CA2280700A1 - Expression of active human factor ix in mammary tissue of transgenic animals - Google Patents

Abstract

Recombinant Factor IX characterized by a high percentage of active protein can be obtained in the milk of transgenic animals that incorporate chimeric DNA molecules according to the present invention. Transgenic animals of the present invention are produced by introducing into developing embryos DNA that encodes Factor IX, such that the foreign DNA is stably incorporated in the DNA of germ line cells of the mature animal. Particularly efficient expression was accomplished using a chimeric construct comprising a mammary gland specific promoter, Factor IX cDNA that lacked the complete or any portion of the 5'untranslated and 3'-untranslated region, which is substituted with a 5'- and 3'- end of the mouse whey acidic protein gene. In vitro cell cultures of cells explanted from the transgenic mammal of the invention and methods of producing Factor IX from such said culture and methods of treating hemophilia B are also described.

Description

EXPRESSION OF ACTIVE HUMAN FACTOR IX
IN HIAM~2AR~' TISSUE OF TRANSGENIC ANIMAhS
BAC~CGROUND OF THE INVENTION
1. FiE:ld of the Invention The pre~~ent invention relates to the production of natural and modified forms of Factor IX. In particular, the inventic>n relates to a transgenic animal containing, stably incorporated in its genomic DNA, an exogenous Factor IX gE:ne that is expressed specifically in mammary tissue, such that Factor IX is secreted into milk produced by the animal. In particular, the invention relates to t:he production of human Factor IX in the milk of a transgenic non-human mammal using a DNA molecule that comprises a whey acidic protein promoter gene, 5' regulatory sequences containing the promoter, human Factor IX c:DNA that lacks at least a portion of the complete or any portion of or the complete the 3'-untranslated region of the native human Factor IX gene, but contains the 5' and 3-'untranslated region of the mouse whey acidic protein. gene.

2. Background Human Factor IX, or "Christmas factor," is encoded by a singlE:-copy gene residing on the X-chromosome at q27.1. For a review of Factor IX gene structure and expression, see High et al., "Factor IX," in MOLECULAR
BASIS OF THROMBOSIS AND HEMOSTASIS, High (ed.), pages 215-237 (Dekker 1995); Kurachi et al., Thromh. Haemost.
73:333 (19'.x5). The Factor IX gene is at least 34 kilobase (kb) pairs in size, and it is composed of eight exons. The rr,ajor transcription start site of the Factor IX gene in human 1~_ver is located at about nucleotide -176. The hurnan Facaor IX mRNA is composed of 205 bases for the 5' untransl,~ted region, 1383 bases for the prepro Factor IX, ,~ stop codon and 1392 bases for the 3' untranslated region.

Factor I:C is synthesized as a prepropolypetide chain composed of three domains: a signal peptide of 29 amino acids, a propeptide: of 17 amino acids, which is required for y-carboxylation of glutamic acid residues, and a mature Factoz~ IX protein of 415 amino acid residues . The Factor IX ;,ymogen undergoes three types of post-translationa:l modifications before it is secreted into the blood: a vitamin K-dependent conversion of glutamic acid residues to carboxyglutamic acids, addition of hydrocarbon chains, and ~i-hydroxylation of an aspartic acid. Mature Factor IX protein contains 12 'y-carboxylated glutamic acid (Gla) residues. Due to the requirement of vitamin K by 'y-carboxylase, Factor IX is one of several vitamin K-dependent blood coagulation factors.

The activation of Factor IX is achieved by a two-step removal of the activation peptide (Ala'46-Arg'8) from the molecule. I3ajaj et al., "Human factor IX and factor IXa," in MF'sTHODS IN ENZYMOLOGY (1993). The first cleavage is made at: the Arg'45-A1a'46 site by either Factor XIa or Factor VIIa/tissue factor. The second, and rate limiting cleavage :is made at Arg'g-Val'8' . The activation pathways in~rolvinc~ Factor XIa and Factor VIIa/tissue factor are both calcium-dependent. However, the Factor VIIa/tissue factor pathway requires tissue factor that is released from damaged endothelial cells. Activated human Factor IX thus exists as a disulfide linked heterodimer of the heavy chain and light chain. For full biological activity, human Factor IX must also have the propeptide removed and must be fully y-carboxylated. Kurachi et al., Blood C'oagula.tion and Fibrinolysis 4:953 (1993).

Factor 7:X is the precursor of a serine protease required for blood clotting by the intrinsic clotting pathway. Defects in Factor IX synthesis result in hemophilia B (or Christmas disease) , an X-linked disorder that occurs _Ln about one in 30,000 males. Patients with hemophilia B are treated with Factor IX obtained from pooled plasma from. normal individuals. Martinowitz et al., Acta Haematol 9g(Suppl. 1):35 (1995). Such Factor IX preparations, however, may be pyrogenic and may be contaminated with pathogenic agents or viruses.

Accordingly, it world be advantageous to develop a means to prepare purified Factor IX that did not require extraction from human plasma.

In the p,~st, therapeutic proteins have been produced in E. coli. However, limitations in secretion and post-translational modification which occur in all living cells has rendered recombinant protein production a highly species, ti:asue and cell specific phenomena. In an example of recombinant FIX expression in mammalian cells, the populat:Lons of recombinant FIX produced in baby hamster kidney cel:Ls are not the same protein products as FIX produced in Chinese hamster ovary cells (Busby et al., Nature 316:684-686 (1985); Kaufman et al., J. Biol. Cheam. 26~_: 9622-9628 (1986) ) . These proteins have profound differences in 'y-carboxylation and propeptide removal and these differences have been established as being very important in determining biological activity. Most importantly, only less than about 40 milliunits/hr/ml of active rFIX were detected in CHO cells even after coexpression of the propeptide cleaving enzyme PACE, coexpression of the carboxy:Lase enzyme, and extensive gene amplification with methotrexate in an attempt to increase expression level and activity (Wasley et al. J. Biol.

Chem. 268: 8458-8465 (1993); Rehemtulla et al., Proc.

Natl. Acad. Sci. (USA), 90: 4611-4615 (1993)).

Researchers concluded that multiple limitations in the secretion of: active rFIX exist in mammalian cells (Rehemvulla et al . , 1993 ) and that the problem of gene transcription was secondary and indeed trivial with respect to post-translational processing of biologically active rFIX in mammalian cells. Thus, FIX mRNA

splicing is a species specific effect occurring in mice and perhaps sheep, but not pigs. Although one might hypothesize ~~hat a FIX could be expressed, one could not predict with any certainty whether such product would be a clinically acceptable, practical, recombinant therapeutic FIX product for a given hemophiliac indication.

Production of recombinant Factor IX in mammalian cell culture (HepG2, mouse fibroblast, mouse hepatoma, rat hepatoma, BH::C, CHO cells) repeatedly has been shown to be recalcitrant and cell-system specific with respect to intracellular restrictions on secretion and proteolytic processing, post-translational modification, expression levels, bio7_ogica7. activity, downstream recovery from production media, and substantiation of circulation half-life (E3usby ~st al., (1985) ; de la Salle et al.

Nature 316: 268-2'70 (1985) ; Anson et al., Nature 315:

684-686 (1985); Rehemtulla et al., 1993; Wasley, et al., (1993); Kaufman et al., (1986); Jallat et al., EMBO J.
9:

3295-3301 (1990)). Importantly, the aforementioned works concluded that nontrivial improvements in these combined criteria ar~ needed if a practical prophylactic FIX

therapeutic product is to be made available from any recombinant mammalian cell production source. For example, attempts to increase the specific activity of rFIX produced by CHO cells by rectifying problems with under-carbo~:ylation by co-expression of the vitamin K-dependent carboxylase enzyme resulted in no improvement in 'y-carboxylation or biological activity (Rehemtulla et al., (1993), implying that multiple rate limitations in this post- t:ranslational modification exist.

Similar difficulties in the production of significant amounts of biologically active rFIX in the mammary epithelial cells of_ transgenic animals also has been documented in the 7_iterature. Although WO-A-90/05188 and WO-A-91-0821.6 predict that production of rFIX should be possible ir.. their production systems, no data are presented in WO-A-91-08216, and only very low levels of secreted rFIX (25 ng/ml) with no biological activity were reported in transgenic sheep in WO-A 90/05188 and in related pub:licatic~ns (Clark et al., Bio/Technology 7:

487-4992 (1989)). Higher expression levels have recently been reported in t:he milk of sheep (5~.g/ml), but again, the product had no biological activity (Colman, IBC Third Internation~il S~.~nposium on Exploiting Transgenic Technology for Commercial Development, San Diego, CA.

(1995)). This demonstrates that the polypeptides produced in WO-A~-90/05188, Clark et al. (1989), and Colman (1995) were: a different species than native human FIX with dissimilar biological activity to human FIX, and could never be used for therapeutic purposes. Work by Clark et al. (199:?) stated that problems in synthesi:~ of r~?IX in the mammary gland of transgenic mice was the: result of aberrant splicing of the rFIX mRNA

in the 3' untranslated region. Correction of the aberrant :>plicing in transgenic mice has been demonstrated (Yul7_ et a1. Proc. Natl. Acad. Sci. USA 92:

10899-10903 (1995); Clark, et al. (1989), WO 95/30000)), resulting in higher expression levels (up to 61 ~.g/ml) with about 9:0% biological active material. However, this aberrant splicing phenomenon appears to be species- and tissue-specific in the mouse mammary gland; other reports with the 3' UTR sequences in CHO cell lines and in the.

liver of transgeni.c mice specifically show no evidence of aberrant sp=Licing (Kaufman et al., (1986); Jallat et al., (1990)). In addition, no evidence was reported for aberrant mR~lA splicing of FIX transcripts with 3' UTR sequences in a human hepatoma cell line (de la Salle et al., (1985)), a mouse fibroblast cell line (de la Salle et al., (1985)), a rat hepatoma cell line (Anson et al., 1985)), or a BHK cell line (Busby et al., (1985)). I~To data are presented to justify the prediction that th;e altered transgene of W095/30000 ~Nill necessarily improve the secretion and biological activity of rFIX in the milk of transgenic livestock or any other cell line. Therefore the claims presented in w0 95/30000 are purely speculative and are limited to the mammary gland of transgenic mice.

The stability of the rFIX product in the milk of transgenic livestock during upstream and downstream processing is a critical issue for the production of a practical trierapeutic. Data presented in Clark et al.

(1989) showed that Clark's method of downstream recovery of what little rF2X was in the milk of their transgenic sheep was not reproducible: in one of the preparations, a signific~~nt ae:nount of rFIX was proteolytically activated. The infusion of activated FIX (FIXa) into a patient is fatal (Kingdon et al., Thrombosis, Diathes.

Haemorrh. (Stuttc~. ) 33: 617 (1975) ) . FIX can be activated by FXI and/or FVIIa/Tissue factor complex in the presence of calcium and phospholipids (Kurachi et al., Hlood Coagulation and Fibrinolysis 4: 953-974 (1993)). Milk is a medium containing calcium and phospholipic3 surfaces. In addition, there is extensively conserved homology between mammalian blood coagulation factors, especially between porcine FXI and human FXI

(Mashiko anal Takahashi, 8iol. Chem. Hoppe-Seyler 375:

481-484 (1994)). Detectable levels of porcine FVII(a).

and FXI(a) in the milk of nontransgenic pigs, and elevated levels of FVII (a) and FXI (a) in the milk of a pig with mastitic: milk have been measured. Thus, one could predict that the recovery of a useful unactivated rFIX produced in the milk of transgenic livestock will be very sensitive to the health of the mammary gland (i.e., no subclinical or clinical mastitis), to the milking procedure (i.e., no tissue damage), to pretreatment of the milk immediately after collection, to storage of the milk before processing, and to the purification and formulation process itself. One would also predict that the undesirable ir.~ vivo activation of rFIX also can be minimized by the coexpression of inhibitors to FVIIa/TF

such as the Tis~~~ue Factor Pathway Inhibitor (TFPI) protein, also called LACI, or the hybrid protein FX-LACI

which is alao a known inhibitor to FVIIa/TF. Although specific inhibitors of FXIa have not been identified, a similar approach can be made for neutralizing FXIa activation by coexpression of analogues of polypeptide substrates of FXIa similar to those that are commercially available for amidolytic assays. Yet another strategy may be to overexpress rFIX at very high levels (> 1 g/1 milk) such that the FIX activating enzyme is extremely limiting. Otherwise, steps must be taken immediately after milk collection to minimize activation. These include, but. are not limited to, chelation of calcium (e. g., addition of EDTA), phospholipid removal, adjustment of p1:3, storage in ultra-low freezers, controlled thawing procedures, addition of protease inhibitors, and ~~urification procedures that maintain minimal activation conduciveness. It activated rFIX

still persi:~ts in the purified product, removal can be facilitated by lectin chromatography(N-linked carbohydrate moieties exist only in the activation peptide), i.mmunoaffinity chromatography using a Mab directed to the activation peptide, or by metal ion induced prec:ipitat:ion techniques that can select for the differences in me>lecular stability of unactivated vs.

activated F7:X. Because of these inherent difficulties in production of active FIX at sufficiently high levels in mammalian cells and transgenic livestock, gene therapy has been cited ~~s perhaps a more practical way of achieving a prophylactic therapeutic rather than recombinant technology (Kurachi et al., (1993); Kay et al., Proc. Natl. Acad. Sci. USA 91: 2353-2357 (1994));

Fallaux et ~~1. , Thromb-Haemost. 74: 266-73 (1995) ) .
This is certainly a profound reality because it specifically _g_ teaches a product suitable for FIX prophylaxis has not yet been found using recombinant production in mammalian cells, even those that have been shown to express active FIX, albeit ~~t low levels. The best recombinant FIX cell production system made from CHO cells is produced at low secretion levels Rehemtulla et al., (1993)) and is in fact not sui'~~able f:or prophylaxis. Furthermore, the data have shown that the homologous plasma proteins FIX and protein C all have very different, cell-specific restriction; on post- translational processing, proteolytic processing, and secretion which preclude on a protein- specific basis the predictability of high expression level;, biological activity, downstream recovery from ~~roduction media, and predictable circulation half-life (Grinnell et al., "Native and Modified recombinant human protein C: function, secretion, and gostranslational modifications," In Protein C a.nd Related Anticoagulants, eds. D.F. Bruley and Drohan 29-63, Gulf Publishing Co., Houston, TX.

(1990); Yan et al., Trends in Biochem. Sci. (1989); Busby et al. , (19135) ) .

Therefore, a need still exists for a means to obtain significant amounts of purified Factor IX from a source other than human plasma. A need also exists for a practical means for producing in mammalian cells rFIX, which is suitable as a treatment for hemophilia B.

Accordingly, it is an object of the present invention to provide a method for producing a transgenic animal that secretes biologically human active Factor IX into its milk.
It is a. further object of this invention to provide a transgenic animal that produces at least 100 ~g of human Factor IX per milliliter of milk.
These and other objects are achieved, in accordance with one embodiment of the present invention by the -g-provision oi= a tra.nsgenic non-human mammal containing an exogenous D1JA molecule stably integrated in its genome.

A non-human transgenic mammal containing an exogenous DNA

molecule stably integrated in its genome, wherein said exogenous DIVA mole=_cule comprises (a) 5' regulatory sequences of a mammary gland-specific gene including a promoter;

(b) a Factor IX-encoding DNA sequence that encodes a signal sequence, a Factor IX pro-sequence and a Factor' IX sequence in a 5'to 3' direction, wherein said signal sequence is effective in directing the secretion of said Factor IX into the milk of said transgenic mammal and wherein said Factor IX sequence lacks at least a potion of the complete or the complete 5'-un.translated and 3' -untranslated regions of the Factor IX gene.; and (c) 3' regu7.atory sequences from a mammary gland-specific. gene or 3' regulatory sequences active in a mammary gland;

wherein said 5' and said 3' regulatory sequences are operatively linked to said Factor IX-encoding DNA

sequence.

Mammar~~ gland-specific promoters that are useful in the present invention are selected from the group consisting of short whey acidic protein (WAP) promoter, long WAP promoter, short a-casein promoter, short ~3-casein promoter, short kappa-casein promoter, long a-casein promoter, long ~i-casein promoter, long kappa-casein promoter, a-lactalbumin promoter and (3-lactoglobul.in promoter.

Non-human transgenic mammals which are contemplated by the present invention are selected from the group consisting of mice, rats, rabbits, pigs, sheep, goats and cows.
It is a further object to provide a process for producing Factor IX by providing a non-human transgenic mammal havin!~ intec3rated into its genome an exogenous DNA
molecule, wherein ;paid exogenous DNA molecule comprises:
(a) prc>vidinc~ a non-human transgenic mammal having int:egrate:d into its genome an exogenous DNA
molecule, wherein said exogenous DNA molecule comprises: (1) 5' regulatory sequences of a mammary gland-specific gene including a promoter; (2) a Factor IX-encoding DNA sequence that enc~ades a signal sequence, a Factor IX
pro-sequence and a Factor IX sequence in a 5'to 3' direci~ion, wherein said signal sequence is efi_ectivE~ in directing the secretion of said Factor IX into the milk of said transgenic mammal and wherein said Factor IX sequence lacks at least a portion of the complete or the complete 5'-untranslated and 3'-untranslated rec3ions of the Factor IX gene . ; and ( 3 ) 3 ' rec~ulato~_y sequences from a mammary gland-spcscific gene or 3' regulatory sequences active in a mammary gland; wherein said 5' and said 3' rec3ulato:ry sequences are operatively linked to said Factor IX-encoding DNA sequence;
(b) allowing said DNA sequences encoding said Factor I:~ to be expressed and said Factor IX to be secreted into the milk of said transgenic mammal;
(c) collecting said milk from said mammal; and (d) isolating said Factor IX from said milk.
It is a further object to provide a method of.
treating hemophilia B using the Factor IX produced by the transgenic mammal, described above. Treating involves administration of the Factor IX of the invention and a pharmaceutically acceptable carrier to a hemophilia B
patient.
It is a further object of the invention to provide an in vitro culture of mammary gland cells that produce Factor IX. Another object of the invention is to provide a method of treating hemophilia B by implanting such w Factor IX mammary gland cells into a patient.

Figures lA-1D schematically depict the construction of a chimeric Factor IX construct. Specifically, Figure lA shows they construction of pWAP4. Figure 1B shows the production of pUCFIX. Figure 1C shows the introduction of human F:CX cDNA into pWAP4. Figure 1D shows the production of pUCWAPFIX. FIX cDNA was modified by PCR in order to ir..troduc~e KpnI sites on the 3' and 5' ends.
Using FIX cDNA as a template, PCR primers humFIXS'KpnI
and humFIX3'KpnI, as shown in Table 1, below, were used to produce FIX ~~DNA with KpnI sites on both ends.
Modified cDTJA may be easily into a "cassette vector" for construct in<3 a ch:imeric gene .
Figure 2 shows the detection of recombinant Factor IX in trans~~enic ~~ig milk using western blot analysis.
Figures 3A-3C: show the production of the pUCWAP6 "cassette vector." Specifically, Figure 3A shows the production of pUCNotI. Figure 3B shows the production of of pUCWAP5 and the production of a fragment that contains the pUCNotI vector sequence flanked by mWAP3'UTR. Figure 3C shows the production of pUCWAP6.
Figure 4 shows the production of plasmid pUCWAP&FIX.
DETAILED DESCRIPTION
1. Overview As di~~cussed above, a method for producing significant quantities of Factor IX in transgenic animals has been elusive. Yull et al., Proc. Nat'1 Acad. Sci.
USA 92:10899 (1995), showed that correction of a cryptic RNA splice site increases the amount of Factor IX
synthesized. by transgenic animals. In these studies, one transgenic mouse line produced about 27 ~,g of biologically act_we Factor IX per milliliter of milk, although, Factor IX..levels of individual mice of the line *rB

varied. Yu:Ll et a1. speculated that the variation was probably due' to epigenetic instability.
In contrast, the studies presented herein show that transgenic pigs c~~n synthesize and secrete high levels (100-200 ~.g/ml mi7_k) of biologically active recombinant human Factor IX in milk. Based on reduced and nonreduced SDS PAGE, the majority of the recombinant human Factor IX
population appears to be a single chain polypeptide having a post-translationally modified structure similar to human Factor :~X. The recombinant human Factor IX
secreted into pig milk is biologically active and is able to initiate clotting in Factor IX-deficient human plasma.
This is the first reported production of high levels of fully active, sufficiently 'y-carboxylated, recombinant human Facto~_ IX in the milk of transgenic livestock.
2. Methods for Producing Transgenic Animals Notwithstanding past failures to express recombinant human Factor IX with suitably high activity in several different expression systems, the present invention provides methods for obtaining recombinant Factor IX
characterized by a high percentage of active protein from the milk of transa~enic animals. As used herein, the term "animal" denotes all mammalian animals except humans. It also includes an individual animal in all stages of development, including embryonic and fetal stages. A
"transgenic" animal is any animal with cells that contain genetic inf~~rmation received, directly or indirectly, by deliberate <~enetic manipulation at the subcellular level,.
such as by microinjection or infection with recombinant virus.
The genetic information to be introduced into the animal is preferably foreign to the species of animal to which the recipient belongs (i.e., "heterologous"), but the information may also be foreign only to the particular individual recipient, or genetic information already po~;sessecl by the recipient. In the last case, the introdu<:ed gene may be differently expressed than is the natural:Ly occurring, or "native," gene.

The language "germ cell line transgenic animal"

refers to a transgenic animal in which foreign DNA has been incorporated into a germ line cell, therefore conferring the ability to transfer the information to offspring. If su~~h offspring, in fact, possess some or all of that information, then they, too, are transgenic animals.

The tra.nsgenic animals of this invention are other than human, including, but not limited to farm animals (pigs, goat:, sheep, cows, horses, rabbits and the like) , rodents (such as mice), and domestic pets (for example, cats and dogs). Livestock animals such as pigs, sheep, goats and cows, are particularly preferred.

Preferably, a transgenic animal of the present invention is produced by introducing into single cell embryos appropriate polynucleotides that encode human Factor IX, or frac3ments or modified products thereof, in a manner such that these polynucleotides are stably integrated into t:he DNA of germ line cells of the mature animal, and are inherited in normal Mendelian fashion.

In accordance: with the invention, DNA molecules can be introduced into embryos by a variety of means to produce transgenic animals. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or by other means.

The transformed cells can then be introduced into embryos and incorporated therein to form transgenic animals. In a preferred method, developing embryos can be infected with retro~riral vectors and transgenic animals can be formed from the infected embryos. In the most preferred method, however, the DNA molecules of the invention are injected into embryos, preferably at the single-cell stage, which a:re allowed to develop into mature transgenic animals. However, the present invention is not limited. to this .preferred method but other methods of *rB

making tran;~genic animals can be used as described, for example, in Transqenic Animal Generation and Use by L.M.

Houdebine, Harwood Academic Press, 1997. Transgenic animals als~~ can be generated using methods of nuclear transfer or cloning using embryonic or adult cell lines as described for example in Campbell et al., Nature 380:

64-66 (1996) and Wilmut et al., Nature 385: 810-813 (1997). F~urthez~ a technique utilizing cytoplasmic injection o:E DNA c:an be used as described in U.S. Patent No. 5,523,222.

Factor IX-producing transgenic animals can be obtained by introducing a chimeric construct comprising Factor IX-encoding sequences. An alternative method of producing t:ransgenic animals is to introduce a Factor IX

chimeric construct with a second construct that may provide higher expression more frequently than that observed with the use of Factor IX constructs alone. As described herein, such doubly-transgenic, or "bigenic,"

animals have native WAP genomic sequences that are injected a~> separate constructs to be concatenated in vivo as addition:al flanking sequences to the target Factor IX cDNA construct.

Methoda for obtaining transgenic animals are well-known. See, for a=_xample, Hogan et al., MANIPULATING THE

MOUSE EMBRYO, (Cold Spring Harbor Press 1986);

Krimpenfort. et al., Bio/Technology 9:88 (1991); Palmiter et al., Cell 41:343 (1985); Kraemer et al., GENETIC

MANIPULATIC>N OF THE EARLY MAMMALIAN EMBRYO, (Cold Spring Harbor Lab~~ratory Press 1985); Hammer et al., Nature 315:680 (1985) ; W~~gner et al. , U. S. Patent No. 5, 175, 385;

Krimpenfort: et a.i: . , U. S . Patent No . 5 , 175 , 384 , Janne et al., Ann. l~Ied. 24:273 (1992), Brem et al., Chim. Oggi.

11:21 (1993), Clerk et al., U.S. Patent No. 5,476,995, hereby incorporated by reference.

3. Constriction of Chimeric Genes Suitable Factor IX-encoding DNA used for producing transgenic animals. can be obtained using human liver tissue as a :source for cloning the human Factor IX gene.

The DNA coding fo:r Factor IX can be fused, in proper reading frame, with appropriate regulatory signals, as described in greater detail below, to produce a chimeric construct which i.s then amplified, for example, by propagation in ~~ bacterial vector, according to conventional practice.

The amplified construct is thereafter excised from the vector and purified for use in microinjection. The purification is preferably accomplished by means of high performance liquid chromatography (HPLC), which removes contamination of the bacterial vector and from polysaccharides typically present when other techniques, such as conventional agarose elect roelution, are used.

The preferred HPLC' method entails sorbing the construct onto an anion-exchange HPLC support and selectively eluting the construct from the support, preferably with an aqueous sodium chloride solution, thereby to eliminate contaminaticm from the vector. Elution also may be effected by other means, such as a pH gradient.

Alternat:ively,, the excised construct can be purified by ultracentrifugation through an aqueous sucrose or sodium chloride gradient, gel electroelution followed by agarose treatment and ethanol precipitation, or low pressure chromatography.

Since it is preferable that the construct have the minimum amount of impurities, more than one cycle of HPLC

or other purification is advantageous. In particular, the use of HPLC--purified DNA for microinjection, as described above, allows for remarkably high transformation frequencies, on the order of 20% or more, for example, in mace and pigs.

DNA constructs useful in the present invention provide a L>NA secxuence encoding Factor IX, preferably human Factor IX, operably linked to all the cis-acting signals necessary for mammary tissue specific expression of Factor TX, post-translational modification of Factor IX, secretion o:E . Factor TX into milk, and full biological activity of Factor IX. Although the present invention preferably entails the use of DNA constructs that produce the desired or native human Factor IX per se, the desired protein also may be produced as a fusion protein containing another protein. For example, the desired recombinant protein of this invention may be produced as part of: a larger recombinant protein in order to stabilize the desired protein or to make its purification from milk faster and easier. The fusion partners then are ;separated chemically or enzymatically, and the desired protein isolated.

Methods for obtaining human Factor IX-encoding DNA

molecules and nucleotide sequences of human Factor IX

gene and cDtJA are provided, for example, by Kurachi et al., Proc. PTat'1 Acad. Sci. USA 79:6461 (1982) , Choo et al., Nature 299:178 (1982), Anson et al., EMBO J. 3:1053 (1984), Brownlee et al., international publication No. WO

84/00560, Yull et al., Proc. Nat'1 Acad. Sci. USA 92:

10899 (1995), Clark, international publication No. WO

95/30000, and Meulien, U.S. Patent No. 5,521,070 (1996).

Human Factor IX probes also can be obtained from the American Ty~~e Culture Collection, Rockville, MD (e. g., ATCC Nos. 6:L385, '79588, 79602, or 79610) .

Alternatively, Factor IX-encoding DNA molecules may be obtained by ~~ynthesizing the genes with mutually priming lone oligonucleotides. See, for example, Ausubel et al., supra, at pages 8.2.8~to 8.2.13; Wosnick et al., Gene 60:115 (1987). Moreover, the polymerase chain reaction can be used to synthesize DNA fragments as large, as 1.8 kilobases in length. Bambot et al., PCR Methods and Applications 2:266 (1993).

Suitable Factor IX-encoding DNA molecules include genomic or complementary DNA molecules that encode naturally occurring Factor IX. In a preferred embodiment, DNA molecules encoding human Factor IX are employed, including cDNA and genomic DNA molecules.

However, the present invention discloses that a cDNA

based construct a.s described herein can be successfully _17_ used for the expression of human Factor IX at w commercially useful levels. Particularly a cDNA based construct containing 5' regulatory sequences of a mammary gland specific gene including a promoter, a Factor IX-encoding DNA sequence as described herein, and 3' regulatory sequences from a mammary gland-specific gene or 3'regulatory sequences active in a mammary gland is preferred. Factor IX-encoding DNA molecules from other species may also be used, such as the Factor IX encoded by rats, pigs, sheep, cows and chimpanzees.

It also will be appreciated that the Factor IX cDNA

fragment dEa cribed herein can be modified using recombinant DNA techniques to obtain functionally equivalent molecules. For example, 3' or 5' portions of the Factor IX gene can be added, or completely deleted, or a few bases at either end may be removed. Introns can be removed or added, or portions of one or more introns can be deleted. P.dditional nucleotide sequences can be inserted into them. The sequences of the introns can be altered. Eaons can be modified in accordance with the discussion ~~f modified Factor IX molecules set forth below. Most. modified forms of the preferred Factor IX

cDNA fragment will not be significantly changed in their ability in transgenic animals to engender the production of milk-born Factor IX. In one embodiment, the Factor IX

encoding portion of the gene lacks the complete 5'-untranslated and 3'-untransla'ted regions of the native Factor IX gene. Thus, these substantially similar fragments will be' equivalent in the invention to the particularl,~ disc:Losed Factor IX cDNA fragment.

A 5'-untranslated region that is not the 5'-untranslated region of the Factor IX gene can be included in the present DNA. Factor IX constructs, particularly the 5'-untranslated region of the mouse WAP gene. Likewise a 3'-untranslated region that is not the 3'-untranslated region of the Factor IX gene, particularly the 3'-untranslated region of the mouse WAP gene.

Further, the Factor IX-encoding DNA molecule can also comprise a ~~' -untranslated region located 5' from the signal sequence DNA., and a 3' -untranslated region located 3' from the Factor IX coding sequence.

Additional use:Eul modifications of Factor IX include those that alter post-translational modifications, size or active site, or that fuse this protein or portions thereof to another protein. Such modifications can be introduced into the protein by techniques well known in this art, such a:~ by synthesizing modified genes by ligation of overlapping oligonucleotide or introducing mutations into the cloned genes by, for example, oligonucleotide-mediated mutagenesis. See, generally, Ausubel et ,sl. (eds.), CURRENT PROTOCOLS IN MOLECULAR

BIOLOGY, pages 8Ø3-8.5.9 (1990); McPherson (ed.), DIRECTED MU'.CAGENESIS: A PRACTICAL APPROACH, IRL Press (1991).

The examples described herein demonstrate that a transgenic ;animal can be produced that synthesizes a sufficientl~~ y-carboxylated, biologically active Factor IX in mammary tissue. Accordingly, the basic methods of the present application can be used to obtain transgenic animals that produce other vitamin K-dependent blood coagulation factors, such as Factor II, Factor VII, Factor X, or the anticoagulation protein, Protein S . DNA

molecules encoding these proteins can be obtained by standard methods. See, for example, Pollak et al., J.

Biol. Chem. 271: 1738 (1996), which describes the characteriz<~tion of the Factor VII gene, which is located.

on chromosome 13 just 2.8 kilobase pairs 5' to the Factor X gene.

The ci,s-acting regulatory regions useful in the invention include the promoter that drives expression of the Factor 7.X gene:. Promoters particularly useful in the invention are "active" in mammary tissue in that the promoters a:re more active in mammary tissue than in other tissues under physiological conditions where milk is synthesized. Most preferred are promoters that are both specific to and efficient in mammary tissue. By "efficient" it is meant that the promoters are strong promoters i.n mammary tissue that can support the synthesis of large amounts of protein for secretion into milk. Among such promoters, highly preferred are the short and lcng whey acidic protein (WAP), short and long a, ~3 and kappa casein, a-lactalbumin and ~3-lactoglobulin ("BLG") promoters.

Promoters may be selected on the basis of the protein composition: of milk from various species. For example, the WAP and BLG promoters are particularly useful with transgenic rodent;, pigs and sheep. The rodent WAP short and long promoter:. have been used to express the rat WAP

gene, the human tissue-type plasminogen activator gene and the CD4 gene, while the sheep BLG promoter has been used to express the sheep BLG gene, the human alpha-1-antitrypsin gene and the human Factor IX gene. See, for example, Pa7.eyanda et al. , 1991, above, and Clark et al.
, TIBTECH 5: 20 (1987). Preferred promoters include the rodent casein anal WAP promoters, and the casein, a-lactalbumin and BLG promoters from porcine, bovine, equine and ovine (pigs, sheep, goats, cows, horses), rabbits, rodents and domestic pets (dogs and cats). The genes for these promoters have been isolated and their nucleotide sequences have been published. See, for example, Clark et a1. (1987), above, and Henninghausen, Protein Expression and Purification 41: 3 (1990).

A useful promoter may be isolated by carrying out conventional restriction endonuclease and subcloning steps. A mouse WF,P promoter, isolated as a 2.6 kb EcoRI-KpnI fragment immediately 5' to the WAP signal sequence, is preferred, although the "long" WAP promoter (the 5' 4.2 kb Sau?~A-Kpnl: promoter of the mouse WAP gene, or a fragment thereof) is also suitable for carrying out this invention. The publication of Paleyanda et al., Transgenic Research 3: 335 (1994), for example, provides examples of a suitable short mouse WAP promoter ("2.5 kb mWAP promo t:er" ) and a long mouse WAP promoter ( "4 . 1 kb mWAP promotE~r"). Pages 336-339 of the Paleyanda publication are incorporated by reference. Also see, for example, Gordon et al., Bio/Technology 5: 1183 (1987);

McKnight et al., "The Whey Acidic Protein," in GENES, ONCOGENES, ;AND HORMONES: ADVANCES IN CELLULAR AND

MOLECULAR BOLOGY OF BREAST CANCER, Dickson et al.

(eds.), pager 399-4E12 (Kluwer Academic Publishers 1991}.

Additional regulatory sequences direct secretion of proteins into milk and/or other body fluids of the transgenic animal. In this regard, both homologous and heterologous regu:Latory sequences are useful in the invention. ~3enerally, regulatory sequences known to direct the ;~ecret_~on of milk proteins, such as either signal peptides from milk or the nascent target polypeptide, can be used, although signal sequences can also be used in accordance with this invention that direct the ~secret:ion of expressed proteins into other body fluids, particularly blood and urine. Examples of such sequences include the signal peptides of secreted coagulation factors including signal peptides of Factor IX, protein C, anct tissue-type plasminogen activator.

Among the useful sequences that regulate transcription, in addition to the promoters discussed above, are enhancers, splice signals, transcription termination signals, polyadenylation sites, buffering sequences, FtNA processing sequences and other sequences which regulate the expression of transgenes.

Particularl~r useful in this regard are those sequences that increa:~e the efficiency of the transcription of the genes for F~~ctor '.LX in the mammary gland or other cells of the transgenic animals listed above. Preferred are transcripti~~n regulatory sequences for proteins highly expressed i:n the mammary gland cells.

Preferably, t:he expression system or construct of this invention a7_so includes a 3' untranslated region downstream of the DNA sequence encoding the desired recombinant protean, or the 3 ' untranslated region of the milk protein gene. or the milk protein gene with its 3' untranslated region, any of which can be used for regulation. This region can increase expression of the transgene. This region apparently stabilizes the RNA

transcript of the expression system and thus increases the yield ~~f thE~ desired protein. Among the 3' untranslated regions useful in this regard are sequences that provide a poly A signal.

For expression of Factor IX, it is preferred that the 3' untransla.ted region is not obtained from the native human Factor IX gene. Suitable heterologous 3'-untranslated sequences can be derived, for example, from the SV40 small t antigen, the casein 3' untranslated region, or other 3' untranslated sequences well known in this art. Preferably, the 3' untranslated region is derived from a milk-specific protein, such as the WAP

protein. The stabilizing effect of this region's poly A

transcript is important in stabilizing the mRNA of the expression :~equen<:e. Ribosome binding sites are also important in increasing the efficiency of expression of Factor IX. Likewise, sequences that regulate the post-translational modification of Factor IX are useful in the invention.

In a particularly preferred embodiment, the transgenes of the :invention generally consist of WAP milk protein regulatory sequences upstream and downstream flanking the Factor IX cDNA/signal peptide sequences. A

native 5' -WF.P regulatory sequence ending in an accessible restriction site immediately before/at the ATG codon may be ligated to the :restriction sites that occur at the ATG.

of translatable sequences with no linker sequences derived frorn the chains of human Factor IX. Each of the combined 5'-regulatory and Factor IX translatable sequences ending in a particular restriction site may then be liga.ted to a corresponding restriction site which occurs at the beginning of the 3'-untranslated region of WAP and adjoining WAP 3'-flanking region. This construction motif enables native 5'-regulatory and 3'-untranslated regi.on_ of the milk protein genes to be immediately juxtaposed without intervening sequences.
Particular restriction sites at the ends of all constructs may be selected in order to facilitate concatenaticn of constructs into a single domain within the animal genome.
Thus, in accordance with the present invention a DNA
molecule theft encodes Factor IX is operably linked to cis-acting regulat~cry sequences which allow for efficient expression cf Factor IX in milk. The resulting chimeric DNA is introduced, into a mammalian embryo, where it integrates into the embryonic genome and becomes part of the heritable genetic endowment of all the cells, including the germ line cells, of the adult which develops from the embryo. The Factor IX which is expressed in the mammary tissue and secreted into the milk of a transgenic mammal obtained in this manner displays a surprisingly high percentage of active protein, a~; measured by enzymatic and coagulation-inhibition assays which are conventionally employed to detect Factor IX activity, such as ELISAs, chromogenic activity assays and coagulation inhibition assays.
4. Isolation of lFactor IX from the Milk of Transge~nic Animals Obtaining milk from a transgenic animal according to the present invention is accomplished by conventional means. See, for example, McBurney et al., J. Lab. Clin.
Med. 64:485 (1964); Velander et al., Proc Nat'1 Acad.
Sci. USA 89:12003 (1992). Factor IX, or fragments thereof, can be isolated and purified from milk or urine by conventional means without deleteriously affecting activity. A preferred method of isolation from milk consists of a combination of anion exchange and immunochromatogravphy, cryoprecipitations, zinc ion-induced precipitation of either whole milk or milk whey (defatted milk) proteins. See, for example, Bringe et al., J. Dairy Res. 56:543 (1989).
Milk is known to contain a number of proteases that have the potential to degrade foreign proteins. These include an alkaline protease with tryptic and -chymotryptic activities, a serine protease, a chymotrypsin-like ,enzyme, an aminopeptidase and an acid protease. Clark et a1. (1987) above. It may be desirable, therefore, to protect newly secreted Factor IX, or fragments thereof, against proteolytic degradation. Such precautions include rapid processing of the milk after collection and addition to the milk of well known inhibitors of proteolysis, such as are listed in SIGMA CHEDZICAL C'O. CATALOG (1993 edition) at page 850.

Thus, in one embodiment, the transgenic mammal of the present invention produces active human Factor IX. For instance, in one embodiment wherein said mammal is a pig, such pig secretes from about 100 to about 220 ~.g of active human Factor IX per milliliter milk. In another embodiment, such pig secretes from about 100 to about 185 ~,g of active: human Factor IX per milliliter milk, from about 100 to about 170 ~.g of active human Factor IX per milliliter c>f mild;, from about 135 to about 220 ~cg of active human Factor IX per milliliter of milk or from about 145 to about 220 ~.g of active human Factor IX per milliliter of milk., as set forth below.

Factor IX produced from the transgenic mammal according to the invention has a specific activity which is at least about: 5 to 200 percent greater than the specific activity of human Factor IX isolated from human plasma, as determined by' an activated partial thromboplast:in c:Lotting time assay. In another embodiment, the specific activity of Factor IX produced by the transgenic mammal of the invention is at least about 10 to 100 percent greater, at least about 15 to 50 percent greater or at least about 15 to about 46 percent greater tha:z the specific activity of human Factor IX

isolated from human plasma.

In another embodiment, the invention relates to an in vitro culture of mammary gland cells explanted from the transgenic mammal of the invention. Such cells are explanted and cultured in vitro, according to methods well known to the skilled artisan. See e.g., U.S. Patent No. 5,580,781. In another embodiment, Factor IX is isolated and purified frcm the in vitro cell culture, according to methods well known to the skilled artisan.
5. Treatment :Methods In anoth~sr embodiment, the present invention relates to a method of treating hemophilia B using Factor IX

produced by the t:ransgenic mammal of the invention.

Specifically, treatment includes the prevention or l0 amelioration of the symptoms of hemophilia B in hemophilia B patients. Symptoms of hemophilia B include excessive bl.eedinc~ upon injury, spontaneous bleeding, especially into weight-bearing joints, soft tissues and mucous membr~~nes. Repeated bleeding into joints results in hemarthroses, which causes painful crippling arthropathy that necessitates joint replacement.

Hematomas in soft tissues may result in "pseudo" tumors composed of necrotic coagulated blood. Such blood can obstruct, compress. or rupture into adjacent organs and can lead to infecl:ion. Bleeding into gastrointestinal tract, central nervous system, intracranium or airway/retroperitoneal space can lead to death if not detected. This, treatment according to the present invention includes the prevention or amelioration of bleeding and the related side effects found in hemophilia B patients. This method involves administering to a patient having hemophilia B symptom, a hemophilia B

symptom pre~rentinc~ or ameliorating amount of Factor IX

produced b~~ the transgenic mammal of the present invention. Administration may be accomplished by any method known to the skilled artisan. For instance, the treatment of: the above described symptoms may consist of intravenous rep7_acement therapy with Factor IX

concentrate: . TrE:atment of maj or bleeding episodes may be by bolus injection of concentrate. However, as described above, tissue damage may remain even after prompt detection ~~nd treatment. Prophylactic treatment is recommended to prevent pain and debilitation. Upon injection, 5C% of Factor IX, according to the invention, is immediately bound to vascular endothelial cells and/or diffuses into the e:Ktravascular space. The remaining 500 has a half life in circulation of approximately 24 hours..

These infusion kinetics result in the need for injections about once to twice per week to maintain minimal therapeutic ~~.evels in the plasma.

Another embodiment of the invention relates to pharmaceutical compositions comprising the Factor IX of the present invention. Such pharmaceutical composition preferably i:~ Factor IX produced by the above described transgenic animal and a pharmaceutically acceptable carrier. Fo:r instance, such pharmaceutical composition may be a stable liquid formulation of the Factor IX of the invention that. can be administered by continuous infusion to ~provid~~ a constant circulating level of the coagulation factor.

The Factor IX produced by the transgenic animal of the present invention may be concentrated and sold in lyophilized :dorm, <~ccording to methods well known to the skilled artisan. For instance, the Factor IX of the present invention which has been lyophilized may be reconstituted with sterile water for injection (WFI) and delivered in a composition of: 0.01 moles/liter histidine, pl3 7.05; 0.066 moles/liter sodium chloride;
3%

mannitol. In another embodiment, lyophilized Factor IX

is reconsti'~uted in sterile WFI and delivered in a composition that includes: 0.04 units heparin/unit FIX;

1 milligram dextrose/unit Factor IX. To avoid repeated invasive treatments as is found with the current therapies for pro;phylaxis, stabilities of at least 30 days at 37C and at least 365 days at 4C are preferred.

The present invention provides significant stability over that of the~~e prey>arations reconstituted.

This skilled artisan would know of other suitable formulation:> for the Factor IX of the present invention.

See, for instance, AlphaNine by Therapeutic Corporation, *rB

Los Angeles, Ca., and Bebulin VH, by Immuno, Vienna, Austria. Of course, any formulations according to the present invention are highly purified and free of viruses, pric>ns, bl~aod-group antibodies, immune complexes and phosphol:ipids.

Dosages or amounts that prevent or ameliorate the symptoms of hemopha_lia B are necessarily dictated by the clinical picture and severity of the disease. Because there is so 'much variability between patients and their clinical conditions, monitoring of coagulation function is essential in during any therapy using the Factor TX of the invention. As a rule, on initial treatment, one unit of Factor I~~ per kg body weight gives a mean rise in Factor IX activit~~ of about 0.5 -1%, on continuation therapy, the mean rise is about 1-1.5% Examples of dosages for long term prophylaxis of symptoms of hemophilia B are about 18-30 IU/kg (1 X weekly) or about 9-15 IU/kg (2 X weekly). Dosages also will vary depending upon the purpose of the treatment. For instance, where a hemophilia B patient has had surgery, it may be d~~sirab:le to raise Factor IX levels in such patients by 30 to ~>0 % following the week of surgery. For dental extra.ctions, the Factor IX levels may need to be raised to 50% immediately prior to the surgery. Mild to moderate hemorrhages may be treated with a single administration of the Factor IX of the invention to raise Factor IX levels to 20 to 30%. In the even to more serious hemorrhages, it may be desirable to raise Factor IX levels to 30 i~o 50% and infusions may be required daily. Again, those of skill in the art would know how to adjust the amount and frequency of dosages of the Factor IX of the present invention depending upon the patient and the c=~inical setting.

In yet ~~nothe:r embodiment, the invention relates to a method of treating hemophilia B using Factor IX-producing ells that are explanted from the transgenic mammal of t;he present invention. Such mammary gland cells express Factor IX in vivo, thereby preventing or amelioratinc: the s~~rmptoms of hemophilia B. This method is accomplishecL by using known techniques for gene therapy.
See e.g., P~ebs, R. Proc. Natl' Acad. Sci. (USA) 89:
11277-11281 (1992), Legendre et al., Pharmaceutical Res.
9: 1235-42 (1992). In one embodiment, Factor IX-producing cells removed from the transgenic mammal according to the :invention are cultured in an in vitro culture sysl~em prior to transplantation into a human.
Such culture sys~~ems are well known to the skilled artisan. See e.g.. U.S. Patent No. 5,580,781. The cells are treated and then transplanted into the patient in a manner so a:~ to avoid rejection by the recipient. Such methods are known to the skilled artisan. See, for instance, U.S. Patent No. 5,573,934, which teaches a method of encapsulating biological material for use in vivo. Other techniques known to the skilled artisan involve placing the biological material in a chamber of an immunoi:~olation apparatus and for enhancing the vascular support for the implanted material using immunomodulatory agents. See, U.S. Patent No. 5,569,462.
The pre;~ent invention, thus generally described, will be understood more' readily by reference to the following examples, which a:re provided by way of illustration and are not intended to be limiting of the present invention.
Exampla 1 Preparation of a Human Factor IX Expression Vector for Production of Transgenic Pigs Generally, the entire murine WAP gene including 2.5 kb of 5' untranslated sequence and 3' untranslated regions was cloneci by standard methods. See Campbell et al., Nucleic Acids Res. 12:8685 (1984). A cDNA fragment encoding human factor IX was obtained and the 3' untranslated regi«n was deleted. Using standard methods, an expression vector was constructed that contained a mouse WAP promoter, isolated as a 2.6 kb EcoRI-KpnI
fragment immediately 5' to the WAP signal sequence, the human Factor IX cDNA sequence lacking a 3' untranslated region, and a 1.6 kb fragment of the 3' untranslated region of the WAP gene. A second expression vector contained a 7.2 kb mouse WAP gene (EcoRI-EcoRI) fragment.

Expression vecto~_s were amplified by bacterial transformation and purified from bacterial cultures using standard methods. Routine recombinant DNA techniques can be found, fc~r example, in Sambrook et al., MOLECULAR

CLONING, A hABORATORY MANUAL, Vol. 1 - 3 (Cold Spring Harbor Press 1989).

More specifically, a chimeric Factor IX construct was prepared, as follows:

1. Pre:parati.on of a Chimeric Factor IX Construct Production of: pWAP4 "cassette vector"

Regulatory 5' and 3' flanking sequences of the mouse WAP gene were used for mammary specific expression.

Specifically, a cassette vector containing a mouse WAP

promoter, defined as a 2.6. kb EcoRI-KpnI fragment immediately 5' to the WAP signal sequence and a 1.5 kb fragment of the 3' untranslated region of the WAP gene was prepared.. These regulatory sequences do not include coding and intragenic untranslated sequences (introns) of the WAP gene' .

The vector de~;ignated pWAP4 was derived from pWAPPC3 (C. Russell, dissertation "Improvement of Expression of Recombinant Human Protein C in the Milk of Transgenic Mammal Using a Novel Transgenic Construct," Virginia Technology Institute, Blacksburg, Virginia (December 1993 ) ) and Haas de~reloped as follows : Using WAPPC3 as a template, PCR primers WAP3'S2 (which contains a 5'KpnI

site and is homologous to endogenous WAP right after the stop signal) and WAP3'A1, as shown in Table 1, below, were used to produce a segment with KpnI and BamHI sites on either end. This segment was digested with KpnI/BamHI

and ligated with t: he vector containing the fragment from KpnI\BamHI digested pWAPPC3. The ligation mixture was used to transform E, coli DHSa cells by electroportation with resultant colonies grown on LB ampicillin plates.
*rB

Picked colonies we're grown up in TB ampicillin broth, plasmids isolated and cut with KpnI, BamHI or both and subjected to gel electrophoresis. Sequencing was performed u;~ing GdAP3'A1 primer and judged as being correct. See Figure lA.
Production of modified (Kpn I) FIX cDNA
The FIX cDNA (containing Kpn I sites located immediately before the start sequence and after the stop sequence) was generated as a PCR fragment. Fragment production protocol is as follows: 100 ~,l total volume containing 200~M dNTP's, 0.5 ~M of each primer (humFIX5'KpnI and humFIX3'KpnI, as shown in Table 1), 2.5 units Pfu polymerase and 30 ng of plasmid template (pMCDSFIX
obtained from Prof. Darryl Stafford, Department of Biology, University of North Carolina, Chapel Hill, North Carolina, USA), reaction mixture was subjected to 30 cycles of denaturation at 95°C for 20 sec, annealing at 50°C for 1 min anct elongation at 75°C for 5 min 45 sec.
After cycling, the reaction mixture was subjected to blunting with T4 DNA polymerase for 10 min, EDTA
concentration brought up to 25 mM, heated to 65°C for 15 min, and extracted with Phenol: Chloroform (1:1), precipitated with equal volumes of 95% ethanol, aspirated, and suspended in H20.
Ligation, Transformation and Sequencing As is shown in Fi<~ure 1B, the plasmid designated pUCFIX
containing the modified (Kpn I ends) FIX cDNA was produced by digestion of both pUClB and the modified cDNA
with Kpn I (per manufacturers instructions, Stratagene, La Jolla, California) purification of digestion products by CHC13: F~henol (1:1) extraction, precipitation with equal volumes of 95% ethanol, aspiration and suspension in HzO. Ligation of plasmid and cDNA was per manufacturers instructions (Stratagene) using 125 ng of Kpn I digested pUCl8 and 125 ng of Kpn I digested *rB ' 1. __.

modified cDrdA. E. colt JM109 was transformed by w electroportat~ion using ligation mixture and plated on LB
ampicillin p7.ates. Selected colonies were grown up in TB
ampicillin broth. Plasmid preparations from these colonies were analyzed by restriction enzyme digestion (Kpn I) and c~el electrophoresis. The entire sense strand of the cDNA was sequenced and found to be correct as compared with FIXA sequences located in Genebank.
Introduction of FIX cDNA into pWAP4 "cassette vector" to produce pWAP;fIX
As shown in. Figure 1C, both pWAP4 and pUCFIX were digested with Kpn I in separate reactions, subjected to gel electrophoresis and the appropriate plasmid fragments removed front the ~~el and ligated. E. colt JM109 was transformed by electroportation using ligation mixture and plated on LB ampicillin plates. Selected colonies were grown up i.n TB ampicillin broth. Plasmid preparations from these colonies were analyzed by restriction enzyme digestion (Kpn I) then gel electrophoresis. Clones positive for the insert were subjected to PCR analysis using primers FIXS1 and WAP3'A1 to determine the correct orientation of the insert.
Production of pUC'WAPFIX
As shown in Figure 1D, the insert containing WAP
promoter, cDNA and 3'WAP UTR was released from pWAPFTX by EcoR I digESStion, subjected to gel electrophoresis, removed from the gel and purified. This fragment was ligated with Kpn I digested pUCl8 and the reaction mixture used to transform E.coli JM109 by electroportation. After electroportation, cells were plated on LB ampic:illin plates with picked colonies grown in TB ampic.illin :broth. Plasmids from picked colonies were purified and subjected to EcoRI enzyme digestion and electrophoresis. After insert confirmation, large scale purification was undertaken, according to methods well known to the skilled artisan.

2. Preparation of Factor IX-Encoding DNA -for Microinjection Chimeric constructs containing either the 7.2 kb mouse WAP genie, or containing the WAP promoter, human Factor IX gene and 3' WAP sequence were excised from pUCWAPFIX by EcoRI restriction digest and purified for microinjection using low melting point agarose electrophoresis. 'the DNA: agarose band was cut from the gel slab. Tree agarose band was then treated with agarase to degrade and remove agarose contamination.

After digestion, the solution containing the cDNA was brought to :~_OmM Mc~2+, 20mM EDTA and 0 . 1 % SDS and then extracted with phenol/chloroform. DNA was precipitated from the aqueous layer with 2.5 volumes of ethanol in the presence of 0.3 M sodium acetate ate -20 degrees centigrade overnight. After centrifugation, the pellet was washed with '70% ethanol, dried, and each of the constructs was resuspended and dissolved in Brinsters microinjecti.on bu=fer to a concentration of 1.4 or 7 ~.g/ml (for mice) , 14 ~.g/ml (for pigs) .

According to another protocol, extracted DNA was purified by HPLC, as follows. After cleaving a chimeric gene from it:s vector, the solution was brought to 10 mM

magnesium, 20 mM EDTA and 0.1% SDS and then extracted with phenol;chloroform. DNA was precipitated from the aqueous layer with 2.5 volumes of ethanol in the presence of 0.3 M sodium acetate at~-20C overnight. After centrifugatuon, the pellet was washed with 70% ethanol, dried, and resuspended in sterile distilled water.

The digested DNA was precipitated with isopropanol and then di:~solved in TE buffer at 0.3 ~,g/ml. Fragments were purified by HPLC using a Waters GEN FAX PAC HPLC

column. The' column was run isocratically using a buffer consisting of 25 mM Tris-HC1 (pH 7.5), 1 mM sodium EDTA, and 0.63 M rdaCl. About 15 ~.g of digested DNA was loaded on the column at a time. DNA samples from all of the chromatogra~?hic runs were then pooled, reprecipitated, and run thr~~ugh t:he column a second time.

DNA conc:entrat:ions were determined by agarose gel electrophoresis by staining with ethidium bromide and comparing the fluorescent intensity of an aliquot of the DNA with the intensity of standards. Samples were then adjusted to 10 uc~/ml and stored at -20° C, prior to microinjection.
Example 2 Production of Transgenic Pigs That Express the Human Factor IX Gene Pig embryos were recovered from the oviduct, and were placed into a 1.5 ml microfuge tube containing approximately 0.5 ml embryo transfer media (Beltsville Embryo Culture Medium). Embryos were centrifuged for 12 minutes at 16,000 x g RCF (13,50 RPM) in a microcentrif:uge (Ffermle, model 2231) . The embryos were then removed from the microfuge tube with a drawn and polished Pa:~teur pipette and placed into a 35 mm petri dish for examination. If the cytoplasm was still opaque with lipid such t:hat pronuclei were not visible, the embryos were. centrifuged again for 15 minutes. Embryos were then placed into a microdrop of media (approximately 100 ~.l) in the center of the lid of a 100 mm petri dish, and silicone: oil was used to cover the microdrop and fill the lid to prevent media from evaporating. The petri dish lid containing the embryos was set onto an inverted microscope (Carl Zeiss) equipped with both a heated stage and Hoffman Modulation Contrast optics (200 x final magnification). A finely drawn (Kopf Vertical Pipette Pulley, model 720) and polished (Narishige microforge, model MF-3c~) micropipette was used to stabilize the embryos while about 1 - 2 picoliters of HPLC-purified DNA

solution containing approximately 200-500 copies of a mixture of t:he two chimeric constructs was delivered into the male pronucleus with another finely drawn micropipette. Embryos surviving the microinjection process as judged by morphological observation were loaded into a polypropylene tube (2 mm ID) for transfer into the recipient pig.
Example 3 Production of pUCWAP6 "Cassette Vector"
and plasmio! pUCW~I.P6FIX
Production ef pUCinYAP6 "cassette vector"

General7.y, the entire murine WAP gene was cloned by standard methods, as described above in Example 1, and regulatory 5' and 3' flanking sequences of the mouse WAP

gene were used for mammary specific expression.

Specifically, a cassette vector containing a mouse WAP

promoter, defined as a 4.1 kb NotI-KpnI fragment immediately 5' to the WAP signal sequence and a 1.6 kb fragment of the 3' untranslated region of the WAP gene was prepared. These regulatory sequences do not include coding and i:ntragenic untranslated sequences (introns) of the WAP gene:.

The vector designated pUCWAP6 was derived from genetic elements from the following plasmids as starting material: piJCl8, pWAP4 and p227.6, which were provided by the American Red Cross . The development of pUCWAP6 is as follows: The pUCl8 vector was cut with the enzymes EcoRI and Hind III to remove the multiple cloning site of the vector, blunted with exonuclease and ligated with NotI linkera. The linearized plasmid was then cut with NotI and licfated. Ligation mixture was used to transform E. coli DHSa cells on LB ampicillin plates, picked colonies were grown in TB ampicillin broth, plasmids were isolated and cuts with NotI then subjected to gel electrophoresis. Plasmid was judged to be correct and designated ~~s pUCl~TotI (See Figure 3A) . The vector pWAP4 was cut with EcoRI: and the f ragment containing the WAP
5 ' 2.6 kbp and 3' genetic elements were separated by gel electrophoresis and purified. The ends of the fragment were modified by blunting with exonuclease and NotI

linkers were ligated on. The fragment was cut with NotI

and ligated into the NotI restriction site of pUCNotI

then used to transform E. coli DHSa cells on ampicillin plates picked colonies were grown in TB ampicillin broth.
Isolated plasmid was verified to be correct by NotI
digestion with the plasmid being designated pUCWAP5. The pUC WAP5 plasmid was subjected to KpnI digestion and a partial NotI digestion producing a fragment that contained the. pUCNotI vector sequence flanked by the mWAP
3'UTR (See Figure 3B). This fragment was ligated with the 4.1 kb 5' wAP promoter produced from digestion of p227.6 with Notl, KpnI and Hind III. The ligation mixture was then used to transform E.coli JM109 cells that were grown on LB ampicillin plates picked colonies were grown in TB ampicillin broth, plasmids isolated were cut with Not I, and NotI/KpnI and judged to be correct.
The plasmid was them designated pUCWAP6 (See Figure 3C).
Production of pUCWAP6FIX
As shown in Figure 4, the plasmid pUCWAP6FIX was produced by digestion of pUCWAPFIX with KpnI and isolating the FIX cDNA by gel electrophoresis. This fragment was inserted into the Kpnl site of pUCWAP6 after KpnI digestion and both fragments were then subjected to ligation. The ligation mixture was then used to transform E. coli ,JM109 cells that were then plated on LB
ampicillin elates. Picked colonies were grown in TB
ampicillin broth and plasmids were isolated. Isolated plasmids were digested with NsiI to verify orientation of the cDNA insert. Plasmids that contained the insert in the correct. orientation were designated pUCWAP6FIX.
After insert. conformation, large scale purification was undertaken, according to methods well known in the art.
DNA was prepared for microinjection as described above.
Example 4 Production of Transgenic Mice That Express the Human Factor IX Gene Transgenic mice were produced essentially as described b~r Hogari et al. , Manipulating the Mouse Embryo, Cold Spring Harbor Press, (1986), which is hereby -incorporated by re:Eerence. That is, glass needles for micro-injection were prepared using a micropipet puller and microforc~e. Injections were performed using a Nikon microscope having Hoffman Modulation Contrast optics, with Narashigi micromanipulators and a pico-injector driven by N2 (Nara:~higi).

Fertilized mou:>e embryos were surgically removed from oviducts of superovulated female CD-1 mice and placed into M2 medium. Cumulus cells were removed from the embryos with hyalL.ronidase at 300 ~g/ml. The embryos were then rinsed i:z new M2 medium, and transferred into M15 medium for storage at 37 degrees centigrade prior to injection.

Stock solutions containing about 1.4 ~.g/ml of the above descrileed DN~~ were prepared and microinjected into the pronucle~i of 1 cell mouse embryos. In addition, stock solutions containing about 7 ~.g/ml total DNA were prepared and. microinjected into the pronuclei of mouse embryos.

After injecting the DNA solution into the male pronucleus, embr~ros were implanted into avertin-anesthesized CD-1 :recipient females made pseudo-pregnant by mating with vasectomized males. About 25-30 microinjected mouse embryos per recipient were transferred into pseudopregnant females. Embryos were allowed to come to term and the newborn mice were analyzed for the presence of the transgene by PCR using the primers FIXS1 ~~nd FIXA1 described in Table 1, below.

3 0 Exampl. a 5 Preparation of DNA from Transgenic Animals DNA can. be prepared from tissue of a transgenic animal of any species by the method exemplified below for mice. Marmur., J. Mol. biol. 3: 208 (1961), incorporated herein by rE~ference.
A 5 mm piece of mouse tail was removed from young, potentially transc~enic mice at weaning (3 weeks) age, and frozen in liquid nitrogen. To the frozen tissue was added 840 ~.7. of L~ysing Solution (8 mM EDTA-0.8% 2-mercaptoethanol-80 ~.g/ml Proteinase K-1 M sodium chlorate in 40 mM TRIS buffer) pH 8.0 and 120 mM NaCl, and the mixture incubated at 50 degrees centigrade. The mixture was then extracted with 250 ~.1 of phenol/chloroform-/isoamyl alcohol (25:24:1) for 10-15 seconds, then centrifuged i_or 10 minutes. The supernatant fluid (about 830 ~.1) was removed to a fresh tube, and a DNA clot produced by vortexing the solution with 0.6 vols. of isopropanol. The mother liquor was decanted, and the DNA

clot rinsed twice with 80% ethanol. The DNA clot was isolated by 5 minutes or centrifugation, aspiration of the supernat~~nt fluid, and air drying of the clot with a stream of air for 10 minutes.

The DNA ~~lot was dissolved in 250 ~1 of the TE buffer (10 mM Tris. HCl, pH 7.0-1mM EDTA, and the solution treated with 10 ~1. of RNase (lmg/ml RNase A and 4, 0000 units/ml RNAse Tl) for 1 hour at 37 degrees centigrade.

This mixture was shaken with 50 ~.1 of a 24:1 (v/v) solution of ~~hloro:Eorm-isoamyl alcohol for 5-10 seconds, centrifuged, and the supernatant fluid transferred to a fresh tube.

The recovered supernatant fluid above was mixed sequentially with 25 ~.l of 3M sodium acetate and 0.5m1 of 95% ethanol. The=_ supernatant fluid above was mixed sequentially with 25 ~,1 of 3M sodium acetate and 0.5m1 of 95% ethanol. The supernatant fluid was decanted from the precipitated DNA, and the precipitate washed with 80%

ethanol. The purified DNA was isolated by centrifugation, air dried, then dissolved in 150 ~l of TE.

Essentially t'.ne same technique was used to prepare DNA from pies, and. the same or similar techniques can be used to pre~~are DNA from other animals. Such DNA can be analyzed to determine whether transgenic animals carried recombinant structures.

Example 6 Ar~alysis; of DNA Derived From Tissue To determine whether test animals carried the recombinant constructs, tissue samples were removed from transgenic animals and treated with proteinase K and SDS

at 37C overnight. The mixture was then incubated with DNase-free RNase at 37C for 1-2 hours. DNA was precipitated from the mixture with sodium acetate and ethanol at -20C overnight, collected by centrifugation, l0 washed in 70% ethanol and dried. The dried DNA pellet was used directly for polymerase chain reaction (PCR).

In some cases, the mixture was extracted extensively with phenol/chloroform prior to ethanol precipitation.

Oligonu~~leoti~3e pairs were used to prime polymerase chain reactions that detected the presence of the WAP

gene or the Factor IX gene in the transgenic animals .

See Table 1, below. Reactions were performed using an annealing te:mperat.ure of 58C, a denaturation temperature of 94C, and an exaension temperature of 72C, using 100 ng of oligo primers and 50 ng of (genomic) template DNA

per reaction, and cycling through the temperatures 40 times usin~3 an automatic temperature cycler (M. J.

Research). PCR reactions were analyzed by running 20% of the reaction products on agarose gels and identifying fragment sizes by comparison with marker DNA fragments.

Two founder transgenic pigs (one male and one female) contained a 2.6 kb mouse WAP promoter-Factor IX cDNA-1.6 kb WAP gene 3 - ' e:nd construct that had been coinj ected.

with the 7.2 kb mouse WAP gene (EcoRI-EcoRI) fragment.

As shown in Table 2, the male, 57-7, did not transmit the transgene. In contrast, founder 58-1 has produced one female off~~pring having the Factor IX cDNA transgene.

Founder 58-1 has produced six additional offspring, three females and threfs males, from her second litter. The three females were not transgenic. Two of the males from the second litter tested positive for the Factor IX

transgene. _ Table 1 Primer Sequences humFIX5'KpnI 5'gc~ta\ggtacc\atgcagcgcg humFIX3'Kpnl 5'gtca\ggtacc\ttaagtgagct FIXS1 5'gc~ataacatcactcaaagcac WAP3'A1 5'tagcagcagattgaaagcattatg FIXA1 5'gt:gaactttgtagatc Table 2 Transge:nic Pigs Containing Recombinant Human Factor IX DNA
Pig ID Construct Sex Comanents 57-7 V~AP/FI~; Male Founder, PCR* positive for WAP and FIX

58-1 VJAP/FI~; Female Founder, PCR positive for WAP and FIX

63-1 WAP/FIX Female G' from 58-1, positive for WAP and FIX

63-2 I~JAP/FI:~ Female G' from 58-1, positive for WAP and FIX (dead) litter WAP/FI:K 3Female,.2 transgenic males #10 3Male to 58-WAP: Whey acid protein; FIX: Factor IX;
*Detect.ion of human Factor IX transgene carried out by the PCR method.

Exampla 7 Expression of Human Factor IX in the Milk of Transgenic Pigs Daily expression levels of recombinant human Factor IX in the mi:Lk of t:ransgenic pig 58-1 were determined as follows. La.ctatir.~g sows were injected intramuscularly with 30-60 IU of oxytocin (Vedco Inc., St. Joseph, MO) to stimulate milk l.et-down. Letdown occurred two to five minutes after injection. Pigs were milked by hand during the course of this study. Immediately after collection the milk wa:~ diluted 1:1 with 200 mM EDTA, pH 7.0 to solubilize the caseins and then frozen. Small aliquots (about one milliliter) of the milk/EDTA mixture were taken and c_ntrif,~ged for approximately 30 minutes at 16000 x g at: 4C. The fat layer was separated from the diluted whey fraction, and the diluted whey fraction was used for all further assays. In this study, all concentration values reported for milk were obtained from diluted whey samples that were multiplied by a factor of 1.9 to acccunt for dilution with EDTA and subsequent removal of milk fat.

Amounts of Factor IX in milk were measured by polyclonal E;LISA. Briefly, Immulon II microtiter plates (Fisher Scientific, Pittsburgh) were coated overnight with 100 ul/well of 1:1000 rabbit anti-human Factor IX

(Dako) in 0.1 M NaHC03, 0.1 M.NaCl, pH 9.6 at 4C. The wells were washed with TBS-Tween (TBST, 25 mM Tris, 50 mM

NaCl, 0.2% Tween 20, pH 7.2), and then blocked for 30 minutes with TBS/0.1% BSA at room temperature. Sample s and human Factor IX standard (a gift from the American Red Cross) in the TBS-BSA dilution buffer were added in triplicate to the wells (100 ~.l/well) and incubated at 37C for 30 minutes. The wells were then washed and blocked for another 10 minutes at room temperature.

Goat anti-human Factor IX (American Diagnostica, Greenwich, ~~T), 1:1000 in TBS-BSA, was then incubated in the wells for 30 minutes at 37C, followed by anti-goat IgG/HRP (S:igma, St. Louis). Bound chromophore was detected with OPD substrate (Abbott, Chicago) at 490 nm using an EL308 Bio-Tek Microplate reader.
As shown in Tahle 3, daily expression levels of 100 220 ~g/ml milk were maintained throughout the 10 day lactation.
Tabl a 3 Recombinant Factor IX Levels in Milk of Tra.nsgenic Pig 58-1, First Lactation Day of rhFIX

Lactation Levelz [~g/ml]

ZRecomt~inant human Factar IX (rhFIX) levels were determined by EL:ISA on daily samples of EDTA-diluted whey.
Example 8 Western Analysis of Human Factor IX Produced by Transgenic Pigs Recombinant human Factor IX also was examined using Western an~ilysis. Daily samples of EDTA-diluted whey from 58-1 were electrophoresed on 8-16% SDS gels (Novex, San Diego) . App:roximately 125 ng of recombinant human Factor IX (as determined by polyclonal ELISA) and human Factor IX standard (American Red Cross), were loaded in each lane. A.total of 25 ~cg of total protein from a pool of non-transgenic (NTG) whey was loaded on the gels.

After elect:rophoz-esis, proteins were transferred overnight to PVDF membranes (Bio Rad). The membranes were washed for 30 minutes in TBST, blocked with TBS/0.05% Tween 20/0.5% Casein (TBST-Casein). The membranes were developed with rabbit anti-Factor IX

(Dako) (1:1000 in TBST-Casein for 45 minutes at 37C) , followed by anti-rabbit IgG/HRP (Sigma) (1:1000 in TBST-Casein for 45 minutes at 37C), and the DAB metal enhanced staining (Pierce). Molecular weight markers were purchased from Bio Rad.

Western analyses revealed the presence of three sub-populations of recombinant human Factor IX: the major population migrated at a M~ of about 60-65 kDa, which is a slightly lower M,. than human Factor IX, and minor sub-populations migrated at about 40-45 kDa, and at about 25 kDa. Pla:ama human Factor IX also possessed a subpopulation at about 45-50 kDa.

In yet another study, whole milk from transgenic pig 58-1 was d_Lluted 1:1 with 200 mM EDTA, pH 7.0 to dissociate casein micelles. Milk was skimmed of fat by centrifugation at 4000 X g for 30 min, at 2C.

100 ~.gs of milk protein were loaded per lane of a 4%/10%

SDS-PAGE gel and resolved at 15 mA/hr for one hour and mA/hr for 2 hours. Proteins were transferred onto nitrocellulose paper (Amersham), at 24 V/h, 4C and western blotted to detect rFIX in milk, using an HRP-30 conjugated coat anti-FIX antibody (Affinity Biologicals) at 0.9 ~.g/m:1 concentration. The results of this study are set for'~h in Figure 1, wherein lanes 1-8 represent milk from da.y 3, 4, 5, 6, 7, 9, 10, 11 of lactation; lane 9, purified recombinant FIX, 1.0 ~.g; and lane 10, human FIX purified from plasma, 0.5 fig. The positions of broad range molecular weight markers (BioRad) are indicated on the left.

Exampl a 9 Purifp:catior.~ of Human Factor IX from Milk of Transgenic Pigs Recombinant human Factor TX was purified from a pool of the first lactation from the milk of 58-1 using ion exchange chromatography followed by metal-dependent immunoaffinity chromatography (MAb 1H5). In these studies, all columns and buffers were kept at 4°C. A
pool of daily EDTA-expanded whey samples was diluted to OD 280 nm of 5.0 with TBS, pH 7.2, then loaded at 1 cm/min on DE.AE FF :3epharose. The column was washed with TBS , pH 7 . 2 , and 'then eluted with 0 . 25 M NaCI in TBS .
This fraction was diluted 1:1 with 40 mM MgCl2 in TBS to a final concentration of 20 mM MgCl2 and loaded on a 1H5 MAb column. The column was washed with TBS containing 20 mM MgCl2, and the product was eluted with 20 mM citrate, 0.15 M NaCl, pH 6.8. The product was dialyzed overnight against 10 ~iM imiclazole, pH 7.2.
The yields from the anion exchange and immunoaffinity steps were quantitative, and no recombinant human Factor IX was detected in the flow-through chromatographic fractions by polyclonal ELISA. This two-step chromatographic procedure isolated the recombinant human Factor IX to about: 80-90°s purity.
Example 10 The Biological Activity of Purified Recombinant Human Factor IX
The biological activity of the purified recombinant human Factor= IX fz-om 58-1 was measured using a one-stage activated partial. thromboplastin clotting time assay (APTT) clotting assay following a protocol given by the American F:ed C=oss Plasma Derivatives Laboratory (Procedure :Eor Factor IX Coagulation Assay, March 1992).
Brief ly, each well. of a plastic Coag-a-mate tray received 90 ~1 of Factor IX-deficient plasma plus 10 ~.l of a Factor IX standard or sample, diluted with Tris/saline/BSA. The tray was then placed on an automated analyzer (APTT mode, 240 second activation).
The run was started, which automatically performed the addition of 100 ~1 of APTT reagent and 100 ~.l of 0.025 M
CaCl2. Data obtained using a standard Factor IX
preparation were fitted to the equation y - ax + b where y = clotting time and x = Factor iX, which was then used to determine the amount of Factor IX in a sample. The Standards of. norm~~l plasma reference pool (Sigma) and human Factor IX (American Red Cross Plasma Derivatives Laboratory) were ~:aed in the assay. Duplicates of 58-1 recombinant human Factor IX, human Factor IX, and normal plasma reference pool samples were run at each dilution.
As shown in Table 4, the immunopurified recombinant human Factor IX read a specific activity of 337 U/mg, which is comparable to the immunopurified human Factor IX
from plasma which had a specific activity of 230 U/mg, and the normal plasma reference pool activity of 250 U/mg.
Tabl a 4 Specific Activity of Recombinant Human Factor IX
Purified from the Milk of a Transgenic Pig Sample Slope Slope Equation Activity Specific Ratio (~) Activity NPRP 0.094 1.0 y=0.094x-3.7 100% 250 U/mg hFIX 0.086 0.92 y=0.086x-3.6 92% 230 U/mg rhFIX 0.127 1.35 y=0.127x-3.4 135% 337 U/mg NPRP: normal plasma reference pool hFIX: human Factor IX standard rhFIX: Factor IX isolated from the transgenic pig WO 98/35689 PCT/US98/02b38 Although the foregoing refers to particular preferred embodiments, it will be understood that the present invention is not s~~ limited. It will occur to those of ordinary skill in t:he art that various modifications may be made to the disclosed embodiments and that such modifications are :intended to be within the scope of the present invention, which is defined by the following claims.
All pub7.ications and patent applications mentioned in this specification are indicative of the level of skill of those in the art to which the invention pertains. A.11 publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application were specifically and. individually indicated to be incorporated. by reference in its entirety.

Claims (49)

What Is Claimed Is:

1. A non-human transgenic mammal containing an exogenous DNA molecule stably integrated in its genome, wherein said exogenous DNA molecule comprises:
(a) 5' regulatory sequences of a mammary gland-specific gene including a promoter;
(b) a Factor IX-encoding DNA sequence that encodes a signal sequence, a Factor IX pro-sequence and a Factor IX sequence in a 5'to 3' direction, wherein said signal sequence is effective in directing the secretion of said Factor IX into the milk of said transgenic mammal and wherein said Factor IX sequence lacks at least a portion of the complete or the complete 5'-untranslated and 3'-untranslated regions of the Factor IX gene.; and (c) 3' regulatory sequences from a mammary gland-specific gene or 3' regulatory sequences active in a mammary gland;
wherein said 5' and said 3' regulatory sequences are operatively linked to said Factor IX-encoding DNA
sequence.

2. The non-human transgenic mammal of claim 1, wherein said promoter is selected from the group consisting of short whey acidic protein (WAP) promoter, long WAP promoter, short .alpha.-casein promoter, short .beta.-casein promoter, short kappa-casein promoter, long .alpha.-casein promoter, long .beta.-casein promoter, long kappa-casein promoter, .alpha.-lactalbumin promoter and .beta.-lactoglobulin promoter.

3. The non-human transgenic mammal of claim 2, wherein said short WAP promoter is the 2.6 kb EcoRI-KpnI
promoter of the mouse WAP gene.

4. The non-human transgenic mammal of claim 2, wherein said long WAP promoter is the 4.1 kb NotI-KpnI

promoter or the 4.2 kb Sau3A-KpnI promoter of the mouse WAP gene.

5. The non-human transgenic mammal of claim 1, wherein said Factor IX-encoding DNA molecule further comprises a 5'-untranslated region that is not the 5'-untranslated region of the Factor IX gene.

6. The non-human transgenic mammal of claim 5, wherein said 5'-untranslated region is the 5'-untranslated region of the mouse WAP gene.

7. The non-human transgenic mammal of claim 1, wherein said Factor IX-encoding DNA molecule further comprises a 3'-untranslated region that is not the 3'-untranslated region of the Factor IX gene.

8. The non-human transgenic mammal of claim 7, wherein said 3'-untranslated region is the 3'-untranslated region of the mouse WAP gene.

9. The non-human transgenic mammal of claim 1, wherein said Factor IX-encoding DNA molecule further comprises a 5'-untranslated region located 5' from said signal sequence DNA, and a 3'-untranslated region located 3' from said Factor IX sequence.

10. The non-human transgenic mammal of claim 1, wherein said Factor IX is biologically active human Factor IX.

11. The non-human transgenic mammal of claim 1, wherein said transgenic mammal is selected from the group consisting of mice, rats, rabbits, pigs, sheep, goats and cows.

12. The non-human transgenic mammal of claim 10, wherein said transgenic mammal secretes from about 100 to about 220 µG of active human Factor IX per milliliter milk.

13. The non-human transgenic mammal of claim 12, wherein said transgenic mammal secretes from about 100 to about 185 µg of active human Factor IX per milliliter milk.

14. The non-human transgenic mammal of claim 13, wherein said transgenic mammal secretes from about 100 to about 170 µg of active human Factor IX per milliliter milk.

15. The non-human transgenic mammal of claim 12, wherein said transgenic mammal secretes from about 135 to about 220 µg of active human Factor IX per milliliter milk.

16. The non-human transgenic mammal of claim 15, wherein said transgenic mammal secretes from about 145 to about 220 µg of active human Factor IX per milliliter milk.

17. The non-human transgenic mammal of claim 12, wherein said transgenic mammal is a pig.

18. The non-human transgenic mammal of claim 10, wherein said active human Factor IX, when purified from the milk of said transgenic mammal, has a specific activity that is as least about 5-200% greater than the specific activity of human Factor IX isolated from human plasma, as determined by an activated partial thromboplastin clotting time assay coagulation assay.

19. The non-human transgenic mammal of claim 18, wherein said active human Factor IX purified from the milk of said transgenic mammal has a specific activity that is at least about 10-100% greater than the specific activity of human Factor IX isolated from human plasma.

20. The non-human transgenic mammal of claim 18, wherein said active human Factor IX purified from the milk of said transgenic mammal has a specific activity that is at least about 15-50% greater than the specific activity of human Factor IX isolated from human plasma.

21. Tree non-human transgenic mammal of claim 18, wherein said active human Factor IX purified from the milk of said transgenic pig has a specific activity that is at least about 15-46% greater than the specific activity of human Factor IX isolated from human plasma.

22. The non-human transgenic mammal of claim 18, wherein said transgenic mammal is a pig.

23. A process for producing Factor IX, comprising:
(a) providing a non-human transgenic mammal having integrated into its genome an exogenous DNA
molecule, wherein said exogenous DNA molecule comprises:
(1) 5' regulatory sequences of a mammary gland-specific gene including a promoter;
(2) a Factor IX-encoding DNA sequence that encodes a signal sequence, a Factor IX pro-sequence and a Factor IX sequence in a 5'to 3' direction, wherein said signal sequence is effective in directing the secretion of said Factor IX into the milk of said transgenic mammal and wherein said Factor IX sequence lacks at least a portion of the complete or the complete 5' -untranslated and 3' -untranslated regions of the Factor IX gene.; and (3) 3' regulatory sequences from a mammary gland-specific gene or 3' regulatory sequences active in a mammary gland;

wherein said 5' and said 3' regulatory sequences are operatively linked to said Factor IX-encoding DNA
sequence;
(b) allowing said DNA sequences encoding said Factor IX
to be expressed and said Factor IX to be secreted into the milk of said transgenic mammal;
(c) collecting said milk from said mammal; and (d) isolating said Factor IX from said milk.

24. They process of claim 23, wherein said promoter is selected from the group consisting of short whey acidic protein (WAP) promoter, long WAP promoter, short .alpha.-casein promoter, short .beta.- casein promoter, short kappa-casein promoter, long .alpha.-casein promoter, long .beta.-casein promoter, long kappa-casein promoter, .alpha.-lactalbumin promoter and .beta.-lactoglobulin promoter.

25. The process of claim 24, wherein said short WAP
promoter is the 2.6 kb EcoRI-KpnI promoter of the mouse WAP gene.

26. The process of claim 24, wherein said long WAP
promoter is the 4.1 kb NotI-KpnI promoter or the 4.2 kb Sau3A-KpnI promoter of the mouse WAP gene.

27. The process of claim 23, wherein said Factor IX-encoding DNA molecule further comprises a 5'-untranslated region that is not the 5'-untranslated region of the Factor IX gene.

28. The process of claim 27, wherein said 5'-untranslated region is the 5'-untranslated region of the mouse WAP gene.

29. The process of claim 23, wherein said Factor IX-encoding DNA molecule further comprises a 3'-untranslated region that is not the 3'-untranslated region of the Factor IX gene.

30. The process of claim 29, wherein said 3'-untranslated region is the 3'-untranslated region of the mouse WAP gene.

31. The process of claim 23, wherein said Factor IX-encoding DNA molecule further comprises a 5'-untranslated region located 5' from said signal sequence DNA, and a 3'-untranslated region located 3' from said Factor IX
sequence.

32. The process of claim 23, wherein said Factor IX
is biologically active human Factor IX.

33. The process of claim 23, wherein said transgenic mammal is selected from the group consisting of mice, rats, rabbits, pigs, sheep, goats and cows.

34. The process of claim 32, wherein said transgenic mammal secretes from about 100 to about 220 µg of active human Factor IX per milliliter milk.

35. The process of claim 34, wherein said transgenic mammal secretes from about 100 to about 185 µg of active human Factor IX per milliliter milk.

36. The process of claim 35, wherein said transgenic mammal secretes from about 100 to about 170 µg of active human Factor IX per milliliter milk.

37. The process of claim 34, wherein said transgenic mammal secretes from about 135 to about 220 µg of active human Factor IX per milliliter milk.

38. The process of claim 37, wherein said transgenic mammal secretes from about 145 to about 220 µg of active human Factor IX per milliliter milk.

39. The process of claim 34, wherein said transgenic mammal is a pig.

40. The process of claim 32, wherein said active human Factor IX, when purified from the milk of said transgenic mammal, has a specific activity that is at least about 5-200% greater than the specific activity of human Factor IX isolated from human plasma, as determined by an activated partial thromboplastin clotting time assay coagulation assay.

41. The process of claim 40, wherein said active human Factor IX purified from the milk of said transgenic mammal has a specific activity that is at least about 10-100% greater than the specific activity of human Factor-IX
isolated from human plasma.

42. The process of claim 41, wherein said active human Factor IX purified from the milk of said transgenic mammal has a specific activity that is at least about 15-50% greater than the specific activity of human Factor IX
isolated from human plasma.

43. The process of claim 42, wherein said active human Factor IX purified from the milk of said transgenic pig has a specific activity that is at least about 15-46%
greater than the specific activity of human Factor IX
isolated from human plasma.

44. The process of claim 40, wherein said transgenic mammal is a pig.

45. A method of treating a patient having hemophilia B comprising administering to said patients a hemophilia B symptom preventing or ameliorating amount of Factor IX
produced by the transgenic non-human mammal of claim 1 and a pharmaceutically acceptable carrier.

46. Mammary gland cells obtained from the non-human transgenic mammal of claim 1, wherein said cells produce said Factor IX.

47. An in vitro culture of the mammary gland cells of claim 46.

48. A method of producing Factor IX, said method comprising the step of isolating said Factor IX from the cultured mammary gland cells of claim 47.

49. A method of treating a patient having hemophilia B comprising transplanting the mammary gland cells of claim 46 into said patient, wherein said Factor IX
produced by said cells ameliorates or prevents the symptoms of hemophilia B in said patient.