteins require transport across the inner membrane and signal peptidase processing as a prelude to incorporation into phage. Certain peptides exert a deleterious effect on these processes and are underrepresented in the libraries (Gallop et al. (1994) J.
Med. Chem. 37(9):1233-1251). These particular biases are not a factor in the LacI display system.
The number of small peptides available in recombinant random libraries is enormous.
Libraries of 10~-109 independent clones are routinely prepared. Libraries as large as 1011 recombinants have been created, but this size approaches the practical limit for clone libraries. This limitation in Library size occurs at the step of transforming the DNA
containing randomized segments into the host bacterial cells. To circumvent this limitation, an in vitro system based on the display of nascent peptides in polysome complexes has recently been developed. This display library method has the potential of producing libraries 3-6 orders of magnitude larger than the currently available phage/phagemid or plasmid Libraries. Furthermore, the construction of the libraries, expression of the peptides, and screening, is done in an entirely cell-free format.
In one application of this method (Gallop et a1. (1994) J. Med Chem.
37(9):1233-1251 ), a molecular DNA library encoding 1012 decapeptides was constructed and the library expressed in an E. coli S30 in vitro coupled transcription/translation system.
Conditions were chosen to stall the ribosomes on the mRNA, causing the accumulation of a substantial proportion of the RNA in polysomes and yielding complexes containing nascent peptides still linked to their encoding RNA. The polysomes are sufficiently robust to be affinity purified on immobilized receptors in much the same way as the more conventional recombinant peptide display Libraries are screened. RNA from the bound complexes is recovered, converted to cDNA, and amplified by PCR to produce a template for the next round of synthesis and screening. The polysome display method can be coupled to the phage display system. Following several rounds of screening, cDNA from the enriched pool of polysomes was cloned into a phagemid vector. This vector serves as both a peptide expression vector, displaying peptides fused to the coat proteins, and as a DNA sequencing vector for peptide identification. By expressing the polysome-derived peptides on phage, one can either continue the affinity selection procedure in this format or assay the peptides on individual clones for binding activity in a phage ELISA, or for binding specificity in a completion phage ELISA (Barnet, et al. (1992) Anal. Biochem 204,357-364). To identify the sequences of the active peptides one sequences the DNA produced by the phagemid host.

The high through-put assays described above can be followed by secondary screens in order to identify further biological activities which will, e.g., allow one skilled in the art-to differentiate agonists from antagonists. The type of a secondary screen used will depend on the desired activity that needs to be tested. For example, an assay can be developed in which the ability to inhibit an interaction between a protein of interest and its respective ligand can be used to identify antagonists from a group of peptide fragments isolated though one of the primary screens described above.
Therefore, methods for generating fragments and analogs and testing them for activity are known in the art. Once the core sequence of interest is identified, it is routine to perform for one skilled in the art to obtain analogs and fragments.
P~ntide Mimetics The invention also provides for reduction of the protein binding domains of the subject y3 or (34 polypeptides to generate mimetics, e.g. peptide or non-peptide agents. See, for example, "Peptide inhibitors of human papillomavirus protein binding to retinoblastoma gene protein" European patent applications EP-412,762A and EP-B31,080A.
Non-hydrolyzable peptide analogs of critical residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffinan et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides:
Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto-methylene pseudopeptides (Ewenson et al. (1986) JMed Chem 29:295; and Ewenson et al. in Peptides:
Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), (3-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. ( 1986) J Chem Soc Perkin Trans 1:1231 ), and (3-aminoalcohols (Gordon et al. (1985) Biochem Biophys Res Commun126:419; and Dann et al.
(1986) Biochem Biophys Res Commun 134:71).
~~ntibodies The invention also includes antibodies specifically reactive with a subject y3 or (34 polypeptides. Anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
Antibodies which specifically bind y3 or (34 epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and pattern of expression of y3 or [34. Anti y3 or (34 antibodies can be used diagnostically in S immuno-precipitation and immuno-blotting to detect and evaluate y3 or ~i4 levels in tissue or bodily fluid as part of a clinical testing procedure.
Another application of antibodies of the present invention is in the immunological screening of cDNA libraries constructed in expression vectors such as ~,gtl l, ~.gtl8-23, 7v.ZAP, and ~,ORF8. Messenger libraries of this type, having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins. For instance, ~,gtl l will produce fusion proteins whose amino termini consist of 13-galactosidase amino acid sequences and whose carboxy tenmini consist of a foreign polypeptide. Antigenic epitopes of a subject polypeptide can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with antibodies of the invention. Phage, scored by this assay, can then be isolated from the infected plate. Thus, the presence of homologs can be detected and cloned from other animals, and alternate isoforms (including splicing variants) can be detected and cloned from human sources.
Other Embodiments Included in the invention are: allelic variations; natural mutants; induced mutants;
proteins encoded by DNA that hybridizes under high or low stringency conditions to a nucleic acid which encodes a polypeptide of SEQ ID NO:1 or SEQ ID N0:3 (for definitions of high and low stringency see Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989, 6.3.1 - 6.3.6, hereby incorporated by reference); and, polypeptides specifically bound by antisera to Y3 or ~i4.
Nucleic acids and polypeptides of the invention includes those that differ from the sequences discolosed herein by virtue of sequencing errors in the disclosed sequences.
The invention also includes fragments, preferably biologically active fragments, or analogs of y3 or ~i4. A biologically active fragment or analog is one having any in vivo or in vitro activity which is characteristic of they3 or (34 shown in SEQ ID N0:3 and SEQ ID
NO:1, respectively, or of other naturally occurring y3 or (34, e.g., one or more of the biological activities described above. Especially preferred are fragments which exist in vivo, e.g., fragments which arise from post transcriptional processing or which arise from translation of alternatively spliced RNA's. Fragments include those expressed in native or endogenous cells, e.g., as a result of post-translational processing, e.g., as the result of the removal of an amino-terminal signal sequence, as well as those made in expression systems, e.g., in CHO cells. Particularly preferred fragments are fragments, e.g., active fragments, which are generated by proteolytic cleavage or alternative splicing events.

Other embodiments are within the following claims.
What is claimed is:

WO 99/19348 PCT/US98lZ1391 S SEQUENCE LISTING
(1) GENERAL INFORMATION:
ld (i) APPLICANT: Burgeson, Robert, et al.

(ii) TITLE OF INVENTION: DNA Sequences (iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: LAHIVE & COCKFIELD

(B) STREET: 28 State Street (C) CITY: Boston 20 (D) STATE: Massachusetts (E) COUNTRY: USA

(F) ZIP: 02109 (v) COMPUTER READABLE FORM:
ZS (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 3O (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US 000000 (B) FILING DATE: 13-APR-1994 (C) CLASSIFICATION:
3S (vii) PRIOR
APPLICATION
DATA:

(A) APPLICATION NUMBER: US 08/111,111 (B) FILING DATE: 12-DEC-1909 (viii) ATTORNEY/AGENT
INFORMATION:

40 (A) NAME: Attorney, Name Init (B} REGISTRATION NUMBER: 000000 (C) REFERENCE/DOCKET NUMBER:
oe (ix) TELECOMMUNICATION
INFORMATION:

4S (A) TELEPHONE: (617)227-7400 (B) TELEFAX: (617)742-4214 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1761 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear SS
(ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:

$ Met Gln Phe Gln Leu Thr Leu Phe Leu His Leu Gly Trp Leu Ser Tyr Ser Lys Ala Gln Asp Asp Cys Asn Arg Gly Ala Cys His Pro Thr Thr Gly Asp Leu Leu Val Gly Arg Asn Thr Gln Leu Met Ala Ser Ser Thr Cys Gly Leu Ser Arg Ala Gln Lys Tyr Cys Ile Leu Ser Tyr Leu Glu 1$ 50 55 60 Gly Glu Gln Lys Cys Ser Ile Cys Asp Ser Arg Phe Pro Tyr Aap Pro Tyr Asp Gln Pro Asn Ser His Thr Ile Glu Asn Val Thr Val Ser Phe G1u Pro Asp Arg Glu Lys Lys Trp Trp Gln Ser Glu Asn Gly Leu Asp 2$
His Val Ser Ile Arg Leu Asp Leu Glu Ala Leu Phe Arg Phe Ser His Leu Ile Leu Thr Phe Lys Thr Phe Arg Pro Ala Ala Met Leu Val Glu Arg Ser Thr Asp Tyr Gly His Asn Trp Lys Val Phe Lys Tyr Phe Ala 3$ Lys Asp Cys Ala Thr Ser Phe Pro Asn Ile Thr Ser Gly Gln Ala Gln Gly Val Gly Asp Ile Val Cys Asp Ser Lys Tyr Ser Asp Ile Glu Pro Ser Thr Gly Gly Glu Val Val Leu Lys Val Leu Asp Pro Ser Phe Glu Ile Glu Asn Pro Tyr Ser Pro Tyr Ile Gln Asp Leu Val Thr Leu Thr 4$ 210 215 220 Asn Leu Arg Ile Asn Phe Thr Lys Leu His Thr Leu Gly Asp Ala Leu $0 Leu Gly Arg Arg Gln Asn Asp Ser Leu Asp Lys Tyr Tyr Tyr Ala Leu Tyr Glu Met Ile Val Arg Gly Ser Cys Phe Cys Asn Gly His Ala Ser $$
Glu Cys Arg Pro Met Gln Lys Met Arg Gly Asp Val Phe Ser Pro Pro Gly Met Val His Gly Gln Cys Val Cys Gln His Asn Thr Asp Gly Pro Asn Cys Glu Arg Cys Lys Asp Phe Phe Gln Asp Ala Pro Trp Arg Pro Ala Ala Asp Leu Gln Asp Asn Ala Cys Arg Ser Cys Ser Cys Asn.Ser His Ser Ser Arg Cys His Phe Aap Met Thr Thr Tyr Leu Ala Ser Gly Gly Leu Ser Gly Gly Val Cys Glu Asp Cys Gln His Asn Thr Glu Gly 1$ Gln His Cys Asp Arg Cys Arg Pro Leu Phe Tyr Arg Asp Pro Leu Lys Thr Ile Ser Asp Pro Tyr Ala Cys Ile Pro Cys Glu Cys Asp Pro Asp Gly Thr Ile Ser Gly Gly Ile Cys Val Ser His Ser Asp Pro Ala Leu Gly Ser Val Ala Gly Gln Cys Leu Cys Lys Glu Asn Val Glu Gly Ala 2$ 420 425 430 Lys Cys Aap Gln Cys Lys Pro Asn His Tyr Gly Leu Ser Ala Thr Asp Pro Leu Gly Cys Gln Pro Cys Asp Cys Asn Pro Leu Gly Ser Leu Pro Phe Leu Thr Cys Aep Val Asp Thr Gly Gln Cys Leu Cys Leu Ser Tyr Val Thr Gly Ala His Cys Glu Glu Cys Thr Val Gly Tyr Trp Gly Leu Gly Asn His Leu His Gly Cys Ser Pro Cys Asp Cys Asp Ile Gly Gly Ala Tyr Ser Asn Val Cys Ser Pro Lys Asn Gly Gln Cys Glu Cys Arg 4$ Pro His Val Thr Gly Arg Ser Cys Ser Glu Pro Ala Pro Gly Tyr Phe $d Phe Ala Pro Leu Asn Phe Tyr Leu Tyr Glu Ala Glu Glu Ala Thr Thr Leu Gln Gly Leu Ala Pro Leu Gly Ser Glu Thr Phe Gly Gln Ser Pro Ala Val His Val Val Leu Gly Glu Pro Val Pro Gly Asn Pro Val Thr $$ 580 585 590 Trp Thr Gly Pro Gly Phe Ala Arg Val Leu Pro Gly Ala Gly Leu Arg 60 Phe Ala Val Asn Asn Ile Pro Phe Pro Val Asp Phe Thr Ile Ala Ile His Tyr Glu Thr Gln Ser Ala Ala Asp Trp Thr Val Gln Ile Val Val $ 625 630 635 640 Asn ProProGlyGly SerGluHis CysIlePro LysThrLeu Gln.Ser w Lys ProGlnSerPhe AlaLeuPro AlaAlaThr ArgIleMet LeuLeu Pro ThrProIleCys LeuGluPro AspValGln TyrSerIle AspVal 1$

Tyr PheSerGlnPro LeuGlnGly GluSerHis AlaHisSer HisVal Leu ValAspSerLeu GlyLeuIle ProGlnIle AsnSerLeu GluAsn Phe CysSerLysGln AspLeuAsp GluTyrGln LeuHisAsn CysVal 2$ Glu IleAlaSerAla MetGlyPro GlnValLeu ProGlyAla CysGlu Arg LeuIleIleSer MetSerAla LysLeuHis AspGlyAla ValAla Cys LysCysHisPro GlnGlySer ValGlySer SerCysSer ArgLeu Gly GlyGlnCysGln CysLysPro LeuValVal GlyArgCys CysAsp 3$ 785 790 795 800 Arg CysSerThrGly SerTyrAsp LeuGlyHis HisGlyCys HisPro Cys HisCysHisPro GlnGlySer LysAspThr Va1CysAsp GlnVal Thr GlyGlnCysPro CysHisGly GluValSer GlyArgArg CysAsp 4$

Arg CysLeuAlaGly TyrPheGly PheProSer CysHisPro CysPro Cys AsnArgPheAla GluLeuCys AspProGlu ThrGlySer CysPhe $0 865 870 875 880 Asn CysGlyGlyPhe ThrThrGly ArgAenCys GluArgCys IleAsp $$ Gly TyrTyrGlyAsn ProSerSer GlyGlnPro CysArgPro CysLeu Cys ProAspAspPro SerSerAsn GlnTyrPhe AlaHisSer CysTyr Gln AsnLeuTrpSer SerAspVal IleCysAsn CysLeuGln GlyTyr $ Thr Gly Thr Gln Cys Gly Glu Cys Ser Thr Gly Phe Tyr Gly Asn Pro Arg Ile Ser Gly Ala Pro Cys Gln Pro Cys Ala Cys Asn Asn Asn Ile Asp Val Thr Asp Pro Glu Ser Cys Ser Arg Val Thr Gly Glu Cys Leu Arg Cys Leu His Asn Thr Gln Gly Ala Asn Cys Gln Leu Cys Lys Pro 1$ 995 1000 1005 Gly His Tyr Gly Ser Ala Leu Asn Gln Thr Cys Arg Arg Cys Ser Cys His Ala Ser Gly Val Ser Pro Met Glu Cys Pro Pro Gly Gly Gly Ala Cys Leu Cys Asp Pro Val Thr Gly Ala Cys Pro Cys Leu Pro Asn Val 2$
Thr Gly Leu Ala Cys Asp Arg Cys Ala Asp Gly Tyr Trp Asn Leu Val Pro Gly Arg Gly Cys Gln Ser Cys Asp Cys Asp Pro Arg Thr Ser Gln Ser Ser His Cys Asp Gln Leu Thr Gly Gln Cys Pro Cys Lys Leu Gly 3$ Tyr Gly Gly Lys Arg Cys Ser Glu Cys Gln Glu Asn Tyr Tyr Gly Asp Pro Pro Gly Arg Cys Ile Pro Cys Asp Cys Asn Arg Ala Gly Thr Gln Lys Pro Ile Cys Asp Pro Asp Thr Gly Met Cys Arg Cys Arg Glu Gly Val Ser Gly Gln Arg Cys Asp Arg Cys Ala Arg Gly His Ser Gln Glu 4$ 1155 1160 1165 Phe Pro Thr Cys Leu Gln Cys His Leu Cys Phe Asp Gln Trp Asp His $0 Thr Ile Ser Ser Leu Ser Lys Ala Val Gln Gly Leu Met Arg Leu Ala Ala Asn Met Glu Asp Lys Arg Glu Thr Leu Pro Val Cys Glu Ala Asp $$
Phe Lys Asp Leu Arg Gly Asn Val Ser Glu Ile Glu Arg Ile Leu Lys His Pro Val Phe Pro Ser Gly Lys Phe Leu Lys Val Lys Asp Tyr His Asp Ser Val Arg Arg Gln Ile Met Gln Leu Asn Glu Gln Leu Lys Ala WO 99/19348 PG"T/US98/21391 Val Tyr Glu Phe Gln Asp Leu Lys Asp Thr Ile Glu Arg Ala Lys Asn Glu Ala Asp Leu Leu Leu Glu Asp Leu Gln Glu Glu Ile Asp Leu Gln Ser Ser Val Leu Asn Ala Ser Ile Ala Asp Ser Ser Glu Asn Ile Lys 1S Lys Tyr Tyr His Ile Ser Ser Ser Ala Glu Lys Lys Ile Asn Glu Thr Ser Ser Thr Ile Asn Thr Ser Ala Asn Thr Arg Asn Asp Leu Leu Thr Ile Leu Asp Thr Leu Thr Ser Lys Gly Asn Leu Ser Leu Glu Arg Leu Lys Gln Ile Lys Ile Pro Asp Ile Gln Ile Leu Asn Glu Lys Val Cys 2$ 1365 1370 1375 Gly Asp Pro Gly Asn Val Pro Cys Val Pro Leu Pro Cys Gly Gly Ala Leu Cys Thr Gly Arg Lys Gly His Arg Lys Cys Arg Gly Pro Gly Cys His Gly Ser Leu Thr Leu Ser Thr Asn Ala Leu Gln Lys Ala Gln Glu Ala Lys Ser Ile Ile Arg Asn Leu Asp Lys Gln Val Arg Gly Leu Lys Asn Gln Ile Glu Ser Ile Ser Glu Gln Ala Glu Val Ser Lys Asn Asn Ala Leu Gln Leu Arg Glu Lys Leu Gly Asn Ile Arg Asn Gln Ser Asp Ser Glu Glu Glu Asn Ile Asn Leu Phe Ile Lys Lys Val Lys Asn Phe Leu Leu Glu Glu Asn Val Pro Pro Glu Asp Ile Glu Lys Val Ala Asn Gly Val Leu Asp Ile His Leu Pro Ile Pro Ser Gln Asn Leu Thr Asp Glu Leu Val Lys Ile Gln Lys His Met Gln Leu Cys Glu Aap Tyr Arg Thr Asp Glu Asn Arg Ser Asn Glu Glu Ala Asp Gly Ala Gln Lys Leu Leu Val Lys Ala Lys Ala Ala Glu Lys Ala Ala Asn Ile Leu Leu Asn Leu Aap Lys Thr Leu Asn Gln Leu Gln Gln Ala Gln Ile Thr Gln Gly Arg Ala AsnSerThr IleThr LeuThr AlaAsnIle ThrLysIle Gln Lys Lys AsnValLeu GlnAla AsnGln ThrArgGlu MetLysSer Glu Glu Leu GluLeuAla LysGln SerGly LeuGluAsp GlyLeuSer Arg Leu Leu GlnThrLys LeuGln HisGln AspHisAla ValAanAla Arg Lys Val GlnAlaGlu SerAla HisGln AlaGlySer LeuGluLys Gln G1u Phe ValGluLeu LysLys TyrAla IleLeuGln ArgLysThr Gln ZS Ser Thr ThrGlyLeu ThrLye ThrLeu GlyLysVal LysGlnLeu Glu Lys Asp AlaAlaGlu LysLeu GlyAsp ThrGluAla LysIleArg Ala Arg Ile ThrAspLeu GluArg IleGln AspLeuAen LeuSerArg Lys Gln Ala LysAlaAsp GlnLeu IleLeu GluAspGln ValValAla Arg Ile Lys AsnGluIle ValGlu GluLys LysTyrAla ArgCysTyr Gln Ser (2) INFORMATION FOR SEQ ID N0:2:
4S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5874 base pairs (B} TYPE: nucleic acid (C} STRANDEDNESS: single (D) TOPOLOGY: linear SO
(ii) MOLECULE TYPE: cDNA
SS (xi} SEQUENCE DESCRIPTION: SEQ ID N0:2:

S

SS

E)OCTGGACCTGGATTTGCCAGGGTTCTCCCTGGGGCTGGCTTGAGATTTGCTGTCAACAACA1920 .

$$

(2) INFORMATION FOR SEQ ID N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1524 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 3O (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:3:

Ala AlaGlyAla GlyAlaHis CysGlnArg.CysAspAla AlaAspPro 35 Gln ArgHisHis AsnAlaSer TyrLeuThr AspPheHis SerGlnAsp Glu SerThrTrp TrpGlnSer ProSerMet AlaPheGly ValGlnTyr Pro ThrSerVal AsnIleThr LeuXaaArg LeuGlyLys AlaTyrGlu Ile ThrTyrVal ArgLeuLys PheHisThr SerArgPro GluSerPhe Ala IleTyrLys ArgSerArg AlaAspGly ProTrpGlu ProTyrGln S0 Phe TyrSerAla SerCysGln LysThrTyr GlyArgPro GluGlyGln Tyr LeuArgPro GlyGluAsp GluArgVal AlaPheCys ThrSerGlu SS

Phe SerAspIle SerProLeu SerGlyGly AsnValAla PheSerThr Leu GluGlyArg ProSerAla TyrAsnPhe GluGluSer ProGlyLeu Gln GluTrpVal ThrSerThr GluLeuLeu IleSerLeu AspArgLeu Asn Thr Phe Gly Asp Asp Ile Phe Lys Asp Pro Lys Val Leu Gln Ser Tyr Tyr Tyr Ala Val Ser Asp Phe Ser Val Gly Gly Arg Cys Lys Cys Asn Gly His Ala Ser Glu Cys Gly Pro Asp Val Ala Gly Gln Leu Ala 1$ Cys Arg Cys Gln His Asn Thr Thr Gly Thr Asp Cys Glu Arg Cys Leu Pro Phe Phe Gln Asp Arg Pro Trp Ala Arg Gly Thr Ala Glu Ala Ala His Glu Cys Leu Pro Cys Asn Cys Ser Gly Arg Ser Glu Glu Cys Thr Phe Asp Arg Glu Leu Phe Arg Ser Thr Gly His Gly Gly Arg Cys Hia 2$ 275 280 285 His Cys Arg Asp His Thr Ala Gly Pro His Cys Glu Arg Cys Gln Glu Asn Phe Tyr His Trp Asp Pro Arg Met Pro Cys Gln Pro Cys Asp Cys 3$
Gln Ser Ala Gly Ser Leu His Leu Gln Cys Asp Asp Thr Gly Thr Cys Ala Cys Lys Pro Thr Val Thr Gly Trp Lys Cys Asp Arg Cys Leu Pro Gly Phe His Ser Leu Ser Glu Gly Gly Cys Arg Pro Cys Thr Cys Asn Pro Ala Gly Ser Leu Asp Thr Cya Asp Pro Arg Ser Gly Arg Cys Pro 4$ Cys Lys Glu Asn Val Glu Gly Aen Leu Cys Asp Arg Cys Arg Pro Gly Thr Phe Asn Leu Gln Pro His Asn Pro Ala Gly Cys Ser Ser Cys Phe $0 Cys Tyr Gly His Ser Lys Val Cys Ala Ser Thr Ala Gln Phe Gln Val His His Ile Leu Ser Asp Phe His Gln Gly Ala Glu Gly Trp Trp Ala $$ 435 440 445 Arg Ser Val Gly Gly Ser Glu His Ser Pro Gln Trp Ser Pro Asn Gly f)0 Val Leu Leu Ser Pro Glu Asp Glu Glu Glu Leu Thr Ala Pro Gly Lys Phe Leu Gly Asp Gln Arg Phe Ser Tyr Gly Gln Pro Leu Ile Leu Thr $ 485 490 495 Phe Arg Val Pro Pro Gly Asp Ser Pro Leu Pro Val Gln Leu Arg Leu Glu Gly Thr Gly Leu Ala Leu Ser Leu Arg His Ser Ser Leu Ser Gly Pro Gln Asp Ala Arg Ala Ser Gln Gly Gly Arg Ala Gln Val Pro Leu 1$
Gln Glu Thr Ser Glu Aap Val Ala Pro Pro Leu Pro Pro Phe His Phe Gln Arg Leu Leu Ala Asn Leu Thr Ser Leu Arg Leu Arg Val Ser Pro Gly Pro Ser Pro Ala Gly Pro Val Phe Leu Thr Glu Val Arg Leu Thr 2$ Ser Ala Arg Pro Gly Leu Ser Pro Pro Ala Ser Trp Val Glu Ile Cys Ser Cys Pro Thr Gly Tyr Thr Gly Gln Phe Cys Glu Ser Cys Ala Pro Gly Tyr Lys Arg Glu Met Pro Gln Gly Gly Pro Tyr Ala Ser Cys Val Pro Cys Thr Cys Asn Gln His Gly Thr Cys Asp Pro Asn Thr Gly Ile 3$ 645 650 655 Cys Val Cys Ser His His Thr Glu Gly Pro Ser Cys Glu Arg Cys Leu Pro Gly Phe Tyr Gly Asn Pro Phe Ala Gly Gln Ala Asp Asp Cys Gln Pro Cys Pro Cys Pro Gly Gln Ser Ala Cys Thr Thr Ile Pro Glu Ser 4$
Gly Glu Val Val Cys Thr His Cys Pro Pro Gly Gln Arg Gly Arg Arg Cys Glu Val Cys Asp Asp Gly Phe Phe Gly Asp Pro Leu Gly Leu Phe $0 725 730 735 Gly His Pro Gln Pro Cys His Gln Cys Gln Cys Ser Gly Asn Val Asp $$ Pro Asn Ala Val Gly Asn Cys Asp Pro Leu Ser Gly His Cys Leu Arg Cys Leu His Asn Thr Thr Gly Asp His Cys Glu His Cys Gln Glu Gly Phe Tyr Gly Ser Ala Leu Ala Pro Arg Pro Ala Asp Lys Cys Met Pro WO 99/19348 ~ 4 PCT/US98/21391 $ Cys Ser Cys His Pro Gln Gly Ser Val Ser Glu Gln Met Pro Cys Asp Pro Val Thr Gly Gln Cys Ser Cys Leu Pro His Val Thr Ala Arg Asp Cys Ser Arg Cys Tyr Pro Gly Phe Phe Asp Leu Gln Pro Gly Arg Gly Cys Arg Ser Cys Lys Cys His Pro Leu Gly Ser Gln Glu Asp Gln Cys 1$ 850 855 860 His Pro Lys Thr Gly Gln Cys Thr Cys Arg Pro Gly Val Thr Gly Gln Ala Cys Asp Arg Cys Gln Leu Gly Phe Phe Gly Ser Ser Ile Lye Gly 2$
Cys Arg Ala Cys Arg Cys Ser Pro Leu Gly Ala Ala Ser Ala Gln Cys His Tyr Asn Gly Thr Cys Val Cys Arg Pro Gly Phe Glu Gly Tyr Lys Cys Aep Arg Cys His Tyr Asn Phe Phe Leu Thr Ala Asp Gly Thr His Cys Gln Gln Cys Pro Ser Cys Tyr Ala Leu Val Lys Glu Glu Xaa Ala 3$ Lys Leu Lys Ala Arg Leu Thr Leu Thr Glu Gly Trp Leu Gln Gly Ser Asp Cys Gly Ser Pro Trp Gly Pro Leu Asp Ile Leu Leu Gly Glu Ala Pro Arg Xaa Asp Val Tyr Gln Gly His His Leu Leu Pro Gly Ala Arg Glu Ala Phe Leu Glu Gln Met Met Gly Leu Glu Gly Ala Val Lys Ala 4$ solo loss 1020 Ala Arg Glu Gln Leu Gln Arg Leu Asn Lys Gly Ala Arg Cys Ala Gln $0 Ala Gly Ser Gln Lys Thr Cys Thr Gln Leu Ala Asp Leu Glu Ala Val $$
Leu Glu Ser Ser Glu Glu Glu Ile Leu His Ala Ala Ala Ile Leu Ala Ser Leu Glu Ile Pro Gln Glu Gly Pro Ser Gln Pro Thr Lys Trp Ser His Leu Ala Ile Glu Ala Arg Ala Leu Ala Arg Ser His Arg Asp Thr Ala Thr Lys Ile Ala Ala Thr Ala Trp Arg Ala Leu Leu Ala Ser Asn WO 99/19348 ~ 5 PCT/US98/Z1391 Thr Ser Tyr Ala Leu Leu Trp Asn Leu Leu Glu Gly Arg Val Ala L_eu Glu Thr Gln Arg Asp Leu Glu Asp Arg Tyr Gln Glu Val Gln Ala Ala Gln Lys Ala Leu Arg Thr Ala Val Ala Glu Val Leu Pro Glu Ala Xaa IS Lys Arg Val Gly His Arg Ala Ala Ser Trp Arg Arg Tyr Ser Pro Val Pro Gly Leu Ala Gly Phe Pro Gly Ser Ser Ala Ser Xaa Lys Ser Arg Ala Glu Asp Leu Gly Leu Lys Ala Lys Ala Leu Glu Lys Thr Val Ala Ser Trp Gln His Met Ala Thr Glu Ala Ala Arg Thr Leu Gln Thr Ala 2$ 1220 1225 1230 Ala Gln Ala Thr Leu Arg Gln Thr Glu Pro Leu Thr Met Ala Arg Ser Arg Leu Thr Ala Thr Phe Ala Ser Gln Leu His Gln Gly Ala Arg Ala Ala Leu Thr Gln Ala Ser Ser Ser Val Gln Ala Ala Thr Val Thr Val Met Gly Ala Arg Thr Leu Leu Ala Asp Leu Glu Gly Met Lys Leu Gln Phe Pro Arg Pro Lys Asp Gln Ala Ala Leu Gln Arg Lys Ala Asp Ser Val Ser Asp Arg Leu Leu Ala Asp Thr Arg Lys Lys Thr Lys Gln Ala 4S Glu Arg Met Leu Gly Asn Ala Ala Pro Leu Ser Ser Ser Ala Lys Lys Lys Gly Arg Glu Ala Glu Val Leu Ala Lys Asp Ser Ala Lys Leu Ala Lys Ala Leu Leu Arg Glu Arg Lys Gln Ala His Arg Arg Ala Ser Arg Leu Thr Ser Gln Xaa Leu Gln Ala Thr Leu Gln Gln Ala Ser Gln Gln Val Leu Ala Ser Glu Ala Arg Arg Gln Glu Leu Glu Glu Ala Glu Arg Val Gly Ala Gly Leu Ser Glu Met Glu Gln Gln Ile Arg Glu Ser Arg Ile Ser Leu Glu Lys Asp Ile Glu Thr Leu Ser Glu Leu Leu Ala Arg Leu Gly SerLeuAsp Thr GlnAlaPro AlaGlnAlaLeuAsn Glu His Thr Gln TrpAlaLeu Glu LeuArgLeu GlnLeuGlySerPro Gly Arg Ser Leu GlnArgLys Leu LeuLeuGlu GlnGluSerGlnGln Gln Ser Glu Leu GlnIleGln Gly GluSerAsp LeuAlaGluIleArg Ala Phe Asp Lys GlnAsnLeu Glu IleLeuHis SerLeuProGluAsn Cys Ala Ala Ser TrpGln ZS (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4890 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:4:

WO 99/19348 ~ ~ PCT/US98/21391 S

lO CTGTCAGGAGAATTTCTATCACTGGGACCCGCGGATGCCATGCCAGCCCTGTGACTGCCA960 GGGAGCCGAAGGCTGGTG~GCCAGAAGTGTGGGGGGCTCTGAGCACTCCCCACAATGGAG1380 SS

WO 99/19348 ~ 8 PCT/US9$/21391 WO 99/19348 ~ g PCT/US98/21391 1$

TGTGTGTATG ACCCAAATAA p~~74AAAAAAA 4 2$

(2) INFORMATION FOR SEQ ID
N0:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1105 amino acids 30 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 3$ (v) FRAGMENT TYPE: internal (xi) SEQUENCE N0:5:
DESCRIPTION:
SEQ
ID

Met GlnPheGln LeuThrLeu PheLeuHis LeuGlyTrp LeuSerTyr Ser LysAlaGln AspAspCys AsnArgGly AlaCysHis ProThrThr 4$ 20 25 30 Gly AepLeuLeu.ValGlyArg AsnThrGln LeuMetAla SerSerThr $0 Cys GlyLeuSer ArgAlaGln LysTyrCys IleLeuSer TyrLeuGiu Gly GluGlnLys CysSerIle CysAspSer ArgPhePro TyrAspPro $$

Tyr AspGlnPro AsnSerHie ThrIleGlu AsnValThr ValSerPhe Glu ProAspArg GluLysLys TrpTrpGln SerGluAsn GlyLeuAsp His ValSerIle ArgLeuAsp LeuGluAla LeuPheArg PheSerHis Leu IleLeuThr PheLysThr PheArgPro AlaAlaMet LeuValGlu Arg SerThrAsp TyrGlyHis AsnTrpLys ValPheLys TyrPheAla Lys AspCysAla ThrSerPhe ProAsnIle ThrSerGly GlnAlaGln 1$ Gly ValGlyAsp IleValCys AspSerLys TyrSerAep IleGluPro Ser ThrGlyGly GluValVal LeuLysVal LeuAspPro SerPheGlu Ile GluAsnPro TyrSerPro TyrIleGln AspLeuVal ThrLeuThr Asn LeuArgIle AenPheThr LysLeuHis ThrLeuGly AspAlaLeu 2$ 225 230 235 240 Leu GlyArgArg GlnAsnAsp SerLeuAsp LysTyrTyr TyrAlaLeu Tyr GluMetIle ValArgGly SerCysPhe CysAsnGly HisAlaSer Glu CysArgPro MetGlnLys MetArgGly RspValPhe SerProPro 3$

Gly MetValHis GlyGlnCys ValCysGln HisAsnThr AspGlyPro Asn CysGluArg CysLysAsp PhePheGln AspAlaPro TrpArgPro Ala AlaAspLeu GlnAspAsn AlaCysArg SerCysSer CysAsnSer 4$ His SerSerArg CysHisPhe AspMetThr ThrTyrLeu AlaSerGly Gly LeuSerGly GlyValCys GluAspCys GlnHisAsn ThrGluGly $~

Gln HisCysAsp ArgCysArg ProLeuPhe TyrArgAsp ProLeuLys Thr IleSerAsp ProTyrAla CysIlePro CysGluCys AspProAsp $$ 385 390 395 400 Gly ThrIleSer GlyGlyIle CysValSer HisSerAsp ProAlaLeu fib Gly SerValAla GlyGlnCys LeuCysLys GluAsnVal GluGlyAla Lys CysAspGln CysLysPro AsnHisTyr GlyLeuSer AlaThrAsp WO 99/19348 2 ~ PCT/US98121391 $ 435 440 445 Pro Leu Gly Cys Gln Pro Cys Aep Cys Asn Pro Leu Gly Ser Leu~Pro Phe Leu Thr Cys Asp Val Asp Thr G1y Gln Cys Leu Cys Leu Xaa Tyr Val Thr Gly Ala His Cys Glu Glu Cys Thr Val Gly Tyr Trp Gly Leu IS
Gly Asn His Leu His Gly Cys Ser Pro Cys Asp Cys Asp Ile Gly Gly Ala Tyr SerAsnVal CysSer ProLysAsn GlyGlnCysGlu CysArg Pro His ValThrGly ArgSer CysSerGlu ProAlaProGly TyrPhe 2$ Phe Ala ProLeuAsn PheTyr LeuTyrGlu AlaGluGluAla ThrThr Leu Gln GlyLeuAla ProLeu GlySerGlu ThrPheGlyGln SerPro Ala Val HisValVal LeuGly GluProVal ProGlyAsnPro ValThr Trp Thr GlyProGly PheAla ArgValLeu ProGlyAlaGly LeuArg 3$ 595 600 605 Phe Ala Val Asn Asn Ile Pro Phe Pro Val Asp Phe Thr Ile Ala Ile 40 His Tyr Glu Thr Gln Ser Ala Ala Asp Trp Thr Val Gln Ile Val Val Asn Pro Pro Gly Gly Ser Glu His Cys Ile Pro Lys Thr Leu Gln Ser Lys Pro Gln Ser Phe Ala Leu Pro Ala Ala Thr Arg Ile Met Leu Leu Pro Thr Pro Ile Cys Leu Glu Pro Asp Val Gln Tyr Ser Ile Asp Val $0 675 680 685 Tyr Phe Ser Gln Pro Leu Gln Gly Glu Ser His Ala His Ser His Val 690 695 ' 700 Leu Val Asp Ser Leu Gly Leu Ile Pro Gln Ile Asn Ser Leu Glu Asn Phe Cys Ser Lys Gln Asp Leu Asp Glu Tyr Gln Leu His Asn Cys Val Glu Ile Ala Ser Ala Met Gly Pro Gln Val Leu Pro Gly Ala Cys Glu WO 99/19348 22 PCT/US98J~1391 Arg Leu Ile Ile Ser Met Ser Ala Lys Leu His Asp Gly Ala Val Ala Cys Lys Cys His Pro Gln Gly Ser Val Gly Ser Ser Cys Ser Arg Leu Gly Gly Gln Cys Gln Cys Lys Pro Leu Val Val Gly Arg Cys Cys Asp Arg Cys Ser Thr Gly Ser Tyr Asp Leu Gly His Hie Gly Cys His Pro Cys His Cys His Pro Gln Gly Ser Lys Asp Thr Val Cys Asp Gln Val Thr Gly Gln Cys Pro Cys His Gly Glu Val Ser Gly Arg Arg Cys Asp Arg Cys Leu Ala Gly Tyr Phe Gly Phe Pro Ser Cys His Pro Cys Pro Cys Xaa Arg Phe Xaa Ala Xaa Asp Xaa Leu Xaa Xaa Asp Pro Glu Thr Gly Ser Cys Phe Asn Cys Gly Gly Phe Thr Thr Gly Arg Asn Cys Glu Arg Cys Ile Asp Gly Tyr Tyr Gly Asn Pro Ser Ser Gly Gln Pro Cys 3$ Arg Pro Cys Leu Cys Pro Asp Asp Pro Ser Ser Asn Gln Tyr Phe Ala His Ser Cys Tyr Gln Asn Leu Trp Ser Ser Asp Val Ile Cys Asn Cys Leu Gln Gly Tyr Thr Gly Thr Gln Cys Gly Glu Cys Ser Thr Gly Phe Tyr Gly Asn Pro Arg Ile Ser Gly Ala Pro Cys Gln Pro Cys Ala Cys Asn Asn Asn Ile Asp Val Thr Asp Pro Glu Ser Cys Ser Arg Val Thr SO Gly Glu Cys Leu Arg Cys Leu His Asn Thr Gln Gly Ala Asn Cys Gln Leu Cys Lys Pro Gly His Tyr Gly Ser Ala Leu Asn Gln Thr Cys Arg Arg Cys Ser Cys His Ala Ser Gly Val Ser Pro Met Glu Cys Pro Pro Gly Gly Gly Ala Cys Leu Cys Asp Pro Val Thr Gly Ala Cys Pro Cys Leu Pro Asn Val Thr Gly Leu Ala Cys Asp Arg Cys Ala Asp Gly Tyr S
Trp Asn Leu Val Pro Gly Arg Gly Cys Gln Ser Cys Asp Cys Asp Pro Arg Xaa Ser Gln Ser Ser His Cys Asp Gln Ala Arg Tyr Phe Lys Ala Tyr IS (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3754 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:6:

ACATGCCCCGTTTGCT(3CCT GAACCTCTCC ACAAAGACTCCCAGATCCTG AATTGAATTT60 S

AGCGGTGGCC

lO GCAGACCCCTCTTCTACAGGGACCCGCTCAAGACCATCTCAGATCCCTACGCGTGCATTC1260 SS

C)OTCCTGAGACAGGGTCATGCTTCAATTGTGGAGGCTTTACAACTGGCAGAAACTGTGAAAG2760 TCTCAAGTTC AGCTTCGCCTACTTCAGTTTCCCCTC'rGTGACTGAGGAAGTCAGAATTCA 3600 3S CCTTCAAAAC CTAAAAAAAAAAA,AAAAAAAAAAA 3754

Claims (3)

1. An isolated laminin 12 which includes an .alpha.2 subunit, a .beta.1 subunit arid a .gamma.3 -subunit.

2. An isolated .gamma.3 subunit.

3. An isolated .beta.4 subunit.