CA2277564A1 - Inhibiting agent against platelet-derived growth factor increase and arteriosclerosis preventive and therapeutic agent - Google Patents
Inhibiting agent against platelet-derived growth factor increase and arteriosclerosis preventive and therapeutic agent Download PDFInfo
- Publication number
- CA2277564A1 CA2277564A1 CA 2277564 CA2277564A CA2277564A1 CA 2277564 A1 CA2277564 A1 CA 2277564A1 CA 2277564 CA2277564 CA 2277564 CA 2277564 A CA2277564 A CA 2277564A CA 2277564 A1 CA2277564 A1 CA 2277564A1
- Authority
- CA
- Canada
- Prior art keywords
- inhibiting
- growth factor
- derived growth
- transplantation
- increase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
- 0 CC(C*)c1c(*)c(CC[C@]([C@]2(C)CC3C)(C(C*4)=C3C4=O)N)c2cc1 Chemical compound CC(C*)c1c(*)c(CC[C@]([C@]2(C)CC3C)(C(C*4)=C3C4=O)N)c2cc1 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/365—Lactones
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Disclosed are an inhibiting agent against platelet-derived growth factor increase, an arteriosclerosis preventive and therapeutic agent, and an arterial intimal thickening inhibiting agent, comprising as an active ingredient a diterpene selected from a compound represented by formula (I), (see image I) a compound represented by formula (II), (see image II) wherein X1, X2 and X3 independently represent a hydroxyl group or a hydrogen atom, and derivatives thereof, utilizing an ability of inhibiting an increase of platelet-derived growth factor as an index.
Description
INHIBITING AGENT AGAINST PLATELET-DERIVED GROWTH FACTOR
INCREASE AND ARTERIOSCLEROSIS PREVENTIVE AND THERAPEUTIC AGENT
1. Field of the Invention The present invention relates to a novel inhibiting agent against platelet-derived growth factor increase, to an arteriosclerosis preventive and therapeutic agent, and to an arterial intimal thickening inhibiting agent, and further to a drug having a potentiality to suppress chronic immunological rejection in heart, lung, liver, etc. transplantation. More particularly, the present invention relates to a drug comprising diterpenes as an active ingredient which efficiently inhibits an increase in platelet-derived growth factor (hereafter, abbreviated as PDGF) after transplantation of an organ, which is effective for the prevention and therapy of arteriosclerosis after transplantation of an organ and for the suppression of arterial intimal thickening, which has potential preventive and therapeutic effects on occlusive bronchitis upon lung transplantation or cholangiolitis upon liver transplantation, or which has an effect of alleviating arteriosclerosis finding when administered against already generated coronary arterial lesion.
INCREASE AND ARTERIOSCLEROSIS PREVENTIVE AND THERAPEUTIC AGENT
1. Field of the Invention The present invention relates to a novel inhibiting agent against platelet-derived growth factor increase, to an arteriosclerosis preventive and therapeutic agent, and to an arterial intimal thickening inhibiting agent, and further to a drug having a potentiality to suppress chronic immunological rejection in heart, lung, liver, etc. transplantation. More particularly, the present invention relates to a drug comprising diterpenes as an active ingredient which efficiently inhibits an increase in platelet-derived growth factor (hereafter, abbreviated as PDGF) after transplantation of an organ, which is effective for the prevention and therapy of arteriosclerosis after transplantation of an organ and for the suppression of arterial intimal thickening, which has potential preventive and therapeutic effects on occlusive bronchitis upon lung transplantation or cholangiolitis upon liver transplantation, or which has an effect of alleviating arteriosclerosis finding when administered against already generated coronary arterial lesion.
2. Description of the Related Art With recent progress of medical technology, transplantation of organs such as heart transplantation (about 30,000 cases or more), kidney transplantation, and lung transplantation has been performed worldwide. In the transplantation of organs, use of immunosuppressive agents is essentially required in order to suppress immunological rejection upon the transplantation of organs.
When transplanting organs, azathioprine and prednisolone have heretofore been used in combination as the immunosuppressive agent, which has been replaced by cyclosporine, a recently developed excellent immunosuppressive agent. Most recently, tacrolimus has been developed and is rapidly becoming in great demand.
Thus, emergence of excellent immunosuppressive agents has greatly improved survival rate in the field of heart transplantation such as 1-year survival rate of about 82~ and 5-year survival rate of about 70o as currently experienced.
However, even when these new immunosuppressive agents are used, there frequently occur side effects, for example, arteriosclerosis, coronary artery stenosis, occlusive cholangiolitis, occlusive bronchitis, etc. after the transplantation of organs. In particular, coronary arterial diseases such as coronary arterial intimal thickening after heart transplantation occurs as late complication after transplantation in about 10~ patients a year, more specifically 7 to 15~/patient/year.
Therefore, in the field of transplantation of organs, there has been desired development of a therapeutic method which not only exhibits an immunosuppressive effect but also suppresses long-term side effects after the surgery. However, no effective therapeutic method has been found yet.
Researches for an effective therapeutic method for treating coronary artery lesion after heart transplantation have been made worldwide and one of such trials includes study aiming at PDGF. The PDGF(Am. J. Cardiol. 1996; 77:1210-1215), which is one of the cell growth factors that platelets produce, accelerates growth of smooth muscle cells at a damaged vessel wall and is considered to cause vessel thickening. In particular, recent reports suggest that it is the major cause of arterial intimal thickening after transplantation. Trials aimed at PDGF are to suppress coronary arterial intimal thickening particularly after heart transplantation by inhibiting an increase in PDGF, thereby preventing and treating coronary artery lesions after heart transplantation.
By the way, it is well known that in China, there has been used Tripterygium wilfordii, a galenica, for treating chronic rheumatoid arthritis, etc. Plants from which the Tripterygium wilfordii, galenica, is derived include Tripterygium wilfordii Hook, f., T. hypoglaucum [Level.]
Hutch, T. regeli Sprague et Tak., and T. forretii Dials. These are vine plants belonging to the family Celastraceae of 2 to 3 m in height.
Tripterygium wilfordii is known to be useful in the form of an ethanol extract in inhibiting immunological rejection at the time of heart transplantation~(International Publication No. W095/15174), and as the components of Tripterygium wilfordii, there are known diterpenes such as triptolide, tripdiolide and triptophenolide, nortriterpenoids such as demethylzelasteral (Japanese Patent Application Laid-open No.
Hei 9-100294), etc.
An object of the present invention is to suppress an increase in PDGF in order to suppress generation of various side effects after transplantation of organs and provide a novel drug having preventive and therapeutic effects against various side effects and a novel drug which is effective for the prevention and therapy of arteriosclerosis after transplantation of organs.
The present inventors have aimed at the above-described pharmacological effects of Tripterygium wilfordii and previously found an inhibiting agent against PDGF increase and an arteriosclerosis inhibiting agent, both comprising Tripterygium wilfordii as the active ingredient and filed a patent application (Japanese Patent Application Laid-open No.
Hei 11-92393). The drugs containing Tripterygium wilfordii as the active ingredient have preventive and therapeutic effects on arteriosclerosis, coronary artery stenosis, occlusive bronchitis, occlusive cholangiolitis which are chronic immunological rejection after transplantation.
To achieve the above-described object, the present inventors have made a further intensive study aiming at diterpenes which are contained in Tripterygium wilfordii and as a result they have found that triptolide, triptophenolide and derivatives thereof are effective as an inhibiting agent against PDGF increase, an arteriosclerosis preventive and therapeutic agent, and an arterial intimal thickening inhibiting agent. The present invention has been completed based on these findings.
That is, the present invention provides:
(1) A platelet-derived growth factor (PDGF) increase inhibiting agent comprising as an active ingredient a diterpene selected from a compound represented by formula (I), ~3 a compound represented by formula (II), x3 c~~) wherein X1, Xz and X3 independently represent a hydroxyl group or a hydrogen atom, and derivatives thereof, utilizing an ability of inhibiting an increase of platelet-derived growth factor as an index;
(2) An arteriosclerosis preventive and therapeutic agent comprising the above-described diterpene as an active ingredient; and (3) An arterial intimal thickening inhibiting agent comprising the above-described diterpene as an active ingredient.
The drugs comprising the compound of the present invention as an active ingredient has an excellent immunosuppressive effect and also have good PDGF increase inhibiting effect, arteriosclerosis preventive and therapeutic effect, and arterial intimal thickening inhibiting effect, so that when administered at the time of transplantation of organs, they serve to effectively suppress acute and chronic immunological rejection and to effectively suppress side effects after transplantation of organs, for example, generation of chronic immunological rejection such as arteriosclerosis, coronary artery stenosis, occlusive cholangiolitis, and occlusive bronchitis, in particular, generation of coronary artery lesions such as coronary arterial intimal thickening after heart transplantation.
BRTEF F~ RTPTTp~T ~F THF TNVFNTTnTT
In the accompanying drawings:
Fig. 1 is a micrograph showing the morphology of an organism, illustrating the state of coronary artery of the grafted heart of a rat administered with cyclosporine for 60 days after heart transplantation in Test Example 1;
Fig. 2 is a micrograph showing the morphology of an organism, illustrating the state of coronary artery of the grafted heart of a rat administered with triptolide for 60 days after heart transplantation in Test Example 1;
Fig. 3 is a micrograph of tissue sections of liver and kidney of a rat administered with triptolide for 60 days after heart transplantation in Test Example l; and Fig. 4 is a graph obtained by electrophoresis, illustrating expression grade of PDGF in heart of a rat administered with cyclosporine for 60 days after heart transplantation, a rat administered with triptolide for 60 days after heart transplantation, and a rat that is not subjected to transplantation treatment.
DFTATT, ,D DF~(~RTPTTn r p H TN'VF tmrnrr In the present invention, the diterpene used as an active ingredient in various drugs is not limited particularly on the origin. It may be derived from natural substances or synthetic products. It can be readily extracted from root, leaves, flowers, etc. of plants belonging to the family Celastraceae, such as Tripterygium wilfordii Hook, f., T.
hypoglaucum [Level.] Hutch, T, regeli Sprague et Tak., and T.
forretii Dials.
Examples of the triptolide derivatives used in the present invention include tripdiolide, triptonide, tripchlorolide, and triptolide esters (U. S. Patent No.
When transplanting organs, azathioprine and prednisolone have heretofore been used in combination as the immunosuppressive agent, which has been replaced by cyclosporine, a recently developed excellent immunosuppressive agent. Most recently, tacrolimus has been developed and is rapidly becoming in great demand.
Thus, emergence of excellent immunosuppressive agents has greatly improved survival rate in the field of heart transplantation such as 1-year survival rate of about 82~ and 5-year survival rate of about 70o as currently experienced.
However, even when these new immunosuppressive agents are used, there frequently occur side effects, for example, arteriosclerosis, coronary artery stenosis, occlusive cholangiolitis, occlusive bronchitis, etc. after the transplantation of organs. In particular, coronary arterial diseases such as coronary arterial intimal thickening after heart transplantation occurs as late complication after transplantation in about 10~ patients a year, more specifically 7 to 15~/patient/year.
Therefore, in the field of transplantation of organs, there has been desired development of a therapeutic method which not only exhibits an immunosuppressive effect but also suppresses long-term side effects after the surgery. However, no effective therapeutic method has been found yet.
Researches for an effective therapeutic method for treating coronary artery lesion after heart transplantation have been made worldwide and one of such trials includes study aiming at PDGF. The PDGF(Am. J. Cardiol. 1996; 77:1210-1215), which is one of the cell growth factors that platelets produce, accelerates growth of smooth muscle cells at a damaged vessel wall and is considered to cause vessel thickening. In particular, recent reports suggest that it is the major cause of arterial intimal thickening after transplantation. Trials aimed at PDGF are to suppress coronary arterial intimal thickening particularly after heart transplantation by inhibiting an increase in PDGF, thereby preventing and treating coronary artery lesions after heart transplantation.
By the way, it is well known that in China, there has been used Tripterygium wilfordii, a galenica, for treating chronic rheumatoid arthritis, etc. Plants from which the Tripterygium wilfordii, galenica, is derived include Tripterygium wilfordii Hook, f., T. hypoglaucum [Level.]
Hutch, T. regeli Sprague et Tak., and T. forretii Dials. These are vine plants belonging to the family Celastraceae of 2 to 3 m in height.
Tripterygium wilfordii is known to be useful in the form of an ethanol extract in inhibiting immunological rejection at the time of heart transplantation~(International Publication No. W095/15174), and as the components of Tripterygium wilfordii, there are known diterpenes such as triptolide, tripdiolide and triptophenolide, nortriterpenoids such as demethylzelasteral (Japanese Patent Application Laid-open No.
Hei 9-100294), etc.
An object of the present invention is to suppress an increase in PDGF in order to suppress generation of various side effects after transplantation of organs and provide a novel drug having preventive and therapeutic effects against various side effects and a novel drug which is effective for the prevention and therapy of arteriosclerosis after transplantation of organs.
The present inventors have aimed at the above-described pharmacological effects of Tripterygium wilfordii and previously found an inhibiting agent against PDGF increase and an arteriosclerosis inhibiting agent, both comprising Tripterygium wilfordii as the active ingredient and filed a patent application (Japanese Patent Application Laid-open No.
Hei 11-92393). The drugs containing Tripterygium wilfordii as the active ingredient have preventive and therapeutic effects on arteriosclerosis, coronary artery stenosis, occlusive bronchitis, occlusive cholangiolitis which are chronic immunological rejection after transplantation.
To achieve the above-described object, the present inventors have made a further intensive study aiming at diterpenes which are contained in Tripterygium wilfordii and as a result they have found that triptolide, triptophenolide and derivatives thereof are effective as an inhibiting agent against PDGF increase, an arteriosclerosis preventive and therapeutic agent, and an arterial intimal thickening inhibiting agent. The present invention has been completed based on these findings.
That is, the present invention provides:
(1) A platelet-derived growth factor (PDGF) increase inhibiting agent comprising as an active ingredient a diterpene selected from a compound represented by formula (I), ~3 a compound represented by formula (II), x3 c~~) wherein X1, Xz and X3 independently represent a hydroxyl group or a hydrogen atom, and derivatives thereof, utilizing an ability of inhibiting an increase of platelet-derived growth factor as an index;
(2) An arteriosclerosis preventive and therapeutic agent comprising the above-described diterpene as an active ingredient; and (3) An arterial intimal thickening inhibiting agent comprising the above-described diterpene as an active ingredient.
The drugs comprising the compound of the present invention as an active ingredient has an excellent immunosuppressive effect and also have good PDGF increase inhibiting effect, arteriosclerosis preventive and therapeutic effect, and arterial intimal thickening inhibiting effect, so that when administered at the time of transplantation of organs, they serve to effectively suppress acute and chronic immunological rejection and to effectively suppress side effects after transplantation of organs, for example, generation of chronic immunological rejection such as arteriosclerosis, coronary artery stenosis, occlusive cholangiolitis, and occlusive bronchitis, in particular, generation of coronary artery lesions such as coronary arterial intimal thickening after heart transplantation.
BRTEF F~ RTPTTp~T ~F THF TNVFNTTnTT
In the accompanying drawings:
Fig. 1 is a micrograph showing the morphology of an organism, illustrating the state of coronary artery of the grafted heart of a rat administered with cyclosporine for 60 days after heart transplantation in Test Example 1;
Fig. 2 is a micrograph showing the morphology of an organism, illustrating the state of coronary artery of the grafted heart of a rat administered with triptolide for 60 days after heart transplantation in Test Example 1;
Fig. 3 is a micrograph of tissue sections of liver and kidney of a rat administered with triptolide for 60 days after heart transplantation in Test Example l; and Fig. 4 is a graph obtained by electrophoresis, illustrating expression grade of PDGF in heart of a rat administered with cyclosporine for 60 days after heart transplantation, a rat administered with triptolide for 60 days after heart transplantation, and a rat that is not subjected to transplantation treatment.
DFTATT, ,D DF~(~RTPTTn r p H TN'VF tmrnrr In the present invention, the diterpene used as an active ingredient in various drugs is not limited particularly on the origin. It may be derived from natural substances or synthetic products. It can be readily extracted from root, leaves, flowers, etc. of plants belonging to the family Celastraceae, such as Tripterygium wilfordii Hook, f., T.
hypoglaucum [Level.] Hutch, T, regeli Sprague et Tak., and T.
forretii Dials.
Examples of the triptolide derivatives used in the present invention include tripdiolide, triptonide, tripchlorolide, and triptolide esters (U. S. Patent No.
5,663,335). These are also known compounds and can be prepared in a manner similar to the method of producing triptolide. Derivatives of triptophenolide include, for example, triptonolide, which is also a known compound and can be prepared in a manner similar to the method of producing triptophenolide. The derivatives of triptophenolide include salts, esters, ordinary protecting groups for hydroxyl groups, isomers, solvated products, and hydrates. These are also selected utilizing a PDGF increase inhibiting ability as an index. "Utilizing a PDGF increase inhibiting ability as an index" means that as indicated in Test Example 2 described hereinbelow, a system in which PDGF is increased is established by administration of an immunosuppressive agent after transplantation of organs, and various candidate compounds are tested for their PDGF increase inhibiting effect with the system being as a control, utilizing a PCR reaction (or cell free synthesis system for protein may also be used).
The drugs comprising the compound of the present invention as an active ingredient has an excellent immunosuppressive effect and also have good PDGF increase inhibiting effect, arteriosclerosis preventive and therapeutic effect, and arterial intimal thickening inhibiting effect, so that when administered at the time of transplantation of organs, they serve to effectively suppress acute and chronic immunological rejection and to effectively suppress side effects after transplantation of organs, for example, generation of chronic immunological rejection such as arteriosclerosis, coronary artery stenosis, occlusive cholangiolitis, and occlusive bronchitis, in particular, generation of coronary artery lesions such as coronary arterial intimal thickening after heart transplantation. Also, it is possible that they will be effective for the prevention and therapy of general arteriosclerosis. The immunosuppresive effect is attributable to the suppression of interleukin-2 (IL-2).
The present inventors have confirmed that when triptolide was administered at a chronic dosage of 10 to 100,CLg/kg/day for 60 days at the time of heart transplantation, there was observed no morphological abnormality in the tissues of liver and kidney.
Next, description will be made on an example of a preferred method for obtaining the triptolide by extraction from plants.
First, at least one selected from root, bark, twig, leaf, flower, etc. of plants belonging to the family Celastraceae, such as Tripterygium wilfordii Hook, f., T. hypoglaucum [Level.] Hutch, T. regeli Sprague et Tak., and T. forretii Dials was sufficiently dried and then subjected to pretreatment such as cutting into pieces and pulverization to obtain powder.
Then, to the powder is added a suitable extraction solvent, for example, acetone, to perform extraction treatment. The extraction treatment can be carried out at room temperature but if desired, it may be performed with properly heating. In this case, in order to efficiently perform the solvent extraction, it is advantageous to stir the mixture suitably so that the extraction solvent penetrates into inside sufficiently.
After completion of the extraction treatment, solid-liquid separation is performed by using conventional means such as filtration, centrifugation, and decantation. The resulting extract is concentrated under reduced pressure, if desired, and water is added thereto and the mixture is further concentrated under reduced pressure to distill off acetone, followed by extraction with hexane and ether in order.
Next, the ether-extracted fraction is subjected to column chromatography and eluted with a suitable solvent to collect a triptolide fraction. The triptolide can be identified, for example, by TLC analysis, LC/MS analysis, and NMR analysis.
The hexane-extracted fraction is subjected to column chromatography and eluted with a suitable solvent, whereby triptophenolide can be collected as a triptophenolide fraction. The triptophenolide can be identified, for example, by TLC analysis, LC/MS analysis, and NMR analysis.
The drugs of the present invention are not particularly limited on the form but may be administered orally or parenterally. The form of administration includes, for example, oral administration forms such as tablets, powder, capsules, and syrups; parenteral administration forms such as liquid injections, for example, solutions, emulsions, suspensions, and fat emulsions, external preparations such as suppositories, inhalations, liniments, and aerosols, etc.
The preparations of the above-described administration forms can be prepared by conventional means by blending the compound as an active ingredient with pharmaceutically necessary additives such as excipients, binders, disintegrants, lubricants, diluents, and isotonic agents.
Further, if desired, there may be added additives such as flavors, colorants, perfumes, microbicides, antiseptics, and stabilizers.
The amount and time of administration of the drugs of the present invention may vary depending on symptom, age, body weight, and administration form but a daily amount of administration for adult is usually on the order of 1 ng/kg to 100 mg/kg body weight, preferably on the order of 0.01 to 10 mg/kg body weight, and more preferably on the order of 0.01 to 0.1 mg/kg body weight.
EXAMPLES
Next, the present invention will be described in more detail by examples and test examples. However, the present invention is by no means limited thereto.
Production Example Tripterygium wilfordii Essence tablets (1500 tablets) were pulverized and extracted with acetone. The obtained extract was concentrated under reduced pressure and then, further concentrated after addition of water to distill off the acetone.
The concentrate was extracted with hexane and ether in order and the obtained extracts were each concentrated to dryness under reduced pressure.
(1) Ether-extracted fraction (4.91 g) was fractionated by silica gel column chromatography (hexane . ethyl acetate = 1:1 by volume). The fractions that showed red to red purple color with Kedde reagent (a mixture of 5~ by weight ethanol solution of 3,5-dinitrobenzoic acid and aqueous 2N sodium hydroxide solution, mixed upon use) were recovered by TLC and purified by reverse phase HPLC (ODS system, manufactured by Waters, Co., solvent: 30$ by weight acetonitrile/water mixed solvent, ml/minute) to obtain 17.7 mg of a single substance.
This was identified as triptolide (CZOH29O6, molecular weight 360) as a result of Rf value, 1H-NMR, and LC/MS analysis (m/z 360) .
(2) Hexane-extracted fraction (850 mg) was fractionated by silica gel column chromatography (hexane . ethyl acetate = 1:1 by volume) and the fractions that were Kedde reagent positive were recovered and then purified by reverse phase HPLC (ODS
system, manufactured by Waters, Co., solvent: 60$ by weight acetonitrile/water mixed solvent, 8.5 ml/minute) to obtain 13.7 mg of a single substance.
This was identified as triptophenolide (CzoHz903, molecular weight 312) as a result of Rf value, iH-NMR, and LC/MS analysis (m/z 312).
[Reference: "J. Pharmacol. Exp. Ther." VoT. 272, p.p. 1305-1312 (1995).]
The triptolide and triptophenolide used in the following preparation examples and test examples were each obtained in Production Examples.
Preparation Example 1 Powder Triptolide 10 mg Crystalline cellulose 100 g were uniformly mixed and 1 g portion was wrapped to prepare a powder.
Preparation Example 2 Capsule Triptolide 10 mg Lactose g0 g Magnesium stearate 10 g were uniformly mixed and the mixed powder was filled in a hard gelatin capsule in an amount of 200 mg each to prepare a capsule.
Production Example 3Powder Triptophenolide 10 mg Crystalline cellulose 100 g were uniformly mixed and 1 g portion was wrapped to prepare a powder.
Preparation Example 4 Capsule Triptophenolide 10 mg Lactose 90 g Magnesium stearate 10 g were uniformly mixed and the mixed powder was filled in a hard gelatin capsule in an amount of 200 mg each to prepare a capsule.
Example 1 Coronary artery intimal thickening inhibiting effect of triptolide in graft heart (1) Subject and Method Wister King rat and Lewis rat weighing 200 to 260 g were used as donors and recipients, respectively. Intra-abdominal heterotropic heart transplantation was performed. Triptolide was orally administered every day to rats after heart transplantation at a dose of 5 mg/kg/day (inventive drug administered group: n=7). As a control, cyclosporine A well known as an immunosuppressive agent was intraperitoneally every day similarly at a dosage of 10 mg/kg/day (cyclosporine administered group: n=7). For both groups, the transplanted hearts were harvested on posttransplantation day 60. All the coronary arteries of 50,um or more in diameter were observed and the incidence and degree of sclerosis-like disease were calculated and evaluated. The coronary arteries of harvested hearts were fixed in 10~ formalin and the specimens were embedded in paraffin and were sectioned. The obtained specimens were stained with hematoxylin and eosin to assess the severity of rejection and with Elastica Masson stain to assess coronary arterial intimal thickening using an optical microscope.
Also, for the triptolide-administered group, liver and kidney were harvested on posttransplantation day 60 and the tissue sections were observed using an optical microscope to assess side effects.
(2) Evaluation and Results Using the evaluation method of Lurie et al., the rejection grades (scales 0 to 3, with greater number indicating stronger rejection) and coronary artery intimal thickening grade (scales 0 to 4, with greater number indicating advanced thickening) were evaluated.
The coronary arteries which consisted of 212 vessels (coronary artery) in the triptolide-administered group and 207 vessels in the cyclosporine-administered group were observed.
The coronary arterial intimal thickening grade was calculated by the following formula (III).
Arterial intimal thickening grade _ ( 1 X N1+2 X NZ+ 3 X N3+ 4 X N9 ) / ( No+N1+N2+N3+N4 ) ( I I I ) wherein in N~, n indicates each grade and Nn represents the number of vessels of n-grade).
The results are shown in Table 1.
Table 1 Triptolide- Cyclosporine admin_is_tered group administered group Rejection grade 1.1 0.3 1.1 0.5 Incidence of 34.0 3 ** 69.1 9 diseased vessel Arterial intimal 0.890.3 ** 1.720.28 thickening grade ** p<0.01 (for cyclosporine-administered group) Further, for the both groups, the states of coronary arteries are shown in Fig. 1 (cyclosporine-administered group) and Fig. 2 (triptolide-administered group).
As will be apparent from Table 1 and Figs. 1 and 2, triptolide has the same degree of rejection inhibiting effect, i.e., immunosuppressive effect, as cyclosporine in the transplanted heart and at the same time excellent coronary arterial intimal thickening inhibiting effect. Further, as for the incidence of diseased vessels, the inventive group administered with triptolide showed significantly lower values than those of cyclosporine-administered group. Therefore, it was suggested that the former has an effect on diseases other than arterial intimal thickening.
Also, observation of the tissue sections of liver and kidney of rats of triptolide-administered group using an optical microscope resulted in that there was no abnormality.
Fig. 3 is a micrograph of tissue sections of (a) liver and (b) kidney of rats administered with triptolide.
Test Example 2 PDGF Inhibitory effect of triptolide in transplanted heart.
(1) Subject and Method In the same manner as in Test Example 1, the transplanted heart was harvested from the inventive administration group (n=7) administered with triptolide and cyclosporine-administered group (n=7) administered with cyclosporine after heart transplantation on posttransplantation day 60. Further, heart was harvested from a rat which was not subjected to heart transplantation (non-treated group: n=6).
The harvested hearts were quickly frozen in liquid nitrogen and then stored at -80°C until RNA isolation. RNAs of the hearts were isolated and purified according to the protocol of RNAzol (Biotex Laboratories, Houston, TX).
Using the total RNA of each heart as a template and oligo dT and MMLV reverse transcriptase, cDNA was synthesized.
Using the following PDGF primer, PCR amplification of the cDNA
was performed in a PCR reaction mixture (10 mM Tris-HC1 (pH
8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTP, 2U Taq polymerase).
PDGF-A chain primer;
5'-primer; 5'GACCGCGGTCTCGAGTGCTACAGTACTGC3' 3'-primer; 5' GACCGCGGCCTCGCCTCCCTGCCGAGCTTCC3~
PCR reaction was performed using a DNA Thermal Cycler for 35 cycles, including denaturing at 94°C for 45 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 90 seconds each cycle.
The resulting PCR products were subjected to Agarose gel electrophoresis by a conventional method and stained with ethidium bromide to examine the degree of expression of PDGF-A. The results are diagrammed in Fig. 4. In Fig. 4, A
represents data of a non-treated rat which was not subjected to transplantation treatment, B represents data of a rat administered with triptolide, and C represents data of a rat administered with cyclosporine.
As will be apparent from Fig. 4, native heart (not subjected to heart transplantation treatment) showed no expression of PDGF-A. On the other hand, in the transplanted hearts, expression of PDGF-A was observed but an increase in expression of PDGF-A in the triptolide-administered group was significantly inhibited as compared with cyclosporine-administered group, control. These results demonstrate that triptolide has an effect of significantly inhibiting an increase in expression of PDGF in transplanted hearts.
Further, in order to learn the state of expression of PDGF in each heart, the mRNA of each heart was used for Northern blot analysis by a conventicnal manner and as a result, similar results to the above were obtained.
The drugs comprising the compound of the present invention as an active ingredient has an excellent immunosuppressive effect and also have good PDGF increase inhibiting effect, arteriosclerosis preventive and therapeutic effect, and arterial intimal thickening inhibiting effect, so that when administered at the time of transplantation of organs, they serve to effectively suppress acute and chronic immunological rejection and to effectively suppress side effects after transplantation of organs, for example, generation of chronic immunological rejection such as arteriosclerosis, coronary artery stenosis, occlusive cholangiolitis, and occlusive bronchitis, in particular, generation of coronary artery lesions such as coronary arterial intimal thickening after heart transplantation. Also, it is possible that they will be effective for the prevention and therapy of general arteriosclerosis. The immunosuppresive effect is attributable to the suppression of interleukin-2 (IL-2).
The present inventors have confirmed that when triptolide was administered at a chronic dosage of 10 to 100,CLg/kg/day for 60 days at the time of heart transplantation, there was observed no morphological abnormality in the tissues of liver and kidney.
Next, description will be made on an example of a preferred method for obtaining the triptolide by extraction from plants.
First, at least one selected from root, bark, twig, leaf, flower, etc. of plants belonging to the family Celastraceae, such as Tripterygium wilfordii Hook, f., T. hypoglaucum [Level.] Hutch, T. regeli Sprague et Tak., and T. forretii Dials was sufficiently dried and then subjected to pretreatment such as cutting into pieces and pulverization to obtain powder.
Then, to the powder is added a suitable extraction solvent, for example, acetone, to perform extraction treatment. The extraction treatment can be carried out at room temperature but if desired, it may be performed with properly heating. In this case, in order to efficiently perform the solvent extraction, it is advantageous to stir the mixture suitably so that the extraction solvent penetrates into inside sufficiently.
After completion of the extraction treatment, solid-liquid separation is performed by using conventional means such as filtration, centrifugation, and decantation. The resulting extract is concentrated under reduced pressure, if desired, and water is added thereto and the mixture is further concentrated under reduced pressure to distill off acetone, followed by extraction with hexane and ether in order.
Next, the ether-extracted fraction is subjected to column chromatography and eluted with a suitable solvent to collect a triptolide fraction. The triptolide can be identified, for example, by TLC analysis, LC/MS analysis, and NMR analysis.
The hexane-extracted fraction is subjected to column chromatography and eluted with a suitable solvent, whereby triptophenolide can be collected as a triptophenolide fraction. The triptophenolide can be identified, for example, by TLC analysis, LC/MS analysis, and NMR analysis.
The drugs of the present invention are not particularly limited on the form but may be administered orally or parenterally. The form of administration includes, for example, oral administration forms such as tablets, powder, capsules, and syrups; parenteral administration forms such as liquid injections, for example, solutions, emulsions, suspensions, and fat emulsions, external preparations such as suppositories, inhalations, liniments, and aerosols, etc.
The preparations of the above-described administration forms can be prepared by conventional means by blending the compound as an active ingredient with pharmaceutically necessary additives such as excipients, binders, disintegrants, lubricants, diluents, and isotonic agents.
Further, if desired, there may be added additives such as flavors, colorants, perfumes, microbicides, antiseptics, and stabilizers.
The amount and time of administration of the drugs of the present invention may vary depending on symptom, age, body weight, and administration form but a daily amount of administration for adult is usually on the order of 1 ng/kg to 100 mg/kg body weight, preferably on the order of 0.01 to 10 mg/kg body weight, and more preferably on the order of 0.01 to 0.1 mg/kg body weight.
EXAMPLES
Next, the present invention will be described in more detail by examples and test examples. However, the present invention is by no means limited thereto.
Production Example Tripterygium wilfordii Essence tablets (1500 tablets) were pulverized and extracted with acetone. The obtained extract was concentrated under reduced pressure and then, further concentrated after addition of water to distill off the acetone.
The concentrate was extracted with hexane and ether in order and the obtained extracts were each concentrated to dryness under reduced pressure.
(1) Ether-extracted fraction (4.91 g) was fractionated by silica gel column chromatography (hexane . ethyl acetate = 1:1 by volume). The fractions that showed red to red purple color with Kedde reagent (a mixture of 5~ by weight ethanol solution of 3,5-dinitrobenzoic acid and aqueous 2N sodium hydroxide solution, mixed upon use) were recovered by TLC and purified by reverse phase HPLC (ODS system, manufactured by Waters, Co., solvent: 30$ by weight acetonitrile/water mixed solvent, ml/minute) to obtain 17.7 mg of a single substance.
This was identified as triptolide (CZOH29O6, molecular weight 360) as a result of Rf value, 1H-NMR, and LC/MS analysis (m/z 360) .
(2) Hexane-extracted fraction (850 mg) was fractionated by silica gel column chromatography (hexane . ethyl acetate = 1:1 by volume) and the fractions that were Kedde reagent positive were recovered and then purified by reverse phase HPLC (ODS
system, manufactured by Waters, Co., solvent: 60$ by weight acetonitrile/water mixed solvent, 8.5 ml/minute) to obtain 13.7 mg of a single substance.
This was identified as triptophenolide (CzoHz903, molecular weight 312) as a result of Rf value, iH-NMR, and LC/MS analysis (m/z 312).
[Reference: "J. Pharmacol. Exp. Ther." VoT. 272, p.p. 1305-1312 (1995).]
The triptolide and triptophenolide used in the following preparation examples and test examples were each obtained in Production Examples.
Preparation Example 1 Powder Triptolide 10 mg Crystalline cellulose 100 g were uniformly mixed and 1 g portion was wrapped to prepare a powder.
Preparation Example 2 Capsule Triptolide 10 mg Lactose g0 g Magnesium stearate 10 g were uniformly mixed and the mixed powder was filled in a hard gelatin capsule in an amount of 200 mg each to prepare a capsule.
Production Example 3Powder Triptophenolide 10 mg Crystalline cellulose 100 g were uniformly mixed and 1 g portion was wrapped to prepare a powder.
Preparation Example 4 Capsule Triptophenolide 10 mg Lactose 90 g Magnesium stearate 10 g were uniformly mixed and the mixed powder was filled in a hard gelatin capsule in an amount of 200 mg each to prepare a capsule.
Example 1 Coronary artery intimal thickening inhibiting effect of triptolide in graft heart (1) Subject and Method Wister King rat and Lewis rat weighing 200 to 260 g were used as donors and recipients, respectively. Intra-abdominal heterotropic heart transplantation was performed. Triptolide was orally administered every day to rats after heart transplantation at a dose of 5 mg/kg/day (inventive drug administered group: n=7). As a control, cyclosporine A well known as an immunosuppressive agent was intraperitoneally every day similarly at a dosage of 10 mg/kg/day (cyclosporine administered group: n=7). For both groups, the transplanted hearts were harvested on posttransplantation day 60. All the coronary arteries of 50,um or more in diameter were observed and the incidence and degree of sclerosis-like disease were calculated and evaluated. The coronary arteries of harvested hearts were fixed in 10~ formalin and the specimens were embedded in paraffin and were sectioned. The obtained specimens were stained with hematoxylin and eosin to assess the severity of rejection and with Elastica Masson stain to assess coronary arterial intimal thickening using an optical microscope.
Also, for the triptolide-administered group, liver and kidney were harvested on posttransplantation day 60 and the tissue sections were observed using an optical microscope to assess side effects.
(2) Evaluation and Results Using the evaluation method of Lurie et al., the rejection grades (scales 0 to 3, with greater number indicating stronger rejection) and coronary artery intimal thickening grade (scales 0 to 4, with greater number indicating advanced thickening) were evaluated.
The coronary arteries which consisted of 212 vessels (coronary artery) in the triptolide-administered group and 207 vessels in the cyclosporine-administered group were observed.
The coronary arterial intimal thickening grade was calculated by the following formula (III).
Arterial intimal thickening grade _ ( 1 X N1+2 X NZ+ 3 X N3+ 4 X N9 ) / ( No+N1+N2+N3+N4 ) ( I I I ) wherein in N~, n indicates each grade and Nn represents the number of vessels of n-grade).
The results are shown in Table 1.
Table 1 Triptolide- Cyclosporine admin_is_tered group administered group Rejection grade 1.1 0.3 1.1 0.5 Incidence of 34.0 3 ** 69.1 9 diseased vessel Arterial intimal 0.890.3 ** 1.720.28 thickening grade ** p<0.01 (for cyclosporine-administered group) Further, for the both groups, the states of coronary arteries are shown in Fig. 1 (cyclosporine-administered group) and Fig. 2 (triptolide-administered group).
As will be apparent from Table 1 and Figs. 1 and 2, triptolide has the same degree of rejection inhibiting effect, i.e., immunosuppressive effect, as cyclosporine in the transplanted heart and at the same time excellent coronary arterial intimal thickening inhibiting effect. Further, as for the incidence of diseased vessels, the inventive group administered with triptolide showed significantly lower values than those of cyclosporine-administered group. Therefore, it was suggested that the former has an effect on diseases other than arterial intimal thickening.
Also, observation of the tissue sections of liver and kidney of rats of triptolide-administered group using an optical microscope resulted in that there was no abnormality.
Fig. 3 is a micrograph of tissue sections of (a) liver and (b) kidney of rats administered with triptolide.
Test Example 2 PDGF Inhibitory effect of triptolide in transplanted heart.
(1) Subject and Method In the same manner as in Test Example 1, the transplanted heart was harvested from the inventive administration group (n=7) administered with triptolide and cyclosporine-administered group (n=7) administered with cyclosporine after heart transplantation on posttransplantation day 60. Further, heart was harvested from a rat which was not subjected to heart transplantation (non-treated group: n=6).
The harvested hearts were quickly frozen in liquid nitrogen and then stored at -80°C until RNA isolation. RNAs of the hearts were isolated and purified according to the protocol of RNAzol (Biotex Laboratories, Houston, TX).
Using the total RNA of each heart as a template and oligo dT and MMLV reverse transcriptase, cDNA was synthesized.
Using the following PDGF primer, PCR amplification of the cDNA
was performed in a PCR reaction mixture (10 mM Tris-HC1 (pH
8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTP, 2U Taq polymerase).
PDGF-A chain primer;
5'-primer; 5'GACCGCGGTCTCGAGTGCTACAGTACTGC3' 3'-primer; 5' GACCGCGGCCTCGCCTCCCTGCCGAGCTTCC3~
PCR reaction was performed using a DNA Thermal Cycler for 35 cycles, including denaturing at 94°C for 45 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 90 seconds each cycle.
The resulting PCR products were subjected to Agarose gel electrophoresis by a conventional method and stained with ethidium bromide to examine the degree of expression of PDGF-A. The results are diagrammed in Fig. 4. In Fig. 4, A
represents data of a non-treated rat which was not subjected to transplantation treatment, B represents data of a rat administered with triptolide, and C represents data of a rat administered with cyclosporine.
As will be apparent from Fig. 4, native heart (not subjected to heart transplantation treatment) showed no expression of PDGF-A. On the other hand, in the transplanted hearts, expression of PDGF-A was observed but an increase in expression of PDGF-A in the triptolide-administered group was significantly inhibited as compared with cyclosporine-administered group, control. These results demonstrate that triptolide has an effect of significantly inhibiting an increase in expression of PDGF in transplanted hearts.
Further, in order to learn the state of expression of PDGF in each heart, the mRNA of each heart was used for Northern blot analysis by a conventicnal manner and as a result, similar results to the above were obtained.
Claims (3)
1. An inhibiting agent against platelet-derived growth factor increase comprising as an active ingredient a diterpene selected from a compound represented by formula (I), a compound represented by formula (II), wherein X1, X2 and X3 independently represent a hydroxyl group or a hydrogen atom, and derivatives thereof, utilizing an ability of inhibiting an increase of platelet-derived growth factor as an index.
2. An arteriosclerosis preventive and therapeutic agent comprising as an active ingredient a diterpene selected from a compound represented by formula (I), a compound represented by formula (II), wherein X1, X2 and X3 independently represent a hydroxyl group or a hydrogen atom, and derivatives thereof, utilizing an ability of inhibiting an increase of platelet-derived growth factor as an index.
3. An arterial intimal thickening inhibiting agent comprising as an active ingredient a diterpene selected from a compound represented by formula (I), a compound represented by formula (II), wherein X1, X2 and X3 independently represent a hydroxyl group or a hydrogen atom, and derivatives thereof, utilizing an ability of inhibiting an increase of platelet-derived growth factor as an index.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA 2277564 CA2277564A1 (en) | 1999-07-13 | 1999-07-13 | Inhibiting agent against platelet-derived growth factor increase and arteriosclerosis preventive and therapeutic agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA 2277564 CA2277564A1 (en) | 1999-07-13 | 1999-07-13 | Inhibiting agent against platelet-derived growth factor increase and arteriosclerosis preventive and therapeutic agent |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2277564A1 true CA2277564A1 (en) | 2001-01-13 |
Family
ID=4163754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2277564 Abandoned CA2277564A1 (en) | 1999-07-13 | 1999-07-13 | Inhibiting agent against platelet-derived growth factor increase and arteriosclerosis preventive and therapeutic agent |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA2277564A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111743856A (en) * | 2020-06-09 | 2020-10-09 | 华南农业大学 | Triptolide ophthalmic material and preparation method and application thereof |
-
1999
- 1999-07-13 CA CA 2277564 patent/CA2277564A1/en not_active Abandoned
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111743856A (en) * | 2020-06-09 | 2020-10-09 | 华南农业大学 | Triptolide ophthalmic material and preparation method and application thereof |
| CN111743856B (en) * | 2020-06-09 | 2021-07-23 | 华南农业大学 | Triptolide ophthalmic material and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5843452A (en) | Immunotherapy composition and method | |
| US6586015B1 (en) | Use of Phyllanthus for treating chronic inflammatory and fibrotic processes | |
| JP4926382B2 (en) | Novel γ-butyrolactone compound and pharmaceutical composition thereof | |
| JP4892690B2 (en) | Hepatitis C virus production inhibitor | |
| US20160145230A1 (en) | Agent containing flavonoid derivatives for treating cancer and inflammation | |
| CN106214674A (en) | The medical usage of 7 hydroxyl butyphthalides | |
| CA2277564A1 (en) | Inhibiting agent against platelet-derived growth factor increase and arteriosclerosis preventive and therapeutic agent | |
| Alvionita et al. | Bioactivity of Flavonoid in Ethanol Extract of Annona squamosa L. Fruit as Xanthine Oxidase Inhibitor | |
| Chiuman et al. | Improvement of liver function from lemon pepper fruit ethanol extract in streptozotocin-induced wistar rats | |
| CN113116868B (en) | Use of tetrahydrocannabinol for the prevention and/or treatment of pulmonary hypertension | |
| WO2008091064A1 (en) | Composition comprising trachelospermi caulis and pyrola japonica extracts for the treatment and prevention of inflammatory diseases | |
| JPH11302171A (en) | Platelet-derived growth factor increase inhibitor and arteriosclerosis preventive/therapeutic agent | |
| Basa’ar et al. | Screening of supercritical fluid extract of Gymnema sylvestre R. Br. roots for phytochemical and pharmacological analysis | |
| JP4979053B2 (en) | Anticancer agent containing gentian extract, health supplement and medicinal cosmetic, and method for producing gentian extract | |
| KR20160130624A (en) | A Pharmaceutical Composition Comprising Extract or Fraction of Salvia plebeia R. Br. for Preventing or Treating Gout | |
| JP2001081030A (en) | Side-effect protective agent in immunosuppresant | |
| JPH0813833B2 (en) | Novel flavonoid glycoside and method for producing the same | |
| KR20050095287A (en) | NEW USE OF 1, 2, 3, 4, 6-PENTA-O-GALLOYL-β-D-GLUCOSE(PGG) AS ANTI-CANCER AGENT AND EXTRACTING METHOD OF PGG FROM GALLA RHOIS | |
| KR100569086B1 (en) | Acer mono leaf extracts and Phenolic compounds isolated thereof having hepatoprotective activity | |
| RU2118166C1 (en) | Agent as an aqueous extract of vegetable raw for treatment of patients with oncological disease and a method of its preparing | |
| WO2007100206A1 (en) | A pharmaceutical and food composition comprising agrimonia extracts | |
| KR20100084038A (en) | Liver cytoprotective composition comprising an extract from the stem barks of alnus hirsuta and compounds isolated therefrom | |
| EP1699463A1 (en) | Pharmaceutical composition for treating and preventing cancer comprising cinnamoni cortex extract and zizyphi fructus extract | |
| Kumar et al. | Calotropis procera leaf extract against paracetamol induced hepatotoxicity in Rats by regulating JNK/ASK-1 Signaling Pathway | |
| CN117586214A (en) | Linderane type sesquiterpene dimer and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Dead |