CA2284730A1 - Methods of modulating p33ing1 mediated apoptosis - Google Patents
Methods of modulating p33ing1 mediated apoptosis Download PDFInfo
- Publication number
- CA2284730A1 CA2284730A1 CA002284730A CA2284730A CA2284730A1 CA 2284730 A1 CA2284730 A1 CA 2284730A1 CA 002284730 A CA002284730 A CA 002284730A CA 2284730 A CA2284730 A CA 2284730A CA 2284730 A1 CA2284730 A1 CA 2284730A1
- Authority
- CA
- Canada
- Prior art keywords
- cell
- cells
- ing1
- biological activity
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4747—Apoptosis related proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Abstract
The invention provides novel methods for modulating apoptosis in eukaryotic cells using peptides and proteins derived from p33ING1 or oligonucleotides derived from the ING1 gene. The invention also provides method of determining the apoptotic characteristic of a eukaryotic cell.
Description
FIELD OF THE INVENTION
This invention relates to a method for modulating apoptosis in cells. The - 5 method of modulation involves using a protein, ING1, and related proteins and peptides, nucleic acids encoding this and related proteins and peptides, and nucleic acids complementary to nucleic acids encoding p33'NC' .
This invention also relates to a method for determining the apoptotic characteristic of cells using oligonucleotides from the ING1 gene, p33ING1 peptides and antibodies directed against p33INC' peptides.
BACKGROUND OF THE INVENTION
Apoptosis is a form of programmed cell death which occurs through the activation of cell-intrinsic suicide machinery. The biochemical machinery responsible for apoptosis is expressed in most, if not all, cells. Apoptosis is primarily a physiologic process necessary to remove individual cells that are no longer needed or that function abnormally. Apoptosis is a regulated event dependent upon active metabolism and protein synthesis by the dying cell.
Apoptosis plays a major role during development and homeostasis. Apoptosis can be triggered in a variety of cell types by the deprivation of growth factors, which appear to repress an active suicide response. Apoptosis is particularly important for the physiology of the immune system. Apoptosis is the mode of death of centroblasts with low affinity for antigen within germinal centers, cells killed by specific cytotoxic T
lymphocytes or natural killer cells, as well as thymocytes bearing high-affinity T-cell receptors for self antigens that are clonally deleted during thymus development (negative selection).
The morphological and biochemical characteristics of cells dying by apoptosis differ markedly from those of cells dying by necrosis. During apoptosis, cells decrease in size and round up. The nuclear chromatin undergoes condensation and fragmentation. Cell death is preceded by DNA fragmentation. The DNA of apoptotic cells is nonrandomly degraded by endogenous calcium and magnesium-dependent endonuclease(s) inhibited by zinc ions. This enzymes) gives fragments of approx. 200 base pairs (bp) or multiples of 200 by by cutting the linker DNA running between nucleosomes. Thus DNA appears to be one of the most important targets of the process that leads to cell suicide. The apoptotic cell then breaks apart into many plasma membrane-bound vesicles called "apoptotic bodies," which contain fragments of condensed chromatin and morphologically intact organelles such as mitochondria.
Apoptotic cells and bodies are rapidly phagocytosed, thereby protecting surrounding tissues from injury. The rapid and efficient clearance of apoptotic cells makes apoptosis extremely difficult to detect in tissue sections.
In contrast, necrosis is associated with rapid metabolic collapse that leads to cell swelling, early loss of plasma membrane integrity, and ultimate cell rupture.
Cytosolic contents leach from the necrotic cell causing injury and inflammation to surrounding tissue.
Recent studies show that multiple cytotoxic stimuli well known to cause necrosis can lead to apoptosis instead when cells are exposed to the same noxious agents at lower concentrations. This insight has led to an interest in the role of apoptosis in the pathogenesis of renal diseases that result primarily from injury to renal tubular epithelial cells. These diseases include acute and chronic renal failure from exposure of the kidney to ischemia or to cytotoxic agents. There is also an interest in the role of apoptosis in Alzheimers and other neurological diseases.
Several genes associated with apoptosis have been identified. Examples include the p53 gene, which is involved in osteosarcoma and adrenocortical, breast and brain cancers;
The gene cloned and sequenced as described herein, ING1 (formerly called p33I°'), represents a new gene which is expressed in normal mammary epithelial cells, but expressed only at lower levels in several cancerous mammary epithelial cell lines and is not expressed in many primary brain tumors.
WO 98!44102 PCTICA98/00277 SUMMARY OF THE INVENTION
The present invention is directed to a method to potentiate apoptosis in a eukaryotic cell, which method comprises selecting said eukaryotic cell; and increasing the p33INC1 biological activity in said eukaryotic cell. It is contemplated that the p33INC' biological activity in said eukaryotic cell may be increased by introducing into said eukaryotic cell an effective amount of a peptide comprising p33'NC' biological activity or by introducing into said eukaryotic cell an effective amount of an oligonucleotide which codes for a peptide comprising p33'NC' biological activity under conditions such that a peptide comprising p33INC' biological activity is expressed by the cell.
Another aspect of the invention provides a method to inhibit apoptosis of a eukaryotic cell, which method comprises selecting said eukaryotic cell; and reducing the effective quantity of p33'NCl biological activity in said eukaryotic cell.
It is contemplated that the effective quantity of p33INC' biological activity may be reduced by administering to the cell a single-stranded oligonucleotide of at least 20 nucleotides which comprises a sequence substantially identical to the complement of the cDNA
sequence of Figure 3 or by administering to the cell a double-stranded oligonucleotide which comprises a sequence substantially identical to the cDNA sequence of Figure 3 under conditions such that a nucleic acid of at least 20 nucleotides having a sequence which is substantially identical to the complement of the cDNA sequence of Figure 3 is expressed. It is also contemplated that the effective quantity of p33'NCl biological activity may be reduced by inactivating the ING1 gene in the cell.
Another aspect of the invention provides a method for determining the apoptotic characteristic of a eukaryotic cell which method comprises selecting said cell; and determining the level of expression of native p33'NC' in said cell and comparing it to the level of expression of native p33INC' in a non-apoptotic cell wherein an increased level of p33'NC' expression in the cell denotes a cell having the potential to be apoptotic. It is contemplated that the level of expression may be determined by exposing the cell to detestably labelled anti-ING1 antibodies or by exposing the cell to a detestably labelled single-stranded oligonucleotide of at least 100 nucleotides which comprises a sequence substantially identical to the complement of the cDNA sequence of Figure 3 under conditions such that the oligonucleotide will bind to any ING1 mRNA present in the cell to determine the level of expression of mRNA ING1 in the cells. It is also contemplated that the level of expression may be determined by exposing the cell to two single-stranded oligonucleotides of from 15 to 25 nucleotides in length, wherein the first oligonucleotide binds to one region of the INGI mRNA and the second oligonucleotide binds to a sequence complementary to another region of the cDNA under conditions wherein polymerase chain reaction can occur and any ING1 mRNA in the cell will be amplified and labelled.
A still further aspect of the invention provides an assay for determining the level of p33'NC' activity in a eukaryotic cell, which assay comprises selecting the eukaryotic cell; determining the p33Inra' biological activity in the cell; and correlating the biological activity against a curve of the p33INC~ biological activity in certain cell types.
A still further aspect of the invention is an isolated eukaryotic cell substantially free of p33'N~' biological activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA to 1C illustrate the strategy and biological assays used for cloning ING1.
Figure 2 sets forth the partial cDNA sequence of ING1 (SEQ ID NO: 1) and the predicted amino acid sequence (SEQ ID NO: 2) of p33'Nm Figure 3 sets forth the complete cDNA sequence of INGl (SEQ ID NO: 9) and the predicted amino acid sequence (SEQ ID NO: 10) of p33'NC' .
Figures 4A to 4C illustrate the effects of P33'NC' overexpression.
Figure 5 illustrates the changes in p33'NCl protein levels in breast cancer cell lines. Figure 5A is a Western blot. Figure 5B is a picture of the coomassie-blue stained gel of Figure 5A.
Figure 6A illustrates Western blotting of neuroblastoma cell lines with anti-p33INC~ antibody. Figure 6B illustrates a Southern blot of neuroblastoma cell line compared to a normal diploid cell strain for ING1 DNA. Figure 6C illustrates the RT-PCR reaction on a neuroblastoma cell line compared to a control diploid fibroblast.
This invention relates to a method for modulating apoptosis in cells. The - 5 method of modulation involves using a protein, ING1, and related proteins and peptides, nucleic acids encoding this and related proteins and peptides, and nucleic acids complementary to nucleic acids encoding p33'NC' .
This invention also relates to a method for determining the apoptotic characteristic of cells using oligonucleotides from the ING1 gene, p33ING1 peptides and antibodies directed against p33INC' peptides.
BACKGROUND OF THE INVENTION
Apoptosis is a form of programmed cell death which occurs through the activation of cell-intrinsic suicide machinery. The biochemical machinery responsible for apoptosis is expressed in most, if not all, cells. Apoptosis is primarily a physiologic process necessary to remove individual cells that are no longer needed or that function abnormally. Apoptosis is a regulated event dependent upon active metabolism and protein synthesis by the dying cell.
Apoptosis plays a major role during development and homeostasis. Apoptosis can be triggered in a variety of cell types by the deprivation of growth factors, which appear to repress an active suicide response. Apoptosis is particularly important for the physiology of the immune system. Apoptosis is the mode of death of centroblasts with low affinity for antigen within germinal centers, cells killed by specific cytotoxic T
lymphocytes or natural killer cells, as well as thymocytes bearing high-affinity T-cell receptors for self antigens that are clonally deleted during thymus development (negative selection).
The morphological and biochemical characteristics of cells dying by apoptosis differ markedly from those of cells dying by necrosis. During apoptosis, cells decrease in size and round up. The nuclear chromatin undergoes condensation and fragmentation. Cell death is preceded by DNA fragmentation. The DNA of apoptotic cells is nonrandomly degraded by endogenous calcium and magnesium-dependent endonuclease(s) inhibited by zinc ions. This enzymes) gives fragments of approx. 200 base pairs (bp) or multiples of 200 by by cutting the linker DNA running between nucleosomes. Thus DNA appears to be one of the most important targets of the process that leads to cell suicide. The apoptotic cell then breaks apart into many plasma membrane-bound vesicles called "apoptotic bodies," which contain fragments of condensed chromatin and morphologically intact organelles such as mitochondria.
Apoptotic cells and bodies are rapidly phagocytosed, thereby protecting surrounding tissues from injury. The rapid and efficient clearance of apoptotic cells makes apoptosis extremely difficult to detect in tissue sections.
In contrast, necrosis is associated with rapid metabolic collapse that leads to cell swelling, early loss of plasma membrane integrity, and ultimate cell rupture.
Cytosolic contents leach from the necrotic cell causing injury and inflammation to surrounding tissue.
Recent studies show that multiple cytotoxic stimuli well known to cause necrosis can lead to apoptosis instead when cells are exposed to the same noxious agents at lower concentrations. This insight has led to an interest in the role of apoptosis in the pathogenesis of renal diseases that result primarily from injury to renal tubular epithelial cells. These diseases include acute and chronic renal failure from exposure of the kidney to ischemia or to cytotoxic agents. There is also an interest in the role of apoptosis in Alzheimers and other neurological diseases.
Several genes associated with apoptosis have been identified. Examples include the p53 gene, which is involved in osteosarcoma and adrenocortical, breast and brain cancers;
The gene cloned and sequenced as described herein, ING1 (formerly called p33I°'), represents a new gene which is expressed in normal mammary epithelial cells, but expressed only at lower levels in several cancerous mammary epithelial cell lines and is not expressed in many primary brain tumors.
WO 98!44102 PCTICA98/00277 SUMMARY OF THE INVENTION
The present invention is directed to a method to potentiate apoptosis in a eukaryotic cell, which method comprises selecting said eukaryotic cell; and increasing the p33INC1 biological activity in said eukaryotic cell. It is contemplated that the p33INC' biological activity in said eukaryotic cell may be increased by introducing into said eukaryotic cell an effective amount of a peptide comprising p33'NC' biological activity or by introducing into said eukaryotic cell an effective amount of an oligonucleotide which codes for a peptide comprising p33'NC' biological activity under conditions such that a peptide comprising p33INC' biological activity is expressed by the cell.
Another aspect of the invention provides a method to inhibit apoptosis of a eukaryotic cell, which method comprises selecting said eukaryotic cell; and reducing the effective quantity of p33'NCl biological activity in said eukaryotic cell.
It is contemplated that the effective quantity of p33INC' biological activity may be reduced by administering to the cell a single-stranded oligonucleotide of at least 20 nucleotides which comprises a sequence substantially identical to the complement of the cDNA
sequence of Figure 3 or by administering to the cell a double-stranded oligonucleotide which comprises a sequence substantially identical to the cDNA sequence of Figure 3 under conditions such that a nucleic acid of at least 20 nucleotides having a sequence which is substantially identical to the complement of the cDNA sequence of Figure 3 is expressed. It is also contemplated that the effective quantity of p33'NCl biological activity may be reduced by inactivating the ING1 gene in the cell.
Another aspect of the invention provides a method for determining the apoptotic characteristic of a eukaryotic cell which method comprises selecting said cell; and determining the level of expression of native p33'NC' in said cell and comparing it to the level of expression of native p33INC' in a non-apoptotic cell wherein an increased level of p33'NC' expression in the cell denotes a cell having the potential to be apoptotic. It is contemplated that the level of expression may be determined by exposing the cell to detestably labelled anti-ING1 antibodies or by exposing the cell to a detestably labelled single-stranded oligonucleotide of at least 100 nucleotides which comprises a sequence substantially identical to the complement of the cDNA sequence of Figure 3 under conditions such that the oligonucleotide will bind to any ING1 mRNA present in the cell to determine the level of expression of mRNA ING1 in the cells. It is also contemplated that the level of expression may be determined by exposing the cell to two single-stranded oligonucleotides of from 15 to 25 nucleotides in length, wherein the first oligonucleotide binds to one region of the INGI mRNA and the second oligonucleotide binds to a sequence complementary to another region of the cDNA under conditions wherein polymerase chain reaction can occur and any ING1 mRNA in the cell will be amplified and labelled.
A still further aspect of the invention provides an assay for determining the level of p33'NC' activity in a eukaryotic cell, which assay comprises selecting the eukaryotic cell; determining the p33Inra' biological activity in the cell; and correlating the biological activity against a curve of the p33INC~ biological activity in certain cell types.
A still further aspect of the invention is an isolated eukaryotic cell substantially free of p33'N~' biological activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA to 1C illustrate the strategy and biological assays used for cloning ING1.
Figure 2 sets forth the partial cDNA sequence of ING1 (SEQ ID NO: 1) and the predicted amino acid sequence (SEQ ID NO: 2) of p33'Nm Figure 3 sets forth the complete cDNA sequence of INGl (SEQ ID NO: 9) and the predicted amino acid sequence (SEQ ID NO: 10) of p33'NC' .
Figures 4A to 4C illustrate the effects of P33'NC' overexpression.
Figure 5 illustrates the changes in p33'NCl protein levels in breast cancer cell lines. Figure 5A is a Western blot. Figure 5B is a picture of the coomassie-blue stained gel of Figure 5A.
Figure 6A illustrates Western blotting of neuroblastoma cell lines with anti-p33INC~ antibody. Figure 6B illustrates a Southern blot of neuroblastoma cell line compared to a normal diploid cell strain for ING1 DNA. Figure 6C illustrates the RT-PCR reaction on a neuroblastoma cell line compared to a control diploid fibroblast.
_ -.~ -...._-__..... r , , .- _..
Figure 7 illustrates the level of ING1 mRNA in control (c) tissue, glioblastoma (GB), astrocytoma {AS) and meningioma (MN) tumors as determined by RT-PCR.
Figures 8A and 8B illustrate the expression of ING1 mRNA and p33INC1 in proliferation competent (y) and in senescent human fibroblasts (o).
Figure 9 illustrates the level of p33'NCl protein through the cell cycle.
Panel A
has anti-cdk2 antibody as a positive control. Panel B shows the results with anti-p33 antibodies. Panel C shows cell cycle profile at each point as determined by FACS:
Figure 10 illustrates the number of cells per colony of cells blocked for ING1 expression.
Figure 1 I illustrates that ING 1 protein levels increase during serum starvation-induced apoptosis of P19 teratocarcinoma cells. Figure 11A shows a Western Blot of protein homogenates probed with a polyclonal antibody specific for ING1.
Figure 11B
shows a trypan blue dye exclusion assay of serum starved P19 cells infected with retroviral constructs expressing antisense ING1 (aS), sense ING1 (s) ,bcl-2 sense (S-bcl-2), bcl-2 antisense (aS-bcl-2) and vector only (V) constructs.
Figure 12A illustrates a Western blot of human c-myc and ING1 expression in NIH 3T3 tet-myc cells retrovirally infected with constructs containing vector (v), antisense (aS) and sense (S) ING1 constructs grown in the presence (+) or absence (-) or tetracycline. Figures 12B - 12D are pictures of cells having vector only (Fig. 12B}, ING1 antisense construct (Fig. 12C) or ING1 sense construct (Fig. 12D) fixed and stained with labelled anti-ING1 antibody.
Figure 13 illustrates that expression of ING1 enhances c-myc-induced apoptosis.
Figure 13A illustrates cell viability of NIH-3T3 tet-myc cells containing antisense (aS), sense (S) INGl or vector only (v) constructs. Figure 13B illustrates the amount of DNA laddering in tet-myc cells expressing INGI sense (S} , antisense (aS), vector (v), bcl-2 and control (c) without vector. Figure 13C illustrates the effect on cell viability of microinjection of GST-ING1 protein.
Figure 7 illustrates the level of ING1 mRNA in control (c) tissue, glioblastoma (GB), astrocytoma {AS) and meningioma (MN) tumors as determined by RT-PCR.
Figures 8A and 8B illustrate the expression of ING1 mRNA and p33INC1 in proliferation competent (y) and in senescent human fibroblasts (o).
Figure 9 illustrates the level of p33'NCl protein through the cell cycle.
Panel A
has anti-cdk2 antibody as a positive control. Panel B shows the results with anti-p33 antibodies. Panel C shows cell cycle profile at each point as determined by FACS:
Figure 10 illustrates the number of cells per colony of cells blocked for ING1 expression.
Figure 1 I illustrates that ING 1 protein levels increase during serum starvation-induced apoptosis of P19 teratocarcinoma cells. Figure 11A shows a Western Blot of protein homogenates probed with a polyclonal antibody specific for ING1.
Figure 11B
shows a trypan blue dye exclusion assay of serum starved P19 cells infected with retroviral constructs expressing antisense ING1 (aS), sense ING1 (s) ,bcl-2 sense (S-bcl-2), bcl-2 antisense (aS-bcl-2) and vector only (V) constructs.
Figure 12A illustrates a Western blot of human c-myc and ING1 expression in NIH 3T3 tet-myc cells retrovirally infected with constructs containing vector (v), antisense (aS) and sense (S) ING1 constructs grown in the presence (+) or absence (-) or tetracycline. Figures 12B - 12D are pictures of cells having vector only (Fig. 12B}, ING1 antisense construct (Fig. 12C) or ING1 sense construct (Fig. 12D) fixed and stained with labelled anti-ING1 antibody.
Figure 13 illustrates that expression of ING1 enhances c-myc-induced apoptosis.
Figure 13A illustrates cell viability of NIH-3T3 tet-myc cells containing antisense (aS), sense (S) INGl or vector only (v) constructs. Figure 13B illustrates the amount of DNA laddering in tet-myc cells expressing INGI sense (S} , antisense (aS), vector (v), bcl-2 and control (c) without vector. Figure 13C illustrates the effect on cell viability of microinjection of GST-ING1 protein.
w0 98/44102 PCT/CA98/00277 DETAILED DESCRIPTION OF THE INVENTION
The invention described herein relates to the discovery of a method for the modulation of apoptosis in eukaryotic cells. The invention also relates to a method for detecting cells having and/or lacking the potential to undergo apoptosis.
Using a strategy based upon subtractive hybridization of normal and cancerous mammary epithelial cell mRNAs and the selection of genetic suppressor elements [3], a novel gene was isolated encoding a 33 kDa protein that is a potent inhibitor of cell growth. Acute expression of transfected constructs encoding p33~NG1 induced apoptosis in cells. Inhibition of translation of the mRNA for this gene prevented apoptosis in cells.
A. Definitions As used herein the following terms have the following meanings:
"Antibody" means a molecule that binds to a known antigen. An "anti-p33'NC' antibody" means an antibody molecule that binds to one or more epitopes of the p33'Nm protein.
"Antisense" and "Antisense nucleotides" means DNA or RNA constructs which block the expression of the naturally-occurring gene product. For example, in the present invention, use of a DNA construct that produces ING1 antisense RNA
blocks the expression of p33INC' by destroying or inactivating ING1 mRNA.
"Apoptosis" means a form of programmed cell death.
The "apoptotic characteristic" of a cell is the ability of a cell to undergo apoptosis when exposed an apoptotic triggering event. Such events include, for example, exposure to certain toxins and/or expression of a tumorigenic gene or activation of cell surface proteins.
"Biological sample" means a sample of eukaryotic cells. These cells may be part of a tissue or organ sample obtained, for example, by biopsy, or they rnay be individual cells, for example, blood cells or cells grown in tissue culture.
The invention described herein relates to the discovery of a method for the modulation of apoptosis in eukaryotic cells. The invention also relates to a method for detecting cells having and/or lacking the potential to undergo apoptosis.
Using a strategy based upon subtractive hybridization of normal and cancerous mammary epithelial cell mRNAs and the selection of genetic suppressor elements [3], a novel gene was isolated encoding a 33 kDa protein that is a potent inhibitor of cell growth. Acute expression of transfected constructs encoding p33~NG1 induced apoptosis in cells. Inhibition of translation of the mRNA for this gene prevented apoptosis in cells.
A. Definitions As used herein the following terms have the following meanings:
"Antibody" means a molecule that binds to a known antigen. An "anti-p33'NC' antibody" means an antibody molecule that binds to one or more epitopes of the p33'Nm protein.
"Antisense" and "Antisense nucleotides" means DNA or RNA constructs which block the expression of the naturally-occurring gene product. For example, in the present invention, use of a DNA construct that produces ING1 antisense RNA
blocks the expression of p33INC' by destroying or inactivating ING1 mRNA.
"Apoptosis" means a form of programmed cell death.
The "apoptotic characteristic" of a cell is the ability of a cell to undergo apoptosis when exposed an apoptotic triggering event. Such events include, for example, exposure to certain toxins and/or expression of a tumorigenic gene or activation of cell surface proteins.
"Biological sample" means a sample of eukaryotic cells. These cells may be part of a tissue or organ sample obtained, for example, by biopsy, or they rnay be individual cells, for example, blood cells or cells grown in tissue culture.
~ i "Cancerous cell" means a cell in or from a neoplasm. Preferably the cancerous cells is breast cancer, brain cancer, gastric cancer, hematologic neoplasms and head and neck squamous cell carcinomas.
"Breast cancer" means any of various malignant neoplasms of the breast or mammary tissue.
"Brain cancer" means any of various malignant neoplasrns of the brain, neuroglial cells or meninges .
"Cell cycle" means the cyclic biochemical and structural events occurring during growth of cells. The cycle is divided into periods called : quiescence (G6), Gap, (G,), DNA synthesis (S), Gape (GZ), and mitosis (M).
"Cell division" means mitosis, i.e., the usual process of cell reproduction.
"Code" or "encode", when used with reference to a nucleotide's relation to a protein, mean the system whereby particular combinations of adjacent nucleotides control the insertion of particular amino acids in equivalent places in a protein molecule.
"Expression" means the production of a protein or polynucleotide in the cell.
A "eukaryotic cell" is a cell having a membrane-bound nucleus containing DNA
in the form of chromosomes, either in a tissue or organ or in tissue culture.
More preferably, it is a mammalian cell.
"Growth" means progression through the cell cycle with the result that two daughter cells are formed from each mother cell. "Actively growing" means that state wherein cells exhibit growth and cell division.
"Hyperplasticity" means an increase in cell number, excluding tumor formation.
"Immunohistochemistry" means a method to localize a specific protein within a cell using cell sections or thin sections of a specific tissue and an antibody directed against the target protein. It is contemplated that the antibody may be directly labelled, radioactively, biotinylated or labelled with a fluorochrome. It is also contemplated that the antibody may be indirectly labelled.
"Inactivating" a gene means rendering the gene incapable of producing an active protein normally encoded by that gene. Methods of inactivating a gene include, for example, deleting the gene in the cell or introducing a deletion or mutation into the gene such that the gene no longer expresses an active protein. Preferably cells having such inactivated genes are substantially free of the active protein.
"In situ hybridization" means a method to identify and localize certain specific transcripts of specific genes in cells and tissue sections. The cells are fixed to a solid support and hybridized to a labelled nucleic acid probe complementary to the sequence to be identified. The probe may be directly labelled or indirectly labelled.
"Label" means to incorporate into a compound a substance that is readily detected. Such substances include radioactive substances and fluorescent dyes, for example.
"Mammalian cell" means a cell in or from a mammal, either in a tissue or organ or in tissue culture.
"Neoplasia" means the process resulting in the formation and growth of an abnormal tissue that grows by cellular proliferation more rapidly than normal, and continues to grow after the stimuli that initiated the new growth cease.
"Neoplastic" describes the abnormal tissue that grows by cellular proliferation more rapidly than normal, and continues to grow after the stimuli that initiated the new growth cease.
"Normal cell" means a non-cancerous cell.
"Proliferation" means growth and reproduction, i.e., division of cells.
"Actively proliferating" means cells that are actively growing and reproducing.
"Native" means the nucleic acid of a non-mutated gene or peptide sequence encoded by such a gene as found in a phenotypically normal cell.
"Substantially identical" means that the polynucleotide or nucleic acid of interest is able to hybridize to the complement of the known sequence under stringent conditions. Such stringent conditions preferably require at least 85 %
homology, more preferably the conditions require at least 90 % homology and most preferably the conditions require at least 95 % homology. When used in relation to peptides and proteins, "substantially identical" means that the amino acid sequence of the peptides _g_ _. . . _. _.. , share at least 85 % homology, more preferably at least 90 % homology and most preferably at least 95 % homology.
"Senescent cells" means cells that are no longer actively dividing and reproducing. Such cells are typically characterized by an inability to respond to growth factors and by altered morphology including increased size and decreased saturation density in tissue culture.
B. Synthesis and Methodolo~v A novel positive selection procedure that combines subtractive hybridization with an in vivo selection assay was used to identify putative growth-suppressor elements. An overview of the strategy used is shown in Figure lA.
Following a modified subtractive hybridization protocol [4,5], total cDNA from a normal mammary epithelial cell line [6] was hybridized independently with cDNAs from the breast cancer cell lines MCF-7, BT-483, BT-474, Hs-578T, ZR-75, MD-MB-468, MD-MB-435 and BT-20 which were obtained from the American Type Culture Collection. Subtracted cDNA, theoretically containing sequences more highly expressed in the phenotypically normal epithelial cells, was then used as a probe to screen a normal human fibroblast cDNA library.
Following screening, 300 cDNA clones were isolated, and their inserts were digested into fragments of 200-800 base pairs. The fragments were then recloned into the retroviral plasmid vector pLNCX [7]. After passage through the packaging line BOSC 23 [3], retroviruses containing the isolated fragments were used to infect normal mouse mammary epithelial cells {NMuMG). The infected cells were subsequently injected into nude mice.
Within 45 days, several mice developed tumors from which the cloned inserts were recovered by amplification using primers specific for pLNCX in polymerase chain reactions {PCR). Two different sequences were isolated from tumors, one of which was subsequently shown to be expressed in the antisense orientation.
The antisense sequence isolated, when introduced into normal fibroblast cells, consistently showed the biological effects of increased cell proliferation in soft agar and in focus forming assays (Fig. 1B and Table 1). This 182 by fragment represented nucleotides 781 to 963 of the cDNA shown in Figure 2 and nucleotides 942 to 1124 of Figure 3. This cDNA encodes a 33 kDa protein called p33I"cl for INhibitor of Growth.
This was formerly designated p33'c' (see U.S. Serial No. 08/569,721 which is incorporated herein by reference in its entirety).
After plating NMuMG cells infected with either control virus or with virus containing an insert of the antisense orientation of ING1 in soft agar, cells receiving the insert formed, on average, at least 50 times the number of colonies as cells infected with virus alone. Similar results were obtained following transfection of the retroviral construct into NIH3T3 cells, where pLNCX containing the insert of the antisense orientation of INGl resulted in the formation of 2.3 times the number of generally larger foci than vector alone.
These results corroborated the observations made in the nude mouse assay that the ING1 sequence corresponds to a gene whose product plays a significant role in regulating cell growth.
In order to isolate the gene corresponding to the fragment showing biological effects, normal human fibroblast and HeLa cell libraries were screened with the fragment, resulting in the isolation of 11 positive clones. Two clones contained cDNA
whose sequence is shown in Figure 2. The complete cDNA sequence (Figure 3) was obtained using rapid amplification of cDNA ends (RACE) by methods known in the art.
Comparison of the sequence of p33INC' shown in Figure 3 to the available protein and nucleotide data bases showed no significant homology to any sequence encoding a known protein and very limited similarity to retinoblastoma binding protein 2 (RbBP2) [9] and to several zinc finger transcription factors. Regions of the p33INC' protein that show homology to retinoblastoma binding protein 2 were identified using the Blast program available from the National Centre for Biological Information (address: www.ncbi.nim.nih.gov).
Use of a polyclonal antibody raised against a glutathione-S-transferase (GST) fusion with p33ING~ revealed a protein of 33 kDa by Western blot analysis of human and mouse cell extracts (Figure 1C).
~ , To determine whether the level of p33INC1 was decreased in cells infected with viral constructs containing the antisense orientation, lysates were prepared from control NMuMG cells and from NMuMG cells infected with antisense INGl that had grown and formed colonies in semi-solid medium. Results of Western blot analysis showed that chronic expression of antisense construct reduced the expression of the endogenous p33'NC' protein by approximately 90% in the cells (Figure 1C, lane 6) compared to control parental cells (Figure 1C, lane 5).
The ING1 cDNA contains several AU-rich elements (AREs) in the 3' untranslated region of the clone (Figure 2) which are believed to be involved in the destabilization of specific mRNAs [10].
Since the ING1 gene was originally isolated by subtractive hybridization between normal and transformed epithelial cDNAs, the levels of ING1 mRNA
expression in different normal, breast cancer, and brain cancer cell lines were examined. Results from Northern blot analysis show that ING1 is expressed at considerably lower levels (approximately 2-8 fold as estimated by scanning densitometry) in BT-20, ZR-75, MDA-MB-435 and T-47D breast cancer cells compared to MDA-MB-468 and SK-BR-3 breast cancer cells and to normal Hs68 fibroblasts. Results from reverse transcription polymerase chain reaction (RT-PCR) showed that ING1 is not expressed or is expressed at very low levels in glioblastomas, astrocytomas and meningiomas.
Isolation of a DNA fragment that was capable of inducing tumors, foci and growth in soft agar when expressed in the antisense orientation, suggested that the cellular role of p33'NC' is to negatively regulate growth. To test this idea, part of the ING1 cDNA was cloned into the mammalian expression vector pBK in the sense orientation (pINGI-S). This construct and the plasmid vector, both of which contain neomycin resistance genes and a cytomegalovirus (CMV) promoter, were transfected into human breast cancer (Hs578T) and normal fibroblast (Hs68) cells.
Following growth of the cells in antibiotic for 3 weeks, a large number of stable transformants were recovered from cells transfected with vector (1 +3), whereas very few colonies were visible in plates of cells transfected with the sense orientation of INGl cDNA
(2+4)(Figure 4A).
To corroborate the results of these chronic assays, the effect of microinjecting these constructs, together with non-specific antibodies into fibroblasts was examined.
Arrows in panels 1 and 3 of Figure 4B identify cells injected with sense (S) and antisense (aS) constructs, respectively, which were visualized by staining for the presence of coinjected non-specific antibodies using indirect immunofluorescence.
Arrows in panels 2 and 4 of Figure 4B show that cells injected with pINGI-S
failed to incorporate bromodeoxyuridine (BrdU) (panel 2) over a 36 hour time course after injection. In contrast, those injected with pINGl-aS entered S phase (panel 4) as estimated by staining with anti-BrdU antibodies.
Figure 4C shows the combined results of 5 separate experiments, which indicated that injection of the pBK vector or of pINGl-aS constructs had no appreciable effect upon the ability of injected cells to incorporate BrdU, whereas injection of pINGl-S blocked the ability of cells to enter into and proceed through S
phase.
Similar results were obtained in larger populations of cells that were electroporated with vector, sense and antisense construct DNAs together with a construct encoding the CD20 surface marker. Such co-transfections allowed the analysis of DNA content in cells that had taken up DNA by staining for CD20 and subsequent analysis by fluorescence activated cell sorting (FACS). As shown in Table 2, the CD20-expressing population co-transfected with pINGI-S had, on average, 63.1 % of cells in GOIG1 whereas those co-transfected with vector had 33.6% of cells in GOIG1 when cells were fixed and stained 48 hours after electroporation.
These results, using several independent methods, indicate that the overexpression of p33'NGl inhibits cell growth and DNA synthesis in both transient and chronic assays, most likely by arresting cells in the G1 phase of the cell cycle.
Since the activity of the tumor suppressor genes increases in senescent cells [20], p33IN~' activity in low and high passage cells was checked. As shown in Figures 8A and 8B, ING1 expression (and the level of the p33'NGl protein) increased several-fold when cells approached the end of their in vitro replicative lifespan.
These data demonstrate that p33INC' is a novel inhibitor of cell growth and a candidate tumor suppressor. Additional experiments also indicate that p33'NG' is localized in the nucleus of cells, which is consistent with p33'"c''s functioning as a tumor suppressor. Further data showed that ING1 gene is localized to the 13q33-S chromosome region. A number of human cancers have been mapped to this region including primary gastric cancer; hematologic neoplasms; head and neck squamous cell carcinomas. Alternatively, p33'NC' might play a role in the regulation of cyclin-dependent kinases (CDKs), as reported recently for the family of CDK
inhibitors including p18[11], p21[12,13] and the candidate tumor suppressor pl6MTS'[8] to which a portion of the p33'"c' sequence shows some homology, and which has been reported to be the MTS 1 multiple tumor suppressor locus of human chromosome 9p21 that is inactivated in many types of human tumors [ 14,15] .
Indications that the ING1 gene may be involved in the modulation of apoptosis first came from the conspicuous presence of p33'"c' in regressing tail and its absence from growing hindlimbs of metamorphosing Xenopus tadpoles. Accordingly, P19 cells were infected with sense (S), antisense (aS) constructs and cell viability was examined under serum starvation. As shown in Figure 12B, the antisense construct conferred a moderate level of protection against death (70% viability). Conversely, P19 cells expressing the sense ING1 construct exhibited greater cell death (44%
viability) suggesting that the ING1 gene confers cellular susceptibility to death induced by serum starvation.
When c-myc was induced in the NIH 3T3 cells by tetracycline withdrawal and the cells were serum starved for 72 hours, they showed a viability of 65 %
compared with controls where myc was not induced (Figure 13A). Apoptosis was minimized in cells coexpressing the antisense INGl construct with only 5% of cells dying upon serum withdrawal. Cells expressing the ING1 protein alone showed 70% viability after serum starvation and apoptosis was magnified when c-myc was also expressed (40%
viable). This showed that with both P19 and NIH 3T3 tet-myc cells expression of the ING1 gene is involved in regulation of apoptosis in a manner that is synergistic with the action of the myc gene.
Without being restricted to a theory, it appears that a loss of p3fNC' or its function appears to have similar consequences to those observed for p53 (33, 34). Since ING1 appears to be important in the control of the G1 to S phase transition, it is possible that 1NG1 could modulate or be modulated by p53. Conversely, ING1 could act independently, perhaps providing an activity where p53-independent mechanisms are at work. Alterations in the proper functioning of p331NC1 may contribute to tumorigenesis by rendering cells refractory to normal apoptotic pathways.
It is expected that several p33'NC'-related peptides will be useful in the present invention. In particular, p33'NC', its analogs and related proteins and peptides which are effective in potentiating apoptosis in eukaryotic cells are preferred.
Included within the scope of the p33"~cl, as that term is used herein, are p33'NC's having the amino acid sequence set forth in Figures 2 and 3, homologous amino acid sequence variants of the sequence of Figures 2 and 3, and homologous in vitro-generated variants and derivatives of p33'NC', which are capable of exhibiting a IS biological activity in common with the p33'"cl of Figure 3. Also included are p33'NC' variants having post-translational modifications, such as acetylation, glycosylation or phosphorylation.
p33INC' biological activity is defined as the possession of at least one cell proliferation, cell regulatory or tumor suppressive function qualitatively in common with native p33'NCIs. One example of the qualitative biological activity of p33'NC' is its ability to inhibit cell growth as estimated by decreasing the S-phase fraction in a population of cells.
The effective quantity of p33'NC' biological activity is that level of p331NC' biological activity necessary to potentiate apoptosis. The methods of this invention may reduce the effective quantity to less than 50% of the p3fNC' biological activity of normal cells more preferably less than 30 % of the p3 f Ncl biological activity, most preferably there will be no p33'NCl biological activity.
p33'NCl immunological activity is defined herein as the possession of immunological cross-reactivity with at least one epitope of native p3fNC' Immunologically cross-reactive, as used herein, means that the candidate polypeptide is , , , capable of competitively inhibiting the qualitative biological activity of the native p33'"c' having this activity, with polyclonal antisera raised against the known active analog. Such antisera are prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analog in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds.
This invention is concerned with amino acid sequence variants of native p33'"cj, Amino acid sequence variants of the p33'"c' are prepared with various objectives in mind, including increasing the affinity of the p33'"c' for its binding partner, facilitating the stability, purification and preparation of the p33'"c', modifying its biological half-life, improving therapeutic efficacy, and lessening the severity or occurrence of side effects during therapeutic use of the p33'"c'.
Amino acid sequence variants of p33'"°' fall into one or more of three classes:
insertional, substitutional, or deletional variants including those variations that arise from variable splicing of transcripts from the chromosomal gene. Additional variants may also be prepared by site specific mutagenesis of nucleotides in the DNA
encoding the p33'"c', by which DNA encoding the variant is obtained, and thereafter expressing the DNA in recombinant cell culture. However, variant p33'"c' fragments having up to about 100 to 150 amino acid residues are prepared conveniently by in vitro synthesis.
The amino acid sequence variants of the p33'"c' may be predetermined variants not found in nature or naturally occurring alleles. The p33'"c' variants typically exhibit the same qualitative biological activity as naturally occurring p33'"c'.
However, the p33'"c' variants and derivatives that are not capable of exhibiting qualitative biological activity similar to native p33'"c', may nonetheless be useful as reagents in diagnostic assays for p33'"c' or antibodies to p33'"cl. Further, when insolubilized in accordance with known methods, they may be used as agents for purifying anti-p33'"c' antibodies from antisera or hybridoma culture supernatants. Further, they may be used as immunogens for raising antibodies to p33'"c' or as a component in an immunoassay kit (labeled so as to be a competitive reagent for native p33'"cl or unlabeled so as to be used as a standard for the p33INC' assay) so long as at least one p33'NCl epitope remains active in these analogs.
While the site for introducing an amino acid variation may be predetermined, the mutation, per se, need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random or saturation mutagenesis (where all 20 possible residues are inserted) is conducted at the target codon and the expressed p33'"c' variant is screened for the optimal combination of desired activities.
Such screening is within the ordinary skill of the art.
Amino acid insertions will usually be on the order of from about one to about ten amino acid residues; substitutions are typically introduced for single residues and deletions will range from about one to about thirty residues. Deletions or insertions preferably are made in adjacent pairs. That is, a deletion of two residues or insertion of two residues. Substitutions, deletions, insertions or any combination thereof may be introduced or combined to arrive at a final construct.
Insertional amino acid sequence variants of the native p33'NC' are those in which one or more amino acid residues extraneous to native p33INC' are introduced into a predetermined site in the target p33i~'GI and which displace the pre-existing residues.
Commonly, insertional variants are fusions of heterologous proteins or polypeptides to the amino or carboxyl terminus of the p33ING1. Such variants are referred to as fusions of the p33'NC' and a polypeptide containing a sequence which is other than that which is normally found in the p33INC' at the inserted position. Several groups of fusions are contemplated for carrying out the invention described herein.
Immunologically active p33'"c1 derivatives and fusions comprise the p33'NCl and a polypeptide containing a non-p33INC' epitope. Such immunologically active derivatives and fusions of p33'NC' are within the scope of this invention. The non-p33'NCl epitope rnay be any immunologically competent polypeptide, i.e., any polypeptide which is capable of eliciting an immune response in the animal in which the fusion is to be administered, or which is capable of being bound by an antibody raised against the non-p33'NC' polypeptide.
-lb-Substitutional variants are those in which at least one residue in the Figure sequence has been removed and a different residue inserted in its place. Novel amino acid sequences as well as isosteric analogs (amino acid or otherwise) are included within the scope of this invention.
Some deletions, insertions and substitutions will not produce radical changes in the characteristics in the p33'NC' molecule. However, while it is difficult to predict the exact effect of the substitution, deletion or insertion in advance of doing so, for example, when modifying an immune epitope on the p33'"~' protein, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. For example, a change in the immunological character of the p33'N°' protein, such as affinity for a given antibody, is measured by a competitive-type intrnunoassay.
Modifications of protein properties such as redox or thermal stability, hydrophobicity, susceptibility to proteolytic degradation, or the tendency to aggregate with carriers or into multimers may be assayed by methods well known to one of skill in the art.
Deletions of cysteine or other labile amino acid residues may also be desirable.
For example, they may increase the oxidative stability of the p3fNG' protein.
Deletion or substitution of potential proteolysis sites, e.g., Arg Arg, is accomplished by deleting one of the basic residues or substituting one with glutaminyl or histidyl residues.
Covalent modifications of the p33'N~' protein are included within the scope of the present invention. Such modifications are introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected side chains or terminal amino acid residues. The resulting covalent derivatives of p33'N~' are useful to identify residues important for p33'NG' ~ s biological activity, for immunoassays of the p33'NC' or for preparation of anti-p33'NC' antibodies for immuno-affinity purification of recombinant p33'NC'. Such modifications are within the ordinary skill of the art and are performed without undue experimentation.
In general, prokaryotes are used for cloning of DNA sequences and in constructing the vectors useful in the present invention. For example, E. coli HB 101, DHSa and XL1-blue are particularly useful. These examples are meant to be illustrative and do not limit the present invention. Alternatively, in vitro methods of cloning such as the polymerase chain reaction may be used.
Expression hosts typically are transformed with DNA encoding the p33'NC' protein which has been ligated into an expression vector. Such vectors ordinarily carry a replication site, although this is not necessary where chromosomal integration will occur. Expression vectors may also include marker sequences which are capable of providing phenotypic selection in transformed cells. Expression vectors also optimally will contain sequences which are useful for the control of transcription and translation.
Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription which may affect mRNA
expression.
Expression vectors may contain a selection gene as a selectable marker.
Examples of suitable selectable markers for eukaryotic cells are dihydrofolate reductase, thymidine kinase, neomycin or hygromycin.
Antibodies to p33'NC' may be prepared in conventional fashion [18] by injecting goats or rabbits, for example, subcutaneously with the complete p33'NC' protein or a peptide consisting of at least 10 amino acids similar to the p33'NC' protein in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freund's adjuvant, The anti-p33'NC' antibodies may be directed against one or more epitopes on p33'NC'. Monoclonal antibodies against p33'NC' can be prepared by methods known in the art [18]. The antibodies are preferably labelled with a marker, for example, with a radioactive or fluorescent marker. It is contemplated that the antibodies would be labelled indirectly by binding them to an anti-goat or anti-rabbit antibody covalently bound to a marker compound.
C. Pharmaceutical Compositions The present invention may be used to potentiate apoptosis in eukaryotic cells by increasing expression of p33'"c'. For example, the potential for apoptosis is increased by introducing into cells a drug or other agent which can increase, directly or indirectly, expression of p33'"c'. Inducing apoptosis in cancer cells is of obvious importance. Inducing apoptosis in tissue culture cells provides a model system for studying the effects of certain drugs for triggering, reversing or halting the apoptotic pathway. Accordingly, increasing a cell's potential to enter the apoptotic pathway is useful.
In one embodiment, a protein or a peptide having p33'"c' biological activity is introduced directly. In a preferred embodiment the peptide possesses at least apoptosis modulating function qualitatively in common with native p33'"c'.
In another embodiment nucleotides coding for p33'NC' are introduced by retroviral or other means. In one embodiment the nucleotide coding for p33'NC' comprises a nucleotide sequence which codes for a peptide having p33'NC' biological activity. In one embodiment the oligonucleotide comprises an oligonucleotide which codes for the amino acid sequence set forth in Figure 3. In another embodiment the oligonucleotide sequence comprises a nucleotide sequence which codes for the amino acid sequence set forth in Figure 2. Preferably the nucleotide sequence is substantially identical to the cDNA sequence of Figure 3, more preferably the sequence is substantially identical to the cDNA sequence of Figure 2 and most preferably the sequence is substantially identical to nucleotides 161 to 1143 of the cDNA
sequence of Figure 3.
Apoptosis is inhibited or substantially decreased by preventing transcription of INGl DNA and/or translation of RNA. This can be carried out by introducing antisense oligonucleotides of the ING1 sequence into cells, in which they hybridize to the p33'NC'-encoding mRNA sequences, preventing their further processing. It is contemplated that the antisense oligonucleotide can be introduced into the cells by introducing antisense single-stranded nucleic acid which is substantially identical to the complement of the cDNA sequence in Figures 2 or 3. It is also contemplated that an antisense oligonucleotide can be expressed in the cells by introducing a single- or double-stranded polynucleotide into the cell under conditions wherein a single-stranded nucleic acid sequence which is substantially identical to the complement of the cDNA
sequence in Figures 2 or 3 is expressed in the cell, for example, by placing the polynucleotide in the antisense direction under the control of a strong promoter. It is contemplated that the antisense oligonucleotide introduced to the cell or expressed in the cell is at least 20 nucleotides, more preferably it is at least 50 nucleotides and most preferably it is at least 100 nucleotides in length. Preferably the antisense oligonucleotide sequence is substantially identical to the complement of nucleotides 942 to 1124 of the cDNA sequence set forth in Figure 3.
It is also possible to inhibit expression of p33'~'c' by the addition of agents which degrade p33'NC'. Such agents include a protease or other substance which enhances p33'NC' breakdown in cells. In either case the effect is indirect, in that less p33'N°' is available than would otherwise be the case.
It is also possible to inhibit expression of p33IN~1 by inactivating the gene coding for ING1 in the cell. Such inactivation can occur by deleting the gene in the cell or by introducing a deletion or mutation into the gene thereby inactivating the gene.
The gene may also be inactivated by inserting into the gene another DNA
fragment such that expression of the native p33'NC' protein does not occur. Methods for introducing mutations, deletions and insertions into genes in eukaryotic cells are known in the art. See, for example, U.S. Patent No. 5,464,764 which is incorporated herein in its entirety.
It is contemplated that the ability to inhibit apoptosis in a eukaryotic cell in tissue culture provides a model system for testing certain proteins and factors for their role in the apoptotic pathway. It also provides a model system for testing compounds suspected of being tumorigenic.
Viral or plasmid vectors may be used to deliver various constructs to target cells in vitro or in vivo. Such viral vectors may include retroviruses, adenovirus or adenovirus-associated viruses. Such methods are known in the art [19].
In vitro such peptides or vectors may be administered by infection, microinjection, electroporation and by other methods known in the art.
In vivo parenteral administration of the nucleic acids is preferred with subdermal or intramuscular administration most preferred. Intravenous administration or use of implanted milliosmol pumps (available from Alza) may also be used.
When used for parenteral administration, which is preferred, the nucleic acids of the present invention may be formulated in a variety of ways. Aqueous solutions of the ._. r nucleic acids of the present invention may be encapsulated in polymeric beads, liposomes, nanoparticles or other injectable depot formulations known tv those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.) The nucleic acids may also be encapsulated in a viral coat. Doses are selected to provide effective inhibition of cancer cell growth and/or proliferation.
The methods of this invention may also be achieved by using a pharmaceutical composition comprising one or more of the following apoptosis inducing compounds:
p33'N~', its analogs and related proteins and peptides. Doses are selected to provide effective induction of apoptosis.
Parenteral administration of the proteins or peptides is preferred, with subdermal or intramuscular administration most preferred. Intravenous administration or use of implanted milliosmol pumps (available from Alza) may also be used.
When used for parenteral administration, which is preferred, the proteins and peptides of the present invention may be formulated in a variety of ways.
Aqueous solutions of the proteins or peptides of the present invention may be encapsulated in polymeric beads, Iiposomes, nanoparticles or other injectable depot formulations known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.) Compositions including a liquid pharmaceutically inert carrier such as water may also be considered for both parenteral and oral administration. Other pharmaceutically compatible liquids may also be used. The use of such liquids is well known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.) The dose level and schedule of administration may vary depending on the particular p33'"c'_related compounds) andlor compositions used, the method of administration, and such factors as the age and condition of the subject.
As discussed previously, parenteral administration is preferred, but formulations may also be considered for other means of administration such as orally, per rectum, and transdermally. The usefulness of these formulations may depend on the particular compound used and the particular subject receiving the p33'N°'-related compound.
Oral formulations of p33INC'_related compounds may optionally and conveniently be used in compositions containing a pharmaceutically inert carrier, including conventional solid carriers, which are conveniently presented in tablet or capsule form. Formulations for rectal or transdermal use may contain a liquid carrier that may be oily, aqueous, emulsified or contain certain solvents suitable to the mode of administration. Suitable formulations are known to those of skill in the art.
(Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990. ) D. Use of ING1 DNA and RNA and p33'N~' and Related Proteins and Peptides for Diagnosis The present invention also has diagnostic use, since simple immunochemical staining of cells or sections of cells should give an accurate estimate of the portion of cells expressing p33'N°'. Such a test based on the use of anti-p33'Nm antibodies or ING1 polynucleotides and other standard secondary techniques of visualization will be useful in determining the apoptotic characteristic of eukaryotic cells. Such a test might also be useful to the scientific research community.
Antibodies specifically reactive with p33'NCi can be produced, using known methods [18]. For example, anti-p33'NC' antisera can be produced by injecting an appropriate host (e.g., rabbits, mice, rats, pigs) with p33'N~' and withdrawing blood from the host animal after sufficient time for antibodies to have been formed.
Monoclonal antibodies can also be produced using known techniques [18]. Such antibodies to p33'NCi will generally be detectably labelled (e.g., with a radioactive label, a fluorescent material, biotin or another member of a binding pair or an enzyme) by methods known in the art. It is also contemplated that the anti-p3fN~' antibodies may be indirectly labelled as follows. The unlabelled primary antibody binds to the target protein. Then a secondary antibody (anti-antibody) directed against the primary antibody and tagged with a detectable label binds to the antigen-primary antibody complex.
In a diagnostic method of the present invention, cells obtained from an individual or a culture are processed in order to determine the extent to which p33'NC' is present in cells, in a specific cell type or in a body fluid. This can be determined using known techniques and an antibody specific for p33'NG'. Comparison of results obtained from cells or a body fluid being analyzed with results obtained from an appropriate control (e.g., cells of the same type known to have normal p33'NC' levels or the same body fluid obtained from an individual known to have normal p33'NG' levels) is carried out. Decreased p33'NG' levels are indicative of an increased probability of abnormal cell proliferation or oncogenesis or of the actual occurrence of abnormal proliferation or oncogenesis. It is contemplated that the levels of p33'"°' in cancerous cells will be at least 50 % less than the level of p33'N°' in non-cancerous cells, more preferably the levels will be less than 30 % of normal levels, most preferably p33'NC' will not be expressed. Increased p33'NC' levels are indicative of an increased probability that the cell is capable of entering the apoptotic pathway. It is contemplated that the levels of p33'NC' in apoptotic cells will be at least 50% greater than the level of p33'NC' in normal cells, more preferably at least 70%o greater.
It is contemplated that a diagnostic kit could include a solid support for attaching the cell or tissue to be tested and a delectably labelled anti-p33'N~' antibody. It is further contemplated that the anti-p33'NC' antibody may not be labelled but the kit would additionally contain another delectably labelled antibody capable of binding to the anti-p33'NC' antibody.
A hybridization probe comprising RNA, ING1 cDNA or ING1 genomic DNA
having a sequence substantially identical to Figure 3 ("ING1 polynucleotide") may be employed as a means for determining the sequence of the ING1 gene present in the genomic DNA of a given sample, or the level of ING1 mRNA expressed in cells of such sample. Such hybridization probes will generally be delectably labelled (eg. with a radioactive label, a fluorescent label, biotin, etc). It is also contemplated that the ING1 polynucleotide may be indirectly labelled by methods known in the art. It is contemplated that in situ hybridization of labelled nucleic acid to the cell will be employed to detect the presence of ING 1 mRNA in the cell.
A tissue sample or cell sample can be prepared by conventional means and probed with the labelled ING1 ~ polynucleotide probe to determine the level of expression of ING1 mRNA in the cells. The ING1 polynucleotide probe may also be used to determine whether the genomic DNA from the cell sample has a mutation or rearrangement of its ING1 gene by methods known in the art (i.e. PCR
sequencing or restriction fragment length polymorphism analysis). The polynucleotide probe may also be used to determine whether the genomic DNA from the cell sample has a mutation/deletion rearrangement of the chromosome region of 13q33-34.
The oligonucleotide probe useful in these methods may comprise at least about nucleotides which sequence is substantially identical to the sequence of Figure 3, more preferably it will comprise at least about 100 nucleotides, and most preferably it will comprise at least 400 nucleotides. In the case of PCR sequencing it is 15 contemplated that one of the two INGI oligonucleotide primers will be substantially identical to one region of the sequence of Figure 3 and that the second oligonucleotide primer will be substantially identical to the complement of a second region of the sequence of Figure 3. The size of these primers is preferably from 15-25 nucleotides, more preferably from 15-20 nucleotides. Most preferably the oligonucleotide probes 20 and primers will be substantially identical to the coding region of the cDNA sequence of Figure 3. Such nucleotides can be generated synthetically by conventional means.
Comparison of the results obtained from cells or a body fluid being analyzed with results obtained from an appropriate control (eg. cells of the same type known to have abnormal or native p33'NCl or fluid from an individual known to have normal p33'NG') is carried out. Decreased INGl mRNA levels are indicative of an increased probability of abnormal cell proliferation or oncogenesis or of the actual occurrence of abnormal proliferation or oncogenesis. It is contemplated that the levels of mRNA in cancerous cells will be at least 50% less than the level of INGI mRNA
in non-cancerous cells, more preferably the levels will be less than 30% of normal levels, most preferably ING1 mRNA will not be expressed. Increased INGl mRNA levels are ,, indicative of an increased probability of cell apoptosis. It is contemplated that the levels of ING1 mRNA in cells having apoptotic potential will be at least 50%
more than the level of ING1 mRNA in native non-senescent cells, more preferably at least 70%
more than native non-senescent cells.
The presence of a mutation/deletion in one copy of the ING1 gene in a diploid cell is also indicative of an increased probability that abnormal cell proliferation will occur. The presence of mutations/deletions in both copies of the ING1 gene is indicative of possible or actual oncogenesis.
The following examples are offered to illustrate this invention and are not meant to be construed in any way as limiting the scope of this invention.
EXAMPLES
The methods described as follows were used to perform the studies described herein. In addition, the generally known methods set forth in laboratory manuals for molecular cloning and antibody techniques [e.g., 17,18] may advantageously be used by one of skill in the art to produce additional embodiments of the invention.
m le 1 Strategy for Cloning and Biological Assay Subtractive hybridization of breast cancer cell line cDNAs with cDNA from normal mammary epithelial cells, subcloning of subtracted cDNAs into the pLNCX
retroviral vector [7] and injection into nude mice was done essentially as described [3]
with the modifications noted below. The cloning of full length cDNA was done using standard methods [17]. The strategy is shown in Figure lA.
cDNA was prepared from an non-transformed mammary epithelial cell line (184A1) [6] and digested with the restriction enzyme ai.3A. cDNAs from the breast cancer cell lines MCF-7, BT-483, BT-474, Hs-578T, ZR-75, MD-MB-468, MD-MB-435 and BT-20 (obtained from the American Type Culture Collection, Bethesda MD) were also digested with ~3A. Fragments of tester DNA (cDNA from normal epithelial cells) were Iigated to "a" adaptors. Fragments of driver DNA (cDNA
from breast tumor cells) were ligated to "b" adaptors. Adaptors were prepared by annealing the synthetic oligonucleotides:
5'-GACCTGGCTCTAGAATTCACGACA-3' (SEQ ID NO: 3) with 5'-GATCTGTCGTGAATTCTAGAGCCAGG-3' {SEQ ID NO: 4) (adaptor "a"); and 5'-GACTCGACGTTGTAACACGGCAGT-3' (SEQ ID NO: 5) with 5'-GATCACTGCCGTGTTACAACGTCGAG-3' (SEQ ID NO: 6) (adaptor "b").
The mixture of driver DNA and tester DNA was denatured, then hybridized at 66 ° C for 18 hours. After hybridization, mixtures were treated with Mung bean nuclease to eliminate single-stranded adaptor-derived ends from "heterozygous"
hybrids (hybrids containing both a and b adaptors). Resultant double-stranded molecules were then selectively amplified by PCR using primer "a".
The "amplicons" were then subjected to five successive rounds of hybridization, selective degradation and PCR amplification using 40 ~cg of driver cDNA
containing adaptors and 200 ng, 5 ng and 5 pg of tester amplicons in respective rounds.
This procedure allowed for a significant enrichment of sequences that were more highl j~
expressed in the phenotypically normal epithelial cells as determined by slot blot hybridization.
All subtracted fractions were combined and used as a probe to screen a near-senescent human diploid fibroblast cDNA library. Following screening, 300 cDNA
clones were isolated and their inserts were randomly fragmented {200-800 bps).
These were then ligated with adaptors prepared by annealing two oligonucleotides 5'-AATCATCGATGGATGGATGG-3' (sense) (SEQ ID NO: 22) 5'-CCATCCATCCATCGATGATTAAA-3' (SEQ ID NO: 23) and were amplified by PCR using the "sense" strand of the adaptor as the PCR
primer.
PCR amplified DNA was recloned into the ~I site of the retroviral plasmid vector pLNCX [7] with synthetic adaptors carrying initiation codons in all reading frames.
This library of about 105 clones, enriched in tumor suppressor sequences was then used for the isolation of transforming genetic suppressor elements (GSEs).
WO 98!44102 PCTICA98I00277 After transfection of the recombinant retroviral plasmids into the packaging line BOSC 23 [25), retroviruses containing the isolated cDNA fragments were used to infect non-tumorigenic immortalized mouse mammary epithelial cells (NMuMG) which were subsequently injected subcutaneously into nude mice. Subcloning into the retroviral S vector, packaging into the BOSC 23 virus-packaging cell line and assays using nude mice were performed as described [3].
After 45 days, two mice developed tumors from which two cDNA inserts were recovered by PCR, one of which is subsequently shown to be expressed in the antisense orientation. The primers used in the PCR amplification were:
5'-CCAAGCTTTGTTTACATCGATGGATG-3' (SEQ ID NO: 7) (sense); and 5'-ATGGCGTTAACTTAAGCTAGCTTGCCAAACCTAC-3' (SEQ ID NO: 8) (antisense). The recovered cDNA insert which was in the antisense orientation was digested with ~1 I and ~'ndIII and recloned back into the retroviral vector, pLNCX, in the same position and orientation and then tested individually in vitro.
NMuMG cells were infected with retrovirus produced from pLNCX vector containing or not containing the ING1 insert (nucleotides 942 to 1,124 of the ING
cDNA set forth in Figure 3). The soft agar culture was comprised of two layers: an underlay (DMEM, 10 % FCS, 0.6 % agar) and an overlay {DMEM, 10 % FCS, 0.3 agar). 5 X 104 cells were plated in soft agar in 10 cm plates and were left at 37 °C for 6-7 weeks before being counted. 5 x 105 transfected NIH 3T3 cells were plated per 10 cm dish. Transfected NIH 3T3 cells were grown in 5 % serum for 4 weeks prior to fixing and visualizing foci. pLNCX-S and pLNCX-aS represent sense and antisense orientations of the ING1 cDNA insert, respectively.
Results of the soft agar and focus forming assa~,y~
Soft Focus agar forming assay assay Trial Number 1 2 3 4 mean 1 2 mean pLNCX 0 0 0 0 0 9 13 11 (vector) pLNCX-Ras 224 248 208 (-) 226.7 (-) (-) (-) pLNCX-aS 42 46 41 82 52.8 18 34 26 pLNCX-S (-) (-) 0 0 0 (-) (-) (-) (-) = not determined These results showed that the antisense ING1 cDNA insert caused increased cell proliferation.
Panel 1 of Figure 1B shows NMuMG cells infected with the retroviral vector pLNCX and panel 2 of Figure 1B shows cells infected with the retroviral vector pLNCX containing the antisense ING1 insert. The bar equals 1 mm. Panel 3 of Figure 1B shows NIH 3T3 cells transfected with vector alone and panel 4 of Figure 1B
shows cells transfected in parallel with pLNCX containing the antisense INGl insert.
Example 2 cDNA of ING1 and Predicted Amino Acid Seauence of p33~NC' In order to isolate the gene corresponding to the fragment showing biological effects, normal human fibroblast and HeLa cell cDNA libraries were screened with the ING1 cDNA fragment from Example 1, resulting in the isolation of 11 positive clones.
Two clones containing the largest cDNA inserts were sequenced on both strands using an Applied Biosystems automated sequencer, yielding the sequence shown in Figure 2.
In order to obtain the 5' end of the iNGl gene, 5' RACE (rapid amplification of cDNA ends) was used. Total cDNAs isolated following reverse transcription had the synthetic adaptor 5'-GTACATATTGTCGTTAGAACGCGTAATACGCCTCACTATAGGGA-3' (SEQ
ID NO: 11) ligated to them and PCR reactions using nested primers from both the adaptor and the ING1 gene were used to amplify the 5' ends of all RT-generated cDNAs. The primers used in the amplification were:
5'-CTGGATCTTCTCGTCGCC-3' (SEQ ID NO: 12) and 5'-AGTGCAGCATCGGCCGCTTC-3' (SEQ ID N0: I3) from the ING1 sequence and:
5'-GTACATATTGTCGTTAGAACGCG-3 ' (SEQ ID NO: 14) and 5'-TAATACGCCTCACTATAGGGA-3' (SEQ ID NO: 15) from the adaptor sequence.
The largest PCR products were recovered from agarose gels following electrophoresis and were subcloned and sequenced to generate the full-length sequence shown in Figure 3.
The predicted coding region of INGI begins at nucleotide 16 and ends at nucleotide 898, as shown in Figure 3, predicting a translation product of 33,350 daltons. Comparison of the sequence of p33'NC' to the available protein and nucleotide data bases showed no significant homology to any sequence encoding a known protein and very limited similarity to retinoblastoma binding protein 2 {RbBP2) [9]
and to several zinc finger transcription factors. Regions of the p33'"c' protein that show homology to different members of the p16"'TS' family of cyclin-dependent kinase inhibitors and to retinoblastoma binding protein 2 were identified using the Blast program available from the National Centre for Biological Information (address:
www.ncbi.nim.nih.gov).
F~pression of a GST-p33'N~l fusion~rotein and creation of anti-p_33 ~lvclonal antibody In order to generate polyclonal antibodies, a fragment of ING1 containing nucleotides 161-1146 of Figure 3 was subcloned into the SRI-.~~ol sites of the bacterial expression vector pGEX-4T1 (Pharmacia Biotech, Inc., Quebec, Canada) containing the glutathione-binding portion of glutathione-S-transferase (GST).
Plasmids were sequenced to verify that the correct reading frame was obtained and the constructs were electroplated into E. coli XLl-Blue. Following selection, bacterial cultures were induced to express the fusion protein by the addition of O.1mM isopropyl thio-galactopyranoside (IPTG) and fusion protein was purified by standard glutathione-Agarose column affinity chromatography. Eluted GST-p33'NC' fusion protein was dialyzed and used in immunogen in female New Zealand white rabbits. After four boosters, rabbits were bled and their serum tested for reactivity against the fusion protein. All animals showed reactivity and the bleeds showing the highest titer were chosen for subsequent use in Western blot, immunoprecipitation and immunofluorescence protocols.
Example 4 Effect of the antisense ING1 fragment on expression of p33ING~ in tissue culture cells Analysis of p33"~~' protein levels in cell samples was performed by Western blotting using anti-p33'NG' antibodies raised against the GST-p33'N~' fusion protein.
Proteins were separated by electrophoresis in 12.5 % polyacrylamide/SDS gels, and electrophoretically transferred to membranes for 1 hour. The membranes were blocked in TBS (100 mM Tris, 150 rnM NaCI) containing 10% non-fat dried milk and 0.1%
Tween-20, for 2 hours. Incubation of the membranes with p33'NC' antiserum was performed in TBS containing 5 % nonfat milk and 0.1 % Tween 20 (TBST) for 30 minutes. Horseradish peroxidase-conjugated goat anti-rabbit antibody was then applied to the filters for 1 hour in TBST. Peroxidase activity was detected using a chemiluminescence system (Amersham Canada, Oakville Ontario Canada) As shown in Figure 1C, NMuMG (lane 1} and ZR-75 (lane 2) cell lines were tested. The Western blot analysis of human and mouse cell lysates revealed a protein of 33 kD. Preincubation of antibodies with GST-p33'N~' fusion protein blocked recognition of p33"~cl in a parallel blot using lysates from the same cells (lanes 3 and 4).
To determine whether the level of p33ING~ was decreased in cells infected with viral constructs containing the antisense orientation, Iysates were prepared from control NMuMG cells and from NMuMG cells infected with antisense ING1 (pLCNX-aS) that had grown and formed colonies in semi-solid medium. A Western blot of lysates from _. ~ ,.
NMuMG cells infected with pLNCX vector (lane 5) or pLNCX vector containing antisense ING1 insert (lane 6) by the method set out above is shown in Figure 1C.
Results of the Western blot analysis showed that chronic expression of antisense construct reduced the expression of the endogenous ING 1 gene by approximately 90 %
compared to control parental cells.
Example 5 Effects of p33'NG' Overexpression Isolation of a DNA fragment that was capable of inducing foci and growth in soft agar when expressed in the antisense orientation, suggested that the cellular role of INGI might be to negatively regulate growth. To test this idea, part of the cDNA (basepairs 161 to 1143 of Figure 3) was cloned into the mammalian expression vector pBK (Stratagene, Aurora, Ontario Canada) in the sense orientation (pINGI-S).
This construct and the plasmid vector, both of which contain neomycin resistance genes and a cytomegalovirus (CMV) promoter, were transfected into human breast cancer (Hs578T) and normal flbroblast (Hs68) cells. Following growth for 3 weeks in medium containing 6418, plates were fixed and stained with Coomassie Brilliant Blue to identify surviving colonies. A large number of stable transformants were recovered from cells transfected with vector whereas very few colonies were visible in plates of cells transfected with the sense orientation of the cDNA of ING1. Figure 4A
shows the results when human Hs578T breast cancer cells (panels 1 and 2) and normal fibroblasts (panels 3 and 4) were transfected with the plasmids pBK (panels 1 and 3) or pINGl-S containing the ING1 cDNA in the sense orientation (panels 2 and 4).
In order to corroborate the results of these chronic assays, we next examined the effect of microinjecting these constructs on the ability of normal diploid fibroblasts to initiate DNA synthesis.
Hs68 cells were plated on glass coverslips, deprived of serum for 12 hours, rnicroinjected with the indicated mixture of plasmid DNA (0.1 ~,g/ml) plus nonspecific IgG (2 ,uglml) and were then incubated for 36 hours in complete medium containing BrdU. Fixed cells were identified by staining for injected IgG and for the incorporation of BrdU. Microinjection, fixation and staining were done as described previously [16].
Figure 4C shows the combined results of 5 separate experiments. Each group represents 110-200 injected cells. As shown in Figure 4B, normal Hs68 HDFs were injected with solutions containing pINGl-S plus non-specific rabbit IgG
(panels 1 and 2) or with pINGl-aS containing the ING1 cDNA in the antisense orientation plus non-specific rabbit IgG {panels 3 and 4). Injected cells were grown in the presence of BrdU
and were fixed and stained for the presence of co-injected IgG (panels 1 and 3) or incorporated BrdU (panels 2 and 4). Arrows identify injected cells. Arrows in panels 2 and 4 show that cells injected with pINGl-S failed to incorporate bromodeoxyuridine (BrdU, panel 2) over a 36 hour time course after injection, whereas those injected with pINGl-aS entered S phase (panel 4) as estimated by staining with anti-BrdU
antibodies.
Figure 4C shows the results of 5 separate experiments which indicate that injection of the pBK vector or of pINGl-aS constructs had no appreciable effect upon the ability of cells to proceed through S phase.
Similar results were obtained in larger populations of cells that were electroporated with vector, sense and antisense construct DNAs together with a construct encoding the CD20 surface marker. Such co-transfections allowed the analysis by flow cytometry of DNA content in transfected cells that were positive for CD20 staining. Hs68 cells were co-transfected with pCMV-CD20 together with pBK-p33'"~'-S or with pBK vector as a negative control. Cells were fixed and stained for CD20 expression using commercially available antibodies and with propidium iodide 48 hours after electroporation. Cell cycle distribution was determined by flow cytometry using fluorescence-activated cell sorting. The percentage of the CD20+ cells in different phases of the cell cycle is shown for two independent experiments.
Overexnression of n33INC1 arrested cells in GO/Gl pBK (vector) pBK-INGl-S
Triall 32.7 38.5 28.8 53.3 19.9 26.8 Trial2 34.5 35.9 29.6 72.8 19.7 7.5 mean 33.6 37.2 29.2 63.1 19.8 17.2 As shown in Table 2, the CD20-expressing population that was cotransfected with pINGl-S had, on average, 63.1 % of cells in GO/G1 whereas those co-transfected with vector had 33.6% of cells in GO/G1 when cells were fixed and stained 48 hours after electroporation. These results, using several independent methods, indicate that the overexpression of ING1 inhibits cell growth in both transient and chronic assays, most likely be arresting cells in the G1 phase of the cell cycle.
Examm~le 6 Alterations of INGl in cancer cell lines Since ING1 was originally isolated by subtractive hybridization between normal and transformed epithelial cDNAs, the ING1 gene and its expression in breast cancer cell lines was also examined. In Figure SA, lane 1 is MCFIOA phenotypically normal epithelial cell line from mammary gland; lane 2 is MDA-MB-468; lane 3 is ZR-75; lane 4 is BT-20; lane 5 is SK-BR-3; lane 6 is MCFT; lane 7 is Hs578T and lane 8 is (breast cancer cell lines). Figure SB shows the coomassie-blue stained gel corresponding to Figure SA. The expression of p33~NC1 in the cell lines was tested by preparing lysates of cell lines and Western blotting using anti-p33INC' antibodies by the method in Example 4. Although analysis of genomic fragments containing the gene did not reveal any structural changes in breast cell lines, results from Western blot analyses shown in Figure 5 suggest that the p33INC1 pxotein was expressed at considerably lower levels in some breast cancer cells compared to a phenotypically normal epithelial cell line. This observation of reduced expression in the absence of mutation is similar to the expression of BRCA-1 reported to occur in non-hereditary forms of breast cancer [25] .
Normal diploid control cell strains and neuroblastoma cell lines were analyzed by Western Blot analysis in a manner similar to that set forth for the breast cancer cell lines. Figure 6A illustrates the Western blotting results of IMR-5 (lane 1) SK-(lane 2); SK-N-SH (lane 3) all neuroblastoma cell lines, and W138 (lane 4) a normal diploid lung fibroblast cell line. Normal diploid fibroblast cells expressed low levels of p33'NCl while immortalized neuroblastoma cells expressed considerably higher levels and in the case of the SK-N-SH neuroblastoma line a truncated protein was observed.
To investigate the nature of the changes} responsible for truncating p33'NC' in this neuroblastoma cell line, two complementary approaches were taken.
Southern blot analysis of DNA, from neuroblastomas and from normal fibroblasts that was digested with different restriction endonucleases and probed with a ING1 nucleic acid probe, clearly indicated that p33'NC' was rearranged in the neuroblastoma cell line.
Human genomic DNAs were digested with HindIII, I~r I or P~~l, electrophoresed through a 0.7 % agarose gel, transferred to a nitrocellulose membrane and hybridized with [32P]-labelled p33'NCl cDNA. Hybridization was performed using standard procedures [17].
Lanes 1-6 show the results for neuroblastoma SK-N-SH (2, 4 and 6) and fox normal diploid W138 cells (1, 3 and 5}. Patterns such as those shown by W138 cells were also seen in other normal diploid cell strains.
To confirm that changes in the p33'NCl gene had occurred in the neuroblastoma cell line and to determine their nature by an independent method, reverse transcription polymerase chain reaction (RT-PCR) with RNA from SK-N-SH neuroblastoma cell line and from a phenotypically normal epithelial cell line (MCF-10) was performed as described [20] . Neuroblastoma cDNA was amplified with PCR primers specific for the p33 gene (direct(d) and reverse (r) primers). These are numbered and shown underlined in Figure 3 and the PCR products were compared with PCR fragments generated in parallel from control cell cDNA. Figure 6C, lanes 1 (primers ld-4r), 3 (ld-2r), 5 (2d-4r) and 7 (2d-3r) show the results for W138, and lanes 2 (ld-4r), 4 (ld-,.
2r), 6 (2d-4r) and 8 (2d-3r) show the results for the neuroblastoma cell line.
Primers were ld: GTAGCGCAGTCTGACAAGCC (nucleotides 474-494 of SEQ ID NO: 9) 2d: TGGTTCCACTTCTCGTGCGT (763-782 of SEQ ID NO: 9) 2r: ACGCACGAGAAGTGGAACCA (SEQ ID NO: 16) 3r: TTTGGATTTCTCCAGGGCTT (SEQ ID NO: 17) and 4r: TACCTGTTGTAAGCCCTCTC (SEQ ID NO: 18). M shows a 1 kb ladder molecule weight marker. All primer pairs gave similar results in both cell lines except for those using primers beyond nucleotide 858. For example, using primers 3r and 4r give no PCR product using neuroblastoma cDNA which is consistent with data indicating that a deletion or a rearrangement had occurred within the p3fNC' gene.
These experiments corroborate the idea that the 3' region of the p3fNC' gene was mutated in this neuroblastoma.
Normal diploid control cell strains and brain cancer cell lines were analyzed by RT-PCR analysis. Reverse transcription with total RNA from each of the cell lines was performed by the method set out in Example 9. The same primer pairs set forth in Example 9 were used. Figure 7 illustrates the RT-PCR results of glioblastoma (lanes GB1-GB4) astrocytoma (lanes AS1-AS3) and meningioma (MN1-MN3) as compared to a control cell line (Cl-C2). The INGl mRNA was expressed at considerably lower levels, or not expressed at all, in the glioblastomas, astrocytomas and meningiomas as compared to the normal cell line.
m le 7 Nuclear Localization of 33p 'NC' The experiments described below were performed with a rabbit polyclonal antibody (ap33) which was raised against a bacterially expressed glutathione-S-transferase (GST)-p33'NC' fusion protein and which reacted with a 33 kDa protein in human and mouse cell lysates as prepared by the method in Example 3.
In the first series of experiments, we determined the location of p3fNC' in fibrobiasts by examining the staining pattern of anti-p33 antibody in fibroblasts by indirect immunofluorescence. For indirect immunofluorescence normal human diploid fibroblasts (Hs68 cells) were grown on glass coverslips for 48 hours at 37°C to 60%
confluence. The cells were fixed in 3.7% formaldehyde, washed in 0.5% Triton X-and in 0.05 % Tween 20 for 10 minutes each at room temperature. Formaldehyde and detergents were diluted in phosphate buffered saline (PBS) pH 7.5. The cells were incubated with a 1:100 dilution of rabbit p33'NC' antiserum for 30 min, washed in PBS
with 0.05 % Tween, incubated with goat anti-rabbit IgG-biotin antibody and then with streptavidin conjugated Texas Red [16]. Samples were examined with a Zeiss Axiophot fluorescence microscope and images were photographed on Kodak TMAX 100 film.
Staining with polyclonal rabbit antibody alone was observed both in nuclear and cytoplasmic compartments. Similar results were obtained with anti-p33 antibodies which were preincubated with 5 fcg of GST protein indicating that the signal was specific for p33'NG'. When the anti-p33 serum was preincubated with 5 ~.g of GSTp33 fusion protein, nuclear staining was lost completely but cytoplasmic staining remained, indicating that the vast majority of p33'NG' staining was nuclear.
To confirm the nuclear localization of the 33 kDa protein. The pINGl-s construct of Example 5 was microinjected into normal Hs68 fibroblast cells which were fixed and stained with anti-p33-antibody 24 hours after injection. Strong staining was clearly localized to the nucleus. These results corroborate staining patterns in uninfected cells and show that p33'NG' is localized primarily, and possibly exclusively, throughout the nucleoplasm.
Exa Chromosomal Localization of the INGI Vie, ne To identify the chromosomal localization of the INGI gene, a genomic 18-kb DNA insert containing the gene was labelled with digoxygenin-dUTP and hybridized to synchronized human lymphocyte metaphase spreads.
A genomic clone of the INGl gene was isolated from a lambda FIX II placental human genomic library (Stratagene, Aurora, Ontario, Canada) with nucleotides 161 to 1143 of the ING1 sequence of Figure 3 using high stringency (65 °C 0.
1X SSC, 0.1 %
SDS) screening. The identity of the clone was confirmed by partial sequence analysis.
FISH was performed using established methods on methotrexate/thymidine synchronized, phytohemagglutinin stimulated, normal peripheral blood lymphocytes [21]. Approximately 50 metaphase spreads were examined for probe localization.
Suppression for 30 minutes with a mixture of sonicated human DNA {Sigma Diagnostics, Mississauga, Ontario, Canada) and cot! DNA (Gibco/BRL, Burlington, Ontario, Canada) was required to reduce the background. The stained slides were counterstained with DAPI and actinomycin D (for a DA-DAPI banding pattern) and were mounted in antifade medium and visualized utilizing a Zeiss Axioplan 2 microscope. Images of representative mitoses were captured using a cooled CCD
camera (Photometrics PXL 1400). Digital alignment of the images from each fluor was done after registration calibration through a triple bandpass filter (F1TCITexas RedIDAPI) to minimize registration error, utilizing commercial software (Electronic Photography v1.3, Biological Detection Inc., Pittsburgh PA).
The results clearly showed localization of the probe to chromosomal region 13q33-34. At least one specific probe signal was present in more than 90% of the mitoses examined. Approximately 80% of the cells had two chromatids of a single chromosome. Approximately, 40% showed labelling of both chromatids of both chromosomes. More than 90% of the signals were localized to a single band. In addition, cohybridization of p33INC' with a commercial 13121 alpha-satellite probe (Oncor, Gaithersberg MD) showed hybridization to the same chromosome.
The INGI gene has been localized to an area near known sites of genomic alteration in several human cancers: primary gastric cancer [22], hematologic neoplasms [23] and head and neck squamous cell carcinomas [24].
Expression levels of ING1 in ~g and senescent fibroblasts.
The normal human diploid fibroblast cell strain Hs68 (ATCC CRL#1635) and a phenotypically normal mouse epithelial cell line from mammary gland {NMuNG) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. Hs68 cells were used at 30 ("young"), 70 ("pre-aged") and 80 ("old") mean population doublings (MPDs) for expression and life span experiments. After retroviral infection, the human diploid fibroblast cells (HDFs) were repeatedly passaged in 10 cm plates, splitting at a ratio of 1:2 when confluent.
For infection of fibroblasts, the retroviral vector (pLNCX) was used. The highly efficient ecotropic (BOSC23) and amphotropic (CAKB) packaging cell lines were used [2b]. pLNCX-aS or pLNCX alone, were transfected into the BOSC23 virus-packaging cell line. Ecotropic and amphotropic packaging lines, and the retroviral vector were kindly provided by Dr. A. Gudkov (University of Illinois at Chicago). The amphotropic cells were infected by viruses from the BOSC23 supernatant. Fibroblasts were plated at 105 cells per 10 cm plate and infected with undiluted viral supernatant from amphotropic producer cells. Infection efficiencies ranged from 85 to 95 % in individual trials .
Since the activity or expression levels of several tumor suppressors increase in senescent cells, the levels of ING1 expression in low and high passage cells were checked. All experiments were performed on the Hs68 strain of primary normal human diploid fibroblasts. Senescent cells were obtained by passaging early-passage ("young") fibroblasts continuously to a point at which one population doubling required from 2 - 3 weeks to complete compared to 24 hours, on average, for young HDFs. Hs68s at MPDs exhibited characteristics typical of senescent cells, including an inability to respond to growth factors and altered morphology including increased size and decreased saturation density.
To study the level of expression of ING1 mRNA, RT-PCR using total RNA
isolated from young and old cells was performed (Figure 8A). The relative levels of ING1 transcript were compared to the internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using PCR primers specific for the p33 and GAPDH genes.
INGI and GAPDH were amplified in the same reaction tube using the "primer dropping" approach [27] which internally controls for efficiency of reverse transcription and amplification by PCR.
Reverse transcription (RT) with 1 ~,g of total RNA from young and old Hs68 cells was performed using SO U of RNasin (Pharmacia Biotech, Inc., Quebec Canada) and 200 U of MMLV reverse transcriptase for 50 min. at 42°C in 20 ~,1 reaction volumes. Two ~,1 of each RT reaction was amplified using 2 U of Taq polymerase. The two sets of primer pairs for the INGl gene and for the GAPDH gene that were used, were:
5'-GAAGCGGCGGATGCTGCACT-3' (SEQ ID NO: 19); and S'-ACGCACGAGAAGTGGAACCA-3'(SEQ ID NO: 16) for the ING1 gene and 5' CGGAGTCAACGGATTTGGTCGTAT -3'(SEQ ID NO: 20); and 5' - AGCCTTCTCCATGGTGGTGAAGAC 3' (SEQ ID NO: 21 ) for the GAPDH gene.
Thirty two PCR cycles for ING1 and twenty two PCR cycles for GAPDH were performed using standard conditions [17]. Primers for GAPDH were added to PCR
tubes at the end of the 10th cycle [27) .
The levels of ING1 mRNA were estimated by scanning densitometry to be approximately ten fold higher in senescent fibroblasts compared to young fibroblasts. In order to see if increased mRNA levels resulted in increased protein levels, Western blotting experiments were performed with a rabbit polyclonal antibody that was raised against a bacterially expressed glutathione-S-transferase (GST)-p33'NCl fusion protein and that reacted with a 33 kDa protein in human and mouse cell lysates.
Hs68 and NMuMG cells were harvested and 20 ~,g of total protein was used in each lane. Proteins were separated by electrophoresis in 12.5 %
polyacrylamide/SDS
gels, and transferred to membranes for 1 hour using an electroblotter. The membranes were blocked in TBS(100 n~IVI Tris, 150 mM NaCI} containing 10% nonfat dried milk and 0.1 % Tween-20 for 2 hours. Incubation of the membranes with p33INC~
antiserum was performed in TBS containing 5 % nonfat milk and 0.1 % Tween-20 for 1 hour and then membranes were washed with TBST solution for 30 minutes. Horseradish peroxidase-conjugated goat anti-rabbit antibody was then applied to the filters for 1 hour in TBST. Peroxidase activity was detected using ECL (Amersham Canada, Oakville, Ontario, Canada) and relative band intensities were determined by scanning densitometry.
As shown in Figure 8B, the level of p33'NC' protein increases approximately 8 fold when cells approach the end of their in vitro replicative lifespan, consistent with results obtained using RT-PCR.
Since ING1 appears to arrest cells in G1 when overexpressed and senescent cells are primarily arrested in the G1 phase of the cell cycle [28], the level of p33'NC~ protein was tested during the cell cycle..Quiescent, proliferation-competent NMuMG
cells were serum stimulated, lysates were prepared at different times after serum addition, and samples were analyzed by Western blotting with anti-p33 antibodies by the method set forth above. The level of p33INC~ was found to decrease as cells exited from G0, to increase during late G1 and to reach a maximum in S phase. This was followed by a decrease in G2 of the cell cycle (Figure 9B). CDK2 expression was used as a control for cell cycle progression and changed as reported previously (Figure 9A) [29]. Figure 9C shows the results of DNA content analysis by fluorescence-activated cell sorting (FACS) in parallel cultures indicating that cells enter S phase at 16 hours under these experimental conditions. These results indicate that ING1 is regulated following mitogen addition to quiescent cells, with expression reaching a peak during DNA
synthesis.
To determine the effects of reducing the levels of ING1 mRNA on the replicative lifespan of HDFs, cells were infected with a pLNCX-aS (the construct carrying a 182 by fragment in the antisense orientation and representing nucleotides 942 to 1,124 of the INGI cDNA (Figure 3)). This antisense fragment effectively inhibits translation of ING1 mRNA as shown previously where chronic expression of the antisense construct resulted in 90 % inhibition of the expression of the endogenous p33I'~G' protein in cells.
Amphotropic and ecotropic packaging cells that were used for infection are capable of producing retroviruses with titers higher than 10~ per ml upon transient transfection which allows delivery of the retroviral construct to HDFs with efficiencies of approximately 90 % as monitored by expression from a retroviral -p-galactosidase construct.
"Young" HDFs at 30 MPDs were "pre-aged" by continuous subculturing until reaching 70 MPDs. Hs68 cells at 70 mean population doublings (MPDs) were infected with the retroviral vector pLNCX as a control or with pLNCX-aS and were subcultured in parallel using subculturing ratios of 1:2. Infected cells were propagated an additional 10 MPDs after which 105 control pLCNX and 105 pLCNX-aS cells at 80 MPD were split into twelve 10 cm plates and cultivated for two months, with weekly refeeding using complete medium. Some of the cells infected with retrovirus alone were observed to divide once during this time, while cells containing the ING1-aS fragment continued to grow and created visible colonies.
To confirm the effect of the antisense fragment of ING1 in cells, indirect immunofluorescence with a rabbit polycional antibody that was raised against p33'NC' was performed. Senescent vector-infected fibroblasts and fibroblasts from colonies resulting from ING1-aS retrovirus infection were grown on glass coverslips for hours at 37 ° C to 60 % confluence. Then the cells were fixed in 3 .7 %
formaldehyde, washed in 0.5 % Triton X100 and in 0.05 % Tween 20 in PBS solution for 10 minutes each at room temperature. The cells were incubated with a 1:100 dilution of rabbit p331'~c' antiserum for 30 min, washed in PBS with 0.05 % Tween, incubated with goat anti-rabbit IgG-biotin antibody and then with streptavidin conjugated Texas Red.
Samples were examined with a Zeiss Axiophot fluorescence microscope and images were photographed on Kodak TMAX 400 film.
Staining with anti-p33 antibody was observed in the nuclear compartment of senescent cells containing control virus but not in cells obtained from colonies that had received antisense p33 retrovirus. These results corroborate the previous observations that p33'NG' is a nuclear protein and confirmed that the levels of p33iNC1 protein decrease in cells from colonies resulting from INGI-aS retrovirus infection.
Similar results were seen in cells from 3 individual colonies and from 20 independent senescent cells containing control retrovirus.
To estimate the efficiency with which down regulation of the ING1 gene by infection with PLCNX-aS was able to extend the proliferative lifespan of normal fibroblasts, the number of cells in each colony was counted. Results of these calculations are shown in Figure 10 in which colonies were divided into 4 groups depending upon the number of cells in the colony. Most colonies contained 100-cells, therefore if cells divided in an arithmetic progression (2,4,8...n}
this class corresponds to approximately 7 additional MPDs (2'=128}. Colonies in the largest category (220-280) correspond to 8 cell doublings (28=25b). Similar results were obtained in two separate trials and strongly indicate that down regulation of p33'NC' protein is sufficient to extend the proliferative lifespan of normal fibroblasts by approximately 10 % , as previously reported for the p53 tumor suppressor gene [30] .
Indications that ING1 may be involved in the modulation of apoptosis first came from the conspicuous presence of ING1 in regressing tail and absence from growing hindlimbs of metamorphosing Xenopus tadpoles and second, the serum deprivation-induced elevation of ING1 levels in P19 teratocarcinoma cells that correlated with the induction of apoptosis within 48-72 hours (Figure 11A; 35).
In order to establish the effect of ING1 expression on apoptosis, we infected P19 cells with sense (S), antisense (aS) and retroviral vector alone (V) and examined cell viability 72 hours after serum withdrawal.
P19 mouse teratocarcinoma cells were grown in alpha MEM medium with 10%
fetal calf serum (FCS: GIBCO/BRL, Burlington, Ontario, CANADA). For serum starvation experiments, the cells were washed twice in PBS {phosphate buffered saline;
137 mM NaCI, 2.7 mM KCI, 10.1 mM NazHP04, 1.8 mM KH2P04, pH 7.4} and serum-free alpha MEM (GIBCO/BRL) was added.
Retroviral infection of target cells was used to introduce ING1 expression constructs. Because the ING1 protein appears to block entry into S-phase of the cell cycle the use of standard drug resistance selection methods is precluded.
Retroviral infection also has a higher efficiency than standard calcium phosphate transfection procedures. The retroviral vector, pLNCX (7), containing sense {S), antisense (aS;
nucleotides 942 to 1124 of the ING1 cDNA) or vector alone were transfected into a WO 98/44102 PCTlCA98/00277 highly-efficient BOSC23 ecotropic virus-packaging cell line. The BOSC23 supernatant was then used to infect ecotropic producer cell lines. The target P19 cells were plated at 104 cells per 10 cm plate and infected with undiluted viral supernatant from ecotropic producer cells. Infection efficiency was determined to be about 60% with the P19 cells because these cells were prone to clumping.
Cell viability was assessed using a trypan blue dye exclusion assay. Cell suspensions were mixed 4:1 with 0.5% trypan blue:saline solution (GIBCO/BRL).
The cells were incubated at room temperature for 5 minutes and counted with a hemacytometer .
As shown in Figure 11B, the antisense ING1 construct conferred a moderate level of protection against death (70%o viable) compared to that conferred by a retroviral construct constitutively expressing the bcl-2 gene (84% viable). Conversely, P19 cells expressing the sense ING1 construct exhibited greater death (44% viable) than the vector only (54 % viable) or antisense bcl-2 controls {56 % viable), suggesting that ING1 confers cellular susceptibility to death induced by serum starvation. These numbers represent a minimal estimate of the effects of ING1 and bcl-2 due to the modest transfection efficiency of P19 cells as outlined above.
Since the infection efficiency was low for P19 cells, we turned to another model system of apoptosis developed in our laboratory, that of rodent fibroblasts (Rat 1 and NIH 3T3) containing a tetracycline-controlled human c-myc gene (tet-myc cells).
Because these cells form a monolayer, transfection efficiencies of greater than 90 % are obtainable.
The human c-myc gene was inserted into a plasmid containing a minimal cytomegalovirus promoter preceded by several binding sites for the tetracycline transcriptional protein (TA) (36). This construct (hTIC-myc) was stably transfected into NIH3T3 or Ratl cells previously selected for the stable expression of the TA
protein that is capable of binding to, and activating transcription of the myc gene on the hTIC-myc construct, in the absence of tetracycline. In the presence of tetracycline, the TA protein is blocked from binding and very little, if any transcription is seen from the c-myc expression construct. If tetracycline is washed from the cells, expression of the WO 98!44102 PCT/CA98100277 c-myc gene increases and expression can be regulated by altering the level of tetracycline to give up to 100 fold higher expression levels. Transformed cell lines that showed low background expression of c-myc and a high degree of inducibility were chosen for future studies.
The transformed rodent fibroblasts, either NIH 3T3- or rat 1-derived cells containing the tetracycline-controlled human c-myc gene (tet-myc cells) were maintained in high glucose Dulbecco's MEM (GIBCO/BRL) supplemented with 10 %
FCS and 2 ~,g/ml tetracycline {Sigma, St. Louis, MO) to repress premature human c-myc gene repression. Removal of tetracycline from the medium results in the rapid accumulation of human c-myc protein (Figure 12A) and subsequent apoptosis. The advantage of such a system is that control and experimental cells possess an identical genetic background and the potential for cellular adaptation to constitutive c-myc overexpression is minimized.
The tet-myc NIH3T3 or Ratl cells were plated at 104 cells per 10 cm plate and infected with undiluted viral supernatant from ecotropic BOSC23 cells described above.
Infection efficiency was determined to be greater than 90% for NIH 3T3 tet-myc cells using a retroviral ~3-galactosidase construct.
Tet-myc cells containing the retroviral constructs were seeded at a density of approximately 104 cells/cm2 on glass coverslips and grown at 37°C for 48 hours before processing as described (lb).
The cells were subsequently treated to induce c-myc expression and apoptosis.
Briefly, this involved washing out the tetracycline inhibitor, elevating c-myc expression by up to 100 fold, and then transferring cells to medium without serum where apoptosis rapidly ensued. Nuclear proteins were isolated at certain timepoints and immunoblotted.
DNA laddering was assessed using the method of Smith et al {32). Tet-myc cells were plated at equal densities as described above. At 72 hours after exposure to 0.1 %
FCS, DNA was isolated from the floating cells on a per plate basis. Equal volumes of lysate were run on a 2 % agarose gel and stained with ethidium bromide.
When c-myc was induced in the NIH 3T3 tet-myc cells by tetracycline withdrawal and the cells were then serum starved for 72 hours, they showed a viability of 65 % compared with controls where c-myc was not induced (Figure 13A).
Apoptosis was minimized in cells coexpressing the antisense INGl construct with only 5 %
of cells S dying upon serum withdrawal. Cells expressing INGI protein alone showed 70%
viability after serum starvation and apoptosis. This was magnified when both the ING1 and the c-myc gene were coexpressed (40% viability). These cells exhibited several hallmarks of apoptosis including shrinkage, loss of substrate adhesion and chromatin condensation. In addition, internucleosomal DNA fragmentation was greatly enhanced in tet-myc cells expressing p33'"~t compared to vector only, antisense ING1 or bcl-2-expressing tetmyc cells (Figure 13B).
To confirm that ING1 enhances apoptosis during serum starvation, we microinjected p33'NC' or a CMV-ING1 expression constructs into rat tet-myc fibroblasts and counted the number of remaining injected cells at various times after serum deprivation. Rat tet-myc cells were seeded on coverslips as described above and injected with about 25 p,g/ml of GST-ING1 protein or GST protein, or with 25 ~,g/ml of CMV-driven ING1 expression construct or vector alone (31}. After allowing the cells to recover for 4-6 hours, the coverslips were washed twice with PBS and the cells were serum starved. Injected cells were identified through coinjection and subsequent immunostaining of a coinjected nonspecific antibody. Because the history of each injected cell could be followed, a more dramatic effect of ING1 expression compared to the previous experimental approaches was apparent (45 % viable at 24h), with a further decrease in surviving cells when c-myc and ING1 were coexpressed (9% viable at 24h).
The results of the microinjection of the GST-INGI protein are shown in Figure 13A.
Similar results were obtained with microinjection of the CMV-ING1 construct.
These results support the data obtained with both the P19 and transformed NIH3T3 tet-myc cells and show that p33'NCl is involved in regulation of apoptosis, in a manner that is synergistic with the action of c-myc.
It therefore appears that in at least three independent cell lines, ING1 expression confers an increased susceptibility to death upon serum starvation.
Conversely, decreasing endogenous INGl levels afforded some protection against cell death.
INGI
markedly influences the outcome of c-myc-induced apoptosis and may, therefore, participate in guiding the response pathway whereby c-myc overexpression activates either apoptosis or tumorigenesis.
Modification of the above-described modes of carrying out various embodiments of this invention will be apparent to those skilled in the art following the teachings of this invention as set forth herein. The examples described above are not limiting, but are merely exemplary of this invention, the scope of which is defined by the following claims .
REFERENCES
The following references are cited in the application as numbers in brackets ([]) at the relevant portion of the application.
1. Levine, A.J., "The Tumor Suppressor Genes", Annu. Rev. Biochem.
62:623-651 (1993).
2. Hunter, T. et al., "Cyclins and Cancer II: Cyclin D and CDK Inhibitors Come of Age", J. Cell 79:573-582 (1994).
3. Gudkov, A.V. et al., "Isolation of genetic suppressor elements, inducing resistance to topoisomerase II-interactive cytotoxic drugs, from human topoisomerase II
cDNA", Natl. Acad. Sc. USA 90:3231-3235 (1993).
4. Straus, D. et al. , "Genomic subtraction for cloning DNA corresponding to deletion mutations", Proc. Natl. Acad. Sc. USA 87:1889-1893 (1990}.
5. Lisitsyn, N. et al., "Cloning the Differences Between Two Complex Genomes", Science 259:946-951 (1993).
6. Yaswen, P. et al. , "Down-regulation of a calmodulin-related gene during transformation of human mammary epithelial cells", Proc. Natl. Acad. Sc. USA
87:7360-7364 (1990).
7. Miller, A.D. et al., "Improved Retroviral Vectors for Gene Transfer and Expression", Biotechniques 7:980-986 (1989).
"Breast cancer" means any of various malignant neoplasms of the breast or mammary tissue.
"Brain cancer" means any of various malignant neoplasrns of the brain, neuroglial cells or meninges .
"Cell cycle" means the cyclic biochemical and structural events occurring during growth of cells. The cycle is divided into periods called : quiescence (G6), Gap, (G,), DNA synthesis (S), Gape (GZ), and mitosis (M).
"Cell division" means mitosis, i.e., the usual process of cell reproduction.
"Code" or "encode", when used with reference to a nucleotide's relation to a protein, mean the system whereby particular combinations of adjacent nucleotides control the insertion of particular amino acids in equivalent places in a protein molecule.
"Expression" means the production of a protein or polynucleotide in the cell.
A "eukaryotic cell" is a cell having a membrane-bound nucleus containing DNA
in the form of chromosomes, either in a tissue or organ or in tissue culture.
More preferably, it is a mammalian cell.
"Growth" means progression through the cell cycle with the result that two daughter cells are formed from each mother cell. "Actively growing" means that state wherein cells exhibit growth and cell division.
"Hyperplasticity" means an increase in cell number, excluding tumor formation.
"Immunohistochemistry" means a method to localize a specific protein within a cell using cell sections or thin sections of a specific tissue and an antibody directed against the target protein. It is contemplated that the antibody may be directly labelled, radioactively, biotinylated or labelled with a fluorochrome. It is also contemplated that the antibody may be indirectly labelled.
"Inactivating" a gene means rendering the gene incapable of producing an active protein normally encoded by that gene. Methods of inactivating a gene include, for example, deleting the gene in the cell or introducing a deletion or mutation into the gene such that the gene no longer expresses an active protein. Preferably cells having such inactivated genes are substantially free of the active protein.
"In situ hybridization" means a method to identify and localize certain specific transcripts of specific genes in cells and tissue sections. The cells are fixed to a solid support and hybridized to a labelled nucleic acid probe complementary to the sequence to be identified. The probe may be directly labelled or indirectly labelled.
"Label" means to incorporate into a compound a substance that is readily detected. Such substances include radioactive substances and fluorescent dyes, for example.
"Mammalian cell" means a cell in or from a mammal, either in a tissue or organ or in tissue culture.
"Neoplasia" means the process resulting in the formation and growth of an abnormal tissue that grows by cellular proliferation more rapidly than normal, and continues to grow after the stimuli that initiated the new growth cease.
"Neoplastic" describes the abnormal tissue that grows by cellular proliferation more rapidly than normal, and continues to grow after the stimuli that initiated the new growth cease.
"Normal cell" means a non-cancerous cell.
"Proliferation" means growth and reproduction, i.e., division of cells.
"Actively proliferating" means cells that are actively growing and reproducing.
"Native" means the nucleic acid of a non-mutated gene or peptide sequence encoded by such a gene as found in a phenotypically normal cell.
"Substantially identical" means that the polynucleotide or nucleic acid of interest is able to hybridize to the complement of the known sequence under stringent conditions. Such stringent conditions preferably require at least 85 %
homology, more preferably the conditions require at least 90 % homology and most preferably the conditions require at least 95 % homology. When used in relation to peptides and proteins, "substantially identical" means that the amino acid sequence of the peptides _g_ _. . . _. _.. , share at least 85 % homology, more preferably at least 90 % homology and most preferably at least 95 % homology.
"Senescent cells" means cells that are no longer actively dividing and reproducing. Such cells are typically characterized by an inability to respond to growth factors and by altered morphology including increased size and decreased saturation density in tissue culture.
B. Synthesis and Methodolo~v A novel positive selection procedure that combines subtractive hybridization with an in vivo selection assay was used to identify putative growth-suppressor elements. An overview of the strategy used is shown in Figure lA.
Following a modified subtractive hybridization protocol [4,5], total cDNA from a normal mammary epithelial cell line [6] was hybridized independently with cDNAs from the breast cancer cell lines MCF-7, BT-483, BT-474, Hs-578T, ZR-75, MD-MB-468, MD-MB-435 and BT-20 which were obtained from the American Type Culture Collection. Subtracted cDNA, theoretically containing sequences more highly expressed in the phenotypically normal epithelial cells, was then used as a probe to screen a normal human fibroblast cDNA library.
Following screening, 300 cDNA clones were isolated, and their inserts were digested into fragments of 200-800 base pairs. The fragments were then recloned into the retroviral plasmid vector pLNCX [7]. After passage through the packaging line BOSC 23 [3], retroviruses containing the isolated fragments were used to infect normal mouse mammary epithelial cells {NMuMG). The infected cells were subsequently injected into nude mice.
Within 45 days, several mice developed tumors from which the cloned inserts were recovered by amplification using primers specific for pLNCX in polymerase chain reactions {PCR). Two different sequences were isolated from tumors, one of which was subsequently shown to be expressed in the antisense orientation.
The antisense sequence isolated, when introduced into normal fibroblast cells, consistently showed the biological effects of increased cell proliferation in soft agar and in focus forming assays (Fig. 1B and Table 1). This 182 by fragment represented nucleotides 781 to 963 of the cDNA shown in Figure 2 and nucleotides 942 to 1124 of Figure 3. This cDNA encodes a 33 kDa protein called p33I"cl for INhibitor of Growth.
This was formerly designated p33'c' (see U.S. Serial No. 08/569,721 which is incorporated herein by reference in its entirety).
After plating NMuMG cells infected with either control virus or with virus containing an insert of the antisense orientation of ING1 in soft agar, cells receiving the insert formed, on average, at least 50 times the number of colonies as cells infected with virus alone. Similar results were obtained following transfection of the retroviral construct into NIH3T3 cells, where pLNCX containing the insert of the antisense orientation of INGl resulted in the formation of 2.3 times the number of generally larger foci than vector alone.
These results corroborated the observations made in the nude mouse assay that the ING1 sequence corresponds to a gene whose product plays a significant role in regulating cell growth.
In order to isolate the gene corresponding to the fragment showing biological effects, normal human fibroblast and HeLa cell libraries were screened with the fragment, resulting in the isolation of 11 positive clones. Two clones contained cDNA
whose sequence is shown in Figure 2. The complete cDNA sequence (Figure 3) was obtained using rapid amplification of cDNA ends (RACE) by methods known in the art.
Comparison of the sequence of p33INC' shown in Figure 3 to the available protein and nucleotide data bases showed no significant homology to any sequence encoding a known protein and very limited similarity to retinoblastoma binding protein 2 (RbBP2) [9] and to several zinc finger transcription factors. Regions of the p33INC' protein that show homology to retinoblastoma binding protein 2 were identified using the Blast program available from the National Centre for Biological Information (address: www.ncbi.nim.nih.gov).
Use of a polyclonal antibody raised against a glutathione-S-transferase (GST) fusion with p33ING~ revealed a protein of 33 kDa by Western blot analysis of human and mouse cell extracts (Figure 1C).
~ , To determine whether the level of p33INC1 was decreased in cells infected with viral constructs containing the antisense orientation, lysates were prepared from control NMuMG cells and from NMuMG cells infected with antisense INGl that had grown and formed colonies in semi-solid medium. Results of Western blot analysis showed that chronic expression of antisense construct reduced the expression of the endogenous p33'NC' protein by approximately 90% in the cells (Figure 1C, lane 6) compared to control parental cells (Figure 1C, lane 5).
The ING1 cDNA contains several AU-rich elements (AREs) in the 3' untranslated region of the clone (Figure 2) which are believed to be involved in the destabilization of specific mRNAs [10].
Since the ING1 gene was originally isolated by subtractive hybridization between normal and transformed epithelial cDNAs, the levels of ING1 mRNA
expression in different normal, breast cancer, and brain cancer cell lines were examined. Results from Northern blot analysis show that ING1 is expressed at considerably lower levels (approximately 2-8 fold as estimated by scanning densitometry) in BT-20, ZR-75, MDA-MB-435 and T-47D breast cancer cells compared to MDA-MB-468 and SK-BR-3 breast cancer cells and to normal Hs68 fibroblasts. Results from reverse transcription polymerase chain reaction (RT-PCR) showed that ING1 is not expressed or is expressed at very low levels in glioblastomas, astrocytomas and meningiomas.
Isolation of a DNA fragment that was capable of inducing tumors, foci and growth in soft agar when expressed in the antisense orientation, suggested that the cellular role of p33'NC' is to negatively regulate growth. To test this idea, part of the ING1 cDNA was cloned into the mammalian expression vector pBK in the sense orientation (pINGI-S). This construct and the plasmid vector, both of which contain neomycin resistance genes and a cytomegalovirus (CMV) promoter, were transfected into human breast cancer (Hs578T) and normal fibroblast (Hs68) cells.
Following growth of the cells in antibiotic for 3 weeks, a large number of stable transformants were recovered from cells transfected with vector (1 +3), whereas very few colonies were visible in plates of cells transfected with the sense orientation of INGl cDNA
(2+4)(Figure 4A).
To corroborate the results of these chronic assays, the effect of microinjecting these constructs, together with non-specific antibodies into fibroblasts was examined.
Arrows in panels 1 and 3 of Figure 4B identify cells injected with sense (S) and antisense (aS) constructs, respectively, which were visualized by staining for the presence of coinjected non-specific antibodies using indirect immunofluorescence.
Arrows in panels 2 and 4 of Figure 4B show that cells injected with pINGI-S
failed to incorporate bromodeoxyuridine (BrdU) (panel 2) over a 36 hour time course after injection. In contrast, those injected with pINGl-aS entered S phase (panel 4) as estimated by staining with anti-BrdU antibodies.
Figure 4C shows the combined results of 5 separate experiments, which indicated that injection of the pBK vector or of pINGl-aS constructs had no appreciable effect upon the ability of injected cells to incorporate BrdU, whereas injection of pINGl-S blocked the ability of cells to enter into and proceed through S
phase.
Similar results were obtained in larger populations of cells that were electroporated with vector, sense and antisense construct DNAs together with a construct encoding the CD20 surface marker. Such co-transfections allowed the analysis of DNA content in cells that had taken up DNA by staining for CD20 and subsequent analysis by fluorescence activated cell sorting (FACS). As shown in Table 2, the CD20-expressing population co-transfected with pINGI-S had, on average, 63.1 % of cells in GOIG1 whereas those co-transfected with vector had 33.6% of cells in GOIG1 when cells were fixed and stained 48 hours after electroporation.
These results, using several independent methods, indicate that the overexpression of p33'NGl inhibits cell growth and DNA synthesis in both transient and chronic assays, most likely by arresting cells in the G1 phase of the cell cycle.
Since the activity of the tumor suppressor genes increases in senescent cells [20], p33IN~' activity in low and high passage cells was checked. As shown in Figures 8A and 8B, ING1 expression (and the level of the p33'NGl protein) increased several-fold when cells approached the end of their in vitro replicative lifespan.
These data demonstrate that p33INC' is a novel inhibitor of cell growth and a candidate tumor suppressor. Additional experiments also indicate that p33'NG' is localized in the nucleus of cells, which is consistent with p33'"c''s functioning as a tumor suppressor. Further data showed that ING1 gene is localized to the 13q33-S chromosome region. A number of human cancers have been mapped to this region including primary gastric cancer; hematologic neoplasms; head and neck squamous cell carcinomas. Alternatively, p33'NC' might play a role in the regulation of cyclin-dependent kinases (CDKs), as reported recently for the family of CDK
inhibitors including p18[11], p21[12,13] and the candidate tumor suppressor pl6MTS'[8] to which a portion of the p33'"c' sequence shows some homology, and which has been reported to be the MTS 1 multiple tumor suppressor locus of human chromosome 9p21 that is inactivated in many types of human tumors [ 14,15] .
Indications that the ING1 gene may be involved in the modulation of apoptosis first came from the conspicuous presence of p33'"c' in regressing tail and its absence from growing hindlimbs of metamorphosing Xenopus tadpoles. Accordingly, P19 cells were infected with sense (S), antisense (aS) constructs and cell viability was examined under serum starvation. As shown in Figure 12B, the antisense construct conferred a moderate level of protection against death (70% viability). Conversely, P19 cells expressing the sense ING1 construct exhibited greater cell death (44%
viability) suggesting that the ING1 gene confers cellular susceptibility to death induced by serum starvation.
When c-myc was induced in the NIH 3T3 cells by tetracycline withdrawal and the cells were serum starved for 72 hours, they showed a viability of 65 %
compared with controls where myc was not induced (Figure 13A). Apoptosis was minimized in cells coexpressing the antisense INGl construct with only 5% of cells dying upon serum withdrawal. Cells expressing the ING1 protein alone showed 70% viability after serum starvation and apoptosis was magnified when c-myc was also expressed (40%
viable). This showed that with both P19 and NIH 3T3 tet-myc cells expression of the ING1 gene is involved in regulation of apoptosis in a manner that is synergistic with the action of the myc gene.
Without being restricted to a theory, it appears that a loss of p3fNC' or its function appears to have similar consequences to those observed for p53 (33, 34). Since ING1 appears to be important in the control of the G1 to S phase transition, it is possible that 1NG1 could modulate or be modulated by p53. Conversely, ING1 could act independently, perhaps providing an activity where p53-independent mechanisms are at work. Alterations in the proper functioning of p331NC1 may contribute to tumorigenesis by rendering cells refractory to normal apoptotic pathways.
It is expected that several p33'NC'-related peptides will be useful in the present invention. In particular, p33'NC', its analogs and related proteins and peptides which are effective in potentiating apoptosis in eukaryotic cells are preferred.
Included within the scope of the p33"~cl, as that term is used herein, are p33'NC's having the amino acid sequence set forth in Figures 2 and 3, homologous amino acid sequence variants of the sequence of Figures 2 and 3, and homologous in vitro-generated variants and derivatives of p33'NC', which are capable of exhibiting a IS biological activity in common with the p33'"cl of Figure 3. Also included are p33'NC' variants having post-translational modifications, such as acetylation, glycosylation or phosphorylation.
p33INC' biological activity is defined as the possession of at least one cell proliferation, cell regulatory or tumor suppressive function qualitatively in common with native p33'NCIs. One example of the qualitative biological activity of p33'NC' is its ability to inhibit cell growth as estimated by decreasing the S-phase fraction in a population of cells.
The effective quantity of p33'NC' biological activity is that level of p331NC' biological activity necessary to potentiate apoptosis. The methods of this invention may reduce the effective quantity to less than 50% of the p3fNC' biological activity of normal cells more preferably less than 30 % of the p3 f Ncl biological activity, most preferably there will be no p33'NCl biological activity.
p33'NCl immunological activity is defined herein as the possession of immunological cross-reactivity with at least one epitope of native p3fNC' Immunologically cross-reactive, as used herein, means that the candidate polypeptide is , , , capable of competitively inhibiting the qualitative biological activity of the native p33'"c' having this activity, with polyclonal antisera raised against the known active analog. Such antisera are prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analog in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds.
This invention is concerned with amino acid sequence variants of native p33'"cj, Amino acid sequence variants of the p33'"c' are prepared with various objectives in mind, including increasing the affinity of the p33'"c' for its binding partner, facilitating the stability, purification and preparation of the p33'"c', modifying its biological half-life, improving therapeutic efficacy, and lessening the severity or occurrence of side effects during therapeutic use of the p33'"c'.
Amino acid sequence variants of p33'"°' fall into one or more of three classes:
insertional, substitutional, or deletional variants including those variations that arise from variable splicing of transcripts from the chromosomal gene. Additional variants may also be prepared by site specific mutagenesis of nucleotides in the DNA
encoding the p33'"c', by which DNA encoding the variant is obtained, and thereafter expressing the DNA in recombinant cell culture. However, variant p33'"c' fragments having up to about 100 to 150 amino acid residues are prepared conveniently by in vitro synthesis.
The amino acid sequence variants of the p33'"c' may be predetermined variants not found in nature or naturally occurring alleles. The p33'"c' variants typically exhibit the same qualitative biological activity as naturally occurring p33'"c'.
However, the p33'"c' variants and derivatives that are not capable of exhibiting qualitative biological activity similar to native p33'"c', may nonetheless be useful as reagents in diagnostic assays for p33'"c' or antibodies to p33'"cl. Further, when insolubilized in accordance with known methods, they may be used as agents for purifying anti-p33'"c' antibodies from antisera or hybridoma culture supernatants. Further, they may be used as immunogens for raising antibodies to p33'"c' or as a component in an immunoassay kit (labeled so as to be a competitive reagent for native p33'"cl or unlabeled so as to be used as a standard for the p33INC' assay) so long as at least one p33'NCl epitope remains active in these analogs.
While the site for introducing an amino acid variation may be predetermined, the mutation, per se, need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random or saturation mutagenesis (where all 20 possible residues are inserted) is conducted at the target codon and the expressed p33'"c' variant is screened for the optimal combination of desired activities.
Such screening is within the ordinary skill of the art.
Amino acid insertions will usually be on the order of from about one to about ten amino acid residues; substitutions are typically introduced for single residues and deletions will range from about one to about thirty residues. Deletions or insertions preferably are made in adjacent pairs. That is, a deletion of two residues or insertion of two residues. Substitutions, deletions, insertions or any combination thereof may be introduced or combined to arrive at a final construct.
Insertional amino acid sequence variants of the native p33'NC' are those in which one or more amino acid residues extraneous to native p33INC' are introduced into a predetermined site in the target p33i~'GI and which displace the pre-existing residues.
Commonly, insertional variants are fusions of heterologous proteins or polypeptides to the amino or carboxyl terminus of the p33ING1. Such variants are referred to as fusions of the p33'NC' and a polypeptide containing a sequence which is other than that which is normally found in the p33INC' at the inserted position. Several groups of fusions are contemplated for carrying out the invention described herein.
Immunologically active p33'"c1 derivatives and fusions comprise the p33'NCl and a polypeptide containing a non-p33INC' epitope. Such immunologically active derivatives and fusions of p33'NC' are within the scope of this invention. The non-p33'NCl epitope rnay be any immunologically competent polypeptide, i.e., any polypeptide which is capable of eliciting an immune response in the animal in which the fusion is to be administered, or which is capable of being bound by an antibody raised against the non-p33'NC' polypeptide.
-lb-Substitutional variants are those in which at least one residue in the Figure sequence has been removed and a different residue inserted in its place. Novel amino acid sequences as well as isosteric analogs (amino acid or otherwise) are included within the scope of this invention.
Some deletions, insertions and substitutions will not produce radical changes in the characteristics in the p33'NC' molecule. However, while it is difficult to predict the exact effect of the substitution, deletion or insertion in advance of doing so, for example, when modifying an immune epitope on the p33'"~' protein, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. For example, a change in the immunological character of the p33'N°' protein, such as affinity for a given antibody, is measured by a competitive-type intrnunoassay.
Modifications of protein properties such as redox or thermal stability, hydrophobicity, susceptibility to proteolytic degradation, or the tendency to aggregate with carriers or into multimers may be assayed by methods well known to one of skill in the art.
Deletions of cysteine or other labile amino acid residues may also be desirable.
For example, they may increase the oxidative stability of the p3fNG' protein.
Deletion or substitution of potential proteolysis sites, e.g., Arg Arg, is accomplished by deleting one of the basic residues or substituting one with glutaminyl or histidyl residues.
Covalent modifications of the p33'N~' protein are included within the scope of the present invention. Such modifications are introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected side chains or terminal amino acid residues. The resulting covalent derivatives of p33'N~' are useful to identify residues important for p33'NG' ~ s biological activity, for immunoassays of the p33'NC' or for preparation of anti-p33'NC' antibodies for immuno-affinity purification of recombinant p33'NC'. Such modifications are within the ordinary skill of the art and are performed without undue experimentation.
In general, prokaryotes are used for cloning of DNA sequences and in constructing the vectors useful in the present invention. For example, E. coli HB 101, DHSa and XL1-blue are particularly useful. These examples are meant to be illustrative and do not limit the present invention. Alternatively, in vitro methods of cloning such as the polymerase chain reaction may be used.
Expression hosts typically are transformed with DNA encoding the p33'NC' protein which has been ligated into an expression vector. Such vectors ordinarily carry a replication site, although this is not necessary where chromosomal integration will occur. Expression vectors may also include marker sequences which are capable of providing phenotypic selection in transformed cells. Expression vectors also optimally will contain sequences which are useful for the control of transcription and translation.
Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription which may affect mRNA
expression.
Expression vectors may contain a selection gene as a selectable marker.
Examples of suitable selectable markers for eukaryotic cells are dihydrofolate reductase, thymidine kinase, neomycin or hygromycin.
Antibodies to p33'NC' may be prepared in conventional fashion [18] by injecting goats or rabbits, for example, subcutaneously with the complete p33'NC' protein or a peptide consisting of at least 10 amino acids similar to the p33'NC' protein in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freund's adjuvant, The anti-p33'NC' antibodies may be directed against one or more epitopes on p33'NC'. Monoclonal antibodies against p33'NC' can be prepared by methods known in the art [18]. The antibodies are preferably labelled with a marker, for example, with a radioactive or fluorescent marker. It is contemplated that the antibodies would be labelled indirectly by binding them to an anti-goat or anti-rabbit antibody covalently bound to a marker compound.
C. Pharmaceutical Compositions The present invention may be used to potentiate apoptosis in eukaryotic cells by increasing expression of p33'"c'. For example, the potential for apoptosis is increased by introducing into cells a drug or other agent which can increase, directly or indirectly, expression of p33'"c'. Inducing apoptosis in cancer cells is of obvious importance. Inducing apoptosis in tissue culture cells provides a model system for studying the effects of certain drugs for triggering, reversing or halting the apoptotic pathway. Accordingly, increasing a cell's potential to enter the apoptotic pathway is useful.
In one embodiment, a protein or a peptide having p33'"c' biological activity is introduced directly. In a preferred embodiment the peptide possesses at least apoptosis modulating function qualitatively in common with native p33'"c'.
In another embodiment nucleotides coding for p33'NC' are introduced by retroviral or other means. In one embodiment the nucleotide coding for p33'NC' comprises a nucleotide sequence which codes for a peptide having p33'NC' biological activity. In one embodiment the oligonucleotide comprises an oligonucleotide which codes for the amino acid sequence set forth in Figure 3. In another embodiment the oligonucleotide sequence comprises a nucleotide sequence which codes for the amino acid sequence set forth in Figure 2. Preferably the nucleotide sequence is substantially identical to the cDNA sequence of Figure 3, more preferably the sequence is substantially identical to the cDNA sequence of Figure 2 and most preferably the sequence is substantially identical to nucleotides 161 to 1143 of the cDNA
sequence of Figure 3.
Apoptosis is inhibited or substantially decreased by preventing transcription of INGl DNA and/or translation of RNA. This can be carried out by introducing antisense oligonucleotides of the ING1 sequence into cells, in which they hybridize to the p33'NC'-encoding mRNA sequences, preventing their further processing. It is contemplated that the antisense oligonucleotide can be introduced into the cells by introducing antisense single-stranded nucleic acid which is substantially identical to the complement of the cDNA sequence in Figures 2 or 3. It is also contemplated that an antisense oligonucleotide can be expressed in the cells by introducing a single- or double-stranded polynucleotide into the cell under conditions wherein a single-stranded nucleic acid sequence which is substantially identical to the complement of the cDNA
sequence in Figures 2 or 3 is expressed in the cell, for example, by placing the polynucleotide in the antisense direction under the control of a strong promoter. It is contemplated that the antisense oligonucleotide introduced to the cell or expressed in the cell is at least 20 nucleotides, more preferably it is at least 50 nucleotides and most preferably it is at least 100 nucleotides in length. Preferably the antisense oligonucleotide sequence is substantially identical to the complement of nucleotides 942 to 1124 of the cDNA sequence set forth in Figure 3.
It is also possible to inhibit expression of p33'~'c' by the addition of agents which degrade p33'NC'. Such agents include a protease or other substance which enhances p33'NC' breakdown in cells. In either case the effect is indirect, in that less p33'N°' is available than would otherwise be the case.
It is also possible to inhibit expression of p33IN~1 by inactivating the gene coding for ING1 in the cell. Such inactivation can occur by deleting the gene in the cell or by introducing a deletion or mutation into the gene thereby inactivating the gene.
The gene may also be inactivated by inserting into the gene another DNA
fragment such that expression of the native p33'NC' protein does not occur. Methods for introducing mutations, deletions and insertions into genes in eukaryotic cells are known in the art. See, for example, U.S. Patent No. 5,464,764 which is incorporated herein in its entirety.
It is contemplated that the ability to inhibit apoptosis in a eukaryotic cell in tissue culture provides a model system for testing certain proteins and factors for their role in the apoptotic pathway. It also provides a model system for testing compounds suspected of being tumorigenic.
Viral or plasmid vectors may be used to deliver various constructs to target cells in vitro or in vivo. Such viral vectors may include retroviruses, adenovirus or adenovirus-associated viruses. Such methods are known in the art [19].
In vitro such peptides or vectors may be administered by infection, microinjection, electroporation and by other methods known in the art.
In vivo parenteral administration of the nucleic acids is preferred with subdermal or intramuscular administration most preferred. Intravenous administration or use of implanted milliosmol pumps (available from Alza) may also be used.
When used for parenteral administration, which is preferred, the nucleic acids of the present invention may be formulated in a variety of ways. Aqueous solutions of the ._. r nucleic acids of the present invention may be encapsulated in polymeric beads, liposomes, nanoparticles or other injectable depot formulations known tv those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.) The nucleic acids may also be encapsulated in a viral coat. Doses are selected to provide effective inhibition of cancer cell growth and/or proliferation.
The methods of this invention may also be achieved by using a pharmaceutical composition comprising one or more of the following apoptosis inducing compounds:
p33'N~', its analogs and related proteins and peptides. Doses are selected to provide effective induction of apoptosis.
Parenteral administration of the proteins or peptides is preferred, with subdermal or intramuscular administration most preferred. Intravenous administration or use of implanted milliosmol pumps (available from Alza) may also be used.
When used for parenteral administration, which is preferred, the proteins and peptides of the present invention may be formulated in a variety of ways.
Aqueous solutions of the proteins or peptides of the present invention may be encapsulated in polymeric beads, Iiposomes, nanoparticles or other injectable depot formulations known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.) Compositions including a liquid pharmaceutically inert carrier such as water may also be considered for both parenteral and oral administration. Other pharmaceutically compatible liquids may also be used. The use of such liquids is well known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.) The dose level and schedule of administration may vary depending on the particular p33'"c'_related compounds) andlor compositions used, the method of administration, and such factors as the age and condition of the subject.
As discussed previously, parenteral administration is preferred, but formulations may also be considered for other means of administration such as orally, per rectum, and transdermally. The usefulness of these formulations may depend on the particular compound used and the particular subject receiving the p33'N°'-related compound.
Oral formulations of p33INC'_related compounds may optionally and conveniently be used in compositions containing a pharmaceutically inert carrier, including conventional solid carriers, which are conveniently presented in tablet or capsule form. Formulations for rectal or transdermal use may contain a liquid carrier that may be oily, aqueous, emulsified or contain certain solvents suitable to the mode of administration. Suitable formulations are known to those of skill in the art.
(Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990. ) D. Use of ING1 DNA and RNA and p33'N~' and Related Proteins and Peptides for Diagnosis The present invention also has diagnostic use, since simple immunochemical staining of cells or sections of cells should give an accurate estimate of the portion of cells expressing p33'N°'. Such a test based on the use of anti-p33'Nm antibodies or ING1 polynucleotides and other standard secondary techniques of visualization will be useful in determining the apoptotic characteristic of eukaryotic cells. Such a test might also be useful to the scientific research community.
Antibodies specifically reactive with p33'NCi can be produced, using known methods [18]. For example, anti-p33'NC' antisera can be produced by injecting an appropriate host (e.g., rabbits, mice, rats, pigs) with p33'N~' and withdrawing blood from the host animal after sufficient time for antibodies to have been formed.
Monoclonal antibodies can also be produced using known techniques [18]. Such antibodies to p33'NCi will generally be detectably labelled (e.g., with a radioactive label, a fluorescent material, biotin or another member of a binding pair or an enzyme) by methods known in the art. It is also contemplated that the anti-p3fN~' antibodies may be indirectly labelled as follows. The unlabelled primary antibody binds to the target protein. Then a secondary antibody (anti-antibody) directed against the primary antibody and tagged with a detectable label binds to the antigen-primary antibody complex.
In a diagnostic method of the present invention, cells obtained from an individual or a culture are processed in order to determine the extent to which p33'NC' is present in cells, in a specific cell type or in a body fluid. This can be determined using known techniques and an antibody specific for p33'NG'. Comparison of results obtained from cells or a body fluid being analyzed with results obtained from an appropriate control (e.g., cells of the same type known to have normal p33'NC' levels or the same body fluid obtained from an individual known to have normal p33'NG' levels) is carried out. Decreased p33'NG' levels are indicative of an increased probability of abnormal cell proliferation or oncogenesis or of the actual occurrence of abnormal proliferation or oncogenesis. It is contemplated that the levels of p33'"°' in cancerous cells will be at least 50 % less than the level of p33'N°' in non-cancerous cells, more preferably the levels will be less than 30 % of normal levels, most preferably p33'NC' will not be expressed. Increased p33'NC' levels are indicative of an increased probability that the cell is capable of entering the apoptotic pathway. It is contemplated that the levels of p33'NC' in apoptotic cells will be at least 50% greater than the level of p33'NC' in normal cells, more preferably at least 70%o greater.
It is contemplated that a diagnostic kit could include a solid support for attaching the cell or tissue to be tested and a delectably labelled anti-p33'N~' antibody. It is further contemplated that the anti-p33'NC' antibody may not be labelled but the kit would additionally contain another delectably labelled antibody capable of binding to the anti-p33'NC' antibody.
A hybridization probe comprising RNA, ING1 cDNA or ING1 genomic DNA
having a sequence substantially identical to Figure 3 ("ING1 polynucleotide") may be employed as a means for determining the sequence of the ING1 gene present in the genomic DNA of a given sample, or the level of ING1 mRNA expressed in cells of such sample. Such hybridization probes will generally be delectably labelled (eg. with a radioactive label, a fluorescent label, biotin, etc). It is also contemplated that the ING1 polynucleotide may be indirectly labelled by methods known in the art. It is contemplated that in situ hybridization of labelled nucleic acid to the cell will be employed to detect the presence of ING 1 mRNA in the cell.
A tissue sample or cell sample can be prepared by conventional means and probed with the labelled ING1 ~ polynucleotide probe to determine the level of expression of ING1 mRNA in the cells. The ING1 polynucleotide probe may also be used to determine whether the genomic DNA from the cell sample has a mutation or rearrangement of its ING1 gene by methods known in the art (i.e. PCR
sequencing or restriction fragment length polymorphism analysis). The polynucleotide probe may also be used to determine whether the genomic DNA from the cell sample has a mutation/deletion rearrangement of the chromosome region of 13q33-34.
The oligonucleotide probe useful in these methods may comprise at least about nucleotides which sequence is substantially identical to the sequence of Figure 3, more preferably it will comprise at least about 100 nucleotides, and most preferably it will comprise at least 400 nucleotides. In the case of PCR sequencing it is 15 contemplated that one of the two INGI oligonucleotide primers will be substantially identical to one region of the sequence of Figure 3 and that the second oligonucleotide primer will be substantially identical to the complement of a second region of the sequence of Figure 3. The size of these primers is preferably from 15-25 nucleotides, more preferably from 15-20 nucleotides. Most preferably the oligonucleotide probes 20 and primers will be substantially identical to the coding region of the cDNA sequence of Figure 3. Such nucleotides can be generated synthetically by conventional means.
Comparison of the results obtained from cells or a body fluid being analyzed with results obtained from an appropriate control (eg. cells of the same type known to have abnormal or native p33'NCl or fluid from an individual known to have normal p33'NG') is carried out. Decreased INGl mRNA levels are indicative of an increased probability of abnormal cell proliferation or oncogenesis or of the actual occurrence of abnormal proliferation or oncogenesis. It is contemplated that the levels of mRNA in cancerous cells will be at least 50% less than the level of INGI mRNA
in non-cancerous cells, more preferably the levels will be less than 30% of normal levels, most preferably ING1 mRNA will not be expressed. Increased INGl mRNA levels are ,, indicative of an increased probability of cell apoptosis. It is contemplated that the levels of ING1 mRNA in cells having apoptotic potential will be at least 50%
more than the level of ING1 mRNA in native non-senescent cells, more preferably at least 70%
more than native non-senescent cells.
The presence of a mutation/deletion in one copy of the ING1 gene in a diploid cell is also indicative of an increased probability that abnormal cell proliferation will occur. The presence of mutations/deletions in both copies of the ING1 gene is indicative of possible or actual oncogenesis.
The following examples are offered to illustrate this invention and are not meant to be construed in any way as limiting the scope of this invention.
EXAMPLES
The methods described as follows were used to perform the studies described herein. In addition, the generally known methods set forth in laboratory manuals for molecular cloning and antibody techniques [e.g., 17,18] may advantageously be used by one of skill in the art to produce additional embodiments of the invention.
m le 1 Strategy for Cloning and Biological Assay Subtractive hybridization of breast cancer cell line cDNAs with cDNA from normal mammary epithelial cells, subcloning of subtracted cDNAs into the pLNCX
retroviral vector [7] and injection into nude mice was done essentially as described [3]
with the modifications noted below. The cloning of full length cDNA was done using standard methods [17]. The strategy is shown in Figure lA.
cDNA was prepared from an non-transformed mammary epithelial cell line (184A1) [6] and digested with the restriction enzyme ai.3A. cDNAs from the breast cancer cell lines MCF-7, BT-483, BT-474, Hs-578T, ZR-75, MD-MB-468, MD-MB-435 and BT-20 (obtained from the American Type Culture Collection, Bethesda MD) were also digested with ~3A. Fragments of tester DNA (cDNA from normal epithelial cells) were Iigated to "a" adaptors. Fragments of driver DNA (cDNA
from breast tumor cells) were ligated to "b" adaptors. Adaptors were prepared by annealing the synthetic oligonucleotides:
5'-GACCTGGCTCTAGAATTCACGACA-3' (SEQ ID NO: 3) with 5'-GATCTGTCGTGAATTCTAGAGCCAGG-3' {SEQ ID NO: 4) (adaptor "a"); and 5'-GACTCGACGTTGTAACACGGCAGT-3' (SEQ ID NO: 5) with 5'-GATCACTGCCGTGTTACAACGTCGAG-3' (SEQ ID NO: 6) (adaptor "b").
The mixture of driver DNA and tester DNA was denatured, then hybridized at 66 ° C for 18 hours. After hybridization, mixtures were treated with Mung bean nuclease to eliminate single-stranded adaptor-derived ends from "heterozygous"
hybrids (hybrids containing both a and b adaptors). Resultant double-stranded molecules were then selectively amplified by PCR using primer "a".
The "amplicons" were then subjected to five successive rounds of hybridization, selective degradation and PCR amplification using 40 ~cg of driver cDNA
containing adaptors and 200 ng, 5 ng and 5 pg of tester amplicons in respective rounds.
This procedure allowed for a significant enrichment of sequences that were more highl j~
expressed in the phenotypically normal epithelial cells as determined by slot blot hybridization.
All subtracted fractions were combined and used as a probe to screen a near-senescent human diploid fibroblast cDNA library. Following screening, 300 cDNA
clones were isolated and their inserts were randomly fragmented {200-800 bps).
These were then ligated with adaptors prepared by annealing two oligonucleotides 5'-AATCATCGATGGATGGATGG-3' (sense) (SEQ ID NO: 22) 5'-CCATCCATCCATCGATGATTAAA-3' (SEQ ID NO: 23) and were amplified by PCR using the "sense" strand of the adaptor as the PCR
primer.
PCR amplified DNA was recloned into the ~I site of the retroviral plasmid vector pLNCX [7] with synthetic adaptors carrying initiation codons in all reading frames.
This library of about 105 clones, enriched in tumor suppressor sequences was then used for the isolation of transforming genetic suppressor elements (GSEs).
WO 98!44102 PCTICA98I00277 After transfection of the recombinant retroviral plasmids into the packaging line BOSC 23 [25), retroviruses containing the isolated cDNA fragments were used to infect non-tumorigenic immortalized mouse mammary epithelial cells (NMuMG) which were subsequently injected subcutaneously into nude mice. Subcloning into the retroviral S vector, packaging into the BOSC 23 virus-packaging cell line and assays using nude mice were performed as described [3].
After 45 days, two mice developed tumors from which two cDNA inserts were recovered by PCR, one of which is subsequently shown to be expressed in the antisense orientation. The primers used in the PCR amplification were:
5'-CCAAGCTTTGTTTACATCGATGGATG-3' (SEQ ID NO: 7) (sense); and 5'-ATGGCGTTAACTTAAGCTAGCTTGCCAAACCTAC-3' (SEQ ID NO: 8) (antisense). The recovered cDNA insert which was in the antisense orientation was digested with ~1 I and ~'ndIII and recloned back into the retroviral vector, pLNCX, in the same position and orientation and then tested individually in vitro.
NMuMG cells were infected with retrovirus produced from pLNCX vector containing or not containing the ING1 insert (nucleotides 942 to 1,124 of the ING
cDNA set forth in Figure 3). The soft agar culture was comprised of two layers: an underlay (DMEM, 10 % FCS, 0.6 % agar) and an overlay {DMEM, 10 % FCS, 0.3 agar). 5 X 104 cells were plated in soft agar in 10 cm plates and were left at 37 °C for 6-7 weeks before being counted. 5 x 105 transfected NIH 3T3 cells were plated per 10 cm dish. Transfected NIH 3T3 cells were grown in 5 % serum for 4 weeks prior to fixing and visualizing foci. pLNCX-S and pLNCX-aS represent sense and antisense orientations of the ING1 cDNA insert, respectively.
Results of the soft agar and focus forming assa~,y~
Soft Focus agar forming assay assay Trial Number 1 2 3 4 mean 1 2 mean pLNCX 0 0 0 0 0 9 13 11 (vector) pLNCX-Ras 224 248 208 (-) 226.7 (-) (-) (-) pLNCX-aS 42 46 41 82 52.8 18 34 26 pLNCX-S (-) (-) 0 0 0 (-) (-) (-) (-) = not determined These results showed that the antisense ING1 cDNA insert caused increased cell proliferation.
Panel 1 of Figure 1B shows NMuMG cells infected with the retroviral vector pLNCX and panel 2 of Figure 1B shows cells infected with the retroviral vector pLNCX containing the antisense ING1 insert. The bar equals 1 mm. Panel 3 of Figure 1B shows NIH 3T3 cells transfected with vector alone and panel 4 of Figure 1B
shows cells transfected in parallel with pLNCX containing the antisense INGl insert.
Example 2 cDNA of ING1 and Predicted Amino Acid Seauence of p33~NC' In order to isolate the gene corresponding to the fragment showing biological effects, normal human fibroblast and HeLa cell cDNA libraries were screened with the ING1 cDNA fragment from Example 1, resulting in the isolation of 11 positive clones.
Two clones containing the largest cDNA inserts were sequenced on both strands using an Applied Biosystems automated sequencer, yielding the sequence shown in Figure 2.
In order to obtain the 5' end of the iNGl gene, 5' RACE (rapid amplification of cDNA ends) was used. Total cDNAs isolated following reverse transcription had the synthetic adaptor 5'-GTACATATTGTCGTTAGAACGCGTAATACGCCTCACTATAGGGA-3' (SEQ
ID NO: 11) ligated to them and PCR reactions using nested primers from both the adaptor and the ING1 gene were used to amplify the 5' ends of all RT-generated cDNAs. The primers used in the amplification were:
5'-CTGGATCTTCTCGTCGCC-3' (SEQ ID NO: 12) and 5'-AGTGCAGCATCGGCCGCTTC-3' (SEQ ID N0: I3) from the ING1 sequence and:
5'-GTACATATTGTCGTTAGAACGCG-3 ' (SEQ ID NO: 14) and 5'-TAATACGCCTCACTATAGGGA-3' (SEQ ID NO: 15) from the adaptor sequence.
The largest PCR products were recovered from agarose gels following electrophoresis and were subcloned and sequenced to generate the full-length sequence shown in Figure 3.
The predicted coding region of INGI begins at nucleotide 16 and ends at nucleotide 898, as shown in Figure 3, predicting a translation product of 33,350 daltons. Comparison of the sequence of p33'NC' to the available protein and nucleotide data bases showed no significant homology to any sequence encoding a known protein and very limited similarity to retinoblastoma binding protein 2 {RbBP2) [9]
and to several zinc finger transcription factors. Regions of the p33'"c' protein that show homology to different members of the p16"'TS' family of cyclin-dependent kinase inhibitors and to retinoblastoma binding protein 2 were identified using the Blast program available from the National Centre for Biological Information (address:
www.ncbi.nim.nih.gov).
F~pression of a GST-p33'N~l fusion~rotein and creation of anti-p_33 ~lvclonal antibody In order to generate polyclonal antibodies, a fragment of ING1 containing nucleotides 161-1146 of Figure 3 was subcloned into the SRI-.~~ol sites of the bacterial expression vector pGEX-4T1 (Pharmacia Biotech, Inc., Quebec, Canada) containing the glutathione-binding portion of glutathione-S-transferase (GST).
Plasmids were sequenced to verify that the correct reading frame was obtained and the constructs were electroplated into E. coli XLl-Blue. Following selection, bacterial cultures were induced to express the fusion protein by the addition of O.1mM isopropyl thio-galactopyranoside (IPTG) and fusion protein was purified by standard glutathione-Agarose column affinity chromatography. Eluted GST-p33'NC' fusion protein was dialyzed and used in immunogen in female New Zealand white rabbits. After four boosters, rabbits were bled and their serum tested for reactivity against the fusion protein. All animals showed reactivity and the bleeds showing the highest titer were chosen for subsequent use in Western blot, immunoprecipitation and immunofluorescence protocols.
Example 4 Effect of the antisense ING1 fragment on expression of p33ING~ in tissue culture cells Analysis of p33"~~' protein levels in cell samples was performed by Western blotting using anti-p33'NG' antibodies raised against the GST-p33'N~' fusion protein.
Proteins were separated by electrophoresis in 12.5 % polyacrylamide/SDS gels, and electrophoretically transferred to membranes for 1 hour. The membranes were blocked in TBS (100 mM Tris, 150 rnM NaCI) containing 10% non-fat dried milk and 0.1%
Tween-20, for 2 hours. Incubation of the membranes with p33'NC' antiserum was performed in TBS containing 5 % nonfat milk and 0.1 % Tween 20 (TBST) for 30 minutes. Horseradish peroxidase-conjugated goat anti-rabbit antibody was then applied to the filters for 1 hour in TBST. Peroxidase activity was detected using a chemiluminescence system (Amersham Canada, Oakville Ontario Canada) As shown in Figure 1C, NMuMG (lane 1} and ZR-75 (lane 2) cell lines were tested. The Western blot analysis of human and mouse cell lysates revealed a protein of 33 kD. Preincubation of antibodies with GST-p33'N~' fusion protein blocked recognition of p33"~cl in a parallel blot using lysates from the same cells (lanes 3 and 4).
To determine whether the level of p33ING~ was decreased in cells infected with viral constructs containing the antisense orientation, Iysates were prepared from control NMuMG cells and from NMuMG cells infected with antisense ING1 (pLCNX-aS) that had grown and formed colonies in semi-solid medium. A Western blot of lysates from _. ~ ,.
NMuMG cells infected with pLNCX vector (lane 5) or pLNCX vector containing antisense ING1 insert (lane 6) by the method set out above is shown in Figure 1C.
Results of the Western blot analysis showed that chronic expression of antisense construct reduced the expression of the endogenous ING 1 gene by approximately 90 %
compared to control parental cells.
Example 5 Effects of p33'NG' Overexpression Isolation of a DNA fragment that was capable of inducing foci and growth in soft agar when expressed in the antisense orientation, suggested that the cellular role of INGI might be to negatively regulate growth. To test this idea, part of the cDNA (basepairs 161 to 1143 of Figure 3) was cloned into the mammalian expression vector pBK (Stratagene, Aurora, Ontario Canada) in the sense orientation (pINGI-S).
This construct and the plasmid vector, both of which contain neomycin resistance genes and a cytomegalovirus (CMV) promoter, were transfected into human breast cancer (Hs578T) and normal flbroblast (Hs68) cells. Following growth for 3 weeks in medium containing 6418, plates were fixed and stained with Coomassie Brilliant Blue to identify surviving colonies. A large number of stable transformants were recovered from cells transfected with vector whereas very few colonies were visible in plates of cells transfected with the sense orientation of the cDNA of ING1. Figure 4A
shows the results when human Hs578T breast cancer cells (panels 1 and 2) and normal fibroblasts (panels 3 and 4) were transfected with the plasmids pBK (panels 1 and 3) or pINGl-S containing the ING1 cDNA in the sense orientation (panels 2 and 4).
In order to corroborate the results of these chronic assays, we next examined the effect of microinjecting these constructs on the ability of normal diploid fibroblasts to initiate DNA synthesis.
Hs68 cells were plated on glass coverslips, deprived of serum for 12 hours, rnicroinjected with the indicated mixture of plasmid DNA (0.1 ~,g/ml) plus nonspecific IgG (2 ,uglml) and were then incubated for 36 hours in complete medium containing BrdU. Fixed cells were identified by staining for injected IgG and for the incorporation of BrdU. Microinjection, fixation and staining were done as described previously [16].
Figure 4C shows the combined results of 5 separate experiments. Each group represents 110-200 injected cells. As shown in Figure 4B, normal Hs68 HDFs were injected with solutions containing pINGl-S plus non-specific rabbit IgG
(panels 1 and 2) or with pINGl-aS containing the ING1 cDNA in the antisense orientation plus non-specific rabbit IgG {panels 3 and 4). Injected cells were grown in the presence of BrdU
and were fixed and stained for the presence of co-injected IgG (panels 1 and 3) or incorporated BrdU (panels 2 and 4). Arrows identify injected cells. Arrows in panels 2 and 4 show that cells injected with pINGl-S failed to incorporate bromodeoxyuridine (BrdU, panel 2) over a 36 hour time course after injection, whereas those injected with pINGl-aS entered S phase (panel 4) as estimated by staining with anti-BrdU
antibodies.
Figure 4C shows the results of 5 separate experiments which indicate that injection of the pBK vector or of pINGl-aS constructs had no appreciable effect upon the ability of cells to proceed through S phase.
Similar results were obtained in larger populations of cells that were electroporated with vector, sense and antisense construct DNAs together with a construct encoding the CD20 surface marker. Such co-transfections allowed the analysis by flow cytometry of DNA content in transfected cells that were positive for CD20 staining. Hs68 cells were co-transfected with pCMV-CD20 together with pBK-p33'"~'-S or with pBK vector as a negative control. Cells were fixed and stained for CD20 expression using commercially available antibodies and with propidium iodide 48 hours after electroporation. Cell cycle distribution was determined by flow cytometry using fluorescence-activated cell sorting. The percentage of the CD20+ cells in different phases of the cell cycle is shown for two independent experiments.
Overexnression of n33INC1 arrested cells in GO/Gl pBK (vector) pBK-INGl-S
Triall 32.7 38.5 28.8 53.3 19.9 26.8 Trial2 34.5 35.9 29.6 72.8 19.7 7.5 mean 33.6 37.2 29.2 63.1 19.8 17.2 As shown in Table 2, the CD20-expressing population that was cotransfected with pINGl-S had, on average, 63.1 % of cells in GO/G1 whereas those co-transfected with vector had 33.6% of cells in GO/G1 when cells were fixed and stained 48 hours after electroporation. These results, using several independent methods, indicate that the overexpression of ING1 inhibits cell growth in both transient and chronic assays, most likely be arresting cells in the G1 phase of the cell cycle.
Examm~le 6 Alterations of INGl in cancer cell lines Since ING1 was originally isolated by subtractive hybridization between normal and transformed epithelial cDNAs, the ING1 gene and its expression in breast cancer cell lines was also examined. In Figure SA, lane 1 is MCFIOA phenotypically normal epithelial cell line from mammary gland; lane 2 is MDA-MB-468; lane 3 is ZR-75; lane 4 is BT-20; lane 5 is SK-BR-3; lane 6 is MCFT; lane 7 is Hs578T and lane 8 is (breast cancer cell lines). Figure SB shows the coomassie-blue stained gel corresponding to Figure SA. The expression of p33~NC1 in the cell lines was tested by preparing lysates of cell lines and Western blotting using anti-p33INC' antibodies by the method in Example 4. Although analysis of genomic fragments containing the gene did not reveal any structural changes in breast cell lines, results from Western blot analyses shown in Figure 5 suggest that the p33INC1 pxotein was expressed at considerably lower levels in some breast cancer cells compared to a phenotypically normal epithelial cell line. This observation of reduced expression in the absence of mutation is similar to the expression of BRCA-1 reported to occur in non-hereditary forms of breast cancer [25] .
Normal diploid control cell strains and neuroblastoma cell lines were analyzed by Western Blot analysis in a manner similar to that set forth for the breast cancer cell lines. Figure 6A illustrates the Western blotting results of IMR-5 (lane 1) SK-(lane 2); SK-N-SH (lane 3) all neuroblastoma cell lines, and W138 (lane 4) a normal diploid lung fibroblast cell line. Normal diploid fibroblast cells expressed low levels of p33'NCl while immortalized neuroblastoma cells expressed considerably higher levels and in the case of the SK-N-SH neuroblastoma line a truncated protein was observed.
To investigate the nature of the changes} responsible for truncating p33'NC' in this neuroblastoma cell line, two complementary approaches were taken.
Southern blot analysis of DNA, from neuroblastomas and from normal fibroblasts that was digested with different restriction endonucleases and probed with a ING1 nucleic acid probe, clearly indicated that p33'NC' was rearranged in the neuroblastoma cell line.
Human genomic DNAs were digested with HindIII, I~r I or P~~l, electrophoresed through a 0.7 % agarose gel, transferred to a nitrocellulose membrane and hybridized with [32P]-labelled p33'NCl cDNA. Hybridization was performed using standard procedures [17].
Lanes 1-6 show the results for neuroblastoma SK-N-SH (2, 4 and 6) and fox normal diploid W138 cells (1, 3 and 5}. Patterns such as those shown by W138 cells were also seen in other normal diploid cell strains.
To confirm that changes in the p33'NCl gene had occurred in the neuroblastoma cell line and to determine their nature by an independent method, reverse transcription polymerase chain reaction (RT-PCR) with RNA from SK-N-SH neuroblastoma cell line and from a phenotypically normal epithelial cell line (MCF-10) was performed as described [20] . Neuroblastoma cDNA was amplified with PCR primers specific for the p33 gene (direct(d) and reverse (r) primers). These are numbered and shown underlined in Figure 3 and the PCR products were compared with PCR fragments generated in parallel from control cell cDNA. Figure 6C, lanes 1 (primers ld-4r), 3 (ld-2r), 5 (2d-4r) and 7 (2d-3r) show the results for W138, and lanes 2 (ld-4r), 4 (ld-,.
2r), 6 (2d-4r) and 8 (2d-3r) show the results for the neuroblastoma cell line.
Primers were ld: GTAGCGCAGTCTGACAAGCC (nucleotides 474-494 of SEQ ID NO: 9) 2d: TGGTTCCACTTCTCGTGCGT (763-782 of SEQ ID NO: 9) 2r: ACGCACGAGAAGTGGAACCA (SEQ ID NO: 16) 3r: TTTGGATTTCTCCAGGGCTT (SEQ ID NO: 17) and 4r: TACCTGTTGTAAGCCCTCTC (SEQ ID NO: 18). M shows a 1 kb ladder molecule weight marker. All primer pairs gave similar results in both cell lines except for those using primers beyond nucleotide 858. For example, using primers 3r and 4r give no PCR product using neuroblastoma cDNA which is consistent with data indicating that a deletion or a rearrangement had occurred within the p3fNC' gene.
These experiments corroborate the idea that the 3' region of the p3fNC' gene was mutated in this neuroblastoma.
Normal diploid control cell strains and brain cancer cell lines were analyzed by RT-PCR analysis. Reverse transcription with total RNA from each of the cell lines was performed by the method set out in Example 9. The same primer pairs set forth in Example 9 were used. Figure 7 illustrates the RT-PCR results of glioblastoma (lanes GB1-GB4) astrocytoma (lanes AS1-AS3) and meningioma (MN1-MN3) as compared to a control cell line (Cl-C2). The INGl mRNA was expressed at considerably lower levels, or not expressed at all, in the glioblastomas, astrocytomas and meningiomas as compared to the normal cell line.
m le 7 Nuclear Localization of 33p 'NC' The experiments described below were performed with a rabbit polyclonal antibody (ap33) which was raised against a bacterially expressed glutathione-S-transferase (GST)-p33'NC' fusion protein and which reacted with a 33 kDa protein in human and mouse cell lysates as prepared by the method in Example 3.
In the first series of experiments, we determined the location of p3fNC' in fibrobiasts by examining the staining pattern of anti-p33 antibody in fibroblasts by indirect immunofluorescence. For indirect immunofluorescence normal human diploid fibroblasts (Hs68 cells) were grown on glass coverslips for 48 hours at 37°C to 60%
confluence. The cells were fixed in 3.7% formaldehyde, washed in 0.5% Triton X-and in 0.05 % Tween 20 for 10 minutes each at room temperature. Formaldehyde and detergents were diluted in phosphate buffered saline (PBS) pH 7.5. The cells were incubated with a 1:100 dilution of rabbit p33'NC' antiserum for 30 min, washed in PBS
with 0.05 % Tween, incubated with goat anti-rabbit IgG-biotin antibody and then with streptavidin conjugated Texas Red [16]. Samples were examined with a Zeiss Axiophot fluorescence microscope and images were photographed on Kodak TMAX 100 film.
Staining with polyclonal rabbit antibody alone was observed both in nuclear and cytoplasmic compartments. Similar results were obtained with anti-p33 antibodies which were preincubated with 5 fcg of GST protein indicating that the signal was specific for p33'NG'. When the anti-p33 serum was preincubated with 5 ~.g of GSTp33 fusion protein, nuclear staining was lost completely but cytoplasmic staining remained, indicating that the vast majority of p33'NG' staining was nuclear.
To confirm the nuclear localization of the 33 kDa protein. The pINGl-s construct of Example 5 was microinjected into normal Hs68 fibroblast cells which were fixed and stained with anti-p33-antibody 24 hours after injection. Strong staining was clearly localized to the nucleus. These results corroborate staining patterns in uninfected cells and show that p33'NG' is localized primarily, and possibly exclusively, throughout the nucleoplasm.
Exa Chromosomal Localization of the INGI Vie, ne To identify the chromosomal localization of the INGI gene, a genomic 18-kb DNA insert containing the gene was labelled with digoxygenin-dUTP and hybridized to synchronized human lymphocyte metaphase spreads.
A genomic clone of the INGl gene was isolated from a lambda FIX II placental human genomic library (Stratagene, Aurora, Ontario, Canada) with nucleotides 161 to 1143 of the ING1 sequence of Figure 3 using high stringency (65 °C 0.
1X SSC, 0.1 %
SDS) screening. The identity of the clone was confirmed by partial sequence analysis.
FISH was performed using established methods on methotrexate/thymidine synchronized, phytohemagglutinin stimulated, normal peripheral blood lymphocytes [21]. Approximately 50 metaphase spreads were examined for probe localization.
Suppression for 30 minutes with a mixture of sonicated human DNA {Sigma Diagnostics, Mississauga, Ontario, Canada) and cot! DNA (Gibco/BRL, Burlington, Ontario, Canada) was required to reduce the background. The stained slides were counterstained with DAPI and actinomycin D (for a DA-DAPI banding pattern) and were mounted in antifade medium and visualized utilizing a Zeiss Axioplan 2 microscope. Images of representative mitoses were captured using a cooled CCD
camera (Photometrics PXL 1400). Digital alignment of the images from each fluor was done after registration calibration through a triple bandpass filter (F1TCITexas RedIDAPI) to minimize registration error, utilizing commercial software (Electronic Photography v1.3, Biological Detection Inc., Pittsburgh PA).
The results clearly showed localization of the probe to chromosomal region 13q33-34. At least one specific probe signal was present in more than 90% of the mitoses examined. Approximately 80% of the cells had two chromatids of a single chromosome. Approximately, 40% showed labelling of both chromatids of both chromosomes. More than 90% of the signals were localized to a single band. In addition, cohybridization of p33INC' with a commercial 13121 alpha-satellite probe (Oncor, Gaithersberg MD) showed hybridization to the same chromosome.
The INGI gene has been localized to an area near known sites of genomic alteration in several human cancers: primary gastric cancer [22], hematologic neoplasms [23] and head and neck squamous cell carcinomas [24].
Expression levels of ING1 in ~g and senescent fibroblasts.
The normal human diploid fibroblast cell strain Hs68 (ATCC CRL#1635) and a phenotypically normal mouse epithelial cell line from mammary gland {NMuNG) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. Hs68 cells were used at 30 ("young"), 70 ("pre-aged") and 80 ("old") mean population doublings (MPDs) for expression and life span experiments. After retroviral infection, the human diploid fibroblast cells (HDFs) were repeatedly passaged in 10 cm plates, splitting at a ratio of 1:2 when confluent.
For infection of fibroblasts, the retroviral vector (pLNCX) was used. The highly efficient ecotropic (BOSC23) and amphotropic (CAKB) packaging cell lines were used [2b]. pLNCX-aS or pLNCX alone, were transfected into the BOSC23 virus-packaging cell line. Ecotropic and amphotropic packaging lines, and the retroviral vector were kindly provided by Dr. A. Gudkov (University of Illinois at Chicago). The amphotropic cells were infected by viruses from the BOSC23 supernatant. Fibroblasts were plated at 105 cells per 10 cm plate and infected with undiluted viral supernatant from amphotropic producer cells. Infection efficiencies ranged from 85 to 95 % in individual trials .
Since the activity or expression levels of several tumor suppressors increase in senescent cells, the levels of ING1 expression in low and high passage cells were checked. All experiments were performed on the Hs68 strain of primary normal human diploid fibroblasts. Senescent cells were obtained by passaging early-passage ("young") fibroblasts continuously to a point at which one population doubling required from 2 - 3 weeks to complete compared to 24 hours, on average, for young HDFs. Hs68s at MPDs exhibited characteristics typical of senescent cells, including an inability to respond to growth factors and altered morphology including increased size and decreased saturation density.
To study the level of expression of ING1 mRNA, RT-PCR using total RNA
isolated from young and old cells was performed (Figure 8A). The relative levels of ING1 transcript were compared to the internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using PCR primers specific for the p33 and GAPDH genes.
INGI and GAPDH were amplified in the same reaction tube using the "primer dropping" approach [27] which internally controls for efficiency of reverse transcription and amplification by PCR.
Reverse transcription (RT) with 1 ~,g of total RNA from young and old Hs68 cells was performed using SO U of RNasin (Pharmacia Biotech, Inc., Quebec Canada) and 200 U of MMLV reverse transcriptase for 50 min. at 42°C in 20 ~,1 reaction volumes. Two ~,1 of each RT reaction was amplified using 2 U of Taq polymerase. The two sets of primer pairs for the INGl gene and for the GAPDH gene that were used, were:
5'-GAAGCGGCGGATGCTGCACT-3' (SEQ ID NO: 19); and S'-ACGCACGAGAAGTGGAACCA-3'(SEQ ID NO: 16) for the ING1 gene and 5' CGGAGTCAACGGATTTGGTCGTAT -3'(SEQ ID NO: 20); and 5' - AGCCTTCTCCATGGTGGTGAAGAC 3' (SEQ ID NO: 21 ) for the GAPDH gene.
Thirty two PCR cycles for ING1 and twenty two PCR cycles for GAPDH were performed using standard conditions [17]. Primers for GAPDH were added to PCR
tubes at the end of the 10th cycle [27) .
The levels of ING1 mRNA were estimated by scanning densitometry to be approximately ten fold higher in senescent fibroblasts compared to young fibroblasts. In order to see if increased mRNA levels resulted in increased protein levels, Western blotting experiments were performed with a rabbit polyclonal antibody that was raised against a bacterially expressed glutathione-S-transferase (GST)-p33'NCl fusion protein and that reacted with a 33 kDa protein in human and mouse cell lysates.
Hs68 and NMuMG cells were harvested and 20 ~,g of total protein was used in each lane. Proteins were separated by electrophoresis in 12.5 %
polyacrylamide/SDS
gels, and transferred to membranes for 1 hour using an electroblotter. The membranes were blocked in TBS(100 n~IVI Tris, 150 mM NaCI} containing 10% nonfat dried milk and 0.1 % Tween-20 for 2 hours. Incubation of the membranes with p33INC~
antiserum was performed in TBS containing 5 % nonfat milk and 0.1 % Tween-20 for 1 hour and then membranes were washed with TBST solution for 30 minutes. Horseradish peroxidase-conjugated goat anti-rabbit antibody was then applied to the filters for 1 hour in TBST. Peroxidase activity was detected using ECL (Amersham Canada, Oakville, Ontario, Canada) and relative band intensities were determined by scanning densitometry.
As shown in Figure 8B, the level of p33'NC' protein increases approximately 8 fold when cells approach the end of their in vitro replicative lifespan, consistent with results obtained using RT-PCR.
Since ING1 appears to arrest cells in G1 when overexpressed and senescent cells are primarily arrested in the G1 phase of the cell cycle [28], the level of p33'NC~ protein was tested during the cell cycle..Quiescent, proliferation-competent NMuMG
cells were serum stimulated, lysates were prepared at different times after serum addition, and samples were analyzed by Western blotting with anti-p33 antibodies by the method set forth above. The level of p33INC~ was found to decrease as cells exited from G0, to increase during late G1 and to reach a maximum in S phase. This was followed by a decrease in G2 of the cell cycle (Figure 9B). CDK2 expression was used as a control for cell cycle progression and changed as reported previously (Figure 9A) [29]. Figure 9C shows the results of DNA content analysis by fluorescence-activated cell sorting (FACS) in parallel cultures indicating that cells enter S phase at 16 hours under these experimental conditions. These results indicate that ING1 is regulated following mitogen addition to quiescent cells, with expression reaching a peak during DNA
synthesis.
To determine the effects of reducing the levels of ING1 mRNA on the replicative lifespan of HDFs, cells were infected with a pLNCX-aS (the construct carrying a 182 by fragment in the antisense orientation and representing nucleotides 942 to 1,124 of the INGI cDNA (Figure 3)). This antisense fragment effectively inhibits translation of ING1 mRNA as shown previously where chronic expression of the antisense construct resulted in 90 % inhibition of the expression of the endogenous p33I'~G' protein in cells.
Amphotropic and ecotropic packaging cells that were used for infection are capable of producing retroviruses with titers higher than 10~ per ml upon transient transfection which allows delivery of the retroviral construct to HDFs with efficiencies of approximately 90 % as monitored by expression from a retroviral -p-galactosidase construct.
"Young" HDFs at 30 MPDs were "pre-aged" by continuous subculturing until reaching 70 MPDs. Hs68 cells at 70 mean population doublings (MPDs) were infected with the retroviral vector pLNCX as a control or with pLNCX-aS and were subcultured in parallel using subculturing ratios of 1:2. Infected cells were propagated an additional 10 MPDs after which 105 control pLCNX and 105 pLCNX-aS cells at 80 MPD were split into twelve 10 cm plates and cultivated for two months, with weekly refeeding using complete medium. Some of the cells infected with retrovirus alone were observed to divide once during this time, while cells containing the ING1-aS fragment continued to grow and created visible colonies.
To confirm the effect of the antisense fragment of ING1 in cells, indirect immunofluorescence with a rabbit polycional antibody that was raised against p33'NC' was performed. Senescent vector-infected fibroblasts and fibroblasts from colonies resulting from ING1-aS retrovirus infection were grown on glass coverslips for hours at 37 ° C to 60 % confluence. Then the cells were fixed in 3 .7 %
formaldehyde, washed in 0.5 % Triton X100 and in 0.05 % Tween 20 in PBS solution for 10 minutes each at room temperature. The cells were incubated with a 1:100 dilution of rabbit p331'~c' antiserum for 30 min, washed in PBS with 0.05 % Tween, incubated with goat anti-rabbit IgG-biotin antibody and then with streptavidin conjugated Texas Red.
Samples were examined with a Zeiss Axiophot fluorescence microscope and images were photographed on Kodak TMAX 400 film.
Staining with anti-p33 antibody was observed in the nuclear compartment of senescent cells containing control virus but not in cells obtained from colonies that had received antisense p33 retrovirus. These results corroborate the previous observations that p33'NG' is a nuclear protein and confirmed that the levels of p33iNC1 protein decrease in cells from colonies resulting from INGI-aS retrovirus infection.
Similar results were seen in cells from 3 individual colonies and from 20 independent senescent cells containing control retrovirus.
To estimate the efficiency with which down regulation of the ING1 gene by infection with PLCNX-aS was able to extend the proliferative lifespan of normal fibroblasts, the number of cells in each colony was counted. Results of these calculations are shown in Figure 10 in which colonies were divided into 4 groups depending upon the number of cells in the colony. Most colonies contained 100-cells, therefore if cells divided in an arithmetic progression (2,4,8...n}
this class corresponds to approximately 7 additional MPDs (2'=128}. Colonies in the largest category (220-280) correspond to 8 cell doublings (28=25b). Similar results were obtained in two separate trials and strongly indicate that down regulation of p33'NC' protein is sufficient to extend the proliferative lifespan of normal fibroblasts by approximately 10 % , as previously reported for the p53 tumor suppressor gene [30] .
Indications that ING1 may be involved in the modulation of apoptosis first came from the conspicuous presence of ING1 in regressing tail and absence from growing hindlimbs of metamorphosing Xenopus tadpoles and second, the serum deprivation-induced elevation of ING1 levels in P19 teratocarcinoma cells that correlated with the induction of apoptosis within 48-72 hours (Figure 11A; 35).
In order to establish the effect of ING1 expression on apoptosis, we infected P19 cells with sense (S), antisense (aS) and retroviral vector alone (V) and examined cell viability 72 hours after serum withdrawal.
P19 mouse teratocarcinoma cells were grown in alpha MEM medium with 10%
fetal calf serum (FCS: GIBCO/BRL, Burlington, Ontario, CANADA). For serum starvation experiments, the cells were washed twice in PBS {phosphate buffered saline;
137 mM NaCI, 2.7 mM KCI, 10.1 mM NazHP04, 1.8 mM KH2P04, pH 7.4} and serum-free alpha MEM (GIBCO/BRL) was added.
Retroviral infection of target cells was used to introduce ING1 expression constructs. Because the ING1 protein appears to block entry into S-phase of the cell cycle the use of standard drug resistance selection methods is precluded.
Retroviral infection also has a higher efficiency than standard calcium phosphate transfection procedures. The retroviral vector, pLNCX (7), containing sense {S), antisense (aS;
nucleotides 942 to 1124 of the ING1 cDNA) or vector alone were transfected into a WO 98/44102 PCTlCA98/00277 highly-efficient BOSC23 ecotropic virus-packaging cell line. The BOSC23 supernatant was then used to infect ecotropic producer cell lines. The target P19 cells were plated at 104 cells per 10 cm plate and infected with undiluted viral supernatant from ecotropic producer cells. Infection efficiency was determined to be about 60% with the P19 cells because these cells were prone to clumping.
Cell viability was assessed using a trypan blue dye exclusion assay. Cell suspensions were mixed 4:1 with 0.5% trypan blue:saline solution (GIBCO/BRL).
The cells were incubated at room temperature for 5 minutes and counted with a hemacytometer .
As shown in Figure 11B, the antisense ING1 construct conferred a moderate level of protection against death (70%o viable) compared to that conferred by a retroviral construct constitutively expressing the bcl-2 gene (84% viable). Conversely, P19 cells expressing the sense ING1 construct exhibited greater death (44% viable) than the vector only (54 % viable) or antisense bcl-2 controls {56 % viable), suggesting that ING1 confers cellular susceptibility to death induced by serum starvation. These numbers represent a minimal estimate of the effects of ING1 and bcl-2 due to the modest transfection efficiency of P19 cells as outlined above.
Since the infection efficiency was low for P19 cells, we turned to another model system of apoptosis developed in our laboratory, that of rodent fibroblasts (Rat 1 and NIH 3T3) containing a tetracycline-controlled human c-myc gene (tet-myc cells).
Because these cells form a monolayer, transfection efficiencies of greater than 90 % are obtainable.
The human c-myc gene was inserted into a plasmid containing a minimal cytomegalovirus promoter preceded by several binding sites for the tetracycline transcriptional protein (TA) (36). This construct (hTIC-myc) was stably transfected into NIH3T3 or Ratl cells previously selected for the stable expression of the TA
protein that is capable of binding to, and activating transcription of the myc gene on the hTIC-myc construct, in the absence of tetracycline. In the presence of tetracycline, the TA protein is blocked from binding and very little, if any transcription is seen from the c-myc expression construct. If tetracycline is washed from the cells, expression of the WO 98!44102 PCT/CA98100277 c-myc gene increases and expression can be regulated by altering the level of tetracycline to give up to 100 fold higher expression levels. Transformed cell lines that showed low background expression of c-myc and a high degree of inducibility were chosen for future studies.
The transformed rodent fibroblasts, either NIH 3T3- or rat 1-derived cells containing the tetracycline-controlled human c-myc gene (tet-myc cells) were maintained in high glucose Dulbecco's MEM (GIBCO/BRL) supplemented with 10 %
FCS and 2 ~,g/ml tetracycline {Sigma, St. Louis, MO) to repress premature human c-myc gene repression. Removal of tetracycline from the medium results in the rapid accumulation of human c-myc protein (Figure 12A) and subsequent apoptosis. The advantage of such a system is that control and experimental cells possess an identical genetic background and the potential for cellular adaptation to constitutive c-myc overexpression is minimized.
The tet-myc NIH3T3 or Ratl cells were plated at 104 cells per 10 cm plate and infected with undiluted viral supernatant from ecotropic BOSC23 cells described above.
Infection efficiency was determined to be greater than 90% for NIH 3T3 tet-myc cells using a retroviral ~3-galactosidase construct.
Tet-myc cells containing the retroviral constructs were seeded at a density of approximately 104 cells/cm2 on glass coverslips and grown at 37°C for 48 hours before processing as described (lb).
The cells were subsequently treated to induce c-myc expression and apoptosis.
Briefly, this involved washing out the tetracycline inhibitor, elevating c-myc expression by up to 100 fold, and then transferring cells to medium without serum where apoptosis rapidly ensued. Nuclear proteins were isolated at certain timepoints and immunoblotted.
DNA laddering was assessed using the method of Smith et al {32). Tet-myc cells were plated at equal densities as described above. At 72 hours after exposure to 0.1 %
FCS, DNA was isolated from the floating cells on a per plate basis. Equal volumes of lysate were run on a 2 % agarose gel and stained with ethidium bromide.
When c-myc was induced in the NIH 3T3 tet-myc cells by tetracycline withdrawal and the cells were then serum starved for 72 hours, they showed a viability of 65 % compared with controls where c-myc was not induced (Figure 13A).
Apoptosis was minimized in cells coexpressing the antisense INGl construct with only 5 %
of cells S dying upon serum withdrawal. Cells expressing INGI protein alone showed 70%
viability after serum starvation and apoptosis. This was magnified when both the ING1 and the c-myc gene were coexpressed (40% viability). These cells exhibited several hallmarks of apoptosis including shrinkage, loss of substrate adhesion and chromatin condensation. In addition, internucleosomal DNA fragmentation was greatly enhanced in tet-myc cells expressing p33'"~t compared to vector only, antisense ING1 or bcl-2-expressing tetmyc cells (Figure 13B).
To confirm that ING1 enhances apoptosis during serum starvation, we microinjected p33'NC' or a CMV-ING1 expression constructs into rat tet-myc fibroblasts and counted the number of remaining injected cells at various times after serum deprivation. Rat tet-myc cells were seeded on coverslips as described above and injected with about 25 p,g/ml of GST-ING1 protein or GST protein, or with 25 ~,g/ml of CMV-driven ING1 expression construct or vector alone (31}. After allowing the cells to recover for 4-6 hours, the coverslips were washed twice with PBS and the cells were serum starved. Injected cells were identified through coinjection and subsequent immunostaining of a coinjected nonspecific antibody. Because the history of each injected cell could be followed, a more dramatic effect of ING1 expression compared to the previous experimental approaches was apparent (45 % viable at 24h), with a further decrease in surviving cells when c-myc and ING1 were coexpressed (9% viable at 24h).
The results of the microinjection of the GST-INGI protein are shown in Figure 13A.
Similar results were obtained with microinjection of the CMV-ING1 construct.
These results support the data obtained with both the P19 and transformed NIH3T3 tet-myc cells and show that p33'NCl is involved in regulation of apoptosis, in a manner that is synergistic with the action of c-myc.
It therefore appears that in at least three independent cell lines, ING1 expression confers an increased susceptibility to death upon serum starvation.
Conversely, decreasing endogenous INGl levels afforded some protection against cell death.
INGI
markedly influences the outcome of c-myc-induced apoptosis and may, therefore, participate in guiding the response pathway whereby c-myc overexpression activates either apoptosis or tumorigenesis.
Modification of the above-described modes of carrying out various embodiments of this invention will be apparent to those skilled in the art following the teachings of this invention as set forth herein. The examples described above are not limiting, but are merely exemplary of this invention, the scope of which is defined by the following claims .
REFERENCES
The following references are cited in the application as numbers in brackets ([]) at the relevant portion of the application.
1. Levine, A.J., "The Tumor Suppressor Genes", Annu. Rev. Biochem.
62:623-651 (1993).
2. Hunter, T. et al., "Cyclins and Cancer II: Cyclin D and CDK Inhibitors Come of Age", J. Cell 79:573-582 (1994).
3. Gudkov, A.V. et al., "Isolation of genetic suppressor elements, inducing resistance to topoisomerase II-interactive cytotoxic drugs, from human topoisomerase II
cDNA", Natl. Acad. Sc. USA 90:3231-3235 (1993).
4. Straus, D. et al. , "Genomic subtraction for cloning DNA corresponding to deletion mutations", Proc. Natl. Acad. Sc. USA 87:1889-1893 (1990}.
5. Lisitsyn, N. et al., "Cloning the Differences Between Two Complex Genomes", Science 259:946-951 (1993).
6. Yaswen, P. et al. , "Down-regulation of a calmodulin-related gene during transformation of human mammary epithelial cells", Proc. Natl. Acad. Sc. USA
87:7360-7364 (1990).
7. Miller, A.D. et al., "Improved Retroviral Vectors for Gene Transfer and Expression", Biotechniques 7:980-986 (1989).
8. Serrano, M. et al., "A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4", Nature 366:704-707 (1993).
9. Defeo-Jones, D. , "Cloning of cDNAs for cellular proteins that bind to the retinoblastoma gene product", Nature 352:251-254 (1991).
10. Aharon, T. et al. , "Selective Destabilization of Short-Lived mRNAs with the Granulocyte-Macrophage Colony-Stimulating Factor AU-Rich 3' Noncoding Region is Mediated by a Cotranslational Mechanism", Mol. Cell. Biol. 13:1971-1980 (1993).
11. Guan, K. et al., "Growth suppression by p18, a p16'NK4/MTS1 and pl4I"K4s~MTS2_related CDK6 inhibitor, correlates with wild-type pRb function", Genes &
Dev. 8:2939-2952 (1994).
Dev. 8:2939-2952 (1994).
12. Harper, J.W. et al., "The p21 Cdk-Interacting Protein Cipl is a Potent Inhibitor of Gl Cyclin-Dependent Kinases", Cell 75:805-816 (1993}.
13. El-Deiry, W.S. et al., "WAF1, a Potential Mediator of p53 Tumor Suppression", Cel175:817-825 (1993).
14. Kamb, A. et al., "A Cell Cycle Regulator Potentially Involved in Genesis of Many Tumor Types", Science 264:436-440 (1994).
I5. Nobori, T. et al., "Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers", Nature 368:753-756 (1994).
16. Riabowol, K. et al., "The cdc2 Kinase Is a Nuclear Protein That Is Essential for Mitosis in Mammalian Cells", Cell 57:393-401 (1989).
17. Sambrook, J. et al., "Molecular Cloning" (2nd.Ed.), A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989).
18. Harlow, E. et al., "Antibodies", A Laboratory Manual, Cold Spring Harbor Laboratory (1988).
19. Yang, Y. et al., "An approach for treating the hepatobiliary disease of cystic fibrosis by somatic gene transfer" Proc. Nat'l. Acad. Sci. USA 90:4601-(1993). .
20. Atadja, P. et al., "Increased activity of p53 in senescing fibroblasts"
Proc.
Nat'l. Acad. Sci. USA 92:8348-8352 (1995).
21. . Demetrick, D.J. "Fluorescence in situ hybridization and human cell cycle genes" In the Cell Cycle - Materials and Methods M. Pagano (ed.) Springer Verlag Press, 29-45 {1995).
22. Motomura et al., "Loss of alleles at loci on chromosome 13 in human primary gastric cancers" Genomics 2, 180-184 (1988).
23. Mitelman et al. , "Report of the committee on chromosome changes in neoplasia" Cytogenet Cell Genet 55:358-386 (1990).
24. Maestro et al., "Chromosome 13q deletion mapping in head and neck squamous cell carcinomas: identification of two distinct regions of preferential loss"
Cancer Research 56:1146-1150 (1996).
25. Thompson, M.E. et al., "Decreased expression of BRCA-1 accelerates growth and is often present during sporadic breast cancer progression" Nature Genetics 9:444-450 (1995).
26. Pear, W . S . et al . , "Production of high titer helper-free retroviruses by transient transfection" Proc. Natl. Acad. Sci. 90:8392-8396 {1993).
27. along, H. et al., "Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method" Anal. Biochem. 223:251-258 (1994).
28. Schneider E.L and Fowlkes, B.J., "Measurement of a DNA content and cell volume in senescent human fibroblasts utilizing flow miltiparameter single cell analysis" Exp. Cell. Res. 98:298-302 (1976).
29. Tsai, L.H. et al., "The cdk2 kinase is required for the G1- to -S
transition in mammalian cells" Oncogene 8:1593-1602 (1993).
30. Bond, et al., "Escape from senescence in human diploid fibroblasts induced directly by mutant p53" Oncogene 9:1885-1889 (1994).
31. Graessmann and Graessmann, "Microinjection of tissue culture cells", Methods in Enzymology 101:482-492 (1983) 32. Smith et aI. , "antibodies to CD3/T-cell receptor complex induce death by apoptosis in immature T cells in thymic cultures", Nature 337:181-184 (1989) 33. Meikrantz and Schlegel "Apoptosis and the cell cycle" J. Cell. Biochem 58:160-174 (1995) 34. Lee and Bernstein "Apoptosis, cancer and the p53 tumor suppressor gene" Cancer Met Rev. 14:149-161 (1995) 35. Galli & Fratelli, "activation of apoptosis by serum deprivation in a teratocarcinoma cell line: inhibition by Lacetycarnitine", Exp. Cell Res.
204:54-60 ( 1993) 36. Gossen and Bujard, "Tight control of gene expression in mammalian cells by tetracycline-responsive promoters", Proc. of Natl Acad. Sci.
89(12):5547-5551 (1992) 37. Garkavtsev et aI. "Suppression of the novel growth inhibitor INGl promotes neoplastic transformation" Nature Gen. 14:415-420 (1996) The disclosure of the above publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if the language of each individual publication, patent and patent application were specifically and individually included herein.
I5. Nobori, T. et al., "Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers", Nature 368:753-756 (1994).
16. Riabowol, K. et al., "The cdc2 Kinase Is a Nuclear Protein That Is Essential for Mitosis in Mammalian Cells", Cell 57:393-401 (1989).
17. Sambrook, J. et al., "Molecular Cloning" (2nd.Ed.), A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989).
18. Harlow, E. et al., "Antibodies", A Laboratory Manual, Cold Spring Harbor Laboratory (1988).
19. Yang, Y. et al., "An approach for treating the hepatobiliary disease of cystic fibrosis by somatic gene transfer" Proc. Nat'l. Acad. Sci. USA 90:4601-(1993). .
20. Atadja, P. et al., "Increased activity of p53 in senescing fibroblasts"
Proc.
Nat'l. Acad. Sci. USA 92:8348-8352 (1995).
21. . Demetrick, D.J. "Fluorescence in situ hybridization and human cell cycle genes" In the Cell Cycle - Materials and Methods M. Pagano (ed.) Springer Verlag Press, 29-45 {1995).
22. Motomura et al., "Loss of alleles at loci on chromosome 13 in human primary gastric cancers" Genomics 2, 180-184 (1988).
23. Mitelman et al. , "Report of the committee on chromosome changes in neoplasia" Cytogenet Cell Genet 55:358-386 (1990).
24. Maestro et al., "Chromosome 13q deletion mapping in head and neck squamous cell carcinomas: identification of two distinct regions of preferential loss"
Cancer Research 56:1146-1150 (1996).
25. Thompson, M.E. et al., "Decreased expression of BRCA-1 accelerates growth and is often present during sporadic breast cancer progression" Nature Genetics 9:444-450 (1995).
26. Pear, W . S . et al . , "Production of high titer helper-free retroviruses by transient transfection" Proc. Natl. Acad. Sci. 90:8392-8396 {1993).
27. along, H. et al., "Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method" Anal. Biochem. 223:251-258 (1994).
28. Schneider E.L and Fowlkes, B.J., "Measurement of a DNA content and cell volume in senescent human fibroblasts utilizing flow miltiparameter single cell analysis" Exp. Cell. Res. 98:298-302 (1976).
29. Tsai, L.H. et al., "The cdk2 kinase is required for the G1- to -S
transition in mammalian cells" Oncogene 8:1593-1602 (1993).
30. Bond, et al., "Escape from senescence in human diploid fibroblasts induced directly by mutant p53" Oncogene 9:1885-1889 (1994).
31. Graessmann and Graessmann, "Microinjection of tissue culture cells", Methods in Enzymology 101:482-492 (1983) 32. Smith et aI. , "antibodies to CD3/T-cell receptor complex induce death by apoptosis in immature T cells in thymic cultures", Nature 337:181-184 (1989) 33. Meikrantz and Schlegel "Apoptosis and the cell cycle" J. Cell. Biochem 58:160-174 (1995) 34. Lee and Bernstein "Apoptosis, cancer and the p53 tumor suppressor gene" Cancer Met Rev. 14:149-161 (1995) 35. Galli & Fratelli, "activation of apoptosis by serum deprivation in a teratocarcinoma cell line: inhibition by Lacetycarnitine", Exp. Cell Res.
204:54-60 ( 1993) 36. Gossen and Bujard, "Tight control of gene expression in mammalian cells by tetracycline-responsive promoters", Proc. of Natl Acad. Sci.
89(12):5547-5551 (1992) 37. Garkavtsev et aI. "Suppression of the novel growth inhibitor INGl promotes neoplastic transformation" Nature Gen. 14:415-420 (1996) The disclosure of the above publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if the language of each individual publication, patent and patent application were specifically and individually included herein.
Claims (17)
1. A method to potentiate apoptosis in a eukaryotic cell, which method comprises:
a) selecting said eukaryotic cell; and b) increasing the p33IMG biological activity in said eukaryotic cell.
a) selecting said eukaryotic cell; and b) increasing the p33IMG biological activity in said eukaryotic cell.
2. The method of Claim 1 wherein the p33ING biological activity in said eukaryotic cell is increased by introducing into said eukaryotic cell an effective amount of a peptide comprising p33ING biological activity.
3. The method of Claim 1 wherein the p33ING biological activity in said eukaryotic cell is increased by introducing into said eukaryotic cell an effective amount of an oligonucleotide which codes for a peptide comprising p33IMG biological activity under conditions such that a peptide comprising p33ING biological activity is expressed by the cell.
4. The method of Claim 1 wherein said eukaryotic cell is a mammalian cell.
5. The method of Claim 4 wherein said mammalian cell is selected from the group consisting of normal cells and cancerous cells.
6. A method to inhibit apoptosis of a eukaryotic cell, which method comprises:
a) selecting said eukaryotic cell; and b) reducing the effective quantity of p33ING biological activity in said eukaryotic cell.
a) selecting said eukaryotic cell; and b) reducing the effective quantity of p33ING biological activity in said eukaryotic cell.
7. The method of Claim 6, wherein the effective quantity of p33ING biological activity is reduced by administering to the cell a single-stranded oligonucleotide of at least 20 nucleotides which comprises a sequence substantially identical to the complement of the cDNA sequence of Figure 3.
8. The method of Claim 6, wherein the effective quantity of p33ING biological activity is reduced by administering to the cell a double-stranded oligonucleotide which comprises a sequence substantially identical to the cDNA sequence of Figure 3 under conditions such that a nucleic acid of at least 20 nucleotides having a sequence which is substantially identical to the complement of the cDNA sequence of Figure 3 is expressed.
9. The method of Claim 6, wherein the effective quantity of p33ING biological activity is reduced by inactivating the ING1 gene in the cell.
10. A method for determining the apoptotic characteristic of a eukaryotic cell which method comprises:
(a) selecting said cell; and (b) determining the level of expression of native p33ING1 in said cell and comparing it to the level of expression of native p33ING1 in a non-apoptotic cell wherein an increased level of p33ING1 expression in the cell denotes a cell having the potential to be apoptotic.
(a) selecting said cell; and (b) determining the level of expression of native p33ING1 in said cell and comparing it to the level of expression of native p33ING1 in a non-apoptotic cell wherein an increased level of p33ING1 expression in the cell denotes a cell having the potential to be apoptotic.
11. The method of Claim 10 wherein step (b) further comprises exposing the cell to detectably labelled anti-ING1 antibodies to determine the level of expression of p33ING1 in the cells.
12. The method of Claim 10 wherein step (b) further comprises exposing the cell to a detectably labelled single-stranded oligonucleotide of at least 100 nucleotides which comprises a sequence substantially identical to the complement of the cDNA
sequence of Figure 3 under conditions such that the oligonucleotide will bind to any ING1 mRNA present in the cell to determine the level of expression of mRNA
ING1 in the cells.
sequence of Figure 3 under conditions such that the oligonucleotide will bind to any ING1 mRNA present in the cell to determine the level of expression of mRNA
ING1 in the cells.
13. The method of Claim 10 wherein step (b) further comprises exposing the cell to two single-stranded oligonucleotides from 15 to 25 nucleotides in length, wherein the first oligonucleotide binds to one region of the ING1 mRNA and the second oligonucleotide binds to a sequence complementary to another region of the ING1 mRNA under conditions wherein polymerase chain reaction can occur and any ING1 mRNA in the cell will be amplified and labelled.
14. The method of Claim 11 further comprising:
(a) attaching the cells to a solid support;
(b) conducting immunohistochemistry with a detectably labelled anti-p33'NC~
antibody.
(a) attaching the cells to a solid support;
(b) conducting immunohistochemistry with a detectably labelled anti-p33'NC~
antibody.
15. The method of Claim 14, wherein the anti-p33ING1 antibody is directly detectably labelled.
16. An assay for determining the level of p33ING1 activity in a eukaryotic cell, which assay comprises:
a) selecting the eukaryotic cell;
b) determining the p33ING1 biological activity in the cell; and c) correlating the biological activity against a curve of the p33ING1 biological activity in certain cell types.
a) selecting the eukaryotic cell;
b) determining the p33ING1 biological activity in the cell; and c) correlating the biological activity against a curve of the p33ING1 biological activity in certain cell types.
17. An isolated eukaryotic cell substantially free of p33ING1 biological activity.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US82815897A | 1997-03-27 | 1997-03-27 | |
US08/828,158 | 1997-03-27 | ||
PCT/CA1998/000277 WO1998044102A2 (en) | 1997-03-27 | 1998-03-26 | Methods of modulating p33ing1 mediated apoptosis |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2284730A1 true CA2284730A1 (en) | 1998-10-08 |
Family
ID=25251055
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002284730A Abandoned CA2284730A1 (en) | 1997-03-27 | 1998-03-26 | Methods of modulating p33ing1 mediated apoptosis |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0970210A1 (en) |
AU (1) | AU6715298A (en) |
CA (1) | CA2284730A1 (en) |
WO (1) | WO1998044102A2 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6737232B1 (en) * | 1999-11-17 | 2004-05-18 | Rigel Pharmaceuticals, Inc. | IAPs associated cell cycle proteins, compositions and methods of use |
CA2439155A1 (en) * | 2001-02-27 | 2002-09-06 | Fangcheng Gong | Isolated human tumor supressor proteins, nucleic acid molecules encoding these human tumor supressor proteins, and uses thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6117633A (en) * | 1995-12-08 | 2000-09-12 | University Technologies International Inc. | DNA sequence encoding the tumor suppressor gene ING1 |
-
1998
- 1998-03-26 WO PCT/CA1998/000277 patent/WO1998044102A2/en not_active Application Discontinuation
- 1998-03-26 EP EP98912175A patent/EP0970210A1/en not_active Withdrawn
- 1998-03-26 CA CA002284730A patent/CA2284730A1/en not_active Abandoned
- 1998-03-26 AU AU67152/98A patent/AU6715298A/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
WO1998044102A2 (en) | 1998-10-08 |
WO1998044102A3 (en) | 1999-01-14 |
EP0970210A1 (en) | 2000-01-12 |
AU6715298A (en) | 1998-10-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP4381476B2 (en) | Amplification of the human MDM2 gene in human tumors | |
Gunster et al. | Identification and characterization of interactions between the vertebrate polycomb-group protein BMI1 and human homologs of polyhomeotic | |
JP3633616B2 (en) | Transcription factor DP-1 | |
US6468985B1 (en) | Retinoblastoma protein-interacting zinc finger proteins | |
US6238918B1 (en) | DNA sequence encoding the tumor suppressor gene ING1 | |
JP4489012B2 (en) | Senescent cell-derived DNA synthesis inhibitor | |
US6420136B1 (en) | Method of modulating p53 activity | |
US5658784A (en) | Nucleic acid encoding transcription factor p300 and uses of p300 | |
WO1998003652A2 (en) | P300/cbp-associated transcriptional co-factor p/caf and uses thereof | |
WO1998003652A9 (en) | P300/cbp-associated transcriptional co-factor p/caf and uses thereof | |
US5726018A (en) | Nucleic acid based assays to detect a novel mammalian protein associated with uncontrolled cell division | |
US6410238B1 (en) | Box-dependent Myc-interacting protein (Bin1) compositions and uses thereof | |
US6323335B1 (en) | Retinoblastoma protein-interacting zinc finger proteins | |
CA2284730A1 (en) | Methods of modulating p33ing1 mediated apoptosis | |
JP2003523732A (en) | Binding of multi-zinc finger transcription factor to nucleic acid | |
US6143522A (en) | Methods of modulating apoptosis | |
EP0792359B1 (en) | Transcription factor e2f-4 | |
US6747133B1 (en) | Antibodies against the tumor suppressor gene ING1 | |
US5965398A (en) | DNA sequence encoding a tumor suppressor gene | |
JP2002503466A (en) | Retinoblastoma protein complex and retinoblastoma interacting protein | |
JPH0881500A (en) | P53as protein and its antibody | |
US20040006210A1 (en) | Human polyhomeotic 2 (hph2) acts as an oncogene | |
Atadja | Garkavtsev et al. | |
US7160677B1 (en) | Transcription factor DP-1 | |
AU2003231196A1 (en) | Androgen-regulated PMEPA1 and cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FZDE | Discontinued |