CA2290718A1 - Improved bacillus thuringiensis toxin - Google Patents

Abstract

New improved Cry9C proteins, having significantly increased toxicity, and DNA sequences encoding these proteins, were designed. Analysis of amino acid positions in domain II of the Cry9C protein by protein mutagenesis identified amino acids involved in insect toxicity. Random replacement of these amino acids identifies proteins with improved toxicity. A combination of identified improved amino acids in a single protein yields modified Cry9C proteins with significantly improved toxicity.

Description

IMPROVED BACILLUS THURINGIENSIS TOXIN
BACKGROUND OF THE INVENTION
{i) Field of the Invention . 5 The present invention provides new improved proteins derived from a Bacillus thuringiensis Cry9C crystal protein. In accordance with this invention, amino acid positions in a Cry9C protein were identified as involved in insect toxicity.
Further in accordance with this invention are provided modified Cry9C proteins with increased of decreased toxicity to an insect species, and DNA sequences encoding such modified Cry9C proteins. Plants can be protected from insect damage by expressing a chimeric gene encoding an improved Cry9C protein with an increased toxicity to an insect species.
(ii) Description of Related Art Bacillus thuringiensis (Bt)-derived proteins are currently widely used to protect plants from insects by expression of such proteins in transgenic plants.
Concerns of insect resistance development and the desire to achieve the optimum toxicity and control of additional insect species resulted in efforts to modify existing Bt-derived proteins so as to increase their toxicity or alter their mode of action.
Most studies on the mode of action of Bacillus thuringiensJS toxins have focused on lepidopteran-specific Cry1 insecticidal crystal proteins ("ICPs").
The following picture has emerged from these studies {Gill et al., 1992, Annu.
Rev.
Entomol. 37, 615-36; Knowles, 1993, BioEssays, 15, 469-476). Following ingestion of the crystals by a susceptible insect, they are dissolved in the alkaline reducing environment of the insect midgut lumen. The liberated proteins, the protoxins, are then proteolytically processed by insect midgut proteases to a protease-resistant fragment. This active fragment, the toxin, then passes through the peritrophic membrane and binds to specific receptors located on the brush border membrane of gut epithelial cells. Subsequent to binding, the toxin or part thereof inserts in the membrane resulting in the formation of pores. These pores lead to colloid osmotic swelling and ultimately lysis of the midgut cells, causing death of the insect.

CONFIRMATION COPY

Binding studies have demonstrated that receptor binding is a crucial step in the mode of action of ICPs (Hofmann et al., 1988, 173, 85-91; Hofmann et al., 1988, Proc. Natl. Acad. Sci. USA, 85, 7844-7848; Van Rie et af., 1990, Appl.
Environm.
Microbiol. 56, 1378-85).
The three dimensional structure of two ICPs, Cry3A and the CrylAa toxic fragment, has been solved (Li et al., 1991, Nature 353, 815-21; Grochulski et al., 1994, Journal of Molecular Biology 254, 1-18). The Cry proteins have been found to have three structural domains: the N-terminal domain I consists of 7 alpha helices, domain II contains three beta-sheets and the C-terminal domain 111 is a beta-sandwich. Based on this structure, a hypothesis has been formulated regarding the structure-function relationships of ICPs. The bundle of long, hydrophobic and amphipathic helices (domain I) is equipped for pore formation in the insect membrane, and regions of the three-sheet domain (domain II) are probably responsible for receptor binding (Li et al, 1991, supra}. The function of domain 111 is less clear. When different ICP amino acid sequences are aligned, five conserved sequence blocks are evident (Hofte & Whiteley, 1989, Microbiol. Revs. 53, 242-255).
These conserved blocks are all located in the interior of a structural domain or at the interface between domains. The high degree of conservation of these internal residues implies that homologous proteins would adopt a similar fold {Li et al., 1991, supra).
Data from Ahmad et al. (1991, FEMS Microbiol. Lett. 68, 97-104}; Wu et al.
(1992, J. Biol. Chem. 267, 2311-2317) and Gazit et al. (1993, Biochemistry 32, 3429-3436) provide evidence for the function of domain I of ICPs as a pore formation unit.
Deletions and alanine substitutions in the Cry1 Aa protoxin at a position predicted to be at or near the second loop of domain fl significantly altered toxicity and receptor binding ability (Lu et al., 1993, XXVIth Annual meeting of the Society for Invertebrate Pathology, Asheville, USA, Conference book, page 31, Abstract 17).
Smith and Ellar {1992, XXVth Annual meeting of the Society for Invertebrate Pathology, Heidelberg, Germany, Conference book, page 111, abstract 68) observed dramatic effects on toxicity towards in vitro insect cell cultures with mutant Cry1 C proteins, differing in the amino acid sequence of the predicted loop regions.

They formulated the hypothesis that it should be possible to map the putative receptor binding domain of this toxin and eventually generate toxins with increased potency. In some cases however, a contribution to specificity and binding from domain Ill of the Cry toxin could not be excluded (Schnepf et al., 1990, supra; Ge et S al., 1991, J. Biol. Chem. 266, 17954-17958). Furthermore, a recent study using hybrid ICPs, constructed by exchanging gene fragments between cry1C and crylE, has indicated that domain II of Cry1 C is not sufficient to confer the high activity of this protein towards Spodoptera exigua and Mamestra brassicae (Schipper et al., 1993, Seventh International Conference on Bacillus, Institut Pasteur, July 18-23, Abstracts of lectures, p. L69). Site-directed mutagenesis experiments on CrylAc indicated that certain amino acids in domain I are important for receptor binding (Wu et al., 1992, supra). Rajamohan et al: (1996, J. Biol. Chem. 271, 2390-2396) explored the role of loop 2 residues in domain I I of the Cry1 Ab protein in reversible and irreversible binding to Manduca sexta and Heliothis virescens.
Also, changes outside the 60 kD toxin region of the Bt protoxin were found to influence toxicity. It was suggested that this may be related to the activation processes by the gut juice (Nakamura et al., 1990, Agric. Biol. Chem. 54, 715-24).
Visser et al. (1993, In "Bacillus thuringiensis, an Environmental Biopesticide Theory and Practice", pp.71-88, eds.: Entwistle, P.F., Cory, J.S., Bailey, M.J., and Higgs, S., John Wiley & Sons, NY) reviewed the domain-function studies with Bt ICPs and concluded that in general, the function of essential stretches of the toxic fragment of Bt ICPs is unknown. From studies of mutant proteins, it was found that several amino acid residues from different regions of the toxic fragment, either conserved or variable, were shown to affect toxic activity.
Lambert et al. (1996, Appl. & Environm. Microbiol. 62, p. 80-86) and PCT
patent publication WO 94/05771 describe a new Bt protein which is currently named cry9Ca1 (abbreviated as Cry9C) (Peferoen et al., 1997, in Advances in Insect Control: The role of transgenic plants; pp. 21-48, Taylor & Francis Ltd., London).
This protein was found to have a broad insect target range within the group of lepidopteran pest insects making it interesting for insect control applications in agriculture.

De Roeck et al. (1995, the 28th annual meeting of the Society for Invertebrate Pathology, Cornell University, Ithaca, New York, p. 52) suggests to determine the likely position of the binding epitope of the CryIH protein by making Alanine mutants so as to allow the determination of the contribution of amino acid positions in binding of the CryIH protein to different insects. The CryIH protein is currently named Cry9C
in the new nomenclature (Crickmore et al., 1995, 28t" annual meeting of the Society for Invertebrate Pathology, Cornell University, Ithaca, New York, p.14.). De Roeck et al. (1997, the 6th International Conference on Perspectives in Protein Engineering, John Innes Centre, Norwich, UK, June 28-July 1, p. 34) determined the likely position of residues in the loops at the apex of the molecule in domain II of the Cry9C protein.
SUMMARY OF THE INVENTION
This invention provides a modified Cry9C protein with an improved toxicity to an insect species, comprising the amino acid sequence of SEQ ID No. 2 or an insecticidally-effective fragment thereof, wherein at least one amino acid in the following regions in SEQ ID No. 2 is replaced by another amino acid: 313-334, 369, 418-425, 480-492.
This invention further provides improved Cry9C proteins comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein at least one of the amino acids at the following positions in SEQ ID No. 2 have been replaced by another amino acid: 313, 316, 317, 318, 319, 321, 323, 325, 329, 330, 368, 369, 418, 420, 421, 422, 480, 481, 483, 484, 485, 487, 488, 490 and 491. Preferred improved Cry9C proteins comprise the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein at least one of the amino acids at the following positions are replaced by other amino acids: 316, 317, 319, 321, 329, 330, 369, 422, and 488.
This invention also provides a modified Cry9C protein with improved toxicity to Ostrinia nubilalis, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein at least the amino acids at position 488 or at least at positions 364 and 488 are replaced by other amino acids, preferably by alanine.

This invention also provides modified Cry9C proteins with improved toxicity to Heliothis virescens, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein the amino acid at position 321 or position 329, is replaced by another amino acid, preferably by alanine.
This invention further provides modified Cry9C proteins with improved toxicity to Diatraea grandiosella, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein the amino acid at any or all of positions 316, 317, 319, 321, 330, 369, or 422 is replaced by another amino acid, preferably by alanine.
Further in accordance are provided DNA sequences encoding the modified Cry9C proteins, and particularly chimeric genes designed for expression in plants comprising these DNA sequences.
In another preferred embodiment of this invention, a plant transformed with a DNA sequence encoding a modified Cry9C protein is provided, so that the plant acquires increased resistance to insects, particularly a corn plant transformed with a modified Cry9C protein yielding increased toxicity towards Heliothis virescens, Ostrinia nubilalis, or Diatraea grandiosella insects.
Other objects and advantages of this invention will become evident from the following description.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
In this invention, certain amino acid residues important for toxicity of the Cry9C protein have been identified. These amino acid residues can be replaced by other amino acids to increase the toxicity to a specific insect species.
The "Cry9C protein", as used herein, refers to an insecticidal protein characterized by the amino acid sequence of SEQ ID No. 2 or any equivalents thereof such as the insecticidally effective truncated proteins or the fusion proteins of the Cry9C protein described in PCT patent publications WO 94/05771 and WO
94/24264. Particularly preferred Cry9C proteins, in accordance with this invention, are proteins containing at least the amino acid sequence of SEQ lD No. 2 from amino acid position 1 or 44 to amino acid position 658. Throughout the description and the claims, the new nomenclature for Bt crystal proteins as suggested by Crickmore et al. (1995, 28th annual meeting of the Society for Invertebrate Pathology, Cornell University, Ithaca, New York, p. 14) and reported in Peferoen et al. (1997, in Advances in Insect Control: The role of transgenic plants, pp.
21-48, Taylor & Francis Ltd., London) has been used.
"Cry9C protein variants", for a particular insect species, are insecticidal proteins that differ from but are indirectly or directly derived from the Cry9C protein.
Indeed, several variants of a Bt protein in which some amino acids are changed into others without significantly changing activity and/or specificity to a particular insect species can be found in nature (Hofte & Whiteley, 1989, supra) or can be made by recombinant DNA techniques. Variants of a Cry9C protein, as used herein, also include proteins containing the specificity- or toxicity-determining domain or region of the Cry9C protein, e.g., in a hybrid with another protein, such as another Bt ICP, a membrane-permeating protein domain, a cytotoxin or an antibody fragment, provided that the Cry9C specificity- or toxicity-determining domain or region contributes to the toxicity or specificity of the hybrid protein. Particularly preferred Cry9C protein variants are those proteins comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein the arginine at position 164 has been replaced by another amino acid, preferably alanine or lysine. These variants with a replacement of the arginine at position 164 in the sequence of SEQ ID No. 2 show a significantly lower susceptibility to breakdown upon protease treatment, and are named herein the "protease-resistant Cry9C variants". Like here for the protease-resistant variants, whenever reference to a particular region or position in SEQ ID No. 2 is made, this does not necessarily imply that the protein referred to is the full-length protein of SEQ ID No. 2;
this statement merely refers to the position corresponding to the particular position in the reference Cry9C protein in SEQ ID No. 2. Indeed, improved Cry9C proteins of the invention can be truncated so that the actual position of an amino acid in that protein will differ but nevertheless reference will be made throughout this invention to the positions in the full-length reference protein, shown in SEQ ID No. 2.
Following the teachings of this invention, Cry9C proteins or variants thereof can be modified to have an increased toxicity for an insect species. "Modified Cry9C

protein", as used herein, refers to a Cry9C protein or its protease-resistant variant wherein amino acids have been modified to analyse the contribution of amino acid positions in toxicity, particularly a Cry9C protein or its protease-resistant variant wherein amino acids have been modified in the regions at the following positions in SEQ ID No. 2: 313-334, 358-369, 418-425, 480-492. "Improved Cry9C protein", in accordance with this invention, refers to a Cry9C protein or its protease-resistant variant wherein at least one amino acid has been replaced, so that the toxicity of this improved protein towards an insect species is significantly increased. In a particularly preferred improved Cry9C protein or its protease-resistant variant, the at least one amino acid change is located in domain II of the Cry9C protein, particularly in the regions of the Cry9C protein characterized by the following positions in SEQ ID
No. 2: 313-334, 358-369, 418-425, 480-492. A modified Cry9C protein, differing in one amino acid from the native protein or its protease-resistant variant and being significantly less toxic towards the target insect, allows the direct identification of this amino acid position as involved in toxicity (provided no gross structural changes are introduced), and thus has considerable value in improving toxicity. In accordance with this invention, the identification of these amino acid positions involved in toxicity allows the construction of modified proteins having increased toxicity to the target insect by amino acid randomization at these positions. Preferred modified Cry9C
proteins in accordance with this invention are the modified Cry9C proteins having altered toxicity to Ostrinia nubilalis, Heliothis virescens or Diatraea grandiosella as shown in Table 1, as well as combinations of those modifications in one modified protein.
An example of an improved Cry9C protein in accordance with this invention is a protein comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 or 666 wherein an amino acid in at least one of the following amino acid positions of SEQ ID No. 2 has been replaced by another amino acid: 313, 316, 317, 318, 319, 321, 323, 325, 329, 330, 362, 364, 368, 369, 418, 420, 421, 422, 480, 481, 483, 484, 485, 487, 488, 490 and 491;
or an amino acid position located in the immediate vicinity of any one of these positions in the three-dimensional structure of the protein, preferably those amino acids whose C-alpha atom is at a maximum distance of about 7 Angstrom from the C-alpha atom _7_ of the amino acid listed above. A preferred improved Cry9C protein in accordance with this invention is the protein of SEQ ID No. 2 with at least one of the following amino acid changes: P316A, A317V, V319A, L321 A, P329A, Y330A, S364A, Y369A, 1422A, and 1488A. "V319A" or "Cry9C(V319A)", as used herein, means a change of the valine amino acid at position 319 in SEQ ID No. 2 to an alanine amino acid.
Preferred improved Cry9C proteins also include Cry9C proteins having also the arginine amino acid at position 164 in SEQ ID No. 2 altered into another amino acid, particularly alanine or lysine, to enhance stability upon protease, particularly trypsin, cleavage.
A preferred Cry9C protein for the control of Ostrinia nubilalis insects in accordance with this invention is a protein comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein an amino acid in at least one of the following amino acid positions in SEQ ID No.
2 has been replaced by another amino acid: 325, 364, 418, 421, 485, and 488. A
particularly preferred improved Cry9C protein for the control of Ostrinia nubilalis insects is a protein comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein the amino acids in at least position 364 or at least in positions 364 and 488 of SEQ ID No. 2 are replaced by another amino acid, particularly alanine.
A preferred Cry9C protein for the control of Heliothis virescens insects in accordance with this invention is a protein comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein an amino acid in at least one of the following amino acid positions in SEQ ID No.
2 has been replaced by another amino acid: 313, 316, 317, 318, 319, 321, 323, 325, 329, 330, 368, 369, 418, 420, 421, 422, 480, 481, 483, 484, 485, 487, 488, 490 and 492, particularly at least one of the following amino acid positions: 321, 325, 329, 418, 420, and 480. A particularly preferred improved Cry9C protein for the control of Heliothis virescens insects is a protein comprising the amino acid sequence of SEQ
ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein the amino acids in at least one of the amino acid positions 321 and 329 of SEQ ID
No. 2 are replaced by another amino acid, particularly alanine.
_g_ A preferred Cry9C protein for the control of Diatraea grandiosella insects in accordance with this invention is a protein comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein an amino acid in at least one of the following amino acid positions in SEQ ID No.
2 has been replaced by another amino acid: 316, 317, 319, 321, 325, 330, 369, 421, 422, 480, 483, 484, 485, 487, 488, 490, and 491; particularly at least one of the following amino acid positions: 480, 484, 485, 487, and 490. A particularly preferred improved Cry9C protein for the control of Diatraea grandiosella insects is a protein comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658 wherein the amino acids in at least one of the amino acid positions 316, 317, 319, 321, 330, 369 and 422 of SEQ ID No. 2 are replaced by another amino acid, particularly alanine or valine (for 317).
By using DNA sequences encoding improved Cry9C proteins in accordance with this invention, improved toxicity to a selected insect species can be obtained upon expression of such DNA in a transgenic plant.
A "cry9C gene", as used herein, is a DNA sequence comprising a DNA
encoding a Cry9C protein (a coding region), and includes necessary regulatory sequences so that a Cry9C protein can be expressed in a cell, preferably a plant or bacterial cell. A cry9C gene does not necessarily need to be expressed everywhere at all times, expression can be periodic (e.g. at certain stages of development in a plant) and/or can be spatially restricted (e.g. in certain cells or tissues in a plant), mainly depending on the activity of regulatory elements provided in the chimeric gene or in the site of insertion in the plant genome. A cry9C gene can be naturally-occurring or can be a hybrid or synthetic DNA and the regulatory elements can be from prokaryotic or eucaryotic origin.
The "modified cry9C gene", as used herein, is a DNA sequence comprising a DNA encoding a modified Cry9C protein (a modified coding region), and includes necessary regulatory sequences so that a Cry9C protein can be expressed in a cell, preferably a plant or bacterial cell. An example of a modified cry9C coding region is the cry9C coding region of SEQ ID No. 3 wherein the valine codon at nucleotide positions 844-846 of SEQ ID No. 3 has been replaced by an alanine codon.
_g_ "Substantial sequence homology" to a DNA sequence, as used herein, refers to DNA sequences differing in some, most or. all of their colons from another DNA
sequence but encoding the same or substantially the same protein. Indeed, because of the degeneracy of the genetic code, the colon usage of a particular DNA
coding region can be substantially modified, e.g., so as to more closely resemble the colon usage of the genes in the host cell, without changing the encoded protein.
Changing the colon usage of a DNA coding region to that of the host cell has been described to be desired for gene expression in foreign hosts (e.g. Bennetzen & Hall, 1982, J.
Biol. Chem. 257, 3026-3031.; Itakura, 1977, Science 198, 1056-1063). Colon usage tables are available in the literature (Wada et al., 1990, Nucl. Acids Res.
18, 2367-1411; Murray et al., 1989, Nucl. Acids Res. 17(2), 477-498) and in the major DNA
sequence databanks (e.g. at EMBL in Heidelberg, Germany). Accordingly, recombinant or synthetic DNA sequences can be constructed so that the same or substantially the same proteins with substantially the same insecticidal activity are produced (Koziel et al., 1993, Biotechnology 11, 194-200; Perlak et al., 1993, Plant Mol. Biol. 22, 313-321 ). A modified cry9C gene has all appropriate control regions so that the modified Cry9C protein can be expressed in a host cell, e.g. for expression in plants, a plant-expressible promoter and a 3' termination and polyadenylation region active in plants.
A "chimeric improved cry9C gene", as used herein, refers to a chimeric gene comprising a DNA sequence encoding the improved Cry9C protein inserted in between controlling elements of different origin, e.g. a DNA sequence encoding the improved Cry9C protein under the control of a promoter transcribing the DNA in the plant cell, and fused to 3' transcription termination sequences active in plant cells.
Protection of a plant, preferably a corn or cotton plant, against an insect species which is known to feed on said plant is preferably accomplished by expressing an improved Cry9C protein in the cells of the plant. This is preferably accomplished by expressing a chimeric improved cry9C gene encoding such an improved Cry9C protein in the cells of a plant, preferably a corn or cotton plant. An improved Cry9C protein of this invention preferably only has a small number, particularly less than 20, more particularly less than 15, preferably less than 10 amino acids replaced by other amino acids as compared to the Cry9C protein, preferably as compared to the region from between amino acid positions 1 and 45 to amino acid position 658 of the Cry9C protein of SEQ ID No. 2. A significant increase in toxicity can already be obtained by replacing only 1 amino acid, but it is preferred that more than one amino acid is changed to improve toxicity.
The following steps are followed to construct the new modified Cry9C proteins:
amino acids in domain II of the Cry9C protein from amino acid positions 313-334, 358-369, 418-425, and 480-492 were chosen for modification, using alanine-scanning mutagenesis (Cunningham & Wells, 1989, Science 244, 1081-85). In case the original position is alanine, a substitution by valine is done. These regions occur at positions corresponding to the solvent-exposed positions in the loop between beta-strands 1 and 2 (comprising alpha-helix 8) and in loop 1 (located between beta strands 2 and 3), in loop 2 (located between beta-strands 6 and 7), and in loop 3 (located between beta-strands 10 and 11 ) in the three-dimensional model of the Cry3A protein (Li et al., 1991, supra). To discount any observed lower toxicity of a modified Cry9C protein which is due to misfolding or structural distortion, the structural stability of mutant ICPs can be analysed by a variety of methods including toxicity to another target insect, crystal formation, solubilization, monoclonal antibody binding analysis, protease resistance, fluorometric monitoring of unfolding and circular dichroism spectrum analysis. In the case of structural distortion, it is impossible to determine the functional role of this position by alanine replacement.
However, a more conservative amino acid substitution may yield a correctly folded mutant protein which allows to determine the functional role of this position.
The amino acid positions, identified above, which yield modified proteins with significantly decreased toxicity ("down-mutants") are randomized. This means that a set of 20 different mutants, representing each type of amino acid, is generated for each position of interest (the original amino acid and the alanine substitution function as a control). This method is further referred to as "amino acid randomization".
Such mutants may be generated by a variety of methods, e.g. following the PCR
overlap extension method (Ho et al., 1989, Gene 77, 51-59). These mutant proteins are then tested in toxicity assays on the target insect. Mutants at each position which are more toxic, e.g., yield higher mortality than the wild type protein, are selected.
Such mutants with improved toxicity are termed "up-mutants". Alternatively, it is also possible to select potential up-mutants on the basis of increased reversible binding which can be measured following the procedures of Van Rie et al. (1990, Appl.
Environm. Microbiol. 56, 1378-1385) or Liang et al. (1995, J. Biol. Chem. 270, 24719-24724), which is incorporated herein by reference.
All or some of the "up-mutant" amino acids, identified in step 2, are combined in a single modified protein. According to additivity principles, mutations in non-interacting parts of a protein should combine to give simple additive changes in the free energy of binding (Lowman and Wells, 1993, J. Mol. Biol., 234, 564-578).
Increases in toxicity are thus accumulated by combining several single mutants into one multiple mutant. Finally a modified protein with improved toxicity is designed, which comprises some or all, preferably all, of the up-mutant amino acids previously identified.
In accordance with this invention, amino acids of domain II of a Cry9C
protein, located at the protruding regions of domain II are chosen for modification. By "protruding regions of domain II", as used herein, are meant the solvent-exposed regions organized in loops, alpha helices or beta-strands which are protruding from domain II and are located at or towards the apex of the molecule.
This invention is particularly suited for improving the toxicity to an insect species for which the Cry9C protein has a rather weak toxicity. The toxicity of this improved Cry9C protein can be increased by combining amino acid mutations in the protein, each yielding an increased toxicity when compared to the amino acid present in the native Cry9C protein. Insect species for which improved Cry9C proteins can be made also include Spodoptera frugiperda, Heliothis zea, Heliothis armigera, and Agrotis ipsilon. Also, this invention is suited to increase toxicity of a Cry9C protein or its protease-resistant variant to one insect species and to decrease toxicity of the same protein to another insect species by making the proper amino acid substitutions in the protein. This may be advantageous, e.g., to limit the likelihood of insect resistance occurrence to the protein in a particular insect species.
An insecticidally effective part of the modified cry9C gene of this invention encoding an insecticidally effective portion of the modified Cry9C protein, can be made in a conventional manner. An "insecticidally effective part" of the modified cry9C gene refers to a gene comprising a DNA coding region encoding a polypeptide with fewer amino acids than the full length modified Cry9C protein but that still retains toxicity to insects. A preferred insecticidally effective part of the Cry9C
protein is the part from amino acid position 1 or 44 to amino acid position 658 in SEQ ID No.
2.
In order to express all or an insecticidally effective part of the improved cry9C
gene in E. coli, in Bt strains and in plants, suitable restriction sites can be introduced, flanking each gene or gene part. This can be done by site-directed mutagenesis, using well-known procedures (Stanssens et al., 1989, Nucl. Acids Res. 92, 4441-4454; White et al., 1989, Trends in Genet. 5, 185-189).
In order to improve expression in foreign host cells such as plant cells, it may be preferred to alter the improved cry9C coding region or its insecticidally effective part to form an equivalent, artificial improved cry9C coding region.
Expression is improved by selectively inactivating certain cryptic regulatory or processing elements present in the native sequence as described in PCT publications WO 91/16432 and 8. This can be done by site-directed mutagenesis or site-directed intron-insertion (WO 93/09218), or by introducing overall changes to the codon usage, e.g., adapting the codon usage to that most preferred by the host organism (publication of European patent application number ("EP") 0 385 962, EP 0 359 472, publication of PCT patent application WO 93/07278, Murray et al., 1989, supra) without significantly changing, preferably without changing, the encoded amino acid sequence. Small modifications to a DNA sequence such as described above can be routinely made by PCR-mediated mutagenesis (Ho et al., 1989, supra; White et al., 1989, supra). For major changes to the DNA sequence, DNA synthesis methods are available in the art (e.g. Davies et al., 1991, Society for Applied Bacteriology, Technical Series 28, pp. 351-359). For obtaining enhanced expression in monocot plants such as com, a monocot intron can be added to the chimeric improved cry9C
gene (Callis et al., 1987, Genes & Development 1, 1183-1200; PCT publication WO
93/07278). Another preferred embodiment of this invention is the expression of the improved Cry9C proteins by the method described in PCT patent publication WO
97/49814, which is incorporated herein by reference.
The chimeric improved cry9C gene can be stably inserted in a conventional manner into the nuclear genome of a single plant cell, and the so-transformed plant cell can be used in a conventional manner to produce a transformed plant that is insect-resistant. Particularly preferred plants in accordance with this invention are corn plants. Corn cells can be stably transformed (e.g. by electroporation) using wounded or enzyme-degraded intact tissues capable of forming compact embryogenic callus (such as corn immature embryos), or the embryogenic callus (such as type I callus in corn) obtained thereof, as described in PCT patent publication WO 92/09696 or US Patent 5,641,664. Other methods for transformation of corn include the methods by Fromm et al. (1990, Bio/Technology 8, 833-839), Cordon-Kamm et al. (1990, The Plant Cell 2, 603-618) and Ishida et al. (1996, Nature Biotechnology 14, 745-750).
Alternatively, a disarmed Ti plasmid, containing the insecticidally effective chimeric improved cry9C gene, in Agrobacterium tumefaciens can be used to transform the plant cell, preferably the corn or cotton cell, and thereafter, a transformed plant can be regenerated from the transformed plant cell using the procedures described, for example, in EP 0116718, EP 0270822, PCT publication WO 84/02913 and EP 0242246 (which are also incorporated herein by reference), and in Could et al. (1991, Plant Physiol. 95, 426-434) or Ishida et al. (1996, supra), particularly the method described in PCT publication WO 94/00977. Preferred Ti-plasmid vectors each contain the insecticidally effective chimeric improved cry9C
gene between the border sequences, or at least located to the left of the right border sequence, of the T-DNA of the Ti-plasmid. Of course, other types of vectors can be used to transform the plant cell, using procedures such as direct gene transfer (as described, for example in EP 0233247), pollen mediated transformation (as described, for example in EP 0270356, PCT publication WO 85/01856, and US
Patent 4,684,611 ), plant RNA virus-mediated transformation (as described, for example in EP 0067553 and US Patent 4,407,956), and liposome-mediated transformation (as described, for example in US Patent 4,536,475).
A resulting transformed plant, such as a transformed corn or cotton plant, can be used in a conventional plant breeding scheme to produce more transformed plants with the same characteristics or to introduce the improved cry9C gene, or an insecticidally effective part thereof in other varieties of the same or related plant species. Seeds, which are obtained from the transformed plants, contain the chimeric improved cry9C gene or its insecticidally effective part as a stable genomic insert. Cells of the transformed plant can be. cultured in a conventional manner to produce the improved Cry9C protein or insecticidally effective portions thereof, which can be recovered for use in conventional insecticide compositions against insects, particularly lepidopteran insects {U.S. Patent 5,254,799). Preferred plants in accordance with this invention, besides corn and cotton, include rice, plants of the genus Brassica such as oilseed rape, cauliflower and broccoli, and also soybean, tomato, tobacco, potato, eggplant, beet, oat, pepper, gladiolus, dahlia, chrysanthemum, sorghum, and garden peas.
The improved cry9C coding region or its insecticidally effective part is inserted in a plant cell genome so that the inserted coding region is downstream (i.e., 3') of, and under the control of, a promoter which can direct the expression of the gene part in the plant cell. This is preferably accomplished by inserting the chimeric improved cry9C gene or its insecticidally effective part in the plant cell genome.
Preferred promoters include: the strong constitutive 35S promoters (the "35S promoters") of the cauliflower mosaic virus of isolates CM 1841 (Gardner et al., 1981, Nucleic Acids Research 9, 2871-2887), CabbB-S (Franck et al., 1980, Cell 27, 285-294) and CabbB-JI (Hull and Howell, 1987, Virology 86, 482-493); the ubiquitin promoter (EP
0342926), and the TR1' promoter and the TR2' promoter which drive the expression of the 1' and 2' genes, respectively, of the T-DNA (Velten et al., 1984, EMBO
J. 3, 2723-2730). Alternatively, a promoter can be utilized which is not constitutive but rather is specific for one or more tissues or organs of the plant, preferably leaf and stem tissue, whereby the inserted chimeric improved cry9C gene or its insecticidally effective part is expressed only in cells of the specific tissues) or organ(s). Another alternative is to use a promoter whose expression is inducible (e.g., by insect feeding or by chemical factors). Known wound-induced promoters inducing systemic expression of their gene product throughout the plant are also of particular interest.
The improved cry9C coding region, or its insecticidally effective part, is inserted in the plant genome so that the inserted coding region is upstream (i.e., 5') of suitable 3' end transcription regulation signals (i.e., transcript termination and polyadenylation signals). Preferred polyadenylation and transcript formation signals include those of the 35S gene (Mogen et al., 1990, The Plant Cell 2, 1261-1272), the _ __ _ __ ..~___ _____ _,__ octopine synthase gene (Gielen et aL, 1984, EMBO J. 3, 835-845) and the T-DNA
gene 7 (Velten and Schell, 1985, Nucl. Acids Res. 13, 6981-6998), which act as 3'-untranslated DNA sequences in transformed plant cells.
The chimeric improved cry9C gene, or its insecticidally effective gene part, can optionally be inserted in the plant genome as a hybrid gene (EP 0 193 259;
Vaeck et al., 1987, Nature 327, 33-37) under the control of the same promoter as the coding region of a selectable marker gene, such as the coding region of the neo gene (EP 0 242 236) encoding kanamycin resistance, so that the plant expresses a fusion protein.
Preferably, the improved cry9C gene is expressed in a plant in combination with another insect control protein, e.g., another Bt-derived crystal protein or an insecticidal fragment thereof, particularly a Cry1 Ab- or Cry1 B-type protein, to prevent or delay the occurrence of insect resistance development (EP 0 408 403).
All or part of the improved cry9C coding region can also be used to transform bacteria, such as a B, thuringiensis which produces other insecticidal toxins (Lereclus et al., 1992, Bio/Technology 10, 418-421; Gelernter & Schwab, 1993, In Bacillus thuringiensis, An Environmental Biopesticide: theory and Practice, pp. 89-104, eds.
Entwistle, P.F., Cory, J.S., Bailey, M.J. and Higgs, S., John Wiley & Sons Ltd.).
Thereby, a transformed Bt strain is produced which is useful for combating a wide spectrum of insect pests or for combating insects in such a manner that insect resistance development is prevented or delayed (EP 0 408 403). Preferred promoter and 3' termination and polyadenylation sequences for the chimeric improved cry9C
gene are derived from Bacillus thuringiensis genes, such as the native ICP
genes.
Alternatively, the improved coding region of the invention can be inserted and expressed in endophytic and/or root-colonizing bacteria, such as bacteria of the genus Pseudomonas or Clavibacter, e.g., under the control of a Bt ICP gene promoter and 3' termination sequences. Successful transfer and expression of ICP
genes into such bacteria has been described by Stock et al. (1990, Can. J.
Microbiol.
36, 879-884), Dimock et at. (1989, In Biotechnology, Biopesticides and Novel Plant Pest Resistance Management, eds. Roberts, D.W. & Granados, R.R., pp.88-92, Boyce Thompson Institute for Plant Research, Ithaca, New York), and Waalwijk et al.
(1991, FEMS Microbiol. Lett. 77, 257-264). Transformation of bacteria with all or part of the improved cry9C coding region of the invention, incorporated in a suitable cloning vehicle, can be carried out in a conventional manner, preferably using conventional electroporation techniques as described in Mahillon et al. {1989, FEMS
Microbiol. Letters 60, 205-210), in PCT patent publication WO 90/06999, Chassy et al. (1988, Trends Biotechnol. 6, 303-309) or other methods, e.g., as described by ~ Lerecfus et al. (1992, Bio/Technology 90, 418).
The improved Cry9C-producing strain can also be transformed with all or an insecticidally effective part of one or more DNA sequences encoding a Bt protein or an insecticidally effective part thereof, such as: a DNA encoding the Bt2 or Cry1 Ab protein (US patent 5,254,799; EP 0 193 259) or the Bt109P or Cry3C protein (PCT
publication WO 91/16433), or another DNA coding for an anti-lepidoptera or an anti-Coleoptera protein. Thereby, a transformed Bt strain can be produced which is useful for combating an even greater variety of insect pests {e.g., Coleoptera and/or additional lepidoptera) or for preventing or delaying the development of insect resistance.
For the purpose of combating insects by contacting them with the improved Cry9C protein, e.g. in the form of transformed plants or insecticidal formulations, any DNA sequence encoding any of the above described improved Cry9C proteins, can be used.
The following Examples are offered by way of illustration and not by way of limitation. The sequence listing referred to in the description and the Examples is as follows:
SEQUENCE LISTING
SEQ ID No. 1: Nucleotide sequence of the Bacillus thuringiensis cry9C gene, showing the coding region and flanking 5' and 3' regions.
SEQ ID No. 2: Amino acid sequence of the full length Bacillus thuringiensis Cry9C protein.
SEQ ID No. 3: Nucleotide sequence of a codon-optimized DNA sequence encoding a truncated Cry9C protein wherein the arginine at _17_ amino acid position 123 (corresponding to amino acid position 164 in the protein of SEQ ID No. 2) has been replaced by lysine.
SEQ ID No. 4: Amino acid sequence of the modified Cry9C protein encoded by the DNA of SEQ ID No. 3.
Unless otherwise stated in the Examples, all general materials and methods, including procedures for making and manipulating recombinant DNA are carried out by the standardized procedures as described in volumes 1 and 2 of Ausubel et al., Current Protocols in Molecular Biology, Current Protocols, USA (1994), in Plant Molecular Biology Labfax (1993, by R.D.D. Croy, jointly published by BIOS
Scientific publications Ltd. UK and Blackwell Scientific Publications, UK) and Sambrook et al., Molecular Cloning - A Laboratory Manual, Second Ed., Cold Spring Harbor Laboratory Press, NY (1989).
EXAMPLES:
1. CONSTRUCTION OF MODIFIED CRY9C PROTEINS
Multiple alignments between Bt crystal protein sequences including the sequences of Cry9C, Cry3A and Cry1 Aa allowed identification of the amino acids located in the expected binding site of the Cry9C domain II. Using known alignment programs, 52 amino acid positions were identified for amino acid replacement.
The amino acids in the Cry9C protein of SEQ ID No. 2 from amino acid positions 313-334, 358-369, 418-425, 480-492 have been identified to correspond to the solvent-accessible regions most likely involved in receptor-binding in the Cry3A
protein, and these positions in the Cry9C protein were chosen for amino acid modification.
Since alanine substitution does not alter the main chain of a protein, and does not impose extreme electrostatic or steric effects and since it eliminates the side chain beyond the beta carbon, each of the amino acids in these identified regions was changed into alanine, one by one, using splice overlap extension PCR (Ho et al., 1989, supra) on the protease-resistant form of the native cry9C gene wherein the arginine codon at position 164 was replaced by an alanine codon. The codon most preferred in the cry9C native gene for alanine, GCA, was used for these modifications. When the original codon encodes alanine, then this is replaced by a valine codon (GTA).
The obtained PCR fragments were ligated in pUCl9-derived vectors. If not present, suitable unique restriction sites were created in the cry9C DNA. All plasmids containing modified DNA sequences were controlled by sequencing the relevant portions and were found to be correctly constructed. The modified cry9C genes were expressed in transformed WK6 cells. Every mutant protein was expressed in these E. coli cells at least twice. Mutants causing problems in expression, probably caused by structural changes in these mutants, were discarded. No gross folding aberrations of the mutants identified to be involved in toxicity (and fisted in Table 1 ) are found, e.g., as was evidenced by the similar SDS-PAGE patterns following trypsin cleavage or treatment with midgut juice of the insect larvae of solubilized mutant and Cry9C(R164A) proteins.
2. INSECT TOXICITY OF THE MODIFIED CRY9C PROTEINS
Bio assays on the modified Cry9C proteins obtained in Example 1 were carried out with first instar larvae of the Southwestern corn borer, Diatraea grandiosella (family Pyralidae); the European corn borer, 4strinia nubilalis (family Pyralidae); and the tobacco budworm, Heliothis virescens (family Noctuidae). A
dilution series of each protein was surface-layered on the artificial diet to determine' the LCSO value. The artificial diet consisted of: agar (20 g), water (1,000 ml), corn flour (96 g, ICN Biochemicals), yeast (30 g), wheat germs (64 g, 1CN
Biochemicals), wesson salt (7.5 g, ICN Biochemicals), casein (15 g), sorbic acid (2 g), aureomycin (0.3 g), nipagin (1 g), wheat germ oil (4 ml), sucrose (15 g), cholesterol (1 g), ascorbic acid (3.5 g), Vanderzand modified vitamin mix (12 g, ICN
Biochemicals).
Larvae were placed on the diet in multi-well plates, 1 larva per well (2 for Ostrinia nubilalis). For each dilution, 24 larvae were tested, and dead and living larvae were counted after 5 days. Prior to application, the mutant proteins were digested with trypsin to release the toxin fragments. For each mutant protein, the assays are repeated at least 5 times, using two different protein preparations. As control protein, the trypsin-digested Cry9C(R164A) protein was used. The Cry9C(R164A) protein has the amino acid sequence of SEQ ID No. 2 wherein the arginine at position was replaced by alanine. This protein was found to be more stable than the wild-type Cry9C toxin while retaining its toxicity to the test insects (see, e.g., PCT
patent publication WO 94/24264). The LCSO values were calculated with the POLO-program, which is based on the probit analysis (POLO-PC, LeOra Software, 1119 Shattuck Ave., Berkeley California 94707). The results of these assays for those protein mutants which gave an LCSO value that is significantly different from that of the control protein in repeated bio assays are summarized in Table 1. It is clear that different positions in the Cry9C protein when substituted to alanine cause increased toxicity in each of the tested insects.
Binding assays on isolated brush border membrane vesicles of Heliothis virescens and Ostrinia nubilalis performed as described in Van Rie et al.
(1990, Appl.
Environm. Microbiol. 56, 1378-1385) showed that for all, with the exception of two, of the modified Cry9C proteins with altered toxicity, receptor binding is also altered (e.g., an observed shift in K~ value), thus confirming that for most amino acid residues altered toxicity is due to altered receptor binding. Hence, these residues are proper candidates for improvement of toxicity by amino acid randomization at or near the identified critical position.
3. COMPETITION BINDING EXPERIMENTS
The Cry9C(R164A) protein was tested in competition binding assays using the ECL protein biotinylation system (Amersham Life Sciences, Amersham International plc., UK) as described by Lambent et al. (1996, supra) to determine if competition occurred with other Bt toxins in selected insects. For the assays, 3ng biotinylated Cry9C(R164A) protein was added to 30 Ng brush border membrane vesicles in PBS
buffer (comprising 0,1 % BSA) in the presence of a 300-fold excess of non-biotinylated toxin (homologous competition assays were included in every test as control). Repeated competition tests showed that in both Ostrinia nubilaiis and Heliothis virescens brush border membranes, there was no detectable competition in receptor binding between the (activated) Cry9C(R164A) protein and any one of the following (activated) Bt toxins: the Cry1 Aa (Schnepf et al., 1985, J. Biol.
Chem. 260, 6264-6272), CrylAb (Hofte et a1.,1986, Eur. J. Biochem. 161, 271-280), CrylAc (Adang et al., 1985, Gene 36, 289-300), Cry1 B (Brizzard & Whiteley, 1988, Nucl.
Acids Res. 16, 4168-4169) and Cry1 C (Honee et al., 1988, Nucl. Acids Res. 16, 6240) toxins. Thus, in these insects the Cry9C(R164A) protein binds to a different receptor than these other Bt toxins. In Diatreae grandiosella competition assays, it was found that the Cry9C(R164A) does compete for a receptor site with the Cry1 B
and Cry1 C Bt toxins, but does not compete with any one of the Cry1 Aa, Cry1 Ab, and Cry1 Ac toxins.
The same results are found for all three insects when testing the Cry9C
~ protein with the amino acid sequence of SEQ ID No. 2 from amino acids 1-658.
Thus, in all these three insects, combination of the Cry9C and a selected non-competitively binding Bt toxin with good toxicity to the target insect can be used simultaneously in order to prevent or delay insect resistance development. In transgenic corn plants, a particularly interesting combination would be the Cry9C (or its protease-resistant variant} and a Cry1 B and/or any of the Cry1 A-type toxins for Osfrinia nubilalis control and the Cry9C (or its protease-resistant variant) and any one of the Cry1 A-type toxins, preferably a Cry1 Ab-type toxin, for D.
grandiosella control. For Heliothis virescens control, the Cry9C (or its protease-resistant variant) and any of the Cry1 A-type toxins are preferred toxins to be co-expressed.
4. CONSTRUCTION OF IMPROVED CRY9C PROTEINS
The modified position in every mutant protein of Example 2 giving rise to a significantly decreased or increased toxicity to an insect species is altered to all other amino acids and the toxicity is re-evaluated. The amino acids yielding the highest toxicity at a particular position are combined to form an improved Cry9C
protein.
Also the alanine mutants yielding an increase in toxicity (up-mutant amino acid positions) are included in such combinations to form improved Cry9C proteins for the selected insect species. Table 1 indeed shows already two up-mutant proteins for every insect tested. Analysis of all these improved Cry9C proteins in the bio assay shows that combinations of up-mutant amino acid positions can substantially increase toxicity of the Cry9C protein towards selected insect species.
5. GENE CONSTRUCTION AND PLANT TRANSFORMATION
A modified DNA sequence encoding a truncated Cry9C(R164K) protein for expression in corn and cotton plants is shown in SEQ lD No. 3. This DNA
sequence has an optimized codon usage for plants and encodes an N- and C-terminally truncated Cry9C protein wherein an arginine amino acid has been replaced by a lysine (at position 123 in SEQ iD No. 3). Based on this DNA sequence, DNA
sequences are made encoding the above improved Cry9C proteins and comprising amino acids 1 to 666 of the Cry9C(R164K) protein. Preferred codons to encode the amino acid replacements in the improved Cry9C proteins are those which are most preferred by the plant host (see, e.g., Murray, 1989, supra). A chimeric improved cry9C gene comprising the 35S promoter and 35S 3' transcription termination and polyadenylation signal is constructed by routine molecular biology techniques as described in the detailed description.
Corn cells are stably transformed by either Agrobacterium-mediated transformation (Ishida et al., 1996, supra and U.S. Patent No. 5,591,616) or by electroporation using wounded and enzyme-degraded embryogenic callus, as described in WO 92/09696 or US Patent 5,641,664 (incorporated herein by reference). The resulting transformed cells are selected by means of the incorporated selectable marker gene, grown into plants and tested for susceptibility towards insects. Corn plants expressing a truncated improved Cry9C(R164K) protein wherein the amino acids at positions 364, 488, 319 and 321 have been replaced into alanine show a significantly higher protection from Ostrinia nubilalis and Diatraea grandiosella damage in comparative tests against corn plants expressing a truncated Cry9C(R164K} protein. A positive correlation is found between the level of expression, as measured by RNA and protein analysis, and the observed insecticidal effect.
Cotton cells are stably transformed by Agrobacterium-mediated transformation (Umbeck et al., 1987, Bio/Technology 5, 263-266; US Patent 5,004,863, incorporated herein by reference). The resulting transformed cells are selected by means of the incorporated selectable marker gene, grown into plants and tested for susceptibility towards insects. Cotton plants expressing the truncated improved Cry9C(R164K, L321 A, P329A) protein at similar levels than cotton plants expressing the truncated Cry9C(R164K) protein show a significantly higher protection from Heliofhis virescens damage. A positive correlation is found between the level of expression, as measured by RNA and protein analysis, and the observed insecticidal effect.

The examples and embodiments of this invention described herein are only supplied for illustrative purposes. Many variations and modifications in accordance with the present invention are known to the person skilled in the art and are included . in this invention and the scope of the claims. For instance, it is possible to alter, delete or add some nucleotides or amino acids to certain regions of the DNA or ~ protein sequences of the invention without departing from the invention.
All publications (including patent publications) referred to in this application are hereby incorporated by reference, particularly WO 94/05771, WO 94/24264, and Lambert et al. (1996, supra).

Table 1: relative toxicity of modified trypsin-digested Cry9C proteins to different insects when compared with the Cry9C(R164A) trypsin-digested protein (mutant 'F313A': the Cry9C(R164A) trypsin-digested protein wherein also the phenylalanine at position 313 is replaced by alanine; 'down(2x)': mutant protein with a significantly lower toxicity (LC50 value about 2 times higher than the control protein), 'up (2x)':
mutant with a significantly higher toxicity (LC50 value about two times lower than that of the control protein), '-': no difference in toxicity found):
mutant H. virescens O. nubilalis D. grandiosella F313A down {2x) - -P3i6A - - up (2x) A317V - - up (2x) N318A down (2-3x) - -V319A - - up (3x) L321 A up (2x) - up (2x) R323A down (3x) - -W325A down (4-5x) down (2x) down (2-3x) P329A up (2x) - -Y330A - down (1.5x) up (2x) V362A down (3-4x) - -S364A - up (2x) -D368A down (2-3x) - -Y369A - - up (2x) R418A down ( 16x) down (2x) -A420V down (12x) - -L421 A - down (2x) -1422A - - up (2x) F480A down (5x) - down (40x) mutant H. virescens O. nubilalis D. grandiosella Q481 A down (3x) - -N483A - - down (2x) Q484A - - down (20x}

A485V down (3x) down (2x) down (20x) S487A down (2x) - down (20x) 1488A down (2x) up (2-3x) down (5x}

N490A - - down (20x) A491 V - - down (3x) SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: PLANT GENETIC SYSTEMS N.V.
(B) STREET: Jozef Plateaustraat 22 (C) CITY: Gent (E) COUNTRY: Belgium (F) POSTAL CODE (ZIP): B-9000 (G) TELEPHONE: (32)(9)2358411 (H) TELEFAX: (32)(9)2231923 (ii) TITLE OF INVENTION: Improved Bacillus thuringiensis toxin (iii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/884,389 (B) FILING DATE: 27-JUN-1997 (2) INFORMATION FOR SEQ ID N0: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4344 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: -(B) LOCATION:668..4141 (D) OTHER INFORMATION:/note= "coding sequence"
(xi) SEQUENCE
DESCRIPTION:
SEQ
ID NO:
1:

TCAAGTATCAGGTTTGTTTTGTTTTGTATATGAGTAAGAACCGAAGGTTTGTP.AAAAAGA480 GATTGAGAGT AAAGATATAT
ATATATAAAT ACAATAAAGA

GATATGATAT GAACATGCAC
TAGATTTATA GTATAGGAGG

CCCATTGTGG

' GTGTCCATCA GATGACGATG TGAGGTATCC TTTGGCAAGT GACCCAAATG 780 CAGCGTTACA

ATTCTTATAT

CTGTTGTTGG

TTTATCAATT

TCATGCGACA

CACTTGCAAG

ATTGGTTGGC

CTTTAGACCT

CATTACTGTC

CTCTTTTTGG

AATTGGAACT

ATCGTTTAAG

TGACTTTAGT

CAACGGGATC

CACCAGCTAA

AGCTCGAAAA

TCAGCAGTAA

TACGCCGTAG

CCACAAGAGC

TAGATTTTCG

GAGGCTTGTT

CAAATGATGA

TTACCTTTTT

CTGGATCTAT AGCTAATGCA
GGAAGTGTAC CTACTTATGT

ACCTTAATAA TACGATTACC
CCAAATAGAA TTACACAATT

CACCTGTTTC GGGTACTACG
GTCTTAAAAG GTCCAGGATT

GAAGAACAAC TAATGGCACA
TTTGGAACGT TAAGAGTAAC

AACAATATCG CCTAAGAGTT
CGTTTTGCCT CAACAGGAAA

1~AAAAAGGTAAAATGAATAGAACCCCCTACTGGTAGAAGGACCGATAGGGGGTTCTTACA 4260 TGAAAAAATGTAGCTGTTTACTAAGGTGTATAAAAAACAGCATATCTGATAGAAP.AAAGT4320 (2) INFORMATION FOR SEQ ID N0: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1157 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Asn Arg Asn Asn Gln Asn Glu Tyr Glu Ile Ile Asp Ala Pro His Cys Gly Cys Pro Ser Asp Asp Asp Val Arg Tyr Pro Leu Ala Ser Asp Pro Asn Ala Ala Leu Gln Asn Met Asn Tyr Lys Asp Tyr Leu Gln Met Thr Asp Glu Asp Tyr Thr Asp Ser Tyr Ile Asn Pro Ser Leu Ser Ile Ser Gly Arg Asp Ala Val Gln Thr Ala Leu Thr Val Val Gly Arg Ile Leu Gly Ala Leu Gly Val Pro Phe Ser Gly Gln Ile Val Ser Phe Tyr Gln Phe Leu Leu Asn Thr Leu Trp Pro Val Asn Asp Thr Ala Ile Trp Glu Ala Phe Met Arg Gln Val Glu Glu Leu Val Asn Gln Gln Ile Thr Glu Phe Ala Arg Asn Gln Ala Leu Ala Arg Leu Gln Gly Leu Gly Asp Ser Phe Asn Val Tyr Gln Arg Ser Leu Gln Asn Trp Leu Ala Asp Arg Asn Asp Thr Arg Asn Leu Ser Val Val Arg Ala Gln Phe Ile Ala Leu Asp Leu Asp Phe Val Asn Ala Ile Pro Leu Phe Ala Val Asn Gly Gln Gln Val Pro Leu Leu Ser Val Tyr Ala Gln Ala Val Asn Leu His Leu Leu Leu Leu Lys Asp Ala Ser Leu Phe Gly Glu Gly Trp Gly Phe Thr Gln Gly Glu Ile Ser Thr Tyr Tyr Asp Arg Gln Leu Glu Leu Thr Ala Lys Tyr Thr Asn Tyr Cys Glu Thr Trp Tyr Asn Thr Gly Leu Asp Arg Leu Arg Gly Thr Asn Thr Glu Ser Trp Leu Arg Tyr His Gln Phe Arg Arg Glu Met Thr Leu Val Val Leu Asp Val Val Ala Leu Phe Pro Tyr 275 280 285 _ Tyr Asp Val Arg Leu Tyr Pro Thr Gly Ser Asn Pro Gln Leu Thr Arg Glu Val Tyr Thr Asp Pro Ile Val Phe Asn Pro Pro Ala Asn Val Gly Leu Cys Arg Arg Trp Gly Thr Asn Pro Tyr Asn Thr Phe Ser Glu Leu Glu Asn Ala Phe Ile Arg Pro Pro His Leu Phe Asp Arg Leu Asn Ser Leu Thr Ile Ser Ser Asn Arg Phe Pro Val Ser Ser Asn Phe Met Asp Tyr Trp Ser Gly His Thr Leu Arg Arg Ser Tyr Leu Asn Asp Ser Ala Val Gln Glu Asp Ser Tyr Gly Leu Ile Thr Thr Thr Arg Ala Thr Ile Asn Pro Gly Val Asp Gly Thr Asn Arg Ile Glu Ser Thr Ala Val Asp Phe Arg Ser Ala Leu Ile Gly Ile Tyr Gly Val Asn Arg Ala Ser Phe Val Pro Gly Gly Leu Phe Asn Gly Thr Thr Ser Pro Ala Asn Gly Gly Cys Arg Asp Leu Tyr Asp Thr Asn Asp Glu Leu Pro Pro Asp Glu Ser Thr Gly Ser Ser Thr His Arg Leu Ser His Val Thr Phe Phe Ser Phe Gln Thr Asn Gln Ala Gly Ser Ile Ala Asn Ala Gly Ser Val Pro Thr Tyr Val Trp Thr Arg Arg Asp Val Asp Leu Asn Asn Thr Ile Thr Pro Asn Arg Ile Thr Gln Leu Pro Leu Val Lys Ala Ser Ala Pro Val Ser Gly Thr Thr Val Leu Lys Gly Pro Gly Phe Thr Gly Gly Gly Ile Leu Arg Arg Thr Thr Asn Gly Thr Phe Gly Thr Leu Arg Val Thr Val Asn Ser Pro Leu Thr Gln Gln Tyr Arg Leu Arg Va1 Arg Phe Ala Ser Thr Gly Asn Phe Ser hle Arg Val Leu Arg Gly Gly Val Ser Ile Gly Asp Val Arg Leu Gly Ser Thr Met Asn Arg Gly Gln Glu Leu Thr Tyr Glu Ser Phe Phe Thr Arg Glu Phe Thr Thr Thr Gly Pro Phe Asn Pro Pro Phe Thr Phe Thr Gln Ala Gln Glu Ile Leu Thr Val Asn Ala Glu Gly Val Ser Thr Gly Gly Glu Tyr Tyr Ile Asp Arg Ile Glu Ile Val Pro Val Asn Pro Ala Arg Glu Ala Glu Glu Asp Leu Glu A1a Ala Lys Lys Ala Val Ala Ser Leu Phe Thr Arg Thr Arg Asp Gly Leu Gln Val Asn Val Thr Asp Tyr Gln Val Asp Gln Ala Ala Asn Leu Val Ser Cys Leu Ser Asp Glu Gln Tyr Gly His Asp Lys Lys Met Leu Leu Glu Ala Val Arg Ala Ala Lys Arg Leu Ser Arg Glu Arg Asn Leu Leu Gln Asp Pro Asp Phe Asn Thr Ile Asn Ser Thr Glu Glu Asn Gly Trp Lys Ala Ser Asn Gly Val Thr Ile Ser Glu Gly Gly Pro Phe Phe Lys Gly Arg Ala Leu Gln Leu Ala Ser Ala Arg Glu Asn Tyr Pro Thr Tyr Ile Tyr Gln Lys Val Asp Ala Ser Val Leu Lys Pro Tyr Thr Arg Tyr Arg Leu Asp Gly Phe Val Lys Ser Ser Gln Asp Leu Glu Ile Asp Leu Ile His His His Lys Val His Leu Val Lys Asn Val Pro Asp Asn Leu Val Ser Asp Thr Tyr Ser Asp Gly Ser Cys Ser Gly Ile Asn Arg Cys Asp Glu Gln His Gln Val Asp Met Gln Leu Asp Ala Glu His His Pro Met Asp Cys Cys Glu Ala Ala Gln Thr His Glu Phe Ser Ser Tyr Ile Asn Thr Gly Asp Leu Asn Ala Ser Val Asp Gln Gly Ile Trp Val Val Leu Lys Val Arg Thr Thr Asp Gly Tyr Ala Thr Leu Gly Asn Leu Glu Leu Val Glu Val Gly Pro Leu Ser Gly Glu Ser Leu Glu Arg Glu Gln Arg Asp Asn Ala Lys Trp Asn Ala Glu Leu Gly Arg Lys Arg Ala Glu Ile Asp Arg Val Tyr Leu Ala Ala Lys Gln Ala Ile Asn His Leu Phe Val Asp Tyr Gln Asp Gln Gln Leu Asn Pro Glu Ile Gly Leu Ala Glu Ile Asn Glu Ala Ser Asn Leu Val Glu Ser Ile Ser Gly Val Tyr Ser Asp Thr Leu Leu Gln Ile Pro Gly Ile Asn Tyr Glu Ile Tyr Thr Glu Leu Ser Asp Arg Leu Gln Gln Ala Ser Tyr Leu Tyr Thr Ser Arg Asn Ala Val Gln Asn Gly Asp Phe Asn Ser Gly Leu Asp Ser Trp Asn Thr Thr Met Asp Ala Ser Val Gln Gln Asp Gly Asn Met His Phe Leu Val Leu Ser His Trp Asp Ala Gln Val Ser Gln Gln Leu Arg Val Asn Pro Asn Cys Lys Tyr Val Leu Arg Val Thr Ala Arg Lys Val Gly Gly Gly Asp Gly Tyr Val Thr Ile Arg Asp Gly Ala His His Gln Glu Thr Leu Thr Phe Asn Ala Cys Asp Tyr Asp Val Asn Gly Thr Tyr Val Asn Asp Asn Ser Tyr Ile Thr Glu Glu Val Val Phe Tyr Pro Glu Thr Lys His Met Trp Val Glu Val Ser Glu Ser Glu Gly Ser Phe Tyr Ile Asp Ser Ile Glu Phe Ile Glu Thr Gln Glu (2) INFORMATION FOR SEQ ID N0: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1897 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "synthetic DNA"

(ix) FEATURE:
(A) NAME/KEY: -(B) LOCATION:13..1890 (D) OTHER INFORMATION:/note = ~"coding sequence"
(xi) SEQUENCE DESCRIPTION:
SEQ ID NO: 3:

ATGACCGACG

GCGACGTGCG
CCTGGGCAGC

(2) INFORMATION FOR SEQ ID N0: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 625 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 4:
Met Ala Asp Tyr Leu Gln Met Thr Asp Glu Asp Tyr Thr Asp Ser Tyr Ile Asn Pro Ser Leu Ser Ile Ser Gly Arg Asp Ala Val Gln Thr Ala Leu Thr Val Val Gly Arg Ile Leu Gly Ala Leu Gly Val Pro Phe Ser Gly Gln Ile Val Ser Phe Tyr Gln Phe Leu Leu Asn Thr Leu Trp Pro Val Asn Asp Thr Ala Ile Trp Glu Ala Phe Met Arg Gln Val Glu Glu Leu Val Asn Gln Gln Ile Thr Glu Phe Ala Arg Asn Gln Ala Leu Ala Arg Leu Gln Gly Leu Gly Asp Ser Phe Asn Val Tyr Gln Arg Ser Leu Gln Asn Trp Leu Ala Asp Arg Asn Asp Thr Lys Asn Leu Ser Val Val Arg Ala Gln Phe Ile Ala Leu Asp Leu Asp Phe Val Asn Ala Ile Pro Leu Phe Ala Val Asn Gly Gln Gln Val Pro Leu Leu Ser Val Tyr Ala Gln Ala Val Asn Leu His Leu Leu Leu Leu Lys Asp Ala Ser Leu Phe Gly Glu Gly Trp Gly Phe Thr Gln Gly Glu Ile Ser Thr Tyr Tyr Asp Arg Gln Leu Glu Leu Thr Ala Lys Tyr Thr Asn Tyr Cys Glu Thr Trp W0.99/00407 PCT/EP98/04033 Tyr Asn Thr Gly Leu Asp Arg Leu Arg Gly Thr Asn Thr Glu Ser Trp Leu Arg Tyr His Gln Phe Arg Arg Glu Met Thr Leu Val Val Leu Asp Val Val Ala Leu Phe Pro Tyr Tyr Asp Val Arg Leu Tyr Pro Thr Gly Ser Asn Pro Gln Leu Thr Arg Glu Val Tyr Thr Asp Pro Ile Val Phe Asn Pro Pro Ala Asn Val Gly Leu Cys Arg Arg Trp Gly Thr Asn Pro Tyr Asn Thr Phe Ser Glu Leu Glu Asn Ala Phe Ile Arg Pro Pro His Leu Phe Asp Arg Leu Asn Ser Leu Thr Ile Ser Ser Asn Arg Phe Pro Val Ser Ser Asn Phe Met Asp Tyr Trp Ser Gly His Thr Leu Arg Arg Ser Tyr Leu Asn Asp Ser Ala Val Gln Glu Asp Ser Tyr Gly Leu Ile Thr Thr Thr Arg Ala Thr Ile Asn Pro Gly Val Asp Gly Thr Asn Arg Ile Glu Ser Thr Ala Val Asp Phe Arg Ser Ala Leu Ile Gly Ile Tyr Gly Val Asn Arg Ala Ser Phe Val Pro Gly Gly Leu Phe Asn Gly Thr Thr Ser Pro Ala Asn Gly Gly Cys Arg Asp Leu Tyr Asp Thr Asn Asp Glu Leu Pro Pro Asp Glu Ser Thr Gly Ser Ser Thr His Arg Leu Sex His Val Thr Phe Phe Ser Phe Gln Thr Asn Gln Ala Gly Ser Ile Ala Asn Ala Gly Ser Val Pro Thr Tyr Val Trp Thr Arg Arg Asp Val Asp Leu Asn Asn Thr Ile Thr Pro Asn Arg Ile Thr Gln Leu Pro Leu Val Lys Ala Ser Ala Pro Val Ser Gly Thr Thr Val Leu Lys Gly Pro Gly Phe Thr Gly Gly Gly Ile Leu Arg Arg Thr Thr Asn Gly Thr Phe Gly Thr Leu Arg Val Thr Val Asn Ser Pro Leu Thr Gln Gln Tyr Arg Leu Arg Val Arg Phe Ala Ser Thr Gly Asn Phe Ser Ile Arg Val Leu Arg Gly Gly Val Ser Ile Gly Asp Val Arg Leu Gly Ser Thr Met Asn Arg Gly Gln Glu Leu Thr Tyr Glu Ser Phe Phe Thr Arg Glu Phe Thr Thr Thr Gly Pro Phe Asn Pro Pro Phe Thr Phe Thr Gln Ala Gln Glu Ile Leu Thr Val Asn Ala Glu Gly Val Ser Thr Gly Gly Glu Tyr Tyr Ile Asp Arg Ile Glu Ile Val Pro Val Asn Pro Ala Arg Glu Ala Glu Glu Asp

Claims (16)

Claims

1. A modified Cry9C protein with an improved toxicity to an insect species, comprising the amino acid sequence of SEQ ID No. 2 or an insecticidally-effective fragment thereof, wherein at least one amino acid in one of the following regions in SEQ ID No. 2 is replaced by another amino acid: 313-334, 358-369, 418-425, 480-492.

2. A modified Cry9C protein with an improved toxicity to an insect species, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid 658, wherein at least one of the amino acids at the following positions in SEQ ID No. 2 have been replaced by another amino acid:
313, 316, 317, 318, 319, 321, 323, 325, 329, 330, 368, 369, 418, 420, 421, 422, 480, 481, 483, 484, 485, 487, 488, 490 and 491.

3. The modified Cry9C protein of claim 1 wherein said at least one amino acid position is position 316, 317, 319, 321, 329, 330, 369, 422, or 488 in SEQ ID
No. 2.

4. The modified Cry9C protein of claim 1 with improved toxicity to Ostrinia nubilalis, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein at least the amino acids at positions 364 and 488 in SEQ ID No. 2 are replaced by other amino acids.

5. The modified Cry9C protein of claim 1 with improved toxicity to Heliothis virescens, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein the amino acid at position 321 or position 329 in SEQ ID No 2, is replaced by another amino acid.

6. The modified Cry9C protein of claim 1 with improved toxicity to Diatraea grandiosella, comprising the amino acid sequence of SEQ ID No. 2 from amino acid position 1 or 44 to amino acid position 658, wherein the amino acid at any or all of amino acid positions 316, 317, 319, 321, 330, 369, or 422 in SEQ ID No. 2 is replaced by another amino acid.

7. The modified Cry9C protein of any one of claims 1 to 6 wherein the arginine at position 164 in SEQ ID No. 2 is replaced by another amino acid.

8. The modified Cry9C protein of any one of claims 1 to 6 wherein said at least one amino acid position is replaced by alanine.

9. A DNA sequence encoding the protein of any one of claims 1 to 6.

10. A DNA sequence encoding the protein of claim 7 or 8.

11. A plant, comprising the DNA of claim 9 or 10.

12. A seed, comprising the DNA of claim 9 or 10.

13. The plant of claim 11 which is selected from the group consisting of:
corn, cotton, rice, oilseed rape, cauliflower, broccoli, soybean, tomato, tobacco, potato, eggplant, beet, oat, pepper, gladiolus, dahlia, chrysanthemum, sorghum, and garden peas.

14. A method for controlling insects feeding on a plant, comprising expressing the protein of any one of claims 1 to 6 in a plant.

15. A method for controlling insects feeding on a plant, comprising growing the plant of Claim 11.

16. A method of obtaining a seed comprising the DNA of Claim 9 or 10 comprising inserting said DNA into the genome of a plant and harvesting the seed from said plant.