CA2274799A1 - Anti-obesity proteins - Google Patents

Abstract

The present invention provides anti-obesity proteins, which when administered to a patient regulate fat tissue. Accordingly, such agents allow patients to overcome their obesity handicap and live normal lives with much reduced risk for type 2 diabetes, cardiovascular disease, and cancer.

Description

WO 98/28414 . PCT/US97I23549 ANTI-OBESITY PROTEINS
Field of the Invention The present invention is in the field of human medicine, particularly in the treatment of obesity and disorders associated with obesity. Most specifically the invention relates to anti-obesity proteins that when administered to a patient regulate fat tissue.
Hackgrouad of the Invention Obesity, and especially upper body obesity, is a common and very serious public health problem in the United States and throughout the world. According to recent statistics, more than 25% of the United States population and 27% of the Canadian population are overweight [Kuczmarski, R. J., Amer. J. of Clin. Nutr. 55:4955-502S
(1992) ; Reeder, B. A. , et. a1. , Can. Med. Assoc. J. , 146:2009-2019 (1992)]. Upper body obesity is the strongest risk factor known for people with type 2 diabetes, and is a strong risk factor for cardiovascular disease and cancer as well. Recent estimates for the medical cost of obesity are $150,000,000,000 world wide. The problem has become serious enough that the surgeon general has begun an initiative to combat the ever increasing adiposity rampant in American society.
Much of this obesity-induced pathology can be attributed to the strong association with dyslipidemia, hypertension, and insulin resistance. Many studies have demonstrated that reduction in obesity by diet and exercise reduces these risk factors dramatically. Unfortunately, these treatments are largely unsuccessful, with a failure rate reaching 95%. This failure may be due to the fact that the condition is strongly associated with genetically inherited factors that contribute to increased appetite, preference for highly caloric foods, reduced physical activity, and increased lipogenic metabolism. This indicates that people inheriting these genetic traits are SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 prone to becoming obese regardless of their efforts to combat the condition. Therefore, a pharmacological agent that can correct this adiposity handicap and allow the physician to successfully treat obese patients in spite of their genetic inheritance is needed.
Physiologists have postulated for years that, when a mammal overeats, the resulting excess fat signals to the brain that the body is obese, which in turn causes the body to eat less and burn more fuel [Hervey, G. R., Nature 222:629-631 (1969)]. This "feedback" model is supported by parabiotic experiments, which implicate a circulating hormone controlling adiposity.
The ob/ob mouse is a model of obesity and diabetes that is known to carry an autosomal recessive trait linked to a mutation in the sixth chromosome. Recently, Zhang, Y.
and co-workers published the positional cloning of the mouse gene linked with this condition [Zhang, Y., et al. Nature 372:425-432 (1994)]. This report disclosed a gene coding for a 167 amino acid protein with a 21 amino acid signal peptide that is exclusively expressed in adipose tissue.
The rat obese gene was subsequently cloned and expressed [Murakami, T. et al., Biochem. Biophys. Res. Comm. 209:944-952 (1995)]. The protein, which is apparently encoded by the ob gene, is now speculated to be the adiposity regulating hormone.
The protein encoded by the ob gene is pharmacologically active, but the physical properties of the protein are less than desirable. The human protein, for example, is prone to precipitation and aggregation in both a formulation and under physiological conditions.
Formulations of a protein containing a precipitate, or that permit precipitation at the site of administration, increase the risk of producing an immunological response in the patient and may result in irritation at the site of injection. Additives to the formulation, such as detergents or surfactants, are undesirable because of increased risk of SUBSTITUTE SHEET ( rule 26 ) WO 98128414 . PCT/US97/23549 toxicology. Accordingly, there remains a need to develop pharmacological agents that demonstrate pharmacological activity and provide improved physical and chemical stability.
Applicants have discovered that the aggregation observed in the native human protein is due, in part, to hydrophobic interactions at the surface of the protein, particularly at residues 1, 2, 3, 30, 36, 41) 42, 43, 45, 46, 47, 48, 49, 50, 74, 89, 92, 99, 100, 138, and 142.
Applicants have further discovered that, by substituting these positions or regions of the protein with charged or hydrophilic amino acids, the propensity of the ob protein to aggregate is dramatically reduced. This reduction in aggregation provides a much improved pharmacological agent.
Accordingly, the present invention provides biologically active obesity proteins. Such agents allow patients to overcome their obesity handicap and live normal lives with a more normalized risk for type 2 diabetes, cardiovascular disease, and cancer.
Summary of Invention The present invention is directed to a protein of the Formula ( I ) 5 10 i5 2 5 Xaa Xaa Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Xaa Asp Ile Ser His Thr Xaa Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Xaa Xaa Ile Gln Ile Ser Asn Asp Leu 4 0 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Xaa Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly SUBSTITUTE SHEET ( ruie 26 ) WO 98/28414 . PCT/US97/23549 Val Leu Glu Ala Ser Gly Tyr Ser.Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Xaa Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO :1 ) ( I ) wherein:
Xaa at position 1 is Val or absent;
Xaa at position 2 is Pro or absent;
Xaa at position 22 is Asn or Ser;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn, Gln, Glu or Asp;
Xaa at position 73 is Val or Met;
Xaa at position 100 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 138 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His, or Arg;
said protein having at least one of the following substitutions:
Xaa at position 1 is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 2 is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg;
Ile at position 3 is replaced with Glu, Asp, Arg, Lys, or His;
Val at position 30 is replaced with Glu, Asp, Arg, Lys, or His;
Val at position 36 is replaced with Glu, Asp, Arg, Lys, or His;
Phe at position 41 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 42 is replaced with Glu, Asp, Arg, Lys, or His;
Pro at position 43 is replaced with Glu, Asp, Arg, Lys, or His;
Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/(TS97/23549 His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Pro at position 47 is replaced with Glu, Asp, Arg, Lys, or His;

Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His;

Leu at position 49 is replaced with Glu, Asp, Arg, Lys, or His;

Thr at position 50 is replaced with Glu, Asp, Arg, Lys, or His;

Ile at position 74 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;

Val at position 89 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;

Phe at position 92 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;

Pro at position 99 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser; or Leu at position 142 is replaced with Glu, Asp, Arg, Lys, or His;

or a pharmaceutically acceptable salt thereof.

The invention further provides a method of treating obesity or those condit ions associated with obesity, which comprises adminis tering to a mammal in need thereof a protein of the Formula (I).

The invention further provides a pharmaceutical formulation, which comprises a rotein of the Formula (I), p optionally having a leader seque nce, together with one or more pharmaceutically acceptable diluents, carriers, or excipients therefor.

The invention further provides proteins of the Formula (I) having additionally a leader sequence bonded to the N-terminus of the protein of Formula I. Such proteins are useful for their anti-obesity activity and as intermediates in the preparation of proteins of the Formula (I) .

SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/ITS97/23549 The invention further provides DNA encoding a protein of Formula {I), or a protein of Formula (I) having a leader sequence.
An additional embodiment of the present invention is a process for producing a protein of Formula (I), which comprises:
(a) transforming a host cell with DNA that encodes the protein of Formula (I) or a protein of Formula (I) having a leader sequence;
(b) culturing the host cell under conditions permitting expression of the protein;
(c) recovering the expressed protein; and, optionally, (d) cleaving enzymatically the leader sequence.
The invention further provides a protein for use in treating obesity and conditions associated with obesity, as well as, for use in preparing a medicament used to treat obesity and conditions associated with obesity.
Detailed Description For purposes of the present invention, as disclosed and claimed herein, the following terms and abbreviations are defined as follows:
Base pair (bp) -- refers to DNA or RNA. The abbreviations A,C,G, and T correspond to the 5~-monophosphate forms of the nucleotides (deoxy)adenine, (deoxy)cytidine, (deoxy)guanine, and {deoxy)thymine, respectively, when they occur in DNA molecules. The abbreviations U,C,G, and T correspond to the 5~-monophosphate forms of the nucleosides uracil, cytidine, guanine, and thymine, respectively, when they occur in RNA
molecules. In double stranded DNA, base pair may refer to a partnership of A with T or C with G. In a DNA/RNA
heteroduplex, base pair may refer to a partnership of T or U
with A or C with G.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97I23549 - 7 _ FMOC - an abbreviation for 9-fluorenymethoxycarbony.
Immunoreactive Protein(s) -- a term used to collectively describe antibodies, fragments of antibodies capable of binding antigens of a similar nature as the parent antibody molecule from which they are derived, and single chain polypeptide binding molecules [Bird, E. R., et al., PCT Application No. PCT/US 87/02208, International Publication No. WO 88/01649, published March 10, 1988].
Plasmid -- an extrachromosomal self-replicating genetic element.
PAM - an abbreviation for 4-hydroxymethyl-phenylacetamidomethyl.
PMSF -- an abbreviation for phenylmethylsulfonyl fluoride.
Reading frame -- the nucleotide sequence from which translation occurs "read" in triplets by the translational apparatus of tRNA, ribosomes and associated factors, each triplet corresponding to a particular amino acid. Because each triplet is distinct and of the same length, the coding sequence must be a multiple of three. A
base pair insertion or deletion (termed a frameshift mutation) may result in two different proteins being coded for by the same DNA segment. To insure against this, the triplet codons corresponding to the desired polypeptide must be aligned in multiples of three from the initiation codon, i.e., the correct "reading frame" must be maintained.
Recombinant DNA Cloning Vector -- any autonomously replicating agent including, but not limited to, plasmids and phages, comprising a DNA molecule to which one or more additional DNA segments can or have been added.
Recombinant DNA Expression Vector -- any recombinant DNA cloning vector in which a promoter has been incorporated.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 _ g _ Replicon -- A DNA sequence that controls and allows for autonomous replication of a plasmid or other vector.
TFA - an abbreviation for trifluoroacetic acid.
Transcription -- the process whereby information contained in a nucleotide sequence o~f DNA is transferred to a complementary RNA sequence.
Translation -- the process whereby the genetic information of messenger RNA is used to specify and direct the synthesis of a polypeptide chain.
Tris -- an abbreviation for tris(hydroxymethyl)-aminomethane.
Treating -- describes the management and care of a patient for the purpose of combating the disease, condition, or disorder and includes the administration of a protein of present invention to prevent the onset of the symptoms or complications, alleviating the symptoms or complications, or eliminating the disease, condition) or disorder. Treating obesity, therefore, includes the inhibition of food intake, the inhibition of weight gain, and inducing weight loss in patients in need thereof.
Vector -- a replicon used for the transformation of cells in gene manipulation bearing polynucleotide sequences corresponding to appropriate protein molecules which, when combined with appropriate control sequences, confer specific properties on the host cell to be transformed. Plasmids, viruses, and bacteriophage are suitable vectors, since they are replicons in their own right. Artificial vectors are constructed by cutting and joining DNA molecules from different sources using restriction enzymes and ligases. Vectors include Recombinant DNA cloning vectors and Recombinant DNA
expression vectors.
X-gal -- an abbreviation for 5-bromo-4-chloro-3-indolyl beta-D-galactoside.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/ITS97/23549 g _ The amino acid abbreviations are accepted by the United States Patent and Trademark Office as set forth in 37 C.F.R. ~ 1.822 (b)(2) (1993). Unless otherwise indicated the amino acids are in the L configuration.
As noted above the present invention provides a protein of the Formula (I):

Xaa Xaa Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Xaa Asp Ile Ser His Thr Xaa Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Xaa Xaa Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Xaa Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Xaa Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO : 1 ) ( I ) wherein:
Xaa at position 1 is Val or absent;
Xaa at position 2 is Pro or absent;
Xaa at position 22 is Asn or Ser;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn, Gln, Glu or Asp;
Xaa at position 73 is Val or Met;
Xaa at position 100 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 138 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His, or Arg;
said protein having at least one of the following substitutions:
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Xaa at position l is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 2 is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg;
Ile at position 3 is replaced with Glu, Asp, Arg, Lys, or His;
Val at position 30 is replaced with Glu, Asp, Arg, Lys, or His;
Val at position 36 is replaced with Glu, Asp, Arg, Lys, or His;
Phe at position 41 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 42 is replaced with Glu, Asp) Arg, Lys, or His;
Pro at position 43 is replaced with Glu, Asp, Arg, Lys, or His;
Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;
His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Pro at position 47 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His;
Leu at position 49 is replaced with Glu, Asp, Arg, Lys, or His;
Thr at position 50 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 74 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;
Val at position 89 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;
Phe at position 92 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;
Pro at position 99 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser; or SUBSTITUTE SHEET ( rule 26 ) Leu at position 142 is replaced with Glu, Asp, Arg, Lys, or His;
or a pharmaceutically acceptable salt thereof.
Preferred proteins are those having one to three substitutions; most preferably one or two substitutions defined in Formula (I).
Other preferred proteins of the present invention are those of SEQ ID NO:1, wherein:
Val at position 36 is replaced with Arg, Lys, or His;
Ile at position 74 is replaced with Glu or Asp, or Phe at position 92 is replaced with Arg, Lys, or His.
Other preferred proteins of the present invention are those of SEQ ID NO:1, wherein:
Phe at position 92 is replaced with Asp, Glu, Lys, Arg, or His, or pharmaceutically acceptable salts thereof.
Other preferred proteins of the present invention are those of SEQ ID N0:1, wherein:
Phe at position 92 is replaced with Asp or Glu, or pharmaceutically acceptable salts thereof.
Other preferred proteins of the present invention are those of SEQ ID NO:1, wherein:
Xaa at position 1 is Val or absent;
Xaa at position 2 is Pro or absent;
Xaa at position 22 is Asn;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn;
Xaa at position 73 is Val;
Xaa at position 100 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 138 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg;
said protein having at least one of the following substitutions:
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/tTS97/23549 Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;
His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Pro at position 47 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His; or Leu at position 142 is replaced with Glu, Asp, Arg, Lys, or His;
or pharmaceutically acceptable salts thereof.
Other preferred proteins of the present invention are those of SEQ ID NO:1, wherein:
Xaa at position 1 is Val;
Xaa at position 2 is Pro;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn;
Xaa at position 100 is Trp, Glu, or Asp;
Xaa at position 138 is Trp, Glu or Asp;
said protein having at least one of the following substitutions:
His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His; or Phe at position 92 is replaced with Glu, Asp, Arg, Lys, or His;
or pharmaceutically acceptable salts thereof.
Other preferred proteins of the present invention are those of SEQ ID NO: I, wherein:
Xaa at position 1 is Val;
Xaa at position 2 is Pro;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn;
Xaa at position 100 is Trp, Glu, or Asp;
Xaa at position 138 is Trp, Glu or Asp;
SUBSTITUTE SHEET ( rule 26 ) WO 98128414 . PCT/US97/23549 said protein having at least one of the following substitutions:
His at position 46 is replaced with Glu, Asp, Arg, or Lys; or Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His;
or pharmaceutically acceptable salts thereof.
Still more preferred are proteins of the present invention are those of SEQ ID NO:1, wherein:
Xaa at position 1 is Val;
Xaa at position 2 is Pro;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn;
Xaa at position 100 is Trp or Asp;
Xaa at position 138 is Trp;
said protein having at least one of the following substitutions:
His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Ile at position 48 is replaced with Asp, Arg, Lys, or His; or Phe at position 92 is replaced with Asp, Glu, Arg, Lys, or His;
or pharmaceutically acceptable salts thereof.
Still more preferred are proteins of the present invention are those of SEQ ID NO: l, wherein:
Xaa at position 1 is Val;
Xaa at position 2 is Pro;
Xaa at pos~i.tion 28 is Gln or absent;
Xaa at position 72 is Asn;
Xaa at position 100 is Trp or Asp;
Xaa at position 138 is Trp;
said protein having at least one of the following substitutions:
His at position 46 is replaced with Glu, Asp, Arg, or Lys; or SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Ile at position 48 is replaced with Asp, Arg, Lys, or His;
or pharmaceutically acceptable salts thereof.
Other preferred proteins of the present invention are those of SEQ ID NO:1, wherein:
Xaa at position 1 is Val or absent;
Xaa at position 2 is Pro or absent;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn, Glu or Asp;
Xaa at position 100 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 138 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg;
said protein having at least one of the following substitutions:
Xaa at position 1 is replaced with Glu, Asp, Ser, Thr, Lys, His, Arg, or absent;
Xaa at position 2 is replaced with Glu, Asp, Ser, Thr, Lys, His, Arg, or absent;
Val at position 89 is replaced with Glu, Asp, Arg, Lys, or His; or Phe at position 92 is replaced with Glu, Asp, Arg, Lys, or His;
or a pharmaceutically acceptable salt thereof.
Other preferred proteins are those of Formula I
wherein:
Xaa at position 1 is Val or absent;
Xaa at position 2 is Pro or absent;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn, Glu or Asp;
Xaa at position 100 is Glu, Asp, Lys, His, or Arg;
Xaa at position 138 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg;
said protein having at least one of the following substitutions:
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . . PCT/US97/23549 Phe at position 92 is replaced with Glu, Asp, Arg, Lys, or His;

Pro position 99 is replaced Glu, Asp, Arg, at with Lys, r is;
o H

or a cally acceptable salt pharmaceuti thereof.

Preferred s ithin ormula I nclude specie w F i species of SEQID N0: 2 SEQID N0:7:
through Val ProIleGln LysVal AspAspThr ThrLeu IleLysThr Gln Lys Ile ValThrArg IleAsn IleSerHis GlnSer ValSerSer Asp Thr Lys GlnLysVal ThrGly AspPheIle GlyLeu AspProIle Leu Pro Leu ThrLeuSer LysMet GlnThrLeu ValTyr GlnGlnIle Asp Ala Leu ThrSerMet ProSer AsnValIle IleSer AsnAspLeu Arg Gln Glu AsnLeuArg AspLeu HisValLeu PheSer LysSerCys Leu Ala His LeuProTrp AlaSer LeuGluThr AspSer LeuGlyGly Gly Leu 3 Val LeuGluAla SerGly SerThrGlu ValAla LeuSerArg 0 Tyr Val Leu GlnGlySer LeuGln MetLeuTrp LeuAsp LeuSerPro Asp Gln Gly Cys ( ID NO :
SEQ 2 ) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser 4 5 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Asp Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCTlUS97/Z3549 115 120 , 125 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO : 3 ) Val Pro IleGln LysValGln AspAspThr LysThrLeuIle LysThr Ile Val ThrArg IleAsnAsp IleSerHis ThrGlnSerVal SerSer Lys Gln LysVal ThrGlyLeu AspPheIle ProGlyLeuAsp ProIle 2 Leu Thr LeuSer LysMetAsp GlnThrLeu AlaValTyrGln GlnIle Leu Thr SerMet ProSerArg AsnValIle GlnIleSerAsn AspLeu 85 90 g5 Glu Asn LeuArg AspLeuLeu HisValLeu AlaPheSerLys SerCys His Leu ProAsp AlaSerGly LeuGluThr LeuAspSerLeu GlyGly Val Leu GluAla SerGlyTyr SerThrGlu ValValAlaLeu SerArg 3 Leu Gln GlySer LeuGlnAsp MetLeuTrp GlnLeuAspLeu SerPro Gly Cys ( Q
SE ID
NO
:

) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Asp 5 0 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile SUBSTITUTE SHEET ( rule 26 ) WO 98128414 . PCT/US97123549 Leu Thr SerMetPro SerArgAsn ValIleGln IleSerAsn AspLeu Glu Asn LeuArgAsp LeuLeuHis ValLeuAla PheSerLys SerCys His Leu ProAspAla SerGlyLeu GluThrLeu AspSerLeu GlyGly Val Leu GluAlaSer GlyTyrSer ThrGluVal ValAlaLeu SerArg Leu Gln GlySerLeu GlnAspMet LeuTrpGln LeuAspLeu SerPro Gly Cys ( Q
SE ID
NO
:

) Val Pro IleGlnLys ValGlnAsp AspThrLys ThrLeuIle LysThr Ile Val ThrArgIle AsnAspIle SerHisThr GlnSerVal SerSer 2 5 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro IIe Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Glri Gln Ile Leu ThrSerMet ProSerArg AsnValIle GlnIleSerAsn AspLeu Glu AsnLeuArg AspLeuLeu HisValLeu AlaAspSerLys SerCys His LeuProTrp AlaSerGly LeuGluThr LeuAspSerLeu GlyGly 4 Val LeuGluAla SerGlyTyr SerThrGlu ValValAlaLeu SerArg Leu GlnGlySer LeuGlnAsp MetLeuTrp GlnLeuAspLeu SerPro Gly Cys ( ID NO :

) Val ProIleGln LysValGln AspAspThr LysThrLeuIle LysThr Ile ValThrArg IleAsnAsp IleSerHis ThrGlnSerVal SerSer Lys GlnLysVal ThrGlyLeu AspPheIle ProGlyLeuHis ProIle SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97123549 Leu Thr Leu Ser Lys Met Asp Gln~Thr Leu Ala Val Tyr Gln Gln Ile 65 70 75 g0 Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Asp Ser Lys Ser Cys His Leu Pro Asp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 2 0 Gly cys ( SEQ ID NO : 7 ) As mentioned above, the invention also provides proteins of the Formula (I) having additionally a leader sequence bonded to the N-terminus of the protein of Formula I. Such proteins are useful for their anti-obesity activity and as intermediates in the preparation of proteins of the Formula (I). The species having SEQ ID N0:8-13 are particularly preferred proteins of Formula (I) having the leader sequence Met-Arg bonded to the N-terminus of the proteins of SEQ ID N0:2-7, respectively.

Met Arg Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile 3 Lys ThrIle ValThrArg IleAsnAsp IleSerHis ThrGlnSer Val Ser SerLys GlnLysVal ThrGlyLeu AspPheIle ProGlyLeu Asp Pro IleLeu ThrLeuSer LysMetAsp GlnThrLeu AlaValTyr Gln Gln IleLeu ThrSerMet ProSerArg AsnValIle GlnIleSer Asn Asp LeuGlu AsnLeuArg AspLeuLeu HisValLeu AlaPheSer Lys 5 Ser CysHis LeuProTrp AlaSerGly LeuGluThr LeuAspSer Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/I1S97/23549 Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO : 8 ) Met Arg ValProIleGln LysVal GlnAspAsp ThrLysThrLeu Ile Lys Thr IleValThrArg IleAsn AspIleSer HisThrGlnSer Val Ser Ser LysGlnLysVal ThrGly LeuAspPhe IleProGlyLeu His Pro Asp LeuThrLeuSer LysMet AspGlnThr LeuAlaValTyr Gln 2 Gln Ile LeuThrSerMet ProSer ArgAsnVal IleGlnIleSer Asn 85 90 . 95 Asp Leu GluAsnLeuArg AspLeu LeuHisVal LeuAlaPheSer Lys loo 105 110 Ser Cys HisLeuProTrp AlaSer GlyLeuGlu ThrLeuAspSer Leu Gly Gly ValLeuGluAIa SerGly TyrSerThr GluValValAla Leu Ser Arg LeuGlnGlySer LeuGln AspMetLeu TrpGlnLeuAsp Leu 3 Ser Pro GlyCys ( ID NO
5 SEQ :

) Met Arg Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile 4 0 Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu Asp Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys SUBSTITUTE SHEET ( rule 26 ) Ser Cys His Leu Pro Asp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro GIy Cys ( SEQ ID NO :10 ) Met ArgVal ProIleGln LysValGln AspAspThr LysThrLeuIle Lys ThrIle ValThrArg IleAsnAsp IleSerHis ThrGlnSerVal 2 Ser SerLys GlnLysVal ThrGlyLeu AspPheIle ProGlyLeuHis Pro AspLeu ThrLeuSer LysMetAsp GlnThrLeu AlaValTyrGln Gln IleLeu ThrSerMet ProSerArg AsnValIle GlnIleSerAsn Asp LeuGlu AsnLeuArg AspLeuLeu HisValLeu AlaPheSerLys loo l05 llo Ser CysHis LeuProAsp AlaSerGly LeuGluThr LeuAspSerLeu 3 Gly GlyVal LeuGluAla SerGlyTyr SerThrGlu ValValAlaLeu Ser ArgLeu GlnGlySer LeuGlnAsp MetLeuTrp GlnLeuAspLeu Ser ProGly Cys ( ID NO
SEQ :11 ) Met Arg Val Pro Ile Gln Lys Val GIn Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val 5 0 Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/Z3549 Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Asp Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu ser Pro Gly Cys ( SEQ ID NO :12 ) Met Arg Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile 2 0 Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Asp Ser Lys 3 5 Ser Cys His Leu Pro Asp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO :13 ) The present invention provides biologically active proteins that provide effective treatment for obesity.
Applicants have discovered that specific substitutions to the hydrophobic residues on the surface of the protein result in improved properties. These residues could not be predicted from the primary sequence. The proteins having these substitutions are pharmacologically active and have a reduced propensity to aggregate when compared to both the SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 mouse and human forms of the protein. The present invention permits obesity protein to be more readily formulated at higher concentrations, and increases their pharmaceutical elegance, because they are compatible with commonly-used preservatives.
The claimed proteins ordinarily are prepared by recombinant techniques. Techniques for making substitutional mutations at predetermined sites in DNA
having a known sequence are well known, for example M13 primer mutagenesis. The mutations that might be made in the DNA encoding the present anti-obesity proteins must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure [DeBoer, H.A., et al., European Patent Publication No. 75,444 A2, published March 30, 1983].
The proteins of the present invention may be produced either by recombinant DNA technology or well known chemical procedures, such as solution or solid-phase peptide synthesis, or semi-synthesis in solution beginning with protein fragments coupled through conventional solution methods.
A. Solid Phase The synthesis of the claimed proteins may proceed by solid phase peptide synthesis or by recombinant methods.
The principles of solid phase chemical synthesis of polypeptides are well known in the art and may be found in general texts in the area such as Dugas, H. and Penney, C., Bioorganic Chemistry Springer-Verlag, New York, (1981) 54-59. For example, peptides may be synthesized by solid-phase methodology utilizing an PE-Applied Biosystems 433A peptide synthesizer (Perkin Elmer-Applied Biosystems Division, Foster City, California) and synthesis cycles supplied by Applied Biosystems. Boc amino acids and other reagents are commercially available from PE-Applied Biosystems and other chemical supply houses. Sequential Boc chemistry using SUBSTITUTE SHEET { rule 26 ) WO 98/28414 . PCT/US97/23549 double couple protocols are applied to the starting p-methyl benzhydryl amine resins for the production of C-terminal carboxamides. For the production of C-terminal acids, the corresponding PAM resin is used. Arginine, Asparagine, Glutamine, Histidine, and Methionine are coupled using preformed hydroxy benzotriazole esters. The following side chain protection may be used:
Arg, Tosyl Asp, cyclohexyl or benzyl Cys, 4-methylbenzyl Glu, cyclohexyl His, benzyloxymethyl Lys, 2-chlorobenzyloxycarbonyl Met, sulfoxide I5 Ser, Benzyl Thr, Benzyl Trp, formyl Tyr, 4-bromo carbobenzoxy Boc deprotection may be accomplished with trifluoroacetic acid (TFA) in methylene chloride. Formyl removal from Trp is accomplished by treatment of the peptidyl resin with 20%
piperidine in dimethylformamide for 60 minutes at 4°C.
Met(O) can be reduced by treatment of the peptidyl resin with TFA/dimethylsulfide/conc. HC1 (95/5/1) at 25°C for 60 minutes. Following the above pre-treatments, the peptides may be further deprotected and cleaved from the resin with anhydrous hydrogen fluoride containing a mixture of 10% m-cresol or m-cresol/10% p-thiocresol or m-cresol/p-thiocresol/dimethyl-sulfide. Cleavage of the side chain protecting groups) and of the peptide from the resin is carried out at 0°C or below, preferably -20°C for thirty minutes followed by thirty minutes at 0°C. After removal of the HF, the peptide/resin is washed with ether. The peptide is extracted with glacial acetic acid and lyophilized.
Purification is accomplished by reversed-phase C18 SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 chromatography in 0.1% TFA with a gradient of increasing acetonitrile concentration, e.g., a 2.2 cm X 25 cm VydacT""
column (The Separations Group, Inc., Hesperia, CA).
One skilled in the art recognizes that the solid phase synthesis could also be accomplished using the FMOC
strategy and a TFA/scavenger cleavage mixture.
B. Recombinant Synthesis The claimed proteins may also be produced by recombinant methods. Recombinant methods are preferred if a high yield or if specific post-translational modifications are desired. The basic steps in the recombinant production of protein include:
a) construction of a synthetic or semi-synthetic (or isolation from natural sources) DNA
encoding the claimed protein, b) integrating the coding sequence into an expression vector in a manner suitable for the expression of the protein either alone or as a fusion protein, c) transforming an appropriate eukaryotic or prokaryotic host cell with the expression vector, and d) recovering and purifying the recombinantly produced protein.
a. Gene Construction Synthetic genes, the in vitro or in vivo transcription and translation of which will result in the production of the protein may be constructed by techniques well known in the art. Owing to the natural degeneracy of the genetic code, the skilled artisan will recognize that a sizable yet definite number of DNA sequences may be constructed which encode the claimed proteins. In the preferred practice of the invention, synthesis is achieved by recombinant DNA technology.
Methodology of synthetic gene construction is well known in the art (Brown, E. L., et a.~. Methods in SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Enzymology, Academic Press,. New York, NY, 68:109-151 (1979)]. The DNA sequence corresponding to the synthetic claimed protein gene may be generated using conventional DNA
synthesizing apparatus such as the Applied Biosystems Model 380A or 380B DNA synthesizers (Perkin Elmer, Applied Biosystems Division, Foster City, Cahifornia).
It may desirable in some applications to modify the coding sequence of the claimed protein so as to incorporate a convenient protease sensitive cleavage site, e.g., between the signal peptide and the structural protein facilitating the controlled excision of the signal peptide from the fusion protein construct.
The gene encoding the claimed protein may also be created by using polymerase chain reaction (PCR). The template can be a cDNA library (commercially available from CLONETECH or STRATAGENE) or mRNA isolated from human adipose tissue. Such methodologies are well known in the art. See, e.g., Maniatis, T., et a1. Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989).
b. Direct Expression or Fusion Protein The claimed protein may be made either by direct expression or as fusion protein comprising the claimed protein followed by enzymatic or chemical cleavage. A
variety of peptidases (e.g., trypsin) which cleave a polypeptide at specific sites or digest the peptides from the amino or carboxy termini (e.g., diaminopeptidase) of the peptide chain are known. Furthermore, particular chemicals (e.g., cyanogen bromide) will cleave a polypeptide chain at specific sites. The skilled artisan will appreciate the modifications necessary to the amino acid sequence (and synthetic or semi-synthetic coding sequence if recombinant means are employed) to incorporate site-specific internal cleavage sites. See, e.g., Carter, P., Chapter 13 in Protein Purification: From Molecular Mechanisms to Large-SUBSTITUTE SHEET ( rule 2b ) Scale Processes, Ladisch, M., et a1. (Eds.) American Chemical Soc., Washington, D.C. (1990).
c. Vector Construction Construction of suitable vectors containing the desired coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to form the plasmids required.
To effect the translation of the desired protein, one inserts the engineered synthetic DNA sequence in any of a plethora of appropriate recombinant DNA expression vectors through the use of appropriate restriction endonucleases. A
synthetic coding sequence. is designed to possess restriction endonuclease cleavage sites at either end of the transcript to facilitate isolation from and integration into these expression and amplification and expression plasmids. The isolated cDNA coding sequence may be readily modified by the use of synthetic linkers to facilitate the incorporation of this sequence into the desired cloning vectors by techniques well known in the art. The particular endonucleases employed will be dictated by the restriction endonuclease cleavage pattern of the parent expression vector to be employed. Restriction sites are chosen so as to properly orient the coding sequence with control sequences to achieve proper in-frame reading and expression of the claimed protein .
In general, plasmid vectors containing promoters and control sequences which are derived from species compatible with the host cell are used with these hosts.
The vector ordinarily carries a replication site as well as marker sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species [Bolivar, F., et al., Gene 2:95-113 (1977)]. Plasmid pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/Z3549 identifying transformed cells. The pHR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA technology.
The desired coding sequence is inserted into an expression vector in the proper orientation to be transcribed from a promoter and ribosome binding site, both of which should be functional in the host cell in which the protein is to be expressed. An example of such an expression vector is a plasmid described in Belagaje, R. M., et al., U.S. patent No. 5,304,473, issued, April 19, 1994, the teachings of which are herein incorporated by reference.
The gene encoding A-C-B proinsulin described in U.S. Patent No. 5,304,473 can be removed from the plasmid pRBl82 with restriction enzymes Ndel and BamHI. The genes encoding the protein of the present invention can be inserted into the plasmid backbone on a Ndel/BamHI restriction fragment cassette.
d. Prokaryotic Ex ression In general, prokaryotes are used for cloning of DNA sequences in constructing the vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No.
31446) is particularly useful. Other microbial strains which may be used include E. coli B and E. coli X1776 (ATCC No.
31537). These examples are illustrative rather than limiting.
Prokaryotes also are used for expression. The aforementioned strains, as well as E. coli W3110 (prototrophic, ATCC No. 27325), bacilli such as Bacillus subtilis, and other enterobacteriaceae such as Salmonella typhimurium or Serratia marcescans, and various pseudomonas species may be used. Promoters suitable for use with prokaryotic hosts include the [i-lactamase (vector pGX2907 [ATCC 39344] contains the replicon and [3-lactamase gene) and lactose promoter systems [Chang, A. C. Y., et al., Nature, 275:617-624 (1978); and Goeddel, D. V., et al., Nature SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 281:544-548 (1979)], alkaline phosphatase, the tryptophan (trp) promoter system (vector pATHl [ATCC 37695] is designed to facilitate expression of an open reading frame as a trpE
fusion protein under control of the trp promoter) and hybrid promoters such as the tac promoter (isolatable from plasmid pDR540 ATCC-37282). However, other functional bacterial promoters, whose nucleotide sequences are generally known, enable one skilled in the art to ligate them to DNA encoding the protein using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems also will contain a Shine-Dalgarno sequence operably linked to the DNA encoding protein.
e. Eukaryotic Ex ression The protein may be recombinantly produced in eukaryotic expression systems. Preferred promoters controlling transcription in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g., p-actin promoter. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication [Fiers, W., et al., Nature, 273:113-120 (1978)]. The entire SV40 genome may be obtained from plasmid pBRSV, ATCC 45019. The immediate early promoter of the human cytomegalovirus may be obtained from plasmid pCMBQ
(ATCC 77177). Of course, promoters from the host cell or related species also are useful herein.
Transcription of a DNA encoding the claimed protein by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10-300 bp, that act on a promoter to increase its transcription. Enhancers are relatively orientation and position independent having been found 5~ [Laimins, L. A., et al., Proc. Nat~1 Acad. Sci.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/I1S97/23549 (USA) 78:464-468 (1981)] and 3~ [Lusky, M., et al., Mol.
Cell. Bio. 3:1108-1122 (1983)] to the transcription unit, within an intron [Banerji, J., et al., Cell 33:729-740 (1983)] as well as within the coding sequence itself [Osborne, T. F., et al., Mol. Cell. Bio. 4:1293-1305 (1984)). Many enhancer sequences are now known from mammalian genes (globin, RSV, SV40, EMC, elastase, albumin, a-fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 late enhancer, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding protein. The 3~ untranslated regions also include transcription termination sites.
Expression vectors may contain a selection gene, also termed a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR, which may be derived from the BgIII/HindIII
restriction fragment of pJOD-10 [ATCC 68815)), thymidine kinase (herpes simplex virus thymidine kinase is contained on the BamHI fragment of vP-5 clone (ATCC 2028), or neomycin (G418) resistance genes, which are obtainable from pNN414 yeast artificial chromosome vector (ATCC 37682). When such selectable markers are successfully transferred into a mammalian host cell, the transfected mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cel l s metabolism and the use of a mutant cell line which lacks the ability to grow without a supplemented media. Two examples are: CHO DHFR-SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 cells (ATCC CRL-9096) and mouse LTK- cells [L-M(TK-) ATCC
CCL-2.3]. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine.
Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection.
Examples of such dominant selection use the drugs neomycin, [Southern P J., et al., J. Molec. Appl. Genet. 1:327-341 (1982)], mycophenolic acid [Mulligan, R. C. et al., Science 209:1422-1427 (1980)], or hygromycin [Sugden, B. et al., Mol Cell. Biol. 5:410-413 (1985)]. The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug, such as, 6418, neomycin (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively.
A preferred vector for eukaryotic expression is pRc/CMV. pRc/CMV is commercially available from Invitrogen Corporation, San Diego, CA. To confirm correct sequences in constructed plasmids, the ligation mixtures are used to transform E. coli K12 strain DHSa (ATCC 31446) and successful transformants are selected by antibiotic resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction and/or SUBSTITUTE SHEET ( rule 26 ) WO 98J284I4 . PCT/LTS97/23549 sequenced by the method of. Messing, J., et al., Nucleic Acids Res. 9:309-321 (1981).
Host cells may be transformed with the expression vectors of this invention and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. The techniques of transforming cells with the aforementioned vectors are well known in the art and may be found in such general references as Maniatis, T., et a1.
Molecular Cloning: A Laboratory Manual, 2"d Ed., Cold Spring Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989), or Current Protocols in Molecular Biology (1989) and supplements.
Preferred suitable host cells for expressing the vectors encoding the claimed proteins in higher eukaryotes include: African green monkey kidney cell line transformed by SV40 (COS-7, ATCC CRL-1651); transformed human primary embryonal kidney cell line 293 [Graham, F. L. et al., J. Gen Virol. 36:59-72 (1977); Harrison, T., et al., Virology 77:319-329 (1977); Graham, F. L. et al., Virology 86:10-21 (1978)]; baby hamster kidney cells [BHK-21(C-13), ATCC CCL-10; MacPherson, I., et a1, Virology 16:147-151 (1962)];
Chinese hamster ovary cells [CHO-DHFR- (ATCC CRL-9096)];
mouse Sertoli cells [TM4, ATCC CRL-1715; Mather, J. P., Biol. Reprod. 23:243-252 (1980)]; African green monkey kidney cells (VERO 76, ATCC CRL-1587); human cervical epitheloid carcinoma cells (HeLa, ATCC CCL-2); canine kidney cells (MDCK, ATCC CCL-34); buffalo rat liver cells (BRL 3A, ATCC CRL-1442); human diploid lung cells (WI-38, ATCC CCL-75); human hepatocellular carcinoma cells (Hep G2, ATCC HB-8065);and mouse mammary tumor cells (MMT 060562, ATCC
CCL51) .
f. Yeast Ex ression SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 In addition to prokaryotic and mammalian host cells, eukaryotic microorganisms such as yeast may also be used as host cells. Saccharomyces cerevisiae, common baker s yeast, is the most commonly-used eukaryotic microorganism for expressing heterologous proteins, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used [ATCC-40053, Stinchcomb, D. T., et al., Nature 282:39-43 (1979); Kingsman, A. J., et al., Gene 7:141-152 (1979); Tschumper, G., et al., Gene 10:157-166 (1980)]. This plasmid already contains the trp gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan [e. g., ATCC 44076 or PEP4-l; Jones, E. W., Genetics 85:23-33 (1977)].
Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase, which is found on plasmid pAPI2BD ATCC 53231 [Patel, A. C., et al., U.S. Patent No. 4,935,350, issued June 19, 1990] or other glycolytic enzymes such as enolase, which is found on plasmid pACl (ATCC 39532), glyceraldehyde-3-phosphate dehydrogenase, which is derived from plasmid pHcGAPCl (ATCC
57090, 57091), zymomonas mobilis [Ingrain, L.O., et al., U.S.
Patent No. 5,000,000 issued March 19, 19911, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, which is contained on plasmid vector pCL28XhoLHBPV [ATCC 39475; Reddy, V. B., et al., U.S.
Patent No. 4,840,896, issued June 20, 1989], glyceraldehyde 3-phosphate dehydrogenase, and enzymes responsible for SUBSTITUTE SHEET ( ruie 26 ) WO 98128414 . PCT/US97/23549 maltose and galactose utilization, such as, the GALL
promoter, which may be found on plasmid pRY121 (ATCC 37658).
Suitable vectors and promoters for use in yeast expression are further described in Hitzeman, R. A., et al., European Patent Publication No. 73,657A1, published March 9, 1983.
Yeast enhancers such as the UAS Gal from Saccharomyces cerevisiae, which is found in conjunction with the CYC1 promoter on plasmid YEpsec--hIlbeta (ATCC 67024), also are advantageously used with yeast promoters.
The following examples are presented to further illustrate the preparation of the claimed proteins. The scope of the present invention is not to be construed as merely consisting of the following examples.
8xample 1 Vector Construction A gene of SEQ ID N0:14 is assembled from a 220 base pair and a 240 base pair segment which are derived from chemically synthesized oligonucleotides:

451 TAGGATCC (SEQ ID N0:14) The base pair segment extends from the Ndel site to the Xbal site at position 220 within the coding region and is assembled from overlapping oligonucleotides which range in length from between and bases.
The base pair segment which extends from the Xbal to the BamHI
site is also assembled from 7 overlapping oligonucleotides which range in length from between 57 and 92 bases.

SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/U597/23549 To assemble these fragments, the respective 7 oligonucleotides are mixed in equimolar amounts, usually at concentrations of about 1-2 picomoles per microliter. Prior to assembly, all but the oligonucleotides at the 5'-ends of the segment are phosphorylated in standard kinase buffer with T4 DNA kinase using the conditions specified by the supplier of the reagents. The mixtures are heated to 95°C
and allowed to cool slowly to room temperature over a period of 1-2 hours to ensure proper annealing of the oligonucleotides. The oligonucleotides are then ligated to each other and into an appropriated cloning vector such as pUCl8 or pUC 19 using T4 DNA ligase. The buffers and conditions are those recommended by the supplier of the enzyme. The vector for the 220 base pair fragment is digested with Ndel and Xbal, whereas the vector for the 240 base pair fragment is digested with Xbal and BamHI prior to use. The ligation mixes are used to transform E. coli DH10B
cells (commercially available from Life Technologies, producer of GIBCO/BRL products, Grand Island, NY) and the transformed cells are plated on tryptone-yeast plates (TY, Difco, Detroit, MI) containing 100 ~g/ml of ampicillin, X-gal and IPTG. Colonies which grow up overnight are grown in liquid TY medium with 100 ~.g/ml of ampicillin and are used for plasmid isolation and DNA sequence analysis. Plasmids with the correct sequence are kept for the assembly of the complete gene. This is accomplished by gel-purification of the 220 base-pair and the 240 base-pair fragments and ligation of these two fragments into an expression vector such as pRBl82 from which the coding sequence for A-C-B
proinsulin is deleted and is digested with Ndel and BamHI
prior to use.
Alternatively, plasmid pET30 (Novagen, Madison, wI) can be digested with Ndel and BamHI, and the desired DNA
sequence encoding the proteins of the present invention can be inserted by procedures recognized in the art and described herein. The source of the DNA is synthetic SUBSTITUTE SHEET ( rule 26 ) WO 98/Z8414 . PCT/I1S97/23549 oligonucleotides that are assembled by art recognized methodology and described herein.
8xample 2 Expression plasmid for the Proteia of S8Q ID N0:3 (pH8767) Plasmid vector pOJ722 (40 fig, NRRL No. B-21,654) was prepared in a manner analogous to Example 1 and was digested with 20 units of EcoRV (Boehringer Mannheim, Indianapolis, IN) and 20 units of Bglll (Boehringer Mannheim) in "Boehringer Mannheim buffer B" at 37oC for two hours. The digest was purified on a 1% agarose gel, and the 2674 by and 1422 by fragments were isolated using the freeze-squeeze method.
The oligonucleotides 14255 [5'-ATC TCA CAC ACA CAG TCA
GTC TCG AGT AAA CAG AAA GTC ACA GGC TTG GAC TTC ATA CCT GGG
CTG CAC CCC GAC CTG ACA TTG TCT AAA ATG GAC CAG ACA CTG GCA
GTC TAT CAA CA-3' (SEQ ID N0:15)] and 14256 [5'-GAT CTG TTG
ATA GAC TGC CAG TGT CTG GTC CAT TTT AGA CAA TGT CAG GTC GGG
GTG CAG CCC AGG TAT GAA GTC CAA GCC TGT GAC TTT CTG TTT ACT
CGA GAC TGA CTG TGT GTG TGA GAT-3' (SEQ ID N0:16)] were kinased in the presence of 1x kinase buffer, 50 mM Tris-HCl pH 8.0, 10 mM MgCl2, 0.5 mM ATP, 1 mM DTT, and 5 units T4 polynucleotide kinase (GIBCO BRL) at 37°C for 30 minutes.
The EcoRV/Bglll 2674 by and 1422 by fragments, prepared as described above, and the 14255 and 14256 linkers were ligated in the presence of 1x kinase buffer, 0.5 mM ATP
and 1 unit T4 DNA ligase (GIBCO BRL) at 16°C overnight. The ligation products are transformed into E. coli BL21(DE3) (Novagen) and colonies growing on TY plates supplemented with 10 ~,g/mL of tetracycline are analyzed. Plasmid DNA is isolated, then subjected to DNA sequencing on a PE-Applied Biosystems 370 DNA sequencer. Plasmids containing the expected -.400 by Nde1 to BamHI fragment are kept, and are designated pHS767.
Example 3 SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Expression plasmid for the Protein of SEQ ID N0:5 (pH8786) Plasmid vector pHS767 (40 ~tg) was digested with 20 units of Pmll (New England Biolab, Beverly, MA) in "New England Biolab buffer 1" at 37°C for two hours. Buffer salts were added to adjust to the mixture to the conditions of "New England Biolab buffer 3." BstXI was added(20 units, New England Biolab), and the plasmid was digested for 2 hours at 55°C. After that, the digest was treated with 20 units of alkaline phosphatase (Boehringer Mannheim) at 37°C
for 30 minutes. The digest was purified on a 1% agarose gel, and the 4170 by fragment was isolated using the freeze-squeeze method.
The oligonucleotides 13824 [5'-TGA GGC TTC CAG GAC
TCC CCC CAG ACT GTC CAA TGT CTC CAG GCC ACT GGC GTC TGG CAA
GTG GCA ACT TTT AGA GAA GGC CAG CAC-3'(SEQ ID N0:17)] and 13825 [5'-GTG CTG GCC TTC TCT AAA AGT TGC CAC TTG CCA GAC
GCC AGT GGC CTG GAG ACA TTG GAC AGT CTG GGG GGA GTC CTG GAA
GCC-3'(SEQ ID N0:18)] were kinased in the presence of lx kinase buffer, 50 mM Tris-HC1 pH 8.0, 10 mM MgCl2, 0.5 mM
ATP, 1 mM DTT, and 5 units T4 polynucleotide kinase (GIBCO
BRL) at 37°C for 30 minutes.
The Pmll/BstXI linearized pHS767 vector, and the 13824 and 13825 linkers, were ligated in the presence of 1x kinase buffer, 0.5 mM ATP and 1 unit T4 DNA ligase (GIBCO
BRL) at 16°C overnight. The ligation products are transformed into E, coli BL21(DE3) (Novagen) and colonies growing on TY plates supplemented with 10 ~g/mL of tetracycline are analyzed. Plasmid DNA is isolated, then subjected to DNA sequencing on a PE-Applied Biosystems 370 DNA sequencer. Plasmids containing the expected 400 by Ndel to BamHI fragment are kept, and are designated pHS786.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/L1S97/23549 Example 4 Expression plasmid for the Protein of SEQ ID N0:2 (pHS775) Plasmid vector pHS767 (40 ug) was digested with 20 units of Xhol (Boehringer Mannheim) and 20 units of Ncol (Boehringer Mannheim) in "Boehringer Mannheim buffer H" at 37°C for two hours. The digest was treated with 20 units of alkaline phosphatase (Boehringer Mannheim) at 37°C for 30 minutes. The digest was purified on a 1% agarose gel, and the 4215 by fragment was isolated using the freeze-squeeze method.
The oligonucleotides 14405 [5'-TCG AGT AAA CAG AAG
GTC ACC GGC TTG GAC TTC ATA CCT GGG CTG GAC CCC ATA CTG ACA
TTG TCT AAA ATG GAC CAG ACA CTG GCA GTC TAT CAA CA-3' (SEQ
ID N0:19)] and 14406 [5'-GAT CTG TTG ATA GAC TGC CAG.TGT CTG
GTC CAT TTT AGA CAA TGT CAG TAT GGG GTC CAG CCC AGG TAT GAA
GTC CAA GCC GGT GAC CTT CTG TTT AC-3' (SEQ ID N0:20)] were kinased in the presence of lx kinase buffer, 50 mM Tris-HC1 pH 5.0, 10 mM MgCl2, 0.5 mM ATP, 1 mM DTT, and 5 units T4 polynucleotide kinase (GIBCO BRL) at 37°C for 30 minutes.
The Xhol/Ncol linearized pHS767 vector and 14405 and 13406 linkers were ligated in the presence of lx Kinase buffer, 0.5 mM ATP and 1 unit T4 DNA ligase (GIBCO BRL) at 16°C overnight. The ligation products are transformed into E. coli BL21(DE3) (Novagen) and colonies growing on TY
plates supplemented with 10 ~g/mL of tetracycline are analyzed. Plasmid DNA is isolated, then subjected to DNA
sequencing on a PE-Applied Biosystems 370 DNA sequencer.
Plasmids containing the expected 400 by Ndel to BamHI
fragment are kept, and are designated pHS775.
Example 5 Expression plasmid for the Protein of SEQ ID N0:4 (pHS785) Plasmid vector pHS775 (40 ug) was digested with 20 units of Pmll (New England Biolab) in "New England Biolab buffer 1" at 37°C for two hours. The buffer salts were adjusted to "New England Biolab buffer 3," 20 units of BstXI
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 (New England Biolab) were added, and the plasmid was digested for 2 hours at 55°C. After that, the digest was treated with 20 units of alkaline phosphatase (Boehringer Mannheim) at 37°C for 30 minutes. The digest was purified on a 1% agarose gel, and the 4170 by fragment was isolated using the freeze-squeeze method.
The oligonucleotides 13824 [5'-TGA GGC TTC CAG GAC
TCC CCC CAG ACT GTC CAA TGT CTC CAG GCC ACT GGC GTC TGG CAA
GTG GCA ACT TTT AGA GAA GGC CAG CAC-3'(SEQ ID N0:21)] and 13825 [5'-GTG CTG GCC TTC TCT AAA AGT TGC CAC TTG CCA GAC
GCC AGT GGC CTG GAG ACA TTG GAC AGT CTG GGG GGA GTC CTG GAA
GCC-3'(SEQ ID N0:22)] were kinased in the presence of lx kinase buffer, 50 mM Tris-HC1 pH 8.0, 10 mM MgCl2, 0.5 mM
ATP, 10 mM DTT, and 5 units T4 polynucleotide kinase (GIBCO
BRL ) .
The Pmll/BstXI linearized pHS775 vector, and the 13824 and 13825 linkers, were ligated in the presence of lx kinase buffer, 0.5 mM ATP and 1 unit T4 DNA ligase (GIBCO
BRL) at 16°C overnight. The ligation products are transformed into E. coli BL21(DE3) (Novagen) and colonies growing on TY plates supplemented with 10 ~.g/mL of tetracycline are analyzed. Plasmid DNA is isolated, then subjected to DNA sequencing on a PE-Applied Biosystems 370 DNA sequencer. Plasmids containing the expected 400 by Ndel to BamHI fragment are kept, and are designated pHS785.
Example 6 Transformation of E. coli with expression plasmids The expression plasmids were transformed into E.
coli cells. Competent E. coli cells (100 ~,L) were transformed with 10 ng of the expression plasmids described earlier. The transformation mixtures were plated in TY-agar plates containing tetracycline (10 ~g/mL)) Transformants were picked and used to grow 10 L cultures.
Cells harboring the expression plasmid for the desired protein were grown overnight at 37°C in 1 L of 2xTY
SUBSTITUTE SHEET { rule 26 ) medium containing tetracycline (10 ~g/mL). After overnight growth, 100 mL of a culture were inoculated into 10 L of medium. When the culture optical density reached 0.6 O.D., expression of the particular protein was induced by adding TPTG to a concentration of 10 ~M. After 3 hours, the E.
coli cells were harvested, and granules were isolated for protein purification.
The techniques of transforming cells with the aforementioned vectors are well-known in the art [Maniatis, T., et al. Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1988); Id., Current Protocols in Molecular Biology (1989), and supplements thereof]. The techniques involved in the transformation of E. coli cells used in the preferred practice of the invention as exemplified herein are well known in the art. The precise conditions under which the transformed E. coli cells are cultured is dependent on the nature of the E. coli host cell line and the expression or cloning vectors employed. For example, vectors which incorporate thermoinducible promoter-operator regions) such as the c1857 thermoinducible lambda-phage promoter-operator region, require a temperature shift from about 30°C to about 40°C. in the culture conditions so as to induce protein synthesis.
In the preferred embodiment of the invention, E.
coli K12 RV308 cells are employed as host cells, but numerous other cell lines are available, such as, but not limited to, E. coli K12 L201, L687, L693, L507, L640) L641, L695, L814 {E. coli B). The transformed host cells are then plated on appropriate media under the selective pressure of the antibiotic corresponding to the resistance gene present on the expression plasmid. The cultures are then incubated for a time and temperature appropriate to the host cell line employed.
Proteins that are expressed in high-level bacterial expression systems characteristically aggregate in SUBSTITUTE SHEET ( rule 26 ) granules or inclusion bodies which contain high levels of the overexpressed protein [Kreuger, J. K., et al., in Protein Folding, Gierasch, L. M. and King, J., eds., American Association for the Advancement of Science Publication No. 89-185, Washington, D.C., 136-142 (1990)].
Such protein aggregates must be dissolved to provide further purification and isolation of the desired protein product.
[Kreuger, J. K., et al., supra.]. A variety of techniques using strongly denaturing solutions such as guanidinium-HC1 and/or weakly denaturing solutions such as urea are used to solubilize the proteins. Removal of the denaturing agents allows the denatured protein to assume its native conformation. The particular conditions for denaturation and folding are determined by the particular~protein expression system and/or the protein in question.
Preferably, the present proteins are expressed with a leader sequence. One of ordinary skill in the art would recognize that numerous leader sequences are operable.
However, the leader sequence is preferably Met-R1-, wherein R1 is any amino acid except Pro or is absent, so that the expressed proteins may be readily converted to the claimed protein with Cathepsin C, or other suitable aminopeptidases.
Preferably, R1 is Arg, Asp, or Tyr; and most preferably, the proteins are expressed with a Met-Arg leader sequence.
Interestingly, the leader sequence does not significantly affect stability or activity of the protein. Nevertheless, the leader sequence is preferably cleaved from the protein.
Thus, the proteins of the Formula: Met-R1-SEQ ID NO:1 are useful as biological agents and, preferably, as intermediates.
SUBSTITUTE SHEET ( rule 26 ) Example 7 The Protein of the Formula: Met-Arg-SEQ ID N0:4 The protein of SEQ ID N0:4 with a Met-Arg leader sequence was expressed in E. coli as previously described.
Granules were solubilized in 8 M urea containing 5 mM
cysteine. The protein was purified by anion exchange in 8 M
urea containing 5 mM cysteine and folded by dilution into 8 M urea (containing 5 mM cysteine) and exhaustive dialysis against phosphate-buffered saline (PBS). Little to no aggregation of the protein was seen. Following final purification of the protein by size exclusion chromatography, the protein was concentrated to 3-3.5 mg/mL
in PBS.
Example 8 The Protein of the Formula SEQ ID N0:3 The protein of SEQ ID N0:3 with a Met-Arg leader sequence was expressed in E. coli, isolated and folded by techniques analogous to the previous Examples. The pH of the protein solution was reduced to pH 2.8. The Met-Arg leader sequence was cleaved by the addition of 6-10 milliunits dDAP per mg of protein (dDAP is the abbreviation for a dipeptidylaminopeptidase isolated from the slime mold, Dicteostelium descoidium, described by Atkinson, P. R., et al., U.S. Patent No. 5,565,330, issued October 15, 1996).
The conversion reaction was allowed to proceed for 2-8 hours at room temperature. The progress of the reaction was monitored by high performance reversed phase chromatography.
The reaction was terminated by adjusting the pH to 8 with NaOH. The des(Met-Arg) protein was further purified by cation exchange chromatography in the presence of 7-8 M urea and size exclusion chromatography in PBS. Following final purification of the proteins by size exclusion chromatography the proteins were concentrated to 3-3.5 mg/mL
in PBS. Virtually no aggregation of either protein was noted.
SUBSTITUTE SHEET ( rule 26 ) The purification.of the claimed proteins is by techniques known in the art and includes reversed phase chromatography, affinity chromatography, ion exchange and size exclusion chromatography.
The claimed proteins contain two cysteine residues. Thus, a disulfide bond may be formed to stabilize the protein. The present invention includes proteins of the Formula (I) wherein the Cys at position 96 is cross-linked to Cys at position 146 as well as those proteins without such disulfide bonds. Preferably, the Cys at position 96 is disulfide bonded to the Cys at position 146. In addition the proteins of the present invention may exist, particularly when formulated, as dimers, trimers, tetramers, and other multimers. Such multimers are included within the scope of the present invention.
The present invention provides a method for treating obesity. The method comprises administering to the organism an effective amount of anti-obesity protein in a dose between about 1 and 1000 ~.g/kg. A preferred dose is from about 10 to 100 ~g/kg of active protein. A typical daily dose for an adult human is from about 0.5 to 100 mg.
In practicing this method, proteins of the Formula (I) can be administered in a single daily dose or in multiple doses per day. The treatment regime may require administration over extended periods of time. The amount per administered dose or the total amount administered will be determined by the physician and depend on such factors as the nature and severity of the disease, the age and general health of the patient and the tolerance of the patient for the protein.
The instant invention further provides pharmaceutical formulations comprising proteins of the present invention. The proteins, preferably in the form of a pharmaceutically acceptable salt, can be formulated for parenteral administration for the therapeutic or prophylactic treatment of obesity. For example, proteins of the Formula (I) can be admixed with conventional SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 ~ PCT/LTS97/23549 pharmaceutical carriers and excipients. The compositions comprising claimed proteins contain from about 0.1 to 95% by weight of the active protein, preferably in a soluble form, and more generally from about 10 to 30%. Furthermore, the present proteins may be administered alone or in combination with other anti-obesity agents or agents useful in treating diabetes. For intravenous (i.v.) use, the protein is administered in commonly-used intravenous fluids) and administered by infusion. Such fluids, for example, physiological saline, Ringer s solution or 5% dextrose solution can be used. For intramuscular preparations, a sterile formulation, preferably a suitable soluble salt form of a protein of the Formula (I), for example the hydrochloride salt, can be dissolved and administered in a pharmaceutical diluent such as pyrogen-free, distilled water, physiological saline, or 5% glucose solution. A
suitable insoluble form of the protein may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g., an ester of a long chain fatty acid such as ethyl oleate.
Pharmaceutically acceptable preservatives such as an alkylparaben, particularly methylparaben, ethylparaben, propylparaben, or butylparaben or chlorobutanol are preferably added to the formulation to allow multi-dose use.
Significantly, the claimed proteins having Asp or Glu at position 100 are also stable in the presence of a phenolic preservative, such as, m-cresol or phenol. Proteins with one of these replacements are highly preferred for that reason. The stability of the proteins in the presence of a phenolic preservative offers advantages in pharmaceutical delivery, including, enhanced preservative effectiveness.
The formulation is preferably prepared in the absence of salt to minimize the ionic strength of the formulation.
The, ability of the present proteins to treat obesity is demonstrated in vivo, as follows.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 ~ PCT/US97/23549 Biological Testing Parabiotic experiments suggest that a protein is released by peripheral adipose tissue and that the protein is able to control body weight gain in normal, as well as obese mice. Therefore, the most closely related biological test is to inject the test protein by any of several routes of administration (e.g., i.v., s.c., i.p., or by minipump or cannula) and then to monitor food and water consumption, body weight gain, and also plasma chemicals or hormones, such as glucose, insulin, ACTH, corticosterone, GH, or T4 over various time periods. Suitable test animals include normal mice (ICR, etc.) and obese mice (ob/ob, Avy/a, KK-Ay, tubby, fat). The ob/ob mouse model of obesity and diabetes is generally accepted in the art as being indicative.of the obesity condition. Control for non-specific effects for these injections is accomplished by administering the vehicle without the protein in the same animal model, and monitoring the same parameters. Alternatively, the protein itself is administered to animals that are thought to lack the protein receptor, such as, db/db mice or fa/fa or cp/cp rats. Proteins demonstrating activity in these models will demonstrate similar activity in other mammals, particularly humans.
Since the target tissue is expected to be the hypothalamus where food intake and lipogenic state are regulated, an alternate study involves injecting a protein directly into the brain of test animals, for example, by i.c.v. injection via the lateral or third ventricles, or by injection directly into specific hypothalamic nuclei, such as, the arcuate, paraventricular, or perifornical nuclei.
The same parameters as above could be measured, or the release of neurotransmitters that are known to regulate feeding or metabolism could be monitored (e. g., NPY, galanin, norepinephrine, dopamine, ~3-endorphin release).
Similar studies are accomplished in vitro using isolated hypothalamic tissue in a perifusion or tissue bath SUBSTITUTE SHEET ( rule 26 ) system. In this situation, the release of neurotransmitters or electrophysiological changes is monitored.
The proteins used to carry out the experiments that are reported in Examples 9 and 10 were prepared in accordance with the teachings and examples provided herein.
Amino acid sequences of the proteins were confirmed by mass spectroscopy and/or amino acid analysis. The proteins were folded with the Cys residues cross-linked by a disulfide bond when tested.
Example 9 Testing of Proteins of SEQ ID N0:2 and 3 in Male ob/ob Mice Male ob/ob mice [Harlan, Ltd., Blackthorn, England] were housed in groups of 5 animals each and provided with Purina 5008 chow and water ad Iibitum. The mice were maintained on a reverse lighting schedule (lights off at 9:00 A.M., and on at 9:00 P.M.). The mice were weighed daily at 8:30 A.M. Their food and water consumption were determined at the same time. Treatment, as indicated below, were made following the morning weighing, just prior to lights out. The mice were treated once daily for 4 days.
Group Treatment (n=5) 1 PBS 0.2 mL/day, S.C.

2 Protein 30 ~,g/0.2 mL/day, S.C.

3 Protein 300 ~,g/0.2 mL/day, S.C.

The effects of these treatments on food consumption and cumulative body weight change are illustrated for representative proteins of the present invention in Tables 1 and 2.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 ~ PCT/LTS97/23549 Table 1. Effect of SEQ ID.N0:2 on food consumption and cumulative body weight change in ob/ob mice Food Consumption Body Weight (g/day) Change (g) Day Group Group Group Group Group Group 1 4.4 4.6 3.4 +0.5 -0.4 -0.4 2 5.3 4.7 2.8 ~+0.4 -0.8 -1.1 3 4.8 4.2 2.2 +0.6 -0.6 -1.5 4 5.1 3.6 1.7 +0.9 -1.2 -2.9 Table 2. Effect of SEQ ID N0:3 on food consumption and cumulative body weight change in ob/ob mice Food Consumption Body Weight (g/day) Change (g) Day Group Group Group Group Group Group 1 5.0 4.5 3.1 -0.3 -0.2 -1.0 2 5.4 3.5 2.2 0.0 -0.8 -2.0 3 5.2 3.3 1.8 +0.1 -1.0 -2.8 Group 1 = Control (PBS); Group 2 - 30 ~g/day of protein;
Group 3 - 300 ~g/day of protein Example 10 Analysis of Aggregation by Dynamic Light Scatteriag (DLS) The physical properties of the present proteins are demonstrated as follows. Based on availability of material, the solution analyzed by DLS was prepared in one of two ways. Material from the last size exclusion chromatography purification step, at approximately 1.5 mg/mL
in PBS, was either concentrated to about 3 or 5 mg/mL by diafiltration, or was dialyzed against water, lyophilized, and then reconstituted to about 3 or 5 mg/mL.
In the first method the protein solution at approximately 1.5 mg/mL was concentrated to greater than about 3 or 5 mg/mL in a small volume stir cell (10 mL) using an Amicon YM10, 25-mm membrane. This was conducted under cold room conditions (about 5°C). Protein concentration was determined by W absorption, and the solution was diluted to SUBSTITUTE SHEET { rule 26 ) about 3.0 mg/mL or 5 mg/mL.with PBS (10-fold water dilution of lOx PBS without Ca/Mg, GIBCO BRL).
A second alternative method, used when lyophilization was feasible, consisted of dialyzing the solution of protein against water, using three to five exchanges of water at about 4°C. A typical dialysis membrane was the Spectra/Por-7 dialysis membrane, 2000 molecular weight cutoff membrane (Spectrum Medical Industries, Los Angeles, CA). The material was concentrated as above to 3 to 4 mg/mL and typically a 2 mg quantity was lyophilized in a 5 mL vial. For DLS analysis this plug was reconstituted with water to greater than 3.3 mg/mL or greater than 5 mg/mL. Several vials were typically pooled.
Protein concentration was determined by W at peak maximum (typically 280-nm). The protein concentration was diluted to about 3 or 5 mg/mL with a combination of water and 10x PBS (without Ca/Mg, GIBCO BRL) to yield a final PBS
concentration of lx.
The protein solution at 3.0 mg/mL or at 5 mg/mL in lx PBS was adjusted to 7.4 with HC1/NaOH and passed through a 0.1 ~m Anotopl"'-10 filter (Whatman International, Ltd.) Maidstone, England) into a DLS cell. The average cumulant particle size was measured on a Brookhaven BI-9000 DLS
instrument (Brookhaven Instruments, Holtsville, NY) with a Lexel argon-ion laser every 15 minutes using a 30 second duration at a 90° angle. A 488-nm filter with a 400 ~m pinhole was assumed. At the 37°C incubation temperature a viscosity of 0.6915 centipoise (cP) and refractive index of 1.333 was used. The light-weighted average particle size was calculated by a cumulant method using the measured auto-correlation baseline.
The estimated time required for various anti-obesity proteins to reach an averaged light-weighted particle size of 50 nm in a PBS solution at pH 7.4 and 37°C is shown in Table 3. The averaged light-weighted particle size was determined from a cumulant analysis of SUBSTITUTE SHEET ( rule 26 ) a binodal distribution composed of monomeric and higher-order aggregate populations. The time necessary to achieve an average aggregate size of 50 nm was estimated by plotting size as a function of time. The proteins were folded with the Cys residues cross-linked by a disulfide bond when tested.
Table 3. Estimated time (minutes) required for various anti-obesity proteins to reach an averaged light-weighted particle size of 50 nm in a PBS solution at pH 7.4 and 37°C.
Estimated Time to Reach nm (min) Protein 3 mg/mL 5 mg/mL

Human Ob Protein 2 u.d.

SEQ ID N0:2 871 n.d.

SEQ ID N0:3 543 n.d.

SEQ ID N0:5 835 342 SEQ ID N0:6 2,399 75g The data in Table 3 demonstrate the dramatic reduction in the propensity of the claimed proteins to aggregate.
The claimed proteins are active in at least one of the above biological tests and are anti-obesity agents. As such, they are useful in treating obesity and those disorders implicated by obesity. However, the proteins are not only useful as therapeutic agents. One skilled in the art recognizes that the proteins are useful in the production of antibodies for diagnostic use and, as proteins, are useful as feed additives for animals.
Furthermore, the proteins are useful for controlling weight for cosmetic purposes in mammals. A cosmetic purpose seeks to control the weight of a mammal to improve bodily appearance. The mammal is not necessarily obese. Such cosmetic use forms part of the present invention.
The principles, preferred embodiments and modes of operation of the present invention have been described in SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 ~ - PCT/US97/23549 the foregoing specification. The invention which is intended to be protected is not limited to the particular forms disclosed, since they are to be regarded as illustrative rather than restrictive. Variations and changes may be made by those skilled in the art without departing from the spirit of the invention.
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 ~ PCT/US97I23549 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Beals, John M
Hoffmann, James A
Kline, Allen D
Schevitz, Richard W
Zhang, Forming (ii) TITLE OF INVENTION: Anti-Obesity Proteins (iii) NUMBER OF SEQUENCES: 22 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Eli Lilly and Company (B) STREET: Lilly Corporate Center (C) CITY: Indianapolis 2 0 (D) STATE: Indiana (E) COUNTRY: U.S.A.
(F) ZIP: 46285 (v) COMPUTER READABLE FORM:

2 (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 3 (vi) CURRENT APPLICATION DATA:
O

(A) APPLICATION NUMBER: WO N/A (w/ Filing) (B) FILING DATE:

(C) CLASSIFICATION:

3 (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Caltrider, Steven P

(B) REGISTRATION NUMBER: 36,467 (C) REFERENCE/DOCKET NUMBER: X-11092 4 (ix) TELECOMMUNICATION INFORMATION:
O

(A) TELEPHONE: (317) 276-0757 (B) TELEFAX: (317) 277-1917 4 5 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 146 amino acids (B) TYPE: amino acid 5 0 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 1 (D) OTHER INFORMATION: /note= "Xaa at position 1 is Val or 6 0 absent ; ~~
(ix) FEATURE:
(A) NAME/KEY: Modified-site (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "Xaa at position 2 is Pro or SUBSTITUTE SHEET ( rule 26 ) absent;"
(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 22 (D) OTHER INFORMATION: /note= "Xaaat position22 is Asn or Ser;"

(ix) FEATURE:

1 {A) NAME/KEY: Modified-site (B) LOCATION: 28 (D) OTHER INFORMATION: /note= "Xaaat position28 is Gln or absent;"

( ix) FEATURE

(A) NAME/KEY: Modified-site (B) LOCATION: 72 (D) OTHER INFORMATION: /note= "Xaaat position72 is Asn, Gln, Glu or Asp;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 73 (D) OTHER INFORMATION: /note= "Xaaat position73 is Val 2 or Met ; "

(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 100 3 {D) OTHER INFORMATION: /note= "Xaaat position100 is 0 Trp, Gln, Glu, Asp, Ser, Thr, Lys, His,..."
or (ix) FEATURE:

(A) NAME/KEY: Modified-site 3 (B) LOCATION: 138 (D) OTHER INFORMATION: /note= "Xaaat position138 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His,Arg;said protein or having at least one of the following:"

4 (ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 1 (D) OTHER INFORMATION: /note= "Xaaat position1 is replaced with Glu, Asp, Ser, Thr, His,or Arg;"
Lys, (ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 2 {D) OTHER INFORMATION: /note= "Xaaat position2 is 50 replaced with Glu, Asp, Ser, Thr, His,or Arg;"
Lys, (ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 3 55 (D) OTHER INFORMATION: /note= "Ileat position3 is replaced with Glu, Asp, Arg, Lys, or His;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site 6 (B) LOCATION: 30 (D) OTHER INFORMATION: /note= "Valat position30 is replaced with Glu, Asp, Arg, Lys, is;"
or H

(ix} FEATURE:
65 (A) NAME/KEY: Modified-site SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCTIUS97/23549 (B) LOCATION: 36 (D) OTHER INFORMATION: /note= "Val at position 36 is replaced with Glu, Asp, Arg, Lys, or His;"
(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 41 (D) OTHER INFORMATION: /note= "Phe at position 41 is replaced with Glu, Asp, Arg, Lys, or His;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 42 (D) OTHER INFORMATION: /note= "Ile at position 42 is replaced with Glu, Asp, Arg, Lys, or His;"

( i.x) FEATURE

(A) NAME/KEY: Modified-site (B) LOCATION: 43 2 (D) OTHER INFORMATION: /note= "Pro at position 0 43 is replaced with Glu, Asp, Arg, Lys, or His;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site 2 (B) LOCATION: 45 (D) OTHER INFORMATION: /note= "Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;"

(ix) FEATURE:

3 (A) NAME/KEY: Modified-site (B) LOCATION: 46 (D) OTHER INFORMATION: /note= "His at position 46 is replaced with Glu, Asp) Arg) or Lys;"

3 {ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 47 (D) OTHER INFORMATION: /note= "Pro at position 47 is replaced with Glu, Asp, Arg, Lys, or His;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 48 (D) OTHER INFORMATION: /note= "Ile at position 48 is 4 replaced with Glu, Asp, Arg, Lys, 5 or His;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 49 5 (D) OTHER INFORMATION: /note= "Leu at position 0 49 is replaced with Glu, Asp, Arg) Lys, or His;"

(ix) FEATURE:

(A) NAME/KEY: Modified-site 5 (B) LOCATION: 50 (D) OTHER INFORMATION: /note= "Thr at position 50 is replaced with Glu) Asp, Arg, Lys, or His;"

(ix) FEATURE:

6 (A) NAME/KEY: Modified-site (B) LOCATION: 74 (D) OTHER INFORMATION: /note= "Ile at position 74 is replaced with Gln, Gly, Asp, Arg, Thr or Ser;"
Lys, His, 65 (ix) FEATURE:

SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 (A) NAME/KEY: Modified-site (B) LOCATION: 89 (D) OTHER INFORMATION: /note= "Valat position 89 is replaced with Gln, Glu, Asp, Arg, His,Thr or Ser;"
Lys, (ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 92 (D) OTHER INFORMATION: /note= "Pheat position 92 is replaced with Gln, Glu, Asp, Arg, His,Thr or Ser;~~
Lys, (ix) FEATURE:

(A) NAME/KEY: Modified-site (B) LOCATION: 99 (D) OTHER INFORMATION: /note= "Proat position 99 is replaced with Gln, Glu, Asp, Arg, His,Thr or Ser; or"
Lys, (ix) FEATURE:

(A) NAME/KEY: Modified-site 2 (B) LOCATION: 142 (D) OTHER INFORMATION: /note= ~~Leuat position 142 is replaced with Glu, Asp, Arg, Lys, r a pharmaceutically or His; o acceptable salt thereof."

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: l:
Xaa Xaa Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Xaa Asp Ile Ser His Thr Xaa Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile 4 0 Leu Thr Ser Met Pro Ser Arg Xaa Xaa Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Xaa Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Xaa Gln Leu Asp Leu Ser Pro 5 5 Gly Cys (2) INFORMATION FOR SEQ ID N0:2:
60 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 146 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/LTS97/23549 (ii) MOLECULE TYPE: protein (xi) SEQUENCE :2:
DESCRIPTION:
SEQ
ID

Val ProIle Gln Lys Val AspAspThr LysThrLeu IleLysThr Gln Ile ValThr Arg Ile Asn IleSerHis ThrGlnSer ValSerSer Asp Lys GlnLys Val Thr Gly AspPheIle ProGlyLeu AspProile Leu Leu ThrLeu Ser Lys Met GlnThrLeu AlaValTyr GlnGlnIle Asp 2 Leu ThrSer Met Pro Ser AsnValIle GlnIleSer AsnAspLeu 0 Arg Glu AsnLeu Arg Asp Leu HisValLeu AlaPheSer LysSerCys Leu His LeuPro Trp Ala Ser LeuGluThr LeuAspSer LeuGlyGly Gly Val LeuGlu Ala Ser Gly SerThrGlu ValValAla LeuSerArg Tyr Leu GlnGly Ser Leu Gln MetLeuTrp GlnLeuAsp LeuSerPro Asp 3 Gly Cys (2) INFORMATI ON FOR SEQ ID
N0:3:

4 (i) SEQUENCE
O CHARACTERISTICS:

(A)LENGTH: 146 amino acids (B)TYPE: amino acid (C)STRANDEDNESS: e singl (D)TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
ial Pro Ile Gln 5ys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Asp Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 65 70 . 75 80 Glu Asn Leu Arg Asp Leu Leu ValLeuAla PheSerLys SerCys His His Leu Pro Trp Ala Ser Gly GluThrLeu AspSerLeu GlyGly Leu Val Leu Glu Ala Ser Gly Tyr ThrGluVal ValAlaLeu SerArg Ser Leu Gln Gly Ser Leu Gln Asp LeuTrpGln LeuAspLeu SerPro Met Gly Cys (2) INFORMATION
FOR
SEQ
ID N0:4:

2 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 146 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:4:

ial Pro IleGln5ys ValGlnAsp AspThrLys ThrLeuIle LysThr Ile Val ThrArgIle AsnAspIle SerHisThr GlnSerVal SerSer Lys Gln LysValThr GlyLeuAsp PheIlePro GlyLeuAsp ProIle Leu Thr LeuSerLys MetAspGln ThrLeuAla ValTyrGln GlnIle 4 Leu Thr SerMetPro SerArgAsn ValIleGln IleSerAsn AspLeu Glu Asn LeuArgAsp LeuLeuHis ValLeuAla PheSerLys SerCys His Leu ProAspAla SerGlyLeu GluThrLeu AspSerLeu GlyGly Val Leu GluAlaSer GlyTyrSer ThrGluVal ValAlaLeu SerArg Leu Gln GlySerLeu GinAspMet LeuTrpGln LeuAspLeu SerPro 6 Gly Cys (2) INFORMATION OR
F SEQ
ID
N0:5:

(i) SEQUENCE CHARACTERISTICS:

SUBSTITUTE SHEET ( rule 26 ) WO 98/Z8414 . . PCT/US97/23549 (A) LENGTH: 146 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: :5:

Val Pro Ile Gln Lys Val Gln AspThrLys ThrLeuIle LysThr Asp Ile Val Thr Arg Ile Asn Asp SerHisThr GlnSerVal SerSer Ile Lys Gln Lys Val Thr Gly Leu PheIlePro GlyLeuHis ProAsp Asp Leu Thr Leu Ser Lys Met Asp ThrLeuAla ValTyrGln GlnIle Gln 2 Leu Thr Ser Met Pro Ser Arg ValIleGln IleSerAsn AspLeu 5 Asn Glu Asn Leu Arg Asp Leu Leu ValLeuAla PheSerLys SerCys His His Leu Pro Asp Ala Ser Gly GluThrLeu AspSerLeu GlyGly Leu Val Leu Glu Ala Ser Gly Tyr ThrGluVal ValAlaLeu SerArg Ser Leu Gln Gly Ser Leu Gln Asp LeuTrpGln LeuAspLeu SerPro Met 4 Gly Cys (2) INFORMATION
FOR
SEQ
ID N0:6:

4 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 146 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Asp Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 2 0 Gly Cys (2) INFORMATION FOR SEQ ID N0:7:
2 5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 146 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
ial Pro Ile Gln 5ys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile 50 Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Asp Ser Lys Ser Cys His Leu Pro Asp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 6 5 Gly Cys SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 (2) INFORMATION
FOR
SEQ
ID N0:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 148 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: :8:

Met Arg Val Pro Ile Gln GlnAsp Asp Thr Lys Thr Leu Lys Val Ile Lys Thr Ile Val Thr Arg AspIle Ser His Thr Gln Ser Ile Asn Val Ser Ser Lys Gln Lys Val LeuAsp Phe Ile Pro Gly Leu Thr Gly Asp Pro Ile Leu Thr Leu Ser AspGln Thr Leu Ala Val Tyr Lys Met Gln 3 Gln Ile Leu Thr Ser Met ArgAsn Val Ile Gln Ile Ser 0 Pro Ser Asn Asp Leu Glu Asn Leu Arg LeuHis Val Leu Ala Phe Ser Asp Leu Lys Ser Cys His Leu Pro Trp GlyLeu Glu Thr Leu Asp Ser Ala Ser Leu Gly Gly Val Leu Glu Ala TyrSer Thr Glu Val Val Ala Ser Gly Leu Ser Arg Leu Gln Gly Ser AspMet Leu Trp Gln Leu Asp Leu Gln Leu 4 Ser Pro Gly Cys (2) INFORMATION
FOR
SEQ
ID N0:9:

5 (i) SEQUENCE CHARACTERISTICS:
O

(A) LENGTH: 148 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
Met Arg Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Lys Thr Ile Val Thr Arg AsnAspIleSer HisThrGln SerVal Il.e Ser Ser 35s Gln Lys Val GlyLeuAspPhe IleProGly LeuHis Thr Pro Asp Leu Thr Leu Ser MetAspGlnThr LeuAlaVal TyrGln Lys Gln Ile Leu Thr Ser Met SerArgAsnVal IleGlnIle SerAsn Pro Asp Leu Glu Asn Leu Arg LeuLeuHisVal LeuAlaPhe SerLys Asp Ser Cys His Leu Pro Trp SerGlyLeuGlu ThrLeuAsp SerLeu Ala Gly Gly Val Leu Glu Ala GlyTyrSerThr GluValVal AlaLeu Ser Ser Arg Leu Gln Gly Ser GlnAspMetLeu TrpGlnLeu AspLeu Leu 2 Ser Pro Gly Cys (2) INFORMATION
FOR
SEQ
ID NO:10:

30 (i) SEQUENCE :
CHARACTERISTICS

(A) LENGTH: 148 aminocids a (B) TYPE: amino acid (C) STRANDEDNESS: e singl (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
NO:10:

Met Arg ValProIle GlnLysVal GlnAspAspThr LysThrLeu Ile Lys Thr IleValThr ArgIleAsn AspIleSerHis ThrGlnSer Val Ser Ser LysGlnLys ValThrGly LeuAspPheIle ProGlyLeu Asp Pro Ile LeuThrLeu SerLysMet AspGlnThrLeu AlaValTyr Gln 55 Gln Ile LeuThrSer MetProSer ArgAsnValIle GlnIleSer Asn Asp Leu GluAsnLeu ArgAspLeu LeuHisValLeu AlaPheSer Lys Ser Cys HisLeuPro AspAIaSer GlyLeuGluThr LeuAspSer Leu Gly Gly ValLeuGlu AlaSerGly TyrSerThrGlu ValValAla Leu SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97/23549 Ser Arg Leu Gln Gly Ser Asp MetLeuTrp GlnLeuAsp Leu Gln Leu Ser Pro Gly Cys (2) INFORMATION
FOR
SEQ
ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 148 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION:
SEQ ID N0:11:

Met Arg Val Pro Ile Gln Gln AspAspThr LysThrLeu Lys Val Ile Lys Thr Ile Val Thr Arg Asp IleSerHis ThrGlnSer Ile Asn Val Ser Ser Lys Gln Lys Val Leu AspPheIle ProGlyLeu Thr Gly His Pro Asp Leu Thr Leu Ser Asp GlnThrLeu AlaValTyr Lys Met Gln 3 Gln Ile Leu Thr Ser Met Arg AsnValIle GlnIleSer 5 Pro Ser Asn Asp Leu Glu Asn Leu Arg Leu HisValLeu AlaPheSer Asp Leu Lys Ser Cys His Leu Pro Asp Gly LeuGluThr LeuAspSer Ala Ser Leu Gly Gly Val Leu Glu Ala Tyr SerThrGlu ValValAla Ser Gly Leu Ser Arg Leu Gln Gly Ser Asp MetLeuTrp GlnLeuAsp Leu Gln Leu 5 Ser Pro Gly Cys (2) INFORMATION
FOR
SEQ
ID N0:12:

5 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 148 amino acids (B) TYPE: amino acid {C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . . PCT/C1S97/23549 (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:12:

Met Arg Val Pro Ile Gln Val GlnAspAsp ThrLysThr LeuIle Lys Lys Thr Ile Val Thr Arg Asn AspIleSer HisThrGln SerVal Ile Ser Ser Lys Gln Lys Val Gly LeuAspPhe IleProGly LeuHis Thr Pro Ile Leu Thr Leu Ser Met AspGlnThr LeuAlaVal TyrGln Lys Gln Ile Leu Thr Ser Met Ser ArgAsnVal IleGlnIle SerAsn Pro Asp Leu Glu Asn Leu Arg Leu LeuHisVal LeuAlaAsp SerLys Asp Ser Cys His Leu Pro Trp Ser GlyLeuGlu ThrLeuAsp SerLeu Ala Gly Gly Val Leu Glu Ala Gly TyrSerThr GluValVal AlaLeu Ser Ser Arg Leu Gln Gly Ser Gln AspMetLeu TrpGlnLeu AspLeu Leu 3 Ser Pro Gly Cys (2) INFORMATION
FOR
SEQ
ID N0:13:

3 (i) SEQUENCE
5 CHARACTERISTICS:

(A) LENGTH: 148 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: e singl (D) TOPOLOGY: linear (ii) MOLECULE
TYPE:
protein (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:13:

Met ArgVal ProIleGln LysValGln AspAspThr LysThrLeu Ile Lys ThrIle ValThrArg IleAsnAsp IleSerHis ThrGlnSer Val Ser SerLys GlnLysVal ThrGlyLeu AspPheIle ProGlyLeu His Pro IleLeu ThrLeuSer LysMetAsp GlnThrLeu AlaValTyr Gln 60 Gln IleLeu ThrSerMet ProSerArg AsnValIle GlnIleSer Asn Asp LeuGlu AsnLeuArg AspLeuLeu HisValLeu AlaAspSer Lys SUBSTITUTE SHEET ( rule 26 ) Ser Cys His Leu Pro Asp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys (2) INFORMATION
FOR
SEQ
ID N0:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 458 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:14:

CATATGAGGGTACCTATCCA AAAAGTACAA GATGACACCAAAACACTGAT AAAGACAATA

GTCACAAGGATAAATGATAT CTCACACACA CAGTCAGTCTCATCTAAACA GAAAGTCACA

GGCTTGGACTTCATACCTGG GCTGCACCCC ATACTGACATTGTCTAAAAT GGACCAGACA

1ao CTGGCAGTCTATCAACAGAT CTTAACAAGT ATGCCTTCTAGAAACGTGAT ACAAATATCT

TTGCCATGGGCCAGTGGCCT GGAGACATTG GACAGTCTGGGGGGAGTCCT GGAAGCCTCA

GGCTATTCTACAGAGGTGGT GGCCCTGAGC AGGCTGCAGGGGTCTCTGCA AGACATGCTG

TGGCAGCTGGACCTGAGCCC CGGGTGCTAA TAGGATCC

(2) INFORMATION
FOR SEQ
ID N0:15:

(i) SEQUENCE
CHARACTERISTICS:

5 (A) LENGTH: 119 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 6 (ii) MOLECULE
O TYPE:
cDNA

65 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
SUBSTITUTE SHEET ( rule 26 ) ATCTCACACA CACAGTCAGT CTCGAGTAAA CAGAAAGTCA CAGGCTTGGA CTTCATACCT

(2) INFORMATION FOR SEQ ID N0:16:
1 0 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 123 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
GATCTGTTGA TAGACTGCCA GTGTCTGGTC CATTTTAGAC AATGTCAGGT CGGGGTGCAG
60 .
CCCAGGTATG AAGTCCAAGC CTGTGACTTT CTGTTTACTC GAGACTGACT GTGTGTGTGA

GAT

(2) INFORMATION FOR SEQ ID N0:17:
(i) 5EQUENCE CHARACTERISTICS:
3 5 {A) LENGTH: 87 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 4 O (ii) MOLECULE TYPE: cDNA
4 5 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
TGAGGCTTCC AGGACTCCCC CCAGACTGTC CAATGTCTCC AGGCCACTGG CGTCTGGCAA

(2) INFORMATION FOR SEQ ID N0:18:
5 5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 84 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
SUBSTITUTE SHEET ( rule 26 ) WO 98/28414 . PCT/US97J23549 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
GTGCTGGCCT TCTCTAAAAG TTGCCACTTG CCAGACGCCA GTGGCCTGGA GACATTGGAC

AGTCTGGGGG GAGTCCTGGA AGCC

(2} INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 98 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
TCGAGTAAAC AGAAGGTCAC CGGCTTGGAC TTCATACCTG GGCTGGACCC CATACTGACA

TTGTCTAAAA TGGACCAGAC ACTGGCAGTC TATCAACA

3 0 (2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 98 base pairs (B) TYPE: nucleic acid 3 5 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:

CCCAGGTATG AAGTCCAAGC CGGTGACCTT CTGTTTAC

(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 87 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
SUBSTITUTE SHEET ( ruie 26 ) WO 98/28414 . PCT/US97/23549 TGAGGCTTCC AGGACTCCCC CCAGACTGTC CAATGTCTCC AGGCCACTGG CGTCTGGCAA
GTGGCAACTT TTAGAGAAGG CCAGCAC
5 8~
(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
10 (A) LENGTH: 84 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 15 {ii) MOLECULE TYPE: cDNA
2 0 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
GTGCTGGCCT TCTCTAAAAG TTGCCACTTG CCAGACGCCA GTGGCCTGGA GACATTGGAC

SUBSTITUTE SHEET ( rule 26 )

Claims (15)

we claim:

1. A protein of the Formula (I):

Xaa Xaa Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Xaa Asp Ile Ser His Thr Xaa Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Xaa Xaa Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Xaa Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Xaa Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO:1) (I) wherein:
Xaa at position 1 is Val or absent;
Xaa at position 2 is Pro or absent;
Xaa at position 22 is Asn or Ser;
Xaa at position 28 is Gln or absent;
Xaa at position 72 is Asn, Gln, Glu or Asp;
Xaa at position 73 is Val or Met;
Xaa at position 100 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 138 is Trp, Gln, Glu, Asp, Ser, Thr, Lys, His, or Arg;
said protein having at least one of the following substitutions:
Xaa at position 1 is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg;
Xaa at position 2 is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg;

Ile at position 3 is replaced with Glu, Asp, Arg, Lys, or His;
Val at position 30 is replaced with Glu, Asp, Arg, Lys, or His;
Val at position 36 is replaced with Glu, Asp, Arg, Lys, or His;
Phe at position 41 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 42 is replaced with Glu, Asp, Arg, Lys, or His;
Pro at position 43 is replaced with Glu, Asp, Arg, Lys, or His;
Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;
His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Pro at position 47 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His;
Leu at position 49 is replaced with Glu, Asp, Arg, Lys, or His;
Thr at position 50 is replaced with Glu, Asp, Arg, Lys, or His;
Ile at position 74 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;
Val at position 89 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;
Phe at position 92 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser;
Pro at position 99 is replaced with Gln, Glu, Asp, Arg, Lys, His, Thr or Ser; or Leu at position 142 is replaced with Glu, Asp, Arg, Lys, or His;
or a pharmaceutically acceptable salt thereof.

2. The protein of Claim 1, wherein the Cys at position 96 is disulfide bonded to Cys at position 146.

3. The protein of Claim 2, wherein Xaa at position 1 is Val;
Xaa at position 2 is Pro;
Xaa at position 28 is Gln or absent;
Xaa at position 72 in Asn or Asp;
Xaa at position 100 is Trp, Glu, or Asp;
Xaa at position 138 is Trp, Glu, or Asp; said protein having at least one of the following substitutions:
His at position 46 is replaced with Glu, Asp, Arg, or Lys;
Ile at position 48 is replaced with Glu, Asp, Arg, Lys, or His; or Phe at position 92 is replaced with Glu, Asp, Arg, Lys, or His.

4. The protein of Claim 3, wherein Xaa at position 100 is Trp or Asp, and Xaa at position 138 is Trp.

5. The protein of Claim 2 which has a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID
NO:7.

6. A protein consisting of the protein as claimed in Claim 1, and a leader sequence, wherein, the leader sequence is bonded to the N-terminal of the protein, or a pharmaceutically acceptable salt thereof.

7. The protein of Claim 6, wherein the leader sequence is Met-R1, wherein R1 is absent or is any amino acid except Pro.

8. The protein. of Claim 7, wherein the leader sequence is Met-Arg, Met-Asp, or Met-Tyr.

9. The protein of Claim 8 which has a sequence selected from the group consisting of SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and SEQ ID
NO:13.

10. A pharmaceutical formulation, comprising as an active agent, a protein of Claim 1, or a pharmaceutically acceptable salt thereof, together with one or more pharmaceutically acceptable diluents, carriers or excipients therefor.

11. A DNA polynucleotide compound comprising DNA
that encodes a protein of Claim 1.

12. A DNA polynucleotide compound comprising DNA
that encodes a protein of Claim 6.

13. A process for preparing a protein as claimed in Claim 6, comprising:
(a) transforming a host cell with DNA that encodes the protein;
(b) culturing the transformed host cell such that the protein is expressed; and (c) recovering the protein.

14. A process for preparing a protein of Claim 1, comprising:
(a) transforming a host cell with DNA that encodes a protein comprised of a protein of Claim 1 and a leader sequence;
(b) culturing the transformed host cell such that the protein encoded for in step (a) is expressed;
(c) enzymatically removing the leader sequence of the expressed protein to produce a protein of Claim 1; and (d) recovering the protein of Claim 1.

15. A method of treating obesity or a condition associated with obesity, which comprises administering to a mammal in need thereof a protein of the Formula (I).